U.S. patent application number 12/268412 was filed with the patent office on 2010-12-02 for production of collagen in the milk of transgenic mammals.
This patent application is currently assigned to Pharming Intellectual Property B.V.. Invention is credited to Richard Berg, Ineke De Wit, Costas N. Karatzas, Frank Pieper, Gerard Platenburg, Paul David Toman.
Application Number | 20100305039 12/268412 |
Document ID | / |
Family ID | 26960921 |
Filed Date | 2010-12-02 |
United States Patent
Application |
20100305039 |
Kind Code |
A1 |
Karatzas; Costas N. ; et
al. |
December 2, 2010 |
Production of collagen in the milk of transgenic mammals
Abstract
The invention provides transgenic nonhuman mammals capable
secreting exogenous procollagen or collagen into their milk. The
mammals are healthy and capable of producing procollagen or
collagen at high levels, usually in trimeric form. Suitable
transgenes for incorporation into the mammals are also
provided.
Inventors: |
Karatzas; Costas N.;
(Beaconsfield, CA) ; Pieper; Frank; (Leiden,
NL) ; De Wit; Ineke; (Leiden, NL) ; Berg;
Richard; (Los Altos, CA) ; Platenburg; Gerard;
(Voorschoten, NL) ; Toman; Paul David; (Mountain
View, CA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER, EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
Pharming Intellectual Property
B.V.
Leiden
CA
Cohesion Technologies, Inc.
Palo Alto
GENE PHARMING EUROPE B.V.
COLLAGEN CORPORATION
|
Family ID: |
26960921 |
Appl. No.: |
12/268412 |
Filed: |
November 10, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10741236 |
Dec 18, 2003 |
|
|
|
12268412 |
|
|
|
|
08482173 |
Jun 7, 1995 |
6713662 |
|
|
10741236 |
|
|
|
|
08281493 |
Jul 27, 1994 |
|
|
|
08482173 |
|
|
|
|
Current U.S.
Class: |
514/16.6 ;
514/17.1; 514/17.2; 530/356 |
Current CPC
Class: |
A23C 9/20 20130101; A01K
2227/10 20130101; A01K 2227/105 20130101; C07K 14/78 20130101; A61P
19/02 20180101; A01K 67/0278 20130101; A01K 2207/15 20130101; A01K
2227/101 20130101; A61P 29/00 20180101; A23J 1/20 20130101; C12N
15/8509 20130101; A01K 2217/00 20130101; A01K 2217/05 20130101;
A01K 2267/01 20130101; A23J 3/06 20130101; C07K 2319/02
20130101 |
Class at
Publication: |
514/16.6 ;
530/356; 514/17.2; 514/17.1 |
International
Class: |
A61K 38/39 20060101
A61K038/39; C07K 14/78 20060101 C07K014/78; A61P 19/02 20060101
A61P019/02; A61P 29/00 20060101 A61P029/00 |
Claims
1-33. (canceled)
34. A procollagen or collagen protein, wherein 7-27% of proline
residues of the protein are hydroxylated, and/or 0-5% of lysine
residues of the protein are hydroxylated.
35. The protein of claim 34 in purified form.
36. The protein of claim 34 that is procollagen.
37. The protein of claim 34 that is collagen.
38. The protein of claim 34, wherein 7-27% of proline residues of
the protein are hydroxylated and 0-5% of lysine residues of the
protein are hydroxylated.
39. The protein of claim 34, wherein 7-27% of proline residues in
the protein are hydroxylated.
40. The procollagen or collagen of claim 34 in trimeric form.
41. The procollagen or collagen of claim 34 in homotrimeric
form.
42. The procollagen or collagen protein of claim 46 associated with
another type of procollagen or collagen protein in heterotrimeric
form.
43. The protein of claim 34, wherein the protein is human.
44. The protein of claim 34 that is pro.alpha.1(I).
45. The protein of claim 34 produced by (a) providing a transgenic
nonhuman mammal having a transgene comprising: (i) a mammary-gland
specific promoter; (ii) a mammary-gland specific enhancer; (iii) a
secretory DNA segment encoding a signal peptide functional in
mammary secretory cells of the transgenic nonhuman mammal; and (iv)
a recombinant DNA segment encoding an exogenous procollagen
polypeptide operably linked to the secretory DNA segment to form a
secretory-recombinant DNA segment, the secretory-recombinant DNA
segment being operably linked to the promoter and to the enhancer;
wherein the transgene, in an adult form of the nonhuman mammal or a
female descendant of the nonhuman mammal, expresses the
secretory-recombinant DNA segment in the mammary secretory cells to
produce a form of the exogenous procollagen polypeptide that is
processed and secreted by the mammary secretory cells into milk as
exogenous procollagen or collagen in a detectable amount; (c)
recovering milk from the adult form of the transgenic nonhuman
mammal or its female descendant, wherein the milk comprises
exogenous procollagen or collagen in a recoverable amount; and (d)
purifying the procollagen or collagen from the milk.
46. In a method of treating a patient using procollagen or collagen
protein, the improvement wherein 7-27% of proline residues of the
protein are hydroxylated, and/or 0-5% of lysine residues of the
protein are hydroxylated.
47. The method of claim 46, wherein the polypeptide is crosslinked
before administration into the patient.
48. The method of claim 46, wherein the polypeptide is crosslinked
after administration into the patient.
49. The method of claim 46 comprising injecting the procollagen or
collagen into the patient to correct a defect in a soft tissue.
50. The method of claim 46, wherein the method is selected from the
group consisting of correcting defects in soft tissues,
reconstructive surgery, restoring defects in bone, enhancing bone
growth, repairing cartilage damage, inducing tolerance to
rheumatoid arthritis, cardiovascular surgery, thoracic surgery,
neurosurgery, and stabilizing an agent in a drug delivery system.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. Ser. No.
10/741,236, filed Dec. 18, 2003, which is a continuation-in-part of
U.S. Ser. No. 08/281,493 filed Jul. 27, 1994, which is incorporated
by reference in its entirety for all purposes.
REFERENCE TO A SEQUENCE LISTING SUBMITTED IN COMPUTER READABLE
FORMAT
[0002] The Sequence Listing written in file
016994-008012USSEQLST.txt is 2,559 bytes, and was created on Jul.
27, 2010. The information contained in this file is hereby
incorporated by reference.
TECHNICAL FIELD
[0003] The invention relates generally to transgenic nonhuman
mammals producing procollagen or collagen in their milk.
BACKGROUND
[0004] Collagen is a family of fibrous proteins present in all
multicellular organisms. Collagen forms insoluble fibers having a
high tensile strength. Collagen is the major fibrous element of
skin, bone tendon cartilage, blood vessels and teeth. It is present
in nearly all organs and serves to hold cells together in discrete
units. Recently, collagen has assumed a therapeutic importance in
reconstructive and cosmetic surgical procedures.
[0005] The process by which collagen is expressed, processed and
ultimately assembled into mature collagen fibers is complex. At
least 28 distinct collagen genes have been reported, whose
expression products combine to form at least 14 different forms of
collagen. Different forms of collagen are associated with different
tissue types. For example, type I collagen is distributed
predominantly in skin, tendon, bone and cornea; type II collagen in
cartilage, invertebrate discs and vitreous bodies; type III
collagen in fetal skin, the cardiovascular system and reticular
fibers; type IV collagen in basement membranes; and type V collagen
in the placenta and skin. Collagen types I, II and III are the most
abundant forms and have a similar fibrillar structure. Type IV does
not exist in fibrils but rather forms a two-dimensional reticulum
constituting the principal component of the basal lamina.
[0006] A collagen gene is expressed to give a polypeptide termed a
procollagen linked at its N-terminal to a signal peptide. The
procollagen polypeptide contains a central segment that is
ultimately found in mature collagen between N- and C-terminal
propeptides. For procollagen .alpha.1(I), the procollagen
polypeptide is about 160 kDa, the mature collagen polypeptide about
90 kDa and the propeptides about 45 kDa. The signal peptide is
linked to the amino end of the N-terminal propeptide. The amino
acid composition of propeptides differs from the mature peptide.
The mature peptide has an unusual repeating structure in which
glycine occurs as nearly every third amino acid and there is a high
proportion of proline residues. The propeptides have a role in
promoting interchain assembly of procollagen chains into triplex
structures.
[0007] Following expression of signal peptide-procollagen
polypeptides, a series of posttranslation modifications occur in
the course of assembly and secretion of procollagen. In
fibroblasts, the following modifications have been identified:
cleavage of signal peptides at the N-termini of the chains;
hydroxylation of the Y-position proline and lysine residues,
hydroxylation of a few X-position proline residues; addition of
galactose or galactose and then glucose to some of the
hydroxylysines, addition of a mannose-rich oligosaccharide to the C
propeptides, association of the C-terminal propeptides through a
process directed by a structure of these domains, formation of both
intra and interchain disulfide bonds in the propeptides. Following
these modifications, the procollagen chains assemble into a
trimeric helix composed of three procollagen chains. In synthesis
of some forms of collagen, the three procollagen chains are of the
same type; in synthesis of other forms of collagen, the three
procollagen chain are heterologous. For example, type I collagen
contains two .alpha.1(I) chains and one .alpha.2(I) chain.
Individual chains assemble into trimers by interactions of
propeptides. These interactions include formation of both
intrachain and interchain disulfide bonds in the propeptides.
[0008] On completion of processing and assembly, procollagen
trimers are secreted from the cell and subject to further
extracellular modifications. The N- and C-terminal propeptides are
cleaved from the mature collagen peptide by specialized enzymes
termed procollagen N-proteinase and procollagen C-proteinase. The
cleavage reaction releases individual trimers of mature collagen
having a molecular weight of about 285 kDa (termed tropocollagen).
Individual trimers spontaneously assemble into higher order
structures. These structures are then solidified by lysyl oxidase
conversion of some lysine and hydroxylysine residues to aldehyde
derivatives that form interchain crosslinks. The final product
constitutes high molecular weight insoluble fibrils that can
fulfill the natural and surgical structural roles noted above. In
all, the modification process requires at least eight specific
enzymes, and several nonspecific enzymes, and requires modification
of over one hundred amino acids. See Prockop et al., New England J.
Med. 311, 376-386 (1984) (incorporated by reference in its entirety
for all purposes).
[0009] The utility of collagen in surgical processes has led to
attempts to express recombinant collagen genes as a source of
collagen. For example, a genomic DNA segment encoding human
cartilage procollagen .alpha.1(II) and a minigene version thereof
(lacking most internal intronic sequences) have been expressed in
3T3 mouse fibroblast, a cell line producing endogenous collagen
type I. See Ala-Kokko et al., J. Biol. Chem. 266, 14175-14178
(1991); Olsen et al., J. Biol. Chem. 266, 1117-11121 (1991)) (each
of which is incorporated by reference in its entirety for all
purposes). A cDNA encoding procollagen .alpha.2(V) has been
expressed in mouse fibroblasts expressing endogenous
pro.alpha.1(V). See Greenspan, Proc. Natl. Acad. Sci. USA 84,
8869-8873 (1987)) (incorporated by reference in its entirety for
all purposes). Heterotrimers were deposited predominantly in the
extracellular matrix of the cell layer. A cDNA encoding the human
pro.alpha.1(I) chain has been expressed in a human fibrosarcoma
cell line producing endogenous collagen type IV. See Geddis &
Prockop, Matrix 13, 399-405 (1993) (incorporated by reference in
its entirety for all purposes).
[0010] About two percent of transformed cell lines secreted
homotrimeric pro.alpha.1(I) chains. These chains were overmodified
compared with normal pro.alpha.1(I) chains as judged by SDS PAGE
analysis. Transgenic mice exhibiting systemic expression of mutated
forms of procollagen genes have also been reported. See Stacey et
al., Nature (1988) 322, 131-136; Khillan et al., J. Biol. Chem.
266, 23373-23379 (1991); WO 92/22333. Most such mice were born dead
or severely deformed.
[0011] Mammalian cellular expression systems are not entirely
satisfactory for production of recombinant proteins because of the
expense of propagation and maintenance of such cells. An
alternative approach to production of recombinant proteins has been
proposed by DeBoer et al., WO 91/08216, whereby recombinant
proteins are produced in the milk of a transgenic animal. This
approach avoids the expense of maintaining mammalian cell cultures
and also simplifies purification of recombinant proteins.
[0012] Although the feasibility of expressing several recombinant
proteins in the milk of transgenic animals has been demonstrated,
it was unpredictable whether this technology could be extended to
the expression of an multimeric protein requiring extensive
posttranslational modification and assembly, such as collagen.
Because mammary gland cells naturally produce only low levels of
endogenous collagen type IV (David et al., Expl. Cell. Res. 170,
402-416 (1987)), it was uncertain whether these cells possessed the
necessary complement and activity of enzymes for proper
modification, assembly and secretion of other types of collagen,
particularly, at high expression levels. If not properly modified,
collagen might accumulate intracellularly rather than being
secreted. Moreover, the large size of trimeric procollagen (>420
kDa) in comparison with other milk protein might have been expected
to clog the secretory apparatus. The health and even viability of
transgenic animals expressing exogenous collagen in their mammary
glands was also uncertain. Inappropriate accumulation of collagen
in the mammary gland might have impaired mammary gland development
and resulted in cessation of lactation. Even low levels of
secondary expression in tissues other than the mammary gland could
have resulted in lethal accumulation of collagen deposits.
[0013] Notwithstanding the above uncertainties and difficulties,
the invention provides inter alia healthy transgenic mammals
secreting procollagen or collagen into their milk.
SUMMARY OF THE INVENTION
[0014] The invention provides transgenic nonhuman mammals useful
for production of procollagen or collagen. The mammals have a
transgene comprising a mammary-gland specific promoter, a
mammary-gland specific enhancer; a secretory DNA segment encoding a
signal peptide functional in mammary secretory cells of the
transgenic mammal, and a recombinant DNA segment encoding an
exogenous procollagen polypeptide. The recombinant DNA segment is
operably linked to the secretory DNA segment to form a
secretory-recombinant DNA segment which is, in turn, operably
linked to the promoter and enhancer. In adult form, the nonhuman
mammal bearing the transgene, or a female descendant of the mammal,
is capable of expressing the secretory-recombinant DNA segment in
the mammary secretory cells to produce a form of the exogenous
procollagen polypeptide that is processed and secreted by the
mammary secretory cells into milk as exogenous procollagen or
collagen. Usually, the exogenous procollagen or collagen is
secreted in trimeric form. The concentration of procollagen or
collagen in the milk is usually about 100 .mu.g/ml and sometimes 1
mg/ml or more. The exogenous procollagen or collagen polypeptide is
usually human, e.g., pro.alpha.1(I). The recombinant DNA segment
can be cDNA, genomic or a hybrid. In some genomic DNA segments, a
segment of the first intron is deleted to remove regulatory
sequences. Some transgenic nonhuman mammals have a first transgene
encoding a pro.alpha.1(I) polypeptide and a second transgene
encoding a pro.alpha.2(I) polypeptide. The two transgenes are
capable of being expressed to produce forms of .alpha.1(I) and
.alpha.2(I) procollagen that are processed and secreted by the
mammary secretory cells into milk as a trimer comprising at least
one chain of .alpha.1(I) procollagen or collagen and at least one
chain of .alpha.2(I) procollagen or collagen. Preferred species of
transgenic mammals include bovine and murine.
[0015] In another aspect, the invention provides milk from
transgenic nonhuman mammals as described above. The milk comprises
procollagen or collagen.
[0016] The invention further provides transgenes for expressing
procollagen or collagen. One such transgene comprises a casein
promoter, a casein enhancer, a cDNA segment encoding a procollagen
signal segment linked in-frame to a procollagen .alpha.1(I)
polypeptide, and a 3' flanking DNA segment from a gene encoding the
procollagen polypeptide. The cDNA segment is operably linked at its
5' end to the promoter and the enhancer, and at its 3' end to the
3' flanking segment. Another transgene comprises a casein promoter,
a casein enhancer and a genomic DNA segment comprising a segment
from a 5' untranslated region to a 3' flanking region of a
procollagen .alpha.1(I) gene, operably linked to the promoter and
the enhancer.
[0017] In a further aspect, the invention provides a stable mammary
gland cell line having a transgene. The transgene comprises a
mammary-gland specific promoter, a mammary-gland specific enhancer,
a secretory DNA segment encoding a signal peptide functional in the
cell line, and a recombinant DNA segment encoding an exogenous
procollagen polypeptide operably linked to the secretory DNA
segment to form a secretory-recombinant DNA segment, the
secretory-recombinant DNA segment being operably linked to the
promoter and to the enhancer. The cell line can be induced by a
lactogenic hormone to express the transgene to produce a form of
the exogenous procollagen polypeptide that is processed and
secreted by the cell lines as exogenous procollagen or collagen in
trimeric form.
BRIEF DESCRIPTION OF THE FIGURES
[0018] FIG. 1(A-B): Construction of a cDNA-genomic hybrid transgene
for procollagen expression.
[0019] FIG. 2(A-B): Construction of genomic transgenes for
procollagen expression.
[0020] FIG. 3(A-B): Northern blot of mRNA in tissue and cell lines
with (B) and without (A) transfected procollagen transgene.
[0021] FIG. 4(A-B): Immunofluorescence staining of mammary gland
cell lines transfected with genomic transgenes for procollagen
expression.
[0022] FIG. 5: SDS-PAGE analysis of milk from transgenic or control
mice. Tracks 1-8 reducing conditions; tracks 9-15, nonreducing
conditions. The lanes contain:
[0023] Lane 1 marker
[0024] Lane 2 control, day 19 lactation
[0025] Lane 3 founder 2399, day 4 lactation
[0026] Lane 4 control, day 6 lactation
[0027] Lane 5 founder 2395, day 4 lactation
[0028] Lane 6 founder 2395, day 2 lactation
[0029] Lane 7 control, day 3 lactation
[0030] Lane 8 marker
[0031] Lane 9 control, day 19 lactation
[0032] Lane 10 founder 2399, day 4 lactation
[0033] Lane 11 control, day 6 lactation
[0034] Lane 12 founder 2395, day 4 lactation
[0035] Lane 13 founder 2395, day 2 lactation
[0036] Lane 14 control, day 3 lactation
[0037] Lane 15 marker
[0038] FIG. 6: SDS-PAGE analysis of milk proteins from additional
transgenic mice under reducing conditions.
[0039] Lane 1 marker
[0040] Lane 2 control, day 10 lactation
[0041] Lane 3 founder 2393, day 4 lactation
[0042] Lane 4 founder 2393, day 11 lactation
[0043] Lane 5 founder 2395, day 4 lactation
[0044] Lane 6 founder 2395, day 13 lactation
[0045] Lane 7 founder 2399, day 4 lactation
[0046] Lane 8 founder 2399, day 13 lactation
[0047] Lane 9 founder 2400, day 5 lactation
[0048] Lane 10 founder 2400, day 12 lactation
[0049] Lane 11 founder 2406, day 4 lactation
[0050] Lane 12 founder 2406, day 11 lactation
[0051] Lane 13 founder 2411, day 5 lactation
[0052] Lane 14 founder 2411, day 11 lactation
[0053] Lane 15 control, day 10 lactation
[0054] FIG. 7(A-C): Construction of .alpha.2(I) procollagen
expression vectors. Panel A shows the location of restriction sites
in the .alpha.s1 gene. Panel B illustrates the steps in
reconstructing the 5' end of the .alpha.2(I) gene in which the 5'
untranslated sequence from the collagen gene is replaced with the
5' untranslated sequence from the bovine .alpha.s1 casein gene.
Panel B also show the step of ligating the reconstructed 5' end
fragment to a BamHI-BamHI fragment containing the rest of the gene.
Panel C (lower) shows the restriction sites in the reconstructed
.alpha.2(I) gene resulting from these steps. Panel C (upper) shows
the restriction sites in a reconstructed .alpha.2(I) gene resulting
from a second strategy in which the BamHI-BamHI fragment is
replaced with a BamH1-XhoI fragment and an XhoI-XhoI fragment from
the .alpha.2(I) procollagen gene.
[0055] FIG. 8: Western blot of milk from a transgenic mouse
harboring a procollagen .alpha.1(I) transgene.
[0056] FIG. 9: Collagenase digestion of milk from a transgenic
mouse harboring a procollagen .alpha.1(I) transgene.
[0057] FIG. 10(A-D): Thermal stability of procollagen in milk from
transgenic mice. Panels A, B, C and D show samples from human skin
fibroblasts (HSV) (expressing natural procollagen type I), human
lung fibroblasts (SV) (encoding human procollagen .alpha.1(I), milk
from mouse 2395 (a high expressor) and milk from mouse 2399 (a
medium expressor). The numbers above each gel indicate the
temperature of digestion. Control samples were incubated at
20.degree. C. without trypsin or chymotrypsin.
[0058] FIG. 11: Northern blot of RNA from various tissues in a
transgenic mouse harboring a transgene expressing homotrimeric
procollagen .alpha.1(I).
DEFINITIONS
[0059] The term "substantial identity" or "substantial homology"
means that two peptide sequences, when optimally aligned, such as
by the programs GAP or BESTFIT using default gap weights, share at
least 65 percent sequence identity, preferably at least 80 or 90
percent sequence identity, more preferably at least 95 percent
sequence identity or more (e.g., 99 percent sequence identity).
Preferably, residue positions which are not identical differ by
conservative amino acid substitutions.
[0060] The term "substantially pure" or "isolated" means an object
species has been identified and separated and/or recovered from a
component of its natural environment. Usually, the object species
is the predominant species present (i.e., on a molar basis it is
more abundant than any other individual species in the
composition), and preferably a substantially purified fraction is a
composition wherein the object species comprises at least about 50
percent (on a molar basis) of all macromolecular species present.
Generally, a substantially pure composition will comprise more than
about 80 to 90 percent by weight of all macromolecular species
present in the composition. Most preferably, the object species is
purified to essential homogeneity (contaminant species cannot be
detected in the composition by conventional detection methods)
wherein the composition consists essentially of a single
macromolecular species.
[0061] A DNA segment is operably linked when placed into a
functional relationship with another DNA segment. For example, DNA
for a signal sequence is operably linked to DNA encoding a
polypeptide if it is expressed as a preprotein that participates in
the secretion of the polypeptide; a promoter or enhancer is
operably linked to a coding sequence if it stimulates the
transcription of the sequence. Generally, DNA sequences that are
operably linked are contiguous, and in the case of a signal
sequence both contiguous and in reading phase. However, enhancers
need not be contiguous with the coding sequences whose
transcription they control. Linking is accomplished by ligation at
convenient restriction sites or at adapters or linkers inserted in
lieu thereof.
[0062] An exogenous DNA segment is one foreign to the cell or
homologous to the cell but in a position within the host cell
nucleic acid in which the element is not ordinarily found.
[0063] Exogenous DNA segments are expressed to yield exogenous
polypeptides.
DETAILED DESCRIPTION
[0064] The invention provides transgenic nonhuman mammals secreting
procollagen or collagen into their milk. Secretion is achieved by
incorporation of a transgene encoding a procollagen gene and
regulatory sequences capable of targeting expression of the gene to
the mammary gland. The procollagen gene is expressed,
posttranslationally modified and assembled into procollagen within
the mammary gland. Procollagen is secreted into the milk, usually
in trimeric form. Usually, further processing of trimeric
procollagen does not spontaneously occur following secretion into
milk.
[0065] A. Collagen Genes
[0066] The invention provides transgenic nonhuman mammals
expressing DNA segments containing any of the more than 23 known
collagen genes. See Adams et al., Am. J. Respir. Cell. Molec. Biol.
1, 161-168 (1989) (incorporated by reference in its entirety for
all purposes). Polypeptides can be expressed individually giving
rise to homopolymers or in combinations, giving rise to
heteropolymers. Expression of a DNA segment or segments that
produce collagen having the same constituent chains as a naturally
occurring form of collagen is preferred.
[0067] The most common types found in interstitial tissues are
types I, III, V and VI, whereas types II, IX, X and XI predominate
in cartilage. Some of these types exist natively as homotriplexes;
others are heterotriplexes.
The nomenclature designates the genetic origin of a particular
collagen. For example, type I collagen is a heterotriplex
containing the products of two different collagen-encoding genes.
This type of collagen is designated [.alpha.1(I)].sub.2
.alpha.2(I); thus, type I collagen triplexes contain two chains
encoded by the procollagen .alpha.1(I) gene and one protein chain
encoded by the pro .alpha.2(I) gene. Type II collagen is designated
[.alpha.1.sub.1(II)].sub.3 comprising a homotrimer of .alpha.1(II)
polypeptides. Type III collagen is also a homotrimer designated
[.alpha.1(III)].sub.3. Type IV and type V collagens are
heterotrimers, respectively designated
[.alpha.1(IV)].sub.2.alpha.2(IV) and
[.alpha.1(V)].sub.2.alpha.2(V). Transgenic mammals expressing
allelic, cognate; nonallelic and induced variants of any of the
known collagen coding sequences are also included. Such variants
usually show substantial sequence identity at the amino acid level
with known procollagen genes particularly in the collagen encoding
domains of such genes. Such variants usually hybridize to a known
gene under stringent conditions or crossreact with antibodies to a
polypeptide encoded by one of the known genes.
[0068] DNA clones containing the genomic or cDNA sequences of many
of the known procollagen genes are available. Barsh et al., J.
Biol. Chem. 259, 14906-14913 (1984) and Chu et al., Nucleic Acid
Res. 10, 5925-5933 (1982) (incorporated by reference in their
entirety for all purposes), respectively describe genomic and cDNA
clones encoding the pro.alpha.1(I) gene. See also Tromp et al.,
Biochem J. 253, 9191-922 (1988). Chu et al., J. Biol. Chem. 260,
4357-4363 (1985) (incorporated by reference in its entirety for all
purposes) describe a clone of a pro.alpha.1(III) gene. Dewet et
al., J. Biol. Chem. 262, 16032-16036 (incorporated by reference in
its entirety for all purposes) describe the cloning of the human
pro.alpha.2(I) gene. Sangiorgi et al., Nucleic Acids Res. 13,
2207-2225 (1985) and Elima et al., Biochem. J. 229, 183-188 (1985)
(incorporated by reference in their entirety for all purposes)
describe genomic and cDNA clones of human pro.alpha.1(II). Other
examples of genomic and cDNA sequences are available from GenBank.
To the extent that additional cloned sequences of collagen genes
are required, they may be obtained from genomic or cDNA libraries
(preferably human) using known collagen DNA sequences or antibodies
to known collagen polypeptides as probes.
[0069] B. Collagen Conformation
[0070] Recombinant collagen or procollagen polypeptides are
preferably processed and assembled to have the same or similar
trimeric structure as naturally occurring collagens. In this
structure, each individual strand forms a helix and the three
strands wrap around each other to form a superhelical cable. In
mature collagen, the superhelical cable contains short nonhelical
extensions designated telopeptides. In procollagen, the nonhelic
regions are longer comprising the telopeptides linked to
propeptides. A homotrimer contains three identical strands; a
heterotrimer contains at least two different type of collagen
chain, and usually contains two copies of a first type and one copy
of a second type. The rise per residue in the superhelix is about
2.9 A and the number of residues per turn is about 3.3 in the case
of type I collagen. The trimeric structure is stabilized in part by
hydrogen bonding of modified residues (e.g., hydroxyproline)
introduced by posttranslational processing. Thus, the assembly of a
trimeric structure indicates that at least substantially complete
posttranslational processing has occurred. Unless an appropriate
number of Y-position prolyl residues are hydroxylated to
4-hydroxyproline by prolyl 4-hydroxylase, the newly synthesized
chains cannot fold in to a triple-helical formation, are poorly
secreted and cannot self-assemble into collagen fibrils. See
Prockop et al., WO 92/22333. The extent of posttranslational
modification can be more precisely determined by SDS-page analysis
in comparison with naturally occurring collagen. The greater the
extent of posttranslational modification the less the mobility of
the monomeric chain under this analysis.
[0071] The existence of trimeric procollagen or collagen can be
detected by resistance to trypsin or chymotrypsin digestion.
Thermal stability and thereby proper folding can be determined from
resistance to proteolytic digestion as a function of temperature.
See Bruckner & Prockop, Annal. Biochem. 110, 36-368 (1981)
(incorporated by reference in its entirety for all purposes). As
the melting point of the triple helix is exceeded (41 degrees for
collagen type 1), the rate of protease digestion greatly increases.
Usually, the procollagen or collagen produced by the transgenic
animals of the invention has a melting point in the range of about
25-45.degree. C. and more usually about 30-40.degree. C. Trimeric
procollagen or collagen can also be identified by the presence of
high molecular weight bands (about 420 kDa for procollagen type I
and about 285 kDa for collagen type I) on nonreducing gels.
[0072] C. Transgene Design
[0073] Transgenes are designed to target expression of a
recombinant protein (usually a procollagen polypeptide) to the
mammary gland of a transgenic nonhuman mammal harboring the
transgene. The basic approach entails operably linking a an
exogenous DNA segment encoding a procollagen polypeptide with a
signal sequence, a promoter and an enhancer. The DNA segment can be
genomic, minigene (genomic with one or more introns omitted), cDNA,
a YAC fragment, a chimera of two different collagen genes, or a
hybrid of any of these. Inclusion of genomic sequences generally
leads to higher levels of expression. Very high levels of
expression might overload the capacity of the mammary gland to
perform posttranslation modifications, assembly and secretion of
procollagen chains. However, the results presented in Example 3
indicate that substantial posttranslational modification occurs
notwithstanding a high expression level in the mg/ml range. Thus,
genomic constructs or hybrid cDNA-genomic constructs are generally
preferred.
[0074] In genomic constructs, it is not necessary to retain all
intronic sequences. Some such sequences, notably the first intron
of .alpha.1(I) procollagen may contain a segment of regulatory
sequences whose removal is desirable. Other intronic sequences can
be removed to obtain a smaller transgene facilitating DNA
manipulations and subsequent microinjection. See Archibald et al.,
WO 90/05188 (incorporated by reference in its entirety for all
purposes).
[0075] It is also possible to delete portions of noncoding exons
(e.g., a 5' portion of exon 1 of the .alpha.1(I) procollagen gene)
forming three dimensional structures in the mRNA impeding
transcription. Removal of some introns is also useful in some
instances to reduce expression levels and thereby ensure that
posttranslational modification is substantially complete. In some
transgenes, selected nucleotides in procollagen sequences are
mutated to remove proteolytic cleavage sites recognized by N- and
C-procollagen peptidases. Removal of such sites prevents
spontaneous conversion of procollagen to collagen (although Example
3 indicates that such conversion is usually substantially absent
even without these mutations). In some transgenes, a nucleotide
encoding a recognition site to collagenase enzyme (Gly-Ile or
Gly-Leu) is mutagenized as a precaution against digestion of
procollagen after secretion into milk. See Wu et al., Proc. Natl.
Acad. Sci. (USA) 87, 5888-5892 (1990) (incorporated by reference in
its entirety for all purposes).
[0076] The species from which the DNA segment encoding a
procollagen sequence is obtained will usually depend on the
intended use of the procollagen. Where the intended use is in human
surgery it is preferred that the DNA segment be of human origin to
minimize subsequent immune response in the recipient human patient.
Analogously if the intended use were in veterinary surgery (e.g.,
on a horse, dog or cat), it is preferable that the DNA segment be
from the same species.
[0077] The promoter and enhancer are from a gene that is
exclusively or at least preferentially expressed in the mammary
gland (i.e., a mammary-gland specific gene). Preferred genes as a
source of promoter and enhancer include .beta.-casein,
.kappa.casein, .alpha.s1-casein, .alpha.s2-casein,
.beta.-lactoglobulin, whey acid protein, and .alpha.-lactalbumin.
The promoter and enhancer are usually but not always obtained from
the same mammary-gland specific gene. This gene is preferably from
the same species of mammal as the mammal into which the transgene
is to be inserted. Expression regulation sequences from other
species such as those from human genes can also be used. The signal
sequence must be capable of directing the secretion of procollagen
from the mammary gland. Suitable signal sequences can be derived
from virtually any mammalian gene encoding a secreted protein.
Preferred sources of signal sequences are the signal sequence
naturally linked to the procollagen DNA segment being expressed, or
a signal sequence from the same gene as the promoter and enhancer
are obtained. Optionally, additional regulatory sequences are
included in the transgene to optimize expression levels. Such
sequences include 5' flanking regions, 5' transcribed but
untranslated regions, intronic sequences, 3' transcribed but
untranslated regions, polyadenylations sites, 3' flanking regions.
Such sequences are usually obtained either from the mammary-gland
specific gene from which the promoter and enhancer are obtained or
from the procollagen gene being expressed. Inclusion of such
sequences produces a genetic milieu simulating that of an authentic
mammary gland specific gene and/or that of an authentic procollagen
gene. This genetic milieu results in some cases (e.g., bovine
.alpha.S1-casein) in higher expression of the transcribed
procollagen gene. Alternatively, 3' flanking regions and
untranslated regions are obtained from other heterologous genes
such as the .beta.-globin gene or viral genes. The inclusion of 3'
and 5' untranslated regions from the procollagen, mammary specific
gene, or other heterologous gene can also increase the stability of
the transcript.
[0078] In some embodiments, about 0.5, 1, 5, 10, 15, 20 or 30 kb of
5' flanking sequence is included from a mammary specific gene in
combination with about 1, 5, 10, 15, 20 or 30 kb or 3' flanking
sequence from the procollagen gene being expressed. If the
procollagen polypeptide is expressed from a cDNA sequence, it is
advantageous to include an intronic sequence between the promoter
and the coding sequence. The intronic sequence is preferably a
hybrid sequence formed from a 5' portion from an intervening
sequence from the first intron of the mammary gland specific region
from which the promoter is obtained and a 3' portion from an
intervening sequence of an IgG intervening sequence or a
procollagen gene. See DeBoer et al. WO 91/08216 (incorporated by
reference in its entirety for all purposes).
[0079] A preferred transgene for expressing procollagen or collagen
comprises a cDNA-genomic hybrid procollagen gene linked 5' to a
casein promoter and enhancer. The hybrid procollagen gene includes
the signal sequence, procollagen coding region, and a 3' flanking
region. The transgene is conveniently assembled from three
components: a 5' flanking sequences from a casein gene containing
the casein promoter and enhancer; a cDNA segment encoding the
signal sequence and procollagen polypeptide and a genomic segment
proving the 3' flanking region. The casein fragment is linked to
the cDNA segment by fusion of 5' untranslated regions of the casein
and procollagen genes. The cDNA segment is linked to the genomic
segment by a fusion within the last exon (exon 52) of the
procollagen coding sequence. Optionally, the cDNA segment includes
an intronic sequence between the 5' casein and procollagen
untranslated regions. Of course, corresponding cDNA and genomic
segments can also be fused at other locations within the gene
provided a contiguous protein can be expressed from the resulting
fusion. Depending on the site of fusion, the construct will contain
anywhere from 0 to 51 introns.
[0080] Other preferred transgenes have a genomic procollagen
segment linked 5' to casein regulatory sequences. The genomic
segment is usually contiguous from the 5' untranslated region to
the 3' flanking region of the procollagen gene, except that a
segment of the first intron is sometimes deleted to remove control
sequences. Thus, the genomic segment includes a portion of the
procollagen 5' untranslated sequence, the signal sequence,
alternating introns and coding exons, a 3' untranslated region, and
a 3' flanking region. The genomic segment is linked via the 5'
untranslated region to a casein fragment comprising a promoter and
enhancer and usually a 5' untranslated region. In some constructs,
all of the procollagen 5' untranslated sequence is replaced with
the casein 5' untranslated sequence.
[0081] DNA sequence information is available for all of the mammary
gland specific genes listed above, in at least one, and often
several organisms. See, e.g., Richards et al., J. Biol. Chem. 256,
526-532 (1981) (.alpha.-lactalbumin rat); Campbell et al., Nucleic
Acids Res. 12, 8685-8697 (1984) (rat WAP); Jones et al., J. Biol.
Chem. 260, 7042-7050 (1985)) (rat 13-casein); Yu-Lee & Rosen,
J. Biol. Chem. 258, 10794-10804 (1983) (rat .gamma.-casein)); Hall,
Biochem. J. 242, 735-742 (1987) (.alpha.-lactalbumin human);
Stewart, Nucleic Acids Res. 12, 389 (1984) (bovine .alpha.s1 and
.kappa. casein cDNAs); Gorodetsky et al., Gene 66, 87-96 (1988)
(bovine .beta. casein); Alexander et al., Eur. J. Biochem. 178,
395-401 (1988) (bovine .kappa. casein); Brignon et al., FEBS Lett.
188, 48-55 (1977) (bovine .alpha.S2 casein); Jamieson et al., Gene
61, 85-90 (1987), Ivanov et al., Biol. Chem. Hoppe-Seyler 369,
425-429 (1988), Alexander et al., Nucleic Acids Res. 17, 6739
(1989) (bovine .beta. lactoglobulin); Vilotte et al., Biochimie 69,
609-620 (1987) (bovine .alpha.-lactalbumin) (incorporated by
reference in their entirety for all purposes). The structure and
function of the various milk protein genes are reviewed by Mercier
& Vilotte, J. Dairy Sci. 76, 3079-3098 (1993) (incorporated by
reference in its entirety for all purposes). To the extent that
additional sequence data might be required, sequences flanking the
regions already obtained could be readily cloned using the existing
sequences as probes. Mammary-gland specific regulatory sequences
from different organisms are likewise obtained by screening
libraries from such organisms using known cognate nucleotide
sequences, or antibodies to cognate proteins as probes.
[0082] General strategies and exemplary transgenes employing
.alpha.s1-casein regulatory sequences for targeting the expression
of a recombinant protein to the mammary gland are described in more
detail in WO 91/08216 and WO 93/25567 (incorporated by reference in
their entirety for all purposes). Examples of transgenes employing
regulatory sequences from other mammary gland specific genes have
also been described. See, e.g., Simon et al., Bio/Technology 6,
179-183 (1988) and WO88/00239 (1988) (.beta.-lactoglobulin
regulatory sequence for expression in sheep); Rosen, EP 279,582 and
Lee et al., Nucleic Acids Res. 16, 1027-1041 (1988) (.beta.-casein
regulatory sequence for expression in mice); Gordon, Biotechnology
5, 1183 (1987) (WAP regulatory sequence for expression in mice); WO
88/01648 (1988) and Eur. J. Biochem. 186, 43-48 (1989)
(.alpha.-lactalbumin regulatory sequence for expression in mice)
(incorporated by reference in their entirety for all purposes).
[0083] Some transgenic mammals express more than one procollagen
gene. Such transgenes are usually constructed independently, each
according to the principles discussed above for a single transgene.
Coinjection of the two transgenes often results in cointegration
and thereby coordinate expression of the transgenes. Coordinate
expression can also be obtained by placing two procollagen genes
under the coordinate control of the same regulatory sequences. This
is achieved by linking the segments encoding the procollagen
inframe through a proteolytic cleavage site. The procollagens are
expressed as a fusion protein that is separated into its component
parts by an intracellular proteolytic enzyme. Alternatively, two
independent transcriptional units can be produced, each encoding a
procollagen gene, and the two units joined to form a single
transgene.
[0084] In some embodiments of the invention, additional transgenes
are constructed for targeting expression of enzymes involved in
posttranslation processing to the mammary gland.
[0085] The data presented in Example 3 indicate that surprisingly
mammary glands already express these enzymes at sufficient
quantities to obtain assembly and secretion of trimeric procollagen
chains at high levels. However, in some transgenic mammals
expressing procollagen at high levels, it is sometimes preferable
to supplement endogenous levels of processing enzymes with
additional enzyme resulting from transgene expression. Such
transgenes are constructed employing similar principles to those
discussed above with the processing enzyme coding sequence
replacing the procollagen coding sequence in the transgene. It is
not generally necessary that posttranslational processing enzymes
be secreted. Thus, the secretion signal sequence linked to
procollagen sequence is replaced with a signal sequence that
targets the processing enzyme to the endoplasmic reticulum without
secretion. For example, the signal sequences naturally associated
with these enzymes are suitable. Genes involved in posttranslation
modifications and assembly protein disulfide isomerase, which
combines with the alpha subunit of prolyl hydroxylase to form a
tetrameric protein isolated as prolyl hydroxylase. The cloned gene
for protein disulfide isomerase is available (Tasanen et al., J.
Biol Chem (1988) 263, 16218-16224) (incorporated by reference in
its entirety for all purposes). The cDNA for the alpha subunit has
also been cloned from chickens and humans. See Bassuk et al., Proc.
Natl. Acad. Sci. USA (1989) 86, 7382-7386; Helaakoski, T., Proc
Natl Acad Sci USA (1989) 86, 4392-4396 (incorporated by reference
in their entirety for all purposes). A clone encoding the human
lysyl oxidase gene is reported by Hanaleinen et al., Genomics 17,
544-548 (1993) (incorporated by reference in its entirety for all
purposes). Some transgenes encode a copy of bik, a cellular protein
reported to facilitate secretion.
[0086] The observation that the transgenic mammal of the invention
principally secrete procollagen rather than processed collagen (see
Example 3) suggests that enzymes having roles in postsecretional
processing steps (e.g., N- and C-terminal proteases) are not
produced by mammary secretory cells in sufficient proportions to
complete processing of the recombinant collagen. The substantial
absence of these enzymes is potentially advantageous because it
allows postsecretional processing, which initiates formation of
insoluble aggregates, to be controlled (see infra). Thus, in
general, there is no need to produce transgenes for expression of
postsecretional enzymes.
[0087] In embodiments where multiple transgenes are constructed for
insertion into the same mammal, the regulatory sequences, while
selected according to the same principles, need not be the same in
each instance. For example, one transgene for expression of a first
procollagen DNA segment might include regulatory sequences from a
.alpha.s1 casein gene. A second transgene for inclusion in the same
animal would usually contain the second procollagen DNA segment
linked to regulatory sequences from an .alpha.s1 casein gene.
However, the second procollagen DNA segment could also be linked to
regulatory sequences from another milk protein gene, such as an
whey acidic protein gene.
[0088] D. Transgenesis
[0089] The transgenes described above are introduced into nonhuman
mammals. Most nonhuman mammals, including rodents such as mice and
rats, rabbits, ovines such as sheep and goats, porcines such as
pigs, and bovines such as cattle and buffalo, are suitable.
However, nonviviparous mammals such as a spiny anteater or duckbill
platypus are typically not employed. In some methods of
transgenesis, transgenes are introduced into the pronuclei of
fertilized oocytes. For some animals, such as mice fertilization is
performed in vivo and fertilized ova are surgically removed. In
other animals, particularly bovines, it is preferably to remove ova
from live or slaughterhouse animals and fertilize the ova in vitro.
See DeBoer et al., WO 91/08216. In vitro fertilization permits a
transgene to be introduced into substantially synchronous cells at
an optimal phase of the cell cycle for integration (not later than
S-phase). Transgenes are usually introduced by microinjection. See
U.S. Pat. No. 4,873,292. Fertilized oocytes are then cultured in
vitro until a pre-implantation embryo is obtained containing about
16-150 cells. The 16-32 cell stage of an embryo is described as a
morula. Pre-implantation embryos containing more than 32 cells are
termed blastocysts.
[0090] These embryos show the development of a blastocoel cavity,
typically at the 64 cell stage. Methods for culturing fertilized
oocytes to the pre-implantation stage are described by Gordon et
al. (1984) Methods Enzymol. 101, 414; Hogan et al., Manipulation of
the Mouse Embryo: A Laboratory Manual, C.S.H.L. N.Y. (1986) (mouse
embryo); and Hammer et al. (1985) Nature 315, 680 (rabbit and
porcine embryos); Gandolfi et al. (1987) J. Reprod. Fert. 81,
23-28; Rexroad et al. (1988) J. Anim. Sci. 66, 947-953 (ovine
embryos) and Eyestone et al. (1989) J. Reprod. Fert. 85, 715-720;
Camous et al. (1984) J. Reprod. Fert. 72, 779-785; and Heyman et
al. (1987) Theriogenology 27, 5968 (bovine embryos) (incorporated
by reference in their entirety for all purposes). Sometimes
pre-implantation embryos are stored frozen for a period pending
implantation. Pre-implantation embryos are transferred to an
appropriate female resulting in the birth of a transgenic or
chimeric animal depending upon the stage of development when the
transgene is integrated. Chimeric mammals can be bred to form true
germline transgenic animals.
[0091] Alternatively, transgenes can be introduced into embryonic
stem cells (ES). These cells are obtained from preimplantation
embryos cultured in vitro. Bradley et al. (1984), Nature 309,
255-258 (incorporated by reference in its entirety for all
purposes). Transgenes can be introduced into such cells by
electroporation or microinjection. Transformed ES cells are
combined with blastocysts from a nonhuman animal.
[0092] The ES cells colonize the embryo and in some embryos form
the germ line of the resulting chimeric animal. See Jaenisch,
Science, 240, 1468-1474 (1988) (incorporated by reference in its
entirety for all purposes). Alternatively, ES cells can be used as
a source of nuclei for transplantation into an enucleated
fertilized oocyte giving rise to a transgenic mammal.
[0093] For production of transgenic animals containing two or more
transgenes, the transgenes can be introduced simultaneously using
the same procedure as for a single transgene. Alternatively, the
transgenes can be initially introduced into separate animals and
then combined into the same genome by breeding the animals.
Alternatively, a first transgenic animal is produced containing one
of the transgenes. A second transgene is then introduced into
fertilized ova or embryonic stem cells from that animal. In some
embodiments, transgenes whose length would otherwise exceed about
50 kb, are constructed as overlapping fragments.
[0094] Such overlapping fragments are introduced into a fertilized
oocyte or embryonic stem cell simultaneously and undergo homologous
recombination in vivo. See Kay et al., WO 92/03917 (incorporated by
reference in its entirety for all purposes).
[0095] E. Characteristics of Transgenic Mammals
[0096] Transgenic mammals of the invention incorporate at least one
transgene and sometimes several transgenes in their genome as
described above. The transgene(s) target expression of procollagen
DNA segments at least predominantly to the mammary gland.
Surprisingly, the mammary glands are capable of expressing enzymes
required for posttranslation modification of collagen in great
excess with respect to the processing capacity needed for
endogenous collagen synthesis. Processing by enzymes in the mammary
gland results in substantially complete posttranslational
modification of exogenous procollagen polypeptides at least to the
extent that trimers of procollagen are formed and secreted.
Hydroxylation of proline residues may in some instances be
increased by supplementing the diet of transgenic animals with
Vitamin C. This is especially desirable when the transgenic animal
is fed on a food mix lacking endogenous Vitamin C. Vitamin C is
supplemented at a level of about 50-1000 mg/kg food or preferably
about 200 mg/kg food. Endogenous collagen produced by the mammary
gland is of type IV and is therefore routed to the basement
membrane. Thus, the secreted procollagen is substantially or
entirely free from endogenous procollagen and collagen (i.e.,
endogenous collagen forms less than 10, 20 or 50% of total secreted
collagen). Usually, the secreted polypeptide is predominantly in
the procollagen form and remains in that form until proteinase(s)
are supplied exogenously. The proteinase can be the procollagen N-
and C-terminal proteases employed in vivo or nonspecific
proteolytic enzymes. The trimeric portion of a procollagen triple
helix is relatively resistant to proteases. Thus, the propeptides
are digested first by nonspecific proteases leaving trimeric
collagen. In some transgenic animals, endogenous proteases are
secreted resulting in spontaneous processing of procollagen to
collagen following secretion.
[0097] Procollagen or collagen is secreted at high levels of at
least 10, 50, 100, 500, 1000, 2000, 5000 or 10,000 .mu.g/ml.
Surprisingly, the transgenic mammals of the invention exhibit
substantially normal health. Secondary expression of procollagen in
tissues other than the mammary gland does not occur to an extent
sufficient to cause deleterious effects. Moreover, virtually all
exogenous procollagen produced in the mammary gland is secreted so
that no significant problem is presented by deposits clogging the
secretory apparatus.
[0098] The age at which transgenic mammals can begin producing
milk, of course, varies with the nature of the animal. For
transgenic bovines, the age is about two-and-a-half years naturally
or six months with hormonal stimulation, whereas for transgenic
mice the age is about 5-6 weeks. Of course, only the female members
of a species are useful for producing milk.
[0099] However, transgenic males are also of value for breeding
female descendants. The sperm from transgenic males can be stored
frozen for subsequent in vitro fertilization and generation of
female offspring.
[0100] F. Cellular Expression Systems
[0101] The transgenes of the invention can also be transfected into
mammary-gland derived cell lines (e.g., HC11 or MacT) to produce
stable cell lines. These cell lines are capable of processing,
assembling and secreting procollagen or collagen in trimeric form
at high concentrations. Expression is induced by the synergistic
effect of lactogenic hormones, such as insulin, hydrocortisone and
prolactin, to the cell media.
[0102] G. Recovery of Proteins from Milk
[0103] Transgenic adult female mammals produce milk containing high
concentrations of exogenous procollagen or collagen. Collagen or
procollagen is purified from milk by virtue of its distinguishing
physical and chemical properties. For example, acidification causes
milk-specific proteins such as casein to precipitate while collagen
or procollagen remains in solution.
[0104] Collagen or procollagen is then precipitated by addition of
salt, alcohol, or propylene glycol. See Miller & Rhodes,
Methods in Enzymology 82, 33-63 (1982); Sage & Bernstein, id.
at 96-127 (incorporated by reference in their entirety for all
purposes).
[0105] H. Further Processing of Procollagen
[0106] The transgenic mammals of the invention usually secrete
trimeric procollagen into milk without complete processing to the
collagen form. Deferred processing is advantageous because
substantial spontaneous processing to collagen might lead to
formation of insoluble aggregates that block the mammary secretory
pores. Conversion of procollagen to collagen can be completed by
addition of proteases to the procollagen. The proteases are usually
N and C-terminal procollagen proteases but nonspecific proteases
(e.g., pepsin, trypsin, chymotrypsin, and papain) can also be used,
in which case the telopeptide regions are also cleaved. In
conventional use of bovine collagen for human therapy, cleavage of
telopeptide regions has been found to render the collagen
hypoantigenic. See Yarborough, Am. J. Med. Sci. 290, 28-31 (1985)
(incorporated by reference in its entirety for all purposes).
Cleavage reactions can be performed before or after purification of
procollagen from milk. Following cleaving of propeptides and/or
telopeptides, collagen spontaneously assembles into higher order
insoluble fibrils suitable for reconstructive purposes. The
remaining posttranslation modifications, that is lysyl oxidase
conversion of some lysine and hydroxylysine residues to aldehyde
derivatives that form interchain crosslinks, can be induced by
supplying exogenous enzymes. Alternatively, crosslinks can be
induced by a variety of chemical agents or ultraviolet irradiation
(see, e.g., Simmons & Kearney, Biotechnol. Appl. Biochem. 17,
23-29 (1993) (incorporated by reference in its entirety for all
purposes). Crosslinks can also be formed in situ, following
injection into a patient.
[0107] The extent of crosslinking introduced before injection
varies depending on the therapeutic use to which collagen is to be
put. See Chvapil et al., Int. Rev. Connect. Tissue Res. 6, 1-61
(1973) (incorporated by reference in its entirety for all
purposes).
I. Uses of Collagen
[0108] The recombinant collagen and procollagen produced according
to the invention find use in a wide variety of therapeutic
procedures. Surgical procedures employing naturally occurring
bovine collagen are already in extensive use. In general, the
present recombinant collagens replace naturally occurring bovine
collagen in these procedures. A common surgical procedure entails
injected of collagen into a patient to correct defects in soft
tissues, such as scars, traumatic and surgical defects and early
wrinkles and creases.
[0109] See Yarborough, supra. Another application is that of
reconstructive surgery such as in the restoration of the tensile
strength of tissues such as the sphincter of the bladder in the
treatment of urinary incontinence. See Apprell et al., Urologic
Clinics of North America 21, 177-182 (1994) (incorporated by
reference in its entirety for all purposes).
[0110] Collagens are also used in combination with ceramics and
other materials to restore defects in bone and enhance bone growth.
Type II collagens are particularly useful for the repair of
cartilage damage. Collagen Type II can also be administered orally
as a therapeutic agent for inducing tolerance to rheumatoid
arthritis. The collagens of the invention are also employed in
cardiovascular surgery, production of synthetic skin, opthalmology,
thoracic surgery, otology, neurosurgery, and as a stabilizing agent
in drug delivery systems. The collagens are usually employed in
high molecular weight fibrillar form. However, procollagens
existing as individual trimeric units can also be used. In this
case, processing to collagen and assembly of higher order forms
takes place in situ after treatment of the patient. The methods are
broadly applicable to human and veterinary subjects.
[0111] The following examples are provided to illustrate but not to
limit the invention.
EXAMPLES
Example 1
Vectors for Collagen Expression
[0112] a. PRO.alpha.1(1) Collagen cDNA based expression vector
[0113] A plasmid vector was constructed containing the bovine
.alpha.S1-casein 5'-flanking region including the proximal promoter
operably linked to a cDNA sequence encoding the human pro.alpha.(I)
collagen gene, which is in turn operably linked to a 3'-flanking
sequences derived from the human genomic collagen gene. The fusion
product of the collagen cDNA [XbalSalI fragment] and the casein
promoter at a Clal site yields the following nucleotide sequence
(SEQ ID NO:1):
##STR00001##
[0114] The XbaI-EcoRI fragment (4363 bp) of a collagen cDNA was
subcloned into the XbaI-EcoRI site of pGEM-7B, giving rise to the
pGCOLXE plasmid (FIG. 1). This collagen cDNA fragment lacks the
region encoding for the last 10 amino acids of the protein. The
full-length coding region of the human pro.alpha.1(I) collagen was
reconstituted by fusing a 5.7 kb EcoRI fragment (Schnieke et al.,
Proc. Natl. Acad. Sci. USA 84, 764-768 (1987)) derived from the
GC103 genomic clone (FIG. 1) (Barsh et al., supra) to the EcoRI
site of the pGCOLXE vector. This 5.7 kb fragment contains the
nucleotides encoding for the last 10 amino acids of the collagen
protein from exon 52, the stop codon, the collagen 3'-UTR and the
3'-flanking sequences including two polyadenylation sites at
.about.300 by and 1314 by downstream of the termination codon. The
orientation of the subcloned fragment was confirmed by HindIII
digestion and sequencing. The resulting plasmid pGCOLXEE is shown
in FIG. 1.
[0115] The collagen sequences were placed under the control of the
bovine .alpha.S1-casein promoter as follows. The plasmid [p(83),
CS)] (FIG. 1), carrying a 6.2 kb .alpha.S1-casein promoter and
fused to the human IgG splice acceptor site fragment (ca. 0.3 kb),
was digested with SalI-ClaI. A 10 kb SalI-ClaI collagen fragment
was excised from plasmid pGCOLXEE (FIG. 1) by SalI digestion
followed by a partial ClaI digestion. The two fragments were
ligated resulting in the construct designated p8cCOL(A1).sub.3. The
structure of the construct was verified by NotI, EcoRI, NotI-SalI,
ClaI/XbaI, HindIII, ClaI/SalI restriction mapping.
[0116] b. Construction of Vectors Based on the Human Genomic
PRO.alpha.1(I) Collagen Gene
[0117] The first intron of the human collagen (1) gene has been
reported to contain both positive and negative transcriptional
regulatory elements (Rossi et al., Proc. Natl. Acad. Sci. 84,
5590-5594 (1987)); Rossouw et al., J. Biol. Chem. 262, 15151-15157
(1987); Bornstein et al., Proc. Natl. Acad. Sci. 84, 8869-8873
(1987); Bornstein et al., J. Biol. Chem. 263, 1603-1606 (1988a);
Bornstein et al., Mol. Cell. Biol. 8, 4851-4857 (1988b)
(incorporated by reference in their entirety for all purposes).
Because the interaction of the enhancer-like elements of the first
collagen intron with the casein 5'-flanking sequences used in the
present studies was unpredictable, expression vectors were
constructed with or without the first intron of the collagen gene.
In both vectors, sequences from the 5'-end of the first exon of the
collagen gene that form a predicted hairpin loop and probably
inhibit translational efficiency of the collagen gene (Chu et al.,
supra, (1985)) were deleted. In both vectors, the predicted
nucleotide sequence from the transcription start site (+1) to the
initiation codon (underlined) of the collagen gene is (SEQ ID
NO:2):
##STR00002##
[0118] (1) Construct Containing the First Intron
[0119] The strategy entailed linking an entire genomic clone of
.alpha.1(I) procollagen (other than the 5' 114 bases which form the
inhibitory hairpin loop) including about 20 kb of collagen 3'
flanking sequence to a 5' .alpha.s1 casein flanking sequence
including a promoter. The construct was assembled from four
fragments.
[0120] Plasmid p(-680, CS) which contains 0.7 kb of the
.alpha.S1-casein promoter was modified by means of a
ClaI-XbaI-KpnI-SalI linker introduced into the ClaI-SalI sites
(FIG. 2, panel A) and verified by sequencing and restriction
mapping. The plasmid was digested with XbaI-KpnI(Asp718) and
ligated to a 1600 by XbaI-KpnI fragment (positions 114 by of the
1st exon to position 1715 by of the second exon of the collagen
GC103 genomic clone; FIG. 2, panel C). This cloning strategy
resulted in pCOL1600. To fuse the 0.7 kb .alpha.S1-casein promoter
to the additional 5' .alpha.s1 flanking sequences, PCOL1600 was
digested with NotI-NsiI and purified. A 6.0 kb fragment of the
.alpha.S1-casein promoter was excised from the p(8 kb, CS) plasmid
(FIG. 2, panel D) by NotI-NsiI digestion and ligated to the
pCOL1600 fragment. The resulting construct was designated
p8COL1600. Construction of p8COL1600 was verified by NsiI-NotI,
NsiI, Asp718, NotI-Asp718, XbaI and HindIII digestion. The casein
promoter-collagen fusion fragments was released from p8COL1600 by
NotI-partial KpnI(Asp718) digestion, resulting in an 8.1 kb DNA
fragment containing .alpha.s1 5' flanking sequence and a 5'
fragment from the al collagen gene.
[0121] The remainder of the al procollagen gene and 3' flanking
sequence was cloned as a 32 kb Asp718-NotI fragment. PWE15_C_S was
digested with NotI (FIG. 2, panel E) and the linker
NotI*-KpnI-SacII-SnaBI-SunI-NotI was inserted (* indicates that
this site is destroyed upon ligation). The resulting vector
(pWESun) was digested with Asp718-SunI and a 32 kb Asp718-Asp718
fragment from collagen GC103 clone (FIG. 2, panel C) was ligated
into these sites. The SunI site is compatible with Asp718 but it is
not regenerated upon ligation. The 32 kb Asp718 genomic collagen
fragment contains most of the collagen gene (from nucleotide 1716
of exon 2) plus approximately 20 kb of 3'-end (cosmid CG103). After
packaging and transformation the orientation of the inserted
fragment was confirmed by NotI-XhoI mapping.
[0122] The Asp718-NotI collagen fragment was excised, purified and
ligated with the NotI/KpnI 8.1 kb fragment and with NotI digested,
dephosphorylated pWE15_C_S cosmid vector (FIG. 2, panel E) in a
three-fragment ligation reaction. This ligation resulted in vector
c8gCOL(A1), which contains the genomic collagen sequences (starting
at position 114 of exon 1, i.e., 4 by upstream from the initiation
codon of translation) of clone GC103 (D'Alessio et al., Gene 67,
10-115 (1988). The structure of the construct was verified by
EcoRI, XhoI-Asp718, HindIII and BamHI-NotI restriction
analysis.
[0123] (2) Genomic Construct Lacking First Intron
[0124] This vector was constructed by the same strategy as
described above except that a 147 by XbaI-KpnI fragment (positions
114 bp-260 by of the collagen cDNA; FIG. 2, panel B) was used
instead of the 1600 by XbaI-KpnI fragment. The equivalent to
p8COL1600 in the previous method was designated p8COL150. A DNA
segment containing the .alpha.s1 casein promoter and 5' procollagen
sequence was excised from this vector as a 6.65 kb fragment. This
fragment was ligated to the 32 kb Asp718-NotI genomic collagen
fragment to yield the vector, c8g_iCOL(A1). This vector is
identical to c8giCOL(A1) except for the deletion of the 1454 by
first intron in the former.
[0125] c. Genomic Constructs Encoding Human .alpha.2(I)
Procollagen
[0126] Three candidate clones for the human .alpha.2(I) procollagen
gene were isolated from a P1 phage library from Genome Systems,
Inc. (St. Louis, Mo.). The clones were probed with oligonucleotides
from intron 1 and the 3' untranslated regions of the human
.alpha.2(I) procollagen sequence described by de Wet et al., J.
Biol. Chem. 262, 16032-16036 (1987) (incorporated by reference in
its entirety for all purposes). One of these clones contained the
full-length gene. Analysis of the human .alpha.2(I) procollagen
gene sequence in the Genbank/EMBL database identified a Cel2
restriction site within exon 1 which overlaps the translation start
site (see FIG. 7, panel A). This Cel2 site provides a convenient
site for fusion of the human .alpha.2(I) procollagen gene with the
bovine .alpha.S.sub.1-casein 5' untranslated sequence. Mapping of
this site within a 5' XhoI/BamHI fragment showed the presence of a
second Cel2 site approximately 2 kb downstream of the translation
start site. See FIG. 7 (panel A).
[0127] The genomic clone was reconstructed in the vector pWE15 by
one of two strategies. In a first strategy, a synthetic polylinker
containing convenient restriction sites was inserted into the
cosmid vector pWE15 at the EcoRI/NheI site.
[0128] The restriction sites within the polylinker (designated
oligo A) are shown in FIG. 7 (panel B). The 5' XhoI/BamHI fragment
of the human .alpha.2(I) procollagen gene was then introduced into
the XhoI/BamHI site of the cosmid vector. The XhoI site is
approximately 500-1000 by upstream of the transcription start site.
The endogenous 5' untranslated region of the .alpha.2(I)
procollagen gene between sites XhoI and Cel2 was replaced with the
bovine casein 5' untranslated region (designed oligo B) (SEQ ID
NO:3).
TABLE-US-00001 ATCGATTTGCTTCTTTCCAGTCTTTCTAGACATG ClaI Met
The orientation of the Cel2/Cel2 fragment following these
manipulations was determined by DNA sequencing. Finally, the
remainder of the human .alpha.2(I) procollagen gene (a 29 kb
BamHI/BamHI fragment) was inserted at the BamHI site linked to the
modified 5' end of the gene. The orientation of the BamHI/BamHI
fragment was checked by restriction mapping. The reconstructed gene
(FIG. 7, panel C) was then linked to the bovine .alpha.s1-casein
promoter-enhancer fragment as described above for the .alpha.1(I)
procollagen gene.
[0129] The second strategy used the same initial steps as the first
strategy, but instead of ligating the 29 kb BamHI-BamHI .alpha.2(I)
procollagen fragment ligated two fragments, a XhoI-BamHI fragment
containing the .alpha.2(I) procollagen and a XhoI-XhoI fragment
containing the .alpha.2(I) procollagen 3' end. The resulting
construct has a 4 kb longer 3' flanking sequence than the construct
produced by the first strategy (5.5 kb vs. 1.5 kb) (FIG. 7, panel
C). The construct otherwise contains the same restriction sites as
the gene construct from the first strategy with which to link it to
the bovine .alpha.S.sub.1-casein promoter-enhancer fragment.
Example 2
Expression of Constructs in Mammary Cell Culture
[0130] This example shows the feasibility of expressing, assembling
and secreting an .alpha.1(I) procollagen in mammary gland cells, a
cell type that does not normally express this gene. The cDNA and
genomic vectors described above were transfected in their circular
form into the mouse mammary epithelial cell line HC11 (Ball et al.,
EMBO 7, 2089-2095 (1988)). The cells were maintained as monolayers
in RPMI 1640 (10% FCS, 2 mM L-Glutamine, 50 .mu.g/ml gentamicin, 5
.mu.g/ml insulin, 10 ng/ml EGF). 30-40 .mu.g of each construct
together and a hygromycin-resistance cotransfecting plasmid were
complexed with 50 .mu.g lipofectine (Gibco) and allowed to fuse
with 2-3.times.10.sup.6 cells.
[0131] After 48 hr of growth in normal medium, selection medium was
applied to select for stable transfectants. Two independent
transfection rounds have been performed, and resistant colonies
were scored after about 2 weeks (Table 1).
TABLE-US-00002 TABLE 1 TRANSFECTION OF COLLAGEN EXPRESSION VECTORS
NUMBER OF COLONIES: CONSTRUCT: TRANSF. 1: TRANSF. 2: p8cCOL (A1)3
900 800 c8gCOL (A1) 45 500 c8g_iCOL (A1) 30 150
[0132] Colonies derived from independent transfection experiments
were pooled and 10.sup.6 cells were seeded in 6-well plates and
grown to confluence. Cells received either normal medium or medium
containing lactogenic hormones. Some cells also received 50
.mu.g/ml sodium ascorbate. RNA was harvested from cultures and
analyzed for expression of human collagen.
[0133] a. Northern Blotting
[0134] Human .alpha.1(I) collagen mRNA was detected by Northern
blotting. Total RNA was isolated from tissues and cells grown under
different conditions by the RNAzol method (Tell-test). 10-20 .mu.g
of total RNA was separated on 1.0% agarose formaldehyde gels
(Sambrook et al., Molecular Cloning: A Laboratory Manual (2d ed.)
CSHP, CSH, NY (1989)) (incorporated by reference in its entirety
for all purposes) and transferred to Hybond filters (Amersham). The
4.3 kbp XbaI-EcoRI fragment isolated from the hCOL cDNA clone was
used as a probe.
[0135] FIG. 3 (panel A) shows RNA obtained from mouse fibroblast
cells (3T3, lane 1) (expected to express collagen type I), mouse
mammary gland (lactating day 8, lane 2) (not expected to express
collagen), human keratinocytes (lane 3) (expected to express
collagen), and human fibroblasts (lane 4) (expected to express
collagen). The latter two lanes showed the two expected 4.8 kb and
5.8 kb collagen transcripts. The mouse fibroblasts (3T3) sample
cross-hybridized with the human probe resulting in a 4.8 kb band.
The lactating mammary gland samples (consisting mainly of
epithelial cells) did not show any cross-hybridizing band.
[0136] FIG. 3 (panel B) shows RNA from control HC11 cells and HC11
cells transfected with the above vectors after culturing cells in
complete medium. The control cells in lanes 1 and 2 do not cross
hybridize with the human collagen probe. Lanes 3, 4, and 5
containing RNA from cells transfected with c8g_iCOL(A1),
p8cCOL(A1).sub.3, and c8gCOL(A1), respectively, show a 4.8 kb
transcript. The presence of the transcript shows that all 3
collagen expression vectors are transcribed and produce human
collagen mRNA.
[0137] b. Immunofluorescence Staining
[0138] Transfected cells were seeded in 8-well chamber slides and
grown to confluency. Normal medium or medium containing lactogenic
hormones was added to the cells. Some cells also received 50
.mu.g/ml sodium ascorbate. After culturing, the cells were fixed
(cold acetone/methanol (1/1) for 10 min, -20.degree. C.), and
incubated with a 1:400 dilution of a rabbit polyclonal antibody
specific for the C-terminus of type I human pro .alpha.1(I)
(Collagen Corp., Palo Alto, Calif.). After thorough washing,
anti-rabbit IgG FITC-conjugate (Sigma, 1:200 dilution) was added.
The detection of human collagen was performed by fluorescence
microscopy, and representative sections of the slides were
photographed.
[0139] FIG. 4, panel A shows cells transfected with construct
c8gCOL (A1) and panel B shows cells transfected with construct
c8g_iCOL(A1). In the transfected cell pools, strongly stained cells
were observed displaying a typical intracellular-patchy-granular
staining pattern. The results indicate that cells within the pools
express the transgene. The cells appear to express the human
collagen at variable levels perhaps reflecting their different
chromosomal sites resulting from random integration. Control HC11
cells showed background staining but with a different distribution
of signal surrounding the cell surface.
[0140] c. Protein Analysis
[0141] Medium and cytoplasmic extracts from control HC11 cells
(murine) and MacT cells (bovine) (Huynh et al., Exp. Cell Res. 197,
191-199 (1991), as well as from the HC11 cells transfected with the
above vectors were prepared as follows.
[0142] About 2.times.10.sup.7 cells were plated in medium (HC11
cells in RPMI 1640; MacT cells in DMEM supplemented with 10% FCS, 2
mM L-Glutamine, 50 .mu.g/ml gentamicin, 5 .mu.g/ml insulin, 10
ng/ml EGF) with or without 50 .mu.g/ml sodium ascorbate. The cells
were cultured for 24 hours. The medium was then harvested in the
presence of protease inhibitors (PMSF, EDTA, leupeptin, and
pepstatin), and lyophilized. The cells were lysed in lysis buffer
(50 mM Tris pH 8, 150 mM NaCl, 0.1% SDS, 1% NP40 supplemented with
the protease inhibitors). The cytoplasmic fraction was then
harvested and lyophilized. The medium and cytoplasmic samples (as
well as negative mouse milk samples) are analyzed for the presence
of human .alpha.1(I) protein by ELISA and Western blotting.
Example 3
Production of Transgenic Animals Expressing .alpha.1(I)
Procollagen
[0143] (1) Transgenesis
[0144] Collagen transgene fragments were excised from the three
vectors described in Example 1 by NotI digestion and purified by
0.65% agarose gel electrophoresis and electroelution. (FIG. 2,
panel A). Fertilized mouse eggs (CBA/BrAxC57B1/6) were
microinjected (with 100-200 copies of the fragment) and transferred
into pseudo-pregnant females as described (Hogan et al., supra).
Total genomic DNA was prepared from a short segment of mouse tail
to check for integration of the injected DNA. EcoRI-digested tail
DNA was analyzed by Southern blotting (Sambrook et al., supra). The
probe used to check for integration of the transgene was a 300 by
NcoI-NsiI fragment, spanning the region from -680 to -250 (relative
to the major transcription start site) of the bovine
.alpha.S1-casein gene. The probe was labeled with .sup.32P using
random hexanucleotide primers (Sambrook et al., supra). The numbers
of transgenic mice containing one of the 3 vectors described in
Example 1 are as follows:
[0145] p8cCOL(A1).sub.3: 23 transfers have been performed and out
of the 15 resulting pregnancies 59 pups were tested. From these, 4
were shown to be transgenic (3 male and 1 female).
[0146] c8gCOL(A1): 32 transfers have been performed and out of the
27 resulting pregnancies 108 pubs were tested. From these 13 were
shown to be transgenic (8 males and 5 females).
[0147] c8g_iCOL(A1): 34 transfers have been performed and out of
the 27 resulting pregnancies 53 pups were tested. From these, 10
were shown to be transgenic (7 males and 3 females).
[0148] All transgenic mice were mated to obtain F1 offspring (both
in case of males and females), and F0 milk (in case of
females).
[0149] (2) Protein Analysis
[0150] Milk from lactating mice was collected 10 min after
subcutaneous injection of 1 unit of oxytocin (PitonS, Organon) to
induce milk secretion. Milk samples were supplemented with protease
inhibitors (PMSF, EDTA, leupeptin, pepstatin), and frozen at
-80.degree. C. until analysis. 5 .mu.l mouse milk (control and
transgenic) was diluted tenfold in PBS. 5 .mu.l samples were then
analyzed by SDS PAGE under reducing (lanes 1-8) and nonreducing
conditions (lanes 9-15).
[0151] FIGS. 5 and 6 shows that milk from transgenic mice contain a
band of about 160 kDa that was not present in the milk of control
mice. The 160 kDa observed on the gels is close to the anticipated
molecular weight for the monomeric form of .alpha.1(I) procollagen
as measured by PAGE. Because secretion of procollagen is believed
to be dependent on the prior posttranslational modifications and
assembly into a trimeric structure, the observation that secretion
has occurred indicates that prior modification and assembly have
also occurred. Analysis of the same samples under nonreducing
conditions indicated the presence of several higher molecular
weight bands in the milk from transgenic mice that were not present
in the controls. These bands are likely trimeric procollagen,
trimeric collagen or higher order forms of collagen. The figure
indicates that most, if not all of the procollagen in transgenic
mouse milk was in the form of higher order structures. This result
shows that the procollagen polypeptide chains are able efficiently
to associate with each other within the mammary epithelium.
Therefore, provision of an exogenous chaperon protein to express
recombinant procollagen in mammary tissue is not necessary.
[0152] (3) Confirmation that .about.160 kDa Band in Reducing Gels
is Procollagen
[0153] Transgenic milk samples were analyzed by Western blotting.
The antiserum was directed against the amino-terminus of human
.alpha.(1) procollagen. A milk sample from founder 2395 was
processed as described for SDS-PAGE and run under nonreducing
conditions, followed by transfer to nitrocellulose filters. Signal
was detected using the ECL system (Amersham). No signal was
observed with negative mouse milk (FIG. 8, track 1). Therefore, the
antibody does not crossreact with nontransgenic mouse milk. Track 2
contains milk from founder 2395. The proteins produced in the milk
of founder 2395 do crossreact with the antibody. This indicates
that the proteins are procollagen, collagen or higher forms
thereof, and that the antigenic determinants are similar to those
in the native procollagen protein.
[0154] Further confirmation that the new polypeptide chain found in
the milk of some transgenic mice is the expression product of the
human .alpha.(1) procollagen gene introduced into these mice was
obtained by digesting milk samples with collagenase. Milk from
mouse 2395 was treated with bacterial collagenase followed by
electrophoresis through a 5% polyacrylamide gel. The procollagen
band at about 160 kDa disappeared (see FIG. 9).
[0155] (4) Concentration of Procollagen
[0156] The concentration of type I procollagen in milk samples was
determined by the Prolagen-C kit (Metra Biosystems, Palo Alto,
Calif.). The kit reports the values in ng/.mu.l of
carboxy-propeptide; therefore, the concentration of HSF samples
were corrected by a factor of 4.5 to account for the entire
procollagen molecule. 0.5 .mu.l of mouse milk was denatured and
electrophoresed on an SDS page gel in comparison with collagen
standards of known concentration. Concentrations were determined by
comparison of band intensities. Concentrations of procollagen from
mice harboring a cDNA construct were too low to detect.
Concentrations from mice harboring a genomic construct were in the
range of 4-10 mg/ml.
[0157] A summary of the expression levels is listed in Table 2.
[0158] In four mouse lines in which expression was examined for
both the founder and her F1 offspring, the relative expression
levels were comparable.
TABLE-US-00003 TABLE 2 Expression Levels of Transgenic Mice
containing the Human .alpha.1(I) Procollagen DNA Relative
expression level construct none low med. high p8cCOL (A1)3 3 1 0 0
c8gCOL (A1) 3 3 3 1 c8g_iCOL (A1) 2 2 3 1
High level expression indicates greater than about 4 mg/ml, medium
expression indicates about 0.8-4 mg/ml and low expression about
0.1-0.8 mg/ml. Constructs indicated as nonexpressors may express at
lower levels detectable by Western blotting. The numbers represent
independent transgenic female founder mice and/or transgenic mouse
lines.
[0159] All F1 mice carrying more that one intact copy of a genomic
transgene expressed in the mg/ml range.
[0160] (5) Proteolytic Digestion Analyses
[0161] The structural integrity of procollagen from milk of
transgenic mice can be tested by digestion with proteases.
[0162] The ends of natural procollagen molecules are susceptible to
digestion by proteases, whereas the central trimeric region is
resistances. Milk samples from transgenic mice were prepared for
digestion by the method of Bruckner & Prockop, Annal. Biochem.
110, 360-368 (1981). Samples were diluted into 10 mM Tris, 0.1 mM
EDTA, 150 mM NaCl, pH 7.4, and digested with a mixture of
trypsin/chymotrypsin (in 4- and 40-fold molar excess respectively)
for 1 hour at 20.degree. C. The reaction was terminated by the
addition of soybean trypsin inhibitor. The samples were heated to
65.degree. C. for 20 min and run on a 7.5% SDS-polyacrylamide gel
and stained with Coomassie R-250.
[0163] FIG. 10 (Panels A and B) shows that digestion of two
positive controls (i.e., media samples from cell lines which
produce human type I procollagen heterotrimer and homotrimer)
produces the expected reduction of size upon enzymatic digestion
from procollagen to collagen retaining only the triple helical
region [i.e., from about 160 kDa to about 100 kDa). A second band
migrating faster than collagen also appears which corresponds to an
intermediate degradation product. Two samples of milk from
transgenic mice (one each from the genomic constructs c8gCOL(A1)
and c8g_iCOL(A1) also showed this pattern, although the
intermediate degradation product was more pronounced (FIG. 10,
panels C and D). The similarity of profiles between the milk
samples and the procollagen controls shows that the type I
procollagen polypeptides in milk are, like the controls, assembled
into a triple helix.
[0164] To test the stability of the trimeric form of procollagen
produced by transgenic mice, a temperature profile of the
procollagen molecule was obtained by increasing reaction
temperatures of the trypsin/chymotrypsin digestion. The results are
shown in FIG. 10. The melting temperature, or Tm, was defined as
the temperature at which one-half of the bands corresponding to
collagen and distinct degradation intermediates were digested by
trypsin/chymotrypsin. FIG. 10 indicates that the thermal stability
of trimeric collagen from transgenic mice is about 30.degree. C.
Although these data evidence a substantial stability, the stability
is somewhat lower than of native type I collagen (40.degree. C.) or
homotrimic collagen produced in cell culture (38.degree. C., as
reported by Geddis & Prockop, Matrix 13, 399-405 (1993). The
difference in melting temperatures is likely the result a lower
degree of hydroxylation of proline residues in procollagen from the
transgenic mice.
[0165] Stability of trimeric collagen produced by transgenic mice
was also tested by pepsin digestion. Like trypsin and chymotrypsin,
pepsin cleaves within the Gly-X-Y region of denatured procollagen,
but is unable to cleave when the procollagen polypeptides are in a
triple helical conformation.
[0166] A pepsin digestion was performed on type I procollagen
hetero- and homotrimers (as controls) and on mouse milk samples
from mice 2395 and 2399 using conditions optimized for complete
digestion of denatured procollagen. The digestion by pepsin was for
2 h at pH 2.5. The samples were neutralized with 1 M Tris and then
loaded onto a 5% SDS-PAGE gel. The Tm for both the heterotrimeric
and homotrimeric procollagen controls is approximately 40.degree.
C. and the procollagen molecules isolated from these two cell lines
melt over a narrow temperature range. The procollagen in milk from
mouse lines 2395 and 2399 has a Tm of about 30.degree. C. and
32.5.degree. C., respectively.
[0167] Thus, procollagen in the milk from mouse 2399 appears to be
slightly more resistant to thermal denaturation than the
procollagen in the milk from mouse 2395.
[0168] (6) Amino Acid Composition
[0169] This experiment determines the amino acid composition of the
human .alpha.1(I) procollagen in the milk of transgenic mice.
[0170] Milk from lines previously determined to be relatively high
expressors (mg/ml range) along with control collagen samples (HSV
and SV), were isolated from 5% SDS PAGE gels. The gel was cut to
isolate the procollagen bands. Each of the gel slices was incubated
at 4.degree. C. overnight to elute the protein from the gel slice
(Fleick & Shiozawa, Analyt. Biochem. 187, 205 (1990). The
supernatant was recovered after centrifugation and lyophilized. The
protein samples were dissolved and reprecipitated (Wissel &
Flugge, Analyt. Biochem. 138, 141-143 (1984)). 1.5-4 .mu.g was
recovered for each sample, except for 2465, for which 0.75 .mu.g
was recovered.
[0171] HSF and SV samples were run in duplicate. Amino acid
analysis of the samples was performed under conditions which would
quantify hydroxyproline residues. Under these conditions, both
aspartic acid and asparagine comigrate and glutamic acid and
glutamine comigrate (due to the loss of amino group of Asn and Gln,
respectively, during processing).
[0172] Approximately 90% of serine and threonine were recovered.
Cysteine and methionine can be partially or fully oxidized under
these conditions, so their values may have been lower than
expected. Tryptophan was completely destroyed under these
conditions and therefore was undetectable. Glycine content was high
due to some carryover from the buffer within the acrylamide gel.
Both hydroxy-proline (HyP) and hydroxy-lysine (HyL) were
Quantified.
TABLE-US-00004 TABLE 3 Measurement of Hydroxylated Amino Acids
OH-Pro OH-Lys sample (Pro + OH-Pro (Lys + OH-Lys) HSV 45% 43% SV
47% 54% 2395 13% 2% 2410 7% 0% 2399 27% 5% 2402 19% 2% 2409 11% 4%
2465 7% 0%
Table 3 shows about equal amounts of proline and hydroxyproline
(45% and 47%) for HSF and SV control samples, respectively, in
agreement with prior measurements (Steinmann et al., J. Biol. Chem.
259, 11129-11138 (1984). Substantial levels of hydroxyproline (from
7% to 27%) were also detected in all procollagen samples isolated
from the milk of transgenic mice. Therefore, proline residues in
procollagen from transgenic mice were hydroxylated at levels of
about 15-60% of the controls. Higher levels of hydroxylation can be
induced, if desired, by altering the feed of the animals,
introducing an additional transgene expressing prolyl hydroxylase
or optimizing expression levels. Expression can be lowered to
optimal levels by using a less efficient enhancer-promoter
fragment, or using cDNA or cDNA-genomic hybrid constructs.
[0173] Levels of lysine hydroxylation were much lower in the
procollagen isolated from milk of transgenic animals relative to
procollagen from control samples. The low levels of hydroxylation
offer the advantage of reducing aggregation of procollagen into
higher order structures in milk, facilitating handling. Formation
of higher order structures can be induced in vitro or can proceed
in situ after injecting procollagen into a patient.
[0174] (7) Histology of Mammary Glands
[0175] Mammary glands from several transgenic mice were fixed in
10% formalin in preparation for histological analysis. The samples
included glands from negative mice, a nonexpressing cDNA-containing
transgenic mouse (line 2392), and three medium to high-expressing
lines of transgenic mice (lines 2395, 2399, 2410, 2412). There were
no significant differences between normal and transgenic mice.
[0176] (8) Tissue-Specificity of Expression RNA was extracted from
the mammary glands of transgenic mice and control nontransgenic
mice and analyzed by Northern blotting as described above. The
probe was a 23 by oligonucleotide specifically hybridizing to the
5' casein UTR of the transgene. Samples from transgenic mice
harboring either of the genomic .alpha.1(I) constructs showed two
labelled bands of the expected length for transgene-specific
transcripts (4.8 and 5.8 kb). Samples from nontransgenic mice did
not give rise to transgene-derived transcripts.
[0177] RNA was also analyzed from various tissues of transgenic
mice to investigate the tissue specificity of transgene expression.
The mouse selected for this analysis was mouse 2817 (line 2395).
This mouse line displays the highest level (>10 mg/ml) of
procollagen. Northern blots of RNA from the mammary gland, brain,
lung, thymus, kidney, liver, salivary gland, tongue, muscle leg,
muscle belly, heart intestine, ovary and stomach are shown in
tracks 2-17 of FIG. 11. Track 1 contains RNA from the mammary gland
of a nontransgenic mouse. Only track 2 (mammary gland of transgenic
mouse) shows bands of the expected size representing
transgene-derived transcript. It is concluded that in mouse 2817
(the highest expressor to date), the transgene is expressed solely
in the lactating mammary gland.
[0178] As will be clear to those skilled in the art from the above,
the invention includes a number of general concepts which can be
expressed as follows.
[0179] Thus, one general aspect of the invention is the use of a
transgenic non-human mammal in the expression of an exogenous
procollagen or collagen, said expression being mammary
gland-specific expression of a transgene which includes a
recombinant DNA segment encoding an exogenous procollagen
polypeptide.
[0180] In another aspect, the invention includes the use of a DNA
segment encoding a human procollagen polypeptide in the production
of a transgene for the mammary gland-specific expression of an
exogenous procollagen or collagen in a transgenic non-human
mammal.
[0181] Yet a further aspect of the invention is the use of a DNA
segment encoding an exogenous procollagen polypeptide in the
production of a stable non-human mammary gland cell line, which
cell line incorporates a transgene and has the ability when induced
by a lactogenic hormone to express the transgene to produce
exogenous procollagen or collagen.
[0182] In the first of the above-mentioned uses, a second transgene
may be provided which includes a recombinant DNA segment encoding a
prolyl hydroxylase enzyme such that, in the adult form of the
non-human mammal or a female descendant thereof, said second
transgene is capable of being expressed in the endoplasmic
reticulum of the mammary secretory cells to produce the prolyl
hydroxylase enzyme in an amount sufficient to hydroxylate the
exogenous procollagen polypeptide such that the polypeptide is
assembled and secreted in the trimeric form.
[0183] In another preferred aspect of the first of the
above-mentioned uses, a second transgene may also be employed such
that, in the adult form of the non-human mammal or a female
descendant thereof, the first and second transgenes are capable of
expressing respective first and second recombinant DNA segments
therein in the mammary secretory cells of said animal to produce
forms of .alpha.1(I) and .alpha.2(I) procollagen that are processed
and secreted by said mammary secretory cells into milk as a trimer
comprising at least one chain of .alpha.1(I) procollagen or
collagen and at least one chain of .alpha.2(I) procollagen or
collagen.
[0184] In all of the above uses, a further aspect may be the
inclusion of a mammary gland specific enhancer and a mammary gland
specific promoter.
[0185] While the foregoing invention has been described in some
detail for purposes of clarity and understanding, it will be clear
to one skilled in the art from a reading of this disclosure that
various changes in form and detail can be made without departing
from the true scope of the invention. All publications and patent
documents cited in this application are incorporated by reference
in their entirety for all purposes to the same extent as if each
individual publication or patent document were so individually
denoted.
Sequence CWU 1
1
* * * * *