U.S. patent application number 12/655083 was filed with the patent office on 2010-11-18 for lectin compositions and methods for modulating an immune response to an antigen.
This patent application is currently assigned to Genitrix LLC. Invention is credited to Andrew H. Segal, Elihu Young.
Application Number | 20100292453 12/655083 |
Document ID | / |
Family ID | 32234181 |
Filed Date | 2010-11-18 |
United States Patent
Application |
20100292453 |
Kind Code |
A1 |
Segal; Andrew H. ; et
al. |
November 18, 2010 |
Lectin compositions and methods for modulating an immune response
to an antigen
Abstract
The present invention also relates to a method of reducing
metastases in a subject comprising administering to the subject a
composition comprising a multifunctional molecule comprising a
first part which is capable of binding to an antigen bearing target
and a second part which is capable of binding to a cell.
Inventors: |
Segal; Andrew H.; (Boston,
MA) ; Young; Elihu; (Sharon, MA) |
Correspondence
Address: |
EDWARDS ANGELL PALMER & DODGE LLP
P.O. BOX 55874
BOSTON
MA
02205
US
|
Assignee: |
Genitrix LLC
|
Family ID: |
32234181 |
Appl. No.: |
12/655083 |
Filed: |
December 21, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10666898 |
Sep 19, 2003 |
|
|
|
12655083 |
|
|
|
|
10645000 |
Aug 20, 2003 |
|
|
|
10666898 |
|
|
|
|
60404823 |
Aug 20, 2002 |
|
|
|
60487407 |
Jul 15, 2003 |
|
|
|
Current U.S.
Class: |
536/23.4 |
Current CPC
Class: |
A61K 2039/5152 20130101;
C12N 2760/16134 20130101; C07K 2319/33 20130101; A61K 39/0011
20130101; A61K 39/39 20130101; C07K 2319/00 20130101; A61K 2039/545
20130101; A61K 39/145 20130101; C07K 14/005 20130101; A61K
2039/55527 20130101; A61K 2039/55516 20130101; A61K 2039/6031
20130101; C07K 14/535 20130101; A61K 2039/55522 20130101; C12N
2760/16034 20130101; A61K 38/00 20130101 |
Class at
Publication: |
536/23.4 |
International
Class: |
C07H 21/04 20060101
C07H021/04 |
Claims
1. A composition comprising a nucleic acid molecule encoding a
fusion polypeptide, said fusion polypeptide comprising a first
amino acid sequence which is selected from: a carbohydrate binding
domain of a collectin; a carbohydrate binding domain of a galectin;
a carbohydrate binding domain of a C-type lectin; or an amino acid
sequence which can bind to a carbohydrate on a glycoprotein, said
carbohydrate being chosen from the group: D-mannose, D-glucose,
D-fucose, L-fucose, N-acetyl-beta-D-glucosamine,
N-acetyl-beta-D-glucosamine, a sialic acid; and a second amino acid
sequence comprising a ligand for a cell surface polypeptide, said
ligand being chosen from the group: a ligand for a cytokine
receptor, a ligand for CD40, a ligand for an adhesion molecule, a
ligand for a defensin receptor, a ligand for a heat shock protein
receptor, a ligand for a counterreceptor for a T cell costimulatory
molecule.
2. The composition of claim 1, wherein said first amino acid
sequence is N-terminal to said second amino acid sequence.
3. The composition of claim 1, wherein said first amino acid
sequence is C-terminal to said second amino acid sequence.
4. The composition of claim 1, wherein said first amino acid
sequence can bind to a sialic acid on a glycoprotein, said sialic
acid comprising at least one of the following carbohydrate
structures: N-acetylneuraminic acid, alpha-NeuNAc-[2->6]-Gal,
alpha-NeuNAc-[2->6]-GalNAc, alpha-NeuNAc-[2->3]-Gal.
5. The composition of claim 1, wherein said first amino acid
sequence comprises a carbohydrate-binding domain of a naturally
occurring lectin.
6. The composition of claim 1, wherein said first amino acid
sequence comprises at least about 10 contiguous amino acids of a
hemagglutinin.
7. The composition of claim 6, wherein said hemagglutinin is an
influenza virus hemagglutinin.
8. The composition of claim 7, wherein said contiguous amino acids
of an influenza hemagglutinin are contiguous amino acids of an
influenza hemagglutinin HA1 domain.
9. The composition of claim 7, wherein said influenza virus is an
influenza A virus.
10. The composition of claim 7, wherein said influenza virus is of
a subtype that infects humans.
11. The composition of claim 9, wherein said influenza virus is of
an H1 subtype.
12. The composition of claim 11, wherein said influenza virus is
from the strain A/PR/8/34.
13. The composition of claim 9, wherein said influenza virus is of
an H2 or H3 subtype.
14. The composition of claim 7, wherein said influenza virus is of
a subtype that does not infect humans.
15. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a mammalian cell surface
polypeptide.
16. The composition of claim 15, wherein said ligand for a cell
surface polypeptide is a ligand for a mouse cell surface
polypeptide.
17. The composition of claim 15, wherein said ligand for a cell
surface polypeptide is a ligand for a human cell surface
polypeptide.
18. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a cell surface polypeptide of a
leukocyte.
19. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a cell surface polypeptide of
an antigen presenting cell.
20. The composition of claim 19, wherein said ligand for a cell
surface polypeptide is a ligand for a cell surface polypeptide of a
professional antigen presenting cell.
21. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a cell surface polypeptide of a
dendritic cell.
22. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a mouse GM-CSF receptor.
23. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises at least about five contiguous amino
acids of a mouse GM-CSF.
24. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises a mouse GM-CSF.
25. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a human GM-CSF receptor.
26. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises at least about five contiguous amino
acids of a human GM-CSF.
27. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises a human GM-CSF.
28. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a receptor for an
interleukin.
29. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a receptor for a mouse
interleukin.
30. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a receptor for a human
interleukin.
31. The composition of claim 28, wherein said interleukin is chosen
from the group: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18,
IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25.
32. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises at least about 5 contiguous amino
acids of an interleukin.
33. The composition of claim 32, wherein said interleukin is chosen
from the group: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18,
IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25.
34. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises an interleukin.
35. The composition of claim 34, wherein said interleukin is chosen
from the group: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18,
IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25.
36. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a receptor for a chemokine.
37. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a receptor for a mouse
chemokine.
38. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a receptor for a human
chemokine.
39. The composition of claim 36, wherein said chemokine is a C--C
cytokine.
40. The composition of claim 36, wherein said chemokine is a
C--X--C cytokine.
41. The composition of claim 36, wherein said cell surface
polypeptide is chosen from the group: CXCR-1, CXCR-2, CXCR-3,
CXCR-4, CCR-1, CCR-2, CCR-3, CCR-4, CCR-5, CCR-6, CCR-7, CCR-8.
42. The composition of claim 36, wherein said chemokine is chosen
from the group: 9E3, AMCF, beta-thromboglobulin, ENA-78, eotaxin,
eotaxin-2, IP-10, KC, LIX, mig, MGSA, mob-1, NAP-2, NAP-3, NAP-4,
PBSF, MGSA, mouse KC, MIP-2, MIP-1 alpha, NAP-2, ENA-78, GCP-2,
ACT-2, C10, CCF18, DC-CK1, ELC, Exodus, FIC, GDCF, GDCF-2, HC-21,
HCC-1, 1-309, JE, LAG-1, MARC, MCAF, MCP-1, MCP-2, MCP-3, MCP-4,
MCP-5, MRP-2, RANTES SDF, TARC, ATAC, Ltn, SCM-1, neurotactin.
43. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises at least about 5 contiguous amino
acids of a chemokine.
44. The composition of claim 43, wherein said chemokine is chosen
from the group: 9E3, AMCF, beta-thromboglobulin, ENA-78, eotaxin,
eotaxin-2, IP-10, KC, LIX, mig, MGSA, mob-1, NAP-2, NAP-3, NAP-4,
PBSF, MGSA, mouse KC, MIP-2, MIP-1 alpha, NAP-2, ENA-78, GCP-2,
ACT-2, C10, CCF18, DC-CK1, ELC, Exodus, FIC, GDCF, GDCF-2, HC-21,
HCC-1, 1-309, JE, LAG-1, MARC, MCAF, MCP-1, MCP-2, MCP-3, MCP-4,
MCP-5, MRP-2, RANTES SDF, TARC, ATAC, Ltn, SCM-1, neurotactin.
45. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises a chemokine.
46. The composition of claim 45, wherein said chemokine is chosen
from the group: 9E3, AMCF, beta-thromboglobulin, ENA-78, eotaxin,
eotaxin-2, IP-10, KC, LIX, mig, MGSA, mob-1, NAP-2, NAP-3, NAP-4,
PBSF, MGSA, mouse KC, MIP-2, MIP-1 alpha, NAP-2, ENA-78, GCP-2,
ACT-2, C10, CCF18, DC-CK1, ELC, Exodus, FIC, GDCF, GDCF-2, HC-21,
HCC-1, 1-309, JE, LAG-1, MARC, MCAF, MCP-1, MCP-2, MCP-3, MCP-4,
MCP-5, MRP-2, RANTES SDF, TARC, ATAC, Ltn, SCM-1, neurotactin.
47. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a receptor for an
interferon.
48. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a receptor for a mouse
interferon.
49. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a receptor for a human
interferon.
50. The composition of claim 47, wherein said interferon is chosen
from the group: an interferon-alpha, an interferon-beta, an
interferon gamma.
51. The composition of claim 47, wherein said ligand for a cell
surface polypeptide comprises at least about 5 contiguous amino
acids of an interferon.
52. The composition of claim 47 wherein said interferon is chosen
from the group: an interferon-alpha, an interferon-beta, an
interferon gamma.
53. The composition of claim 47, wherein said ligand for a cell
surface polypeptide comprises an interferon.
54. The composition of claim 53, wherein said interferon is chosen
from the group: an interferon-alpha, an interferon-beta, an
interferon gamma.
55. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a mouse TNF-alpha receptor.
56. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises at least about five contiguous amino
acids of a mouse TNF-alpha.
57. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises a mouse TNF-alpha.
58. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a human TNF-alpha receptor.
59. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises at least about five contiguous amino
acids of a human TNF-alpha.
60. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises a human TNF-alpha.
61. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a mouse flt-3 receptor.
62. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises at least about five contiguous amino
acids of a mouse flt-3.
63. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises a mouse flt-3.
64. The composition of claim 1, wherein said ligand for a cell
surface polypeptide is a ligand for a human flt-3 receptor.
65. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises at least about five contiguous amino
acids of a human flt-3.
66. The composition of claim 1, wherein said ligand for a cell
surface polypeptide comprises a human flt-3.
67. The composition of claim 1, wherein said encoded fusion
polypeptide further comprises a linker interposed between said
first and second amino acid sequences.
68. The composition of claim 67, wherein said linker has the
formula (Gly.sub.xSer).sub.n, wherein n is an integer between 1 and
15, and x is an integer between 1 and 10.
69. The composition of claim 1, wherein said encoded fusion
polypeptide further comprises a secretory signal sequence.
Description
RELATED APPLICATIONS
[0001] The present application is a continuation application to
U.S. Utility application Ser. No. 10/666,898, filed Sep. 19, 2003,
which is a divisional application to U.S. Utility Application with
Ser. No. 10/645,000, filed Aug. 20, 2003, which claims priority to
U.S. Provisional applications 60/404,823, filed Aug. 20, 2002 and
60/487,407, filed Jul. 15, 2003, the entirety of each is hereby
incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] Typically, the specific modulation of an immune response to
an antigen in a subject requires the administration of another
substance, e.g. an adjuvant, in admixture with the antigen in order
to initiate and/or direct the modulation. Traditional adjuvants,
though, have a number of weaknesses. For example, many are crude,
heterogeneous preparations. In addition, many are relatively weak
immunomodulators, and some cause severe local inflammation that is
unacceptable in humans. Purified soluble polypeptides, such as
cytokines, have some advantages over crude adjuvants, but their
value is limited because they diffuse away from the antigen upon
administration. While certain cell-surface molecules may be
potential immunomodulators as components of cell-based vaccines,
their application generally involves gene transfer into the cells,
which is often problematic.
[0003] The invention therefore fills heretofore unmet needs by
providing molecules that can bind to antigen bearing targets, such
as cells, viruses, and isolated antigens, and that can serve as
immunomodulators when administered with an antigen bearing target.
In addition, the invention provides compositions comprising these
molecules and related methods. The compositions and methods of the
invention are also useful for other applications, e.g. any
application in which it is desirable to attach a biological
effector, such as a polypeptide ligand for a cell surface receptor,
to a target structure, such as a virus or a cell.
SUMMARY OF THE INVENTION
[0004] The present invention relates to a multifunctional molecule,
e.g. a fusion polypeptide, comprising a first part which is capable
of binding to an antigen bearing target and a second part which is
capable of binding to a cell. In a preferred embodiment, the first
part is a first cell surface binding moiety and the second part is
a second cell surface binding moiety. In this embodiment, the first
cell surface binding moiety can attach to a virus or cell, e.g. a
tumor cell, which comprises an antigen. It is also particularly
preferred that the second cell surface binding moiety can bind to a
cell-surface polypeptide, e.g. a non-immunoglobulin polypeptide, of
an antigen presenting cell (APC). Thus, in some embodiments, a
multifunctional molecule of the invention can serve as a bridge or
link between an antigen bearing target and an APC.
[0005] As used herein an "antigen bearing target" is an entity
which comprises an antigen. As used herein an "antigen bearing
target" includes, for example, a whole cell which expresses an
antigen a cell fraction comprising an antigen, a membrane fraction
comprising an antigen, a virus comprising an antigen, a viral
particle comprising an antigen, or an antigen, e.g. a polypeptide
antigen, which may be free of any other cell-derived or
virus-derived material. Cellular fractions may be prepared using
methods known to those of skill in the art such as those taught in
Cell Biology A Laboratory Handbook (Academic Press 1994 Editor J.
E. Celis ISBN 0-12-164715-3)
[0006] The term "antigen" as used herein refers to a molecule
against which a subject can initiate a humoral and/or cellular
immune response. Antigens can be any type of biologic molecule
including, for example, simple intermediary metabolites, sugars,
lipids, and hormones as well as macromolecules such as complex
carbohydrates, phospholipids, nucleic acids and proteins. Common
categories of antigens include, but are not limited to, viral
antigens, bacterial antigens, fungal antigens, protozoa and other
parasitic antigens, tumor antigens, antigens involved in autoimmune
disease, allergy and graft rejection, and other miscellaneous
antigens. In the compositions and methods of the invention, it is
preferred that the antigen is a polypeptide, e.g., one comprising
at least seven amino acids.
[0007] As used herein, "antigen presenting cell" or "APC" refers to
cells that ingest and present antigen to T cells. These cells
include phagocytic leukocytes, macrophages, and dendritic cells, B
lymphocytes, and endothelial cells. A "professional APC" is an APC
that is constitutively able to activate a T lymphocyte.
Professional APCs typically constitutively express class II major
histocompatibility molecules and costimulatory molecules such as
B7-1 and/or B7-2.
[0008] In one embodiment, the invention encompasses a
multifunctional molecule, the first part of which is a lectin.
Thus, the multifunctional molecule can bind to one or more
carbohydrates of an antigen bearing target. In a preferred
embodiment of the invention, the first part of the multifunctional
molecule is a lectin and the second portion is a ligand for a cell
surface protein (e.g., a ligand for a cell surface receptor).
Preferably, the cell surface protein is a cell surface receptor of
an APC. Ligands for a cell surface receptor include any ligand
which will bind to a cell surface protein, and preferably include,
but are not limited to, an opsonin, cytokine, adhesion molecule,
counterreceptor of a T cell costimulatory molecule, a defensin, a
ligand for a CD40 molecule, or a heat shock protein, or a portion
of any of these ligands, including about (or at least about) 5, 8,
10, 12, 15, 20, 25, 35, 50, 60, 70, 80, 100, or 120 contiguous
amino acids of such a ligand. Preferably, the multifunctional
molecule which comprises first and second parts comprises an amino
acid sequence which can bind to a cell surface protein (e.g., a
cell surface receptor) including, but not limited to an adhesion
molecule, a costimulatory molecule for a T cell, or a receptor for
at least one of the following types of molecules: a cytokine, a
defensin, a heat shock protein, a CD40 molecule, or an opsonin.
[0009] A cell surface protein (e.g., a cell surface receptor)
useful in the present invention is any cell surface molecule which
can bind the ligand portion of a multifunctional molecule of the
invention. Preferably, the cell surface receptor is a CD40
molecule, a T cell costimulatory molecule, an adhesion molecule, or
a receptor for a cytokine, a defensin, a heat shock protein, an
opsonin, or an adhesion molecule. Cell surface proteins, useful in
the invention include, but are not limited to the cell surface
molecules identified by GenBank Accession number in Appendix I and
II, or those cell surface molecules which are encoded by a nucleic
acid molecule identified by GenBank Accession number in Appendix I
or II.
[0010] The term "cytokine" as used herein refers to a polypeptide
molecule that is naturally secreted by mammalian cells and that
binds to a cell surface protein on a leukocyte, inducing a change
(e.g., a change in the proliferative state, a change in the
transcriptional profile or a change in the propensity to migrate)
in the leukocyte (other than mere occupancy of the leukocyte's
receptors for the cytokine). "Change" refers to at least about a 5%
increase or decrease as compared to in the absence of a cytokine.
The term "cytokine" also refers herein to a polypeptide molecule
that is a ligand for a receptor for a naturally occurring
cytokine.
[0011] Examples of cytokines which are useful in the methods and
compositions of the invention include the following: GM-CSF, Il-2,
IL-4, IL-6, IL-12, ligands for hematopoietin receptors, ligands for
immunoglobulin superfamily receptors, ligands for interferon
receptors, ligands for TNF receptors, and ligands for chemokine
receptors. An antibody against a cytokine receptor can also be a
cytokine.
[0012] In one embodiment of the invention, it is preferred that a
cytokine comprised by a composition of the invention promote a Th1
immune response, i.e., the generation of T cells that express Th1
cytokines such as IL-2 and IFN-.gamma.. In another embodiment, it
is preferred that a cytokine comprised by a composition of the
invention promote a Th2 immune response, i.e., the generation of T
cells that express Th2 cytokines such as IL-4 and IL-10.
[0013] "Engineered cytokines" as described herein are cytokines
which comprise a heterologous cell surface binding moiety.
[0014] The term "opsonin" as used herein refers to naturally
occurring and non-naturally occurring molecules which are capable,
by virtue of being contemporaneously bound or attached to both an
antigen-containing cell and an antigen-presenting cell (APC), of
acting as a link or coupling agent (an adapter) between the antigen
and the APC to allow more efficient binding, engulfment, and
internalization of the antigen-containing cell by the APC. An
opsonin useful according to the invention, also includes
non-naturally occurring opsonins capable of binding to APCs via
receptors that can bind naturally occurring opsonins.
[0015] The term "opsonin" as used herein can also refer to
molecules which can be processed such that at least one product of
the processing step or steps is capable of, by virtue of being
contemporaneously bound or attached to both an antigen-containing
cell and an APC, acting as a link or coupling agent to allow more
efficient binding, engulfment, and internalization of other
antigen-containing cells by the APC. An opsonin can also be any
polypeptide chain of a multichain opsonin.
[0016] Examples of opsonins which are useful in the methods and
compositions of the invention include the following: vitronectin,
fibronectin, complement components such as C1q (including any of
its component polypeptide chains A, B and C), complement fragments
such as C3d, C3b and C4b, mannose binding protein, conglutinin,
surfactant proteins A and D, C-reactive protein (CRP),
alpha-2-macroglobulin, and immunoglobulins, for example, the Fc
portion of an immunoglobulin.
[0017] "Innate opsonins" are opsonins of the innate immune system
and are known in the art as secreted polypeptide molecules of the
innate immune system and are believed to bind contemporaneously to
an antigen and to the surface of an APC. They can thus act as
"bridges", and are thought, by virtue of this property, to promote
internalization of antigens by APCs. The mode in which opsonins
bind to antigens varies among opsonins, and can be covalent or
noncovalent. In general, the antigen-binding moieties of innate
opsonins differ from the antigen-binding moieties of
immunoglobulins in that the former are relatively invariant among
members of the same species, and do not undergo diversification
during the ontogeny of an individual.
[0018] A molecule containing a naturally occurring APC-binding
moiety shall be considered an opsonin if it contains a moiety
through which it can be stably bound or attached to a cell such
that the APC-binding moiety is located in the extracellular space,
whether or not the opsonin molecule contains its natural
antigen-binding domain.
[0019] "Engineered opsonins", as described herein, include
molecules in which a cell surface binding moiety is substituted for
the natural antigen-binding domain of an opsonin or where a cell
surface binding moiety is linked to the opsonin without
modification or removal of the natural antigen-binding domain of
the opsonin.
[0020] A "cell surface binding moiety" is a moiety through which a
molecule can be stably bound to a cell surface, e.g. a cell wall, a
polysaccharide capsule, or the lipid or protein component of a
plasma membrane, or to the surface of a virus. Such moieties
include but are not limited to crosslinking moieties and lipid
moieties. It is preferred that the cell surface binding moiety bind
to a cell by a means other than interaction of a polypeptide with
its cognate cell-surface polypeptide. It is further preferred that
the cell surface binding moiety comprise a non-polypeptide moiety.
In a preferred embodiment, a lipid moiety is linked to the
engineered molecule via a glycosylphosphatidylinositol (GPI)
moiety. In another preferred embodiment, the lipid comprises a
fatty acid, e.g. palmitate. In yet another preferred embodiment of
the invention, the cell surface binding moiety is linked to an
opsonin or an antigen-binding domain-truncated opsonin at the
antigen-binding end of the opsonin. In another preferred
embodiment, the multifunctional molecule comprises an idiotypic
portion of an immunoglobulin which can bind to an APC. Preferably,
the opsonin of an opsonin-enhanced cell is one of alpha' chain C3b
or mannose binding protein.
[0021] If the opsonin is a fragment of C3, it is preferred hat it
bind to CR1 with a greater affinity than to CR2. It is further
preferred that the fragment of C3 not be a ligand for CR2.
Preferably, the opsonin is neither C3bi, C3d, nor C3dg.
[0022] It is preferred that the opsonins bind to receptors that
trigger phagocytosis and that are non-clonotypic and thus do not
vary from cell to cell as, for example, clonotypic receptors do.
Non-clonotypic receptors are present on cells which play a role in
innate immunity, and include, e.g., non-idiotypic receptors.
Examples of such receptors include CR1, CR2, CR3, CR4, and C1q
receptor, receptors containing a component of the C1q receptor,
collectin receptors, receptors for .alpha.2m, receptors for CRP,
and Fc receptors for immunoglobulins.
[0023] "Exogenous" refers to something which is introduced from or
produced outside the cell.
[0024] "Endogenous" refers to something which is expressed or
present naturally in a cell.
[0025] "Heterologous" refers to something which is not naturally
expressed in a cell.
[0026] Preferably, the multifunctional molecule which comprises
first and second parts can bind, via the second part, to the
surface or plasma membrane of an antigen presenting cell (APC),
i.e. a cell that can present antigen to a T cell, e.g. a cell that
can activate a T cell, at least in part by presenting antigen to
the T cell. The APC may be a leukocyte, e.g. a cell of monocytic
lineage and/or a dendritic cell. Preferably, binding of the
multifunctional molecule is independent of expression of an
idiotype, e.g. a clonotypic determinant of an immunoglobulin, on
the APC. Most preferably, the multifunctional molecule comprises a
first end which can bind to a cell that comprises an antigen and a
second end which can bind to a APC.
[0027] The multifunctional molecule may bind to an antigen bearing
target cell by, e.g., inserting into the lipid portion of a cell
membrane or by binding to a structure, e.g. a polypeptide or a
carbohydrate, that is physically associated with the lipid portion
of the membrane. The structure need not be directly in contact with
the lipid portion of the membrane, but may be indirectly attached,
e.g. a carbohydrate that is part of a cell-surface glycoprotein.
Preferably the multifunctional molecule can bind via a first part
to an antigen bearing target, preferably a mammalian cell that
comprises an antigen, and via a second part to an APC. The
invention also encompasses the use of a molecule that can bind via
a first part to a virus or to a non-mammalian cell, e.g. a fungal
or bacterial cell, and via a second part to an APC. In the latter
cases, the first part may bind, e.g., to a component of a cell wall
or a capsule.
[0028] In a preferred embodiment, the multifunctional molecule
which comprises first and second parts comprises a first part which
comprises a lectin and a second part that can bind to a leukocyte,
e.g. an APC, e.g. a cell of monocytic lineage or a dendritic cell
(which may itself be of monocytic lineage). A "lectin", according
to the invention, is a molecule or part of a molecule, e.g. an
amino acid sequence, which can bind to a carbohydrate, e.g. a
polysaccharide. Families of naturally occurring lectins include:
[0029] 1) Galectins, a rapidly growing family of animal lectins.
All of them share galactose-specificity. [0030] 2)
Calcium-dependent (C-type) animal lectins, an extremely large
family composed of members having diverse structures and functions.
[0031] 3) Among this C-type lectin family, selectins form a
distinguishable subfamily by their specific function in leukocyte
adhesion to endothelial cells through sialyl-LewisX recognition.
[0032] 4) Collectins, another subfamily of C-type lectins specific
for mannose, which have a unique structure consisting of a C-type
lectin domain and a collagen-like domain. They are involved in
innate immunity. [0033] 5) Invertebrates are known to contain
various lectins in their body fluids, probably as body-protection
factors. Recently, some lectins from an echinoderm were found to
show hemolytic activity. [0034] 6) Annexins, a group of proteins
having affinity to lipids that were recently shown to be lectins
showing binding to glycosaminoglycans. [0035] 7) The legume lectin
family, which consists of a large number of members, such as ConA,
with variable saccharide specificity comparable to C-type lectins.
[0036] 8) Ricin, the first lectin investigated in Russia more than
100 years ago. It is now evident that the ricin family has many
other homologous members which differ in either toxicity or
sugar-binding specificities.
[0037] Thus, a multifunctional molecule of the invention may bind
to one or more carbohydrates. Carbohydrates to which lectins may
bind also include, for example, carbohydrates comprising lactose,
D-mannose, D-glucose, D-fucose, L-fucose (e.g. alpha-L-fucose),
D-galactose, blood group A oligosaccharides, blood group B
oligosaccharides, saccharides comprising
alpha-D-Gal(1->3)[alpha-Lfuc(1->2)]-beta-D-Gal(1->3/4-beta-D-Glc-
NAc, saccharides comprising alpha-sialyl [2->3]-lactose,
alpha-D-mannosyl glycoconjugates, alpha-NeuNAc-[2->6]-Gal,
alpha-NeuNAc-[2->6]-GalNAc, alpha-NeuNAc-[2->3]-Gal,
N-acetyl-beta-D-glucosamine, terminal alpha-D-galactosyl residues,
terminal beta-D-galactosyl residues, N-acetyllactosamine, terminal
alpha-D-mannosyl residues, N-acetyl-beta-D-glucosamine, terminal
N-acetyl-D-galactosamine, N-acetylneuraminic acid, and terminal
alpha-D-galactosaminyl residues.
[0038] The multifunctional molecule which comprises a lectin may
comprise, for example, the whole of a naturally occurring lectin or
a portion of a naturally occurring lectin, e.g. about (or at least
about) 5, 8, 10, 12, 15, 20, 25, 35, 50, 60, 70, 80, 100, or 120
contiguous amino acids of a naturally occurring polypeptide lectin.
In one embodiment the multifunctional molecule comprises a
carbohydrate-binding domain of a naturally occurring lectin, i.e.,
a portion of a lectin that can bind to a carbohydrate in the
absence of the remainder of the lectin. In another embodiment the
lectin may be non-naturally occurring, e.g. identified from an
artificial library of molecules or designed by modifying the
structure of a naturally occurring lectin.
[0039] Lectins known as "hemagglutinins" bind to carbohydrates on
erythrocytes, e.g. blood group antigens, and when incubated with
these cells cause them to aggregate. The influenza virus
hemagglutinin, for example, binds to sialic acid (as does the human
parainfluenza virus 3 hemagglutinin/neuraminidase). There are at
least 15 known influenza hemagglutinin subtypes, defined by their
distinct antigenic properties. Any of these subtypes, designated,
e.g., H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14,
and H15, may provide amino acid sequences useful in the
compositions and methods of the invention. In one embodiment of the
invention, the hemagglutinin is of a subtype from a virus that
infects humans, e.g. H1, H2, or H3. In another embodiment, the
hemagglutinin is of a subtype from a virus that does not infect
humans, e.g. one of H4 through H15. Amino acid sequences can vary
up to about 20% for influenza hemagglutinins within a given
subtype, and can vary between about 30% and about 70% for influenza
hemagglutinins from different subtypes.
[0040] Influenza hemagglutinin is expressed as a single polypeptide
chain, designated HA0, which trimerizes post-translationally. HA0
is proteolytically cleaved to yield two domains, HA1 and HA2, which
are disulfide-bonded to each other. HA1 comprises significant
sialic acid binding activity, while HA2 is anchored to the viral
membrane and facilitates fusion of this membrane with a host cell
membrane. In preferred embodiments of the invention, the
multifunctional molecule comprising first and second parts
comprises an amino acid sequence of an HA1 domain.
[0041] The molecule may be a fusion polypeptide which comprises one
or more amino acids interposed between the first and second parts
which bind to cells, e.g. a fusion polypeptide which comprises a
first amino acid sequence which can bind to an antigen bearing
target and a second amino acid sequence which can bind to a
leukocyte, and which further comprises at least one amino acid
interposed between the first and second parts. The interposed amino
acids may comprise, e.g., a linker sequence intended to lessen
steric hindrance or other undesirable interactions between the
aforementioned first and second parts. For, example, one such type
of sequence takes the form (Gly.sub.3Ser).sub.n. Additional useful
linkers include, but are not limited to
(Arg-Ala-Arg-Asp-Pro-Arg-Val-Pro-Val-Ala-Thr).sub.1-5 (Xu et al.,
1999, Proc. Natl. Acad. Sci. U.S.A. 96: 151-156), (Gly-Ser).sub.n
(Shao et al., 2000, Bioconjug. Chem. 11: 822-826),
(Thr-Ser-Pro).sub.n (Kroon et al., 2000, Eur. J. Biochem. 267:
6740-6752), (Gly-Gly-Gly).sub.n (Kluczyk et al., 2000, Peptides 21:
1411-1420), and (Glu-Lys).sub.n (Klyczyk et al., 2000, supra),
wherein n is 1 to 15 (each of the preceding references is also
incorporated herein by reference). In another embodiment, no amino
acids are interposed between the first and second parts.
[0042] The present invention further provides a nucleic acid
molecule, preferably a recombinant nucleic acid molecule which
encodes a multifunctional polypeptide of the present invention. The
nucleic acid molecule may be, for example, DNA, RNA, cDNA, or mRNA.
The nucleic acid molecule may be naturally occurring or may be
partially or wholly synthesized using techniques known to those of
skill in the art. In a preferred embodiment, the nucleic acid
molecule is a DNA molecule comprising a first nucleic acid sequence
encoding a first amino acid sequence which can bind to an antigen
bearing target, and a second nucleic acid sequence encoding a
second amino acid sequence which can bind to a cell surface
receptor on an APC.
[0043] The present invention still further provides a vector
comprising the nucleic acid molecule encoding a multifunctional
polypeptide of the invention, e.g. an expression vector suitable
for expressing in a host cell, wherein the host cell is preferably
a eukaryotic cell, more preferably an animal cell, more preferably
a mammalian cell, and still more preferably a human cell. In
another preferred embodiment the host cell is a yeast cell, e.g.
Saccharomyces cerevesiae.
[0044] The invention also provides a host cell comprising a nucleic
acid vector which comprises a sequence encoding the multifunctional
molecule of the present invention. Preferably, the host cell is a
eukaryotic cell, such as a yeast cell- or an animal cell,
preferably a human cell. The host cell may also be a prokaryotic
cell.
[0045] The invention also encompasses a molecule, e.g. a
polypeptide, e.g. a fusion polypeptide, which comprises a first
part that can bind to an antigen bearing target, e.g. a cell, e.g.
a cell that comprises an antigen, and a second part that can bind
to a cell, e.g. a leukocyte, e.g. an APC. The molecule may have any
of the characteristics taught in the descriptions of methods and
compositions herein. Preferably the first and second parts are
heterologous to each other. The molecule may be, e.g., a
recombinant polypeptide expressed in a mammalian cell, an insect
cell, a plant cell, a yeast cell, or a bacterial cell.
[0046] The invention also encompasses a method of modulating an
immune response in an animal comprising the step of expressing in
an animal, e.g. expressing in a host cell of the animal, a
multifunctional molecule of the invention, e.g. a polypeptide which
comprises a first part that can bind to a antigen bearing target
and a second part that can bind to a cell. According to the
invention, "expressing in an animal" means "causing to be present
in an animal". When the molecule is a polypeptide, it is preferably
expressed by introducing into the host cell, in vivo or ex vivo, a
nucleic acid encoding the polypeptide. If the nucleic acid is
introduced into the host cell ex vivo, the host cell may
subsequently be administered to the animal. In a preferred
embodiment, the method further comprises administering to the
animal the antigen to which the immune response is modulated. For
example, the antigen may be administered to the animal as part of a
composition which further comprises a nucleic acid that encodes the
multifunctional molecule. In another preferred embodiment, the
antigen is already present in the animal at the time the
multifunctional molecule is expressed. In yet another preferred
embodiment, the antigen is administered to the animal after
administration of the multifunctional molecule. In still other
preferred embodiments, the antigen is expressed in the animal, e.g.
by administering to the animal a composition comprising a nucleic
acid encoding the antigen, either before or after expression of the
multifunctional molecule in the animal. In another embodiment,
nucleic acid sequences encoding the multifunctional molecule and
the antigen are introduced into one or more host cells of the
animal, e.g. by administering to the animal a composition
comprising those nucleic acid sequences.
[0047] As used herein, the term "modulating an immune response" to
a selected antigen using the methods and compositions of the
invention means rendering the response more or less efficient, more
or less rapid, greater or lesser in magnitude, and/or more or less
easily induced than the response obtained from administration of a
composition which is identical in every respect except that it does
not comprise a multifunctional molecule of the invention. In a
preferred embodiment, the response is between about 5 and 100%, or
preferably between about 5 and 50% or more preferably between about
5 and 25% more or less efficient, more or less rapid, greater or
lesser in magnitude, and/or more or less easily induced than the
response obtained from administration of a composition which is
identical in every respect except that it does not comprise a
multifunctional molecule of the invention.
[0048] The term "modulate the immune response" may refer to
stimulation/activation of an immune response to a selected antigen,
or it may refer to suppression, elimination, or attenuation of an
immune response to a selected antigen. In a preferred embodiment,
modulating the immune response results in stimulation/activation of
an immune response to a selected antigen by about at least 5%, or
preferably between 5 and 50% or more preferably between 50 and
100%, as compared to an immune response in the absence of
vaccination, or it may result in suppression, elimination, or
attenuation of an immune response to a selected antigen by about at
least 5%, or preferably between 5 and 50% or more preferably
between 50 and 100%, as compared to an immune response in the
absence of vaccination. In some cases, one immune response to an
antigen (e.g. a Th1 response) may be increased while another immune
response to the same antigen (e.g. a Th2 response) may be
diminished.
[0049] The invention also encompasses a composition comprising a
multifunctional molecule of the invention and antigen bearing
target, e.g. a virus, a prion, or a cell. Preferably, when the
antigen bearing target is a cell, the multifunctional molecule is
exogenous to the cell. The multifunctional molecule may be
heterologous to the cell. In one embodiment, the multifunctional
molecule is expressed within the cell, e.g. from a recombinant
nucleic acid within the cell. The invention also encompasses a cell
comprising a nucleic acid encoding a multifunctional molecule of
the invention. The multifunctional molecule may have any of the
characteristics set forth herein. An antigen bearing target (e.g.,
a cell) useful in the invention includes, for example, malignant
cells, benign tumor cells, lymphocytes, e.g. B or T lymphocytes
which may be pathogenic and/or autoreactive, cells expressing an
antigen from an exogenously introduced nucleic acid molecule,
eukaryotic cells such as mammalian cells, human cells, fibroblasts,
insect and fungal cells, and prokaryotic cells such as bacterial
cells. Examples of viruses useful in the invention include, e.g.,
retroviruses such as human immunodeficiency viruses 1 and 2;
herpesviruses such as herpes simplex viruses 1 and 2,
cytomegalovirus, and varicella zoster virus; human papilloma virus;
rabies virus; rotavirus; influenza viruses A, B, and C; hepatitis
viruses A, B, C, and E or delta agent; adenoviruses; measles virus;
mumps virus; polio virus; rubella virus; parainflunza viruses;
coxsackie viruses A and B; variola virus; yellow fever virus;
dengue and other hemorrhagic fever viruses; West Nile fever virus;
Eastern equine encephalitis virus; Western equine encephalitis
virus; Venezuelan equine encephalitis virus; Japanese encephalitis
virus; rhinoviruses; and foot and mouth disease virus. Prions
include the agents of scrapie, kuru, and bovine spongiform
encephalitis. The cell, virus, or prion may be attenuated, i.e.
rendered non-pathogenic, by, e.g., killing, irradiation, chemical
fixation, passaging in culture with selection for diminished
pathogenicity, or genetic manipulation. Preferably, the composition
further comprises a leukocyte, e.g. a monocyte, a cell of monocytic
lineage, a macrophage, or a dendritic cell or another APC.
[0050] Preferably, in the inventive methods and compositions, the
cell is substantially unable to divide in vitro. "Substantially
unable to divide in vitro" means that the cell divides at a rate
that is less than about 50% of the rate of division of
corresponding cells which are not treated to prevent cell division.
In a preferred embodiment, the cell divides at a rate that is less
than about 30-50% of the rate of division of corresponding cells
which are not treated to prevent cell division.
[0051] Preferably, the composition is substantially free of culture
medium. As used herein, "culture medium" refers to medium that is
used in cell culture containing at least 2% animal serum, such as
fetal calf serum.
[0052] More particularly, the present invention provides a
multifunctional molecule which is a fusion polypeptide comprising:
a lectin which comprises at least about 10 contiguous amino acids
of an influenza virus hemagglutinin, and at least about 5
contiguous amino acids of a naturally occurring GM-CSF
molecule.
[0053] In one embodiment, the lectin is N-terminal to the
contiguous amino acids of a naturally occurring GM-CSF
molecule.
[0054] In an alternate embodiment, the lectin is C-terminal to the
contiguous amino acids of a naturally occurring GM-CSF
molecule.
[0055] In one embodiment, the lectin comprises at least about 10
contiguous amino acids of the HA1 domain of an influenza virus
hemagglutinin.
[0056] In one embodiment, the lectin is the HAl domain of an
influenza virus hemagglutinin.
[0057] Preferably, the influenza virus hemagglutinin is a
hemagglutinin of an influenza A virus. In other preferred
embodiments the influenza virus hemagglutinin is a hemagglutinin of
an influenza B or influenza C virus.
[0058] In one embodiment, the influenza virus hemagglutinin is of a
subtype from a virus that infects humans. Preferably, the influenza
virus hemagglutinin is of an H1 subtype. Still more preferably, the
influenza virus hemagglutinin is from the influenza A strain
PR/8/34.
[0059] In one embodiment, the influenza virus hemagglutinin is of
an H2 subtype.
[0060] In one embodiment, the influenza virus hemagglutinin is of
an H3 subtype.
[0061] In one embodiment, the influenza virus hemagglutinin is of a
subtype from a virus that does not infect humans.
[0062] In one embodiment the fusion polypeptide comprises the
entire amino acid sequence of a naturally occurring GM-CSF
molecule.
[0063] Preferably, the GM-CSF molecule is a murine GM-CSF. Still
more preferably, the GM-CSF molecule is a human GM-CSF.
[0064] In one aspect, the invention encompasses a method of
reducing the number of metastases, e.g. tumor metastases, in a
subject, e.g. a mammal, e.g. a human, comprising the step of
administering to the subject any of the compositions described
herein, e.g. a composition comprising a multifunctional molecule of
the invention or a nucleic acid molecule encoding a multifunctional
molecule of the invention. Typically, such a composition will
further comprise an antigen associated with the disease, or a
nucleic acid encoding such an antigen. The method may comprise any
of the methods of administering a composition, modulating an immune
response, or treating a disease described herein.
[0065] The invention provides, a method of reducing the number of
metastasis in an animal comprising administering to said animal a
composition comprising a cell comprising an antigen, said
composition further comprising a fusion protein comprising a lectin
and a ligand for a cell surface protein.
[0066] As used herein, a "metastasis" refers to a focus of disease
that is caused by a malignant cell or infectious organism which has
traveled from one site in a host to a second site in the host
(e.g., from one site to a non-contiguous site; e.g., from a first
organ to a second organ). More specifically, "metastasis" refers to
a detectable focus of malignant tumor or infection that is derived
from, and spread from, and is distinct from the primary site of
disease. Accordingly, "metastases" refers to a plurality of foci
either in a single organ or tissue in a subject, or in two or more
organs or tissues in a subject. A "focus" as used herein may be at
least a single malignant or infectious cell, or may be a detectable
focus, which is detectable by one or more of the methods described
hereinbelow. Metastases is said to be detected where a metastases
is able to be detected by one of skill in the art using one or more
of the assay methods described hereinbelow.
[0067] According to the invention, "reducing the number of
metastases" may mean either causing there to be fewer (e.g., at
least 10% fewer, 20%, 30%, 50%, 70%, 90%, and up to at least 100%
fewer) metastases than expected (where the number or severity of
metastases expected is based on the observations made in a set
(e.g., more than one) or similar subjects which has not received
the multifunctional molecule of the invention). In one embodiment
"reducing the number of metastases" may encompass preventing
metastases (e.g. a subject does not develop any detectable foci of
disease), e.g. in a subject with a tumor, or causing one or more
preexisting metastases to become undetectable, e.g. by radiologic,
non-invasive imaging techniques, or other techniques as described
herein. Those skilled in the art will recognize that a metastasis
itself may become undetectable even though residual scarring or
fibrosis may be detectable. Metastases may be, for example, to
bone, brain, liver, lung, or spinal cord, or any other organ or
tissue.
[0068] In another aspect, the invention encompasses a method of
reducing the number of metastases in a population of subjects
comprising the step of administering to one or more subjects any of
the compositions described herein e.g. a composition comprising a
multifunctional molecule of the invention or a nucleic acid
molecule encoding a multifunctional molecule of the invention.
Typically, such a composition will further comprise an antigen
associated with the disease, or a nucleic acid encoding such an
antigen. The method may comprise any of the methods of
administering a composition, modulating an immune response, or
treating a disease described herein.
[0069] In another aspect, the invention encompasses a method of
reducing the size of a metastasis in a subject comprising the step
of administering to the subject any of the compositions described
herein, e.g. a composition comprising a multifunctional molecule of
the invention or a nucleic acid molecule encoding a multifunctional
molecule of the invention. Typically, such a composition will
further comprise an antigen associated with the disease, or a
nucleic acid encoding such an antigen. The method may comprise any
of the methods of administering a composition, modulating an immune
response, or treating a disease described herein. The "size" of a
metastasis, as used herein refers to the one, two or three
dimensional area encompassed by a metastasis, or alternatively,
refers to the number of malignant or infectious cells present in a
metastasis. The size of the metastasis, which may be measured by
direct visualization or by noninvasive imaging, may be reduced by,
e.g., at least about 10%, at least about 20%, 30%, 50%, 70%, 90%,
and up to at least 100%.
[0070] The invention provides a method of reducing the size of a
metastasis in an animal comprising administering to said animal a
composition comprising a cell comprising an antigen, said
composition further comprising a fusion protein comprising a lectin
and a ligand for a cell surface protein.
[0071] In another aspect, the invention encompasses a method of
reducing the average size of metastases in a subject comprising the
step of administering to the subject any of the compositions
described herein. The method may comprise any of the methods of
administering a composition, modulating an immune response, or
treating a disease described herein. According to the invention,
"reducing the average size of metastases" may mean either causing
metastases to be smaller on average than expected, e.g. by
preventing one or more of them from growing to the expected size,
or causing one or more preexisting metastases to become smaller,
thus decreasing the mean size of the metastases. The average size
of the metastases, which may be determined by direct visualization
or by noninvasive imaging, may be reduced by, e.g., at least about
10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at least
100%.
[0072] In another aspect, the invention encompasses a method of
reducing the average size of metastases in a population comprising
the step of administering to one or more subjects any of the
compositions described herein, e.g. a composition comprising a
multifunctional molecule of the invention or a nucleic acid
molecule encoding a multifunctional molecule of the invention. The
method may comprise any of the methods of administering a
composition, modulating an immune response, or treating a disease
described herein.
[0073] Thus, in another aspect the invention encompasses preventing
or treating a disease in a subject by administering to the subject
any of the compositions described herein, e.g. a composition
comprising a multifunctional molecule of the invention or a nucleic
acid molecule encoding a multifunctional molecule of the invention.
Typically, such a composition will further comprise an antigen
associated with the disease, or a nucleic acid encoding such an
antigen. The disease may be, for example, a benign or malignant
tumor, an infectious disease, an allergy, or an autoimmune disease.
"Treating a disease" means decreasing morbidity or mortality
associated with the disease in a patient or population afflicted
with the disease. For example, survival, relapse-free survival, or
disease-free survival may be prolonged by, e.g., at least about
10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at least
100%, or the number of metastases may be reduced by, e.g., at least
about 10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at
least 100%. For preventive applications, the incidence of the
targeted disease may be reduced by, e.g., at least about 10%, at
least about 20%, 30%, 50%, 70%, 90%, and up to at least 100%.
[0074] In yet another aspect, the invention encompasses a method of
modulating an immune response to an antigen in a subject, e.g. a
mammal, e.g. a human, comprising the steps of 1) administering to
the subject a composition comprising the antigen and further
comprising a multifunctional molecule of the invention and 2)
administering to the subject a composition comprising the antigen
and not comprising (i.e. free of) the multifunctional molecule
administered in step 1. Generally, the two steps will be performed
sequentially, e.g. at least 1 day apart, or at least 1 week apart,
or at least 1 month apart, or at least 6 months apart, or at least
1 year apart. In one embodiment, the composition comprising the
multifunctional molecule is administered to the subject prior to
the composition which is free of the multifunctional molecule. In
another embodiment, the composition which is free of the
multifunctional molecule is administered to the subject prior to
the composition which comprises the multifunctional molecule. The
antigen of the composition may be comprised by an antigen bearing
target such as a cell, a cell fraction, a virus, or a viral
particle.
[0075] In yet another aspect, the invention encompasses a method of
modulating an immune response to an antigen in a subject, e.g. a
mammal, e.g. a human, comprising the steps of 1) administering to
the subject a composition comprising the antigen and further
comprising a nucleic acid molecule encoding a multifunctional
molecule of the invention and 2) administering to the subject a
composition comprising the antigen and not comprising (i.e. free
of) the nucleic acid molecule administered in step 1. Again, the
two steps will generally be performed sequentially, e.g. at least 1
day apart, or at least 1 week apart, or at least 1 month apart, or
at least 6 months apart, or at least 1 year apart. In one
embodiment, the composition comprising the nucleic acid molecule is
administered to the subject prior to the composition which is free
of the nucleic acid molecule. In another embodiment, the
composition which is free of the nucleic acid molecule is
administered to the subject prior to the composition which
comprises the nucleic acid molecule. The antigen of the composition
may be comprised by an antigen bearing target such as a cell, a
cell fraction, a virus, or a viral particle. The nucleic acid
molecule may be comprised by an expression vector.
[0076] In yet another aspect, the invention encompasses a method of
modulating an immune response to an antigen in a subject, e.g. a
mammal, e.g. a human, comprising the steps of 1) administering to
the subject a composition comprising a nucleic acid molecule
encoding the antigen and further comprising a multifunctional
molecule of the invention and 2) administering to the subject a
composition comprising a nucleic acid molecule encoding the antigen
and not comprising (i.e. free of) the multifunctional molecule
administered in step 1. Generally, the two steps will be performed
sequentially, e.g. at least 1 day apart, or at least 1 week apart,
or at least 1 month apart, or at least 6 months apart, or at least
1 year apart. In one embodiment, the composition comprising the
multifunctional molecule is administered to the subject prior to
the composition which is free of the multifunctional molecule. In
another embodiment, the composition which is free of the
multifunctional molecule is administered to the subject prior to
the composition which comprises the multifunctional molecule. The
antigen of the composition may be comprised by an antigen bearing
target such as a cell, a cell fraction, a virus, or a viral
particle. One or more of the nucleic acid molecules may be
comprised by an expression vector.
[0077] In yet another aspect, the invention encompasses a method of
modulating an immune response to an antigen in a subject, e.g. a
mammal, e.g. a human, comprising the steps of 1) administering to
the subject a composition comprising the antigen and further
comprising a multifunctional molecule of the invention and 2)
administering to the subject a composition comprising a nucleic
acid molecule encoding the antigen and not comprising (i.e. free
of) the multifunctional molecule administered in step 1. Generally,
the two steps will be performed sequentially, e.g. at least 1 day
apart, or at least 1 week apart, or at least 1 month apart, or at
least 6 months apart, or at least 1 year apart. In one embodiment,
the composition comprising the multifunctional molecule is
administered to the subject prior to the composition which is free
of the multifunctional molecule. In another embodiment, the
composition which is free of the multifunctional molecule is
administered to the subject prior to the composition which
comprises the multifunctional molecule. The antigen of the
composition may be comprised by an antigen bearing target such as a
cell, a cell fraction, a virus, or a viral particle. The nucleic
acid molecule may be comprised by an expression vector.
[0078] In yet another aspect, the invention encompasses a method of
modulating an immune response to an antigen in a subject, e.g. a
mammal, e.g. a human, comprising the steps of 1) administering to
the subject a composition comprising a nucleic acid molecule
encoding the antigen and further comprising a multifunctional
molecule of the invention and 2) administering to the subject a
composition comprising the antigen and not comprising (i.e. free
of) the multifunctional molecule administered in step 1. Generally,
the two steps will be performed sequentially, e.g. at least 1 day
apart, or at least 1 week apart, or at least 1 month apart, or at
least 6 months apart, or at least 1 year apart. In one embodiment,
the composition comprising the multifunctional molecule is
administered to the subject prior to the composition which is free
of the multifunctional molecule. In another embodiment, the
composition which is free of the multifunctional molecule is
administered to the subject prior to the composition which
comprises the multifunctional molecule. The antigen of the
composition may be comprised by an antigen bearing target such as a
cell, a cell fraction, a virus, or a viral particle. The nucleic
acid molecule may be comprised by an expression vector.
[0079] In yet another aspect, the invention encompasses a method of
modulating an immune response to an antigen in a subject, e.g. a
mammal, e.g. a human, comprising the steps of 1) administering to
the subject a composition comprising a nucleic acid molecule
encoding the antigen and further comprising a nucleic acid molecule
encoding a multifunctional molecule of the invention and 2)
administering to the subject a composition comprising a nucleic
acid molecule encoding the antigen and not comprising (i.e. free
of) the nucleic acid molecule encoding the multifunctional
molecule, which was administered in step 1. Again, the two steps
will generally be performed sequentially, e.g. at least 1 day
apart, or at least 1 week apart, or at least 1 month apart, or at
least 6 months apart, or at least 1 year apart. In one embodiment,
the composition comprising the nucleic acid molecule is
administered to the subject prior to the composition which is free
of the nucleic acid molecule encoding the multifunctional
molecule.
[0080] In another embodiment, the composition which is free of the
nucleic acid molecule encoding the multifunctional molecule is
administered to the subject prior to the composition which
comprises the nucleic acid molecule encoding the multifunctional
molecule. One or more of the nucleic acid molecules may be
comprised by an expression vector.
[0081] In yet another aspect, the invention encompasses a method of
modulating an immune response to an antigen in a subject, e.g. a
mammal, e.g. a human, comprising the steps of 1) administering to
the subject a composition comprising a nucleic acid molecule
encoding the antigen and further comprising a nucleic acid molecule
encoding a multifunctional molecule of the invention and 2)
administering to the subject a composition comprising a nucleic
acid molecule encoding the antigen and further comprising a
multifunctional molecule of the invention. The multifunctional
molecules of step 1 and step 2 may be the same or different. Again,
the two steps will generally be performed sequentially, e.g. at
least 1 day apart, or at least 1 week apart, or at least 1 month
apart, or at least 6 months apart, or at least 1 year apart. In one
embodiment, the composition comprising the nucleic acid molecule is
administered to the subject prior to the composition which is free
of the nucleic acid molecule encoding the multifunctional molecule.
In another embodiment, the composition which is free of the nucleic
acid molecule encoding the multifunctional molecule is administered
to the subject prior to the composition which comprises the nucleic
acid molecule encoding the multifunctional molecule. One or more of
the nucleic acid molecules may be comprised by an expression
vector.
[0082] In yet another aspect, the invention encompasses a method of
modulating an immune response to an antigen in a subject, e.g. a
mammal, e.g. a human, comprising the steps of 1) administering to
the subject a composition comprising a nucleic acid molecule
encoding the antigen and further comprising a multifunctional
molecule of the invention and 2) administering to the subject a
composition comprising a nucleic acid molecule encoding the antigen
and further comprising a nucleic acid molecule encoding a
multifunctional molecule of the invention. The multifunctional
molecules of step 1 and step 2 may be the same or different. Again,
the two steps will generally be performed sequentially, e.g. at
least 1 day apart, or at least 1 week apart, or at least 1 month
apart, or at least 6 months apart, or at least 1 year apart. In one
embodiment, the composition comprising the nucleic acid molecule is
administered to the subject prior to the composition which is free
of the nucleic acid molecule encoding the multifunctional molecule.
In another embodiment, the composition which is free of the nucleic
acid molecule encoding the multifunctional molecule is administered
to the subject prior to the composition which comprises the nucleic
acid molecule encoding the multifunctional molecule. One or more of
the nucleic acid molecules may be comprised by an expression
vector.
[0083] The present invention encompasses a method of modulating an
immune response in an animal comprising the step of administering a
composition comprising a multifunctional molecule, e.g. a
polypeptide, e.g. a fusion polypeptide, which comprises a first
part that can bind to a antigen bearing target and a second part
that can bind to a cell. In a preferred embodiment, the composition
further comprises an antigen, an immune response to which is
modulated by administration of the composition. The antigen may be,
for example, a polypeptide (e.g. a recombinant polypeptide), a
lipid (e.g. a glycolipid), or a carbohydrate (e.g. a polysaccharide
or a component of a bacterial or fungal cell wall). The composition
therefore comprises an antigen bearing target, whether, e.g., a
homogeneous antigen or a heterogeneous structure such as a cell or
a virus. When the antigen bearing target is a cell, it may be
autologous, syngeneic, allogeneic, or xenogeneic to the animal. In
other preferred embodiments, the antigen is already present in the
animal at the time the molecule is administered, and/or the antigen
is administered to the animal prior to administration of the
molecule. In yet another preferred embodiment, the antigen is
administered to the animal after administration of the
molecule.
[0084] Preferably, the composition comprises multifunctional
molecules which are not bound to an antigen bearing target. In a
preferred embodiment, the composition further comprises an antigen
bearing target, e.g. a cell. In one embodiment of the invention,
the composition comprises multifunctional molecules, some of which
are bound to a antigen bearing target, e.g. to the surface of a
cell, and some of which are external to and not bound to any
target. In another embodiment, the composition comprises a
multifunctional molecule and further comprises a portion of a cell,
e.g. a membrane fraction of a cell (i.e., an antigen bearing
target). In yet another embodiment, the composition comprises a
multifunctional molecule and further comprises a multiplicity of
different molecules derived from a cell, as is found, e.g., in a
cell lysate. Cells may be lysed, for example, by freezing and
thawing, preferably repeatedly. In a preferred embodiment, the
composition is cell-free.
[0085] The present invention further encompasses a method of
vaccinating a mammal to a selected antigen comprising administering
to the animal a vaccine composition comprising a multifunctional
molecule of the invention comprising a first part which is a
lectin, and a second part which is a ligand for a cell surface
protein, e.g. a cell surface receptor of an APC. Preferably, the
lectin can bind to an antigen bearing target which comprises the
antigen.
[0086] In one embodiment, the invention provides a method of
vaccinating a mammal to a selected antigen comprising removing at
least one cell from the mammal, wherein the cell comprises the
antigen, contacting the cell ex vivo with a multifunctional
molecule comprising a first part which is a lectin and is capable
of binding to at least one carbohydrate molecule on the surface of
the antigen bearing cell, and a second part which is a ligand for a
cell surface protein of an APC, so as to form an antigen bearing
cell/multifunctional molecule complex; and placing the complex back
into the mammal.
[0087] In a preferred embodiment, the composition comprises an
antigen, an immune response to which is modulated by administration
of the composition.
[0088] The invention provides a method of modulating an immune
response to a selected antigen in a mammal comprising administering
to said animal a composition comprising a cell comprising said
antigen, and a multifunctional molecule comprising a lectin and a
ligand for a cell surface protein.
[0089] The invention also relates to a method of vaccinating an
animal to a selected antigen comprising removing at least one cell
from said animal, wherein the cell comprises said antigen;
contacting said cell ex vivo with a fusion polypeptide comprising a
lecting and a ligand for a cell surface protein of an antigen
presenting cell so as to form a complex; and placing said complex
back in said animal.
[0090] The present invention provides a method for juxtaposing an
APC with an antigen bearing target comprising: contacting an APC
and antigen bearing target with a multifunctional molecule
comprising a first part comprising a lectin which is able to bind
to at least one carbohydrate moiety on the antigen bearing target
and a second part comprising a ligand for a cell surface protein on
the APC. Preferably, the multifunctional molecule is first
contacted with the antigen bearing target and the resulting antigen
bearing target/multifunctional molecule complex is subsequently
contacted with the APC. In one embodiment the antigen bearing
target is a cell from an animal comprising an antigen, and is
contacted with the multifunctional molecule ex vivo under
conditions which permit the binding of the lectin to at least one
carbohydrate moiety of the cell. The resulting multifunctional
molecule/antigen bearing cell complex is then administered back to
the animal from which the antigen bearing cell was derived wherein
it is able to bind to a cell surface receptor on an APC via the
ligand portion of the multifunctional molecule, thereby juxtaposing
the antigen bearing target and the APC.
[0091] "Juxtaposition", in the context of the present invention,
includes but is not limited to physical contact. An APC and antigen
bearing target are "juxtaposed" with one another if they are
sufficiently close for the APC to internalize the antigen bearing
target. An APC and antigen bearing target are also "juxtaposed" if
they are separated by no more that 20 .mu.m, preferably no more
than 10 .mu.m, and still more preferably no more than 5 .mu.m, and
more preferably no more than 1 .mu.m.
[0092] As used herein, "contacting" refers to admixing in vitro or
in vivo.
[0093] The invention also encompasses a method of modulating an
immune response to an antigen comprising contacting in vitro an
antigen bearing target, a multifunctional molecule of the
invention, and an APC and administering the resultant composition
to a subject. In one embodiment the antigen bearing
target/multifunctional molecule complex is contacted with an APC
for a time sufficient to permit internalization of the antigen
bearing target by the APC. In other embodiments the antigen bearing
target/multifunctional molecule complex is contacted with an APC
for a time that allows internalization of less than about 80%, less
than about 60%, less than about 40%, less than about 20%, less than
about 10%, or less than about 5% of the antigen bearing target by
the APC. Methods for determining the amount of target internalized,
e.g. by measuring the amount remaining outside the APC and
subtracting from the starting amount, are well-known in the art.
Preferably, the antigen bearing target/multifunctional molecule
complex is contacted with an APC for less than about 10 minutes,
less than about 30 minutes, less than about 60 minutes, less than
about 90 minutes, less than about 120 minutes, or less than about
180 minutes.
[0094] As used herein, "time sufficient to permit internalization"
refers to a period of time that is of a sufficient duration to
allow internalization of the selected antigen or antigen bearing
target by the APC (for example, no more than about fourteen days,
or seven days, or five or three days, or as little as about 24, 12,
6, 3, 2 or 1 hour, or even as little as about 30, 20, 10, 5, or 1
minute).
[0095] The invention also encompasses a method of attaching a
ligand for a cell surface polypeptide to an antigen bearing target
comprising admixing the antigen bearing target with a
multifunctional molecule which comprises the ligand. The invention
also encompasses a method of attaching an amino acid sequence to an
antigen bearing target comprising admixing the antigen bearing
target with a fusion polypeptide which comprises the amino acid
sequence and further comprises a lectin. The invention also
encompasses a composition comprising an antigen bearing target
admixed with a fusion polypeptide which comprises a first amino
acid sequence which is not a lectin and a second amino acid
sequence which comprises a lectin.
[0096] The invention also comprises methods of producing a
multifunctional molecule of the invention in each of the following
cell types: a yeast cell, a mammalian cell, a bacterial cell, an
insect cell. Each of these methods comprises the step of
introducing a nucleic acid encoding a multifunctional molecule into
the respective cell type, as taught hereinbelow.
[0097] The invention also encompasses methods of detecting or
quantifying a multifunctional molecule of the invention comprising
contacting the multifunctional molecule with an antibody or other
ligand that binds to the multifunctional molecule. Such methods
include ELISA assays and flow cytometry, as described hereinbelow.
Preferably, the multifunctional molecule to be detected or
quantitated is bound to an antigen bearing target.
DETAILED DESCRIPTION
[0098] The present invention is based, in part, on the discovery
that a multifunctional fusion protein comprising a first
polypeptide which is a lectin and a second polypeptide which is a
ligand of a cell surface receptor of an APC, can effectively target
an antigen bearing target, such as a cell bearing an antigen of
interest, to an APC, wherein the antigen is engulfed by the APC,
and an appropriate immune response to the antigen is mounted by an
animal to which the multifunctional molecule is administered.
[0099] Accordingly, the present invention provides a method for
vaccinating a mammal comprising administering to the animal a
vaccine composition comprising a multifunctional molecule of the
invention comprising a first part which is a lectin and which can
bind to a target bearing the antigen, and a second part which is a
ligand for a cell surface protein of an APC. In one embodiment, the
method comprises removing at least one cell from the mammal,
wherein the cell comprises the antigen, contacting the cell ex vivo
with a multifunctional molecule comprising a first part which is a
lectin and is capable of binding to at lease one carbohydrate
molecule on the surface of the antigen bearing cell, and a second
part which is a ligand for a cell surface protein of an APC, so as
to form an antigen bearing cell/multifunctional molecule complex;
and placing the complex back into the mammal.
Multifunctional Molecules
[0100] The present invention encompasses a multifunctional molecule
comprising a first part which can bind to an antigen bearing
target, and a second part which is a ligand for a cell surface
protein of a cell, e.g. an antigen presenting cell. Preferably, the
first part which can bind to an antigen bearing target is a lectin
which binds to at least one carbohydrate molecule present on the
antigen bearing target. Preferably the lectin is an influenza
hemagglutinin and binds to sialic acid residues present on the
antigen bearing target. Preferably, the ligand of a cell surface
protein of an antigen presenting cell is selected from an opsonin,
a cytokine, a ligand for a CD40 molecule, an adhesion molecule, a
defensin, a heat shock protein, or a counterreceptor for a T cell
costimulatory molecule. Cell surface molecules which can act as
receptors for the second part of the multifunctional molecule
include CD40 molecules and specific receptors for an opsonin, a
cytokine, an adhesion molecule, a defensin, a heat shock protein,
or a counterreceptor for a T cell costimulatory molecule, and also
include, but are not limited to the cell surface molecules listed
in Appendix I and II.
[0101] Lectins
[0102] The multifunctional molecule which comprises first and
second parts can comprise a first part which comprises a lectin and
a second part that can bind to a leukocyte, e.g. an APC, e.g. a
cell of monocytic lineage or a dendritic cell (which may itself be
of monocytic lineage). A "lectin", according to the invention, is a
molecule or part of a molecule, e.g. an amino acid sequence, which
can bind to a carbohydrate, e.g. a polysaccharide. Families of
naturally occurring lectins include: [0103] 1) Galectins, a rapidly
growing family of animal lectins. All of them share
galactose-specificity. [0104] 2) Calcium-dependent (C-type) animal
lectins, an extremely large family composed of members having
diverse structures and functions. [0105] 3) Among this C-type
lectin family, selectins form a distinguishable subfamily by their
specific function in leukocyte adhesion to endothelial cells
through sialyl-LewisX recognition. [0106] 4) Collectins, another
subfamily of C-type lectins specific for mannose, which have a
unique structure consisting of a C-type lectin domain and a
collagen-like domain. They are involved in innate immunity. [0107]
5) Invertebrates are known to contain various lectins in their body
fluids, probably as body-protection factors. Recently, some lectins
from an echinoderm were found to show hemolytic activity. [0108] 6)
Annexins, a group of proteins having affinity to lipids that were
recently shown to be lectins showing binding to glycosaminoglycans.
[0109] 7) The legume lectin family, which consists of a large
number of members, such as ConA, with variable saccharide
specificity comparable to C-type lectins. [0110] 8) Ricin, the
first lectin investigated in Russia more than 100 years ago. It is
now evident that the ricin family has many other homologous members
which differ in either toxicity or sugar-binding specificities.
[0111] Thus, a multifunctional molecule of the invention may bind
to one or more carbohydrates. Carbohydrates to which lectins may
bind also include, for example, carbohydrates comprising lactose,
D-mannose, D-glucose, D-fucose, L-fucose (e.g. alpha-L-fucose),
D-galactose, blood group A oligosaccharides, blood group B
oligosaccharides, saccharides comprising
alpha-D-Gal(1->3)[alpha-Lfuc(1->2)]-beta-D-Gal(1->3/4-beta-D-Glc-
NAc, saccharides comprising alpha-sialyl-[2->3]-lactose,
alpha-D-mannosyl glycoconjugates, alpha-NeuNAc-[2->6]-Gal,
alpha-NeuNAc-[2->6]-GalNAc, alpha-NeuNAc-[2->3]-Gal,
N-acetyl-beta-D-glucosamine, terminal alpha-D-galactosyl residues,
terminal beta-D-galactosyl residues, N-acetyllactosamine, terminal
alpha-D-mannosyl residues, N-acetyl-beta-D-glucosamine, terminal
N-acetyl-D-galactosamine, N-acetylneuraminic acid, and terminal
alpha-D-galactosaminyl residues.
[0112] The multifunctional molecule which comprises a lectin may
comprise, for example, the whole of a naturally occurring lectin or
a portion of a naturally occurring lectin, e.g. about (or at least
about) 5, 8, 10, 12, 15, 20, 25, 35, 50, 60, 70, 80, 100, or 120
contiguous amino acids of a naturally occurring polypeptide lectin.
In one embodiment the multifunctional molecule comprises a
carbohydrate-binding domain of a naturally occurring lectin, i.e.,
a portion of a lectin that can bind to a carbohydrate in the
absence of the remainder of the lectin. In another embodiment the
lectin may be non-naturally occurring, e.g. identified from an
artificial library of molecules or designed by modifying the
structure of a naturally occurring lectin.
[0113] Lectins known as "hemagglutinins" bind to carbohydrates on
erythrocytes, e.g. blood group antigens, and when incubated with
these cells cause them to aggregate. The influenza virus
hemagglutinin, for example, binds to sialic acid. There are at
least 15 known influenza hemagglutinin subtypes, defined by their
distinct antigenic properties. Any of these subtypes, designated,
e.g., H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14,
and H15, may provide amino acid sequences useful in the
compositions and methods of the invention. In one embodiment of the
invention, the hemagglutinin is of a subtype from a virus that
infects humans, e.g. H1, H2, or H3. In another embodiment, the
hemagglutinin is of a subtype from a virus that does not infect
humans, e.g. one of H4 through H15. Amino acid sequences can vary
up to about 20% for influenza hemagglutinins within a given
subtype, and can vary between about 30% and about 70% for influenza
hemagglutinins from different subtypes. Methods for determining
amino acid sequence homology are known to those of skill in the
art. Examples of other software that can perform sequence
comparisons to determine the % identity between hemagglutinin
variants (or variants of any portion of the multifunctional
molecules disclosed herein) include, but are not limited to, the
BLAST package (Ausubel et al., 1995, Short Protocols in Molecular
Biology, 3rd Edition, John Wiley & Sons), FASTA (Atschul et
al., 1990, J. Mol. Biol., 403-410) and the GENEWORKS suite of
comparison tools. Both BLAST and FASTA are available for offline
and online searching.
[0114] Although the final % homology can be measured in terms of
identity, the alignment process itself is typically not based on an
all-or-nothing pair comparison. Instead, a scaled similarity score
matrix is generally used that assigns scores to each pairwise
comparison based on chemical similarity or evolutionary distance.
An example of such a matrix commonly used is the BLOSUM62 matrix
the default matrix for the BLAST suite of programs. GCG Wisconsin
programs generally use either the public default values or a custom
symbol comparison table if supplied. It is preferred to use the
public default values for the GCG package, or in the case of other
software, the default matrix, such as BLOSUM62.
[0115] Advantageously, the BLAST algorithm is employed, with
parameters set to default values. The BLAST algorithm is described
in detail in Altschul et al., (1990) J. Mol. Biol. 215:403-410,
which is incorporated herein by reference. The search parameters
are defined as follows, and can be advantageously set to the
defined default parameters.
[0116] Advantageously, "substantial identity" when assessed by
BLAST equates to sequences which match with an EXPECT value of at
least about 7, preferably at least about 9 and most preferably 10
or more. The default threshold for EXPECT in BLAST searching is
usually 10.
[0117] BLAST (Basic Local Alignment Search Tool) is the heuristic
search algorithm employed by the programs blastp, blastn, blastx,
tblastn, and tblastx; these programs ascribe significance to their
findings using the statistical methods of Karlin and Altschul
(Karlin and Altschul 1990, Proc. Natl. Acad. Sci. USA 87:2264-68;
Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. USA 90:5873-7)
with a few enhancements. The BLAST programs are tailored for
sequence similarity searching, for example to identify homologues
to a query sequence. For a discussion of basic issues in similarity
searching of sequence databases, see Altschul et al (1994) Nature
Genetics 6:119-129.
[0118] The five BLAST programs available through the National
Institutes of Health (NIH; Bethesda, Md.) perform the following
tasks: blastp compares an amino acid query sequence against a
protein sequence database; blastn compares a nucleotide query
sequence against a nucleotide sequence database; blastx compares
the six-frame conceptual translation products of a nucleotide query
sequence (both strands) against a protein sequence database;
tblastn compares a protein query sequence against a nucleotide
sequence database dynamically translated in all six reading frames
(both strands); tblastx compares the six-frame translations of a
nucleotide query sequence against the six-frame translations of a
nucleotide sequence database.
[0119] BLAST uses the following search parameters:
[0120] HISTOGRAM--Display a histogram of scores for each search;
default is yes. (See parameter H in the BLAST Manual).
[0121] DESCRIPTIONS--Restricts the number of short descriptions of
matching sequences reported to the number specified; default limit
is 100 descriptions. (See parameter V in the manual page).
[0122] EXPECT--The statistical significance threshold for reporting
matches against database sequences; the default value is 10, such
that 10 matches are expected to be found merely by chance,
according to the stochastic model of Karlin and Altschul (1990). If
the statistical significance ascribed to a match is greater than
the EXPECT threshold, the match will not be reported. Lower EXPECT
thresholds are more stringent, leading to fewer chance matches
being reported. Fractional values are acceptable. (See parameter E
in the BLAST Manual).
[0123] CUTOFF--Cutoff score for reporting high-scoring segment
pairs. The default value is calculated from the EXPECT value (see
above). HSPs are reported for a database sequence only if the
statistical significance ascribed to them is at least as high as
would be ascribed to a lone HSP having a score equal to the CUTOFF
value. Higher CUTOFF values are more stringent, leading to fewer
chance matches being reported. (See parameter S in the BLAST
Manual). Typically, significance thresholds can be more intuitively
managed using EXPECT.
[0124] ALIGNMENTS--Restricts database sequences to the number
specified for which high-scoring segment pairs (HSPs) are reported;
the default limit is 50. If more database sequences than this
happen to satisfy the statistical significance threshold for
reporting (see EXPECT and CUTOFF below), only the matches ascribed
the greatest statistical significance are reported. (See parameter
B in the BLAST Manual).
[0125] MATRIX--Specify an alternate scoring matrix for BLASTP,
BLASTX, TBLASTN and TBLASTX. The default matrix is BLOSUM62
(Henikoff & Henikoff, 1992). The valid alternative choices
include: PAM40, PAM120, PAM250 and IDENTITY. No alternate scoring
matrices are available for BLASTN; specifying the MATRIX directive
in BLASTN requests returns an error response.
[0126] STRAND--Restrict a TBLASTN search to just the top or bottom
strand of the database sequences; or restrict a BLASTN, BLASTX or
TBLASTX search to just reading frames on the top or bottom strand
of the query sequence.
[0127] FILTER--Mask off segments of the query sequence that have
low compositional complexity, as determined by the SEG program of
Wootton & Federhen (1993) Computers and Chemistry 17:149-163,
or segments consisting of short-periodicity internal repeats, as
determined by the XNU program of Clayerie & States (1993)
Computers and Chemistry 17:191-201, or, for BLASTN, by the DUST
program of Tatusov and Lipman (NIH). Filtering can eliminate
statistically significant but biologically uninteresting reports
from the blast output (e.g., hits against common acidic-, basic- or
proline-rich regions), leaving the more biologically interesting
regions of the query sequence available for specific matching
against database sequences.
[0128] Low complexity sequence found by a filter program is
substituted using the letter "N" in nucleotide sequence (e.g.,
"NNNNNNNNNNNNN") and the letter "X" in protein sequences (e.g.,
"XXXXXXXXX").
[0129] Filtering is only applied to the query sequence (or its
translation products), not to database sequences. Default filtering
is DUST for BLASTN, SEG for other programs.
[0130] It is not unusual for nothing at all to be masked by SEG,
XNU, or both, when applied to sequences in SWISS-PROT, so filtering
should not be expected to always yield an effect. Furthermore, in
some cases, sequences are masked in their entirety, indicating that
the statistical significance of any matches reported against the
unfiltered query sequence should be suspect.
[0131] NCBI-gi--Causes NCBI gi identifiers to be shown in the
output, in addition to the accession and/or locus name.
[0132] Most preferably, sequence comparisons are conducted using
the simple BLAST search algorithm provided by the NIH. In some
embodiments of the present invention, no gap penalties are used
when determining sequence identity.
[0133] Influenza hemagglutinin is expressed as a single polypeptide
chain, designated HA0, which trimerizes post-translationally. HA0
is proteolytically cleaved to yield two domains, HA1 and HA2, which
are disulfide-bonded to each other. HA1 comprises significant
sialic acid binding activity, while HA2 is anchored to the viral
membrane and facilitates fusion of this membrane with a host cell
membrane. In preferred embodiments of the invention, the
multifunctional molecule comprising first and second parts
comprises an amino acid sequence of an HA1 domain.
[0134] Additional examples of lectin molecules useful in the
present invention include, but are not limited to, those lectins
shown in Table 1, and variants thereof having at least 50%, 70%,
90%, and up to 99% sequence homology with the sequences of the
lectins shown in Table 1.
TABLE-US-00001 TABLE 1 KEY NAME ABBREVIATION CLASS LECTIN CODE [1]
/../. Quail Intestinal -- LECa.Ggg.Sss.xx.Xxxx. Lectin. [2] /../.
Porcine Heart Lectin -- LECa.Ggg.Sss.xx.Xxxx. (PHL). [3] /../.
Hepatic beta- S-lectin or GLTa.Ggg.Sss.xx.Xxxx. galactoside binding
Galectin. lectins. [4] /../. Mammalian Brain S-lectin or
GLTa.Ggg.Sss.xx.Xxxx. Beta-Galactoside- Galectin. binding Lectin.
[5] Aaptos papillata. -- -- LECi.Ada.Pap.xx.Xxxx. [6] Abelmoschus
-- -- LECp.Abe.Esc.xx.Xxxx. esculentus. [7] Abramis brana. -- --
LECp.Abr.Bra.xx.Xxxx. [8] Abrus precatorius. APA; APA-A; APA-
beta-trefoil lectin LECp.AbrPre.se.Cga1 C; Abrin. (APA); Type 2
(abrin) RIP. LECp.AbrPre.se.Cga2 (APA). [10] Achatina fulica.
Achatina fulica Cold -- LECi.Ach.ful.xx.Xsi1. Aggltutinin;
achatinin-H. [13] Actinomyces -- -- LECf.Act.Vis.xx.Xga1. viscosus.
[14] Adenia digitata. Modeccin. Type 2 RIP. LECp.AdeDig.ro.Cga1.
[15] Adenia volksensii. Volkensin. Type 2 RIP. LECp.AdeVol.ro.Cga1.
[16] Aegilops -- Hevein domain LECp.Aeg.Gen.se.Hch1. geniculata.
lectin, chitin binding. [19] Aegopodium APA. --
LECp.Aeg.Pod.rh.Hga1. podagraria. [20] Aeromonas -- --
LECb.Aer.Sal.xx.Xxxx. salmonicida. [21] Afzelia africana. -- --
LECz.Afz.Afr.xx.Xxxx. [22] Agardhiella tenera. -- --
LECz.Aga.Ten.xx.Xxxx. [23] Agaricales. -- -- LECz.Aga.sss.xx.Xxxx.
[24] Agaricus bisporus. ABA-I, ABA-II, -- LECf.Aga.Bis.xx.Xga1.
ABA-III, ABA-IV. [25] Agaricus blazei. -- -- LECf.Aga.Bla.xx.Xxxx.
[26] Agaricus -- -- LECf.Aga.Cam.xx.Xxxx. campestris. [27] Agaricus
edulis. -- -- LECf.Aga.Edu.xx.Xxxx. [28] Agrobacterium -- --
LECu.Agr.Rad.xx.Xxxx. radiobacter. [29] Agrocybe aegerita. -- --
LECf.Agr.Aeg.xx.Xxxx. [30] Agropyrum AREL, ARLL. Hololectin;
LECp.Agr.Rep.se.Hch1 repens. Monocot (AREL) mannose-binding
LECp.Agr.Rep.le.Hch1 lectins. (ARLL). [31] Aleuria aurantia. -- --
LECf.Ale.Aur.xx.Xfu1. [32] Allium AAA. Monocot
LECp.All.Asc.bu.Hma1. ascalonicum. mannose-binding lectins. [36]
Allium cepa. ACA. Monocot LECp.All.Cep.bu.Hma1. mannose-binding
lectins. [37] Allium moly. AMA. Monocot LECp.All.Mol.bu.Hma1.
mannose-binding lectins. [38] Allium porrum. APA. Monocot
LECp.All.Por.le.Hma1. mannose-binding lectins. [39] Allium sativum.
ASA. Monocot LECp.All.Sat.bu.Hma1 Mannose-binding (ASA-I) lectin.
LECp.All.Sat.bu.Hma1 (ASA-I) LECp.All.Sat.bu.Hma1 (ASA-I)
LECp.All.Sat.bu.Hma1 (ASA-I) LECp.All.Sat.bu.Hma2 (ASA-II)
LECp.All.Sat.le.Hma1 (ASA-III) LECp.All.Sat.ro.Hma1 (ASA-IV). [40]
Allium ursinum. AUA-I, AUA-II, Monocot LECp.All.Urs.bu.Hma1
AUA-III, AUA-Ir, Mannose-binding (AUA-I) AUA-L, AUA-Iir. lectin.
LECp.All.Urs.bu.Hma2 (AUA-II) LECp.All.Urs.le.Hma1 (AUA-L)
LECp.All.Urs.ro.Hma1 (AUA-Ir) LECp.All.Urs.ro.Hma2 (AUA-IIr). [42]
Allium vineale. AVA. Monocot LECp.All.Vin.bu.Hma1. Mannose-binding
lectin. [43] Allomyrina -- -- LECi.All.Dic.xx.Xxxx. dichotoma. [44]
Alocasia indica. -- -- LECp.Alo.Ind.tu.Hcu1. [45] Aloe arborescens.
Aloctin, AAA. AAA: Monocot LECp.Alo.Arb.le.? Mannose-binding
(Aloctin-A) proteins Aloctin- LECp.Alo.Arb.le.Hma1 A: u. (AAA).
[46] Amaranthus ACA, Amaranthin, beta-trefoil lectin,
LECp.Ama.Cau.se.Hga1. caudatus. ACL. Amaranthin group. [47]
Amaranthus -- Amaranthin LECp.Ama.Cru.se.Hga1. cruentus. group.
[48] Amaranthus AHML, Amaranthin. Amaranthin LECp.Ama.Hyp.xx.Xgal1.
hypochondriacus. group. [49] Amranthus -- Amaranthin
LECp.Ama.Leu.se.Hga1. leucocarpus. group. [50] Amaranthus ASL.
Amaranthin LECp.Ama.Spi.se.Hga1. spinosus. group. [51] Amphicarpaea
ABrA. Legume lectins. LECp.Amp.Bra.se.Hma1. bracteata. [52] Anadara
granosa. Anadarin MS. -- LECi.Ana.Gra.xx.Xsi1. [53] Anguilla
anguilla. AAL. -- LECi.Ang.Ang.xx.Xfu1. [54] Anthocidaris -- Novel,
unique LECi.Ant.Cra.xx.Xxxx. crassispina. lectin class. [55]
Anthocidaris -- -- LECi.Ant.Cra.xx.Xxxx. crassispina Ovum. [57]
Apium graveolens. -- -- LECp.Api.Gra.xx.Xxxx. [58] Aplysia -- --
LECi.Apl.Dac.xx.Xxxx. dactylomela. [59] Aplysia depilans. -- --
LECi.Apl.Dep.xx.Xga1. [60] Aplysina archeria. -- --
LECu.Apl.Arc.xx.Xxxx. [61] Arachis hypogea. PNA, GNL, MNL, All
Arachnis LECp.Ara.Hyp.se.Hga1 PRA-I, PRA-II. lectins are classed
(PNA) as legume lectins. LECp.Ara.Hyp.no.Hga1 (GNL)
LECp.Ara.Hyp.se.Hga1 (MNL) LECp.Ara.Hyp.se.Hga1 (PRA-I)
LECp.Ara.Hyp.se.Hga1 (PRA-II). [62] Araucaria Lectin I, Lectin II.
-- LECp.Ara.Bra.se.Hmg1 brasiliensis. (Lectin I)
LECp.Ara.Bra.se.Hmg2 (Lectin II). [63] Arion -- --
LECi.Ari.Emp.xx.Xxxx. empiricorum. [64] Arisaema ACA. --
LECp.Ari.Con.tu.Hcu1. consanguineum. [65] Arisaema ACmA. --
LECz.Ari.Cur.tu.Hcu1. curvatum. [66] Arthrobotrys AOL. --
LECf.Art.Oli.xx.Xxxx. oligospora. [68] Artocarpus hirsuta. -- --
LECp.Art.Hir.xx.Xxxx. [69] Artocarpus incisa. -- --
LECp.Art.Inc.xx.Xxxx. [70] Artocarpus Jacalin, AIA, KM+, beta-prism
plant LECp.Art.Int.se.Hga1. integrifolia. Artocarpin. lectin,
Jacalin- related lectins. [71] Artocarpus Artocarpin, ALA-I,
Jacalin-related LECp.Art.Lak.se.Hga1. lakoocha. ALA-II. lectins.
[72] Arum maculatum. AMA. Monocot binding LECp.Aru.Mac.tu.Hma1.
lectins. [73] Ascaris -- -- LECi.Asc.Lum.xx.Xxxx. lumbricoides.
[74] Asparagus -- -- LECp.Asp.Off.xx.Xxxx. officinalis. [75]
Bacillus -- -- LECb.Bac.Pols.xx.Xxxx. polymyxa. [76] Bacterioides
-- -- LECb.Bac.Fra.xx.Xxxx. fragilis. [77] Bandeiraea BS-I,
BS-I-A4, BS-I- -- LECp.Ban.Sim.xx.Xxxx. simplicifolia. B4, BS-II.
[78] Basidiomycotina. -- -- LECf.Bas.Sss.xx.Xxxx. [79] Bauhinia
purpurea. BPA. Legume lectin. LECp.Bau.Pur.se.Hga1. [80] Bauhinia
-- -- LECz.Bau.Tom.xx.Xxxx. tomentosa. [81] Beauveria -- --
LECf.Bea.Bas.xx.Xsi1. bassiana. [82] Beta vulgaris. -- --
LECp.Bet.Vul.xx.Xxxx. [83] Beta vulgaris. -- --
LECp.Bet.Vul.xx.Xxxx. [84] Biomphalaria BGL-I, BGL-II. --
LECp.Bio.Gla.xx.Xxxx. glabrata. [85] Biomphalaria -- --
LECi.Bio.Gla.xx.Xxxx. glabrata. [86] Birgus latro. -- --
LECz.Bir.Lat.xx.Xxxx. [87] Blaberus BDL1, BDL2, BDL3. --
LECi.Bla.Dis.xx.Xxxx. discoidalis. [88] Bordetella Pertussis toxin
1PRT. -- LECz.Ggg.Sss.xx.Xxxx. pertussis. [89] Bos Taurus. Mannose
6-phosphate P-lectin. LECa.Bos.Tau.xx.Xxxx. receptor (1C39). [90]
Bos taurus. Bovine Conglutinin. C-lectin or LECa.Bos.Tau.xx.Xxxx.
Collectin. [91] Bos taurus. Bovine collectin-43 C-lectin or
Leca.Bos.Tau.xx.Xxxx. (CL-43). Collectin. [92] Botryllus --
S-lectin. LECi.Bot.Sch.xx.Xxxx. schlosseri. [93] Botrytis cinerea.
-- -- LECz.Bot.Cin.xx.Xxxx. [94] Bowringia BMA. Legume lectins.
LECp.Bow.Mil.se.Hmg1. milbraedii. [95] Brachypodium BsyL.
Chitin-binding LECp.Bra.Syl.se.Hch1. sylvaticum. lectins. [96]
Bradyrhizobium -- -- LECp.Bra.Jap.xx.Xga1. japonicum. [97]
Branchiostoma -- -- LECi.Bra.Lan.xx.Xxxx. lanceolatum. [98]
Brassica -- -- LECp.Bra.Cam.xx.Xxxx. campetsris. [99] Brassica --
-- LECp.Bra.Nap.xx.Xxxx. napobrassica. [100] Brassica napus. -- --
LECp.Bra.Nap.xx.Xxxx. [101] Bryonia dioica. BDA. --
LECp.Bry.Dio.tu.Hga1. [113] Cancer -- -- LECi.Can.Ant.xx.Xsi1.
antennarius. [114] Candida albican Adhesins. --
LECf.Can.Alb.xx.Xfu1. adhesin. [115] Canna generalis. -- --
LECp.Can.Gen.rh.Hma1. [116] Capnocytophaga -- --
LECu.Cap.Gin.xx.Xxxx. gingivalis Actinomyces Israelii Coaggregation
agglutinin. [117] Capsicum annum. -- -- LECp.Cap.Ann.xx.Xxxx. [118]
Caragana CAA-I, CAA-II. -- LECp.Car.Arb.se.Hga1 arborescens.
(CAA-I) LECp.Car.Arb.se.Hga2 (CAA-II). [119] Carcharhinus -- --
LECa.Car.Spr.xx.Xxxx. springeri. [120] Carcinoscorpious L10;
carcinoscorpin. -- LECi.Car.Rot.xx.Xsi1. rotundacauda. [121] Carica
papya. -- -- LECp.Car.Pap.xx.Xxxx. [123] Carum carvia. -- --
LECp.Car.Car.xx.Xxxx. [124] Carybdea alata -- --
LECi.Car.Ala.xx.Xxxx. Hemolysin. [125] Castanea crenata. CCA. --
LECp.Cas.Cre.xx.Xxxx. [126] Cepaea hortensis. CHA-I. --
LECi.Cep.Hor.xx.Xxxx. [127] Channa punctatus. -- --
LECa.Cha.Pun.xx.Xxxx. [129] Chelidonium -- -- LECp.Che.Maj.se.Hch1.
majus. [132] Chicorium -- -- LECp.Chi.Int.xx.Xxxx. intybus. [133]
Cholla opuntia. -- -- LECp.Cho.Opu.xx.Xxxx. [134] Cicer arietinum.
CAA. -- LECp.Cic.Ari.se.Hcu1. [135] Cinachyrella -- --
LECi.Cin.All.xx.Xxxx. alloclada. [136] Cinnamonum -- --
LECp.Cin.Cam.xx.Xxxx. camphora. [137] Citrullus vulgaris. -- --
LECp.Cit.Vul.xx.Xxxx. [139] Citrus aurantium. -- --
LECp.Cit.Aur.se.Cnd1. [140] Citrus aurantium. -- --
LECp.Cit.Aur.xx.Xxxx. [141] Citrus medica. -- --
LECp.Cit.Med.xx.Xxxx. [142] Cladrastis lutea. CLA-I, CLA-II. --
LECp.Cla.Lut.ba.Hmg1 (CLA-I)
LECp.Cla.Lut.ba.Hmg2 (CLA-II). [143] Clerodendron CTA. --
LECp.Cle.Tri.fr.Hga1. trichotomum. [144] Clitocyba -- --
LECf.Cli.Neb.xx.Xxxx. nebularis. [145] Clivia miniata. CMA. --
LECp.Cli.Min.le.Hma1. [146] Clostridium -- -- LECb.Clo.Bot.xx.Xxxx.
botulinum. [147] Clostridium tetani. Tetanus toxin --
LECb.Ggg.Sss.xx.Xxxx. (1A8D). [148] Clupea harengus. -- --
LECa.Clu.Har.xx.Xxxx. [149] Coccinia grandis. CIA. --
LECp.Coc.Gra.fr.Hch1. [151] Cocus nucifera. -- --
LECp.Coc.Nuc.xx.Xxxx. [152] Codium fragilis. -- --
LECu.Cod.Fra.xx.Xxxx. [153] Cofea arabica. -- --
LECp.Cof.Ara.xx.Xxxx. [154] Colchicum CAA. -- LECp.Col.Aut.bu.Hcu1.
autumnale. [155] Collybia velutipes. -- -- LECf.Col.Vels.xx.Xxxx.
[156] Colocasia CEA. -- LECp.Col.Esc.tu.Hma1. esculentum. [157]
Conger myriaster. Congerin I, Congerin S-lectin.
LECi.Con.Myr.xx.Xga1. II. [159] Conidiobolus -- --
LECf.Con.Obs.xx.Xga1. obscurus. [160] Coprinus cinereus. Cg1, Cg2.
Galectin. LECf.Cop.Cin.xx.Xxxx. [161] Corbicula -- --
LECi.Cor.Flu.xx.Xxxx. fluminea Hemolysin. [163] Corylus avellania.
-- -- LECp.Cor.Ave.xx.Xxxx. [164] Cratylia mollis. -- --
LECz.Cra.Mol.xx.Xxxx. [165] Crenomytilus CGL. --
LECi.Cre.Gra.xx.Xxxx. grayanus. [166] Crocus sativum. -- --
LECp.Cro.Sat.bu.Hma1. [167] Crocus vernus. CVA. --
LECp.Cro.Ver.xx.Xxxx. [169] Crotolaria striata. -- --
LECp.Cro.Str.se.Hga1. [170] Crotolaria -- -- LECz.Cro.Aeg.xx.Xxxx.
aegyptica. [171] Crotolaria falcata. -- -- LECz.Cro.Fal.xx.Xxxx.
[172] Crotolaria juncea. -- -- LECp.Cro.Jun.se.Hga1. [174] Croton
tiglium. -- -- LECp.Cro.Tig.se.Hcu1. [175] Cucumaria CEL-III. --
LECi.Cuc.Ech.xx.Xxxx. echinata. [176] Cucumis -- --
LECp.Cuc.Cat.xx.Xxxx. catalupensis. [177] Cucumis melo. -- --
LECp.Cuc.Mel.xx.Xch1. [178] Cucumis sativus. -- --
LECp.Cuc.Sat.xx.Xch1. [180] Cucurbita ficifolia. -- --
LECp.Cuc.Fic.xx.Xxxx. [181] Cucurbita maxima. CMA, PP2. --
LECp.Cuc.Max.ps.Hch1. [182] Cucurbita pepe. -- --
LECp.Cuc.Pep.xx.Xxxx. [183] Cucurbita pepo. CPA. --
LECp.Cuc.Pep.fr.Hch1. [184] Cucurbita sativus. -- --
LECp.Cuc.Sat.xx.Xxxx. [185] Cydonia oblonja. -- --
LECp.Cyd.Obl.xx.Xxxx. [186] Cymbidium -- -- LECz.Cym.Hyb.le.Hma1.
hybrid. [187] Cyphomandra -- -- LECp.Cyp.Bet.xx.Xxxx. betacea.
[188] Cytisis CMA-I, CMA-II. -- LECp.Cyt.Mul.se.Hch1 multiflorus.
(CMA-I) LECp.Cyt.Mul.se.Hfu1 (CMA-II). [189] Cytisus scoparius.
CSA-I, CSA-II, -- LECp.Cyt.Sco.se.Hga1 CMH-I, CMH-II. (CS-I)
LECp.Cyt.Sco.se.Hga2 (CS-II). [190] Cytisus -- --
LECp.Cyt.Ses.se.Hch1 sessilfolius. (CSA-I) LECp.Cyt.Ses.se.Hga1
(CSA-II). [191] Dacrymycetales. -- -- LECz.Dac.sss.xx.Xxxx. [192]
Dalbergia. -- -- LECz.Dal.sss.xx.Xxxx. [193] Datura innoxia. -- --
LECp.Dat.Inn.xx.Xxxx. [194] Datura DSA. Chitin-bindng
LECp.Dat.Str.se.Hch1. stramonium. lectins. [195] Daucus carrota. --
-- LECp.Dau.Car.xx.Xxxx. [196] Dendroaspis JML, Jameson's --
LECi.Den.Jam.xx.Xga1. jamesoni. Mamba Venon. [198] Deuteromycetes.
-- -- LECz.Deu.sss.xx.Xxxx. [199] Dicolea lehmani. -- --
LECz.Dio.Leh.xx.Xxxx. [200] Dictyostelium Discoidin I. --
LECu.Dic.Dis.xx.Xxxx. discoideum. [201] Dictyostelium Purpurin. --
LECu.Dic.Pur.xx.Xxxx. purpureum. [202] Didemnum DTL, DCL-I, DCL- --
LECi.Did.Sss.xx.Xga1. candidum. II. [203] Dieffenbachia -- --
LECp.Dif.Seq.xx.Xxxx. sequina. [204] Dioclea -- Legume lectin.
LECp.Dio.Gra.xx.Xxxx. grandifolia. [205] Dioclea DLL-I, DLL-II,
Legume lectin. LECp.Dio.Gui.xx.Xmg1. guianensis. DLL-III. [206]
Dioclea virgata. -- Legume lectin. LECz.Dio.Vir.xx.Xxxx. [207]
Dolichos biflorus. DBA-S, DBA-R, Legume lectin.
LECp.Dol.Bif.se.Hga1 DB-58, DB-57, (DBA) DB46. LECp.Dol.Bif.pl.Hcu1
(DB58) LECp.Dol.Bif.pl.Hcu2 (DB57) LECp.Dol.Bif.ro.?ga1 (DB46).
[208] Drosophila. -- -- LECi.Dro.Meg.xx.Xxxx. [209] Dumasia. -- --
LECz.Dum.sss.xx.Xxxx. [210] Echinocereus -- --
LECp.Echi.Eng.xx.Xxxx. engelmanii. [211] Echis EMS16. --
LECi.Ech.Mul.xx.Xxxx. multisquamatus. [212] Electrophorus
Electrolectin. -- LECi.Ele.Ele.xx.Xxxx. electricus. [213] Elymus --
Hevein domain LECp.Ely.Can.se.Hch1. canadensis. lectin, chitin
binding. [223] Erythrina velutina. -- -- LECp.Ery.Vel.xx.Xxxx.
[224] Escherichia coli. Pili mannose-specific Verotoxin-1:
LECb.Ech.Col.xx.Xxxx. FimH adhesin ADP-ribosylating (1QUN),.
toxins. [225] Euhadra -- -- LECz.Euh.Cal.xx.Xxxx. callizoma. [226]
Euphorbia -- -- LECp.Eup.Sss.xx.Xxxx. characias. [227] Euphorbia --
-- LECp.Eup.Het.xx.Xga1. heterophylla. [228] Evonymus -- --
LECp.Evo.Eur.se.Hcu1. europaea. [229] Falcata japonica. -- --
LECp.Fal.Jap.se.Hga1. [230] Ficus cunia. -- --
LECp.Fic.Cun.xx.Xxxx. [231] Flammulina -- -- LECf.Fla.Vel.xx.Xxxx.
veltipes. [232] Fomes -- -- LECz.Fom.Fom.xx.Xxxx. fomentarius.
[233] Fragaria vesca. -- -- LECp.Fra.Ves.xx.Xxxx. [234] Fucus
serratus. -- -- LECu.Fuc.Ser.xx.Xxxx. [235] Fucus vesiculosis. --
-- LECu.Fuc.Ves.xx.Xxxx. [236] Galactia tashiroi. -- --
LECp.Gal.Tas.se.Hga1. [237] Galactia -- -- LECp.Gal.Ten.se.Hga1.
tenuiflora. [238] Galanthus nivalis. -- Monocot lectin.
LECp.Gal.Niv.bu.Hma1. [239] Galleria -- -- LECi.Gal.Mel.xx.Xxxx.
mellonella. [240] Gallus gallus. GGL. S-lectin or
GLTa.Gal.Gal.xx.Xxxx. Galectin. [241] Gallus gallus. Chicken
Hepatic -- LECa.Gal.Gal.xx.Xxxx. lectins (CHL). [242] Gallus
gallus. Chicken egg -- LECa.Gal.Gal.xx.Xxxx. agglutinins. [243]
Gallus gallus. Chick Beta- S-lectin or LECa.Gal.Gal.xx.Xxxx.
galactoside-Binding Galectin. lectins. [244] Gallus gallus. Chicken
Serum C-lectin or LECa.Gal.Gal.xx.Xxxx. Mannose-Binding Collectin.
Protein. [245] Gallus gallus. Chicken Liver C-lectin or
LECa.Gal.Gal.xx.Xxxx. Mannose-Binding Collectin. Protein. [246]
Gallus gallus. Chicken Thymic S-lectin or GLTa.Gal.Gal..xx.Xxxx.
Electrolectin (CTE). Galectin. [247] Gallus gallus. Chick Embryonic
S-lectin or GLTa.Gal.Gal.xx.Xxxx. Skin Lectins. Galectin. [248]
Genypterus -- -- LECi.Epi.Tre.xx.Xxxx. blacodes. [249] Geodia
cydonium. -- -- LECi.Geo.Cyd.xx.Xga1. [250] Giardia lambia Taglin.
-- LECu.Gia.Lam.xx.Xxxx. Surface lectin. [251] Gliricida sepium.
Lectin A, Lectin B. -- LECp.Gli.Sep.se.Hga1 (Lectin A)
LECp.Gli.Sep.se.Hga2 (Lectin B). [252] Glossina -- --
LECi.Glo.Lon.xx.Xxxx. longipennis lectin. [253] Glycine max. SBA.
Legume lectin. LECp.Gly.Max.se.Hga1. [254] Gonatanthus -- --
LECz.Gon.Pum.ti.Hcu1. pumilus. [256] Grateulopia -- --
LECu.Gra.Fil.xx.Xxxx. filicina. [257] Griffithsia -- --
LECu.Gri.Flo.xx.Xxxx. flosculosa. [258] Griffonia GS-I-A4, GS-I-A4,
Legume lectin. LECp.Gri.Sim.se.Hga1 Simplicifolia GS-I-B4, GS-II,
GS- (GS-I-A4) lectins. IV. LECp.Gri.Sim.se.Hga2 (GS-I-B4)
LECp.Gri.Sim.se.Hch1 (GS-II) LECp.Gri.Sim.se.Hfu1 (GS- IV)
LECp.Gri.Sim.le.Hga1 (GS-I-A4) LECp.Gri.Sim.le.Hga2 (GS- I-B4)
LECp.Gri.Sim.le.Hch1 (GS- II) LECp.Gri.Sim.le.Hfu1 (GS-IV). [260]
Grifola frondosa. GFL. -- LECf.Gri.Fro.xx.Xga1. [261] Haemonchus --
-- LECz.Xxx.Xxx.xx.Xxxx. contortus. [262] Halidrys siliquosa. -- --
LECu.Hal.Sil.xx.Xxxx. [263] Halimeda opuntia. -- --
LECu.Hal.Opu.xx.Xxxx. [264] Halocynthia -- -- LECi.Hal.Pyr.xx.Xxxx.
pyriformis. [265] Halocynthia -- -- LECi.Hal.Ror.xx.Xga1. roretzi.
[266] Haynaldia villosa. -- Hevein domain LECp.Hay.Vil.se.Hch1.
lectin, chitin binding. [269] Helianthus annus. -- beta-prism plant
LECp.Hel.Ann.xx.Xxxx. lectin. [270] Helianthus HTA. Jacalin-related
LECp.Hel.Tub.tu.Hmmm1. tuberosus. lectins. [271] Helicobacter
HP-SAL. -- LECb.Hel.Pyl.xx.Xxxx. pylori. [272] Helix aspersa. -- --
LECi.Hel.Asp.xx.Xxxx. [273] Helix pomatia. HPA. --
LECi.Hel.Pom.xx.Xxxx. [274] Herpetomonas. -- -- LECz.Her.xx.Xxxx.
[276] Heteranthelium -- Hevein domain LECp.Het.Pil.se.Hch1.
piliferum. lectin, chitin binding. [277] Heterometrus -- --
LECi.Het.gra.xx.Xsi1. granulomanus. [279] Hevea brasiliensis. HBA,
Hevein. Chitin-binding LECp.Hev.Bra.la.Mch1. lectin with hevein
domain. [280] Hippeastrum HHA. Monocot lectin.
LECp.Hip.Hyb.bu.Hma1. hybrid. [281] Hippopus Tridacnin. C-lectin.
LECi.Hip.Hip.xx.Xxxx. hippopus. [282] Hizoctonia solani. -- --
LECz.Hiz.Sol.xx.Xxxx. [283] Hohenbuehelia -- --
LECf.Hoh.Ser.xx.Xxxx. serotina. [284] Homarus HAA. --
LECi.Hom.Ame.xx.Xxxx. americanus. [285] Homo sapiens. P-selectin
(1KJD). C-lectin. LECh.Hom.Sap.xx.Xxxx. [286] Homo sapiens. Human
Mannose C-lectin. LECh.Hom.Sap.xx.Xxxx. Binding Protein (MBP)
(1HUP). [287] Homo sapiens. Gut Mucus Anti- --
LECh.Hom.Sap.xx.Xxxx. Salmonella Lectin. [288] Homo sapiens. Human
Membrane -- LECh.Hom.Sap.Xxxx. Lectins (HKML, HCCML). [289] Homo
sapiens. Human Synovial -- LECh.Hom.Sap.xx.Xxxx. Tissue Lectins.
[290] Homo sapiens. Human Placenta -- LECh.Hom.Sap.xx.Xxxx. Lectins
(HPL-H, HPL-BG). [291] Homo sapiens. Human Brain --
LECh.Hom.Sap.xx.Xxxx. Galactoside-binding Lectin. [292] Homo
sapiens. Human 14-kDa -- LECh.Hom.Sap.xx.Xxxx. Lectins. [293] Homo
sapiens. Human Core-specific -- LECh.Hom.Sap.xx.Xxxx.
Lectin (HCSL). [294] Homo sapiens. Cell Membrane --
LECh.Hom.Sap.xx.Xxxx. Lectins. [295] Homo sapiens. Tumoricidal --
LECh.Hom.Sap.xx.Xga1. Macrophage Lectin. [296] Homo sapiens.
Tumor-associated -- LECa.Ggg.Sss.xx.Xxxx. Vertebrate Lectin. [297]
Homo sapiens. Human Conglutinin- -- LECh.Hom.Sap.xx.Xxxx. like
Protein. [298] Homo sapiens. Mannose-Specific --
LECh.Hom.Sap.xx.Xma1. Endocytosis Receptor. [299] Homo sapiens.
Human Penultimate -- LECh.Hom.Sap.xx.Xxxx. Galactose Lectin. [300]
Homo sapiens. Thrombospondin. -- LECh.Hom.Sap.xx.Xxxx. [301] Homo
sapiens. Tetranectin. -- LECh.Hom.Sap.xx.Xxxx. [302] Homo sapiens.
Human Dendritic -- LECh.Hom.Sap.xx.Xxxx. Cell Immunoreceptor
(DCIR). [303] Homo sapiens. Human Seminal -- LECh.Hom.Sap.xx.Xxxx.
Lectin (HSL). [304] Homo sapiens. Charcot-Leyden S-lectin or
GLTh.Hom.Sap.xx.Xxxx. crystal protein Galectin. (1LCL). [305] Homo
sapiens. Galectin II L-14-II Proto S-lectin or
GLTh.Hom.Sap.xx.Xxxx. (1HLC). Galectin. [306] Homo sapiens. Human
Lung C-lectin or GLTh.Hom.Sap.xx.Xxxx. Surfactant Protein
Collectin. (1B08). [307] Homo sapiens. Galectin III. Chimera
S-lectin GLTh.Hom.Sap.xx.Xxxx. or Galectin. [308] Homo sapiens.
Galectin VII, hGal-7. Proto S-lectin or GLTh.Hom.Sap.xx.Xxxx.
Galectin. [309] Homo sapiens. Pentraxin (1CRV). Pentraxin, S-
GLTh.Hom.Sap.xx.Xxxx. lectin or Galectin. [310] Homo sapiens.
Sialoadhesin. I-lectin. LECz.Ggg.Sss.xx.Xxxx. [311] Homo sapiens.
Serum Amyloid P Pentraxin. LECh.Hom.Sap.xx.Xxxx. Component. [312]
Homo sapiens. E-Selectin (1ESL). C-lectin. SELh.Hom.Sap.xx.Xxxx.
[313] Homo sapiens. L-Selectin (1KJB). C-lectin.
SELh.Hom.Sap.xx.Xxxx. [314] Homo sapiens. C-Reactive protein
Pentraxin, S- GLTh.Hom.Sap.xx.Xxxx. (1CRV). lectin or Galectin.
[315] Homo sapiens. Galectin XII. S-lectin or GLTh.Hom.Sap.xx.Xxxx.
Galectin. [316] Homo sapiens. Galectin I. Proto S-lectin or
GLTh.Hom.Sap.xx.Xxxx. Galectin. [317] Homo sapiens. Galectin IX,
Tandem Repeat GLTh.Hom.Sap.sr.Xxxx. Ecalectin. S-lectin or
Galectin. [318] Homo sapiens. Galectin VIII. Tandem Repeat
GLTh.Hom.Sap.xx.Xxxx. S-lectin or Galectin. [319] Homo sapiens.
Galectin IV. Tandem Repeat GLTh.Hom.Sap.xx.Xxxx. S-lectin or
Galectin. [320] Homo sapiens. Alpha-1/Beta-1 Integrin A (or I)
INTh.Hom.Sap.xx.Xxxx. integrin. domain. [321] Homo sapiens.
Alpha-2/Beta-1 Integrin A (or I) INTh.Hom.Sap.xx.Xxxx. integrin.
domain. [322] Homo sapiens. Alpha-3/Beta-1 Integrin A (or I)
INTh.Xxx.Xxx.xx.Xxxx. integrin. domain. [323] Homo sapiens.
Alpha-4/Beta-1 Integrin A (or I) INTh.Xxx.Xxx.xx.Xxxx. integrin.
domain. [338] Homo sapiens. Alpha-5/Beta-8 Integrin A (or I)
INTh.Hom.Sap.xx.Xxxx. integrin. domain. [339] Homo sapiens.
Alpha-4/Beta-7 Integrin. INTh.Hom.Sap.xx.Xxxx. Integrin. [340] Homo
sapiens. Alpha-E/Beta-7. Integrin. INTh.Hom.Sap.xx.Xxxx. [341] Homo
sapiens. Mucosal addressin Addressin. LECh.Xxx.Xxx.xx.Xxxx. cell
adhesion molecule-1 (MADCAM-1). [342] Homo sapiens. Vascular
Adhesion -- LECh.Xxx.Xxx.xx.Xxxx. Molecule (VCAM-1. [343] Homo
sapiens. P-Selectin. Selectin. SELh.Xxx.Xxx.xx.Xxxx. [344] Homo
sapiens. Intercellular Addressin?. LECh.Xxx.Xxx.xx.Xxxx. Adhesion
Molecule (ICAM-1, ICAM-2). [345] Homo sapiens. Peripheral Lymph
Addressin. LECh.Xxx.Xxx.xx.Xxxx. Node Addressin (PNAd). [346] Homo
sapiens. Vascular Adhesion -- LECh.Xxx.Xxx.xx.Xxxx. Protein
(VAP-1). [347] Homo sapiens. LFA-3. Addressin?.
LECh.Xxx.Xxx.xx.Xxxx. [348] Homo sapiens. Versican. Soluble
C-lectin LECh.Xxx.Xxx.xx.Xxxx. (`Lecticans`). [349] Homo sapiens.
Aggrecan. Soluble C-lectin LECh.Xxx.Xxx.xx.Xxxx. (`Lecticans`).
[350] Homo sapiens. Neurocan. Soluble C-lectin
LECh.Xxx.Xxx.xx.Xxxx. (`Lecticans`). [351] Homo sapiens. Brevican.
Soluble C-lectin LECh.Xxx.Xxx.xx.Xxxx. (`Lecticans`). [352] Homo
sapiens. Annexin V. Annexin. ANNh.Hom.Sap.xx.Xxx5. [353] Homo
sapiens. Annexin II. Annexin. ANNh.Hom.Sap.xx.Xxx2. [354] Homo
sapiens. Annexin IV. Annexin. ANNh.Hom.Sap.xx.Xxx4. [355] Homo
sapiens. Annexin I Annexin. ANNh.Hom.Sap.xx.Xxx1. (Lipocortin-1),
ANX1. [356] Homo sapiens. Annexin VII, -- ANNh.Hom.Sap.xx.Xxx7.
Synexin. [357] Homo sapiens. Activated Leukocyte -- LECh.Hom.Sapxx.
Adhesion Molecule (ALCAM). [358] Homo sapiens. E-cadherin. --
CDHh.Hom.Sap.xx.XxxE. [360] Homo sapiens. N-cadherin --
CDHh.Hom.Sap.xx.XxxN. (uvomorulin). [361] Homo sapiens. VE-cadherin
-- CDHh.Hom.Sap.xx.XxxVE. (Vascular Endothelial Cadherin). [362]
Homo sapiens. P-cadherin. -- CDHh.Hom.Sap.xx.XxxP. [363] Homo
sapiens. Annexin XI (CAP- -- ANNh.Hom.Sap.xx.Xxx9. 50). [364] Homo
sapiens. Endothelial Cell- -- CDHh.Hom.Sapxxx. Selective Adhesion
Molecule (ESAM). [365] Homo sapiens. ELAM-1. --
CDHh.Xxx.Xxx.xx.Xxxx. [366] Homo sapiens. GMP-140. --
CDHh.Xxx.Xxx.xx.Xxxx. [367] Homo sapiens. Cutaneous --
LECh.Xxx.Xxx.xx.Xxxx. Lymphocyte Antigen (CLA). [369] Homo sapiens.
Lymphocyte -- LECh.Xxx.Xxx.xx.Xxxx. Function-Associated Antigen-1
(LFA-1). [370] Homo sapiens. Very Late Antigen 4 --
LECh.Xxx.Xxx.xx.Xxxx. (VLA-4). [371] Hordeum vulgare. HVA. --
LECp.Hor.Vul.se.Hch1. [372] Hura crepitans. HCA. Type 2 RIP.
LECp.Hur.Cre.se.Cga1 (HCA) LECp.Hur.Cre.la.Cga1. [373] Hygrophorus
-- -- LECf.Hyg.Hyp.xx.Xxxx. hypothejus. [374] Hypnea -- --
LECu.Hyp.Cer.xx.Xxxx. cervicornis. [375] Hyptos -- --
LECz.Hyp.Sua.xx.Xxxx. suaveolens. [376] Iberis amara. -- --
LECp.Ibe.Ama.xx.Xxxx. [377] Influenza virus. Hemagglutinin.
Hemagglutinin. LECv.Inf.Vir.xx.Xxxx. [378] Ipomoea batatas. -- --
LECp.Ipo.Bat.xx.Xxxx. [379] Iris hollandica. -- --
LECp.Iri.Hol.xx.Xxxx. [380] Iris hybrid. IRA. Type 2 RIP.
LECp.Iri.Hyb.bu.Cga1. [381] Juglans regia. -- --
LECp.Jug.Reg.xx.Xxxx. [382] Klyveromyces -- --
LECz.Kly.Bul.xx.Xxxx. bulgaricus. [383] Kuehneromyces -- --
LECu.Kue.Mut.xx.Xxxx. mutabilis. [384] Labiaceae -- --
LECp.Lab.Ori.xx.Xxxx. origanum. [385] Lablab purpureus. DLA, LPA.
Legum lectin. LECp.Lab.Pur.se.Hmg1. [386] Laburnum LAA-I, LAA-II.
Legume lectin. LECp.Lab.Alp.se.Hch1 alpinum. (LAA-I)
LECp.Lab.Alp.se.Hga1 (LAA-II). [387] Laccaria -- --
LECz.Lac.Ame.xx.Xxxx. amethystina. [389] Lachesis huta. BML. --
LECi.Lac.Jut.xx.Xxxx. [390] Lactarius LDL. --
LECf.Lac.Del.xx.Xgal1. deliciosus. [391] Lactarius -- --
LECz.Lac.Lig.xx.Xxxx. lignyotus. [392] Lactuca scariole. PLA-I,
PLA-II. -- LECa.Lac.Sca.xx.Xxxx. [393] Laelia autumnalis. -- --
LECp.Lae.Aut.xx.Xxxx. [394] Laetiporus PSL. --
LECf.Lae.Sul.xx.Xxxx. sulfureus. [395] Lathyrus cicera. LcLI,
LcLII. -- LECp.Lat.Cic.xx.Xxxx. [396] Lathyrus nissolia. -- --
LECp.Lat.Nis.xx.Xxxx. [397] Lathyrus ochrus. LOL-I, LOL-II. Legume
lectin. LECp.Lat.Och.xx.Xxxx. [398] Lathyrus odoratus. -- --
LECp.Lat.Odo.xx.Xxxx. [399] Lathyrus silvestris. -- --
LECp.Lat.Sil.xx.Xxxx. [400] Lathyrus -- -- LECp.Lat.Tub.xx.Xxxx.
tuberosus. [401] Lens culinaris. LCA, LcH. Legume lectins.
LECp.Len.Cul.se.Hmg1. [402] Lepidium -- -- LECp.Lep.Sat.xx.Xxxx.
sativuum. [403] Leptonychotes -- -- LECz.Lep.Wed.xx.Xxxx. weddelli.
[404] Leptospermum LAA. -- LECp.Lep.Arc.xx.Xxxx. archinoides. [405]
Leucojum. -- -- LECz.Leu.sss.xx.Xxxx. [406] Leucojum LAA. Monocot
LECp.Leu.Aes.bu.Hma1. aestivum. mannose-binding lectins. [407]
Leucojum vernum. LVA. Monocot LECp.Leu.Ver.bu.Hma1. mannose-binding
lectins. [408] Limulus Limulin. Pentraxin. LECi.Lim.Pol.xx.Xsi1.
polyphemus. [409] Liocarcinus -- -- LECi.Lio.Dep.xx.Xxxx.
depurator. [410] Listeria ovata. LOA, LOMBP. Monocot
LECp.Lis.Ova.le.Hma1 mannose binding (LOA) proteins.
LECp.Lis.Ova.le.Mma1 (LMOBP). [411] Litchi chinensis. LCL. --
LECp.Lit.Chi.xx.Xxxx. [412] Lonchocarpus -- Legume lectin.
LECp.Lon.Cap.se.Hga1. capassa. [413] Lontonis bainesii. -- Legum
lectins. LECp.Lon.Bai.se.Hga1 LECp.Lon.Bai.ro.Hga1. [414]
Lophocereus -- -- LECp.Lop.Sho.xx.Xxxx. shotti. [415] Lotus LTA.
Legume lectins. LECp.Lot.Tet.se.Hfu1. tetragonolobus. [416] Luffa
acutangula. LAA. Cucurbtaceae LECp.Luf.Acu.fr.Hch1. phloem lectins.
[417] Lumbricus EW29. -- LECi.Lum.Ter.xx.Xxxx. terrestris. [418]
Lycopersicon LEA, TL, LEL. Chitin-binding LECp.Lyc.Esc.fr.Hch1.
esculentum. lectins. [419] Lycoris aurea. -- Monocot
LECp.Lyc.Aur.bu.Hma1. mannose-binding lectins. [420] Maackia MALb,
MAHb, Legume lectins. LECp.Maa.Amu.se.Hsi1 amurensis. MAL, MAHs.
(MAHs, MAH) LECp.Maa.Amu.se.Hsi2 (MAHs, MAH) LECp.Maa.Amu.ba.Hsi1
(MAHb) LECp.Maa.Amu.ba.Hsi1 (MALb). [421] Machaerocereus MEA-I,
MEA-II. ?. LECp.Mac.Eru.st.Hga1. eruca. [422] Machaerocereus --
Hevein domain LECp.Mac.Gum.xx.Xxxx. gummosus. lectin, chitin
binding. [423] Maclura pomifera. MPA. beta-prism plant
LECi.Mac.Pom.xx.Xxxx. lectin. [424] Macrobdella LL1-63. --
LECi.Mac.Dec.xx.Xxxx. decora. [425] Macrobrachium MrL. --
LECi.Mac.Ros.xx.Xxxx. rosenbergii. [426] Macrotyloma -- --
LECp.Mac.Axi.xx.Xxxx. axillare. [427] Malus officinalis. -- --
LECp.Mal.Off.xx.Xxxx. [428] Manduca sexta. Immulectin. C-lectin.
LECi.Man.Sex.xx.Xxxx. [429] Mangifera indica. MIA. --
LECp.Man.Ind.xx.Xxxx. [430] Marah -- -- LECp.Mar.Mac.xx.Xxxx.
macrocarpus. [431] Marasmius -- -- LECf.Mar.Ore.xx.Xxxx. oreades.
[432] Medicago sativa. -- -- LECp.Med.Sat.xx.Xxxx. [433] Medicago
-- -- LECp.Med.Tru.xx.Xxxx. truncatula.
[434] Megabalanus rosa. -- -- LECi.Mag.Ros.xx.Xxxx. [435]
Megapitaria -- -- LECi.Meg.Squ.xx.Xxxx. squalida. [436] Melanoleuca
-- -- LECf.Mel.Mel.xx.Xxxx. melaleuca. [437] Melastiza chateri. --
-- LECf.Mel.Cha.xx.Xxxx. [438] Mesocricetus -- Pentraxin.
LECz.Ggg.Sss.xx.Xxxx. auratus. [474] Orchidaceae. -- --
LECp.Orc.Sss.xx.Xxxx. [475] Ornithodoros Dorin-M. --
LECi.Orn.Mou.xx.Xxxx. moubata. [476] Oryza sativa. OSA. Chitin
binding LECp.Ory.Sat.see.Hch1. lectins. [477] Oscillatoria -- --
LECu.Osc.Aga.xx.Xxxx. agardhii. [478] Otala lactea. -- --
LECi.Ota.Lac.xx.Xxxx. [480] Pachydereus -- -- LECp.Pac.Pri.se.Hch1.
pringleii. [481] Pacifastacus -- -- LECi.Pac.Len.xx.Xxxx.
leniusculus. [482] Palmaria palmata. -- -- LECz.Pal.Pal.xx.Xxxx.
[483] Paracentrotus -- -- LECi.Par.Liv.xx.Xxxx. lividus. [484]
Parkia -- -- LECp.Par.Big.xx.Xxxx. biglandulosa. [485] Parkia
discolor. -- -- LECz.Par.Dis.xx.Xxxx. [486] Parkia -- --
LECz.Par.Pla.xx.Xxxx. platycephala. [487] Parkia speciosa. -- --
LECp.Park.Spe.xx.Xxxx. [488] Paxillus -- -- LECz.Pax.Atr.xx.Xxxx.
atrotomentosus. [489] Paxillus -- -- LECf.Pax.Pan.Sss.xx.Xxxx.
panuoides. [490] Penaeus -- -- LECp.Pen.Cal.xx.Xxxx.
californiensis. [492] Penaeus -- -- LECi.Pen.Sty.xx.Xxxx.
stylirostris. [494] Penaeus vannamei. -- -- LECi.Pen.Van.xx.Xxxx.
[495] Perca fluviatilis. -- -- LECa.Per.Flu.xx.Xxxx. [496] Peresea
gratissima. -- -- LECz.Per.Gra.xx.Xxxx. [497] Persea americana.
PAA. -- LECp.Per.Ame.xx.Xxxx. [498] Petromyzon -- --
LECz.Pet.Mar.xx.Xxxx. marinus. [499] Petrosecinum -- --
LECp.Pet.Hor.xx.Xxxx. hortense. [500] Peziza badia. -- --
LECp.Pez.Bad.xx.Xxxx. [501] Phage p22. Phage P22 --
LECb.Ggg.Sss.xx.Xxxx. TailspikeProteins (1TSP). [502] Phalera
flavescens. PFA. -- LECi.Pha.Fla.xx.Xxxx. [503] Phallus impudicus.
-- -- LECf.Pha.Imp.xx.Xxxx. [504] Phallusia -- --
LECi.Pha.Mam.xx.Xxxx. mamillata. [505] Phaseolus -- Legume lectins.
LECp.Pha.Acu.se.Hcu1 acutifolius. (erythroagglutinin)
LECp.Pha.Acu.se.Hcu2 (lymphoagglutinin). [506] Phaseolus aureus. --
-- LECp.Pha.Aur.xx.Xxxx. [507] Phaseolus PCA. Legume lectin.
LECp.Pha.Coc.se.Hcu1 coccineus. (PCA) LECp.Pha.Coc.se.Hcu2. [508]
Phaseolus -- -- LECp.Pha.Coc.xx.Xxxx. coccineus. [509] Phaseolus
PLA, LBA, LBL. Legume lectins. LECp.Pha.Lim.se.Hga1. limenesis.
[510] Phaseolus lunatus. -- -- LECp.Pha.Lun.se.Xxxx. [511]
Phaseolus PHA-E, PHA-L. Legume lectin. LECp.Pha.Vul.xx.Xxxx.
vulgaris. [512] Phaseolus GNlL, GNpL, GNsL. --
LECp.Pha.Vul.xx.Xxxx. vulgaris. [513] Phaseolus Pinto III. --
LECa.Pha.Vul.xx.Xxxx. vulgaris. [514] Phaseolus -- --
LECp.Pha.Vul.xx.Xxxx. vulgaris. [515] Phaseolus -- --
LECp.Pha.Vul.xx.Xxxx. vulgaris. [516] Phaseolus -- --
LECp.Pha.Vul.xx.Xxxx. vulgaris. [517] Phaseolus -- --
LECp.Pha.Vul.xx.Xxxx. vulgaris. [518] Phaseolus -- --
LECp.Pha.Vul.xx.Xxxx. vulgaris. [519] Phaseolus -- --
LECp.Pha.Vul.xx.Xxxx. vulgaris. [520] Phlomis -- --
LECz.Phl.Fru.xx.Xxxx. fructicosa. [521] Pholiota aurivella. PAA. --
LECf.Ggg.Sss.xx.Xxxx. [522] Pholiota squarrosa. -- --
LECf.Pho.Squ.xx.Xxxx. [524] Phoradendron -- --
LECz.Pjo.Cal.xx.Xxxx. californicum. [525] Phragmites. -- --
LECz.Phr.sss.xx.Xxxx. [526] Phragmites -- -- LECp.Phr.Aus.xx.Xxxx.
austalis. [527] Physalia physalis. Physalitoxin. --
LECi.Phy.Phy.xx.Xxxx. [528] Physalis angulata. PA-VII-A, PA-VII-B
-- LECz.Phy.Ang.xx.Xxxx. and PA-VII-C. [529] Physarum -- --
LECu.Phy.Pol.xx.Xxxx. polycephalum. [530] Phytolacca PWM, Pa-1,
Pa-2 -- LECp.Phy.Ame.ro.Hch1(Pa- americana. (PL-A) Pa-3, Pa-4 1)
(PL-C), Pa-5. LECp.Phy.Ame.ro.Hch2(Pa- 2) LECp.Phy.Ame.ro.Hch3(Pa-
3) LECp.Phy.Ame.ro.Hch4(Pa- 4) LECp.Phy.Ame.ro.Hch5(Pa- 5)
LECp.Phy.Ame.ro.Hch6(PL- B). [531] Pimenta -- --
LECp.Pim.Off.xx.Xxxx. officinalis. [532] Pisum sativum. PSA, PsA.
Legume lectins. LECp.Pis.Sat.se.Hmg1 (PSA, PsA)
LECp.Pis.Sat.ro.Hmg1. [533] Plecoglossus PAL. --
LECa.Ple.Alt.xx.Xxxx. altivelis. [535] Pleurocybella -- --
LECf.Ggg.Sss.xx.Xxxx. porrigens. [536] Pleurotus -- --
LECf.Ple.Ost.xx.Xxxx. ostreatus. [537] Plumaria elegans. -- --
LECu.Plu.Ele.xx.Xxxx. [538] Polyandrocarpa -- C-lectin.
LECi.Pol.Mis.xx.Xga1. misakiensis. [539] Polygonum -- --
LECp.Pol.Mul.xx.Xxxx. multiformum. [540] Polyomavirus. 1VPN. --
LECV.Pol.Vir.xx.Xxxx. [541] Polyporus -- -- LECf.Pol.Fom.xx.Xxxx.
fomentarius. [542] Polyporus -- -- LECf.Pol.Squ.xx.Xxxx. squamosus.
[543] Polysphondylium -- -- LECu.Pol.Pal.xx.Xxxx. pallidum. [544]
Potamon -- -- LECi.Pot.Pot.xx.Xxxx. potamios. [545] Prunus
Americana. -- -- LECp.Pru.Ame.xx.Xxxx. [546] Prunus avium. -- --
LECp.Pru.Avi.xx.Xxxx. [547] Psathyrostachys -- Hevein domain
LECp.Psa.Jun.se.Hch1. juncea. lectin, chitin binding. [548]
Pseudomonas -- -- LECb.Pse.Aer.xx.Xga1. aeruginosa. [549]
Pseudomonas -- -- LECb.Pse.Apl.xx.Xxxx. aplysia. [550] Psophocarpus
PTL-I (WBA-I), -- LECp.Pso.Tet.se.Hga1 tetragonolobus. PTL-II
(WBA-II), (PTL-I) WBTL, L-I, L-II. LECp.Pso.Tet.se.Hga2 (PTL-II)
LECp.Pso.Tet.ro.Hga1 (WBTL) LECp.Pso.Tet.so.Hga2
LECp.Pso.Tet.le.Hga1 (L-I) LECp.Pso.Tet.le.Hga2 (L- II). [551]
Ptilota serrata. -- -- LECu.Pxx.Ser.xx.Xxxx. [552] Punica granatum.
-- -- LECp.Pun.Gra.xx.Xxxx. [553] Rana catesbeiana. -- Lectins
LECa.Ran.Cat.xx.Xxxx. Displaying RNase Activity (Leczymes). [554]
Rana catesbeiana cSBL. Lectins LECa.Ran.Cat.xx.Xxxx. ovum lectin.
Displaying RNase Activity (Leczymes). [555] Rana japonica. jSBL.
Lectins LECa.Ran.Jap.xx.Xxxx. Displaying RNase Activity (Leczymes).
[557] Rana -- -- LECa.Ran.Nig.xx.Xxxx. nigromaculata. [558]
Raphanus sativus. -- -- LECp.Rap.Sat.xx.Xxxx. [559] Ratus
norvegicus. Mannan Binding C-lectin or LECa.Rat.Nor.xx.Xxxx.
Protein (MBP-A). Collectin. [560] Ratus ratus. Rat peritioneal --
LECa.Rat.Rat.xx.Xfu1 macrophage lectin. LECa.Rat.Rat.xx.Xga1. [561]
Ratus ratus. -- -- LECa.Rat.Rat.xx.Xxxx. [562] Ratus ratus.
Galectin II. S-lectin or GLT2.Rat.Rat.xx.Xxxx. Galectin. [563]
Ratus ratus. Galectin IV. Tandem Repeat GLTa.Rat.Rat.xx.Xxxx.
S-lectin or Galectin. [564] Rheum -- -- LECp.Rhe.Rhas.xx.Xxxx.
rhapontium. [565] Ribes rubrum. -- -- LECp.Rib.Rubs.xx.Xxxx. [566]
Ricinus RCA-I, RCA-II, beta-trefoil lectin. LECp.Ric.Com.se.Cga1
communis. Ricin. (Ricin D) LECp.Ric.Com.se.Cga2 (Ricin E)
LECp.Ric.Com.se.Cga2 (RCA, RSL). [567] Robinia RPA-I, RCA-III. --
LECp.Rob.Pse.se.Hcu1 pseudoacacia. (RPsA-I) LECp.Rob.Pse.se.Hcu2
(RPsA-II) LECp.Rob.Pse.se.Hcu1 (RPbA-I) LECp.Rob.Pse.se.Hcu2
(RPbA-II). [568] Rubus fructicosus. RFA. ?. LECp.Rub.Fru.tc.Xga1.
[569] Rubus idaeus. -- -- LECp.Rub.Ida.xx.Xxxx. [570] Rutilus
rutilus. -- -- LECv.Rut.Rut.xx.Xxxx. [571] Salmo gairdneri. -- --
LECa.Sal.Gai.xx.Xxxx. [572] Salmo salar v. -- --
LECa.Sal.Sal.xx.Xma1. Atlantica. [573] Salmo salar v. -- --
LECa.Sal.Sal.xx.Xxxx. Chinook. [574] Salmo trutta. -- --
LECa.Sal.Tru.xx.Xxxx. [618] Tetragonolobus -- --
LECp.Tet.Pur.xx.Xxxx. pupurea. [619] Thermopsis. -- --
LECz.The.sss.xx.Xxxx. [621] Toxopneustes -- C-lectin.
LECi.Xxx.Xxx.xx.Xxxx. pileolu. [622] Trichoderma. -- --
LECf.Tri.Sss.xx.Xxxx. [623] Tricholoma -- -- LECf.Tri.Mon.xx.Xxxx.
mongolicum. [624] Tricholomataceae -- -- LECf.Tri.Sss.xx.Xxxx.
93-138. [625] Tricholomataceae -- -- LECz.Tri.Sss.xx.Xxxx. 93-34.
[626] Trichosanthes TJA-II, TJA-I, TK-I, -- LECp.Tri.Jap.xx.Xxxx.
japonica. TK-II. [627] Trifolium repens. -- --
LECp.Tri.Rep.xx.Xxxx. [628] Triticum WGA. Hevein domain
LECp.Tri.Aes.se.Hch1. aestivium. lectin, chitin binding lectin.
[629] Tulipa gesneriana. TGA. -- LECp.Tul.Ges.xx.Xxxx. [630] Udotea
petiolata. -- -- LECp.Udo.Pet.xx.Xxxx. [631] Ulex europaeus. UEA-I,
UEA-II, Legume lectin. LECp.Ule.Eur.xx.Xxxx. UEA-III. [632] Ulva
lactuca. -- -- LECu.Ulv.Lac.xx.Xxxx. [633] Ulva laetevirens. -- --
LECu.Ulv.Lae.xx.Xxxx. [635] Ulva rigida. -- --
LECz.Ulv.Rig.xx.Xxxx. [637] Urtica dioica. UDA. Chitin-binding
LECp.Urt.Dio.rh.Hch1. lectins. [638] Vaejovis -- --
LECi.Vae.Con.xx.Xxxx. confuscius. [639] Vatairea VML. --
LECp.Vat.Mac.xx.Xxxx. macrocarpa. [640] Vibrio -- --
LECb.Vib.Alg.xx.Xch1. alginolyticus. [641] Vibrio chlolera. VPCV;
Chitovibrin. -- LECb.Vib.Cho.xx.Xxxx. [642] Vicia cracca. -- --
LECp.Vic.Cra.xx.Xxxx. [643] Vicia ervilia. -- --
LECp.Vic.Erv.xx.Xxxx. [644] Vicia faba. VFA, Favin. Legume lectin.
LECp.Vic.Fab.xx.Xxxx. [645] Vicia graminea. VGA. --
LECp.Vic.Gra.xx.Xxxx. [646] Vicia hyrcanica. -- --
LECp.Vic.Hyr.xx.Xxxx. [647] Vicia sativa. -- --
LECp.Vic.Sat.xx.Xxxx. [648] Vicia unijuga. VUA. --
LECp.Vic.Unj.xx.Xxxx. [649] Vicia villosa. VVA-A4, VVL-A4. Legume
lectin. LECp.Vic.Vil.xx.Xxxx. [650] Vigna radiata. MBL-I, MBL-II.
-- LECp.Vig.Rad.xx.Xxxx. [651] Vigna unguiculata. -- --
LECp.Vig.Ung.xx.Xxxx.
[652] Viscum album. ML-I, ML-II, ML-III, Beta-trefoil lectin
LECp.Vis.Alb.pl.Cga1 Viscumin, (ML-I). (ML-I, viscumin) VisAlbCBA.
LECp.Vis.Alb.pl.Cga2 (ML-II, viscumin) LECp.Vis.Alb.pl.Cga3
(ML-III, VAA-II) LECp.Vis.Alb.pl.Hch1 (VisAlbCBA). [653] Vitis
vinifera. -- -- LECp.Vit.Vin.xx.Xxxx. [654] Volvariella VVL. --
LECf.Vol.Vol.xx.Xxxx. volvacea. [655] Wistaria WFA. --
LECp.Wis.Flo.xx.Xxxx. floribunda. [656] Wistaria -- --
LECp.Wis.Flo.xx.Xxxx. floribunda. [657] Wistaria sinensis. -- --
LECp.Wis.Sin.xx.Xxxx. [658] Wistaris -- -- LECz.Wis.Bra.xx.Xxxx.
brachbotrys. [659] Xanthosoma -- -- LECp.Xan.Sag.xx.Xxxx.
sagittifolium. [660] Xenopus laevis -- -- LECa.Xen.Lae.xx.Xga1.
ovum. [661] Xeromus -- -- LECz.Xer.Chr.xx.Xxxx. chrysenteron. [662]
Xylaria -- -- LECf.Xyl.Pol.xx.Xxxx. polymorpha. [663] Zea mays.
ZMA-I, ZMA-II, -- LECp.Zea.May.xx.Xxxx. ZMEA. [664] Cannabis
sativa. CSA. -- LECp.CanSat.se.Glu. [665] Smilax glabra.
Sarparilla. -- LECp.SmiGla.rh.xxx. [666] Trichosanthes Snake gourd.
-- -- anguina.
[0135] Lectin codes take the following form:
TABLE-US-00002 LLLx.Ggg.Sss.ti.TspN
[0136] An explanation of each index variable follows.
LLL refers to the general category of agglutinin. At this point six
general categories are recognized: lectins (LEC), integrins (INT),
cadherins (CDH), annexins (ANN), selectins (SEL) and galectins
(GLT). The x value refers to the taxonomic groups of the
agglutinin, Table 1 summarizes these categories:
TABLE-US-00003 Category Taxonomic group LECa, GLTa Lectin or
galectin from higher animal, typically vertebrates. LECh, GLTh
Lectin or galectin from humans LECi, GLTi Lectin or galectin from
invertebrates LECp. Plant lectins LECf. Lectin from fungi LECu.
Lectin from unicellular organisms LECb. Lectin from Bacteria LECv.
Viral lectins
Ggg stands for the three first letters of the plant genus name (in
Latin). Sss stands for the three first letters of the plant species
name (in Latin). ti refers to the tissue from which the lectin has
been isolated. Table 2 summarizes the indices used for the various
tissues:
TABLE-US-00004 Tissue, cell or organ Taxonomic grouping Index Bark
Plant Ba Bulb Plant Bu Cell membrane Bacteria, Unicellular Cm
Epidermis Human, vertebrates Ep Fruit Plant Fr Hemolymph
Invertebrates He Latex Plant La Leaf Plant Le Nodule Plant No Organ
or cell type Human, vertebrates, Oc Invertebrates Phloem sap Plant
Ps Rhizome Plant Rh Root Plant Ro Seed Plant Se Serum or plasma
Human, vertebrates, Sr Invertebrates Spores or fruiting bodies
Fungi Sp Stem Plant St Tentacles Invertebrates Te Tuber Plant Tu
Whole body homogenate Invertebrates Wb Venom Invertebrates Ve
Undefined Human, vertebrates, Un Invertebrates, Bacteria,
Unicellular, Virus, Fungal
T refers to the lectin subtype. Hololectins, merolectins,
chimerolectins and superlectins are indicated by the letters H, M,
C and S, respectively. sp refers to the specificity group. Each
group is indicated by the index given in Table 3:
TABLE-US-00005 Specificity Index of group Mannose-binding lectins
ma Mannose/maltose-binding mm lectins Mannose/glucose-binding mg
lectins GlcNAc/(GlcNAc)-binding ch lectins Gal/GalNAc-binding
lectins ga Fucose-binding lectins fu Sialic acid-binding lectins si
Lectins with a complex but co known specificity Lectins with a
complex and cu unknown specificity Lectins with a dual specificity
du Lectins with an undetermined nd specificity
[0137] Lipids
[0138] A multifunctional molecule of the invention can also be a
molecule that comprises a first part which comprises a lipid and a
second part which comprises an amino acid sequence which can bind
to a cell surface molecule, e.g. a cell surface molecule of an APC.
The attachment of a lipid, e.g. a long-chain fatty acid, to a
molecule, e.g. a polypeptide, can permit the complex to become
stably associated with the plasma membrane when the complex is
admixed with a cell (Nagarajan et al, 1995, J Immunol Methods
184:241-51; McHugh et al, 1995, PNAS 92:8059-63; van den Berg et
al, 1995, J Cell Biol, 131:669-77). This is believed to occur
through intercalation of the lipid into the membrane. A convenient
method of producing a lipid-associated polypeptide comprises
expressing, in a suitable host cell, a nucleic acid encoding, in
part, a signal sequence directing the post-translational addition
of a GPI moiety. Using recombinant DNA technology, a naturally
non-GPI linked protein can be expressed as a GPI-linked protein by
constructing a nucleic acid that encodes the protein linked to a
heterologous GPI signal sequence. Nucleotide sequences encoding GPI
signal sequences useful for this purpose include, for example,
those comprised by decay accelerating factor (e.g., sequences
encoding amino acid sequence "22" in Table 1 of Bucht and
Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32; sequences
encoding signal sequences disclosed in Caras et al, U.S. Pat. No.
5,109,113); brevican (e.g., nt 1982-2047 of Genbank accession
number X86406), mesothelin (e.g., nt 1858-1983 of Genbank U40434),
coccidioides immitis antigen 2 (e.g., sequences encoding amino
acids 172-194 of NCBI Entrez protein database accession # 1256444,
Zhu et al, 1996, Gene 181:121-5), acetylcholinesterase (e.g.,
sequences encoding the peptide "HC" as described in Duval et al,
1992, EMBO J 11:3255-61; (e.g., sequences encoding amino acid
sequence "19" in Table 1 of Bucht and Hjalmarsson, 1996, Biochim
Biophys Acta 1292:223-32)), human folate receptors alpha and beta
(e.g., sequences encoding amino acids 230-257 of NCBI Entrez
protein database accession # 182416 or amino acids 228-255 of NCBI
Entrez protein database accession # 1655592, Yan and Ratnam, 1995,
Biochemistry 34:14594-600), 5' nucleotidase (e.g., sequences
encoding amino acids 547-570 or 547-574 of NCBI Entrez protein
database accession # 404502, Furukawa et al, 1994, Biochim Biophys
Acta 1190:273-8; (e.g., sequences encoding amino acid sequences "5"
or "6" in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys
Acta 1292:223-32)), CD59 (e.g. encoded by nt 393-473 of Genbank
U48255; sequences encoding amino acid sequence "20" in Table 1 of
Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32;
sequences encoding amino acids 74-101 of FIG. 2 of Powell et al,
1997, J Immunol 158:1692-1702), T-cadherin (e.g., sequences
encoding the 76 C-terminal amino acids of chick T cadherin as
described by Koller and Ranscht, 1996, J Biol Chem 271:30061-7),
aminopeptidase P (e.g., sequences encoding amino acids 649-673 of
NCBI Entrez protein database accession # 1517942, Hyde et al, 1996,
Biochem J 319:197-201), carboxypeptidase M, CD16B, Thy 1, carbonic
anhydrase IV (e.g., sequences encoding amino acids 284-312 of NCBI
Entrez protein database accession # 179791, Okuyama et al, 1995,
Arch Biochem Biophys 320:315-22), placental alkaline phosphatase
(e.g., sequences encoding amino acids 498-529 of NCBI Entrez
protein database accession # 178464, Oda et al, 1994, Biochem J
301:577-83), neuronal glycoprotein F3, carcinoembryonic antigen
(e.g., sequences encoding amino acid sequence "28" in Table 1 of
Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32),
MRC-OX45 (e.g., sequences encoding amino acid sequence "2" in Table
1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta
1292:223-32), RT 6.2 (e.g., sequences encoding amino acid sequence
"3" in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta
1292:223-32), D. discoideum prespore-specific antigen (e.g.,
sequences encoding amino acid sequence "4" in Table 1 of Bucht and
Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), microsomal
dipeptidase (e.g., sequences encoding amino acid sequence "8" in
Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta
1292:223-32), CAMPATH-1 (e.g., sequences encoding amino acid
sequence "9" in Table 1 of Bucht and Hjalmarsson, 1996, Biochim
Biophys Acta 1292:223-32), T. brucei PARP (e.g., sequences encoding
amino acid sequence "10" in Table 1 of Bucht and Hjalmarsson, 1996,
Biochim Biophys Acta 1292:223-32), T. brucei VSG Mit 118a (e.g.,
sequences encoding amino acid sequence "11" in Table 1 of Bucht and
Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG
Mit 117a (e.g., sequences encoding amino acid sequence "12" in
Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta
1292:223-32), T. brucei VSG MITat 1.1000 BC (e.g., sequences
encoding amino acid sequence "13" in Table 1 of Bucht and
Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG
MITat 1.5b (e.g., sequences encoding amino acid sequence "14" in
Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta
1292:223-32), T. brucei VSG ILTat 1.1 (e.g., sequences encoding
amino acid sequence "15" in Table 1 of Bucht and Hjalmarsson, 1996,
Biochim Biophys Acta 1292:223-32), T. brucei VSG TxTat 1 (e.g.,
sequences encoding amino acid sequence "16" in Table 1 of Bucht and
Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG
Mit 221 (e.g., sequences encoding amino acid sequence "17" in Table
1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta
1292:223-32), prion proteins (e.g., sequences encoding amino acid
sequence "18" in Table 1 of Bucht and Hjalmarsson, 1996, Biochim
Biophys Acta 1292:223-32), urokinase receptor (e.g., sequences
encoding amino acid sequence "21" in Table 1 of Bucht and
Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. congolense
VSG YNat 1.1 (e.g., sequences encoding amino acid sequence "23" in
Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta
1292:223-32), S. cerevesiae GAS-1 (e.g., sequences encoding amino
acid sequence "24" in Table 1 of Bucht and Hjalmarsson, 1996,
Biochim Biophys Acta 1292:223-32), Thy-1 (e.g., sequences encoding
amino acid sequences "25" or "26" in Table 1 of Bucht and
Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), L. major PSP
(e.g., sequences encoding amino acid sequence "29" in Table 1 of
Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), D.
discoideum contact site A glycoprotein (e.g., sequences encoding
the 25 C-terminal amino acids as described in Barth et al, 1996,
Biochem J 317:533-40) CD24, and synthetic sequences (e.g. as
described by Coyne et al, 1993, J Biol Chem 268:6689-93).
[0139] GPI-linked polypeptides can be extracted from cells using
the following method. 5.times.10.sup.6 cells are spun down and
frozen at -80.degree. C. The pellet is thawed in 14 ml of 0.15M
NaCl/10 mM Tris 7.4/0.1 mM primaquine/2% Trito X-114 with stirring
at 0.degree. C. for 1 h, then centrifuged at 8800 g at 0.degree. C.
for 10 min. The supernatant is maintained at -20.degree. C.
overnight, thawed at room temperature, and then placed at
32.degree. C. for 12 min. It is then centrifuged at 3000 g for 3
min at 32.degree. C. The top layer is decanted and 11 ml of cold
Buffer A (0.15M NaCl/10 mM Tris 7.4/0.1 mM primaquine/0.06% Triton
X-114) is added to the bottom layer. This is incubated on ice for
10 min. The 12 min 32.degree. C. incubation, 32.degree. C. 3000 g
centrifugation, decanting of top layer, and addition of 11 ml cold
Buffer A to bottom layer are repeated. The solution is centrifuged
at 18000 g for 10 min at 0.degree. C. The 12 min 32.degree. C.
incubation, 32.degree. C. 3000 g centrifugation, and decanting of
top layer are repeated. 3 vol of cold acetone are added to the
final bottom phase. The solution is centrifuged at 12,000 RPM for
30 min, the supernatant removed, and the protein pellet containing
the GPI fraction dried under vacuum. Specific proteins can be
purified by methods well-known to those skilled in the art, e.g.
immunoaffinity purification.
[0140] Another method of producing a lipid-linked polypeptide is to
chemically link the polypeptide to a fatty acid such as palmitate.
1.5 mg/ml of the polypeptide is suspended in PBS, pH 7.8,
containing 0.3% deeoxycholic acid, 0.1% sodium bicarbonate, and
0.1% sodium azide. The optimal final pH of the solution is 7.6-8.0.
The mixture is warmed to 37.degree. C. and the N-hydroxysuccinimide
ester of palmitic acid (Research Organics, Cleveland, Ohio) is
added to a final concentration of 0.1 mg/ml. The solution is
incubated overnight at room temperature. The polypeptide is
purified by passage through a 16.times.250 mm Sephadex G-75
chromatography column equilibrated with 0.15% deoxycholic acid in
PBS, pH 7.6.
[0141] Crosslinking Moieties Useful According to the Invention
[0142] Another convenient method of linking a ligand to an antigen
bearing target is to use a crosslinking agent. A "crosslinking
agent" is a chemical entity that can react with functional groups
on at least two other molecules, e.g. two polypeptides or a
polypeptide and a lipid, such that upon reaction with the
crosslinking agent the two molecules become covalently linked.
Thus, a ligand for CD40 can be crosslinked to a molecule on the
surface of a cell.
[0143] A wide variety of crosslinking agents, both bifunctional and
polyfunctional, are known in the art and are commercially
available, e.g. from Sigma (St. Louis, Mo.). These include, for
example, S-acetylmercaptosuccinic anhydride, S-acetylthioglycolic
acid N-hydroxysuccinimide ester, S-acetylthiopropionic acid
N-hydroxysuccinimide ester, adipic acid dihydrazide, 4-azidobenzoic
acid N-hydroxysuccinimide ester,
N-(5-azido-2-nitrobenzyloxy)succinimide,
6-(4-azido-2-nitrophenylamino)hexanoic acid N-hydroxysuccinimide
ester, p-azidophenacyl bromide, N-(4-azidophenylthio)phthalimide,
4-azidosalicylic acid N-hydroxysuccinimide ester, bromoacetic acid
N-hydroxysuccinimide ester, 1,4-butanediol diglycidyl ether,
carbonyl-bis(L-methionine p-nitrophenyl ester),
2-diazo-3,3,3-trifluoropropionic acid p-nitrophenyl ester, diethyl
malonimidate, 1,5-difluoro-2,4-dinitrobenzene,
4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid, dimethyl
adipimidate, dimethyl 3,3'-dithiobispropionimidate, dimethyl
pimelimidate, dimethyl suberimidate, 4,4'-dithiobisphenyl azide,
dithiobis(propionic acid N-hydroxysuccinimide ester), ethylene
glycol bis-(succinic acid N-hydroxysuccinimide ester),
4-fluoro-3-nitrophenyl azide, bis-(4-fluoro-3-nitrophenyl) sulfone,
p-formylbenzoic acid N-hydroxysuccinimide ester, glutaraldehyde,
2-iminothiolane, 6-(iodoacetamido)caproic acid N-hydroxysuccinimide
ester, iodoacetic acid N-hydroxysuccinimide ester, 3-malemidoacetic
acid N-hydroxysuccinimide ester, 3-malemidobenzoic acid
N-hydroxysuccinimide ester, 4-(N-malemido)benzophenone,
gamma-malemidobutyric acid N-hydroxysuccinimide ester,
epsilon-malemidocaproic acid N-hydroxysuccinimide ester,
4-(N-malemidomethyl)cyclohexanecarboxylic acid N-hydroxysuccinimide
ester, 4-(N-malemidomethyl)cyclohexanecarboxylic acid
3-sulfo-N-hydroxysuccinimide ester, beta-malemidopropionic acid
N-hydroxysuccinimide ester,
N,N'-bis(3-malemidopropionyl)-2-hydroxy-1,3-propanediamine,
1,4-phenylene diisothiocyanate, N,N'-o-phenylene dimalemide,
N,N'-p-phenylene dimalemide, polyoxyethylene bis(glycidyl ether),
bis(polyoxyethylene bis(glycidyl ether)), polyoxyethylene
bis(imidazolylcarbonyl), bis(polyoxyethylene
bis(imidazolylcarbonyl)), polyoxyethylene bis(p-nitrophenyl
carbonate), 3-(2-pyridyldithio)propionic acid N-hydroxysuccinimide
ester, suberic acid bis(N-hydroxysuccinimide) ester, succinic acid
malemidoethyl N-hydroxysuccinimide ester, 1, 5
bis(succinimidooxycarbonyloxy)-pentane, and bis(N-succinimidyl)
carbonate.
[0144] Ligands of a Cell Surface Protein
[0145] The multifunctional molecules of the present invention
comprise one part which is a lectin and is capable of binding to at
least one carbohydrate molecule on an antigen bearing target, and a
second part comprising a ligand for a cell surface protein of an
antigen presenting cell. The ligand can be any ligand which binds
to one or more of the cell surface molecules indicated by GenBank
Accession number in Appendix I or II. More preferably, however, the
ligand includes, but is not limited to an opsonin, a cytokine, a
heat shock protein, an adhesion molecule. a defensin, or a
counterreceptor for a T cell costimulatory molecule; or a portion
of any of these molecules, e.g., about (or at least about) 5, 8,
10, 12, 15, 20, 25, 35, 40, 50, 60, 70, 80, 100, or 120 contiguous
amino acid residues, up to the full length of such a molecule.
[0146] Cytokines Useful According to the Invention
[0147] The term "cytokine" as defined hereinabove refers to a
polypeptide molecule that is naturally secreted by mammalian cells
and that binds to a cell surface receptor on a leukocyte. The term
"cytokine" also refers herein to a polypeptide molecule that is a
ligand for a receptor for a naturally occurring cytokine. Unlike an
opsonin, a cytokine does not naturally contemporaneously bind an
antigen and a cell-surface receptor.
[0148] Leukocytes which bear receptors for cytokines include, for
example, monocytes, macrophages, dendritic cells, neutrophils,
eosinophils, basophils, platelets, lymphocytes, T lymphocytes, B
lymphocytes, NK cells, myeloma cells, lymphoma cells, and leukemic
cells.
[0149] Without being bound by any one mechanism, it is believed
that cell-surface associated cytokines provide an advantage over
freely diffusible cytokines by allowing stable juxtaposition of the
cytokine to the cell, thus increasing the concentration of cytokine
in the vicinity of the cell.
[0150] Preferred cytokines are non-rodent cytokines, e.g primate,
e.g. human cytokines.
[0151] Some cytokines can be regarded as belonging to one or more
families of cytokines based on structural and/or functional
properties. One such family consists of the interleukins.
Interleukins are structurally diverse, but share the property of
both being expressed by and acting on leukocytes. Examples of
interleukins include IL-1 (e.g. polypeptides encoded by Genbank
Accession No. M15330, M28983, E04743, M15131) IL-2 (e.g.
polypeptides encoded by Genbank Accession No. E01 108, K02797),
IL-3 (e.g. polypeptides encoded by Genbank Accession No. A02046,
M14743), IL-4 (e.g. polypeptides encoded by M13982, M25892), IL-5
(e.g. polypeptides encoded by X06270, J03478), IL-6 (e.g.
polypeptides encoded by E02772, M20572), IL-7 (e.g. polypeptides
encoded by J04156, M29054-29057), IL-8 (e.g. polypeptides encoded
by M28130), IL-9 (e.g. sequences disclosed in Kelleher et al,
Blood. 1991; 77: 1436-1441, Immunogenetics 1990; 31(4):265-270),
IL-10 (e.g. polypeptides encoded by M84340, U16720), IL-11 (e.g.
sequences disclosed in Paul et al, Proc Natl Acad Sci USA. 1990;
87: 7512-7516, Morris et al, Exp Hematol. 1996; 24: 1369-1376),
IL-12 (e.g. polypeptides encoded by Genbank Accession No. M86671,
S82412; Genbank protein P29459, P29460), IL-13 (e.g. polypeptides
encoded by U31120, L13028), 1L-14 (e.g. sequences disclosed in
Ambrus et al, Proceedings of the National Academy of Science (USA)
1993; 90: 6330-4), IL-15 (e.g. polypeptides encoded by AF031167,
U22339), 1L-16 (e.g. polypeptides encoded by AF006001, M90391),
IL-17 (e.g. polypeptides encoded by U32659, U43088), IL-18 (e.g.
polypeptides encoded by D49949, D49950), IL-19 (e.g. polypeptides
encoded by AY040367), IL-20 (e.g. polypeptides encoded by NM02130,
NM018724), IL-21 (e.g. polypeptides encoded by AF254069, AF254070),
IL-22 (e.g. polypeptides encoded by AF279437), IL-23 (e.g.
polypeptides encoded by AF301619, AF301620, AY055379 [p19 alpha
chain combines with IL-12 p40 chain to form IL-23]), IL-24 (e.g.
polypeptides encoded by AF276916, NM053095), IL-25 (e.g.
polypeptides encoded by NM080837), TNF-alpha (e.g. polypeptides
encoded by M16441, Y00467), and GM-CSF (e.g. polypeptides encoded
by X03019, M11220) and their homologues among species. Nucleotide
sequences encoding homologues will hybridize to each other under
moderate- to high-stringency conditions.
[0152] Another family consists of the hematopoietins. Members of
this family comprise helical regions, known as helices A, B, C, and
D. Helices A and B and helices C and D run roughly parallel to each
other, respectively. Examples of hematopoietins include IL-2, IL-3,
IL-4, IL-5, IL-6, IL-7, IL-9, IL-11, IL-12, IL-13, 1L-15, GM-CSF,
G-CSF (e.g. polypeptides encoded by Genbank Accession No. E01219,
M13926), oncostatin M (e.g. polypeptides encoded by Genbank
Accession No. D31942, sequences disclosed in Malik et al, Mol Cell
Biol 1989, 9:2847-2853), LIF (e.g. polypeptides encoded by Genbank
Accession No. X13967, X06381), CNTF (e.g. polypeptides encoded by
Genbank Accession No. U05342, X60542), and their homologues among
species. Nucleotide sequences encoding homologues will hybridize to
each other under moderate- to high-stringency conditions.
[0153] Human IL2 is a protein of 133 amino acids (15.4 kDa) with a
slightly basic pI. Murine and human IL2 display a homology of
approximately 65%. IL2 is synthesized as a precursor protein of 153
amino acids with the first 20 amino-terminal amino acids
functioning as a hydrophobic secretory signal sequence. The protein
contains a single disulfide bond (positions Cys58/105) essential
for biological activity.
[0154] IL2 is O-glycosylated at threonine at position 3. Variants
with different molecular masses and charges are due to variable
glycosylation. Non-glycosylated IL2 is also biologically active.
Glycosylation appears to promote elimination of the factor by
hepatocytes.
[0155] A dimeric form of human IL2, produced by the action of a
transglutaminase isolated from regenerating fish optic nerves, has
been shown to be a cytotoxic factor for rat brain oligodendrocytes
in culture.
[0156] The human IL2 gene contains four exons. The IL2 gene maps to
human chromosome 4q26-28 (murine chromosome 3). The homology of
murine and human IL2 is 72% at the nucleotide level in the coding
region.
[0157] The biological activities of IL2 are mediated by a membrane
receptor that is expressed almost exclusively on activated, but not
on resting, T-cells at densities of 4-12.times.10.sup.3
receptors/cell. Activated B-cells and resting mononuclear
leukocytes rarely express this receptor. The expression of the IL2
receptor is modulated by IL5 and IL6. Three different types of IL2
receptors are distinguished that are expressed differentially and
independently. The high affinity IL2 receptor (Kdis .about.10 pM)
constitutes approximately 10% of all IL2 receptors expressed by a
cells. This receptor is a membrane receptor complex consisting of
the two subunits IL2R-alpha (TAC antigen=T-cell activation antigen;
p55) and IL2R-beta (p75; CD122) as the ligand binding domains and a
gamma chain as a signaling component. p75 is expressed
constitutively on resting T-lymphocytes, NK-cells, and a number of
other cell types while the expression of p55 is usually observed
only after cell activation. p55 is, however, synthesized
constitutively by a number of tumor cells and by HTLV-1-infected
cells.
[0158] IL2 receptor expression of monocytes is induced by
IFN-gamma, so that these cells become tumor-cytotoxic. In T-cells
the expression of p75 can be reduced by IL3. An intermediate
affinity IL2 receptor (Kdis=100 pM) consists of the p75 subunit and
a gamma chain (see below) while a low affinity receptor (Kdis=10
nM) is formed by p55 alone.
[0159] p55 (e.g. polypeptides encoded by Genbank Accession No.
X01057) has a length of 251 amino acids with an extracellular
domain of 219 amino acids an a very short cytoplasmic domain of 13
amino acids. The p55 gene maps to human chromosome 10p14-p15.
[0160] p75 (e.g. polypeptides encoded by Genbank Accession No.
M26062, M28052) has a length of 525 amino acids with an
extracellular domain of 214 amino acids and a cytoplasmic domain of
286 amino acids. The p75 gene contains 10 exons and has a length of
approximately 24 kb. It maps to human chromosome 22q11. 2-q12 and
to murine chromosome 15 (band E).
[0161] A third 64 kDa subunit of the IL2 receptor, designated
gamma, has been described (e.g. polypeptides encoded by Genbank
Accession No. D13821, D11086). Murine and human gamma subunits of
the receptor have approximately 70% sequence identity at the
nucleotide and amino acid levels. This subunit is required for the
generation of high and intermediate affinity IL2 receptors but does
not bind IL2 by itself. These two receptor types consist of an
alpha-beta-gamma heterotrimer and a beta-gamma heterodimer,
respectively. The gene encoding the gamma subunit of the IL2
receptor maps to human chromosome Xq13, spans approximately 4.2 kb
and contains eight exons. The gamma subunit of the IL2 receptor has
been shown recently to be a component of the receptors for IL4 and
IL7. It is also believed to be a component of the IL13
receptor.
[0162] The amino acids at positions 267-317 lying directly adjacent
to the transmembrane region of p75 are involved in IL2-mediated
signal transduction. In addition the IL2 receptor is associated
with a number of other proteins (p22, p40, p100) which are thought
to be involved in mediating conformational changes in the receptor
chains, receptor-mediated endocytosis, and further signal
transduction processes. One of the identified proteins is the 95
kDa cell adhesion molecule ICAM-1 which probably focuses IL2
receptors at regions of cell-to-cell contacts and thus may mediate
paracrine activities, for example, during IL2-mediated stimulation
of T-cells. Another protein associated with p75 is a
tyrosine-specific protein kinase called lck. The observation that
proliferation of cells induced by IL2 is inhibited by specific
inhibitors of protein tyrosine kinases in an lck negative cell line
suggests that other kinases may also be associated with IL2
receptors. Two such kinases, called fyn and lyn, have been
identified. In addition, IL2 receptor signaling may also be
mediated by vav.
[0163] Activated lymphocytes continuously secrete a 42 kDa fragment
of the TAC antigen. This fragment circulates in the serum and
plasma and functions as a soluble IL2 receptor (sIL2R). The
concentrations of this soluble receptor vary markedly in different
pathological situations, for example, infections, autoimmune
diseases, leukemias, or after organ transplantation. Levels may
increase up to 100-fold. The levels of sIL2R appear to correlate
with the severity of HIV-induces diseases and may be of diagnostic
value also in other settings.
[0164] Mouse and human IL2 both cause proliferation of T-cells of
the homologous species at high efficiency. Human IL2 also
stimulates proliferation of mouse T-cells at similar
concentrations, whereas mouse IL2 stimulates human T-cells at a
lower (sixfold to 170-fold) efficiency.
[0165] IL2 is a growth factor for all subpopulations of
T-lymphocytes. It is an antigen-unspecific proliferation factor for
T-cells that induces cell cycle progression in resting cells and
thus allows clonal expansion of activated T-lymphocytes. This
effect is modulated by hormones such as prolactin.
[0166] IL2 also promotes the proliferation of activated B-cells
also this requires the presence of additional factors, for example,
IL4.
[0167] Due to its effects on T-cells and B-cells IL2 is a central
regulator of immune responses. It also plays a role in
anti-inflammatory reactions, in hematopoiesis and in tumor
surveillance. IL2 stimulates the synthesis of IFN-gamma in
peripheral leukocytes and also induces the secretion of IL1,
TNF-alpha and TNF-beta.
[0168] It is believed that he induction of the secretion of
tumoricidal cytokines apart from the activity in the expansion of
LAK cells (lymphokine-activated killer cells) are probably the main
factors responsible for the antitumor activity of IL2.
[0169] IL2 can be assayed in bioassays employing cell lines that
respond' to the factor (e.g., ATH8, CT6, CTLL-2, FDCPmix, HT-2,
NKC3, TALL-103). Specific ELISA assays for IL2 and enzyme
immunoassays for the soluble receptor are also available. The
soluble receptor can be detected also by employing biotinylated IL2
and flow-through cytometry or ELISA assays.
[0170] IL2 displays significant anti-tumor activity for a variety
of tumor cell types since it supports the proliferation and clonal
expansion of T-cells that specifically attack certain tumors. IL2
is increasingly used to treat patients with cancers refractory to
conventional treatment. Combination therapy with systemically
administered IL2 has resulted in long-term remissions in 30% of
patients with metastatic renal cell carcinoma, for which there is
no standard treatment. Objective and long-lived clinical responses
have been documented also in a proportion of patients with melanoma
or acute myeloid leukemia.
[0171] High dose systemic IL2 therapy is also associated with a
great number of unwanted toxic side-effects. IL2 has additional
effects on other components of the cellular immune system,
including B-cells and macrophages, and induces the secretion of
other soluble mediators, including TNF-alpha, TNF-beta, and
IFN-gamma. These effects may contribute to the antitumor activity
of IL2 as well as to its dose-related toxicity.
[0172] The transduction of murine tumor cells with a functional IL2
gene has been shown to lead to the rejection of the genetically
modified cells by syngeneic hosts. Altered tumor cells expressing
IL2 also increase systemic immunity.
[0173] Human IL4 is a protein of 129 amino acids (20 kDa) that is
synthesized as a precursor containing a hydrophobic secretory
signal sequence of 24 amino acids. IL4 is glycosylated at two
arginine residues (positions 38 and 105) and contains six cysteine
residues involved in disulfide bond formation. The disulfide bonds
are essential for biological activity. Some glycosylation variants
of IL4 have been described that differ in their biological
activities. A comparison of murine and human IL4 shows that both
proteins only diverge at positions 91-128.
[0174] An IL4 variant, Y124D, in which Tyr124 of the recombinant
human protein is substituted by an aspartic acid residue, binds
with high affinity to the IL4 receptor (Kd=310 pM). This variant is
a powerful antagonist for the IL4 receptor system. It retains no
detectable proliferative activity for T-cells and competitively
inhibits IL4-dependent T-cell proliferation (K(i)=620 pM). The
existence of this mutant demonstrates that high affinity binding
and signal generation can be uncoupled efficiently in a ligand.
Y124D also acts as a powerful antagonist for the IL13 receptor.
[0175] The human IL4 gene contains four exons and has a length of
approximately 10 kb. It maps to chromosome 5q23-31. The murine gene
maps to chromosome 11. The IL4 gene is in close proximity to other
genes encoding hematopoietic growth factors (e.g., GM-CSF, M-CSF,
IL3, IL5). The distance between the IL4 and the IL5 gene is
approximately 90-240 kb.
[0176] At the nucleotide level the human and the murine IL4 gene
display approximately 70% homology. The 5' region of the IL4
contains several sequence elements, designated CLE (conserved
lymphokine element), that are binding sites for transcription
factors controlling the expression of this and other genes. A
sequence motif, called P sequence (CGAAAATTTCC; SEQ ID NO: 1) in
the 5' region of the human IL4 gene (positions-79-69) is the
binding site for a nuclear factor, called NF(P), mediating the
response to T-cell activation signals.
[0177] The biological activities of IL4 are mediated by a specific
receptor (Kdis=20-100 pM) which is expressed at densities of
100-5000 copies/cell (e.g. polypeptides encoded by Genbank
Accession No. M29854, X52425). The extracellular domain of the IL4
receptor is related to the receptors for erythropoietin (Epo), IL6,
and the beta chain of the IL2 receptor. It has been given the name
CD124.
[0178] The cDNA for the murine IL4 receptor encodes a transmembrane
protein of 810 amino acids (including a secretory signal sequence).
This receptor has a large intracellular domain of 553 amino acids.
The human receptor has an extracellular domain of 207 amino acids,
a transmembrane domain of 24 residues, and a large intracellular
domain of 569 amino acids.
[0179] The IL4 receptor has been shown recently to contain the
gamma subunit of the IL2 receptor as a signaling component. This
gamma subunit is also associated with the receptors for IL4 and IL7
and probably also of IL13. Two forms of the receptor have been
described, one of which is secreted. The secreted receptor only
contains the extracellular IL4 binding domain and is capable of
blocking IL4 activities. An IL4 binding protein (IL4-BP) that binds
IL4 with the same affinity as the IL4 receptor has been shown also
to be a soluble IL4 receptor variant. These soluble receptors
probably function as physiological regulators of cytokine
activities by inhibiting receptor binding or act as transport
proteins. Soluble receptors or binding proteins have been described
also for IL1 (IL1 receptor antagonist), IL2, IL6, IL7, TNF-alpha,
IGF, and IFN-gamma.
[0180] The biological activities of IL4 are species-specific; mouse
IL4 is inactive on human cells and human IL4 is inactive on murine
cells. IL4 promotes the proliferation and differentiation of
activated B-cells, the expression of class II MHC antigens, and of
low-affinity IgE receptors in resting B-cells. IL4 enhances
expression of class II MHC antigens on B-cells. It can promote
their capacity to respond to other B-cell stimuli and to present
antigens for T-cells. This may be one way to promote the clonal
expansion of specific B-cells and the immune system may thus be
able to respond to very low concentrations of antigens. The
production of IL4 by non-B non-T-cells is stimulated if these cells
interact with other cells via their Fc receptors for IgE or IgG.
This effect can be enhanced by IL3. IL2 and PAF (platelet
activating factor) induce the synthesis of IL4 while TGF-beta
inhibits it.
[0181] IL3 antagonizes the IL2-induced effects in B-cells and
causes a slow decrease of the expression of IL2 receptors, thus
inhibiting the proliferation of human B-cells stimulated by IL2. In
activated B-cells IL4 stimulates the synthesis of IgG1 and IgE and
inhibits the synthesis of IgM, IgG3, IgG2a and IgG2b. This isotype
switching induced by IL4 in B-cells is antagonized by IFN-gamma.
The growth of multiple myelomas can be suppressed by IL4 which
inhibits the synthesis of IL6, a myeloma growth factor. IL4 also
inhibits the synthesis of IL6 in human alveolar macrophages.
[0182] Pretreatment of macrophages with IL4 prevents the production
of IL1, TNF-alpha and prostaglandins in response to activation of
the cells by bacterial endotoxins or IFN-gamma.
[0183] IL4 synergises with Epo and G-CSF/Epo in the generation of
colonies containing granulocytes or erythroid progenitor cells in a
colony formation assay.
[0184] The classical detection method for IL4 is a B-cell
costimulation assay measuring the enhanced proliferation of
stimulated purified B-cells. IL4 can be detected also in bioassays,
employing IL4-responsive cells (e.g., BALM-4; BCL1; CT.4S; CTL44;
CTLL-2; Da; FDCPmix; HT-2; L4; L138.8A; MO7E; MC/9; NFS-60; Ramos,
Sez627, TF-1; TS1). A specific detection method for human IL4 is
the induction of CD23 in a number of B-cell lines with CD23
detected either by flow-through cytometry or by a fluorescence
immunoassay. An immunoassay that allows rapid determination of the
rate of IL4 production under conditions preventing
consumption/degradation is cytokine immunotrapping.
[0185] IL4 inhibits the growth of colon and mammary carcinomas. It
has been shown to augment the development of LAK cells. The
transduction of murine tumor cells with a functional IL4 gene has
been shown to lead to the rejection of the genetically modified
cells by syngeneic hosts. Altered tumor cells expressing IL4 also
increase systemic immunity. Mice vaccinated with transduced cells
reject a subsequent challenge of non-transduced cells, and, in some
cases, a pre-existing tumor.
[0186] Human IL6 is a protein of 185 amino acids glycosylated at
positions 73 and 172. It is synthesized as a precursor protein of
212 amino acids. Monocytes express at least five different
molecular forms of IL6 with molecular masses of 21.5-28 kDa. They
mainly differ by post-translational alterations such as
glycosylation and phosphorylation.
[0187] IL6 isolated from various cell types shows some
microheterogeneity in its N terminus. A 42-45 kDa form has been
observed in plasma that is probably complexed with a carrier
protein, alpha-2-macroglobulin (.alpha.2M). Murine and human IL6
show 65% sequence homology at the DNA level and 42% homology at the
protein level.
[0188] IL6 is a member of a family of cytokines which also includes
LIF, CNTF, Oncostatin M, IL11, and CT-1. All known members of the
IL6 cytokine family induce hepatic expression of acute phase
proteins.
[0189] A stable and highly bioactive designer cytokine consisting
of a fusion protein between IL6 and a soluble IL6 receptor,
designated H-IL6, has been used for human hematopoietic progenitor
cell expansion and is useful in cases in which cells do not respond
to IL6 but require a stable complex consisting of IL6 and a soluble
IL6 receptor.
[0190] The human IL6 gene has a length of approximately 5 kb and
contains five exons. It maps to human chromosome 7p21-p14 between
the markers D7S135 and D7S370. The murine gene maps to chromosome
5. The nucleotide sequences of IL6 and G-CSF genes resemble each
other in a way suggesting a possible evolutionary relationship.
[0191] The IL6 receptor (e.g. polypeptides encoded by Genbank
Accession No. M20566, E03515) is expressed on T-cells,
mitogen-activated B-cells, peripheral monocytes and some
macrophage- and B-cell-derived tumor cell types. It is not
expressed in resting B-cells but is in resting T-cells. In
hepatocytes the IL6 receptor expression is enhanced after treatment
with IL6 or IL1. In several cell types the expression of the IL6
receptor is also enhanced by glucocorticoids. The IL6 receptor gene
maps to human chromosome 1q21.
[0192] The IL6 receptor is a strongly glycosylated protein of 80
kDa and a length of 449 amino acids. It has been designated CD126.
It is synthesized as a precursor of 468 amino acids. The molecular
structure resembles that of receptors for M-CSF, PDGF and IL1 in
that the receptor contains an immunoglobulin-like sequence domain
in the aminoterminal region of the extracellular receptor
domain.
[0193] The intracellular domain of the IL6 receptor has a length of
approximately 82 amino acids and does not show any homology to
other proteins involved in intracellular signal transduction. Two
different forms of the receptor have been described that bind IL6
with different affinities (Kdis=10.sup.-9 and 10.sup.-11 M) and
most likely arise by post-translational modification of the same
receptor protein. Biological activities of IL6 have been found also
at concentrations of 10.sup.-13-10.sup.-15 M suggesting either the
existence of other high-affinity receptor conformations or the
existence of further receptor molecules with higher affinities.
[0194] IL6 receptor-mediated signal transduction involves protein
kinase C and also adenylate cyclase.
[0195] The complex formed between IL6 and its receptor associates
with a transmembrane glycoprotein, gp130 (918 amino acids;
cytoplasmic domain of 277 amino acids), that is involved in signal
transduction. Binding of IL6 to its receptor leads to
disulfide-linked homodimerization of gp130 and the associated
activation of a tyrosine kinase as the first step of signal
transduction. gp130 is expressed also in cells that do not express
IL6 receptors. It has been found to be a component of other
receptors, including those for IL11, LIF, Oncostatin M, and CNTF,
and CT-1. This explains why LIF, CNTF, and IL6 share many
biological activities although the factors themselves are not
related to each other. A factor resembling STAT proteins, termed
LIL factor, has been found to be involved in signaling pathways of
IL6, and also of IL1 and bacterial lipopolysaccharides.
[0196] A soluble form of the IL6 receptor (IL6R-SUP (IL6 receptor
soluble urinary protein)) has been described also that also
interacts with gp130. These soluble receptors probably function as
physiological regulators of cytokine activities by inhibiting
receptor binding or act as transport proteins. Similar soluble
receptors or binding proteins have been described also for IL1
(IL1ra, IL1 receptor antagonist), IL2, IL4, IL7, TNF-alpha, IGF,
and IFN-gamma.
[0197] Some cells, including hematopoietic progenitor cells and
neuronal cells, are only responsive towards a combination of IL6
and soluble IL6 receptor but not to IL6 alone.
[0198] Human IL6 is biologically active in monkeys, rats, and mice.
Murine IL6 is not active in human cells. The plethora of biological
activities is exemplified by the many different acronyms under
which IL6 has been described. IL6 is a pleiotropic cytokine
influencing antigen-specific immune responses and inflammatory
reactions. It is one of the major physiological mediators of cute
phase reaction. In hepatocytes IL6 in combination with
glucocorticoids induces the synthesis of metallothioneins and
increases intracellular zinc levels, thus preventing CCL4-induced
hepatotoxicity. IL6 is a neurotrophic factor for cholinergic
neurons that promotes their survival in culture. Some neuronal cell
lines can be induced to differentiate by IL6.
[0199] IL6, like IL1, stimulates the synthesis of ACTH
(Corticotropin)) in the pituitary. Glucocorticoids synthesized in
response to ACTH inhibit the production of IL6, IL1 and TNF in
vivo, thus establishing a sort of negative feedback loop between
the immune system and neuroendocrine functions. In astrocytes IL6
induces the synthesis of Nerve Growth Factor (NGF).
[0200] IL6 is a B-cell differentiation factor in vivo and in vitro
and an activation factor for T-cells. In the presence of IL2 IL6
induces the differentiation of mature and immature T-cells into
cytotoxic T-cells. IL6 also induces the proliferation of thymocytes
and probably plays a role in the development of thymic T-cells.
[0201] IL6 is capable of inducing the final maturation of B-cells
into immunoglobulin-secreting plasma cells if the cells have been
pre-activated by IL4. In B-cells IL6 stimulates the secretion of
antibodies to such a degree that serum IgG1 levels can rise
120-400-fold.
[0202] IL6 at concentrations of only 0.002 ng/mL is one of the
major autocrine growth modulator for many human myelomas. The
growth of these cells can be inhibited by monoclonal antibodies
directed against IL6. It can be inhibited also by the introduction
of antisense oligonucleotides against IL6 or by IL4. The
growth-inhibitory effects of corticosteroids on myeloma cells is
probably due to the steroid-induced reduction in the expression of
IL6. The growth of human IL6 dependent myeloma cells can be
inhibited also by IFN-gamma. IL6 may also function as an autocrine
growth modulator for other tumor types, some of which have been
found to secrete IL6 constitutively. IL6 has been shown to be an
autocrine modulator of growth for in vitro cervical tumor cell
growth. On the other hand IL6 blocks the growth of some solid
tumors such as mammary carcinomas, cervical carcinomas, human lung
cancer cell lines, histiocytic lymphomas, and melanomas.
[0203] IL6 and IL3 synergise in vitro in promoting the
proliferation of multipotent hematopoietic progenitor cells. IL6 is
also a thrombopoietin that induces the maturation of megakaryocytes
in vitro and increases platelet counts in vivo. In murine, but not
in human bone marrow cultures IL6 shows activities resembling those
of GM-CSF.
[0204] Plasmacytoma cells produce IL6 and also the IL6 receptor. It
has been suggested that these cells are stimulated in an autocrine
fashion. A paracrine mechanism involving the presence of two
different cell populations, one producing the factor and the other
expressing the receptor, has been described also.
[0205] IL6 can be detected in bioassays employing IL6 responsive
cell lines (e.g., 7TD1; B9; CESS, KPMM2, KT-3; M1, MH60-BSF-2,
MO7E; Mono Mac 6; NFS-60; PIL-6; SKW6-C14; T1165; XG-1). IL6 can be
assayed also by its activity as a hybridoma growth factor.
Sensitive immunoassays and colorimetric tests are also available.
An ELISA assay exists for detecting the receptor-associated gp130
protein.
[0206] In combination with other cytokines (for example, IL2) IL6
may be useful in the treatment of some tumor types. The
transduction of murine tumor cells with a functional IL6 gene has
been shown to lead to the rejection of the genetically modified
cells by syngeneic hosts. Altered tumor cells expressing IL6 also
increase systemic immunity. Mice vaccinated with transduced cells
reject a subsequent challenge of non-transduced cells, and, in some
cases, a pre-existing tumor.
[0207] Human IL10 is a homodimeric protein with subunits having a
length of 160 amino acids. Human IL10 shows 73% amino acid homology
with murine IL10. The human IL10 contains four exons. It is closely
related to the product of the BCRF-1 gene (Bam HI C fragment
rightward reading frame) of Epstein-Barr virus (84% homology at the
protein level). These two proteins are more closely related to each
other than human and murine IL10. BCRF-1 has therefore also been
called viral IL10 (vIL10). The human IL10 gene maps to chromosome
1. The human IL10 shows 81% homology with murine IL10 at the
nucleotide level.
[0208] A receptor has been identified on murine and human cells by
using radiolabeled IL10 (e.g. polypeptides encoded by Genbank
Accession No. L12120, U00672). Mouse IL10 is capable of blocking
binding of human IL10 to mouse but not human cells. The murine IL10
receptor has been cloned. This receptor is a protein of
approximately 110 kDa that binds murine IL10 specifically. This
receptor is structurally related to receptors for IFN.
[0209] IL10 inhibits the synthesis of a number of cytokines such as
IFN-gamma, IL2 and TNF-beta in Th1 subpopulations of T-cells but
not of Th2 cells. This activity is antagonized by IL4. The
inhibitory effect on IFN-gamma production is indirect and appears
to be the result of a suppression of IL12 synthesis by accessory
cells. In the human system, IL10 is produced by, and down-regulates
the function of, Th1 and Th2 cells. In macrophages stimulated by
bacterial lipopolysaccharides IL10 inhibits the synthesis of IL1,
IL6 and TNF-alpha by promoting, among other things, the degradation
of cytokine mRNA. It also leads to an inhibition of antigen
presentation. In human monocytes IFN-gamma and IL10 antagonize each
other's production and function. IL10 has been shown also to be a
physiologic antagonist of IL12.
[0210] IL10 also inhibits mitogen- or anti-CD3-induced
proliferation of T-cells in the presence of accessory cells and
reduces the production of IFN-gamma and IL2. Exogenous IL2 and IL4
inhibit the proliferation-inhibitory effect but do not influence
the production of IFN-gamma. In LPS-stimulated macrophages
IFN-gamma increases the synthesis of IL6 by inhibiting the
production of IL10. IL10 appears to be responsible for most or all
of the ability of Th2 supernatants to inhibit cytokine synthesis by
Th1 cells.
[0211] IL10 inhibits secretion of 1 g by T-cell-independent
antigens induced by IL5 but not that induced by IL2.
[0212] Murine Ly-1 B cells are the principal source of IL10. In
contrast to other B-cells, Ly-1 B-cells express greatly elevated
constitutive and inducible levels of IL10. These cells also have
the distinctive property of continuous self-replenishment. The
continuous treatment of newborn mice with anti-IL10 antibodies
leads to a depletion of the Ly-1 B-cells while maintaining a normal
population of splenic B-cells. These mice also contain greatly
reduced serum immunoglobulin M levels and are also impaired in
their antibody responses to specific antigens. IL10 is therefore a
regulator of Ly-1 B-cell development. The mechanism of Ly-1 B-cell
depletion appears to involve the increased production of IFN-gamma
since co-administration of neutralizing anti-IFN-gamma antibodies
substantially restores the number of peritoneal-resident Ly-1
B-cells in these mice.
[0213] IL10 is also a costimulator for the growth of mature and
immature thymocytes (together with IL2, IL4 and IL7) and functions
as a cytotoxic T-cell differentiation factor, promoting a higher
number of IL2-activated cytotoxic T-lymphocyte precursors to
proliferate and differentiate into cytotoxic effector cells. IL10
sustains viability of B-cells in vitro and also stimulates B-cells
and promotes their differentiation. It enhances the expression of
MHC class II antigens on B-cells whereas it inhibits MHC class II
expression on monocytes. In B-cells activated via their antigen
receptors or via CD40 IL10 induces the secretion of IgG, IgA and
IgM. This effect is synergised by IL4 while the synthesis of
immunoglobulins induced by IL10 is antagonized by TGF-beta. The
activation of macrophages can be prevented by IL10.
[0214] It has been shown that human IL10 is a potent and specific
chemoattractant for human T-lymphocytes. The chemotactic activity
is directed towards cells expressing CD8 and not towards CD4 (+)
cells. IL10 also inhibits the chemotactic response of CD4 (+)
cells, but not of CD8 (+) cells, towards IL8. IL10 can be detected
with a sensitive ELISA assay. The murine mast cell line D36 can be
used to bioassay human IL10. The intracellular factor can be
detected also by flow cytometry.
[0215] The introduction of an IL10 expression vector into CHO cells
has been used to analyze the consequences of local IL10 production
in vivo. These altered cells were no longer tumorigenic in nude
mice or severe combined immunodeficient SCID mice and also
suppressed the growth of equal numbers of co-injected normal CHO
cells. While normal CHO tumors are usually substantially
infiltrated by macrophages, these were virtually absent within
CHO-IL10 tumor tissues, suggesting that IL10 indirectly suppresses
tumor growth of certain tumors by inhibiting infiltration of
macrophages which may provide tumor growth promoting activity.
[0216] Human IL12 is a heterodimeric 70 kDa glycoprotein consisting
of a 40 kDa subunit (p40, 306 amino acids; 10% carbohydrate) and a
35 kDa subunit (p35, 197 amino acids; 20% carbohydrate) linked by
disulfide bonds that are essential for the biological activity of
IL12. p40 contains 10 cysteines and a binding site for heparin; p35
contains 7 cysteines.
[0217] The two subunits of IL12 are not related to any other known
proteins. p40 shows some homology with the extracellular domain of
the receptor for IL6, and p35 appears to be a homologue of IL6.
[0218] Bioactive murine and human IL12 fusion proteins combining
the two IL12 subunits in a single molecule have been described.
This designer cytokine retains antitumor activity in vivo. Flexi
12, a single chain protein retaining all of the biological
characteristics of the dimeric recombinant IL12, has also been
described.
[0219] The gene encoding the p40 subunit of IL12 (IL12B) maps to
human chromosome 5q31-q33 in the same region that also harbors
other cytokine genes. The gene encoding the p35 subunit of IL12
(IL12A) maps to human chromosome 3p12-q13.2. The expression of the
two genes is regulated independently of each other.
[0220] The IL12 receptor appears to be a single protein of
approximately 110 kDa (e.g. polypeptides encoded by Genbank
Accession No. U03187, U23922, U64198, U64199). Up to 1000-9000 high
affinity IL12 receptors/cell are expressed on peripheral blood
mononuclear cells activated by various T-cell mitogens or by IL2.
IL12 receptors are present on activated T-cells expressing CD4 and
CD8 and on activated CD56 positive natural killer cells. Resting
peripheral blood mononuclear cells, tonsillar B-cells, or tonsillar
B-cells activated by anti-IgM/Dx, anti-IgM/Dx+IL2, or SAC+IL2 do
not express the receptor. High affinity IL12 receptors are
expressed constitutively on a transformed marmoset NK-like cell
line, HVS.SILVA 40.
[0221] Binding of IL12 to its receptor can be prevented by
monoclonal antibodies directed against the p40 subunit which
therefore contains the binding site. The p40 subunit of IL12 shows
homology with the extracellular domain of the IL6 receptor. A
virus-encoded homologue of the p40 subunit is EBV-induced
gene-3.
[0222] Human IL12 is not active in murine lymphocytes. Hybrid
heterodimers consisting of murine p35 and human p40 subunits retain
bioactivity on murine cells; however, the combination of human p35
and murine p40 is completely inactive on murine cells. Murine IL12
is active on both murine and human lymphocytes. The p40 subunit of
murine IL12 subunit p40 (IL12p40) has been shown to specifically
antagonize the effects of the IL12 heterodimer in different assay
systems and to function as an endogenous specific inhibitor for the
IL12 heterodimer.
[0223] IL12 stimulates the proliferation of human lymphoblasts
activated by phytohemagglutinin. IL12 activates NK-cells positive
for CD56, and this activity is blocked by antibodies specific for
TNF-alpha. IL12 promotes specific allogenic CTL reactions. IL12
synergizes also with anti-CD3 antibodies and with allogeneic
stimulation in mixed lymphocyte cultures in inducing T-cell
proliferation.
[0224] In peripheral lymphocytes of the Th1 type IL12 induces the
synthesis of IFN-gamma and IL2, and TNF. TNF-alpha also appears to
be involved in mediating the effects of IL12 on natural killer
cells since the effects of IL12 are inhibited by an antibody
directed against TNF-alpha. IL12 and TNF-alpha are costimulators
for IFN-gamma production with IL12 maximizing the IFN-gamma
response; the production of IL12, TNF, and IFN-gamma is inhibited
by IL10. In Th2 helper cells IL12 reduces the synthesis of IL4,
IL5, and IL10.
[0225] IL12 synergises with suboptimal amounts of IL2 in promoting
the proliferation of mononuclear cells in the peripheral blood and
in promoting the generation of LAK cells (lymphokine activated
killer cells). Picomolar concentrations of IL12 are as effective as
nanomolar concentrations of IL2 in augmenting the cytolytic
activity of natural killer cells expanded in vivo by IL2. IL12 also
acts as a co-mitogen and potentiates the proliferation of resting
peripheral cells induced by IL2.
[0226] IL12 enhances myelopoiesis of primitive bone marrow
progenitor cells induced by SCF (stem cell factor) and synergizes
with colony stimulating factors to induce proliferation. IL12 also
has synergistic effects on more committed bone marrow progenitors,
synergising with IL3, IL11, or IL3 plus SCF.
[0227] IL12 is of potential clinical interest since it allows the
reduction of doses of IL2 required for the generation of LAK cells
(lymphokine-activated killer cells). IL12 has been shown to inhibit
the growth of a variety of experimental tumors in vivo and to have
antiangiogenic effects in vivo, which are, at least in part,
mediated by IFN-gamma. IL12 therefore seems to be a potential
candidate also for the treatment of angiogenesis-dependent
malignancies.
[0228] IL19 and IL10 share 21 percent amino acid identity and are
probably homologs. In monocytes treatment with bacterial
lipopolysaccharides induces the synthesis of IL19 and this effect
is potentiated in the presence of IL4 or IL13 but is unaffected by
IFN-gamma. GM-CSF directly induces IL19 gene expression in
monocytes. IL19 has been shown to bind to the IL20 receptor complex
(Dumoutier L et al Cutting edge: STAT activation by IL-19, IL-20
and mda-7 through IL-20 receptor complexes of two types. Journal of
Immunology 167(7): 3545-9 (2001); Gallagher G et al Cloning,
expression and initial characterization of interleukin-19 (IL-19),
a novel homologue of human interleukin-10 (IL-10). Genes Immun
1(7): 442-50 (2000)).
[0229] IL20 is structurally related to IL10. IL20 appears to be an
autocrine factor for keratinocytes that regulates their
participation in inflammation. Overexpression of IL20 in transgenic
mice causes neonatal lethality with skin abnormalities
characterized by an impairment of epidermal differentiation
(Blumberg H et al Interleukin 20: discovery, receptor
identification, and role in epidermal function. Cell 104(1): 9-19
(2001); Dumoutier L et al Cutting edge: STAT activation by IL-19,
IL-20 and mda-7 through IL-20 receptor complexes of two types.
Journal of Immunology 167(7): 3545-9 (2001); Rich B E and Kupper T
S Cytokines: IL-20--a new effector in skin inflammation. Current
Biology 11(13): R531-4 (2001)).
[0230] An IL20 receptor has been identified to consist of two
orphan class 2 cytokine receptor subunits. The receptor is
expressed in skin and its expression is upregulated dramatically in
psoriatic skin. Engagement of the receptor in a keratinocyte cell
line involves signaling by one member of the STAT proteins,
STAT3.
[0231] The IL20 receptor complex has been shown to bind also IL19
and IL24.
[0232] IL21 has been isolated by Parrish-Novak et al from a cDNA
library derived from activated CD3 (+) T-cells in a search for the
ligand of a type-1 cytokine receptor isolated previously. The cDNA
encodes a secreted protein of 131 amino acids protein most closely
related to IL2 and IL15. The IL21 gene maps to human chromosome
4q26-q27 near the IL2 gene. IL21 mRNA is expressed in CD4 (+) but
not in CD8 (+) T-cells after cell activation. It is not expressed
also in B-cells and monocytes (Asao H et al Cutting edge: the
common gamma-chain is an indispensable subunit of the IL-21
receptor complex. Journal of Immunology 167(1):1-5 (2001); Ozaki K
et al Cloning of a type I cytokine receptor most related to the
IL-2 receptor beta chain. Proceedings of the National Academy of
Science (USA) 97: 11439-11444 (2000); Parrish-Novak J et al
Interleukin 21 and its receptor are involved in NK cell expansion
and regulation of lymphocyte function. Nature 408: 57-63
(2000)).
[0233] IL21 stimulates proliferation of B-cell stimulated by
crosslinking of the CD40 antigen. It inhibits proliferation
stimulated by IL4 plus anti-IgM. IL21 augments stimulation of the
proliferation of naive (CD45RA (+)) but not memory (CD45RO (+))
T-cells mediated by engagement of CD3. IL21 stimulates the
proliferation of bone marrow progenitor cells and the expression of
the NK-cell marker CD56 in the presence of IL15.
[0234] The IL21 receptor has been isolated by Parrish-Novak et al
and found to be expressed by CD23 (+) B-cells, B-cell lines, a
T-cell leukemia line, and NK-cell lines. The receptor gene has been
mapped to human chromosome 16p12. The same receptor has been
isolated by Ozaki et al, who called it NILR (novel interleukin
receptor). The receptor (538 amino acids) is most closely related
to human IL2 beta receptor. The receptor contains a WSXWS motif in
the extracellular region, typical of type-1 cytokine receptors. The
receptor is expressed on NK-cells, T-cells, and B-cell lines.
[0235] The common gamma chain, which is an indispensable subunit of
the functional receptor complexes for IL2, IL4, IL7, IL9, and IL15
has been shown also to be part of the IL21 receptor complex. The
functional signalling complex activates Janus kinases JAK1, JAK3,
and the STAT proteins STAT1, and STAT3 (Asao et al).
[0236] IL22 (180 amino acids including a signal sequence; 25 kDa;
also called IL-TIF) was identified by a cDNA subtraction method as
a gene induced specifically by IL9 in mouse T lymphocytes. The
protein shows limited homology with IL10 (22 percent amino acid
identity). Human and murine IL-TIF proteins share 79 percent amino
acid identity.
[0237] The murine and human IL-TIF genes both consist of 6 exons.
The human single-copy gene maps to chromosome 12q15 (90 Kb from the
IFN-gamma gene, and 27 Kb from the AK155 gene encoding another
IL10-related cytokine. In mice the gene is located also in the same
region as the IFN-gamma gene. In BALB/c and DBA/2 mice the gene is
a single copy gene. In C57B1/6, FVB and 129 mice the gene is
duplicated. The two copies, termed IL-TIF-alpha and IL-TIF-beta
show 98 percent nucleotide identity in the coding region and differ
by a deletion of 658 nucleotide in IL-TIF-beta. This gene may be
inactive.
[0238] Expression of IL-TIF is induced by IL9 in thymic lymphomas,
T-cells, and mast cells, and by lectins in freshly isolated
splenocytes. IL-TIF expression in T-cells does not require protein
synthesis, and depends on the activation Janus kinases and STAT
proteins. IL-TIF is expressed constitutively in thymus and
brain.
[0239] In HepG2 human hepatoma cells IL-TIF up-regulates the
production of acute phase proteins. IL-TIF also acts as a
pro-inflammatory cytokine in vivo because injection of the protein
also induces the synthesis of acute phase proteins. Synthesis of
IL-TIF is induced rapidly after injection of bacterial
lipopolysaccharides. In contrast to IL10, IL22 does not inhibit the
production of pro-inflammatory cytokines by monocytes in response
to bacterial lipopolysaccharides. It also does not impair IL10
function on monocytes. IL-TIF has some inhibitory effects on IL4
production from Th2 T-helper cells.
[0240] IL10 and IL-TIF utilise a common receptor subunit.
Antibodies directed against the beta chain of the IL10 receptor
block the induction of acute phase proteins by IL-TIF. The
functional IL-TIF receptor complex consists of two receptor chains.
One chain has been identified as the orphan receptor CRF2-4 that is
expressed in normal liver and kidney. The other chain is the IL10
receptor-2, the second chain of the IL10 receptor complex. Monkey
COS expressing CRF2-9 alone respond to IL-TIF. In hamster cells
both chains must be expressed to yield functional IL-TIF receptors.
Although both receptor chains can bind IL-TIF independently binding
of IL-TIF to the receptor complex is greater. This sharing of
receptor subunits is similar to the shared use of the common gamma
chain by cytokines such as IL2, IL4, IL7, IL9, and IL15. Some cell
lines that do not respond to IL10 respond to IL-TIF by activation
of STAT-1, STAT-3, and STAT-5.
[0241] A soluble secreted receptor (231 amino acids), designated
IL22BP [IL22 binding protein] has been described (Kotenko et al).
The protein demonstrates 34 percent amino acid identity with the
extracellular domain of the IL22R1 chain and is known also as
CRF2-10. The gene maps to human chromosome 6q24, 35 kb from the
IFN-gamma R1 gene. It is expressed in various tissues with maximal
expression in breast, lungs, and colon. The protein binds IL-TIF
and inhibits its activity, blocking its interaction with the cell
surface IL22 receptor complex and thus acting as a natural cytokine
antagonist. IL22BP also blocks induction of the suppressors of
cytokine signaling-3 (SOCS-3) gene expression by IL22 in HepG2
cells (Dumoutier L et al Cloning and characterization of
IL-10-related T cell-derived inducible factor (IL-TIF), a novel
cytokine structurally related to IL-10 and inducible by IL-9.
Journal of Immunology 164(4): 1814-1819 (2000); Dumoutier L et al
Human interleukin-10-related T cell-derived inducible factor:
molecular cloning and functional characterization as an
hepatocyte-stimulating factor. Proceedings of the National Academy
of Science (USA) 97(18): 10144-9 (2000); Dumoutier L et al
IL-TIF/IL-22: genomic organization and mapping of the human and
mouse genes. Genes Immun 1(8): 488-494 (2000); Dumoutier L et al
Cloning and characterization of il-22 binding protein, a natural
antagonist of il-10-related t cell-derived inducible factor/il-22.
Journal of Immunology 166(12): 7090-5 (2001); Kotenko S V et al
Identification, cloning, and characterization of a novel soluble
receptor that binds IL-22 and neutralizes its activity. Journal of
Immunology 166(12): 7096-7103 (2001); Kotenko S V et al
Identification of the functional interleukin-22 (IL-22) receptor
complex: the IL-10R2 chain (IL-10Rbeta) is a common chain of both
the IL-10 and IL-22 (IL-10-related T cell-derived inducible factor,
IL-TIF) receptor complexes. Journal of Biological Chemistry 276(4):
2725-32 (2001); Xie M H et al Interleukin (IL)-22, a novel human
cytokine that signals through the interferon receptor-related
proteins CRF2-4 and IL-22R. Journal of Biological Chemistry
275(40): 31335-9 (2000)).
[0242] IL-23 is the name given to a factor that is composed of the
p40 subunit of IL12 (IL12B) and another protein of 19 kDa,
designated p19. p19 is structurally related to IL6, G-CSF, and the
p35 subunit of IL12. In databanks the p19 subunit is found also
under the acronym SGRF (IL6 G-CSF related factor).
[0243] p19 by itself is biologically inactive while the complex of
p19 with p40 is active. The active complex is secreted by dendritic
cells after cell activation.
[0244] Mouse memory T-cells (CD4 (+) CD45 Rb(low)) proliferate in
response to IL23 but not in response to IL12. Human IL23 has been
shown to stimulate the production of IFN-gamma by PHA blast T-cells
and memory T-cells. It also induces proliferation of both cell
types.
[0245] IL23 binds to the beta-1 subunit but not to the beta-2
subunit of the IL12 receptor, activating one of the STAT proteins,
STAT4, in PHA blast T-cells.
[0246] Expression of p19 in transgenic mice leads to runting,
systemic inflammation, infertility, and death before 3 months of
age. The animals show high serum concentrations of the
pro-inflammatory cytokines TNF-alpha and IL1. The number of
circulating neutrophils is increased. Acute phase proteins are
expressed constitutively. Animals expressing p19 specifically in
the liver do not show these abnormalities. Expression of p19 is
most likely due to hematopoietic cells as bone marrow
transplantation of cells expressing p19 causes the same phenotype
as that observed in the transgenic animals (Oppmann B et al Novel
p19 protein engages IL-12p40 to form a cytokine, IL-23, with
biological activities similar as well as distinct from IL-12.
Immunity 13(5): 715-25 (2000); Wiekowski M T et al Ubiquitous
Transgenic Expression of the IL-23 Subunit p19 Induces Multiorgan
Inflammation, Runting, Infertility, and Premature Death. Journal of
Immunology 166(12): 7563-70 (2001)).
[0247] IL24 is a name given to a protein that is known also as ST16
[suppression of tumorigenicity-16] and MDA-7 [melanoma
differentiation-associated gene 7]. The rat counterpart of IL24 has
been identified as mob-5 or C49a. The murine counterpart is
FISP.
[0248] MDA-7 protein (206 amino acids) was identified initially as
a melanoma differentiation-associated cDNA in a study using
cultured human melanoma cells that lose proliferative capacity and
terminally differentiate in response to human IFN-beta and
mezerein. The expression of MDA-7 is upregulated as a consequence
of terminal differentiation. HO-1 and C8161 human melanoma cells
engineered to express MDA-7 show reduces growth and do not form
colonies in a colony formation assay. MDA-7 selectively suppresses
the growth of human breast cancer cells by promoting cell death by
apoptosis. Ectopic expression of MDA-7 by means of a replication
defective adenovirus results in growth suppression and induction of
apoptosis in a broad spectrum of additional cancers, including
melanoma, glioblastoma multiforme, osteosarcoma and carcinomas of
the breast, cervix, colon, lung, nasopharynx and prostate. No
apparent harmful effects are observed after expression of MDA-7 in
normal epithelial or fibroblast cells.
[0249] In human hematopoietic cells MDA-7 expression is induced
during megakaryocyte differentiation in response to treatment with
TPA (12-O-tetradecanoyl-phorbol-13-acetate).
[0250] The human MDA-7 gene maps to chromosome 1q32 and is tightly
linked (within a region of 195 kb) to the genes encoding IL10,
IL19, and IL20.
[0251] The receptor for IL24 has been identified as the IL20
receptor complex. This receptor also binds to IL19 (Blumberg H et
al Interleukin 20: discovery, receptor identification, and role in
epidermal function. Cell 104(1): 9-19 (2001); Dumoutier L et al
Cutting edge: STAT activation by IL-19, IL-20 and mda-7 through
IL-20 receptor complexes of two types. Journal of Immunology
167(7): 3545-9 (2001); Huang E Y et al Genomic structure,
chromosomal localization and expression profile of a novel melanoma
differentiation associated (mda-7) gene with cancer specific growth
suppressing and apoptosis inducing properties. Oncogene 20(48):
7051-63 (2001); Jiang H et al Subtraction hybridization identifies
a novel melanoma differentiation associated gene, mda-7, modulated
during human melanoma differentiation, growth and progression.
Oncogene 11: 2477-2486 (1995); Jiang H et al The melanoma
differentiation associated gene mda-7 suppresses cancer cell
growth. Proceedings of the National Academy of Science (USA) 93:
9160-9165 (1996); Su Z et al The cancer growth suppressor gene
mda-7 selectively induces apoptosis in human breast cancer cells
and inhibits tumor growth in nude mice. Proceedings of the National
Academy of Science (USA) 95: 14400-14405 (1998)).
[0252] IL25 (also known as SF20) has been identified in a search
for factors that stimulate cell proliferation. The factor is
secreted by bone marrow stromal cells
[0253] The IL25 receptor has been identified as mouse thymic shared
antigen-1 (TSA-1). Enforced expression of the receptor in one of
the factor-dependent cell lines, BaF3, which does not express the
receptor, causes cell proliferation. FDCP2 cells, which express the
receptor, also proliferate in response to SF20/IL25. In both cases
proliferation is abolished by specific blocking antibodies directed
against the receptor.
[0254] SF20/IL-25 has no detectable myelopoietic activity but
supports proliferation of cells in the lymphoid lineage (Tulin E E
et al SF20/IL-25, a Novel Bone Marrow Stroma-Derived Growth Factor
That Binds to Mouse Thymic Shared Antigen-1 and Supports Lymphoid
Cell Proliferation. Journal of Immunology 167(11): 6338-47
(2001)).
[0255] The members of the TNF ligand superfamily (TNFalpha,
TNF-beta, LT beta, CD27 ligand, CD30 ligand, CD40 ligand, CD95
ligand, 4 1BB, OX40 ligand, TRAIL) share common biological
activities, but some properties are shared by only some ligands,
while others are unique. Human TNF-alpha is a non-glycosylated
protein of 17 kDa and a length of 157 amino acids. Murine TNF-alpha
is N-glycosylated. Homology with TNF-beta is approximately 30%.
TNF-alpha forms dimers and trimers. The 17 kDa form of the factor
is produced by processing of a precursor protein of 233 amino
acids. A TNF-alpha converting enzyme has been shown to mediate this
conversion. A transmembrane form of 26 kDa has been described
also.
[0256] TNF-alpha contains a single disulfide bond that can be
destroyed without altering the biological activity of the factor.
Mutations Ala84 to Val and Val91 to Ala reduce the cytotoxic
activity of the factor almost completely. These sites are involved
in receptor binding. The deletion of 7 N-terminal amino acids and
the replacement of Pro8Ser9Asp10 by ArgLysArg yields a mutated
factor with an approximately 10-fold enhanced antitumor activity
and increased receptor binding, as demonstrated by the L-M cell
assay, while at the same time reducing the toxicity.
[0257] The gene has a length of approximately 3.6 kb and contains
four exons. The primary transcript has a length of 2762 nucleotides
and encodes a precursor protein of 233 amino acids. The
aminoterminal 78 amino acids function as a presequence. The human
gene maps to chromosome 6p23-6q12. It is located between class I
HLA region for HLA-B and the gene encoding complement factor C. The
gene encoding TNF-beta is approximately 1.2 kb downstream of the
TNF-alpha gene. However, both genes are regulated independently.
The two genes also lie close to each other on murine chromosome
17.
[0258] Approximately 500-10000 high-affinity receptors
(Ka=2.5.times.10.sup.-9 M) for TNF-alpha are expressed on all
somatic cell types with the exception of erythrocytes. Two
receptors of 55 kDa (TNF-R1; new designation: CD120a) (e.g.
polypeptides encoded by Genbank Accession No. X55313) and 75 kDa
(TNF-R2; new designation: CD120b) (e.g. as described in Goodwin R G
et al (1991) Molecular Cellular Biology 11: 3020-6) have been
described. One receptor is a glycosylated protein of 455 amino
acids that contains an extracellular domain of 171 and a
cytoplasmic domain of 221 amino acids. Sequence homologies in the
cysteine-rich domains of the extracellular portion reveal that the
receptor is related to the low-affinity receptor of NGF and to
human cell surface antigen CD40.
[0259] Deletion analysis in the C-terminal intracellular region of
the 55 kDa receptor, TNF-R1 has revealed the existence of a
so-called death domain, which is involved in signaling processes
leading to programmed cell death. The death domain of TNF-R1
interacts with a variety of other signaling adaptor molecules,
including TRADD, and RIP.
[0260] The two known receptors bind both TNF-alpha and TNF-beta.
p55 is expressed particularly on cells susceptible to the cytotoxic
action of TNF. p75 is also present on many cell types, especially
those of myeloid origin (a virus-encoded homologue of the receptor
subunit is EBV-induced gene-6). It is strongly expressed on
stimulated T-cells and B-lymphocytes. The differential activities
of TNF on various cell types, i.e. growth-promoting and
growth-inhibiting activities, are probably mediated by the
differential expression and/or regulation of multiple receptors in
combination with other distinct receptor-associated proteins. p55
appears to play a critical role in host defenses against
microorganisms and their pathogenic factors.
[0261] A third receptor subtype is expressed in normal human liver.
It binds TNF-alpha but not TNF-beta. Some viruses contain genes
encoding secreted proteins with TNF binding properties that are
closely homologous to the p55 and p75 TNF receptors. Differential
effects of the two receptor subtypes have been found also in
TNF-mediated adhesion of leukocytes to the endothelium. It appears
that engagement of the p55 receptor specifically leads to the
induction of the cellular adhesion molecules ICAM-1, E-selectin,
V-CAM-1, and CD44, while engagement of both the p55 and the p75
receptor induces expression of alpha-2 integrin.
[0262] Truncated soluble forms of the receptor have been found
also. The soluble forms, in particular the soluble extracellular
domain of the p60 receptor, block the antiproliferative effects of
TNF and, therefore, may modulate the harmful effects of TNF.
[0263] Receptor densities are reduced by IL1 and tumor promoters
such as phorbol esters. The expression of TNF-alpha receptor
density is induced by IFN-alpha, IFN-beta, and IFN-gamma.
[0264] Signal transducers that associate with the cytoplasmic
domains of members of the TNF receptor superfamily comprise TRAF
(Tumor necrosis factor receptor-associated factors).
[0265] Human TNF-alpha is active on murine cells with a slightly
reduced specific activity. In general, TNF-alpha and TNF-beta
display similar spectra of biological activities in in-vitro
systems, although TNF-beta is often less potent or displays
apparent partial agonist activity.
[0266] TNF-alpha shows a wide spectrum of biological activities. It
causes cytolysis and cytostasis of many tumor cell lines in vitro.
Sensitive cells die within hours after exposure to picomolar
concentrations of the factor and this involves, at least in part,
mitochondria-derived second messenger molecules serving as common
mediators of TNF cytotoxic and gene-regulatory signaling pathways.
The factor induces hemorrhagic necrosis of transplanted tumors.
Within hours after injection TNF-alpha leads to the destruction of
small blood vessels within malignant tumors. The factor also
enhances phagocytosis and cytotoxicity in neutrophilic granulocytes
and also modulates the expression of many other proteins, including
fos, myc, IL1 and IL6.
[0267] The 26 kDa form of TNF is found predominantly on activated
monocytes and T-cells. It is also biologically active and mediates
cell destruction by direct cell-to-cell contacts.
[0268] The chemotactic properties of fMLP (Formyl-Met-Leu-Phe) for
neutrophils are enhanced by TNF-alpha. TNF-alpha induces the
synthesis of a number of chemoattractant cytokines, including
IP-10, JE, KC, in a cell-type and tissue-specific manner.
[0269] TNF-alpha is a growth factor for normal human diploid
fibroblasts. It promotes the synthesis of collagenase and
prostaglandin E2 in fibroblasts. It may also function as an
autocrine growth modulator for human chronic lymphocytic leukemia
cells in vivo and has been described to be an autocrine growth
modulator for neuroblastoma cells. The autocrine growth-promoting
activity is inhibited by IL4.
[0270] In resting macrophages TNF induces the synthesis of IL1 and
prostaglandin E2. It also stimulates phagocytosis and the synthesis
of superoxide dismutase in macrophages. TNF activates osteoclasts
and thus induces bone resorption.
[0271] In leukocyte and lymphocyte progenitors TNF stimulates the
expression of class I and II HLA and differentiation antigens, and
the production of IL1, colony stimulating factors, IFN-gamma, and
arachidonic acid metabolism. It also stimulates the biosynthesis of
collagenases in endothelial cells and synovial cells.
[0272] IL6 suppresses the synthesis of IL1 induced by bacterial
endotoxins and TNF, and the synthesis of TNF induced by
endotoxins.
[0273] The neurotransmitter SP (substance P) induces the synthesis
of TNF and IL1 in macrophages. IL1, like IL6, stimulates the
synthesis of ACTH (corticotropin)) in the pituitary.
Glucocorticoids synthesized in response to ACTH in turn inhibit the
synthesis of IL6, IL1 and TNF in vivo, thus establishing a negative
feedback loop between the immune system and neuroendocrine
functions.
[0274] TNF-alpha enhances the proliferation of T-cells induced by
various stimuli in the absence of IL2. Some subpopulations of
T-cells only respond to IL2 in the presence of TNF-alpha. In The
presence of IL2 TNF-alpha promotes the proliferation and
differentiation of B-cells.
[0275] The functional capacities of skin Langerhans cells are also
influenced by TNF-alpha. These cells are not capable of initiating
primary immune responses such as contact sensibilisation. They are
converted into immunostimulatory dendritic cells by GM-CSF and also
IL1. These cells therefore are a reservoir for immunologically
immature lymphoid dendritic cells. The enhanced ability of
maturated Langerhans cells to process antigens is significantly
reduced by TNF-alpha.
[0276] Although TNF-alpha is also required for normal immune
responses the overexpression has severe pathological consequences.
TNF-alpha is the major mediator of cachexia observed in tumor
patients (hence its name, cachectin). TNF is also responsible for
some of the severe effects during Gram-negative sepsis.
[0277] TNF-alpha can be detected in bioassays involving cell lines
that respond to it (e.g., BT-20, CT6, EL4; PK15; L929; L-M; MO7E;
T1165; WEHI-3B). TNF-alpha can be detected also by a sensitive
sandwich enzyme immunoassay, ELISA, an immunoradiometric assay
(IRMA), and by an assay designated RELAY (receptor-mediated
label-transfer assay). Intracellular factor is detected by two
color immunofluorescence flow cytometry. Higuchi et al have
described an assay based on the release of tritiated thymidine from
cells undergoing apoptosis after treatment with either TNF-alpha or
TNF-beta. IFN-alpha, IFN-beta, IFN-gamma, TGF-beta, IL4, LIF and
GM-CSF have been shown not to interfere with this assay.
[0278] In contrast to chemotherapeutic drugs TNF specifically
attacks malignant cells. Extensive preclinical studies have
documented a direct cytostatic and cytotoxic effect of TNF-alpha
against subcutaneous human xenografts and lymph node metastases in
nude mice, as well as a variety of immunomodulatory effects on
various immune effector cells, including neutrophils, macrophages,
and T-cells. Single- and multiple-dose phase I studies have
confirmed that TNF can be administered safely to patients with
advanced malignancies in a dose range associated with anticancer
effect without concomitant serious toxicities such as shock and
cachexia. However, clinical trials on the whole have unfortunately
so far failed to demonstrate significant improvements in cancer
treatment, with TNF-induced systemic toxicity being a major
limitation for the use of TNF as an antineoplastic agent in most
cases. The combined use of TNF and cytotoxic or immune modulatory
agents, particularly IFN-gamma and possibly IL2, may be of
advantage in the treatment of some tumors. In some cases
intratumoral application of TNF has been found to be of advantage
in tumor control.
[0279] Some mutant forms of TNF-beta with selective activity on the
p55 receptor have been described recently. It has been shown that
activation of the p55 receptor is sufficient to trigger cytotoxic
activity towards transformed cells. Some of these mutants have been
described to retain their antitumor activity in nude mice carrying
transplanted human tumors.
[0280] TNF can also be used to increase the aggressiveness of
lymphokine-activated killer cells. Studies with an experimental
fibrosarcoma metastasis model have shown that TNF induces
significant enhancement of the number of metastases in the lung. It
has been suggested that low doses of endogenous TNF or
administration of TNF during cytokine therapy may enhance the
metastatic potential of circulating tumor cells. The transduction
of murine tumor cells with a functional TNF-alpha gene has been
shown to lead to the rejection of the genetically modified cells by
syngeneic hosts.
[0281] The interferons are a family of cytokines that induce a
virus-nonspecific antiviral state in target cells. Binding of an
interferon to its receptor induces new protein synthesis which, in
turn, results in the inactivation of initiation factor eIF-2. The
inactivation is thought to contribute to the antiviral state
induced by the interferons. Interferons also induce pathways that
activate intracellular endonucleases which degrade viral mRNA. Many
interferons also possess immunomodulatory activities, such as
activation of macrophages and lymphocytes. Examples of interferons
include IFN-gamma (e.g. polypeptides encoded by Genbank Accession
No. K01900, J00209, M12350, J00213, J00216, J00214, M11003, M11026,
M34913, M54886, X01974, L38698, M13710, K01238, M13660, M68944,
X01972, X01971, X01973, X01969), IFN-gamma (e.g. polypeptides
encoded by Genbank Accession No. M28622, X14029, X14455, K00020,
J00218, E00171, X04430, A09363, M27327, M16656, M25460, K03196),
IFN-gamma e.g. polypeptides encoded by Genbank Accession No.
A34532, X87308, E00756, K00083), IFN-gamma e.g. polypeptides
encoded by Genbank Accession No. X58822, A12140), bovine
trophoblast protein-1 (IFN-gamma) e.g. polypeptides encoded by
Genbank Accession No. M31556, M31557, M31558), and their homologues
among species. Human IFN-gamma and IFN-gamma are thought to bind to
a common receptor (e.g. polypeptides encoded by Genbank Accession
No. X60459, M89641) which is distinct from the receptor for
IFN-gamma (e.g. polypeptides encoded by Genbank Accession No.
J03143, M28233).
[0282] At least 23 different variants of IFN-alpha are known. The
individual proteins have molecular masses between 19-26 kDa and
consist of proteins with lengths of 156-166 and 172 amino acids.
All IFN-alpha subtypes possess a common conserved sequence region
between amino acid positions 115-151 while the amino-terminal ends
are variable. Many IFN-alpha subtypes differ in their sequences at
only one or two positions. Naturally occurring variants also
include proteins truncated by 10 amino acids at the
carboxy-terminal end. Disulfide bonds are formed between cysteines
at positions 1/98 and 29/138. The disulfide bond 29/138 is
essential for biological activity while the 1/98 bond can be
reduces without affecting bioactivity.
[0283] Human IFN-beta is a glycoprotein (approximately 20% sugar
moiety) of 20 kDa and has a length of 166 amino acids.
Glycosylation is not required for biological activity in vitro. The
protein contains a disulfide bond Cys31/141) required for
biological activity. At the DNA level IFN-beta displays 34%
sequence homology with IFN-beta-2 and approximately 30% homology
with other IFN-alpha subtypes. In contrast to IFN-gamma IFN-beta is
stable at pH2.
[0284] Human IFN-gamma is a dimeric protein with subunits of 146
amino acids. The protein is glycosylated at two sites. The pI is
8.3-8.5. IFN-gamma is synthesized as a precursor protein of 166
amino acids including a secretory signal sequence of 23 amino
acids. Two molecular forms of the biologically active protein of 20
and 25 kDa have been described. Both of them are glycosylated at
position 25. The 25 kDa form is also glycosylated at position 97.
The observed differences of natural IFN-gamma with respect to
molecular mass and charge are due to variable glycosylation
patterns. 40-60 kDa forms observed under non-denaturing conditions
are dimers and tetramers of IFN-gamma.
[0285] Members of the CSF family of cytokines allow the growth and
differentiation of bone marrow cells immobilized on soft agar or
methylcellulose. While hematopoietic progenitor cells can be
maintained only for short periods of time in the absence of such
factors, their presence allows the development of colonies
containing erythroid cells, neutrophils, eosinophils, macrophages,
and/or megakaryocytes, depending on the particular factor. The
biochemical analysis of various activities stimulating colony
formation supporting the growth and development of these cell types
revealed that there existed many different and distinct factors of
this sort.
[0286] Many of these factors are either N- or O-glycosylated.
Glycosylation has been shown to enhance the solubility, stability
and resistance to proteolytic enzymes. It does not appear to be
required for the full spectrum of biological activities of these
factors. The genes encoding many of the human colony stimulating
factors have been cloned and mapped. Some of the genes are in close
vicinity but they do not show great homology among each other with
the exception of some conserved regions.
[0287] Colony stimulating factors are produced by many different
cell types, including, for example, B-lymphocytes, epithelial
cells, fibroblasts, endothelial cells, macrophages, Stromal cell
line, T-lymphocytes. They are synthesized as precursor molecules
containing a classical hydrophobic secretory signal sequence of
approximately 25-32 amino acids. The secreted factors have an
extremely high specific biological activity are active at very low
concentrations (1-100 pM). These factors are absolutely required
for the proliferation of hematopoietic progenitor cells. The
concentrations required for mere maintenance of viability are
usually orders of magnitude lower than those required to induce
cell proliferation or to elicit specific functional activities of
the cells.
[0288] The names of the individual factors usually indicate the
cell types that respond to these factors. The classical colony
stimulating factors include M-CSF (e.g. polypeptides encoded by
Genbank Accession No. E03235, M64592, U22386, X05010)
(macrophage-specific), G-CSF (granulocyte-specific), GM-CSF
(macrophage/granulocyte-specific), IL3 (multifunctional) and
MEG-CSF (e.g. polypeptides encoded by Genbank Accession No. D86370,
U70136) (megakaryocyte-specific). G-CSF and M-CSF are
lineage-specific while GM-CSF and IL3 are multifunctional
hematopoietic growth factors acting on earlier stages of
differentiation of hematopoietic progenitor cells.
[0289] Human GM-CSF is a monomeric protein of 127 amino acids with
two glycosylation sites. The protein is synthesized as a precursor
of 144 amino acids, which included a hydrophobic secretory signal
sequence at the aminoterminal end. The sugar moiety is not required
for the full spectrum of biological activities. Non-glycosylated
and glycosylated GM-CSF show the same activities in vitro. Fully
glycosylated GM-CSF is biologically more active in vivo than the
non-glycosylated protein. The different molecular weight forms of
GM-CSF (14 kDa, 35 kDa) described in the literature are the result
of varying degrees of glycosylation. GM-CSF contains four cysteine
residues (positions 54/96 and 88/121).
[0290] A comparison of the protein sequence of GM-CSF with those of
the other colony stimulating factors reveals that they are not
strongly homologous to each other. Human and murine GM-CSF display
60% homology at the protein level and 70% at the nucleotide level.
The two factors do not, however, cross-react immunologically.
GM-CSF can be associated with the extracellular matrix of cells as
a complex with heparan sulfate proteoglycans. This allows storage
of the factor in a biologically inactive form. The exact mechanism
by which the factor is eventually released from these depots is not
known.
[0291] The human gene has a length of approximately 2. 5 kb and
contains four exons. The distance between the GM-CSF gene and the
IL3 gene is approximately 9 kb. The human GM-CSF gene maps to
chromosome 5q22-31 in the vicinity of other genes encoding
hematopoietic growth factors (M-CSF, IL3, IL4, IL5) and the gene
encoding the M-CSF receptor. The 5' region of the GM-CSF gene
contains several sequence elements known as CLE (conserved
lymphokine element). They function as binding sites for
transcription factors, modulating the expression of the GM-CSF
gene.
[0292] GM-CSF receptors are expressed at densities of several 100
to several 1000 copies/cell on the cell surface of myeloid cells.
The receptor is expressed also on non-hematopoietic cells such as
endothelial cells and small cell lung carcinoma cells. In
receptor-positive cell lineages the receptor density decreases with
increasing degrees of maturation.
[0293] The receptor shows significant homologies with other
receptors for hematopoietic growth factors, including IL2-beta,
IL3, IL6, IL7, Epo and the prolactin receptors. One cloned subunit
of the GM-CSF receptor (GM-R alpha, 45 kDa) binds GM-CSF with low
affinity (e.g. polypeptides encoded by Genbank Accession No.
SEG_HUMGRAS). The second subunit (GM-R beta, 120 kDa) does not bind
GM-CSF. GM-R alpha is a protein of 400 amino acids that contains
only a short cytoplasmic domain of 54 amino acids. The high
affinity GM-CSF receptor is formed by the aggregation of the two
receptor subunits. The GM-R beta subunit of the receptor (e.g.
polypeptides encoded by Genbank Accession No. SEG_MUSAIC2B, M59941)
is also a constituent of other cytokine receptor systems. It is a
component of the high affinity receptors for IL3 and IL5, both of
which also contain a cytokine-specific subunit (AIC2A).
[0294] Human GM-CSF is not active on murine cells and vice versa.
GM-CSF was isolated initially as a factor stimulating the growth of
macrophage/granulocyte-containing colonies in soft agar cultures
(colony formation assay). GM-CSF is indispensable for the growth
and development of granulocyte and macrophage progenitor cells. It
stimulates myeloblasts and monoblasts and triggers irreversible
differentiation of these cells. GM-CSF synergises with Epo in the
proliferation of erythroid and megakaryocytic progenitor cells. In
combination with another colony stimulating factor, M-CSF, one
observes the phenomenon of synergistic suppression, i.e., the
combination of these two factors leads to a partial suppression of
the generation of macrophage-containing cell colonies.
[0295] For some types of blast cells from patients with acute
myeloid leukemia GM-CSF acts as an autocrine mediator of growth.
GM-CSF is a strong chemoattractant for neutrophils. It enhances
microbicidal activity, oxidative metabolism, and phagocytotic
activity of neutrophils and macrophages. It also improves the
cytotoxicity of these cells. GM-CSF displays a less pronounced
specificity than, for example, G-CSF. It stimulates the
proliferation and differentiation of neutrophilic, eosinophilic,
and monocytic lineages. It also functionally activates the
corresponding mature forms, enhancing, for example, the expression
of certain cell surface adhesion proteins (CD-11A, CD-11C). The
overexpression of these proteins could be one explanation for the
observed local accumulation of granulocytes at sites of
inflammation. In addition, GM-CSF also enhances expression of
receptors for fMLP (Formyl-Met-Leu-Phe) which is a stimulator of
neutrophil activity.
[0296] At pico to nanomolar concentrations GM-CSF is chemotactic
for eosinophils and also influences the chemotactic behavior of
these cells in response to other chemotactic factors.
[0297] In granulocytes GM-CSF stimulates the release of arachidonic
acid metabolites and the increased generation of reactive oxygen
species. The activation of the Na+/H+ antiport system leads to a
rapid alkalization of the cytosol. Phagocytotic activities of
neutrophil granulocytes and the cytotoxicity of eosinophils is also
enhanced considerably by GM-CSF. Since GM-CSF is produced by cells
(T-lymphocytes, tissue macrophages, endothelial cells, mast cells)
present at sites of inflammatory responses it can be assumed that
it is an important mediator for inflammatory reactions.
[0298] The functional state of Langerhans cells of the skin is also
influenced by GM-CSF. These cells are not capable of initiating
primary immune responses, for example, contact sensibilization.
They are converted to highly potent immunostimulatory dendritic
cells by GM-CSF (and also IL1). Langerhans cells therefore form an
in situ reservoir for immunologically immature lymphoid dendritic
cells. The maturation of these cells which is seen as an increased
ability to process antigens, can be down-regulated by
TNF-alpha.
[0299] At nanomolar concentrations GM-CSF induces the expression of
complement C3a receptors on basophils. Cells which normally do not
respond to C3a and which have been activated by GM-CSF degranulate
in response to the C3a stimulus. This is accompanied by the release
of histamine and leukotriene C4. This process may be of
significance in hypersensitivity reactions associated with
inflammatory responses (T-lymphocytes, tissue macrophages,
endothelial cells, mast cells). GM-CSF has been shown also to be a
potent inducer of trophoblast interferon (TP-1).
[0300] GM-CSF synergises with some other cytokines, including IL1,
IL3 and G-CSF. GM-CSF and G-CSF must act in concert to allow the
development of neutrophil-containing colonies in vitro.
[0301] IL3 by itself only negligibly expands the number of
circulating blood cells; a subsequent dose of GM-CSF, however,
significantly increases cell numbers, probably because IL3 first
leads to an expansion of those cells capable of responding to
GM-CSF.
[0302] The observations that most IL3-dependent cell lines can also
grow in the presence of GM-CSF and IL4 and that several synergistic
effects are observed between GM-CSF and IL4 suggest that these
three factors perform similar functions in controlling the growth
of cells. There are some indications that the mechanism of signal
transduction contains at least some common factors.
[0303] Experiments with tyrosine-specific protein kinases encoded
by an oncogene have shown that the expression of this kinase
activity in factor-dependent cells abolishes their dependence on
GM-CSF, IL3 and IL4. The exact mechanism by which these factors
regulate the proliferation and differentiation of cells is still
unknown.
[0304] The consequences of a deregulated expression of GM-CSF have
been studied in transgenic mice harboring a constitutively
expressed GM-CSF gene. The overexpression of the transgene encoding
GM-CSF leads to pathological alterations in the retina and causes
blindness and also causes muscle deterioration. These mice are
characterized by a very pronounced increase in activated
macrophages. In addition, the overexpression of GM-CSF leads to the
activation of mature macrophages secreting large amounts of IL1 and
TNF, suggesting that these cytokines may be responsible for some
aspects of the transgenic mouse disease.
[0305] Histopathological examination demonstrates a pronounced
increase in the progenitor cell population of the monocytic
lineage. GM-CSF-transgenic animals usually die within months from
the massive tissue damage resulting from the overexpression of
these factors. Similar results have been obtained with mice
possessing a bone marrow manipulated to overexpress GM-CSF by
transformation with suitable retrovirus vectors. These findings do
not seem to be of clinical significance, though. The long-term
treatment of primates and mice with GM-CSF has shown that
life-threatening complications do not occur.
[0306] The biological consequences of GM-CSF gene disruption have
been studied in mice generated from ES cells carrying a targeted
deletion of the gene. Mice homozygous for a targeted disruption of
the GM-CSF gene are characterized by an unimpaired steady-state
hematopoiesis, demonstrating that GM-CSF is not essential for
maintaining normal levels of the major types of mature
hematopoietic cells and their precursors in blood, marrow, and
spleen.
[0307] Most GM-CSF-deficient mice are superficially healthy and
fertile but develop abnormal lungs. GM-CSF-deficient mice develop a
progressive accumulation of surfactant lipids and proteins in the
alveolar space, the defining characteristics of the idiopathic
human disorder pulmonary alveolar proteinosis. Extensive lymphoid
hyperplasia associated with lung airways and blood vessels is found
also. These results demonstrate an unexpected, critical role for
GM-CSF in pulmonary homeostasis.
[0308] Transgenic mice homozygous for null mutations of the gene
encoding the common beta subunit (beta C) of the GM-CSF, IL3, and
IL5 receptor complexes exhibit normal development and survive to
young adult life. They develop pulmonary peribronchovascular
lymphoid infiltrates and areas resembling alveolar proteinosis.
Eosinophil numbers in peripheral blood and bone marrow of
homozygous deletion mutants are reduced, while other hematological
parameters are normal. Bone marrow cells from homozygous deletion
mutants do not show high-affinity binding of GM-CSF, while cells
from heterozygous animals show an intermediate number of
high-affinity receptors. In clonal cultures of bone marrow cells
derived from homozygous deletion mutants, even high concentrations
of GM-CSF and IL5 do not stimulate colony formation in the colony
formation assay. Differences in the systemic clearance and
distribution of GM-CSF between mutant and wild-type littermates are
not observed.
[0309] Nishinakamura et al have crossed beta-c mutant mice with
mice deficient for IL3. The double-mutant mice lacking all IL3,
GM-CSF, and IL5 functions are apparently normally fertile. The
animals show the same reduced numbers of eosinophils and a lack of
eosinophilic response to parasites as beta-c mutant mice. The
immune response of the double mutant mice to Listeria monocytogenes
is normal. Hematopoietic recovery after treatment with fluorouracil
is also normal. These findings suggest the existence of alternative
mechanism to produce blood cells that do not depend on the presence
of IL3, GM-CSF, and IL5.
[0310] GM-CSF can be assayed in a colony formation assay by the
development of colonies containing macrophages, neutrophils,
eosinophils, and megakaryocytes. GM-CSF is also detected in
specific bioassays with cells lines that depend in their growth on
the presence of GM-CSF or that respond to this factor (e.g.,
AML-193; B6SUt-A; BAC1.2F5; BCL1; Da; FDCP1; GF-D8; GM/SO; IC-2;
MO7E; NFS-60; PT-18; TALL-103; TF-1; UT-7).
[0311] GM-CSF can be employed for the physiological reconstitution
of hematopoiesis in all diseases characterized either by an
aberrant maturation of blood cells or by a reduced production of
leukocytes. The main and most important clinical application of
GM-CSF is probably the treatment of life-threatening neutropenia
following chemo and/or radiotherapy, which is markedly reduced
under GM-CSF treatment. GM-CSF can be used also to correct
chemotherapy-induced cytopenias and to counteract cytopenia-related
predisposition to infections and hemorrhages.
[0312] In order to avoid potential complications following the
administration of GM-CSF careful clinical monitoring is required in
certain patient groups, for example those with myelodysplastic
syndrome, acute myeloid leukemia, inflammatory disease, autoimmune
thrombocytopenia or malfunctional immunological responsiveness.
[0313] Several studies have demonstrated that the use of GM-CSF
enhances tolerance to cytotoxic drug treatment and can be used to
prevent dose reductions necessitated by the side effects of
cytotoxic drug treatment. GM-CSF treatment frequently permits to
increase the doses of cytotoxic drugs per course. These studies
have also revealed a significantly reduced morbidity under GM-CSF
treatment.
[0314] The transduction of murine tumor cells with a functional
GM-CSF gene has been shown to lead to the rejection of the
genetically modified cells by syngeneic hosts. Moreover,
vaccination with GM-CSF transduced tumor cells prevents growth of a
subsequent inoculum of wild-type syngeneic tumor cells.
[0315] The chemokine family of cytokines consists of relatively
small, structurally similar polypeptides that induce chemotaxis in
leukocytes. Chemokines have molecular masses of 8-10 kDa and show
approximately 20-50% sequence homology among each other at the
protein level. The proteins also share common gene structures and
tertiary structures. All chemokines possess a number of conserved
cysteine residues involved in intramolecular disulfide bond
formation.
[0316] According to the chromosomal locations of individual genes
two different subfamilies of chemokines are distinguished. Members
of the alpha-chemokines are referred to also as the 4q chemokine
family because the genes encoding members of this family map to
human chromosome 4q12-21. The first two cysteine residues of
members of this family are separated by a single amino acids and
these proteins, therefore, are called also C--X--C chemokines. This
subfamily includes 9E3 (e.g. Genbank protein P08317), AMCF (e.g.
polypeptides encoded by Genbank Accession No. M99367, M99368),
beta-thromboglobulin (e.g. as disclosed in Begg G S et al (1978),
Biochemistry 17: 1739-44), CINC family members (e.g. polypeptides
encoded by Genbank Accession No. D21095), ENA-78 (e.g. polypeptides
encoded by Genbank Accession No. X78686), eotaxin (e.g.
polypeptides encoded by Genbank Accession No. U46572, U40672),
GCP-2 (e.g. polypeptides encoded by Genbank Accession No. Y08770,
U83303), IL8, IP-10 (e.g. polypeptides encoded by Genbank Accession
No. L07417, X02530), KC (e.g. polypeptides encoded by Genbank
Accession No. J04596), LIX (e.g. polypeptides encoded by Genbank
Accession No. U27267), mig (e.g. polypeptides encoded by Genbank
Accession No. M34815, Z24725), MGSA (e.g. polypeptides encoded by
Genbank Accession No. X12510), mob-1 (e.g. polypeptides encoded by
Genbank Accession No. U17035), NAP-2 (as described in Clark-Lewis I
et al (1991) Biochemistry 30: 3128-35, Cohen A B et al (1992)
American Journal of Physiology 263: L249-56), NAP-3 (as described
in: Schroder J M et al (1991) Journal of Experimental Medicine 171:
1091-100), NAP-4 (as described in Schroder J M et al (1990)
Biochemical and Biophysical Research Communications 172: 898-904),
PBSF (SDF) (e.g. polypeptides encoded by Genbank Accession No.
D21072, U16752, D50645), and PF4 (e.g. polypeptides encoded by
Genbank Accession No. M25897).
[0317] IL8, MGSA, mouse KC, MIP-2 (e.g. polypeptides encoded by
Genbank Accession No. X65647 and as described in Blum S et al Three
human homologues of a murine gene encoding an inhibitor of stem
cell proliferation. DNA Cell Biol. 9: 589-602 (1990); Clements J M
et al Biological and structural properties of MIP-1 alpha expressed
in yeast. Cytokine 4: 76-82 (1992); Devatelis G et al Cloning and
characterization of a cDNA for murine macrophage inflammatory
protein (MIP), a novel monokine with inflammatory and chemokinetic
properties. Journal of Experimental Medicine 167: 1939-44 (1988)
(erratum in JEM 170: 2189 (1989)); Farber J M A macrophage mRNA
selectively induced by gamma-interferon encodes a member of the
platelet factor 4 family of cytokines. Proceedings of the National
Academy of Science (USA) 87: 5238-42 (1990); Haskill S et al
Identification of three related human GRO genes encoding cytokine
functions. Proceedings of the National Academy of Science (USA) 87:
7732-6 (1990); Poltorak A N et al (1995) Journal of Inflammation
45(3): 207-19; Rossi D L et al (1997) Journal of Immunology 158(3):
1033-1036; Sherry B et al (1988) Journal of Experimental Medicine
168: 2251-9; Tekamp-Olson P et al (1990) Journal of Experimental
Medicine 172: 911-9; Wolpe S D et al (1989) Proceedings of the
National Academy of Science (USA) 86: 612-16; Wolpe S D et al
(1989) FASEB Journal 3: 2565-73), NAP-2, ENA-78, and GCP-2 comprise
a subgroup of the human C--X--C-chemokines defined by the conserved
ELR sequence motif (glutamic acid-leucine-arginine) immediately
preceding the first cysteine residue near the amino-terminal end.
Chemokines with an ELR sequence motif have been found to
chemoattract and activate primarily neutrophils. Chemokines without
the ELR sequence motif appear to chemoattract and activate
monocytes, dendritic cells, T-cells, NK-cells, B-lymphocytes,
basophils, and eosinophils.
[0318] Members of the beta-chemokines or 17q chemokine family map
to human chromosome 17q11-32 (murine chromosome11). The first two
cysteine residues are adjacent and, therefore, these proteins are
called also C--C chemokines. This subfamily includes ACT-2 (e.g.
polypeptides encoded by Genbank Accession No. J04130), C10 (e.g. as
described in Berger M S et al (1993) DNA Cell Biol. 12: 839-47;
Berger M S et al (1996) 8: 439-447), CCF18 (e.g. as described in
Hara T et al (1995) Journal of Immunology 155: 5352-8), DC-CK1
(e.g. as described in Adema G J et al (1997) Nature 387: 713-717),
ELC (e.g. polypeptides encoded by Genbank Accession No. AB000887,
AF059208), Eotaxin-2 (e.g. as described in Forssmann U et al (1997)
Journal of Experimental Medicine 185: 2171-2176), Exodus (e.g.
polypeptides encoded by Genbank Accession No. U64197, U88320,
U88321, U88322), FIC (e.g. polypeptides encoded by Genbank
Accession No. L04694), GDCF and GDCF-2 (e.g. as described in
Kuratsu J et al (1989) Journal of the National Cancer Institute 81:
347-51; Yoshimura T et al (1989) Journal of Experimental Medicine
169: 1449-59; Yoshimura T et al (1989) Journal of Immunology 142:
1956-62), HC-21 (e.g. as described in Chang H C & Reinherz E L
(1989) European Journal of Immunology 19:1045-1051), HCC-1 (e.g.
polypeptides encoded by Genbank Accession No. Z49270), I-309 (e.g.
polypeptides encoded by Genbank Accession No. M57502), JE (e.g.
polypeptides encoded by Genbank Accession No. AF058786, M28226),
LAG-1 (lymphocyte activation gene-1) (e.g. polypeptides encoded by
Genbank Accession No. X53683), LARC D86955), LD78 E03130, E03131,
MARC (e.g. as described in Thirion S et al (1994) Biochemical and
Biophysical Research Communications 201: 493-499), MCAF M24545 and
as described in Apella E et al (1990) Progress in Clinical and
Biological Research 349: 405-17), MCP-1 (e.g. polypeptides encoded
by Genbank Accession No. X14768), MCP-2 (e.g. polypeptides encoded
by Genbank Accession No. Y16645), MCP-3 (e.g. polypeptides encoded
by Genbank Accession No. X72308, S71251), MCP-4 (e.g. polypeptides
encoded by Genbank Accession No. X98306), MCP-5 (e.g. polypeptides
encoded by Genbank Accession No. U50712), MIP (macrophage
inflammatory protein) (e.g. polypeptides encoded by Genbank
Accession No. U77180, U77035, U49513, M35590), MRP-2 (e.g. as
described in Youn B S et al (1995) Journal of Immunology 155:
2661-7), RANTES SDF (e.g. polypeptides encoded by Genbank Accession
No. M21121, M77747), TARC (e.g. Genbank protein Accession No.
Q92583).
[0319] In addition there are several other factors that are related
to chemokines but that either have not been assigned yet to one of
the two chemokine groups or that do not possess the classical
features of either of the two chemokine groups (for example, ATAC
(e.g. polypeptides encoded by Genbank Accession No. X86474), Ltn
(e.g. polypeptides encoded by Genbank Accession No. U15607,
U23772), SCM-1 (e.g. polypeptides encoded by Genbank Accession No.
D63789, D63790, D43769). These have been referred to as C-type
chemokines or gamma-chemokines.
[0320] Yet another group of chemokines has been identified that
comprises neurotactin (e.g. polypeptides encoded by Genbank
Accession No. AF010586, which is characterized by a CX(3) C
cysteine signature motif. The existence of clearly defined
subgroups of chemokines on the basis of structural and functional
properties illustrates the importance of chemoattractant diversity
in the regulation of leukocyte movement through the body.
[0321] The biological activities of chemokines are mediated by
specific receptors and also by receptors with overlapping ligand
specificities that bind several of these proteins which always
belong either to the C--C-chemokines or the group of
C--X--C-chemokines. Chemokine receptors belong to the large group
of G-protein-coupled seven transmembrane domain receptors which
contain seven hydrophobic alpha-helical segments that transverse
the membrane. These receptors form a structurally related group
within the superfamily of G-protein-coupled receptors which mediate
signalling via heterotrimeric G-proteins.
[0322] The receptors that bind C--X--C chemokines are designated
CXCR followed by a number (e.g., CXCR-1 (e.g. polypeptides encoded
by Genbank Accession No. L19591), CXCR-2 (e.g. polypeptides encoded
by Genbank Accession No. M94582), CXCR-3 (e.g. polypeptides encoded
by Genbank Accession No. X95876), CXCR-4 (e.g. polypeptides encoded
by Genbank Accession No. D87747, AF025375) while those binding C--C
chemokines are designated CCR followed by a number (e.g., CCR-1
(e.g. polypeptides encoded by Genbank Accession No.L09230, U29678),
CCR-2 (e.g. polypeptides encoded by Genbank Accession No. U29677,
U95626), CCR-3 (e.g. polypeptides encoded by Genbank Accession No.
U51241), CCR-4 (e.g. polypeptides encoded by Genbank Accession No.
X90862, X85740), CCR-5 (e.g. polypeptides encoded by Genbank
Accession No. U54994, U83327), CCR-6 (e.g. polypeptides encoded by
Genbank Accession No. U95626), CCR-7 (e.g. polypeptides encoded by
Genbank Accession No. L31581), CCR-8 (e.g. polypeptides encoded by
Genbank Accession No. Z98206, U45983). Viral chemokine receptor
homologues include ECRF-3, EBI-1 (EBV-induced gene-1), and
US28.
[0323] It is now assumed that the combinatorial effects of multiple
chemokines and other mediators are responsible for the cellular
composition at inflammatory sites. In addition, many chemokines
also directly activate cells. Some of them activate granulocytes
and/or monocytes and cause respiratory bursts, degranulation, and
the release of lysosomal enzymes. Others prime immune cells to
respond to sub-optimal amounts of other inflammatory mediators. Yet
others have been shown to be potent histamine releasing factors for
basophils. It has been proposed that erythrocytes through their
promiscuous chemokine receptor play an important role in regulating
the chemokine network. Chemokines bound to the erythrocyte receptor
are known to be inaccessible to their normal target cells. This
appears to provide a sink for superfluous chemokines and may serve
to limit the systemic effects of these mediators without disrupting
localized processes taking place at the site of inflammation.
[0324] Certain C--C chemokines exhibit biological activities other
than mere chemotaxis. Some chemokines have been shown to be capable
of inducing the proliferation and activation of killer cells known
as CHAK (C--C-chemokine-activated killer), which are similar to
cells activated by IL2.
[0325] Another particularly useful cytokine according to the
invention is flt-3 ligand (e.g., polypeptides encoded by Genbank
Accession Nos. U04806, U04807, U03858, L23636, U29874, U29875,
U44024). This cytokine binds to the flt-3 tyrosine kinase (e.g.,
polypeptides encoded by Genbank Accession Nos. Z26652, X59398). The
human flt-3 ligand also stimulates the proliferation of cells
expressing murine flt-3 receptors.
[0326] The effects of flt-3 ligand are synergized by coexpression
of G-CSF, GM-CSF, M-CSF, IL3, PIXY-321, and SCF. In combination
with SCF and IL3 flt-3 ligand can cause expansion of cells with the
marker spectrum CD34 (+) CD38 (-).Alone flt-3 ligand supports the
survival of precursor cell types in the lineage of blood-forming
cells such as CFU-GM, CFU-GEMM, and the very primitive high
proliferative potential colony-forming cells. flt-3 ligand only has
marginal effects on erythroid and megakaryocyte progenitor
cells.
[0327] In the mouse, flt-3 ligand potently enhances growth of
various types of progenitor/precursor cells in synergy with G-CSF,
GM-CSF, M-CSF, IL3, IL6, IL7, IL11, IL12 and SCF. flt-3 ligand
supports growth of LTC-IC (long-term culture-initiating cells). The
ability of flt-3 ligand to promote the survival of hematopoietic
progenitor cells is abrogated by TGF-beta and counteracted by
TNF-alpha.
[0328] A study of the expression of functional flt-3 receptor and
the responses to the ligand in AML (acute myeloid leukemia) and ALL
(acute lymphoblastic leukemia) shows a considerable heterogeneity.
BCP-ALL in particular fails to proliferate in the presence of flt-3
ligand despite strong expression of surface flt-3 receptor.
[0329] It has been shown that in patients with aplastic anemia and
in cancer patients with chemotherapy-induced transient suppression
of hematopoiesis, serum levels of flt-3 ligand fluctuate in an
inverse relationship to the degree of bone marrow failure. flt-3
ligand levels in serum inversely correlate with the colony forming
ability in vitro of bone marrow precursors from patients with
aplastic anemia. flt-3 ligand treatment of mice challenged with
syngeneic fibrosarcoma cells has been shown to result in complete
tumor regression and in decreased tumor growth rates.
[0330] Antitumor cytokines are especially useful in the methods and
compositions of the invention. According to the invention, an
"antitumor cytokine" is a cytokine that can limit the growth or
metastasis of tumor cells in vitro or in vivo, or can prolong the
survival of a tumor-bearing animal, when either admixed with the
cells or administered to the animal. The cytokine can be formulated
as a solution in a biologically compatible buffer, e.g. PBS, and
admixed with tumor cells in vitro. The concentration of cytokine
may be from about the picomolar range to about the micromolar
range. An antitumor cytokine will, for example, reduce the growth
rate of the cells, e.g. by at least 10% compared to buffer alone,
or inhibit metastatic properties of the cells, as may be evidenced
by, e.g., increased cell adhesiveness or decreased ability to
invade an extracellular matrix substrate, such as an artificial
basement membrane. Alternatively, an antitumor cytokine may inhibit
the growth or metastasis of a tumor in vivo, or may prolong the
survival of a tumor-bearing animal. To evaluate the in vivo
antitumor effects of a cytokine, the cytokine may be formulated in
a pharmaceutically acceptable carrier and administered, e.g., by
intravenous, intratumoral, or intraperitoneal injection. The
cytokine may also be administered in association with cells, such
as tumor cells that express or are coated with the cytokine.
[0331] Assays for Bioactivity
[0332] According to the invention, it is preferred that a cytokine
be "bioactive", "highly bioactive", "extremely bioactive",
"natively bioactive", or "suprabioactive". Different levels of
bioactivity relate to the ability to induce a change in a leukocyte
(other than mere occupancy of the leukocyte's receptors for the
cytokine). According to the invention, all naturally occurring
cytokines are natively bioactive. Many types of assay can
demonstrate the bioactivity of a non-naturally occurring cytokine.
For example, a cytokine may be shown to induce survival and/or
proliferation of a particular cell type. As another example, a
cytokine may change the concentration of an intracellular second
messenger, such as cAMP, arachidonic acid, calcium ions, or
inositol triphosphate. The following are examples of assays for
bioactivity:
[0333] Assay 1
[0334] Each well of one or more 60-well Lux microtiter trays is
loaded with 200 FDC-P1 cells in 10 ul Dulbecco's modified Eagle's
medium with a final concentration of 10% newborn calf serum.
Cytokine in a concentration in at most the micromolar range is
added to each well in a volume of 5 ul. The tray is incubated for
48 h at 37.degree. C. in 10% CO.sub.2. Viable cell counts are
performed. The average number of viable cells/well is counted. This
assay is useful, for example, for identifying bioactivity mediated
through a murine GM-CSF receptor.
[0335] Assay 2
[0336] Cytokine sample and a recombinant standard identical to a
naturally occurring cytokine are each diluted serially in complete
RPMI-10 in 96-well flat-bottom microtiter plates. Each dilution is
plated in triplicate. CT.4S cells in active log-phase growth are
collected, washed at least twice in complete RPMI-10, and
resuspended in complete RPMI-10 at 1.times.10.sup.5 cells/ml. 50 ul
of the cell suspension is added to each well of the plate, which is
then incubated for 24 h at 37.degree. C. in 5% CO.sub.2. Tritiated
thymidine is added to each well and the plate is incubated for an
additional 24 h. The cells are then harvested and tritium
incorporation is measured by liquid scintillation counting. This
assay is useful, for example, for identifying bioactivity mediated
through an IL-4 receptor.
[0337] Assay 3 (Colony Formation Assay)
[0338] Agar (4% w/v) is melted in sterile water by boiling 3 min.
The agar is then cooled to 42.degree. C. and added to 42.degree. C.
RPMI-15 to a final concentration of 0.4%. The solution is
maintained at 42.degree. C. Femurs are removed from young mice
using sterile technique. Marrow is collected by flushing the opened
ends of the bones with sterile Hank's Balanced Salt Solution (HBSS)
using a syringe equipped with a 23G needle. Marrow is placed in a
15 ml tissue culture tube and vortexed into a cell suspension. Bone
fragments are allowed to settle for 5 min, and the supernatant
suspension is removed. The suspension is adjusted to
7.5.times.10.sup.6 nucleated cells/ml and diluted 1:100 by adding
the 42.degree. C. RPMI with 0.4% agar. 2-fold serial dilutions of
cytokine are added to 35 mm tissue culture dishes in a volume
<=0.2 ml. Control dishes have no cytokine added. 1 ml warm cell
suspension is added to each dish and the agar is allowed to set at
room temperature. The cultures are incubated for 5-7 days at
37.degree. C. in 5% CO.sub.2. Colony formation is then evaluated by
microscopy. The average number of colonies of a given type (or
aggregate number of colonies of given different types) on the
cytokine plates and the average number on the control plates is
counted. This assay is useful, for example, for identifying
bioactivity mediated through CSF receptors.
[0339] Assay 4
[0340] Cytokine is diluted serially in RPMI 1640/25 mM HEPES/1%
BSA. 25 ul of each dilution is plated in triplicate in a multiwell
chemotaxis chamber bottom. Wells containing medium alone serve as
negative controls and wells containing chemotaxis-inducing
naturally occurring cytokine serve as positive controls. A
polycarbonate membrane is placed over the chamber bottom and the
chamber is assembled. 50 ul of peripheral blood mononuclear cells
at 1.5.times.10.sup.6 cells/ml in the RPMI/HEPES/BSA is added to
each of the upper wells of the chamber. The chamber is incubated
for 90 min at 37.degree. C. in 5% CO.sub.2. The membrane is
removed, washed, and stained. Migrated cells in 3-5 random fields
of each well are counted by microscopy.
[0341] Assay 5
[0342] Naturally-occurring cytokine reference standard is diluted
to 2 ng/ml in a 17.times.100 mm tube using supplemented medium. 3
further 5-fold serial dilutions are also prepared. Serial dilutions
of cytokine are prepared in 17.times.100 mm tubes from 2 ng/ml to
20 pg/ml. 50 ul of PHA-activated human lymphoblasts
4.times.10.sup.5 cells/ml in supplemental medium is added to each
well of a 96-well flat-bottom microtiter plate. 50 ul of each
dilution of reference standard or cytokine is added to triplicate
wells. Negative control wells receive 50 ul of supplemented media
alone. The plate is incubated for 48 h at 37.degree. C. in 5%
CO.sub.2 and the cells are labeled with tritiated thymidine.
Incorporation is measured by liquid scintillation counting. This
assay is useful, for example, for identifying bioactivity mediated
through an IL-12 receptor.
[0343] Assay 6
[0344] In another assay for bioactivity, an immunocompetent animal
is vaccinated with on the order of 10.sup.4-10.sup.8 irradiated
cytokine-transduced or cytokine-coated tumor cells, and challenged
with on the order of 10.sup.4-10.sup.8 live wild-type tumor cells
(in any temporal sequence). Readouts of the assay are survival,
tumor onset, or number of metastases.
[0345] Further examples of cytokine assays can be found, e.g., in:
Callard R E et al Assay for human B cell growth and differentiation
factors. in: Clemens M J et al (eds) Lymphokines and Interferons. A
practical Approach, pp. 345-64, IRL Press, Oxford 1987; Coligan J E
et al Current protocols in immunology. Grene and
Wiley-Interscience, New York 1991); Dotsika E N Assays for
mediators affecting cellular immune functions. Current Opinion in
Immunology 2: 932-5 (1989); Feldmann M et al Cytokine assays: role
in evaluation of the pathogenesis of autoimmunity. Immunological
Reviews 119: 105-123 (1991); Guiguet M et al Misinterpretation of
the biological activity of cytokine-containing preparations
attributable to unrecognized interacting components. Analytical
Biochemistry 247(2): 441-442 (1997); Hamblin A S & O'Garra A
Assays for interleukins and other related factors. In: Lymphocytes,
a practical approach, Klaus G G B (edt), pp. 209-28, IRL Press,
Oxford, (1987); Laska E M & Meisner M J Statistical methods and
applications of bioassay. Annu. Rev. Pharmacol. Toxicol. 27: 385-97
(1987); Mosman T R & Fong T A T Specific assays for cytokine
production by T cells Journal of Immunological Methods 116: 151-8
(1989); Newton R C & Uhl J Assays relevant to the detection and
quantitation of cytokines and their inhibitors. Modern Methods in
Pharmacol. 5: 83-99 (1989); Thorpe R et al Detection and
measurement of cytokines. Blood Rev. 6: 133-48 (1992); van Zoelen E
J The use of biological assays for detection of polypeptide growth
factors. Progress in Growth Factor Research 2: 131-52 (1990);
Winstanley F P Cytokine bioassay. In: Gallagher G et al (eds) Tumor
Immunobiology, A practical Approach. Oxford University Press, pp.
179-303 (1993); Wadha M et al Quantitative biological assays for
individual cytokines. In: Balkwill F R (edt) Cytokines, A practical
approach. Oxford University press, pp. 309-330 (1991)
[0346] According to the invention, if a non-naturally occurring
cytokine gives a readout in a bioactivity assay that is at least
10% but not more than 29% (to the nearest 1%) of the readout
yielded by an equimolar amount of a naturally occurring cytokine
(the latter giving a positive result in the assay), then the
non-naturally occurring cytokine is "bioactive". According to the
invention, if a non-naturally occurring cytokine gives a readout in
a bioactivity assay that is at least 30% but not more than 49% (to
the nearest 1%) of the readout yielded by an equimolar amount of a
naturally occurring cytokine (the latter giving a positive result
in the assay), then the non-naturally occurring cytokine is "highly
bioactive". According to the invention, if a non-naturally
occurring cytokine gives a readout in a bioactivity assay that is
at least 50% but not more than 69% (to the nearest 1%) of the
readout yielded by an equimolar amount of a naturally occurring
cytokine (the latter giving a positive result in the assay), then
the non-naturally occurring cytokine is "extremely bioactive".
According to the invention, if a non-naturally occurring cytokine
gives a readout in a bioactivity assay that is at least 70% but not
more than 100% (to the nearest 1%) of the readout yielded by an
equimolar amount of a naturally occurring cytokine (the latter
giving a positive result in the assay), then the non-naturally
occurring cytokine is "natively bioactive". According to the
invention, if a non-naturally occurring cytokine gives a readout in
a bioactivity assay that is greater than 100% of the readout
yielded by an equimolar amount of a naturally occurring cytokine
(the latter giving a positive result in the assay), then the
non-naturally occurring cytokine is "suprabioactive".
[0347] Ligands for CD40 Useful According to the Invention
[0348] Nucleotide sequences encoding the CD40 proteins of various
species are provided by, e.g., Genbank Accession Nos. Y10507,
M83312, and U57745. Human CD40 is a transmembrane glycoprotein with
a length of 277 amino acids (48 kDa). CD40 is a phosphoprotein and
can be expressed as a homodimer. A soluble form of CD40 (28 kDa)
has also been described. CD40 protein is expressed on all
B-lymphocytes during various stages of development, activated
T-cells and monocytes, follicular dendritic cells, thymic
epithelial cells, and various carcinoma cell lines. It is expressed
on most mature B-cell malignancies and on some early B-cell acute
lymphocytic leukemias. CD40 has been demonstrated on the majority
of myeloma cell lines and myeloma cells from patients with plasma
cell dyscrasia.
[0349] Induction of CD40 mRNA and enhancement of cell surface
protein expression in primary human monocytes is observed after
treatment with GM-CSF, IL3, or IFN-gamma. The human CD40 gene maps
to chromosome 20.
[0350] CD40 has been proposed to play a role in the development of
memory cells. It also plays a role in cell activation, functioning
as a competence factor and progression factor. Crosslinking of the
CD40 antigen (in combination with cytokines such as IL4 and IL5)
leads to B-cell proliferation and induces immunoglobulin class
switching from IgM to the synthesis of IgG, IgA, and IgE in the
absence of activated T-cells. CD40 is one of the obligatory signals
required for commitment of naive B-cells to IgA secretion; the
mechanism of IgA induction requires the cooperation of IL10 and
TGF-beta. Soluble CD40 inhibits T-cell-dependent B-cell
proliferation.
[0351] Monoclonal antibodies against CD40 mediate a variety of
effects on B-lymphocytes, including induction of intercellular
adhesion (via CD11a/CD18 (LFA-1)), short- and long-term
proliferation, differentiation and enhanced tyrosine
phosphorylation of proteins. Germinal center centrocytes are
prevented from undergoing cell death by apoptosis by activation
through CD40 and antigen receptors.
[0352] In human resting B-cells expression of CD40 is induced by
IL4. Treatment of human B-cells with IL6 leads to the
phosphorylation of the intracellular CD40 domain. CD40 does not,
however, function as a receptor for IL6. In activated human B-cells
the synthesis of IL6 is induced by treatment of the cells with
monoclonal antibodies directed against CD40, suggesting that CD40
participates in signal transduction mechanisms dependent on
IL6.
[0353] Some limited sequence homologies have been found with
receptors for Nerve Growth Factor, TNF-alpha and CD27 and it has
been assumed that CD40 may be involved also in modulating the
biological activity of these and other cytokines.
[0354] CD40 has biological functions also in non-immune cells
although these are still largely unknown. CD40 ligation has been
shown to induce cell death by apotosis in transformed cells of
mesenchymal and epithelial origin. In part these processes are
mediated through the death domain present in the cytoplasmic domain
of CD40.
[0355] A particularly useful ligand for CD40 is CD154. CD154 ("CD40
ligand"; human protein 29.3 kDa, 261 amino acids) is a member of
the TNF family of proteins. The human protein shows 82.8% and 77.4%
identity at the cDNA and protein level, respectively, with a
similar protein isolated from murine EL4 thymoma cells. Both
proteins are the ligands for the CD40 cell surface antigen
expressed on resting B-cells. The human gene encoding CD154 maps to
chromosome Xq26.3-q27. Nucleotide sequences encoding the native
CD40 ligands of various species are provided by, e.g., Genbank
Accession Nos. X67878, X96710, X68550, X65453, Z48469, and L07414.
Amino acid sequences of the CD154 molecules of various species are
provided, e.g., by Entrez protein database Accession Nos. 1705713,
231718, 560693, 3047129, 116000, 1518170, 38412, 109639, 1083014,
38484, and 37270.
[0356] CD154 is naturally synthesized as a transmembrane
polypeptide. Nevertheless, a biologically active soluble fragment
of human CD154 has been described (Pietravalle et al, 1996, J Biol
Chem 271:5965-5967.) Mazzei et al (1995, J Biol Chem 270:7025-7028)
identified a biologically active soluble fragment of CD154 as a
homotrimer of polypeptides consisting of amino acids Glu 108
through Leu 261 of intact transmembrane CD154. Graf et al (1995,
Eur J Immunol 25:1749) describe another active fragment consisting
of the C-terminal fragment produced by proteolyttic cleavage at Met
113. Aruffo et al disclose soluble forms of CD154 and their use to
stimulate B cells in vitro in U.S. Pat. No. 5,540,926. In the
present invention, particularly useful ligands for CD40 include
polypeptides that comprise a sequence as set forth in SEQ ID NO. 2
of the '926 patent, from amino acid residues 47 to 261. These
residues are comprised by the extracellular domain of human
CD154.
[0357] Another particularly useful type of ligand for CD40 is an
antibody to CD40. Examples of such antibodies include the
monoclonal antibodies designated product numbers MCA1143 and
MCA1590 of Harlan Bioproducts for Science (Indianapolis, Ind.);
monoclonal antibodies designated catalog numbers P61640F (produced
by clone 14G7), P42374M (produced by clone MAB89), P61046M
(produced by clone BL-C4), and P54486M (produced by clone B-B20) of
Biodesign International (Kennebunk, Me.); monoclonal antibody
designated catalog number 05-422 (produced by clone 626.1) of
Upstate Biotechnology (Lake Placid, N.Y.); monoclonal antibody
designated catalog number 3601 (produced by clone S2C6) of Mabtech
(Nacka, Sweden); monoclonal antibodies designated catalog numbers
RDI-CBL486 (produced by clone BB20), RDI-M1691clb (produced by
clone CLB-14G7), RDI-mCD40-323 (produced by clone 3/23) of Research
Diagnostics (Flanders, N.J.); monoclonal antibodies described in
Schwabe et al, 1997, Hybridoma 16:217-226; monoclonal antibodies
described in Bjorck et al, 1994, Immunology 83:430-437; monoclonal
antibody G28-5 described by Ledbetter et al, 1994, Circ Shock
44:67-72; and monoclonal antibodies described in Buske et al, 1997,
Exp Hematol 25:329-337.
[0358] Opsonins Useful According to the Invention
[0359] As defined hereinabove, "opsonin" refers to naturally
occurring and non-naturally occurring molecules which bind to both
antigens and antigen presenting cells (APCs), such as, for example,
phagocytic leukocytes (including monocytes and macrophages),
dendritic cells (for example, Langerhans cells of the skin), B
lymphocytes and, in humans, endothelial cells, or molecules which
can be processed such that at least one product of the processing
step or steps can bind to both antigens and antigen presenting
cells (APCs), such as, for example, phagocytic leukocytes,
dendritic cells, B lymphocytes, and, in humans, endothelial
cells.
[0360] Without being bound to any one mechanism of action, it is
believed that opsonin-enhanced cells provide a beneficial effect
according to the invention because the opsonin portion acts as a
link or coupling agent between the antigen and the APC to allow
more efficient binding, engulfment, and internalization of the
antigen. In addition, the opsonin itself can be internalized with
the antigen. "Internalization" refers to the cellular uptake of a
molecule such that it is brought into the cytoplasm or a
compartment within the cytoplasm of the cell. Phagocytosis is a
process by which a molecule is internalized by a cell.
[0361] Preferred opsonins are non-rodent opsonins, e.g., primate,
e.g., human, opsonins. Opsonins useful according to the invention
bind to receptors on APCs (e.g., phagocytic leukocytes, e.g.,
macrophages and other cells of the phagocytic system) such as
receptors on cells which play a role in innate immunity, as
described herein.
[0362] Some sets of opsonins can be regarded as structurally and
functionally similar. For example, one family comprises fragments
of complement components C3 and C4. These two components are highly
structurally homologous, and each possesses an intramolecular
thiolester bond that is broken when a peptide (C3a or C4a
respectively) is proteolytically cleaved from the native molecule.
Disruption of the thiolester makes available a chemical structure
that can form an ester linkage with an antigen. The moiety of C3 on
which this ester bond resides, i.e. the non-C3a moiety, is
designated C3b, and C4b is the analogous product of C4 cleavage.
C3b can be further proteolysed by proteins such as factor Ito yield
fragments such as C3bi and C3d, which also remain linked to the
antigen via the ester bond.
[0363] There are four structurally unique proteins that are known
to function as high affinity receptors for biologically active,
membrane-bound fragments of C3 and/or C4. CR1 is the major receptor
for the C3b fragment of C3 and C4b fragment of C4. It is expressed
on monocytes and monocyte-derived APCs, among other cell types. CR2
is the major receptor for the fragment of C3 known as C3d, and is
expressed on, e.g., mature B lymphocytes, but not on cells of
monocytic lineage. The major role of CR2 on B lymphocytes is
believed to be direct costimulation of B cells in concert with
their cognate antigens.
[0364] CR3 is expressed primarily by neutrophils and monocytes and
is also expressed on FDC, Kupffer cells, and NK cells. CR3 is a C3
fragment receptor with a primary specificity for C3bi. CR3 has been
proposed as an important organizer of cytoskeletal events necessary
for adhesive interactions and membrane reorganization during
processes such as phagocytosis.
[0365] CR4 is a member of the beta2 integrin family, and its alpha
chain is structurally similar to the alpha chain of CR3 and LFA-1.
Its primary physiologic ligands are believed to be C3d and C3d,g;
however, its biologic activities are less well understood than
CR3.
[0366] Another example of a family of innate opsonins is the
collectins, a group of collagenous C-type lectins that comprises
complement component C1q, mannose binding protein, surfactant
proteins A and D, and conglutinin. Each molecule comprises a lectin
domain that can bind to an antigen, and a collagenous domain that
can bind to receptors on phagocytic mononuclear cells, including
receptors that are wholly or partially identical to the C1q
receptor (Nepomuceno et al, Immunity 6:11 '9-29; Termer et al,
Immunity 3:485-93; Guan et al, J Immunol 152:4005-16; Geertsma et
al, Am J Physiol 267:L578-84; Miyamura et al, Biochem J 300:237-42;
Malhotra et al, J Exp Med 172:955-9; Malhotra et al, Biochem J
293:15-19). Most known collectins comprise multiple polypeptide
chains, in some cases homomeric and in others heteromeric, that are
assembled post-translationally, in part by covalent cross-linkage
of hydroxyproline and hydroxylysine residues. Collectins are
demonstrated to be opsonins in, for example, Pikaar et al, J Infect
Dis 172:481-9; Alvarez-Dominguez et al, Infection & Immunity
61:3664-72; Kuhlman et al, J Exp Med 169:1733-45; and Geertsma et
al, op cit.
[0367] Among the other innate opsonins useful according to the
invention are C-reactive protein (CRP), alpha-2 macroglobulin, and
fibronectin. CRP, a member of the pentraxin family of molecules,
binds to receptors on cells of monocytic lineage and has been shown
to be an opsonin (Tebo and Mortenson, J Immunol 144:231-8; Holzer
et al, J Immunol 133:1424-30). Alpha-2 macroglobulin, like C3 and
C4, comprises an internal thiolester bond that can be disrupted
when the molecule is proteolysed. Such disruption allows covalent
binding of the molecule to an antigen, and binding of alpha-2
macroglobulin to an APC can promote uptake of the conjugate.
Fibronectin binds to the alpha 5 beta 1 integrin and can also bind
to various antigens, allowing it to function as an opsonin (Cosio,
J Lab Clin Med 103:613-9; Czop and Austen, J Immunol
129:2678-81).
[0368] Immunoglobulins (antibodies) can function as opsonins by
binding antigens via their variable regions and APCs via their
constant regions. Typically, an immunoglobulin comprises two heavy
chains which are covalently bound to each other and each of which
is bound to one light chain. These heterotetramers can further
assemble into higher-order structures, such as the pentamers of
IgM. Both heavy and light chain variable regions can contribute to
the structure of the antigen binding site, whereas the APC binding
site is located on the heavy chain constant region. Recombinant
single-chain antibodies have also been described. APC receptors for
immunoglobulins include Fc alpha, Fc gamma, Fc epsilon, and Fc mu
receptors for IgA, IgG, IgE, and IgM, respectively.
[0369] Opsonins that are naturally expressed by multicellular
eukaryotic organisms are secreted. The latter characteristic
distinguishes opsonins from adhesion molecules. A non-naturally
occurring molecule containing a naturally occurring APC-binding
moiety shall be considered an opsonin if it contains a moiety
through which it can be stably bound or attached to a cell such
that the APC-binding moiety is located in the extracellular space,
whether or not the molecule contains an antigen-binding moiety of a
naturally occurring antigen. Moieties through which molecules can
be stably bound to a cell include crosslinking moieties,
transmembrane sequences, and lipid moieties. The preparation of
proteins containing these sequences or moieties is well-known to
one of skill in the art.
[0370] An "APC binding moiety of an opsonin" is a sequence or
domain of an opsonin which when included in a chimeric molecule
permits binding of the chimeric molecule to a receptor that is
physiologically expressed on an APC with an affinity at least in
the nanomolar range.
[0371] There are a number of examples of opsonin fragments that
comprise APC binding moieties. Such a fragment may be any length so
long as it retains an APC binding function; for example, it may be
about 40 amino acids, 100 amino acids, 150 amino acids, 500 amino
acids, 800 amino acids, or even as long as 3000 amino acids. For
example, Las Holtet et al, 1994, FEBS Lett 344:242 describe a
carboxy-terminal fragment of human atm (val1299-ala1451) that binds
with high affinity to the .alpha.2m receptor. Fragments comprising
amino acids 1314-1451 of human .alpha.2m and the corresponding
domain of rat .alpha.2m also bind to .alpha.2m receptors, albeit
with 1-2% of the affinities of native .alpha.2m (Van Leuven et al,
1986, J Biol Chem 261:11369; Enghild et al, 1989, Biochemistry
28:1406; Salvesen et al, 1992, FEBS Lett 313:198; Sottrup-Jensen et
al, 1986, FEBS Lett 205:20).
[0372] Becherer and Lambris, 1988, J Biol Chem 263:14586 describe
fragments of C3b that bind to CR1, e.g., C3c, fragments of C3
generated by elastase treatment and comprising the N-terminal of
the alpha' chain of C3b, and a synthetic peptide comprising the 42
N-terminal amino acids of the C3b alpha' chain. A binding sequence
in C3 for CR3 has also been described (Wright et al, 1987, PNAS
84:4235).
[0373] "Collagen stalks" of C1q, which are N-terminal fragments
obtained by pepsin digestion, bind to the C1q receptor (Reid, 1981,
Methods Enzymol 80:16; Malhotra et al, 1993, Biochem J 293:15).
Malhotra et al, ibid., also provide evidence that an APC binding
moiety of conglutinin is comprised by its 55 N-terminal amino
acids. Ezekowitz (U.S. Pat. No. 5,270,199) offers a putative APC
binding site in human mannose binding protein consisting of
nucleotides 370-438 of FIG. 2 in the '199 Patent. In addition, by
homology with conglutinin, exon 1 disclosed in the '199 Patent may
comprise an APC binding moiety.
[0374] An APC binding moiety of IgG comprises the CH2 domain and
the lower hinge region, including residues 234-237, as described by
Canfield and Morrison, 1991, J Exp Med 173:1483-91; Lund et al,
1991, J Immunol 147:2657-62; and Sarmay et al, 1992, Mol Immunol,
29:633-9.
[0375] Examples of opsonins which can be used in the compositions
and methods of the invention include fibronectin (e.g., Genbank
accessions X02761, K00799, K02273, X82402, X00307, X00739), CRP
(e.g., Genbank accessions X17496, M11880, M11881, M11882),
complement components such as C1q (e.g., Genbank accessions X66295,
M22531, X03084, X58861, and Swiss-Prot accessions P02747, P02745),
complement fragments such as C3b and C3d (e.g., Genbank accessions
K02782, K02765), mannose binding protein (e.g., Genbank accessions
S42292, S42294, X15422), conglutinin (e.g., Genbank accession
X71774), alpha-2-macroglobulin (e.g., Genbank accessions M93264,
M11313), and surfactant proteins A (e.g., Genbank accessions
M68519, S48768) and D (e.g., Genbank accessions L40156, X65018,
S38981), immunoglobulins, and their homologues among species.
TABLE-US-00006 TABLE 2 Exemplary Opsonin, APC binding moiety/APC
receptor pairs useful according to the invention. Exemplary APC
Binding Opsonin Moiety Receptor .alpha.-2 macroglobulin
Val(1299)-Ala(1451) of .alpha.-2m receptor, CD91 human .alpha.-2m
C3b 42 N-terminal amino acids of CR1 the .alpha.' chain of human
C3b C3bi C3bi CR2, CR3 C3d C3d CR2, CR4 Clq Collagen stalks
Collectin receptor (Reid, 1981, Methods (Nepomuceno et al., 1997,
Enzymol. 80: 16) Immunity 6: 119), CD93 Conglutinin 55 N-terminal
amino acids of Collectin receptor bovine conglutinin MBP 1.
Polypeptide encoded by nt Collectin receptor, CD35, 370-438 of FIG.
2, U.S. Pat. No. CD14 5,270,199 2. Polypeptide encoded by Econ . .
. I of FIG. 2, U.S. Pat. No. 5,270,199 CRP CRP CRP receptor,
Fc.gamma.RI, Fc.gamma.RIIa (CD32) Fibronectin Fibronectin
.alpha.5b1 integrin IgG CH2 domain plus lower Fc.gamma.RI,
Fc.gamma.RII, Fc.gamma.RIII hinge including amino acids 234-237, as
described by Lund et al., 1991, J. Immunol. 147: 2657 Surfactant
Protein A Surfactant Protein A Collectin receptor, CD14 Surfactant
Protein D Surfactant Protein D
[0376] Determination of Opsonicity According to the Invention
[0377] A given naturally occurring opsonin is considered useful
according to the invention if it is determined to possess
opsonicity according to one or more of the following assays, and if
it is a secreted molecule.
Assay 1
[0378] In one assay of opsonicity, as described by O'Rear and Ross
in Current Protocols in Immunology, 1994, John Wiley & Sons,
pp. 13.4.5-9, SRBC bound via a physiologically occurring linkage to
the candidate opsonin molecule are obtained. APCs from the species
to which the candidate opsonin is native are suspended at
4.times.10.sup.6/ml in ice-cold HBSS with 1% (w/v) Cohn fraction of
BSA. If the candidate opsonin is a fragment of C3, the APCs are
freshly drawn, uncultivated peripheral blood monocytes. SRBC linked
to the candidate opsonin or control SRBC (identical to the former
but not linked to the candidate opsonin) are suspended in the same
solution at 2.times.10.sup.8/ml. 100 ul of SRBC suspension and
100u1 of APC suspension are mixed in a 10.times.75 mm plastic tube.
The tube is rotated at 40 rpm at 37.degree. C. for 2-20 min. A
small drop of the suspension is placed on a slide, covered with a
coverslip, and allowed to stand for 5-10 min. Excess fluid can be
removed by pressure on the coverslip, and the coverslip can be
sealed to the slide, e.g. with clear nail polish. The slide is
examined microscopically, and the percentage of APCs visibly
adherent to 4 or more SRBCs is determined. If the percentage is 50%
or greater when there are up to 4.times.10.sup.4 candidate opsonin
molecules/SRBC', the candidate opsonin can be an opsonin.
Assay 2 (For Protease-Activated Candidate Opsonin)
[0379] Candidate opsonin or radiolabeled Candidate opsonin is
treated with a 1.5-3 fold molar excess of protease (0.05 M
triethanolamine-0.1 M NaCl, pH 8.0, room temperature overnight). In
this assay, the protease can serve as the antigen or an excess of
another antigen can be added. Prior to binding studies, the
candidate opsonin-antigen complex is dialyzed against HBSS
(4.degree. C.).
[0380] Candidate opsonin-antigen complex binding to monocytes is
measured by incubating labeled ligand at a concentration up to 1.0
M with (1.5-4.0).times.10.sup.6 monocytes in 200 ml volume on ice.
Nonspecific binding of radiolabeled ligands is determined in the
presence of a 100-fold molar excess labeled candidate
opsonin-antigen complex. The unbound ligand is separated from the
cells and cell-bound ligand by rapid vacuum filtration on glass
fiber filters. Studies are performed on ice to avoid potential
complications due to endocytosis. Binding constarts and the number
of sites per cell are determined by analysis and by nonlinear curve
fit. If candidate opsonin-antigen complex affinity for a monocyte
binding site is in at least the nanomolar range, the candidate
opsonin is an opsonin.
Assay 3
[0381] Part I
[0382] To directly evaluate whether candidate opsonin is bound to
the surface of P. carinii, immunoelectron microscopy is performed.
P. carinii are isolated from bronchoaveolar lavage (BAL) of
moribund infected rats using TBS with 1 mM calcium to preserve
surface-bound candidate opsonin. Isolated organisms are fixed in
periodate-lysine-paraformaldehyde buffer and embedded in Lowacryl
mounting medium (Ted Pella, Inc., Redding, Calif.). Ultrathin
sections are obtained, blocked with normal goat serum (2%) for 1 h,
and incubated with either rabbit anti-candidate opsonin or
nonimmune rabbit IgG (25 mg/ml) overnight. After washing, the
sections are subsequently incubated with goat and rabbit IgG
conjugated to 15 nM colloidal gold (Amersham Corp., Arlington
Heights, Ill.). The sections are washed again and examined on a
transmission electron microscope (model 6400:JEOL USA, Inc.,
Peabody, Mass.).
[0383] Part II
[0384] The attachment of P. carinii to cultured alveolar
macrophages in the presence or absence of antibody to the candidate
opsonin or with the addition of purified candidate is quantified as
follows. Adherence of P. carinii to alveolar macrophages is assayed
by .sup.51Cr-labeling the organisms. P. carinii are isolated from
infected rats with TBS containing 1 mM calcium to prevent loss of
surface-bound candidate opsonin. The organisms are radiolabeled by
incubation for 8 h at 37.degree. C. in 2 ml of DME containing 20%
FCS and 200 mCi of .sup.51Cr-sodium chromate (New England Nuclear).
Normal alveolar macrophages are lavaged from healthy rats and
plated in tissue culture plates (1.times.10.sup.5) cells/well)
which are been precoated with normal rat IgG (100 mg/ml.times.60
min) in order to ensure firm adherence of the macrophages. After 1
h, the macrophages are gently washed with HBSS to remove
nonadherent cells. >95% of macrophages are adherent after this
wash. .sup.51Cr-P. carinii (1.times.10.sup.6) containing
surface-associated candidate opsonin are added to the macrophages
and incubated at 37.degree. C. for an additional hour.
Subsequently, nonadherent P. carinii are removed by washing. The
macrophage monolayers containing adherent P. carinii are
solubilized in 1 N NaOH and quantified. Adherence of P. carinii is
defined as: percentage of adherence=(A/A+B).times.100, where
A=.sup.51Cr-P. carinii associated with the monolayer, and
B=unattached .sup.51Cr-P. carinii. To assess the effect of
candidate opsonin on the attachment of P. carinii to alveolar
macrophage lung cells in culture, P. carinii adherence assays are
conducted in the presence or absence of a polyclonal rabbit
antibody generated against the candidate opsonin (100 mg/ml).
[0385] If candidate opsonin binding to P. carinii is apparent in
Part I and if, in Part II, % adherence is diminished in the
presence of anti-candidate opsonin with statistical significance of
P<0.05, the candidate opsonin is an opsonin.
Assay 4
[0386] Association of bacteria with adherent monocytes is measured
as follows. Endotoxin level in the modified PBS and in all buffers
used is below 50 pg/ml as determined by the Limulus assay.
5.times.10.sup.3 monocytes in modified PBS are allowed to adhere to
the wells of a Terasaki plate for 2 h at 37.degree. C. After
nonadherent cells are removed by three washes with PBS,
5.times.10.sup.4 FITC-labeled bacteria in 0.5 ml buffer with or
without 10-50 micrograms/ml of candidate opsonin are added. A
bacteria-to-monocyte ratio of 10:1 to 50:1 is used. After 30 min of
incubation at 37.degree. C. in the dark, the nonadherent bacteria
are removed by five washes with warm PBS. Assays are performed in
quadruplicate; in each well, the number of bacteria associated with
.sup.3 100 monocytes is counted under a flourescence microscope
using .times.400 magnification. Results are expressed as the number
of bacteria associated with 100 monocytes. If this number with
candidate opsonin can be at least twice that without candidate
opsonin, the candidate opsonin is an opsonin.
Assay 5
[0387] Part I
[0388] About 1.times.10.sup.7 to 6.times.10.sup.7 bacteria per ml
are incubated (20 min, 0.degree. C.) with 10 mcg/ml of
.sup.125I-candidate opsonin in a total volume of 0.7 ml. of PBS
aliquots, 100 ml, of the reaction mixtures are layered over 150 ml
of an oil cushion (60% dibutyl phthalate, 40% dioctyl phthalate
[Eastman Kodak Co., Rochester, N.Y.]), and the mixtures are
centrifuged (10,000.times.g, 60 s, 4.degree. C.). The tip of the
tube, containing the cell pellet, is cut with a Mozart razor blade,
and the radioactivity is counted.
[0389] Part II
[0390] APCs are plated in 96-well tissue culture plates (Costar,
Cambridge, Mass.) at 2.times.10.sup.5 cells per ml the evening
before use. 2.times.10.sup.6 bacteria per well (0.1 ml per well)
are added to the culture plates with or without 100 mcg/ml of
candidate opsonin. The plates are then centrifuged at 1,000.times.g
for 7 min. After 15 min at 37.degree. C. to allow the uptake of
bacteria, free bacteria are removed by several washes with cold
PBS. They are then incubated (45 min, 37.degree. C.) in RPMI 1640
plus an amount of antibiotic that, when present in the culture for
45 min, kills all extracellular bacteria. The end of this
incubation period is considered time zero. Monolayers are washed
three times with Hanks' balanced saline solution, and the same
volume of RPMI 1640 (R0) is added. The cells are lysed by using
several cycles of freezing and thawing. The number (CFU) of viable
bacteria per well is determined by quantitative plate counts on
blood agar plates (Columbia blood agar; Becton Dickinson, San Jose,
Calif.) after 24 h of incubation. Each result is given as the mean
of three determinations.
[0391] If, in Part I, candidate opsonin-treated bacterial pellet
has >75 KCPM and this incorporation can be inhibited by
unlabeled candidate opsonin, and if in Part II the CFU with
candidate opsonin is greater than without (P<0.05), the
candidate opsonin can be an opsonin.
Assay 6
[0392] 200 .mu.l of GHBSS (Hanks Balanced Salt Solution)+0.1% of
gelatin containing 10 m mol CaCl.sub.2) containing 10.sup.7
bacteria is prepared. The bacteria are then incubated at 4.degree.
C. with 20-100 .mu.g/ml of candidate opsonin. Binding assays are
done in the presence or absence of a competitive inhibitor. After
incubation for 30 minutes, the bacteria are washed five times in a
GHBSS+10 mmol CaCl.sub.2 at room temperature in a microfuge at
1,300 g for 3 minutes. Thereafter, a 1:1,000 dilution of rabbit
anti-candidate opsonin antiserum is incubated with the bacteria for
1 h in PBS+5% FCS and 10 mmol CaCl.sub.2 and then the bacteria are
washed three times in GHBSS+10 mmol CaCl.sub.2 plus 0.05% Tween 20.
Binding of anti-serum to bacteria is detected by a 1:1,000 dilution
of goat anti-rabbit IgG conjugated to rhodamine (Fisher
Pharmaceuticals, Orangeburg, N.Y.). After incubation, the bacteria
are washed five times in GHBSS+10 mmol CaCl.sub.2 plus 0.05% Tween
20, smeared onto glass slides and allowed to air dry. Thereafter
bacteria are fixed with 100% ice cold methanol for 5 minutes.
Negative controls included the absence of candidate opsonin and no
first step antibody. Numerous fields of triplicate assays are
examined by fluorescence microscopy.
[0393] Part II Association of Radiolabeled Bacteria with Cells.
[0394] 10.sup.7 radiolabeled bacteria are resuspended in 200 .mu.l
of GHBSS+10 mmol CaCl.sub.2 and are incubated with or without
candidate opsonin ranging from 2 .mu.g/ml to 40 pg/ml at 4.degree.
C. for 30 min. The bacteria are then washed three times in GHBSS+10
mmol CaCl.sub.2 for 3 min at room temperature in a microfuge at
1,300 g, resuspended in 50 .mu.l of GHBSS and added to a 1-ml
suspension containing on the order of 10.sup.6 APCs (GHBSS). The
bacteria and APCs are gently rocked at 37.degree. C. for 20 min and
thereafter the unattached bacteria are removed by five washes using
differential centrifugation at 82 g in a microfuge. Before the last
wash, an aliquot from each sample is plated on a Labtek slide and
cells are adhered for 10 min, fixed in methanol, stained with
Giemsa, and scored by light microscopy. To score the cells plated
on the Labtek slides, at least 400 cells are counted. The
phagocytic index represented the number of attached or ingested
particles per 100 PMNs. The pellet from above containing cells and
radiolabeled bacteria is then lysed in 100 .mu.l PBS+0.5% Triton
X-100 and the radioactivity is measured in a scintillation counter.
If, in Part I, specific binding of candidate opsonin to bacteria is
evident, and in Part II the specific uptake of bacteria, in cpm, is
more than three times greater with candidate opsonin than without,
the candidate opsonin can be an opsonin.
Assay 7
[0395] Part I
[0396] To investigate binding to L. donovani promastigotes cultures
are seeded at 5.times.10.sup.5 parasites ml.sup.-1. At regular time
points up to 9 days, a fraction of parasites are counted, washed,
and resuspended in 1% BSA, 0.5 mM Ca.sup.2+. 0.05% NaN.sub.3,
Tris-buffered saline (TBS), (10 mM Tris-HCl, 0.15 M NaCl, pH 8.0)
(diluent) to 2.times.10.sup.5 ml.sup.-1. Fifty microliters of this
suspension are then added to 200-.mu.l microfuge tubes containing
70 .mu.l 5 .mu.g/ml radiolabled candidate opsonin (0.12
.mu.Ci/.mu.g) in diluent without EDTA, which had been layered over
150 .mu.l of a dinonyl phthalate/dibutyl phthalate (40:60 v/v) oil
mixture. Parasites are incubated for 1 h and centrifuged through
the oil layer, the cell pellet is cut off, and associated candidate
is detected by gamma counting. Each assay is performed in
triplicate. The concentration dependency of candidate binding to
promastigotes is also measured as above, using an activity of 0.045
.mu.Ci/.mu.g and a twofold dilution series from 60 to 0.015
.mu.g/ml candidate.
[0397] Part II
[0398] APCs are plated out at 1.times.10.sup.6 cells/well on glass
coverslips in a 24-well tissue culture plate. Cells are incubated
in RPMI 1640 (Life Technologies) supplemented with 10% PCS, 1 mM
glutamine, 200 U/ml penicillin and 200 .mu.g/ml streptomycin in a
humidified incubator at 37.degree. C. After 24 h, nonadherent cells
are removed and remaining cells are used after 6 days.
Promastigotes are incubated with or without candidate at 30
.mu.g/ml in RPMI 1640 for 1 h and then washed three times before
adding to the APC cultures at 10.sup.6/well. Promastigotes are
allowed to infect APCs for 1 h, then cells are washed, fixed with
methanol, and Geimsa stained (BDH, Poole, Dorset, U.K.) before
counting. The percentage of APCs infected and the number of
parasites/100 macrophages is determined from quadruplicate
cultures.
[0399] If in Part I the affinity of candidate opsonin for parasites
is at least in the nanomolar range and in Part II the number of
parasites taken up/100 APCs is, with candidate opsonin, at least
twice that without candidate opsonin, the candidate opsonin can be
an opsonin.
Assay 8
[0400] Part I
[0401] Portions (0.5 ml) of [.sup.35S] methionine-labeled culture
medium containing 5 percent fetal calf serum and the candidate
opsonin are incubated for 30 minutes at room temperature with 0.1
ml or 0.2 ml of a 10 percent suspension of a microorganism). The
microorganisms tested may include, for example, Salmonella
typhimurium, Bacillus subtilis, Staphylococcus aureus, Escherichia
coli, and Saccharomyces cerevisiae. Bound proteins are released by
boiling in buffer containing 2 percent SDS and 0.1 M dithiothreitol
and are analyzed on a 5 percent SDS gel.
[0402] Part II
[0403] Fixed bacteria (0.1 ml; 10 percent by volume; 10.sup.10
organisms per milliliter), labeled with [.sup.3H]thymidine, are
incubated with 0.1 ml of serum with or without depletion of the
candidate opsonin. After being washed with PBS, the bacteria are
incubated with on the order of 1.times.10.sup.7 APCs in a final
volume of 0.9 ml PBS containing divalent cations. At intervals 0.2
ml is removed to ice-cold PBS with N-ethylmaleimide (2 mM) to block
further endocytosis, and the cells are washed (at about 100 g for
10 seconds)
[0404] If in Part I a band corresponding to the candidate opsonin
is apparent, and if in Part II the CPM after 6-10 min of incubation
is at least three times greater for undepleted samples with serum
than with depleted serum, the candidate opsonin can be an
opsonin.
[0405] In lieu of results form Parts I of assays 3, 5, 6, 7, 8, a
candidate opsonin that satisfies Part II of an assay can be an
opsonin if it can bind to the antigen of the assay with an affinity
in at least the nanomolar range.
Assay 9
[0406] SRBC coated with at least 1.2.times.10.sup.4 molecules/cell
of a fragment of C3 are prepared as described by O'Rear and Ross in
Current Protocols in Immunology, 1994, John Wiley & Sons, pp.
13.4.5-9. 250 ul of monocytes at 2.times.10.sup.5 cells/ml of RPMI
with 10% fetal calf serum are added to each well of an 8-well glass
tissue culture plate and incubated at 37.degree. C., 5% CO.sub.2
for 3 h. The monocytes are washed twice with HBSS, and 50 ul of the
SRBC at 1.5.times.10.sup.8/ml of DVBS.sup.2+ are added to each
well. The plate is centrifuged at 50 g for 5 min and then incubated
at 37.degree. C., 5% CO.sub.2 for 3 h. The walls are washed twice
with HBSS, fixed with 0.5% glutaraldehyde, and stained with Giemsa
stain. If >40% of the monocytes form rosettes with at least 1
SRBC as determined by light microscopy, the candidate can be an
opsonin.
[0407] Heat Shock Proteins Useful in the Invention
[0408] Heat shock proteins (HSPs) are associated in cells with a
broad spectrum of peptides, polypeptides, denatured proteins and
antigens with which they form complexes. Such HSP-peptide complexes
have been described as being useful in vaccines against cancers and
infectious diseases by Srivastava et al., "Heat shock
protein-peptide complexes in cancer immunotherapy" in Current
Opinion in Immunology (1994), 6:728-732; Srivastava,
"Peptide-Binding Heat Shock Proteins in the Endoplasmic Reticulum"
in Advances in Cancer Research (1993), 62:153-177. The HSP-peptide
complexes appear to work as vaccines, because they may function as
antigen carrying and presentation molecules. The development of
vaccines using such antigens has been described by Baltz, "Vaccines
in the treatment of Cancer" in Am. J. Health-Syst. Pharm. (1995),
52:2574-2585. The antigenicity of heat shock proteins appears to
derive not from the heat shock protein itself, but from the
associated peptides, see Udono et al., "Heat Shock Protein
70-associated Peptides Elicit Specific Cancer Immunity" in J. Exp.
Med. (1993), 178:1391-1396; Srivastava et al., "Heat shock proteins
transfer peptides during antigen processing and CTL priming" in
Immunogenetics (1994), 39:93-98; Srivastava, "A Critical
Contemplation on the Roles of Heat Shock Proteins in Transfer of
Antigenic Peptides During Antigen Presentation" in Behring Inst.
Mitt. (1994), 94:37-47. HSPs appear to be part of the process by
which peptides are transported to the Major Histocompatibility
Complex (MHC) molecules for surface presentation.
[0409] A number of different HSPs have been shown to exhibit
immunogenicity, and are useful in the present invention, including,
but not limited to: gp96, hsp90, hsp100, hsp60, hsp 25 and hsp70,
see Udono et al., supra. and Udono et al., "Comparison of
Tumor-Specific Immunogenicities of Stress-Induced Proteins gp96,
hsp90, and hsp 70" in Journal of Immunology (1994), 5398-5403; gp96
and grp94, Li et al., "Tumor rejection antigen gp96/grp94 is an
ATPase: implications for protein folding and antigen presentation"
in The EMBO Journal, Vol. 12, No. 8 (1993), 3143-3151; and gp96,
hsp90 and hsp70, Blachere et al., "Heat Shock Protein Vaccines
Against Cancer" in Journal Of Immunotherapy (1993), 14:352-356.
[0410] Heat shock proteins may be purified for use in the present
invention using a procedure employing DE52 ionexchange
chromatography followed by affinity chromatography on ATP-agarose,
see Welch et al., "Rapid Purification of Mammalian 70,000-Dalton
Stress Proteins: Affinity of the Proteins for Nucleotides" in
Molecular and Cellular Biology (June 1985), 1229-1237.
[0411] Adhesion Molecules Useful in the Invention
[0412] Adhesion molecules useful in the present invention include
any cell-surface protein which is involved in bediating the
recognition and adhesion of cell sto their substrate and to other
cells. Cellular adhesion molecules can be divided into two primary
classes: Ca.sup.2+ dependent (cadherins) and Ca.sup.2+
independent.
[0413] There are over a dozen different types of Ca.sup.2+
dependent adhesion molecules called cadherins. Most cadherins are
single-pass transmembrane glycoproteins composed of about 700-750
amino acid residues. The large extracellular part of the molecule
is usually folded into five domains, each containing about 100
amino acid residues. Four of these domains contain presumptive
Ca.sup.2+ binding sites. Cadherins are often present in the cell
membrane as dimers.
[0414] Cadherens useful in the present invention include, but are
not limited to cadherin E, cadherin N, cadherin BR, cadherin P,
cadherin R, cadherin M, cadherin VE, cadherin T&H, cadherin OB,
cadherin K, cadherin 7, cadherin 8, cadherin KSP, cadherin LI,
cadherin 18, fibroblast 1, cadherin, fibroblast 2, cadherin,
fibroblast 3, cadherin 23, desmocollin 1, desmocollin 2, desmoglein
1, desmoglein 2, desmoglein 3, and protocadherin 1, 2, 3, 7, 8, and
9.
[0415] The remaining adhesion molecules are Ca.sup.2+ independent,
and, like the cadherins, may be used as ligands of a cell surface
protein on an APC in the present invention. General classes of
adhesion molecules as well as specific adhesion molecules useful in
the present invention are shown below in Table 3.
TABLE-US-00007 TABLE 3 Selectins L-selectin; E-selectin; P-selectin
Integrins .alpha.1.beta.1; .alpha.2.beta.1; .alpha.3.beta.1;
.alpha.4.beta.1; .alpha.5.beta.1; .alpha.6.beta.1; .alpha.7.beta.1;
.alpha.8.beta.1; .alpha.9.beta.1; .alpha.v.beta.1; .alpha.L.beta.2;
.alpha.M.beta.2; .alpha.X.beta.2; .alpha.IIb.beta.3;
.alpha.v.beta.3; .alpha.6.beta.4; .alpha.v.beta.5; .alpha.v.beta.6;
.alpha.v.beta.7; .alpha.IEL.beta.7; .alpha.11 Immunoglobulin Neural
Specific: Adhesion molecule on glia (AMOG); L1CAM; Myelin-
Superfamily associated glycoprotein (MAG); Myelin-oligodendrocyte
glycoprotein (MOG); NCAM-1 (CD-56); NrCAM; OBCAM; P.sub.0protein;
PMP-22protein; Neurofascin; NgCAM Systemic IgCAMS: ALCAM; Basigin
(CD147); BL-CAM (CD22); CD44; ICAM-1 (CD54); ICAM-3 (CD50);
Lymphocyte function antigen-2 (LFA- 2); LFA-3 (CD58; MHC molecules;
MAdCAM-1; PECAM (CD31); T-cell receptor; VACM-1 Other Adhesion
Agrin; CD34; GlyCAM-1; Oligodendrocyte-myelin glycoprotein (OMGP)
Molecules
[0416] Defensins Useful in the Invention
[0417] In one embodiment, the portion of the multifunctional
molecule which is a ligand of a cell surface protein of an APC is a
defensin. Defensins are a large family of broad-spectrum
antimicrobial peptides, identified originally in leukocytes of
rabbits and humans. Defensins, cationic, polar peptides (30-35 aa,
3-4 kDa), are distinguished by a conserved tri-disulfide and
largely beta sheet structure. When expressed at the cell surface,
defensins have been hypothesized to function as a biochemical
barrier against microbial infection by inhibiting colonization of
the epithelium by a wide range of pathogenic microorganisms.
Defensins useful in the present invention include, but are not
limited to human alpha defensins 1-6, human neutrophil peptides
1-4, human beta defensin 1 and 2, and rat beta defeinsin 1 and
2.
[0418] Counter-Receptors of T Cell Co-Stimulatory Molecules of the
Invention
[0419] In one embodiment of the invention the portion of the
multifunctional molecule which is a ligand of a cell surface
protein of an APC is a counter-receptor of a T cell co-stimulatory
molecule. Costimulation is defined as a signaling pathway that does
more than simply augment antigen receptor--proximal activation
events, but that intersects with antigen-specific signals
synergistically to allow lymphocyte activation. Accordingly, a
counter-receptor of a co-stimulatory molecule, useful in the
present invention includes, but is not limited to a receptor for
one or more of B7-1, B7-2, ICOS:B7 h, PD-1:PD-L1/PD-L2, CD48, CD40
ligand, and OX40. Counter-receptors useful in the present invention
include, but are not limited to CD28, CTLA-4, ICOS, PD-1, members
of the TNF receptor family, CD40, the major B cell costimulatory
molecule, as well as OX-40, 4-1BB, CD30, and CD27.
[0420] Peptide Linkers
[0421] In one embodiment, the multifunctional molecule is a fusion
polypeptide which comprises one or more amino acids interposed
between the first and second parts which bind to cells, e.g. a
fusion polypeptide which comprises a first amino acid sequence
which can bind to an antigen bearing target and a second amino acid
sequence which can bind to a leukocyte, and which further comprises
at least one amino acid interposed between the first and second
parts. The interposed amino acids may comprise, e.g., a linker
sequence intended to lessen steric hindrance or other undesirable
interactions between the aforementioned first and second parts.
For, example, one such type of sequence takes the form
(Gly.sub.xSer).sub.n, wherein n is an integer from between 1 and
15, and x is an integer between 1 and 10. Additional useful linkers
include, but are not limited to
(Arg-Ala-Arg-Asp-Pro-Arg-Val-Pro-Val-Ala-Thr).sub.1-5 (Xu et al.,
1999, Proc. Natl. Acad. Sci. U.S.A. 96: 151-156), (Gly-Ser).sub.n
(Shao et al., 2000, Bioconjug. Chem. 11: 822-826),
(Thr-Ser-Pro).sub.n (Kroon et al., 2000, Eur. J. Biochem. 267:
6740-6752), (Gly-Gly-Gly).sub.n (Kluczyk et al., 2000, Peptides 21:
1411-1420), and (Glu-Lys).sub.n (Klyczyk et al., 2000, supra),
wherein n is 1 to 15 (each of the preceding references is also
incorporated herein by reference). In another embodiment, no amino
acids are interposed between the first and second parts.
Antigens Useful According to the Invention
[0422] 1. Viral Antigens
[0423] Examples of viral antigens include, but are not limited to,
retroviral antigens such as retroviral antigens from the human
immunodeficiency virus (HIV) antigens such as gene products of the
gag, pol, and env genes, the Nef protein, reverse transcriptase,
and other HIV components; hepatitis viral antigens such as the S.
M, and L proteins of hepatitis B virus, the pre-S antigen of
hepatitis B virus, and other hepatitis, e.g., hepatitis A, B. and
C, viral components such as hepatitis C viral RNA; influenza viral
antigens such as hemagglutinin and neuraminidase and other
influenza viral components; measles viral antigens such as the
measles virus fusion protein and other measles virus components;
rubella viral antigens such as proteins E1 and E2 and other rubella
virus components; rotaviral antigens such as VP7sc and other
rotaviral components; cytomegaloviral antigens such as envelope
glycoprotein B and other cytomegaloviral antigen components;
respiratory syncytial viral antigens such as the RSV fusion
protein, the M2 protein and other respiratory syncytial viral
antigen components; herpes simplex viral antigens such as immediate
early proteins, glycoprotein D, and other herpes simplex viral
antigen components; varicella zoster viral antigens such as gpI,
gpII, and other varicella zoster viral antigen components; Japanese
encephalitis viral antigens such as proteins E, M-E, M-E-NS 1, NS
1, NS 1-NS2A, 80% E, and other Japanese encephalitis viral antigen
components; rabies viral antigens such as rabies glycoprotein,
rabies nucleoprotein and other rabies viral antigen components. See
Fundamental Virology, Second Edition, e's. Fields, B. N. and Knipe,
D. M. (Raven Press, New York, 1991) for additional examples of
viral antigens.
[0424] 2. Bacterial Antigens
[0425] Bacterial antigens which can be used in the compositions and
methods of the invention include, but are not limited to, pertussis
bacterial antigens such as pertussis toxin, filamentous
hemagglutinin, pertactin, FIM2, FIM3, adenylate cyclase and other
pertussis bacterial antigen components; diptheria bacterial
antigens such as diptheria toxin or toxoid and other diphtheria
bacterial antigen components; tetanus bacterial antigens such as
tetanus toxin or toxoid and other tetanus bacterial antigen
components; streptococcal bacterial antigens such as M proteins and
other streptococcal bacterial antigen components; gram-negative
bacilli bacterial antigens such as lipopolysaccharides and other
gram-negative bacterial antigen components; Mycobacterium
tuberculosis bacterial antigens such as mycolic acid, heat shock
protein 65 (HSP65), the 30 kDa major secreted protein, antigen 85A
and other mycobacterial antigen components; Helicobacter pylori
bacterial antigen components; pneumococcal bacterial antigens such
as pneumolysin, pneumococcal capsular polysaccharides and other
pneumococcal bacterial antigen components; hemophilus influenza
bacterial antigens such as capsular polysaccharides and other
hemophilus influenza bacterial antigen components; anthrax
bacterial antigens such as anthrax protective antigen and other
anthrax bacterial antigen components; rickettsiae bacterial
antigens such as romps and other rickettsiae bacterial antigen
component. Also included with the bacterial antigens described
herein are any other bacterial, mycobacterial, mycoplasmal,
rickettsial, or chlamydial antigens.
[0426] 3. Fungal Antigens
[0427] Fungal antigens which can be used in the compositions and
methods of the invention include, but are not limited to, Candida
fungal antigen components; histoplasma fungal antigens such as heat
shock protein 60 (HSP60) and other histoplasma fungal antigen
components; cryptococcal fungal antigens such as capsular
polysaccharides and other cryptococcal fungal antigen components;
coccidiodes fungal antigens such as spherule antigens and other
coccidiodes fungal antigen components; and tinea fungal antigens
such as trichophytin and other coccidiodes fungal antigen
components.
[0428] 4. Parasite Antigens
[0429] Examples of protozoa and other parasitic antigens include,
but are not limited to, plasmodium falciparum antigens such as
merozoite surface antigens, sporozoite surface antigens,
circumsporozoite antigens, gametocyte/gamete surface antigens,
blood-stage antigen pf 1 55/RESA and other plasmodial antigen
components; toxoplasma antigens such as SAG-1, p30 and other
toxoplasma antigen components; schistosomae antigens such as
glutathione-S-transferase, paramyosin, and other schistosomal
antigen components; leishmania major and other leishmaniae antigens
such as gp63, lipophosphoglycan and its associated protein and
other leishmanial antigen components; and trypanosoma cruzi
antigens such as the 75-77 kDa antigen, the 56 kDa antigen and
other trypanosomal antigen components.
[0430] 5. Tumor antigens.
[0431] Tumor antigens which can be used in the compositions and
methods of the invention include, but are not limited to,
telomerase components; multidrug resistance proteins such as
P-glycoprotein; MAGE-1, alpha fetoprotein, carcinoembryonic
antigen, mutant p53, immunoglobulins of B-cell derived
malignancies, fusion polypeptides expressed from genes that have
been juxtaposed by chromosomal translocations, human chorionic
gonadotrpin, calcitonin, tyrosinase, papillomavirus antigens,
gangliosides or other carbohydrate-containing components of
melanoma or other tumor cells. It is contemplated by the invention
that antigens from any type of tumor cell can be used in the
compositions and methods described herein.
[0432] 6. Antigens Relating to Autoimmunity.
[0433] Antigens involved in autoimmune diseases, allergy, and graft
rejection can be used in the compositions and methods of the
invention. For example, an antigen involved in any one or more of
the following autoimmune diseases or disorders can be used in the
present invention: diabetes mellitus, arthritis (including
rheumatoid arthritis, juvenile rheumatoid arthritis,
osteoarthritis, psoriatic arthritis), multiple sclerosis,
myasthenia gravis, systemic lupus erythematosis, autoimmune
thyroiditis, dermatitis (including atopic dermatitis and eczematous
dermatitis), psoriasis, Sjogren's Syndrome, including
keratoconjunctivitis sicca secondary to Sjogren's Syndrome,
alopecia areata, allergic responses due to arthropod bite
reactions, Crohn's disease, aphthous ulcer, iritis, conjunctivitis,
keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma,
cutaneous lupus erythematosus, scleroderma, vaginitis, proctitis,
drug eruptions, leprosy reversal reactions, erythema nodosum
leprosum, autoimmune uveitis, allergic encephalomyelitis, acute
necrotizing hemorrhagic encephalopathy, idiopathic bilateral
progressive sensorineural hearing loss, aplastic anemia, pure red
cell anemia, idiopathic thrombocytopenia, polychondritis, Wegener's
granulomatosis, chronic active hepatitis, Stevens-Johnson syndrome,
idiopathic sprue, lichen planus, Crohn's disease, Graves
opthalmopathy, sarcoidosis, primary biliary cirrhosis, uveitis
posterior, and interstitial lung fibrosis. Examples of antigens
involved in autoimmune disease include glutamic acid decarboxylase
65 (GAD 65), native DNA, myelin basic protein, myelin proteolipid
protein, acetylcholine receptor components, thyroglobulin, and the
thyroid stimulating hormone (TSH) receptor. Examples of antigens
involved in allergy include pollen antigens such as Japanese cedar
pollen antigens, ragweed pollen antigens, rye grass pollen
antigens, animal derived antigens such as dust mite antigens and
feline antigens, histocompatiblity antigens, and penicillin and
other therapeutic drugs. Examples of antigens involved in graft
rejection include antigenic components of the graft to be
transplanted into the graft recipient such as heart, lung, liver,
pancreas, kidney, and neural graft components. An antigen can also
be an altered peptide ligand useful in treating an autoimmune
disease.
[0434] Examples of miscellaneous antigens which can be can be used
in the compositions and methods of the invention include endogenous
hormones such as luteinizing hormone, follicular stimulating
hormone, testosterone, growth hormone, prolactin, and other
hormones, drugs of addiction such as cocaine and heroin, and
idiotypic fragments of antigen receptors such as Fab-containing
portions of an anti-leptin receptor antibody.
Determination of Binding of a Multifunctional Molecule to a Antigen
Bearing Target or APC
[0435] Multiple techniques are known to those of skill in the art
for detecting protein-protein binding. That is, the binding of a
multifunctional molecule of the invention to either or both of an
antigen bearing target and an APC.
[0436] The association between the multifunctional molecule and an
antigen bearing target and/or an APC may be measured for example by
Fluorescent Resonance Energy Transfer (FRET), wherein one peptide
(i.e., the multifunctional molecule) comprises a fluorescent label
moiety, and the antigen bearing target or APC harbours a second
such moiety, and where excitation at an appropriate wavelength may
result in absorption of photons by one label, followed by FRET, and
emission at a second wavelength characteristic of the second
fluorophore, this emission being measured and corresponding to the
amount of antigen bearing target or APC which is associated with
the multifunctional molecule. Alternatively, this association may
be measured in one of many other ways which are described more
fully below.
[0437] A "fluorescent tag" or "fluorescent group" refers to either
a fluorophore or a fluorescent protein or fluorescent fragment
thereof, or refers to a fluorescent amino acid such as tryptophan
which may be incorporated into a polypeptide. "Fluorescent protein"
refers to any protein which fluoresces when excited with
appropriate electromagnetic radiation. This includes proteins whose
amino acid sequences are either natural or engineered.
[0438] It is additionally preferred that the fluorophores comprise
fluorescein and tetramethylrhodamine or another suitable pair. In
another preferred embodiment, the label comprises two different
fluorescent proteins. It is preferred that fluorescent proteins
comprise any protein selected from the group consisting of green
fluorescent protein (GFP), blue fluorescent protein, red
fluorescent protein and other engineered forms of GFP.
[0439] Preferably, the polypeptide comprises a cysteine amino acid
through which the label is attached via a covalent bond. More
preferably, the label may be attached via a primary amine group
such as via a lysine residue. As will be apparent to a person
skilled in the art, it is preferable to avoid using the same
chemistry for both labelling and immobilising polypeptides of the
invention. For example, if the polypeptide is immobilised via
cysteine residues, the label is advantageously attached via lysine
residues.
[0440] Preferably, the measuring is performed by fluorescent
resonance energy transfer (FRET), fluorescence anisotropy or
fluorescence correlation spectroscopy, or by measuring the binding
of a fluorescent partner polypeptide to an immobilised polypeptide.
Techniques for performing such measurements are well known to those
of skill in the art.
[0441] It is preferred that the fluorescence emitting means
comprise two different fluorophores, and particularly preferred
that the fluorophores comprise fluorescein and tetramethylrhodamine
or another suitable pair.
[0442] As used herein with regard to fluorescent labels for use in
FRET, the term "appropriate combination" refers to a choice of
reporter labels such that the emission wavelength spectrum of one
(the "donor" moiety) is within the excitation wavelength spectrum
of the other (the "acceptor" moiety).
[0443] Methods of detection without use of label are known in the
art. These include detection using surface plasmon resonance to
detect changes in the mass of, for example the multifunctional
molecule, which would occur if binding of the partner polypeptide
increased or decreased. Such measurements may be made for example
using a BIACORE machine. In this embodiment, the multifunctional
molecule is immobilized on a solid support prior to contacting the
molecule with the antigen bearing moiety and/or APC.
[0444] In addition to the above methods, one technique for
determining the binding of a multifunctional molecule of the
invention to an antigen bearing moiety and/or and APC involves the
use of antibodies specifically directed to the multifunctional
molecule. Briefly, antigen bearing cells, for example, are
incubated with the multifunctional molecule of the invention in
RPMI 1640, or other suitable buffer, for 1-4 hours at 37.degree. C.
with shaking. The cells are then washed in PBS containing 2% FBS,
or other cell culture serum. The antigen bearing cells are then
incubated with, for example, an FITC labeled anti-multifunctional
molecule antibody for 1 hour at 4.degree. C. After additional
washing in PBS, the cells are analyzed by flow cytometry, wherein
the identification of labeled cells is indicative of the binding of
the multifunctional molecule of the invention to the antigen
bearing cell.
Preparation of a Cell Containing a Recombinant Nucleic Acid
According to the Invention
[0445] In one embodiment of the present invention, a nucleic acid
molecule encoding a multifunctional molecule of the present
invention is introduced into a host cell capable of expressing the
nucleic acid molecule so as to produce the multifunctional
molecule. In one embodiment, the host cell is permitted to express
the nucleic acid ex vivo. In an alternate embodiment, the host cell
is transfected with the nucleic acid molecule encoding the
multifunctional molecule, and then placed back into the host animal
from which it was obtained, wherein the multifunctional polypeptide
molecule is expressed in vivo in the host animal.
[0446] Host cells are transfected, as taught herein, via
conventional methods well-known in the art. Suitable methods for
transforming or transfecting host cells can be found in Sambrook et
al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold
Spring Harbor Laboratory press (1989)), and other laboratory
manuals. Additional examples of methods of introducing nucleic acid
molecules encoding multifunctional molecules are described below.
The cells containing the introduced nucleic acid molecules
encoding, for example, multifunctional molecule and/or an antigen,
can themselves be administered to a subject (as the antigen)
according to the methods of the invention, e.g., in a vaccine
composition.
[0447] A. Introduction of Naked Nucleic Acid into Cells
[0448] 1. Transfection mediated by DEAE-dextran: Naked nucleic acid
can be introduced into cells by forming a mixture of the nucleic
acid and DEAE-dextran and incubating the mixture with the cells. A
dimethylsulfoxide or chloroquine shock step can be added to
increase the amount of nucleic acid uptake. DEAE-dextran
transfection is only applicable to in vitro modification of cells
and can be used to introduce nucleic acid transiently into cells
but is not preferred for creating stably transfected cells. Thus,
this method can be used for short term production of a gene product
but is not a method of choice for long-term production of a gene
product. Protocols for DEAE-dextran-mediated transfection can be
found in Current Protocols in Molecular Biology, Ausubel, F. M. et
al. (e's.) Greene Publishing Associates, (1989), Section 9.2 and in
Molecular Cloning: A Laboratory Manual. 2nd Edition. Sambrook et
al. Cold Spring Harbor Laboratory Press, (1989), Sections
16.41-16.46 or other standard laboratory manuals.
[0449] 2. Electroporation: Naked nucleic acid can also be
introduced into cells by incubating the cells and the nucleic acid
together in an appropriate buffer and subjecting the cells to a
high-voltage electric pulse. The efficiency with which nucleic acid
is introduced into cells by electroporation is influenced by the
strength of the applied field, the length of the electric pulse,
the temperature, the conformation and concentration of the nucleic
acid and the ionic composition of the media. Electroporation can be
used to stably (or transiently) transfect a wide variety of cell
types and is only applicable to in vitro modification of cells.
Protocols for electroporating cells can be found in Current
Protocols in Molecular Biology, Ausubel, F. M. et al. (e's.) Greene
Publishing Associates, (1989), Section 9.3 and in Molecular
Cloning: A Laboratory Manual, 2nd Edition, Sambrook et al. Cold
Spring Harbor Laboratory Press, (1989), Sections 16.54-16.55 or
other standard laboratory manuals.
[0450] 3. Liposome-mediated transfection ("lipofection"): Naked
nucleic acid can be introduced into cells by mixing the nucleic
acid with a liposome suspension containing cationic lipids. The
nucleic acid/liposome complex is then incubated with cells.
Liposome mediated transfection can be used to stably (or
transiently) transfect cells in culture in vitro. Protocols can be
found in Current Protocols in Molecular Biology, Ausubel, F. M. et
al. (e's.) Greene Publishing Associates, (1989), Section 9.4 and
other standard laboratory manuals. Additionally, gene delivery in
vivo has been accomplished using liposomes. See for example Nicolau
et al. (1987) Meth. Enz. 149:157-176; Wang and Huang (1987) Proc.
Natl. Acad. Sci. SA 84:7851-785S; Brigham et al. (1989) Am. J. Med.
Sci. 298:278; and Gould-Fogerite et al. (1989) Gene 84:429-438.
[0451] 4. Direct Injection: Naked nucleic acid can be introduced
into cells by directly injecting the nucleic acid into the cells.
For an in vitro culture of cells, nucleic acid can be introduced by
microinjection. Since each cell is microinjected individually, this
approach is very labor intensive when modifying large numbers of
cells. However, a situation wherein microinjection is a method of
choice is in the production of transgenic animals (discussed in
greater detail below). In this situation, the nucleic acid is
stably introduced into a fertilized oocyte which is then allowed to
develop into an animal. The resultant animal contains cells
carrying the nucleic acid introduced into the oocyte. Direct
injection has also been used to introduce naked nucleic acid into
cells in vivo (see e.g., Acsadi et al. (1991) Nature 332: 815-818;
Wolff et al. (1990) Science 247:1465-1468). A delivery apparatus
(e.g., a "gene gun") for injecting DNA into cells in vivo can be
used. Such an apparatus is commercially available (e.g., from
BioRad).
[0452] 5. Receptor-Mediated DNA Uptake: Naked nucleic acid can also
be introduced into cells by complexing the nucleic acid to a
cation, such as polylysine, which is coupled to a ligand for a
cell-surface receptor (see for example Wu, G. and Wu, C. H. (1988)
J. Biol. Chem. 263:14621; Wilson et al. (1992) J. Biol. Chem.
267:963-967; and U.S. Pat. No. 5,166,320). Binding of the nucleic
acid-ligand complex to the receptor facilitates uptake of the
nucleic acid by receptor-mediated endocytosis. Receptors to which a
nucleic acid-ligand complex have targeted include the transferrin
receptor and the asialoglycoprotein receptor. A nucleic acid-ligand
complex linked to adenovirus capsids which naturally disrupt
endosomes, thereby releasing material into the cytoplasm can be
used to avoid degradation of the complex by intracellular lysosomes
(see for example Curiel et al. (1991) Proc. Natl. Acad. Sci. USA
88:8850; Cristiano et al. (1993) Proc. Natl. Acad. Sci. USA
90:2122-2126). Receptor-mediated nucleic acid uptake can be used to
introduce nucleic acid into cells either in vitro or in vivo and,
additionally, has the added feature that nucleic acid can be
selectively targeted to a particular cell type by use of a ligand
which binds to a receptor selectively expressed on a target cell of
interest.
[0453] Generally, when naked nucleic acid is introduced into cells
in culture (e.g., by one of the transfection techniques described
above) only a small fraction of cells (about 1 out of 105)
typically integrate the transfected nucleic acid into their genomes
(i.e., the nucleic acid is maintained in the cell episomally).
Thus, in order to identify cells which have taken up exogenous
nucleic acid, it is advantageous to transfect nucleic acid encoding
a selectable marker into the cell along with the nucleic acid(s) of
interest. Preferred selectable markers include those which confer
resistance to drugs such as G418, hygromycin and methotrexate.
Alternatively, a selectable marker maybe one which emits a
detectable signal upon expression such as green fluorescen protein
or blue fluorescent protein. Selectable markers may be introduced
on the same plasmid as the gene(s) of interest or may be introduced
on a separate plasmid.
[0454] B. Viral-Mediated Gene Transfer
[0455] A preferred approach for introducing nucleic acid encoding a
gene product into a cell is by use of a viral vector containing
nucleic acid, e.g. a cDNA, encoding the gene product. Infection of
cells with a viral vector has the advantage that a large proportion
of cells receive the nucleic acid, which can obviate the need for
selection of cells which have received the nucleic acid.
Additionally, molecules encoded within the viral vector, e.g., by a
cDNA contained in the viral vector, are expressed efficiently in
cells which have taken up viral vector nucleic acid and viral
vector systems can be used either in vitro or in vivo.
[0456] 1. Retroviruses: Defective retroviruses are well
characterized for use in gene transfer for gene therapy purposes
(for a review see Miller, A. D. (1990) Blood 76:271). A recombinant
retrovirus can be constructed having a nucleic acid encoding a gene
product of interest inserted into the retroviral genome.
Additionally, portions of the retroviral genome can be removed to
render the retrovirus replication defective. The replication
defective retrovirus is then packaged into virions which can be
used to infect a target cell through the use of a helper virus by
standard techniques. Protocols for producing recombinant
retroviruses and for infecting cells in vitro or in vivo with such
viruses can be found in Current Protocols in Molecular Biology,
Ausubel, F. M. et al. (eds.) Greene Publishing Associates, (1989),
Sections 9.10-9.14 and other standard laboratory manuals. Examples
of suitable retroviruses include pLJ, pZIP, pWE and pEM which are
well known to those skilled in the art. Examples of suitable
packaging virus lines include .phi.Crip, .phi.Cre, .sub.--2, and
_Am. Retroviruses have been used to introduce a variety of genes
into many different cell types, including epithelial cells,
endothelial cells, lymphocytes, myoblasts, hepatocytes, bone marrow
cells, in vitro and/or in vivo (see for example Eglitis, et al.
(1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl.
Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad.
Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad.
Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci.
USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA
88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van
Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644;
Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992)
Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et al. (1993) J.
Immunol. 150:4104-115; U.S. Pat. No. 4,868,116; U.S. Pat. No.
4,980,286; PCT Application WO 89/07136; PCT Application WO
89/02468; PCT Application WO 89/05345; and PCT Application WO
92/07573). Retroviral vectors require target cell division in order
for the retroviral genome (and foreign nucleic acid inserted into
it) to be integrated into the host genome to stably introduce
nucleic acid into the cell. Thus, it may be necessary to stimulate
replication of the target cell.
[0457] 2. Adenoviruses: The genome of an adenovirus can be
manipulated such that it encodes and expresses a gene product of
interest but is inactivated in terms of its ability to replicate in
a normal lytic viral life cycle. See for example Berkner et al.
(1988) BioTechniques 6:616; Rosenfeld et al. (1991) Science
252:431-434; and Rosenfeld et al. (1992) Cell 68:143-155. Suitable
adenoviral vectors derived from the adenovirus strain Ad type 5
d1324 or other strains of adenovirus (e.g., Adz, Ad3, Ad7 etc.) are
well known to those skilled in the art. Recombinant adenoviruses
are advantageous in that they do not require dividing cells to be
effective gene delivery vehicles and can be used to infect a wide
variety of cell types, including airway epithelium (Rosenfeld et
al. (1992) cited supra), endothelial cells (Lemarchand et al.
(1992) Proc. Natl. Acad. Sci. USA 89:6482-6486), hepatocytes (Herz
and Gerard (1993) Proc. Natl. Acad. Sci. USA 90:2812-2816) and
muscle cells (Quantin et al. (1992) Proc. Natl. Acad. Sci. USA
89:2581-2584). Additionally, introduced adenoviral nucleic acid
(and foreign DNA contained therein) is not integrated into the
genome of a host cell but remains episomal, thereby avoiding
potential problems that can occur as a result of insertional
mutagenesis in situations where introduced nucleic acid becomes
integrated into the host genome (e.g., retroviral DNA). Moreover,
the carrying capacity of the adenoviral genome for foreign DNA is
large (up to 8 kilobases) relative to other gene delivery vectors
(Berkner et al. cited supra; Haj-Ahmand and Graham (1986) J. Virol.
57:267). Most replication-defective adenoviral vectors currently in
use are deleted for all or parts of the viral E1 and E3 genes but
retain as much as 80% of the adenoviral genetic material.
[0458] 3. Adeno-Associated Viruses: Adeno-associated virus (AAV) is
a naturally occurring defective virus that requires another virus,
such as an adenovirus or a herpes virus, as a helper virus for
efficient replication and a productive life cycle. (For a review
see Muzyczka et al. Curr. Topics in Micro. and Immunol. (1992)
158:97-129). It is also one of the few viruses that may integrate
its DNA into non-dividing cells, and exhibits a high frequency of
stable integration (see for example Flotte et al. (1992) Am. J.
Respir. Cell. Mol. Biol. 7:349-356; Samulski et al. (1989) J.
Virol. 63:3822-3828; and McLaughlin et al. (1989) J. Virol
62:1963-1973). Vectors containing as little as 300 base pairs of
AAV can be packaged and can integrate. Space for exogenous nucleic
acid is limited to about 4.5 kb. An AAV vector such as that
described in Tratschin et al. (1985) Mol. Cell. Biol. 5:3251-3260
can be used to introduce nucleic acid into cells. A variety of
nucleic acids have been introduced into different cell types using
AAV vectors (see for example Hermonat et al. (1984) Proc. Natl.
Acad. Sci. USA 81:6466-6470; Tratschin et al. (1985) Mol. Cell.
Biol. 4:2072-2081; Wondisford et al. (1988) Mol. Endocrinol.
2:32-39; Tratschin et al. (1984) J. Virol. 51:611-619; and Flotte
et al. (1993) J. Biol. Chem. 268:3781-3790).
[0459] The efficacy of a particular expression vector system and
method of introducing nucleic acid into a cell can be assessed by
standard approaches routinely used in the art. For example, nucleic
acid introduced into a cell can be detected by a filter
hybridization technique (e.g., Southern blotting) and RNA produced
by transcription of introduced nucleic acid can be detected, for
example, by Northern blotting, RNase protection or reverse
transcriptase-polymerase chain reaction (RI-PCR). The gene product
can be detected by an appropriate assay, for example by
immunological detection of a produced protein, such as with a
specific antibody, or by a functional assay to detect a functional
activity of the gene product, such as an enzymatic assay. If the
gene product of interest to be expressed by a cell is not readily
assayable, an expression system can first be optimized using a
reporter gene linked to the regulatory elements and vector to be
used. The reporter gene encodes a gene product which is easily
detectable and, thus, can be used to evaluate the efficacy of the
system. Standard reporter genes used in the art include genes
encoding beta-galactosidase, chloramphenicol acetyl transferase,
luciferase and human growth hormone.
Cells Useful According to the Invention
[0460] The invention provides for host cells transfected with
nucleic acid constructs encoding a multifunctional molecule of the
invention. Host cells useful in the invention include but are not
limited to the following.
[0461] A host cell can be any cell which is able to act as a
carrier for an antigen according to the invention and thus may be a
nucleated cell or a procaryotic cell into which nucleic acid can be
artificially introduced. Procaryotic cells useful according to the
invention include bacterial cells. Eucaryotic (nucleated) cells
useful according to the invention include cells of a yeast, fungus,
cells of a parasite and mammalian cells. Mammalian cells useful
according to the invention include but are not limited to
fibroblasts, including specialized mesenchymal cells such as a
synoviocytes; keratinocytes, epithelial cells, endothelial cells,
leukocytes and tumor cells.
[0462] Cell lines useful according to the invention include but are
not limited to B16, CMS-5 fibrosarcoma cells, Cos1 cells and CHO
cells, TS/A, Lewis lung carcinoma, RENCA, Dunning rat prostate
carcinoma, and cell lines included in the catalogue of the American
Type Culture Collection (Manassas, Va.).
[0463] Host cells comprising a nucleic acid molecule encoding a
multifunctional molecule of the invention can be prepared from
pathogenic cells according to the invention. Pathogenic cells
include tumor cells (e.g. B16 cells, CMS-5 fibrosarcoma cells, and
cells derived from the tumors included in the section entitled
"Tumors for which the Invention is Useful"), and cells derived from
pathogenic bacterium, pathogenic fungus, pathogenic virus,
pathogenic parasite, or a pathogenic arthropod.
Methods of Detecting Expression from an Artificially Introduced
Recombinant Nucleic Acid Sequence
[0464] The invention provides for methods of detecting a protein
(e.g., a multifunctional molecule) that is expressed from a
recombinant nucleic acid molecule that has been artificially
introduced into a cell.
[0465] Preparation of Antibodies
[0466] Antibodies specific for a protein useful according to the
invention (e.g., a multifunctional molecule) are useful for protein
purification, and for the detection of expression of these proteins
from cells into which a recombinant nucleic acid molecule
expressing these proteins has been artificially introduced. By
antibody, we include constructions using the binding (variable)
region of such an antibody, and other antibody modifications. Thus,
an antibody useful in the invention may comprise a whole antibody,
an antibody fragment, a polyfunctional antibody aggregate, or in
general a substance comprising one or more specific binding sites
from an antibody. The antibody fragment may be a fragment such as
an Fv, Fab or F(ab').sub.2 fragment or a derivative thereof, such
as a single chain Fv fragment. The antibody or antibody fragment
may be non-recombinant, recombinant or humanized. The antibody may
be of an immunoglobulin isotype, e.g., IgG, IgM, and so forth. In
addition, an aggregate, polymer, derivative and conjugate of an
immunoglobulin or a fragment thereof can be used where
appropriate.
[0467] Although a protein product (or fragment or oligopeptide
thereof) of a protein according to the invention (e.g., a
multifunctional molecule according to the invention) that is useful
for the production of antibodies does not require biological
activity, it must be antigenic. Antibodies may be directed to any
portion of the multifunctional molecule of the invention. For
example, an antibody may be directed to the lecting portion of the
multifunctional molecule or to the ligand portion of the
multifunctional molecule. Peptides used to induce specific
antibodies may have an amino acid sequence consisting of at least
five amino acids and preferably at least 10 amino acids.
Preferably, they should be identical to a region of the natural
protein and may contain the entire amino acid sequence of a small,
naturally occurring molecule. Short stretches of amino acids
corresponding to the protein product of a recombinant nucleic acid
encoding a protein useful according to the invention (e.g., a
multifunctional molecule according to the invention) may be fused
with amino acids from another protein such as keyhole limpet
hemocyanin or GST, and antibody will be produced against the
chimeric molecule. Procedures well known in the art can be used for
the production of antibodies to the protein products of recombinant
nucleic acids of the invention.
[0468] For the production of antibodies, various hosts including
goats, rabbits, rats, mice etc. . . . may be immunized by injection
with the protein products (or any portion, fragment, or
oligonucleotide thereof which retains immunogenic properties) of
the recombinant nucleic acid molecules encoding proteins useful
according to the invention. Depending on the host species, various
adjuvants may be used to increase the immunological response. Such
adjuvants include but are not limited to Freund's, mineral gels
such as aluminum hydroxide, and surface active substances such as
lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanin, and dinitrophenol. BCG
(bacilli Calmette-Guerin) and Corynebacterium parvum are
potentially useful human adjuvants.
[0469] I. Polyclonal Antibodies.
[0470] The antigen protein may be conjugated to a conventional
carrier in order to increase its immunogenicity, and an antiserum
to the peptide-carrier conjugate will be raised. Coupling of a
peptide to a carrier protein and immunizations may be performed as
described (Dymecki et al., 1992, J. Biol. Chem., 267: 4815). The
serum can be titered against protein antigen by ELISA (below) or
alternatively by dot or spot blotting (Boersma and Van Leeuwen,
1994, J. Neurosci. Methods, 51: 317). At the same time, the
antiserum may be used in tissue sections prepared as described. A
useful serum will react strongly with the appropriate peptides by
ELISA, for example, following the procedures of Green et al., 1982,
Cell, 28: 477.
[0471] 2. Monoclonal Antibodies.
[0472] Techniques for preparing monoclonal antibodies are well
known, and monoclonal antibodies may be prepared using a candidate
antigen (e.g., a mulispecific molecule or a lectin whose level is
to be measured or which is to be either inactivated or
affinity-purified, preferably bound to a carrier, as described by
Arnheiter et al., 1981, Nature, 294; 278.
[0473] Monoclonal antibodies are typically obtained from hybridoma
tissue cultures or from ascites fluid obtained from animals into
which the hybridoma tissue was introduced.
[0474] Monoclonal antibody-producing hybridomas (or polyclonal
sera) can be screened for antibody binding to the target
protein.
[0475] 3. Antibody Detection Methods
[0476] Particularly preferred immunological tests rely on the use
of either monoclonal or polyclonal antibodies and include
enzyme-linked immunoassays (ELISA), immunoblotting and
immunoprecipitation (see Voller, 1978, Diagnostic Horizons, 2:1,
Microbiological Associates Quarterly Publication, Walkersville,
Md.; Voller et al., 1978, J. Clin. Pathol., 31: 507; U.S. Reissue
Pat. No. 31,006; UK Patent 2,019,408; Butler, 1981, Methods
Enzymol., 73: 482; Maggio, E. (ed.), 1980, Enzyme Immunoassay, CRC
Press, Boca Raton, Fla.) or radioimmunoassays (RIA) (Weintraub, B.,
Principles of radioimmunoassays, Seventh Training Course on
Radioligand Assay Techniques, The Endocrine Society, March 1986,
pp. 1-5, 46-49 and 68-78). For analysing tissues for the presence
or absence of a protein produced by a recombinant nucleic acid
encoding a protein useful according to the invention (e.g.,
multifunctional molecule or portion thereof), immunohistochemistry
techniques may be used. It will be apparent to one skilled in the
art that the antibody molecule may have to be labelled to
facilitate easy detection of a target protein. Techniques for
labelling antibody molecules are well known to those skilled in the
art (see Harlow and Lane, 1989, Antibodies, Cold Spring Harbor
Laboratory).
Determining Whether an Immune Response is Modulated According to
the Invention
[0477] The multifunctional molecules described herein are useful
according to the invention to modulate an immune response in a
mammalian, preferably a human, to an antigen or antigens contained
in the antigen bearing target which is bound to the lectin portion
of the multifunctional molecule. In one embodiment, a composition
comprising a multifunctional molecule bound to an antigen bearing
target is administered to an animal, preferably a human. The second
portion of the multifunctional molecule comprising a ligand for a
cell-surface molecule of an APC targets the composition to antigen
presenting cells in the animal to which the composition has been
administered. The antigen bearing target is taken up (i.e.,
ingested or phagocytosed) by antigen presenting cells.
Alternatively, the multifunctional molecule/antigen bearing target
complex is contacted with antigen presenting cells in vitro under
conditions which allow phagocytosis, wherein the APCs are
subsequently returned to the host organism from which they were
derived.
[0478] The present invention thus provides a method for modulating
an immune response in an mammal comprising administering to the
mammal a composition comprising at least a multifunctional molecule
as described herein. In one embodiment, the composition further
comprises an antigen bearing target. In a further embodiment, the
composition still further comprises an APC.
[0479] An "immune response" refers to stimulation/activation of a
selected response involving the immune system, or suppression,
elimination, or attenuation of a selected response. In a preferred
embodiment, an immune response refers to stimulation/activation of
a selected response involving the immune system by about at least
5%, or preferably between 5 and 50% or more preferably between 50
and 100% or at least 100% or greater, or suppression, elimination,
or attenuation of a selected response by about at least 5%, or
preferably between 5 and 50% or more preferably between 50 and 100%
or at least 100% or greater, as compared to control cells that are
not CD 40-ligand enhanced cells. Thus, to modulate an immune
response means that the desired response is more efficient, more
rapid, greater in magnitude, and/or more easily induced than when
an antigen bearing target is contacted with an APC in the absence
of a multifunctional molecule. Different immune responses in the
subject may be modulated differentially, e.g., the cellular immune
response may be selectively enhanced while the humoral response may
be selectively attenuated, and vice versa.
[0480] The following in vitro and in vivo assays are useful for
determining whether an immune response is modulated according to
the invention. The assays described in detail below measure
stimulation or suppression of cellular or humoral immune responses
to an antigen. The antigens referred to in the following assays are
representative. It will be apparent to one of skill in the art that
an immune response to a selected antigen useful according to the
invention may be measured using one or more of the following assays
by adapting the assay to that antigen.
[0481] I. Detection of Increased Phagocytosis
[0482] The following assay may be used in order to determine
whether opsonin-enhanced cells stimulate phagocytosis by antigen
presenting cells.
[0483] Phagocytosis is examined using monocytes that have been
adhered at 37.degree. for 30 min in RPMI without added FCS. Sheep
erythrocytes are incubated with an opsonin, or its precursor, under
conditions such that there are no more than 300 of such molecules,
on average, are deposited on each erythrocyte. If a precursor is
used, coated erythrocytes are then processed to convert all
precursors to the actual candidate molecule (e.g., See Carlo et
al., J. Immunol. 123:523-8 (1979)). Fresh monocytes are isolated
from the subject, and 5.times.10.sup.4-1.times.10.sup.5 of these
cells suspended in 0.25-0.5 ml of RPMI medium with 1% BSA. This
aliquot is placed in a tissue culture well and incubated for 30 min
at 37.degree. C. An excess of coated erythrocytes, suspended at
1.2.times.10.sup.8 cells/ml, is overlain on the monocytes, the
plate is centrifuged for 5 min at 50 g, and incubated for 30 min at
37.degree. C. Non-ingested material is removed in two hypotonic
lysis steps using ice-cold lysing buffer before fixing and staining
the adherent cells, and examining the cells under light microscopy.
Phagocytosis is quantified by determining the percentage of 100
monocytes ingesting one or more target cells, and the total number
of ingested E/100 monocyptes (PI) is recorded. Stimulation of
phagocytosis according to the invention is indicated by a
phagocytic index of equal to or greater than 40.
[0484] Another assay for phagocytosis is as follows: Cells of the
murine macrophage line are harvested and suspended in DMEM-10 at
4.times.10.sup.5/ml. 2.0 ml of this suspension is aliquoted into
individual 3.5 cm cell culture plates, and the dishes incubated at
37.degree. C. in 5% CO.sub.2 overnight. Target cells, as well as
control cells, are harvested on the same day as the macrophages,
washed in PBS, and resuspended 2 min in PKH26 dye (a 2 .mu.M
solution in 1 ml of the supplied diluent) at 5.times.10.sup.6
cells/ml. The fluorescent PKH26 dye emits in the red spectrum when
excited, whereas the FITC label that is used for the phagocytes
emits in the green spectrum. PKH26 is stable in the
endosomal/lysosomal compartment of phagocytes. The dyed target
cells are washed 3 times with PBS and cultured overnight to allow
leaching of PKH26 out into the medium. This minimizes leakage of
dye during the assay. The following day the target cells are
harvested, washed 3 times with PBS, and resuspended in serum-free
DMEM at 5.times.10.sup.5/ml. The phagocytic cells are rinsed
vigorously with PBS on the culture plates in order to remove serum,
and 2 ml of target cells is added to each plate After 0, 2, 4, or 8
h, the plates are rinsed 3 times with PBS to remove all non-adhered
cells and the remaining cells are incubated with 2 mM EDTA to
release them from the plate. The released cells are washed with 1%
FBS/PBS, and suspending in 100 .mu.l of the same buffer. 2 .mu.g
anti-phagocyte (e.g. anti-CR3) antibody is added and the cells
placed on ice for 25 min. The cells are washed 3 times with 1%
FBS/PBS, resuspended in 100 .mu.l of this solution, and stained
with a 1:25 dilution of FITC-conjugated secondary IgG for 25 min on
ice. Cells are washed 3 times and resuspended in 500 .mu.l 1%
FBS/PBS, then analyzed on a Becton Dickinson FACScan with CellQuest
software.
[0485] FL-1 (green) fluorescence is used to gate phagocytes. The
FL-2 (red) fluorescence of these cells, which reflects
internalization of PKH26-labeled target cells, is then measured.
Phagocytosis induced by, e.g., an opsonin is indicated by the
difference between mean FL-2 fluorescence of macrophages incubated
with opsonin-coated versus non-opsonin-coated target cells. Use of
an opsonin will increase mean FL-2 fluorescence by, e.g. at least
10%., or enough to obtain a p value less than or equal to 0.05 by
student t-test.
[0486] II. Amplification of the Immune Response Usually Involves
Proliferation of Particular Subpopulations of Lymphoid Cells that
are Normally in the Resting State.
[0487] Proliferative assays have the following applications in
clinical studies: (1) Assessment of overall immunologic competence
of T cells or B cells as manifested in their ability to respond to
polyclonal proliferation signals such as mitogens or anti-CD3
antibodies. Defects in the proliferation may be indicative of
fundamental cellular immunologic defect. Low proliferation is often
found as a nonspecific secondary effect of chronic disease. (2)
Assessment of an individual's response to specific antigens, where
low responses are indicative of general or specific immunologic
defect. (3) Determination of MHC compatibility by the mixed
lymphocyte reaction (MLR).
[0488] In addition, proliferative assays are useful for estimating
lymphokine production, investigating signal transduction, and
assessing growth factor requirements (e.g., lymphokines) for T or B
cells. The procedure outlined here measures incorporation of
[.sup.3H]thymidine into DNA, which usually correlates well with
cell growth as measured by changes in cell number. However, when
the activation stimulus is toxic, as with chemical activators such
as ionomycin plus phorbol myristate acetate (PMA), the burst of new
DNA synthesis following activation may not be accompanied with a
net increase in viable cells, and, in fact, a decline in cell
number may be observed. In this instance, [.sup.3H]thymidine
incorporation in DNA is more indicative of initial cell stimulation
than estimation of cell number. In addition, [.sup.3H]thymidine
incorporation provides information on cell populations, not on
individual cells. Alternate methods, such as flow cytometry may be
used for studies requiring that type of information.
[0489] Assay For Antigen-Induced T Cell Proliferation
[0490] This protocol is designed to test the proliferation of T
cells in response to a specific antigen--tetanus toxoid. It can be
modified to test T cell proliferation in response to any protein or
polysaccharide antigen. Materials: (T cell suspension, autologous
antigen-presenting cell suspension (non-T cells), Tetanus toxoid
solution (Connaught or State Laboratory Institute of
Massachusetts)). (1) Count T cells and adjust to 1.times.10.sup.6
cells/ml with complete RPMI-10 AB. (2) Treat antigen-presenting
cells with mitomycin C (or irradiate with 2500 rad) as in step 2 of
one-way MLR protocol. Adjust concentration of antigen-presenting
cells to 2.times.10.sup.5 cells/ml. Antigen-presenting cells can
consist of autologous non-T cells or autologous
monocytes/macrophages. (3) Add 100 ul T cell suspension and 50 ul
antigen-presenting cell population to wells; mix just before
dispensing. (4) Add 50 ul tetanus toxoid solution to give final
concentrations of 0, 1, 5, 10, and 20 ug/ml. Prepare three wells
for each dilution. (5) Incubate 6 days in a humidified 37.degree.
C., 5% CO.sub.2 incubator. (6) Pulse with [.sup.3H]thymidine and
harvest as described in support protocol.
[0491] Assay For Lymphokine-Dependent Cell Proliferation
[0492] This protocol assays the lymphokine-dependent proliferation
of a lymphocyte population, in this case, the IL-4 dependent
proliferation of B cells. Materials: (Tonsil B cell suspension,
Anti-IgM cross-linked to Sepharose beads (Bio-Rad), 10,000 U/ml
human rIL-4 (Genzyme) in complete RPMI-10). (1) Count tonsil B
cells and adjust concentration to 1.times.10.sup.6 cells/ml with
complete RPMI-10. (2) Dispense 100 ul of tonsil B cells into each
well. Prepare three wells for each experimental condition. (3)
Dilute 10,000 U/ml rIL-4 solution 1:10, 1:100, and 1:1000. Add 20
ul of the stock or dilution to appropriate wells to yield 1000
U/ml, 100 U/ml, 10 U/ml, and 1 U/ml. Include a control well with no
rIL-4. (4) Pipet anti-IgM beads into appropriate wells.
[0493] Determine the optimal concentration of beads with pilot
experiments. It is best to include several concentrations of beads
in each experiment to "bracket" the optimal dose. Prepare wells
with tonsil B cells and IL-4 dilutions alone, anti-IgM beads alone,
culture medium alone, and all the combinations of IL-4 and anti-IgM
bead dilutions. (5) Increase the volume of each well to 200 ul with
complete RPMI-10 as necessary. (6) Culture 5 days in a humidified
37.degree. C., 5% CO.sub.2 incubator. (7) Pulse with
[.sup.3H]thymidine and harvest as described in support
protocol.
[0494] [.sup.3H] Thymidine Pulse and Harvest of Cell Cultures
[0495] This protocol is used in conjunction with the preceding
protocols to complete the [.sup.3H] thymidine incorporation assay.
(1) Add 20 ul of 50 uCi/ml [.sup.3H]thymidine to each culture (1.0
uCi) at a fixed time before terminating the culture (usually 6 or
18 hr). (2) Harvest cell cultures using an automated multiwell
harvester that aspirates cells, lyses cells, and transfers DNA onto
filter paper, while allowing unincorporated [.sup.3H]thymidine to
wash out. Fill and aspirate each row of the microtiter plate ten
times to ensure complete cell transfer and complete removal of
unincorporated thymidine. Wash each filter strip with 100% ethanol
to facilitate drying. Transfer to scintillation vials. For
semiautomated harvester, transfer filter dots for each well into
scintillation counting vials. For manual transfer, dry filters
under lamp and transfer to scintillation vial with forceps. Add
scintillation fluid to each vial. (3) Count samples in
scintillation counter until standard deviation is less than 2%.
Calculate mean cpm for background cultures and for each
experimental condition. There should be less than 20% variation in
replicate cultures.
[0496] III. Induction and Measurement of In Vitro Antibody
Responses
[0497] The capacity of the human immune system to mount an antibody
response following in vivo immunization with a protein or
polysaccharide antigen is a revealing indication of the overall
integrity of both the B and T cell arms of the immune system. As
such, in vivo immunization followed by measurement of the antibody
response is an appropriate test of immune function in the various
acquired and congenital immunodeficiencies and in a host of other
conditions affecting the immune system. The following procedures
are for in vivo immunization and for the measurement of the
subsequent immune response using an ELISA technique.
[0498] Immuno-Enzymetric Assay for Cytokines Using NIP- and
HRPO-Labeled Antibodies
[0499] This protocol describes an immunonoenzymetric assay for
cytokines using a heterogeneous, noncompetitive immunoassay
reaction in which the cytokine is immobilized by a coating antibody
bound to a microtiter plate. Unbound material is washed free, and
detection is carried out using a different anti-cytokine antibody
labeled with the hapten nitroiodophenyl (NIP). This is in turn
detected by a horseradish peroxidase (HRPO) conjugate of an
anti-NIP antibody, which is revealed with the chromogenic substrate
ABTS. In this noncompetitive immunoassay, the immunoassay signal
(A.sub.405) increases as a direct function of the amount of
cytokine present in the sample. Antibodies are prepared as
described in Current Protocols in Immunology, 1995,
6.20.2-6.20.10.
[0500] Coat assay plate. (1) Using a multichannel pipettor,
transfer 100 ul of an appropriate dilution of coating antibody into
all wells of the assay plate that are to be used. (2) Seal plates
with microtiter plate sealer or Parafilm and incubate 2 hr. At
37.degree. C. Prepare samples and standards in preparation plate.
(3) Dilute each sample (or aliquot of conditioned medium) to be
assayed with an equal volume of immunoassay diluent. (4) Pipet less
than or equal to 1 ml of each diluted sample to be assayed into the
upper chamber of a separate Spin-X microfiltration device.
Microcentifuge 5 min. At 10,000 rpm and save the filtrates that
collect in the lower chambers. (5) Add 65 ul of each diluted sample
to the appropriate well of a preparation plate (i.e., a separate
96-well microtiter plate). (6) Thaw an aliquot of cytokine standard
at room temperature and make sure that it is well mixed. Pipet 130
ul into the well of the preparation plate representing the highest
concentration on the standard curve. Transfer 65 ul from this well
into the next, then continue performing serial 1:1 dilutions in
immunoassay diluent so that 65 ul of each concentration represented
on the standard curve is placed in appropriate well of the
preparation plate. (7) Thaw an aliquot of calibrator at room
temperature (if used). Dilute with an equal volume of immunoassay
diluent, then pipet 65 ul of diluted calibrator into appropriate
well or wells of preparation plate.
[0501] Incubate with coating antibody. (8) Remove coated assay
plate from incubator. Dip in 2-liter beaker filled with 1.times.
wash buffer, then invert over sink and flick to remove liquid.
Repeat two more times, then bang dry on paper towel. (9) Transfer
50 ul of solution from each well of preparation plate to
corresponding well of the assay plate using multichannel pipettor.
(10) Seal plate with microtiter plate sealer or Parafilm and
incubate 2 hr. at room temperature.
[0502] Incubate with detecting antibody. (11) Dilute NIP-labeled
detecting antibody specific to cytokine of interest to 1 ug/ml in
detecting buffer. (12) Wash assay plate as in step 8. (13) Add 75
ul diluted detecting antibody from step 11 to all wells of assay
plate, including unused outer walls. (14) Reseal plate with
microtiter plate sealer or Parafilm and incubate 1 hr. at room
temperature.
[0503] Incubate with HRPO-conjugated anti-NIP antibody. (15) Dilute
HRPO-conjugated anti-NIP Mab 1:3000 in detecting buffer. (16) Wash
assay plate as in step 8. (17) Add 75 ul of diluted HRPO-labeled
anti-NIP antibody from step 15 to all wells of assay plate. (18)
Reseal plate with microtiter plate sealer or Parafilm and incubate
1 hr. at room temperature.
[0504] Incubate with chromogenic substrate. (19) Wash assay plate
as in step 8. (20) Add 100 ul ABTS substrate working solutions to
all wells of assay plate. Cover plate and incubate at room
temperature until color development reaches desired level
(generally until A.sub.405 for wells containing the highest
concentration of standard is between 1.5 and 2). This protocol
usually produces an assay that can be read after 30 to 60 min.
[0505] Read plate and analyze data. (21) Using microtiter plate
reader with computer interface, measure absorbance in all wells at
405 nm in single-wavelength mode or at 405 and 650 nm in
dual-wavelength mode. (22) Fit standard data to a curve described
by a first-degree (linear), second degree (quadratic), or
four-parameter (nonlinear) mathematical function using
curve-fitting software. (23) Interpolate absorbance data from
unknown cytokine samples to fitted standard curve, and calculate
cytokine concentrations.
[0506] IV. Induction of an In Vivo Antibody Response Provides an
Approach to the Evaluation of the Overall Integrity of the Immune
System.
[0507] In the protocols presented here, diptheria and tetanus
toxoids are used as representative protein antigens and
pneumococcal polysaccharides are used as representative
polysaccharide antigens because of their safety and availability.
It should be noted, however, that the responses elicited by these
antigens are likely to be secondary responses because of past
vaccination or natural exposure. To obtain a primary response, an
unusual antigen such as keyhole limpet hemocyanin should be
used.
[0508] When antigens are administered by the intramuscular or
subcutaneous route, as they are here, a "systemic" immune response
is induced and measurement of circulating antibody is most
appropriate. It is, however, sometimes of interest to evaluate
"local" or mucosal immune responses. In this case, the antigen is
given either intranasally to stimulate respiratory lymphoid tissue
or orally to stimulate gastrointestinal lymphoid tissue and
bronchial washings or intestinal fluids, rather than blood, is
assayed for antibody content; in addition, antigens are used that
are more appropriate for stimulation of the local/mucosal response
(i.e., influenza virus antigen for respiratory responses and
cholera toxin for gastrointestinal responses).
[0509] In assaying the in vivo antibody response, it is important
to determine responses to both protein and polysaccharide antigens
because these antigens stimulate different components of the immune
system. In this regard, the major antibody response to protein
antigen is composed of IgG1 and IgG3 subclass antibodies, whereas
the major antibody response to polysaccharide antigen is composed
of IgG2 subclass antibody.
[0510] A variety of immunoassay techniques have been used to
measure antibody responses in materials obtained after in vivo
immunization. Of these, the ELISA assay is perhaps the most useful
because it yields a stable, easily measurable, reproducible, and
safe readout.
[0511] Induction of In Vivo Antibody Responses to
Protein/Polysaccharide Antigens
[0512] In this protocol antigens are administered by the
intramuscular or subcutaneous route and serum is collected for
measurement of responses. (1) Draw preimmunized blood sample, allow
blood to clot, and separate serum from clot by centrifugation.
Store serum at -20.degree. C. to -70.degree. C. in appropriately
labeled plastic tubes. (2) Inject 0.5 ml of toxoid mixture into an
appropriately prepared intramuscular site (deltoid or thigh),
taking care not to inject material intravenously. (3) Inject 0.5 ml
polyvalent pneumococcal vaccine into an appropriately prepared
subcutaneous site, taking care not to inject material
intravenously. (4) Draw post-immunization blood samples at desired
intervals, usually at 1, 2, and 3 weeks. Separate serum and store
at -20.degree. C. to -70.degree. C. (5) After all serum samples are
collected, assay samples for presence of antibodies using
ELISA.
[0513] The ELISA offers a rapid, sensitive, reproducible,
nonradioactive method for measuring in vivo antibody responses to a
variety of antigens, including protein and polysaccharide antigens
in sera obtained from individuals vaccinated with tetanus and
diphtheria boosters and the polyvalent pneumococcal polysaccharide
vaccine. Assays specific for tetanus, diphtheria and the
pneumococcal polysaccharide types I, II, and III are detailed in
Current Protocols in Immunology, 1995, Vols. 6 and 7.
[0514] Assay Using Tumor Rejection
[0515] In another assay for immunomodulation, an immunocompent
animal is vaccinated with on the order of 10.sup.4-10.sup.8
irradiated cytokine-coated tumor cells, and challenged with on the
order of 10.sup.4-10.sup.8 live wild-type tumor cells (in any
temporal sequence). If survival or tumor onset in these animals
differs from that of animal vaccinated, using identical parameters,
with irradiated non-cytokine coated cells instead of
opsonin-enhanced cells, immunomodulation has occurred. For example,
if at least 10% of the animals in the test group survive 100%
longer than mean survival in the control group, the test is
positive. As another example, onset of tumors in 20% of the test
animals might be 50% later than mean onset in the control
animals.
Dosage and Administration
[0516] The invention encompasses methods of modulating an immune
response in a mammal to a selected antigen, the method comprising
administering to a mammal a therapeutic amount of a composition
comprising a multifunctional molecule as described herein, or a
composition comprising a multifunctional molecule of the invention
and an antigen bearing target, or administering a composition
comprising a therapeutic amount of APCs which have been contacted
with a multifunctional molecule and antigen bearing target in
vitro.
[0517] Compositions described herein may be prepared as
injectables, either as liquid solutions or suspensions; solid forms
suitable for solution in or suspension in, liquid prior to
infection can also be prepared. The preparation can also be
emulsified, or encapsulated in liposomes. The active immunogenic
ingredients are often mixed with carriers which are
pharmaceutically acceptable and compatible with the active
ingredient. The term "pharmaceutically acceptable carrier" refers
to a carrier that does not cause an allergic reaction or other
untoward effect in subjects to whom it is administered. As used
herein, a "pharmaceutically acceptable carrier" does not include
culture medium, or any solution containing about 0.2-2% serum or
greater. Suitable pharmaceutically acceptable carriers include, for
example, one or more of water, saline, phosphate buffered saline,
dextrose, glycerol, ethanol, or the like and combinations thereof.
In addition, if desired, the vaccine can contain minor amounts of
auxiliary substances such as wetting or emulsifying agents, pH
buffering agents, and/or adjuvants which enhance the effectiveness
of the vaccine. Examples of adjuvants which may be effective
include but are not limited to: aluminum hydroxide,
N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP),
N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred
to as nor-MDP),
N-acetylmuramyl-L-alanyl-D-isoglutaminyl-alanine-2-1'-2'-dipalm-
itoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (COP) 19835A,
referred to as MTP-PE), and RIBI, which contains three components
extracted from bacteria, monophosphoryl lipid A, trehalose
dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2%
squalene/Tween 80 emulsion. Other examples of adjuvants include DDA
(dimethyldioctadecylammonium bromide), Freund's complete and
incomplete adjuvants and QuilA. In addition, immune modulating
substances such as lymphokines (e.g., IFN-, IL-2 and IL-12) or
synthetic IFN-inducers such as poly I:C can be used in combination
with adjuvants described herein.
[0518] Compositions of the invention can be administered
parenterally, by injection, for example, either subcutaneously or
intramuscularly. Additional formulations which are suitable for
other modes of administration include suppositories, and in some
cases, oral formulations or formulations suitable for distribution
as aerosols. In the case of the oral formulations, the manipulation
of T-cell subsets employing adjuvants, antigen packaging, or the
addition of individual cytokines to various formulations can result
in improved oral vaccines with optimized immune responses. For
suppositories, traditional binders and carriers may include, for
example, polyalkylene glycols or triglycerides; such suppositories
may be formed from mixtures containing the active ingredient in the
range of 0.5% to 10%, preferably 1%-2%. Oral formulations include
such normally employed excipients as, for example, pharmaceutical
grades of mannitol, lactose, starch magnesium stearate, sodium
saccharine, cellulose, magnesium carbonate, and the like. These
compositions take the form of solutions, suspensions, tablets,
pills, capsules, sustained release formulations or powders and
contain 10%-95% of active ingredient, preferably 25-70%.
[0519] The compositions of the invention can be formulated into the
vaccine compositions as neutral or salt forms. Pharmaceutically
acceptable salts include the acid addition salts (formed with free
amino groups of the peptide) and which are formed with inorganic
acids such as, for example, hydrochloric or phosphoric acids, or
with organic acids such as acetic, oxalic, tartaric, maleic, and
the like. Salts formed with the free carboxyl groups can also be
derived from inorganic bases such as, for example, sodium,
potassium, ammonium, calcium, or ferric hydroides, and such organic
bases as isopropylamine, trimethylamine, 2-ethylamino ethanol,
histidine, procaine, and the like.
[0520] Any cellular component of such vaccine compositions can, in
preparation for inclusion in such compositions, be subjected to
treatments which involve attenuation or inactivation of the cells
of the vaccine, including, for example, exposure to ionizing
radiation, which can inhibit cell division, antiproliferative
agents such as cyclophosphamide, cytochalasin D, or colchicine, or
killing with or without fixation.
[0521] The compositions, including antigen bearing targets and APCs
are administered in a manner compatible with the dosage
formulation, and in such amount as will be prophylactically and/or
therapeutically effective. The quantity to be administered depends
on the subject to be treated, including, e.g., capacity of the
subject's immune system to synthesize antibodies, and the degree of
protection desired. Suitable dose ranges are on the order of
several hundred micrograms active ingredient per vaccination with a
preferred range from about 0.1 .mu.g to 1000 .mu.g, such as in the
range from about 1 .mu.g to 300 .mu.g, and preferably in the range
from about 10 .mu.g to 50 .mu.g. Suitable regiments for initial
administration and booster shots are also variable but are typified
by an initial administration followed by subsequent inoculations or
other administrations. Precise amounts of active ingredient
required to be administered depend on the judgment of the
practitioner and may be peculiar to each subject. It will be
apparent to those of skill in the art that the therapeutically
effective amount of cells of this invention will depend, inter
alia, upon the administration schedule, the unit dose of antigen
administered, whether the cells are administered in combination
with other therapeutic agents, the immune status and health of the
recipient, and the therapeutic activity of the particular
composition.
[0522] The compositions can be given in a single dose schedule, or
preferably in a multiple dose schedule. A multiple dose schedule is
one in which a primary course of vaccination can include 1-10
separate doses, followed by other doses given at subsequent time
intervals required to maintain and or reinforce the immune
response, for example, at 1-4 months for a second dose, and if
needed, a subsequent dose(s) after several months. Periodic
boosters at intervals of 1-5 years, usually 3 years, are preferable
to maintain the desired levels of protective immunity. The course
of the immunization can be followed by in vitro proliferation
assays of peripheral blood lymphocytes (PBLs) co-cultured with
ESAT6 or ST-CF, and by measuring the levels of IFN-released from
the primed lymphocytes. The assays can be performed using
conventional labels, such as radionucleotides, enzymes, fluorescent
labels and the like. These techniques are known to one skilled in
the art and can be found in U.S. Pat. Nos. 3,791,932, 4,174,384 and
3,949,064, which are hereby incorporated by reference.
Tumors for which the Invention is Applicable
[0523] The invention contemplates treatment of tumors including but
not limited to the following:
[0524] Melanomas, squamous cell tumors, basal cell carcinomas,
astrocytomas, gliomas, glioblastoma multiforme, meningiomas,
ependymomas, schwannomas, neuroblastomas, retinoblastomas,
meningiomas, glomus tumors, sarcomas, including, e.g.,
osteosarcomas, Ewing's sarcomas, chondrosarcomas, myosarcomas,
synovial cell sarcomas, fibrosarcomas, spindle cell tumors,
angiosarcomas, primitive neuroectodermal cell tumors, and Kaposi's
sarcomas, lymphomas, acute and chronic leukemias, tumors of the
head and neck, nasopharyngeal carcinomas, carcinomas of the
pharynx, laryngeal carcinomas, carcinomas of the thyroid,
carcinomas of the parathyroids, thymomas, esophageal carcinomas,
gastric carcinomas, tumors of the small bowel, carcinomas of the
colon and rectum, mesotheliomas, lung carcinomas, including
adenocarcinomas, squamous cell carcinomas, bronchoalveolar
carcinomas, and small cell tumors, pancreatic carcinomas, islet
cell and non-islet cell tumors, carcinomas of the breast, cardiac
myxomas, pituitary tumors, carcinoid tumors, hepatomas,
cholangiocarcinomas, hepatoblastomas, renal cell carcinomas,
nephroblastomas, Wilms' tumors, adrenal carcinomas,
pheochromocytomas, germ cell tumors, choriocarcinomas, ovarian
carcinomas, testicular tumors, seminomas, endometrial tumors,
carcinomas of the prostate, carcinomas of the seminal vesicles,
vaginal tumors, carcinomas of the penis, hydatiform moles,
carcinomas of the gall bladder, and carcinomas of the urinary
bladder.
Subjects for Treatment According to the Invention
[0525] The present invention provides a method for reducing the
size and/or number of metastases in a subject. The method comprises
administering to the subject a vaccine composition comprising a
multifunctional molecule of the invention. A "subject" as used
herein, may refer to an organism of the Kingdom animalia,
preferably a mammal, and still more preferably a human. A
"subject", according to the invention may also be an animal in need
of anti-metastases therapy, e.g., a patient with malignant
metastases to one or more organs or tissues, e.g., a human patient
with lung or lymph node metastases. A "subject", according to the
invention may also be an animal model of metastases, in which the
animal is manipulated, either genetically, or by injection of
malignant cells, or by other methods known to those of skill in the
art, to simulate the appearance of foci of malignant cells or
infected cells which are observed in a similar animal with
naturally occurring metastases. The generation of animal models of
metastasis is well known in the art, and examples of such models
may be found in, for example, Ryan M H et al., J. Immunol. 2001;
167:4286-92; Specht J M et al., J Exp Med. 1997; 186:1213-21;
Nakanishi et al., Tumour Biol. 2003 24:70-6; Wang et al., Int J
Gastrointest Cancer, 2001; 29(1):37-46; Muralidharan et al., J Clin
Laser Med. Surg. 2003 21(2):75-83; Tanaka et al., Chest 2003,
123(4):1248-53; Huang et al., Clin Exp Metastasis 2002; 19(4):359;
and Irvine K R et al., J Immunol. 1996; 156:238-45. One of skill in
the art would be able to readily adapt the animal models of
metastasis known in the art to generate a metastasis model of
interest for any given application.
Detection of Metastases
[0526] The present invention provides a method of reducing the
number and/or size of metastases in a subject comprising
administering to a subject, a multifunctional molecule as described
herein. One of skill in the art will recognize that the detection
and measurement of metastases is routine in the art and may be
accomplished using well established methods. For example,
metastases may be detected using gross examination of a subject,
such as exploratory surgery (e.g., laparotomy). Alternatively,
metastases may be detected, measure, and/or observed using less
invasive techniques and methods such as thorascopy,
mediastinoscopy, and laparoscopy. One of skill in the art may also
detect the presence of metastases using imaging techniques known to
those of skill in the art. Such techniques include, but are not
limited to radiographic imaging, computerized tomography (CT scan),
magnetic resonance imaging (MRI), positron emission tomography (PET
scan), single photon excitation (SPECT), and radionuclide
scintigraphy (e.g., bone scan). The sensitivity of many of the
above imaging methods may be enhanced, as known by those of skill
in the art by injection or IV administration of contrast agents
(e.g., iodine or barium) to a subject to be imaged. Additional
methods for assessing the presence of, or detecting, or measuring
metastasis is through the use of gross or histological pathologic
examination (i.e., in which a tissue sample is removed from a
subject an examined at either or both of the gross anatomical
level, or at the histological or ultrastructural level according to
methods which are well known in the art). The above methods for the
detection, measurement, and imaging of metastases are known to
those of skill in the art and may be adapted according to the
knowledge in the art to particular tissues, organs, or cells which
one of skill in the art wishes to asses according to the methods of
the invention. More detailed descriptions of such methods may be
found in the art, for example, the Oxford Textbook of Oncology,
2.sup.nd Ed., New York, Oxford University Press, 2002.
[0527] According to the invention, metastasis is detected if any
amount of metastasis is detected in a subject. That is, upon the
detection of even a single foci in a subject, metastasis may be
said to have been detected. Preferably, metastasis is detected as
plural metastatic foci, in one or preferably one or more organs in
a subject.
Transgenic Animals According to the Invention
[0528] A nucleic acid molecule encoding a multifunctional molecule
as described herein can be used to produce nonhuman transgenic
animals, and cells of such transgenic animals can be isolated and
used in a vaccine formulation in animal or human vaccination.
[0529] For example, in one embodiment, a nucleic acid molecule is
introduced into a fertilized oocyte or an embryonic stem cell. Such
cells can then be used to create non-human transgenic animals in
which exogenous nucleic acid molecules encoding the polypeptides of
the invention have been introduced into their genome or homologous
recombinant animals in which endogenous nucleic acid molecules have
been altered. Such animals are useful for studying the function
and/or activity of the molecules of the invention and for
identifying and/or evaluating modulators of the activity of the
molecules of the invention. As used herein, a "transgenic animal"
is a non-human animal, prefers mammal, more preferably a mouse, in
which one or more of the cells of the animal includes a transgene.
A transgene is exogenous nucleic acid which is integrated into the
genome of a cell from which a transgenic animal develops and which
remains in the genome of the mature animal, thereby directing the
expression of an encoded gene product in one or more cell types or
tissues of the transgenic animal.
[0530] A transgenic animal of the invention can be created by
introducing nucleic acid molecules encoding the polypeptides
described herein (i.e., a multifunctional molecule) into the male
pronuclei of a fertilized oocyte, e.g., by microinjection, and
allowing the oocyte to develop in a pseudopregnant female foster
animal. Intronic sequences and polyadenylation signals can also be
included in the transgene to increase the efficiency of expression
of the transgene. A tissue-specific regulatory sequence(s) can be
operably linked to the transgene to direct expression of a
polypeptide of the invention to particular cells. Methods for
generating transgenic animals via embryo manipulation and
microinjection, particularly animals such as mice, have become
conventional in the art and are described, for example, in U.S.
Pat. Nos. 4,736,866 and 4,870,009, both by Leder et al., U.S. Pat.
No. 4,873,191 by Wagner et al. and in Hogan, B., Manipulating the
Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1986). Similar methods are used for production of
other transgenic animals. A transgenic founder animal can be
identified based upon the presence of the nucleic acid molecule of
the invention, e.g., the transgene in its genome and/or expression
of the transgene mRNA in tissues or cells of the animals. A
transgenic founder animal can then be used to breed additional
animals carrying the transgene. Moreover, transgenic animals
carrying a transgene encoding polypeptides of the invention can
further be bred to other transgenic animals carrying other
transgenes.
[0531] The invention is further illustrated by the following
exemplifications which should not be construed as being further
limiting.
EXAMPLES
Example 1
Cloning of a Murine GM-CSF Fused to the S. cerevesiae Gas1 GPI
Modification Signal Sequence
[0532] The starting point for producing a yeast expression vector
was the pUC19-GM-CSF-mammalian GPI signal sequence plasmid
(pUC19-GM-CSF-GPI). This plasmid encodes murine GM-CSF (upstream)
fused in-frame to the human Thy-1 GPI modification signal sequence
(downstream). The following two oligonucleotides were purchased
from Midland Certified Reagent Company (Midland, Tex.):
TABLE-US-00008 GTX-5
5'pAATTCCGCGCCGGCACAGTGCTCAGAGACAAACTGGTCAAGTGTGAG
GGCATCAGCCTGCTGGCTCAGAACACCTCGTGGCTGCTGCTGCTCCTGCT
GTCCCTCTCCCTCCTCCAGGCCACGGATTTCATGTCCCTGTGACTGGGTA C3'
GTX-5 comprises: [0533] a. Sequences at the 5' end suitable for
ligating to an EcoRI site (bases 1-5) [0534] b. An NgoM1 site for
creating an in-frame chimeric coding sequence (bases 9-14) [0535]
c. The coding sequence for the GPI modification sequence of human
Thy-1 (Genbank Accession No. M11749) (bases 15-137) [0536] d. A
termination codon (bases 138-140) [0537] e. Sequences at the 3' end
for ligating to a KpnI site (bases 144-148)
TABLE-US-00009 [0537] GTX-6
5'pCCAGTCACAGGGACATGAAATCCGTGGCCTGGAGGAGGGAGAGGGAC
AGCAGGAGCAGCAGCAGCCACGAGGTGTTCTGAGCCAGCAGGCTGATGCC
CTCACACTTGACCAGTTTGTCTCTGAGCACTGTGCCGGCGCGG3'
[0538] This oligonucleotide is complementary to GTX-5, except for
staggered ends.
[0539] GTX-5 and GTX-6 were dissolved in individual tubes in
sterile water at a final concentration of 1 microgram/lambda. GTX-5
and GTX-6 were mixed at a final concentration of 100 ng/lambda and
allowed to anneal for 60 minutes at room temperature.
[0540] The GTX-5:GTX-6 double stranded oligonucleotide was then
cloned into the plasmid pUC19. Four micrograms of pUC19 DNA was
digested with EcoRI and KpnI. After electrophoresis, the linear DNA
was purified from a 0.7% agarose gel using a Qiagen (Santa Clarita,
Calif.) gel purification kit according to instructions provided by
the manufacturer. 100 ng of the GTX-5:GTX-6 oligonucleotide was
ligated to 200 ng of the EcoRI-KpnI digested pUC19 in a final
volume of 20 microliters at room temperature for 60 minutes.
[0541] The plasmid was transformed into competent AG-1 cells, which
were purchased from Stratagene. Transformed E. coli were inoculated
onto LB-amp plates. Bacterial colonies grown on LB plates
containing ampicillin (100 micrograms/ml) were picked and
inoculated into one ml of LB with amp and grown overnight at
37.degree. with shaking.
[0542] Plasmid DNA was isolated using a standard alkaline lysis
miniprep protocol and DNA was digested with EcoRI and KpnI. DNA was
electrophoresed on 1.6% agarose gels stained with ethidium bromide,
and colonies containing an EcoRI-KpnI fragment of approximately 148
by were thus identified. Positive colonies were inoculated into 100
ml of LB with ampicillin and grown overnight. Plasmid DNA was again
purified using kits purchased from Qiagen.
[0543] The nucleotide sequence of a Thy-GPI positive clone,
designated pUC-GPI 21, was sequenced, confirming its identity.
[0544] The GM-CSF coding sequence was amplified by PCR from a mouse
lung cDNA library purchased from Clontech. PCR was performed for 35
cycles using pfu polymerase and the following primers:
TABLE-US-00010 Upstream
5'CCGAATTCATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCTAC3' Downstream
5'CAGCCGGCTTTTTGGACTGGTTTTTTGCATTCAAAGGGGATATCAGTCAG3'
[0545] PCR parameters were denaturation at 90.degree. for 1 minute,
annealing at 60.degree. for 1 minute, and extension at 72.degree.
for 1 minute.
[0546] The GM-CSF chain PCR product was purified after
electrophoresis through a 1% agarose gel. The DNA band was excised
and the DNA fragment purified using a kit purchased from
Qiagen.
[0547] The purified GM-CSF DNA fragment was digested with EcoRI and
NgoM1. After digestion, the reaction mix was extracted with
phenol:chloroform (1:1) followed by chloroform. The aqueous phase
was adjusted to 0.3M sodium acetate pH 5.2 and the DNA was
precipitated with 2 volumes of ethanol at -80.degree. for 2 hours.
The DNA was pelleted by centrifugation, ethanol was removed, and
the pellet was rinsed with 70% ethanol. The pellet was dried under
vacuum.
[0548] The GM-CSF DNA was resuspended in sterile water and ligated
to pUC19-GPI 21 that had been digested with EcoRI-NgoM1. Ligation
was for one hour at room temperature. PUC19 GPI 21 ligated to
GM-CSF DNA was used to transform competent AG-1 cells. Transformed
AG-1 cells were selected on LB plates with ampicillin. Plasmid DNA
was isolated and analyzed as above. Restriction digests were
performed to confirm the pUC19 GPI-GM-CSF chimeric construct. The
DNA from several positive clones was isolated and sequenced.
[0549] This plasmid was digested with NgoMIV and KpnI, and the
larger resulting fragment isolated after electrophoresis through a
1% agarose gel.
[0550] The 280 by GPI modification signal sequence from the yeast
protein Gas1 was amplified by PCR from the yeast cosmid clone C9952
(ATCC). This PCR employed pfu polymerase and the primers:
TABLE-US-00011 Upstream Primer
5'GTAGCCGGCGCTAGCTCGGGGTCTTCTTCCAAGTCTA Downstream Primer
5'TACGGTACCCCTAGGCCACAATGAAATAAGATACCATACC3'
[0551] These primers add a 5' NgoMIV site and a 3' KpnI site to the
Gas1 fragment.
TABLE-US-00012 Conditions for PCR were: Denaturation 90.degree. one
minute Annealing 60.degree. one minute Extension 72.degree. one
minute Cycles 25
[0552] The PCR product was purified after electrophoresis through a
1% agarose gel and digested with NgoM IV and KpnI. The Gas1 GPI
signal sequence was then ligated into the pUC19-GM-CSF-GPI plasmid
prepared above so that the Gas1 signal sequence was fused in-frame
downstream of the GM-CSF sequence, replacing the Thy-1 sequence.
This vector is termed pUC19-GMCSF-Gas1.1. The resultant plasmid was
then transformed into AG-1 competent E. coli (Stratagene) and
plasmid clones were isolated by alkaline lysis mini-prep. Plamids
were then screened for inserts by restriction digest. DNA from a
positive clone was sequenced to confirm the identity of the GAS1
coding region.
[0553] A yeast expression plasmid for GPI-GM-CSF was then generated
utilizing the pITY-4 vector, which was kindly provided by Dr. K.
Dane Wittrup (University of Illinois). This plasmid stably
integrates into the yeast genome and allows high-level expression
of heterologous genes. Features of pITY-4 include: a delta sequence
(LTR of Ty element) that enables multiple integration events by
homologous recombination; a neo/kanamycin resistance gene that
provides for selection in E. coli and tunable selection in yeast;
the Gall promoter for high-level inducible transcription; a unique
EagI cloning site; a synthetic Pre-Pro sequence optimized for
efficient secretion of expressed genes; the alpha factor
termination sequence; and an origin of replication for propagation
in E. coli. In this system, yeast are grown in dextrose-containing
media for 3 days, then are switched to media containing galactose
to induce transcription of genes inserted downstream of the Gall
promoter.
[0554] The GMCSF-Gas1 insert described above was amplified by PCR
from pUC19-GMCSF-Gas1.1 using pfu polymerase and the primers:
TABLE-US-00013 Upsteam 5'TACGGCCGGCACCCACCCGCTCACCC3' Downstream
5'TACGGCCGCCACAATGAAAATAAGATACCAT3'
[0555] These primers add EagI sites at both ends for cloning into
the pITY-4 plasmid.
TABLE-US-00014 Conditions for PCR were: Denaturation 90.degree. one
minute Annealing 60.degree. one minute Extension 72.degree. one
minute Cycles 25
[0556] The PCR product was purified after electrophoresis through a
1% agarose gel and digested with EagI. The EagI-flanked GMCSF-Gas1
fragment was ligated into EagI-digested pITY-4 and used to
transform E. coli AG1 cells. E. coli were then grown on
kanamycin-containing LB plates (100 ug/ml). Plasmids from kanamycin
resistant colonies were purified by mini-prep and mapped by
restriction digests for presence and correct orientation of
inserts. The identity of a positive clone was confirmed by
sequencing. This plasmid is termed pITY-GMCSF-Gas1.1.
Example 2
Expression of Murine GM-CSF Fused to the Gas1 GPI Modification
Signal Sequence in Yeast
[0557] A 50 ml culture of the E. coli clone containing
pITY-GMCSF-Gas1.1 was grown in LB with 100 ug/ml kanamycin and the
plasmid purified using a Midi-Prep Kit from Qiagen. The S.
cerevesiae strain BJ5464 (ATCC) was then transformed with
pITY-GMCSF-Gas1.1 using a lithium acetate (LiAc) protocol. A 10 ml
overnight culture of BJ5464 in YPD (Per liter: 20 g Bactotryptone,
10 g yeast extract, 20 g dextrose) was used to inoculate a 100 ml
flask. Yeast were grown for 3 hours at 30.degree. and then
harvested by centrifugation at 12,000.times.g for 2 minutes at room
temperature. Cells were washed with sterile water and centrifuged
again. The cells were resuspended in 1.0 ml of 100 mM LiAc,
transferred to a 1.5 ml microfuge tube and centrifuged in an
Eppendorf microfuge at top speed for 15 seconds. The cells were
then resuspended in 0.5 ml of 100 mM LiAc and 50 uL samples were
aliquoted to individual tubes. The cells were pelleted. 240 uL of
PEG (50% w/v), 36 uL 1.0M LiAc, 5 uL (10 mg/ml) boiled carrier DNA
(salmon sperm DNA, Sigma), and 2 ug plasmid in 75 uL water, were
then added in that order. After the addition of plasmid, the tube
was vortexed, incubated at 30.degree. for 30 minutes and
heat-shocked at 42.degree. for 15 minutes. The cells were then
pelleted, resuspended in sterile water and plated on YPD plates
containing 1 mg/ml G418.
[0558] Individual colonies of G418-resistant yeast were picked and
grown in one ml of YPD with 1 mg/ml G418 for 3 days. The cells were
then pelleted by centrifugation in a microfuge and the YPD
(dextrose-containing, galactose-free) media was replaced with YPG
(20 g bactotryptone, 10 g yeast extract, 20 g galactose per liter)
with 1 mg/ml G418. Yeast were grown in YPG for 3 days to allow full
induction of transcription from the Gall promoter. After induction,
cells were pelleted, washed with TN (0.15M NaCl, 25 mM Tris pH 7.4)
and lysed in TN containing 20 mM octyl glucopyranoside (OGP), 1 mM
PMSF, and 1 ug/ml each aprotinin, leupeptin and pepstatin. Yeast
were lysed by vortexing with acid-washed glass beads (425-600
microns, Sigma). Insoluble material was pelleted and the
supernatant assayed using a murine GM-CSF ELISA (Endogen). A colony
expressing high levels of GPI-GM-CSF was identified. Based on
standard curve of soluble GMCSF, we estimate expression to be
approximately 25 ug/L, a significant improvement over mammalian
expression and sufficient for in vivo experiments. This yeast clone
is designated SC-GM-GPI.
[0559] One of the advantages of stably integrating vectors for
expression in yeast is that, after the initial cloning and colony
isolation, antibiotic maintenance is no longer required. To confirm
this, cells were grown with and without G418 and tested for
GPI-GM-CSF expression. We have seen no decrease in expression
levels in the absence of G418 over 8 months.
[0560] To produce GPI-GM-CSF on a scale suitable for in vitro and
in vivo functional characterization, 500 ml of YPD was inoculated
with SC-GM-GPI and grown for three days at 30.degree. with shaking.
Cells were pelleted by centrifugation at 12,000.times.g for 2
minutes at room temperature and transferred to an equal volume of
YPG for an additional three days of growth. Cells were then
pelleted, washed with TN and lysed in 25 ml of TN containing 20 mM
OGP, 1 mM PMSF, and 1 ug/ml each aprotinin, leupeptin and
pepstatin. Cells were then lysed by vortexing with acid washed
glass beads, 20 g/500 ml culture, (425-600 microns, Sigma).
Insoluble material was pelleted at 8,000.times.g for 10 minutes at
room temperature and the soluble material was applied to an
immunoaffinity column of anti-murine GMCSF monoclonal antibody
(Endogen)) linked to cyanogen bromide-activated Sepharose 4B
(Sigma). Coupling of the monoclonal to the Sepharose was performed
according to the manufacturer's instructions. Efficiency of
coupling was monitored using OD.sub.280 and binding of murine
GM-CSF to immobolized antibody was confirmed using commercially
available, recombinant cytokine.
[0561] Soluble yeast-derived material was applied to the column and
allowed to flow by gravity. The column was washed sequentially
with: (a) 20 volumes of TN with 1% Triton X-100; (b) 5 volumes of
50 mM Tris pH 8.0, 1 mM OGP; (c) 20 volumes TN with 1 mM OGP. Bound
material was then eluted with 10 volumes of 0.15M NaCl, 25 mM Tris
pH 2.5 with 1 mM OGP. Eluted material was neutralized with 1/200
volume of 1.5M Tris pH8.8. The purified material was concentrated
using a Microsep 3K centrifugal device (Pall Gelman Laboratory).
Yields of GPI-GM-CSF were determined by ELISA (Endogen) to be 25
ug/L of culture. Final concentration was adjusted to 40 ug/ml by
addition of 0.15M NaCl, 25 mM Tris pH 7.4 with 1 mM OGP.
[0562] Purified GPI-GM-CSF was analyzed by stained gel and western
blot. Approximately 1 ug of purified GPI-GM-CSF or recombinant
soluble murine GM-CSF per lane were electrophoresed. Gels were then
stained with silver nitrate using the Sigma silver staining kit
according to the manufacturer's directions (Sigma). For western
blots, gels were transferred to Protran BA83 (Schleicher and
Schuell) using an Owl Scientific electric transblotter and blocked
with TBS (Tris Buffered Saline) containing 0.05% Tween 20 and 2%
nonfat dry milk overnight at room temperature. The blot was then
incubated with primary antibody (rat monoclonal anti-murine GMCSF,
Endogen) at 1:5000 dilution in blocking buffer for 2 hours at room
temperature. The blot was washed with TBS-0.05% Tween 20, and
incubated with a secondary antibody, alkaline phosphatase
conjugated goat anti-rat IgG (Sigma) at 1:10,000 for 1 hour at room
temperature. After washing, color was developed with NBT-BCIP
(Sigma). A single dominant band migrating at approximately the same
rate as a recombinant soluble GM-CSF standard was clearly present
on both the gel and the blot (the molecular weight of the GPI
moiety is only approximately 1500 compared to approximately 14,000
for the protein moiety]. Given the immunoreactivity with
anti-GM-CSF and the ability of this material to bind to tumor cell
membranes, these bands appear to represent GPI-GM-CSF. While some
high molecular weight material, possibly representing aggregates,
is visible in the blot, this material is not visible in the less
sensitive silver stain, indicating that it is present in lower
amount than the dominant band.
Example 3
Attachment of Murine GM-CSF Fused to the Gas1 GPI Modification
Signal Sequence to Cells
[0563] Wild type CMS-5 murine fibrosarcoma cells grown in DMEM, 10%
FBS, Pen-Strep were harvested, washed twice with RPMI 1640 (Life
Technologies) and resuspended in RPMI 1640 at a concentration of
5.times.10.sup.5 cells/ml. 0.9 ml aliquots of the cell suspension
were dispensed to Eppendorf siliconized microfuge tubes. Each
aliquot received either 1 ug of purified GPI-GM-CSF prepared as in
Example 2, 1 ug of soluble recombinant murine GM-CSF (Intergen,
supplied as lyophilized powder and reconstituted at 40 ug/ml in the
same buffer as GPI-GM-CSF), or media alone. Cells were then
incubated for 3 hours at 37.degree. C. with shaking and then washed
3 times with PBS containing 2% FBS.
[0564] For detection of GPI-GM-CSF by flow cytometry, cells were
incubated with a rat anti-murine GM-CSF monoclonal antibody
(Endogen) for one hour at 4.degree. C. The cells were then washed 3
times with PBS containing 2% FBS, and incubated with FITC-labeled
goat anti-rat IgG antibody (Sigma) for one hour at 4.degree. C.,
and again washed 3 times with PBS containing 2% FBS. The cells were
analyzed by flow cytometry on a Becton-Dickinson Facscalibur.
Decoration with GPI-GM-CSF caused an approximately 10-fold increase
in peak and mean FL-1 fluorescence relative to cells incubated with
media alone. In contrast, cells incubated with soluble GM-CSF had
virtually the same profile as the negative control cells. This data
indicates that GPI-GM-CSF, but not soluble recombinant GM-CSF, can
bind to tumor cells.
[0565] GPI-GM-CSF attached to CMS-5 cells was also detected and
quantitated by ELISA. CMS-5 cells were harvested and washed as
described above. 1.times.10.sup.6 cells in 1 ml of RPMI 1640 were
incubated with 1 ug of purified GPI-GM-CSF. After incubation for 2
hours at 37.degree. C., the cells were washed 3 times with PBS
containing 2% FBS. The cell pellet was lysed with 50 microliters of
PBS containing 0.15% deoxycholate and the detergent subsequently
diluted by the addition of 200 microliters of PBS. The material was
serially diluted with PBS and amounts of GM-CSF determined using an
ELISA kit (Endogen) against a soluble, recombinant GM-CSF standard
provided by the manufacturer. Based on this data, the mean number
of GPI-GM-CSF molecules incorporated/cell over five experiments was
37,000+/-33,000. The large standard deviation was due to one
experiment in which the number of molecules/cell was 66,000.
Excluding this experiment, the mean was 29,500+/-4,500.
[0566] "Decoration" of B16 murine melanoma cells with GPI-GM-CSF
was also quantitated by ELISA. Decoration and ELISA were performed
exactly as described for CMS-5 cells. The mean number of
molecules/cell over three experiments was 21,000+/-11,500.
Example 4
Stability of Murine GM-CSF Fused to the Gas1 GPI Modification
Signal Sequence on Cells
[0567] To study the stability of incorporated GPI-GM-CSF on cells,
CMS-5 cells were harvested and decorated as described above in
Example 3. After decoration, the cells were washed 3 times with PBS
containing 2% FBS and then resuspended at 4.times.10.sup.6 cells/ml
in RPMI 1640. The cells were irradiated at 3500 rads from a
.sup.137Cs source. The cells were then incubated at 37.degree. C.
in 5% CO.sub.2 and aliquots were removed at hourly intervals,
washed three times, and lysed in 50 ul PBS with 0.15% deoxycholate.
200 ul of PBS was then added to dilute the deoxycholate.
Cell-associated GM-CSF was measured by ELISA. Even at 6 hours,
cells showed only about a 20% loss of cell-surface GPI-GM-CSF.
After 6 hours, viability of irradiated cells (both decorated and
non-decorated) as measured by microscopic inspection with trypan
blue staining was significantly compromised. However, in vivo data
(see below) indicates that both cell-surface retention of
GPI-GM-CSF and post-irradiation cellular viability are sufficient
to sustain a biological effect.
Example 5
Bioactivity of Murine GM-CSF Fused to the Gas1 GPI Modification
Signal Sequence to Cells
[0568] The bioactivity of GPI-GM-CSF was assayed by determining the
molecule's ability to support the proliferation of the FDC-P1 cell
line, a murine bone-marrow derived, GM-CSF dependent cell line.
Proliferation of FDC cells was measured with the Biotrak Cell
Proliferation ELISA (Amersham Pharmacia), an assay that utilizes
the thymidine analogue 5-bromo-2'-deoxyuridine (BrdU). WEHI cells
(ATCC) were grown in Iscove MEM, 10% FBS, Penicillin-streptomycin,
as a source of conditioned media for FDC-P1 cells. FDC-P1 cells
were grown in DMEM, 10% FBS, Penicillin-streptomycin with 25% WEHI
conditioned media, harvested, and washed 3 times with DMEM, 10%
FBS, Penicillin-streptomycin. The cells were resuspended at
1.times.10.sup.5/ml in DMEM, 10% FBS, Penicillin-streptomycin and
100 uL was aliquoted to individual wells of a 96 well microtitre
plate. Groups, done in triplicate, were as follows: [0569] A.
Media--No Cells [0570] B. FDC-PI Cells-Unstimulated [0571] C.
FDC-P1 Cells+10 ng soluble GM-CSF [0572] D. FDC-PI Cells+10 ng
GM-CSF as GPI-GM-CSF (as determined by ELISA against GM-CSF
standard) [0573] E. FDC-PI Cells+10 ng GPI-GM-CSF (as in "D")
denatured by extraction of the protein with chloroform:methanol
(3:1) followed by acetone precipitation and resuspension. All
protein solutions were diluted to 100 ng/ml in 0.15M NaCl, 25 mM
Tris pH 7.4 with 1 mM OGP, so that the volume added to each well
was 100 uL.
[0574] The non-isotopic proliferation assay was performed according
to the manufacturer's instructions. The plated cells were grown for
two days at 37.degree. C. in 5% CO.sub.2. On day 3, 10 ul of the
BrdU solution was added to individual wells and the cells incubated
for 3 more hours. The plate was then centrifuged at 300.times.g for
10 minutes and the supernatant removed. The plate was dried by
incubating at 60.degree. C. for one hour. The plate was then fixed
and blocked according to the manufacturer's instructions. The fixed
cells were then incubated with peroxidase-labelled anti-BrdU for 90
minutes. The wells were then washed and color developed with TMB
according to the manufacturer's instructions. In two experiments,
GPI-GM-CSF consistently sustained proliferation at a level somewhat
(about 25%) higher than did soluble recombinant GM-CSF, indicating
that GPI-GM-CSF is suprabioactive. The effect of GPI-GM-CSF was not
due to the GPI moiety alone, since denatured GPI-GM-CSF did not
support proliferation. The GPI moiety remained linked to the
protein after denaturation, since the protein was still able to
decorate cells as demonstrated by ELISA, which recognizes linear
epitopes on GM-CSF.
Example 6
Effective Immunization with Cells Admixed with GPI-GM-CSF
[0575] These experiments included mice vaccinated with: [0576] (a)
Wild-type cells (WT) [0577] (b) Cells incubated with soluble
GM-CSF--Unwashed (total GM-CSF in dose: 1 microgram) [0578] (c)
Cells decorated with GPI-GM-CSF--Unbound GPI-GM-CSF Washed off
Following Incubation (total GPI-GM-CSF in dose: 0.74 nanograms by
ELISA [mean of 2 experiments; 73 and 75 ng individually) [0579] (d)
Cells decorated with GPI-GM-CSF-Unwashed (total GM-CSF in dose: 1
microgram) GPI-GM-CSF mass and concentration values are expressed
in terms of equivalence to GM-CSF as determined by ELISA against a
soluble GM-CSF standard.
[0580] CMS-5 cells were grown to 70% confluence in DMEM, 10% FBS,
Penicillin-streptomycin, harvested trypsinization, and washed 3
times with RPMI 1640. Viability was determined by trypan blue
staining of an aliquot and the cells were then resuspended at a
concentration of 4.times.10.sup.6 cells/ml a 1 ul aliquots
dispensed into siliconized microfuge tubes. The cells were
incubated with 1 ug GPI-GM-CSF or 1 ug soluble recombinant murine
GM-CSF per 10.sup.6 cells for 3 hours at 37.degree. C. "Washed"
groups were then washed 3 times with PBS, 2% FBS and resuspended at
4.times.10.sup.6 cells/ml in RPMI 1640. An aliquot of the washed
GPI-GM-CSF decorated cells was removed and the amount of
cell-associated GM-CSF measured by ELISA as described above. There
were approximately 31,000 and 32,000 GPI-GM-CSF molecules/cell in
the washed decorated groups in the two experiments,
respectively.
[0581] The cells were irradiated at 3500 rads from a .sup.137Cs
source. 8-10 week-old female Balb/c mice (which are syngeneic for
CMS-5) were anesthetized by metofane inhalation and vaccinated
subcutaneously in the left inguinal fold with 1.times.10.sup.6
cells in 0.25 ml. Seven days later, wild-type CMS-5 cells at 70%
confluence were harvested and washed 3 times in HBSS. Viability was
determined by trypan blue staining of an aliquot and cells were
adjusted to 4.times.10.sup.6/ml in HBSS. The previously vaccinated
mice were then injected subcutaneously behind the neck, under
metofane anesthesia, with 2.times.10.sup.6 live, wild-type CMS-5
cells in 0.5 ml HBSS.
[0582] Tumor development was assessed daily by palpation and visual
inspection. "Onset" was defined as the first day on which a tumor
mass was both palpable and visible. The observer was blinded to the
vaccine received by each set of mice to ensure against bias. Mice
were sacrificed by CO2 asphyxiation when tumors become unwieldy.
Experiments were terminated 70 days after tumor challenge, as
planned in advance.
[0583] Data is pooled from three experiments for GPI-GM-CSF
unwashed, soluble GM-CSF, and wild-type vaccine groups. Data for
these groups includes that from undepleted controls in a lymphocyte
subset depletion experiment. Data for the GPI-GM-CSF washed group
is pooled from two experiments, since this group was not included
in the initial depletion experiment. The depletion experiment had 4
mice/group, and the other experiments had 5/group. In terms of
total mouse numbers, n=14 for GPI-GM-CSF unwashed; 10 for
GPI-GM-CSF washed; 14 for soluble GM-CSF unwashed; and 14 for WT.
Approximate percentages of mice surviving tumor-free to day 70
after challenge were: WT, 15%; soluble GM-CSF, 50%; GPI-GM-CSF
washed, 60%; GPI-GM-CSF unwashed, 85%. Thus, even though the
GPI-GM-CSF washed vaccine contained over a thousand-fold less
GM-CSF than the unwashed soluble, administration of cells decorated
with GPI-GM-CSF was more effective. Furthermore, the GPI-GM-CSF
unwashed vaccine, in which some molecules were not attached to a
cell, was even more effective.
Example 7
Cloning and Expression of Human GM-CSF Fused to the Gas1 GPI
Modification Signal Sequence
[0584] Human GM-CSF is amplified by PCR from a human T cell cDNA
library (Clontech) using Pfu polymerase (Stratagene). The following
primers are used:
TABLE-US-00015 Upstream 5'GCGAATCCCGGCCGGCACCCGCCCGCTCGCCCAGCCCC
Downstream 5'CAGCCGGCCTCCTGGACTGGCTCCCAGCAGTC
[0585] The upstream primer contains EcoR1 and Eag1 restriction
sites immediately preceding the first amino acid found in the
mature human GM-CSF protein. Since expression in S. cerevisiae
utilizes a yeast leader sequence, cloning of the human GM-CSF
begins at the N terminus of the mature protein. Each downstream
primer omits the native stop codon to allow in-frame ligation to
the sequence encoding the Gas1 GPI modification signal. The
downstream primer contains an NgoM IV restriction site, consistent
with restriction sites used in other constructs.
[0586] PCR parameters are denaturation at 97.degree. C. for 1
minute, [0587] annealing at 56.degree. C. for 1 minute, and [0588]
extension at 72.degree. C. for 2 minutes. PCR is performed for the
least number of cycles yielding a visible band on agarose gel
electrophoresis. After amplification, the reaction mix is allowed
to cool at 4.degree. for 10 minutes.
[0589] The PCR product is isolated by electrophoresis through a 1%
agarose gel and eluted from the excised agarose band using a
commercially available kit (Qiagen). The purified hGM-CSF DNA
fragment is digested with EcoR1 and NgoM IV and ligated to the
(murine) pUC19 GM-CSF-GPI plasmid that has been digested with EcoR1
and NgoM IV. This replaces the murine GM-CSF with its human
counterpart. The pUC19-hGM-CSF GPI plasmid is then transformed into
competent AG-1 E. coli cells, 30 colonies are picked for
mini-culture, and plasmid clones are isolated and purified using
commercially available kits (Qiagen). Positive clones are
identified by restriction enzyme test digest and agarose gel
electrophoresis. Positive E. coli colonies are grown overnight in
maxi-culture and their plasmids purified using Qiagen maxi-prep
kits. Inserts are sequenced.
[0590] To clone GM-CSF GAS1 g into the pITY-4 expression vector,
PCR of this construct from the pUC19 vector is performed. The
primers are:
TABLE-US-00016 5'TACGGCCGGCACCCGCCCGCTCGCCCAGCCCC
3'TACGGCCGCCACAATGAAAATAAGATACCAT
The upstream primer has an EagI site immediately preceding the
first codon of the mature GM-CSF. This removes the mammalian
secretion signal and allows for in-frame ligation to the yeast
signal sequence. The same restriction site can be used as for the
mouse construct because it is absent in the human sequence. The
downstream primer appends an EagI site at the 3' end. PCR is
performed using Pfu polymerase for 25 cycles. Conditions for PCR
are: denaturation 90.degree. one minute, annealing 60.degree. one
minute, extension 72.degree. one minute. After amplification, the
reaction mix is allowed to cool at 4.degree. for 10 minutes.
[0591] The PCR product is isolated by electrophoresis through a 1%
agarose gel and eluted from the excised agarose band using a
commercially available kit (Qiagen). The purified GM-CSF GAS1 g DNA
fragment is digested with EagI, ligated to pITY-4, and transformed
into AG-1 chemically competent bacteria (Stratagene). 30 colonies
are picked for mini-culture and plasmid clones are isolated and
purified using commercially available kits (Qiagen). Positive
clones are identified by restriction enzyme test digest and agarose
gel electrophoresis. Positive E. coli colonies are grown overnight
in maxi-culture and their plasmids purified using Qiagen maxi-prep
kits. Inserts are sequenced.
[0592] The GPI-human GM-CSF molecule is expressed in S. cerevesiae
as described for the murine molecule in Example 2. Immunoaffinity
purification is performed as described in Example 2, substituting
an anti-human GM-CSF antibody for the anti-murine GM-CSF antibody.
ELISA to detect and quantitate the molecule, whether in isolation
or bound to an antigen bearing target, is performed using an
anti-human GM-CSF monoclonal antibody, as is flow cytometry on
cells decorated with the molecule.
Example 8
Cloning of GM-CSF/Influenza Hemagglutinin Chimeric Proteins
[0593] pUC19 GMCSF-K-GAS1.1
[0594] pUC19 GM-CSF-K-HA was cloned starting with pUC19
GM-CSF-K-Gas1.1, which we produced in our laboratory. This plasmid
includes a sequence that encodes murine GM-CSF fused to a
downstream glycosylphosphatidylinositol modification sequence
derived from the yeast GAS1 protein (the latter obtained from Dr.
D. Wittrup, University of Illinois). A linker sequence is
interposed between the GM-CSF and GAS1 portions. To insert the
linker sequence, the plasmid pUC19 GMCSF-Gas1.1, also previously
produced in our lab, was digested with NgoM IV and NheI. These
restriction enzymes cut at the 3' end of the GM-CSF molecule and at
the 5' end of the Gas1.1 sequence, respectively. The resulting
plasmid was purified after electrophoresis through agarose gel
using a kit manufactured by Qiagen. The following oligonucleotides
were purchased:
TABLE-US-00017 5' CCGGCACTAGTGGCGGAGGGGGCTCCGGCGGCGGGGGCAGCG 5'
CTAGCGCTGCCCCCGCCGCCGGCGCCCCCTCCGCCACTAGTG
The synthetic oligonucleotides contain: [0595] 1. 5' overhang that
anneals to NgoM IV digested plasmid DNA [0596] 2. 3' overhang that
anneals to Nhe I digested plasmid DNA [0597] 3. DNA sequence coding
for the peptide GGGGSGGGGS where G stands for glycine and S stands
for serine. This 10 amino acid sequence (G.sub.4S).sub.2 is
designed to insert a kink/spacer in the protein between the GMCSF
and the Gas1.1 moieties. [0598] 4. SpeI site to allow confirmation
of cloning of the small fragment and for further manipulations. The
two oligonucleotides were mixed in equimolar concentrations, boiled
for 2 minutes and allowed to anneal at room temperature. The
oligonucleotide was ligated into the NgoM IV-Nhe I digested plasmid
and the plasmid was used to transform the E. coli strain AG-1.
Transformants were selected on LB plates containing 100 ug/ml
ampicillin. Plasmid DNA was isolated, digested with Spe I, and
electrophoresed on agarose gels to confirm the presence of the
(G.sub.4S).sub.2 sequence. pUC19 GM-CSF-K-hemagglutinin (HA)
[0599] The plasmid pUC19 GM-CSF-K-HA was produced, which encodes a
chimeric protein containing (from amino terminal to carboxy
terminal): (1) murine GM-CSF; (2) the (G.sub.4S).sub.2 linker
described above; and (3) the HA1 domain of the H1 HA from the
A/PR/8/34 influenza A isolate. The HA1 sequence used (amino acids
18 to 344 of the HA precursor) omits the N-terminal leader sequence
and the downstream HA2 domain. A termination codon was added after
amino acid 344.
[0600] pUC19 GM-CSF-K-Gas1.1. was digested with Nhe I and Kpn I.
Nhe I cuts at the 5' end of the Gas1.1 coding sequence and Kpn I
cuts at the 3' end of the Gas1.1 coding sequence, respectively. The
resulting plasmid with the GPI coding region removed, was purified
after electrophoresis through agarose gel using a kit manufactured
by Qiagen. The HA1 coding sequence was cloned by PCR from a plasmid
encoding the HA gene of the A/PR/8/34 strain of influenza. The HA1
sequence used begins at amino acid 18, the start of the mature
protein, i.e. lacking the secretion signal sequence. The 3' end
corresponds to amino acid 344, eliminating the transmembrane region
and substituting a termination codon. Primers for PCR of the HA1
sequence were as follows:
TABLE-US-00018 Upstream HA1 Primer 5' ATGCTAGCGACACAATATGTATAGGC
Downstream HA1 Primer 5' ATGGTACCCGGCCGTTATCATCTGGATTGAATGGACGG
TABLE-US-00019 Conditions for PCR were: Denaturation 90.degree. one
minute Annealing 60.degree. one minute Extension 72.degree. one
minute
PCR was performed for 20 cycles using vent polymerase.
[0601] Following PCR, the product was electrophoresed through a
1.0% agarose gel and the HA1 cDNA was extracted from the gel using
a Qiagen kit according to the manufacturer's instructions. The
purified HA1 DNA fragment was digested with Nhe I and Kpn I. To
make the fusion protein, the purified Nhe I-Kpn I HA fragment was
ligated into the pUC19 GM-CSF-K-Gas1.1 vector that had been
digested with Nhe I and Kpn Ito remove the Gas1.1 coding region.
The DNA was used to transform E. coli AG1 and transformants
selected on LB-ampicillin plates. Plasmid DNA from individual
colonies was isolated and digested with restriction enzymes.
Restriction digests identified a pUC19 GM-CSF-K-HA plasmid.
[0602] The pUC19 GM-CSF-K-HA plasmid was purified according to the
manufacturer's instructions using a kit purchased from Qiagen.
Example 9
Cloning of GM-CSF-K-HA into Yeast Expression Vector
[0603] PCR of pUC19 GM-CSF-K-HA was used to isolate a DNA fragment
encoding GM-CSF-K-HA for cloning into a yeast expression vector.
The PCR product contains Eag I cloning sites for in frame insertion
into the yeast expression vector.
TABLE-US-00020 Upstream Primer 5' TACGGCCGGCACCCACCCGCTCACCC
Downstream Primer 5' ATGGTACCCGGCCGTTATCATCTGGATTGAATGGACGG
TABLE-US-00021 Conditions for PCR were: Denaturation 90.degree. one
minute Annealing 60.degree. one minute Extension 72.degree. one
minute
PCR was performed for 20 cycles using vent polymerase.
[0604] Following PCR, the product was electrophoresed through a
1.0% agarose gel and the GM-CSF-K-HA gene was extracted from the
gel using a Qiagen kit according to the manufacturers instructions.
The purified DNA fragment was digested with Eag I and ligated to
the yeast expression vector ITK that had been digested with Eag I.
The ITK vector is designed for (1) replication in E. coli and (2)
expression of genes in the yeast Saccharomyces cerevisiae after
stable integration using homologous recombination. The vector
contains: [0605] 1. Sequences for replication of the plasmid in E.
coli [0606] 2. Yeast Gal promoter for expression of heterologous
genes in yeast grown in media containing galactose. [0607] 3.
PrePro--Synthetic DNA sequence, optimized for secretion and signal
sequence cleavage of distal genes in yeast. [0608] 4. Unique Eag I
site for cloning genes to be expressed. [0609] 5. Alpha
terminator-DNA sequence for efficient termination of proximal
genes. [0610] 6. Delta sequence that allows for stable integration
of the plasmid by recombination with endogenous delta sequences in
the yeast chromosome. [0611] 7. Antibiotic resistance gene allowing
for selection in E. coli with kanamycin and selection in yeast with
G418.
[0612] This plasmid was used to transform E. coli strain AG-1.
Transformants were selected by growth on LB plates containing 100
ug/ml kanamycin. Individual colonies were grown in LB media
containing kanamycin and plasmids were purified. Restriction
digests determined orientation of inserts. The resulting plasmid
ITK GM-CSF-K-HA was purified using a kit purchased from Qiagen
according to the manufacturer's instructions.
Example 10
Expression of GM-CSF-K-HA in Yeast
[0613] The purified plasmid was linearized with Mfe 1 and used to
transform the yeast strain Saccharomyces cerevisiae WDHY131 using
lithium acetate (LiAc). A 10 ml culture of S. cerevisiae grown to
saturation at 30.degree. in YPD media (per liter/20 g
Bactotryptone; 20 g dextrose; 10 g yeast extract) was used to
inoculate 100 ml of YPD. The culture was grown at 30.degree. with
shaking for 3 hours. The yeast were harvested by centrifugation at
11,000.times.g for 2 minutes and resuspended in 25 ml of sterile
water. The yeast were centrifuged as above and resuspended in 1.0
ml of 100 mM lithium acetate and transferred to a 1.5 ml microfuge
tube. The yeast were pelleted by centrifugation at 12,000.times.g
for 15 seconds and the supernatant removed. The cells were
resuspended in 0.5 ml of 100 mM LiAc. 50 uL of cell suspension was
added to individual microfuge tubes and centrifuged as above.
Supernatant was removed.
[0614] Transformation mix added to the yeast pellet consisted of:
240 uL PEG (50% w/v); 36 uL 1.0 M LiAc; 5 uL single stranded DNA
(10 mg/ml) and 1 ug of linearized ITK GM-CSF-K-HA in 75 uL of
water. The mixture was vortexed to resuspend the cell pellet and
incubated at 30.degree. for 30 minutes. The cells were then shocked
at 42.degree. for 15 minutes, centrifuged to pellet cells and
resuspended in 0.5 ml of YPD. Yeast were incubated in YPD media for
3 hours and plated on YPD plates containing 2 mg/ml G418. Plates
were grown at 30.degree. for 3 days until individual colonies
appeared. To screen for expression of GM-CSF-K-HA, individual
colonies were grown in 1 ml of YPD media at 30.degree. for 2 days.
The cells were centrifuged at 8,000.times.g for 2 minutes and the
YPD media removed and replaced with 1 ml of YPG media (per liter/20
g Bactotryptone; 20 g galactose; 10 g yeast extract) for induction
from the gal promoter. Yeast were grown in YPG media for 2 days. At
this time, an aliquot was removed and cells were pelleted. The
supernatant was tested for GM-CSF expression using an ELISA kit
purchased from Endogen. Protocol was according to the manufacturer.
A high-expressing yeast clone secreting the chimeric protein
GM-CSF-K-HA was identified. Based on standard curve of soluble
GMCSF, expression level was approximately 2.4 mg/L of GM-CSF
moiety.
Example 11
Production of pUC19 HA (hemagglutinin)-K-GM-CSF
[0615] The plasmid pUC19 HA-K-GM-CSF was also produced, which
encodes a chimeric protein containing (from amino terminal to
carboxy terminal): (1) an HA1 domain (2) K, the (G.sub.4S).sub.2
linker described above, and (3) murine GM-CSF, The HA1 begins at
the amino terminus of the mature protein, amino acid 18,
eliminating the leader sequence. The 3' end terminates at amino
acid 344. The (G.sub.4S).sub.2 has been added to supply a flexible
linker. The GM-CSF begins at amino acid 18 of the GM-CSF protein,
corresponding to the first amino acid of the mature protein.
[0616] The HA-K sequence was first cloned by PCR of the HA1 coding
sequence from a plasmid encoding the HA gene of the A/PR/8/34
strain of influenza.
TABLE-US-00022 Upstream Primer 5' CTGAATTCCGGCCGGACACAATATGTATAGGC
Downstream Primer 5'
ATGGTACCGCTGCCCCCGCCGCCGGAGCCCCCTCCGCCACTTCTGGA TTGAATGGACGGAAT
[0617] The oligonucleotides for PCR generate a nucleic acid with:
[0618] 1. A 5' EcoRI site at the amino terminus of the mature HA
[0619] 2. The (G.sub.4S).sub.2 linker at the carboxy terminus of
the HA1 domain (amino acid 344 of the HA precursor) [0620] 3. A Kpn
I site distal to the end of the (G.sub.4S).sub.2 sequence
TABLE-US-00023 [0620] Conditions for PCR were: Denaturation
90.degree. one minute Annealing 60.degree. one minute Extension
72.degree. one minute
PCR was performed for 20 cycles using vent polymerase.
[0621] Following PCR, the product was electrophoresed through a
1.0% agarose gel and the HA 1-K DNA was extracted from the gel
using a Qiagen kit according to the manufacturer's instructions.
The purified HA-K DNA fragment was digested with EcoRI and Kpn I
and the fragment was cloned into pUC19 that had been digested with
EcoRI and KpnI. The plasmid was used to transform E. coli AG-1 to
amp.sup.r. Individual colonies were picked and grown in LB-amp. The
identity of plasmids with the correct insert was determined by
restriction mapping. The resulting plasmid termed pUC19 HA-K was
purified using a Qiagen kit according to the manufacturer's
instructions.
The GM-CSF fragment was cloned by PCR.
TABLE-US-00024 Upstream Primer 5' ACGGTACCGCACCCACCCGCTCACCCATC
Downstream Primer 5' TAGGATCCCGGCCGTCATTTTTGGACTGGTTTTTTGCACG
The PCR primers generate a GM-CSF fragment with [0622] 1. 5' KpnI
site that allows in frame translation from the (G.sub.4S).sub.2
portion of the HA-K molecule to the start of the mature GM-CSF
molecule at amino acid 18. [0623] 2. A termination codon at the 3'
end of the GM-CSF [0624] 3. 3' BamHI site
TABLE-US-00025 [0624] Conditions for PCR were: Denaturation
90.degree. one minute Annealing 60.degree. one minute Extension
72.degree. one minute
PCR was performed for 20 cycles using vent polymerase.
[0625] Following PCR, the product was electrophoresed through a
1.0% agarose gel and the GM-CSF gene was extracted from the gel
using a Qiagen kit according to the manufacturer's instructions.
The purified fragment was digested with Kpn I and BamHI and the
fragment was ligated into pUC19 HA-K plasmid that had been digested
with KpnI and BamHI. The plasmid was used to transform E. coli AG-1
to amp.sup.r. Individual colonies were picked and grown in LB-amp.
The identity of plasmids with the correct insert was determined by
restriction mapping. The resulting plasmid termed pUC19 HA-K-GM-CSF
was purified using a Qiagen kit according to the manufacturer's
instructions.
Example 12
Cloning of HA-K-GM-CSF into Yeast Expression Vector
[0626] PCR of pUC19 HA-K-GM-CSF was used to generate a DNA fragment
encoding HA-K-GM-CSF for cloning into a yeast expression vector.
The PCR product contains Eag I cloning sites for in-frame insertion
into the yeast expression vector.
TABLE-US-00026 Upstream Primer 5' CTGAATTCCGGCCGGACACAATATGTATAGGC
Downstream Primer 5' TAGGATCCCGGCCGTCATTTTTGGACTGGTTTTTTGCACG
TABLE-US-00027 Conditions for PCR were: Denaturation 90.degree. one
minute Annealing 60.degree. one minute Extension 72.degree. one
minute
PCR was performed for 20 cycles using vent polymerase.
[0627] Following PCR, the product was electrophoresed through a
1.0% agarose gel and the HA-K-GM-CSF gene was extracted from the
gel using a Qiagen kit according to the manufacturers instructions.
The purified DNA fragment was digested with Eag I and ligated to
the yeast expression vector ITK, that had been digested with Eag I.
The ITK vector is designed for (1) replication in E. coli and (2)
expression of genes in the yeast Saccharomyces cerevisiae after
stable integration using homologous recombination. The vector
contains: [0628] 1. Sequences for replication of the plasmid in E.
coli [0629] 2. Yeast Gal promoter for expression of heterologous
genes in media containing galactose. [0630] 3. PrePro--Synthetic
DNA sequence, optimized for secretion and signal sequence cleavage
of distal genes in yeast. [0631] 4. Unique Eag I site for cloning
genes to be expressed. [0632] 5. Alpha terminator-DNA sequence for
efficient termination of proximal genes. [0633] 6. Delta sequence
that allows for stable integration of the plasmid by recombination
with endogenous delta sequences in the yeast chromosome. [0634] 7.
Antibiotic resistance gene allowing for selection in E. coli with
kanamycin and selection in yeast with G418.
[0635] This plasmid was used to transform E. coli strain AG-1.
Transformants were selected by growth on LB plates containing 100
ug/ml kanamycin. Individual colonies were grown in LB media
containing kanamycin and plasmids were purified. Restriction
digests determined orientation of inserts. The resulting plasmid
ITK HA-K-GM-CSF was purified using a kit purchased from Qiagen
according to the manufacturer's instructions.
[0636] The purified plasmid was linearized with Mfe 1 and used to
transform the yeast strain Saccharomyces cerevisiae WDHY131 using
lithium acetate (LiAc). A 10 ml culture of S. cerevisiae grown to
saturation at 30.degree. C. in YPD media (per liter/20 g
Bactotryptone; 20 g dextrose; 10 g yeast extract) was used to
inoculate 100 ml of YPD. The culture was grown at 30.degree. C.
with shaking for 3 hours. The yeast were harvested by
centrifugation at 11,000.times.g for 2 minutes and resuspended in
25 ml of sterile water. The yeast were centrifuged as above and
resuspended in 1.0 ml of 100 mM lithium acetate and transferred to
a 1.5 ml microfuge tube. The yeast were pelleted by centrifugation
at 12,000.times.g for 15 seconds and the supernatant removed. The
cells were resuspended in 0.5 ml of 100 mM LiAc. 50 uL of cell
suspension was added to individual microfuge tubes and centrifuged
as above. Supernatant was removed. Transformation mix added to the
yeast pellet consisted of: 240 uL PEG (50% w/v); 36 uL 1.0 M LiAc;
5 uL single stranded DNA (10 mg/ml) and 1 ug of linearized ITK
HA-K-GM-CSF in 75 uL of water. The mixture was vortexed to
resuspend the cell pellet and incubated at 30.degree. for 30
minutes. The cells were then shocked at 42.degree. C. for 15
minutes, centrifuged to pellet cells and resuspended in 0.5 ml of
YPD. Yeast were incubated in YPD media for 3 hours and plated on
YPD plates containing 2 mg/ml G418. Plates were grown at 30.degree.
C. for 3 days until individual colonies appeared. To screen for
expression of HA-K-GM-CSF, individual colonies were grown in 1 ml
of YPD media at 30.degree. C. for 2 days. The cells were
centrifuged at 8,000.times.g for 2 minutes and the YPD media
removed and replaced with 1 ml of YPG media (per liter/20 g
Bactotryptone; 20 g galactose; 10 g yeast extract) for induction
from the gal promoter. Yeast were grown in YPG media for 2 days. At
this time, an aliquot was removed and cells were pelleted. The
supernatant was tested for GM-CSF expression using an ELISA kit
purchased from Endogen. The protocol was according to the
manufacturer.
[0637] A colony expressing high levels of the chimeric protein was
identified. Based on standard curve of soluble GMCSF, expression
level is approximately 2.0 mg/L of soluble material. There is no
decrease in expression levels in the absence of G418.
Example 13
Scale Up Purification of GM-CSF-K-HA
[0638] For scaled-up purification of the chimeric protein, yeast
were inoculated into 500 ml of YPD and grown for three days at
30.degree. C. Cells were pelleted by centrifugation at
12,000.times.g for 2 minutes and transferred to an equal volume of
YPG for an additional three days of growth. The cells were then
pelleted by centrifugation at 12,000.times.g for 2 minutes and the
supernatant collected. The soluble material was applied to an
immunoaffinity column of anti-murine GMCSF monoclonal antibody
(Endogen)) linked to cyanogen bromide-activated Sepharose 4B
(Sigma). Coupling of the monoclonal to the Sepharose was performed
according to the manufacturer. Efficiency of coupling was monitored
using OD.sub.280 and of binding of GMCSF to immobolized antibody
was tested using soluble, commercially available material.
[0639] Soluble yeast-derived material was applied to the column and
allowed to flow by gravity. The column was washed with: (a) 20
volumes of 0.15M NaCl, 25 mM Tris pH 7.4 (TN) (b) 5 volumes of 50
mM Tris pH 8.0 (c) 20 volumes TN. Bound material was then eluted
with 10 volumes of 0.15M NaCl, 25 mM Tris pH 2.5. Eluted material
was neutralized with 1/200 volume of 1.5M Tris pH8.8. The purified
material was concentrated using a Microsep 3K centrifugal devise
(Pall Gelman Laboratory). Yields of chimeric protein were
determined by ELISA (Endogen) according to the manufacturer's
instructions.
[0640] Purified GM-CSF-K-HA
[0641] Purified GM-CSF-K-HA was analyzed by western blot.
Approximately 1 ug of GM-K-HA per lane was electrophoresed along
with soluble GMCSF. For western blot, gels were transferred to
Protran BA83 (Schleicher and Schuell), blocked with TBS (Tris
Buffered Saline) containing 0.05% Tween 20 and 2% Nonfat Dry Milk.
The blot was incubated with primary antibody (rat monoclonal
anti-murine GMCSF, Endogen) at 1:5000 dilution in blocking buffer
for 2 hours at room temperature. The blot was washed with TBS-0.05%
Tween 20. Secondary antibody, alkaline phosphatase conjugated
anti-rat IgG (Sigma) was incubated at 1:10,000 for 1 hour at room
temperature.
Example 14
Decoration of Cells with GM-K-HA
[0642] Purified GM-CSF-K-HA was used to decorate CMS 5 murine
fibrosarcoma cells. CMS 5 cells were grown in DMEM, 10% FBS,
Penicillin-streptomycin, harvested by trypsinization and washed 3
times with RPMI 1640 (Gibco). Cells were diluted to
1.times.10.sup.6/ml in RPMI 1640 and 0.9 ml were aliquoted to
siliconized tubes. Cells were incubated for 2 hours at 37.degree.
C. with shaking and then washed 3 times with PBS containing 2% FBS.
Primary antibody, rat anti-murine GMCSF monoclonal, was incubated
for one hour at 4.degree. C. Cells were washed as above, treated
with FITC labeled anti-rat antibody (Sigma), and incubated for one
hour at 4.degree. C. After additional washing, the cells were
analyzed by flow cytometry, which confirmed the presence of
GM-CSF-K-HA on the surface of the tumor cells.
Example 15
Quantitation of GM-CSF-K-HA on the Cell Surface of CMS 5 Cells
After Decoration
[0643] CMS 5 cells were harvested and washed as described above.
1.times.10.sup.6 cells in 1 ml of RPMI 1640 were incubated with 1
ug of purified GM-K-HA. After incubation for 15 min, 30 min, 1
hour, or 2 hours at 4.degree. C., room temperature, or 37.degree.
C., the cells were washed 3 times with PBS containing 2% FBS. The
cell pellet was lysed with 50 microliters of PBS containing 0.15%
deoxycholate and the detergent subsequently diluted by the addition
of 200 microliters of PBS. The material was serially diluted with
PBS and tested by ELISA (Endogen). Based on the amount of GM-CSF
detected in the cell lysates, it was possible to quantitate the
average number of GM-CSF molecules associated with each cell. For
example, after a 15 min incubation at 4.degree. C., 58,700
molecules were present per cell. After a 15 min incubation at room
temperature, 25,700 molecules were present per cell. After a 15 min
incubation at 37.degree. C., 17,200 molecules were present per
cell.
Example 16
Effective Immunization with Tumor Cells Admixed with
GM-CSF/Hemagglutinin Fusion Polypeptides
[0644] CMS-5 murine fibrosarcoma cells were grown to 70% confluence
in DMEM, 10% FBS, Penicillin-streptomycin, harvested by
trypsinization, and washed 3 times with RPMI 1640. Viability was
determined by trypan blue staining of an aliquot and the cells were
then resuspended at a concentration of 4.times.10.sup.6 cells/ml
and 1 ml aliquots dispensed into siliconized microfuge tubes. The
cells were incubated with 1 ug (microgram) murine GM-CSF-K-HA or 10
ng (nanograms) HA-K-murine GM-CSF per 10.sup.6 cells for 3 hours at
37.degree. C. Cells were then washed 3 times with RPMI 1640 and
resuspended at 4.times.10.sup.6 cells/ml in RPMI 1640. An aliquot
of the cells was removed and the amount of cell-associated GM-CSF
measured by ELISA as described above. There were approximately
20,240 and 18,000 molecules/cell in the GM-CSF-K-HA and HA-K-GM-CSF
groups, respectively. Cells for a control vaccine, to be
administered without a molecule of the invention (or any other
immunomodulator), were prepared in parallel.
[0645] The cells were irradiated at 3500 rads from a .sup.137Cs
source. 8 week-old female Balb/c mice (which are syngeneic for
CMS-5) were anesthetized by metofane inhalation and vaccinated
subcutaneously in the left inguinal fold with 1.times.10.sup.6
cells in 0.25 ml. Each mouse received cells from only one vaccine
type. Seven days later, wild-type CMS-5 cells at 70% confluence
were harvested and washed 3 times in HBSS. Viability was determined
by trypan blue staining of an aliquot and cells were adjusted to
4.times.10.sup.6/ml in HBSS. The previously vaccinated mice were
then injected subcutaneously behind the neck, under metofane
anesthesia, with 2.times.10.sup.6 live, wild-type CMS-5 cells in
0.5 ml HBSS. The groups receiving the HA-K-GM-CSF and control
vaccines each consisted of 5 mice, whereas the group receiving the
GM-CSF-K-HA vaccine consisted of 4 mice because 1 mouse failed to
awaken from anesthesia.
[0646] Tumor development was assessed daily by palpation and visual
inspection. The observer was blinded to the vaccine received by
each set of mice to ensure against bias. Mice were sacrificed by
CO2 asphyxiation when tumors become unwieldy. All mice that had
received the control vaccine developed tumors within 18 days after
challenge with live tumor cells. In contrast, 100% of mice that had
received the GM-CSF-K-HA vaccine and 60% of mice that had received
the HA-K-GM-CSF vaccine remained tumor-free at the end of the
experiment, 40 days after challenge. Thus, immunization with a
composition comprising tumor cells and a molecule of the invention
confers significantly longer tumor-free survival than immunization
with a composition comprising tumor cells but not comprising a
molecule of the invention.
Example 17
Cloning of Human GM-CSF-K-HA
[0647] pUC19 human GM-CSF-K-HA (hGM-CSF-K-HA) is cloned starting
with pUC19 GM-CSF-K-HA. pUC19 GM-CSF-K-HA. is digested with EcoRI
and NgoM IV. EcoRI cuts at the 5' end of the murine GM-CSF coding
sequence and Ngo M IV cuts at the 3' end of the murine GM-CSF
molecule. The resulting plasmid with the murine GM-CSF coding
region removed is purified after electrophoresis through agarose
gel using a kit manufactured by Qiagen. The human GM-CSF coding
segment is generated by PCR from a commercially available human
cDNA library (Clontech). The human sequence begins at amino acid
18, the start of the mature protein, i.e. lacking the secretory
signal sequence. The 3' end corresponds to amino acid 144,
eliminating the endogenous termination codon.
TABLE-US-00028 Upstream hGM-CSF Primer 5'
GCGAATTCCGGCCGGCACCCGCCCGCTCGCCCAGC Downstream hGM-CSF Primer
5'TAGCCGGCCTCCTGGACTGGCTCCCAGCA
TABLE-US-00029 Conditions for PCR are: Denaturation 90.degree. one
minute Annealing 60.degree. one minute Extension 72.degree. one
minute
PCR is performed for 20 cycles using vent polymerase.
[0648] Following PCR, the product is electrophoresed through a 1.0%
agarose gel and the hGM-CSF gene is extracted from the gel using a
Qiagen kit according to the manufacturer's instructions. The
purified hGM-CSF DNA fragment is digested with Eco RI and NgoM IV
and ligated into the pUC 19 murine GM-CSF-K-HA vector that has been
digested with EcoRI and NgoM IV to remove the murine GM-CSF
sequence. The DNA is used to transform E. coli AG1 and
transformants are selected on LB-ampicillin plates. Plasmid DNA
from individual colonies is isolated and digested with restriction
enzymes to identify clone harboring a pUC19 hGM-CSF-K-HA
plasmid.
[0649] The pUC19 hGM-CSF-K-HA plasmid is purified according to the
manufacturer's instructions using a kit purchased from Qiagen. PCR
of pUC19 hGM-CSF-K-HA is used to generate a DNA fragment encoding
hGM-CSF-K-HA for cloning into a yeast expression vector. The PCR
product contains Eag I cloning sites for in frame insertion into
the yeast expression vector.
TABLE-US-00030 Upstream Primer 5'
GCGAATTCCGGCCGGCACCCGCCCGCTCGCCCAGC Downstream Primer 5'
ATGGTACCCGGCCGTTATCATCTGGATTGAATGGACGG
TABLE-US-00031 Conditions for PCR are: Denaturation 90.degree. one
minute Annealing 60.degree. one minute Extension 72.degree. one
minute
PCR is performed for 20 cycles using vent polymerase.
[0650] Following PCR the product is electrophoresed through a 1.0%
agarose gel and the hGM-CSF-K-HA gene is extracted from the gel
using a Qiagen kit according to the manufacturer's instructions.
The purified DNA fragment is digested with Eag I and ligated to the
yeast expression vector ITK that has been digested with Eag I. The
ITK vector is designed for (1) replication in E. coli and (2)
expression of genes in the yeast Saccharomyces cerevisiae after
stable integration using homologous recombination. The vector
contains: [0651] 1. Sequences for replication of the plasmid in E.
coli [0652] 2. Yeast Gal promoter for expression of heterologous
genes in yeast grown in media containing galactose. [0653] 3.
PrePro--Synthetic DNA sequence, optimized for secretion and signal
sequence cleavage of distal genes in yeast. [0654] 4. Unique Eag I
site for cloning genes to be expressed. [0655] 5. Alpha
terminator-DNA sequence for efficient termination of proximal
genes. [0656] 6. Delta sequence that allows for stable integration
of the plasmid by recombination with endogenous delta sequences in
the yeast chromosome. [0657] 7. Antibiotic resistance gene allowing
for selection in E. coli with kanamycin and selection in yeast with
G418.
[0658] This plasmid is used to transform E. coli strain AG-1.
Transformants are selected by growth on LB plates containing 100
ug/ml kanamycin. Individual colonies are grown in LB media
containing kanamycin and plasmids are purified. Restriction digests
determine orientation of inserts. The resulting plasmid ITK
hGM-CSF-K-HA is purified using a kit purchased from Qiagen
according to the manufacturer's instructions.
[0659] The purified plasmid is linearized with Mfe 1 and used to
transform the yeast strain Saccharomyces cerevisiae WDHY131 using
lithium acetate (LiAc). A 10 ml culture of S. cerevisiae grown to
saturation at 30.degree. in YPD media (per liter/20 g
Bactotryptone; 20 g dextrose; 10 g yeast extract) is used to
inoculate 100 ml of YPD. The culture is grown at 30.degree. with
shaking for 3 hours. The yeast are harvested by centrifugation at
11,000.times.g for 2 minutes and resuspended in 25 ml of sterile
water. The yeast are centrifuged as above and resuspended in 1.0 ml
of 100 mM lithium acetate and transferred to a 1.5 ml microfuge
tube. The yeast are pelleted by centrifugation at 12,000.times.g
for 15 seconds and the supernatant removed. The cells are
resuspended in 0.5 ml of 100 mM LiAc. 50 uL of cell suspension is
added to individual microfuge tubes and centrifuged as above.
Supernatant is removed. Transformation mix added to the yeast
pellet consists of: 240 uL PEG (50% w/v); 36 uL 1.0 M LiAc; 5 uL
single stranded DNA (10 mg/ml) and 1 ug of linearized ITK
hGM-CSF-K-HA in 75 uL of water. The mixture is vortexed to
resuspend the cell pellet and incubated at 30.degree. for 30
minutes. The cells are then shocked at 42.degree. for 15 minutes,
centrifuged to pellet, and resuspended in 0.5 ml of YPD. Yeast are
incubated in YPD media for 3 hours and plated on YPD plates
containing 2 mg/ml G418. Plates are grown at 30.degree. for 3 days
until individual colonies appear.
[0660] To screen for expression of hGM-CSF-K-HA, individual
colonies are grown in 1 ml of YPD media at 30.degree. for 2 days.
The cells are centrifuged at 8,000.times.g for 2 minutes and the
YPD media removed and replaced with 1 ml of YPG media (per liter/20
g Bactotryptone; 20 g galactose; 10 g yeast extract) for induction
from the gal promoter. Yeast are grown in YPG media for 2 days. An
aliquot is then removed and the cells are pelleted. The supernatant
is tested for hGM-CSF expression using an ELISA kit purchased from
Endogen. Protocol is according to the manufacturer.
Example 18
Reduction of Metastases in a Mouse Model
[0661] B16F10 murine melanoma cells were harvested and washed three
times in PBS. Cells were then suspended at 5.times.10.sup.5 viable
cells/ml in PBS, with viability determined by staining an aliquot
of cells with Trypan blue. 100 ul of this suspension was injected
into the tail veins of 8-10 week old female C57BL/6 mice. On day 1
or day 3 after tumor challenge, mice were immunized with
1.times.10.sup.6 irradiated B16F10 cells subcutaneously in the left
inguinal fold. Groups (3 mice each) received either cells alone,
cells mixed with 1 ug soluble recombinant murine GM-CSF
(Serologicals Corp.), or cells mixed with 1 ug of a multifunctional
molecule of the invention comprising murine GM-CSF at the N
terminus, a (Gly.sub.4Ser).sub.2 flexible linker, and the HA1
domain of influenza A/PR/8/34 hemagglutinin at the C terminus. The
latter composition comprised both free and cell-bound
multifunctional molecule.
[0662] Mice were sacrificed on day 12, the thoracic cavity opened
with dissecting scissors, and the lungs removed en bloc by tracheal
transection. Metastases were enumerated with a hand lens. In the
mice immunized 1 day after challenge, the average number of
metastases/mouse was as follows:
TABLE-US-00032 Cells alone: 30.00 Cells + GM-CSF: 14.33 Cells +
multifunctional molecule: 0.67
[0663] In the mice immunized 3 days after challenge, the average
number of metastases/mouse was as follows:
TABLE-US-00033 Cells alone: 36.33 Cells + GM-CSF: 10.33 Cells +
multifunctional molecule: 1.00
[0664] Thus, administration of the composition comprising a
multifunctional molecule of the invention was able to effectively
reduce metastases and treat disease.
Example 19
GM-CSF-HA1-Mediated Protection Against Tumor Challenge In Vivo
[0665] As an allogeneic tumor vaccine model, C57BL/6 mice
(haplotype b) were immunized with C3H (haplotype k)-derived K1735
melanoma cells, followed by challenge with C57BL/6-derived B16F10
melanoma cells. K1735 cells were grown to 70% confluence in DMEM
with 10% FBS and penicillin-streptomycin, harvested by
trypsinization, and washed 3 times with RPMI 1640. Viability was
determined by trypan blue staining of an aliquot and the cells were
then resuspended at a concentration of 4.times.10.sup.6 cells/ml
for K1735. One ml aliquots were then dispensed into siliconized
microfuge tubes. The cells were incubated with 1 ug mGM-CSF-HA1 (a
fusion polypeptide consisting of murine GM-CSF at the N terminus, a
(Gly.sub.4Ser).sub.2 linker, and the HA1 domain of influenza
A/PR/8/34) per 10.sup.6 cells for 2 hours at 4.degree. C. An
aliquot of the cells was removed for measurement of cell-associated
GM-CSF by ELISA. Mean cell-associated GM-CSF across two experiments
was approximately 60,000. Cells that were not admixed with any
polypeptide and, in one experiment, cells mixed with 1 ug soluble
murine GM-CSF (Serologicals Corp.) were prepared in parallel as
control vaccines.
[0666] The cells were irradiated at 3500 rads from a .sup.137Cs
source. 8 week-old female C57BL/6 mice were anesthetized by
metofane inhalation and vaccinated subcutaneously in the left
inguinal fold with or 1.times.10.sup.6 cells in 0.25 ml RPMI, along
with a total of 1 ug GM-CSF-HA1 (including bound and free fusion
polypeptide). Each mouse received cells from only one vaccine type.
Seven days later, B16F10 cells, as appropriate, at 70% confluence
were harvested and washed 3 times in HBSS. Viability was determined
by trypan blue staining of an aliquot and cells were adjusted in
HBSS to 1.times.10.sup.5/ml. The previously vaccinated mice were
then challenged subcutaneously behind the neck, under metofane
anesthesia, with 0.5 ml of the B16F10 cell suspension.
[0667] Tumor development was assessed daily by palpation and visual
inspection. "Onset" was defined as the first day on which a tumor
mass was both palpable and visible. The observer was blinded to the
vaccine received by each set of mice to ensure against bias. Mice
were sacrificed by CO2 asphyxiation when tumors become unwieldy.
Experiments were terminated 70 days after tumor challenge, as
planned in advance.
[0668] In pooled results from two experiments, 70 days after
challenge, 7/10 mice that had been vaccinated with cells admixed
with fusion polypeptide remained tumor-free. In contrast, 10/10
mice that had been vaccinated with cells alone developed tumors, as
did 4/5 mice vaccinated with cells admixed with soluble murine
GM-CSF.
Other Embodiments
[0669] The foregoing examples demonstrate experiments performed and
contemplated by the present inventors in making and carrying out
the invention. It is believed that these examples include a
disclosure of techniques which serve to both apprise the art of the
practice of the invention and to demonstrate its usefulness. It
will be appreciated by those of skill in the art that the
techniques and embodiments disclosed herein are preferred
embodiments only that in general numerous equivalent methods and
techniques may be employed to achieve the same result.
[0670] All of the references identified hereinabove, are hereby
expressly incorporated herein by reference to the extent that they
describe, set forth, provide a basis for or enable compositions
and/or methods which may be important to the practice of one or
more embodiments of the present inventions.
Sequence CWU 1
1
31111PRTArtificialSynthetic Peptide Spacer 1Arg Ala Arg Asp Pro Arg
Val Pro Val Ala Thr1 5 10211DNAHomo sapiens 2cgaaaatttc c
113148DNAArtificialSynthetic Oligonucleotide 3aattccgcgc cggcacagtg
ctcagagaca aactggtcaa gtgtgagggc atcagcctgc 60tggctcagaa cacctcgtgg
ctgctgctgc tcctgctgtc cctctccctc ctccaggcca 120cggatttcat
gtccctgtga ctgggtac 1484140DNAArtificialSynthetic Oligonucleotide
4ccagtcacag ggacatgaaa tccgtggcct ggaggaggga gagggacagc aggagcagca
60gcagccacga ggtgttctga gccagcaggc tgatgccctc acacttgacc agtttgtctc
120tgagcactgt gccggcgcgg 140550DNAArtificialSynthetic
Oligonucleotide 5ccgaattcat gtggctgcag aatttacttt tcctgggcat
tgtggtctac 50650DNAArtificialSynthetic Oligonucleotide 6cagccggctt
tttggactgg ttttttgcat tcaaagggga tatcagtcag
50737DNAArtificialSynthetic Oligonucleotide 7gtagccggcg ctagctcggg
gtcttcttcc aagtcta 37840DNAArtificialSynthetic Oligonucleotide
8tacggtaccc ctaggccaca atgaaataag ataccatacc
40926DNAArtificialSynthetic Oligonucleotide 9tacggccggc acccacccgc
tcaccc 261031DNAArtificialSynthetic Oligonucleotide 10tacggccgcc
acaatgaaaa taagatacca t 311138DNAArtificialSynthetic
Oligonucleotide 11gcgaatcccg gccggcaccc gcccgctcgc ccagcccc
381232DNAArtificialSynthetic Oligonucleotide 12cagccggcct
cctggactgg ctcccagcag tc 321332DNAArtificialSynthetic
Oligonucleotide 13tacggccggc acccgcccgc tcgcccagcc cc
321431DNAArtificialSynthetic Oligonucleotide 14tacggccgcc
acaatgaaaa taagatacca t 311542DNAArtificialSynthetic
Oligonucleotide 15ccggcactag tggcggaggg ggctccggcg gcgggggcag cg
421642DNAArtificialSynthetic Oligonucleotide 16ctagcgctgc
ccccgccgcc ggcgccccct ccgccactag tg 421710PRTArtificialSynthetic
Peptide Spacer 17Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser1 5
101826DNAArtificialSynthetic Oligonucleotide 18atgctagcga
cacaatatgt ataggc 261938DNAArtificialSynthetic Oligonucleotide
19atggtacccg gccgttatca tctggattga atggacgg
382026DNAArtificialSynthetic Oligonucleotide 20tacggccggc
acccacccgc tcaccc 262138DNAArtificialSynthetic Oligonucleotide
21atggtacccg gccgttatca tctggattga atggacgg
382232DNAArtificialSynthetic Oligonucleotide 22ctgaattccg
gccggacaca atatgtatag gc 322362DNAArtificialSynthetic
Oligonucleotide 23atggtaccgc tgcccccgcc gccggagccc cctccgccac
ttctggattg aatggacgga 60at 622429DNAArtificialSynthetic
Oligonucleotide 24acggtaccgc acccacccgc tcacccatc
292540DNAArtificialSynthetic Oligonucleotide 25taggatcccg
gccgtcattt ttggactggt tttttgcacg 402632DNAArtificialSynthetic
Oligonucleotide 26ctgaattccg gccggacaca atatgtatag gc
322740DNAArtificialSynthetic Oligonucleotide 27taggatcccg
gccgtcattt ttggactggt tttttgcacg 402835DNAArtificialSynthetic
Oligonucleotide 28gcgaattccg gccggcaccc gcccgctcgc ccagc
352929DNAArtificialSynthetic Oligonucleotide 29tagccggcct
cctggactgg ctcccagca 293035DNAArtificialSynthetic Oligonucleotides
30gcgaattccg gccggcaccc gcccgctcgc ccagc
353138DNAArtificialSynthetic Oligonucleotide 31atggtacccg
gccgttatca tctggattga atggacgg 38
* * * * *