Binding molecules capable of neutralizing rabies virus and uses thereof

Abstract

Provided are binding molecules that specifically bind to rabies virus and are capable of neutralizing the virus. Further provided are nucleic acid molecules encoding the binding molecules, compositions comprising the binding molecules and methods of identifying or producing the binding molecules. The binding molecules can be used in the diagnosis, prophylaxis and/or treatment of a condition resulting from rabies virus. In certain embodiments, they can be used in the post-exposure prophylaxis of rabies.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a divisional of U.S. patent application Ser. No. 11/978,742, filed Oct. 29, 2007, pending, which application is a divisional of U.S. patent application Ser. No. 11/590,126, filed Oct. 31, 2006, now U.S. Pat. No. 7,579,446, issued Aug. 25, 2009, which application is a continuation of International Patent Appln. No. PCT/EP2005/052410 filed May 26, 2005, and published in English as PCT Internat'l Publication No. WO 2005/118644 A2, on Dec. 15, 2005, which application claims priority to Internat'l Patent Appln. No. PCT/EP2005/050953 filed Mar. 3, 2005, which application claims priority to Internat'l Patent Appln. No. PCT/EP2005/050310, filed Jan. 25, 2005, which application claims priority to Internat'l Patent Appln. No. PCT/EP2004/052772 filed Nov. 3, 2004, which application claims. priority to Internat'l Patent Appln. No. PCT/EP2004/052286 filed Sep. 23, 2004, which application claims priority to Internat'l Patent Appln. No. PCT/EP2004/051661 filed Jul. 29, 2004 which application claims priority to Internat'l Patent Appln. No. PCT/EP2004/050943 filed May 27, 2004, and U.S. Provisional Patent Appln. Ser. No. 60/575,023 filed May 27, 2004, the contents of the entirety of each of which are incorporated herein by this reference.

STATEMENT ACCORDING TO 37 C.F.R. .sctn.1.52(e)(5)--SEQUENCE LISTING SUBMITTED ON COMPACT DISC

[0002] Pursuant to 37 C.F.R. .sctn.1.52(e)(1)(ii), a compact disc containing an electronic version of the Sequence Listing has been submitted concomitant with this application, the contents of which are hereby incorporated herein by reference. A second compact disc is being submitted herewith and is an identical copy of the first compact disc. The discs are labeled "copy 1" and "copy 2," respectively, and each disc contains one file entitled "Sequence Listing 2578-7990US.txt" which is 337 KB and was created on Oct. 30, 2006.

TECHNICAL FIELD

[0003] The invention relates generally to biotechnology and medicine. In particular, the invention relates to binding molecules directed against rabies, such as virus-neutralizing binding molecules. The binding molecules are useful in the post-exposure prophylaxis of rabies.

BACKGROUND

[0004] Rabies is a viral infection with nearly worldwide distribution that affects principally wild and domestic animals but also involves humans, resulting in a devastating, almost invariably fatal encephalitis. Annually, more than 70,000 human fatalities are estimated, and millions of others require post-exposure treatment.

[0005] The rabies virus is a bullet-shaped, enveloped, single-stranded RNA virus classified in the rhabdovirus family and Lyssavirus genus. The genome of rabies virus codes for five viral proteins: RNA-dependent RNA polymerase (L); a nucleoprotein (N); a phosphorylated protein (P); a matrix protein (M) located on the inner side of the viral protein envelope; and an external surface glycoprotein (G).

[0006] The G protein (62-67 kDa) is a type-I glycoprotein composed of 505 amino acids that has two to four potential N-glycosylation sites, of which only one or two are glycosylated depending on the virus strains. The G protein forms the protrusions that cover the outer surface of the virion envelope and is known to induce virus-neutralizing antibodies.

[0007] Rabies can be treated or prevented by both passive and active immunizations. Rabies post-exposure prophylaxis includes prompt local wound care and administration of both passive (anti-rabies immunoglobulins) and active (vaccines) immunizations.

[0008] Currently, the anti-rabies immunoglobulins (RIG) are prepared from the serum samples of either rabies virus-immune humans (HRIG) or rabies virus-immune horses (ERIG). A disadvantage of ERIG as well as HRIG is that they are not available in sufficient amounts and, in case of HRIG, are too expensive. In addition, the use of ERIG might lead to adverse reactions such as anaphylactic shock. The possibility of contamination by known or unknown pathogens is an additional concern associated with HRIG. To overcome these disadvantages it has been suggested to use monoclonal antibodies capable of neutralizing rabies virus in post-exposure prophylaxis. Rabies virus-neutralizing murine monoclonal antibodies are known in the art (see, Schumacher et al., 1989). However, the use of murine antibodies in vivo is limited due to problems associated with administration of murine antibodies to humans, such as short serum half life, an inability to trigger certain human effector functions and elicitation of an unwanted dramatic immune response against the murine antibody in a human (the "human anti-mouse antibody" (HAMA) reaction).

[0009] Recently, human rabies virus-neutralizing monoclonal antibodies have been described (see, Dietzschold et al., 1990, Champion et al., 2000, and Hanlon et al., 2001). For human anti-rabies monoclonal antibodies to be as effective as HRIG in post-exposure prophylaxis a mixture of monoclonal antibodies should be used. In such a mixture each antibody should bind to a different epitope or site on the virus to prevent the escape of resistant variants of the virus.

[0010] Currently, a significant need still exists for new human rabies virus-neutralizing monoclonal antibodies having improved post-exposure prophylactic potential, particularly antibodies having different epitope-recognition specificities.

SUMMARY OF THE INVENTION

[0011] Described are human monoclonal antibodies that offer the potential to be used in mixtures useful in the post-exposure prophylaxis of a wide range of rabies viruses and neutralization-resistant variants thereof.

[0012] Herebelow follow definitions of terms as used herein.

DEFINITIONS

[0013] Binding molecule: As used herein the term "binding molecule" refers to an intact immunoglobulin including monoclonal antibodies, such as chimeric, humanized or human monoclonal antibodies, or to an antigen-binding and/or variable domain comprising fragment of an immunoglobulin that competes with the intact immunoglobulin for specific binding to the binding partner of the immunoglobulin, e.g., rabies virus or a fragment thereof such as, for instance, the G protein. Regardless of structure, the antigen-binding fragment binds with the same antigen that is recognized by the intact immunoglobulin. An antigen-binding fragment can comprise a peptide or polypeptide comprising an amino acid sequence of at least two contiguous amino acid residues, at least five contiguous amino acid residues, at least ten contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 35 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues, or at least 250 contiguous amino acid residues of the amino acid sequence of the binding molecule.

[0014] The term "binding molecule," as used herein includes all immunoglobulin classes and subclasses known in the art. Depending on the amino acid sequence of the constant domain of their heavy chains, binding molecules can be divided into the five major classes of intact antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgA1, IgA2, IgG1, IgG2, IgG3 and IgG4.

[0015] Antigen-binding fragments include, inter alia, Fab, F(ab'), F(ab').sub.2, Fv, dAb, Fd, complementarity determining region (CDR) fragments, single-chain antibodies (scFv), bivalent single-chain antibodies, single-chain phage antibodies, diabodies, triabodies, tetrabodies, (poly)peptides that contain at least a fragment of an immunoglobulin that is sufficient to confer specific antigen binding to the (poly)peptide, etc. The above fragments may be produced synthetically or by enzymatic or chemical cleavage of intact immunoglobulins or they may be genetically engineered by recombinant DNA techniques. The methods of production are well known in the art and are described, for example, in "Antibodies: A Laboratory Manual," edited by E. Harlow and D. Lane (1988), Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., which is incorporated herein by reference. A binding molecule or antigen-binding fragment thereof may have one or more binding sites. If there is more than one binding site, the binding sites may be identical to one another or they may be different.

[0016] The binding molecule can be a naked or unconjugated binding molecule but can also be part of an immunoconjugate. A naked or unconjugated binding molecule is intended to refer to a binding molecule that is not conjugated, operatively linked or otherwise physically or functionally associated with an effector moiety or tag, such as inter alia a toxic substance, a radioactive substance, a liposome, or an enzyme. It will be understood that naked or unconjugated binding molecules do not exclude binding molecules that have been stabilized, multimerized, humanized or in any other way manipulated, other than by the attachment of an effector moiety or tag. Accordingly, all post-translationally modified naked and unconjugated binding molecules are included herewith, including where the modifications are made in the natural binding molecule-producing cell environment, by a recombinant-binding molecule-producing cell, and are introduced by the hand of man after initial binding molecule preparation. Of course, the term naked or unconjugated binding molecule does not exclude the ability of the binding molecule to form functional associations with effector cells and/or molecules after administration to the body, as some of such interactions are necessary in order to exert a biological effect. The lack of associated effector group or tag is therefore applied in definition to the naked or unconjugated binding molecule in vitro, not in vivo.

[0017] Complementarily determining regions (CDR): The term "complementarity determining regions" as used herein means sequences within the variable regions of binding molecules, such as immunoglobulins, that usually contribute to a large extent to the antigen-binding site which is complementary in shape and charge distribution to the epitope recognized on the antigen. The CDR regions can be specific for linear epitopes, discontinuous epitopes, or conformational epitopes of proteins or protein fragments, either as present on the protein in its native conformation or, in some cases, as present on the proteins as denatured, e.g., by solubilization in SDS. Epitopes may also consist of post-translational modifications of proteins.

[0018] Functional variant: The term "functional variant," as used herein, refers to a binding molecule that comprises a nucleotide and/or amino acid sequence that is altered by one or more nucleotides and/or amino acids compared to the nucleotide and/or amino acid sequences of the parent binding molecule and that is still capable of competing for binding to the binding partner, e.g., rabies virus or a fragment thereof, with the parent binding molecule. In other words, the modifications in the amino acid and/or nucleotide sequence of the parent binding molecule do not significantly affect or alter the binding characteristics of the binding molecule encoded by the nucleotide sequence or containing the amino acid sequence, i.e., the binding molecule is still able to recognize and bind its target. The functional variant may have conservative sequence modifications including nucleotide and amino acid substitutions, additions and deletions. These modifications can be introduced by standard techniques known in the art, such as site-directed mutagenesis and random PCR-mediated mutagenesis, and may comprise natural as well as non-natural nucleotides and amino acids.

[0019] Conservative amino acid substitutions include the ones in which the amino acid residue is replaced with an amino acid residue having similar structural or chemical properties. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan). It will be clear to the skilled artisan that other classifications of amino acid residue families than the one used above can also be employed. Furthermore, a variant may have non-conservative amino acid substitutions, e.g., replacement of an amino acid with an amino acid residue having different structural or chemical properties. Similar minor variations may also include amino acid deletions or insertions, or both. Guidance in determining which amino acid residues may be substituted, inserted, or deleted without abolishing immunological activity may be found using computer programs well known in the art.

[0020] A mutation in a nucleotide sequence can be a single alteration made at a locus (a point mutation), such as transition or transversion mutations, or alternatively, multiple nucleotides may be inserted, deleted or changed at a single locus. In addition, one or more alterations may be made at any number of loci within a nucleotide sequence. The mutations may be performed by any suitable method known in the art.

[0021] Host: The term "host," as used herein, is intended to refer to an organism or a cell into which a vector such as a cloning vector or an expression vector has been introduced. The organism or cell can be prokaryotic or eukaryotic. It should be understood that this term is intended to refer not only to the particular subject organism or cell, but to the progeny of such an organism or cell as well. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent organism or cell, but are still included within the scope of the term "host" as used herein.

[0022] Human: The term "human," when applied to binding molecules as defined herein, refers to molecules that are either directly derived from a human or based upon a human sequence. When a binding molecule is derived from or based on a human sequence and subsequently modified, it is still to be considered human as used throughout the specification. In other words, the term human, when applied to binding molecules is intended to include binding molecules having variable and constant regions derived from human germline immunoglobulin sequences based on variable or constant regions either or not occurring in a human or human lymphocyte or in modified form. Thus, the human binding molecules may include amino acid residues not encoded by human germline immunoglobulin sequences, comprise substitutions and/or deletions (e.g., mutations introduced by, for instance, random or site-specific mutagenesis in vitro or by somatic mutation in vivo). "Based on" as used herein refers to the situation that a nucleic acid sequence may be exactly copied from a template, or with minor mutations, such as by error-prone PCR methods, or synthetically made matching the template exactly or with minor modifications. Semisynthetic molecules based on human sequences are also considered to be human as used herein.

[0023] Monoclonal antibody: The term "monoclonal antibody" as used herein refers to a preparation of antibody molecules of single molecular composition, i.e., primary structure, i.e., having a single amino acid sequence. A monoclonal antibody displays a single binding specificity and affinity for a particular epitope. Accordingly, the term "human monoclonal antibody" refers to an antibody displaying a single binding specificity which has variable and constant regions derived from, or based on, human germline immunoglobulin sequences or derived from completely synthetic sequences. The method of preparing the monoclonal antibody is not relevant.

[0024] Nucleic acid molecule: The term "nucleic acid molecule" as used in the invention refers to a polymeric form of nucleotides and includes both sense and antisense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A nucleotide refers to a ribonucleotide, deoxynucleotide or a modified form of either type of nucleotide. The term also includes single- and double-stranded forms of DNA. In addition, a polynucleotide may include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages. The nucleic acid molecules may be modified chemically or biochemically or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.). The above term is also intended to include any topological conformation, including single-stranded, double-stranded, partially duplexed, triplex, hair-pinned, circular and padlocked conformations. Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule. A reference to a nucleic acid sequence encompasses its complement unless otherwise specified. Thus, a reference to a nucleic acid molecule having a particular sequence should be understood to encompass its complementary strand, with its complementary sequence. The complementary strand is also useful, e.g., for antisense therapy, hybridization probes and PCR primers.

[0025] Pharmaceutically acceptable excipient: By "pharmaceutically acceptable excipient" is meant any inert substance that is combined with an active molecule such as a drug, agent, or binding molecule for preparing an agreeable or convenient dosage form. The "pharmaceutically acceptable excipient" is an excipient that is non-toxic, or at least of which the toxicity is acceptable for its intended use, to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation comprising the drug, agent or binding molecule.

[0026] Post exposure prophylaxis: "Post exposure prophylaxis" (PEP) is indicated for persons possibly exposed to a rabid animal. Possible exposures include bite exposure (i.e., any penetration of the skin by teeth) including animal bites, and non-bite exposure. Non-bite exposures include exposure to large amounts of aerosolized rabies virus in laboratories or caves and surgical recipients of corneas transplanted from patients who died of rabies. The contamination of open wounds, abrasions, mucous membranes, or theoretically, scratches, with saliva or other potentially infectious material (such as neural tissue) from a rabid animal also constitutes a non-bite exposure. Other contact by itself, such as petting a rabid animal and contact with blood, urine, or feces of a rabid animal, does not constitute an exposure and is not an indication for prophylaxis. PEP should begin as soon as possible after an exposure. If no exposure has occurred post exposure prophylaxis is not necessary. In all post exposure prophylaxis regimens, except for persons previously immunized, active and passive immunizations should be used concurrently.

[0027] Specifically Binding: The term "specifically binding," as used herein, in reference to the interaction of a binding molecule, e.g., an antibody, and its binding partner, e.g., an antigen, means that the interaction is dependent upon the presence of a particular structure, e.g., an antigenic determinant or epitope, on the binding partner. In other words, the antibody preferentially binds or recognizes the binding partner even when the binding partner is present in a mixture of other molecules or organisms. The binding may be mediated by covalent or non-covalent interactions or a combination of both. In yet other words, the term "specifically binding" means immunospecifically binding to an antigen or a fragment thereof and not immunospecifically binding to other antigens. A binding molecule that immunospecifically binds to an antigen may bind to other peptides or polypeptides with lower affinity as determined by, e.g., radioimmunoassays (RIA), enzyme-linked immunosorbent assays (ELISA), BIACORE, or other assays known in the art. Binding molecules or fragments thereof that immunospecifically bind to an antigen may be cross-reactive with related antigens. In certain embodiments, binding molecules or fragments thereof that immunospecifically bind to an antigen do not cross-react with other antigens.

[0028] Therapeutically effective amount: The term "therapeutically effective amount" refers to an amount of the binding molecule as defined herein that is effective for post-exposure prophylaxis of rabies.

[0029] Vector: The term "vector" denotes a nucleic acid molecule into which a second nucleic acid molecule can be inserted for introduction into a host where it will be replicated, and in some cases expressed. In other words, a vector is capable of transporting a nucleic acid molecule to which it has been linked. Cloning as well as expression vectors are contemplated by the term "vector," as used herein. Vectors include, but are not limited to, plasmids, cosmids, bacterial artificial chromosomes (BAC) and yeast artificial chromosomes (YAC) and vectors derived from bacteriophages or plant or animal (including human) viruses. Vectors comprise an origin of replication recognized by the proposed host and in case of expression vectors, promoter and other regulatory regions recognized by the host. A vector containing a second nucleic acid molecule is introduced into a cell, for example, by transformation, transfection, or by making use of bacterial or viral entry mechanisms. Other ways of introducing nucleic acid into cells are known, such as electroporation or particle bombardment often used with plant cells, and the like. The method of introducing nucleic acid into cells depends among other things on the type of cells, and so forth. This is not critical to the invention. Certain vectors are capable of autonomous replication in a host into which they are introduced (e.g., vectors having a bacterial origin of replication can replicate in bacteria). Other vectors can be integrated into the genome of a host upon introduction into the host, and thereby are replicated along with the host genome.

[0030] Provided are binding molecules capable of specifically binding to and neutralizing rabies virus. Furthermore, described are nucleic acid molecules encoding at least the binding region of these binding molecules. The invention further provides for the use of the binding molecules of the invention in the post exposure prophylaxis of a subject at risk of developing a condition resulting from rabies virus.

DESCRIPTION OF THE FIGURES

[0031] FIG. 1 shows the comparison of the amino acid sequences of the rabies virus strain CVS-11 and E57 escape viruses. Virus-infected cells were harvested two days post-infection and total RNA was isolated. cDNA was generated and used for DNA sequencing. Regions containing mutations are shown and the mutations are indicated in bold. FIG. 1A shows the comparison of the nucleotide sequences. Numbers above amino acids indicate amino acid numbers from rabies virus glycoprotein including signal peptide. FIG. 1B shows the comparison of amino acid sequences. Schematic drawing of rabies virus glycoprotein is shown on top. The black box indicates the signal peptide, while the gray box indicates the transmembrane domain. The sequences in FIG. 1 are also represented by SEQ ID NOS:130 through 141 of the incorporated SEQUENCE LISTING.

[0032] FIG. 2 shows the comparison of the amino acid sequences of the rabies virus strain CVS-11 and EJB escape viruses. Virus-infected cells were harvested two days post-infection and total RNA was isolated. cDNA was generated and used for DNA sequencing. Regions containing mutations are shown and the mutations are indicated in bold. FIG. 2A shows the comparison of the nucleotide sequences. Numbers above amino acids indicate amino acid numbers from rabies virus glycoprotein including the signal peptide. FIG. 2B shows the comparison of amino acid sequences. Schematic drawing of rabies virus glycoprotein is shown on top. The black box indicates the signal peptide, while the gray box indicates the transmembrane domain. The sequences in FIG. 2 are also represented by SEQ ID NOS:142 through 151.

[0033] FIG. 3 shows the vector PDV-C06.

[0034] FIG. 4 shows a competition ELISA of anti-rabies virus scFvs and the biotinylated anti-rabies virus antibody called CR-57. ELISA plates coated with purified rabies virus G protein were incubated with the respective scFvs before addition of CR-57bio (0.5 .mu.g/ml). Subsequently, CR-57bio binding was monitored in absence and presence of scFvs.

[0035] FIG. 5 shows a competition ELISA of anti-rabies virus scFvs and the anti-rabies virus antibody called CR-57. ELISA plates coated with purified rabies virus G protein were incubated with CR-57 (1 .mu.g/ml) before addition of excess scFvs. Subsequently, scFv binding was monitored in absence and presence of CR-57.

[0036] FIG. 6 shows a competition ELISA assay of anti-rabies virus G protein IgGs and the anti-rabies virus antibody called CR-57. G protein (ERA strain) was incubated with unlabeled IgGs (shown on the X-axis). Biotinylated CR57 (CR57bio) was added and allowed to bind to the G protein before visualization by means of streptavidin-HRP. ELISA signals are shown as percentage of CR57bio binding alone.

[0037] FIG. 7 shows a competition FACS assay of anti-rabies virus G protein IgGs and the anti-rabies virus antibody called CR-57. G protein (ERA strain) expressing PER.C6.RTM. cells were incubated with unlabeled IgGs (shown on the X-axis). Biotinylated CR57 (CR57bio) was added and allowed to bind to the G protein expressing cells before visualization by means of streptavidin-PE. FACS signals are shown as percentage of CR57bio binding alone.

[0038] FIG. 8 shows the comparison of the amino acid sequences of CVS-11 and E98 escape viruses. Virus-infected cells were harvested two days post-infection and total RNA was isolated. cDNA was generated and used for DNA sequencing. Region containing a point mutation is shown and the mutation is indicated in bold. FIG. 8A shows the comparison of the nucleotide sequences SEQ ID NOS:745 and 746. The number above the nucleotide indicates the mutated nucleotide (indicated in bold) from rabies virus glycoprotein open reading frame without signal peptide sequence. FIG. 8B shows the comparison of amino acid sequences SEQ ID NOS:747 and 748. The number above the amino acid indicates the mutated amino acid (indicated in bold) from rabies virus glycoprotein without signal peptide sequence.

[0039] FIG. 9 shows a phylogenetic tree of 123 rabies street viruses (123 rabies virus G glycoprotein sequences, Neighbor joining, Kimura-2-parameter method, 500 bootstraps). Bold indicates viruses harboring the N>D mutation as observed in E98 escape viruses.

[0040] FIG. 10 shows neutralizing epitopes on rabies glycoprotein. A schematic drawing of the rabies virus glycoprotein is shown depicting the antigenic sites including the novel CR57 epitope. The signal peptide (19 amino acids) and transmembrane domain are indicated by black boxes. Disulfide bridges are indicated. Amino acid numbering is from the mature protein minus the signal peptide sequence.

DETAILED DESCRIPTION OF THE INVENTION

[0041] In a first aspect, the invention encompasses binding molecules capable of specifically binding to rabies virus. In certain embodiments, the binding molecules of the invention also have rabies virus-neutralizing activity. In certain embodiments, the binding molecules of the invention are human binding molecules. Alternatively, they may also be binding molecules of other animals. Rabies virus is part of the Lyssavirus genus. In total, the Lyssavirus genus includes eleven genotypes: rabies virus (genotype 1), Lagos bat virus (genotype 2), Mokola virus (genotype 3), Duvenhage virus (genotype 4), European bat lyssavirus 1 (genotype 5), European bat lyssavirus 2 (genotype 6), Australian bat lyssavirus (genotype 7), Aravan virus (genotype 8), Khujand virus (genotype 9), Irkut virus (genotype 10) and West Caucasian virus (genotype 11). Besides binding to rabies virus, the binding molecules of the invention may also be capable of binding to other genotypes of the Lyssavirus genus. In certain embodiments, the binding molecules may also be capable of neutralizing other genotypes of the Lyssavirus genus. Furthermore, the binding molecules of the invention may even be capable of binding to and/or neutralizing viruses, other than Lyssaviruses, of the rhabdovirus family. This family includes the genera cytorhabdovirus, ephemerovirus, lyssavirus, nucleorhabdovirus, rhabdovirus and vesiculovirus.

[0042] The binding molecules may be capable of specifically binding to rabies virus in its natural form or in its inactivated/attenuated form. Inactivation of rabies virus may be performed by treatment with inter alia beta-propiolactone (BPL) (White and Chappel, 1982), heating at 56.degree. C. for more than 30 minutes, gamma irradiation, treatment with acetylethylenimine or ethylenimine or treatment with ascorbic acid and copper sulfate for 72 hours (Madhusudana et al., 2004). General viral inactivation methods well known to the skilled artisan such as inter alia pasteurization (wet heat), dry heat treatment, vapor heat treatment, treatment with low pH, treatment with organic solvent/detergent, nanofiltration; UV light irradiation may also be used. In certain embodiments, the inactivation is performed by treatment with beta-propiolactone (BPL). Methods to test if rabies virus is still infective or partly or completely inactivated are well known to the person skilled in the art and can among others be found in "Laboratory techniques in rabies," edited by F.-X. Meslin, M. M. Kaplan and H. Koprowski (1996), 4th edition, Chapter 36, World Health Organization, Geneva.

[0043] The binding molecules may also be capable of specifically binding to one or more fragments of the rabies virus such as inter alia a preparation of one or more proteins and/or (poly)peptides derived from rabies virus or a cell transfected with a rabies virus protein and/or (poly)peptide. For methods of treatment and/or prevention such as methods for post exposure prophylaxis of rabies virus the binding molecules are preferably capable of specifically binding to surface accessible proteins of rabies virus such as the M (see, Ameyama et al. 2003) or G protein. For diagnostic purposes, the human binding molecules may also be capable of specifically binding to proteins not present on the surface of rabies virus. The amino acid sequence of surface accessible and internal proteins of various known strains of rabies virus can be found in the EMBL-database and/or other databases.

[0044] In certain embodiments, the fragment at least comprises an antigenic determinant recognized by the human binding molecules of the invention. An "antigenic determinant" as used herein is a moiety, such as a rabies virus (poly)peptide, (glyco)protein, or analog or fragment thereof, that is capable of binding to a human binding molecule of the invention with sufficiently high affinity to form a detectable antigen-binding molecule complex.

[0045] The binding molecules according to the invention can be intact immunoglobulin molecules such as polyclonal or monoclonal antibodies, in particular human monoclonal antibodies, or the binding molecules can be antigen-binding fragments including, but not limited to, Fab, F(ab'), F(ab').sub.2, Fv, dAb, Fd, complementarity determining region (CDR) fragments, single-chain antibodies (scFv), bivalent single-chain antibodies, single-chain phage antibodies, diabodies, triabodies, tetrabodies, and (poly)peptides that contain at least a fragment of an immunoglobulin that is sufficient to confer specific antigen binding to the rabies virus or fragment thereof. The binding molecules of the invention can be used in non-isolated or isolated form. Furthermore, the binding molecules of the invention can be used alone or in a mixture comprising at least one human binding molecule (or variant or fragment thereof). In other words, the binding molecules can be used in combination, e.g., as a pharmaceutical composition comprising two or more binding molecules, variants or fragments thereof. For example, binding molecules having rabies virus-neutralizing activity can be combined in a single therapy to achieve a desired prophylactic, therapeutic or diagnostic effect.

[0046] RNA viruses such as rabies virus make use of their own RNA polymerase during virus replication. These RNA polymerases tend to be error-prone. This leads to the formation of so-called quasi-species during a viral infection. Each quasi-species has a unique RNA genome, which could result in differences in amino acid composition of viral proteins. If such mutations occur in structural viral proteins, the virus could potentially escape from the host's immune system due to a change in T or B cell epitopes. The likelihood of this to happen is higher when individuals are treated with a mixture of two binding molecules, such as human monoclonal antibodies, than with a polyclonal antibody mixture (HRIG). Therefore, a prerequisite for a mixture of two human monoclonal antibodies for treatment of rabies is that the two antibodies recognize non-overlapping, non-competing epitopes on their target antigen, i.e., rabies virus glycoprotein. The chance of the occurrence of rabies escape viruses is thereby minimized. As a consequence thereof, the binding molecules of the invention preferably are capable of reacting with different, non-overlapping, non-competing epitopes of the rabies virus, such as epitopes on the rabies virus G protein. The mixture of binding molecules may further comprise at least one other therapeutic agent such as a medicament suitable for the post exposure prophylaxis of rabies.

[0047] Typically, binding molecules according to the invention can bind to their binding partners, i.e., rabies virus or fragments thereof such as rabies virus proteins, with an affinity constant (K.sub.d-value) that is lower than 0.2*10.sup.-4 M, 1.0*10.sup.-5 M, 1.0*10.sup.-6 M, 1.0*10.sup.-7 M, preferably lower than 1.0*10.sup.-8 M, more preferably lower than 1.0*10.sup.-9 M, more preferably lower than 1.0*10.sup.-1.degree. M, even more preferably lower than 1.0*10.sup.-11 M, and in particular lower than 1.0*10.sup.-12 M. The affinity constants can vary for antibody isotypes. For example, affinity binding for an IgM isotype refers to a binding affinity of at least about 1.0*10.sup.-7 M. Affinity constants can for instance be measured using surface plasmon resonance, i.e., an optical phenomenon that allows for the analysis of real-time biospecific interactions by detection of alterations in protein concentrations within a biosensor matrix, for example, using the BIACORE system (Pharmacia Biosensor AB, Uppsala, Sweden).

[0048] The binding molecules according to the invention may bind to rabies virus in purified/isolated or non-purified/non-isolated form. The binding molecules may bind to rabies virus in soluble form such as, for instance, in a sample or may bind to rabies virus bound or attached to a carrier or substrate, e.g., microtiter plates, membranes and beads, etc. Carriers or substrates may be made of glass, plastic (e.g., polystyrene), polysaccharides, nylon, nitrocellulose, or teflon, etc. The surface of such supports may be solid or porous and of any convenient shape. Alternatively, the binding molecules may also bind to fragments of rabies virus, such as proteins or (poly)peptides of the rabies virus. In certain embodiments, the binding molecules are capable of specifically binding to the rabies virus G protein or fragment thereof. The rabies virus proteins or (poly)peptides may either be in soluble form or may bind to rabies virus bound or attached to a carrier or substrate as described above. In certain embodiments, cells transfected with the G protein may be used as binding partner for the binding molecules.

[0049] In certain embodiments, the binding molecules of the invention neutralize rabies virus infectivity. This may be achieved by preventing the attachment of rabies virus to its receptors on host cells, such as inter alia the murine p75 neurotrophin receptor, the neural cell adhesion molecule (CD56) and the acetylcholine receptor, or inhibition of the release of RNA into the cytoplasm of the cell or prevention of RNA transcription or translation. In a specific embodiment, the binding molecules of the invention prevent rabies virus from infecting host cells by at least 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 10% relative to infection of host cells by rabies virus in the absence of the binding molecules. Neutralization can, for instance, be measured as described in "Laboratory techniques in rabies," edited by F.-X. Meslin, M. M. Kaplan and H. Koprowski (1996), 4th edition, Chapters 15-17, World Health Organization, Geneva. Furthermore, the human binding molecules of the invention may be complement fixing binding molecules capable of assisting in the lysis of enveloped rabies virus. The human binding molecules of the invention might also act as opsonins and augment phagocytosis of rabies virus either by promoting its uptake via Fc or C3b receptors or by agglutinating rabies virus to make it more easily phagocytosed.

[0050] In a preferred embodiment, the binding molecules according to the invention comprise at least a CDR3 region comprising the amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 and SEQ ID NO:24. In certain embodiments, the CDR3 region is a heavy chain CDR3 region.

[0051] In yet another embodiment, the binding molecules according to the invention comprise a variable heavy chain comprising essentially an amino acid sequence selected from the group consisting of SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48 and SEQ ID NO:49. In a preferred embodiment, the binding molecules according to the invention comprise a variable heavy chain comprising essentially an amino acid sequence comprising amino acids 1-119 of SEQ ID NO:335.

[0052] In a further embodiment, the binding molecules according to the invention comprise a variable heavy chain comprising the amino acid sequence of SEQ ID NO:26 and a variable light chain comprising the amino acid sequence of SEQ ID NO:50, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:27 and a variable light chain comprising the amino acid sequence of SEQ ID NO:51, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:28 and a variable light chain comprising the amino acid sequence of SEQ ID NO:52, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:29 and a variable light chain comprising the amino acid sequence of SEQ ID NO:53, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:30 and a variable light chain comprising the amino acid sequence of SEQ ID NO:54, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:31 and a variable light chain comprising the amino acid sequence of SEQ ID NO:55, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:32 and a variable light chain comprising the amino acid sequence of SEQ ID NO:56, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:33 and a variable light chain comprising the amino acid sequence of SEQ ID NO:57, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:34 and a variable light chain comprising the amino acid sequence of SEQ ID NO:58, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:35 and a variable light chain comprising the amino acid sequence of SEQ ID NO:59, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:36 and a variable light chain comprising the amino acid sequence of SEQ ID NO:60, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:37 and a variable light chain comprising the amino acid sequence of SEQ ID NO:61, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:38 and a variable light chain comprising the amino acid sequence of SEQ ID NO:62, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:39 and a variable light chain comprising the amino acid sequence of SEQ ID NO:63, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:40 and a variable light chain comprising the amino acid sequence of SEQ ID NO:64, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:41 and a variable light chain comprising the amino acid sequence of SEQ ID NO:65, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:42 and a variable light chain comprising the amino acid sequence of SEQ ID NO:66, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:43 and a variable light chain comprising the amino acid sequence of SEQ ID NO:67, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:44 and a variable light chain comprising the amino acid sequence of SEQ ID NO:68, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:45 and a variable light chain comprising the amino acid sequence of SEQ ID NO:69, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:46 and a variable light chain comprising the amino acid sequence of SEQ ID NO:70, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:47 and a variable light chain comprising the amino acid sequence of SEQ ID NO:71, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:48 and a variable light chain comprising the amino acid sequence of SEQ ID NO:72, a variable heavy chain comprising the amino acid sequence of SEQ ID NO:49 and a variable light chain comprising the amino acid sequence of SEQ ID NO:73. In a preferred embodiment, the human binding molecules according to the invention comprise a variable heavy chain comprising the amino acid sequence comprising amino acids 1-119 of SEQ ID NO:335 and a variable light chain comprising the amino acid sequence comprising amino acids 1-107 of SEQ ID NO:337.

[0053] In a preferred embodiment, the binding molecules having rabies virus-neutralizing activity of the invention are administered in IgG format, preferably IgG1 format.

[0054] Another aspect of the invention includes functional variants of binding molecules as defined herein. Molecules are considered to be "functional variants of a binding molecule according to the invention," if the variants are capable of competing for specific binding to rabies virus or a fragment thereof with the parent binding molecules; in other words, when the functional variants are still capable of binding to rabies virus or a fragment thereof. Functional variants should also still have rabies virus-neutralizing activity. Functional variants include, but are not limited to, derivatives that are substantially similar in primary structural sequence, but which contain e.g., in vitro or in vivo modifications, chemical and/or biochemical, that are not found in the parent binding molecule. Such modifications include inter alia acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI-anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, ubiquitination, and the like.

[0055] Alternatively, functional variants can be binding molecules as defined in the invention comprising an amino acid sequence containing substitutions, insertions, deletions or combinations thereof of one or more amino acids compared to the amino acid sequences of the parent binding molecules. Furthermore, functional variants can comprise truncations of the amino acid sequence at either or both the amino or carboxy termini. Functional variants according to the invention may have the same or different, either higher or lower, binding affinities compared to the parent binding molecule but are still capable of binding to rabies virus or a fragment thereof and are still capable of neutralizing rabies virus. For instance, functional variants according to the invention may have increased or decreased binding affinities for rabies virus or a fragment thereof compared to the parent binding molecules or may have a higher or lower rabies virus-neutralizing activity. In certain embodiments, the amino acid sequences of the variable regions, including, but not limited to, framework regions, hypervariable regions, in particular the CDR3 regions, are modified. Generally, the light chain and the heavy chain variable regions comprise three hypervariable regions, comprising three CDRs, and more conserved regions, the so-called framework regions (FRs). The hypervariable regions comprise amino acid residues from CDRs and amino acid residues from hypervariable loops. Functional variants intended to fall within the scope of the invention have at least about 50% to about 99%, preferably at least about 60% to about 99%, more preferably at least about 70% to about 99%, even more preferably at least about 80% to about 99%, most preferably at least about 90% to about 99%, in particular at least about 95% to about 99%, and in particular at least about 97% to about 99% amino acid sequence homology with the parent binding molecules as defined herein. Computer algorithms such as inter alia Gap or Bestfit known to a person skilled in the art can be used to optimally align amino acid sequences to be compared and to define similar or identical amino acid residues.

[0056] In certain embodiments, functional variants may be produced when the parent binding molecule comprises a glycosylation site in its sequence that results in glycosylation of the binding molecule upon expression in eukaryotic cells and hence might abrogate the binding to the antigen. The functional variant produced no longer contains the glycosylation site, but will be capable of binding to rabies virus and still have neutralizing activity.

[0057] Functional variants can be obtained by altering the parent binding molecules or parts thereof by general molecular biology methods known in the art including, but not limited to, error-prone PCR, oligonucleotide-directed mutagenesis and site-directed mutagenesis. Furthermore, the functional variants may have complement fixing activity, be capable of assisting in the lysis of enveloped rabies virus and/or act as opsonins and augment phagocytosis of rabies virus either by promoting its uptake via Fc or C3b receptors or by agglutinating rabies virus to make it more easily phagocytosed.

[0058] In yet a further aspect, the invention includes immunoconjugates, i.e., molecules comprising at least one binding molecule or functional variant thereof as defined herein and further comprising at least one tag, such as inter alia a detectable moiety/agent. Also contemplated in the invention are mixtures of immunoconjugates according to the invention or mixtures of at least one immunoconjugate according to the invention and another molecule, such as a therapeutic agent or another binding molecule or immunoconjugate. In a further embodiment, the immunoconjugates of the invention may comprise one or more tags. These tags can be the same or distinct from each other and can be joined/conjugated non-covalently to the binding molecules. The tag(s) can also be joined/conjugated directly to the binding molecules through covalent bonding, including, but not limited to, disulfide bonding, hydrogen bonding, electrostatic bonding, recombinant fusion and conformational bonding. Alternatively, the tag(s) can be joined/conjugated to the binding molecules by means of one or more linking compounds. Techniques for conjugating tags to binding molecules are well known to the skilled artisan.

[0059] The tags of the immunoconjugates of the invention may be therapeutic agents, but preferably they are detectable moieties/agents. Immunoconjugates comprising a detectable agent can be used diagnostically to, for example, assess if a subject has been infected with rabies virus or monitor the development or progression of a rabies virus infection as part of a clinical testing procedure to, e.g., determine the efficacy of a given treatment regimen. However, they may also be used for other detection and/or analytical and/or diagnostic purposes. Detectable moieties/agents include, but are not limited to, enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals, and nonradioactive paramagnetic metal ions.

[0060] The tags used to label the binding molecules for detection and/or analytical and/or diagnostic purposes depend on the specific detection/analysis/diagnosis techniques and/or methods used such as inter alia immunohistochemical staining of (tissue) samples, flow cytometric detection, scanning laser cytometric detection, fluorescent immunoassays, enzyme-linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs), bioassays (e.g., neutralization assays), Western blotting applications, etc. For immunohistochemical staining of tissue samples preferred labels are enzymes that catalyze production and local deposition of a detectable product. Enzymes typically conjugated to binding molecules to permit their immunohistochemical visualization are well known and include, but are not limited to, acetylcholinesterase, alkaline phosphatase, beta-galactosidase, glucose oxidase, horseradish peroxidase, and urease. Typical substrates for production and deposition of visually detectable products are also well known to the skilled person in the art. Next to that, immunoconjugates of the invention can be labeled using colloidal gold or they can be labeled with radioisotopes, such as .sup.33P, .sup.32P, .sup.35S, .sup.3H, and .sup.125I. Binding molecules of the invention can be attached to radionuclides directly or indirectly via a chelating agent by methods well known in the art.

[0061] When the binding molecules of the invention are used for flow cytometric detections, scanning laser cytometric detections, or fluorescent immunoassays, they can usefully be labeled with fluorophores. A wide variety of fluorophores useful for fluorescently labeling the binding molecules of the invention are known to the skilled artisan. When the binding molecules of the invention are used for secondary detection using labeled avidin, streptavidin, captavidin or neutravidin, the binding molecules may be labeled with biotin to form suitable prosthetic group complexes.

[0062] When the immunoconjugates of the invention are used for in vivo diagnostic use, the binding molecules can also be made detectable by conjugation to e.g., magnetic resonance imaging (MRI) contrast agents, such as gadolinium diethylenetriaminepentaacetic acid, to ultrasound contrast agents or to X-ray contrast agents, or by radioisotopic labeling.

[0063] Furthermore, the binding molecules, functional variants thereof or immunoconjugates of the invention can also be attached to solid supports, which are particularly useful for in vitro immunoassays or purification of rabies virus or a fragment thereof. Such solid supports might be porous or nonporous, planar or nonplanar and include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene supports. The human binding molecules can also, for example, usefully be conjugated to filtration media, such as NHS-activated Sepharose or CNBr-activated Sepharose for purposes of immunoaffinity chromatography. They can also usefully be attached to paramagnetic microspheres, typically by biotin-streptavidin interaction. The microspheres can be used for isolation of rabies virus or a fragment thereof from a sample containing rabies virus or a fragment thereof. As another example, the human binding molecules of the invention can usefully be attached to the surface of a microtiter plate for ELISA.

[0064] The binding molecules of the invention or functional variants thereof can be fused to marker sequences, such as a peptide to facilitate purification. Examples include, but are not limited to, the hexa-histidine tag, the hemagglutinin (HA) tag, the myc tag or the flag tag.

[0065] Alternatively, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate. In another aspect, the human binding molecules of the invention may be conjugated/attached to one or more antigens. In certain embodiments, these antigens are antigens that are recognized by the immune system of a subject to which the binding molecule-antigen conjugate is administered. The antigens may be identical but may also differ from each other. Conjugation methods for attaching the antigens and binding molecules are well known in the art and include, but are not limited to, the use of cross-linking agents. The human binding molecules will bind to rabies virus and the antigens attached to the human binding molecules will initiate a powerful T-cell attack on the conjugate which will eventually lead to the destruction of the rabies virus.

[0066] Next to producing immunoconjugates chemically by conjugating, directly or indirectly via, for instance, a linker, the immunoconjugates can be produced as fusion proteins comprising the human binding molecules of the invention and a suitable tag. Fusion proteins can be produced by methods known in the art such as, e.g., recombinantly by constructing nucleic acid molecules comprising nucleotide sequences encoding the human binding molecules in frame with nucleotide sequences encoding the suitable tag(s) and then expressing the nucleic acid molecules.

[0067] It is another aspect of the invention to provide a nucleic acid molecule encoding at least a binding molecule or functional variant thereof according to the invention. Such nucleic acid molecules can be used as intermediates for cloning purposes, e.g., in the process of affinity maturation described above. In a preferred embodiment, the nucleic acid molecules are isolated or purified.

[0068] One of ordinary skill in the art will appreciate that functional variants of these nucleic acid molecules are also intended to be a part of the invention. Functional variants are nucleic acid sequences that can be directly translated, using the standard genetic code, to provide an amino acid sequence identical to that translated from the parent nucleic acid molecules.

[0069] In certain embodiments, the nucleic acid molecules encode binding molecules comprising a CDR3 region, preferably a heavy chain CDR3 region, comprising an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 and SEQ ID NO:24.

[0070] The nucleic acid molecules may encode human binding molecules comprising a variable heavy chain comprising essentially an amino acid sequence selected from the group consisting of SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48 and SEQ ID NO:49. In a particularly preferred embodiment, the nucleic acid molecules encode binding molecules comprising a variable heavy chain comprising essentially an amino acid sequence comprising amino acids 1-119 of SEQ ID NO:335.

[0071] In yet another embodiment, the nucleic acid molecules encode binding molecules comprising a variable heavy chain comprising the amino acid sequence of SEQ ID NO:26 and a variable light chain comprising the amino acid sequence of SEQ ID NO:50, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:27 and a variable light chain comprising the amino acid sequence of SEQ ID NO:51, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:28 and a variable light chain comprising the amino acid sequence of SEQ ID NO:52, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:29 and a variable light chain comprising the amino acid sequence of SEQ ID NO:53, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:30 and a variable light chain comprising the amino acid sequence of SEQ ID NO:54, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:31 and a variable light chain comprising the amino acid sequence of SEQ ID NO:55, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:32 and a variable light chain comprising the amino acid sequence of SEQ ID NO:56, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:33 and a variable light chain comprising the amino acid sequence of SEQ ID NO:57, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ED NO:34 and a variable light chain comprising the amino acid sequence of SEQ ID NO:58, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:35 and a variable light chain comprising the amino acid sequence of SEQ ID NO:59, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:36 and a variable light chain comprising the amino acid sequence of SEQ ID NO:60, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:37 and a variable light chain comprising the amino acid sequence of SEQ ID NO:61, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:38 and a variable light chain comprising the amino acid sequence of SEQ ID NO:62, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:39 and a variable light chain comprising the amino acid sequence of SEQ ID NO:63, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:40 and a variable light chain comprising the amino acid sequence of SEQ ID NO:64, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:41 and a variable light chain comprising the amino acid sequence of SEQ ID NO:65, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:42 and a variable light chain comprising the amino acid sequence of SEQ ID NO:66, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:43 and a variable light chain comprising the amino acid sequence of SEQ ID NO:67, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:44 and a variable light chain comprising the amino acid sequence of SEQ ID NO:68, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:45 and a variable light chain comprising the amino acid sequence of SEQ ID NO:69, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:46 and a variable light chain comprising the amino acid sequence of SEQ ID NO:70, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:47 and a variable light chain comprising the amino acid sequence of SEQ ID NO:71, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:48 and a variable light chain comprising the amino acid sequence of SEQ ID NO:72, or they encode a variable heavy chain comprising the amino acid sequence of SEQ ID NO:49 and a variable light chain comprising the amino acid sequence of SEQ ID NO:73. In a preferred embodiment, the nucleic acid molecules encode human binding molecules comprising a variable heavy chain comprising the amino acid sequence comprising amino acids 1-119 of SEQ ID NO:335 and a variable light chain comprising the amino acid sequence comprising amino acids 1-107 of SEQ ID NO:337.

[0072] In a specific embodiment of the invention, the nucleic acid molecules encoding the variable heavy chain of the binding molecules of the invention comprise essentially a nucleotide sequence selected from the group consisting of SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96 and SEQ ID NO:97. In certain embodiments, the nucleic acid molecules encoding the variable heavy chain of the binding molecules of the invention comprise essentially a nucleotide sequence comprising nucleotides 1-357 of SEQ ID NO:334.

[0073] In yet another specific embodiment of the invention, the nucleic acid molecules encoding the variable light chain of the binding molecules of the invention comprise essentially a nucleotide sequence selected of the group consisting of SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO:106, SEQ ID NO:107, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:110, SEQ ID NO:111, SEQ ID NO:112, SEQ ID NO:113, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120 and SEQ ID NO:121. In certain embodiments, the nucleic acid molecules encoding the variable light chain of the human binding molecules of the invention comprise essentially a nucleotide sequence comprising nucleotides 1-321 of SEQ ID NO:336.

[0074] It is another aspect of the invention to provide vectors, i.e., nucleic acid constructs, comprising one or more nucleic acid molecules according to the invention. Vectors can be derived from plasmids such as inter alia F, R1, RP1, Col, pBR322, TOL, Ti, etc.; cosmids; phages such as lambda, lambdoid, M13, Mu, P1, P22, Q.sub..beta., T-even, T-odd, T2, T4, T7, etc.; plant viruses such as inter alia alfalfa mosaic virus, bromovirus, capillovirus, carlavirus, carmovirus, caulivirus, clostervirus, comovirus, cryptovirus, cucumovirus, dianthovirus, fabavirus, fijivirus, furovirus, geminivirus, hordeivirus, ilarvirus, luteovirus, machlovirus, marafivirus, necrovirus, nepovirus, phytorepvirus, plant rhabdovirus, potexvirus, potyvirus, sobemovirus, tenuivirus, tobamovirus, tobravirus, tomato spotted wilt virus, tombusvirus, tymovirus, etc.; or animal viruses such as inter alia adenovirus, arenaviridae, baculoviridae, birnaviridae, bunyaviridae, calciviridae, cardioviruses, coronaviridae, corticoviridae, cystoviridae, Epstein-Barr virus, enteroviruses, filoviridae, flaviviridae, Foot-and-Mouth disease virus, hepadnaviridae, hepatitis viruses, herpesviridae, immunodeficiency viruses, influenza virus, inoviridae, iridoviridae, orthomyxoviridae, papovaviruses, paramyxoviridae, parvoviridae, picornaviridae, poliovirus, polydnaviridae, poxyiridae, reoviridae, retroviruses, rhabdoviridae, rhinoviruses, Semliki Forest virus, tetraviridae, togaviridae, toroviridae, vaccinia virus, vescular stomatitis virus, etc. Vectors can be used for cloning and/or for expression of the human binding molecules of the invention and might even be used for gene therapy purposes. Vectors comprising one or more nucleic acid molecules according to the invention operably linked to one or more expression-regulating nucleic acid molecules are also covered by the invention. The choice of the vector is dependent on the recombinant procedures followed and the host used. Introduction of vectors in host cells can be effected by inter alia calcium phosphate transfection, virus infection, DEAE-dextran mediated transfection, lipofectamine transfection or electroporation. Vectors may be autonomously replicating or may replicate together with the chromosome into which they have been integrated. In certain embodiments, the vectors contain one or more selection markers. The choice of the markers may depend on the host cells of choice, although this is not critical to the invention as is well known to persons skilled in the art. They include, but are not limited to, kanamycin, neomycin, puromycin, hygromycin, zeocin, thymidine kinase gene from Herpes simplex virus (HSV-TK), and dihydrofolate reductase gene from mouse (dhfr). Vectors comprising one or more nucleic acid molecules encoding the human binding molecules as described above operably linked to one or more nucleic acid molecules encoding proteins or peptides that can be used to isolate the binding molecules are also covered by the invention. These proteins or peptides include, but are not limited to, glutathione-S-transferase, maltose-binding protein, metal-binding polyhistidine, green fluorescent protein, luciferase and beta-galactosidase.

[0075] Hosts containing one or more copies of the vectors mentioned above are an additional subject of the invention. In certain embodiments, the hosts are host cells. Host cells include, but are not limited to, cells of mammalian, plant, insect, fungal or bacterial origin. Bacterial cells include, but are not limited to, cells from Gram positive bacteria such as several species of the genera Bacillus, Streptomyces and Staphylococcus or cells of Gram negative bacteria such as several species of the genera Escherichia, such as E. coli, and Pseudomonas. In the group of fungal cells preferably yeast cells are used. Expression in yeast can be achieved by using yeast strains such as inter alia Pichia pastoris, Saccharomyces cerevisiae and Hansenula polymorpha. Furthermore, insect cells such as cells from Drosophila and Sf9 can be used as host cells. Besides that, the host cells can be plant cells. Transformed (transgenic) plants or plant cells are produced by known methods, for example, Agrobacterium-mediated gene transfer, transformation of leaf discs, protoplast transformation by polyethylene glycol-induced DNA transfer, electroporation, sonication, microinjection or bolistic gene transfer. Additionally, a suitable expression system can be a baculovirus system. Expression systems using mammalian cells, such as Chinese Hamster Ovary (CHO) cells, COS cells, BHK cells or Bowes melanoma cells, are preferred in the invention. Mammalian cells provide expressed proteins with post-translational modifications that are most similar to natural molecules of mammalian origin. Since the invention deals with molecules that may have to be administered to humans, a completely human expression system would be particularly preferred. Therefore, even more preferably, the host cells are human cells. Examples of human cells are inter alia HeLa, 911, AT1080, A549, 293 and HEK293T cells. Preferred mammalian cells are human retina cells such as 911 cells or the cell line deposited at the European Collection of Cell Cultures (ECACC), CAMR, Salisbury, Wiltshire SP4 OJG, Great Britain on 29 Feb. 1996 under number 96022940 and marketed under the trademark PER.C6.RTM. (PER.C6 is a registered trademark of Crucell Holland B. V.). For the purposes of this application "PER.C6" refers to cells deposited under number 96022940 or ancestors, passages up-stream or downstream as well as descendants from ancestors of deposited cells, as well as derivatives of any of the foregoing.

[0076] In preferred embodiments, the human producer cells comprise at least a functional part of a nucleic acid sequence encoding an adenovirus E1 region in expressible format. In even more preferred embodiments, the host cells are derived from a human retina and immortalized with nucleic acids comprising adenoviral E1 sequences, such as the cell line deposited at the European Collection of Cell Cultures (ECACC), CAMR, Salisbury, Wiltshire SP4 OJG, Great Britain on 29 Feb. 1996 under number 96022940 and marketed under the trademark PER.C6.RTM.. Production of recombinant proteins in host cells can be performed according to methods well known in the art. The use of the cells marketed under the trademark PER.C6.RTM. as a production platform for proteins of interest has been described in WO 00/63403, the disclosure of which is incorporated herein by reference in its entirety.

[0077] A method of producing a binding molecule or a functional variant according to the invention is an additional part of the invention. The method comprises the steps of (a) culturing a host according to the invention under conditions conducive to the expression of the binding molecule or functional variant thereof, and (b) optionally, recovering the expressed binding molecule or functional variant thereof. The expressed binding molecules or functional variants thereof can be recovered from the cell free extract, but preferably they are recovered from the culture medium. Methods to recover proteins, such as binding molecules, from cell free extracts or culture medium are well known to the man skilled in the art. Binding molecules or functional variants thereof as obtainable by the above described method are also a part of the invention.

[0078] Alternatively, next to the expression in hosts, such as host cells, the binding molecules or functional variants thereof of the invention can be produced synthetically by conventional peptide synthesizers or in cell-free translation systems using RNA nucleic acid derived from DNA molecules according to the invention. Binding molecules or functional variants thereof as obtainable by the above described synthetic production methods or cell-free translation systems are also a part of the invention.

[0079] In certain embodiments, binding molecules or functional variants thereof, according to the invention, may be generated by transgenic non-human mammals, such as, for instance, transgenic mice or rabbits, that express human immunoglobulin genes. In certain embodiments, the transgenic non-human mammals have a genome comprising a human heavy chain transgene and a human light chain transgene encoding all or a portion of the human binding molecules as described above. The transgenic non-human mammals can be immunized with a purified or enriched preparation of rabies virus or a fragment thereof. Protocols for immunizing non-human mammals are well established in the art. See "Using Antibodies: A Laboratory Manual," edited by E. Harlow, D. Lane (1998), Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., and "Current Protocols in Immunology," edited by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, W. Strober (2001), John Wiley & Sons Inc., New York, the disclosures of which are incorporated herein by reference.

[0080] In a further aspect, the invention provides a method of identifying binding molecules such as human monoclonal antibodies or fragments thereof according to the invention or nucleic acid molecules according to the invention capable of specifically binding to rabies virus and comprises the steps of (a) contacting a collection of binding molecules on the surface of replicable genetic packages with the rabies virus or a fragment thereof under conditions conducive to binding, (b) selecting at least once for replicable genetic packages binding to the rabies virus or the fragment thereof, and (c) separating and recovering the replicable genetic packages binding to the rabies virus or the fragment thereof.

[0081] The selection step may be performed in the presence of rabies virus. The rabies virus may be isolated or non-isolated, e.g., present in serum and/or blood of an infected individual. In certain embodiments, the rabies virus is inactivated. Alternatively, the selection step may be performed in the presence of a fragment of rabies virus, such as an extracellular part of the rabies virus, one or more (poly)peptides derived from rabies virus, such as the G protein, fusion proteins comprising these proteins or (poly)peptides, and the like. In certain embodiments, cells transfected with rabies virus G protein are used for selection procedures.

[0082] In yet a further aspect, the invention provides a method of obtaining a binding molecule or a nucleic acid molecule according to the invention, wherein the method comprises the steps of (a) performing the above described method of identifying binding molecules, such as human monoclonal antibodies or fragments thereof according to the invention, or nucleic acid molecules according to the invention, and (b) isolating from the recovered replicable genetic packages the binding molecule and/or the nucleic acid encoding the binding molecule. Once a new monoclonal antibody has been established or identified with the above mentioned method of identifying binding molecules or nucleic acid molecules encoding the binding molecules, the DNA encoding the scFv or Fab can be isolated from the bacteria or replicable genetic packages and combined with standard molecular biological techniques to make constructs encoding bivalent scFvs or complete human immunoglobulins of a desired specificity (e.g., IgG, IgA or IgM). These constructs can be transfected into suitable cell lines and complete human monoclonal antibodies can be produced (see, Huls et al., 1999; Boel et al., 2000).

[0083] A replicable genetic package as used herein can be prokaryotic or eukaryotic and includes cells, spores, bacteria, viruses, (bacterio)phage and polysomes. A preferred replicable genetic package is a phage. The human binding molecules, such as, for instance, single chain Fvs, are displayed on the replicable genetic package, i.e., they are attached to a group or molecule located at an exterior surface of the replicable genetic package. The replicable genetic package is a screenable unit comprising a human binding molecule to be screened linked to a nucleic acid molecule encoding the binding molecule. The nucleic acid molecule should be replicable either in vivo (e.g., as a vector) or in vitro (e.g., by PCR, transcription and translation). In vivo replication can be autonomous (as for a cell), with the assistance of host factors (as for a virus) or with the assistance of both host and helper virus (as for a phagemid). Replicable genetic packages displaying a collection of human binding molecules are formed by introducing nucleic acid molecules encoding exogenous binding molecules to be displayed into the genomes of the replicable genetic packages to form fusion proteins with endogenous proteins that are normally expressed from the outer surface of the replicable genetic packages. Expression of the fusion proteins, transport to the outer surface and assembly results in display of exogenous binding molecules from the outer surface of the replicable genetic packages. In a further aspect, the invention pertains to a human binding molecule capable of binding rabies virus or a fragment thereof and being obtainable by the identification method as described above.

[0084] In yet a further aspect, the invention relates to a method of identifying a binding molecule potentially having neutralizing activity against rabies virus, wherein the method comprises the steps of (a) contacting a collection of binding molecules on the surface of replicable genetic packages with the rabies virus under conditions conducive to binding, (b) separating and recovering binding molecules that bind to the rabies virus from binding molecules that do not bind, (c) isolating at least one recovered binding molecule, (d) verifying if the binding molecule isolated has neutralizing activity against the rabies virus, wherein the rabies virus in step a is inactivated. The inactivated rabies virus may be purified before being inactivated. Purification may be performed by means of well-known purification methods suitable for viruses such as, for instance, centrifugation through a glycerol cushion. The inactivated rabies virus in step (a) may be immobilized to a suitable material before use. Alternatively, the rabies virus in step (a) may still be active. In another alternative embodiment, a fragment of a rabies virus, such as a polypeptide of a rabies virus such as the G protein, is used in step (a). In yet another embodiment, cells transfected with rabies virus G protein are used for selecting binding molecule potentially having neutralizing activity against rabies virus. As indicated herein, when cells expressing rabies virus G protein were included in the selection method the number of selected neutralizing antibodies was higher compared to selection methods wherein only purified rabies virus G protein and/or inactivated rabies virus was used.

[0085] In a further embodiment, the method of identifying a binding molecule potentially having neutralizing activity against rabies virus as described above further comprises the step of separating and recovering, and optionally isolating, human binding molecules containing a variable heavy 3-30 germline gene. A person skilled in the art can identify the specific germline gene by methods known in the art such as, for instance, nucleotide sequencing. The step of separating and recovering binding molecules containing a variable heavy 3-30 germline gene can be performed before or after step (c). As indicated below, the majority of rabies virus-neutralizing human monoclonal antibodies found in the invention comprise this specific V.sub.H germline gene.

[0086] Phage display methods for identifying and obtaining (neutralizing) binding molecules, e.g., antibodies, are by now well-established methods known by the person skilled in the art. They are, e.g., described in U.S. Pat. No. 5,696,108; Burton and Barbas, 1994; de Kruif et al., 1995b; and "Phage Display: A Laboratory Manual," edited by C. F. Barbas, D. R. Burton, J. K. Scott and G. J. Silverman (2001), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. All these references are herewith incorporated herein in their entirety.

[0087] For the construction of phage display libraries, collections of human monoclonal antibody heavy and light chain variable region genes are expressed on the surface of bacteriophage, preferably filamentous bacteriophage, particles in, for example, single-chain Fv (scFv) or in Fab format (see, de Kruif et al., 1995b). Large libraries of antibody fragment-expressing phages typically contain more than 1.0*10.sup.9 antibody specificities and may be assembled from the immunoglobulin V regions expressed in the B lymphocytes of immunized- or non-immunized individuals. In a specific embodiment of the invention, the phage library of human binding molecules, preferably scFv phage library, is prepared from RNA isolated from cells obtained from a subject that has been vaccinated against rabies or exposed to a rabies virus. RNA can be isolated from inter alia bone marrow or peripheral blood, preferably peripheral blood lymphocytes. The subject can be an animal vaccinated or exposed to rabies virus, but is preferably a human subject which has been vaccinated or has been exposed to rabies virus. In certain embodiments, the human subject has been vaccinated. A collection of human binding molecules on the surface of replicable genetic packages, such as a scFv phage library, as described above is another aspect of the invention.

[0088] Alternatively, phage display libraries may be constructed from immunoglobulin variable regions that have been partially assembled in vitro to introduce additional antibody diversity in the library (semi-synthetic libraries). For example, in vitro assembled variable regions contain stretches of synthetically produced, randomized or partially randomized DNA in those regions of the molecules that are important for antibody specificity, e.g., CDR regions. Rabies virus-specific phage antibodies can be selected from the libraries by immobilizing target antigens such as antigens from rabies virus on a solid phase and subsequently exposing the target antigens to a phage library to allow binding of phages expressing antibody fragments specific for the solid phase-bound antigen(s). Non-bound phages are removed by washing and bound phages eluted from the solid phase for infection of Escherichia coli (E. coli) bacteria and subsequent propagation. Multiple rounds of selection and propagation are usually required to sufficiently enrich for phages binding specifically to the target antigen(s). If desired, before exposing the phage library to target antigens the phage library can first be subtracted by exposing the phage library to non-target antigens bound to a solid phase. Phages may also be selected for binding to complex antigens, such as complex mixtures of rabies virus proteins or (poly)peptides, host cells expressing one or more rabies virus proteins or (poly)peptides of rabies virus, or (inactivated) rabies virus itself. Antigen-specific phage antibodies can be selected from the library by incubating a solid phase with bound thereon a preparation of inactivated rabies virus with the phage antibody library to let, for example, the scFv or Fab part of the phage bind to the proteins/polypeptides of the rabies virus preparation. After incubation and several washes to remove unbound and loosely attached phages, the phages that have bound with their scFv or Fab part to the preparation are eluted and used to infect Escherichia coli to allow amplification of the new specificity. Generally, one or more selection rounds are required to separate the phages of interest from the large excess of non-binding phages. Alternatively, known proteins or (poly)peptides of the rabies virus can be expressed in host cells and these cells can be used for selection of phage antibodies specific for the proteins or (poly)peptides. A phage display method using these host cells can be extended and improved by subtracting non-relevant binders during screening by addition of an excess of host cells comprising no target molecules or non-target molecules that are similar, but not identical, to the target, and thereby strongly enhance the chance of finding relevant binding molecules. (This process is referred to as the MAbstract.RTM. process. MAbstract.RTM. is a registered trademark of Crucell Holland B. V. See also, U.S. Pat. No. 6,265,150, which is incorporated herein by reference.)

[0089] In yet a further aspect, the invention provides compositions comprising at least one binding molecule, at least one functional variant or fragment thereof, at least one immunoconjugate according to the invention or a combination thereof. The compositions may further comprise inter alia stabilizing molecules, such as albumin or polyethylene glycol, or salts. In certain embodiments, the salts used are salts that retain the desired biological activity of the human binding molecules and do not impart any undesired toxicological effects. If necessary, the human binding molecules of the invention may be coated in or on a material to protect them from the action of acids or other natural or non-natural conditions that may inactivate the binding molecules.

[0090] In yet a further aspect, the invention provides compositions comprising at least one nucleic acid molecule as defined in the invention. The compositions may comprise aqueous solutions such as aqueous solutions containing salts (e.g., NaCl or salts as described above), detergents (e.g., SDS) and/or other suitable components.

[0091] Furthermore, the invention pertains to pharmaceutical compositions comprising at least one n binding molecule according to the invention, at least one functional variant or fragment thereof, at least one immunoconjugate according to the invention, at least one composition according to the invention, or combinations thereof. The pharmaceutical composition of the invention further comprises at least one pharmaceutically acceptable excipient.

[0092] In certain embodiments, a pharmaceutical composition of the invention comprises at least one additional binding molecule, i.e., the pharmaceutical composition can be a cocktail/mixture of binding molecules. The pharmaceutical composition may comprise at least two binding molecules according to the invention or at least one binding molecule according to the invention and at least one further anti-rabies virus binding molecule. The further binding molecule preferably comprises a CDR3 region comprising the amino acid sequence of SEQ ID NO:25. The binding molecule comprising the CDR3 region comprising the amino acid sequence of SEQ ID NO:25 may be a chimeric or humanized monoclonal antibody or functional fragment thereof, but preferably, it is a human monoclonal antibody or functional fragment thereof. In certain embodiments, the binding molecule comprises a heavy chain variable region comprising the amino acid sequence SEQ ID NO:273. In certain embodiments, the binding molecule comprises a light chain variable region comprising the amino acid sequence SEQ ID NO:275. In yet another embodiment, the binding molecule comprises a heavy and light chain comprising the amino acid sequences of SEQ ID NO:123 and SEQ ID NO:125, respectively. The binding molecules in the pharmaceutical composition should be capable of reacting with different, non-competing epitopes of the rabies virus. The epitopes may be present on the G protein of rabies virus and may be different, non-overlapping epitopes. The binding molecules should be of high affinity and should have a broad specificity. In certain embodiments, they neutralize as many fixed and street strains of rabies virus as possible. Even more preferably, they also exhibit neutralizing activity towards other genotypes of the Lyssavirus genus or even with other viruses of the rhabdovirus family, while exhibiting no cross-reactivity with other viruses or normal cellular proteins. In certain embodiments, the binding molecule is capable of neutralizing escape variants of the other binding molecule in the cocktail.

[0093] Another aspect of the invention pertains to a pharmaceutical composition comprising at least two rabies virus-neutralizing binding molecules, preferably (human) binding molecules according to the invention, wherein the binding molecules are capable of reacting with different, non-competing epitopes of the rabies virus. In certain embodiments, the pharmaceutical composition comprises a first rabies virus-neutralizing binding molecule which is capable of reacting with an epitope located in antigenic site I of the rabies virus G protein and a second rabies virus-neutralizing binding molecule which is capable of reacting with an epitope located in antigenic site III of the rabies virus G protein. The antigenic structure of the rabies glycoprotein was initially defined by Lafon et al. (1983). The antigenic sites were identified using a panel of mouse mAbs and their respective mAb-resistant virus variants. Since then, the antigenic sites have been mapped by identification of the amino acid mutations in the glycoprotein of mAb-resistant variants (see, Seif et al., 1985; Prehaud et al., 1988; and Benmansour et al., 1991). The majority of rabies-neutralizing mAbs are directed against antigenic site II (see, Benmansour et al., 1991), which is a discontinuous conformational epitope comprising amino acids 34-42 and amino acids 198-200 (see, Prehaud et al., 1988). Antigenic site III is a continuous conformational epitope at amino acids 330-338 and harbors two charged residues, K.sub.330 and R333, that affect viral pathogenicity (see, Seif et al., 1985; Coulon et al., 1998; and Dietzschold et al., 1983). The conformational antigenic site I was defined by only one mAb, 509-6, and located at amino acid 231 (see, Benmansour et al., 1991; and Lafon et al., 1983). Antigenic site IV is known to harbor overlapping linear epitopes (see, Tordo, 1996; Bunschoten et at, 1989; Luo et al., 1997; and Ni et al., 1995). Benmansour et al. (1991) also described the presence of a minor site located at position 342-343, which is distinct from antigenic site III despite its close proximity. Alignment of the CR-57 epitope with the currently known linear and conformational-neutralizing epitopes on rabies glycoprotein (FIG. 10) revealed that the CR-57 epitope is located in the same region as the conformational antigenic site I, defined by the single mAb 509-6. Based on nucleotide and amino acid sequences of the glycoprotein of the escape viruses of CR04-098, the epitope recognized by this antibody appears to be located in the same region as the continuous conformational antigenic site III.

[0094] In a preferred embodiment, the pharmaceutical composition comprises a first rabies virus-neutralizing binding molecule comprising at least a CDR3 region, preferably heavy chain CDR3 region, comprising the amino acid sequence of SEQ ID NO:25 and a second rabies virus-neutralizing binding molecule comprising at least a CDR3 region, preferably heavy chain CDR3 region, comprising the amino acid sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:22. More preferably, the second rabies virus-neutralizing binding molecule comprises at least a CDR3 region, preferably a heavy chain CDR3 region, comprising the amino acid sequence of SEQ ID NO:14. In certain embodiments, the first rabies virus-neutralizing binding molecule comprises a heavy and light chain comprising the amino acid sequences of SEQ ID NO:123 and SEQ ID NO:125, respectively, and the second rabies virus-neutralizing binding molecule comprises a heavy and light chain comprising the amino acid sequences of SEQ ID NO:335 and SEQ ID NO:337, respectively. In certain embodiments, the heavy and light chain of the first rabies virus-neutralizing binding molecule are encoded by SEQ ID NO:122 and SEQ ID NO:124, respectively, and the heavy and light chain of the second rabies virus-neutralizing binding molecule are encoded by SEQ ID NO:334 and SEQ ID NO:336, respectively.

[0095] A pharmaceutical composition comprising two binding molecules, wherein the pI of the binding molecules is divergent and may have a problem when choosing a suitable buffer which optimally stabilizes both binding molecules. When adjusting the pH of the buffer of the composition such that it increases the stability of one binding molecule, this might decrease the stability of the other binding molecule. Decrease of stability or even instability of a binding molecule may lead to its precipitation or aggregation or to its spontaneous degradation resulting in loss of the functionality of the binding molecule. Therefore, in another aspect, the invention provides a pharmaceutical composition comprising at least two binding molecules, preferably human binding molecules, wherein the binding molecules have isoelectric points (pI) that differ less than about 1.5, 1.4, 1.3, 1.2, 1.1, 1.0, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, preferably less than (and including) 0.25 pI units from one another. The pI can be measured experimentally, e.g., by means of isoelectric focusing, or be calculated based on the amino acid sequence of the binding molecules. In certain embodiments, the binding molecules are binding molecules according to the invention and the pharmaceutical composition is a pharmaceutical composition according to the invention. In certain embodiments, the binding molecules are monoclonal antibodies, e.g., human monoclonal antibodies such as IgG1 antibodies. In certain embodiments, the binding molecules are capable of binding to and/or neutralizing an infectious agent, e.g., a virus, a bacterium, a yeast, a fungus or a parasite. In certain embodiments, the binding molecules are capable of binding to and/or neutralizing a lyssavirus, e.g., rabies virus. In a specific embodiment, both binding molecules have a calculated pI that is in the range between 8.0-9.5, preferably 8.1-9.2, more preferably 8.2-8.5. In certain embodiments, the binding molecules have the heavy chain CDR3 region of SEQ ID NO:14 and SEQ ID NO:25, respectively.

[0096] In certain embodiments, the invention provides a cocktail of two or more human or other animal binding molecules, including but not limited to antibodies, wherein at least one binding molecule is derived from an antibody phage or other replicable package display technique and at least one binding molecule is obtainable by a hybridoma technique. When divergent techniques are being used, the selection of binding molecules having a compatible pI is also very useful in order to obtain a composition, wherein each binding molecule is sufficiently stable for storage, handling and subsequent use.

[0097] In certain embodiments, the binding molecules present in the pharmaceutical composition of the invention augment each other's neutralizing activity, i.e., they act synergistically when combined. In other words, the pharmaceutical compositions may exhibit synergistic rabies virus, and even lyssavirus, neutralizing activity. As used herein, the term "synergistic" means that the combined effect of the binding molecules when used in combination is greater than their additive effects when used individually. The ranges and ratios of the components of the pharmaceutical compositions of the invention should be determined based on their individual potencies and tested in in vitro neutralization assays or animal models such as hamsters.

[0098] Furthermore, the pharmaceutical composition according to the invention may comprise at least one other therapeutic, prophylactic and/or diagnostic agent. The further therapeutic and/or prophylactic agents may be anti-viral agents such as ribavirin or interferon-alpha.

[0099] The binding molecules or pharmaceutical compositions of the invention can be tested in suitable animal model systems prior to use in humans. Such animal model systems include, but are not limited to, mice, rats, hamsters, monkeys, etc.

[0100] Typically, pharmaceutical compositions must be sterile and stable under the conditions of manufacture and storage. The human binding molecules, variant or fragments thereof, immunoconjugates, nucleic acid molecules or compositions of the invention can be in powder form for reconstitution in the appropriate pharmaceutically acceptable excipient before or at the time of delivery. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0101] Alternatively, the binding molecules, variant or fragments thereof, immunoconjugates, nucleic acid molecules or compositions of the invention can be in solution and the appropriate pharmaceutically acceptable excipient can be added and/or mixed before or at the time of delivery to provide a unit dosage injectable form. In certain embodiments, the pharmaceutically acceptable excipient used in the invention is suitable to high drug concentration, can maintain proper fluidity and, if necessary, can delay absorption.

[0102] The choice of the optimal route of administration of the pharmaceutical compositions will be influenced by several factors including the physico-chemical properties of the active molecules within the compositions, the urgency of the clinical situation and the relationship of the plasma concentrations of the active molecules to the desired therapeutic effect. For instance, if necessary, the human binding molecules of the invention can be prepared with carriers that will protect them against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers can inter alia be used, such as ethylene vinyl acetate, poly-anhydrides, poly-glycolic acid, collagen, poly-orthoesters, and poly-lactic acid. Furthermore, it may be necessary to coat the human binding molecules with, or co-administer the binding molecules with, a material or compound that prevents the inactivation of the human binding molecules. For example, the human binding molecules may be administered to a subject in an appropriate carrier, for example, liposomes, or a diluent.

[0103] The routes of administration can generally be divided into two main categories, oral and parenteral administration. The preferred administration of the human binding molecules and pharmaceutical compositions of the invention is into and around the wound and intramuscularly in the gluteal region. Formulations of the human binding molecules and pharmaceutical compositions are dependent on the routes of administration.

[0104] In a further aspect, the binding molecules, functional variants, immunoconjugates, compositions, or pharmaceutical compositions of the invention can be used as a medicament. Thus, a method of treatment and/or prevention of a lyssavirus infection using the human binding molecules, functional variants, immunoconjugates, compositions, or pharmaceutical compositions of the invention is another part of the invention. The lyssavirus can be a virus from any of the known genotypes, but is preferably rabies virus. The above-mentioned molecules or compositions can be used in the post-exposure prophylaxis of rabies.

[0105] The molecules or compositions mentioned above may be employed in conjunction with other molecules useful in diagnosis, prophylaxis and/or treatment of rabies virus. They can be used in vitro, ex vivo or in vivo. For instance, the human binding molecules, functional variants, immunoconjugates or pharmaceutical compositions of the invention can be co-administered with a vaccine against rabies. Alternatively, the vaccine may also be administered before or after administration of the molecules or compositions of the invention. Administration of the molecules or compositions of the invention with a vaccine is suitable for post exposure prophylaxis. Rabies vaccines include, but are not limited to, purified chick embryo cell (PCEC) vaccine (RabAvert), human diploid cell vaccine (HDCV; Imovax vaccine) or rabies vaccine adsorbed (RVA).

[0106] The molecules are typically formulated in the compositions and pharmaceutical compositions of the invention in a therapeutically or diagnostically effective amount. Dosage regimens can be adjusted to provide the optimum desired response (e.g., a therapeutic response). A suitable dosage range may, for instance, be 0.1-100 IU/kg body weight, preferably 1.0-50 IU/kg body weight and more preferably 10-30 IU/kg body weight, such as 20 IU/kg body weight.

[0107] In certain embodiments, a single bolus of the binding molecules or pharmaceutical compositions of the invention are administered. The molecules and pharmaceutical compositions according to the invention are preferably sterile. Methods to render these molecules and compositions sterile are well known in the art. The dosing regimen of post exposure prophylaxis is administration of five doses of rabies vaccine intramuscularly in the deltoid muscle on days 0, 3, 7, 14 and 28 days after exposure in individuals not previously immunized against rabies virus. The human binding molecules or pharmaceutical compositions according to the invention should be administered into and around the wounds on day 0 or otherwise as soon as possible after exposure, with the remaining volume given intramuscularly at a site distant from the vaccine. Non-vaccinated individuals are advised to be administered anti-rabies virus human binding molecules, but it is clear to the skilled artisan that vaccinated individuals in need of such treatment may also be administered anti-rabies virus human binding molecules.

[0108] In another aspect, the invention concerns the use of binding molecules or functional variants thereof, immunoconjugates according to the invention, nucleic acid molecules according to the invention, compositions or pharmaceutical compositions according to the invention in the preparation of a medicament for the diagnosis, prophylaxis, treatment, or combination thereof, of a condition resulting from an infection by a lyssavirus. The lyssavirus can be a virus from any of the known genotypes but is preferably rabies virus. In certain embodiments, the molecules mentioned above are used in the preparation of a medicament for the post exposure prophylaxis of rabies.

[0109] Next to that, kits comprising at least one binding molecule according to the invention, at least one functional variant thereof according to the invention, at least one immunoconjugate according to the invention, at least one nucleic acid molecule according to the invention, at least one composition according to the invention, at least one pharmaceutical composition according to the invention, at least one vector according to the invention, at least one host according to the invention or a combination thereof are also a part of the invention. Optionally, the above described components of the kits of the invention are packed in suitable containers and labeled for diagnosis, prophylaxis and/or treatment of the indicated conditions. The above-mentioned components may be stored in unit or multi-dose containers, for example, sealed ampoules, vials, bottles, syringes, and test tubes, as an aqueous, preferably sterile, solution or as a lyophilized, preferably sterile, formulation for reconstitution. The containers may be formed from a variety of materials such as glass or plastic and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The kit may further comprise more containers comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, culture medium for one or more of the suitable hosts. Associated with the kits can be instructions customarily included in commercial packages of therapeutic, prophylactic or diagnostic products, that contain information about, for example, the indications, usage, dosage, manufacture, administration, contraindications and/or warnings concerning the use of such therapeutic, prophylactic or diagnostic products.

[0110] Currently, HRIG products are used for post exposure prophylaxis of rabies. An adult dose of HRIG of 1500 IU (75 kg individual, 20 IU/kg) is only available in a volume of 10 ml. More concentrated HRIG products are not possible as the currently obtainable 10 ml dose contains 1-1.5 gram of total IgG. In view thereof the current HRIG products have two drawbacks. Firstly, it is often not anatomically feasible to administer the recommended full dose in and around the bite wounds and secondly the administration of the current volume dose of HRIG is associated with significant pain. The invention gives a solution to these drawbacks as it provides a pharmaceutical composition comprising a full adult dose in a volume of approximately 2 ml or less, if desirable. Such a pharmaceutical composition may comprise, for example, two binding molecules capable of neutralizing rabies virus, preferably CR57 and CR04-098. The pharmaceutical composition further comprises a pharmaceutically acceptable excipient and has a volume of around 2 ml. More is also possible, but less desirable in view of the pain associated with injecting larger volumes. Less than 2 ml is also possible. The pharmaceutical composition comprises the full adult dose (in IU) necessary for successful post exposure prophylaxis. In certain embodiments, the pharmaceutical composition is stored in a 10 ml vial such as, for instance, a 10 ml ready-to-use vial (type I glass) with a stopper. By providing a 10 ml vial the option is given to dilute the pharmaceutical composition towards a higher volume in case an individual presents a large wound surface area. The invention also provides a kit comprising at least a container (such as a vial) comprising the pharmaceutical composition. The kit may further comprise a second container which holds a diluent suitable for diluting the pharmaceutical composition towards a higher volume. Suitable diluents include, but are not limited to, the pharmaceutically acceptable excipient of the pharmaceutical composition and a saline solution. Furthermore, the kit may comprise instructions for diluting the pharmaceutical composition and/or instructions for administering the pharmaceutical composition, whether diluted or not.

[0111] The invention further pertains to a method of detecting a rabies virus in a sample, wherein the method comprises the steps of (a) contacting a sample with a diagnostically effective amount of a binding molecule, a functional variant or an immunoconjugate according to the invention, and (b) determining whether the binding molecule, functional variant, or immunoconjugate specifically binds to a molecule of the sample. The sample may be a biological sample including, but not limited to blood, serum, tissue or other biological material from (potentially) infected subjects. The (potentially) infected subjects may be human subjects, but also animals that are suspected as carriers of rabies virus might be tested for the presence of rabies virus using the human binding molecules, functional variants or immunoconjugates of the invention. The sample may first be manipulated to make it more suitable for the method of detection. "Manipulation" means inter alia treating the sample suspected to contain and/or containing rabies virus in such a way that the rabies virus will disintegrate into antigenic components such as proteins, (poly)peptides or other antigenic fragments. In certain embodiments, the binding molecules, functional variants or immunoconjugates of the invention are contacted with the sample under conditions which allow the formation of an immunological complex between the human binding molecules and rabies virus or antigenic components thereof that may be present in the sample. The formation of an immunological complex, if any, indicating the presence of rabies virus in the sample, is then detected and measured by suitable means. Such methods include, inter alia, homogeneous and heterogeneous binding immunoassays, such as radioimmunoassays (RIA), ELISA, immunofluorescence, immunohistochemistry, FACS, BIACORE and Western blot analyses.

[0112] Furthermore, the binding molecules of the invention can be used to identify epitopes of rabies virus proteins such as the G protein. The epitopes can be linear, but also structural and/or conformational. In one embodiment, binding of binding molecules of the invention to a series of overlapping peptides, such as 15-mer peptides, of a protein from rabies virus such as the rabies virus G protein can be analyzed by means of PEPSCAN analysis (see, inter alia WO 84/03564, WO 93/09872, Slootstra et al. 1996). The binding of human binding molecules to each peptide can be tested in a PEPSCAN-based enzyme-linked immunosorbent assay (ELISA). In certain embodiments, a random peptide library comprising peptides from rabies virus proteins can be screened for peptides capable of binding to the human binding molecules of the invention. In the above assays the use of rabies virus-neutralizing human binding molecules may identify one or more neutralizing epitopes. The peptides/epitopes found can be used as vaccines and for the diagnosis of rabies.

[0113] In a further aspect, the invention provides a method of screening a binding molecule or a functional variant of a binding molecule for specific binding to a different, preferably non-overlapping epitope of rabies virus as the epitope bound by a binding molecule or functional variant of the invention, wherein the method comprises the steps of (a) contacting a binding molecule or a functional variant to be screened, a binding molecule or functional variant of the invention and rabies virus or a fragment thereof (such as for instance the rabies virus G protein), (b) measure if the binding molecule or functional variant to be screened is capable of competing for specifically binding to the rabies virus or fragment thereof with the binding molecule or functional variant of the invention. If no competition is measured the binding molecules or functional variants to be screened bind to a different epitope. In a specific embodiment of the above screening method, human binding molecules, or functional variants thereof, may be screened to identify human binding molecules or functional variants capable of binding a different epitope than the epitope recognized by the binding molecule comprising the CDR3 region comprising the amino acid sequence of SEQ ID NO:25. In certain embodiments, the epitopes are non-overlapping or non-competing. It is clear to the skilled person that the above screening method can also be used to identify binding molecules or functional variants thereof capable of binding to the same epitope. In a further step it may be determined if the screened binding molecules that are not capable of competing for specifically binding to the rabies virus or fragment thereof have neutralizing activity. It may also be determined if the screened binding molecules that are capable of competing for specifically binding to the rabies virus or fragment thereof have neutralizing activity. Neutralizing anti-rabies virus binding molecules or functional variants thereof found in the screening method are another part of the invention. In the screening method "specifically binding to the same epitope" also contemplates specific binding to substantially or essentially the same epitope as the epitope bound by the human binding molecules of the invention. The capacity to block, or compete with, the binding of the human binding molecules of the invention to rabies virus typically indicates that a binding molecule to be screened binds to an epitope or binding site on the rabies virus that structurally overlaps with the binding site on the rabies virus that is immunospecifically recognized by the binding molecules of the invention. Alternatively, this can indicate that a binding molecule to be screened binds to an epitope or binding site which is sufficiently proximal to the binding site immunospecifically recognized by the binding molecules of the invention to sterically or otherwise inhibit binding of the binding molecules of the invention to rabies virus or a fragment thereof.

[0114] In general, competitive inhibition is measured by means of an assay, wherein an antigen composition, i.e., a composition comprising rabies virus or fragments (such as G proteins) thereof, is admixed with reference binding molecules and binding molecules to be screened. In certain embodiments, the reference binding molecule may be one of the human binding molecules of the invention and the binding molecule to be screened may be another human binding molecule of the invention. In certain embodiments, the reference binding molecule may be the binding molecule comprising the CDR3 region comprising the amino acid sequence of SEQ ID NO:25 and the binding molecule to be screened may be one of the human binding molecules of the invention. In yet another embodiment, the reference binding molecule may be one of the human binding molecules of the invention and the binding molecule to be screened may be the binding molecule comprising the CDR3 region comprising the amino acid sequence of SEQ ID NO:25. Usually, the binding molecules to be screened are present in excess. Protocols based upon ELISAs are suitable for use in such simple competition studies. In certain embodiments, one may pre-mix the reference binding molecules with varying amounts of the binding molecules to be screened (e.g., 1:10, 1:20, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90 or 1:100) for a period of time prior to applying to the antigen composition. In other embodiments, the reference binding molecules and varying amounts of binding molecules to be screened can simply be admixed during exposure to the antigen composition. In any event, by using species or isotype secondary antibodies one will be able to detect only the bound reference binding molecules, the binding of which will be reduced by the presence of a binding molecule to be screened that recognizes substantially the same epitope. In conducting a binding molecule competition study between a reference binding molecule and any binding molecule to be screened (irrespective of species or isotype), one may first label the reference binding molecule with a detectable label, such as, e.g., biotin, an enzymatic, a radioactive or other label to enable subsequent identification. In these cases, one would pre-mix or incubate the labeled reference binding molecules with the binding molecules to be screened at various ratios (e.g., 1:10, 1:20, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90 or 1:100) and (optionally after a suitable period of time) then assay the reactivity of the labeled reference binding molecules and compare this with a control value in which no potentially competing binding molecule was included in the incubation. The assay may again be any one of a range of immunological assays based upon antibody hybridization, and the reference binding molecules would be detected by means of detecting their label, e.g., using streptavidin in the case of biotinylated reference binding molecules or by using a chromogenic substrate in connection with an enzymatic label (such as 3,3'5,5'-tetramethylbenzidine (TMB) substrate with peroxidase enzyme) or by simply detecting a radioactive label. A binding molecule to be screened that binds to the same epitope as the reference binding molecule will be able to effectively compete for binding and thus will significantly reduce reference binding molecule binding, as evidenced by a reduction in bound label. Binding molecules binding different non-competing epitopes will show no reduction. The reactivity of the (labeled) reference binding molecule in the absence of a completely irrelevant binding molecule would be the control high value. The control low value would be obtained by incubating the labeled reference binding molecule with unlabelled reference binding molecules of exactly the same type, when competition would occur and reduce binding of the labeled reference binding molecule. In a test assay, a significant reduction in labeled reference binding molecule reactivity in the presence of a binding molecule to be screened is indicative of a binding molecule that recognizes the same epitope, i.e., one that "cross-reacts" with the labeled reference binding molecule. If no reduction is shown, the binding molecule may bind a different non-competing epitope.

[0115] Binding molecules identified by these competition assays ("competitive binding molecules") include, but are not limited to, antibodies, antibody fragments and other binding agents that bind to an epitope or binding site bound by the reference binding molecule as well as antibodies, antibody fragments and other binding agents that bind to an epitope or binding site sufficiently proximal to an epitope bound by the reference binding molecule for competitive binding between the binding molecules to be screened and the reference binding molecule to occur. In certain embodiments, competitive binding molecules of the invention will, when present in excess, inhibit specific binding of a reference binding molecule to a selected target species by at least 10%, preferably by at least 25%, more preferably by at least 50%, and most preferably by at least 75% to 90% or even greater. The identification of one or more competitive binding molecules that bind to about, substantially, essentially or at the same epitope as the binding molecules of the invention is a straightforward technical matter. As the identification of competitive binding molecules is determined in comparison to a reference binding molecule, it will be understood that actually determining the epitope to which the reference binding molecule and the competitive binding molecule bind is not in any way required in order to identify a competitive binding molecule that binds to the same or substantially the same epitope as the reference binding molecule. Alternatively, binding molecules binding to different non-competing epitopes identified by these competition assays may also include, but are not limited to, antibodies, antibody fragments and other binding agents.

[0116] In another aspect, the invention provides a method of identifying a binding molecule potentially having neutralizing activity against an infectious agent causing disease in a living being or a nucleic acid molecule encoding a binding molecule potentially having neutralizing activity against an infectious agent causing disease in a living being, wherein the method comprises the steps of (a) contacting a collection of binding molecules on the surface of replicable genetic packages with at least a cell expressing a protein of the infectious agent causing disease in a living being on its surface under conditions conducive to binding, (b) separating and recovering binding molecules that bind to the cell expressing a protein of the infectious agent causing disease in a living being on its surface from binding molecules that do not bind the cell, (c) isolating at least one recovered binding molecule, (d) verifying if the binding molecule isolated has neutralizing activity against the infectious agent causing disease in a living being. The cell expressing a protein of the infectious agent causing disease in a living being on its surface can be a cell transfected with the protein. A person skilled in the art is aware that antigens of the infectious agent other than proteins can also be successfully used in the method. In a specific embodiment, the cell is a PER.C6.RTM. cell. However, other (E1-immortalized) cell lines could also be used to express the proteins such as BHK, CHO, NSO, HEK293, or 911 cells. In certain embodiments, the binding molecule is human. The infectious agent can be a virus, a bacterium, a yeast, a fungus or a parasite. In certain embodiments, the protein is a protein normally expressed on the surface of the infectious agent or comprises at least a part of a protein that is surface accessible. In a specific embodiment, the collection of binding molecules on the surface of replicable genetic packages are subtracted/counterselected with the cells used for expressing of the protein of the infectious agent, i.e., the cells are identical to the cells used in step (a) with the proviso that they do not express the protein of the infectious agent on their surface. The cells used for subtraction/counterselection can be untransfected cells. Alternatively, the cells can be transfected with a protein or (extracellular) part thereof that is similar and/or highly homologous in sequence or structure with the respective protein of the infectious agent and/or that is derived from an infectious agent of the same family or even genus.

[0117] Another aspect of the invention pertains to a binding molecule as defined herein having rabies virus-neutralizing activity, wherein the human binding molecule comprises at least a heavy chain CDR3 region comprising the amino acid sequence comprising SEQ ID NO:25 and further wherein the human binding molecule has a rabies virus-neutralizing activity of at least 2500 IU/mg protein. More preferably, the human binding molecule has a rabies virus-neutralizing activity of at least 2800 IU/mg protein, at least 3000 IU/mg protein, at least 3200 IU/mg protein, at least 3400 IU/mg protein, at least 3600 IU/mg protein, at least 3800 IU/mg protein, at least 4000 IU/mg protein, at least 4200 IU/mg protein, at least 4400 IU/mg protein, at least 4600 IU/mg protein, at least 4800 IU/mg protein, at least 5000 IU/mg protein, at least 5200 IU/mg protein, at least 5400 IU/mg protein. The neutralizing activity of the binding molecule was measured by an in vitro neutralization assay (modified RFFIT (rapid fluorescent focus inhibition test)). The assay is described in detail in the example section infra.

[0118] In certain embodiments, the binding molecule comprises a variable heavy chain comprising the amino acid sequence comprising SEQ ID NO:273. In certain embodiments, the binding molecule comprises a heavy chain comprising the amino acid sequence comprising SEQ ID NO:123. The variable light chain of the binding molecule may comprise the amino acid sequence comprising SEQ ID NO:275. The light chain of the binding molecule may comprise the amino acid sequence comprising SEQ ID NO:125.

[0119] A nucleic acid molecule encoding the binding molecules as described above is also a part of the invention. In certain embodiments, the nucleic acid molecule comprises the nucleotide sequence comprising SEQ ID NO:122. In addition, the nucleic acid molecule may also comprise the nucleotide sequence comprising SEQ ID NO:124. A vector comprising the nucleic acid molecules and a host cell comprising such a vector are also provided herein. In certain embodiments, the host cell is a mammalian cell such as a human cell. Examples of cells suitable for production of human binding molecules are inter alia HeLa, 911, AT1080, A549, 293 and HEK293T cells. Preferred mammalian cells are human retina cells such as 911 cells or the cell line deposited at the European Collection of Cell Cultures (ECACC), CAMR, Salisbury, Wiltshire SP4 OJG, Great Britain on 29 Feb. 1996 under number 96022940 and marketed under the trademark PER.C6.RTM. (PER.C6 is a registered trademark of Crucell Holland B. V.). For the purposes of this application "PER.C6" refers to cells deposited under number 96022940 or ancestors, passages up-stream or downstream as well as descendants from ancestors of deposited cells, as well as derivatives of any of the foregoing.

EXAMPLES

[0120] To illustrate the invention, the following examples are provided. The examples are not intended to limit the scope of the invention in any way.

Example 1

Epitope Recognition of Human Anti-Rabies Antibodies CR-57 and CR-JB

[0121] To address whether the human monoclonal antibodies called CR-57 and CR-JB recognize non-overlapping, non-competing epitopes, escape viruses of the human monoclonal antibodies called CR-57 and CR-JB were generated. CR-57 and CR-JB were generated essentially as described (see, Jones et al., 2003), via introduction of the variable heavy and light chain coding regions of the corresponding antibody genes into a single human IgG1 expression vector named pcDNA3002(Neo). The resulting vectors pgSO57C11 and pgSOJBC11 were used for transient expression in cells from the cell line deposited at the European Collection of Cell Cultures (ECACC), CAMR, Salisbury, Wiltshire SP4 OJG, Great Britain on 29 Feb. 1996 under number 96022940 and marketed under the trademark PER.C6.RTM.. The nucleotide and amino acid sequences of the heavy and light chains of these antibodies are shown in SEQ ID NOS:122 through 129, respectively. Serial dilutions (0.5 ml) of rabies virus strain CVS-11 (dilutions ranging from 10.sup.-1 to 10.sup.-8) were incubated with a constant amount (.about.4 IU/ml) of antibody CR-57 or CR-JB (0.5 ml) for one hour at 37.degree. C./5% CO.sub.2 before addition to wells containing mouse neuroblastoma cells (MNA cells) or BSR cells (Baby Hamster Kidney-like cell line). After three days of selection in the presence of either human monoclonal antibody CR-57 or CR-JB, medium (1 ml) containing potential escape viruses was harvested and stored at 4.degree. C. until further use. Subsequently, the cells were acetone-fixed for 20 minutes at 4.degree. C., and stained overnight at 37.degree. C./5% CO.sub.2 with an anti-rabies N-FITC antibody conjugate (Centocor). The number of foci per well were scored by immunofluorescence and medium of wells containing one to six foci were chosen for virus amplification. All E57 escape viruses were generated from one single focus with the exception of E57B1 (three foci). EJB escape viruses were isolated from one focus (EJB3F), three foci (EJB2B), four foci (EJB2C), five foci (EJB2E, 2F), or six foci (EJB2D), respectively. Each escape virus was first amplified on a small scale on BSR or MNA cells depending on their growth characteristics. These small virus batches were then used to further amplify the virus on a large scale on MNA or BSR cells. Amplified virus was then titrated on MNA cells to determine the titer of each escape virus batch as well as the optimal dilution of the escape virus (giving 80% to 100% infection after 24 hours) for use in a virus neutralization assay.

[0122] Modified RFFIT (rapid fluorescent focus inhibition test) assays were performed to examine cross-protection of E57 (the escape viruses of CR-57) and EJB (the escape viruses of CR-JB) with CR-JB and CR-57, respectively. Therefore, CR-57 or CR-JB was diluted by serial threefold dilutions starting with a 1:5 dilution. Rabies virus (strain CVS-11) was added to each dilution at a concentration that gives 80% to 100% infection. Virus/IgG mix was incubated for one hour at 37.degree. C./5% CO.sub.2 before addition to MNA cells. Twenty-four hours post-infection (at 34.degree. C./5% CO.sub.2) the cells were acetone-fixed for 20 minutes at 4.degree. C., and stained for minimally three hours with an anti-rabies virus N-FITC antibody conjugate (Centocor). The wells were then analyzed for rabies virus infection under a fluorescence microscope to determine the 50% endpoint dilution. This is the dilution at which the virus infection is blocked by 50% in this assay. To calculate the potency, an Internat'l standard (Rabies Immune Globulin Lot R3, Reference material from the laboratory of Standards and Testing DMPQ/CBER/FDA) was included in each modified RFFIT. The 50% endpoint dilution of this standard corresponds with a potency of 2 IU/ml. The neutralizing potency of the single human monoclonal antibodies CR-57 and CR-JB as well as the combination of these antibodies were tested.

[0123] EJB viruses were no longer neutralized by CR-JB or CR-57 (see, Table 1), suggesting both antibodies bound to and induced amino acid changes in similar regions of the rabies virus glycoprotein. E57 viruses were no longer neutralized by CR-57, whereas 4 out of 6 E57 viruses were still neutralized by CR-JB, although with a lower potency (see, Table 1). A mixture of the antibodies CR-57 and CR-JB (in a 1:1 IU/mg ratio) gave similar results as observed with the single antibodies (data not shown).

[0124] To identify possible mutations in the rabies virus glycoprotein the nucleotide sequence of the glycoprotein open reading frame (ORF) of each of the EJB and E57 escape viruses was determined. Viral RNA of each of the escape viruses and CVS-11 was isolated from virus-infected MNA cells and converted into cDNA by standard RT-PCR. Subsequently, cDNA was used for nucleotide sequencing of the rabies virus glycoprotein ORFs in order to identify mutations.

[0125] Both E57 and EJB escape viruses showed mutations in the same region of the glycoprotein (see, FIGS. 1 and 2, respectively; see for all the sequences described in FIGS. 1 and 2 SEQ ID NOS:130 through 151). This indicates that both antibodies recognize overlapping epitopes. From the above can be concluded that the combination of CR-57 and CR-JB in a cocktail does not prevent the escape of neutralization-resistant variants and is therefore not an ideal immunoglobulin preparation for rabies post exposure prophylaxis.

Example 2

Construction of a ScFv Phage Display Library Using Peripheral Blood Lymphocytes of Rabies-Vaccinated Donors

[0126] From four rabies-vaccinated human subjects, 50 ml blood was drawn from a vein one week after the last boost. Peripheral blood lymphocytes (PBL) were isolated from these blood samples using Ficoll cell density fractionation. The blood serum was saved and frozen at -20.degree. C. The presence of anti-rabies antibodies in the sera was tested positive using a FACS staining on rabies virus glycoprotein transfected 293T cells. Total RNA was prepared from the PBL using organic phase separation (TRIZOL.TM.) and subsequent ethanol precipitation. The obtained RNA was dissolved in DEPC-treated ultrapure water and the concentration was determined by OD 260 nm measurement. Thereafter, the RNA was diluted to a concentration of 100 ng/.mu.l. Next, 1 .mu.g of RNA was converted into cDNA as follows: To 10 .mu.l total RNA, 13 .mu.l DEPC-treated ultrapure water and 1 .mu.l random hexamers (500 ng/.mu.l) were added and the obtained mixture was heated at 65.degree. C. for five minutes and quickly cooled on wet-ice. Then, 8 .mu.l 5X First-Strand buffer, 2 .mu.l dNTP (10 mM each), 2 .mu.l DTT (0.1 M), 2 .mu.l Rnase-inhibitor (40 U/.mu.l) and 2 .mu.l Superscript.TM.III MMLV reverse transcriptase (200 U/.mu.l) were added to the mixture, incubated at room temperature for five minutes and incubated for one hour at 50.degree. C. The reaction was terminated by heat inactivation, i.e., by incubating the mixture for 15 minutes at 75.degree. C.

[0127] The obtained cDNA products were diluted to a final volume of 200 .mu.l with DEPC-treated ultrapure water. The OD 260 nm of a 50 times diluted solution (in 10 mM Tris buffer) of the dilution of the obtained cDNA products gave a value of 0.1.

[0128] For each donor 5 to 10 .mu.l of the diluted cDNA products were used as template for PCR amplification of the immunoglobulin gamma heavy chain family and kappa or lambda light chain sequences using specific oligonucleotide primers (see, Tables 2 through 7). PCR reaction mixtures contained, besides the diluted cDNA products, 25 pmol sense primer and 25 pmol anti-sense primer in a final volume of 50 .mu.l of 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 2.5 mM MgCl.sub.2, 250 .mu.M dNTPs and 1.25 units Taq polymerase. In a heated-lid thermal cycler having a temperature of 96.degree. C., the mixtures obtained were quickly melted for two minutes, followed by 30 cycles of: 30 seconds at 96.degree. C., 30 seconds at 60.degree. C. and 60 seconds at 72.degree. C.

[0129] In a first round amplification, each of seventeen light chain variable region sense primers (eleven for the lambda light chain (see, Table 2) and six for the kappa light chain (see, Table 3) were combined with an anti-sense primer recognizing the C-kappa called HuCk 5'-ACACTCTCCCCTGTTGAAGCTCTT-3' (see, SEQ ID NO:152) or C-lambda constant region HuC.lamda.2 5'-TGAACATTCTGTAGGGGCCACTG-3' (see, SEQ ID NO:153) and HuC.lamda.7 5'-AGAGCATTCTGCAGGGGCCACTG-3' (see, SEQ ID NO:154) (the HuC.lamda.2 and HuC.lamda.7 anti-sense primers were mixed to equimolarity before use), yielding four times 17 products of about 600 basepairs. These products were purified on a 2% agarose gel and isolated from the gel using Qiagen gel-extraction columns. One-tenth of each of the isolated products was used in an identical PCR reaction as described above using the same seventeen sense primers, whereby each lambda light chain sense primer was combined with one of the three Jlambda-region-specific anti-sense primers and each kappa light chain sense primer was combined with one of the five Jkappa-region-specific anti-sense primers. The primers used in the second amplification were extended with restriction sites (see, Table 4) to enable directed cloning in the phage display vector PDV-006 (see, FIG. 3 and SEQ ID NO:155). This resulted in four times 63 products of approximately 350 basepairs that were pooled to a total of ten fractions. This number of fractions was chosen to maintain the natural distribution of the different light chain families within the library and not to over or under represent certain families. The number of alleles within a family was used to determine the percentage of representation within a library (see, Table 5). In the next step, 2.5 .mu.g of pooled fraction and 100 .mu.g PDV-C06 vector were digested with SalI and NotI and purified from gel. Thereafter, a ligation was performed overnight at 16.degree. C. as follows. To 500 ng PDV-006 vector 70 ng pooled fraction was added in a total volume of 50 .mu.l ligation mix containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl.sub.2, 10 mM DTT, 1 mM ATP, 25 .mu.g/ml BSA and 2.5 .mu.l T4 DNA Ligase (400 IRA. This procedure was followed for each pooled fraction. The ligation mixes were purified by phenol/chloroform, followed by a chloroform extraction and ethanol precipitation, methods well known to the skilled artisan. The DNA obtained was dissolved in 50 .mu.l ultrapure water and per ligation mix two times 2.5 .mu.l aliquots were electroporated into 40 .mu.l of TG1 competent E. coli bacteria according to the manufacturer's protocol (Stratagene). Transformants were grown overnight at 37.degree. C. in a total of 30 dishes (three dishes per pooled fraction; dimension of dish: 240 mm.times.240 mm) containing 2TY agar supplemented with 50 .mu.g/ml ampicillin and 4.5% glucose. A (sub)library of variable light chain regions was obtained by scraping the transformants from the agar plates. This (sub)library was directly used for plasmid DNA preparation using a Qiagen.TM. QIAFilter MAXI prep kit.

[0130] For each donor the heavy chain immunoglobulin sequences were amplified from the same cDNA preparations in a similar two round PCR procedure and identical reaction parameters as described above for the light chain regions with the proviso that the primers depicted in Tables 6 and 7 were used. The first amplification was performed using a set of nine sense directed primers (see, Table 6; covering all families of heavy chain variable regions) each combined with an IgG-specific constant region anti-sense primer called HuCIgG 5'-GTC CAC CTT GGT GTT GCT GGG CTT-3' (SEQ ID NO:156) yielding four times nine products of about 650 basepairs. These products were purified on a 2% agarose gel and isolated from the gel using Qiagen gel-extraction columns. One-tenth of each of the isolated products was used in an identical PCR reaction as described above using the same nine sense primers, whereby each heavy chain sense primer was combined with one of the four JH-region-specific anti-sense primers. The primers used in the second round were extended with restriction sites (see, Table 7) to enable directed cloning in the light chain (sub)library vector. This resulted per donor in 36 products of approximately 350 basepairs. These products were pooled for each donor per used (VH) sense primer into nine fractions. The products obtained were purified using Qiagen PCR Purification columns. Next, the fractions were digested with SfiI and XhoI and ligated in the light chain (sub)library vector, which was cut with the same restriction enzymes, using the same ligation procedure and volumes as described above for the light chain (sub)library. Alternatively, the fractions were digested with NcoI and XhoI and ligated in the light chain vector, which was cut with the same restriction enzymes, using the same ligation procedure and volumes as described above for the light chain (sub)library. Ligation purification and subsequent transformation of the resulting definitive library was also performed as described above for the light chain (sub)library and at this point, the ligation mixes of each donor were combined per VH pool. The transformants were grown in 27 dishes (three dishes per pooled fraction; dimension of dish: 240 mm.times.240 mm) containing 2TY agar supplemented with 50 .mu.g/ml ampicillin and 4.5% glucose. All bacteria were harvested in 2TY culture medium containing 50 .mu.g/ml ampicillin and 4.5% glucose, mixed with glycerol to 15% (v/v) and frozen in 1.5 ml aliquots at -80.degree. C. Rescue and selection of each library were performed as described below.

Example 3

Selection of Phages Carrying Single Chain Fv Fragments Specifically Recognizing Rabies Virus Glycoprotein

[0131] Antibody fragments were selected using antibody phage display libraries, general phage display technology and MAbstract.RTM. technology, essentially as described in U.S. Pat. No. 6,265,150 and in WO 98/15833 (both of which are incorporated by reference herein). The antibody phage libraries used were two different semi-synthetic scFv phage libraries (JK1994 and WT2000) and the immune scFv phage libraries (RAB-03-G01 and RAB-04-G01) prepared as described in Example 2 above. The first semi-synthetic scFv phage library (JK1994) has been described in de Kruif et al. (1995b), the second one (WT2000) was built essentially as described in de Kruif et al. (1995b). Briefly, the library has a semi-synthetic format whereby variation was incorporated in the heavy and light chain V genes using degenerated oligonucleotides that incorporate variation within CDR regions. Only VH3 heavy chain genes were used, in combination with kappa and lambda light chain genes. CDR1 and CDR3 of the heavy chain and CDR3 of the light chain were recreated synthetically in a PCR-based approach similar as described in de Kruif et al. (1995b). The thus created V region genes were cloned sequentially in scFv format in a phagemid vector and amplified to generate a phage library as described before. Furthermore, the methods and helper phages as described in WO 02/103012 (incorporated by reference herein) were used in the invention. For identifying phage antibodies recognizing rabies virus glycoprotein phage selection experiments were performed using whole rabies virus (rabies virus Pitman-Moore strain) inactivated by treatment with beta-propiolactone, purified rabies virus glycoprotein (rabies virus ERA strain), and/or transfected cells expressing rabies virus G protein (rabies virus ERA strain).

[0132] The G protein was purified from the rabies virus ERA strain as follows. To a virus solution, 1/10 volume of 10% octyl-beta-glucopyranoside was added and mixed gently. Upon a 30-minute incubation at 4.degree. C., the virus sample was centrifuged (36,000 rpm, 4.degree. C.) in a SW51 rotor. The supernatant was collected and dialyzed overnight at 4.degree. C. against 0.1 M Tris/EDTA. Subsequently, the glycoprotein was collected from the dialysis chamber, aliquoted, and stored at -80.degree. C. until further use. The protein concentration was determined by OD 280 nm and the integrity of the G protein was analyzed by SDS-PAGE.

[0133] Whole inactivated rabies virus or rabies virus G protein were diluted in phosphate buffered saline (PBS), 2 to 3 ml was added to MaxiSorp Nunc-Immuno Tubes (Nunc) and incubated overnight at 4.degree. C. on a rotating wheel. An aliquot of a phage library (500 .mu.l, approximately 10.sup.13 cfu, amplified using CT helper phage (see, WO 02/103012)) was blocked in blocking buffer (2% Protifar in PBS) for one to two hours at room temperature. The blocked phage library was added to the immunotube (either preincubated with or without CR-57 scFv to block the epitope recognized by CR-57), incubated for two hours at room temperature, and washed with wash buffer (0.1% Tween-20 (Serva) in PBS) to remove unbound phages. Bound phages were then eluted from the antigen by incubation for ten minutes at room temperature with 1 ml of 50 mM Glycine-HCl pH 2.2. Subsequently, the eluted phages were mixed with 0.5 ml of 1 M Tris-HCl pH 7.5 to neutralize the pH. This mixture was used to infect 5 ml of an XL1-Blue E. coli culture that had been grown at 37.degree. C. to an OD 600 nm of approximately 0.3. The phages were allowed to infect the XL1-Blue bacteria for 30 minutes at 37.degree. C. Then, the mixture was centrifuged for ten minutes, at 3200*g at room temperature and the bacterial pellet was resuspended in 0.5 ml 2-trypton yeast extract (2TY) medium. The obtained bacterial suspension was divided over two 2TY agar plates supplemented with tetracycline, ampicillin and glucose. After incubation overnight of the plates at 37.degree. C., the colonies were scraped from the plates and used to prepare an enriched phage library, essentially as described by de Kruif et al. (1995a) and WO 02/103012. Briefly, scraped bacteria were used to inoculate 2TY medium containing ampicillin, tetracycline and glucose and grown at a temperature of 37.degree. C. to an OD 600 nm of .about.0.3. CT helper phages were added and allowed to infect the bacteria after which the medium was changed to 2TY containing ampicillin, tetracycline and kanamycin. Incubation was continued overnight at 30.degree. C. The next day, the bacteria were removed from the 2TY medium by centrifugation after which the phages in the medium were precipitated using polyethylene glycol (PEG) 6000/NaCl. Finally, the phages were dissolved in 2 ml of PBS with 1% bovine serum albumin (BSA), filter-sterilized and used for the next round of selection.

[0134] Phage selections were also performed with rabies virus glycoprotein transfected cells. The cells used were cells from the cell line deposited at the European Collection of Cell Cultures (ECACC), CAMR, Salisbury, Wiltshire SP4 OJG, Great Britain on 29 Feb. 1996, under number 96022940 and marketed under the trademark PER.C6.RTM.. They are hereinafter referred to as PER.C6.RTM. cells. Here, the blocked phage library (2 ml) was first added to 1*10.sup.7 subtractor cells (in DMEM/10% FBS) and incubated for one hour at 4.degree. C. on a rotating wheel. The subtractor cells were PER.C6.RTM. cells that expressed the Vesicular Stomatitis Virus (VSV) glycoprotein ecto domain on their surface fused to the rabies virus transmembrane and cytoplasmic domain. With this subtraction step phages recognizing either VSV glycoprotein or antigens specific for PER.C6.RTM. cells were removed from the phage library. The phage/cell mixture was centrifuged (five minutes at 4.degree. C. at 500.times.g) to remove cell-bound phages, and the supernatant was added to a new tube containing 3 ml of 1*10.sup.7 subtractor cells. The subtraction step was repeated twice with the respective supernatant. Subsequently, the subtracted phages were incubated for 1.5 hours at 4.degree. C. on a rotating wheel with the rabies virus glycoprotein expressing transfected cells (PER.C6.RTM. cells (3*10.sup.6 cells)). Before that, the transfected cells were preincubated, either with or without CR-57 scFv, to block the epitope recognized by CR-57. After incubation, the cells were washed five times with 1 ml of DMEM/10% FBS (for each wash, the cells were resuspended and transferred to new tube), phages were eluted and processed as described above.

[0135] Typically, two rounds of selections were performed before isolation of individual phage antibodies. After the second round of selection, individual E. coli colonies were used to prepare monoclonal phage antibodies. Essentially, individual colonies were grown to log-phase in 96-well plate format and infected with VCSM13 helper phages after which phage antibody production was allowed to proceed overnight. The produced phage antibodies were PEG/NaCl-precipitated and filter-sterilized and tested in ELISA for binding to both whole inactivated rabies virus and purified rabies virus G protein. From the selection, a large panel of phage antibodies was obtained that demonstrated binding to both whole inactivated rabies virus and rabies virus G protein (see, example below). Two selection strategies were followed with the above-described immune libraries. In the first strategy 736 phage antibodies were selected after two selection rounds using in the first and second selection round inactivated virus or purified G protein. In the second strategy, 736 phage antibodies were selected after two selection rounds using in the first selection round cell surface expressed recombinant G protein and in the second selection round inactivated virus or purified G protein. The number of unique phage antibodies obtained by the first strategy was 97, while the second strategy yielded 70 unique ones. The 97 unique phage antibodies found by means of the first strategy gave rise to 18 neutralizing antibodies and the 70 unique clones identified by means of the second strategy yielded 33 neutralizing antibodies. This clearly demonstrates that selections that included rabies virus glycoprotein transfected cells, i.e., cell surface expressed recombinant G protein, as antigen appeared to yield more neutralizing antibodies compared to selections using only purified G protein and/or inactivated virus.

Example 4

Validation of the Rabies Virus Glycoprotein-Specific Single-Chain Phage Antibodies

[0136] Selected single-chain phage antibodies that were obtained in the screens described above, were validated in ELISA for specificity, i.e., binding to rabies virus G protein, purified as described supra. Additionally, the single-chain phage antibodies were also tested for binding to 5% FBS. For this purpose, the rabies virus G protein or 5% FBS preparation was coated to Maxisorp.TM. ELISA plates. After coating, the plates were blocked in PBS/1% Protifar for one hour at room temperature. The selected single-chain phage antibodies were incubated for 15 minutes in an equal volume of PBS/1% Protifar to obtain blocked phage antibodies. The plates were emptied, and the blocked phage antibodies were added to the wells. Incubation was allowed to proceed for one hour, the plates were washed in PBS containing 0.1% Tween-20 and bound phage antibodies were detected (using OD 492 nm measurement) using an anti-M13 antibody conjugated to perOxidase. As a control, the procedure was performed simultaneously using no single-chain phage antibody, a negative control single chain phage antibody directed against CD8 (SC02-007) or a positive control single chain phage antibody directed against rabies virus glycoprotein (scFv SO57). As shown in Table 8, the selected phage antibodies called SC04-001, SC04-004, SC04-008, SC04-010, SC04-018, SC04-021, SC04-026, 5C04-031, SC04-038, SC04-040, SC04-060, SC04-073, SC04-097, SC04-098, SC04-103, SC04-104, SC04-108, SC04-120, SC04-125, SC04-126, SC04-140, SC04-144, SC04-146, and SC04-164 displayed significant binding to the immobilized purified rabies virus G protein, while no binding to FBS was observed. Identical results were obtained in ELISA using the whole inactivated rabies virus prepared as described supra (data not shown).

Example 5

Characterization of the Rabies Virus-Specific scFvs

[0137] From the selected specific single chain phage antibody (scFv) clones plasmid DNA was obtained and nucleotide sequences were determined according to standard techniques. The nucleotide sequences of the scFvs (including restriction sites for cloning) called SC04-001, SC04-004, SC04-008, SC04-010, SC04-018, SC04-021, SC04-026, SC04-031, 5C04-038, SC04-040, 5C04-060, SC04-073, SC04-097, SC04-098, SC04-103, SC04-104, SC04-108, SC04-120, SC04-125, SC04-126, SC04-140, SC04-144, SC04-146, and SC04-164 are shown in SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:181, SEQ ID NO:183, SEQ ID NO:185, SEQ ID NO:187, SEQ ID NO:189, SEQ ID NO:191, SEQ ID NO:193, SEQ ID NO:195, SEQ ID NO:197, SEQ ID NO:199, SEQ ID NO:201 and SEQ ID NO:203, respectively. The amino acid sequences of the scFvs called SC04-001, 5C04-004, 5C04-008, SC04-010, SC04-018, 5C04-021, SC04-026, SC04-031, SC04-038, SC04-040, SC04-060, SC04-073, SC04-097, SC04-098, SC04-103, SC04-104, SC04-108, SC04-120, SC04-125, SC04-126, SC04-140, SC04-144, SC04-146, and SC04-164 are shown in SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID NO:176, SEQ ID NO:178, SEQ ID NO:180, SEQ ID NO:182, SEQ ID NO:184, SEQ ID NO:186, SEQ ID NO:188, SEQ ID NO:190, SEQ ID NO:192, SEQ ID NO:194, SEQ ID NO:196, SEQ ID NO:198, SEQ ID NO:200, SEQ ID NO:202 and SEQ ID NO:204, respectively.

[0138] The VH and VL gene identity (see, I. M. Tomlinson, S. C. Williams, O. Ignatovitch, S. J. Corbett, G. Winter, "V-BASE Sequence Directory," Cambridge United Kingdom: MRC Centre for Protein Engineering (1997)) and heavy chain CDR3 compositions of the scFvs specifically binding the rabies virus G protein are depicted in Table 9.

Example 6

In Vitro Neutralization of Rabies Virus by Rabies Virus-Specific scFvs (Modified RFFIT)

[0139] In order to determine whether the selected scFvs were capable of blocking rabies virus infection, in vitro neutralization assays (modified RFFIT) were performed. The scFv preparations were diluted by serial threefold dilutions starting with a 1:5 dilution. Rabies virus (strain CVS-11) was added to each dilution at a concentration that gives 80% to 100% infection. Virus/scFv mix was incubated for one hour at 37.degree. C./5% CO.sub.2 before addition to MNA cells. Twenty-four hours post-infection (at 34.degree. C./5% CO.sub.2), the cells were acetone-fixed for 20 minutes at 4.degree. C., and stained for minimally three hours with an anti-rabies N-FITC antibody conjugate (Centocor). The cells were then analyzed for rabies virus infection under a fluorescence microscope to determine the 50% endpoint dilution. This is the dilution at which the virus infection is blocked by 50% in this assay (see, Example 1). Several scFvs were identified that showed neutralizing activity against rabies virus (see, Table 10).

[0140] Additionally, it was investigated by means of the in vitro neutralization assay (modified RFFIT) as described above, if the selected scFvs were capable of neutralizing the E57 escape viruses as prepared in Example 1 (E57A2, E57A3, E57B1, E57B2, E57B3 and E57C3). Several scFvs were identified that showed neutralizing activity against the E57 escape viruses (see, Tables 11A and 11B).

Example 7

Rabies Virus G Protein Competition ELISA with scFvs

[0141] To identify antibodies that bind to non-overlapping, non-competing epitopes, a rabies glycoprotein competition ELISA was performed. Nunc-Immuno.TM. Maxisorp F96 plates (Nunc) were coated overnight at 4.degree. C. with a 1:1000 dilution of purified rabies virus glycoprotein (1 mg/ml; rabies virus ERA strain) in PBS (50 .mu.l). Uncoated protein was washed away before the wells were blocked with 100 .mu.l PBS/1% Protifar for one hour at room temperature. Subsequently, the blocking solution was discarded and 50 .mu.l of the non-purified anti-rabies virus scFvs in PBS/1% Protifar (2.times. diluted) was added. Wells were washed five times with 100 .mu.A of PBS/0.05% Tween-20. Then, 50 .mu.l biotinylated anti-rabies virus competitor IgG, CR-57bio, was added to each well, incubated for five minutes at room temperature, and the wells were washed five times with 100 .mu.l of PBS/0.05% Tween-20. To detect the binding of CR-57bio, 50 .mu.l of a 1:2000 dilution of streptavidin-HRP antibody (Becton Dickinson) was added to the wells and incubated for one hour at room temperature. Wells were washed again as above and the ELISA was further developed by addition of 100 .mu.l of OPD reagens (Sigma). The reaction was stopped by adding 50 .mu.l 1 M H.sub.2SO.sub.4 before measuring the OD at 492 nm.

[0142] The signal obtained with CR-57bio alone could be reduced to background levels when co-incubated with scFv 5057, i.e., the scFv form of CR-57 (for nucleotide and amino acid sequence of SO57 see SEQ ID NOS:205 and 206, respectively) or scFv SOJB, i.e., the scFv form of CR-JB (for nucleotide and amino acid sequence of SOJB see SEQ ID NOS:312 and 313, respectively). This indicates that the scFvs SO57 and SOJB compete with the interaction of CR-57bio to rabies virus glycoprotein by binding to the same epitope or to an overlapping epitope as CR-57bio, respectively. In contrast, an irrelevant scFv called SC02-007, i.e., a scFv binding to CD8, did not compete for binding. The anti-rabies virus scFvs called SC04-004, SC04-010, SC04-024, SC04-060, SC04-073, SC04-097, SC04-098, SC04-103, SC04-104, SC04-120, SC04-125, SC04-127, SC04-140, SC04-144 and SC04-146 did also not compete with CR-57bio, indicating that these scFvs bind to a different epitope than the epitope recognized by CR-57 (see, FIG. 4).

[0143] Similar results were obtained with the following experiment. First, the rabies virus antibody CR-57 was added to wells coated with rabies virus G protein. Next, the competing scFvs were added. In this set-up the anti-rabies virus scFvs were detected with anti-VSV-HRP by virtue of the presence of a VSV-tag in the scFv amino acid sequences (see, FIG. 5).

Example 8

Construction of Fully Human Immunoglobulin Molecules (Human Monoclonal Anti-Rabies Virus Antibodies) from the Selected Anti-Rabies Virus Single Chain Fvs

[0144] Heavy and light chain variable regions of the scFvs called SC04-001, SC04-008, SC04-018, SC04-040 and SC04-126 were PCR-amplified using oligonucleotides to append restriction sites and/or sequences for expression in the IgG expression vectors pSyn-C03-HC.gamma.1 (see, SEQ ID NO:277) and pSyn-C04-C.lamda. (see, SEQ ID NO:278), respectively. The V.sub.H and V.sub.L genes were amplified using the oligonucleotides as shown in Table 12 and 13, respectively, and the PCR products were cloned into the vectors pSyn-C03-HC.gamma.1 and pSyn-C04-C.lamda., respectively.

[0145] Heavy and light chain variable regions of the scFvs called SC04-004, SC04-010, SC04-021, 5C04-026, SC04-031, SC04-038, SC04-060, SC04-073, SC04-097, SC04-098, SC04-103, SC04-104, SC04-108, SC04-120, SC04-125, SC04-140, SC04-144, SC04-146 and SC04-164 were also PCR-amplified using oligonucleotides to append restriction sites and/or sequences for expression in the IgG expression vectors pSyn-C03-HC.gamma.1 and pSyn-C05-C.kappa. (see, SEQ ID NO:279), respectively. The V.sub.H and V.sub.L genes were amplified using the oligonucleotides as given in Table 12 and 13, respectively, and the PCR products were cloned into the vectors pSyn-C03-HC.gamma.1 and pSyn-C05-Ck, respectively. The oligonucleotides are designed such that they correct any deviations from the germline sequence that have been introduced during library construction, due to the limited set of oligonucleotides that have been used to amplify the large repertoire of antibody genes. Nucleotide sequences for all constructs were verified according to standard techniques known to the skilled artisan.

[0146] The resulting expression constructs pgG104-001C03, pgG104-008C03, pgG104-018C03, pgG104-040C03 and pgG104-126C03 encoding the anti-rabies virus human IgG1 heavy chains in combination with the relevant pSyn-004-V.lamda. construct encoding the corresponding light chain were transiently expressed in 293T cells and supernatants containing IgG1 antibodies were obtained. The expression constructs pgG104-004C03, pgG104-010C03, pgG104-021C03, pgG104-026C03, pgG104-031C03, pgG104-038C03, pgG104-060C03, pgG104-073C03, pgG104-097C03, pgG104-098C03, pgG104-103C03, pgG104-104C03, pgG104-108C03, pgG104-120C03, pgG104-125C03, pgG104-140C03, pgG104-144C03, pgG104-146C03 and pgG104-164C03 encoding the anti-rabies virus human IgG1 heavy chains in combination with the relevant pSyn-C05-V.kappa. construct encoding the corresponding light chain were transiently expressed in 293T cells and supernatants containing IgG1 antibodies were obtained.

[0147] The nucleotide and amino acid sequences of the heavy and light chains of the antibodies called CR04-001, CR04-004, CR04-008, CR04-010, CR04-018, CR04-021, CR04-026, CR04-031, CR04-038, CR04-040, CR04-060, CR04-073, CR04-097, CR04-098, CR04-103, CR04-104, CR04-108, CR04-120, CR04-125, CR04-126, CR04-140, CR04-144, CR04-146 and CR04-164 were determined according to standard techniques. Subsequently, the recombinant human monoclonal antibodies were purified over a protein-A column followed by a buffer exchange on a desalting column using standard purification methods used generally for immunoglobulins (see, for instance WO 00/63403 which is incorporated by reference herein).

[0148] Additionally, for CR04-098, a single human IgG1 expression vector named pgG104-098C10 was generated as described above for vectors pgSO57C11 and pgSOJBC11 encoding CR-57 and CR-JB, respectively (see, Example 1). The nucleotide and amino acid sequences of the heavy and light chains of antibody CR04-098 encoded by vector pgG104-098C10 are shown in SEQ ID NOS:334 through 337, respectively. Vectors pgSO57C11 (see, Example 1) and pgG104-098C10 were used for stable expression of CR-57 and CR04-098, respectively, in cells from the cell line deposited at the European Collection of Cell Cultures (ECACC), CAMR, Salisbury, Wiltshire SP4 OJG, Great Britain on 29 Feb. 1996 under number 96022940 and marketed under the trademark PER.C6.RTM.. The stably produced CR-57 and CR04-098 have a calculated isoelectric point of 8.22 and 8.46, respectively. The experimentally observed isoelectric points are between 8.1-8.3 for CR-57 and 9.0-9.2 for CR04-098. The recombinant human monoclonal antibodies were purified as described above. Unless otherwise stated, for CR04-001, CR04-004, CR04-008, CR04-010, CR04-018, CR04-021, CR04-026, CR04-031, CR04-038, CR04-040, CR04-060, CR04-073, CR04-097, CR04-098, CR04-103, CR04-104, CR04-108, CR04-120, CR04-125, CR04-126, CR04-140, CR04-144, CR04-146 and CR04-164 use was made of recombinant human monoclonal antibodies transiently expressed by the two vector system as described above and for CR57 use was made of recombinant human monoclonal antibody transiently expressed by the one vector system as described in Example 1.

Example 9

Rabies Virus G Protein Competition ELISA with IgGs

[0149] To address whether the human monoclonal anti-rabies virus G protein IgGs bind to non-overlapping, non-competing epitopes, competition experiments are performed. Wells with coated rabies virus G protein are incubated with increasing concentrations (0 to 50 .mu.g/ml) of unlabeled anti-rabies virus G protein IgG for one hour at room temperature. Then, 50 .mu.l of a different biotinylated anti-rabies virus IgG (1 .mu.g/ml) is added to each well, incubated for five minutes at room temperature, and immediately washed five times with 100 .mu.l of PBS/0.05% Tween-20. Subsequently, wells are incubated for one hour at room temperature with 50 .mu.l of a 1:2000 dilution of streptavidin-HRP (Becton Dickinson), washed and developed as described above. A decrease in signal with increasing concentration of unlabeled IgG indicates that the two antibodies are competing with each other and recognize the same epitope or overlapping epitopes.

[0150] Alternatively, wells coated with rabies virus G protein (ERA strain) were incubated with 50 lag/ml of unlabeled anti-rabies virus G protein IgG for one hour at room temperature. Then, 50 .mu.l of biotinylated CR57 (0.5 to 5 .mu.g/ml; at subsaturated levels) was added to each well. The further steps were performed as described supra. The signals obtained were compared to the signal obtained with only biotinylated CR57 (see, FIG. 6; no competitor). From FIG. 6 can be deduced that the signal could not be reduced with the antibody called CR02-428 which served as a negative control. In contrast, competition with unlabeled CR57 (positive control) or CR-JB reduced the signal to background levels. From FIG. 6 can further be deduced that none of the anti-rabies virus G protein IgGs competed significantly with CR-57, which is in agreement with the scFv competition data as described in Example 7.

[0151] In addition, competition experiments were performed on rabies virus G protein (ERA strain) transfected PER.C6.RTM. cells by means of flow cytometry. Transfected cells were incubated with 20 .mu.A of unlabeled anti-rabies virus G protein IgG (50 .mu.g/ml) for 20 minutes at 4.degree. C. After washing of the cells with PBS containing 1% BSA, 20 .mu.l of biotinylated CR57 (0.5 to 5 .mu.g/ml; at subsaturated levels) were added to each well, incubated for five minutes at 4.degree. C., and immediately washed twice with 100 .mu.l of PBS containing 1% BSA. Subsequently, wells were incubated for 15 minutes at 4.degree. C. with 20 .mu.l of a 1:200 dilution of streptavidin-PE (Caltag), washed and developed as described above. The signal obtained with biotinylated CR57 could not be reduced significantly with the negative control antibody CR02-428 (see, FIG. 7). In contrast, competition with unlabeled CR57 (positive control) or CR-JB reduced the signal to background levels. None of the anti-rabies virus G protein IgGs competed significantly with CR-57, with the exception of CR04-126 which reduced the signal to approximately 30% (see, FIG. 7). The latter did not compete in ELISA (see, FIG. 6). This may be caused by the difference in the way the glycoprotein is presented to the antibody in FACS experiments compared to ELISA experiments. The binding of CR04-126 could be more dependent on the conformation of the glycoprotein, resulting in the competitive effect observed with CR04-126 in the FACS-based competition assay and not in the ELISA-based competition assay. Additionally, CR04-008 and CR04-010 reduced the signal to approximately 50% (see, FIG. 7) in the FACS-based competition assay indicating that they might compete with CR57. For CR04-010 this was however not confirmed by the scFv competition data or the ELISA-based competition assay. For the other IgGs, the FACS data were in agreement with the respective ELISA data of both the scFvs and the IgGs.

Example 10

Additive/Synergistic Effects of Anti-Rabies IgGs in In Vitro Neutralization of Rabies Virus (Modified RFFIT)

[0152] In order to determine whether the anti-rabies virus G protein IgGs have additive or synergistic effects in neutralization of rabies virus, different combinations of the IgGs are tested. First, the potency (in IU/mg) of each individual antibody is determined in a modified RFFIT (see, Example 1). Then, antibody combinations are prepared based on equal amounts of IU/mg and tested in the modified RFFIT. The potencies of each antibody combination can be determined and compared with the expected potencies. If the potency of the antibody combination is equal to the sum of the potencies of each individual antibody present in the combination, the antibodies have an additive effect. If the potency of the antibody combination is higher, the antibodies have a synergistic effect in neutralization of rabies virus.

[0153] Alternatively, additive or synergistic effects can be determined by the following experiment. First, the potency of the antibodies to be tested, e.g., CR-57 and CR04-098, is determined in a standard RFFIT (see, "Laboratory techniques in rabies," edited by F.-X. Meslin, M. M. Kaplan and H. Koprowski (1996), 4th edition, Chapter 15, World Health Organization, Geneva). Then, the antibodies are mixed in a 1:1 ratio based on This antibody mixture, along with the individual antibodies at the same concentration, are tested in six independent RFFIT experiments to determine the 50% neutralizing endpoint. Subsequently, the combination index (CI) is determined for the antibody mixture using the formula CI=(C1/Cx1)+(C2/Cx2)+(C1C2/Cx1Cx2) as described by Chou et al. (1984). C1 and C2 are the amount (in .mu.g) of monoclonal antibody 1 and monoclonal antibody 2 that lead to 50% neutralization when used in combination and Cx1 and Cx2 are the amount (in .mu.g) of monoclonal antibody 1 and monoclonal antibody 2 that lead to 50% neutralization when used alone. CI=1, indicates an additive effect, CI<1 indicates a synergistic effect and CI>1 indicates an antagonistic effect of the monoclonal antibodies.

Example 11

Identification of Epitopes Recognized by Recombinant Human Anti-Rabies Virus Antibodies by PEPSCAN-ELISA

[0154] 15-mer linear and looped/cyclic peptides were synthesized from the extracellular domain of the G protein of the rabies virus strain ERA (see, SEQ ID NO:207 for the complete amino acid sequence of the glycoprotein G of the rabies virus strain ERA, the extracellular domain consists of amino acids 20-458; the protein-id of the glycoprotein of rabies virus strain ERA in the EMBL-database is J02293) and screened using credit-card format mini-PEPSCAN cards (455 peptide formats/card) as described previously (Slootstra et al., 1996; WO 93/09872). All peptides were acetylated at the amino terminus. In all looped peptides position-2 and position-14 were replaced by a cysteine (acetyl-XC CX-minicard). If other cysteines besides the cysteines at position-2 and position-14 were present in a prepared peptide, the other cysteines were replaced by an alanine. The looped peptides were synthesized using standard Fmoc-chemistry and deprotected using trifluoric acid with scavengers. Subsequently, the deprotected peptides were reacted on the cards with an 0.5 mM solution of 1,3-bis(bromomethyl)benzene in ammonium bicarbonate (20 mM, pH 7.9/acetonitril (1:1 (v/v)). The cards were gently shaken in the solution for 30 to 60 minutes, while completely covered in the solution. Finally, the cards were washed extensively with excess of H.sub.2O and sonicated in disrupt buffer containing 1% SDS/0.1% beta-mercaptoethanol in PBS (pH 7.2) at 70.degree. C. for 30 minutes, followed by sonication in H.sub.2O for another 45 minutes.

[0155] The human monoclonal antibodies were prepared as described above. Binding of these antibodies to each linear and looped peptide was tested in a PEPSCAN-based enzyme-linked immunosorbent assay (ELISA). The 455-well credit card format polypropylene cards, containing the covalently linked peptides, were incubated with the antibodies (10 .mu.g/ml; diluted in blocking solution, which contained 5% horse-serum (v/v) and 5% ovalbumin (w/v)) (4.degree. C., overnight). After washing, the peptides were incubated with anti-human antibody peroxidase (dilution 1/1000) (one hour, 25.degree. C.), and subsequently, after washing, the peroxidase substrate 2,2'-azino-di-3-ethylbenzthiazoline sulfonate (ABTS) and 2 .mu.l/ml 3% H.sub.2O.sub.2 were added. Controls (for linear and looped) were incubated with anti-human antibody peroxidase only. After one hour, the color development was measured. The color development of the ELISA was quantified with a CCD-camera and an image processing system. The set-up consisted of a CCD-camera and a 55 mm lens (Sony CCD Video Camera XC-77RR, Nikon micro-nikkor 55 mm f/2.8 lens), a camera adaptor (Sony Camera adaptor DC-77RR) and the Image Processing Software package Optimas, version 6.5 (Media Cybernetics, Silver Spring, Md. 20910, U.S.A.). Optimas ran on a Pentium II computer system.

[0156] The human anti-rabies virus G protein monoclonal antibodies were tested for binding to the 15-mer linear and looped/cyclic peptides synthesized as described supra. A peptide is considered to relevantly bind to an antibody when OD values are equal to or higher than two times the average OD-value of all peptides (per antibody). See Table 14 for results of the binding of the human monoclonal antibodies called CR57, CRJB and CR04-010 to the linear peptides of the extracellular domain of glycoprotein G of rabies virus strain ERA. Regions showing significant binding to the respective antibodies are highlighted in grey.

[0157] Antibody CR57 bound to the linear peptides having an amino acid sequence selected from the group consisting of SLKGACKLKLCGVLG (SEQ ID NO:314), LKGACKLKLCGVLGL (SEQ ID NO:315), KGACKLKLCGVLGLR (SEQ ID NO:316), GACKLKLCGVLGLRL (SEQ ID NO:317), ACKLKLCGVLGLRLM (SEQ ID NO:318), CKLKLCGVLGLRLMD (SEQ ID NO:319), KLKLCGVLGLRLMDG (SEQ ID NO:320), LKLCGVLGLRLMDGT (SEQ ID NO:321) and KLCGVLGLRLMDGTW (SEQ ID NO:322) (see, Table 14). The peptides having the amino acid sequences GACKLKLCGVLGLRL (SEQ ID NO:317) and ACKLKLCGVLGLRLM (SEQ ID NO:318) have an OD-value that is lower than twice the average value. Nevertheless these peptides were claimed, because they are in the near proximity of a region of antigenic peptides recognized by antibody CR57. Binding was most prominent to the peptide with the amino acid sequence KLCGVLGLRLMDGTW (SEQ ID NO:322).

[0158] Antibody CR04-010 bound to the linear peptides having an amino acid sequence selected from the group consisting of GFGKAYTIFNKTLME (SEQ ID NO:323), FGKAYTIFNKTLMEA (SEQ ID NO:324), GKAYTIFNKTLMEAD (SEQ ID NO:325), KAYTIFNKTLMEADA (SEQ ID NO:326), AYTIFNKTLMEADAH (SEQ ID NO:327), YTIFNKTLMEADAHY (SEQ ID NO:328), TIFNKTLMEADAHYK (SEQ ID NO:329), IFNKTLMEADAHYKS (SEQ ID NO:330) and FNKTLMEADAHYKSV (SEQ ID NO:331). The peptides having the amino acid sequences AYTIFNKTLMEADAH (SEQ ID NO:327) and YTIFNKTLMEADAHY (SEQ ID NO:328) have an OD-value that is lower than twice the average value. Nevertheless these peptides were claimed, because they are in the near proximity of a region of antigenic peptides recognized by antibody CR04-010. Binding was most prominent to the peptides with the amino acid sequences TIFNKTLMEADAHYK (SEQ ID NO:329), IFNKTLMEADAHYKS (SEQ ID NO:330) and FNKTLMEADAHYKSV (SEQ ID NO:331).

[0159] CRJB and the antibodies called CR04-040, CR04-098 and CR04-103 (data not shown) did not recognize a region of linear antigenic peptides.

[0160] Any of the above peptides or parts thereof represents good candidates of a neutralizing epitope of rabies virus and could form the basis for a vaccine or for raising neutralizing antibodies to treat and/or prevent a rabies virus infection.

[0161] SLKGACKLKLCGVLGLRLMDGTW (SEQ ID NO:332) and GFGKAYTIFNKTLMEADAHYKSV (SEQ ID NO:333) are particularly interesting regions of the glycoprotein based on their high reactivity in PEPSCAN.

[0162] From the above PEPSCAN data can further be deduced that the human monoclonal antibodies called CR57 and CR04-010 bind to different regions of the rabies virus G protein indicating that they recognize non-competing epitopes.

Example 12

Determination of Neutralizing Potency of Anti-Rabies G Protein IgGs Using an In Vitro Neutralization Assay (Modified RFFIT)

[0163] The neutralizing potency of each of the produced human monoclonal antibodies was determined in a modified RFFIT as described in Example 1. Sixteen IgGs neutralized rabies strain CVS-11 with a potency higher than 1000 IU/mg, whereas only two IgGs had a potency lower than 2 IU/mg (see, Table 15). Eight of the sixteen antibodies outperformed transiently produced CR-57 with regard to potency, suggesting a higher efficiency in post exposure prophylaxis of rabies virus than CR-57. The potency of transiently produced CR-57 was approximately 3800 IU/mg protein (see, Tables 1 and 15), whereas stably produced CR-57 displayed a potency of 5400 IU/mg protein (data not shown). Interestingly, the majority of the neutralizing human monoclonal antibodies identified contain a variable heavy 3-30 germline gene (see, Table 9).

[0164] Based on the affinity of the antibodies for rabies virus (data not shown) and 100% endpoint dilution of the antibodies in a modified RFFIT assay (data not shown), a panel of six unique IgGs, i.e., CR04-010, CR04-040, CR04-098, CR04-103, CR04-104, and CR04-144, were chosen for further development. Within this panel, antibody CR04-098 was particularly interesting as it displayed the highest potency, i.e., approximately 7300 IU/mg protein (see, Table 15). A similar potency was also found for stably produced CR04-098 (data not shown).

Example 13

In Vitro Neutralization of E57 Escape Viruses by Anti-Rabies Virus IgGs

[0165] To further characterize the novel human monoclonal anti-rabies antibodies the neutralizing activity of the IgGs against E57 escape viruses was tested in a modified RFFIT as described above. The majority of the anti-rabies virus IgGs had good neutralizing activity against all six E57 escape viruses (see, Table 16). In contrast, CR04-008, CR04-018 and CR04-126 did not neutralize 6/6, 2/6 and 3/6 E57 escape viruses, respectively. No neutralization means that no 50% endpoint was reached at an antibody dilution of 1:100. CR04-021, CR04-108, CR04-120, CR04-125, and CR04-164 showed a significant decrease in neutralizing activity against a number of escape viruses. This suggests that the epitope of these antibodies has been affected either directly or indirectly in the E57 escape virus glycoprotein. On the basis of the above several anti-rabies virus IgGs may be compatible with CR-57 in an anti-rabies cocktail for post exposure prophylaxis treatment. In particular, the panel of six unique IgGs as identified above, i.e., antibodies CR04-010, CR04-040, CR04-098, CR04-103, CR04-104, and CR04-144, displayed good neutralizing potency towards the E57 escape viruses suggesting that epitope(s) recognized by these antibodies was/were not affected by the amino acid mutations induced by CR-57. Antibody CR04-098 appeared most promising since it had a potency higher than 3000 IU/mg for each of the escape viruses.

Example 14

Epitope recognition of anti-rabies antibodies CR-57 and CR04-098

[0166] To confirm that the human monoclonal antibodies called CR-57 and CR04-098 recognize non-overlapping, non-competing epitopes, escape viruses of the human monoclonal antibody called CR04-098 were generated essentially as described for escape viruses of CR57 (see, Example 1). In short, the number of foci per well was scored by immunofluorescence and medium of wells containing preferably one focus were chosen for virus amplification. All E98 escape viruses were generated from one single focus with the exception of E98-2 (two foci) and E98-4 (four foci). A virus was defined as an escape variant if the neutralization index was <2.5 logs. The neutralization index was determined by subtracting the number of infectious virus particles/ml produced in BSR cell cultures infected with virus plus monoclonal antibody (.about.4 IU/ml) from the number of infectious virus particles/ml produced in BSR or MNA cell cultures infected with virus alone (log focus forming units/ml virus in absence of monoclonal antibody minus log ffu/ml virus in presence of monoclonal antibody). An index lower than 2.5 logs was considered as evidence of escape.

[0167] To further investigate that CR04-098 binds to a different non-overlapping, non-competing epitope compared to CR-57, CR-57 was tested against E98 escape viruses in a modified RFFIT assay as described above. As shown in Table 17, CR-57 had good neutralizing activity against all five E98 escape viruses. Additionally, antibodies CR04-010 and CR04-144 were tested for neutralizing activity against the E98 escape viruses. Both antibodies did not neutralize the E98 escape viruses (data not shown) suggesting that the epitope recognized by both antibodies is either directly or indirectly affected by the amino acid mutation induced by antibody CR04-098. The antibodies CR04-018 and CR04-126 were tested for neutralizing activity against only one of the E98 escape viruses, i.e., E98-4. CR04-018 was capable of neutralizing the escape virus, while CR04-126 only had a weak neutralizing potency towards the escape virus. This suggests that the epitope recognized by CR04-018 is not affected by the mutation induced by antibody CR04-098. Additionally, the antibodies CR04-010, CR04-038, CR04-040, CR04-073, CR04-103, CR04-104, CR04-108, CR04-120, CR04-125, CR04-164 did not neutralize E98-4 suggesting that they recognize the same epitope as CR04-098 (data not shown).

[0168] To identify possible mutations in the rabies glycoprotein of each of the E98 escape viruses, the nucleotide sequence of the glycoprotein open reading frame (ORF) was determined as described before for the E57 and EJB escape viruses. All E98 escape viruses showed the mutation N to D at amino acid position 336 of the rabies glycoprotein (see, FIG. 8). This region of the glycoprotein has been defined as antigenic site III comprising of amino acids 330-338 (numbering without signal peptide). In contrast, CR-57 recognized an epitope located at amino acids 226-231 (numbering without signal peptide), which overlaps with antigenic site I. In addition to the N336D mutation the E98 escape virus called E98-5 showed the mutation H to Q at amino acid position 354 (codon change CAT to CAG) of the rabies glycoprotein (data not shown).

[0169] Moreover, Pepscan analysis of binding of CR57 to peptides harboring a mutated CR57 epitope (as observed in E57 escape viruses) did show that interaction of CR57 was abolished (data not shown). Strikingly, CR04-098 was still capable of binding to the mutated glycoprotein (comprising the N336D mutation) expressed on PER.C6.RTM. cells, as measured by flow cytometry (data not shown), even though viruses containing this mutation were no longer neutralized.

[0170] Furthermore, epitope mapping studies and affinity ranking studies were performed using surface plasmon resonance analysis using a BIAcore3000.TM. analytical system. Purified rabies glycoprotein (ERA strain) was immobilized as a ligand on a research grade CM5 four-flow channel (Fc) sensor chip (Biacore AB, Sweden) using amine coupling. Ranking was performed at 25.degree. C. with HBS-EP (Biacore AB, Sweden) as running buffer. 50 .mu.l of each antibody was injected at a constant flow rate of 20 .mu.l/minute. Then, running buffer was applied for 750 seconds followed by regeneration of the CM5 chip with 5 .mu.l 2M NaOH, 5 .mu.l 45 mM HCl and 5 .mu.l 2 mM NaOH. The resonance signals expressed as resonance units (RU) were plotted as a function of time and the increase and decrease in RU as a measure of association and dissociation, respectively, were determined and used for ranking of the antibodies. The actual KD values for CR57 and CR04-098 as determined by surface plasmon resonance analysis were 2.4 nM and 4.5 nM, respectively. The epitope mapping studies further confirmed that CR57 and CR04-098 bind to different epitopes on rabies glycoprotein. Injection of CR57 resulted in a response of 58 RU (data not shown). After injection of CR04-098 an additional increase in response level (24 RU) was obtained, suggesting that binding sites for CR04-098 were not occupied (data not shown). Similar results were observed when the reverse order was applied showing that each antibody reached similar RU levels regardless of the order of injection (data not shown). These results further demonstrate that CR57 and CR04-098 can bind simultaneously and recognize different epitopes on the rabies virus glycoprotein.

[0171] Overall, the above data further confirm that the antibodies CR-57 and CR04-098 recognize distinct non-overlapping epitopes, i.e., epitopes in antigenic site I and III, respectively. The data are in good agreement with the ELISA/FACS competition data indicating that CR-57 and CR04-098 do not compete for binding to ERA G and the good neutralizing activity of antibody CR04-098 against all E57 escape viruses. On the basis of these results and the fact that in vitro exposure of rabies virus to the combination of CR57 and CR04-098 (selection in the presence of 4 IU/ml of either antibody) yielded no escape viruses (data not shown), it was concluded that the antibodies CR-57 and CR04-098 recognize non-overlapping, non-competing epitopes and can advantageously be used in an anti-rabies virus antibody cocktail for post-exposure prophylaxis treatment.

Example 15

Assessment of Conservation of the Epitope Recognized by CR57 and CR04-098

[0172] The minimal binding region of CR-57 (amino acids KLCGVL within SEQ ID NO:332, the region of the glycoprotein of rabies virus recognized by CR57 as determined by means of PEPSCAN and alanine scanning technology) was aligned with nucleotide sequences of 229 genotype 1 rabies virus isolates to assess the conservation of the epitope (see, Table 18). The sample set contained human isolates, bat isolates and isolates from canines or from domestic animals most likely bitten by rabid canines. Frequency analysis of the amino acids at each position within the minimal binding region revealed that the critical residues constituting the epitope were highly conserved. The lysine at position one was conserved in 99.6% of the isolates, while in only 1/229 isolates a conservative K>R mutation was observed. Positions two and three (L and C) were completely conserved. It is believed that the central cysteine residue is structurally involved in the glycoprotein folding and is conserved among all lyssaviruses (see, Badrane and Tordo, 2001). The glycine at position four was conserved in 98.7% of the isolates, while in 3/229 isolates mutations towards charged amino acids (G>R in 1/229; G>E in 2/229) were observed. The fifth position was also conserved with the exception of one isolate where a conservative V>I mutation was observed. At the sixth position, which is not a critical residue as determined by an alanine-replacement scan, significant heterogeneity was observed in the street isolates: L in 70.7%, P in 26.7% and S in 2.6% of the strains, respectively. Taken together, approximately 99 percent of the rabies viruses that can be encountered are predicted to be recognized by the CR-57 antibody.

[0173] One hundred twenty-three of these 229 virus isolates were analyzed for the presence of mutations in both the CR-57 and CR04-098 epitope. None of these 123 street viruses did contain mutations in both epitopes. The N>D mutation as observed in the E98 escape viruses was present in only five virus isolates. These viruses were geographically distinct and isolated from animals in Africa (see, FIG. 9 for phylogenetic tree; the five virus isolates, i.e., AF325483, AF325482, AF325481, AF325480 and AF325485, are indicated in bold). The phylogenetic analysis of glycoprotein sequences revealed that rabies viruses with mutated CR57 epitopes are only distantly related to rabies viruses bearing a mutated CR04-098 epitope. Therefore, the likelihood of encountering a rabies virus resistant to neutralization by a cocktail of CR-57 and CR04-098 is virtually absent.

TABLE-US-00001 TABLE 1 Neutralizing potency of CR-57 and CR-JB against wild-type and escape viruses. Potency Potency Potency Potency CR-57 CR-JB CR-57 CR-JB Virus (IU/mg) (IU/mg) Virus (IU/mg) (IU/mg) CVS-11 3797 605 CVS-11 3797 605 E57A2 0 <0.2 EJB2B 0.004 0.6 E57A3 0 419 EJB2C <0.004 2 E57B1 0 93 EJB2D <0.004 3 E57B2 0 <0.3 EJB2E <0.2 <0.3 E57B3 0 419 EJB2F <0.06 3 E57C3 0 31 EJB3F <0.04 0.06

TABLE-US-00002 TABLE 2 Human lambda chain variable region primers (sense). Primer name Primer nucleotide sequence SEQ ID NO HuV.lamda.1A 5'-CAGTCTGTGCTGACTCAGCC SEQ ID NO: 208 ACC-3' HuV.lamda.1B 5'-CAGTCTGTGYTGACGCAGCCG SEQ ID NO: 209 CC-3' HuV.lamda.1C 5'-CAGTCTGTCGTGACGCAGCCG SEQ ID NO: 210 CC-3' HuV.lamda.2 5'-CARTCTGCCCTGACTCAGCCT-3' SEQ ID NO: 211 HuV.lamda.3A 5'-TCCTATGWGCTGACTCAGCCAC SEQ ID NO: 212 C-3' HuV.lamda.3B 5'-TCTTCTGAGCTGACTCAGGAC SEQ ID NO: 213 CC-3' HuV.lamda.4 5'-CACGTTATACTGACTCAACCGC SEQ ID NO: 214 C-3' HuV.lamda.5 5'-CAGGCTGTGCTGACTCAGCCG SEQ ID NO: 215 TC-3' HuV.lamda.6 5'-AATTTTATGCTGACTCAGCCCC SEQ ID NO: 216 A-3' HuV.lamda.7/8 5'-CAGRCTGTGGTGACYCAGGAGC SEQ ID NO: 217 C-3' HuV.lamda.9 5'-CWGCCTGTGCTGACTCAGCCMC SEQ ID NO: 218 C-3'

TABLE-US-00003 TABLE 3 Human kappa chain variable region primers (sense). Primer name Primer nucleotide sequence SEQ ID NO HuV.kappa.1B 5'-GACATCCAGWTGACCCAGTCTCC-3' SEQ ID NO: 219 HuV.kappa.2 5'-GATGTTGTGATGACTCAGTCTCC-3' SEQ ID NO: 220 HuV.kappa.3 5'-GAAATTGTGWTGACRCAGTCTCC-3' SEQ ID NO: 221 HuV.kappa.4 5'-GATATTGTGATGACCCACACTCC-3' SEQ ID NO: 222 HuV.kappa.5 5'-GAAACGACACTCACGCAGTCTCC-3' SEQ ID NO: 223 HuV.kappa.6 5'-GAAATTGTGCTGACTCAGTCTCC-3' SEQ ID NO: 224

TABLE-US-00004 TABLE 4 Human kappa chain variable region primers extended with SalI restriction sites (sense), human kappa chain J-region primers extended with NotI restriction sites (anti-sense), human lambda chain variable region primers extended with SalI restriction sites (sense) and human lambda chain J-region primers extended with NotI restriction sites (anti-sense). Primer name Primer nucleotide sequence SEQ ID NO HuV.kappa.1B-SalI 5'-TGAGCACACAGGTCGACGGACATCCAGWTGACCCAGTCTCC-3' SEQ ID NO: 225 HuV.kappa.2-SalI 5'-TGAGCACACAGGTCGACGGATGTTGTGATGACTCAGTCTCC-3' SEQ ID NO: 226 HuV.kappa.3B-SalI 5'-TGAGCACACAGGTCGACGGAAATTGTGWTGACRCAGTCTCC-3' SEQ ID NO: 227 HuV.kappa.4B-SalI 5'-TGAGCACACAGGTCGACGGATATTGTGATGACCCACACTCC-3' SEQ ID NO: 228 HuV.kappa.5-SalI 5'-TGAGCACACAGGTCGACGGAAACGACACTCACGCAGTCTCC-3' SEQ ID NO: 229 HuV.kappa.6-SalI 5'-TGAGCACACAGGTCGACGGAAATTGTGCTGACTCAGTCTCC-3' SEQ ID NO: 230 HuJ.kappa.1-NotI 5'-GAGTCATTCTCGACTTGCGGCCGCACGTTTGATTTCCACCTTGGTCCC-3' SEQ ID NO: 231 HuJ.kappa.2-NotI 5'-GAGTCATTCTCGACTTGCGGCCGCACGTTTGATCTCCAGCTTGGTCCC-3' SEQ ID NO: 232 HuJ.kappa.3-NotI 5'-GAGTCATTCTCGACTTGCGGCCGCACGTTTGATATCCACTTTGGTCCC-3' SEQ ID NO: 233 HuJ.kappa.4-NotI 5'-GAGTCATTCTCGACTTGCGGCCGCACGTTTGATCTCCACCTTGGTCCC-3' SEQ ID NO: 234 HuJ.kappa.5-NotI 5'-GAGTCATTCTCGACTTGCGGCCGCACGTTTAATCTCCAGTCGTGTCCC-3' SEQ ID NO: 235 HuV.lamda.1A-SalI 5'-TGAGCACACAGGTCGACGCAGTCTGTGCTGACTCAGCCACC-3' SEQ ID NO: 236 HuV.lamda.1B-SalI 5'-TGAGCACACAGGTCGACGCAGTCTGTGYTGACGCAGCCGCC-3' SEQ ID NO: 237 HuV.lamda.1C-SalI 5'-TGAGCACACAGGTCGACGCAGTCTGTCGTGACGCAGCCGCC-3' SEQ ID NO: 238 HuV.lamda.2-SalI 5'-TGAGCACACAGGTCGACGCARTCTGCCCTGACTCAGCCT-3' SEQ ID NO: 239 HuV.lamda.3A-SalI 5'-TGAGCACACAGGTCGACGTCCTATGWGCTGACTCAGCCACC-3' SEQ ID NO: 240 HuV.lamda.3B-SalI 5'-TGAGCACACAGGTCGACGTCTTCTGAGCTGACTCAGGACCC-3' SEQ ID NO: 241 HuV.lamda.4-SalI 5'-TGAGCACACAGGTCGACGCACGTTATACTGACTCAACCGCC-3' SEQ ID NO: 242 HuV.lamda.5-SalI 5'-TGAGCACACAGGTCGACGCAGGCTGTGCTGACTCAGCCGTC-3' SEQ ID NO: 243 HuV.lamda.6-SalI 5'-TGAGCACACAGGTCGACGAATTTTATGCTGACTCAGCCCCA-3' SEQ ID NO: 244 HuV.lamda.7/8-SalI 5'-TGAGCACACAGGTCGACGCAGRCTGTGGTGACYCAGGAGCC-3' SEQ ID NO: 245 HuV.lamda.9-SalI 5'-TGAGCACACAGGTCGACGCWGCCTGTGCTGACTCAGCCMCC-3' SEQ ID NO: 246 HuJ.lamda.1-NotI 5'-GAGTCATTCTCGACTTGCGGCCGCACCTAGGACGGTGACCTTGGTCCC-3' SEQ ID NO: 247 HuJ.lamda.2/3-NotI 5'-GAGTCATTCTCGACTTGCGGCCGCACCTAGGACGGTCAGCTTGGTCCC-3' SEQ ID NO: 248 HuJ.lamda.4/5-NotI 5'-GAGTCATTCTCGACTTGCGGCCGCACYTAAAACGGTGAGCTGGGTCCC-3' SEQ ID NO: 249

TABLE-US-00005 TABLE 5 Distribution of the different light chain products over the ten fractions. Number Fraction Light chain products of alleles number alleles/fraction Vk1B/Jk1-5 19 1 and 2 9.5 Vk2/Jk1-5 9 3 9 Vk3B/Jk1-5 7 4 7 Vk4B/Jk1-5 1 5 5 Vk5/Jk1-5 1 Vk6/Jk1-5 3 V.lamda.1A/Jl1-3 5 6 5 V.lamda.1B/Jl1-3 V.lamda.1C/Jl1-3 V.lamda.2/Jl1-3 5 7 5 V.lamda.3A/Jl1-3 9 8 9 V.lamda.3B/Jl1-3 V.lamda.4/Jl1-3 3 9 5 V.lamda.5/Jl1-3 1 V.lamda.6/Jl1-3 1 V.lamda.7/8/Jl1-3 3 10 6 V.lamda.9/Jl1-3 3

TABLE-US-00006 TABLE 6 Human IgG heavy chain variable region primers (sense). Primer name Primer nucleotide sequence SEQ ID NO HuVH1B/ 5'-CAGRTGCAGCTGGTGCARTCT SEQ ID NO: 250 7A GG-3' HuVH1C 5'-SAGGTCCAGCTGGTRCAGTCTGG- SEQ ID NO: 251 3' HuVH2B 5'-SAGGTGCAGCTGGTGGAGTCTG SEQ ID NO: 252 G-3' HuVH3B 5'-SAGGTGCAGCTGGTGGAGTCTG SEQ ID NO: 253 G-3' HuVH3C 5'-GAGGTGCAGCTGGTGGAGWCYG SEQ ID NO: 254 G-3' HuVH4B 5'-CAGGTGCAGCTACAGCAGTGG SEQ ID NO: 255 GG-3' HuVH4C 5'-CAGSTGCAGCTGCAGGAGTCSG SEQ ID NO: 256 G-3' HuVH5B 5'-GARGTGCAGCTGGTGCAGTCT SEQ ID NO: 257 GG-3' HuVH6A 5'-CAGGTACAGCTGCAGCAGTCAG SEQ ID NO: 258 G-3'

TABLE-US-00007 TABLE 7 Human IgG heavy chain variable region primers extended with SfiI/NcoI restriction sites (sense) and human IgG heavy chain J-region primers extended with XhoI/BstEII restriction sites (anti-sense). Primer name Primer nucleotide sequence SEQ ID NO HuVH1B/7A-SfiI 5'-GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCCAGRTGCAGCTGGTGCARTCTGG-3' SEQ ID NO: 259 HuVH1C-SfiI 5'-GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCSAGGTCCAGCTGGTRCAGTCTGG-3' SEQ ID NO: 260 HuVH2B-SfiI 5'-GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCCAGRTCACCTTGAAGGAGTCTGG-3' SEQ ID NO: 261 HuVH3B-SfiI 5'-GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCSAGGTGCAGCTGGTGGAGTCTGG-3' SEQ ID NO: 262 HuVH3C-SfiI 5'-GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAGWCYGG-3' SEQ ID NO: 263 HuVH4B-SfiI 5'-GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTACAGCAG TGGGG-3' SEQ ID NO: 264 HuVH4C-SfiI 5'-GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCCAGSTGCAGCTGCAGGAGTCSGG-3' SEQ ID NO: 265 HuVH5B-SfiI 5'-GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCGARGTGCAGCTGGTGCAGTCTGG-3' SEQ ID NO: 266 HuVH6A-SfiI 5'-GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCCCAGGTACAGCTGCAGCAGTCAGG-3' SEQ ID NO: 267 HuJH1/2-XhoI 5'-GAGTCATTCTCGACTCGAGACGGTGACCAGGGTGCC-3' SEQ ID NO: 268 HuJH3-XhoI 5'-GAGTCATTCTCGACTCGAGACGGTGACCATTGTCCC-3' SEQ ID NO: 269 HuJH4/5-XhoI 5'-GAGTCATTCTCGACTCGAGACGGTGACCAGGGTTCC-3' SEQ ID NO: 270 HuJH6-XhoI 5'-GAGTCATTCTCGACTCGAGACGGTGACCGTGGTCCC-3' SEQ ID NO: 271

TABLE-US-00008 TABLE 8 Binding of single-chain (scFv) phage antibodies to rabies virus G protein (ERA strain) and to FBS as measured by ELISA. Name phage Rabies virus FBS antibody G protein (OD 492 nm) (OD 492 nm) SC04-001 0.828 0.053 SC04-004 0.550 0.054 SC04-008 0.582 0.058 SC04-010 0.915 0.043 SC04-018 0.247 0.052 SC04-021 0.278 0.052 SC04-026 0.212 0.054 SC04-031 0.721 0.065 SC04-038 0.653 0.061 SC04-040 0.740 0.053 SC04-060 0.923 0.056 SC04-073 0.657 0.054 SC04-097 0.835 0.056 SC04-098 0.798 0.060 SC04-103 0.606 0.059 SC04-104 0.566 0.063 SC04-108 0.363 0.052 SC04-120 0.571 0.052 SC04-125 0.735 0.049 SC04-126 0.232 0.051 SC04-140 0.865 0.057 SC04-144 0.775 0.054 SC04-146 0.484 0.057 SC04-164 0.547 0.057 control (SO57) 0.650 0.055 control (02-007) 0.063 0.052

TABLE-US-00009 TABLE 9 Data of the single-chain Fvs capable of binding rabies virus G protein. SEQ SEQ ID NO ID NO of of nucl. amino acid Name scFv (libr.) sequence sequence HCDR3 (SEQ ID NO:) V.sub.H-locus V.sub.L-locus sc04-001 (JK1994) 157 158 GLYGELFDY (SEQ ID NO: 1) 3-20 (DP32) Vl3 (31-V2-13) sc04-004 (WT2000) 159 160 DYLYPTTDFDY (SEQ ID NO: 2) 3-23 (DP47) VkI (O12/O2-DPK9) sc04-008 (RAB-03-G01) 161 162 MGFTGTYFDY (SEQ ID NO: 3) 2-70 (DP28) Vl3 (3h-V2-14) sc04-010 (RAB-03-G01) 163 164 DGLDLTGTIQPFGY (SEQ ID NO: 4) 3-30 (DP49) VkI (L11-DPK3) sc04-018 (RAB-03-G01) 165 166 VSVTTGAFNI (SEQ ID NO: 5) 4-04 (DP70) Vl1 (lc-V1-16) sc04-021 (RAB-03-G01) 167 168 GSVLGDAFDI (SEQ ID NO: 6) 3-30 (DP49) VkI (L8) sc04-026 (RAB-03-G01) 169 170 TSNWNYLDRFDP (SEQ ID NO: 7) 5-51 (DP73) VkII (A19/03-DPK15) sc04-031 (RAB-03-G01) 171 172 GSVLGDAFDI (SEQ ID NO: 8) 3-30 (DP49) VkI (L5-DPK5) sc04-038 (RAB-03-G01) 173 174 GSVLGDAFDI (SEQ ID NO: 9) 3-30 (DP49) VkI (L5-DPK5) sc04-040 (RAB-03-G01) 175 176 GSKVGDFDY (SEQ ID NO: 10) 3-30 (DP49) Vl3 (3h-V2-14) sc04-060 (RAB-04-G01) 177 178 EKEKYSDRSGYSYYYYYMDV 4-59 (DP71) VkI (O12/O2-DPK9) (SEQ ID NO: 11) sc04-073 (RAB-04-G01) 179 180 DGLDLTGTIQPFGY (SEQ ID NO: 12) 3-30 (DP49) VkI (L12) sc04-097 (RAB-04-G01) 181 182 TASNLGRGGMDV (SEQ ID NO: 13) 3-23 (DP47) VkI (L8) sc04-098 (RAB-04-G01) 183 184 VAVAGTHFDY (SEQ ID NO: 14) 3-30 (DP49) VkI (A30) sc04-103 (RAB-04-G01) 185 186 VAVAGESFDS (SEQ ID NO: 15) 3-30 (DP49) VkI (L5-DPK5) sc04-104 (RAB-04-G01) 187 188 IVVVTALDAFDI (SEQ ID NO: 16) 3-30 (DP49) VkI (L12) sc04-108 (RAB-04-G01) 189 190 FMIVADDAFDI (SEQ ID N0: 17) 3-30 (DP49) VkI (L1) sc04-120 (RAB-04-G01) 191 192 GGKTGEFDY (SEQ ID NO: 18) 3-30 (DP49) VkI (L8) sc04-125 (RAB-04-G01) 193 194 IATAGTGFDY (SEQ ID NO: 19) 3-30 (DP49) VkI (L8) sc04-126 (RAB-04-G01) 195 196 MGFTGTYFDY (SEQ ID NO: 20) 2-70 (DP28) Vl3 (3h-V2-14) sc04-14 (RAB-04-G01) 197 198 VTNPGDAFDI (SEQ ID NO: 21) 3-30 (DP49) VkI (L4/18a) sc04-144 (RAB-04-G01) 199 200 GGKTGEFDY (SEQ ID NO: 22) 3-30 (DP49) VkI (L8) sc04-146 (RAB-04-G01) 201 202 GGKTGEFDY (SEQ ID NO: 23) 3-30 (DP49) VkIII (L2-DPK21) sc04-164 (RAB-04-G01) 203 204 GSVLGDAFDI (SEQ ID NO: 24) 3-30 (DP49) VkI (L19-DPK6) SO57 205 206 ENLDNSGTYYYFSGWFDP 1-69 (DP10) Vl2 (2e-V1-3) (SEQ ID NO: 25) SOJB 312 313 RQHISSFPWFDS (SEQ ID NO: 276) 2-05 Vl3 (3h-V2-14)

TABLE-US-00010 TABLE 10 Data of assay for rabies virus-neutralizing activity of scFvs. 50% endpoint 50% endpoint dilution Potency Name scFv dilution WHO standard (2 IU/ml) (IU/ml) SC04-001 270 405 1.3 SC04-004 3645 405 18 SC04-008 >10935 405 >54 SC04-010 810 405 4 SC04-018 15 405 0.1 SC04-021 270 405 1.3 SC04-026 45 270 0.3 SC04-031 90 270 0.7 SC04-038 270 270 2 SC04-040 45 270 0.3 SC04-060 30 270 0.2 SC04-073 405 270 3 SC04-097 30 270 0.2 SC04-098 1215 270 9 SC04-103 45 270 0.3 SC04-104 135 270 1 SC04-108 135 270 1 SC04-120 810 270 6 SC04-125 405 270 3 SC04-126 10 270 0.1 SC04-140 135 270 1 SC04-144 810 270 6 SC04-146 405 270 3 SC04-164 45 270 0.3

TABLE-US-00011 TABLE 11A Data of assay for measuring neutralizing activity of scFvs for E57 escape viruses E57A2, E57A3 and E57B1. E57A2 E57A3 E57B1 Name scFv 1* 2* 3* 1* 2* 3* 1* 2* 3* SC04-001 10 90 0.2 10 90 0.2 30 45 1.3 SC04-004 810 90 18.0 1215 90 27.0 810 45 36.0 SC04-008 10 90 0.2 15 90 0.3 270 45 12.0 SC04-010 270 90 6.0 270 90 6.0 270 45 12.0 SC04-018 5 90 0.1 15 90 0.3 15 45 0.7 SC04-021 10 90 0.2 30 90 0.7 10 90 0.2 SC04-026 <5 90 0.0 <5 45 0.0 <5 90 0.0 SC04-031 10 90 0.2 30 90 0.7 10 90 0.2 SC04-038 90 90 2.0 90 90 2.0 45 90 1.0 SC04-040 15 90 0.3 5 90 0.1 5 90 0.1 SC04-060 5 90 0.1 5 90 0.1 <5 90 0.0 SC04-073 135 90 3.0 90 30 6.0 30 30 2.0 SC04-097 <5 90 0.0 <5 90 0.0 <5 90 0.0 SC04-098 810 90 18.0 270 30 18.0 270 30 18.0 SC04-103 <5 90 0.0 10 90 0.2 5 90 0.1 SC04-104 90 90 2.0 30 30 2.0 30 30 2.0 SC04-108 15 90 0.3 <5 90 0.0 <5 90 0.0 SC04-120 45 90 1.0 30 30 2.0 10 30 0.7 SC04-125 135 90 3.0 135 30 9.0 90 30 6.0 SC04-126 <5 90 0.0 <5 45 0.0 <5 90 0.0 SC04-140 30 45 1.3 90 30 6.0 45 90 1.0 SC04-144 270 45 12.0 270 30 18.0 135 90 3.0 SC04-146 90 45 4.0 90 30 6.0 90 90 2.0 SC04-164 15 45 0.7 30 30 2.0 15 90 0.3 1* is 50% endpoint dilution 2* is 50% endpoint dilution WHO standard (2 IU/ml) 3* is Potency (IU/ml)

TABLE-US-00012 TABLE 11B Data of assay for measuring neutralizing activity of scFvs for E57 escape viruses E57B2, E57B3 and E57C3. E57B2 E57B3 E57C3 Name scFv 1* 2* 3* 1* 2* 3* 1* 2* 3* SC04-001 30 45 1.3 90 270 0.7 5 90 0.1 SC04-004 5 45 0.2 2430 270 18.0 270 90 6.0 SC04-008 5 45 0.2 45 270 0.3 10 90 0.2 SC04-010 45 45 2.0 405 270 3.0 270 90 6.0 SC04-018 15 45 0.7 15 270 0.1 30 90 0.7 SC04-021 10 90 0.2 30 270 0.2 10 90 0.2 SC04-026 <5 45 0.0 <5 45 0.0 <5 30 0.0 SC04-031 10 90 0.2 30 270 0.2 30 90 0.7 SC04-038 30 90 0.7 90 270 0.7 90 90 2.0 SC04-040 5 90 0.1 15 135 0.2 10 90 0.2 SC04-060 <5 90 0.0 10 135 0.1 5 90 0.1 SC04-073 30 90 0.7 90 270 0.7 90 90 2.0 SC04-097 <5 90 0.0 <5 135 0.0 <5 90 0.0 SC04-098 90 90 2.0 810 270 6.0 270 90 6.0 SC04-103 <5 90 0.0 10 135 0.1 10 90 0.2 SC04-104 45 90 1.0 45 270 0.3 90 90 2.0 SC04-108 10 90 0.2 <5 135 0.0 15 90 0.3 SC04-120 15 90 0.3 45 270 0.3 30 90 0.7 SC04-125 90 90 2.0 270 270 2.0 270 90 6.0 SC04-126 <5 45 0.0 <5 45 0.0 <5 30 0.0 SC04-140 30 90 0.7 90 90 2.0 270 90 6.0 SC04-144 90 90 2.0 270 90 6.0 405 90 9.0 SC04-146 30 90 0.7 90 90 2.0 90 90 2.0 SC04-164 15 90 0.3 15 90 0.3 30 90 0.7 1* is 50% endpoint dilution 2* is 50% endpoint dilution WHO standard (2 IU/ml) 3* is Potency (IU/ml)

TABLE-US-00013 TABLE 12 Oligonucleotides used for PCR amplification of V.sub.H genes. Name and nucleotide sequence V.sub.H gene SEQ ID NO: 5H-B: acctgtcttgaattctccatggccgaggtgcagctggtggagtctg SC04-001 280 5H-C: acctgtcttgaattctccatggcccaggtgcagctggtggagtctgg SC04-021 281 SC04-031 SC04-125 SC04-164 5H-C-long: acctgtcttgaattctccatggcccaggtgcagctggtggagtctgggg SC04-010 282 SC04-038 SC04-040 SC04-073 SC04-098 SC04-103 SC04-104 SC04-108 SC04-120 SC04-140 SC04-144 SC04-146 5H-F: acctgtcttgaattctccatggcccaggtgcagctgcaggagtccggccc SC04-018 283 SC04-060 5H-H: acctgtcttgaattctccatggccgaggtgcagctggtgcagtctgg SC04-026 284 5H-I: acctgtcttgaattctccatggccgaggtgcagctgctggagtctgg SC04-004 285 SC04-097 5H-M: acctgtcttgaattctccatggcccaggtgaccttgaaggagtctgg SC04-008 286 SC04-126 sy3H-A: gcccttggtgctagcgctggagacggtcaccagggtgccctggcccc SC04-001 287 SC04-004 SC04-008 SC04-010 SC04-026 SC04-040 SC04-073 SC04-098 SC04-120 SC04-125 SC04-126 SC04-144 SC04-146 sy3H-C: gcccttggtgctagcgctggagacggtcacggtggtgccctggcccc SC04-097 288 sy3H-C-long: gcccttggtgctagcgctggagacggtcacggtggtgcccttgccccagacgtc SC04-060 289 sy3H-D: gcccttggtgctagcgctggacacggtcaccatggtgccctggcccc SC04-018 290 SC04-021 SC04-031 SC04-038 SC04-104 SC04-108 SC04-140 SC04-164 sy3H-E: gcccttggtgctagcgctggacacggtcaccagggtgccccggcccc SC04-103 291

TABLE-US-00014 TABLE 13 Oligonucleotides used for PCR amplification of V.sub.L genes. Name and nucleotide sequence V.sub.L gene SEQ ID NO: 3L-B: ttttccttagcggccgcgactcacctaggacggtcagcttggtc SC04-001 292 5K-B: acctgtctcgagttttccatggctgacatccagatgacccagtc SC04-031 293 SC04-060 SC04-073 SC04-098 SC04-103 SC04-104 SC04-108 SC04-164 5K-C: acctgtctcgagttttccatggctgacatccagatgacccagtctccatcctccc SC04-004 294 5K-G: acctgtctcgagttttccatggctgacatcgtgatgacccagtctcc SC04-026 295 5K-K: acctgtctcgagttttccatggctgccatccagatgacccagtctcc SC04-010 296 5K-M: acctgtctcgagttttccatggctgacatccagctgacccagtc SC04-021 297 SC04-097 SC04-120 SC04-125 SC04-144 5K-N: acctgtctcgagttttccatggctgacatccagatgactcagtc SC04-038 298 5K-O: acctgtctcgagttttccatggctgccatccagctgacccagtc SC04-140 299 5K-Q: acctgtctcgagttttccatggctgagatcgtgatgactcagtc SC04-146 300 5L-E: acctgtctcgagttttccatggcttcctacgtgctgactcagccg SC04-008 301 5L-F: acctgtctcgagttttccatggctcagtccgtgctgactcagcc SC04-018 302 5L-G: acctgtctcgagttttccatggcttcctacgtgctgactcagcc SC04-040 303 SC04-126 sy3K-F: gctgggggcggccacggtccgcttgatctccaccttggtccc SC04-004 304 SC04-010 SC04-021 SC04-031 SC04-098 SC04-104 SC04-125 SC04-140 SC04-144 SC04-164 sy3K-I: gctgggggcggccacggtccgcttgatctccagccgtgtccc SC04-038 305 SC04-097 SC04-103 SC04-108 SC04-146 sy3K-J: gctgggggcggccacggtccgcttgatctccagcttggtccc SC04-026 306 SC04-060 SC04-073 sy3K-K: gctgggggcggccacggtccgcttgatgtccaccttggtccc SC04-120 307 sy3L-A: ccagcacggtaagcttcagcacggtcaccttggtgccagttcc SC04-018 308 SC04-126 sy3L-C: ccagcacggtaagcttcagcacggtcagcttggtgcctccgcc SC04-040 309 sy3L-D: ccagcacggtaagcttcaacacggtcagctgggtccc SC04-008 310 sy5L-A: acctgtctcgagttttccatggcttcctccgagctgacccaggaccctgctg SC04-001 311

TABLE-US-00015 TABLE 14 Binding of the human monoclonal antibodies CR57, CRJB and CR04-010 (10 .mu.g/ml) to linear peptides of the extracellular domain of glycoprotein G of rabies virus strain ERA. Amino acid sequence of linear peptide CR57 CRJB CR04-010 SEQ ID NO: KFPIYTILDKLGPWS 71 97 1 338 FPIYTILDKLGPWSP 42 105 39 339 PIYTILDKLGPWSPI 36 89 87 340 IYTILDKLGPWSPID 44 97 104 341 YTILDKLGPWSPIDI 48 114 91 342 TILDKLGPWSPIDIH 76 96 88 343 ILDKLGPWSPIDIHH 54 104 69 344 LDKLGPWSPIDIHHL 55 99 107 345 DKLGPWSPIDIHHLS 62 103 93 346 KLGPWSPIDIHHLSC 72 105 45 347 LGPWSPIDIHHLSCP 69 112 19 348 GPWSPIDIHHLSCPN 68 114 33 349 PWSPIDIHHLSCPNN 62 104 47 350 WSPIDIHHLSCPNNL 80 106 11 351 SPIDIHHLSCPNNLV 74 85 1 352 PIDIHHLSCPNNLVV 46 93 90 353 IDLHHLSCPNNLVVE 69 102 55 354 DIHHLSCPNNLVVED 38 96 78 355 IHHLSCPNNLVVEDE 37 85 113 356 HHLSCPNNLVVEDEG 56 76 117 357 HLSCPNNLVVEDEGC 65 119 111 358 LSCPNNLVVEDEGCT 69 117 127 359 SCPNNLVVEDEGCTN 83 114 91 360 CPNNLVVEDEGCTNL 77 97 49 361 PNNLVVEDEGCTNLS 78 107 97 362 NNLVVEDEGCTNLSG 72 99 97 363 NLVVEDEGCTNLSGF 75 119 55 364 LVVEDEGCTNLSGFS 76 103 52 365 VVEDEGCTNLSGFSY 73 107 91 366 VEDEGCTNLSGFSYM 74 103 31 367 EDEGCTNLSGFSYME 54 90 7 368 DEGCTNLSGFSYMEL 1 23 1 369 EGCTNLSGFSYMELK 51 114 129 370 GCTNLSGFSYMELKV 55 114 118 371 CTNLSGFSYMELKVG 47 110 137 372 TNLSGFSYMELKVGY 43 106 161 373 NLSGFSYMELKVGYI 61 115 170 374 LSGFSYMELKVGYIL 71 132 169 375 SGFSYMELKVGYILA 79 132 161 376 GFSYMELKVGYILAI 65 111 141 377 FSYMELKVGYILAIK 89 112 192 378 SYMELKVGYILAIKM 65 123 152 379 YMELKVGYILAIKMN 78 114 150 380 MELKVGYILAIKMNG 76 141 107 381 ELKVGYILAIKMNGF 87 132 76 382 LKVGYILAIKMNGFT 78 112 118 383 KVGYILAIKMNGFTC 78 118 68 384 VGYILAIKMNGFTCT 77 93 1 385 GYILAIKMNGFTCTG 75 90 1 386 YILAIKMNGFTCTGV 47 107 107 387 ILAIKMNGFTCTGVV 79 103 104 388 LAIKMNGFTCTGVVT 68 130 159 389 AIKMNGFTCTGVVTE 47 103 152 390 IKMNGFTCTGVVTEA 68 108 138 391 KMNGFTCTGVVTEAE 76 104 133 392 MNGFTCTGVVTEAEN 69 99 148 393 NGFTCTGVVTEAENY 69 101 138 394 GFTCTGVVTEAENYT 71 86 129 395 FTCTGVVTEAENYTN 83 125 154 396 TCTGVVTEAENYTNF 92 112 129 397 CTGVVTEAENYTNFV 76 123 150 398 TGVVTEAENYTNFVG 85 110 154 399 GVVTEAENYTNFVGY 86 111 110 400 VVTEAENYTNFVGYV 87 106 114 401 VTEAENYTNFVGYVT 79 90 73 402 TEAENYTNFVGYVTT 68 84 8 403 EAENYTNFVGYVTTT 69 117 142 404 AENYINFVGYVTTTF 66 106 110 405 ENYTNFVGYVTTTFK 44 112 183 406 NYTNFVGYVTTTFKR 49 114 174 407 YTNFVGYVTTTFKRK 51 104 138 408 TNFVGYVTTTFKRKH 71 125 165 409 NFVGYVTTTFKRKHF 65 107 154 410 FVGYVTTTFKRKHFR 70 111 152 411 VGYVTTTFKRKHFRP 75 113 155 412 GYVTTTFKRKHFRPT 70 123 160 413 YVTTTFKRKHFRPTP 85 106 160 414 VTTTFKRKHFRPTPD 79 105 119 415 TTTFKRKHFRPTPDA 80 108 137 416 TTFKRKHFRPTPDAC 74 99 110 417 TFKRKHFRPTPDACR 96 111 108 418 FKRKHFRPTPDACRA 64 92 62 419 KRKHFRPTPDACRAA 65 93 1 420 RKHFRPTPDACRAAY 64 107 99 421 KHFRPTPDACRAAYN 73 112 124 422 HFRPTPDACRAAYNW 46 113 118 423 FRPTPDACRAAYNWK 43 112 148 424 RPTPDACRAAYNWKM 77 101 129 425 PTPDACRAAYNWKMA 99 125 143 426 TPDACRAAYNWKMAG 92 132 160 427 PDACRAAYNWKMAGD 61 124 147 428 DACRAAYNWKMAGDP 84 113 136 429 ACRAAYNWKMAGDPR 82 116 138 430 CRAAYNWKMAGDPRY 87 118 137 431 RAAYNWKMAGDPRYE 90 130 120 432 AAYNWKMAGDPRYEE 68 106 120 433 AYNWKMAGDPRYEES 96 94 77 434 YNWKMAGDPRYEESL 83 118 116 435 NWKMAGDPRYEESLH 58 101 69 436 WKMAGDPRYEESLHN 69 101 1 437 KMAGDPRYEESLHNP 62 102 84 438 MAGDPRYEESLHNPY 64 116 112 439 AGDPRYEESLHNPYP 40 101 125 440 GDPRYEESLHNPYPD 36 98 123 441 DPRYEESLHNPYPDY 57 110 118 442 PRYEESLHNPYPDYR 73 115 129 443 RYEESLHNPYPDYRW 69 112 125 444 YEESLHNPYPDYRWL 58 106 120 445 EESLHNPYPDYRWLR 76 123 141 446 ESLHNPYPDYRWLRT 92 132 125 447 SLHNPYPDYRWLRTV 78 111 137 448 LHNPYPDYRWLRTVK 79 106 142 449 HNPYPDYRWLRTVKT 86 108 146 450 NPYPDYRWLRTVKTT 85 102 151 451 PYPDYRWLRTVKTTK 65 93 103 452 YPDYRWLRTVKTTKE 72 97 97 453 PDYRWLRTVKTTKES 76 85 27 454 DYRWLRTVKTTKESL 54 111 105 455 YRWLRTVKTTKESLV 46 117 125 456 RWLRTVKTTKESLVI 40 110 120 457 WLRTVKTTKESLVII 41 104 125 458 LRTVKTTKESLVIIS 65 104 161 459

RTVKTTKESLVIISP 82 120 150 460 TVKTTKESLVIISPS 76 116 150 461 VKTTKESLVIISPSV 71 120 154 462 KTTKESLVIISPSVA 101 112 147 463 TTKESLVIISPSVAD 78 121 141 464 TKESLVIISPSVADL 86 112 132 465 KESLVIISPSVADLD 86 117 111 466 ESLVIISPSVADLDP 88 125 143 467 SLVIISPSVADLDPY 68 105 125 468 LVIISPSVADLDPYD 85 107 93 469 VIISPSVADLDPYDR 59 98 50 470 IISPSVADLDPYDRS 83 125 14 471 ISPSVADLDPYDRSL 50 119 91 472 SPSVADLDPYDRSLH 59 114 118 473 PSVADLDPYDRSLHS 44 114 118 474 SVADLDPYDRSLHSR 49 106 129 475 VADLDPYDRSLHSRV 71 113 141 476 ADLDPYDRSLHSRVF 70 121 141 477 DLDPYDRSLHSRVFP 111 152 127 478 LDPYDRSLHSRVFPS 99 142 106 479 DPYDRSLHSRVFPSG 90 120 134 480 86 120 130 481 YDRSLHSRVFPSGKC 364 818 127 482 DRSLHSRVFPSGKCS 98 142 141 483 87 141 156 484 SLHSRVFPSGKCSGV 69 111 141 485 LHSRVFPSGKCSGVA 78 114 129 486 HSRVFPSGKCSGVAV 97 118 111 487 SRVFPSGKCSGVAVS 100 125 24 488 RVFPSGKCSGVAVSS 69 110 106 489 VFPSGKCSGVAVSST 74 114 142 490 FPSGKCSGVAVSSTY 64 134 146 491 PSGKCSGVAVSSTYC 56 112 132 492 SGKCSGVAVSSTYCS 64 121 120 493 GKCSGVAVSSTYCST 92 143 145 494 KCSGVAVSSTYCSTN 88 130 130 495 CSGVAVSSTYCSTNH 110 165 143 496 SGVAVSSTYCSTNHD 79 110 115 497 GVAVSSTYCSTNHDY 79 114 108 498 VAVSSTYCSTNHDYT 85 114 118 499 AVSSTYCSTNHDYTI 71 105 102 500 VSSTYCSTNHDYTIW 78 107 121 501 SSTYCSTNHDYTIWM 76 107 121 502 STYCSTNHDYTIWMP 86 99 119 503 TYCSTNHDYTIWMPE 96 107 74 504 YCSTNHDYTIWMPEN 47 92 29 505 CSTNHDYTIWMPENP 52 106 86 506 STNHDYTIWMPENPR 60 112 107 507 TNHDYTIWMPENPRL 69 129 119 508 NHDYTIWMPENPRLG 71 119 130 509 HDYTIWMPENPRLGM 82 125 123 510 DYTIWMPENPRLGMS 93 127 123 511 YTIWMPENPRLGMSC 97 132 143 512 TIWMPENPRLGMSCD 69 106 134 513 IWMPENPRLGMSCDI 98 110 101 514 WMPENPRLGMSCDIF 88 113 120 515 MPENPRLGMSCDIFT 105 121 143 516 PENPRLGMSCDIFTN 83 111 104 517 ENPRLGMSCDIFTNS 71 118 111 518 NPRLGMSCDIFTNSR 90 113 138 519 PRLGMSCDIFTNSRG 72 112 105 520 RLGMSCDIFTNSRGK 88 106 113 521 LGMSCDIFTNSRGKR 76 110 114 522 GMSCDIFTNSRGKRA 54 120 101 523 MSCDIFTNSRGKRAS 46 110 106 524 SCDIFTNSRGKRASK 44 111 98 525 CDIFTNSRGKRASKG 42 104 117 526 DIFTNSRGKRASKGS 70 107 111 527 IFTNSRGKRASKGSE 77 125 87 528 FTNSRGKRASKGSET 83 111 119 529 TNSRGKRASKGSETC 68 108 110 530 NSRGKRASKGSETCG 92 100 119 531 SRGKRASKGSETCGF 64 93 90 532 RGKRASKGSETCGFV 75 104 115 533 GKRASKGSETCGFVD 92 124 118 534 KRASKGSETCGFVDE 92 106 129 535 RASKGSETCGFVDER 86 110 134 536 ASKGSETCGFVDERG 97 108 103 537 SKGSETCGFVDERGL 92 102 76 538 KGSETCGFVDERGLY 90 97 44 539 GSETCGFVDERGLYK 57 115 92 540 SETCGFVDERGLYKS 33 116 86 541 ETCGFVDERGLYKSL 64 120 138 542 TCGFVDERGLYKSLK 47 120 125 543 CGFVDERGLYKSLKG 72 115 120 544 GFVDERGLYKSLKGA 84 120 129 545 FVDERGLYKSLKGAC 86 121 124 546 VDERGLYKSLKGACK 50 108 110 547 DERGLYKSLKGACKL 90 119 54 548 ERGLYKSLKGACKLK 90 118 106 549 RGLYKSLKGACKLKL 90 121 121 550 GLYKSLKGACKLKLC 94 129 92 551 LYKSLKGACKLKLCG 93 136 141 552 YKSLKGACKLKLCGV 80 112 110 553 KSLKGACKLKLCGVL 129 113 110 554 SLKGACKLKLCGVLG 111 124 314 LKGACKLKLCGVLGL 90 23 315 KGACKLKLCGVLGLR 111 100 316 GACKLKLCGVLGLRL 134 129 317 ACKLKLCGVLGLRLM 117 142 318 CKLKLCGVLGLRLMD 111 147 319 KLKLCGVLGLRLMDG 120 114 320 LKLCGVLGLRLMDGT 145 148 321 KLCGVLGLRLMDGTW 132 86 322 LCGVLGLRLMDGTWV 83 138 129 555 CGVLGLRLMDGTWVA 99 117 104 556 GVLGLRLMDGTWVAM 89 148 117 557 VLGLRLMDGTWVAMQ 90 141 127 558 LGLRLMDGTWVAMQT 102 115 97 559 GLRLMDGTWVAMQTS 104 138 120 560 LRLMDGTWVAMQTSN 103 114 118 561 RLMDGTWVAMQTSNE 100 113 130 562 LMDGTWVAMQTSNET 96 106 106 563 MDGTWVAMQTSNETK 97 97 110 564 DGTWVAMQTSNETKW 69 114 92 565 GTWVAMQTSNETKWC 58 113 82 566 TWVAMQTSNETKWCP 78 118 107 567 WVAMQTSNETKWCPP 50 114 116 568 VAMQTSNETKWCPPD 86 104 151 569 AMQTSNETKWCPPDQ 104 114 128 570 MQTSNETKWCPPDQL 104 132 125 571 QTSNETKWCPPDQLV 92 120 155 572 TSNETKWCPPDQLVN 97 111 90 573 SNETKWCPPDQLVNL 99 129 110 574 NETKWCPPDQLVNLH 90 128 107 575

ETKWCPPDQLVNLHD 105 120 118 576 TKWCPPDQLVNLHDF 85 125 125 577 KWCPPDQLVNLHDFR 89 113 121 578 WCPPDQLVNLHDFRS 101 119 99 579 CPPDQLVNLHDFRSD 93 137 127 580 PPDQLVNLHDFRSDE 107 120 56 581 PDQLVNLHDFRSDEI 35 106 63 582 DQLVNLHDFRSDEIE 54 117 97 583 QLVNLHDFRSDEIEH 60 113 106 584 LVNLHDFRSDEIEHL 47 104 100 585 VNLHDFRSDEIEHLV 83 129 98 586 NLHDFRSDEIEHLVV 83 113 110 587 LHDFRSDEIEHLVVE 93 115 121 588 HDFRSDEIEHLVVEE 69 107 150 589 DFRSDEIEHLVVEEL 99 103 110 590 FRSDEIEHLVVEELV 86 114 116 591 RSDEIEHLVVEELVR 100 138 104 592 SDEIEHLVVEELVRK 101 117 118 593 DEIEHLVVEELVRKR 94 123 143 594 EIEHLVVEELVRKRE 82 113 121 595 IEHLVVEELVRKREE 90 129 118 596 EHLVVEELVRKREEC 82 114 106 597 HLVVEELVRKREECL 82 123 46 598 LVVEELVRKREECLD 64 100 79 599 VVEELVRKREECLDA 62 108 97 600 VEELVRKREECLDAL 58 111 101 601 EELVRKREECLDALE 69 112 123 602 ELVRKREECLDALES 82 113 117 603 LVRKREECLDALESI 86 130 124 604 VRKREECLDALESIM 58 181 151 605 RKREECLDALESIMT 73 110 137 606 KREECLDALESIMTT 102 113 97 607 REECLDALESIMTTK 94 110 106 608 EECLDALESIMTTKS 82 120 133 609 ECLDALESIMTTKSV 91 112 125 610 CLDALESIMTTKSVS 101 146 155 611 LDALESIMTTKSVSF 97 116 152 612 DALESIMTTKSVSFR 104 120 188 613 ALESIMTTKSVSFRR 97 132 137 614 LESIMTTKSVSFRRL 48 114 130 615 ESIMTTKSVSFRRLS 62 111 114 616 SIMTTKSVSFRRLSH 54 130 97 617 IMTTKSVSFRRLSHL 43 101 111 618 MTTKSVSFRRLSHLR 59 116 125 619 TTKSVSFRRLSHLRK 66 118 111 620 TKSVSFRRLSHLRKL 83 125 123 621 KSVSFRRLSHLRKLV 108 124 129 622 SVSFRRLSHLRKLVP 64 123 117 623 VSFRRLSHLRKLVPG 90 111 105 624 SFRRLSHLRKLVPGF 92 110 96 625 FRRLSHLRKLVPGFG 90 108 111 626 RRLSHLRKLVPGFGK 92 143 118 627 RLSHLRKLVPGFGKA 93 123 148 628 LSHLRKLVPGFGKAY 96 139 150 629 SHLRKLVPGFGKAYT 113 132 132 630 HLRKLVPGFGKAYTI 99 111 102 631 LRKLVPGFGKAYTIF 83 118 82 632 RKLVPGFGKAYTIFN 47 115 86 633 KLVPGFGKAYTIFNK 47 114 123 634 LVPGFGKAYTIFNKT 54 112 139 635 VPGFGKAYTIFNKTL 58 114 138 636 PGFGKAYTIFNKTLM 78 113 157 637 GFGKAYTIFNKTLME 78 123 323 FGKAYTIFNKTLMEA 90 151 324 GKAYTIFNKTLMEAD 76 127 325 KAYTIFNKTLMEADA 101 123 326 AYTIFNKTLMEADAH 86 121 327 YTIFNKTLMEADAHY 104 147 328 TIFNKTLMEADAHYK 107 123 329 IFNKTLMEADAHYKS 100 118 330 FNKTLMEADAHYKSV 111 141 331 NKTLMEADAHYKSVR 104 116 141 638 KTLMEADAHYKSVRT 91 98 123 639 TLMEADAHYKSVRTW 100 114 90 640 LMEADAHYKSVRTWN 73 107 97 641 MEADAHYKSVRTWNE 62 129 83 642 EADAHYKSVRTWNEI 58 97 106 643 ADAHYKSVRTWNEIL 56 100 100 644 DAHYKSVRTWNEILP 59 121 112 645 AHYKSVRTWNEILPS 112 160 125 646 HYKSVRTWNEILPSK 80 130 123 647 YKSVRTWNEILPSKG 66 137 116 648 KSVRTWNEILPSKGC 115 125 114 649 SVRTWNEILPSKGCL 106 138 118 650 VRTWNEILPSKGCLR 90 124 133 651 RTWNEILPSKGCLRV 120 127 120 652 TWNEILPSKGCLRVG 97 146 127 653 WNEILPSKGCLRVGG 102 136 117 654 NEILPSKGCLRVGGR 104 130 163 655 EILPSKGCLRVGGRC 104 112 128 656 ILPSKGCLRVGGRCH 79 113 107 657 LPSKGCLRVGGRCHP 77 119 100 658 PSKGCLRVGGRCHPH 69 138 91 659 SKGCLRVGGRCHPHV 72 121 103 660 KGCLRVGGRCHPHVN 68 130 115 661 GCLRVGGRCHPHVNG 85 125 123 662 CLRVGGRCHPHVNGV 102 132 134 663 LRVGGRCHPHVNGVF 104 143 133 664 RVGGRCHPHVNGVFF 86 143 99 665 VGGRCHPHVNGVFFN 120 136 120 666 GGRCHPHVNGVFFNG 86 119 119 667 GRCHPHVNGVFFNGI 117 113 117 668 RCHPHVNGVFFNGII 98 141 143 669 CHPHVNGVFFNGIIL 97 150 151 670 HPHVNGVFFNGIILG 104 138 164 671 PHVNGVFFNGIILGP 93 173 146 672 HVNGVFFNGIILGPD 97 123 114 673 VNGVFFNGIILGPDG 68 116 85 674 NGVFFNGIILGPDGN 66 117 97 675 GVFFNGIILGPDGNV 58 116 100 676 VFFNGIILGPDGNVL 55 132 108 677 FFNGIILGPDGNVLI 92 143 105 678 FNGIILGPDGNVLIP 61 139 130 679 NGIILGPDGNVLIPE 102 146 141 680 GIILGPDGNVLIPEM 107 132 123 681 IILGPDGNVLIPEMQ 85 118 93 682 ILGPDGNVLIPEMQS 125 134 119 683 LGPDGNVLIPEMQSS 100 134 150 684 GPDGNVLIPEMQSSL 86 154 157 685 PDGNVLIPEMQSSLL 87 129 139 686 DGNVLIPEMQSSLLQ 123 134 169 687 GNVLIPEMQSSLLQQ 96 120 168 688 NVLIPEMQSSLLQQH 72 120 150 689 VLIPEMQSSLLQQHM 92 104 142 690 LIPEMQSSLLQQHME 89 111 85 691 IPEMQSSLLQQHMEL 89 128 129 692

PEMQSSLLQQHMELL 62 133 93 693 EMQSSLLQQHMELLE 58 129 142 694 MQSSLLQQHMELLES 65 113 117 695 QSSLLQQHMELLESS 82 114 132 696 SSLLQQHMELLESSV 90 128 132 697 SLLQQHMELLESSVI 124 163 133 698 LLQQHMELLESSVIP 78 111 121 699 LQQHMELLESSVIPL 106 134 128 700 QQHMELLESSVIPLV 103 134 133 701 QHMELLESSVIPLVH 98 146 139 702 HMELLESSVIPLVHP 110 129 134 703 MELLESSVIPLVHPL 90 125 152 704 ELLESSVIPLVHPLA 90 133 155 705 LLESSVIPLVHPLAD 72 117 118 706 LESSVIPLVHPLADP 90 128 128 707 ESSVIPLVHPLADPS 104 138 143 708 SSVIPLVHPLADPST 73 104 93 709 SVIPLVHPLADPSTV 72 137 107 710 VIPLVHPLADPSTVF 69 141 123 711 IPLVHPLADPSTVFK 96 156 188 712 PLVHPLADPSTVFKD 93 112 138 713 LVHPLADPSTVFKDG 164 174 188 714 VHPLADPSTVFKDGD 98 138 125 715 HPLADPSTVFKDGDE 74 141 117 716 PLADPSTVFKDGDEA 99 125 90 717 LADPSTVFKDGDEAE 68 116 113 718 ADPSTVFKDGDEAED 147 152 110 719 DPSTVFKDGDEAEDF 98 147 137 720 PSTVFKDGDEAEDFV 104 143 141 721 STVFKDGDEAEDFVE 104 120 125 722 TVFKDGDEAEDFVEV 107 124 96 723 VFKDGDEAEDFVEVH 100 106 93 724 FKDGDEAEDFVEVHL 65 76 119 725 KDGDEAEDFVEVHLP 72 93 76 726 DGDEAEDFVEVHLPD 85 123 91 727 GDEAEDFVEVHLPDV 46 124 113 728 DEAEDFVEVHLPDVH 68 136 123 729 EAEDFVEVHLPDVHN 76 117 114 730 AEDFVEVHLPDVHNQ 123 138 123 731 EDFVEVHLPDVHNQV 90 141 123 732 DFVEVHLPDVHNQVS 96 141 118 733 FVEVHLPDVHNQVSG 92 143 102 734 VEVHLPDVHNQVSGV 106 141 123 735 EVHLPDVHNQVSGVD 91 150 139 736 VHLPDVHNQVSGVDL 110 114 137 737 HLPDVHNQVSGVDLG 104 150 129 738 LPDVHNQVSGVDLGL 104 154 154 739 PDVHNQVSGVDLGLP 106 129 115 740 DVHNQVSGVDLGLPN 117 133 113 741 VHNQVSGVDLGLPNW 100 119 38 742 HNQVSGVDLGLPNWG 76 106 38 743 NQVSGVDLGLPNWGK 78 138 98 744 Average 91.9 119.5 130.9 StDV 157.9 37.6 169.8

TABLE-US-00016 TABLE 15 Neutralizing potencies of anti-rabies virus G protein IgGs. Name IgG IU/mg CR04-001 89 CR04-004 5 CR04-008 1176 CR04-010 3000 CR04-018 1604 CR04-021 1500 CR04-026 <2 CR04-031 272 CR04-038 2330 CR04-040 3041 CR04-060 89 CR04-073 6116 CR04-097 <1 CR04-098 7317 CR04-103 3303 CR04-104 4871 CR04-108 4871 CR04-120 4938 CR04-125 4718 CR04-126 2655 CR04-140 478 CR04-144 6250 CR04-146 ND CR04-164 4724 CR57 3800 CRJB 605 ND = not determined

TABLE-US-00017 TABLE 16 Neutralizing potencies of anti-rabies virus G protein IgGs against E57 escape viruses. E57A2 E57A3 E57B1 E57B2 E57B3 E57C3 Name IgG (IU/mg) (IU/mg) (IU/mg) (IU/mg) (IU/mg) (IU/mg) CR04-008 0* 0 0 0 0 0 CR04-010 8127 1355 5418 1355 2709 4064 CR04-018 1604 0 1604 0 59 535 CR04-021 450 2 150 8 50 50 CR04-038 9437 1573 9437 1049 6291 1573 CR04-040 8209 2736 24628 1368 5473 912 CR04-073 8256 1835 11008 1835 3669 1835 CR04-098 9878 3293 9878 3293 3293 3293 CR04-103 8917 2972 17835 2972 5945 2972 CR04-104 3288 2192 6576 2192 4384 1096 CR04-108 3288 731 4384 731 2192 731 CR04-120 1111 14 741 82 247 41 CR04-125 708 39 236 79 157 79 CR04-126 88 0 18 0 18 0 CR04-144 5625 2813 11250 2813 5625 1875 CR04-164 4252 472 4252 472 945 709 *0 indicates no 50% endpoint at a dilution of 1:100 of the antibody

TABLE-US-00018 TABLE 17 Neutralizing potency of CR-57 against E98 escape viruses. E98-2 E98-4 E98-5 E98-6 E98-7 (IU/mg) (IU/mg) (IU/mg) (IU/mg) (IU/mg) CR-57 2813 8438 4219 2813 8438 CR04-098 0* 0 0 0 0 *Zero indicates no 50% endpoint at a dilution of 1:1000 of the antibody.

TABLE-US-00019 TABLE 18 Occurrence of amino acid residues in the minimal binding region of CR57 within genotype 1 rabies viruses. Wild-type K L C G V L K (99.6%)* L (100%) C (100%) G (98.7%) V (99.6%) L (70.7%) R (0.4%) E (0.9%) I (0.4%) P (26.7%) R (0.4%) S (2.6%) *Percentage of occurrence of each amino acid is shown within 229 rabies virus isolates.

REFERENCES

[0174] Ameyama S., H. Toriumi, T. Takahashi, Y. Shimura, T. Nakahara, Y. Honda, K. Mifune, T. Uchiyama and A. Kawai (2003). Monoclonal antibody #3-9-16 recognizes one of the two isoforms of rabies virus matrix protein that exposes its N-terminus on the virion surface. Microbiol. Immunol. 47:639-651. [0175] Badrane H. and N. Tordo (2001). Host switching in Lyssavirus history from the Chiroptera to the Carnivora orders. J. Virol. 75:8096-8104. [0176] Benmansour A., H. Leblois, P. Coulon, C. Tuffereau, Y. Gaudin, A. Flamand and F. Lafay (1991). Antigenicity of rabies virus glycoprotein. J. Virol. 65:4198-4203. [0177] Boel E., S. Verlaan, M. J. Poppelier, N. A. Westerdaal, J. A. Van Strijp and T. Logtenberg (2000). Functional human monoclonal antibodies of all isotypes constructed from phage display library-derived single-chain Fv antibody fragments. J. Immunol. Methods 239:153-166. [0178] Bunschoten H., M. Gore, I. J. Claassen, F. G. Uytdehaag, B. Dietzschold, W. H. Wunner and A. D. Osterhaus (1989). Characterization of a new virus-neutralizing epitope that denotes a sequential determinant on the rabies virus glycoprotein. J. Gen. Virol. 70 (Pt 2):291-8. [0179] Burton D. R. and C. F. Barbas (1994). Human antibodies from combinatorial libraries. Adv. Immunol. 57:191-280. [0180] Champion J. M., R. B. Kean, C. E. Rupprecht, A. L. Notkins, H. Koprowski, B. Dietzschold and D. C. Hooper (2000). The development of monoclonal human rabies virus-neutralizing antibodies as a substitute for pooled human immune globulin in the prophylactic treatment of rabies virus exposure. J. Immunol. Methods 235:81-90. [0181] Chou T. C. and P. Talalay (1984). Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv. Enzyme Regul. 22:27-55. [0182] Coulon P., J. P. Ternaux, A. Flamand and C. Tuffereau (1998). An avirulent mutant of rabies virus is unable to infect motoneurons in vivo and in vitro. J. Virol. 72:273-278. [0183] de Kruif J., L. Terstappen, E. Boel and T. Logtenberg (1995a). Rapid selection of cell subpopulation-specific human monoclonal antibodies from a synthetic phage antibody library. Proc. Natl. Acad. Sci. USA 92:3938. [0184] de Kruif J., E. Boel and T. Logtenberg (1995b). Selection and application of human single-chain Fv antibody fragments from a semi-synthetic phage antibody display library with designed CDR3 regions. J. Mol. Biol. 248:97-105. [0185] Dietzschold B., W. H. Wunner, T. J. Wiktor, A. D. Lopes, M. Lafon, C. L. Smith and H. Koprowski (1983). Characterization of an antigenic determinant of the glycoprotein that correlates with pathogenicity of rabies virus. Proc. Natl. Acad. Sci. USA 80:70-74. [0186] Dietzschold B., M. Gore, P. Casali, Y. Ueki, C. E. Rupprecht, A. L. Notkins and H. Koprowski (1990). Biological characterization of human monoclonal antibodies to rabies virus. J. Virol. 64:3087-3090. [0187] Hanlon C. A., C. A. DeMattos, C. C. DeMattos, M. Niezgoda, D. C. Hooper, H. Koprowski, A. Notkins and C. E. Rupprecht (2001). Experimental utility of rabies virus-neutralizing human monoclonal antibodies in post-exposure prophylaxis. Vaccine 19:3834-3842. [0188] Huls G., I. J. Heijnen, E. Cuomo, J. van der Linden, E. Boel, J. van de Winkel and T. Logtenberg (1999). Antitumor immune effector mechanisms recruited by phage display-derived fully human IgG1 and IgA1 monoclonal antibodies. Cancer Res. 59:5778-5784. [0189] Jones D., N. Kroos, R. Anema, B. van Montfort, A. Vooys, S. van der Kraats, E. van der Helm, S. Smits, J. Schouten, K. Brouwer, F. Lagerwerf, P. van Berkel, D. J. Opstelten, T. Logtenberg and A. Bout (2003). High-level expression of recombinant IgG in the human cell line PER.C6. Biotechnol. Prog. 19:163-168. [0190] Lafon M., T. J. Wiktor and R. I. Macfarlan (1983). Antigenic sites on the CVS rabies virus glycoprotein: analysis with monoclonal antibodies. J. Gen. Virol. 64 (Pt 4):843-851. [0191] Luo T. R., N. Minamoto, H. Ito, H. Goto, S. Hiraga, N. Ito, M. Sugiyama and T. Kinjo (1997). A virus-neutralizing epitope on the glycoprotein of rabies virus that contains Trp251 is a linear epitope. Virus Res. 51:35-41. [0192] Madhusudana S. N., R. Shamsundar and S. Seetharaman (2004). In vitro inactivation of the rabies virus by ascorbic acid. Int. J. Infect. Dis. 8:21-25. [0193] Ni Y., Y. Tominaga, Y. Honda, K. Morimoto, S. Sakamoto and A. Kawai (1995). Mapping and characterization of a sequential epitope on the rabies virus glycoprotein which is recognized by a neutralizing monoclonal antibody, RG719. Microbiol. Immunol. 39:693-702. [0194] Prehaud C., P. Coulon, F. LaFay, C. Thiers and A. Flamand (1988). Antigenic site II of the rabies virus glycoprotein:structure and role in viral virulence. J. Virol. 62:1-7. [0195] Schumacher C. L., B. Dietzschold, H. C. Ertl, H. S, Niu, C. E. Rupprecht and H. Koprowski (1989). Use of mouse anti-rabies monoclonal antibodies in post-exposure treatment of rabies. J. Clin. Invest. 84:971-975. [0196] Seif I., P. Coulon, E. Rollin and A. Flamand (1985). Rabies virulence: effect on pathogenicity and sequence characterization of rabies virus mutations affecting antigenic site III of the glycoprotein. J. Virol. 53:926-934. [0197] Slootstra J. W., W. C. Puijk, G. J. Ligtvoet, J. P. Langeveld and R. H. Meloen (1996). Structural aspects of antibody-antigen interaction revealed through small random peptide libraries. Mol. Divers. 1:87-96. [0198] Tordo N. (1996). Characteristics and molecular biology of rabies virus. In F.-X. Meslin, M. M. Kaplan, H. Koprowski, editors, Laboratory Techniques in rabies, 4.sup.th edition Geneva, Switzerland: World Health Organization. [0199] White L. A. and W. A. Chappell (1982). Inactivation of rabies virus in reagents used for the fluorescent rabies antibody test. J. Clin. Microbiol. 16:253-256.

Sequence CWU 1

1

74819PRTArtificial sequenceCDR3 of SC04-001 1Gly Leu Tyr Gly Glu Leu Phe Asp Tyr1 5211PRTArtificial sequenceCDR3 of SC04-004 2Asp Tyr Leu Tyr Pro Thr Thr Asp Phe Asp Tyr1 5 10310PRTArtificial sequenceCDR3 of SC04-008 3Met Gly Phe Thr Gly Thr Tyr Phe Asp Tyr1 5 10414PRTArtificial sequenceCDR3 of SC04-010 4Asp Gly Leu Asp Leu Thr Gly Thr Ile Gln Pro Phe Gly Tyr1 5 10510PRTArtificial sequenceCDR3 of SC04-018 5Val Ser Val Thr Thr Gly Ala Phe Asn Ile1 5 10610PRTArtificial sequenceCDR3 of SC04-021 6Gly Ser Val Leu Gly Asp Ala Phe Asp Ile1 5 10712PRTArtificial sequenceCDR3 of SC04-026 7Thr Ser Asn Trp Asn Tyr Leu Asp Arg Phe Asp Pro1 5 10810PRTArtificial sequenceCDR3 of SC04-031 8Gly Ser Val Leu Gly Asp Ala Phe Asp Ile1 5 10910PRTArtificial sequenceCDR3 of SC04-038 9Gly Ser Val Leu Gly Asp Ala Phe Asp Ile1 5 10109PRTArtificial sequenceCDR3 of SC04-040 10Gly Ser Lys Val Gly Asp Phe Asp Tyr1 51120PRTArtificial sequenceCDR3 of SC04-060 11Glu Lys Glu Lys Tyr Ser Asp Arg Ser Gly Tyr Ser Tyr Tyr Tyr Tyr1 5 10 15Tyr Met Asp Val 201214PRTArtificial sequenceCDR3 of SC04-073 12Asp Gly Leu Asp Leu Thr Gly Thr Ile Gln Pro Phe Gly Tyr1 5 101312PRTArtificial sequenceCDR3 of SC04-097 13Thr Ala Ser Asn Leu Gly Arg Gly Gly Met Asp Val1 5 101410PRTArtificial sequenceCDR3 of SC04-098 14Val Ala Val Ala Gly Thr His Phe Asp Tyr1 5 101510PRTArtificial sequenceCDR3 of SC04-103 15Val Ala Val Ala Gly Glu Ser Phe Asp Ser1 5 101612PRTArtificial sequenceCDR3 of SC04-104 16Ile Val Val Val Thr Ala Leu Asp Ala Phe Asp Ile1 5 101711PRTArtificial sequenceCDR3 of SC04-108 17Phe Met Ile Val Ala Asp Asp Ala Phe Asp Ile1 5 10189PRTArtificial sequenceCDR3 of SC04-120 18Gly Gly Lys Thr Gly Glu Phe Asp Tyr1 51910PRTArtificial sequenceCDR3 of SC04-125 19Ile Ala Thr Ala Gly Thr Gly Phe Asp Tyr1 5 102010PRTArtificial sequenceCDR3 of SC04-126 20Met Gly Phe Thr Gly Thr Tyr Phe Asp Tyr1 5 102110PRTArtificial sequenceCDR3 of SC04-140 21Val Thr Asn Pro Gly Asp Ala Phe Asp Ile1 5 10229PRTArtificial sequenceCDR3 of SC04-144 22Gly Gly Lys Thr Gly Glu Phe Asp Tyr1 5239PRTArtificial sequenceCDR3 of SC04-146 23Gly Gly Lys Thr Gly Glu Phe Asp Tyr1 52410PRTArtificial sequenceCDR3 of SC04-164 24Gly Ser Val Leu Gly Asp Ala Phe Asp Ile1 5 102518PRTArtificial sequenceCDR3 of SO57 25Glu Asn Leu Asp Asn Ser Gly Thr Tyr Tyr Tyr Phe Ser Gly Trp Phe1 5 10 15Asp Pro26117PRTArtificial sequenceHeavy chain variable region of SC04-001 26Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Arg Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Gly Leu Tyr Gly Glu Leu Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser 11527118PRTArtificial sequenceHeavy chain variable region of SC04-004 27Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Asp Tyr Leu Tyr Pro Thr Thr Asp Phe Asp Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val 11528120PRTArtificial sequenceHeavy chain variable region of SC04-008 28Gln Val Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu 35 40 45Trp Leu Ala Arg Ile Asp Trp Asp Asp Asp Lys Tyr Tyr Ser Thr Ser 50 55 60Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val65 70 75 80Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr 85 90 95Cys Ala Arg Met Gly Phe Thr Gly Thr Tyr Phe Asp Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 12029123PRTArtificial sequenceHeavy chain variable region of SC04-010 29Gln Val Gln Leu Val Gln Ser Gly Gly Asp Leu Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Asp Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Asp Gly Leu Asp Leu Thr Gly Thr Ile Gln Pro Phe Gly Tyr 100 105 110Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 12030119PRTArtificial sequenceHeavy chain variable region of SC04-018 30Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Arg Pro Ser Gly1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp 35 40 45Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser65 70 75 80Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Val Ser Val Thr Thr Gly Ala Phe Asn Ile Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser 11531119PRTArtificial sequenceHeavy chain variable region of SC04-021 31Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Ser Tyr Asp Gly Ser Ser Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Gly Ser Val Leu Gly Asp Ala Phe Asp Ile Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser 11532121PRTArtificial sequenceHeavy chain variable region of SC04-026 32Glu Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Glu1 5 10 15Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Asn Phe Pro Tyr Ser 20 25 30Trp Ile Ala Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met 35 40 45Gly Ile Ile Phe Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Pro Phe 50 55 60Gln Gly Gln Val Thr Ile Ser Ala Asp Asn Ser Lys Ser Thr Ala Tyr65 70 75 80Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys 85 90 95Ala Arg Thr Ser Asn Trp Asn Tyr Leu Asp Arg Phe Asp Pro Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val Ser Ser 115 12033119PRTArtificial sequenceHeavy chain variable region of SC04-031 33Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Gly Ser Val Leu Gly Asp Ala Phe Asp Ile Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser 11534119PRTArtificial sequenceHeavy chain variable region of SC04-038 34Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Ser Tyr Asp Gly Ser Ser Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Gly Ser Val Leu Gly Asp Ala Phe Asp Ile Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser 11535118PRTArtificial sequenceHeavy chain variable region of SC04-040 35Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Thr Ile Phe Tyr Asp Gly Ser Tyr Lys Asp Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Gly Ser Lys Val Gly Asp Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser Ser 11536128PRTArtificial sequenceHeavy chain variable region of SC04-060 36Gln Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys Ala Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Asp Gly Ser Ile Ser Ser Phe 20 25 30Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Glu Ile Gln Asp Thr Gly Arg Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Ile Ser Leu Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Thr Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg Glu Lys Glu Lys Tyr Ser Asp Arg Ser Gly Tyr Ser Tyr Tyr Tyr 100 105 110Tyr Tyr Met Asp Val Trp Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 12537123PRTArtificial sequenceHeavy chain variable region of SC04-073 37Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Ala Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Asp Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Asp Gly Leu Asp Leu Thr Gly Thr Ile Gln Pro Phe Gly Tyr 100 105 110Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 12038121PRTArtificial sequenceHeavy chain variable region of SC04-097 38Glu Val Gln Leu Val Gln Ser Gly Gly His Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Leu Ile Ile Gly Ser Gly Arg Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Thr Ala Ser Asn Leu Gly Arg Gly Gly Met Asp Val Trp Gly 100 105 110Gln Gly Thr Thr Val Thr Val Ser Ser 115 12039119PRTArtificial sequenceHeavy chain variable region of SC04-098 39Glu Val Gln Leu Val Gln Ser Gly Gly Gly Ala Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Leu Tyr Asp Gly Ser Asp Lys Phe Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Val Ala Val Ala Gly Thr His Phe Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser 11540119PRTArtificial sequenceHeavy chain variable region of SC04-103 40Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Leu Tyr Asp Gly Ser Asp Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Val Ala Val Ala Gly Glu Ser Phe Asp Ser Trp Gly Arg Gly 100 105 110Thr Leu Val Thr Val Ser Ser 11541121PRTArtificial sequenceHeavy chain variable region of SC04-104 41Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Thr Ile Ser Tyr Asp Gly Asn Val Lys Asp Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Ile Val Val Val Thr Ala Leu Asp Ala Phe Asp Ile Trp Gly 100

105 110Gln Gly Thr Met Val Thr Val Ser Ser 115 12042120PRTArtificial sequenceHeavy chain varaible region of SC04-108 42Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Leu Tyr Asp Gly Ser Asp Lys Phe Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asp Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Phe Met Ile Val Ala Asp Asp Ala Phe Asp Ile Trp Gly Gln 100 105 110Gly Thr Met Val Thr Val Ser Ser 115 12043118PRTArtificial sequenceHeavy chain variable region of SC04-120 43Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Thr Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Thr Ile Ser Tyr Asp Gly Ser Ile Lys Asp Tyr Ala Asp Ser Glu 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Gly Gly Lys Thr Gly Glu Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser Ser 11544119PRTArtificial sequenceHeavy chain variable region of SC04-125 44Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Ser Tyr Asp Gly Ser Asp Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Ile Ala Thr Ala Gly Thr Gly Phe Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser 11545120PRTArtificial sequenceHeavy chain variable region of SC04-126 45Gln Val Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Asn Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Gly 20 25 30Gly Val Gly Val Gly Trp Phe Arg Gln Pro Pro Gly Lys Ala Leu Glu 35 40 45Trp Leu Ala Arg Ile Asp Trp Asp Asp Asp Lys Tyr Tyr Ser Thr Ser 50 55 60Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Ile Gln Val65 70 75 80Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr 85 90 95Cys Ala Arg Met Gly Phe Thr Gly Thr Tyr Phe Asp Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 12046119PRTArtificial sequenceHeavy chain variable region of SC04-140 46Gln Met Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Leu Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Ala Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Val Thr Asn Pro Gly Asp Ala Phe Asp Ile Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser 11547118PRTArtificial sequenceHeavy chain variable region of SC04-144 47Gln Val Gln Leu Gln Glu Leu Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Thr Ile Ser Tyr Asp Gly Ser Ile Lys Asp Tyr Ala Asp Ser Glu 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Gly Gly Lys Thr Gly Glu Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser Ser 11548118PRTArtificial sequenceHeavy chain variable region of SC04-146 48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Thr Ile Ser Tyr Asp Gly Ser Ile Lys Asp Tyr Ala Asp Ser Glu 50 55 60Glu Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Gly Gly Lys Thr Gly Glu Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser Ser 11549119PRTArtificial sequenceHeavy chain variable region of SC04-164 49Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Ser Tyr Asp Gly Ser Ser Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Gly Ser Val Leu Gly Asp Ala Phe Asp Ile Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser 11550108PRTArtificial sequenceLight chain variable region of SC04-001 50Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln1 5 10 15Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Ala 20 25 30Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr 35 40 45Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser 50 55 60Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu65 70 75 80Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn His 85 90 95Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 10551103PRTArtificial sequenceLight chain variable region of SC04-004 51Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr1 5 10 15Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr 20 25 30Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser 35 40 45Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly 50 55 60Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala65 70 75 80Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Pro Pro Thr Phe Gly Gln 85 90 95Gly Thr Lys Val Glu Ile Lys 10052109PRTArtificial sequenceLight chain variable region of SC04-008 52Gln Ala Val Leu Thr Gln Pro Ser Ser Val Ser Val Ala Pro Gly Glu1 5 10 15Thr Ala Ser Val Thr Cys Gly Gly Asp Asn Ile Gly Ser Lys Ser Val 20 25 30His Trp Tyr Gln Lys Lys Pro Gly Gln Ala Pro Val Leu Val Val Phe 35 40 45Asp Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60Thr Ser Gly Asn Thr Ala Ala Leu Thr Ile Ser Arg Val Glu Ala Gly65 70 75 80Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp Asp Ser Ser Asn Asp His 85 90 95Leu Tyr Val Phe Gly Pro Gly Thr Gln Leu Thr Val Leu 100 10553107PRTArtificial sequenceLight chain variable region of SC04-010 53Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp 20 25 30Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln Asp Tyr Asn Tyr Pro Arg 85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 10554110PRTArtificial sequenceLight chain variable region of SC04-018 54Gln Pro Val Leu Thr Gln Pro Leu Ser Ala Ser Gly Thr Pro Gly Gln1 5 10 15Arg Val Thr Ile Ser Cys Ser Gly Asp Thr Ser Asn Ile Gly Ser Asn 20 25 30Thr Val His Trp Tyr Gln Arg Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45Ile His Asn Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60Gly Ala Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln65 70 75 80Ser Glu Asp Glu Ala Asp Tyr Phe Cys Ala Ala Trp Asp Asp Asn Leu 85 90 95Asn Gly Tyr Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 100 105 11055107PRTArtificial sequenceLight chain variable region of SC04-021 55Asp Ile Gln Met Thr Gln Ser Pro Phe Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Gly Ser Ser 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Phe Cys Leu Gln His His Asp Tyr Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 10556112PRTArtificial sequenceLight chain variable region of SC04-026 56Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly His Asp Tyr Leu Asp Trp Tyr Val Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Pro Leu Ile Tyr Leu Gly Ser Asp Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr His Phe Thr Leu Asn Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ser 85 90 95Leu Gln Thr Pro Trp Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 11057107PRTArtificial sequenceLight chain variable region of SC04-031 57Asp Ile Gln Met Thr Gln Ser Pro Ser Phe Val Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asn Ser Phe Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10558107PRTArtificial sequenceLight chain variable region of SC04-038 58Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Gly Trp 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Glu Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Arg Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asn Ser Phe Pro Pro 85 90 95Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 10559108PRTArtificial sequenceLight chain variable region of SC04-040 59Gln Pro Val Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly Gln1 5 10 15Thr Ala Arg Ile Ser Cys Gly Gly Asp Asn Ile Gly Thr Asn Thr Val 20 25 30Gln Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Val Tyr 35 40 45Asp Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60Asn Ser Gly Asp Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly65 70 75 80Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp Asp Asp Ser Ser Asp Leu 85 90 95Val Val Phe Gly Gly Gly Thr Lys Val Thr Val Leu 100 10560107PRTArtificial sequenceLight chain variable region of SC04-060 60Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Thr Tyr 20 25 30Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Asn Leu Leu Ile 35 40 45Tyr Gly Ala Ser Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Glu Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Phe Thr Thr Pro Arg 85 90 95Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 10561107PRTArtificial sequenceLight chain variable region of SC04-073 61Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser His Ser Ile Ser Ser Trp 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Lys Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln Asp Tyr Asn Tyr Pro Arg 85 90 95Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 10562107PRTArtificial sequenceLight chain variable region of SC04-097 62Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser His 20 25 30Leu

Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Phe Asn Ser Tyr Pro Ile 85 90 95Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 10563107PRTArtificial sequenceLight chain variable region of SC04-098 63Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp 20 25 30Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Pro 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10564107PRTArtificial sequenceLight chain variable region of SC04-103 64Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Arg Ser Leu Ile 35 40 45Tyr Asp Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asp Ser Phe Pro Ile 85 90 95Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 10565109PRTArtificial sequenceLight chain variable region of SC04-104 65Asp Ile Gln Leu Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ile Leu Gly His Trp 20 25 30Leu Pro Leu Ser Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu 35 40 45Leu Ile Ser Lys Ala Ser Ser Leu Glu Ser Gly Val Pro Pro Arg Phe 50 55 60Ser Gly Ser Gly Ser Gly Ser Asp Phe Thr Leu Thr Ile Ser Ser Leu65 70 75 80Gln Pro Asp Asp Phe Ala Thr Tyr Tyr Cys Leu Gln Tyr His Glu Tyr 85 90 95Pro Leu Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 10566107PRTArtificial sequenceLight chain variable region of SC04-108 66Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser His 20 25 30Leu Val Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Ser Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Glu Ser Ala Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Ile 85 90 95Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 10567107PRTArtificial sequenceLight chain variable region of SC04-120 67Asp Ile Gln Leu Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Asn Ser Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Glu Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Phe 85 90 95Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys 100 10568107PRTArtificial sequenceLight chain variable region of SC04-125 68Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Asp Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10569109PRTArtificial sequenceLight chain variable region of SC04-126 69Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly Lys1 5 10 15Thr Ala Arg Ile Thr Cys Gly Gly Asn Asn Ile Gly Ser Lys Ser Val 20 25 30His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr 35 40 45Tyr Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly65 70 75 80Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp Asp Ser Ser Ser Asp His 85 90 95Pro Tyr Val Phe Gly Thr Gly Thr Lys Leu Thr Val Leu 100 10570107PRTArtificial sequenceLight chain variable region of SC04-140 70Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Ala 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Asp Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Phe Asn Ser Tyr Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10571107PRTArtificial sequenceLight chain variable region of SC04-144 71Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Gly Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Ser Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Leu Ala Thr Tyr Tyr Cys Gln Gln Tyr Asp Ser Tyr Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 10572107PRTArtificial sequenceLight chain variable region of SC04-146 72Asp Val Val Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly1 5 10 15Glu Ser Ala Thr Leu Phe Cys Arg Ala Ser Glu Ser Val Tyr Ser Asn 20 25 30Leu Ala Trp Tyr Gln His Lys Pro Gly Arg Ala Pro Arg Leu Leu Ile 35 40 45Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Ala Arg Phe Asp Gly 50 55 60Thr Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ser65 70 75 80Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Asn Asp Trp Pro Ile 85 90 95Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 10573107PRTArtificial sequenceLight chain variable region of SC04-164 73Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asn Ser Phe Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Asp Ile Lys 100 10574351DNAArtificial sequenceHeavy chain variable region SC04-001 74gaggtgcagc tggtggagtc tgggggaggt gtggtacggc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt cacctttgat gattatggca tgagctgggt ccgccaagct 120ccagggaagg ggctggagtg ggtctctggt attaattgga atggtggtag cacaggttat 180gcagactctg tgaagggccg attcaccatc tccagagaca acgccaagaa ctccctgtat 240ctgcaaatga acagtctgag agccgaggac acggccgtgt attactgtgc aaagggcctt 300tatggggagc tttttgacta ctggggccaa ggtaccctgg tcaccgtctc g 35175354DNAArtificial sequenceHeavy chain variable region of SC04-004 75gaggtgcagc tggtggagtc tgggggaggc ttggtccagc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagc aactactgga tgaactgggt ccgccaggcg 120cccgggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag cacatactac 180gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc caaagactac 300ctctacccca ccaccgactt cgattactgg ggccagggca ccctggtgac cgtg 35476360DNAArtificial sequenceHeavy chain varaible region of SC04-008 76caggtcacct tgaaggagtc tggtcctacg ctggtgaaac ccacacagac cctcacgctg 60acctgcacct tctctgggtt ctcactcagc actagtggag tgggtgtggg ctggatccgt 120cagcccccag gaaaggccct ggagtggctt gcacgcattg attgggatga tgataaatac 180tacagcacat ctctgaagac caggctcacc atctccaagg acacctccaa aaaccaggtg 240gtccttacaa tgaccaacat ggaccctgtg gacacagcca cgtattactg tgcacggatg 300ggtttcactg gaacctactt tgactactgg ggccagggca ccctggtcac cgtctcgagc 36077369DNAArtificial sequenceHeavy chain variable region of SC04-010 77caggtgcagc tggtgcagtc tgggggagac ttggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcagat atatcatatg atggaagtaa taaatactat 180gcagactccg tgaagggccg attcaccatt tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagatggg 300ctggatttaa ctggaacgat tcagccattt ggctactggg gccagggaac cctggtcacc 360gtctcgagc 36978357DNAArtificial sequenceHeavy chain variable region of SC04-018 78gaggtgcagc tggtggagtc tggcccagga ctggtgaggc cttcggggac cctgtccctc 60acctgcgctg tctctggtgg ctccatcagc agtagtaact ggtggagttg ggtccgccag 120cccccaggga aggggctgga gtggattggg gaaatctatc atagtgggag caccaactac 180aacccgtccc tcaagagtcg agtcaccata tcagtagaca agtccaagaa ccagttctcc 240ctgaagctga gctctgtgac cgccgcggac acggccgtgt attactgtgc gagagtttct 300gtgactacgg gtgcttttaa tatctggggc caagggacaa tggtcaccgt ctcgagc 35779357DNAArtificial sequenceHeavy chain varaible region SC04-021 79gaggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagtag taaatattat 180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagggtcc 300gtcctcggtg atgcttttga tatctggggc caagggacaa tggtcaccgt ctcgagc 35780363DNAArtificial sequenceHeavy chain variable region of SC04-026 80gaggtgcagc tggtggagtc tggagcagag gtgaagaagc cgggggaatc tctgaagatc 60tcctgtaagg gttctggata caactttccc tactcctgga tcgcctgggt gcgccagatg 120cccgggaaag gcctggagtg gatggggatc atctttcctg gtgactctga caccagatat 180agtccgccct tccaaggcca ggtcaccatc tcagccgaca actccaaaag caccgcctac 240ctgcagtgga gtagcctgaa ggcctcggac accgccatgt attactgtgc gcggacctcg 300aactggaact atttggaccg gttcgacccc tggggccagg gcaccctggt caccgtctcg 360agc 36381357DNAArtificial sequenceHeavy chain varaible region of SC04-031 81gaggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagtaa taaatactat 180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagggtcc 300gtcctcggtg atgcttttga tatctggggc caagggacaa tggtcaccgt ctcgagc 35782357DNAArtificial sequenceHeavy chain varaible region of SC04-038 82caggtgcagc tggtgcaatc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagtag taaatattat 180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagggtcc 300gtcctcggtg atgcttttga tatctggggc caagggacaa tggtcaccgt ctcgagc 35783354DNAArtificial sequenceHeavy chain variable region of SC04-040 83caggtgcagc tggtgcagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcggt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcaact atattctatg atggaagtta taaagactat 180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaaggcagt 300aaggtaggcg actttgacta ctggggccag ggaaccctgg tcaccgtctc gagc 35484384DNAArtificial sequenceHeavy chain variable region of SC04-060 84caggtgcagc tggtggagtc tggcccagga ctggtgaagg cttcggagac cctgtccctc 60acttgcacgg tctctgatgg ctccatcagt agtttctact ggagctggat ccggcagccc 120cccgggaagg gactggagtg ggttggggaa atccaggaca ctgggaggac caattacaac 180ccctccctca agagtcgagt cactatatca ctagacacgt ccaagaacca gttctccctg 240acgttgagct ctgtgaccgc tgcggacacg gccgtgtatt actgcgcgag agagaaggag 300aaatactctg atagaagcgg ttattcgtac tactactatt acatggacgt ctggggcaaa 360gggaccacgg tcaccgtctc gagc 38485369DNAArtificial sequenceHeavy chain variable region of SC04-073 85caggtgcagc tggtgcagtc tgggggaggc gtggcccagc ctgggaggtc cctgagactc 60tcctgtgcag cgtctggatt caccttcagt agttatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcagat atatcatatg atggaagtaa taaatactat 180gcagactccg tgaagggccg attcaccatt tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagatggg 300ctggatttaa ctggaacgat tcagccattt ggctactggg gccagggcac cctggtcacc 360gtctcgagc 36986369DNAArtificial sequenceHeavy chain variable region of SC04-097 86caggtgcagc tggtgcagtc tgggggagac ttggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcagat atatcatatg atggaagtaa taaatactat 180gcagactccg tgaagggccg attcaccatt tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagatggg 300ctggatttaa ctggaacgat tcagccattt ggctactggg gccagggaac cctggtcacc 360gtctcgagc 36987357DNAArtificial sequenceHeavy chain variable region of SC04-098 87gaagtgcagc tggtgcagtc tgggggaggc gcggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggctgtt atattatatg atggaagtga taaattctat 180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240ctgcagatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagtagca 300gtggctggta cgcactttga ctactggggc cagggaaccc tggtcaccgt ctcgagc 35788357DNAArtificial sequenceHeavy chain variable region of SC04-103 88caggtgcagc tgcaggagtc ggggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcagtt atattatatg atggaagtga taaatactat 180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagtcgct 300gtggctgggg aaagctttga ctcctggggc cggggcaccc tggtcaccgt ctcgagc 35789363DNAArtificial sequenceHeavy chain variable region of SC04-104 89caggtgcagc tgcaggagtc ggggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcaact atatcatatg atggaaatgt taaagactat 180gcagactccg tgaagggccg attcaccatc tccagagaca

attccaagaa cacgctgtat 240ctgcaaatga acagcctgag aactgaggac acggctgtgt attactgtgc gaaaatagtg 300gtggtgaccg ccctcgatgc ttttgatatc tggggccaag ggacaatggt caccgtctcg 360agc 36390360DNAArtificial sequenceHeavy chain varaible region of SC04-108 90gaagtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60tcctgtgcag cgtctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcagtt atattatatg atggaagtga taagttctat 180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagga cacgctgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaatttatg 300atagtagcag atgatgcttt tgatatctgg ggccaaggga caatggtcac cgtctcgagc 36091354DNAArtificial sequenceHeavy chain variable region of SC04-120 91gaggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt acctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcaact atatcatatg atggaagtat taaagactat 180gcagactccg agaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagggggg 300aagactggag agtttgacta ctggggccag ggaaccctgg tcaccgtctc gagc 35492357DNAArtificial sequenceHeavy chain variable region of SC04-125 92caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagtga taaatactat 180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctctat 240ctgcaaatga acagcttgag agctgaggac acggctgtgt attactgtgc gaagatagca 300acagctggta ccgggtttga ctactggggc cagggaaccc tggtcaccgt ctcgagc 35793360DNAArtificial sequenceHeavy chain variable region of SC04-126 93caggtcacct tgaaggagtc tggtcccacg ctggtgaacc ccacacagac cctcacgttg 60acctgcacct tctctgggtt ctcgctcagc actggtggag tgggtgtggg ctggttccgt 120cagcccccag ggaaggccct ggagtggctt gcacgcattg attgggatga tgataaatac 180tacagcacat ctctgaagac caggctcacc atctccaagg acacctccaa aatccaggtg 240gtccttacaa tgaccaacat ggaccctgtg gacacagcca cgtattactg tgcacggatg 300ggtttcactg gaacctactt tgactactgg ggccagggca ccctggtcac cgtctcgagc 36094357DNAArtificial sequenceHeavy chain variable region of SC04-140 94cagatgcagc tggtgcagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcagtt atattatatg atggaagtaa taaatactat 180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cgcgttgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaggtgacc 300aaccccggag atgcttttga tatctggggc caagggacca tggtcaccgt ctcgagc 35795354DNAArtificial sequenceHeavy chain variable region of SC04-144 95caggtgcagc tgcaggagtt ggggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcggt agctatggca tgcactgggt ccgccaggct 120ccgggcaagg ggctggagtg ggtggcaact atatcatatg atggaagtat taaagactat 180gcagactccg agaagggccg attcaccatc tccagagaca attccaagaa cacactgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagggggg 300aagactggag agtttgacta ctggggccag ggaaccctgg tcaccgtctc gagc 35496354DNAArtificial sequenceHeavy chain variable region of SC04-146 96gaagtgcagc tggtgcagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccgggcaagg ggctggagtg ggtggcaact atatcatatg atggaagtat taaagactat 180gcagactccg aggagggccg attcaccatc tccagagaca attccaagaa cacactgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagggggg 300aagactggag agtttgacta ctggggccag ggcaccctgg tcaccgtctc gagc 35497357DNAArtificial sequenceHeavy chain variable region of SC04-164 97gaggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagcag taaatactac 180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagggtcc 300gtcctcggtg atgcttttga tatctggggc caagggacaa tggtcaccgt ctcgagc 35798324DNAArtificial sequenceLight chain varaible region of SC04-001 98tcgtctgagc tgactcagga ccctgctgtg tctgtggcct tgggacagac agtcaggatc 60acatgccaag gagacagcct cagaagctat tatgcaagct ggtaccagca gaagccagga 120caggcccctg tacttgtcat ctatggtaaa aacaaccggc cctcagggat cccagaccga 180ttctctggct ccagctcagg aaacacagct tccttgacca tcactggggc tcaggcggaa 240gatgaggctg actattactg taactcccgg gacagcagtg gtaaccatgt ggtattcggc 300ggagggacca agctgaccgt ccta 32499309DNAArtificial sequenceLight chain variable region of SC04-004 99acccagtctc catcctccct gtctgcatct gtaggagaca gagtcaccat cacttgccgg 60gcaagtcaga gcattagcag ctacttaaat tggtatcagc agaaaccagg gaaagcccct 120aagctcctga tctatgctgc atccagtttg caaagtgggg tcccatcaag gttcagtggc 180agtggatctg ggacagattt cactctcacc atcagcagtc tgcaacctga agattttgca 240acttactact gtcaacagag ttacagtacc cctccaacgt tcggccaagg gaccaaggtg 300gagatcaaa 309100327DNAArtificial sequenceLight chain variable region of SC04-008 100caggctgtgc tgactcagcc gtcctcggtg tcagtggccc caggagagac ggccagcgtt 60acctgtgggg gagacaacat tgggagtaag agtgtgcact ggtaccaaaa gaagccaggc 120caggcccctg tgctggtcgt ctttgatgat agcgaccggc cctcagggat ccctgagcga 180ttctctggct ccacctctgg gaacacggcc gccctgacca tcagcagggt cgaagccggg 240gatgaggccg actattactg tcaggtgtgg gatagtagta atgatcatct ttatgtcttc 300ggacccggga cccagctcac cgtttta 327101321DNAArtificial sequenceLight chain variable region of SC04-010 101gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gggcattaga aatgatttag gctggtatca gcagaaacca 120gggaaagccc ctaagctcct gatctatgct gcatccagtt tacaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tggcacagat ttcactctca ccatcagcag cctgcagcct 240gaagattttg caacttatta ctgtctacaa gattacaatt accctcggac gttcggccaa 300gggaccaagg tggagatcaa a 321102330DNAArtificial sequenceLight chain variable region of SC04-018 102cagcctgtgc tgactcagcc cctctcagcg tctgggaccc ccgggcagag ggtcaccatc 60tcttgttctg gagacacctc caacatcgga agtaatactg tacactggta ccagcgcctc 120ccaggaacgg cccccaaact cctcatccat aataataatc agcggccctc aggggtccct 180gaccggttct ctggcgccaa gtctggcacc tcagcctccc tggccatcag tgggctccag 240tctgaggatg aggctgatta tttctgtgca gcatgggatg acaacctgaa tggttatgtc 300ttcggaactg ggaccaaggt caccgtccta 330103321DNAArtificial sequenceLight chain variablre region of SC04-021 103gacatccaga tgacccagtc tccattctcc ctgtctgctt ctgtcggaga cagagttacc 60atcacttgcc gggccagtca gggcattggc agttccttag cctggtatca gcaaaaacca 120gggaaagccc ctaaactcct gatctacgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 240gaagattttg caacttattt ctgtctgcag catcatgatt acccgctcac tttcggcgga 300gggaccaagc tggagatcaa a 321104336DNAArtificial sequenceLight chain variable region of SC04-026 104gatgttgtga tgactcagtc tccactctcc ctgcccgtca cccctggaga gccggcctcc 60atctcctgca ggtctagtca gagcctcctg catagtaatg gacatgatta cttggattgg 120tacgtgcaga agccagggca gtctccacag cccctgatct atttgggttc tgatcgggcc 180tccggggtcc ctgacaggtt cagtggcagt ggatcaggca cacattttac actgaatatc 240agcagagtgg aggctgagga tgttggggtt tattactgca tgcaatctct acaaactcct 300tggacttttg gccaggggac caagctggag atcaaa 336105321DNAArtificial sequenceLight chain variable region of SC04-031 105gacatccaga tgacccagtc tccatctttc gtgtctgcat ctgtaggaga cagagtcacc 60atcacttgtc gggcgagtca gggtattagc agttggttag cctggtatca gcagaaacca 120gggaaagccc ctaagctcct gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 240gaagattttg caacttacta ttgtcaacag gctaacagtt tcccactcac tttcggcgga 300gggaccaagg tggagatcaa a 321106321DNAArtificial sequenceLight chain variable region of SC04-038 106gacatccagt tgactcagtc tccatcttcc gtgtctgcat ctgtaggaga cagagtcacc 60atcacttgtc gggcgagtca gggtattagc ggctggttag cctggtatca gcagaaacca 120gagaaagccc ctaagctcct gatctatgcg gcatccagtt tgcaacgtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 240gaagattttg caacttacta ttgtcaacag gctaacagtt tcccccccac cttcggccaa 300gggacacgac tggagattaa a 321107324DNAArtificial sequenceLight chain variable region of SC04-040 107cagcctgtgc tgactcagcc cccctcggtg tcagtggccc caggacagac ggccaggatt 60tcctgtgggg gagacaacat tggaactaat actgtgcagt ggtaccagca gaagccaggc 120caggcccctg tcctggtcgt ctatgatgat agcgaccggc cctcagggat ccctgagcga 180ttctctggct ccaactctgg ggacacggcc accctgacca tcagcagggt cgaggccggg 240gatgaggccg attattactg tcaggtgtgg gatgacagta gtgatctggt ggtattcggc 300ggagggacca aggtcaccgt ccta 324108321DNAArtificial sequenceLight chain variable region of SC04-060 108gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gggcattagc acctatttaa attggtatca gcagaaacca 120gggaaagccc ctaacctcct gatctacggt gcatctaatt tgcaaagtgg ggtcccatca 180aggttcagtg gcagtgaatc tgggacagat ttcactctca ccatcagcag tctacaacct 240gaagattttg caacttacta ctgtcagcag agtttcacta cccctcgcac gttcggccaa 300gggaccaagc tggagatcaa a 321109321DNAArtificial sequenceLight chain variable region of SC04-073 109gacatccagt tgacccagtc gccatccttc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggccagtca cagtattagt agctggttgg cctggtatca gcagaaacca 120gggaaagccc ctaagctcct gatctataag gcatctagtt tagaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 240gaagattttg caacttatta ctgtctacaa gattacaatt accctcggac gttcggccaa 300gggaccaagc tggagatcaa a 321110321DNAArtificial sequenceLight chain variable region of SC04-097 110gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gggcattaga aatgatttag gctggtatca gcagaaacca 120gggaaagccc ctaagctcct gatctatgct gcatccagtt tacaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tggcacagat ttcactctca ccatcagcag cctgcagcct 240gaagattttg caacttatta ctgtctacaa gattacaatt accctcggac gttcggccaa 300gggaccaagg tggagatcaa a 321111321DNAArtificial sequenceLight chain variable region of SC04-098 111gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gggcattaga aatgatttag gctggtatca gcagaaacca 120gggaaagccc ctaagctcct gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 240gaagattttg caacttatta ctgtcaacag cttaatagtt accctcccac tttcggcgga 300gggaccaagg tggaaatcaa a 321112321DNAArtificial sequenceLight chain variable region of SC04-103 112gacatccagt tgacccagtc tccatcttcc gtgtctgcat ctgtaggaga cagagtcacc 60atcacttgtc gggcgagtca gggtattagc agctggttag cctggtatca gcagaagcca 120gggaaagccc ctaggtccct gatctatgat gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagac tttactctca ccatcagcag cctgcagcct 240gaagattttg caacttacta ttgtcaacag gctgacagtt tcccgatcac cttcggccaa 300gggacacgac tggagattaa a 321113327DNAArtificial sequenceLight chain variable region of SC04-104 113gacatccagt tgacccagtc tccttccacc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggccagtca gattcttggt cactggttgc ccttgtcctg gtatcagcag 120aaaccaggta aagcccctaa actcctgatc tctaaggcgt ctagtttaga aagtggagtc 180ccaccaaggt tcagcggcag tggatctggg tcagatttca ctctcaccat cagcagcctg 240cagcccgatg attttgcaac ttattactgc ctccaatatc atgagtaccc gctcaccttc 300ggcggaggga ccaagctgga gatcaaa 327114321DNAArtificial sequenceLight chain variable region of SC04-108 114gacatccagt tgacccagtc tccatcctca ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgtc gggcgagtca gggcattagc agtcatttag tctggtatca gcagaaacca 120gggaaagccc ctaagtccct gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg gcagtgaatc tgcgacagat ttcactctca ccatcagcag cctgcagcct 240gaagattttg caacttatta ctgccaacag tattacagtt accctatcac cttcggccaa 300gggacacgac tggagattaa a 321115321DNAArtificial sequenceLight chain variable region of SC04-120 115gacatccagt tgacccagtc tccttccacc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggccagtca gggcattaac agttatttag cctggtatca gcaagaacca 120gggaaagccc ctaaactcct gatctatgct gcatccactt tgcaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagaa ttcactctca caatcagcag cctgcagcct 240gaagattttg caacttatta ctgtcaacag cttaatagtt accccttcac tttcggccct 300gggaccaaag tggatatcaa a 321116321DNAArtificial sequenceLight chain variable region of SC04-125 116gacatccaga tgacccagtc tccatcttcc gtgtctgcat ctgtaggaga cagagtcacc 60atcacttgtc gggcgagtca gggcattagc agttatttag cctggtatca gcaaaaacca 120gggaaagccc ctaagctcct gatctatgat gcctccagtt tggaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagaa ttcactctca ccatcagcag cctgcagcct 240gatgattttg caacttatta ctgtcaacaa cttaacagtt acccactcac tttcggcgga 300gggaccaagg tggagatcaa a 321117327DNAArtificial sequenceLight chain variable region of SC04-126 117cagtctgtgc tgactcagcc accctcagtg tcagtggccc caggaaagac ggccaggatt 60acctgtgggg gaaacaacat tggaagtaaa agtgtgcact ggtaccagca gaagccaggc 120caggcccctg tgctggtcat ctattatgat agcgaccggc cctcagggat ccctgagcga 180ttctctggct ccaactctgg gaacacggcc accctgacca tcagcagggt cgaagccggg 240gatgaggctg actattactg tcaggtgtgg gatagtagta gtgatcatcc ctatgtcttc 300ggaactggga ccaagctgac cgtccta 327118321DNAArtificial sequenceLight chain variable region of SC04-140 118gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtcggaga cagagtcacc 60atcacttgcc gggcaagtca gggcattagc agtgctttag cctggtatca gcagaaacca 120gggaaagctc ctaagctcct gatctatgat gcctccagtt tggaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 240gaagattttg caacttatta ctgtcaacag tttaatagtt acccgctcac tttcggcgga 300gggaccaagg tggaaatcaa a 321119321DNAArtificial sequenceLight chain variable region of SC04-144 119gacatccagt tgacgcagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggccagtca gggcattagc agttatttag cctggtatca gcaaaaacca 120gggaaaggcc ctaagctcct gatctatgct gcatccactt tacaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagac ttcagtctca ccatcagtag cctgcagcct 240gaagatttag caacttatta ctgccaacag tatgatagtt accctctcac tttcggcgga 300gggaccaagg tggaaatcaa a 321120321DNAArtificial sequenceLight chain variable region of SC04-146 120gatgttgtga tgactcagtc tccagccacc ctgtctgtgt ctccagggga aagcgccaca 60ctcttctgca gggccagtga gagtgtttat agcaacttgg cctggtatca gcacaaacct 120ggccgggctc ccaggctcct catctatggt gcatccacca gggccactgg tatcccagcc 180aggttcgatg gcactgggtc tgggacagac ttcacactca ccatcagcag cctgcagtct 240gaagattttg cagtttatta ctgtcagcaa tataatgact ggccgatcac cttcggccaa 300gggacacgac tggagattaa a 321121321DNAArtificial sequenceLight chain variable region of SC04-164 121gacatccagt tgacccagtc tccatcttct gtgtctgcat ctgtaggaga cagagtcacc 60atcacttgtc gggcgagtca gggtattagc agctggttag cctggtatca gcagaaacca 120gggaaagccc ctaagctcct gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagat ttcactctca ctatcagcag cctgcagcct 240gaagattttg caacttacta ttgtcaacag gctaacagtt tcccgctcac tttcggcgga 300gggaccaaag tggatatcaa a 3211222107DNAArtificial sequenceHeavy chain CR57 122caggtgcagc tggtgcagag cggagccgag gtgaagaagc ccggcagcag cgtgaaggtg 60agctgcaagg ccagcggcgg caccttcaac aggtacaccg tgaactgggt gagacaggcc 120ccaggccagg gcctggagtg gatgggcggc atcatcccta tcttcggcac cgccaactac 180gcccagagat tccagggcag gctcaccatc accgccgacg agagcaccag caccgcctac 240atggagctga gcagcctgag aagcgatgac accgccgtgt acttctgcgc cagggagaac 300ctggataaca gcggcaccta ctactacttc agcggctggt tcgacccctg gggccagggc 360accctggtga ccgtgagctc aggtgagtgc ggccgcgagc ccagacactg gacgctgaac 420ctcgcggaca gttaagaacc caggggcctc tgcgccctgg gcccagctct gtcccacacc 480gcggtcacat ggcaccacct ctcttgcagc ctccaccaag ggcccatcgg tcttccccct 540ggcaccctcc tccaagagca cctctggggg cacagcggcc ctgggctgcc tggtcaagga 600ctacttcccc gaaccggtga cggtgtcgtg gaactcaggc gccctgacca gcggcgtgca 660caccttcccg gctgtcctac agtcctcagg actctactcc ctcagcagcg tggtgaccgt 720gccctccagc agcttgggca cccagaccta catctgcaac gtgaatcaca agcccagcaa 780caccaaggtg gacaagagag ttggtgagag gccagcacag ggagggaggg tgtctgctgg 840aagccaggct cagcgctcct gcctggacgc atcccggcta tgcagtccca gtccagggca 900gcaaggcagg ccccgtctgc ctcttcaccc ggaggcctct gcccgcccca ctcatgctca 960gggagagggt cttctggctt tttccccagg ctctgggcag gcacaggcta ggtgccccta 1020acccaggccc tgcacacaaa ggggcaggtg ctgggctcag acctgccaag agccatatcc 1080gggaggaccc tgcccctgac ctaagcccac cccaaaggcc aaactctcca ctccctcagc 1140tcggacacct tctctcctcc cagattccag taactcccaa tcttctctct gcagagccca 1200aatcttgtga caaaactcac acatgcccac cgtgcccagg taagccagcc caggcctcgc 1260cctccagctc aaggcgggac aggtgcccta gagtagcctg catccaggga caggccccag 1320ccgggtgctg acacgtccac ctccatctct tcctcagcac ctgaactcct

ggggggaccg 1380tcagtcttcc tcttcccccc aaaacccaag gacaccctca tgatctcccg gacccctgag 1440gtcacatgcg tggtggtgga cgtgagccac gaagaccctg aggtcaagtt caactggtac 1500gtggacggcg tggaggtgca taatgccaag acaaagccgc gggaggagca gtacaacagc 1560acgtaccgtg tggtcagcgt cctcaccgtc ctgcaccagg actggctgaa tggcaaggag 1620tacaagtgca aggtctccaa caaagccctc ccagccccca tcgagaaaac catctccaaa 1680gccaaaggtg ggacccgtgg ggtgcgaggg ccacatggac agaggccggc tcggcccacc 1740ctctgccctg agagtgaccg ctgtaccaac ctctgtccct acagggcagc cccgagaacc 1800acaggtgtac accctgcccc catcccggga ggagatgacc aagaaccagg tcagcctgac 1860ctgcctggtc aaaggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca 1920gccggagaac aactacaaga ccacgcctcc cgtgctggac tccgacggct ccttcttcct 1980ctatagcaag ctcaccgtgg acaagagcag gtggcagcag gggaacgtct tctcatgctc 2040cgtgatgcat gaggctctgc acaaccacta cacgcagaag agcctctccc tgtctccggg 2100taaatga 2107123457PRTArtificial sequenceHeavy chain CR57 123Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Asn Arg Tyr 20 25 30Thr Val Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Arg Phe 50 55 60Gln Gly Arg Leu Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Phe Cys 85 90 95Ala Arg Glu Asn Leu Asp Asn Ser Gly Thr Tyr Tyr Tyr Phe Ser Gly 100 105 110Trp Phe Asp Pro Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala 115 120 125Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser 130 135 140Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe145 150 155 160Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly 165 170 175Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu 180 185 190Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr 195 200 205Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg 210 215 220Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro225 230 235 240Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 245 250 255Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 260 265 270Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 275 280 285Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 290 295 300Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His305 310 315 320Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 325 330 335Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 340 345 350Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met 355 360 365Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 370 375 380Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn385 390 395 400Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 405 410 415Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 420 425 430Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 435 440 445Lys Ser Leu Ser Leu Ser Pro Gly Lys 450 455124859DNAArtificial sequenceLight chain of CR57 124cagagcgccc tcacccagcc cagaagcgtg agcggcagcc ctggccagag cgtgaccatc 60agctgcaccg gcaccagcag cgacatcggc ggctacaact tcgtgagctg gtatcagcag 120caccccggca aggcccctaa gctcatgatc tacgacgcca ccaagagacc cagcggcgtg 180cccgacagat tcagcggcag caagagcggc aacaccgcca gcctcaccat cagcggactg 240caggccgagg acgaggccga ctactactgc tgcagctacg ccggcgacta cacccctggc 300gtggtgttcg gcggaggcac caagcttacc gtcctaggta agtgcacttt gcggccgcta 360ggaagaaact caaaacatca agattttaaa tacgcttctt ggtctccttg ctataattat 420ctgggataag catgctgttt tctgtctgtc cctaacatgc cctgtgatta tccgcaaaca 480acacacccaa gggcagaact ttgttactta aacaccatcc tgtttgcttc tttcctcagg 540acagcccaag gctgcaccat ctgtgaccct gttccccccc tcctccgagg agctgcaggc 600caacaaggcc accctggtgt gcctcatcag cgacttctac cctggcgccg tgaccgtggc 660ctggaaggcc gacagcagcc ccgtgaaggc cggcgtggag accaccaccc ccagcaagca 720gagcaacaac aagtacgccg ccagcagcta cctgagcctc acccccgagc agtggaagag 780ccaccggagc tacagctgcc aggtgaccca cgagggcagc accgtggaga agaccgtggc 840ccccaccgag tgcagctag 859125218PRTArtificial sequenceLight chain of CR57 125Gln Ser Ala Leu Thr Gln Pro Arg Ser Val Ser Gly Ser Pro Gly Gln1 5 10 15Ser Val Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Ile Gly Gly Tyr 20 25 30Asn Phe Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 35 40 45Met Ile Tyr Asp Ala Thr Lys Arg Pro Ser Gly Val Pro Asp Arg Phe 50 55 60Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu65 70 75 80Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Cys Ser Tyr Ala Gly Asp 85 90 95Tyr Thr Pro Gly Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser 115 120 125Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp 130 135 140Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro145 150 155 160Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn 165 170 175Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys 180 185 190Ser His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val 195 200 205Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 210 2151262089DNAArtificial sequenceHeavy chain of CRJB 126cagatcaccc tgaaggagac cggccccacc ctggtgaagc ccacccagac cctcaccctc 60acctgcacct tcagcggctt cagcctgagc accagcggcg tgggcgtggg ctggatcaga 120cagccccctg gcaaggccct ggagtgggtg accctcatct actgggacga cgacaagaga 180tacagcccca gcctggagaa cagggtgacc atccggaagg acaccagcaa gaaccaggtg 240gccctcacca tgaccaacat ggaccccctg gataccggca cctactactg cgcccacagg 300cagcacatca gcagcttccc ctggttcgac agctggggcc agggcacact ggtgaccgtg 360agctcaggtg agtgcggccg cgagcccaga cactggacgc tgaacctcgc ggacagttaa 420gaacccaggg gcctctgcgc cctgggccca gctctgtccc acaccgcggt cacatggcac 480cacctctctt gcagcctcca ccaagggccc atcggtcttc cccctggcac cctcctccaa 540gagcacctct gggggcacag cggccctggg ctgcctggtc aaggactact tccccgaacc 600ggtgacggtg tcgtggaact caggcgccct gaccagcggc gtgcacacct tcccggctgt 660cctacagtcc tcaggactct actccctcag cagcgtggtg accgtgccct ccagcagctt 720gggcacccag acctacatct gcaacgtgaa tcacaagccc agcaacacca aggtggacaa 780gagagttggt gagaggccag cacagggagg gagggtgtct gctggaagcc aggctcagcg 840ctcctgcctg gacgcatccc ggctatgcag tcccagtcca gggcagcaag gcaggccccg 900tctgcctctt cacccggagg cctctgcccg ccccactcat gctcagggag agggtcttct 960ggctttttcc ccaggctctg ggcaggcaca ggctaggtgc ccctaaccca ggccctgcac 1020acaaaggggc aggtgctggg ctcagacctg ccaagagcca tatccgggag gaccctgccc 1080ctgacctaag cccaccccaa aggccaaact ctccactccc tcagctcgga caccttctct 1140cctcccagat tccagtaact cccaatcttc tctctgcaga gcccaaatct tgtgacaaaa 1200ctcacacatg cccaccgtgc ccaggtaagc cagcccaggc ctcgccctcc agctcaaggc 1260gggacaggtg ccctagagta gcctgcatcc agggacaggc cccagccggg tgctgacacg 1320tccacctcca tctcttcctc agcacctgaa ctcctggggg gaccgtcagt cttcctcttc 1380cccccaaaac ccaaggacac cctcatgatc tcccggaccc ctgaggtcac atgcgtggtg 1440gtggacgtga gccacgaaga ccctgaggtc aagttcaact ggtacgtgga cggcgtggag 1500gtgcataatg ccaagacaaa gccgcgggag gagcagtaca acagcacgta ccgtgtggtc 1560agcgtcctca ccgtcctgca ccaggactgg ctgaatggca aggagtacaa gtgcaaggtc 1620tccaacaaag ccctcccagc ccccatcgag aaaaccatct ccaaagccaa aggtgggacc 1680cgtggggtgc gagggccaca tggacagagg ccggctcggc ccaccctctg ccctgagagt 1740gaccgctgta ccaacctctg tccctacagg gcagccccga gaaccacagg tgtacaccct 1800gcccccatcc cgggaggaga tgaccaagaa ccaggtcagc ctgacctgcc tggtcaaagg 1860cttctatccc agcgacatcg ccgtggagtg ggagagcaat gggcagccgg agaacaacta 1920caagaccacg cctcccgtgc tggactccga cggctccttc ttcctctata gcaagctcac 1980cgtggacaag agcaggtggc agcaggggaa cgtcttctca tgctccgtga tgcatgaggc 2040tctgcacaac cactacacgc agaagagcct ctccctgtct ccgggtaaa 2089127452PRTArtificial sequenceHeavy chain of CRJB 127Gln Ile Thr Leu Lys Glu Thr Gly Pro Thr Leu Val Lys Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu 35 40 45Trp Val Thr Leu Ile Tyr Trp Asp Asp Asp Lys Arg Tyr Ser Pro Ser 50 55 60Leu Glu Asn Arg Val Thr Ile Arg Lys Asp Thr Ser Lys Asn Gln Val65 70 75 80Ala Leu Thr Met Thr Asn Met Asp Pro Leu Asp Thr Gly Thr Tyr Tyr 85 90 95Cys Ala His Arg Gln His Ile Ser Ser Phe Pro Trp Phe Asp Ser Trp 100 105 110Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 115 120 125Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr 130 135 140Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr145 150 155 160Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 165 170 175Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 180 185 190Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn 195 200 205His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser 210 215 220Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu225 230 235 240Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 245 250 255Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 260 265 270His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 275 280 285Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr 290 295 300Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn305 310 315 320Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 325 330 335Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln 340 345 350Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val 355 360 365Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 370 375 380Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro385 390 395 400Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 405 410 415Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val 420 425 430Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu 435 440 445Ser Pro Gly Lys 450128841DNAArtificial sequenceLight chain of CRJB 128agctacgtgc tcacccagcc ccccagcgtg agcgtggccc ctggcaagac cgccagaatc 60aactgcggcg gcaacaacat cgagtaccgg agcgtgcact ggtatcagca gaagagcggc 120caggcccccg tggccgtgat ctacgacaac agcgacagac ctagcggcat ccccgagaga 180ttcagcggca gcaagagcgg caacaccgcc accctcacca tcagcagagt ggaggccggc 240gacgaggccg actactactg ccaggtgtgg gacatcagca gcgatgtggt gttcggcgga 300ggcaccaagc ttaccgtcct aggtaagtgc actttgcggc cgctaggaag aaactcaaaa 360catcaagatt ttaaatacgc ttcttggtct ccttgctata attatctggg ataagcatgc 420tgttttctgt ctgtccctaa catgccctgt gattatccgc aaacaacaca cccaagggca 480gaactttgtt acttaaacac catcctgttt gcttctttcc tcaggacagc ccaaggctgc 540accatctgtg accctgttcc ccccctcctc cgaggagctg caggccaaca aggccaccct 600ggtgtgcctc atcagcgact tctaccctgg cgccgtgacc gtggcctgga aggccgacag 660cagccccgtg aaggccggcg tggagaccac cacccccagc aagcagagca acaacaagta 720cgccgccagc agctacctga gcctcacccc cgagcagtgg aagagccacc ggagctacag 780ctgccaggtg acccacgagg gcagcaccgt ggagaagacc gtggccccca ccgagtgcag 840c 841129213PRTArtificial sequenceLight chain of CRJB 129Ser Tyr Val Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly Lys1 5 10 15Thr Ala Arg Ile Asn Cys Gly Gly Asn Asn Ile Glu Tyr Arg Ser Val 20 25 30His Trp Tyr Gln Gln Lys Ser Gly Gln Ala Pro Val Ala Val Ile Tyr 35 40 45Asp Asn Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60Lys Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly65 70 75 80Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp Asp Ile Ser Ser Asp Val 85 90 95Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gln Pro Lys Ala 100 105 110Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu Glu Leu Gln Ala 115 120 125Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe Tyr Pro Gly Ala 130 135 140Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val Lys Ala Gly Val145 150 155 160Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys Tyr Ala Ala Ser 165 170 175Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser His Arg Ser Tyr 180 185 190Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu Lys Thr Val Ala 195 200 205Pro Thr Glu Cys Ser 21013012DNARabies virusmisc_featurePart of glycoprotein of CVS-11, E57A2, E57B1, E57B2, E57B3 and E57C3 130atacaccatc tc 1213112DNARabies virusmisc_featurePart of glycoprotein of E57A3 131atacaacatc tc 1213218DNARabies virusmisc_featurePart of glycoprotein of CVS-11 132ctcaagttat gtggagtt 1813318DNARabies virusmisc_featurePart of glycoprotein of E57A2 133ctcaagttat gtgaagtt 1813418DNARabies virusmisc_featurePart of glycoprotein of E57A3, E57B1 and E57B3 134ctcgagttat gtggagtt 1813518DNARabies virusmisc_featurePart of glycoprotein of E57B2 and E57C3 135ctcaatttat gtggagtt 1813616PRTRabies virusMISC_FEATUREPart of glycoprotein of CVS-11, E57A2, E57B1, E57B2, E57B3 and E57C3 136Gly Pro Trp Ser Pro Ile Asp Ile His His Leu Ser Cys Pro Asn Asn1 5 10 1513716PRTRabies virusMISC_FEATUREPart of glycoprotein of E57A3 137Gly Pro Trp Ser Pro Ile Asp Ile Gln His Leu Ser Cys Pro Asn Asn1 5 10 1513823PRTRabies virusMISC_FEATUREPart of glycoprotein of CVS-11 138Ser Leu Lys Gly Ala Cys Arg Leu Lys Leu Cys Gly Val Leu Gly Leu1 5 10 15Arg Leu Met Asp Gly Thr Trp 2013923PRTRabies virusMISC_FEATUREPart of glycoprotein of E57A2 139Ser Leu Lys Gly Ala Cys Arg Leu Lys Leu Cys Glu Val Leu Gly Leu1 5 10 15Arg Leu Met Asp Gly Thr Trp 2014023PRTRabies virusMISC_FEATUREPart of glycoprotein of E57A3, E57B1 and E57B3 140Ser Leu Lys Gly Ala Cys Arg Leu Glu Leu Cys Gly Val Leu Gly Leu1 5 10 15Arg Leu Met Asp Gly Thr Trp 2014123PRTRabies virusMISC_FEATUREPart of glycoprotein of E57B2 and E57C3 141Ser Leu Lys Gly Ala Cys Arg Leu Asn Leu Cys Gly Val Leu Gly Leu1 5 10 15Arg Leu Met Asp Gly Thr Trp 2014215DNARabies

virusmisc_featurePart of glycoprotein of CVS-11 142cccgagaatc cgaga 1514315DNARabies virusmisc_featurePart of glycoprotein of EJB2B, EJB2C, EJB2D, EJB2E, EJB2F and EJB3F 143cccgaggatc cgaga 1514415DNARabies virusmisc_featurePart of glycoprotein of CVS-11 144tgtggagttc ttgga 1514515DNARabies virusmisc_featurePart of glycoprotein of EJB2B, EJB2C and EJB2F 145tgtgaagttc ctgga 1514615DNARabies virusmisc_featurePart of glycoprotein of EJB2D, EJB2E and EJB3F 146tgtggagttc ctgga 1514713PRTRabies virusMISC_FEATUREPart of glycoprotein of CVS-11 147Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Met1 5 1014813PRTRabies virusMISC_FEATUREPart of glycoprotein of EJB2B, EJB2C, EJB2D, EJB2E, EJB2F and EJB3F 148Tyr Thr Ile Trp Met Pro Glu Asp Pro Arg Leu Gly Met1 5 1014923PRTRabies virusMISC_FEATUREPart of glycoprotein of CVS-11 149Ser Leu Lys Gly Ala Cys Arg Leu Lys Leu Cys Gly Val Leu Gly Leu1 5 10 15Arg Leu Met Asp Gly Thr Trp 2015023PRTRabies virusMISC_FEATUREPart of glycoprotein of EJB2B, EJB2C and EJB2F 150Ser Leu Lys Gly Ala Cys Arg Leu Lys Leu Cys Glu Val Pro Gly Leu1 5 10 15Arg Leu Met Asp Gly Thr Trp 2015123PRTRabies virusMISC_FEATUREPart of glycoprotein of EJB2D, EJB2E and EJB3F 151Ser Leu Lys Gly Ala Cys Arg Leu Lys Leu Cys Gly Val Pro Gly Leu1 5 10 15Arg Leu Met Asp Gly Thr Trp 2015224DNAArtificial sequenceAnti-sense primer HuCkappa 152acactctccc ctgttgaagc tctt 2415323DNAArtificial sequenceAnti-sense primer HuClambda2 153tgaacattct gtaggggcca ctg 2315423DNAArtificial sequenceAnti-sense primer HuClambda7 154agagcattct gcaggggcca ctg 231554941DNAArtificial sequenceVector PDV-C06 155aagcttgcat gcaaattcta tttcaaggag acagtcataa tgaaatacct attgcctacg 60gcagccgctg gattgttatt actcgcggcc cagccggcca tggccgaggt gtttgactaa 120tggggcgcgc ctcagggaac cctggtcacc gtctcgagcg gtacgggcgg ttcaggcgga 180accggcagcg gcactggcgg gtcgacggaa attgtgctca cacagtctcc agccaccctg 240tctttgtctc caggggaaag agccaccctc tcctgcaggg ccagtcagag tgttagcagc 300tacttagcct ggtaccaaca gaaacctggc caggctccca ggctcctcat ctatgatgca 360tccaacaggg ccactggcat cccagccagg ttcagtggca gtgggtctgg gacagacttc 420actctcacca tcagcagcct agagcctgaa gattttgcag tttattactg tcagcagcgt 480agcaactggc ctccggcttt cggcggaggg accaaggtgg agatcaaacg tgcggccgca 540catcatcatc accatcacgg ggccgcatat accgatattg aaatgaaccg cctgggcaaa 600ggggccgcat agactgttga aagttgttta gcaaaacctc atacagaaaa ttcatttact 660aacgtctgga aagacgacaa aactttagat cgttacgcta actatgaggg ctgtctgtgg 720aatgctacag gcgttgtggt ttgtactggt gacgaaactc agtgttacgg tacatgggtt 780cctattgggc ttgctatccc tgaaaatgag ggtggtggct ctgagggtgg cggttctgag 840ggtggcggtt ctgagggtgg cggtactaaa cctcctgagt acggtgatac acctattccg 900ggctatactt atatcaaccc tctcgacggc acttatccgc ctggtactga gcaaaacccc 960gctaatccta atccttctct tgaggagtct cagcctctta atactttcat gtttcagaat 1020aataggttcc gaaataggca gggtgcatta actgtttata cgggcactgt tactcaaggc 1080actgaccccg ttaaaactta ttaccagtac actcctgtat catcaaaagc catgtatgac 1140gcttactgga acggtaaatt cagagactgc gctttccatt ctggctttaa tgaggatcca 1200ttcgtttgtg aatatcaagg ccaatcgtct gacctgcctc aacctcctgt caatgctggc 1260ggcggctctg gtggtggttc tggtggcggc tctgagggtg gcggctctga gggtggcggt 1320tctgagggtg gcggctctga gggtggcggt tccggtggcg gctccggttc cggtgatttt 1380gattatgaaa aaatggcaaa cgctaataag ggggctatga ccgaaaatgc cgatgaaaac 1440gcgctacagt ctgacgctaa aggcaaactt gattctgtcg ctactgatta cggtgctgct 1500atcgatggtt tcattggtga cgtttccggc cttgctaatg gtaatggtgc tactggtgat 1560tttgctggct ctaattccca aatggctcaa gtcggtgacg gtgataattc acctttaatg 1620aataatttcc gtcaatattt accttctttg cctcagtcgg ttgaatgtcg cccttatgtc 1680tttggcgctg gtaaaccata tgaattttct attgattgtg acaaaataaa cttattccgt 1740ggtgtctttg cgtttctttt atatgttgcc acctttatgt atgtattttc gacgtttgct 1800aacatactgc gtaataagga gtcttaataa gaattcactg gccgtcgttt tacaacgtcg 1860tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc cccctttcgc 1920cagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt tgcgcagcct 1980gaatggcgaa tggcgcctga tgcggtattt tctccttacg catctgtgcg gtatttcaca 2040ccgcatacgt caaagcaacc atagtacgcg ccctgtagcg gcgcattaag cgcggcgggt 2100gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc cgctcctttc 2160gctttcttcc cttcctttct cgccacgttc gccggctttc cccgtcaagc tctaaatcgg 2220gggctccctt tagggttccg atttagtgct ttacggcacc tcgaccccaa aaaacttgat 2280ttgggtgatg gttcacgtag tgggccatcg ccctgataga cggtttttcg ccctttgacg 2340ttggagtcca cgttctttaa tagtggactc ttgttccaaa ctggaacaac actcaaccct 2400atctcgggct attcttttga tttataaggg attttgccga tttcggccta ttggttaaaa 2460aatgagctga tttaacaaaa atttaacgcg aattttaaca aaatattaac gtttacaatt 2520ttatggtgca ctctcagtac aatctgctct gatgccgcat agttaagcca gccccgacac 2580ccgccaacac ccgctgacgc gccctgacgg gcttgtctgc tcccggcatc cgcttacaga 2640caagctgtga ccgtctccgg gagctgcatg tgtcagaggt tttcaccgtc atcaccgaaa 2700cgcgcgagac gaaagggcct cgtgatacgc ctatttttat aggttaatgt catgataata 2760atggtttctt agacgtcagg tggcactttt cggggaaatg tgcgcggaac ccctatttgt 2820ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc ctgataaatg 2880cttcaataat attgaaaaag gaagagtatg agtattcaac atttccgtgt cgcccttatt 2940cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta 3000aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga tctcaacagc 3060ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag cacttttaaa 3120gttctgctat gtggcgcggt attatcccgt attgacgccg ggcaagagca actcggtcgc 3180cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga aaagcatctt 3240acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag tgataacact 3300gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc ttttttgcac 3360aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa tgaagccata 3420ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg caacaacgtt gcgcaaacta 3480ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg gatggaggcg 3540gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt tattgctgat 3600aaatctggag ccggtgagcg tgggtctcgc ggtatcattg cagcactggg gccagatggt 3660aagccctccc gtatcgtagt tatctacacg acggggagtc aggcaactat ggatgaacga 3720aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact gtcagaccaa 3780gtttactcat atatacttta gattgattta aaacttcatt tttaatttaa aaggatctag 3840gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt ttcgttccac 3900tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt ttttctgcgc 3960gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg tttgccggat 4020caagagctac caactctttt tccgaaggta actggcttca gcagagcgca gataccaaat 4080actgtccttc tagtgtagcc gtagttaggc caccacttca agaactctgt agcaccgcct 4140acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga taagtcgtgt 4200cttaccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc gggctgaacg 4260gggggttcgt gcacacagcc cagcttggag cgaacgacct acaccgaact gagataccta 4320cagcgtgagc tatgagaaag cgccacgctt cccgaaggga gaaaggcgga caggtatccg 4380gtaagcggca gggtcggaac aggagagcgc acgagggagc ttccaggggg aaacgcctgg 4440tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc 4500tcgtcagggg ggcggagcct atggaaaaac gccagcaacg cggccttttt acggttcctg 4560gccttttgct ggccttttgc tcacatgttc tttcctgcgt tatcccctga ttctgtggat 4620aaccgtatta ccgcctttga gtgagctgat accgctcgcc gcagccgaac gaccgagcgc 4680agcgagtcag tgagcgagga agcggaagag cgcccaatac gcaaaccgcc tctccccgcg 4740cgttggccga ttcattaatg cagctggcac gacaggtttc ccgactggaa agcgggcagt 4800gagcgcaacg caattaatgt gagttagctc actcattagg caccccaggc tttacacttt 4860atgcttccgg ctcgtatgtt gtgtggaatt gtgagcggat aacaatttca cacaggaaac 4920agctatgacc atgattacgc c 494115624DNAArtificial sequenceAnti-sense primer HuCIgG 156gtccaccttg gtgttgctgg gctt 24157741DNAArtificial sequenceSC04-001 157gcc atg gcc gag gtg cag ctg gtg gag tct ggg gga ggt gtg gta cgg 48Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Arg1 5 10 15cct ggg ggg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttt 96Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30gat gat tat ggc atg agc tgg gtc cgc caa gct cca ggg aag ggg ctg 144Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtc tct ggt att aat tgg aat ggt ggt agc aca ggt tat gca 192Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala 50 55 60gac tct gtg aag ggc cga ttc acc atc tcc aga gac aac gcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn65 70 75 80tcc ctg tat ctg caa atg aac agt ctg aga gcc gag gac acg gcc gtg 288Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gca aag ggc ctt tat ggg gag ctt ttt gac tac tgg ggc 336Tyr Tyr Cys Ala Lys Gly Leu Tyr Gly Glu Leu Phe Asp Tyr Trp Gly 100 105 110caa ggt acc ctg gtc acc gtc tcg aga ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Leu Val Thr Val Ser Arg Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc tct ggc ggt ggc gga tcg tct gag ctg act cag gac cct gct 432Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140gtg tct gtg gcc ttg gga cag aca gtc agg atc aca tgc caa gga gac 480Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155 160agc ctc aga agc tat tat gca agc tgg tac cag cag aag cca gga cag 528Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln 165 170 175gcc cct gta ctt gtc atc tat ggt aaa aac aac cgg ccc tca ggg atc 576Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile 180 185 190cca gac cga ttc tct ggc tcc agc tca gga aac aca gct tcc ttg acc 624Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr 195 200 205atc act ggg gct cag gcg gaa gat gag gct gac tat tac tgt aac tcc 672Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser 210 215 220cgg gac agc agt ggt aac cat gtg gta ttc ggc gga ggg acc aag ctg 720Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu225 230 235 240acc gtc cta ggt gcg gcc gca 741Thr Val Leu Gly Ala Ala Ala 245158247PRTArtificial sequenceSynthetic Construct 158Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Arg1 5 10 15Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn65 70 75 80Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Gly Leu Tyr Gly Glu Leu Phe Asp Tyr Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val Ser Arg Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155 160Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln 165 170 175Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile 180 185 190Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr 195 200 205Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser 210 215 220Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu225 230 235 240Thr Val Leu Gly Ala Ala Ala 245159741DNAArtificial sequenceSC04-004 159tcc atg gct gag gtg cag ctg gtg gag tct ggg gga ggc ttg gtc cag 48Ser Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln1 5 10 15cct ggg ggg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agc aac tac tgg atg aac tgg gtc cgc cag gcg ccc ggg aag ggg ctg 144Ser Asn Tyr Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtc tca gct att agt ggt agt ggt ggt agc aca tac tac gca 192Glu Trp Val Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala 50 55 60gac tcc gtg aag ggc cgg ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga gcc gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcc aaa gac tac ctc tac ccc acc acc gac ttc gat tac 336Tyr Tyr Cys Ala Lys Asp Tyr Leu Tyr Pro Thr Thr Asp Phe Asp Tyr 100 105 110tgg ggc cag ggc acc ctg gtg acc gtg ctc gag ggt acc gga ggt tcc 384Trp Gly Gln Gly Thr Leu Val Thr Val Leu Glu Gly Thr Gly Gly Ser 115 120 125ggc gga acc ggg tct ggg act ggt acg agc gag ctc acc cag tct cca 432Gly Gly Thr Gly Ser Gly Thr Gly Thr Ser Glu Leu Thr Gln Ser Pro 130 135 140tcc tcc ctg tct gca tct gta gga gac aga gtc acc atc act tgc cgg 480Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg145 150 155 160gca agt cag agc att agc agc tac tta aat tgg tat cag cag aaa cca 528Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr Gln Gln Lys Pro 165 170 175ggg aaa gcc cct aag ctc ctg atc tat gct gca tcc agt ttg caa agt 576Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser 180 185 190ggg gtc cca tca agg ttc agt ggc agt gga tct ggg aca gat ttc act 624Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 195 200 205ctc acc atc agc agt ctg caa cct gaa gat ttt gca act tac tac tgt 672Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys 210 215 220caa cag agt tac agt acc cct cca acg ttc ggc caa ggg acc aag gtg 720Gln Gln Ser Tyr Ser Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val225 230 235 240gag atc aaa cgt gcg gcc gca 741Glu Ile Lys Arg Ala Ala Ala 245160247PRTArtificial sequenceSynthetic Construct 160Ser Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln1 5 10 15Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Asn Tyr Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Asp Tyr Leu Tyr Pro Thr Thr Asp Phe Asp Tyr 100 105 110Trp Gly Gln Gly Thr Leu Val Thr Val Leu Glu Gly Thr Gly Gly Ser 115 120 125Gly Gly Thr Gly Ser Gly Thr Gly Thr Ser Glu Leu Thr Gln Ser Pro 130 135 140Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg145 150 155 160Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr Gln Gln Lys Pro 165 170 175Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser 180 185 190Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 195 200 205Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys 210 215 220Gln Gln Ser Tyr Ser Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val225 230 235 240Glu Ile Lys Arg Ala Ala Ala

245161756DNAArtificial sequenceSC04-008 161gcc atg gcc cag gtc acc ttg aag gag tct ggt cct acg ctg gtg aaa 48Ala Met Ala Gln Val Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys1 5 10 15ccc aca cag acc ctc acg ctg acc tgc acc ttc tct ggg ttc tca ctc 96Pro Thr Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu 20 25 30agc act agt gga gtg ggt gtg ggc tgg atc cgt cag ccc cca gga aag 144Ser Thr Ser Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys 35 40 45gcc ctg gag tgg ctt gca cgc att gat tgg gat gat gat aaa tac tac 192Ala Leu Glu Trp Leu Ala Arg Ile Asp Trp Asp Asp Asp Lys Tyr Tyr 50 55 60agc aca tct ctg aag acc agg ctc acc atc tcc aag gac acc tcc aaa 240Ser Thr Ser Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys65 70 75 80aac cag gtg gtc ctt aca atg acc aac atg gac cct gtg gac aca gcc 288Asn Gln Val Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala 85 90 95acg tat tac tgt gca cgg atg ggt ttc act gga acc tac ttt gac tac 336Thr Tyr Tyr Cys Ala Arg Met Gly Phe Thr Gly Thr Tyr Phe Asp Tyr 100 105 110tgg ggc cag ggc acc ctg gtc acc gtc tcg agc ggt acg ggc ggt tca 384Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser 115 120 125ggc gga acc ggc agc ggc act ggc ggg tcg acg cag gct gtg ctg act 432Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Gln Ala Val Leu Thr 130 135 140cag ccg tcc tcg gtg tca gtg gcc cca gga gag acg gcc agc gtt acc 480Gln Pro Ser Ser Val Ser Val Ala Pro Gly Glu Thr Ala Ser Val Thr145 150 155 160tgt ggg gga gac aac att ggg agt aag agt gtg cac tgg tac caa aag 528Cys Gly Gly Asp Asn Ile Gly Ser Lys Ser Val His Trp Tyr Gln Lys 165 170 175aag cca ggc cag gcc cct gtg ctg gtc gtc ttt gat gat agc gac cgg 576Lys Pro Gly Gln Ala Pro Val Leu Val Val Phe Asp Asp Ser Asp Arg 180 185 190ccc tca ggg atc cct gag cga ttc tct ggc tcc acc tct ggg aac acg 624Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Thr Ser Gly Asn Thr 195 200 205gcc gcc ctg acc atc agc agg gtc gaa gcc ggg gat gag gcc gac tat 672Ala Ala Leu Thr Ile Ser Arg Val Glu Ala Gly Asp Glu Ala Asp Tyr 210 215 220tac tgt cag gtg tgg gat agt agt aat gat cat ctt tat gtc ttc gga 720Tyr Cys Gln Val Trp Asp Ser Ser Asn Asp His Leu Tyr Val Phe Gly225 230 235 240ccc ggg acc cag ctc acc gtt tta agt gcg gcc gca 756Pro Gly Thr Gln Leu Thr Val Leu Ser Ala Ala Ala 245 250162252PRTArtificial sequenceSynthetic Construct 162Ala Met Ala Gln Val Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys1 5 10 15Pro Thr Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu 20 25 30Ser Thr Ser Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys 35 40 45Ala Leu Glu Trp Leu Ala Arg Ile Asp Trp Asp Asp Asp Lys Tyr Tyr 50 55 60Ser Thr Ser Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys65 70 75 80Asn Gln Val Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala 85 90 95Thr Tyr Tyr Cys Ala Arg Met Gly Phe Thr Gly Thr Tyr Phe Asp Tyr 100 105 110Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser 115 120 125Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Gln Ala Val Leu Thr 130 135 140Gln Pro Ser Ser Val Ser Val Ala Pro Gly Glu Thr Ala Ser Val Thr145 150 155 160Cys Gly Gly Asp Asn Ile Gly Ser Lys Ser Val His Trp Tyr Gln Lys 165 170 175Lys Pro Gly Gln Ala Pro Val Leu Val Val Phe Asp Asp Ser Asp Arg 180 185 190Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Thr Ser Gly Asn Thr 195 200 205Ala Ala Leu Thr Ile Ser Arg Val Glu Ala Gly Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Gln Val Trp Asp Ser Ser Asn Asp His Leu Tyr Val Phe Gly225 230 235 240Pro Gly Thr Gln Leu Thr Val Leu Ser Ala Ala Ala 245 250163759DNAArtificial sequenceSC04-010 163gcc atg gcc cag gtg cag ctg gtg cag tct ggg gga gac ttg gtc cag 48Ala Met Ala Gln Val Gln Leu Val Gln Ser Gly Gly Asp Leu Val Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca gat ata tca tat gat gga agt aat aaa tac tat gca 192Glu Trp Val Ala Asp Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc att tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa gat ggg ctg gat tta act gga acg att cag cca 336Tyr Tyr Cys Ala Lys Asp Gly Leu Asp Leu Thr Gly Thr Ile Gln Pro 100 105 110ttt ggc tac tgg ggc cag gga acc ctg gtc acc gtc tcg agc ggt acg 384Phe Gly Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr 115 120 125ggc ggt tca ggc gga acc ggc agc ggc act ggc ggg tcg acg gac atc 432Gly Gly Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile 130 135 140cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga gac aga 480Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg145 150 155 160gtc acc atc act tgc cgg gca agt cag ggc att aga aat gat tta ggc 528Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp Leu Gly 165 170 175tgg tat cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc tat gct 576Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala 180 185 190gca tcc agt tta caa agt ggg gtc cca tca agg ttc agc ggc agt gga 624Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly 195 200 205tct ggc aca gat ttc act ctc acc atc agc agc ctg cag cct gaa gat 672Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp 210 215 220ttt gca act tat tac tgt cta caa gat tac aat tac cct cgg acg ttc 720Phe Ala Thr Tyr Tyr Cys Leu Gln Asp Tyr Asn Tyr Pro Arg Thr Phe225 230 235 240ggc caa ggg acc aag gtg gag atc aaa cgt gcg gcc gca 759Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Ala Ala Ala 245 250164253PRTArtificial sequenceSynthetic Construct 164Ala Met Ala Gln Val Gln Leu Val Gln Ser Gly Gly Asp Leu Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Asp Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Asp Gly Leu Asp Leu Thr Gly Thr Ile Gln Pro 100 105 110Phe Gly Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr 115 120 125Gly Gly Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile 130 135 140Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg145 150 155 160Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp Leu Gly 165 170 175Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala 180 185 190Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly 195 200 205Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp 210 215 220Phe Ala Thr Tyr Tyr Cys Leu Gln Asp Tyr Asn Tyr Pro Arg Thr Phe225 230 235 240Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Ala Ala Ala 245 250165756DNAArtificial sequenceSC04-018 165gcc atg gcc gag gtg cag ctg gtg gag tct ggc cca gga ctg gtg agg 48Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Arg1 5 10 15cct tcg ggg acc ctg tcc ctc acc tgc gct gtc tct ggt ggc tcc atc 96Pro Ser Gly Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile 20 25 30agc agt agt aac tgg tgg agt tgg gtc cgc cag ccc cca ggg aag ggg 144Ser Ser Ser Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly 35 40 45ctg gag tgg att ggg gaa atc tat cat agt ggg agc acc aac tac aac 192Leu Glu Trp Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn 50 55 60ccg tcc ctc aag agt cga gtc acc ata tca gta gac aag tcc aag aac 240Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn65 70 75 80cag ttc tcc ctg aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg 288Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val 85 90 95tat tac tgt gcg aga gtt tct gtg act acg ggt gct ttt aat atc tgg 336Tyr Tyr Cys Ala Arg Val Ser Val Thr Thr Gly Ala Phe Asn Ile Trp 100 105 110ggc caa ggg aca atg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc 384Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125gga acc ggc agc ggc act ggc ggg tcg acg cag cct gtg ctg act cag 432Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Gln Pro Val Leu Thr Gln 130 135 140ccc ctc tca gcg tct ggg acc ccc ggg cag agg gtc acc atc tct tgt 480Pro Leu Ser Ala Ser Gly Thr Pro Gly Gln Arg Val Thr Ile Ser Cys145 150 155 160tct gga gac acc tcc aac atc gga agt aat act gta cac tgg tac cag 528Ser Gly Asp Thr Ser Asn Ile Gly Ser Asn Thr Val His Trp Tyr Gln 165 170 175cgc ctc cca gga acg gcc ccc aaa ctc ctc atc cat aat aat aat cag 576Arg Leu Pro Gly Thr Ala Pro Lys Leu Leu Ile His Asn Asn Asn Gln 180 185 190cgg ccc tca ggg gtc cct gac cgg ttc tct ggc gcc aag tct ggc acc 624Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ala Lys Ser Gly Thr 195 200 205tca gcc tcc ctg gcc atc agt ggg ctc cag tct gag gat gag gct gat 672Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala Asp 210 215 220tat ttc tgt gca gca tgg gat gac aac ctg aat ggt tat gtc ttc gga 720Tyr Phe Cys Ala Ala Trp Asp Asp Asn Leu Asn Gly Tyr Val Phe Gly225 230 235 240act ggg acc aag gtc acc gtc cta ggt gcg gcc gca 756Thr Gly Thr Lys Val Thr Val Leu Gly Ala Ala Ala 245 250166252PRTArtificial sequenceSynthetic Construct 166Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Arg1 5 10 15Pro Ser Gly Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile 20 25 30Ser Ser Ser Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly 35 40 45Leu Glu Trp Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn 50 55 60Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn65 70 75 80Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Arg Val Ser Val Thr Thr Gly Ala Phe Asn Ile Trp 100 105 110Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Gln Pro Val Leu Thr Gln 130 135 140Pro Leu Ser Ala Ser Gly Thr Pro Gly Gln Arg Val Thr Ile Ser Cys145 150 155 160Ser Gly Asp Thr Ser Asn Ile Gly Ser Asn Thr Val His Trp Tyr Gln 165 170 175Arg Leu Pro Gly Thr Ala Pro Lys Leu Leu Ile His Asn Asn Asn Gln 180 185 190Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ala Lys Ser Gly Thr 195 200 205Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala Asp 210 215 220Tyr Phe Cys Ala Ala Trp Asp Asp Asn Leu Asn Gly Tyr Val Phe Gly225 230 235 240Thr Gly Thr Lys Val Thr Val Leu Gly Ala Ala Ala 245 250167747DNAArtificial sequenceSC04-021 167gcc atg gcc gag gtg cag ctg gtg gag tct ggg gga ggc gtg gtc cag 48Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca gtt ata tca tat gat gga agt agt aaa tat tat gca 192Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Ser Lys Tyr Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa ggg tcc gtc ctc ggt gat gct ttt gat atc tgg 336Tyr Tyr Cys Ala Lys Gly Ser Val Leu Gly Asp Ala Phe Asp Ile Trp 100 105 110ggc caa ggg aca atg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc 384Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125gga acc ggc agc ggc act ggc ggg tcg acg gac atc cag atg acc cag 432Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Met Thr Gln 130 135 140tct cca ttc tcc ctg tct gct tct gtc gga gac aga gtt acc atc act 480Ser Pro Phe Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160tgc cgg gcc agt cag ggc att ggc agt tcc tta gcc tgg tat cag caa 528Cys Arg Ala Ser Gln Gly Ile Gly Ser Ser Leu Ala Trp Tyr Gln Gln 165 170 175aaa cca ggg aaa gcc cct aaa ctc ctg atc tac gct gca tcc agt ttg 576Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu 180 185 190caa agt ggg gtc cca tca agg ttc agc ggc agt gga tct ggg aca gat 624Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205ttc act ctc acc atc agc agc ctg cag cct gaa gat ttt gca act tat 672Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220ttc tgt ctg cag cat cat gat tac ccg ctc act ttc ggc gga ggg acc 720Phe Cys Leu Gln His His Asp Tyr Pro Leu Thr Phe Gly Gly Gly Thr225 230 235 240aag ctg gag atc aaa cgt gcg gcc gca 747Lys Leu Glu Ile Lys Arg Ala Ala Ala 245168249PRTArtificial sequenceSynthetic Construct 168Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

35 40 45Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Ser Lys Tyr Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Gly Ser Val Leu Gly Asp Ala Phe Asp Ile Trp 100 105 110Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Met Thr Gln 130 135 140Ser Pro Phe Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160Cys Arg Ala Ser Gln Gly Ile Gly Ser Ser Leu Ala Trp Tyr Gln Gln 165 170 175Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu 180 185 190Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220Phe Cys Leu Gln His His Asp Tyr Pro Leu Thr Phe Gly Gly Gly Thr225 230 235 240Lys Leu Glu Ile Lys Arg Ala Ala Ala 245169768DNAArtificial sequenceSC04-026 169gcc atg gcc gag gtg cag ctg gtg gag tct gga gca gag gtg aag aag 48Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys1 5 10 15ccg ggg gaa tct ctg aag atc tcc tgt aag ggt tct gga tac aac ttt 96Pro Gly Glu Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Asn Phe 20 25 30ccc tac tcc tgg atc gcc tgg gtg cgc cag atg ccc ggg aaa ggc ctg 144Pro Tyr Ser Trp Ile Ala Trp Val Arg Gln Met Pro Gly Lys Gly Leu 35 40 45gag tgg atg ggg atc atc ttt cct ggt gac tct gac acc aga tat agt 192Glu Trp Met Gly Ile Ile Phe Pro Gly Asp Ser Asp Thr Arg Tyr Ser 50 55 60ccg ccc ttc caa ggc cag gtc acc atc tca gcc gac aac tcc aaa agc 240Pro Pro Phe Gln Gly Gln Val Thr Ile Ser Ala Asp Asn Ser Lys Ser65 70 75 80acc gcc tac ctg cag tgg agt agc ctg aag gcc tcg gac acc gcc atg 288Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met 85 90 95tat tac tgt gcg cgg acc tcg aac tgg aac tat ttg gac cgg ttc gac 336Tyr Tyr Cys Ala Arg Thr Ser Asn Trp Asn Tyr Leu Asp Arg Phe Asp 100 105 110ccc tgg ggc cag ggc acc ctg gtc acc gtc tcg agc ggt acg ggc ggt 384Pro Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly 115 120 125tca ggc gga acc ggc agc ggc act ggc ggg tcg acg gat gtt gtg atg 432Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Val Val Met 130 135 140act cag tct cca ctc tcc ctg ccc gtc acc cct gga gag ccg gcc tcc 480Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly Glu Pro Ala Ser145 150 155 160atc tcc tgc agg tct agt cag agc ctc ctg cat agt aat gga cat gat 528Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser Asn Gly His Asp 165 170 175tac ttg gat tgg tac gtg cag aag cca ggg cag tct cca cag ccc ctg 576Tyr Leu Asp Trp Tyr Val Gln Lys Pro Gly Gln Ser Pro Gln Pro Leu 180 185 190atc tat ttg ggt tct gat cgg gcc tcc ggg gtc cct gac agg ttc agt 624Ile Tyr Leu Gly Ser Asp Arg Ala Ser Gly Val Pro Asp Arg Phe Ser 195 200 205ggc agt gga tca ggc aca cat ttt aca ctg aat atc agc aga gtg gag 672Gly Ser Gly Ser Gly Thr His Phe Thr Leu Asn Ile Ser Arg Val Glu 210 215 220gct gag gat gtt ggg gtt tat tac tgc atg caa tct cta caa act cct 720Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ser Leu Gln Thr Pro225 230 235 240tgg act ttt ggc cag ggg acc aag ctg gag atc aaa cgt gcg gcc gca 768Trp Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Ala Ala Ala 245 250 255170256PRTArtificial sequenceSynthetic Construct 170Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys1 5 10 15Pro Gly Glu Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Asn Phe 20 25 30Pro Tyr Ser Trp Ile Ala Trp Val Arg Gln Met Pro Gly Lys Gly Leu 35 40 45Glu Trp Met Gly Ile Ile Phe Pro Gly Asp Ser Asp Thr Arg Tyr Ser 50 55 60Pro Pro Phe Gln Gly Gln Val Thr Ile Ser Ala Asp Asn Ser Lys Ser65 70 75 80Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met 85 90 95Tyr Tyr Cys Ala Arg Thr Ser Asn Trp Asn Tyr Leu Asp Arg Phe Asp 100 105 110Pro Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly 115 120 125Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Val Val Met 130 135 140Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly Glu Pro Ala Ser145 150 155 160Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser Asn Gly His Asp 165 170 175Tyr Leu Asp Trp Tyr Val Gln Lys Pro Gly Gln Ser Pro Gln Pro Leu 180 185 190Ile Tyr Leu Gly Ser Asp Arg Ala Ser Gly Val Pro Asp Arg Phe Ser 195 200 205Gly Ser Gly Ser Gly Thr His Phe Thr Leu Asn Ile Ser Arg Val Glu 210 215 220Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ser Leu Gln Thr Pro225 230 235 240Trp Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Ala Ala Ala 245 250 255171747DNAArtificial sequenceSC04-031 171gcc atg gcc gag gtg cag ctg gtg gag tct ggg gga ggc gtg gtc cag 48Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca gtt ata tca tat gat gga agt aat aaa tac tat gca 192Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa ggg tcc gtc ctc ggt gat gct ttt gat atc tgg 336Tyr Tyr Cys Ala Lys Gly Ser Val Leu Gly Asp Ala Phe Asp Ile Trp 100 105 110ggc caa ggg aca atg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc 384Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125gga acc ggc agc ggc act ggc ggg tcg acg gac atc cag atg acc cag 432Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Met Thr Gln 130 135 140tct cca tct ttc gtg tct gca tct gta gga gac aga gtc acc atc act 480Ser Pro Ser Phe Val Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160tgt cgg gcg agt cag ggt att agc agt tgg tta gcc tgg tat cag cag 528Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp Leu Ala Trp Tyr Gln Gln 165 170 175aaa cca ggg aaa gcc cct aag ctc ctg atc tat gct gca tcc agt ttg 576Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu 180 185 190caa agt ggg gtc cca tca agg ttc agc ggc agt gga tct ggg aca gat 624Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205ttc act ctc acc atc agc agc ctg cag cct gaa gat ttt gca act tac 672Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220tat tgt caa cag gct aac agt ttc cca ctc act ttc ggc gga ggg acc 720Tyr Cys Gln Gln Ala Asn Ser Phe Pro Leu Thr Phe Gly Gly Gly Thr225 230 235 240aag gtg gag atc aaa cga gcg gcc gca 747Lys Val Glu Ile Lys Arg Ala Ala Ala 245172249PRTArtificial sequenceSynthetic Construct 172Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Gly Ser Val Leu Gly Asp Ala Phe Asp Ile Trp 100 105 110Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Met Thr Gln 130 135 140Ser Pro Ser Phe Val Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp Leu Ala Trp Tyr Gln Gln 165 170 175Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu 180 185 190Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220Tyr Cys Gln Gln Ala Asn Ser Phe Pro Leu Thr Phe Gly Gly Gly Thr225 230 235 240Lys Val Glu Ile Lys Arg Ala Ala Ala 245173747DNAArtificial sequenceSC04-038 173gcc atg gcc cag gtg cag ctg gtg caa tct ggg gga ggc gtg gtc cag 48Ala Met Ala Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca gtt ata tca tat gat gga agt agt aaa tat tat gca 192Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Ser Lys Tyr Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa ggg tcc gtc ctc ggt gat gct ttt gat atc tgg 336Tyr Tyr Cys Ala Lys Gly Ser Val Leu Gly Asp Ala Phe Asp Ile Trp 100 105 110ggc caa ggg aca atg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc 384Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125gga acc ggc agc ggc act ggc ggg tcg acg gac atc cag ttg act cag 432Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu Thr Gln 130 135 140tct cca tct tcc gtg tct gca tct gta gga gac aga gtc acc atc act 480Ser Pro Ser Ser Val Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160tgt cgg gcg agt cag ggt att agc ggc tgg tta gcc tgg tat cag cag 528Cys Arg Ala Ser Gln Gly Ile Ser Gly Trp Leu Ala Trp Tyr Gln Gln 165 170 175aaa cca gag aaa gcc cct aag ctc ctg atc tat gcg gca tcc agt ttg 576Lys Pro Glu Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu 180 185 190caa cgt ggg gtc cca tca agg ttc agc ggc agt gga tct ggg aca gat 624Gln Arg Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205ttc act ctc acc atc agc agc ctg cag cct gaa gat ttt gca act tac 672Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220tat tgt caa cag gct aac agt ttc ccc ccc acc ttc ggc caa ggg aca 720Tyr Cys Gln Gln Ala Asn Ser Phe Pro Pro Thr Phe Gly Gln Gly Thr225 230 235 240cga ctg gag att aaa cgt gcg gcc gca 747Arg Leu Glu Ile Lys Arg Ala Ala Ala 245174249PRTArtificial sequenceSynthetic Construct 174Ala Met Ala Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Ser Lys Tyr Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Gly Ser Val Leu Gly Asp Ala Phe Asp Ile Trp 100 105 110Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu Thr Gln 130 135 140Ser Pro Ser Ser Val Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160Cys Arg Ala Ser Gln Gly Ile Ser Gly Trp Leu Ala Trp Tyr Gln Gln 165 170 175Lys Pro Glu Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu 180 185 190Gln Arg Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220Tyr Cys Gln Gln Ala Asn Ser Phe Pro Pro Thr Phe Gly Gln Gly Thr225 230 235 240Arg Leu Glu Ile Lys Arg Ala Ala Ala 245175747DNAArtificial sequenceSC04-040 175gcc atg gcc cag gtg cag ctg gtg cag tct ggg gga ggc gtg gtc cag 48Ala Met Ala Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30ggt agc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Gly Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca act ata ttc tat gat gga agt tat aaa gac tat gca 192Glu Trp Val Ala Thr Ile Phe Tyr Asp Gly Ser Tyr Lys Asp Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa ggc agt aag gta ggc gac ttt gac tac tgg ggc 336Tyr Tyr Cys Ala Lys Gly Ser Lys Val Gly Asp Phe Asp Tyr Trp Gly 100 105 110cag gga acc ctg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc gga 384Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly Gly 115 120 125acc ggc agc ggc act ggc ggg tcg acg cag cct gtg ctg act cag ccc 432Thr Gly Ser Gly Thr Gly Gly Ser Thr Gln Pro Val Leu Thr Gln Pro 130 135 140ccc tcg gtg tca gtg gcc cca gga cag acg gcc agg att tcc tgt ggg 480Pro Ser Val Ser Val Ala Pro Gly Gln Thr Ala Arg Ile Ser Cys Gly145

150 155 160gga gac aac att gga act aat act gtg cag tgg tac cag cag aag cca 528Gly Asp Asn Ile Gly Thr Asn Thr Val Gln Trp Tyr Gln Gln Lys Pro 165 170 175ggc cag gcc cct gtc ctg gtc gtc tat gat gat agc gac cgg ccc tca 576Gly Gln Ala Pro Val Leu Val Val Tyr Asp Asp Ser Asp Arg Pro Ser 180 185 190ggg atc cct gag cga ttc tct ggc tcc aac tct ggg gac acg gcc acc 624Gly Ile Pro Glu Arg Phe Ser Gly Ser Asn Ser Gly Asp Thr Ala Thr 195 200 205ctg acc atc agc agg gtc gag gcc ggg gat gag gcc gat tat tac tgt 672Leu Thr Ile Ser Arg Val Glu Ala Gly Asp Glu Ala Asp Tyr Tyr Cys 210 215 220cag gtg tgg gat gac agt agt gat ctg gtg gta ttc ggc gga ggg acc 720Gln Val Trp Asp Asp Ser Ser Asp Leu Val Val Phe Gly Gly Gly Thr225 230 235 240aag gtc acc gtc cta ggt gcg gcc gca 747Lys Val Thr Val Leu Gly Ala Ala Ala 245176249PRTArtificial sequenceSynthetic Construct 176Ala Met Ala Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Gly Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Thr Ile Phe Tyr Asp Gly Ser Tyr Lys Asp Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Gly Ser Lys Val Gly Asp Phe Asp Tyr Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly Gly 115 120 125Thr Gly Ser Gly Thr Gly Gly Ser Thr Gln Pro Val Leu Thr Gln Pro 130 135 140Pro Ser Val Ser Val Ala Pro Gly Gln Thr Ala Arg Ile Ser Cys Gly145 150 155 160Gly Asp Asn Ile Gly Thr Asn Thr Val Gln Trp Tyr Gln Gln Lys Pro 165 170 175Gly Gln Ala Pro Val Leu Val Val Tyr Asp Asp Ser Asp Arg Pro Ser 180 185 190Gly Ile Pro Glu Arg Phe Ser Gly Ser Asn Ser Gly Asp Thr Ala Thr 195 200 205Leu Thr Ile Ser Arg Val Glu Ala Gly Asp Glu Ala Asp Tyr Tyr Cys 210 215 220Gln Val Trp Asp Asp Ser Ser Asp Leu Val Val Phe Gly Gly Gly Thr225 230 235 240Lys Val Thr Val Leu Gly Ala Ala Ala 245177774DNAArtificial sequenceSC04-060 177gcc atg gcc cag gtg cag ctg gtg gag tct ggc cca gga ctg gtg aag 48Ala Met Ala Gln Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys1 5 10 15gct tcg gag acc ctg tcc ctc act tgc acg gtc tct gat ggc tcc atc 96Ala Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Asp Gly Ser Ile 20 25 30agt agt ttc tac tgg agc tgg atc cgg cag ccc ccc ggg aag gga ctg 144Ser Ser Phe Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu 35 40 45gag tgg gtt ggg gaa atc cag gac act ggg agg acc aat tac aac ccc 192Glu Trp Val Gly Glu Ile Gln Asp Thr Gly Arg Thr Asn Tyr Asn Pro 50 55 60tcc ctc aag agt cga gtc act ata tca cta gac acg tcc aag aac cag 240Ser Leu Lys Ser Arg Val Thr Ile Ser Leu Asp Thr Ser Lys Asn Gln65 70 75 80ttc tcc ctg acg ttg agc tct gtg acc gct gcg gac acg gcc gtg tat 288Phe Ser Leu Thr Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 85 90 95tac tgc gcg aga gag aag gag aaa tac tct gat aga agc ggt tat tcg 336Tyr Cys Ala Arg Glu Lys Glu Lys Tyr Ser Asp Arg Ser Gly Tyr Ser 100 105 110tac tac tac tat tac atg gac gtc tgg ggc aaa ggg acc acg gtc acc 384Tyr Tyr Tyr Tyr Tyr Met Asp Val Trp Gly Lys Gly Thr Thr Val Thr 115 120 125gtc tcg agc ggt acg ggc ggt tca ggc gga acc ggc agc ggc act ggc 432Val Ser Ser Gly Thr Gly Gly Ser Gly Gly Thr Gly Ser Gly Thr Gly 130 135 140ggg tcg acg gac atc cag atg acc cag tct cca tcc tcc ctg tct gca 480Gly Ser Thr Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala145 150 155 160tct gta gga gac aga gtc acc atc act tgc cgg gca agt cag ggc att 528Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile 165 170 175agc acc tat tta aat tgg tat cag cag aaa cca ggg aaa gcc cct aac 576Ser Thr Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Asn 180 185 190ctc ctg atc tac ggt gca tct aat ttg caa agt ggg gtc cca tca agg 624Leu Leu Ile Tyr Gly Ala Ser Asn Leu Gln Ser Gly Val Pro Ser Arg 195 200 205ttc agt ggc agt gaa tct ggg aca gat ttc act ctc acc atc agc agt 672Phe Ser Gly Ser Glu Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser 210 215 220cta caa cct gaa gat ttt gca act tac tac tgt cag cag agt ttc act 720Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Phe Thr225 230 235 240acc cct cgc acg ttc ggc caa ggg acc aag ctg gag atc aaa cgt gcg 768Thr Pro Arg Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Ala 245 250 255gcc gca 774Ala Ala178258PRTArtificial sequenceSynthetic Construct 178Ala Met Ala Gln Val Gln Leu Val Glu Ser Gly Pro Gly Leu Val Lys1 5 10 15Ala Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Asp Gly Ser Ile 20 25 30Ser Ser Phe Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Gly Glu Ile Gln Asp Thr Gly Arg Thr Asn Tyr Asn Pro 50 55 60Ser Leu Lys Ser Arg Val Thr Ile Ser Leu Asp Thr Ser Lys Asn Gln65 70 75 80Phe Ser Leu Thr Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 85 90 95Tyr Cys Ala Arg Glu Lys Glu Lys Tyr Ser Asp Arg Ser Gly Tyr Ser 100 105 110Tyr Tyr Tyr Tyr Tyr Met Asp Val Trp Gly Lys Gly Thr Thr Val Thr 115 120 125Val Ser Ser Gly Thr Gly Gly Ser Gly Gly Thr Gly Ser Gly Thr Gly 130 135 140Gly Ser Thr Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala145 150 155 160Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile 165 170 175Ser Thr Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Asn 180 185 190Leu Leu Ile Tyr Gly Ala Ser Asn Leu Gln Ser Gly Val Pro Ser Arg 195 200 205Phe Ser Gly Ser Glu Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser 210 215 220Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Phe Thr225 230 235 240Thr Pro Arg Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Ala 245 250 255Ala Ala179759DNAArtificial sequenceSC04-073 179gcc atg gcc cag gtg cag ctg gtg cag tct ggg gga ggc gtg gcc cag 48Ala Met Ala Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Ala Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcg tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agt tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca gat ata tca tat gat gga agt aat aaa tac tat gca 192Glu Trp Val Ala Asp Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc att tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa gat ggg ctg gat tta act gga acg att cag cca 336Tyr Tyr Cys Ala Lys Asp Gly Leu Asp Leu Thr Gly Thr Ile Gln Pro 100 105 110ttt ggc tac tgg ggc cag ggc acc ctg gtc acc gtc tcg agc ggt acg 384Phe Gly Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr 115 120 125ggc ggt tca ggc gga acc ggc agc ggc act ggc ggg tcg acg gac atc 432Gly Gly Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile 130 135 140cag ttg acc cag tcg cca tcc ttc ctg tct gca tct gta gga gac aga 480Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser Val Gly Asp Arg145 150 155 160gtc acc atc act tgc cgg gcc agt cac agt att agt agc tgg ttg gcc 528Val Thr Ile Thr Cys Arg Ala Ser His Ser Ile Ser Ser Trp Leu Ala 165 170 175tgg tat cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc tat aag 576Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Lys 180 185 190gca tct agt tta gaa agt ggg gtc cca tca agg ttc agc ggc agt gga 624Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly 195 200 205tct ggg aca gat ttc act ctc acc atc agc agc ctg cag cct gaa gat 672Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp 210 215 220ttt gca act tat tac tgt cta caa gat tac aat tac cct cgg acg ttc 720Phe Ala Thr Tyr Tyr Cys Leu Gln Asp Tyr Asn Tyr Pro Arg Thr Phe225 230 235 240ggc caa ggg acc aag ctg gag atc aaa cgt gcg gcc gca 759Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Ala Ala Ala 245 250180253PRTArtificial sequenceSynthetic Construct 180Ala Met Ala Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Ala Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Asp Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Asp Gly Leu Asp Leu Thr Gly Thr Ile Gln Pro 100 105 110Phe Gly Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr 115 120 125Gly Gly Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile 130 135 140Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser Val Gly Asp Arg145 150 155 160Val Thr Ile Thr Cys Arg Ala Ser His Ser Ile Ser Ser Trp Leu Ala 165 170 175Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Lys 180 185 190Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly 195 200 205Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp 210 215 220Phe Ala Thr Tyr Tyr Cys Leu Gln Asp Tyr Asn Tyr Pro Arg Thr Phe225 230 235 240Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Ala Ala Ala 245 250181753DNAArtificial sequenceSC04-097 181gcc atg gcc gaa gtg cag ctg gtg cag tct ggg gga cac ttg gta cag 48Ala Met Ala Glu Val Gln Leu Val Gln Ser Gly Gly His Leu Val Gln1 5 10 15cct ggg ggg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttt 96Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agc agc tat gcc atg agc tgg gtc cgc cag gct cca ggg aag ggg ctg 144Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtc tca ctt att att ggt agc ggt cgt agc aca tac tac gca 192Glu Trp Val Ser Leu Ile Ile Gly Ser Gly Arg Ser Thr Tyr Tyr Ala 50 55 60gac tcc gtg aag ggc cgg ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga gcc gag gac acg gcc gta 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa acc gcg agt aat ctt gga agg ggg ggt atg gac 336Tyr Tyr Cys Ala Lys Thr Ala Ser Asn Leu Gly Arg Gly Gly Met Asp 100 105 110gtc tgg ggc caa ggg acc acg gtc acc gtc tcg agc ggt acg ggc ggt 384Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Thr Gly Gly 115 120 125tca ggc gga acc ggc agc ggc act ggc ggg tcg acg gac att cag ttg 432Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu 130 135 140acc cag tct cca tcc tcc ctg tct gca tct gtg gga gac aga gtc act 480Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr145 150 155 160atc act tgc cgg gcc agt cag ggc att agc agt cat tta gcc tgg tat 528Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser His Leu Ala Trp Tyr 165 170 175cag caa aaa cca ggg aaa gcc cct aag ctc ctg atc tat gct gca tcc 576Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser 180 185 190agt ttg caa agt ggg gtc cca tca agg ttc agc ggc agt gga tct ggg 624Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly 195 200 205aca gaa ttc act ctc acc atc agc agc ctg cag cct gaa gat ttt gca 672Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala 210 215 220act tat tac tgt caa cag ttt aat agt tac ccg atc acc ttc ggc caa 720Thr Tyr Tyr Cys Gln Gln Phe Asn Ser Tyr Pro Ile Thr Phe Gly Gln225 230 235 240ggg aca cga ctg gag att aaa cgt gcg gcc gca 753Gly Thr Arg Leu Glu Ile Lys Arg Ala Ala Ala 245 250182251PRTArtificial sequenceSynthetic Construct 182Ala Met Ala Glu Val Gln Leu Val Gln Ser Gly Gly His Leu Val Gln1 5 10 15Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ser Leu Ile Ile Gly Ser Gly Arg Ser Thr Tyr Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Thr Ala Ser Asn Leu Gly Arg Gly Gly Met Asp 100 105 110Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Thr Gly Gly 115 120 125Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu 130 135 140Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr145 150 155 160Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser His Leu Ala Trp Tyr 165 170 175Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser 180 185 190Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly 195 200 205Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala 210 215 220Thr Tyr Tyr Cys Gln Gln Phe Asn Ser Tyr Pro Ile Thr Phe Gly Gln225 230 235 240Gly Thr Arg Leu Glu Ile Lys Arg Ala Ala Ala 245 250183747DNAArtificial sequenceSC04-098 183gcc atg gcc gaa gtg cag ctg gtg cag tct ggg gga ggc gcg gtc cag 48Ala Met Ala Glu Val Gln Leu Val Gln Ser Gly Gly Gly Ala Val Gln1 5

10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gct gtt ata tta tat gat gga agt gat aaa ttc tat gca 192Glu Trp Val Ala Val Ile Leu Tyr Asp Gly Ser Asp Lys Phe Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg cag atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa gta gca gtg gct ggt acg cac ttt gac tac tgg 336Tyr Tyr Cys Ala Lys Val Ala Val Ala Gly Thr His Phe Asp Tyr Trp 100 105 110ggc cag gga acc ctg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc 384Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125gga acc ggc agc ggc act ggc ggg tcg acg gac atc cag atg acc cag 432Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Met Thr Gln 130 135 140tct cca tcc tcc ctg tct gca tct gta gga gac aga gtc acc atc act 480Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160tgc cgg gca agt cag ggc att aga aat gat tta ggc tgg tat cag cag 528Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp Leu Gly Trp Tyr Gln Gln 165 170 175aaa cca ggg aaa gcc cct aag ctc ctg atc tat gct gca tcc agt ttg 576Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu 180 185 190caa agt ggg gtc cca tca agg ttc agc ggc agt gga tct ggg aca gat 624Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205ttc act ctc acc atc agc agc ctg cag cct gaa gat ttt gca act tat 672Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220tac tgt caa cag ctt aat agt tac cct ccc act ttc ggc gga ggg acc 720Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Pro Thr Phe Gly Gly Gly Thr225 230 235 240aag gtg gaa atc aaa cgt gcg gcc gca 747Lys Val Glu Ile Lys Arg Ala Ala Ala 245184249PRTArtificial sequenceSynthetic Construct 184Ala Met Ala Glu Val Gln Leu Val Gln Ser Gly Gly Gly Ala Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Val Ile Leu Tyr Asp Gly Ser Asp Lys Phe Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Val Ala Val Ala Gly Thr His Phe Asp Tyr Trp 100 105 110Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Met Thr Gln 130 135 140Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp Leu Gly Trp Tyr Gln Gln 165 170 175Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu 180 185 190Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Pro Thr Phe Gly Gly Gly Thr225 230 235 240Lys Val Glu Ile Lys Arg Ala Ala Ala 245185747DNAArtificial sequenceSC04-103 185gcc atg gcc cag gtg cag ctg cag gag tcg ggg gga ggc gtg gtc cag 48Ala Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Val Val Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca gtt ata tta tat gat gga agt gat aaa tac tat gca 192Glu Trp Val Ala Val Ile Leu Tyr Asp Gly Ser Asp Lys Tyr Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa gtc gct gtg gct ggg gaa agc ttt gac tcc tgg 336Tyr Tyr Cys Ala Lys Val Ala Val Ala Gly Glu Ser Phe Asp Ser Trp 100 105 110ggc cgg ggc acc ctg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc 384Gly Arg Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125gga acc ggc agc ggc act ggc ggg tcg acg gac atc cag ttg acc cag 432Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu Thr Gln 130 135 140tct cca tct tcc gtg tct gca tct gta gga gac aga gtc acc atc act 480Ser Pro Ser Ser Val Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160tgt cgg gcg agt cag ggt att agc agc tgg tta gcc tgg tat cag cag 528Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp Leu Ala Trp Tyr Gln Gln 165 170 175aag cca ggg aaa gcc cct agg tcc ctg atc tat gat gca tcc agt ttg 576Lys Pro Gly Lys Ala Pro Arg Ser Leu Ile Tyr Asp Ala Ser Ser Leu 180 185 190caa agt ggg gtc cca tca agg ttc agc ggc agt gga tct ggg aca gac 624Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205ttt act ctc acc atc agc agc ctg cag cct gaa gat ttt gca act tac 672Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220tat tgt caa cag gct gac agt ttc ccg atc acc ttc ggc caa ggg aca 720Tyr Cys Gln Gln Ala Asp Ser Phe Pro Ile Thr Phe Gly Gln Gly Thr225 230 235 240cga ctg gag att aaa cgt gcg gcc gca 747Arg Leu Glu Ile Lys Arg Ala Ala Ala 245186249PRTArtificial sequenceSynthetic Construct 186Ala Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Val Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Val Ile Leu Tyr Asp Gly Ser Asp Lys Tyr Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Val Ala Val Ala Gly Glu Ser Phe Asp Ser Trp 100 105 110Gly Arg Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu Thr Gln 130 135 140Ser Pro Ser Ser Val Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp Leu Ala Trp Tyr Gln Gln 165 170 175Lys Pro Gly Lys Ala Pro Arg Ser Leu Ile Tyr Asp Ala Ser Ser Leu 180 185 190Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220Tyr Cys Gln Gln Ala Asp Ser Phe Pro Ile Thr Phe Gly Gln Gly Thr225 230 235 240Arg Leu Glu Ile Lys Arg Ala Ala Ala 245187759DNAArtificial sequenceSC04-104 187gcc atg gcc cag gtg cag ctg cag gag tcg ggg gga ggc gtg gtc cag 48Ala Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Val Val Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca act ata tca tat gat gga aat gtt aaa gac tat gca 192Glu Trp Val Ala Thr Ile Ser Tyr Asp Gly Asn Val Lys Asp Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga act gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa ata gtg gtg gtg acc gcc ctc gat gct ttt gat 336Tyr Tyr Cys Ala Lys Ile Val Val Val Thr Ala Leu Asp Ala Phe Asp 100 105 110atc tgg ggc caa ggg aca atg gtc acc gtc tcg agc ggt acg ggc ggt 384Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly 115 120 125tca ggc gga acc ggc agc ggc act ggc ggg tcg acg gac atc cag ttg 432Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu 130 135 140acc cag tct cct tcc acc ctg tct gca tct gta gga gac aga gtc acc 480Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly Asp Arg Val Thr145 150 155 160atc act tgc cgg gcc agt cag att ctt ggt cac tgg ttg ccc ttg tcc 528Ile Thr Cys Arg Ala Ser Gln Ile Leu Gly His Trp Leu Pro Leu Ser 165 170 175tgg tat cag cag aaa cca ggt aaa gcc cct aaa ctc ctg atc tct aag 576Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Ser Lys 180 185 190gcg tct agt tta gaa agt gga gtc cca cca agg ttc agc ggc agt gga 624Ala Ser Ser Leu Glu Ser Gly Val Pro Pro Arg Phe Ser Gly Ser Gly 195 200 205tct ggg tca gat ttc act ctc acc atc agc agc ctg cag ccc gat gat 672Ser Gly Ser Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Asp Asp 210 215 220ttt gca act tat tac tgc ctc caa tat cat gag tac ccg ctc acc ttc 720Phe Ala Thr Tyr Tyr Cys Leu Gln Tyr His Glu Tyr Pro Leu Thr Phe225 230 235 240ggc gga ggg acc aag ctg gag atc aaa cgt gcg gcc gca 759Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Ala Ala 245 250188253PRTArtificial sequenceSynthetic Construct 188Ala Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Val Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Thr Ile Ser Tyr Asp Gly Asn Val Lys Asp Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Ile Val Val Val Thr Ala Leu Asp Ala Phe Asp 100 105 110Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly 115 120 125Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu 130 135 140Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly Asp Arg Val Thr145 150 155 160Ile Thr Cys Arg Ala Ser Gln Ile Leu Gly His Trp Leu Pro Leu Ser 165 170 175Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Ser Lys 180 185 190Ala Ser Ser Leu Glu Ser Gly Val Pro Pro Arg Phe Ser Gly Ser Gly 195 200 205Ser Gly Ser Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Asp Asp 210 215 220Phe Ala Thr Tyr Tyr Cys Leu Gln Tyr His Glu Tyr Pro Leu Thr Phe225 230 235 240Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Ala Ala 245 250189750DNAArtificial sequenceSC04-108 189gcc atg gcc gaa gtg cag ctg gtg cag tct ggg gga ggc ttg gta cag 48Ala Met Ala Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln1 5 10 15cct ggg ggg tcc ctg aga ctc tcc tgt gca gcg tct gga ttc acc ttc 96Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca gtt ata tta tat gat gga agt gat aag ttc tat gca 192Glu Trp Val Ala Val Ile Leu Tyr Asp Gly Ser Asp Lys Phe Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc atc tcc aga gac aat tcc aag gac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asp65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa ttt atg ata gta gca gat gat gct ttt gat atc 336Tyr Tyr Cys Ala Lys Phe Met Ile Val Ala Asp Asp Ala Phe Asp Ile 100 105 110tgg ggc caa ggg aca atg gtc acc gtc tcg agc ggt acg ggc ggt tca 384Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser 115 120 125ggc gga acc ggc agc ggc act ggc ggg tcg acg gac atc cag ttg acc 432Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu Thr 130 135 140cag tct cca tcc tca ctg tct gca tct gta gga gac aga gtc acc atc 480Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile145 150 155 160act tgt cgg gcg agt cag ggc att agc agt cat tta gtc tgg tat cag 528Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser His Leu Val Trp Tyr Gln 165 170 175cag aaa cca ggg aaa gcc cct aag tcc ctg atc tat gct gca tcc agt 576Gln Lys Pro Gly Lys Ala Pro Lys Ser Leu Ile Tyr Ala Ala Ser Ser 180 185 190ttg caa agt ggg gtc cca tca agg ttc agc ggc agt gaa tct gcg aca 624Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Glu Ser Ala Thr 195 200 205gat ttc act ctc acc atc agc agc ctg cag cct gaa gat ttt gca act 672Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr 210 215 220tat tac tgc caa cag tat tac agt tac cct atc acc ttc ggc caa ggg 720Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Ile Thr Phe Gly Gln Gly225 230 235 240aca cga ctg gag att aaa cgt gcg gcc gca 750Thr Arg Leu Glu Ile Lys Arg Ala Ala Ala 245 250190250PRTArtificial sequenceSynthetic Construct 190Ala Met Ala Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln1 5 10 15Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Val Ile Leu Tyr Asp Gly Ser Asp Lys Phe Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asp65 70 75 80Thr Leu Tyr Leu

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Phe Met Ile Val Ala Asp Asp Ala Phe Asp Ile 100 105 110Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser 115 120 125Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu Thr 130 135 140Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile145 150 155 160Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser His Leu Val Trp Tyr Gln 165 170 175Gln Lys Pro Gly Lys Ala Pro Lys Ser Leu Ile Tyr Ala Ala Ser Ser 180 185 190Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Glu Ser Ala Thr 195 200 205Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr 210 215 220Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Ile Thr Phe Gly Gln Gly225 230 235 240Thr Arg Leu Glu Ile Lys Arg Ala Ala Ala 245 250191744DNAArtificial sequenceSC04-120 191gcc atg gcc gag gtg cag ctg gtg cag tct ggg gga ggc ttg gta cag 48Ala Met Ala Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln1 5 10 15cct ggc agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt acc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Thr Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca act ata tca tat gat gga agt att aaa gac tat gca 192Glu Trp Val Ala Thr Ile Ser Tyr Asp Gly Ser Ile Lys Asp Tyr Ala 50 55 60gac tcc gag aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Glu Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa ggg ggg aag act gga gag ttt gac tac tgg ggc 336Tyr Tyr Cys Ala Lys Gly Gly Lys Thr Gly Glu Phe Asp Tyr Trp Gly 100 105 110cag gga acc ctg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc gga 384Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly Gly 115 120 125acc ggc agc ggc act ggc ggg tcg acg gac atc cag ttg acc cag tct 432Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu Thr Gln Ser 130 135 140cct tcc acc ctg tct gca tct gta gga gac aga gtc acc atc act tgc 480Pro Ser Thr Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys145 150 155 160cgg gcc agt cag ggc att aac agt tat tta gcc tgg tat cag caa gaa 528Arg Ala Ser Gln Gly Ile Asn Ser Tyr Leu Ala Trp Tyr Gln Gln Glu 165 170 175cca ggg aaa gcc cct aaa ctc ctg atc tat gct gca tcc act ttg caa 576Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr Leu Gln 180 185 190agt ggg gtc cca tca agg ttc agc ggc agt gga tct ggg aca gaa ttc 624Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe 195 200 205act ctc aca atc agc agc ctg cag cct gaa gat ttt gca act tat tac 672Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr 210 215 220tgt caa cag ctt aat agt tac ccc ttc act ttc ggc cct ggg acc aaa 720Cys Gln Gln Leu Asn Ser Tyr Pro Phe Thr Phe Gly Pro Gly Thr Lys225 230 235 240gtg gat atc aaa cgt gcg gcc gca 744Val Asp Ile Lys Arg Ala Ala Ala 245192248PRTArtificial sequenceSynthetic Construct 192Ala Met Ala Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Thr Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Thr Ile Ser Tyr Asp Gly Ser Ile Lys Asp Tyr Ala 50 55 60Asp Ser Glu Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Gly Gly Lys Thr Gly Glu Phe Asp Tyr Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly Gly 115 120 125Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu Thr Gln Ser 130 135 140Pro Ser Thr Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys145 150 155 160Arg Ala Ser Gln Gly Ile Asn Ser Tyr Leu Ala Trp Tyr Gln Gln Glu 165 170 175Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr Leu Gln 180 185 190Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe 195 200 205Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr 210 215 220Cys Gln Gln Leu Asn Ser Tyr Pro Phe Thr Phe Gly Pro Gly Thr Lys225 230 235 240Val Asp Ile Lys Arg Ala Ala Ala 245193747DNAArtificial sequenceSC04-125 193gcc atg gcc cag gtg cag ctg gtg gag tct ggg gga ggc gtg gtc cag 48Ala Met Ala Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca gtt ata tca tat gat gga agt gat aaa tac tat gca 192Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Asp Lys Tyr Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctc tat ctg caa atg aac agc ttg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aag ata gca aca gct ggt acc ggg ttt gac tac tgg 336Tyr Tyr Cys Ala Lys Ile Ala Thr Ala Gly Thr Gly Phe Asp Tyr Trp 100 105 110ggc cag gga acc ctg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc 384Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125gga acc ggc agc ggc act ggc ggg tcg acg gac atc cag atg acc cag 432Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Met Thr Gln 130 135 140tct cca tct tcc gtg tct gca tct gta gga gac aga gtc acc atc act 480Ser Pro Ser Ser Val Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160tgt cgg gcg agt cag ggc att agc agt tat tta gcc tgg tat cag caa 528Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr Leu Ala Trp Tyr Gln Gln 165 170 175aaa cca ggg aaa gcc cct aag ctc ctg atc tat gat gcc tcc agt ttg 576Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Asp Ala Ser Ser Leu 180 185 190gaa agt ggg gtc cca tca agg ttc agc ggc agt gga tct ggg aca gaa 624Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu 195 200 205ttc act ctc acc atc agc agc ctg cag cct gat gat ttt gca act tat 672Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Asp Asp Phe Ala Thr Tyr 210 215 220tac tgt caa caa ctt aac agt tac cca ctc act ttc ggc gga ggg acc 720Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr225 230 235 240aag gtg gag atc aaa cgt gcg gcc gca 747Lys Val Glu Ile Lys Arg Ala Ala Ala 245194249PRTArtificial sequenceSynthetic Construct 194Ala Met Ala Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Asp Lys Tyr Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Ile Ala Thr Ala Gly Thr Gly Phe Asp Tyr Trp 100 105 110Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Met Thr Gln 130 135 140Ser Pro Ser Ser Val Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr Leu Ala Trp Tyr Gln Gln 165 170 175Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Asp Ala Ser Ser Leu 180 185 190Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu 195 200 205Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Asp Asp Phe Ala Thr Tyr 210 215 220Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr225 230 235 240Lys Val Glu Ile Lys Arg Ala Ala Ala 245195756DNAArtificial sequenceSC04-126 195gcc atg gcc cag gtc acc ttg aag gag tct ggt ccc acg ctg gtg aac 48Ala Met Ala Gln Val Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Asn1 5 10 15ccc aca cag acc ctc acg ttg acc tgc acc ttc tct ggg ttc tcg ctc 96Pro Thr Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu 20 25 30agc act ggt gga gtg ggt gtg ggc tgg ttc cgt cag ccc cca ggg aag 144Ser Thr Gly Gly Val Gly Val Gly Trp Phe Arg Gln Pro Pro Gly Lys 35 40 45gcc ctg gag tgg ctt gca cgc att gat tgg gat gat gat aaa tac tac 192Ala Leu Glu Trp Leu Ala Arg Ile Asp Trp Asp Asp Asp Lys Tyr Tyr 50 55 60agc aca tct ctg aag acc agg ctc acc atc tcc aag gac acc tcc aaa 240Ser Thr Ser Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys65 70 75 80atc cag gtg gtc ctt aca atg acc aac atg gac cct gtg gac aca gcc 288Ile Gln Val Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala 85 90 95acg tat tac tgt gca cgg atg ggt ttc act gga acc tac ttt gac tac 336Thr Tyr Tyr Cys Ala Arg Met Gly Phe Thr Gly Thr Tyr Phe Asp Tyr 100 105 110tgg ggc cag ggc acc ctg gtc acc gtc tcg agc ggt acg ggc ggt tca 384Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser 115 120 125ggc gga acc ggc agc ggc act ggc ggg tcg acg cag tct gtg ctg act 432Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Gln Ser Val Leu Thr 130 135 140cag cca ccc tca gtg tca gtg gcc cca gga aag acg gcc agg att acc 480Gln Pro Pro Ser Val Ser Val Ala Pro Gly Lys Thr Ala Arg Ile Thr145 150 155 160tgt ggg gga aac aac att gga agt aaa agt gtg cac tgg tac cag cag 528Cys Gly Gly Asn Asn Ile Gly Ser Lys Ser Val His Trp Tyr Gln Gln 165 170 175aag cca ggc cag gcc cct gtg ctg gtc atc tat tat gat agc gac cgg 576Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr Tyr Asp Ser Asp Arg 180 185 190ccc tca ggg atc cct gag cga ttc tct ggc tcc aac tct ggg aac acg 624Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Asn Ser Gly Asn Thr 195 200 205gcc acc ctg acc atc agc agg gtc gaa gcc ggg gat gag gct gac tat 672Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly Asp Glu Ala Asp Tyr 210 215 220tac tgt cag gtg tgg gat agt agt agt gat cat ccc tat gtc ttc gga 720Tyr Cys Gln Val Trp Asp Ser Ser Ser Asp His Pro Tyr Val Phe Gly225 230 235 240act ggg acc aag ctg acc gtc cta ggt gcg gcc gca 756Thr Gly Thr Lys Leu Thr Val Leu Gly Ala Ala Ala 245 250196252PRTArtificial sequenceSynthetic Construct 196Ala Met Ala Gln Val Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Asn1 5 10 15Pro Thr Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu 20 25 30Ser Thr Gly Gly Val Gly Val Gly Trp Phe Arg Gln Pro Pro Gly Lys 35 40 45Ala Leu Glu Trp Leu Ala Arg Ile Asp Trp Asp Asp Asp Lys Tyr Tyr 50 55 60Ser Thr Ser Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys65 70 75 80Ile Gln Val Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala 85 90 95Thr Tyr Tyr Cys Ala Arg Met Gly Phe Thr Gly Thr Tyr Phe Asp Tyr 100 105 110Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser 115 120 125Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Gln Ser Val Leu Thr 130 135 140Gln Pro Pro Ser Val Ser Val Ala Pro Gly Lys Thr Ala Arg Ile Thr145 150 155 160Cys Gly Gly Asn Asn Ile Gly Ser Lys Ser Val His Trp Tyr Gln Gln 165 170 175Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr Tyr Asp Ser Asp Arg 180 185 190Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Asn Ser Gly Asn Thr 195 200 205Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Gln Val Trp Asp Ser Ser Ser Asp His Pro Tyr Val Phe Gly225 230 235 240Thr Gly Thr Lys Leu Thr Val Leu Gly Ala Ala Ala 245 250197747DNAArtificial sequenceSC04-140 197gcc atg gcc cag atg cag ctg gtg cag tct ggg gga ggc gtg gtc cag 48Ala Met Ala Gln Met Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca gtt ata tta tat gat gga agt aat aaa tac tat gca 192Glu Trp Val Ala Val Ile Leu Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80gcg ttg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Ala Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aag gtg acc aac ccc gga gat gct ttt gat atc tgg 336Tyr Tyr Cys Ala Lys Val Thr Asn Pro Gly Asp Ala Phe Asp Ile Trp 100 105 110ggc caa ggg acc atg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc 384Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125gga acc ggc agc ggc act ggc ggg tcg acg gac atc cag atg acc cag 432Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Met Thr Gln 130 135 140tct cca tcc tcc ctg tct gca tct gtc gga gac aga gtc acc atc act 480Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160tgc cgg gca agt cag ggc att agc agt gct tta gcc tgg tat cag cag 528Cys Arg Ala Ser Gln Gly Ile Ser Ser Ala Leu Ala Trp Tyr Gln Gln 165 170 175aaa cca ggg aaa gct cct aag ctc ctg atc tat gat gcc tcc agt ttg 576Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

Tyr Asp Ala Ser Ser Leu 180 185 190gaa agt ggg gtc cca tca agg ttc agc ggc agt gga tct ggg aca gat 624Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205ttc act ctc acc atc agc agc ctg cag cct gaa gat ttt gca act tat 672Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220tac tgt caa cag ttt aat agt tac ccg ctc act ttc ggc gga ggg acc 720Tyr Cys Gln Gln Phe Asn Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr225 230 235 240aag gtg gaa atc aaa cgt gcg gcc gca 747Lys Val Glu Ile Lys Arg Ala Ala Ala 245198249PRTArtificial sequenceSynthetic Construct 198Ala Met Ala Gln Met Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Val Ile Leu Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Ala Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Val Thr Asn Pro Gly Asp Ala Phe Asp Ile Trp 100 105 110Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Met Thr Gln 130 135 140Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160Cys Arg Ala Ser Gln Gly Ile Ser Ser Ala Leu Ala Trp Tyr Gln Gln 165 170 175Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Asp Ala Ser Ser Leu 180 185 190Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220Tyr Cys Gln Gln Phe Asn Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr225 230 235 240Lys Val Glu Ile Lys Arg Ala Ala Ala 245199744DNAArtificial sequenceSC04-144 199gcc atg gcc cag gtg cag ctg cag gag ttg ggg gga ggc gtg gtc cag 48Ala Met Ala Gln Val Gln Leu Gln Glu Leu Gly Gly Gly Val Val Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30ggt agc tat ggc atg cac tgg gtc cgc cag gct ccg ggc aag ggg ctg 144Gly Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca act ata tca tat gat gga agt att aaa gac tat gca 192Glu Trp Val Ala Thr Ile Ser Tyr Asp Gly Ser Ile Lys Asp Tyr Ala 50 55 60gac tcc gag aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Glu Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80aca ctg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa ggg ggg aag act gga gag ttt gac tac tgg ggc 336Tyr Tyr Cys Ala Lys Gly Gly Lys Thr Gly Glu Phe Asp Tyr Trp Gly 100 105 110cag gga acc ctg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc gga 384Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly Gly 115 120 125acc ggc agc ggc act ggc ggg tcg acg gac atc cag ttg acg cag tct 432Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu Thr Gln Ser 130 135 140cca tcc tcc ctg tct gca tct gta gga gac aga gtc acc atc act tgc 480Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys145 150 155 160cgg gcc agt cag ggc att agc agt tat tta gcc tgg tat cag caa aaa 528Arg Ala Ser Gln Gly Ile Ser Ser Tyr Leu Ala Trp Tyr Gln Gln Lys 165 170 175cca ggg aaa ggc cct aag ctc ctg atc tat gct gca tcc act tta caa 576Pro Gly Lys Gly Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr Leu Gln 180 185 190agt ggg gtc cca tca agg ttc agc ggc agt gga tct ggg aca gac ttc 624Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe 195 200 205agt ctc acc atc agt agc ctg cag cct gaa gat tta gca act tat tac 672Ser Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Leu Ala Thr Tyr Tyr 210 215 220tgc caa cag tat gat agt tac cct ctc act ttc ggc gga ggg acc aag 720Cys Gln Gln Tyr Asp Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys225 230 235 240gtg gaa atc aaa cgt gcg gcc gca 744Val Glu Ile Lys Arg Ala Ala Ala 245200248PRTArtificial sequenceSynthetic Construct 200Ala Met Ala Gln Val Gln Leu Gln Glu Leu Gly Gly Gly Val Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Gly Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Thr Ile Ser Tyr Asp Gly Ser Ile Lys Asp Tyr Ala 50 55 60Asp Ser Glu Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Gly Gly Lys Thr Gly Glu Phe Asp Tyr Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly Gly 115 120 125Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu Thr Gln Ser 130 135 140Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys145 150 155 160Arg Ala Ser Gln Gly Ile Ser Ser Tyr Leu Ala Trp Tyr Gln Gln Lys 165 170 175Pro Gly Lys Gly Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr Leu Gln 180 185 190Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe 195 200 205Ser Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Leu Ala Thr Tyr Tyr 210 215 220Cys Gln Gln Tyr Asp Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys225 230 235 240Val Glu Ile Lys Arg Ala Ala Ala 245201744DNAArtificial sequenceSC04-146 201gcc atg gcc gaa gtg cag ctg gtg cag tct ggg gga ggc gtg gtc cag 48Ala Met Ala Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agc tat ggc atg cac tgg gtc cgc cag gct ccg ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca act ata tca tat gat gga agt att aaa gac tat gca 192Glu Trp Val Ala Thr Ile Ser Tyr Asp Gly Ser Ile Lys Asp Tyr Ala 50 55 60gac tcc gag gag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Glu Glu Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80aca ctg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa ggg ggg aag act gga gag ttt gac tac tgg ggc 336Tyr Tyr Cys Ala Lys Gly Gly Lys Thr Gly Glu Phe Asp Tyr Trp Gly 100 105 110cag ggc acc ctg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc gga 384Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly Gly 115 120 125acc ggc agc ggc act ggc ggg tcg acg gat gtt gtg atg act cag tct 432Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Val Val Met Thr Gln Ser 130 135 140cca gcc acc ctg tct gtg tct cca ggg gaa agc gcc aca ctc ttc tgc 480Pro Ala Thr Leu Ser Val Ser Pro Gly Glu Ser Ala Thr Leu Phe Cys145 150 155 160agg gcc agt gag agt gtt tat agc aac ttg gcc tgg tat cag cac aaa 528Arg Ala Ser Glu Ser Val Tyr Ser Asn Leu Ala Trp Tyr Gln His Lys 165 170 175cct ggc cgg gct ccc agg ctc ctc atc tat ggt gca tcc acc agg gcc 576Pro Gly Arg Ala Pro Arg Leu Leu Ile Tyr Gly Ala Ser Thr Arg Ala 180 185 190act ggt atc cca gcc agg ttc gat ggc act ggg tct ggg aca gac ttc 624Thr Gly Ile Pro Ala Arg Phe Asp Gly Thr Gly Ser Gly Thr Asp Phe 195 200 205aca ctc acc atc agc agc ctg cag tct gaa gat ttt gca gtt tat tac 672Thr Leu Thr Ile Ser Ser Leu Gln Ser Glu Asp Phe Ala Val Tyr Tyr 210 215 220tgt cag caa tat aat gac tgg ccg atc acc ttc ggc caa ggg aca cga 720Cys Gln Gln Tyr Asn Asp Trp Pro Ile Thr Phe Gly Gln Gly Thr Arg225 230 235 240ctg gag att aaa cgt gcg gcc gca 744Leu Glu Ile Lys Arg Ala Ala Ala 245202248PRTArtificial sequenceSynthetic Construct 202Ala Met Ala Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Thr Ile Ser Tyr Asp Gly Ser Ile Lys Asp Tyr Ala 50 55 60Asp Ser Glu Glu Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Gly Gly Lys Thr Gly Glu Phe Asp Tyr Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly Gly 115 120 125Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Val Val Met Thr Gln Ser 130 135 140Pro Ala Thr Leu Ser Val Ser Pro Gly Glu Ser Ala Thr Leu Phe Cys145 150 155 160Arg Ala Ser Glu Ser Val Tyr Ser Asn Leu Ala Trp Tyr Gln His Lys 165 170 175Pro Gly Arg Ala Pro Arg Leu Leu Ile Tyr Gly Ala Ser Thr Arg Ala 180 185 190Thr Gly Ile Pro Ala Arg Phe Asp Gly Thr Gly Ser Gly Thr Asp Phe 195 200 205Thr Leu Thr Ile Ser Ser Leu Gln Ser Glu Asp Phe Ala Val Tyr Tyr 210 215 220Cys Gln Gln Tyr Asn Asp Trp Pro Ile Thr Phe Gly Gln Gly Thr Arg225 230 235 240Leu Glu Ile Lys Arg Ala Ala Ala 245203747DNAArtificial sequenceSC04-164 203gcc atg gcc gag gtg cag ctg gtg gag tct ggg gga ggc gtg gtc cag 48Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln1 5 10 15cct ggg agg tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttc 96Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30agt agc tat ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg 144Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45gag tgg gtg gca gtt ata tca tat gat gga agc agt aaa tac tac gca 192Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Ser Lys Tyr Tyr Ala 50 55 60gac tcc gtg aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac 240Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80acg ctg tat ctg caa atg aac agc ctg aga gct gag gac acg gct gtg 288Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95tat tac tgt gcg aaa ggg tcc gtc ctc ggt gat gct ttt gat atc tgg 336Tyr Tyr Cys Ala Lys Gly Ser Val Leu Gly Asp Ala Phe Asp Ile Trp 100 105 110ggc caa ggg aca atg gtc acc gtc tcg agc ggt acg ggc ggt tca ggc 384Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125gga acc ggc agc ggc act ggc ggg tcg acg gac atc cag ttg acc cag 432Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu Thr Gln 130 135 140tct cca tct tct gtg tct gca tct gta gga gac aga gtc acc atc act 480Ser Pro Ser Ser Val Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160tgt cgg gcg agt cag ggt att agc agc tgg tta gcc tgg tat cag cag 528Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp Leu Ala Trp Tyr Gln Gln 165 170 175aaa cca ggg aaa gcc cct aag ctc ctg atc tat gct gca tcc agt ttg 576Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu 180 185 190caa agt ggg gtc cca tca agg ttc agc ggc agt gga tct ggg aca gat 624Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205ttc act ctc act atc agc agc ctg cag cct gaa gat ttt gca act tac 672Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220tat tgt caa cag gct aac agt ttc ccg ctc act ttc ggc gga ggg acc 720Tyr Cys Gln Gln Ala Asn Ser Phe Pro Leu Thr Phe Gly Gly Gly Thr225 230 235 240aaa gtg gat atc aaa cgt gcg gcc gca 747Lys Val Asp Ile Lys Arg Ala Ala Ala 245204249PRTArtificial sequenceSynthetic Construct 204Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln1 5 10 15Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 20 25 30Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 35 40 45Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Ser Lys Tyr Tyr Ala 50 55 60Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn65 70 75 80Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Lys Gly Ser Val Leu Gly Asp Ala Phe Asp Ile Trp 100 105 110Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Thr Gly Gly Ser Gly 115 120 125Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Asp Ile Gln Leu Thr Gln 130 135 140Ser Pro Ser Ser Val Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr145 150 155 160Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp Leu Ala Trp Tyr Gln Gln 165 170 175Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu 180 185 190Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220Tyr Cys Gln Gln Ala Asn Ser Phe Pro Leu Thr Phe Gly Gly Gly Thr225 230 235 240Lys Val Asp Ile Lys Arg Ala Ala Ala 245205786DNAArtificial sequenceSO57 205gcc atg gcc cag gtg cag ctg gtg cag agc gga gcc gag gtg aag aag 48Ala Met Ala Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys1 5 10 15ccc ggc agc agc gtg aag gtg agc tgc aag gcc agc ggc ggc acc ttc 96Pro Gly Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe 20 25 30aac agg tac acc gtg aac tgg gtg aga cag gcc cca ggc cag ggc ctg 144Asn Arg Tyr Thr Val Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 40 45gag tgg atg ggc ggc atc atc cct atc ttc ggc acc gcc aac tac gcc 192Glu Trp Met Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala 50 55 60cag aga ttc cag ggc agg ctc acc atc acc gcc gac gag agc acc agc 240Gln Arg Phe Gln Gly Arg Leu Thr Ile Thr Ala Asp Glu Ser Thr Ser65

70 75 80acc gcc tac atg gag ctg agc agc ctg aga agc gat gac acc gcc gtg 288Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Asp Asp Thr Ala Val 85 90 95tac ttc tgc gcc agg gag aac ctg gat aac agc ggc acc tac tac tac 336Tyr Phe Cys Ala Arg Glu Asn Leu Asp Asn Ser Gly Thr Tyr Tyr Tyr 100 105 110ttc agc ggc tgg ttc gac ccc tgg ggc cag ggc acc ctg gtg acc gtc 384Phe Ser Gly Trp Phe Asp Pro Trp Gly Gln Gly Thr Leu Val Thr Val 115 120 125tcg agc ggt acg ggc ggt tca ggc gga acc ggc agc ggc act ggc ggg 432Ser Ser Gly Thr Gly Gly Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly 130 135 140tcg acg cag agc gcc ctc acc cag ccc aga agc gtg agc ggc agc cct 480Ser Thr Gln Ser Ala Leu Thr Gln Pro Arg Ser Val Ser Gly Ser Pro145 150 155 160ggc cag agc gtg acc atc agc tgc acc ggc acc agc agc gac atc ggc 528Gly Gln Ser Val Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Ile Gly 165 170 175ggc tac aac ttc gtg agc tgg tat cag cag cac ccc ggc aag gcc cct 576Gly Tyr Asn Phe Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro 180 185 190aag ctc atg atc tac gac gcc acc aag aga ccc agc ggc gtg ccc gac 624Lys Leu Met Ile Tyr Asp Ala Thr Lys Arg Pro Ser Gly Val Pro Asp 195 200 205aga ttc agc ggc agc aag agc ggc aac acc gcc agc ctc acc atc agc 672Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser 210 215 220gga ctg cag gcc gag gac gag gcc gac tac tac tgc tgc agc tac gcc 720Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Cys Ser Tyr Ala225 230 235 240ggc gac tac acc cct ggc gtg gtg ttc ggc gga ggc acc aag ctt acc 768Gly Asp Tyr Thr Pro Gly Val Val Phe Gly Gly Gly Thr Lys Leu Thr 245 250 255gtg cta ggt gcg gcc gca 786Val Leu Gly Ala Ala Ala 260206262PRTArtificial sequenceSynthetic Construct 206Ala Met Ala Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys1 5 10 15Pro Gly Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe 20 25 30Asn Arg Tyr Thr Val Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu 35 40 45Glu Trp Met Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala 50 55 60Gln Arg Phe Gln Gly Arg Leu Thr Ile Thr Ala Asp Glu Ser Thr Ser65 70 75 80Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Asp Asp Thr Ala Val 85 90 95Tyr Phe Cys Ala Arg Glu Asn Leu Asp Asn Ser Gly Thr Tyr Tyr Tyr 100 105 110Phe Ser Gly Trp Phe Asp Pro Trp Gly Gln Gly Thr Leu Val Thr Val 115 120 125Ser Ser Gly Thr Gly Gly Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly 130 135 140Ser Thr Gln Ser Ala Leu Thr Gln Pro Arg Ser Val Ser Gly Ser Pro145 150 155 160Gly Gln Ser Val Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Ile Gly 165 170 175Gly Tyr Asn Phe Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro 180 185 190Lys Leu Met Ile Tyr Asp Ala Thr Lys Arg Pro Ser Gly Val Pro Asp 195 200 205Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser 210 215 220Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Cys Ser Tyr Ala225 230 235 240Gly Asp Tyr Thr Pro Gly Val Val Phe Gly Gly Gly Thr Lys Leu Thr 245 250 255Val Leu Gly Ala Ala Ala 260207524PRTRabies virusMISC_FEATUREG protein of rabies virus ERA strain 207Met Val Pro Gln Ala Leu Leu Phe Val Pro Leu Leu Val Phe Pro Leu1 5 10 15Cys Phe Gly Lys Phe Pro Ile Tyr Thr Ile Leu Asp Lys Leu Gly Pro 20 25 30Trp Ser Pro Ile Asp Ile His His Leu Ser Cys Pro Asn Asn Leu Val 35 40 45Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr Met Glu 50 55 60Leu Lys Val Gly Tyr Ile Leu Ala Ile Lys Met Asn Gly Phe Thr Cys65 70 75 80Thr Gly Val Val Thr Glu Ala Glu Asn Tyr Thr Asn Phe Val Gly Tyr 85 90 95Val Thr Thr Thr Phe Lys Arg Lys His Phe Arg Pro Thr Pro Asp Ala 100 105 110Cys Arg Ala Ala Tyr Asn Trp Lys Met Ala Gly Asp Pro Arg Tyr Glu 115 120 125Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr Arg Trp Leu Arg Thr Val 130 135 140Lys Thr Thr Lys Glu Ser Leu Val Ile Ile Ser Pro Ser Val Ala Asp145 150 155 160Leu Asp Pro Tyr Asp Arg Ser Leu His Ser Arg Val Phe Pro Ser Gly 165 170 175Lys Cys Ser Gly Val Ala Val Ser Ser Thr Tyr Cys Ser Thr Asn His 180 185 190Asp Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Met Ser Cys 195 200 205Asp Ile Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser Glu 210 215 220Thr Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly225 230 235 240Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu Met Asp 245 250 255Gly Thr Trp Val Ala Met Gln Thr Ser Asn Glu Thr Lys Trp Cys Pro 260 265 270Pro Asp Gln Leu Val Asn Leu His Asp Phe Arg Ser Asp Glu Ile Glu 275 280 285His Leu Val Val Glu Glu Leu Val Arg Lys Arg Glu Glu Cys Leu Asp 290 295 300Ala Leu Glu Ser Ile Met Thr Thr Lys Ser Val Ser Phe Arg Arg Leu305 310 315 320Ser His Leu Arg Lys Leu Val Pro Gly Phe Gly Lys Ala Tyr Thr Ile 325 330 335Phe Asn Lys Thr Leu Met Glu Ala Asp Ala His Tyr Lys Ser Val Arg 340 345 350Thr Trp Asn Glu Ile Leu Pro Ser Lys Gly Cys Leu Arg Val Gly Gly 355 360 365Arg Cys His Pro His Val Asn Gly Val Phe Phe Asn Gly Ile Ile Leu 370 375 380Gly Pro Asp Gly Asn Val Leu Ile Pro Glu Met Gln Ser Ser Leu Leu385 390 395 400Gln Gln His Met Glu Leu Leu Glu Ser Ser Val Ile Pro Leu Val His 405 410 415Pro Leu Ala Asp Pro Ser Thr Val Phe Lys Asp Gly Asp Glu Ala Glu 420 425 430Asp Phe Val Glu Val His Leu Pro Asp Val His Asn Gln Val Ser Gly 435 440 445Val Asp Leu Gly Leu Pro Asn Trp Gly Lys Tyr Val Leu Leu Ser Ala 450 455 460Gly Ala Leu Thr Ala Leu Met Leu Ile Ile Phe Leu Met Thr Cys Cys465 470 475 480Arg Arg Val Asn Arg Ser Glu Pro Thr Gln His Asn Leu Arg Gly Thr 485 490 495Gly Arg Glu Val Ser Val Thr Pro Gln Ser Gly Lys Ile Ile Ser Ser 500 505 510Trp Glu Ser His Lys Ser Gly Gly Glu Thr Arg Leu 515 52020823DNAArtificial sequencePrimer HuVlambda1A 208cagtctgtgc tgactcagcc acc 2320923DNAArtificial sequencePrimer HuVlambda1B 209cagtctgtgy tgacgcagcc gcc 2321023DNAArtificial sequencePrimer HuVlambda1C 210cagtctgtcg tgacgcagcc gcc 2321121DNAArtificial sequencePrimer HuVlambda2 211cartctgccc tgactcagcc t 2121223DNAArtificial sequencePrimer HuVlambda3A 212tcctatgwgc tgactcagcc acc 2321323DNAArtificial sequencePrimer HuVlambda3B 213tcttctgagc tgactcagga ccc 2321423DNAArtificial sequencePrimer HuVlambda4 214cacgttatac tgactcaacc gcc 2321523DNAArtificial sequencePrimer HuVlambda5 215caggctgtgc tgactcagcc gtc 2321623DNAArtificial sequencePrimer HuVlambda6 216aattttatgc tgactcagcc cca 2321723DNAArtificial sequencePrimer HuVlambda7/8 217cagrctgtgg tgacycagga gcc 2321823DNAArtificial sequencePrimer HuVlambda9 218cwgcctgtgc tgactcagcc mcc 2321923DNAArtificial sequencePrimer HuVkappa1B 219gacatccagw tgacccagtc tcc 2322023DNAArtificial sequencePrimer HuVkappa2 220gatgttgtga tgactcagtc tcc 2322123DNAArtificial sequencePrimer HuVkappa3 221gaaattgtgw tgacrcagtc tcc 2322223DNAArtificial sequencePrimer HuVkappa4 222gatattgtga tgacccacac tcc 2322323DNAArtificial sequencePrimer HuVkappa5 223gaaacgacac tcacgcagtc tcc 2322423DNAArtificial sequencePrimer HuVkappa6 224gaaattgtgc tgactcagtc tcc 2322541DNAArtificial sequencePrimer HuVkappa1B-SalI 225tgagcacaca ggtcgacgga catccagwtg acccagtctc c 4122641DNAArtificial sequencePrimer HuVkappa2-SalI 226tgagcacaca ggtcgacgga tgttgtgatg actcagtctc c 4122741DNAArtificial sequencePrimer HuVkappa3B-SalI 227tgagcacaca ggtcgacgga aattgtgwtg acrcagtctc c 4122841DNAArtificial sequencePrimer HuVkappa4B-SalI 228tgagcacaca ggtcgacgga tattgtgatg acccacactc c 4122941DNAArtificial sequencePrimer HuVkappa5-SalI 229tgagcacaca ggtcgacgga aacgacactc acgcagtctc c 4123041DNAArtificial sequencePrimer HuVkappa6-SalI 230tgagcacaca ggtcgacgga aattgtgctg actcagtctc c 4123148DNAArtificial sequencePrimer HuJkappa1-NotI 231gagtcattct cgacttgcgg ccgcacgttt gatttccacc ttggtccc 4823248DNAArtificial sequencePrimer HuJkappa2-NotI 232gagtcattct cgacttgcgg ccgcacgttt gatctccagc ttggtccc 4823348DNAArtificial sequencePrimer HuJkappa3-NotI 233gagtcattct cgacttgcgg ccgcacgttt gatatccact ttggtccc 4823448DNAArtificial sequencePrimer HuJkappa4-NotI 234gagtcattct cgacttgcgg ccgcacgttt gatctccacc ttggtccc 4823548DNAArtificial sequencePrimer HuJkappa5-NotI 235gagtcattct cgacttgcgg ccgcacgttt aatctccagt cgtgtccc 4823641DNAArtificial sequencePrimer HuVlambda1A-SalI 236tgagcacaca ggtcgacgca gtctgtgctg actcagccac c 4123741DNAArtificial sequencePrimer HuVlambda1B-SalI 237tgagcacaca ggtcgacgca gtctgtgytg acgcagccgc c 4123841DNAArtificial sequencePrimer HuVlambda1C-SalI 238tgagcacaca ggtcgacgca gtctgtcgtg acgcagccgc c 4123939DNAArtificial sequencePrimer HuVlambda2-SalI 239tgagcacaca ggtcgacgca rtctgccctg actcagcct 3924041DNAArtificial sequencePrimer HuVlambda3A-SalI 240tgagcacaca ggtcgacgtc ctatgwgctg actcagccac c 4124141DNAArtificial sequencePrimer HuVlambda3B-SalI 241tgagcacaca ggtcgacgtc ttctgagctg actcaggacc c 4124241DNAArtificial sequencePrimer HuVlambda4-SalI 242tgagcacaca ggtcgacgca cgttatactg actcaaccgc c 4124341DNAArtificial sequencePrimer HuVlambda5-SalI 243tgagcacaca ggtcgacgca ggctgtgctg actcagccgt c 4124441DNAArtificial sequencePrimer HuVlambda6-SalI 244tgagcacaca ggtcgacgaa ttttatgctg actcagcccc a 4124541DNAArtificial sequencePrimer HuVlambda7/8-SalI 245tgagcacaca ggtcgacgca grctgtggtg acycaggagc c 4124641DNAArtificial sequencePrimer HuVlambda9-SalI 246tgagcacaca ggtcgacgcw gcctgtgctg actcagccmc c 4124748DNAArtificial sequencePrimer HuJlambda1-NotI 247gagtcattct cgacttgcgg ccgcacctag gacggtgacc ttggtccc 4824848DNAArtificial sequencePrimer HuJlambda2/3-NotI 248gagtcattct cgacttgcgg ccgcacctag gacggtcagc ttggtccc 4824948DNAArtificial sequencePrimer HuJlambda4/5-NotI 249gagtcattct cgacttgcgg ccgcacytaa aacggtgagc tgggtccc 4825023DNAArtificial sequencePrimer HuVH1B/7A 250cagrtgcagc tggtgcartc tgg 2325123DNAArtificial sequencePrimer HuVH1C 251saggtccagc tggtrcagtc tgg 2325223DNAArtificial sequencePrimer HuVH2B 252saggtgcagc tggtggagtc tgg 2325323DNAArtificial sequencePrimer HuVH3B 253saggtgcagc tggtggagtc tgg 2325423DNAArtificial sequencePrimer HuVH3C 254gaggtgcagc tggtggagwc ygg 2325523DNAArtificial sequencePrimer HuVH4B 255caggtgcagc tacagcagtg ggg 2325623DNAArtificial sequencePrimer HuVH4C 256cagstgcagc tgcaggagtc sgg 2325723DNAArtificial sequencePrimer HuVH5B 257gargtgcagc tggtgcagtc tgg 2325823DNAArtificial sequencePrimer HuVH6A 258caggtacagc tgcagcagtc agg 2325956DNAArtificial sequencePrimer HuVH1B/7A-SfiI 259gtcctcgcaa ctgcggccca gccggccatg gcccagrtgc agctggtgca rtctgg 5626056DNAArtificial sequencePrimer HuVH1C-SfiI 260gtcctcgcaa ctgcggccca gccggccatg gccsaggtcc agctggtrca gtctgg 5626156DNAArtificial sequencePrimer HuVH2B-SfiI 261gtcctcgcaa ctgcggccca gccggccatg gcccagrtca ccttgaagga gtctgg 5626256DNAArtificial sequencePrimer HuVH3B-SfiI 262gtcctcgcaa ctgcggccca gccggccatg gccsaggtgc agctggtgga gtctgg 5626356DNAArtificial sequencePrimer HuVH3C-SfiI 263gtcctcgcaa ctgcggccca gccggccatg gccgaggtgc agctggtgga gwcygg 5626456DNAArtificial sequencePrimer HuVH4B-SfiI 264gtcctcgcaa ctgcggccca gccggccatg gcccaggtgc agctacagca gtgggg 5626556DNAArtificial sequencePrimer HuVH4C-SfiI 265gtcctcgcaa ctgcggccca gccggccatg gcccagstgc agctgcagga gtcsgg 5626656DNAArtificial sequencePrimer HuVH5B-SfiI 266gtcctcgcaa ctgcggccca gccggccatg gccgargtgc agctggtgca gtctgg 5626756DNAArtificial sequencePrimer HuVH6A-SfiI 267gtcctcgcaa ctgcggccca gccggccatg gcccaggtac agctgcagca gtcagg 5626836DNAArtificial sequencePrimer HuJH1/2-XhoI 268gagtcattct cgactcgaga cggtgaccag ggtgcc 3626936DNAArtificial sequencePrimer HuJH3-XhoI 269gagtcattct cgactcgaga cggtgaccat tgtccc 3627036DNAArtificial sequencePrimer HuJH4/5-XhoI 270gagtcattct cgactcgaga cggtgaccag ggttcc 3627136DNAArtificial sequencePrimer HuJH6-XhoI 271gagtcattct cgactcgaga cggtgaccgt ggtccc 36272381DNAArtificial sequenceHeavy chain variable region of CR57 272caggtgcagc tggtgcagag cggagccgag gtgaagaagc ccggcagcag cgtgaaggtg 60agctgcaagg ccagcggcgg caccttcaac aggtacaccg tgaactgggt gagacaggcc 120ccaggccagg gcctggagtg gatgggcggc atcatcccta tcttcggcac cgccaactac 180gcccagagat tccagggcag gctcaccatc accgccgacg agagcaccag caccgcctac 240atggagctga gcagcctgag aagcgatgac accgccgtgt acttctgcgc cagggagaac 300ctggataaca gcggcaccta ctactacttc agcggctggt tcgacccctg gggccagggc 360accctggtga ccgtgagctc a 381273127PRTArtificial sequenceHeavy chain variable region of CR57 273Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Asn Arg Tyr 20 25 30Thr Val Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Arg Phe 50 55 60Gln Gly Arg Leu Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Phe Cys 85 90 95Ala Arg Glu Asn Leu Asp Asn Ser Gly Thr Tyr Tyr Tyr Phe Ser Gly 100 105 110Trp Phe Asp Pro Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125274336DNAArtificial sequenceLight chain variable region of CR57 274cagagcgccc tcacccagcc cagaagcgtg agcggcagcc ctggccagag cgtgaccatc

60agctgcaccg gcaccagcag cgacatcggc ggctacaact tcgtgagctg gtatcagcag 120caccccggca aggcccctaa gctcatgatc tacgacgcca ccaagagacc cagcggcgtg 180cccgacagat tcagcggcag caagagcggc aacaccgcca gcctcaccat cagcggactg 240caggccgagg acgaggccga ctactactgc tgcagctacg ccggcgacta cacccctggc 300gtggtgttcg gcggaggcac caagcttacc gtccta 336275112PRTArtificial sequenceLight chain variable region of CR57 275Gln Ser Ala Leu Thr Gln Pro Arg Ser Val Ser Gly Ser Pro Gly Gln1 5 10 15Ser Val Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Ile Gly Gly Tyr 20 25 30Asn Phe Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 35 40 45Met Ile Tyr Asp Ala Thr Lys Arg Pro Ser Gly Val Pro Asp Arg Phe 50 55 60Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu65 70 75 80Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Cys Ser Tyr Ala Gly Asp 85 90 95Tyr Thr Pro Gly Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 11027612PRTArtificial sequenceCDR3 of CRJB 276Arg Gln His Ile Ser Ser Phe Pro Trp Phe Asp Ser1 5 102776778DNAArtificial sequenceVector pSyn-C03-HCgamma1 277gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180ttagggttag gcgttttgcg ctgcttcgct aggtggtcaa tattggccat tagccatatt 240attcattggt tatatagcat aaatcaatat tggctattgg ccattgcata cgttgtatcc 300atatcataat atgtacattt atattggctc atgtccaaca ttaccgccat gttgacattg 360attattgact agttattaat agtaatcaat tacggggtca ttagttcata gcccatatat 420ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc 480ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag ggactttcca 540ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac atcaagtgta 600tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg cctggcatta 660tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg tattagtcat 720cgctattacc atggtgatgc ggttttggca gtacatcaat gggcgtggat agcggtttga 780ctcacgggga tttccaagtc tccaccccat tgacgtcaat gggagtttgt tttggcacca 840aaatcaacgg gactttccaa aatgtcgtaa caactccgcc ccattgacgc aaatgggcgg 900taggcgtgta cggtgggagg tctatataag cagagctcgt ttagtgaacc gtcagatcgc 960ctggagacgc catccacgct gttttgacct ccatagaaga caccgggacc gatccagcct 1020ccgcggccgg gaacggtgca ttggaagctg gcctggatgg cctgactctc ttaggtagcc 1080ttgcagaagt tggtcgtgag gcactgggca ggtaagtatc aaggttacaa gacaggttta 1140aggagatcaa tagaaactgg gcttgtcgag acagagaaga ctcttgcgtt tctgataggc 1200acctattggt cttactgaca tccactttgc ctttctctcc acaggtgtcc actcccagtt 1260caattacagc tcgccaccat ggcctgcccc ggcttcctgt gggccctggt gatcagcacc 1320tgcctggaat tcagcatgag cagcgctagc accaagggcc ccagcgtgtt ccccctggcc 1380cccagcagca agagcaccag cggcggcaca gccgccctgg gctgcctggt gaaggactac 1440ttccccgagc ccgtgaccgt gagctggaac agcggcgcct tgaccagcgg cgtgcacacc 1500ttccccgccg tgctgcagag cagcggcctg tacagcctga gcagcgtggt gaccgtgccc 1560agcagcagcc tgggcaccca gacctacatc tgcaacgtga accacaagcc cagcaacacc 1620aaggtggaca aacgcgtgga gcccaagagc tgcgacaaga cccacacctg ccccccctgc 1680cctgcccccg agctgctggg cggaccctcc gtgttcctgt tcccccccaa gcccaaggac 1740accctcatga tcagccggac ccccgaggtg acctgcgtgg tggtggacgt gagccacgag 1800gaccccgagg tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 1860aagccccggg aggagcagta caacagcacc taccgggtgg tgagcgtgct caccgtgctg 1920caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgcct 1980gcccccatcg agaagaccat cagcaaggcc aagggccagc cccgggagcc ccaggtgtac 2040accctgcccc ccagccggga ggagatgacc aagaaccagg tgtccctcac ctgtctggtg 2100aagggcttct accccagcga catcgccgtg gagtgggaga gcaacggcca gcccgagaac 2160aactacaaga ccaccccccc tgtgctggac agcgacggca gcttcttcct gtacagcaag 2220ctcaccgtgg acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 2280gaggccctgc acaaccacta cacccagaag agcctgagcc tgagccccgg caagtgataa 2340tctagagggc ccgtttaaac ccgctgatca gcctcgactg tgccttctag ttgccagcca 2400tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc 2460ctttcctaat aaaatgagga aattgcatcg cattgtctga gtaggtgtca ttctattctg 2520gggggtgggg tggggcagga cagcaagggg gaggattggg aagacaatag caggcatgct 2580ggggatgcgg tgggctctat ggcttctgag gcggaaagaa ccagctgggg ctctaggggg 2640tatccccacg cgccctgtag cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc 2700gtgaccgcta cacttgccag cgccctagcg cccgctcctt tcgctttctt cccttccttt 2760ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc gggggctccc tttagggttc 2820cgatttagtg ctttacggca cctcgacccc aaaaaacttg attagggtga tggttcacgt 2880agtgggccat cgccctgata gacggttttt cgccctttga cgttggagtc cacgttcttt 2940aatagtggac tcttgttcca aactggaaca acactcaacc ctatctcggt ctattctttt 3000gatttataag ggattttgcc gatttcggcc tattggttaa aaaatgagct gatttaacaa 3060aaatttaacg cgaattaatt ctgtggaatg tgtgtcagtt agggtgtgga aagtccccag 3120gctccccagc aggcagaagt atgcaaagca tgcatctcaa ttagtcagca accaggtgtg 3180gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc aattagtcag 3240caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc agttccgccc 3300attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag gccgcctctg 3360cctctgagct attccagaag tagtgaggag gcttttttgg aggcctaggc ttttgcaaaa 3420agctcccggg agcttgtata tccattttcg gatctgatca agagacagga tgaggatcgt 3480ttcgcatgat tgaacaagat ggattgcacg caggttctcc ggccgcttgg gtggagaggc 3540tattcggcta tgactgggca caacagacaa tcggctgctc tgatgccgcc gtgttccggc 3600tgtcagcgca ggggcgcccg gttctttttg tcaagaccga cctgtccggt gccctgaatg 3660aactgcagga cgaggcagcg cggctatcgt ggctggccac gacgggcgtt ccttgcgcag 3720ctgtgctcga cgttgtcact gaagcgggaa gggactggct gctattgggc gaagtgccgg 3780ggcaggatct cctgtcatct caccttgctc ctgccgagaa agtatccatc atggctgatg 3840caatgcggcg gctgcatacg cttgatccgg ctacctgccc attcgaccac caagcgaaac 3900atcgcatcga gcgagcacgt actcggatgg aagccggtct tgtcgatcag gatgatctgg 3960acgaagagca tcaggggctc gcgccagccg aactgttcgc caggctcaag gcgcgcatgc 4020ccgacggcga ggatctcgtc gtgacccatg gcgatgcctg cttgccgaat atcatggtgg 4080aaaatggccg cttttctgga ttcatcgact gtggccggct gggtgtggcg gatcgctatc 4140aggacatagc gttggctacc cgtgatattg ctgaagagct tggcggcgaa tgggctgacc 4200gcttcctcgt gctttacggt atcgccgctc ccgattcgca gcgcatcgcc ttctatcgcc 4260ttcttgacga gttcttctga gcgggactct ggggttcgaa atgaccgacc aagcgacgcc 4320caacctgcca tcacgagatt tcgattccac cgccgccttc tatgaaaggt tgggcttcgg 4380aatcgttttc cgggacgccg gctggatgat cctccagcgc ggggatctca tgctggagtt 4440cttcgcccac cccaacttgt ttattgcagc ttataatggt tacaaataaa gcaatagcat 4500cacaaatttc acaaataaag catttttttc actgcattct agttgtggtt tgtccaaact 4560catcaatgta tcttatcatg tctgtatacc gtcgacctct agctagagct tggcgtaatc 4620atggtcatag ctgtttcctg tgtgaaattg ttatccgctc acaattccac acaacatacg 4680agccggaagc ataaagtgta aagcctgggg tgcctaatga gtgagctaac tcacattaat 4740tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg tcgtgccagc tgcattaatg 4800aatcggccaa cgcgcgggga gaggcggttt gcgtattggg cgctcttccg cttcctcgct 4860cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc 4920ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg 4980ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg 5040cccccctgac gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg 5100actataaaga taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac 5160cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca 5220tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt 5280gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc 5340caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag 5400agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac 5460tagaagaaca gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt 5520tggtagctct tgatccggca aacaaaccac cgctggtagc ggtttttttg tttgcaagca 5580gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc 5640tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag 5700gatcttcacc tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata 5760tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat 5820ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg 5880ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc 5940tccagattta tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc 6000aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc 6060gccagttaat agtttgcgca acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc 6120gtcgtttggt atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc 6180ccccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa 6240gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat 6300gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata 6360gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata cgggataata ccgcgccaca 6420tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag 6480gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc 6540agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc 6600aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata 6660ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta 6720gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtc 67782786283DNAArtificial sequenceVector pSyn-C04-Clambda 278gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgttaa ttaacatgaa 180gaatctgctt agggttaggc gttttgcgct gcttcgctag gtggtcaata ttggccatta 240gccatattat tcattggtta tatagcataa atcaatattg gctattggcc attgcatacg 300ttgtatccat atcataatat gtacatttat attggctcat gtccaacatt accgccatgt 360tgacattgat tattgactag ttattaatag taatcaatta cggggtcatt agttcatagc 420ccatatatgg agttccgcgt tacataactt acggtaaatg gcccgcctgg ctgaccgccc 480aacgaccccc gcccattgac gtcaataatg acgtatgttc ccatagtaac gccaataggg 540actttccatt gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt ggcagtacat 600caagtgtatc atatgccaag tacgccccct attgacgtca atgacggtaa atggcccgcc 660tggcattatg cccagtacat gaccttatgg gactttccta cttggcagta catctacgta 720ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt acatcaatgg gcgtggatag 780cggtttgact cacggggatt tccaagtctc caccccattg acgtcaatgg gagtttgttt 840tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca actccgcccc attgacgcaa 900atgggcggta ggcgtgtacg gtgggaggtc tatataagca gagctcgttt agtgaaccgt 960cagatcgcct ggagacgcca tccacgctgt tttgacctcc atagaagaca ccgggaccga 1020tccagcctcc gcggccggga acggtgcatt ggaatcgatg actctcttag gtagccttgc 1080agaagttggt cgtgaggcac tgggcaggta agtatcaagg ttacaagaca ggtttaagga 1140gatcaataga aactgggctt gtcgagacag agaagactct tgcgtttctg ataggcacct 1200attggtctta ctgacatcca ctttgccttt ctctccacag gtgtccactc ccagttcaat 1260tacagctcgc caccatggcc tgccccggct tcctgtgggc cctggtgatc agcacctgcc 1320tcgagatccc cggaccgcgg ccgcaagctt accgtgctgg gccagcccaa ggccgctccc 1380agcgtgaccc tgttcccccc ctcctccgag gagctgcagg ccaacaaggc caccctggtg 1440tgcctcatca gcgacttcta ccctggcgcc gtgaccgtgg cctggaaggc cgacagcagc 1500cccgtgaagg ccggcgtgga gaccaccacc cccagcaagc agagcaacaa caagtacgcc 1560gccagcagct acctgagcct cacccccgag cagtggaaga gccaccggag ctacagctgc 1620caggtgaccc acgagggcag caccgtggag aagaccgtgg cccccaccga gtgcagctaa 1680tagacttaag tttaaaccgc tgatcagcct cgactgtgcc ttctagttgc cagccatctg 1740ttgtttgccc ctcccccgtg ccttccttga ccctggaagg tgccactccc actgtccttt 1800cctaataaaa tgaggaaatt gcatcgcatt gtctgagtag gtgtcattct attctggggg 1860gtggggtggg gcaggacagc aagggggagg attgggaaga caatagcagg catgctgggg 1920atgcggtggg ctctatggct tctgaggcgg aaagaaccag ctggggctct agggggtatc 1980cccacgcgcc ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga 2040ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct tcctttctcg 2100ccacgttcgc cggctttccc cgtcaagctc taaatcgggg gctcccttta gggttccgat 2160ttagtgcttt acggcacctc gaccccaaaa aacttgatta gggtgatggt tcacgtagtg 2220ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg ttctttaata 2280gtggactctt gttccaaact ggaacaacac tcaaccctat ctcggtctat tcttttgatt 2340tataagggat tttggccatt tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat 2400ttaacgcgaa ttaattctgt ggaatgtgtg tcagttaggg tgtggaaagt ccccaggctc 2460cccagcaggc agaagtatgc aaagcatgca tctcaattag tcagcaacca ggtgtggaaa 2520gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac 2580catagtcccg cccctaactc cgcccatccc gcccctaact ccgcccagtt ccgcccattc 2640tccgccccat ggctgactaa ttttttttat ttatgcagag gccgaggccg cctctgcctc 2700tgagctattc cagaagtagt gaggaggctt ttttggaggc ctaggctttt gcaaaaagct 2760cccgggagct tgtatatcca ttttcggatc tgatcagcac gtgatgaaaa agcctgaact 2820caccgcgacg tctgtcgaga agtttctgat cgaaaagttc gacagcgtct ccgacctgat 2880gcagctctcg gagggcgaag aatctcgtgc tttcagcttc gatgtaggag ggcgtggata 2940tgtcctgcgg gtaaatagct gcgccgatgg tttctacaaa gatcgttatg tttatcggca 3000ctttgcatcg gccgcgctcc cgattccgga agtgcttgac attggggaat tcagcgagag 3060cctgacctat tgcatctccc gccgtgcaca gggtgtcacg ttgcaagacc tgcctgaaac 3120cgaactgccc gctgttctgc agccggtcgc ggaggccatg gatgcgatcg ctgcggccga 3180tcttagccag acgagcgggt tcggcccatt cggaccgcaa ggaatcggtc aatacactac 3240atggcgtgat ttcatatgcg cgattgctga tccccatgtg tatcactggc aaactgtgat 3300ggacgacacc gtcagtgcgt ccgtcgcgca ggctctcgat gagctgatgc tttgggccga 3360ggactgcccc gaagtccggc acctcgtgca cgcggatttc ggctccaaca atgtcctgac 3420ggacaatggc cgcataacag cggtcattga ctggagcgag gcgatgttcg gggattccca 3480atacgaggtc gccaacatct tcttctggag gccgtggttg gcttgtatgg agcagcagac 3540gcgctacttc gagcggaggc atccggagct tgcaggatcg ccgcggctcc gggcgtatat 3600gctccgcatt ggtcttgacc aactctatca gagcttggtt gacggcaatt tcgatgatgc 3660agcttgggcg cagggtcgat gcgacgcaat cgtccgatcc ggagccggga ctgtcgggcg 3720tacacaaatc gcccgcagaa gcgcggccgt ctggaccgat ggctgtgtag aagtactcgc 3780cgatagtgga aaccgacgcc ccagcactcg tccgagggca aaggaatagc acgtgctacg 3840agatttcgat tccaccgccg ccttctatga aaggttgggc ttcggaatcg ttttccggga 3900cgccggctgg atgatcctcc agcgcgggga tctcatgctg gagttcttcg cccaccccaa 3960cttgtttatt gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa 4020taaagcattt ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta 4080tcatgtctgt ataccgtcga cctctagcta gagcttggcg taatcatggt catagctgtt 4140tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg gaagcataaa 4200gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact 4260gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc 4320ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg 4380ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc 4440cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag 4500gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca 4560tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca 4620ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg 4680atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag 4740gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt 4800tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca 4860cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg 4920cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa gaacagtatt 4980tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc 5040cggcaaacaa accaccgctg gtagcggttt ttttgtttgc aagcagcaga ttacgcgcag 5100aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 5160cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 5220ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 5280tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 5340atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 5400tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc 5460aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 5520catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 5580gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 5640ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 5700aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 5760atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 5820cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 5880gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 5940agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt 6000gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 6060caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 6120ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta 6180tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat 6240aggggttccg cgcacatttc cccgaaaagt gccacctgac gtc 62832796267DNAArtificial sequenceVector pSyn-C05-Ckappa 279gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgttaa ttaacatgaa 180gaatctgctt agggttaggc gttttgcgct gcttcgctag gtggtcaata ttggccatta 240gccatattat tcattggtta tatagcataa atcaatattg gctattggcc attgcatacg 300ttgtatccat atcataatat gtacatttat attggctcat gtccaacatt accgccatgt 360tgacattgat tattgactag ttattaatag taatcaatta cggggtcatt agttcatagc 420ccatatatgg agttccgcgt tacataactt acggtaaatg gcccgcctgg ctgaccgccc 480aacgaccccc gcccattgac gtcaataatg acgtatgttc ccatagtaac gccaataggg 540actttccatt gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt ggcagtacat 600caagtgtatc atatgccaag tacgccccct attgacgtca atgacggtaa atggcccgcc 660tggcattatg

cccagtacat gaccttatgg gactttccta cttggcagta catctacgta 720ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt acatcaatgg gcgtggatag 780cggtttgact cacggggatt tccaagtctc caccccattg acgtcaatgg gagtttgttt 840tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca actccgcccc attgacgcaa 900atgggcggta ggcgtgtacg gtgggaggtc tatataagca gagctcgttt agtgaaccgt 960cagatcgcct ggagacgcca tccacgctgt tttgacctcc atagaagaca ccgggaccga 1020tccagcctcc gcggccggga acggtgcatt ggaatcgatg actctcttag gtagccttgc 1080agaagttggt cgtgaggcac tgggcaggta agtatcaagg ttacaagaca ggtttaagga 1140gatcaataga aactgggctt gtcgagacag agaagactct tgcgtttctg ataggcacct 1200attggtctta ctgacatcca ctttgccttt ctctccacag gtgtccactc ccagttcaat 1260tacagctcgc caccatggcc tgccccggct tcctgtgggc cctggtgatc agcacctgcc 1320tcgagttcag cggccctaag cggaccgtgg ccgctcccag cgtgttcatc ttccccccct 1380ccgacgagca gctgaagagc ggcaccgcca gcgtggtgtg cctgctgaac aacttctacc 1440cccgggaggc caaggtgcag tggaaggtgg acaacgccct gcagagcggc aacagccagg 1500agagcgtgac cgagcaggac agcaaggact ccacctacag cctgagcagc accctcaccc 1560tgagcaaggc cgactacgag aagcacaagg tgtacgcctg cgaggtgacc caccagggcc 1620tgagcagccc cgtgaccaag agcttcaacc ggggcgagtg ttaatagact taagtttaaa 1680ccgctgatca gcctcgactg tgccttctag ttgccagcca tctgttgttt gcccctcccc 1740cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat aaaatgagga 1800aattgcatcg cattgtctga gtaggtgtca ttctattctg gggggtgggg tggggcagga 1860cagcaagggg gaggattggg aagacaatag caggcatgct ggggatgcgg tgggctctat 1920ggcttctgag gcggaaagaa ccagctgggg ctctaggggg tatccccacg cgccctgtag 1980cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag 2040cgccctagcg cccgctcctt tcgctttctt cccttccttt ctcgccacgt tcgccggctt 2100tccccgtcaa gctctaaatc gggggctccc tttagggttc cgatttagtg ctttacggca 2160cctcgacccc aaaaaacttg attagggtga tggttcacgt agtgggccat cgccctgata 2220gacggttttt cgccctttga cgttggagtc cacgttcttt aatagtggac tcttgttcca 2280aactggaaca acactcaacc ctatctcggt ctattctttt gatttataag ggattttggc 2340catttcggcc tattggttaa aaaatgagct gatttaacaa aaatttaacg cgaattaatt 2400ctgtggaatg tgtgtcagtt agggtgtgga aagtccccag gctccccagc aggcagaagt 2460atgcaaagca tgcatctcaa ttagtcagca accaggtgtg gaaagtcccc aggctcccca 2520gcaggcagaa gtatgcaaag catgcatctc aattagtcag caaccatagt cccgccccta 2580actccgccca tcccgcccct aactccgccc agttccgccc attctccgcc ccatggctga 2640ctaatttttt ttatttatgc agaggccgag gccgcctctg cctctgagct attccagaag 2700tagtgaggag gcttttttgg aggcctaggc ttttgcaaaa agctcccggg agcttgtata 2760tccattttcg gatctgatca gcacgtgatg aaaaagcctg aactcaccgc gacgtctgtc 2820gagaagtttc tgatcgaaaa gttcgacagc gtctccgacc tgatgcagct ctcggagggc 2880gaagaatctc gtgctttcag cttcgatgta ggagggcgtg gatatgtcct gcgggtaaat 2940agctgcgccg atggtttcta caaagatcgt tatgtttatc ggcactttgc atcggccgcg 3000ctcccgattc cggaagtgct tgacattggg gaattcagcg agagcctgac ctattgcatc 3060tcccgccgtg cacagggtgt cacgttgcaa gacctgcctg aaaccgaact gcccgctgtt 3120ctgcagccgg tcgcggaggc catggatgcg atcgctgcgg ccgatcttag ccagacgagc 3180gggttcggcc cattcggacc acaaggaatc ggtcaataca ctacatggcg tgatttcata 3240tgcgcgattg ctgatcccca tgtgtatcac tggcaaactg tgatggacga caccgtcagt 3300gcgtccgtcg cgcaggctct cgatgagctg atgctttggg ccgaggactg ccccgaagtc 3360cggcacctcg tgcacgcgga tttcggctcc aacaatgtcc tgacggacaa tggccgcata 3420acagcggtca ttgactggag cgaggcgatg ttcggggatt cccaatacga ggtcgccaac 3480atcttcttct ggaggccgtg gttggcttgt atggagcagc agacgcgcta cttcgagcgg 3540aggcatccgg agcttgcagg atcgccgcgg ctccgggcgt atatgctccg cattggtctt 3600gaccaactct atcagagctt ggttgacggc aatttcgatg atgcagcttg ggcgcagggt 3660cgatgcgacg caatcgtccg atccggagcc gggactgtcg ggcgtacaca aatcgcccgc 3720agaagcgcgg ccgtctggac cgatggctgt gtagaagtac tcgccgatag tggaaaccga 3780cgccccagca ctcgtccgag ggcaaaggaa tagcacgtgc tacgagattt cgattccacc 3840gccgccttct atgaaaggtt gggcttcgga atcgttttcc gggacgccgg ctggatgatc 3900ctccagcgcg gggatctcat gctggagttc ttcgcccacc ccaacttgtt tattgcagct 3960tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc atttttttca 4020ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctgtataccg 4080tcgacctcta gctagagctt ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt 4140tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa agcctggggt 4200gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg 4260ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg 4320cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg 4380cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat 4440aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc 4500gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc 4560tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga 4620agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt 4680ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg 4740taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc 4800gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg 4860gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc 4920ttgaagtggt ggcctaacta cggctacact agaagaacag tatttggtat ctgcgctctg 4980ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc 5040gctggtagcg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa 5100gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa 5160gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa 5220tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc 5280ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga 5340ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca 5400atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc 5460ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat 5520tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc 5580attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt 5640tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc 5700ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg 5760gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt 5820gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg 5880gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga 5940aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg 6000taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg 6060tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt 6120tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc 6180atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca 6240tttccccgaa aagtgccacc tgacgtc 626728046DNAArtificial sequenceOligonucleotide 5H-B 280acctgtcttg aattctccat ggccgaggtg cagctggtgg agtctg 4628147DNAArtificial sequenceOligonucleotide 5H-C 281acctgtcttg aattctccat ggcccaggtg cagctggtgg agtctgg 4728249DNAArtificial sequenceOligonucleotide 5H-C-long 282acctgtcttg aattctccat ggcccaggtg cagctggtgg agtctgggg 4928350DNAArtificial sequenceOligonucleotide 5H-F 283acctgtcttg aattctccat ggcccaggtg cagctgcagg agtccggccc 5028447DNAArtificial sequenceOligonucleotide 5H-H 284acctgtcttg aattctccat ggccgaggtg cagctggtgc agtctgg 4728547DNAArtificial sequenceOligonucleotide 5H-I 285acctgtcttg aattctccat ggccgaggtg cagctgctgg agtctgg 4728647DNAArtificial sequenceOligonucleotide 5H-M 286acctgtcttg aattctccat ggcccaggtg accttgaagg agtctgg 4728747DNAArtificial sequenceOligonucleotide sy3H-A 287gcccttggtg ctagcgctgg agacggtcac cagggtgccc tggcccc 4728847DNAArtificial sequenceOligonucleotide sy3H-C 288gcccttggtg ctagcgctgg agacggtcac ggtggtgccc tggcccc 4728954DNAArtificial sequenceOligonucleotide sy3H-C-long 289gcccttggtg ctagcgctgg agacggtcac ggtggtgccc ttgccccaga cgtc 5429047DNAArtificial sequenceOligonucleotide sy3H-D 290gcccttggtg ctagcgctgg acacggtcac catggtgccc tggcccc 4729147DNAArtificial sequenceOligonucleotide sy3H-E 291gcccttggtg ctagcgctgg acacggtcac cagggtgccc cggcccc 4729244DNAArtificial sequenceOligonucleotide 3L-B 292ttttccttag cggccgcgac tcacctagga cggtcagctt ggtc 4429344DNAArtificial sequenceOligonucleotide 5K-B 293acctgtctcg agttttccat ggctgacatc cagatgaccc agtc 4429455DNAArtificial sequenceOligonucleotide 5K-C 294acctgtctcg agttttccat ggctgacatc cagatgaccc agtctccatc ctccc 5529547DNAArtificial sequenceOligonucleotide 5K-G 295acctgtctcg agttttccat ggctgacatc gtgatgaccc agtctcc 4729647DNAArtificial sequenceOligonucleotide 5K-K 296acctgtctcg agttttccat ggctgccatc cagatgaccc agtctcc 4729744DNAArtificial sequenceOligonucleotide 5K-M 297acctgtctcg agttttccat ggctgacatc cagctgaccc agtc 4429844DNAArtificial sequenceOligonucleotide 5K-N 298acctgtctcg agttttccat ggctgacatc cagatgactc agtc 4429944DNAArtificial sequenceOligonucleotide 5K-O 299acctgtctcg agttttccat ggctgccatc cagctgaccc agtc 4430044DNAArtificial sequenceOligonucleotide 5K-Q 300acctgtctcg agttttccat ggctgagatc gtgatgactc agtc 4430145DNAArtificial sequenceOligonucleotide 5L-E 301acctgtctcg agttttccat ggcttcctac gtgctgactc agccg 4530244DNAArtificial sequenceOligonucleotide 5L-F 302acctgtctcg agttttccat ggctcagtcc gtgctgactc agcc 4430344DNAArtificial sequenceOligoucleotide 5L-G 303acctgtctcg agttttccat ggcttcctac gtgctgactc agcc 4430442DNAArtificial sequenceOligonucleotide sy3K-F 304gctgggggcg gccacggtcc gcttgatctc caccttggtc cc 4230542DNAArtificial sequenceOligonucleotide sy3K-I 305gctgggggcg gccacggtcc gcttgatctc cagccgtgtc cc 4230642DNAArtificial sequenceOligonucleotide sy3K-J 306gctgggggcg gccacggtcc gcttgatctc cagcttggtc cc 4230742DNAArtificial sequenceOligonucleotide sy3K-K 307gctgggggcg gccacggtcc gcttgatgtc caccttggtc cc 4230843DNAArtificial sequenceOligonucleotide sy3L-A 308ccagcacggt aagcttcagc acggtcacct tggtgccagt tcc 4330943DNAArtificial sequenceOligonucleotide sy3L-C 309ccagcacggt aagcttcagc acggtcagct tggtgcctcc gcc 4331037DNAArtificial sequenceOligonucleotide sy3L-D 310ccagcacggt aagcttcaac acggtcagct gggtccc 3731152DNAArtificial sequenceOligonucleotide sy5L-A 311acctgtctcg agttttccat ggcttcctcc gagctgaccc aggaccctgc tg 52312756DNAArtificial sequencescFv SOJB 312gccatggccc agatcaccct gaaggagacc ggccccaccc tggtgaagcc cacccagacc 60ctcaccctca cctgcacctt cagcggcttc agcctgagca ccagcggcgt gggcgtgggc 120tggatcagac agccccctgg caaggccctg gagtgggtga ccctcatcta ctgggacgac 180gacaagagat acagccccag cctggagaac agggtgacca tccggaagga caccagcaag 240aaccaggtgg ccctcaccat gaccaacatg gaccccctgg ataccggcac ctactactgc 300gcccacaggc agcacatcag cagcttcccc tggttcgaca gctggggcca gggcacactg 360gtgaccgtct cgagcggtac gggcggttca ggcggaaccg gcagcggcac tggcgggtcg 420acgagctacg tgctcaccca gccccccagc gtgagcgtgg cccctggcaa gaccgccaga 480atcaactgcg gcggcaacaa catcgagtac cggagcgtgc actggtatca gcagaagagc 540ggccaggccc ccgtggccgt gatctacgac aacagcgaca gacctagcgg catccccgag 600agattcagcg gcagcaagag cggcaacacc gccaccctca ccatcagcag agtggaggcc 660ggcgacgagg ccgactacta ctgccaggtg tgggacatca gcagcgatgt ggtgttcggc 720ggaggcacca agcttaccgt gctaggtgcg gccgca 756313252PRTArtificial sequencescFv SOJB 313Ala Met Ala Gln Ile Thr Leu Lys Glu Thr Gly Pro Thr Leu Val Lys1 5 10 15Pro Thr Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu 20 25 30Ser Thr Ser Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys 35 40 45Ala Leu Glu Trp Val Thr Leu Ile Tyr Trp Asp Asp Asp Lys Arg Tyr 50 55 60Ser Pro Ser Leu Glu Asn Arg Val Thr Ile Arg Lys Asp Thr Ser Lys65 70 75 80Asn Gln Val Ala Leu Thr Met Thr Asn Met Asp Pro Leu Asp Thr Gly 85 90 95Thr Tyr Tyr Cys Ala His Arg Gln His Ile Ser Ser Phe Pro Trp Phe 100 105 110Asp Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Thr Gly 115 120 125Gly Ser Gly Gly Thr Gly Ser Gly Thr Gly Gly Ser Thr Ser Tyr Val 130 135 140Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly Lys Thr Ala Arg145 150 155 160Ile Asn Cys Gly Gly Asn Asn Ile Glu Tyr Arg Ser Val His Trp Tyr 165 170 175Gln Gln Lys Ser Gly Gln Ala Pro Val Ala Val Ile Tyr Asp Asn Ser 180 185 190Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Lys Ser Gly 195 200 205Asn Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly Asp Glu Ala 210 215 220Asp Tyr Tyr Cys Gln Val Trp Asp Ile Ser Ser Asp Val Val Phe Gly225 230 235 240Gly Gly Thr Lys Leu Thr Val Leu Gly Ala Ala Ala 245 25031415PRTArtificial sequencePeptide 314Ser Leu Lys Gly Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly1 5 10 1531515PRTArtificial sequencePeptide 315Leu Lys Gly Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu1 5 10 1531615PRTArtificial sequencePeptide 316Lys Gly Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu Arg1 5 10 1531715PRTArtificial sequencePeptide 317Gly Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu1 5 10 1531815PRTArtificial sequencePeptide 318Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu Met1 5 10 1531915PRTArtificial sequencePeptide 319Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu Met Asp1 5 10 1532015PRTArtificial sequencePeptide 320Lys Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu Met Asp Gly1 5 10 1532115PRTArtificial sequencePeptide 321Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu Met Asp Gly Thr1 5 10 1532215PRTArtificial sequencePeptide 322Lys Leu Cys Gly Val Leu Gly Leu Arg Leu Met Asp Gly Thr Trp1 5 10 1532315PRTArtificial sequencePeptide 323Gly Phe Gly Lys Ala Tyr Thr Ile Phe Asn Lys Thr Leu Met Glu1 5 10 1532415PRTArtificial sequencePeptide 324Phe Gly Lys Ala Tyr Thr Ile Phe Asn Lys Thr Leu Met Glu Ala1 5 10 1532515PRTArtificial sequencePeptide 325Gly Lys Ala Tyr Thr Ile Phe Asn Lys Thr Leu Met Glu Ala Asp1 5 10 1532615PRTArtificial sequencePeptide 326Lys Ala Tyr Thr Ile Phe Asn Lys Thr Leu Met Glu Ala Asp Ala1 5 10 1532715PRTArtificial sequencePeptide 327Ala Tyr Thr Ile Phe Asn Lys Thr Leu Met Glu Ala Asp Ala His1 5 10 1532815PRTArtificial sequencePeptide 328Tyr Thr Ile Phe Asn Lys Thr Leu Met Glu Ala Asp Ala His Tyr1 5 10 1532915PRTArtificial sequencePeptide 329Thr Ile Phe Asn Lys Thr Leu Met Glu Ala Asp Ala His Tyr Lys1 5 10 1533015PRTArtificial sequencePeptide 330Ile Phe Asn Lys Thr Leu Met Glu Ala Asp Ala His Tyr Lys Ser1 5 10 1533115PRTArtificial sequencePeptide 331Phe Asn Lys Thr Leu Met Glu Ala Asp Ala His Tyr Lys Ser Val1 5 10 1533223PRTArtificial sequencePeptide 332Ser Leu Lys Gly Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu1 5 10 15Arg Leu Met Asp Gly Thr Trp 2033323PRTArtificial sequencePeptide 333Gly Phe Gly Lys Ala Tyr Thr Ile Phe Asn Lys Thr Leu Met Glu Ala1 5 10 15Asp Ala His Tyr Lys Ser Val 203342083DNAArtificial sequenceHeavy chain of CR04-098 334caggtgcagc tggtggagtc tgggggaggc gcggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg ggtggctgtt atattatatg atggaagtga taaattctat 180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240ctgcagatga acagcctgag agctgaggac acggctgtgt attactgtgc gaaagtagca 300gtggctggta cgcactttga ctactggggc cagggcaccc tggtgaccgt cagctcaggt 360gagtgcggcc gcgagcccag acactggacg ctgaacctcg cggacagtta agaacccagg 420ggcctctgcg ccctgggccc agctctgtcc cacaccgcgg tcacatggca ccacctctct 480tgcagcctcc

accaagggcc catcggtctt ccccctggca ccctcctcca agagcacctc 540tgggggcaca gcggccctgg gctgcctggt caaggactac ttccccgaac cggtgacggt 600gtcgtggaac tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc 660ctcaggactc tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcaccca 720gacctacatc tgcaacgtga atcacaagcc cagcaacacc aaggtggaca agagagttgg 780tgagaggcca gcacagggag ggagggtgtc tgctggaagc caggctcagc gctcctgcct 840ggacgcatcc cggctatgca gtcccagtcc agggcagcaa ggcaggcccc gtctgcctct 900tcacccggag gcctctgccc gccccactca tgctcaggga gagggtcttc tggctttttc 960cccaggctct gggcaggcac aggctaggtg cccctaaccc aggccctgca cacaaagggg 1020caggtgctgg gctcagacct gccaagagcc atatccggga ggaccctgcc cctgacctaa 1080gcccacccca aaggccaaac tctccactcc ctcagctcgg acaccttctc tcctcccaga 1140ttccagtaac tcccaatctt ctctctgcag agcccaaatc ttgtgacaaa actcacacat 1200gcccaccgtg cccaggtaag ccagcccagg cctcgccctc cagctcaagg cgggacaggt 1260gccctagagt agcctgcatc cagggacagg ccccagccgg gtgctgacac gtccacctcc 1320atctcttcct cagcacctga actcctgggg ggaccgtcag tcttcctctt ccccccaaaa 1380cccaaggaca ccctcatgat ctcccggacc cctgaggtca catgcgtggt ggtggacgtg 1440agccacgaag accctgaggt caagttcaac tggtacgtgg acggcgtgga ggtgcataat 1500gccaagacaa agccgcggga ggagcagtac aacagcacgt accgtgtggt cagcgtcctc 1560accgtcctgc accaggactg gctgaatggc aaggagtaca agtgcaaggt ctccaacaaa 1620gccctcccag cccccatcga gaaaaccatc tccaaagcca aaggtgggac ccgtggggtg 1680cgagggccac atggacagag gccggctcgg cccaccctct gccctgagag tgaccgctgt 1740accaacctct gtccctacag ggcagccccg agaaccacag gtgtacaccc tgcccccatc 1800ccgggaggag atgaccaaga accaggtcag cctgacctgc ctggtcaaag gcttctatcc 1860cagcgacatc gccgtggagt gggagagcaa tgggcagccg gagaacaact acaagaccac 1920gcctcccgtg ctggactccg acggctcctt cttcctctat agcaagctca ccgtggacaa 1980gagcaggtgg cagcagggga acgtcttctc atgctccgtg atgcatgagg ctctgcacaa 2040ccactacacg cagaagagcc tctccctgtc tccgggtaaa tga 2083335449PRTArtificial sequenceHeavy chain of CR04-098 335Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ala Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Leu Tyr Asp Gly Ser Asp Lys Phe Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Val Ala Val Ala Gly Thr His Phe Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe 115 120 125Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu 130 135 140Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp145 150 155 160Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu 165 170 175Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser 180 185 190Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro 195 200 205Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp Lys 210 215 220Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro225 230 235 240Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 245 250 255Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp 260 265 270Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 275 280 285Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val 290 295 300Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu305 310 315 320Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys 325 330 335Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 340 345 350Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr 355 360 365Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 370 375 380Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu385 390 395 400Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys 405 410 415Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu 420 425 430Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly 435 440 445Lys 336847DNAArtificial sequenceLight chain of CR04-098 336gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gggcattaga aatgatttag gctggtatca gcagaaacca 120gggaaagccc ctaagctcct gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 240gaagattttg caacttatta ctgtcaacag cttaatagtt accctcccac tttcggcgga 300gggaccaagg tggagatcaa acgtaagtgc actttgcggc cgctaggaag aaactcaaaa 360catcaagatt ttaaatacgc ttcttggtct ccttgctata attatctggg ataagcatgc 420tgttttctgt ctgtccctaa catgccctgt gattatccgc aaacaacaca cccaagggca 480gaactttgtt acttaaacac catcctgttt gcttctttcc tcaggaactg tggctgcacc 540atctgtcttc atcttcccgc catctgatga gcagttgaaa tctggaactg cctctgttgt 600gtgcctgctg aataacttct atcccagaga ggccaaagta cagtggaagg tggataacgc 660cctccaatcg ggtaactccc aggagagtgt cacagagcag gacagcaagg acagcaccta 720cagcctcagc agcaccctga cgctgagcaa agcagactac gagaaacaca aagtctacgc 780ctgcgaagtc acccatcagg gcctgagctc gcccgtcaca aagagcttca acaggggaga 840gtgttag 847337213PRTArtificial sequenceLight chain of CR04-098 337Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Asp 20 25 30Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Pro 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Thr Val Ala Ala Pro 100 105 110Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr 115 120 125Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys 130 135 140Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu145 150 155 160Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser 165 170 175Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala 180 185 190Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe 195 200 205Asn Arg Gly Glu Cys 21033815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 338Lys Phe Pro Ile Tyr Thr Ile Leu Asp Lys Leu Gly Pro Trp Ser1 5 10 1533915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 339Phe Pro Ile Tyr Thr Ile Leu Asp Lys Leu Gly Pro Trp Ser Pro1 5 10 1534015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 340Pro Ile Tyr Thr Ile Leu Asp Lys Leu Gly Pro Trp Ser Pro Ile1 5 10 1534115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 341Ile Tyr Thr Ile Leu Asp Lys Leu Gly Pro Trp Ser Pro Ile Asp1 5 10 1534215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 342Tyr Thr Ile Leu Asp Lys Leu Gly Pro Trp Ser Pro Ile Asp Ile1 5 10 1534315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 343Thr Ile Leu Asp Lys Leu Gly Pro Trp Ser Pro Ile Asp Ile His1 5 10 1534415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 344Ile Leu Asp Lys Leu Gly Pro Trp Ser Pro Ile Asp Ile His His1 5 10 1534515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 345Leu Asp Lys Leu Gly Pro Trp Ser Pro Ile Asp Ile His His Leu1 5 10 1534615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 346Asp Lys Leu Gly Pro Trp Ser Pro Ile Asp Ile His His Leu Ser1 5 10 1534715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 347Lys Leu Gly Pro Trp Ser Pro Ile Asp Ile His His Leu Ser Cys1 5 10 1534815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 348Leu Gly Pro Trp Ser Pro Ile Asp Ile His His Leu Ser Cys Pro1 5 10 1534915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 349Gly Pro Trp Ser Pro Ile Asp Ile His His Leu Ser Cys Pro Asn1 5 10 1535015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 350Pro Trp Ser Pro Ile Asp Ile His His Leu Ser Cys Pro Asn Asn1 5 10 1535115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 351Trp Ser Pro Ile Asp Ile His His Leu Ser Cys Pro Asn Asn Leu1 5 10 1535215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 352Ser Pro Ile Asp Ile His His Leu Ser Cys Pro Asn Asn Leu Val1 5 10 1535315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 353Pro Ile Asp Ile His His Leu Ser Cys Pro Asn Asn Leu Val Val1 5 10 1535415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 354Ile Asp Ile His His Leu Ser Cys Pro Asn Asn Leu Val Val Glu1 5 10 1535515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 355Asp Ile His His Leu Ser Cys Pro Asn Asn Leu Val Val Glu Asp1 5 10 1535615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 356Ile His His Leu Ser Cys Pro Asn Asn Leu Val Val Glu Asp Glu1 5 10 1535715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 357His His Leu Ser Cys Pro Asn Asn Leu Val Val Glu Asp Glu Gly1 5 10 1535815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 358His Leu Ser Cys Pro Asn Asn Leu Val Val Glu Asp Glu Gly Cys1 5 10 1535915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 359Leu Ser Cys Pro Asn Asn Leu Val Val Glu Asp Glu Gly Cys Thr1 5 10 1536015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 360Ser Cys Pro Asn Asn Leu Val Val Glu Asp Glu Gly Cys Thr Asn1 5 10 1536115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 361Cys Pro Asn Asn Leu Val Val Glu Asp Glu Gly Cys Thr Asn Leu1 5 10 1536215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 362Pro Asn Asn Leu Val Val Glu Asp Glu Gly Cys Thr Asn Leu Ser1 5 10 1536315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus

strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 363Asn Asn Leu Val Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly1 5 10 1536415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 364Asn Leu Val Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe1 5 10 1536515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 365Leu Val Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser1 5 10 1536615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 366Val Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr1 5 10 1536715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 367Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr Met1 5 10 1536815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 368Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr Met Glu1 5 10 1536915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 369Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr Met Glu Leu1 5 10 1537015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 370Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr Met Glu Leu Lys1 5 10 1537115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 371Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr Met Glu Leu Lys Val1 5 10 1537215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 372Cys Thr Asn Leu Ser Gly Phe Ser Tyr Met Glu Leu Lys Val Gly1 5 10 1537315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 373Thr Asn Leu Ser Gly Phe Ser Tyr Met Glu Leu Lys Val Gly Tyr1 5 10 1537415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 374Asn Leu Ser Gly Phe Ser Tyr Met Glu Leu Lys Val Gly Tyr Ile1 5 10 1537515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 375Leu Ser Gly Phe Ser Tyr Met Glu Leu Lys Val Gly Tyr Ile Leu1 5 10 1537615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 376Ser Gly Phe Ser Tyr Met Glu Leu Lys Val Gly Tyr Ile Leu Ala1 5 10 1537715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 377Gly Phe Ser Tyr Met Glu Leu Lys Val Gly Tyr Ile Leu Ala Ile1 5 10 1537815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 378Phe Ser Tyr Met Glu Leu Lys Val Gly Tyr Ile Leu Ala Ile Lys1 5 10 1537915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 379Ser Tyr Met Glu Leu Lys Val Gly Tyr Ile Leu Ala Ile Lys Met1 5 10 1538015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 380Tyr Met Glu Leu Lys Val Gly Tyr Ile Leu Ala Ile Lys Met Asn1 5 10 1538115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 381Met Glu Leu Lys Val Gly Tyr Ile Leu Ala Ile Lys Met Asn Gly1 5 10 1538215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 382Glu Leu Lys Val Gly Tyr Ile Leu Ala Ile Lys Met Asn Gly Phe1 5 10 1538315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 383Leu Lys Val Gly Tyr Ile Leu Ala Ile Lys Met Asn Gly Phe Thr1 5 10 1538415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 384Lys Val Gly Tyr Ile Leu Ala Ile Lys Met Asn Gly Phe Thr Cys1 5 10 1538515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 385Val Gly Tyr Ile Leu Ala Ile Lys Met Asn Gly Phe Thr Cys Thr1 5 10 1538615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 386Gly Tyr Ile Leu Ala Ile Lys Met Asn Gly Phe Thr Cys Thr Gly1 5 10 1538715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 387Tyr Ile Leu Ala Ile Lys Met Asn Gly Phe Thr Cys Thr Gly Val1 5 10 1538815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 388Ile Leu Ala Ile Lys Met Asn Gly Phe Thr Cys Thr Gly Val Val1 5 10 1538915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 389Leu Ala Ile Lys Met Asn Gly Phe Thr Cys Thr Gly Val Val Thr1 5 10 1539015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 390Ala Ile Lys Met Asn Gly Phe Thr Cys Thr Gly Val Val Thr Glu1 5 10 1539115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 391Ile Lys Met Asn Gly Phe Thr Cys Thr Gly Val Val Thr Glu Ala1 5 10 1539215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 392Lys Met Asn Gly Phe Thr Cys Thr Gly Val Val Thr Glu Ala Glu1 5 10 1539315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 393Met Asn Gly Phe Thr Cys Thr Gly Val Val Thr Glu Ala Glu Asn1 5 10 1539415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 394Asn Gly Phe Thr Cys Thr Gly Val Val Thr Glu Ala Glu Asn Tyr1 5 10 1539515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 395Gly Phe Thr Cys Thr Gly Val Val Thr Glu Ala Glu Asn Tyr Thr1 5 10 1539615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 396Phe Thr Cys Thr Gly Val Val Thr Glu Ala Glu Asn Tyr Thr Asn1 5 10 1539715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 397Thr Cys Thr Gly Val Val Thr Glu Ala Glu Asn Tyr Thr Asn Phe1 5 10 1539815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 398Cys Thr Gly Val Val Thr Glu Ala Glu Asn Tyr Thr Asn Phe Val1 5 10 1539915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 399Thr Gly Val Val Thr Glu Ala Glu Asn Tyr Thr Asn Phe Val Gly1 5 10 1540015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 400Gly Val Val Thr Glu Ala Glu Asn Tyr Thr Asn Phe Val Gly Tyr1 5 10 1540115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 401Val Val Thr Glu Ala Glu Asn Tyr Thr Asn Phe Val Gly Tyr Val1 5 10 1540215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 402Val Thr Glu Ala Glu Asn Tyr Thr Asn Phe Val Gly Tyr Val Thr1 5 10 1540315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 403Thr Glu Ala Glu Asn Tyr Thr Asn Phe Val Gly Tyr Val Thr Thr1 5 10 1540415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 404Glu Ala Glu Asn Tyr Thr Asn Phe Val Gly Tyr Val Thr Thr Thr1 5 10 1540515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 405Ala Glu Asn Tyr Thr Asn Phe Val Gly Tyr Val Thr Thr Thr Phe1 5 10 1540615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 406Glu Asn Tyr Thr Asn Phe Val Gly Tyr Val Thr Thr Thr Phe Lys1 5 10 1540715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 407Asn Tyr Thr Asn Phe Val Gly Tyr Val Thr Thr Thr Phe Lys Arg1 5 10 1540815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 408Tyr Thr Asn Phe Val Gly Tyr Val Thr Thr Thr Phe Lys Arg Lys1 5 10

1540915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 409Thr Asn Phe Val Gly Tyr Val Thr Thr Thr Phe Lys Arg Lys His1 5 10 1541015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 410Asn Phe Val Gly Tyr Val Thr Thr Thr Phe Lys Arg Lys His Phe1 5 10 1541115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 411Phe Val Gly Tyr Val Thr Thr Thr Phe Lys Arg Lys His Phe Arg1 5 10 1541215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 412Val Gly Tyr Val Thr Thr Thr Phe Lys Arg Lys His Phe Arg Pro1 5 10 1541315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 413Gly Tyr Val Thr Thr Thr Phe Lys Arg Lys His Phe Arg Pro Thr1 5 10 1541415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 414Tyr Val Thr Thr Thr Phe Lys Arg Lys His Phe Arg Pro Thr Pro1 5 10 1541515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 415Val Thr Thr Thr Phe Lys Arg Lys His Phe Arg Pro Thr Pro Asp1 5 10 1541615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 416Thr Thr Thr Phe Lys Arg Lys His Phe Arg Pro Thr Pro Asp Ala1 5 10 1541715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 417Thr Thr Phe Lys Arg Lys His Phe Arg Pro Thr Pro Asp Ala Cys1 5 10 1541815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 418Thr Phe Lys Arg Lys His Phe Arg Pro Thr Pro Asp Ala Cys Arg1 5 10 1541915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 419Phe Lys Arg Lys His Phe Arg Pro Thr Pro Asp Ala Cys Arg Ala1 5 10 1542015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 420Lys Arg Lys His Phe Arg Pro Thr Pro Asp Ala Cys Arg Ala Ala1 5 10 1542115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 421Arg Lys His Phe Arg Pro Thr Pro Asp Ala Cys Arg Ala Ala Tyr1 5 10 1542215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 422Lys His Phe Arg Pro Thr Pro Asp Ala Cys Arg Ala Ala Tyr Asn1 5 10 1542315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 423His Phe Arg Pro Thr Pro Asp Ala Cys Arg Ala Ala Tyr Asn Trp1 5 10 1542415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 424Phe Arg Pro Thr Pro Asp Ala Cys Arg Ala Ala Tyr Asn Trp Lys1 5 10 1542515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 425Arg Pro Thr Pro Asp Ala Cys Arg Ala Ala Tyr Asn Trp Lys Met1 5 10 1542615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 426Pro Thr Pro Asp Ala Cys Arg Ala Ala Tyr Asn Trp Lys Met Ala1 5 10 1542715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 427Thr Pro Asp Ala Cys Arg Ala Ala Tyr Asn Trp Lys Met Ala Gly1 5 10 1542815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 428Pro Asp Ala Cys Arg Ala Ala Tyr Asn Trp Lys Met Ala Gly Asp1 5 10 1542915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 429Asp Ala Cys Arg Ala Ala Tyr Asn Trp Lys Met Ala Gly Asp Pro1 5 10 1543015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 430Ala Cys Arg Ala Ala Tyr Asn Trp Lys Met Ala Gly Asp Pro Arg1 5 10 1543115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 431Cys Arg Ala Ala Tyr Asn Trp Lys Met Ala Gly Asp Pro Arg Tyr1 5 10 1543215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 432Arg Ala Ala Tyr Asn Trp Lys Met Ala Gly Asp Pro Arg Tyr Glu1 5 10 1543315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 433Ala Ala Tyr Asn Trp Lys Met Ala Gly Asp Pro Arg Tyr Glu Glu1 5 10 1543415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 434Ala Tyr Asn Trp Lys Met Ala Gly Asp Pro Arg Tyr Glu Glu Ser1 5 10 1543515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 435Tyr Asn Trp Lys Met Ala Gly Asp Pro Arg Tyr Glu Glu Ser Leu1 5 10 1543615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 436Asn Trp Lys Met Ala Gly Asp Pro Arg Tyr Glu Glu Ser Leu His1 5 10 1543715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 437Trp Lys Met Ala Gly Asp Pro Arg Tyr Glu Glu Ser Leu His Asn1 5 10 1543815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 438Lys Met Ala Gly Asp Pro Arg Tyr Glu Glu Ser Leu His Asn Pro1 5 10 1543915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 439Met Ala Gly Asp Pro Arg Tyr Glu Glu Ser Leu His Asn Pro Tyr1 5 10 1544015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 440Ala Gly Asp Pro Arg Tyr Glu Glu Ser Leu His Asn Pro Tyr Pro1 5 10 1544115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 441Gly Asp Pro Arg Tyr Glu Glu Ser Leu His Asn Pro Tyr Pro Asp1 5 10 1544215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 442Asp Pro Arg Tyr Glu Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr1 5 10 1544315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 443Pro Arg Tyr Glu Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr Arg1 5 10 1544415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 444Arg Tyr Glu Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr Arg Trp1 5 10 1544515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 445Tyr Glu Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr Arg Trp Leu1 5 10 1544615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 446Glu Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr Arg Trp Leu Arg1 5 10 1544715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 447Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr Arg Trp Leu Arg Thr1 5 10 1544815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 448Ser Leu His Asn Pro Tyr Pro Asp Tyr Arg Trp Leu Arg Thr Val1 5 10 1544915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 449Leu His Asn Pro Tyr Pro Asp Tyr Arg Trp Leu Arg Thr Val Lys1 5 10 1545015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 450His Asn Pro Tyr Pro Asp Tyr Arg Trp Leu Arg Thr Val Lys Thr1 5 10 1545115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 451Asn Pro Tyr Pro Asp Tyr Arg Trp Leu Arg Thr Val Lys Thr Thr1 5 10 1545215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 452Pro Tyr Pro Asp Tyr Arg Trp Leu Arg Thr Val Lys Thr Thr Lys1 5 10 1545315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 453Tyr Pro Asp Tyr Arg Trp Leu Arg Thr Val Lys Thr Thr Lys Glu1 5 10 1545415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids

20-458 of SEQ ID NO207. 454Pro Asp Tyr Arg Trp Leu Arg Thr Val Lys Thr Thr Lys Glu Ser1 5 10 1545515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 455Asp Tyr Arg Trp Leu Arg Thr Val Lys Thr Thr Lys Glu Ser Leu1 5 10 1545615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 456Tyr Arg Trp Leu Arg Thr Val Lys Thr Thr Lys Glu Ser Leu Val1 5 10 1545715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 457Arg Trp Leu Arg Thr Val Lys Thr Thr Lys Glu Ser Leu Val Ile1 5 10 1545815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 458Trp Leu Arg Thr Val Lys Thr Thr Lys Glu Ser Leu Val Ile Ile1 5 10 1545915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 459Leu Arg Thr Val Lys Thr Thr Lys Glu Ser Leu Val Ile Ile Ser1 5 10 1546015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 460Arg Thr Val Lys Thr Thr Lys Glu Ser Leu Val Ile Ile Ser Pro1 5 10 1546115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 461Thr Val Lys Thr Thr Lys Glu Ser Leu Val Ile Ile Ser Pro Ser1 5 10 1546215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 462Val Lys Thr Thr Lys Glu Ser Leu Val Ile Ile Ser Pro Ser Val1 5 10 1546315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 463Lys Thr Thr Lys Glu Ser Leu Val Ile Ile Ser Pro Ser Val Ala1 5 10 1546415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 464Thr Thr Lys Glu Ser Leu Val Ile Ile Ser Pro Ser Val Ala Asp1 5 10 1546515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 465Thr Lys Glu Ser Leu Val Ile Ile Ser Pro Ser Val Ala Asp Leu1 5 10 1546615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 466Lys Glu Ser Leu Val Ile Ile Ser Pro Ser Val Ala Asp Leu Asp1 5 10 1546715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 467Glu Ser Leu Val Ile Ile Ser Pro Ser Val Ala Asp Leu Asp Pro1 5 10 1546815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 468Ser Leu Val Ile Ile Ser Pro Ser Val Ala Asp Leu Asp Pro Tyr1 5 10 1546915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 469Leu Val Ile Ile Ser Pro Ser Val Ala Asp Leu Asp Pro Tyr Asp1 5 10 1547015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 470Val Ile Ile Ser Pro Ser Val Ala Asp Leu Asp Pro Tyr Asp Arg1 5 10 1547115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 471Ile Ile Ser Pro Ser Val Ala Asp Leu Asp Pro Tyr Asp Arg Ser1 5 10 1547215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 472Ile Ser Pro Ser Val Ala Asp Leu Asp Pro Tyr Asp Arg Ser Leu1 5 10 1547315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 473Ser Pro Ser Val Ala Asp Leu Asp Pro Tyr Asp Arg Ser Leu His1 5 10 1547415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 474Pro Ser Val Ala Asp Leu Asp Pro Tyr Asp Arg Ser Leu His Ser1 5 10 1547515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 475Ser Val Ala Asp Leu Asp Pro Tyr Asp Arg Ser Leu His Ser Arg1 5 10 1547615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 476Val Ala Asp Leu Asp Pro Tyr Asp Arg Ser Leu His Ser Arg Val1 5 10 1547715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 477Ala Asp Leu Asp Pro Tyr Asp Arg Ser Leu His Ser Arg Val Phe1 5 10 1547815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 478Asp Leu Asp Pro Tyr Asp Arg Ser Leu His Ser Arg Val Phe Pro1 5 10 1547915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 479Leu Asp Pro Tyr Asp Arg Ser Leu His Ser Arg Val Phe Pro Ser1 5 10 1548015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 480Asp Pro Tyr Asp Arg Ser Leu His Ser Arg Val Phe Pro Ser Gly1 5 10 1548115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 481Pro Tyr Asp Arg Ser Leu His Ser Arg Val Phe Pro Ser Gly Lys1 5 10 1548215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 482Tyr Asp Arg Ser Leu His Ser Arg Val Phe Pro Ser Gly Lys Cys1 5 10 1548315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 483Asp Arg Ser Leu His Ser Arg Val Phe Pro Ser Gly Lys Cys Ser1 5 10 1548415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 484Arg Ser Leu His Ser Arg Val Phe Pro Ser Gly Lys Cys Ser Gly1 5 10 1548515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 485Ser Leu His Ser Arg Val Phe Pro Ser Gly Lys Cys Ser Gly Val1 5 10 1548615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 486Leu His Ser Arg Val Phe Pro Ser Gly Lys Cys Ser Gly Val Ala1 5 10 1548715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 487His Ser Arg Val Phe Pro Ser Gly Lys Cys Ser Gly Val Ala Val1 5 10 1548815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 488Ser Arg Val Phe Pro Ser Gly Lys Cys Ser Gly Val Ala Val Ser1 5 10 1548915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 489Arg Val Phe Pro Ser Gly Lys Cys Ser Gly Val Ala Val Ser Ser1 5 10 1549015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 490Val Phe Pro Ser Gly Lys Cys Ser Gly Val Ala Val Ser Ser Thr1 5 10 1549115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 491Phe Pro Ser Gly Lys Cys Ser Gly Val Ala Val Ser Ser Thr Tyr1 5 10 1549215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 492Pro Ser Gly Lys Cys Ser Gly Val Ala Val Ser Ser Thr Tyr Cys1 5 10 1549315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 493Ser Gly Lys Cys Ser Gly Val Ala Val Ser Ser Thr Tyr Cys Ser1 5 10 1549415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 494Gly Lys Cys Ser Gly Val Ala Val Ser Ser Thr Tyr Cys Ser Thr1 5 10 1549515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 495Lys Cys Ser Gly Val Ala Val Ser Ser Thr Tyr Cys Ser Thr Asn1 5 10 1549615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 496Cys Ser Gly Val Ala Val Ser Ser Thr Tyr Cys Ser Thr Asn His1 5 10 1549715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 497Ser Gly Val Ala Val Ser Ser Thr Tyr Cys Ser Thr Asn His Asp1 5 10 1549815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 498Gly Val Ala Val Ser Ser Thr Tyr Cys Ser Thr Asn His Asp Tyr1 5 10 1549915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 499Val Ala Val Ser Ser Thr Tyr Cys Ser Thr Asn His Asp Tyr Thr1 5 10 1550015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain

of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 500Ala Val Ser Ser Thr Tyr Cys Ser Thr Asn His Asp Tyr Thr Ile1 5 10 1550115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 501Val Ser Ser Thr Tyr Cys Ser Thr Asn His Asp Tyr Thr Ile Trp1 5 10 1550215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 502Ser Ser Thr Tyr Cys Ser Thr Asn His Asp Tyr Thr Ile Trp Met1 5 10 1550315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 503Ser Thr Tyr Cys Ser Thr Asn His Asp Tyr Thr Ile Trp Met Pro1 5 10 1550415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 504Thr Tyr Cys Ser Thr Asn His Asp Tyr Thr Ile Trp Met Pro Glu1 5 10 1550515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 505Tyr Cys Ser Thr Asn His Asp Tyr Thr Ile Trp Met Pro Glu Asn1 5 10 1550615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 506Cys Ser Thr Asn His Asp Tyr Thr Ile Trp Met Pro Glu Asn Pro1 5 10 1550715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 507Ser Thr Asn His Asp Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg1 5 10 1550815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 508Thr Asn His Asp Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg Leu1 5 10 1550915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 509Asn His Asp Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg Leu Gly1 5 10 1551015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 510His Asp Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Met1 5 10 1551115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 511Asp Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Met Ser1 5 10 1551215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 512Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Met Ser Cys1 5 10 1551315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 513Thr Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Met Ser Cys Asp1 5 10 1551415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 514Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Met Ser Cys Asp Ile1 5 10 1551515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 515Trp Met Pro Glu Asn Pro Arg Leu Gly Met Ser Cys Asp Ile Phe1 5 10 1551615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 516Met Pro Glu Asn Pro Arg Leu Gly Met Ser Cys Asp Ile Phe Thr1 5 10 1551715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 517Pro Glu Asn Pro Arg Leu Gly Met Ser Cys Asp Ile Phe Thr Asn1 5 10 1551815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 518Glu Asn Pro Arg Leu Gly Met Ser Cys Asp Ile Phe Thr Asn Ser1 5 10 1551915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 519Asn Pro Arg Leu Gly Met Ser Cys Asp Ile Phe Thr Asn Ser Arg1 5 10 1552015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 520Pro Arg Leu Gly Met Ser Cys Asp Ile Phe Thr Asn Ser Arg Gly1 5 10 1552115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 521Arg Leu Gly Met Ser Cys Asp Ile Phe Thr Asn Ser Arg Gly Lys1 5 10 1552215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 522Leu Gly Met Ser Cys Asp Ile Phe Thr Asn Ser Arg Gly Lys Arg1 5 10 1552315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 523Gly Met Ser Cys Asp Ile Phe Thr Asn Ser Arg Gly Lys Arg Ala1 5 10 1552415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 524Met Ser Cys Asp Ile Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser1 5 10 1552515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 525Ser Cys Asp Ile Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys1 5 10 1552615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 526Cys Asp Ile Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly1 5 10 1552715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 527Asp Ile Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser1 5 10 1552815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 528Ile Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser Glu1 5 10 1552915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 529Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser Glu Thr1 5 10 1553015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 530Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser Glu Thr Cys1 5 10 1553115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 531Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser Glu Thr Cys Gly1 5 10 1553215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 532Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser Glu Thr Cys Gly Phe1 5 10 1553315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 533Arg Gly Lys Arg Ala Ser Lys Gly Ser Glu Thr Cys Gly Phe Val1 5 10 1553415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 534Gly Lys Arg Ala Ser Lys Gly Ser Glu Thr Cys Gly Phe Val Asp1 5 10 1553515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 535Lys Arg Ala Ser Lys Gly Ser Glu Thr Cys Gly Phe Val Asp Glu1 5 10 1553615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 536Arg Ala Ser Lys Gly Ser Glu Thr Cys Gly Phe Val Asp Glu Arg1 5 10 1553715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 537Ala Ser Lys Gly Ser Glu Thr Cys Gly Phe Val Asp Glu Arg Gly1 5 10 1553815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 538Ser Lys Gly Ser Glu Thr Cys Gly Phe Val Asp Glu Arg Gly Leu1 5 10 1553915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 539Lys Gly Ser Glu Thr Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr1 5 10 1554015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 540Gly Ser Glu Thr Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys1 5 10 1554115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 541Ser Glu Thr Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser1 5 10 1554215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 542Glu Thr Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu1 5 10 1554315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 543Thr Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys1 5 10 1554415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 544Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly1 5 10 1554515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 545Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly Ala1 5

10 1554615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 546Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly Ala Cys1 5 10 1554715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 547Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly Ala Cys Lys1 5 10 1554815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 548Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly Ala Cys Lys Leu1 5 10 1554915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 549Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly Ala Cys Lys Leu Lys1 5 10 1555015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 550Arg Gly Leu Tyr Lys Ser Leu Lys Gly Ala Cys Lys Leu Lys Leu1 5 10 1555115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 551Gly Leu Tyr Lys Ser Leu Lys Gly Ala Cys Lys Leu Lys Leu Cys1 5 10 1555215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 552Leu Tyr Lys Ser Leu Lys Gly Ala Cys Lys Leu Lys Leu Cys Gly1 5 10 1555315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 553Tyr Lys Ser Leu Lys Gly Ala Cys Lys Leu Lys Leu Cys Gly Val1 5 10 1555415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 554Lys Ser Leu Lys Gly Ala Cys Lys Leu Lys Leu Cys Gly Val Leu1 5 10 1555515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 555Leu Cys Gly Val Leu Gly Leu Arg Leu Met Asp Gly Thr Trp Val1 5 10 1555615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 556Cys Gly Val Leu Gly Leu Arg Leu Met Asp Gly Thr Trp Val Ala1 5 10 1555715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 557Gly Val Leu Gly Leu Arg Leu Met Asp Gly Thr Trp Val Ala Met1 5 10 1555815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 558Val Leu Gly Leu Arg Leu Met Asp Gly Thr Trp Val Ala Met Gln1 5 10 1555915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 559Leu Gly Leu Arg Leu Met Asp Gly Thr Trp Val Ala Met Gln Thr1 5 10 1556015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 560Gly Leu Arg Leu Met Asp Gly Thr Trp Val Ala Met Gln Thr Ser1 5 10 1556115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 561Leu Arg Leu Met Asp Gly Thr Trp Val Ala Met Gln Thr Ser Asn1 5 10 1556215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 562Arg Leu Met Asp Gly Thr Trp Val Ala Met Gln Thr Ser Asn Glu1 5 10 1556315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 563Leu Met Asp Gly Thr Trp Val Ala Met Gln Thr Ser Asn Glu Thr1 5 10 1556415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 564Met Asp Gly Thr Trp Val Ala Met Gln Thr Ser Asn Glu Thr Lys1 5 10 1556515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 565Asp Gly Thr Trp Val Ala Met Gln Thr Ser Asn Glu Thr Lys Trp1 5 10 1556615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 566Gly Thr Trp Val Ala Met Gln Thr Ser Asn Glu Thr Lys Trp Cys1 5 10 1556715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 567Thr Trp Val Ala Met Gln Thr Ser Asn Glu Thr Lys Trp Cys Pro1 5 10 1556815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 568Trp Val Ala Met Gln Thr Ser Asn Glu Thr Lys Trp Cys Pro Pro1 5 10 1556915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 569Val Ala Met Gln Thr Ser Asn Glu Thr Lys Trp Cys Pro Pro Asp1 5 10 1557015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 570Ala Met Gln Thr Ser Asn Glu Thr Lys Trp Cys Pro Pro Asp Gln1 5 10 1557115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 571Met Gln Thr Ser Asn Glu Thr Lys Trp Cys Pro Pro Asp Gln Leu1 5 10 1557215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 572Gln Thr Ser Asn Glu Thr Lys Trp Cys Pro Pro Asp Gln Leu Val1 5 10 1557315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 573Thr Ser Asn Glu Thr Lys Trp Cys Pro Pro Asp Gln Leu Val Asn1 5 10 1557415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 574Ser Asn Glu Thr Lys Trp Cys Pro Pro Asp Gln Leu Val Asn Leu1 5 10 1557515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 575Asn Glu Thr Lys Trp Cys Pro Pro Asp Gln Leu Val Asn Leu His1 5 10 1557615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 576Glu Thr Lys Trp Cys Pro Pro Asp Gln Leu Val Asn Leu His Asp1 5 10 1557715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 577Thr Lys Trp Cys Pro Pro Asp Gln Leu Val Asn Leu His Asp Phe1 5 10 1557815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 578Lys Trp Cys Pro Pro Asp Gln Leu Val Asn Leu His Asp Phe Arg1 5 10 1557915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 579Trp Cys Pro Pro Asp Gln Leu Val Asn Leu His Asp Phe Arg Ser1 5 10 1558015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 580Cys Pro Pro Asp Gln Leu Val Asn Leu His Asp Phe Arg Ser Asp1 5 10 1558115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 581Pro Pro Asp Gln Leu Val Asn Leu His Asp Phe Arg Ser Asp Glu1 5 10 1558215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 582Pro Asp Gln Leu Val Asn Leu His Asp Phe Arg Ser Asp Glu Ile1 5 10 1558315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 583Asp Gln Leu Val Asn Leu His Asp Phe Arg Ser Asp Glu Ile Glu1 5 10 1558415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 584Gln Leu Val Asn Leu His Asp Phe Arg Ser Asp Glu Ile Glu His1 5 10 1558515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 585Leu Val Asn Leu His Asp Phe Arg Ser Asp Glu Ile Glu His Leu1 5 10 1558615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 586Val Asn Leu His Asp Phe Arg Ser Asp Glu Ile Glu His Leu Val1 5 10 1558715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 587Asn Leu His Asp Phe Arg Ser Asp Glu Ile Glu His Leu Val Val1 5 10 1558815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 588Leu His Asp Phe Arg Ser Asp Glu Ile Glu His Leu Val Val Glu1 5 10 1558915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 589His Asp Phe Arg Ser Asp Glu Ile Glu His Leu Val Val Glu Glu1 5 10 1559015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 590Asp Phe Arg Ser Asp Glu Ile Glu His Leu Val Val Glu Glu Leu1 5 10 1559115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of

glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 591Phe Arg Ser Asp Glu Ile Glu His Leu Val Val Glu Glu Leu Val1 5 10 1559215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 592Arg Ser Asp Glu Ile Glu His Leu Val Val Glu Glu Leu Val Arg1 5 10 1559315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 593Ser Asp Glu Ile Glu His Leu Val Val Glu Glu Leu Val Arg Lys1 5 10 1559415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 594Asp Glu Ile Glu His Leu Val Val Glu Glu Leu Val Arg Lys Arg1 5 10 1559515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 595Glu Ile Glu His Leu Val Val Glu Glu Leu Val Arg Lys Arg Glu1 5 10 1559615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 596Ile Glu His Leu Val Val Glu Glu Leu Val Arg Lys Arg Glu Glu1 5 10 1559715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 597Glu His Leu Val Val Glu Glu Leu Val Arg Lys Arg Glu Glu Cys1 5 10 1559815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 598His Leu Val Val Glu Glu Leu Val Arg Lys Arg Glu Glu Cys Leu1 5 10 1559915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 599Leu Val Val Glu Glu Leu Val Arg Lys Arg Glu Glu Cys Leu Asp1 5 10 1560015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 600Val Val Glu Glu Leu Val Arg Lys Arg Glu Glu Cys Leu Asp Ala1 5 10 1560115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 601Val Glu Glu Leu Val Arg Lys Arg Glu Glu Cys Leu Asp Ala Leu1 5 10 1560215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 602Glu Glu Leu Val Arg Lys Arg Glu Glu Cys Leu Asp Ala Leu Glu1 5 10 1560315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 603Glu Leu Val Arg Lys Arg Glu Glu Cys Leu Asp Ala Leu Glu Ser1 5 10 1560415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 604Leu Val Arg Lys Arg Glu Glu Cys Leu Asp Ala Leu Glu Ser Ile1 5 10 1560515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 605Val Arg Lys Arg Glu Glu Cys Leu Asp Ala Leu Glu Ser Ile Met1 5 10 1560615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 606Arg Lys Arg Glu Glu Cys Leu Asp Ala Leu Glu Ser Ile Met Thr1 5 10 1560715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 607Lys Arg Glu Glu Cys Leu Asp Ala Leu Glu Ser Ile Met Thr Thr1 5 10 1560815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 608Arg Glu Glu Cys Leu Asp Ala Leu Glu Ser Ile Met Thr Thr Lys1 5 10 1560915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 609Glu Glu Cys Leu Asp Ala Leu Glu Ser Ile Met Thr Thr Lys Ser1 5 10 1561015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 610Glu Cys Leu Asp Ala Leu Glu Ser Ile Met Thr Thr Lys Ser Val1 5 10 1561115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 611Cys Leu Asp Ala Leu Glu Ser Ile Met Thr Thr Lys Ser Val Ser1 5 10 1561215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 612Leu Asp Ala Leu Glu Ser Ile Met Thr Thr Lys Ser Val Ser Phe1 5 10 1561315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 613Asp Ala Leu Glu Ser Ile Met Thr Thr Lys Ser Val Ser Phe Arg1 5 10 1561415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 614Ala Leu Glu Ser Ile Met Thr Thr Lys Ser Val Ser Phe Arg Arg1 5 10 1561515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 615Leu Glu Ser Ile Met Thr Thr Lys Ser Val Ser Phe Arg Arg Leu1 5 10 1561615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 616Glu Ser Ile Met Thr Thr Lys Ser Val Ser Phe Arg Arg Leu Ser1 5 10 1561715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 617Ser Ile Met Thr Thr Lys Ser Val Ser Phe Arg Arg Leu Ser His1 5 10 1561815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 618Ile Met Thr Thr Lys Ser Val Ser Phe Arg Arg Leu Ser His Leu1 5 10 1561915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 619Met Thr Thr Lys Ser Val Ser Phe Arg Arg Leu Ser His Leu Arg1 5 10 1562015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 620Thr Thr Lys Ser Val Ser Phe Arg Arg Leu Ser His Leu Arg Lys1 5 10 1562115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 621Thr Lys Ser Val Ser Phe Arg Arg Leu Ser His Leu Arg Lys Leu1 5 10 1562215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 622Lys Ser Val Ser Phe Arg Arg Leu Ser His Leu Arg Lys Leu Val1 5 10 1562315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 623Ser Val Ser Phe Arg Arg Leu Ser His Leu Arg Lys Leu Val Pro1 5 10 1562415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 624Val Ser Phe Arg Arg Leu Ser His Leu Arg Lys Leu Val Pro Gly1 5 10 1562515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 625Ser Phe Arg Arg Leu Ser His Leu Arg Lys Leu Val Pro Gly Phe1 5 10 1562615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 626Phe Arg Arg Leu Ser His Leu Arg Lys Leu Val Pro Gly Phe Gly1 5 10 1562715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 627Arg Arg Leu Ser His Leu Arg Lys Leu Val Pro Gly Phe Gly Lys1 5 10 1562815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 628Arg Leu Ser His Leu Arg Lys Leu Val Pro Gly Phe Gly Lys Ala1 5 10 1562915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 629Leu Ser His Leu Arg Lys Leu Val Pro Gly Phe Gly Lys Ala Tyr1 5 10 1563015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 630Ser His Leu Arg Lys Leu Val Pro Gly Phe Gly Lys Ala Tyr Thr1 5 10 1563115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 631His Leu Arg Lys Leu Val Pro Gly Phe Gly Lys Ala Tyr Thr Ile1 5 10 1563215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 632Leu Arg Lys Leu Val Pro Gly Phe Gly Lys Ala Tyr Thr Ile Phe1 5 10 1563315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 633Arg Lys Leu Val Pro Gly Phe Gly Lys Ala Tyr Thr Ile Phe Asn1 5 10 1563415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 634Lys Leu Val Pro Gly Phe Gly Lys Ala Tyr Thr Ile Phe Asn Lys1 5 10 1563515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 635Leu Val Pro Gly Phe Gly Lys Ala Tyr Thr Ile Phe Asn Lys Thr1 5 10 1563615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 636Val Pro Gly Phe Gly Lys Ala Tyr Thr Ile Phe Asn Lys Thr Leu1 5 10 1563715PRTArtificial Sequence15 contiguous and consecutive amino acids

from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 637Pro Gly Phe Gly Lys Ala Tyr Thr Ile Phe Asn Lys Thr Leu Met1 5 10 1563815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 638Asn Lys Thr Leu Met Glu Ala Asp Ala His Tyr Lys Ser Val Arg1 5 10 1563915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 639Lys Thr Leu Met Glu Ala Asp Ala His Tyr Lys Ser Val Arg Thr1 5 10 1564015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 640Thr Leu Met Glu Ala Asp Ala His Tyr Lys Ser Val Arg Thr Trp1 5 10 1564115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 641Leu Met Glu Ala Asp Ala His Tyr Lys Ser Val Arg Thr Trp Asn1 5 10 1564215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 642Met Glu Ala Asp Ala His Tyr Lys Ser Val Arg Thr Trp Asn Glu1 5 10 1564315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 643Glu Ala Asp Ala His Tyr Lys Ser Val Arg Thr Trp Asn Glu Ile1 5 10 1564415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 644Ala Asp Ala His Tyr Lys Ser Val Arg Thr Trp Asn Glu Ile Leu1 5 10 1564515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 645Asp Ala His Tyr Lys Ser Val Arg Thr Trp Asn Glu Ile Leu Pro1 5 10 1564615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 646Ala His Tyr Lys Ser Val Arg Thr Trp Asn Glu Ile Leu Pro Ser1 5 10 1564715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 647His Tyr Lys Ser Val Arg Thr Trp Asn Glu Ile Leu Pro Ser Lys1 5 10 1564815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 648Tyr Lys Ser Val Arg Thr Trp Asn Glu Ile Leu Pro Ser Lys Gly1 5 10 1564915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 649Lys Ser Val Arg Thr Trp Asn Glu Ile Leu Pro Ser Lys Gly Cys1 5 10 1565015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 650Ser Val Arg Thr Trp Asn Glu Ile Leu Pro Ser Lys Gly Cys Leu1 5 10 1565115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 651Val Arg Thr Trp Asn Glu Ile Leu Pro Ser Lys Gly Cys Leu Arg1 5 10 1565215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 652Arg Thr Trp Asn Glu Ile Leu Pro Ser Lys Gly Cys Leu Arg Val1 5 10 1565315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 653Thr Trp Asn Glu Ile Leu Pro Ser Lys Gly Cys Leu Arg Val Gly1 5 10 1565415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 654Trp Asn Glu Ile Leu Pro Ser Lys Gly Cys Leu Arg Val Gly Gly1 5 10 1565515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 655Asn Glu Ile Leu Pro Ser Lys Gly Cys Leu Arg Val Gly Gly Arg1 5 10 1565615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 656Glu Ile Leu Pro Ser Lys Gly Cys Leu Arg Val Gly Gly Arg Cys1 5 10 1565715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 657Ile Leu Pro Ser Lys Gly Cys Leu Arg Val Gly Gly Arg Cys His1 5 10 1565815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 658Leu Pro Ser Lys Gly Cys Leu Arg Val Gly Gly Arg Cys His Pro1 5 10 1565915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 659Pro Ser Lys Gly Cys Leu Arg Val Gly Gly Arg Cys His Pro His1 5 10 1566015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 660Ser Lys Gly Cys Leu Arg Val Gly Gly Arg Cys His Pro His Val1 5 10 1566115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 661Lys Gly Cys Leu Arg Val Gly Gly Arg Cys His Pro His Val Asn1 5 10 1566215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 662Gly Cys Leu Arg Val Gly Gly Arg Cys His Pro His Val Asn Gly1 5 10 1566315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 663Cys Leu Arg Val Gly Gly Arg Cys His Pro His Val Asn Gly Val1 5 10 1566415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 664Leu Arg Val Gly Gly Arg Cys His Pro His Val Asn Gly Val Phe1 5 10 1566515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 665Arg Val Gly Gly Arg Cys His Pro His Val Asn Gly Val Phe Phe1 5 10 1566615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 666Val Gly Gly Arg Cys His Pro His Val Asn Gly Val Phe Phe Asn1 5 10 1566715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 667Gly Gly Arg Cys His Pro His Val Asn Gly Val Phe Phe Asn Gly1 5 10 1566815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 668Gly Arg Cys His Pro His Val Asn Gly Val Phe Phe Asn Gly Ile1 5 10 1566915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 669Arg Cys His Pro His Val Asn Gly Val Phe Phe Asn Gly Ile Ile1 5 10 1567015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 670Cys His Pro His Val Asn Gly Val Phe Phe Asn Gly Ile Ile Leu1 5 10 1567115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 671His Pro His Val Asn Gly Val Phe Phe Asn Gly Ile Ile Leu Gly1 5 10 1567215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 672Pro His Val Asn Gly Val Phe Phe Asn Gly Ile Ile Leu Gly Pro1 5 10 1567315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 673His Val Asn Gly Val Phe Phe Asn Gly Ile Ile Leu Gly Pro Asp1 5 10 1567415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 674Val Asn Gly Val Phe Phe Asn Gly Ile Ile Leu Gly Pro Asp Gly1 5 10 1567515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 675Asn Gly Val Phe Phe Asn Gly Ile Ile Leu Gly Pro Asp Gly Asn1 5 10 1567615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 676Gly Val Phe Phe Asn Gly Ile Ile Leu Gly Pro Asp Gly Asn Val1 5 10 1567715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 677Val Phe Phe Asn Gly Ile Ile Leu Gly Pro Asp Gly Asn Val Leu1 5 10 1567815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 678Phe Phe Asn Gly Ile Ile Leu Gly Pro Asp Gly Asn Val Leu Ile1 5 10 1567915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 679Phe Asn Gly Ile Ile Leu Gly Pro Asp Gly Asn Val Leu Ile Pro1 5 10 1568015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 680Asn Gly Ile Ile Leu Gly Pro Asp Gly Asn Val Leu Ile Pro Glu1 5 10 1568115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 681Gly Ile Ile Leu Gly Pro Asp Gly Asn Val Leu Ile Pro Glu Met1 5 10 1568215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 682Ile Ile Leu Gly Pro Asp Gly Asn Val Leu Ile

Pro Glu Met Gln1 5 10 1568315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 683Ile Leu Gly Pro Asp Gly Asn Val Leu Ile Pro Glu Met Gln Ser1 5 10 1568415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 684Leu Gly Pro Asp Gly Asn Val Leu Ile Pro Glu Met Gln Ser Ser1 5 10 1568515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 685Gly Pro Asp Gly Asn Val Leu Ile Pro Glu Met Gln Ser Ser Leu1 5 10 1568615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 686Pro Asp Gly Asn Val Leu Ile Pro Glu Met Gln Ser Ser Leu Leu1 5 10 1568715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 687Asp Gly Asn Val Leu Ile Pro Glu Met Gln Ser Ser Leu Leu Gln1 5 10 1568815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 688Gly Asn Val Leu Ile Pro Glu Met Gln Ser Ser Leu Leu Gln Gln1 5 10 1568915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 689Asn Val Leu Ile Pro Glu Met Gln Ser Ser Leu Leu Gln Gln His1 5 10 1569015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 690Val Leu Ile Pro Glu Met Gln Ser Ser Leu Leu Gln Gln His Met1 5 10 1569115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 691Leu Ile Pro Glu Met Gln Ser Ser Leu Leu Gln Gln His Met Glu1 5 10 1569215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 692Ile Pro Glu Met Gln Ser Ser Leu Leu Gln Gln His Met Glu Leu1 5 10 1569315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 693Pro Glu Met Gln Ser Ser Leu Leu Gln Gln His Met Glu Leu Leu1 5 10 1569415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 694Glu Met Gln Ser Ser Leu Leu Gln Gln His Met Glu Leu Leu Glu1 5 10 1569515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 695Met Gln Ser Ser Leu Leu Gln Gln His Met Glu Leu Leu Glu Ser1 5 10 1569615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 696Gln Ser Ser Leu Leu Gln Gln His Met Glu Leu Leu Glu Ser Ser1 5 10 1569715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 697Ser Ser Leu Leu Gln Gln His Met Glu Leu Leu Glu Ser Ser Val1 5 10 1569815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 698Ser Leu Leu Gln Gln His Met Glu Leu Leu Glu Ser Ser Val Ile1 5 10 1569915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 699Leu Leu Gln Gln His Met Glu Leu Leu Glu Ser Ser Val Ile Pro1 5 10 1570015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 700Leu Gln Gln His Met Glu Leu Leu Glu Ser Ser Val Ile Pro Leu1 5 10 1570115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 701Gln Gln His Met Glu Leu Leu Glu Ser Ser Val Ile Pro Leu Val1 5 10 1570215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 702Gln His Met Glu Leu Leu Glu Ser Ser Val Ile Pro Leu Val His1 5 10 1570315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 703His Met Glu Leu Leu Glu Ser Ser Val Ile Pro Leu Val His Pro1 5 10 1570415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 704Met Glu Leu Leu Glu Ser Ser Val Ile Pro Leu Val His Pro Leu1 5 10 1570515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 705Glu Leu Leu Glu Ser Ser Val Ile Pro Leu Val His Pro Leu Ala1 5 10 1570615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 706Leu Leu Glu Ser Ser Val Ile Pro Leu Val His Pro Leu Ala Asp1 5 10 1570715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 707Leu Glu Ser Ser Val Ile Pro Leu Val His Pro Leu Ala Asp Pro1 5 10 1570815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 708Glu Ser Ser Val Ile Pro Leu Val His Pro Leu Ala Asp Pro Ser1 5 10 1570915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 709Ser Ser Val Ile Pro Leu Val His Pro Leu Ala Asp Pro Ser Thr1 5 10 1571015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 710Ser Val Ile Pro Leu Val His Pro Leu Ala Asp Pro Ser Thr Val1 5 10 1571115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 711Val Ile Pro Leu Val His Pro Leu Ala Asp Pro Ser Thr Val Phe1 5 10 1571215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 712Ile Pro Leu Val His Pro Leu Ala Asp Pro Ser Thr Val Phe Lys1 5 10 1571315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 713Pro Leu Val His Pro Leu Ala Asp Pro Ser Thr Val Phe Lys Asp1 5 10 1571415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 714Leu Val His Pro Leu Ala Asp Pro Ser Thr Val Phe Lys Asp Gly1 5 10 1571515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 715Val His Pro Leu Ala Asp Pro Ser Thr Val Phe Lys Asp Gly Asp1 5 10 1571615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 716His Pro Leu Ala Asp Pro Ser Thr Val Phe Lys Asp Gly Asp Glu1 5 10 1571715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 717Pro Leu Ala Asp Pro Ser Thr Val Phe Lys Asp Gly Asp Glu Ala1 5 10 1571815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 718Leu Ala Asp Pro Ser Thr Val Phe Lys Asp Gly Asp Glu Ala Glu1 5 10 1571915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 719Ala Asp Pro Ser Thr Val Phe Lys Asp Gly Asp Glu Ala Glu Asp1 5 10 1572015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 720Asp Pro Ser Thr Val Phe Lys Asp Gly Asp Glu Ala Glu Asp Phe1 5 10 1572115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 721Pro Ser Thr Val Phe Lys Asp Gly Asp Glu Ala Glu Asp Phe Val1 5 10 1572215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 722Ser Thr Val Phe Lys Asp Gly Asp Glu Ala Glu Asp Phe Val Glu1 5 10 1572315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 723Thr Val Phe Lys Asp Gly Asp Glu Ala Glu Asp Phe Val Glu Val1 5 10 1572415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 724Val Phe Lys Asp Gly Asp Glu Ala Glu Asp Phe Val Glu Val His1 5 10 1572515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 725Phe Lys Asp Gly Asp Glu Ala Glu Asp Phe Val Glu Val His Leu1 5 10 1572615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 726Lys Asp Gly Asp Glu Ala Glu Asp Phe Val Glu Val His Leu Pro1 5 10 1572715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 727Asp Gly Asp Glu Ala Glu Asp Phe Val Glu Val His Leu Pro Asp1 5 10 1572815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein

the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 728Gly Asp Glu Ala Glu Asp Phe Val Glu Val His Leu Pro Asp Val1 5 10 1572915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 729Asp Glu Ala Glu Asp Phe Val Glu Val His Leu Pro Asp Val His1 5 10 1573015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 730Glu Ala Glu Asp Phe Val Glu Val His Leu Pro Asp Val His Asn1 5 10 1573115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 731Ala Glu Asp Phe Val Glu Val His Leu Pro Asp Val His Asn Gln1 5 10 1573215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 732Glu Asp Phe Val Glu Val His Leu Pro Asp Val His Asn Gln Val1 5 10 1573315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 733Asp Phe Val Glu Val His Leu Pro Asp Val His Asn Gln Val Ser1 5 10 1573415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 734Phe Val Glu Val His Leu Pro Asp Val His Asn Gln Val Ser Gly1 5 10 1573515PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 735Val Glu Val His Leu Pro Asp Val His Asn Gln Val Ser Gly Val1 5 10 1573615PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 736Glu Val His Leu Pro Asp Val His Asn Gln Val Ser Gly Val Asp1 5 10 1573715PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 737Val His Leu Pro Asp Val His Asn Gln Val Ser Gly Val Asp Leu1 5 10 1573815PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 738His Leu Pro Asp Val His Asn Gln Val Ser Gly Val Asp Leu Gly1 5 10 1573915PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 739Leu Pro Asp Val His Asn Gln Val Ser Gly Val Asp Leu Gly Leu1 5 10 1574015PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 740Pro Asp Val His Asn Gln Val Ser Gly Val Asp Leu Gly Leu Pro1 5 10 1574115PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 741Asp Val His Asn Gln Val Ser Gly Val Asp Leu Gly Leu Pro Asn1 5 10 1574215PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 742Val His Asn Gln Val Ser Gly Val Asp Leu Gly Leu Pro Asn Trp1 5 10 1574315PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 743His Asn Gln Val Ser Gly Val Asp Leu Gly Leu Pro Asn Trp Gly1 5 10 1574415PRTArtificial Sequence15 contiguous and consecutive amino acids from the extracellular domain of glycoprotein G of rabies virus strain ERA (SEQ ID NO207), wherein the extracellular domain of glycoprotein G consists of amino acids 20-458 of SEQ ID NO207. 744Asn Gln Val Ser Gly Val Asp Leu Gly Leu Pro Asn Trp Gly Lys1 5 10 1574521DNARabies virus - part of glycoprotein of CVS-11 745cggacctgga atgagatcat c 2174621DNARabies virus - part of glycoprotein of E98-2, 4, 5, 6, 7 746cggacctggg atgagatcat c 2174718PRTRabies virus - part of glycoprotein of CVS-11 747His Tyr Lys Ser Val Arg Thr Trp Asn Glu Ile Ile Pro Ser Lys Gly1 5 10 15Cys Leu74818PRTRabies virus - part of glycoprotein of E98-2, 4, 5, 6, 7 748His Tyr Lys Ser Val Arg Thr Trp Asp Glu Ile Ile Pro Ser Lys Gly1 5 10 15Cys Leu

Claims

1.-5. (canceled)

6. A pharmaceutical composition comprising two recombinant human monoclonal antibodies, wherein the recombinant human monoclonal antibodies have isoelectric points as measured by isoelectric focusing that differ by less than 1.5 pI units.

7. The pharmaceutical composition of claim 6, wherein the isoelectric points differ by less than 1.2 pI units.

8. The pharmaceutical composition of claim 6, wherein both recombinant human monoclonal antibodies are capable of neutralizing an infectious agent.

9. The pharmaceutical composition of claim 8, wherein both recombinant human monoclonal antibodies are capable of neutralizing rabies virus.