U.S. patent application number 12/658949 was filed with the patent office on 2010-12-02 for cd44v6 peptides as inhibitors of bacterial infections.
This patent application is currently assigned to Karlsruher Institut fur Technologie. Invention is credited to Christian Jung, Alexandra Matzke, Veronique Orian-Rousseau, Helmut Ponta.
Application Number | 20100305026 12/658949 |
Document ID | / |
Family ID | 40834558 |
Filed Date | 2010-12-02 |
United States Patent
Application |
20100305026 |
Kind Code |
A1 |
Jung; Christian ; et
al. |
December 2, 2010 |
CD44V6 peptides as inhibitors of bacterial infections
Abstract
The present invention relates to the use of peptide compounds
for the prevention and/or treatment of a bacterial infection.
Inventors: |
Jung; Christian; (Karlsruhe,
DE) ; Orian-Rousseau; Veronique; (Rittershofen,
FR) ; Matzke; Alexandra; (Pforzheim, DE) ;
Ponta; Helmut; (Weingarten, DE) |
Correspondence
Address: |
KNOBBE MARTENS OLSON & BEAR LLP
2040 MAIN STREET, FOURTEENTH FLOOR
IRVINE
CA
92614
US
|
Assignee: |
Karlsruher Institut fur
Technologie
Karlsruhe
DE
|
Family ID: |
40834558 |
Appl. No.: |
12/658949 |
Filed: |
February 16, 2010 |
Current U.S.
Class: |
514/2.8 ;
514/2.4; 514/2.9; 530/321; 530/327; 530/330 |
Current CPC
Class: |
C07K 14/70585 20130101;
Y02A 50/411 20180101; A61K 38/178 20130101; A61K 38/12 20130101;
A61P 31/04 20180101; Y02A 50/475 20180101; Y02A 50/30 20180101 |
Class at
Publication: |
514/2.8 ;
514/2.4; 514/2.9; 530/330; 530/321; 530/327 |
International
Class: |
A61K 38/08 20060101
A61K038/08; A61K 38/10 20060101 A61K038/10; A61K 38/12 20060101
A61K038/12; C07K 7/06 20060101 C07K007/06; C07K 7/64 20060101
C07K007/64; C07K 7/08 20060101 C07K007/08; A61P 31/04 20060101
A61P031/04 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 16, 2009 |
EP |
09002149.4-2107 |
Claims
1. A method for the prevention and/or treatment of a bacterial
infection in an individual comprising administering a peptide
compound comprising the amino acid sequence set forth in amino
acids 7 to 11 of SEQ ID NO: 2 or of SEQ ID NO: 1, or a functionally
active derivative thereof, or a pharmaceutically acceptable salt
thereof.
2. The method according to claim 1, wherein the peptide compound
comprises SEQ ID NO: 2.
3. The method according to claim 2, wherein the bacterial infection
is an infection with an intracellular bacterium selected from the
group consisting of Listeria spp., Mycobacterium spp., Plasmodium
spp., and Shigella spp.
4. The method according to claim 3, wherein the intracellular
bacterium is Listeria monocytogenes.
5. The method according to claim 2, wherein the bacterial infection
is listeriosis.
6. The method according to claim 2, wherein the peptide compound is
a cyclopeptide or a pharmaceutically acceptable salt thereof.
7. The method according to claim 1, wherein the peptide compound
comprises SEQ ID NO: 1.
8. The method according to claim 7, wherein the bacterial infection
is an infection with an intracellular bacterium selected from the
group consisting of Listeria spp., Mycobacterium spp., Plasmodium
spp., and Shigella spp.
9. The method according to claim 8, wherein the intracellular
bacterium is Listeria monocytogenes.
10. The method according to claim 7, wherein the bacterial
infection is listeriosis.
11. The method according to claim 7, wherein the peptide compound
is a cyclopeptide or a pharmaceutically acceptable salt
thereof.
12. The method according to claim 1, wherein the bacterial
infection is an infection with an intracellular bacterium.
13. The method according to claim 12, wherein the intracellular
bacterium is selected from the group consisting of Listeria spp.,
Mycobacterium spp., Plasmodium spp., and Shigella spp.
14. The method according to claim 13, wherein the intracellular
bacterium is Listeria monocytogenes.
15. The method according to claim 1, wherein the bacterial
infection is listeriosis.
16. The method according to claim 1, wherein the peptide compound
is a cyclopeptide or a pharmaceutically acceptable salt
thereof.
17. A peptide compound comprising the amino acid sequence set forth
in amino acids 7 to 11 of SEQ ID NO: 2 or of SEQ ID NO: 1, or a
functionally active derivative thereof, or a pharmaceutically
acceptable salt thereof.
18. The peptide compound according to claim 17, wherein the peptide
compound comprises SEQ ID NO: 2.
19. The peptide compound according to claim 17, wherein the peptide
compound comprises SEQ ID NO: 1.
20. The peptide compound according to claim 17, wherein the peptide
compound is a cyclopeptide or a pharmaceutically acceptable salt
thereof.
Description
[0001] The present invention relates to the use of peptide
compounds for the prevention and/or treatment of a bacterial
infection.
[0002] Bacteria have developed ingenious strategies to invade
mammalian cells and to spread from one cell to another. They
express proteins that mimic functions of cellular proteins in order
to target host cells and promote their entry. One such bacterium is
Listeria monocytogenes, a food-borne pathogen that can cause
listeriosis. This disease manifests as meningitis, encephalitis,
gastroenteritis and mother-to-fetus infections that lead to
abortion in pregnant women. L. monocytogenes induces its uptake
into non-phagocytic host cells using surface proteins of the
internalin family. Although L. monocytogenes expresses several
internalins, only two members, internalin A and B (InlA, InlB), are
well characterized. InlA is covalently linked to the bacterial cell
wall and binds to E-cadherin. InlB is non-covalently bound to
bacterial lipoteichoic acids and stimulates c-Met phosphorylation.
Both InlA and InlB can independently mediate L. monocytogenes
invasion. After the initial binding to the cell surface, the
bacterium is engulfed by a "zipper" mechanism. Activation of cell
surface proteins leads to actin remodeling and membrane extensions
so that the bacteria can be driven into the cells. The vacuoles
containing the bacteria are then lysed by listeriolysin O, a
molecule that can lyse phagosomal membranes. The bacteria are
released into the cytoplasm and move from one cell to another using
the actin cytoskeleton.
[0003] InlB activates c-Met similarly to HGF, the classical c-Met
ligand, and induces downstream signaling pathways such as the MAPK
or the JNK pathway. Activated c-Met is internalized, a process that
normally regulates receptor tyrosine kinase (RTK) activation and
turnover. Indeed, shortly after activation by their ligands, RTKs
like c-Met are endocytosed, in most cases through a
clathrin-dependent mechanism. This internalization process is
subverted by L. monocytogenes to invade eukaryotic cells.
[0004] InlB and HGF do not compete with each other for binding to
c-Met. These data speak for the presence of different binding sites
for InlB and HGF on c-Met and are consistent with the fact that
InlB and HGF have no sequence homology and are not structurally
related. InlB consists of several domains including an N-terminal
leucine rich repeat (LRR), an Inter-repeat region (IR) followed by
a B-repeat (BR) and three C-terminal glycine/tryptophan-rich (GW)
domains. The LRR domain is critical for binding to c-Met and is
essential for the invasion of bacteria. Four amino acids located in
the exposed concave region of the LRR domain seem to be critical
for this binding, since mutations of all four amino acids lead to a
dramatic decrease of L. monocytogenes invasion. The functions of
the IR and of the B domains are not well characterized whereas the
role of the GW-rich modules seems to be the ability to bind to
heparan-sulfate proteoglycans (HSPG). The binding to HSPGs enhances
bacterial entry and is critical for c-Met clustering and
activation. Also heparin, a sulphated glycosaminoglycan present on
HSPGs, induces oligomerization of c-Met. A truncated form of InlB,
InlB321 where the B-repeat and GW domains are removed and that
cannot bind to heparin, induces phosphorylation of c-Met, but not
the phenotypic cellular response like cell scattering or
proliferation. This monomeric mutant is unable to dimerize the
isolated ligand-binding domain of c-Met in vitro, even in the
presence of heparin. Interestingly, in the case of HGF, heparan
sulfation is not required for activation of the c-Met receptor.
Indeed, a mutant of HGF deficient in heparin sulfate binding is
even more potent for c-Met activation than wild type HGF.
Furthermore, removal of heparan sulfate moieties from cell surface
molecules does not interfere with the activation of c-Met.
[0005] CD44 forms a family of transmembrane glycoproteins that play
important roles in many cellular processes amongst which are the
regulation of growth, survival, differentiation and migration. The
smallest isoform is called CD44s or CD44 standard. Larger isoforms
differ thereof mainly in their extracellular domain in which
inclusion of ten so-called "variant exons" in various combinations
can take place. Herein, the term CD44v6 designates isoforms that
contain the v6 variant exon either alone or in combination with
other variant exons. All CD44v6 isoforms are able to act as a
co-receptor for c-Met. In pathological situations, these isoforms
confer metastatic propensity to several tumor cells.
[0006] The role of CD44v6 for c-Met activation is two-fold: the
extracellular part of CD44 is needed for activation of the receptor
itself whereas the cytoplasmic tail is instrumental for signaling.
The cytoplasmic domain of CD44v6 recruits the actin cytoskeleton
via binding to ERM (Ezrin-Radixin-Moesin) proteins. CD44v6, HGF,
c-Met, ERM proteins together with the cytoskeleton form a
signalosome complex that promotes signaling. For instance, Ras
activation by its guanine-nucleotide exchange factor SOS did not
occur in cells transfected with a mutant form of CD44v6 where the
cytoplasmic domain had been removed. Furthermore, siRNA repressing
ezrin abrogated HGF induced signaling to Erk. Finally, an ezrin
protein that lacked the actin-binding domain (ez?ABD) acted in a
dominant negative fashion and repressed the activation of Erk
induced by HGF.
[0007] The co-receptor function of CD44v6 for c-Met is not unique.
For instance, VEGFR-2 that plays a pivotal role in angiogenesis
also requires CD44v6 for activation and for signaling.
Interestingly, the same CD44v6 peptides that block c-Met activation
also inhibited the activation of VEGFR-2 induced with VEGFA-165 and
reveal a role of CD44 in angiogenesis. More and more evidence shows
that several RTK-ligand units recruit other players such as cell
adhesion molecules most likely to fine-tune the signaling events.
Examples are FGFRs or EGFRs that recruit members of the syndecan
and cadherin family as co-receptors.
[0008] Therefore, one technical problem underlying the present
invention is to provide a medicament that can inhibit bacterial
infection.
[0009] The solution to the above technical problem is achieved by
the embodiments characterized in the claims.
[0010] In particular, the present invention relates to a peptide
compound comprising an amino acid sequence displayed by amino acids
7 to 11 of SEQ ID NO: 2 or of SEQ ID NO: 1, or a functionally
active derivative thereof, or a pharmaceutically acceptable salt
thereof, for use in the prevention and/or treatment of a bacterial
infection in an individual.
[0011] In another aspect, the present invention relates to a
peptide compound comprising an amino acid sequence displayed by SEQ
ID NO: 2 or SEQ ID NO: 1, or a functionally active derivative
thereof, or a pharmaceutically acceptable salt thereof, for use in
the manufacture of a medicament for the prevention and/or treatment
of a bacterial infection in an individual.
[0012] In a preferred embodiment, the peptide compound of the
present invention is a peptide consisting of amino acids 7 to 11 of
SEQ ID NO: 2 or of SEQ ID NO: 1. In another preferred embodiment of
the present invention, the peptide compound of the present
invention is a peptide comprising or consisting of SEQ ID NO: 2 or
SEQ ID NO. 1.
[0013] The peptide compound of the present invention may be any
peptide compound described in European patent application EP 1 647
556 which is hereby incorporated by reference in its entirety.
[0014] In a preferred embodiment, the peptide compound of the
present invention comprises or consists of a fragment of SEQ ID NO:
2 or of SEQ ID NO: 1, said fragment having the activity of
inhibiting the complex formation between CD44, c-Met and Inl-B
leading to the phosphorylation and internalization of c-Met, as
well as to phosphorylation of Erk.
[0015] For example the peptide compound of the present invention is
selected from the group consisting of
[0016] peptides comprising or consisting of the amino acid sequence
as shown in SEQ ID NO: 2 or SEQ ID NO: 1;
[0017] peptides consisting of a fragment of SEQ ID NO: 4 or of SEQ
ID NO: 3, and having the activity of inhibiting the complex
formation between CD44, c-Met and InlB leading to the
phosphorylization and internalization of c-Met, as well as to
phosphorylation of Erk;
[0018] heterologous fusion peptides comprising or consisting of a
peptide according to (a) or (b) fused to a heterologous amino acid
sequence; and
[0019] derivatives of a peptide according to (a), (b) or (c) having
the activity of inhibiting the complex formation between CD44,
c-Met and InlB leading to the phosphorylization and internalization
of c-Met, as well as to phosphorylation of Erk.
[0020] In a preferred embodiment of the present invention, the
peptide compound of the present invention is selected from the
group consisting of
[0021] peptides comprising or consisting of the amino acid sequence
as shown in SEQ ID NO: 2 or SEQ ID NO: 1,
[0022] peptides comprising or consisting of any one of the
following amino acid sequences:
[0023] amino acids 2 to 14 of SEQ ID NO: 2 or 1,
[0024] amino acids 2 to 13 of SEQ ID NO: 2 or 1,
[0025] amino acids 2 to 12 of SEQ ID NO: 2 or 1,
[0026] amino acids 2 to 11 of SEQ ID NO: 2 or 1,
[0027] amino acids 3 to 14 of SEQ ID NO: 2 or 1,
[0028] amino acids 3 to 13 of SEQ ID NO: 2 or 1,
[0029] amino acids 3 to 12 of SEQ ID NO: 2 or 1,
[0030] amino acids 3 to 11 of SEQ ID NO: 2 or 1,
[0031] amino acids 4 to 14 of SEQ ID NO: 2 or 1,
[0032] amino acids 4 to 13 of SEQ ID NO: 2 or 1,
[0033] amino acids 4 to 12 of SEQ ID NO: 2 or 1,
[0034] amino acids 4 to 11 of SEQ ID NO: 2 or 1,
[0035] amino acids 5 to 14 of SEQ ID NO: 2 or 1,
[0036] amino acids 5 to 13 of SEQ ID NO: 2 or 1,
[0037] amino acids 5 to 12 of SEQ ID NO: 2 or 1,
[0038] amino acids 5 to 11 of SEQ ID NO: 2 or 1,
[0039] amino acids 6 to 14 of SEQ ID NO: 2 or 1,
[0040] amino acids 6 to 13 of SEQ ID NO: 2 or 1,
[0041] amino acids 6 to 12 of SEQ ID NO: 2 or 1,
[0042] amino acids 6 to 11 of SEQ ID NO: 2 or 1,
[0043] amino acids 7 to 14 of SEQ ID NO: 2 or 1,
[0044] amino acids 7 to 13 of SEQ ID NO: 2 or 1,
[0045] amino acids 7 to 12 of SEQ ID NO: 2 or 1,
[0046] amino acids 7 to 11 of SEQ ID NO: 2 or 1,
[0047] and
[0048] heterologous fusion peptides comprising (a) or (b) fused to
a heterologous amino acid sequence.
[0049] The peptide compound of the present invention may comprise
amino acid sequences derived from other proteins. Therefore, in a
preferred embodiment, the peptide compound of the present invention
comprises fusion peptides comprising one of the above amino acid
sequences fused to a another, preferably heterologous, amino acid
sequence. The heterologous amino acid sequence may comprise or
consist of 1, 2, 3, 4 or more amino acids. The heterologous amino
acid sequence may for example comprise or consist of at least 5 or
at least 10 or at least 20 heterologous amino acids. The
heterologous amino acid sequences may be fused to the N- and/or
C-terminus of the peptide compound of the present invention.
[0050] In a further embodiment of the present invention, the
peptide compound of the present invention is a derivative of the
peptides described above. The term "derivative" as used herein
comprises functionally active derivatives, variants and chemical
derivatives of the peptide compound.
[0051] The term "functionally active derivative" as used herein
related to derivatives which contain deletions, additions and/or
substitutions of amino acids, the presence, absence or substitution
of which does not have a substantial influence on the activity of
the peptide compound, e.g. conservative amino acid substitutions,
i.e. substitution of an amino acid by an amino acid having similar
chemical properties. The term "derivative" includes
post-translational modifications, e.g. glycosylation patterns that
differ from the wild-type.
[0052] A "variant" of a peptide is meant to refer to a molecule
substantially similar to either the entire peptide, or a fragment
thereof having essentially the same function. A variant of a first
peptide may be a second peptide which has 1 to 5, preferably 1 to
4, more preferably 1 to 3, more preferably 1 or 2 amino acid
substitutions, additions and/or deletions with respect to said
first peptide. For example, variants of SEQ ID NO: 2 may have 1 to
5 amino acid substitutions with respect to SEQ ID NO: 2, as long as
the activity of inhibiting the complex formation between CD44,
c-Met and Inl-B leading to the phosphorylation and internalization
of c-Met, as well as to phosphorylation of Erk, is substantially
the same as that of the peptide consisting of the amino acid
sequence as shown in SEQ ID NO: 2.
[0053] A molecule is a "chemical derivative" of a first peptide
when it contains additional chemical moieties not present in the
first peptide. Such moieties may improve for example the molecule's
solubility, absorption, or biological half-life. The moieties may
alternatively for example decrease the toxicity of the molecule, or
eliminate or attenuate any undesirable side effect of the
molecule.
[0054] Generally, the derivative has at least 75%, preferably at
least 100% of the activity of inhibiting the complex formation
between CD44, c-Met and Inl-B leading to the phosphorylation and
internalization of c-Met, as well as to phosphorylation of Erk of
the peptide compound from which it is derived.
[0055] The term "fragment" of a given peptide as used herein is
meant to refer to any peptide subset of said peptide. Generally, a
fragment comprises at least 2 contiguous amino acids of the
sequence of said peptide. Preferably, the fragment comprises at
least 4, more preferably at least 5, more preferably at least 6,
more preferably at least 8, even more preferably at least 10
contiguous amino acids of said peptide.
[0056] Methods for determining the activity of inhibiting the
complex formation between CD44, c-Met and Inl-B leading to the
phosphorylation and internalization of c-Met, as well as to
phosphorylation of Erk are well known in the art. The peptide
compound of the invention has the activity of inhibiting the
complex formation between CD44, c-Met and Inl-B leading to the
phosphorylation and internalization of c-Met, as well as to
phosphorylation of Erk, measured in form of the activation of the
Erk protein through phosphorylation. The inhibitory activity
results in a reduction of downstream Erk activation. Preferably,
downstream Erk activation is reduced by at least 30%, more
preferably by at least 50% and even more preferably by at least 70%
with respect to the downstream Erk activation in the presence of a
control peptide. For example the activity can be determined in cell
culture.
[0057] The term "peptide compound" as used herein denotes a
compound comprising at least one peptide. In one embodiment of the
present application the "peptide compound" consists of a peptide.
The term "peptide compound" includes compounds comprising a peptide
and a chemical moiety which is not an amino acid.
[0058] The term "peptide" as used herein refers to any compound
comprising two or more amino acids joined to each other by peptide
bonds or modified peptide bonds, i.e. peptide isosteres. "Peptide"
refers to both short chains and to longer chains, generally
referred to as polypeptides. Peptides may contain amino acids other
than the 20 gene-encoded amino acids. Peptides include amino acid
sequences modified either by natural processes, such as
post-translational processing, or by chemical modification
techniques which are well known in the art. Modifications can occur
anywhere in a peptide, including the peptide backbone, the amino
acid side-chains and the amino or carboxyl termini. The same type
of modification may be present in the same or varying degrees at
several sites in a given peptide. Also, a given peptide may contain
many types of modifications.
[0059] Peptides may be branched and they may be cyclic, with or
without branching. Cyclic, branched and branched cyclic peptides
may result from post-translation natural processes or may be made
by synthetic methods. Modifications include acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin,
covalent attachment of a heme moiety, covalent attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid
or lipid derivative, covalent attachment of phosphatidylinositol,
cross-linking, cyclization, disulfide bond formation,
demethylation, formation of covalent cross-links, formation of
cystine, formation of pyroglutamate, formylation,
gamma-carboxylation, glycosylation, GPI anchor formation,
hydroxylation, iodination, methylation, myristoylation, oxidation,
proteolytic processing, phosphorylation, prenylation, racemization,
selenoylation, sulfation, transfer-RNA mediated addition of amino
acids to proteins such as arginylation, ubiquitination and
sumoylation.
[0060] The term "peptide compound" may as a preferred embodiment
include salts, preferably pharmaceutically acceptable salts of the
peptides described herein. Salts encompassed within the term
"pharmaceutically acceptable salts" refer to non-toxic salts of the
peptide compounds of this invention. Representative salts and
esters include the following: acetate, ascorbate, benzenesulfonate,
benzoate, bicarbonate, bisulfate, bitartrate, borate, caamsylate,
carbonate, citrate, dihydrochloride, methanesulfonate,
ethanesulfonate, p-toluenesulfonate, cyclohexylsulfamate, quinate,
edetate, edisylate, estolate, esylate, fumarate, gluconate,
glutamate, glycerophophates, hydrobromide, hydrochloride,
hydroxynaphthoate, lactate, lactobionate, laurate, malate, maleate,
mandelate, mesylate, mucate, napsylate, nitrate, n-methylglucamine,
oleate, oxalate, palmoates, pamoate (embonate), palmitate,
pantothenate, perchlorates, phosphate/diphosphate,
polygalacturonate, salicylates, stearate, succinates, sulfate,
sulfamate, subacetate, succinate, tannate, tartrate, tosylate,
trifluoroacetate, and valerate. Other salts include Ca, Li, Mg, Na,
and K salts; salts of amino acids such as lysine or arginine;
guanidine, diethanolamine or choline; ammonium, substituted
ammonium salts or aluminum salts. The salts are prepared by
conventional methods.
[0061] The peptide of the invention has a length of at least 2
amino acids. Preferably, the length of the peptide is at least 4,
more preferably at least 5, more preferably at least 6, more
preferably at least 8, most preferably at least 10 amino acids. The
maximum length is not particularly limited. It is preferred,
however, that the peptide has a length of from about 6 to about 30
amino acids, preferably of from about 8 to about 25 amino acids,
more preferably of from about 10 to about 20 amino acids, most
preferably of from about 10 to about 15 amino acids. Larger
peptides may be employed, for example when fusion peptides with
heterologous amino acid sequences are prepared.
[0062] It is preferred that the peptide of the present invention is
an isolated peptide.
[0063] It is also preferred that the peptide of the present
invention is in a pure state. Preferably, the peptide is 80% pure,
preferably 90% pure, more preferably 95% pure, even more preferably
99% pure and particularly preferred is a pharmaceutically pure
state that is greater than 99.9% pure with respect to contaminating
macromolecules, particularly other peptides. It is preferred that
the peptide is free of infectious and pyrogenic agents.
[0064] Preferably, a purified peptide is substantially free of
other peptides. When used in this context, the term "pure" does not
exclude the presence of the same peptide in alternative physical
forms, such as dimers.
[0065] The peptides of the present invention may be prepared by
chemical synthesis or by recombinant expression in host cells. The
preparation by chemical synthesis is preferred. As protein
products, compounds of SEQ ID NO: 2 or 1 or other peptides of the
present invention are amenable to production by the technique of
solution- or solid-phase peptide synthesis. The synthetic peptide
synthesis approach generally entails the use of automated
synthesizers and appropriate resins as solid phase, to which is
attached the C-terminal amino acid of the desired peptide.
Extension of the peptide in the N-terminal direction is then
achieved by successively coupling a suitably protected form of the
next desired amino acid, using either FMOC- or BOC-based chemical
protocols typically, until synthesis is complete. Protecting groups
are then cleaved from the peptide, usually simultaneously with
cleavage of peptide from the resin, and the peptide is then
isolated and purified using conventional techniques, such as by
reversed phase HPLC using acetonitrile as solvent and
tri-fluoroacetic acid as ion-pairing agent. Such procedures are
generally described in numerous publications.
[0066] The peptide compound of the present invention may be a
chemically derived structure, diverted from the peptide sequences
described herein, or a pharmaceutically acceptable salt and/or
physiologically functional derivative thereof. The chemically
derived structure can be a cyclopeptide or a pharmaceutically
acceptable salt and/or physiologically functional derivative
thereof. The invention further includes the use of a substance
metabolized to a peptide compound of the invention.
[0067] The individual according to the present invention may be any
individual which is susceptible to a bacterial infection. In a
preferred embodiment the individual is a vertebrate, more
preferably a mammal, like for example a mouse, a rat, a human, a
rabbit, a pig a cattle, or a horse, and most preferably a rat or a
human.
[0068] In a preferred embodiment of the present invention, the
bacterial infection is an infection with an intracellular
bacterium. Preferably, the intracellular bacterium is selected from
the group consisting of Listeria spp., Mycobacterium spp.,
Plasmodium spp., and Shigella spp. An especially preferred
intracellular bacterium is Listeria monocytogenes.
[0069] In a preferred embodiment of the present invention, the
intracellular bacterium is a bacterium, wherein the cellular uptake
of the bacterium is mediated by InlB-induced activation of
c-Met.
[0070] In a preferred embodiment of the present invention, the
intracellular bacterium is a bacterium, wherein the cellular uptake
of the bacterium involves the formation of a complex between CD44,
c-Met and InlB, leading to the phosphorylation and internalization
of c-Met, as well as to phosphorylation of Erk.
[0071] In yet another preferred embodiment of the present
invention, the bacterial infection is listeriosis.
[0072] The medicament of the present invention can be formulated as
e.g., liquids, suspensions, emulsions, lozenges, cachets, ampoules,
suppositories, pessaries, ointments, gels, pastes, sprays, lotions,
oils, boluses, electuaries, aerosols, powders, granules, tablets,
pills, capsules, injections, solutions, foams, creams, enemas and
the like, comprising at least one compound of the present invention
alone or in admixture with pharmaceutically acceptable carriers,
excipients and/or diluents.
[0073] Specific dose levels of the medicament of the present
invention for any particular patient will be employed depending
upon a variety of factors including the age, body weight, general
health, sex, diet, and prior medication, and the severity of the
particular disease of the patient, and the activity of specific
compounds employed, time of administration, route of
administration, rate of excretion, the duration of the treatment,
other drugs, compounds, and/or materials used in combination. The
appropriate dosage of medicament can vary from patient to patient.
Determining the optimal dosage will generally involve balancing of
the level of therapeutic benefit against any risk or deleterious
side effects of the treatment.
[0074] Administration in vivo can be effected in one dose,
continuously or intermittently throughout the course of treatment.
Methods of determining the most effective means and dosages of
administration are well known to those of skill in the art, and
will vary with the formulation used for therapy, the purpose of the
therapy, the target cell being treated, and the subject being
treated. Single or multiple administrations can be carried out with
the dose level and pattern being selected by the treating
physician.
[0075] In general, a suitable systemic dose of the active compound
of the medicament of the present invention is in the range of about
0.01 to about 1000 mg per kilogram body weight preferably 0.1 to
500 mg per kilogram body weight and even more preferably 1.0 to 500
mg per kilogram body weight of the subject per day. Where the
active ingredient is a salt, an ester, prodrug, or the like, the
amount administered is calculated on the basis of the parent
compound and so the actual weight to be used is increased
proportionately. In case the compound is applied locally, the
amount of compound may vary from the above given estimation.
However, such an application would aim at reaching local
concentrations of the drug ranging from about 0.1 ng/ml to 10
mg/ml, more preferred from 1 ng/ml to 1 mg/ml.
[0076] The figures show:
[0077] FIG. 1: InlB requires CD44v6 for c-Met activation
[0078] HeLa cells were induced with InlB (A) at a concentration of
1 nM for 5 min at 37.degree. C. Pretreatment with a control peptide
or a CD44v6 14-mer peptide having SEQ ID NO: 2 at a concentration
of 100 ng/ml for 30 min was performed when indicated.
Phosphorylation of c-Met and of Erk were measured as described in
experimental procedures. The same experiments were performed with
the HT29 cells (B). (C) HeLa cells were transfected with two
different siRNA (v6-1 and v6-2, described in experimental
procedures) to downregulate CD44v6 and with a control siRNA. 48 h
after transfection, cells were starved for additional 24 h.
InlB-induced c-Met and Erk phosphorylation were measured. The
expression of CD44v6 was detected by Western Blot analysis. The
numbers reflect -fold induction as determined by densitometric
scanning (Image J program).
[0079] FIG. 2: A CD44v6 isoform is sufficient for InlB-induced
c-Met activation
[0080] AS cells or ASs6 cells were induced with InlB as indicated
(A) and ASs6 cells in addition with a CD44v6 14-mer peptide having
SEQ ID NO: 1 or an unrelated (control) peptide (B). Erk
phosphorylation (A,B) or c-Met phosphorylation (B) was determined.
In (C), HeLa cells were induced either with HGF or InlB for 5 min
at 37.degree. C. CD44v6 was immunoprecipitated from the lysates and
a Western Blot was performed using CD44v6 and c-Met antibodies as
indicated. For control, an IgG antibody was used. The numbers
reflect -fold induction as determined by densitometric scanning
(Image J program).
[0081] FIG. 3: InlB-induced scattering is blocked by a CD44v6
peptide
[0082] Scattering of HT29 cells was determined after treatment with
InlB alone or together with a control peptide or a CD44v6 peptide
or antibody as indicated. The magnification used was .times.20.
[0083] FIG. 4: Uptake of InlB-coated latex beads is dependent on
CD44v6
[0084] Control beads or beads coated with InlB (see experimental
procedures) were incubated with HeLa cells. Cells were pretreated
with a CD44v6 peptide having SEQ ID NO: 2 or a control peptide for
one hour as indicated. Extracellular beads bind to a Cy3-labelled
antibody and are stained red in immunofluorescence microscopy. In
phase contrast microscopy both extracellular and intracellular
beads are detected. The number of internalized beads (black) was
counted in approximately a thousand cells and shown as
intracellular beads/100 cells in the graph. The results are
expressed as means.+-.standard deviation of three independent
experiments.
[0085] FIG. 5: Ezrin-dependent uptake of InlB-coated beads.
[0086] InlB-dependent c-Met and Erk phosphorylation was measured in
HeLa cells transiently transfected with a control vector or a
vector coding for a truncated version of ezrin deprived of the
actin binding domain (ez?ABD or DN Ezrin). In these cells also the
uptake of latex beads was determined as described in FIG. 4. The
counts of internalized beads obtained for three independent
experiments are given in Table 1.
[0087] The present invention will now be further illustrated in the
following examples without being limited thereto.
EXAMPLES
Experimental Procedures
[0088] Cells. The human colon adenocarcinoma cell lines HT29 and
the human cervix carcinoma cell line HeLa (American tissue culture
collection, ATCC; Wesel, Germany. Accession no: CCL-2) were grown
in Dulbecco's modified Eagle's medium (DMEM; Invitrogen, Karlsruhe,
Germany) supplemented with 10% fetal calf serum (FCS; PAA Colbe,
Germany). The rat pancreatic carcinoma cell line BSp73AS and its
transfectant BSp73ASs6 were grown in RMPI (Invitrogen, Karlsruhe,
Germany) plus 10% FCS.
[0089] Antibodies and other reagents. The human monoclonal antibody
against CD44v6 (Biwa) was obtained from Bender (Vienna, Austria).
The pan-CD44 antibody IM7 was from Pharmingen, the antibody against
Erk 1 (K-23) from Santa Cruz (Calif., USA). The Phospho-Erk
antibody (Phospho-p44/42 Map Kinase) was purchased from Cell
Signalling Technology (Beverly, England). Secondary antibodies
labeled with HRP were purchased from Dako (Hamburg, Germany). Mouse
IgG was obtained from Santa Cruz (CA, U.S.A). The hybridoma cell
supernatant of anti-InlB monoclonal antibody was a kind gift from
J. Wehland, Braunschweig, Germany. HGF was a generous gift of
George Vande Woude (Van Andel Institute, USA). InlB was prepared as
is known in the art. The CD44 v6 peptide (14-mer: KEQWFGNRWHEGYR,
SEQ ID NO:2) and the control peptide were synthesized by NMI
Technology Transfer (Reutlingen, Germany). An ezrin construct where
the last 29 amino acids encoding the actin-binding domain have been
deleted has been kindly provided by Monique Arpin (CNRS, Paris,
France). The Cy-3 labeled secondary antibody was bought from
Dianova (Hamburg, Germany).
[0090] Detection of c-Met and Erk phosphorylation. In all
experiments cells were induced with 1 nM of InlB where indicated.
Induction was performed for 5 min at 37.degree. C. Blocking
experiments were performed by incubating the CD44v6 14-mer peptide
having for example SEQ ID NO: 2 or SEQ ID NO: 1 (100 ng/ml) or the
control peptide (100 ng/ml) for 30 min at 37.degree. C. prior to
induction with InlB. Cells were lysed with sample buffer+DTT and
subjected to SDS-PAGE. The corresponding blots were treated with
the respective antibodies according to the manufacturer
instructions.
[0091] Co-immunoprecipitation. HT29 cells were induced with InlB (1
nM) or with HGF (0.15 nM) for 5 min at 37.degree. C. Cells were
lysed using a buffer containing 25 mM Hepes pH 7.5; 100 mM NaCl; 10
mM MgCl.sub.2; 1 mM EDTA; 10% Glycerol; 1% NP40. Lysates were
cleared by centrifugation at 15000 rpm for 30 min. Cleared lysates
were incubated with an anti-CD44v6 antibody (IM7) over night
followed by an incubation with a mixture of Protein A and Protein G
agarose beads (Pierce, Rockford, USA) for 2 h. The beads were
washed 3 times with the lysis buffer and solubilized in sample
buffer+DTT. The samples were loaded on an SDSPAGE gel and blotted
with the anti-phospho-Met antibody.
[0092] Scattering assay. HT29 cells were seeded at a concentration
of 3.times.10.sup.5 cells/well in a 6-well plate. They were then
incubated with InlB (1 nM) for 48 h at 37.degree. C. For the
blocking experiments, CD44 anti-v6 antibodies (Biwa; 100 .mu.g/ml)
or a CD44v6 peptide (100 ng/ml) were added before addition of InlB.
Pictures were taken using a phase contrast microscope 48 h after
induction.
[0093] siRNA inhibition. Cells were transfected with CD44v6
specific siRNAs (eurofins MWG GmbH, Ebersberg, Germany):
TABLE-US-00001 v6-1: siRNA 25nt (SEQ ID NO: 5) 5'- AGU AGU ACA ACG
GAA GAA ATT -3' v6-2: siRNA 25nt (SEQ ID NO: 6) 5'- GGA UAU CGC CAA
ACA CCC ATT -3'
[0094] or control siRNA (AATTCTCCGAACGTGTCACGT, SEQ ID NO: 7)
(Quiagen, Hilden, Germany, Cat. No. 1022076) using lipofectamine
2000 (Invitrogen, Karlsruhe, Germany) according to the
manufacturer's protocol. 48 h post-transfection the cells were
starved for 24 h and then treated with InlB as described above.
[0095] Latex bead invasion assay. Coating of the beads with InlB
was performed as is known in the art. Briefly, 25 .mu.l of latex
beads (4.times.10.sup.8 beads/ml, Dynabeads M-450, Dynal,
Invitrogen, Karlsruhe, Germany) were coated with goat anti-mouse
IgG and then incubated with 0.5 ml of hybridoma cell supernatant of
monoclonal anti-InlB antibody for 2 h at 4.degree. C. After washing
with PBS, the beads were incubated with InlB (3 .mu.M) latex beads
coated with both the goat anti-mouse IgG and the anti-InlB mAb were
used as control beads. For the invasion assay, 2.times.10.sup.4
cells were seeded in chamber slides (LabTek Chamber slides, Nunc,
Langenselbold, Germany). Cells were incubated for 2 h with the
InlB-coated beads or control beads in 0.2 ml of complete DMEM at
37.degree. C. The cells were washed with 0.5 ml of medium and
incubated in medium for 1 h at 37.degree. C. After this incubation
time, the cells were washed three times with 1 ml of CB buffer (10
mM Pipes, 150 mM NaCl, 5 mM EGTA, 5 mM glucose, 5 mM MgCl2, 100
.mu.g/ml streptomycin), fixed with 4% paraformaldehyde in CB buffer
for 30 min and washed with PBS. The non-permeabilized cells were
incubated with 0.2 ml of BSA (1% in CB buffer and incubated with a
Cy3-labeled goat anti-mouse antibody (1:200 dilution) to detect the
extracellular beads. Intracellular and extracellular beads were
detected by phase contrast microscopy. An overlay of fluorescence
scans and bright field scans show the internalized beads in black
and the extracellular beads in red. Cells were mounted in PVA and
viewed using microscope (Axioskop 200M (fluo), Zeiss, Jena,
Germany). Intracellular beads were counted in approximately 1000
cells. Each experiment was repeated at least three times and
results were analyzed statistically.
Example 1
InlB Requires CD44v6 for c-Met Activation
[0096] CD44v6 is necessary for HGF-induced c-Met activation. This
was demonstrated by means of CD44v6 specific antibodies, CD44v6
peptides and CD44v6-specific siRNA that all blocked the activation
of c-Met. These tools were used to investigate whether CD44v6 also
plays a role in InlB-induced activation of c-Met and signaling. In
HT29 and in HeLa cells, where a contribution of CD44v6 to
HGF-induced c-Met activation was already observed a human CD44v6
14-mer peptide having SEQ ID NO: 2 completely abrogated
InlB-induced activation of c-Met (FIGS. 1A, B). Also downstream
signaling monitored by Erk activation was inhibited. A control
peptide had no effect. By means of siRNA against CD44v6, the
requirement of CD44v6 was further confirmed. Two different siRNAs
down-regulated CD44v6 expression in HeLa cells and thereby
inhibited InlB-induced c-Met and Erk activation (FIG. 1C).
[0097] Thus, a CD44v6-specific peptide and siRNA against CD44v6 are
able to block InlB-induced activation of c-Met and subsequent
signaling. The HT29 and HeLa cells used in these experiments
express CD44 variant isoforms containing exon v6 together with
other variant exons. In order to confirm the dependency of c-Met
activation on CD44v6 and to test whether an isoform containing
exclusively exon v6 was sufficient for the activation of c-Met, rat
pancreatic carcinoma cells (BSp73AS, abbreviated AS, FIG. 2) or
these cells transfected with such a CD44v6 isoform (BSp73ASs6,
abbreviated ASs6) were used. These cells express this CD44v6
isoform as the only variant isoform in addition to CD44s. In the AS
cells, no activation of c-Met was observed after addition of InlB,
whereas activation was detected in cells expressing CD44v6 (FIG.
2A). Therefore, this experiment not only confirmed that a CD44v6
isoform is needed for InlB-induced activation but it also
demonstrated that exon v6 inclusion alone was sufficient. As
expected, InlB-induced c-Met and Erk phosphorylation were abrogated
in these ASs6 cells upon treatment with the CD44v6 peptide having
SEQ ID NO:1 (FIG. 2B).
Example 2
CD44v6, c-Met and InlB Form a Complex
[0098] The results so far suggest that CD44v6, c-Met and InlB are
in close vicinity and form a complex. To identify such a complex
CD44v6 was immunoprecipitated and the presence of c-Met in the
complex checked. Indeed, upon induction with InlB, endogenous c-Met
and CD44v6 were co-immunoprecipitated (FIG. 2C), whereas no complex
was observed in the absence of InlB. In the control IgG
immunoprecipitation, no association between c-Met and CD44v6 is to
be observed.
Example 3
CD44v6 Mediates InlB-Induced Scattering and Entry of InlB-Coated
Beads
[0099] InlB similarly to HGF can induce complex biological
responses such as scattering upon activation of c-Met. It was
tested whether scattering was also dependent on CD44v6. As
expected, both a anti-CD44v6 antibody and a CD44v6-specific peptide
having SEQ ID NO: 2 blocked this response (FIG. 3). InlB-activated
c-Met is internalized leading to the entry of the bacteria into the
host cells. This process can be simulated using InlB-coated latex
beads that are also internalized into mammalian cells. The latex
beads invasion assay was used to test the effect of a CD44v6
peptide on InlB-induced cellular entry. The beads were first coated
with an anti-mouse antibody followed by a monoclonal antibody (mAb)
against InlB and then loaded with InlB. HeLa cells were incubated
with control beads (only coated with the anti-mouse antibody
together with the anti-InlB mAb) or InlB-coated beads. In order to
distinguish between beads that have entered the cells and beads
that remained outside, a Cy3-labelled antibody directed against the
anti-InlB mAb was used. As the cells were not permeabilized, this
labeled antibody could only bind to beads that remained outside.
The binding of this antibody can be detected by immunofluorescence
microscopy. In phase contrast microscopy, however, all beads can be
seen. An overlay between the two pictures allows distinguishing
between beads in and outside the cells. The red beads are the ones
outside the cells whereas the black beads correspond to the
internalized ones. Control beads without InlB are all excluded from
the cells whereas InlB-coated beads can enter. A drastic decrease
of the entry was observed when HeLa cells were preincubated with
the CD44v6 peptide. The entry was blocked to nearly 100%. The
control peptide had no effect on the uptake. Intracellular beads
were counted in approximately one thousand cells (FIG. 4). These
data demonstrate that CD44v6 is instrumental for the entry of
InlB-coated beads into the cells suggesting that also the entry of
the bacteria itself might depend on CD44v6.
Example 4
ERM Proteins are Essential for Entry of InlB-Coated Beads in
Cells
[0100] The recruitment of ERM proteins together with the
cytoskeleton to CD44v6 is a decisive step in c-Met dependent signal
transduction. In order to investigate if ERM proteins and the
cytoskeleton are also necessary for internalization of InlB-coated
beads, an ezrin protein that lacks the actin binding (eZ?ABD)
ability was used. This protein acts in a dominant negative fashion
on signal transduction. In the case of HGF it competes with
endogenous ezrin and has a dramatic effect on Erk phosphorylation
whereas c-Met activation itself is not affected. The same is true
for InlB-induced c-Met and Erk activation (FIG. 5). Transfection of
HeLa cells with this dominant negative ezrin construct completely
abrogated the entry of InlB-coated beads whereas transfection with
a control vector had no effect. The number of internalized beads
for approximately one thousand cells was counted and the results of
three independent experiments are shown in Table 1. In conclusion,
the link of ezrin to the cytoskeleton is instrumental for entry of
InlB-coated beads.
TABLE-US-00002 TABLE 1 Ezrin is required for entry of InIB-coated
beads into cells Experiment 1 Experiment 2 Experiment 3 HeLa cells
+DN +DN +DN +vector Ezrin +vector Ezrin +vector Ezrin InIB beads 56
4 81 1 83 1 per 100 cells
[0101] It has been shown that InlB activation of c-Met is dependent
on CD44v6. Indeed, InlB-induced c-Met activation as well as
downstream Erk phosphorylation can be blocked by means of a CD44v6
peptide and upon downregulation of CD44v6 by siRNA. In addition,
induction of c-Met via InlB in a cell line that lacks CD44v6 is
possible only after transfection of CD44v6. InlB induces a complex
between c-Met and CD44v6 as shown by co-immunoprecipitation. In
addition, scattering and in particular, entry of InlB-coated beads
that mimic the entry of L. monocytogenes into cells is dependent on
CD44v6. This event is also regulated by ezrin binding to the
cytoskeleton. Taken together these data demonstrate a role of
CD44v6 in InlB-mediated L. monocytogenes invasion of eukaryotic
cells.
[0102] HGF and InlB share no structural similarities and bind to
different sites on c-Met. However, the same CD44v6 peptide blocks
activation of c-Met induced by both ligands. A likely explanation
would be that the CD44v6 peptide inhibits the interaction between
CD44v6 and c-Met and thereby its activation. This however seems not
to be the case. The CD44v6 peptide rather addresses CD44v6 itself
changing its conformation. This observation could also explain how
the same CD44v6 peptide blocks the activation of a completely
different receptor, VEGFR-2.
[0103] InlB recruits heparin to activate c-Met. CD44v6 does not
seem to act itself as an HSPG in the case of InlB induction, as
only the CD44v3-containing isoforms can be heparan-sulphated and
the HT29 cells do not express the v3 and the v6 exons in the same
isoform. Furthermore, it has been shown that an isoform of CD44
containing only the v6 exon was sufficient to support InlB-induced
Erk phosphorylation. This isoform can certainly not be
heparan-sulphated.
[0104] The recruitment of heparin by InlB leads to the clustering
of c-Met, a process required for full activation. The activation of
the c-Met receptor via InlB is the first step necessary for
InlB-mediated L. monocytogenes uptake into host cells. The bacteria
uptake by means of InlB-coated beads was simulated. Their uptake
can be completely inhibited by CD44v6-specific peptides
demonstrating that CD44v6 is instrumental for infection of cells by
L. monocytogenes. Interestingly also Shigella makes use of CD44 for
its entry into mammalian cells. Shigella is responsible for
bacillary dysentery in humans. It secretes several proteins named
IpaA-D that are essential for the infection process. One of them,
IpaB interacts with CD44s. This binding is essential for bacteria
invasion.
[0105] In the case of InlB, signaling depends on the actin
cytoskeleton. Transfection of an ezrin protein lacking the
actin-binding domain leads to a drastic reduction of Erk
phosphorylation but not of c-Met activation. More strikingly, also
the uptake of InlB-coated beads is dependent on ezrin binding to
the cytoskeleton. These data fit perfectly with recent evidence
showing that actin is necessary for clathrin-dependent
internalization since the disruption of actin assembly leads to a
complete block of this process. Interestingly, also Shigella
invasion via CD44 requires ezrin for the entry process.
[0106] Taken together, the data shown here demonstrate that a link
from c-Met to the cytoskeleton via the CD44v6 cytoplasmic domain
and ERM proteins is required for InlB-dependent uptake of beads
into cells showing a similar mechanism mediating L. monocytogenes
invasion of host cells.
Sequence CWU 1
1
7114PRTRattus norvegicus 1Lys Glu Lys Trp Phe Glu Asn Glu Trp Gln
Gly Lys Asn Pro1 5 10214PRTHomo sapiens 2Lys Glu Gln Trp Phe Gly
Asn Arg Trp His Glu Gly Tyr Arg1 5 10342PRTRattus norvegicus 3Trp
Ala Asp Pro Asn Ser Thr Thr Glu Glu Ala Ala Thr Gln Lys Glu1 5 10
15Lys Trp Phe Glu Asn Glu Trp Gln Gly Lys Asn Pro Pro Thr Pro Ser
20 25 30Glu Asp Ser His Val Thr Glu Gly Thr Thr 35 40442PRTHomo
sapiens 4Gln Ala Thr Pro Ser Ser Thr Thr Glu Glu Thr Ala Thr Gln
Lys Glu1 5 10 15Gln Trp Phe Gly Asn Arg Trp His Glu Gly Tyr Arg Gln
Thr Pro Arg 20 25 30Glu Asp Ser His Ser Thr Thr Gly Thr Ala 35
40521DNAartificialsiRNA molecule 5aguaguacaa cggaagaaat t
21621DNAartificialsiRNA molecule 6ggauaucgcc aaacacccat t
21721DNAartificialsiRNA molecule 7aattctccga acgtgtcacg t 21
* * * * *