U.S. patent application number 11/989959 was filed with the patent office on 2010-11-25 for apoptosis promoter, cell proliferation inhibitor, prophylactic/therapeutic agent for cancer, screening method for the promoter, inhibitor or agent.
Invention is credited to Noboru Konishi, Kazutake Tsujikawa, Hiroshi Yamamoto.
Application Number | 20100297145 11/989959 |
Document ID | / |
Family ID | 37708857 |
Filed Date | 2010-11-25 |
United States Patent
Application |
20100297145 |
Kind Code |
A1 |
Tsujikawa; Kazutake ; et
al. |
November 25, 2010 |
Apoptosis promoter, cell proliferation inhibitor,
prophylactic/therapeutic agent for cancer, screening method for the
promoter, inhibitor or agent
Abstract
Disclosed is an apoptosis promoter, cell proliferation
inhibitor, prophylactic/therapeutic agent for cancer or the like
which comprises a compound capable of inhibit the expression or
function of PCA-1 as an active ingredient. Also disclosed is a
method for screening of a compound for use in the promotion of
apoptosis, the inhibition of cell proliferation or the
prevention/treatment of cancer, which comprises selecting a
compound capable of inhibit the expression or function of PCA-1, or
the like.
Inventors: |
Tsujikawa; Kazutake; (
Osaka, JP) ; Yamamoto; Hiroshi; ( Osaka, JP) ;
Konishi; Noboru; (Nara, JP) |
Correspondence
Address: |
WENDEROTH, LIND & PONACK, L.L.P.
1030 15th Street, N.W.,, Suite 400 East
Washington
DC
20005-1503
US
|
Family ID: |
37708857 |
Appl. No.: |
11/989959 |
Filed: |
August 4, 2006 |
PCT Filed: |
August 4, 2006 |
PCT NO: |
PCT/JP2006/315896 |
371 Date: |
March 13, 2008 |
Current U.S.
Class: |
424/172.1 ;
435/29; 435/375; 435/7.21; 514/44R |
Current CPC
Class: |
G01N 2510/00 20130101;
G01N 2333/916 20130101; A61K 48/00 20130101; A61K 38/00 20130101;
A61P 43/00 20180101; A61P 35/00 20180101; G01N 33/5023
20130101 |
Class at
Publication: |
424/172.1 ;
435/375; 514/44.R; 435/29; 435/7.21 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C12N 5/07 20100101 C12N005/07; A61K 31/7088 20060101
A61K031/7088; C12Q 1/02 20060101 C12Q001/02; A61P 35/00 20060101
A61P035/00; G01N 33/53 20060101 G01N033/53 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 4, 2005 |
JP |
227274/2005 |
Claims
1. A method of promoting apoptosis, comprising administering an
effective amount of a compound that suppresses the expression or
function of PCA-1.
2. The method of claim 1, wherein the compound that suppresses the
expression or function of PCA-1 is (i) or (ii) below: (i) a nucleic
acid having a nucleotide sequence or a portion thereof
complementary to the nucleotide sequence that encodes the PCA-1
polypeptide; (ii) an antibody that specifically recognizes the
PCA-1 polypeptide, a dominant negative mutant of the PCA-1
polypeptide, or a nucleic acid having the nucleotide sequence that
encodes the same.
3. The method of claim 1, wherein the apoptosis is caspase 8/FADD
dependent or induced by paclitaxel.
4. A method of inhibiting cell growth, comprising administering an
effective amount of a compound that suppresses the expression or
function of PCA-1.
5. The method of claim 4, wherein the compound that suppresses the
expression or function of PCA-1 is (i) or (ii) below: (i) a nucleic
acid having a nucleotide sequence or a portion thereof
complementary to the nucleotide sequence that encodes the PCA-1
polypeptide; (ii) an antibody that specifically recognizes the
PCA-1 polypeptide, a dominant negative mutant of the PCA-1
polypeptide, or a nucleic acid having the nucleotide sequence that
encodes the same.
6. The method of claim 4, wherein the cell growth is MAP kinase
signaling dependent.
7. A method of preventing or treating cancer comprising
administering an effective amount of a compound that suppresses the
expression or function of PCA-1.
8. The method of claim 7, wherein the compound that suppresses the
expression or function of PCA-1 is (i) or (ii) below: (i) a nucleic
acid having a nucleotide sequence or a portion thereof
complementary to the nucleotide sequence that encodes the PCA-1
polypeptide; (ii) an antibody that specifically recognizes the
PCA-1 polypeptide, a dominant negative mutant of the PCA-1
polypeptide, or a nucleic acid having the nucleotide sequence that
encodes the same.
9. The method of claim 7, wherein the cancer is prostate
cancer.
10. A screening method for a compound for promoting apoptosis,
comprising selecting a compound capable of suppressing the
expression or function of PCA-1.
11. The method of claim 10, wherein the apoptosis is caspase 8/FADD
dependent or induced by paclitaxel.
12. The method of claim 10, wherein a function of PCA-1 is selected
from the group consisting of (i) to (iii) below: (i) a function to
inhibit the ubiquitination of FLIP; (ii) a function to increase the
FLIP-Raf-1 interaction; (iii) a function to enhance MAP kinase
signaling.
13. A screening method for a compound for inhibiting cell growth,
comprising selecting a compound capable of suppressing the
expression or function of PCA-1.
14. The method of claim 13, wherein the cell growth is MAP kinase
signaling dependent.
15. The method of claim 13, wherein a function of PCA-1 is selected
from the group consisting of (i) to (iv) below: (i) a function to
inhibit the ubiquitination of FLIP; (ii) a function to increase the
FLIP-Raf-1 interaction; (iii) a function to enhance MAP kinase
signaling; (iv) a function to increase cyclin D expression.
16. A screening method for a compound for preventing or treating
cancer, comprising selecting a compound capable of suppressing the
expression or function of PCA-1.
17. The method of claim 16, wherein the cancer is prostate
cancer.
18. The method of claim 16, wherein a function of PCA-1 is selected
from the group consisting of (i) to (iv) below: (i) a function to
inhibit the ubiquitination of FLIP; (ii) a function to increase the
FLIP-Raf-1 interaction; (iii) a function to enhance MAP kinase
signaling; (iv) a function to increase cyclin D expression.
19. A screening method for a compound for promoting the
ubiquitination of FLIP, comprising the following steps: (1) a step
for treating PCA-1-expressing cells with a test compound in the
presence of a proteasome inhibitor; (2) a step for evaluating the
ubiquitination of FLIP in said cells.
20. A screening method for a compound for the promoting
paclitaxel-induced apoptosis, comprising the following steps: (1) a
step for treating PCA-1-expressing cells with paclitaxel in the
presence of a test compound; (2) a step for evaluating the degree
of the apoptosis of said cells.
21. A screening method for a compound for promoting caspase
8/FADD-dependent apoptosis, comprising the following steps: (1) a
step for treating PCA-1-expressing cells with a caspase
8/FADD-dependent apoptosis inducer in the presence of a test
compound; (2) a step for evaluating the degree of the apoptosis of
said cells.
22. The method described in claim 19, which is a screening method
for a compound for preventing/treating cancer.
23. The method of claim 22, wherein the cancer is prostate
cancer.
24-29. (canceled)
Description
TECHNICAL FIELD
[0001] The present invention relates to an apoptosis promoting
agent, a cell growth inhibitor, or a prophylactic/therapeutic agent
for cancer, comprising a compound that suppresses the expression or
function of PCA-1 as an active ingredient. The present invention
also relates to a screening method for a compound for promoting
apoptosis, a compound for inhibiting cell growth, or a compound for
preventing/treating cancer, comprising selecting a compound capable
of suppressing the expression or function of PCA-1.
BACKGROUND ART
[0002] Prostate cancer is a malignant tumor ranking high among male
cancers in terms of morbidity and mortality in Europe and US. In
Japan, the morbidity and mortality of prostate cancer have recently
been rising rapidly with the westernization of dietary life and
general population aging.
[0003] In order to search for a target molecule for the treatment
of prostate cancer, the present inventors histopathologically
divided prostate tissue isolated from a prostate cancer patient
into a tumor portion and a non-tumor portion, and analyzed genes
showing differential expression between the non-tumor portion and
the tumor portion. As a result, the present inventors succeeded in
cloning a gene called PCA-1 (also referred to as human AlkB
homologue 3 (hABH3)) as a gene expressed at higher levels
specifically in the tumor portion than in the non-tumor portion
(Proceedings of the 123rd Annual Meeting of the Pharmaceutical
Society of Japan No. 4, p. 15, 2003). Recently, PCA-1 was
identified as an enzyme for repair of DNA and RNA alkylation
damage, and was suggested to be relevant to cancer prophylaxis
(Nature, vol. 421, p 859-863, 2003/Proc. Natl. Acad. Sci. USA, vol.
99, No. 26, pp. 16660-16665, 2002). The present inventors found
that the survival rate for a prostate cancer cell line treated with
the alkylating agent methyl methanesulfonate increased with the
introduction of a PCA-1 expression vector (Program and Proceedings
of the 26th Annual Meeting of the Molecular Biology Society of
Japan, p. 525, 2003).
[0004] However, the biological functions of PCA-1 in prostate
cancer cell are unclear. Hence, there is a demand for elucidating
the biological functions of PCA-1 in prostate cancer cell, and
developing a prophylactic/therapeutic drug for prostate cancer
based thereon.
[0005] It is an object of the present invention to elucidate the
biological functions of PCA-1 in prostate cancer cells, and to
provide a cancer prophylactic/therapeutic drug, a screening method
therefor and the like based on the function.
DISCLOSURE OF THE INVENTION
[0006] With the aim of accomplishing the above-described objects,
the present inventors diligently analyzed the functions of PCA-1 on
the growth and anticancer agent susceptibility of prostate cancer
cells. As a result, when a prostate cancer cell line was allowed to
highly express PCA-1, an increase in the expression of FLICE-like
inhibitory protein (FLIP) and FLIP-dependent promotion of the
Raf-1/extracellular stress-regulated kinase (ERK) signal were
confirmed; the growth potential of cancer cells via growth factors
such as EGF was significantly enhanced. PCA-1 was also found to
inhibit the tumor necrosis factor-related apoptosis-inducing ligand
(TRAIL) via FLIP, and to inhibit paclitaxel-induced apoptosis via
the Raf-1/ERK/signal. Meanwhile, because the same phenomenon was
not observed when the expression of endogenous PCA-1 was knocked
down with siRNA, even when FLIP was highly expressed, it was
thought that PCA-1 is essential for the functioning of the
FLIP/Raf-1/ERK signal. From these findings, the present inventors
found that PCA-1 plays an important role as a factor for the
mechanism for the acquirement of anticancer-agent resistance and
cell growth in prostate cancer cells, and that by suppressing the
expression or function of PCA-1, it is possible to inhibit
anticancer-agent resistance, to suppress cell growth, and to
prevent/treat prostate cancer, and developed the present invention.
Accordingly, the present invention relates to the following:
[1] An apoptosis promoting agent comprising a compound that
suppresses the expression or function of PCA-1 as an active
ingredient. [2] The agent described in [1] above, wherein the
compound that suppresses the expression or function of PCA-1 is (i)
or (ii) is below: (i) a nucleic acid having a nucleotide sequence
or a portion thereof complementary to the nucleotide sequence that
encodes the PCA-1 polypeptide; (ii) an antibody that specifically
recognizes the PCA-1 polypeptide, a dominant negative mutant of the
PCA-1 polypeptide, or a nucleic acid having the nucleotide sequence
that encodes the same. [3] The agent described in [1] above,
wherein the apoptosis is caspase 8/FADD dependent or induced by
paclitaxel. [4] A cell growth inhibitor comprising a compound that
suppresses the expression or function of PCA-1 as an active
ingredient. [5] The agent described in [4] above, wherein the
compound that suppresses the expression or function of PCA-1 is (i)
or (ii) below: (i) a nucleic acid having a nucleotide sequence or a
portion thereof complementary to the nucleotide sequence that
encodes the PCA-1 polypeptide; (ii) an antibody that specifically
recognizes the PCA-1 polypeptide, a dominant negative mutant of the
PCA-1 polypeptide, or a nucleic acid having the nucleotide sequence
that encodes the same. [6] The agent described in [4] above,
wherein the cell growth is MAP kinase signaling dependent. [7] A
prophylactic/therapeutic agent for a cancer, comprising a compound
that suppresses the expression or function of PCA-1 as an active
ingredient. [8] The agent described in [7] above, wherein the
compound that suppresses the expression or function of PCA-1 is (i)
or (ii) below: (i) a nucleic acid having a nucleotide sequence or a
portion thereof complementary to the nucleotide sequence that
encodes the PCA-1 polypeptide; (ii) an antibody that specifically
recognizes the PCA-1 polypeptide, a dominant negative mutant of the
PCA-1 polypeptide, or a nucleic acid having the nucleotide sequence
that encodes the same. [9] The agent described in [7] above,
wherein the cancer is prostate cancer. [10] A screening method for
a compound for promoting apoptosis, comprising selecting a compound
capable of suppressing the expression or function of PCA-1. [11]
The method described in [10] above, wherein the apoptosis is
caspase 8/FADD dependent or induced by paclitaxel. [12] The method
described in [10] above, wherein a function of PCA-1 is selected
from the group consisting of (i) to (iii) below: (i) a function to
inhibit the ubiquitination of FLIP; (ii) a function to increase the
FLIP-Raf-1 interaction; (iii) a function to enhance MAP kinase
signaling. [13] A screening method for a compound for inhibiting
cell growth, comprising selecting a compound capable of suppressing
the expression or function of PCA-1. [14] The method described in
[13] above, wherein the cell growth is MAP kinase signaling
dependent. [15] The method described in [13] above, wherein a
function of PCA-1 is selected from the group consisting of (i) to
(iv) below: (i) a function to inhibit the ubiquitination of FLIP;
(ii) a function to increase the FLIP-Raf-1 interaction; (iii) a
function to enhance MAP kinase signaling; (iv) a function to
increase cyclin D expression. [16] A screening method for a
compound for preventing or treating cancer, comprising selecting a
compound capable of suppressing the expression or function of
PCA-1. [17] The method described in [16] above, wherein the cancer
is prostate cancer. [18] The method described in [16] above,
wherein a function of PCA-1 is selected from the group consisting
of (i) to (iv) below: (i) a function to inhibit the ubiquitination
of FLIP; (ii) a function to increase the FLIP-Raf-1 interaction;
(iii) a function to enhance MAP kinase signaling; (iv) a function
to increase cyclin D expression. [19] A screening method for a
compound for promoting the ubiquitination of FLIP, comprising the
following steps: (1) a step for treating PCA-1-expressing cells
with a test compound in the presence of a proteasome inhibitor; (2)
a step for evaluating the ubiquitination of FLIP in the
aforementioned cells. [20] A screening method for a compound for
promoting paclitaxel-induced apoptosis, comprising the following
steps: (1) a step for treating PCA-1-expressing cells with
paclitaxel in the presence of a test compound; (2) a step for
evaluating the degree of the apoptosis of the aforementioned cells.
[21] A screening method for a compound for promoting caspase
8/FADD-dependent apoptosis, comprising the following steps: (1) a
step for treating PCA-1-expressing cells with a caspase
8/FADD-dependent apoptosis inducer in the presence of a test
compound; (2) a step for evaluating the degree of the apoptosis of
the aforementioned cells. [22] The method described in one of [19]
to [21] above, which is a screening method for a compound for
preventing/treating cancer. [23] The method described in [22]
above, wherein the cancer is prostate cancer. [24] A method of
promoting apoptosis, comprising administering an effective amount
of a compound that suppresses the expression or function of PCA-1.
[25] A method of inhibiting cell growth, comprising administering
an effective amount of a compound that suppresses the expression or
function of PCA-1. [26] A method of preventing or treating cancer
comprising administering an effective amount of a compound that
suppresses the expression or function of PCA-1. [27] A use of a
compound that suppresses the expression or function of PCA-1 for
producing an apoptosis promoting agent. [28] A use of a compound
that suppresses the expression or function of PCA-1 for producing a
cell growth inhibitor. [29] A use of a compound that suppresses the
expression or function of PCA-1 for producing a
prophylactic/therapeutic agent for a cancer.
[0007] Because a compound that suppresses the expression or
function of PCA-1, which is an active ingredient of the agent of
the present invention, cancels the apoptosis inhibitory action and
cell growth enhancing action of PCA-1, and reduces the
anticancer-agent resistance and cell growth of cancer cells, the
compound is useful as an apoptosis promoting agent, a cell growth
inhibitor, and a prophylactic/therapeutic agent for cancer. By
selecting a compound capable of suppressing the expression or
function of PCA-1, a compound for promoting apoptosis, a compound
for inhibiting cell growth, and a compound for preventing or
treating cancer, having a novel action mechanism, can be screened
for.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] FIG. 1 shows the results of Western blotting showing
increased expression of PCA-1 protein in two clones (Clone 2, Clone
31) of a PCA-1-overexpressing cell line (DU145/PCA-1). HygB
indicates a control incorporating an empty vector.
[0009] FIG. 2 is a graph showing cell growth (BrdU uptake) in the
PCA-1-overexpressing cell line. White column: HygB, shaded column:
Clone 2, black column: Clone 31 (the same applies to FIGS. 3, 9,
and 11).
[0010] FIG. 3 is a graph showing the effect of an ERK inhibitor
(U0126) on the cell growth of the PCA-1-overexpressing cell line in
the presence of EGF.
[0011] FIG. 4 shows the results of Western blotting showing the
activation of EGF-induced ERK and the expression of Cyclin D1 in
the PCA-1-overexpressing cell line, and the effects of an ERK
inhibitor (U0126) thereon. pERK: phospho-ERK.
[0012] FIG. 5 shows the results of Western blotting showing
increased expression of FLIP protein in the PCA-1-overexpressing
cell line.
[0013] FIG. 6 shows the results of Western blotting showing the
inhibition of the ubiquitination of FLIP protein in the
PCA-1-overexpressing cell line. I.B.: immunoblotting, *:
ubiquitinated FLIP.
[0014] FIG. 7 shows the results of Western blotting showing
increased expression of FLIP protein in two clones (Clone 1, Clone
12) of an FLIP-overexpressing cell line (DU145/FLIP).
[0015] FIG. 8 shows the results of Western blotting showing the
FLIP-Raf-1 interaction in the FLIP-overexpressing cell line, and
the effect of PCA-1 siRNA thereon. I.P.: immunoprecipitation.
[0016] FIG. 9 shows the inhibition of paclitaxel-induced apoptosis
by PCA-1 (upper graph) and the induction of the pMEK1-Raf-1
interaction (lower panel).
[0017] FIG. 10 shows the actions of U0126 and PD98059 on the
paclitaxel-induced apoptosis inhibitory effect and ERK activating
effect of PCA-1.
[0018] FIG. 11 shows the inhibition of TRAIL-induced apoptosis by
PCA-1.
[0019] FIG. 12 schematically shows the effects of PCA-1 on cell
growth and apoptosis.
BEST MODE FOR CARRYING OUT THE INVENTION
1. An Agent Comprising a Compound that Suppresses the Expression or
Function of PCA-1 as an Active Ingredient
[0020] As shown in an Example below and the like, when PCA-1 is
highly expressed, paclitaxel- or TRAIL-induced apoptosis is
inhibited, cell growth via MAP kinase signaling such as by EGF is
accentuated, and anticancer-agent resistance is enhanced. From this
fact, a compound that suppresses the expression or function of
PCA-1 is understood to be capable of inhibiting the anticancer
agent resistance of cancer cells and preventing/treating cancer by
promoting apoptosis induced by paclitaxel, TRAIL and the like, and
inhibiting cell growth via MAP kinase signaling such as by EGF.
Therefore, an agent comprising a compound that suppresses the
expression or function of PCA-1 as an active ingredient is useful
in promoting apoptosis, inhibiting cell growth, and
preventing/treating cancer.
[0021] The expression of PCA-1 refers to a state wherein the
translation product of PCA-1 (i.e., polypeptide) is produced and
localized to the action site thereof in a functional manner.
[0022] A function of PCA-1 refers to a biological function
(activity) exhibited by the translation product of PCA-1. As shown
in an Example below, when PCA-1 is highly expressed, the
ubiquitination of FLIP is inhibited, the amount of FLIP polypeptide
expressed increases, the FLIP-Raf-1 interaction increases, MAP
kinase signaling is enhanced, and cyclin D1 expression increases.
Therefore, as examples of the function of PCA-1, a function to
inhibit the ubiquitination of FLIP (including a function to hence
increase the amount of FLIP polypeptide expressed), a function to
increase the FLIP-Raf-1 interaction, a function to enhance MAP
kinase signaling, a function to increase cyclin D1 expression and
the like can be mentioned. In addition, a function to repair DNA
and RNA alkylation damage (Nature, (UK), vol. 421, p 859-863, 2003)
and the like are also included in the functions of PCA-1.
[0023] Ubiquitination refers to the phenomenon in which many
ubiquitin units bind to protein in a chain form. A ubiquitinated
protein is recognized by proteasome and degraded. Therefore, if the
ubiquitination of FLIP is inhibited by PCA-1, the FLIP degradation
rate will decrease, resulting in an increase in the amount of FLIP
polypeptide expressed in the cells.
[0024] FLIP (FADD-like ICE inhibitory protein) is known to act as a
dominant negative molecule for caspase 8 (Yonehara S., Cell Struct.
Funct., 28(1), 1-2, 2003). That is, caspase 8 interacts with FADD
to induce caspase 8/FADD-dependent apoptosis such as FASL-induced
(via FAS) apoptosis, TRAIL-induced (via DR4 or DR5) apoptosis, and
TNF-.alpha.-induced (via TNFR) apoptosis, whereas FLIP suppresses
caspase 8/FADD-dependent apoptosis by binding to FADD in place of
caspase 8. FLIP is known to interact with Raf-1 to activate Raf-1
(Kataoka T., et al, Curr. Biol., 10(11), 640-648, 2000). Therefore,
as the amount of FLIP polypeptide expressed in the cells increases,
caspase 8/FADD-dependent apoptosis is suppressed, the FLIP-Raf-1
interaction increases, and Raf-1 is activated.
[0025] The activated Raf-1 activates the phosphorylation cascade of
Raf-1/MEK1/ERK (MAP kinase signaling). Upon activation of MAP
kinase signaling, various transcription factors that are present
downstream thereof are directly or indirectly activated, the
expression of a variety of genes involved in cell growth,
differentiation and the like (cyclin D1 and the like) is induced,
and cell growth and differentiation are induced.
[0026] In the agent of the present invention, the compound that
suppresses the expression of PCA-1 may act in any one of the stages
of PCA-1 transcription, post-transcriptional regulation,
translation, post-translational modification, localization, protein
folding and the like.
[0027] A compound that suppresses the function of PCA-1 refers to a
compound having an action to suppress one of the above-described
functions of PCA-1 (for example, a function to inhibit the
ubiquitination of FLIP, a function to increase the FLIP-Raf-1
interaction, a function to enhance MAP kinase signaling, a function
to increase cyclin D1 expression and the like) by binding to the
PCA-1 polypeptide, by modifying the polypeptide, or by reducing the
stability of the polypeptide, and the like.
[0028] As examples of the compound that suppresses the expression
or function of PCA-1, (i) and (ii) below and the like can be
mentioned.
(i) A nucleic acid having a nucleotide sequence or a portion
thereof complementary to the nucleotide sequence that encodes the
PCA-1 polypeptide; (ii) an antibody that specifically recognizes
the PCA-1 polypeptide, a dominant negative mutant of the PCA-1
polypeptide, or a nucleic acid having the nucleotide sequence that
encodes the same.
[0029] In the present invention, the PCA-1 polypeptide can be the
PCA-1 polypeptide of an optionally chosen mammal. As the mammal,
human and non-human mammals can be mentioned. As examples of
non-human mammals, laboratory animals such as mice, rats, hamsters,
guinea pigs, and other rodents, as well as rabbits, domestic
animals such as swine, bovine, goat, horses, and sheep, companion
animals such as dogs and cats, and primates such as monkeys,
orangutans, and chimpanzees can be mentioned. The mammal is
preferably a human.
[0030] The PCA-1 polypeptide of a mammal is preferably a wild-type
polypeptide; for example, a human wild-type PCA-1 polypeptide (for
example, a polypeptide consisting of the amino acid sequence shown
by SEQ ID NO:2) and the like can be mentioned.
[0031] Polypeptides consisting of substantially the same amino acid
sequence as a wild-type PCA-1 polypeptide are also included in the
"PCA-1 polypeptide". As "a protein having substantially the same
amino acid sequence", polypeptides consisting of an amino acid
sequence having a homology of about 90% or more, preferably 95% or
more, more preferably about 98% or more, to the amino acid sequence
of the wild-type PCA-1 polypeptide, and having substantially the
same quality of function as the wild-type PCA-1 polypeptide and the
like can be mentioned.
[0032] Here, "a homology" means the proportion (%) of identical
amino acid residues and analogous amino acid residues to all
overlapping amino acid residues in the optimal alignment where two
amino acid sequences are aligned using a mathematical algorithm
known in the technical field (preferably, the algorithm is such
that a gap can be introduced into one or both of the sequences for
the optimal alignment). "An analogous amino acid" means an amino
acid having similar physiochemical properties; examples thereof
include amino acids classified under the same group, such as
aromatic amino acids (Phe, Trp, Tyr), aliphatic amino acids (Ala,
Leu, Ile, Val), polar amino acids (Gln, Asn), basic amino acids
(Lys, Arg, H is), acidic amino acids (Glu, Asp), amino acids having
a hydroxyl group (Ser, Thr) and amino acids having a small
side-chain (Gly, Ala, Ser, Thr, Met). Substitution by such
analogous amino acids is expected not to change the phenotype of a
polypeptide (i.e., conservative amino acid substitution). Specific
examples of the conservative amino acid substitution are well known
in the technical field and are described in various documents (see,
for example, Bowie et al., Science, 247:1306-1310 (1990)).
[0033] Algorithms to determine amino acid sequence homology
include, for example, but are not limited to, the algorithm
described in Karlin et al., Proc. Natl. Acad. Sci. USA,
90:5873-5877 (1993) [the algorithm is incorporated in the NBLAST
and XBLAST programs (version 2.0) (Altschul et al., Nucleic Acids
Res., 25:3389-3402 (1997))], the algorithm described in Needleman
et al., J. Mol. Biol., 48:444-453 (1970) [the algorithm is
incorporated in the GAP program in the GCG software package], the
algorithm described in Myers and Miller, CABIOS, 4:11-17 (1988)
[the algorithm is incorporated in the ALIGN program (version 2.0),
which is part of the CGC sequence alignment software package], the
algorithm described in Pearson et al., Proc. Natl. Acad. Sci. USA,
85:2444-2448 (1988) [the algorithm is incorporated in the FASTA
program in the GCG software package] and the like. Amino acid
sequence homology can be calculated as appropriate with the
above-described program using default parameters thereof. For
example, amino acid sequence homology can be calculated using the
homology calculation algorithm NCBI BLAST-2 (National Center for
Biotechnology Information Basic Local Alignment Search Tool) under
the following conditions (matrix=BLOSUM62; gap open=11; gap
extension=1; x_dropoff=50; expectancy=10; filtering=ON).
[0034] "Substantially the same quality of function" means that, for
example, the function of the PCA-1 polypeptide is qualitatively
equivalent to the function of the wild-type PCA-1 polypeptide.
Therefore, it is preferable that the function of the PCA-1
polypeptide be equivalent to the function of the wild-type PCA-1
polypeptide (for example, about 0.1 to 10 times, preferably about
0.5 to 2 times), but the quantitative factors, such as the extent
of activity and the molecular weight of the protein, may be
different. As mentioned herein, the function of the PCA-1
polypeptide includes the above-described functions (a function to
inhibit the ubiquitination of FLIP, a function to increase the
FLIP-Raf-1 interaction, a function to enhance MAP kinase signaling,
a function to increase cyclin D expression, a function to repair
DNA and RNA alkylation damage) and the like. The individual
functions can be evaluated by the methods described in the section
below (2. A screening method comprising selecting a compound
capable of suppressing the expression or function of PCA-1).
[0035] As the nucleotide sequence that encodes the PCA-1
polypeptide, the nucleotide sequences of cDNA, mRNA, initial
transcription product (immature mRNA), and chromosome DNA that
encode the PCA-1 polypeptide are included; more specifically, for
example, a nucleotide sequence of a cDNA that encodes the human
wild-type PCA-1 polypeptide (for example, SEQ ID NO:1), a
nucleotide sequence of a chromosome DNA that encodes the human
wild-type PCA-1 polypeptide (for example, GenBank accession number:
NT.sub.--009237) and the like can be mentioned.
[0036] A nucleic acid having a nucleotide sequence that is
complementary to the target region of the desired nucleic acid,
that is, a nucleic acid capable of hybridizing to the desired
nucleic acid under physiological conditions (for example,
intracellular and the like) can be said to be "antisense" against
the desired nucleic acid. As used herein, "complementary" refers to
having a complementarity between nucleotide sequences of about 70%
or more, preferably about 80% or more, more preferably about 90% or
more, still more preferably about 95% or more, most preferably
100%. Nucleotide sequence homology in the present description can
be calculated using the homology calculation algorithm NCBI BLAST
(National Center for Biotechnology Information Basic Local
Alignment Search Tool) under the following conditions
(expectancy=10; gap allowed; filtering=ON; match score=1; mismatch
score=-3). As preferable examples of other algorithms for
determining nucleotide sequence homology, the above-described amino
acid sequence homology calculation algorithms can be mentioned.
[0037] A nucleic acid having a nucleotide sequence or a portion
thereof complementary to the nucleotide sequence that encodes the
PCA-1 polypeptide (hereinafter also referred to as "antisense
PCA-1") can be designed and synthesized on the basis of information
on the nucleotide sequence that encodes a cloned or determined
PCA-1 polypeptide. Such a nucleic acid is capable of inhibiting the
replication or expression of the PCA-1 gene. Hence, antisense PCA-1
is capable of hybridizing to an RNA (mRNA or initial transcription
product) transcribed from the gene (chromosome DNA) that encodes
the PCA-1 polypeptide under physiological conditions (for example,
intracellular and the like) to inhibit the synthesis (processing)
or function (translation into protein) of the mRNA.
[0038] The target region of antisense PCA-1 is not limited with
respect to length, as long as the translation into PCA-1
polypeptide is inhibited as a result of hybridization of antisense
nucleic acid; the target region may be the entire sequence or a
partial sequence of the mRNA or initial transcription product that
encodes the polypeptide, and the length is about 15 bases for the
shortest, and the entire sequence of the mRNA or initial
transcription product for the longest. Considering the ease of
synthesis, oligonucleotides consisting of about 15 to about 30
bases are preferable, but these are not limiting. Specifically, for
example, the 5' end hairpin loop; 5' end 6-base-pair repeats, 5'
end untranslated region, translation initiation codon, protein
coding region, translation termination codon, 3' end untranslated
region, 3' end palindrome region, and 3' end hairpin loop of a
nucleic acid that encodes PCA-1 (for example, mRNA or initial
transcription product) may be selected as target regions, but any
other region in the nucleic acid that encodes PCA-1 may be selected
as the target. For example, the intron portion of the PCA-1 gene is
also the preferable target region.
[0039] Furthermore, antisense PCA-1 may be one not only capable of
hybridizing to the mRNA or initial transcription product that
encodes the PCA-1 polypeptide to inhibit its translation into a
polypeptide, but also capable of binding to the double-stranded DNA
that encodes the PCA-1 polypeptide to form a triple strand
(triplex) to inhibit the transcription of the RNA.
[0040] The kind of the antisense nucleic acid may be DNA or RNA, or
a DNA/RNA chimera. Because a natural form antisense nucleic acid
easily undergoes degradation of the phosphor-diester bond thereof
by a nuclease present in the cells, an antisense nucleic acid can
also be synthesized using a modified nucleotide of the
thiophosphate form (P.dbd.O in phosphate bond replaced with
P.dbd.S), 2'-O-methyl form and the like, which are stable to
decomposing enzymes. Other important factors for the designing of
antisense nucleic acids include increases in water-solubility and
cell membrane permeability and the like; these can also be cleared
by choosing appropriate dosage forms such as those using liposome
or microspheres.
[0041] A ribozyme capable of specifically cleaving the mRNA or
initial transcription product that encodes PCA-1 in the coding
region (including the intron portion in the case of initial
transcription product) can also be included in antisense PCA-1.
"Ribozyme" refers to an RNA having an enzyme activity to cleave a
nucleic acid; since it has recently been found that an oligo-DNA
having the nucleotide sequence of the enzyme activity site also has
the same nucleic acid cleavage activity, this term is herein used
as a concept including DNA, as long as it possesses
sequence-specific nucleic acid cleavage activity. The most
versatile ribozyme is self-splicing RNA, found in infectious RNAs
such as viroid and virosoid, and is known to occur in the
hammerhead type, the hairpin type and the like. The hammerhead type
exhibits enzyme activity with about 40 bases, and it is possible to
specifically cleave only the target mRNA by rendering several bases
(about 10 bases in total) at each end adjacent to the hammerhead
structure moiety a sequence complementary to the desired cleavage
site of the mRNA. Furthermore, when a ribozyme is used in the form
of an expression vector comprising the DNA that encodes the same, a
hybrid ribozyme wherein a sequence modified from tRNA is further
joined to promote the localization of the transcription product to
cytoplasm may be used [Nucleic Acids Res., 29(13): 2780-2788
(2001)].
[0042] A double stranded oligo RNA (siRNA) having a nucleotide
sequence complementary to a partial sequence in the coding region
of the mRNA or initial transcription product that encodes PCA-1
(including the intron portion in the case of initial transcription
product) is also included in antisense PCA-1. It had been known
that so-called RNA interference (RNAi), which is a phenomenon that
if short double stranded RNA is introduced into cells, an mRNA
complementary to one strand of the RNA is degraded, occurs in
nematodes, insects, plants and the like; since this phenomenon was
confirmed to also occur in mammalian cells [Nature, 411(6836):
494-498 (2001)], siRNA has been widely utilized as an alternative
technique to ribozymes. The size of siRNA is not limited, as long
as RNAi can be induced; for example, the size can be not less than
15 bp, preferably not less than 20 bp. An siRNA having RNAi
activity can be prepared by synthesizing a sense strand and an
antisense strand using an automated DNA/RNA synthesizer, denaturing
them in an appropriate annealing buffer solution, for example, at
about 90 to about 95.degree. C. for about 1 minute, and then
annealing them at about 30 to about 70.degree. C. for about 1 to
about 8 hours.
[0043] An expression vector capable of expressing the
above-described nucleic acid having a nucleotide sequence or a
portion thereof complementary to the nucleotide sequence that
encodes the PCA-1 polypeptide is also preferable as a compound that
suppresses the expression or function of PCA-1. The expression
vector is preferably an expression vector capable of functioning in
cells (prostate cancer cells and the like) of the subject mammal,
and can be provided in a manner wherein a nucleic acid having a
nucleotide sequence or a portion thereof complementary to the
nucleotide sequence that encodes the PCA-1 polypeptide is
functionally joined downstream of an appropriate promoter (for
example, promoters capable of exhibiting promoter activity in cells
(prostate cancer cells and the like) of the subject mammal) in the
vector.
[0044] As the expression vector, plasmid vectors, viral vectors and
the like can be mentioned; vectors suitable for use in cells
(prostate cancer cells and the like) of mammals such as humans
include viral vectors such as adenovirus, retrovirus,
adeno-associated virus, herpesvirus, vaccinia virus, poxvirus,
poliovirus, Sindbis virus, Sendai virus, and Epstein-Barr
virus.
[0045] Any promoter can be used, as long as it is capable of
exhibiting promoter activity in cells (prostate cancer cells and
the like) of the subject mammal; examples include viral promoters
such as SV40-derived initial promoter, cytomegalovirus LTR, Rous
sarcoma virus LTR, MoMuLV-derived LTR, and adenovirus-derived
initial promoter, and mammalian constitutive protein gene promoters
such as .beta.-actin gene promoter, PGK gene promoter, and
transferrin gene promoter and the like.
[0046] The expression vector can contain a transcription
termination signal, that is, a terminator region, downstream of the
nucleic acid having a nucleotide sequence or a portion thereof
complementary to the nucleotide sequence that encodes the PCA-1
polypeptide. Furthermore, the expression vector can further
comprise a selection marker gene (genes that confer resistance to
drugs such as tetracycline, ampicillin, kanamycin, hygromycin, and
phosphinothricin, genes that compensate for auxotrophic mutation,
genes that encode fluorescent proteins, and the like).
[0047] An antibody that specifically recognizes the PCA-1
polypeptide is capable of suppressing a function of PCA-1 by
binding specifically to the PCA-1 polypeptide. The antibody may be
a polyclonal antibody or a monoclonal antibody, and can be prepared
by a well-known immunological technique. The antibody may also be a
bindable fragment of an antibody (for example, Fab, F(ab').sub.2),
or a recombinant antibody (for example, single-chain antibody).
[0048] For example, the polyclonal antibody can be acquired by
administering the PCA-1 polypeptide or a fragment thereof (as
required, may be prepared as a complex crosslinked to a carrier
protein such as bovine serum albumin or KLH (keyhole limpet
hemocyanin)) as the antigen, along with a commercially available
adjuvant (for example, Freund's complete or incomplete adjuvant),
to an animal subcutaneously or intraperitoneally about 2 to 4 times
at intervals of 2 to 3 weeks (the antibody titer of partially drawn
serum has been determined by a known antigen-antibody reaction and
its elevation has been confirmed in advance), collecting whole
blood about 3 to about 10 days after final immunization, and
purifying the antiserum. As the animal to receive the antigen,
mammals such as rats, mice, rabbits, goat, guinea pigs, and
hamsters can be mentioned.
[0049] The monoclonal antibody can be prepared by a cell fusion
method (for example, Takeshi Watanabe, Saibou Yugouhou No Genri To
Monokuronaru Koutai No Sakusei, edited by Akira Taniuchi and
Toshitada Takahashi, "Monokuronaru Koutai To Gan--Kiso To
Rinsho--", pages 2-14, Science Forum Shuppan, 1985). For example,
the PCA-1 polypeptide or a fragment thereof, along with a
commercially available adjuvant, is subcutaneously or
intraperitoneally administered to a mouse 2 to 4 times, and about 3
days after final administration, the spleen or lymph nodes are
collected, and leukocytes are collected. These leukocytes and
myeloma cells (for example, NS-1, P3X63Ag8 and the like) are
cell-fused to obtain a hybridoma that produces a monoclonal
antibody that specifically recognizes the PCA-1 polypeptide. This
cell fusion may be performed by the PEG method [J. Immunol.
Methods, 81(2): 223-228 (1985)], or by the voltage pulse method
[Hybridoma, 7(6): 627-633 (1988)].
[0050] A hybridoma that produces the desired monoclonal antibody
can be selected by detecting an antibody that binds specifically to
the antigen from the culture supernatant using a widely known EIA
or RIA method and the like. Cultivation of the hybridoma that
produces the monoclonal antibody can be performed in vitro, or in
vivo such as in mouse or rat ascitic fluid, preferably in mouse
ascitic fluid, and the antibody can be acquired from the culture
supernatant of the hybridoma or the ascitic fluid of the
animal.
[0051] In view of therapeutic efficacy and safety in humans, the
antibody may be a chimeric antibody or a humanized or human type
antibody. The chimeric antibody can be prepared with reference to,
for example, "Jikken Igaku (extra issue), Vol. 6, No. 10, 1988",
JP-B-H03-73280 and the like; the humanized antibody can be prepared
with reference to, for example, JP-T-H04-506458, JP-A-S62-296890
and the like; the human antibody can be prepared with reference to,
for example, "Nature Genetics, Vol. 15, p. 146-156, 1997", "Nature
Genetics, Vol. 7, p. 13-21, 1994", JP-T-H04-504365, International
Application Publication WO94/25585, "Nikkei Science, June issue,
pp. 40 to 50, 1995", "Nature, Vol. 368, pp. 856-859, 1994",
JP-T-H06-500233 and the like.
[0052] To suppress the function of PCA-1 more efficiently, as the
antibody that specifically recognizes the PCA-1 polypeptide, an
antibody can be selected that specifically recognizes a functional
domain of the PCA-1 polypeptide (active site for repair of DNA and
RNA alkylation damage and the like) to reduce the function
accounted for by the domain.
[0053] A dominant negative mutant of the PCA-1 polypeptide refers
to a mutant wherein a function (activity) of the PCA-1 polypeptide
has been reduced by mutagenesis. The dominant negative mutant is
capable of indirectly inhibiting a function (activity) of the PCA-1
polypeptide by competing with the PCA-1 polypeptide. The dominant
negative mutant can be prepared by introducing a mutation to the
nucleic acid that encodes the PCA-1 polypeptide. Examples of the
mutation include amino acid mutations in a functional domain
(active site for repair of DNA and RNA alkylation damage and the
like) that result in a reduction in the function accounted for by
the domain (for example, deletion, substitution, and addition of
one or more amino acids). A dominant negative mutant can be
prepared by a method known per se using PCR or a commonly known
mutagenesis reagent.
[0054] A nucleic acid having the nucleotide sequence that encodes
the above-described antibody that specifically recognizes the PCA-1
polypeptide or the dominant negative mutant of the PCA-1
polypeptide are also preferable as the compound that suppresses the
expression or function of PCA-1. The nucleic acid can be provided
in a manner functionally joined downstream of an appropriate
promoter (for example, promoters capable of exhibiting promoter
activity in cells (prostate cancer cells and the like) of the
subject mammal) in an appropriate expression vector (for example,
expression vectors capable of functioning in cells (prostate cancer
cells and the like) of the recipient mammal).
[0055] As the expression vector and the promoter used, the same
ones used in the above-described "expression vector capable of
expressing a nucleic acid or a portion thereof having a nucleotide
sequence complementary to the nucleotide sequence that encodes the
PCA-1 polypeptide" can be used. The expression vector can comprise
a transcription termination signal, that is, a terminator region,
downstream of a nucleic acid having a nucleotide sequence that
encodes an antibody that specifically recognizes the PCA-1
polypeptide or a dominant negative mutant of the PCA-1 polypeptide.
Furthermore, the expression vector, like the above-described
"expression vector capable of expressing a nucleic acid having a
nucleotide sequence or a portion thereof complementary to the
nucleotide sequence, that encodes the PCA-1 polypeptide", can
further comprise a selection marker gene.
[0056] The agent of the present invention can comprise, in addition
to a compound that suppresses the expression or function of PCA-1,
an optionally chosen carrier, for example, a pharmaceutically
acceptable carrier.
[0057] As examples of the pharmaceutically acceptable carrier,
excipients such as sucrose, starch, mannit, sorbit, lactose,
glucose, cellulose, talc, calcium phosphate, and calcium carbonate;
binders such as cellulose, methylcellulose, hydroxypropylcellulose,
polypropylpyrrolidone, gelatin, gum arabic, polyethylene glycol,
sucrose, and starch; disintegrants such as starch,
carboxymethylcellulose, hydroxypropyl starch, sodium-glycol-starch,
sodium hydrogen carbonate, calcium phosphate, and calcium citrate;
lubricants such as magnesium stearate, Aerosil, talc, and sodium
lauryl sulfate; flavoring agents such as citric acid, menthol,
glycyrrhizin ammonium salt, glycine, and orange flour;
preservatives such as sodium benzoate, sodium hydrogen sulfite,
methylparaben, and propylparaben; stabilizers such as citric acid,
sodium citrate, and acetic acid; suspending agents such as
methylcellulose, polyvinylpyrrolidone, and aluminum stearate;
dispersing agents such as surfactants; diluents such as water,
physiological saline, and orange juice; base waxes such as cacao
butter, polyethylene glycol, and kerosene; and the like can be
mentioned, but these are not to be construed as limiting.
[0058] Preparations suitable for oral administration are liquids
prepared by dissolving an effective amount of an active ingredient
in a diluent such as water or physiological saline, capsules,
saches or tablets containing an effective amount of an active
ingredient in the form of solids or granules, suspensions prepared
by suspending an effective amount of an active ingredient in an
appropriate dispersant, emulsions prepared by dispersing and
emulsifying a solution of an effective amount of an active
ingredient in an appropriate dispersant, and the like.
[0059] Preparations suitable for parenteral administration (for
example, subcutaneous injection, intramuscular injection, topical
injection, intraperitoneal administration and the like) are aqueous
and non-aqueous isotonic sterile injectable liquids, which may
contain an antioxidant, a buffer solution, a bacteriostatic agent,
an isotonizing agent and the like. Aqueous and non-aqueous sterile
suspensions can also be mentioned, which may contain a suspending
agent, a solubilizer, a thickening agent, a stabilizer, an
antiseptic and the like. The preparation can be enclosed in
containers such as ampoules and vials for unit dosage or a
plurality of dosages. It is also possible to freeze-dry the active
ingredient and a pharmaceutically acceptable carrier, and store
them in a state that may be dissolved or suspended in an
appropriate sterile vehicle just before use.
[0060] When the compound that suppresses the expression or function
of PCA-1 is a nucleic acid, the agent of the present invention can
further comprise a reagent for nucleic acid introduction in order
to promote the introduction of the nucleic acid to the cells. When
the nucleic acid is incorporated in a viral vector, particularly in
retrovirus vector, retronectin, fibronectin, polybrene and the like
can be used as the transfection reagent. When the nucleic acid is
incorporated in a plasmid vector, cationic lipids such as
lipofectin, lipfectamine, DOGS (transfectam;
dioctadecylamidoglycylspermine), DOPE
(1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOTAP
(1,2-dioleoyl-3-trimethylammoniumpropane), DDAB
(dimethyldioctadecylammonium bromide), DHDEAB
(N,N-di-n-hexadecyl-N,N-dihydroxyethylammonium bromide), HDEAB
(N-n-hexadecyl-N,N-dihydroxyethylammonium bromide), polybrene, or
poly(ethyleneimine) (PEI) can be used.
[0061] When the compound that suppresses the expression or function
of PCA-1 is a polypeptide (antibody, dominant negative mutant and
the like), the agent of the present invention can further comprise
a reagent for polypeptide introduction in order to increase the
efficiency of introduction of the polypeptide in the cells. As the
reagent, Profect (produced by Nacalai Tesque, Inc.), ProVectin
(produced by IMGENEX) and the like can be used.
[0062] The dosage of the agent of the present invention varies
depending on the activity and choice of the active ingredient,
seriousness of the disease, animal species being the subject of
administration, drug tolerance, body weight, and age of the subject
of administration, and the like, and is generally about 0.0001 to
about 5000 mg/kg, based on the amount of active ingredient per day
for an adult.
[0063] In one embodiment, the agent of the present invention can be
for promoting apoptosis (apoptosis promoting agent). In this case,
the apoptosis preferably is caspase 8/FADD dependent or induced by
paclitaxel. As caspase 8/FADD-dependent apoptosis, FASL-induced
apoptosis, TRAIL-induced apoptosis, TNF-.alpha.-induced apoptosis
and the like can be mentioned. The reason why caspase
8/FADD-dependent apoptosis is preferred is that when the expression
or function of PCA-1 is suppressed by an active ingredient of the
agent of the present invention, the inhibitory function of PCA-1 on
the ubiquitination of FLIP is suppressed, and the amount of FLIP
polypeptide expressed in the cells decreases, whereby the
suppression of caspase 8/FADD-dependent apoptosis by FLIP can be
cancelled. The reason why paclitaxel-induced apoptosis is preferred
is that paclitaxel-induced apoptosis is inhibited by the activation
of MAP kinase that can be induced by paclitaxel per se (ERK and the
like) (McDaid H. M. et al, Mol. Pharmacol., 60(2), 290-301, 2001),
and that when the expression or function of PCA-1 is suppressed by
an active ingredient of the agent of the present invention, the
inhibitory function of PCA-1 on the ubiquitination of FLIP is
suppressed, and the amount of FLIP polypeptide expressed in the
cells decreases, whereby the interaction between FLIP and Raf-1
decreases, and the activation of Raf-1 is suppressed, and as a
result, the activation of MAP kinase signaling can be
suppressed.
[0064] The apoptosis promoting agent of the present invention is
capable of promoting the apoptosis of cells (cells isolated from
tissues (including cultured cells), normal cells, cancer cells,
cell lines and the like), preferably prostate cancer cells, derived
from a desired tissue (for example, prostate, thymus, liver, testis
and the like) of one of the above-described mammals.
[0065] In one embodiment, the agent of the present invention can be
for inhibiting cell growth (cell growth inhibitor). When the
expression or function of PCA-1 is suppressed by an active
ingredient of the agent of the present invention, the inhibitory
function of PCA-1 on the ubiquitination of FLIP is suppressed, and
the amount of FLIP polypeptide expressed in the cells decreases,
whereby the FLIP-Raf-1 interaction decreases, and as a result, MAP
kinase signaling is suppressed; therefore, the agent of the present
invention is capable of suitably inhibiting MAP kinase
signaling-dependent cell growth. As examples of the MAP kinase
signaling-dependent cell growth, cell growth dependent on a growth
factor such as EGF and the like can be mentioned.
[0066] The cell growth inhibitor of the present invention is
capable of inhibiting the growth of cells (cells isolated from
tissues (including cultured cells), normal cells, cancer cells,
cell line and the like), preferably prostate cancer cells, derived
from a desired tissue (for example, prostate, thymus, liver, testis
and the like) of one of the above-described mammals.
[0067] In one embodiment, the agent of the present invention can be
for preventing/treating cancer (prophylactic/therapeutic agent for
cancer). In this case, the cancer can be a cancer derived from a
desired tissue (for example, prostate, thymus, liver, testis and
the like) of one of the above-described mammals, and is preferably
prostate cancer. "prostate cancer" refers to a concept broadly
involving the cancers that have developed in the prostate, and
encompasses not only adenocarcinomas that have developed in the
prostate, but also squamous cell carcinoma, transitional cell
carcinoma, neuroendocrine carcinoma, undifferentiated cancers and
the like. Preferably, the prostate cancer is an adenocarcinoma that
has developed in the prostate. In prostate cancer, PCA-1 is highly
expressed (Proceedings of the 123rd Annual Meeting of the
Pharmaceutical Society of Japan No. 4, p 15, 2003), and the agent
of the present invention can be particularly effective.
2. A Screening Method Comprising Selecting a Compound that
Suppresses the Expression or Function of PCA-1
[0068] As described above, a compound that suppresses the
expression or function of PCA-1 is capable of inhibiting the
anticancer-agent resistance of cancer cells to prevent/treat cancer
by promoting apoptosis (caspase 8/FADD-dependent apoptosis,
paclitaxel-induced apoptosis and the like) and inhibiting MAP
kinase signaling-dependent cell growth (cell growth dependent on a
growth factor such as EGF and the like). Therefore, by selecting a
compound capable of suppressing the expression or function of
PCA-1, a compound for promoting apoptosis, a compound for
inhibiting cell growth, or a compound for preventing/treating
cancer can be acquired.
[0069] The test compound subjected to the screening method may be
any commonly known compound or novel compound; for example, nucleic
acids, carbohydrates, lipids, proteins, peptides, organic low
molecular compounds, compound libraries prepared using
combinatorial chemistry technology, random peptide libraries
prepared by solid phase synthesis or the phage display method, or
naturally occurring ingredients derived from microorganisms,
animals, plants, marine organisms and the like, and the like can be
mentioned.
[0070] For example, when a compound capable of suppressing the
expression of PCA-1 is selected, a test compound and cells
permitting a measurement of the expression of PCA-1 are brought
into contact with each other, the amount of PCA-1 expressed in the
cells brought into contact with the test compound is measured, and
the amount expressed is compared with the amount of PCA-1 expressed
in control cells not brought into contact with the test
compound.
[0071] Cells permitting a measurement of the expression of PCA-1
refer to cells permitting a direct or indirect evaluation of the
expression level of a product, for example, transcription product
or translation product, of the PCA-1 gene. The cells permitting a
direct evaluation of the expression level of a product of the PCA-1
gene can be cells capable of naturally expressing PCA-1; meanwhile,
the cells permitting an indirect evaluation of the expression level
of a product of the PCA-1 gene can be cells permitting reporter
assay for the PCA-1 gene transcriptional regulatory region.
[0072] Cells capable of naturally expressing PCA-1 are not limited,
as long as they potentially express PCA-1. These cells can easily
be identified by those skilled in the art; useful cells include
primary cultured cells, cell lines induced from the primary
cultured cells, commercially available cell lines, cell lines
available from cell banks, and the like. As examples of the cells
capable of naturally expressing PCA-1, prostate cancer cells and
the like of one of the aforementioned mammals can be mentioned.
[0073] The cells permitting reporter assay for the PCA-1 gene
transcriptional regulatory region are cells comprising a PCA-1 gene
transcriptional regulatory region and a reporter gene functionally
joined to the region. The PCA-1 gene transcriptional regulatory
region and the reporter gene can be inserted in an expression
vector. The PCA-1 gene transcriptional regulatory region is not
particularly limited, as long as it is a region capable of
controlling the expression of the PCA-1 gene; for example, a region
from the transcription initiation point to about 2 kbp upstream
thereof, or a region consisting of the base sequence of the
foregoing region wherein one or more bases have been deleted,
substituted or added, and having the capability of controlling the
transcription of the PCA-1 gene, and the like can be mentioned. The
reporter gene may be any gene that encodes an enzyme that produces
a detectable protein or a detactable substance; examples include
the GFP (green fluorescent protein) gene, the GUS
(.beta.-glucuronidase) gene, the LUS (luciferase) gene, the CAT
(chloramphenicol acetyltransferase) gene and the like.
[0074] The cells to be transfected with the PCA-1 gene
transcriptional regulatory region and a reporter gene functionally
joined to the region are not particularly limited, as long as they
permit an evaluation of the PCA-1 gene transcriptional regulatory
function, that is, as long as the amount of reporter gene expressed
can be quantitatively analyzed. However, it is preferable that the
above-described cells capable of naturally expressing the PCA-1
gene (for example, prostate cancer cells and the like) be used as
the cells to be transfected because these cells express a
physiological transcriptional regulatory factor for the PCA-1 gene,
and are thought to be more suitable for the evaluation of the
regulation of the expression of the PCA-1 gene.
[0075] Contact of a test compound with cells permitting a
measurement of the expression of PCA-1 can be performed in an
appropriate culture medium. The culture medium can be chosen as
appropriate according to the choice of cells used and the like; for
example, a minimal essential medium (MEM), Dulbecco's modified
Eagle medium (DMEM), RPMI1640 medium, 199 medium and the like,
containing about 5 to 20% fetal bovine serum, can be mentioned.
Cultivation conditions are also determined as appropriate according
to the choice of cells used and the like; for example, the pH of
the medium is about 6 to about 8, cultivation temperature is
normally about 30 to about 40.degree. C., and cultivation time is
about 12 to about 72 hours.
[0076] Next, the amount of PCA-1 expressed in the cells brought
into contact with the test compound is measured. A measurement of
the amount expressed can be performed by a method known per se,
taking into consideration the kind of cell used and the like. For
example, when cells capable of naturally expressing PCA-1 are used
as the cells permitting a measurement of the expression of PCA-1,
the amount expressed can be measured with a product, for example,
transcription product (mRNA) or translation product (polypeptide),
of the PCA-1 gene as the subject of measurement, by a method known
per se. For example, the amount of transcription product expressed
can be measured by preparing total RNA from the cells, and
performing RT-PCR, Northern blotting and the like. The amount of
translation product expressed can be measured by preparing an
extract from the cells, and performing an immunological technique.
As the immunological technique, radioisotope immunoassay (RIA),
ELISA (Methods in Enzymol. 70: 419-439 (1980)), the fluorescent
antibody method, Western blotting and the like can be used.
Meanwhile, when cells permitting reporter assay of the PCA-1 gene
transcriptional regulatory region are used as the cells permitting
a measurement of the expression of PCA-1, the amount expressed can
be measured on the basis of the signal intensity of the
reporter.
[0077] Next, the amount of PCA-1 expressed in the cells brought
into contact with the test compound is compared with the amount of
PCA-1 expressed in control cells not brought into contact with the
test compound. This comparison of the amount expressed is performed
preferably on the basis of the presence or absence of a significant
difference. Although the amount of PCA-1 expressed in the control
cells not brought into contact with the test compound may be
measured before, or simultaneously with, the measurement of the
amount of PCA-1 expressed in the cells brought into contact with
the test compound, it is preferable, from the viewpoint of
experimental accuracy and reproducibility, that the amount
expressed be simultaneously measured.
[0078] As a result of the comparison, a compound judged to be
capable of suppressing the expression of PCA-1 can be obtained as a
compound for promoting apoptosis, a compound for inhibiting cell
growth, or a compound for preventing or treating cancer.
[0079] When a compound capable of suppressing a function of PCA-1
is chosen, the function (activity) of PCA-1 is measured in the
presence of a test compound, and the function (activity) is
compared with the function (activity) of PCA-1 in the absence of
the test compound.
[0080] For example, when a function to inhibit the ubiquitination
of FLIP is measured as the function of PCA-1, cells permitting a
measurement of the FLIP ubiquitination inhibitory activity of PCA-1
and a test compound are brought into contact with each other, the
FLIP ubiquitination inhibitory activity in the cells brought into
contact with the test compound is measured, and this is compared
with the FLIP ubiquitination inhibitory activity in control cells
not brought into contact with the test compound. In this case, for
the purpose of suppressing the degradation of ubiquitinated FLIP by
proteasome, the cells and the test compound may be brought into
contact with each other in the presence of a proteasome inhibitor
(for example, MG132 and the like).
[0081] The cells used are not particularly limited, as long as they
permit a measurement of the FLIP ubiquitination inhibitory activity
of PCA-1; for example, cells that express PCA-1, FLIP, and an
enzyme involved in FLIP ubiquitination and the like in a functional
manner and the like can be mentioned. The PCA-1, FLIP, and enzyme
involved in FLIP ubiquitination and the like may be naturally
expressed ones, or ones forcibly expressed by transfection. As
examples of cells permitting a measurement of the FLIP
ubiquitination inhibitory activity of PCA-1, cells obtained by
introducing the PCA-1 gene to cells wherein the occurrence of FLIP
ubiquitination has been confirmed, and having the FLIP
ubiquitination inhibited by the introduced PCA-1, and the like can
be mentioned. "Cells wherein the occurrence of FLIP ubiquitination
has been confirmed" can easily be identified by those skilled in
the art; for example, useful cells include primary culture cells of
the above-described mammals, cell lines induced from the primary
culture cells, commercially available cell lines, cell lines
available from cell banks and the like. The "cells wherein the
occurrence of FLIP ubiquitination has been confirmed" are
preferably prostate cancer cells.
[0082] Contact of a test compound with cells permitting a
measurement of the FLIP ubiquitination inhibitory activity of
PCA-1, like contact of a test compound with cells permitting a
measurement of PCA-1 expression, can be performed in an appropriate
culture medium (for example, a minimal essential medium (MEM),
Dulbecco's modified Eagle medium (DMEM), RPMI1640 medium and 199
medium, containing about 5 to 20% fetal bovine serum). Cultivation
conditions are determined as appropriate according to the choice of
cells used, the choice of interaction measured and the like; for
example, the pH of the medium is about 6 to about 8, cultivation
temperature is normally about 30 to about 40.degree. C., and
cultivation time is about 1 hour to about 72 hours.
[0083] Next, the FLIP ubiquitination inhibitory activity of PCA-1
in the cells brought into contact with the test compound is
measured. A measurement of FLIP ubiquitination can be performed by
a method known per se; for example, an evaluation can be achieved
by immunoprecipitating FLIP from an extract from the cells, and
quantifying the amount of ubiquitin bound to the FLIP by Western
blotting. In this case, it is judged that the lower the degree of
FLIP ubiquitination is, the higher the "FLIP ubiquitination
inhibitory activity of PCA-1" is; when the "FLIP ubiquitination
inhibitory activity of PCA-1" is suppressed, the degree of FLIP
ubiquitination increases.
[0084] Next, the FLIP ubiquitination inhibitory activity of PCA-1
in the cells brought into contact with the test compound is
compared with the activity in control cells not brought into
contact with the test compound. This comparison of the amount
expressed is performed preferably on the basis of the presence or
absence of a significant difference. Although the FLIP
ubiquitination inhibitory activity of PCA-1 in the control cells
not brought into contact with the test compound may be measured
before, or simultaneously with, the measurement of the FLIP
ubiquitination inhibitory activity of PCA-1 in the cells brought
into contact with the test compound, it is preferable, from the
viewpoint of experimental accuracy and reproducibility, that the
activity be simultaneously measured.
[0085] When a function to increase the FLIP-Raf-1 interaction is
measured as the function of PCA-1, cells permitting a measurement
of the FLIP-Raf-1 interaction-increasing activity of PCA-1 and a
test compound are brought into contact with each other, the
FLIP-Raf-1 interaction-increasing activity in the cells brought
into contact with the test compound is measured, and this is
compared with the FLIP-Raf-1 interaction-increasing activity in
control cells not brought into contact with the test compound.
[0086] The cells used are not particularly limited, as long as they
permit a measurement of the FLIP-Raf-1 interaction-increasing
activity of PCA-1; for example, cells that express PCA-1, FLIP, and
Raf-1 in a functional manner and the like can be mentioned. The
PCA-1, FLIP, Raf-1 and the like may be naturally expressed ones, or
ones forcibly expressed by transfection. As examples of cells
permitting a measurement of the FLIP-Raf-1 interaction-increasing
activity of PCA-1, cells obtained by introducing the PCA-1 gene to
cells wherein the occurrence of FLIP-Raf-1 interaction has been
confirmed, and having the FLIP-Raf-1 interaction increased by the
introduced PCA-1 and the like can be mentioned. "Cells wherein the
occurrence of FLIP-Raf-1 interaction has been confirmed" can easily
be identified by those skilled in the art; for example, useful
cells include primary culture cells of the above-described mammals,
cell lines induced from the primary culture cells, commercially
available cell lines, cell lines available from cell banks and the
like. The "cells wherein the occurrence of FLIP-Raf-1 interaction
has been confirmed" are preferably prostate cancer cells.
[0087] Contact of a test compound with cells permitting a
measurement of the FLIP-Raf-1 interaction-increasing activity of
PCA-1, like that described above, can be performed in an
appropriate culture medium (for example, a minimal essential medium
(MEM), Dulbecco's modified Eagle medium (DMEM), RPMI1640 medium and
199 medium, containing about 5 to 20% fetal bovine serum).
Cultivation conditions are determined as appropriate according to
the choice of cells used, the choice of interaction determined and
the like; for example, the pH of the medium is about 6 to about 8,
cultivation temperature is normally about 30 to about 40.degree.
C., and cultivation time is about 1 minute to about 72 hours.
[0088] Next, the FLIP-Raf-1 interaction-increasing activity of
PCA-1 in the cells brought into contact with the test compound is
measured. A measurement of FLIP-Raf-1 interaction can be performed
by a method known per se; for example, an evaluation can be
achieved by immunoprecipitating FLIP from an extract from the
cells, and quantifying the amount of Raf-1 co-precipitated with the
FLIP by Western blotting. In this case, it is judged that the
higher the degree of FLIP-Raf-1 interaction is, the higher "the
FLIP-Raf-1 interaction-increasing activity of PCA-1" is; when "the
FLIP-Raf-1 interaction-increasing activity of PCA-1" is suppressed,
the degree of FLIP-Raf-1 interaction decreases.
[0089] Next, the FLIP-Raf-1 interaction-increasing activity of
PCA-1 in the cells brought into contact with the test compound is
compared with the activity in the control cells not brought into
contact with the test compound. This comparison of the activity can
be performed preferably on the basis of the presence or absence of
a significant difference. Although the FLIP-Raf-1
interaction-increasing activity of PCA-1 in the control cells not
brought into contact with the test compound may be measured before,
or simultaneously with, the measurement of the FLIP-Raf-1
interaction-increasing activity of PCA-1 in the cells brought into
contact with the test compound, it is preferable, from the
viewpoint of experimental accuracy and reproducibility, that the
activity be simultaneously measured. When the function to enhance
MAP kinase signaling is measured as the function of PCA-1, cells
permitting a measurement of the MAP kinase signaling-enhancing
activity of PCA-1 and a test compound are brought into contact with
each other, the MAP kinase signaling-enhancing activity in the
cells brought into contact with the test compound is measured, and
this is compared with the MAP kinase signaling-enhancing activity
in control cells not brought into contact with the test
compound.
[0090] The cells used are not particularly limited, as long as they
permit a measurement of the MAP kinase signaling-enhancing activity
of PCA-1; for example, cells that express PCA-1 and a molecule that
constitutes MAP kinase signaling (Raf-1, MEK1, ERK and the like) in
a functional manner and the like can be mentioned. The PCA-1 and
the molecule that constitutes MAP kinase signaling may be naturally
expressed ones, or ones forcibly expressed by transfection. As
examples of the cells permitting a measurement of the MAP kinase
signaling-enhancing activity of PCA-1, cells obtained by
introducing the PCA-1 gene to cells wherein the occurrence of MAP
kinase signaling has been confirmed, and having the MAP kinase
signaling enhanced by the introduced PCA-1, and the like can be
mentioned. "Cells wherein the occurrence of MAP kinase signaling
has been confirmed" can is easily be identified by those skilled in
the art; for example, useful cells include primary cultured cells
of the above-described mammals, cell lines induced from the primary
cultured cells, commercially available cell lines, cell lines
available from cell banks and the like. The "cells wherein the
occurrence of MAP kinase signaling has been confirmed" are
preferably prostate cancer cells. Because MAP kinase signaling
generally depends on cell activation, the cells may be activated by
being treated as appropriate. For example, when prostate cancer
cells and the like are used, the cells can be stimulated with a
growth factor capable of activating MAP kinase signaling, such as
EGF.
[0091] Contact of a test compound with cells permitting a
measurement of the MAP kinase signaling-enhancing activity of
PCA-1, like that described above, can be performed in an
appropriate culture medium (for example, a minimal essential medium
(MEM), Dulbecco's modified Eagle medium (DMEM), RPMI1640 medium,
199 medium, containing about 5 to 20% fetal bovine serum).
Cultivation conditions are determined as appropriate according to
the choice of cells used, the choice of interaction determined and
the like; for example, the pH of the medium is about 6 to about 8,
cultivation temperature is normally about 30 to about 40.degree.
C., and cultivation time is about 1 minute to about 72 hours.
[0092] Next, the MAP kinase signaling-enhancing activity of PCA-1
in the cells brought into contact with the test compound is
measured. A measurement of MAP kinase signaling can be performed by
a method known per se, normally with the phosphorylation of a
molecule that constitutes MAP kinase signaling (Raf-1, MEK1, ERK
and the like) as an index. For example, MAP kinase signaling can be
measured by using cells cultured in the presence of
.gamma..sup.32P-ATP, with an antibody against the molecule that
constitutes MAP kinase signaling (Raf-1, MEK1, ERK and the like)
and the like, immunoprecipitating the molecule that constitutes MAP
kinase signaling from an extract of the cells, and quantifying the
amount of .sup.32P incorporated in the molecule by phosphorylation.
Using an antibody specific for the molecule that constitutes MAP
kinase signaling, the degree of phosphorylation may be measured by
Western blotting and the like. In this case, it is judged that the
higher the degree of phosphorylation of the molecule that
constitutes MAP kinase signaling is, the higher "the MAP kinase
signaling-enhancing activity of PCA-1" is; when "the MAP kinase
signaling-enhancing activity of PCA-1" is suppressed, the degree of
phosphorylation of the molecule that constitutes MAP kinase
signaling decreases.
[0093] Next, the MAP kinase signaling-enhancing activity of PCA-1
in the cells brought into contact with the test compound is
compared with the activity in the control cells not brought into
contact with the test compound. This comparison of the activity is
performed preferably on the basis of the presence or absence of a
significant difference. Although the MAP kinase signaling-enhancing
activity of PCA-1 in the control cells not brought into contact
with the test compound may be measured before, or simultaneously
with, the measurement of the MAP kinase signaling-enhancing
activity of PCA-1 in the cells brought into contact with the test
compound, it is preferable, from the viewpoint of experimental
accuracy and reproducibility, that the activity be simultaneously
measured.
[0094] Next, the MAP kinase signaling-enhancing activity of PCA-1
in the cells brought into contact with the test compound is
compared with the activity in the control cells not brought into
contact with the test compound. This comparison of the activity is
performed preferably on the basis of the presence or absence of a
significant difference. Although the MAP kinase signaling-enhancing
activity of PCA-1 in the control cells not brought into contact
with the test compound may be measured before, or simultaneously
with, the measurement of the MAP kinase signaling-enhancing
activity of PCA-1 in the cells brought into contact with the test
compound, it is preferable, from the viewpoint of experimental
accuracy and reproducibility, that the activity be simultaneously
measured.
[0095] When a function to increase cyclin D1 expression is measured
as the function of PCA-1, cells permitting a measurement of the
cyclin D1 expression-increasing activity of PCA-1 and a test
compound are brought into contact with each other, the cyclin D1
expression-increasing activity in the cells brought into contact
with the test compound is measured, and this is compared with the
cyclin D1 expression-increasing activity in control cells not
brought into contact with the test compound.
[0096] The cells used are not particularly limited, as long as the
cyclin D1 expression-increasing activity of PCA-1 can be measured;
for example, cells that express PCA-1 and cyclin D1 in a functional
manner and the like can be mentioned. The PCA-1 may be naturally
expressed one, or one forcibly expressed by transfection. The
cyclin D1 is preferably a naturally expressible one. As examples of
the cells permitting a measurement of the cyclin D1
expression-increasing activity of PCA-1, cells obtained by
introducing the PCA-1 gene to cells wherein the potential for
cyclin D1 expression has been confirmed, and having cyclin D1
expression enhanced by the introduced PCA-1, and the like can be
mentioned. "Cells wherein the potential for cyclin D1 expression
has been confirmed" can easily be identified by those skilled in
the art; for example, useful cells include primary culture cells of
the above-described mammals, cell lines induced from the primary
culture cells, commercially available cell lines, cell lines
available from cell banks and the like. The "cells wherein the
potential for cyclin D1 expression has been confirmed" are
preferably prostate cancer cells. Because cyclin D1 expression
normally depends on cell activation (particularly activation of MAP
kinase signaling), the cells may be activated by being treated as
appropriate. For example, when prostate cancer cells and the like
are used, the cells can be stimulated with a growth factor capable
of activating MAP kinase signaling, such as EGF.
[0097] Contact of a test compound with cells permitting a
measurement of the cyclin D1 expression-increasing activity of
PCA-1, like that described above, can be performed in an
appropriate culture medium (for example, a minimal essential medium
(MEM), Dulbecco's modified Eagle medium (DMEM), RPMI1640 medium and
199 medium, containing about 5 to 20% fetal bovine serum).
Cultivation conditions are determined as appropriate according to
the choice of cells used, the choice of interaction determined and
the like; for example, the pH of the medium is about 6 to about 8,
cultivation temperature is normally about 30 to about 40.degree.
C., and cultivation time is about 1 minute to about 72 hours.
[0098] Next, the cyclin D1 expression-increasing activity of PCA-1
in the cells brought into contact with the test compound is
measured. The amount of cyclin D1 expressed can be measured with a
product, for example, transcription product (mRNA) or translation
product (polypeptide), of the cyclin D1 gene as the subject of
measurement, by a method known per se. For example, the amount of
transcription product expressed can be measured by preparing total
RNA from the cells, and performing RT-PCR, Northern blotting and
the like. The amount of translation product expressed can be
measured by preparing an extract from the cells, and performing an
immunological technique. As the immunological technique,
radioisotope immunoassay (RIA), ELISA (Methods in Enzymol. 70:
419-439 (1980)), the fluorescent antibody method, Western blotting
and the like can be used. In this case, it is judged that the
larger the amount of cyclin D1 expressed is, the higher "the cyclin
D1 expression-increasing activity of PCA-1" is; if "the cyclin D1
expression-increasing activity of PCA-1" is suppressed, the degree
of the amount of cyclin D1 expressed decreases.
[0099] Next, the cyclin D1 expression-increasing activity of PCA-1
in the cells brought into contact with the test compound is
compared with the activity in the control cells not brought into
contact with the test compound. This comparison of the activity is
performed preferably on the basis of the presence or absence of a
significant difference. Although the cyclin D1
expression-increasing activity of PCA-1 in the control cells not
brought into contact with the test compound may be measured before,
or simultaneously with, the measurement of the cyclin D1
expression-increasing activity of PCA-1 in the cells brought into
contact with the test compound, it is preferable, from the
viewpoint of experimental accuracy and reproducibility, that the
activity be simultaneously measured.
[0100] As a result of the comparison, a compound judged to be
capable of suppressing the function of PCA-1 can be selected as a
compound for promoting apoptosis, a compound for inhibiting cell
growth, or a compound for preventing or treating cancer.
[0101] In the screening method of the present invention,
particularly when a compound for promoting apoptosis is screened
for, the apoptosis can preferably be caspase 8/FADD dependent or
induced by paclitaxel. As the caspase 8/FADD-dependent apoptosis,
FASL-induced apoptosis, TRAIL-induced apoptosis,
TNF-.alpha.-induced apoptosis and the like can be mentioned. The
reason why caspase 8/FADD-dependent apoptosis is preferred is that
when the expression or function of PCA-1 is suppressed by an active
ingredient of the agent of the present invention, the inhibitory
function of PCA-1 on the ubiquitination of FLIP is suppressed, and
the amount of FLIP polypeptide expressed in the cells decreases,
whereby the suppression of caspase 8/FADD-dependent apoptosis by
FLIP can be cancelled. The reason why caspase paclitaxel-induced
apoptosis is preferred is that paclitaxel-induced apoptosis is
inhibited by the activation of MAP kinase (ERK and the like), which
can be induced by paclitaxel per se (McDaid H. M. et al, Mol.
Pharmacol., 60(2), 290-301, 2001), and that when the expression or
function of PCA-1 is suppressed by an active ingredient of the
agent of the present invention, the inhibitory function of PCA-1 on
the ubiquitination of FLIP is suppressed, and the amount of FLIP
polypeptide expressed in the cells decreases, whereby the
interaction between FLIP and Raf-1 decreases, the activation of
Raf-1 is suppressed, and as a result, the activation of MAP kinase
signaling can be suppressed.
[0102] Taking into consideration the above-described mechanism of
the involvement of PCA-1 in apoptosis, when a compound for
promoting apoptosis is screened for by selecting a compound capable
of suppressing the function of PCA-1 in the method of the present
invention, a function of PCA-1 can preferably be selected from the
group consisting of (i) to (iii) below:
(i) a function to inhibit the ubiquitination of FLIP; (ii) a
function to increase the FLIP-Raf-1 interaction; (iii) a function
to enhance MAP kinase signaling.
[0103] When the expression or function of PCA-1 is suppressed, the
inhibitory function of PCA-1 on the ubiquitination of FLIP is
suppressed, the ubiquitination of FLIP is enhanced, and the amount
of FLIP polypeptide expressed in the cells decreases, whereby the
FLIP-Raf-1 interaction decreases, and as a result, MAP kinase
signaling weakens, cyclin D1 expression is suppressed, and finally
cell growth is inhibited. Therefore, taking into consideration this
mechanism of action of PCA-1, particularly when a compound for
inhibiting cell growth is screened for in the method of the present
invention, the cell growth can preferably depend on MAP kinase
signaling. As examples of MAP kinase signaling-dependent cell
growth, cell growth depending on a cell growth factor such as EGF
and the like can be mentioned.
[0104] Taking into consideration the above-described mechanism of
the involvement of PCA-1 in cell growth, when a compound for
inhibiting cell growth is screened for by selecting a compound
capable of suppressing the function of PCA-1 in the method of the
present invention, a function of PCA-1 can preferably be selected
from the group consisting of (i) to (iv) below:
(i) a function to inhibit the ubiquitination of FLIP; (ii) a
function to increase the FLIP-Raf-1 interaction; (iii) a function
to enhance MAP kinase signaling; (iv) a function to increase cyclin
D expression.
[0105] In the screening method of the present invention,
particularly when a compound for preventing/treating cancer is
screened for, the cancer can be a cancer derived from a desired
tissue (for example, prostate, thymus, liver, testis and the like)
of one of the above-described mammals, and is preferably prostate
cancer. In prostate cancer, PCA-1 is highly expressed (Proceedings
of the 123rd Annual Meeting of the Pharmaceutical Society of Japan
No. 4, p 15, 2003), and a compound obtained by the screening method
of the present invention can be particularly effective.
[0106] Taking into consideration the above-described mechanism of
the involvement of PCA-1 in apoptosis and cell growth, when a
compound for preventing/treating cancer is screened for by
selecting a compound capable of suppressing the function of PCA-1
in the method of the present invention, a function of PCA-1 can
preferably be selected from the group consisting of (i) to (iv)
below:
(i) a function to inhibit the ubiquitination of FLIP; (ii) a
function to increase the FLIP-Raf-1 interaction; (iii) a function
to enhance MAP kinase signaling; (iv) a function to increase cyclin
D expression.
[0107] A compound that can be obtained by the screening method of
the present invention can be rendered a candidate compound for
pharmaceutical development, and, like the above-described agent of
the present invention, can be prepared as an apoptosis promoting
agent, a cell growth inhibitor, or a prophylactic/therapeutic agent
for cancer (prostate cancer and the like).
3. A Screening Method for a Compound for Promoting the
Ubiquitination of FLIP)
[0108] As shown in an Example below, when PCA-1 is highly
expressed, the ubiquitination of FLIP is inhibited, the expression
of FLIP polypeptide increases, and as a result, apoptosis is
inhibited, cell growth is enhanced, and the cells become resistant
to anticancer agents. Therefore, a compound capable of promoting
the ubiquitination of FLIP in cells wherein PCA-1 is expressed, if
obtained, would be useful as a compound for promoting apoptosis, a
compound for inhibiting cell growth, and a compound for
preventing/treating cancer. In particular, in prostate cancer,
because PCA-1 is highly expressed (Proceedings of the 123rd Annual
Meeting of the Pharmaceutical Society of Japan No. 4, p 15, 2003),
a compound capable of promoting the ubiquitination of FLIP in cells
wherein PCA-1 is expressed can be particularly useful as a compound
for preventing/treating prostate cancer. Accordingly, the present
invention provides a screening method for a compound for promoting
the ubiquitination of FLIP, comprising the following steps:
(1) a step for treating PCA-1-expressing cells with a test compound
in the presence of a proteasome inhibitor; (2) a step for
evaluating the ubiquitination of FLIP in the aforementioned
cells.
[0109] PCA-1-expressing cells can easily be identified by those
skilled in the art; for example, useful cells include primary
cultured cells of the above-described mammals, cell lines induced
from the primary cultured cells, commercially available cell lines,
cell lines available from cell banks and the like, and prostate
cancer cells are preferably used. The amount of PCA-1 expressed in
the cells is not particularly limited, as long as it is sufficient
to inhibit the ubiquitination of FLIP; it is preferable that the
amount expressed be sufficient to inhibit the ubiquitination of
FLIP to an about 1/2, preferably about 1/10, level compared with
cells that do not express PCA-1 (for example, cells wherein the
functional expression of PCA-1 is inhibited by siRNA against PCA-1)
in order to more securely inhibit the ubiquitination of FLIP. In
the cells, the PCA-1 may be a naturally expressed one, or one
forcibly expressed by transfection; however, it is preferable that
the PCA-1 be forcibly expressed by transfection in order to achieve
more potent and more secure PCA-1 expression. PCA-1 expression by
transfection is achieved by introducing an expression vector
capable of expressing PCA-1 to the above-described cells. The
expression vector can be provided in a manner wherein the nucleic
acid that encodes PCA-1 is functionally joined downstream of a
promoter capable of functioning in the cells to be transfected.
[0110] In the step (1), PCA-1-expressing cells are treated with a
test compound in the presence of a proteasome inhibitor. The test
compound is the same as that used in the foregoing section (2. A
screening method comprising selecting a compound capable of
suppressing the expression or function of PCA-1). The reason why a
proteasome inhibitor is used is that by suppressing the degradation
of ubiquitinated FLIP by proteasome, the promoting activity of the
test compound on the ubiquitination of FLIP is accurately
evaluated. As the proteasome inhibitor, MG132 and the like can be
mentioned.
[0111] Treatment of PCA-1-expressing cells with a test compound can
be performed in an appropriate culture medium. The culture medium
can be chosen as appropriate according to the choice of cells used
and the like; for example, a minimal essential medium (MEM),
Dulbecco's modified Eagle medium (DMEM), RPMI1640 medium, 199
medium and the like, containing about 5 to 20% fetal bovine serum
can be mentioned. Cultivation conditions are also determined as
appropriate according to the choice of cells used and the like; for
example, the pH of the medium is about 6 to about 8, cultivation
temperature is normally about 30 to about 40.degree. C., and
cultivation time is about 12 to about 72 hours. The proteasome
inhibitor concentration in the medium is not particularly limited,
as long as the degradation of ubiquitinated FLIP by proteasome is
inhibited; for example, when MG132 is used, the concentration is
normally about 10 to about 30 .mu.M.
[0112] Next, the FLIP ubiquitination in the cells brought into
contact with the test compound is evaluated. A measurement of the
FLIP ubiquitination can be performed by a method known per se; for
example, an evaluation can be achieved by immunoprecipitating FLIP
from an extract of the cells, and quantifying the amount of
ubiquitin bound to the FLIP by Western blotting.
[0113] Next, the FLIP ubiquitination in the cells brought into
contact with the test compound is compared with the FLIP
ubiquitination in the control cells not brought into contact with
the test compound. This comparison of the FLIP ubiquitination is
performed preferably on the basis of the presence or absence of a
significant difference. Although the FLIP ubiquitination in the
control cells not brought into contact with the test compound may
be measured before, or simultaneously with, the measurement of the
FLIP ubiquitination in the cells brought into contact with the test
compound, it is preferable, from the viewpoint of experimental
accuracy and reproducibility, that the amount expressed be
simultaneously measured.
[0114] As a result of the comparison, a compound judged to have
increased the degree of FLIP ubiquitination compared with the
control cells is selected as a compound for promoting FLIP
ubiquitination.
[0115] A compound that can be obtained by the screening method of
the present invention can be rendered a candidate compound for
pharmaceutical development, and, like the above-described agent of
the present invention, can be prepared as an FLIP ubiquitination
promoting agent, an apoptosis suppressing agent, a cell growth
inhibitor, or a prophylactic/therapeutic agent for cancer (prostate
cancer and the like).
4. Screening Method for a Compound for Promoting Apoptosis
[0116] As shown in an Example below and the like, when PCA-1 is
highly expressed, paclitaxel-induced apoptosis is inhibited, and
resistance to paclitaxel is acquired. When PCA-1 is highly
expressed, caspase 8/FADD-dependent apoptosis induced by TRAIL and
the like is inhibited, and resistance to caspase 8/FADD-dependent
apoptosis inducers (FASL, TRAIL, TNF-R, anti-FAS antibody and the
like) is acquired. Therefore, a compound capable of promoting
apoptosis induced by paclitaxel or a caspase 8/FADD-dependent
apoptosis inducer in cells wherein PCA-1 is expressed, if obtained,
would be useful as a compound for preventing/treating cancer that
has acquired resistance to paclitaxel or the caspase
8/FADD-dependent apoptosis inducer. In particular, in prostate
cancer, because PCA-1 is highly expressed (Proceedings of the 123rd
Annual Meeting of the Pharmaceutical Society of Japan No. 4, p 15,
2003), a compound capable of promoting apoptosis induced by
paclitaxel or a caspase 8/FADD-dependent apoptosis inducer is
useful as a compound for prostate cancer prophylaxis/treatment.
Accordingly, the present invention provides a screening method for
a compound for promoting paclitaxel-induced apoptosis, comprising
the following steps:
(1) a step for treating PCA-1-expressing cells with paclitaxel in
the presence of a test compound; (2) a step for evaluating the
degree of the apoptosis of the aforementioned cells;
[0117] The present invention further provides a screening method
for a compound for promoting caspase 8/FADD-dependent apoptosis,
comprising the following steps:
(1) a step for treating PCA-1-expressing cells with paclitaxel or a
caspase 8/FADD-dependent apoptosis inducer in the presence of a
test compound; (2) a step for evaluating the degree of the
apoptosis of the aforementioned cells.
[0118] PCA-1-expressing cells can easily be identified by those
skilled in the art; for example, useful cells include primary
cultured cells of the above-described mammals, cell lines induced
from the primary cultured cells, commercially available cell lines,
cell lines available from cell banks and the like, and prostate
cancer cells are preferably used. The amount of PCA-1 expressed in
the cells is not limited, as long as it is sufficient to inhibit
paclitaxel-induced apoptosis or caspase 8/FADD-dependent apoptosis;
it is preferable that the amount expressed be sufficient to inhibit
paclitaxel-induced apoptosis or caspase 8/FADD-dependent apoptosis
to an about 1/2, preferably about 1/10, level compared with cells
that do not express PCA-1 (for example, cells wherein the
functional expression of PCA-1 is inhibited by siRNA against PCA-1)
in order to construct a more sensitive screening method by securely
inhibiting the apoptosis. In the cells, the PCA-1 may be naturally
expressed one, or one forcibly expressed by transfection; however,
it is preferable that the PCA-1 be forcibly expressed by
transfection in order to achieve more potent and more secure PCA-1
expression. PCA-1 expression by transfection is achieved by
introducing an expression vector capable of expressing PCA-1 to the
above-described cells. The expression vector can be provided in a
manner wherein the nucleic acid that encodes PCA-1 is functionally
joined downstream of a promoter capable of functioning in the cells
to be transfected.
[0119] In the step (1), PCA-1-expressing cells are treated with
paclitaxel or a caspase 8/FADD-dependent apoptosis inducer in the
presence of a test compound. The test compound is the same as used
in the foregoing section (2. A screening method comprising
selecting a compound capable of suppressing the expression or
function of PCA-1).
[0120] Treatment of PCA-1-expressing cells with a test compound can
be performed in an appropriate culture medium. The culture medium
can be chosen as appropriate according to the choice of cells used
and the like; for example, a minimal essential medium (MEM),
Dulbecco's modified Eagle medium (DMEM), RPMI1640 medium, 199
medium and the like, containing about 5 to 20% fetal bovine serum
can be mentioned. Cultivation conditions are also determined as
appropriate according to the choice of cells used and the like; for
example, the pH of the medium is about 6 to about 8, cultivation
temperature is normally about 30 to about 40.degree. C., and
cultivation time is about 12 to about 72 hours. The paclitaxel
concentration in the medium is not particularly limited, as long as
it falls in a range of concentration allowing the induction of
apoptosis in cells that are not expressing PCA-1, and the
concentration is, for example, about 0.1 to about 20 .mu.M. The
concentration of caspase 8/FADD-dependent apoptosis inducer in the
medium is not particularly limited, as long as it falls in a range
of concentration allowing the induction of apoptosis in cells that
are not expressing PCA-1, and the concentration is chosen as
appropriate according to the choice of inducer and the choice of
cells used for the screening; for example, when TRAIL is used as
the caspase 8/FADD-dependent apoptosis inducer, the TRAIL
concentration in the medium is about 1 to about 1000 ng/ml.
[0121] Next, the degree of apoptosis in the cells brought into
contact with the test compound is evaluated. A measurement of
apoptosis can be performed by a method known per se; for example,
agarose gel electrophoresis for detecting a fragment cleaved in DNA
nucleosome units as a "DNA ladder", pulse field electrophoresis for
detecting apoptosis that produces 50 to 300 kbp high molecular
weight DNA fragments, the in situ end labeling method (TUNEL
method) for detecting a DNA cleavage end is to detect apoptosis in
tissue, and a method comprising staining cells with a fluorescent
dye, and thereafter performing the detection of cell size change
and cells with decreased DNA contents or detection of live or dead
cells, and the like, by flowcytometry, and the like can be
used.
[0122] Next, the degree of apoptosis in the cells brought into
contact with the test compound is compared with the degree of
apoptosis in control cells not brought into contact with the test
compound. This comparison of the degree of apoptosis is performed
preferably on the basis of the presence or absence of a significant
difference. Although the apoptosis in the control cells not brought
into contact with the test compound may be measured before, or
simultaneously with, the measurement of the apoptosis in the cells
brought into contact with the test compound, it is preferable, from
the viewpoint of experimental accuracy and reproducibility, that
the value be simultaneously measured.
[0123] As a result of the comparison, a compound judged to have
increased the degree of paclitaxel-induced or caspase
8/FADD-dependent apoptosis compared with the control cells is
selected as a compound for promoting paclitaxel-induced apoptosis
or a compound for promoting caspase 8/FADD-dependent apoptosis.
[0124] A compound that can be obtained by the screening method of
the present invention can be rendered a candidate compound for
pharmaceutical development, and, like the above-described agent of
the present invention, can be prepared as a paclitaxel-induced
apoptosis promoting agent, a caspase 8/FADD-dependent apoptosis
promoting agent, or a prophylactic/therapeutic agent for cancer
(prostate cancer and the like).
[0125] The present invention is hereinafter described in more
detail by means of the following Examples, which, however, do not
limit the scope of the present invention by any means.
EXAMPLES
Example 1
Materials and Methods
1) Preparation of Cell Line, Gene, and Transfected Cell Line
[0126] The human prostate cancer cell line DU145 (purchased from
ATCC) was cultured in RPMI medium (in the presence of 10% serum)
and used. The human PCA-1 gene was cleaved out from a PCA-1 vector,
and this was inserted into pIRES/Neo, which is a vector that
encodes the neomycin resistance gene (hereinafter pIRES/Neo/PCA-1).
DU145 was transfected (lipofection method) with this gene; 48 hours
later, neomycin was added, the cells were cultured for about 2
months, and at least two clones exhibiting resistance to neomycin
(DU145/PCA-1) were isolated and subjected to experiments that
followed. For control, a clone (DU145/Neo) incorporating an empty
vector, and cultured under the same conditions, was used.
[0127] Regarding FLIP (FLICE-like inhibitory protein), a cDNA was
prepared by RT-PCR, inserted into pME18S-FLAG2, and DU145 was
transfected (lipofection method) with the vector along with the
pTK-Hyg vector (Clonetech Laboratories Japan, Ltd., Tokyo, Japan),
which is a vector that encodes the hygromycin resistance gene. The
cells were cultured in the presence of hygromycin for about 2
months, and at least two clones exhibiting resistance to hygromycin
(DU145/FLIP) were isolated and subjected to experiments that
followed. For control, a clone (DU145/HygB) incorporating an empty
vector, and cultured under the same conditions, was used.
2) Knockdown of PCA-1
[0128] siRNA against PCA-1 (CCGAGAGUGAACCUGACC: SEQ ID NO:3) was
inserted into the pRNA-H1.1/Hygro vector, and DU145 was transiently
transfected with the vector (lipofection method). Expression
suppressive and knockdown effects were confirmed by Western
blotting.
3) FLIP Ubiquitination Assay
[0129] After stimulation with MG132, the cells were harvested and
immunoprecipitated with an anti-FLIP antibody; thereafter, Western
blot was performed using the anti-FLIP antibody and an
anti-ubiquitin antibody, and the ubiquitination of the FLIP
molecule was examined.
4) Search for Cell Growth
[0130] Experiments were performed using the MTS
[(3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulphonyl)-
-2H-tetrazolium, inner salt] reagent (Promega, Tokyo, Japan) in
accordance with the attached protocol.
(Results)
1) Function of PCA-1 on Cell Growth Via Epidermal Growth Factor
[0131] Cell growth for 36 hours under serum-free conditions was
examined. Although there was no significant difference without
stimulation (FIG. 2), cell growth increased by 1.5 fold to 2 fold
for a PCA-1-overexpressing cell line (DU145/PCA-1) compared with a
control (DU145/Neo) with stimulation with EGF (10 ng/ml); this
effect was inhibited (cancelled) by a pretreatment with an
inhibitor of extracellular stress-regulated kinase (ERK) (U0126)
(FIG. 3).
[0132] In DU145/PCA-1, EGF-induced ERK activation and the
expression of the target gene thereof, cyclin D1, increased
significantly compared with the control (DU145/Neo) (FIG. 4). ERK
activation was determined by searching for the expression of
phospho-ERK by Western blotting.
2) Inhibition of FLIP Ubiquitination and Promotion of FLIP-Raf-1
Binding by PCA-1
[0133] In DU145/PCA-1, the expression of FLIP protein was increased
significantly compared with the control (DU145/Neo) (by Western
blotting) (FIG. 5); however, as far as determined by RT-PCR, no a
significant difference was observed in mRNA content. Hence, the
role of PCA-1 in the ubiquitination of FLIP was analyzed. After
MG132 treatment, the ubiquitination of FLIP was examined; in the
control (DU145/Neo), the ubiquitination of FLIP was confirmed, but
in DU145/PCA-1, the ubiquitination of FLIP was inhibited (FIG.
6).
[0134] Interestingly, in DU145 wherein FLIP only was forcibly
expressed (DU145/FLIP), an FLIP-Raf-1 interaction was observed, but
this phenomena was inhibited (cancelled) by knocking down
endogenous PCA-1 by transient forced expression of PCA-1 siRNA
(FIG. 8).
[0135] From these findings, it was thought that PCA-1 not only
inhibits the ubiquitination of FLIP to thereby increase the amount
of FLIP protein expressed, but also influences the mutual binding
(interaction) of FLIP and Raf-1 to intensify the cell growth
signals from Raf-1 and below.
3) Role of PCA-1 in Paclitaxel-Induced Apoptosis
[0136] A control cell line (DU145/Neo) and DU145/PCA-1 were
stimulated with paclitaxel (100 nM); 48 hours later, apoptosis was
quantified using flowcytometry. As a result, in DU145/PCA-1,
paclitaxel-induced apoptosis was significantly inhibited compared
with the control strain (DU145/Neo) (FIG. 9). It was also found
that in DU145/PCA-1, ERK activation by paclitaxel was promoted
compared with the control (DU145/Neo), and that when an ERK
inhibitor (U0126) was used, the paclitaxel-induced apoptosis
inhibitory effect of PCA-1 was cancelled (FIG. 10).
[0137] From these findings, it was thought that PCA-1 inhibits
apoptosis induction by promoting ERK activation by paclitaxel.
4) Role of PCA-1 in Apoptosis Induced by Tumor Necrosis
Factor-Related Apoptosis-Inducing Ligand (TRAIL)
[0138] TRAIL is drawing attention as a new-generation anticancer
agent for prostate cancer, and it has been reported that FLIP acts
suppressively on the mechanism therefor. Hence, the effects of
PCA-1 on TRAIL-induced apoptosis were analyzed. DU145/PCA-1 and
control (DU145/Neo) were stimulated with TRAIL 50 ng/ml; 24 hours
later, apoptosis induction was analyzed by flowcytometry; apoptosis
induction was significantly inhibited in DU145/PCA-1 compared with
the control (FIG. 11).
[0139] A schematic diagram showing the effects of PCA-1 on cell
growth and apoptosis, suggested from the results shown above, is
shown in FIG. 12.
Example 2
Materials and Methods
1) Cell Line
[0140] The human prostate cancer cell line DU145 (purchased from
ATCC) was cultured in RPMI1640 medium (in the presence of 10% fetal
bovine serum) and used.
2) Knockdown of PCA-1 with siRNA
[0141] DU145 was transiently transfected with siRNAs against PCA-1
(gaaagaagcugacuggauauu (SEQ ID NO:4), gcacauuugagaugagaaauu (SEQ ID
NO:5), gagagaagcuucacugaaauu (SEQ ID NO:6)) using DharmaFECT 1 (GE
Healthcare Bioscience.). Expression suppression and knockdown
effects were confirmed by real-time PCR and PCA-1 quantitative
ELISA method. Control siRNA (auccgcgcgauaguacgua (SEQ ID NO:7)) was
purchased from GE Healthcare Bioscience.
3) Real-time PCR of PCA-1
[0142] Real-time PCR was performed using the SYBE ExScript RT-PCR
kit (Takara Bio Inc.). The PCA-1, GAPDH-specific primers, and PCR
conditions used are shown below.
[0143] Primer Base Sequences
TABLE-US-00001 hABH3 F; TACCACTGCTAAGAGCCATCTCC (SEQ ID NO: 8) R;
ACCTGCTGAGGTTCTTTGAACAC (SEQ ID NO: 9) GAPDH F;
CCATCACCATCTTCCAGGAG (SEQ ID NO: 10) R; AATGAGCCCAGCCTTCTCC (SEQ ID
NO: 11)
[0144] Real-Time PCR Conditions
TABLE-US-00002 PCA-1 95.degree. C. 9 min GAPDH 95.degree. C. 30 sec
.dwnarw. .dwnarw. 95.degree. C. 30 sec 95.degree. C. 15 sec
52.degree. C. 30 sec {close oversize bracket} .times.40 67.degree.
C. 30 sec {close oversize bracket} .times.45 72.degree. C. 15 sec
72.degree. C. 15 sec .dwnarw. .dwnarw. 57.degree. C. 15 sec
72.degree. C. 15 sec
4) Enzyme-Linked Immunosorbent Assay (ELISA) of PCA-1
[0145] A trapping antibody (rabbit anti-PCA-1 antibody) was added
to a 96-well plate (1 .mu.g/well), and the plate was placed in a
wet box and incubated at 4.degree. C. overnight. After the plate
was washed with a PBS containing 1% Tween 20, a blocking agent was
added, and the plate was allowed to stand at room temperature for
1.5 hours. After plate washing, a detection antibody (mouse
anti-PCA-1 antibody clone 2-5A, 0.25 .mu.g/well) was added, and the
plate was allowed to stand at room temperature for 1.5 hours. After
plate washing, an assay sample (100 .mu.l/well) was added, and the
plate was allowed to stand at room temperature for 1.5 hours. After
plate washing, a tertiary antibody (HRP-labeled goat anti-mouse IgG
antibody, 2 ng/well) was added, and the plate was allowed to stand
at room temperature for 2 hours. After final plate washing, a color
developer was added (50 .mu.l/well); 30 minutes later, absorbance
was measured at 415 nm.
5) WST-1 Method
[0146] Two days after DU145 was transfected with siRNA, the cells
were harvested, and 100 .mu.l of the cells were sown to a 96-well
plate at 1.times.10.sup.4/ml. Thereafter, 10 .mu.l of a 1:9 mixture
of a 1-methoxy PMS (1-methoxy-5-methylphenazinium.methylsulfate)
solution and a WST-1
(2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium,
monosodium salt) solution was added to each well every 24 hours; 1
hour later, absorbance was measured at 450 nm. As the control
wavelength, 630 nm was used. The day of the start of transfection
is designated as day 0.
6) Apoptosis Analysis
[0147] After DU145 was transfected with PCA-1 siRNA, the cells were
harvested and fixed with ethanol. Thereafter, the cells were
stained with propidium iodide, and the ratio of apoptosis cells was
analyzed using a flowcytometer.
(Results)
[0148] 1) Knockdown with PCA-1 siRNA
[0149] Three days after transfection with the PCA-1 siRNAs (day 3),
RNA was prepared, and real-time PCR was performed. As a result, in
all transfectants with the three kinds of PCA-1 siRNAs, the PCA-1
mRNA level was not more than about 20% compared with the control
siRNA transfectant. When quantified at the protein level using a
PCA-1 ELISA system, in the PCA-1 siRNA transfectants, the level was
below the limit of detection (20 pg). This result shows that
effective knockdown was achieved with the PCA-1 siRNAs used.
2) Induction of Apoptosis by Knocking-Down of PCA-1
[0150] The growth of DU145 wherein PCA-1 had been knocked down was
analyzed by WST-1. In the control siRNA transfected cells,
remarkable growth was observed over time. Meanwhile, in the cells
wherein PCA-1 had been knocked down, almost no growth was observed
until day 6. The table below shows the absorbance on each
measurement day relative to the absorbance on day 3 written as
1.
TABLE-US-00003 Transfection Day 3 Day 4 Day 5 Day 6 Day 7 Day 8
Control siRNA 1 1.99 3.98 7.25 11.91 12.90 PCA-1 siRNA 1 1.14 1.42
1.35 1.95 2.45
3) Induction of Apoptosis by Knocking-Down of PCA-1
[0151] Apoptosis of DU145 by knocking-down of PCA-1 was analyzed.
On Day 2, in both the control siRNA transfectant and PCA-1 siRNA
transfectant, almost no apoptosis cells were observed. However, in
the cells wherein PCA-1 had been knocked down, the ratio of
apoptosis cells increased remarkably over time.
TABLE-US-00004 Transfection Day 2 Day 3 Day 4 Day 5 Control siRNA
0.98% 1.96% 5.00% 1.88% PCA-1 siRNA 1.18% 10.63% 22.19% 20.99%
INDUSTRIAL APPLICABILITY
[0152] Because a compound that suppresses the expression or
function of PCA-1, which is an active ingredient of the agent of
the present invention, cancels the apoptosis inhibitory action and
cell growth enhancing action of PCA-1, and reduces the
anticancer-agent resistance and cell growth of cancer cells, it is
useful as an apoptosis promoting agent, a cell growth inhibitor,
and a prophylactic/therapeutic agent for cancer. By selecting a
compound capable of suppressing the expression or function of
PCA-1, it is possible to screen for a compound for promoting
apoptosis, a compound for inhibiting cell growth, and a compound
for preventing/treating cancer, having a novel mechanism of
action.
[0153] This application is based on a patent application No.
2005-227274 filed in Japan (filing date: Aug. 4, 2005), the
contents of which are incorporated in full herein by this
reference.
Sequence CWU 1
1
1111520DNAHomo sapiensCDS(407)..(1267) 1aggtcacaga ctgcggagtg
ggtcaggggc tgcgagggct gccccaagtc ctaccgggtt 60tgcacgggcg cgcccggctc
cgcccgcaag tgcgccttcc tgacttactg ctgggtgcgc 120ggggctgggg
gtgcgagtac cacccctgaa gtctcttcct gggcgacctc cggggcctca
180ttctaggcct ccttaaagag aaggatctaa attaggaaaa ggaagtgccc
ttatccacga 240ccaagctctt ccacctgcgg agctcgctta gtctgcacct
caaccgtgcg gaaagtgact 300gccctgttta ctgaggaaaa actggggctc
agaaagatac catggagtag tttgaaacag 360gaacaaaatc ttctgaaagc
tcggagcaga agcctttttg gtcaac atg gag gaa 415 Met Glu Glu 1aaa aga
cgg cga gcc cga gtt cag gga gcc tgg gct gcc cct gtt aaa 463Lys Arg
Arg Arg Ala Arg Val Gln Gly Ala Trp Ala Ala Pro Val Lys 5 10 15agc
cag gcc att gct cag cca gct acc act gct aag agc cat ctc cac 511Ser
Gln Ala Ile Ala Gln Pro Ala Thr Thr Ala Lys Ser His Leu His20 25 30
35cag aag cct ggc cag acc tgg aag aac aaa gag cat cat ctc tct gac
559Gln Lys Pro Gly Gln Thr Trp Lys Asn Lys Glu His His Leu Ser Asp
40 45 50aga gag ttt gtg ttc aaa gaa cct cag cag gta gta cgt aga gct
cct 607Arg Glu Phe Val Phe Lys Glu Pro Gln Gln Val Val Arg Arg Ala
Pro 55 60 65gag cca cga gtg att gac aga gag ggt gtg tat gaa atc agc
ctg tca 655Glu Pro Arg Val Ile Asp Arg Glu Gly Val Tyr Glu Ile Ser
Leu Ser 70 75 80ccc aca ggt gta tct agg gtc tgt ttg tat cct ggc ttt
gtt gac gtg 703Pro Thr Gly Val Ser Arg Val Cys Leu Tyr Pro Gly Phe
Val Asp Val 85 90 95aaa gaa gct gac tgg ata ttg gaa cag ctt tgt caa
gat gtt ccc tgg 751Lys Glu Ala Asp Trp Ile Leu Glu Gln Leu Cys Gln
Asp Val Pro Trp100 105 110 115aaa cag agg acc ggc atc aga gag gat
ata act tat cag caa cca aga 799Lys Gln Arg Thr Gly Ile Arg Glu Asp
Ile Thr Tyr Gln Gln Pro Arg 120 125 130ctt aca gca tgg tat gga gaa
ctt cct tac act tat tca aga atc act 847Leu Thr Ala Trp Tyr Gly Glu
Leu Pro Tyr Thr Tyr Ser Arg Ile Thr 135 140 145atg gaa cca aat cct
cac tgg cac cct gtg ctg cgc aca cta aag aac 895Met Glu Pro Asn Pro
His Trp His Pro Val Leu Arg Thr Leu Lys Asn 150 155 160cgc att gaa
gag aac act ggc cac acc ttc aac tcc tta ctc tgc aat 943Arg Ile Glu
Glu Asn Thr Gly His Thr Phe Asn Ser Leu Leu Cys Asn 165 170 175ctt
tat cgc aat gag aag gac agc gtg gac tgg cac agt gat gat gaa 991Leu
Tyr Arg Asn Glu Lys Asp Ser Val Asp Trp His Ser Asp Asp Glu180 185
190 195ccc tca cta ggg agg tgc ccc att att gct tca cta agt ttt ggt
gcc 1039Pro Ser Leu Gly Arg Cys Pro Ile Ile Ala Ser Leu Ser Phe Gly
Ala 200 205 210aca cgc aca ttt gag atg aga aag aag cca cca cca gaa
gag aat gga 1087Thr Arg Thr Phe Glu Met Arg Lys Lys Pro Pro Pro Glu
Glu Asn Gly 215 220 225gac tac aca tat gtg gaa aga gtg aag ata ccc
ttg gat cat ggg acc 1135Asp Tyr Thr Tyr Val Glu Arg Val Lys Ile Pro
Leu Asp His Gly Thr 230 235 240ttg tta atc atg gaa gga gcg aca caa
gct gac tgg cag cat cga gtg 1183Leu Leu Ile Met Glu Gly Ala Thr Gln
Ala Asp Trp Gln His Arg Val 245 250 255ccc aaa gaa tac cac tct aga
gaa ccg aga gtg aac ctg acc ttt cgg 1231Pro Lys Glu Tyr His Ser Arg
Glu Pro Arg Val Asn Leu Thr Phe Arg260 265 270 275aca gtc tat cca
gac cct cga ggg gca ccc tgg tga cgtcagagct 1277Thr Val Tyr Pro Asp
Pro Arg Gly Ala Pro Trp 280 285ttgagagaga agcttcactg aaacggagca
aaccttccac tgagaagcca cttcaagagg 1337ctggtgctgc tagatctcat
gatgtggctg ttgggaagat ggtggggttt gtttgccagc 1397ttggagtcct
attaaatgaa agccagcaac tcatgttggt aataggtcta ctgtgggaac
1457agttatccct aaccacagct caaaatcgct atcatcttta ggcaaattaa
aatctatgtg 1517gca 15202286PRTHomo sapiens 2Met Glu Glu Lys Arg Arg
Arg Ala Arg Val Gln Gly Ala Trp Ala Ala1 5 10 15Pro Val Lys Ser Gln
Ala Ile Ala Gln Pro Ala Thr Thr Ala Lys Ser 20 25 30His Leu His Gln
Lys Pro Gly Gln Thr Trp Lys Asn Lys Glu His His 35 40 45Leu Ser Asp
Arg Glu Phe Val Phe Lys Glu Pro Gln Gln Val Val Arg 50 55 60Arg Ala
Pro Glu Pro Arg Val Ile Asp Arg Glu Gly Val Tyr Glu Ile65 70 75
80Ser Leu Ser Pro Thr Gly Val Ser Arg Val Cys Leu Tyr Pro Gly Phe
85 90 95Val Asp Val Lys Glu Ala Asp Trp Ile Leu Glu Gln Leu Cys Gln
Asp 100 105 110Val Pro Trp Lys Gln Arg Thr Gly Ile Arg Glu Asp Ile
Thr Tyr Gln 115 120 125Gln Pro Arg Leu Thr Ala Trp Tyr Gly Glu Leu
Pro Tyr Thr Tyr Ser 130 135 140Arg Ile Thr Met Glu Pro Asn Pro His
Trp His Pro Val Leu Arg Thr145 150 155 160Leu Lys Asn Arg Ile Glu
Glu Asn Thr Gly His Thr Phe Asn Ser Leu 165 170 175Leu Cys Asn Leu
Tyr Arg Asn Glu Lys Asp Ser Val Asp Trp His Ser 180 185 190Asp Asp
Glu Pro Ser Leu Gly Arg Cys Pro Ile Ile Ala Ser Leu Ser 195 200
205Phe Gly Ala Thr Arg Thr Phe Glu Met Arg Lys Lys Pro Pro Pro Glu
210 215 220Glu Asn Gly Asp Tyr Thr Tyr Val Glu Arg Val Lys Ile Pro
Leu Asp225 230 235 240His Gly Thr Leu Leu Ile Met Glu Gly Ala Thr
Gln Ala Asp Trp Gln 245 250 255His Arg Val Pro Lys Glu Tyr His Ser
Arg Glu Pro Arg Val Asn Leu 260 265 270Thr Phe Arg Thr Val Tyr Pro
Asp Pro Arg Gly Ala Pro Trp 275 280 285318RNAArtificialsiRNA
against human PCA-1 3ccgagaguga accugacc 18421RNAArtificialsiRNA to
PCA-1 4gaaagaagcu gacuggauau u 21521RNAArtificialsiRNA to PCA-1
5gcacauuuga gaugagaaau u 21621RNAArtificialsiRNA to PCA-1
6gagagaagcu ucacugaaau u 21719RNAArtificialcontrol siRNA
7auccgcgcga uaguacgua 19823DNAArtificialprimer 8taccactgct
aagagccatc tcc 23923DNAArtificialprimer 9acctgctgag gttctttgaa cac
231020DNAArtificialprimer 10ccatcaccat cttccaggag
201119DNAArtificialprimer 11aatgagccca gccttctcc 19
* * * * *