U.S. patent application number 12/610967 was filed with the patent office on 2010-11-25 for combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood glp-1 level.
This patent application is currently assigned to ARENA PHARMACEUTICALS, INC.. Invention is credited to Hussien A. Al-Shamma, Zhi-Liang Chu, Robert M. Jones, James N. Leonard.
Application Number | 20100298333 12/610967 |
Document ID | / |
Family ID | 36570727 |
Filed Date | 2010-11-25 |
United States Patent
Application |
20100298333 |
Kind Code |
A1 |
Chu; Zhi-Liang ; et
al. |
November 25, 2010 |
COMBINATION THERAPY FOR THE TREATMENT OF DIABETES AND CONDITIONS
RELATED THERETO AND FOR THE TREATMENT OF CONDITIONS AMELIORATED BY
INCREASING A BLOOD GLP-1 LEVEL
Abstract
The present invention concerns combination of an amount of a
GPR119 agonist with an amount of a dipeptidyl peptidase IV (DPP-IV)
inhibitor such that the combination provides an effect in lowering
a blood glucose level or in increasing a blood GLP-1 level in a
subject over that provided by the amount of the GPR119 agonist or
the amount of the DPP-IV inhibitor alone and the use of such a
combination for treating or preventing diabetes and conditions
related thereto or conditions ameliorated by increasing a blood
GLP-1 level. The present invention also relates to the use of a G
protein-coupled receptor to screen for GLP-1 secretagogues.
Inventors: |
Chu; Zhi-Liang; (San Diego,
CA) ; Leonard; James N.; (San Diego, CA) ;
Al-Shamma; Hussien A.; (Encinitas, CA) ; Jones;
Robert M.; (San Diego, CA) |
Correspondence
Address: |
FISH & RICHARDSON P.C.
P.O. BOX 1022
MINNEAPOLIS
MN
55440-1022
US
|
Assignee: |
ARENA PHARMACEUTICALS, INC.
San Diego
CA
|
Family ID: |
36570727 |
Appl. No.: |
12/610967 |
Filed: |
November 2, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12609599 |
Oct 30, 2009 |
|
|
|
12610967 |
|
|
|
|
11603417 |
Nov 22, 2006 |
7803754 |
|
|
12609599 |
|
|
|
|
11328405 |
Jan 9, 2006 |
|
|
|
11603417 |
|
|
|
|
60726880 |
Oct 14, 2005 |
|
|
|
60683172 |
May 19, 2005 |
|
|
|
60643086 |
Jan 10, 2005 |
|
|
|
Current U.S.
Class: |
514/249 ;
514/412; 514/423 |
Current CPC
Class: |
A61P 25/00 20180101;
A61K 31/4196 20130101; G01N 2800/2857 20130101; A61P 25/08
20180101; G01N 2800/2814 20130101; A61P 27/02 20180101; A61P 17/02
20180101; A61P 3/10 20180101; A61K 31/401 20130101; G01N 2800/042
20130101; G01N 2800/2835 20130101; A61P 27/12 20180101; A61P 1/14
20180101; G01N 2333/726 20130101; A61K 31/415 20130101; A61P 5/48
20180101; A61P 25/14 20180101; A61P 3/06 20180101; A61P 9/10
20180101; A61K 45/06 20130101; A61P 3/00 20180101; A61P 1/18
20180101; A61P 25/28 20180101; A61P 25/16 20180101; A61P 43/00
20180101; A61P 13/12 20180101; G01N 33/76 20130101; A61K 31/00
20130101; A61P 3/04 20180101; A61P 9/12 20180101; G01N 2800/2871
20130101; A61P 25/02 20180101; A61P 9/00 20180101; G01N 33/74
20130101; A61P 9/08 20180101; A61K 31/00 20130101; A61K 2300/00
20130101; A61K 31/401 20130101; A61K 2300/00 20130101; A61K 31/415
20130101; A61K 2300/00 20130101; A61K 31/4196 20130101; A61K
2300/00 20130101 |
Class at
Publication: |
514/249 ;
514/423; 514/412 |
International
Class: |
A61K 31/4985 20060101
A61K031/4985; A61K 31/40 20060101 A61K031/40; A61K 31/403 20060101
A61K031/403; A61P 9/10 20060101 A61P009/10; A61P 3/10 20060101
A61P003/10; A61P 25/28 20060101 A61P025/28; A61P 25/08 20060101
A61P025/08; A61P 25/00 20060101 A61P025/00 |
Claims
1.-47. (canceled)
48. A method of treating a condition ameliorated by increasing a
blood GLP-1 level in a subject in need thereof , comprising
administering to the subject a therapeutically effective amount of
a GPR119 agonist and a DPP-IV inhibitor, wherein the DPP-IV
inhibitor is not identical to
1-[2-[5-cyanopyridin-2-yl)amino]ethylamino]acetyl-2-cyano-(S)-pyrrolidine
(NVP-DPP728).
49. The method of claim 48, wherein the GPR119 agonist and the
DPP-IV inhibitor are administered in amounts sufficient to increase
a blood GLP-1 level in the subject.
50. The method of claim 48, wherein the amount of GPR119 agonist
alone and the amount of DPP-IV inhibitor alone are therapeutically
ineffective in increasing the blood GLP-1 level in the subject.
51. The method of claim 48, wherein the GPR119 agonist and the
DPP-IV inhibitor are admixed with a pharmaceutically acceptable
carrier.
52. The method of claim 51, wherein the GPR119 agonist and the
DPP-IV inhibitor are each admixed with a different pharmaceutically
acceptable carrier.
53. The method of claim 48, wherein the GPR119 agonist is an
agonist of human GPR119.
54. The method of claim 48, wherein the GPR119 agonist is a small
molecule.
55. The method of claim 48, wherein the GPR119 agonist is orally
active.
56. The method of claim 48, wherein the GPR119 agonist is a
selective GPR119 agonist.
57. The method of claim 48, wherein the GPR119 agonist has a
selectivity for GPR119 over a CRF-1 receptor of at least about
100-fold.
58. The method of claim 48, wherein the GPR119 agonist has an EC50
of less than about 10 .mu.M.
59. The method of claim 48, wherein the GPR119 agonist has an EC50
of less than about 1 .mu.M.
60. The method of claim 48, wherein the GPR119 agonist has an EC50
of less than about 100 nM.
61. The method of claim 48, wherein the DPP-IV inhibitor is:
MK-0431:
3(R)-Amino-1-[3-(trifluoromethyl)-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a-
]pyrazin-7-yl]-4-(2,4,5-trifluorophenyl)butan-1-one; LAF237:
(1-[[3-hydroxy-1-adamantyl)amino]acetyl]-2-cyano-(S)-pyrrolidine;
or BMS-477118:
(1S,3S,5S)-2-[2(S)-Amino-2-(3-hydroxyadamantan-1-yl)acetyl]-2
azabicyclo[3.1.0]hexane-3-carbonitrile.
62. The method of claim 48, wherein the GPR119 agonist and the
DPP-IV inhibitor are administered to the subject simultaneously,
separately, or sequentially.
63. The method of claim 48, wherein the subject is a human.
64. The method of claim 48, wherein the subject is a non-human
mammal.
65. The method of claim 48, wherein the condition ameliorated by
increasing a blood GLP-1 level is selected from the group
consisting of diabetes, a condition related to diabetes, myocardial
infarction, learning impairment, memory impairment, and a
neurodegenerative disorder.
66. The method of claim 48, wherein the condition ameliorated by
increasing a blood GLP-1 level is a neurodegenerative disorder
selected from the group consisting of excitotoxic brain damage
caused by severe epileptic seizures, Alzheimer's disease,
Parkinson's disease, Huntington's disease, prion-associated
disease, stroke, motor-neuron disease, learning or memory
impairment, traumatic brain injury, spinal cord injury, and
peripheral neuropathy.
67. A method of increasing a blood GLP-1 level in a subject
deficient in GLP-1, comprising administering to the subject a
therapeutically effective amount of a GPR119 agonist and a DPP-IV
inhibitor, wherein the DPP-IV inhibitor is not identical to
1-[2-[5-cyanopyridin-2-yl)amino]ethylamino-]acetyl-2-cyano-(S)-pyrrolidin-
e (NVP-DPP728).
68. The method of claim 67, wherein the amount of GPR119 agonist
alone and the amount of DPP-IV inhibitor alone are therapeutically
ineffective in increasing the blood GLP-1 level in the subject.
69. The method of claim 67, wherein the GPR119 agonist and the
DPP-IV inhibitor are admixed with a pharmaceutically acceptable
carrier.
70. The method of claim 69, wherein the GPR119 agonist and the
DPP-IV inhibitor are each admixed with a different pharmaceutically
acceptable carrier.
71. The method of claim 67, wherein the GPR119 agonist is an
agonist of human GPR119.
72. The method of claim 67, wherein the GPR119 agonist is a small
molecule.
73. The method of claim 67, wherein the GPR119 agonist is orally
active.
74. The method of claim 67, wherein the GPR119 agonist is a
selective GPR119 agonist.
75. The method of claim 67, wherein the GPR119 agonist has a
selectivity for GPR119 over a CRF-1 receptor of at least about
100-fold.
76. The method of claim 67, wherein the GPR119 agonist has an EC50
of less than about 10 .mu.M.
77. The method of claim 67, wherein the GPR119 agonist has an EC50
of less than about 1 .mu.M.
78. The method of claim 67, wherein the GPR119 agonist has an EC50
of less than about 100 nM.
79. The method of claim 67, wherein the DPP-IV inhibitor is:
MK-0431:
3(R)-Amino-1-[3-(trifluoromethyl)-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a-
]pyrazin-7-yl]-4-(2,4,5-trifluorophenyl)butan-1-one; LAF237:
(1-[[3-hydroxy-1-adamantyl)amino]acetyl]-2-cyano-(S)-pyrrolidine;
or BMS-477118:
(1S,3S,5S)-2-[2(S)-Amino-2-(3-hydroxyadamantan-1-yl)acetyl]-2
azabicyclo[3.1.0]hexane-3-carbonitrile.
80. The method of claim 67, wherein the GPR119 agonist and the
DPP-IV inhibitor are administered to the subject simultaneously,
separately, or sequentially.
81. The method of claim 67, wherein the subject is a human.
82. The method of claim 67, wherein the subject is a non-human
mammal.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Ser. No.
11/328,405, filed on Jan. 9, 2006, which in turn claims the benefit
of U.S. Ser. Nos. 60/643,086, filed Jan. 10, 2005, 60/683,172,
filed May 19, 2005, and 60/726,880, filed Oct. 14, 2005, each of
which is hereby incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to compositions and methods
for treating or preventing diabetes and conditions related thereto.
The present invention further relates to compositions and methods
for increasing a blood GLP-1 level in a mammal. The present
invention also relates to methods of using a G protein-coupled
receptor to screen for GLP-1 secretagogues.
BACKGROUND OF THE INVENTION
[0003] The following discussion is intended to facilitate the
understanding of the invention, but is not intended nor admitted to
be prior art to the invention.
[0004] A. Diabetes
[0005] Type 2 diabetes is one of the most common chronic diseases.
Type 2 diabetes is characterized by fasting and postprandial
hyperglycemia and by relative insulin insufficiency. Hyperglycemia
may cause long-term microvascular and macrovascular complications,
such as nephropathy, neuropathy, retinopathy, and peripheral
vascular disease. In addition, Type 2 diabetes is a comorbid
disease that frequently compounds hyperlipidemia, atherosclerosis
and hypertension. Hyperlipidemia is a primary risk factor for
cardiovascular disease due to atherosclerosis. Obesity is a well
known common risk factor for the development of atherosclerosis,
stroke, hypertension and Type 2 diabetes. Type 2 diabetes causes
significant morbidity and mortality at considerable expense to
patients, their families and society. The incidence of Type 2
diabetes in the United States is about 7% and accounts for as much
as 10% of all health care dollars. Furthermore, the incidence of
Type 2 diabetes worldwide is increasing such that Type 2 diabetes
is now considered to be a worldwide epidemic.
[0006] B. Glucagon-Like Peptide-1 (GLP-1)
[0007] Glucagon-like peptide-1 (GLP-1) is an incretin hormone
derived from the posttranslaltional modification of proglucagon and
secreted by gut endocrine cells. GLP-1 mediates its actions through
a specific G protein-coupled receptor (GPCR), namely GLP-1R. GLP-1
is best characterized as a hormone that regulates glucose
homeostasis. GLP-1 has been shown to stimulate glucose-dependent
insulin secretion and to increase pancreatic beta cell mass. GLP-1
has also been shown to reduce the rate of gastric emptying and to
promote satiety. The efficacy of GLP-1 peptide agonists in
controlling blood glucose in Type 2 diabetics has been demonstrated
in several clinical studies [see, e.g., Nauck et al., Drug News
Perspect (2003) 16:413-422], as has its efficacy in reducing body
mass [Zander et al., Lancet (2002) 359:824-830].
[0008] GLP-1 receptor agonists are additionally useful in
protecting against myocardial infarction and against cognitive and
neurodegenerative disorders. GLP-1 has been shown to be
cardioprotective in a rat model of myocardial infarction [Bose et
al., Diabetes (2005) 54:146-151], and GLP-1R has been shown in
rodent models to be involved in learning and neuroprotection
[During et al., Nat Med (2003) 9:1173-1179; and Greig et al., Ann N
Y Acad Sci (2004) 1035:290-315].
[0009] Certain disorders such as Type 2 diabetes are characterized
by a deficiency in GLP-1 [see, e.g., Nauck et al., Diabetes (2004)
53 Suppl 3:S190-196].
[0010] Current GLP-1 peptide agonists suffer from a lack of oral
bioavailability, negatively impacting patient compliance. Efforts
to develop orally bioavailable non-peptidergic, small-molecule
agonists of GLP-1R have so far been unsuccessful [Mentlein, Expert
Opin Investig Drugs (2005) 14:57-64]. An attractive alternative
approach is to develop an orally active composition for increasing
an endogenous level of GLP-1 in the blood.
[0011] C. GPR119
[0012] GPR119 G protein-coupled receptor (GPR119; e.g., human
GPR119, GenBank.RTM. Accession No. AAP72125 and alleles thereof;
e.g., mouse GPR119, GenBank.RTM. Accession No. AY288423 and alleles
thereof) is selectively expressed on pancreatic beta cells. GPR119
activation leads to elevation of a level of intracellular cAMP,
consistent with GPR119 being coupled to Gs. Agonists to GPR119
stimulate glucose-dependent insulin secretion in vitro and lower an
elevated blood glucose level in vivo. See, e.g., International
Applications WO 04/065380, WO 04/076413, and EP 1338651, the
disclosure of each of which is herein incorporated by reference in
its entirety. In the patent literature, GPR119 has been referred to
as RUP3 (see, e.g., International Application WO 00/31258).
[0013] D. Dipeptidyl Peptidase IV (DPP-IV)
[0014] Dipeptidyl peptidase IV (DPP-IV, EC 3.4.14.5) exhibits
catalytic activity against a broad range of peptide substrates that
includes peptide hormones, neuropeptides, and chemokines. The
incretins glucagon-like peptide 1 (GLP-1) and glucose-dependent
insulinotropic polypeptide (GIP), which stimulate glucose-dependent
insulin secretion and otherwise promote blood glucose homeostasis,
are rapidly cleaved by DPP-IV at the position 2 alanine leading to
inactivation of their biological activity. Both pharmacological and
genetic attenuation of DPP-IV activity is associated with enhanced
incretin action, increased insulin, and lower blood glucose in
vivo. Genetic attenuation of DPP-IV activity has been shown to
provide resistance to obesity and to improve insulin sensitivity. A
second-generation DPP-IV inhibitor, LAF237 (Ahren et al., J Clin
Endocrinol Metab (2004) 89:2078-2084; and Villhauer et al., J Med
Chem (2003) 46:2774-2789; the disclosure of each of which is herein
incorporated by reference in its entirety), is currently in phase 3
clinical trials for Type 2 diabetes and additional DPP-IV
inhibitors are in clinical development, including MK-0431,
BMS-477118, PSN-9301 and SYR-322.
[0015] Because the incretin hormones are not, the only substrates
for DPP-IV, there is concern that inhibition of the cleavage of
other endogenous DPP-IV substrates may give rise to undesirable
side effects [see, e.g., Chen et al, J Biol Regul Homeost Agents
(2004) 18:47-54, the disclosure of which is herein incorporated by
reference in its entirety]. It therefore would be advantageous to
identify an activity promoting blood glucose homeostasis which is
associated with substantially lower concentrations of DPP-IV
inhibitor.
[0016] E. G Protein-Coupled Receptors
[0017] GPCRs share a common structural motif, having seven
sequences of between 22 to 24 hydrophobic amino acids that form
seven alpha helices, each of which spans the membrane (each span is
identified by number, i.e., transmembrane-1 (TM-1), transmembrane-2
(TM-2), etc.). The transmembrane helices are joined by strands of
amino acids between transmembrane-2 and transmembrane-3,
transmembrane-4 and transmembrane-5, and transmembrane-6 and
transmembrane-7 on the exterior, or "extracellular" side, of the
cell membrane (these are referred to as "extracellular" regions 1,
2 and 3 (EC-1, EC-2 and EC-3), respectively). The transmembrane
helices are also joined by strands of amino acids between
transmembrane-1 and transmembrane-2, transmembrane-3 and
transmembrane-4, and transmembrane-5 and transmembrane-6 on the
interior, or "intracellular" side, of the cell membrane (these are
referred to as "intracellular" regions 1, 2 and 3 (IC-1, IC-2 and
IC-3), respectively). The "carboxy" ("C") terminus of the receptor
lies in the intracellular space within the cell, and the "amino"
("N") terminus of the receptor lies in the extracellular space
outside of the cell.
[0018] Generally, when an agonist binds to a G protein-coupled
receptor (often referred to as "activation" of the receptor), there
is a change in the conformation of the receptor that facilitates
coupling between the intracellular region and an intracellular
"G-protein." It has been reported that GPCRs are "promiscuous" with
respect to G proteins, i.e., that a GPCR can interact with more
than one G protein. See, Kenakin, T., 43 Life Sciences 1095 (1988).
Although other G proteins may exist, currently, Gq, Gs, Gi, Gz and
Go are G proteins that have been identified. Ligand-activated GPCR
coupling with the G-protein initiates a signaling cascade process
(referred to as "signal transduction"). Under normal conditions,
signal transduction ultimately results in cellular activation or
cellular inhibition.
[0019] Gs stimulates the enzyme adenylyl cyclase. Gi (and Gz and
Go), on the other hand, inhibit adenylyl cyclase. Adenylyl cyclase
catalyzes the conversion of ATP to cAMP; thus, activated GPCRs that
couple the Gs protein are associated with increased cellular levels
of cAMP. On the other hand, activated GPCRs that couple Gi (or Gz,
Go) protein are associated with decreased cellular levels of cAMP.
See, generally, "Indirect Mechanisms of Synaptic Transmission,"
Chpt. 8, From Neuron To Brain (3.sup.rd Ed.) Nichols, J. G. et al
eds. Sinauer Associates, Inc. (1992). Thus, assays that detect cAMP
can be utilized to determine if a candidate compound is, e.g., an
agonist to the receptor (i.e., such a compound would increase the
levels of cAMP). Gq and Go are associated with activation of the
enzyme phospholipase C, which in turn hydrolyzes the phospholipid
PIP.sub.2, releasing two intracellular messengers: diacyclglycerol
(DAG) and inositol 1,4,5-triphosphate (IP3). Increased accumulation
of IP3 is associated with activation of Gq- and Go-associated
receptors. See, generally, "Indirect Mechanisms of Synaptic
Transmission," Chpt. 8, From Neuron To Brain (3.sup.rd Ed.)
Nichols, J. G. et al eds. Sinauer Associates, Inc. (1992). Assays
that detect IP3 accumulation can be utilized to determine if a
candidate compound is, e.g., an agonist to a Gq- or Go-associated
receptor (i.e., such a compound would increase the levels of IP3).
Assay that detect the level of intracellular free calcium can also
be utilized to determine if a candidate compound is, e.g., an
agonist to a Gq or Go-associated receptor (i.e., such a compound
would increase the levels of intracellular free calcium) See, e.g.,
Table A ("N/A": "not applicable").
TABLE-US-00001 TABLE A Effect on Effect on cAMP Effect on IP3 cAMP
Effect on IP3 Production upon Accumulation Production Accu-
Activation of upon Activation upon mulation GPCR (i.e., of GPCR
(i.e., contact upon constitutive constitutive with an contact with
G activation or activation or Inverse an Inverse protein agonist
binding) agonist binding) Agonist Agonist Gs Increase N/A Decrease
N/A Gi Decrease N/A Increase N/A Gz Decrease N/A Increase N/A Go
Decrease Increase Increase Decrease Gq N/A Increase N/A
Decrease
[0020] There are also promiscuous G proteins, which appear to
couple several classes of GPCRs to the phospholipase C pathway,
such as G.alpha.15 or G.alpha.16 [Offermanns & Simon, J Biol
Chem (1995) 270:15175-80], or chimeric G proteins designed to
couple a large number of different GPCRs to the same pathway, e.g.
phospholipase C [Milligan & Rees, Trends in Pharmaceutical
Sciences (1999) 20:118-24].
[0021] Under physiological conditions, GPCRs exist in the cell
membrane in equilibrium between two different conformations: an
"inactive" state and an "active" state. A receptor in an inactive
state is unable to link to the intracellular signaling transduction
pathway to initiate signal transduction leading to a biological
response. Changing the receptor conformation to the active state
allows linkage to the transduction pathway (via the G-protein) and
produces a biological response.
[0022] A receptor may be stabilized in an active state by a ligand
or a compound such as a drug. Recent discoveries, including but not
exclusively limited to modifications to the amino acid sequence of
the receptor, provide means other than ligands or drugs to promote
and stabilize the receptor in the active state conformation. These
means effectively stabilize the receptor in an active state by
simulating the effect of a ligand binding to the receptor.
Stabilization by such ligand-independent means is termed
"constitutive receptor activation." An endogenous receptor
exhibiting activity in the absence of ligand is referred to as a
constitutively active endogenous receptor.
SUMMARY OF THE INVENTION
[0023] The present invention concerns combination of an amount of a
GPR119 agonist with an amount of a dipeptidyl peptidase IV (DPP-IV)
inhibitor such that the combination provides an effect in lowering
a blood glucose level in a subject over that provided by the amount
of the GPR119 agonist or the amount of the DPP-IV inhibitor alone
and the use of such a combination for treating or preventing
diabetes and conditions related thereto. The present invention
further concerns combination of an amount of a GPR119 agonist with
an amount of a dipeptidyl peptidase IV (DPP-IV) inhibitor such that
the combination provides an effect in increasing a blood GLP-1
level in a subject over that provided by the amount of the GPR119
agonist or the amount of the DPP-IV inhibitor alone and the use of
such a combination for treating or preventing a condition
ameliorated by increasing a blood GLP-1 level or for increasing a
blood GLP-1 level in a subject deficient in GLP-1. The present
invention also relates to methods of using GPR119 G protein-coupled
receptor to screen for GLP-1 secretagogues.
[0024] In a first aspect, the present invention features a method
of treating or preventing diabetes or a condition related thereto
comprising administering to a subject in need thereof a
therapeutically effective amount of a composition comprising or
consisting essentially of a GPR119 agonist and a DPP-IV inhibitor.
In certain embodiments, the GPR119 agonist and the DPP-IV inhibitor
are administered in amounts sufficient to lower a blood glucose
level in the subject. In certain embodiments, the blood glucose
level is an elevated blood glucose level.
[0025] The present invention additionally features a method of
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level comprising administering to a subject in need
thereof a therapeutically effective amount of a composition
comprising or consisting essentially of a GPR119 agonist and a
DPP-IV inhibitor. In certain embodiments, the GPR119 agonist and
the DPP-IV inhibitor are administered in amounts sufficient to
increase a blood GLP-1 level in the subject.
[0026] The present invention additionally features a method of
increasing a blood GLP-1 level comprising administering to a
subject deficient in GLP-1 a therapeutically effective amount of a
composition comprising or consisting essentially of a GPR119
agonist and a DPP-IV inhibitor. In certain embodiments, the GPR119
agonist and the DPP-IV inhibitor are administered in amounts
sufficient to increase a blood GLP-1 level in the subject.
[0027] In certain embodiments, diabetes is Type 2 diabetes.
[0028] In certain embodiments, the condition related to diabetes is
selected from the group consisting of hyperglycemia, impaired
glucose tolerance, insulin resistance, pancreatic beta-cell
insufficiency, enteroendocrine cell insufficiency, glucosuria,
metabolic acidosis, cataracts, diabetic nephropathy, diabetic
neuropathy, diabetic retinopathy, diabetic coronary artery disease,
diabetic cerebrovascular disease, diabetic peripheral vascular
disease, metabolic syndrome, hyperlipidemia, atherosclerosis,
stroke, hypertension, and obesity.
[0029] In certain embodiments, the condition ameliorated by
increasing a blood GLP-1 level is selected from the group
consisting of diabetes, a condition related to diabetes, myocardial
infarction, learning impairment, memory impairment, and a
neurodegenerative disorder.
[0030] In certain embodiments, the condition ameliorated by
increasing a blood GLP-1 level is a neurodegenerative disorder
selected from the group consisting of excitotoxic brain damage
caused by severe epileptic seizures, Alzheimer's disease,
Parkinson's disease, Huntington's disease, prion-associated
disease, stroke, motor-neuron disease, learning or memory
impairment, traumatic brain injury, spinal cord injury, and
peripheral neuropathy.
[0031] In certain embodiments, the subject is a human.
[0032] In a second aspect, the present invention features a
composition comprising or consisting essentially of a GPR119
agonist and a DPP-IV inhibitor. In certain embodiments, the present
invention relates to a dosage form of the composition wherein the
GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient
to lower a blood glucose level in a subject. In certain
embodiments, the blood glucose level is an elevated blood glucose
level. In certain embodiments, the present invention relates to a
dosage form of the composition wherein the GPR119 agonist and the
DPP-IV inhibitor are in amounts sufficient to increase a blood
GLP-1 level in a subject.
[0033] In certain embodiments, the subject is a human.
[0034] In a third aspect, the present invention features a
composition comprising or consisting essentially of a GPR119
agonist and a DPP-IV inhibitor for use in a method of treatment of
the human or animal body by therapy. In certain embodiments, the
present invention relates to a dosage form of the composition
wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts
sufficient to lower a blood glucose level in a subject. In certain
embodiments, the blood glucose level is an elevated blood glucose
level. In certain embodiments, the present invention relates to a
dosage form of the composition wherein the GPR119 agonist and the
DPP-IV inhibitor are in amounts sufficient to increase a blood
GLP-1 level in a subject.
[0035] The present invention additionally features a composition
comprising or consisting essentially of a GPR119 agonist and a
DPP-IV inhibitor for use in a method of treatment or prevention of
diabetes or a condition related thereto of the human or animal body
by therapy. In certain embodiments, the present invention relates
to a dosage form of the composition wherein the GPR119 agonist and
the DPP-IV inhibitor are in amounts sufficient to lower a blood
glucose level in a subject. In certain embodiments, the blood
glucose level is an elevated blood glucose level.
[0036] The present invention additionally features a composition
comprising or consisting essentially of a GPR119 agonist and a
DPP-IV inhibitor for use in a method of treatment or prevention of
a condition ameliorated by increasing a blood GLP-1 level of the
human or animal body by therapy. In certain embodiments, the
present invention relates to a dosage form of the composition
wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts
sufficient to increase a blood GLP-1 level in a subject.
[0037] The present invention additionally features a composition
comprising or consisting essentially of a GPR119 agonist and a
DPP-IV inhibitor for use in a method of treatment or prevention of
a deficiency of GLP-1 of the human or animal body by therapy. In
certain embodiments, the present invention relates to a dosage form
of the composition wherein the GPR119 agonist and the DPP-IV
inhibitor are in amounts sufficient to increase a blood GLP-1 level
in a subject.
[0038] In certain embodiments, the subject is a human.
[0039] In a fourth aspect, the present invention features a method
of preparing a pharmaceutical composition, said method comprising
or consisting essentially of admixing a GPR119 agonist and a DPP-IV
inhibitor, together with at least one pharmaceutically acceptable
carrier. In certain embodiments, the method further comprises the
step of preparing a dosage form of the pharmaceutical composition
wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts
sufficient to lower a blood glucose level in a subject. In certain
embodiments, the blood glucose level is an elevated blood glucose
level. In certain embodiments, the method further comprises the
step of preparing a dosage form of the pharmaceutical composition
wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts
sufficient to increase a blood GLP-1 level in a subject.
[0040] In certain embodiments, the subject is a human.
[0041] In a fifth aspect, the present invention features a
pharmaceutical composition comprising or consisting essentially of
a GPR119 agonist and a DPP-IV inhibitor, together with at least one
pharmaceutically acceptable carrier. In certain embodiments, the
present invention relates to a dosage form of the pharmaceutical
composition wherein the GPR119 agonist and the DPP-IV inhibitor are
in amounts sufficient to lower a blood glucose level in a subject.
In certain embodiments, the blood glucose level is an elevated
blood glucose level. In certain embodiments, the present invention
relates to a dosage form of the pharmaceutical composition wherein
the GPR119 agonist and the DPP-IV inhibitor are in amounts
sufficient to increase a blood GLP-1 level in a subject.
[0042] In certain embodiments, the subject is a human.
[0043] In a sixth aspect, the present invention features a method
of treating or preventing diabetes or a condition related thereto
comprising administering to a subject in need thereof a
therapeutically effective amount of a pharmaceutical composition in
accordance with the fifth aspect. In certain embodiments, the
GPR119 agonist and the DPP-IV inhibitor are administered in amounts
sufficient to lower a blood glucose level in the subject. In
certain embodiments, the blood glucose level is an elevated blood
glucose level.
[0044] The present invention additionally features a method of
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level comprising administering to a subject in need
thereof a therapeutically effective amount of a pharmaceutical
composition in accordance with the fifth aspect. In certain
embodiments, the GPR119 agonist and the DPP-IV inhibitor are
administered in amounts sufficient to increase a blood GLP-1 level
in the subject.
[0045] The present invention additionally features a method of
increasing a blood GLP-1 level comprising administering to a
subject deficient in GLP-1 a therapeutically effective amount of a
pharmaceutical composition in accordance with the fifth aspect. In
certain embodiments, the GPR119 agonist and the DPP-IV inhibitor
are administered in amounts sufficient to increase a blood GLP-1
level in the subject.
[0046] In certain embodiments, the subject is a human.
[0047] In a seventh aspect, the present invention features use of a
composition comprising or consisting essentially of a GPR119
agonist and a DPP-IV inhibitor for the manufacture of a medicament
for the treatment or prevention of diabetes or a condition related
thereto. In certain embodiments, the present invention relates to a
dosage form of the medicament wherein the GPR119 agonist and the
DPP-IV inhibitor are in amounts sufficient to lower a blood glucose
level in a subject. In certain embodiments, the blood glucose level
is an elevated blood glucose level.
[0048] The present invention additionally features use of a
composition comprising or consisting essentially of a GPR119
agonist and a DPP-IV inhibitor for the manufacture of a medicament
for the treatment or prevention of a condition ameliorated by
increasing a blood GLP-1 level. In certain embodiments, the present
invention relates to a dosage form of the medicament wherein the
GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient
to increase a blood GLP-1 level in a subject.
[0049] The present invention additionally features use of a
composition comprising or consisting essentially of a GPR119
agonist and a DPP-IV inhibitor for the manufacture of a medicament
for the treatment or prevention of a deficiency of GLP-1. In
certain embodiments, the present invention relates to a dosage form
of the medicament wherein the GPR119 agonist and the DPP-IV
inhibitor are in amounts sufficient to increase a blood GLP-1 level
in a subject.
[0050] In certain embodiments, the subject is a human.
[0051] In an eighth aspect, the invention features a method for
identifying GLP-1 secretagogues or compounds useful for treating or
preventing a condition ameliorated by increasing a blood GLP-1
level, comprising the steps of: [0052] (a) contacting a test
compound with a host cell or with membrane of a host cell that
expresses a G protein-coupled receptor, wherein the G
protein-coupled receptor comprises an amino acid sequence selected
from the group consisting of: [0053] (i) amino acids 1-335 of SEQ
ID NO:2; [0054] (ii) amino acids 2-335 of SEQ ID NO:2; [0055] (iii)
amino acids 2-335 of SEQ ID NO:2, with the proviso that the
receptor does not comprise the amino acid sequence of SEQ ID NO:2;
[0056] (iv) the amino acid sequence of a G protein-coupled receptor
encoded by a polynucleotide comprising a nucleotide sequence, said
nucleotide sequence being the sequence obtainable by a process
comprising performing polymerase chain reaction (PCR) on a human
DNA sample using specific primers SEQ ID NO:3 and SEQ ID NO:4;
[0057] (v) the amino acid sequence of a G protein-coupled receptor
encoded by a polynucleotide comprising a nucleotide sequence, said
nucleotide sequence hybridizing under stringent conditions to the
complement of SEQ ID NO:1; and [0058] (vi) a biologically active
fragment of any one of (i) to (v); and [0059] (b) determining the
ability of the test compound to stimulate functionality of the
receptor; wherein the ability of the test compound to stimulate
functionality of the receptor is indicative of the test compound
being a GLP-1 secretagogue or a compound useful for preventing or
treating a condition ameliorated by increasing a blood GLP-1
level.
[0060] The invention additionally features a method for identifying
GLP-1 secretagogues or compounds useful for treating or preventing
a condition ameliorated by increasing a blood GLP-1 level,
comprising steps (a) and (b) of this eighth aspect, and further
comprising: [0061] (c) contacting a compound which stimulates
functionality of the receptor in step (b) in vitro with a mammalian
enteroendocrine cell; and [0062] (d) determining whether the
compound stimulates GLP-1 secretion from the mammalian
enteroendocrine cell; wherein the ability of the test compound to
stimulate GLP-1 secretion from the mammalian enteroendocrine cell
is indicative of the test compound being a GLP-1 secretagogue or a
compound useful for treating or preventing a condition ameliorated
by increasing a blood GLP-1 level.
[0063] The invention additionally features a method for identifying
GLP-1 secretagogues or compounds useful for treating or preventing
a condition ameliorated by increasing a blood GLP-1 level,
comprising steps (a) and (b) of this eighth aspect, and further
comprising: [0064] (c) administering a compound which stimulates
functionality of the receptor in step (b) to a mammal; and [0065]
(d) determining whether the compound increases a blood GLP-1 level
in the mammal; wherein the ability of the test compound to increase
a blood GLP-1 level in the mammal is indicative of the test
compound being a GLP-1 secretagogue or a compound useful for
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level. In certain embodiments, the mammal is a
non-human mammal.
[0066] In certain embodiments, the identified GLP-1 secretagogue or
the identified compound useful for treating or preventing a
condition ameliorated by increasing a blood GLP-1 level is an
agonist of the receptor. In some embodiments, the agonist is a
partial agonist.
[0067] In certain embodiments, the receptor is coupled to a G
protein. In certain embodiments, the G protein is Gs.
[0068] In certain embodiments, the human DNA sample is human
genomic DNA.
[0069] In certain embodiments, the process is RT-PCR (reverse
transcription-polymerase chain reaction). RT-PCR techniques are
well known to the skilled artisan.
[0070] In certain embodiments, the human DNA sample is human cDNA.
In certain embodiments, the cDNA is from a human tissue that
expresses GPR119. In some embodiments, the human tissue that
expresses GPR119 is pancreas, pancreatic islet, colon, small
intestine, or fetal liver. In certain embodiments, the cDNA is from
a human cell type that expresses GPR119. In some embodiments, the
cDNA is from a pancreatic beta cell line or an enteroendocrine cell
line.
[0071] In certain embodiments, stringent hybridization conditions
comprise hybridization at 42.degree. C. in a solution comprising
50% formamide, 5.times.SSC (150 mM NaCl, 15 mM trisodium citrate),
50 mM sodium phosphate (pH 7.6), 5.times.Denhardt's solution, 10%
dextran sulfate, and 20 .mu.g/ml denatured, sheared salmon sperm
DNA, followed by washing at 65.degree. C. in a solution comprising
0.1.times.SSC. Hybridization techniques are well known to the
skilled artisan.
[0072] In certain embodiments, the G protein-coupled receptor
encoded by a polynucleotide comprising a nucleotide sequence, said
nucleotide sequence hybridizing under stringent conditions to the
complement of SEQ ID NO:1, exhibits a biological activity selected
from the group consisting of increasing a level of intracellular
cAMP and binding a known ligand of GPR119. In certain embodiments,
the encoded G protein-coupled receptor increases a level of
intracellular cAMP and binds a known ligand of GPR119.
[0073] In some embodiments, the G protein-coupled receptor is part
of a fusion protein comprising a G protein. Techniques for making a
GPCR:G fusion construct are well known to the skilled artisan (see,
e.g., International Application WO 02/42461).
[0074] In some embodiments, the G protein-coupled receptor is
recombinant.
[0075] In certain embodiments, the host cell comprises an
expression vector, said expression vector comprising a
polynucleotide encoding the G protein-coupled receptor. In some
embodiments, the expression vector is pCMV. This vector was
deposited with the American Type Culture Collection (ATCC) on Oct.
13, 1998 (10801 University Blvd., Manassas, Va. 20110-2209 USA)
under the provisions of the Budapest Treaty for the International
Recognition of the Deposit of Microorganisms for the Purpose of
Patent Procedure. The DNA was tested by the ATCC and determined to
be viable. The ATCC has assigned the following deposit number to
pCMV: ATCC #203351. Other suitable expression vectors will be
readily apparent to those of ordinary skill in the art, and a wide
variety of expression vectors are commercially available (e.g.,
from Clontech, Palo Alto, Calif.; Stratagene, La Jolla, Calif.; and
Invitrogen, Carlsbad, Calif.).
[0076] In some embodiments, the host cell is mammalian. In some
embodiments, the mammalian host cell is selected from the group
consisting of 293, 293T, CHO, MCB3901, and COS-7. In some
embodiments, the host cell is melanophore. In some embodiments, the
host cell is an enteroendocrine cell. In some embodiments, the
enteroendocrine cell is GLUTag-Fro cell line. Other suitable host
cells will be readily apparent to those of ordinary skill in the
art, and a wide variety of cell lines are available from the
American Type Culture Collection, 10801 University Boulevard,
Manassas, Va. 20110-2209.
[0077] In certain embodiments, said determining is consistent with
the G protein-coupled receptor being a Gs-coupled receptor.
[0078] In some embodiments, said determining is consistent with the
G protein-coupled receptor being coupled through a promiscuous G
protein, such as G.alpha.15 or G.alpha.16, to the phopholipase C
pathway. Promiscuous G proteins are well known to the skilled
artisan [see, e.g., Offermanns et al., J Biol Chem (1995)
270:15175-15180]. In some embodiments, said determining is
consistent with the G protein-coupled receptor being coupled
through a chimeric G protein, e.g. to the phospholipase C pathway.
Chimeric G proteins are well known to the skilled artisan [see,
e.g., Milligan et al., Trends in Pharmaceutical Sciences (1999)
20:118-124; and WO 02/42461].
[0079] In some embodiments, said determining is through the
measurement of a level of a second messenger selected from the
group consisting of cyclic AMP (cAMP), cyclic GMP (cGMP), inositol
1,4,5-triphosphate (IP3), diacylglycerol (DAG), MAP kinase
activity, MAPK/ERK kinase kinase-1 (MEKK1) activity, and Ca2+. In
some preferred embodiments, the second messenger is cAMP. In
certain preferred embodiments, a level of intracellular cAMP is
elevated.
[0080] In certain embodiments, said determining is carried out with
membrane comprising the G protein-coupled receptor.
[0081] In certain embodiments, said determining is through the use
of a melanophore assay. In some preferred embodiments, a level of
pigment dispersion is elevated.
[0082] In some embodiments, said determining is through the
measurement of an activity mediated by elevation of a level of
intracellular cAMP. In some embodiments, said activity is
stimulation of GLP-1 secretion.
[0083] In some embodiments, said determining is through CRE-Luc
reporter assay. In some preferred embodiments, a level of
luciferase activity is elevated.
[0084] In some embodiments, said determining is through the
measurement of GTP.gamma.S binding to membrane comprising the G
protein-coupled receptor. In some preferred embodiments, said
GTP.gamma.S is labeled with [.sup.35S]. In some preferred
embodiments, said GTP.gamma.S binding to membrane comprising the
GPCR is elevated.
[0085] In some embodiments, the test compound is a small molecule.
In some embodiments, the test compound is a small molecule, with
the proviso that the small molecule is not a polypeptide. In some
embodiments, the test compound is a small molecule, with the
proviso that the small molecule is not an antibody or an
antigen-binding fragment thereof. In some embodiments, the test
compound is a small molecule, with the proviso that the small
molecule is not a lipid. In some embodiments, the test compound is
a small molecule, with the proviso that the small molecule is not a
polypeptide or a lipid. In some embodiments, the test compound is a
polypeptide. In some embodiments, the test compound is a
polypeptide, with the proviso that the polypeptide is not an
antibody or an antigen-binding fragment thereof. In some
embodiments, the test compound is a lipid. In some embodiments, the
test compound is not an antibody or an antigen-binding fragment
thereof. In some embodiments, the test compound is an antibody or
an antigen-binding fragment thereof.
[0086] In some embodiments, the method further comprises
synthesizing the GLP-1 secretagogue or the compound useful for
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level.
[0087] In some embodiments, the method further comprises:
optionally, determining the structure of the GLP-1 secretagogue or
the compound useful for treating or preventing a condition
ameliorated by increasing a blood GLP-1 level; and providing the
GLP-1 secretagogue or the compound useful for treating or
preventing a condition ameliorated by increasing a blood GLP-1
level or providing the name or structure of the GLP-1 secretagogue
or the compound useful for treating or preventing a condition
ameliorated by increasing a blood GLP-1 level.
[0088] In some embodiments, said method further comprises:
optionally, determining the structure of the GLP-1 secretagogue or
the compound useful for treating or preventing a condition
ameliorated by increasing a blood GLP-1 level; optionally,
providing the name or structure of the GLP-1 secretagogue or the
compound useful for treating or preventing a condition ameliorated
by increasing a blood GLP-1 level; and producing or synthesizing
the GLP-1 secretagogue or the compound useful for treating or
preventing a condition ameliorated by increasing a blood GLP-1
level.
[0089] In some embodiments, said method further comprises the step
of formulating the GLP-1 secretagogue or the compound useful for
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level into a pharmaceutical composition.
[0090] In a ninth aspect, the invention features a method for
identifying GLP-1 secretagogues or compounds useful for treating or
preventing a condition ameliorated by increasing a blood GLP-1
level, comprising the steps of: [0091] (a) contacting a G
protein-coupled receptor with an optionally labeled known ligand to
the receptor in the presence or absence of a test compound, wherein
the G protein-coupled receptor comprises an amino acid sequence
selected from the group consisting of: [0092] (i) amino acids 1-335
of SEQ ID NO:2; [0093] (ii) amino acids 2-335 of SEQ ID NO:2;
[0094] (iii) amino acids 2-335 of SEQ ID NO:2, with the proviso
that the receptor does not comprise the amino acid sequence of SEQ
ID NO:2; [0095] (iv) the amino acid sequence of a G protein-coupled
receptor encoded by a polynucleotide comprising a nucleotide
sequence, said nucleotide sequence being the sequence obtainable by
a process comprising performing polymerase chain reaction (PCR) on
a human DNA sample using specific primers SEQ ID NO:3 and SEQ ID
NO:4; [0096] (v) the amino acid sequence of a G protein-coupled
receptor encoded by a polynucleotide comprising a nucleotide
sequence, said nucleotide sequence hybridizing under stringent
conditions to the complement of SEQ ID NO:1; and [0097] (vi) a
biologically active fragment of any one of (i) to (v); and [0098]
(b) detecting the complex between said known ligand and said
receptor; and [0099] (c) determining whether less of said complex
is formed in the presence of the test compound than in the absence
of the test compound; wherein said determination is indicative of
the test compound being a GLP-1 secretagogue or a compound useful
for preventing or treating a condition ameliorated by increasing a
blood GLP-1 level.
[0100] In certain embodiments, the optionally labeled known ligand
is a labeled known ligand. In certain embodiments, the labeled
known ligand is a radiolabeled known ligand. Techniques for
radiolabeling a compound, such as for labeling a known ligand of a
G protein-coupled receptor of the invention, are well known to the
skilled artisan. See, e.g., International Application WO
04/065380.
[0101] Techniques for detecting the complex between a G
protein-coupled receptor and a compound known to be a ligand of the
G protein-coupled receptor are well known to the skilled artisan.
See, e.g., International Application WO 04/065380.
[0102] The invention additionally features a method for identifying
GLP-1 secretagogues or compounds useful for treating or preventing
a condition ameliorated by increasing a blood GLP-1 level,
comprising steps (a) to (c) of this ninth aspect, and further
comprising: [0103] (d) contacting a compound in the presence of
which less of said complex is formed in step (c) in vitro with a
mammalian enteroendocrine cell; and [0104] (e) determining whether
the compound stimulates GLP-1 secretion from the mammalian
enteroendocrine cell; wherein the ability of the test compound to
stimulate GLP-1 secretion from the mammalian enteroendocrine cell
is indicative of the test compound being a GLP-1 secretagogue or a
compound useful for treating or preventing a condition ameliorated
by increasing a blood GLP-1 level.
[0105] The invention additionally features a method for identifying
GLP-1 secretagogues or compounds useful for treating or preventing
a condition ameliorated by increasing a blood GLP-1 level,
comprising steps (a) to (c) of this ninth aspect, and further
comprising: [0106] (d) administering a compound in the presence of
which less of said complex is formed in step (c) to a mammal; and
[0107] (e) determining whether the compound increases a blood GLP-1
level in the mammal; wherein the ability of the test compound to
increase a blood GLP-1 level in the mammal is indicative of the
test compound being a GLP-1 secretagogue or a compound useful for
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level. In certain embodiments, the mammal is a
non-human mammal.
[0108] In certain embodiments, the receptor is recombinant.
[0109] In some embodiments, the test compound is a small molecule.
In some embodiments, the test compound is a small molecule, with
the proviso that the small molecule is not a polypeptide. In some
embodiments, the test compound is a small molecule, with the
proviso that the small molecule is not an antibody or an
antigen-binding fragment thereof. In some embodiments, the test
compound is a small molecule, with the proviso that the small
molecule is not a lipid. In some embodiments, the test compound is
a small molecule, with the proviso that the small molecule is not a
polypeptide or a lipid. In some embodiments, the test compound is a
polypeptide. In some embodiments, the test compound is a
polypeptide, with the proviso that the polypeptide is not an
antibody or an antigen-binding fragment thereof. In some
embodiments, the test compound is a lipid. In some embodiments, the
test compound is not an antibody or an antigen-binding fragment
thereof. In some embodiments, the test compound is an antibody or
an antigen-binding fragment thereof.
[0110] In some embodiments, the method further comprises
synthesizing the GLP-1 secretagogue or the compound useful for
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level.
[0111] In some embodiments, the method further comprises:
optionally, determining the structure of the GLP-1 secretagogue or
the compound useful for treating or preventing a condition
ameliorated by increasing a blood GLP-1 level; and providing the
GLP-1 secretagogue or the compound useful for treating or
preventing a condition ameliorated by increasing a blood GLP-1
level or providing the name or structure of the GLP-1 secretagogue
or the compound useful for treating or preventing a condition
ameliorated by increasing a blood GLP-1 level.
[0112] In some embodiments, said method further comprises:
optionally, determining the structure of the GLP-1 secretagogue or
the compound useful for treating or preventing a condition
ameliorated by increasing a blood GLP-1 level; optionally,
providing the name or structure of the GLP-1 secretagogue or the
compound useful for treating or preventing a condition ameliorated
by increasing a blood GLP-1 level; and producing or synthesizing
the GLP-1 secretagogue or the compound useful for treating or
preventing a condition ameliorated by increasing a blood GLP-1
level.
[0113] In some embodiments, said method further comprises the step
of formulating the GLP-1 secretagogue or the compound useful for
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level into a pharmaceutical composition.
[0114] This application claims the benefit of priority from the
following provisional applications, filed via U.S. Express mail
with the United States Patent and Trademark Office on the indicated
dates: U.S. Provisional No. 60/643,086, filed Jan. 10, 2005; U.S.
Provisional No. 60/683,172, filed May 19, 2005; and U.S.
Provisional No. 60/726,880, filed Oct. 14, 2005. The disclosure of
each of the foregoing applications is herein incorporated by
reference in its entirety.
BRIEF DESCRIPTION OF THE DRAWINGS
[0115] The invention is illustrated in connection with the figures
appended hereto in which:
[0116] FIG. 1 shows a synergistic effect of GPR119 agonist and
DPP-IV inhibitor in lowering an elevated blood glucose level in
oral glucose tolerance test (oGTT) in mice. See Example 1.
[0117] FIG. 2 shows a synergistic effect of GPR119 agonist and
DPP-IV inhibitor in increasing a blood GLP-1 level after glucose
challenge in mice. See Example 3.
[0118] FIG. 3 shows expression of GPR119 in gut. See Example
10.
[0119] FIG. 4 shows expression of GPR119 in GLUTag enteroendocrine
cell line. See Example 11.
[0120] FIG. 5 shows elevation of the level of intracellular cAMP in
GLUTag enteroendocrine cells by GPR119 agonist. See Example 12.
[0121] FIG. 6 shows stimulation of GLP-1 secretion in GLUTag
enterendocrine cells by GPR119 agonist. See Example 13.
[0122] FIG. 7 shows an effect of GPR119 agonist AR244061 and DPP-IV
inhibitor MK-0431 in lowering blood glucose level in oral glucose
tolerance test (oGTT) in mice. See Example 14.
[0123] FIG. 8 shows an effect of GPR119 agonist AR244061 and DPP-IV
inhibitor LAF237 in lowering blood glucose level in oral glucose
tolerance test (oGTT) in mice. See Example 14.
[0124] FIG. 9 shows an effect of GPR119 agonist AR244061 and DPP-IV
inhibitor FE107542 in lowering blood glucose level in oral glucose
tolerance test (oGTT) in mice. See Example 14.
DETAILED DESCRIPTION OF THE INVENTION
[0125] This invention is concerned with the combination of certain
compounds, or pharmaceutically acceptable salts thereof, for the
treatment or prevention of diabetes and conditions related thereto.
This invention is further concerned with the combination of certain
compounds, or pharmaceutically acceptable salts thereof, for the
treatment or prevention of a condition ameliorated by increasing a
blood GLP-1 level. Applicant has found that an amount of a GPR119
agonist in combination with an amount of a DPP-IV inhibitor can
provide an unexpected synergistic effect in lowering a blood
glucose level in a subject over that provided by the amount of the
GPR119 agonist alone or by the amount of the DPP-IV inhibitor
alone. Applicant has additionally found that an amount of a GPR119
agonist in combination with an amount of a DPP-IV inhibitor can
provide an unexpected synergistic effect in increasing a blood
GLP-1 level in a subject over that provided by the amount of the
GPR119 agonist alone or by the amount of the DPP-IV inhibitor
alone. Applicant has additionally discovered that GPR119 is a GLP-1
secretagogue receptor.
[0126] By the use of a combination of a GPR119 agonist and a DPP-IV
inhibitor in accordance with the present invention, it is possible
to treat or prevent diabetes and conditions related thereto with a
dose of a DPP-IV inhibitor substantially lower than that currently
contemplated for use in therapy for diabetes and conditions related
thereto, thereby reducing the likelihood of unwanted side-effects
associated with inhibition of DPP-IV activity. By the use of a
combination of a GPR119 agonist and a DPP-IV inhibitor in
accordance with the present invention, it is possible to treat or
prevent a condition ameliorated by increasing a blood GLP-1 level
with a dose of a DPP-IV inhibitor substantially lower than that
currently contemplated for use in therapy for said condition,
thereby reducing the likelihood of unwanted side-effects associated
with inhibition of DPP-IV activity. Furthermore, by the use of a
combination of a GPR119 agonist and a DPP-IV inhibitor in
accordance with the present invention, it is possible to treat or
prevent diabetes and conditions related thereto with a dose of a
GPR119 agonist substantially lower than that currently contemplated
for use in therapy for diabetes and conditions related thereto,
thereby reducing the likelihood of unwanted side-effects should any
be found to be associated with activation of GPR119 receptor. The
present invention provides a new, unexpected and advantageous
approach to lowering a blood glucose level in a subject. The
present invention additionally provides a new, unexpected and
advantageous approach to increasing a blood GLP-1 level in a
subject.
[0127] The term "ligand", as used herein, shall mean a molecule
that specifically binds to a GPCR. A ligand may be, for example, a
polypeptide, a lipid, a small molecule, an antibody. An endogenous
ligand is a ligand that is an endogenous, natural ligand for a
native GPCR. A ligand may be a GPCR "antagonist", "agonist",
"partial agonist", or "inverse agonist", or the like.
[0128] The term "agonist", as used herein, shall mean an agent
(e.g., ligand, candidate compound) that by virtue of binding to a
GPCR activates the GPCR so as to elicit an intracellular response
mediated by the GPCR.
[0129] The term "partial agonist", as used herein, shall mean an
agent (e.g., ligand, candidate compound) that by virtue of binding
to a GPCR activates the GPCR so as to elicit an intracellular
response mediated by the GPCR, albeit to a lesser exent or degree
than does a full agonist.
[0130] The term "antagonist" shall mean an agent (e.g., ligand,
candidate compound) that binds, and preferably binds competitively,
to a GPCR at about the same site as an agonist or partial agonist
but which does not activate an intracellular response initiated by
the active form of the GPCR, and can thereby inhibit the
intracellular response by agonist or partial agonist. An
anatagonist typically does not diminish the baseline intracellular
response in the absence of an agonist or partial agonist.
[0131] The term "inverse agonist" shall mean an agent (e.g.,
ligand, candidate compound) which binds to a GPCR and which
inhibits the baseline intracellular response initiated by the
active form of the receptor below the normal base level activity
which is observed in the absence of an agonist or partial
agonist.
[0132] The term "GPR119 agonist," as used herein, refers to a
compound that binds to GPR119 receptor and acts as an agonist.
[0133] The term "selective GPR119 agonist," as used herein, refers
to a GPR119 agonist having selectivity for GPR119 receptor over one
or more closely related receptors, such as corticotrophin-releasing
factor-1 (CRF-1) receptor.
[0134] The term "DPP-IV inhibitor," as used herein, refers to a
compound that binds to DPP-IV and inhibits DPP-IV dipeptidyl
peptidase activity.
[0135] The term "selective DPP-IV inhibitor," as used herein,
refers to a DPP-IV inhibitor having selectivity for DPP-IV over
closely related peptidases, such as one or more of
post-proline-cleaving enzyme (PPCE), dipeptidyl peptidase II
(DPP-II), dipeptidyl peptidase 8 (DPP-8), and dipeptidyl peptidase
9 (DPP-9).
[0136] The term "blood glucose level" or "blood GLP-1 level" shall
mean blood glucose concentration or blood GLP-1 concentration,
respectively. In certain embodiments, blood GLP-1 level is a level
in blood of biologically active GLP-1, wherein GLP-1 having agonist
activity at GLP-1R is biologically active. In certain embodiments,
a blood glucose level or blood GLP-1 level is a plasma glucose
level or a plasma GLP-1 level.
[0137] The term "elevated blood glucose level" shall mean an
elevated blood glucose level such as that found in a subject
demonstrating clinically inappropriate basal and postprandial
hyperglycemia or such as that found in a subject in oral glucose
tolerance test (oGTT).
[0138] The term "subject," as used herein, shall refer to a mammal,
including but not limited to a mouse, a rat, a rabbit, a pig, a
dog, a cat, a non-human primate and a human, more preferably to a
mouse or rat, most preferably to a human.
[0139] The term "in need of prevention or treatment" as used herein
refers to a judgement made by a caregiver (e.g. physician, nurse,
nurse practitioner in the case of humans; veterinarian in the case
of non-human mammals) that a subject requires or will benefit from
treatment.
[0140] The term "therapeutically effective amount" or
"therapeutically effective dose" is intended to mean that amount of
drug that will elicit the desired biological or medical response.
In certain embodiments, a therapeutically effective amount is that
amount of drug which will create an AUC inhibition above 30% in
mouse oGTT assay.
[0141] The term "therapeutically ineffective amount" or
"therapeutically ineffective dose" is intended to mean an amount of
drug less than the therapeutically effective amount of the drug. In
certain embodiments, a therapeutically ineffective amount is an
amount of drug which will create an AUC inhibition less than or
equal to 30% in mouse oGTT assay.
[0142] The term "amount that is effective to prevent" refers to
that amount of drug that will prevent or reduce the risk of
occurrence of the biological or medical event that is sought to be
prevented. In many instances, the amount that is effective to
prevent is the same as the therapeutically effective amount.
[0143] The term "composition" shall mean a material comprising at
least one component.
[0144] The term "active ingredient" shall mean any component that
provides pharmacological activity or other direct effect in the
diagnosis, cure, mitigation, treatment, or prevention of
disease.
[0145] The term "pharmaceutical composition" shall mean a
composition comprising at least one active ingredient, whereby the
composition is amenable to investigation and treatment in a
mammal.
[0146] The term "dosage form" shall mean the physical form in which
a drug is produced and dispensed, such as a tablet, capsule, or an
injectable.
[0147] As used herein, the term "diabetes" encompasses both
insulin-dependent diabetes mellitus (also known as Type 1 diabetes)
and non-insulin-dependent diabetes mellitus (also known as Type 2
diabetes).
[0148] The term "condition related to diabetes" is intended to
include but not be limited to hyperglycemia, impaired glucose
tolerance, insulin resistance, pancreatic beta-cell insufficiency,
enteroendocrine cell insufficiency, glucosuria, metabolic acidosis,
cataracts, diabetic nephropathy, diabetic neuropathy, diabetic
retinopathy, diabetic coronary artery disease, diabetic
cerebrovascular disease, diabetic peripheral vascular disease,
metabolic syndrome, hyperlipidemia, atherosclerosis, stroke,
hypertension, and obesity, where it is understood that conditions
related to diabetes can be included in embodiments individually or
in any combination.
[0149] The term "condition ameliorated by increasing a blood GLP-1
level" is intended to include but not be limited to diabetes, a
condition related to diabetes, myocardial infarction, learning
impairment, memory impairment, and a neurodegenerative disorder,
where it is understood that conditions ameliorated by increasing a
blood GLP-1 level can be included in embodiments individually or in
any combination.
[0150] The term "atherosclerosis" as used herein refers to a form
of vascular disease characterized by the deposition of atheromatous
plaques containing cholesterol and lipids on the innermost layer of
the walls of large and medium-sized arteries.
[0151] The term "metabolic syndrome" as defined herein, and
according to the Adult Treatment Panel III (ATP III; National
Institutes of Health: Third Report of the National Cholesterol
Education Program Expert Panel on Detection, Evaluation, and
Treatment of High Blood Cholesterol in Adults (Adult Treatment
Panel III), Executive Summary; Bethesda, Md., National Institutes
of Health, National Heart, Lung and Blood Institute, 2001 (NIH pub.
No 01-3670), occurs when a person meets three or more of five
criteria related to obesity, hypertriglyceridemia, low HDL
cholesterol, high blood pressure, and high fasting glucose.
[0152] The term "neurodegenerative disorder" is intended to include
but not be limited to excitotoxic brain damage caused by severe
epileptic seizures, Alzheimer's disease, Parkinson's disease,
Huntington's disease, prion-associated disease, stroke,
motor-neuron disease, learning or memory impairment, traumatic
brain injury, spinal cord injury, and peripheral neuropathy.
[0153] The term "obesity," as used herein, is defined as a body
mass index (BMI) of 30.0 or greater, in accordance with the WHO
classifications of weight [Kopelman, Nature (2000) 404:635-643; the
disclosure of which is herein incorporated by reference in its
entirety].
[0154] The term "C.sub.1-5 acyl" denotes a C.sub.1-5 alkyl radical
attached to a carbonyl wherein the definition of alkyl has the same
definition as described herein; some examples include but not
limited to, acetyl, propionyl, n-butanoyl, iso-butanoyl,
sec-butanoyl, t-butanoyl (i.e., pivaloyl), pentanoyl and the
like.
[0155] The term "C.sub.1-5 acyloxy" denotes an acyl radical
attached to an oxygen atom wherein acyl has the same definition has
described herein; some examples include but not limited to
acetyloxy, propionyloxy, butanoyloxy, iso-butanoyloxy,
sec-butanoyloxy, t-butanoyloxy and the like.
[0156] The term "C.sub.1-6 acylsulfonamide" refers to a C.sub.1-6
acyl attached directly to the nitrogen of the sulfonamide, wherein
the definitions for C.sub.1-6 acyl and sulfonamide have the same
meaning as described herein, and a C.sub.1-6 acylsulfonamide can be
represented by the following formula:
##STR00001##
Some embodiments of the present invention are when acylsulfonamide
is a C.sub.1-5 acylsulfonamide, some embodiments are C.sub.1-4
acylsulfonamide, some embodiments are C.sub.1-3 acylsulfonamide,
and some embodiments are C.sub.1-2 acylsulfonamide. Examples of an
acylsulfonamide include, but not limited to, acetylsulfamoyl
[--S(.dbd.O).sub.2NHC(.dbd.O)Me], propionylsulfamoyl
[--S(.dbd.O).sub.2NHC(.dbd.O)Et], isobutyrylsulfamoyl,
butyrylsulfamoyl, 2-methyl-butyrylsulfamoyl,
3-methyl-butyrylsulfamoyl, 2,2-dimethyl-propionylsulfamoyl,
pentanoylsulfamoyl, 2-methyl-pentanoylsulfamoyl,
3-methyl-pentanoylsulfamoyl, 4-methyl-pentanoylsulfamoyl, and the
like.
[0157] The term "C.sub.2-6 alkenyl" denotes a radical containing 2
to 6 carbons wherein at least one carbon-carbon double bond is
present, some embodiments are 2 to 4 carbons, some embodiments are
2 to 3 carbons, and some embodiments have 2 carbons. Both E and Z
isomers are embraced by the term "alkenyl." Furthermore, the term
"alkenyl" includes di- and tri-alkenyls. Accordingly, if more than
one double bond is present then the bonds may be all E or Z or a
mixtures of E and Z. Examples of an alkenyl include vinyl, allyl,
2-butenyl, 3-butenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl,
2-hexenyl, 3-hexenyl, 4-hexenyl, 5-hexanyl, 2,4-hexadienyl and the
like.
[0158] The term "C.sub.1-4 alkoxy" as used herein denotes a radical
alkyl, as defined herein, attached directly to an oxygen atom.
Examples include methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy,
t-butoxy, iso-butoxy, sec-butoxy and the like.
[0159] The term "C.sub.1-8 alkyl" denotes a straight or branched
carbon radical containing 1 to 8 carbons, some embodiments are 1 to
6 carbons, some embodiments are 1 to 3 carbons, and some
embodiments are 1 or 2 carbons. Examples of an alkyl include, but
not limited to, methyl, ethyl, n-propyl, iso-propyl, n-butyl,
sec-butyl, iso-butyl, t-butyl, pentyl, iso-pentyl, t-pentyl,
neo-pentyl, 1-methylbutyl [i.e.,
--CH(CH.sub.3)CH.sub.2CH.sub.2CH.sub.3], 2-methylbutyl [i.e.,
--CH.sub.2CH(CH.sub.3)CH.sub.2CH.sub.3], n-hexyl and the like.
[0160] The term "C.sub.1-4 alkylcarboxamido" or "C.sub.1-4
alkylcarboxamide" denotes a single C.sub.1-4 alkyl group attached
to the nitrogen of an amide group, wherein alkyl has the same
definition as found herein. The C.sub.1-5 alkylcarboxamido may be
represented by the following:
##STR00002##
Examples include, but not limited to, N-methylcarboxamide,
N-ethylcarboxamide, N-n-propylcarboxamide, N-iso-propylcarboxamide,
N-n-butylcarboxamide, N-sec-butylcarboxamide,
N-iso-butylcarboxamide, N-t-butylcarboxamide and the like.
[0161] The term "C.sub.1-3 alkylene" refers to a C.sub.1-3 divalent
straight carbon group. In some embodiments C.sub.1-3 alkylene
refers to, for example, --CH.sub.2--, --CH.sub.2CH.sub.2--,
--CH.sub.2CH.sub.2CH.sub.2--, and the like. In some embodiments,
C.sub.1-3 alkylene refers to --CH--, --CHCH.sub.2--,
--CHCH.sub.2CH.sub.2--, and the like wherein these examples relate
generally to "A".
[0162] The term "C.sub.1-4 alkylsulfinyl" denotes a C.sub.1-4 alkyl
radical attached to a sulfoxide radical of the formula: --S(O)--
wherein the alkyl radical has the same definition as described
herein. Examples include, but not limited to, methylsulfinyl,
ethylsulfinyl, n-propylsulfinyl, iso-propylsulfinyl,
n-butylsulfinyl, sec-butylsulfinyl, iso-butylsulfinyl, t-butyl, and
the like.
[0163] The term "C.sub.1-4 alkylsulfonamide" refers to the
groups
##STR00003## [0164] wherein C.sub.1-4 alkyl has the same definition
as described herein.
[0165] The term "C.sub.1-4 alkylsulfonyl" denotes a C.sub.1-4 alkyl
radical attached to a sulfone radical of the formula:
--S(O).sub.2-- wherein the alkyl radical has the same definiti+on
as described herein. Examples include, but not limited to,
methylsulfonyl, ethylsulfonyl, n-propylsulfonyl,
iso-propylsulfonyl, n-butylsulfonyl, sec-butylsulfonyl,
iso-butylsulfonyl, t-butyl, and the like.
[0166] The term "C.sub.1-4 alkylthio" denotes a C.sub.1-4 alkyl
radical attached to a sulfide of the formula: --S-- wherein the
alkyl radical has the same definition as described herein. Examples
include, but not limited to, methylsulfanyl (i.e., CH.sub.3S--),
ethylsulfanyl, n-propylsulfanyl, iso-propylsulfanyl,
n-butylsulfanyl, sec-butylsulfanyl, iso-butylsulfanyl, t-butyl, and
the like.
[0167] The term "C.sub.1-4 alkylthiocarboxamide" denotes a
thioamide of the following formulae:
##STR00004##
[0168] wherein C.sub.1-4 alkyl has the same definition as described
herein.
[0169] The term "C.sub.1-4 alkylthioureyl" denotes the group of the
formula: --NC(S)N-- wherein one are both of the nitrogens are
substituted with the same or different C.sub.1-4 alkyl groups and
alkyl has the same definition as described herein. Examples of an
alkylthioureyl include, but not limited to, CH.sub.3NHC(S)NH--,
NH.sub.2C(S)NCH.sub.3--, (CH.sub.3).sub.2N(S)NH--,
(CH.sub.3).sub.2N(S)NH--, (CH.sub.3).sub.2N(S)NCH.sub.3--,
CH.sub.3CH.sub.2NHC(S)NH--, CH.sub.3CH.sub.2NHC(S)NCH.sub.3--, and
the like.
[0170] The term "C.sub.1-4 alkylureyl" denotes the group of the
formula: --NC(O)N-- wherein one are both of the nitrogens are
substituted with the same or different C.sub.1-4 alkyl group
wherein alkyl has the same definition as described herein. Examples
of an alkylureyl include, but not limited to, CH.sub.3NHC(O)NH--,
NH.sub.2C(O)NCH.sub.3--, (CH.sub.3).sub.2N(O)NH--,
(CH.sub.3).sub.2N(O)NH--, (CH.sub.3).sub.2N(O)NCH.sub.3--,
CH.sub.3CH.sub.2NHC(O)NH--, CH.sub.3CH.sub.2NHC(O)NCH.sub.3--, and
the like.
[0171] The term "C.sub.2-6 alkynyl" denotes a radical containing 2
to 6 carbons and at least one carbon-carbon triple bond, some
embodiments are 2 to 4 carbons, some embodiments are 2 to 3
carbons, and some embodiments have 2 carbons. Examples of an
alkynyl include, but not limited to, ethynyl, 1-propynyl,
2-propynyl, 1-butynyl, 2-butynyl, 3-butynyl, 1-pentynyl,
2-pentynyl, 3-pentynyl, 4-pentynyl, 1-hexynyl, 2-hexynyl,
3-hexynyl, 4-hexynyl, 5-hexynyl and the like. The term "alkynyl"
includes di- and tri-ynes.
[0172] The term "amino" denotes the group --NH.sub.2.
[0173] The term "C.sub.1-4 alkylamino" denotes one alkyl radical
attached to an amino radical wherein the alkyl radical has the same
meaning as described herein. Some examples include, but not limited
to, methylamino, ethylamino, n-propylamino, iso-propylamino,
n-butylamino, sec-butylamino, iso-butylamino, t-butylamino, and the
like. Some embodiments are "C.sub.1-2 alkylamino."
[0174] The term "aryl" denotes an aromatic ring radical containing
6 to 10 ring carbons. Examples include phenyl and naphthyl.
[0175] The term "arylalkyl" defines a C.sub.1-C.sub.4 alkylene,
such as --CH.sub.2--, --CH.sub.2CH.sub.2-- and the like, which is
further substituted with an aryl group. Examples of an "arylalkyl"
include benzyl, phenethylene and the like.
[0176] The term "arylcarboxamido" denotes a single aryl group
attached to the nitrogen of an amide group, wherein aryl has the
same definition as found herein. The example is
N-phenylcarboxamide.
[0177] The term "arylureyl" denotes the group --NC(O)N-- where one
of the nitrogens are substituted with an aryl.
[0178] The term "benzyl" denotes the group
--CH.sub.2C.sub.6H.sub.5.
[0179] The term "carbo-C.sub.1-6-alkoxy" refers to a C.sub.1-6
alkyl ester of a carboxylic acid, wherein the alkyl group is as
defined herein. In some embodiments, the carbo-C.sub.1-6-alkoxy
group is bonded to a nitrogen atom and together form a carbamate
group (e.g., N--COO--C.sub.1-6-alkyl). In some embodiments, the
carbo-C.sub.1-6-alkoxy group is an ester (e.g.,
--COO--C.sub.1-6-alkyl). Examples include, but not limited to,
carbomethoxy, carboethoxy, carbopropoxy, carboisopropoxy,
carbobutoxy, carbo-sec-butoxy, carbo-iso-butoxy, carbo-t-butoxy,
carbo-n-pentoxy, carbo-iso-pentoxy, carbo-t-pentoxy,
carbo-neo-pentoxy, carbo-n-hexyloxy, and the like.
[0180] The term "carboxamide" refers to the group --CONH.sub.2.
[0181] The term "carboxy" or "carboxyl" denotes the group
--CO.sub.2H; also referred to as a carboxylic acid group.
[0182] The term "cyano" denotes the group --CN.
[0183] The term "C.sub.3-7 cycloalkenyl" denotes a non-aromatic
ring radical containing 3 to 6 ring carbons and at least one double
bond; some embodiments contain 3 to 5 carbons; some embodiments
contain 3 to 4 carbons. Examples include cyclopropenyl,
cyclobutenyl, cyclopentenyl, cyclopentenyl, cyclohexenyl, and the
like.
[0184] The term "C.sub.3-7 cycloalkyl" denotes a saturated ring
radical containing 3 to 6 carbons; some embodiments contain 3 to 5
carbons; some embodiments contain 3 to 4 carbons. Examples include
cyclopropyl, cyclobutyl, cyclopentyl, cyclopenyl, cyclohexyl,
cycloheptyl and the like.
[0185] The term "C.sub.4-8 diacylamino" denotes an amino group
bonded with two acyl groups defined herein wherein the acyl groups
may be the same or different, such as:
##STR00005##
Examples of C.sub.4-8 diacylamino groups include, but limited to,
diacetylamino, dipropionylamino, acetylpropionylamino and the
like.
[0186] The term "C.sub.2-6 dialkylamino" denotes an amino
substituted with two of the same or different alkyl radicals
wherein alkyl radical has the same definition as described herein.
Some examples include, but not limited to, dimethylamino,
methylethylamino, diethylamino, methylpropylamino,
methylisopropylamino, ethylpropylamino, ethylisopropylamino,
dipropylamino, propylisopropylamino and the like. Some embodiments
are "C.sub.2-4 dialkylamino."
[0187] The term "C.sub.1-4 dialkylcarboxamido" or "C.sub.1-4
dialkylcarboxamide" denotes two alkyl radicals, that are the same
or different, attached to an amide group, wherein alkyl has the
same definition as described herein. A C.sub.1-4 dialkylcarboxamido
may be represented by the following groups:
##STR00006##
wherein C.sub.1-4 has the same definition as described herein.
Examples of a dialkylcarboxamide include, but not limited to,
N,N-dimethylcarboxamide, N-methyl-N-ethylcarboxamide,
N,N-diethylcarboxamide, N-methyl-N-isopropylcarboxamide, and the
like.
[0188] The term "C.sub.2-6 dialkylsulfonamide" refers to one of the
following groups shown below:
##STR00007##
wherein C.sub.1-3 has the same definition as described herein, for
example but not limited to, methyl, ethyl, n-propyl, isopropyl, and
the like.
[0189] The term "C.sub.2-6 dialkylthiocarboxamido" or "C.sub.2-6
dialkylthiocarboxamide" denotes two alkyl radicals, that are the
same or different, attached to a thioamide group, wherein alkyl has
the same definition as described herein. A C.sub.1-4
dialkylthiocarboxamido may be represented by the following
groups:
##STR00008## [0190] Examples of a dialkylthiocarboxamide include,
but not limited to, N,N-dimethylthiocarboxamide,
N-methyl-N-ethylthiocarboxamide and the like.
[0191] The term "C.sub.2-6 dialkylsulfonylamino" refers to an amino
group bonded with two C.sub.1-3 alkylsulfonyl groups as defined
herein.
[0192] The term "ethynylene" refers to the carbon-carbon triple
bond group as represented below:
##STR00009##
[0193] The term "formyl" refers to the group --CHO.
[0194] The term "C.sub.1-4 haloalkoxy" denotes a haloalkyl, as
defined herein, which is directly attached to an oxygen atom.
Examples include, but not limited to, difluoromethoxy,
trifluoromethoxy, 2,2,2-trifluoroethoxy, pentafluoroethoxy and the
like.
[0195] The term "C.sub.1-4 haloalkyl" denotes an C.sub.1-4 alkyl
group, defined herein, wherein the alkyl is substituted with one
halogen up to fully substituted and a fully substituted C.sub.1-4
haloalkyl can be represented by the formula C.sub.nL.sub.2n+1
wherein L is a halogen and "n" is 1, 2, 3 or 4; when more than one
halogen is present then they may be the same or different and
selected from the group consisting of F, Cl, Br and I, preferably
F. Examples of C.sub.1-4 haloalkyl groups include, but not limited
to, fluoromethyl, difluoromethyl, trifluoromethyl,
chlorodifluoromethyl, 2,2,2-trifluoroethyl, pentafluoroethyl and
the like.
[0196] The term "C.sub.1-4 haloalkylcarboxamide" denotes an
alkylcarboxamide group, defined herein, wherein the alkyl is
substituted with one halogen up to fully substituted represented by
the formula wherein L is a halogen and "n" is 1, 2, 3 or 4. When
more than one halogen is present they may be the same or different
and selected from the group consisting of F, Cl, Br and I,
preferably F.
[0197] The term "C.sub.1-4 haloalkylsulfinyl" denotes a haloalkyl
radical attached to a sulfoxide group of the formula: --S(O)--
wherein the haloalkyl radical has the same definition as described
herein. Examples include, but not limited to,
trifluoromethylsulfinyl, 2,2,2-trifluoroethylsulfinyl,
2,2-difluoroethylsulfinyl and the like.
[0198] The term "C.sub.1-4 haloalkylsulfonyl" denotes a haloalkyl
radical attached to a sulfone group of the formula: --S(O).sub.2--
wherein haloalkyl has the same definition as described herein.
Examples include, but not limited to, trifluoromethylsulfonyl,
2,2,2-trifluoroethylsulfonyl, 2,2-difluoroethylsulfonyl and the
like.
[0199] The term "C.sub.1-4 haloalkylthio" denotes a haloalkyl
radicaol directly attached to a sulfur wherein the haloalkyl has
the same meaning as described herein. Examples include, but not
limited to, trifluoromethylthio (i.e., CF.sub.3S--),
1,1-difluoroethylthio, 2,2,2-trifluoroethylthio and the like.
[0200] The term "halogen" or "halo" denotes to a fluoro, chloro,
bromo or iodo group.
[0201] The term "C.sub.1-2 heteroalkylene" refers to a C.sub.1-2
alkylene bonded to a heteroatom selected from O, S, S(O),
S(O).sub.2 and NH. Some represented examples include, but not
limited to, the groups of the following formulae:
##STR00010##
[0202] and the like.
[0203] The term "heteroaryl" denotes an aromatic ring system that
may be a single ring, two fused rings or three fused rings wherein
at least one ring carbon is replaced with a heteroatom selected
from, but not limited to, the group consisting of O, S and N
wherein the N can be optionally substituted with H, C.sub.1-4 acyl
or C.sub.1-4 alkyl. Examples of heteroaryl groups include, but not
limited to, pyridyl, benzofuranyl, pyrazinyl, pyridazinyl,
pyrimidinyl, triazinyl, quinoline, benzoxazole, benzothiazole,
1H-benzimidazole, isoquinoline, quinazoline, quinoxaline and the
like. In some embodiments, the heteroaryl atom is O, S, NH,
examples include, but not limited to, pyrrole, indole, and the
like.
[0204] The term "heterocyclic" denotes a non-aromatic carbon ring
(i.e., cycloalkyl or cycloalkenyl as defined herein) wherein one,
two or three ring carbons are replaced by a heteroatom selected
from, but not limited to, the group consisting of O, S, N, wherein
the N can be optionally substituted with H, C.sub.1-4 acyl or
C.sub.1-4 alkyl, and ring carbon atoms optionally substituted with
oxo or a thiooxo thus forming a carbonyl or thiocarbonyl group. The
heterocyclic group is a 3-, 4-, 5-, 6- or 7-membered containing
ring. Examples of a heterocyclic group include but not limited to
aziridin-1-yl, aziridin-2-yl, azetidin-1-yl, azetidin-2-yl,
azetidin-3-yl, piperidin-1-yl, piperidin-4-yl, morpholin-4-yl,
piperzin-1-yl, piperzin-4-yl, pyrrolidin-1-yl, pyrrolidin-3-yl,
[1,3]-dioxolan-2-yl and the like.
[0205] The term "heterocyclic-carbonyl" denotes a heterocyclic
group, as defined herein, directly bonded to the carbon of a
carbonyl group (i.e., C.dbd.O). In some embodiments, a ring
nitrogen of the heterocyclic group is bonded to the carbonyl group
forming an amide. Examples include, but not limited to,
##STR00011##
and the like.
[0206] In some embodiments, a ring carbon is bonded to the carbonyl
group forming a ketone group.
[0207] Examples include, but not limited to,
##STR00012##
and the like.
[0208] The term "heterocyclic-oxy" refers to a heterocyclic group,
as defined herein, that is directly bonded to an oxygen atom.
Examples include the following:
##STR00013##
and the like.
[0209] The term "heterocycliccarboxamido" denotes a heterocyclic
group, as defined herein, with a ring nitrogen where the ring
nitrogen is bonded directly to the carbonyl forming an amide.
Examples include, but not limited to,
##STR00014##
and the like.
[0210] The term "heterocyclicsulfonyl" denotes a heterocyclic
group, as defined herein, with a ring nitrogen where the ring
nitrogen is bonded directly to an SO.sub.2 group forming an
sulfonamide. Examples include, but not limited to,
##STR00015##
and the like.
[0211] The term "hydroxyl" refers to the group --OH.
[0212] The term "hydroxylamino" refers to the group --NHOH.
[0213] The term "nitro" refers to the group --NO.sub.2.
[0214] The term "C.sub.4-7 oxo-cycloalkyl" refers to a C.sub.4-7
cycloalkyl, as defined herein, wherein one of the ring carbons is
replaced with a carbonyl. Examples of C.sub.4-7 oxo-cycloalkyl
include, but are not limited to, 2-oxo-cyclobutyl,
3-oxo-cyclobutyl, 3-oxo-cyclopentyl, 4-oxo-cyclohexyl, and the like
and represented by the following structures respectively:
##STR00016##
[0215] The term "perfluoroalkyl" denotes the group of the formula
--C.sub.nF.sub.2n+1; stated differently, a perfluoroalkyl is an
alkyl as defined herein wherein the alkyl is fully substituted with
fluorine atoms and is therefore considered a subset of haloalkyl.
Examples of perfluoroalkyls include CF.sub.3, CF.sub.2CF.sub.3,
CF.sub.2CF.sub.2CF.sub.3, CF(CF.sub.3).sub.2,
CF.sub.2CF.sub.2CF.sub.2CF.sub.3, CF.sub.2CF(CF.sub.3).sub.2,
CF(CF.sub.3)CF.sub.2CF.sub.3 and the like.
[0216] The term "phenoxy" refers to the group
C.sub.6H.sub.5O--.
[0217] The term "phenyl" refers to the group C.sub.6H.sub.5--.
[0218] The term "phosphonooxy" refers to a group with the following
chemical structure:
##STR00017##
[0219] The term "sulfonamide" refers to the group
--SO.sub.2NH.sub.2.
[0220] The term "sulfonic acid" refers to the group
--SO.sub.3H.
[0221] The term "tetrazolyl" refers to the five membered heteroaryl
of the following formulae:
##STR00018##
[0222] In some embodiments, the tetrazolyl group is further
substituted at either the 1 or 5 position respectively with a group
selected from the group consisting of C.sub.1-3 alkyl, C.sub.1-3
haloalkyl and C.sub.1-3 alkoxy.
[0223] The term "thiol" denotes the group --SH.
[0224] The term "GLP-1 secretagogue" shall mean an agent (e.g., a
compound) that promotes GLP-1 secretion from a cell, e.g. an
enteroendocrine cell.
[0225] The term "endogenous" shall mean a material that a mammal
naturally produces. The term "biologically active fragment of a G
protein-coupled receptor" shall mean a fragment of the GPCR having
structural and biochemical functions of a naturally occurring GPCR.
In certain embodiments, the biologically active fragment couples to
a G protein. In certain embodiments, the biologically active
fragment binds to a known ligand of the GPCR.
[0226] The term "primer" is used herein to denote a specific
oligonucleotide sequence which is complementary to a target
nucleotide sequence and used to hybridize to the target nucleotide
sequence. A primer serves as an initiation point for nucleotide
polymerization catalyzed by DNA polymerase, RNA polymerase, or
reverse transcriptase.
[0227] The term "expression vector" shall mean a DNA sequence that
is required for the transcription of cloned DNA and translation of
the transcribed mRNA in an appropriate host cell recombinant for
the expression vector. An appropriately constructed expression
vector should contain an origin of replication for autonomous
replication in host cells, selectable markers, a limited number of
useful restriction enzyme sites, a potential for high copy number,
and active promoters. The cloned DNA to be transcribed is operably
linked to a constitutively or conditionally active promoter within
the expression vector.
[0228] The term "candidate compound" or "test compound" shall mean
a compound (for example and not limitation, a chemical compound)
that is amenable to screening.
[0229] The term "contact" or "contacting" shall mean bringing at
least two moieties together.
[0230] The terms "modulate" or "modify" shall be taken to refer to
an increase or decrease in the amount, quality, or effect of a
particular activity, function or molecule. By way of illustration
and not limitation, agonists, partial agonists, inverse agonists,
and antagonists of a G protein-coupled receptor are modulators of
the receptor.
[0231] The term "small molecule" shall be taken to mean a compound
having a molecular weight of less than about 10,000 grams per mole,
including a peptide, peptidomimetic, amino acid, amino acid
analogue, polynucleotide, polynucleotide analogue, nucleotide,
nucleotide analogue, organic compound or inorganic compound (i.e.
including a heterorganic compound or organometallic compound), and
salts, esters and other pharmaceutically acceptable forms thereof.
In certain preferred embodiments, small molecules are organic or
inorganic compounds having a molecular weight of less than about
5,000 grams per mole. In certain preferred embodiments, small
molecules are organic or inorganic compounds having molecular
weight of less than about 1,000 grams per mole. In certain
preferred embodiments, small molecules are organic or inorganic
compounds having a molecular weight of less than about 800 grams
per mole. In certain preferred embodiments, small molecules are
organic or inorganic compounds having a molecular weight of less
than about 600 grams per mole. In certain preferred embodiments,
small molecules are organic or inorganic compounds having a
molecular weight of less than about 500 grams per mole.
[0232] The term "polynucleotide" shall refer to RNA, DNA, or
RNA/DNA hybrid sequence of more than one nucleotide in either
single chain or duplex form. The polynucleotides of the invention
may be prepared by any known method, including synthetic,
recombinant, ex vivo generation, or a combination thereof, as well
as utilizing any purification methods known in the art.
[0233] The term "polypeptide" shall refer to a polymer of amino
acids without regard to the length of the polymer. Thus, peptides,
oligopeptides, and proteins are included within the definition of
polypeptide. This term also does not specify or exclude
post-expression modifications of polypeptides. For example,
polypeptides that include the covalent attachment of glycosyl
groups, acetyl groups, phosphate groups, lipid groups and the like
are expressly encompassed by the term polypeptide.
[0234] The term "antibody" is intended herein to encompass
monoclonal antibody and polyclonal antibody.
[0235] The term "second messenger" shall mean an intracellular
response produced as a result of receptor activation. A second
messenger can include, for example, inositol 1,4,5-triphosphate
(IP3), diacylglycerol (DAG), cyclic AMP (cAMP), cyclic GMP (cGMP),
MAP kinase activity, MAPK/ERK kinase kinase-1 (MEKK1) activity, and
Ca2+. Second messenger response can be measured for a determination
of receptor activation.
[0236] The term "receptor functionality" shall refer to the normal
operation of a receptor to receive a stimulus and moderate an
effect in the cell, including, but not limited to regulating gene
transcription, regulating the influx or efflux of ions, effecting a
catalytic reaction, and/or modulating activity through G-proteins,
such as eliciting a second messenger response.
[0237] The term "stimulate" or "stimulating," in relationship to
the term "response" or "functionality of the receptor" shall mean
that a response or a functionality of the receptor is increased in
the presence of a compound as opposed to in the absence of the
compound.
[0238] The term "inhibit" or "inhibiting," in relationship to the
term "response" or "functionality of the receptor" shall mean that
a response a functionality of the receptor is decreased or
prevented in the presence of a compound as opposed to in the
absence of the compound.
[0239] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the lower limit unless the
context clearly indicates otherwise, between the upper and lower
limit of that range and any other stated or intervening value in
that stated range, is encompassed within the invention. The upper
and lower limits of these smaller ranges may independently be
included in the smaller ranges, and are also encompassed within the
invention, subject to any specifically excluded limit in the stated
range. Where the stated range includes one or both of the limits,
ranges excluding either or both of those included limits are also
included in the invention.
[0240] GPR119 Agonists
[0241] Preferably, GPR119 is mammalian GPR119. More preferably,
GPR119 is rodent or primate GPR119. Most preferably, GPR119 is
human GPR119.
[0242] The class of GPR119 agonists useful in the novel therapeutic
combinations of the present invention include compounds which
exhibit an acceptably high affinity for GPR119 receptor. The GPR119
agonist or pharmaceutically acceptable salt may be any agonist,
more preferably a selective GPR119 agonist.
[0243] Examples of GPR119 agonists are described in International
Application No. PCT/US2004/001267 (published as WO 04/065380), the
disclosure of which is herein incorporated by reference in its
entirety. Disclosed in International Application No.
PCT/US2004/001267 as a GPR119 agonist is a compound of Formula
(I):
##STR00019##
[0244] wherein: [0245] A and B are independently C.sub.1-3 alkylene
optionally substituted with 1 to 4 methyl groups; [0246] D is O, S,
S(O), S(O).sub.2, CR.sub.2R.sub.3 or N--R.sub.2; [0247] V is
selected from the group consisting of C.sub.1-3 alkylene,
ethynylene and C.sub.1-2 heteroalkylene wherein each are optionally
substituted with 1 to 4 substituents selected from the group
consisting of C.sub.1-3 alkyl, C.sub.1-4 alkoxy, carboxy, cyano,
C.sub.1-3 haloalkyl and halogen; or [0248] V is absent; [0249] W is
NR.sub.4, O, S, S(O) or S(O).sub.2; or [0250] W is absent; [0251] X
is N or CR.sub.5; [0252] Y is N or CR.sub.6; [0253] Z is selected
from the group consisting of C.sub.1-5 acyl, C.sub.1-5 acyloxy,
C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4 alkylcarboxamide,
C.sub.1-4 alkylthiocarboxamide, C.sub.1-4 alkylsulfonamide,
C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4
alkylthio, C.sub.1-4 alkylthioureyl, C.sub.1-4 alkylureyl, amino,
C.sub.1-2 alkylamino, C.sub.2-4 dialkylamino,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.4-8
diacylamino, C.sub.2-6 dialkylcarboxamide, C.sub.1-4
dialkylthiocarboxamide, C.sub.2-6 dialkylsulfonamide, C.sub.1-4
dialkylsulfonylamino, formyl, C.sub.1-4 haloalkoxy, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylcarboxamide, C.sub.1-4
haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkylthio, halogen, aryl, heterocyclic, heteroaryl, hydroxyl,
hydroxylamino, nitro and tetrazolyl, wherein C.sub.1-8 alkyl and
C.sub.1-5 acyl are each optionally substituted with 1, 2, 3 or 4
groups selected from the group consisting of C.sub.1-5 acyl,
C.sub.1-5 acyloxy, C.sub.1-4 alkoxy, C.sub.1-4 alkylcarboxamide,
C.sub.1-4 alkylsulfonamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4
alkylsulfonyl, C.sub.1-4 alkylthio, C.sub.1-4 alkylureyl, amino,
C.sub.1-2 alkylamino, C.sub.2-4 dialkylamino,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, formyl,
C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkylthio, halogen, hydroxyl,
hydroxylamino and nitro; or [0254] Z is a group of Formula
(IA):
[0254] ##STR00020## [0255] wherein: [0256] R.sub.7 is H, C.sub.1-8
alkyl or C.sub.3-6 cycloalkyl; and [0257] R.sub.8 is H, nitro or
nitrile; [0258] Ar.sub.1 is aryl or heteroaryl wherein each are
optionally substituted with R.sub.9-R.sub.13; [0259] R.sub.1 is
selected from the group consisting of H, C.sub.1-5 acyloxy,
C.sub.2-6 alkenyl, C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4
alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-4 alkylsulfonamide,
C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4
alkylthio, C.sub.1-4 alkylureyl, amino, C.sub.1-4 alkylamino,
C.sub.2-8 dialkylamino, carboxamide, cyano, C.sub.3-6 cycloalkyl,
C.sub.2-6 dialkylcarboxamide, C.sub.2-6 dialkylsulfonamide,
halogen, C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl, C.sub.1-4
haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkylthio and hydroxyl; [0260] R.sub.2 is selected from the
group consisting of H, C.sub.1-5 acyl, C.sub.1-5 acyloxy, C.sub.1-4
alkoxy, C.sub.1-8 alkyl, C.sub.1-4 alkylcarboxamide, C.sub.1-4
alkylthiocarboxamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4
alkylsulfonyl, C.sub.1-4 alkylthio, amino, carbo-C.sub.1-6-alkoxy,
carboxamide, carboxy, cyano, C.sub.3-6-cycloalkyl, C.sub.2-6
dialkylcarboxamide, C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl,
halogen, heteroaryl, hydroxyl and phenyl; and wherein C.sub.1-8
alkyl, heteroaryl and phenyl are each optionally substituted with 1
to 5 substituents selected from the group consisting of C.sub.1-5
acyl, C.sub.1-5 acyloxy, C.sub.1-4 alkoxy, C.sub.1-8 alkyl,
C.sub.1-4 alkylamino, C.sub.1-4 alkylcarboxamide, C.sub.1-4
alkylthiocarboxamide, C.sub.1-4 alkylsulfonamide, C.sub.1-4
alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio,
C.sub.1-4 alkylthioureyl, C.sub.1-4 alkylureyl, amino,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano,
C.sub.3-6-cycloalkyl, C.sub.3-6-cycloalkyl-C.sub.1-3-alkylene,
C.sub.3-6-cycloalkyl-C.sub.1-3-heteroalkylene, C.sub.2-8
dialkylamino, C.sub.2-6 dialkylcarboxamide, C.sub.1-4
dialkylthiocarboxamide, C.sub.2-6 dialkylsulfonamide, C.sub.1-4
alkylthioureyl, C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl,
C.sub.1-4 haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylthio, halogen, heterocyclic,
hydroxyl, hydroxylamino and nitro; or [0261] R.sub.2 is
--Ar.sub.2--Ar.sub.3 wherein Ar.sub.2 and Ar.sub.3 are
independently aryl or heteroaryl each optionally substituted with 1
to 5 substituents selected from the group consisting of H,
C.sub.1-5 acyl, C.sub.1-5 acyloxy, C.sub.1-4 alkoxy, C.sub.1-8
alkyl, C.sub.1-4 alkylcarboxamide, C.sub.1-4 alkylthiocarboxamide,
C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4
alkylthio, amino, carbo-C.sub.1-6-alkoxy, carboxamide, carboxy,
cyano, C.sub.3-6-cycloalkyl, C.sub.2-6 dialkylcarboxamide,
C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl, halogen, hydroxyl and
nitro; or [0262] R.sub.2 is a group of Formula (IB):
[0262] ##STR00021## [0263] wherein: [0264] R.sub.14 is C.sub.1-8
alkyl or C.sub.3-6 cycloalkyl; and R.sub.15 is F, Cl, Br or CN; or
[0265] R.sub.2 is a group of Formula (IC):
[0265] ##STR00022## [0266] wherein: [0267] G is C.dbd.O,
CR.sub.16R.sub.17, O, S, S(O), S(O).sub.2; where R.sub.16 and
R.sub.17 are independently H or C.sub.1-8 alkyl; and [0268]
Ar.sub.4 is phenyl or heteroaryl optionally substituted with 1 to 5
substituents selected from the group consisting of C.sub.1-5 acyl,
C.sub.1-5 acyloxy, C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4
alkylcarboxamide, C.sub.1-4 alkylthiocarboxamide, C.sub.1-4
alkylsulfonamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl,
C.sub.1-4 alkylthio, C.sub.1-4 alkylthioureyl, C.sub.1-4
alkylureyl, amino, carbo-C.sub.1-6-alkoxy, carboxamide, carboxy,
cyano, C.sub.3-6-cycloalkyl, C.sub.2-6 dialkylcarboxamide,
C.sub.1-4 dialkylthiocarboxamide, C.sub.2-6 dialkylsulfonamide,
C.sub.1-4 alkylthioureyl, C.sub.1-4 haloalkoxy, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylthio,
halogen, heteroaryl, hydroxyl, hydroxylamino and nitro; [0269]
R.sub.3 is H, C.sub.1-8 alkyl, C.sub.1-4 alkoxy, halogen or
hydroxyl; [0270] R.sub.4 is H or C.sub.1-8 alkyl; [0271] R.sub.5
and R.sub.6 are independently H, C.sub.1-8 alkyl or halogen; [0272]
R.sub.9 is selected from the group consisting of C.sub.1-5 acyl,
C.sub.1-5 acyloxy, C.sub.2-6 alkenyl, C.sub.1-4 alkoxy, C.sub.1-8
alkyl, C.sub.1-4 alkylamino, C.sub.1-4 alkylcarboxamide, C.sub.2-6
alkynyl, C.sub.1-4 alkylsulfonamide, C.sub.1-4 alkylsulfinyl,
C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio, C.sub.1-4 alkylureyl,
amino, arylsulfonyl, carbo-C.sub.1-6-alkoxy, carboxamide, carboxy,
cyano, C.sub.3-6 cycloalkyl, C.sub.2-6 dialkylamino, C.sub.2-6
dialkylcarboxamide, C.sub.2-6 dialkylsulfonamide, halogen,
C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl, C.sub.1-4
haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkylthio, heterocyclic, heterocyclicsulfonyl, heteroaryl,
hydroxyl, nitro, C.sub.4-7 oxo-cycloalkyl, phenoxy, phenyl,
sulfonamide and sulfonic acid, and wherein C.sub.1-5 acyl,
C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4 alkylsulfonamide,
alkylsulfonyl, arylsulfonyl, heteroaryl, phenoxy and phenyl are
each optionally substituted with 1 to 5 substituents selected
independently from the group consisting of C.sub.1-5 acyl,
C.sub.1-5 acyloxy, C.sub.2-6 alkenyl, C.sub.1-4 alkoxy, C.sub.1-8
alkyl, C.sub.1-4 alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-4
alkylsulfonamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl,
C.sub.1-4 alkylthio, C.sub.1-4 alkylureyl, carbo-C.sub.1-6-alkoxy,
carboxamide, carboxy, cyano, C.sub.3-6 cycloalkyl, C.sub.2-6
dialkylcarboxamide, halogen, C.sub.1-4 haloalkoxy, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkylthio, heteroaryl,
heterocyclic, hydroxyl, nitro and phenyl; or [0273] R.sub.9 is a
group of Formula (ID):
[0273] ##STR00023## [0274] wherein: [0275] "p" and "r" are
independently 0, 1, 2 or 3; and [0276] R.sub.18 is H, C.sub.1-5
acyl, C.sub.2-6 alkenyl, C.sub.1-8 alkyl, C.sub.1-4
alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-4 alkylsulfonamide,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.3-6
cycloalkyl, C.sub.2-6 dialkylcarboxamide, halogen, heteroaryl or
phenyl, and wherein the heteroaryl and phenyl are each optionally
substituted with 1 to 5 substituents selected independently from
the group consisting of C.sub.1-4 alkoxy, amino, C.sub.1-4
alkylamino, C.sub.2-6 alkynyl, C.sub.2-8 dialkylamino, halogen,
C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl and hydroxyl; and [0277]
R.sub.10-R.sub.13 are independently selected form the group
consisting of C.sub.1-5 acyl, C.sub.1-5 acyloxy, C.sub.2-6 alkenyl,
C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4 alkylcarboxamide,
C.sub.2-6 alkynyl, C.sub.1-4 alkylsulfonamide, C.sub.1-4
alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio,
C.sub.1-4 alkylureyl, carbo-C.sub.1-6-alkoxy, carboxamide, carboxy,
cyano, C.sub.3-6 cycloalkyl, C.sub.2-6 dialkylcarboxamide, halogen,
C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl, C.sub.1-4
haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkylthio, hydroxyl and nitro; or [0278] two adjacent
R.sub.10-R.sub.11 groups together with Ar.sub.1 form a 5, 6 or 7
membered cycloalkyl, cycloalkenyl or heterocyclic group wherein the
5, 6 or 7 membered group is optionally substituted with
halogen.
[0279] The present invention also encompasses diastereomers as well
as optical isomers, e.g. mixtures of enantiomers including racemic
mixtures, as well as individual enantiomers and diastereomers,
which arise as a consequence of structural asymmetry in certain
compounds of the invention. Separation of the individual isomers or
selective synthesis of the individual isomers is accomplished by
application of various methods which are well known to
practitioners in the art.
[0280] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/001267 include the
following compounds according to Formula (I) (referred to herein as
Group A1):
[6-(4-Benzenesulfonyl-piperidin-1-yl)-5-nitro-pyrimidin-4-yl]-(4-methanes-
ulfonyl-phenyl)-amine;
{4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperazin-1-
-yl}-acetic acid ethyl ester;
(2-Fluoro-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-py-
rimidin-4-yl}-amine;
1-[6-(4-Imidazol-1-yl-phenoxy)-5-nitro-pyrimidin-4-yl]-piperidine-4-carbo-
xylic acid ethyl ester;
1-[5-Nitro-6-(4-[1,2,4]triazol-1-yl-phenoxy)-pyrimidin-4-yl]-piperidine-4-
-carboxylic acid ethyl ester;
{6-[4-(4-Fluoro-phenoxy)-piperidin-1-yl]-5-nitro-pyrimidin-4-yl}-(4-metha-
nesulfonyl-phenyl)-amine;
{6-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimid-
in-4-yl}-(4-methanesulfonyl-phenyl)-amine;
{6-[4-(3-Cyclopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrim-
idin-4-yl}-(4-methanesulfonyl-phenyl)-amine;
(4-Methanesulfonyl-phenyl)-(5-nitro-6-{4-[3-(3-trifluoromethyl-phenyl)-[1-
,2,4]oxadiazol-5-yl]-piperidin-1-yl}-pyrimidin-4-yl)-amine;
{6-[4-(3-Ethyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimidin-4-
-yl}-(2-fluoro-phenyl)-amine;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-
-yl)-piperidin-1-yl]-5-nitro-pyrimidin-4-yl}-amine;
{6-[4-(3-Ethyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimidin-4-
-yl}-(2-fluoro-4-methanesulfonyl-phenyl)-amine;
(4-Methanesulfonyl-phenyl)-{5-nitro-6-[4-(3-propyl-[1,2,4]oxadiazol-5-yl)-
-piperidin-1-yl]-pyrimidin-4-yl}-amine;
{6-[4-(3-Cyclopropylmethyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-
-pyrimidin-4-yl}-(4-methanesulfonyl-phenyl)-amine;
(4-Methanesulfonyl-phenyl)-{5-nitro-6-[4-(pyridin-4-yloxy)-piperidin-1-yl-
]-pyrimidin-4-yl}-amine;
(4-Methanesulfonyl-phenyl)-{5-nitro-6-[4-(pyrimidin-2-yloxy)-piperidin-1--
yl]-pyrimidin-4-yl}-amine;
1-[6-(4-Carbamoylmethyl-phenoxy)-5-nitro-pyrimidin-4-yl]-piperidine-4-car-
boxylic acid ethyl ester;
1-{6-[4-(1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-phenoxy]-5-nitro-pyrimidin--
4-yl}-piperidine-4-carboxylic acid ethyl ester;
4'-[4-(2-Methoxycarbonylacetyl)-phenoxy]-3'-nitro-3,4,5,6-tetrahydro-2H-[-
1,2']bipyridinyl-4-carboxylic acid ethyl ester;
{6-[4-(2-Methoxy-phenylsulfanyl)-piperidin-1-yl]-5-nitro-pyrimidin-4-yl}--
(4-[1,2,4]triazol-1-yl-phenyl)-amine;
4'-(2-Amino-4-ethanesulfonyl-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2-
']bipyridinyl-4-carboxylic acid ethyl ester;
4'-(4-Imidazol-1-yl-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyrid-
inyl-4-carboxylic acid ethyl ester;
(4-Methoxy-2-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-pyrimid-
in-4-yloxy}-phenyl)-phenyl-methanone;
4-{4-[6-(4-Cyclopropylmethoxymethyl-piperidin-1-yl)-5-nitro-pyrimidin-4-y-
loxy]-phenyl}-butan-2-one;
4-{4-[5-Nitro-6-(4-propoxymethyl-piperidin-1-yl)-pyrimidin-4-yloxy]-pheny-
l}-butan-2-one;
4-{4-[6-(4-Butoxymethyl-piperidin-1-yl)-5-nitro-pyrimidin-4-yloxy]-phenyl-
}-butan-2-one;
4-{4-[6-(4-Isobutoxymethyl-piperidin-1-yl)-5-nitro-pyrimidin-4-yloxy]-phe-
nyl}-butan-2-one;
{1-[6-(Benzo[1,3]dioxol-5-ylamino)-5-nitro-pyrimidin-4-yl]-piperidin-4-yl-
}-(4-fluoro-phenyl)-methanone;
(2,3-Difluoro-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl-
]-pyrimidin-4-yl}-amine;
(2,4-Difluoro-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl-
]-pyrimidin-4-yl}-amine;
1-{2-Nitro-3-[4-(3-oxo-butyl)-phenoxy]-phenyl}-piperidine-4-carboxylic
acid ethyl ester;
1-[6-(4-Acetyl-phenoxy)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic
acid ethyl ester;
3'-Nitro-2'-[4-(3-oxo-butyl)-phenoxy]-3,4,5,6-tetrahydro-2H-[1,4']bipyrid-
inyl-4-carboxylic acid ethyl ester;
4-(4-{5-Nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-pyrimidin-4-ylo-
xy}-phenyl)-butan-2-one;
4-(4-{5-Nitro-6-[4-(2-trifluoromethyl-phenoxy)-piperidin-1-yl]-pyrimidin--
4-yloxy}-phenyl)-butan-2-one;
4-(4-{6-[4-(3-Methyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrim-
idin-4-yloxy}-phenyl)-butan-2-one;
4-(2,4-Difluoro-phenoxy)-5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1--
yl]-pyrimidine;
4-(4-{6-[4-(4-Fluoro-benzoyl)-piperidin-1-yl]-5-nitro-pyrimidin-4-yloxy}--
phenyl)-butan-2-one;
4-(4-4-(4-Methanesulfonyl-phenoxy)-5-nitro-6-[4-(pyridin-4-ylsulfanyl)-cy-
clohexyl]-pyrimidine;
4-(4-Methanesulfonyl-phenoxy)-5-nitro-6-(4-phenylsulfanyl-cyclohexyl)-pyr-
imidine;
1-{6-[(Benzo[1,3]dioxol-5-ylmethyl)-amino]-5-nitro-pyrimidin-4-yl-
}-piperidine-4-carboxylic acid ethyl ester;
1-{6-[4-(1,1-Dioxo-1.lamda..sup.6-thiomorpholin-4-ylmethyl)-phenylamino]--
5-nitro-pyrimidin-4-yl}-piperidine-4-carboxylic acid ethyl ester;
1-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-
-carboxylic acid ethyl ester;
1-[6-(4-Dimethylsulfamoyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-
-4-carboxylic acid ethyl ester;
1-[6-(3-Methoxy-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxy-
lic acid ethyl ester;
1-[6-(2-Methoxy-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxy-
lic acid ethyl ester;
1-[6-(4-Methanesulfonyl-phenoxy)-5-nitro-pyrimidin-4-yl]-piperidine-4-car-
boxylic acid ethyl ester;
1-{6-[4-(2-Methoxycarbonyl-acetyl)-phenoxy]-5-nitro-pyrimidin-4-yl}-piper-
idine-4-carboxylic acid ethyl ester;
1-[6-(2-Amino-4-ethanesulfonyl-phenoxy)-5-nitro-pyrimidin-4-yl]-piperidin-
e-4-carboxylic acid ethyl ester;
1-[6-(2,5-Dimethoxy-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-car-
boxylic acid ethyl ester;
(4-{5-Nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-pyrimidin-4-ylami-
no}-phenyl)-phenyl-methanone;
1-[6-(4-Cyclohexyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carb-
oxylic acid ethyl ester;
1-[5-Nitro-6-(4-[1,2,4]triazol-1-yl-phenylamino)-pyrimidin-4-yl]-piperidi-
ne-4-carboxylic acid ethyl ester;
1-[5-Nitro-6-(4-trifluoromethanesulfonyl-phenylamino)-pyrimidin-4-yl]-pip-
eridine-4-carboxylic acid ethyl ester;
1-[5-Nitro-6-(4-[1,2,3]thiadiazol-4-yl-phenylamino)-pyrimidin-4-yl]-piper-
idine-4-carboxylic acid ethyl ester;
[6-(4-Ethoxymethyl-piperidin-1-yl)-5-nitro-pyrimidin-4-yl]-(4-methanesulf-
onyl-phenyl)-amine;
[5-Nitro-6-(4-propyl-piperidin-1-yl)-pyrimidin-4-yl]-(4-[1,2,4]triazol-1--
yl-phenyl)-amine;
{5-Nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-pyrimidin-4-yl}-(4-[-
1,2,4]triazol-1-yl-phenyl)-amine;
(2-Fluoro-phenyl)-{6-[4-(3-methyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]--
5-nitro-pyrimidin-4-yl}-amine;
(4-Methanesulfonyl-phenyl)-{6-[4-(3-methyl-[1,2,4]oxadiazol-5-yl)-piperid-
in-1-yl]-5-nitro-pyrimidin-4-yl}-amine;
{6-[4-(3-Methyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimidin--
4-yl}-(4-[1,2,4]triazol-1-yl-phenyl)-amine;
(4-Methanesulfonyl-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-
-1-yl]-pyrimidin-4-yl}-amine;
(3-Methoxy-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-p-
yrimidin-4-yl}-amine;
1-[6-(Benzo[1,3]dioxol-5-ylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-ca-
rboxylic acid ethyl ester;
1-[6-(2-Fluoro-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxyl-
ic acid ethyl ester;
1-[6-(3-Fluoro-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxyl-
ic acid ethyl ester;
1-[6-(3,4-Dihydro-2H-benzo[b][1,4]dioxepin-7-ylamino)-5-nitro-pyrimidin-4-
-yl]-piperidine-4-carboxylic acid ethyl ester;
1-{6-[4-(Morpholine-4-sulfonyl)-phenylamino]-5-nitro-pyrimidin-4-yl}-pipe-
ridine-4-carboxylic acid ethyl ester;
Benzo[1,3]dioxol-5-yl-[5-nitro-6-(4-propyl-piperidin-1-yl)-pyrimidin-4-yl-
]-amine;
(4-Fluoro-phenyl)-{1-[5-nitro-6-(4-[1,2,4]triazol-1-yl-phenylamin-
o)-pyrimidin-4-yl]-piperidin-4-yl}-methanone;
[5-Nitro-6-(4-phenylsulfanyl-piperidin-1-yl)-pyrimidin-4-yl]-(4-[1,2,4]tr-
iazol-1-yl-phenyl)-amine;
(4-Fluoro-phenyl)-{1-[6-(2-fluoro-phenylamino)-5-nitro-pyrimidin-4-yl]-pi-
peridin-4-yl}-methanone;
(4-Methanesulfonyl-phenyl)-[5-nitro-6-(4-phenylsulfanyl-piperidin-1-yl)-p-
yrimidin-4-yl]-amine;
(4-Methanesulfonyl-phenyl)-{5-nitro-6-[4-(pyridin-2-yloxy)-piperidin-1-yl-
]-pyrimidin-4-yl}-amine;
(4-Methanesulfonyl-phenyl)-{5-nitro-6-[4-(pyridin-4-ylsulfanyl)-piperidin-
-1-yl]-pyrimidin-4-yl}-amine;
(4-Methanesulfonyl-phenyl)-{6-[4-(4-methoxy-phenylsulfanyl)-piperidin-1-y-
l]-5-nitro-pyrimidin-4-yl}-amine;
2-Methoxy-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-py-
rimidin-4-yl}-amine;
(4-Methanesulfonyl-phenyl)-(5-nitro-6-{4-[3-(3-trifluoromethyl-phenyl)-[1-
,2,4]oxadiazol-5-yl]-piperidin-1-yl}-pyrimidin-4-yl)-amine;
{6-[4-(3-Ethyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimidin-4-
-yl}-(4-methanesulfonyl-phenyl)-amine;
(6-{4-[5-(4-Fluoro-phenyl)-[1,3,4]oxadiazol-2-yl]-piperidin-1-yl}-5-nitro-
-pyrimidin-4-yl)-(4-methanesulfonyl-phenyl)-amine;
(4-Methanesulfonyl-phenyl)-[5-nitro-6-(4-pyridin-2-ylmethyl-piperidin-1-y-
l)-pyrimidin-4-yl]amine;
1-{6-[4-(2,5-Dioxo-imidazolidin-4-yl)-phenoxy]-5-nitro-pyrimidin-4-yl}-pi-
peridine-4-carboxylic acid ethyl ester;
1-[5-Nitro-6-(4-propionyl-phenoxy)-pyrimidin-4-yl]-piperidine-4-carboxyli-
c acid ethyl ester;
1-[5-Nitro-6-(4-[1,2,3]thiadiazol-4-yl-phenoxy)-pyrimidin-4-yl]-piperidin-
e-4-carboxylic acid ethyl ester;
1-[6-[4-(3-oxo-butyl)-phenoxy]-5-(2,2,2-trifluoro-acetylamino)-pyrimidin--
4-yl]-piperidine-4-carboxylic acid ethyl ester;
1-[6-(2-Benzoyl-5-methoxy-phenoxy)-5-nitro-pyrimidin-4-yl]piperidine-4-ca-
rboxylic acid ethyl ester;
3'-Nitro-4'-[4-(3-oxo-butyl)-phenoxy]-3,4,5,6-tetrahydro-2H-[1,2']bipyrid-
inyl-4-carboxylic acid ethyl ester; 1-[6-(4-Dimethyl
sulfamoyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic
acid ethyl ester;
1-{6-[4-(4,5-Dichloro-imidazol-1-yl)-phenylamino]-5-nitro-pyrimidin-4-yl}-
-piperidine-4-carboxylic acid ethyl ester;
Benzo[1,3]dioxol-5-yl-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl-
]-pyrimidin-4-yl}-amine;
(4-Fluoro-phenyl)-{1-[6-(2-fluoro-phenylamino)-5-nitro-pyrimidin-4-yl]-pi-
peridin-4-yl}-methanone;
(2,5-Difluoro-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl-
]-pyrimidin-4-yl}-amine;
1-{5-Nitro-6-[4-(3-oxo-butyl)-phenoxy]-pyrimidin-4-yl}-piperidine-4-carbo-
xylic acid ethyl ester;
4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-methanesulf-
onyl-phenoxy)-pyrimidine-5-carbonitrile;
5-[1,3]Dioxolan-2-yl-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-
-yl]-6-(4-methanesulfonyl-phenoxy)-pyrimidine;
4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-methanesulf-
onyl-phenoxy)-pyrimidine-5-carbaldehyde;
5-[1,3]Dioxolan-2-yl-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-
-yl]-6-(4-[1,2,3]thiadiazol-4-yl-phenoxy)-pyrimidine;
4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-[1,2,3]thia-
diazol-4-yl-phenoxy)-pyrimidine-5-carbaldehyde;
4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-[1,2,3]thia-
diazol-4-yl-phenoxy)-pyrimidine-5-carboxylic acid;
[4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-[1,2,3]thi-
adiazol-4-yl-phenoxy)-pyrimidin-5-yl]-methanol;
[4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-[1,2,3]thi-
adiazol-4-yl-phenoxy)-pyrimidin-5-ylmethyl]-dimethyl-amine;
4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-methylsulfa-
nyl-phenylamino)-pyrimidine-5-carbonitrile;
4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-methanesulf-
inyl-phenylamino)-pyrimidine-5-carbonitrile;
(4-Methanesulfonyl-phenyl)-{5-nitro-6-[4-(4-trifluoromethoxy-phenoxy)-pip-
eridin-1-yl]-pyrimidin-4-yl}-amine;
4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-methanesulf-
onyl-phenylamino)-pyrimidine-5-carbonitrile;
1-{1-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yl]--
piperidin-4-yl}-hexan-1-one;
1-{1-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidin-
-4-yl}-hexan-1-one;
{6-[4-(3-tert-Butyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimi-
din-4-yl}-(2-fluoro-4-methanesulfonyl-phenyl)-amine;
{6-[4-(3-tert-Butyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimi-
din-4-yl}-(4-methanesulfonyl-phenyl)-amine;
[6-(4-Benzofuran-2-yl-piperidin-1-yl)-5-nitro-pyrimidin-4-yl]-(4-methanes-
ulfonyl-phenyl)-amine and
5-Nitro-4-(5-phenyl-[1,3,4]oxadiazol-2-ylsulfanyl)-6-[4-(pyridin-2-ylsulf-
anyl)-piperidin-1-yl]-pyrimidine.
[0281] Examples of GPR119 agonists are described in International
Application No. PCT/US2004/005555 (published as WO 04/076413), the
disclosure of which is herein incorporated by reference in its
entirety. Disclosed in International Application No.
PCT/US2004/005555 as a GPR119 agonist is a compound of Formula
(II):
##STR00024##
[0282] wherein: [0283] A and B are independently C.sub.1-3 alkylene
optionally substituted with 1 to 4 methyl groups; [0284] U is N or
CR.sub.1; [0285] D is O, S, S(O), S(O).sub.2, CR.sub.2R.sub.3 or
NR.sub.2; [0286] V is selected from the group consisting of
C.sub.1-3 alkylene, ethynylene and C.sub.1-2 heteroalkylene
optionally substituted with 1 to 4 substituents selected from the
group consisting of C.sub.1-3 alkyl, C.sub.1-4 alkoxy, carboxy,
cyano, C.sub.1-3 haloalkyl and halogen; or V is absent; [0287] W is
--S(O).sub.2NR.sub.4--, --NR.sub.4--, --O--, --S--, --S(O).sub.2--;
or W is absent; [0288] X is N or CR.sub.5; [0289] Y is N or
CR.sub.6; [0290] Z is selected from the group consisting of H,
C.sub.1-5 acyl, C.sub.1-5 acyloxy, C.sub.1-4 alkoxy, C.sub.1-6
alkyl, C.sub.1-4 alkylcarboxamide, C.sub.1-4 alkylthiocarboxamide,
C.sub.1-4 alkylsulfonamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4
alkylsulfonyl, C.sub.1-4 alkylthio, C.sub.1-4 alkylthioureyl,
C.sub.1-4 alkylureyl, amino, carbo-C.sub.1-6-alkoxy, carboxamide,
carboxy, cyano, C.sub.4-8 diacylamino, C.sub.1-4
dialkylcarboxamide, C.sub.1-4 dialkylthiocarboxamide, C.sub.2-6
dialkylsulfonamide, C.sub.1-4 dialkylsulfonylamino, formyl,
C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl, C.sub.1-4
haloalkylcarboxamide, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkylthio, halogen, aryl,
heteroaryl, hydroxyl, hydroxylamino, nitro and tetrazolyl; or
[0291] Z is a group of Formula (IIA):
[0291] ##STR00025## [0292] wherein: [0293] R.sub.7 is H, C.sub.1-6
alkyl or C.sub.3-6 cycloalkyl; and [0294] R.sub.8 is H, nitro or
cyano; [0295] Ar.sub.1 is aryl or heteroaryl optionally substituted
with R.sub.9, R.sub.10, R.sub.11, R.sub.12 and R.sub.13; [0296]
R.sub.1, R.sub.5 and R.sub.6 are independently selected from the
group consisting of H, C.sub.1-5 acyloxy, C.sub.2-6 alkenyl,
C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4 alkylcarboxamide,
C.sub.2-6 alkynyl, C.sub.1-4 alkylsulfonamide, C.sub.1-4
alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio,
C.sub.1-4 alkylureyl, amino, C.sub.1-4 alkylamino, C.sub.2-8
dialkylamino, carboxamide, cyano, C.sub.3-6 cycloalkyl, C.sub.2-6
dialkylcarboxamide, C.sub.2-6 dialkylsulfonamide, halogen,
C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl, C.sub.1-4
haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkylthio, hydroxyl and nitro; [0297] R.sub.2 is selected from
the group consisting of H, C.sub.1-5 acyl, C.sub.1-5 acyloxy,
C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4 alkylcarboxamide,
C.sub.1-4 alkylthiocarboxamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4
alkylsulfonyl, C.sub.1-4 alkylthio, amino, carbo-C.sub.1-6-alkoxy,
carboxamide, carboxy, cyano, C.sub.3-6-cycloalkyl, C.sub.2-6
dialkylcarboxamide, C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl,
halogen, heteroaryl, hydroxyl and phenyl; and wherein C.sub.1-8
alkyl, heteroaryl and phenyl are optionally substituted with 1 to 5
substituents selected from the group consisting of C.sub.1-5 acyl,
C.sub.1-5 acyloxy, C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4
alkylamino, C.sub.1-4 alkylcarboxamide, C.sub.1-4
alkylthiocarboxamide, C.sub.1-4 alkylsulfonamide, C.sub.1-4
alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio,
C.sub.1-4 alkylthioureyl, C.sub.1-4 alkylureyl, amino,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano,
C.sub.3-6-cycloalkyl,
C.sub.3-6-cycloalkyl-C.sub.1-3-heteroalkylene, C.sub.2-8
dialkylamino, C.sub.2-6 dialkylcarboxamide, C.sub.1-4
dialkylthiocarboxamide, C.sub.2-6 dialkylsulfonamide, C.sub.1-4
alkylthioureyl, C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl,
C.sub.1-4 haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylthio, halogen, heterocyclic,
hydroxyl, hydroxylamino and nitro; or [0298] R.sub.2 is
--Ar.sub.2--Ar.sub.3 wherein Ar.sub.2 and Ar.sub.3 are
independently aryl or heteroaryl optionally substituted with 1 to 5
substituents selected from the group consisting of H, C.sub.1-5
acyl, C.sub.1-5 acyloxy, C.sub.1-4 alkoxy, C.sub.1-8 alkyl,
C.sub.1-4 alkylcarboxamide, C.sub.1-4 alkylthiocarboxamide,
C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4
alkylthio, amino, carbo-C.sub.1-6-alkoxy, carboxamide, carboxy,
cyano, C.sub.3-6-cycloalkyl, C.sub.2-6 dialkylcarboxamide,
C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl, halogen, hydroxyl and
nitro; or [0299] R.sub.2 is a group of Formula (IIB):
[0299] ##STR00026## [0300] wherein: [0301] R.sub.14 is C.sub.1-8
alkyl or C.sub.3-6 cycloalkyl; and R.sub.15 is F, Cl, Br or CN; or
[0302] R.sub.2 is a group of Formula (IIC):
[0302] ##STR00027## [0303] wherein: [0304] G is C.dbd.O,
CR.sub.16R.sub.17, O, S, S(O), S(O).sub.2; where R.sub.16 and
R.sub.17 are independently H or C.sub.1-8 alkyl; and [0305]
Ar.sub.4 is phenyl or heteroaryl optionally substituted with 1 to 5
substituents selected from the group consisting of C.sub.1-5 acyl,
C.sub.1-5 acyloxy, C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4
alkylcarboxamide, C.sub.1-4 alkylthiocarboxamide, C.sub.1-4
alkylsulfonamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl,
C.sub.1-4 alkylthio, C.sub.1-4 alkylthioureyl, C.sub.1-4
alkylureyl, amino, carbo-C.sub.1-6-alkoxy, carboxamide, carboxy,
cyano, C.sub.3-6-cycloalkyl, C.sub.2-6 dialkylcarboxamide,
C.sub.1-4 dialkylthiocarboxamide, C.sub.2-6 dialkylsulfonamide,
C.sub.1-4 alkylthioureyl, C.sub.1-4 haloalkoxy, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylthio,
halogen, heteroaryl, hydroxyl, hydroxylamino and nitro; [0306]
R.sub.3 is H, C.sub.1-8 alkyl, C.sub.1-4 alkoxy or hydroxyl; [0307]
R.sub.4 is H or C.sub.1-8 alkyl; [0308] R.sub.9 is selected from
the group consisting of C.sub.1-5 acyl, C.sub.1-5 acyloxy,
C.sub.2-6 alkenyl, C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4
alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-4 alkylsulfonamide,
C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4
alkylthio, C.sub.1-4 alkylureyl, amino, arylsulfonyl,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.3-6
cycloalkyl, C.sub.2-6 dialkylcarboxamide, halogen, C.sub.1-4
haloalkoxy, C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylsulfinyl,
C.sub.1-4 haloalkylsulfonyl, C.sub.1-4 haloalkylthio, heterocyclic,
heterocyclicsulfonyl, heteroaryl, hydroxyl, nitro, C.sub.4-7
oxo-cycloalkyl, phenoxy, phenyl, sulfonamide and sulfonic acid, and
wherein C.sub.1-5 acyl, C.sub.1-4 alkoxy, C.sub.1-8 alkyl,
C.sub.1-4 alkylsulfonamide, alkylsulfonyl, arylsulfonyl,
heteroaryl, phenoxy and phenyl are optionally substituted with 1 to
5 substituents selected independently from the group consisting of
C.sub.1-5 acyl, C.sub.1-5 acyloxy, C.sub.2-6 alkenyl, C.sub.1-4
alkoxy, C.sub.1-8 alkyl, C.sub.1-4 alkylcarboxamide, C.sub.2-6
alkynyl, C.sub.1-4 alkylsulfonamide, C.sub.1-4 alkylsulfinyl,
C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio, C.sub.1-4 alkylureyl,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.3-6
cycloalkyl, C.sub.2-6 dialkylcarboxamide, halogen, C.sub.1-4
haloalkoxy, C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylsulfinyl,
C.sub.1-4 haloalkylsulfonyl, C.sub.1-4 haloalkylthio, heteroaryl,
heterocyclic, hydroxyl, nitro and phenyl; or [0309] R.sub.9 is a
group of Formula (IID):
[0309] ##STR00028## [0310] wherein: [0311] "p" and "r" are
independently 0, 1, 2 or 3; and [0312] R.sub.18 is H, C.sub.1-5
acyl, C.sub.2-6 alkenyl, C.sub.1-8 alkyl, C.sub.1-4
alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-4 alkylsulfonamide,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.3-6
cycloalkyl, C.sub.2-6 dialkylcarboxamide, halogen, heteroaryl or
phenyl, and wherein the heteroaryl or phenyl optionally substituted
with 1 to 5 substituents selected independently from the group
consisting of C.sub.1-4 alkoxy, C.sub.1-8 alkyl, amino, C.sub.1-4
alkylamino, C.sub.2-6 alkynyl, C.sub.2-8 dialkylamino, halogen,
C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl and hydroxyl; and [0313]
R.sub.10-R.sub.13 are independently selected form the group
consisting of C.sub.1-5 acyl, C.sub.1-5 acyloxy, C.sub.2-6 alkenyl,
C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4 alkylcarboxamide,
C.sub.2-6 alkynyl, C.sub.1-4 alkylsulfonamide, C.sub.1-4
alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio,
C.sub.1-4 alkylureyl, amino, carbo-C.sub.1-6-alkoxy, carboxamide,
carboxy, cyano, C.sub.3-6 cycloalkyl, C.sub.2-6 dialkylcarboxamide,
halogen, C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl, C.sub.1-4
haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkylthio, hydroxyl and nitro; or [0314] two adjacent
R.sub.10-R.sub.11 groups form a 5, 6 or 7 membered cycloalkyl,
cycloalkenyl or heterocyclic group with Ar.sub.1 wherein the 5, 6
or 7 membered group is optionally substituted with halogen.
[0315] The present invention also encompasses diastereomers as well
as optical isomers, e.g. mixtures of enantiomers including racemic
mixtures, as well as individual enantiomers and diastereomers,
which arise as a consequence of structural asymmetry in certain
compounds of the invention. Separation of the individual isomers or
selective synthesis of the individual isomers is accomplished by
application of various methods which are well known to
practitioners in the art.
[0316] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/005555 include the
following compounds according to Formula (II) (referred to herein
as Group B1):
6'-[4-(2-Methoxycarbonyl-acetyl)-phenoxy]-3'-nitro-3,4,5,6-tetrahydro-2H--
[1,2']bipyridinyl-4-carboxyli c acid ethyl ester;
1-[4-(4-Acetyl-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-6'-yloxy)-
-phenyl]ethanone;
6'-[4-(4-Hydroxy-benzenesulfonyl)-phenoxy]-3'-nitro-3,4,5,6-tetrahydro-2H-
-[1,2']bipyridinyl-4-carboxylic acid ethyl ester;
6'-(4-Imidazol-1-yl-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyrid-
inyl-4-carboxylic acid ethyl ester;
6'-(4-Benzoyl-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-
-carboxylic acid ethyl ester;
6'-[4-(2-Methoxy-ethyl)-phenoxy]-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bip-
yridinyl-4-carboxylic acid ethyl ester;
6'-(4-Cyclopentyl-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridin-
yl-4-carboxylic acid ethyl ester;
6'-(4'-Cyano-biphenyl-4-yloxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyr-
idinyl-4-carboxylic acid ethyl ester;
3'-Nitro-6'-(4-sulfo-phenoxy)-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-c-
arboxylic acid ethyl ester;
3'-Nitro-6'-(4-pyrrol-1-yl-phenoxy)-3,4,5,6-tetrahydro-2H-[1,2']bipyridin-
yl-4-carboxylic acid ethyl ester;
6'-(4-Carbamoyl-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2]bipyridinyl--
4-carboxylic acid ethyl ester;
3'-Nitro-6'-(4-[1,2,4]triazol-1-yl-phenoxy)-3,4,5,6-tetrahydro-2H-[1,2']b-
ipyridinyl-4-carboxylic acid ethyl ester;
6'-(2-Amino-4-ethanesulfonyl-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2-
]bipyridinyl-4-carboxylic acid ethyl ester;
3'-Nitro-6'-[4-(4-oxo-cyclohexyl)-phenoxy]-3,4,5,6-tetrahydro-2H-[1,2']bi-
pyridinyl-4-carboxylic acid ethyl ester;
6'-(4'-Methoxy-biphenyl-4-yloxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bip-
yridinyl-4-carboxylic acid ethyl ester;
3'-Nitro-6'-(4-[1,2,3]thiadiazol-4-yl-phenoxy)-3,4,5,6-tetrahydro-2H-[1,2-
']bipyridinyl-4-carboxylic acid ethyl ester;
6'-[4-(1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-phenoxy]-3'-nitro-3,4,5,6-tet-
rahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester;
6'-[4-(2,5-Dioxo-imidazolidin-4-yl)-phenoxy]-3'-nitro-3,4,5,6-tetrahydro--
2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester;
3'-Nitro-6'-[4-(3-oxo-butyl)-phenoxy]-3,4,5,6-tetrahydro-2H-[1,2']bipyrid-
inyl-4-carboxylic acid ethyl ester;
3-[4-(3'-Nitro-4-propyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-6'-yloxy)-
-phenyl]-3-oxo-propionic acid methyl ester;
4-[4-(3'-Nitro-4-propyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-6'-yloxy)-
-phenyl]-butan-2-one;
4-{7-[3'-Nitro-4-(pyridin-2-ylsulfanyl)-3,4,5,6-tetrahydro-2H-[1,2']bipyr-
idinyl-6'-yloxy]-phenyl}-butan-2-one; and
3'-Nitro-4-(pyridin-2-ylsulfanyl)-6'-(4-[1,2,4]triazol-1-yl-phenoxy)-3,4,-
5,6-tetrahydro-2H-[1,2']bipyridinyl.
[0317] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/005555 include the
following compounds according to Formula (II) (referred to herein
as Group B2):
1-[5-(4-Benzoyl-phenoxy)-2-nitro-phenyl]-piperidine-4-carboxylic
acid ethyl ester;
1-{5-[4-(2-Methoxycarbonyl-acetyl)-phenoxy]-2-nitro-phenyl}-piperidine-4--
carboxylic acid ethyl ester;
1-[5-(2-Amino-4-ethanesulfonyl-phenoxy)-2-nitro-phenyl]piperidine-4-carbo-
xylic acid ethyl ester;
1-{2-Nitro-5-[4-(3-oxo-butyl)-phenoxy]-phenyl}-piperidine-4-carboxylic
acid ethyl ester;
4-{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-butan-2-one;
1-{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-ethanone;
3-{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-3-oxo-propioni-
c acid methyl ester;
5-Ethanesulfonyl-2-[4-nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenylam-
ine;
{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-phenyl-metha-
none;
1-{4-Nitro-3-[4-(3-oxo-butyl)-phenoxy]-phenyl}-piperidine-4-carboxyl-
ic acid ethyl ester;
4-{4-[2-Nitro-5-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-butan-2-one;
1-[3-(4-Benzoyl-phenoxy)-4-nitro-phenyl]-piperidine-4-carboxylic
acid ethyl ester;
{4-[2-Nitro-5-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-phenyl-methanone-
;
1-{5-[4-(2-Carboxy-ethyl)-phenoxy]-2-nitro-phenyl}-piperidine-4-carboxyl-
ic acid ethyl ester;
1-{5-[4-(2-Carboxy-2-oxo-ethyl)-phenoxy]-2-nitro-phenyl}-piperidine-4-car-
boxylic acid ethyl ester;
1-[2-Nitro-5-(4-vinyl-phenoxy)-phenyl]-piperidine-4-carboxylic acid
ethyl ester;
3-{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-propion-
ic acid;
3-{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-2-oxo--
propionic acid;
1-[2-Nitro-5-(4-vinyl-phenoxy)-phenyl]-4-propyl-piperidine;
1-{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-butan-1-one;
1-{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-pentan-1-one;
1-{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-hexan-1-one;
4-{4-[3-(4-Methoxymethyl-piperidin-1-yl)-4-nitro-phenoxy]-phenyl}-butan-2-
-one; 1-{4-[3-(4-M
ethoxymethyl-piperidin-1-yl)-4-nitro-phenoxy]-phenyl}-ethanone;
{4-[3-(4-Methoxymethyl-piperidin-1-yl)-4-nitro-phenoxy]-phenyl}-phenyl-me-
thanone;
2-(3-Methyl-[1,2,4]oxadiazol-5-yl)-1-{4-[4-nitro-3-(4-propyl-pipe-
ridin-1-yl)-phenoxy]-phenyl}-ethanone;
4-(4-{3-[4-(3-Methyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-4-nitro-pheno-
xy}-phenyl)-butan-2-one;
4-(4-{4-Nitro-3-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-phenoxy}-phenyl-
)-butan-2-one;
2-{1-[2-Nitro-5-(4-[1,2,4]triazol-1-yl-phenoxy)-phenyl]-piperidin-4-ylsul-
fanyl}-pyridine;
2-Methyl-5-{4-[4-nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-2H-py-
razol-3-ol;
2-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-5-trifluoromethyl-pyridin-
e;
5-Bromo-2-[4-nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-pyridine;
1-(4-{4-Nitro-3-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-phenoxy}-phenyl-
)-ethanone;
2-{1-[5-(4-Methanesulfonyl-phenoxy)-2-nitro-phenyl]-piperidin-4-ylsulfany-
l}-pyridine;
1-{5-[4-(5-Methyl-[1,3,4]oxadiazol-2-yl)-phenoxy]-2-nitro-phenyl}-4-propy-
l-piperidine;
1-{5-[3-(3-Methyl-[1,2,4]oxadiazol-5-yl)-phenoxy]-2-nitro-phenyl}-4-propy-
l-piperidine.
[0318] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/005555 include the
following compound according to Formula (II) (referred to herein as
Group B3):
5-Bromo-1-[4-nitro-3-(4-propyl-piperidin-1-yl)-phenyl]-1H-pyridin-2-one.
[0319] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/005555 include the
following compounds according to Formula (II) (referred to herein
as Group B4):
6'-Benzenesulfonylamino-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl--
4-carboxylic acid ethyl ester;
6'-(Benzenesulfonyl-methyl-amino)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bi-
pyridinyl-4-carboxylic acid ethyl ester;
6'-(Benzenesulfonyl-butyl-amino)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bip-
yridinyl-4-carboxylic acid ethyl ester;
6'-(5-Ethanesulfonyl-2-hydroxy-phenylamino)-3'-nitro-3,4,5,6-tetrahydro-2-
H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester;
6'-(2-Bromo-4-trifluoromethyl-benzenesulfonylamino)-3'-nitro-3,4,5,6-tetr-
ahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester;
{4-[3'-Nitro-4-(pyridin-2-ylsulfanyl)-3,4,5,6-tetrahydro-2H-[1,2']bipyrid-
inyl-6'-ylamino]-phenyl}-phenyl-methanone and
[3'-Nitro-4-(pyridin-2-ylsulfanyl)-3,4,5,6-tetrahydro-2H-[1,2']bipyridiny-
l-6'-yl]-(4-[1,2,4]triazol-1-yl-phenyl)-amine.
[0320] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/005555 include the
following compounds according to Formula (II) (referred to herein
as Group B5):
1-[5-(4-Benzoyl-phenylamino)-2-nitro-phenyl]-piperidine-4-carboxylic
acid ethyl ester and
{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenylamino]-phenyl}-phenyl-metha-
none.
[0321] Examples of GPR119 agonists are described in International
Application No. PCT/US2004/022327 (published as WO 05/007647), the
disclosure of which is herein incorporated by reference in its
entirety. Disclosed in International Application No.
PCT/US2004/022327 as a GPR119 agonist is a compound of Formula
(III):
##STR00029## [0322] wherein: [0323] A and B are each independently
C.sub.1-3 alkylene optionally substituted with 1 to 4 substituents
selected from the group consisting of C.sub.1-3 alkyl, C.sub.1-4
alkoxy, carboxy, cyano, C.sub.1-3 haloalkyl and halogen; [0324] D
is O, S, S(O), S(O).sub.2, CR.sub.2R.sub.3 or N--R.sub.2; [0325] E
is N, C or CR.sub.4; [0326] is a single bond when E is N or
CR.sub.4, or a double bond when E is C; [0327] V.sub.1 is selected
from the group consisting of C.sub.1-3 alkylene, ethynylene and
C.sub.1-2 heteroalkylene optionally substituted with 1 to 4
substituents selected from the group consisting of C.sub.1-3 alkyl,
C.sub.1-4 alkoxy, carboxy, cyano, C.sub.1-3 haloalkyl and halogen;
or V.sub.1 is a bond; [0328] V.sub.2 is C.sub.3-6 cycloalkylene or
C.sub.1-3 alkylene wherein each are optionally substituted with 1
to 4 substituents selected from the group consisting of C.sub.1-3
alkyl, C.sub.1-4 alkoxy, carboxy, cyano, C.sub.1-3 haloalkyl and
halogen; or V.sub.2 is a bond; [0329] W is NR.sub.5, O, S, S(O) or
S(O).sub.2; or W is absent; [0330] Q is NR.sub.8, O, S, S(O) or
S(O).sub.2; [0331] X is N or CR.sub.7; [0332] Y is N or CR.sub.8;
[0333] Z is selected from the group consisting of C.sub.1-5 acyl,
C.sub.1-5 acyloxy, C.sub.2-6 alkenyl, C.sub.1-4 alkoxy, C.sub.1-8
alkyl, C.sub.1-4 alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-4
alkylthiocarboxamide, C.sub.1-4 alkylsulfonamide, C.sub.1-4
alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio,
C.sub.1-4 alkylthioureyl, C.sub.1-4 alkylureyl, amino, C.sub.1-2
alkylamino, C.sub.2-4 dialkylamino, carbamimidoyl,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.3-7
cycloalkyl, C.sub.4-8 diacylamino, C.sub.2-6 dialkylcarboxamide,
C.sub.2-6 dialkylthiocarboxamide, C.sub.2-6 dialkylsulfonamide,
C.sub.2-6 dialkylsulfonylamino, formyl, C.sub.1-4 haloalkoxy,
C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylcarboxamide, C.sub.1-4
haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkylthio, halogen, aryl, heterocyclic, heteroaryl, hydroxyl,
hydroxycarbamimidoyl, hydroxylamino, nitro and tetrazolyl, wherein
C.sub.1-8 alkyl, C.sub.3-7 cycloalkyl, and heterocyclic are each
optionally substituted with 1, 2, 3 or 4 groups selected from the
group consisting of C.sub.1-5 acyl, C.sub.1-5 acyloxy, C.sub.1-4
alkoxy, C.sub.1-7 alkyl, C.sub.1-4 alkylcarboxamide, C.sub.1-4
alkylsulfonamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl,
C.sub.1-4 alkylthio, C.sub.1-4 alkylureyl, amino, C.sub.1-2
alkylamino, C.sub.2-4 dialkylamino, carbo-C.sub.1-6-alkoxy,
carboxamide, carboxy, cyano, formyl, C.sub.1-4 haloalkoxy,
C.sub.1-4 haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkylthio, halogen, hydroxyl, hydroxylamino and nitro, and
wherein said C.sub.1-7 alkyl is optionally substituted with amino;
or [0334] Z is a group of Formula (IIIA):
[0334] ##STR00030## [0335] wherein: [0336] R.sub.9 is H, C.sub.1-8
alkyl or C.sub.3-7 cycloalkyl; and [0337] R.sub.10 is H, nitro or
nitrile;
[0338] Ar.sub.1 is aryl or heteroaryl each optionally substituted
with R.sub.11, R.sub.12, R.sub.13, R.sub.14, and R.sub.15; wherein
R.sub.11 is selected from the group consisting of C.sub.1-5 acyl,
C.sub.1-6 acylsulfonamide, C.sub.1-5 acyloxy, C.sub.2-6 alkenyl,
C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4 alkylamino, C.sub.1-4
alkylcarboxamide, C.sub.1-4 alkylthiocarboxamide, C.sub.2-6
alkynyl, C.sub.1-4 alkylsulfonamide, C.sub.1-4 alkylsulfinyl,
C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio, C.sub.1-4
alkylthioureyl, C.sub.1-4 alkylureyl, amino, arylsulfonyl,
carbamimidoyl, carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano,
C.sub.3-7 cycloalkyl, C.sub.3-7 cycloalkyloxy, C.sub.2-6
dialkylamino, C.sub.2-6 dialkylcarboxamide, C.sub.2-6
dialkylthiocarboxamide, guanidinyl, halogen, C.sub.1-4 haloalkoxy,
C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkylthio, heterocyclic,
heterocyclic-oxy, heterocyclicsulfonyl, heterocyclic-carbonyl,
heteroaryl, heteroarylcarbonyl, hydroxyl, nitro, C.sub.4-7
oxo-cycloalkyl, phenoxy, phenyl, sulfonamide, sulfonic acid, and
thiol, and wherein C.sub.1-5 acyl, C.sub.1-6 acylsulfonamide,
C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4 alkylamino, C.sub.1-6
alkylsulfonamide, C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio,
arylsulfonyl, carbamimidoyl, C.sub.2-6 dialkylamino, heterocyclic,
heterocyclic-carbonyl, heteroaryl, phenoxy and phenyl are
optionally substituted with 1 to 5 substituents selected
independently from the group consisting of C.sub.1-5 acyl,
C.sub.1-5 acyloxy, C.sub.2-6 alkenyl, C.sub.1-4 alkoxy, C.sub.1-7
alkyl, C.sub.1-4 alkylamino, C.sub.1-4 alkylcarboxamide, C.sub.2-6
alkynyl, C.sub.1-4 alkylsulfonamide, C.sub.1-4 alkylsulfinyl,
C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio, C.sub.1-4 alkylureyl,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.3-7
cycloalkyl, C.sub.3-7 cycloalkyloxy, C.sub.2-6 dialkylamino,
C.sub.2-6 dialkylcarboxamide, halogen, C.sub.1-4 haloalkoxy,
C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkylthio, heteroaryl,
heterocyclic, hydroxyl, nitro, phenyl, and phosphonooxy, wherein
said C.sub.1-7 alkyl and C.sub.1-4 alkylcarboxamide are each
optionally substituted with 1 to 5 substituents selected from the
group consisting of C.sub.1-4 alkoxy and hydroxy; or [0339]
R.sub.11 is a group of Formula (IIIB):
[0339] ##STR00031## [0340] wherein: [0341] "p" and "r" are each
independently 0, 1, 2 or 3; and R.sub.16 is H, C.sub.1-5 acyl,
C.sub.2-6 alkenyl, C.sub.1-8 alkyl, C.sub.1-4 alkylcarboxamide,
C.sub.2-6 alkynyl, C.sub.1-4 alkylsulfonamide,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.3-7
cycloalkyl, C.sub.2-6 dialkylcarboxamide, halogen, heteroaryl or
phenyl, and wherein the heteroaryl or phenyl optionally substituted
with 1 to 5 substituents selected independently from the group
consisting of C.sub.1-4 alkoxy, amino, C.sub.1-4 alkylamino,
C.sub.2-6 alkynyl, C.sub.2-8 dialkylamino, halogen, C.sub.1-4
haloalkoxy, C.sub.1-4 haloalkyl and hydroxyl; and [0342] R.sub.12,
R.sub.13, R.sub.14, and R.sub.15 are each independently selected
form the group consisting of C.sub.1-5 acyl, C.sub.1-5 acyloxy,
C.sub.2-6 alkenyl, C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4
alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-4 alkylsulfonamide,
C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4
alkylthio, C.sub.1-4 alkylureyl, carbo-C.sub.1-6-alkoxy,
carboxamide, carboxy, cyano, C.sub.3-7 cycloalkyl, C.sub.2-6
dialkylcarboxamide, halogen, C.sub.1-4 haloalkoxy, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkylthio, hydroxyl and nitro; or
[0343] two adjacent groups selected from the group consisting of
R.sub.12, R.sub.13, R.sub.14 and R.sub.15 together with the atoms
to which they are attached form a 5-, 6- or 7-membered cycloalkyl,
cycloalkenyl or heterocyclic group fused with Ar.sub.1, wherein the
5-, 6- or 7-membered group is optionally substituted with halogen;
[0344] R.sub.1, R.sub.7 and R.sub.8 are each independently selected
from the group consisting of H, C.sub.1-5 acyloxy, C.sub.2-6
alkenyl, C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4
alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-4 alkylsulfonamide,
C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4
alkylthio, C.sub.1-4 alkylureyl, amino, C.sub.1-4 alkylamino,
C.sub.2-8 dialkylamino, carboxamide, cyano, C.sub.3-7 cycloalkyl,
C.sub.2-6 dialkylcarboxamide, C.sub.2-6 dialkylsulfonamide,
halogen, C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl, C.sub.1-4
haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkylthio and hydroxyl; [0345] R.sub.2 is selected from the
group consisting of C.sub.1-8 alkyl, amino, aryl, carboxamide,
carboxy, cyano, C.sub.3-6-cycloalkyl, C.sub.1-4 haloalkoxy,
C.sub.1-4 haloalkyl, halogen, heteroaryl and hydroxyl; and wherein
C.sub.1-8 alkyl, aryl or heteroaryl optionally substituted with 1
to 5 substituents selected from the group consisting of C.sub.1-5
acyl, C.sub.1-5 acyloxy, C.sub.1-4 alkoxy, C.sub.1-8 alkyl,
C.sub.1-4 alkylamino, C.sub.1-4 alkylcarboxamide, C.sub.1-4
alkylthiocarboxamide, C.sub.1-4 alkylsulfonamide, C.sub.1-4
alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio,
C.sub.1-4 alkylthioureyl, C.sub.1-4 alkylureyl, amino,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano,
C.sub.3-6-cycloalkyl,
C.sub.3-6-cycloalkyl-C.sub.1-3-heteroalkylene, C.sub.2-8
dialkylamino, C.sub.2-6 dialkylcarboxamide, C.sub.2-6
dialkylthiocarboxamide, C.sub.2-6 dialkylsulfonamide, C.sub.1-4
alkylthioureyl, C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl,
C.sub.1-4 haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylthio, halogen, heterocyclic,
hydroxyl, hydroxylamino and nitro; or [0346] R.sub.2 is
--Ar.sub.2--Ar.sub.3 wherein Ar.sub.2 and Ar.sub.3 are each
independently aryl or heteroaryl optionally substituted with 1 to 5
substituents selected from the group consisting of H, C.sub.1-5
acyl, C.sub.1-5 acyloxy, C.sub.1-4 alkoxy, C.sub.1-8 alkyl,
C.sub.1-4 alkylcarboxamide, C.sub.1-4 alkylthiocarboxamide,
C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4
alkylthio, amino, C.sub.1-4 alkylamino, carbo-C.sub.1-6-alkoxy,
carboxamide, carboxy, cyano, C.sub.3-6-cycloalkyl, C.sub.2-8
dialkylamino, C.sub.2-6 dialkylcarboxamide, C.sub.1-4 haloalkoxy,
C.sub.1-4 haloalkyl, halogen, hydroxyl and nitro; or [0347] R.sub.2
is a group of Formula (IIIC):
[0347] ##STR00032## [0348] wherein: [0349] R.sub.17 is H, C.sub.1-8
alkyl, C.sub.3-7 cycloalkyl, aryl, heteroaryl or OR.sub.19; and
R.sub.18 is F, Cl, Br, CN or NR.sub.20R.sub.21; where R.sub.19 is
H, C.sub.1-8 alkyl or C.sub.3-7 cycloalkyl, and R.sub.20 and
R.sub.21 are each independently H, C.sub.1-8 alkyl, C.sub.3-7
cycloalkyl, aryl or heteroaryl; or [0350] R.sub.2 is a group of
Formula (IIID):
[0350] ##STR00033## [0351] wherein: [0352] G is: [0353] i)
--C(O)--, --C(O)NR.sub.23--, --C(O)O--, --OC(O)NR.sub.23--,
--NR.sub.23C(O)O--, --OC(O)--, --C(S)--, --C(S)NR.sub.23--,
--C(S)O--, --OC(S)--, --CR.sub.23R.sub.24--, --O--, --S--, --S(O)--
or --S(O).sub.2-- when D is CR.sub.2R.sub.3, or [0354] ii)
--CR.sub.23R.sub.24C(O)--, --C(O)--,
--CR.sub.23R.sub.24C(O)NR.sub.25--, --C(O)NR.sub.23--, --C(O)O--,
--C(S)--, --C(S)NR.sub.23--, --C(S)O--, --CR.sub.23R.sub.24--,
--S(O).sub.2--, or a bond when D is NR.sub.2, [0355] wherein
R.sub.23, R.sub.24 and R.sub.25 are each independently H or
C.sub.1-8 alkyl; and R.sub.22 is H, C.sub.1-8 alkyl, C.sub.2-6
alkynyl, C.sub.3-7 cycloalkyl, phenyl, heteroaryl, or heterocyclic
each optionally substituted with 1 to 5 substituents selected from
the group consisting of C.sub.1-5 acyl, C.sub.1-5 acyloxy,
C.sub.2-6 alkenyl, C.sub.1-4 alkoxy, C.sub.1-7 alkyl, C.sub.1-4
alkylamino, C.sub.1-4 alkylcarboxamide, C.sub.1-4
alkylthiocarboxamide, C.sub.1-4 alkylsulfonamide, C.sub.1-4
alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio,
C.sub.1-4 alkylthioureyl, C.sub.1-4 alkylureyl, amino,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.3-7
cycloalkyl, C.sub.2-8 dialkylamino, C.sub.2-6 dialkylcarboxamide,
C.sub.2-4 dialkylthiocarboxamide, C.sub.2-6 dialkylsulfonamide,
C.sub.1-4 alkylthioureyl, C.sub.1-4 haloalkoxy, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylthio,
halogen, heteroaryl, heterocyclic, hydroxyl, hydroxylamino, nitro,
phenyl, phenoxy, and sulfonic acid, wherein said C.sub.1-7 alkyl,
heteroaryl, phenyl and phenoxy are each optionally substituted with
1 to 5 substituents selected from the group consisting of C.sub.1-5
acyl, C.sub.1-5 acyloxy, C.sub.1-4 alkoxy, C.sub.1-8 alkyl,
C.sub.1-4 alkylamino, C.sub.1-4 alkylcarboxamide, C.sub.1-4
alkylthiocarboxamide, C.sub.1-4 alkylsulfonamide, C.sub.1-4
alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio,
C.sub.1-4 alkylthioureyl, C.sub.1-4 alkylureyl, amino,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.3-7
cycloalkyl, C.sub.2-8 dialkylamino, C.sub.2-6 dialkylcarboxamide,
C.sub.2-6 dialkylthiocarboxamide, C.sub.2-6 dialkylsulfonamide,
C.sub.1-4 alkylthioureyl, C.sub.1-4 haloalkoxy, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylthio,
halogen, heterocyclic, hydroxyl, hydroxylamino, and nitro; [0356]
R.sub.3 is H, C.sub.1-8 alkyl, C.sub.1-4 alkoxy or hydroxyl; and
[0357] R.sub.4, R.sub.5 and R.sub.6 are each independently H,
C.sub.1-8 alkyl or C.sub.3-7 cycloalkyl, wherein said C.sub.1-8
alkyl is optionally substituted with C.sub.1-4 alkoxy, C.sub.3-7
cycloalkyl, or heteroaryl.
[0358] The present invention also encompasses diastereomers as well
as optical isomers, e.g. mixtures of enantiomers including racemic
mixtures, as well as individual enantiomers and diastereomers,
which arise as a consequence of structural asymmetry in certain
compounds of the invention. Separation of the individual isomers or
selective synthesis of the individual isomers is accomplished by
application of various methods which are well known to
practitioners in the art.
[0359] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022327 include the
following compounds according to Formula (III) (referred to herein
as Group C1):
3-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxymethyl]-pyr-
rolidine-1-carboxylic acid tert-butyl ester;
4-[5-Cyano-6-(6-methylsulfanyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid tert-butyl ester;
4-[5-Cyano-6-(6-methanesulfonyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-pip-
eridine-1-carboxylic acid tert-butyl ester;
[6-(1-Hexyl-piperidin-4-yloxy)-5-nitro-pyrimidin-4-yl]-(4-methanesulfonyl-
-phenyl)-amine;
[6-(1-Cyclopropylmethyl-piperidin-4-yloxy)-5-nitro-pyrimidin-4-yl]-(4-met-
hanesulfonyl-phenyl)-amine;
4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid isopropyl ester;
4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid 2-isopropyl-5-methyl-cyclohexyl ester;
{4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidi-
n-1-yl}-pyridin-3-yl-methanone;
(2-Chloro-pyridin-3-yl)-{4-[6-(4-methanesulfonyl-phenylamino)-5-nitro-pyr-
imidin-4-yloxy]-piperidin-1-yl}-methanone;
{4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidi-
n-1-yl}-pyridin-2-yl-methanone;
(4-Methanesulfonyl-phenyl)-[6-(1-methanesulfonyl-piperidin-4-yloxy)-5-nit-
ro-pyrimidin-4-yl]-amine;
(4-Methanesulfonyl-phenyl)-{5-nitro-6-[1-(propane-1-sulfonyl)-piperidin-4-
-yloxy]-pyrimidin-4-yl}-amine;
{6-[1-(Butane-1-sulfonyl)-piperidin-4-yloxy]-5-nitro-pyrimidin-4-yl}-(4-m-
ethanesulfonyl-phenyl)-amine;
(4-Methanesulfonyl-phenyl)-{5-nitro-6-[1-(thiophene-2-sulfonyl)-piperidin-
-4-yloxy]-pyrimidin-4-yl}-amine;
(4-Methanesulfonyl-phenyl)-{6-[1-(1-methyl-1H-imidazole-4-sulfonyl)-piper-
idin-4-yloxy]-5-nitro-pyrimidin-4-yl}-amine;
{6-[1-(2,4-Dimethyl-thiazole-5-sulfonyl)-piperidin-4-yloxy]-5-nitro-pyrim-
idin-4-yl}-(4-methanesulfonyl-phenyl)-amine;
4-[5-Cyano-6-(3-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]--
piperidine-1-carboxylic acid tert-butyl ester;
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]--
piperidine-1-carboxylic acid tert-butyl ester;
4-[5-Cyano-6-(4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid tert-butyl ester;
4-[6-(6-Methanesulfonyl-pyridin-3-ylamino)-5-nitro-pyrimidin-4-yloxy]-pip-
eridine-1-carboxylic acid tert-butyl ester;
4-[5-Acetyl-6-(6-methanesulfonyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid tert-butyl ester;
4-[5-Amino-6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]--
piperidine-1-carboxylic acid tert-butyl ester;
4-[5-Cyano-6-(4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid isopropyl ester;
4-[5-Cyano-6-(4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid ethyl ester;
4-[5-Cyano-6-(4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid isobutyl ester;
4-(4-Methanesulfonyl-phenylamino)-6-[1-(tetrahydro-furan-2-carbonyl)-pipe-
ridin-4-yloxy]-pyrimidine-5-carbonitrile;
4-[1-(3,3-Dimethyl-2-oxo-butyl)-piperidin-4-yloxy]-6-(4-methanesulfonyl-p-
henylamino)-pyrimidine-5-carbonitrile;
4-(4-Methanesulfonyl-phenylamino)-6-[1-(pyridine-3-carbonyl)-piperidin-4--
yloxy]-pyrimidine-5-carbonitrile;
4-(1-Formyl-piperidin-4-yloxy)-6-(4-methanesulfonyl-phenylamino)-pyrimidi-
ne-5-carbonitrile and
4-(4-Methanesulfonyl-phenylamino)-6-[1-(pyridine-2-carbonyl)-piperidin-4--
yloxy]-pyrimidine-5-carbonitrile.
[0360] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022327 include the
following compounds according to Formula (III) (referred to herein
as Group C2):
4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid tert-butyl ester;
(4-Methanesulfonyl-phenyl)-[5-nitro-6-(piperidin-4-yloxy)-pyrimidin-4-yl]-
-amine;
1-{4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-
-piperidin-1-yl}-3,3-dimethyl-butan-1-one;
(4-Methanesulfonyl-phenyl)-[5-nitro-6-(1-pyridin-2-ylmethyl-piperidin-4-y-
loxy)-pyrimidin-4-yl]-amine;
(4-Methanesulfonyl-phenyl)-[5-nitro-6-(1-pyridin-3-ylmethyl-piperidin-4-y-
loxy)-pyrimidin-4-yl]-amine;
{6-[1-(3,3-Dimethyl-butyl)-piperidin-4-yloxy]-5-nitro-pyrimidin-4-yl}-(4--
methanesulfonyl-phenyl)-amine;
(4-Methanesulfonyl-phenyl)-{6-[1-(3-methyl-butyl)-piperidin-4-yloxy]-5-ni-
tro-pyrimidin-4-yl}-amine;
(4-Methanesulfonyl-phenyl)-[5-nitro-6-(3,4,5,6-tetrahydro-2H-[1,2']bipyri-
dinyl-4-yloxy)-pyrimidin-4-yl]-amine;
4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid ethyl ester;
1-{4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperi-
din-1-yl}-3,3-dimethyl-butan-2-one;
{6-[1-(2-Ethoxy-ethyl)-piperidin-4-yloxy]-5-nitro-pyrimidin-4-yl}-(4-meth-
anesulfonyl-phenyl)-amine;
4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxymethyl]-pip-
eridine-1-carboxylic acid tert-butyl ester;
4-{2-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-ethyl}-
-piperidine-1-carboxylic acid tert-butyl ester;
3-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-pyrrolidi-
ne-1-carboxylic acid tert-butyl ester and
3-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxymethyl]-pyr-
rolidine-1-carboxylic acid tert-butyl ester.
[0361] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022327 include the
following compounds according to Formula (III) (referred to herein
as Group C3):
4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-ylamino]-piperid-
ine-1-carboxylic acid tert-butyl ester;
N-(4-Methanesulfonyl-phenyl)-5-nitro-N'-piperidin-4-yl-pyrimidine-4,6-dia-
mine;
1-{4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-ylamino]-
-piperidin-1-yl}-ethanone and
1-{4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-ylamino]-pipe-
ridin-1-yl}-2,2-dimethyl-propan-1-one.
[0362] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022327 include the
following compounds according to Formula (III) (referred to herein
as Group C4):
4-[6-(4-Cyano-2-fluoro-phenylamino)-5-ethynyl-pyrimidin-4-yloxy]-piperidi-
ne-1-carboxylic acid isopropyl ester;
4-[5-Ethynyl-6-(2-fluoro-4-[1,2,4]triazol-1-yl-phenylamino)-pyrimidin-4-y-
loxy]-piperidine-1-carboxylic acid isopropyl ester;
4-{5-Ethynyl-6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]--
pyrimidin-4-ylamino}-3-fluoro-benzonitrile;
{5-Ethynyl-6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-py-
rimidin-4-yl}-(2-fluoro-4-methanesulfonyl-phenyl)-amine;
4-{6-[2,5-Difluoro-4-(2-methanesulfonyl-ethyl)-phenylamino]-5-methyl-pyri-
midin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-sulfamoyl-ethyl)-phenylamino]-5-methyl-pyrimidin-4-yl-
oxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[6-(2-Fluoro-ethyl)-2-methyl-pyridin-3-ylamino]-5-methyl-pyrimidin-4-
-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{2-[4-Fluoro-6-(2-isopropoxy-ethyl)-pyridin-3-ylamino]-3-methyl-pyridin-
-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(2-[1,2,4]triazol-1-yl-ethyl)-phenylamino]-5-methyl--
pyrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{5-Ethynyl-6-[2-fluoro-4-(4-methoxy-pyridin-2-yl)-phenylamino]-pyrimidi-
n-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-propionylsulfamoyl-ethyl)-phenylamino]-5-methyl-pyrim-
idin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-methanesulfonyl-ethyl)-phenylamino]-5-methyl-pyrimidi-
n-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester; and
4-{6-[2,3-Difluoro-4-(2-methanesulfonyl-ethyl)-phenylamino]-5-methyl-pyri-
midin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester.
[0363] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022327 include the
following compounds according to Formula (III) (referred to herein
as Group C5):
4-[5-Acetyl-6-(6-methanesulfonyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid isobutyl ester;
1-[4-(1-Benzyl-azetidin-3-yloxy)-6-(6-methanesulfonyl-pyridin-3-ylamino)--
pyrimidin-5-yl]-ethanone;
4-[5-Cyano-6-(6-propylamino-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperid-
ine-1-carboxylic acid isopropyl ester;
4-[5-Cyano-6-(2-fluoro-4-isopropylamino-phenylamino)-pyrimidin-4-yloxy]-p-
iperidine-1-carboxylic acid isopropyl ester;
4-[5-Cyano-6-(2-fluoro-4-propylamino-phenylamino)-pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid isopropyl ester;
4-[5-Cyano-6-(2-fluoro-4-propoxy-phenylamino)-pyrimidin-4-yloxy]-piperidi-
ne-1-carboxylic acid isopropyl ester;
4-[5-Cyano-6-(6-propyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-
-carboxylic acid isopropyl ester;
4-{5-Cyano-6-[4-(2-dimethylamino-ethylsulfanyl)-2-fluoro-phenylamino]-pyr-
imidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{5-Cyano-6-[4-(2-dimethylamino-ethanesulfonyl)-2-fluoro-phenylamino]-3--
oxy-pyrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl
ester;
4-{5-Cyano-6-[2-fluoro-4-(4-methyl-piperazin-1-yl)-phenylamino]-pyrimidin-
-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{5-Cyano-6-[2-fluoro-4-(3-methyl-butylamino)-phenylamino]-pyrimidin-4-y-
loxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[5-Cyano-6-(2-fluoro-4-morpholin-4-yl-phenylamino)pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid isopropyl ester;
4-{5-Cyano-6-[4-(2-dimethylamino-ethylamino)-2-fluoro-phenylamino]-pyrimi-
din-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[5-Cyano-6-(4-dimethylamino-2-fluoro-phenylamino)-pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid isopropyl ester;
4-{5-Cyano-6-[2-fluoro-4-(2-pyrrolidin-1-yl-ethylamino)-phenylamino]-pyri-
midin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-methyl-pyrimidin-4-yloxy]-
-piperidine-1-carboxylic acid isopropyl ester;
4-{5-Cyano-6-[2-fluoro-4-(2-morpholin-4-yl-ethylamino)-phenylamino]-pyrim-
idin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-iodo-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[5-Cyano-6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]--
piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-morpholin-4-yl-phenylamino)-5-methyl-pyrimidin-4-yloxy]--
piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2,5-Difluoro-4-propoxy-phenylamino)-5-methyl-pyrimidin-4-yloxy]-pip-
eridine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-propylamino-phenylamino)-5-methyl-pyrimidin-4-yloxy]-pip-
eridine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-methoxy-ethylamino)-phenylamino]-5-methyl-pyrimidin-4-
-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-(6-{2-Fluoro-4-[(tetrahydro-furan-2-ylmethyl)-amino]-phenylamino}-5-met-
hyl-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl
ester;
4-{6-[2-Fluoro-4-(2-methanesulfonyl-ethylamino)-phenylamino]-5-methyl-pyr-
imidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-(6-{2-Fluoro-4-[(2-methanesulfonyl-ethyl)-methyl-amino]-phenylamino}-5--
methyl-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl
ester;
4-[6-(4-Bromo-2,5-difluoro-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piper-
idine-1-carboxylic acid isopropyl ester;
4-[6-(4-Cyano-2-fluoro-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid isopropyl ester;
4-[6-(4-Cyano-2,5-difluoro-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piper-
idine-1-carboxylic acid isopropyl ester;
4-[6-(2,5-Difluoro-4-morpholin-4-yl-phenylamino)-5-methyl-pyrimidin-4-ylo-
xy]-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(6-Chloro-2-methyl-pyridin-3-ylamino)-5-methyl-pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid isopropyl ester;
4-[5-Methyl-6-(2-methyl-6-morpholin-4-yl-pyridin-3-ylamino)-pyrimidin-4-y-
loxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[5-(4,5-Dihydro-1H-imidazol-2-yl)-6-(2-fluoro-4-methanesulfonyl-phenyla-
mino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl
ester;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-
-yl)-piperidin-4-yloxy]-5-methyl-pyrimidin-4-yl}-amine;
4-[6-(2-Fluoro-4-propoxy-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperid-
ine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-methanesulfonyl-ethoxy)-phenylamino]-5-methyl-pyrimid-
in-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-methoxy-ethoxy)-phenylamino]-5-methyl-pyrimidin-4-ylo-
xy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-isopropoxy-ethoxy)-phenylamino]-5-methyl-pyrimidin-4--
yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(6-Chloro-4-methyl-pyridin-3-ylamino)-5-methyl-pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-(N-hydroxycarbamimidoyl)--
pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[5-Carbamimidoyl-6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-
-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(tetrahydro-furan-2-ylmethoxy)-phenylamino]-5-methyl-pyr-
imidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[5-Methyl-6-(4-methyl-6-morpholin-4-yl-pyridin-3-ylamino)-pyrimidin-4-y-
loxy]-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[6-(2-Methoxy-ethoxy)-2-methyl-pyridin-3-ylamino]-5-methyl-pyrimidin-
-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[6-(2-Methoxy-ethoxy)-4-methyl-pyridin-3-ylamino]-5-methyl-pyrimidin-
-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(2-methoxy-ethoxy)-phenylamino]-5-methyl-pyrimidin-4-
-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-isopropoxy-ethylsulfamoyl)-phenylamino]-5-methyl-pyri-
midin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(N-hydroxycarbamimidoyl)-phenylamino]-5-methyl-pyrim-
idin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(4-Carbamoyl-2,5-difluoro-phenylamino)-5-methyl-pyrimidin-4-yloxy]-p-
iperidine-1-carboxylic acid isopropyl ester;
4-{6-[(2-Fluoro-4-methanesulfonyl-phenyl)-(2-methoxy-ethyl)-amino]-5-meth-
yl-pyrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(4-Carbamimidoyl-2,5-difluoro-phenylamino)-5-methyl-pyrimidin-4-ylox-
y]-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[4-(2-Ethoxy-ethoxy)-2-fluoro-phenylamino]-5-methyl-pyrimidin-4-ylox-
y}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(tetrahydro-pyran-4-yloxy)-phenylamino]-5-methyl-pyrimid-
in-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-hydroxy-ethoxy)-phenylamino]-5-methyl-pyrimidin-4-ylo-
xy}-piperidine-1-carboxylic acid isopropyl ester;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-methyl-pyrimidin-4-ylo-
xy]-piperidin-1-yl}-butan-1-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-methyl-pyrimidin-4-ylo-
xy]-piperidin-1-yl}-pentan-1-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-methyl-pyrimidin-4-ylo-
xy]-piperidin-1-yl}-3-methyl-butan-1-one;
4-{6-[2-Fluoro-4-(pyridin-2-ylmethoxy)-phenylamino]-5-methyl-pyrimidin-4--
yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[2-(2-Fluoro-4-methanesulfonyl-phenylamino)-3-methyl-pyridin-4-yloxy]-p-
iperidine-1-carboxylic acid isopropyl ester;
4-[6-(6-Chloro-4-fluoro-pyridin-3-ylamino)-5-cyano-pyrimidin-4-yloxy]-pip-
eridine-1-carboxylic acid isopropyl ester; and
4-[5-Amino-6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]--
piperidine-1-carboxylic acid isopropyl ester.
[0364] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022327 include the
following compound according to Formula (III) (referred to herein
as Group C6):
4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-methyl-pyrimidin-4-yl]--
isopropyl-amino}-methyl)-piperidine-1-carboxylic acid tert-butyl
ester.
[0365] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022327 include the
following compounds according to Formula (III) (referred to herein
as Group C7):
4-(2-Fluoro-4-methanesulfonyl-phenoxy)-6-[1-(3-methoxy-propyl)-piperidin--
4-yloxy]-5-methyl-pyrimidine;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-3-methoxy-propan-2-ol;
4-{6-[2-Fluoro-4-(5-isopropoxymethyl-[1,2,4]oxadiazol-3-yl)-phenoxy]-5-me-
thyl-pyrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl
ester;
4-{6-[2-Fluoro-4-(5-methoxy-pyridin-2-yl)-phenoxy]-5-methyl-pyrimidin-4-y-
loxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[6-(2-Cyclopropoxy-ethylamino)-2-methyl-pyridin-3-yloxy]-5-methyl-py-
rimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(pyridine-2-carbonyl)-phenoxy]-5-methyl-pyrimidin-4-ylox-
y}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methanesulfonylamino-pyrimidi-
n-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(4-Methoxy-6'-methyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-5'-ylox-
y)-5-methyl-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid
isopropyl ester; [0366]
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-2-(4-trifluoromethoxy-phenoxy)-propan-1-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-2-(4-trifluoromethoxy-phenoxy)-ethanone;
N-(4-Chloro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-
-pyrimidin-4-yloxy]-piperidin-1-yl}-acetamide;
N-(3-Chloro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-
-pyrimidin-4-yloxy]-piperidin-1-yl}-acetamide;
N-(3,5-Dichloro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-me-
thyl-pyrimidin-4-yloxy]-piperidin-1-yl}-acetamide;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-N-(4-trifluoromethyl-phenyl)-acetamide;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-N-phenyl-acetamide;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-N-(4-isopropyl-phenyl)-acetamide;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-N-(4-methoxy-phenyl)-acetamide;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-N-(3-trifluoromethyl-phenyl)-acetamide;
4-{6-[2-Fluoro-4-(3-methoxy-propane-1-sulfonyl)-phenoxy]-5-methyl-pyrimid-
in-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[6-(2-Isopropoxy-ethyl)-2-methyl-pyridin-3-yloxy]-5-methyl-pyrimidin-
-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{5-Methyl-6-[2-methyl-6-(2-pyridin-2-yl-ethoxy)-pyridin-3-yloxy]-pyrimi-
din-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(thiophene-2-carbonyl)-phenoxy]-5-methyl-pyrimidin-4-ylo-
xy}-piperidine-1-carboxylic acid isopropyl ester;
4-(6-{6-[(2-Isopropoxy-ethyl)-methyl-amino]-2-methyl-pyridin-3-yloxy}-5-m-
ethyl-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl
ester;
4-{6-[6-(2-Isopropoxy-ethanesulfonyl)-2-methyl-pyridin-3-yloxy]-5-methyl--
pyrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[6-(2-Hydroxy-ethanesulfonyl)-2-methyl-pyridin-3-yloxy]-5-methyl-pyr-
imidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(6-Amino-2-methyl-pyridin-3-yloxy)-5-methyl-pyrimidin-4-yloxy]-piper-
idine-1-carboxylic acid isopropyl ester;
4-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-6-[1-(3-methyl-butyl)-pip-
eridin-4-yloxy]-pyrimidine;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-morpholin-4-yl-ethanone;
1-(3,4-Dichloro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-me-
thyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
1-(3-Chloro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-
-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-thiophen-3-yl-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-phenyl-ethanone;
1-(2,4-Dimethoxy-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-m-
ethyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
4-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-6-[1-(4-methyl-pentyl)-pi-
peridin-4-yloxy]-pyrimidine;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-3-isopropoxy-propan-1-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-4-isopropoxy-butan-1-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-3-hydroxy-propan-1-one;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-(5-pyridin-2-yl-thiophen-2-yl)-ethanone;
4-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-6-[1-(5-methyl-hexyl)-pip-
eridin-4-yloxy]-pyrimidine;
3-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-3-oxo-propane-1-sulfonic acid;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-thiophen-2-yl-ethanone;
4-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-6-(1-pentyl-piperidin-4-y-
loxy)-pyrimidine;
4-(1-Butyl-piperidin-4-yloxy)-6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-me-
thyl-pyrimidine;
4-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-cyclohexanecarboxylic acid;
1-(4-Diethylamino-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5--
methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-(2-methyl-4-phenyl-furan-3-yl)-ethanone;
4-(2-Fluoro-4-methanesulfonyl-phenoxy)-6-(1-hexyl-piperidin-4-yloxy)-5-me-
thyl-pyrimidine;
4-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-butyric acid;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-pentan-2-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-hexan-2-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-4-hexan-2-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-4-methyl-pentan-2-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-5-methyl-hexan-2-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-6-methyl-heptan-2-one;
5-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-4-oxo-pentanoic acid;
5-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-4-oxo-pentanenitrile;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-2-pyridin-2-yl-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-pyridin-4-yl-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-ylmethyl}-acrylic acid;
1-[1,4]Dioxan-2-yl-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl--
pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
1-(2,3-Dihydro-[1,4]dioxin-2-yl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phen-
oxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-p-tolyl-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-(4-methoxy-phenyl)-ethanone;
1-(2-Chloro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-
-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
3-(2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-ylox-
y]-piperidin-1-yl}-acetyl)-benzonitrile;
1-(2,4-Dimethyl-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-me-
thyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
1-(4-Chloro-3-methyl-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-
-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
1-(4-Difluoromethoxy-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-
-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
1-(2,3-Dihydro-benzo[1,4]dioxin-6-yl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-
-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-(5-phenyl-thiophen-2-yl)-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-thiophen-2-yl-ethanone;
{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-pi-
peridin-1-yl}-acetic acid ethyl ester;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-3-methoxy-propan-2-ol;
4-(2-Fluoro-4-methanesulfonyl-phenoxy)-6-[1-(4-methoxy-cyclohexyl)-piperi-
din-4-yloxy]-5-methyl-pyrimidine;
-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-p-
iperidin-1-yl}-hexan-1-one;
4-{6-[2-Fluoro-4-(2-isobutoxy-ethoxy)-phenoxy]-5-methyl-pyrimidin-4-yloxy-
}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[4-(2-Cyclopropoxy-ethoxy)-2-fluoro-phenoxy]-5-methyl-pyrimidin-4-yl-
oxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[4-(2-Ethoxy-ethoxy)-2-fluoro-phenoxy]-5-methyl-pyrimidin-4-yloxy}-p-
iperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(3-methoxy-propoxy)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-
-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-pyridin-2-yl-ethoxy)-phenoxy]-5-methyl-pyrimidin-4-yl-
oxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(tetrahydro-pyran-4-yloxy)-phenoxy]-5-methyl-pyrimidin-4-
-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[4-(2-tert-Butoxy-ethoxy)-2-fluoro-phenoxy]-5-methyl-pyrimidin-4-ylo-
xy}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-sulfo-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-1--
carboxylic acid isopropyl ester;
4-[6-(2,5-Difluoro-4-trifluoromethoxy-phenoxy)-5-ethynyl-pyrimidin-4-ylox-
y]-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2,5-Difluoro-4-trifluoromethoxy-phenoxy)-5-prop-1-ynyl-pyrimidin-4--
yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[5-Ethynyl-6-(2-fluoro-4-methoxy-phenoxy)-pyrimidin-4-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[5-Ethynyl-6-(6-methoxy-4-methyl-pyridin-3-yloxy)-pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid isopropyl ester;
4-{5-Ethynyl-6-[6-(2-isopropoxy-ethyl)-2-methyl-pyridin-3-yloxy]-pyrimidi-
n-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(4-Cyano-2-fluoro-phenoxy)-5-ethynyl-pyrimidin-4-yloxy]-piperidine-1-
-carboxylic acid isopropyl ester;
4-[5-Ethynyl-6-(2-fluoro-4-[1,2,4]triazol-4-yl-phenoxy)-pyrimidin-4-yloxy-
]-piperidine-1-carboxylic acid isopropyl ester;
4-[5-Ethynyl-6-(2-fluoro-4-[1,2,4]triazol-1-yl-phenoxy)-pyrimidin-4-yloxy-
]-piperidine-1-carboxylic acid isopropyl ester;
1-{4-[5-Ethynyl-6-(2-fluoro-4-[1,2,4]triazol-1-yl-phenoxy)-pyrimidin-4-yl-
oxy]-piperidin-1-yl}-3-pyridin-2-yl-propan-1-one;
4-{5-Ethynyl-6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]--
pyrimidin-4-yloxy}-3-fluoro-benzonitrile;
5-Ethynyl-4-(2-fluoro-4-methanesulfonyl-phenoxy)-6-[1-(3-isopropyl-[1,2,4-
]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrimidine;
4-[1-(3-Ethyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-5-ethynyl-6-(2-fl-
uoro-4-methanesulfonyl-phenoxy)-pyrimidine;
4-[1-(3-Ethyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-6-(2-fluoro-4-met-
hanesulfonyl-phenoxy)-5-methyl-pyrimidine;
4-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-6-[1-(3-methyl-[1,2,4]oxa-
diazol-5-yl)-piperidin-4-yloxy]-pyrimidine;
4-[6-(2-Fluoro-4-methanesulfonylamino-phenoxy)-5-methyl-pyrimidin-4-yloxy-
]-piperidine-1-carboxylic acid isopropyl ester;
cis-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy-
]-cyclohexyl}-carbamic acid isopropyl ester;
trans-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-ylo-
xy]-cyclohexyl}-carbamic acid isopropyl ester;
N-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
cyclohexyl}-3-methyl-butyramide;
N-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
cyclohexyl}-isobutyramide;
4-{6-[2,5-Difluoro-4-(2-methanesulfonyl-ethyl)-phenoxy]-5-methyl-pyrimidi-
n-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[4-Fluoro-6-(2-methanesulfonyl-ethyl)-pyridin-3-yloxy]-5-methyl-pyri-
midin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{5-Cyclopropyl-6-[2,5-difluoro-4-(2-hydroxy-ethyl)-phenoxy]-pyrimidin-4-
-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-(5-Cyclopropyl-6-{2,5-difluoro-4-[2-(4-methoxy-piperidin-1-yl)-ethyl]-p-
henoxy}-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl
ester;
4-{6-[2,5-Difluoro-4-(2-morpholin-4-yl-ethyl)-phenoxy]-5-methyl-pyrimidin-
-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-(6-{2-Fluoro-4-[2-(4-methoxy-piperidin-1-yl)-ethyl]-phenoxy}-5-methyl-p-
yrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[6-(2-Fluoro-ethyl)-2-methyl-pyridin-3-yloxy]-5-methyl-pyrimidin-4-y-
loxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(1-hydroxy-cyclopropylmethyl)-phenoxy]-5-methyl-pyrimidi-
n-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{2-[2,5-Difluoro-4-(2-methanesulfonyl-ethyl)-phenoxy]-3-methyl-pyridin--
4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
(R)-4-(6-{2-Fluoro-4-[2-(3-methoxy-piperidin-1-yl)-ethyl]-phenoxy}-5-meth-
yl-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
(S)-4-(6-{2-Fluoro-4-[2-(3-methoxy-piperidin-1-yl)-ethyl]-phenoxy}-5-meth-
yl-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
(R)-4-(5-Ethynyl-6-{2-fluoro-4-[2-(2-methoxy-piperidin-1-yl)-ethyl]-pheno-
xy}-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl
ester;
(S)-4-(2-{2-Fluoro-4-[2-(2-methoxy-piperidin-1-yl)-ethyl]-phenoxy}-3-meth-
yl-pyridin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[4-Fluoro-6-(2-morpholin-4-yl-ethyl)-pyridin-3-yloxy]-5-methyl-pyrim-
idin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{5-Ethynyl-6-[4-fluoro-6-(2-methanesulfonyl-ethyl)-pyridin-3-yloxy]-pyr-
imidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{2-[2,5-Difluoro-4-(2-isopropoxy-ethyl)-phenoxy]-3-methyl-pyridin-4-ylo-
xy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-propionylsulfamoyl-ethyl)-phenoxy]-5-methyl-pyrimidin-
-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-sulfamoyl-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-
-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(2-sulfamoyl-ethyl)-phenoxy]-5-ethynyl-pyrimidin-4-y-
loxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(2-[1,2,4]triazol-1-yl-ethyl)-phenoxy]-5-methyl-pyri-
midin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2,3-Difluoro-4-(2-methanesulfonyl-ethyl)-phenoxy]-5-methyl-pyrimidi-
n-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-(2-{2-Fluoro-4-[2-(6-methoxy-pyridin-2-yl)-ethyl]-phenoxy}-3-methyl-pyr-
idin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
4-(6-{2-Fluoro-4-[2-(3-methoxy-pyridin-2-yl)-ethyl]-phenoxy}-5-methyl-pyr-
imidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(3-Fluoro-1-oxy-pyridin-4-yloxy)-5-methyl-pyrimidin-4-yloxy]-piperid-
ine-1-carboxylic acid isopropyl ester;
4-[6-(5'-Methoxy-6-methyl-[2,2']bipyridinyl-5-yloxy)-5-methyl-pyrimidin-4-
-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-{5-Ethynyl-6-[2-fluoro-4-(4-methoxy-pyridin-2-yl)-phenoxy]-pyrimidin-4--
yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(3-methoxy-pyridin-2-yl)-phenoxy]-5-methyl-pyrimidin-4-y-
loxy}-piperidine-1-carboxylic acid isopropyl ester;
4-(6-{2,5-Difluoro-4-[2-(3-methoxy-piperidin-1-yl)-ethyl]-phenoxy}-5-meth-
yl-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
and
4-(6-{2,5-Difluoro-4-[2-(3-methoxy-piperidin-1-yl)-ethyl]-phenoxy}-5-ethy-
nyl-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl
ester.
[0367] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022327 include the
following compounds according to Formula (III) (referred to herein
as Group C8):
4-[6-(2-Fluoro-4-morpholin-4-yl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid isopropyl ester;
{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-pi-
peridin-1-yl}-[6-(2-pyrrolidin-1-yl-ethyl)-pyridin-3-yl]-methanone;
(6-Amino-pyridin-3-yl)-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methy-
l-pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
4-[5-Ethyl-6-(2-fluoro-4-methanesulfonyl-phenoxy)-pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-1-carboxyl-
ic acid isopropyl ester;
4-{6-[6-(2-Isopropoxy-ethylamino)-2-methyl-pyridin-3-yloxy]-5-methyl-pyri-
midin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[6-(2-Hydroxy-ethylsulfanyl)-2-methyl-pyridin-3-yloxy]-5-methyl-pyri-
midin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[5-Methyl-6-(2-methyl-6-pentyl-pyridin-3-yloxy)-pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid isopropyl ester;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-(3-fluoro-phenyl)-ethanone;
4-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-6-[1-(2-pyridin-3-yl-ethy-
l)-piperidin-4-yloxy]-pyrimidine;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-(4-trifluoromethoxy-phenyl)-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-pyridin-2-yl-ethanone;
4-{6-[6-(2-Methoxy-ethanesulfonyl)-2-methyl-pyridin-3-yloxy]-5-methyl-pyr-
imidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-(2-Fluoro-4-methanesulfonyl-phenoxy)-6-[1-(3-isopropyl-[1,2,4]oxadiazol-
-5-yl)-piperidin-4-yloxy]-5-methyl-pyrimidine;
4-(6-{2-Fluoro-4-[(2-hydroxy-ethylcarbamoyl)-methyl]-phenoxy}-5-methyl-py-
rimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(5-Iodo-pyridin-2-yloxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-1-ca-
rboxylic acid isopropyl ester;
4-(6-{2-Fluoro-4-[N-(2-isopropoxy-ethyl)-carbamimidoyl]-phenoxy}-5-methyl-
-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(4-Carboxy-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine--
1-carboxylic acid isopropyl ester;
4-(4-Bromo-2-fluoro-phenoxy)-6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-pip-
eridin-4-yloxy]-5-methyl-pyrimidine;
4-[6-(5-Methanesulfonyl-pyridin-2-yloxy)-5-methyl-pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid isopropyl ester;
4-{6-[6-(2-Hydroxy-ethylamino)-2-methyl-pyridin-3-yloxy]-5-methyl-pyrimid-
in-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[5-Cyclopropyl-6-(2-fluoro-4-methanesulfonyl-phenoxy)-pyrimidin-4-yloxy-
]-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[6-(2-Methanesulfonyl-ethylamino)-2-methyl-pyridin-3-yloxy]-5-methyl-
-pyrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-4-oxo-butyric acid;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-(3-trifluoromethyl-phenyl)-ethanone;
4-{6-[6-(2-Methoxy-ethylsulfanyl)-2-methyl-pyridin-3-yloxy]-5-methyl-pyri-
midin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
1-(2,5-Dimethoxy-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-m-
ethyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-pyridin-2-yl-ethanone;
4-[6-(6-Chloro-2-methyl-pyridin-3-yloxy)-5-methyl-pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid isopropyl ester;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-(4-fluoro-phenyl)-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-(4-trifluoromethyl-phenyl)-ethanone;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-3,3-dimethyl-butan-2-one;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-pyridin-3-yl-ethanone;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-butan-2-one;
4-(6-{2-Fluoro-4-[(2-isopropoxy-ethylcarbamoyl)-methyl]-phenoxy}-5-methyl-
-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-1-(4-methanesulfonyl-phenyl)-ethanone;
1-(4-Chloro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-
-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
4-(2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-ylox-
y]-piperidin-1-yl}-acetyl)-benzonitrile;
1-(3,4-Difluoro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-me-
thyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
4-{6-[2-Fluoro-4-(2-isopropoxy-ethylcarbamoyl)-phenoxy]-5-methyl-pyrimidi-
n-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-butan-1-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-pentan-1-one;
4-[6-(2,4-Difluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-1-carb-
oxylic acid isopropyl ester;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-3-methyl-butan-1-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-4-methyl-pentan-1-one;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-5-methyl-hexan-1-one;
4-{6-[2-Fluoro-4-(2-methoxy-ethylcarbamoyl)-phenoxy]-5-methyl-pyrimidin-4-
-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-pip-
eridine-1-carboxylic acid isopropyl ester;
4-[6-(4-Bromo-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-1--
carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(methoxy-methyl-carbamoyl)-phenoxy]-5-methyl-pyrimidin-4-
-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-3-methoxy-propan-1-one;
4-[6-(4-Cyano-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-1--
carboxylic acid isopropyl ester;
4-[5-(5-Aminomethyl-4,5-dihydro-oxazol-2-yl)-6-(2-fluoro-4-methanesulfony-
l-phenoxy)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid
isopropyl ester;
4-{6-[6-(2-Methoxy-ethylamino)-2-methyl-pyridin-3-yloxy]-5-methyl--
pyrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[6-(3-Methanesulfonyl-pyrrolidin-1-yl)-2-methyl-pyridin-3-yloxy]-5-m-
ethyl-pyrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl
ester;
4-[6-(6-Benzylamino-2-methyl-pyridin-3-yloxy)-5-methyl-pyrimidin-4-yloxy]-
-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(4-Carbamoyl-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-isopropoxy-ethylamino)-phenoxy]-5-methyl-pyrimidin-4--
yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-(6-{2-Fluoro-4-[(tetrahydro-furan-2-ylmethyl)-amino]-phenoxy}-5-methyl--
pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
4-(6-{6-[(2-Methanesulfonyl-ethyl)-methyl-amino]-2-methyl-pyridin-3-yloxy-
}-5-methyl-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid
isopropyl ester;
4-[6-(2-Fluoro-4-hydroxycarbamoyl-phenoxy)-5-methyl-pyrimidin-4-yl-
oxy]-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-pyrrolidin-1-yl-ethylcarbamoyl)-phenoxy]-5-methyl-pyr-
imidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(4-isopropyl-piperazine-1-carbonyl)-phenoxy]-5-methyl-py-
rimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-morpholin-4-yl-ethyl)-phenoxy]-5-methyl-pyrimidin-4-y-
loxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-methanesulfonyl-ethyl)-phenoxy]-5-methyl-pyrimidin-4--
yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-hydroxy-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-p-
iperidine-1-carboxylic acid isopropyl ester;
4-[6-(4-Carboxymethyl-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piper-
idine-1-carboxylic acid isopropyl ester;
4-[6-(4-Dimethylcarbamoylmethyl-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-yl-
oxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-sulfamoyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-propionylsulfamoyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidine-1-carboxylic acid isopropyl ester;
4-[5-Ethynyl-6-(2-fluoro-4-methanesulfonyl-phenoxy)-pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-phosphonooxy-ethyl)-phenoxy]-5-methyl-pyrimidin-4-ylo-
xy}-piperidine-1-carboxylic acid isopropyl ester;
4-[5-Bromo-6-(2-fluoro-4-methanesulfonyl-phenoxy)-pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid isopropyl ester;
4-(6-{2-Fluoro-4-[2-(2-methanesulfonyl-pyrrolidin-1-yl)-2-oxo-ethyl]-phen-
oxy}-5-methyl-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid
isopropyl ester;
4-[6-(4-Carbamoylmethyl-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-ylo-
xy]-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-{[(tetrahydro-furan-2-ylmethyl)-carbamoyl]-methyl}-pheno-
xy)-5-methyl-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid
isopropyl ester;
4-[6-(2-Fluoro-3-sulfamoyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid isopropyl ester;
C-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]--
piperidin-1-yl}-C-(4-fluoro-phenyl)-methyleneamine;
3-tert-Butoxy-1-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrim-
idin-4-yloxy]-piperidin-1-yl}-propan-1-one;
2-Ethoxy-1-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin--
4-yloxy]-piperidin-1-yl}-ethanone;
{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-pi-
peridin-1-yl}-(tetrahydro-furan-2-yl)-methanone;
(S)-1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-ylo-
xy]-piperidin-1-yl}-3-methyl-2-methylamino-butan-1-one;
4-(6-{2-Fluoro-4-[2-(3-hydroxy-piperidin-1-yl)-2-oxo-ethyl]-phenoxy}-5-me-
thyl-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl
ester;
4-{6-[2-Fluoro-4-(2-morpholin-4-yl-2-oxo-ethyl)-phenoxy]-5-methyl-pyrimid-
in-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-imidazol-1-yl-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yl-
oxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-Fluoro-4-(2-[1,2,3]triazol-1-yl-ethyl)-phenoxy]-5-methyl-pyrimidi-
n-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
(R)-1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-ylo-
xy]-piperidin-1-yl}-3-methyl-2-methylamino-butan-1-one;
(S)-1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-ylo-
xy]-piperidin-1-yl}-3-hydroxy-butan-1-one;
(R)--N-(1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-
-yloxy]-piperidine-1-carbonyl}-2-methyl-propyl)-acetamide;
(S)--N-(1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-
-yloxy]-piperidine-1-carbonyl}-2-methyl-propyl)-acetamide;
(R)--N-(2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-
-yloxy]-piperidin-1-yl}-1-methyl-2-oxo-ethyl)-acetamide;
(S)--N-(2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-
-yloxy]-piperidin-1-yl}-1-methyl-2-oxo-ethyl)-acetamide;
4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-pip-
eridine-1-carboxylic acid (S)-tetrahydro-furan-3-yl ester;
4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-pip-
eridine-1-carboxylic acid (R)-tetrahydro-furan-3-yl ester;
4-[6-(2-Amino-4-ethanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piper-
idine-1-carboxylic acid isopropyl ester;
4-[6-(4-Methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-1-
-carboxylic acid isopropyl ester;
(1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-
-piperidine-1-carbonyl}-2-methyl-propyl)-carbamic acid tert-butyl
ester;
4-{6-[2-Fluoro-4-(6-methoxy-pyridin-3-yl)-phenoxy]-5-methyl-pyrimidin-4-y-
loxy}-piperidine-1-carboxylic acid isopropyl ester;
3-Amino-1-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-
-yloxy]-piperidin-1-yl}-4-methyl-pentan-1-one;
2-Amino-1-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-
-yloxy]-piperidin-1-yl}-3-methyl-butan-1-one;
4-{6-[2-Fluoro-4-(2-isopropoxy-ethoxy)-phenoxy]-5-methyl-pyrimidin-4-ylox-
y}-piperidine-1-carboxylic acid isopropyl ester; and
4-[5-Methyl-6-(4-sulfo-phenoxy)-pyrimidin-4-yloxy]-piperidine-1-carboxyli-
c acid isopropyl ester.
[0368] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022327 include the
following compounds according to Formula (III) (referred to herein
as Group C9):
4-({Cyclopropyl-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidi-
n-4-yl]-amino}-methyl)-piperidine-1-carboxylic acid tert-butyl
ester;
4-({Cyclopropyl-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidi-
n-4-yl]-amino}-methyl)-piperidine-1-carboxylic acid isopropyl
ester;
4-({[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yl]-isop-
ropyl-amino}-methyl)-piperidine-1-carboxylic acid isopropyl ester;
and
4-({Cyclopropylmethyl-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-py-
rimidin-4-yl]-amino}-methyl)-piperidine-1-carboxylic acid isopropyl
ester.
[0369] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022327 include the
following compound according to Formula (III) (referred to herein
as Group C10):
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-methyl-pyrimidin-4-ylsulf-
anyl]-piperidine-1-carboxylic acid isopropyl ester.
[0370] Examples of GPR119 agonists are described in International
Application No. PCT/US2004/022417 (published as WO 05/007658), the
disclosure of each of which is herein incorporated by reference in
its entirety. Disclosed in International Application No.
PCT/US2004/022417 as a GPR119 agonist is a compound of Formula
(IV):
##STR00034## [0371] wherein: [0372] A and B are each independently
C.sub.1-3 alkylene optionally substituted with 1 to 4 substituents
selected from the group consisting of C.sub.1-3 alkyl, C.sub.1-4
alkoxy, carboxy, cyano, C.sub.1-3 haloalkyl and halogen; [0373] D
is O, S, S(O), S(O).sub.2, CR.sub.1R.sub.2 or N--R.sub.2, wherein
R.sub.1 is selected from the group consisting of H, C.sub.1-8
alkyl, C.sub.1-4 alkoxy, halogen and hydroxyl; [0374] E is N, C or
CR.sub.3, wherein R.sub.3 is H or C.sub.1-8 alkyl; [0375] is a
single bond when E is N or CR.sub.3, or a double bond when E is C;
[0376] K is a C.sub.3-6 cycloalkylene or C.sub.1-3 alkylene wherein
each are optionally substituted with 1 to 4 substituents selected
from the group consisting of C.sub.1-3 alkyl, C.sub.1-4 alkoxy,
carboxy, cyano, C.sub.1-3 haloalkyl and halogen; or K is a bond;
[0377] Q is NR.sub.4, O, S, S(O) or S(O).sub.2, wherein R.sub.4 is
H or C.sub.1-8 alkyl and the C.sub.1-8 alkyl is optionally
substituted with C.sub.2-8 dialkylamine; [0378] T is N or CR.sub.5;
[0379] M is N or CR.sub.6; [0380] J is N or CR.sub.7; [0381] U is C
or N; [0382] V is N, CR.sub.1 or V is a bond; [0383] W is N or C;
[0384] X is O, S, N, CR.sub.9 or NR.sub.11; [0385] Y is O, S, N,
CR.sub.10 or NR.sub.12; [0386] Z is C or N; [0387] R.sub.5,
R.sub.6, R.sub.7, R.sub.8, R.sub.9 and R.sub.10 are each
independently selected from the group consisting of H, C.sub.1-5
acyloxy, C.sub.2-6 alkenyl, C.sub.1-4 alkoxy, C.sub.1-8 alkyl,
C.sub.1-4 alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-4
alkylsulfonamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl,
C.sub.1-4 alkylthio, C.sub.1-4 alkylureyl, amino, C.sub.1-4
alkylamino, C.sub.2-8 dialkylamino, carboxamide, cyano, C.sub.3-6
cycloalkyl, C.sub.2-6 dialkylcarboxamide, C.sub.2-6
dialkylsulfonamide, halogen, C.sub.1-4 haloalkoxy, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkylthio, hydroxyl, hydroxylamino
and nitro; wherein said C.sub.2-6 alkenyl, C.sub.1-8 alkyl,
C.sub.2-6 alkynyl and C.sub.3-6 cycloalkyl are optionally
substituted with 1, 2, 3 or 4 substituents selected from the group
consisting of C.sub.1-5 acyl, C.sub.1-5 acyloxy, C.sub.1-4 alkoxy,
C.sub.1-4 alkylamino, C.sub.1-4 alkylcarboxamide, C.sub.1-4
alkylthiocarboxamide, C.sub.1-4 alkylsulfonamide, C.sub.1-4
alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio,
C.sub.1-4 alkylthioureyl, C.sub.1-4 alkylureyl, amino,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.2-8
dialkylamino, C.sub.2-6 dialkylcarboxamide, C.sub.1-4
dialkylthiocarboxamide, C.sub.2-6 dialkylsulfonamide, C.sub.1-4
alkylthioureyl, C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl,
C.sub.1-4 haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylthio, halogen, hydroxyl,
hydroxylamino and nitro; [0388] R.sub.11 and R.sub.12 are each
independently selected from C.sub.2-6 alkenyl, C.sub.1-8 alkyl,
C.sub.2-6 alkynyl or C.sub.3-6 cycloalkyl each optionally
substituted with 1, 2, 3 or 4 substituents selected from the group
consisting of C.sub.1-5 acyl, C.sub.1-5 acyloxy, C.sub.1-4 alkoxy,
C.sub.1-4 alkylamino, C.sub.1-4 alkylcarboxamide, C.sub.1-4
alkylthiocarboxamide, C.sub.1-4 alkylsulfonamide, C.sub.1-4
alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio,
C.sub.1-4 alkylthioureyl, C.sub.1-4 alkylureyl, amino,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.2-8
dialkylamino, C.sub.2-6 dialkylcarboxamide, C.sub.1-4
dialkylthiocarboxamide, C.sub.2-6 dialkylsulfonamide, C.sub.1-4
alkylthioureyl, C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl,
C.sub.1-4 haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylthio, halogen, hydroxyl,
hydroxylamino and nitro; [0389] Ar.sub.1 is aryl or heteroaryl each
optionally substituted with R.sub.13, R.sub.14, R.sub.15, R.sub.16,
and R.sub.17; wherein R.sub.13 is selected from the group
consisting of C.sub.1-5 acyl, C.sub.1-6 acylsulfonamide, C.sub.1-5
acyloxy, C.sub.2-6 alkenyl, C.sub.1-4 alkoxy, C.sub.1-8 alkyl,
C.sub.1-4 alkylamino, C.sub.1-6 alkylcarboxamide, C.sub.1-4
alkylthiocarboxamide, C.sub.2-6 alkynyl, C.sub.1-4
alkylsulfonamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl,
C.sub.1-4 alkylthio, C.sub.1-4 alkylthioureyl, C.sub.1-4
alkylureyl, amino, arylsulfonyl, carbamimidoyl,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.3-7
cycloalkyl, C.sub.3-7 cycloalkyloxy, C.sub.2-6 dialkylamino,
C.sub.2-6 dialkylcarboxamide, C.sub.2-6 dialkylthiocarboxamide,
guanidinyl, halogen, C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl,
C.sub.1-4 haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkylthio, heterocyclic, heterocyclic-oxy,
heterocyclicsulfonyl, heterocyclic-carbonyl, heteroaryl,
heteroarylcarbonyl, hydroxyl, nitro, C.sub.4-7 oxo-cycloalkyl,
phenoxy, phenyl, sulfonamide, sulfonic acid, and thiol, and wherein
said C.sub.1-5 acyl, C.sub.1-6 acylsulfonamide, C.sub.1-4 alkoxy,
C.sub.1-8 alkyl, C.sub.1-4 alkylamino, C.sub.1-6 alkylsulfonamide,
C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio, arylsulfonyl,
carbamimidoyl, C.sub.2-6 dialkylamino, heterocyclic,
heterocyclic-carbonyl, heteroaryl, phenoxy and phenyl are
optionally substituted with 1 to 5 substituents selected
independently from the group consisting of C.sub.1-5 acyl,
C.sub.1-5 acyloxy, C.sub.2-6 alkenyl, C.sub.1-4 alkoxy, C.sub.1-7
alkyl, C.sub.1-4 alkylamino, C.sub.1-4 alkylcarboxamide, C.sub.2-6
alkynyl, C.sub.1-4 alkylsulfonamide, C.sub.1-4 alkylsulfinyl,
C.sub.1-4 alkylsulfonyl, C.sub.1-4 alkylthio, C.sub.1-4 alkylureyl,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.3-7
cycloalkyl, C.sub.3-7 cycloalkyloxy, C.sub.2-6 dialkylamino,
C.sub.2-6 dialkylcarboxamide, halogen, C.sub.1-4 haloalkoxy,
C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkylthio, heteroaryl,
heterocyclic, hydroxyl, nitro, phenyl, and phosphonooxy, and
wherein said C.sub.1-7 alkyl and C.sub.1-4 alkylcarboxamide are
each optionally substituted with 1 to 5 substituents selected from
the group consisting of C.sub.1-4 alkoxy and hydroxy; or [0390]
R.sub.13 is a group of Formula (IVA): (IVA)
[0390] ##STR00035## [0391] wherein: [0392] "p" and "r" are
independently 0, 1, 2 or 3; and [0393] R.sub.18 is H, C.sub.1-5
acyl, C.sub.2-6 alkenyl, C.sub.1-8 alkyl, C.sub.1-4
alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-4 alkylsulfonamide,
carbo-C.sub.1-6-alkoxy, carboxamide, carboxy, cyano, C.sub.3-7
cycloalkyl, C.sub.2-6 dialkylcarboxamide, halogen, heteroaryl or
phenyl, wherein said heteroaryl or phenyl optionally substituted
with 1 to 5 substituents selected independently from the group
consisting of C.sub.1-4 alkoxy, amino, C.sub.1-4 alkylamino,
C.sub.2-4 alkynyl, C.sub.2-8 dialkylamino, halogen, C.sub.1-4
haloalkoxy, C.sub.1-4 haloalkyl and hydroxyl; [0394] R.sub.14,
R.sub.15, R.sub.16, and R.sub.17 are each independently selected
form the group consisting of H, C.sub.1-5 acyl, C.sub.1-5 acyloxy,
C.sub.2-6 alkenyl, C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4
alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-4 alkylsulfonamide,
C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4
alkylthio, C.sub.1-4 alkylureyl, carbo-C.sub.1-6-alkoxy,
carboxamide, carboxy, cyano, C.sub.3-7 cycloalkyl, C.sub.2-6
dialkylcarboxamide, halogen, C.sub.1-4 haloalkoxy, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkylthio, hydroxyl and nitro; or
[0395] two adjacent R.sub.14, R.sub.15, R.sub.16 and R.sub.17
together with the atoms to which they are attached form a 5, 6 or 7
member cycloalkyl, cycloalkenyl or heterocyclic group fused with
Ar.sub.1 wherein the 5, 6 or 7 member group is optionally
substituted with halogen; and [0396] R.sub.2 is selected from the
group consisting of C.sub.1-8 alkyl, C.sub.2-6 alkynyl, amino,
aryl, carboxamide, carboxy, cyano, C.sub.3-6-cycloalkyl, C.sub.1-4
haloalkoxy, C.sub.1-4 haloalkyl, halogen, heteroaryl and hydroxyl;
and wherein said C.sub.1-8 alkyl, aryl and heteroaryl are each
optionally substituted with 1 to 5 substituents selected from the
group consisting of C.sub.1-5 acyl, C.sub.1-5 acyloxy, C.sub.1-4
alkoxy, C.sub.1-8 alkyl, C.sub.1-4 alkylamino, C.sub.1-4
alkylcarboxamide, C.sub.1-4 alkylthiocarboxamide, C.sub.1-4
alkylsulfonamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl,
C.sub.1-4 alkylthio, C.sub.1-4 alkylthioureyl, C.sub.1-4
alkylureyl, amino, carbo-C.sub.1-6-alkoxy, carboxamide, carboxy,
cyano, C.sub.3-6-cycloalkyl,
C.sub.3-6-cycloalkyl-C.sub.1-3-heteroalkylene, C.sub.2-8
dialkylamino, C.sub.2-6 dialkylcarboxamide, C.sub.2-6
dialkylthiocarboxamide, C.sub.2-6 dialkylsulfonamide, C.sub.1-4
alkylthioureyl, C.sub.1-4 haloalkoxy, C.sub.1-4 haloalkyl,
C.sub.1-4 haloalkylsulfinyl, C.sub.1-4 haloalkylsulfonyl, C.sub.1-4
haloalkyl, C.sub.1-4 haloalkylthio, halogen, heterocyclic,
hydroxyl, hydroxylamino and nitro; or [0397] R.sub.2 is
--Ar.sub.2--Ar.sub.3 wherein Ar.sub.2 and Ar.sub.3 are each
independently aryl or heteroaryl each optionally substituted with 1
to 5 substituents selected from the group consisting of H,
C.sub.1-5 acyl, C.sub.1-5 acyloxy, C.sub.1-4 alkoxy, C.sub.1-8
alkyl, C.sub.1-4 alkylcarboxamide, C.sub.1-4 alkylthiocarboxamide,
C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl, C.sub.1-4
alkylthio, amino, C.sub.1-4 alkylamino, carbo-C.sub.1-6-alkoxy,
carboxamide, carboxy, cyano, C.sub.3-6-cycloalkyl, C.sub.2-8
dialkylamino, C.sub.2-6 dialkylcarboxamide, C.sub.1-4 haloalkoxy,
C.sub.1-4 haloalkyl, halogen, hydroxyl and nitro; or [0398] R.sub.2
is a group of Formula (IVB):
[0398] ##STR00036## [0399] wherein: [0400] R.sub.19 is H, C.sub.1-8
alkyl, C.sub.3-7 cycloalkyl, aryl, heteroaryl or OR.sub.21; and
R.sub.20 is F, Cl, Br, CN or NR.sub.22R.sub.23; where R.sub.21 is
H, C.sub.1-8 alkyl or C.sub.3-7 cycloalkyl, and R.sub.22 and
R.sub.23 are independently H, C.sub.1-8 alkyl, C.sub.3-7
cycloalkyl, aryl or heteroaryl; or [0401] R.sub.2 is a group of
Formula (IVC):
[0401] ##STR00037## [0402] wherein: [0403] G is: [0404] i)
--C(O)--, --C(O)NR.sub.25--, --NR.sub.25C(O)--, --NR.sub.25--,
--NR.sub.25C(O)O--, --OC(O)NR.sub.25--,
--CR.sub.25R.sub.26NR.sub.27C(O)--,
--CR.sub.25R.sub.26C(O)NR.sub.27--, --C(O)O--, --OC(O)--, --C(S)--,
--C(S)NR.sub.25--, --C(S)O--, --OC(S)--, --CR.sub.25R.sub.26--,
--O--, --S--, --S(O)--, --S(O).sub.2-- or a bond when D is
CR.sub.2R.sub.3; or [0405] ii) --CR.sub.25R.sub.26C(O)--, --C(O)--,
--CR.sub.25R.sub.26C(O)NR.sub.27--, --C(O)NR.sub.25--, --C(O)O--,
--C(S)--, --C(S)NR.sub.25--, --C(S)O--, --CR.sub.25R.sub.26--,
--S(O).sub.2--, or a bond when D is NR.sub.2; [0406] wherein
R.sub.25, R.sub.26 and R.sub.27 are each independently H or
C.sub.1-8 alkyl; and R.sub.24 is H, C.sub.1-8 alkyl, C.sub.3-7
cycloalkyl, phenyl, heteroaryl, or heterocyclic each optionally
substituted with 1 to 5 substituents selected from the group
consisting of C.sub.1-5 acyl, C.sub.1-5 acyloxy, C.sub.2-6 alkenyl,
C.sub.1-4 alkoxy, C.sub.1-7 alkyl, C.sub.1-4 alkylamino, C.sub.1-4
alkylcarboxamide, C.sub.1-4 alkylthiocarboxamide, C.sub.1-4
alkylsulfonamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4 alkylsulfonyl,
C.sub.1-4 alkylthio, C.sub.1-4 alkylthioureyl, C.sub.1-4
alkylureyl, amino, carbo-C.sub.1-6-alkoxy, carboxamide, carboxy,
cyano, C.sub.3-7 cycloalkyl, C.sub.2-8 dialkylamino, C.sub.2-6
dialkylcarboxamide, C.sub.2-6 dialkylthiocarboxamide, C.sub.2-6
dialkylsulfonamide, C.sub.1-4 alkylthioureyl, C.sub.1-4 haloalkoxy,
C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylsulfinyl, C.sub.1-4
haloalkylsulfonyl, C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylthio,
halogen, heteroaryl, heterocyclic, hydroxyl, hydroxylamino, nitro,
phenyl, phenoxy, and sulfonic acid, wherein said C.sub.1-4 alkoxy,
C.sub.1-7 alkyl, C.sub.1-4 alkylamino, heteroaryl, phenyl and
phenoxy are each optionally substituted with 1 to 5 substituents
selected from the group consisting of C.sub.1-5 acyl, C.sub.1-5
acyloxy, C.sub.1-4 alkoxy, C.sub.1-8 alkyl, C.sub.1-4 alkylamino,
C.sub.1-4 alkylcarboxamide, C.sub.1-4 alkylthiocarboxamide,
C.sub.1-4 alkylsulfonamide, C.sub.1-4 alkylsulfinyl, C.sub.1-4
alkylsulfonyl, C.sub.1-4 alkylthio, C.sub.1-4 alkylthioureyl,
C.sub.1-4 alkylureyl, amino, carbo-C.sub.1-6-alkoxy, carboxamide,
carboxy, cyano, C.sub.3-7 cycloalkyl, C.sub.2-8 dialkylamino,
C.sub.2-6 dialkylcarboxamide, C.sub.2-6 dialkylthiocarboxamide,
C.sub.2-6 dialkylsulfonamide, C.sub.1-4 alkylthioureyl, C.sub.1-4
haloalkoxy, C.sub.1-4 haloalkyl, C.sub.1-4 haloalkylsulfinyl,
C.sub.1-4 haloalkylsulfonyl, C.sub.1-4 haloalkyl, C.sub.1-4
haloalkylthio, halogen, heterocyclic, hydroxyl, hydroxylamino,
nitro, and phenyl; [0407] provided that Z and U are not both N.
[0408] The present invention also encompasses diastereomers as well
as optical isomers, e.g. mixtures of enantiomers including racemic
mixtures, as well as individual enantiomers and diastereomers,
which arise as a consequence of structural asymmetry in certain
compounds of the invention. Separation of the individual isomers or
selective synthesis of the individual isomers is accomplished by
application of various methods which are well known to
practitioners in the art.
[0409] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compounds according to Formula (IV) (referred to herein
as Group D1):
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid tert-butyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-3-methyl-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
oxy]-piperidine-1-carboxylic acid tert-butyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-3,6-dimethyl-1H-pyrazolo[3,4-d]pyrimidin--
4-yloxy]-piperidine-1-carboxylic acid tert-butyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid isobutyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid isopropyl ester;
1-(4-Methanesulfonyl-phenyl)-4-(piperidin-4-yloxy)-1H-pyrazolo[3,4-d]pyri-
midine;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylo-
xy]-piperidin-1-yl}-pyridin-3-yl-methanone;
(3-Fluoro-phenyl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyri-
midin-4-yloxy]-piperidin-1-yl}-methanone;
(1-tert-Butyl-5-methyl-1H-pyrazol-4-yl)-{4-[1-(4-methanesulfonyl-phenyl)--
1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(5-tert-Butyl-2-methyl-2H-pyrazol-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)--
1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-pi-
peridine-1-carboxylic acid tert-butyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-pi-
peridine-1-carboxylic acid isopropyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-pi-
peridine-1-carboxylic acid isobutyl ester;
Furan-2-yl-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-
-yloxy]-piperidin-1-yl}-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(1-methyl-1H-pyrrol-2-yl)-methanone;
2-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
iperidin-1-yl}-1-pyridin-3-yl-ethanone;
2-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
iperidin-1-yl}-1-pyridin-2-yl-ethanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(5-methyl-pyridin-3-yl)-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(2-methyl-pyridin-3-yl)-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(6-methyl-pyridin-3-yl)-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(5-methyl-isoxazol-3-yl)-methanone;
2-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
iperidin-1-yl}-1-thiophen-2-yl-ethanone;
4-(1-Benzyl-azetidin-3-yloxy)-1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,-
4-d]pyrimidine;
3-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-pi-
peridine-1-carboxylic acid tert-butyl ester;
1-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
iperidin-1-yl}-3,3-dimethyl-butan-2-one;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-pyrazin-2-yl-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(5-methyl-pyrazin-2-yl)-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-pyrimidin-5-yl-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-pyridazin-4-yl-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-thiophen-2-yl-methanone;
(3,4-Dimethyl-isoxazol-5-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo-
[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
3-tert-Butoxy-1-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimi-
din-4-yloxy]-piperidin-1-yl}-propan-1-one;
(3-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]--
piperidin-1-yl}-3-oxo-propyl)-methyl-carbamic acid tert-butyl
ester;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(6-trifluoromethyl-pyridin-3-yl)-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-c-
yclohexyl}-carbamic acid tert-butyl ester;
N-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-cyclohe-
xane-1,4-diamine;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(4-methyl-[1,2,3]thiadiazol-5-yl)-methanone;
(3,5-Dimethyl-isoxazol-4-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo-
[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(2,5-Dimethyl-2H-pyrazol-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazo-
lo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(3-methyl-isoxazol-5-yl)-methanone;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carbothioic acid pyridin-4-ylamide;
N-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-
-cyclohexyl}-nicotinamide;
3-tert-Butoxy-N-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimi-
din-4-ylamino]-cyclohexyl}-propionamide;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-c-
yclohexyl}-carbamic acid tert-butyl ester;
(3,5-Dimethyl-isoxazol-4-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo-
[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
4-[1-(3,5-Bis-trifluoromethyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy-
]-piperidine-1-carboxylic acid tert-butyl ester;
3-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-azet-
idine-1-carboxylic acid isopropyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid butyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid propyl ester;
4-[1-(3-Fluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-1--
carboxylic acid tert-butyl ester;
4-[1-(2,4-Difluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid tert-butyl ester;
{4-[1-(2,4-Difluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-cycloh-
exyl}-carbamic acid tert-butyl ester;
{4-[1-(3-Fluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-cyclohexyl-
}-carbamic acid tert-butyl ester;
N-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-cyclohe-
xane-1,4-diamine;
{3-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-p-
iperidin-1-yl}-(6-methyl-pyridin-3-yl)-methanone;
{3-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-p-
iperidin-1-yl}-(2-methyl-pyridin-3-yl)-methanone;
{3-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-p-
iperidin-1-yl}-(5-methyl-pyridin-3-yl)-methanone;
{3-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-p-
iperidin-1-yl}-pyridin-3-yl-methanone;
{3-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-p-
iperidin-1-yl}-(1-methyl-1H-pyrrol-3-yl)-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-cyc-
lohexyl}-carbamic acid tert-butyl ester;
N-[1-(2,4-Difluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-cyclohexane--
1,4-diamine;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(4-trifluoromethyl-pyridin-3-yl)-methanone;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid cyclohexyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid tetrahydro-pyran-4-yl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid cyclopentyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid tetrahydro-furan-3-yl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid tetrahydro-furan-3-yl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid tetrahydro-thiopyran-4-yl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid cyclobutyl ester;
(6-tert-Butyl-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[-
3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(4-{[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]--
methyl}-cyclohexyl)-carbamic acid tert-butyl ester;
N-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-
-cyclohexylmethyl}-nicotinamide;
N-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-
-cyclohexylmethyl}-6-methyl-nicotinamide;
4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
oxy]-piperidine-1-carboxylic acid tert-butyl ester;
4-({[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-methy-
l-amino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-{[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-m-
ethyl}-piperidine-1-carboxylic acid tert-butyl ester;
3-{[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-m-
ethyl}-piperidine-1-carboxylic acid tert-butyl ester;
4-({Ethyl-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-
-amino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-{1-[2-(2-Dimethylamino-ethoxy)-4-methanesulfonyl-phenyl]-1H-pyrazolo[3,-
4-d]pyrimidin-4-yloxy}-piperidine-1-carboxylic acid tert-butyl
ester;
3-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
amino]-piperidine-1-carboxylic acid tert-butyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid pyridin-3-ylmethyl esteracid tert-butyl
ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid 2-pyridin-3-yl-ethyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid 3-pyridin-3-yl-propyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid 2-dimethylamino-ethyl ester;
4-{[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-methyl-
-amino}-piperidine-1-carboxylic acid tert-butyl ester;
4-[1-(2,4-Difluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid tert-butyl ester;
4-({Ethyl-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimi-
din-4-yl]-amino}-methyl)-piperidine-1-carboxylic acid isopropyl
ester;
4-({Ethyl-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimi-
din-4-yl]-amino}-methyl)-piperidine-1-carboxylic acid tert-butyl
ester;
4-[6-Dimethylamino-1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimid-
in-4-yloxy]-piperidine-1-carboxylic acid tert-butyl ester;
1-(4-{[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-met-
hyl-amino}-piperidin-1-yl)-3,3-dimethyl-butan-2-one;
4-{[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-methyl-
-amino}-piperidine-1-carboxylic acid cyclobutyl ester; and
4-[({1-[4-(2-Methanesulfonyl-ethyl)-phenyl]-1H-pyrazolo[3,4-d]pyrimidin-4-
-yl}-methyl-amino)-methyl]-piperidine-1-carboxylic acid tert-butyl
ester.
[0410] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compounds according to Formula (IV) (referred to herein
as Group D2):
4-({[1-(2,5-Difluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-methyl-ami-
no}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
2-{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-
-yloxy]-piperidin-1-yl}-1-(4-trifluoromethoxy-phenyl)-ethanone;
2-{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-
-yloxy]-piperidin-1-yl}-1-(3-fluoro-phenyl)-ethanone;
2-{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-
-yloxy]-piperidin-1-yl}-1-pyridin-2-yl-ethanone;
(2,5-Dimethyl-furan-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,-
4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
4-({(2-Dimethylamino-ethyl)-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-
-d]pyrimidin-4-yl]-amino}-methyl)-piperidine-1-carboxylic acid
tert-butyl ester;
4-({(2-Dimethylamino-ethyl)-[1-(2-fluoro-4-methanesulfonyl-phenyl)-
-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-amino}-methyl)-piperidine-1-carboxylic
acid tert-butyl ester;
4-[1-(2-Dimethylamino-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimid-
in-4-yloxy]-piperidine-1-carboxylic acid tert-butyl ester;
4-(2-{Ethyl-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-y-
l]-amino}-ethyl)-piperazine-1-carboxylic acid tert-butyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylsulfanyl]-
-piperidine-1-carboxylic acid tert-butyl ester;
4-{2-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-e-
thyl}-piperazine-1-carboxylic acid ethyl ester;
4-{2-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
ropyl}-piperazine-1-carboxylic acid ethyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidine-4-sulfinyl]--
piperidine-1-carboxylic acid tert-butyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidine-4-sulfonyl]--
piperidine-1-carboxylic acid tert-butyl ester;
4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
sulfanyl]-piperidine-1-carboxylic acid tert-butyl ester;
4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
sulfanyl]-piperidine-1-carboxylic acid butyl ester;
4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
sulfanyl]-piperidine-1-carboxylic acid 2-methoxy-ethyl ester;
4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
sulfanyl]-piperidine-1-carboxylic acid 3,3-dimethyl-butyl ester;
4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
sulfanyl]-piperidine-1-carboxylic acid 4-methyl-pentyl ester;
4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
sulfanyl]-piperidine-1-carboxylic acid cyclopropylmethyl ester;
4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
sulfanyl]-piperidine-1-carboxylic acid cyclobutylmethyl ester;
4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
sulfanyl]-piperidine-1-carboxylic acid 2-cyclopropyl-ethyl ester;
(5-Bromo-furan-2-yl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazol-
o[3,4-d]pyrimidin-4-ylsulfanyl]-piperidin-1-yl}-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(5-morpholin-4-ylmethyl-furan-2-yl)-methanone;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid pentyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid 1-ethyl-propyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid 2-ethyl-butyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid cyclopentylmethyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid 2-pyrrolidin-1-yl-ethyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid 2-morpholin-4-yl-ethyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid ethyl ester;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid 2,2-dimethyl-propyl ester;
(5-Butyl-pyridin-2-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d-
]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
Ethyl-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin--
4-yl]-(3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-ylmethyl)-amine;
Ethyl-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin--
4-yl]-(5'-trifluoromethyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-ylmeth-
yl)-amine;
[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-
-(5'-trifluoromethyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-yl)-amine;
4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
oxy]-piperidine-1-carboxylic acid isopropyl ester;
5'-Fluoro-4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-y-
loxy]-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-5'-m-
ethyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl;
4-[1-(4-Methanesulfonyl-phenyl)-H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-6'-tr-
ifluoromethyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl;
[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]--
[1-(3-isopropyl-[1,2,4]oxadiazol-5-ylmethyl)-pyrrolidin-3-yl]-amine;
[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]--
[1-(3-isopropyl-[1,2,4]oxadiazol-5-ylmethyl)-pyrrolidin-3-yl]-amine;
(4-Ethyl-pyridin-2-yl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyraz-
olo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol--
5-ylmethyl)-pyrrolidin-3-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol--
5-ylmethyl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
(5'-Fluoro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl;
-4-yl)-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-am-
ine;
(5-Bromo-pyridin-3-yl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-p-
yrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
3-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
oxy]-pyrrolidine-1-carboxylic acid tert-butyl ester;
3-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-py-
rrolidine-1-carboxylic acid tert-butyl ester;
3-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
amino]-pyrrolidine-1-carboxylic acid isopropyl ester;
(6-Chloro-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4--
d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(5-Chloro-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4--
d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(1-methyl-3-trifluoromethyl-1H-pyrazol-4-yl)-methanone;
(2-Chloro-pyridin-4-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4--
d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(4-Hydroxy-3-methoxy-phenyl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo-
[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(4-Chloro-3-nitro-phenyl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,-
4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
1-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
iperidin-1-yl}-3-methyl-butan-1-one;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(6-pyrazol-1-yl-pyridin-3-yl)-methanone;
(2-Hydroxy-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-
-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(5,6-Dichloro-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[-
3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(5-Bromo-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d-
]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
5-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
iperidine-1-carbonyl}-nicotinic acid;
(1H-Imidazol-4-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyr-
imidin-4-yloxy]-piperidin-1-yl}-methanone;
3-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pyrr-
olidine-1-carboxylic acid tert-butyl ester;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(6-pyrrolidin-1-yl-pyridin-3-yl)-methanone;
(6-Isobutylamino-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazo-
lo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(6-Ethylamino-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[-
3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(6-Cyclobutylamino-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyra-
zolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(6-Isopropylamino-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyraz-
olo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
[6-(1-Ethyl-propylamino)-pyridin-3-yl]-{4-[1-(4-methanesulfonyl-phenyl)-1-
H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-[6-(1-propyl-butylamino)-pyridin-3-yl]-methanone;
5-Benzyloxy-2-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidi-
n-4-yloxy]-piperidine-1-carbonyl}-pyran-4-one;
Benzo[c]isoxazol-3-yl-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]-
pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(4-Chloro-pyridin-2-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4--
d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(4-Iodo-pyridin-2-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]-
pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
1-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
iperidin-1-yl}-butan-2-one;
2-(5-Bromo-pyridin-3-yl)-1-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3-
,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
(6-Fluoro-pyridin-2-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4--
d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(5-Fluoro-pyridin-2-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4--
d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(6-Chloro-pyridin-2-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4--
d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(2-Chloro-5-fluoro-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyra-
zolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-[5-(2-methyl-pyrrolidin-1-ylmethyl)-pyridin-3-yl]-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(6-methyl-pyridin-2-yl)-methanone;
5-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
iperidine-1-carbonyl}-nicotinonitrile;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(4-methoxy-pyridin-2-yl)-methanone;
(2-Fluoro-pyridin-4-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4--
d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(2-Fluoro-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4--
d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(6-Fluoro-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4--
d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(4-methoxy-thiophen-3-yl)-methanone;
2-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
iperidine-1-carbonyl}-pyran-4-one;
(5-Ethyl-pyridin-2-yl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyraz-
olo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(4-Ethoxy-phenyl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3-
,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-(5-pyridin-2-yl-thiophen-2-yl)-methanone;
(5-Amino-pyridin-2-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d-
]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(5-Amino-pyridin-2-yl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyraz-
olo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-y-
loxy]-piperidin-1-yl}-[5-(3-methyl-butylamino)-pyridin-2-yl]-methanone;
{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-y-
loxy]-piperidin-1-yl}-(4-trifluoromethoxy-phenyl)-methanone;
(5-Butyl-pyridin-2-yl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyraz-
olo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
(5-Ethylamino-pyridin-2-yl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H--
pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-y-
loxy]-piperidin-1-yl}-(5-isopropoxymethyl-pyridin-2-yl)-methanone;
(4-Difluoromethoxy-phenyl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-p-
yrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-y-
loxy]-piperidin-1-yl}-(5-isopropoxy-pyridin-2-yl)-methanone;
5-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
iperidine-1-carbonyl}-pyridine-2-carboxylic acid methyl ester;
{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridin-1-yl}-acetic acid ethyl ester;
{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-y-
loxy]-piperidin-1-yl}-(3-trifluoromethoxy-phenyl)-methanone;
1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
1-(4-Chloro-phenyl)-2-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]-
pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
2-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
iperidin-1-yl}-1-(3-trifluoromethyl-phenyl)-ethanone;
4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
oxy]-5'-isopropoxy-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl;
1-(4-Methanesulfonyl-phenyl)-4-[1-(4-trifluoromethoxy-phenyl)-piperidin-4-
-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(4-trifluoromethoxy-phenyl)-pi-
peridin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
1-(4-Chloro-3-methyl-phenyl)-2-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazo-
lo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
1-(3,4-Dichloro-phenyl)-2-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,-
4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
5'-Bromo-4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
oxy]-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl;
1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(3-trifluoromethoxy-phenyl)-pi-
peridin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-5'-t-
rifluoromethyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl;
1-(2,4-Dimethoxy-phenyl)-2-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3-
,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
1-(4-Difluoromethoxy-phenyl)-2-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazo-
lo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
1-(4-Diethylamino-phenyl)-2-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[-
3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
(2-{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin--
4-yloxy]-piperidin-1-yl}-5-methyl-pyrimidin-4-yl)-dimethyl-amine;
1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(5-methyl-4-pyrrolidin-1-yl-py-
rimidin-2-yl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
sulfanyl]-piperidine-1-carboxylic acid isopropyl ester;
4-[1-(2-Methyl-4-propylamino-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-
-piperidine-1-carboxylic acid isopropyl ester;
4-[1-(4-Isopropylamino-2-methyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylo-
xy]-piperidine-1-carboxylic acid isopropyl ester;
4-[1-(2-Methyl-4-morpholin-4-yl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylo-
xy]-piperidine-1-carboxylic acid isopropyl ester;
4-{1-[4-(2-Methoxy-ethylamino)-2-methyl-phenyl]-1H-pyrazolo[3,4-d]pyrimid-
in-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-(1-{4-[(2-Methanesulfonyl-ethyl)-methyl-amino]-2-methyl-phenyl}-1H-pyra-
zolo[3,4-d]pyrimidin-4-yloxy)-piperidine-1-carboxylic acid
isopropyl ester;
4-[1-(4-Bromo-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperid-
ine-1-carboxylic acid isopropyl ester;
4-[1-(4-Propylamino-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidi-
ne-1-carboxylic acid isopropyl ester;
4-[1-(4-Isopropylamino-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piper-
idine-1-carboxylic acid isopropyl ester;
4-(1-{4-[4-(2-Methanesulfonyl-ethyl)-piperazin-1-yl]-2-methyl-phenyl}-1H--
pyrazolo[3,4-d]pyrimidin-4-yloxy)-piperidine-1-carboxylic acid
isopropyl ester;
4-(1-{2-Methyl-4-[(tetrahydro-furan-2-ylmethyl)-amino]-phenyl}-1H--
pyrazolo[3,4-d]pyrimidin-4-yloxy)-piperidine-1-carboxylic acid
isopropyl ester;
4-[1-(4-Cyclopropylamino-2-methyl-phenyl)-1H-pyrazolo[3,4-d]pyrimi-
din-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-{1-[4-(2-Dimethylamino-ethylamino)-2-methyl-phenyl]-1H-pyrazolo[3,4-d]p-
yrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[1-(4-Morpholin-4-yl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piper-
idine-1-carboxylic acid isopropyl ester;
4-({[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4--
yl]-isopropyl-amino}-methyl)-piperidine-1-carboxylic acid
tert-butyl ester;
4-[1-(2-Fluoro-4-morpholin-4-yl-phenyl)-1H-pyrazolo[3,4-d]pyrimidi-
n-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[1-(2-Fluoro-4-isopropylamino-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylo-
xy]-piperidine-1-carboxylic acid isopropyl ester;
4-(1-{4-[(2-Methanesulfonyl-ethyl)-methyl-amino]-phenyl}-1H-pyrazolo[3,4--
d]pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
4-{1-[4-(2-Methoxy-ethylamino)-phenyl]-1H-pyrazolo[3,4-d]pyrimidin-4-ylox-
y}-piperidine-1-carboxylic acid isopropyl ester;
4-(1-{4-[(Tetrahydro-furan-2-ylmethyl)-amino]-phenyl}-1H-pyrazolo[3,4-d]p-
yrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
4-(1-{4-[4-(2-Methanesulfonyl-ethyl)-piperazin-1-yl]-phenyl}-1H-pyrazolo[-
3,4-d]pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl
ester;
4-[1-(4-Amino-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-1-c-
arboxylic acid isopropyl ester;
4-({[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4--
yl]-isopropyl-amino}-methyl)-piperidine-1-carboxylic acid isopropyl
ester;
4-[1-(5-Ethyl-pyrimidin-2-yl)-piperidin-4-ylsulfanyl]-1-(2-fluoro-4-metha-
nesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidine;
4-[1-(2-Fluoro-4-sulfamoyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-p-
iperidine-1-carboxylic acid isopropyl ester;
4-[1-(2-Fluoro-4-propionylsulfamoyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-
-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[1-(4-Cyano-2-fluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piper-
idine-1-carboxylic acid isopropyl ester;
1-(2,5-Difluoro-4-methoxy-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl-
)-cyclohexyloxy]-1H-pyrazolo[3,4-d]pyrimidine;
4-[1-(2,5-Difluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin--
4-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[1-(4-Fluoro-6-methoxy-pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylox-
y]-piperidine-1-carboxylic acid isopropyl ester;
4-[1-(6-Methoxy-2-methyl-pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylox-
y]-piperidine-1-carboxylic acid isopropyl ester;
4-[1-(2,5-Difluoro-4-sulfamoyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylox-
y]-piperidine-1-carboxylic acid isopropyl ester;
4-[1-(2-Fluoro-4-hydroxy-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridine-1-carboxylic acid isopropyl ester;
3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
yrazolo[3,4-d]pyrimidin-1-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
yrazolo[3,4-d]pyrimidin-1-yl}-benzonitrile;
3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
yrazolo[3,4-d]pyrimidin-1-yl}-benzenesulfonamide;
1-(2,5-Difluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
1-(4-Fluoro-6-methoxy-pyridin-3-yl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
4-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-1-(6-methoxy--
2-methyl-pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidine;
2,5-Difluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-ylox-
y]-pyrazolo[3,4-d]pyrimidin-1-yl}-benzenesulfonamide;
1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-cyclohexyloxy]-1H-pyrazolo[3,4-d]pyrimidine;
3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyraz-
olo[3,4-d]pyrimidin-1-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyraz-
olo[3,4-d]pyrimidin-1-yl}-benzonitrile;
3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyraz-
olo[3,4-d]pyrimidin-1-yl}-benzenesulfonamide;
1-(2,5-Difluoro-4-methanesulfonyl-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-cyclohexyloxy]-1H-pyrazolo[3,4-d]pyrimidine;
1-(4-Fluoro-6-methoxy-pyridin-3-yl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-cyclohexyloxy]-1H-pyrazolo[3,4-d]pyrimidine;
4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1-(6-methoxy-2-me-
thyl-pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidine;
2,5-Difluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-p-
yrazolo[3,4-d]pyrimidin-1-yl}-benzenesulfonamide;
4-[1-(2-Fluoro-4-methoxy-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pip-
eridine-1-carboxylic acid isopropyl ester;
4-[1-(4-Difluoromethoxy-2-fluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl-
oxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[1-(2-Fluoro-4-trifluoromethoxy-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-y-
loxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[1-(2,5-Difluoro-4-methoxy-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-
-piperidine-1-carboxylic acid isopropyl ester;
3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
yrazolo[3,4-d]pyrimidin-1-yl}-phenol;
1-(2-Fluoro-4-methoxy-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-pi-
peridin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
1-(4-Difluoromethoxy-2-fluoro-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
1-(2-Fluoro-4-trifluoromethoxy-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-
-5-yl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
1-(2,5-Difluoro-4-methoxy-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl-
)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyraz-
olo[3,4-d]pyrimidin-1-yl}-phenol;
1-(2-Fluoro-4-methoxy-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cy-
clohexyloxy]-1H-pyrazolo[3,4-d]pyrimidine;
1-(4-Difluoromethoxy-2-fluoro-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-cyclohexyloxy]-1H-pyrazolo[3,4-d]pyrimidine; and
1-(2-Fluoro-4-trifluoromethoxy-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-
-5-yl)-cyclohexyloxy]-1H-pyrazolo[3,4-d]pyrimidine.
[0411] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compounds according to Formula (IV) (referred to herein
as Group D3):
4-[9-(6-Methanesulfonyl-pyridin-3-yl)-9H-purin-6-yloxy]-piperidine-1-carb-
oxylic acid isobutyl ester;
{4-[9-(6-Methanesulfonyl-pyridin-3-yl)-9H-purin-6-yloxy]-piperidin-1-yl}--
pyridin-3-yl-methanone;
4-[9-(4-Methanesulfonyl-phenyl)-9H-purin-6-yloxy]-piperidine-1-carboxylic
acid tert-butyl ester;
4-[9-(6-Methanesulfonyl-pyridin-3-yl)-9H-purin-6-yloxy]-piperidine-1-carb-
oxylic acid tert-butyl ester and
4-[9-(2-Fluoro-4-methanesulfonyl-phenyl)-9H-purin-6-yloxy]-piperidine-1-c-
arboxylic acid tert-butyl ester.
[0412] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compounds according to Formula (IV) (referred to herein
as Group D4):
4-[9-(2-Fluoro-4-propionylsulfamoyl-phenyl)-9H-purin-6-yloxy]-piperidine--
1-carboxylic acid isopropyl ester;
4-[9-(4-Cyano-2-fluoro-phenyl)-9H-purin-6-yloxy]-piperidine-1-carboxylic
acid isopropyl ester;
4-[9-(2-Fluoro-4-sulfamoyl-phenyl)-9H-purin-6-yloxy]-piperidine-1-carboxy-
lic acid isopropyl ester;
9-(2-Fluoro-4-methanesulfonyl-phenyl)-6-[1-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-piperidin-4-yloxy]-9H-purine;
3-Fluoro-4-{6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
urin-9-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
urin-9-yl}-benzonitrile;
3-Fluoro-4-{6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
urin-9-yl}-benzenesulfonamide;
4-[9-(2,5-Difluoro-4-methanesulfonyl-phenyl)-9H-purin-6-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[9-(4-Fluoro-6-methoxy-pyridin-3-yl)-9H-purin-6-yloxy]-piperidine-1-car-
boxylic acid isopropyl ester;
4-[9-(6-Methoxy-2-methyl-pyridin-3-yl)-9H-purin-6-yloxy]-piperidine-1-car-
boxylic acid isopropyl ester;
4-[9-(2,5-Difluoro-4-sulfamoyl-phenyl)-9H-purin-6-yloxy]-piperidine-1-car-
boxylic acid isopropyl ester;
9-(2,5-Difluoro-4-methanesulfonyl-phenyl)-6-[1-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-piperidin-4-yloxy]-9H-purine;
9-(4-Fluoro-6-methoxy-pyridin-3-yl)-6-[1-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-piperidin-4-yloxy]-9H-purine;
6-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-9-(6-methoxy--
2-methyl-pyridin-3-yl)-9H-purine;
2,5-Difluoro-4-{6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-ylox-
y]-purin-9-yl}-benzenesulfonamide;
9-(2-Fluoro-4-methanesulfonyl-phenyl)-6-[4-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-cyclohexyloxy]-9H-purine;
3-Fluoro-4-{6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-purin-
-9-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-purin-
-9-yl}-benzonitrile;
3-Fluoro-4-{6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-purin-
-9-yl}-benzenesulfonamide;
9-(2,5-Difluoro-4-methanesulfonyl-phenyl)-6-[4-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-cyclohexyloxy]-9H-purine;
9-(4-Fluoro-6-methoxy-pyridin-3-yl)-6-[4-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-cyclohexyloxy]-9H-purine;
6-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-9-(6-methoxy-2-me-
thyl-pyridin-3-yl)-9H-purine; and
2,5-Difluoro-4-{6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-p-
urin-9-yl}-benzenesulfonamide.
[0413] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compound according to Formula (IV) (referred to herein as
Group D5):
4-[3-(4-Methanesulfonyl-phenyl)-3H-[1,2,3]triazolo[4,5-d]pyrimidin-7-ylox-
y]-piperidine-1-carboxylic acid tert-butyl ester.
[0414] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compounds according to Formula (IV) (referred to herein
as Group D6):
3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-piperidin-4-yloxy]-3H-[1,2,3]triazolo[4,5-d]pyrimidine;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-[-
1,2,3]triazolo[4,5-d]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-[-
1,2,3]triazolo[4,5-d]pyrimidin-3-yl}-benzonitrile;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-[-
1,2,3]triazolo[4,5-d]pyrimidin-3-yl}-benzenesulfonamide;
3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-cyclohexyloxy]-3H-[1,2,3]triazolo[4,5-d]pyrimidine;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-[1,2,-
3]triazolo[4,5-d]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-[1,2,-
3]triazolo[4,5-d]pyrimidin-3-yl}-benzonitrile;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-[1,2,-
3]triazolo[4,5-d]pyrimidin-3-yl}-benzenesulfonamide;
3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-cyclohexyloxy]-3H-[1,2,3]triazolo[4,5-d]pyrimidine;
3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-cyclohexyloxy]-3H-[1,2,3]triazolo[4,5-d]pyrimidine;
7-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-3-(6-methoxy-2-me-
thyl-pyridin-3-yl)-3H-[1,2,3]triazolo[4,5-d]pyrimidine;
2,5-Difluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-[-
1,2,3]triazolo[4,5-d]pyrimidin-3-yl}-benzenesulfonamide;
4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-3H-[1,2,3]triazolo[4,5-d]pyrimid-
in-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2-Fluoro-4-propionylsulfamoyl-phenyl)-3H-[1,2,3]triazolo[4,5-d]pyri-
midin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(4-Cyano-2-fluoro-phenyl)-3H-[1,2,3]triazolo[4,5-d]pyrimidin-7-yloxy-
]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2-Fluoro-4-sulfamoyl-phenyl)-3H-[1,2,3]triazolo[4,5-d]pyrimidin-7-y-
loxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-3H-[1,2,3]triazolo[4,5-d]pyr-
imidin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(4-Fluoro-6-methoxy-pyridin-3-yl)-3H-[1,2,3]triazolo[4,5-d]pyrimidin-
-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(6-Methoxy-2-methyl-pyridin-3-yl)-3H-[1,2,3]triazolo[4,5-d]pyrimidin-
-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2,5-Difluoro-4-sulfamoyl-phenyl)-3H-[1,2,3]triazolo[4,5-d]pyrimidin-
-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-piperidin-4-yloxy]-3H-[1,2,3]triazolo[4,5-d]pyrimidine;
3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-piperidin-4-yloxy]-3H-[1,2,3]triazolo[4,5-d]pyrimidine;
7-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-3-(6-methoxy--
2-methyl-pyridin-3-yl)-3H-[1,2,3]triazolo[4,5-d]pyrimidine; and
2,5-Difluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-ylox-
y]-[1,2,3]triazolo[4,5-d]pyrimidin-3-yl}-benzenesulfonamide.
[0415] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compound according to Formula (IV) (referred to herein as
Group D7):
4-[3-(4-Methanesulfonyl-phenyl)-isoxazolo[4,5-d]pyrimidin-7-yloxy]-piperi-
dine-1-carboxylic acid tert-butyl ester.
[0416] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compounds according to Formula (IV) (referred to herein
as Group D8):
4-({Ethyl-[3-(4-methanesulfonyl-phenyl)-isoxazolo[4,5-d]pyrimidin-7-yl]-a-
mino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-[3-(4-Methanesulfonyl-phenyl)-isoxazolo[4,5-d]pyrimidin-7-ylsulfanyl]-p-
iperidine-1-carboxylic acid tert-butyl ester; and
4-[3-(4-Methanesulfonyl-phenyl)-isoxazolo[4,5-d]pyrimidin-7-yloxy]-piperi-
dine-1-carboxylic acid isopropyl ester.
[0417] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compound according to Formula (IV) (referred to herein as
Group D9):
4-[8-(2-Fluoro-4-methanesulfonyl-phenyl)-[1,7]naphthyridin-4-yloxy]-piper-
idine-1-carboxylic acid isopropyl ester.
[0418] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compounds according to Formula (IV) (referred to herein
as Group D10):
4-[8-(2-Fluoro-4-methanesulfonyl-phenyl)-quinolin-4-yloxy]-piperidine-1-c-
arboxylic acid isopropyl ester;
4-[8-(4-Methylsulfanyl-phenyl)-quinolin-4-yloxy]-piperidine-1-carboxylic
acid isopropyl ester;
4-[8-(4-Methanesulfonyl-phenyl)-quinolin-4-yloxy]-piperidine-1-carboxylic
acid isopropyl ester;
4-[8-(4-Isopropoxy-phenyl)-quinolin-4-yloxy]-piperidine-1-carboxylic
acid isopropyl ester;
4-[8-(4-Bromo-2-fluoro-phenyl)-quinolin-4-yloxy]-piperidine-1-carboxylic
acid isopropyl ester;
4-[8-(2-Fluoro-4-propionylsulfamoyl-phenyl)-quinolin-4-yloxy]-piperidine--
1-carboxylic acid isopropyl ester;
4-[8-(4-Cyano-2-fluoro-phenyl)-quinolin-4-yloxy]-piperidine-1-carboxylic
acid isopropyl ester;
4-[8-(2-Fluoro-4-sulfamoyl-phenyl)-quinolin-4-yloxy]-piperidine-1-carboxy-
lic acid isopropyl ester;
4-[8-(2,5-Difluoro-4-methanesulfonyl-phenyl)-quinolin-4-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[8-(4-Fluoro-6-methoxy-pyridin-3-yl)-quinolin-4-yloxy]-piperidine-1-car-
boxylic acid isopropyl ester;
4-[8-(6-Methoxy-2-methyl-pyridin-3-yl)-quinolin-4-yloxy]-piperidine-1-car-
boxylic acid isopropyl ester;
4-[8-(2,5-Difluoro-4-sulfamoyl-phenyl)-quinolin-4-yloxy]-piperidine-1-car-
boxylic acid isopropyl ester;
2,5-Difluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-ylox-
y]-quinolin-8-yl}-benzenesulfonamide;
4-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-8-(6-methoxy--
2-methyl-pyridin-3-yl)-quinoline;
8-(4-Fluoro-6-methoxy-pyridin-3-yl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-piperidin-4-yloxy]-quinoline;
8-(2,5-Difluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-piperidin-4-yloxy]-quinoline;
3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-q-
uinolin-8-yl}-benzenesulfonamide;
3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-q-
uinolin-8-yl}-benzonitrile;
3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-q-
uinolin-8-yl}-N-propionyl-benzenesulfonamide;
8-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-piperidin-4-yloxy]-quinoline;
2,5-Difluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-q-
uinolin-8-yl}-benzenesulfonamide;
4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-8-(6-methoxy-2-me-
thyl-pyridin-3-yl)-quinoline;
8-(4-Fluoro-6-methoxy-pyridin-3-yl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-cyclohexyloxy]-quinoline;
8-(2,5-Difluoro-4-methanesulfonyl-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-cyclohexyloxy]-quinoline;
3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-quino-
lin-8-yl}-benzenesulfonamide;
3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-quino-
lin-8-yl}-benzonitrile;
3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-quino-
lin-8-yl}-N-propionyl-benzenesulfonamide; and
8-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-cyclohexyloxy]-quinoline.
[0419] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compounds according to Formula (IV) (referred to herein
as Group D11):
4-[8-(2-Fluoro-4-methanesulfonyl-phenyl)-pyrido[3,4-d]pyrimidin-4-yloxy]--
piperidine-1-carboxylic acid isopropyl ester;
4-[8-(2-Fluoro-4-propionylsulfamoyl-phenyl)-pyrido[3,4-d]pyrimidin-4-ylox-
y]-piperidine-1-carboxylic acid isopropyl ester;
4-[8-(4-Cyano-2-fluoro-phenyl)-pyrido[3,4-d]pyrimidin-4-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[8-(2-Fluoro-4-sulfamoyl-phenyl)-pyrido[3,4-d]pyrimidin-4-yloxy]-piperi-
dine-1-carboxylic acid isopropyl ester;
4-[8-(2,5-Difluoro-4-methanesulfonyl-phenyl)-pyrido[3,4-d]pyrimidin-4-ylo-
xy]-piperidine-1-carboxylic acid isopropyl ester;
4-[8-(4-Fluoro-6-methoxy-pyridin-3-yl)-pyrido[3,4-d]pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid isopropyl ester;
4-[8-(6-Methoxy-2-methyl-pyridin-3-yl)-pyrido[3,4-d]pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid isopropyl ester;
4-[8-(2,5-Difluoro-4-sulfamoyl-phenyl)-pyrido[3,4-d]pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid isopropyl ester;
8-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-piperidin-4-yloxy]-pyrido[3,4-d]pyrimidine;
3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
yrido[3,4-d]pyrimidin-8-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
yrido[3,4-d]pyrimidin-8-yl}-benzonitrile;
3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
yrido[3,4-d]pyrimidin-8-yl}-benzenesulfonamide;
8-(2,5-Difluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-piperidin-4-yloxy]-pyrido[3,4-d]pyrimidine;
8-(4-Fluoro-6-methoxy-pyridin-3-yl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-piperidin-4-yloxy]-pyrido[3,4-d]pyrimidine;
4-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-8-(6-methoxy--
2-methyl-pyridin-3-yl)-pyrido[3,4-d]pyrimidine;
2,5-Difluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-ylox-
y]-pyrido[3,4-d]pyrimidin-8-yl}-benzenesulfonamide;
8-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-cyclohexyloxy]-pyrido[3,4-d]pyrimidine;
3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrid-
o[3,4-d]pyrimidin-8-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrid-
o[3,4-d]pyrimidin-8-yl}-benzonitrile;
3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrid-
o[3,4-d]pyrimidin-8-yl}-benzenesulfonamide;
8-(2,5-Difluoro-4-methanesulfonyl-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-cyclohexyloxy]-pyrido[3,4-d]pyrimidine;
8-(4-Fluoro-6-methoxy-pyridin-3-yl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-cyclohexyloxy]-pyrido[3,4-d]pyrimidine;
4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-8-(6-methoxy-2-me-
thyl-pyridin-3-yl)-pyrido[3,4-d]pyrimidine; and
2,5-Difluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-p-
yrido[3,4-d]pyrimidin-8-yl}-benzenesulfonamide.
[0420] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compounds according to Formula (IV) (referred to herein
as Group D12):
3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-cyclohexyloxy]-pyrazolo[1,5-a]pyrimidine;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyraz-
olo[1,5-a]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyraz-
olo[1,5-a]pyrimidin-3-yl}-benzonitrile;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyraz-
olo[1,5-a]pyrimidin-3-yl}-benzenesulfonamide;
3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-cyclohexyloxy]-pyrazolo[1,5-a]pyrimidine;
3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-cyclohexyloxy]-pyrazolo[1,5-a]pyrimidine;
7-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-3-(6-methoxy-2-me-
thyl-pyridin-3-yl)-pyrazolo[1,5-a]pyrimidine;
2,5-Difluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-p-
yrazolo[1,5-a]pyrimidin-3-yl}-benzenesulfonamide;
4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-pyrazolo[1,5-a]pyrimidin-7-yloxy-
]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2-Fluoro-4-propionylsulfamoyl-phenyl)-pyrazolo[1,5-a]pyrimidin-7-yl-
oxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(4-Cyano-2-fluoro-phenyl)-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidi-
ne-1-carboxylic acid isopropyl ester;
4-[3-(2-Fluoro-4-sulfamoyl-phenyl)-pyrazolo[1,5-a]pyrimidin-7-yloxy]-pipe-
ridine-1-carboxylic acid isopropyl ester;
4-[3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-pyrazolo[1,5-a]pyrimidin-7-y-
loxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(4-Fluoro-6-methoxy-pyridin-3-yl)-pyrazolo[1,5-a]pyrimidin-7-yloxy]--
piperidine-1-carboxylic acid isopropyl ester;
4-[3-(6-Methoxy-2-methyl-pyridin-3-yl)-pyrazolo[1,5-a]pyrimidin-7-yloxy]--
piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2,5-Difluoro-4-sulfamoyl-phenyl)-pyrazolo[1,5-a]pyrimidin-7-yloxy]--
piperidine-1-carboxylic acid isopropyl ester;
3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-piperidin-4-yloxy]-pyrazolo[1,5-a]pyrimidine;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
yrazolo[1,5-a]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
yrazolo[1,5-a]pyrimidin-3-yl}-benzonitrile;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-p-
yrazolo[1,5-a]pyrimidin-3-yl}-benzenesulfonamide;
3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-piperidin-4-yloxy]-pyrazolo[1,5-a]pyrimidine;
3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-piperidin-4-yloxy]-pyrazolo[1,5-a]pyrimidine;
7-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-3-(6-methoxy--
2-methyl-pyridin-3-yl)-pyrazolo[1,5-a]pyrimidine;
2,5-Difluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-ylox-
y]-pyrazolo[1,5-a]pyrimidin-3-yl}-benzenesulfonamide;
4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-2-methyl-pyrazolo[1,5-a]pyrimidi-
n-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2-Fluoro-4-propionylsulfamoyl-phenyl)-2-methyl-pyrazolo[1,5-a]pyrim-
idin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(4-Cyano-2-fluoro-phenyl)-2-methyl-pyrazolo[1,5-a]pyrimidin-7-yloxy]-
-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2-Fluoro-4-sulfamoyl-phenyl)-2-methyl-pyrazolo[1,5-a]pyrimidin-7-yl-
oxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-2-methyl-pyrazolo[1,5-a]pyri-
midin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(4-Fluoro-6-methoxy-pyridin-3-yl)-2-methyl-pyrazolo[1,5-a]pyrimidin--
7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(6-Methoxy-2-methyl-pyridin-3-yl)-2-methyl-pyrazolo[1,5-a]pyrimidin--
7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2,5-Difluoro-4-sulfamoyl-phenyl)-2-methyl-pyrazolo[1,5-a]pyrimidin--
7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
2,5-Difluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-ylox-
y]-2-methyl-pyrazolo[1,5-a]pyrimidin-3-yl}-benzenesulfonamide;
7-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-3-(6-methoxy--
2-methyl-pyridin-3-yl)-2-methyl-pyrazolo[1,5-a]pyrimidine;
3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-piperidin-4-yloxy]-2-methyl-pyrazolo[1,5-a]pyrimidine;
3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-piperidin-4-yloxy]-2-methyl-pyrazolo[1,5-a]pyrimidine;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-
-methyl-pyrazolo[1,5-a]pyrimidin-3-yl}-benzenesulfonamide;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-
-methyl-pyrazolo[1,5-a]pyrimidin-3-yl}-benzonitrile;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-
-methyl-pyrazolo[1,5-a]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide;
3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-piperidin-4-yloxy]-2-methyl-pyrazolo[1,5-a]pyrimidine;
3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-cyclohexyloxy]-2-methyl-pyrazolo[1,5-a]pyrimidine;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-met-
hyl-pyrazolo[1,5-a]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-met-
hyl-pyrazolo[1,5-a]pyrimidin-3-yl}-benzonitrile;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-met-
hyl-pyrazolo[1,5-a]pyrimidin-3-yl}-benzenesulfonamide;
3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-cyclohexyloxy]-2-methyl-pyrazolo[1,5-a]pyrimidine;
3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-cyclohexyloxy]-2-methyl-pyrazolo[1,5-a]pyrimidine;
7-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-3-(6-methoxy-2-me-
thyl-pyridin-3-yl)-2-methyl-pyrazolo[1,5-a]pyrimidine; and
2,5-Difluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-
-methyl-pyrazolo[1,5-a]pyrimidin-3-yl}-benzenesulfonamide.
[0421] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compounds according to Formula (IV) (referred to herein
as Group D13):
4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-1-methyl-1H-pyrazolo[4,3-d]pyrim-
idin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2-Fluoro-4-propionylsulfamoyl-phenyl)-1-methyl-1H-pyrazolo[4,3-d]py-
rimidin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(4-Cyano-2-fluoro-phenyl)-1-methyl-1H-pyrazolo[4,3-d]pyrimidin-7-ylo-
xy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2-Fluoro-4-sulfamoyl-phenyl)-1-methyl-1H-pyrazolo[4,3-d]pyrimidin-7-
-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-1-methyl-1H-pyrazolo[4,3-d]p-
yrimidin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(4-Fluoro-6-methoxy-pyridin-3-yl)-1-methyl-1H-pyrazolo[4,3-d]pyrimid-
in-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(6-Methoxy-2-methyl-pyridin-3-yl)-1-methyl-1H-pyrazolo[4,3-d]pyrimid-
in-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2,5-Difluoro-4-sulfamoyl-phenyl)-1-methyl-1H-pyrazolo[4,3-d]pyrimid-
in-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-piperidin-4-yloxy]-1-methyl-1H-pyrazolo[4,3-d]pyrimidine;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-1-
-methyl-1H-pyrazolo[4,3-d]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-1-
-methyl-1H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzonitrile;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-1-
-methyl-1H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzenesulfonamide;
3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-piperidin-4-yloxy]-1-methyl-1H-pyrazolo[4,3-d]pyrimidine;
3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-piperidin-4-yloxy]-1-methyl-1H-pyrazolo[4,3-d]pyrimidine;
7-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-3-(6-methoxy--
2-methyl-pyridin-3-yl)-1-methyl-1H-pyrazolo[4,3-d]pyrimidine;
2,5-Difluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-ylox-
y]-1-methyl-1H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzenesulfonamide;
3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-cyclohexyloxy]-1-methyl-1H-pyrazolo[4,3-d]pyrimidine;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1-met-
hyl-1H-pyrazolo[4,3-d]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1-met-
hyl-1H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzonitrile;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1-met-
hyl-1H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzenesulfonamide;
3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-cyclohexyloxy]-1-methyl-1H-pyrazolo[4,3-d]pyrimidine;
3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-cyclohexyloxy]-1-methyl-1H-pyrazolo[4,3-d]pyrimidine;
7-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-3-(6-methoxy-2-me-
thyl-pyridin-3-yl)-1-methyl-1H-pyrazolo[4,3-d]pyrimidine; and
2,5-Difluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1-
-methyl-1H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzenesulfonamide.
[0422] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/US2004/022417 include the
following compounds according to Formula (IV) (referred to herein
as Group D14):
4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-2-methyl-2H-pyrazolo[4,3-d]pyrim-
idin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2-Fluoro-4-propionylsulfamoyl-phenyl)-2-methyl-2H-pyrazolo[4,3-d]py-
rimidin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(4-Cyano-2-fluoro-phenyl)-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-7-ylo-
xy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2-Fluoro-4-sulfamoyl-phenyl)-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-7-
-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-2-methyl-2H-pyrazolo[4,3-d]p-
yrimidin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(4-Fluoro-6-methoxy-pyridin-3-yl)-2-methyl-2H-pyrazolo[4,3-d]pyrimid-
in-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(6-Methoxy-2-methyl-pyridin-3-yl)-2-methyl-2H-pyrazolo[4,3-d]pyrimid-
in-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
4-[3-(2,5-Difluoro-4-sulfamoyl-phenyl)-2-methyl-2H-pyrazolo[4,3-d]pyrimid-
in-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester;
3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-piperidin-4-yloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidine;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-
-methyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-
-methyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzonitrile;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-
-methyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzenesulfonamide;
3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-piperidin-4-yloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidine;
3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-piperidin-4-yloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidine;
7-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-3-(6-methoxy--
2-methyl-pyridin-3-yl)-2-methyl-2H-pyrazolo[4,3-d]pyrimidine;
2,5-Difluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-ylox-
y]-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzenesulfonamide;
3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol--
5-yl)-cyclohexyloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidine;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-met-
hyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-met-
hyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzonitrile;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-met-
hyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzenesulfonamide;
3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadia-
zol-5-yl)-cyclohexyloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidine;
3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5--
yl)-cyclohexyloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidine;
7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-3-(6-methoxy-2-me-
thyl-pyridin-3-yl)-2-methyl-2H-pyrazolo[4,3-d]pyrimidine; and
2,5-Difluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-
-methyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzenesulfonamide.
[0423] Examples of GPR119 agonists are described in U.S. Patent
Application No. 60/577,354, the disclosure of which is herein
incorporated by reference in its entirety. Disclosed in U.S. Patent
Application No. 60/577,354 as a GPR119 agonist is a compound of
Formula (V):
##STR00038##
[0424] or N-oxide thereof;
[0425] wherein: [0426] A.sub.1 and A.sub.2 are independently
C.sub.1-3 alkylene optionally substituted with one or more
substituents selected independently from the group consisting of
C.sub.1-6 alkyl, C.sub.1-6 alkoxy, and carboxy; [0427] D is
CR.sub.1R.sub.2 or NR.sub.2, wherein R.sub.1 is selected from the
group consisting of H, C.sub.1-6 alkyl, C.sub.1-6 alkoxy, halogen
and hydroxyl; [0428] E is N, C or CR.sub.3, wherein R.sub.3 is H or
C.sub.1-6 alkyl; [0429] is a single bond when E is N or CR.sub.3,
or a double bond when E is C; [0430] K is absent, C.sub.3-6
cycloalkylene, or C.sub.1-3 alkylene group optionally substituted
with one or more substituents selected independently from the group
consisting of C.sub.1-6 alkyl, C.sub.1-6 alkoxy, carboxy, cyano,
and halogen; [0431] Q.sub.1 is NR.sub.4, O, S, S(O) or S(O).sub.2,
wherein R.sub.4 is H, C.sub.1-6 acyl, C.sub.1-6 alkyl, C.sub.2-6
alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, or
C.sub.3-7-cycloalkyl-C.sub.1-3-alkylene, wherein said C.sub.1-6
alkyl is optionally substituted with one or more substituents
selected independently from the group consisting of C.sub.1-6 acyl,
C.sub.1-6 acyloxy, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6
alkyl, C.sub.1-6 alkylamino, C.sub.1-6 alkylcarboxamide, C.sub.2-6
alkynyl, C.sub.1-6 alkylsulfonamide, C.sub.1-6 alkylsulfinyl,
C.sub.1-6 alkylsulfonyl, C.sub.1-6 alkylthio, C.sub.1-6
alkylthiocarboxamide, C.sub.1-6 alkylthioureyl, C.sub.1-6
alkylureyl, amino, di-C.sub.1-6-alkylamino, C.sub.1-6
alkoxycarbonyl, carboxamide, carboxy, cyano, C.sub.3-6 cycloalkyl,
di-C.sub.1-6-alkylcarboxamide, di-C.sub.1-6-alkylsulfonamide,
di-C.sub.1-6-alkylthiocarboxamido, C.sub.1-6 haloalkoxy, C.sub.1-6
haloalkyl, halogen, C.sub.1-6 haloalkylsulfinyl, C.sub.1-6
haloalkylsulfonyl, C.sub.1-6 haloalkylthio, hydroxyl, hydroxylamino
and nitro; [0432] Q.sub.2 is absent, NR.sub.5, or O, wherein
R.sub.5 is H, C.sub.1-6 acyl, C.sub.1-6 alkyl, C.sub.2-6 alkenyl,
C.sub.2-6 alkynyl, C.sub.3-7 cycloalkyl, or
C.sub.3-7-cycloalkyl-C.sub.1-3-alkylene, wherein said C.sub.1-6
alkyl is optionally substituted with one or more substituents
selected independently from the group consisting of C.sub.1-6 acyl,
C.sub.1-6 acyloxy, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6
alkyl, C.sub.1-6 alkylamino, C.sub.1-6 alkylcarboxamide, C.sub.2-6
alkynyl, C.sub.1-6 alkylsulfonamide, C.sub.1-6 alkylsulfinyl,
C.sub.1-6 alkylsulfonyl, C.sub.1-6 alkylthio, C.sub.1-6
alkylthiocarboxamide, C.sub.1-6 alkylthioureyl, C.sub.1-6
alkylureyl, amino, di-C.sub.1-6-alkylamino, C.sub.1-6
alkoxycarbonyl, carboxamide, carboxy, cyano, C.sub.3-6 cycloalkyl,
di-C.sub.1-6-alkylcarboxamide, di-C.sub.1-6-alkylsulfonamide,
di-C.sub.1-6 alkylthiocarboxamido, C.sub.1-6 haloalkoxy, C.sub.1-6
haloalkyl, halogen, C.sub.1-6 haloalkylsulfinyl, C.sub.1-6
haloalkylsulfonyl, C.sub.1-4 haloalkylthio, hydroxyl, hydroxylamino
and nitro; [0433] W is N or CH; [0434] X is N or CR.sub.6; [0435] Y
is N or CR.sub.7; [0436] Z is N or CR.sub.8; [0437] V is absent,
C.sub.1-3 heteroalkylene, or C.sub.1-3 alkylene wherein each are
optionally substituted with one or more substituents selected
independently from the group consisting of C.sub.1-3 alkyl,
C.sub.1-6 alkoxy, carboxy, cyano, C.sub.1-3 haloalkyl, and halogen;
[0438] R.sub.6, R.sub.7, and R.sub.8 are each independently
selected from the group consisting of H, C.sub.1-6 acyl, C.sub.1-6
acyloxy, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6 alkyl,
C.sub.1-6 alkylamino, C.sub.1-6 alkylcarboxamide, C.sub.2-6
alkynyl, C.sub.1-6 alkylsulfonamide, C.sub.1-6 alkylsulfinyl,
C.sub.1-6 alkylsulfonyl, C.sub.1-6 alkylthio, C.sub.1-6
alkylthiocarboxamide, C.sub.1-6 alkylthioureyl, C.sub.1-6
alkylureyl, amino, di-C.sub.1-6-alkylamino, C.sub.1-6
alkoxycarbonyl, carboxamide, carboxy, cyano, C.sub.3-6 cycloalkyl,
di-C.sub.1-6-alkylcarboxamide, di-C.sub.1-6-alkylsulfonamide,
di-C.sub.1-6-alkylthiocarboxamido, C.sub.1-6 haloalkoxy, C.sub.1-6
haloalkyl, halogen, C.sub.1-6 haloalkylsulfinyl, C.sub.1-6
haloalkylsulfonyl, C.sub.1-6 haloalkylthio, hydroxyl, hydroxylamino
and nitro, wherein said C.sub.2-6 alkenyl, C.sub.1-6 alkyl,
C.sub.2-6 alkynyl and C.sub.3-6 cycloalkyl are each optionally
substituted with one or more substituents independently selected
from the group consisting of C.sub.1-6 acyl, C.sub.1-6 acyloxy,
C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6 alkyl, C.sub.1-6
alkylamino, C.sub.1-6 alkylcarboxamide, C.sub.2-6 alkynyl,
C.sub.1-6 alkylsulfonamide, C.sub.1-6 alkylsulfinyl, C.sub.1-6
alkylsulfonyl, C.sub.1-6 alkylthio, C.sub.1-6 alkylthiocarboxamide,
C.sub.1-6 alkylthioureyl, C.sub.1-6 alkylureyl, amino, di-C.sub.1-6
alkylamino, C.sub.1-6 alkoxycarbonyl, carboxamide, carboxy, cyano,
C.sub.3-6 cycloalkyl, di-C.sub.1-6-alkylcarboxamide,
di-C.sub.1-6-alkylsulfonamide, di-C.sub.1-6-alkylthiocarboxamido,
C.sub.1-6 haloalkoxy, C.sub.1-6 haloalkyl, halogen, C.sub.1-6
haloalkylsulfinyl, C.sub.1-6 haloalkylsulfonyl, C.sub.1-6
haloalkylthio, hydroxyl, hydroxylamino and nitro; [0439] Ar is aryl
or heteroaryl optionally substituted with R.sub.9-R.sub.13; [0440]
R.sub.9 is selected from the group consisting of C.sub.1-6 acyl,
C.sub.1-6 acyloxy, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6
alkyl, C.sub.1-6 alkylamino, C.sub.1-6 alkylcarboxamide, C.sub.2-6
alkynyl, C.sub.1-6 alkylsulfonamide, C.sub.1-6 alkylsulfinyl,
C.sub.1-6 alkylsulfonyl, C.sub.1-6 alkylthio, C.sub.1-6
alkylthiocarboxamide, C.sub.1-6 alkylthioureyl, C.sub.1-6
alkylureyl, amino, aryl, arylcarbonyl, arylsulfonyl,
di-C.sub.1-6-alkylamino, carbamimidoyl, C.sub.1-6 alkoxycarbonyl,
carboxamide, carboxy, cyano, C.sub.3-6 cycloalkyl,
di-C.sub.1-6-alkylcarboxamide, di-C.sub.1-6-alkylsulfonamide,
di-C.sub.1-6-alkylthiocarboxamido, guanidine, C.sub.1-6 haloalkoxy,
C.sub.1-6 haloalkyl, halogen, C.sub.1-6 haloalkylsulfinyl,
C.sub.1-6 haloalkylsulfonyl, C.sub.1-6 haloalkylthio, heterocyclic,
heterocyclicsulfonyl, heteroaryl, hydroxyl, hydroxylamino, nitro,
C.sub.3-6 oxo-cycloalkyl, phenoxy, sulfonamide, sulfonic acid and
thiol; and wherein each available R.sub.9 is optionally substituted
with one or more substituents selected independently from the group
consisting of C.sub.1-6 acyl, C.sub.1-6 acylsulfonamide, C.sub.1-6
acyloxy, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6 alkyl,
C.sub.1-6 alkylamino, C.sub.1-6 alkylcarboxamide, C.sub.2-6
alkynyl, C.sub.1-6 alkylsulfonamide, C.sub.1-6 alkylsulfinyl,
C.sub.1-6 alkylsulfonyl, C.sub.1-6 alkylthio, C.sub.1-6
alkylthiocarboxamide, C.sub.1-6 alkylthioureyl, C.sub.1-6
alkylureyl, amino, aryl, arylcarbonyl, arylsulfonyl,
di-C.sub.1-6-alkylamino, C.sub.1-6 alkoxycarbonyl, carboxamide,
carboxy, cyano, C.sub.3-6 cycloalkyl,
di-C.sub.1-6-alkylcarboxamide, di-C.sub.1-6-alkylsulfonamide,
di-C.sub.1-6-alkylthiocarboxamido, C.sub.1-6 haloalkoxy, C.sub.1-6
haloalkyl, halogen, C.sub.1-6 haloalkylsulfinyl, C.sub.1-6
haloalkylsulfonyl, C.sub.1-6 haloalkylthio, heteroaryl,
heteroarylcarbonyl, heteroarylsulfonyl, heterocyclic, hydroxyl,
hydroxylamino, and nitro; [0441] R.sub.10-R.sub.13 are
independently selected from the group consisting of C.sub.1-6 acyl,
C.sub.1-6 acyloxy, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6
alkyl, C.sub.1-6 alkylamino, C.sub.1-6 alkylcarboxamide, C.sub.2-6
alkynyl, C.sub.1-6 alkylsulfonamide, C.sub.1-6 alkylsulfinyl,
C.sub.1-6 alkylsulfonyl, C.sub.1-6 alkylthio, C.sub.1-6
alkylthiocarboxamide, C.sub.1-6 alkylthioureyl, C.sub.1-6
alkylureyl, amino, di-C.sub.1-6-alkylamino, C.sub.1-6
alkoxycarbonyl, carboxamide, carboxy, cyano, C.sub.3-6 cycloalkyl,
di-C.sub.1-6-alkylcarboxamide, di-C.sub.1-6-alkylsulfonamide,
di-C.sub.1-6-alkylthiocarboxamido, C.sub.1-6 haloalkoxy, C.sub.1-6
haloalkyl, halogen, C.sub.1-6 haloalkylsulfinyl, C.sub.1-6
haloalkylsulfonyl, C.sub.1-6 haloalkylthio, hydroxyl,
hydroxylamino, nitro, and thiol; or two adjacent groups together
with the atoms to which they are bonded form a 5, 6 or 7 member
cycloalkyl, cycloalkenyl or heterocyclic group wherein the 5, 6 or
7 member group is optionally substituted with halogen or oxo; and
[0442] R.sub.2 is selected from the group consisting of H,
C.sub.1-6 acyl, C.sub.1-6 acyloxy, C.sub.2-6 alkenyl, C.sub.1-6
alkoxy, C.sub.1-6 alkyl, C.sub.1-6 alkylamino, C.sub.1-6
alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-6 alkylsulfonamide,
C.sub.1-6 alkylsulfinyl, C.sub.1-6 alkylsulfonyl, C.sub.1-6
alkylthio, C.sub.1-6 alkylthiocarboxamide, C.sub.1-6
alkylthioureyl, C.sub.1-6 alkylureyl, amino, aryl, arylcarbonyl,
aryloxy, di-C.sub.1-6-alkylamino, carbamimidoyl, C.sub.1-6
alkoxycarbonyl, C.sub.3-7-cycloalkoxycarbonyl, carboxamide,
carboxy, cyano, C.sub.3-6 cycloalkyl,
di-C.sub.1-6-alkylcarboxamide, di-C.sub.1-6-alkylsulfonamide,
di-C.sub.1-6-alkylthiocarboxamido, guanidine, C.sub.1-6 haloalkoxy,
C.sub.1-6 haloalkyl, halogen, C.sub.1-6 haloalkylsulfinyl,
C.sub.1-6 haloalkylsulfonyl, C.sub.1-6 haloalkylthio, heteroaryl,
heteroaryl-C.sub.1-3-alkylene, heteroarylcarbonyl, heteroaryloxy,
heterocycliccarboxamide, hydroxyl, hydroxylamino and nitro; wherein
each available R.sub.2 is optionally substituted with one or more
substituents selected independently from the group consisting of
C.sub.1-6 acyl, C.sub.1-6 acyloxy, C.sub.2-6 alkenyl, C.sub.1-6
alkoxy, C.sub.1-6 alkyl, C.sub.1-6 alkylamino, C.sub.1-6
alkylcarboxamide, C.sub.2-6 alkynyl, C.sub.1-6 alkylsulfonamide,
C.sub.1-6 alkylsulfinyl, C.sub.1-6 alkylsulfonyl, C.sub.1-6
alkylthio, C.sub.1-6 alkylthiocarboxamide, C.sub.1-6
alkylthioureyl, C.sub.1-6 alkylureyl, amino, aryl,
di-C.sub.1-6-alkylamino, C.sub.1-6 alkoxycarbonyl, carboxamide,
carboxy, cyano, C.sub.3-6 cycloalkyl,
di-C.sub.1-6-alkylcarboxamide, di-C.sub.1-6-alkylsulfonamide,
di-C.sub.1-6-alkylthiocarboxamido, C.sub.1-6 haloalkoxy, C.sub.1-6
haloalkyl, halogen, C.sub.1-6 haloalkylsulfinyl, C.sub.1-6
haloalkylsulfonyl, C.sub.1-6 haloalkylthio, heterocyclic,
heteroaryl, hydroxyl, hydroxylamino and nitro, and wherein
C.sub.1-6 alkyl is further optionally substituted with one or more
substituents selected independently from the group consisting of
C.sub.1-6 acyl, C.sub.1-6 alkoxy, C.sub.1-6 alkylamino, C.sub.1-6
alkylcarboxamide, C.sub.1-6 alkylsulfonamide, C.sub.1-6
alkylsulfinyl, C.sub.1-6 alkylsulfonyl, C.sub.1-6 alkylthio,
C.sub.1-6 alkylureyl, amino, di-C.sub.1-6-alkylamino, C.sub.1-6
alkoxycarbonyl, carboxamide, carboxy, cyano, C.sub.3-6 cycloalkyl,
di-C.sub.1-6-alkylcarboxamide, di-C.sub.1-6-alkylsulfonamide,
C.sub.1-6 haloalkoxy, C.sub.1-6 haloalkyl, halogen, C.sub.1-6
haloalkylsulfinyl, C.sub.1-6 haloalkylsulfonyl, C.sub.1-6
haloalkylthio, heterocyclic, hydroxyl, hydroxylamino and nitro.
[0443] The present invention also encompasses diastereomers as well
as optical isomers, e.g. mixtures of enantiomers including racemic
mixtures, as well as individual enantiomers and diastereomers,
which arise as a consequence of structural asymmetry in certain
compounds of the invention. Separation of the individual isomers or
selective synthesis of the individual isomers is accomplished by
application of various methods which are well known to
practitioners in the art.
[0444] Specific examples of GPR119 agonists disclosed in U.S.
Patent Application No. 60/577,354 include the following compounds
according to Formula (V) (referred to herein as Group E1):
4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-methanesulf-
onyl-phenoxy)-pyrimidine;
{6-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-pyrimidin-4-yl}-
-(4-methanesulfonyl-phenyl)-amine;
4-{[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-ami-
no}-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-am-
ino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(4-Methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-meth-
yl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2,5-Difluoro-benzylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-p-
iperidine-1-carboxylic acid tert-butyl ester;
4-[({6-[(Benzo[1,3]dioxol-5-ylmethyl)-amino]-pyrimidin-4-yl}-methyl-amino-
)-methyl]-piperidine-1-carboxylic acid tert-butyl ester;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-fluoro-phenoxy)-piperidin-1--
yl]-pyrimidin-4-yl}-amine;
4-({Methyl-[6-(2-pyridin-4-yl-ethylamino)-pyrimidin-4-yl]-amino}-methyl)--
piperidine-1-carboxylic acid tert-butyl ester;
4-({Methyl-[6-(2-pyridin-3-yl-ethylamino)-pyrimidin-4-yl]-amino}-methyl)--
piperidine-1-carboxylic acid tert-butyl ester;
4-[(Methyl-{6-[(pyridin-3-ylmethyl)-amino]-pyrimidin-4-yl}-amino)-methyl]-
-piperidine-1-carboxylic acid tert-butyl ester;
4-[({6-[(2-Fluoro-4-methanesulfonyl-phenyl)-methyl-amino]-pyrimidin-4-yl}-
-methyl-amino)-methyl]-piperidine-1-carboxylic acid tert-butyl
ester;
4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-am-
ino}-methyl)-piperidine-1-carboxylic acid isobutyl ester;
4-({[6-(4-Cyano-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methy-
l)-piperidine-1-carboxylic acid tert-butyl ester;
4-[({6-[4-(2-Methanesulfonyl-ethyl)-phenylamino]-pyrimidin-4-yl}-methyl-a-
mino)-methyl]-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(4-Ethylsulfanyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl-
)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(4-Isopropylsulfanyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-me-
thyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(4-Ethylsulfamoyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methy-
l)-piperidine-1-carboxylic acid tert-butyl ester;
4-({Methyl-[6-(4-methylsulfamoyl-phenylamino)-pyrimidin-4-yl]-amino}-meth-
yl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(4-Dimethylsulfamoyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-me-
thyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({Methyl-[6-(4-methylsulfamoylmethyl-phenylamino)-pyrimidin-4-yl]-amino-
}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({Methyl-[6-(4-sulfamoyl-phenylamino)-pyrimidin-4-yl]-amino}-methyl)-pi-
peridine-1-carboxylic acid tert-butyl ester;
4-({Methyl-[6-(4-[1,2,4]triazol-1-yl-phenylamino)-pyrimidin-4-yl]-amino}--
methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({Methyl-[6-(4-[1,2,4]triazol-1-ylmethyl-phenylamino)-pyrimidin-4-yl]-a-
mino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-[(Methyl-{6-[4-(2-[1,2,4]triazol-1-yl-ethyl)-phenylamino]-pyrimidin-4-y-
l}-amino)-methyl]-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(Benzo[1,3]dioxol-5-ylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-
-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(6-Methanesulfonyl-pyridin-3-ylamino)-pyrimidin-4-yl]-methyl-amino-
}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(3,5-Dimethoxy-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)--
piperidine-1-carboxylic acid tert-butyl ester;
4-[(Methyl-{6-[4-(2-oxo-oxazolidin-4-ylmethyl)-phenylamino]-pyrimidin-4-y-
l}-amino)-methyl]-piperidine-1-carboxylic acid tert-butyl ester;
4-[({6-[4-(1,1-Dioxo-1.lamda.6-thiomorpholin-4-ylmethyl)-phenylamino]-pyr-
imidin-4-yl}-methyl-amino)-methyl]-piperidine-1-carboxylic acid
tert-butyl ester;
4-({Methyl-[6-(4-pyrazol-1-yl-phenylamino)-pyrimidin-4-yl]-amino}--
methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2,2-Difluoro-benzo[1,3]dioxol-5-ylamino)-pyrimidin-4-yl]-methyl-a-
mino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({Methyl-[6-(4-trifluoromethanesulfonyl-phenylamino)-pyrimidin-4-yl]-am-
ino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-[(Methyl-{6-[4-(morpholine-4-sulfonyl)-phenylamino]-pyrimidin-4-yl}-ami-
no)-methyl]-piperidine-1-carboxylic acid tert-butyl ester;
4-[(Methyl-{6-[2-(pyridine-2-carbonyl)-phenylamino]-pyrimidin-4-yl}-amino-
)-methyl]-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2-Fluoro-5-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-am-
ino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
N-Ethyl-3-fluoro-4-[6-(methyl-piperidin-4-ylmethyl-amino)-pyrimidin-4-yla-
mino]-benzenesulfonamide;
3-Fluoro-N-isopropyl-4-[6-(methyl-piperidin-4-ylmethyl-amino)-pyrimidin-4-
-ylamino]-benzenesulfonamide;
4-({[6-(3,4-Difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-p-
iperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2,6-Difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-p-
iperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2,5-Difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-p-
iperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2,3-Difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-p-
iperidine-1-carboxylic acid tert-butyl ester;
4-({Methyl-[6-(2,3,5-trifluoro-phenylamino)-pyrimidin-4-yl]-amino}-methyl-
)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2-Fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piper-
idine-1-carboxylic acid tert-butyl ester;
4-({[6-(2-Fluoro-4-methyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-meth-
yl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(3-Chloro-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-meth-
yl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2,4-Difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-p-
iperidine-1-carboxylic acid tert-butyl ester;
4-[(Methyl-{6-[2-(1-oxy-pyridin-3-yl)-ethylamino]-pyrimidin-4-yl}-amino)--
methyl]-piperidine-1-carboxylic acid tert-butyl ester;
4-[(Methyl-{6-[2-(1-oxy-pyridin-3-yl)-ethylamino]-pyrimidin-4-yl}-amino)--
methyl]-piperidine-1-carboxylic acid isobutyl ester;
4-({[6-(2,5-Difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-p-
iperidine-1-carboxylic acid isobutyl ester;
4-({[6-(4-Cyano-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methy-
l)-piperidine-1-carboxylic acid isobutyl ester;
4-[({6-[2-(2-Fluoro-phenoxy)-ethylamino]-pyrimidin-4-yl}-methyl-amino)-me-
thyl]-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2-Fluoro-phenoxy)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidin-
e-1-carboxylic acid tert-butyl ester;
4-({[6-(2,5-Difluoro-phenoxy)-pyrimidin-4-yl]-methyl-amino}-methyl)-piper-
idine-1-carboxylic acid tert-butyl ester;
4-[({6-[2-(2-Chloro-phenoxy)-ethylamino]-pyrimidin-4-yl}-methyl-amino)-me-
thyl]-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2-Chloro-phenoxy)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidin-
e-1-carboxylic acid tert-butyl ester;
4-[({6-[2-(4-Fluoro-phenoxy)-propylamino]-pyrimidin-4-yl}-methyl-amino)-m-
ethyl]-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(4-Ethylsulfamoyl-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-ami-
no}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2-Fluoro-4-isopropylsulfamoyl-phenylamino)-pyrimidin-4-yl]-methyl-
-amino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(4-Cyano-2,5-difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-m-
ethyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(4-Bromo-2,5-difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-m-
ethyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(5-Carboxy-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-met-
hyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(6-Methoxy-pyridin-3-ylamino)-pyrimidin-4-yl]-methyl-amino}-methyl-
)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2,6-Dimethoxy-pyridin-3-ylamino)-pyrimidin-4-yl]-methyl-amino}-me-
thyl)-piperidine-1-carboxylic acid tert-butyl ester;
6-{6-[(1-tert-Butoxycarbonyl-piperidin-4-ylmethyl)-methyl-amino]-pyrimidi-
n-4-ylamino}-nicotinic acid;
4-({[6-(6-Acetylamino-pyridin-3-ylamino)-pyrimidin-4-yl]-methyl-amino}-me-
thyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(5-Fluoro-pyridin-2-ylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-
-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(4-Cyano-2-ethyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl-
)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(4-Butyryl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-pipe-
ridine-1-carboxylic acid tert-butyl ester;
4-({[6-(5-Bromo-3-methyl-pyridin-2-ylamino)-pyrimidin-4-yl]-methyl-amino}-
-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(3-Bromo-5-methyl-pyridin-2-ylamino)-pyrimidin-4-yl]-methyl-amino}-
-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({Methyl-[6-(5-trifluoromethyl-pyridin-2-ylamino)-pyrimidin-4-yl]-amino-
}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(4-Bromo-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methy-
l)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(3-Carboxy-4-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-met-
hyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(4-Ethoxycarbonyl-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-ami-
no}-methyl)-piperidine-1-carboxylic acid isobutyl ester;
4-({[6-(4-Carboxy-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-met-
hyl)-piperidine-1-carboxylic acid isobutyl ester;
4-({[6-(4-Cyano-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methy-
l)-piperidine-1-carboxylic acid isopropyl ester;
4-({[6-(4-Cyano-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methy-
l)-piperidine-1-carboxylic acid butyl ester;
4-({[6-(4-Cyano-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methy-
l)-piperidine-1-carboxylic acid cyclopropylmethyl ester;
{4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-piperazin--
1-yl}-acetic acid ethyl ester;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-
-ylmethyl)-piperazin-1-yl]-pyrimidin-4-yl}-amine;
4-({[6-(2,5-Difluoro-4-hydroxy-phenylamino)-pyrimidin-4-yl]-methyl-amino}-
-methyl)-piperidine-1-carboxylic acid isobutyl ester;
4-({[6-(4-Ethylcarbamoyl-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-ami-
no}-methyl)-piperidine-1-carboxylic acid isobutyl ester;
4-[({6-[2-Fluoro-4-(N-hydroxycarbamimidoyl)-phenylamino]-pyrimidin-4-yl}--
methyl-amino)-methyl]-piperidine-1-carboxylic acid isobutyl ester;
4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-am-
ino}-methyl)-piperidine-1-carboxylic acid 3-methyl-butyl ester;
4-({[6-(2,5-Difluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methy-
l-amino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-am-
ino}-methyl)-piperidine-1-carboxylic acid isopropyl ester;
(5-Butyl-pyridin-2-yl)-[4-({[6-(2-fluoro-4-methanesulfonyl-phenylamino)-p-
yrimidin-4-yl]-methyl-amino}-methyl)-piperidin-1-yl]-methanone;
N-(2-Fluoro-4-methanesulfonyl-phenyl)-N'-(5'-fluoro-3,4,5,6-tetrahydro-2H-
-[1,2']bipyridinyl-4-ylmethyl)-N'-methyl-pyrimidine; -4,6-diamine;
4-({[6-(4-Carbamimidoyl-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amin-
o}-methyl)-piperidine-1-carboxylic acid isobutyl ester;
4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-am-
ino}-methyl)-piperidine-1-carboxylic acid cyclobutyl ester;
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-ylamino]-piperi-
dine-1-carboxylic acid tert-butyl ester;
N-(2-Fluoro-4-methanesulfonyl-phenyl)-N'-[1-(3-isopropyl-[1,2,4]oxadiazol-
-5-ylmethyl)-piperidin-4-ylmethyl]-N'-methyl-pyrimidine;
-4,6-diamine;
4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-am-
ino}-methyl)-piperidine-1-carboxylic acid 1-ethyl-propyl ester;
4-({Ethyl-[6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-ami-
no}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({Ethyl-[6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-ami-
no}-methyl)-piperidine-1-carboxylic acid isopropyl ester;
4-({[6-(4-Cyano-2,5-difluoro-phenylamino)-pyrimidin-4-yl]-ethyl-amino}-me-
thyl)-piperidine-1-carboxylic acid isopropyl ester;
4-({[6-(4-Amino-2,5-difluoro-phenoxy)-pyrimidin-4-yl]-ethyl-amino}-methyl-
)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2,5-Difluoro-4-methoxy-phenylamino)-pyrimidin-4-yl]-ethyl-amino}--
methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[6-(2,5-Difluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-ethyl-
-amino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({Ethyl-[6-(2,4,5-trifluoro-phenylamino)-pyrimidin-4-yl]-amino}-methyl)-
-piperidine-1-carboxylic acid tert-butyl ester;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-
-yl)-piperidin-1-yl]-pyrimidin-4-yl}-amine;
4-[(Ethyl-{6-[4-(N-ethylcarbamimidoyl)-2,5-difluoro-phenylamino]-pyrimidi-
n-4-yl}-amino)-methyl]-piperidine-1-carboxylic acid isopropyl
ester;
4-({[6-(4-Bromo-2,5-difluoro-phenylamino)-pyrimidin-4-yl]-ethyl-amino}-me-
thyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-[({6-[5-(2-Amino-ethylamino)-4-cyano-2-fluoro-phenylamino]-pyrimidin-4--
yl}-ethyl-amino)-methyl]-piperidine-1-carboxylic acid isopropyl
ester;
{(1-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-piperidin-
-4-yl}-acetic acid methyl ester;
3-{4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-piperazi-
n-1-yl}-propionic acid ethyl ester;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(4-isobutyl-phenyl)-piperidin-1-
-yl]-pyrimidin-4-yl}-amine;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(4-isopropyl-phenyl)-piperidin--
1-yl]-pyrimidin-4-yl}-amine;
{6-[4-(3-Cyclopropylmethyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-pyrimid-
in-4-yl}-(2-fluoro-4-methanesulfonyl-phenyl)-amine;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-isobutyl-[1,2,4]oxadiazol-5--
yl)-piperidin-1-yl]-pyrimidin-4-yl}-amine;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(4-isopropoxy-phenyl)-piperazin-
-1-yl]-pyrimidin-4-yl}-amine;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(4-isopropoxy-phenyl)-piperidin-
-1-yl]-pyrimidin-4-yl}-amine;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(5-isopropoxy-pyridin-2-yl)-pip-
erazin-1-yl]-pyrimidin-4-yl}-amine;
{6-[4-(3-Dimethylaminomethyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-pyrim-
idin-4-yl}-(2-fluoro-4-methanesulfonyl-phenyl)-amine;
(2-Fluoro-4-methanesulfonyl-phenyl)-(6-{4-[2-(3-isopropyl-[1,2,4]oxadiazo-
l-5-yl)-ethyl]-piperazin-1-yl}-pyrimidin-4-yl)-amine;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(5-isopropoxy-pyridin-2-yloxy)--
piperidin-1-yl]-pyrimidin-4-yl}-amine;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-pyridin-3-yl-[1,2,4]oxadiazo-
l-5-yl)-piperidin-1-yl]-pyrimidin-4-yl}-amine;
2,5-Difluoro-4-{6-[4-(4-isopropoxy-phenyl)-piperazin-1-yl]-pyrimidin-4-yl-
amino}-benzonitrile;
4-{[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-ylamino]-methy-
l}-piperidine-1-carboxylic acid tert-butyl ester;
4-{[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-ylamino]-methy-
l}-piperidine-1-carboxylic acid isopropyl ester;
4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-isopropyl-
-amino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({[4-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-2-yl]-methyl-amin-
o}-methyl)-piperidine-1-carboxylic acid isobutyl ester; and
4-({[2-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-4-yl]-methyl-amin-
o}-methyl)-piperidine-1-carboxylic acid isobutyl ester.
[0445] Specific examples of GPR119 agonists disclosed in U.S.
Patent Application No. 60/577,354 include the following compounds
according to Formula (V) (referred to herein as Group E2):
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidi-
ne-1-carboxylic acid tert-butyl ester;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-
-ylmethyl)-piperidin-4-yloxy]-pyrimidin-4-yl}-amine;
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidi-
ne-1-carboxylic acid isopropyl ester;
(6-Chloro-pyridin-2-yl)-{4-[6-(2-fluoro-4-methanesulfonyl-phenylamino)-py-
rimidin-4-yloxy]-piperidin-1-yl}-methanone;
(6-Bromo-pyridin-2-yl)-{4-[6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyr-
imidin-4-yloxy]-piperidin-1-yl}-methanone;
{4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperid-
in-1-yl}-(6-methyl-pyridin-2-yl)-methanone;
{4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperid-
in-1-yl}-(6-fluoro-pyridin-2-yl)-methanone;
{4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperid-
in-1-yl}-pyridin-2-yl-methanone;
(5-Bromo-pyridin-3-yl)-{4-[6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyr-
imidin-4-yloxy]-piperidin-1-yl}-methanone;
{4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperid-
in-1-yl}-(5-methyl-pyridin-3-yl)-methanone;
(5,6-Dichloro-pyridin-3-yl)-{4-[6-(2-fluoro-4-methanesulfonyl-phenylamino-
)-pyrimidin-4-yloxy]-piperidin-1-yl}-methanone;
4-[6-(4-Cyano-2,5-difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-c-
arboxylic acid tert-butyl ester;
4-[6-(2,5-Difluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-pipe-
ridine-1-carboxylic acid tert-butyl ester;
4-[6-(2,4,5-Trifluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carbox-
ylic acid tert-butyl ester;
4-[6-(4-Bromo-2,5-difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-c-
arboxylic acid tert-butyl ester;
4-[6-(3-Fluoro-4-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carb-
oxylic acid tert-butyl ester;
4-[6-(3-Hydroxy-4-methoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-ca-
rboxylic acid tert-butyl ester;
4-[6-(6-Cyano-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxyl-
ic acid tert-butyl ester;
4-[6-(3-Chloro-4-cyano-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carbo-
xylic acid tert-butyl ester;
4-[6-(6-Chloro-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxy-
lic acid tert-butyl ester;
4-[6-(3-Fluoro-4-methoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-car-
boxylic acid tert-butyl ester;
4-[6-(3,4-Dimethoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxyl-
ic acid tert-butyl ester;
4-[6-(2,3-Dihydro-benzo[1,4]dioxin-6-ylamino)-pyrimidin-4-yloxy]-piperidi-
ne-1-carboxylic acid tert-butyl ester;
4-[6-(4-Cyano-2,5-difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-c-
arboxylic acid isopropyl ester;
4-[6-(4-Cyano-5-ethylamino-2-fluoro-phenylamino)-pyrimidin-4-yloxy]-piper-
idine-1-carboxylic acid tert-butyl ester;
4-[6-(4-Ethoxy-2,5-difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1--
carboxylic acid isopropyl ester;
4-[6-(4-Ethylsulfanyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carbox-
ylic acid tert-butyl ester;
4-[6-(4-Isopropylsulfanyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-ca-
rboxylic acid tert-butyl ester;
(5-Butyl-pyridin-2-yl)-{4-[6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyr-
imidin-4-yloxy]-piperidin-1-yl}-methanone;
4-[6-(5-Chloro-3-methyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine--
1-carboxylic acid tert-butyl ester;
4-[6-(6-Acetylamino-4-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperi-
dine-1-carboxylic acid tert-butyl ester;
4-[6-(5-Fluoro-4-methyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine--
1-carboxylic acid tert-butyl ester;
4-[6-(6-Methoxy-5-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-
-1-carboxylic acid tert-butyl ester;
4-[6-(6-Methoxy-2-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-
-1-carboxylic acid tert-butyl ester;
4-[6-(6-Fluoro-5-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine--
1-carboxylic acid tert-butyl ester;
4-[6-(2-Chloro-6-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine--
1-carboxylic acid tert-butyl ester;
4-[6-(4-Methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxy-
lic acid tert-butyl ester;
4-[6-(2-Methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxy-
lic acid tert-butyl ester;
4-[6-(6-Chloro-2-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine--
1-carboxylic acid tert-butyl ester;
4-[6-(6-Fluoro-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxy-
lic acid tert-butyl ester;
4-[6-(2-Chloro-4-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine--
1-carboxylic acid tert-butyl ester;
4-[6-(6-Methoxy-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carbox-
ylic acid tert-butyl ester;
4-[6-(5-Fluoro-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxy-
lic acid tert-butyl ester;
4-[6-(2-Fluoro-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxy-
lic acid tert-butyl ester;
4-[6-(6-Chloro-5-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine--
1-carboxylic acid tert-butyl ester;
4-[6-(2-Methyl-pyridin-4-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxy-
lic acid tert-butyl ester;
4-[6-(2-Methoxy-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carbox-
ylic acid tert-butyl ester;
4-[6-(2,5-Difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxyli-
c acid tert-butyl ester;
4-[6-(4-Chloro-2-fluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carb-
oxylic acid tert-butyl ester;
4-[6-(2,5-Difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxyli-
c acid isopropyl ester;
4-[6-(6-Methoxy-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carbox-
ylic acid isopropyl ester;
4-[6-(4-Cyano-3-methoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carb-
oxylic acid isopropyl ester;
4-[6-(3-Fluoro-4-hydroxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-car-
boxylic acid isopropyl ester;
4-[6-(6-Ethoxy-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxy-
lic acid isopropyl ester;
4-[6-(2,5-Difluoro-4-isopropoxy-phenylamino)-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid isopropyl ester;
(2-Fluoro-4-methanesulfonyl-phenyl)-[6-(5'-isopropoxy-3,4,5,6-tetrahydro--
2H-[1,2']bipyridinyl-4-yloxy)-pyrimidin-4-yl]-amine;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-
-yl)-piperidin-4-yloxy]-pyrimidin-4-yl}-amine;
4-[6-(4-Cyano-2-fluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carbo-
xylic acid isopropyl ester;
4-[6-(Pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic
acid isopropyl ester;
4-[6-(Pyridin-4-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic
acid isopropyl ester;
4-[6-(2,5-Difluoro-4-propoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-
-carboxylic acid isopropyl ester;
4-[6-(4-Ethylamino-2-fluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1--
carboxylic acid isopropyl ester;
4-[6-(4-Dimethylamino-2-fluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-propylamino-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-
-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-isopropylamino-phenylamino)-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid isopropyl ester;
4-[6-(2-Methyl-6-propylamino-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperi-
dine-1-carboxylic acid isopropyl ester;
4-[6-(2-Methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxy-
lic acid isopropyl ester;
4-[6-(6-Isopropylamino-2-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-pip-
eridine-1-carboxylic acid isopropyl ester;
4-[6-(2-Methyl-6-propoxy-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[6-(4-Iodo-2-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carbox-
ylic acid isopropyl ester;
4-[6-(2-Fluoro-4-iodo-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carbox-
ylic acid isopropyl ester;
4-{6-[Methyl-(2-methyl-4,5,6,7-tetrahydro-2H-indazol-3-yl)-amino]-pyrimid-
in-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2-Methyl-2H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carb-
oxylic acid isopropyl ester;
4-[6-(2-Phenyl-2H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carb-
oxylic acid isopropyl ester;
4-[6-(5-tert-Butyl-1H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1--
carboxylic acid isopropyl ester;
4-[6-(5-p-Tolyl-1H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-car-
boxylic acid isopropyl ester;
4-[6-(6-Methoxy-5-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[6-(4-Methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxy-
lic acid isopropyl ester;
4-[6-(4-Acetylamino-3-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-
-carboxylic acid isopropyl ester;
4-[6-(3-Chloro-4-fluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carb-
oxylic acid isopropyl ester;
4-[6-(3,5-Dimethoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxyl-
ic acid isopropyl ester;
4-[6-(6-Ethyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxyl-
ic acid isopropyl ester;
4-[6-(5-Methyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxy-
lic acid isopropyl ester;
4-[6-(2-Methyl-quinolin-6-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carbox-
ylic acid isopropyl ester;
4-[6-(2-Methylsulfanyl-benzothiazol-6-ylamino)-pyrimidin-4-yloxy]-piperid-
ine-1-carboxylic acid isopropyl ester;
4-[6-(6-Morpholin-4-yl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-
-carboxylic acid isopropyl ester;
4-[6-(4-Benzenesulfonyl-thiophen-3-ylamino)-pyrimidin-4-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[6-(4-Piperidin-1-yl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carbo-
xylic acid isopropyl ester;
4-[6-(3-Trifluoromethoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-car-
boxylic acid isopropyl ester;
4-[6-(5-Oxo-5,6,7,8-tetrahydro-naphthalen-2-ylamino)-pyrimidin-4-yloxy]-p-
iperidine-1-carboxylic acid isopropyl ester;
4-[6-(6-Methyl-1H-pyrazolo[3,4-b]pyridin-3-ylamino)-pyrimidin-4-yloxy]-pi-
peridine-1-carboxylic acid isopropyl ester;
4-[6-(5-Cyano-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxyl-
ic acid isopropyl ester;
4-[6-(4-Bromo-2,5-difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-c-
arboxylic acid isopropyl ester;
4-[6-(4-Trifluoromethyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine--
1-carboxylic acid isopropyl ester;
4-[6-(5-Methyl-1H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carb-
oxylic acid isopropyl ester;
4-[6-(5-Cyclopropyl-1H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-
-carboxylic acid isopropyl ester;
4-[6-(2,6-Dimethyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-car-
boxylic acid isopropyl ester;
4-[6-(4-Cyano-2-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carbo-
xylic acid isopropyl ester;
4-[6-(4-Methoxy-2-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-car-
boxylic acid isopropyl ester;
4-[6-(2,4-Dimethoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxyl-
ic acid isopropyl ester;
4-{6-[Acetyl-(2-fluoro-4-methanesulfonyl-phenyl)-amino]-pyrimidin-4-yloxy-
}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(5-Carbamoyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carb-
oxylic acid isopropyl ester;
4-{6-[4-(3,4-Difluoro-phenyl)-thiazol-2-ylamino]-pyrimidin-4-yloxy}-piper-
idine-1-carboxylic acid isopropyl ester;
4-[6-(5-Oxo-1-phenyl-4,5-dihydro-1H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-
-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(3-Oxazol-5-yl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxyl-
ic acid isopropyl ester;
4-[6-(5-Trifluoromethyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine--
1-carboxylic acid isopropyl ester;
4-[6-(4-Chloro-2-trifluoromethoxy-phenylamino)-pyrimidin-4-yloxy]-piperid-
ine-1-carboxylic acid isopropyl ester;
4-{6-[(5-Pyridin-2-yl-thiophen-2-ylmethyl)-amino]-pyrimidin-4-yloxy}-pipe-
ridine-1-carboxylic acid isopropyl ester;
4-{6-[5-(4-Chloro-phenyl)-2H-pyrazol-3-ylamino]-pyrimidin-4-yloxy}-piperi-
dine-1-carboxylic acid isopropyl ester;
4-[6-(1-Oxo-indan-5-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic
acid isopropyl ester;
4-{6-[5-(1-Methyl-pyrrolidin-2-yl)-pyridin-2-ylamino]-pyrimidin-4-yloxy}--
piperidine-1-carboxylic acid isopropyl ester;
4-[6-(6-Methoxy-2-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[6-(5-Bromo-3-methyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-1-
-carboxylic acid isopropyl ester;
4-[6-(2-Chloro-6-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine--
1-carboxylic acid isopropyl ester;
4-[6-(2-Ethynyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic
acid isopropyl ester;
4-[6-(4-Bromo-2-trifluoromethoxy-phenylamino)-pyrimidin-4-yloxy]-piperidi-
ne-1-carboxylic acid isopropyl ester;
4-[6-(3-Iodo-4-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carbox-
ylic acid isopropyl ester;
4-[6-(2-Fluoro-5-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carb-
oxylic acid isopropyl ester;
4-{6-[5-(4-Methoxy-phenyl)-[1,3,4]thiadiazol-2-ylamino]-pyrimidin-4-yloxy-
}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(3,5-Dimethyl-isoxazol-4-ylamino)-pyrimidin-4-yloxy]-piperidine-1-ca-
rboxylic acid isopropyl ester;
4-[2-(2,5-Difluoro-4-propoxy-phenylamino)-pyridin-4-yloxy]-piperidine-1-c-
arboxylic acid isopropyl ester;
4-[6-(2,5-Difluoro-4-propylamino-phenylamino)-pyrimidin-4-yloxy]-piperidi-
ne-1-carboxylic acid isopropyl ester;
4-[6-(2,5-Difluoro-4-morpholin-4-yl-phenylamino)-pyrimidin-4-yloxy]-piper-
idine-1-carboxylic acid isopropyl ester;
4-[6-(2-Methyl-4-propylamino-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-
-carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(4-methyl-piperazin-1-yl)-phenylamino]-pyrimidin-4-y-
loxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(2-pyrrolidin-1-yl-ethoxy)-phenylamino]-pyrimidin-4--
yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[4-(2-Dimethylamino-ethoxy)-2,5-difluoro-phenylamino]-pyrimidin-4-yl-
oxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(2-morpholin-4-yl-ethoxy)-phenylamino]-pyrimidin-4-y-
loxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2,4-Difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxyli-
c acid isopropyl ester;
4-[6-(2,4,5-Trifluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carbox-
ylic acid isopropyl ester;
4-[6-(4-Methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carb-
oxylic acid isopropyl ester;
4-{6-[Acetyl-(4-methanesulfonyl-phenyl)-amino]-pyrimidin-4-yloxy}-piperid-
ine-1-carboxylic acid isopropyl ester;
(2,5-Difluoro-4-propoxy-phenyl)-{6-[1-(5-isopropyl-[1,2,4]oxadiazol-3-yl)-
-piperidin-4-yloxy]-pyrimidin-4-yl}-amine;
4-{6-[2,5-Difluoro-4-(morpholin-4-ylamino)-phenylamino]-pyrimidin-4-yloxy-
}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(2-methoxy-ethylamino)-phenylamino]-pyrimidin-4-ylox-
y}-piperidine-1-carboxylic acid isopropyl ester;
4-(6-{2,5-Difluoro-4-[(tetrahydro-furan-2-ylmethyl)-amino]-phenylamino}-p-
yrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(4-Butylamino-2,5-difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidin-
e-1-carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(3-methyl-butylamino)-phenylamino]-pyrimidin-4-yloxy-
}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-2-methyl-pyrimidin-4-yloxy]-
-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(2-morpholin-4-yl-ethylamino)-phenylamino]-pyrimidin-
-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-{6-[2-(2,5-Difluoro-phenoxy)-ethylamino]-pyrimidin-4-yloxy}-piperidine--
1-carboxylic acid isopropyl ester;
4-[6-(2,5-Difluoro-phenoxy)-pyrimidin-4-yloxy]-piperidine-1-carboxylic
acid isopropyl ester;
4-[6-(4-Bromo-2-fluoro-phenoxy)-pyrimidin-4-yloxy]-piperidine-1-carboxyli-
c acid isopropyl ester;
4-[6-(2-Fluoro-4-morpholin-4-yl-phenoxy)-pyrimidin-4-yloxy]-piperidine-1--
carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(tetrahydro-furan-2-ylmethoxy)-phenylamino]-pyrimidi-
n-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-2-yloxy]-piperidine-
-1-carboxylic acid tert-butyl ester;
4-[5-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-3-yloxy]-piperidine-
-1-carboxylic acid tert-butyl ester;
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-2-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[4-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-2-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[4-(2,5-Difluoro-4-propoxy-phenylamino)-pyridin-2-yloxy]-piperidine-1-c-
arboxylic acid isopropyl ester; and
4-[2-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-4-yloxy]-piperidine-
-1-carboxylic acid isopropyl ester;
4-[2-(2,5-Difluoro-4-propoxy-phenylamino)-pyridin-4-yloxy]-piperidine-1-c-
arboxylic acid isopropyl ester.
[0446] Examples of GPR119 agonists are described in International
Application No. PCT/GB2004/050046 (published as WO 2005/061489),
the disclosure of which is herein incorporated by reference in its
entirety. Disclosed in International Application No.
PCT/GB2004/050046 as a GPR119 agonist is a compound of Formula
(VI):
R.sup.1-A-V-B-R.sup.2 (VI)
[0447] wherein: [0448] V is a 5-membered heteroaryl ring containing
up to four heteroatoms selected from O, N and S, optionally
substituted by C.sub.1-4 alkyl; [0449] A is --CH.dbd.CH-- or
(CH.sub.2).sub.n; [0450] B is --CH.dbd.CH-- or (CH.sub.2).sub.n,
where one of the CH.sub.2 groups may be replaced by O, NR.sup.5,
S(O).sub.m, C(O) or C(O)NR.sup.12; [0451] n is independently 0, 1,
2 or 3; [0452] m is independently 0, 1 or 2; [0453] R.sup.1 is 3-
or 4-pyridyl, 4- or 5-pyrimidinyl or 2-pyrazinyl, any of which may
be optionally substituted by one or more substituents selected from
halo, C.sub.1-4 alkyl, C.sub.1-4 fluoroalkyl, C.sub.2-4 alkenyl,
C.sub.2-4 alkynyl, C.sub.3-7 cycloalkyl, aryl, OR.sup.6, CN,
NO.sub.2, S(O).sub.mR.sup.6, CON(R.sup.6).sub.2, N(R.sup.6).sub.2,
NR.sup.10COR.sup.6, NR.sup.10SO.sub.2R.sup.6,
SO.sub.2N(R.sup.6).sub.2, a 4- to 7-membered heterocyclyl group or
a 5- or 6-membered heteroaryl group; [0454] R.sup.2 is 4- to
7-membered cycloalkyl substituted by R.sup.3, C(O)OR.sup.3,
C(O)R.sup.3 or S(O).sub.2R.sup.3, or 4- to 7-membered heterocyclyl,
containing one or two nitrogen atoms which is unsubstituted or
substituted by C(O)OR.sup.4, C(O)R.sup.3, S(O).sub.2R.sup.3,
C(O)NHR.sup.4, P(O)(OR.sup.11).sub.2 or a 5- or 6-membered nitrogen
containing heteroaryl group; [0455] R.sup.3 is C.sub.3-8 alkyl,
C.sub.3-8 alkenyl or C.sub.3-8 alkynyl, any of which may be
optionally substituted with up to 5 fluoro or chloro atoms, and may
contain a CH.sub.2 group that may be replaced by O, or C.sub.3-7
cycloalkyl, aryl, heterocyclyl, heteroaryl, C.sub.1-4
alkylC.sub.3-7 cycloalkyl, C.sub.1-4 alkylaryl, C.sub.1-4
alkylheterocyclyl or C.sub.1-4 alkylheteroaryl, any of which may be
optionally substituted with one or more substituents selected from
halo, C.sub.1-4 alkyl, C.sub.1-4 fluoroalkyl, OR.sup.6, CN,
CO.sub.2C.sub.1-4 alkyl, N(R.sup.6).sub.2 and NO.sub.2; [0456]
R.sup.4 is C.sub.2-8 alkyl, C.sub.2-8 alkenyl or C.sub.2-8 alkynyl,
any of which may be optionally substituted with up to 5 fluoro or
chloro atoms, and may contain a CH.sub.2 group that may be replaced
by O, or C.sub.3-7 cycloalkyl, aryl, heterocyclyl, heteroaryl,
C.sub.1-4 alkylC.sub.3-7 cycloalkyl, C.sub.1-4 alkylaryl, C.sub.1-4
alkylheterocyclyl or C.sub.1-4 alkylheteroaryl, any of which may be
substituted with one or more substituents selected from halo,
C.sub.1-4 alkyl, C.sub.1-4 fluoroalkyl, OR.sup.6, CN,
CO.sub.2C.sub.1-4 alkyl, N(R.sup.6).sub.2 and NO.sub.2; [0457]
R.sup.5 is hydrogen, C(O)R.sup.7, S(O).sub.2R.sup.8, C.sub.3-7
cycloalkyl or C.sub.1-4 alkyl optionally substituted by OR.sup.6,
C.sub.3-7 cycloalkyl, aryl, heterocyclyl or heteroaryl, wherein the
cyclic groups may be substituted with one or more substituents
selected from halo, C.sub.1-2 alkyl, C.sub.1-2 fluoroalkyl,
OR.sup.6, CN, N(R.sup.6).sub.2 and NO.sub.2; [0458] R.sup.6 are
independently hydrogen, C.sub.1-4 alkyl, C.sub.3-7 cycloalkyl,
aryl, heterocyclyl or heteroaryl, wherein the cyclic groups may be
substituted with one or more substituents selected from halo,
C.sub.1-4 alkyl, C.sub.1-4 fluoroalkyl, OR.sup.9, CN,
SO.sub.2CH.sub.3, N(R.sup.10).sub.2 and NO.sub.2; or a group
(N(R.sup.10).sub.2 may form a 4- to 7-membered heterocyclic ring
optionally containing a further heteroatom selected from O and
NR.sup.10; [0459] R.sup.7 is hydrogen, C.sub.1-4 alkyl, OR.sup.6,
N(R.sup.6).sub.2, aryl or heteroaryl; [0460] R.sup.8 is C.sub.1-4
alkyl, C.sub.1-4 fluoroalkyl, aryl or heteroaryl; [0461] R.sup.9 is
hydrogen, C.sub.1-2 alkyl or C.sub.1-2 fluoroalkyl; [0462] R.sup.10
is hydrogen or C.sub.1-4 alkyl; [0463] R.sup.11 is phenyl; and
[0464] R.sup.12 is hydrogen, C.sub.1-4 alkyl or C.sub.3-7
cycloalkyl.
[0465] The present invention also encompasses diastereomers as well
as optical isomers, e.g. mixtures of enantiomers including racemic
mixtures, as well as individual enantiomers and diastereomers,
which arise as a consequence of structural asymmetry in certain
compounds of the invention. Separation of the individual isomers or
selective synthesis of the individual isomers is accomplished by
application of various methods which are well known to
practitioners in the art.
[0466] Specific examples of GPR119 agonists disclosed in
International Application No. PCT/GB2004/050046 include the
following compounds according to Formula (VI) (referred to herein
as Group F1):
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid tert-butyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-1-carboxylic
acid tert-butyl ester;
3-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid tert-butyl ester;
4-[5-(4-Pentylcyclohexylmethyl)-[1,2,4]oxadiazol-3-yl]pyridine;
trans-2-Chloro-4-[5-(4-pentylcyclohexane)-[1,2,4]oxadiazol-3-yl]pyridine;
trans-4-[5-(4-Pentylcyclohexane)-[1,2,4]oxadiazol-3-ylmethyl]pyridine;
4-(3-Pyridin-4-ylmethyl-[1,2,4]oxadiazol-5-yl)piperidine-1-carboxylic
acid tert-butyl ester;
trans-3-[5-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-3-ylmethyl]pyridine;
4-[5-(4-Butylcyclohexane)-[1,2,4]oxadiazol-3-yl]pyridine;
4-[5-(4-n-Propylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine;
trans-4-[5-(4-Pentylcyclohexane)-[1,2,4]oxadiazol-3-yl]pyridine;
4-[2-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)-ethyl]piperidine-1-carboxylic
acid tert-butyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)piperidine-1-carboxylic
acid tert-butyl ester;
3-[5-(4-Propylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine;
3-[5-(4-Butylcyclohexane)-[1,2,4]oxadiazol-3-yl]pyridine;
trans-4-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine-2-carboxyl-
ic acid methylamide;
trans-4-[5-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine-2-carboxyl-
ic acid amide;
trans-4-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine;
trans-2-Chloro-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine;
trans-3-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine;
trans-2-Methyl-3-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine;
trans-2-Chloro-6-methyl-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]p-
yridine;
trans-4-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine-2--
carbonitrile;
trans-2-Chloro-3-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine;
trans-2-Chloro-6-methyl-3-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]p-
yridine;
trans-2-Methyl-5-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]py-
ridine;
trans-3-Methyl-5-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyr-
idine;
trans-2,6-Dichloro-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]-
pyridine;
trans-2-Chloro-6-methoxy-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadia-
zol-5-yl]pyridine;
trans-5-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]-2-[1,2,4]triazol-1-
-ylpyridine;
2-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyrazine;
4-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyrimidine;
trans-5-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine-2-carbonit-
rile;
trans-5-Chloro-2-methylsulfanyl-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxa-
diazol-5-yl]pyrimidine;
trans-2-Fluoro-5-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine;
trans-2-Fluoro-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine;
trans-2-Imidazol-1-yl-5-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyr-
idine;
trans-2-Methyl-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyri-
dine;
trans-3-Methyl-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyrid-
ine;
trans-4-{2-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]vinyl}pyridi-
ne;
4-(5-Pyridin-4-yl-[1,2,4]oxadiazol-3-ylmethoxy)piperidine-1-carboxylic
acid tert-butyl ester;
4-[5-(2-Cyanopyridin-4-yl)-[1,2,4]oxadiazol-3-ylmethoxy]piperidine-1-carb-
oxylic acid tert-butyl ester;
(E)-4-[5-(2-Pyridin-3-yl-vinyl)-[1,2,4]oxadiazol-3-ylmethoxy]piperidine-1-
-carboxylic acid tert-butyl ester;
(E)-4-[5-(2-Pyridin-3-yl-vinyl)-[1,2,4]oxadiazol-3-yl]piperidine-1-carbox-
ylic acid tert-butyl ester;
(E)-4-[5-(2-Pyridin-3-yl-vinyl)-[1,2,4]oxadiazol-3-ylmethyl]piperidine-1--
carboxylic acid tert-butyl ester;
(E)-4-[5-(2-Pyridin-4-yl-vinyl)-[1,2,4]oxadiazol-3-yl]piperidine-1-carbox-
ylic acid tert-butyl ester;
4-[5-(2-Pyridin-4-yl-ethyl)-[1,2,4]oxadiazol-3-yl]-piperidine-1-carboxyli-
c acid tert-butyl ester;
4-{5-[2-(2-Cyanopyridin-4-yl)ethyl]-[1,2,4]oxadiazol-3-yl}piperidine-1-ca-
rboxylic acid tert-butyl ester;
4-{5-[2-(2-Cyanopyridin-4-yl)ethyl]-[1,2,4]oxadiazol-3-ylmethoxy}piperidi-
ne-1-carboxylic acid tert-butyl ester;
4-{5-[2-(2-Cyanopyridin-4-yl)ethyl]-[1,2,4]oxadiazol-3-ylmethyl}piperidin-
e-1-carboxylic acid tert-butyl ester;
4-(5-Piperidin-4-yl-[1,2,4]oxadiazol-3-yl)pyridine;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-1-carboxylic
acid isobutyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-1-carboxylic
acid 2-methoxyethyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-1-carboxylic
acid ethyl ester;
3,3-Dimethyl-1-[4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidin-1-yl]bu-
tan-1-one;
2-Cyclopentyl-1-[4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperi-
din-1-yl]ethanone;
4-{5-[1-(Butane-1-sulfonyl)piperidin-4-yl]-[1,2,4]oxadiazol-3-yl}pyridine-
; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-1-carboxylic
acid propylamide;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-1-carboxylic
acid tert-butylamide;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid cyclopentyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid benzyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid isobutyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid ethyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid cycloheptyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid methyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid 2-methoxy-ethyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid isopropyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid 4-methoxy-phenyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid 2,2,2-trichloroethyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid 4-chloro-phenyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid phenyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid 2-ethyl-hexyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid propyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid hexyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid (1R,2S,5R)-2-isopropyl-5-methylcyclohexyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid (1S,2R,5S)-2-isopropyl-5-methylcyclohexyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid 2,2-dimethylpropyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid naphthalen-1-yl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid 2-methoxy-phenyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid 3-trifluoromethylphenyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid prop-2-ynyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid but-2-ynyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid pentyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid p-tolyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid 2-chloro-phenyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid naphthalen-2-yl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid butyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid 4-methoxycarbonyl-phenyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid 4-fluoro-phenyl ester;
3-Methyl-1-[4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-1-yl-
]-butan-1-one;
Phenyl-[4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-1-yl]met-
hanone;
1-[4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-1-yl]b-
utan-1-one;
2,2-Dimethyl-1-[4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin--
1-yl]propan-1-one;
Cyclopentyl-[4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-1-y-
l]methanone;
[4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-1-yl]-p-tolylme-
thanone;
3,3-Dimethyl-1-[4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)pi-
peridin-1-yl]butan-1-one;
4-{5-[1-(Butane-1-sulfonyl)piperidin-4-yloxymethyl]-[1,2,4]oxadiazol-3-yl-
}pyridine;
4-{5-[1-(Propane-1-sulfonyl)piperidin-4-yloxymethyl]-[1,2,4]oxa-
diazol-3-yl}pyridine;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid tert-butylamide;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic
acid o-tolylamide;
trans-4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)cyclohexanecarboxylic
acid propyl ester;
trans-4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)cyclohexanecarboxylic
acid butyl ester;
trans-4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)cyclohexanecarboxylic
acid isobutyl ester;
trans-4-[5-(4-Propoxymethylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine;
trans-4-[5-(4-Butoxymethylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine;
cis-4-[5-(3-Butoxymethylcyclopentyl)-[1,2,4]oxadiazol-3-yl]pyridine;
cis-4-[5-(3-Propoxymethylcyclopentyl)-[1,2,4]oxadiazol-3-yl]pyridine;
cis-4-[5-(3-Butoxymethylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)-3,4,5,6-tetrahydro-2H-[1,-
3']bipyridinyl;
2-[4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-1-yl]pyrazine-
;
2-[4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-1-yl]pyrimid-
ine;
(4-Pentylcyclohexyl)-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amin-
e;
(4-Pentylcyclohexyl-methyl)-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl-
)amine;
4-[(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-1--
carboxylic acid tert-butyl ester;
4-{[3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]methyl}-piperidine-1-
-carboxylic acid tert-butyl ester;
4-{[5-(2-Cyanopyridin-4-yl)-[1,2,4]oxadiazol-3-ylmethyl]amino}-piperidine-
-1-carboxylic acid tert-butyl ester;
Methyl-(4-pentylcyclohexyl)-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)a-
mine;
Methyl-(4-pentylcyclohexylmethyl)-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-
-ylmethyl)amine;
4-[Methyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-1--
carboxylic acid tert-butyl ester;
4-[Ethyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-1-c-
arboxylic acid tert-butyl ester;
4-[Propyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-1--
carboxylic acid tert-butyl ester;
4-[Cyclopropylmethyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]pi-
peridine-1-carboxylic acid tert-butyl ester;
4-[Butyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-1-c-
arboxylic acid tert-butyl ester;
4-{[Methyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]methyl}-pipe-
ridine-1-carboxylic acid tert-butyl ester;
4-{[Ethyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]methyl}-piper-
idine-1-carboxylic acid tert-butyl ester;
4-{[5-(2-Cyanopyridin-4-yl)-[1,2,4]oxadiazol-3-ylmethyl]ethylamino}-piper-
idine-1-carboxylic acid tert-butyl ester;
4-[Methyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-1--
carboxylic acid cyclopentyl ester;
4-{[Methyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]methyl}-pipe-
ridine-1-carboxylic acid 2,2,2-trichloroethyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxymethyl)piperidine-1-carboxy-
lic acid tert-butyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)piperazine-1-carboxylic
acid tert-butyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethylsulfanyl)piperidine-1-carbox-
ylic acid tert-butyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethanesulfonyl)piperidine-1-carbo-
xylic acid tert-butyl ester;
4-(5-Pyridin-4-yl-[1,3,4]oxadiazol-2-ylmethoxy)piperidine-1-carboxylic
acid tert-butyl ester;
3-Pyridin-4-yl-[1,2,4]oxadiazole-5-carboxylic acid
(4-pentylcyclohexyl)amide;
[4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-1-yl]phosphonic
acid diphenyl ester;
4-(4-Pyridin-4-yl-thiazol-2-ylmethoxy)piperidine-1-carboxylic acid
tert-butyl ester;
4-(2-Pyridin-4-yl-thiazol-4-ylmethyl)piperidine-1-carboxylic acid
tert-butyl ester;
trans-4-[5-(4-Pentyl-cyclohexyl)-[1,3,4]thiadiazol-2-yl]pyridine;
4-(5-Pyridin-4-yl-[1,3,4]thiadiazol-2-ylmethoxy)piperidine-1-carboxylic
acid tert-butyl ester;
4-(5-Pyridin-4-yl-4H-[1,2,4]triazol-3-ylmethoxy)piperidine-1-carboxylic
acid tert-butyl ester;
4-[2-(5-Pyridin-4-yl-isoxazol-3-yl)ethyl]piperidine-1-carboxylic
acid tert-butyl ester;
4-(5-Pyridin-4-yl-isoxazol-3-ylmethoxy)piperidine-1-carboxylic acid
tert-butyl ester;
4-(5-Pyridin-4-yl-isoxazol-3-ylmethyl)piperidine-1-carboxylic acid
tert-butyl ester;
4-[2-(1-Methyl-5-pyridin-4-yl-1H-pyrazol-3-yl)ethyl]piperidine-1-carboxyl-
ic acid tert-butyl ester;
4-[2-(2-Methyl-5-pyridin-4-yl-2H-pyrazol-3-yl)ethyl]-piperidine-1-carboxy-
lic acid tert-butyl ester;
(E)-4-{5-[2-(2-Cyanopyridin-4-yl)vinyl]-[1,2,4]oxadiazol-3-yl}piperidine--
1-carboxylic acid tert-butyl ester;
4-{5-[2-(2H-Tetrazol-5-yl)pyridine-4-yl]-[1,2,4]oxadiazol-3-ylmethoxy}-pi-
peridine-1-carboxylic acid tert-butyl ester;
4-[5-(2-Cyanopyridin-4-yl)-[1,2,4]oxadiazol-3-ylmethoxy]piperidine-1-carb-
oxylic acid isopropyl ester; and
4-[5-(2-Cyanopyridin-4-yl)-[1,2,4]oxadiazol-3-ylmethoxy]piperidine-1-carb-
oxylic acid phenyl ester.
[0467] In one aspect of the present invention, the GPR119 agonist
is a compound of Formula (I).
[0468] In one aspect of the present invention, the GPR119 agonist
is a compound of Formula (II).
[0469] In one aspect of the present invention, the GPR119 agonist
is a compound of Formula (III).
[0470] In one aspect of the present invention, the GPR119 agonist
is a compound of Formula (IV).
[0471] In one aspect of the present invention, the GPR119 agonist
is a compound of Formula (V).
[0472] In one aspect of the present invention, the GPR119 agonist
is a compound of Formula (VI).
[0473] In one aspect of the present invention, the GPR119 agonist
is a compound of Formula (VI),
provided that the compound is not
4-(5-piperidin-4-yl-[1,2,4]oxadiazol-3-yl)pyridine,
4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-1-carboxylic
acid butyl ester,
4-[5-(4-butylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine,
3-[5-(4-butylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine, or
3-[5-(4-propylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine.
[0474] In one aspect of the present invention, the GPR119 agonist
is selected from Group A1, Group B1, Group B2, Group B3, Group B4,
Group B5, Group C1, Group C2, Group C3, Group C4, Group C5, Group
C6, Group C7, Group C8, Group C9, Group C10, Group D1, Group D2,
Group D3, Group D4, Group D5, Group D6, Group D7, Group D8, Group
D9, Group D10, Group D11, Group D12, Group D13, Group D14, Group
E1, Group E2 or Group F1.
[0475] In one aspect, the GPR119 agonist is selected from the left
column of Table B.
[0476] Specific examples of GPR119 agonists include
2-(pyridine-4-yl)ethyl thiobenzoate and
L-.alpha.-lysophosphatidylcholine oleoyl, as disclosed in EP
1338651, the disclosure of which is herein incorporated by
reference in its entirety.
[0477] Examples of GPR119 agonists may be found in International
Application WO 03/026661, the disclosure of which is herein
incorporated by reference in its entirety. GPR119 agonists
disclosed in WO 03/026661 include but are not limited to the
compounds in Table C.
TABLE-US-00002 TABLE C Cmpd No. Chemical Structure Chemical Name 1C
##STR00039## [2-(4-Bromo-phenyl)-6- methyl-pyrimidin-4-yl]-
methyl-amine 2C ##STR00040## [2-(4-Bromo-phenyl)-6-
methyl-pyrimidin-4-yl]-p-tolyl- amine 3C ##STR00041##
[2-(4-Bromo-phenyl)-6- methyl-pyrimidin-4-yl]-(4-
methoxy-phenyl)-amine 4C ##STR00042## [2-(4-Bromo-phenyl)-6-
methyl-pyrimidin-4-yl]- phenyl-amine 5C ##STR00043##
[2-(4-Bromo-phenyl)-6- methyl-pyrimidin-4-yl]- cyclohexyl-amine 6C
##STR00044## 5-[2-(4-Bromo-phenyl)-6- ethyl-pyrimidin-4-ylamino]-
pentan-1-ol 7C ##STR00045## 3-[2-(4-Bromo-phenyl)-6-
methyl-pyriidin-4-ylamino]- propionitrile 8C ##STR00046##
[2-(4-Bromo-phenyl)-6-ethyl- pyrimidin-4-yl]-(4-fluoro-
benzyl)-amine 9C ##STR00047## [2-(4-Bromo-phenyl)-6-ethyl-
pyrimidin-4-yl]-(4-chloro- phenyl)-ethyl]-amine 10C ##STR00048##
[2-(4-Bromo-phenyl)-6-ethyl- pyrimidin-4-yl]pyridin-2-
ylmethyl-amine 11C ##STR00049## [2-(4-Bromo-phenyl)-6-
methyl-pyrimidin-4-yl]- pyridin-3-ylmethyl-amine 12C ##STR00050##
3-{[2-(4-Bromo-phenyl)-6- methyl-pyrimidin-4-ylamino]-
methyl}-1H-pyridin-2-one 13C ##STR00051## 4-{[2-(4-Bromo-phenyl)-6-
ethyl-pyrimidin-4-ylamino]- methyl}-1H-pyridin-2-one 14C
##STR00052## 4-{2-[2-(4-Bromo-phenyl)-6-
methyl-pyrimidin-4-ylamino]- ethyl}-1H-pyridin-2-one 15C
##STR00053## [2-(3-Chloro-4-fluoro-phenyl)-
6-ethyl-pyrimidin-4-yl]-(1,1- dioxo-hexahydro-1l6-
thiopyran-4-yl)-amine 16C ##STR00054##
[6-Methyl-2-(3,4,5-trifluoro- phenyl)-pyrimidin-4-yl]-[2-(1-
oxy-pyridin-3-yl)-ethyl]-amine 17C ##STR00055##
[6-Ethyl-2-(3,4,5-trifluoro- phenyl)-pyrimidin-4-yl]-[2-(1-
oxy-pyridin-3-yl)-ethyl]-amine 18C ##STR00056##
[6-Methyl-2-(2,4,5-trifluoro- phenyl)-pyrimidin-4-yl]-[2-(1-
oxy-pyridin-3-yl)-ethyl]-amine 19C ##STR00057##
4-{4-Methyl-6-[2-(1-oxy- pyridin-3-yl)-ethylamino]-
pyrimidin-2-yl}-benzonitrile 20C ##STR00058##
2-[4-(6-Methyl-2-phenyl- pyrimidin-4-ylamino)-phenyl]- ethanol 21C
##STR00059## [2-(3-Chloro-phenyl)-6- methyl-pyrimidin-4-yl]-
methyl-amine 22C ##STR00060## 2-{[2-(4-Bromo-phenyl)-6-
methyl-pyrimidin-4-yl]- methyl-amino}-ethanol; compound with
methane
[0478] Examples of GPR119 agonists may be found in International
Application JP 2004269468, the disclosure of which is herein
incorporated by reference in its entirety. GPR119 agonists
disclosed in JP 2004269468 include but are not limited to the
compounds in Table D.
TABLE-US-00003 TABLE D Cmpd No. Chemical Structure Chemical Name 1D
##STR00061## 3-[6-Ethyl-2-(3,4,5-trifluoro-
phenyl)-pyrimidin-4-ylamino]- propane-1,2-diol 2D ##STR00062##
(S)-3-[6-Methyl-2-(2,3,5- trifluoro-phenyl)-pyrimidin-4-
ylamino]-propane-1,2-diol 3D ##STR00063##
(S)-3-[2-(4-Bromo-3-fluoro- phenyl)-6-methyl-pyrimidin-4-
ylamino]-propane-1,2-diol 4D ##STR00064## (R)-3-[6-Ethyl-2-(3,4,5-
trifluoro-phenyl)-pyrimidin-4- ylamino]-propane-1,2-diol 5D
##STR00065## (R)-3-[2-(3-Chloro-4-fluoro-
phenyl)-6-ethyl-pyrimidin-4- ylamino]-propane-1,2-diol 6D
##STR00066## (R)-3-[2-(4-Bromo-2,5- difluoro-phenyl)-5-fluoro-6-
methyl-pyrimidin-4-ylamino]- propane-1,2-diol 7D ##STR00067##
(R)-3-[2-(4-Chloro-2,5- difluoro-phenyl)-6-
difluoromethyl-pyrimidin-4- ylamino]-propane-1,2-diol
[0479] Examples of GPR119 agonists may be found in International
Application JP 2004269469, the disclosure of which is herein
incorporated by reference in its entirety. GPR119 agonists
disclosed in JP 2004269469 include but are not limited to the
compounds in Table E.
TABLE-US-00004 TABLE E Cmpd No. Chemical Structure Chemical Name 1E
##STR00068## 5-{2-[2-(4-Bromo-phenyl)-6-
ethyl-pyrimidin-4-ylamino]- ethyl}-1H-pyridin-2-one 2E ##STR00069##
5-{2-[6-Methyl-2-(2,4,5- trifluoro-phenyl)-pyrimidin-4-
ylamino]-ethyl}-1H-pyridin-2- one 3E ##STR00070##
4-{2-[2-(4-Chloro-2,5- difluoro-phenyl)-6-ethyl-
pyrimidin-4-ylamino]-ethyl}- 1H-pyridin-2-one 4E ##STR00071##
3-Chloro-4-{2-[6-methyl-2- (2,4,5-trifluoro-phenyl)-
pyrimidin-4-ylamino]ethyl}- 1H-pyridin-2-one 5E ##STR00072##
4-{1-Hydroxy-2-[6-methyl-2- (2,4,5-trifluoro-phenyl)-
pyrimidin-4-ylamino}-ethyl}- 1H-pyridin-2-one 6E ##STR00073##
4-{1-Methyl-2-[6-methyl-2- (2,4,5-trifluoro-phenyl)-
pyrimidin-4-ylamino]-ethyl}- 1H-pyridin-2-one
[0480] In one aspect of the present invention, the GPR119 agonist
is a compound which comprises Group A1, Group B1, Group B2, Group
B3, Group B4, Group B5, Group C1, Group C2, Group C3, Group C4,
Group C5, Group C6, Group C7, Group C8, Group C9, Group C10, Group
D1, Group D2, Group D3, Group D4, Group D5, Group D6, Group D7,
Group D8, Group D9, Group D10, Group D11, Group D12, Group D13,
Group D14, Group E1, Group E2 or Group F1.
[0481] In one aspect, the GPR119 agonist is not identical to a
compound included in the left column of Table B.
[0482] In one aspect, the GPR119 agonist is not identical to a
compound disclosed in International Application No.
PCT/US2004/001267.
[0483] In one aspect, the GPR119 agonist is not identical to a
compound disclosed in International Application No.
PCT/GB2004/050046.
[0484] In one aspect, the GPR119 agonist is not identical to a
compound of Formula (I).
[0485] In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group A1.
[0486] In one aspect, the GPR119 agonist is not identical to a
compound disclosed in International Application No.
PCT/US2004/005555.
[0487] In one aspect, the GPR119 agonist is not identical to a
compound of Formula (II).
[0488] In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group B1, Group B2, Group B3, Group B4 or
Group B5.
[0489] In one aspect, the GPR119 agonist is not identical to a
compound, taken individually, which comprises any one of Group B1,
Group B2, Group B3, Group B4 or Group B5 taken individually.
[0490] In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group B1.
[0491] In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group B2. In one aspect, the GPR119
agonist is not identical to a compound which comprises Group B3. In
one aspect, the GPR119 agonist is not identical to a compound which
comprises Group B4. In one aspect, the GPR119 agonist is not
identical to a compound which comprises Group B5.
[0492] In one aspect, the GPR119 agonist is not identical to a
compound disclosed in International Application No.
PCT/US04/022327.
[0493] In one aspect, the GPR119 agonist is not identical to a
compound of Formula (III).
[0494] In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group C1, Group C2, Group C3, Group C4,
Group C5, Group C6, Group C7, Group C8, Group C9 or Group C10.
[0495] In one aspect, the GPR119 agonist is not identical to a
compound, taken individually, which comprises any one of Group C1,
Group C2, Group C3, Group C4, Group C5, Group C6, Group C7, Group
C8, Group C9 or Group C10 taken individually.
[0496] In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group C1. In one aspect, the GPR119
agonist is not identical to a compound which comprises Group C2. In
one aspect, the GPR119 agonist is not identical to a compound which
comprises Group C3. In one aspect, the GPR119 agonist is not
identical to a compound which comprises Group C4. In one aspect,
the GPR119 agonist is not identical to a compound which comprises
Group C5. In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group C6. In one aspect, the GPR119
agonist is not identical to a compound which comprises Group C7. In
one aspect, the GPR119 agonist is not identical to a compound which
comprises Group C8. In one aspect, the GPR119 agonist is not
identical to a compound which comprises Group C9. In one aspect,
the GPR119 agonist is not identical to a compound which comprises
Group C10.
[0497] In one aspect, the GPR119 agonist is not identical to a
compound disclosed in International Application No.
PCT/US04/022417.
[0498] In one aspect, the GPR119 agonist is not identical to a
compound of Formula (IV).
[0499] In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group D1, Group D2, Group D3, Group D4,
Group D5, Group D6, Group D7, Group D8, Group D9, Group D10, Group
D11, Group D12, Group D13 or Group D14.
[0500] In one aspect, the GPR119 agonist is not identical to a
compound, taken individually, which comprises any one of Group D1,
Group D2, Group D3, Group D4, Group D5, Group D6, Group D7, Group
D8, Group D9, Group D10, Group D11, Group D12, Group D13 or Group
D14 taken individually.
[0501] In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group D1. In one aspect, the GPR119
agonist is not identical to a compound which comprises Group D2. In
one aspect, the GPR119 agonist is not identical to a compound which
comprises Group D3. In one aspect, the GPR119 agonist is not
identical to a compound which comprises Group D4. In one aspect,
the GPR119 agonist is not identical to a compound which comprises
Group D5. In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group D6. In one aspect, the GPR119
agonist is not identical to a compound which comprises Group D7. In
one aspect, the GPR119 agonist is not identical to a compound which
comprises Group D8. In one aspect, the GPR119 agonist is not
identical to a compound which comprises Group D9. In one aspect,
the GPR119 agonist is not identical to a compound which comprises
Group D10. In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group D11. In one aspect, the GPR119
agonist is not identical to a compound which comprises Group D12.
In one aspect, the GPR119 agonist is not identical to a compound
which comprises Group D13. In one aspect, the GPR119 agonist is not
identical to a compound which comprises Group D14.
[0502] In one aspect, the GPR119 agonist is not identical to a
compound disclosed in U.S. Patent Application No. 60/577,354.
[0503] In one aspect, the GPR119 agonist is not identical to a
compound of Formula (V).
[0504] In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group E1 or Group E2.
[0505] In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group E1.
[0506] In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group E2.
[0507] In one aspect, the GPR119 agonist is not identical to a
compound of Formula (VI).
[0508] In one aspect, the GPR119 agonist is not identical to a
compound which comprises Group F1.
[0509] In one aspect, the GPR119 agonist is not identical to a
compound disclosed in EP 1338651.
[0510] In one aspect, the GPR119 agonist is not identical to
2-(pyridine-4-yl)ethyl thiobenzoate.
[0511] In one aspect, the GPR119 agonist is not identical to
L-.alpha.-lysophosphatidylcholine oleoyl.
[0512] In one aspect, the GPR119 agonist is not identical to a
compound disclosed in WO 03/026661.
[0513] In one aspect, the GPR119 agonist is not identical to a
compound in Table C.
[0514] In one aspect, the GPR119 agonist is not identical to a
compound disclosed in JP 2004269468.
[0515] In one aspect, the GPR119 agonist is not identical to a
compound in Table D.
[0516] In one aspect, the GPR119 agonist is not identical to a
compound disclosed in JP 2004269469.
[0517] In one aspect, the GPR119 agonist is not identical to a
compound in Table E.
[0518] In one aspect, the GPR119 agonist is not identical to a
compound disclosed in WO 2005/061489.
[0519] In one aspect, the GPR119 agonist is not identical to
4-(5-piperidin-4-yl-[1,2,4]oxadiazol-3-yl)pyridine. In one aspect,
the GPR119 agonist is not identical to
4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-1-carboxylic
acid butyl ester. In one aspect, the GPR119 agonist is not
identical to
4-[5-(4-butylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine. In one
aspect, the GPR119 agonist is not identical to
3-[5-(4-butylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine. In one
aspect, the GPR119 agonist is not identical to
3-[5-(4-propylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine.
[0520] In one aspect of the present invention, any one or more
GPR119 agonist can be excluded from any embodiment of the present
invention.
[0521] In one aspect of the present invention, any one or more
GPR119 agonist which comprises Group A1, Group B1, Group B2, Group
B3, Group B4, Group B5, Group C1, Group C2, Group C3, Group C4,
Group C5, Group C6, Group C7, Group C8, Group C9, Group C10, Group
D1, Group D2, Group D3, Group D4, Group D5, Group D6, Group D7,
Group D8, Group D9, Group D10, Group D11, Group D12, Group D13,
Group D14, Group E1, Group E2 or Group F1 can be excluded from any
embodiment of the present invention.
[0522] In one aspect of the present invention, the GPR119 agonist
has an EC50 of less than about 10 .mu.M, less than about 1 .mu.M,
less than about 100 nM, less than about 75 nM, less than about 50
nM, less than about 25 nM, less than about 20 nM, less than about
15 nM, less than about 10 nM, less than about 5 nM, less than about
4 nM, less than about 3 nM, less than about 2 nM, or less than
about 1 nM. Preferably the GPR119 agonist has an EC50 of less than
about 50 nM, less than about 25 nM, less than about 20 nM, less
than about 15 nM, less than about 10 nM, less than about 5 nM, less
than about 4 nM, less than about 3 nM, less than about 2 nM, or
less than about 1 nM.
[0523] In one aspect of the present invention, the GPR119 agonist
is a selective GPR119 agonist, wherein the selective GPR119 agonist
has a selectivity for GPR119 over corticotrophin-releasing factor-1
(CRF-1) receptor of at least about 100-fold.
[0524] In one aspect of the present invention, the GPR19 agonist is
orally active.
[0525] In one aspect of the present invention, the GPR119 agonist
is an agonist of human GPR119.
DPP-IV Inhibitors
[0526] The class of DPP-IV inhibitors useful in the novel
therapeutic combinations of the present invention include compounds
which exhibit an acceptably high affinity for DPP-IV. The DPP-IV
inhibitor or pharmaceutically acceptable salt may be any DPP-IV
inhibitor, more preferably a selective dipeptidyl peptidase
inhibitor, and most preferably a selective DPP-IV inhibitor.
[0527] Examples of DPP-IV inhibitors are described in Villhauer et
al., J Med Chem (2003) 46:2774-2789, for LAF237; Ahren et al, J
Clin Endocrinol Metab (2004) 89:2078-2084; Villhauer et al., J Med
Chem (2002) 45:2362-2365 for NVP-DPP728; Ahren et al, Diabetes Care
(2002) 25:869-875 for NVP-DPP728; Peters et al., Bioorg Med Chem
Lett (2004) 14:1491-1493; Caldwell et al., Bioorg Med Chem Lett
(2004) 14:1265-1268; Edmondson et al., Bioorg Med Chem Lett (2004)
14:5151-5155; and Abe et al., J Nat Prod (2004) 67:999-1004; the
disclosure of each of which is herein incorporated by reference in
its entirety.
[0528] Specific examples of DPP-IV inhibitors include, but are not
limited to, dipeptide derivatives or dipeptide mimetics such as
alanine-pyrrolidide, isoleucine-thiazolidide, and the
pseudosubstrate N-valyl prolyl, O-benzoyl hydroxylamine, as
described e.g. in U.S. Pat. No. 6,303,661, the disclosure of which
is herein incorporated by reference in its entirety.
[0529] Examples of DPP-IV inhibitors may be found in U.S. Pat. Nos.
6,869,947, 6,867,205, 6,861,440, 6,849,622, 6,812,350, 6,803,357,
6,800,650, 6,727,261, 6,716,843, 6,710,040, 6,706,742, 6,645,995,
6,617,340, 6,699,871, 6,573,287, 6,432,969, 6,395,767, 6,380,398,
6,303,661, 6,242,422, 6,166,063, 6,100,234, 6,040,145, the
disclosure of each of which is herein incorporated by reference in
its entirety. Examples of DPP-IV inhibitors may be found in U.S.
Pat. Appl. Nos. 2005059724, 2005059716, 2005043292, 2005038020,
2005032804, 2005004205, 2004259903, 2004259902, 2004259883,
2004254226, 2004242898, 2004229926, 2004180925, 2004176406,
2004138214, 2004116328, 2004110817, 2004106656, 2004097510,
2004087587, 2004082570, 2004077645, 2004072892, 2004063935,
2004034014, 2003232788, 2003225102, 2003216450, 2003216382,
2003199528, 2003195188, 2003162820, 2003149071, 2003134802,
2003130281, 2003130199, 2003125304, 2003119750, 2003119738,
2003105077, 2003100563, 2003087950, 2003078247, 2002198205,
2002183367, 2002103384, 2002049164, 2002006899, the disclosure of
each of which is herein incorporated by reference in its
entirety.
[0530] Examples of DPP-IV inhibitors may be found in International
Applications WO 2005/087235, WO 2005/082348, WO 2005/082849, WO
2005/079795, WO 2005/075426, WO 2005/072530, WO 2005/063750, WO
2005/058849, WO 2005/049022, WO 2005/047297, WO 2005/044195, WO
2005/042488, WO 2005/040095, WO 2005/037828, WO 2005/037779, WO
2005/034940, WO 2005/033099, WO 2005/032590, WO 2005/030751, WO
2005/030127, WO 2005/026148, WO 2005/025554, WO 2005/023762, WO
2005/020920, WO 05/19168, WO 05/12312, WO 05/12308, WO 05/12249, WO
05/11581, WO 05/09956, WO 05/03135, WO 05/00848, WO 05/00846, WO
04/112701, WO 04/111051, WO 04/111041, WO 04/110436, WO 04/110375,
WO 04/108730, WO 04/104216, WO 04/104215, WO 04/103993, WO
04/103276, WO 04/99134, WO 04/96806, WO 04/92128, WO 04/87650, WO
04/87053, WO 04/85661, WO 04/85378, WO 04/76434, WO 04/76433, WO
04/71454, WO 04/69162, WO 04/67509, WO 04/64778, WO 04/58266, WO
04/52362, WO 04/52850, WO 04/50022, WO 04/50658, WO 04/48379, WO
04/46106, WO 04/43940, WO 04/41820, WO 04/41795, WO 04/37169, WO
04/37181, WO 04/33455, WO 04/32836, WO 04/20407, WO 04/18469, WO
04/18468, WO 04/18467, WO 04/14860, WO 04/09544, WO 04/07468, WO
04/07446, WO 04/04661, WO 04/00327, WO 03/106456, WO 03/104229, WO
03/101958, WO 03/101448, WO 03/99279, WO 03/95425, WO 03/84940, WO
03/82817, WO 03/80633, WO 03/74500, WO 03/72556, WO 03/72528, WO
03/68757, WO 03/68748, WO 03/57666, WO 03/57144, WO 03/55881, WO
03/45228, WO 03/40174, WO 03/38123, WO 03/37327, WO 03/35067, WO
03/35057, WO 03/24965, WO 03/24942, WO 03/22871, WO 03/15775, WO
03/04498, WO 03/04496, WO 03/02530, WO 03/02596, WO 03/02595, WO
03/02593, WO 03/02553, WO 03/02531, WO 03/00181, WO 03/00180, WO
03/00250, WO 02/83109, WO 02/83128, WO 02/76450, WO 02/68420, WO
02/62764, WO 02/55088, WO 02/51836, WO 02/38541, WO 02/34900, WO
02/30891, WO 02/30890, WO 02/14271, WO 02/02560, WO 01/97808, WO
01/96295, WO 01/81337, WO 01/81304, WO 01/68603, WO 01/55105, WO
01/52825, WO 01/34594, WO 00/71135, WO 00/69868, WO 00/56297, WO
00/56296, WO 00/34241, WO 00/23421, WO 00/10549, WO 99/67278, WO
99/62914, WO 99/61431, WO 99/56753, WO 99/25719, WO 99/16864, WO
98/50066, WO 98/50046, WO 98/19998, WO 98/18763, WO 97/40832, WO
95/29691, WO 95/15309, WO 93/10127, WO 93/08259, WO 91/16339, EP
1517907, EP 1513808, EP 1492777, EP 1490335, EP 1489088, EP
1480961, EP 1476435, EP 1476429, EP 1469873, EP 1465891, EP
1463727, EP 1461337, EP 1450794, EP 1446116, EP 1442049, EP
1441719, EP 1426366, EP 1412357, EP1406873, EP 1406872, EP 1406622,
EP 1404675, EP 1399420, EP 1399471, EP 1399470, EP 1399469, EP
1399433, EP 1399154, EP 1385508, EP 1377288, EP 1355886, EP
1354882, EP 1338592, EP 1333025, EP 1304327, EP 1301187, EP
1296974, EP 1280797, EP 1282600, EP 1261586, EP 1258476, EP
1254113, EP 1248604, EP 1245568, EP 1215207, EP 1228061, EP
1137635, EP 1123272, EP 1104293, EP 1082314, EP 1050540, EP
1043328, EP 0995440, EP 0980249, EP 0975359, EP 0731789, EP
0641347, EP 0610317, EP 0528858, CA 2466870, CA 2433090, CA
2339537, CA 2289125, CA 2289124, CA 2123128, DD 296075, DE
19834591, DE 19828113, DE 19823831, DE 19616486, DE 10333935, DE
10327439, DE 10256264, DE 10251927, DE 10238477, DE 10238470, DE
10238243, DE 10143840, FR 2824825, FR 2822826, JP2005507261; JP
2005505531, JP 2005502624, JP 2005500321, JP 2005500308,
JP2005023038, JP 2004536115, JP 2004535445, JP 2004535433, JP
2004534836, JP 2004534815, JP 2004532220, JP 2004530729, JP
2004525929, JP 2004525179, JP 2004522786, JP 2004521149, JP
2004503531, JP 2004315496, JP 2004244412, JP 2004043429, JP
2004035574, JP 2004026820, JP 2004026678, JP 2004002368, JP
2004002367, JP 2003535898, JP 2003535034, JP 2003531204, JP
2003531191, JP 2003531118, JP 2003524591, JP 2003520849, JP
2003327532, JP 2003300977, JP 2003238566, JP 2002531547, JP
2002527504, JP 2002517401, JP 2002516318, JP 2002363157, JP
2002356472, JP 2002356471, JP 2002265439, JP 2001510442, JP
2000511559, JP 2000327689, JP 2000191616, JP 1998182613, JP
1998081666, JP 1997509921, JP 1995501078, JP 1993508624, the
disclosure of each of which is herein incorporated by reference in
its entirety.
[0531] In one aspect of the present invention, the DPP-IV inhibitor
is valine-pyrrolidide [Deacon et al, Diabetes (1998) 47:764769; the
disclosure of which is herein incorporated by reference in its
entirety].
[0532] In one aspect of the present invention, the DPP-IV inhibitor
is 3-(L-Isoleucyl)thiazolidine (isoleucine-thiazolidide).
Isoleucine-thiazolidide may be found in JP 2001510442, WO 97/40832,
U.S. Pat. No. 6,303,661, and DE 19616486, the disclosure of each of
which is herein incorporated by reference in its entirety.
Isoleucine-thiazolidide is described as an orally active and
selective DPP-IV inhibitor [Pederson et al, Diabetes (1998)
47:1253-1258; the disclosure of which is herein incorporated by
reference in its entirety].
[0533] In one aspect of the present invention, the DPP-IV inhibitor
is
1-[2-[5-cyanopyridin-2-yl)amino]ethylamino]acetyl-2-cyano-(S)-pyrrolidine
(NVP-DPP728). NVP-DPP728 may be found in WO 98/19998 and JP
2000511559, the disclosure of each of which is herein incorporated
by reference in its entirety. NVP-DPP728 is described as an orally
active and selective DPP-IV inhibitor [Villhauer et al, J Med Chem
(2002) 45:2362-2365].
[0534] In one aspect of the present invention, the DPP-IV inhibitor
is
3(R)-Amino-1-[3-(trifluoromethyl)-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a-
]pyrazin-7-yl]-4-(2,4,5-trifluorophenyl)butan-1-one (MK-0431).
MK-0431 may be found in EP 1412357, WO 03/04498, U.S. Pat. No.
6,699,871, and US 2003100563, the disclosure of each of which is
herein incorporated by reference in its entirety. MK-0431 is
described as an orally active and selective DPP-IV inhibitor [Weber
et al, Diabetes (2004) 53(Suppl. 2):A151, 633-P (Abstract), the
disclosure of which is herein incorporated by reference in its
entirety].
[0535] In one aspect of the present invention, the DPP-IV inhibitor
is (1-[[3-hydroxy-1-adamantyl)amino]acetyl]-2-cyano-(S)-pyrrolidine
(LAF237). LAF237 may be found in U.S. Pat. No. 6,166,063, WO
00/34241, EP 1137635, and JP 2002531547, the disclosure of each of
which is herein incorporated by reference in its entirety. LAF237
is described as an orally active and selective DPP-IV inhibitor
[Villhauer et al, J Med Chem (2003) 46:2774-2789].
[0536] In one aspect of the present invention, the DPP-IV inhibitor
is
(1S,3S,5S)-2-[2(S)-Amino-2-(3-hydroxyadamantan-1-yl)acetyl]-2-azabicyclo[-
3.1.0]hexane-3-carbonitrile (BMS-477118).
[0537] In one aspect of the present invention, the DPP-IV inhibitor
is [1-[2(S)-Amino-3-methylbutyryl]pyrrolidin-2(R)-yl]boronic acid
(PT-100).
[0538] In one aspect of the present invention, the DPP-IV inhibitor
is GSK-823093.
[0539] In one aspect of the present invention, the DPP-IV inhibitor
is PSN-9301.
[0540] In one aspect of the present invention, the DPP-IV inhibitor
is T-6666.
[0541] In one aspect of the present invention, the DPP-IV inhibitor
is SYR-322.
[0542] In one aspect of the present invention, the DPP-IV inhibitor
is SYR-619.
[0543] In one aspect of the present invention, the DPP-IV inhibitor
is CR-14023.
[0544] In one aspect of the present invention, the DPP-IV inhibitor
is CR-14025.
[0545] In one aspect of the present invention, the DPP-IV inhibitor
is CR-14240.
[0546] In one aspect of the present invention, the DPP-IV inhibitor
is CR-13651.
[0547] In one aspect of the present invention, the DPP-IV inhibitor
is NNC-72-2138.
[0548] In one aspect of the present invention, the DPP-IV inhibitor
is N,N-7201.
[0549] In one aspect of the present invention, the DPP-IV inhibitor
is PHX-1149.
[0550] In one aspect of the present invention, the DPP-IV inhibitor
is PHX-1004.
[0551] In one aspect of the present invention, the DPP-IV inhibitor
is SNT-189379.
[0552] In one aspect of the present invention, the DPP-IV inhibitor
is GRC-8087.
[0553] In one aspect of the present invention, the DPP-IV inhibitor
is PT-630.
[0554] In one aspect of the present invention, the DPP-IV inhibitor
is SK-0403.
[0555] In one aspect of the present invention, the DPP-IV inhibitor
is GSK-825964.
[0556] In one aspect of the present invention, the DPP-IV inhibitor
is TS-021.
[0557] In one aspect of the present invention, the DPP-IV inhibitor
is GRC-8200.
[0558] In one aspect of the present invention, the DPP-IV inhibitor
is GRC-8116.
[0559] In one aspect of the present invention, the DPP-IV inhibitor
is FE107542.
[0560] In one aspect of the present invention, the DPP-IV inhibitor
is selected from the right column of Table B.
[0561] In one aspect of the present invention, the DPP-IV inhibitor
is not a dipeptide derivative.
[0562] In one aspect of the present invention, the DPP-IV inhibitor
is not a dipeptide mimetic.
[0563] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to valine-pyrrolidide.
[0564] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to alanine-pyrrolidide.
[0565] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to 3-(L-Isoleucyl)thiazolidine
(isoleucine-thiazolidide).
[0566] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to N-valyl propyl,O-benzoyl hydroxylamine.
[0567] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to
1-[2-[5-cyanopyridin-2-yl)amino]ethylamino]acetyl-2-cyano-(S)-pyrrolidine
(NVP-DPP728).
[0568] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to
3(R)-Amino-1-[3-(trifluoromethyl)-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a-
]pyrazin-7-yl]-4-(2,4,5-trifluorophenyl)butan-1-one (MK-0431).
[0569] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to
(1-[[3-hydroxy-1-adamantyl)amino]acetyl]-2-cyano-(S)-pyrrolidine
(LAF237).
[0570] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to
(1S,3S,5S)-2-[2(S)-Amino-2-(3-hydroxyadamantan-1-yl)acetyl]-2-azabicyclo[-
3.1.0]hexane-3-carbonitrile (BMS-477118).
[0571] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to
[1-[2(S)-Amino-3-methylbutyryl]pyrrolidin-2(R)-yl]boronic acid
(PT-100).
[0572] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to GSK-823093.
[0573] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to PSN-9301.
[0574] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to T-6666.
[0575] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to SYR-322.
[0576] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to SYR-619.
[0577] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to CR-14023.
[0578] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to CR-14025.
[0579] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to CR-14240.
[0580] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to CR-13651.
[0581] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to NNC-72-2138.
[0582] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to N,N-7201.
[0583] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to PHX-1149.
[0584] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to PHX-1004.
[0585] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to SNT-189379.
[0586] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to GRC-8087.
[0587] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to PT-630.
[0588] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to SK-0403.
[0589] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to GSK-825964.
[0590] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to TS-021.
[0591] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to GRC-8200.
[0592] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to GRC-8116.
[0593] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to FE107542.
[0594] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to a compound included in the right column of
Table B.
[0595] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to a compound disclosed in a U.S. patent having a
U.S. patent No. selected from the group consisting of U.S. Pat.
Nos. 6,869,947, 6,867,205, 6,861,440, 6,849,622, 6,812,350,
6,803,357, 6,800,650, 6,727,261, 6,716,843, 6,710,040, 6,706,742,
6,645,995, 6,617,340, 6,699,871, 6,573,287, 6,432,969, 6,395,767,
6,380,398, 6,303,661, 6,242,422, 6,166,063, 6,100,234, and
6,040,145.
[0596] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to a compound disclosed in a U.S. patent
application having a U.S. patent application No. selected from the
group consisting of 2005059724, 2005059716, 2005043292, 2005038020,
2005032804, 2005004205, 2004259903, 2004259902, 2004259883,
2004254226, 2004242898, 2004229926, 2004180925, 2004176406,
2004138214, 2004116328, 2004110817, 2004106656, 2004097510,
2004087587, 2004082570, 2004077645, 2004072892, 2004063935,
2004034014, 2003232788, 2003225102, 2003216450, 2003216382,
2003199528, 2003195188, 2003162820, 2003149071, 2003134802,
2003130281, 2003130199, 2003125304, 2003119750, 2003119738,
2003105077, 2003100563, 2003087950, 2003078247, 2002198205,
2002183367, 2002103384, 2002049164, and 2002006899.
[0597] In one aspect of the present invention, the DPP-IV inhibitor
is not identical to a compound disclosed in an International
Application selected from the group consisting of WO 2005/087235,
WO 2005/082348, WO 2005/082849, WO 2005/079795, WO 2005/075426, WO
2005/072530, WO 2005/063750, WO 2005/058849, WO 2005/049022, WO
2005/047297, WO 2005/044195, WO 2005/042488, WO 2005/040095, WO
2005/037828, WO 2005/037779, WO 2005/034940, WO 2005/033099, WO
2005/032590, WO 2005/030751, WO 2005/030127, WO 2005/026148, WO
2005/025554, WO 2005/023762, WO 2005/020920, WO 05/19168, WO
05/12312, WO 05/12308, WO 05/12249, WO 05/11581, WO 05/09956, WO
05/03135, WO 05/00848, WO 05/00846, WO 04/112701, WO 04/111051, WO
04/111041, WO 04/110436, WO 04/110375, WO 04/108730, WO 04/104216,
WO 04/104215, WO 04/103993, WO 04/103276, WO 04/99134, WO 04/96806,
WO 04/92128, WO 04/87650, WO 04/87053, WO 04/85661, WO 04/85378, WO
04/76434, WO 04/76433, WO 04/71454, WO 04/69162, WO 04/67509, WO
04/64778, WO 04/58266, WO 04/52362, WO 04/52850, WO 04/50022, WO
04/50658, WO 04/48379, WO 04/46106, WO 04/43940, WO 04/41820, WO
04/41795, WO 04/37169, WO 04/37181, WO 04/33455, WO 04/32836, WO
04/20407, WO 04/18469, WO 04/18468, WO 04/18467, WO 04/14860, WO
04/09544, WO 04/07468, WO 04/07446, WO 04/04661, WO 04/00327, WO
03/106456, WO 03/104229, WO 03/101958, WO 03/101448, WO 03/99279,
WO 03/95425, WO 03/84940, WO 03/82817, WO 03/80633, WO 03/74500, WO
03/72556, WO 03/72528, WO 03/68757, WO 03/68748, WO 03/57666, WO
03/57144, WO 03/55881, WO 03/45228, WO 03/40174, WO 03/38123, WO
03/37327, WO 03/35067, WO 03/35057, WO 03/24965, WO 03/24942, WO
03/22871, WO 03/15775, WO 03/04498, WO 03/04496, WO 03/02530, WO
03/02596, WO 03/02595, WO 03/02593, WO 03/02553, WO 03/02531, WO
03/00181, WO 03/00180, WO 03/00250, WO 02/83109, WO 02/83128, WO
02/76450, WO 02/68420, WO 02/62764, WO 02/55088, WO 02/51836, WO
02/38541, WO 02/34900, WO 02/30891, WO 02/30890, WO 02/14271, WO
02/02560, WO 01/97808, WO 01/96295, WO 01/81337, WO 01/81304, WO
01/68603, WO 01/55105, WO 01/52825, WO 01/34594, WO 00/71135, WO
00/69868, WO 00/56297, WO 00/56296, WO 00/34241, WO 00/23421, WO
00/10549, WO 99/67278, WO 99/62914, WO 99/61431, WO 99/56753, WO
99/25719, WO 99/16864, WO 98/50066, WO 98/50046, WO 98/19998, WO
98/18763, WO 97/40832, WO 95/29691, WO 95/15309, WO 93/10127, WO
93/08259, WO 91/16339, EP 1517907, EP 1513808, EP 1492777, EP
1490335, EP 1489088, EP 1480961, EP 1476435, EP 1476429, EP
1469873, EP 1465891, EP 1463727, EP 1461337, EP 1450794, EP
1446116, EP 1442049, EP 1441719, EP 1426366, EP 1412357, EP1406873,
EP 1406872, EP 1406622, EP 1404675, EP 1399420, EP 1399471, EP
1399470, EP 1399469, EP 1399433, EP 1399154, EP 1385508, EP
1377288, EP 1355886, EP 1354882, EP 1338592, EP 1333025, EP
1304327, EP 1301187, EP 1296974, EP 1280797, EP 1282600, EP
1261586, EP 1258476, EP 1254113, EP 1248604, EP 1245568, EP
1215207, EP 1228061, EP 1137635, EP 1123272, EP 1104293, EP
1082314, EP 1050540, EP 1043328, EP 0995440, EP 0980249, EP
0975359, EP 0731789, EP 0641347, EP 0610317, EP 0528858, CA
2466870, CA 2433090, CA 2339537, CA 2289125, CA 2289124, CA
2123128, DD 296075, DE 19834591, DE 19828113, DE 19823831, DE
19616486, DE 10333935, DE 10327439, DE 10256264, DE 10251927, DE
10238477, DE 10238470, DE 10238243, DE 10143840, FR 2824825, FR
2822826, JP2005507261, JP 2005505531, JP 2005502624, JP 2005500321,
JP 2005500308, JP2005023038, JP 2004536115, JP 2004535445, JP
2004535433, JP 2004534836, JP 2004534815, JP 2004532220, JP
2004530729, JP 2004525929, JP 2004525179, JP 2004522786, JP
2004521149, JP 2004503531, JP 2004315496, JP 2004244412, JP
2004043429, JP 2004035574, JP 2004026820, JP 2004026678, JP
2004002368, JP 2004002367, JP 2003535898, JP 2003535034, JP
2003531204, JP 2003531191, JP 2003531118, JP 2003524591, JP
2003520849, JP 2003327532, JP 2003300977, JP 2003238566, JP
2002531547, JP 2002527504, JP 2002517401, JP 2002516318, JP
2002363157, JP 2002356472, JP 2002356471, JP 2002265439, JP
2001510442, JP 2000511559, JP 2000327689, JP 2000191616, JP
1998182613, JP 1998081666, JP 1997509921, JP 1995501078, and JP
1993508624.
[0598] In one aspect of the present invention, any one or more
DPP-IV inhibitor can be excluded from any embodiment of the present
invention.
[0599] In one aspect of the present invention, the DPP-IV inhibitor
has an IC50 of less than about 10 .mu.M, less than about 1 .mu.M,
less than about 100 nM, less than about 75 nM, less than about 50
nM, less than about 25 nM, less than about 20 nM, less than about
15 nM, less than about 10 nM, less than about 5 nM, less than about
4 nM, less than about 3 nM, less than about 2 nM, or less than
about 1 nM. Preferably the DPP-IV inhibitor has an IC50 of less
than about 50 nM, less than about 25 nM, less than about 20 nM,
less than about 15 nM, less than about 10 nM, less than about 5 nM,
less than about 4 nM, less than about 3 nM, less than about 2 nM,
or less than about 1 nM.
[0600] In one aspect of the present invention, the DPP-IV inhibitor
a selective DPP-IV inhibitor, wherein the selective DPP-IV
inhibitor has a selectivity for human plasma DPP-IV over one or
more of PPCE, DPP-II, DPP-8 and DPP-9 of at least about 10-fold,
more preferably of at least about 100-fold, and most preferably of
at least about 1000-fold.
[0601] In one aspect of the present invention, the DPP-IV inhibitor
is orally active.
In One Aspect of the Present Invention, the DPP-IV Inhibitor is an
Inhibitor of Human DPP-IV
Combination of GPR119 Agonist and DPP-IV Inhibitor
[0602] By way of illustration and not limitation, an exemplary
combination of GPR119 agonist and DPP-IV inhibitor in accordance
with the present invention is provided by selecting a GPR119
agonist from the left column of Table B and a DPP-IV inhibitor from
the right column of Table B. It is expressly contemplated that each
individual combination of GPR119 agonist and DPP-IV inhibitor
provided by selecting a GPR119 agonist from the left column of
Table B and a DPP-IV inhibitor from the right column of Table B is
a separate embodiment within the scope of the present
invention.
TABLE-US-00005 TABLE B GPR119 Agonist DPP-IV Inhibitor
[6-(4-Benzenesulfonyl-piperidin-1-yl)-5-nitro- valine-pyrrolidide
pyrimidin-4-yl]-(4-methanesulfonyl-phenyl)- amine
{4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-
3-(L-Isoleucyl)thiazolidine pyrimidin-4-yl]-piperazin-1-yl}-acetic
acid ethyl (isoleucine-thiazolidide) ester
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-
1-[2-[5-cyanopyridin-2-
isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-
yl)amino]ethylamino]acetyl-2-cyano-(S)-
5-nitro-pyrimidin-4-yl}-amine pyrrolidine (NVP-DPP728)
6'-[4-(2-Methoxycarbonyl-acetyl)-phenoxy]-3'-
3(R)-Amino-1-[3-(trifluoromethyl)-5,6,7,8-
nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-
tetrahydro[1,2,4]triazolo[4,3-a]pyrazin-7-yl]-4- carboxylic acid
ethyl ester (2,4,5-trifluorophenyl)butan-1-one (MK-0431)
1-[4-(4-Acetyl-3'-nitro-3,4,5,6-tetrahydro-2H-
(1-[[3-hydroxy-1-adamantyl)amino]acetyl]-2-
[1,2']bipyridinyl-6'-yloxy)-phenyl]-ethanone cyano-(S)-pyrrolidine
(LAF237) 6'-[4-(4-Hydroxy-benzenesulfonyl)-phenoxy]-3'-
(1S,3S,5S)-2-[2(S)-Amino-2-(3-
nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-
hydroxyadamantan-1-yl)acetyl]-2- carboxylic acid ethyl ester
azabicyclo[3.1.0]hexane-3-carbonitrile (BMS-477118)
1-[5-(4-Benzoyl-phenoxy)-2-nitro-phenyl]-
[1-[2(S)-Amino-3-methylbutyryl]pyrrolidin-2(R)-
piperidine-4-carboxylic acid ethyl ester yl]boronic acid (PT-100)
1-{5-[4-(2-Methoxycarbonyl-acetyl)-phenoxy]-2- GSK-823093
nitro-phenyl}-piperidine-4-carboxylic acid ethyl ester
1-[5-(2-Amino-4-ethanesulfonyl-phenoxy)-2- PSN-9301
nitro-phenyl]-piperidine-4-carboxylic acid ethyl ester
5-Bromo-1-[4-nitro-3-(4-propyl-piperidin-1-yl)- T-6666
phenyl]-1H-pyridin-2-one 6'-Benzenesulfonylamino-3'-nitro-3,4,5,6-
SYR-322 tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl
ester 6'-(Benzenesulfonyl-methyl-amino)-3'-nitro- SYR-619
3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4- carboxylic acid ethyl
ester 6'-(Benzenesulfonyl-butyl-amino)-3'-nitro- CR-14023
3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4- carboxylic acid ethyl
ester 1-[5-(4-Benzoyl-phenylamino)-2-nitro-phenyl]- CR-14025
piperidine-4-carboxylic acid ethyl ester
{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)- CR-14240
phenylamino]-phenyl}-phenyl-methanone
3-[6-(4-Methanesulfonyl-phenylamino)-5-nitro- CR-13651
pyrimidin-4-yloxymethyl]-pyrrolidine-1- carboxylic acid tert-butyl
ester 4-[5-Cyano-6-(6-methylsulfanyl-pyridin-3- NNC-72-2138
ylamino)-pyrimidin-4-yloxy]-piperidine-1- carboxylic acid
tert-butyl ester 4-[5-Cyano-6-(6-methanesulfonyl-pyridin-3- NN-7201
ylamino)-pyrimidin-4-yloxy]-piperidine-1- carboxylic acid
tert-butyl ester 4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-
PHX-1149 pyrimidin-4-yloxy]-piperidine-1-carboxylic acid tert-butyl
ester (4-Methanesulfonyl-phenyl)-[5-nitro-6- PHX-1004
(piperidin-4-yloxy)-pyrimidin-4-yl]-amine
1-{4-[6-(4-Methanesulfonyl-phenylamino)-5- SNT-189379
nitro-pyrimidin-4-yloxy]-piperidin-1-yl}-3,3- dimethyl-butan-1-one
4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro- GRC-8087
pyrimidin-4-ylamino]-piperidine-1-carboxylic acid tert-butyl ester
N-(4-Methanesulfonyl-phenyl)-5-nitro-N'- PT-630
piperidin-4-yl-pyrimidine-4,6-diamine
1-{4-[6-(4-Methanesulfonyl-phenylamino)-5- SK-0403
nitro-pyrimidin-4-ylamino]-piperidin-1-yl}- ethanone
4-[6-(4-Cyano-2-fluoro-phenylamino)-5-ethynyl- GSK-825964
pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester
4-[5-Ethynyl-6-(2-fluoro-4-[1,2,4]triazol-1-yl-
8-(3-Aminopiperidin-1-yl)-N2,7-dibenzyl-1-
phenylamino)-pyrimidin-4-yloxy]-piperidine-1- methylguanine
trifluoroacetate carboxylic acid isopropyl ester
4-{5-Ethynyl-6-[1-(3-isopropyl-[1,2,4]oxadiazol-
N-[2-[2-[8-(3-Aminopiperidin-1-yl)-7-(2-
5-yl)-piperidin-4-yloxy]-pyrimidin-4-ylamino}-
butynyl)-3-methylxanthin-1- 3-fluoro-benzonitrile
yl]acetyl]phenyl]formamide
4-[5-Acetyl-6-(6-methanesulfonyl-pyridin-3-
8-[3(R)-Aminopiperidin-1-yl]-7-(2-butynyl)-3-
ylamino)-pyrimidin-4-yloxy]-piperidine-1-
methyl-1-(quinazolin-2-ylmethyl)xanthine carboxylic acid isobutyl
ester 1-[4-(1-Benzyl-azetidin-3-yloxy)-6-(6-
8-(3-Aminopiperidin-1-yl)-1-(benzo[c]-1,8-
methanesulfonyl-pyridin-3-ylamino)-pyrimidin-
naphthyridin-6-ylmethyl)-7-(2-butynyl)-3- 5-yl]-ethanone
methylxanthine 4-[5-Cyano-6-(6-propylamino-pyridin-3-
2-[8-[3(R)-Aminopiperidin-1-yl]-7-(2-butynyl)-
ylamino)-pyrimidin-4-yloxy]-piperidine-1-
3-methylxanthin-1-yl]-N-(2-pyridyl)acetamide carboxylic acid
isopropyl ester 4-({[6-(2-Fluoro-4-methanesulfonyl-
2-(3-Aminopiperidin-1-yl)-3-(2-butynyl)-5-
phenylamino)-5-methyl-pyrimidin-4-yl]-
(quinoxalin-6-ylmethyl)-4,5-dihydro-3H-
isopropyl-amino}-methyl)-piperidine-1-
imidazo[4,5-d]pyridazin-4-one carboxylic acid tert-butyl ester
4-(2-Fluoro-4-methanesulfonyl-phenoxy)-6-[1-
(1S,3S,5S)-2-[2(S)-Amino-4,4-
(3-methoxy-propyl)-piperidin-4-yloxy]-5-methyl-
dimethylpentanoyl]-2-azabicyclo[3.1.0]hexane- pyrimidine
3(S)-carbonitrile trifluoroacetate
1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-
N1-(1-Cyanoethyl)-N1,3-dimethyl-L-valinamide
5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-3- methoxy-propan-2-ol
4-{6-[2-Fluoro-4-(5-isopropoxymethyl-
(1S,3S,5S)-2-[2(S)-Amino-2-[1-(3,3-
[1,2,4]oxadiazol-3-yl)-phenoxy]-5-methyl-
dimethylbutyryl)piperidin-4-yl]acetyl]-2-
pyrimidin-4-yloxy}-piperidine-1-carboxylic acid
azabicyclo[3.1.0]hexane-3-carbonitrile isopropyl ester
4-[6-(2-Fluoro-4-morpholin-4-yl-phenoxy)-5-
2-[7-(2-Butynyl)-1-(2-phenylethyl)-8-(1-
methyl-pyrimidin-4-yloxy]-piperidine-1-
piperazinyl)xanthin-3-yl]-N-(2- carboxylic acid isopropyl ester
propynyl)acetamide hydrochloride
{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-
2-[7-(2-Butynyl)-1-(3-cyanobenzyl)-6-oxo-8-(1-
methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-[6-(2-
piperazinyl)-6,7-dihydro-1H-purin-2-yloxy]-N-
pyrrolidin-1-yl-ethyl)-pyridin-3-yl]-methanone methylbenzamide
trifluoroacetate (6-Amino-pyridin-3-yl)-{4-[6-(2-fluoro-4-
2-[3-(2-Butynyl)-4-oxo-2-(1-piperazinyl)-4,5-
methanesulfonyl-phenoxy)-5-methyl-pyrimidin-
dihydro-3H-imidazo[4,5-d]pyridazin-5-
4-yloxy]-piperidin-1-yl}-methanone ylmethyl]benzonitrile
trifluoroacetate 4-({Cyclopropyl-[6-(2-fluoro-4-methanesulfonyl-
N-[1(S)-[2(S)-Cyanopyrrolidin-1-ylcarbonyl]-4-
phenoxy)-5-methyl-pyrimidin-4-yl]-amino}-
(pyrazin-2-ylcarboxamido)butyl]carbamic acid 1-
methyl)-piperidine-1-carboxylic acid tert-butyl acetoxyethyl ester
ester 4-({Cyclopropyl-[6-(2-fluoro-4-methanesulfonyl-
2(S),4-Diamino-1-(4-thiomorpholinyl)butan-1-
phenoxy)-5-methyl-pyrimidin-4-yl]-amino}- one
methyl)-piperidine-1-carboxylic acid isopropyl ester
4-({[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-
1-[Perhydroindol-2(S)-ylcarbonyl]azetidine-2(S)-
methyl-pyrimidin-4-yl]-isopropyl-amino}- carbonitrile
methyl)-piperidine-1-carboxylic acid isopropyl ester
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-
1-(2-Benzothiazolyl)-1-[1-[(2S,3aS,7aS)-
5-methyl-pyrimidin-4-ylsulfanyl]-piperidine-1-
perhydroindol-2-ylcarbonyl]pyrrolidin-2(S)- carboxylic acid
isopropyl ester yl]methanone hydrochloride
4-[1-(4-Methanesulfonyl-phenyl)-1H-
1-[2(S)-Amino-2-cyclohexylacetyl]-4-
pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-1-
methylazetidine-2-carbonitrile hydrochloride carboxylic acid
tert-butyl ester 4-[1-(4-Methanesulfonyl-phenyl)-3-methyl-1H-
6-[2-[2-[5(S)-Cyano-4,5-dihydro-1H-pyrazol-1-
pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-1-
yl]-2-oxoethylamino]ethylamino]pyridine-3- carboxylic acid
tert-butyl ester carbonitrile
4-[1-(4-Methanesulfonyl-phenyl)-3,6-dimethyl-
6-[2-[2-[2(S)-Cyano-4(S)-fluoropyrrolidin-1-yl]-
1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-
2-oxoethylamino]-2-methylpropylamino]-N,N- piperidine-1-carboxylic
acid tert-butyl ester dimethylpyridine-3-sulfonamide
4-({[1-(2,5-Difluoro-phenyl)-1H-pyrazolo[3,4-
trans-N-[4-[1(S)-Amino-2-[3(S)-fluoropyrrolidin-
d]pyrimidin-4-yl]-methyl-amino}-methyl)-
1-yl]-2-oxoethyl]cyclohexyl]-2,4- piperidine-1-carboxylic acid
tert-butyl ester difluorobenzenesulfonamide
2-{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-
2(S)-Amino-1-(1-pyrrolidinyl)-2-[4-(thiazol-2-
1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-
ylamino)cyclohexyl]ethanone trifluoroacetate
1-yl}-1-(4-trifluoromethoxy-phenyl)-ethanone
2-{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-
N-[(1R,3R)-3-[1(S)-Amino-2-oxo-2-(1-
1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-
pyrrolidinyl)ethyl]cyclopentyl]-4-
1-yl}-1-(3-fluoro-phenyl)-ethanone
(methylsulfonyl)benzenesulfonamide
4-[9-(6-Methanesulfonyl-pyridin-3-yl)-9H-purin-
3(R)-Amino-1-(6-benzyl-3-methyl-5,6,7,8-
6-yloxy]-piperidine-1-carboxylic acid isobutyl
tetrahydroimidazo[1,2-a]pyrazin-7-yl)-4-(3,4- ester
difluorophenyl)butan-1-one
{4-[9-(6-Methanesulfonyl-pyridin-3-yl)-9H-
trans-N-[4-[1(S)-Amino-2-oxo-2-(1-
purin-6-yloxy]-piperidin-1-yl}-pyridin-3-yl-
pyrrolidinyl)ethyl]cyclohexyl]-2,4- methanone
difluorobenzenesulfonamide
4-[9-(4-Methanesulfonyl-phenyl)-9H-purin-6-
3(R)-Amino-4-(2,5-difluorophenyl)-1-[4-
yloxy]-piperidine-1-carboxylic acid tert-butyl
hydroxy-2-(trifluoromethyl)-5,6,7,8- ester
tetrahydropyrido[3,4-d]pyrimidin-7-yl]butan-1- one
4-[9-(2-Fluoro-4-propionylsulfamoyl-phenyl)-
N-[(1R,3R)-3-[1(S)-Amino-2-oxo-2-(1-
9H-purin-6-yloxy]-piperidine-1-carboxylic acid
pyrrolidinyl)ethyl]cyclopentyl]-2- isopropyl ester
(methylsulfonamido)ethanesulfonamide
4-[9-(4-Cyano-2-fluoro-phenyl)-9H-purin-6-
2-[4-[3(R)-Amino-4-(2-fluorophenyl)butyryl]-
yloxy]-piperidine-1-carboxylic acid isopropyl
3(R)-benzylpiperazin-1-yl]-N-[3- ester
(methylsulfonamido)phenyl]acetamide
4-[9-(2-Fluoro-4-sulfamoyl-phenyl)-9H-purin-6-
3(R)-Amino-1-(3-thiazolidinyl)-4-(2,4,5-
yloxy]-piperidine-1-carboxylic acid isopropyl
trifluorophenyl)butan-1-one ester
4-[3-(4-Methanesulfonyl-phenyl)-3H-
4-[3(R)-Amino-4-(2,4,5-trifluorophenyl)butyryl]-
[1,2,3]triazolo[4,5-d]pyrimidin-7-yloxy]-
3(R)-methyl-1,4-diazepan-2-one piperidine-1-carboxylic acid
tert-butyl ester 3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[1-(3-
3(S)-Amino-4-(3,3-difluoropyrrolidin-1-yl)-N,N-
isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-
dimethyl-4-oxo-2(S)-[4-([1,2,4]triazolo[1,5-
yloxy]-3H-[1,2,3]triazolo[4,5-d]pyrimidine
a]pyridin-6-yl)phenyl]butyramide
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-
3(R)-Amino-1-[2-(trifluoromethyl)-5,6,7,8-
5-yl)-piperidin-4-yloxy]-[1,2,3]triazolo[4,5-
tetrahydro[1,2,4]triazolo[1,5-a]pyrazine-7-yl]-4-
d]pyrimidin-3-yl}-N-propionyl- (2,4,5-trifluorophenyl)butanone
hydrochloride benzenesulfonamide
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-
2(S)-Amino-3(S)-(4-fluorophenyl)-1-(3-
5-yl)-piperidin-4-yloxy]-[1,2,3]triazolo[4,5-
thiazolidinyl)butan-1-one d]pyrimidin-3-yl}-benzonitrile
4-[3-(4-Methanesulfonyl-phenyl)-isoxazolo[4,5-
7-[3(R)-Amino-4-(2,5-difluorophenyl)butyryl]-
d]pyrimidin-7-yloxy]-piperidine-1-carboxylic
5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-2- acid tert-butyl ester
carboxylic acid ethyl ester
4-({Ethyl-[3-(4-methanesulfonyl-phenyl)-
3(R)-Amino-1-(8-chloro-1,2,3,4-
isoxazolo[4,5-d]pyrimidin-7-yl]-amino}-methyl)-
tetrahydropyrazino[1,2-a]benzimidazol-2-yl)-4-
piperidine-1-carboxylic acid tert-butyl ester
(2,5-difluorophenyl)butan-1-one trifluoroacetate
4-[3-(4-Methanesulfonyl-phenyl)-isoxazolo[4,5-
3(R)-Amino-4-(2,5-difluorophenyl)-1-[2-(4-
d]pyrimidin-7-ylsulfanyl]-piperidine-1-
fluorophenyl)-4,5,6,7-tetrahydrothiazolo[4,5- carboxylic acid
tert-butyl ester c]pyridin-5-yl]butan-1-one
4-[3-(4-Methanesulfonyl-phenyl)-isoxazolo[4,5-
2-[4-[2-[3(R)-Amino-4-(2-fluorophenyl)butyryl]-
d]pyrimidin-7-yloxy]-piperidine-1-carboxylic
1,2,3,4-tetrahydroisoquinolin-3- acid isopropyl ester
ylcarboxamidomethyl]phenyl]acetic acid
4-[8-(2-Fluoro-4-methanesulfonyl-phenyl)-
3(S)-Amino-2-oxopiperidin-1-ylphosphonic
[1,7]naphthyridin-4-yloxy]-piperidine-1- diamide hydrochloride
carboxylic acid isopropyl ester
4-[8-(2-Fluoro-4-methanesulfonyl-phenyl)-
2-[2-(5-Nitropyridin-2-ylamino)ethylamino]-1-
quinolin-4-yloxy]-piperidine-1-carboxylic acid
(1-pyrrolidinyl)ethanone dihydrochloride isopropyl ester
4-[8-(4-Methylsulfanyl-phenyl)-quinolin-4-
2-[8-(3-Aminopiperidin-1-yl)-1,3- yloxy]-piperidine-1-carboxylic
acid isopropyl dimethylxanthin-7-ylmethyl]benzonitrile ester
hemisuccinate 4-[8-(4-Methanesulfonyl-phenyl)-quinolin-4-
2(S)-Amino-2-cyclohexyl-1-(3,3,4,4- yloxy]-piperidine-1-carboxylic
acid isopropyl tetrafluoropyrrolidin-1-yl)ethanone hydrochloride
ester 4-[8-(2-Fluoro-4-methanesulfonyl-phenyl)-
2(S)-Amino-2-cyclohexyl-1-(3-fluoropyrrolidin-
pyrido[3,4-d]pyrimidin-4-yloxy]-piperidine-1- 1-yl)ethanone
carboxylic acid isopropyl ester
4-[8-(2-Fluoro-4-propionylsulfamoyl-phenyl)-
2-Amino-1-cyclopentyl-3-methylpentan-1-one
pyrido[3,4-d]pyrimidin-4-yloxy]-piperidine-1- hydrochloride
carboxylic acid isopropyl ester
4-[8-(4-Cyano-2-fluoro-phenyl)-pyrido[3,4-
4-Amino-5-oxo-5-(1-pyrrolidinyl)pentanamide
d]pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester
3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[4-(3-
1-[2-[1,1-Dimethyl-2-(6-phenylpyridin-2-
isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-
ylamino)ethylamino]acetyl]pyrrolidine-2(S)-
pyrazolo[1,5-a]pyrimidine carbonitrile hydrochloride
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-
(7R*,8S*,13bS*)-7-Butyl-11,12-dimethoxy-,
5-yl)-cyclohexyloxy]-pyrazolo[1,5-a]pyrimidin-
3,4,4a,6,7,8,9,9a,13b-decahydro-1H-pyrido[1,2-
3-yl}-N-propionyl-benzenesulfonamide f]phenanthridin-8-amine
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-
5-(Aminomethyl)-6-(2,4-dichlorophenyl)-2-(3,5-
5-yl)-cyclohexyloxy]-pyrazolo[1,5-a]pyrimidin-
dimethoxyphenyl)pyrimidin-4-amine 3-yl}-benzonitrile
4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-1-
3-(Aminomethyl)-4-(2,4-dichlorophenyl)-7,8-
methyl-1H-pyrazolo[4,3-d]pyrimidin-7-yloxy]-
dimethoxy-5H-indeno[1,2-b]pyridin-2-amine piperidine-1-carboxylic
acid isopropyl ester 4-[3-(2-Fluoro-4-propionylsulfamoyl-phenyl)-1-
5-(Aminomethyl)-6-(2,4-dichlorophenyl)-N2-(2-
methyl-1H-pyrazolo[4,3-d]pyrimidin-7-yloxy]-
methoxyethyl)-N2-methylpyrimidine-2,4-diamine
piperidine-1-carboxylic acid isopropyl ester
4-[3-(4-Cyano-2-fluoro-phenyl)-1-methyl-1H-
4,4-Difluoro-1-[2-[exo-8-(2-pyrimidinyl)-8-
pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-1-
azabicyclo[3.2.1]oct-3- carboxylic acid isopropyl ester
ylamino]acetyl]pyrrolidine-2(S)-carbonitrile
4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-2-
exo-3-[2-[8-(2-Pyrimidinyl)-8-
methyl-2H-pyrazolo[4,3-d]pyrimidin-7-yloxy]-
azabicyclo[3.2.1]oct-3- piperidine-1-carboxylic acid isopropyl
ester ylamino]acetyl]thiazolidine-4(R)-carbonitrile
4-[3-(2-Fluoro-4-propionylsulfamoyl-phenyl)-2-
1-[2-[3-(2,3-Dihydro-1H-isoindol-2-yl)-1,1-
methyl-2H-pyrazolo[4,3-d]pyrimidin-7-yloxy]-
dimethyl-3-oxopropylamino]acetyl]pyrrolidine-
piperidine-1-carboxylic acid isopropyl ester 2(S)-carbonitrile
4-[3-(4-Cyano-2-fluoro-phenyl)-2-methyl-2H-
8-(3-Aminoperhydroazepin-1-yl)-3-methyl-7-(2-
pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-1-
methylbenzyl)-2,3,6,7-tetrahydro-1H-purine-2,6- carboxylic acid
isopropyl ester dione 4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-
8-[3(R)-Aminopiperidin-1-yl]-7-(5-fluoro-2-
piperidin-1-yl]-6-(4-methanesulfonyl-phenoxy)-
methylbenzyl)-1,3-dimethylxanthine pyrimidine
{6-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-
2-[2-(3-Aminopiperidin-1-yl)-6,7-dimethoxy-4-
piperidin-1-yl]-pyrimidin-4-yl}-(4- oxo-3,4-dihydroquinazolin-3-
methanesulfonyl-phenyl)-amine ylmethyl]benzonitrile
4-{[6-(2-Fluoro-4-methanesulfonyl-
1-[2(S)-Amino-3,3-dimethylbutyryl]-4(S)-
phenylamino)-pyrimidin-4-yl]-methyl-amino}-
fluoropyrrolidine-2(S)-carbonitrile hydrochloride
piperidine-1-carboxylic acid tert-butyl ester
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-
2-[3-(Aminomethyl)-4-butoxy-2-(2,2-
pyrimidin-4-yloxy]-piperidine-1-carboxylic acid
dimethylpropyl)-1-oxo-1,2-dihydroisoquinolin-6- tert-butyl ester
yloxy]acetamide hydrochloride
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[1-(3-
3-(3-Chloroimidazo[1,2-a]pyridin-2-
isopropyl-[1,2,4]oxadiazol-5-ylmethyl)-piperidin-
ylmethylsulfonyl)-N,N-dimethyl-1H-1,2,4-
4-yloxy]-pyrimidin-4-yl}-amine; 4-[6-(2-Fluoro-
triazole-1-carboxamide 4-methanesulfonyl-phenylamino)-pyrimidin-4-
yloxy]-piperidine-1-carboxylic acid isopropyl ester
(6-Chloro-pyridin-2-yl)-{4-[6-(2-fluoro-4-
6-Chloro-2-isobutyl-4-phenylquinolin-3-
methanesulfonyl-phenylamino)-pyrimidin-4- ylmethylamine
yloxy]-piperidin-1-yl}-methanone
[2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl]-
trans-1-[2-[4-(1,3-Dioxo-2,3-dihydro-1H- methyl-amine isoindol-2-
yl)cyclohexylamino]acetyl]pyrrolidine-2(S)- carbonitrile
hydrochloride [2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl]-
trans-4-[2-[4(R)-Cyanothiazolidin-3-yl]-2- p-tolyl-amine
oxoethylamino]-N,N- dimethylcyclohexanecarboxamide hydrochloride
[2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl]-
N-(5-Chloropyridin-2-yl)-2-[4-[1-[2-(4- (4-methoxy-phenyl)-amine
cyanothiazolidin-3-yl)-2-
oxoethyl]hydrazino]piperidin-1-yl]acetamide tris(trifluoroacetate)
[2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl]-
6-[2-[2-[2(S)-Cyanoazetidin-1-yl]-2- phenyl-amine
oxoethylamino]ethylamino]pyridine-3- carbonitrile dihydrochloride
[2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl]-
4(S)-Fluoro-1-[2-[1-(2-hydroxyacetyl)-4- cyclohexyl-amine
methylpiperidin-4-ylamino]acetyl]pyrrolidine- 2(S)-carbonitrile
fumarate 5-[2-(4-Bromo-phenyl)-6-ethyl-pyrimidin-4- TS-021
ylamino]-pentan-1-ol 3-[2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-
GRC-8200 ylamino]-propionitrile
[2-(4-Bromo-phenyl)-6-ethyl-pyrimidin-4-yl]-(4- GRC-8116
fluoro-benzyl)-amine
[2-(4-Bromo-phenyl)-6-ethyl-pyrimidin-4-yl]-[2- FE107542
(4-chloro-phenyl)-ethyl]-amine
[2-(4-Bromo-phenyl)-6-ethyl-pyrimidin-4-yl]-
pyridin-2-ylmethyl-amine
[2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl]-
pyridin-3-ylmethyl-amine
3-{[2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-
ylamino]-methyl}-1H-pyridin-2-one
4-{[2-(4-Bromo-phenyl)-6-ethyl-pyrimidin-4-
ylamino]-methyl}-1H-pyridin-2-one
4-{2-[2-(4-Bromo-phenyl)-6-methyl-pyrimidin-
4-ylamino]-ethyl}-1H-pyridin-2-one
[2-(3-Chloro-4-fluoro-phenyl)-6-ethyl-pyrimidin-
4-yl]-(1,1-dioxo-hexahydro-116-thiopyran-4-yl)- amine
[6-Methyl-2-(3,4,5-trifluoro-phenyl)-pyrimidin-
4-yl]-[2-(1-oxy-pyridin-3-yl)-ethyl]-amine
[6-Ethyl-2-(3,4,5-trifluoro-phenyl)-pyrimidin-4-
yl]-[2-(1-oxy-pyridin-3-yl)-ethyl]-amine
[6-Methyl-2-(2,4,5-trifluoro-phenyl)-pyrimidin-
4-yl]-[2-(1-oxy-pyridin-3-yl)-ethyl]-amine
4-{4-Methyl-6-[2-(1-oxy-pyridin-3-yl)-
ethylamino]-pyrimidin-2-yl}-benzonitrile
2-[4-(6-Methyl-2-phenyl-pyrimidin-4-ylamino)- phenyl]-ethanol
[2-(3-Chloro-phenyl)-6-methyl-pyrimidin-4-yl]- methyl-amine
2-{[2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-
yl]-methyl-amino}-ethanol; compound with methane
3-[6-Ethyl-2-(3,4,5-trifluoro-phenyl)-pyrimidin-
4-ylamino]-propane-1,2-diol
(S)-3-[6-Methyl-2-(2,3,5-trifluoro-phenyl)-
pyrimidin-4-ylamino]-propane-1,2-diol
(S)-3-[2-(4-Bromo-3-fluoro-phenyl)-6-methyl-
pyrimidin-4-ylamino]-propane-1,2-diol
(R)-3-[6-Ethyl-2-(3,4,5-trifluoro-phenyl)-
pyrimidin-4-ylamino]-propane-1,2-diol
(R)-3-[2-(3-Chloro-4-fluoro-phenyl)-6-ethyl-
pyrimidin-4-ylamino]-propane-1,2-diol
(R)-3-[2-(4-Bromo-2,5-difluoro-phenyl)-5-fluoro-
6-methyl-pyrimidin-4-ylamino]-propane-1,2-diol
(R)-3-[2-(4-Chloro-2,5-difluoro-phenyl)-6-
difluoromethyl-pyrimidin-4-ylamino]-propane- 1,2-diol
5-{2-[2-(4-Bromo-phenyl)-6-ethyl-pyrimidin-4-
ylamino]-ethyl}-1H-pyridin-2-one
5-{2-[6-Methyl-2-(2,4,5-trifluoro-phenyl)-
pyrimidin-4-ylamino]-ethyl}-1H-pyridin-2-one
4-{2-[2-(4-Chloro-2,5-difluoro-phenyl)-6-ethyl-
pyrimidin-4-ylamino]-ethyl}-1H-pyridin-2-one
6-Chloro-4-{2-[6-methyl-2-(2,4,5-trifluoro-
phenyl)-pyrimidin-4-ylamino]-ethyl}-1H- pyridin-2-one
4-{1-Hydroxy-2-[6-methyl-2-(2,4,5-trifluoro-
phenyl)-pyrimidin-4-ylamino]-ethyl}-1H- pyridin-2-one
4-{1-Methyl-2-[6-methyl-2-(2,4,5-trifluoro-
phenyl)-pyrimidin-4-ylamino]-ethyl}-1H- pyridin-2-one
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-
ylmethoxy)piperidine-1-carboxylic acid tert-butyl ester
4-[5-(2-Cyanopyridin-4-yl)-[1,2,4]oxadiazol-3-
ylmethoxy]piperidine-1-carboxylic acid tert-butyl ester
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-
ylmethoxy)piperidine-1-carboxylic acid cyclopentyl ester
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-
ylmethoxy)piperidine-1-carboxylic acid 2,2,2- trichloroethyl ester
4-[Ethyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-
ylmethyl)amino]piperidine-1-carboxylic acid tert-butyl ester
4-[Methyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-
ylmethyl)amino]piperidine-1-carboxylic acid cyclopentyl ester
4-{[Methyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-
ylmethyl)amino]methyl}piperidine-1-carboxylic acid
2,2,2-trichloroethyl ester
[0603] Additionally, compounds of the invention, including those
illustrated in TABLE B, encompass all pharmaceutically acceptable
salts, solvates, and hydrates thereof. See, e.g., Berge et al
(1977), Journal of Pharmaceutical Sciences 66:1-19; and
Polymorphism in Pharmaceutical Solids (1999) Brittain, ed., Marcel
Dekker, Inc.; the disclosure of each of which is herein
incorporated by reference in its entirety.
[0604] As relates to the combination therapy described above, the
compounds according to the invention can be administered in any
suitable way. Suitable routes of administration include oral,
nasal, rectal, transmucosal, transdermal, or intestinal
administration, parenteral delivery, including intramuscular,
subcutaneous, intramedullary injections, as well as intrathecal,
direct intraventricular, intravenous, intraperitoneal, intranasal,
intrapulmonary (inhaled) or intraocular injections using methods
known in the art. Other suitable routes of administration are
aerosol and depot formulation. Sustained release formulations,
particularly depot, of the invented medicaments are expressly
contemplated. In certain preferred embodiments, the compounds
according to the present invention are administered orally. The
compounds according to the present invention can be made up in
solid or liquid form, such as tablets, capsules, powders, syrups,
elixirs and the like, aerosols, sterile solutions, suspensions or
emulsions, and the like. In certain embodiments, one or both of the
GPR119 agonist and the DPP-IV inhibitor are administered
orally.
[0605] Formulations for oral administration may be in the form of
aqueous solutions and suspensions, in addition to solid tablet and
capsule formulations. The aqueous solutions and suspensions may be
prepared from sterile powders or granules. The compounds may be
dissolved in water, polyethylene glycol, propylene glycol, ethanol,
corn oil, cottonseed oil, peanut oil, sesame oil, benzyl alcohol,
sodium chloride, and/or various buffers. Other adjuvants are well
and widely known in the art.
[0606] It will be appreciated that the GPR119 agonist and the
DPP-IV inhibitor may be present as a combined preparation for
simultaneous, separate or sequential use for the treatment or
prevention of diabetes or a condition related thereto. Such
combined preparations may be, for example, in the form of a twin
pack.
[0607] It will therefore be further appreciated that the invention
contemplates a product comprising or consisting essentially of a
GPR119 agonist and a DPP-IV inhibitor as a combined preparation for
simultaneous, separate or sequential use in the prevention or
treatment of diabetes or a condition related thereto.
[0608] A combination of the present invention comprising or
consisting essentially of a GPR119 agonist and a DPP-IV inhibitor
can be prepared by mixing the GPR119 agonist and the DPP-IV
inhibitor either all together or independently with a
pharmaceutically acceptable carrier, excipient, binder, dilutent,
etc. as described herein, and administering the mixture or mixtures
either orally or non-orally as a pharmaceutical composition(s).
[0609] It will therefore be further appreciated that the GPR119
agonist and the DPP-IV inhibitor or pharmaceutical composition can
be administered in separate dosage forms or in a single dosage
form.
[0610] It is further appreciated that when the GPR119 agonist and
the DPP-IV inhibitor are in separate dosage forms, GPR119 agonist
and DPP-IV inhibitor can be administered by different routes.
[0611] Pharmaceutical compositions of the GPR119 agonist and DPP-IV
inhibitor, either individually or in combination, may be prepared
by methods well known in the art, e.g., by means of conventional
mixing, dissolving, granulation, dragee-making, levigating,
emulsifying, encapsulating, entrapping, lyophilizing processes or
spray drying.
[0612] Pharmaceutical compositions for use in accordance with the
present invention may be formulated in conventional manner using
one or more physiologically acceptable carriers comprising
excipients and auxiliaries which facilitate processing of the
active compounds into preparations which can be used
pharmaceutically. Suitable pharmaceutically acceptable carriers are
available to those in the art [see, e.g., Remington: The Science
and Practice of Pharmacy, (Gennaro et al., eds.), 20.sup.th
Edition, 2000, Lippincott Williams & Wilkins; and Handbook of
Pharmaceutical Excipients (Rowe et al., eds), 4.sup.th Edition,
2003, Pharmaceutical Press; the disclosure of each of which is
herein incorporated by reference in its entirety]. Proper
formulation is dependent upon the route of administration chosen.
The term "carrier" material or "excipient" material herein means
any substance, not itself a therapeutic agent, used as a carrier
and/or dilutent and/or adjuvant, or vehicle for delivery of a
therapeutic agent to a subject or added to a pharmaceutical
composition to improve its handling or storage properties or to
permit or facilitate formation of a dose unit of the composition
into a discrete article such as a capsule or tablet suitable for
oral administration. Excipients can include, by way of illustration
and not limitation, diluents, disintegrants, binding agents,
adhesives, wetting agents, polymers, lubricants, glidants,
substances added to mask or counteract a disagreeable taste or
odor, flavors, dyes, fragrances, and substances added to improved
appearance of the composition. Acceptable excipients include
stearic acid, magnesium stearate, magnesium oxide, sodium and
calcium salts of phosphoric and sulfuric acids, magnesium
carbonate, talc, gelatin, acacia gum, sodium alginate, pectin,
dextrin, mannitol, sorbitol, lactose, sucrose, starches, gelatin,
cellulosic materials, such as cellulose esters of alkanoic acids
and cellulose alkyl esters, low melting wax cocoa butter or powder,
polymers, such as polyvinyl-pyrrolidone, polyvinyl alcohol, and
polytheylene glycols, and other pharmaceutically acceptable
materials. The components of the pharmaceutical composition can be
encapsulated or tableted for convenient administration.
[0613] Pharmaceutically acceptable refers to those properties
and/or substances which are acceptable to the patient from a
pharmacological/toxicological point of view and to the
manufacturing pharmaceutical chemist from a physical/chemical point
of view regarding composition, formulation, stability, patient
acceptance and bioavailability.
[0614] When the GPR119 agonist and the DPP-IV inhibitor are in
separate dosage forms, it is understood that a pharmaceutically
acceptable carrier used for the GPR119 agonist formulation need not
be identical to a pharmaceutically acceptable carrier used for the
DPP-IV inhibitor formulation.
[0615] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used which may
optionally contain gum Arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[0616] Pharmaceutical compositions which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with a filler such as lactose, a binder such as starch,
and/or a lubricant such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, liquid polyethylene glycols, cremophor, capmul,
medium or long chain mon-, di- or triglycerides. Stabilizers may be
added in these formulations, also.
[0617] Additionally, the GPR119 agonist and DPP-IV inhibitor may be
delivered using a sustained-release system. Various
sustained-release materials have been established and are well
known to those skilled in the art. Sustained-release tablets or
capsules are particularly preferred. For example, a time delay
material such as glyceryl monostearate or glyceryl distearate may
be employed. The dosage form may also be coated by the techniques
described in the U.S. Pat. Nos. 4,256,108, 4,166,452, and 4,265,874
to form osmotic therapeutic tablets for controlled release.
[0618] It is expressly contemplated that a combination therapy of
the present invention may be administered or provided alone or in
combination with one or more other pharmaceutically or
physiologically acceptable compound. In one aspect of the present
invention, the other pharmaceutically or physiologically acceptable
compound is not a GPR119 agonist and is not a DPP-IV inhibitor. In
one aspect of the present invention, the other pharmaceutically or
physiologically acceptable compound is a pharmaceutical agent
selected from the group consisting of sulfonylurea (e.g.,
glibenclamide, glipizide, gliclazide, glimepiride), meglitinide
(e.g., repaglinide, nateglinide), biguanide (e.g., metformin),
alpha-glucosidase inhibitor (e.g., acarbose, epalrestat, miglitol,
voglibose), thizaolidinedione (e.g., rosiglitazone, pioglitazone),
insulin analog (e.g., insulin lispro, insulin aspart, insulin
glargine), chromium picolinate/biotin, and biological agent (e.g.,
adiponectin or a fragment comprising the C-terminal globular domain
thereof, or a multimer of adiponectin or said fragment thereof; or
an agonist of adiponectin receptor AdipoR1 or AdipoR2, preferably
wherein said agonist is orally active). In one aspect of the
present invention, the pharmaceutical agent is metformin. In one
aspect of the present invention, the pharmaceutical agent is an
agonist to adiponectin receptor AdipoR1 or AdipoR2, preferably
wherein the agonist is orally active.
[0619] In a combination therapy according to the present invention,
the GPR119 agonist according to the present invention and the
DPP-IV inhibitor according to the present invention can be
administered simultaneously or at separate intervals. When
administered simultaneously the GPR119 agonist and the DPP-IV
inhibitor can be incorporated into a single pharmaceutical
composition or into separate compositions, e.g., the GPR119 agonist
in one composition and the DPP-IV inhibitor in another composition.
Each of these compositions may be formulated with common
excipients, diluents or carriers, and compressed into tablets, or
formulated elixirs or solutions; and as sustained relief dosage
forms and the like. The GPR119 agonist and DPP-IV inhibitor may be
administered via different routes. For example, the GPR119 agonist
may be administered orally via tablet and the DPP-IV inhibitor may
be administered via inhalation.
[0620] When separately administered, therapeutically effective
amounts of the GPR119 agonist and the DPP-IV inhibitor according to
the present invention are administered on a different schedule. One
may be administered before the other as long as the time between
the two administrations falls within a therapeutically effective
interval. A therapeutically effective interval is a period of time
beginning when one of either (a) the GPR119 agonist or (b) the
DPP-IV inhibitor is administered to a mammal and ending at the
limit of the beneficial effect in the treatment of the combination
of (a) and (b).
[0621] In one aspect, the present invention features a
pharmaceutical composition comprising or consisting essentially of
a combination of an amount of a GPR119 agonist according to the
present invention and an amount of a DPP-IV inhibitor according to
the present invention, together with at least one pharmaceutically
acceptable carrier.
[0622] In one aspect, the present invention features a
pharmaceutical composition comprising or consisting essentially of
a combination of an amount of a GPR119 agonist according to the
present invention and an amount of a DPP-IV inhibitor according to
the present invention, together with at least one pharmaceutically
acceptable carrier. The present invention also relates to a dosage
form of the pharmaceutical composition wherein the GPR119 agonist
and the DPP-IV inhibitor are in amounts sufficient to give an
effect in lowering a blood glucose level in a subject. In certain
embodiments, the blood glucose level is an elevated blood glucose
level.
[0623] In one aspect, the present invention features a
pharmaceutical composition comprising or consisting essentially of
a combination of an amount of a GPR119 agonist according to the
present invention and an amount of a DPP-IV inhibitor according to
the present invention, together with at least one pharmaceutically
acceptable carrier. The present invention also relates to a dosage
form of the pharmaceutical composition wherein the GPR119 agonist
and the DPP-IV inhibitor are in amounts sufficient to give an
effect in lowering a blood glucose level in a subject, and wherein
the amount of the GPR119 agonist alone and the amount of the DPP-IV
inhibitor alone are therapeutically ineffective in lowering the
blood glucose level in the subject. In certain embodiments, the
blood glucose level is an elevated blood glucose level.
[0624] In one aspect, the present invention features a
pharmaceutical composition comprising or consisting essentially of
a combination of an amount of a GPR119 agonist according to the
present invention and an amount of a DPP-IV inhibitor according to
the present invention, together with at least one pharmaceutically
acceptable carrier. The present invention also relates to a dosage
form of the pharmaceutical composition wherein the GPR119 agonist
and the DPP-IV inhibitor are in amounts sufficient to give an
effect in lowering a blood glucose level in a subject, and wherein
the effect is a synergistic effect. In certain embodiments, the
blood glucose level is an elevated blood glucose level.
[0625] In one aspect, the present invention relates to a
pharmaceutical composition comprising or consisting essentially of
a combination of an amount of a GPR119 agonist according to the
present invention and an amount of a DPP-IV inhibitor according to
the present invention, together with at least one pharmaceutically
acceptable carrier. The present invention also relates to a dosage
form of the pharmaceutical composition wherein the GPR119 agonist
and the DPP-IV inhibitor are in amounts sufficient to give an
effect in lowering a blood glucose level in a subject, wherein the
effect is a synergistic effect, and wherein the amount of the
GPR119 agonist alone and the amount of the DPP-IV inhibitor alone
are therapeutically ineffective in lowering the blood glucose level
in the subject. In certain embodiments, the blood glucose level is
an elevated blood glucose level.
[0626] In one aspect, the present invention features a
pharmaceutical composition comprising or consisting essentially of
a combination of an amount of a GPR119 agonist according to the
present invention and an amount of a DPP-IV inhibitor according to
the present invention, together with at least one pharmaceutically
acceptable carrier. The present invention also relates to a dosage
form of the pharmaceutical composition wherein the GPR119 agonist
and the DPP-IV inhibitor are in amounts sufficient to give an
effect in increasing a blood GLP-1 level in a subject.
[0627] In one aspect, the present invention features a
pharmaceutical composition comprising or consisting essentially of
a combination of an amount of a GPR119 agonist according to the
present invention and an amount of a DPP-IV inhibitor according to
the present invention, together with at least one pharmaceutically
acceptable carrier. The present invention also relates to a dosage
form of the pharmaceutical composition wherein the GPR119 agonist
and the DPP-IV inhibitor are in amounts sufficient to give an
effect in increasing a blood GLP-1 level in a subject, and wherein
the amount of the GPR119 agonist alone and the amount of the DPP-IV
inhibitor alone are therapeutically ineffective in increasing a
blood GLP-1 level in the subject.
[0628] In one aspect, the present invention features a
pharmaceutical composition comprising or consisting essentially of
a combination of an amount of a GPR119 agonist according to the
present invention and an amount of a DPP-IV inhibitor according to
the present invention, together with at least one pharmaceutically
acceptable carrier. The present invention also relates to a dosage
form of the pharmaceutical composition wherein the GPR119 agonist
and the DPP-IV inhibitor are in amounts sufficient to give an
effect in increasing a blood GLP-1 level in a subject, and wherein
the effect is a synergistic effect.
[0629] In one aspect, the present invention relates to a
pharmaceutical composition comprising or consisting essentially of
a combination of an amount of a GPR119 agonist according to the
present invention and an amount of a DPP-IV inhibitor according to
the present invention, together with at least one pharmaceutically
acceptable carrier. The present invention also relates to a dosage
form of the pharmaceutical composition wherein the GPR119 agonist
and the DPP-IV inhibitor are in amounts sufficient to give an
effect in increasing a blood GLP-1 level in a subject, wherein the
effect is a synergistic effect, and wherein the amount of the
GPR119 agonist alone and the amount of the DPP-IV inhibitor alone
are therapeutically ineffective in increasing a blood GLP-1 level
in the subject.
[0630] Pharmaceutical compositions suitable for use in the present
invention include compositions wherein the active ingredients are
contained in an amount to achieve their intended purpose. In some
embodiments, a pharmaceutical composition of the present invention
is understood to be useful for treating or preventing diabetes and
conditions related thereto. Diabetes and conditions related thereto
are according to the present invention. In some embodiments, a
pharmaceutical composition of the present invention is understood
to be useful for treating or preventing a condition ameliorated by
increasing a blood GLP-1 level. Conditions ameliorated by
increasing a blood GLP-1 level are according to the present
invention.
[0631] In certain embodiments of the combination therapy of the
present invention, the amount of GPR119 agonist according to the
present invention and the amount of DPP-IV inhibitor according to
the present invention are provided in amounts to give a synergistic
effect in lowering a blood glucose level in a subject. In certain
embodiments, the blood glucose level is an elevated blood glucose
level. Determination of the amounts of GPR119 agonist and DPP-IV
inhibitor providing a synergistic effect in lowering blood glucose
level in a subject is well within the capability of those skilled
in the art, especially in light of the detailed disclosure provided
herein. In one embodiment of the combination therapy of the present
invention, the amount of GPR119 agonist according to the present
invention and the amount of DPP-IV inhibitor according to the
present invention are provided in amounts to give a synergistic
effect in lowering a blood glucose level in a subject, wherein the
amount of the GPR119 agonist alone and the amount of the DPP-IV
inhibitor alone are therapeutically ineffective in lowering the
blood glucose level in the subject. In certain embodiments, the
blood glucose level is an elevated blood glucose level.
Determination of the amounts of GPR119 agonist and DPP-IV inhibitor
providing a synergistic effect in lowering blood glucose level in a
subject, wherein the amount of the GPR119 agonist alone and the
amount of the DPP-IV inhibitor alone are therapeutically
ineffective in lowering blood glucose level in the subject, is well
within the capability of those skilled in the art, especially in
light of the detailed disclosure provided herein.
[0632] In certain embodiments of the combination therapy of the
present invention, the amount of GPR119 agonist according to the
present invention and the amount of DPP-IV inhibitor according to
the present invention are provided in amounts to give a synergistic
effect in increasing a blood GLP-1 level in a subject.
Determination of the amounts of GPR119 agonist and DPP-IV inhibitor
providing a synergistic effect in increasing a blood GLP-1 level in
a subject is well within the capability of those skilled in the
art, especially in light of the detailed disclosure provided
herein. In one embodiment of the combination therapy of the present
invention, the amount of GPR119 agonist according to the present
invention and the amount of DPP-IV inhibitor according to the
present invention are provided in amounts to give a synergistic
effect in increasing a blood GLP-1 level in a subject, wherein the
amount of the GPR119 agonist alone and the amount of the DPP-IV
inhibitor alone are therapeutically ineffective in increasing a
blood GLP-1 level in the subject. Determination of the amounts of
GPR119 agonist and DPP-IV inhibitor providing a synergistic effect
in increasing a blood GLP-1 level in a subject, wherein the amount
of the GPR119 agonist alone and the amount of the DPP-IV inhibitor
alone are therapeutically ineffective in increasing a blood GLP-1
level in the subject, is well within the capability of those
skilled in the art, especially in light of the detailed disclosure
provided herein.
[0633] The data obtained from animal studies, including but not
limited to studies using mice, rats, rabbits, pigs, and non-human
primates, can be used in formulating a range of dosage for use in
humans. In general, one skilled in the art understands how to
extrapolate in vivo data obtained in an animal model system to
another, such as a human. In some circumstances, these
extrapolations may merely be based on the weight of the animal
model in comparison to another, such as a human; in other
circumstances, these extrapolations are not simply based on weights
but rather incorporate a variety of factors. Representative factors
include the type, age, weight, sex, diet and medical condition of
the patient, the severity of the disease, the route of
administration, pharmacological considerations such as the
activity, efficacy, pharmacokinetic and toxicology profiles of the
particular compound employed, whether a drug delivery system is
utilized, on whether an acute or chronic disease state is being
treated or prophylaxis is conducted or on whether further active
compounds are administered in addition to the compounds of the
present invention and as part of a drug combination. The dosage
regimen for treating a disease condition with the compounds and/or
compositions of this invention is selected in accordance with a
variety factors as cited above. Thus, the actual dosage regimen
employed may vary widely and therefore may deviate from a preferred
dosage regimen and one skilled in the art will recognize that
dosage and dosage regimen outside these typical ranges can be
tested and, where appropriate, may be used in the methods of this
invention.
[0634] An exemplary and preferred animal model system is oral
glucose tolerance test (oGTT) in mice (see, Example 1). In this
model, by way of illustration and not limitation, an amount of a
GPR119 agonist alone or a DPP-IV inhibitor alone which is
therapeutically ineffective is an amount of the GPR119 agonist
alone or the DPP-IV inhibitor alone producing an Area Under Curve
(AUC) inhibition of glycemic excursion less than or equal to about
30%, less than about 25%, less than about 20%, less than about 15%,
less than about 10%, or less than about 5%, more preferably less
than about 25%, less than about 20%, less than about 15%, less than
about 10%, or less than about 5%. In this model, by way of
illustration and not limitation, an amount of a GPR119 agonist
alone or a DPP-IV inhibitor alone which is therapeutically
ineffective is an amount of the GPR119 agonist alone or the DPP-IV
inhibitor alone producing an Area Under Curve (AUC) inhibition of
glycemic excursion about 0-30%, about 0-25%, about 0-20%, about
0-15%, about 0-10%, or about 0-5%, more preferably about 0-25%,
about 0-20%, about 0-15%, about 0-10%, or about 0-5%. In this
model, by way of illustration and not limitation, a therapeutically
effective amount of a combination of a GPR119 agonist and a DPP-IV
inhibitor in accordance with the present invention is an amount of
the combination producing an Area Under Curve (AUC) inhibition of
glycemic excursion greater than about 30%, greater than about 35%,
greater than about 40%, greater than about 45%, greater than about
50%, greater than about 55%, greater than about 60%, greater than
about 65%, greater than about 70%, greater than about 75%, greater
than about 80%, greater than about 85%, greater than about 90%, or
greater than about 95%, more preferably greater than about 35%,
greater than about 40%, greater than about 45%, greater than about
50%, greater than about 55%, greater than about 60%, greater than
about 65%, greater than about 70%, or greater than about 75%,
greater than about 80%, greater than about 85%, greater than about
90%, or greater than about 95%.
[0635] Dosage amount and interval may be adjusted in order to
provide a synergistic effect in lowering a blood glucose level in
the subject in accordance with the present invention or to provide
a synergistic effect in increasing a blood GLP-1 level in the
subject in accordance with the present invention. In certain
embodiments, the blood glucose level is an elevated blood glucose
level. It will be appreciated that the exact dosage of a GPR119
agonist or DPP-IV inhibitor in accordance with the present
invention will vary depending on the combination of the GPR119
agonist and DPP-IV inhibitor, its potency, the mode of
administration, the age and weight of the patient and the severity
of the condition to be treated. The exact formulation, route of
administration and dosage can be chosen by the individual physician
in view of the patient's condition. By way of illustration and not
limitation, an amount of GPR119 agonist or DPP-IV inhibitor
providing a synergistic effect in lowering a blood glucose level in
the subject in accordance with the present invention or providing a
synergistic effect in increasing a blood GLP-1 level in the subject
in accordance with the present invention is less than about 0.001
mg/kg body weight, less than about 0.005 mg/kg body weight, less
than about 0.01 mg/kg body weight, less than about 0.05 mg/kg body
weight, less than about 0.1 mg/kg body weight, less than about 0.5
mg/kg body weight, less than about 1 mg/kg body weight, less than
about 5 mg/kg body weight, less than about 10 mg/kg body weight,
less than about 50 mg/kg body weight, or less than about 100 mg/kg
body weight. In certain embodiments, the blood glucose level is an
elevated blood glucose level. In some embodiments, an amount of
GPR119 agonist or DPP-IV inhibitor providing a synergistic effect
in lowering a blood glucose level in the subject in accordance with
the present invention or providing a synergistic effect in
increasing a blood GLP-1 level in the subject in accordance with
the present invention is less than about 0.001-100 mg/kg body
weight, less than about 0.001-50 mg/kg body weight, less than about
0.001-10 mg/kg body weight, less than about 0.001-5 mg/kg body
weight, less than about 0.001-1 mg/kg body weight, less than about
0.001 to 0.5 mg/kg body weight, less than about 0.001-0.1 mg/kg
body weight, less than about 0.001-0.05 mg/kg body weight, less
than about 0.001-0.01 mg/kg body weight, or less than about
0.001-0.005 mg/kg body weight. In certain embodiments, the blood
glucose level is an elevated blood glucose level. In some
embodiments, an amount of GPR119 agonist or DPP-IV inhibitor
providing a synergistic effect in lowering a blood glucose level in
the subject in accordance with the present invention or providing a
synergistic effect in increasing a blood GLP-1 level in the subject
in accordance with the present invention is about 0.001-100 mg/kg
body weight, about 0.001-50 mg/kg body weight, about 0.001-10 mg/kg
body weight, about 0.001-5 mg/kg body weight, about 0.001 to 1
mg/kg body weight, about 0.001-0.5 mg/kg body weight, about
0.001-0.1 mg/kg body weight, about 0.001-0.05 mg/kg body weight,
about 0.001-0.01 mg/kg body weight, or about 0.001-0.005 mg/kg body
weight. In certain embodiments, the blood glucose level is an
elevated blood glucose level.
[0636] An additional exemplary and preferred animal model system is
increase of a blood GLP-1 level after glucose challenge in mice
(see, Example 3).
[0637] Dosage amount and interval may be adjusted individually to
provide plasma levels of GPR119 agonist according to the present
invention and DPP-IV inhibitor according to the present invention
which provide a synergistic effect in lowering a blood glucose
level in the subject according to the present invention or provide
a synergistic effect in increasing a blood GLP-1 level in the
subject according to the present invention. In certain embodiments,
the blood glucose level is an elevated blood glucose level. Dosage
intervals can also be determined using the value for a selected
range of GPR119 agonist concentration or the value for a selected
range of DPP-IV inhibitor concentration providing a synergistic
effect in lowering a blood glucose level in the subject according
to the present invention or providing a synergistic effect in
increasing a blood GLP-1 level in the subject according to the
present invention. In certain embodiments, the blood glucose level
is an elevated blood glucose level. GPR119 agonist and DPP-IV
inhibitor should be administered using a regimen that maintains
plasma levels within the selected range of GPR119 agonist
concentration and DPP-IV inhibitor concentration, respectively, for
10-90% of the time, preferably between 30-99% of the time, and most
preferably between 50-90% of the time. In cases of local
administration or selective uptake, the range of GPR119 agonist
concentration or the range of DPP-IV inhibitor concentration
providing a synergistic effect in lowering a blood glucose level in
the subject according to the present invention or providing a
synergistic effect in increasing a blood GLP-1 level in the subject
according to the present invention may not be related to plasma
concentration. In certain embodiments, the blood glucose level is
an elevated blood glucose level.
[0638] The amount of composition administered will, of course, be
dependent on the subject being treated, on the subject's weight,
the severity of the affliction, the manner of administration, and
the judgement of the prescribing physician.
[0639] In one aspect, the present invention accordingly features a
method of treating or preventing diabetes or a condition related
thereto comprising administering to a subject in need thereof a
therapeutically effective amount of a composition comprising or
consisting essentially of an amount of a GPR119 agonist according
to the present invention and an amount of a DPP-IV inhibitor
according to the present invention.
[0640] In one aspect, the present invention relates to a method of
treating or preventing diabetes or a condition related thereto
comprising administering to a subject in need thereof a
therapeutically effective amount of a composition comprising or
consisting essentially of an amount of a GPR119 agonist according
to the present invention and an amount of a DPP-IV inhibitor
according to the present invention. In a related aspect, the
present invention features said method wherein the GPR119 agonist
and the DPP-IV inhibitor are administered in amounts sufficient to
give an effect in lowering a blood glucose level in the subject. In
certain embodiments, the blood glucose level is an elevated blood
glucose level.
[0641] In one aspect, the present invention relates to a method of
treating or preventing diabetes or a condition related thereto
comprising administering to a subject in need thereof a
therapeutically effective amount of a composition comprising or
consisting essentially of an amount of a GPR119 agonist according
to the present invention and an amount of a DPP-IV inhibitor
according to the present invention. In a related aspect, the
present invention features said method wherein the GPR119 agonist
and the DPP-IV inhibitor are administered in amounts sufficient to
give an effect in lowering a blood glucose level in the subject,
and wherein the amount of the GPR119 agonist alone and the amount
of the DPP-IV inhibitor alone are therapeutically ineffective in
lowering the blood glucose level in the subject. In certain
embodiments, the blood glucose level is an elevated blood glucose
level.
[0642] In one aspect, the present invention relates to a method of
treating or preventing diabetes or a condition related thereto
comprising administering to a subject in need thereof a
therapeutically effective amount of a composition comprising or
consisting essentially of an amount of a GPR119 agonist according
to the present invention and an amount of a DPP-IV inhibitor
according to the present invention. In a related aspect, the
present invention features said method wherein the GPR119 agonist
and the DPP-IV inhibitor are administered in amounts sufficient to
give an effect in lowering a blood glucose level in the subject,
and wherein the effect is a synergistic effect. In certain
embodiments, the blood glucose level is an elevated blood glucose
level.
[0643] In one aspect, the present invention relates to a method of
treating or preventing diabetes or a condition related thereto
comprising administering to a subject in need thereof a
therapeutically effective amount of a composition comprising or
consisting essentially of an amount of a GPR119 agonist according
to the present invention and an amount of a DPP-IV inhibitor
according to the present invention. In a related aspect, the
present invention features said method wherein the GPR119 agonist
and the DPP-IV inhibitor are administered in amounts sufficient to
give an effect in lowering a blood glucose level in the subject,
wherein the effect is a synergistic effect, and wherein the amount
of the GPR119 agonist alone and the amount of the DPP-IV inhibitor
alone are therapeutically ineffective in lowering the blood glucose
level in the subject. In certain embodiments, the blood glucose
level is an elevated blood glucose level.
[0644] A combination therapy of the present invention is useful in
treating or preventing diabetes or a condition related thereto in a
mammal, including and most preferably in a human. In some
embodiments, diabetes is Type 1 diabetes. In some preferred
embodiments, diabetes is Type 2 diabetes. A condition related to
diabetes includes, but is not limited to, hyperglycemia, impaired
glucose tolerance, insulin resistance, pancreatic beta-cell
insufficiency, enteroendocrine cell insufficiency, glucosuria,
metabolic acidosis, cataracts, diabetic nephropathy, diabetic
neuropathy, diabetic retinopathy, diabetic coronary artery disease,
diabetic cerebrovascular disease, diabetic peripheral vascular
disease, metabolic syndrome, hyperlipidemia, atherosclerosis,
stroke, hypertension, and obesity. It is understood that conditions
related to diabetes can be included in embodiments individually or
in any combination.
[0645] In one aspect, the present invention accordingly features a
method of treating or preventing a condition ameliorated by
increasing a blood GLP-1 level comprising administering to a
subject in need thereof a therapeutically effective amount of a
composition comprising or consisting essentially of an amount of a
GPR119 agonist according to the present invention and an amount of
a DPP-IV inhibitor according to the present invention.
[0646] In one aspect, the present invention relates to a method of
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level comprising administering to a subject in need
thereof a therapeutically effective amount of a composition
comprising or consisting essentially of an amount of a GPR119
agonist according to the present invention and an amount of a
DPP-IV inhibitor according to the present invention. In a related
aspect, the present invention features said method wherein the
GPR119 agonist and the DPP-IV inhibitor are administered in amounts
sufficient to give an effect in increasing a blood GLP-1 level in
the subject.
[0647] In one aspect, the present invention relates to a method of
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level comprising administering to a subject in need
thereof a therapeutically effective amount of a composition
comprising or consisting essentially of an amount of a GPR119
agonist according to the present invention and an amount of a
DPP-IV inhibitor according to the present invention. In a related
aspect, the present invention features said method wherein the
GPR119 agonist and the DPP-IV inhibitor are administered in amounts
sufficient to give an effect in increasing a blood GLP-1 level in
the subject, and wherein the amount of the GPR119 agonist alone and
the amount of the DPP-IV inhibitor alone are therapeutically
ineffective in increasing a blood GLP-1 level in the subject.
[0648] In one aspect, the present invention relates to a method of
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level comprising administering to a subject in need
thereof a therapeutically effective amount of a composition
comprising or consisting essentially of an amount of a GPR119
agonist according to the present invention and an amount of a
DPP-IV inhibitor according to the present invention. In a related
aspect, the present invention features said method wherein the
GPR119 agonist and the DPP-IV inhibitor are administered in amounts
sufficient to give an effect in increasing a blood GLP-1 level in
the subject, and wherein the effect is a synergistic effect.
[0649] In one aspect, the present invention relates to a method of
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level comprising administering to a subject in need
thereof a therapeutically effective amount of a composition
comprising or consisting essentially of an amount of a GPR119
agonist according to the present invention and an amount of a
DPP-IV inhibitor according to the present invention. In a related
aspect, the present invention features said method wherein the
GPR119 agonist and the DPP-IV inhibitor are administered in amounts
sufficient to give an effect in increasing a blood GLP-1 level in
the subject, wherein the effect is a synergistic effect, and
wherein the amount of the GPR119 agonist alone and the amount of
the DPP-IV inhibitor alone are therapeutically ineffective in
increasing a blood GLP-1 level in the subject.
[0650] A combination therapy of the present invention is useful in
treating or preventing a condition ameliorated by increasing a
blood GLP-1 level in a mammal, including and most preferably in a
human. A condition ameliorated by increasing a blood GLP-1 level
includes, but is not limited to, diabetes, a condition related to
diabetes, myocardial infarction, learning impairment, memory
impairment, and a neurodegenerative disorder, wherein a condition
related to diabetes includes, but is not limited to, hyperglycemia,
impaired glucose tolerance, insulin resistance, pancreatic
beta-cell insufficiency, enteroendocrine cell insufficiency,
glucosuria, metabolic acidosis, cataracts, diabetic nephropathy,
diabetic neuropathy, diabetic retinopathy, diabetic coronary artery
disease, diabetic cerebrovascular disease, diabetic peripheral
vascular disease, metabolic syndrome, hyperlipidemia,
atherosclerosis, stroke, hypertension, and obesity, wherein a
neurodegenerative disorder includes, but is not limited to,
excitotoxic brain damage caused by severe epileptic seizures,
Alzheimer's disease, Parkinson's disease, Huntington's disease,
prion-associated disease, motor-neuron disease, traumatic brain
injury, spinal cord injury, and peripheral neuropathy. In some
embodiments, diabetes is Type 1 diabetes. In some preferred
embodiments, diabetes is Type 2 diabetes. It is understood that
conditions ameliorated by increasing a blood GLP-1 level can be
included in embodiments individually or in any combination.
[0651] Without further elaboration, it is believed that one skilled
in the art can, using the preceding description, practice the
present invention to its fullest extent. The foregoing detailed
description is given for clearness of understanding only, and no
unnecessary limitation should be understood therefrom, as
modifications within the scope of the invention may become apparent
to those skilled in the art.
[0652] The inventions described in this application were made by
Arena Pharmaceuticals, Inc as a result of activities undertaken
within the scope of a Dec. 20, 2004 joint research agreement
between Ortho-McNeil Pharmaceutical, Inc. and Arena
Pharmaceuticals, Inc.
[0653] Throughout this application, various publications, patents
and patent applications are cited. The disclosures of these
publications, patents and patent applications referenced in this
application are herein incorporated by reference in their entirety
into the present disclosure. Citation herein by Applicant of a
publication, patent, or patent application is not an admission by
Applicant of said publication, patent, or patent application as
prior art.
EXAMPLES
[0654] Without further elaboration, it is believed that one skilled
in the art can, using the preceding description, practice the
present invention to its fullest extent. The following detailed
examples are to be construed as merely illustrative, and not
limitations of the preceding disclosure in any way whatsoever.
Those skilled in the art will promptly recognize appropriate
variations from the procedures.
Example 1
Synergistic Effect of GPR119 Agonist and DPP-IV Inhibitor in
Lowering an Elevated Blood Glucose Level in Oral Glucose Tolerance
Test (oGTT) in Mice
[0655] Oral glucose tolerance test (oGTT) in mice was carried out
as described here. Overnight fasted mice (n=6 mice per treatment)
were administered via oral gavage with vehicle (PET), a GPR119
agonist (AR231453) at 1 mkg (milligram compound per kilogram of
body weight), a DPP-IV inhibitor (AR247810) at 0.1 mkg, or a
combination of the GPR119 agonist (1 mkg) and the DPP-IV inhibitor
(0.1 mkg). Thirty minutes later, a glucose bolus (3 gram/kg) was
then delivered per orally. Plasma glucose levels were determined at
the indicated time points over a two hour period using blood
(.about.5 .mu.l) collected from tail nick and a glucose meter.
Glycemic excursion curve was graphed based on data from 6 mice and
given in mean values +/-SEM (FIG. 1A). Area Under Curve (AUC) of
the glycemic excursion was calculated for each mouse and AUC
inhibition (%) was reported in FIG. 1B.
[0656] In this Example, GPR119 agonist given at 1 mkg alone, or
DPP-IV inhibitor given at 0.1 mkg alone produced an AUC inhibition
of glycemic excursion less than 15-20% in this mouse model, which
is regarded as therapeutically ineffective for the long term
glycemic control in diabetic patients. On the other hand, the
combination of both compounds at their therapeutically ineffective
dose (0.1 mkg for the DPP-IV inhibitor, and 1 mkg for the GPR119
agonist in this Example) produced an AUC inhibition over 60%.
Typically, a therapeutically effective dose would create an AUC
inhibition above 30% in this mouse model study, such as that
observed for the incretin mimetic exendin-4 at .about.60%.
[0657] Both the DPP-IV inhibitor and the GPR119 agonist alone can
produce an effective therapeutic response (at around 40% AUC
inhibition) in this type of mouse model study, but only at
significantly higher doses (FIG. 1C and FIG. 1D, respectively).
Example 2
Combination of GPR119 Agonist and DPP-IV Inhibitor for Treating or
Preventing Diabetes and Conditions Related Thereto
[0658] A GPR119 agonist in accordance with the present invention is
selected. A DPP-IV inhibitor in accordance with the present
invention is selected.
[0659] Titration of the GPR119 agonist with respect to percent
inhibition of Area Under Curve (AUC) in mouse oral glucose
tolerance test (oGTT) is determined across a dose range from about
0.01 mkg (milligram compound per kilogram of body weight) to about
100 mkg. See Example 1. A dose of the GPR119 agonist producing an
AUC inhibition of glycemic excursion of about 15-20% is chosen.
Typically, a dose of GPR119 agonist producing an AUC inhibition 30%
or less is therapeutically ineffective in this mouse model.
[0660] Titration of the DPP-IV inhibitor with respect to percent
inhibition of Area Under Curve (AUC) in mouse oral glucose
tolerance test (oGTT) is determined across a dose range from about
0.01 mkg (milligram compound per kilogram of body weight) to about
100 mkg. See Example 1. A dose of the DPP-IV inhibitor producing an
AUC inhibition of glycemic excursion of about 15-20% is chosen.
Typically, a dose of DPP-IV inhibitor producing an AUC inhibition
30% or less is therapeutically ineffective in this mouse model.
[0661] The AUC inhibition of glycemic excursion produced by the
combination of the chosen dose of the GPR119 agonist and the chosen
dose of the DPP-IV inhibitor is determined in mouse oGTT assay.
Therapeutic efficacy of the combination of the GPR119 agonist and
the DPP-IV inhibitor is determined. Typically, an amount of the
combination producing an AUC inhibition above 30% is
therapeutically effective in this mouse model. Synergism between
the GPR119 agonist and the DPP-IV inhibitor is determined.
[0662] Data obtained from this mouse model can be used to formulate
a range of dosage for use in humans. In general, one skilled in the
art understands how to extrapolate in vivo data obtained in an
animal model system to another, such as a human. A combination of
GPR119 agonist and DPP-IV inhibitor in accordance with the present
invention is useful in treating or preventing diabetes and
conditions related thereto.
[0663] It is understood that the foregoing is intended to be
illustrative and not limiting.
Example 3
Synergistic Effect of GPR119 Agonist and DPP-IV Inhibitor in
Increasing a Blood GLP-1 Level after Glucose Challenge in Mice
[0664] C57blk/6 male mice (8 weeks of age) were fasted for 18
hours, and randomly assigned into twelve groups with n=6 for each
group. Mice were administered per orally with vehicle (PET), GPR119
agonist (10 mg/kg) DPP-IV inhibitor (1 mg/kg), or a combination of
GPR119 agonist and DPP-IV inhibitor, as indicated. The GPR119
agonist (AR231453) and the DPP-IV inhibitor (AR247810) used here
are identical to those used in Example 1. Thirty minutes after
treatment, a glucose bolus at 3 g/kg were delivered per orally, and
plasma were collected at 0 minute (no glucose bolus), and at 2
minutes and 5 minutes after glucose bolus. Plasma GLP-1 levels were
determined by using a GLP-1 ELISA kit purchased from Linco Research
Laboratory [Glucagon-Like Peptide-1 (Active) ELISA kit, Catalog
#EGLP-35K].
[0665] Administration of a GPR119 agonist together with a DPP-IV
inhibitor was found to produce a synergistic effect in increasing a
blood GLP-1 level. See FIG. 2.
Example 4
Melanophore Assay for GPR119 Agonist Activity
[0666] Melanophores are maintained in culture as reported by
Potenza et al [Pigment Cell Research (1992) 5:372-378] and
transfected with an expression vector encoding a GPR119 receptor
(GPR119; e.g., human GP 119, GenBank.RTM. Accession No. AAP72125
and alleles thereof) using electroporation. Following
electroporation, the transfected cells are plated into 96 well
plates for the assay. The cells are then allowed to grow for 48
hours in order to both recover from the electroporation procedure
and attain maximal receptor expression levels.
[0667] On the assay day, the growth medium on the cells is replaced
with serum-free buffer containing 10 nM melatonin. The melatonin
acts via an endogenous Gi-coupled GPCR in the melanophores to lower
intracellular cAMP levels. In response to lowered cAMP levels, the
melanophores translocate their pigment to the center of the cell.
The net effect of this is a significant decrease in the absorbance
reading of the cell monolayer in the well, measured at 600-650
nM.
[0668] After a 1-hour incubation in melatonin, the cells become
completely pigment-aggregated. At this point a baseline absorbance
reading is collected. Serial dilutions of test compounds are then
added to the plate, and compounds having GPR119 agonist activity
produce increases in intracellular cAMP levels. In response to
these increased cAMP levels, the melanophores translocate their
pigment back into the cell periphery. After one hour, stimulated
cells are fully pigment-dispersed. The cell monolayer in the
dispersed state absorbs much more light in the 600-650 nm range.
The measured increase in absorbance compared to the baseline
reading allows one to quantitate the degree of receptor stimulation
and plot a dose-response curve.
[0669] Materials and methods relating to melanophore assay are
found in U.S. Pat. Nos. 5,462,856 and 6,051,386, the disclosure of
each of which is herein incorporated by reference in its
entirety.
[0670] Other assays for identifying a compound as a GPR119 agonist
will be readily apparent to the skilled artisan (see, e.g., Example
7, infra).
Example 5
Full-Length Cloning of Endogenous Human GPR119
[0671] Polynucleotide encoding endogenous human GPR119 was cloned
by PCR using the GPR119 specific primers:
[0672] 5'-GTCCTGCCACTTCGAGACATGG-3' (SEQ ID NO:3; sense, ATG as
initiation codon)
[0673] 5'-GAAACTTCTCTGCCCTTACCGTC-3' (SEQ ID NO:4; antisense, 3' of
stop codon)
and human genomic DNA as template. TaqPlus Precision.TM. DNA
polymerase (Stratagene) was used for amplification by the following
cycle with step 2 to step 4 repeated 35 times: 94.degree. C., 3
minutes; 94.degree. C., 1 minute; 58.degree. C., 1 minute;
72.degree. C., 2 minutes; 72.degree. C., 10 minutes. A 1.0 Kb PCR
fragment of predicted size was isolated and cloned into the
pCRII-TOPO.TM. vector (Invitrogen) and completely sequenced using
the T7 DNA sequenase kit (Amersham). See, SEQ ID NO:1 for nucleic
acid sequence and SEQ ID NO:2 for the deduced amino acid
sequence.
Example 6
Receptor Expression
[0674] Although a variety of cells are available to the art for the
expression of G protein-coupled receptors, it is most preferred
that mammalian cells or melanophores be utilized. The following are
illustrative; those of ordinary skill in the art are credited with
the ability to determine those techniques that are preferentially
beneficial for the needs of the artisan. See, e.g., Example 4,
supra, as it relates to melanophores.
[0675] a. Transient Transfection
[0676] On day one, 6.times.10.sup.6/10 cm dish of 293 cells are
plated out. On day two, two reaction tubes are prepared (the
proportions to follow for each tube are per plate): tube A is
prepared by mixing 4 .mu.g DNA (e.g., pCMV vector; pCMV vector with
receptor cDNA, etc.) in 0.5 ml serum free DMEM (Gibco BRL); tube B
is prepared by mixing 24 .mu.l lipofectamine (Gibco BRL) in 0.5 ml
serum free DMEM. Tubes A and B are admixed by inversions (several
times), followed by incubation at room temperature for 30-45 min.
The admixture is referred to as the "transfection mixture". Plated
293 cells are washed with 1XPBS, followed by addition of 5 ml serum
free DMEM. 1 ml of the transfection mixture is added to the cells,
followed by incubation for 4 hrs at 37.degree. C./5% CO.sub.2. The
transfection mixture is removed by aspiration, followed by the
addition of 10 ml of DMEM/10% Fetal Bovine Serum. Cells are
incubated at 37.degree. C./5% CO.sub.2. After 48 hr incubation,
cells are harvested and utilized for analysis.
[0677] b. Stable Cell Lines
[0678] Approximately 12.times.10.sup.6 293 cells are plated on a 15
cm tissue culture plate. Grown in DME High Glucose Medium
containing ten percent fetal bovine serum and one percent sodium
pyruvate, L-glutamine, and antibiotics. Twenty-four hours following
plating of 293 cells (or to .about.80% confluency), the cells are
transfected using 12 .mu.g of DNA (e.g., pCMV-neo.sup.r vector with
receptor cDNA). The 12 .mu.g of DNA is combined with 60 .mu.l of
lipofectamine and 2 ml of DME High Glucose Medium without serum.
The medium is aspirated from the plates and the cells are washed
once with medium without serum. The DNA, lipofectamine, and medium
mixture are added to the plate along with 10 ml of medium without
serum. Following incubation at 37.degree. C. for four to five
hours, the medium is aspirated and 25 ml of medium containing serum
is added. Twenty-four hours following transfection, the medium is
aspirated again, and fresh medium with serum is added. Forty-eight
hours following transfection, the medium is aspirated and medium
with serum is added containing geneticin (G418 drug) at a final
concentration of approximately 12.times.10.sup.6 293 cells are
plated on a 15 cm tissue culture plate. Grown in DME High Glucose
Medium containing ten percent fetal bovine serum and one percent
sodium pyruvate, L-glutamine, and antibiotics. Twenty-four hours
following plating of 293 cells (or to .about.80% confluency), the
cells are transfected using 12 .mu.g of DNA (e.g., pCMV vector with
receptor cDNA). The 12 .mu.g of DNA is combined with 60 .mu.l of
lipofectamine and 2 ml of DME High Glucose Medium without serum.
The medium is aspirated from the plates and the cells are washed
once with medium without serum. The DNA, lipofectamine, and medium
mixture are added to the plate along with 10 ml of medium without
serum. Following incubation at 37.degree. C. for four to five
hours, the medium is aspirated and 25 ml of medium containing serum
is added. Twenty-four hours following transfection, the medium is
aspirated again, and fresh medium with serum is added. Forty-eight
hours following transfection, the medium is aspirated and medium
with serum is added containing geneticin (G418 drug) at a final
concentration of 500 .mu.g/ml. The transfected cells now undergo
selection for positively transfected cells containing the G418
resistance gene. The medium is replaced every four to five days as
selection occurs. During selection, cells are grown to create
stable pools, or split for stable clonal selection.
Example 7
Assays for Screening Candidate Compounds as GPR119 Agonists
[0679] A variety of approaches are available for screening
candidate compounds as GPR119 agonists. The following are
illustrative; those of ordinary skill in the art are credited with
the ability to determine those techniques that are preferentially
beneficial for the needs of the artisan. Assays for screening
compounds as agonists of a G protein-coupled receptor are well
known to the skilled artisan (see, e.g., International Application
WO 02/42461).
[0680] 1. Membrane Binding Assays: [.sup.35S]GTP.gamma.S Assay
[0681] When a G protein-coupled receptor is in its active state,
either as a result of ligand binding or constitutive activation,
the receptor couples to a G protein and stimulates the release of
GDP and subsequent binding of GTP to the G protein. The alpha
subunit of the G protein-receptor complex acts as a GTPase and
slowly hydrolyzes the GTP to GDP, at which point the receptor
normally is deactivated. Activated receptors continue to exchange
GDP for GTP. The non-hydrolyzable GTP analog,
[.sup.35S]GTP.gamma.S, can be utilized to demonstrate enhanced
binding of [.sup.35S]GTP.gamma.S to membranes expressing activated
receptors. The advantage of using [.sup.35S]GTP.gamma.S binding to
measure activation is that: (a) it is generically applicable to all
G protein-coupled receptors; (b) it is proximal at the membrane
surface making it less likely to pick-up molecules which affect the
intracellular cascade.
[0682] The assay utilizes the ability of G protein coupled
receptors to stimulate [.sup.35S]GTP.gamma.S binding to membranes
expressing the relevant receptors. The assay is generic and has
application to drug discovery at all G protein-coupled
receptors.
Membrane Preparation
[0683] In some embodiments, membranes comprising a G
protein-coupled receptor of the invention and for use in the
identification of candidate compounds as, e.g., agonists of the
receptor, are preferably prepared as follows:
[0684] a. Materials
[0685] "Membrane Scrape Buffer" is comprised of 20 mM HEPES and 10
mM EDTA, pH 7.4; "Membrane Wash Buffer" is comprised of 20 mM HEPES
and 0.1 mM EDTA, pH 7.4; "Binding Buffer" is comprised of 20 mM
HEPES, 100 mM NaCl, and 10 mM MgCl.sub.2, pH 7.4.
[0686] b. Procedure
[0687] All materials will be kept on ice throughout the procedure.
Firstly, the media will be aspirated from a confluent monolayer of
cells, followed by rinse with 10 ml cold PBS, followed by
aspiration. Thereafter, 5 ml of Membrane Scrape Buffer will be
added to scrape cells; this will be followed by transfer of
cellular extract into 50 ml centrifuge tubes (centrifuged at 20,000
rpm for 17 minutes at 4.degree. C.). Thereafter, the supernatant
will be aspirated and the pellet will be resuspended in 30 ml
Membrane Wash Buffer followed by centrifuge at 20,000 rpm for 17
minutes at 4.degree. C. The supernatant will then be aspirated and
the pellet resuspended in Binding Buffer. This will then be
homogenized using a Brinkman Polytron.TM.homogenizer (15-20 second
bursts until the all material is in suspension). This is referred
to herein as "Membrane Protein".
Bradford Protein Assay
[0688] Following the homogenization, protein concentration of the
membranes will be determined using the Bradford Protein Assay
(protein can be diluted to about 1.5 mg/ml, aliquoted and frozen
(-80.degree. C.) for later use; when frozen, protocol for use will
be as follows: on the day of the assay, frozen Membrane Protein is
thawed at room temperature, followed by vortex and then homogenized
with a Polytron at about 12.times.1,000 rpm for about 5-10 seconds;
it is noted that for multiple preparations, the homogenizer should
be thoroughly cleaned between homogenization of different
preparations).
[0689] a. Materials
[0690] Binding Buffer (as per above); Bradford Dye Reagent;
Bradford Protein Standard will be utilized, following manufacturer
instructions (Biorad, cat. no. 500-0006).
[0691] b. Procedure
[0692] Duplicate tubes will be prepared, one including the
membrane, and one as a control "blank". Each contained 800 .mu.l
Binding Buffer. Thereafter, 10 .mu.l of Bradford Protein Standard
(1 mg/ml) will be added to each tube, and 10 .mu.l of membrane
Protein will then be added to just one tube (not the blank).
Thereafter, 200 .mu.l of Bradford Dye Reagent will be added to each
tube, followed by vortex of each. After five (5) minutes, the tubes
will be re-vortexed and the material therein will be transferred to
cuvettes. The cuvettes will then be read using a CECIL 3041
spectrophotometer, at wavelength 595.
Identification Assay
[0693] a. Materials
[0694] GDP Buffer consists of 37.5 ml Binding Buffer and 2 mg GDP
(Sigma, cat. no. G-7127), followed by a series of dilutions in
Binding Buffer to obtain 0.2 .mu.M GDP (final concentration of GDP
in each well was 0.1 .mu.M GDP); each well comprising a candidate
compound, has a final volume of 200 .mu.l consisting of 100 .mu.l
GDP Buffer (final concentration, 0.1 .mu.M GDP), 50 .mu.l Membrane
Protein in Binding Buffer, and 50 .mu.l [.sup.35S]GTP.gamma.S (0.6
nM) in Binding Buffer (2.5 .mu.l [.sup.35S]GTP.gamma.S per 10 ml
Binding Buffer).
[0695] b. Procedure
[0696] Candidate compounds will be preferably screened using a
96-well plate format (these can be frozen at -80.degree. C.).
Membrane Protein (or membranes with expression vector excluding the
Target GPCR, as control), will be homogenized briefly until in
suspension. Protein concentration will then be determined using the
Bradford Protein Assay set forth above. Membrane Protein (and
control) will then be diluted to 0.25 mg/ml in Binding Buffer
(final assay concentration, 12.5 .mu.g/well). Thereafter, 100 .mu.l
GDP Buffer was added to each well of a Wallac
Scintistrip.TM.(Wallac). A 5 ul pin-tool will then be used to
transfer 5 .mu.l of a candidate compound into such well (i.e., 5
.mu.l in total assay volume of 200 .mu.l is a 1:40 ratio such that
the final screening concentration of the candidate compound is 10
.mu.M). Again, to avoid contamination, after each transfer step the
pin tool should be rinsed in three reservoirs comprising water
(1.times.), ethanol (1.times.) and water (2.times.)--excess liquid
should be shaken from the tool after each rinse and dried with
paper and kimwipes. Thereafter, 50 .mu.l of Membrane Protein will
be added to each well (a control well comprising membranes without
the Target GPCR was also utilized), and pre-incubated for 5-10
minutes at room temperature. Thereafter, 50 .mu.l of
[.sup.35S]GTP.gamma.S (0.6 nM) in Binding Buffer will be added to
each well, followed by incubation on a shaker for 60 minutes at
room temperature (again, in this example, plates were covered with
foil). The assay will then be stopped by spinning of the plates at
4000 RPM for 15 minutes at 22.degree. C. The plates will then be
aspirated with an 8 channel manifold and sealed with plate covers.
The plates will then be read on a Wallac 1450 using setting "Prot.
#37" (as per manufacturer's instructions).
[0697] 2. Adenylyl Cyclase Assay
[0698] A Flash Plate.TM. Adenylyl Cyclase kit (New England Nuclear;
Cat. No. SMP004A) designed for cell-based assays can be modified
for use with crude plasma membranes. The Flash Plate wells can
contain a scintillant coating which also contains a specific
antibody recognizing cAMP. The cAMP generated in the wells can be
quantitated by a direct competition for binding of radioactive cAMP
tracer to the cAMP antibody. The following serves as a brief
protocol for the measurement of changes in cAMP levels in whole
cells that express the receptors.
[0699] In certain embodiments, a modified Flash Plate.TM. Adenylyl
Cyclase kit (New England Nuclear; Cat. No. SMP004A) is utilized for
identification of candidate compounds as, e.g., GPR119 agonists in
accordance with the following protocol.
[0700] Cells transfected with a G protein-coupled receptor of the
invention are harvested approximately three days after
transfection. Membranes are prepared by homogenization of suspended
cells in buffer containing 20 mM HEPES, pH 7.4 and 10 mM
MgCl.sub.2. Homogenization is performed on ice using a Brinkman
Polytron.TM. for approximately 10 seconds. The resulting homogenate
is centrifuged at 49,000.times.g for 15 minutes at 4.degree. C. The
resulting pellet is then resuspended in buffer containing 20 mM
HEPES, pH 7.4 and 0.1 mM EDTA, homogenized for 10 seconds, followed
by centrifugation at 49,000.times.g for 15 minutes at 4.degree. C.
The resulting pellet is then stored at -80.degree. C. until
utilized. On the day of direct identification screening, the
membrane pellet is slowly thawed at room temperature, resuspended
in buffer containing 20 mM HEPES, pH 7.4 and 10 mM MgCl.sub.2, to
yield a final protein concentration of 0.60 mg/ml (the resuspended
membranes are placed on ice until use).
[0701] cAMP standards and Detection Buffer (comprising 2 .mu.Ci of
tracer {[.sup.125I]cAMP (100 .mu.l) to 11 ml Detection Buffer] are
prepared and maintained in accordance with the manufacturer's
instructions. Assay Buffer was prepared fresh for screening and
contained 20 mM HEPES, pH 7.4, 10 mM MgCl.sub.2, 20 mM
phosphocreatine (Sigma), 0.1 units/ml creatine phosphokinase
(Sigma), 50 .mu.M GTP (Sigma), and 0.2 mM ATP (Sigma); Assay Buffer
was then stored on ice until utilized.
[0702] Candidate compounds are added, preferably, to e.g. 96-well
plate wells (3 .mu.l/well; 12 .mu.M final assay concentration),
together with 40 .mu.l Membrane Protein (30 .mu.g/well) and 50
.mu.l of Assay Buffer. This admixture was then incubated for 30
minutes at room temperature, with gentle shaking.
[0703] Following the incubation, 100 .mu.l of Detection Buffer is
added to each well, followed by incubation for 2-24 hours. Plates
are then counted in a Wallac MicroBeta.TM. plate reader using
"Prot. #31" (as per manufacturer's instructions).
[0704] 3. CRE-Luc Reporter Assay
[0705] 293 and 293T cells are plated-out on 96 well plates at a
density of 2.times.10.sup.4 cells per well and were transfected
using Lipofectamine Reagent (BRL) the following day according to
manufacturer instructions. A DNA/lipid mixture is prepared for each
6-well transfection as follows: 260 ng of plasmid DNA in 100 .mu.l
of DMEM is gently mixed with 2 .mu.l of lipid in 100 .mu.l of DMEM
(the 260 ng of plasmid DNA consists of 200 ng of a 8xCRE-Luc
reporter plasmid, 50 ng of pCMV comprising a G protein-coupled
receptor of the invention or pCMV alone, and 10 ng of a GPRS
expression plasmid [GPRS in pcDNA3 (Invitrogen)]. The 8XCRE-Luc
reporter plasmid was prepared as follows: vector SRIF-.beta.-gal
was obtained by cloning the rat somatostatin promoter (-71/+51) at
BglV-HindIII site in the p.beta.gal-Basic Vector (Clontech). Eight
(8) copies of cAMP response element were obtained by PCR from an
adenovirus template AdpCF126CCRE8 [see, Suzuki et al., Hum Gene
Ther (1996) 7:1883-1893; the disclosure of which is herein
incorporated by reference in its entirety) and cloned into the
SRIF-.beta.-gal vector at the Kpn-BglV site, resulting in the
8xCRE-.beta.-gal reporter vector. The 8xCRE-Luc reporter plasmid
was generated by replacing the beta-galactosidase gene in the
8xCRE-.beta.-gal reporter vector with the luciferase gene obtained
from the pGL3-basic vector (Promega) at the HindIII-BamHI site.
Following 30 min. incubation at room temperature, the DNA/lipid
mixture is diluted with 400 .mu.l of DMEM and 100 .mu.l of the
diluted mixture is added to each well. 100 .mu.l of DMEM with 10%
FCS are added to each well after a 4 hr incubation in a cell
culture incubator. The following day the transfected cells are
changed with 200 .mu.l/well of DMEM with 10% FCS. Eight (8) hours
later, the wells are changed to 100 .mu.l/well of DMEM without
phenol red, after one wash with PBS. Luciferase activity is
measured the next day using the LucLite.TM. reporter gene assay kit
(Packard) following manufacturer instructions and read on a 1450
MicroBeta.TM. scintillation and luminescence counter (Wallac).
Example 8
Radiolabeled Compound
[0706] In certain embodiments, a compound known to be a ligand of a
G protein-coupled receptor of the invention is radiolabeled. A
radiolabeled compound as described herein can be used in a
screening assay to identify/evaluate compounds. In general terms, a
newly synthesized or identified compound (i.e., test compound) can
be evaluated for its ability to reduce binding of the radiolabeled
known ligand to the receptor, by its ability to reduce formation of
the complex between the radiolabeled known ligand and the receptor.
Suitable radionuclides that may be incorporated in compounds of the
present invention include but are not limited to .sup.3H (also
written as T), .sup.11C, .sup.14C, .sup.18F, .sup.125I, .sup.82Br,
.sup.123I, .sup.124I, .sup.125I, .sup.131I, .sup.75Br, .sup.76Br,
.sup.15O, .sup.13N, .sup.35S and .sup.77Br. Compounds that
incorporate .sup.3H, .sup.14C, .sup.125I, .sup.131I, .sup.35S or
.sup.82Br will generally be most useful.
[0707] It is understood that a "radiolabelled" compound" is a
compound that has incorporated at least one radionuclide. In some
embodiments, the radionuclide is selected from the group consisting
of .sup.3H, .sup.14C, .sup.125I, .sup.35S and .sup.82Br. In some
embodiments, the radionuclide .sup.3H or .sup.14C. Moreover, it
should be understood that all of the atoms represented in the
compounds known to be ligands of a G protein-coupled receptor of
the invention can be either the most commonly occurring isotope of
such atoms or the more scarce radioisotope or nonradioactive
isotope.
[0708] Synthetic methods for incorporating radioisotopes into
organic compounds including those applicable to those compounds
known to be ligands of a G protein-coupled receptor of the
invention are well known in the art and include incorporating
activity levels of tritium into target molecules include: A.
Catalytic Reduction with Tritium Gas--This procedure normally
yields high specific activity products and requires halogenated or
unsaturated precursors. B. Reduction with Sodium Borohydride
[.sup.3H]--This procedure is rather inexpensive and requires
precursors containing reducible functional groups such as
aldehydes, ketones, lactones, esters, and the like. C. Reduction
with Lithium Aluminum Hydride [.sup.3H]--This procedure offers
products at almost theoretical specific activities. It also
requires precursors containing reducible functional groups such as
aldehydes, ketones, lactones, esters, and the like. D. Tritium Gas
Exposure Labeling--This procedure involves exposing precursors
containing exchangeable protons to tritium gas in the presence of a
suitable catalyst. E. N-Methylation using Methyl Iodide
[.sup.3H]--This procedure is usually employed to prepare O-methyl
or N-methyl (.sup.3H) products by treating appropriate precursors
with high specific activity methyl iodide (.sup.3H). This method in
general allows for high specific activity, such as about 80-87
Ci/mmol.
[0709] Synthetic methods for incorporating activity levels of
.sup.125I into target molecules include: A. Sandmeyer and like
reactions--This procedure transforms an aryl or heteroaryl amine
into a diazonium salt, such as a tetrafluoroborate salt, and
subsequently to .sup.125I labelled compound using Na.sup.125I. A
represented procedure was reported by Zhu, D.-G. and co-workers in
J. Org. Chem. 2002, 67, 943-948. B. Ortho .sup.125Iodination of
phenols--This procedure allows for the incorporation of .sup.125I
at the ortho position of a phenol as reported by Collier, T. L. and
co-workers in J. Labelled Compd Radiopharm. 1999, 42, S264-S266. C.
Aryl and heteroaryl bromide exchange with .sup.125I--This method is
generally a two step process. The first step is the conversion of
the aryl or heteroaryl bromide to the corresponding tri-alkyltin
intermediate using for example, a Pd catalyzed reaction [i.e.
Pd(Ph.sub.3P).sub.4] or through an aryl or heteroaryl lithium, in
the presence of a tri-alkyltinhalide or hexaalkylditin [e.g.,
(CH.sub.3).sub.3SnSn(CH.sub.3).sub.3]. A represented procedure was
reported by Bas, M.-D. and co-workers in J. Labelled Compd
Radiopharm. 2001, 44, S280-S282.
[0710] The foregoing techniques are intended to be illustrative and
not limiting. Other techniques for radiolabeling a compound known
to be a ligand of a G protein-coupled receptor of the invention are
well known to the skilled artisan.
Example 9
Receptor Binding Assay
[0711] A test compound can be evaluated for its ability to reduce
formation of the complex between a compound known to be a ligand of
a G protein-coupled receptor of the invention and the receptor. In
certain embodiments, the known ligand is radiolabeled. The
radiolabeled known ligand can be used in a screening assay to
identify/evaluate compounds. In general terms, a newly synthesized
or identified compound (i.e., test compound) can be evaluated for
its ability to reduce binding of the radiolabeled known ligand to
the receptor, by its ability to reduce formation of the complex
between the radiolabeled known ligand and the receptor.
Assay Protocol for Detecting the Complex Between a Compound Known
to be a Ligand of a G Protein-Coupled Receptor of the Invention and
the Receptor
[0712] A. Preparation of the Receptor
[0713] 293 cells are transiently transfected with 10 ug expression
vector comprising a polynucleotide encoding a G protein-coupled
receptor of the invention using 60 ul Lipofectamine (per 15-cm
dish). The transiently transfected cells are grown in the dish for
24 hours (75% confluency) with a media change and removed with 10
ml/dish of Hepes-EDTA buffer (20 mM Hepes+10 mM EDTA, pH 7.4). The
cells are then centrifuged in a Beckman Coulter centrifuge for 20
minutes, 17,000 rpm (JA-25.50 rotor). Subsequently, the pellet is
resuspended in 20 mM Hepes+1 mM EDTA, pH 7.4 and homogenized with a
50-ml Dounce homogenizer and again centrifuged. After removing the
supernatant, the pellets are stored at -80.degree. C., until used
in binding assay. When used in the assay, membranes are thawed on
ice for 20 minutes and then 10 mL of incubation buffer (20 mM
Hepes, 1 mM MgCl.sub.2, 100 mM NaCl, pH 7.4) added. The membranes
are then vortexed to resuspend the crude membrane pellet and
homogenized with a Brinkmann PT-3100 Polytron homogenizer for 15
seconds at setting 6. The concentration of membrane protein is
determined using the BRL Bradford protein assay.
[0714] B. Binding Assay
[0715] For total binding, a total volume of 50 ul of appropriately
diluted membranes (diluted in assay buffer containing 50 mM Tris
HCl (pH 7.4), 10 mM MgCl.sub.2, and 1 mM EDTA; 5-50 ug protein) is
added to 96-well polyproylene microtiter plates followed by
addition of 100 ul of assay buffer and 50 ul of a radiolabeled
known ligand. For nonspecific binding, 50 ul of assay buffer is
added instead of 100 ul and an additional 50 ul of 10 uM said known
ligand which is not radiolabeled is added before 50 ul of said
radiolabeled known ligand is added. Plates are then incubated at
room temperature for 60-120 minutes. The binding reaction is
terminated by filtering assay plates through a Microplate Devices
GF/C Unifilter filtration plate with a Brandell 96-well plate
harvestor followed by washing with cold 50 mM Tris HCl, pH 7.4
containing 0.9% NaCl. Then, the bottom of the filtration plate are
sealed, 50 ul of Optiphase Supermix is added to each well, the top
of the plates are sealed, and plates are counted in a Trilux
MicroBeta scintillation counter. For determining whether less of
the complex between said radiolabeled known ligand and said
receptor is formed in the presence of a test compound, instead of
adding 100 ul of assay buffer, 100 ul of appropriately diluted said
test compound is added to appropriate wells followed by addition of
50 ul of said radiolabled known ligand.
[0716] A level of specific binding of the radiolabled known ligand
in the presence of the test compound less than a level of specific
binding of the radiolabeled known ligand in the absence of the test
compound is indicative of less of the complex between said
radiolabeled known ligand and said receptor being formed in the
presence of the test compound than in the absence of the test
compound.
Example 10
Expression of GPR119 in Gut
[0717] The expression of GPR119 mRNA in various tissues was
determined using RNase Protection Assay (RPA).
[0718] Mouse tissue RNA was obtained commercially (Clontech). A 255
bp protected fragment of mouse GPR119 was cloned into pCRII-TOPO
cloning vector (Invitrogen). The sequence of the 255 bp protected
fragment was as follows (nucleotides that comprise mouse GPR119
coding region are underlined):
TABLE-US-00006 (SEQ ID NO: 5)
5'-CTGGCCTGCCAGTAATGGCCAGAACGGTGCTGTGACTCTGAGCCTAT
AGCACATCTAATCCTGTCCCATGAGAATCTGAGCTCGCCATCCAGCATGC
CTTTGTAAGTGGAAGTGCTGCTACCTCACCATGGAGTCATCCTTCTCATT
TGGAGTGATCCTTGCTGTCCTAACCATCCTCATCATTGCTGTTAATGCAC
TGGTAGTTGTGGCTATGCTGCTATCAATCTACAAGAATGATGGTGTTGGC CTTTGCTT-3'.
[0719] The full length probe size was 356 bp. The plasmid was
linearized with BamHI and gel purified using the Sephaglass
Bandprep Kit (Amersham). After gel purification of the fragment, a
riboprobe was made by in vitro transcription with using T7 RNA
polymerase (Ambion Maxiscript Kit). The probe was purified by
acrylamide gel electrophoresis and hybridized with 20 ug of total
RNA at 45.degree. C. overnight. The hybrids were digested with
RNAse the following day and run on a 5% acrylamide gel to detect
the results (Ambion, RPA III kit). All the procedures for in vitro
transcription and RPA reactions were following the manufacturer's
instructions.
[0720] The highest level of GPR119 expression was found in
pancreatic islets, although GPR119 was also found to be expressed
in colon and to lesser extent in small intestine. See FIG. 3.
Example 11
Expression of GPR119 in GLUTag Enteroendocrine Cell Line
[0721] Northern blot analysis was used to determine the level of
GPR119 mRNA expression in GLUTag (Fla subline; see Example 12,
infra), HIT-T15 (a hamster pancreatic beta cell line; ATCC No.
CRL-1777), and NCI-H716 (a human endocrine cell line; ATCC No.
CRL-251). GLUTag is a mouse enteroendocrine cell line that secretes
GLP-1 [Brubaker et al., Endocrinology (1998) 139:4108-4114].
[0722] RNA was extracted from tissue cultured cells by using RNA
Bee (Tel-Test). Ten (10) .mu.g of total RNA was separated on a 0.8%
agarose gel electrophoresis, and blotted onto nylon membrane
(Amersham). The RNA blot was hybridized with a .sup.32P-labeled
mouse GPR119 cDNA probe (see, e.g., mouse GPR119, GenBank.RTM.
Accession No. AY288423), followed by reprobing with a
.sup.32P-labeled cDNA probe for mouse preproglucagon mRNA as a
control. The hybridization signals were visualized by
autoradiography.
[0723] GLUTag cells (Fla subline; see Example 12, infra) were found
to express GPR119 and preproglucagon. See FIG. 4.
Example 12
GPR119 Agonist Elevates Intracellular Camp in GLUTag Cells
[0724] GLUTag is a mouse enteroendocrine cell line that secretes
GLP-1 [Brubaker et al., Endocrinology (1998) 139:4108-4114]. The
effect of GPR119 agonist on the level of intracellular cAMP in
GLUTag (Fla subline) enteroendocrine cells was determined. The Fro
subline of GLUTag was used as a negative control. Northern blot
analysis (inset) using mouse GPR119 cDNA as probe (see, e.g., mouse
GPR119, GenBank.RTM. Accession No. AY288423) indicated that the Fla
subline of GLUTag expresses GPR119, whereas the Flo subline of
GLUTag does not detectably express GPR119.
[0725] GluTag (GLUTag-Fla and GLUTag-Fro) cells were plated at -85%
confluency in 15-cm tissue culture plate with regular growth
medium. On the next day, cells were scraped off with cold Scraping
Buffer (20 mM HEPES, 10 mM EDTA, pH7.4) and spinned down at 1000
rpm for 17 mins at 4.degree. C. Cell pellets were washed with cold
Membrane Wash Buffer (20 mM HEPES, 0.1 mM EDTA, pH7.4) and spun
again as above. The membrane pellets were resuspended in cold
Binding Buffer (20 mM HEPES, 1 mM MgCl.sub.2, 100 mMNaCl, pH7.4)
and homogenized twice using a Polytron.TM. homogenizer (Model No.
PT3100; Brinkman) at 7000 rpm for 10 seconds. Protein concentration
was determined by Bradford Assay. Cell membranes were diluted to a
protein concentration of 0.2 mg/ml in Binding Buffer. (The final
assay concentration was 10 ug/well).
[0726] The cyclase assay was done with a Flash Plate.TM. Adenylyl
Cyclase kit (New England Nuclear; Cat. No. SMP004A). The Flash
Plate wells contain a scintillant coating which also contains a
specific antibody recognizing cAMP. The cAMP generated in the wells
can be quantitated by a direct competition for binding of
radioactive cAMP tracer to the cAMP antibody.
[0727] Details of the cyclase assay as it was carried out are
described here. cAMP standards and Detection Buffer (comprising 1
.mu.Ci of tracer [125I]cAMP (50 .mu.l) to 11 ml Detection Buffer)
were prepared and maintained in accordance with the manufacturer's
instructions. GPR119 agonist AR231453 was freshly prepared and
serially diluted in 50 ul freshly prepared 2.times. Reconstitution
Buffer (20 mM Phosphocreatine, 20 units/50 ul Creatine
Phosphokinase, 20 uM GTP, 0.2 mM ATP, 1 mM IBMX). Eight doses of
GPR119 agonist, from 10 uM down to 1.27 nM, were tested. The assay
was carried out in a 96-well Flash Plate. GPR1119 agonist and cAMP
standards were first added to appropriate wells. The cell membranes
were then added to the wells, and the plate was incubated for 60
minutes at room temperature. 100 ul of Detection Mix containing
tracer .sup.3H-cAMP was then added to each well. Plates were
incubated for an additional two hours, after which the samples were
counted in a Wallac MicroBeta scintillation counter. Values of
cAMP/well were then extrapolated from a standard cAMP curve which
was contained within each assay plate.
[0728] GPR119 agonist was found to elevate the level of
intracellular cAMP in GLUTag-Fla cells which express GPR119, but
not in GLUTag-Fro cells which do not express GPR119. GPR119 agonist
was found to elevate cAMP in GLUTag cells with an EC50 of about 4.3
nM. See FIG. 5.
Example 13
GPR119 Agonist Stimulates GLP-1 Secretion in GLUTag Cells
[0729] GLUTag-Fla cells (see Example 12, supra) were plated in
24-well plates on day one in complete culture medium (DMEM/10%
FBS). On day two the culture medium was replaced with a low glucose
medium (DMEM/3 mM Glucose/10% FBS). On day three cells were washed
twice with 1XPBS. The washed GLUTag-Fla cells were stimulated with
GPR119 agonist (AR231453) at various concentrations or with
forskolin (1 uM) as a positive control in serum free DMEM with 15
mM glucose for one hour at 37.degree. C. and 5% CO2 in a tissue
culture incubator. The supernatants were then collected and
clarified by centrifugation at 500 g and 4.degree. C. for 5
minutes. GLP-1 released into the supernatant was determined by
ELISA using reagents purchased from LINCO Research Laboratory
[Glucagon-Like Peptide-1 (Active) ELISA Kit. Cat. #EGLP-35K].
[0730] GLUTag-Fla cells were found to secrete GLP-1 when stimulated
with GPR119 agonist. See FIG. 6.
Example 14
Effect of GPR119 Agonist AR244061 and DPP-IV Inhibitors in Lowering
Blood Glucose Level in Oral Glucose Tolerance Test (oGTT) in
Mice
[0731] Oral glucose tolerance test (oGTT) in 7-8 week old C57BL/6J
mice was carried out as described here. Overnight fasted mice (n=8
mice per treatment group) were administered via oral gavage with
vehicle, a GPR119 agonist (AR244061, different to that used in
Example 1), a DPP-IV inhibitor (MK-0431, LAF237 or FE107542), or a
combination of the GPR119 agonist and the DPP-IV inhibitor. GPR119
agonist AR244061 was administered at 10 mpk or 30 mpk (milligram
compound per kilogram of body weight). DPP-IV inhibitors MK-0431
and LAF237 were administered at 1 mpk, and FE107542 was
administered at 10 mpk. One hour after compound dosing, a glucose
bolus (2 gram/kg) was delivered per orally, and tail blood samples
were collected to measure blood glucose at 0, 30, 60 and 120
minutes. Results obtained for MK-0431 are shown in FIG. 7; results
obtained for LAF237 are shown in FIG. 8; and results obtained for
FE107542 are shown in FIG. 9. For each treatment group, glycemic
excursion curve was graphed and is presented with blood glucose
concentration given in mean values +/-standard error of the mean
(SEM). Area Under Curve (AUC) of the glycemic excursion was
calculated and reported as AUC (% of vehicle control).
[0732] From inspection of FIG. 7, FIG. 8 and FIG. 9, it is apparent
that whereas at the concentrations used both the GPR119 agonist (a
GPR119 agonist different to that used in Example 1) and the DPP-IV
inhibitor alone (for each of three different DPP-IV inhibitors)
provided measurable glycemic control, combination of the GPR119
agonist and the DPP-IV inhibitor provided a dose-dependent level of
glycemic control over that provided by the GPR119 agonist or DPP-IV
inhibitor alone.
[0733] While the foregoing specification teaches the principles of
the present invention, with examples provided for the purpose of
illustration, it will be understood that the practice of the
invention encompasses all of the usual variations, adaptions, or
modifications, as come within the scope of the following claims and
its equivalents.
Sequence CWU 1
1
511008DNAHomo sapien 1atggaatcat ctttctcatt tggagtgatc cttgctgtcc
tggcctccct catcattgct 60actaacacac tagtggctgt ggctgtgctg ctgttgatcc
acaagaatga tggtgtcagt 120ctctgcttca ccttgaatct ggctgtggct
gacaccttga ttggtgtggc catctctggc 180ctactcacag accagctctc
cagcccttct cggcccacac agaagaccct gtgcagcctg 240cggatggcat
ttgtcacttc ctccgcagct gcctctgtcc tcacggtcat gctgatcacc
300tttgacaggt accttgccat caagcagccc ttccgctact tgaagatcat
gagtgggttc 360gtggccgggg cctgcattgc cgggctgtgg ttagtgtctt
acctcattgg cttcctccca 420ctcggaatcc ccatgttcca gcagactgcc
tacaaagggc agtgcagctt ctttgctgta 480tttcaccctc acttcgtgct
gaccctctcc tgcgttggct tcttcccagc catgctcctc 540tttgtcttct
tctactgcga catgctcaag attgcctcca tgcacagcca gcagattcga
600aagatggaac atgcaggagc catggctgga ggttatcgat ccccacggac
tcccagcgac 660ttcaaagctc tccgtactgt gtctgttctc attgggagct
ttgctctatc ctggaccccc 720ttccttatca ctggcattgt gcaggtggcc
tgccaggagt gtcacctcta cctagtgctg 780gaacggtacc tgtggctgct
cggcgtgggc aactccctgc tcaacccact catctatgcc 840tattggcaga
aggaggtgcg actgcagctc taccacatgg ccctaggagt gaagaaggtg
900ctcacctcat tcctcctctt tctctcggcc aggaattgtg gcccagagag
gcccagggaa 960agttcctgtc acatcgtcac tatctccagc tcagagtttg atggctaa
10082335PRTHomo sapien 2Met Glu Ser Ser Phe Ser Phe Gly Val Ile Leu
Ala Val Leu Ala Ser1 5 10 15Leu Ile Ile Ala Thr Asn Thr Leu Val Ala
Val Ala Val Leu Leu Leu 20 25 30Ile His Lys Asn Asp Gly Val Ser Leu
Cys Phe Thr Leu Asn Leu Ala 35 40 45Val Ala Asp Thr Leu Ile Gly Val
Ala Ile Ser Gly Leu Leu Thr Asp 50 55 60Gln Leu Ser Ser Pro Ser Arg
Pro Thr Gln Lys Thr Leu Cys Ser Leu65 70 75 80Arg Met Ala Phe Val
Thr Ser Ser Ala Ala Ala Ser Val Leu Thr Val 85 90 95Met Leu Ile Thr
Phe Asp Arg Tyr Leu Ala Ile Lys Gln Pro Phe Arg 100 105 110Tyr Leu
Lys Ile Met Ser Gly Phe Val Ala Gly Ala Cys Ile Ala Gly 115 120
125Leu Trp Leu Val Ser Tyr Leu Ile Gly Phe Leu Pro Leu Gly Ile Pro
130 135 140Met Phe Gln Gln Thr Ala Tyr Lys Gly Gln Cys Ser Phe Phe
Ala Val145 150 155 160Phe His Pro His Phe Val Leu Thr Leu Ser Cys
Val Gly Phe Phe Pro 165 170 175Ala Met Leu Leu Phe Val Phe Phe Tyr
Cys Asp Met Leu Lys Ile Ala 180 185 190Ser Met His Ser Gln Gln Ile
Arg Lys Met Glu His Ala Gly Ala Met 195 200 205Ala Gly Gly Tyr Arg
Ser Pro Arg Thr Pro Ser Asp Phe Lys Ala Leu 210 215 220Arg Thr Val
Ser Val Leu Ile Gly Ser Phe Ala Leu Ser Trp Thr Pro225 230 235
240Phe Leu Ile Thr Gly Ile Val Gln Val Ala Cys Gln Glu Cys His Leu
245 250 255Tyr Leu Val Leu Glu Arg Tyr Leu Trp Leu Leu Gly Val Gly
Asn Ser 260 265 270Leu Leu Asn Pro Leu Ile Tyr Ala Tyr Trp Gln Lys
Glu Val Arg Leu 275 280 285Gln Leu Tyr His Met Ala Leu Gly Val Lys
Lys Val Leu Thr Ser Phe 290 295 300Leu Leu Phe Leu Ser Ala Arg Asn
Cys Gly Pro Glu Arg Pro Arg Glu305 310 315 320Ser Ser Cys His Ile
Val Thr Ile Ser Ser Ser Glu Phe Asp Gly 325 330
335322DNAArtificialPrimer 3gtcctgccac ttcgagacat gg
22423DNAArtificialPrimer 4gaaacttctc tgcccttacc gtc
235255DNAArtificialProbe 5ctggcctgcc agtaatggcc agaacggtgc
tgtgactctg agcctatagc acatctaatc 60ctgtcccatg agaatctgag ctcgccatcc
agcatgcctt tgtaagtgga agtgctgcta 120cctcaccatg gagtcatcct
tctcatttgg agtgatcctt gctgtcctaa ccatcctcat 180cattgctgtt
aatgcactgg tagttgtggc tatgctgcta tcaatctaca agaatgatgg
240tgttggcctt tgctt 255
* * * * *