U.S. patent application number 12/525020 was filed with the patent office on 2010-12-09 for let-7 microrna and mimetics thereof as therapeutics for cancer.
This patent application is currently assigned to IMMUNE DISEASE INSTITUTE. Invention is credited to Xiaoqu Hu, Judy Lieberman, Erwei Song, Fengyan Yu.
Application Number | 20100310583 12/525020 |
Document ID | / |
Family ID | 39651280 |
Filed Date | 2010-12-09 |
United States Patent
Application |
20100310583 |
Kind Code |
A1 |
Lieberman; Judy ; et
al. |
December 9, 2010 |
LET-7 MICRORNA AND MIMETICS THEREOF AS THERAPEUTICS FOR CANCER
Abstract
The present invention relates to methods to treat or prevent
cancers in a subject, in particular the present invention relates
to a method of treating and/or preventing cancer comprising
targeting cancer stem cells by administering miRNAs which have
reduced expression or are lacking in the cancer stem cells. In some
embodiments, the miRNAs that are reduced or lacking in cancer stem
cells are let-7 miRNAs. In alternative embodiments, the present
invention relates to a method of treating and/or preventing cancer
comprising targeting cancer stem cells by administering miRNAs
which have increased expression levels in the cancer stem cells.
Another aspect of the present invention relates to methods to
enrich for a cancer stem cell population. Another aspect of the
present invention relates to methods to identify miRNAs which
contribute to the self-renewal capacity of cancer stem cells.
Inventors: |
Lieberman; Judy; (Brookline,
MA) ; Song; Erwei; (Guangzhou, CN) ; Yu;
Fengyan; (Guangzhou, CN) ; Hu; Xiaoqu;
(Guangzhou, CN) |
Correspondence
Address: |
DAVID S. RESNICK
NIXON PEABODY LLP, 100 SUMMER STREET
BOSTON
MA
02110-2131
US
|
Assignee: |
IMMUNE DISEASE INSTITUTE
Boston
MA
|
Family ID: |
39651280 |
Appl. No.: |
12/525020 |
Filed: |
January 31, 2008 |
PCT Filed: |
January 31, 2008 |
PCT NO: |
PCT/US08/52654 |
371 Date: |
August 26, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60898610 |
Jan 31, 2007 |
|
|
|
Current U.S.
Class: |
424/174.1 ;
514/19.3; 514/44A; 514/44R; 514/9.7 |
Current CPC
Class: |
A61K 45/06 20130101;
C12N 2310/141 20130101; A61K 31/7105 20130101; C12N 15/113
20130101; C12N 2310/11 20130101; A61P 35/00 20180101; C12N 2310/111
20130101; A61K 47/6807 20170801; A61K 31/7088 20130101 |
Class at
Publication: |
424/174.1 ;
514/44.A; 514/44.R; 514/19.3; 514/9.7 |
International
Class: |
A61K 31/713 20060101
A61K031/713; A61K 31/7088 20060101 A61K031/7088; A61K 38/16
20060101 A61K038/16; A61K 39/395 20060101 A61K039/395; A61K 38/22
20060101 A61K038/22; A61P 35/00 20060101 A61P035/00 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] This invention was made with government support to ES under
Contract No. 30525022 awarded by the National Science Foundation of
China, Contract No. 2005CB724605 awarded by the 973 Program Project
from Ministry of Science and Technology of China.
Claims
1. A method of treating or preventing a cancer in a subject wherein
the cancer comprises a cancer stem cell, the method comprising
administering to the subject a pharmaceutical composition
comprising an effective amount of at least one let-7 miRNA, or an
agent that increases the expression of a let-7 miRNA in a cancer
stem cell, wherein the let-7 miRNA binds to and inhibits an RNA
transcript comprising a let-7 target sequence which is expressed in
a cancer stem cell.
2. The method of claim 1, wherein the let-7 target sequence
comprises SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO:11 or a
homologue thereof.
3.-5. (canceled)
6. The method of claim 1, wherein the let-7 family member is
selected from the group consisting of let-7a, let-7a1, let-7b,
let-7c, let-7d, let-7e and let-7f and homologues thereof that are
effective in gene silencing.
7. (canceled)
8. The method of claim 1, wherein the miRNA is a pri-miRNA,
pre-miRNA, mature miRNA or a fragment or variant thereof effective
in gene silencing.
9. The method of claim 1, wherein the let-7 miRNA comprises SEQ ID
NO:1-8 or a fragment or homologue thereof effective in gene
silencing.
10.-15. (canceled)
16. The method of claim 1, wherein the agent is selected from a
group consisting of; a small molecule, protein, antibody, aptamer,
ribozyme, nucleic acid or nucleic acid analogue.
17. (canceled)
18. (canceled)
19. The method of claim 1, wherein the cancer is selected from at
least one of the group consisting of a pre-cancer, malignant
cancer, therapy resistant cancer, breast cancer.
20.-22. (canceled)
23. The method of claim 1, wherein let-7 miRNA further comprises a
binding moiety and a targeting moiety, wherein the binding moiety
binds let-7 miRNA to the targeting moiety.
24. The method of claim 23, wherein the targeting moiety is a cell
surface receptor ligand or binds to a cell surface antigen present
on a cancer stem cell.
25. The method of claim 24, wherein the cell surface receptor
ligand is selected from a group consisting of CD133, CD44,
mini-MUC; MUC-1; HER2/neu; HER2; mammoglobulin; labyrinthin; SCP-1;
NY-ESO-1; SSX-2; N-terminal blocked soluble cytokeratin; 43 kD
human cancer antigen; human tumor associated antigen (PRAT); human
tumor associated antigen (TUAN); L6 antigen; carcinoembryonic
antigen; CA15-3; oncoprotein 18/stathmin (Op18); human glandular
kallikrein (hK2); NY--BR antigens, tumor protein D52, and
prostate-specific antigen; and EEA, c-kit, ABC7, SCA1, CD24-, lin-,
Oct4+ or combinations thereof.
26. The method of claim 23, wherein the targeting moiety is
selected from the group consisting of an antibody, a single chain
antibody, a Fab portion of an antibody or a (Fab')2 segment.
27. The method of claim 26, wherein the antibody is an antibody to
a cell surface antigen on a cancer stem cell.
28. (canceled)
29. The method of claim 23, wherein the binding moiety is a protein
or a nucleic acid binding domain of a protein, and the binding
moiety is fused to the carboxyl terminus of the targeting
moiety.
30. The method of claim 23, wherein the binding moiety is the
protein protamine or nucleic acid binding fragment of
protamine.
31. The method of claim 1, further comprising administering to the
subject one or more additional cancer therapies selected from the
group consisting of surgery, chemotherapy, radiotherapy,
thermotherapy, immunotherapy, hormone therapy and laser
therapy.
32.-42. (canceled)
43. The method of claim 1, wherein the subject is a mammal or a
human.
44.-99. (canceled)
100. A pharmaceutical composition comprising a let-7 miRNA, a
binding moiety, a targeting moiety and a pharmaceutically
acceptable carrier, wherein the let-7 miRNA binds to and inhibits
an RNA transcript comprising a let-7 target sequence and wherein
binding moiety binds to the let-7 miRNA and the targeting moiety,
and wherein the targeting moiety targets a cancer stem cell.
101. A pharmaceutical composition comprising an agent which
increases the expression of let-7 miRNA in a cancer stem cell, and
a pharmaceutically acceptable carrier, wherein the let-7 miRNA
binds to and inhibits an RNA transcript comprising a let-7 target
sequence.
102. The pharmaceutical composition of claim 100, wherein the let-7
target sequence comprises SEQ ID NO:9 or SEQ ID NO: 10 or SEQ ID
NO:11 or a homologue thereof effective in gene silencing.
103.-107. (canceled)
108. The pharmaceutical composition of claim 101, wherein the agent
is selected from the group comprising a small molecule, nucleic
acid, nucleic acid analogue, aptamer, ribosome, peptide, protein,
antibody, or variants and fragments thereof.
109. (canceled)
110. The pharmaceutical composition of claim 100 for the treatment
or prevention of cancer in a subject, or a human subject.
111. The pharmaceutical composition of claim 110, wherein the
cancer is breast cancer.
112. (canceled)
Description
CROSS REFERENCED APPLICATIONS
[0001] This Application claims benefit under 35 U.S.C. .sctn.119(e)
of U.S. Provisional Application Ser. No. 60/898,610 filed Jan. 31,
2007, the contents of which is incorporated herein in its entirety
by reference.
BACKGROUND OF THE INVENTION
[0003] Accumulating evidence suggests that many cancers are
maintained in a hierarchical organization of rare, slowly dividing
tumor-initiating cells, rapidly dividing amplifying cells
(precursor cells) and differentiated tumor cells.sup.1,2.
Tumor-initiating (also termed cancer stem) cells have been
identified in hematologic.sup.3-5, brain.sup.6-8, breast.sup.9,10
prostate.sup.11 and colon cancers.sup.12. Stem cells, which are
self-renewing and can differentiate into heterogeneous cell
populations, are highly tumorigenic.sup.1,2. Tumor-initiating cells
are thought not only to be the source of the tumor, but can also to
be responsible for tumor progression.sup.13, metastasis.sup.14,15,
resistance to cancer therapy and subsequent tumor
recurrence.sup.16,17.
[0004] Although there is a growing consensus that cancer stem cells
are important in generating tumors and for resistance to therapy
and metastasis, a major obstacle to their study is getting enough
cells because of their very low frequency in tumors.sup.9,10,12,37.
Therefore, there is much need in the art for an efficient method
for enriching for these cancer stem cells.
[0005] In some organisms, miRNAs are known to play a role in
maintaining stemness of embryonic stem (ES) cells, because ES cells
deficient in miRNA processing genes cannot be maintained.sup.20.
Previous studies have shown an overall reduction in miRNA
expression in embryonic or tissue stem cells.sup.21 and changes in
specific miRNAs have been associated with self-renewal and
differentiation of ES cells.sup.20,22. Moreover, miRNA expression
profiling has been shown to be useful for characterizing the stage,
subtype and prognosis of some cancers.sup.18,23,24
[0006] Based on the importance of cancers stem cells believed to be
not only to be the source of the tumor, but also to be responsible
for tumor progression.sup.13, metastasis.sup.14,15, resistance to
cancer therapy and subsequent tumor recurrence.sup.16,17, a method
for reliably determining if a subject has a cancer stem cell is
needed in the art. In addition, a method for reducing the
occurrence of cancer stem cells and a method of treating cancer
stem cells in patients are also highly desirable.
SUMMARY OF THE INVENTION
[0007] The present invention relates to methods to treat or prevent
cancers in a subject, in particular the present invention relates
to a method of treating and/or preventing cancer comprising
targeting cancer stem cells by administering miRNAs which have
reduced expression or are lacking in the cancer stem cells. In some
embodiments, the miRNAs that are reduced or lacking in cancer stem
cells are let-7 miRNAs. Conversely, in alternative embodiments, the
present invention relates to a method of treating and/or preventing
cancer comprising targeting cancer stem cells by administering
agents which inhibit the expression of miRNAs, which have increased
expression levels in the cancer stem cells. Another aspect of the
present invention relates to methods to enrich for a cancer stem
cell population. Another aspect of the present invention relates to
methods to identify miRNAs which contribute to the self-renewal
capacity of cancer stem cells.
[0008] One aspect of the present invention relates to a method of
treating or preventing a cancer in a subject which comprises
administering to the subject a pharmaceutical composition
comprising an effective amount of at least one let-7 miRNA, or an
agent that increases the expression of a let-7 miRNA, wherein the
let-7 miRNA binds to and inhibits an RNA transcript comprising a
let-7 target sequence which is expressed in a cancer stem cell. In
some embodiments, the let-7 target sequence comprises SEQ ID NO:9
or a homologue thereof. For example, the let-7 target sequence that
is a homologue of SEQ ID NO:9 can comprise SEQ ID NO: 10 or SEQ ID
NO:11.
[0009] In some embodiments, the method comprises administering a
pharmaceutical composition comprising let-7 miRNA, where let-7
miRNA is encoded by a let-7-encoding nucleic acid construct. As a
non-limiting example, the let-7 miRNA can be a member of the let-7
family of miRNAs, such as, but not limited to let-7a, let-7b,
let-7c, let-7d, let-7e and let-7f and homologues thereof that are
effective in gene silencing. In some embodiments, the let-7 is
let-7a or let-7a1.
[0010] In some embodiments, a let-7 miRNA can be a pri-miRNA,
pre-miRNA, mature miRNA or a fragment or variant thereof effective
in gene silencing. In some embodiments, the let-7 miRNA comprises
SEQ ID NO:1 or a fragment or homologue thereof effective in gene
silencing. In alternative embodiments, let-7 miRNA homologues can
be used, for example the let-7 miRNA from the let-7 miRNA family
including, but not limited to, let-7 miRNA comprising SEQ ID
NOS:2-6 or a fragment or homologue thereof effective in gene
silencing. In some embodiments, a let-7 miRNA useful in the methods
disclosed herein is a pre-miRNA of SEQ ID NO:7 or a fragment or
homologue thereof effective in gene silencing. In some embodiments,
a let-7 miRNA is a let-7a-1 stem-loop. In alternative embodiments,
the let-7 miRNA is let-7a-1 of SEQ ID NO:8 or a fragment or
homologue thereof effective in gene silencing. In other
embodiments, the let-7 miRNA is an RNA interference-inducing (RNAi)
molecule including, but not limited to, a siRNA, dsRNA, stRNA,
shRNA and gene silencing variants thereof. In alternative
embodiments the let-7 miRNA is an agent which binds and inhibits an
RNA transcript comprising a let-7 target sequence. Examples of such
agents include, but are not limited to a small molecule, protein,
antibody, aptamer, ribozyme, nucleic acid or nucleic acid
analogue.
[0011] In some embodiments, the methods as disclosed herein are
useful for the treatment or prevention of a cancer, for example
where a cancer is characterized by the reduction or loss of a let-7
miRNA. In some embodiments the cancer comprises a cancer stem cell.
In some embodiments, the cancer is a pre-cancer, and/or a malignant
cancer and/or a therapy resistant cancer. In some embodiments, the
cancer is a breast cancer.
[0012] In some embodiments, the let-7 miRNA or let-7 agent can
further comprise a binding moiety and a targeting moiety, and in
some embodiments the binding moiety binds let-7 miRNA to the
targeting moiety. In some embodiments, a targeting moiety is a cell
surface receptor ligand or antigen-binding fragment thereof, for
example a cell surface receptor ligand including, but not limited
to, CD133, CD44, mini-MUC; MUC-1; HER2/neu; HER2; mammoglobulin;
labyrinthin; SCP-1; NY-ESO-1; SSX-2; N-terminal blocked soluble
cytokeratin; 43 kD human cancer antigen; human tumor associated
antigen (PRAT); human tumor associated antigen (TUAN); L6 antigen;
carcinoembryonic antigen; CA15-3; oncoprotein 18/stathmin (Op18);
human glandular kallikrein (hK2); NY--BR antigens, tumor protein
D52, and prostate-specific antigen; and EEA, c-kit, ABC7, SCA1 or
combinations or antigen binding fragments thereof.
[0013] In some embodiments, a targeting moiety useful in the
methods as disclosed herein is an antibody, for example an antibody
including not just complete or full length antibodies, but also
antibody derivatives, such as a single chain antibody, a Fab
portion of an antibody or a (Fab').sub.2 segment, which binds to a
cell surface antigen present on a cancer cell. In some embodiments,
a binding moiety useful in the methods as disclosed herein is a
protein or a nucleic acid binding domain of a protein, and in some
embodiments the binding moiety is fused to the carboxyl terminus of
the targeting moiety, and in some embodiments, the binding moiety
is the protein protamine or nucleic acid binding fragment of
protamine.
[0014] In some embodiments, the methods as disclosed herein further
comprise administering to the subject at least one or more
additional cancer therapies, such as surgery, chemotherapy,
radiotherapy, thermotherapy, immunotherapy, hormone therapy and
laser therapy.
[0015] In some embodiments, the let-7 miRNA is administered to a
subject more than once, and can be administered before, after or at
the same time as an additional cancer therapy or agent.
[0016] In some embodiments, the let-7 miRNA is encoded by a nucleic
acid in a vector, for example, a plasmid, cosmid, phagemid, or
virus or variants thereof, and in some embodiments the let-7 miRNA
is operatively linked to a promoter. In some embodiments, the
vector further comprises one or more in vivo expression elements
for expression in human cells, such as a promoter or enhancer and
combinations thereof.
[0017] In some embodiments, administration of the let-7 miRNA or
let-7 agents can be intravenous, intradermal, intramuscular,
intraarterial, intralesional, percutaneous, subcutaneous, or by
aerosol administration, or combinations thereof. In some
embodiments, administration is prophylactic administration, and in
alternative embodiments, administration is therapeutic
administration.
[0018] In some embodiments, the methods and composions as disclosed
herein can be adminisistered to a subject, where the subject is,
for example, a mammal such as a human. In some embodiments, the
subject has previously undergone at least one or more cancer
therapies including, but not limited to, surgery, chemotherapy,
radiotherapy, thermotherapy, immunotherapy, hormone therapy and
laser therapy.
[0019] Another aspect of the present invention relatest to a method
of treating or preventing a cancer in a subject, the methods
comprising administering to the subject an effective amount of at
least one agent that inhibits one or more genes and/or a product of
such gene expression, wherein the RNA transcript of (i.e.
transcribed from) the gene comprises a let-7 target sequence, and
the gene is gene silenced by let-7 miRNA in non cancer cells.
[0020] In some embodiments, the let-7 target sequence comprises SEQ
ID NO:9 or a homologue thereof effective in gene silencing. For
example, the let-7 target sequence can comprise SEQ ID NO:10 or SEQ
ID NO:11 or a homologue thereof effective in directing gene
silencing.
[0021] In some embodiments, the genes which comprise a let-7 target
sequence in their RNA transcript include, but are not limited to,
RAS, lin-42, KRAS, GRB2, hbl-1, daf-12, pha-4 or human homologues
thereof.
[0022] In some embodiments, an agent as disclosed herein can be,
for example a small molecule, nucleic acid, nucleic acid analogue,
aptamer, ribozyme, peptide, protein, antibody, or variants and
fragments thereof. In some embodiments, a nucleic acid agent can be
DNA, RNA, nucleic acid analogue, peptide nucleic acid (PNA),
pseudo-complementary PNA (pcPNA), locked nucleic acid (LNA) or
analogue thereof, and in embodiments where the nucleic acid agent
is RNA, the RNA can be a small inhibitory RNA (RNAi), siRNA,
microRNA, shRNA, miRNA and analogues and homologues and variants
thereof effective in gene silencing.
[0023] In some embodiments, a let-7 miRNA or agent can be
administered to a subject via a variety of different routes, for
example intravenous, intradermal, intramuscular, intraarterial,
intralesional, percutaneous, subcutaneous, or by aerosol
administration. In some embodiments, administration is prophylactic
administration and in alternative embodiments, administration is
therapeutic administration. In some embodiments, the methods and
compositions as disclosed herein can be adminisistered to a
subject, where the subject is, for example, a mammal such as a
human. In some embodiments, the subject has previously undergone at
least one or more cancer therapies, scuh as, but not limited to
surgery, chemotherapy, radiotherapy, thermotherapy, immunotherapy,
hormone therapy and laser therapy.
[0024] Another aspect of the present invention relates to a method
to determine if a subject is at risk of having a metastasis or
malignant cancer, the method comprising assessing the presence of a
let-7 miRNA in a test biological sample obtained from the subject,
wherein if the level of a let-7 miRNA in the test biological sample
is reduced relative to the level of the let-7 miRNA in a reference
sample, the subject is at risk of having a metastasis or a
malignant cancer. In some embodiments, if the subject is identified
as having a risk of metastasis or a malignant cancer, the method
further comprises administering to the subject an effective amount
of a pharmaceutical composition comprising at least one let-7
miRNA, or an agent that increases the expression of a let-7 miRNA
according to claim 1.
[0025] In some embodiments, biological sample as disclosed herein
is a tissue samples, such as a tumor tissue sample or a cancer cell
or tumor cell, for example a biopsy tissue sample obtained from the
subject, such as a biopsy tissue sample is from a cancer. In some
embodiments, the biopsy sample is from breast cancer.
[0026] In some embodiments, let-7 miRNA levels can be determined by
any methods known by persons of ordinary skill in the art. For
example, let-7 miRNA levels can be determined using a nucleic acid
probe in, for example, Northern blot analysis, PCR, RT-PCR or
quantitative RT-PCR. Examples of a nucleic acid probe useful in the
methods as disclosed herein include a nucleic acid probe
corresponding to SEQ ID NO:12 or SEQ ID NO:13 or SEQ ID NO:14 or a
nucleic acid probe which specifically hybridizes to SEQ ID NO: 13
or SEQ ID NO:14, where such nucleic acid probes can be used in
Northern blot analysis, PCR, RT-PCR, quantitative RT-PCR and other
methods to determine expression levels of nucleic acids in a
biological sample.
[0027] Another aspect of the present invention relates to a method
to enrich for cancer stem cells, the method comprising; (i)
transplanting a plurality of cancer cells into a mammal, wherein
the mammal is administered a low dose cancer therapy, and allowing
a sufficient period of time for the cancer cells to form a tumor,
(ii) removing the tumor from the mammal and dissociating the tumor
into single cells, (iii) transplanting a plurality of the single
cells into a mammal, wherein the mammal is administered a low dose
cancer therapy, and allowing a sufficient period of time for the
cancer cells to form a tumor, (iv) repeating steps (iii) and (iv) a
plurality of times, for example, at least 2 times and in some
instances at least 3, 4, 5 or more times, (v) removing the tumor
from the mammal and dissociating the tumor into single cells, and
(vi) culturing the cells as single-cells for sufficient time to
form an embryoid body, wherein the embryoid body comprise a
population of cells enriched in cancer stem cells.
[0028] In some embodiments of methods to enrich for cancer stem
cell, the embryoid body is a mammosphere. In some embodiments, a
cancer cell that is transplanted into a mammal is a primary cancer
cell or a cancer cell line, such as a genetically modified primary
cancer cell or cancer cell line. In some embodiments, a cancer cell
is from a biological sample, such as a biopsy tissue, for example a
cancer biopsy tissue sample.
[0029] In alternative embodiments where the cancer cell is of a
cancer cell line, the cancer cell line can be derived from a tumor
or cancer including, but not limited to, breast cancer, lung
cancer, head and neck cancer, bladder cancer, stomach cancer,
cancer of the nervous system, bone cancer, bone marrow cancer,
brain cancer, colon cancer, esophageal cancer, endometrial cancer,
gastrointestinal cancer, genital-urinary cancer, stomach cancer,
lymphomas, melanoma, glioma, bladder cancer, pancreatic cancer, gum
cancer, kidney cancer, retinal cancer, liver cancer, nasopharynx
cancer, ovarian cancer, oral cancers, bladder cancer, hematological
neoplasms, follicular lymphoma, cervical cancer, multiple myeloma,
osteosarcomas, thyroid cancer, prostate cancer, colon cancer,
prostate cancer, skin cancer, stomach cancer, testis cancer, tongue
cancer, or uterine cancer. In some embodiments, the cancer cell
line is a breast cancer cell line.
[0030] In some embodiments, cancer cells are transplanted into a
mammal which can be any mammal, such as a monkey, rodent or
genetically modified rodent. In some embodiments, the mammal is an
immunocompromised mammal, for example, a NOD/SCID mouse.
[0031] In some embodiments of methods to enrich for cancer stem
cells, a cancer therapy can be for example, chemotherapy,
radiotherapy, thermotherapy, immunotherapy, hormone therapy and
laser therapy. An example of chemotherapy is the chemotherapy agent
Epirubicin.
[0032] In some embodiments of methods to enrich for cancer stem
cells, administration of the low-dose cancer therapy can be
continuous administration or in alternative embodiments,
non-continuous administration, for example twice a day, once a day,
every other day, twice a week, once a week, every other week or
once a month. In some embodiments, administration can be by any
route known by persons of ordinary skill in the art, such as
intravenous, intradermal, intramuscular, intraarterial,
intralesional, percutaneous, subcutaneous, intraperitoneal, or
aerosol administration. In some embodiments, the time to culture
the cells to enable them to form an embryoid body is a sufficient
period of time is a period of time to allow the tumors to reach at
least about 2 cm in diameter. In some embodiments, transplanting
the cells relates to transplanting the cells into the mammary fat
pad of a female rodent.
[0033] Another aspect of the present invention relates to methods
to identify miRNAs that contribute to the self-renewal capacity of
cancer stem cells, the method comprising obtaining cancer stem
cells, for example by the methods as disclosed herein, and
analyzing the expression of a plurality of miRNAs from said cancer
stem cells, and comparing the expression profile of miRNAs of said
cancer stem cells with the miRNA expression profile from a
reference sample, wherein an increased or reduced level of
expression of an miRNA in the cancer stem cells as compared to the
level of miRNA in the reference sample identifies an miRNA that
contributes to the self-renewal capacity of the cancer stem cells.
In some embodiments, a reference sample useful in the methods as
disclosed herein is a non-stem cell cancer cell, or a
differentiated cancer stem cell.
[0034] Any means to analyze a miRNA expression profile known by
persons of ordinary skill in the art can be used in the methods as
disclosed herein, for example by microarray assay.
[0035] In some embodiments of the methods as disclosed herein, the
methods can further comprise assessing the miRNA that contributes
to the self-renewal capacity, the method comprising introducing
into the cancer stem cell the miRNA if the miRNA is identified to
be expressed at a lower level in a cancer stem cell as compared to
the reference sample, and assessing the ability of the cancer stem
cell to from a embryoid body, wherein a reduced ability to from a
embryoid body indicates that the miRNA contributes to a cancer stem
cell's self-renewal capacity. In alternative embodiments, the
methods can further comprise assessing the miRNA that contributes
to the self-renewal capacity, the method comprising inhibiting the
expression of an miRNA in the cancer stem cell if the miRNA is
identified to be expressed at a higher level in the cancer stem
cell as compared to the reference sample, and assessing the ability
of the cancer stem cell to from an embryoid body, wherein a reduced
ability to from an embryoid body identified an miRNA that
contributes to cancer stem cell self-renewal capacity.
[0036] Another aspect of the present invention relates to a
pharmaceutical composition comprising a let-7 miRNA and a
pharmaceutically acceptable carrier, wherein the let-7 miRNA binds
to and inhibits an RNA transcript comprising a let-7 target
sequence.
[0037] Another aspect of the present invention relates to a
pharmaceutical composition comprising an agent which increases the
expression of a let-7 miRNA and a pharmaceutically acceptable
carrier, wherein the let-7 miRNA binds to and inhibits an RNA
transcript comprising a let-7 target sequence.
[0038] Another aspect of the present invention relates to a
pharmaceutical composition comprising an agent which decreases the
expression of at least one of miR-129, miR-140, miR-184 or miR-198
and a pharmaceutically acceptable carrier.
[0039] In some embodiments, a pharmaceutical composition as
disclosed herein comprises a let-7 miRNA or an agent which
increases a let-7 miRNA, and the let-7 target sequence comprises
SEQ ID NO:9 or a homologue thereof effective in gene silencing,
such as a let-7 target sequence comprising SEQ ID NO: 10 or SEQ ID
NO:11.
[0040] In some embodiments, the pharmaceutical compositions as
disclosed herein are useful of for the treatment or prevention of
cancer in a subject, for example, for the treatment or prevention
of breast cancer. In some embodiments, the subject is a mammal,
such as a human subject.
[0041] In some embodiments where a pharmaceutical composition
comprises an agent, the agent can be, for example, a small
molecule, nucleic acid, nucleic acid analogue, aptamer, ribozyme,
peptide, protein, antibody, or variants and fragments thereof. In
some embodiments where the agent is a nucleic acid, the nucleic
acid can be for example, DNA, RNA, nucleic acid analogue, peptide
nucleic acid (PNA), pseudo-complementary PNA (pcPNA), locked
nucleic acid (LNA) or analogue thereof.
BRIEF DESCRIPTION OF DRAWINGS
[0042] FIGS. 1A-1G show that breast cancer cells under pressure of
chemotherapy are enriched for breast tumor-initiating cells. FIG.
1A shows that primary breast cancer cells isolated from surgical
specimens from patients who received preoperative neoadjuvant
chemotherapy are substantially enriched for self-renewing cells
with the properties of cancer stem cells, compared to untreated
patients. Representative images show increased numbers and size of
mammospheres after 15 d of culture, and FIG. 1B shows a higher
percentage of CD44.sup.+CD24.sup.- cells in freshly isolated tumor
cells from patients who received chemotherapy. Similarly, FIGS.
1C-1G show that passaging the human breast cancer cell line SKBR3
in Epirubucin-treated immunodeficient mice enriches for
tumor-initiating cells. SK-3rd cells dissociated from the 3.sup.rd
passage xenograft are self-renewing. They have enhanced ability,
compared to the parental line, to form mammospheres, and the
mammospheres can be repetitively passaged in vitro and are larger.
FIG. 1C shows numbers of primary, secondary (generated from
dissociated primary mammospheres) and tertiary (generated from
dissociated secondary mammospheres) mammospheres on day 15 from
1000 cells. *, P<0.001 compared with SKBR3. FIG. 1D shows
mammospheres generated from single-cell cultures of SK-3rd and
SKBR3, imaged on indicated days of suspension culture. Shown are
the mean.+-.SD number of cells/sphere for each timepoint. *,
P<0.001 compared with SKBR3. FIGS. 1F and 1G show that when
SK-3rd cells have the phenotype of breast tumor-initiating cells;
they are CD44.sup.+CD24.sup.-Oct4.sup.+. FIG. 1E (left) shows when
SK-3rd mammospheres are dissociated, and removed from growth
factors and plated on collagen, they adhere and differentiate (FIG.
1E, right) and assume the parental SBKR3 phenotype (Oct-4
immunoblot, as shown in FIG. 1F). FIG. 1G shows that SK-3rd and
SKBR3 cells cultured as spheres are CD44.sup.+CD24.sup.-. When they
differentiate in adherent cultures, they gradually assume the
parental SBKR3 phenotype, but somewhat more rapidly for SKBR3
mammospheres.
[0043] FIGS. 2A-2G show that SK-3rd cells and primary breast cancer
cells from chemotherapy-treated patients have low expression of
let-7 family miRNAs. FIG. 2A shows miRNA array analysis, which
shows that miRNAs are differentially expressed in SK-3rd cells
cultured in mammospheres (1) or adhered for 8 hr (2), 24 hr (3), or
10 days (4) and parent SKBR3 (5). Most miRNAs, including all let-7
homologs or let-7 family members, are reduced in SK-3rd cultured in
mammospheres or just adhered for 8 hr, and increase during
differentiation to similar levels as SKBR3. FIG. 2B shows the
microarray results for let-7 were verified by Northern blot using a
nonspecific let-7 probe, and FIG. 2C shows verification by qRT-PCR
amplified for let-7a (mean.+-.SD relative to U6). FIG. 1D shows
that infection of SK-3rd with lentivirus expressing pre-let-7a
(lend-let-7) vs. empty vector increased let-7 expression to levels
comparable to differentiated SK-3rd. let-7 function, assayed by
luciferase assay in cells transfected with a reporter gene
containing a let-7 target site in its 3'-UTR, is negligible in
SK-3rd cells but increases upon differentiation or by infection
with lend-let-7 (*, P<0.001 compared with SK-3rd). Transfection
with let-7 ASO reduces endogenous or exogenous let-7 activity (#,
P<0.01 compared to cells not transfected with let-7 ASO). FIG.
2E shows that H-RAS, a target of let-7, is highly expressed in
SK-3rd, but not in the differentiated adherent cell line or SKBR3
(protein assayed by immunoblot relative to .alpha.-actin). FIGS. 2F
and 2G shows that infection with lend-let-7 or lentivirus encoding
RAS-shRNA, but not GFP-shRNA or empty vector, suppresses H-RAS
expression in SK-3rd cells, while transfection of SKBR3 with let-7
ASO augments H-RAS protein. FIG. 2F shows let-7 is also reduced in
primary mammospheres from isolated tumor cells from patients who
received neoadjuvant chemotherapy, compared to patients who did
not. FIG. 2F shows a northern blot of representative samples probed
for let-7 family miRNAs and FIG. 2G shows qRT-PCR results for 5
chemotherapy-treated patients and 6 untreated patients amplified
for let-7a (mean.+-.SD relative to U6). In FIG. 2F, samples are
mammospheric (lane 1) and adherent differentiated cell (lane 2) RNA
from representative chemotherapy patient, compared with RNA
extracted from a patient who did not receive chemotherapy (lane
3).
[0044] FIGS. 3A-3F shows that SK-3rd cells engineered to express
let-7a lose "stemness". FIG. 3A shows that single cell cultures of
dissociated SK-3rd cells, infected with lend-let-7 or lentivirus
expressing RAS-shRNA, but not GFP-shRNA or empty vector, form fewer
mammospheres, and FIG. 3B shows that mammospheres that do form
develop more slowly and are reduced in cell number (*, P<0.0001;
compared to untransduced cells). Conversely, FIG. 3C shows that
SKBR3 cells transfected with let-7a ASO, but not control lin-4 ASO,
generate 10-fold more mammospheres. FIG. 3D shows that let-7
expression, assayed by qRT-PCR relative to U6, increases during in
vitro differentiation of SK-3rd. FIG. 3E shows that SK-3rd cells
infected with lend-let-7, and to a lesser extent lentivirus
expressing RAS-shRNA, proliferate less during in vitro
differentiation than untransduced or control transduced cells as
measured by [.sup.3H]-incorporation *, P<0.01; #, P<0.05
compared with untransduced SK-3rd. FIG. 3F shows that after 10 d of
in vitro differentiation, SK-3rd cells over-expressing let-7a, but
not RAS-shRNA, have half as many undifferentiated cells lacking
expression of the cytokeratins CK14 or CK18.
[0045] FIGS. 4A-4D shows that expression of pre-let-7a by SK-3rd
cells suppresses tumor xenograft growth in NOD/SCID mice. FIG. 4A
shows tumor volume which was measured after subcutaneous mammary
fat pad inoculation of 2.times.10.sup.3 (top), 2.times.10.sup.4
(middle) or 2.times.10.sup.5 (bottom) SKBR3 cells or SK-3rd cells
that were untransduced or transduced with empty vector or to
express let-7. The number in the figure legend indicates the number
of mice who developed tumors. 10 mice were in each group.
Over-expression of let-7a led to fewer tumors and the tumors that
arose grew more slowly. FIG. 4B shows tumors that grew in mice
inoculated with 2.times.10.sup.5 cells had similar histology by
hematoxylin and eosin staining (HE, magnification 200.times.), but
the SK-3rd tumors, either untransduced or transduced with empty
vector, had higher expression of H-RAS (400.times., and shown in
FIG. 4C) and a higher proliferative index assessed by PCNA staining
(400.times., shown in FIG. 4D), than the parental SKBR3 cells or
SK-3rd cells transduced with lend-let-7.
[0046] FIGS. 5A-5C show that SK-3rd cells transduced with
pre-let-7a are less likely to metastasize. FIG. 5A shows
Hematoxylin and eosin staining of the lung (.times.200) and liver
(.times.400) of mice implanted subcutaneously with 2.times.10.sup.5
SK-3rd cells (either untransduced or transduced with lentivirus
vector or lend-let-7) or SKBR3. Arrows indicate focal metastasis.
FIG. 5B shows mean.+-.SD wet lung weight in mice bearing tumor
xenografts (n=10/group). FIG. 5C shows the expression of human HPRT
mRNA relative to mouse GAPDH, by qRT-PCR. The numbers indicate the
number of animals in each group of 10 with lung or liver
metastasis. N.D., not detected
[0047] FIG. 6 shows that SK-3rd cells in single cell suspension
cultures have enhanced capability to form mammospheres. Nonadherent
mammospheres generated from single-cell suspension cultures of
SK-3rd and SKBR3 cells were counted for 20 d of culture. *,
P<0.001 SK-3rd compared with SKBR3 cells at the same time
point.
[0048] FIGS. 7A-7D shows sequences of let-7 miRNA. FIG. 7A shows
the nucleic acid sequences of isoforms or homologues of let-7,
let-7a (SEQ ID NO:1); let-7b (SEQ ID NO:2); hsa-let-7c (SEQ ID
NO:3); hsa-let-7d (SEQ ID NO:4); hsa-let-7e (SEQ ID NO:5);
hsa-let-7f (SEQ ID NO:6). FIG. 7B shows the nucleic acid sequence
of let-7 miRNA (SEQ ID NO:7). FIG. 7C shows the nucleic acid
sequence homo sapiens let-7a1 stem loop (SEQ ID NO: 8). FIG. 7D
shows the nucleic acid sequence of the let-7 target sequence
(5'-AACTATACAACCTACTACCTCA-3'; SEQ ID NO: 9) and 2 let-7 target
sequences (SEQ ID NO:10 and SEQ ID NO:11) inserted into the
reporter vector.
[0049] FIGS. 8A-C show that breast cancer cells under pressure of
chemotherapy are enriched for tumor initiating breast cancer cells
(BT-IC). FIG. 8A shows that the majority of freshly isolated SK-3rd
cells are CD44+CD24-, as expected for BT-IC, while cells with this
phenotype are rare in SKBR3 (representative data of five
experiments shown). FIG. 8B shows that when SK-3rd spheres are
dissociated, removed from growth factors, and plated on collagen
for 8 hr (top), they do not express luminal (Muc1 and CK-18) or
myoepithelial (CK-14 and .alpha.-SMA) differentiation markers,
while after further differentiation (bottom), they develop into
elongated cells with subpopulations staining for either
differentiated subtype. FIG. 8C shows that freshly isolated SK-3rd
cells are enriched for Hoechst low SP cells compared with SKBR3
cells.
[0050] FIGS. 9A-9F show that let-7 miRNA is reduced in mamospheric
SK-3.sup.rd cells in primary tumor initiating breast cancer cells
(BT-IC). FIG. 9A shows Northern Blot probed for let-7m and FIG. 9B
shows results from qRT-PCR amplified for let-9a (mean.+-.SD
relative to U6) to verify the microarray results. Spheres derived
from either SK-3rd or SKBR3 show similar low expression of let-7
that increases gradually beginning 1 days following induction of
differentiation and plateaus within 6 days. #, p<0.01; *,
p<0.001 as compared with cells cultured in spheres. Error bars
correspond to mean.+-.SD. FIG. 9C shows HMGA2, a target of let-7,
is highly expressed in mammospheric SK-3rd but not in
differentiated adherent SK-3rd or SKBR3 (protein assayed by
immunoblot relative to b-actin). Infection with lenti-let-7 or
lentivirus encoding RAS- or HMGA2-shRNA, but not GFP shRNA or
vector, suppresses HMGA2 expression, respectively, in mammospheric
SK-3rd cells, while transfection of SKBR3 with let-7 ASO augments
HMGA2 protein. In addition, FIGS. 9D-F show tumors from eight
untreated patients and five patients treated with neoadjuvant
chemotherapy were enriched for BT-IC by sorting for
lin.sup.-CD44.sup.+CD24.sup.- cells or by growth as mammospheres.
Tumors depleted of BT-IC by adherent growth or by excluding
CD44.sup.+CD24.sup.- cells also have reduced let-7 compared to
adjacent normal breast tissue. FIG. 9D shows FACS analysis and FIG.
9E shows Northern blots probed for let-7 and U6 for representative
untreated (#7), and neoadjuvant chemotherapy treated (#5) patients.
FIG. 9F shows mean.+-.SD of relative let-7 expression for all
samples analyzed by qRT-PCR. Infection with lenti-let-7 increases
let-7 in BT-IC-enriched primary cells. #, p<0.05; *, p<0.01
compared with samples depleted of CD44.sup.+CD24.sup.- cells.
[0051] FIG. 10A-10D show that silencing HMGA2 reduces the
undifferentiated subpopulation and proliferation of SK-3rd cells
but does not significantly alter mammosphere formation. FIG. 10A
shows that BT-IC-enriched cells, sorted for
lin.sup.-CD44.sup.+CD24.sup.-/low phenotype from primary
chemotherapy-naive breast tumors, have a markedly higher capacity
to form mammospheres compared with CD44.sup.+CD24.sup.--depleted
cells. Transduction with lenti-let-7, but not lentivector, reduces
mammosphere generation. *, p<0.001 compared with untransduced
cells. Mammosphere formation by let-7-transduced BT-IC is also
significantly reduced on serial passage but is stable in
untransduced cells. FIG. 10B shows single-cell cultures of
dissociated SK-3.sup.rd cells, infected with lenti-HMGA2-shRNA,
form a comparable number of mammospheres as uninfected cells or
cells infected with lenti-GFP-shRNA or lentivector. Lenti-let-7 was
used as a positive control. *, p<0.01 as compared with
untransduced SK-3rd. FIG. 10C shows that silencing HMGA2 with
lenti-HMGA2-shRNA reduces proliferation of SK-3rd cells on day 4 of
in vitro differentiation in adherent cultures (peak of
proliferation), but not as much as lenti-let-7 transduction. Cell
proliferation was measured by [3H]-incorporation *, p<0.01; #,
p<0.05 compared with untransduced SK-3rd. FIG. 10D shows that
transduction with lenti-HMGA2-shRNA or lenti-let-7, but not with
lenti-GFP-shRNA or vector, similarly reduces the proportion of
lin.sup.- cells in SK-3rd cells cultured in mammospheres. *,
p<0.01 compared with vector transduced cells. Error bars
correspond to mean.+-.SD.
DESCRIPTION OF THE INVENTION
[0052] In accordance with the present invention, the inventors have
discovered that preoperative chemotherapy in patients enriches for
tumor-initiating cells, herein referred to as "cancer stem cells".
The inventors have also discovered that cancer stem cells lack or
have reduced expression of specific miRNA as compared with normal
tissue and non-stem cell cancer cells. The inventors herein have
discovered cancer stem cells lack or have reduced miRNA expression
of miRNAs including, but not limited to, let-7, miR-107, miR-10a,
miR-128a, miR128b, miR-132, miR-138, miR-16, miR-17, miR-195,
miR-199a, miR-20, miR-200a, miR-200b, miR-200c, miR-20b, miR-22. In
particular, the inventors have discovered that cancer stem cells
have reduced or lack let-7 miRNA expression compared with normal
tissue and non-stem cell cancer cells. Furthermore, the inventors
have discovered that breast cancer stem cells have reduced
expression of let-7 which is not the case in non-stem cell breast
cancer cells, and that reduced expression or lack of let-7 is
required to maintain "stemness" of the cancer stem cells, for
example lack of let-7 enables cancer stem cells to self-renew and
be maintained in an undifferentiated state. The inventors also
discovered that cancer stem cells that lack or have reduced
expression of let-7 as compared to non-stem cell cancers were
highly malignant and were more likely to result in metastasis in
the liver and lung. Thus, the inventors have discovered that cells
having reduced expression or lacking specific miRNAs, for example
but not limited to, cells having reduced expression or lacking
expression of let-7 miRNA identifies a cell as a cancer stem cell
and identifies the cell as contributing to increased tumorigenicity
and cancer metastasis.
[0053] In another aspect of the invention, the inventors discovered
that expression of specific miRNAs is reduced or absent in cancer
stem cells, and that expression of such miRNAs reduces these cancer
stem cells' self-proliferative capacity and converts the cancer
stem cells from highly malignant and metastasizing cancer stem
cells into less malignant cells. For example, the expression of
let-7 in cancer stem cells was discovered to reduce the cells
capacity for self-proliferation and render them less malignant.
Thus, the inventors have discovered that specific miRNA that are
reduced and/or lacking in cancer stem cells act as tumor
suppressors; for example, let-7 acts as a tumor suppressor.
[0054] Another aspect of the invention relates to the inventors
discovery of a novel method to enrich for cancer stem cells using
repeated passaging of cancer cells. The inventors demonstrate a
method for enriching for a population of cancer stem cells by (i)
transplanting cancer cells in an animal model in vivo, and allowing
the cancer cells to grow into a tumor in the presence of low dose
chemotherapy, then harvesting the cancer cells from the tumor and
(ii) re-transplanting the harvested cancer cells into a subsequent
animal model and repeating step (i). The steps (i) and (ii) can be
repeated a number of times, for example at least 2, or at least 3
or at least 4 or up to as many as 10 or more times to enrich for a
population of cancer stem cells that are resistant to at least one
or more different low dose chemotherapy agents.
[0055] Further, the inventors have discovered a method to identify
miRNAs that contribute to cancer stem cells' self-proliferative
capability and "stemness". As disclosed herein, the term "stemness"
is defined below, and typically refers to the self-proliferative
capacity of an immature or non-terminally differentiated cell, for
example, the capacity of a cell to produce a daughter cell, which
themselves can be induced to proliferate and produce progeny that
subsequently differentiate into one or more mature cell types,
while also retaining one or more cells with parental developmental
potential.
[0056] Accordingly, the present invention provides methods to treat
cancers by targeting cancer stem cells, the method comprising
targeting the cancer stem cell with miRNAs or mimetics thereof to
increase the levels of miRNAs which are reduced or lacking in
cancer stem cells as compared to non-stem cell cancer cells. As a
non-limiting example, the present invention provides methods to
treat and prevent cancers by targeting cancer stem cells with let-7
miRNA, and/or a mimetic thereof, to increase levels of let-7 miRNA
in the cancer stem cell. An increase in let-7 miRNA in the cell
will increase let-7 mediated gene silencing in the cancer stem
cell, which will cause a reduction in the self-renewal and
proliferative capacity and/or differentiation capacity of a cancer
stem cell to a less malignant cell. In some embodiments, any form
of let-7 can be used in the methods as disclosed herein, for
example any nucleic acid or any agent which has a minimum
biological activity of binding to and inhibiting the let-7 target
sequence 5'-AACTATACAACCTACTACCTCA-3' (SEQ ID NO: 9). In some
embodiments, one can use let-7a, and in alternative embodiments,
let-7 miRNA can be in the form of any of the following, but not
limited to, let-7 pre-miRNA, let-7 pri-miRNA or mature let-7 miRNA
or homologues, fragments and variants thereof that retain a gene
regulatory biological activity of the mature let-7 miRNA,
especially the ability to down-regulate the expression of a target
gene by miRNA-mediated gene silencing.
[0057] In alternative embodiments, cancers can be treated by
targeting the cancer stem cell with any one or a combination of the
following miRNAs and mimetics thereof: miR-107; miR-10a; miR-128a;
miR128b; miR-132; miR-138; miR-16; miR-17; miR-195; miR-199a;
miR-20; miR-200a; miR-200b; miR-200c; miR-20b and miR-22.
[0058] In some embodiments, the invention provides methods to treat
cancers by targeting cancer cells with a plurality of different
miRNA and/or miRNA mimetics to increase the levels of more than one
miRNA that are reduced or lacking in the cancer stem cells compared
with non-stem cell cancer cells.
[0059] Conversely, the inventors have also discovered that cancer
stem cells have increased expression of other specific miRNAs as
compared with normal tissue and non-stem cell cancer cells. For
example, the inventors have discovered that cancer stem cells have
an increased level of expression of at least the following miRNA's:
miRNAs miR-129; miR-140; miR-184; and miR-198. Accordingly, the
present invention also provides methods to treat cancers by
targeting cancer stem cells, the method comprising targeting the
cancer stem cell with agents which inhibit the expression of miRNAs
which are increased or elevated in the cancer stem cells as
compared with non-stem cell cancer cells. As a non-limiting
example, the invention provides methods to treat cancers by
targeting cancer stem cells with an agent that inhibits the
activity and/or expression of miR-198 to reduce levels of miR-198
miRNA in the cancer stem cell. Such an agent can be an inhibitory
nucleic acid molecule, for example but not limited to antisense
nucleic acid molecules and RNA-interference molecules such as
siRNA, etc.
[0060] Therefore in some embodiments, the methods of the present
invention relate to the treatment of cancers by targeting cancer
stem cells, the method comprising upregulating miRNAs that are
reduced or lacking in cancer stem cells. As a non-limiting example,
let-7 miRNAs can be upregulated by providing, pharmaceutical
compositions comprising let-7 miRNA and/or let-7 mimetics to a
cancer stem cell in a therapeutically effective amount for the
treatment of cancer. In such embodiments, the cancer comprises a
cancer stem cell and/or a cell with reduced or lacking let-7
expression.
[0061] In some embodiments, the pharmaceutical composition
comprising miRNA or mimetics thereof, for example let-7 and/or
let-7 mimetics is administered with, at the same time, or
sequential to another agent or therapy, for example a cancer
therapy. Such additional agents include, but are not limited to,
surgery, chemotherapy, radiotherapy, thermotherapy, immunotherapy,
hormone therapy and laser therapy.
[0062] Another aspect of the invention relates to use of let-7
miRNA and/or let-7 mimetics as diagnostics and as therapeutics. In
some embodiments, let-7 miRNAs and/or let-7 mimetics are
administered to a subject in a pharmaceutical composition where the
subject has a cancer stem cell. The administration can be a
treatment and/or prophylaxis for cancer, where the subject has at
least one cancer stem cell. The subject can have, or not have,
symptoms or manifestation of cancer, since cancer stem cells can
exist in the absence of symptoms of cancer. In some embodiments,
the pharmaceutical compositions comprising let-7 miRNA and/or let-7
mimetics are administered to a subject with a cancer stem cell.
[0063] The cancer stem cell can be present in any type of cancer
including, for example breast cancer. In some embodiments, the
cancer is a treatment-resistant cancer, for example, but not
limited to a cancer which is resistant to chemotherapy, such as a
chemotherapy-resistant breast cancer.
[0064] In another aspect of the present invention, methods are
provided to treat cancers by targeting the cancer stem cells, the
method comprising targeting the cancer stem cell with agents that
inhibit genes and/or their gene products (i.e. mRNAs or proteins)
which are normally gene silenced by the miRNAs that are reduced in
the cancer stem cells, for example, genes that are gene silenced by
let-7 miRNA. Such genes that are regulated by miRNA are genes which
comprise miRNA target sequences in their mRNA. For example, genes
silenced by let-7 comprise a let-7 target sequence within their
mRNA. The let-7 target sequence can be in the 5'UTR, 3'UTR or
coding sequence. Examples of such genes that comprise a let-7
target sequence in their mRNA include, but are not limited to, RAS,
HRAS, KRAS, lin-42, GRB2, hbl-1, daf-12 and pha-4, or human
homologues thereof. In some embodiments, agents inhibit the
activity and/or the expression of genes that are gene silenced by
miRNAs that are reduced or lacking on cancer stem cells. As a
non-limiting example, in some embodiments an agent inhibits the
activity and/or expression of genes comprising let-7 target
sequence within their mRNA.
[0065] In some embodiments, the methods of the present intervention
relate to the treatment of cancers by targeting cancer stem cells,
the method comprising administering a pharmaceutical composition
comprising at least one agent that inhibits the activity and/or the
expression of at least one gene that is gene silenced by miRNA that
are reduced or lacking in cancer stem cells. As a non-limiting
example, a pharmaceutical composition comprising at least one agent
that inhibits the activity and/or the expression of at least one
gene that is gene silenced by let-7 and/or comprises a let-7 target
within their mRNA is administered to a cancer stem cell in a
therapeutically effective amount for the treatment of cancer. In
such embodiments, the cancer comprises a cancer stem cell and/or a
cell with reduced or lacking let-7 expression.
[0066] In another aspect of the present invention, methods for
diagnosing whether a subject is at risk of having or has a
metastasis or a malignant cancer are provided. In some embodiments,
the methods comprise assessing the level of let-7 in a biological
sample from the subject, and if the level of let-7 is below a
reference level, the subject is identified as being at risk of
having a metastasis and/or malignant cancer. In some embodiments,
the biological sample is from a cancer biopsy. In some embodiments,
the cancer biopsy is a breast cancer biopsy. In such embodiments,
if the level of let-7 in the biological sample obtained from the
subject is below the reference level, the subject is administered a
pharmaceutical compositions comprising let-7 miRNA and/or a let-7
mimetic.
[0067] In another embodiment, the cancer to be treated is any
cancer that comprises cancer stem cells. In alternative
embodiments, the cancer to be treated is any cancer characterized
by reduced expression and/or lack of let-7 miRNA expression. In
some embodiments, the cancer is breast cancer. In some embodiments,
the cancer is a resistant cancer, for example a multi-drug and/or
chemotherapy-resistant cancer. In some embodiments, the cancer is
lung or colon cancer.
[0068] In some embodiments, the let-7 miRNA are nucleic acids,
include but not limited to let-7 pri miRNA, let-7 pre-miRNA, mature
let-7 miRNA or homologues, fragments or variants thereof that
retain the biological activity of the mature let-7 miRNA.
[0069] In alternative embodiments, mimetics of let-7 miRNA are
useful in the methods of the present invention. A let-7 mimetic is
an entity or agent that functions as a let-7 miRNA, for example, a
nucleic acid or agent which has a minimum biological activity of
binding to and inhibiting expression of a gene comprising the let-7
target sequence 5'-AACTATACAACCTACTACCTCA-3' (SEQ ID NO: 9).
Examples of let-7 mimetics include, but are not limited to, small
molecules, proteins, nucleic acids, ribosomes, aptamers, antibodies
and nucleic acid analogues that mimic let-7 miRNA. Nucleic acid
let-7 mimetics can also include, but are not limited to, RNA
interference-inducing molecules (RNAi), including but not limited
to, siRNA, dsRNA, stRNA, shRNA and modified versions thereof, where
the RNA interference (RNAi) molecule has a minimum biological
activity of binding to and inhibiting the expression of a gene
comprising the let-7 target sequence 5'-AACTATACAACCTACTACCTCA-3'
(SEQ ID NO: 9).
[0070] Effective, safe dosages can be experimentally determined in
model organisms and in human trials by methods well known to one of
ordinary skill in the art. The let-7 miRNA and/or let-7 mimetics in
a pharmaceutical composition can be administered alone or in
combination with adjuvant cancer therapy such as surgery,
chemotherapy, radiotherapy, thermotherapy, immunotherapy, hormone
therapy and laser therapy, to provide a beneficial effect, e.g.
reduce tumor size, reduce cell proliferation of the tumor, inhibit
angiogenesis, inhibit metastasis, or otherwise improve at least one
symptom or manifestation of the disease.
[0071] Another aspect of the invention provides methods for the
enrichment of cancer stem cells. The method relates to sequential
passaging of cancer cells in vivo when exposed to low dose
chemotherapy.
[0072] In another embodiment, the present invention provides
methods to identify miRNAs that contribute to the
self-proliferative capacity and/or tumorogenicity of a cancer stem
cell. In some embodiments, the method comprises comparing the miRNA
expression profile of a cancer stem cell enriched by the methods as
disclosed herein, with the miRNA expression profile of a reference
sample, such as, but not limiting to an expression profile of a
non-stem cancer cell. A change in a miRNA in the cancer stem cell
as compared with a reference sample identifies a miRNA that
contributes, in whole or in part, to the self-proliferative
capacity and/or tumorogenicity of the cancer stem cell. In further
embodiments, the present invention provides methods to assess the
role and level of such contribution of the identified miRNA to the
cancer stem cells self-proliferative capability, the method
comprising either introducing or inhibiting the miRNA in the cancer
stem cell, depending upon whether the miRNA being assessed is
downregulated or upregulated respectively, in the cancer stem cell
as compared with the reference sample.
DEFINITIONS
[0073] For convenience, certain terms employed in the entire
application (including the specification, examples, and appended
claims) are collected here. Unless defined otherwise, all technical
and scientific terms used herein have the same meaning as commonly
understood by one of ordinary skill in the art to which this
invention belongs.
[0074] As used herein, the term "let-7" refers to a nucleic acid or
an agent which has a minimum biological activity of binding to (or
hybridizing to) and inhibiting the expression of a gene comprising
the let-7 target sequence, where the target sequence is
5'-AACTATACAACCTACTACCTCA-3' (SEQ ID NO: 9). A let-7 can be
assessed for its ability to bind to and inhibit the target sequence
SEQ ID NO:9 using the let-7 luciferase assay as disclosed herein in
the Examples, for example by using the pMIR-REPORT.TM. luciferase
reporter vector with a let-7 target sequence (SEQ ID NO: 9) (as
well as SEQ ID NO:10 and SEQ ID NO:11) cloned into its 3'UTR. let-7
can refer to a nucleic acid encoding a let-7 miRNA corresponding to
SEQ ID NO: 1. "let-7" also refers to a nucleic acid encoding a
let-7 miRNA or homologues and variants of SEQ ID NO: 1, including
conservative substitutions, additions, and deletions therein which
do not adversely affect the structure or function, and where such
homologues and variants have the same function or same activity of
let-7 encoded by SEQ ID NO:1 and are capable of binding to and
inhibiting the expression of a gene comprising the let-7 target
sequence 5'-AACTATACAACCTACTACCTCA-3' (SEQ ID NO: 9). Preferably,
let-7 refers to the nucleic acid encoding let-7 from C. elegans
(NCBI Accession No. AY390762), and in some embodiments, let-7
refers to the nucleic acid encoding a let-7 family member from
humans, including but not limited to, NCBI Accession Nos. AJ421724,
AJ421725, AJ421726, AJ421727, AJ421728, AJ421729, AJ421730,
AJ421731, AJ421732, and functional or biologically active sequence
variants of let-7, including alleles, and in vitro generated
derivatives of let-7 that demonstrate let-7 activity. The term
"let-7 family" includes let-7 homologues and isoforms, for example
but not limited to let-7 family members including let-7a (SEQ ID
NO:1); let-7b (SEQ ID NO:2); hsa-let-7c (SEQ ID NO:3); hsa-let-7d
(SEQ ID NO:4); hsa-let-7e (SEQ ID NO:5); hsa-let-7f (SEQ ID
NO:6).
[0075] A let-7 agent as also referred to herein also encompasses a
"let-7 mimetic" and means an agent which binds to and inhibits the
let-7 target sequence 5'-AACTATACAACCTACTACCTCA-3' (SEQ ID NO: 9).
In this context, a let-7 agent can be any agent or RNA
interference-inducing molecule, for example but not limited to
unmodified and modified double stranded (ds) RNA molecules
including, short-temporal RNA (stRNA), small interfering RNA
(siRNA), short-hairpin RNA (shRNA), microRNA (miRNA),
double-stranded RNA (dsRNA). Alternatively, a let-7 agent can be a
small molecule, protein, aptamer, nucleic acid analogue, antibody
etc. that binds to and inhibits the let-7 target sequence SEQ ID
NO:9; Activity of a let-7 agent can be assessed using, for example,
the let-7 luciferase assay as disclosed herein in the Examples
which uses the pMIR-REPORT.TM. luciferase reporter vector with a
let-7 target sequence (SEQ ID NO: 9) cloned into its 3'UTR.
[0076] The terms "same activity" or "same function" as used in
reference to the same activity or function of let-7 means a let-7
molecule which can bind to and inhibit the target sequence SEQ ID
NO:9 with at least 80% of the efficiency, or greater efficiency, as
the wild type let-7 (SEQ ID NO:1), as assessed using, for example,
the let-7 luciferase assay as disclosed herein in the Examples.
[0077] The terms "microRNA" or "miRNA" used interchangeably herein,
are endogenous RNAs, some of which are known to regulate the
expression of protein-coding genes at the posttranscriptional
level. As used herein, the term "microRNA" refers to any type of
micro-interfering RNA, including but not limited to, endogenous
microRNA and artificial microRNA. Typically, endogenous microRNA
are small RNAs encoded in the genome which are capable of
modulating the productive utilization of mRNA. A mature miRNA is a
single-stranded RNA molecule of about 21-23 nucleotides in length
which is complementary to a target sequence, and hybridizes to the
target RNA sequence to inhibit expression of a gene which encodes a
miRNA target sequence. miRNAs themselves are encoded by genes that
are transcribed from DNA but not translated into protein
(non-coding RNA); instead they are processed from primary
transcripts known as pri-miRNA to short stem-loop structures called
pre-miRNA and finally to functional miRNA. Mature miRNA molecules
are partially complementary to one or more messenger RNA (mRNA)
molecules, and their main function is to downregulate gene
expression. MicroRNA sequences have been described in publications
such as, Lim, et al., Genes & Development, 17, p. 991-1008
(2003), Lim et al Science 299, 1540 (2003), Lee and Ambros Science,
294, 862 (2001), Lau et al., Science 294, 858-861 (2001),
Lagos-Quintana et al, Current Biology, 12, 735-739 (2002), Lagos
Quintana et al, Science 294, 853-857 (2001), and Lagos-Quintana et
al, RNA, 9, 175-179 (2003), which are incorporated by reference.
Multiple microRNAs can also be incorporated into the precursor
molecule.
[0078] A mature miRNA is produced as a result of a series of miRNA
maturation steps; first a gene encoding the miRNA is transcribed.
The gene encoding the miRNA is typically much longer than the
processed mature miRNA molecule; miRNAs are first transcribed as
primary transcripts or "pri-miRNA" with a cap and poly-A tail,
which is subsequently processed to short, about 70-nucleotide
"stem-loop structures" known as "pre-miRNA" in the cell nucleus.
This processing is performed in animals by a protein complex known
as the Microprocessor complex, consisting of the nuclease Drosha
and the double-stranded RNA binding protein Pasha. These pre-miRNAs
are then processed to mature miRNAs in the cytoplasm by interaction
with the endonuclease Dicer, which also initiates the formation of
the RNA-induced silencing complex (RISC). This complex is
responsible for the gene silencing observed due to miRNA expression
and RNA interference. The pathway is different for miRNAs derived
from intronic stem-loops; these are processed by Drosha but not by
Dicer. In some instances, a given region of DNA and its
complementary strand can both function as templates to give rise to
at least two miRNAs. Mature miRNAs can direct the cleavage of mRNA
or they can interfere with translation of the mRNA, either of which
results in reduced protein accumulation, rendering miRNAs capable
of modulating gene expression and related cellular activities.
[0079] The term "pri-miRNA" refers to a precursor to a mature miRNA
molecule which comprises; (i) a microRNA sequence and (ii)
stem-loop component which are both flanked (i.e. surrounded on each
side) by "microRNA flanking sequences", where each flanking
sequence typically ends in either a cap or poly-A tail. A
pri-microRNA, (also referred to as large RNA precursors), are
composed of any type of nucleic acid based molecule capable of
accommodating the microRNA flanking sequences and the microRNA
sequence. Examples of pri-miRNAs and the individual components of
such precursors (flanking sequences and microRNA sequence) are
provided herein. The nucleotide sequence of the pri-miRNA precursor
and its stem-loop components can vary widely. In one aspect a
pre-miRNA molecule can be an isolated nucleic acid; including
microRNA flanking sequences and comprising a stem-loop structure
and a microRNA sequence incorporated therein. A pri-miRNA molecule
can be processed in vivo or in vitro to an intermediate species
caller "pre-miRNA", which is further processed to produce a mature
miRNA.
[0080] The term "pre-miRNA" refers to the intermediate miRNA
species in the processing of a pri-miRNA to mature miRNA, where
pri-miRNA is processed to pre-miRNA in the nucleus, where upon
pre-miRNA translocates to the cytoplasm where it undergoes
additional processing in the cytoplasm to form mature miRNA.
Pre-miRNAs are generally about 70 nucleotides long, but can be less
than 70 nucleotides or more than 70 nucleotides.
[0081] The term "microRNA flanking sequence" as used herein refers
to nucleotide sequences including microRNA processing elements.
MicroRNA processing elements are the minimal nucleic acid sequences
which contribute to the production of mature miRNA from precursor
microRNA. Often these elements are located within a 40 nucleotide
sequence that flanks a microRNA stem-loop structure. In some
instances the microRNA processing elements are found within a
stretch of nucleotide sequences of between 5 and 4,000 nucleotides
in length that flank a microRNA stem-loop structure. Thus, in some
embodiments the flanking sequences are 5-4,000 nucleotides in
length. As a result, the length of the precursor molecule can be,
in some instances at least about 150 nucleotides or 270 nucleotides
in length. The total length of the precursor molecule, however, can
be greater or less than these values. In other embodiments the
minimal length of the microRNA flanking sequence is 10, 20, 30, 40,
50, 60, 70, 80, 90, 100, 150, 200 and any integer there between. In
other embodiments the maximal length of the microRNA flanking
sequence is 2,000, 2,100, 2,200, 2,300, 2,400, 2,500, 2,600, 2,700,
2,800, 2,900, 3,000, 3,100, 3,200, 3,300, 3,400, 3,500, 3,600,
3,700, 3,800, 3,900 4,000 and any integer there between.
[0082] MicroRNA flanking sequences can be native microRNA flanking
sequences or artificial microRNA flanking sequences. A native
microRNA flanking sequence is a nucleotide sequence that is
ordinarily associated in naturally existing systems with microRNA
sequences, i.e., these sequences are found within the genomic
sequences surrounding the minimal microRNA hairpin in vivo.
Artificial microRNA flanking sequences are nucleotides sequences
that are not found to be flanking to microRNA sequences in
naturally existing systems. microRNA flanking sequences within the
pri-miRNA molecule can flank one or both sides of the stem-loop
structure encompassing the microRNA sequence. Thus, one end (i.e.,
5') of the stem-loop structure can be adjacent to a single flanking
sequence and the other end (i.e., 3') of the stem-loop structure
can not be adjacent to a flanking sequence. Preferred structures
have flanking sequences on both ends of the stem-loop structure.
The flanking sequences can be directly adjacent to one or both ends
of the stem-loop structure or can be connected to the stem-loop
structure through a linker, additional nucleotides or other
molecules.
[0083] A "stem-loop structure" refers to a nucleic acid having a
secondary structure that includes a region of nucleotides which are
known or predicted to form a double strand (stem portion) that is
linked on one side by a region of predominantly single-stranded
nucleotides (loop portion). The terms "hairpin" and "fold-back"
structures are also used herein to refer to stem-loop structures.
Such structures are well known in the art and the term is used
consistently with its known meaning in the art. The actual primary
sequence of nucleotides within the stem-loop structure is not
critical to the practice of the invention as long as the secondary
structure is present. As is known in the art, the secondary
structure does not require exact base-pairing. Thus, the stem can
include one or more base mismatches. Alternatively, the
base-pairing can be exact, i.e. not include any mismatches. In some
instances the precursor microRNA molecule can include more than one
stem-loop structure. The multiple stem-loop structures can be
linked to one another through a linker, such as, for example, a
nucleic acid linker or by a microRNA flanking sequence or other
molecule or some combination thereof.
[0084] Furthermore, miRNA-like stem-loops can be expressed in cells
as a vehicle to deliver artificial miRNAs and short interfering
RNAs (siRNAs) for the purpose of modulating the expression of
endogenous genes through the miRNA and or RNAi pathways. As used
herein, the term "miRNA mimetic" refers to an artificial miRNA or
RNAi (RNA interference molecule) which is flanked by the stem-loop
like structures of a pri-miRNA.
[0085] The term "artificial microRNA" includes any type of RNA
sequence, other than endogenous microRNA, which is capable of
modulating the productive utilization of mRNA. For instance, the
term artificial microRNA also encompasses a nucleic acid sequence
which would be previously identified as siRNA, where the siRNA is
incorporated into a vector and surrounded by miRNA flanking
sequences as described herein.
[0086] As used herein, "double stranded RNA" or "dsRNA" refers to
RNA molecules that are comprised of two substantially complementary
strands. Double-stranded molecules include those comprised of a
single RNA molecule that doubles back on itself to form a
two-stranded structure. For example, the stem loop structure of the
progenitor molecules from which the single-stranded miRNA is
derived, called the pre-miRNA (Bartel et al. 2004. Cell
116:281-297), comprises a dsRNA molecule.
[0087] As used herein, "gene silencing" or "gene silenced" by a
miRNA and/or RNA interference molecule "refers to a decrease in the
mRNA level in a cell for a target gene by at least about 5%, at
least about 10%, at least about 20%, at least about 30%, at least
about 40%, at least about 50%, at least about 60%, at least about
70%, at least about 80%, at least about 90%, at least about 95%, at
least about 99% up to and including 100%, and any integer in
between of the mRNA level found in the cell without the presence of
the miRNA or RNA interference molecule. In one preferred
embodiment, the mRNA levels are decreased by at least about 70%, at
least about 80%, at least about 90%, at least about 95%, at least
about 99%, up to and including 100% and any integer in between 5%
and 100%."
[0088] The term "reduced" or "reduce" as used herein generally
means a decrease by a statistically significant amount. However,
for avoidance of doubt, "reduced" means a decrease by at least 10%
as compared to a reference level, for example a decrease by at
least about 20%, or at least about 30%, or at least about 40%, or
at least about 50%, or at least about 60%, or at least about 70%,
or at least about 80%, or at least about 90% or up to and including
a 100% decrease (i.e. absent level as compared to a reference
sample), or any decrease between 10-100% as compared to a reference
level.
[0089] The term "lacking" or "lack of" when used in the context of
the expression of let-7 herein, refers to a level let-7 which is
undetectable by the methods as used herein to measure such levels.
The term "lack of" typically refers to minimal, absent or about
null levels of let-7 expression, but does not necessarily mean
let-7 is completely absent, it means the level of let-7 in a cell
is below a level for a significant let-7 target gene silencing in
that cell.
[0090] The term "increased" or "increase" as used herein generally
means an increase by a statically significant amount; for the
avoidance of any doubt, "increased" means an increase of at least
10% as compared to a reference level, for example an increase of at
least about 20%, or at least about 30%, or at least about 40%, or
at least about 50%, or at least about 60%, or at least about 70%,
or at least about 80%, or at least about 90% or up to and including
a 100% increase or any increase between 10-100% as compared to a
reference level, or at least about a 2-fold, or at least about a
3-fold, or at least about a 4-fold, or at least about a 5-fold or
at least about a 10-fold increase, or any increase between 2-fold
and 10-fold or greater as compared to a reference level.
[0091] The terms "enriching" or "enriched" are used interchangeably
herein and mean that the yield (fraction) of cells of one type is
increased by at least 10% over the fraction of cells of that type
in the starting culture or preparation.
[0092] The term "tissue" refers to a group or layer of similarly
specialized cells which together perform certain special functions.
The term "tissue-specific" refers to a source of cells from a
specific tissue.
[0093] The term "substantially pure", with respect to a particular
cell population, refers to a population of cells that is at least
about 75%, preferably at least about 85%, more preferably at least
about 90%, and most preferably at least about 95% pure, with
respect to the cells making up a total cell population. Recast, the
terms "substantially pure" or "essentially purified", with regard
to a preparation of one or more partially and/or terminally
differentiated cell types, refer to a population of cells that
contain fewer than about 20%, more preferably fewer than about 15%,
10%, 8%, 7%, most preferably fewer than about 5%, 4%, 3%, 2%, 1%,
or less than 1%, of cells that are not stem cells or stem cell
progeny.
[0094] The term "stem cell" as used herein, as used in the context
of or with reference to a "cancer stem cell" refers to an
undifferentiated cell which is capable of proliferation and giving
rise to more progenitor cells having the ability to generate a
large number of mother cells that can in turn give rise to
differentiated, or differentiable daughter cells. The daughter
cells themselves can be induced to proliferate and produce progeny
that subsequently differentiate into one or more mature cell types,
while also retaining one or more cells with parental developmental
potential. The term "cancer stem cell" refers then, to a cell with
the capacity or potential, under particular circumstances, to
differentiate to a more specialized or differentiated phenotype,
and which retains the capacity, under certain circumstances, to
proliferate without substantially differentiating. In one
embodiment, the term progenitor or stem cell refers to a
generalized mother cell whose descendants (progeny) specialize,
often in different directions, by differentiation, e.g., by
acquiring completely individual characters, as occurs in
progressive diversification of embryonic cells and tissues.
Cellular differentiation is a complex process typically occurring
through many cell divisions. A differentiated cell can derive from
a multipotent cell which itself is derived from a multipotent cell,
and so on. While each of these multipotent cells can be considered
stem cells, the range of cell types each can give rise to can vary
considerably. Some differentiated cells also have the capacity to
give rise to cells of greater developmental potential. Such
capacity can be natural or can be induced artificially upon
treatment with various factors. In many biological instances, stem
cells are also "multipotent" because they can produce progeny of
more than one distinct cell type, but this is not required for
"stemness." Self-renewal is the other classical part of the stem
cell definition, and it is essential as used in this document. In
theory, self-renewal can occur by either of two major mechanisms.
Stem cells can divide asymmetrically, with one daughter retaining
the stem state and the other daughter expressing some distinct
other specific function and phenotype. Alternatively, some of the
stem cells in a population can divide symmetrically into two stems,
thus maintaining some stem cells in the population as a whole,
while other cells in the population give rise to differentiated
progeny only. Formally, it is possible that cells that begin as
stem cells might proceed toward a differentiated phenotype, but
then "reverse" and re-express the stem cell phenotype, a term often
referred to as "dedifferentiation". Cancer stem cells have the
ability for self-renewal, multipotent differentiation and vigorous
proliferative capacity, as well as the ability to form mammospheres
(or emboid bodies). In some embodiments, breast cancer stem cells
are also positive for breast cancer stem cell phenotype
(Oct4.sup.+CD44.sup.+CD24.sup.-lineage.sup.-).sup.1
[0095] The term "progenitor cells" is used synonymously with "stem
cell." Generally, "progenitor cells" have a cellular phenotype that
is more primitive (i.e., is at an earlier step along a
developmental pathway or progression) than is a fully
differentiated cell. Often, progenitor cells also have significant
or very high proliferative potential. Progenitor cells can give
rise to multiple distinct differentiated cell types or to a single
differentiated cell type, depending on the developmental pathway
and on the environment in which the cells develop and
differentiate. It is possible that cells that begin as progenitor
cells might proceed toward a differentiated phenotype, but then
"reverse" and re-express the progenitor cell phenotype.
[0096] In the context of cell ontogeny, the adjective
"differentiated", or "differentiating" is a relative term. A
"differentiated cell" is a cell that has progressed further down
the developmental pathway than the cell it is being compared with.
Thus, stem cells can differentiate to lineage-restricted precursor
cells (such as a mesodermal stem cell), which in turn can
differentiate into other types of precursor cells further down the
pathway, and then to an end-stage differentiated cell, which plays
a characteristic role in a certain tissue type, and can or can not
retain the capacity to proliferate further.
[0097] As indicated above, there are different levels or classes of
cells falling under the general definition of a "stem cell." These
are "totipotent," "pluripotent" and "multipotent" stem cells. The
term "totipotent" refers to a stem cell that can give rise to any
tissue or cell type in the body. "Pluripotent" stem cells can give
rise to any type of cell in the body except germ line cells. Stem
cells that can give rise to a smaller or limited number of
different cell types are generally termed "multipotent." Thus,
totipotent cells differentiate into pluripotent cells that can give
rise to most, but not all, of the tissues necessary for fetal
development. Pluripotent cells undergo further differentiation into
multipotent cells that are committed to give rise to cells that
have a particular function. For example, multipotent hematopoietic
stem cells give rise to the red blood cells, white blood cells and
platelets in the blood.
[0098] The term "stemness" as used herein refers to a cell with
stem cell properties, for example a cell that has the capacity for
self-renewal, for example a cell that is totipotent, pluripotent or
multipotent. A cancer cell that is a "cancer stem cell" or a cancer
cell with stemness properties is a cancer cell which can give rises
to daughter cells which themselves can be induced to proliferate
and produce progeny that subsequently differentiate into one or
more mature cell types, while also retaining one or more cells with
parental developmental potential. The term "cancer stem cell"
therefore refers to a cell with the capacity or potential, under
particular circumstances, to differentiate to a more specialized or
differentiated phenotype, and which retains the capacity, under
certain circumstances, to proliferate without substantially
differentiating the self-renewal potential of breast
tumor-initating cells can be determined by their capacity to give
rise to mammospheres.sup.10 or emboid bodies in vitro. Furthermore,
self-renewing breast cancer cells have been shown to be
CD44.sup.+CD24.sup.-9,10,15, as demonstrated in Example 1 herein.
Cancer stem cells have the ability for self-renewal, multipotent
differentiation and vigorous proliferative capacity, as well as the
ability to form mammospheres (or emboid bodies).
[0099] As used herein a "siRNA" refers to a nucleic acid that forms
a double stranded RNA, which double stranded RNA has the ability to
reduce or inhibit expression of a particular gene or target gene
when the siRNA is expressed in the same cell as the gene or target
gene. The double stranded RNA siRNA can be formed by the
complementary strands. The complementary portions of the siRNA that
hybridize to form the double stranded molecule typically have
substantial or complete identity. In one embodiment, a siRNA refers
to a nucleic acid that has substantial or complete identity to
sequence of a target gene and forms a double stranded RNA. The
sequence of the siRNA can correspond to the full length target
gene, or to a subsequence thereof. Typically, the siRNA is at least
about 15-50 nucleotides in length (e.g., each complementary
sequence of the double stranded siRNA is about 15-50 nucleotides in
length, and the double stranded siRNA is about 15-50 base pairs in
length, preferably about 19-30 base nucleotides, preferably about
20-25 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30 nucleotides in length).
[0100] As used herein "shRNA" or "small hairpin RNA" (also called
stem loop) is a type of siRNA. In one embodiment, these shRNAs are
composed of a short, e.g. about 19 to about 25 nucleotide,
antisense strand, followed by a nucleotide loop of about 5 to about
9 nucleotides, and the analogous sense strand. Alternatively, the
sense strand can precede the nucleotide loop structure and the
antisense strand can follow.
[0101] The term "biological sample" as used herein means a sample
of biological tissue or fluid that comprises nucleic acids. Such
samples include, but are not limited to, tissue isolated from
animals. Biological samples can also include sections of tissues
such as biopsy and autopsy samples, frozen sections taken for
histologic purposes, blood, plasma, serum, sputum, stool, tears,
mucus, hair, and skin. Biological samples also include explants and
primary and/or transformed cell cultures derived from patient
tissues. A biological sample can be provided by removing a sample
of cells from an animal, but can also be accomplished by using
previously isolated cells (e.g., isolated by another person, at
another time, and/or for another purpose), or by performing the
methods as disclosed herein in vivo. Archival tissues, such as
those having treatment or outcome history can also be used.
[0102] The term "tissue" is intended to include, blood, blood
preparations such as plasma and serum, bones, joints, muscles,
smooth muscles, and organs.
[0103] The terms "disease" or "disorder" are used interchangeably
herein, and refer to any alteration in state of the body or of some
of the organs, interrupting or disturbing the performance of the
functions and/or causing symptoms such as discomfort, dysfunction,
distress, or even death to the person afflicted or those in contact
with a person. A disease or disorder can also related to a
distemper, ailing, ailment, malady, disorder, sickness, illness,
complaint, indisposition or affliction.
[0104] The terms "subject" and "individual" are used
interchangeably herein, and refer to an animal, for example a
human, to whom treatment, including prophylactic treatment, with a
pharmaceutical composition as disclosed herein, is provided. The
term "subject" as used herein refers to human and non-human
animals. The term "non-human animals" and "non-human mammals" are
used interchangeably herein and includes all vertebrates, e.g.,
mammals, such as non-human primates, (particularly higher
primates), sheep, dog, rodent (e.g. mouse or rat), guinea pig,
goat, pig, cat, rabbits, cows, and non-mammals such as chickens,
amphibians, reptiles etc. In one embodiment, the subject is human.
In another embodiment, the subject is an experimental animal or
animal substitute as a disease model.
[0105] The term `effective amount" as used herein refers to the
amount of therapeutic agent of pharmaceutical composition to
alleviate at least one of the symptoms of the disease or
disorder.
[0106] The terms "malignancy" and "cancer" are used interchangeably
herein and refers to any disease of an organ or tissue in mammals
characterized by poorly controlled or uncontrolled multiplication
of normal or abnormal cells in that tissue which results in a tumor
and has an effect on the body as a whole. Cancer diseases within
the scope of the definition comprise benign neoplasms, dysplasias,
hyperplasias as well as neoplasms showing metastatic growth or any
other transformations like e.g. leukoplakias which often precede a
breakout of cancer.
[0107] As used herein, the term "tumor" refers to a mass of
transformed cells that are characterized, at least in part, by
containing angiogenic vasculature. The transformed cells are
characterized by neoplastic uncontrolled cell multiplication which
is rapid and continues even after the stimuli that initiated the
new growth has ceased. The term "tumor" is used broadly to include
the tumor parenchymal cells as well as the supporting stroma,
including the angiogenic blood vessels that infiltrate the tumor
parenchymal cell mass. Although a tumor generally is a malignant
tumor, i.e., a cancer having the ability to metastasize (i.e. a
metastatic tumor), a tumor also can be nonmalignant (i.e.
non-metastatic tumor). Tumors are hallmarks of cancer, a neoplastic
disease the natural course of which is fatal. Cancer cells exhibit
the properties of invasion and metastasis and are highly
anaplastic.
[0108] As used herein, the term "metastases" or "metastatic tumor"
refers to a secondary tumor that grows separately elsewhere in the
body from the primary tumor and has arisen from detached,
transported cells, wherein the primary tumor is a solid tumor. The
primary tumor, as used herein, refers to a tumor that originated in
the location or organ in which it is present and did not
metastasize to that location from another location. As used herein,
a "malignant tumor" is one having the properties of invasion and
metastasis and showing a high degree of anaplasia. Anaplasia is the
reversion of cells to an immature or a less differentiated form,
and it occurs in most malignant tumors.
[0109] The term "therapy resistant cancer" as used herein refers to
a cancer present in a subject which is resistant to, or refractory
to at least two different anti-cancer agents such as chemotherapy
agents, which means, typically a subject has been treated with at
least two different anti-cancer agents that did not provide
effective treatment as that term is defined herein.
[0110] The term "gene" as used herein refers to a genomic gene
comprising transcriptional and/or translational regulatory
sequences and/or a coding region and/or non-translated sequences
(e.g., introns, 5'- and 3'-untranslated sequences). The coding
region of a gene can be a nucleotide sequence coding for an amino
acid sequence or a functional RNA, such as tRNA, rRNA, catalytic
RNA, siRNA, miRNA and antisense RNA. A gene can also be an mRNA or
cDNA corresponding to the coding regions (e.g., exons and miRNA)
optionally comprising 5'- or 3' untranslated sequences linked
thereto. A gene can also be an amplified nucleic acid molecule
produced in vitro comprising all or a part of the coding region
and/or 5'- or 3'-untranslated sequences linked thereto.
[0111] The term "nucleic acid" or "oligonucleotide" or
"polynucleotide" used herein means at least two nucleotides
covalently linked together. As will be appreciated by those in the
art, the depiction of a single strand also defines the sequence of
the complementary strand. Thus, a nucleic acid also encompasses the
complementary strand of a depicted single strand. As will also be
appreciated by those in the art, many variants of a nucleic acid
can be used for the same purpose as a given nucleic acid. Thus, a
nucleic acid also encompasses substantially identical nucleic acids
and complements thereof. As will also be appreciated by those in
the art, a single strand provides a probe that can hybridize to the
target sequence under stringent hybridization conditions. Thus, a
nucleic acid also encompasses a probe that hybridizes under
stringent hybridization conditions.
[0112] Nucleic acids can be single stranded or double stranded, or
can contain portions of both double stranded and single stranded
sequence. The nucleic acid can be DNA, both genomic and cDNA, RNA,
or a hybrid, where the nucleic acid can contain combinations of
deoxyribo- and ribo-nucleotides, and combinations of bases
including uracil, adenine, thymine, cytosine, guanine, inosine,
xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids
can be obtained by chemical synthesis methods or by recombinant
methods.
[0113] A nucleic acid will generally contain phosphodiester bonds,
although nucleic acid analogs can be included that can have at
least one different linkage, e.g., phosphoramidate,
phosphorothioate, phosphorodithioate, or O-methylphosphoroamidite
linkages and peptide nucleic acid backbones and linkages. Other
analog nucleic acids include those with positive backbones;
non-ionic backbones, and non-ribose backbones, including those
described in U.S. Pat. Nos. 5,235,033 and 5,034,506, which are
incorporated by reference. Nucleic acids containing one or more
non-naturally occurring or modified nucleotides are also included
within one definition of nucleic acids. The modified nucleotide
analog can be located for example at the 5'-end and/or the 3'-end
of the nucleic acid molecule. Representative examples of nucleotide
analogs can be selected from sugar- or backbone-modified
ribonucleotides. It should be noted, however, that also
nucleobase-modified ribonucleotides, i.e. ribonucleotides,
containing a non naturally occurring nucleobase instead of a
naturally occurring nucleobase such as uridines or cytidines
modified at the 5-position, e.g. 5-(2-amino)propyl uridine, 5-bromo
uridine; adenosines and guanosines modified at the 8-position, e.g.
8-bromo guanosine; deaza nucleotides, e.g. 7 deaza-adenosine; O--
and N-- alkylated nucleotides, e.g. N6-methyl adenosine are
suitable. The 2' OH-- group can be replaced by a group selected
from H. OR, R. halo, SH, SR, NH2, NHR, NR2 or CN, wherein R is C-C6
alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I. Modifications
of the ribose-phosphate backbone can be done for a variety of
reasons, e.g., to increase the stability and half-life of such
molecules in physiological environments or as probes on a biochip.
Mixtures of naturally occurring nucleic acids and analogs can be
made; alternatively, mixtures of different nucleic acid analogs,
and mixtures of naturally occurring nucleic acids and analogs can
be made.
[0114] The term "probe" as used herein refers to an oligonucleotide
capable of binding to a target nucleic acid of complementary
sequence through one or more types of chemical bonds, usually
through complementary base pairing, usually through hydrogen bond
formation. Probes can bind target sequences lacking complete
complementarily with the probe sequence depending upon the
stringency of the hybridization conditions. There can be any number
of base pair mismatches which will interfere with hybridization
between the target sequence and single stranded target nucleic
acids, but a probe will bind a selected target specifically, i.e.
to the substantial exclusion of non-target nucleic acids under at
least one set of conditions. A probe can be single stranded or
partially single and partially double stranded. A probe will
generally be detectably labeled or carry a moiety that permits
signal detection.
[0115] For sequence comparison, typically one sequence acts as a
reference sequence, to which test sequences are compared. When
using a sequence comparison algorithm, test and reference sequences
are input into a computer, subsequence coordinates are designated,
if necessary, and sequence algorithm program parameters are
designated. The sequence comparison algorithm then calculates the
percent sequence identity for the test sequence(s) relative to the
reference sequence, based on the designated program parameters.
[0116] Optimal alignment of sequences for comparison can be
conducted, for example, by the local homology algorithm of Smith
and Waterman (Adv. Appl. Math. 2:482 (1981), which is incorporated
by reference herein), by the homology alignment algorithm of
Needleman and Wunsch (J. Mol. Biol. 48:443-53 (1970), which is
incorporated by reference herein), by the search for similarity
method of Pearson and Lipman (Proc. Natl. Acad. Sci. USA 85:2444-48
(1988), which is incorporated by reference herein), by computerized
implementations of these algorithms (e.g., GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, 575 Science Dr., Madison, Wis.), or by visual
inspection. (See generally Ausubel et al. (eds.), Current Protocols
in Molecular Biology, 4th ed., John Wiley and Sons, New York
(1999)).
[0117] One example of a useful algorithm is PILEUP. PILEUP creates
a multiple sequence alignment from a group of related sequences
using progressive, pairwise alignments to show the percent sequence
identity. It also plots a tree or dendogram showing the clustering
relationships used to create the alignment. PILEUP uses a
simplification of the progressive alignment method of Feng and
Doolittle (J. Mol. Evol. 25:351-60 (1987), which is incorporated by
reference herein). The method used is similar to the method
described by Higgins and Sharp (Comput. Appl. Biosci. 5:151-53
(1989), which is incorporated by reference herein). The program can
align up to 300 sequences, each of a maximum length of 5,000
nucleotides or amino acids. The multiple alignment procedure begins
with the pairwise alignment of the two most similar sequences,
producing a cluster of two aligned sequences. This cluster is then
aligned to the next most related sequence or cluster of aligned
sequences. Two clusters of sequences are aligned by a simple
extension of the pairwise alignment of two individual sequences.
The final alignment is achieved by a series of progressive,
pairwise alignments. The program is run by designating specific
sequences and their amino acid or nucleotide coordinates for
regions of sequence comparison and by designating the program
parameters. For example, a reference sequence can be compared to
other test sequences to determine the percent sequence identity
relationship using the following parameters: default gap weight
(3.00), default gap length weight (0.10), and weighted end
gaps.
[0118] Another example of an algorithm that is suitable for
determining percent sequence identity and sequence similarity is
the BLAST algorithm, which is described by Altschul et al. (J. Mol.
Biol. 215:403-410 (1990), which is incorporated by reference
herein). (See also Zhang et al., Nucleic Acid Res. 26:3986-90
(1998); Altschul et al., Nucleic Acid Res. 25:3389-402 (1997),
which are incorporated by reference herein). Software for
performing BLAST analyses is publicly available through the
National Center for Biotechnology Information internet web site.
This algorithm involves first identifying high scoring sequence
pairs (HSPs) by identifying short words of length W in the query
sequence, which either match or satisfy some positive-valued
threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score
threshold (Altschul et al. (1990), supra). These initial
neighborhood word hits act as seeds for initiating searches to find
longer HSPs containing them. The word hits are then extended in
both directions along each sequence for as far as the cumulative
alignment score can be increased. Extension of the word hits in
each direction is halted when: the cumulative alignment score falls
off by the quantity X from its maximum achieved value; the
cumulative score goes to zero or below, due to the accumulation of
one or more negative-scoring residue alignments; or the end of
either sequence is reached. The BLAST algorithm parameters W, T,
and X determine the sensitivity and speed of the alignment. The
BLAST program uses as defaults a word length (W) of 11, the
BLOSUM62 scoring matrix (see Henikoff and Henikoff, Proc. Natl.
Acad. Sci. USA 89:10915-9 (1992), which is incorporated by
reference herein) alignments (B) of 50, expectation (E) of 10, M=5,
N=-4, and a comparison of both strands.
[0119] In addition to calculating percent sequence identity, the
BLAST algorithm also performs a statistical analysis of the
similarity between two sequences (see, e.g., Karlin and Altschul,
Proc. Natl. Acad. Sci. USA 90:5873-77 (1993), which is incorporated
by reference herein). One measure of similarity provided by the
BLAST algorithm is the smallest sum probability (P(N)), which
provides an indication of the probability by which a match between
two nucleotide or amino acid sequences would occur by chance. For
example, a nucleic acid is considered similar to a reference
sequence if the smallest sum probability in a comparison of the
test nucleic acid to the reference nucleic acid is less than about
0.1, more typically less than about 0.01, and most typically less
than about 0.001.
[0120] The term "variant" as used in the context of let-7 miRNA
variants means a modified let-7 miRNA with at least on of the
following; altered nucleic acid sequence, such as insertions,
deletions, substitutions, fragments of at least 5 nucleic acids,
modification of the nucleic acids or nucleic acid analogues as
compared to the wild type mature let-7 miRNA (SEQ ID NO:1).
[0121] As used herein, the terms "homologous" or "homologues" are
used interchangeably, and when used to describe a polynucleotide or
polypeptide, indicates that two polynucleotides or polypeptides, or
designated sequences thereof, when optimally aligned and compared,
for example using BLAST, version 2.2.14 with default parameters for
an alignment (see below) are identical, with appropriate nucleotide
insertions or deletions or amino-acid insertions or deletions, in
at least 70% of the nucleotides, usually from about 75% to 99%, and
more preferably at least about 98 to 99% of the nucleotides. The
term "homolog" or "homologous" as used herein also refers to
homology with respect to structure and/or function. With respect to
sequence homology, sequences are homologs if they are at least 50%,
at least 60 at least 70%, at least 80%, at least 90%, at least 95%
identical, at least 97% identical, or at least 99% identical. The
term "substantially homologous" refers to sequences that are at
least 90%, at least 95% identical, at least 97% identical or at
least 99% identical. Homologous sequences can be the same
functional gene in different species.
[0122] Determination of homologs of the genes or peptides of the
present invention can be easily ascertained by the skilled artisan.
The terms "homology", "identity" and "similarity" refer to the
degree of sequence similarity between two peptides or between two
optimally aligned nucleic acid molecules. Homology and identity can
each be determined by comparing a position in each sequence which
can be aligned for purposes of comparison. When an equivalent
position in the compared sequences is occupied by the same base or
amino acid, then the molecules are identical at that position; when
the equivalent site occupied by similar amino acid residues (e.g.,
similar in steric and/or electronic nature such as, for example
conservative amino acid substitutions), then the molecules can be
referred to as homologous (similar) at that position. Expression as
a percentage of homology/similarity or identity refers to a
function of the number of similar or identical amino acids at
positions shared by the compared sequences, respectfully. A
sequence which is "unrelated" or "non-homologous" shares less than
40% identity, though preferably less than 25% identity with a
sequence of the present application.
[0123] As used herein, the term "sequence identity" means that two
polynucleotide or amino acid sequences are identical (i.e., on a
nucleotide-by-nucleotide or residue-by-residue basis) over the
comparison window. The term "percentage of sequence identity" is
calculated by comparing two optimally aligned sequences over the
window of comparison, determining the number of positions at which
the identical nucleic acid base (e.g., A, T. C, G. U. or 1) or
residue occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total
number of positions in the comparison window (i.e., the window
size), and multiplying the result by 100 to yield the percentage of
sequence identity.
[0124] The terms "substantial identity" as used herein denotes a
characteristic of a polynucleotide or amino acid sequence, wherein
the polynucleotide or amino acid comprises a sequence that has at
least 85 percent sequence identity, preferably at least 90 to 95
percent sequence identity, more usually at least 99 percent
sequence identity as compared to a reference sequence over a
comparison window of at least 18 nucleotide (6 amino acid)
positions, frequently over a window of at least 24-48 nucleotide
(8-16 amino acid) positions, wherein the; percentage of sequence
identity is calculated by comparing the reference sequence to the
sequence which can include deletions or additions which total 20
percent or less of the reference sequence over the comparison
window. The reference sequence can be a subset of a larger
sequence. The term "similarity", when used to describe a
polypeptide, is determined by comparing the amino acid sequence and
the conserved amino acid substitutes of one polypeptide to the
sequence of a second polypeptide.
[0125] As used herein, the term "expression profile" refers to the
amount or level of a plurality of different miRNAs expressed in a
cell or a population of cells or a tissue.
[0126] The term "target" as used herein refers to a polynucleotide
that can be bound by one or more probes under stringent
hybridization conditions. The term "targeting" as used herein in
the context of "targeting a cancer cell" means directing a
therapeutic agent as disclosed herein, such as a let-7 miRNA or
homologues thereof to that cancer cell to treat a cancer compring
such a cancer stem cell.
[0127] The term "target cell" as used herein refers to a cell which
comprises cell surface antigens, such as for example but not
limited to, cell surface receptors or glycoprotein or other cell
surface markers which the targeting moiety as disclosed herein can
recognize and bind thereto.
[0128] The terms "targeting moiety" or "target moiety" are used
interchangeably herein and refer to a molecule which has affinity,
or binds to a molecule on the surface of a target cell, for example
a targeting moiety functions as an agent that homes in on or
preferentially associates or binds to a particular tissue, cell
type, receptor, infecting agent or other area of interest. Examples
of a targeting moiety include, but are not limited to, an antibody,
an antigen binding fragment of an antibody, an antigen, a ligand, a
receptor, one member of a specific binding pair, a polyamide
including a peptide having affinity for a biological receptor, an
oligosaccharide, a polysaccharide, a steroid or steroid derivative,
a hormone, e.g., estradiol or histamine, a hormone-mimic, e.g.,
morphine, or other compound having binding specificity for a
cellular target. In the methods of the present invention, a
targeting moiety promotes transport or preferential localization of
the let-7 miRNA to a target cell, for example a target cancer stem
cell. Targeting moiety useful in the methods and compositions as
disclosed herein binds to cell-surface antigens or proteins present
on cancer stem cells. Examples include, but are not limited to,
tumor-associated antigens (TAAs), the HLA-DR antigen, c-erbB-2
proto-oncogene, MUC1, MAG-1, VEGFR2, pro-vasopressin (pro-VP),
TAG-72 (sialyl Tn or STn), STn-KLH, GD3, cancer antigen 125 (CA
125, human ovarian cancer cell surface antigen. (OCCSA), alpha
fetoprotein (AFP), and other cancer cell surface antigens which are
disclosed in, for example, US20030143237A1, which is incorporated
herein by reference.
[0129] As used herein, the term "binding moiety" refers to a
protein or the nucleic acid binding domain of a protein which has
the ability to associate with or complex with nucleic acids such as
let-7 miRNA as disclosed herein. In some embodiments, a binding
moiety is complexed with a targeting moiety by any means commonly
known by persons of ordinary skill in the art, for example but not
limited to, fusion, chemical conjugation, van de Waals forces, and
in some embodiments the binding moiety can be fused to the carboxy
portion of the targeting moiety. The location of the targeting
moiety may be either in the carboxyl-terminal or amino-terminal end
of the construct or in the middle of the fusion protein.
Alternatively, the fusion protein may comprise more than one miRNA
binding moiety and one or more targeting moieties. In one
embodiment, the binding moiety is the nucleic acid binding domain
of a protein selected from the group of nucleic acid binding
domains present in proteins selected from the group consisting of
protamine, GCN4, Fos, Jun, TFIIS, FMRI, yeast protein HX, Vigillin,
Mer1, bacterial polynucleotide phosphorylase, ribosomal protein S3,
and heat shock protein. In one embodiment, the binding moiety is
the protein protamine or an nucleic acid-binding fragment of
protamine.
[0130] The term "vectors" refers to a nucleic acid molecule capable
of transporting another nucleic acid to which it has been linked; a
plasmid is a species of the genus encompassed by "vector". The term
"vector" typically refers to a nucleic acid sequence containing an
origin of replication and other entities necessary for replication
and/or maintenance in a host cell. Vectors capable of directing the
expression of genes and/or nucleic acid sequence to which they are
operatively linked are referred to herein as "expression vectors".
In general, expression vectors of utility are often in the form of
"plasmids" which refer to circular double stranded DNA loops which,
in their vector form are not bound to the chromosome, and typically
comprise entities for stable or transient expression or the encoded
DNA. Other expression vectors can be used in the methods as
disclosed herein for example, but are not limited to, plasmids,
episomes, bacterial artificial chromosomes, yeast artificial
chromosomes, bacteriophages or viral vectors, and such vectors can
integrate into the host's genome or replicate autonomously in the
particular cell. A vector can be a DNA or RNA vector. Other forms
of expression vectors known by those skilled in the art which serve
the equivalent functions can also be used, for example self
replicating extrachromosomal vectors or vectors which integrates
into a host genome.
[0131] As used herein, the terms "treat" or "treatment" or
"treating" refers to both therapeutic treatment and prophylactic or
preventative measures, wherein the object is to prevent or slow the
development of the disease, such as slow down the development of a
tumor, the spread of cancer, or reducing at least one effect or
symptom of a condition, disease or disorder associated with
inappropriate proliferation or a cell mass, for example cancer.
Treatment is generally "effective" if one or more symptoms or
clinical markers are reduced as that term is defined herein.
Alternatively, treatment is "effective" if the progression of a
disease is reduced or halted. That is, "treatment" includes not
just the improvement of symptoms or markers, but also a cessation
of at least slowing of progress or worsening of symptoms that would
be expected in absence of treatment. Beneficial or desired clinical
results include, but are not limited to, alleviation of one or more
symptom(s), diminishment of extent of disease, stabilized (i.e.,
not worsening) state of disease, delay or slowing of disease
progression, amelioration or palliation of the disease state, and
remission (whether partial or total), whether detectable or
undetectable. "Treatment" can also mean prolonging survival as
compared to expected survival if not receiving treatment. Those in
need of treatment include those already diagnosed with cancer, as
well as those likely to develop secondary tumors due to
metastasis.
[0132] The term "effective amount" as used herein refers to the
amount of therapeutic agent of pharmaceutical composition to
alleviate at least one or more symptom of the disease or disorder,
and relates to a sufficient amount of pharmacological composition
to provide the desired effect. The phrase "therapeutically
effective amount" as used herein, e.g., of an miRNA-related
composition as disclosed herein means a sufficient amount of the
composition to treat a disorder, at a reasonable benefit/risk ratio
applicable to any medical treatment. The term "therapeutically
effective amount" therefore refers to an amount of the composition
as disclosed herein that is sufficient to effect a therapeutically
or prophylacticly significant reduction in a symptom or clinical
marker associated with a T-cell disease or a cancer-mediated
condition when administered to a typical subject who has a T-cell
disease or a cancer.
[0133] A therapeutically or prophylatically significant reduction
in a symptom is, e.g. at least about 10%, at least about 20%, at
least about 30%, at least about 40%, at least about 50%, at least
about 60%, at least about 70%, at least about 80%, at least about
90%, at least about 100%, at least about 125%, at least about 150%
or more in a measured parameter as compared to a control or
non-treated subject. Measured or measurable parameters include
clinically detectable markers of disease, for example, elevated or
depressed levels of a biological marker, as well as parameters
related to a clinically accepted scale of symptoms or markers for a
disease or disorder. It will be understood, however, that the total
daily usage of the compositions and formulations as disclosed
herein will be decided by the attending physician within the scope
of sound medical judgment. The exact amount required will vary
depending on factors such as the type of disease being treated.
[0134] With reference to the treatment of a subject with a cancer,
the term "therapeutically effective amount" refers to the amount
that is safe and sufficient to prevent or delay the development and
further growth of a tumor or the spread of metastases in cancer
patients. The amount can thus cure or cause the cancer to go into
remission, slow the course of cancer progression, slow or inhibit
tumor growth, slow or inhibit tumor metastasis, slow or inhibit the
establishment of secondary tumors at metastatic sites, or inhibit
the formation of new tumor metastases. The effective amount for the
treatment of cancer depends on the tumor to be treated, the
severity of the tumor, the drug resistance level of the tumor, the
species being treated, the age and general condition of the
subject, the mode of administration and so forth. Thus, it is not
possible to specify the exact "effective amount". However, for any
given case, an appropriate "effective amount" can be determined by
one of ordinary skill in the art using only routine
experimentation. The efficacy of treatment can be judged by an
ordinarily skilled practitioner, for example, efficacy can be
assessed in animal models of cancer and tumor, for example
treatment of a rodent with a cancer, and any treatment or
administration of the compositions or formulations that leads to a
decrease of at least one symptom of the cancer, for example a
reduction in the size of the tumor or a slowing or cessation of the
rate of growth of the tumor indicates effective treatment. In
embodiments where the compositions are used for the treatment of
cancer, the efficacy of the composition can be judged using an
experimental animal model of cancer, e.g., wild-type mice or rats,
or preferably, transplantation of tumor cells. When using an
experimental animal model, efficacy of treatment is evidenced when
a reduction in a symptom of the cancer, for example a reduction in
the size of the tumor or a slowing or cessation of the rate of
growth of the tumor occurs earlier in treated, versus untreated
animals. By "earlier" is meant that a decrease, for example in the
size of the tumor occurs at least 5% earlier, but preferably more,
e.g., one day earlier, two days earlier, 3 days earlier, or
more.
[0135] As used herein, the term "treating" when used in reference
to a cancer treatment is used to refer to the reduction of a
symptom and/or a biochemical marker of cancer, for example a
reduction in at least one biochemical marker of cancer by at least
about 10% would be considered an effective treatment. Examples of
such biochemical markers of cancer include CD44, telomerase,
TGF-.alpha., TGF-.beta., erbB-2, erbB-3, MUC1, MUC2, CK20, PSA,
CA125 and FOBT. A reduction in the rate of proliferation of the
cancer cells by at least about 10% would also be considered
effective treatment by the methods as disclosed herein. As
alternative examples, a reduction in a symptom of cancer, for
example, a slowing of the rate of growth of the cancer by at least
about 10% or a cessation of the increase in tumor size, or a
reduction in the size of a tumor by at least about 10% or a
reduction in the tumor spread (i.e. tumor metastasis) by at least
about 10% would also be considered as affective treatments by the
methods as disclosed herein. In some embodiments, it is preferred,
but not required that the therapeutic agent actually kill the
tumor.
[0136] As used herein, the terms "administering," and "introducing"
are used interchangeably herein and refer to the placement of the
therapeutic agents as disclosed herein into a subject by a method
or route which results in delivering of such agent(s) at a desired
site. The compounds can be administered by any appropriate route
which results in an effective treatment in the subject.
[0137] The phrases "parenteral administration" and "administered
parenterally" as used herein mean modes of administration other
than enteral and topical administration, usually by injection, and
includes, without limitation, intravenous, intramuscular,
intraarterial, intrathecal, intraventricular, intracapsular,
intraorbital, intracardiac, intradermal, intraperitoneal,
transtracheal, subcutaneous, subcuticular, intraarticular, sub
capsular, subarachnoid, intraspinal, intracerebro spinal, and
intrasternal injection and infusion. The phrases "systemic
administration," "administered systemically", "peripheral
administration" and "administered peripherally" as used herein mean
the administration therapeutic compositions other than directly
into a tumor such that it enters the animal's system and, thus, is
subject to metabolism and other like processes.
[0138] The phrase "pharmaceutically acceptable" is employed herein
to refer to those compounds, materials, compositions, and/or dosage
forms which are, within the scope of sound medical judgment,
suitable for use in contact with the tissues of human beings and
animals without excessive toxicity, irritation, allergic response,
or other problem or complication, commensurate with a reasonable
benefit/risk ratio. The phrase "pharmaceutically acceptable
carrier" as used herein means a pharmaceutically acceptable
material, composition or vehicle, such as a liquid or solid filler,
diluent, excipient, solvent or encapsulating material, involved in
maintaining the activity of or carrying or transporting the subject
agents from one organ, or portion of the body, to another organ, or
portion of the body. In addition to being "pharmaceutically
acceptable" as that term is defined herein, each carrier must also
be "acceptable" in the sense of being compatible with the other
ingredients of the formulation. The pharmaceutical formulation
contains a compound of the invention in combination with one or
more pharmaceutically acceptable ingredients. The carrier can be in
the form of a solid, semi-solid or liquid diluent, cream or a
capsule. These pharmaceutical preparations are a further object of
the invention. Usually the amount of active compounds is between
0.1-95% by weight of the preparation, preferably between 0.2-20% by
weight in preparations for parenteral use and preferably between 1
and 50% by weight in preparations for oral administration. For the
clinical use of the methods of the present invention, targeted
delivery composition of the invention is formulated into
pharmaceutical compositions or pharmaceutical formulations for
parenteral administration, e.g., intravenous; mucosal, e.g.,
intranasal; enteral, e.g., oral; topical, e.g., transdermal;
ocular, e.g., via corneal scarification or other mode of
administration. The pharmaceutical composition contains a compound
of the invention in combination with one or more pharmaceutically
acceptable ingredients. The carrier can be in the form of a solid,
semi-solid or liquid diluent, cream or a capsule.
[0139] The terms "composition" or "pharmaceutical composition" used
interchangeably herein refer to compositions or formulations that
usually comprise an excipient, such as a pharmaceutically
acceptable carrier that is conventional in the art and that is
suitable for administration to mammals, and preferably humans or
human cells. Such compositions can be specifically formulated for
administration via one or more of a number of routes, including but
not limited to, oral, ocular parenteral, intravenous,
intraarterial, subcutaneous, intranasal, sublingual, intraspinal,
intracerebroventricular, and the like. In addition, compositions
for topical (e.g., oral mucosa, respiratory mucosa) and/or oral
administration can form solutions, suspensions, tablets, pills,
capsules, sustained-release formulations, oral rinses, or powders,
as known in the art are described herein. The compositions also can
include stabilizers and preservatives. For examples of carriers,
stabilizers and adjuvants, University of the Sciences in
Philadelphia (2005) Remington: The Science and Practice of Pharmacy
with Facts and Comparisons, 21st Ed.
[0140] The term "agent" refers to any entity which is normally not
present or not present at the levels being administered to a cell,
tissue or subject. Agent can be selected from a group comprising:
chemicals; small molecules; nucleic acid sequences; nucleic acid
analogues; proteins; peptides; aptamers; antibodies; or functional
fragments thereof. A nucleic acid sequence can be RNA or DNA, and
can be single or double stranded, and can be selected from a group
comprising: nucleic acid encoding a protein of interest;
oligonucleotides; and nucleic acid analogues; for example
peptide-nucleic acid (PNA), pseudo-complementary PNA (pc-PNA),
locked nucleic acid (LNA), etc. Such nucleic acid sequences
include, but are not limited to nucleic acid sequence encoding
proteins, for example that act as transcriptional repressors,
antisense molecules, ribozymes, small inhibitory nucleic acid
sequences, for example but not limited to RNAi, shRNAi, siRNA,
micro RNAi (mRNAi), antisense oligonucleotides etc. A protein
and/or peptide or fragment thereof can be any protein of interest,
for example, but not limited to; mutated proteins; therapeutic
proteins; truncated proteins, wherein the protein is normally
absent or expressed at lower levels in the cell. Proteins can also
be selected from a group comprising; mutated proteins, genetically
engineered proteins, peptides, synthetic peptides, recombinant
proteins, chimeric proteins, antibodies, midibodies, tribodies,
humanized proteins, humanized antibodies, chimeric antibodies,
modified proteins and fragments thereof. An gent can be applied to
the media, where it contacts the cell and induces its effects.
Alternatively, an agent can be intracellular as a result of
introduction of a nucleic acid sequence encoding the agent into the
cell and its transcription resulting in the production of the
nucleic acid and/or protein environmental stimuli within the cell.
In some embodiments, the agent is any chemical, entity or moiety,
including without limitation synthetic and naturally-occurring
non-proteinaceous entities. In certain embodiments the agent is a
small molecule having a chemical moiety. For example, chemical
moieties included unsubstituted or substituted alkyl, aromatic, or
heterocyclyl moieties including macrolides, leptomycins and related
natural products or analogues thereof. Agents can be known to have
a desired activity and/or property, or can be selected from a
library of diverse compounds.
[0141] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0142] Other than in the operating examples, or where otherwise
indicated, all numbers expressing quantities of ingredients or
reaction conditions used herein should be understood as modified in
all instances by the term "about." The term "about" when used in
connection with percentages can mean.+-.1%. The present invention
is further explained in detail by the following examples, but the
scope of the invention should not be limited thereto.
[0143] It should be understood that this invention is not limited
to the particular methodology, protocols, and reagents, etc.,
described herein and as such can vary. The terminology used herein
is for the purpose of describing particular embodiments only, and
is not intended to limit the scope of the present invention, which
is defined solely by the claims.
Let-7 microRNA
[0144] The present invention relates in part to use of let-7 miRNA
and/or mimetics thereof for the treatment of cancer. In some
embodiments, the methods relate to the treatment of cancer by
targeting cancer stem cells with let-7 miRNA and/or a mimetic
thereof. In some embodiments, the let-7 is any isoform of let-7,
including but not limited to let-7a. In another embodiment, the
let-7 miRNA is a let-7 pre-miRNA, let-7 pri-miRNA or mature let-7
miRNA or fragments and variants thereof that retain the biological
activity of the mature let-7 miRNA.
[0145] Let-7 microRNAs or let-7 miRNAs are endogenous RNAs which
function as gene silencing molecules that regulate the expression
of protein-coding genes that comprise a let-7 target sequence.
Let-7 miRNAs function to repress the expression of genes at the
posttranscriptional level. Let-7 target sites to which let-7 miRNA
binds in its role as a gene silencer are typically in the mRNA of
the target gene, and can be in the 5' UTR, the 3' UTR or in the
coding region.
[0146] Micro RNAs (also referred to as "miRNAs") are small
non-coding RNAs belonging to a class of regulatory molecules found
in plants and animals. Without wishing to be bound by theory,
miRNAs are thought to control gene expression by binding to
complementary sites (herein referred to as "target sequences") on
target messenger RNA (mRNA) transcripts. miRNAs often function as
"gene silencers" to suppress or repress the expression of a target
gene. miRNAs are generated from large RNA precursors (termed
pri-miRNAs) that are processed in the nucleus into approximately 70
nucleotide pre-miRNAs, which fold into imperfect stem loop
structures (Lee, Y., et al., Nature (2003) 425(6956):415-9) (See
FIG. 7c). The pre-miRNAs undergo an additional processing step
within the cytoplasm where mature miRNAs of 18-25 nucleotides in
length are excised from one side of the pre-miRNA hairpin by an
RNase III enzyme, Dicer (Hutvagner, G., et al., Science (2001)
12:12 and Grishok, A., et al., Cell (2001) 106(1):23-34).
[0147] mRNAs have been shown to regulate gene expression in two
ways. First, miRNAs that bind to protein-coding mRNA sequences that
are exactly complementary to the miRNA induce the RNA-mediated
interference (RNAi) pathway. Messenger RNA targets are cleaved by
ribonucleases in the RISC complex. This mechanism of miRNA-mediated
gene silencing has been observed mainly in plants (Hamilton, A. J.
and D.C. Baulcombe, Science (1999) 286(5441):950-2 and Reinhart, B.
J., et al., MicroRNAs in plants. Genes and Dev. (2002)
16:1616-1626), but an example is known from animals (Yekta, S., I.
H. Shih, and D. P. Bartel, Science (2004) 304(5670):594-6). In the
second mechanism, miRNAs that bind to imperfect complementary sites
on messenger RNA transcripts direct gene regulation at the
posttranscriptional level but do not cleave their mRNA targets.
mRNAs identified in both plants and animals use this mechanism to
exert translational control of their gene targets (Barter, D. P.,
Cell (2004) 116(2):281-97).
[0148] Hundreds of miRNAs have been identified in the fly, worm,
plant and mammalian genomes. The biological role for the majority
of the miRNAs remains unknown because almost all of these were
found through cloning and bioinformatic approaches (Lagos-Quintana,
M., et al., Curr Biol (2002) 12(9):735-9, Lagos-Quintana, M., et
al., RNA (2003) 9(2): 175-179, Lagos-Quintana, M., et al., Science
(2001) 294(5543): 853-8; Lee, R. C. and V. Ambros, Science (2001)
294(5543):862-4; Lau, N. C., et al., Science (2001)
294(5543):858-62; Lim, L. P., et al., Genes Dev (2003) 17(8):991
1008; Johnston, R. J. and 0. Robert, Nature (2003) 426(6968):845-9;
and Chang, S., et al. Nature (2004) 430(7001):785-9).
[0149] let-7 is an endogenous miRNA which functions as a gene
silencing molecule to regulate, at the posttranscriptional level,
the expression of some known protein-coding genes that comprise a
let-7 target sequence. let-7 miRNA and homologues and variants
thereof include conservative substitutions, additions, and
deletions therein not adversely affecting the structure or gene
silencing function. Preferably, let-7 refers to the nucleic acid
encoding let-7 from C. elegans (NCBI Accession No. AY390762), most
preferably, let-7 refers to the nucleic acid encoding a let-7
family member from humans, including but not limited to NCBI
Accession Nos. AJ421724, AJ421725, AJ421726, AJ421727, AJ421728,
AJ421729, AJ421730, AJ421731, AJ421732, and biologically active
sequence variants of let-7, including alleles, and in vitro
generated derivatives of let-7 that demonstrate let-7 activity in
that it is capable of binding to and inhibiting the expression of a
gene comprising the let-7 target sequence, where the target
sequence is 5'-AACTATACAACCTACTACCTCA-3' (SEQ ID NO: 9). Let-7 also
encompasses all isoforms of let-7, for example but not limited to
let-7 family members including let-7a (SEQ ID NO:1); let-7b (SEQ ID
NO:2); hsa-let-7c (SEQ ID NO:3); hsa-let-7d (SEQ ID NO:4);
hsa-let-7e (SEQ ID NO:5); hsa-let-7f (SEQ ID NO:6).
[0150] In one embodiment, the let-7 miRNAs useful according to the
present invention are members of the let-7 family, and can be
selected from the group consisting of: hsa-let-7a MIMAT0000062:
5'-UGAGGUAGUAGGUUGUAUAGUU-3' (SEQ ID NO: 1); hsa-let-7b
MIMAT0000063: 5'-UGAGGUAGUAGGUUGUGUGGUU-3' (SEQ ID NO:2);
hsa-let-7c MIMAT0000064: 5'-UGAGGUAGUAGGUUGUAUGGUU-3' SEQ ID NO:3);
hsa-let-7d MIMAT0000065: 5'-AGAGGUAGUAGGUUGCAUAGU-3' (SEQ ID NO:4);
hsa-let-7e MIMAT0000066: 5'-UGAGGUAGGAGGUUGUAUAGU-3' (SEQ ID NO:5);
hsa-let-7f MIMAT0000067: 5'-UGAGGUAGUAGAUUGUAUAGUU-3 (SEQ ID NO:6).
In some embodiments, the let-7 miRNA is let-7a isoform, of
hsa-let-7a MIMAT0000062: 5'-UGAGGUAGUAGGUUGUAUAGUU-3' (SEQ ID
NO:1).
[0151] In some embodiments, the let-7 miRNA or let-7 miRNA is a
pre-miRNA. In some embodiments, the let-7 miRNA is
5'-UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGA
UAACUAUACAAUCUACUGUCUUUCCUA-3' (SEQ ID NO:7), also called MI0000060
herein.
[0152] In some embodiments, let-7 is homo sapiens let-7a1 stem loop
(SEQ ID NO:8) as shown in FIG. 7C, which corresponds to
5'-ugggaugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaaucuacu-
gucuu-uccua-3' where the underlined residues represent non
hybridized nucleic acids, bold resides represent part of the
hair-pin turn and the bold underlined residues represent the middle
residues of hairpin turn (see FIG. 7C herein).
[0153] Let-7 useful in the present invention includes sequence
variants of let-7 that retain at least 50% of the target
gene-inhibitory function of wildtype mature let-7 miRNA (SEQ ID NO:
1). Let-7 variants generally fall into one or more of three
classes: substitution, insertional or deletional variants.
Insertions include 5' and/or 3' terminal fusions as well as
intrasequence insertions of single or multiple residues. Insertions
can also be introduced within the mature sequence of let-7.
Intrasequence insertions ordinarily will be smaller insertions than
those at the 5' or 3' terminus, on the order of 1 to 4 residues. It
is understood that the variants substitutions insertions or
deletions of residues will not result in a deleterious effect on
the function of the variant in its ability to bind to, and inhibit
the expression of genes comprising let-7 target sequence
5'-AACTATACAACCTACTACCTCA-3' (SEQ ID NO: 9), and preferably the
substitution, insertional or deletional variants with have
increased binding affinity for the let-7 target sequence
5'-AACTATACAACCTACTACCTCA-3' (SEQ ID NO: 9), and thus increased
gene silencing efficacy of the target gene as compared to wild type
let-7 corresponding to SEQ ID NO:1.
[0154] Substitutional variants are those in which at least one
residue has been removed and a different residue inserted in its
place. Insertional sequence variants of let-7 are those in which
one or more residues are introduced into a predetermined site in
the target let-7 miRNA. Most commonly, insertional variants are
fusions of nucleic acids at the 5' or 3' terminus of let-7.
Deletion variants are characterized by the removal of one or more
residues from the let-7 RNA sequence. These variants ordinarily are
prepared by site specific mutagenesis of nucleotides in the DNA
encoding let-7, thereby producing DNA encoding the variant, and
thereafter expressing the DNA in recombinant cell culture. However,
variant let-7 fragments can be conveniently prepared by in vitro
synthesis. The variants typically exhibit the same qualitative
biological activity as the naturally-occurring analogue, although
variants also are selected in order to modify the characteristics
of let-7.
[0155] While the site for introducing a sequence variation is
selected, the mutation per se need not be predetermined. For
example, in order to optimize the performance of a mutation at a
given site, random mutagenesis can be conducted at the target
region and the expressed let-7 variants screened for the optimal
combination of desired activity. Techniques for making substitution
mutations at predetermined sites in DNA having a known sequence are
well known. Nucleotide substitutions are typically of single
residues; insertions usually will be on the order of about from 1
to 10 residues; and deletions will range about from 1 to 30
residues. Deletions or insertions preferably are made in adjacent
pairs; i.e. a deletion of 2 residues or insertion of 2
residues.
[0156] Substitutions, deletion, insertions or any combination
thereof can be combined to arrive at a final construct. Changes can
be made to increase the activity of the miRNA, to increase its
biological stability or half-life, and the like. All such
modifications to the nucleotide sequences encoding such miRNA are
encompassed.
[0157] In some embodiments of the present invention, the let-7
miRNA and mimetics thereof are produced by methods known by persons
of ordinary skill in the art. In some embodiments, the let-7 miRNA
and mimetics thereof can be produced as disclosed in International
Patent No: WO2005/047505, which is incorporated herein in its
entirety by reference. In some embodiments, the let-7 microRNA
molecule is a precursor microRNA molecule. A let-7 precursor
microRNA (let-7 pre-miRNA) molecule is an isolated nucleic acid
including a stem-loop structure wherein a microRNA sequence is
incorporated into the stem-loop structure. In some embodiments, the
let-7 precursor microRNA molecule includes a microRNA flanking
sequence on either or both sides of the microRNA sequence.
[0158] In another embodiment, the let-7 microRNA sequence and the
microRNA flanking sequence are derived from the same microRNA gene.
In another embodiment of the invention the let-7 microRNA sequence
and the microRNA flanking sequence are not derived from the same
microRNA gene.
[0159] In another embodiment, a let-7 precursor microRNA has a
nucleic acid having a stem-loop structure, wherein a let-7 microRNA
sequence is incorporated into a stem of the stem-loop structure,
and, a microRNA flanking sequence flanking at least one end of the
stem-loop structure, wherein the microRNA sequence and the microRNA
flanking sequence are not derived from the same microRNA gene.
[0160] In some embodiments, the size range of the let-7 miRNA can
be from 21 nucleotides to 170 nucleotides, although let-7 miRNAs of
up to 2000 nucleotides can be utilized. In some embodiments the
size range of the miRNA is from 70 to 170 nucleotides in length. In
another embodiment, mature let-7 miRNAs of from 21 to 25
nucleotides in length can be used.
[0161] In some embodiments, the let-7 microRNA sequence is an
artificial let-7 microRNA. In alternative embodiments, let-7 is
from a DNA isolate. A DNA isolate is understood to mean chemically
synthesized DNA, cDNA or genomic DNA with or without the 3' and/or
5' flanking regions.
[0162] In alternative embodiments, DNA encoding let-7 can be
obtained from other sources by a) obtaining a cDNA library from
cells containing mRNA, b) conducting hybridization analysis with
labeled DNA encoding let-7 or fragments thereof (usually, greater
than 100 bp) in order to detect clones in the cDNA library
containing homologous sequences, and c) analyzing the clones by
restriction enzyme analysis and nucleic acid sequencing to identify
full-length clones.
[0163] As used herein nucleic acids and/or nucleic acid sequences
are homologous when they are derived, naturally or artificially,
from a common ancestral nucleic acid or nucleic acid sequence.
Homology is generally inferred from sequence similarity between two
or more nucleic acids or proteins (or sequences thereof). The
precise percentage of similarity between sequences that is useful
in establishing homology varies with the nucleic acid and protein
at issue, but as little as 25% sequence similarity is routinely
used to establish homology. Higher levels of sequence similarity,
e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more can
also be used to establish homology. Methods for determining
sequence similarity percentages (e.g., BLASTN using default
parameters) are generally available. Software for performing BLAST
analyses is publicly available through the National Center for
Biotechnology Information (www. ncbi.nlm.nih.gov).
[0164] Suitable nucleic acids for use in the methods described
herein include, but are not limited to, let-7 pri-miRNA, let-7
pre-miRNA, mature let-7 miRNA or fragments of variants thereof that
retain the biological activity of let-7 miRNA and DNA encoding
let-7 pri-miRNA, let-7 pre-miRNA, mature let-7 miRNA, fragments or
variants thereof, or DNA encoding regulatory elements of let-7
miRNA.
[0165] Interestingly, multiple miRNAs can regulate the same mRNA
target by recognizing the same or multiple sites. The presence of
multiple miRNA complementarily sites in most genetically identified
targets can indicate that the cooperative action of multiple RISCs
provides the most efficient translational inhibition. Thus, in one
embodiment, the methods provide for treatment of cancer by
targeting cancer stem cells, the method comprising targeting the
cancer stem cells with a pharmaceutical composition comprising
let-7 mimetics, where the let-7 mimetic is a different miRNA that
complements the function of wild type let-7 miRNA (i.e. SEQ ID
NO:1) and/or functions independently of let-7 to gene silence the
same mRNA that let-7 silences.
Let-7 Mimetics
[0166] In alternative embodiments, mimetics of miRNAs that are
reduced and/or lacking in cancer stem cells are useful in the
methods of the present invention. A miRNA mimetic is any entity or
agent that has at least a gene-silencing function of the subject
miRNA. In some embodiments, let-7 mimetics are useful in the
methods of the present invention. Examples of let-7 mimetics
include, but are not limited to small molecules, proteins, nucleic
acids, ribosomes, aptamers, antibodies, nucleic acid analogues,
etc. that have let-7 activity or function as the term is used
herein. Nucleic acid let-7 mimetics can also include, but are not
limited to, RNA interference-inducing molecules, including, but not
limited to siRNA, dsRNA, stRNA, shRNA and modified versions
thereof, where the RNA interference molecule has the same function
as let-7 miRNA.
[0167] In some embodiments the let-7 mimetics can be
RNA-interference or RNA interference molecules, including, but not
limited to double-stranded RNA, such as siRNA, double-stranded DNA
or single-stranded DNA. In some embodiments, a let-7 mimetic is a
single-stranded RNA (ssRNA), a form of RNA endogenously found in
eukaryotic cells as the product of DNA transcription. Cellular
ssRNA molecules include messenger RNAs (and the progenitor
pre-messenger RNAs), small nuclear RNAs, small nucleolar RNAs,
transfer RNAs and ribosomal RNAs. Double-stranded RNA (dsRNA)
induces a size-dependent immune response such that dsRNA larger
than 30 bp activates the interferon response, while shorter dsRNAs
feed into the cell's endogenous RNA interference machinery
downstream of the Dicer enzyme.
[0168] Numerous specific siRNA molecules have been designed that
have been shown to inhibit gene expression (Ratcliff et al. Science
276:1558-1560, 1997; Waterhouse et al. Nature 411:834-842, 2001).
In addition, specific siRNA molecules have been shown to inhibit,
for example, HIV-1 entry to a cell by targeting the host CD4
protein expression in target cells thereby reducing the entry sites
for HIV-1 which targets cells expressing CD4 (Novina et al. Nature
Medicine, 8:681-686, 2002). Short interfering RNA have further been
designed and successfully used to silence expression of Fas to
reduce Fas-mediated apoptosis in vivo (Song et al. Nature Medicine
9:347-351, 2003).
[0169] It has been shown in plants that longer, about 24-26 nt
siRNA, correlates with systemic silencing and methylation of
homologous DNA. Conversely, the about 21-22 nt short siRNA class
correlates with mRNA degradation but not with systemic signaling or
methylation (Hamilton et al. EMBO J. 2002 Sep. 2; 21(17):4671-9).
These findings reveal an unexpected level of complexity in the RNA
silencing pathway in plants that may also apply in animals. In
higher order eukaryotes, DNA is methylated at cytosines located 5'
to guanosine in the CpG dinucleotide. This modification has
important regulatory effects on gene expression, especially when
involving CpG-rich areas known as CpG islands, located in the
promoter regions of many genes. While almost all gene-associated
islands are protected from methylation on autosomal chromosomes,
extensive methylation of CpG islands has been associated with
transcriptional inactivation of selected imprinted genes and genes
on the inactive X-chromosomes of females. Aberrant methylation of
normally unmethylated CpG islands has been documented as a
relatively frequent event in immortalized and transformed cells and
has been associated with transcriptional inactivation of defined
tumor suppressor genes in human cancers. In this last situation,
promoter region hypermethylation stands as an alternative to coding
region mutations in eliminating tumor suppression gene function
(Herman, et al.). The use of siRNA molecules for directing
methylation of a target gene is described in U.S. Provisional
Application No. 60/447,013, filed Feb. 13, 2003, referred to in
U.S. Patent Application Publication No. 20040091918.
[0170] It is also known that the RNA interference does not have to
match perfectly to its target sequence. Preferably, however, the 5'
and middle part of the antisense (guide) strand of the siRNA is
perfectly complementary to the target nucleic acid sequence.
[0171] The RNA interference-inducing molecule functioning as let-7
mimetics according to the present invention includes RNA molecules
that have natural or modified nucleotides, natural ribose sugars or
modified sugars and natural or modified phosphate backbone.
[0172] Accordingly, the RNA interference-inducing molecules
functioning as a let-7 mimetic include, but are not limited to,
unmodified and modified double stranded (ds) RNA molecules
including short-temporal RNA (stRNA), small interfering RNA
(siRNA), short-hairpin RNA (shRNA), microRNA (miRNA), and
double-stranded RNA (dsRNA), (see, e.g. Baulcombe, Science
297:2002-2003, 2002). The dsRNA molecules, e.g. siRNA, also may
contain 3' overhangs, preferably 3'UU or 3'TT overhangs. In one
embodiment, the siRNA molecules do not include RNA molecules that
comprise ssRNA greater than about 30-40 bases, about 40-50 bases,
about 50 bases or more. In one embodiment, the siRNA molecules have
a double stranded structure. In one embodiment, the siRNA molecules
are double stranded for more than about 25%, more than about 50%,
more than about 60%, more than about 70%, more than about 80% or
more than about 90% of their length.
[0173] In some embodiments, let-7 is any agent which binds to and
inhibits the expression of an RNA transcript comprising a let-7
target sequence, where the target sequence is
5'-AACTATACAACCTACTACCTCA-3' (SEQ ID NO: 9) as shown in FIG. 7D. In
such embodiments, these agents can be an RNA interference-inducing
molecule, including, but not limited to unmodified and modified
double stranded (ds) RNA molecules including, short-temporal RNA
(stRNA), small interfering RNA (siRNA), short-hairpin RNA (shRNA),
microRNA (miRNA), and double-stranded RNA (dsRNA). In other
embodiments, the agents may be any small molecule, protein,
aptamer, nucleic acid analogue, antibody etc. that binds to and
inhibits the expression of an RNA transcript comprising a let-7
target sequence SEQ ID NO:9.
[0174] The miRNA and RNA interference molecules according to the
present invention can be produced using any known techniques such
as direct chemical synthesis, through processing of longer double
stranded RNAs by exposure to recombinant Dicer protein or
Drosophila embryo lysates, through an in vitro system derived from
S2 cells, using phage RNA polymerase, RNA-dependant RNA polymerase,
and DNA based vectors. Use of cell lysates or in vitro processing
may further involve the subsequent isolation of the short, for
example, about 21-23 nucleotide, siRNAs from the lysate, etc.
Chemical synthesis usually proceeds by making two single stranded
RNA-oligomers followed by the annealing of the two single stranded
oligomers into a double stranded RNA. Other examples include
methods disclosed in WO 99/32619 and WO 01/68836 that teach
chemical and enzymatic synthesis of siRNA. Moreover, numerous
commercial services are available for designing and manufacturing
specific siRNAs (see, e.g., QIAGEN Inc., Valencia, Calif. and
AMBION Inc., Austin, Tex.).
[0175] Examples of methods of preparing such RNA interference are
shown, for example in an International Patent application Nos.
PCT/US03/34424 and PCT/US03/34686 the contents and references of
which are herein incorporated by reference in their entirety.
[0176] Various specific siRNA and miRNA molecules have been
described and additional molecules can be easily designed by one
skilled in the art. For example, the miRNA Database at
http://www.sanger.ac.uk/Software/Rfam/mirna/index.shtml provides a
useful source to identify additional miRNAs useful according to the
present invention (Griffiths-Jones S, NAR, 2004, 32, Database
Issue, D109-D111; Ambros V, Bartel B, Bartel D P, Burge C B,
Carrington J C, Chen X, Dreyfuss G, Eddy S R, Griffiths-Jones S,
Marshall M, Matzke M, Ruvkun G, Tuschl T. RNA, 2003, 9(3),
277-279).
[0177] The miRNA and RNA interference as described herein also
includes RNA molecules having one or more non-natural nucleotides,
i.e. nucleotides other than adenine "A", guanine "G", uracil "U",
or cytosine "C", a modified nucleotide residue or a derivative or
analog of a natural nucleotide are also useful. Any modified
residue, derivative or analog may be used to the extent that it
does not eliminate or substantially reduce (by at least 50%) RNAi
activity of the dsRNA. For example, the activity a miRNA or RNAi
molecule with the modified residue can be compared with the
activity of a miRNA or RNAi molecule with the same nucleic acid
sequence without the modified residue in an assay for gene
silencing the target gene. If the miRNA or RNAi with the modified
residue(s) has an efficiency of gene silencing which is the same,
greater or a least half as efficient as the miRNA or RNAi without
the modification, the modified mRNA or RNAi is useful in the
methods and compositions as disclosed herein. Examples of modified
residues, derivatives or analogues include, but are not limited to,
aminoallyl UTP, pseudo-UTP, 5-I-UTP, 5-I-CTP, 5-Br-UTP, alpha-S
ATP, alpha-S CTP, alpha-S GTP, alpha-S UTP, 4-thio UTP, 2-thio-CTP,
2'NH2 UTP, 2'NH.sub.2 CTP, and 2'F UTP. Such modified nucleotides
include, but are not limited to, aminoallyl uridine,
pseudo-uridine, 5-I-uridine, 5-I-cytidine, 5-Br-uridine, alpha-S
adenosine, alpha-S cytidine, alpha-S guanosine, alpha-S uridine,
4-thio uridine, 2-thio-cytidine, 2'NH.sub.2 uridine, 2'NH2
cytidine, and 2' F uridine, including the free pho (NTP) RNA
molecules as well as all other useful forms of the nucleotides.
[0178] RNA interference as referred to herein additionally includes
RNA molecules which contain modifications in the ribose sugars, as
well as modifications in the "phosphate backbone" of the nucleotide
chain. For example, siRNA or miRNA molecules containing
D-arabinofuranosyl structures in place of the naturally-occurring
D-ribonucleosides found in RNA can be used in RNA interference
according to the present invention (U.S. Pat. No. 5,177,196). Other
examples include RNA molecules containing the o-linkage between the
sugar and the heterocyclic base of the nucleoside, which confers
nuclease resistance and tight complementary strand binding to the
oligonucleotides and molecules similar to the oligonucleotides
containing 2'-O-methyl ribose, arabinose and particularly
D-arabinose (U.S. Pat. No. 5,177,196). Also, phosphorothioate
linkages can be used to stabilize the siRNA and miRNA molecules
(U.S. Pat. No. 5,177,196). siRNA and miRNA molecules having various
"tails" covalently attached to either their 3'- or to their
5'-ends, or to both, are also been known in the art and can be used
to stabilize the siRNA and miRNA molecules delivered using the
methods of the present invention. Generally speaking, intercalating
groups, various kinds of reporter groups and lipophilic groups
attached to the 3' or 5' ends of the RNA molecules are well known
to one skilled in the art and are useful according to the methods
of the present invention. Descriptions of syntheses of
3'-cholesterol or 3'-acridine modified oligonucleotides applicable
to preparation of modified RNA molecules useful according to the
present invention can be found, for example, in the articles:
Gamper, H. B., Reed, M. W., Cox, T., Virosco, J. S., Adams, A. D.,
Gall, A., Scholler, J. K., and Meyer, R. B. (1993) Facile
Preparation and Exonuclease Stability of 3'-Modified
Oligodeoxynucleotides. Nucleic Acids Res. 21 145-150; and Reed, M.
W., Adams, A. D., Nelson, J. S., and Meyer, R. B., Jr. (1991)
Acridine and Cholesterol-Derivatized Solid Supports for Improved
Synthesis of 3'-Modified Oligonucleotides. Bioconjugate Chem. 2
217-225 (1993).
Let-7 miRNAs and let-7 Mimetics as Therapeutics
[0179] The methods of the invention are useful for treating any
type of disease or disorder in which it is desirable to increase
let-7 miRNA. These include, for example, diseases where let-7
expression is reduced or lacking in the pathological tissue and the
reduction contributes to the disease pathology and/or progression
of the disease. An example of such a disease is cancer.
[0180] In one embodiment methods are provided to treat cancers by
using agents which inhibit the gene or gene product that is
regulated by let-7 miRNA. For example, also encompassed in the
present invention is use of any agent that inhibits the expression
of a gene or inhibits its gene product (protein) that comprises a
let-7 target sequence in its mRNA. The let-7 target site may be in
the 5' UTR, the 3' UTR or in the coding region of the mRNA. The
target sequence of let-7 is SEQ ID NO:9 or homologues thereof.
Examples of genes that comprise let-7 target sequences include, but
are not limited to, RAS, HRAS, lin-42, KRAS, GRB2, hbl-1, daf-12,
pha-4, or human homologues thereof, as disclosed in International
Patent Application: WO06/028967, which is incorporated in its
entirety herein by reference. In some embodiments, these genes
encode endogenous mammalian proteins, C. elegans proteins,
parasitic proteins, and viral proteins encoded by a eukaryotic cell
after entry of a virus into the cell.
[0181] In some embodiments, the subject can be administered a
plurality of agents to inhibit more than one gene and/or protein
which are normally regulated at the level of mRNA by let-7 miRNA.
The agents can be RNA interference molecules, for example miRNA,
siRNA, shRNA, or proteins, small molecules, nucleic acids, nucleic
acid analogues, aptamers, antibodies, peptides and variants and
analogues thereof. In some embodiments, where the agent is an
antibody, the antibody can be a recombinant antibody, humanized
antibody, chimeric antibody, modified antibody, monoclonal
antibody, polyclonal antibody, miniantibody, dimeric miniantibody,
minibody, diabody or tribody or antigen-binding variants, analogues
or modified versions thereof.
[0182] In some embodiments, the disease is associated with a stem
cell. In some embodiments, the disease is associated with a cancer
stem cell.
[0183] In one embodiment, the cancer is breast cancer. Thus in one
embodiment, let-7 miRNA and let-7 mimetics of the present invention
are useful in therapeutic protocols in the treatment of breast
cancer. In some embodiments, the methods of the present invention
are useful for treating cancers where cancer cells lack let-7 or
have reduced let-7 expression, including, as non-limiting examples,
colon and lung cancer. Thus in one embodiment, let-7 miRNA and
let-7 mimetics of the present invention are useful in therapeutic
protocols in the treatment of, e.g., colon and lung cancer.
[0184] The let-7 miRNA relationship to cancer is not limited to
breast, lung, or colon cancer--rather, let-7 miRNA represents a
broad-spectrum tumor suppressor. Thus, in other embodiments, the
let-7 miRNA and let-7 mimetics of the present invention are useful
in therapeutic protocols related to other cancers, including, but
not limited to, cancer selected breast cancer, lung cancer, head
and neck cancer, bladder cancer, stomach cancer, cancer of the
nervous system, bone cancer, bone marrow cancer, brain cancer,
colon cancer, esophageal cancer, endometrial cancer,
gastrointestinal cancer, genital-urinary cancer, stomach cancer,
lymphomas, melanoma, glioma, bladder cancer, pancreatic cancer, gum
cancer, kidney cancer, retinal cancer, liver cancer, nasopharynx
cancer, ovarian cancer, oral cancers, bladder cancer, hematological
neoplasms, follicular lymphoma, cervical cancer, multiple myeloma,
osteosarcomas, thyroid cancer, prostate cancer, colon cancer,
prostate cancer, skin cancer, stomach cancer, testis cancer, tongue
cancer, or uterine cancer.
[0185] Also encompassed is the use of other miRNAs and mimetics
thereof that are downregulated in cancer stem cells for the
treatment of other cancers, wherein the cancer comprises a cancer
stem cell lacking or having reduced expression of the miRNA.
Examples of such miRNAs include, but are not limited to miR-107,
miR-10a, miR-128a, miR128b, miR-132, miR-138, miR-16, miR-17,
miR-195, miR-199a, miR-20, miR-200a, miR-200b, miR-200c, miR-20b,
and miR-22.
Production of let-7 miRNA and Mimetics Thereof.
[0186] mRNA can be isolated from cells or tissues, recombinantly
produced, or synthesized in vitro by a variety of techniques well
known to one of ordinary skill in the art. In one approach, miRNA
is isolated from cells or tissues.
[0187] Techniques for isolating miRNA from cells or tissues are
well known to one of ordinary skill in the art. For example, miRNA
can be isolated from total RNA using the miRNA isolation kit from
Ambion, Inc. Another technique utilizes the flashPAGE Fractionator
System (Ambion, Inc.) for PAGE purification of small nucleic
acids.
[0188] The miRNA can be obtained by preparing a recombinant version
thereof (i.e., by using the techniques of genetic engineering to
produce a recombinant nucleic acid which can then be isolated or
purified by techniques well known to one of ordinary skill in the
art). This approach involves growing a culture of host cells in a
suitable culture medium, and purifying the miRNA from the cells or
the culture in which the cells are grown. For example, the methods
include a process for producing a miRNA in which a host cell,
containing a suitable expression vector that includes a nucleic
acid encoding an miRNA, is cultured under conditions that allow
expression of the encoded miRNA. In a preferred embodiment the
nucleic acid encodes let-7. The miRNA can be recovered from the
culture, from the culture medium or from a lysate prepared from the
host cells, and further purified. The host cell can be a higher
eukaryotic host cell such as a mammalian cell, a lower eukaryotic
host cell such as a yeast cell, or the host cell can be a
prokaryotic cell such as a bacterial cell. Introduction of a vector
containing the nucleic acid encoding the miRNA into the host cell
can be effected by calcium phosphate transfection, DEAE-dextran
mediated transfection, or electroporation (Davis, L. et al., Basic
Methods in Molecular Biology (1986)).
[0189] Any host/vector system can be used to express one or more of
the miRNAs. These include, but are not limited to, eukaryotic hosts
such as HeLa cells and yeast, as well as prokaryotic host such as
E. coli and B. subtilis. miRNA can be expressed in mammalian cells,
yeast, bacteria, or other cells where the miRNA gene is under the
control of an appropriate promoter. Appropriate cloning and
expression vectors for use with prokaryotic and eukaryotic hosts
are described by Sambrook, et al., in Molecular Cloning: A
Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y. (1989).
In the preferred embodiment, the miRNA is expressed in mammalian
cells. Examples of mammalian expression systems include C127,
monkey COS cells, Chinese Hamster Ovary (CHO) cells, human kidney
293 cells, human epidermal A43 1 cells, human Colo205 cells, 3T3
cells, CV-1 cells, other transformed primate cell lines, normal
diploid cells, cell strains derived from in vitro culture of
primary tissue, primary explants, HeLa cells, mouse L cells, BILK,
HL-60, U937, HaK or Jurkat cells.
[0190] Mammalian expression vectors will comprise an origin of
replication, a suitable promoter, polyadenylation site,
transcriptional termination sequences, and 5' flanking
non-transcribed sequences. DNA sequences derived from the SV40
viral genome, for example, SV40 origin, early promoter, enhancer,
splice, and polyadenylation sites may be used to provide the
required non-transcribed genetic elements. Potentially suitable
yeast strains include Saccharomyces cerevsiae, Schizosaccharomyces
pombe, Klayveromyces strains, Candida, or any yeast strain capable
of expressing miRNA. Potentially suitable bacterial strains include
Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any
bacterial strain capable of expressing miRNA.
[0191] In another approach, genomic DNA encoding let-7 is isolated,
the genomic DNA is expressed in a mammalian expression system, and
RNA is purified and modified as necessary for administration to a
patient. In one approach, the let-7 is in the form of a pre-miRNA,
which can be modified as desired (i.e. for increased stability or
cellular uptake).
[0192] Knowledge of DNA sequences of miRNA allows for modification
of cells to permit or increase expression of an endogenous miRNA.
Cells can be modified (e.g., by homologous recombination) to
provide increased miRNA expression by replacing, in whole or in
part, the naturally occurring promoter with all or part of a
heterologous promoter so that the cells express the miRNA at higher
levels. The heterologous promoter is inserted in such a manner that
it is operatively linked to the desired miRNA encoding sequences.
See, for example, PCT International Publication No. WO 94/12650 by
Transkaryotic Therapies, Inc., PCT International Publication No. WO
92/20808 by Cell Genesys, Inc., and PCT International Publication
No. WO 91/09955 by Applied Research Systems. Cells also may be;
engineered to express an endogenous gene comprising the miRNA under
the control of inducible regulatory elements, in which case the
regulatory sequences of the endogenous gene may be replaced by
homologous recombination. Gene activation techniques are described
in U.S. Pat. No. 5,272,071 to Chappel; U.S. Pat. No. 5,578,461 to
Sherwin et al.; PCT/US92/09627 (WO93/09222) by Selden et al.; and
PCT/US90/06436 (WO91/06667) by Skoultchi et al. The miRNA may be
prepared by culturing transformed host cells under culture
conditions suitable to express the miRNA. The resulting expressed
miRNA may then be purified from such culture (i.e., from culture
medium or cell extracts) using known purification processes, such
as gel filtration and ion exchange chromatography. The purification
of the miRNA may also include an affinity column containing agents
which will bind to the protein; one or more column steps over such
affinity resins as concanavalin A-agarose, Heparin-Toyopearl.TM. or
Cibacrom blue 3GA Sepharose.TM.; one or more steps involving
hydrophobic interaction chromatography using such resins as phenyl
ether, butyl ether, or propyl ether; immunoaffnity chromatography,
or complementary cDNA affinity chromatography.
[0193] The miRNA can also be expressed as a product of transgenic
animals, which are characterized by somatic or germ cells
containing a nucleotide sequence encoding the miRNA. A vector
containing DNA encoding miRNA and appropriate regulatory elements
can be inserted in the germ line of animals using homologous
recombination (Capecchi, Science t 244:1288-1292 (1989)), such that
they express the miRNA. Transgenic animals, preferably non-human
mammals, are produced using methods as described in U.S. Pat. No.
5,489,743 to Robinson, et al., and PCT Publication No. WO 94/28122
by Ontario Cancer Institute. miRNA can be isolated from cells or
tissue isolated from transgenic animals as discussed above.
[0194] In one approach, the miRNA can be obtained synthetically,
for example, by chemically synthesizing a nucleic acid by any
method of synthesis known to the skilled artisan. The synthesized
miRNA can then be purified by any method known in the art. Methods
for chemical synthesis of nucleic acids include, but are not
limited to, in vitro chemical synthesis using phosphotriester,
phosphate or phosphoramidite chemistry and solid phase techniques,
or via deoxynucleoside H-phosphonate intermediates (see U.S. Pat.
No. 5,705,629 to Bhongle).
[0195] In some circumstances, for example, where increased nuclease
stability is desired, nucleic acids having nucleic acid analogs
and/or modified internucleoside linkages may be preferred. Nucleic
acids containing modified internucleoside linkages can also be
synthesized using reagents and methods that are well known in the
art. For example, methods of synthesizing nucleic acids containing
phosphonate phosphorothioate, phosphorodithioate, phosphoramidate
methoxyethyl phosphoramidate, formacetal, thioformacetal,
diisopropylsilyl, acetamidate, carbamate, dimethylene-sulfide
(--CH2-S--CH2), dimethylene-sulfoxide (--CH2-SO--CH2),
dimethylene-sulfone (--CH2-SO2-CH2), 2'-O-alkyl, and
2'-deoxy-2'-fluoro' phosphorothioate internucleoside linkages are
well known in the art (see Uhlmann et al., 1990, Chem. Rev.
90:543-584; Schneider et al., 1990, Tetrahedron Lett. 31:335 and
references cited therein). U.S. Pat. Nos. 5,614,617 and 5,223,618
to Cook, et al., 5,714,606 to Acevedo, et al, 5,378,825 to Cook, et
al., 5,672,697 and 5,466,786 to Buhr, et al., 5,777,092 to Cook, et
al., 5,602,240 to De Mesmacker, et al., 5,610,289 to Cook, et al.
and 5,858,988 to Wang, also describe nucleic acid analogs for
enhanced nuclease stability and cellular uptake.
Pharmaceutical Compositions
[0196] In some embodiments, miRNAs and miRNA mimetics, for example
let-7 miRNAs and/or let-7 mimetics are administered to a subject in
a pharmaceutical composition where the subject has a cancer stem
cell. The administration may be a treatment and/or prophylaxis for
cancer, where the subject has at least one cancer stem cell. The
subject may have, or may not have, symptoms or manifestation of
cancer, since cancer stem cells can exist in the absence of
symptoms of cancer. In some embodiments, the pharmaceutical
compositions comprising miRNA and miRNA mimetics, for example let-7
miRNA and/or let-7 mimetics are administered to a subject with a
cancer stem cell. In some embodiments, the cancer stem cell is
present in any type of cancer. In some embodiments, the cancer is
breast cancer. In some embodiments, the cancer is a
treatment-resistant cancer, for example but not limited to a
chemotherapy-resistant breast cancer.
[0197] In another aspect of the present invention, the methods
described herein encompass administering a pharmaceutical
composition comprising a miRNA or mimetic thereof to a subject,
where the subject comprises a cancer stem cell which is lacking or
has reduced expression of an miRNA. In this aspect, the cancer stem
cell is, e.g., a cancer stem cell lacking or having reduced
expression of one or more of the following miRNAs; let-7, miR-107,
miR-10a, miR-128a, miR128b, miR-132, miR-138, miR-16, miR-17,
miR-195, miR-199a, miR-20, miR-200a, miR-200b, miR-200c, miR-20b,
miR-22.
[0198] Therefore in some embodiments, the methods of the present
invention relate to the treatment of cancers by targeting cancer
stem cells, the method comprising upregulating let-7 microRNAs or
providing analogous pharmaceutical compounds, for example
pharmaceutical compositions comprising let-7 miRNA and/or let-7
mimetics to a cancer stem cell in a therapeutic effective amount
for the treatment of cancer. In such embodiments, the cancer
comprises a cancer stem cell and/or a cell with reduced or lacking
let-7 expression.
[0199] In some embodiments, the let-7 miRNAs are nucleic acids, for
example but not limited to let-7 pri miRNA, let-7 pre-miRNA, mature
let-7 miRNA or fragments or variants thereof that retain the same
biological activity as the mature let-7 miRNA, for example, they
have a minimum biological activity of binding to (or hybridizing
to) a target RNA transcript comprising a let-7 target sequence, and
inhibiting expression from that transcript where the target
sequence is 5'-AACTATACAACCTACTACCTCA-3' (SEQ ID NO: 9). In some
embodiments, the let-7 miRNA are encoded by DNA compositions
encoding a let-7 pri miRNA, let-7 pre-miRNA, mature let-7 miRNA or
fragments or homologues thereof, or regulatory elements which
express the let-7 miRNA.
[0200] In alternative embodiments, mimetics of let-7 miRNA are
useful in the methods of the present invention. A let-7 mimetic is
any entity or agent that functions as a let-7 miRNA. Examples of
let-7 mimetics are, but not limited to small molecules, proteins,
nucleic acids, ribosomes, aptamers, antibodies, nucleic acid
analogues etc. Nucleic acids let-7 mimetics can also be, for
example, but not limited to, RNA interference-inducing molecules,
for example but not limited to siRNA, dsRNA, stRNA, shRNA and
modified versions thereof, where the RNA interference molecule has
the same function as let-7 miRNA.
[0201] In another aspect of the present invention provide methods
to treat cancers by targeting the cancer stem cells, the method
comprising targeting the cancer stem cell with agents that inhibit
genes and/or their gene products (mRNAs or proteins) which are
normally gene silenced by let-7 miRNA. Such genes are, for example,
genes which comprise a let-7 target sequence within their mRNA. The
let-7 target sequence can be in the 5'UTR, 3'UTR or coding
sequence. Examples of such genes that comprise a let-7 target
sequence, (i.e. genes which have SEQ ID NO:9 or a homologue
thereof) within their mRNA are for example, but not limited to,
RAS, HRAS, KRAS, lin-42, GRB2, hbl-1, daf-12 and pha-4. In some
embodiments, agents inhibit the activity and/or the expression of
genes comprising let-7 target sequence within their mRNA. In some
embodiments, the methods of the present intervention relate to the
treatment of cancers by targeting cancer stem cells, the method
comprising administering a pharmaceutical composition comprising at
least one agent that inhibits the activity and/or the expression of
at least one gene that is gene silenced by let-7 and/or comprises a
let-7 target within their mRNA to a cancer stem cell in therapeutic
effective amount for the treatment of cancer. In such embodiments,
the cancer comprises a cancer stem cell and/or a cell with reduced
or lacking let-7 expression.
[0202] Effective, safe dosages can be experimentally determined in
model organisms and in human trials by methods well known to one of
ordinary skill in the art. The let-7 miRNA and let-7 mimetics in a
pharmaceutical composition can be administered alone or in
combination with adjuvant cancer therapy such as surgery,
chemotherapy, radiotherapy, thermotherapy, immunotherapy, hormone
therapy and laser therapy, to provide a beneficial effect, e.g.
reduce tumor size, reduce cell proliferation of the tumor, inhibit
angiogenesis, inhibit metastasis, or otherwise improve at least one
symptom or manifestation of the disease.
[0203] In some embodiments, the pharmaceutical compositions
comprising let-7 miRNA and/or let-7 are administered to cells in
vivo and in vitro. The in vivo administration as used herein means
delivery of the let-7 miRNA and let-7 mimetics into a living
subject, including human. The in vitro administration as used
herein means delivery of let-7 miRNA and let-7 mimetics into cells
and organs outside a living subject.
Targeting let-7 miRNA and let-7 Mimetics
[0204] In another embodiment of the invention miRNA and/or miRNA
mimetics, for example let-7 miRNA and/or let-7 mimetics are
targeted to specific cells, for example cancer stem cells in order
minimize or avoid any undesired potential side effects of let miRNA
and/or let-7 mimetic. In such embodiments, the methods of the
present invention provide means to target cancer stem cells
specifically, because these cancer stem cells typically express a
variety of specific proteins on their surface and thus can be
targeted. In some embodiments, the miRNA and/or let-7 mimetics can
be fused to a cell targeting moiety or protein, as disclosed in the
International Patent Application PCT/US05/029111 which is
incorporated herein in its entirety by reference.
[0205] In such embodiments, the target moiety specifically brings
the delivery system to the target cell. The particular target
moiety for delivering the interference RNAs, including let-7 miRNAs
and let-7 mimetic, can be determined empirically based upon the
present disclosure and depending upon the target cell. For example,
with somatic cell therapy in vivo with readily accessible cells or
tissues such as an intravascular target, immune cell target or the
like, the important attributes of the target moiety are affinity
and selectivity.
[0206] In some embodiments of the present invention, the miRNA and
siRNA are delivered to a limited number of cells thereby limiting,
for example, potential side effects of therapies using siRNA. The
particular cell surface targets that are chosen for the targeting
moiety will depend upon the target cell. Cells can be specifically
targeted, for example, by use of antibodies against unique
proteins, lipids or carbohydrates that are present on the cell
surface. A skilled artisan can readily determine such molecules
based on the general knowledge in the art.
[0207] The strategy for choosing the targeting moiety is very
adaptable. For example, any cell-specific antigen, including
proteins, carbohydrates and lipids can be used to create an
antibody that can be used to target the miRNA and siRNA to a
specific cell type according to the methods described herein. For
example, certain tumors frequently possess a large amount of a
particular cell surface receptor (e.g. neu with breast cancers), or
an abnormal form of a particular protein. Therefore, a tumor
antigen can serve as a specific target to deliver siRNA into the
tumor cells to inhibit growth and/or proliferation of the cell or
to destroy the cell. Any known tumor antigen expressed on the tumor
cell surface can be used for generating an antibody to serve as a
targeting moiety.
[0208] For example, tumor antigens useful according to the present
invention include, but are not limited to, mini-MUC; MUC-1
(Marshall et al., J. CLin. Oncol. 18:3964-73 (2000); HER2/neu; HER2
receptor (U.S. Pat. No. 5,772,997); mammoglobulin (U.S. Pat. No.
5,922,836); labyrinthin (U.S. Pat. No. 6,166,176); SCP-1 (U.S. Pat.
No. 6,140,050); NY-ESO-1 (U.S. Pat. No. 6,140,050); SSX-2 (U.S.
Pat. No. 6,140,050); N-terminal blocked soluble cytokeratin (U.S.
Pat. No. 4,775,620); 43 kD human cancer antigen (U.S. Pat. No.
6,077,950); human tumor associated antigen (PRAT) (U.S. Pat. No.
6,020,478); human tumor associated antigen (TUAN) (U.S. Pat. No.
5,922,566); L6 antigen (U.S. Pat. No. 5,597,707); carcinoembryonic
antigen (RT-PCR analysis for breast cancer prognosis in Clin Cancer
Res 6:4176-85, 2000); CA15-3 (Eur J Gynaecol Oncol 21:278-81,
2000); oncoprotein 18/stathmin (Op18) (Br J. Cancer 83:311-8,
2000); human glandular kallikrein (hK2) (Breast Cancer Res Treat
59:263-70, 2000); NY--BR antigens (Cancer Immun. Mar 30; 1:4,
2001), tumor protein D52 (Cancer Immun. Mar 30; 1:4, 2001), and
prostate-specific antigen (Breast Cancer Res Treat 59:263-70,
2000); and EEA.
[0209] In some embodiments, the tumor antigens useful for targeting
the let-7 miRNA and mimetics thereof are CD44, CD133, ABC7, c-kit,
or SCA1.
[0210] In other embodiments, the let-7 miRNA and/or let-7 mimetics
of the present invention can be targeted to other receptors of
interest, for example but not limited to include those for
lymphokines such as interleukins and interferons, for example, the
interleukin-2 (IL-2) receptor (IL-2R). The p55, IL-2R alpha chain,
also referred to as the Tac protein, is associated with Ag or
mitogen-activated T-cells but not resting T-cells. It is expressed
in high levels on malignant cells of lymphoid cancers such as adult
T-cell leukemia, cutaneous T-cell lymphoma and Hodgkin's disease.
The anti-Tac antibody will bind to this protein. Humanized version
of such antibodies are known and described in Queen, C., et al.,
Proc. Natl. Acad. Sci. USA:10029-10039 (1989); Hakimi, J., et al.,
J. of Immun. 151:1075-1085 (1993) (Mik.beta.1 which is a Mab
against IL-2R.beta. chain); Kreitman, R. J., et al., J. of Immun.
149:2810-2815 (1992); Hakimi, J., et al., J. of Immun.
147:1352-1359 (1991). Antibodies to these various proteins are
known and available. These antibodies can readily be adapted for
use in this system by following the general procedures described
herein, and substituting the gene coding for the desired binding
site for the exemplified gene.
[0211] In another embodiment, let-7 miRNA and/or let-7 mimetics of
the present invention can be targeted the using single chain
antibody fragment, ML39 scFv, that recognizes the ErbB2 receptor
(Li et al. "Single-chain antibody-mediated gene delivery into
ErbB2-positive human breast cancer cells" Cancer Gene Ther. 2001;
8:555-65; also Song Nature Biotech 2005). ML39 scFV recognizes the
ErbB2 receptor and as such is useful as a targeting moiety in the
methods of the present invention for targeting and delivery to
cells expressing ErbB2, for example, breast cancer cells. Methods
for producing a fusion protein containing an ML39 scFv targeting
moiety are described below and in Li et al. 2001 (supra). Other
useful single chain antibody fragment to target the let-7 miRNA and
RNA interference molecules of the present invention are a single
chain antibody fragment to the transferrin receptor described in,
for example, Xu et al. (Mol Cancer Ther. 2002, 1(5):337-46) and the
single chain antibody fragment recognizing prostate specific
membrane antigen described in, for example, Li et al. (Intl J
Oncology. 2003, 23: 1329-1332). Any antibody with a known sequence
can be used to prepare a similar construct as described above, and
any method to prepare such a construct is commonly known in the
art.
Delivery of let-7 miRNA or let-7 Mimetics
[0212] In one embodiment, a vector encoding let-7 miRNA and/or a
let-7 mimetic is delivered into a specific target cell. Nucleic
acid sequences necessary for expression in prokaryotes usually
include a promoter, an operator (optional), often along with other
sequences. Eukaryotic cells are known to utilize promoters,
enhancers, and termination and polyadenylation signals.
[0213] One can also use localization sequences to deliver the
released let-7 miRNA and/or let-7 mimetics intracellularly to a
cell compartment of interest. Typically, the delivery system first
binds to a specific receptor on the cell. Thereafter, the targeted
cell internalizes the delivery system, which is bound to the cell.
For example, membrane proteins on the cell surface, including
receptors and antigens can be internalized by receptor mediated
endocytosis after interaction with the ligand to the receptor or
antibodies. (Dautry-Varsat, A., et al., Sci. Am. 250:52-58 (1984)).
This endocytic process is exploited by the present delivery system.
Because this process may damage the let-7 miRNA or let-7 RNA
interference molecules, for example let-7 siRNA as it is being
internalized, it may be desirable to use a segment containing
multiple repeats of the RNA interference-inducing molecule of
interest. One can also include sequences or moieties that disrupt
endosomes and lysosomes. See, e.g., Cristiano, R. J., et al., Proc.
Natl. Acad. Sci. USA 90:11548-11552 (1993); Wagner, E., et al.,
Proc. Natl. Acad. Sci. USA 89:6099-6103 (1992); Cotten, M., et al.,
Proc. Natl. Acad. Sci. USA 89:6094-6098 (1992).
[0214] In some embodiments, let-7 miRNA and/or let-7 mimetics are
complexed with desired targeting moieties by mixing the let-7 miRNA
or let-7 RNA interference molecules with the targeting moiety in
the presence of complexing agents. Examples of such complexing
agents include, but are not limited to, poly-amino acids;
polyimines; polyacrylates; polyalkylacrylates, polyoxethanes,
polyalkylcyanoacrylates; cationized gelatins, albumins, starches,
acrylates, polyethyleneglycols (PEG) and starches;
polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans,
celluloses and starches. In some embodiments, the complexing agents
include chitosan, N-trimethylchitosan, poly-L-lysine,
polyhistidine, polyornithine, polyspermines, protamine,
polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE),
polyaminostyrene (e.g. p-amino), poly(methylcyanoacrylate),
poly(ethylcyanoacrylate), poly(butylcyanoacrylate),
poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate),
DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide,
DEAE-albumin and DEAE-dextran, polymethylacrylate,
polyhexylacrylate, poly(D,L-lactic acid),
poly(DL-lactic-co-glycolic acid (PLGA), alginate, and
polyethyleneglycol (PEG), and polyethylenimine.
[0215] In alternative embodiments, let-7 miRNA and/or let-7 mimetic
complexing agent is protamine or an RNA-binding domain, such as an
siRNA-binding fragment or nucleic acid binding fragment of
protamine. Protamine is a polycationic peptide with molecular
weight about 4000-4500 Da. Protamine is a small basic nucleic acid
binding protein, which serves to condense the animal's genomic DNA
for packaging into the restrictive volume of a sperm head (Warrant,
R. W., et al., Nature 271:130-135 (1978); Krawetz, S. A., et al.,
Genomics 5:639-645 (1989)). The positive charges of the protamine
can strongly interact with negative charges of the phosphate
backbone of nucleic acid, such as RNA, resulting in a neutral and
stable interference RNA-protamine complex.
[0216] In one embodiment, the protamine fragment is encoded by a
nucleic acid sequence disclosed in International Patent
Application: PCT/US05/029111, which is incorporated herein in its
entirety by reference. The methods, reagents and references that
describe a preparation of a nucleic acid-protamine complex in
detail are disclosed in the U.S. Patent Application Publication
Nos. US2002/0132990 and US2004/0023902, and are herein incorporated
by reference in their entirety.
[0217] In some embodiments, a binding domain is used to complex the
targeting moiety to the let-7 miRNA and/or let-7 mimetic. In some
embodiments, the binding domain is selected from the nucleic acid
binding domains present in proteins selected from the group
consisting of GCN4, Fos, Jun, TFIIS, FMRI, yeast protein HX,
Vigillin, Mer1, bacterial polynucleotide phosphorylase, ribosomal
protein S3, and heat shock protein.
Administration
[0218] In one aspect, the invention provides methods of
administering any of the let-7 miRNA and/or let-7 mimetics
described herein to a subject. When administered, the let-7 miRNA
and/or let-7 mimetics are applied in a therapeutically effective,
pharmaceutically acceptable amount as a pharmaceutically acceptable
formulation.
[0219] A therapeutically effective amount can be determined on an
individual basis and will be based, at least in part, on
consideration of the species of mammal, the mammal's age, sex,
size, and health; the compound and/or composition used, the type of
delivery system used; the time of administration relative to the
severity of the disease; and whether a single, multiple, or
controlled-release dose regimen is employed. A therapeutically
effective amount can be determined by one of ordinary skill in the
art employing such factors and using no more than routine
experimentation.
[0220] In administering the systems and methods of the invention to
a subject, dosing amounts, dosing schedules, routes of
administration, and the like may be selected so as to affect known
activities of these systems and methods. Dosage may be adjusted
appropriately to achieve desired drug levels, local or systemic,
depending upon the mode of administration. The doses may be given
in one or several administrations per day. As one example, if daily
doses are required, daily doses may be from about 0.01 mg/kg/day to
about 1000 mg/kg/day, and in some embodiments, from about 0.1 to
about 100 mg/kg/day or from about 1 mg/kg/day to about 10
mg/kg/day. Parenteral administration, in some cases, may be from
one to several orders of magnitude lower dose per day, as compared
to oral doses. For example, the dosage of an active compound when
parenterally administered may be between about 0.1
micrograms/kg/day to about 10 mg/kg/day, and in some embodiments,
from about 1 microgram/kg/day to about 1 mg/kg/day or from about
0.01 mg/kg/day to about 0.1 mg/kg/day. In some embodiments, the
concentration of the active compound(s), if administered
systemically, is at a dose of about 1.0 mg to about 2000 mg for an
adult of kg body weight, per day. In other embodiments, the dose is
about 10 mg to about 1000 mg/70 kg/day. In yet other embodiments,
the dose is about 100 mg to about 500 mg/70 kg/day. Preferably, the
concentration, if applied topically, is about 0.1 mg to about 500
mg/gm of ointment or other base, more preferably about 1.0 mg to
about 100 mg/gm of base, and most preferably, about 30 mg to about
70 mg/gm of base. The specific concentration partially depends upon
the particular composition used, as some are more effective than
others. The dosage concentration of the composition actually
administered is dependent at least in part upon the particular
physiological response being treated, the final concentration of
composition that is desired at the site of action, the method of
administration, the efficacy of the particular composition, the
longevity of the particular composition, and the timing of
administration relative to the severity of the disease. Preferably,
the dosage form is such that it does not substantially
deleteriously affect the mammal. The dosage can be determined by
one of ordinary skill in the art employing such factors and using
no more than routine experimentation. In the event that the
response of a particular subject is insufficient at such doses,
even higher doses (or effectively higher doses by a different, more
localized delivery route) may be employed to the extent that
subject tolerance permits. Multiple doses per day are also
contemplated in some cases to achieve appropriate systemic levels
within the subject or within the active site of the subject. In
some cases, dosing amounts, dosing schedules, routes of
administration, and the like may be selected as described herein,
whereby therapeutically effective levels for the treatment of
cancer are provided.
[0221] In certain embodiments where cancers are being treated,
let-7 miRNA and/or let-7 mimetics of the invention may be
administered to a subject who has a family history of cancer, or to
a subject who has a genetic predisposition for cancer, for example
breast cancer. In other embodiments, let-7 miRNA and/or let-7
mimetics are administered to a subject who has reached a particular
age, or to a subject more likely to get cancer. In yet other
embodiments, the let-7 miRNA and/or let-7 mimetics are administered
to subjects who exhibit symptoms of cancer (e.g., early or
advanced). In still other embodiments, the composition may be
administered to a subject as a preventive measure.
[0222] In some embodiments, the inventive composition may be
administered to a subject based on demographics or epidemiological
studies, or to a subject in a particular field or career. In some
embodiments, the miRNA and/or miRNA mimetic, for example let-7 or
let-7 mimetic are administered to a subject that has had a prior
therapy, for example cancer therapy. Examples of such therapies
include, but are not limited to, surgery, chemotherapy,
radiotherapy, thermotherapy, immunotherapy, hormone therapy and
laser therapy.
[0223] Administration of let-7 miRNA and/or let-7 mimetics of the
invention to a subject may be accomplished by any medically
acceptable method which allows the composition to reach its target.
The particular mode selected will depend of course, upon factors
such as those previously described, for example, the particular
composition, the severity of the state of the subject being
treated, the dosage required for therapeutic efficacy, etc. As used
herein, a "medically acceptable" mode of treatment is a mode able
to produce effective levels of the active compound(s) of the
composition within the subject without causing clinically
unacceptable adverse effects.
[0224] The methods to deliver let-7 miRNA and mimetics thereof to
the cell or subject useful in the present invention are well known
in the art, and include chemical transfection using lipid-based,
amine based and polymer based techniques, viral vectors and
combinations thereof (see, for example, products from Ambion Inc.,
Austin, Tex.; and Novagen, EMD Biosciences, Inc, an Affiliate of
Merck KGaA, Darmstadt, Germany).
[0225] Other described ways to deliver miRNA and/or miRNA mimetics
is from vectors, such as lentiviral constructs, and introducing
siRNA molecules into cells using electroporation. However, feline
FIV lentivirus vectors which are based on the feline
immunodeficiency virus (FIV) retrovirus and the HIV lentivirus
vector system, which is based on the human immunodeficiency virus
(HIV), carry with them problems related to permanent integration.
Electroporation is also useful in the present invention, although
it is generally only used to deliver siRNAs into cells in
vitro.
[0226] The target cell types to which miRNA and/or miRNA mimetics
can be delivered using the methods of the invention include
eukaryotic cells including, but not limited to hepatocytes,
myocytes, neural cells, lipocytes, lymphocytes, macrophages,
cardiac cells, endothelial cells, epithelial cells, and the like.
In one embodiment, the target cell type is a tumor cell or a cancer
cell including, but not limited to, a lung cancer cell, retinal
cancer cell, breast cancer cell, ovarian cancer cell, prostate
cancer cell, head and neck cancer cell, lymphoma cell, melanoma
cell, glioma cell, bladder cancer cell, genital-urinary cancer
cell, stomach cancer cell, pancreatic cancer cell, liver cancer
cell, kidney cancer cell, gastrointestinal cancer and the like. In
some embodiments, the target cells are cancer stem cells. In
alternative embodiments, the target cells are selected from the
group consisting of human lymphocytes, human dendritic cells, human
adult stem cells and embryonic stem cells.
[0227] In one embodiment, the nucleic acid encoding a miRNA and/or
miRNA mimetics, for example let-7 miRNA or mimetic thereof is
present on a vector. These vectors include a sequence encoding
mature let-7 microRNA and in vivo expression elements. In some
embodiments, these vectors include a sequence encoding let-7
pre-miRNA and in vivo expression elements such that the let-7
pre-miRNA is expressed and processed in vivo into a mature let-7
miRNA. In another embodiment, these vectors include a sequence
encoding the let-7 pri-miRNA gene and in vivo expression elements.
In this embodiment, the primary transcript is first processed to
produce the stem-loop precursor miRNA molecule. The stem-loop
precursor is then processed to produce the mature let-7
microRNA.
[0228] In some embodiments, the miRNA and/or miRNA mimetics, for
example let-7 and let-7 mimetics can be delivered in vivo and in
vitro. The in vivo delivery as used herein means delivery of the
miRNA and/or miRNA mimetic, for example let-7 and let-7 mimetic
into a living subject, including human. The in vitro delivery as
used herein means delivery of miRNA and/or miRNA mimetic, for
example let-7 and let-7 mimetic into cells and organs outside a
living subject.
[0229] Vectors include, but are not limited to, plasmids, cosmids,
phagemids, viruses, other vehicles derived from viral or bacterial
sources that have been manipulated by the insertion or
incorporation of the nucleic acid sequences for producing the
microRNA, and free nucleic acid fragments which can be attached to
these nucleic acid sequences. Viral and retroviral vectors are a
preferred type of vector and include, but are not limited to,
nucleic acid sequences from the following viruses: retroviruses,
such as: Moloney murine leukemia virus; Murine stem cell virus,
Harvey murine sarcoma virus; marine mammary tumor virus; Rous
sarcoma virus; adenovirus; adeno-associated virus; SV40-type
viruses; polyoma viruses; Epstein-Ban viruses; papilloma viruses;
herpes viruses; vaccinia viruses; polio viruses; and RNA viruses
such as any retrovirus. One of skill in the art can readily employ
other vectors known in the art.
[0230] Viral vectors are generally based on non-cytopathic
eukaryotic viruses in which non-essential genes have been replaced
with the nucleic acid sequence of interest. Non-cytopathic viruses
include retroviruses, the life cycle of which involves reverse
transcription of genomic viral RNA into DNA with subsequent
proviral integration into host cellular DNA.
[0231] Retroviruses have been approved for human gene therapy
trials. Genetically altered retroviral expression vectors have
general utility for the high efficiency transduction of nucleic
acids in viva. Standard protocols for producing
replication-deficient retroviruses (including the steps of
incorporation of exogenous genetic material into a plasmid,
transfection of a packaging cell lined with plasmid, production of
recombinant retroviruses by the packaging cell line, collection of
viral particles from tissue culture media, and infection of the
target cells with viral particles) are provided in Kriegler, M.,
"Gene Transfer and Expression, A Laboratory Manual," W.H. Freeman
Co., New York (1990) and Murry, E. J. Ed. "Methods in Molecular L
Biology," vol. 7, Humana Press, Inc., Cliffton, N.J. (1991).
[0232] In some embodiments the "in vivo expression elements" are
any regulatory nucleotide sequence, such as a promoter sequence or
promoter-enhancer combination, which facilitates the efficient
expression of the nucleic acid to produce the microRNA. The in vivo
expression element may, for example, be a mammalian or viral
promoter, such as a constitutive or inducible promoter and/or a
tissue specific promoter. Examples of which are well known to one
of ordinary skill in the art. Constitutive mammalian promoters
include, but are not limited to, polymerase promoters as well as
the promoters for the following genes: hypoxanthine phosphoribosyl
transferase (HPTR), adenosine deaminase, pyruvate kinase, and
beta.-actin. Exemplary viral promoters which function
constitutively in eukaryotic cells include, but are not limited to,
promoters from the simian virus, papilloma virus, adenovirus, human
immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus,
the long terminal repeats (LTR) of moloney leukemia virus and other
retroviruses, and the thymidine kinase promoter of herpes simplex
virus. Other constitutive promoters are known to those of ordinary
skill in the art. Inducible promoters are expressed in the presence
of an inducing agent and include, but are not limited to,
metal-inducible promoters and steroid-regulated promoters. For
example, the metallothionein promoter is induced to promote
transcription in the presence of certain metal ions. Other
inducible promoters are known to those of ordinary skill in the
art.
[0233] Examples of tissue-specific promoters include, but are not
limited to, the promoter for creatine kinase, which has been used
to direct expression in muscle and cardiac tissue and
immunoglobulin heavy or light chain promoters for expression in B
cells. Other tissue specific promoters include the human smooth
muscle alpha-actin promoter. Exemplary tissue-specific expression
elements for the liver include but are not limited to HMG-COA
reductase promoter, sterol regulatory element 1, phosphoenol
pyruvate carboxy kinase (PEPCK) promoter, human C-reactive protein
(CRP) promoter, human glucokinase promoter, cholesterol L 7-alpha
hydroylase (CYP-7) promoter, beta-galactosidase alpha-2,6
sialylkansferase promoter, insulin-like growth factor binding
protein (IGFBP-1) promoter, aldolase B promoter, human transferrin
promoter, and collagen type I promoter. Exemplary tissue-specific
expression elements for the prostate include but are not limited to
the prostatic acid phosphatase (PAP) promoter, prostatic secretory
protein of 94 (PSP 94) promoter, prostate specific antigen complex
promoter, and human glandular kallikrein gene promoter (hgt-1).
Exemplary tissue-specific expression elements for gastric tissue
include but are not limited to the human H+/K.sup.+-ATPase alpha
subunit promoter. Exemplary tissue-specific expression elements for
the pancreas include but are not limited to pancreatitis associated
protein promoter (PAP), elastase 1 transcriptional enhancer,
pancreas specific amylase and elastase enhancer promoter, and
pancreatic cholesterol esterase gene promoter. Exemplary
tissue-specific expression elements for the endometrium include,
but are not limited to, the uteroglobin promoter. Exemplary
tissue-specific expression elements for adrenal cells include, but
are not limited to, cholesterol side-chain cleavage (SCC) promoter.
Exemplary tissue-specific expression elements for the general
nervous system include, but are not limited to, gamma-gamma enolase
(neuron-specific enolase, NSE) promoter. Exemplary tissue-specific
expression elements for the brain include, but are not limited to,
the neurofilament heavy chain (NF--H) promoter. Exemplary
tissue-specific expression elements for lymphocytes include, but
are not limited to, the human CGL-1/granzyme B promoter, the
terminal deoxy transferase (TdT), lambda 5, VpreB, and lck
(lymphocyte specific tyrosine protein kinase p561ck) promoter, the
humans CD2 promoter and its 3' transcriptional enhancer, and the
human NK and T cell specific activation (NKG5) promoter. Exemplary
tissue-specific expression elements for the colon include, but are
not limited to, pp60c-src tyrosine kinase promoter, organ-specific
neoantigens (OSNs) promoter, and colon specific antigen-P
promoter.
[0234] In some embodiments, tissue-specific expression elements for
breast cells include, but are not limited to, the human
alpha-lactalbumin promoter. Exemplary tissue-specific expression
elements for the lung include, but are not limited to, the cystic
fibrosis transmembrane conductance regulator (CFTR) gene
promoter.
[0235] Other elements aiding specificity of expression in a tissue
of interest can include secretion leader sequences, enhancers,
nuclear localization signals, endosmolytic peptides, etc.
Preferably, these elements are derived from the tissue of interest
to aid specificity. In general, the in vivo expression element
shall include, as necessary, 5' non-transcribing and 5'
non-translating sequences involved with the initiation of
transcription. They optionally include enhancer sequences or
upstream activator sequences.
[0236] let-7 miRNA or let-7 mimetics, either alone, expressed as a
viral vector or complexed to targeting moieties can be delivered
using any delivery system such as topical administration,
subcutaneous, intramuscular, intraperitoneal, intrathecal and
intravenous injections, catheters for delivering the miRNA and
miRNA mimetic, for example let-7 and/or let-7 mimetic into, for
example, a specific organ, such as breast, brain, liver, heart or
kidneys, or into, for example, a specific location having a cancer
stem cell, and/or affected with malignant growth or cancer. The
let-7 miRNA or let-7 mimetics, either alone or complexed to
targeting moieties can also be administered vaginally.
[0237] A pharmaceutically acceptable carrier as used herein means
any pharmaceutically acceptable means to mix and/or deliver let-7
miRNA and/or let-7 mimetics, either alone or complexed to targeting
moieties to a subject, or in combination with one or more
pharmaceutically acceptable ingredients.
[0238] In the preparation of pharmaceutical formulations containing
let-7 miRNA and/or let-7 mimetics, either alone or complexed to
targeting moieties of the present invention in the form of dosage
units for oral administration the compound selected may be mixed
with solid, powdered ingredients, such as lactose, saccharose,
sorbitol, mannitol, starch, arnylopectin, cellulose derivatives,
gelatin, or another suitable ingredient, as well as with
disintegrating agents and lubricating agents such as magnesium
stearate, calcium stearate, sodium stearyl fumarate and
polyethylene glycol waxes. The mixture is then processed into
granules or pressed into tablets.
[0239] Soft gelatin capsules may be prepared with capsules
containing a mixture of the active compound or compounds of the
invention in vegetable oil, fat, or other suitable vehicle for soft
gelatin capsules. Hard gelatin capsules may contain granules of the
active compound. Hard gelatin capsules may also contain let-7 miRNA
and/or let-7 mimetics, either alone or complexed to targeting
moieties in combination with solid powdered ingredients such as
lactose, saccharose, sorbitol, mannitol, potato starch, corn
starch, arnylopectin, cellulose derivatives or gelatin.
[0240] Dosage units for rectal or vaginal administration may be
prepared (i) in the form of suppositories which contain the active
substance, i.e. let-7 miRNA and/or let-7 mimetics, either alone or
complexed to targeting moieties, mixed with a neutral fat base;
(ii) in the form of a gelatin rectal capsule which contains the
active substance in a mixture with a vegetable oil, paraffin oil or
other suitable vehicle for gelatin rectal capsules; (iii) in the
form of a ready-made micro enema; or (iv) in the form of a dry
micro enema formulation to be reconstituted in a suitable solvent
just prior to administration.
[0241] Liquid preparations for oral administration may be prepared
in the form of syrups or suspensions, e.g. solutions or suspensions
containing from 0.2% to 20% by weight of the active ingredient and
the remainder consisting of sugar or sugar alcohols and a mixture
of ethanol, water, glycerol, propylene glycol and polyethylene
glycol. If desired, such liquid preparations may contain coloring
agents, flavoring agents, saccharin and carboxymethyl cellulose or
other thickening agents. Liquid preparations for oral
administration may also be prepared in the form of a dry powder to
be reconstituted with a suitable solvent prior to use.
[0242] Solutions for parenteral administration may be prepared as a
solution of a compound of the invention in a pharmaceutically
acceptable solvent, preferably in a concentration from 0.1% to 10%
by weight. These solutions may also contain stabilizing ingredients
and/or buffering ingredients and are dispensed into unit doses in
the form of ampoules or vials. Solutions for parenteral
administration may also be prepared as a dry preparation to be
reconstituted with a suitable solvent extemporaneously before
use.
[0243] The methods of the present invention to also encompass
delivery of let-7 miRNA and/or let-7 mimetics, either alone or
complexed to targeting moieties orally in granular form including
sprayed dried particles, or complexed to form micro or
nanoparticles.
[0244] The subject or individual as referred to herein and
throughout the specification includes mammals, such as murine,
specifically mice and rats, bovine, and primates, such as
human.
[0245] Other oral let-7 miRNA and/or let-7 mimetics for use with
the invention include solutions or suspensions in aqueous or
non-aqueous liquids such as a syrup, an elixir, or an emulsion. In
another set of embodiments, the let-7 miRNA and/or let-7 mimetics
may be used to fortify a food or a beverage.
[0246] Injections can be e.g., intravenous, intratumoral,
intradermal, subcutaneous, intramuscular, or interperitoneal. The
composition can be injected interdermally for treatment or
prevention of infectious disease, for example. In some embodiments,
the injections can be given at multiple locations. Implantation
includes inserting implantable drug delivery systems, e.g.,
microspheres, hydrogels, polymeric reservoirs, cholesterol
matrixes, polymeric systems, e.g., matrix erosion and/or diffusion
systems and non-polymeric systems, e.g., compressed, fused, or
partially-fused pellets. Inhalation includes administering the
composition with an aerosol in an inhaler, either alone or attached
to a carrier that can be absorbed. For systemic administration, it
may be preferred that the composition is encapsulated in
liposomes.
[0247] In some embodiments, the miRNA or let-7 mimetic and/or
nucleic acid encoding such, for example vectors are provided in a
manner which enables tissue-specific uptake of the agent and/or
nucleic acid delivery system. Techniques include using tissue or
organ localizing devices, such as wound dressings or transdermal
delivery systems, using invasive devices such as vascular or
urinary catheters, and using interventional devices such as stents
having drug delivery capability and configured as expansive devices
or stent grafts.
[0248] let-7 miRNA and/or let-7 mimetics of the invention may also
be delivered using a bioerodible or bioresorbable implant by way of
diffusion, or more preferably, by degradation of the polymeric
matrix. Exemplary synthetic polymers which can be used to form the
biodegradable delivery system include: polyamides, polycarbonates,
polyalkylenes, s polyalkylene glycols, polyalkylene oxides,
polyalkylene terepthalates, polyvinyl alcohols, polyvinyl ethers,
polyvinyl esters, poly-vinyl halides, polyvinylpyrrolidone,
polyglycolides, polysiloxanes, polyurethanes and co-polymers
thereof, alkyl cellulose, hydroxyalkyl celluloses, cellulose
ethers, cellulose esters, nitro celluloses, polymers of acrylic and
methacrylic esters, methyl cellulose, ethyl cellulose,
hydroxypropyl cellulose, lo hydroxy-propyl methyl cellulose,
hydroxybutyl methyl cellulose, cellulose acetate, cellulose
propionate, cellulose acetate butyrate, cellulose acetate
phthalate, carboxylethyl cellulose, cellulose triacetate, cellulose
sulphate sodium salt, poly(methyl methacrylate), poly(ethyl
methacrylate), poly(butylmethacrylate), poly(isobutyl
methacrylate), i poly(hexylmethacrylate), poly(isodecyl
methacrylate), poly(lauryl methacrylate), poly(phenyl
methacrylate), poly(methyl acrylate), poly(isopropyl acrylate),
poly(isobutyl acrylate), poly(octadecyl acrylate), polyethylene,
polypropylene, poly(ethylene glycol), poly(ethylene oxide),
poly(ethylene terephthalate), poly(vinyl alcohols), polyvinyl
acetate, poly vinyl chloride, polystyrene, polyvinylpyrrolidone,
and polymers of lactic; acid and glycolic acid, polyanhydrides,
poly(ortho)esters, poly(butic acid), poly(valeric acid), and
poly(lactide-cocaprolactone), and natural polymers such as alginate
and other polysaccharides including dextran and cellulose,
collagen, chemical derivatives thereof (substitutions, additions of
chemical groups, for example, alkyl, alkylene, hydroxylations,
oxidations, and other modifications routinely made by those skilled
in the art), albumin and other hydrophilic proteins, zein and other
prolamines and 2s hydrophobic proteins, copolymers and mixtures
thereof. In general, these materials degrade either by enzymatic
hydrolysis or exposure to water in vivo, by surface or bulk
erosion. Examples of non-biodegradable polymers include ethylene
vinyl acetate, poly(meth)acrylic acid, polyamides, copolymers and
mixtures thereof.
[0249] Bioadhesive polymers of particular interest include
bioerodible hydrogels described by H. S. Sawhney, C. P. Pathak and
J. A. Hubell in Macromolecules, (1993) i 26:581-587, the teachings
of which are incorporated herein, polyhyaluronic acids, casein,
gelatin, glutin, polyanhydrides, polyacrylic acid, alginate,
chitosan, poly(methyl I methacrylates), poly(ethyl methacrylates),
poly(butylmethacrylate), poly(isobutyl methacrylate),
poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl
methacrylate), poly(phenyl methacrylate), poly(methyl acrylate),
poly(isopropyl acrylate), poly(isobutyl acrylate), and
poly(octadecyl acrylate).
[0250] In certain embodiments of the invention, the administration
of the let-7 miRNA and/or let-7 mimetics of the invention may be
designed so as to result in sequential exposures to the composition
over a certain time period, for example, hours, days, weeks, months
or years. This may be accomplished, for example, by repeated
administrations of let-7 miRNAs and/or let-7 mimetics of the
invention by one of the methods described above, or by a sustained
or controlled release delivery system in which the let-7 miRNA
and/or let-7 mimetics are delivered over a prolonged period without
repeated administrations. Administration of the let-7 miRNA and/or
let-7 mimetics using such a delivery system may be, for example, by
oral dosage forms, bolus injections, transdermal patches or
subcutaneous implants. Maintaining a substantially constant
concentration of the composition may be preferred in some
cases.
[0251] Other delivery systems suitable for use with the present
invention include time release, delayed release, sustained release,
or controlled release delivery systems. Such systems may avoid
repeated administrations in many cases, increasing convenience to;
the subject and the physician. Many types of release delivery
systems are available and known to those of ordinary skill in the
art. They include, for example, polymer-based systems such as
polylactic and/or polyglycolic acids, polyanhydrides,
polycaprolactones, copolyoxalates, polyesteramides,
polyorthoesters, polyhydroxybutyric acid, and/or combinations of
these. Microcapsules of the foregoing polymers containing drugs are
described in, for example, U.S. Pat. No. 5,075,109. Other examples
include nonpolymer systems that are lipid-based including sterols
such as cholesterol, cholesterol esters, and fatty acids or neuka1
fats such as mono-, di- and triglycerides; hydrogel release
systems; liposome-based systems; phospholipid based-systems;
silastic systems; peptide based systems; wax coatings; compressed
tablets using conventional binders and excipients; or partially
fused implants. Specific examples include, but are not limited to,
erosional systems in which the composition is contained in a form
within a matrix (for example, as described in U.S. Pat. Nos.
4,452,775, 4,675,189, 5,736,152, 4,667,014, 4,748,034 and--29
5,239,660), or diffusional systems in which an active component
controls the release rate I (for example, as described in U.S. Pat.
Nos. 3,832,253, 3,854,480, 5,133,974 and 5,407,686). The
formulation may be as, for example, microspheres, hydrogels,
polymeric reservoirs, cholesterol matrices, or polymeric systems.
In some embodiments, s the system may allow sustained or controlled
release of the composition to occur, for example, through control
of the diffusion or erosion/degradation rate of the formulation
containing the composition. In addition, a pump-based hardware
delivery system may be used to deliver one or more embodiments of
the invention.
[0252] Examples of systems in which release occurs in bursts
includes, e.g., systems in which the composition is entrapped in
liposomes which are encapsulated in a polymer matrix, the liposomes
being sensitive to specific stimuli, e.g., temperature, pH, light
or a degrading enzyme and systems in which the composition is
encapsulated by a tonically-coated microcapsule with a microcapsule
core degrading enzyme. Examples of systems in which release of the
inhibitor is gradual and continuous include, e.g., erosional Is
systems in which the composition is contained in a forth within a
matrix and effusional systems in which the composition permeates at
a controlled rate, e.g., through a polymer. Such sustained release
systems can be e.g., in the form of pellets, or capsules.
[0253] Examples of systems in which release occurs in bursts
includes, e.g., systems in which the composition is entrapped in
liposomes which are encapsulated in a polymer matrix, the liposomes
being sensitive to specific stimuli, e.g., temperature, pH, light
or a degrading enzyme and systems in which the composition is
encapsulated by an tonically-coated microcapsule with a
microcapsule core degrading enzyme. Examples of systems in which
release of the inhibitor is gradual and continuous include, e.g.,
erosional systems in which the composition is contained in a form
within a matrix and effusional systems in which the composition
permeates at a controlled rate, e.g., through a polymer. Such
sustained release systems can be e.g., in the form of pellets, or
capsules.
[0254] Use of a long-term release implant may be particularly
suitable in some; embodiments of the invention. "Long-term
release," as used herein, means that the implant containing let-7
miRNA and/or let-7 mimetics are constructed and arranged to deliver
therapeutically effective levels of the composition for at least 30
or 45 days, and preferably at least 60 or days, or even longer in
some cases. Long-term release implants are well known to those of
ordinary skill in the art, and include some of the release systems
described above.
[0255] In some embodiments, the let-7 miRNA and/or let-7 mimetics
of the invention may include pharmaceutically acceptable carriers
with formulation ingredients such as salts, carriers, buffering
agents, emulsifiers, diluents, excipients, chelating agents,
fillers, drying agents, antioxidants, antimicrobials,
preservatives, binding agents, bulking agents, silicas,
solubilizers, or stabilizers that may be used with the active
compound. For example, if the formulation is a liquid, the carrier
may be a solvent, partial solvent, or non-solvent, and may be
aqueous or organically based. Examples of suitable formulation
ingredients--30 include diluents such as calcium carbonate, sodium
carbonate, lactose, kaolin, calcium I phosphate, or sodium
phosphate; granulating and disintegrating agents such as corn
starch or algenic acid; binding agents such as starch, gelatin or
acacia; lubricating agents such as magnesium stearate, stearic
acid, or talc; time-delay materials such as glycerol monostearate
or glycerol distearate; suspending agents such as sodium
carboxymethylcellulose, methylcellulose,
hydroxypropylmethylcellulose, sodium alginate,
polyvinylpyrrolidone; dispersing or wetting agents such as lecithin
or other naturally-occurring phosphatides; thickening agents such
as cetyl alcohol or beeswax; buffering agents such as acetic acid
and salts thereof, citric acid and salts thereof, boric lo acid and
salts thereof, or phosphoric acid and salts thereof; or
preservatives such as benzalkonium chloride, chlorobutanol,
parabens, or thimerosal. Suitable carrier concentrations can be
determined by those of ordinary skill in the art, using no more
than routine experimentation. The compositions of the invention may
be formulated into i preparations in solid, semi-solid, liquid or
gaseous forms such as tablets, capsules, elixirs, powders,
granules, ointments, solutions, depositories, inhalants or
injectables. Those of ordinary skill in the art will know of other
suitable formulation ingredients, or will be able to ascertain
such, using only routine experimentation.
[0256] Preparations include sterile aqueous or nonaqueous
solutions, suspensions and; emulsions, which can be isotonic with
the blood of the subject in certain embodiments. Examples of
nonaqueous solvents are polypropylene glycol, polyethylene glycol,
vegetable oil such as olive oil, sesame oil, coconut oil, arachis
oil, peanut oil, mineral oil, injectable organic esters such as
ethyl oleate, or fixed oils including synthetic mono or
all-glycerides. Aqueous carriers include water, alcoholic/aqueous
solutions, emulsions or suspensions, including saline and buffered
media. Parenteral vehicles include sodium chloride solution,
1,3-butandiol, Ringer's dextrose, dextrose and sodium chloride,
lactated Ringer's or fixed oils. Intravenous vehicles include fluid
and nutrient replenishers, electrolyte replenishers (such as those
based on Ringer's dextrose), and the like. Preservatives and other
additives may also be present such as, for example, antimicrobials,
antioxidants, chelating agents and inert gases and the like. In
addition, so sterile, fixed oils are conventionally employed as a
solvent or suspending medium. For i this purpose any bland fixed
oil may be employed including synthetic mono- or di-glycerides. In
addition, fatty acids such as oleic acid may be used in the
preparation of injectables. Carrier formulation suitable for oral,
subcutaneous, intravenous, intramuscular, etc. administrations can
be found in Remington's Pharmaceutical Sciences, Mack Publishing
Co., Easton, Pa. Those of skill in the art can readily determine
the various parameters for preparing and formulating the
compositions of the invention without resort to undue
experimentation.
[0257] In some embodiments, the present invention encompasses let-7
miRNA and/or let-7 mimetics of the invention in association or
contact with a suitable carrier, which may constitute one or more
accessory ingredients. The final compositions may be prepared by
any suitable technique, for example, by uniformly and intimately
bringing the composition into association with a liquid carrier, a
finely divided solid carrier or both, optionally with one or more
formulation ingredients as previously described, and then, if
necessary, shaping the product. In some embodiments, the
compositions of the present invention may be present as
pharmaceutically acceptable salts. The term "pharmaceutically
acceptable salts" includes salts of the composition, prepared in
combination with, for example, acids or bases, depending on the
particular compounds found within the composition and the treatment
modality desired. Pharmaceutically acceptable salts can be prepared
as; alkaline metal salts, such as lithium, sodium, or potassium
salts, or as alkaline earth salts, such as beryllium, magnesium or
calcium salts. Examples of suitable bases that may be used to form
salts include ammonium, or mineral bases such as sodium hydroxide,
lithium hydroxide, potassium hydroxide, calcium hydroxide,
magnesium hydroxide, and the like. Examples of suitable acids that
may be used to form salts include inorganic or mineral acids such
as hydrochloric, hydrobromic, hydroiodic, hydrofluoric, nitric,
carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric,
dihydrogenphosphoric, sulfuric, monohydrogensulfuric, phosphorous
acids and the like.
[0258] Other suitable acids include organic acids, for example,
acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic,
suberic, fumaric, mandelic, phthalic, benzenesulfonic,
p-tolylsulfonic, citric, tartaric, methanesulfonic, glucuronic,
galacturonic, salicylic, formic, naphthalene-2-sulfonic, and the
like. Still other suitable i acids include amino acids such as
arginate, aspartate, glutamate, and the like.
[0259] Dosages for a particular patient can be determined by one of
ordinary skill in the art using conventional considerations, (e.g.
by means of an appropriate, conventional pharmacological protocol).
A physician may, for example, prescribe a relatively low dose at
first, subsequently increasing the dose until an appropriate
response is obtained. The dose administered to a patient is
sufficient to effect a beneficial therapeutic response in the
patient over time, or, e.g., to reduce symptoms, or other
appropriate activity, depending on the application. The dose is
determined by the efficacy of the particular formulation, and the
activity, stability or serum half-life of the miRNA employed and
the condition of the patient, as well as the body weight or surface
area of the patient to be treated. The size of the dose is also
determined by the existence, nature, and extent of any adverse
side-effects that accompany the administration of a particular
vector, formulation, or the like in a particular subject.
Therapeutic compositions comprising one or more nucleic acids are
optionally tested in one or more appropriate in vitro and/or in
viva animal models of disease, to confirm efficacy, tissue
metabolism, and to estimate dosages, according to methods well
known in the art. In particular, dosages can be initially
determined by activity, stability or other suitable measures of
treatment vs. non-treatment (e.g., comparison of treated vs.
untreated cells or animal models), in a relevant assay.
Formulations are administered at a rate determined by the LD50 of
the relevant formulation, and/or observation of any side-effects of
the nucleic acids at various concentrations, e.g., as applied to
the mass and overall health of the patient. Administration can be
accomplished via single or divided doses.
[0260] In vitro models can be used to determine the effective doses
of the nucleic acids as a potential cancer treatment. Suitable in
vitro models include, but are not limited to, proliferation assays
of cultured tumor cells, growth of cultured tumor cells in soft
agar (see Freshney, (1987) Culture of Animal Cells: A Manual of
Basic Technique, Wily-Liss, New York, N.Y. Ch 18 and Ch 21), tumor
systems in nude mice as described in Giovanella et al., I J. Natl.
Can. Inst., 52: 921-30 (1974), mobility and invasive potential of
tumor cells in Boyden Chamber assays as described in Pilkington et
al., Anticancer Res., 17: 4107-9 (1997), and angiogenesis assays
such as induction of vascularization of the chick chorioallantoic
membrane or induction of vascular endothelial cell migration as
described in Ribatta et al., Intl. J. Dev. Biol., 40: 1189-97
(1999) and Li et al., Clin. Exp. Metastasis, 17:423-9 (1999),
respectively. Suitable tumor cells lines are available, e.g. from
American Type Tissue Culture Collection catalogs.
[0261] In vivo models are the preferred models to determine the
effective doses of nucleic acids described above as potential
cancer treatments. Suitable in vivo models include, but are not
limited to, mice that carry a mutation in the KRAS oncogene
(Lox-Stop-Lox K-RasGi2D mutants, Kras24TYj) available from the
National Cancer Institute (NCI) Frederick Mouse Repository. Other
mouse models known in the art and that are available include but
are not limited to models for breast cancer, gastrointestinal
cancer, hematopoietic cancer, lung cancer, mammary gland cancer,
nervous system cancer, ovarian cancer, prostate cancer, skin
cancer, cervical cancer, oral cancer, and sarcoma cancer (see
http://emice.nci.nih. gov/mouse_models/).
[0262] In determining the effective amount of the miRNA and mimetic
thereof, for example let-7 and let-7 mimetic to be administered in
the treatment or prophylaxis of disease the physician evaluates
circulating plasma levels, formulation toxicities, and progression
of the disease.
[0263] The dose administered to a 70 kilogram subject is typically
in the range equivalent to dosages of currently-used therapeutic
antisense oligonucleotides such as Vikavene (fomivirsen sodium
injection) which is approved by the FDA for treatment of
cytomegaloviral RNA, adjusted for the altered activity or serum
half-life of the relevant composition.
[0264] In some embodiments, the miRNA and miRNA mimetic, for
example let-7 miRNA and/or mimetics thereof of the present
invention described herein can supplement the treatment of any
known additional therapy, including, but not limited to, antibody
administration, vaccine administration, administration of cytotoxic
agents, natural amino acid polypeptides, nucleic acids, nucleotide
analogues, and biologic response modifiers. In some embodiments,
additional therapy is, for example, surgery, chemotherapy,
radiotherapy, thermotherapy, immunotherapy, hormone therapy and
laser therapy. In some embodiments, the additional therapy is
chemotherapy. Two or more combined compounds may be used together
or sequentially with miRNAs or miRNA mimetics, for example the
let-7 miRNA and/or let-7 mimetics of the present invention. The
let-7 miRNA and/or let-7 mimetics can be administered before the
additional therapy, after the additional therapy or at the same
time as the additional therapy. In some embodiments, the let-7
miRNA and let-7 mimetics are administered a plurality of times, and
in other embodiments, the additional therapies are also
administered a plurality of times.
[0265] In some embodiments of the invention miRNA and/or miRNA
mimetics, for example, nucleic acids encoding the let-7 miRNA and
let-7 mimetics can also be administered in therapeutically
effective amounts as a portion of an anti-cancer cocktail. An
anti-cancer cocktail is a mixture, for example of a least one let-7
miRNA and/or let-7 mimetic of the present invention with one or
more additional anti-cancer agents in addition to a
pharmaceutically acceptable carrier for delivery. The use of
anti-cancer cocktails as a cancer treatment is routine. Anti-cancer
agents that are well known in the art and can be used as a
treatment in combination with the let-7 miRNA and mimetics thereof
as described herein include, but are not limited to: Actinomycin D,
Aminoglutethimide, Asparaginase, Bleomycin, Busulfan, Carboplatin,
Carmustine, Chlorambucil, Cisplatin (cis-DDP), Cyclophosphamide,
Cytarabine HCl (Cytosine arabinoside), Dacarbazine, Dactinomycin,
Daunorubicin HCl, Doxorubicin HCl, Estramustine phosphate sodium,
Etoposide (V16-213), Flosuridine, S-Fluorouracil (5-Fu), Flutamide,
Hydroxyurea (hydroxycarb amide), Ifosfamide, Interferon Alpha-2 a,
Interferon Alpha-2b, Leuprolide acetate (LHRH-releasing factor
analog), Lomustine, Mechlorethamine HCl (nitrogen mustard),
Melphalan, Mercaptopurine, Mesna, Methotrexate (MTX), Mitomycin,
Mitoxantrone HCl, Ockeotide, Paclitaxel; Plicamycin, Procarbazine
HCl, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa,
Vinblastine sulfate, Vincristine sulfate, Amsacrine, Azacitidine,
Hexamethylmelamine, Interleukin-2, Mitoguazone, Pentostatin,
Semustine, Teniposide, and Vindesine sulfate, and analogues
thereof.
[0266] In certain embodiments, the pharmaceutical compositions
comprising miRNA and/or miRNA mimetics, for example, pharmaceutical
compositions comprising let-7 miRNA and/or let-7 mimetics can
optionally further comprise one or more additional therapies or
agents. In certain embodiments, the additional agent or agents are
anti-cancer agents. In some embodiments, the therapeutic agents are
chemotherapeutic agents, for example cisplatin, paxicital etc. In
some embodiments, the therapeutic agents are radiotherapeutic
agents. Examples of chemotherapeutic agents in the pharmaceutical
compositions of this invention are, for example nitrogen mustards
such as cyclophosphamide, ifosfamide, and melphalan; ethylenimines
and methylmelamines such as hexamethylmelamine and thiotepa;
pyrimidine analogs such as fluorouracil and fluorodeoxyuridine;
vinca alkaloids such as vinblastine; epipodophyllotoxins such as
etoposide and teniposide; antibiotics such as actinomycin D,
doxorubicin, bleomycin, and mithramycin; biological response
modifiers such as interferon, platinum coordination complexes such
as cisplatin and carboplatin; estrogens such as diethylstilbestrol
and ethinyl estradiol; antiandrogens such as flutamine; and
gonadotropin releasing hormone analogs such as leuprolide. Other
compounds such as decarbazine, nitrosoureas, methotrexate,
diticene, and procarbazine are also effective. Of course, other
chemotherapeutic agents which are known to those of ordinary skill
in the art can readily be substituted as this list should not be
considered exhaustive or limiting.
[0267] In some embodiments, the let-7 miRNA is administered to a
subject with other anti-cancer therapies, for example cancer
therapies to which the cancer was previously resistant or
refractory.
Diseases to be Treated with let-7 miRNA and let-7 Mimetics
[0268] The invention provides methods for the treatment of any
disease or disorder characterized by lack or reduced expression of
let-7. In some embodiments, the disease is cancer. In some
embodiments, the cancer comprises cancer stem cells. Cancer
treatments promote tumor regression by inhibiting tumor cell
proliferation, inhibiting angiogenesis (growth of new blood vessels
that is necessary to support tumor growth) and/or prohibiting
metastasis by reducing tumor cell motility or invasiveness. The
effect of let-7 miRNA and let-7 mimetics on inhibiting cancer as
disclosed herein and in the Examples is expected to be a general
effect on cancer stem cells. That is, where a tumor of any type has
a cancer stem cell, one would expect the approach as disclosed
herein for using let-7 miRNA or let-7 mimetics thereof for the
treatment and/or prevention of cancer to work. In particular, the
methods and compositions as disclosed herein are likely to work in
a subject that has any form of cancer where the cancer comprises
cancer stem cells with a reduced level of let-7 miRNA as compared
to non-stem cancer cells.
[0269] The therapeutic formulations described herein comprising
let-7 miRNA and let-7 mimetics may be effective in adult and
pediatric oncology including in solid phase tumors/malignancies,
locally advanced tumors, human soft tissue sarcomas, metastatic
cancer, including lymphatic metastases, blood cell malignancies
including multiple myeloma, acute and chronic leukemias, and
lymphomas, head and neck cancers including mouth cancer, larynx
cancer and thyroid cancer, lung cancers including small cell
carcinoma and non-small cell cancers, breast cancers including
small cell carcinoma and ductal carcinoma, gastrointestinal cancers
including esophageal cancer, stomach cancer, colon cancer,
colorectal cancer and polyps associated with colorectal neoplasia,
pancreatic cancers, liver cancer, urologic cancers including
bladder cancer and prostate cancer, malignancies of the female
genital tract including ovarian carcinoma, uterine (including
endometrial) cancers, and solid tumor in the ovarian follicle,
kidney cancers including renal cell carcinoma, brain cancers
including intrinsic brain tumors, neuroblastoma, askocytic brain
tumors, gliomas, metastatic tumor cell invasion in the central
nervous system, bone cancers including osteomas, skin cancers
including malignant melanoma, tumor progression of human skin
keratinocytes, squamous cell carcinoma, basal cell carcinoma,
hemangiopericytoma and Kaposi's sarcoma.
[0270] Therapeutic formulations can be administered in
therapeutically effective dosages alone or in combination with
adjuvant cancer therapy such as surgery, chemotherapy,
radiotherapy, thermotherapy, immunotherapy, hormone therapy and
laser therapy, to provide a beneficial effect, e.g. reducing tumor
size, slowing rate of tumor growth, reducing cell proliferation of
the tumor, promoting cancer cell death, inhibiting angiogenesis,
inhibiting metastasis, or otherwise improving overall clinical
condition, without necessarily eradicating the cancer.
[0271] Examples of cancers which can be treated by the methods and
compositions as disclosed herein include, but are not limited to,
bladder cancer; breast cancer; brain cancer including glioblastomas
and medulloblastomas; cervical cancer; choriocarcinoma; colon
cancer including colorectal carcinomas; endometrial cancer;
esophageal cancer; gastric cancer; head and neck cancer;
hematological neoplasms including acute lymphocytic and myelogenous
leukemia, multiple myeloma, AIDS associated leukemias and adult
T-cell leukemia lymphoma; intraepithelial neoplasms including
Bowen's disease and Paget's disease, liver cancer; lung cancer
including small cell lung cancer and non-small cell lung cancer;
lymphomas including Hodgkin's disease and lymphocytic lymphomas;
neuroblastomas; oral cancer including squamous cell carcinoma;
osteosarcomas; ovarian cancer including those arising from
epithelial cells, stromal cells, germ cells and mesenchymal cells;
pancreatic cancer; prostate cancer; rectal cancer; sarcomas
including leiomyosarcoma, rhabdomyosarcoma, liposarcoma,
fibrosarcoma, synovial sarcoma and osteosarcoma; skin cancer
including melanomas, Kaposi's sarcoma, basocellular cancer, and
squamous cell cancer; testicular cancer including germinal tumors
such as seminoma, non-seminoma (teratomas, choriocarcinomas),
stromal tumors, and germ cell tumors; thyroid cancer including
thyroid adenocarcinoma and medullar carcinoma; transitional cancer
and renal cancer including adenocarcinoma and Wilm's tumor. In one
embodiment, the formulations comprising let-7 miRNA and let-7
mimetics are administered for treatment or prevention of breast
cancer. In another embodiment, the formulations comprising let-7
miRNA and/or let-7 mimetics are administered for treatment or
prevention of breast cancer.
[0272] In some embodiments, the formulations comprising let-7 miRNA
and let-7 mimetics are administered for treatment or prevention of
cancers which comprise at least one or a population stem cell
cancer cells. Methods to identify a cancer stem cell are well known
in the art, and include, for example the methods disclosed in U.S
Patent Applications; 2008/0020407, 2007/0254319, 2007/0244046,
2007/0238127, 2007/0238137, 2007/0248628, 2007/0231325,
2007/0134794, and International Patent Applications WO2007147165,
WO2007145901, WO2007145840, WO2007142711, WO2007124125,
WO2007133250, WO2007118242, WO2007112097, WO2007118238,
WO2007053648, WO2003102215, WO2003102215, WO2003050502, and
Eurpoean Patent Applications, EP1726208, EP1697715 and EP1461023,
which are all incorporated herein in their entirety by reference.
Cancer stem cells were first detected in the blood cancer, acute
myeloid leukemia (AML) (Lapidot et al, Nature 77:645-648 (1994)).
More recently it has been demonstrated that malignant human breast
tumors similarly harbor a small, distinct population of cancer stem
cells enriched for the ability to form tumors in immunodeficient
mice. An ESA+, CD44+, CD24-/low, Lin-cell population was found to
be 50-fold enriched for tumorigenic cells compared to
unfractionated tumor cells (Al-Hajj et al, PNAS 700:3983-3988
(2003)).
[0273] In addition, therapeutic let-7 miRNA and let-7 mimetics may
be used for prophylactic treatment of cancer. There are hereditary
conditions and/or environmental situations (e.g. exposure to
carcinogens) known in the art that predispose an individual to
developing cancers. Under these circumstances, it may be beneficial
to treat these individuals with therapeutically effective doses of
the nucleic acids encoding let-7 miRNA and let-7 mimetics to reduce
the risk of developing cancers.
[0274] In one embodiment, the pharmaceutical compositions
comprising let-7 miRNA and/or let-7 mimetics of the present
invention are useful to be administered to a subject who has cancer
regression. In another embodiment, the pharmaceutical compositions
comprising let-7 miRNA and/or let-7 mimetics of the present
invention are useful to be administered to a subject who has a
therapy-resistant cancer, for example a chemotherapy resistant
cancer. In some embodiments, the pharmaceutical compositions
comprising let-7 miRNA and/or let-7 mimetics are useful to be
administered to a subject who has cancer and has been exposed to
adjuvant cancer therapies.
[0275] In another embodiment, the pharmaceutical compositions
comprising let-7 miRNA and/or let-7 mimetics are useful to be
administered to a subject with a malignant cancer. In some
embodiments, the let-7 miRNA and/or let-7 mimetics of the present
invention can be administered to a subject with a cancer or tumor
comprising a cancer stem cell.
[0276] In one embodiment, the subject is assessed if they are at
risk of having a metastasis or malignant cancer, the method
comprising assessing a level of let-7 in a biological sample, and
if the levels of let-7 are below a reference level, the subject is
at risk of having a metastasis or a malignant cancer. In some
embodiments, the biological sample is obtained from a biopsy tissue
sample, and in some embodiments, the sample is from a tumor or
cancer tissue sample. The level of let-7 can be determined by
methods known by the skilled artisan, for example by northern blot
analysis or RT-PCR as disclosed in the Examples. In some
embodiments, the reference level is the level of let-7 that does
not result in malignancy or a malignant cancer. In some
embodiments, the reference level the based on the level of let-7
expression in a normal tissue sample, where in the tissue sample is
a biological tissue sample from a tissue matched, species matched
and age matched biological sample. In some embodiments, the
reference level is based on a reference sample is from a
non-malignant matched tissue sample. In some embodiments, the
reference level is based on a reference sample from a non-stem cell
cancer tissue sample.
[0277] In one embodiment, let-7 miRNA and/or let-7 mimetics in a
suitable formulation may be administered to a subject who has a
family history of cancer, or to a subject who has a genetic
predisposition for cancer. In other embodiments, the nucleic acid
in a suitable formulation is administered to a subject who has
reached a particular age, or to a subject more likely to get
cancer. In yet other embodiments, the nucleic acid in a suitable
formulation is administered to subjects who exhibit symptoms of
cancer (e.g., early or advanced). In still other embodiments, the
nucleic acid in a suitable formulation may be administered to a
subject as a preventive measure. In some embodiments, let-7 miRNA
and let-7 mimetics in a suitable formulation may be administered to
a subject based on demographics or epidemiological studies, or to a
subject in a particular field or career.
Methods to Enrich for Cancer Stem Cells
[0278] One aspect of the present invention provides methods for the
enrichment of cancer stem cells. Such methods can provide
populations of cancer stem cells for the study of anti-tumor
therapies or tumor development or for screening anti-tumor agents.
Such cells can also be useful to identify miRNAs or other gene
products that correlate with or confer "stemness" to such cells
(see below). In such an embodiment, the methods comprise repeated
selection for cancer stem cells by sequential transplantation of
cancer cells and tumor formation under the selective pressure of
low dose cancer therapy. The term "low dose" means a dose of
chemotherapy that is used below the dose which is typically
clinically administered as a treatment to eradicate a tumor in a
subject. The term low dose also refers to a dose of the
chemotherapy agent which is used to keep a cancer from reappearing
or reoccurring, which is often referred in the clinic as a
maintenance dose. In some embodiments, the term low dose is about
half, or less than half, (i.e., <50%, e.g., .gtoreq.45%,
.gtoreq.40%, .gtoreq.35%, .gtoreq.30%, or lower, but generally
greater than 1%) (i.e., 50%) the dose which is normally
administered clinically to treat or eradicate a tumor in a subject.
In some embodiments, the method comprises obtaining cancer cells
and transplanting the cancer cells into a mammal, and administering
a low dose cancer therapy to the mammal for a period of time and
sufficient for the cancer cells to develop into a tumor of a
desired diameter. In some embodiments, the desired diameter of the
tumor is about 2 cm in diameter. Once the desired diameter of the
tumor is reached, the tumor is removed from the mammal and
dissociated into single cells and re-transplanting into another
mammal which is also administered a low dose cancer therapy during
the formation of the tumor of a desired diameter. The process of
tumor formation under low dose cancer therapy and
re-transplantation is repeated a plurality of times. In some
embodiments, the process is repeated 2, 3, 4, 5 up to 10 times, and
in some embodiments the process is repeated more than 10 times. In
some embodiments, on the final removal of the tumor from the
mammal, the tumor is dissociated into single cells and cultured as
embryoid bodies (EBs), herein termed "mammospheres" in the
Examples, which comprise a population of cells enriched for cancer
stem cells.
[0279] In some embodiments, the cancer cells are any cancer cells,
for example cancer cell lines or primary cancer cells obtained from
a subject. In some embodiments, the cancer cells are human cancer
cells. In alternative embodiments, the cancer cells are mammalian,
for example rodent. In some embodiments, the cancer cell is a
breast cancer cell, and in other embodiments the cancer cells can
be from breast cancer, lung cancer, head and neck cancer, bladder
cancer, stomach cancer, cancer of the nervous system, bone cancer,
bone marrow cancer, brain cancer, colon cancer, esophageal cancer,
endometrial cancer, gastrointestinal cancer, genital-urinary
cancer, stomach cancer, lymphomas, melanoma, glioma, bladder
cancer, pancreatic cancer, gum cancer, kidney cancer, retinal
cancer, liver cancer, nasopharynx cancer, ovarian cancer, oral
cancers, bladder cancer, hematological neoplasms, follicular
lymphoma, cervical cancer, multiple myeloma, osteosarcomas, thyroid
cancer, prostate cancer, colon cancer, prostate cancer, skin
cancer, stomach cancer, testis cancer, tongue cancer, or uterine
cancer.
[0280] In some embodiments, the cancer cells are transplanted into
the mammal at the location most suitable for the specific cancer
cell. For example, breast cancer cells are implanted in the mammary
fat pad. In alternative embodiments, the cancer cells are implanted
into brain where the cancer cells are obtained from brain
cancer.
[0281] In some embodiments, the mammal used in the transplantation
is a rodent, and in some embodiments the rodent is a genetically
modified rodent, and in some embodiments the rodent is an
immunocompromised rodent, for example but not limited to a NOD/SCID
mouse.
[0282] In some embodiments the cancer therapy is chemotherapy,
radiotherapy, thermotherapy, immunotherapy, hormone therapy and
laser therapy. In some embodiments, more than one cancer therapy
can be administered, and in some embodiments the cancer therapies
can be administered at the same time or sequentially. In some
embodiments, the cancer therapies can be of different types, for
example one cancer therapy can be a chemotherapeutic agent and one
cancer therapy is a immunotherapy, and in alternative embodiments
the cancer therapies can be of the same types, for example two or
more different chemotherapeutic agents. In some embodiments, the
cancer therapies can be administered to the same mammal and in
anther embodiment they can be administered to different
mammals.
[0283] In some embodiments, administration is performed by any
means and at any frequency intervals for sustained cancer therapy.
For example, in some embodiments, the administration is continuous
administration, and in some embodiments administration is, for
example but not limited to twice a day, every day, every other day,
twice a week, once a week, every other week or once a month. In
some embodiments, administration is intravenous, intradermal,
intramuscular, intraarterial, interlesional, percutaneous,
subcutaneous, intraperitoneal or by aerosol.
[0284] The in vivo delivery as used herein means delivery of the
miRNA and/or miRNA mimetic, for example let-7 and let-7 mimetic
into a living subject, including human. The in vitro delivery as
used herein means delivery of miRNA and/or miRNA mimetic, for
example let-7 and let-7 mimetic into cells and organs outside a
living subject.
[0285] In another embodiment, the present invention provides
methods to identify miRNA that contribute to the self-proliferative
capacity and/or tumorogenicity of cancer stem cells. The method
comprises comparing the miRNA expression profile of a cancer stem
cell, for example a cancer stem cell which has been enriched by the
methods described herein, with the miRNA expression profile of a
reference sample. In some embodiments, a reference is any
biological sample. A difference in the level of expression of a
miRNA in the cancer stem cell sample as compared with the level of
expression of the same miRNA in a reference sample identifies that
the miRNA contributes to, in whole or in part, to the
self-proliferative capacity and/or tumorogenicity of the cancer
stem cell. In this embodiment, the difference in the level of
expression of the miRNA in the cancer stem cell as compared with
the reference level is a statistically significant change, but
generally is at least about 10%, for example, at least about 20%,
or at least about 30%, or at least about 40%, or at least about
50%, or at least about 60%, or at least about 70%, or at least
about 80% or at least about 90%, or at least about 100%, or at
least about 2-fold, or at least about 2.5-fold, or at least about 3
fold, or at least about 5-fold, or at least about 10-fold or more,
or any integer in between a 10% difference and a 10-fold difference
or more.
[0286] In some embodiments, the reference sample is a plurality of
cancer cells, and in some embodiments the cancer cell is a cancer
cell from which the cancer stem cells was derived using the methods
of the present invention or from a cell derived from the cancer
stem cell, for example a differentiated cancer stem cell. A number
of miRNA profiles from reference samples can be compared to the
miRNA profile of the cancer stem cell.
[0287] In further embodiments, the present invention provides
methods to assess the level of contribution of the miRNA identified
to contribute to the cancer stem cell self-proliferative
capability, the method comprising either introducing or inhibiting
the miRNA in the cancer stem cell, depending if the miRNA being
assessed is downregulated or upregulated respectively, in the
cancer stem cell as compared with the reference sample.
[0288] In some embodiments, a cancer stem cell's self-proliferative
capacity is determined by the ability of the cancer stem cell to
form embryoid bodies (EBs) (or mammospheres) in culture. To assess
the effect of the miRNA on the self-proliferative ability of the
cancer stem cell, if the miRNA is downregulated in the cancer stem
cell compared to the reference sample, and the miRNA or mimetic
thereof is introduced back into the cancer stem cell and the
ability of the cancer stem cell to form mammospheres or EBs in
culture is reduced, the miRNA contributes to the self-proliferative
ability and/or tumorogeneicity of the cancer stem cell. Similarly,
if the miRNA is upregulated in the cancer stem cell as compared to
the reference sample, and the expression and/or activity of the
miRNA is inhibited in cancer stem cell and the ability of the
cancer stem cell to form mammospheres or EBs in culture is reduced,
the miRNA contributes to the self-proliferative ability and/or
tumorogeneicity of the cancer stem cell.
EXAMPLES
[0289] Throughout this application, various publications are
referenced. The disclosures of all of the publications and those
references cited within those publications in their entireties are
hereby incorporated by reference into this application in order to
more fully describe the state of the art to which this invention
pertains. The following examples are not intended to limit the
scope of the claims to the invention, but are rather intended to be
exemplary of certain embodiments. Any variations in the exemplified
methods which occur to the skilled artisan are intended to fall
within the scope of the present invention.
[0290] Methods
[0291] Primary tumor specimens. Tumors were obtained following a
protocol approved by the ethics committee of the No. 2 Affiliated
Hospital of Sun-Yat-Sen University in China from 11 consented
female patients (median age 52 years) with biopsy-diagnosed poorly
differentiated invasive ductal carcinomas of the breast. Five
patients received 4 cycles of neoadjuvant chemotherapy with
5-fluorouracil 500 mg/m.sup.2, epirubicin 100 mg/m.sup.2 and
cyclophosphamide 500 mg/m.sup.2 followed by modified radical
resection of the breasts. Modified radical resection was performed
in 6 cases without neoadjuvant chemotherapy. The average tumor size
was 3.4 cm (range, 2.5-4.3 cm), and all patients had axillary lymph
node metastasis. Surgical specimens were received in the laboratory
within 20 min of surgery, and were immediate mechanically
disaggregated and digested with collagenase as described.sup.10.
Single cancer cells were obtained by filtration through a 30.mu.
filter.
[0292] In-vivo enrichment of breast tumor-initiating cells. Female
NOD/LtSz-scid/scid (NOD/SCID) mice were bred and maintained under
defined conditions at the Animal Experiment Center of Sun-Yat-Sen
University, and all animal experiments were approved by the Animal
Care and Use Committee of the Sun-Yat-Sen University. SKBR3 cells
(ATCC) were passaged in NOD/SCID mice by injecting 2.times.10.sup.6
cells into the mammary fat pad of 5-week-old mice. To select for
chemoresistant breast tumor-initiating cells, Epirubicin (8 mg/kg,
Pharmacia and Upjohn) was injected into the tail vein weekly.
Single cell suspensions were obtained by collagenase digestion as
described.sup.10 of tumor xenografts, removed when tumors reached
.about.2 cm in diameter. The dissociated cells were repetitively
passaged in Epirubicin-treated NOD/SCID mice as above for 3
generations. Freshly isolated single tumor cells obtained from the
3'1-generation xenografts (SK-3rd) were used to generate
mammosphere cultures.
[0293] Mammosphere culture. SK-3rd and SKBR3 cells were cultured in
suspension at a clonal density of 1,000 cells/mL in serum-free
DMEM-F12 (BioWhittaker), supplemented with B27 (1:50, Invitrogen),
20 ng/mL EGF (BD Biosciences), 0.4% bovine serum albumin (Sigma)
and 4 .mu.g/mL insulin (Sigma).sup.25. Alternatively, single-cell
suspension culture was obtained by suspending a single SK-3rd or
SKBR3 cell in 200 .mu.L, of the above medium in 96-well plates. To
propagate mammospheres in vitro, the spheres were collected by
gentle centrifugation and were dissociated to obtain single cells
enzymatically and mechanically as described.sup.25. Single cells
were then cultured in suspension to generate mammospheres of the
next generation. The percentage of wells with mammospheres was
analyzed at indicated times, and the size of mammospheres
(cells/sphere) was determined by dissociating and counting the
cells in the spheres.
[0294] Generation of microRNA and shRNA-expressing lentiviruses.
Oligonucleotides encoding let-7a1 pre-miRNA.sup.33 (SEQ ID NO: 7)
or shRNA targeting H-RAS1.sup.46 or eGFP were synthesized according
to previously published sequences and cloned under the control of
the U6 promoter in the lentiviral vector lentilox pLL3.7 as
previously reported.sup.47. Generation of lentivirus vectors was
performed as described.sup.47 by co-transfecting pLL3.7 carrying
the miRNA or shRNA expression cassette with helper plasmid
pCMV-VSV-G and pHR'8.9.DELTA.VPR in 293 T cells using FuGENE 6
(Roche). The viral supernatant was collected 48 hrs after
transfection, and viral titers determined by transducing HeLa cells
at serial dilutions and analyzing GFP expression by flow
cytometry.
[0295] Transduction with lentivirus vectors. SK-3rd cells
dissociated from the primary mammospheres were spin-infected with 1
mL of lentiviral supernatant containing 8 .mu.g/mL polybrene for 2
hr at a multiplicity of infection (MOI) of 1:5, followed by
incubation for 2 hours at 37.degree. C. Transduction efficiency,
evaluated by GFP expression, was >90%.
[0296] Transfection with let-7a ASO. After washing in D-MEM medium
without serum, SKBR3 cells were transfected in 24-well plates with
30 pmol of let-7 ASO or 30 pmol of a control lin-4 ASO (Ambion)
using Lipofectamine 2000 overnight. Cells were harvested for
further experiments 48 hr post-transfection.
[0297] miRNA microarray analysis. Total RNA enriched for small RNAs
was isolated using the mirVana RNA Isolation Kit (Ambion), and
miRNAs were then excised from RNA electrophoresed through
polyacrylamide gels. A poly(A) tail was appended to the 3'-end of
miRNAs from all the above samples with a mixture of unmodified and
amine-modified nucleotides (Ambion). The tailed samples were
fluorescently labeled using an amine-reactive Cy3 dye (Amersham),
and the unincorporated dyes were removed with glass fiber filters.
The samples were hybridized for 14 hr onto slides arrayed with
miRNA probes from the NCode.TM. miRNA Microarray Probe Set
(Invitrogen). Slides were then washed 3.times.2 min in 2.times.SSC
and scanned using a Generation .beta. array scanner (Amersham
Pharmacia). Fluorescence intensities for the Cy3-labeled samples
were normalized by the median total Cy3 signal on the arrays. The
signal intensity of each element was analyzed using ArrayVision
(Imaging Research Ltd), and images were created with DMVS 2.0
software (Chipscreen Biosciences Ltd).
[0298] Northern blot. Northern blot for let-7 miRNA was performed
as previously reported.sup.33. Briefly, 10 .mu.g of RNA were
fractionated on a 15% denaturing polyacrylamide gel. The RNA was
then electrotransferred to Nytran Plus (Schleicher & Schuell,
Inc., Keene, N.H.) at 200 mA for 2.5 hr, UV cross-linked at 1,200
.mu.F, and prehybridized for 30 min at 40.degree. C. in UltraHyb
buffer (Ambion). The let-7 probe (5'-TACTATACAACCTACTACCTCAATTTGCC;
SEQ ID NO:12) was radiolabeled as described.sup.33 and blots were
hybridized in 10 mL of UltraHyb buffer (Ambion). After washing
2.times.5 min at room temperature in 2.times.SSC, 0.1% SDS and
3.times.10 min in 1.times.SSC, 0.1% SDS, the blots were analyzed on
a phosphorimager (Molecular Dynamics). The process was repeated
using a radiolabeled probe for U6 snRNA
(5'-GCAGGGGCCATGCTAATCTTCTCTGTATCG; SEQ ID NO:13).sup.42.
[0299] Quantitative RT-PCR. Real-time reverse transcription PCR was
performed using an ABI Prism 7900 Sequence Detection System
(Perkin-Elmer Applied Biosystems). SYBR green (Molecular Probes)
was used to detect PCR products. All reactions were done in a
25-.mu.l reaction volume in triplicate. Primers for mature let-7a
miRNA (Probe 1: SEQ ID NO:14 and SEQ ID NO:15) and U6 snRNA were
from Ambion. PCR amplification consisted of 10 min of an initial
denaturation step at 95.degree. C., followed by 55 cycles of PCR at
95.degree. C. for 30s, 56.degree. C. for 30s and 72.degree. C. for
15s. Standard curves were generated and the relative amount of
target gene mRNA was normalized to U6 snRNA. Specificity was
verified by melt curve analysis and agarose gel electrophoresis. To
quantify cancer metastasis in mouse lungs and livers, qRT-PCR for
human hypoxanthine-guanine-phosphoribosyltransferase (hHPRT), was
performed on Trizol (Life Technologies, Gaithersburg, Md.)-isolated
total RNA using described primers for human HPRT (hHPRT) and mouse
GAPDH (mGAPDH).sup.48. Following reverse transcription for 30 min
at 48.degree. C. and Taq activation for 10 min at 95.degree. C., 40
cycles of PCR at 95.degree. C. for 20 sec, 55.degree. C. for 30
sec, and 72.degree. C. for 30 sec were performed.
[0300] let-7 luciferase assay. To evaluate the miRNA function of
let-7, a pMIR-REPORT.TM. luciferase reporter vector with a let-7
target sequence (SEQ ID NO: 9) (as well as SEQ ID NO:10 and SEQ ID
NO:11) was cloned into its 3'UTR (luc-let-7-ts) (Ambion) was used.
The reporter vector plasmid was transfected using Lipofectamine
2000 according to the manufacturer's instruction. To correct for
transfection efficiency, a luciferase reporter vector without a
let-7 target was transfected in parallel. Luciferase activity was
assayed by luciferase assay kit (Promega). let-7 miRNA function was
expressed as percentage reduction in the luciferase activity of
cells transfected with the reporter vector containing the let-7
target sequence compared to cells transfected with the vector
without the let-7 target.
[0301] Western blot. Protein extracts were resolved through 12%
SDS-PAGE, transferred to nitrocellulose membranes, probed with
rabbit polyclonal antibodies against human H-RAS (Upstate) or human
Oct-4 (Chemicon Int), and then with peroxidase-conjugated goat
anti-rabbit Ig secondary antibody (Oncogene Research Product), and
then visualized by chemiluminescence (Amersham).
[0302] Flow cytometry. For cell surface staining, unfixed cells
were incubated with FITC-labeled anti-CD44 and PE-labeled anti-CD24
(PharMingen) at 4.degree. C. For staining cytoplasmic antigens,
cells were permeabilized with the Caltag Laboratories (Burlingame)
Fix and Perm kit and stained with FITC-labeled CK14 and PE-labeled
CK18 (Neomarkers). Cells were analyzed by flow cytometry on a
FACScalibur instrument with CellQuest software (BD).
[0303] Cell proliferation. .sup.3H-thymidine (1 .mu.Ci) was added
for 6 h to 2.times.10.sup.4 cells in octuplicate microtiter wells,
before harvesting and analysis by scintillation counting using a
Top Count microplate reader (Packard).
[0304] Tumor implantation. Indicated numbers of SKBR3 or SK-3rd
cells dissociated from mammospheres were injected subcutaneously
into the mammary fat pads of 5-week-old NOD/SCID mice. Mice were
examined by palpation for tumor formation for up to 60 d. After
tumors were detected, tumor size was measured every 3 d by
calipers, and tumor volumes calculated as Volume
(mm.sup.3)=L.times.W.sup.2.times.0.4. Mice were sacrificed by
cervical dislocation and the presence of tumors was confirmed by
necropsy. Tumor xenografts as well as whole lung and liver tissues
were harvested, weighed and snap-frozen in liquid nitrogen.
Portions of the lung and liver tissues were used for real-time
RT-PCR for human HPRT to evaluate metastasis. Cryosections (4
.mu.m) were stained with hematoxylin and eosin and used for
immunohistochemistry.
[0305] Immunohistochemistry. Cryosections were stained using
anti-human RAS (Upstate) or anti-human PCNA (BD Biosciences) mAb.
Briefly, endogenous peroxidase activity was quenched by incubation
with 3% hydrogen peroxide in methanol for 5 min. Sections were
washed in phosphate buffered saline (PBS) and blocked for 1 h in a
washing buffer containing 5% normal goat serum (Sigma Chemical Co.
St Louis, Mo.). The primary antibody was added for incubation
overnight at 4.degree. C. After washing in PBS, slides were
incubated with biotinylated goat anti-mouse Ig and then with
streptavidin conjugated with horseradish peroxidase. After further
washing in PBS, slides were developed with diaminobenzidine (DAB;
Dako Corp. Carpinteria, Calif.) lightly counterstained with
hematoxylin. Negative control slides were stained with isotype
mouse immunoglobulin to replace primary antibodies. The percentage
of H-RAS and PCNA-positive tumor cells was calculated by counting
1,000 tumor cells.
[0306] Statistics. All in vitro experiments were performed either
in triplicate or in pentuplicate. The results are described as
mean.+-.SD. Statistical analysis was performed by one-way analysis
of variance (ANOVA) and comparisons among groups were performed by
independent sample t-test or Bonferroni's multiple-comparison
t-test.
Example 1
[0307] Low-dose chemotherapy selects for tumor-initiating breast
cancer cells. Resistance to chemotherapy distinguishes
tumor-initiating cells from other cancer cells.sup.1,2,17.
Accordingly, treatment with chemotherapy should enrich for tumor
stem cells compared to more differentiated progeny. To examine
this, the inventors compared the proportion of self-renewing cancer
cells in primary breast cancer tissues surgically removed from
patients with poorly differentiated invasive breast cancer who
received four cycles of preoperative chemotherapy with tumors from
matched untreated patients. Freshly isolated cells were cultured in
suspension in medium supplemented with epidermal growth factor
(EGF), B27 and insulin to generate mammospheres (or emboid bodies),
a previously described method for culturing both mammary gland
progenitor cells.sup.25 and breast tumor-initiating cells.sup.10.
The self-renewal potential of breast tumor-initiating cells can be
gauged by their capacity to give rise to mammospheres.sup.10. From
5 patients who received neoadjuvant chemotherapy, 5.8.+-.2.6% of
tumor cells formed mammospheres after 15 d as compared with
0.4.+-.0.3% from 6 chemotherapy-naive patients, a 14-fold increase
(P<0.001, FIG. 1a). Furthermore, the primary mammospheres from
neoadjuvant chemotherapy patients could be passaged for at least
8-10 generations (end point of the study), while those from
patients without chemotherapy vanished within 2-3 generations.
Self-renewing breast cancer cells have been shown to be
CD44.sup.+CD24.sup.-9,10,15; 70.+-.8% of freshly examined primary
tumor cells from chemotherapy-treated patients had this phenotype,
while only 9.+-.3% of cells from untreated patients did
(P<0.001, FIG. 1b). These data demonstrate that neoadjuvant
chemotherapies selectively enhance the proportionate survival of
breast tumor-initiating cells in primary cancer tissues.
[0308] The inventors took advantage of this finding to demonstrate
the ability to enrich for tumor-initiating cells by consecutively
passaging breast cancer cells in NOD/SCID mice treated with low
dose chemotherapy. Mice injected in the mammary fat pad with SKBR3
tumor cells were treated with Epirubicin weekly for 10-12 weeks
until xenografts reached a diameter of .about.2 cm. Cells from the
3.sup.rd passaged xenograft (SK-3rd) were cultured in suspension to
generate mammospheres. The number of mammospheres reflects the
quantity of stem cells with self-renewal potential, while the
number of cells per mammosphere measures the self-renewal capacity
of each cell.sup.25,26. The inventors assessed the percentage of
mammospheres formed by SK-3rd and their parental SKBR3 counterparts
after 15 d in suspension culture. Mammosphere formation in SK-3rd
was approximately 20-fold higher than SKBR3 (16.3% vs. 0.8%,
P<0.001, FIG. 1c). Moreover, dissociated SK-3rd cells from
primary mammospheres generated an equivalent proportion of
secondary spheres and subsequently tertiary spheres (FIG. 1c),
demonstrating their self-renewing potential in vitro. Long-term
SK-3rd mammosphere cultures could be maintained for >50
passages, while within 3-4 passages, mammospheres from SKBR3 failed
to generate secondary spheres and became adherent and
differentiated. These findings were confirmed by single cell
cloning (FIG. 6). SK-3rd mammospheres were observed beginning at
day 5 and increased in size and cell number until day 15 (FIG. 1d).
Secondary mammospheres could be passaged>40 times from single
cell SK-3.sup.rd clones. However, mammospheres did not appear until
d 15 in parental SKBR3 cells and were about 18-fold fewer in number
and much smaller (FIG. 1d).
[0309] Dissociated SK-3rd mammospheres could be differentiated in
vitro by plating on collagen in serum-containing medium lacking
exogenous growth factors. Within 24 hr, the suspended cells began
to adhere and spread and could thereafter be maintained and
expanded as differentiated cells (FIG. 1e). Moreover, 93% of
mammosphere-derived SK-3rd, but fewer than 0.5% of parental SKBR3,
were CD44.sup.+CD24.sup.-, the phenotype of tumor-initiating breast
cancer cells.sup.9,10,15 (FIG. 1g). During in vitro differentiation
of SK-3rd, the percentage of CD44.sup.+CD24.sup.-/low cells
decreased steadily to .about.32% on d 3, 11% on d 7 and 2% on d 10.
Furthermore, SK-3rd, but not SKBR3, cells highly expressed the stem
cell-associated transcription factor Oct-4, which declined upon in
vitro differentiation (FIG. 10. Therefore SK-3rd mammospheric cells
have the self-renewing and differentiating capability and
phenotypic properties expected of breast cancer stem cells.
Example 2
[0310] Breast tumor-initiating cells have reduced expression of
let-7 miRNAs and let-7 homologues or let-7 mimetics. The inventors
used miRNA microarrays to compare miRNA expression in
mammosphere-derived SK-3rd with their in vitro differentiated
progeny and the parental SKBR3 cells. As has been reported for ES
cells.sup.22,27, most of the 52 miRNAs that were reproducibly
expressed above background in any of the 3 cell lines had reduced
expression in SK-3rd compared with either the differentiated SK-3rd
cells or SKBR3 (FIG. 2a). Cluster analysis of multiple samples
showed a clear distinction between mammospheric cells and the other
two adherent lines (data not shown). Using ANOVA analysis on the
normalized chip data, we identified a number of human miRNAs whose
expression in mammospheric cells was significantly different from
the differentiated and parent cells. Among them, the let-7 family
emerged as the most consistently and significantly reduced miRNAs.
let-7 was initially identified as a miRNA that regulates
development in C. elegans.sup.28, where it was shown to target key
genes include lin-41, hbl, daf-12, pha-4 and let-60 (a RAS
homolog).sup.29-31. In humans, 11 homologues of let-7 miRNAs
exists, which are differentially expressed in different tissues,
but are believed to have redundant targets and functions.sup.29,32.
Human let-7, which is down-regulated in some cancers and associated
with poor prognosis in lung cancer.sup.33, targets the RAS oncogene
and thereby acts as a tumor suppressor.sup.31. To verify the
reduction of let-7 miRNAs in SK-3rd, the inventors performed
Northern blot using a probe that recognizes a variety of let-7
family members or homologues.sup.31 (FIG. 2b). let-7 was barely
detected in SK-3rd, but increased with differentiation and was
abundant in the parent SKBR3 cells. This result was verified using
a let-7a-specific primer for quantitative reverse transcription-PCR
(qRT-PCR). let-7a was 10-fold lower in SK-3rd than differentiated
SK-3rd, and the level in the differentiated cells was comparable to
SKBR3 (FIG. 2c).
Example 3
[0311] let-7 activity is low in breast cancer stem cells and
increases during differentiation. To investigate let-7 function,
the inventors transfected a luciferase reporter vector containing a
let-7 target sequence in its 3'UTR into SK-3rd, differentiated
SK-3rd and SKBR3. Luciferase activity was suppressed by 52% in
differentiated SK-3rd cells (P<0.001) and by 78% in SKBR3
(P<0.001), while there was no suppression in SK-3rd (FIG. 2d).
Infection of SK-3rd with a lentivirus expressing let-7a pre-miRNA
enhanced miRNA expression and function comparably to that of the
differentiated progeny cells (FIG. 2b-d). Co-transfection of
differentiated SK-3rd cells, SKBR3 or let-7a lentivirus-infected
SK-3rd with a let-7 antisense oligonucleotide (ASO) significantly
reduced the suppression in luciferase activity mediated by
endogenous or exogenous let-7 (P<0.01; FIG. 2d).
[0312] Since RAS is a major target of let-7 miRNAs.sup.31, the
inventors next compared HRAS1 mRNA and protein expression in the 3
cell lines. H-RAS protein was highly expressed in SK-3rd stem
cells, but was greatly reduced in differentiated SK-3rd cells and
SKBR3. (Other RAS proteins were not detected in any of these cells
(data not shown). As expected, introduction of let-7a or RAS-shRNA
by lentiviruses into SK-3rd reduced H-RAS protein to the level
found in the differentiated cells, while inhibiting let-7 with a
specific ASO in the parent SKBR3 cells up-regulated H-RAS
expression substantially (FIG. 2e). However, HRAS1 mRNA, measured
by qRT-PCR, did not differ significantly amongst the 3 sources of
cells (data not shown). Therefore, let-7 silences RAS expression by
inhibiting translation, and reduced let-7 in breast cancer stem
cells leads to RAS over-expression.
Example 4
[0313] let-7 is reduced in breast tumor-initiating cells from
primary cancers. To confirm that the results with the breast cancer
cell line are physiologically relevant to primary breast cancers,
the inventors examined let-7 family expression in the breast
tumor-initiating cells from primary cancers by Northern blot and
quantified it by qRT-PCR using a let-7a-specific primer (FIG.
2f,g). In agreement with the data from SK-3rd cells, the
tumor-initiating cells from primary mammospheres from primary
cancers from chemotherapy-treated patients had reduced let-7 (Fog
20, for example at least about, 20%, or at least about 30% or at
least about 50% lower level, as compared with the primary cancer
cells freshly isolated from tissue samples of untreated patients.
When the tumor-initiating mammospheric cells were differentiated
for 14 d in adherent cultures, let-7 expression returned to the
level in untreated-patient cells.
Example 5
[0314] Reduced let-7 is required to maintain self-renewal of
tumor-initiating cells. To test the importance of low let-7
expression in breast cancer stem cells, the inventors first studied
the effect of enforced let-7a expression in SK-3rd on self-renewal
using the mammosphere-forming assay. As disclosed above, the
ability of a cell to form a mammosphere (i.e. an embryoid body)
indicates the self-renewal capacity of the cell. SK-3rd cells
infected with let-7a lentivirus formed 5.3-fold fewer secondary
mammospheres than uninfected SK-3rd or SK-3rd cells infected with
lentiviral vectors that were empty or expressed an eGFP-shRNA (FIG.
3a). Mammosphere formation was also delayed and the mammospheres
that formed were 2-3-fold smaller in let-7a-expressing SK-3rd cells
compared with control SK-3rd cells (FIG. 3b). Importantly, the
let-7a-transduced mammospheric cells could only be passaged for
8-10 generations. Therefore let-7a transduction not only reduced
the number of tumor-initiating cells, but also weakened their
self-renewing capacity. Conversely, transfecting let-7 ASO into
parental SKBR3 cells enhanced their ability to form mammospheres by
.about.6-fold (FIG. 3c).
Example 6
[0315] Reduced let-7 maintains tumor-initiating cell proliferation,
but inhibits their differentiation. Another important stem cell
property is the potential to proliferate during differentiation.
When mammospheric SK-3rd cells were plated for differentiation,
let-7 expression measured by qRT-PCR, increased gradually and
plateaued on d 6 (FIG. 3d). Resting SK-3rd cells proliferated at
half the rate of parental SBR3 cells as measured by [.sup.3H]
incorporation (FIG. 3e). During differentiation, SK-3rd
proliferation increased about 7-fold from baseline to a peak on d 4
and then fell by d 8 to a level somewhat higher than that of the
parental cell line (P<0.01). To investigate the effect of let-7
on proliferation, the inventors measured proliferation during
differentiation of SK-3rd cells transduced with pre-let-7a.
Enhancing let-7a expression reduced peak [.sup.3]-incorporation by
58%, demonstrating that reduced let-7 enhances the proliferative
potential of differentiating stem cells.
[0316] Another hallmark of stem cells is their undifferentiated
state and potential to differentiate into multiple lineages.
Mammospheric SK-3rd cells expressed neither myoepithelial (CK14)
nor luminal epithelial (CK18) cytokeratins (data not shown), while
the parental SKBR3 cells were 70% myoepithelial and 30% luminal
epithelial (FIG. 3f). However, after 10 days of differentiation,
most of the SK-3rd cells expressed differentiation markers
(44.+-.4% CK14+CK18-, 28.+-.7% CK14-CK18+), but 15.+-.3% were
lin.sup.-. let-7a over-expression significantly (P<0.001)
reduced the proportion of lin.sup.- cells to 6.+-.2%, but control
lentiviruses, including a lentivirus expressing RAS-shRNA (see
below), had no effect on in vitro differentiation. Taken together,
these data demonstrate that low let-7 expression helps to maintain
the undifferentiated status and proliferative potential of breast
tumor-initiating cells.
Example 7
[0317] let-7 expression silences RAS and other genes: Silencing RAS
only partly recapitulates the effects of let-7 expression. Since
RAS is a well-documented target of let-7.sup.31 the inventors
investigated whether the effects of reduced let-7 in maintaining
tumor-initiating properties of SK-3.sup.rd could be attributed to
RAS oncogene expression. A lentivirus expressing RAS-shRNA reduced
H-RAS protein in SK-3rd to the level in SKBR3 or differentiated
SK-3rd and comparably to that of the let-7a-lentivirus (FIG. 2e).
SK-3rd cells with silenced H-RAS formed mammospheres at a level
that was about half that of untransduced or control vector
transduced SK-3.sup.rd cells, but about 3-fold greater than cells
transfected with let-7a-lentivirus (FIG. 3a); moreover the
mammospheres that formed were intermediary in size (465.+-.94 cells
vs. 745.+-.155 cells for untransduced SK-3rd and 277.+-.82 cells
for let-7a-transduced SK-3rd on d 20; FIG. 3b). Silencing RAS also
somewhat reduced SK-3.sup.rd proliferation under differentiating
conditions, but much less than expressing let-7a (FIG. 3e,
P<0.001, on d 4 of differentiation, the peak of proliferation).
As noted above, silencing RAS, unlike over-expressing let-7a, in
SK-3rd did not reduce the residual proportion of undifferentiated
cells lacking cytokeratin expression after in vitro differentiation
(FIG. 3f). Therefore, let-7 silencing of RAS explains some, but not
all, of the role of let-7 in converting breast cancer stem cells to
more differentiated progeny. These data demonstrate that expression
of let-7 targets other RNA transcripts in addition to RAS in breast
cancer stem cells which contribute to the "stemness" or
self-renewal capacity of cancer stem cells, such as breast cancer
stem cells.
Example 8
[0318] Lack of let-7 facilitates tumorigenesis of breast
tumor-initiating cells. Cancer stem cells establish tumor
xenografts much more readily than differentiated tumor
cells.sup.1,2. When mammospheric SK-3rd cells were inoculated
subcutaneously into NOD/SCID mice, eight of ten mice engrafted with
2.times.10.sup.3 cells generated tumors that were first detected
36-45 d later (Table 1, FIG. 4a). All animals injected with 10 or
100-fold more cells developed tumors within 30 and 21 days,
respectively. Within 14 days after tumors were identified, their
sizes reached 1.8.+-.0.7 cm in diameter. By contrast, no mice
inoculated with 2.times.10.sup.3 or 2.times.10.sup.4 SKBR3 cells
developed tumors by day 60, while tumors developed by day 45 in
only 3 of 10 animals inoculated with 2.times.10.sup.5 SKBR3 cells.
Therefore, SK-3rd cells are at least 100-fold more tumorigenic than
the parental cell line. When let-7a expression was enforced in
mammospheric SK-3rd cells, tumors developed in only 20%, 50% and
70% of mice inoculated with 2.times.10.sup.3, 2.times.10.sup.4 and
2.times.10.sup.5 cells, respectively. Moreover, the
let-7a-expressing tumors grew more slowly than the untransduced or
control vector-transduced SK-3rd tumors; it took 25-33 days for the
tumors after they became palpable to reach 2.0 cm in diameter,
while the control SK-3rd cells reached that size in .about.12 d
(FIG. 4a).
TABLE-US-00001 TABLE 1 Incidence of tumors and metastasis in
mammospheric SK-3.sup.rd cells and SKBR3 cells in NOD/SCID mice. 1
.times. 10.sup.3 1 .times. 10.sup.4 1 .times. 10.sup.5 Number of
Lung Liver Lung Liver Lung Liver cells inoculated Tumors metastasis
metastasis Tumors metastasis metastasis Tumors metastasis
metastasis Mammo- Untransduced 8/10 6/10 3/10 10/10 7/10 4/10 10/10
8/10 6/10 spheric Lentivirus 8/10 5/10 3/10 10/10 8/10 5/10 10/10
8/10 5/10 SK-3.sup.rd cells Lenti-let-7 2/10* 1/10 0/10 5/10* 3/10
1/10 7/10 4/10 3/10 RAS-shRNA 3/10* 2/10 1/10 7/10 5/10 3/10 10/10
7/10 4/10 SKBR3 0/10.sup..infin. 0/10* 0/10 0/10.sup.#
0/10.sup..infin. 0/10 3/10 0/10 0/10 *= p < 0.05; .sup..infin.=
p < 0.01, .sup.#= p < 0.001 compared with untransduced
mammospheric SK-3.sup.rd cells.
[0319] Furthermore, primary mammospheres from chemotherapy patients
could be passaged for at least eight to ten generations (endpoint
of the study), while those from patients without chemotherapy
vanished within two to three generations. In the primary breast
cancers; 74%.+-.7% of tumor cells from chemotherapy-treated
patients, but only 9%.+-.4% of cells from untreated patients, were
CD44.sup.+CD24.sup.-/low, the phenotype ascribed to BT-IC (Al-Hajj
et al., 2003; Ponti et al., 2005) (p<0.001, FIG. 1B). Enrichment
of BT-IC by chemotherapy was confirmed by studying paired specimens
from seven patients obtained by biopsy prior to chemotherapy and at
surgery following neoadjuvant chemotherapy. Only 0.5%.+-.0.3% of
tumor cells before chemotherapy, but 5.9%.+-.1.7% of cells obtained
after chemotherapy, formed mammospheres after 15 days of suspension
culture (p<0.001, data not shown).
[0320] Similarly, the proportion of CD44.sup.+CD24.sup.-/low cells
was 9.5-fold higher in samples after chemotherapy (p<0.001,
Table 2). In another patient group with metastatic pleural
effusions who had received chemotherapy 2-6 years before, pleural
cancer cells were highly enriched (31%.+-.10%) for
CD44.sup.+CD24.sup.-/low cells (data not shown). These data from
three cohorts suggest that chemotherapy selectively enhances the
proportionate survival of BT-IC.
TABLE-US-00002 TABLE 2 Incidence of tumors from primary breast
cancer cells serially transplanted in NOD/SCID mice. 2 .times.
10.sup.3 cells 5 .times. 10.sup.3 cells Number of Primary Primary
cells inoculated Tumors Passage 1 Paggsate 2 Tumors Passage 1
Paggsate 2 lin.sup.-CD44.sup.+CD24.sup.-/low Untransduced 6/8 8/8
8/8 8/8 8/8 8/8 Lentivirus 6/8 8/8 8/8 7/8 8/8 8/8 Lenti-let-7 2/8*
2/8.sup..infin. 2/8.sup..infin. 4/8.sup..infin. 4/8.sup..infin.
5/8* lin.sup.-NotCD44.sup.+CD24.sup.-/low 0/8 0/8.sup.# 0/8.sup.#
0/8.sup.# 0/8 0/8.sup.# *= p < 0.05; .sup..infin.= p < 0.01,
.sup.#= p < 0.001 compared with untransduced lin.sup.-
CD44.sup.+CD24.sup.-/low cells. For the initial inoculation, each
mouse was inoculated with sorted cells, transduced or nor, from a
different chemotherapy naive human patient. For subsequent
passages, cells were isolated, sorted, and transduced forms from
mice injected with tumor cells from the two pateients whos
lenti-let7 transduced cells established xenographs.
[0321] By hematoxylin and eosin staining, the tissue structure and
cell morphology of the tumors generated from SKBR3, mammospheric
SK-3rd or SK-3rd cells expressing let-7a were not grossly different
(FIG. 4b). However, H-RAS expression by immunohistochemistry was
much higher in xenografts generated from mammosphere-derived SK-3rd
cells as compared to those from the parent SKBR3 cells.
Transduction of SK-3rd with let-7a-lentivirus, but not control
lentivirus, significantly reduced H-RAS in the tumors, almost to
the level of SKBR3-derived tumors (FIGS. 4b,c). In keeping with the
faster growth of the SK-3rd tumors, a higher proportion of
SK-3rd-derived tumor cells than SKBR3-derived tumor cells stained
for the proliferating cell-associated antigen PCNA (FIG. 4b,d).
Transduction of SK-3rd with let7a-lentivirus also significantly
reduced PCNA staining in the xenografted tumors, although not to
that of the SKBR3-derived tumor. Therefore the inventors have
demonstrated that the lack of let-7 plays an important role in the
enhanced tumorigenicity and proliferation of tumor-initiating
SK-3rd cells.
Example 9
[0322] Lack of let-7 in breast tumor-initiating cells promotes lung
and liver metastasis. It has been hypothesized that cancer cells
migrate to distal sites to initiate metastases only when they
possess "stemness".sup.14,15,34. The inventors compared lung and
liver metastases of the xenografts generated from SK-3rd cells,
expressing let-7a or not, and SKBR3 cells. Five weeks after
inoculation with 2.times.10.sup.5 mammospheric SK-3rd cells,
massive lung metastases were visualized by microscopy in 8 of 10
mice, but none of the mice injected with the same number of SKBR3
cells developed microscopic lung metastases within 9 weeks of
inoculation (FIG. 5a). As an indicator of metastases, the wet lung
weight of mice engrafted with SK-3rd was significantly higher
(-3-fold) than those injected with parental cells (P<0.01; FIG.
5b). Transduction of SK-3rd with lenti-let-7 reduced both the
numbers of mice with lung metastases from 8 to 5 of 10 animals and
the average lung weight by 44% (P<0.01). The metastases were not
only smaller, but also dispersed among alveoli (FIG. 5a),
suggesting reduced clinical severity. The number of tumor cells in
the lung, quantified by qRT-PCR for human HPRT, was also 30% less
in the animals injected with let-7a-expressing SK-3rd compared with
those inoculated with cells transduced with the empty vector
(P<0.05; FIG. 5c).
[0323] Similarly, mammospheric SK-3rd cells developed
micrometastases in the livers of 6 of 10 mice inoculated with
2.times.10.sup.5 cells, but SKBR3 cells did not (Table 1, FIG. 5a).
let-7a expression in SK-3.sup.rd reduced both the occurrence of
liver metastasis by .about.50% as well as their size. This was
confirmed by measuring a 58% reduction in human HPRT mRNA in the
livers of animals inoculated with lenti-let-7-transduced cells
(n=3) as compared with those implanted with cells transduced with
the control lentivirus (n=5, P<0.01; FIG. 5c). Therefore, the
lack of let-7 in breast tumor-initiating cells contributes to their
ability to metastasize to both the lung and liver.
[0324] The inventors have discovered breast tumors removed from
patients treated with preoperative chemotherapy are enriched for
tumor-initiating cells, also known as cancer stem cells. By taking
advantage of the chemotherapeutic resistance of tumor-initiating
cells, the inventors generated a human breast cancer stem cell line
(SK-3rd) by sequential in vivo passage of a breast cancer cell line
in immunodeficient mice treated with a low dose of a
chemotherapeutic drug. The inventors discovered that their
generated cancer stem cell line, SK-3.sup.rd, has many of the
hallmarks characteristic of stem cells, for instance, Sk-3.sup.rd
cells have the ability for self-renewal, multipotent
differentiation and vigorous proliferative capacity, as well as the
ability to form mammospheres (or embryoid bodies), and are also
positive for breast cancer stem cell phenotype
(Oct4.sup.+CD44.sup.+CD24.sup.-lineage).sup.1. Moreover, the
inventors also discovered SK-3rd was much more malignant in
immunodeficient mice than the parental line--it required 100-fold
fewer cells to produce tumors, and surprisingly the tumors from the
SK-3.sup.rd metastasized, which did not occur at the same frequency
in the parental line. Although there is a growing consensus that
cancer stem cells are important in generating tumors and for
resistance to therapy and metastasis, a major obstacle to their
study is getting enough cells because of their very low frequency
in tumors.sup.9,10,12,37. Herein, the inventors have discovered a
method for enriching for cancer stem cells, to enable unlimited
numbers of cancer stem cells to be obtained. The methods of the
invention are useful for enriching for and obtaining unlimited
numbers of cancer stem cells from any cancer type, for example
breast cancer.
[0325] In vitro culture may produce epigenetic changes that might
alter the properties of tumor-initiating cells in subtle, not
easily detectable ways. Therefore, the inventors did as many of the
studies as possible with freshly isolated in vivo passaged cells.
Nonetheless, the self-renewing properties of the in vitro passaged
mammospheres were highly stable (FIG. 1c), demonstrating that even
with in vitro passage, mammospheres isolated from SK-3rd maintain
"stemness" and their self-renewal capacity. The inventors were
careful to compare their results generated with an in vivo passaged
cell line with those obtained in freshly isolated primary breast
cancer cells. The primary tumors resected from adjuvant
chemotherapy-treated patients had a surprisingly high frequency
(-6%) of mammospheric cells with expected properties of
tumor-initiating cells, a frequency that was only a third that of
the mouse-passaged stem cell line (16%) and 14 times that of
untreated-patient tumors. Therefore, the inventors have discovered
that enriched primary breast tumor-initiating cells, or cancer stem
cells, obtained from chemotherapy-treated patients are good source
for studying primary tumor-initiating cells, particularly cancer
stem cells from human subject.
[0326] The inventors also discovered that the expression of let-7
miRNA and let-7 homologues are significantly reduced or lacking in
tumor-initiating SK-3.sup.rd cells, distinguishing SK-3.sup.rd
tumor-initiating cells from both their differentiated progeny and
the parental cell line. Moreover, the inventors discovered that
lack of let-7 is required to maintain "stemness" and cancer stem
cells self-renewal capacity. By over-expressing let-7a in
SK-3.sup.rd cells, the inventors discovered that let-7 reduces
self-renewal and proliferative capability and converts highly
malignant and metastasizing tumor-initiating into less malignant
cells, similar to the parental cells. Conversely, by antagonizing
let-7 with antisense oligonucleotides (ASO) in the parental line,
the inventors discovered that reduction of let-7 in the parental
line had the effect of enhancing its self-renewal potential.
[0327] let-7 genes map to sites with frequent chromosomal
instability during oncogenesis.sup.40, and let-7 is poorly
expressed in lung.sup.24,33 and colon cancer.sup.41.
Down-regulation of let-7 has not been reported in breast
cancer.sup.42 let-7 has been postulated to work as a tumor
suppressor gene by silencing the expression of the RAS
oncogenes.sup.31. The inventors also discovered that in the
SK-3.sup.rd cancer stem cells which only express HRAS, that the
H-RAS protein, but not mRNA, was inversely correlated with let-7;
H-RAS was high in tumor-initiating SK-3rd, but low in
differentiated SK-3rd and SKBR3. Moreover, the inventors discovered
that exogenous let-7a significantly knocked-down H-RAS. H-RAS is
increased in up to 60% of human breast cancers.sup.43,44, but
mutations are rare.sup.44,45. In additional experiments, the
inventors discovered that silencing RAS to a level similar to that
mediated by let-7 had much less of an effect on cancer stem cell
self-renewal and in vitro differentiation than over-expressing
let-7, leading to the discovery that RAS is not the only target of
let-7 that contributes to maintaining "stemness" of cancer stem
cells.
REFERENCES
[0328] The references cited herein and throughout the application
are incorporated herein in their entirety by reference. [0329] 1.
Jordan, C. T., Guzman, M. L. & Noble, M. Cancer stem cells. N
Engl J Med 355, 1253-61 (2006). [0330] 2. Polyak, K. & Hahn, W.
C. Roots and stems: stem cells in cancer. Nat Med 12, 296-300
(2006). [0331] 3. Wang, J. C. & Dick, J. E. Cancer stem cells:
lessons from leukemia. Trends Cell Biol 15, 494-501 (2005). [0332]
4. Jordan, C. T. & Guzman, M. L. Mechanisms controlling
pathogenesis and survival of leukemic stem cells. Oncogene 23,
7178-87 (2004). [0333] 5. Dick, J. E. Acute myeloid leukemia stem
cells. Ann N Y Acad Sci 1044, 1-5 (2005). [0334] 6. Vescovi, A. L.,
Galli, R. & Reynolds, B. A. Brain tumour stem cells. Nat Rev
Cancer 6, 425-36 (2006). [0335] 7. Galli, R. et al. Isolation and
characterization of tumorigenic, stem-like neural precursors from
human glioblastoma. Cancer Res 64, 7011-21 (2004). [0336] 8. Singh,
S. K. et al. Identification of human brain tumour initiating cells.
Nature 432, 396-401 (2004). [0337] 9. Al-Hajj, M., Wicha, M. S.,
Benito-Hernandez, A., Morrison, S. J. & Clarke, M. F.
Prospective identification of tumorigenic breast cancer cells. Proc
Natl Acad Sci USA 100, 3983-8 (2003). [0338] 10. Ponti, D. et al.
Isolation and in vitro propagation of tumorigenic breast cancer
cells with stem/progenitor cell properties. Cancer Res 65, 5506-11
(2005). [0339] 11. Patrawala, L. et al. Highly purified CD44+
prostate cancer cells from xenograft human tumors are enriched in
tumorigenic and metastatic progenitor cells. Oncogene 25, 1696-708
(2006). [0340] 12. O'Brien C, A., Pollett, A., Gallinger, S. &
Dick, J. E. A human colon cancer cell capable of initiating tumour
growth in immunodeficient mice. Nature (2006). [0341] 13. Dalerba,
P., Cho, R. W. & Clarke, M. F. Cancer Stem Cells: Models and
Concepts. Annu Rev Med (2006). [0342] 14. Wicha, M. S. Cancer stem
cells and metastasis: lethal seeds. Clin Cancer Res 12, 5606-7
(2006). [0343] 15. Sheridan, C. et al. CD44+/CD24-breast cancer
cells exhibit enhanced invasive properties: an early step necessary
for metastasis. Breast Cancer Res 8, R59 (2006). [0344] 16. Eramo,
A. et al. Chemotherapy resistance of glioblastoma stem cells. Cell
Death Differ 13, 1238-41 (2006). [0345] 17. Dean, M., Fojo, T.
& Bates, S. Tumour stem cells and drug resistance. Nat Rev
Cancer 5, 275-84 (2005). [0346] 18. Lu, J. et al. MicroRNA
expression profiles classify human cancers. Nature 435, 834-8
(2005). [0347] 19. Chen, C. Z. MicroRNAs as oncogenes and tumor
suppressors. N Engl J Med 353, 1768-71 (2005). [0348] 20. Hatfield,
S. D. et al. Stem cell division is regulated by the microRNA
pathway. Nature 435, 974-8 (2005). [0349] 21. Croce, C. M. &
Calin, G. A. miRNAs, cancer, and stem cell division. Cell 122, 6-7
(2005). [0350] 22. Shcherbata, H. R. et al. The MicroRNA pathway
plays a regulatory role in stem cell division. Cell Cycle 5, 172-5
(2006). [0351] 23. Murdie, P. MicroRNA signature predicts prognosis
and progression of chronic lymphocytic leukemia. Nat Clin Pract
Oncol 3, 67 (2006). [0352] 24. Yanaihara, N. et al. Unique microRNA
molecular profiles in lung cancer diagnosis and prognosis. Cancer
Cell 9, 189-98 (2006). [0353] 25. Dontu, G. et al. In vitro
propagation and transcriptional profiling of human mammary
stem/progenitor cells. Genes Dev 17, 1253-70 (2003). [0354] 26.
Dontu, G. et al. Role of Notch signaling in cell-fate determination
of human mammary stem/progenitor cells. Breast Cancer Res 6,
R605-15 (2004). [0355] 27. Tang, F., Hajkova, P., Barton, S. C.,
Lao, K. & Surani, M. A. MicroRNA expression profiling of single
whole embryonic stem cells. Nucleic Acids Res 34, e9 (2006). [0356]
28. Reinhart, B. J. et al. The 21-nucleotide let-7 RNA regulates
developmental timing in Caenorhabditis elegans. Nature 403, 901-6
(2000). [0357] 29. Abbott, A. L. et al. The let-7 MicroRNA family
members mir-48, mir-84, and mir-241 function together to regulate
developmental timing in Caenorhabditis elegans. Dev Cell 9, 403-14
(2005). [0358] 30. Grosshans, H., Johnson, T., Reinert, K. L.,
Gerstein, M. & Slack, F. J. The temporal patterning microRNA
let-7 regulates several transcription factors at the larval to
adult transition in C. elegans. Dev Cell 8, 321-30 (2005). [0359]
31. Johnson, S. M. et al. RAS is regulated by the let-7 microRNA
family. Cell 120, 635-47 (2005). [0360] 32. Banerjee, D. &
Slack, F. Control of developmental timing by small temporal RNAs: a
paradigm for RNA-mediated regulation of gene expression. Bioessays
24, 119-29 (2002). [0361] 33. Takamizawa, J. et al. Reduced
expression of the let-7 microRNAs in human lung cancers in
association with shortened postoperative survival. Cancer Res 64,
3753-6 (2004). [0362] 34. Townson, J. L. & Chambers, A. F.
Dormancy of solitary metastatic cells. Cell Cycle 5, 1744-50
(2006). [0363] 35. Liu, G. et al. Analysis of gene expression and
chemoresistance of CD133+ cancer stem cells in glioblastoma. Mol
Cancer 5, 67 (2006). [0364] 36. Vander Borght, S. et al. Breast
cancer resistance protein (BCRP/ABCG2) is expressed by progenitor
cells/reactive ductules and hepatocytes and its expression pattern
is influenced by disease etiology and species type: possible
functional consequences. J Histochem Cytochem 54, 1051-9 (2006).
[0365] 37. Youn, B. S., Sen, A., Behie, L. A., Girgis-Gabardo, A.
& Hassell, J. A. Scale-up of breast cancer stem cell aggregate
cultures to suspension bioreactors. Biotechnol Prog 22, 801-10
(2006). [0366] 38. Soutschek, J. et al. Therapeutic silencing of an
endogenous gene by systemic administration of modified siRNAs.
Nature 432, 173-8 (2004). [0367] 39. Song, E. et al. Antibody
mediated in vivo delivery of small interfering RNAs via
cell-surface receptors. Nat Biotechnol 23, 709-17 (2005). [0368]
40. Calin, G. A. et al. Human microRNA genes are frequently located
at fragile sites and genomic regions involved in cancers. Proc Natl
Acad Sci USA 101, 2999-3004 (2004). [0369] 41. Akao, Y., Nakagawa,
Y. & Naoe, T. let-7 microRNA functions as a potential growth
suppressor in human colon cancer cells. Biol Pharm Bull 29, 903-6
(2006). [0370] 42. Iorio, M. V. et al. MicroRNA gene expression
deregulation in human breast cancer. Cancer Res 65, 7065-70 (2005).
[0371] 43. Hanahan, D. & Weinberg, R. A. The hallmarks of
cancer. Cell 100, 57-70 (2000). [0372] 44. Downward, J. Targeting
RAS signalling pathways in cancer therapy. Nat Rev Cancer 3, 11-22
(2003). [0373] 45. Bos, J. L. ras oncogenes in human cancer: a
review. Cancer Res 49, 4682-9 (1989). [0374] 46. Kawasaki, H.,
Suyama, E., Iyo, M. & Taira, K. siRNAs generated by recombinant
human Dicer induce specific and significant but target
site-independent gene silencing in human cells. Nucleic Acids Res
31, 981-7. (2003). [0375] 47. Lee, S. K. et al. Lentiviral delivery
of short hairpin RNAs protects CD4 T cells from multiple clades and
primary isolates of HIV. Blood 106, 818-26 (2005). [0376] 48.
Muller, A. et al. Involvement of chemokine receptors in breast
cancer metastasis. Nature 410, 50-6 (2001).
Sequence CWU 1
1
15122RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1ugagguagua gguuguauag uu
22222RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 2ugagguagua gguugugugg uu
22322RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 3ugagguagua gguuguaugg uu
22421RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 4agagguagua gguugcauag u
21521RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 5ugagguagga gguuguauag u
21622RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 6ugagguagua gauuguauag uu
22780RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 7ugggaugagg uaguagguug uauaguuuua
gggucacacc caccacuggg agauaacuau 60acaaucuacu gucuuuccua
80880RNAHomo sapiens 8ugggaugagg uaguagguug uauaguuuua gggucacacc
caccacuggg agauaacuau 60acaaucuacu gucuuuccua 80922DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 9aactatacaa cctactacct ca 221051DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 10aatgcactag taactataca acctactacc tcagctcagc
aagcttaatg c 511151DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 11gcattaagct tgctgagctg
aggtagtagg ttgtatagtt actagtgcat t 511229DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
12tactatacaa cctactacct caatttgcc 291330DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
13gcaggggcca tgctaatctt ctctgtatcg 301421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
14aactatacaa tctactgtct t 211520DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 15aactatacaa cctactacct
20
* * * * *
References