U.S. patent application number 12/827590 was filed with the patent office on 2010-12-02 for compositions and methods for the diagnosis and treatment of tumor.
Invention is credited to BELINDA CAIRNS, Ruihuan Chen, Gretchen Frantz, Kenneth J. Hillan, Hartmut Koeppen, Heidi S. Phillips, Paul Polakis, Mark Sliwkowski, Victoria Smith, Susan D. Spencer, P. Mickey Williams, Thomas D. Wu, Zemin Zhang.
Application Number | 20100303834 12/827590 |
Document ID | / |
Family ID | 36036964 |
Filed Date | 2010-12-02 |
United States Patent
Application |
20100303834 |
Kind Code |
A1 |
CAIRNS; BELINDA ; et
al. |
December 2, 2010 |
COMPOSITIONS AND METHODS FOR THE DIAGNOSIS AND TREATMENT OF
TUMOR
Abstract
The present invention is directed to compositions of matter
useful for the diagnosis and treatment of tumor in mammals and to
methods of using those compositions of matter for the same.
Inventors: |
CAIRNS; BELINDA;
(Burlingame, CA) ; Chen; Ruihuan; (Palo Alto,
CA) ; Frantz; Gretchen; (San Francisco, CA) ;
Hillan; Kenneth J.; (San Francisco, CA) ; Koeppen;
Hartmut; (Berkeley, CA) ; Phillips; Heidi S.;
(Palo Alto, CA) ; Polakis; Paul; (Burlingame,
CA) ; Spencer; Susan D.; (Tiburon, CA) ;
Smith; Victoria; (Burlingame, CA) ; Williams; P.
Mickey; (Half Moon Bay, CA) ; Wu; Thomas D.;
(San Francisco, CA) ; Zhang; Zemin; (Foster City,
CA) ; Sliwkowski; Mark; (San Carlos, CA) |
Correspondence
Address: |
Arnold & Porter LLP (24126);Attn: SV Docketing Dept.
1400 Page Mill Road
Palo Alto
CA
94304
US
|
Family ID: |
36036964 |
Appl. No.: |
12/827590 |
Filed: |
June 30, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10936626 |
Sep 8, 2004 |
7803915 |
|
|
12827590 |
|
|
|
|
10872991 |
Jun 21, 2004 |
|
|
|
10936626 |
|
|
|
|
10872972 |
Jun 21, 2004 |
|
|
|
10872991 |
|
|
|
|
10241220 |
Sep 11, 2002 |
|
|
|
10872991 |
|
|
|
|
10241220 |
Sep 11, 2002 |
|
|
|
10872972 |
|
|
|
|
10177488 |
Jun 19, 2002 |
|
|
|
10872991 |
|
|
|
|
10177488 |
Jun 19, 2002 |
|
|
|
10872972 |
|
|
|
|
60299500 |
Jun 20, 2001 |
|
|
|
60301880 |
Jun 29, 2001 |
|
|
|
60323268 |
Sep 18, 2001 |
|
|
|
Current U.S.
Class: |
424/174.1 ;
435/375; 435/7.2; 435/7.23 |
Current CPC
Class: |
C07K 16/30 20130101;
C07K 2317/77 20130101; G01N 33/57484 20130101; A61K 2039/505
20130101; C07K 16/1072 20130101; C07K 2317/73 20130101; C07K
2317/76 20130101; A61K 51/1006 20130101; A61K 51/1018 20130101;
A61K 47/6817 20170801; C07K 16/18 20130101; A61P 35/00 20180101;
C07K 16/303 20130101; A61P 43/00 20180101; A61K 47/6859 20170801;
A61K 47/6809 20170801; A61K 47/6839 20170801; A61K 47/60 20170801;
A61K 47/6851 20170801; A61K 47/6803 20170801 |
Class at
Publication: |
424/174.1 ;
435/375; 435/7.2; 435/7.23 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61P 35/00 20060101 A61P035/00; C12N 5/09 20100101
C12N005/09; G01N 33/53 20060101 G01N033/53 |
Claims
1. A method of inhibiting growth of a cell expressing TAT188, the
method comprising contacting the cell with an antibody comprising
in a corresponding complementary determining region (CDR) an amino
acid sequence having the amino acid sequence of all six of the CDRs
in the specific order as found in the antibody secreted by a
hybridoma selected from the group consisting of 3B5.1 (ATCC
Accession Number PTA-6193), 12B9.1 (ATCC Accession Number
PTA-6194), and 12G12.1 (ATCC Accession Number PTA-6195).
2. The method of claim 1, wherein the cell is a cancer cell.
3. The method of claim 2, wherein the cancer cell is selected from
the group consisting of breast, colon, rectum, endometrium, kidney,
lung, ovary, skin, and liver.
4. The method of claim 3, wherein the cancer cell is a mammalian
cell.
5. The method of claim 4, wherein the mammalian cell is a human
cell.
6. A method of detecting the level of TAT188 polypeptide expressed
in a test cell relative to a control cell, the method comprising:
(a) contacting the test cell and the control cell with an isolated
anti-TAT188 antibody comprising in a corresponding complementary
determining region (CDR) an amino acid sequence having the amino
acid sequence of all six of the CDRs in the specific order as found
in the antibody secreted by a hybridoma selected from the group
consisting of 3B5.1 (ATCC Accession Number PTA-6193), 12B9.1 (ATCC
Accession Number PTA-6194), and 12G12.1 (ATCC Accession Number
PTA-6195); (b) detecting binding of the antibody; and (c)
determining the relative binding of the antibody to the test and
control cell.
7. The method of claim 6, wherein the test cell and control cell
are lysed.
8. The method of claim 6, wherein the test cell is in a tissue.
9. The method of claim 8, wherein the tissue is a tumor tissue.
10. The method of claim 9, wherein the tumor tissue is selected
from the group consisting of breast, colon, rectum, endometrium,
kidney, lung, ovary, skin, and liver.
11. A method of detecting the level of TAT188 polypeptide or a
polypeptide having at least 80% sequence identity to the amino acid
sequence of SEQ ID NO: 15 in a test cell relative to a control
cell, the method comprising: (a) contacting the test cell and the
control cell with an isolated antibody comprising in a
corresponding complementary determining region (CDR) an amino acid
sequence having the amino acid sequence of all six of the CDRs in
the specific order as found in the antibody secreted by a hybridoma
selected from the group consisting of 3B5.1 (ATCC Accession Number
PTA-6193), 12B9.1 (ATCC Accession Number PTA-6194), and 12G12.1
(ATCC Accession Number PTA-6195); (b) detecting binding of the
antibody; and (c) determining the relative binding of the antibody
to the test and control cell.
12. The method of claim 11, wherein the level of TAT188 polypeptide
in the test cell is greater than that in the control cell.
13. The method of claim 12, wherein the method diagnoses cancer in
a tissue containing or having contained the test cell.
14. The method of claim 11, wherein the detecting the level of
expression of the polypeptide comprises employing an antibody in an
immunohistochemistry analysis.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of, and claims priority
under 35 U.S.C. .sctn.120 to, U.S. application Ser. No. 10/936,626,
filed Sep. 8, 2004, which is a continuation-in-part of, and claims
priority under 35 U.S.C. .sctn.120 to, both U.S. application Ser.
Nos. 10/872,991 and 10/872,972 both filed Jun. 21, 2004, and where
both U.S. application Ser. Nos. 10/872,991 and 10/872,972 are
continuations of, and claim priority under 35 U.S.C. .sctn.120 to,
U.S. application Ser. No. 10/241,220 filed Sep. 11, 2002, and which
is a continuation-in-part of, and claims priority under 35 U.S.C.
.sctn.120 to, U.S. application Ser. No. 10/177,488 filed Jun. 19,
2002, now abandoned, which claims priority under 35 U.S.C.
.sctn.119 to U.S. Provisional Application Ser. Nos. 60/299,500
filed Jun. 20, 2001, 60/301,880 filed Jun. 29, 2001, 60/323,268
filed Sep. 18, 2001, 60/557,116 filed Mar. 26, 2004 and 60/598,899
filed Aug. 4, 2004, the disclosures of all of which applications
are herein incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention is directed to compositions of matter
useful for the diagnosis and treatment of tumor in mammals and to
methods of using those compositions of matter for the same.
BACKGROUND OF THE INVENTION
[0003] Malignant tumors (cancers) are the second leading cause of
death in the United States, after heart disease (Boring et al., CA
Cancel J. Clin. 43:7 (1993)). Cancer is characterized by the
increase in the number of abnormal, or neoplastic, cells derived
from a normal tissue which proliferate to form a tumor mass, the
invasion of adjacent tissues by these neoplastic tumor cells, and
the generation of malignant cells which eventually spread via the
blood or lymphatic system to regional lymph nodes and to distant
sites via a process called metastasis. In a cancerous state, a cell
proliferates under conditions in which normal cells would not grow.
Cancer manifests itself in a wide variety of forms, characterized
by different degrees of invasiveness and aggressiveness.
[0004] In attempts to discover effective cellular targets for
cancer diagnosis and therapy, researchers have sought to identify
transmembrane or otherwise membrane-associated polypeptides that
are specifically expressed on the surface of one or more particular
type(s) of cancer cell as compared to on one or more normal
non-cancerous cell(s). Often, such membrane-associated polypeptides
are more abundantly expressed on the surface of the cancer cells as
compared to on the surface of the non-cancerous cells. The
identification of such tumor-associated cell surface antigen
polypeptides has given rise to the ability to specifically target
cancer cells for destruction via antibody-based therapies. In this
regard, it is noted that antibody-based therapy has proved very
effective in the treatment of certain cancers. For example,
HERCEPTIN.RTM. and RITUXAN.RTM. (both from Genentech Inc., South
San Francisco, Calif.) are antibodies that have been used
successfully to treat breast cancer and non-Hodgkin's lymphoma,
respectively. More specifically, HERCEPTIN.RTM. is a recombinant
DNA-derived humanized monoclonal antibody that selectively binds to
the extracellular domain of the human epidermal growth factor
receptor 2 (HER2) proto-oncogene. HER2 protein overexpression is
observed in 25-30% of primary breast cancers. RITUXAN.RTM. is a
genetically engineered chimeric murine/human monoclonal antibody
directed against the CD20 antigen found on the surface of normal
and malignant B lymphocytes. Both these antibodies are
recombinantly produced in CHO cells.
[0005] In other attempts to discover effective cellular targets for
cancer diagnosis and therapy, researchers have sought to identify
(1) non-membrane-associated polypeptides that are specifically
produced by one or more particular type(s) of cancer cell(s) as
compared to by one or more particular type(s) of non-cancerous
normal cell(s), (2) polypeptides that are produced by cancer cells
at an expression level that is significantly higher than that of
one or more normal non-cancerous cell(s), or (3) polypeptides whose
expression is specifically limited to only a single (or very
limited number of different) tissue type(s) in both the cancerous
and non-cancerous state (e.g., normal prostate and prostate tumor
tissue). Such polypeptides may remain intracellularly located or
may be secreted by the cancer cell. Moreover, such polypeptides may
be expressed not by the cancer cell itself, but rather by cells
which produce and/or secrete polypeptides having a potentiating or
growth-enhancing effect on cancer cells. Such secreted polypeptides
are often proteins that provide cancer cells with a growth
advantage over normal cells and include such things as, for
example, angiogenic factors, cellular adhesion factors, growth
factors, and the like. Identification of antagonists of such
non-membrane associated polypeptides would be expected to serve as
effective therapeutic agents for the treatment of such cancers.
Furthermore, identification of the expression pattern of such
polypeptides would be useful for the diagnosis and treatment of
particular cancers in mammals.
[0006] The ability to modulate gene expression in a mammal is still
difficult. Traditionally, it has been done using tools such viral
vectors that will express a polypeptide that the host is lacking.
The ability to introduce a viral vector into a host that will
reduce gene expression has not been perfected. Repression of gene
expression has traditionally been done in mammals in a "knockout"
fashion, where the test mammal, usually a mouse, has the gene
ablated or "knocked out" through the technique of homolgous
recombination. This technique in mice is slow, laborious and
difficult, and impractical in humans. Therefore, Applicants turned
to a vector system which will express an interfering RNA (si RNA)
to reduce gene expression.
[0007] siRNAs have proven useful as a tool in studies of modulating
gene expression where traditional antagonists such as small
molecules or antibodies have failed. (Shi Y., Trends in Genetics
19(1):9-12 (2003)). In vitro synthesized, double stranded RNAs that
are 21 to 23 nucleotides in length can act as interfering RNAs
(iRNAs) and can specifically inhibit gene expression (Zamore et
al., Cell 1010(1):25-33 (2000)). These iRNAs act by mediating
degradation of their target RNAs. Since they are under 30
nucleotides in length, however they do not trigger a cell antiviral
defense mechanism. Such mechanisms include interferon production,
and a general shutdown of host cell protein synthesis. Practically,
siRNAs can by synthesized and then cloned into DNA vectors. Such
vectors can be transfected and made to express the siRNA at high
levels and/or in a tissue specific manner. The high level of siRNA
expression is used to "knockdown" or significantly reduce the
amount of protein produced in a cell, and thus it is useful in
experiments where overexpression of a protein is believed to be
linked to a disorders such as cancer. Despite advances in mammalian
cancer therapy, there is a great need for therapeutic agents
capable of effectively inhibiting neoplastic cell growth through
reduction of gene expression. Accordingly, it is an objective of
the present invention to identify a system that will modulate gene
expression.
[0008] Improving the delivery of drugs and other agents to target
cells, tissues and tumors to achieve maximal efficacy and minimal
toxicity has been the focus of considerable research for many
years. Though many attempts have been made to develop effective
methods for importing biologically active molecules into cells,
both in vivo and in vitro, none has proved to be entirely
satisfactory. Optimizing the association of the drug with its
intracellular target, while minimizing intercellular redistribution
of the drug, e.g. to neighboring cells, is often difficult or
inefficient.
[0009] Most agents currently administered to a patient parenterally
are not targeted, resulting in systemic delivery of the agent to
cells and tissues of the body where it is unnecessary, and often
undesirable. This may result in adverse drug side effects, and
often limits the dose of a drug (e.g., chemotherapeutic
(anti-cancer), cytotoxic, enzyme inhibitor agents and antiviral or
antimicrobial drugs) that can be administered. By comparison,
although oral administration of drugs is considered to be a
convenient and economical mode of administration, it shares the
same concerns of non-specific toxicity to unaffected cells once the
drug has been absorbed into the systemic circulation. Further
complications involve problems with oral bioavailability and
residence of drug in the gut leading to additional exposure of gut
to the drug and hence risk of gut toxicities. Accordingly, a major
goal has been to develop methods for specifically targeting agents
to cells and tissues. The benefits of such treatment include
avoiding the general physiological effects of inappropriate
delivery of such agents to other cells and tissues, such as
uninfected cells. Intracellular targeting may be achieved by
methods, compounds and formulations which allow accumulation or
retention of biologically active agents, i.e. active metabolites,
inside cells.
[0010] Monoclonal antibody therapy has been established for the
targeted treatment of patients with cancer, immunological and
angiogenic disorders.
[0011] There are a variety of useful toxins available. For example,
the auristatin peptides, auristain E (AE) and monomethylauristatin
(MMAE), synthetic analogs of dolastatin, were conjugated to: (i)
chimeric monoclonal antibodies cBR96 (specific to Lewis Y on
carcinomas); (ii) cAC10 which is specific to CD30 on hematological
malignancies (Klussman, et al (2004), Bioconjugate Chemistry
15(4):765-773; Doronina et al (2003) Nature Biotechnology
21(7):778-784; "Monomethylvaline Compounds Capable of Conjugation
to Ligands"; Francisco et al (2003) Blood 102(4):1458-1465; US
2004/0018194; (iii) anti-CD20 antibodies such as rituxan (WO
04/032828) for the treatment of CD20-expressing cancers and immune
disorders; (iv) anti-EphB2 antibodies 2H9 and anti-IL-8 for
treatment of colorectal cancer (Mao, et al (2004) Cancer Research
64(3):781-788); (v) E-selectin antibody (Bhaskar et al (2003)
Cancer Res. 63:6387-6394); and (vi) other anti-CD30 antibodies (WO
03/043583). Monomethylauristatin (MMAE) has also been conjugated to
2H9, an antibody against EphB2R which is a type 1 TM tyrosine
kinase receptor with close homology between mouse and human, and is
over-expressed in colorectal cancer cells (Mao et al (2004) Cancer
Res. 64:781-788).
[0012] Monomethylauristatin MMAF, a variant of auristatin E (MMAE)
with a phenylalanine at the C-terminus (U.S. Pat. No. 5,767,237;
U.S. Pat. No. 6,124,431), has been reported to be less potent than
MMAE, but more potent when conjugated to monoclonal antibodies
(Senter et al, Proceedings for the American Association for Cancer
Research, Volume 45, Abstract Number 623, presented Mar. 28, 2004).
Auristatin F phenylene diamine (AFP); a phenylalanine variant of
MMAE was linked to an anti-CD70 mAb, 1F6, through the C-terminus of
1F6 via a phenylene diamine spacer (Law et al, Proceedings of the
American Association for Cancer Research, Volume 45, Abstract
Number 625, presented Mar. 28, 2004)
[0013] Despite the above identified advances in mammalian cancer
therapy, there is a great need for additional diagnostic and
therapeutic agents capable of detecting the presence of tumor in a
mammal and for effectively inhibiting neoplastic cell growth,
respectively. Accordingly, it is an objective of the present
invention to identify: (1) cell membrane-associated polypeptides
that are more abundantly expressed on one or more type(s) of cancer
cell(s) as compared to on normal cells or on other different cancer
cells, (2) non-membrane-associated polypeptides that are
specifically produced by one or more particular type(s) of cancer
cell(s) (or by other cells that produce polypeptides having a
potentiating effect on the growth of cancer cells) as compared to
by one or more particular type(s) of non-cancerous normal cell(s),
(3) non-membrane-associated polypeptides that are produced by
cancer cells at an expression level that is significantly higher
than that of one or more normal non-cancerous cell(s), or (4)
polypeptides whose expression is specifically limited to only a
single (or very limited number of different) tissue type(s) in both
a cancerous and non-cancerous state (e.g., normal prostate and
prostate tumor tissue), and to use those polypeptides, and their
encoding nucleic acids, to produce compositions of matter useful in
the therapeutic treatment and diagnostic detection of cancer in
mammals. It is also an objective of the present invention to
identify cell membrane-associated, secreted or intracellular
polypeptides whose expression is limited to a single or very
limited number of tissues, and to use those polypeptides, and their
encoding nucleic acids, to produce compositions of matter useful in
the therapeutic treatment and diagnostic detection of cancer in
mammals.
SUMMARY OF THE INVENTION
A. Embodiments
[0014] In the present specification, Applicants describe for the
first time the identification of various cellular polypeptides (and
their encoding nucleic acids or fragments thereof) which are
expressed to a greater degree on the surface of or by one or more
types of cancer cell(s) as compared to on the surface of or by one
or more types of normal non-cancer cells. Alternatively, such
polypeptides are expressed by cells which produce and/or secrete
polypeptides having a potentiating or growth-enhancing effect on
cancer cells. Again alternatively, such polypeptides may not be
overexpressed by tumor cells as compared to normal cells of the
same tissue type, but rather may be specifically expressed by both
tumor cells and normal cells of only a single or very limited
number of tissue types (preferably tissues which are not essential
for life, e.g., prostate, etc.). All of the above polypeptides are
herein referred to as Tumor-associated Antigenic Target
polypeptides ("TAT" polypeptides) and are expected to serve as
effective targets for cancer therapy and diagnosis in mammals.
[0015] Accordingly, in one embodiment of the present invention, the
invention provides an isolated nucleic acid molecule having a
nucleotide sequence that encodes a tumor-associated antigenic
target polypeptide or fragment thereof (a "TAT" polypeptide).
[0016] In certain aspects, the isolated nucleic acid molecule
comprises a nucleotide sequence having at least about 80% nucleic
acid sequence identity, alternatively at least about 81%, 82%, 83%,
84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99% or 100% nucleic acid sequence identity, to (a) a DNA
molecule encoding a full-length TAT polypeptide having an amino
acid sequence as disclosed herein, a TAT polypeptide amino acid
sequence lacking the signal peptide as disclosed herein, an
extracellular domain of a transmembrane TAT polypeptide, with or
without the signal peptide, as disclosed herein or any other
specifically defined fragment of a full-length TAT polypeptide
amino acid sequence as disclosed herein, or (b) the complement of
the DNA molecule of (a).
[0017] In other aspects, the isolated nucleic acid molecule
comprises a nucleotide sequence having at least about 80% nucleic
acid sequence identity, alternatively at least about 81%, 82%, 83%,
84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99% or 100% nucleic acid sequence identity, to (a) a DNA
molecule comprising the coding sequence of a full-length TAT
polypeptide cDNA as disclosed herein, the coding sequence of a TAT
polypeptide lacking the signal peptide as disclosed herein, the
coding sequence of an extracellular domain of a transmembrane TAT
polypeptide, with or without the signal peptide, as disclosed
herein or the coding sequence of any other specifically defined
fragment of the full-length TAT polypeptide amino acid sequence as
disclosed herein, or (b) the complement of the DNA molecule of
(a).
[0018] In further aspects, the invention concerns an isolated
nucleic acid molecule comprising a nucleotide sequence having at
least about 80% nucleic acid sequence identity, alternatively at
least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid
sequence identity, to (a) a DNA molecule that encodes the same
mature polypeptide encoded by the full-length coding region of any
of the human protein cDNAs deposited with the ATCC as disclosed
herein, or (b) the complement of the DNA molecule of (a).
[0019] Another aspect of the invention provides an isolated nucleic
acid molecule comprising a nucleotide sequence encoding a TAT
polypeptide which is either transmembrane domain-deleted or
transmembrane domain-inactivated, or is complementary to such
encoding nucleotide sequence, wherein the transmembrane domain(s)
of such polypeptide(s) are disclosed herein. Therefore, soluble
extracellular domains of the herein described TAT polypeptides are
contemplated.
[0020] In other aspects, the present invention is directed to
isolated nucleic acid molecules which hybridize to (a) a nucleotide
sequence encoding a TAT polypeptide having a full-length amino acid
sequence as disclosed herein, a TAT polypeptide amino acid sequence
lacking the signal peptide as disclosed herein, an extracellular
domain of a transmembrane TAT polypeptide, with or without the
signal peptide, as disclosed herein or any other specifically
defined fragment of a full-length TAT polypeptide amino acid
sequence as disclosed herein, or (b) the complement of the
nucleotide sequence of (a). In this regard, an embodiment of the
present invention is directed to fragments of a full-length TAT
polypeptide coding sequence, or the complement thereof, as
disclosed herein, that may find use as, for example, hybridization
probes useful as, for example, diagnostic probes, antisense
oligonucleotide probes, or for encoding fragments of a full-length
TAT polypeptide that may optionally encode a polypeptide comprising
a binding site for an anti-TAT polypeptide antibody, a TAT binding
oligopeptide or other small organic molecule that binds to a TAT
polypeptide. Such nucleic acid fragments are usually at least about
5 nucleotides in length, alternatively at least about 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95,
100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160,
165, 170, 175, 180, 185, 190, 195, 200, 210, 220, 230, 240, 250,
260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380,
390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510,
520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640,
650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770,
780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900,
910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 nucleotides in
length, wherein in this context the term "about" means the
referenced nucleotide sequence length plus or minus 10% of that
referenced length. It is noted that novel fragments of a TAT
polypeptide-encoding nucleotide sequence may be determined in a
routine manner by aligning the TAT polypeptide-encoding nucleotide
sequence with other known nucleotide sequences using any of a
number of well known sequence alignment programs and determining
which TAT polypeptide-encoding nucleotide sequence fragment(s) are
novel. All of such novel fragments of TAT polypeptide-encoding
nucleotide sequences are contemplated herein. Also contemplated are
the TAT polypeptide fragments encoded by these nucleotide molecule
fragments, preferably those TAT polypeptide fragments that comprise
a binding site for an anti-TAT antibody, a TAT binding oligopeptide
or other small organic molecule that binds to a TAT
polypeptide.
[0021] In another embodiment, the invention provides isolated TAT
polypeptides encoded by any of the isolated nucleic acid sequences
hereinabove identified.
[0022] In a certain aspect, the invention concerns an isolated TAT
polypeptide, comprising an amino acid sequence having at least
about 80% amino acid sequence identity, alternatively at least
about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence
identity, to a TAT polypeptide having a full-length amino acid
sequence as disclosed herein, a TAT polypeptide amino acid sequence
lacking the signal peptide as disclosed herein, an extracellular
domain of a transmembrane TAT polypeptide protein, with or without
the signal peptide, as disclosed herein, an amino acid sequence
encoded by any of the nucleic acid sequences disclosed herein or
any other specifically defined fragment of a full-length TAT
polypeptide amino acid sequence as disclosed herein.
[0023] In a further aspect, the invention concerns an isolated TAT
polypeptide comprising an amino acid sequence having at least about
80% amino acid sequence identity, alternatively at least about 81%,
82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, or 99% amino acid sequence identity, to an
amino acid sequence encoded by any of the human protein cDNAs
deposited with the ATCC as disclosed herein.
[0024] In a specific aspect, the invention provides an isolated TAT
polypeptide without the N-terminal signal sequence and/or without
the initiating methionine and is encoded by a nucleotide sequence
that encodes such an amino acid sequence as hereinbefore described.
Processes for producing the same are also herein described, wherein
those processes comprise culturing a host cell comprising a vector
which comprises the appropriate encoding nucleic acid molecule
under conditions suitable for expression of the TAT polypeptide and
recovering the TAT polypeptide from the cell culture.
[0025] Another aspect of the invention provides an isolated TAT
polypeptide which is either transmembrane domain-deleted or
transmembrane domain-inactivated. Processes for producing the same
are also herein described, wherein those processes comprise
culturing a host cell comprising a vector which comprises the
appropriate encoding nucleic acid molecule under conditions
suitable for expression of the TAT polypeptide and recovering the
TAT polypeptide from the cell culture.
[0026] In other embodiments of the present invention, the invention
provides vectors comprising DNA encoding any of the herein
described polypeptides. Host cells comprising any such vector are
also provided. By way of example, the host cells may be CHO cells,
E. coli cells, or yeast cells. A process for producing any of the
herein described polypeptides is further provided and comprises
culturing host cells under conditions suitable for expression of
the desired polypeptide and recovering the desired polypeptide from
the cell culture.
[0027] In other embodiments, the invention provides isolated
chimeric polypeptides comprising any of the herein described TAT
polypeptides fused to a heterologous (non-TAT) polypeptide. Example
of such chimeric molecules comprise any of the herein described TAT
polypeptides fused to a heterologous polypeptide such as, for
example, an epitope tag sequence or a Fc region of an
immunoglobulin.
[0028] In another embodiment, the invention provides an antibody
which binds, preferably specifically, to any of the above or below
described polypeptides. Optionally, the antibody is a monoclonal
antibody, antibody fragment, chimeric antibody, humanized antibody,
single-chain antibody or antibody that competitively inhibits the
binding of an anti-TAT polypeptide antibody to its respective
antigenic epitope. Antibodies of the present invention may
optionally be conjugated to a growth inhibitory agent or cytotoxic
agent such as a toxin, including, for example, a maytansinoid or
calicheamicin, an antibiotic, a radioactive isotope, a nucleolytic
enzyme, or the like. The antibodies of the present invention may
optionally be produced in CHO cells or bacterial cells and
preferably induce death of a cell to which they bind. For
diagnostic purposes, the antibodies of the present invention may be
detectably labeled, attached to a solid support, or the like.
[0029] In another embodiment of the present invention comprising
antibody conjugated to a cytotoxin, the toxin may be selected from
any of the toxins known in the art. In one embodiment, the toxin is
linked to the antibody by a peptide or petidomimetic linker In one
embodiment, the toxin is linked to the antibody via a linker
comprising valine-citrulline (-vc-). In one embodiment the toxin is
MMAE. In one embodiment the toxin is MMAE. In one embodiment, the
toxin is an auristatin peptide.
[0030] In other embodiments of the present invention, the invention
provides vectors comprising DNA encoding any of the herein
described antibodies. Host cell comprising any such vector are also
provided. By way of example, the host cells may be CHO cells, E.
coli cells, or yeast cells. A process for producing any of the
herein described antibodies is further provided and comprises
culturing host cells under conditions suitable for expression of
the desired antibody and recovering the desired antibody from the
cell culture.
[0031] In another embodiment, the invention provides oligopeptides
("TAT binding oligopeptides") which bind, preferably specifically,
to any of the above or below described TAT polypeptides.
Optionally, the TAT binding oligopeptides of the present invention
may be conjugated to a growth inhibitory agent or cytotoxic agent
such as a toxin, including, for example, a maytansinoid or
calicheamicin, an antibiotic, a radioactive isotope, a nucleolytic
enzyme, or the like. The TAT binding oligopeptides of the present
invention may optionally be produced in CHO cells or bacterial
cells and preferably induce death of a cell to which they bind. For
diagnostic purposes, the TAT binding oligopeptides of the present
invention may be detectably labeled, attached to a solid support,
or the like.
[0032] In other embodiments of the present invention, the invention
provides vectors comprising DNA encoding any of the herein
described TAT binding oligopeptides. Host cell comprising any such
vector are also provided. By way of example, the host cells may be
CHO cells, E. coli cells, or yeast cells. A process for producing
any of the herein described TAT binding oligopeptides is further
provided and comprises culturing host cells under conditions
suitable for expression of the desired oligopeptide and recovering
the desired oligopeptide from the cell culture.
[0033] In another embodiment, the invention provides small organic
molecules ("TAT binding organic molecules") which bind, preferably
specifically, to any of the above or below described TAT
polypeptides. Optionally, the TAT binding organic molecules of the
present invention may be conjugated to a growth inhibitory agent or
cytotoxic agent such as a toxin, including, for example, a
maytansinoid or calicheamicin, an antibiotic, a radioactive
isotope, a nucleolytic enzyme, or the like. The TAT binding organic
molecules of the present invention preferably induce death of a
cell to which they bind. For diagnostic purposes, the TAT binding
organic molecules of the present invention may be detectably
labeled, attached to a solid support, or the like.
[0034] In a still further embodiment, the invention concerns a
composition of matter comprising a TAT polypeptide as described
herein, a chimeric TAT polypeptide as described herein, an anti-TAT
antibody as described herein, a TAT binding oligopeptide as
described herein, or a TAT binding organic molecule as described
herein, in combination with a carrier. Optionally, the carrier is a
pharmaceutically acceptable carrier.
[0035] In a still further embodiment, the invention concerns a
composition of matter comprising a TAT polypeptide as described
herein, a chimeric TAT polypeptide as described herein, an anti-TAT
antibody as described herein, a TAT binding oligopeptide as
described herein, a TAT binding interfereing RNA (siRNA) or a TAT
binding organic molecule as described herein, in combination with a
carrier. Optionally, the carrier is a pharmaceutically acceptable
carrier. Specifically the TAT polypeptide is TAT188, also referred
to herein as E16 or as TAT188(E16). The anti-TAT188 (also referred
to as anti-E16 or anti-TAT188(E16)) antibodies of one embodiment of
the invention include without limitation 3B5, 12B9, and 12G12, as
described herein. The siRNA of the embodiment includes siTAT188
(also referred to as siE16 or siTAT188(E16 or TAT188 siRNA or E16
siRNA or TAT188(E16) siRNA)) as described herein.
[0036] In yet another embodiment, the invention concerns an article
of manufacture comprising a container and a composition of matter
contained within the container, wherein the composition of matter
may comprise a TAT polypeptide as described herein, a chimeric TAT
polypeptide as described herein, an anti-TAT antibody as described
herein, a TAT binding oligopeptide as described herein, or a TAT
binding organic molecule as described herein. The article may
further optionally comprise a label affixed to the container, or a
package insert included with the container, that refers to the use
of the composition of matter for the therapeutic treatment or
diagnostic detection of a tumor.
[0037] Another embodiment of the present invention is directed to
the use of a TAT polypeptide as described herein, a chimeric TAT
polypeptide as described herein, an anti-TAT polypeptide antibody
as described herein, a TAT binding oligopeptide as described
herein, or a TAT binding organic molecule as described herein, for
the preparation of a medicament useful in the treatment of a
condition which is responsive to the TAT polypeptide, chimeric TAT
polypeptide, anti-TAT polypeptide antibody, TAT binding
oligopeptide, or TAT binding organic molecule.
B. Additional Embodiments
[0038] Another embodiment of the present invention is directed to a
method for inhibiting the growth of a cell that expresses a TAT
polypeptide, wherein the method comprises contacting the cell with
an antibody, an oligopeptide or a small organic molecule that binds
to the TAT polypeptide, and wherein the binding of the antibody,
oligopeptide or organic molecule to the TAT polypeptide causes
inhibition of the growth of the cell expressing the TAT
polypeptide. In preferred embodiments, the cell is a cancer cell
and binding of the antibody, oligopeptide or organic molecule to
the TAT polypeptide causes death of the cell expressing the TAT
polypeptide. Optionally, the antibody is a monoclonal antibody,
antibody fragment, chimeric antibody, humanized antibody, or
single-chain antibody. Antibodies, TAT binding oligopeptides and
TAT binding organic molecules employed in the methods of the
present invention may optionally be conjugated to a growth
inhibitory agent or cytotoxic agent such as a toxin, including, for
example, a maytansinoid or calicheamicin, an antibiotic, a
radioactive isotope, a nucleolytic enzyme, or the like. The
antibodies and TAT binding oligopeptides employed in the methods of
the present invention may optionally be produced in CHO cells or
bacterial cells.
[0039] Yet another embodiment of the present invention is directed
to a method of therapeutically treating a mammal having a cancerous
tumor comprising cells that express a TAT polypeptide, wherein the
method comprises administering to the mammal a therapeutically
effective amount of an antibody, an oligopeptide or a small organic
molecule that binds to the TAT polypeptide, thereby resulting in
the effective therapeutic treatment of the tumor. Optionally, the
antibody is a monoclonal antibody, antibody fragment, chimeric
antibody, humanized antibody, or single-chain antibody. Antibodies,
TAT binding oligopeptides and TAT binding organic molecules
employed in the methods of the present invention may optionally be
conjugated to a growth inhibitory agent or cytotoxic agent such as
a toxin, including, for example, a maytansinoid or calicheamicin,
an antibiotic, a radioactive isotope, a nucleolytic enzyme, or the
like. The antibodies and oligopeptides employed in the methods of
the present invention may optionally be produced in CHO cells or
bacterial cells.
[0040] Yet another embodiment of the present invention is directed
to a method of determining the presence of a TAT polypeptide in a
sample suspected of containing the TAT polypeptide, wherein the
method comprises exposing the sample to an antibody, oligopeptide
or small organic molecule that binds to the TAT polypeptide and
determining binding of the antibody, oligopeptide or organic
molecule to the TAT polypeptide in the sample, wherein the presence
of such binding is indicative of the presence of the TAT
polypeptide in the sample. Optionally, the sample may contain cells
(which may be cancer cells) suspected of expressing the TAT
polypeptide. The antibody, TAT binding oligopeptide or TAT binding
organic molecule employed in the method may optionally be
detectably labeled, attached to a solid support, or the like.
[0041] A further embodiment of the present invention is directed to
a method of diagnosing the presence of a tumor in a mammal, wherein
the method comprises detecting the level of expression of a gene
encoding a TAT polypeptide (a) in a test sample of tissue cells
obtained from said mammal, and (b) in a control sample of known
normal non-cancerous cells of the same tissue origin or type,
wherein a higher level of expression of the TAT polypeptide in the
test sample, as compared to the control sample, is indicative of
the presence of tumor in the mammal from which the test sample was
obtained.
[0042] Another embodiment of the present invention is directed to a
method of diagnosing the presence of a tumor in a mammal, wherein
the method comprises (a) contacting a test sample comprising tissue
cells obtained from the mammal with an antibody, oligopeptide or
small organic molecule that binds to a TAT polypeptide and (b)
detecting the formation of a complex between the antibody,
oligopeptide or small organic molecule and the TAT polypeptide in
the test sample, wherein the formation of a complex is indicative
of the presence of a tumor in the mammal. Optionally, the antibody,
TAT binding oligopeptide or TAT binding organic molecule employed
is detectably labeled, attached to a solid support, or the like,
and/or the test sample of tissue cells is obtained from an
individual suspected of having a cancerous tumor.
[0043] Yet another embodiment of the present invention is directed
to a method for treating or preventing a cell proliferative
disorder associated with altered, preferably increased, expression
or activity of a TAT polypeptide, the method comprising
administering to a subject in need of such treatment an effective
amount of an antagonist of a TAT polypeptide. Preferably, the cell
proliferative disorder is cancer and the antagonist of the TAT
polypeptide is an anti-TAT polypeptide antibody, TAT binding
oligopeptide, TAT binding organic molecule or antisense
oligonucleotide. Effective treatment or prevention of the cell
proliferative disorder may be a result of direct killing or growth
inhibition of cells that express a TAT polypeptide or by
antagonizing the cell growth potentiating activity of a TAT
polypeptide.
[0044] Yet another embodiment of the present invention is directed
to a method of binding an antibody, oligopeptide or small organic
molecule to a cell that expresses a TAT polypeptide, wherein the
method comprises contacting a cell that expresses a TAT polypeptide
with said antibody, oligopeptide or small organic molecule under
conditions which are suitable for binding of the antibody,
oligopeptide or small organic molecule to said TAT polypeptide and
allowing binding therebetween.
[0045] Other embodiments of the present invention are directed to
the use of (a) a TAT polypeptide, (b) a nucleic acid encoding a TAT
polypeptide or a vector or host cell comprising that nucleic acid,
(c) an anti-TAT polypeptide antibody, (d) a TAT-binding
oligopeptide, or (e) a TAT-binding small organic molecule in the
preparation of a medicament useful for (i) the therapeutic
treatment or diagnostic detection of a cancer or tumor, or (ii) the
therapeutic treatment or prevention of a cell proliferative
disorder.
[0046] Another embodiment of the present invention is directed to a
method for inhibiting the growth of a cancer cell, wherein the
growth of said cancer cell is at least in part dependent upon the
growth potentiating effect(s) of a TAT polypeptide (wherein the TAT
polypeptide may be expressed either by the cancer cell itself or a
cell that produces polypeptide(s) that have a growth potentiating
effect on cancer cells), wherein the method comprises contacting
the TAT polypeptide with an antibody, an oligopeptide or a small
organic molecule that binds to the TAT polypeptide, thereby
antagonizing the growth-potentiating activity of the TAT
polypeptide and, in turn, inhibiting the growth of the cancer cell.
Preferably the growth of the cancer cell is completely inhibited.
Even more preferably, binding of the antibody, oligopeptide or
small organic molecule to the TAT polypeptide induces the death of
the cancer cell. Optionally, the antibody is a monoclonal antibody,
antibody fragment, chimeric antibody, humanized antibody, or
single-chain antibody. Antibodies, TAT binding oligopeptides and
TAT binding organic molecules employed in the methods of the
present invention may optionally be conjugated to a growth
inhibitory agent or cytotoxic agent such as a toxin, including, for
example, a maytansinoid or calicheamicin, an antibiotic, a
radioactive isotope, a nucleolytic enzyme, or the like. The
antibodies and TAT binding oligopeptides employed in the methods of
the present invention may optionally be produced in CHO cells or
bacterial cells.
[0047] Yet another embodiment of the present invention is directed
to a method of therapeutically treating a tumor in a mammal,
wherein the growth of said tumor is at least in part dependent upon
the growth potentiating effect(s) of a TAT polypeptide, wherein the
method comprises administering to the mammal a therapeutically
effective amount of an antibody, an oligopeptide or a small organic
molecule that binds to the TAT polypeptide, thereby antagonizing
the growth potentiating activity of said TAT polypeptide and
resulting in the effective therapeutic treatment of the tumor.
Optionally, the antibody is a monoclonal antibody, antibody
fragment, chimeric antibody, humanized antibody, or single-chain
antibody. Antibodies, TAT binding oligopeptides and TAT binding
organic molecules employed in the methods of the present invention
may optionally be conjugated to a growth inhibitory agent or
cytotoxic agent such as a toxin, including, for example, a
maytansinoid or calicheamicin, an antibiotic, a radioactive
isotope, a nucleolytic enzyme, or the like. The antibodies and
oligopeptides employed in the methods of the present invention may
optionally be produced in CHO cells or bacterial cells.
C. Further Additional Embodiments
[0048] In yet further embodiments, the invention is directed to the
following set of potential embodiments for this application:
[0049] 1. Isolated nucleic acid having a nucleotide sequence that
has at least 80% nucleic acid sequence identity to:
[0050] (a) a DNA molecule encoding the amino acid sequence shown in
any one of FIGS. 79 to 154 (SEQ ID NOS:79-154);
[0051] (b) a DNA molecule encoding the amino acid sequence shown in
any one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its
associated signal peptide;
[0052] (c) a DNA molecule encoding an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide;
[0053] (d) a DNA molecule encoding an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide;
[0054] (e) the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78);
[0055] (f) the full-length coding region of the nucleotide sequence
shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0056] (g) the complement of (a), (b), (c), (d), (e) or (f).
[0057] 2. Isolated nucleic acid having:
[0058] (a) a nucleotide sequence that encodes the amino acid
sequence shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154);
[0059] (b) a nucleotide sequence that encodes the amino acid
sequence shown in any one of FIGS. 79 to 154 (SEQ ID NOS:79-154),
lacking its associated signal peptide;
[0060] (c) a nucleotide sequence that encodes an extracellular
domain of the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), with its associated signal peptide;
[0061] (d) a nucleotide sequence that encodes an extracellular
domain of the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0062] (e) the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78);
[0063] (f) the full-length coding region of the nucleotide sequence
shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0064] (g) the complement of (a), (b), (c), (d), (e) or (f).
[0065] 3. Isolated nucleic acid that hybridizes to:
[0066] (a) a nucleic acid that encodes the amino acid sequence
shown in any one of FIGS. 79 to 154 (SEQ ID NOS:79-154);
[0067] (b) a nucleic acid that encodes the amino acid sequence
shown in any one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking
its associated signal peptide;
[0068] (c) a nucleic acid that encodes an extracellular domain of
the polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide;
[0069] (d) a nucleic acid that encodes an extracellular domain of
the polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide;
[0070] (e) the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78);
[0071] (f) the full-length coding region of the nucleotide sequence
shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0072] (g) the complement of (a), (b), (c), (d), (e) or (f).
[0073] 4. The nucleic acid of embodiment 3, wherein the
hybridization occurs under stringent conditions.
[0074] 5. The nucleic acid of embodiment 3 which is at least about
5 nucleotides in length.
[0075] 6. An expression vector comprising the nucleic acid of
embodiment 1, 2 or 3.
[0076] 7. The expression vector of embodiment 6, wherein said
nucleic acid is operably linked to control sequences recognized by
a host cell transformed with the vector.
[0077] 8. A host cell comprising the expression vector of
embodiment 7.
[0078] 9. The host cell of embodiment 8 which is a CHO cell, an E.
coli cell or a yeast cell.
[0079] 10. A process for producing a polypeptide comprising
culturing the host cell of embodiment 8 under conditions suitable
for expression of said polypeptide and recovering said polypeptide
from the cell culture.
[0080] 11. An isolated polypeptide having at least 80% amino acid
sequence identity to:
[0081] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0082] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0083] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0084] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0085] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0086] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78).
[0087] 12. An isolated polypeptide having:
[0088] (a) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154);
[0089] (b) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154), lacking its associated signal peptide
sequence;
[0090] (c) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide sequence;
[0091] (d) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide sequence;
[0092] (e) an amino acid sequence encoded by the nucleotide
sequence shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78);
or
[0093] (f) an amino acid sequence encoded by the full-length coding
region of the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78).
[0094] 13. A chimeric polypeptide comprising the polypeptide of
embodiment 11 or 12 fused to a heterologous polypeptide.
[0095] 14. The chimeric polypeptide of embodiment 13, wherein said
heterologous polypeptide is an epitope tag sequence or an Fc region
of an immunoglobulin.
[0096] 15. An isolated antibody that binds to a polypeptide having
at least 80% amino acid sequence identity to:
[0097] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0098] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0099] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0100] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0101] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0102] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78).
[0103] 16. An isolated antibody that binds to a polypeptide
having:
[0104] (a) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154);
[0105] (b) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154), lacking its associated signal peptide
sequence;
[0106] (c) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide sequence;
[0107] (d) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide sequence;
[0108] (e) an amino acid sequence encoded by the nucleotide
sequence shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78);
or
[0109] (f) an amino acid sequence encoded by the full-length coding
region of the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78).
[0110] 17. The antibody of embodiment 15 or 16 which is a
monoclonal antibody.
[0111] 18. The antibody of embodiment 15 or 16 which is an antibody
fragment.
[0112] 19. The antibody of embodiment 15 or 16 which is a chimeric
or a humanized antibody.
[0113] 20. The antibody of embodiment 15 or 16 which is conjugated
to a growth inhibitory agent.
[0114] 21. The antibody of embodiment 15 or 16 which is conjugated
to a cytotoxic agent.
[0115] 22. The antibody of embodiment 21, wherein the cytotoxic
agent is selected from the group consisting of toxins, antibiotics,
radioactive isotopes and nucleolytic enzymes.
[0116] 23. The antibody of embodiment 21, wherein the cytotoxic
agent is a toxin.
[0117] 24. The antibody of embodiment 23, wherein the toxin is
selected from the group consisting of maytansinoid and
calicheamicin.
[0118] 25. The antibody of embodiment 23, wherein the toxin is a
maytansinoid.
[0119] 26. The antibody of embodiment 15 or 16 which is produced in
bacteria.
[0120] 27. The antibody of embodiment 15 or 16 which is produced in
CHO cells.
[0121] 28. The antibody of embodiment 15 or 16 which induces death
of a cell to which it binds.
[0122] 29. The antibody of embodiment 15 or 16 which is detectably
labeled.
[0123] 30. An isolated nucleic acid having a nucleotide sequence
that encodes the antibody of embodiment 15 or 16.
[0124] 31. An expression vector comprising the nucleic acid of
embodiment 30 operably linked to control sequences recognized by a
host cell transformed with the vector.
[0125] 32. A host cell comprising the expression vector of
embodiment 31.
[0126] 33. The host cell of embodiment 32 which is a CHO cell, an
E. coli cell or a yeast cell.
[0127] 34. A process for producing an antibody comprising culturing
the host cell of embodiment 32 under conditions suitable for
expression of said antibody and recovering said antibody from the
cell culture.
[0128] 35. An isolated oligopeptide that binds to a polypeptide
having at least 80% amino acid sequence identity to:
[0129] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0130] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0131] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0132] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0133] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0134] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78).
[0135] 36. An isolated oligopeptide that binds to a polypeptide
having:
[0136] (a) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154);
[0137] (b) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154), lacking its associated signal peptide
sequence;
[0138] (c) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide sequence;
[0139] (d) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide sequence;
[0140] (e) an amino acid sequence encoded by the nucleotide
sequence shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78);
or
[0141] (f) an amino acid sequence encoded by the full-length coding
region of the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78).
[0142] 37. The oligopeptide of embodiment 35 or 36 which is
conjugated to a growth inhibitory agent.
[0143] 38. The oligopeptide of embodiment 35 or 36 which is
conjugated to a cytotoxic agent.
[0144] 39. The oligopeptide of embodiment 38, wherein the cytotoxic
agent is selected from the group consisting of toxins, antibiotics,
radioactive isotopes and nucleolytic enzymes.
[0145] 40. The oligopeptide of embodiment 38, wherein the cytotoxic
agent is a toxin.
[0146] 41. The oligopeptide of embodiment 40, wherein the toxin is
selected from the group consisting of maytansinoid and
calicheamicin.
[0147] 42. The oligopeptide of embodiment 40, wherein the toxin is
a maytansinoid.
[0148] 43. The oligopeptide of embodiment 35 or 36 which induces
death of a cell to which it binds.
[0149] 44. The oligopeptide of embodiment 35 or 36 which is
detectably labeled.
[0150] 45. A TAT binding organic molecule that binds to a
polypeptide having at least 80% amino acid sequence identity
to:
[0151] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0152] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0153] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0154] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0155] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0156] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78).
[0157] 46. The organic molecule of embodiment 45 that binds to a
polypeptide having:
[0158] (a) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154);
[0159] (b) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154), lacking its associated signal peptide
sequence;
[0160] (c) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide sequence;
[0161] (d) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide sequence;
[0162] (e) an amino acid sequence encoded by the nucleotide
sequence shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78);
or
[0163] (f) an amino acid sequence encoded by the full-length coding
region of the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78).
[0164] 47. The organic molecule of embodiment 45 or 46 which is
conjugated to a growth inhibitory agent.
[0165] 48. The organic molecule of embodiment 45 or 46 which is
conjugated to a cytotoxic agent.
[0166] 49. The organic molecule of embodiment 48, wherein the
cytotoxic agent is selected from the group consisting of toxins,
antibiotics, radioactive isotopes and nucleolytic enzymes.
[0167] 50. The organic molecule of embodiment 48, wherein the
cytotoxic agent is a toxin.
[0168] 51. The organic molecule of embodiment 50, wherein the toxin
is selected from the group consisting of maytansinoid and
calicheamicin.
[0169] 52. The organic molecule of embodiment 50, wherein the toxin
is a maytansinoid.
[0170] 53. The organic molecule of embodiment 45 or 46 which
induces death of a cell to which it binds.
[0171] 54. The organic molecule of embodiment 45 or 46 which is
detectably labeled.
[0172] 55. A composition of matter comprising: [0173] (a) the
polypeptide of embodiment 11; [0174] (b) the polypeptide of
embodiment 12; [0175] (c) the chimeric polypeptide of embodiment
13; [0176] (d) the antibody of embodiment 15; [0177] (e) the
antibody of embodiment 16; [0178] (f) the oligopeptide of
embodiment 35; [0179] (g) the oligopeptide of embodiment 36; [0180]
(h) the TAT binding organic molecule of embodiment 45; or [0181]
(i) the TAT binding organic molecule of embodiment 46; in
combination with a carrier.
[0182] 56. The composition of matter of embodiment 55, wherein said
carrier is a pharmaceutically acceptable carrier.
[0183] 57. An article of manufacture comprising:
[0184] (a) a container; and
[0185] (b) the composition of matter of embodiment 55 contained
within said container.
[0186] 58. The article of manufacture of embodiment 57 further
comprising a label affixed to said container, or a package insert
included with said container, referring to the use of said
composition of matter for the therapeutic treatment of or the
diagnostic detection of a cancer.
[0187] 59. A method of inhibiting the growth of a cell that
expresses a protein having at least 80% amino acid sequence
identity to:
[0188] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0189] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0190] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0191] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0192] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0193] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78), said method comprising contacting said cell with
an antibody, oligopeptide or organic molecule that binds to said
protein, the binding of said antibody, oligopeptide or organic
molecule to said protein thereby causing an inhibition of growth of
said cell.
[0194] 60. The method of embodiment 59, wherein said antibody is a
monoclonal antibody.
[0195] 61. The method of embodiment 59, wherein said antibody is an
antibody fragment.
[0196] 62. The method of embodiment 59, wherein said antibody is a
chimeric or a humanized antibody.
[0197] 63. The method of embodiment 59, wherein said antibody,
oligopeptide or organic molecule is conjugated to a growth
inhibitory agent.
[0198] 64. The method of embodiment 59, wherein said antibody,
oligopeptide or organic molecule is conjugated to a cytotoxic
agent.
[0199] 65. The method of embodiment 64, wherein said cytotoxic
agent is selected from the group consisting of toxins, antibiotics,
radioactive isotopes and nucleolytic enzymes.
[0200] 66. The method of embodiment 64, wherein the cytotoxic agent
is a toxin.
[0201] 67. The method of embodiment 66, wherein the toxin is
selected from the group consisting of maytansinoid and
calicheamicin.
[0202] 68. The method of embodiment 66, wherein the toxin is a
maytansinoid.
[0203] 69. The method of embodiment 59, wherein said antibody is
produced in bacteria.
[0204] 70. The method of embodiment 59, wherein said antibody is
produced in CHO cells.
[0205] 71. The method of embodiment 59, wherein said cell is a
cancer cell.
[0206] 72. The method of embodiment 71, wherein said cancer cell is
further exposed to radiation treatment or a chemotherapeutic
agent.
[0207] 73. The method of embodiment 71, wherein said cancer cell is
selected from the group consisting of a breast cancer cell, a
colorectal cancer cell, a lung cancer cell, an ovarian cancer cell,
a central nervous system cancer cell, a liver cancer cell, a
bladder cancer cell, a pancreatic cancer cell, a cervical cancer
cell, a melanoma cell and a leukemia cell.
[0208] 74. The method of embodiment 71, wherein said protein is
more abundantly expressed by said cancer cell as compared to a
normal cell of the same tissue origin.
[0209] 75. The method of embodiment 59 which causes the death of
said cell.
[0210] 76. The method of embodiment 59, wherein said protein
has:
[0211] (a) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154);
[0212] (b) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154), lacking its associated signal peptide
sequence;
[0213] (c) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide sequence;
[0214] (d) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide sequence;
[0215] (e) an amino acid sequence encoded by the nucleotide
sequence shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78);
or
[0216] (f) an amino acid sequence encoded by the full-length coding
region of the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78).
[0217] 77. A method of therapeutically treating a mammal having a
cancerous tumor comprising cells that express a protein having at
least 80% amino acid sequence identity to:
[0218] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0219] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0220] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0221] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0222] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0223] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78), said method comprising administering to said
mammal a therapeutically effective amount of an antibody,
oligopeptide or organic molecule that binds to said protein,
thereby effectively treating said mammal.
[0224] 78. The method of embodiment 77, wherein said antibody is a
monoclonal antibody.
[0225] 79. The method of embodiment 77, wherein said antibody is an
antibody fragment.
[0226] 80. The method of embodiment 77, wherein said antibody is a
chimeric or a humanized antibody.
[0227] 81. The method of embodiment 77, wherein said antibody,
oligopeptide or organic molecule is conjugated to a growth
inhibitory agent.
[0228] 82. The method of embodiment 77, wherein said antibody,
oligopeptide or organic molecule is conjugated to a cytotoxic
agent.
[0229] 83. The method of embodiment 82, wherein said cytotoxic
agent is selected from the group consisting of toxins, antibiotics,
radioactive isotopes and nucleolytic enzymes.
[0230] 84. The method of embodiment 82, wherein the cytotoxic agent
is a toxin.
[0231] 85. The method of embodiment 84, wherein the toxin is
selected from the group consisting of maytansinoid and
calicheamicin.
[0232] 86. The method of embodiment 84, wherein the toxin is a
maytansinoid.
[0233] 87. The method of embodiment 77, wherein said antibody is
produced in bacteria.
[0234] 88. The method of embodiment 77, wherein said antibody is
produced in CHO cells.
[0235] 89. The method of embodiment 77, wherein said tumor is
further exposed to radiation treatment or a chemotherapeutic
agent.
[0236] 90. The method of embodiment 77, wherein said tumor is a
breast tumor, a colorectal tumor, a lung tumor, an ovarian tumor, a
central nervous system tumor, a liver tumor, a bladder tumor, a
pancreatic tumor, or a cervical tumor.
[0237] 91. The method of embodiment 77, wherein said protein is
more abundantly expressed by the cancerous cells of said tumor as
compared to a normal cell of the same tissue origin.
[0238] 92. The method of embodiment 77, wherein said protein
has:
[0239] (a) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154);
[0240] (b) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154), lacking its associated signal peptide
sequence;
[0241] (c) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide sequence;
[0242] (d) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide sequence;
[0243] (e) an amino acid sequence encoded by the nucleotide
sequence shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78);
or
[0244] (f) an amino acid sequence encoded by the full-length coding
region of the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78).
[0245] 93. A method of determining the presence of a protein in a
sample suspected of containing said protein, wherein said protein
has at least 80% amino acid sequence identity to:
[0246] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0247] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0248] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0249] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0250] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0251] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78), said method comprising exposing said sample to
an antibody, oligopeptide or organic molecule that binds to said
protein and determining binding of said antibody, oligopeptide or
organic molecule to said protein in said sample, wherein binding of
the antibody, oligopeptide or organic molecule to said protein is
indicative of the presence of said protein in said sample.
[0252] 94. The method of embodiment 93, wherein said sample
comprises a cell suspected of expressing said protein.
[0253] 95. The method of embodiment 94, wherein said cell is a
cancer cell.
[0254] 96. The method of embodiment 93, wherein said antibody,
oligopeptide or organic molecule is detectably labeled.
[0255] 97. The method of embodiment 93, wherein said protein
has:
[0256] (a) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154);
[0257] (b) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154), lacking its associated signal peptide
sequence;
[0258] (c) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide sequence;
[0259] (d) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide sequence;
[0260] (e) an amino acid sequence encoded by the nucleotide
sequence shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78);
or
[0261] (f) an amino acid sequence encoded by the full-length coding
region of the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78).
[0262] 98. A method of diagnosing the presence of a tumor in a
mammal, said method comprising determining the level of expression
of a gene encoding a protein having at least 80% amino acid
sequence identity to:
[0263] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0264] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0265] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0266] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0267] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0268] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78), in a test sample of tissue cells obtained from
said mammal and in a control sample of known normal cells of the
same tissue origin, wherein a higher level of expression of said
protein in the test sample, as compared to the control sample, is
indicative of the presence of tumor in the mammal from which the
test sample was obtained.
[0269] 99. The method of embodiment 98, wherein the step of
determining the level of expression of a gene encoding said protein
comprises employing an oligonucleotide in an in situ hybridization
or RT-PCR analysis.
[0270] 100. The method of embodiment 98, wherein the step
determining the level of expression of a gene encoding said protein
comprises employing an antibody in an immunohistochemistry or
Western blot analysis.
[0271] 101. The method of embodiment 98, wherein said protein
has:
[0272] (a) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154);
[0273] (b) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154), lacking its associated signal peptide
sequence;
[0274] (c) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide sequence;
[0275] (d) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide sequence;
[0276] (e) an amino acid sequence encoded by the nucleotide
sequence shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78);
or
[0277] (f) an amino acid sequence encoded by the full-length coding
region of the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78).
[0278] 102. A method of diagnosing the presence of a tumor in a
mammal, said method comprising contacting a test sample of tissue
cells obtained from said mammal with an antibody, oligopeptide or
organic molecule that binds to a protein having at least 80% amino
acid sequence identity to:
[0279] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0280] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0281] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0282] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0283] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0284] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78), and detecting the formation of a complex between
said antibody, oligopeptide or organic molecule and said protein in
the test sample, wherein the formation of a complex is indicative
of the presence of a tumor in said mammal.
[0285] 103. The method of embodiment 102, wherein said antibody,
oligopeptide or organic molecule is detectably labeled.
[0286] 104. The method of embodiment 102, wherein said test sample
of tissue cells is obtained from an individual suspected of having
a cancerous tumor.
[0287] 105. The method of embodiment 102, wherein said protein
has:
[0288] (a) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154);
[0289] (b) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154), lacking its associated signal peptide
sequence;
[0290] (c) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide sequence;
[0291] (d) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide sequence;
[0292] (e) an amino acid sequence encoded by the nucleotide
sequence shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78);
or
[0293] (f) an amino acid sequence encoded by the full-length coding
region of the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78).
[0294] 106. A method for treating or preventing a cell
proliferative disorder associated with increased expression or
activity of a protein having at least 80% amino acid sequence
identity to:
[0295] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0296] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0297] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0298] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0299] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0300] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78), said method comprising administering to a
subject in need of such treatment an effective amount of an
antagonist of said protein, thereby effectively treating or
preventing said cell proliferative disorder.
[0301] 107. The method of embodiment 106, wherein said cell
proliferative disorder is cancer.
[0302] 108. The method of embodiment 106, wherein said antagonist
is an anti-TAT polypeptide antibody, TAT binding oligopeptide, TAT
binding organic molecule or antisense oligonucleotide.
[0303] 109. A method of binding an antibody, oligopeptide or
organic molecule to a cell that expresses a protein having at least
80% amino acid sequence identity to:
[0304] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0305] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0306] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0307] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0308] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0309] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78), said method comprising contacting said cell with
an antibody, oligopeptide or organic molecule that binds to said
protein and allowing the binding of the antibody, oligopeptide or
organic molecule to said protein to occur, thereby binding said
antibody, oligopeptide or organic molecule to said cell.
[0310] 110. The method of embodiment 109, wherein said antibody is
a monoclonal antibody.
[0311] 111. The method of embodiment 109, wherein said antibody is
an antibody fragment.
[0312] 112. The method of embodiment 109, wherein said antibody is
a chimeric or a humanized antibody.
[0313] 113. The method of embodiment 109, wherein said antibody,
oligopeptide or organic molecule is conjugated to a growth
inhibitory agent.
[0314] 114. The method of embodiment 109, wherein said antibody,
oligopeptide or organic molecule is conjugated to a cytotoxic
agent.
[0315] 115. The method of embodiment 114, wherein said cytotoxic
agent is selected from the group consisting of toxins, antibiotics,
radioactive isotopes and nucleolytic enzymes.
[0316] 116. The method of embodiment 114, wherein the cytotoxic
agent is a toxin.
[0317] 117. The method of embodiment 116, wherein the toxin is
selected from the group consisting of maytansinoid and
calicheamicin.
[0318] 118. The method of embodiment 116, wherein the toxin is a
maytansinoid.
[0319] 119. The method of embodiment 109, wherein said antibody is
produced in bacteria.
[0320] 120. The method of embodiment 109, wherein said antibody is
produced in CHO cells.
[0321] 121. The method of embodiment 109, wherein said cell is a
cancer cell.
[0322] 122. The method of embodiment 121, wherein said cancer cell
is further exposed to radiation treatment or a chemotherapeutic
agent.
[0323] 123. The method of embodiment 121, wherein said cancer cell
is selected from the group consisting of a breast cancer cell, a
colorectal cancer cell, a lung cancer cell, an ovarian cancer cell,
a central nervous system cancer cell, a liver cancer cell, a
bladder cancer cell, a pancreatic cancer cell, a cervical cancer
cell, a melanoma cell and a leukemia cell.
[0324] 124. The method of 123, wherein said protein is more
abundantly expressed by said cancer cell as compared to a normal
cell of the same tissue origin.
[0325] 125. The method of embodiment 109 which causes the death of
said cell.
[0326] 126. Use of a nucleic acid as disclosed in any of
embodiments 1 to 5 or 30 in the preparation of a medicament for the
therapeutic treatment or diagnostic detection of a cancer.
[0327] 127. Use of a nucleic acid as disclosed in any of
embodiments 1 to 5 or 30 in the preparation of a medicament for
treating a tumor.
[0328] 128. Use of a nucleic acid as disclosed in any of
embodiments 1 to 5 or 30 in the preparation of a medicament for
treatment or prevention of a cell proliferative disorder.
[0329] 129. Use of an expression vector as disclosed in any of
embodiments 6, 7 or 31 in the preparation of a medicament for the
therapeutic treatment or diagnostic detection of a cancer.
[0330] 130. Use of an expression vector as disclosed in any of
embodiments 6, 7 or 31 in the preparation of medicament for
treating a tumor.
[0331] 131. Use of an expression vector as disclosed in any of
embodiments 6, 7 or 31 in the preparation of a medicament for
treatment or prevention of a cell proliferative disorder.
[0332] 132. Use of a host cell as disclosed in any of embodiments
8, 9, 32, or 33 in the preparation of a medicament for the
therapeutic treatment or diagnostic detection of a cancer.
[0333] 133. Use of a host cell as disclosed in any of embodiments
8, 9, 32 or 33 in the preparation of a medicament for treating a
tumor.
[0334] 134. Use of a host cell as disclosed in any of embodiments
8, 9, 32 or 33 in the preparation of a medicament for treatment or
prevention of a cell proliferative disorder.
[0335] 135. Use of a polypeptide as disclosed in any of embodiments
11 to 14 in the preparation of a medicament for the therapeutic
treatment or diagnostic detection of a cancer.
[0336] 136. Use of a polypeptide as disclosed in any of embodiments
11 to 14 in the preparation of a medicament for treating a
tumor.
[0337] 137. Use of a polypeptide as disclosed in any of embodiments
11 to 14 in the preparation of a medicament for treatment or
prevention of a cell proliferative disorder.
[0338] 138. Use of an antibody as disclosed in any of embodiments
15 to 29 in the preparation of a medicament for the therapeutic
treatment or diagnostic detection of a cancer.
[0339] 139. Use of an antibody as disclosed in any of embodiments
15 to 29 in the preparation of a medicament for treating a
tumor.
[0340] 140. Use of an antibody as disclosed in any of embodiments
15 to 29 in the preparation of a medicament for treatment or
prevention of a cell proliferative disorder.
[0341] 141. Use of an oligopeptide as disclosed in any of
embodiments 35 to 44 in the preparation of a medicament for the
therapeutic treatment or diagnostic detection of a cancer.
[0342] 142. Use of an oligopeptide as disclosed in any of
embodiments 35 to 44 in the preparation of a medicament for
treating a tumor.
[0343] 143. Use of an oligopeptide as disclosed in any of
embodiments 35 to 44 in the preparation of a medicament for
treatment or prevention of a cell proliferative disorder.
[0344] 144. Use of a TAT binding organic molecule disclosed in any
of embodiments s 45 to 54 in the preparation of a medicament for
the therapeutic treatment or diagnostic detection of a cancer.
[0345] 145. Use of a TAT binding organic molecule as disclosed in
any of embodiments 45 to 54 in the preparation of a medicament for
treating a tumor.
[0346] 146. Use of a TAT binding organic molecule as disclosed in
any of embodiments 45 to 54 in the preparation of a medicament for
treatment or prevention of a cell proliferative disorder.
[0347] 147. Use of a composition of matter as disclosed in any of
embodiments s 55 or 56 in the preparation of a medicament for the
therapeutic treatment or diagnostic detection of a cancer.
[0348] 148. Use of a composition of matter as c disclosed in any of
embodiments 55 or 56 in the preparation of a medicament for
treating a tumor.
[0349] 149. Use of a composition of matter as disclosed in any of
embodiments 55 or 56 in the preparation of a medicament for
treatment or prevention of a cell proliferative disorder.
[0350] 150. Use of an article of manufacture as disclosed in any of
embodiments 57 or 58 in the preparation of a medicament for the
therapeutic treatment or diagnostic detection of a cancer.
[0351] 151. Use of an article of manufacture as disclosed in any of
embodiments 57 or 58 in the preparation of a medicament for
treating a tumor.
[0352] 152. Use of an article of manufacture as disclosed in any of
embodiments 57 or 58 in the preparation of a medicament for
treatment or prevention of a cell proliferative disorder.
[0353] 153. A method for inhibiting the growth of a cell, wherein
the growth of said cell is at least in part dependent upon a growth
potentiating effect of a protein having at least 80% amino acid
sequence identity to:
[0354] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0355] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0356] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0357] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0358] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0359] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78), said method comprising contacting said protein
with an antibody, oligopeptide or organic molecule that binds to
said protein, there by inhibiting the growth of said cell.
[0360] 154. The method of embodiment 153, wherein said cell is a
cancer cell.
[0361] 155. The method of embodiment 153, wherein said protein is
expressed by said cell.
[0362] 156. The method of embodiment 153, wherein the binding of
said antibody, oligopeptide or organic molecule to said protein
antagonizes a cell growth-potentiating activity of said
protein.
[0363] 157. The method of embodiment 153, wherein the binding of
said antibody, oligopeptide or organic molecule to said protein
induces the death of said cell.
[0364] 158. The method of embodiment 153, wherein said antibody is
a monoclonal antibody.
[0365] 159. The method of embodiment 153, wherein said antibody is
an antibody fragment.
[0366] 160. The method of embodiment 153, wherein said antibody is
a chimeric or a humanized antibody.
[0367] 161. The method of embodiment 153, wherein said antibody,
oligopeptide or organic molecule is conjugated to a growth
inhibitory agent.
[0368] 162. The method of embodiment 153, wherein said antibody,
oligopeptide or organic molecule is conjugated to a cytotoxic
agent.
[0369] 163. The method of embodiment 162, wherein said cytotoxic
agent is selected from the group consisting of toxins, antibiotics,
radioactive isotopes and nucleolytic enzymes.
[0370] 164. The method of embodiment 162, wherein the cytotoxic
agent is a toxin.
[0371] 165. The method of embodiment 164, wherein the toxin is
selected from the group consisting of maytansinoid and
calicheamicin.
[0372] 166. The method of embodiment 164, wherein the toxin is a
maytansinoid.
[0373] 167. The method of embodiment 153, wherein said antibody is
produced in bacteria.
[0374] 168. The method of embodiment 153, wherein said antibody is
produced in CHO cells.
[0375] 169. The method of embodiment 153, wherein said protein
has:
[0376] (a) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154);
[0377] (b) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154), lacking its associated signal peptide
sequence;
[0378] (c) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide sequence;
[0379] (d) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide sequence;
[0380] (e) an amino acid sequence encoded by the nucleotide
sequence shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78);
or
[0381] (f) an amino acid sequence encoded by the full-length coding
region of the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78).
[0382] 170. A method of therapeutically treating a tumor in a
mammal, wherein the growth of said tumor is at least in part
dependent upon a growth potentiating effect of a protein having at
least 80% amino acid sequence identity to:
[0383] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0384] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0385] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0386] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0387] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0388] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78), said method comprising contacting said protein
with an antibody, oligopeptide or organic molecule that binds to
said protein, thereby effectively treating said tumor.
[0389] 171. The method of embodiment 170, wherein said protein is
expressed by cells of said tumor.
[0390] 172. The method of embodiment 170, wherein the binding of
said antibody, oligopeptide or organic molecule to said protein
antagonizes a cell growth-potentiating activity of said
protein.
[0391] 173. The method of embodiment 170, wherein said antibody is
a monoclonal antibody.
[0392] 174. The method of embodiment 170, wherein said antibody is
an antibody fragment.
[0393] 175. The method of embodiment 170, wherein said antibody is
a chimeric or a humanized antibody.
[0394] 176. The method of embodiment 170, wherein said antibody,
oligopeptide or organic molecule is conjugated to a growth
inhibitory agent.
[0395] 177. The method of embodiment 170, wherein said antibody,
oligopeptide or organic molecule is conjugated to a cytotoxic
agent.
[0396] 178. The method of embodiment 177, wherein said cytotoxic
agent is selected from the group consisting of toxins, antibiotics,
radioactive isotopes and nucleolytic enzymes.
[0397] 179. The method of embodiment 177, wherein the cytotoxic
agent is a toxin.
[0398] 180. The method of embodiment 179, wherein the toxin is
selected from the group consisting of maytansinoid and
calicheamicin.
[0399] 181. The method of embodiment 179, wherein the toxin is a
maytansinoid.
[0400] 182. The method of embodiment 170, wherein said antibody is
produced in bacteria.
[0401] 183. The method of embodiment 170, wherein said antibody is
produced in CHO cells.
[0402] 184. The method of embodiment 170, wherein said protein
has:
[0403] (a) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154);
[0404] (b) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154), lacking its associated signal peptide
sequence;
[0405] (c) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide sequence;
[0406] (d) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide sequence;
[0407] (e) an amino acid sequence encoded by the nucleotide
sequence shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78);
or
[0408] (f) an amino acid sequence encoded by the full-length coding
region of the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78).
[0409] 185. An isolated antibody that binds to a polypeptide having
at least 80% amino acid sequence identity to:
[0410] (a) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154);
[0411] (b) the polypeptide shown in any one of FIGS. 79 to 154 (SEQ
ID NOS:79-154), lacking its associated signal peptide;
[0412] (c) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), with its associated
signal peptide;
[0413] (d) an extracellular domain of the polypeptide shown in any
one of FIGS. 79 to 154 (SEQ ID NOS:79-154), lacking its associated
signal peptide;
[0414] (e) a polypeptide encoded by the nucleotide sequence shown
in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78); or
[0415] (f) a polypeptide encoded by the full-length coding region
of the nucleotide sequence shown in any one of FIGS. 1 to 78A-B
(SEQ ID NOS:1-78).
[0416] 186. An isolated antibody that binds to a polypeptide
having:
[0417] (a) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154);
[0418] (b) the amino acid sequence shown in any one of FIGS. 79 to
154 (SEQ ID NOS:79-154), lacking its associated signal peptide
sequence;
[0419] (c) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), with its associated signal peptide sequence;
[0420] (d) an amino acid sequence of an extracellular domain of the
polypeptide shown in any one of FIGS. 79 to 154 (SEQ ID
NOS:79-154), lacking its associated signal peptide sequence;
[0421] (e) an amino acid sequence encoded by the nucleotide
sequence shown in any one of FIGS. 1 to 78A-B (SEQ ID NOS:1-78);
or
[0422] (f) an amino acid sequence encoded by the full-length coding
region of the nucleotide sequence shown in any one of FIGS. 1 to
78A-B (SEQ ID NOS:1-78).
[0423] 187. The antibody of embodiment 185 which is a monoclonal
antibody.
[0424] 188. The antibody of embodiment 185 which is an antibody
fragment.
[0425] 189. The antibody of embodiment 185 which is a chimeric or a
humanized antibody.
[0426] 190. The antibody of embodiment 185 which is conjugated to a
growth inhibitory agent.
[0427] 191. The antibody of embodiment 185 which is conjugated to a
cytotoxic agent.
[0428] 192. The antibody of embodiment 191, wherein the cytotoxic
agent is selected from the group consisting of toxins, antibiotics,
radioactive isotopes and nucleolytic enzymes.
[0429] 193. The antibody of embodiment 191, wherein the cytotoxic
agent is a toxin.
[0430] 194. The antibody of embodiment 193, wherein the toxin is
selected from the group consisting of auristatin, maytansinoid and
calicheamicin.
[0431] 195. The antibody of embodiment 193, wherein the toxin is a
maytansinoid.
[0432] 196. The antibody of embodiment 185 which is produced in
bacteria.
[0433] 197. The antibody of embodiment 185 which is produced in CHO
cells.
[0434] 198. The antibody of embodiment 185 which induces death of a
cell to which it binds.
[0435] 199. The antibody of embodiment 185 which is detectably
labeled.
[0436] 200. The antibody of embodiment 193, wherein the toxin is
selected from the group consisting of MMAE (mono-methyl auristatin
E), MMAF, (auristatin E valeryl benzylhydrazone), and AFP
(Auristatin F phenylene diamine).
[0437] 201. The antibody of embodiment 193, wherein the toxin is
covalently attached to the antibody by a linker.
[0438] 202. The antibody of embodiment 201, wherein the linker is
selected from the group consisting of maleimidocaproyl (MC),
valine-citrulline (val-cit, vc), citrulline (2-amino-5-ureido
pentanoic acid), PAB (.rho.-aminobenzylcarbamoyl), Me
(N-methyl-valine citrulline), MC (PEG).sub.6-OH
(maleimidocaproyl-polyethylene glycol), SPP (N-Succinimidyl
4-(2-pyridylthio) pentanoate), SMCC(N-Succinimidyl
4-(N-maleimidomethyl)cyclohexane-1 carboxylate), and MC-vc-PAB.
[0439] 203. The antibody of embodiment 200, wherein the toxin is
MMAE.
[0440] 204. The antibody of embodiment 200, wherein the toxin is
MMAF.
[0441] 205. The antibody of embodiment 202, wherein the linker is
MC-vc-PAB and the toxin is MMAE or MMAF.
[0442] 206. The antibody of any one of embodiments 185-205, wherein
the antibody binds the TAT188 polypeptide.
[0443] 207. The antibody of embodiment 206, wherein the antibody
inhibits proliferation or promotes cell death of a cell expressing
TAT188.
[0444] 208. The antibody of embodiment 207, wherein the cell is a
cancer cell.
[0445] 209. The antibody of embodiment 208, where the cancer cell
is selected from the group of breast, colon, rectum, endometrium,
kidney, lung, ovary, skin, and liver.
[0446] 210. An isolated antibody that competes with binding to the
epitopes of TAT188 polypeptide bound by an antibody produced by the
hybridoma selected from the group consisting of 3B5.1 (ATCC
Accession No. PTA-6193), 12B9.1 (ATCC Accession No. PTA-6194) and
12G12.1 (ATCC Accession No. PTA-6195).
[0447] 211. An isolated antibody having the biological activity of
an antibody produced by the hybridoma selected from the group
consisting of 3B5.1 (ATCC Accession No. PTA-6193), 12B9.1 (ATCC
Accession No. PTA-6194) and 12G12.1 (ATCC Accession No. PTA-6195),
wherein the biological activity is inhibition of cell proliferation
or promotion of cell death in a cell expressing TAT188.
[0448] 212. An isolated antibody comprising in a corresponding
complementary determining region (CDR) an amino acid sequence
having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99% or 100% of the amino acid sequence of at least 1, 2, 3, 4,
5, or 6 of the CDR(s) of the antibody produced by a hybridoma
selected from the group consisting of 3B5.1 (ATCC Accession No.
PTA-6193), 12B9.1 (ATCC Accession No. PTA-6194) and 12G12.1 (ATCC
Accession No. PTA-6195).
[0449] 213. The antibody of any one of embodiments 185-205, wherein
the antibody comprises in a corresponding complementary determining
region (CDR) an amino acid sequence having at least 80%, 85%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the amino
acid sequence of at least 1, 2, 3, 4, 5, or 6 of the CDR(s) of the
antibody produced by a hybridoma selected from the group consisting
of 3B5.1 (ATCC Accession No. PTA-6193), 12B9.1 (ATCC Accession No.
PTA-6194) and 12G12.1 (ATCC Accession No. PTA-6195).
[0450] 214. The antibody of any one of embodiments 185-205, wherein
the antibody exhibits the biological activity of an antibody
produced by the hybridoma selected from the group consisting of
3B5.1 (ATCC Accession No. PTA-6193), 12B9.1 (ATCC Accession No.
PTA-6194) and 12G12.1 (ATCC Accession No. PTA-6195), wherein the
biological activity is inhibition of cell proliferation or
promotion of cell death in a cell expressing TAT188.
[0451] 215. The antibody of embodiment 214, wherein the cell is a
cancer cell.
[0452] 216. The antibody of embodiment 215, wherein the cancer cell
is selected from the group consisting of breast, colon, rectum,
endometrium, kidney, lung, ovary, skin, and liver.
[0453] 217. A method of inhibiting growth of a cell expressing
TAT188, the method comprising contacting the cell with an antibody
of any one of embodiments 185-205.
[0454] 218. The method of embodiment 217, wherein the cell is a
cancer cell.
[0455] 219. The method of embodiment 218, wherein the cancer cell
is selected from the group consisting of breast, colon, rectum,
endometrium, kidney, lung, ovary, skin, and liver.
[0456] 220. The method of embodiment 219, wherein the cancer cell
is a mammalian cell.
[0457] 221. The method of embodiment 220, wherein the mammalian
cell is a human cell.
[0458] 222. A method of inhibiting growth of a cell expressing
TAT188, the method comprising contacting the cell with an antibody
of any one of embodiments 185-205, wherein the antibody comprises
in a corresponding complementary determining region (CDR) an amino
acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99% or 100% of the amino acid sequence of at
least 1, 2, 3, 4, 5, or 6 of the CDR(s) of the antibody produced by
a hybridoma selected from the group consisting of 3B5.1 (ATCC
Accession No. PTA-6193), 12B9.1 (ATCC Accession No. PTA-6194) and
12G12.1 (ATCC Accession No. PTA-6195).
[0459] 223. A method of detecting the level of TAT188 polypeptide
expressed in a test cell relative to a control cell, the method
comprising: [0460] (a) contacting the test cell and the control
cell with an isolated anti-TAT188 antibody of embodiment 210;
[0461] (b) detecting binding of the antibody; and [0462] (c)
determining the relative binding of the antibody to the test and
control cell.
[0463] 224. The method of embodiment 223, wherein the test cell and
control cell are lysed.
[0464] 225. The method of embodiment 223, wherein the test cell is
in a tissue.
[0465] 226. The method of embodiment 225, wherein the tissue is a
tumor tissue.
[0466] 227. The method of embodiment 226, wherein the tumor tissue
is selected from the group consisting of breast, colon, rectum,
endometrium, kidney, lung, ovary, skin, and liver.
[0467] 228. A method of detecting the level of TAT188 polypeptide
or a polypeptide having at least 80% sequence identity to the amino
acid sequence shown in FIG. 115 (SEQ ID NO:115) in a test cell
relative to a control cell, the method comprising: [0468] (a)
contacting the test cell and the control cell with an isolated
antibody of any one of embodiments 185-189, 196-199, and 210-212;
[0469] (b) detecting binding of the antibody; and [0470] (c)
determining the relative binding of the antibody to the test and
control cell.
[0471] 229. The method of embodiment 228, wherein the level of
TAT188 polypeptide in the test cell is greater than that in the
control cell.
[0472] 230. The method of embodiment 229, wherein the method
diagnoses cancer in a tissue containing or having contained the
test cell.
[0473] 231. A TAT binding interfering RNA (siRNA) which binds to a
nucleic acid having at least 80% sequence identity to:
[0474] (a) a nucleotide sequence shown in FIG. 37 (SEQ ID NO:37;
and
[0475] (b) the complement of (a), wherein the siRNA reduces
expression of TAT188.
[0476] 232. An expression vector comprising the siRNA of embodiment
231.
[0477] 233. The expression vector of embodiment 232, wherein said
siRNA is operably linked to control sequences recognized by a host
cell transfected with the vector.
[0478] 234. A host cell comprising the expression vector of
embodiment 233.
[0479] 235. A composition of matter comprising: [0480] (a) the
antibody of embodiment 185, or [0481] (b) the siRNA of embodiment
231, in combination with a carrier.
[0482] 236. The composition of matter of embodiment 235, wherein
said carrier is a pharmaceutically acceptable carrier.
[0483] 237. An article of manufacture:
[0484] (a) a container; and
[0485] (b) the composition of matter of embodiment 235 contained
within said container.
[0486] 238. The article of manufacture of embodiment 237, further
comprising a label affixed to said container, or a package insert
included with said container, referring to the use of said
composition of matter for the therapeutic treatment of or the
diagnostic detection of a cancer.
[0487] 239. A method of inhibiting the growth of a cancer cell that
expresses a polypeptide having at least 80% amino acid sequence
identity to the amino acid sequence shown in FIG. 115 (SEQ ID
NO:115), said method comprising contacting said cancer cell with a
siRNA that binds to a nucleic acid encoding the amino acid in said
cancer cell, thereby inhibiting the growth of said cancer cell.
[0488] 240. The method of embodiment 239, wherein the nucleic acid
has the sequence shown in FIG. 37 (SEQ ID NO:37).
[0489] 241. The method of embodiment 228, wherein the detecting the
level of expression of the polypeptide comprises employing an
antibody in an immunohistochemistry analysis.
[0490] 242. A method for treating or preventing a cell
proliferative disorder associated with increased expression or
activity of a polypeptide having at least 80% amino acid sequence
identity to the amino acid sequence shown in FIG. 115 (SEQ ID
NO:115), said method comprising administering to a subject in need
of such treatment an effective amount of an antagonist of a TAT188
polypeptide.
[0491] 243. The method of embodiment 242, wherein said antagonist
is an isolated anti-TAT188 polypeptide antibody of any one of
embodiments 1-21 and 23-28.
[0492] 244. The method of embodiment 243, wherein the cell
proliferative disorder is cancer.
[0493] 245. The method of embodiment 244, wherein the cancer is
selected from the group consisting of breast, colon, rectum,
endometrium, kidney, lung, ovary, skin, and liver.
[0494] Yet further embodiments of the present invention will be
evident to the skilled artisan upon a reading of the present
specification.
BRIEF DESCRIPTION OF THE DRAWINGS
[0495] FIG. 1 shows a nucleotide sequence (SEQ ID NO:1) of a TAT161
cDNA, wherein SEQ ID NO:1 is a clone designated herein as
"DNA77507".
[0496] FIGS. 2A-B show a nucleotide sequence (SEQ ID NO:2) of a
TAT101 cDNA, wherein SEQ ID NO:2 is a clone designated herein as
"DNA80894".
[0497] FIG. 3 shows a nucleotide sequence (SEQ ID NO:3) of a TAT157
cDNA, wherein SEQ ID NO:3 is a clone designated herein as
"DNA82343".
[0498] FIG. 4 shows a nucleotide sequence (SEQ ID NO:4) of a TAT160
cDNA, wherein SEQ ID NO:4 is a clone designated herein as
"DNA87994".
[0499] FIG. 5 shows a nucleotide sequence (SEQ ID NO:5) of a TAT158
cDNA, wherein SEQ ID NO:5 is a clone designated herein as
"DNA88131".
[0500] FIG. 6 shows a nucleotide sequence (SEQ ID NO:6) of a TAT110
cDNA, wherein SEQ ID NO:6 is a clone designated herein as
"DNA95930".
[0501] FIG. 7 shows a nucleotide sequence (SEQ ID NO:7) of a TAT210
cDNA, wherein SEQ ID NO:7 is a clone designated herein as
"DNA95930-1".
[0502] FIG. 8 shows a nucleotide sequence (SEQ ID NO:8) of a TAT159
cDNA, wherein SEQ ID NO:8 is a clone designated herein as
"DNA96917".
[0503] FIG. 9 shows a nucleotide sequence (SEQ ID NO:9) of a TAT112
cDNA, wherein SEQ ID NO:9 is a clone designated herein as
"DNA96930".
[0504] FIG. 10 shows a nucleotide sequence (SEQ ID NO:10) of a
TAT147 cDNA, wherein SEQ ID NO:10 is a clone designated herein as
"DNA96936".
[0505] FIG. 11 shows a nucleotide sequence (SEQ ID NO:11) of a
TAT145 cDNA, wherein SEQ ID NO:11 is a clone designated herein as
"DNA98565".
[0506] FIG. 12 shows a nucleotide sequence (SEQ ID NO:12) of a
TAT152 cDNA, wherein SEQ ID NO:12 is a clone designated herein as
"DNA246435".
[0507] FIG. 13 shows a nucleotide sequence (SEQ ID NO:13) of a
TAT162 cDNA, wherein SEQ ID NO:13 is a clone designated herein as
"DNA98591".
[0508] FIG. 14 shows a nucleotide sequence (SEQ ID NO:14) of a
TAT114 cDNA, wherein SEQ ID NO:14 is a clone designated herein as
"DNA108809".
[0509] FIG. 15 shows a nucleotide sequence (SEQ ID NO:15) of a
TAT119 cDNA, wherein SEQ ID NO:15 is a clone designated herein as
"DNA119488".
[0510] FIG. 16 shows a nucleotide sequence (SEQ ID NO:16) of a
TAT103 cDNA, wherein SEQ ID NO:16 is a clone designated herein as
"DNA143493".
[0511] FIGS. 17A-B show a nucleotide sequence (SEQ ID NO:17) of a
TAT130 cDNA, wherein SEQ ID NO:17 is a clone designated herein as
"DNA167234".
[0512] FIG. 18 shows a nucleotide sequence (SEQ ID NO:18) of a
TAT166 cDNA, wherein SEQ ID NO:18 is a clone designated herein as
"DNA235621".
[0513] FIG. 19 shows a nucleotide sequence (SEQ ID NO:19) of a
TAT132 cDNA, wherein SEQ ID NO:19 is a clone designated herein as
"DNA176766".
[0514] FIG. 20 shows a nucleotide sequence (SEQ ID NO:20) of a
TAT150 cDNA, wherein SEQ ID NO:20 is a clone designated herein as
"DNA236463".
[0515] FIG. 21 shows a nucleotide sequence (SEQ ID NO:21) of a
TAT129 cDNA, wherein SEQ ID NO:21 is a clone designated herein as
"DNA181162".
[0516] FIG. 22 shows a nucleotide sequence (SEQ ID NO:22) of a
TAT111 cDNA, wherein SEQ ID NO:22 is a clone designated herein as
"DNA188221".
[0517] FIG. 23 shows a nucleotide sequence (SEQ ID NO:23) of a
TAT146 cDNA, wherein SEQ ID NO:23 is a clone designated herein as
"DNA233876".
[0518] FIG. 24 shows a nucleotide sequence (SEQ ID NO:24) of a
TAT148 cDNA, wherein SEQ ID NO:24 is a clone designated herein as
"DNA193891".
[0519] FIG. 25 shows a nucleotide sequence (SEQ ID NO:25) of a
TAT187 cDNA, wherein SEQ ID NO:25 is a clone designated herein as
"DNA248170".
[0520] FIG. 26 shows a nucleotide sequence (SEQ ID NO:26) of a
TAT118 cDNA, wherein SEQ ID NO:26 is a clone designated herein as
"DNA194628".
[0521] FIG. 27 shows a nucleotide sequence (SEQ ID NO:27) of a
TAT167 cDNA, wherein SEQ ID NO:27 is a clone designated herein as
"DNA246415".
[0522] FIG. 28 shows a nucleotide sequence (SEQ ID NO:28) of a
TAT123 cDNA, wherein SEQ ID NO:28 is a clone designated herein as
"DNA210499".
[0523] FIG. 29 shows a nucleotide sequence (SEQ ID NO:29) of a
TAT211 cDNA, wherein SEQ ID NO:29 is a clone designated herein as
"DNA219894".
[0524] FIG. 30 shows a nucleotide sequence (SEQ ID NO:30) of a
TAT113 cDNA, wherein SEQ ID NO:30 is a clone designated herein as
"DNA215609".
[0525] FIG. 31 shows a nucleotide sequence (SEQ ID NO:31) of a
TAT128 cDNA, wherein SEQ ID NO:31 is a clone designated herein as
"DNA220432".
[0526] FIGS. 32A-B show a nucleotide sequence (SEQ ID NO:32) of a
TAT164 cDNA, wherein SEQ ID NO:32 is a clone designated herein as
"DNA226094".
[0527] FIG. 33 shows a nucleotide sequence (SEQ ID NO:33) of a
TAT122 cDNA, wherein SEQ ID NO:33 is a clone designated herein as
"DNA226165".
[0528] FIG. 34 shows a nucleotide sequence (SEQ ID NO:34) of a
TAT117 cDNA, wherein SEQ ID NO:34 is a clone designated herein as
"DNA226237".
[0529] FIG. 35 shows a nucleotide sequence (SEQ ID NO:35) of a
TAT168 cDNA, wherein SEQ ID NO:35 is a clone designated herein as
"DNA246450".
[0530] FIG. 36 shows a nucleotide sequence (SEQ ID NO:36) of a
TAT144 cDNA, wherein SEQ ID NO:36 is a clone designated herein as
"DNA226456".
[0531] FIG. 37 shows a nucleotide sequence (SEQ ID NO:37) of a
TAT188 cDNA, wherein SEQ ID NO:37 is a clone designated herein as
"DNA237637".
[0532] FIG. 38 shows a nucleotide sequence (SEQ ID NO:38) of a
TAT126 cDNA, wherein SEQ ID NO:38 is a clone designated herein as
"DNA226539".
[0533] FIG. 39 shows a nucleotide sequence (SEQ ID NO:39) of a
TAT151 cDNA, wherein SEQ ID NO:39 is a clone designated herein as
"DNA236511".
[0534] FIG. 40 shows a nucleotide sequence (SEQ ID NO:40) of a
TAT115 cDNA, wherein SEQ ID NO:40 is a clone designated herein as
"DNA226771".
[0535] FIG. 41 shows a nucleotide sequence (SEQ ID NO:41) of a
TAT163 cDNA, wherein SEQ ID NO:41 is a clone designated herein as
"DNA227087".
[0536] FIG. 42 shows a nucleotide sequence (SEQ ID NO:42) of a
TAT227 cDNA, wherein SEQ ID NO:42 is a clone designated herein as
"DNA266307".
[0537] FIG. 43 shows a nucleotide sequence (SEQ ID NO:43) of a
TAT228 cDNA, wherein SEQ ID NO:43 is a clone designated herein as
"DNA266311".
[0538] FIG. 44 shows a nucleotide sequence (SEQ ID NO:44) of a
TAT229 cDNA, wherein SEQ ID NO:44 is a clone designated herein as
"DNA266312".
[0539] FIG. 45 shows a nucleotide sequence (SEQ ID NO:45) of a
TAT230 cDNA, wherein SEQ ID NO:45 is a clone designated herein as
"DNA266313".
[0540] FIG. 46 shows a nucleotide sequence (SEQ ID NO:46) of a
TAT121 cDNA, wherein SEQ ID NO:46 is a clone designated herein as
"DNA227224".
[0541] FIG. 47 shows a nucleotide sequence (SEQ ID NO:47) of a
TAT183 cDNA, wherein SEQ ID NO:47 is a clone designated herein as
"DNA247486".
[0542] FIG. 48 shows a nucleotide sequence (SEQ ID NO:48) of a
TAT165 cDNA, wherein SEQ ID NO:48 is a clone designated herein as
"DNA227578".
[0543] FIG. 49 shows a nucleotide sequence (SEQ ID NO:49) of a
TAT131 cDNA, wherein SEQ ID NO:49 is a clone designated herein as
"DNA227800".
[0544] FIG. 50 shows a nucleotide sequence (SEQ ID NO:50) of a
TAT140 cDNA, wherein SEQ ID NO:50 is a clone designated herein as
"DNA227904".
[0545] FIG. 51 shows a nucleotide sequence (SEQ ID NO:51) of a
TAT127 cDNA, wherein SEQ ID NO:51 is a clone designated herein as
"DNA228199".
[0546] FIG. 52 shows a nucleotide sequence (SEQ ID NO:52) of a
TAT116 cDNA, wherein SEQ ID NO:52 is a clone designated herein as
"DNA228201".
[0547] FIG. 53 shows a nucleotide sequence (SEQ ID NO:53) of a
TAT189 cDNA, wherein SEQ ID NO:53 is a clone designated herein as
"DNA247488".
[0548] FIG. 54 shows a nucleotide sequence (SEQ ID NO:54) of a
TAT190 cDNA, wherein SEQ ID NO:54 is a clone designated herein as
"DNA236538".
[0549] FIG. 55 shows a nucleotide sequence (SEQ ID NO:55) of a
TAT191 cDNA, wherein SEQ ID NO:55 is a clone designated herein as
"DNA247489".
[0550] FIG. 56 shows a nucleotide sequence (SEQ ID NO:56) of a
TAT133 cDNA, wherein SEQ ID NO:56 is a clone designated herein as
"DNA228211".
[0551] FIG. 57 shows a nucleotide sequence (SEQ ID NO:57) of a
TAT186 cDNA, wherein SEQ ID NO:57 is a clone designated herein as
"DNA233937".
[0552] FIG. 58 shows a nucleotide sequence (SEQ ID NO:58) of a
TAT120 cDNA, wherein SEQ ID NO:58 is a clone designated herein as
"DNA228993".
[0553] FIG. 59 shows a nucleotide sequence (SEQ ID NO:59) of a
TAT124 cDNA, wherein SEQ ID NO:59 is a clone designated herein as
"DNA228994".
[0554] FIG. 60 shows a nucleotide sequence (SEQ ID NO:60) of a
TAT105 cDNA, wherein SEQ ID NO:60 is a clone designated herein as
"DNA229410".
[0555] FIGS. 61A-B show a nucleotide sequence (SEQ ID NO:61) of a
TAT107 cDNA, wherein SEQ ID NO:61 is a clone designated herein as
"DNA229411".
[0556] FIGS. 62A-B show a nucleotide sequence (SEQ ID NO:62) of a
TAT108 cDNA, wherein SEQ ID NO:62 is a clone designated herein as
"DNA229413".
[0557] FIGS. 63A-B show a nucleotide sequence (SEQ ID NO:63) of a
TAT139 cDNA, wherein SEQ ID NO:63 is a clone designated herein as
"DNA229700".
[0558] FIG. 64 shows a nucleotide sequence (SEQ ID NO:64) of a
TAT143 cDNA, wherein SEQ ID NO:64 is a clone designated herein as
"DNA231312".
[0559] FIG. 65 shows a nucleotide sequence (SEQ ID NO:65) of a
TAT100 cDNA, wherein SEQ ID NO:65 is a clone designated herein as
"DNA231542".
[0560] FIG. 66 shows a nucleotide sequence (SEQ ID NO:66) of a
TAT284 cDNA, wherein SEQ ID NO:66 is a clone designated herein as
"DNA231542-1".
[0561] FIG. 67 shows a nucleotide sequence (SEQ ID NO:67) of a
TAT285 cDNA, wherein SEQ ID NO:67 is a clone designated herein as
"DNA231542-2".
[0562] FIG. 68 shows a nucleotide sequence (SEQ ID NO:68) of a
TAT285-1 cDNA, wherein SEQ ID NO:68 is a clone designated herein as
"DNA297393".
[0563] FIG. 69 shows a nucleotide sequence (SEQ ID NO:69) of a
TAT125 cDNA, wherein SEQ ID NO:69 is a clone designated herein as
"DNA232754".
[0564] FIG. 70 shows a nucleotide sequence (SEQ ID NO:70) of a
TAT149 cDNA, wherein SEQ ID NO:70 is a clone designated herein as
"DNA234833".
[0565] FIG. 71 shows a nucleotide sequence (SEQ ID NO:71) of a
TAT231 cDNA, wherein SEQ ID NO:71 is a clone designated herein as
"DNA268022".
[0566] FIG. 72 shows a nucleotide sequence (SEQ ID NO:72) of a
TAT153 cDNA, wherein SEQ ID NO:72 is a clone designated herein as
"DNA236246".
[0567] FIG. 73 shows a nucleotide sequence (SEQ ID NO:73) of a
TAT104 cDNA, wherein SEQ ID NO:73 is a clone designated herein as
"DNA236343".
[0568] FIG. 74 shows a nucleotide sequence (SEQ ID NO:74) of a
TAT141 cDNA, wherein SEQ ID NO:74 is a clone designated herein as
"DNA236493".
[0569] FIG. 75 shows a nucleotide sequence (SEQ ID NO:75) of a
TAT102 cDNA, wherein SEQ ID NO:75 is a clone designated herein as
"DNA236534".
[0570] FIG. 76 shows a nucleotide sequence (SEQ ID NO:76) of a
TAT109 cDNA, wherein SEQ ID NO:76 is a clone designated herein as
"DNA246430".
[0571] FIG. 77 shows a nucleotide sequence (SEQ ID NO:77) of a
TAT142 cDNA, wherein SEQ ID NO:77 is a clone designated herein as
"DNA247480".
[0572] FIGS. 78A-B show a nucleotide sequence (SEQ ID NO:78) of a
TAT106 cDNA, wherein SEQ ID NO:78 is a clone designated herein as
"DNA264454".
[0573] FIG. 79 shows the amino acid sequence (SEQ ID NO:79) derived
from the coding sequence of SEQ ID NO:1 shown in FIG. 1.
[0574] FIG. 80 shows the amino acid sequence (SEQ ID NO:80) derived
from the coding sequence of SEQ ID NO:2 shown in FIG. 2.
[0575] FIG. 81 shows the amino acid sequence (SEQ ID NO:81) derived
from the coding sequence of SEQ ID NO:3 shown in FIG. 3.
[0576] FIG. 82 shows the amino acid sequence (SEQ ID NO:82) derived
from the coding sequence of SEQ ID NO:4 shown in FIG. 4.
[0577] FIG. 83 shows the amino acid sequence (SEQ ID NO:83) derived
from the coding sequence of SEQ ID NO:5 shown in FIG. 5.
[0578] FIG. 84 shows the amino acid sequence (SEQ ID NO:84) derived
from the coding sequence of SEQ ID NO:6 shown in FIG. 6.
[0579] FIG. 85 shows the amino acid sequence (SEQ ID NO:85) derived
from the coding sequence of SEQ ID NO:7 shown in FIG. 7.
[0580] FIG. 86 shows the amino acid sequence (SEQ ID NO:86) derived
from the coding sequence of SEQ ID NO:8 shown in FIG. 8.
[0581] FIG. 87 shows the amino acid sequence (SEQ ID NO:87) derived
from the coding sequence of SEQ ID NO:9 shown in FIG. 9.
[0582] FIG. 88 shows the amino acid sequence (SEQ ID NO:88) derived
from the coding sequence of SEQ ID NO:10 shown in FIG. 10.
[0583] FIG. 89 shows the amino acid sequence (SEQ ID NO:89) derived
from the coding sequence of SEQ ID NO:11 shown in FIG. 11.
[0584] FIG. 90 shows the amino acid sequence (SEQ ID NO:90) derived
from the coding sequence of SEQ ID NO:12 shown in FIG. 12.
[0585] FIG. 91 shows the amino acid sequence (SEQ ID NO:91) derived
from the coding sequence of SEQ ID NO:13 shown in FIG. 13.
[0586] FIG. 92 shows the amino acid sequence (SEQ ID NO:92) derived
from the coding sequence of SEQ ID NO:14 shown in FIG. 14.
[0587] FIG. 93 shows the amino acid sequence (SEQ ID NO:93) derived
from the coding sequence of SEQ ID NO:15 shown in FIG. 15.
[0588] FIG. 94 shows the amino acid sequence (SEQ ID NO:94) derived
from the coding sequence of SEQ ID NO:16 shown in FIG. 16.
[0589] FIG. 95 shows the amino acid sequence (SEQ ID NO:95) derived
from the coding sequence of SEQ ID NO:17 shown in FIGS. 17A-B.
[0590] FIG. 96 shows the amino acid sequence (SEQ ID NO:96) derived
from the coding sequence of SEQ ID NO:18 shown in FIG. 18.
[0591] FIG. 97 shows the amino acid sequence (SEQ ID NO:97) derived
from the coding sequence of SEQ ID NO:19 shown in FIG. 19.
[0592] FIG. 98 shows the amino acid sequence (SEQ ID NO:98) derived
from the coding sequence of SEQ ID NO:20 shown in FIG. 20.
[0593] FIG. 99 shows the amino acid sequence (SEQ ID NO:99) derived
from the coding sequence of SEQ ID NO:21 shown in FIG. 21.
[0594] FIG. 100 shows the amino acid sequence (SEQ ID NO:100)
derived from the coding sequence of SEQ ID NO:22 shown in FIG.
22.
[0595] FIG. 101 shows the amino acid sequence (SEQ ID NO:101)
derived from the coding sequence of SEQ ID NO:23 shown in FIG.
23.
[0596] FIG. 102 shows the amino acid sequence (SEQ ID NO:102)
derived from the coding sequence of SEQ ID NO:24 shown in FIG.
24.
[0597] FIG. 103 shows the amino acid sequence (SEQ ID NO:103)
derived from the coding sequence of SEQ ID NO:25 shown in FIG.
25.
[0598] FIG. 104 shows the amino acid sequence (SEQ ID NO:104)
derived from the coding sequence of SEQ ID NO:26 shown in FIG.
26.
[0599] FIG. 105 shows the amino acid sequence (SEQ ID NO:105)
derived from the coding sequence of SEQ ID NO:27 shown in FIG.
27.
[0600] FIG. 106 shows the amino acid sequence (SEQ ID NO:106)
derived from the coding sequence of SEQ ID NO:28 shown in FIG.
28.
[0601] FIG. 107 shows the amino acid sequence (SEQ ID NO:107)
derived from the coding sequence of SEQ ID NO:29 shown in FIG.
29.
[0602] FIG. 108 shows the amino acid sequence (SEQ ID NO:108)
derived from the coding sequence of SEQ ID NO:30 shown in FIG.
30.
[0603] FIG. 109 shows the amino acid sequence (SEQ ID NO:109)
derived from the coding sequence of SEQ ID NO:31 shown in FIG.
31.
[0604] FIGS. 110A-B shows the amino acid sequence (SEQ ID NO:110)
derived from the coding sequence of SEQ ID NO:32 shown in FIGS.
32A-B.
[0605] FIG. 111 shows the amino acid sequence (SEQ ID NO:111)
derived from the coding sequence of SEQ ID NO:33 shown in FIG.
33.
[0606] FIG. 112 shows the amino acid sequence (SEQ ID NO:112)
derived from the coding sequence of SEQ ID NO:34 shown in FIG.
34.
[0607] FIG. 113 shows the amino acid sequence (SEQ ID NO:113)
derived from the coding sequence of SEQ ID NO:35 shown in FIG.
35.
[0608] FIG. 114 shows the amino acid sequence (SEQ ID NO:114)
derived from the coding sequence of SEQ ID NO:36 shown in FIG.
36.
[0609] FIG. 115 shows the amino acid sequence (SEQ ID NO:115)
derived from the coding sequence of SEQ ID NO:37 shown in FIG.
37.
[0610] FIG. 116 shows the amino acid sequence (SEQ ID NO:116)
derived from the coding sequence of SEQ ID NO:38 shown in FIG.
38.
[0611] FIG. 117 shows the amino acid sequence (SEQ ID NO:117)
derived from the coding sequence of SEQ ID NO:39 shown in FIG.
39.
[0612] FIG. 118 shows the amino acid sequence (SEQ ID NO:118)
derived from the coding sequence of SEQ ID NO:40 shown in FIG.
40.
[0613] FIG. 119 shows the amino acid sequence (SEQ ID NO:119)
derived from the coding sequence of SEQ ID NO:41 shown in FIG.
41.
[0614] FIG. 120 shows the amino acid sequence (SEQ ID NO:120)
derived from the coding sequence of SEQ ID NO:42 shown in FIG.
42.
[0615] FIG. 121 shows the amino acid sequence (SEQ ID NO:121)
derived from the coding sequence of SEQ ID NO:43 shown in FIG.
43.
[0616] FIG. 122 shows the amino acid sequence (SEQ ID NO:122)
derived from the coding sequence of SEQ ID NO:44 shown in FIG.
44.
[0617] FIG. 123 shows the amino acid sequence (SEQ ID NO:123)
derived from the coding sequence of SEQ ID NO:45 shown in FIG.
45.
[0618] FIG. 124 shows the amino acid sequence (SEQ ID NO:124)
derived from the coding sequence of SEQ ID NO:46 shown in FIG.
46.
[0619] FIG. 125 shows the amino acid sequence (SEQ ID NO:125)
derived from the coding sequence of SEQ ID NO:47 shown in FIG.
47.
[0620] FIG. 126 shows the amino acid sequence (SEQ ID NO:126)
derived from the coding sequence of SEQ ID NO:48 shown in FIG.
48.
[0621] FIG. 127 shows the amino acid sequence (SEQ ID NO:127)
derived from the coding sequence of SEQ ID NO:49 shown in FIG.
49.
[0622] FIG. 128 shows the amino acid sequence (SEQ ID NO:128)
derived from the coding sequence of SEQ ID NO:50 shown in FIG.
50.
[0623] FIG. 129 shows the amino acid sequence (SEQ ID NO:129)
derived from the coding sequence of SEQ ID NO:51 shown in FIG.
51.
[0624] FIG. 130 shows the amino acid sequence (SEQ ID NO:130)
derived from the coding sequence of SEQ ID NO:52 shown in FIG.
52.
[0625] FIG. 131 shows the amino acid sequence (SEQ ID NO:131)
derived from the coding sequence of SEQ ID NO:53 shown in FIG.
53.
[0626] FIG. 132 shows the amino acid sequence (SEQ ID NO:132)
derived from the coding sequence of SEQ ID NO:54 shown in FIG.
54.
[0627] FIG. 133 shows the amino acid sequence (SEQ ID NO:133)
derived from the coding sequence of SEQ ID NO:55 shown in FIG.
55.
[0628] FIG. 134 shows the amino acid sequence (SEQ ID NO:134)
derived from the coding sequence of SEQ ID NO:56 shown in FIG.
56.
[0629] FIG. 135 shows the amino acid sequence (SEQ ID NO:135)
derived from the coding sequence of SEQ ID NO:57 shown in FIG.
57.
[0630] FIG. 136 shows the amino acid sequence (SEQ ID NO:136)
derived from the coding sequence of SEQ ID NO:58 shown in FIG.
58.
[0631] FIG. 137 shows the amino acid sequence (SEQ ID NO:137)
derived from the coding sequence of SEQ ID NO:59 shown in FIG.
59.
[0632] FIG. 138 shows the amino acid sequence (SEQ ID NO:138)
derived from the coding sequence of SEQ ID NO:60 shown in FIG.
60.
[0633] FIG. 139 shows the amino acid sequence (SEQ ID NO:139)
derived from the coding sequence of SEQ ID NO:61 shown in FIGS.
61A-B.
[0634] FIG. 140 shows the amino acid sequence (SEQ ID NO:140)
derived from the coding sequence of SEQ ID NO:62 shown in FIGS.
62A-B.
[0635] FIG. 141 shows the amino acid sequence (SEQ ID NO:141)
derived from the coding sequence of SEQ ID NO:63 shown in FIGS.
63A-B.
[0636] FIG. 142 shows the amino acid sequence (SEQ ID NO:142)
derived from the coding sequence of SEQ ID NO:64 shown in FIG.
64.
[0637] FIG. 143 shows the amino acid sequence (SEQ ID NO:143)
derived from the coding sequence of SEQ ID NO:66 shown in FIG.
66.
[0638] FIG. 144 shows the amino acid sequence (SEQ ID NO:144)
derived from the coding sequence of SEQ ID NO:67 shown in FIG.
67.
[0639] FIG. 145 shows the amino acid sequence (SEQ ID NO:145)
derived from the coding sequence of SEQ ID NO:68 shown in FIG.
68.
[0640] FIG. 146 shows the amino acid sequence (SEQ ID NO:146)
derived from the coding sequence of SEQ ID NO:69 shown in FIG.
69.
[0641] FIG. 147 shows the amino acid sequence (SEQ ID NO:147)
derived from the coding sequence of SEQ ID NO:70 shown in FIG.
70.
[0642] FIG. 148 shows the amino acid sequence (SEQ ID NO:148)
derived from the coding sequence of SEQ ID NO:71 shown in FIG.
71.
[0643] FIG. 149 shows the amino acid sequence (SEQ ID NO:149)
derived from the coding sequence of SEQ ID NO:73 shown in FIG.
73.
[0644] FIG. 150 shows the amino acid sequence (SEQ ID NO:150)
derived from the coding sequence of SEQ ID NO:74 shown in FIG.
74.
[0645] FIG. 151 shows the amino acid sequence (SEQ ID NO:151)
derived from the coding sequence of SEQ ID NO:75 shown in FIG.
75.
[0646] FIG. 152 shows the amino acid sequence (SEQ ID NO:152)
derived from the coding sequence of SEQ ID NO:76 shown in FIG.
76.
[0647] FIG. 153 shows the amino acid sequence (SEQ ID NO:153)
derived from the coding sequence of SEQ ID NO:77 shown in FIG.
77.
[0648] FIG. 154 shows the amino acid sequence (SEQ ID NO:154)
derived from the coding sequence of SEQ ID NO:78 shown in FIGS.
78A-B.
[0649] FIG. 155 is a diagram depicting the three dimensional
structure of the E16 polypeptide (TAT188) as a subunit of the
sodium ion independent large neutral amino acid transporter.
[0650] FIG. 156 shows the graphical results of FACS plots
demonstrating binding of anti-TAT188 (anti-E16) antibodies to PC3
cell surface (green plot) and reduction in binding with reduction
in TAT188 expression (red plot).
[0651] FIG. 157 shows internalization of anti-TAT188 antibody after
binding to the surface of TAT188-expressing PC3 cells.
[0652] FIG. 158 is a bar graph showing changes in TAT188 amino acid
transport activity in the presence of anti-TAT188 antibody with
time.
[0653] FIG. 159 provides plots of cell viability in the presence of
increasing amounts of MC-vc-PAB-MMAE toxin-conjugated anti-TAT188
antibody in PC3 and Colo205 cells.
[0654] FIG. 160 is a plot of cell viability in the presence of
increasing amounts of MC-vc-PAB-MMAE or MC-vc-PAB-MMAF
toxin-conjugated anti-TAT188 antibody in Colo205 cells.
[0655] FIG. 161shows the results anti-human E16 antibody binding
cells endogenously expressing E16 polypeptide, where the cells are
monkey COS7 cells, human MCF10A breast cancer cells, and mouse
NIH-3T3 cells. FIG. 161A shows the FACS results of binding of
anti-E16 antibodies 3B5, 12B9, and 12G12 to monkey COS. FIG. 161B
shows binding of anti-E16 3B5 to human breast tumor cell line
MCF10A and no binding to mouse NIH-3T3 cells.
[0656] FIG. 162 is a plot of mean tumor volume changes over time in
xenograft mice administered naked (not toxin-conjugated) anti-E16
antibodies.
[0657] FIG. 163 is a graph of mean tumor volume changes over time
in xenograft mice administered toxin-conjugated anti-E16
antibodies, where the toxin was either MC-vc-PAB-MMAE or
MC-vc-PAB-MMAF.
[0658] FIG. 164 shows that E16-GFP fusion polypeptide expression is
reduced in cells transfected with siRNA that targets the E16 gene.
The top panel are photographs of the results of bioluminescence
assays for the presence of GFP. The lower panel are photographs of
phase contrast visualization showing the GFP bioluminescence
reduction was not caused by reduction in cell number.
[0659] FIG. 165 is a Western blot showing that E16-GFP fusion
polypeptide expression is inhibited in PC3 cells transiently
transfected with E16 siRNA. .beta.-tubulin is a gel loading
control.
[0660] FIG. 166 shows that transient transfection of PC3 cells with
E16 siRNA is associated with a reduction in amino acid transport
function, consistent with reduced expression of E16.
[0661] FIG. 167 is a plot of cell proliferation over time with and
without transient transfection with E16 siRNA. Cell proliferation
is reduced in PC3 cells transiently transfected with E16.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
I. Definitions
[0662] The terms "TAT polypeptide" and "TAT" as used herein and
when immediately followed by a numerical designation, refer to
various polypeptides, wherein the complete designation (i.e.,
TAT/number) refers to specific polypeptide sequences as described
herein. The terms "TAT/number polypeptide" and "TAT/number" wherein
the term "number" is provided as an actual numerical designation as
used herein encompass native sequence polypeptides, polypeptide
variants and fragments of native sequence polypeptides and
polypeptide variants (which are further defined herein). The TAT
polypeptides described herein may be isolated from a variety of
sources, such as from human tissue types or from another source, or
prepared by recombinant or synthetic methods. The term "TAT
polypeptide" refers to each individual TAT/number polypeptide
disclosed herein. All disclosures in this specification which refer
to the "TAT polypeptide" refer to each of the polypeptides
individually as well as jointly. For example, descriptions of the
preparation of, purification of, derivation of, formation of
antibodies to or against, formation of TAT binding oligopeptides to
or against, formation of TAT binding organic molecules to or
against, administration of, compositions containing, treatment of a
disease with, etc., pertain to each polypeptide of the invention
individually. The term "TAT polypeptide" also includes variants of
the TAT/number polypeptides disclosed herein.
[0663] A "native sequence TAT polypeptide" comprises a polypeptide
having the same amino acid sequence as the corresponding TAT
polypeptide derived from nature. Such native sequence TAT
polypeptides can be isolated from nature or can be produced by
recombinant or synthetic means. The term "native sequence TAT
polypeptide" specifically encompasses naturally-occurring truncated
or secreted forms of the specific TAT polypeptide (e.g., an
extracellular domain sequence), naturally-occurring variant forms
(e.g., alternatively spliced forms) and naturally-occurring allelic
variants of the polypeptide. In certain embodiments of the
invention, the native sequence TAT polypeptides disclosed herein
are mature or full-length native sequence polypeptides comprising
the full-length amino acids sequences shown in the accompanying
figures. Start and stop codons (if indicated) are shown in bold
font and underlined in the figures. Nucleic acid residues indicated
as "N" in the accompanying figures are any nucleic acid residue.
However, while the TAT polypeptides disclosed in the accompanying
figures are shown to begin with methionine residues designated
herein as amino acid position 1 in the figures, it is conceivable
and possible that other methionine residues located either upstream
or downstream from the amino acid position 1 in the figures may be
employed as the starting amino acid residue for the TAT
polypeptides.
[0664] The TAT polypeptide "extracellular domain" or "ECD" refers
to a form of the TAT polypeptide which is essentially free of the
transmembrane and cytoplasmic domains. Ordinarily, a TAT
polypeptide ECD will have less than 1% of such transmembrane and/or
cytoplasmic domains and preferably, will have less than 0.5% of
such domains. It will be understood that any transmembrane domains
identified for the TAT polypeptides of the present invention are
identified pursuant to criteria routinely employed in the art for
identifying that type of hydrophobic domain. The exact boundaries
of a transmembrane domain may vary but most likely by no more than
about 5 amino acids at either end of the domain as initially
identified herein. Optionally, therefore, an extracellular domain
of a TAT polypeptide may contain from about 5 or fewer amino acids
on either side of the transmembrane domain/extracellular domain
boundary as identified in the Examples or specification and such
polypeptides, with or without the associated signal peptide, and
nucleic acid encoding them, are contemplated by the present
invention.
[0665] The approximate location of the "signal peptides" of the
various TAT polypeptides disclosed herein may be shown in the
present specification and/or the accompanying figures. It is noted,
however, that the C-terminal boundary of a signal peptide may vary,
but most likely by no more than about 5 amino acids on either side
of the signal peptide C-terminal boundary as initially identified
herein, wherein the C-terminal boundary of the signal peptide may
be identified pursuant to criteria routinely employed in the art
for identifying that type of amino acid sequence element (e.g.,
Nielsen et al., Prot. Eng. 10:1-6 (1997) and von Heinje et al.,
Nucl. Acids. Res. 14:4683-4690 (1986)). Moreover, it is also
recognized that, in some cases, cleavage of a signal sequence from
a secreted polypeptide is not entirely uniform, resulting in more
than one secreted species. These mature polypeptides, where the
signal peptide is cleaved within no more than about 5 amino acids
on either side of the C-terminal boundary of the signal peptide as
identified herein, and the polynucleotides encoding them, are
contemplated by the present invention.
[0666] "TAT polypeptide variant" means a TAT polypeptide,
preferably an active TAT polypeptide, as defined herein having at
least about 80% amino acid sequence identity with a full-length
native sequence TAT polypeptide sequence as disclosed herein, a TAT
polypeptide sequence lacking the signal peptide as disclosed
herein, an extracellular domain of a TAT polypeptide, with or
without the signal peptide, as disclosed herein or any other
fragment of a full-length TAT polypeptide sequence as disclosed
herein (such as those encoded by a nucleic acid that represents
only a portion of the complete coding sequence for a full-length
TAT polypeptide). Such TAT polypeptide variants include, for
instance, TAT polypeptides wherein one or more amino acid residues
are added, or deleted, at the N- or C-terminus of the full-length
native amino acid sequence. Ordinarily, a TAT polypeptide variant
will have at least about 80% amino acid sequence identity,
alternatively at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%,
88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% amino
acid sequence identity, to a full-length native sequence TAT
polypeptide sequence as disclosed herein, a TAT polypeptide
sequence lacking the signal peptide as disclosed herein, an
extracellular domain of a TAT polypeptide, with or without the
signal peptide, as disclosed herein or any other specifically
defined fragment of a full-length TAT polypeptide sequence as
disclosed herein. Ordinarily, TAT variant polypeptides are at least
about 10 amino acids in length, alternatively at least about 20,
30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170,
180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300,
310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430,
440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560,
570, 580, 590, 600 amino acids in length, or more. Optionally, TAT
variant polypeptides will have no more than one conservative amino
acid substitution as compared to the native TAT polypeptide
sequence, alternatively no more than 2, 3, 4, 5, 6, 7, 8, 9, or 10
conservative amino acid substitution as compared to the native TAT
polypeptide sequence.
[0667] "Percent (%) amino acid sequence identity" with respect to
the TAT polypeptide sequences identified herein is defined as the
percentage of amino acid residues in a candidate sequence that are
identical with the amino acid residues in the specific TAT
polypeptide sequence, after aligning the sequences and introducing
gaps, if necessary, to achieve the maximum percent sequence
identity, and not considering any conservative substitutions as
part of the sequence identity. Alignment for purposes of
determining percent amino acid sequence identity can be achieved in
various ways that are within the skill in the art, for instance,
using publicly available computer software such as BLAST, BLAST-2,
ALIGN or Megalign (DNASTAR) software. Those skilled in the art can
determine appropriate parameters for measuring alignment, including
any algorithms needed to achieve maximal alignment over the full
length of the sequences being compared. For purposes herein,
however, % amino acid sequence identity values are generated using
the sequence comparison computer program ALIGN-2, wherein the
complete source code for the ALIGN-2 program is provided in Table 1
below. The ALIGN-2 sequence comparison computer program was
authored by Genentech, Inc. and the source code shown in Table 1
below has been filed with user documentation in the U.S. Copyright
Office, Washington D.C., 20559, where it is registered under U.S.
Copyright Registration No. TXU510087. The ALIGN-2 program is
publicly available through Genentech, Inc., South San Francisco,
Calif. or may be compiled from the source code provided in Table 1
below. The ALIGN-2 program should be compiled for use on a UNIX
operating system, preferably digital UNIX V4.0D. All sequence
comparison parameters are set by the ALIGN-2 program and do not
vary.
[0668] In situations where ALIGN-2 is employed for amino acid
sequence comparisons, the % amino acid sequence identity of a given
amino acid sequence A to, with, or against a given amino acid
sequence B (which can alternatively be phrased as a given amino
acid sequence A that has or comprises a certain % amino acid
sequence identity to, with, or against a given amino acid sequence
B) is calculated as follows:
ti 100 times the fraction X/Y where X is the number of amino acid
residues scored as identical matches by the sequence alignment
program ALIGN-2 in that program's alignment of A and B, and where Y
is the total number of amino acid residues in B. It will be
appreciated that where the length of amino acid sequence A is not
equal to the length of amino acid sequence B, the % amino acid
sequence identity of A to B will not equal the % amino acid
sequence identity of B to A. As examples of % amino acid sequence
identity calculations using this method, Tables 2 and 3 demonstrate
how to calculate the % amino acid sequence identity of the amino
acid sequence designated "Comparison Protein" to the amino acid
sequence designated "TAT", wherein "TAT" represents the amino acid
sequence of a hypothetical TAT polypeptide of interest, "Comparison
Protein" represents the amino acid sequence of a polypeptide
against which the "TAT" polypeptide of interest is being compared,
and "X, "Y" and "Z" each represent different hypothetical amino
acid residues. Unless specifically stated otherwise, all % amino
acid sequence identity values used herein are obtained as described
in the immediately preceding paragraph using the ALIGN-2 computer
program.
[0669] "TAT variant polynucleotide" or "TAT variant nucleic acid
sequence" means a nucleic acid molecule which encodes a TAT
polypeptide, preferably an active TAT polypeptide, as defined
herein and which has at least about 80% nucleic acid sequence
identity with a nucleotide acid sequence encoding a full-length
native sequence TAT polypeptide sequence as disclosed herein, a
full-length native sequence TAT polypeptide sequence lacking the
signal peptide as disclosed herein, an extracellular domain of a
TAT polypeptide, with or without the signal peptide, as disclosed
herein or any other fragment of a full-length TAT polypeptide
sequence as disclosed herein (such as those encoded by a nucleic
acid that represents only a portion of the complete coding sequence
for a full-length TAT polypeptide). Ordinarily, a TAT variant
polynucleotide will have at least about 80% nucleic acid sequence
identity, alternatively at least about 81%, 82%, 83%, 84%, 85%,
86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or
99% nucleic acid sequence identity with a nucleic acid sequence
encoding a full-length native sequence TAT polypeptide sequence as
disclosed herein, a full-length native sequence TAT polypeptide
sequence lacking the signal peptide as disclosed herein, an
extracellular domain of a TAT polypeptide, with or without the
signal sequence, as disclosed herein or any other fragment of a
full-length TAT polypeptide sequence as disclosed herein. Variants
do not encompass the native nucleotide sequence.
[0670] Ordinarily, TAT variant polynucleotides are at least about 5
nucleotides in length, alternatively at least about 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95,
100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160,
165, 170, 175, 180, 185, 190, 195, 200, 210, 220, 230, 240, 250,
260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380,
390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510,
520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640,
650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770,
780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900,
910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 nucleotides in
length, wherein in this context the term "about" means the
referenced nucleotide sequence length plus or minus 10% of that
referenced length.
[0671] "Percent (%) nucleic acid sequence identity" with respect to
TAT-encoding nucleic acid sequences identified herein is defined as
the percentage of nucleotides in a candidate sequence that are
identical with the nucleotides in the TAT nucleic acid sequence of
interest, after aligning the sequences and introducing gaps, if
necessary, to achieve the maximum percent sequence identity.
Alignment for purposes of determining percent nucleic acid sequence
identity can be achieved in various ways that are within the skill
in the art, for instance, using publicly available computer
software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR)
software. For purposes herein, however, % nucleic acid sequence
identity values are generated using the sequence comparison
computer program ALIGN-2, wherein the complete source code for the
ALIGN-2 program is provided in Table 1 below. The ALIGN-2 sequence
comparison computer program was authored by Genentech, Inc. and the
source code shown in Table 1 below has been filed with user
documentation in the U.S. Copyright Office, Washington D.C., 20559,
where it is registered under U.S. Copyright Registration No.
TXU510087. The ALIGN-2 program is publicly available through
Genentech, Inc., South San Francisco, Calif. or may be compiled
from the source code provided in Table 1 below. The ALIGN-2 program
should be compiled for use on a UNIX operating system, preferably
digital UNIX V4.0D. All sequence comparison parameters are set by
the ALIGN-2 program and do not vary.
[0672] In situations where ALIGN-2 is employed for nucleic acid
sequence comparisons, the % nucleic acid sequence identity of a
given nucleic acid sequence C to, with, or against a given nucleic
acid sequence D (which can alternatively be phrased as a given
nucleic acid sequence C that has or comprises a certain % nucleic
acid sequence identity to, with, or against a given nucleic acid
sequence D) is calculated as follows:
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by
the sequence alignment program ALIGN-2 in that program's alignment
of C and D, and where Z is the total number of nucleotides in D. It
will be appreciated that where the length of nucleic acid sequence
C is not equal to the length of nucleic acid sequence D, the %
nucleic acid sequence identity of C to D will not equal the %
nucleic acid sequence identity of D to C. As examples of % nucleic
acid sequence identity calculations, Tables 4 and 5, demonstrate
how to calculate the % nucleic acid sequence identity of the
nucleic acid sequence designated "Comparison DNA" to the nucleic
acid sequence designated "TAT-DNA", wherein "TAT-DNA" represents a
hypothetical TAT-encoding nucleic acid sequence of interest,
"Comparison DNA" represents the nucleotide sequence of a nucleic
acid molecule against which the "TAT-DNA" nucleic acid molecule of
interest is being compared, and "N", "L" and "V" each represent
different hypothetical nucleotides. Unless specifically stated
otherwise, all % nucleic acid sequence identity values used herein
are obtained as described in the immediately preceding paragraph
using the ALIGN-2 computer program.
[0673] In other embodiments, TAT variant polynucleotides are
nucleic acid molecules that encode a TAT polypeptide and which are
capable of hybridizing, preferably under stringent hybridization
and wash conditions, to nucleotide sequences encoding a full-length
TAT polypeptide as disclosed herein. TAT variant polypeptides may
be those that are encoded by a TAT variant polynucleotide.
[0674] The term "full-length coding region" when used in reference
to a nucleic acid encoding a TAT polypeptide refers to the sequence
of nucleotides which encode the full-length TAT polypeptide of the
invention (which is often shown between start and stop codons,
inclusive thereof, in the accompanying figures). The term
"full-length coding region" when used in reference to an ATCC
deposited nucleic acid refers to the TAT polypeptide-encoding
portion of the cDNA that is inserted into the vector deposited with
the ATCC (which is often shown between start and stop codons,
inclusive thereof, in the accompanying figures).
[0675] "Isolated," when used to describe the various TAT
polypeptides disclosed herein, means polypeptide that has been
identified and separated and/or recovered from a component of its
natural environment. Contaminant components of its natural
environment are materials that would typically interfere with
diagnostic or therapeutic uses for the polypeptide, and may include
enzymes, hormones, and other proteinaceous or non-proteinaceous
solutes. In preferred embodiments, the polypeptide will be purified
(1) to a degree sufficient to obtain at least 15 residues of
N-terminal or internal amino acid sequence by use of a spinning cup
sequenator, or (2) to homogeneity by SDS-PAGE under non-reducing or
reducing conditions using Coomassie blue or, preferably, silver
stain. Isolated polypeptide includes polypeptide in situ within
recombinant cells, since at least one component of the TAT
polypeptide natural environment will not be present. Ordinarily,
however, isolated polypeptide will be prepared by at least one
purification step.
[0676] An "isolated" TAT polypeptide-encoding nucleic acid or other
polypeptide-encoding nucleic acid is a nucleic acid molecule that
is identified and separated from at least one contaminant nucleic
acid molecule with which it is ordinarily associated in the natural
source of the polypeptide-encoding nucleic acid. An isolated
polypeptide-encoding nucleic acid molecule is other than in the
form or setting in which it is found in nature. Isolated
polypeptide-encoding nucleic acid molecules therefore are
distinguished from the specific polypeptide-encoding nucleic acid
molecule as it exists in natural cells. However, an isolated
polypeptide-encoding nucleic acid molecule includes
polypeptide-encoding nucleic acid molecules contained in cells that
ordinarily express the polypeptide where, for example, the nucleic
acid molecule is in a chromosomal location different from that of
natural cells.
[0677] The term "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells are known to utilize promoters, polyadenylation
signals, and enhancers.
[0678] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are contiguous, and, in the case of a
secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide adaptors or linkers are used
in accordance with conventional practice.
[0679] "Stringency" of hybridization reactions is readily
determinable by one of ordinary skill in the art, and generally is
an empirical calculation dependent upon probe length, washing
temperature, and salt concentration. In general, longer probes
require higher temperatures for proper annealing, while shorter
probes need lower temperatures. Hybridization generally depends on
the ability of denatured DNA to reanneal when complementary strands
are present in an environment below their melting temperature. The
higher the degree of desired homology between the probe and
hybridizable sequence, the higher the relative temperature which
can be used. As a result, it follows that higher relative
temperatures would tend to make the reaction conditions more
stringent, while lower temperatures less so. For additional details
and explanation of stringency of hybridization reactions, see
Ausubel et al., Current Protocols in Molecular Biology, Wiley
Interscience Publishers, (1995).
[0680] "Stringent conditions" or "high stringency conditions", as
defined herein, may be identified by those that: (1) employ low
ionic strength and high temperature for washing, for example 0.015
M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl
sulfate at 50EC; (2) employ during hybridization a denaturing
agent, such as formamide, for example, 50% (v/v) formamide with
0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50
mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride,
75 mM sodium citrate at 42EC; or (3) overnight hybridization in a
solution that employs 50% formamide, 5.times.SSC (0.75 M NaCl,
0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1%
sodium pyrophosphate, 5.times.Denhardt's solution, sonicated salmon
sperm DNA (50:g/ml), 0.1% SDS, and 10% dextran sulfate at 42EC,
with a 10 minute wash at 42EC in 0.2.times.SSC (sodium
chloride/sodium citrate) followed by a 10 minute high-stringency
wash consisting of 0.1.times.SSC containing EDTA at 55EC.
[0681] "Moderately stringent conditions" may be identified as
described by Sambrook et al., Molecular Cloning: A Laboratory
Manual, New York: Cold Spring Harbor Press, 1989, and include the
use of washing solution and hybridization conditions (e.g.,
temperature, ionic strength and % SDS) less stringent that those
described above. An example of moderately stringent conditions is
overnight incubation at 37EC in a solution comprising: 20%
formamide, 5.times.SSC (150 mM NaCl, 15 mM trisodium citrate), 50
mM sodium phosphate (pH 7.6), 5.times.Denhardt's solution, 10%
dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA,
followed by washing the filters in 1.times.SSC at about 37-50EC.
The skilled artisan will recognize how to adjust the temperature,
ionic strength, etc. as necessary to accommodate factors such as
probe length and the like.
[0682] The term "epitope tagged" when used herein refers to a
chimeric polypeptide comprising a TAT polypeptide or anti-TAT
antibody fused to a "tag polypeptide". The tag polypeptide has
enough residues to provide an epitope against which an antibody can
be made, yet is short enough such that it does not interfere with
activity of the polypeptide to which it is fused. The tag
polypeptide preferably also is fairly unique so that the antibody
does not substantially cross-react with other epitopes. Suitable
tag polypeptides generally have at least six amino acid residues
and usually between about 8 and 50 amino acid residues (preferably,
between about 10 and 20 amino acid residues).
[0683] "Active" or "activity" for the purposes herein refers to
form(s) of a TAT polypeptide which retain a biological and/or an
immunological activity of native or naturally-occurring TAT,
wherein "biological" activity refers to a biological function
(either inhibitory or stimulatory) caused by a native or
naturally-occurring TAT other than the ability to induce the
production of an antibody against an antigenic epitope possessed by
a native or naturally-occurring TAT and an "immunological" activity
refers to the ability to induce the production of an antibody
against an antigenic epitope possessed by a native or
naturally-occurring TAT.
[0684] The term "antagonist" is used in the broadest sense, and
includes any molecule that partially or fully blocks, inhibits, or
neutralizes a biological activity of a native TAT polypeptide
disclosed herein. In a similar manner, the term "agonist" is used
in the broadest sense and includes any molecule that mimics a
biological activity of a native TAT polypeptide disclosed herein.
Suitable agonist or antagonist molecules specifically include
agonist or antagonist antibodies or antibody fragments, fragments
or amino acid sequence variants of native TAT polypeptides,
peptides, antisense oligonucleotides, small organic molecules, etc.
Methods for identifying agonists or antagonists of a TAT
polypeptide may comprise contacting a TAT polypeptide with a
candidate agonist or antagonist molecule and measuring a detectable
change in one or more biological activities normally associated
with the TAT polypeptide.
[0685] "Treating" or "treatment" or "alleviation" refers to both
therapeutic treatment and prophylactic or preventative measures,
wherein the object is to prevent or slow down (lessen) the targeted
pathologic condition or disorder. Those in need of treatment
include those already with the disorder as well as those prone to
have the disorder or those in whom the disorder is to be prevented.
A subject or mammal is successfully "treated" for a TAT
polypeptide-expressing cancer if, after receiving a therapeutic
amount of an anti-TAT antibody, TAT binding oligopeptide or TAT
binding organic molecule according to the methods of the present
invention, the patient shows observable and/or measurable reduction
in or absence of one or more of the following: reduction in the
number of cancer cells or absence of the cancer cells; reduction in
the tumor size; inhibition (i.e., slow to some extent and
preferably stop) of cancer cell infiltration into peripheral organs
including the spread of cancer into soft tissue and bone;
inhibition (i.e., slow to some extent and preferably stop) of tumor
metastasis; inhibition, to some extent, of tumor growth; and/or
relief to some extent, one or more of the symptoms associated with
the specific cancer; reduced morbidity and mortality, and
improvement in quality of life issues. To the extent the anti-TAT
antibody or TAT binding oligopeptide may prevent growth and/or kill
existing cancer cells, it may be cytostatic and/or cytotoxic.
Reduction of these signs or symptoms may also be felt by the
patient.
[0686] The above parameters for assessing successful treatment and
improvement in the disease are readily measurable by routine
procedures familiar to a physician. For cancer therapy, efficacy
can be measured, for example, by assessing the time to disease
progression (TTP) and/or determining the response rate (RR).
Metastasis can be determined by staging tests and by bone scan and
tests for calcium level and other enzymes to determine spread to
the bone. CT scans can also be done to look for spread to the
pelvis and lymph nodes in the area. Chest X-rays and measurement of
liver enzyme levels by known methods are used to look for
metastasis to the lungs and liver, respectively. Other routine
methods for monitoring the disease include transrectal
ultrasonography (TRUS) and transrectal needle biopsy (TRNB).
[0687] For bladder cancer, which is a more localized cancer,
methods to determine progress of disease include urinary cytologic
evaluation by cystoscopy, monitoring for presence of blood in the
urine, visualization of the urothelial tract by sonography or an
intravenous pyelogram, computed tomography (CT) and magnetic
resonance imaging (MRI). The presence of distant metastases can be
assessed by CT of the abdomen, chest x-rays, or radionuclide
imaging of the skeleton.
[0688] "Chronic" administration refers to administration of the
agent(s) in a continuous mode as opposed to an acute mode, so as to
maintain the initial therapeutic effect (activity) for an extended
period of time. "Intermittent" administration is treatment that is
not consecutively done without interruption, but rather is cyclic
in nature.
[0689] "Mammal" for purposes of the treatment of, alleviating the
symptoms of or diagnosis of a cancer refers to any animal
classified as a mammal, including humans, domestic and farm
animals, and zoo, sports, or pet animals, such as dogs, cats,
cattle, horses, sheep, pigs, goats, rabbits, etc. Preferably, the
mammal is human.
[0690] Administration "in combination with" one or more further
therapeutic agents includes simultaneous (concurrent) and
consecutive administration in any order.
[0691] "Carriers" as used herein include pharmaceutically
acceptable carriers, excipients, or stabilizers which are nontoxic
to the cell or mammal being exposed thereto at the dosages and
concentrations employed. Often the physiologically acceptable
carrier is an aqueous pH buffered solution. Examples of
physiologically acceptable carriers include buffers such as
phosphate, citrate, and other organic acids; antioxidants including
ascorbic acid; low molecular weight (less than about 10 residues)
polypeptide; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids such as glycine, glutamine, asparagine, arginine or
lysine; monosaccharides, disaccharides, and other carbohydrates
including glucose, mannose, or dextrins; chelating agents such as
EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming
counterions such as sodium; and/or nonionic surfactants such as
TWEEN.RTM., polyethylene glycol (PEG), and PLURONICS.RTM..
[0692] By "solid phase" or "solid support" is meant a non-aqueous
matrix to which an antibody, TAT binding oligopeptide or TAT
binding organic molecule of the present invention can adhere or
attach. Examples of solid phases encompassed herein include those
formed partially or entirely of glass (e.g., controlled pore
glass), polysaccharides (e.g., agarose), polyacrylamides,
polystyrene, polyvinyl alcohol and silicones. In certain
embodiments, depending on the context, the solid phase can comprise
the well of an assay plate; in others it is a purification column
(e.g., an affinity chromatography column). This term also includes
a discontinuous solid phase of discrete particles, such as those
described in U.S. Pat. No. 4,275,149.
[0693] A "liposome" is a small vesicle composed of various types of
lipids, phospholipids and/or surfactant which is useful for
delivery of a drug (such as a TAT polypeptide, an antibody thereto
or a TAT binding oligopeptide) to a mammal. The components of the
liposome are commonly arranged in a bilayer formation, similar to
the lipid arrangement of biological membranes.
[0694] A "small" molecule or "small" organic molecule is defined
herein to have a molecular weight below about 500 Daltons.
[0695] An "effective amount" of a polypeptide, antibody, TAT
binding oligopeptide, TAT binding organic molecule or an agonist or
antagonist thereof as disclosed herein is an amount sufficient to
carry out a specifically stated purpose. An "effective amount" may
be determined empirically and in a routine manner, in relation to
the stated purpose.
[0696] The term "therapeutically effective amount" refers to an
amount of an antibody, polypeptide, TAT binding oligopeptide, TAT
binding organic molecule or other drug effective to "treat" a
disease or disorder in a subject or mammal. In the case of cancer,
the therapeutically effective amount of the drug may reduce the
number of cancer cells; reduce the tumor size; inhibit (i.e., slow
to some extent and preferably stop) cancer cell infiltration into
peripheral organs; inhibit (i.e., slow to some extent and
preferably stop) tumor metastasis; inhibit, to some extent, tumor
growth; and/or relieve to some extent one or more of the symptoms
associated with the cancer. See the definition herein of
"treating". To the extent the drug may prevent growth and/or kill
existing cancer cells, it may be cytostatic and/or cytotoxic.
[0697] A "growth inhibitory amount" of an anti-TAT antibody, TAT
polypeptide, TAT binding oligopeptide, TAT siRNA (such as a TAT188
siRNA) or TAT binding organic molecule is an amount capable of
inhibiting the growth of a cell, especially tumor, e.g., cancer
cell, either in vitro or in vivo. A "growth inhibitory amount" of
an anti-TAT antibody, TAT polypeptide, TAT binding oligopeptide,
TAT siRNA (such as a TAT188 siRNA) or TAT binding organic molecule
for purposes of inhibiting neoplastic cell growth may be determined
empirically and in a routine manner.
[0698] A "cytotoxic amount" of an anti-TAT antibody, TAT
polypeptide, TAT binding oligopeptid, TAT siRNA (such as a TAT188
siRNA) e or TAT binding organic molecule is an amount capable of
causing the destruction of a cell, especially tumor, e.g., cancer
cell, either in vitro or in vivo. A "cytotoxic amount" of an
anti-TAT antibody, TAT polypeptide, TAT binding oligopeptide, TAT
siRNA (such as a TAT188 siRNA) or TAT binding organic molecule for
purposes of inhibiting neoplastic cell growth may be determined
empirically and in a routine manner.
[0699] The term "antibody" is used in the broadest sense and
specifically covers, for example, single anti-TAT monoclonal
antibodies (including agonist, antagonist, and neutralizing
antibodies), anti-TAT antibody compositions with polyepitopic
specificity, polyclonal antibodies, single chain anti-TAT
antibodies, and fragments of anti-TAT antibodies (see below) as
long as they exhibit the desired biological or immunological
activity. The term "immunoglobulin" (Ig) is used interchangeable
with antibody herein.
[0700] An "isolated antibody" is one which has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials which would interfere with diagnostic or therapeutic uses
for the antibody, and may include enzymes, hormones, and other
proteinaceous or nonproteinaceous solutes. In preferred
embodiments, the antibody will be purified (1) to greater than 95%
by weight of antibody as determined by the Lowry method, and most
preferably more than 99% by weight, (2) to a degree sufficient to
obtain at least 15 residues of N-terminal or internal amino acid
sequence by use of a spinning cup sequenator, or (3) to homogeneity
by SDS-PAGE under reducing or nonreducing conditions using
Coomassie blue or, preferably, silver stain. Isolated antibody
includes the antibody in situ within recombinant cells since at
least one component of the antibody's natural environment will not
be present. Ordinarily, however, isolated antibody will be prepared
by at least one purification step.
[0701] The basic 4-chain antibody unit is a heterotetrameric
glycoprotein composed of two identical light (L) chains and two
identical heavy (H) chains (an IgM antibody consists of 5 of the
basic heterotetramer unit along with an additional polypeptide
called J chain, and therefore contain 10 antigen binding sites,
while secreted IgA antibodies can polymerize to form polyvalent
assemblages comprising 2-5 of the basic 4-chain units along with J
chain). In the case of IgGs, the 4-chain unit is generally about
150,000 daltons. Each L chain is linked to a H chain by one
covalent disulfide bond, while the two H chains are linked to each
other by one or more disulfide bonds depending on the H chain
isotype. Each H and L chain also has regularly spaced intrachain
disulfide bridges. Each H chain has at the N-terminus, a variable
domain (V.sub.H) followed by three constant domains (C.sub.H) for
each of the .alpha. and .gamma. chains and four C.sub.H domains for
.mu. and .epsilon. isotypes. Each L chain has at the N-terminus, a
variable domain (V.sub.L) followed by a constant domain (C.sub.L)
at its other end. The V.sub.L is aligned with the V.sub.H and the
C.sub.L is aligned with the first constant domain of the heavy
chain (C.sub.H1). Particular amino acid residues are believed to
form an interface between the light chain and heavy chain variable
domains. The pairing of a V.sub.H and V.sub.L together forms a
single antigen-binding site. For the structure and properties of
the different classes of antibodies, see, e.g., Basic and Clinical
Immunology, 8th edition, Daniel P. Stites, Abba I. Ten and Tristram
G. Parslow (eds.), Appleton & Lange, Norwalk, Conn., 1994, page
71 and Chapter 6.
[0702] The L chain from any vertebrate species can be assigned to
one of two clearly distinct types, called kappa and lambda, based
on the amino acid sequences of their constant domains. Depending on
the amino acid sequence of the constant domain of their heavy
chains (C.sub.H), immunoglobulins can be assigned to different
classes or isotypes. There are five classes of immunoglobulins:
IgA, IgD, IgE, IgG, and IgM, having heavy chains designated
.alpha., .delta., .epsilon., .gamma., and .mu. respectively. The
.gamma. and .alpha. classes are further divided into subclasses on
the basis of relatively minor differences in C.sub.H sequence and
function, e.g., humans express the following subclasses: IgG1,
IgG2, IgG3, IgG4, IgA1, and IgA2.
[0703] The term "variable" refers to the fact that certain segments
of the variable domains differ extensively in sequence among
antibodies. The V domain mediates antigen binding and define
specificity of a particular antibody for its particular antigen.
However, the variability is not evenly distributed across the
110-amino acid span of the variable domains. Instead, the V regions
consist of relatively invariant stretches called framework regions
(FRs) of 15-30 amino acids separated by shorter regions of extreme
variability called "hypervariable regions" that are each 9-12 amino
acids long. The variable domains of native heavy and light chains
each comprise four FRs, largely adopting a .beta.-sheet
configuration, connected by three hypervariable regions, which form
loops connecting, and in some cases forming part of, the
.beta.-sheet structure. The hypervariable regions in each chain are
held together in close proximity by the FRs and, with the
hypervariable regions from the other chain, contribute to the
formation of the antigen-binding site of antibodies (see Kabat et
al., Sequences of Proteins of Immunological Interest, 5th Ed.
Public Health Service, National Institutes of Health, Bethesda, Md.
(1991)). The constant domains are not involved directly in binding
an antibody to an antigen, but exhibit various effector functions,
such as participation of the antibody in antibody dependent
cellular cytotoxicity (ADCC).
[0704] The term "hypervariable region" when used herein refers to
the amino acid residues of an antibody which are responsible for
antigen-binding. The hypervariable region (HVR) generally comprises
amino acid residues from a "complementarity determining region" or
"CDR" (e.g. around about residues 24-34 (L1), 50-56 (L2) and 89-97
(L3) in the V.sub.L, and around about 1-35 (H1), 50-65 (H2) and
95-102 (H3) in the V.sub.H; Kabat et al., Sequences of Proteins of
Immunological Interest, 5th Ed. Public Health Service, National
Institutes of Health, Bethesda, Md. (1991)) and/or those residues
from a "hypervariable loop" (e.g. residues 26-32 (L1), 50-52 (L2)
and 91-96 (L3) in the V.sub.L, and 26-32 (H1), 53-55 (H2) and
96-101 (H3) in the V.sub.H; Chothia and Lesk J. Mol. Biol.
196:901-917 (1987)). The HVRs are also defined as encompassing the
sequences as disclosed in U.S. Application Ser. No. 60/545,840,
filed Feb. 19, 2004, incorporated herein by reference in its
entirety, wherein extended HVRs include some of the amino acid
sequence positions within the variable regions that are defined as
being in contact with a bound ligand of the antibody based on an
analysis of complex crystal structures. As used herein the terms
"HVR" and "CDR" are used interchangeably to encompass the extend
HVRs defined as follows.
[0705] The term "hypervariable region" when used herein refers to
the regions of an antibody variable domain which are hypervariable
in sequence and/or form structurally defined loops. Generally,
antibodies comprise six hypervariable regions; three in the VH (H1,
H2, H3), and three in the VL (L1, L2, L3). A number of
hypervariable region delineations are in use and are encompassed
herein. The Kabat Complementarity Determining Regions (CDRs) are
based on sequence variability and are the most commonly used (Kabat
et al., Sequences of Proteins of Immunological Interest, 5th Ed.
Public Health Service, National Institutes of Health, Bethesda, Md.
(1991)). Chothia refers instead to the location of the structural
loops (Chothia and Lesk J. Mol. Biol. 196:901-917 (1987)). The AbM
hypervariable regions represent a compromise between the Kabat CDRs
and Chothia structural loops, and are used by Oxford Molecular's
AbM antibody modeling software. The "contact" hypervariable regions
are based on an analysis of the available complex crystal
structures. The residues from each of these hypervariable regions
are noted below.
TABLE-US-00001 TABLE HVR Loop Kabat AbM Chothia Contact L1 L24-L34
L24-L34 L26-L32 L30-L36 L2 L50-L56 L50-L56 L50-L52 L46-L55 L3
L89-L97 L89-L97 L91-L96 L89-L96 H1 H31-H35B H26-H35B H26- H30-H35B
(Kabat H32 . . . 34 Numbering) H1 H31-H35 H26-H35 H26-H32 H30-H35
(Chothia Numbering) H2 H50-H65 H50-H58 H53-H55 H47-H58 H3 H95-H102
H95-H102 H96-H101 H93-H101
[0706] Hypervariable regions may comprise "extended hypervariable
regions" as follows: 24-34 (L1), 50-56 (L2) and 89-97 (L3) in the
VL and 26-35 (H1), 50-65 or 49-65 (H2) and 93-102, 94-102 or 95-102
(H3) in the VH. The variable domain residues are numbered according
to Kabat et al., supra for each of these definitions.
[0707] "Framework" or "FR" residues are those variable domain
residues other than the hypervariable region residues as herein
defined.
[0708] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigenic site. Furthermore, in contrast to polyclonal antibody
preparations which include different antibodies directed against
different determinants (epitopes), each monoclonal antibody is
directed against a single determinant on the antigen. In addition
to their specificity, the monoclonal antibodies are advantageous in
that they may be synthesized uncontaminated by other antibodies.
The modifier "monoclonal" is not to be construed as requiring
production of the antibody by any particular method. For example,
the monoclonal antibodies useful in the present invention may be
prepared by the hybridoma methodology first described by Kohler et
al., Nature, 256:495 (1975), or may be made using recombinant DNA
methods in bacterial, eukaryotic animal or plant cells (see, e.g.,
U.S. Pat. No. 4,816,567). The "monoclonal antibodies" may also be
isolated from phage antibody libraries using the techniques
described in Clackson et al., Nature, 352:624-628 (1991) and Marks
et al., J. Mol. Biol., 222:581-597 (1991), for example.
[0709] The monoclonal antibodies herein include "chimeric"
antibodies in which a portion of the heavy and/or light chain is
identical with or homologous to corresponding sequences in
antibodies derived from a particular species or belonging to a
particular antibody class or subclass, while the remainder of the
chain(s) is identical with or homologous to corresponding sequences
in antibodies derived from another species or belonging to another
antibody class or subclass, as well as fragments of such
antibodies, so long as they exhibit the desired biological activity
(see U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl.
Acad. Sci. USA, 81:6851-6855 (1984)). Chimeric antibodies of
interest herein include "primatized" antibodies comprising variable
domain antigen-binding sequences derived from a non-human primate
(e.g. Old World Monkey, Ape etc), and human constant region
sequences.
[0710] An "intact" antibody is one which comprises an
antigen-binding site as well as a C.sub.L and at least heavy chain
constant domains, C.sub.H1, C.sub.H2 and C.sub.H3. The constant
domains may be native sequence constant domains (e.g. human native
sequence constant domains) or amino acid sequence variant thereof.
Preferably, the intact antibody has one or more effector
functions.
[0711] "Antibody fragments" comprise a portion of an intact
antibody, preferably the antigen binding or variable region of the
intact antibody. Examples of antibody fragments include Fab, Fab',
F(ab').sub.2, and Fv fragments; diabodies; linear antibodies (see
U.S. Pat. No. 5,641,870, Example 2; Zapata et al., Protein Eng.
8(10): 1057-1062 [1995]); single-chain antibody molecules; and
multispecific antibodies formed from antibody fragments.
[0712] Papain digestion of antibodies produces two identical
antigen-binding fragments, called "Fab" fragments, and a residual
"Fc" fragment, a designation reflecting the ability to crystallize
readily. The Fab fragment consists of an entire L chain along with
the variable region domain of the H chain (V.sub.H), and the first
constant domain of one heavy chain (C.sub.H1). Each Fab fragment is
monovalent with respect to antigen binding, i.e., it has a single
antigen-binding site. Pepsin treatment of an antibody yields a
single large F(ab').sub.2 fragment which roughly corresponds to two
disulfide linked Fab fragments having divalent antigen-binding
activity and is still capable of cross-linking antigen. Fab'
fragments differ from Fab fragments by having additional few
residues at the carboxy terminus of the C.sub.H1 domain including
one or more cysteines from the antibody hinge region. Fab'-SH is
the designation herein for Fab' in which the cysteine residue(s) of
the constant domains bear a free thiol group. F(ab').sub.2 antibody
fragments originally were produced as pairs of Fab' fragments which
have hinge cysteines between them. Other chemical couplings of
antibody fragments are also known.
[0713] The Fc fragment comprises the carboxy-terminal portions of
both H chains held together by disulfides. The effector functions
of antibodies are determined by sequences in the Fc region, which
region is also the part recognized by Fc receptors (FcR) found on
certain types of cells.
[0714] "Fv" is the minimum antibody fragment which contains a
complete antigen-recognition and -binding site. This fragment
consists of a dimer of one heavy- and one light-chain variable
region domain in tight, non-covalent association. From the folding
of these two domains emanate six hypervariable loops (3 loops each
from the H and L chain) that contribute the amino acid residues for
antigen binding and confer antigen binding specificity to the
antibody. However, even a single variable domain (or half of an Fv
comprising only three CDRs specific for an antigen) has the ability
to recognize and bind antigen, although at a lower affinity than
the entire binding site.
[0715] "Single-chain Fv" also abbreviated as "sFv" or "scFv" are
antibody fragments that comprise the V.sub.H and V.sub.L antibody
domains connected into a single polypeptide chain. Preferably, the
sFv polypeptide further comprises a polypeptide linker between the
V.sub.H and V.sub.L domains which enables the sFv to form the
desired structure for antigen binding. For a review of sFv, see
Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113,
Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315
(1994); Borrebaeck 1995, infra
[0716] The term "diabodies" refers to small antibody fragments
prepared by constructing sFv fragments (see preceding paragraph)
with short linkers (about 5-10 residues) between the V.sub.H and
V.sub.L domains such that inter-chain but not intra-chain pairing
of the V domains is achieved, resulting in a bivalent fragment,
i.e., fragment having two antigen-binding sites. Bispecific
diabodies are heterodimers of two "crossover" sFv fragments in
which the V.sub.H and V.sub.L domains of the two antibodies are
present on different polypeptide chains. Diabodies are described
more fully in, for example, EP 404,097; WO 93/11161; and Hollinger
et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).
[0717] "Humanized" forms of non-human (e.g., rodent) antibodies are
chimeric antibodies that contain minimal sequence derived from the
non-human antibody. For the most part, humanized antibodies are
human immunoglobulins (recipient antibody) in which residues from a
hypervariable region of the recipient are replaced by residues from
a hypervariable region of a non-human species (donor antibody) such
as mouse, rat, rabbit or non-human primate having the desired
antibody specificity, affinity, and capability. In some instances,
framework region (FR) residues of the human immunoglobulin are
replaced by corresponding non-human residues. Furthermore,
humanized antibodies may comprise residues that are not found in
the recipient antibody or in the donor antibody. These
modifications are made to further refine antibody performance. In
general, the humanized antibody will comprise substantially all of
at least one, and typically two, variable domains, in which all or
substantially all of the hypervariable loops correspond to those of
a non-human immunoglobulin and all or substantially all of the FRs
are those of a human immunoglobulin sequence. The humanized
antibody optionally also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin. For further details, see Jones et al., Nature
321:522-525 (1986); Riechmann et al., Nature 332:323-329 (1988);
and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992).
[0718] A "species-dependent antibody," e.g., a mammalian anti-human
IgE antibody, is an antibody which has a stronger binding affinity
for an antigen from a first mammalian species than it has for a
homologue of that antigen from a second mammalian species.
Normally, the species-dependent antibody "bind specifically" to a
human antigen (i.e., has a binding affinity (Kd) value of no more
than about 1.times.10.sup.-7 M, preferably no more than about
1.times.10.sup.-8 and most preferably no more than about
1.times.10.sup.-9 M) but has a binding affinity for a homologue of
the antigen from a second non-human mammalian species which is at
least about 50 fold, or at least about 500 fold, or at least about
1000 fold, weaker than its binding affinity for the human antigen.
The species-dependent antibody can be of any of the various types
of antibodies as defined above, but preferably is a humanized or
human antibody.
[0719] A "TAT binding oligopeptide" is an oligopeptide that binds,
preferably specifically, to a TAT polypeptide as described herein.
TAT binding oligopeptides may be chemically synthesized using known
oligopeptide synthesis methodology or may be prepared and purified
using recombinant technology. TAT binding oligopeptides are usually
at least about 5 amino acids in length, alternatively at least
about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55,
56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72,
73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89,
90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 amino acids in
length or more, wherein such oligopeptides that are capable of
binding, preferably specifically, to a TAT polypeptide as described
herein. TAT binding oligopeptides may be identified without undue
experimentation using well known techniques. In this regard, it is
noted that techniques for screening oligopeptide libraries for
oligopeptides that are capable of specifically binding to a
polypeptide target are well known in the art (see, e.g., U.S. Pat.
Nos. 5,556,762, 5,750,373, 4,708,871, 4,833,092, 5,223,409,
5,403,484, 5,571,689, 5,663,143; PCT Publication Nos. WO 84/03506
and WO84/03564; Geysen et al., Proc. Natl. Acad. Sci. U.S.A.,
81:3998-4002 (1984); Geysen et al., Proc. Natl. Acad. Sci. U.S.A.,
82:178-182 (1985); Geysen et al., in Synthetic Peptides as
Antigens, 130-149 (1986); Geysen et al., J. Immunol. Meth.,
102:259-274 (1987); Schoofs et al., J. Immunol., 140:611-616
(1988), Cwirla, S. E. et al. (1990) Proc. Natl. Acad. Sci. USA,
87:6378; Lowman, H. B. et al. (1991) Biochemistry, 30:10832;
Clackson, T. et al. (1991) Nature, 352: 624; Marks, J. D. et al.
(1991), J. Mol. Biol., 222:581; Kang, A. S. et al. (1991) Proc.
Natl. Acad. Sci. USA, 88:8363, and Smith, G. P. (1991) Current
Opin. Biotechnol., 2:668).
[0720] A "TAT binding organic molecule" is an organic molecule
other than an oligopeptide or antibody as defined herein that
binds, preferably specifically, to a TAT polypeptide as described
herein. TAT binding organic molecules may be identified and
chemically synthesized using known methodology (see, e.g., PCT
Publication Nos. WO00/00823 and WO00/39585). TAT binding organic
molecules are usually less than about 2000 daltons in size,
alternatively less than about 1500, 750, 500, 250 or 200 daltons in
size, wherein such organic molecules that are capable of binding,
preferably specifically, to a TAT polypeptide as described herein
may be identified without undue experimentation using well known
techniques. In this regard, it is noted that techniques for
screening organic molecule libraries for molecules that are capable
of binding to a polypeptide target are well known in the art (see,
e.g., PCT Publication Nos. WO00/00823 and WO00/39585).
[0721] An "interfering RNA" or "small interfering RNA (siRNA)" is a
double stranded RNA molecule less than 30 nucleotides in length
that reduces expression of a target gene. A "TAT interfering RNA"
or "TAT siRNA" binds, preferably specifically, to a TAT nucleic
acid and reduces its expression. This means the expression of the
TAT molecule is lower with the interfering RNA present as compared
to expression of the TAT molecule in the control where the
interfering RNA is not present. TAT interfering RNAs may be
identified and synthesized using known methods (Shi Y., Trends in
Genetics 19(1):9-12 (2003), WO/2003056012 and WO2003064621).
[0722] An antibody, oligopeptide, siRNA or other organic molecule
"which binds" an antigen of interest, e.g. a tumor-associated
polypeptide antigen target, is one that binds the antigen with
sufficient affinity such that the antibody, oligopeptide or other
organic molecule is useful as a diagnostic and/or therapeutic agent
in targeting a cell or tissue expressing the antigen, and does not
significantly cross-react with other proteins. In such embodiments,
the extent of binding of the antibody, oligopeptide, siRNA or other
organic molecule to a "non-target" protein will be less than about
10% of the binding of the antibody, oligopeptide, siRNA or other
organic molecule to its particular target protein as determined by
fluorescence activated cell sorting (FACS) analysis or
radioimmunoprecipitation (RIA). With regard to the binding of an
antibody, oligopeptide or other organic molecule to a target
molecule, the term "specific binding" or "specifically binds to" or
is "specific for" a particular polypeptide or an epitope on a
particular polypeptide target means binding that is measurably
different from a non-specific interaction. Specific binding can be
measured, for example, by determining binding of a molecule
compared to binding of a control molecule, which generally is a
molecule of similar structure that does not have binding activity.
For example, specific binding can be determined by competition with
a control molecule that is similar to the target, for example, an
excess of non-labeled target. In this case, specific binding is
indicated if the binding of the labeled target to a probe is
competitively inhibited by excess unlabeled target. The term
"specific binding" or "specifically binds to" or is "specific for"
a particular polypeptide or an epitope on a particular polypeptide
target as used herein can be exhibited, for example, by a molecule
having a Kd for the target of at least about 10.sup.-4 M,
alternatively at least about 10.sup.-5 M, alternatively at least
about 10.sup.-6 M, alternatively at least about 10.sup.-7 M,
alternatively at least about 10.sup.-8 M, alternatively at least
about 10.sup.-9 M, alternatively at least about 10.sup.-10 M,
alternatively at least about 10.sup.-11 M, alternatively at least
about 10.sup.-12 M, or greater. In one embodiment, the term
"specific binding" refers to binding where a molecule binds to a
particular polypeptide or epitope on a particular polypeptide
without substantially binding to any other polypeptide or
polypeptide epitope.
[0723] An antibody, oligopeptide, siRNA or other organic molecule
that "inhibits the growth of tumor cells expressing a TAT
polypeptide" or a "growth inhibitory" antibody, oligopeptide or
other organic molecule is one which results in measurable growth
inhibition of cancer cells expressing or overexpressing the
appropriate TAT polypeptide. The TAT polypeptide may be a
transmembrane polypeptide expressed on the surface of a cancer cell
or may be a polypeptide that is produced and secreted by a cancer
cell. Preferred growth inhibitory anti-TAT antibodies,
oligopeptides or organic molecules inhibit growth of TAT-expressing
tumor cells by greater than 20%, preferably from about 20% to about
50%, and even more preferably, by greater than 50% (e.g., from
about 50% to about 100%) as compared to the appropriate control,
the control typically being tumor cells not treated with the
antibody, oligopeptide or other organic molecule being tested. In
one embodiment, growth inhibition can be measured at an antibody
concentration of about 0.1 to 30 .mu.g/ml or about 0.5 nM to 200 nM
in cell culture, where the growth inhibition is determined 1-10
days after exposure of the tumor cells to the antibody. Growth
inhibition of tumor cells in vivo can be determined in various ways
such as is described in the Experimental Examples section below.
The antibody is growth inhibitory in vivo if administration of the
anti-TAT antibody at about 1 .mu.g/kg to about 100 mg/kg body
weight results in reduction in tumor size or tumor cell
proliferation within about 5 days to 3 months from the first
administration of the antibody, preferably within about 5 to 30
days.
[0724] An antibody, oligopeptide, siRNA or other organic molecule
which "induces apoptosis" is one which induces programmed cell
death as determined by binding of annexin V, fragmentation of DNA,
cell shrinkage, dilation of endoplasmic reticulum, cell
fragmentation, and/or formation of membrane vesicles (called
apoptotic bodies). The cell is usually one which overexpresses a
TAT polypeptide. Preferably the cell is a tumor cell, e.g., a
prostate, breast, ovarian, stomach, endometrial, lung, kidney,
colon, colorectal, bladder cell. Various methods are available for
evaluating the cellular events associated with apoptosis. For
example, phosphatidyl serine (PS) translocation can be measured by
annexin binding; DNA fragmentation can be evaluated through DNA
laddering; and nuclear/chromatin condensation along with DNA
fragmentation can be evaluated by any increase in hypodiploid
cells. Preferably, the antibody, oligopeptide or other organic
molecule which induces apoptosis is one which results in about 2 to
50 fold, preferably about 5 to 50 fold, and most preferably about
10 to 50 fold, induction of annexin binding relative to untreated
cell in an annexin binding assay.
[0725] Antibody "effector functions" refer to those biological
activities attributable to the Fc region (a native sequence Fc
region or amino acid sequence variant Fc region) of an antibody,
and vary with the antibody isotype. Examples of antibody effector
functions include: C1q binding and complement dependent
cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated
cytotoxicity (ADCC); phagocytosis; down regulation of cell surface
receptors (e.g., B cell receptor); and B cell activation.
[0726] "Antibody-dependent cell-mediated cytotoxicity" or "ADCC"
refers to a form of cytotoxicity in which secreted Ig bound onto Fc
receptors (FcRs) present on certain cytotoxic cells (e.g., Natural
Killer (NK) cells, neutrophils, and macrophages) enable these
cytotoxic effector cells to bind specifically to an antigen-bearing
target cell and subsequently kill the target cell with cytotoxins.
The antibodies "arm" the cytotoxic cells and are absolutely
required for such killing. The primary cells for mediating ADCC, NK
cells, express Fc.gamma.RIII only, whereas monocytes express
Fc.gamma.RI, Fc.gamma.RII and Fc.gamma.RIII. FcR expression on
hematopoietic cells is summarized in Table 3 on page 464 of Ravetch
and Kinet, Annu. Rev. Immunol. 9:457-92 (1991). To assess ADCC
activity of a molecule of interest, an in vitro ADCC assay, such as
that described in U.S. Pat. No. 5,500,362 or 5,821,337 may be
performed. Useful effector cells for such assays include peripheral
blood mononuclear cells (PBMC) and Natural Killer (NK) cells.
Alternatively, or additionally, ADCC activity of the molecule of
interest may be assessed in vivo, e.g., in a animal model such as
that disclosed in Clynes et al. (USA) 95:652-656 (1998).
[0727] "Fc receptor" or "FcR" describes a receptor that binds to
the Fc region of an antibody. The preferred FcR is a native
sequence human FcR. Moreover, a preferred FcR is one which binds an
IgG antibody (a gamma receptor) and includes receptors of the
Fc.gamma.RI, Fc.gamma.RII and Fc.gamma.RIII subclasses, including
allelic variants and alternatively spliced forms of these
receptors. Fc.gamma.RII receptors include Fc.gamma.RIIA (an
"activating receptor") and Fc.gamma.RIIB (an "inhibiting
receptor"), which have similar amino acid sequences that differ
primarily in the cytoplasmic domains thereof. Activating receptor
Fc.gamma.RIIA contains an immunoreceptor tyrosine-based activation
motif (ITAM) in its cytoplasmic domain Inhibiting receptor
Fc.gamma.RIIB contains an immunoreceptor tyrosine-based inhibition
motif (ITIM) in its cytoplasmic domain. (see review M. in Daeron,
Annu. Rev. Immunol. 15:203-234 (1997)). FcRs are reviewed in
Ravetch and Kinet, Annu. Rev. Immunol. 9:457-492 (1991); Capel et
al., Immunomethods 4:25-34 (1994); and de Haas et al., J. Lab.
Clin. Med. 126:330-41 (1995). Other FcRs, including those to be
identified in the future, are encompassed by the term "FcR" herein.
The term also includes the neonatal receptor, FcRn, which is
responsible for the transfer of maternal IgGs to the fetus (Guyer
et al., J. Immunol. 117:587 (1976) and Kim et al., J. Immunol.
24:249 (1994)).
[0728] "Human effector cells" are leukocytes which express one or
more FcRs and perform effector functions. Preferably, the cells
express at least Fc (RIII and perform ADCC effector function.
Examples of human leukocytes which mediate ADCC include peripheral
blood mononuclear cells (PBMC), natural killer (NK) cells,
monocytes, cytotoxic T cells and neutrophils; with PBMCs and NK
cells being preferred. The effector cells may be isolated from a
native source, e.g., from blood.
[0729] "Complement dependent cytotoxicity" or "CDC" refers to the
lysis of a target cell in the presence of complement. Activation of
the classical complement pathway is initiated by the binding of the
first component of the complement system (C1q) to antibodies (of
the appropriate subclass) which are bound to their cognate antigen.
To assess complement activation, a CDC assay, e.g., as described in
Gazzano-Santoro et al., J. Immunol. Methods 202:163 (1996), may be
performed.
[0730] The terms "cancer" and "cancerous" refer to or describe the
physiological condition in mammals that is typically characterized
by unregulated cell growth. Examples of cancer include, but are not
limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or
lymphoid malignancies. More particular examples of such cancers
include squamous cell cancer (e.g., epithelial squamous cell
cancer), lung cancer including small-cell lung cancer, non-small
cell lung cancer, adenocarcinoma of the lung and squamous carcinoma
of the lung, cancer of the peritoneum, hepatocellular cancer,
gastric or stomach cancer including gastrointestinal cancer,
pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer,
liver cancer, bladder cancer, cancer of the urinary tract,
hepatoma, breast cancer, colon cancer, rectal cancer, colorectal
cancer, endometrial or uterine carcinoma, salivary gland carcinoma,
kidney or renal cancer, prostate cancer, vulval cancer, thyroid
cancer, hepatic carcinoma, anal carcinoma, penile carcinoma,
melanoma, multiple myeloma and B-cell lymphoma, brain, as well as
head and neck cancer, and associated metastases.
[0731] The terms "cell proliferative disorder" and "proliferative
disorder" refer to disorders that are associated with some degree
of abnormal cell proliferation. In one embodiment, the cell
proliferative disorder is cancer.
[0732] "Tumor", as used herein, refers to all neoplastic cell
growth and proliferation, whether malignant or benign, and all
pre-cancerous and cancerous cells and tissues.
[0733] An antibody, oligopeptide or other organic molecule which
"induces cell death" is one which causes a viable cell to become
nonviable. The cell is one which expresses a TAT polypeptide,
preferably a cell that overexpresses a TAT polypeptide as compared
to a normal cell of the same tissue type. The TAT polypeptide may
be a transmembrane polypeptide expressed on the surface of a cancer
cell or may be a polypeptide that is produced and secreted by a
cancer cell. Preferably, the cell is a cancer cell, e.g., a breast,
ovarian, stomach, endometrial, salivary gland, lung, kidney, colon,
colorectal, thyroid, pancreatic or bladder cell. Cell death in
vitro may be determined in the absence of complement and immune
effector cells to distinguish cell death induced by
antibody-dependent cell-mediated cytotoxicity (ADCC) or complement
dependent cytotoxicity (CDC). Thus, the assay for cell death may be
performed using heat inactivated serum (i.e., in the absence of
complement) and in the absence of immune effector cells. To
determine whether the antibody, oligopeptide or other organic
molecule is able to induce cell death, loss of membrane integrity
as evaluated by uptake of propidium iodide (PI), trypan blue (see
Moore et al. Cytotechnology 17:1-11 (1995)) or 7AAD can be assessed
relative to untreated cells. Preferred cell death-inducing
antibodies, oligopeptides or other organic molecules are those
which induce PI uptake in the PI uptake assay in BT474 cells.
[0734] A "TAT-expressing cell" is a cell which expresses an
endogenous or transfected TAT polypeptide either on the cell
surface or in a secreted form. A "TAT-expressing cancer" is a
cancer comprising cells that have a TAT polypeptide present on the
cell surface or that produce and secrete a TAT polypeptide. A
"TAT-expressing cancer" optionally produces sufficient levels of
TAT polypeptide on the surface of cells thereof, such that an
anti-TAT antibody, oligopeptide ot other organic molecule can bind
thereto and have a therapeutic effect with respect to the cancer.
In another embodiment, a "TAT-expressing cancer" optionally
produces and secretes sufficient levels of TAT polypeptide, such
that an anti-TAT antibody, oligopeptide ot other organic molecule
antagonist can bind thereto and have a therapeutic effect with
respect to the cancer. With regard to the latter, the antagonist
may be an antisense oligonucleotide which reduces, inhibits or
prevents production and secretion of the secreted TAT polypeptide
by tumor cells. A cancer which "overexpresses" a TAT polypeptide is
one which has significantly higher levels of TAT polypeptide at the
cell surface thereof, or produces and secretes, compared to a
noncancerous cell of the same tissue type. Such overexpression may
be caused by gene amplification or by increased transcription or
translation. TAT polypeptide overexpression may be determined in a
diagnostic or prognostic assay by evaluating increased levels of
the TAT protein present on the surface of a cell, or secreted by
the cell (e.g., via an immunohistochemistry assay using anti-TAT
antibodies prepared against an isolated TAT polypeptide which may
be prepared using recombinant DNA technology from an isolated
nucleic acid encoding the TAT polypeptide; FACS analysis, etc.).
Alternatively, or additionally, one may measure levels of TAT
polypeptide-encoding nucleic acid or mRNA in the cell, e.g., via
fluorescent in situ hybridization using a nucleic acid based probe
corresponding to a TAT-encoding nucleic acid or the complement
thereof; (FISH; see WO98/45479 published October, 1998), Southern
blotting, Northern blotting, or polymerase chain reaction (PCR)
techniques, such as real time quantitative PCR(RT-PCR). One may
also study TAT polypeptide overexpression by measuring shed antigen
in a biological fluid such as serum, e.g., using antibody-based
assays (see also, e.g., U.S. Pat. No. 4,933,294 issued Jun. 12,
1990; WO91/05264 published Apr. 18, 1991; U.S. Pat. No. 5,401,638
issued Mar. 28, 1995; and Sias et al., J. Immunol. Methods
132:73-80 (1990)). Aside from the above assays, various in vivo
assays are available to the skilled practitioner. For example, one
may expose cells within the body of the patient to an antibody
which is optionally labeled with a detectable label, e.g., a
radioactive isotope, and binding of the antibody to cells in the
patient can be evaluated, e.g., by external scanning for
radioactivity or by analyzing a biopsy taken from a patient
previously exposed to the antibody.
[0735] As used herein, the term "immunoadhesin" designates
antibody-like molecules which combine the binding specificity of a
heterologous protein (an "adhesin") with the effector functions of
immunoglobulin constant domains. Structurally, the immunoadhesins
comprise a fusion of an amino acid sequence with the desired
binding specificity which is other than the antigen recognition and
binding site of an antibody (i.e., is "heterologous"), and an
immunoglobulin constant domain sequence. The adhesin part of an
immunoadhesin molecule typically is a contiguous amino acid
sequence comprising at least the binding site of a receptor or a
ligand. The immunoglobulin constant domain sequence in the
immunoadhesin may be obtained from any immunoglobulin, such as
IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and
IgA-2), IgE, IgD or IgM.
[0736] The word "label" when used herein refers to a detectable
compound or composition which is conjugated directly or indirectly
to the antibody, oligopeptide or other organic molecule so as to
generate a "labeled" antibody, oligopeptide or other organic
molecule. The label may be detectable by itself (e.g. radioisotope
labels or fluorescent labels) or, in the case of an enzymatic
label, may catalyze chemical alteration of a substrate compound or
composition which is detectable.
[0737] The term "cytotoxic agent" as used herein refers to a
substance that inhibits or prevents the function of cells and/or
causes destruction of cells. The term is intended to include
radioactive isotopes (e.g., At.sup.211, I.sup.131, I.sup.125,
Y.sup.90, Re.sup.186, Re.sup.188, Sm.sup.153, Bi.sup.212, P.sup.32
and radioactive isotopes of Lu), chemotherapeutic agents e.g.
methotrexate, adriamicin, vinca alkaloids (vincristine,
vinblastine, etoposide), doxorubicin, melphalan, mitomycin C,
chlorambucil, daunorubicin or other intercalating agents, enzymes
and fragments thereof such as nucleolytic enzymes, antibiotics, and
toxins such as small molecule toxins or enzymatically active toxins
of bacterial, fungal, plant or animal origin, including fragments
and/or variants thereof, and the various antitumor or anticancer
agents disclosed below. Other cytotoxic agents are described below.
A tumoricidal agent causes destruction of tumor cells. Cytotoxins
may be covalently attached to an antibody to target the toxin to a
particular cell of interest which expresses the antigen. Useful
cytotoxins are their linker include, without limitation, the
following:
[0738] Linkers:
MC=maleimidocaproyl Val Cit=valine-citrulline, dipeptide site in
protease cleavable linker. Citrulline=2-amino-5-ureido pentanoic
acid PAB=.rho.-aminobenzylcarbamoyl ("self immolative" portion of
linker) Me=N-methyl-valine citrulline where the linker peptide bond
has been modified to prevent its cleavage by cathepsin B MC
(PEG)6-OH=maleimidocaproyl-polyethylene glycol, attached to
antibody cysteines. SPP.dbd.N-Succinimidyl 4-(2-pyridylthio)
pentanoate SMCC.dbd.N-Succinimidyl
4-(N-maleimidomethyl)cyclohexane-1 carboxylate
[0739] Cytotoxic Drugs:
MMAE=mono-methyl auristatin E (MW 718) MMAF=variant of auristatin E
(MMAE) with a phenylalanine at the C-terminus of the drug (MW
731.5) AEVB=auristatin E valeryl benzylhydrazone, acid labile
linker through the C-terminus of AE (MW 732) AFP=Auristatin F
phenylene diamine; (the phenylalanine variant linked to the
antibody through the C-terminus via a phenylene diamine spacer) (MW
732).
[0740] A "growth inhibitory agent" when used herein refers to a
compound or composition which inhibits growth of a cell, especially
a TAT-expressing cancer cell, either in vitro or in vivo. Thus, the
growth inhibitory agent may be one which significantly reduces the
percentage of TAT-expressing cells in S phase. Examples of growth
inhibitory agents include agents that block cell cycle progression
(at a place other than S phase), such as agents that induce G1
arrest and M-phase arrest. Classical M-phase blockers include the
vincas (vincristine and vinblastine), taxanes, and topoisomerase II
inhibitors such as doxorubicin, epirubicin, daunorubicin,
etoposide, and bleomycin. Those agents that arrest G1 also spill
over into S-phase arrest, for example, DNA alkylating agents such
as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin,
methotrexate, 5-fluorouracil, and ara-C. Further information can be
found in The Molecular Basis of Cancer, Mendelsohn and Israel,
eds., Chapter 1, entitled "Cell cycle regulation, oncogenes, and
antineoplastic drugs" by Murakami et al. (W B Saunders:
Philadelphia, 1995), especially p. 13. The taxanes (paclitaxel and
docetaxel) are anticancer drugs both derived from the yew tree.
Docetaxel (TAXOTERE.RTM., Rhone-Poulenc Rorer), derived from the
European yew, is a semisynthetic analogue of paclitaxel
(TAXOL.RTM., Bristol-Myers Squibb). Paclitaxel and docetaxel
promote the assembly of microtubules from tubulin dimers and
stabilize microtubules by preventing depolymerization, which
results in the inhibition of mitosis in cells.
[0741] "Doxorubicin" is an anthracycline antibiotic. The full
chemical name of doxorubicin is
(8S-cis)-10-[(3-amino-2,3,6-trideoxy-''-L-lyxo-hexapyranosyl)oxy]-7,8,9,1-
0-tetrahydro-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy-5,12-naphthacen-
edione.
[0742] The term "cytokine" is a generic term for proteins released
by one cell population which act on another cell as intercellular
mediators. Examples of such cytokines are lymphokines, monokines,
and traditional polypeptide hormones. Included among the cytokines
are growth hormone such as human growth hormone, N-methionyl human
growth hormone, and bovine growth hormone; parathyroid hormone;
thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein
hormones such as follicle stimulating hormone (FSH), thyroid
stimulating hormone (TSH), and luteinizing hormone (LH); hepatic
growth factor; fibroblast growth factor; prolactin; placental
lactogen; tumor necrosis factor .alpha. and .beta.;
mullerian-inhibiting substance; mouse gonadotropin-associated
peptide; inhibin; activin; vascular endothelial growth factor;
integrin; thrombopoietin (TPO); nerve growth factors such as
NGF-.beta.; platelet-growth factor; transforming growth factors
(TGFs) such as TGF.alpha. and TGF.beta.; insulin-like growth
factor-I and -II; erythropoietin (EPO); osteoinductive factors;
interferons such as interferon .alpha., .beta., and .gamma.; colony
stimulating factors (CSFs) such as macrophage-CSF (M-CSF);
granulocyte-macrophage-CSF (GM-CSF); and granulocyte-CSF (G-CSF);
interleukins (ILs) such as IL-1, IL-1a, IL-2, IL-3, IL-4, IL-5,
IL-6, IL-7, IL-8, IL-9, IL-11, IL-12; a tumor necrosis factor such
as TNF.alpha. or TNF-.beta.; and other polypeptide factors
including LIF and kit ligand (KL). As used herein, the term
cytokine includes proteins from natural sources or from recombinant
cell culture and biologically active equivalents of the native
sequence cytokines
[0743] The term "package insert" is used to refer to instructions
customarily included in commercial packages of therapeutic
products, that contain information about the indications, usage,
dosage, administration, contraindications and/or warnings
concerning the use of such therapeutic products.
TABLE-US-00002 TABLE 1 /* * * C-C increased from 12 to 15 * Z is
average of EQ * B is average of ND * match with stop is _M;
stop-stop = 0; J (joker) match = 0 */ #define _M -8 /* value of a
match with a stop */ int _day[26][26] = { /* A B C D E F G H I J K
L M N O P Q R S T U V W X Y Z */ /* A */ { 2, 0,-2, 0, 0,-4,
1,-1,-1, 0,-1,-2,-1, 0,_M, 1, 0,-2, 1, 1, 0, 0,-6, 0,-3, 0}, /* B
*/ { 0, 3,-4, 3, 2,-5, 0, 1,-2, 0, 0,-3,-2, 2,_M,-1, 1, 0, 0, 0,
0,-2,-5, 0,-3, 1}, /* C */ {-2,-4,15,-5,-5,-4,-3,-3,-2,
0,-5,-6,-5,-4,_M,-3,-5,-4, 0,-2, 0,-2,-8, 0, 0,-5}, /* D */ { 0,
3,-5, 4, 3,-6, 1, 1,-2, 0, 0,-4,-3, 2,_M,-1, 2,-1, 0, 0, 0,-2,-7,
0,-4, 2}, /* E */ { 0, 2,-5, 3, 4,-5, 0, 1,-2, 0, 0,-3,-2, 1,_M,-1,
2,-1, 0, 0, 0,-2,-7, 0,-4, 3}, /* F */ {-4,-5,-4,-6,-5, 9,-5,-2, 1,
0,-5, 2, 0,-4,_M,-5,-5,-4,-3,-3, 0,-1, 0, 0, 7,-5}, /* G */ { 1,
0,-3, 1, 0,-5, 5,-2,-3, 0,-2,-4,-3, 0,_M,-1,-1,-3, 1, 0, 0,-1,-7,
0,-5, 0}, /* H */ { -1, 1,-3, 1, 1,-2,-2, 6,-2, 0, 0,-2,-2, 2,_M,
0, 3, 2,-1,-1, 0,-2,-3, 0, 0, 2}, /* I */ {-1,-2,-2,-2,-2, 1,-3,-2,
5, 0,-2, 2, 2,-2,_M,-2,-2,-2,-1, 0, 0, 4,-5, 0,-1,-2}, /* J */ { 0,
0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,_M, 0, 0, 0, 0, 0, 0, 0, 0,
0, 0, 0}, /* K */ {-1, 0,-5, 0, 0,-5,-2, 0,-2, 0, 5,-3, 0, 1,_M,-1,
1, 3, 0, 0, 0,-2,-3, 0,-4, 0}, /* L */ {-2,-3,-6,-4,-3, 2,-4,-2, 2,
0,-3, 6, 4,-3,_M,-3,-2,-3,-3,-1, 0, 2,-2, 0,-1,-2}, /* M */
{-1,-2,-5,-3,-2, 0,-3,-2, 2, 0, 0, 4, 6,-2,_M,-2,-1, 0,-2,-1, 0,
2,-4, 0,-2,-1}, /* N */ { 0, 2,-4, 2, 1,-4, 0, 2,-2, 0, 1,-3,-2,
2,_M,-1, 1, 0, 1, 0, 0,-2,-4, 0,-2, 1}, /* O */
{_M,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M,
0,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M}, /* P */ { 1,-1,-3,-1,-1,-5,-1,
0,-2, 0,-1,-3,-2,-1,_M, 6, 0, 0, 1, 0, 0,-1,-6, 0,-5, 0}, /* Q */ {
0, 1,-5, 2, 2,-5,-1, 3,-2, 0, 1,-2,-1, 1,_M, 0, 4, 1,-1,-1,
0,-2,-5, 0,-4, 3}, /* R */ {-2, 0,-4,-1,-1,-4,-3, 2,-2, 0, 3,-3, 0,
0,_M, 0, 1, 6, 0,-1, 0,-2, 2, 0,-4, 0}, /* S */ { 1, 0, 0, 0, 0,-3,
1,-1,-1, 0, 0,-3,-2, 1,_M, 1,-1, 0, 2, 1, 0,-1,-2, 0,-3, 0}, /* T
*/ { 1, 0,-2, 0, 0,-3, 0,-1, 0, 0, 0,-1,-1, 0,_M, 0,-1,-1, 1, 3, 0,
0,-5, 0,-3, 0}, /* U */ { 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
0,_M, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, /* V */ {
0,-2,-2,-2,-2,-1,-1,-2, 4, 0,-2, 2, 2,-2,_M,-1,-2,-2,-1, 0, 0,
4,-6, 0,-2,-2}, /* W */ {-6,-5,-8,-7,-7, 0,-7,-3,-5,
0,-3,-2,-4,-4,_M,-6,-5, 2,-2,-5, 0,-6,17, 0, 0,-6}, /* X */ { 0, 0,
0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,_M, 0, 0, 0, 0, 0, 0, 0, 0, 0,
0, 0}, /* Y */ {-3,-3, 0,-4,-4, 7,-5, 0,-1,
0,-4,-1,-2,-2,_M,-5,-4,-4,-3,-3, 0,-2, 0, 0,10,-4}, /* Z */ { 0,
1,-5, 2, 3,-5, 0, 2,-2, 0, 0,-2,-1, 1,_M, 0, 3, 0, 0, 0, 0,-2,-6,
0,-4, 4} }; /* */ #include <stdio.h> #include <ctype.h>
#define MAXJMP 16 /* max jumps in a diag */ #define MAXGAP 24 /*
don't continue to penalize gaps larger than this */ #define JMPS
1024 /* max jmps in an path */ #define MX 4 /* save if there's at
least MX-1 bases since last jmp */ #define DMAT 3 /* value of
matching bases */ #define DMIS 0 /* penalty for mismatched bases */
#define DINS0 8 /* penalty for a gap */ #define DINS1 1 /* penalty
per base */ #define PINS0 8 /* penalty for a gap */ #define PINS1 4
/* penalty per residue */ struct jmp { short n[MAXJMP]; /* size of
jmp (neg for dely) */ unsigned short x[MAXJMP]; /* base no. of jmp
in seq x */ }; /* limits seq to 2{circumflex over ( )}16 -1 */
struct diag { int score; /* score at last jmp */ long offset; /*
offset of prev block */ short ijmp; /* current jmp index */ struct
jmp jp; /* list of jmps */ }; struct path { int spc; /* number of
leading spaces */ short n[JMPS]; /* size of jmp (gap) */ int
x[JMPS]; /* loc of jmp (last elem before gap) */ }; char *ofile; /*
output file name */ char *namex[2]; /* seq names: getseqs( ) */
char *prog; /* prog name for err msgs */ char *seqx[2]; /* seqs:
getseqs( ) */ int dmax; /* best diag: nw( ) */ int dmax0; /* final
diag */ int dna; /* set if dna: main( ) */ int endgaps; /* set if
penalizing end gaps */ int gapx, gapy; /* total gaps in seqs */ int
len0, len1; /* seq lens */ int ngapx, ngapy; /* total size of gaps
*/ int smax; /* max score: nw( ) */ int *xbm; /* bitmap for
matching */ long offset; /* current offset in jmp file */ struct
diag *dx; /* holds diagonals */ struct path pp[2]; /* holds path
for seqs */ char *calloc( ), *malloc( ), *index( ), *strcpy( );
char *getseq( ), *g_calloc( ); /* Needleman-Wunsch alignment
program * * usage: progs file1 file2 * where file1 and file2 are
two dna or two protein sequences. * The sequences can be in upper-
or lower-case an may contain ambiguity * Any lines beginning with
`;`, `>` or `<` are ignored * Max file length is 65535
(limited by unsigned short x in the jmp struct) * A sequence with
1/3 or more of its elements ACGTU is assumed to be DNA * Output is
in the file "align.out" * * The program may create a tmp file in
/tmp to hold info about traceback. * Original version developed
under BSD 4.3 on a vax 8650 */ #include "nw.h" #include "day.h"
static _dbval[26] = {
1,14,2,13,0,0,4,11,0,0,12,0,3,15,0,0,0,5,6,8,8,7,9,0,10,0 }; static
_pbval[26] = { 1, 2|(1<<(`D`-`A`))|(1<<(`N`-`A`)), 4,
8, 16, 32, 64, 128, 256, 0xFFFFFFF, 1<<10, 1<<11,
1<<12, 1<<13, 1<<14, 1<<15, 1<<16,
1<<17, 1<<18, 1<<19, 1<<20, 1<<21,
1<<22, 1<<23, 1<<24,
1<<25|(1<<(`E`-`A`))|(1<<(`Q`-`A`)) }; main(ac,
av) main int ac; char *av[ ]; { prog = av[0]; if (ac != 3) {
fprintf(stderr,"usage: %s file1 file2\n", prog);
fprintf(stderr,"where file1 and file2 are two dna or two protein
sequences.\n"); fprintf(stderr,"The sequences can be in upper- or
lower-case\n"); fprintf(stderr,"Any lines beginning with `;` or
`<` are ignored\n"); fprintf(stderr,"Output is in the file
\"align.out\"\n"); exit(1); } namex[0] = av[1]; namex[1] = av[2];
seqx[0] = getseq(namex[0], &len0); seqx[1] = getseq(namex[1],
&len1); xbm = (dna)? _dbval : _pbval; endgaps = 0; /* 1 to
penalize endgaps */ ofile = "align.out"; /* output file */ nw( );
/* fill in the matrix, get the possible jmps */ readjmps( ); /* get
the actual jmps */ print( ); /* print stats, alignment */
cleanup(0); /* unlink any tmp files */ } /* do the alignment,
return best score: main( ) * dna: values in Fitch and Smith, PNAS,
80, 1382-1386, 1983 * pro: PAM 250 values * When scores are equal,
we prefer mismatches to any gap, prefer * a new gap to extending an
ongoing gap, and prefer a gap in seqx * to a gap in seq y. */ nw( )
nw { char *px, *py; /* seqs and ptrs */ int *ndely, *dely; /* keep
track of dely */ int ndelx, delx; /* keep track of delx */ int
*tmp; /* for swapping row0, row1 */ int mis; /* score for each type
*/ int ins0, ins1; /* insertion penalties */ register id; /*
diagonal index */ register ij; /* jmp index */ register *col0,
*col1; /* score for curr, last row */ register xx, yy; /* index
into seqs */ dx = (struct diag *)g_calloc("to get diags",
len0+len1+1, sizeof(struct diag)); ndely = (int *)g_calloc("to get
ndely", len1+1, sizeof(int)); dely = (int *)g_calloc("to get dely",
len1+1, sizeof(int)); col0 = (int *)g_calloc("to get col0", len1+1,
sizeof(int)); col1 = (int *)g_calloc("to get col1", len1+1,
sizeof(int)); ins0 = (dna)? DINS0 : PINS0; ins1 = (dna)? DINS1 :
PINS1; smax = -10000; if (endgaps) { for (col0[0] = dely[0] =
-ins0, yy = 1; yy <= len1; yy++) { col0[yy] = dely[yy] =
col0[yy-1] - ins1; ndely[yy] = yy; } col0[0] = 0; /* Waterman Bull
Math Biol 84 */ } else for (yy = 1; yy <= len1; yy++) dely[yy] =
-ins0; /* fill in match matrix */ for (px = seqx[0], xx = 1; xx
<= len0; px++, xx++) { /* initialize first entry in col */ if
(endgaps) { if (xx == 1) col1[0] = delx = -(ins0+ins1); else
col1[0] = delx = col0[0] - ins1; ndelx = xx; } else { col1[0] = 0;
delx = -ins0; ndelx = 0; } ...nw for (py = seqx[1], yy = 1; yy
<= len1; py++, yy++) { mis = col0[yy-1]; if (dna) mis +=
(xbm[*px-`A`]&xbm[*py-`A`])? DMAT : DMIS; else mis +=
_day[*px-`A`][*py-`A`]; /* update penalty for del in x seq; * favor
new del over ongong del * ignore MAXGAP if weighting endgaps */ if
(endgaps || ndely[yy] < MAXGAP) { if (col0[yy] - ins0 >=
dely[yy]) { dely[yy] = col0[yy] - (ins0+ins1); ndely[yy] = 1; }
else { dely[yy] -= ins1; ndely[yy]++; } } else { if (col0[yy] -
(ins0+ins1) >= dely[yy]) { dely[yy] = col0[yy] - (ins0+ins1);
ndely[yy] = 1; } else ndely[yy]++; } /* update penalty for del in y
seq;
* favor new del over ongong del */ if (endgaps || ndelx <
MAXGAP) { if (col1[yy-1] - ins0 >= delx) { delx = col1[yy-1] -
(ins0+ins1); ndelx = 1; } else { delx -= ins1; ndelx++; } } else {
if (col1[yy-1] - (ins0+ins1) >= delx) { delx = col1[yy-1] -
(ins0+ins1); ndelx = 1; } else ndelx++; } /* pick the maximum
score; we're favoring * mis over any del and delx over dely */
...nw id = xx - yy + len1 - 1; if (mis >= delx && mis
>= dely[yy]) col1[yy] = mis; else if (delx >= dely[yy]) {
col1[yy] = delx; ij = dx[id].ijmp; if (dx[id].jp.n[0] &&
(!dna || (ndelx >= MAXJMP && xx > dx[id].jp.x[ij]+MX)
|| mis > dx[id].score+DINS0)) { dx[id].ijmp++; if (++ij >=
MAXJMP) { writejmps(id); ij = dx[id].ijmp = 0; dx[id].offset =
offset; offset += sizeof(struct jmp) + sizeof(offset); } }
dx[id].jp.n[ij] = ndelx; dx[id].jp.x[ij] = xx; dx[id].score = delx;
} else { col1[yy] = dely[yy]; ij = dx[id].ijmp; if (dx[id].jp.n[0]
&& (!dna || (ndely[yy] >= MAXJMP && xx >
dx[id].jp.x[ij]+MX) || mis > dx[id].score+DINS0)) {
dx[id].ijmp++; if (++ij >= MAXJMP) { writejmps(id); ij =
dx[id].ijmp = 0; dx[id].offset = offset; offset += sizeof(struct
jmp) + sizeof(offset); } } dx[id].jp.n[ij] = -ndely[yy];
dx[id].jp.x[ij] = xx; dx[id].score = dely[yy]; } if (xx == len0
&& yy < len1) { /* last col */ if (endgaps) col1[yy] -=
ins0+ins1*(len1-yy); if (col1[yy] > smax) { smax = col1[yy];
dmax = id; } } } if (endgaps && xx < len0) col1[yy-1] -=
ins0+ins1*(len0-xx); if (col1[yy-1] > smax) { smax = col1[yy-1];
dmax = id; } tmp = col0; col0 = col1; col1 = tmp; } (void)
free((char *)ndely); (void) free((char *)dely); (void) free((char
*)col0); (void) free((char *)col1); } /* * * print( ) -- only
routine visible outside this module * * static: * getmat( ) --
trace back best path, count matches: print( ) * pr_align( ) --
print alignment of described in array p[ ]: print( ) * dumpblock( )
-- dump a block of lines with numbers, stars: pr_align( ) * nums( )
-- put out a number line: dumpblock( ) * putline( ) -- put out a
line (name, [num], seq, [num]): dumpblock( ) * stars( ) - -put a
line of stars: dumpblock( ) * stripname( ) -- strip any path and
prefix from a seqname */ #include "nw.h" #define SPC 3 #define
P_LINE 256 /* maximum output line */ #define P_SPC 3 /* space
between name or num and seq */ extern _day[26][26]; int olen; /*
set output line length */ FILE *fx; /* output file */ print( )
print { int lx, ly, firstgap, lastgap; /* overlap */ if ((fx =
fopen(ofile, "w")) == 0) { fprintf(stderr, "%s: can't write %s\n",
prog, ofile); cleanup(1); } fprintf(fx, "<first sequence: %s
(length = %d)\n", namex[0], len0); fprintf(fx, "<second
sequence: %s (length = %d)\n", namex[1], len1); olen = 60; lx =
len0; ly = len1; firstgap = lastgap = 0; if (dmax < len1 - 1) {
/* leading gap in x */ pp[0].spc = firstgap = len1 - dmax - 1; ly
-= pp[0].spc; } else if (dmax > len1 - 1) { /* leading gap in y
*/ pp[1].spc = firstgap = dmax - (len1 - 1); lx -= pp[1].spc; } if
(dmax0 < len0 - 1) { /* trailing gap in x */ lastgap = len0 -
dmax0 -1; lx -= lastgap; } else if (dmax0 > len0 - 1) { /*
trailing gap in y */ lastgap = dmax0 - (len0 - 1); ly -= lastgap; }
getmat(lx, ly, firstgap, lastgap); pr_align( ); } /* * trace back
the best path, count matches */ static getmat(lx, ly, firstgap,
lastgap) getmat int lx, ly; /* "core" (minus endgaps) */ int
firstgap, lastgap; /* leading trailing overlap */ { int nm, i0, i1,
siz0, siz1; char outx[32]; double pct; register n0, n1; register
char *p0, *p1; /* get total matches, score */ i0 = i1 = siz0 = siz1
= 0; p0 = seqx[0] + pp[1].spc; p1 = seqx[1] + pp[0].spc; n0 =
pp[1].spc + 1; n1 = pp[0].spc + 1; nm = 0; while ( *p0 &&
*p1 ) { if (siz0) { p1++; n1++; siz0--; } else if (siz1) { p0++;
n0++; siz1--; } else { if (xbm[*p0-`A`]&xbm[*p1-`A`]) nm++; if
(n0++ == pp[0].x[i0]) siz0 = pp[0].n[i0++]; if (n1++ ==
pp[1].x[i1]) siz1 = pp[1].n[i1++]; p0++; p1++; } } /* pct homology:
* if penalizing endgaps, base is the shorter seq * else, knock off
overhangs and take shorter core */ if (endgaps) lx = (len0 <
len1)? len0 : len1; else lx = (lx < ly)? lx : ly; pct =
100.*(double)nm/(double)lx; fprintf(fx, "\n"); fprintf(fx, "<%d
match%s in an overlap of %d: %.2f percent similarity\n", nm, (nm ==
1)? "" : "es", lx, pct); fprintf(fx, "<gaps in first sequence:
%d", gapx); ...getmat if (gapx) { (void) sprintf(outx, " (%d
%s%s)", ngapx, (dna)? "base":"residue", (ngapx == 1)? "":"s");
fprintf(fx,"%s", outx); fprintf(fx, ", gaps in second sequence:
%d", gapy); if (gapy) { (void) sprintf(outx, " (%d %s%s)", ngapy,
(dna)? "base":"residue", (ngapy == 1)? "":"s"); fprintf(fx,"%s",
outx); } if (dna) fprintf(fx, "\n<score: %d (match = %d,
mismatch = %d, gap penalty = %d + %d per base)\n", smax, DMAT,
DMIS, DINS0, DINS1); else fprintf(fx, "\n<score: %d (Dayhoff PAM
250 matrix, gap penalty = %d + %d per residue)\n", smax, PINS0,
PINS1); if (endgaps) fprintf(fx, "<endgaps penalized. left
endgap: %d %s%s, right endgap: %d %s%s\n", firstgap, (dna)? "base"
: "residue", (firstgap == 1)? "" : "s", lastgap, (dna)? "base" :
"residue", (lastgap == 1)? "" : "s"); else fprintf(fx, "<endgaps
not penalized\n"); } static nm; /* matches in core -- for checking
*/ static lmax; /* lengths of stripped file names */ static ij[2];
/* jmp index for a path */ static nc[2]; /* number at start of
current line */ static ni[2]; /* current elem number -- for gapping
*/ static siz[2]; static char *ps[2]; /* ptr to current element */
static char *po[2]; /* ptr to next output char slot */ static char
out[2][P_LINE]; /* output line */ static char star[P_LINE]; /* set
by stars( ) */ /* * print alignment of described in struct path pp[
] */ static pr_align( ) pr_align { int nn; /* char count */ int
more; register i; for (i = 0, lmax = 0; i < 2; i++) { nn =
stripname(namex[i]); if (nn > lmax) lmax = nn; nc[i] = 1; ni[i]
= 1; siz[i] = ij[i] = 0; ps[i] = seqx[i]; po[i] = out[i]; } for (nn
= nm = 0, more = 1; more; ) { ...pr_align for (i = more = 0; i <
2; i++) { /*
* do we have more of this sequence? */ if (!*ps[i]) continue;
more++; if (pp[i].spc) { /* leading space */ *po[i]++ = ` `;
pp[i].spc--; } else if (siz[i]) { /* in a gap */ *po[i]++ = `-`;
siz[i]--; } else { /* we're putting a seq element */ *po[i] =
*ps[i]; if (islower(*ps[i])) *ps[i] = toupper(*ps[i]); po[i]++;
ps[i]++; /* * are we at next gap for this seq? */ if (ni[i] ==
pp[i].x[ij[i]]) { /* * we need to merge all gaps * at this location
*/ siz[i] = pp[i].n[ij[i]++]; while (ni[i] == pp[i].x[ij[i]])
siz[i] += pp[i].n[ij[i]++]; } ni[i]++; } } if (++nn == olen ||
!more && nn) { dumpblock( ); for (i = 0; i < 2; i++)
po[i] = out[i]; nn = 0; } } } /* * dump a block of lines, including
numbers, stars: pr_align( ) */ static dumpblock( ) dumpblock {
register i; for (i = 0; i < 2; i++) *po[i]-- = `\0`;
...dumpblock (void) putc(`\n`, fx); for (i = 0; i < 2; i++) { if
(*out[i] && (*out[i] != ` ` || *(po[i]) != ` `)) { if (i ==
0) nums(i); if (i == 0 && *out[1]) stars( ); putline(i); if
(i == 0 && *out[1]) fprintf(fx, star); if (i == 1) nums(i);
} } } /* * put out a number line: dumpblock( ) */ static nums(ix)
nums int ix; /* index in out[ ] holding seq line */ { char
nline[P_LINE]; register i, j; register char *pn, *px, *py; for (pn
= nline, i = 0; i < lmax+P_SPC; i++, pn++) *pn = ` `; for (i =
nc[ix], py = out[ix]; *py; py++, pn++) { if (*py == ` ` || *py ==
`-`) *pn = ` `; else { if (i%10 == 0 || (i == 1 && nc[ix]
!= 1)) { j = (i < 0)? -i : i; for (px = pn; j; j /= 10, px--)
*px = j%10 + `0`; if (i < 0) *px = `-`; } else *pn = ` `; i++; }
} *pn = `\0`; nc[ix] = i; for (pn = nline; *pn; pn++) (void)
putc(*pn, fx); (void) putc(`\n`, fx); } /* * put out a line (name,
[num], seq, [num]): dumpblock( ) */ static putline(ix) putline int
ix; { ...putline int i; register char *px; for (px = namex[ix], i =
0; *px && *px != `:`; px++, i++) (void) putc(*px, fx); for
(; i < lmax+P_SPC; i++) (void) putc(` `, fx); /* these count
from 1: * ni[ ] is current element (from 1) * nc[ ] is number at
start of current line */ for (px = out[ix]; *px; px++) (void)
putc(*px&0x7F, fx); (void) putc(`\n`, fx); } /* * put a line of
stars (seqs always in out[0], out[1]): dumpblock( ) */ static
stars( ) stars { int i; register char *p0, *p1, cx, *px; if
(!*out[0] || (*out[0] == ` ` && *(po[0]) == ` `) ||
!*out[1] || (*out[1] == ` ` && *(po[1]) == ` `)) return; px
= star; for (i = lmax+P_SPC; i; i--) *px++ = ` `; for (p0 = out[0],
p1 = out[1]; *p0 && *p1; p0++, p1++) { if (isalpha(*p0)
&& isalpha(*p1)) { if (xbm[*p0-`A`]&xbm[*p1-`A`]) { cx
= `*`; nm++; } else if (!dna && _day[*p0-`A`][*p1-`A`] >
0) cx = `.`; else cx = ` `; } else cx = ` `; *px++ = cx; } *px++ =
`\n`; *px = `\0`; } /* * strip path or prefix from pn, return len:
pr_align( ) */ static stripname(pn) stripname char *pn; /* file
name (may be path) */ { register char *px, *py; py = 0; for (px =
pn; *px; px++) if (*px == `/`) py = px + 1; if (py) (void)
strcpy(pn, py); return(strlen(pn)); } /* * cleanup( ) -- cleanup
any tmp file * getseq( ) -- read in seq, set dna, len, maxlen *
g_calloc( ) -- calloc( ) with error checkin * readjmps( ) -- get
the good jmps, from tmp file if necessary * writejmps( ) -- write a
filled array of jmps to a tmp file: nw( ) */ #include "nw.h"
#include <sys/file.h> char *jname = "/tmp/homgXXXXXX"; /* tmp
file for jmps */ FILE *fj; int cleanup( ); /* cleanup tmp file */
long lseek( ); /* * remove any tmp file if we blow */ cleanup(i)
cleanup int i; { if (fj) (void) unlink(jname); exit(i); } /* *
read, return ptr to seq, set dna, len, maxlen * skip lines starting
with `;`, `<`, or `>` * seq in upper or lower case */ char *
getseq(file, len) getseq char *file; /* file name */ int *len; /*
seq len */ { char line[1024], *pseq; register char *px, *py; int
natgc, tlen; FILE *fp; if ((fp = fopen(file,"r")) == 0) {
fprintf(stderr,"%s: can't read %s\n", prog, file); exit(1); } tlen
= natgc = 0; while (fgets(line, 1024, fp)) { if (*line == `;` ||
*line == `<` || *line == `>`) continue; for (px = line; *px
!= `\n`; px++) if (isupper(*px) || islower(*px)) tlen++; } if
((pseq = malloc((unsigned)(tlen+6))) == 0) { fprintf(stderr,"%s:
malloc( ) failed to get %d bytes for %s\n", prog, tlen+6, file);
exit(1); } pseq[0] = pseq[1] = pseq[2] = pseq[3] = `\0`; ...getseq
py = pseq + 4; *len = tlen; rewind(fp); while (fgets(line, 1024,
fp)) { if (*line == `;` || *line == `<` || *line == `>`)
continue; for (px = line; *px != `\n`; px++) { if (isupper(*px))
*py++ = *px; else if (islower(*px)) *py++ = toupper(*px); if
(index("ATGCU",*(py-1))) natgc++; } } *py++ = `\0`; *py = `\0`;
(void) fclose(fp); dna = natgc > (tlen/3); return(pseq+4); }
char * g_calloc(msg, nx, sz) g_calloc char *msg; /* program,
calling routine */
int nx, sz; /* number and size of elements */ { char *px, *calloc(
); if ((px = calloc((unsigned)nx, (unsigned)sz)) == 0) { if (*msg)
{ fprintf(stderr, "%s: g_calloc( ) failed %s (n=%d, sz=%d)\n",
prog, msg, nx, sz); exit(1); } } return(px); } /* * get final jmps
from dx[ ] or tmp file, set pp[ ], reset dmax: main( ) */ readjmps(
) readjmps { int fd = -1; int siz, i0, i1; register i, j, xx; if
(fj) { (void) fclose(fj); if ((fd = open(jname, O_RDONLY, 0)) <
0) { fprintf(stderr, "%s: can't open( ) %s\n", prog, jname);
cleanup(1); } } for (i = i0 = i1 = 0, dmax0 = dmax, xx = len0; ;
i++) { while (1) { for (j = dx[dmax].ijmp; j >= 0 &&
dx[dmax].jp.x[j] >= xx; j--) ; ...readjmps if (j < 0
&& dx[dmax].offset && fj) { (void) lseek(fd,
dx[dmax].offset, 0); (void) read(fd, (char *)&dx[dmax].jp,
sizeof(struct jmp)); (void) read(fd, (char *)&dx[dmax].offset,
sizeof(dx[dmax].offset)); dx[dmax].ijmp = MAXJMP-1; } else break; }
if (i >= JMPS) { fprintf(stderr, "%s: too many gaps in
alignment\n", prog); cleanup(1); } if (j >= 0) { siz =
dx[dmax].jp.n[j]; xx = dx[dmax].jp.x[j]; dmax += siz; if (siz <
0) { /* gap in second seq */ pp[1].n[i1] = -siz; xx += siz; /* id =
xx - yy + len1 - 1 */ pp[1].x[i1] = xx - dmax + len1 - 1; gapy++;
ngapy -= siz; /* ignore MAXGAP when doing endgaps */ siz = (-siz
< MAXGAP || endgaps)? -siz : MAXGAP; i1++; } else if (siz >
0) { /* gap in first seq */ pp[0].n[i0] = siz; pp[0].x[i0] = xx;
gapx++; ngapx += siz; /* ignore MAXGAP when doing endgaps */ siz =
(siz < MAXGAP || endgaps)? siz : MAXGAP; i0++; } } else break; }
/* reverse the order of jmps */ for (j = 0, i0--; j < i0; j++,
i0--) { i = pp[0].n[j]; pp[0].n[j] = pp[0].n[i0]; pp[0].n[i0] = i;
i = pp[0].x[j]; pp[0].x[j] = pp[0].x[i0]; pp[0].x[i0] = i; } for (j
= 0, i1--; j < i1; j++, i1--) { i = pp[1].n[j]; pp[1].n[j] =
pp[1].n[i1]; pp[1].n[i1] = i; i = pp[1].x[j]; pp[1].x[j] =
pp[1].x[i1]; pp[1].x[i1] = i; } if (fd >= 0) (void) close(fd);
if (fj) { (void) unlink(jname); fj = 0; offset = 0; } } /* * write
a filled jmp struct offset of the prev one (if any): nw( ) */
writejmps(ix) writejmps int ix; { char *mktemp( ); if (!fj) { if
(mktemp(jname) < 0) { fprintf(stderr, "%s: can't mktemp( )
%s\n", prog, jname); cleanup(1); } if ((fj = fopen(jname, "w")) ==
0) { fprintf(stderr, "%s: can't write %s\n", prog, jname); exit(1);
} } (void) fwrite((char *)&dx[ix].jp, sizeof(struct jmp), 1,
fj); (void) fwrite((char *)&dx[ix].offset,
sizeof(dx[ix].offset), 1, fj); }
TABLE-US-00003 TABLE 2 TAT XXXXXXXXXXXXXXX (Length = 15 amino
acids) Comparison XXXXXYYYYYYY (Length = 12 amino acids) Protein %
amino acid sequence identity = (the number of identically matching
amino acid residues between the two polypeptide sequences as
determined by ALIGN-2) divided by (the total number of amino acid
residues of the TAT polypeptide) = 5 divided by 15 = 33.3%
TABLE-US-00004 TABLE 3 TAT XXXXXXXXXX (Length = 10 amino acids)
Comparison XXXXXYYYYYYZZYZ (Length = 15 amino acids) Protein %
amino acid sequence identity = (the number of identically matching
amino acid residues between the two polypeptide sequences as
determined by ALIGN-2) divided by (the total number of amino acid
residues of the TAT polypeptide) = 5 divided by 10 = 50%
TABLE-US-00005 TABLE 4 TAT-DNA NNNNNNNNNNNNNN (Length = 14
nucleotides) Comparison NNNNNNLLLLLLLLLL (Length = 16 nucleotides)
DNA % nucleic acid sequence identity = (the number of identically
matching nucleotides between the two nucleic acid sequences as
determined by ALIGN-2) divided by (the total number of nucleotides
of the TAT-DNA nucleic acid sequence) = 6 divided by 14 = 42.9%
TABLE-US-00006 TABLE 5 TAT-DNA NNNNNNNNNNNN (Length = 12
nucleotides) Comparison DNA NNNNLLLVV (Length = 9 nucleotides) %
nucleic acid sequence identity = (the number of identically
matching nucleotides between the two nucleic acid sequences as
determined by ALIGN-2) divided by (the total number of nucleotides
of the TAT-DNA nucleic acid sequence) = 4 divided by 12 = 33.3%
II. Compositions and Methods of the Invention
[0744] A. Anti-TAT Antibodies
[0745] In one embodiment, the present invention provides anti-TAT
antibodies which may find use herein as therapeutic and/or
diagnostic agents. Exemplary antibodies include polyclonal,
monoclonal, humanized, bispecific, and heteroconjugate
antibodies.
[0746] 1. Polyclonal Antibodies
[0747] Polyclonal antibodies are preferably raised in animals by
multiple subcutaneous (sc) or intraperitoneal (ip) injections of
the relevant antigen and an adjuvant. It may be useful to conjugate
the relevant antigen (especially when synthetic peptides are used)
to a protein that is immunogenic in the species to be immunized.
For example, the antigen can be conjugated to keyhole limpet
hemocyanin (KLH), serum albumin, bovine thyroglobulin, or soybean
trypsin inhibitor, using a bifunctional or derivatizing agent,
e.g., maleimidobenzoyl sulfosuccinimide ester (conjugation through
cysteine residues), N-hydroxysuccinimide (through lysine residues),
glutaraldehyde, succinic anhydride, SOCl.sub.2, or
R.sup.1N.dbd.C.dbd.NR, where R and R.sup.1 are different alkyl
groups.
[0748] Animals are immunized against the antigen, immunogenic
conjugates, or derivatives by combining, e.g., 100 .mu.g or 5 .mu.g
of the protein or conjugate (for rabbits or mice, respectively)
with 3 volumes of Freund's complete adjuvant and injecting the
solution intradermally at multiple sites. One month later, the
animals are boosted with 1/5 to 1/10 the original amount of peptide
or conjugate in Freund's complete adjuvant by subcutaneous
injection at multiple sites. Seven to 14 days later, the animals
are bled and the serum is assayed for antibody titer. Animals are
boosted until the titer plateaus. Conjugates also can be made in
recombinant cell culture as protein fusions. Also, aggregating
agents such as alum are suitably used to enhance the immune
response.
[0749] 2. Monoclonal Antibodies
[0750] Monoclonal antibodies may be made using the hybridoma method
first described by Kohler et al., Nature, 256:495 (1975), or may be
made by recombinant DNA methods (U.S. Pat. No. 4,816,567).
[0751] In the hybridoma method, a mouse or other appropriate host
animal, such as a hamster, is immunized as described above to
elicit lymphocytes that produce or are capable of producing
antibodies that will specifically bind to the protein used for
immunization. Alternatively, lymphocytes may be immunized in vitro.
After immunization, lymphocytes are isolated and then fused with a
myeloma cell line using a suitable fusing agent, such as
polyethylene glycol, to form a hybridoma cell (Goding, Monoclonal
Antibodies: Principles and Practice, pp. 59-103 (Academic Press,
1986)).
[0752] The hybridoma cells thus prepared are seeded and grown in a
suitable culture medium which medium preferably contains one or
more substances that inhibit the growth or survival of the unfused,
parental myeloma cells (also referred to as fusion partner). For
example, if the parental myeloma cells lack the enzyme hypoxanthine
guanine phosphoribosyl transferase (HGPRT or HPRT), the selective
culture medium for the hybridomas typically will include
hypoxanthine, aminopterin, and thymidine (HAT medium), which
substances prevent the growth of HGPRT-deficient cells.
[0753] Preferred fusion partner myeloma cells are those that fuse
efficiently, support stable high-level production of antibody by
the selected antibody-producing cells, and are sensitive to a
selective medium that selects against the unfused parental cells.
Preferred myeloma cell lines are murine myeloma lines, such as
those derived from MOPC-21 and MPC-11 mouse tumors available from
the Salk Institute Cell Distribution Center, San Diego, Calif. USA,
and SP-2 and derivatives e.g., X63-Ag8-653 cells available from the
American Type Culture Collection, Manassas, Va., USA. Human myeloma
and mouse-human heteromyeloma cell lines also have been described
for the production of human monoclonal antibodies (Kozbor, J.
Immunol., 133:3001 (1984); and Brodeur et al., Monoclonal Antibody
Production Techniques and Applications, pp. 51-63 (Marcel Dekker,
Inc., New York, 1987)).
[0754] Culture medium in which hybridoma cells are growing is
assayed for production of monoclonal antibodies directed against
the antigen. Preferably, the binding specificity of monoclonal
antibodies produced by hybridoma cells is determined by
immunoprecipitation or by an in vitro binding assay, such as
radioimmunoassay (RIA) or enzyme-linked immunosorbent assay
(ELISA).
[0755] The binding affinity of the monoclonal antibody can, for
example, be determined by the Scatchard analysis described in
Munson et al., Anal. Biochem., 107:220 (1980).
[0756] Once hybridoma cells that produce antibodies of the desired
specificity, affinity, and/or activity are identified, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods (Goding, Monoclonal Antibodies: Principles and
Practice, pp. 59-103 (Academic Press, 1986)). Suitable culture
media for this purpose include, for example, D-MEM or RPMI-1640
medium. In addition, the hybridoma cells may be grown in vivo as
ascites tumors in an animal e.g., by i.p. injection of the cells
into mice.
[0757] The monoclonal antibodies secreted by the subclones are
suitably separated from the culture medium, ascites fluid, or serum
by conventional antibody purification procedures such as, for
example, affinity chromatography (e.g., using protein A or protein
G-Sepharose) or ion-exchange chromatography, hydroxylapatite
chromatography, gel electrophoresis, dialysis, etc.
[0758] DNA encoding the monoclonal antibodies is readily isolated
and sequenced using conventional procedures (e.g., by using
oligonucleotide probes that are capable of binding specifically to
genes encoding the heavy and light chains of murine antibodies).
The hybridoma cells serve as a preferred source of such DNA. Once
isolated, the DNA may be placed into expression vectors, which are
then transfected into host cells such as E. coli cells, simian COS
cells, Chinese Hamster Ovary (CHO) cells, or myeloma cells that do
not otherwise produce antibody protein, to obtain the synthesis of
monoclonal antibodies in the recombinant host cells. Review
articles on recombinant expression in bacteria of DNA encoding the
antibody include Skerra et al., Curr. Opinion in Immunol.,
5:256-262 (1993) and Pluckthun, Immunol. Revs. 130:151-188
(1992).
[0759] In a further embodiment, monoclonal antibodies or antibody
fragments can be isolated from antibody phage libraries generated
using the techniques described in McCafferty et al., Nature,
348:552-554 (1990). Clackson et al., Nature, 352:624-628 (1991) and
Marks et al., J. Mol. Biol., 222:581-597 (1991) describe the
isolation of murine and human antibodies, respectively, using phage
libraries. Subsequent publications describe the production of high
affinity (nM range) human antibodies by chain shuffling (Marks et
al., Bio/Technology, 10:779-783 (1992)), as well as combinatorial
infection and in vivo recombination as a strategy for constructing
very large phage libraries (Waterhouse et al., Nuc. Acids. Res.
21:2265-2266 (1993)). Thus, these techniques are viable
alternatives to traditional monoclonal antibody hybridoma
techniques for isolation of monoclonal antibodies.
[0760] The DNA that encodes the antibody may be modified to produce
chimeric or fusion antibody polypeptides, for example, by
substituting human heavy chain and light chain constant domain
(C.sub.H and C.sub.L) sequences for the homologous murine sequences
(U.S. Pat. No. 4,816,567; and Morrison, et al., Proc. Natl. Acad.
Sci. USA, 81:6851 (1984)), or by fusing the immunoglobulin coding
sequence with all or part of the coding sequence for a
non-immunoglobulin polypeptide (heterologous polypeptide). The
non-immunoglobulin polypeptide sequences can substitute for the
constant domains of an antibody, or they are substituted for the
variable domains of one antigen-combining site of an antibody to
create a chimeric bivalent antibody comprising one
antigen-combining site having specificity for an antigen and
another antigen-combining site having specificity for a different
antigen.
[0761] 3. Human and Humanized Antibodies
[0762] The anti-TAT antibodies of the invention may further
comprise humanized antibodies or human antibodies. Humanized forms
of non-human (e.g., murine) antibodies are chimeric
immunoglobulins, immunoglobulin chains or fragments thereof (such
as Fv, Fab, Fab', F(ab').sub.2 or other antigen-binding
subsequences of antibodies) which contain minimal sequence derived
from non-human immunoglobulin. Humanized antibodies include human
immunoglobulins (recipient antibody) in which residues from a
complementary determining region (CDR) of the recipient are
replaced by residues from a CDR of a non-human species (donor
antibody) such as mouse, rat or rabbit having the desired
specificity, affinity and capacity. In some instances, Fv framework
residues of the human immunoglobulin are replaced by corresponding
non-human residues. Humanized antibodies may also comprise residues
which are found neither in the recipient antibody nor in the
imported CDR or framework sequences. In general, the humanized
antibody will comprise substantially all of at least one, and
typically two, variable domains, in which all or substantially all
of the CDR regions correspond to those of a non-human
immunoglobulin and all or substantially all of the FR regions are
those of a human immunoglobulin consensus sequence. The humanized
antibody optimally also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann
et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct.
Biol., 2:593-596 (1992)].
[0763] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source which is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and co-workers [Jones et al.,
Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327
(1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by
substituting rodent CDRs or CDR sequences for the corresponding
sequences of a human antibody. Accordingly, such "humanized"
antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567),
wherein substantially less than an intact human variable domain has
been substituted by the corresponding sequence from a non-human
species. In practice, humanized antibodies are typically human
antibodies in which some CDR residues and possibly some FR residues
are substituted by residues from analogous sites in rodent
antibodies.
[0764] The choice of human variable domains, both light and heavy,
to be used in making the humanized antibodies is very important to
reduce antigenicity and HAMA response (human anti-mouse antibody)
when the antibody is intended for human therapeutic use. According
to the so-called "best-fit" method, the sequence of the variable
domain of a rodent antibody is screened against the entire library
of known human variable domain sequences. The human V domain
sequence which is closest to that of the rodent is identified and
the human framework region (FR) within it accepted for the
humanized antibody (Sims et al., J. Immunol. 151:2296 (1993);
Chothia et al., J. Mol. Biol., 196:901 (1987)). Another method uses
a particular framework region derived from the consensus sequence
of all human antibodies of a particular subgroup of light or heavy
chains. The same framework may be used for several different
humanized antibodies (Carter et al., Proc. Natl. Acad. Sci. USA,
89:4285 (1992); Presta et al., J. Immunol. 151:2623 (1993)).
[0765] It is further important that antibodies be humanized with
retention of high binding affinity for the antigen and other
favorable biological properties. To achieve this goal, according to
a preferred method, humanized antibodies are prepared by a process
of analysis of the parental sequences and various conceptual
humanized products using three-dimensional models of the parental
and humanized sequences. Three-dimensional immunoglobulin models
are commonly available and are familiar to those skilled in the
art. Computer programs are available which illustrate and display
probable three-dimensional conformational structures of selected
candidate immunoglobulin sequences. Inspection of these displays
permits analysis of the likely role of the residues in the
functioning of the candidate immunoglobulin sequence, i.e., the
analysis of residues that influence the ability of the candidate
immunoglobulin to bind its antigen. In this way, FR residues can be
selected and combined from the recipient and import sequences so
that the desired antibody characteristic, such as increased
affinity for the target antigen(s), is achieved. In general, the
hypervariable region residues are directly and most substantially
involved in influencing antigen binding.
[0766] Various forms of a humanized anti-TAT antibody are
contemplated. For example, the humanized antibody may be an
antibody fragment, such as a Fab, which is optionally conjugated
with one or more cytotoxic agent(s) in order to generate an
immunoconjugate. Alternatively, the humanized antibody may be an
intact antibody, such as an intact IgG1 antibody.
[0767] As an alternative to humanization, human antibodies can be
generated. For example, it is now possible to produce transgenic
animals (e.g., mice) that are capable, upon immunization, of
producing a full repertoire of human antibodies in the absence of
endogenous immunoglobulin production. For example, it has been
described that the homozygous deletion of the antibody heavy-chain
joining region (J.sub.H) gene in chimeric and germ-line mutant mice
results in complete inhibition of endogenous antibody production.
Transfer of the human germ-line immunoglobulin gene array into such
germ-line mutant mice will result in the production of human
antibodies upon antigen challenge. See, e.g., Jakobovits et al.,
Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et al.,
Nature, 362:255-258 (1993); Bruggemann et al., Year in Immuno. 7:33
(1993); U.S. Pat. Nos. 5,545,806, 5,569,825, 5,591,669 (all of
GenPharm); 5,545,807; and WO 97/17852.
[0768] Alternatively, phage display technology (McCafferty et al.,
Nature 348:552-553 [1990]) can be used to produce human antibodies
and antibody fragments in vitro, from immunoglobulin variable (V)
domain gene repertoires from unimmunized donors. According to this
technique, antibody V domain genes are cloned in-frame into either
a major or minor coat protein gene of a filamentous bacteriophage,
such as M13 or fd, and displayed as functional antibody fragments
on the surface of the phage particle. Because the filamentous
particle contains a single-stranded DNA copy of the phage genome,
selections based on the functional properties of the antibody also
result in selection of the gene encoding the antibody exhibiting
those properties. Thus, the phage mimics some of the properties of
the B-cell. Phage display can be performed in a variety of formats,
reviewed in, e.g., Johnson, Kevin S, and Chiswell, David J.,
Current Opinion in Structural Biology 3:564-571 (1993). Several
sources of V-gene segments can be used for phage display. Clackson
et al., Nature, 352:624-628 (1991) isolated a diverse array of
anti-oxazolone antibodies from a small random combinatorial library
of V genes derived from the spleens of immunized mice. A repertoire
of V genes from unimmunized human donors can be constructed and
antibodies to a diverse array of antigens (including self-antigens)
can be isolated essentially following the techniques described by
Marks et al., J. Mol. Biol. 222:581-597 (1991), or Griffith et al.,
EMBO J. 12:725-734 (1993). See, also, U.S. Pat. Nos. 5,565,332 and
5,573,905.
[0769] As discussed above, human antibodies may also be generated
by in vitro activated B cells (see U.S. Pat. Nos. 5,567,610 and
5,229,275).
[0770] 4. Antibody Fragments
[0771] In certain circumstances there are advantages of using
antibody fragments, rather than whole antibodies. The smaller size
of the fragments allows for rapid clearance, and may lead to
improved access to solid tumors.
[0772] Various techniques have been developed for the production of
antibody fragments. Traditionally, these fragments were derived via
proteolytic digestion of intact antibodies (see, e.g., Morimoto et
al., Journal of Biochemical and Biophysical Methods 24:107-117
(1992); and Brennan et al., Science, 229:81 (1985)). However, these
fragments can now be produced directly by recombinant host cells.
Fab, Fv and ScFv antibody fragments can all be expressed in and
secreted from E. coli, thus allowing the facile production of large
amounts of these fragments. Antibody fragments can be isolated from
the antibody phage libraries discussed above. Alternatively,
Fab'-SH fragments can be directly recovered from E. coli and
chemically coupled to form F(ab').sub.2 fragments (Carter et al.,
Bio/Technology 10:163-167 (1992)). According to another approach,
F(ab').sub.2 fragments can be isolated directly from recombinant
host cell culture. Fab and F(ab').sub.2 fragment with increased in
vivo half-life comprising a salvage receptor binding epitope
residues are described in U.S. Pat. No. 5,869,046. Other techniques
for the production of antibody fragments will be apparent to the
skilled practitioner. In other embodiments, the antibody of choice
is a single chain Fv fragment (scFv). See WO 93/16185; U.S. Pat.
No. 5,571,894; and U.S. Pat. No. 5,587,458. Fv and sFv are the only
species with intact combining sites that are devoid of constant
regions; thus, they are suitable for reduced nonspecific binding
during in vivo use. sFv fusion proteins may be constructed to yield
fusion of an effector protein at either the amino or the carboxy
terminus of an sFv. See Antibody Engineering, ed. Borrebaeck,
supra. The antibody fragment may also be a "linear antibody", e.g.,
as described in U.S. Pat. No. 5,641,870 for example. Such linear
antibody fragments may be monospecific or bispecific.
[0773] 5. Bispecific Antibodies
[0774] Bispecific antibodies are antibodies that have binding
specificities for at least two different epitopes. Exemplary
bispecific antibodies may bind to two different epitopes of a TAT
protein as described herein. Other such antibodies may combine a
TAT binding site with a binding site for another protein.
Alternatively, an anti-TAT arm may be combined with an arm which
binds to a triggering molecule on a leukocyte such as a T-cell
receptor molecule (e.g. CD3), or Fc receptors for IgG (Fc(R), such
as Fc(RI (CD64), Fc(RII (CD32) and Fc(RIII (CD16), so as to focus
and localize cellular defense mechanisms to the TAT-expressing
cell. Bispecific antibodies may also be used to localize cytotoxic
agents to cells which express TAT. These antibodies possess a
TAT-binding arm and an arm which binds the cytotoxic agent (e.g.,
saporin, anti-interferon-", vinca alkaloid, ricin A chain,
methotrexate or radioactive isotope hapten). Bispecific antibodies
can be prepared as full length antibodies or antibody fragments
(e.g., F(ab').sub.2 bispecific antibodies).
[0775] WO 96/16673 describes a bispecific anti-ErbB2/anti-Fc(RIII
antibody and U.S. Pat. No. 5,837,234 discloses a bispecific
anti-ErbB2/anti-Fc(RI antibody. A bispecific anti-ErbB2/Fc"
antibody is shown in WO98/02463. U.S. Pat. No. 5,821,337 teaches a
bispecific anti-ErbB2/anti-CD3 antibody.
[0776] Methods for making bispecific antibodies are known in the
art. Traditional production of full length bispecific antibodies is
based on the co-expression of two immunoglobulin heavy chain-light
chain pairs, where the two chains have different specificities
(Millstein et al., Nature 305:537-539 (1983)). Because of the
random assortment of immunoglobulin heavy and light chains, these
hybridomas (quadromas) produce a potential mixture of 10 different
antibody molecules, of which only one has the correct bispecific
structure. Purification of the correct molecule, which is usually
done by affinity chromatography steps, is rather cumbersome, and
the product yields are low. Similar procedures are disclosed in WO
93/08829, and in Traunecker et al., EMBO J. 10:3655-3659
(1991).
[0777] According to a different approach, antibody variable domains
with the desired binding specificities (antibody-antigen combining
sites) are fused to immunoglobulin constant domain sequences.
Preferably, the fusion is with an Ig heavy chain constant domain,
comprising at least part of the hinge, C.sub.H2, and C.sub.H3
regions. It is preferred to have the first heavy-chain constant
region (C.sub.H1) containing the site necessary for light chain
bonding, present in at least one of the fusions. DNAs encoding the
immunoglobulin heavy chain fusions and, if desired, the
immunoglobulin light chain, are inserted into separate expression
vectors, and are co-transfected into a suitable host cell. This
provides for greater flexibility in adjusting the mutual
proportions of the three polypeptide fragments in embodiments when
unequal ratios of the three polypeptide chains used in the
construction provide the optimum yield of the desired bispecific
antibody. It is, however, possible to insert the coding sequences
for two or all three polypeptide chains into a single expression
vector when the expression of at least two polypeptide chains in
equal ratios results in high yields or when the ratios have no
significant affect on the yield of the desired chain
combination.
[0778] In a preferred embodiment of this approach, the bispecific
antibodies are composed of a hybrid immunoglobulin heavy chain with
a first binding specificity in one arm, and a hybrid immunoglobulin
heavy chain-light chain pair (providing a second binding
specificity) in the other arm. It was found that this asymmetric
structure facilitates the separation of the desired bispecific
compound from unwanted immunoglobulin chain combinations, as the
presence of an immunoglobulin light chain in only one half of the
bispecific molecule provides for a facile way of separation. This
approach is disclosed in WO 94/04690. For further details of
generating bispecific antibodies see, for example, Suresh et al.,
Methods in Enzymology 121:210 (1986).
[0779] According to another approach described in U.S. Pat. No.
5,731,168, the interface between a pair of antibody molecules can
be engineered to maximize the percentage of heterodimers which are
recovered from recombinant cell culture. The preferred interface
comprises at least a part of the C.sub.H3 domain. In this method,
one or more small amino acid side chains from the interface of the
first antibody molecule are replaced with larger side chains (e.g.,
tyrosine or tryptophan). Compensatory "cavities" of identical or
similar size to the large side chain(s) are created on the
interface of the second antibody molecule by replacing large amino
acid side chains with smaller ones (e.g., alanine or threonine).
This provides a mechanism for increasing the yield of the
heterodimer over other unwanted end-products such as
homodimers.
[0780] Bispecific antibodies include cross-linked or
"heteroconjugate" antibodies. For example, one of the antibodies in
the heteroconjugate can be coupled to avidin, the other to biotin.
Such antibodies have, for example, been proposed to target immune
system cells to unwanted cells (U.S. Pat. No. 4,676,980), and for
treatment of HIV infection (WO 91/00360, WO 92/200373, and EP
03089). Heteroconjugate antibodies may be made using any convenient
cross-linking methods. Suitable cross-linking agents are well known
in the art, and are disclosed in U.S. Pat. No. 4,676,980, along
with a number of cross-linking techniques.
[0781] Techniques for generating bispecific antibodies from
antibody fragments have also been described in the literature. For
example, bispecific antibodies can be prepared using chemical
linkage. Brennan et al., Science 229:81 (1985) describe a procedure
wherein intact antibodies are proteolytically cleaved to generate
F(ab').sub.2 fragments. These fragments are reduced in the presence
of the dithiol complexing agent, sodium arsenite, to stabilize
vicinal dithiols and prevent intermolecular disulfide formation.
The Fab' fragments generated are then converted to
thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB
derivatives is then reconverted to the Fab'-thiol by reduction with
mercaptoethylamine and is mixed with an equimolar amount of the
other Fab'-TNB derivative to form the bispecific antibody. The
bispecific antibodies produced can be used as agents for the
selective immobilization of enzymes.
[0782] Recent progress has facilitated the direct recovery of
Fab'-SH fragments from E. coli, which can be chemically coupled to
form bispecific antibodies. Shalaby et al., J. Exp. Med. 175:
217-225 (1992) describe the production of a fully humanized
bispecific antibody F(ab').sub.2 molecule. Each Fab' fragment was
separately secreted from E. coli and subjected to directed chemical
coupling in vitro to form the bispecific antibody. The bispecific
antibody thus formed was able to bind to cells overexpressing the
ErbB2 receptor and normal human T cells, as well as trigger the
lytic activity of human cytotoxic lymphocytes against human breast
tumor targets.
[0783] Various techniques for making and isolating bispecific
antibody fragments directly from recombinant cell culture have also
been described. For example, bispecific antibodies have been
produced using leucine zippers. Kostelny et al., J. Immunol.
148(5):1547-1553 (1992). The leucine zipper peptides from the Fos
and Jun proteins were linked to the Fab' portions of two different
antibodies by gene fusion. The antibody homodimers were reduced at
the hinge region to form monomers and then re-oxidized to form the
antibody heterodimers. This method can also be utilized for the
production of antibody homodimers. The "diabody" technology
described by Hollinger et al., Proc. Natl. Acad. Sci. USA
90:6444-6448 (1993) has provided an alternative mechanism for
making bispecific antibody fragments. The fragments comprise a
V.sub.H connected to a V.sub.L by a linker which is too short to
allow pairing between the two domains on the same chain.
Accordingly, the V.sub.H and V.sub.L domains of one fragment are
forced to pair with the complementary V.sub.L and V.sub.H domains
of another fragment, thereby forming two antigen-binding sites.
Another strategy for making bispecific antibody fragments by the
use of single-chain Fv (sFv) dimers has also been reported. See
Gruber et al., J. Immunol., 152:5368 (1994).
[0784] Antibodies with more than two valencies are contemplated.
For example, trispecific antibodies can be prepared. Tutt et al.,
J. Immunol. 147:60 (1991).
[0785] 6. Heteroconjugate Antibodies
[0786] Heteroconjugate antibodies are also within the scope of the
present invention. Heteroconjugate antibodies are composed of two
covalently joined antibodies. Such antibodies have, for example,
been proposed to target immune system cells to unwanted cells [U.S.
Pat. No. 4,676,980], and for treatment of HIV infection [WO
91/00360; WO 92/200373; EP 03089]. It is contemplated that the
antibodies may be prepared in vitro using known methods in
synthetic protein chemistry, including those involving crosslinking
agents. For example, immunotoxins may be constructed using a
disulfide exchange reaction or by forming a thioether bond.
Examples of suitable reagents for this purpose include
iminothiolate and methyl-4-mercaptobutyrimidate and those
disclosed, for example, in U.S. Pat. No. 4,676,980.
[0787] 7. Multivalent Antibodies
[0788] A multivalent antibody may be internalized (and/or
catabolized) faster than a bivalent antibody by a cell expressing
an antigen to which the antibodies bind. The antibodies of the
present invention can be multivalent antibodies (which are other
than of the IgM class) with three or more antigen binding sites
(e.g. tetravalent antibodies), which can be readily produced by
recombinant expression of nucleic acid encoding the polypeptide
chains of the antibody. The multivalent antibody can comprise a
dimerization domain and three or more antigen binding sites. The
preferred dimerization domain comprises (or consists of) an Fc
region or a hinge region. In this scenario, the antibody will
comprise an Fc region and three or more antigen binding sites
amino-terminal to the Fc region. The preferred multivalent antibody
herein comprises (or consists of) three to about eight, but
preferably four, antigen binding sites. The multivalent antibody
comprises at least one polypeptide chain (and preferably two
polypeptide chains), wherein the polypeptide chain(s) comprise two
or more variable domains. For instance, the polypeptide chain(s)
may comprise VD1-(X1).sub.n-VD2-(X2).sub.n--Fc, wherein VD1 is a
first variable domain, VD2 is a second variable domain, Fc is one
polypeptide chain of an Fc region, X1 and X2 represent an amino
acid or polypeptide, and n is 0 or 1. For instance, the polypeptide
chain(s) may comprise: VH-CH1-flexible linker-VH-CH1-Fc region
chain; or VH-CH1-VH-CH1-Fc region chain. The multivalent antibody
herein preferably further comprises at least two (and preferably
four) light chain variable domain polypeptides. The multivalent
antibody herein may, for instance, comprise from about two to about
eight light chain variable domain polypeptides. The light chain
variable domain polypeptides contemplated here comprise a light
chain variable domain and, optionally, further comprise a CL
domain.
[0789] 8. Effector Function Engineering
[0790] It may be desirable to modify the antibody of the invention
with respect to effector function, e.g., so as to enhance
antigen-dependent cell-mediated cyotoxicity (ADCC) and/or
complement dependent cytotoxicity (CDC) of the antibody. This may
be achieved by introducing one or more amino acid substitutions in
an Fc region of the antibody. Alternatively or additionally,
cysteine residue(s) may be introduced in the Fc region, thereby
allowing interchain disulfide bond formation in this region. The
homodimeric antibody thus generated may have improved
internalization capability and/or increased complement-mediated
cell killing and antibody-dependent cellular cytotoxicity (ADCC).
See Caron et al., J. Exp Med. 176:1191-1195 (1992) and Shopes, B.
J. Immunol. 148:2918-2922 (1992). Homodimeric antibodies with
enhanced anti-tumor activity may also be prepared using
heterobifunctional cross-linkers as described in Wolff et al.,
Cancer Research 53:2560-2565 (1993). Alternatively, an antibody can
be engineered which has dual Fc regions and may thereby have
enhanced complement lysis and ADCC capabilities. See Stevenson et
al., Anti-Cancer Drug Design 3:219-230 (1989). To increase the
serum half life of the antibody, one may incorporate a salvage
receptor binding epitope into the antibody (especially an antibody
fragment) as described in U.S. Pat. No. 5,739,277, for example. As
used herein, the term "salvage receptor binding epitope" refers to
an epitope of the Fc region of an IgG molecule (e.g., IgG.sub.1,
IgG.sub.2, IgG.sub.3, or IgG.sub.4) that is responsible for
increasing the in vivo serum half-life of the IgG molecule.
[0791] 9. Immunoconjugates
[0792] The invention also pertains to immunoconjugates comprising
an antibody conjugated to a cytotoxic agent such as a
chemotherapeutic agent, a growth inhibitory agent, a toxin (e.g.,
an enzymatically active toxin of bacterial, fungal, plant, or
animal origin, or fragments thereof), or a radioactive isotope
(i.e., a radioconjugate).
[0793] Chemotherapeutic agents useful in the generation of such
immunoconjugates have been described above. Enzymatically active
toxins and fragments thereof that can be used include diphtheria A
chain, nonbinding active fragments of diphtheria toxin, exotoxin A
chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin
proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S),
momordica charantia inhibitor, curcin, crotin, sapaonaria
officinalis inhibitor, gelonin, mitogellin, restrictocin,
phenomycin, enomycin, and the tricothecenes. A variety of
radionuclides are available for the production of radioconjugated
antibodies. Examples include .sup.212Bi, .sup.131I, .sup.131In,
.sup.90Y, and .sup.186Re. Conjugates of the antibody and cytotoxic
agent are made using a variety of bifunctional protein-coupling
agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate
(SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters
(such as dimethyl adipimidate HCL), active esters (such as
disuccinimidyl suberate), aldehydes (such as glutareldehyde),
bis-azido compounds (such as bis (.rho.-azidobenzoyl)
hexanediamine), bis-diazonium derivatives (such as
bis-(.rho.-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such
as tolyene 2,6-diisocyanate), and bis-active fluorine compounds
(such as 1,5-difluoro-2,4-dinitrobenzene). For example, a ricin
immunotoxin can be prepared as described in Vitetta et al.,
Science, 238: 1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. See WO94/11026.
[0794] Conjugates of an antibody and one or more small molecule
toxins, such as a calicheamicin, maytansinoids, a trichothene, and
CC1065, and the derivatives of these toxins that have toxin
activity, are also contemplated herein.
Maytansine and Maytansinoids
[0795] In one preferred embodiment, an anti-TAT antibody (full
length or fragments) of the invention is conjugated to one or more
maytansinoid molecules.
[0796] Maytansinoids are mitototic inhibitors which act by
inhibiting tubulin polymerization. Maytansine was first isolated
from the east African shrub Maytenus serrata (U.S. Pat. No.
3,896,111). Subsequently, it was discovered that certain microbes
also produce maytansinoids, such as maytansinol and C-3 maytansinol
esters (U.S. Pat. No. 4,151,042). Synthetic maytansinol and
derivatives and analogues thereof are disclosed, for example, in
U.S. Pat. Nos. 4,137,230; 4,248,870; 4,256,746; 4,260,608;
4,265,814; 4,294,757; 4,307,016; 4,308,268; 4,308,269; 4,309,428;
4,313,946; 4,315,929; 4,317,821; 4,322,348; 4,331,598; 4,361,650;
4,364,866; 4,424,219; 4,450,254; 4,362,663; and 4,371,533, the
disclosures of which are hereby expressly incorporated by
reference.
Maytansinoid-Antibody Conjugates
[0797] In an attempt to improve their therapeutic index, maytansine
and maytansinoids have been conjugated to antibodies specifically
binding to tumor cell antigens. Immunoconjugates containing
maytansinoids and their therapeutic use are disclosed, for example,
in U.S. Pat. Nos. 5,208,020, 5,416,064 and European Patent EP 0 425
235 B1, the disclosures of which are hereby expressly incorporated
by reference. Liu et al., Proc. Natl. Acad. Sci. USA 93:8618-8623
(1996) described immunoconjugates comprising a maytansinoid
designated DM1 linked to the monoclonal antibody C242 directed
against human colorectal cancer. The conjugate was found to be
highly cytotoxic towards cultured colon cancer cells, and showed
antitumor activity in an in vivo tumor growth assay. Chari et al.,
Cancer Research 52:127-131 (1992) describe immunoconjugates in
which a maytansinoid was conjugated via a disulfide linker to the
murine antibody A7 binding to an antigen on human colon cancer cell
lines, or to another murine monoclonal antibody TA.1 that binds the
HER-2/neu oncogene. The cytotoxicity of the TA.1-maytansonoid
conjugate was tested in vitro on the human breast cancer cell line
SK-BR-3, which expresses 3.times.10.sup.5 HER-2 surface antigens
per cell. The drug conjugate achieved a degree of cytotoxicity
similar to the free maytansonid drug, which could be increased by
increasing the number of maytansinoid molecules per antibody
molecule. The A7-maytansinoid conjugate showed low systemic
cytotoxicity in mice.
Anti-TAT Polypeptide Antibody-Maytansinoid Conjugates
(Immunoconjugates)
[0798] Anti-TAT antibody-maytansinoid conjugates are prepared by
chemically linking an anti-TAT antibody to a maytansinoid molecule
without significantly diminishing the biological activity of either
the antibody or the maytansinoid molecule. An average of 3-4
maytansinoid molecules conjugated per antibody molecule has shown
efficacy in enhancing cytotoxicity of target cells without
negatively affecting the function or solubility of the antibody,
although even one molecule of toxin/antibody would be expected to
enhance cytotoxicity over the use of naked antibody. Maytansinoids
are well known in the art and can be synthesized by known
techniques or isolated from natural sources. Suitable maytansinoids
are disclosed, for example, in U.S. Pat. No. 5,208,020 and in the
other patents and nonpatent publications referred to hereinabove.
Preferred maytansinoids are maytansinol and maytansinol analogues
modified in the aromatic ring or at other positions of the
maytansinol molecule, such as various maytansinol esters.
[0799] There are many linking groups known in the art for making
antibody-maytansinoid conjugates, including, for example, those
disclosed in U.S. Pat. No. 5,208,020 or EP Patent 0 425 235 B1, and
Chari et al., Cancer Research 52:127-131 (1992). The linking groups
include disufide groups, thioether groups, acid labile groups,
photolabile groups, peptidase labile groups, or esterase labile
groups, as disclosed in the above-identified patents, disulfide and
thioether groups being preferred.
[0800] Conjugates of the antibody and maytansinoid may be made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP),
succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate,
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis (.rho.-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(.rho.-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as toluene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene).
Particularly preferred coupling agents include
N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP) (Carlsson et
al., Biochem. J. 173:723-737 [1978]) and
N-succinimidyl-4-(2-pyridylthio)pentanoate (SPP) to provide for a
disulfide linkage.
[0801] The linker may be attached to the maytansinoid molecule at
various positions, depending on the type of the link. For example,
an ester linkage may be formed by reaction with a hydroxyl group
using conventional coupling techniques. The reaction may occur at
the C-3 position having a hydroxyl group, the C-14 position
modified with hyrdoxymethyl, the C-15 position modified with a
hydroxyl group, and the C-20 position having a hydroxyl group. In a
preferred embodiment, the linkage is formed at the C-3 position of
maytansinol or a maytansinol analogue.
Calicheamicin
[0802] Another immunoconjugate of interest comprises an anti-TAT
antibody conjugated to one or more calicheamicin molecules. The
calicheamicin family of antibiotics are capable of producing
double-stranded DNA breaks at sub-picomolar concentrations. For the
preparation of conjugates of the calicheamicin family, see U.S.
Pat. Nos. 5,712,374, 5,714,586, 5,739,116, 5,767,285, 5,770,701,
5,770,710, 5,773,001, 5,877,296 (all to American Cyanamid Company).
Structural analogues of calicheamicin which may be used include,
but are not limited to, .gamma..sub.1.sup.I, .alpha..sub.2.sup.I,
.alpha..sub.3.sup.I, N-acetyl-.gamma..sub.1.sup.I, PSAG and
.theta..sup.I.sub.1 (Hinman et al., Cancer Research 53:3336-3342
(1993), Lode et al., Cancer Research 58:2925-2928 (1998) and the
aforementioned U.S. patents to American Cyanamid). Another
anti-tumor drug that the antibody can be conjugated is QFA which is
an antifolate. Both calicheamicin and QFA have intracellular sites
of action and do not readily cross the plasma membrane. Therefore,
cellular uptake of these agents through antibody mediated
internalization greatly enhances their cytotoxic effects.
Other Cytotoxic Agents
[0803] Other antitumor agents that can be conjugated to the
anti-TAT antibodies of the invention include BCNU, streptozoicin,
vincristine and 5-fluorouracil, the family of agents known
collectively LL-E33288 complex described in U.S. Pat. Nos.
5,053,394, 5,770,710, as well as esperamicins (U.S. Pat. No.
5,877,296).
[0804] Enzymatically active toxins and fragments thereof which can
be used include diphtheria A chain, nonbinding active fragments of
diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa),
ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin,
Aleurites fordii proteins, dianthin proteins, Phytolaca americana
proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor,
curcin, crotin, sapaonaria officinalis inhibitor, gelonin,
mitogellin, restrictocin, phenomycin, enomycin and the
tricothecenes. See, for example, WO 93/21232 published Oct. 28,
1993.
[0805] The present invention further contemplates an
immunoconjugate formed between an antibody and a compound with
nucleolytic activity (e.g., a ribonuclease or a DNA endonuclease
such as a deoxyribonuclease; DNase).
[0806] For selective destruction of the tumor, the antibody may
comprise a highly radioactive atom. A variety of radioactive
isotopes are available for the production of radioconjugated
anti-TAT antibodies. Examples include At.sup.211, I.sup.131,
I.sup.125, Y.sup.90, Re.sup.186, Re.sup.188, Sm.sup.153,
Bi.sup.212, P.sup.32, Pb.sup.212 and radioactive isotopes of Lu.
When the conjugate is used for diagnosis, it may comprise a
radioactive atom for scintigraphic studies, for example tc.sup.99m
or I.sup.123, or a spin label for nuclear magnetic resonance (NMR)
imaging (also known as magnetic resonance imaging, mri), such as
iodine-123 again, iodine-131, indium-111, fluorine-19, carbon-13,
nitrogen-15, oxygen-17, gadolinium, manganese or iron.
[0807] The radio- or other labels may be incorporated in the
conjugate in known ways. For example, the peptide may be
biosynthesized or may be synthesized by chemical amino acid
synthesis using suitable amino acid precursors involving, for
example, fluorine-19 in place of hydrogen. Labels such as
tc.sup.99m or I.sup.123, .Re.sup.186, Re.sup.188 and In.sup.111 can
be attached via a cysteine residue in the peptide. Yttrium-90 can
be attached via a lysine residue. The IODOGEN method (Fraker et al
(1978) Biochem. Biophys. Res. Commun. 80: 49-57 can be used to
incorporate iodine-123. "Monoclonal Antibodies in
Immunoscintigraphy" (Chatal, CRC Press 1989) describes other
methods in detail.
[0808] Conjugates of the antibody and cytotoxic agent may be made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP),
succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate,
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis (.rho.-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(.rho.-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be prepared as described in
Vitetta et al., Science 238:1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. See WO94/11026. The linker may be
a "cleavable linker" facilitating release of the cytotoxic drug in
the cell. For example, an acid-labile linker, peptidase-sensitive
linker, photolabile linker, dimethyl linker or disulfide-containing
linker (Chari et al., Cancer Research 52:127-131 (1992); U.S. Pat.
No. 5,208,020) may be used.
[0809] Alternatively, a fusion protein comprising the anti-TAT
antibody and cytotoxic agent may be made, e.g., by recombinant
techniques or peptide synthesis. The length of DNA may comprise
respective regions encoding the two portions of the conjugate
either adjacent one another or separated by a region encoding a
linker peptide which does not destroy the desired properties of the
conjugate.
[0810] In yet another embodiment, the antibody may be conjugated to
a "receptor" (such streptavidin) for utilization in tumor
pre-targeting wherein the antibody-receptor conjugate is
administered to the patient, followed by removal of unbound
conjugate from the circulation using a clearing agent and then
administration of a "ligand" (e.g., avidin) which is conjugated to
a cytotoxic agent (e.g., a radionucleotide).
[0811] 10. Immunoliposomes
[0812] The anti-TAT antibodies disclosed herein may also be
formulated as immunoliposomes. A "liposome" is a small vesicle
composed of various types of lipids, phospholipids and/or
surfactant which is useful for delivery of a drug to a mammal. The
components of the liposome are commonly arranged in a bilayer
formation, similar to the lipid arrangement of biological
membranes. Liposomes containing the antibody are prepared by
methods known in the art, such as described in Epstein et al.,
Proc. Natl. Acad. Sci. USA 82:3688 (1985); Hwang et al., Proc.
Natl. Acad. Sci. USA 77:4030 (1980); U.S. Pat. Nos. 4,485,045 and
4,544,545; and WO97/38731 published Oct. 23, 1997. Liposomes with
enhanced circulation time are disclosed in U.S. Pat. No.
5,013,556.
[0813] Particularly useful liposomes can be generated by the
reverse phase evaporation method with a lipid composition
comprising phosphatidylcholine, cholesterol and PEG-derivatized
phosphatidylethanolamine (PEG-PE). Liposomes are extruded through
filters of defined pore size to yield liposomes with the desired
diameter. Fab' fragments of the antibody of the present invention
can be conjugated to the liposomes as described in Martin et al.,
J. Biol. Chem. 257:286-288 (1982) via a disulfide interchange
reaction. A chemotherapeutic agent is optionally contained within
the liposome. See Gabizon et al., J. National Cancer Inst.
81(19):1484 (1989).
[0814] B. TAT Binding Oligopeptides
[0815] TAT binding oligopeptides of the present invention are
oligopeptides that bind, preferably specifically, to a TAT
polypeptide as described herein. TAT binding oligopeptides may be
chemically synthesized using known oligopeptide synthesis
methodology or may be prepared and purified using recombinant
technology. TAT binding oligopeptides are usually at least about 5
amino acids in length, alternatively at least about 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61,
62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78,
79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95,
96, 97, 98, 99, or 100 amino acids in length or more, wherein such
oligopeptides that are capable of binding, preferably specifically,
to a TAT polypeptide as described herein. TAT binding oligopeptides
may be identified without undue experimentation using well known
techniques. In this regard, it is noted that techniques for
screening oligopeptide libraries for oligopeptides that are capable
of specifically binding to a polypeptide target are well known in
the art (see, e.g., U.S. Pat. Nos. 5,556,762, 5,750,373, 4,708,871,
4,833,092, 5,223,409, 5,403,484, 5,571,689, 5,663,143; PCT
Publication Nos. WO 84/03506 and WO84/03564; Geysen et al., Proc.
Natl. Acad. Sci. U.S.A., 81:3998-4002 (1984); Geysen et al., Proc.
Natl. Acad. Sci. U.S.A., 82:178-182 (1985); Geysen et al., in
Synthetic Peptides as Antigens, 130-149 (1986); Geysen et al., J.
Immunol. Meth., 102:259-274 (1987); Schoofs et al., J. Immunol.,
140:611-616 (1988), Cwirla, S. E. et al. (1990) Proc. Natl. Acad.
Sci. USA, 87:6378; Lowman, H. B. et al. (1991) Biochemistry,
30:10832; Clackson, T. et al. (1991) Nature, 352: 624; Marks, J. D.
et al. (1991), J. Mol. Biol., 222:581; Kang, A. S. et al. (1991)
Proc. Natl. Acad. Sci. USA, 88:8363, and Smith, G. P. (1991)
Current Opin. Biotechnol., 2:668).
[0816] In this regard, bacteriophage (phage) display is one well
known technique which allows one to screen large oligopeptide
libraries to identify member(s) of those libraries which are
capable of specifically binding to a polypeptide target. Phage
display is a technique by which variant polypeptides are displayed
as fusion proteins to the coat protein on the surface of
bacteriophage particles (Scott, J. K. and Smith, G. P. (1990)
Science 249: 386). The utility of phage display lies in the fact
that large libraries of selectively randomized protein variants (or
randomly cloned cDNAs) can be rapidly and efficiently sorted for
those sequences that bind to a target molecule with high affinity.
Display of peptide (Cwirla, S. E. et al. (1990) Proc. Natl. Acad.
Sci. USA, 87:6378) or protein (Lowman, H. B. et al. (1991)
Biochemistry, 30:10832; Clackson, T. et al. (1991) Nature, 352:
624; Marks, J. D. et al. (1991), J. Mol. Biol., 222:581; Kang, A.
S. et al. (1991) Proc. Natl. Acad. Sci. USA, 88:8363) libraries on
phage have been used for screening millions of polypeptides or
oligopeptides for ones with specific binding properties (Smith, G.
P. (1991) Current Opin. Biotechnol., 2:668). Sorting phage
libraries of random mutants requires a strategy for constructing
and propagating a large number of variants, a procedure for
affinity purification using the target receptor, and a means of
evaluating the results of binding enrichments. U.S. Pat. Nos.
5,223,409, 5,403,484, 5,571,689, and 5,663,143.
[0817] Although most phage display methods have used filamentous
phage, lambdoid phage display systems (WO 95/34683; U.S. Pat. No.
5,627,024), T4 phage display systems (Ren, Z-J. et al. (1998) Gene
215:439; Zhu, Z. (1997) CAN 33:534; Jiang, J. et al. (1997) can
128:44380; Ren, Z-J. et al. (1997) CAN 127:215644; Ren, Z-J. (1996)
Protein Sci. 5:1833; Efimov, V. P. et al. (1995) Virus Genes
10:173) and T7 phage display systems (Smith, G. P. and Scott, J. K.
(1993) Methods in Enzymology, 217, 228-257; U.S. Pat. No.
5,766,905) are also known.
[0818] Many other improvements and variations of the basic phage
display concept have now been developed. These improvements enhance
the ability of display systems to screen peptide libraries for
binding to selected target molecules and to display functional
proteins with the potential of screening these proteins for desired
properties. Combinatorial reaction devices for phage display
reactions have been developed (WO 98/14277) and phage display
libraries have been used to analyze and control bimolecular
interactions (WO 98/20169; WO 98/20159) and properties of
constrained helical peptides (WO 98/20036). WO 97/35196 describes a
method of isolating an affinity ligand in which a phage display
library is contacted with one solution in which the ligand will
bind to a target molecule and a second solution in which the
affinity ligand will not bind to the target molecule, to
selectively isolate binding ligands. WO 97/46251 describes a method
of biopanning a random phage display library with an affinity
purified antibody and then isolating binding phage, followed by a
micropanning process using microplate wells to isolate high
affinity binding phage. The use of Staphlylococcus aureus protein A
as an affinity tag has also been reported (Li et al. (1998) Mol.
Biotech., 9:187). WO 97/47314 describes the use of substrate
subtraction libraries to distinguish enzyme specificities using a
combinatorial library which may be a phage display library. A
method for selecting enzymes suitable for use in detergents using
phage display is described in WO 97/09446. Additional methods of
selecting specific binding proteins are described in U.S. Pat. Nos.
5,498,538, 5,432,018, and WO 98/15833.
[0819] Methods of generating peptide libraries and screening these
libraries are also disclosed in U.S. Pat. Nos. 5,723,286,
5,432,018, 5,580,717, 5,427,908, 5,498,530, 5,770,434, 5,734,018,
5,698,426, 5,763,192, and 5,723,323.
[0820] C. TAT Binding Organic Molecules
[0821] TAT binding organic molecules are organic molecules other
than oligopeptides or antibodies as defined herein that bind,
preferably specifically, to a TAT polypeptide as described herein.
TAT binding organic molecules may be identified and chemically
synthesized using known methodology (see, e.g., PCT Publication
Nos. WO00/00823 and WO00/39585). TAT binding organic molecules are
usually less than about 2000 daltons in size, alternatively less
than about 1500, 750, 500, 250 or 200 daltons in size, wherein such
organic molecules that are capable of binding, preferably
specifically, to a TAT polypeptide as described herein may be
identified without undue experimentation using well known
techniques. In this regard, it is noted that techniques for
screening organic molecule libraries for molecules that are capable
of binding to a polypeptide target are well known in the art (see,
e.g., PCT Publication Nos. WO00/00823 and WO00/39585). TAT binding
organic molecules may be, for example, aldehydes, ketones, oximes,
hydrazones, semicarbazones, carbazides, primary amines, secondary
amines, tertiary amines, N-substituted hydrazines, hydrazides,
alcohols, ethers, thiols, thioethers, disulfides, carboxylic acids,
esters, amides, ureas, carbamates, carbonates, ketals, thioketals,
acetals, thioacetals, aryl halides, aryl sulfonates, alkyl halides,
alkyl sulfonates, aromatic compounds, heterocyclic compounds,
anilines, alkenes, alkynes, diols, amino alcohols, oxazolidines,
oxazolines, thiazolidines, thiazolines, enamines, sulfonamides,
epoxides, aziridines, isocyanates, sulfonyl chlorides, diazo
compounds, acid chlorides, or the like.
[0822] D. Screening for Anti-TAT Antibodies, TAT Binding
Oligopeptides and TAT Binding Organic Molecules With the Desired
Properties
[0823] Techniques for generating antibodies, oligopeptides and
organic molecules that bind to TAT polypeptides have been described
above. One may further select antibodies, oligopeptides or other
organic molecules with certain biological characteristics, as
desired.
[0824] The growth inhibitory effects of an anti-TAT antibody,
oligopeptide or other organic molecule of the invention may be
assessed by methods known in the art, e.g., using cells which
express a TAT polypeptide either endogenously or following
transfection with the TAT gene. For example, appropriate tumor cell
lines and TAT-transfected cells may treated with an anti-TAT
monoclonal antibody, oligopeptide or other organic molecule of the
invention at various concentrations for a few days (e.g., 2-7) days
and stained with crystal violet or MTT or analyzed by some other
colorimetric assay. Another method of measuring proliferation would
be by comparing .sup.3H-thymidine uptake by the cells treated in
the presence or absence an anti-TAT antibody, TAT binding
oligopeptide or TAT binding organic molecule of the invention.
After treatment, the cells are harvested and the amount of
radioactivity incorporated into the DNA quantitated in a
scintillation counter. Appropriate positive controls include
treatment of a selected cell line with a growth inhibitory antibody
known to inhibit growth of that cell line. Growth inhibition of
tumor cells in vivo can be determined in various ways known in the
art. Preferably, the tumor cell is one that overexpresses a TAT
polypeptide. Preferably, the anti-TAT antibody, TAT binding
oligopeptide or TAT binding organic molecule will inhibit cell
proliferation of a TAT-expressing tumor cell in vitro or in vivo by
about 25-100% compared to the untreated tumor cell, more
preferably, by about 30-100%, and even more preferably by about
50-100% or 70-100%, in one embodiment, at an antibody concentration
of about 0.5 to 30:g/ml. Growth inhibition can be measured at an
antibody concentration of about 0.5 to 30:g/ml or about 0.5 nM to
200 nM in cell culture, where the growth inhibition is determined
1-10 days after exposure of the tumor cells to the antibody. The
antibody is growth inhibitory in vivo if administration of the
anti-TAT antibody at about 1:g/kg to about 100 mg/kg body weight
results in reduction in tumor size or reduction of tumor cell
proliferation within about 5 days to 3 months from the first
administration of the antibody, preferably within about 5 to 30
days.
[0825] To select for an anti-TAT antibody, TAT binding oligopeptide
or TAT binding organic molecule which induces cell death, loss of
membrane integrity as indicated by, e.g., propidium iodide (PI),
trypan blue or 7AAD uptake may be assessed relative to control. A
PI uptake assay can be performed in the absence of complement and
immune effector cells. TAT polypeptide-expressing tumor cells are
incubated with medium alone or medium containing the appropriate
anti-TAT antibody (e.g, at about 10:g/ml), TAT binding oligopeptide
or TAT binding organic molecule. The cells are incubated for a 3
day time period. Following each treatment, cells are washed and
aliquoted into 35 mm strainer-capped 12.times.75 tubes (1 ml per
tube, 3 tubes per treatment group) for removal of cell clumps.
Tubes then receive PI (10:g/ml). Samples may be analyzed using a
FACSCAN.RTM. flow cytometer and FACSCONVERT.RTM. CellQuest software
(Becton Dickinson). Those anti-TAT antibodies, TAT binding
oligopeptides or TAT binding organic molecules that induce
statistically significant levels of cell death as determined by PI
uptake may be selected as cell death-inducing anti-TAT antibodies,
TAT binding oligopeptides or TAT binding organic molecules.
[0826] To screen for antibodies, oligopeptides or other organic
molecules which bind to an epitope on a TAT polypeptide bound by an
antibody of interest, a routine cross-blocking assay such as that
described in Antibodies, A Laboratory Manual, Cold Spring Harbor
Laboratory, Ed Harlow and David Lane (1988), can be performed. This
assay can be used to determine if a test antibody, oligopeptide or
other organic molecule binds the same site or epitope as a known
anti-TAT antibody. Alternatively, or additionally, epitope mapping
can be performed by methods known in the art. For example, the
antibody sequence can be mutagenized such as by alanine scanning,
to identify contact residues. The mutant antibody is initailly
tested for binding with polyclonal antibody to ensure proper
folding. In a different method, peptides corresponding to different
regions of a TAT polypeptide can be used in competition assays with
the test antibodies or with a test antibody and an antibody with a
characterized or known epitope.
[0827] E. Antibody Dependent Enzyme Mediated Prodrug Therapy
(ADEPT)
[0828] The antibodies of the present invention may also be used in
ADEPT by conjugating the antibody to a prodrug-activating enzyme
which converts a prodrug (e.g., a peptidyl chemotherapeutic agent,
see WO81/01145) to an active anti-cancer drug. See, for example, WO
88/07378 and U.S. Pat. No. 4,975,278.
[0829] The enzyme component of the immunoconjugate useful for ADEPT
includes any enzyme capable of acting on a prodrug in such a way so
as to covert it into its more active, cytotoxic form.
[0830] Enzymes that are useful in the method of this invention
include, but are not limited to, alkaline phosphatase useful for
converting phosphate-containing prodrugs into free drugs;
arylsulfatase useful for converting sulfate-containing prodrugs
into free drugs; cytosine deaminase useful for converting non-toxic
5-fluorocytosine into the anti-cancer drug, 5-fluorouracil;
proteases, such as serratia protease, thermolysin, subtilisin,
carboxypeptidases and cathepsins (such as cathepsins B and L), that
are useful for converting peptide-containing prodrugs into free
drugs; D-alanylcarboxypeptidases, useful for converting prodrugs
that contain D-amino acid substituents; carbohydrate-cleaving
enzymes such as .beta.-galactosidase and neuraminidase useful for
converting glycosylated prodrugs into free drugs; .beta.-lactamase
useful for converting drugs derivatized with .beta.-lactams into
free drugs; and penicillin amidases, such as penicillin V amidase
or penicillin G amidase, useful for converting drugs derivatized at
their amine nitrogens with phenoxyacetyl or phenylacetyl groups,
respectively, into free drugs. Alternatively, antibodies with
enzymatic activity, also known in the art as "abzymes", can be used
to convert the prodrugs of the invention into free active drugs
(see, e.g., Massey, Nature 328:457-458 (1987)). Antibody-abzyme
conjugates can be prepared as described herein for delivery of the
abzyme to a tumor cell population.
[0831] The enzymes of this invention can be covalently bound to the
anti-TAT antibodies by techniques well known in the art such as the
use of the heterobifunctional crosslinking reagents discussed
above. Alternatively, fusion proteins comprising at least the
antigen binding region of an antibody of the invention linked to at
least a functionally active portion of an enzyme of the invention
can be constructed using recombinant DNA techniques well known in
the art (see, e.g., Neuberger et al., Nature 312:604-608
(1984).
[0832] F. Full-Length TAT Polypeptides
[0833] The present invention also provides newly identified and
isolated nucleotide sequences encoding polypeptides referred to in
the present application as TAT polypeptides. In particular, cDNAs
(partial and full-length) encoding various TAT polypeptides have
been identified and isolated, as disclosed in further detail in the
Examples below.
[0834] As disclosed in the Examples below, various cDNA clones have
been deposited with the ATCC. The actual nucleotide sequences of
those clones can readily be determined by the skilled artisan by
sequencing of the deposited clone using routine methods in the art.
The predicted amino acid sequence can be determined from the
nucleotide sequence using routine skill. For the TAT polypeptides
and encoding nucleic acids described herein, in some cases,
Applicants have identified what is believed to be the reading frame
best identifiable with the sequence information available at the
time.
[0835] G. Anti-TAT Antibody and TAT Polypeptide Variants
[0836] In addition to the anti-TAT antibodies and full-length
native sequence TAT polypeptides described herein, it is
contemplated that anti-TAT antibody and TAT polypeptide variants
can be prepared. Anti-TAT antibody and TAT polypeptide variants can
be prepared by introducing appropriate nucleotide changes into the
encoding DNA, and/or by synthesis of the desired antibody or
polypeptide. Those skilled in the art will appreciate that amino
acid changes may alter post-translational processes of the anti-TAT
antibody or TAT polypeptide, such as changing the number or
position of glycosylation sites or altering the membrane anchoring
characteristics.
[0837] Variations in the anti-TAT antibodies and TAT polypeptides
described herein, can be made, for example, using any of the
techniques and guidelines for conservative and non-conservative
mutations set forth, for instance, in U.S. Pat. No. 5,364,934.
Variations may be a substitution, deletion or insertion of one or
more codons encoding the antibody or polypeptide that results in a
change in the amino acid sequence as compared with the native
sequence antibody or polypeptide. Optionally the variation is by
substitution of at least one amino acid with any other amino acid
in one or more of the domains of the anti-TAT antibody or TAT
polypeptide. Guidance in determining which amino acid residue may
be inserted, substituted or deleted without adversely affecting the
desired activity may be found by comparing the sequence of the
anti-TAT antibody or TAT polypeptide with that of homologous known
protein molecules and minimizing the number of amino acid sequence
changes made in regions of high homology. Amino acid substitutions
can be the result of replacing one amino acid with another amino
acid having similar structural and/or chemical properties, such as
the replacement of a leucine with a serine, i.e., conservative
amino acid replacements. Insertions or deletions may optionally be
in the range of about 1 to 5 amino acids. The variation allowed may
be determined by systematically making insertions, deletions or
substitutions of amino acids in the sequence and testing the
resulting variants for activity exhibited by the full-length or
mature native sequence.
[0838] Anti-TAT antibody and TAT polypeptide fragments are provided
herein. Such fragments may be truncated at the N-terminus or
C-terminus, or may lack internal residues, for example, when
compared with a full length native antibody or protein. Certain
fragments lack amino acid residues that are not essential for a
desired biological activity of the anti-TAT antibody or TAT
polypeptide.
[0839] Anti-TAT antibody and TAT polypeptide fragments may be
prepared by any of a number of conventional techniques. Desired
peptide fragments may be chemically synthesized. An alternative
approach involves generating antibody or polypeptide fragments by
enzymatic digestion, e.g., by treating the protein with an enzyme
known to cleave proteins at sites defined by particular amino acid
residues, or by digesting the DNA with suitable restriction enzymes
and isolating the desired fragment. Yet another suitable technique
involves isolating and amplifying a DNA fragment encoding a desired
antibody or polypeptide fragment, by polymerase chain reaction
(PCR). Oligonucleotides that define the desired termini of the DNA
fragment are employed at the 5' and 3' primers in the PCR.
Preferably, anti-TAT antibody and TAT polypeptide fragments share
at least one biological and/or immunological activity with the
native anti-TAT antibody or TAT polypeptide disclosed herein.
[0840] In particular embodiments, conservative substitutions of
interest are shown in Table 6 under the heading of preferred
substitutions. If such substitutions result in a change in
biological activity, then more substantial changes, denominated
exemplary substitutions in Table 6, or as further described below
in reference to amino acid classes, are introduced and the products
screened.
TABLE-US-00007 TABLE 6 Original Exemplary Preferred Residue
Substitutions Substitutions Ala (A) val; leu; ile val Arg (R) lys;
gln; asn lys Asn (N) gln; his; lys; arg gln Asp (D) glu glu Cys (C)
ser ser Gln (Q) asn asn Glu (E) asp asp Gly (G) pro; ala ala His
(H) asn; gln; lys; arg arg Ile (I) leu; val; met; ala; phe; leu
norleucine Leu (L) norleucine; ile; val; ile met; ala; phe Lys (K)
arg; gln; asn arg Met (M) leu; phe; ile leu Phe (F) leu; val; ile;
ala; tyr leu Pro (P) ala ala Ser (S) thr thr Thr (T) ser ser Trp
(W) tyr; phe tyr Tyr (Y) trp; phe; thr; ser phe Val (V) ile; leu;
met; phe; leu ala; norleucine
[0841] Substantial modifications in function or immunological
identity of the anti-TAT antibody or TAT polypeptide are
accomplished by selecting substitutions that differ significantly
in their effect on maintaining (a) the structure of the polypeptide
backbone in the area of the substitution, for example, as a sheet
or helical conformation, (b) the charge or hydrophobicity of the
molecule at the target site, or (c) the bulk of the side chain.
Naturally occurring residues are divided into groups based on
common side-chain properties:
(1) hydrophobic: norleucine, met, ala, val, leu, ile; (2) neutral
hydrophilic: cys, ser, thr; (3) acidic: asp, glu; (4) basic: asn,
gln, his, lys, arg; (5) residues that influence chain orientation:
gly, pro; and (6) aromatic: trp, tyr, phe.
[0842] Non-conservative substitutions will entail exchanging a
member of one of these classes for another class. Such substituted
residues also may be introduced into the conservative substitution
sites or, more preferably, into the remaining (non-conserved)
sites.
[0843] The variations can be made using methods known in the art
such as oligonucleotide-mediated (site-directed) mutagenesis,
alanine scanning, and PCR mutagenesis. Site-directed mutagenesis
[Carter et al., Nucl. Acids Res., 13:4331 (1986); Zoller et al.,
Nucl. Acids Res., 10:6487 (1987)], cassette mutagenesis [Wells et
al., Gene, 34:315 (1985)], restriction selection mutagenesis [Wells
et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)] or
other known techniques can be performed on the cloned DNA to
produce the anti-TAT antibody or TAT polypeptide variant DNA.
[0844] Scanning amino acid analysis can also be employed to
identify one or more amino acids along a contiguous sequence. Among
the preferred scanning amino acids are relatively small, neutral
amino acids. Such amino acids include alanine, glycine, serine, and
cysteine. Alanine is typically a preferred scanning amino acid
among this group because it eliminates the side-chain beyond the
beta-carbon and is less likely to alter the main-chain conformation
of the variant [Cunningham and Wells, Science, 244:1081-1085
(1989)]. Alanine is also typically preferred because it is the most
common amino acid. Further, it is frequently found in both buried
and exposed positions [Creighton, The Proteins, (W.H. Freeman &
Co., N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)]. If alanine
substitution does not yield adequate amounts of variant, an
isoteric amino acid can be used.
[0845] Any cysteine residue not involved in maintaining the proper
conformation of the anti-TAT antibody or TAT polypeptide also may
be substituted, generally with serine, to improve the oxidative
stability of the molecule and prevent aberrant crosslinking
Conversely, cysteine bond(s) may be added to the anti-TAT antibody
or TAT polypeptide to improve its stability (particularly where the
antibody is an antibody fragment such as an Fv fragment).
[0846] A particularly preferred type of substitutional variant
involves substituting one or more hypervariable region residues of
a parent antibody (e.g., a humanized or human antibody). Generally,
the resulting variant(s) selected for further development will have
improved biological properties relative to the parent antibody from
which they are generated. A convenient way for generating such
substitutional variants involves affinity maturation using phage
display. Briefly, several hypervariable region sites (e.g., 6-7
sites) are mutated to generate all possible amino substitutions at
each site. The antibody variants thus generated are displayed in a
monovalent fashion from filamentous phage particles as fusions to
the gene III product of M13 packaged within each particle. The
phage-displayed variants are then screened for their biological
activity (e.g., binding affinity) as herein disclosed. In order to
identify candidate hypervariable region sites for modification,
alanine scanning mutagenesis can be performed to identify
hypervariable region residues contributing significantly to antigen
binding. Alternatively, or additionally, it may be beneficial to
analyze a crystal structure of the antigen-antibody complex to
identify contact points between the antibody and human TAT
polypeptide. Such contact residues and neighboring residues are
candidates for substitution according to the techniques elaborated
herein. Once such variants are generated, the panel of variants is
subjected to screening as described herein and antibodies with
superior properties in one or more relevant assays may be selected
for further development.
[0847] Nucleic acid molecules encoding amino acid sequence variants
of the anti-TAT antibody are prepared by a variety of methods known
in the art. These methods include, but are not limited to,
isolation from a natural source (in the case of naturally occurring
amino acid sequence variants) or preparation by
oligonucleotide-mediated (or site-directed) mutagenesis, PCR
mutagenesis, and cassette mutagenesis of an earlier prepared
variant or a non-variant version of the anti-TAT antibody.
[0848] H. Modifications of Anti-TAT Antibodies and TAT
Polypeptides
[0849] Covalent modifications of anti-TAT antibodies and TAT
polypeptides are included within the scope of this invention. One
type of covalent modification includes reacting targeted amino acid
residues of an anti-TAT antibody or TAT polypeptide with an organic
derivatizing agent that is capable of reacting with selected side
chains or the N- or C-terminal residues of the anti-TAT antibody or
TAT polypeptide. Derivatization with bifunctional agents is useful,
for instance, for crosslinking anti-TAT antibody or TAT polypeptide
to a water-insoluble support matrix or surface for use in the
method for purifying anti-TAT antibodies, and vice-versa. Commonly
used crosslinking agents include, e.g.,
1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde,
N-hydroxysuccinimide esters, for example, esters with
4-azidosalicylic acid, homobifunctional imidoesters, including
disuccinimidyl esters such as
3,3'-dithiobis(succinimidylpropionate), bifunctional maleimides
such as bis-N-maleimido-1,8-octane and agents such as
methyl-3-[(.rho.-azidophenyl)dithio]propioimidate.
[0850] Other modifications include deamidation of glutaminyl and
asparaginyl residues to the corresponding glutamyl and aspartyl
residues, respectively, hydroxylation of proline and lysine,
phosphorylation of hydroxyl groups of seryl or threonyl residues,
methylation of the "-amino groups of lysine, arginine, and
histidine side chains [T. E. Creighton, Proteins: Structure and
Molecular Properties, W.H. Freeman & Co., San Francisco, pp.
79-86 (1983)], acetylation of the N-terminal amine, and amidation
of any C-terminal carboxyl group.
[0851] Another type of covalent modification of the anti-TAT
antibody or TAT polypeptide included within the scope of this
invention comprises altering the native glycosylation pattern of
the antibody or polypeptide. "Altering the native glycosylation
pattern" is intended for purposes herein to mean deleting one or
more carbohydrate moieties found in native sequence anti-TAT
antibody or TAT polypeptide (either by removing the underlying
glycosylation site or by deleting the glycosylation by chemical
and/or enzymatic means), and/or adding one or more glycosylation
sites that are not present in the native sequence anti-TAT antibody
or TAT polypeptide. In addition, the phrase includes qualitative
changes in the glycosylation of the native proteins, involving a
change in the nature and proportions of the various carbohydrate
moieties present.
[0852] Glycosylation of antibodies and other polypeptides is
typically either N-linked or O-linked. N-linked refers to the
attachment of the carbohydrate moiety to the side chain of an
asparagine residue. The tripeptide sequences asparagine-X-serine
and asparagine-X-threonine, where X is any amino acid except
proline, are the recognition sequences for enzymatic attachment of
the carbohydrate moiety to the asparagine side chain. Thus, the
presence of either of these tripeptide sequences in a polypeptide
creates a potential glycosylation site. O-linked glycosylation
refers to the attachment of one of the sugars N-aceylgalactosamine,
galactose, or xylose to a hydroxyamino acid, most commonly serine
or threonine, although 5-hydroxyproline or 5-hydroxylysine may also
be used.
[0853] Addition of glycosylation sites to the anti-TAT antibody or
TAT polypeptide is conveniently accomplished by altering the amino
acid sequence such that it contains one or more of the
above-described tripeptide sequences (for N-linked glycosylation
sites). The alteration may also be made by the addition of, or
substitution by, one or more serine or threonine residues to the
sequence of the original anti-TAT antibody or TAT polypeptide (for
O-linked glycosylation sites). The anti-TAT antibody or TAT
polypeptide amino acid sequence may optionally be altered through
changes at the DNA level, particularly by mutating the DNA encoding
the anti-TAT antibody or TAT polypeptide at preselected bases such
that codons are generated that will translate into the desired
amino acids.
[0854] Another means of increasing the number of carbohydrate
moieties on the anti-TAT antibody or TAT polypeptide is by chemical
or enzymatic coupling of glycosides to the polypeptide. Such
methods are described in the art, e.g., in WO 87/05330 published 11
Sep. 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp.
259-306 (1981).
[0855] Removal of carbohydrate moieties present on the anti-TAT
antibody or TAT polypeptide may be accomplished chemically or
enzymatically or by mutational substitution of codons encoding for
amino acid residues that serve as targets for glycosylation.
Chemical deglycosylation techniques are known in the art and
described, for instance, by Hakimuddin, et al., Arch. Biochem.
Biophys., 259:52 (1987) and by Edge et al., Anal. Biochem., 118:131
(1981). Enzymatic cleavage of carbohydrate moieties on polypeptides
can be achieved by the use of a variety of endo- and
exo-glycosidases as described by Thotakura et al., Meth. Enzymol.,
138:350 (1987).
[0856] Another type of covalent modification of anti-TAT antibody
or TAT polypeptide comprises linking the antibody or polypeptide to
one of a variety of nonproteinaceous polymers, e.g., polyethylene
glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the
manner set forth in U.S. Pat. No. 4,640,835; 4,496,689; 4,301,144;
4,670,417; 4,791,192 or 4,179,337. The antibody or polypeptide also
may be entrapped in microcapsules prepared, for example, by
coacervation techniques or by interfacial polymerization (for
example, hydroxymethylcellulose or gelatin-microcapsules and
poly-(methylmethacylate) microcapsules, respectively), in colloidal
drug delivery systems (for example, liposomes, albumin
microspheres, microemulsions, nano-particles and nanocapsules), or
in macroemulsions. Such techniques are disclosed in Remington's
Pharmaceutical Sciences, 16th edition, Oslo, A., Ed., (1980).
[0857] The anti-TAT antibody or TAT polypeptide of the present
invention may also be modified in a way to form chimeric molecules
comprising an anti-TAT antibody or TAT polypeptide fused to
another, heterologous polypeptide or amino acid sequence.
[0858] In one embodiment, such a chimeric molecule comprises a
fusion of the anti-TAT antibody or TAT polypeptide with a tag
polypeptide which provides an epitope to which an anti-tag antibody
can selectively bind. The epitope tag is generally placed at the
amino- or carboxyl-terminus of the anti-TAT antibody or TAT
polypeptide. The presence of such epitope-tagged forms of the
anti-TAT antibody or TAT polypeptide can be detected using an
antibody against the tag polypeptide. Also, provision of the
epitope tag enables the anti-TAT antibody or TAT polypeptide to be
readily purified by affinity purification using an anti-tag
antibody or another type of affinity matrix that binds to the
epitope tag. Various tag polypeptides and their respective
antibodies are well known in the art. Examples include
poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly)
tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et
al., Mol. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the
8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al.,
Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes
Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et
al., Protein Engineering, 3(6):547-553 (1990)]. Other tag
polypeptides include the Flag-peptide [Hopp et al., BioTechnology,
6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al.,
Science, 255:192-194 (1992)]; an "-tubulin epitope peptide [Skinner
et al., J. Biol. Chem., 266:15163-15166 (1991)]; and the T7 gene 10
protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci.
USA, 87:6393-6397 (1990)].
[0859] In an alternative embodiment, the chimeric molecule may
comprise a fusion of the anti-TAT antibody or TAT polypeptide with
an immunoglobulin or a particular region of an immunoglobulin. For
a bivalent form of the chimeric molecule (also referred to as an
"immunoadhesin"), such a fusion could be to the Fc region of an IgG
molecule. The Ig fusions preferably include the substitution of a
soluble (transmembrane domain deleted or inactivated) form of an
anti-TAT antibody or TAT polypeptide in place of at least one
variable region within an Ig molecule. In a particularly preferred
embodiment, the immunoglobulin fusion includes the hinge, CH.sub.2
and CH.sub.3, or the hinge, CH.sub.1, CH.sub.2 and CH.sub.3 regions
of an IgG1 molecule. For the production of immunoglobulin fusions
see also U.S. Pat. No. 5,428,130 issued Jun. 27, 1995.
[0860] I. Preparation of Anti-TAT Antibodies and TAT
Polypeptides
[0861] The description below relates primarily to production of
anti-TAT antibodies and TAT polypeptides by culturing cells
transformed or transfected with a vector containing anti-TAT
antibody- and TAT polypeptide-encoding nucleic acid. It is, of
course, contemplated that alternative methods, which are well known
in the art, may be employed to prepare anti-TAT antibodies and TAT
polypeptides. For instance, the appropriate amino acid sequence, or
portions thereof, may be produced by direct peptide synthesis using
solid-phase techniques [see, e.g., Stewart et al., Solid-Phase
Peptide Synthesis, W.H. Freeman Co., San Francisco, Calif. (1969);
Merrifield, J. Am. Chem. Soc., 85:2149-2154 (1963)]. In vitro
protein synthesis may be performed using manual techniques or by
automation. Automated synthesis may be accomplished, for instance,
using an Applied Biosystems Peptide Synthesizer (Foster City,
Calif.) using manufacturer's instructions. Various portions of the
anti-TAT antibody or TAT polypeptide may be chemically synthesized
separately and combined using chemical or enzymatic methods to
produce the desired anti-TAT antibody or TAT polypeptide.
[0862] 1. Isolation of DNA Encoding Anti-TAT Antibody or TAT
Polypeptide
[0863] DNA encoding anti-TAT antibody or TAT polypeptide may be
obtained from a cDNA library prepared from tissue believed to
possess the anti-TAT antibody or TAT polypeptide mRNA and to
express it at a detectable level. Accordingly, human anti-TAT
antibody or TAT polypeptide DNA can be conveniently obtained from a
cDNA library prepared from human tissue. The anti-TAT antibody- or
TAT polypeptide-encoding gene may also be obtained from a genomic
library or by known synthetic procedures (e.g., automated nucleic
acid synthesis).
[0864] Libraries can be screened with probes (such as
oligonucleotides of at least about 20-80 bases) designed to
identify the gene of interest or the protein encoded by it.
Screening the cDNA or genomic library with the selected probe may
be conducted using standard procedures, such as described in
Sambrook et al., Molecular Cloning: A Laboratory Manual (New York:
Cold Spring Harbor Laboratory Press, 1989). An alternative means to
isolate the gene encoding anti-TAT antibody or TAT polypeptide is
to use PCR methodology [Sambrook et al., supra; Dieffenbach et al.,
PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory
Press, 1995)].
[0865] Techniques for screening a cDNA library are well known in
the art. The oligonucleotide sequences selected as probes should be
of sufficient length and sufficiently unambiguous that false
positives are minimized. The oligonucleotide is preferably labeled
such that it can be detected upon hybridization to DNA in the
library being screened. Methods of labeling are well known in the
art, and include the use of radiolabels like .sup.32P-labeled ATP,
biotinylation or enzyme labeling. Hybridization conditions,
including moderate stringency and high stringency, are provided in
Sambrook et al., supra.
[0866] Sequences identified in such library screening methods can
be compared and aligned to other known sequences deposited and
available in public databases such as GenBank or other private
sequence databases. Sequence identity (at either the amino acid or
nucleotide level) within defined regions of the molecule or across
the full-length sequence can be determined using methods known in
the art and as described herein.
[0867] Nucleic acid having protein coding sequence may be obtained
by screening selected cDNA or genomic libraries using the deduced
amino acid sequence disclosed herein for the first time, and, if
necessary, using conventional primer extension procedures as
described in Sambrook et al., supra, to detect precursors and
processing intermediates of mRNA that may not have been
reverse-transcribed into cDNA.
[0868] 2. Selection and Transformation of Host Cells
[0869] Host cells are transfected or transformed with expression or
cloning vectors described herein for anti-TAT antibody or TAT
polypeptide production and cultured in conventional nutrient media
modified as appropriate for inducing promoters, selecting
transformants, or amplifying the genes encoding the desired
sequences. The culture conditions, such as media, temperature, pH
and the like, can be selected by the skilled artisan without undue
experimentation. In general, principles, protocols, and practical
techniques for maximizing the productivity of cell cultures can be
found in Mammalian Cell Biotechnology: a Practical Approach, M.
Butler, ed. (IRL Press, 1991) and Sambrook et al., supra.
[0870] Methods of eukaryotic cell transfection and prokaryotic cell
transformation are known to the ordinarily skilled artisan, for
example, CaCl.sub.2, CaPO.sub.4, liposome-mediated and
electroporation. Depending on the host cell used, transformation is
performed using standard techniques appropriate to such cells. The
calcium treatment employing calcium chloride, as described in
Sambrook et al., supra, or electroporation is generally used for
prokaryotes. Infection with Agrobacterium tumefaciens is used for
transformation of certain plant cells, as described by Shaw et al.,
Gene, 23:315 (1983) and WO 89/05859 published 29 Jun. 1989. For
mammalian cells without such cell walls, the calcium phosphate
precipitation method of Graham and van der Eb, Virology, 52:456-457
(1978) can be employed. General aspects of mammalian cell host
system transfections have been described in U.S. Pat. No.
4,399,216. Transformations into yeast are typically carried out
according to the method of Van Solingen et al., J. Bact., 130:946
(1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA), 76:3829
(1979). However, other methods for introducing DNA into cells, such
as by nuclear microinjection, electroporation, bacterial protoplast
fusion with intact cells, or polycations, e.g., polybrene,
polyornithine, may also be used. For various techniques for
transforming mammalian cells, see Keown et al., Methods in
Enzymology, 185:527-537 (1990) and Mansour et al., Nature,
336:348-352 (1988).
[0871] Suitable host cells for cloning or expressing the DNA in the
vectors herein include prokaryote, yeast, or higher eukaryote
cells. Suitable prokaryotes include but are not limited to
eubacteria, such as Gram-negative or Gram-positive organisms, for
example, Enterobacteriaceae such as E. coli. Various E. coli
strains are publicly available, such as E. coli K12 strain MM294
(ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strain W3110
(ATCC 27,325) and K5 772 (ATCC 53,635). Other suitable prokaryotic
host cells include Enterobacteriaceae such as Escherichia, e.g., E.
coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g.,
Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and
Shigella, as well as Bacilli such as B. subtilis and B.
licheniformis (e.g., B. licheniformis 41P disclosed in DD 266,710
published 12 Apr. 1989), Pseudomonas such as P. aeruginosa, and
Streptomyces. These examples are illustrative rather than limiting.
Strain W3110 is one particularly preferred host or parent host
because it is a common host strain for recombinant DNA product
fermentations. Preferably, the host cell secretes minimal amounts
of proteolytic enzymes. For example, strain W3110 may be modified
to effect a genetic mutation in the genes encoding proteins
endogenous to the host, with examples of such hosts including E.
coli W3110 strain 1A2, which has the complete genotype tonA; E.
coli W3110 strain 9E4, which has the complete genotype tonA ptr3;
E. coli W3110 strain 27C7 (ATCC 55,244), which has the complete
genotype tonA ptr3 phoA E15 (argF-lac)169 degP ompT kan.sup.r; E.
coli W3110 strain 37D6, which has the complete genotype tonA ptr3
phoA E15 (argF-lac)169 degP ompT rbs7 ilvG kan.sup.r; E. coli W3110
strain 40B4, which is strain 37D6 with a non-kanamycin resistant
degP deletion mutation; and an E. coli strain having mutant
periplasmic protease disclosed in U.S. Pat. No. 4,946,783 issued 7
Aug. 1990. Alternatively, in vitro methods of cloning, e.g., PCR or
other nucleic acid polymerase reactions, are suitable.
[0872] Full length antibody, antibody fragments, and antibody
fusion proteins can be produced in bacteria, in particular when
glycosylation and Fc effector function are not needed, such as when
the therapeutic antibody is conjugated to a cytotoxic agent (e.g.,
a toxin) and the immunoconjugate by itself shows effectiveness in
tumor cell destruction. Full length antibodies have greater half
life in circulation. Production in E. coli is faster and more cost
efficient. For expression of antibody fragments and polypeptides in
bacteria, see, e.g., U.S. Pat. No. 5,648,237 (Carter et. al.), U.S.
Pat. No. 5,789,199 (Jolt' et al.), and U.S. Pat. No. 5,840,523
(Simmons et al.) which describes translation initiation regio (TIR)
and signal sequences for optimizing expression and secretion, these
patents incorporated herein by reference. After expression, the
antibody is isolated from the E. coli cell paste in a soluble
fraction and can be purified through, e.g., a protein A or G column
depending on the isotype. Final purification can be carried out
similar to the process for purifying antibody expressed e.g, in CHO
cells.
[0873] In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression hosts
for anti-TAT antibody- or TAT polypeptide-encoding vectors.
Saccharomyces cerevisiae is a commonly used lower eukaryotic host
microorganism. Others include Schizosaccharomyces pombe (Beach and
Nurse, Nature, 290: 140 [1981]; EP 139,383 published 2 May 1985);
Kluyveromyces hosts (U.S. Pat. No. 4,943,529; Fleer et al.,
Bio/Technology, 9:968-975 (1991)) such as, e.g., K. lactis
(MW98-8C, CBS683, CBS4574; Louvencourt et al., J. Bacteriol.,
154(2):737-742 [1983]), K. fragilis (ATCC 12,424), K. bulgaricus
(ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC
56,500), K. drosophilarum (ATCC 36,906; Van den Berg et al.,
Bio/Technology, 8:135 (1990)), K. thermotolerans, and K. marxianus;
yarrowia (EP 402,226); Pichia pastoris (EP 183,070; Sreekrishna et
al., J. Basic Microbiol., 28:265-278 [1988]); Candida; Trichoderma
reesia (EP 244,234); Neurospora crassa (Case et al., Proc. Natl.
Acad. Sci. USA, 76:5259-5263 [1979]); Schwanniomyces such as
Schwanniomyces occidentalis (EP 394,538 published 31 Oct. 1990);
and filamentous fungi such as, e.g., Neurospora, Penicillium,
Tolypocladium (WO 91/00357 published 10 Jan. 1991), and Aspergillus
hosts such as A. nidulans (Ballance et al., Biochem. Biophys. Res.
Commun., 112:284-289 [1983]; Tilburn et al., Gene, 26:205-221
[1983]; Yelton et al., Proc. Natl. Acad. Sci. USA, 81: 1470-1474
[1984]) and A. niger (Kelly and Hynes, EMBO J., 4:475-479 [1985]).
Methylotropic yeasts are suitable herein and include, but are not
limited to, yeast capable of growth on methanol selected from the
genera consisting of Hansenula, Candida, Kloeckera, Pichia,
Saccharomyces, Torulopsis, and Rhodotorula. A list of specific
species that are exemplary of this class of yeasts may be found in
C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).
[0874] Suitable host cells for the expression of glycosylated
anti-TAT antibody or TAT polypeptide are derived from multicellular
organisms. Examples of invertebrate cells include insect cells such
as Drosophila S2 and Spodoptera Sf9, as well as plant cells, such
as cell cultures of cotton, corn, potato, soybean, petunia, tomato,
and tobacco. Numerous baculoviral strains and variants and
corresponding permissive insect host cells from hosts such as
Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito),
Aedes albopictus (mosquito), Drosophila melanogaster (fruitfly),
and Bombyx mori have been identified. A variety of viral strains
for transfection are publicly available, e.g., the L-1 variant of
Autographa califormica NPV and the Bm-5 strain of Bombyx mori NPV,
and such viruses may be used as the virus herein according to the
present invention, particularly for transfection of Spodoptera
frugiperda cells.
[0875] However, interest has been greatest in vertebrate cells, and
propagation of vertebrate cells in culture (tissue culture) has
become a routine procedure. Examples of useful mammalian host cell
lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC
CRL 1651); human embryonic kidney line (293 or 293 cells subcloned
for growth in suspension culture, Graham et al., J. Gen Virol.
36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10);
Chinese hamster ovary cells/-DHFR(CHO, Urlaub et al., Proc. Natl.
Acad. Sci. USA 77:4216 (1980)); mouse sertoli cells (TM4, Mather,
Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL
70); African green monkey kidney cells (VERO-76, ATCC CRL-1587);
human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney
cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC
CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells
(Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51);
TRI cells (Mather et al., Annals N.Y. Acad. Sci. 383:44-68 (1982));
MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2).
[0876] Host cells are transformed with the above-described
expression or cloning vectors for anti-TAT antibody or TAT
polypeptide production and cultured in conventional nutrient media
modified as appropriate for inducing promoters, selecting
transformants, or amplifying the genes encoding the desired
sequences.
[0877] 3. Selection and Use of a Replicable Vector
[0878] The nucleic acid (e.g., cDNA or genomic DNA) encoding
anti-TAT antibody or TAT polypeptide may be inserted into a
replicable vector for cloning (amplification of the DNA) or for
expression. Various vectors are publicly available. The vector may,
for example, be in the form of a plasmid, cosmid, viral particle,
or phage. The appropriate nucleic acid sequence may be inserted
into the vector by a variety of procedures. In general, DNA is
inserted into an appropriate restriction endonuclease site(s) using
techniques known in the art. Vector components generally include,
but are not limited to, one or more of a signal sequence, an origin
of replication, one or more marker genes, an enhancer element, a
promoter, and a transcription termination sequence. Construction of
suitable vectors containing one or more of these components employs
standard ligation techniques which are known to the skilled
artisan.
[0879] The TAT may be produced recombinantly not only directly, but
also as a fusion polypeptide with a heterologous polypeptide, which
may be a signal sequence or other polypeptide having a specific
cleavage site at the N-terminus of the mature protein or
polypeptide. In general, the signal sequence may be a component of
the vector, or it may be a part of the anti-TAT antibody- or TAT
polypeptide-encoding DNA that is inserted into the vector. The
signal sequence may be a prokaryotic signal sequence selected, for
example, from the group of the alkaline phosphatase, penicillinase,
1 pp, or heat-stable enterotoxin II leaders. For yeast secretion
the signal sequence may be, e.g., the yeast invertase leader, alpha
factor leader (including Saccharomyces and Kluyveromyces "-factor
leaders, the latter described in U.S. Pat. No. 5,010,182), or acid
phosphatase leader, the C. albicans glucoamylase leader (EP 362,179
published 4 Apr. 1990), or the signal described in WO 90/13646
published 15 November 1990. In mammalian cell expression, mammalian
signal sequences may be used to direct secretion of the protein,
such as signal sequences from secreted polypeptides of the same or
related species, as well as viral secretory leaders.
[0880] Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more
selected host cells. Such sequences are well known for a variety of
bacteria, yeast, and viruses. The origin of replication from the
plasmid pBR322 is suitable for most Gram-negative bacteria, the 2:
plasmid origin is suitable for yeast, and various viral origins
(SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning
vectors in mammalian cells.
[0881] Expression and cloning vectors will typically contain a
selection gene, also termed a selectable marker. Typical selection
genes encode proteins that (a) confer resistance to antibiotics or
other toxins, e.g., ampicillin, neomycin, methotrexate, or
tetracycline, (b) complement auxotrophic deficiencies, or (c)
supply critical nutrients not available from complex media, e.g.,
the gene encoding D-alanine racemase for Bacilli.
[0882] An example of suitable selectable markers for mammalian
cells are those that enable the identification of cells competent
to take up the anti-TAT antibody- or TAT polypeptide-encoding
nucleic acid, such as DHFR or thymidine kinase. An appropriate host
cell when wild-type DHFR is employed is the CHO cell line deficient
in DHFR activity, prepared and propagated as described by Urlaub et
al., Proc. Natl. Acad. Sci. USA, 77:4216 (1980). A suitable
selection gene for use in yeast is the trp1 gene present in the
yeast plasmid YRp7 [Stinchcomb et al., Nature, 282:39 (1979);
Kingsman et al., Gene, 7:141 (1979); Tschemper et al., Gene, 10:157
(1980)]. The trp1 gene provides a selection marker for a mutant
strain of yeast lacking the ability to grow in tryptophan, for
example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85:12
(1977)].
[0883] Expression and cloning vectors usually contain a promoter
operably linked to the anti-TAT antibody- or TAT
polypeptide-encoding nucleic acid sequence to direct mRNA
synthesis. Promoters recognized by a variety of potential host
cells are well known. Promoters suitable for use with prokaryotic
hosts include the .beta.-lactamase and lactose promoter systems
[Chang et al., Nature, 275:615 (1978); Goeddel et al., Nature,
281:544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter
system [Goeddel, Nucleic Acids Res., 8:4057 (1980); EP 36,776], and
hybrid promoters such as the tac promoter [deBoer et al., Proc.
Natl. Acad. Sci. USA, 80:21-25 (1983)]. Promoters for use in
bacterial systems also will contain a Shine-Dalgarno (S.D.)
sequence operably linked to the DNA encoding anti-TAT antibody or
TAT polypeptide.
[0884] Examples of suitable promoting sequences for use with yeast
hosts include the promoters for 3-phosphoglycerate kinase [Hitzeman
et al., J. Biol. Chem., 255:2073 (1980)] or other glycolytic
enzymes [Hess et al., J. Adv. Enzyme Reg., 7:149 (1968); Holland,
Biochemistry, 17:4900 (1978)], such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
[0885] Other yeast promoters, which are inducible promoters having
the additional advantage of transcription controlled by growth
conditions, are the promoter regions for alcohol dehydrogenase 2,
isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionein,
glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible
for maltose and galactose utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP
73,657.
[0886] Anti-TAT antibody or TAT polypeptide transcription from
vectors in mammalian host cells is controlled, for example, by
promoters obtained from the genomes of viruses such as polyoma
virus, fowlpox virus (UK 2,211,504 published 5 Jul. 1989),
adenovirus (such as Adenovirus 2), bovine papilloma virus, avian
sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and
Simian Virus 40 (SV40), from heterologous mammalian promoters,
e.g., the actin promoter or an immunoglobulin promoter, and from
heat-shock promoters, provided such promoters are compatible with
the host cell systems.
[0887] Transcription of a DNA encoding the anti-TAT antibody or TAT
polypeptide by higher eukaryotes may be increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp, that act on a
promoter to increase its transcription. Many enhancer sequences are
now known from mammalian genes (globin, elastase, albumin,
.alpha.-fetoprotein, and insulin). Typically, however, one will use
an enhancer from a eukaryotic cell virus. Examples include the SV40
enhancer on the late side of the replication origin (bp 100-270),
the cytomegalovirus early promoter enhancer, the polyoma enhancer
on the late side of the replication origin, and adenovirus
enhancers. The enhancer may be spliced into the vector at a
position 5' or 3' to the anti-TAT antibody or TAT polypeptide
coding sequence, but is preferably located at a site 5' from the
promoter.
[0888] Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human, or nucleated cells from other
multicellular organisms) will also contain sequences necessary for
the termination of transcription and for stabilizing the mRNA. Such
sequences are commonly available from the 5' and, occasionally 3',
untranslated regions of eukaryotic or viral DNAs or cDNAs. These
regions contain nucleotide segments transcribed as polyadenylated
fragments in the untranslated portion of the mRNA encoding anti-TAT
antibody or TAT polypeptide.
[0889] Still other methods, vectors, and host cells suitable for
adaptation to the synthesis of anti-TAT antibody or TAT polypeptide
in recombinant vertebrate cell culture are described in Gething et
al., Nature, 293:620-625 (1981); Mantei et al., Nature, 281:40-46
(1979); EP 117,060; and EP 117,058.
[0890] 4. Culturing the Host Cells
[0891] The host cells used to produce the anti-TAT antibody or TAT
polypeptide of this invention may be cultured in a variety of
media. Commercially available media such as Ham's F10 (Sigma),
Minimal Essential Medium ((MEM), (Sigma), RPMI-1640 (Sigma), and
Dulbecco's Modified Eagle's Medium ((DMEM), Sigma) are suitable for
culturing the host cells. In addition, any of the media described
in Ham et al., Meth. Enz. 58:44 (1979), Barnes et al., Anal.
Biochem. 102:255 (1980), U.S. Pat. Nos. 4,767,704; 4,657,866;
4,927,762; 4,560,655; or 5,122,469; WO 90/03430; WO 87/00195; or
U.S. Patent Re. 30,985 may be used as culture media for the host
cells. Any of these media may be supplemented as necessary with
hormones and/or other growth factors (such as insulin, transferrin,
or epidermal growth factor), salts (such as sodium chloride,
calcium, magnesium, and phosphate), buffers (such as HEPES),
nucleotides (such as adenosine and thymidine), antibiotics (such as
GENTAMYCINT.TM. drug), trace elements (defined as inorganic
compounds usually present at final concentrations in the micromolar
range), and glucose or an equivalent energy source. Any other
necessary supplements may also be included at appropriate
concentrations that would be known to those skilled in the art. The
culture conditions, such as temperature, pH, and the like, are
those previously used with the host cell selected for expression,
and will be apparent to the ordinarily skilled artisan.
[0892] 5. Detecting Gene Amplification/Expression
[0893] Gene amplification and/or expression may be measured in a
sample directly, for example, by conventional Southern blotting,
Northern blotting to quantitate the transcription of mRNA [Thomas,
Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)], dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Alternatively,
antibodies may be employed that can recognize specific duplexes,
including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes
or DNA-protein duplexes. The antibodies in turn may be labeled and
the assay may be carried out where the duplex is bound to a
surface, so that upon the formation of duplex on the surface, the
presence of antibody bound to the duplex can be detected.
[0894] Gene expression, alternatively, may be measured by
immunological methods, such as immunohistochemical staining of
cells or tissue sections and assay of cell culture or body fluids,
to quantitate directly the expression of gene product. Antibodies
useful for immunohistochemical staining and/or assay of sample
fluids may be either monoclonal or polyclonal, and may be prepared
in any mammal. Conveniently, the antibodies may be prepared against
a native sequence TAT polypeptide or against a synthetic peptide
based on the DNA sequences provided herein or against exogenous
sequence fused to TAT DNA and encoding a specific antibody
epitope.
[0895] 6. Purification of Anti-TAT Antibody and TAT Polypeptide
[0896] Forms of anti-TAT antibody and TAT polypeptide may be
recovered from culture medium or from host cell lysates. If
membrane-bound, it can be released from the membrane using a
suitable detergent solution (e.g. Triton-X 100) or by enzymatic
cleavage. Cells employed in expression of anti-TAT antibody and TAT
polypeptide can be disrupted by various physical or chemical means,
such as freeze-thaw cycling, sonication, mechanical disruption, or
cell lysing agents.
[0897] It may be desired to purify anti-TAT antibody and TAT
polypeptide from recombinant cell proteins or polypeptides. The
following procedures are exemplary of suitable purification
procedures: by fractionation on an ion-exchange column; ethanol
precipitation; reverse phase HPLC; chromatography on silica or on a
cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE;
ammonium sulfate precipitation; gel filtration using, for example,
Sephadex G-75; protein A Sepharose columns to remove contaminants
such as IgG; and metal chelating columns to bind epitope-tagged
forms of the anti-TAT antibody and TAT polypeptide. Various methods
of protein purification may be employed and such methods are known
in the art and described for example in Deutscher, Methods in
Enzymology, 182 (1990); Scopes, Protein Purification: Principles
and Practice, Springer-Verlag, New York (1982). The purification
step(s) selected will depend, for example, on the nature of the
production process used and the particular anti-TAT antibody or TAT
polypeptide produced.
[0898] When using recombinant techniques, the antibody can be
produced intracellularly, in the periplasmic space, or directly
secreted into the medium. If the antibody is produced
intracellularly, as a first step, the particulate debris, either
host cells or lysed fragments, are removed, for example, by
centrifugation or ultrafiltration. Carter et al., Bio/Technology
10:163-167 (1992) describe a procedure for isolating antibodies
which are secreted to the periplasmic space of E. coli. Briefly,
cell paste is thawed in the presence of sodium acetate (pH 3.5),
EDTA, and phenylmethylsulfonylfluoride (PMSF) over about 30 min.
Cell debris can be removed by centrifugation. Where the antibody is
secreted into the medium, supernatants from such expression systems
are generally first concentrated using a commercially available
protein concentration filter, for example, an Amicon or Millipore
Pellicon ultrafiltration unit. A protease inhibitor such as PMSF
may be included in any of the foregoing steps to inhibit
proteolysis and antibiotics may be included to prevent the growth
of adventitious contaminants.
[0899] The antibody composition prepared from the cells can be
purified using, for example, hydroxylapatite chromatography, gel
electrophoresis, dialysis, and affinity chromatography, with
affinity chromatography being the preferred purification technique.
The suitability of protein A as an affinity ligand depends on the
species and isotype of any immunoglobulin Fc domain that is present
in the antibody. Protein A can be used to purify antibodies that
are based on human (1, (2 or (4 heavy chains (Lindmark et al., J.
Immunol. Meth. 62:1-13 (1983)). Protein G is recommended for all
mouse isotypes and for human (3 (Guss et al., EMBO J. 5:15671575
(1986)). The matrix to which the affinity ligand is attached is
most often agarose, but other matrices are available. Mechanically
stable matrices such as controlled pore glass or
poly(styrenedivinyl)benzene allow for faster flow rates and shorter
processing times than can be achieved with agarose. Where the
antibody comprises a C.sub.H3 domain, the Bakerbond ABX.TM.resin
(J. T. Baker, Phillipsburg, N.J.) is useful for purification. Other
techniques for protein purification such as fractionation on an
ion-exchange column, ethanol precipitation, Reverse Phase HPLC,
chromatography on silica, chromatography on heparin SEPHAROSE.TM.
chromatography on an anion or cation exchange resin (such as a
polyaspartic acid column), chromatofocusing, SDS-PAGE, and ammonium
sulfate precipitation are also available depending on the antibody
to be recovered.
[0900] Following any preliminary purification step(s), the mixture
comprising the antibody of interest and contaminants may be
subjected to low pH hydrophobic interaction chromatography using an
elution buffer at a pH between about 2.5-4.5, preferably performed
at low salt concentrations (e.g., from about 0-0.25M salt).
[0901] J. Pharmaceutical Formulations
[0902] Therapeutic formulations of the anti-TAT antibodies, TAT
binding oligopeptides, TAT siRNA, TAT binding organic molecules
and/or TAT polypeptides used in accordance with the present
invention are prepared for storage by mixing the antibody,
polypeptide, oligopeptide, siRNA or organic molecule having the
desired degree of purity with optional pharmaceutically acceptable
carriers, excipients or stabilizers (Remington's Pharmaceutical
Sciences 16th edition, Osol, A. Ed. (1980)), in the form of
lyophilized formulations or aqueous solutions. Acceptable carriers,
excipients, or stabilizers are nontoxic to recipients at the
dosages and concentrations employed, and include buffers such as
acetate, Tris, phosphate, citrate, and other organic acids;
antioxidants including ascorbic acid and methionine; preservatives
(such as octadecyldimethylbenzyl ammonium chloride; hexamethonium
chloride; benzalkonium chloride, benzethonium chloride; phenol,
butyl or benzyl alcohol; alkyl parabens such as methyl or propyl
paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and
m-cresol); low molecular weight (less than about 10 residues)
polypeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids such as glycine, glutamine, asparagine, histidine,
arginine, or lysine; monosaccharides, disaccharides, and other
carbohydrates including glucose, mannose, or dextrins; chelating
agents such as EDTA; tonicifiers such as trehalose and sodium
chloride; sugars such as sucrose, mannitol, trehalose or sorbitol;
surfactant such as polysorbate; salt-forming counter-ions such as
sodium; metal complexes (e.g., Zn-protein complexes); and/or
non-ionic surfactants such as TWEEN.RTM., PLURONICS.RTM. or
polyethylene glycol (PEG). The antibody preferably comprises the
antibody at a concentration of between 5-200 mg/ml, preferably
between 10-100 mg/ml.
[0903] The formulations herein may also contain more than one
active compound as necessary for the particular indication being
treated, preferably those with complementary activities that do not
adversely affect each other. For example, in addition to an
anti-TAT antibody, TAT binding oligopeptide, TAT siRNA or TAT
binding organic molecule, it may be desirable to include in the one
formulation, an additional antibody, e.g., a second anti-TAT
antibody which binds a different epitope on the TAT polypeptide, or
an antibody to some other target such as a growth factor that
affects the growth of the particular cancer. Alternatively, or
additionally, the composition may further comprise a
chemotherapeutic agent, cytotoxic agent, cytokine, growth
inhibitory agent, anti-hormonal agent, and/or cardioprotectant.
Such molecules are suitably present in combination in amounts that
are effective for the purpose intended.
[0904] The active ingredients may also be entrapped in
microcapsules prepared, for example, by coacervation techniques or
by interfacial polymerization, for example, hydroxymethylcellulose
or gelatin-microcapsules and poly-(methylmethacylate)
microcapsules, respectively, in colloidal drug delivery systems
(for example, liposomes, albumin microspheres, microemulsions,
nano-particles and nanocapsules) or in macroemulsions. Such
techniques are disclosed in Remington's Pharmaceutical Sciences,
16th edition, Osol, A. Ed. (1980).
[0905] Sustained-release preparations may be prepared. Suitable
examples of sustained-release preparations include semi-permeable
matrices of solid hydrophobic polymers containing the antibody,
which matrices are in the form of shaped articles, e.g., films, or
microcapsules. Examples of sustained-release matrices include
polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and (ethyl-L-glutamate, non-degradable ethylene-vinyl acetate,
degradable lactic acid-glycolic acid copolymers such as the LUPRON
DEPOT.RTM. (injectable microspheres composed of lactic
acid-glycolic acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid.
[0906] The formulations to be used for in vivo administration must
be sterile. This is readily accomplished by filtration through
sterile filtration membranes.
[0907] K. Diagnosis and Treatment with Anti-TAT Antibodies, TAT
Binding Oligopeptides, TAT siRNA and TAT Binding Organic
Molecules
[0908] To determine TAT expression in the cancer, various
diagnostic assays are available. In one embodiment, TAT polypeptide
overexpression may be analyzed by immunohistochemistry (IHC).
Parrafin embedded tissue sections from a tumor biopsy may be
subjected to the IHC assay and accorded a TAT protein staining
intensity criteria as follows:
[0909] Score 0--no staining is observed or membrane staining is
observed in less than 10% of tumor cells.
[0910] Score 1+--a faint/barely perceptible membrane staining is
detected in more than 10% of the tumor cells. The cells are only
stained in part of their membrane.
[0911] Score 2+--a weak to moderate complete membrane staining is
observed in more than 10% of the tumor cells.
[0912] Score 3+--a moderate to strong complete membrane staining is
observed in more than 10% of the tumor cells.
[0913] Those tumors with 0 or 1+ scores for TAT polypeptide
expression may be characterized as not overexpressing TAT, whereas
those tumors with 2+ or 3+ scores may be characterized as
overexpressing TAT.
[0914] Alternatively, or additionally, FISH assays such as the
INFORM.degree. (sold by Ventana, Ariz.) or PATHVISION.RTM. (Vysis,
Ill.) may be carried out on formalin-fixed, paraffin-embedded tumor
tissue to determine the extent (if any) of TAT overexpression in
the tumor.
[0915] TAT overexpression or amplification may be evaluated using
an in vivo diagnostic assay, e.g., by administering a molecule
(such as an antibody, oligopeptide or organic molecule) which binds
the molecule to be detected and is tagged with a detectable label
(e.g., a radioactive isotope or a fluorescent label) and externally
scanning the patient for localization of the label.
[0916] As described above, the anti-TAT antibodies, oligopeptides
and organic molecules of the invention have various non-therapeutic
applications. The anti-TAT antibodies, oligopeptides and organic
molecules of the present invention can be useful for diagnosis and
staging of TAT polypeptide-expressing cancers (e.g., in
radioimaging). The antibodies, oligopeptides and organic molecules
are also useful for purification or immunoprecipitation of TAT
polypeptide from cells, for detection and quantitation of TAT
polypeptide in vitro, e.g., in an ELISA or a Western blot, to kill
and eliminate TAT-expressing cells from a population of mixed cells
as a step in the purification of other cells.
[0917] Currently, depending on the stage of the cancer, cancer
treatment involves one or a combination of the following therapies:
surgery to remove the cancerous tissue, radiation therapy, and
chemotherapy. Anti-TAT antibody, oligopeptide, siRNA or organic
molecule therapy may be especially desirable in elderly patients
who do not tolerate the toxicity and side effects of chemotherapy
well and in metastatic disease where radiation therapy has limited
usefulness. The tumor targeting anti-TAT antibodies, oligopeptides,
siRNA and organic molecules of the invention are useful to
alleviate TAT-expressing cancers upon initial diagnosis of the
disease or during relapse. For therapeutic applications, the
anti-TAT antibody, oligopeptide, siRNA or organic molecule can be
used alone, or in combination therapy with, e.g., hormones,
antiangiogens, or radiolabelled compounds, or with surgery,
cryotherapy, and/or radiotherapy. Anti-TAT antibody, oligopeptide,
siRNA or organic molecule treatment can be administered in
conjunction with other forms of conventional therapy, either
consecutively with, pre- or post-conventional therapy.
Chemotherapeutic drugs such as TAXOTERE.RTM. (docetaxel),
TAXOL.RTM. (palictaxel), estramustine and mitoxantrone are used in
treating cancer, in particular, in good risk patients. In the
present method of the invention for treating or alleviating cancer,
the cancer patient can be administered anti-TAT antibody,
oligopeptide, siRNA or organic molecule in conjunction with
treatment with the one or more of the preceding chemotherapeutic
agents. In particular, combination therapy with palictaxel and
modified derivatives (see, e.g., EP0600517) is contemplated. The
anti-TAT antibody, oligopeptide, siRNA or organic molecule will be
administered with a therapeutically effective dose of the
chemotherapeutic agent. In another embodiment, the anti-TAT
antibody, oligopeptide, siRNA or organic molecule is administered
in conjunction with chemotherapy to enhance the activity and
efficacy of the chemotherapeutic agent, e.g., paclitaxel. The
Physicians' Desk Reference (PDR) discloses dosages of these agents
that have been used in treatment of various cancers. The dosing
regimen and dosages of these aforementioned chemotherapeutic drugs
that are therapeutically effective will depend on the particular
cancer being treated, the extent of the disease and other factors
familiar to the physician of skill in the art and can be determined
by the physician.
[0918] In one particular embodiment, a conjugate comprising an
anti-TAT antibody, oligopeptide, siRNA or organic molecule
conjugated with a cytotoxic agent is administered to the patient.
Preferably, the immunoconjugate bound to the TAT protein is
internalized by the cell, resulting in increased therapeutic
efficacy of the immunoconjugate in killing the cancer cell to which
it binds. In a preferred embodiment, the cytotoxic agent targets or
interferes with the nucleic acid in the cancer cell. Examples of
such cytotoxic agents are described above and include
maytansinoids, calicheamicins, ribonucleases and DNA
endonucleases.
[0919] The anti-TAT antibodies, oligopeptides, organic molecules or
toxin conjugates thereof are administered to a human patient, in
accord with known methods, such as intravenous administration,
e.g., as a bolus or by continuous infusion over a period of time,
by intramuscular, intraperitoneal, intracerobrospinal,
subcutaneous, intra-articular, intrasynovial, intrathecal, oral,
topical, or inhalation routes. Intravenous or subcutaneous
administration of the antibody, oligopeptide or organic molecule is
preferred.
[0920] Other therapeutic regimens may be combined with the
administration of the anti-TAT antibody, oligopeptide or organic
molecule. The combined administration includes co-administration,
using separate formulations or a single pharmaceutical formulation,
and consecutive administration in either order, wherein preferably
there is a time period while both (or all) active agents
simultaneously exert their biological activities. Preferably such
combined therapy results in a synergistic therapeutic effect.
[0921] It may also be desirable to combine administration of the
anti-TAT antibody or antibodies, oligopeptides or organic
molecules, with administration of an antibody directed against
another tumor antigen associated with the particular cancer.
[0922] In another embodiment, the therapeutic treatment methods of
the present invention involves the combined administration of an
anti-TAT antibody (or antibodies), oligopeptides or organic
molecules and one or more chemotherapeutic agents or growth
inhibitory agents, including co-administration of cocktails of
different chemotherapeutic agents. Chemotherapeutic agents include
estramustine phosphate, prednimustine, cisplatin, 5-fluorouracil,
melphalan, cyclophosphamide, hydroxyurea and hydroxyureataxanes
(such as paclitaxel and doxetaxel) and/or anthracycline
antibiotics. Preparation and dosing schedules for such
chemotherapeutic agents may be used according to manufacturers'
instructions or as determined empirically by the skilled
practitioner. Preparation and dosing schedules for such
chemotherapy are also described in Chemotherapy Service Ed., M.C.
Perry, Williams & Wilkins, Baltimore, Md. (1992).
[0923] The antibody, oligopeptide or organic molecule may be
combined with an anti-hormonal compound; e.g., an anti-estrogen
compound such as tamoxifen; an anti-progesterone such as
onapristone (see, EP 616 812); or an anti-androgen such as
flutamide, in dosages known for such molecules. Where the cancer to
be treated is androgen independent cancer, the patient may
previously have been subjected to anti-androgen therapy and, after
the cancer becomes androgen independent, the anti-TAT antibody,
oligopeptide or organic molecule (and optionally other agents as
described herein) may be administered to the patient.
[0924] Sometimes, it may be beneficial to also co-administer a
cardioprotectant (to prevent or reduce myocardial dysfunction
associated with the therapy) or one or more cytokines to the
patient. In addition to the above therapeutic regimes, the patient
may be subjected to surgical removal of cancer cells and/or
radiation therapy, before, simultaneously with, or post antibody,
oligopeptide or organic molecule therapy. Suitable dosages for any
of the above co-administered agents are those presently used and
may be lowered due to the combined action (synergy) of the agent
and anti-TAT antibody, oligopeptide or organic molecule.
[0925] For the prevention or treatment of disease, the dosage and
mode of administration will be chosen by the physician according to
known criteria. The appropriate dosage of antibody, oligopeptide or
organic molecule will depend on the type of disease to be treated,
as defined above, the severity and course of the disease, whether
the antibody, oligopeptide or organic molecule is administered for
preventive or therapeutic purposes, previous therapy, the patient's
clinical history and response to the antibody, oligopeptide or
organic molecule, and the discretion of the attending physician.
The antibody, oligopeptide or organic molecule is suitably
administered to the patient at one time or over a series of
treatments. Preferably, the antibody, oligopeptide or organic
molecule is administered by intravenous infusion or by subcutaneous
injections. Depending on the type and severity of the disease,
about 1.mu./kg to about 50 mg/kg body weight (e.g., about 0.1-15
mg/kg/dose) of antibody can be an initial candidate dosage for
administration to the patient, whether, for example, by one or more
separate administrations, or by continuous infusion. A dosing
regimen can comprise administering an initial loading dose of about
4 mg/kg, followed by a weekly maintenance dose of about 2 mg/kg of
the anti-TAT antibody. However, other dosage regimens may be
useful. A typical daily dosage might range from about 1.mu./kg to
100 mg/kg or more, depending on the factors mentioned above. For
repeated administrations over several days or longer, depending on
the condition, the treatment is sustained until a desired
suppression of disease symptoms occurs. The progress of this
therapy can be readily monitored by conventional methods and assays
and based on criteria known to the physician or other persons of
skill in the art.
[0926] Aside from administration of the antibody protein to the
patient, the present application contemplates administration of the
antibody by gene therapy. Such administration of nucleic acid
encoding the antibody is encompassed by the expression
"administering a therapeutically effective amount of an antibody".
See, for example, WO96/07321 published Mar. 14, 1996 concerning the
use of gene therapy to generate intracellular antibodies.
[0927] There are two major approaches to getting the nucleic acid
(optionally contained in a vector) into the patient's cells; in
vivo and ex vivo. For in vivo delivery the nucleic acid is injected
directly into the patient, usually at the site where the antibody
is required. For ex vivo treatment, the patient's cells are
removed, the nucleic acid is introduced into these isolated cells
and the modified cells are administered to the patient either
directly or, for example, encapsulated within porous membranes
which are implanted into the patient (see, e.g., U.S. Pat. Nos.
4,892,538 and 5,283,187). There are a variety of techniques
available for introducing nucleic acids into viable cells. The
techniques vary depending upon whether the nucleic acid is
transferred into cultured cells in vitro, or in vivo in the cells
of the intended host. Techniques suitable for the transfer of
nucleic acid into mammalian cells in vitro include the use of
liposomes, electroporation, microinjection, cell fusion,
DEAE-dextran, the calcium phosphate precipitation method, etc. A
commonly used vector for ex vivo delivery of the gene is a
retroviral vector.
[0928] The currently preferred in vivo nucleic acid transfer
techniques include transfection with viral vectors (such as
adenovirus, Herpes simplex I virus, or adeno-associated virus) and
lipid-based systems (useful lipids for lipid-mediated transfer of
the gene are DOTMA, DOPE and DC-Chol, for example). For review of
the currently known gene marking and gene therapy protocols see
Anderson et al., Science 256:808-813 (1992). See also WO 93/25673
and the references cited therein.
[0929] The anti-TAT antibodies of the invention can be in the
different forms encompassed by the definition of "antibody" herein.
Thus, the antibodies include full length or intact antibody,
antibody fragments, native sequence antibody or amino acid
variants, humanized, chimeric or fusion antibodies,
immunoconjugates, and functional fragments thereof. In fusion
antibodies an antibody sequence is fused to a heterologous
polypeptide sequence. The antibodies can be modified in the Fc
region to provide desired effector functions. As discussed in more
detail in the sections herein, with the appropriate Fc regions, the
naked antibody bound on the cell surface can induce cytotoxicity,
e.g., via antibody-dependent cellular cytotoxicity (ADCC) or by
recruiting complement in complement dependent cytotoxicity, or some
other mechanism. Alternatively, where it is desirable to eliminate
or reduce effector function, so as to minimize side effects or
therapeutic complications, certain other Fc regions may be
used.
[0930] In one embodiment, the antibody competes for binding or bind
substantially to, the same epitope as the antibodies of the
invention. Antibodies having the biological characteristics of the
present anti-TAT antibodies of the invention are also contemplated,
specifically including the in vivo tumor targeting and any cell
proliferation inhibition or cytotoxic characteristics.
[0931] Methods of producing the above antibodies are described in
detail herein.
[0932] The present anti-TAT antibodies, oligopeptides, siRNAs and
organic molecules are useful for treating a TAT-expressing cancer
or alleviating one or more symptoms of the cancer in a mammal. Such
a cancer includes prostate cancer, cancer of the urinary tract,
lung cancer, breast cancer, colon cancer, colorectal cancer, and
ovarian cancer, more specifically, prostate adenocarcinoma, renal
cell carcinomas, colorectal adenocarcinomas, lung adenocarcinomas,
lung squamous cell carcinomas, and pleural mesothelioma. The
cancers encompass metastatic cancers of any of the preceding. The
antibody, oligopeptide, siRNA or organic molecule is able to bind
to at least a portion of the cancer cells that express TAT
polypeptide in the mammal. In a preferred embodiment, the antibody,
oligopeptide, siRNA or organic molecule is effective to destroy or
kill TAT-expressing tumor cells or inhibit the growth of such tumor
cells, in vitro or in vivo, upon binding to TAT polypeptide on the
cell. Such an antibody includes a naked anti-TAT antibody (not
conjugated to any agent). Naked antibodies that have cytotoxic or
cell growth inhibition properties can be further harnessed with a
cytotoxic agent to render them even more potent in tumor cell
destruction. Cytotoxic properties can be conferred to an anti-TAT
antibody by, e.g., conjugating the antibody with a cytotoxic agent,
to form an immunoconjugate as described herein. The cytotoxic agent
or a growth inhibitory agent is preferably a small molecule. Toxins
such as calicheamicin or a maytansinoid and analogs or derivatives
thereof, are preferable.
[0933] The invention provides a composition comprising an anti-TAT
antibody, oligopeptide, siRNA or organic molecule of the invention,
and a carrier. For the purposes of treating cancer, compositions
can be administered to the patient in need of such treatment,
wherein the composition can comprise one or more anti-TAT
antibodies present as an immunoconjugate or as the naked antibody.
In a further embodiment, the compositions can comprise these
antibodies, oligopeptides, siRNAs or organic molecules in
combination with other therapeutic agents such as cytotoxic or
growth inhibitory agents, including chemotherapeutic agents. The
invention also provides formulations comprising an anti-TAT
antibody, oligopeptide, siRNA or organic molecule of the invention,
and a carrier. In one embodiment, the formulation is a therapeutic
formulation comprising a pharmaceutically acceptable carrier.
[0934] Another aspect of the invention is isolated nucleic acids
encoding the anti-TAT antibodies. Nucleic acids encoding both the H
and L chains and especially the hypervariable region residues,
chains which encode the native sequence antibody as well as
variants, modifications and humanized versions of the antibody, are
encompassed.
[0935] The invention also provides methods useful for treating a
TAT polypeptide-expressing cancer or alleviating one or more
symptoms of the cancer in a mammal, comprising administering a
therapeutically effective amount of an anti-TAT antibody,
oligopeptide, siRNA or organic molecule to the mammal. The
antibody, oligopeptide or organic molecule therapeutic compositions
can be administered short term (acute) or chronic, or intermittent
as directed by physician. Also provided are methods of inhibiting
the growth of, and killing a TAT polypeptide-expressing cell.
[0936] The invention also provides kits and articles of manufacture
comprising at least one anti-TAT antibody, oligopeptide, siRNA or
organic molecule. Kits containing anti-TAT antibodies,
oligopeptides, siRNAs or organic molecules find use, e.g., for TAT
cell killing assays, for purification or immunoprecipitation of TAT
polypeptide from cells. For example, for isolation and purification
of TAT, the kit can contain an anti-TAT antibody, oligopeptide,
siRNA or organic molecule coupled to beads (e.g., sepharose beads).
Kits can be provided which contain the antibodies, oligopeptides,
siRNA or organic molecules for detection and quantitation of TAT in
vitro, e.g., in an ELISA or a Western blot. Such antibody,
oligopeptide, siRNA or organic molecule useful for detection may be
provided with a label such as a fluorescent or radiolabel.
[0937] L. Articles of Manufacture and Kits
[0938] Another embodiment of the invention is an article of
manufacture containing materials useful for the treatment of
anti-TAT expressing cancer. The article of manufacture comprises a
container and a label or package insert on or associated with the
container. Suitable containers include, for example, bottles,
vials, syringes, etc. The containers may be formed from a variety
of materials such as glass or plastic. The container holds a
composition which is effective for treating the cancer condition
and may have a sterile access port (for example the container may
be an intravenous solution bag or a vial having a stopper
pierceable by a hypodermic injection needle). At least one active
agent in the composition is an anti-TAT antibody, oligopeptide,
siRNA or organic molecule of the invention. The label or package
insert indicates that the composition is used for treating cancer.
The label or package insert will further comprise instructions for
administering the antibody, oligopeptide, siRNA or organic molecule
composition to the cancer patient. Additionally, the article of
manufacture may further comprise a second container comprising a
pharmaceutically-acceptable buffer, such as bacteriostatic water
for injection (BWFI), phosphate-buffered saline, Ringer's solution
and dextrose solution. It may further include other materials
desirable from a commercial and user standpoint, including other
buffers, diluents, filters, needles, and syringes.
[0939] Kits are also provided that are useful for various purposes,
e.g., for TAT-expressing cell killing assays, for purification or
immunoprecipitation of TAT polypeptide from cells. For isolation
and purification of TAT polypeptide, the kit can contain an
anti-TAT antibody, oligopeptide, siRNA or organic molecule coupled
to beads (e.g., sepharose beads). Kits can be provided which
contain the antibodies, oligopeptides, siRNAs or organic molecules
for detection and quantitation of TAT polypeptide in vitro, e.g.,
in an ELISA or a Western blot. As with the article of manufacture,
the kit comprises a container and a label or package insert on or
associated with the container. The container holds a composition
comprising at least one anti-TAT antibody, oligopeptide, siRNA or
organic molecule of the invention. Additional containers may be
included that contain, e.g., diluents and buffers, control
antibodies. The label or package insert may provide a description
of the composition as well as instructions for the intended in
vitro or diagnostic use.
[0940] M. Uses for TAT Polypeptides and TAT-Polypeptide Encoding
Nucleic Acids
[0941] Nucleotide sequences (or their complement) encoding TAT
polypeptides have various applications in the art of molecular
biology, including uses as hybridization probes, in chromosome and
gene mapping and in the generation of anti-sense RNA, siRNA and DNA
probes. TAT-encoding nucleic acid will also be useful for the
preparation of TAT polypeptides by the recombinant techniques
described herein, wherein those TAT polypeptides may find use, for
example, in the preparation of anti-TAT antibodies as described
herein.
[0942] The full-length native sequence TAT gene, or portions
thereof, may be used as hybridization probes for a cDNA library to
isolate the full-length TAT cDNA or to isolate still other cDNAs
(for instance, those encoding naturally-occurring variants of TAT
or TAT from other species) which have a desired sequence identity
to the native TAT sequence disclosed herein. Optionally, the length
of the probes will be about 20 to about 50 bases. The hybridization
probes may be derived from at least partially novel regions of the
full length native nucleotide sequence wherein those regions may be
determined without undue experimentation or from genomic sequences
including promoters, enhancer elements and introns of native
sequence TAT. By way of example, a screening method will comprise
isolating the coding region of the TAT gene using the known DNA
sequence to synthesize a selected probe of about 40 bases.
Hybridization probes may be labeled by a variety of labels,
including radionucleotides such as .sup.32P or .sup.35S, or
enzymatic labels such as alkaline phosphatase coupled to the probe
via avidin/biotin coupling systems. Labeled probes having a
sequence complementary to that of the TAT gene of the present
invention can be used to screen libraries of human cDNA, genomic
DNA or mRNA to determine which members of such libraries the probe
hybridizes to. Hybridization techniques are described in further
detail in the Examples below. Any EST sequences disclosed in the
present application may similarly be employed as probes, using the
methods disclosed herein.
[0943] Other useful fragments of the TAT-encoding nucleic acids
include antisense or sense oligonucleotides comprising a
singe-stranded nucleic acid sequence (either RNA or DNA) capable of
binding to target TAT mRNA (sense) or TAT DNA (antisense)
sequences. Antisense or sense oligonucleotides, according to the
present invention, comprise a fragment of the coding region of TAT
DNA. Such a fragment generally comprises at least about 14
nucleotides, preferably from about 14 to 30 nucleotides. The
ability to derive an antisense or a sense oligonucleotide, based
upon a cDNA sequence encoding a given protein is described in, for
example, Stein and Cohen (Cancer Res. 48:2659, 1988) and van der
Krol et al. (BioTechniques 6:958, 1988).
[0944] Binding of antisense or sense oligonucleotides to target
nucleic acid sequences results in the formation of duplexes that
block transcription or translation of the target sequence by one of
several means, including enhanced degradation of the duplexes,
premature termination of transcription or translation, or by other
means. Such methods are encompassed by the present invention. The
antisense oligonucleotides thus may be used to block expression of
TAT proteins, wherein those TAT proteins may play a role in the
induction of cancer in mammals. Antisense or sense oligonucleotides
further comprise oligonucleotides having modified
sugar-phosphodiester backbones (or other sugar linkages, such as
those described in WO 91/06629) and wherein such sugar linkages are
resistant to endogenous nucleases. Such oligonucleotides with
resistant sugar linkages are stable in vivo (i.e., capable of
resisting enzymatic degradation) but retain sequence specificity to
be able to bind to target nucleotide sequences.
[0945] Preferred intragenic sites for antisense binding include the
region incorporating the translation initiation/start codon
(5'-AUG/5'-ATG) or termination/stop codon (5'-UAA, 5'-UAG and
5-UGA/5'-TAA, 5'-TAG and 5'-TGA) of the open reading frame (ORF) of
the gene. These regions refer to a portion of the mRNA or gene that
encompasses from about 25 to about 50 contiguous nucleotides in
either direction (i.e., 5' or 3') from a translation initiation or
termination codon. Other preferred regions for antisense binding
include: introns; exons; intron-exon junctions; the open reading
frame (ORF) or "coding region," which is the region between the
translation initiation codon and the translation termination codon;
the 5' cap of an mRNA which comprises an N7-methylated guanosine
residue joined to the 5'-most residue of the mRNA via a 5'-5'
triphosphate linkage and includes 5' cap structure itself as well
as the first 50 nucleotides adjacent to the cap; the 5'
untranslated region (5'UTR), the portion of an mRNA in the 5'
direction from the translation initiation codon, and thus including
nucleotides between the 5' cap site and the translation initiation
codon of an mRNA or corresponding nucleotides on the gene; and the
3' untranslated region (3'UTR), the portion of an mRNA in the 3'
direction from the translation termination codon, and thus
including nucleotides between the translation termination codon and
3' end of an mRNA or corresponding nucleotides on the gene.
[0946] Specific examples of preferred antisense compounds useful
for inhibiting expression of TAT proteins include oligonucleotides
containing modified backbones or non-natural internucleoside
linkages. Oligonucleotides having modified backbones include those
that retain a phosphorus atom in the backbone and those that do not
have a phosphorus atom in the backbone. For the purposes of this
specification, and as sometimes referenced in the art, modified
oligonucleotides that do not have a phosphorus atom in their
internucleoside backbone can also be considered to be
oligonucleosides. Preferred modified oligonucleotide backbones
include, for example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotri-esters,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonates, 5'-alkylene phosphonates and chiral phosphonates,
phosphinates, phosphoramidates including 3'-amino phosphoramidate
and aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriesters,
selenophosphates and borano-phosphates having normal 3'-5'
linkages, 2'-5' linked analogs of these, and those having inverted
polarity wherein one or more internucleotide linkages is a 3' to
3', 5' to 5' or 2' to 2' linkage. Preferred oligonucleotides having
inverted polarity comprise a single 3' to 3' linkage at the 3'-most
internucleotide linkage i.e. a single inverted nucleoside residue
which may be abasic (the nucleobase is missing or has a hydroxyl
group in place thereof). Various salts, mixed salts and free acid
forms are also included. Representative United States patents that
teach the preparation of phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555;
5,527,899; 5,721,218; 5,672,697 and 5,625,050, each of which is
herein incorporated by reference.
[0947] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; riboacetyl backbones; alkene containing backbones;
sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate and sulfonamide backbones; amide backbones;
and others having mixed N, O, S and CH.sub.2 component parts.
Representative United States patents that teach the preparation of
such oligonucleosides include, but are not limited to, U.S. Pat.
Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141;
5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677;
5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240;
5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070;
5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and
5,677,439, each of which is herein incorporated by reference.
[0948] In other preferred antisense oligonucleotides, both the
sugar and the internucleoside linkage, i.e., the backbone, of the
nucleotide units are replaced with novel groups. The base units are
maintained for hybridization with an appropriate nucleic acid
target compound. One such oligomeric compound, an oligonucleotide
mimetic that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA
compounds, the sugar-backbone of an oligonucleotide is replaced
with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative United States patents that
teach the preparation of PNA compounds include, but are not limited
to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of
which is herein incorporated by reference. Further teaching of PNA
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0949] Preferred antisense oligonucleotides incorporate
phosphorothioate backbones and/or heteroatom backbones, and in
particular --CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--]
described in the above referenced U.S. Pat. No. 5,489,677, and the
amide backbones of the above referenced U.S. Pat. No. 5,602,240.
Also preferred are antisense oligonucleotides having morpholino
backbone structures of the above-referenced U.S. Pat. No.
5,034,506.
[0950] Modified oligonucleotides may also contain one or more
substituted sugar moieties. Preferred oligonucleotides comprise one
of the following at the 2' position: OH; F; O-alkyl, S-alkyl, or
N-alkyl; O-alkenyl, 5-alkeynyl, or N-alkenyl; O-alkynyl, S-alkynyl
or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and
alkynyl may be substituted or unsubstituted C.sub.1 to C.sub.10
alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Particularly
preferred are O[(CH.sub.2).sub.nO].sub.mCH.sub.3,
O(CH.sub.2).sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2,
O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10. Other preferred antisense oligonucleotides
comprise one of the following at the 2' position: C.sub.1 to
C.sub.10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl,
alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl,
Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2 CH.sub.3,
ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl,
heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted
silyl, an RNA cleaving group, a reporter group, an intercalator, a
group for improving the pharmacokinetic properties of an
oligonucleotide, or a group for improving the pharmacodynamic
properties of an oligonucleotide, and other substituents having
similar properties. A preferred modification includes
2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Hely. Chim. Acta,
1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred
modification includes 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples hereinbelow, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).
[0951] A further preferred modification includes Locked Nucleic
Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or
4' carbon atom of the sugar ring thereby forming a bicyclic sugar
moiety. The linkage is preferably a methelyne (--CH.sub.2--).sub.n
group bridging the 2' oxygen atom and the 4' carbon atom wherein n
is 1 or 2. LNAs and preparation thereof are described in WO
98/39352 and WO 99/14226.
[0952] Other preferred modifications include 2'-methoxy
(2'-O--CH.sub.3), 2'-aminopropoxy (2'-OCH.sub.2CH.sub.2CH.sub.2
NH.sub.2), 2'-allyl (2'-CH.sub.2--CH.dbd.CH.sub.2), 2'-O-allyl
(2'-O--CH.sub.2--CH.dbd.CH.sub.2) and 2'-fluoro (2'-F). The
2'-modification may be in the arabino (up) position or ribo (down)
position. A preferred 2'-arabino modification is 2'-F. Similar
modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Oligonucleotides may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747;
and 5,700,920, each of which is herein incorporated by reference in
its entirety.
[0953] Oligonucleotides may also include nucleobase (often referred
to in the art simply as "base") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include other synthetic and natural nucleobases such as
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(--C.dbd.C--CH.sub.3 or --CH.sub.2--C.dbd.CH) uracil and cytosine
and other alkynyl derivatives of pyrimidine bases, 6-azo uracil,
cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil,
8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other
8-substituted adenines and guanines, 5-halo particularly 5-bromo,
5-trifluoromethyl and other 5-substituted uracils and cytosines,
7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine,
8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine
and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases
include tricyclic pyrimidines such as phenoxazine
cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a
substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John
Wiley & Sons, 1990, and those disclosed by Englisch et al.,
Angewandte Chemie, International Edition, 1991, 30, 613. Certain of
these nucleobases are particularly useful for increasing the
binding affinity of the oligomeric compounds of the invention.
These include 5-substituted pyrimidines, 6-azapyrimidines and N-2,
N-6 and O-6 substituted purines, including 2-aminopropyladenine,
5-propynyluracil and 5-propynylcytosine. 5-methylcytosine
substitutions have been shown to increase nucleic acid duplex
stability by 0.6-1.2.degree. C. (Sanghvi et al, Antisense Research
and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are
preferred base substitutions, even more particularly when combined
with 2'-O-methoxyethyl sugar modifications. Representative United
States patents that teach the preparation of modified nucleobases
include, but are not limited to: U.S. Pat. No. 3,687,808, as well
as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273;
5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177;
5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617;
5,645,985; 5,830,653; 5,763,588; 6,005,096; 5,681,941 and
5,750,692, each of which is herein incorporated by reference.
[0954] Another modification of antisense oligonucleotides
chemically linking to the oligonucleotide one or more moieties or
conjugates which enhance the activity, cellular distribution or
cellular uptake of the oligonucleotide. The compounds of the
invention can include conjugate groups covalently bound to
functional groups such as primary or secondary hydroxyl groups.
Conjugate groups of the invention include intercalators, reporter
molecules, polyamines, polyamides, polyethylene glycols,
polyethers, groups that enhance the pharmacodynamic properties of
oligomers, and groups that enhance the pharmacokinetic properties
of oligomers. Typical conjugates groups include cholesterols,
lipids, cation lipids, phospholipids, cationic phospholipids,
biotin, phenazine, folate, phenanthridine, anthraquinone, acridine,
fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance
the pharmacodynamic properties, in the context of this invention,
include groups that improve oligomer uptake, enhance oligomer
resistance to degradation, and/or strengthen sequence-specific
hybridization with RNA. Groups that enhance the pharmacokinetic
properties, in the context of this invention, include groups that
improve oligomer uptake, distribution, metabolism or excretion.
Conjugate moieties include but are not limited to lipid moieties
such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad.
Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al.,
Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g.,
hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992,
660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3,
2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res.,
1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10,
1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330;
Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid,
e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety. Oligonucleotides of
the invention may also be conjugated to active drug substances, for
example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen,
fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen,
dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid,
folinic acid, a benzothiadiazide, chlorothiazide, a diazepine,
indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an
antidiabetic, an antibacterial or an antibiotic.
Oligonucleotide-drug conjugates and their preparation are described
in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15,
1999) and U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, each of which is herein incorporated by
reference.
[0955] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
compound or even at a single nucleoside within an oligonucleotide.
The present invention also includes antisense compounds which are
chimeric compounds. "Chimeric" antisense compounds or "chimeras,"
in the context of this invention, are antisense compounds,
particularly oligonucleotides, which contain two or more chemically
distinct regions, each made up of at least one monomer unit, i.e.,
a nucleotide in the case of an oligonucleotide compound. These
oligonucleotides typically contain at least one region wherein the
oligonucleotide is modified so as to confer upon the
oligonucleotide increased resistance to nuclease degradation,
increased cellular uptake, and/or increased binding affinity for
the target nucleic acid. An additional region of the
oligonucleotide may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby greatly enhancing the efficiency of
oligonucleotide inhibition of gene expression. Consequently,
comparable results can often be obtained with shorter
oligonucleotides when chimeric oligonucleotides are used, compared
to phosphorothioate deoxyoligonucleotides hybridizing to the same
target region. Chimeric antisense compounds of the invention may be
formed as composite structures of two or more oligonucleotides,
modified oligonucleotides, oligonucleosides and/or oligonucleotide
mimetics as described above. Preferred chimeric antisense
oligonucleotides incorporate at least one 2' modified sugar
(preferably 2'-O--(CH.sub.2).sub.2--O--CH.sub.3) at the 3' terminal
to confer nuclease resistance and a region with at least 4
contiguous 2'-H sugars to confer RNase H activity. Such compounds
have also been referred to in the art as hybrids or gapmers.
Preferred gapmers have a region of 2' modified sugars (preferably
2'-O--(CH.sub.2).sub.2--O--CH.sub.3) at the 3'-terminal and at the
5' terminal separated by at least one region having at least 4
contiguous 2'-H sugars and preferably incorporate phosphorothioate
backbone linkages. Representative United States patents that teach
the preparation of such hybrid structures include, but are not
limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007;
5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, each of which is herein
incorporated by reference in its entirety.
[0956] The antisense compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives. The compounds of the invention may also be admixed,
encapsulated, conjugated or otherwise associated with other
molecules, molecule structures or mixtures of compounds, as for
example, liposomes, receptor targeted molecules, oral, rectal,
topical or other formulations, for assisting in uptake,
distribution and/or absorption. Representative United States
patents that teach the preparation of such uptake, distribution
and/or absorption assisting formulations include, but are not
limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016;
5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721;
4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170;
5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854;
5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948;
5,580,575; and 5,595,756, each of which is herein incorporated by
reference.
[0957] Other examples of sense or antisense oligonucleotides
include those oligonucleotides which are covalently linked to
organic moieties, such as those described in WO 90/10048, and other
moieties that increases affinity of the oligonucleotide for a
target nucleic acid sequence, such as poly-(L-lysine). Further
still, intercalating agents, such as ellipticine, and alkylating
agents or metal complexes may be attached to sense or antisense
oligonucleotides to modify binding specificities of the antisense
or sense oligonucleotide for the target nucleotide sequence.
[0958] Antisense or sense oligonucleotides may be introduced into a
cell containing the target nucleic acid sequence by any gene
transfer method, including, for example, CaPO.sub.4-mediated DNA
transfection, electroporation, or by using gene transfer vectors
such as Epstein-Barr virus. In a preferred procedure, an antisense
or sense oligonucleotide is inserted into a suitable retroviral
vector. A cell containing the target nucleic acid sequence is
contacted with the recombinant retroviral vector, either in vivo or
ex vivo. Suitable retroviral vectors include, but are not limited
to, those derived from the murine retrovirus M-MuLV, N2 (a
retrovirus derived from M-MuLV), or the double copy vectors
designated DCT5A, DCT5B and DCT5C (see WO 90/13641).
[0959] Sense or antisense oligonucleotides also may be introduced
into a cell containing the target nucleotide sequence by formation
of a conjugate with a ligand binding molecule, as described in WO
91/04753. Suitable ligand binding molecules include, but are not
limited to, cell surface receptors, growth factors, other
cytokines, or other ligands that bind to cell surface receptors.
Preferably, conjugation of the ligand binding molecule does not
substantially interfere with the ability of the ligand binding
molecule to bind to its corresponding molecule or receptor, or
block entry of the sense or antisense oligonucleotide or its
conjugated version into the cell.
[0960] Alternatively, a sense or an antisense oligonucleotide may
be introduced into a cell containing the target nucleic acid
sequence by formation of an oligonucleotide-lipid complex, as
described in WO 90/10448. The sense or antisense
oligonucleotide-lipid complex is preferably dissociated within the
cell by an endogenous lipase.
[0961] Antisense or sense RNA or DNA molecules are generally at
least about 5 nucleotides in length, alternatively at least about
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80,
85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150,
155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 210, 220, 230,
240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360,
370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490,
500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620,
630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750,
760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880,
890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000
nucleotides in length, wherein in this context the term "about"
means the referenced nucleotide sequence length plus or minus 10%
of that referenced length.
[0962] Alternatively, a double stranded RNA can be generated.
Double stranded RNA that are under 30 nucleotides in length will
inhibit the expression of specific genes when introduced into a
cell. This mechanism is known as RNA mediated interference (RNAi)
and small (under 30 nucleotide) RNAs used as a reagent are known as
siRNAs. TAT interfering RNAs may be identified and synthesized
using known methods (Shi Y., Trends in Genetics 19(1):9-12 (2003),
WO/2003056012 and WO2003064621). siRNAs are useful to reduce the
amount of gene expression in conditions where a reduction in the
expression of the target gene would alleviate the condition or
disorder.
[0963] The probes may also be employed in PCR techniques to
generate a pool of sequences for identification of closely related
TAT coding sequences.
[0964] Nucleotide sequences encoding a TAT can also be used to
construct hybridization probes for mapping the gene which encodes
that TAT and for the genetic analysis of individuals with genetic
disorders. The nucleotide sequences provided herein may be mapped
to a chromosome and specific regions of a chromosome using known
techniques, such as in situ hybridization, linkage analysis against
known chromosomal markers, and hybridization screening with
libraries.
[0965] When the coding sequences for TAT encode a protein which
binds to another protein (example, where the TAT is a receptor),
the TAT can be used in assays to identify the other proteins or
molecules involved in the binding interaction. By such methods,
inhibitors of the receptor/ligand binding interaction can be
identified. Proteins involved in such binding interactions can also
be used to screen for peptide or small molecule inhibitors or
agonists of the binding interaction. Also, the receptor TAT can be
used to isolate correlative ligand(s). Screening assays can be
designed to find lead compounds that mimic the biological activity
of a native TAT or a receptor for TAT. Such screening assays will
include assays amenable to high-throughput screening of chemical
libraries, making them particularly suitable for identifying small
molecule drug candidates. Small molecules contemplated include
synthetic organic or inorganic compounds. The assays can be
performed in a variety of formats, including protein-protein
binding assays, biochemical screening assays, immunoassays and cell
based assays, which are well characterized in the art.
[0966] Nucleic acids which encode TAT or its modified forms can
also be used to generate either transgenic animals or "knock out"
animals which, in turn, are useful in the development and screening
of therapeutically useful reagents. A transgenic animal (e.g., a
mouse or rat) is an animal having cells that contain a transgene,
which transgene was introduced into the animal or an ancestor of
the animal at a prenatal, e.g., an embryonic stage. A transgene is
a DNA which is integrated into the genome of a cell from which a
transgenic animal develops. In one embodiment, cDNA encoding TAT
can be used to clone genomic DNA encoding TAT in accordance with
established techniques and the genomic sequences used to generate
transgenic animals that contain cells which express DNA encoding
TAT. Methods for generating transgenic animals, particularly
animals such as mice or rats, have become conventional in the art
and are described, for example, in U.S. Pat. Nos. 4,736,866 and
4,870,009. Typically, particular cells would be targeted for TAT
transgene incorporation with tissue-specific enhancers. Transgenic
animals that include a copy of a transgene encoding TAT introduced
into the germ line of the animal at an embryonic stage can be used
to examine the effect of increased expression of DNA encoding TAT.
Such animals can be used as tester animals for reagents thought to
confer protection from, for example, pathological conditions
associated with its overexpression. In accordance with this facet
of the invention, an animal is treated with the reagent and a
reduced incidence of the pathological condition, compared to
untreated animals bearing the transgene, would indicate a potential
therapeutic intervention for the pathological condition.
[0967] Alternatively, non-human homologues of TAT can be used to
construct a TAT "knock out" animal which has a defective or altered
gene encoding TAT as a result of homologous recombination between
the endogenous gene encoding TAT and altered genomic DNA encoding
TAT introduced into an embryonic stem cell of the animal. For
example, cDNA encoding TAT can be used to clone genomic DNA
encoding TAT in accordance with established techniques. A portion
of the genomic DNA encoding TAT can be deleted or replaced with
another gene, such as a gene encoding a selectable marker which can
be used to monitor integration. Typically, several kilobases of
unaltered flanking DNA (both at the 5' and 3' ends) are included in
the vector [see e.g., Thomas and Capecchi, Cell, 51:503 (1987) for
a description of homologous recombination vectors]. The vector is
introduced into an embryonic stem cell line (e.g., by
electroporation) and cells in which the introduced DNA has
homologously recombined with the endogenous DNA are selected [see
e.g., Li et al., Cell, 69:915 (1992)]. The selected cells are then
injected into a blastocyst of an animal (e.g., a mouse or rat) to
form aggregation chimeras [see e.g., Bradley, in Teratocarcinomas
and Embryonic Stem Cells: A Practical Approach, E. J. Robertson,
ed. (IRL, Oxford, 1987), pp. 113-152]. A chimeric embryo can then
be implanted into a suitable pseudopregnant female foster animal
and the embryo brought to term to create a "knock out" animal.
Progeny harboring the homologously recombined DNA in their germ
cells can be identified by standard techniques and used to breed
animals in which all cells of the animal contain the homologously
recombined DNA. Knockout animals can be characterized for instance,
for their ability to defend against certain pathological conditions
and for their development of pathological conditions due to absence
of the TAT polypeptide.
[0968] Nucleic acid encoding the TAT polypeptides may also be used
in gene therapy. In gene therapy applications, genes are introduced
into cells in order to achieve in vivo synthesis of a
therapeutically effective genetic product, for example for
replacement of a defective gene. "Gene therapy" includes both
conventional gene therapy where a lasting effect is achieved by a
single treatment, and the administration of gene therapeutic
agents, which involves the one time or repeated administration of a
therapeutically effective DNA or mRNA. Antisense RNAs and DNAs can
be used as therapeutic agents for blocking the expression of
certain genes in vivo. It has already been shown that short
antisense oligonucleotides can be imported into cells where they
act as inhibitors, despite their low intracellular concentrations
caused by their restricted uptake by the cell membrane. (Zamecnik
et al., Proc. Natl. Acad. Sci. USA 83:4143-4146 [1986]). The
oligonucleotides can be modified to enhance their uptake, e.g. by
substituting their negatively charged phosphodiester groups by
uncharged groups.
[0969] There are a variety of techniques available for introducing
nucleic acids into viable cells. The techniques vary depending upon
whether the nucleic acid is transferred into cultured cells in
vitro, or in vivo in the cells of the intended host. Techniques
suitable for the transfer of nucleic acid into mammalian cells in
vitro include the use of liposomes, electroporation,
microinjection, cell fusion, DEAE-dextran, the calcium phosphate
precipitation method, etc. The currently preferred in vivo gene
transfer techniques include transfection with viral (typically
retroviral) vectors and viral coat protein-liposome mediated
transfection (Dzau et al., Trends in Biotechnology 11, 205-210
[1993]). In some situations it is desirable to provide the nucleic
acid source with an agent that targets the target cells, such as an
antibody specific for a cell surface membrane protein or the target
cell, a ligand for a receptor on the target cell, etc. Where
liposomes are employed, proteins which bind to a cell surface
membrane protein associated with endocytosis may be used for
targeting and/or to facilitate uptake, e.g. capsid proteins or
fragments thereof tropic for a particular cell type, antibodies for
proteins which undergo internalization in cycling, proteins that
target intracellular localization and enhance intracellular
half-life. The technique of receptor-mediated endocytosis is
described, for example, by Wu et al., J. Biol. Chem. 262, 4429-4432
(1987); and Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414
(1990). For review of gene marking and gene therapy protocols see
Anderson et al., Science 256, 808-813 (1992).
[0970] The nucleic acid molecules encoding the TAT polypeptides or
fragments thereof described herein are useful for chromosome
identification. In this regard, there exists an ongoing need to
identify new chromosome markers, since relatively few chromosome
marking reagents, based upon actual sequence data are presently
available. Each TAT nucleic acid molecule of the present invention
can be used as a chromosome marker.
[0971] The TAT polypeptides and nucleic acid molecules of the
present invention may also be used diagnostically for tissue
typing, wherein the TAT polypeptides of the present invention may
be differentially expressed in one tissue as compared to another,
preferably in a diseased tissue as compared to a normal tissue of
the same tissue type. TAT nucleic acid molecules will find use for
generating probes for PCR, Northern analysis, Southern analysis and
Western analysis.
[0972] This invention encompasses methods of screening compounds to
identify those that mimic the TAT polypeptide (agonists) or prevent
the effect of the TAT polypeptide (antagonists). Screening assays
for antagonist drug candidates are designed to identify compounds
that bind or complex with the TAT polypeptides encoded by the genes
identified herein, or otherwise interfere with the interaction of
the encoded polypeptides with other cellular proteins, including
e.g., inhibiting the expression of TAT polypeptide from cells. Such
screening assays will include assays amenable to high-throughput
screening of chemical libraries, making them particularly suitable
for identifying small molecule drug candidates.
[0973] The assays can be performed in a variety of formats,
including protein-protein binding assays, biochemical screening
assays, immunoassays, and cell-based assays, which are well
characterized in the art.
[0974] All assays for antagonists are common in that they call for
contacting the drug candidate with a TAT polypeptide encoded by a
nucleic acid identified herein under conditions and for a time
sufficient to allow these two components to interact.
[0975] In binding assays, the interaction is binding and the
complex formed can be isolated or detected in the reaction mixture.
In a particular embodiment, the TAT polypeptide encoded by the gene
identified herein or the drug candidate is immobilized on a solid
phase, e.g., on a microtiter plate, by covalent or non-covalent
attachments. Non-covalent attachment generally is accomplished by
coating the solid surface with a solution of the TAT polypeptide
and drying. Alternatively, an immobilized antibody, e.g., a
monoclonal antibody, specific for the TAT polypeptide to be
immobilized can be used to anchor it to a solid surface. The assay
is performed by adding the non-immobilized component, which may be
labeled by a detectable label, to the immobilized component, e.g.,
the coated surface containing the anchored component. When the
reaction is complete, the non-reacted components are removed, e.g.,
by washing, and complexes anchored on the solid surface are
detected. When the originally non-immobilized component carries a
detectable label, the detection of label immobilized on the surface
indicates that complexing occurred. Where the originally
non-immobilized component does not carry a label, complexing can be
detected, for example, by using a labeled antibody specifically
binding the immobilized complex.
[0976] If the candidate compound interacts with but does not bind
to a particular TAT polypeptide encoded by a gene identified
herein, its interaction with that polypeptide can be assayed by
methods well known for detecting protein-protein interactions. Such
assays include traditional approaches, such as, e.g.,
cross-linking, co-immunoprecipitation, and co-purification through
gradients or chromatographic columns. In addition, protein-protein
interactions can be monitored by using a yeast-based genetic system
described by Fields and co-workers (Fields and Song, Nature
(London), 340:245-246 (1989); Chien et al., Proc. Natl. Acad. Sci.
USA, 88:9578-9582 (1991)) as disclosed by Chevray and Nathans,
Proc. Natl. Acad. Sci. USA, 89: 5789-5793 (1991). Many
transcriptional activators, such as yeast GAL4, consist of two
physically discrete modular domains, one acting as the DNA-binding
domain, the other one functioning as the transcription-activation
domain. The yeast expression system described in the foregoing
publications (generally referred to as the "two-hybrid system")
takes advantage of this property, and employs two hybrid proteins,
one in which the target protein is fused to the DNA-binding domain
of GAL4, and another, in which candidate activating proteins are
fused to the activation domain. The expression of a GAL1-lacZ
reporter gene under control of a GAL4-activated promoter depends on
reconstitution of GAL4 activity via protein-protein interaction.
Colonies containing interacting polypeptides are detected with a
chromogenic substrate for .beta.-galactosidase. A complete kit
(MATCHMAKER.TM.) for identifying protein-protein interactions
between two specific proteins using the two-hybrid technique is
commercially available from Clontech. This system can also be
extended to map protein domains involved in specific protein
interactions as well as to pinpoint amino acid residues that are
crucial for these interactions.
[0977] Compounds that interfere with the interaction of a gene
encoding a TAT polypeptide identified herein and other intra- or
extracellular components can be tested as follows: usually a
reaction mixture is prepared containing the product of the gene and
the intra- or extracellular component under conditions and for a
time allowing for the interaction and binding of the two products.
To test the ability of a candidate compound to inhibit binding, the
reaction is run in the absence and in the presence of the test
compound. In addition, a placebo may be added to a third reaction
mixture, to serve as positive control. The binding (complex
formation) between the test compound and the intra- or
extracellular component present in the mixture is monitored as
described hereinabove. The formation of a complex in the control
reaction(s) but not in the reaction mixture containing the test
compound indicates that the test compound interferes with the
interaction of the test compound and its reaction partner.
[0978] To assay for antagonists, the TAT polypeptide may be added
to a cell along with the compound to be screened for a particular
activity and the ability of the compound to inhibit the activity of
interest in the presence of the TAT polypeptide indicates that the
compound is an antagonist to the TAT polypeptide. Alternatively,
antagonists may be detected by combining the TAT polypeptide and a
potential antagonist with membrane-bound TAT polypeptide receptors
or recombinant receptors under appropriate conditions for a
competitive inhibition assay. The TAT polypeptide can be labeled,
such as by radioactivity, such that the number of TAT polypeptide
molecules bound to the receptor can be used to determine the
effectiveness of the potential antagonist. The gene encoding the
receptor can be identified by numerous methods known to those of
skill in the art, for example, ligand panning and FACS sorting.
Coligan et al., Current Protocols in Immun., 1(2): Chapter 5
(1991). Preferably, expression cloning is employed wherein
polyadenylated RNA is prepared from a cell responsive to the TAT
polypeptide and a cDNA library created from this RNA is divided
into pools and used to transfect COS cells or other cells that are
not responsive to the TAT polypeptide. Transfected cells that are
grown on glass slides are exposed to labeled TAT polypeptide. The
TAT polypeptide can be labeled by a variety of means including
iodination or inclusion of a recognition site for a site-specific
protein kinase. Following fixation and incubation, the slides are
subjected to autoradiographic analysis. Positive pools are
identified and sub-pools are prepared and re-transfected using an
interactive sub-pooling and re-screening process, eventually
yielding a single clone that encodes the putative receptor.
[0979] As an alternative approach for receptor identification,
labeled TAT polypeptide can be photoaffinity-linked with cell
membrane or extract preparations that express the receptor
molecule. Cross-linked material is resolved by PAGE and exposed to
X-ray film. The labeled complex containing the receptor can be
excised, resolved into peptide fragments, and subjected to protein
micro-sequencing. The amino acid sequence obtained from
micro-sequencing would be used to design a set of degenerate
oligonucleotide probes to screen a cDNA library to identify the
gene encoding the putative receptor.
[0980] In another assay for antagonists, mammalian cells or a
membrane preparation expressing the receptor would be incubated
with labeled TAT polypeptide in the presence of the candidate
compound. The ability of the compound to enhance or block this
interaction could then be measured.
[0981] More specific examples of potential antagonists include an
oligonucleotide that binds to the fusions of immunoglobulin with
TAT polypeptide, and, in particular, antibodies including, without
limitation, poly- and monoclonal antibodies and antibody fragments,
single-chain antibodies, anti-idiotypic antibodies, and chimeric or
humanized versions of such antibodies or fragments, as well as
human antibodies and antibody fragments. Alternatively, a potential
antagonist may be a closely related protein, for example, a mutated
form of the TAT polypeptide that recognizes the receptor but
imparts no effect, thereby competitively inhibiting the action of
the TAT polypeptide.
[0982] Another potential TAT polypeptide antagonist is an antisense
RNA or DNA construct prepared using antisense technology, where,
e.g., an antisense RNA or DNA molecule acts to block directly the
translation of mRNA by hybridizing to targeted mRNA and preventing
protein translation. Antisense technology can be used to control
gene expression through triple-helix formation or antisense DNA or
RNA, both of which methods are based on binding of a polynucleotide
to DNA or RNA. For example, the 5' coding portion of the
polynucleotide sequence, which encodes the mature TAT polypeptides
herein, is used to design an antisense RNA oligonucleotide of from
about 10 to 40 base pairs in length. A DNA oligonucleotide is
designed to be complementary to a region of the gene involved in
transcription (triple helix--see Lee et al., Nucl. Acids Res.,
6:3073 (1979); Cooney et al., Science, 241: 456 (1988); Dervan et
al., Science, 251:1360 (1991)), thereby preventing transcription
and the production of the TAT polypeptide. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks
translation of the mRNA molecule into the TAT polypeptide
(antisense--Okano, Neurochem., 56:560 (1991); Oligodeoxynucleotides
as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton,
Fla., 1988). The oligonucleotides described above can also be
delivered to cells such that the antisense RNA or DNA may be
expressed in vivo to inhibit production of the TAT polypeptide.
When antisense DNA is used, oligodeoxyribonucleotides derived from
the translation-initiation site, e.g., between about -10 and +10
positions of the target gene nucleotide sequence, are
preferred.
[0983] Potential antagonists include small molecules that bind to
the active site, the receptor binding site, or growth factor or
other relevant binding site of the TAT polypeptide, thereby
blocking the normal biological activity of the TAT polypeptide.
Examples of small molecules include, but are not limited to, small
peptides or peptide-like molecules, preferably soluble peptides,
and synthetic non-peptidyl organic or inorganic compounds.
[0984] Ribozymes are enzymatic RNA molecules capable of catalyzing
the specific cleavage of RNA. Ribozymes act by sequence-specific
hybridization to the complementary target RNA, followed by
endonucleolytic cleavage. Specific ribozyme cleavage sites within a
potential RNA target can be identified by known techniques. For
further details see, e.g., Rossi, Current Biology, 4:469-471
(1994), and PCT publication No. WO 97/33551 (published Sep. 18,
1997).
[0985] Nucleic acid molecules in triple-helix formation used to
inhibit transcription should be single-stranded and composed of
deoxynucleotides. The base composition of these oligonucleotides is
designed such that it promotes triple-helix formation via Hoogsteen
base-pairing rules, which generally require sizeable stretches of
purines or pyrimidines on one strand of a duplex. For further
details see, e.g., PCT publication No. WO 97/33551, supra.
[0986] These small molecules can be identified by any one or more
of the screening assays discussed hereinabove and/or by any other
screening techniques well known for those skilled in the art.
[0987] Isolated TAT polypeptide-encoding nucleic acid can be used
herein for recombinantly producing TAT polypeptide using techniques
well known in the art and as described herein. In turn, the
produced TAT polypeptides can be employed for generating anti-TAT
antibodies using techniques well known in the art and as described
herein.
[0988] Antibodies specifically binding a TAT polypeptide identified
herein, as well as other molecules identified by the screening
assays disclosed hereinbefore, can be administered for the
treatment of various disorders, including cancer, in the form of
pharmaceutical compositions.
[0989] If the TAT polypeptide is intracellular and whole antibodies
are used as inhibitors, internalizing antibodies are preferred.
However, lipofections or liposomes can also be used to deliver the
antibody, or an antibody fragment, into cells. Where antibody
fragments are used, the smallest inhibitory fragment that
specifically binds to the binding domain of the target protein is
preferred. For example, based upon the variable-region sequences of
an antibody, peptide molecules can be designed that retain the
ability to bind the target protein sequence. Such peptides can be
synthesized chemically and/or produced by recombinant DNA
technology. See, e.g., Marasco et al., Proc. Natl. Acad. Sci. USA,
90: 7889-7893 (1993).
[0990] The formulation herein may also contain more than one active
compound as necessary for the particular indication being treated,
preferably those with complementary activities that do not
adversely affect each other. Alternatively, or in addition, the
composition may comprise an agent that enhances its function, such
as, for example, a cytotoxic agent, cytokine, chemotherapeutic
agent, or growth-inhibitory agent. Such molecules are suitably
present in combination in amounts that are effective for the
purpose intended.
[0991] The following examples are offered for illustrative purposes
only, and are not intended to limit the scope of the present
invention in any way.
[0992] All patent and literature references cited in the present
specification are hereby incorporated by reference in their
entirety.
EXAMPLES
[0993] Commercially available reagents referred to in the examples
were used according to manufacturer's instructions unless otherwise
indicated. The source of those cells identified in the following
examples, and throughout the specification, by ATCC accession
numbers is the American Type Culture Collection, Manassas, Va.
Example 1
Tissue Expression Profiling Using GeneExpress.RTM.
[0994] A proprietary database containing gene expression
information (GeneExpress.RTM., Gene Logic Inc., Gaithersburg, Md.)
was analyzed in an attempt to identify polypeptides (and their
encoding nucleic acids) whose expression is significantly
upregulated in a particular tumor tissue(s) of interest as compared
to other tumor(s) and/or normal tissues. Specifically, analysis of
the GeneExpress.RTM. database was conducted using either software
available through Gene Logic Inc., Gaithersburg, Md., for use with
the GeneExpress.RTM. database or with proprietary software written
and developed at Genentech, Inc. for use with the GeneExpress.RTM.
database. The rating of positive hits in the analysis is based upon
several criteria including, for example, tissue specificity, tumor
specificity and expression level in normal essential and/or normal
proliferating tissues. The following is a list of molecules whose
tissue expression profile as determined from an analysis of the
GeneExpress.RTM. database evidences high tissue expression and
significant upregulation of expression in a specific tumor or
tumors as compared to other tumor(s) and/or normal tissues and
optionally relatively low expression in normal essential and/or
normal proliferating tissues. As such, the molecules listed below
are excellent polypeptide targets for the diagnosis and therapy of
cancer in mammals.
TABLE-US-00008 Molecule upregulation of expression in: as compared
to: DNA77507 (TAT161) breast tumor normal breast tissue DNA77507
(TAT161) colon tumor normal colon tissue DNA77507 (TAT161) lung
tumor normal lung tissue DNA77507 (TAT161) kidney tumor normal
kidney tissue DNA77507 (TAT161) liver tumor normal liver tissue
DNA77507 (TAT161) ovarian tumor normal ovarian tissue DNA77507
(TAT161) pancreatic tumor normal pancreatic tissue DNA77507
(TAT161) rectum tumor normal rectum tissue DNA77507 (TAT161) skin
tumor normal skin tissue DNA77507 (TAT161) uterine tumor normal
uterine tissue DNA77507 (TAT161) brain tumor normal brain tissue
DNA77507 (TAT161) soft tissue tumor normal soft tissue DNA77507
(TAT161) bone tumor normal bone tissue DNA80894 (TAT101) breast
tumor normal breast tissue DNA82343 (TAT157) colon tumor normal
colon tissue DNA82343 (TAT157) ovarian tumor normal ovarian tissue
DNA82343 (TAT157) stomach tumor normal stomach tissue DNA82343
(TAT157) liver tumor normal liver tissue DNA82343 (TAT157) rectum
tumor normal rectum tissue DNA82343 (TAT157) small intestine tumor
normal small intestine tissue DNA82343 (TAT157) esophagus tumor
normal esophagus tissue DNA82343 (TAT157) testis tumor normal
testis tissue DNA82343 (TAT157) thymus tumor normal thymus tissue
DNA87994 (TAT160) breast tumor normal breast tissue DNA87994
(TAT160) pancreatic tumor normal pancreatic tissue DNA87994
(TAT160) rectum tumor normal rectum tissue DNA87994 (TAT160) colon
tumor normal colon tissue DNA87994 (TAT160) esophagus tumor normal
esophagus tissue DNA87994 (TAT160) ovarian tumor normal ovarian
tissue DNA87994 (TAT160) lung tumor normal lung tissue DNA87994
(TAT160) uterine tumor normal uterine tissue DNA88131 (TAT158) bone
tumor normal bone tissue DNA88131 (TAT158) breast tumor normal
breast tissue DNA88131 (TAT158) colon tumor normal colon tissue
DNA88131 (TAT158) uterine tumor normal uterine tissue DNA88131
(TAT158) esophagus tumor normal esophagus tissue DNA88131 (TAT158)
lung tumor normal lung tissue DNA88131 (TAT158) ovarian tumor
normal ovarian tissue DNA88131 (TAT158) pancreatic tumor normal
pancreatic tissue DNA88131 (TAT158) prostate tumor normal prostate
tissue DNA88131 (TAT158) skin tumor normal skin tissue DNA88131
(TAT158) soft tissue tumor normal soft tissue DNA88131 (TAT158)
stomach tumor normal stomach tissue DNA88131 (TAT158) rectum tumor
normal rectum tissue DNA88131 (TAT158) neuroendocrine tumor normal
neuroendocrine tissue DNA88131 (TAT158) brain tumor normal brain
tissue DNA95930 (TAT110) colon tumor normal colon tissue DNA95930
(TAT110) uterine tumor normal uterine tissue DNA95930 (TAT110)
endometrial tumor normal endometrial tissue DNA95930 (TAT110)
rectum tumor normal rectum tissue DNA95930 (TAT110) ovarian tumor
normal ovarian tissue DNA95930 (TAT110) breast tumor normal breast
tissue DNA95930 (TAT110) lung tumor normal lung tissue DNA95930
(TAT110) prostate tumor normal prostate tissue DNA95930-1 (TAT210)
colon tumor normal colon tissue DNA95930-1 (TAT210) uterine tumor
normal uterine tissue DNA95930-1 (TAT210) endometrial tumor normal
endometrial tissue DNA95930-1 (TAT210) rectum tumor normal rectum
tissue DNA95930-1 (TAT210) ovarian tumor normal ovarian tissue
DNA95930-1 (TAT210) breast tumor normal breast tissue DNA95930-1
(TAT210) lung tumor normal lung tissue DNA95930-1 (TAT210) prostate
tumor normal prostate tissue DNA96917 (TAT159) pancreatic tumor
normal pancreatic tissue DNA96917 (TAT159) lung tumor normal lung
tissue DNA96917 (TAT159) liver tumor normal liver tissue DNA96930
(TAT112) breast tumor normal breast tissue DNA96930 (TAT112) colon
tumor normal colon tissue DNA96930 (TAT112) rectum tumor normal
rectum tissue DNA96930 (TAT112) uterine tumor normal uterine tissue
DNA96930 (TAT112) lung tumor normal lung tissue DNA96930 (TAT112)
ovarian tumor normal ovarian tissue DNA96930 (TAT112) pancreatic
tumor normal pancreatic tissue DNA96930 (TAT112) stomach tumor
normal stomach tissue DNA96936 (TAT147) breast tumor normal breast
tissue DNA96936 (TAT147) colon tumor normal colon tissue DNA96936
(TAT147) testis tumor normal testis tissue DNA96936 (TAT147)
ovarian tumor normal ovarian tissue DNA98565 (TAT145) brain tumor
normal brain tissue DNA98565 (TAT145) glioma normal glial tissue
DNA246435 (TAT152) brain tumor normal brain tissue DNA246435
(TAT152) glioma normal glial tissue DNA98591 (TAT162) colon tumor
normal colon tissue DNA98591 (TAT162) rectum tumor normal rectum
tissue DNA98591 (TAT162) ovarian tumor normal ovarian tissue
DNA98591 (TAT162) pancreatic tumor normal pancreatic tissue
DNA98591 (TAT162) stomach tumor normal stomach tissue DNA108809
(TAT114) colon tumor normal colon tissue DNA108809 (TAT114) kidney
tumor normal kidney tissue DNA119488 (TAT119) colon tumor normal
colon tissue DNA119488 (TAT119) lung tumor normal lung tissue
DNA119488 (TAT119) rectum tumor normal rectum tissue DNA143493
(TAT103) breast tumor normal breast tissue DNA167234 (TAT130)
prostate tumor normal prostate tissue DNA235621 (TAT166) prostate
tumor normal prostate tissue DNA235621 (TAT166) liver tumor normal
liver tissue DNA176766 (TAT132) kidney tumor normal kidney tissue
DNA176766 (TAT132) ovarian tumor normal ovarian tissue DNA176766
(TAT132) uterine tumor normal uterine tissue DNA236463 (TAT150)
kidney tumor normal kidney tissue DNA236463 (TAT150) ovarian tumor
normal ovarian tissue DNA236463 (TAT150) uterine tumor normal
uterine tissue DNA181162 (TAT129) prostate tumor normal prostate
tissue DNA188221 (TAT111) colon tumor normal colon tissue DNA188221
(TAT111) endometrial tumor normal endometrial tissue DNA188221
(TAT111) stomach tumor normal stomach tissue DNA233876 (TAT146)
colon tumor normal colon tissue DNA233876 (TAT146) endometrial
tumor normal endometrial tissue DNA233876 (TAT146) stomach tumor
normal stomach tissue DNA193891 (TAT148) colon tumor normal colon
tissue DNA248170 (TAT187) colon tumor normal colon tissue DNA248170
(TAT187) breast tumor normal breast tissue DNA194628 (TAT118)
kidney tumor normal kidney tissue DNA246415 (TAT167) kidney tumor
normal kidney tissue DNA215609 (TAT113) colon tumor normal colon
tissue DNA215609 (TAT113) rectum tumor normal rectum tissue
DNA220432 (TAT128) prostate tumor normal prostate tissue DNA226094
(TAT164) breast tumor normal breast tissue DNA226094 (TAT164) brain
tumor normal brain tissue DNA226094 (TAT164) lung tumor normal lung
tissue DNA226094 (TAT164) skin tumor normal skin tissue DNA226165
(TAT122) breast tumor normal breast tissue DNA226165 (TAT122)
endometrial tumor normal endometrial tissue DNA226165 (TAT122)
kidney tumor normal kidney tissue DNA226165 (TAT122) lung tumor
normal lung tissue DNA226165 (TAT122) ovarian tumor normal ovarian
tissue DNA226165 (TAT122) colon tumor normal colon tissue DNA226165
(TAT122) rectum tumor normal rectum tissue DNA226165 (TAT122) skin
tumor normal skin tissue DNA226165 (TAT122) soft tissue tumor
normal soft tissue tissue DNA226165 (TAT122) bladder tumor normal
bladder tissue DNA226237 (TAT117) kidney tumor normal kidney tissue
DNA246450 (TAT168) kidney tumor normal kidney tissue DNA226456
(TAT144) breast tumor normal breast tissue DNA226456 (TAT144) colon
tumor normal colon tissue DNA226456 (TAT144) rectum tumor normal
rectum tissue DNA226456 (TAT144) endometrial tumor normal
endometrial tissue DNA226456 (TAT144) kidney tumor normal kidney
tissue DNA226456 (TAT144) lung tumor normal lung tissue DNA226456
(TAT144) ovarian tumor normal ovarian tissue DNA226456 (TAT144)
skin tumor normal skin tissue DNA237637 (TAT188) breast tumor
normal breast tissue DNA237637 (TAT188) colon tumor normal colon
tissue DNA237637 (TAT188) rectum tumor normal rectum tissue
DNA237637 (TAT188) endometrial tumor normal endometrial tissue
DNA237637 (TAT188) kidney tumor normal kidney tissue DNA237637
(TAT188) lung tumor normal lung tissue DNA237637 (TAT188) ovarian
tumor normal ovarian tissue DNA237637 (TAT188) skin tumor normal
skin tissue DNA237637 (TAT188) liver tumor normal liver tissue
DNA237637 (TAT188) lung tumor normal lung tissue DNA226539 (TAT126)
breast tumor normal breast tissue DNA226539 (TAT126) colon tumor
normal colon tissue DNA226539 (TAT126) rectum tumor normal rectum
tissue DNA226539 (TAT126) endometrial tumor normal endometrial
tissue DNA226539 (TAT126) lung tumor normal lung tissue DNA226539
(TAT126) ovarian tumor normal ovarian tissue DNA226539 (TAT126)
pancreatic tumor normal pancreatic tissue DNA236511 (TAT151) breast
tumor normal breast tissue DNA236511 (TAT151) colon tumor normal
colon tissue DNA236511 (TAT151) rectum tumor normal rectum tissue
DNA236511 (TAT151) endometrial tumor normal endometrial tissue
DNA236511 (TAT151) lung tumor normal lung tissue DNA236511 (TAT151)
ovarian tumor normal ovarian tissue DNA236511 (TAT151) pancreatic
tumor normal pancreatic tissue DNA226771 (TAT115) breast tumor
normal breast tissue DNA226771 (TAT115) colon tumor normal colon
tissue DNA227087 (TAT163) breast tumor normal breast tissue
DNA227087 (TAT163) colon tumor normal colon tissue DNA227087
(TAT163) rectum tumor normal rectum tissue DNA227087 (TAT163) lung
tumor normal lung tissue DNA227087 (TAT163) ovarian tumor normal
ovarian tissue DNA227087 (TAT163) prostate tumor normal prostate
tissue DNA227087 (TAT163) endocrine tumor normal endocrine tissue
DNA227087 (TAT163) kidney tumor normal kidney tissue DNA227087
(TAT163) liver tumor normal liver tissue DNA227087 (TAT163) nervous
system tumor normal nervous system tissue DNA227087 (TAT163)
pancreatic tumor normal pancreatic tissue DNA227087 (TAT163)
uterine tumor normal uterine tissue DNA227087 (TAT163) small
intestine tumor normal small intestine tissue DNA227087 (TAT163)
lymphoid tumor normal lymphoid tissue DNA266307 (TAT227) breast
tumor normal breast tissue DNA266307 (TAT227) colon tumor normal
colon tissue DNA266307 (TAT227) rectum tumor normal rectum tissue
DNA266307 (TAT227) lung tumor normal lung tissue DNA266307 (TAT227)
ovarian tumor normal ovarian tissue DNA266307 (TAT227) prostate
tumor normal prostate tissue DNA266307 (TAT227) endocrine tumor
normal endocrine tissue DNA266307 (TAT227) kidney tumor normal
kidney tissue DNA266307 (TAT227) liver tumor normal liver tissue
DNA266307 (TAT227) nervous system tumor normal nervous system
tissue DNA266307 (TAT227) pancreatic tumor normal pancreatic tissue
DNA266307 (TAT227) uterine tumor normal uterine tissue DNA266307
(TAT227) small intestine tumor normal small intestine tissue
DNA266307 (TAT227) lymphoid tumor normal lymphoid tissue DNA266311
(TAT228) breast tumor normal breast tissue DNA266311 (TAT228) colon
tumor normal colon tissue DNA266311 (TAT228) rectum tumor normal
rectum tissue DNA266311 (TAT228) lung tumor normal lung tissue
DNA266311 (TAT228) ovarian tumor normal ovarian tissue DNA266311
(TAT228) prostate tumor normal prostate tissue DNA266311 (TAT228)
endocrine tumor normal endocrine tissue DNA266311 (TAT228) kidney
tumor normal kidney tissue DNA266311 (TAT228) liver tumor normal
liver tissue DNA266311 (TAT228) nervous system tumor normal nervous
system tissue DNA266311 (TAT228) pancreatic tumor normal pancreatic
tissue DNA266311 (TAT228) uterine tumor normal uterine tissue
DNA266311 (TAT228) small intestine tumor normal small intestine
tissue DNA266311 (TAT228) lymphoid tumor normal lymphoid tissue
DNA266312 (TAT229) breast tumor normal breast tissue DNA266312
(TAT229) colon tumor normal colon tissue DNA266312 (TAT229) rectum
tumor normal rectum tissue DNA266312 (TAT229) lung tumor normal
lung tissue DNA266312 (TAT229) ovarian tumor normal ovarian tissue
DNA266312 (TAT229) prostate tumor normal prostate tissue DNA266312
(TAT229) endocrine tumor normal endocrine tissue DNA266312 (TAT229)
kidney tumor normal kidney tissue DNA266312 (TAT229) liver tumor
normal liver tissue DNA266312 (TAT229) nervous system tumor normal
nervous system tissue DNA266312 (TAT229) pancreatic tumor normal
pancreatic tissue DNA266312 (TAT229) uterine tumor normal uterine
tissue DNA266312 (TAT229) small intestine tumor normal small
intestine tissue DNA266312 (TAT229) lymphoid tumor normal lymphoid
tissue DNA266313 (TAT230) breast tumor normal breast tissue
DNA266313 (TAT230) colon tumor normal colon tissue DNA266313
(TAT230) rectum tumor normal rectum tissue DNA266313 (TAT230) lung
tumor normal lung tissue DNA266313 (TAT230) ovarian tumor normal
ovarian tissue DNA266313 (TAT230) prostate tumor normal prostate
tissue DNA266313 (TAT230) endocrine tumor normal endocrine tissue
DNA266313 (TAT230) kidney tumor normal kidney tissue DNA266313
(TAT230) liver tumor normal liver tissue DNA266313 (TAT230) nervous
system tumor normal nervous system tissue DNA266313 (TAT230)
pancreatic tumor normal pancreatic tissue DNA266313 (TAT230)
uterine tumor normal uterine tissue DNA266313 (TAT230) small
intestine tumor normal small intestine tissue DNA266313 (TAT230)
lymphoid tumor normal lymphoid tissue DNA227224 (TAT121) breast
tumor normal breast tissue DNA227224 (TAT121) colon tumor normal
colon tissue DNA227224 (TAT121) rectum tumor normal rectum tissue
DNA227224 (TAT121) endometrial tumor normal endometrial tissue
DNA227224 (TAT121) kidney tumor normal kidney tissue DNA227224
(TAT121) lung tumor normal lung tissue DNA227224 (TAT121) ovarian
tumor normal ovarian tissue DNA227224 (TAT121) skin tumor normal
skin tissue DNA227224 (TAT121) testis tumor normal testis tissue
DNA227224 (TAT121) bladder tumor normal bladder tissue DNA247486
(TAT183) breast tumor normal breast tissue
DNA247486 (TAT183) colon tumor normal colon tissue DNA247486
(TAT183) rectum tumor normal rectum tissue DNA247486 (TAT183)
endometrial tumor normal endometrial tissue DNA247486 (TAT183)
kidney tumor normal kidney tissue DNA247486 (TAT183) lung tumor
normal lung tissue DNA247486 (TAT183) ovarian tumor normal ovarian
tissue DNA247486 (TAT183) skin tumor normal skin tissue DNA247486
(TAT183) testis tumor normal testis tissue DNA247486 (TAT183)
bladder tumor normal bladder tissue DNA227800 (TAT131) prostate
tumor normal prostate tissue DNA228199 (TAT127) breast tumor normal
breast tissue DNA228199 (TAT127) endometrial tumor normal
endometrial tissue DNA228199 (TAT127) ovarian tumor normal ovarian
tissue DNA228199 (TAT127) pancreatic tumor normal pancreatic tissue
DNA228199 (TAT127) lung tumor normal lung tissue DNA228201 (TAT116)
colon tumor normal colon tissue DNA228201 (TAT116) rectum tumor
normal rectum tissue DNA247488 (TAT189) colon tumor normal colon
tissue DNA247488 (TAT189) rectum tumor normal rectum tissue
DNA236538 (TAT190) colon tumor normal colon tissue DNA236538
(TAT190) rectum tumor normal rectum tissue DNA247489 (TAT191) colon
tumor normal colon tissue DNA247489 (TAT191) rectum tumor normal
rectum tissue DNA228211 (TAT133) uterine tumor normal uterine
tissue DNA233937 (TAT186) uterine tumor normal uterine tissue
DNA233937 (TAT186) ovarian tumor normal ovarian tissue DNA228994
(TAT124) lung tumor normal lung tissue DNA228994 (TAT124) ovarian
tumor normal ovarian tissue DNA228994 (TAT124) skin tumor normal
skin tissue DNA228994 (TAT124) breast tumor normal breast tissue
DNA229410 (TAT105) breast tumor normal breast tissue DNA229411
(TAT107) breast tumor normal breast tissue DNA229413 (TAT108)
breast tumor normal breast tissue DNA229700 (TAT139) breast tumor
normal breast tissue DNA231312 (TAT143) breast tumor normal breast
tissue DNA231312 (TAT143) colon tumor normal colon tissue DNA231542
(TAT100) brain tumor normal brain tissue DNA231542 (TAT100) glioma
normal glial tissue DNA231542-1 (TAT284) brain tumor normal brain
tissue DNA231542-1 (TAT284) glioma normal glial tissue DNA231542-2
(TAT285) brain tumor normal brain tissue DNA231542-2 (TAT285)
glioma normal glial tissue DNA297393 (TAT285-1) brain tumor normal
brain tissue DNA297393 (TAT285-1) glioma normal glial tissue
DNA234833 (TAT149) colon tumor normal colon tissue DNA268022
(TAT231) colon tumor normal colon tissue DNA268022 (TAT231) breast
tumor normal breast tissue DNA268022 (TAT231) ovarian tumor normal
ovarian tissue DNA236246 (TAT153) breast tumor normal breast tissue
DNA236343 (TAT104) breast tumor normal breast tissue DNA236493
(TAT141) breast tumor normal breast tissue DNA236493 (TAT141)
glioblastoma tumor normal glial tissue DNA236534 (TAT102) breast
tumor normal breast tissue DNA236534 (TAT102) colon tumor normal
colon tissue DNA236534 (TAT102) rectum tumor normal rectum tissue
DNA236534 (TAT102) cervical tumor normal cervical tissue DNA236534
(TAT102) endometrial tumor normal endometrial tissue DNA236534
(TAT102) lung tumor normal lung tissue DNA236534 (TAT102) ovarian
tumor normal ovarian tissue DNA236534 (TAT102) pancreatic tumor
normal pancreatic tissue DNA236534 (TAT102) prostate tumor normal
prostate tissue DNA236534 (TAT102) stomach tumor normal stomach
tissue DNA236534 (TAT102) bladder tumor normal bladder tissue
DNA246430 (TAT109) breast tumor normal breast tissue DNA246430
(TAT109) prostate tumor normal prostate tissue DNA247480 (TAT142)
breast tumor normal breast tissue DNA247480 (TAT142) lung tumor
normal lung tissue DNA264454 (TAT106) breast tumor normal breast
tissue
Example 2
Microarray Analysis to Detect Upregulation of TAT Polypeptides in
Cancerous Tumors
[0995] Nucleic acid microarrays, often containing thousands of gene
sequences, are useful for identifying differentially expressed
genes in diseased tissues as compared to their normal counterparts.
Using nucleic acid microarrays, test and control mRNA samples from
test and control tissue samples are reverse transcribed and labeled
to generate cDNA probes. The cDNA probes are then hybridized to an
array of nucleic acids immobilized on a solid support. The array is
configured such that the sequence and position of each member of
the array is known. For example, a selection of genes known to be
expressed in certain disease states may be arrayed on a solid
support. Hybridization of a labeled probe with a particular array
member indicates that the sample from which the probe was derived
expresses that gene. If the hybridization signal of a probe from a
test (disease tissue) sample is greater than hybridization signal
of a probe from a control (normal tissue) sample, the gene or genes
overexpressed in the disease tissue are identified. The implication
of this result is that an overexpressed protein in a diseased
tissue is useful not only as a diagnostic marker for the presence
of the disease condition, but also as a therapeutic target for
treatment of the disease condition.
[0996] The methodology of hybridization of nucleic acids and
microarray technology is well known in the art. In one example, the
specific preparation of nucleic acids for hybridization and probes,
slides, and hybridization conditions are all detailed in PCT Patent
Application Serial No. PCT/US01/10482, filed on Mar. 30, 2001 and
which is herein incorporated by reference.
[0997] In the present example, cancerous tumors derived from
various human tissues were studied for upregulated gene expression
relative to cancerous tumors from different tissue types and/or
non-cancerous human tissues in an attempt to identify those
polypeptides which are overexpressed in a particular cancerous
tumor(s). In certain experiments, cancerous human tumor tissue and
non-cancerous human tumor tissue of the same tissue type (often
from the same patient) were obtained and analyzed for TAT
polypeptide expression. Additionally, cancerous human tumor tissue
from any of a variety of different human tumors was obtained and
compared to a "universal" epithelial control sample which was
prepared by pooling non-cancerous human tissues of epithelial
origin, including liver, kidney, and lung. mRNA isolated from the
pooled tissues represents a mixture of expressed gene products from
these different tissues. Microarray hybridization experiments using
the pooled control samples generated a linear plot in a 2-color
analysis. The slope of the line generated in a 2-color analysis was
then used to normalize the ratios of (test:control detection)
within each experiment. The normalized ratios from various
experiments were then compared and used to identify clustering of
gene expression. Thus, the pooled "universal control" sample not
only allowed effective relative gene expression determinations in a
simple 2-sample comparison, it also allowed multi-sample
comparisons across several experiments.
[0998] In the present experiments, nucleic acid probes derived from
the herein described TAT polypeptide-encoding nucleic acid
sequences were used in the creation of the microarray and RNA from
various tumor tissues were used for the hybridization thereto.
Below is shown the results of these experiments, demonstrating that
various TAT polypeptides of the present invention are significantly
overexpressed in various human tumor tissues as compared to their
normal counterpart tissue(s). Moreover, all of the molecules shown
below are significantly overexpressed in their specific tumor
tissue(s) as compared to in the "universal" epithelial control. As
described above, these data demonstrate that the TAT polypeptides
of the present invention are useful not only as diagnostic markers
for the presence of one or more cancerous tumors, but also serve as
therapeutic targets for the treatment of those tumors.
TABLE-US-00009 upregulation Molecule of expression in: as compared
to: DNA95930 (TAT110) colon tumor normal colon tissue DNA95930
(TAT110) lung tumor normal lung tissue DNA95930 (TAT110) prostate
tumor normal prostate tissue DNA95930 (TAT110) endometrial tumor
normal endometrial tissue DNA95930 (TAT110) ovarian tumor normal
ovarian tissue DNA95930-1 (TAT210) colon tumor normal colon tissue
DNA95930-1 (TAT210) lung tumor normal lung tissue DNA95930-1
(TAT210) prostate tumor normal prostate tissue DNA95930-1 (TAT210)
endometrial tumor normal endometrial tissue DNA95930-1 (TAT210)
ovarian tumor normal ovarian tissue DNA96930 (TAT112) colon tumor
normal colon tissue DNA96930 (TAT112) breast tumor normal breast
tissue DNA96930 (TAT112) lung tumor normal lung tissue DNA96936
(TAT147) breast tumor normal breast tissue DNA96936 (TAT147) colon
tumor normal colon tissue DNA96936 (TAT147) ovarian tumor normal
ovarian tissue DNA96936 (TAT147) prostate tumor normal prostate
tissue DNA108809 (TAT114) colon tumor normal colon tissue DNA119488
(TAT119) colon tumor normal colon tissue DNA119488 (TAT119) lung
tumor normal lung tissue DNA143493 (TAT103) breast tumor normal
breast tissue DNA181162 (TAT129) prostate tumor normal prostate
tissue DNA188221 (TAT111) colon tumor normal colon tissue DNA188221
(TAT111) lung tumor normal lung tissue DNA188221 (TAT111) ovarian
tumor normal ovarian tissue DNA233876 (TAT146) colon tumor normal
colon tissue DNA233876 (TAT146) lung tumor normal lung tissue
DNA233876 (TAT146) ovarian tumor normal ovarian tissue DNA210499
(TAT123) ovarian tumor normal ovarian tissue DNA210499 (TAT123)
lung tumor normal lung tissue DNA219894 (TAT211) ovarian tumor
normal ovarian tissue DNA219894 (TAT211) lung tumor normal lung
tissue DNA215609 (TAT113) colon tumor normal colon tissue DNA220432
(TAT128) prostate tumor normal prostate tissue DNA226165 (TAT122)
breast tumor normal breast tissue DNA226165 (TAT122) colon tumor
normal colon tissue DNA226165 (TAT122) rectum tumor normal rectum
tissue DNA226165 (TAT122) lung tumor normal lung tissue DNA226165
(TAT122) ovarian tumor normal ovarian tissue DNA226165 (TAT122)
prostate tumor normal prostate tissue DNA226456 (TAT144) breast
tumor normal breast tissue DNA226456 (TAT144) colon tumor normal
colon tissue DNA237637 (TAT188) breast tumor normal breast tissue
DNA237637 (TAT188) colon tumor normal colon tissue DNA226539
(TAT126) rectum tumor normal rectum tissue DNA226539 (TAT126) colon
tumor normal colon tissue DNA226539 (TAT126) lung tumor normal lung
tissue DNA226539 (TAT126) ovarian tumor normal ovarian tissue
DNA236511 (TAT151) rectum tumor normal rectum tissue DNA236511
(TAT151) colon tumor normal colon tissue DNA236511 (TAT151) lung
tumor normal lung tissue DNA236511 (TAT151) ovarian tumor normal
ovarian tissue DNA226771 (TAT115) colon tumor normal colon tissue
DNA227224 (TAT121) ovarian tumor normal ovarian tissue DNA227224
(TAT121) rectum tumor normal rectum tissue DNA227224 (TAT121) colon
tumor normal colon tissue DNA227224 (TAT121) lung tumor normal lung
tissue DNA227224 (TAT121) breast tumor normal breast tissue
DNA227224 (TAT121) prostate tumor normal prostate tissue DNA247486
(TAT183) ovarian tumor normal ovarian tissue DNA247486 (TAT183)
rectum tumor normal rectum tissue DNA247486 (TAT183) colon tumor
normal colon tissue DNA247486 (TAT183) lung tumor normal lung
tissue DNA247486 (TAT183) breast tumor normal breast tissue
DNA247486 (TAT183) prostate tumor normal prostate tissue DNA228199
(TAT127) ovarian tumor normal ovarian tissue DNA228199 (TAT127)
lung tumor normal lung tissue DNA228201 (TAT116) colon tumor normal
colon tissue DNA247488 (TAT189) colon tumor normal colon tissue
DNA236538 (TAT190) colon tumor normal colon tissue DNA247489
(TAT191) colon tumor normal colon tissue DNA228994 (TAT124) lung
tumor normal lung tissue DNA228994 (TAT124) breast tumor normal
breast tissue DNA228994 (TAT124) ovarian tumor normal ovarian
tissue DNA231312 (TAT143) colon tumor normal colon tissue DNA231542
(TAT100) brain tumor normal brain tissue DNA231542 (TAT100) glioma
normal glial tissue DNA231542-1 (TAT284) brain tumor normal brain
tissue DNA231542-1 (TAT284) glioma normal glial tissue DNA231542-2
(TAT285) brain tumor normal brain tissue DNA231542-2 (TAT285)
glioma normal glial tissue DNA297393 (TAT285-1) brain tumor normal
brain tissue DNA297393 (TAT285-1) glioma normal glial tissue
DNA236246 (TAT153) breast tumor normal breast tissue DNA236343
(TAT104) breast tumor normal breast tissue DNA236534 (TAT102)
breast tumor normal breast tissue DNA236534 (TAT102) colon tumor
normal colon tissue DNA246430 (TAT109) prostate tumor normal
prostate tissue DNA264454 (TAT106) breast tumor normal breast
tissue DNA98565 (TAT145) glioma normal brain tissue DNA246435
(TAT152) glioma normal brain tissue DNA226094 (TAT164) glioma
normal brain tissue
Example 3
Quantitative Analysis of TAT mRNA Expression
[0999] In this assay, a 5' nuclease assay (for example,
TaqMan.RTM.) and real-time quantitative PCR (for example, ABI Prizm
7700 Sequence Detection System.RTM. (Perkin Elmer, Applied
Biosystems Division, Foster City, Calif.)), were used to find genes
that are significantly overexpressed in a cancerous tumor or tumors
as compared to other cancerous tumors or normal non-cancerous
tissue. The 5' nuclease assay reaction is a fluorescent PCR-based
technique which makes use of the 5' exonuclease activity of Taq DNA
polymerase enzyme to monitor gene expression in real time. Two
oligonucleotide primers (whose sequences are based upon the gene or
EST sequence of interest) are used to generate an amplicon typical
of a PCR reaction. A third oligonucleotide, or probe, is designed
to detect nucleotide sequence located between the two PCR primers.
The probe is non-extendible by Taq DNA polymerase enzyme, and is
labeled with a reporter fluorescent dye and a quencher fluorescent
dye. Any laser-induced emission from the reporter dye is quenched
by the quenching dye when the two dyes are located close together
as they are on the probe. During the PCR amplification reaction,
the Taq DNA polymerase enzyme cleaves the probe in a
template-dependent manner. The resultant probe fragments
disassociate in solution, and signal from the released reporter dye
is free from the quenching effect of the second fluorophore. One
molecule of reporter dye is liberated for each new molecule
synthesized, and detection of the unquenched reporter dye provides
the basis for quantitative interpretation of the data.
[1000] The 5' nuclease procedure is run on a real-time quantitative
PCR device such as the ABI Prism 7700.TM. Sequence Detection. The
system consists of a thermocycler, laser, charge-coupled device
(CCD) camera and computer. The system amplifies samples in a
96-well format on a thermocycler. During amplification,
laser-induced fluorescent signal is collected in real-time through
fiber optics cables for all 96 wells, and detected at the CCD. The
system includes software for running the instrument and for
analyzing the data.
[1001] The starting material for the screen was mRNA isolated from
a variety of different cancerous tissues. The mRNA is quantitated
precisely, e.g., fluorometrically. As a negative control, RNA was
isolated from various normal tissues of the same tissue type as the
cancerous tissues being tested.
[1002] 5' nuclease assay data are initially expressed as Ct, or the
threshold cycle. This is defined as the cycle at which the reporter
signal accumulates above the background level of fluorescence.
The)Ct values are used as quantitative measurement of the relative
number of starting copies of a particular target sequence in a
nucleic acid sample when comparing cancer mRNA results to normal
human mRNA results. As one Ct unit corresponds to 1 PCR cycle or
approximately a 2-fold relative increase relative to normal, two
units corresponds to a 4-fold relative increase, 3 units
corresponds to an 8-fold relative increase and so on, one can
quantitatively measure the relative fold increase in mRNA
expression between two or more different tissues. Using this
technique, the molecules listed below have been identified as being
significantly overexpressed in a particular tumor(s) as compared to
their normal non-cancerous counterpart tissue(s) (from both the
same and different tissue donors) and thus, represent excellent
polypeptide targets for the diagnosis and therapy of cancer in
mammals.
TABLE-US-00010 upregulation Molecule of expression in: as compared
to: DNA77507 (TAT161) breast tumor normal breast tissue DNA82343
(TAT157) colon tumor normal colon tissue DNA88131 (TAT158) breast
tumor normal breast tissue DNA88131 (TAT158) colon tumor normal
colon tissue DNA95930 (TAT110) colon tumor normal colon tissue
DNA95930 (TAT110) lung tumor normal lung tissue DNA95930 (TAT110)
prostate tumor normal prostate tissue DNA95930 (TAT110) endometrial
normal endometrial tissue tumor DNA95930 (TAT110) ovarian tumor
normal ovarian tissue DNA95930-1 (TAT210) colon tumor normal colon
tissue DNA95930-1 (TAT210) lung tumor normal lung tissue DNA95930-1
(TAT210) prostate tumor normal prostate tissue DNA95930-1 (TAT210)
endometrial normal endometrial tissue tumor DNA95930-1 (TAT210)
ovarian tumor normal ovarian tissue DNA96930 (TAT112) colon tumor
normal colon tissue DNA96936 (TAT147) colon tumor normal colon
tissue DNA98591 (TAT162) colon tumor normal colon tissue DNA108809
(TAT114) kidney tumor normal kidney tissue DNA119488 (TAT119) lung
tumor normal lung tissue DNA188221 (TAT111) colon tumor normal
colon tissue DNA233876 (TAT146) colon tumor normal colon tissue
DNA193891 (TAT148) colon tumor normal colon tissue DNA248170
(TAT187) colon tumor normal colon tissue DNA194628 (TAT118) kidney
tumor normal kidney tissue DNA246415 (TAT167) kidney tumor normal
kidney tissue DNA210499 (TAT123) lung tumor normal lung tissue
DNA219894 (TAT211) lung tumor normal lung tissue DNA215609 (TAT113)
colon tumor normal colon tissue DNA220432 (TAT128) prostate tumor
normal prostate tissue DNA226165 (TAT122) lung tumor normal lung
tissue DNA226237 (TAT117) kidney tumor normal kidney tissue
DNA246450 (TAT168) kidney tumor normal kidney tissue DNA226456
(TAT144) breast tumor normal breast tissue DNA237637 (TAT188)
breast tumor normal breast tissue DNA226539 (TAT126) ovarian tumor
normal ovarian tissue DNA236511 (TAT151) ovarian tumor normal
ovarian tissue DNA227224 (TAT121) lung tumor normal lung tissue
DNA247486 (TAT183) lung tumor normal lung tissue DNA227800 (TAT131)
prostate tumor normal prostate tissue DNA228199 (TAT127) ovarian
tumor normal ovarian tissue DNA228199 (TAT127) lung tumor normal
lung tissue DNA228201 (TAT116) colon tumor normal colon tissue
DNA247488 (TAT189) colon tumor normal colon tissue DNA236538
(TAT190) colon tumor normal colon tissue DNA247489 (TAT191) colon
tumor normal colon tissue DNA228993 (TAT120) lung tumor normal lung
tissue DNA228994 (TAT124) lung tumor normal lung tissue DNA236343
(TAT104) breast tumor normal breast tissue DNA236534 (TAT102)
ovarian tumor normal ovarian tissue DNA246430 (TAT109) breast tumor
normal breast tissue DNA247480 (TAT142) lung tumor normal lung
tissue DNA98565 (TAT145) glioma normal brain tissue DNA246435
(TAT152) glioma normal brain tissue DNA226094 (TAT164) glioma
normal brain tissue DNA227578 (TAT165) glioma normal brain tissue
DNA231542 (TAT100) glioma normal brain tissue DNA231542-1 (TAT284)
glioma normal brain tissue DNA231542-2 (TAT285) glioma normal brain
tissue DNA297393 (TAT285-1) glioma normal brain tissue
Example 4
In situ Hybridization
[1003] In situ hybridization is a powerful and versatile technique
for the detection and localization of nucleic acid sequences within
cell or tissue preparations. It may be useful, for example, to
identify sites of gene expression, analyze the tissue distribution
of transcription, identify and localize viral infection, follow
changes in specific mRNA synthesis and aid in chromosome
mapping.
[1004] In situ hybridization was performed following an optimized
version of the protocol by Lu and Gillett, Cell Vision 1:169-176
(1994), using PCR-generated .sup.33P-labeled riboprobes having
homology to the target sequence to be detected. Briefly,
formalin-fixed, paraffin-embedded human tissues were sectioned,
deparaffinized, deproteinated in proteinase K (20 g/ml) for 15
minutes at 37EC, and further processed for in situ hybridization as
described by Lu and Gillett, supra. A [.sup.33-P] UTP-labeled
antisense riboprobe was generated from a PCR product and hybridized
at 55EC overnight. The slides were dipped in Kodak NTB2 nuclear
track emulsion and exposed for 4 weeks.
.sup.33P-Riboprobe Synthesis
[1005] 6.0:1(125 mCi) of .sup.33P-UTP (Amersham BF 1002, SA<2000
Ci/mmol) were speed vac dried. To each tube containing dried
.sup.33P-UTP, the following ingredients were added:
[1006] 2.0:15x transcription buffer
[1007] 1.0:1 DTT (100 mM)
[1008] 2.0:1 NTP mix (2.5 mM:10; each of 10 mM GTP, CTP &
ATP+10:1 H.sub.2O)
[1009] 1.0:1 UTP (50:M)
[1010] 1.0:1 Rnasin
[1011] 1.0:1 DNA template (1:g)
[1012] 1.0:1 H.sub.2O
[1013] 1.0:1 RNA polymerase (for PCR products T3=AS, T7=S,
usually)
[1014] The tubes were incubated at 37EC for one hour. 1.0:1 RQ1
DNase were added, followed by incubation at 37EC for 15 minutes.
90:1 TE (10 mM Tris pH 7.6/1 mM EDTA pH 8.0) were added, and the
mixture was pipetted onto DE81 paper. The remaining solution was
loaded in a Microcon-50 ultrafiltration unit, and spun using
program 10 (6 minutes). The filtration unit was inverted over a
second tube and spun using program 2 (3 minutes). After the final
recovery spin, 100:1 TE were added. 1:1 of the final product was
pipetted on DE81 paper and counted in 6 ml of Biofluor II.
[1015] The probe was run on a TBE/urea gel. 1-3:1 of the probe or
5:1 of RNA Mrk III were added to 3:1 of loading buffer. After
heating on a 95EC heat block for three minutes, the probe was
immediately placed on ice. The wells of gel were flushed, the
sample loaded, and run at 180-250 volts for 45 minutes. The gel was
wrapped in saran wrap and exposed to XAR film with an intensifying
screen in -70EC freezer one hour to overnight.
.sup.33P-Hybridization
[1016] A. Pretreatment of Frozen Sections
[1017] The slides were removed from the freezer, placed on
aluminium trays and thawed at room temperature for 5 minutes. The
trays were placed in 55EC incubator for five minutes to reduce
condensation. The slides were fixed for 10 minutes in 4%
paraformaldehyde on ice in the fume hood, and washed in
0.5.times.SSC for 5 minutes, at room temperature (25 ml
20.times.SSC+975 ml SQ H.sub.2O). After deproteination in 0.5:g/ml
proteinase K for 10 minutes at 37EC (12.5:1 of 10 mg/ml stock in
250 ml prewarmed RNase-free RNAse buffer), the sections were washed
in 0.5.times.SSC for 10 minutes at room temperature. The sections
were dehydrated in 70%, 95%, 100% ethanol, 2 minutes each.
[1018] B. Pretreatment of Paraffin-Embedded Sections
[1019] The slides were deparaffinized, placed in SQ H.sub.2O, and
rinsed twice in 2.times.SSC at room temperature, for 5 minutes each
time. The sections were deproteinated in 20:g/ml proteinase K
(500:1 of 10 mg/ml in 250 ml RNase-free RNase buffer; 37EC, 15
minutes)-human embryo, or 8.times. proteinase K (100:1 in 250 ml
Rnase buffer, 37EC, 30 minutes)-formalin tissues. Subsequent
rinsing in 0.5.times.SSC and dehydration were performed as
described above.
[1020] C. Prehybridization
[1021] The slides were laid out in a plastic box lined with Box
buffer (4.times.SSC, 50% formamide)--saturated filter paper.
[1022] D. Hybridization
[1023] 1.0.times.10.sup.6 cpm probe and 1.0:1 tRNA (50 mg/ml stock)
per slide were heated at 95EC for 3 minutes. The slides were cooled
on ice, and 48:1 hybridization buffer were added per slide. After
vortexing, 50:1.sup.33P mix were added to 50:1 prehybridization on
slide. The slides were incubated overnight at 55EC.
[1024] E. Washes
[1025] Washing was done 2.times.10 minutes with 2.times.SSC, EDTA
at room temperature (400 ml 20.times.SSC+16 ml 0.25M EDTA,
V.sub.f=4L), followed by RNaseA treatment at 37EC for 30 minutes
(500:1 of 10 mg/ml in 250 ml Rnase buffer=20:g/ml), The slides were
washed 2.times.10 minutes with 2.times.SSC, EDTA at room
temperature. The stringency wash conditions were as follows: 2
hours at 55EC, 0.1.times.SSC, EDTA (20 ml 20.times.SSC+16 ml EDTA,
V.sub.f=4L).
[1026] F. Oligonucleotides
[1027] In situ analysis was performed on a variety of DNA sequences
disclosed herein. The oligonucleotides employed for these analyses
were obtained so as to be complementary to the nucleic acids (or
the complements thereof) as shown in the accompanying figures.
[1028] G. Results
[1029] In situ analysis was performed on a variety of DNA sequences
disclosed herein. The results from these analyses are as
follows.
(1) DNA95930 (TAT110)
[1030] In one analysis, significant expression is observed in 3/3
lung tumors, 3/3 colorectal adenocarcinomas, 1/1 prostate cancers,
3/3 transitional cell carcinomas and 3/3 endometrial
adenocarcinomas, wherein the level of expression in the counterpart
normal tissues is significantly less.
[1031] In a second independent analysis, significant expression is
observed in 7/7 endometrial and 12/15 ovarian adenocarcinomas,
wherein the level of expression in the counterpart normal tissues
is significantly less.
[1032] In a third independent analysis, significant expression is
observed in 24/26 colorectal tumor samples, wherein the level of
expression in the counterpart normal tissue is significantly
less.
[1033] Finally, in a fourth independent analysis, expression is
observed in 8/26 samples of non-malignant prostate tissue, 55/82
samples of primary prostate cancer and in 5/23 samples of
metastatic prostate cancer.
(2) DNA95930-1 (TAT210)
[1034] In one analysis, significant expression is observed in 3/3
lung tumors, 3/3 colorectal adenocarcinomas, 1/1 prostate cancers,
3/3 transitional cell carcinomas and 3/3 endometrial
adenocarcinomas, wherein the level of expression in the counterpart
normal tissues is significantly less.
[1035] In a second independent analysis, significant expression is
observed in 7/7 endometrial and 12/15 ovarian adenocarcinomas,
wherein the level of expression in the counterpart normal tissues
is significantly less.
[1036] In a third independent analysis, significant expression is
observed in 24/26 colorectal tumor samples, wherein the level of
expression in the counterpart normal tissue is significantly
less.
[1037] Finally, in a fourth independent analysis, expression is
observed in 8/26 samples of non-malignant prostate tissue, 55/82
samples of primary prostate cancer and in 5/23 samples of
metastatic prostate cancer.
(3) DNA96930 (TAT112)
[1038] Strong expression in colorectal cancers. Expression in the
malignant epithelium appears significantly stronger than in
adjacent benign epithelium. Additionally, strong expression is
observed in all 23 of 23 samples of pancreatic adenocarcinoma
tested, wherein expression in normal pancreatic tissue is not
detectable.
(4) DNA96936 (TAT147)
[1039] In one analysis, a strongly positive signal was observed in
6/6 breast tumors. In another independent analysis, a positive
signal was observed in 4/4 non small cell lung carcinomas,
[1040] wherein the tumors appear to have stronger expression
compared with normal lung. 1/1 endometrial adenocarcinomas shows
strong expression and 3/3 colorectal adenocarcinomas show variable
expression.
(5) DNA108809 (TAT114)
[1041] Positive signal in all renal cell carcinomas tested (n=3)
while no expression observed in normal kidney tissue. Additionally,
positive expression is observed in 5/12 stomach tumors, 5/24
colorectal tumors, 3/8 pancreatic tumors and 1/3 lung tumors.
Normal non-cancerous tissue expression is limited to stomach and
small intestine.
(6) DNA176766 (TAT132)
[1042] Positive signal in all endometrial adenocarcinomas tested
(n=3) while no expression observed in normal endometrial
tissue.
(7) DNA236463 (TAT150)
[1043] Positive signal in all endometrial adenocarcinomas tested
(n=3) while no expression observed in normal endometrial
tissue.
(8) DNA181162 (TAT129)
[1044] Neoplastic prostate epithelia are generally positive, with
signal intensities varying from weak to strong between cases.
Non-prostatic tissues are negative.
(9) DNA188221 (TAT111)
[1045] Strong signal seen in colonic multi-tumor array over
malignant epithelium. In normal tissues, a certain probe gave
specific signal over epithelial cells lining the lower 2/3 of the
colonic crypts, the intensity of signal appeared significantly
lower than in the colonic carcinomas. Positive expression is
observed in 12/18 colorectal adenocarcinomas, 6/8 metastatic
adenocarcinomas and 2/9 gastric adenocarcinomas.
(10) DNA233876 (TAT146)
[1046] Strong signal seen in colonic multi-tumor array over
malignant epithelium. In normal tissues, a certain probe gave
specific signal over epithelial cells lining the lower 2/3 of the
colonic crypts, the intensity of signal appeared significantly
lower than in the colonic carcinomas. Positive expression is
observed in 12/18 colorectal adenocarcinomas, 6/8 metastatic
adenocarcinomas and 2/9 gastric adenocarcinomas.
(11) DNA210499 (TAT123)
[1047] In one analysis, 12/14 ovarian adenocarcinomas are positive
and 8/9 endometrial adenocarcinomas are positive. Normal ovarian
stroma is negative as is uterine myometrium. Other normal ovarian
and uterine tissues are negative.
[1048] In an independent analysis, 16/27 non small cell lung
carcinomas are positive, wherein the signal is moderate or
strong.
(12) DNA219894 (TAT211)
[1049] In one analysis, 12/14 ovarian adenocarcinomas are positive
and 8/9 endometrial adenocarcinomas are positive. Normal ovarian
stroma is negative as is uterine myometrium. Other normal ovarian
and uterine tissues are negative.
[1050] In an independent analysis, 16/27 non small cell lung
carcinomas are positive, wherein the signal is moderate or
strong.
(13) DNA215609 (TAT113)
[1051] Strong signal seen in colonic carcinomas, with only very low
level signal in normal colon. Lung and breast carcinomas were
negative.
(14) DNA220432 (TAT128)
[1052] The only normal adult tissue expressing this gene is
prostatic epithelium. The expression is of moderate to strong
intensity and focal, it is more prevalent in hyperplastic
epithelium.
[1053] In one analysis where 50 cases of primary prostate cancer
are available for review, 29 cases (58%) are positive, 18 cases
(36%) are negative and 3 cases (6%) are equivocal. In another
analysis where 37 cases of primary prostate cancer are available
for review, 33 cases (89%) are positive, 4 cases (11%) are
negative. Finally, in another independent analysis where 27 cases
of metastatic prostate cancer are available for review, 14 cases
(52%) are positive, 11 cases (41%) are negative and 2 cases (7%)
are equivocal.
(15) DNA226237 (TAT117)
[1054] In one analysis, two of 3 renal cell carcinomas are
positive, wherein normal kidney expression is negative.
(16) DNA246450 (TAT168)
[1055] In one analysis, two of 3 renal cell carcinomas are
positive, wherein normal kidney expression is negative.
(17) DNA227087 (TAT163)
[1056] A probe for this molecule showed a positive signal in a
subpopulation of tumor-associated stromal cells in all tested cases
of lung, breast, colon, pancreatic and endometrial carcinomas. The
intensity of the labeling was often quite strong. In a case of
colon adenocarcinoma with adjacent benign colon, labeling was
restricted to the tumor-associated stroma and the normal benign
tissue was negative. A breast fibroadenoma also showed labeling of
subepithelial stromal cells.
(18) DNA266307 (TAT227)
[1057] A probe for this molecule showed a positive signal in a
subpopulation of tumor-associated stromal cells in all tested cases
of lung, breast, colon, pancreatic and endometrial carcinomas. The
intensity of the labeling was often quite strong. In a case of
colon adenocarcinoma with adjacent benign colon, labeling was
restricted to the tumor-associated stroma and the normal benign
tissue was negative. A breast fibroadenoma also showed labeling of
subepithelial stromal cells.
(19) DNA266311 (TAT228)
[1058] A probe for this molecule showed a positive signal in a
subpopulation of tumor-associated stromal cells in all tested cases
of lung, breast, colon, pancreatic and endometrial carcinomas. The
intensity of the labeling was often quite strong. In a case of
colon adenocarcinoma with adjacent benign colon, labeling was
restricted to the tumor-associated stroma and the normal benign
tissue was negative. A breast fibroadenoma also showed labeling of
subepithelial stromal cells.
(20) DNA266312 (TAT229)
[1059] A probe for this molecule showed a positive signal in a
subpopulation of tumor-associated stromal cells in all tested cases
of lung, breast, colon, pancreatic and endometrial carcinomas. The
intensity of the labeling was often quite strong. In a case of
colon adenocarcinoma with adjacent benign colon, labeling was
restricted to the tumor-associated stroma and the normal benign
tissue was negative. A breast fibroadenoma also showed labeling of
subepithelial stromal cells.
(21) DNA266313 (TAT230)
[1060] A probe for this molecule showed a positive signal in a
subpopulation of tumor-associated stromal cells in all tested cases
of lung, breast, colon, pancreatic and endometrial carcinomas. The
intensity of the labeling was often quite strong. In a case of
colon adenocarcinoma with adjacent benign colon, labeling was
restricted to the tumor-associated stroma and the normal benign
tissue was negative. A breast fibroadenoma also showed labeling of
subepithelial stromal cells.
(22) DNA227224 (TAT121)
[1061] Expression is seen in 2 of 3 endometrial
adenocarcinomas.
(23) DNA247486 (TAT183)
[1062] Expression is seen in 2 of 3 endometrial
adenocarcinomas.
(24) DNA227800 (TAT131)
[1063] In one analysis, 46/64 primary prostate cancers are positive
and 6/14 metastatic prostate cancers are positive. Weak to moderate
expression is seen in prostate epithelium
(25) DNA228199 (TAT127)
[1064] Expression is observed in 13 of 15 ovarian tumors
(adenocarcinoma and surface epithelial tumors). Benign ovarian
surface epithelium is also positive. The expression level in most
positive tumors is strong or moderate and fairly uniform.
Expression is also observed in 8 of 9 uterine adenocarcinomas.
Seven of 23 non small cell lung carcinomas are positive.
(26) DNA228201 (TAT116)
[1065] The malignant cells of 13/16 colorectal adenocarcinomas are
positive for TAT116 expression. Additionally, 9/10 metastatic
adenocarcinomas are positive for expression. Expression is also
observed in the basal portions of normal colonic crypts.
(27) DNA247488 (TAT189)
[1066] The malignant cells of 13/16 colorectal adenocarcinomas are
positive for TAT189 expression. Additionally, 9/10 metastatic
adenocarcinomas are positive for expression. Expression is also
observed in the basal portions of normal colonic crypts.
(28) DNA236538 (TAT190)
[1067] The malignant cells of 13/16 colorectal adenocarcinomas are
positive for TAT190 expression. Additionally, 9/10 metastatic
adenocarcinomas are positive for expression. Expression is also
observed in the basal portions of normal colonic crypts.
(29) DNA247489 (TAT191)
[1068] The malignant cells of 13/16 colorectal adenocarcinomas are
positive for TAT191 expression. Additionally, 9/10 metastatic
adenocarcinomas are positive for expression. Expression is also
observed in the basal portions of normal colonic crypts.
(30) DNA228994 (TAT124)
[1069] Thirteen of 61 cass of non small cell lung carcinoma are
positive for expression of TAT124. Expression level in these
positive tumor samples is significantly higher than in normal adult
tissues.
(31) DNA231542 (TAT100)
[1070] In situ analysis performed as described above evidences
significantly upregulated expression in human glioma and
glioblastoma tissues as compared to normal brain (and other)
tissue.
(32) DNA231542-1 (TAT284)
[1071] In situ analysis performed as described above evidences
significantly upregulated expression in human glioma and
gliobalstoma tissues as compared to normal brain (and other)
tissue.
(33) DNA231542-2 (TAT285)
[1072] In situ analysis performed as described above evidences
significantly upregulated expression in human glioma and
glioblastoma tissues as compared to normal brain (and other)
tissue.
(34) DNA297393 (TAT285-1)
[1073] In situ analysis performed as described above evidences
significantly upregulated expression in human glioma and
glioblastoma tissues as compared to normal brain (and other)
tissue.
(35) DNA236534 (TAT102)
[1074] Expression of TAT102 is seen in 14 of 15 ovarian epithelial
malignancies (adenocarcinoma, epithelial surface tumors,
endometrioid Ca). Also, 8 of 9 endometrial adenocarcinomas of the
uterus express TAT102.
[1075] Moreover, expression of TAT102 is seen in 24 of 27 non-small
cell lung cancers, positive cases include squamous and
adenocarcinomas. Expression in these tumor tissues is significantly
higher than in their normal tissue counterparts.
(36) DNA246430 (TAT109)
[1076] Fourteen of 92 breast tumor samples are positive for TAT109
expression. Expression in all normal tissues is undetectable.
(37) DNA264454 (TAT106)
[1077] Expression of TAT106 is observed in 38/88 breast tumors.
Expression in normal breast tissue is weak or undetectable.
(38) DNA98565 (TAT145)
[1078] Positive signal for TAT145 was observed in most gliomas,
glioblastomas, some melanomas, and normal brain (primarily
localized to astrocytes). The signal intensity in the glioblastomas
appeared to be greater than that in normal astrocytes. While the
majority of glioma and glioblastoma samples tested were positive
for TAT145 expression, the majority of normal brain samples tested
were negative for such expression.
(39) DNA246435 (TAT152)
[1079] Positive signal for TAT152 was observed in most
glioblastomas, some melanomas, and normal brain (primarily
localized to astrocytes). The signal intensity in the glioblastomas
appeared to be greater than that in normal astrocytes. While the
majority of glioma and glioblastoma samples tested were positive
for TAT152 expression, the majority of normal brain samples tested
were negative for such expression.
(40) DNA167234 (TAT130)
[1080] Seventy cases of primary adenocarcinoma of the prostate were
available for review. Of these 70 cases, 56 cases (80%) are
positive for TAT130 expression. TAT130 expression in non-prostatic
tissues is weak or undetectable.
(41) DNA235621 (TAT166)
[1081] Seventy cases of primary adenocarcinoma of the prostate were
available for review. Of these 70 cases, 56 cases (80%) are
positive for TAT166 expression. TAT166 expression in non-prostatic
tissues is weak or undetectable.
(42) DNA236493 (TAT141)
[1082] Positive expression is observed in 70/148 breast carcinomas,
2/63 colorectal adenocarcinomas, 4/42 ovarian tumors, 9/69 non
small cell lung carcinomas, 9/67 prostate adenocarcinomas and 5/25
gliomas. Expression in normal non-cancerous tissues appears
restricted to prostate and breast epithelium.
(43) DNA226094 (TAT164)
[1083] Twenty one of 37 glioblastoma samples and 8 or 8 glioma
samples were positive for TAT 164 expression while all other tumor
and normal tissues examined (including normal brain tissue) were
negative.
(44) DNA227578 (TAT165)
[1084] Fifteen of 25 glioblastoma samples teste4d were positive for
expression while significantly weaker expression was observed in
the normal brain samples tested.
Example 5
Immunohistochemistry Analysis
[1085] Antibodies against certain TAT polypeptides disclosed herein
were prepared and immunohistochemistry analysis was performed as
follows. Tissue sections were first fixed for 5 minutes in
acetone/ethanol (frozen or paraffin-embedded). The sections were
then washed in PBS and then blocked with avidin and biotin (Vector
kit) for 10 minutes each followed by a wash in PBS. The sections
were then blocked with 10% serum for 20 minutes and then blotted to
remove the excess. A primary antibody was then added to the
sections at a concentration of 10:g/ml for 1 hour and then the
sections were washed in PBS. A biotinylated secondary antibody
(anti-primary antibody) was then added to the sections for 30
minutes and then the sections were washed with PBS. The sections
were then exposed to the reagents of the Vector ABC kit for 30
minutes and then the sections were washed in PBS. The sections were
then exposed to Diaminobenzidine (Pierce) for 5 minutes and then
washed in PBS. The sections were then counterstained with Mayers
hematoxylin, covered with a coverslip and visualized.
Immunohistochemistry analysis can also be performed as described in
Sambrook et al., Molecular Cloning: A Laboratory Manual, New York:
Cold Spring Harbor Press, 1989 and Ausubel et al., Current
Protocols of Molecular Biology, Unit 3.16, John Wiley and Sons
(1997). The results from these analyses are show below.
(1) DNA96930 (TAT112)
[1086] Significantly higher expression was detected in the apical
surface of the colonic crypts of colon tumors than on the apical
surface of the normal colonic crypts. Additionally, TAT112 was
found to be significantly overexpressed in pancreatic
adenocarcinoma cells as compared to normal pancreatic cells.
Finally, IHC analysis performed as described above evidenced that
TAT112 is significantly overexpressed in lung carcinoma as compared
to normal lung tissue, non small cell lung carcinoma as compared to
normal lung tissue and stomach carcinoma as compared to normal
stomach tissue.
(2) DNA226539 (TAT126)
[1087] Positive expression is observed in 2/10 uterine
adenocarcinomas, 9/17 ovarian adenocarcinomas and 2/20 non small
cell lung carcinomas. Using this procedure, expression of TAT126
was not detectable in any normal tissue.
(3) DNA236511 (TAT151)
[1088] Positive expression is observed in 2/10 uterine
adenocarcinomas, 9/17 ovarian adenocarcinomas and 2/20 non small
cell lung carcinomas. Using this procedure, expression of TAT151
was not detectable in any normal tissue.
Example 6
Verification and Analysis of Differential TAT Polypeptide
Expression by GEPIS
[1089] TAT polypeptides which may have been identified as a tumor
antigen as described in one or more of the above Examples were
analyzed and verified as follows. An expressed sequence tag (EST)
DNA database (LIFESEQ.RTM., Incyte Pharmaceuticals, Palo Alto,
Calif.) was searched and interesting EST sequences were identified
by GEPIS. Gene expression profiling in silico (GEPIS) is a
bioinformatics tool developed at Genentech, Inc. that characterizes
genes of interest for new cancer therapeutic targets. GEPIS takes
advantage of large amounts of EST sequence and library information
to determine gene expression profiles. GEPIS is capable of
determining the expression profile of a gene based upon its
proportional correlation with the number of its occurrences in EST
databases, and it works by integrating the LIFESEQ.RTM. EST
relational database and Genentech proprietary information in a
stringent and statistically meaningful way. In this example, GEPIS
is used to identify and cross-validate novel tumor antigens,
although GEPIS can be configured to perform either very specific
analyses or broad screening tasks. For the initial screen, GEPIS is
used to identify EST sequences from the LIFESEQ.RTM. database that
correlate to expression in a particular tissue or tissues of
interest (often a tumor tissue of interest). The EST sequences
identified in this initial screen (or consensus sequences obtained
from aligning multiple related and overlapping EST sequences
obtained from the initial screen) were then subjected to a screen
intended to identify the presence of at least one transmembrane
domain in the encoded protein. Finally, GEPIS was employed to
generate a complete tissue expression profile for the various
sequences of interest. Using this type of screening bioinformatics,
various TAT polypeptides (and their encoding nucleic acid
molecules) were identified as being significantly overexpressed in
a particular type of cancer or certain cancers as compared to other
cancers and/or normal non-cancerous tissues. The rating of GEPIS
hits is based upon several criteria including, for example, tissue
specificity, tumor specificity and expression level in normal
essential and/or normal proliferating tissues. The following is a
list of molecules whose tissue expression profile as determined by
GEPIS evidences high tissue expression and significant upregulation
of expression in a specific tumor or tumors as compared to other
tumor(s) and/or normal tissues and optionally relatively low
expression in normal essential and/or normal proliferating tissues.
As such, the molecules listed below are excellent polypeptide
targets for the diagnosis and therapy of cancer in mammals.
TABLE-US-00011 upregulation Molecule of expression in: as compared
to: DNA77507 (TAT161) breast tumor normal breast tissue DNA77507
(TAT161) colon tumor normal colon tissue DNA77507 (TAT161) lung
tumor normal lung tissue DNA77507 (TAT161) kidney tumor normal
kidney tissue DNA77507 (TAT161) liver tumor normal liver tissue
DNA77507 (TAT161) ovarian tumor normal ovarian tissue DNA77507
(TAT161) pancreatic tumor normal pancreatic tissue DNA77507
(TAT161) rectum tumor normal rectum tissue DNA77507 (TAT161) skin
tumor normal skin tissue DNA77507 (TAT161) uterine tumor normal
uterine tissue DNA77507 (TAT161) brain tumor normal brain tissue
DNA77507 (TAT161) soft tissue tumor normal soft tissue DNA77507
(TAT161) bone tumor normal bone tissue DNA82343 (TAT157) colon
tumor normal colon tissue DNA82343 (TAT157) ovarian tumor normal
ovarian tissue DNA82343 (TAT157) stomach tumor normal stomach
tissue DNA82343 (TAT157) thymus tumor normal thymus tissue DNA82343
(TAT157) small intestine normal small intestine tumor tissue
DNA87994 (TAT160) breast tumor normal breast tissue DNA87994
(TAT160) pancreatic tumor normal pancreatic tissue DNA87994
(TAT160) colon tumor normal colon tissue DNA87994 (TAT160)
esophagus tumor normal esophagus tissue DNA87994 (TAT160) ovarian
tumor normal ovarian tissue DNA87994 (TAT160) prostate tumor normal
prostate tissue DNA88131 (TAT158) breast tumor normal breast tissue
DNA88131 (TAT158) colon tumor normal colon tissue DNA88131 (TAT158)
lung tumor normal lung tissue DNA88131 (TAT158) pancreatic tumor
normal pancreatic tissue DNA88131 (TAT158) prostate tumor normal
prostate tissue DNA88131 (TAT158) stomach tumor normal stomach
tissue DNA88131 (TAT158) bladder tumor normal bladder tissue
DNA88131 (TAT158) brain tumor normal brain tissue DNA95930 (TAT110)
colon tumor normal colon tissue DNA95930 (TAT110) lung tumor normal
lung tissue DNA95930 (TAT110) prostate tumor normal prostate tissue
DNA95930 (TAT110) endometrial tumor normal endometrial tissue
DNA95930 (TAT110) ovarian tumor normal ovarian tissue DNA95930
(TAT110) breast tumor normal breast tissue DNA95930-1 (TAT210)
colon tumor normal colon tissue DNA95930-1 (TAT210) lung tumor
normal lung tissue DNA95930-1 (TAT210) prostate tumor normal
prostate tissue DNA95930-1 (TAT210) endometrial tumor normal
endometrial tissue DNA95930-1 (TAT210) ovarian tumor normal ovarian
tissue DNA95930-1 (TAT210) breast tumor normal breast tissue
DNA96917 (TAT159) pancreatic tumor normal pancreatic tissue
DNA96917 (TAT159) lung tumor normal lung tissue DNA96917 (TAT159)
liver tumor normal liver tissue DNA96917 (TAT159) prostate tumor
normal prostate tissue DNA96930 (TAT112) breast tumor normal breast
tissue DNA96930 (TAT112) colon tumor normal colon tissue DNA96930
(TAT112) lung tumor normal lung tissue DNA96930 (TAT112) ovarian
tumor normal ovarian tissue DNA96930 (TAT112) pancreatic tumor
normal pancreatic tissue DNA96930 (TAT112) stomach tumor normal
stomach tissue DNA96936 (TAT147) breast tumor normal breast tissue
DNA96936 (TAT147) colon tumor normal colon tissue DNA96936 (TAT147)
prostate tumor normal prostate tissue DNA96936 (TAT147) uterine
tumor normal uterine tissue DNA98565 (TAT145) brain tumor normal
brain tissue DNA98565 (TAT145) colon tumor normal colon tissue
DNA246435 (TAT152) brain tumor normal brain tissue DNA246435
(TAT152) colon tumor normal colon tissue DNA98591 (TAT162) colon
tumor normal colon tissue DNA98591 (TAT162) small intestine normal
small intestine tumor tissue DNA98591 (TAT162) ovarian tumor normal
ovarian tissue DNA98591 (TAT162) esophagus tumor normal esophagus
tissue DNA108809 (TAT114) colon tumor normal colon tissue DNA108809
(TAT114) lung tumor normal lung tissue DNA108809 (TAT114) ovarian
tumor normal ovarian tissue DNA108809 (TAT114) brain tumor normal
brain tissue DNA143493 (TAT103) breast tumor normal breast tissue
DNA167234 (TAT130) prostate tumor normal prostate tissue DNA235621
(TAT166) prostate tumor normal prostate tissue DNA176766 (TAT132)
kidney tumor normal kidney tissue DNA176766 (TAT132) uterine tumor
normal uterine tissue DNA236463 (TAT150) kidney tumor normal kidney
tissue DNA236463 (TAT150) uterine tumor normal uterine tissue
DNA181162 (TAT129) prostate tumor normal prostate tissue DNA188221
(TAT111) colon tumor normal colon tissue DNA188221 (TAT111) liver
tumor normal liver tissue DNA188221 (TAT111) lung tumor normal lung
tissue DNA233876 (TAT146) colon tumor normal colon tissue DNA233876
(TAT146) liver tumor normal liver tissue DNA233876 (TAT146) lung
tumor normal lung tissue DNA193891 (TAT148) prostate tumor normal
prostate tissue DNA193891 (TAT148) breast tumor normal breast
tissue DNA248170 (TAT187) breast tumor normal breast tissue
DNA248170 (TAT187) prostate tumor normal prostate tissue DNA194628
(TAT118) kidney tumor normal kidney tissue DNA246415 (TAT167)
kidney tumor normal kidney tissue DNA215609 (TAT113) colon tumor
normal colon tissue DNA220432 (TAT128) prostate tumor normal
prostate tissue DNA226094 (TAT164) breast tumor normal breast
tissue DNA226094 (TAT164) brain tumor normal brain tissue DNA226094
(TAT164) ovarian tumor normal ovarian tissue DNA226094 (TAT164)
lung tumor normal lung tissue DNA226165 (TAT122) breast tumor
normal breast tissue DNA226165 (TAT122) endometrial tumor normal
endometrial tissue DNA226165 (TAT122) lung tumor normal lung tissue
DNA226165 (TAT122) colon tumor normal colon tissue DNA226237
(TAT117) kidney tumor normal kidney tissue DNA246450 (TAT168)
kidney tumor normal kidney tissue DNA246450 (TAT168) brain tumor
normal brain tissue DNA226456 (TAT144) breast tumor normal breast
tissue DNA226456 (TAT144) brain tumor normal brain tissue DNA226456
(TAT144) endometrial tumor normal endometrial tissue DNA226456
(TAT144) kidney tumor normal kidney tissue DNA226456 (TAT144) lung
tumor normal lung tissue DNA237637 (TAT188) breast tumor normal
breast tissue DNA237637 (TAT188) brain tumor normal brain tissue
DNA237637 (TAT188) endometrial tumor normal endometrial tissue
DNA237637 (TAT188) kidney tumor normal kidney tissue DNA237637
(TAT188) lung tumor normal lung tissue DNA226539 (TAT126) colon
tumor normal colon tissue DNA226539 (TAT126) endometrial tumor
normal endometrial tissue DNA226539 (TAT126) ovarian tumor normal
ovarian tissue DNA226539 (TAT126) pancreatic tumor normal
pancreatic tissue DNA236511 (TAT151) colon tumor normal colon
tissue DNA236511 (TAT151) endometrial tumor normal endometrial
tissue DNA236511 (TAT151) ovarian tumor normal ovarian tissue
DNA236511 (TAT151) pancreatic tumor normal pancreatic tissue
DNA226771 (TAT115) colon tumor normal colon tissue DNA227087
(TAT163) breast tumor normal breast tissue DNA227087 (TAT163) colon
tumor normal colon tissue DNA227087 (TAT163) endocrine tumor normal
endocrine tissue DNA227087 (TAT163) kidney tumor normal kidney
tissue DNA227087 (TAT163) liver tumor normal liver tissue DNA227087
(TAT163) lung tumor normal lung tissue DNA227087 (TAT163)
pancreatic tumor normal pancreatic tissue DNA227087 (TAT163)
uterine tumor normal uterine tissue DNA227087 (TAT163) prostate
tumor normal prostate tissue DNA227087 (TAT163) bladder tumor
normal bladder tissue DNA266307 (TAT227) breast tumor normal breast
tissue DNA266307 (TAT227) colon tumor normal colon tissue DNA266307
(TAT227) endocrine tumor normal endocrine tissue DNA266307 (TAT227)
kidney tumor normal kidney tissue DNA266307 (TAT227) liver tumor
normal liver tissue DNA266307 (TAT227) lung tumor normal lung
tissue DNA266307 (TAT227) pancreatic tumor normal pancreatic tissue
DNA266307 (TAT227) uterine tumor normal uterine tissue DNA266307
(TAT227) prostate tumor normal prostate tissue DNA266307 (TAT227)
bladder tumor normal bladder tissue DNA266311 (TAT228) breast tumor
normal breast tissue DNA266311 (TAT228) colon tumor normal colon
tissue DNA266311 (TAT228) endocrine tumor normal endocrine tissue
DNA266311 (TAT228) kidney tumor normal kidney tissue DNA266311
(TAT228) liver tumor normal liver tissue DNA266311 (TAT228) lung
tumor normal lung tissue DNA266311 (TAT228) pancreatic tumor normal
pancreatic tissue DNA266311 (TAT228) uterine tumor normal uterine
tissue DNA266311 (TAT228) prostate tumor normal prostate tissue
DNA266311 (TAT228) bladder tumor normal bladder tissue DNA266312
(TAT229) breast tumor normal breast tissue DNA266312 (TAT229) colon
tumor normal colon tissue DNA266312 (TAT229) endocrine tumor normal
endocrine tissue DNA266312 (TAT229) kidney tumor normal kidney
tissue DNA266312 (TAT229) liver tumor normal liver tissue DNA266312
(TAT229) lung tumor normal lung tissue DNA266312 (TAT229)
pancreatic tumor normal pancreatic tissue DNA266312 (TAT229)
uterine tumor normal uterine tissue DNA266312 (TAT229) prostate
tumor normal prostate tissue DNA266312 (TAT229) bladder tumor
normal bladder tissue DNA266313 (TAT230) breast tumor normal breast
tissue DNA266313 (TAT230) colon tumor normal colon tissue DNA266313
(TAT230) endocrine tumor normal endocrine tissue DNA266313 (TAT230)
kidney tumor normal kidney tissue DNA266313 (TAT230) liver tumor
normal liver tissue DNA266313 (TAT230) lung tumor normal lung
tissue DNA266313 (TAT230) pancreatic tumor normal pancreatic tissue
DNA266313 (TAT230) uterine tumor normal uterine tissue DNA266313
(TAT230) prostate tumor normal prostate tissue DNA266313 (TAT230)
bladder tumor normal bladder tissue DNA227224 (TAT121) breast tumor
normal breast tissue DNA227224 (TAT121) endometrial tumor normal
endometrial tissue DNA227224 (TAT121) lung tumor normal lung tissue
DNA227224 (TAT121) skin tumor normal skin tissue DNA247486 (TAT183)
breast tumor normal breast tissue DNA247486 (TAT183) endometrial
tumor normal endometrial tissue DNA247486 (TAT183) lung tumor
normal lung tissue DNA247486 (TAT183) skin tumor normal skin tissue
DNA227578 (TAT165) brain tumor normal brain tissue DNA227800
(TAT131) prostate tumor normal prostate tissue DNA227800 (TAT131)
kidney tumor normal kidney tissue DNA227904 (TAT140) breast tumor
normal breast tissue DNA228199 (TAT127) uterine tumor normal
uterine tissue DNA228199 (TAT127) fallopian tube tumor normal
fallopian tube tissue DNA228199 (TAT127) ovarian tumor normal
ovarian tissue DNA228199 (TAT127) lung tumor normal lung tissue
DNA228201 (TAT116) colon tumor normal colon tissue DNA247488
(TAT189) colon tumor normal colon tissue DNA236538 (TAT190) colon
tumor normal colon tissue DNA247489 (TAT191) colon tumor normal
colon tissue DNA231312 (TAT143) colon tumor normal colon tissue
DNA231542 (TAT100) brain tumor normal brain tissue DNA231542
(TAT100) glioma normal glial tissue DNA231542-1 (TAT284) brain
tumor normal brain tissue DNA231542-1 (TAT284) glioma normal glial
tissue DNA231542-2 (TAT285) brain tumor normal brain tissue
DNA231542-2 (TAT285) glioma normal glial tissue DNA297393
(TAT285-1) brain tumor normal brain tissue DNA297393 (TAT285-1)
glioma normal glial tissue DNA232754 (TAT125) lung tumor normal
lung tissue DNA236246 (TAT153) breast tumor normal breast tissue
DNA236343 (TAT104) breast tumor normal breast tissue DNA236493
(TAT141) breast tumor normal breast tissue DNA236493 (TAT141)
glioblastoma tumor normal glial tissue DNA236534 (TAT102) breast
tumor normal breast tissue DNA236534 (TAT102) lung tumor normal
lung tissue DNA236534 (TAT102) pancreatic tumor normal pancreatic
tissue DNA236534 (TAT102) prostate tumor normal prostate tissue
DNA236534 (TAT102) bladder tumor normal bladder tissue DNA247480
(TAT142) lung tumor normal lung tissue DNA264454 (TAT106) breast
tumor normal breast tissue DNA264454 (TAT106) prostate tumor normal
prostate tissue DNA264454 (TAT106) ovarian tumor normal ovarian
tissue
Example 7
Use of TAT as a Hybridization Probe
[1090] The following method describes use of a nucleotide sequence
encoding TAT as a hybridization probe for, i.e., diagnosis of the
presence of a tumor in a mammal.
[1091] DNA comprising the coding sequence of full-length or mature
TAT as disclosed herein can also be employed as a probe to screen
for homologous DNAs (such as those encoding naturally-occurring
variants of TAT) in human tissue cDNA libraries or human tissue
genomic libraries.
[1092] Hybridization and washing of filters containing either
library DNAs is performed under the following high stringency
conditions. Hybridization of radiolabeled TAT-derived probe to the
filters is performed in a solution of 50% formamide, 5.times.SSC,
0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH
6.8, 2.times.Denhardt's solution, and 10% dextran sulfate at
42.degree. C. for 20 hours. Washing of the filters is performed in
an aqueous solution of 0.1.times.SSC and 0.1% SDS at 42.degree.
C.
[1093] DNAs having a desired sequence identity with the DNA
encoding full-length native sequence TAT can then be identified
using standard techniques known in the art.
Example 8
Expression of TAT in E. coli
[1094] This example illustrates preparation of an unglycosylated
form of TAT by recombinant expression in E. coli.
[1095] The DNA sequence encoding TAT is initially amplified using
selected PCR primers. The primers should contain restriction enzyme
sites which correspond to the restriction enzyme sites on the
selected expression vector. A variety of expression vectors may be
employed. An example of a suitable vector is pBR322 (derived from
E. coli; see Bolivar et al., Gene, 2:95 (1977)) which contains
genes for ampicillin and tetracycline resistance. The vector is
digested with restriction enzyme and dephosphorylated. The PCR
amplified sequences are then ligated into the vector. The vector
will preferably include sequences which encode for an antibiotic
resistance gene, a trp promoter, a polyhis leader (including the
first six STII codons, polyhis sequence, and enterokinase cleavage
site), the TAT coding region, lambda transcriptional terminator,
and an argU gene.
[1096] The ligation mixture is then used to transform a selected E.
coli strain using the methods described in Sambrook et al., supra.
Transformants are identified by their ability to grow on LB plates
and antibiotic resistant colonies are then selected. Plasmid DNA
can be isolated and confirmed by restriction analysis and DNA
sequencing.
[1097] Selected clones can be grown overnight in liquid culture
medium such as LB broth supplemented with antibiotics. The
overnight culture may subsequently be used to inoculate a larger
scale culture. The cells are then grown to a desired optical
density, during which the expression promoter is turned on.
[1098] After culturing the cells for several more hours, the cells
can be harvested by centrifugation. The cell pellet obtained by the
centrifugation can be solubilized using various agents known in the
art, and the solubilized TAT protein can then be purified using a
metal chelating column under conditions that allow tight binding of
the protein.
[1099] TAT may be expressed in E. coli in a poly-His tagged form,
using the following procedure. The DNA encoding TAT is initially
amplified using selected PCR primers. The primers will contain
restriction enzyme sites which correspond to the restriction enzyme
sites on the selected expression vector, and other useful sequences
providing for efficient and reliable translation initiation, rapid
purification on a metal chelation column, and proteolytic removal
with enterokinase. The PCR-amplified, poly-His tagged sequences are
then ligated into an expression vector, which is used to transform
an E. coli host based on strain 52 (W3110 fuhA(tonA) lon galE
rpoHts(htpRts) clpP(lacIq). Transformants are first grown in LB
containing 50 mg/ml carbenicillin at 30EC with shaking until an
O.D. 600 of 3-5 is reached. Cultures are then diluted 50-100 fold
into CRAP media (prepared by mixing 3.57 g
(NH.sub.4).sub.2SO.sub.4, 0.71 g sodium citrate.2H.sub.2O, 1.07 g
KCl, 5.36 g Difco yeast extract, 5.36 g Sheffield hycase SF in 500
mL water, as well as 110 mM MPOS, pH 7.3, 0.55% (w/v) glucose and 7
mM MgSO.sub.4) and grown for approximately 20-30 hours at 30EC with
shaking Samples are removed to verify expression by SDS-PAGE
analysis, and the bulk culture is centrifuged to pellet the cells.
Cell pellets are frozen until purification and refolding.
[1100] E. coli paste from 0.5 to 1 L fermentations (6-10 g pellets)
is resuspended in 10 volumes (w/v) in 7 M guanidine, 20 mM Tris, pH
8 buffer. Solid sodium sulfite and sodium tetrathionate is added to
make final concentrations of 0.1M and 0.02 M, respectively, and the
solution is stirred overnight at 4EC. This step results in a
denatured protein with all cysteine residues blocked by
sulfitolization. The solution is centrifuged at 40,000 rpm in a
Beckman Ultracentifuge for 30 min. The supernatant is diluted with
3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM
Tris, pH 7.4) and filtered through 0.22 micron filters to clarify.
The clarified extract is loaded onto a 5 ml Qiagen Ni-NTA metal
chelate column equilibrated in the metal chelate column buffer. The
column is washed with additional buffer containing 50 mM imidazole
(Calbiochem, Utrol grade), pH 7.4. The protein is eluted with
buffer containing 250 mM imidazole. Fractions containing the
desired protein are pooled and stored at 4EC. Protein concentration
is estimated by its absorbance at 280 nm using the calculated
extinction coefficient based on its amino acid sequence.
[1101] The proteins are refolded by diluting the sample slowly into
freshly prepared refolding buffer consisting of: 20 mM Tris, pH
8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM
EDTA. Refolding volumes are chosen so that the final protein
concentration is between 50 to 100 micrograms/ml. The refolding
solution is stirred gently at 4EC for 12-36 hours. The refolding
reaction is quenched by the addition of TFA to a final
concentration of 0.4% (pH of approximately 3). Before further
purification of the protein, the solution is filtered through a
0.22 micron filter and acetonitrile is added to 2-10% final
concentration. The refolded protein is chromatographed on a Poros
R1/H reversed phase column using a mobile buffer of 0.1% TFA with
elution with a gradient of acetonitrile from 10 to 80%. Aliquots of
fractions with A280 absorbance are analyzed on SDS polyacrylamide
gels and fractions containing homogeneous refolded protein are
pooled. Generally, the properly refolded species of most proteins
are eluted at the lowest concentrations of acetonitrile since those
species are the most compact with their hydrophobic interiors
shielded from interaction with the reversed phase resin. Aggregated
species are usually eluted at higher acetonitrile concentrations.
In addition to resolving misfolded forms of proteins from the
desired form, the reversed phase step also removes endotoxin from
the samples.
[1102] Fractions containing the desired folded TAT polypeptide are
pooled and the acetonitrile removed using a gentle stream of
nitrogen directed at the solution. Proteins are formulated into 20
mM Hepes, pH 6.8 with 0.14 M sodium chloride and 4% mannitol by
dialysis or by gel filtration using G25 Superfine (Pharmacia)
resins equilibrated in the formulation buffer and sterile
filtered.
[1103] Certain of the TAT polypeptides disclosed herein have been
successfully expressed and purified using this technique(s).
Example 9
Expression of TAT in Mammalian Cells
[1104] This example illustrates preparation of a potentially
glycosylated form of TAT by recombinant expression in mammalian
cells.
[1105] The vector, pRK5 (see EP 307,247, published Mar. 15, 1989),
is employed as the expression vector. Optionally, the TAT DNA is
ligated into pRK5 with selected restriction enzymes to allow
insertion of the TAT DNA using ligation methods such as described
in Sambrook et al., supra. The resulting vector is called
pRK5-TAT.
[1106] In one embodiment, the selected host cells may be 293 cells.
Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue
culture plates in medium such as DMEM supplemented with fetal calf
serum and optionally, nutrient components and/or antibiotics. About
10:g pRK5-TAT DNA is mixed with about 1:g DNA encoding the VA RNA
gene [Thimmappaya et al., Cell, 31:543 (1982)] and dissolved in
500:1 of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCl.sub.2. To this
mixture is added, dropwise, 500:1 of 50 mM HEPES (pH 7.35), 280 mM
NaCl, 1.5 mM NaPO.sub.4, and a precipitate is allowed to form for
10 minutes at 25.degree. C. The precipitate is suspended and added
to the 293 cells and allowed to settle for about four hours at
37.degree. C. The culture medium is aspirated off and 2 ml of 20%
glycerol in PBS is added for 30 seconds. The 293 cells are then
washed with serum free medium, fresh medium is added and the cells
are incubated for about 5 days.
[1107] Approximately 24 hours after the transfections, the culture
medium is removed and replaced with culture medium (alone) or
culture medium containing 200 .mu.Ci/ml .sup.35S-cysteine and 200
.mu.Ci/ml .sup.35S-methionine. After a 12 hour incubation, the
conditioned medium is collected, concentrated on a spin filter, and
loaded onto a 15% SDS gel. The processed gel may be dried and
exposed to film for a selected period of time to reveal the
presence of TAT polypeptide. The cultures containing transfected
cells may undergo further incubation (in serum free medium) and the
medium is tested in selected bioassays.
[1108] In an alternative technique, TAT may be introduced into 293
cells transiently using the dextran sulfate method described by
Somparyrac et al., Proc. Natl. Acad. Sci., 12:7575 (1981). 293
cells are grown to maximal density in a spinner flask and 700:g
pRK5-TAT DNA is added. The cells are first concentrated from the
spinner flask by centrifugation and washed with PBS. The
DNA-dextran precipitate is incubated on the cell pellet for four
hours. The cells are treated with 20% glycerol for 90 seconds,
washed with tissue culture medium, and re-introduced into the
spinner flask containing tissue culture medium, 5:g/ml bovine
insulin and 0.1:g/ml bovine transferrin. After about four days, the
conditioned media is centrifuged and filtered to remove cells and
debris. The sample containing expressed TAT can then be
concentrated and purified by any selected method, such as dialysis
and/or column chromatography.
[1109] In another embodiment, TAT can be expressed in CHO cells.
The pRK5-TAT can be transfected into CHO cells using known reagents
such as CaPO.sub.4 or DEAE-dextran. As described above, the cell
cultures can be incubated, and the medium replaced with culture
medium (alone) or medium containing a radiolabel such as
.sup.35S-methionine. After determining the presence of TAT
polypeptide, the culture medium may be replaced with serum free
medium. Preferably, the cultures are incubated for about 6 days,
and then the conditioned medium is harvested. The medium containing
the expressed TAT can then be concentrated and purified by any
selected method.
[1110] Epitope-tagged TAT may also be expressed in host CHO cells.
The TAT may be subcloned out of the pRK5 vector. The subclone
insert can undergo PCR to fuse in frame with a selected epitope tag
such as a poly-his tag into a Baculovirus expression vector. The
poly-his tagged TAT insert can then be subcloned into a SV40 driven
vector containing a selection marker such as DHFR for selection of
stable clones. Finally, the CHO cells can be transfected (as
described above) with the SV40 driven vector. Labeling may be
performed, as described above, to verify expression. The culture
medium containing the expressed poly-His tagged TAT can then be
concentrated and purified by any selected method, such as by
Ni.sup.2+-chelate affinity chromatography.
[1111] TAT may also be expressed in CHO and/or COS cells by a
transient expression procedure or in CHO cells by another stable
expression procedure.
[1112] Stable expression in CHO cells is performed using the
following procedure. The proteins are expressed as an IgG construct
(immunoadhesin), in which the coding sequences for the soluble
forms (e.g. extracellular domains) of the respective proteins are
fused to an IgG1 constant region sequence containing the hinge, CH2
and CH2 domains and/or is a poly-His tagged form.
[1113] Following PCR amplification, the respective DNAs are
subcloned in a CHO expression vector using standard techniques as
described in Ausubel et al., Current Protocols of Molecular
Biology, Unit 3.16, John Wiley and Sons (1997). CHO expression
vectors are constructed to have compatible restriction sites 5' and
3' of the DNA of interest to allow the convenient shuttling of
cDNA's. The vector used expression in CHO cells is as described in
Lucas et al., Nucl. Acids Res. 24:9 (1774-1779 (1996), and uses the
SV40 early promoter/enhancer to drive expression of the cDNA of
interest and dihydrofolate reductase (DHFR). DHFR expression
permits selection for stable maintenance of the plasmid following
transfection.
[1114] Twelve micrograms of the desired plasmid DNA is introduced
into approximately 10 million CHO cells using commercially
available transfection reagents Superfect.RTM. (Quiagen),
Dosper.RTM. or Fugene.RTM. (Boehringer Mannheim). The cells are
grown as described in Lucas et al., supra. Approximately
3.times.10.sup.7 cells are frozen in an ampule for further growth
and production as described below.
[1115] The ampules containing the plasmid DNA are thawed by
placement into water bath and mixed by vortexing. The contents are
pipetted into a centrifuge tube containing 10 mLs of media and
centrifuged at 1000 rpm for 5 minutes. The supernatant is aspirated
and the cells are resuspended in 10 mL of selective media (0.2 Fm
filtered PS20 with 5% 0.2 Fm diafiltered fetal bovine serum). The
cells are then aliquoted into a 100 mL spinner containing 90 mL of
selective media. After 1-2 days, the cells are transferred into a
250 mL spinner filled with 150 mL selective growth medium and
incubated at 37.degree. C. After another 2-3 days, 250 mL, 500 mL
and 2000 mL spinners are seeded with 3.times.10.sup.5 cells/mL. The
cell media is exchanged with fresh media by centrifugation and
resuspension in production medium. Although any suitable CHO media
may be employed, a production medium described in U.S. Pat. No.
5,122,469, issued Jun. 16, 1992 may actually be used. A 3L
production spinner is seeded at 1.2.times.10.sup.6 cells/mL. On day
0, the cell number pH ie determined. On day 1, the spinner is
sampled and sparging with filtered air is commenced. On day 2, the
spinner is sampled, the temperature shifted to 33.degree. C., and
30 mL of 500 g/L glucose and 0.6 mL of 10% antifoam (e.g., 35%
polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade
Emulsion) taken. Throughout the production, the pH is adjusted as
necessary to keep it at around 7.2. After 10 days, or until the
viability dropped below 70%, the cell culture is harvested by
centrifugation and filtering through a 0.22 Fm filter. The filtrate
was either stored at 4.degree. C. or immediately loaded onto
columns for purification.
[1116] For the poly-His tagged constructs, the proteins are
purified using a Ni-NTA column (Qiagen). Before purification,
imidazole is added to the conditioned media to a concentration of 5
mM. The conditioned media is pumped onto a 6 ml Ni-NTA column
equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCl
and 5 mM imidazole at a flow rate of 4-5 ml/min. at 4.degree. C.
After loading, the column is washed with additional equilibration
buffer and the protein eluted with equilibration buffer containing
0.25 M imidazole. The highly purified protein is subsequently
desalted into a storage buffer containing 10 mM Hepes, 0.14 M NaCl
and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia)
column and stored at -80.degree. C.
[1117] Immunoadhesin (Fc-containing) constructs are purified from
the conditioned media as follows. The conditioned medium is pumped
onto a 5 ml Protein A column (Pharmacia) which had been
equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading,
the column is washed extensively with equilibration buffer before
elution with 100 mM citric acid, pH 3.5. The eluted protein is
immediately neutralized by collecting 1 ml fractions into tubes
containing 275 FL of 1 M Tris buffer, pH 9. The highly purified
protein is subsequently desalted into storage buffer as described
above for the poly-His tagged proteins. The homogeneity is assessed
by SDS polyacrylamide gels and by N-terminal amino acid sequencing
by Edman degradation.
[1118] Certain of the TAT polypeptides disclosed herein have been
successfully expressed and purified using this technique(s).
Example 10
Expression of TAT in Yeast
[1119] The following method describes recombinant expression of TAT
in yeast.
[1120] First, yeast expression vectors are constructed for
intracellular production or secretion of TAT from the ADH2/GAPDH
promoter. DNA encoding TAT and the promoter is inserted into
suitable restriction enzyme sites in the selected plasmid to direct
intracellular expression of TAT. For secretion, DNA encoding TAT
can be cloned into the selected plasmid, together with DNA encoding
the ADH2/GAPDH promoter, a native TAT signal peptide or other
mammalian signal peptide, or, for example, a yeast alpha-factor or
invertase secretory signal/leader sequence, and linker sequences
(if needed) for expression of TAT.
[1121] Yeast cells, such as yeast strain AB110, can then be
transformed with the expression plasmids described above and
cultured in selected fermentation media. The transformed yeast
supernatants can be analyzed by precipitation with 10%
trichloroacetic acid and separation by SDS-PAGE, followed by
staining of the gels with Coomassie Blue stain.
[1122] Recombinant TAT can subsequently be isolated and purified by
removing the yeast cells from the fermentation medium by
centrifugation and then concentrating the medium using selected
cartridge filters. The concentrate containing TAT may further be
purified using selected column chromatography resins.
[1123] Certain of the TAT polypeptides disclosed herein have been
successfully expressed and purified using this technique(s).
Example 11
Expression of TAT in Baculovirus-Infected Insect Cells
[1124] The following method describes recombinant expression of TAT
in Baculovirus-infected insect cells.
[1125] The sequence coding for TAT is fused upstream of an epitope
tag contained within a baculovirus expression vector. Such epitope
tags include poly-his tags and immunoglobulin tags (like Fc regions
of IgG). A variety of plasmids may be employed, including plasmids
derived from commercially available plasmids such as pVL1393
(Novagen). Briefly, the sequence encoding TAT or the desired
portion of the coding sequence of TAT such as the sequence encoding
an extracellular domain of a transmembrane protein or the sequence
encoding the mature protein if the protein is extracellular is
amplified by PCR with primers complementary to the 5' and 3'
regions. The 5' primer may incorporate flanking (selected)
restriction enzyme sites. The product is then digested with those
selected restriction enzymes and subcloned into the expression
vector.
[1126] Recombinant baculovirus is generated by co-transfecting the
above plasmid and BaculoGold.TM. virus DNA (Pharmingen) into
Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711) using
lipofectin (commercially available from GIBCO-BRL). After 4-5 days
of incubation at 28.degree. C., the released viruses are harvested
and used for further amplifications. Viral infection and protein
expression are performed as described by O'Reilley et al.,
Baculovirus expression vectors: A Laboratory Manual, Oxford: Oxford
University Press (1994).
[1127] Expressed poly-his tagged TAT can then be purified, for
example, by Ni.sup.2+-chelate affinity chromatography as follows.
Extracts are prepared from recombinant virus-infected Sf9 cells as
described by Rupert et al., Nature, 362:175-179 (1993). Briefly,
Sf9 cells are washed, resuspended in sonication buffer (25 mL
Hepes, pH 7.9; 12.5 mM MgCl.sub.2; 0.1 mM EDTA; 10% glycerol; 0.1%
NP-40; 0.4 M KCl), and sonicated twice for 20 seconds on ice. The
sonicates are cleared by centrifugation, and the supernatant is
diluted 50-fold in loading buffer (50 mM phosphate, 300 mM NaCl,
10% glycerol, pH 7.8) and filtered through a 0.45 Fm filter. A
Ni.sup.2+-NTA agarose column (commercially available from Qiagen)
is prepared with a bed volume of 5 mL, washed with 25 mL of water
and equilibrated with 25 mL of loading buffer. The filtered cell
extract is loaded onto the column at 0.5 mL per minute. The column
is washed to baseline A.sub.280 with loading buffer, at which point
fraction collection is started. Next, the column is washed with a
secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol,
pH 6.0), which elutes nonspecifically bound protein. After reaching
A.sub.280 baseline again, the column is developed with a 0 to 500
mM Imidazole gradient in the secondary wash buffer. One mL
fractions are collected and analyzed by SDS-PAGE and silver
staining or Western blot with Ni.sup.2+-NTA-conjugated to alkaline
phosphatase (Qiagen). Fractions containing the eluted
His.sub.10-tagged TAT are pooled and dialyzed against loading
buffer.
[1128] Alternatively, purification of the IgG tagged (or Fc tagged)
TAT can be performed using known chromatography techniques,
including for instance, Protein A or protein G column
chromatography.
[1129] Certain of the TAT polypeptides disclosed herein have been
successfully expressed and purified using this technique(s).
Example 12
Preparation of Antibodies that Bind Tat
[1130] This example illustrates preparation of monoclonal
antibodies which can specifically bind TAT. This example further
illustrates preparation of monoclonal antibodies which can
specifically bind TAT188(E16) polypeptide.
[1131] Techniques for producing the monoclonal antibodies are known
in the art and are described, for instance, in Goding, supra.
Immunogens that may be employed include purified TAT, fusion
proteins containing TAT, and cells expressing recombinant TAT on
the cell surface. Selection of the immunogen can be made by the
skilled artisan without undue experimentation.
[1132] Mice, such as Balb/c, are immunized with the TAT immunogen
emulsified in complete Freund's adjuvant and injected
subcutaneously or intraperitoneally in an amount from 1-100
micrograms. Alternatively, the immunogen is emulsified in MPL-TDM
adjuvant (Ribi Immunochemical Research, Hamilton, Mont.) and
injected into the animal's hind foot pads. The immunized mice are
then boosted 10 to 12 days later with additional immunogen
emulsified in the selected adjuvant. Thereafter, for several weeks,
the mice may also be boosted with additional immunization
injections. Serum samples may be periodically obtained from the
mice by retro-orbital bleeding for testing in ELISA assays to
detect anti-TAT antibodies.
[1133] The TAT188 polypeptide, E16, is a twelve-transmembrane
protein with both the C- and N-terminus located intracellularly.
TAT(E16) is a subunit of the Na2+ independent large neutral amino
acid transporter, heterodimerized with a common heavy chain 4F2hc
(CD98hc) to form a functional unit (see diagram in FIG. 155). To
prepare anti-TAT188 (anti-E16) antibodies targeting extracellular
domain(s), PC3 cells, which endogenously express E16, were used as
the immunogen. Briefly, PC3 cells (22.times.10.sup.6 cells/ml) were
injected into Balb-c mice. Antibodies titers were tested against
control 293 cells and 293-E16 cells (293 cells transfected with and
producing E16). Six hybridomas were prepared which expressed
anti-E16 antibodies. Of these, three antibodies were shown to have
good specificity for E16 by FACS analysis (see FIG. 156) in which
cell surface binding paralleled E16 surface expression.
Specifically E16 siRNA transfection inhibited E16 expression (see
Example 17 herein) and also decreased the amount of anti-E16
antibody bound to the surface of PC3 cells. These antibodies are
referred to herein as 3B5.1 (or 3B5), 12G12.1 (or 12G12), and
12B9.1 (or 12B9) and were used for further experiments disclosed
herein.
[1134] Hybridomas expressing the antibodies of the invention were
prepared as follows. After a suitable antibody titer has been
detected, the animals "positive" for antibodies can be injected
with a final intravenous injection of TAT. Three to four days
later, the mice are sacrificed and the spleen cells are harvested.
The spleen cells are then fused (using 35% polyethylene glycol) to
a selected murine myeloma cell line such as P3X63AgU.1, available
from ATCC, No. CRL 1597. The fusions generate hybridoma cells which
can then be plated in 96 well tissue culture plates containing HAT
(hypoxanthine, aminopterin, and thymidine) medium to inhibit
proliferation of non-fused cells, myeloma hybrids, and spleen cell
hybrids.
[1135] The hybridoma cells were screened in an ELISA for reactivity
against TAT. Determination of "positive" hybridoma cells secreting
the desired monoclonal antibodies against TAT is within the skill
in the art.
[1136] The positive hybridoma cells can be injected
intraperitoneally into syngeneic Balb/c mice to produce ascites
containing the anti-TAT monoclonal antibodies. Alternatively, the
hybridoma cells can be grown in tissue culture flasks or roller
bottles. Purification of the monoclonal antibodies produced in the
ascites can be accomplished using ammonium sulfate precipitation,
followed by gel exclusion chromatography. Alternatively, affinity
chromatography based upon binding of antibody to protein A or
protein G can be employed.
[1137] Antibodies directed against certain of the TAT polypeptides
disclosed herein have been successfully produced using this
technique(s). More specifically, functional monoclonal antibodies
that are capable of recognizing and binding to TAT protein (as
measured by standard ELISA, FACS sorting analysis and/or
immunohistochemistry analysis) have been successfully generated
against the following TAT proteins as disclosed herein: TAT110
(DNA95930), TAT210 (DNA95930-1), TAT113 (DNA215609), TAT126
(DNA226539), TAT151 (DNA236511), TAT111 (DNA188221), TAT146
(DNA233876), TAT112 (DNA96930), TAT145 (DNA98565), TAT152
(DNA246435), TAT141 (DNA236493), TAT114 (DNA108809), TAT104
(DNA236343), TAT100 (DNA231542), TAT284 (DNA231542-1), TAT285
(DNA231542-2), TAT285-1 (DNA297393), TAT144 (DNA226456), TAT188
(DNA237637), TAT123 (DNA210499), TAT211 (DNA219894), TAT102
(DNA236534), TAT127 (DNA228199) and TAT128 (DNA220432).
Interestingly, Applicants have identified that the monoclonal
antibodies prepared against TAT111 (DNA188221) and TAT146
(DNA233876) are capable of blocking activation of the EphB2R
receptor encoded by the DNA188221 and DNA233876 molecules by its
associated ligand polypeptide. As such, antibodies and methods for
using those antibodies for blocking activation of the EphB2R
receptor (i.e., TAT111 and TAT146 polypeptides) by its associated
ligand are encompassed within the presently described invention.
Moreover, Applicants have identified that monoclonal antibodies
directed against the TAT110 (DNA95930) and TAT210 (DNA95930-1)
polypeptides (i.e., IL-20 receptor alpha polypeptides) are capable
of inhibiting activation of the IL20 receptor alpha by IL-19
protein. As such, antibodies and methods for using those antibodies
for inhibiting activation of the IL-20 receptor alpha (i.e., TAT110
and TAT210 polypeptides) by IL-19 are encompassed within the
presently described invention.
[1138] In addition to the successful preparation of monoclonal
antibodies directed against the TAT polypeptides as described
herein, many of those monoclonal antibodies have been successfully
conjugated to a cell toxin for use in directing the cellular toxin
to a cell (or tissue) that expresses a TAT polypeptide of
interested (both in vitro and in vivo). For example, toxin (e.g.,
DM1) derivatized monoclonal antibodies have been successfully
generated to the following TAT polypeptides as described herein:
TAT110 (DNA95930), TAT210 (DNA95930-1), TAT112 (DNA96930), TAT113
(DNA215609), TAT111 (DNA188221) and TAT146 (DNA233876). As shown
herein below, other useful conjugate toxins include the auristatins
MMAE and MMAF.
Example 13
Purification of TAT Polypeptides Using Specific Antibodies
[1139] Native or recombinant TAT polypeptides may be purified by a
variety of standard techniques in the art of protein purification.
For example, pro-TAT polypeptide, mature TAT polypeptide, or
pre-TAT polypeptide is purified by immunoaffinity chromatography
using antibodies specific for the TAT polypeptide of interest. In
general, an immunoaffinity column is constructed by covalently
coupling the anti-TAT polypeptide antibody to an activated
chromatographic resin.
[1140] Polyclonal immunoglobulins are prepared from immune sera
either by precipitation with ammonium sulfate or by purification on
immobilized Protein A (Pharmacia LKB Biotechnology, Piscataway,
N.J.). Likewise, monoclonal antibodies are prepared from mouse
ascites fluid by ammonium sulfate precipitation or chromatography
on immobilized Protein A. Partially purified immunoglobulin is
covalently attached to a chromatographic resin such as
CnBr-activated SEPHAROSE.TM. (Pharmacia LKB Biotechnology). The
antibody is coupled to the resin, the resin is blocked, and the
derivative resin is washed according to the manufacturer's
instructions.
[1141] Such an immunoaffinity column is utilized in the
purification of TAT polypeptide by preparing a fraction from cells
containing TAT polypeptide in a soluble form. This preparation is
derived by solubilization of the whole cell or of a subcellular
fraction obtained via differential centrifugation by the addition
of detergent or by other methods well known in the art.
Alternatively, soluble TAT polypeptide containing a signal sequence
may be secreted in useful quantity into the medium in which the
cells are grown.
[1142] A soluble TAT polypeptide-containing preparation is passed
over the immunoaffinity column, and the column is washed under
conditions that allow the preferential absorbance of TAT
polypeptide (e.g., high ionic strength buffers in the presence of
detergent). Then, the column is eluted under conditions that
disrupt antibody/TAT polypeptide binding (e.g., a low pH buffer
such as approximately pH 2-3, or a high concentration of a
chaotrope such as urea or thiocyanate ion), and TAT polypeptide is
collected.
Example 14
In Vitro Tumor Cell Killing Assay
[1143] Mammalian cells expressing the TAT polypeptide of interest
may be obtained using standard expression vector and cloning
techniques. Alternatively, many tumor cell lines expressing TAT
polypeptides of interest are publicly available, for example,
through the ATCC and can be routinely identified using standard
ELISA or FACS analysis. Anti-TAT polypeptide monoclonal antibodies
(and toxin conjugated derivatives thereof) may then be employed in
assays to determine the ability of the antibody to kill TAT
polypeptide expressing cells in vitro.
[1144] For example, cells expressing the TAT polypeptide of
interest are obtained as described above and plated into 96 well
dishes. In one analysis, the antibody/toxin conjugate (or naked
antibody) is included throughout the cell incubation for a period
of 4 days. In a second independent analysis, the cells are
incubated for 1 hour with the antibody/toxin conjugate (or naked
antibody) and then washed and incubated in the absence of
antibody/toxin conjugate for a period of 4 days. Cell viability is
then measured using the CellTiter-Glo Luminescent Cell Viability
Assay from Promega (Cat# G7571). Untreated cells serve as a
negative control.
[1145] In one specific analysis, the ability of monoclonal
antibodies directed against TAT112 (DNA96930) were analyzed for the
ability to kill cells expressing that polypeptide. In one analysis,
an expression vector called gD.NCA was prepared. The TAT112
polypeptide encoding sequences inserted into that vector are driven
by an SV40 promoter and the vector also contains the SV40 early
poly A signal. The gD.NCA vector was co-transfected into PC3 cells
along with an SV40 vector that expresses Neo resistance in PC3
cells, and positive transformants were selected in 800:g/ml G418.
Positive clones were isolated in 96 well plates and analyzed by
flow cytometry using an anti-TAT112 monoclonal antibody prepared as
described above and called 3E6. Clone 3 was selected for the
analysis as it was found to express a high level of TAT112
polypeptide on its surface. In a second independent analysis, the
pancreatic cancer cell line, Hpaf II, was obtained from the ATCC
and employed in the assay.
[1146] In another specific analysis, the ability of monoclonal
antibodies directed against TAT188 (DNA237637) were analyzed for
the ability to kill cells expressing that polypeptide.
[1147] First, the ability of a naked anti-TAT188(E16) antibody to
affect cellular activity was demonstrated.
[1148] A. Anti-TAT188(E16) Monoclonal Antibodies Stimulate
TAT188(E16) Internalization and Reduce Amino Acid Transport
Activity.
[1149] The binding of anti-E16 antibody to cells expressing the E16
protein elicited antibody internalization which paralleled a
reduction in amino acid transport. PC3 cells were incubated with
primary antibodies for indicated time with proteasome inhibitors
(Sigma) at 37.degree. C. Then antibodies are removed and cells are
washed with PBS several times. Cells are fixed with 4% PFA, then
permeabilized with PBS/0.1% TritonX-100. After blocking with 10%
goat serum, cells were stained with secondary antibody (goat
anti-mouse IgG-Cy3 conjugated (Jackson immunolabs)) and analyzed by
fluorescent microscope. The results show that an anti-E16
monoclonal antibody binds and is internalized by PC3 cells
expressing TAT188(E16) on their surface (see FIG. 157). The
demonstration of anti-TAT188 antibody internalization highlights a
useful feature of the antibody-E16 interaction because the
internalization of a bound antibody can result in the uptake of
toxins conjugated to the anti-TAT188 antibodies (see sections B and
C of this Example 14).
[1150] The function of TAT188(E16) as an amino acid transport
protein was inhibited by the binding of anti-TAT188(E16) antibody.
The leucine transport functional assay was performed as follows.
Cells were grown in 24 well plate and treated with anti-E16
antibody for over night. Cells were then rinsed with warm Na++ free
Hepes-Ringer, and incubated for 10 min at 37.degree. C. Buffer was
changed to 200:1/well of assay buffer containing radiolabeled amino
acid (L-[2, 3-.sup.3H]-Arginine or L-[3, 4, 5-.sup.3H(N)]-Leucine)
5:Ci/ml, 50:1 insodium-free Hepes-Ringer). After incubating the
radioactive mixture for 30 sec at 37.degree. C., buffer was removed
by aspiration and cells were wash with ice-cold sodium-free
Hepes-Ringer 1 ml/well for 4 times. Thep lates were dried and to
them was added 0.2 ml/well of 0.2% SDS/0.2N NaOH. 0.1 ml aliquots
of lysates from each sample were neutralized with 0.1 ml of 0.2N
Hcl, after which liquid scintillation cocktail was added.
([.sup.3H]) radioactivity of the lysates was tested using
scintillation counter. The results in FIG. 158 also demonstrate
that anti-E16 antibody binding to E16 protein on the cell surface
causes overall reduction in amino acid transport after
approximately 24 hours. The reduction is due to concomitant E16
polypeptide internalization and loss of available E16 for transport
function.
[1151] B. The Binding of Toxin-Conjugated Anti-TAT188(E16)
Antibodies to TAT188(E16)-Expressing Cells Results in Cell
Killing.
[1152] Preparation of Anti-TAT188-MC-vc-PAB-MMAE by Conjugation of
Anti-TAT188 and MC-vc-PAB-MMAE
[1153] Antibodies provide a convenient and highly specific method
for delivering cytotoxins to cells where a relatively unique
feature of the cell, such as a tissue specific (or disease specific
or both) surface protein, allows the cell to be targeted for
killing while avoiding the killing of healthy cells. The auristatin
cytotoxins coupled to an antibody via a MC-vc-PAB linker as
disclosed hereinabove, are useful to demonstrate cell killing
resulting from E16 mediated internalization of the antibody-toxin
conjugate. The procedure was performed as follows. Using a
MC-vc-PAB linker, the MMAE toxin was covalently linked to cysteine
residues on anti-TAT188 antibodies. Anti-TAT188, dissolved in 500
mM sodium borate and 500 mM sodium chloride at pH 8.0 is treated
with an excess of 100 mM dithiothreitol (DTT). After incubation at
37.degree. C. for about 30 minutes, the buffer is exchanged by
elution over Sephadex G25 resin and eluted with PBS with 1 mM DTPA.
The thiol/Ab value is checked by determining the reduced antibody
concentration from the absorbance at 280 nm of the solution and the
thiol concentration by reaction with DTNB (Aldrich, Milwaukee,
Wis.) and determination of the absorbance at 412 nm. The reduced
antibody dissolved in PBS is chilled on ice.
[1154] The drug linker reagent,
maleimidocaproyl-valine-citrulline-PAB-monomethyl auristatin E
(MMAE), i.e. MC-vc-PAB-MMAE, dissolved in DMSO, is diluted in
acetonitrile and water at known concentration, and added to the
chilled reduced anti-TAT188(E16) antibody in PBS. After about one
hour, an excess of maleimide is added to quench the reaction and
cap any unreacted antibody thiol groups. The reaction mixture is
concentrated by centrifugal ultrafiltration and
anti-TAT188(E16)-MC-vc-PAB-MMAE was purified and desalted by
elution through G25 resin in PBS, filtered through 0.2 mm filters
under sterile conditions, and frozen for storage.
[1155] Preparation of Anti-TAT188-MC-vc-PAB-MMAF by Conjugation of
Anti-TAT188 and MC-vc-PAB-MMAF
[1156] Anti-TAT188-MC-val-cit-PAB-MMAF was prepared by conjugation
of anti-TAT188(E16) and MC-val-cit-PAB-MMAF following the procedure
disclosed above for conjugation of MMAE. MMAF is a derivative of
MMAE with a phenylalanine at the C-terminus of the drug.
[1157] Determination of in Vitro Cytotoxicity of Toxin-Conjugated
Anti-TAT188
[1158] The toxin-conjugated 3B5, 12B9, and 12G12 antibodies for
this experiment were prepared as 3B5-MC-vc-PAB-MMAE,
12B9-MC-vc-PAB-MMAE, and 3B5-MC-vc-PAB-MMAE conjugates,
respectively. Antibody-toxin conjugate, alpha-IL8-MC-vc-PAB-MMAE,
was used as a negative control. PC3 cells (a prostate cancer cell
line, available from ATCC and which endogenously expressed E16 on
its surface) and Colo205 cells (a human colon cancer cell line,
available from ATCC and which endogenously expresses E16 on its
surface) were contacted with increasing concentrations of
toxin-conjugated antibodies and monitored for cell killing by a
standard cell viability bioluminescence assay (CellTiterGlo.TM.
Kit, Promega) as described above. The results shown in FIG. 159A
(PC3 cells) and FIG. 159B (Colo205 cells) demonstrate that the
three toxin-conjugated anti-E16 antibodies promote killing of cells
that express E16.
[1159] Another toxin, MMAF, was linked to antibody and tested for
cytotoxicity. The toxin-linked 3B5 antibodies for this experiment
were designated 3B5-MC-vc-PAB-MMAE and 3B5-MC-vc-PAB-MMAF.
Antibody-toxin conjugate, alpha-IL8-vc-MMAE, was used as a negative
control. The average number of toxin molecules attached to each
antibody was approximately four toxin molecules per antibody as
shown in FIG. 160. Human colon cancer cell line, Colo205, cells
were seeded in 96well plates at 4000cells/well in 50:1 of culture
medium. The next day cells were incubated with 3B5-MC-vc-PAB-MMAE,
3B5-MC-vc-PAB-MMAF or alpha-IL8-vc-MMAE antibodies in graded
concentrations diluted in 50:1 of culture medium for 72 hrs. Cell
viability was measured using a CellTiter-Glo.TM. luminescent cell
viability assay kit (Promega). The results shown in FIG. 160
demonstrate that MC-vc-PAB-MMAE and MC-vc-PAB-MMAF-conjugated
anti-E16 antibodies have the ability to kill cells expressing E16,
with MMAF toxin (EC50 approximately 0.06:g/ml) providing greater
cell killing than MMAF (EC50 approximately 0.007:g/ml).
[1160] Development of the antibodies of the invention as
therapeutic agent in humans requires early toxicity studies in
monkeys and/or primates. The E16 amino acid sequence varies across
species such as human versus monkey, rat and mouse E16 amino acid
sequences is 96.26%, 91.05% and 90.66, respectively. To determine
whether the anti-human TAT188(E16) antibodies were also capable of
binding and killing monkey cells, the following in vitro experiment
was performed. A monkey cell line, COS 7 (available from ATCC),
that endogenously expresses monkey E16 on its surface was used. The
anti-E16 antibodies 3B5, 12B9, and 12G12 were contacted with human,
monkey, and mouse cells endogenously expressing human, monkey and
mouse E16, respectively, and analyzed by standard FACS analysis.
The FACS showed that each of the three anti-human E16 antibodies
3B5, 12G12, and 12B9 bind monkey COS7 cells expressing human E16
(see FIG. 161A) as well as human cells expressing human E16 (see
FIG. 161B), but do not bind mouse E16 expressing cells (see FIG.
161B). Thus, the anti-TAT188(E16) antibodies of the invention are
useful for clinical activity, efficacy and toxicity studies.
Example 15
In Vivo Tumor Cell Killing Assay
[1161] Anti-TAT112 Activity:
[1162] To test the efficacy of unconjugated anti-TAT112 monoclonal
antibodies, anti-TAT112 antibody was injected intraperitoneally
into nude mice 24 hours prior to receiving PC3.gD.NCA clone 3 cells
(obtained as described in Example 14 above) subcutaneously in the
flank. Antibody injections continued twice per week for the
remainder of the study. Tumor volume was measured twice per
week.
[1163] To test the efficacy of DM1-conjugated anti-TAT112 antibody,
PC3.gD.NCA clone 3 cells (obtained as described in Example 14
above) were inoculated into the flank of nude mice. When the tumors
reached a mean volume of approximately 100 mm3, mice were treated
with DM1-conjugated anti-TAT112 antibody intravenously either once
or twice per week.
[1164] The results of the above analyses demonstrated that both the
unconjugated anti-TAT112 as well as the DM1-conjugated anti-TAT112
antibody were highly efficacious in reducing tumor volume in this
in vivo model. These analyses demonstrate that anti-TAT polypeptide
monoclonal antibodies are efficacious for killing tumor cells that
express a TAT polypeptide of interest.
[1165] Anti-TAT118 (E16) Activity:
[1166] To test the efficacy of unconjugated anti-TAT188 monoclonal
antibodies, anti-TAT188 antibodies 3B5, 12B9, and 12G12 for cell
killing in vitro, the following procedure was performed. PC3 cells,
which express E16 endogenously, were injected into athymic nude
mice (nu/nu) at the dorsal flank. On the same day as cell
inoculation, antibodies were injected at 2 mg/kg intraperitoneously
twice per week. The control mice were injected with PBS without
antibody. Ten mice in each group were monitored for 4 weeks and
tumor volume was measured twice per week. By injecting tumor cells
and anti-E16 antibody simultaneously, this procedure tested the
ability of the administered antibodies to inhibit tumor
establishment in the xenograft mice. The results in FIG. 162 show
that in this experiment, mean tumor volume was not significantly
lower than for control antibody.
[1167] To test the efficacy of MC-vc-PAB-MMAE and MC-vc-PAB-MMAF
conjugated anti-TAT188(E16) antibody, Colo205 cells were inoculated
into the flank of athymic nude mice (nu/nu), and after
approximately 1 week, when the tumor had reached a mean volume of
approximately 100-200 mm.sup.3, mice were injected with conjugated
antibody at 3 mg/kg intravenously once per week. The following
antibody treatments were performed on the day tumor-containing mice
were divided into groups: (1) Mock Control--0.2 ml or less PBS,
intravenous injection once per week for 4 weeks; (2) Antibody
control--anti-IL8-MC-vc-PAB-MMAE in 0.2 ml or less PBS, intravenous
injection once per week for 4 weeks; (3)
Antibody--3B5-MC-vc-PAB-MMAE in 0.2 ml or less PBS, intravenous
injection once per week for 4 weeks; (4)
Antibody--3B5-MC-vc-PAB-MMAF in 0.2 ml or less PBS, intravenous
injection once per week for 4 weeks. Mean tumor volume was measured
and plotted versus time. The results in FIG. 163 show that MMAE-
and MMAF-conjugated anti-E16 antibody significantly reduced tumor
volume in this in vivo model. These analyses demonstrate that
anti-TAT polypeptide monoclonal antibodies, such as anti-188(E16)
antibodies are efficacious for killing tumor cells that express a
TAT polypeptide of interest, such as the TAT188(E16)
polypeptide.
Example 16
Northern Blot Analysis
[1168] Northern blot analysis was performed essentially as
described by Sambrook et al., supra. Northern blot analysis using
probes derived from DNA231542, DNA231542-1, DNA231542-2 and
DNA297393 evidences significant upregulation of expression in human
glioma tissue as compared to normal human brain tissue.
[1169] Northern blot analysis using probes derived from DNA237637
(TAT188, E16) were also performed and the results showed that
expression in human breast, colon, rectum, endometrium, kidney,
lung, ovary, skin, and liver evidences significant upregulation of
expression in human cancers as compared to normal human tissue of
the same tissue type.
Example 17
Modulating TAT Expression by siRNA
[1170] siRNAs have proven useful as a tool in studies of modulating
gene expression where traditional antagonists such as small
molecules or antibodies have failed. (Shi Y., Trends in Genetics
19(1):9-12 (2003)). In vitro synthesized, double stranded RNAs that
are 21 to 23 nucleotides in length can act as interfering RNAs
(iRNAs) and can specifically inhibit gene expression (Fire A.,
Trends in Genetics 391; 806-810 (1999)). These iRNAs act by
mediating degradation of their target RNAs. Since they are under 30
nucleotides in length, however they do not trigger a cell antiviral
defense mechanism. Such mechanisms include interferon production,
and a general shutdown of host cell protein synthesis. Practically,
siRNAs can by synthesized and then cloned into DNA vectors. Such
vectors can be transfected and made to express the siRNA at high
levels. The high level of siRNA expression is used to "knockdown"
or significantly reduce the amount of protein produced in a cell,
and thus it is useful in experiments where overexpression of a
protein is believed to be linked to a disorder such as cancer. The
TATs are cell surface expressed tumor antigens and TAT
overexpression was shown by microarray, Taqman.TM. and in situ
hybridization analyses. While antibody binding to TATs such as
TAT188 are shown herein to inhibit function of the tumor antigen
and, with respect to toxin-conjugated antibodies, cause cell
killing), siRNAs are useful antagonists to TAT proteins by limiting
cellular production of the antigen.
[1171] Experimental Methods and Results: TAT188 (E16)
[1172] The following experiments demonstrate that siRNA specific
for TAT188 (also referred to herein as E16) reduces RNA expression,
protein production, cell surface expression, and protein function.
The same or similar procedures are useful demonstrating siRNA
downregulation of other TAT RNAs of the invention. Selection of a
target sequence may be performed by any suitable procedure (see,
for example, Amarzguioui, M. And Prydz, H., Biochem Biophys Res
Comm 316:1050-1058 (2004).
[1173] A. Transient Transfection of E16 siRNA Reduces the
Expression of E16-GFP in PC3-E16-GFP Cells.
[1174] The prostate cancer cell line, PC3, was used in this set of
experiments as it overexpresses TAT188 endogenously. PC3 cells were
transfected using double-stranded 21mer RNA oligos directed against
TAT188 (siTAT188), lamin or mock transfected. These oligos are
listed below.
[1175] siRNA Oligos:
[1176] TAT188(E16)
[1177] The DNA sequence of the target region within the coding
sequence of TAT188(E16) is shown below followed by the sequences of
the sense and antisense strands of the double stranded siRNA.
[1178] AAGGAAGAGGCGCGGGAGAAG (SEQ ID NO:155), is the nucleic acid
sequence within the TAT188 coding region targeted by the siRNA
oligos used in the TAT188 siRNA examples disclosed herein. Other
sequences may be chosen as targets according to standard practice
with the field of siRNA gene silencing.
TABLE-US-00012 TAT188(E16) siRNA oligos: Sense:
r(GGAAGAGGCGCGGGAGAAG)TT (SEQ ID NO: 156) Antisense:
r(CUUCUCCCGCGCCUCUUCC)TT (SEQ ID NO: 157) silamin siRNA oligos:
Sense: r(CUGGACUUCCAGAAGAACA)TT (SEQ ID NO: 158) Antisense:
r(UGUUCUGGAAGUCCAG)TT (SEQ ID NO: 159) (see Elbashir et al., Nature
411:494-498 (2001)
[1179] Two days post-transfection and the relative level of
TAT188(E16) polypeptide versus the knock-down of E16-EGFP
expression was analyzed by fluorescent microscope monitoring of
EGFP fluorescence. A decrease in E16 expression parallels a
reduction in EGFP production and bioluminescence detected. The
results in FIG. 164 demonstrate that transient transfection with
siTAT188(E16) siRNA reduced E16-EGFP fusion expression. The fusion
protein referred to as "GFP" in FIGS. 164 and 164 refer to an
E16-EGFP fusion produced by cloning the E16 gene into pEGFP-C1
vector from BDClontech).
[1180] B. Transient Transfection of E16 siRNA Reduces TAT188(E16)
Polypeptide Production--
[1181] Reduction of E16 expression was demonstrated by reduction in
E16 protein using Western blot analysis. siTAT188(siE16) RNA oligos
SEQ ID NO:156 and SEQ ID NO:157 and the lamin siRNA oligos SEQ ID
NO:158 and SEQ ID NO:159 used in this example were the same as
shown above in part A of this example. PC3 cells transiently
transfected with E16-EGFP were harvested 3 days post-transfection
and a Western blot was performed on beta-tubulin band to indicate
protein loading. Western blot of TAT188(E16)-GFP fusions were
visualized using detectably labelled anti-GFP antibody (see FIG.
165, left lane--mock transfection; right lane, E16 siRNA
transfection). The results demonstrate that the presence
TAT188(E16) siRNA in a cell expressing E16-GFP fusion protein
reduced the expression of E16-GFP significantly.
[1182] C. Transient Transfection of E16 siRNA Inhibits Endogenous
E16 Amino Acid Transporter Activity in PC3 Cells.
[1183] The same procedure for transient transfection of TAT188(E16)
siRNA and lamin siRNA (control) was performed. The test and control
cells were tested for E16 activity as an amino acid transport
protein as follows using the leucine transport assay described
herein above. The results in FIG. 166 show that E16 siRNA reduction
in E16 RNA and protein production is consistent with reduction in
the amount of E 16 available to function in amino acid transport in
the cell.
[1184] D. Transient Transfection of E16 siRNA Reduces the Surface
Expression of E16
[1185] This example was performed as follows. Forty eight hours
after transfection of siRNA, cells were analysed by FACS. Briefly,
cells were incubated with primary antibodies for one hour on ice.
The cells were then labeled with a secondary antibody conjugated
with a fluorescent dye (such as nonlimiting examples Cy-3 or PE)
and collecting data with FACScaliber.TM. or FACScan.TM.. The
collected data was analyzed using, as non-limiting examples,
Cellquest.TM. (BD Clontech) or FlowJo.TM. (Tree Star, Inc.). As
disclosed in Example 12, herein, the three anti-E16 monoclonal
antibodies, 3b5, 12B9, and 12G12, were shown to bind less on PC3
cells after transfection of TAT188(E16) siRNA consistent with
reduced expression of the E16 protein in the presence of targeted
siRNA (see FIG. 156).
[1186] E. Transient Transfection of TAT188(E16) siRNA Inhibits PC3
Cell Proliferation.
[1187] Proliferation of PC3 cells transfected with siRNA targeting
TAT188 can be assayed according to the following commercial
protocol (Promega Corp. Technical Bulletin TB288; Mendoza et al.
(2202) Cancer Res. 62:5485-5488). For example, PC3 cells were
plated at 3.5.times.10.sup.5 cells/well in 6 well plates. The next
day, double stranded RNA (dsRNA, SEQ ID NO:155 and SEQ ID NO:156)
or lamin control siRNA (using siRNA oligos SEQ ID NO:157 and SEQ ID
NO:158) at a final concentration of 100 nM was used to transfect
the cells using Lipofectamin2000 (Invitrogen). After 6 hrs of
transfection, cells were reseeded into 96 well plates, and cell
viability was measured using Cell Counting Kit-8.TM. (Dojindo) at
the time points indicated in FIG. 167, where RLU=relative
luminescence units. Other cells that may be assayed by this method
if they express TAT188 (either endogenously or after transfection
with nucleic acid encoding TAT188) include without limitation
SKBR-3, BT474, MCF7 or MDA-MB-468 demonstrating that reduction in
E16 expression in breast cancer cells results in cell killing and
that breast cancer, as well as prostate, colorectal and other types
of cancer, are desirable targets for treatment using E16 expression
knockdown.
[1188] These data shows that siRNAs can "knockdown" or reduce the
expression of TAT proteins such as TAT188 (E16) protein. The
reduction is shown by reduction of RNA expression (in in situ
hybridization assays), reduced protein production (as shown in
Western blot analyses), reduced cell surface expression of TAT188
(E16) (as shown by FACS analyses and internalization assays), and
reduced function (as shown by reduction in amino acid transport).
siRNA reduction of TAT proteins, such as TAT188 (E16) over a period
of time results in reduction of cell proliferation in cancer cell
lines. Therefore, siRNA is useful in reducing TAT proteins such as
TAT188 (E16). Reduction in the level of TAT proteins, such as
TAT188 (E16), causes a reduction in the proliferation of cancer
cell lines. Since cancer is a cell proliferative disorder, these
results show that antagonists of TAT polypeptides, such as TAT188
(E16) would be useful in the reduction of cancer cell growth.
Reduction of cancer cell growth would be useful in the alleviation
of cancer in mammals.
Example 18
Deposit of Materials
[1189] The following hybridoma cell line has been deposited with
the American Type Culture Collection, 10801 University Blvd.,
Manassas, Va. 20110-2209 USA (ATCC):
TABLE-US-00013 Hybridoma/ Antibody Designation ATCC No. Deposit
Date 3B5.1 PTA-unassigned PTA-6193 Sep. 8, 2004 12B9.1
PTA-unassigned PTA-6194 Sep. 8, 2004 12G12.1 PTA-unassigned
PTA-6195 Sep. 8, 2004
[1190] This deposit was made under the provisions of the Budapest
Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture for 30 years from the date of deposit. The cell
line will be made available by ATCC under the terms of the Budapest
Treaty, and subject to an agreement between Genentech, Inc. and
ATCC, which assures (a) that access to the culture will be
available during pendency of the patent application to one
determined by the Commissioner to be entitled thereto under 37 CFR
.sctn.1.14 and 35 USC .sctn.122, and (b) that all restrictions on
the availability to the public of the culture so deposited will be
irrevocably removed upon the granting of the patent.
[1191] The assignee of the present application has agreed that if
the culture on deposit should die or be lost or destroyed when
cultivated under suitable conditions, it will be promptly replaced
on notification with a viable specimen of the same culture.
Availability of the deposited cell line is not to be construed as a
license to practice the invention in contravention of the rights
granted under the authority of any government in accordance with
its patent laws.
[1192] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
the construct deposited, since the deposited embodiment is intended
as a single illustration of certain aspects of the invention and
any constructs that are functionally equivalent are within the
scope of this invention. The deposit of material herein does not
constitute an admission that the written description herein
contained is inadequate to enable the practice of any aspect of the
invention, including the best mode thereof, nor is it to be
construed as limiting the scope of the claims to the specific
illustrations that it represents. Indeed, various modifications of
the invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description and fall within the scope of the appended claims.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20100303834A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20100303834A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References