U.S. patent application number 12/320513 was filed with the patent office on 2010-11-18 for antibodies that specifically bind to gmad.
This patent application is currently assigned to Teva Biopharmaceuticals USA, Inc.. Invention is credited to Vivian R. Albert, Kevin P. Baker, Partha Chowdhury.
Application Number | 20100292441 12/320513 |
Document ID | / |
Family ID | 28791904 |
Filed Date | 2010-11-18 |
United States Patent
Application |
20100292441 |
Kind Code |
A1 |
Baker; Kevin P. ; et
al. |
November 18, 2010 |
Antibodies that specifically bind to GMAD
Abstract
The present invention relates to antibodies and related
molecules that immunospecifically bind to GMAD. Such antibodies
have uses, for example, in the prevention and treatment of both
insulin- and non insulin-dependent diabetes mellitus (i.e. Type I
and Type II diabetes) and other related disorders. The invention
also relates to nucleic acid molecules encoding anti-GMAD
antibodies, vectors and host cells containing these nucleic acids,
and methods for producing the same. The present invention relates
to methods and compositions for preventing, detecting, diagnosing,
treating or ameliorating a disease or disorder, especially diabetes
and other related disorders, comprising administering to an animal,
preferably a human, an effective amount of one or more antibodies
or fragments or variants thereof, or related molecules, that
immunospecifically bind to GMAD.
Inventors: |
Baker; Kevin P.;
(Darnestown, MD) ; Albert; Vivian R.; (Rockville,
MD) ; Chowdhury; Partha; (Gaithersburg, MD) |
Correspondence
Address: |
FOLEY AND LARDNER LLP;SUITE 500
3000 K STREET NW
WASHINGTON
DC
20007
US
|
Assignee: |
Teva Biopharmaceuticals USA,
Inc.
|
Family ID: |
28791904 |
Appl. No.: |
12/320513 |
Filed: |
January 28, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10935290 |
Sep 8, 2004 |
7550569 |
|
|
12320513 |
|
|
|
|
PCT/US2003/009625 |
Mar 28, 2003 |
|
|
|
10935290 |
|
|
|
|
60368813 |
Apr 1, 2002 |
|
|
|
Current U.S.
Class: |
530/387.3 ;
435/326; 530/387.1; 530/388.1; 530/391.3; 530/391.7 |
Current CPC
Class: |
C07K 16/18 20130101;
C07K 2317/21 20130101; A61K 47/6843 20170801; A61K 51/1018
20130101; C07K 2317/56 20130101; C07K 2317/622 20130101; A61K
2039/505 20130101; C07K 16/26 20130101 |
Class at
Publication: |
530/387.3 ;
530/387.1; 530/388.1; 530/391.3; 530/391.7; 435/326 |
International
Class: |
C07K 16/18 20060101
C07K016/18; C12N 5/16 20060101 C12N005/16 |
Claims
1.-43. (canceled)
44. An isolated antibody or fragment thereof comprising: (a) an
amino acid sequence comprising the VH domain of SEQ ID NO: 43; and
(b) an amino acid sequence comprising the VL domain of SEQ ID NO:
43; wherein said antibody or fragment thereof specifically binds a
GMAD polypeptide.
45. The antibody or fragment thereof of claim 44, wherein the
antibody or fragment thereof is selected from the group consisting
of: (a) a whole immunoglobulin molecule; (b) an scFv; (c) a Fab
fragment; (d) an Fab' fragment; (e) an F(ab').sub.2; (f) an Fv; and
(g) a disulfide linked Fv.
46. The antibody or fragment thereof of claim 44 wherein the
antibody or fragment thereof is monoclonal, human, chimeric, or
humanized.
47. The antibody or fragment thereof of claim 44 which comprises a
heavy chain immunoglobulin constant domain selected from the group
consisting of: (a) a human IgM constant domain; (b) a human IgG1
constant domain; (c) a human IgG2 constant domain; (d) a human IgG3
constant domain; (e) a human IgG4 constant domain; and (f) a human
IgA constant domain.
48. The antibody or fragment thereof of claim 44 which comprises a
light chain immunoglobulin constant domain selected from the group
consisting of: (a) a human Ig kappa constant domain; and (b) a
human Ig lambda constant domain.
49. The antibody or fragment thereof of claim 44 wherein the
antibody or fragment thereof is conjugated to a detectable
label.
50. The antibody or fragment thereof of claim 49, wherein the
detectable label is a radiolabel.
51. The antibody or fragment thereof of claim 50, wherein the
radiolabel is .sup.125I, .sup.131I, .sup.111In, .sup.90Y,
.sup.99Tc, .sup.177Lu, .sup.166Ho, or .sup.153Sm.
52. The antibody or fragment thereof of claim 49, wherein the
detectable label is an enzyme, a fluorescent label, a luminescent
label, or a bioluminescent label.
53. The antibody or fragment thereof of claim 44 wherein the
antibody or fragment thereof is biotinylated.
54. The antibody or fragment thereof of claim 44 wherein the
antibody or fragment thereof is conjugated to a therapeutic or
cytotoxic agent.
55. The antibody or fragment thereof of claim 54, wherein the
therapeutic or cytotoxic agent is an anti-metabolite, an alkylating
agent, an antibiotic, a growth factor, a cytokine, an
anti-angiogenic agent, an anti-mitotic agent, an anthracycline, a
toxin, or an apoptotic agent.
56. The antibody or fragment thereof of claim 44 wherein the
antibody or fragment thereof is attached to a solid support.
57. The antibody or fragment thereof of claim 44 wherein the
antibody or fragment thereof specifically binds a GMAD polypeptide
in a Western blot.
58. The antibody or fragment thereof of claim 44 wherein the
antibody or fragment thereof specifically binds a GMAD polypeptide
in an ELISA.
59. An isolated cell that produces the antibody or fragment thereof
of claim 44.
60. The antibody or fragment thereof of claim 44 wherein the
antibody or fragment thereof inhibits the activity of a GMAD
polypeptide or a fragment thereof.
61. The antibody or fragment thereof of claim 60 wherein the
antibody or fragment thereof diminishes or abolishes the ability of
a GMAD polypeptide or a fragment thereof to bind to its
receptor.
62. The antibody or fragment thereof of claim 60 wherein the
antibody or fragment thereof diminishes or abolishes the ability of
a GMAD polypeptide or a fragment thereof to inhibit insulin
action.
63. A kit comprising the antibody or fragment thereof of claim
44.
64. The kit of claim 63, comprising a control antibody.
65. The kit of claim 63, wherein the antibody or fragment thereof
is coupled or conjugated to a detectable label.
66. An isolated antibody comprising SEQ ID NO: 43, wherein the
antibody specifically binds a GMAD polypeptide.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of International
Application No. PCT/US03/09625, filed Mar. 28, 2003, which claims
benefit under 35 U.S.C. .sctn.119(e) of U.S. Provisional
Application No. 60/368,813, filed Apr. 1, 2002, each of which is
hereby incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to antibodies and related
molecules that immunospecifically bind to GMAD. Such antibodies
have uses, for example, in the prevention and treatment of both
insulin- and non insulin-dependent diabetes mellitus (i.e. Type I
and Type II diabetes) and other related disorders. The invention
also relates to nucleic acid molecules encoding anti-GMAD
antibodies, vectors and host cells containing these nucleic acids,
and methods for producing the same. The present invention relates
to methods and compositions for preventing, detecting, diagnosing,
treating or ameliorating a disease or disorder, especially diabetes
and other related disorders, comprising administering to an animal,
preferably a human, an effective amount of one or more antibodies
or fragments or variants thereof, or related molecules, that
immunospecifically bind to GMAD.
BACKGROUND OF THE INVENTION
[0003] Over the past few decades, an increasing percentage of the
population has become diabetic. Diabetes mellitus is categorized
into two types: Type I, known as Insulin-Dependent Diabetes
Mellitus (IDDM), or Type H, known as Non-Insulin-Dependent Diabetes
Mellitus (NIDDM). IDDM is an autoimmune disorder in which the
insulin-secreting pancreatic beta cells of the islets of Langerhans
are destroyed. In these individuals, recombinant insulin therapy is
employed to maintain glucose homeostasis and normal energy
metabolism. NIDDM, on the other hand, is a polygenic disorder with
no one gene responsible for the progression of the disease.
[0004] In NIDDM, insulin resistance eventually leads to the
abolishment of insulin secretion resulting in insulin deficiency.
Insulin resistance, at least in part, ensues from a block at the
level of glucose uptake and phosphorylation in humans. Diabetics
demonstrate a decrease in expression in adipose tissue of
insulin-receptor substrate 1 ("IRS1") (Carvalho et al., FASEB J
13(15):2173-8 (1999)), glucose transporter 4 ("GLUT4") (Garvey et
al., Diabetes 41(4):465-75 (1992)), and the novel abundant protein
M gene transcript 1 ("apM1") (Statnick et al., Int J Exp Diabetes
1(2): 81-8 (2000)), as well as other as of yet unidentified
factors. Insulin deficiency in NIDDM leads to failure of normal
pancreatic beta-cell function and eventually to pancreatic-beta
cell death.
[0005] NIDDM is also characterized by target-tissue resistance to
insulin, that cannot be overcome by beta cell hypersecretion.
Insulin resistance is accompanied by increased adiposity, which in
turn leads to obesity. A polypeptide known as GMAD (also known as
Resistin) is specifically secreted by adipocytes, leading to a
decrease in insulin action (e.g., glucose transport), and a
subsequent increase in adiposity in animal models (Steppan et. al.,
Nature, vol 409, 18, 307-12 (2001)). In addition, secretion of the
GMAD polypeptide has been shown to lead to increased insulin
resistance by adipocytes, whereas an inhibition of GMAD leads to an
increase in insulin action and thus an increase in cellular glucose
uptake (Steppan et. al., Nature, vol 409, 18, 307-12 (2001)).
[0006] Insulin affects fat, muscle, and liver. Insulin is the major
regulator of energy metabolism. Malfunctioning of any step(s) in
insulin secretion and/or action can lead to many disorders,
including for example the dysregulation of oxygen utilization,
adipogenesis, glycogenesis, lipogenesis, glucose uptake, protein
synthesis, thermogenesis, and maintenance of the basal metabolic
rate. This malfunctioning results in diseases and/or disorders that
include, but are not limited to, diabetes (e.g.,
Non-Insulin-Dependent Diabetes Mellitus (NIDDM)), insulin
resistance, insulin deficiency, hyperinsulinemia, hyperglycemia,
hyperlipidemia, hyperketonemia, dyslipidemia, hypertension,
coronary artery disease, renal failure, neuropathy (e.g., autonomic
neuropathy, parasympathetic neuropathy, and polyneuropathy),
metabolic disorders (e.g., glucose metabolic disorders), endocrine
disorders, obesity, weight loss, liver disorders (e.g., liver
disease, cirrhosis of the liver, and disorders associated with
liver transplant), stroke and conditions associated with these
disorders.
[0007] Numerous debilitating diabetes-related secondary effects
include, but are not limited to, obesity, forms of blindness
(cataracts and diabetic retinopathy), limb amputations, kidney
failure, fatty liver, coronary artery disease, stroke and
neuropathy. Some of the current drugs used to treat insulin
resistance and/or diabetes (e.g., insulin secratogogues such as
sulfonylurea, insulin sensitizers such as thiazolidenediones and
metformin, and a-glucosidase and lipase inhibitors) are inadequate
due to the dosage amounts and frequency with which they have to be
administered as a result of poor pharmacokinetic properties, the
lack of effective control over blood sugar levels, and potential
side effects, among other reasons. Diabetes therapeutic proteins,
in their native state or when recombinantly produced, exhibit a
rapid in vivo clearance. Typically, significant amounts of
therapeutics are required to be effective during therapy. In
addition, small molecules smaller than the 20 kDa range can be
readily filtered through the renal tubules (glomerulus) leading to
dose-dependent nephrotoxicity.
[0008] The discovery of a new composition that regulates glucose
metabolism satisfies a need in the art by providing new
compositions which are useful in the diagnosis, treatment,
prevention and/or prognosis of diabetes, as well as endocrine
disorders, hyperglycemia, liver disorders, inflammation, and
aberrant cell growth. Furthermore, the identification of a new
composition that regulates glucose metabolism permits the
development of a range of derivatives, agonists and antagonists
which in turn have applications in the diagnosis, treatment,
prevention and/or prognosis of a range of conditions such as
diabetes, musculoskeletal disorders, cartilage and bone growth
disorders, liver disorders, inflammation, and aberrant cell
growth.
SUMMARY OF THE INVENTION
[0009] The present invention encompasses antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) that immunospecifically bind to a
GMAD polypeptide or polypeptide fragment or variant of a GMAD. In
particular, the invention encompasses antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) that immunospecifically bind to a
polypeptide or polypeptide fragment or variant of human GMAD such
as those of SEQ ID NO:2.
[0010] The present invention relates to methods and compositions
for preventing, treating or ameliorating a disease or disorder
comprising administering to an animal, preferably a human, an
effective amount of one or more antibodies or fragments or variants
thereof, or related molecules, that specifically bind to a GMAD
polypeptide or a fragment or variant thereof. In specific
embodiments, the present invention relates to methods and
compositions for preventing, treating or ameliorating a disease or
disorder associated with GMAD function or aberrant GMAD expression,
comprising administering to an animal, preferably a human, an
effective amount of one or more antibodies or fragments or variants
thereof, or related molecules, that immunospecifically bind to a
GMAD polypeptide or a fragment or variant thereof. In highly
preferred embodiments, the present invention relates to
antibody-based methods and compositions for preventing, treating or
ameliorating Non-Insulin Dependent Diabetes Mellitus (NIDDM) and/or
conditions associated with NIDDM. Other diseases and disorders
which can be treated, prevented or ameliorated with the antibodies
of the invention include, but are not limited to, insulin
resistance, insulin deficiency, hyperinsulinemia, hyperglycemia,
hyperlipidemia, hyperketonemia, dyslipidemia, hypertension,
coronary artery disease, renal failure, neuropathy (e.g., autonomic
neuropathy, parasympathetic neuropathy, and polyneuropathy),
metabolic disorders (e.g., glucose metabolic disorders), endocrine
disorders, obesity, weight loss, liver disorders (e.g., liver
disease, cirrhosis of the liver, and disorders associated with
liver transplant), stroke and conditions associated with these
disorders.
[0011] The present invention also encompasses methods and
compositions for detecting, diagnosing, or prognosing diseases or
disorders comprising administering to an animal, preferably a
human, an effective amount of one or more antibodies or fragments
or variants thereof, or related molecules, that specifically bind
to GMAD or a fragment or variant thereof. In specific embodiments,
the present invention also encompasses methods and compositions for
detecting, diagnosing, or prognosing diseases or disorders
associated with GMAD function or GMAD receptor function or aberrant
GMAD or GMAD receptor expression, comprising administering to an
animal, preferably a human, an effective amount of one or more
antibodies or fragments or variants thereof, or related molecules,
that specifically bind to GMAD or a fragment or variant thereof. In
highly preferred embodiments, the present invention relates to
antibody-based methods and compositions for detecting, diagnosing,
or prognosing Non-Insulin Dependent Diabetes Mellitus (NIDDM)
and/or conditions associated with NIDDM. Other diseases and
disorders which can be detected, diagnosed, or prognosed with the
antibodies of the invention include, but are not limited to,
insulin resistance, insulin deficiency, hyperinsulinemia,
hyperglycemia, hyperlipidemia, hyperketonemia, dyslipidemia,
hypertension, coronary artery disease, renal failure, neuropathy
(e.g., autonomic neuropathy, parasympathetic neuropathy, and
polyneuropathy), metabolic disorders (e.g., glucose metabolic
disorders), endocrine disorders, obesity, weight loss, liver
disorders (e.g., liver disease, cirrhosis of the liver, and
disorders associated with liver transplant), inflammatory disorders
(e.g., asthma, allergic disorders) stroke and proliferative
disorders.
[0012] Another embodiment of the present invention includes the use
of the antibodies of the invention as a diagnostic tool to monitor
the expression of GMAD expression on cells.
[0013] Single chain Fv's (scFvs) that specifically bind GMAD
polypeptides (SEQ ID NO:2) have been generated. Thus, the invention
encompasses these scFvs, listed in Table 1. In addition, the
invention encompasses cell lines engineered to express antibodies
corresponding to these scFvs which are deposited with the American
Type Culture Collection ("ATCC") as of the dates listed in Table 1
and given the ATCC Deposit Numbers identified in Table 1. The ATCC
is located at 10801 University Boulevard, Manassas, Va. 20110-2209,
USA. The ATCC deposit was made pursuant to the terms of the
Budapest Treaty on the international recognition of the deposit of
microorganisms for purposes of patent procedure.
[0014] Further, the present invention encompasses polynucleotides
encoding the scFvs, as well as the amino acid sequences of the
scFvs. Molecules comprising, or alternatively consisting of,
fragments or variants of these scFvs (e.g., VH domains, VH CDRs, VL
domains, or VL CDRs having an amino acid sequence of any one of the
scFvs referred to in Table 1), that specifically bind to GMAD
polypeptides or fragments or variants thereof are also encompassed
by the invention, as are nucleic acid molecules that encode these
antibodies and/or molecules. In highly preferred embodiments, the
present invention encompasses antibodies, or fragments or variants
thereof, that bind to the mature form of the GMAD polypeptide (or
fragments and variants thereof).
[0015] The present invention also provides anti-GMAD antibodies
which are coupled to a detectable label, such as an enzyme, a
fluorescent label, a luminescent label, or a bioluminescent label.
The present invention also provides anti-GMAD antibodies which are
coupled to a therapeutic or cytotoxic agent. The present invention
also provides anti-GMAD antibodies which are coupled to a
radioactive material.
[0016] The present invention further provides antibodies that
inhibit or abolish GMAD activity. In highly preferred embodiments
of the present invention, anti-GMAD antibodies of the present
invention are used to treat, prevent or ameliorate NIDDM and/or
conditions associated with NIDDM. In other highly preferred
embodiments, anti-GMAD antibodies of the present invention are
administered to an individual alone or in combination with other
therapeutic compounds to treat, prevent or ameliorate NIDDM.
[0017] The present invention also provides antibodies that
specifically bind one or more GMAD polypeptides and act as either
GMAD agonists or GMAD antagonists. In specific embodiments, the
antibodies of the invention inhibit the differentiation of GMAD or
GMAD receptor expressing cells (e.g., adipocytes). In other
specific embodiments, the antibodies of the invention downregulate
or inhibit GMAD expression and thereby promote glucose uptake.
[0018] In further embodiments, the antibodies of the invention have
a dissociation constant (K.sub.D) of 10.sup.-7 M or less. In
preferred embodiments, the antibodies of the invention have a
dissociation constant (K.sub.D) of 10.sup.-9 M or less.
[0019] In further embodiments, antibodies of the invention have an
off rate (k.sub.off) of 10.sup.-3/sec or less. In preferred
embodiments, antibodies of the invention have an off rate
(k.sub.off) of 10.sup.4/sec or less. In other preferred
embodiments, antibodies of the invention have an off rate
(k.sub.off) of 10.sup.-5/sec or less.
[0020] The present invention also provides panels of antibodies
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants) wherein the panel members
correspond to one, two, three, four, five, ten, fifteen, twenty, or
more different antibodies of the invention (e.g., whole antibodies,
Fabs, F(ab').sub.2 fragments, Fd fragments, disulfide-linked Fvs
(sdFvs), anti-idiotypic (anti-Id) antibodies, and scFvs).
[0021] The present invention further provides mixtures of
antibodies, wherein the mixture corresponds to one, two, three,
four, five, ten, fifteen, twenty, or more different antibodies of
the invention (e.g., whole antibodies, Fabs, F(ab').sub.2
fragments, Fd fragments, disulfide-linked Fvs (sdFvs),
anti-idiotypic (anti-Id) antibodies, and scFvs)). The present
invention also provides for compositions comprising, or
alternatively consisting of, one, two, three, four, five, ten,
fifteen, twenty, or more antibodies of the present invention
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof). A composition of the
invention may comprise, or alternatively consist of, one, two,
three, four, five, ten, fifteen, twenty, or more amino acid
sequences of one or more antibodies or fragments or variants
thereof. Alternatively, a composition of the invention may
comprise, or alternatively consist of, nucleic acid molecules
encoding one or more antibodies of the invention.
[0022] The present invention also provides for fusion proteins
comprising an antibody (including molecules comprising, or
alternatively consisting of, antibody fragments or variants
thereof) of the invention, and a heterologous polypeptide (i.e., a
polypeptide unrelated to an antibody or antibody domain). Nucleic
acid molecules encoding these fusion proteins are also encompassed
by the invention. A composition of the present invention may
comprise, or alternatively consist of, one, two, three, four, five,
ten, fifteen, twenty or more fusion proteins of the invention.
Alternatively, a composition of the invention may comprise, or
alternatively consist of, nucleic acid molecules encoding one, two,
three, four, five, ten, fifteen, twenty or more fusion proteins of
the invention.
[0023] The present invention also provides for a nucleic acid
molecule(s), generally isolated, encoding an antibody (including
molecules, such as scFvs, VH domains, or VL domains, that comprise,
or alternatively consist of, an antibody fragment or variant
thereof) of the invention. The present invention also provides a
host cell transformed with a nucleic acid molecule of the invention
and progeny thereof. The present invention also provides a method
for the production of an antibody (including a molecule comprising,
or alternatively consisting of, an antibody fragment or variant
thereof) of the invention. The present invention further provides a
method of expressing an antibody (including a molecule comprising,
or alternatively consisting of, an antibody fragment or variant
thereof) of the invention from a nucleic acid molecule. These and
other aspects of the invention are described in further detail
below.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0024] The term "antibody," as used herein, refers to
immunoglobulin molecules and immunologically active portions of
immunoglobulin molecules, i.e., molecules that contain an antigen
binding site that specifically binds an antigen. As such, the term
antibody encompasses not only whole antibody molecules, but also
antibody multimers and antibody fragments as well as variants
(including derivatives) of antibodies, antibody multimers and
antibody fragments. Examples of molecules which are described by
the term "antibody" herein include, but are not limited to: single
chain Fvs (scFvs), Fab fragments, Fab' fragments, F(ab').sub.2,
disulfide linked Fvs (sdFvs), Fvs, and fragments comprising or
alternatively consisting of, either a VL or a VH domain. The term
"single chain Fv" or "scFv" as used herein refers to a polypeptide
comprising a VL domain of antibody linked to a VH domain of an
antibody. Antibodies that specifically bind to GMAD may have
cross-reactivity with other antigens. Preferably, antibodies that
specifically bind to GMAD do not cross-react with other antigens.
Antibodies that specifically bind to GMAD can be identified, for
example, by immunoassays or other techniques known to those of
skill in the art, e.g., the immunoassays described in the Examples
below.
[0025] Antibodies of the invention include, but are not limited to,
monoclonal, multispecific, human or chimeric antibodies, single
chain antibodies, Fab fragments, F(ab') fragments, anti-idiotypic
(anti-Id) antibodies (including, e.g., anti-Id antibodies to
antibodies of the invention), intracellularly-made antibodies
(i.e., intrabodies), and epitope-binding fragments of any of the
above. The immunoglobulin molecules of the invention can be of any
type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g.,
IgG.sub.1, IgG.sub.2, IgG.sub.3, IgG.sub.4, IgA.sub.1 and
IgA.sub.2) or subclass of immunoglobulin molecule. Preferably, an
antibody of the invention comprises, or alternatively consists of,
a VH domain, VH CDR, VL domain, or VL CDR having an amino acid
sequence of any one of those referred to in Table 1, or a fragment
or variant thereof. In a preferred embodiment, the immunoglobulin
is an IgG1 isotype. In another preferred embodiment, the
immunoglobulin is an IgG4 isotype. Immunoglobulins may have both a
heavy and light chain. An array of IgG, IgE, IgM, IgD, IgA, and IgY
heavy chains may be paired with a light chain of the kappa or
lambda forms.
[0026] Antibodies of the invention may also include multimeric
forms of antibodies. For example, antibodies of the invention may
take the form of antibody dimers, trimers, or higher-order
multimers of monomeric immunoglobulin molecules. Dimers of whole
immunoglobulin molecules or of F(ab')2 fragments are tetravalent,
whereas dimers of Fab fragments or scFv molecules are bivalent.
Individual monomers withon an antibody multimer may be identical or
different, i.e., they may be heteromeric or homomeric antibody
multimers. For example, individual antibodies within a multimer may
have the same or different binding specificities.
[0027] Multimerization of antibodies may be accomplished through
natural aggregation of antibodies or through chemical or
recombinant linking techniques known in the art. For example, some
percentage of purified antibody preparations (e.g., purified IgG1
molecules) spontaneously form protein aggregates containing
antibody homodimers, and other higher-order antibody multimers.
Alternatively, antibody homodimers may be formed through chemical
linkage techniques known in the art. For example,
heterobifunctional crosslinking agents including, but not limited
to, SMCC [succinimidyl
4-(maleimidomethyl)cyclohexane-1-carboxylate] and SATA
[N-succinimidyl S-acethylthio-acetate] (available, for example,
from Pierce Biotechnology, Inc. (Rockford, Ill.)) can be used to
form antibody multimers. An exemplary protocol for the formation of
antibody homodimers is given in Ghetie et al., Proceedings of the
National Academy of Sciences USA (1997) 94:7509-7514, which is
hereby incorporated by reference in its entirety. Antibody
homodimers can be converted to Fab'2 homodimers through digestion
with pepsin. Another way to form antibody homodimers is through the
use of the autophilic T15 peptide described in Zhao and Kohler, The
Journal of Immunology (2002) 25:396-404, which is hereby
incorporated by reference in its entirety.
[0028] Alternatively, antibodies can be made to multimerize through
recombinant DNA techniques. IgM and IgA naturally form antibody
multimers through the interaction with the J chain polypeptide.
Non-IgA or non-IgM molecules, such as IgG molecules, can be
engineered to contain the J chain interaction domain of IgA or IgM,
thereby conferring the ability to form higher order multimers on
the non-IgA or non-IgM molecules. (see, for example,
Chintalacharuvu et al., (2001) Clinical Immunology 101:21-31. and
Frigerio et al., (2000) Plant Physiology 123:1483-94., both of
which are hereby incorporated by reference in their entireties.)
ScFv dimers can also be formed through. recombinant techniques
known in the art; an example of the construction of scFv dimers is
given in et al., (2000) Cancer Research 60:6964-6971 which is
hereby incorporated by reference in its entirety. Antibody
multimers may be purified using any suitable method known in the
art, including, but not limited to, size exclusion
chromatography.
[0029] By "isolated antibody" is intended an antibody removed from
its native environment. Thus, an antibody produced by, purified
from and/or contained within a hybridoma and/or a recombinant host
cell is considered isolated for purposes of the present
invention.
[0030] Unless otherwise defined in the specification, specific
binding or immunospecifc binding by an anti-GMAD antibody means
that the anti-GMAD antibody binds GMAD but does not significantly
bind to (i.e., cross react with) proteins other than GMAD, such as
other proteins in the same family of proteins). An antibody that
binds GMAD protein and does not cross-react with other proteins is
not necessarily an antibody that does not bind said other proteins
in all conditions; rather, the GMAD-specific antibody of the
invention preferentially binds GMAD compared to its ability to bind
said other proteins such that it will be suitable for use in at
least one type of assay or treatment, i.e., give low background
levels or result in no unreasonable adverse effects in treatment.
It is well known that the portion of a protein bound by an antibody
is known as the epitope. An epitope may either be linear (i.e.,
comprised of sequential amino acids residues in a protein
sequences) or conformational (i.e., comprised of one or more amino
acid residues that are not contiguous in the primary structure of
the protein but that are brought together by the secondary,
tertiary or quatemary structure of a protein). Given that
GMAD-specific antibodies bind to epitopes of GMAD, an antibody that
specifically binds GMAD may or may not bind fragments of GMAD
and/or variants of GMAD (e.g., proteins that are at least 90%
identical to GMAD) depending on the presence or absence of the
epitope bound by a given GMAD-specific antibody in the GMAD
fragment or variant. Likewise, GMAD-specific antibodies of the
invention may bind species orthologues of GMAD (including fragments
thereof) depending on the presence or absence of the epitope
recognized by the antibody in the orthologue. Additionally,
GMAD-specific antibodies of the invention may bind modified forms
of GMAD, for example, GMAD fusion proteins. In such a case when
antibodies of the invention bind GMAD fusion proteins, the antibody
must make binding contact with the GMAD moiety of the fusion
protein in order for the binding to be specific. Antibodies that
specifically bind to GMAD can be identified, for example, by
immunoassays or other techniques known to those of skill in the
art, e.g., the immunoassays described in the Examples below.
[0031] The term "variant" as used herein refers to a polypeptide
that possesses a similar or identical amino acid sequence as a GMAD
polypeptide, a fragment of a GMAD polypeptide, an anti-GMAD
antibody and/or antibody fragment thereof. A variant having a
similar amino acid sequence refers to a polypeptide that satisfies
at least one of the following: (a) a polypeptide comprising, or
alternatively consisting of, an amino acid sequence that is at
least 30%, at least 35%, at least 40%, at least 45%, at least 50%,
at least 55%, at least 60%, at least 65%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95% or at
least 99% identical to the amino acid sequence of a GMAD
polypeptide, or a fragment thereof, an anti-GMAD antibody or
antibody fragment thereof (including a VH domain, VHCDR, VL domain,
or VLCDR having an amino acid sequence of any one of those of one
or more scFvs referred to in Table 1) described herein; (b) a
polypeptide encoded by a nucleotide sequence, the complementary
sequence of which hybridizes under stringent conditions to a
nucleotide sequence encoding a GMAD polypeptide (e.g., SEQ ID
NO:2), a fragment of a GMAD polypeptide, an anti-GMAD antibody or
antibody fragment thereof (including a VH domain, VHCDR, VL domain,
or VLCDR having an amino acid sequence of any one of those referred
to in Table 1), described herein, of at least 5 amino acid
residues, at least 10 amino acid residues, at least 15 amino acid
residues, at least 20 amino acid residues, at least 25 amino acid
residues, at least 30 amino acid residues, at least 40 amino acid
residues, at least 50 amino acid residues, at least 60 amino
residues, at least 70 amino acid residues, at least 80 amino acid
residues, at least 90 amino acid residues, at least 100 amino acid
residues, at least 125 amino acid residues, or at least 150 amino
acid residues; and (c) a polypeptide encoded by a nucleotide
sequence that is at least 30%, at least 35%, at least 40%, at least
45%, at least 50%, at least 55%, at least 60%, at least 65%, at
least 70%, at least 75%, at least 80%, at least 85%, at least 90%,
at least 95% or at least 99%, identical to the nucleotide sequence
encoding a GMAD polypeptide, a fragment of a GMAD polypeptide, an
anti-GMAD antibody or antibody fragment thereof (including a VH
domain, VHCDR, VL domain, or VLCDR having an amino acid sequence of
any one of those of one or more scFvs referred to in Table 1),
described herein. Preferably, a variant GMAD polypeptide, a variant
fragment of a GMAD polypeptide, or a variant anti-GMAD antibody
and/or antibody fragment possess similar or identical function
and/or structure as the reference GMAD polypeptide, the reference
fragment of a GMAD polypeptide, or the reference anti-GMAD antibody
and/or antibody fragment, respectively.
[0032] A polypeptide with similar structure to a GMAD polypeptide,
a fragment of a GMAD polypeptide, an anti-GMAD antibody or antibody
fragment thereof, described herein refers to a polypeptide that has
a similar secondary, tertiary or quaternary structure of a GMAD
polypeptide, a fragment of a GMAD polypeptide, an anti-GMAD
antibody, or antibody fragment thereof, described herein. The
structure of a polypeptide can be determined by methods known to
those skilled in the art, including but not limited to, X-ray
crystallography, nuclear magnetic resonance, and crystallographic
electron microscopy.
[0033] To determine the percent identity of two amino acid
sequences or of two nucleic acid sequences, the sequences are
aligned for optimal comparison purposes (e.g., gaps can be
introduced in the sequence of a first amino acid or nucleic acid
sequence for optimal alignment with a second amino acid or nucleic
acid sequence). The amino acid residues or nucleotides at
corresponding amino acid positions or nucleotide positions are then
compared. When a position in the first sequence is occupied by the
same amino acid residue or nucleotide at the corresponding position
in the second sequence, then the molecules are identical at that
position. The percent identity between the two sequences is a
function of the number of identical positions shared by the
sequences (i.e., % identity=number of identical overlapping
positions/total number of positions.times.100%). In one embodiment,
the two sequences are the same length.
[0034] The determination of percent identity between two sequences
can be accomplished using a mathematical algorithm known to those
of skill in the art. An example of a mathematical algorithm for
comparing two sequences is the algorithm of Karlin and Altschul
Proc. Natl. Acad. Sci. USA 87:2264-2268(1990), modified as in
Karlin and Altschul Proc. Natl. Acad. Sci. USA 90:5873-5877(1993).
The BLASTn and BLASTx programs of Altschul, et al. J. Mol. Biol.
215:403-410(1990) have incorporated such an alogrithm. BLAST
nucleotide searches can be performed with the BLASTn program
(score=100, wordlength=12) to obtain nucleotide sequences
homologous to a nucleic acid molecules of the invention. BLAST
protein searches can be performed with the BLASTx program
(score=50, wordlength=3) to obtain amino acid sequences homologous
to a protein molecules of the invention. To obtain gapped
alignments for comparison purposes, Gapped BLAST can be utilized as
described in Altschul et al. Nucleic Acids Res. 25:3589-3402(1997).
Alternatively, PSI-BLAST can be used to perform an iterated search
which detects distant relationships between molecules (Id.). When
utilizing BLAST, Gapped BLAST, and PSI-BLAST programs, the default
parameters of the respective programs (e.g., BLASTx and BLASTn) can
be used.
[0035] Another example of a mathematical algorithm utilized for the
comparison of sequences is the algorithm of Myers and Miller,
CABIOS (1989). The ALIGN program (version 2.0) which is part of the
GCG sequence alignment software package has incorporated such an
alogrithm. Other algorithms for sequence analysis known in the art
include ADVANCE and ADAM as described in Torellis and Robotti
Comput. Appl. Biosci., 10:3-5(1994); and FASTA described in Pearson
and Lipman Proc. Natl. Acad. Sci. 85:2444-8(1988). Within FASTA,
ktup is a control option that sets the sensitivity and speed of the
search.
[0036] The term "derivative" as used herein, refers to a variant
polypeptide of the invention that comprises, or alternatively
consists of, an amino acid sequence of a GMAD polypeptide, a
fragment of a GMAD polypeptide, or an antibody of the invention
which has been altered by the introduction of amino acid residue
substitutions, deletions or additions. The term "derivative" as
used herein also refers to a GMAD polypeptide, a fragment of a GMAD
polypeptide, or an antibody that specifically binds to a GMAD
polypeptide which has been modified, e.g., by the covalent
attachment of any type of molecule to the polypeptide. For example,
but not by way of limitation, a GMAD polypeptide, a fragment of a
GMAD polypeptide, or an anti-GMAD antibody, may be modified, e.g.,
by glycosylation, acetylation, pegylation, phosphorylation,
amidation, derivatization by known protecting/blocking groups,
proteolytic cleavage, linkage to a cellular ligand or other
protein, etc. A derivative of a GMAD polypeptide, a fragment of a
GMAD polypeptide, or an anti-GMAD antibody, may be modified by
chemical modifications using techniques known to those of skill in
the art, including, but not limited to, specific chemical cleavage,
acetylation, formylation, metabolic synthesis of tunicamycin, etc.
Further, a derivative of a GMAD polypeptide, a fragment of a GMAD
polypeptide, or an anti-GMAD antibody, may contain one or more
non-classical amino acids. A polypeptide derivative possesses a
similar or identical function as a GMAD polypeptide, a fragment of
a GMAD polypeptide, or an anti-GMAD receptor antibody, described
herein.
[0037] The term "fragment" as used herein refers to a polypeptide
comprising an amino acid sequence of at least 5 amino acid
residues, at least 10 amino acid residues, at least 15 amino acid
residues, at least 20 amino acid residues, at least 25 amino acid
residues, at least 30 amino acid residues, at least 35 amino acid
residues, at least 40 amino acid residues, at least 45 amino acid
residues, at least 50 amino acid residues, at least 60 amino
residues, at least 70 amino acid residues, at least 80 amino acid
residues, at least 90 amino acid residues, or at least 100 amino
acid residues of the amino acid sequence of GMAD, or an anti-GMAD
antibody (including molecules such as scFv's, that comprise, or
alternatively consist of, antibody fragments or variants thereof)
that specifically binds to GMAD.
[0038] The term "host cell" as used herein refers to the particular
subject cell transfected with a nucleic acid molecule and the
progeny or potential progeny of such a cell. Progeny may not be
identical to the parent cell transfected with the nucleic acid
molecule due to mutations or environmental influences that may
occur in succeeding generations or integration of the nucleic acid
molecule into the host cell genome.
[0039] As used herein the phrase "splice variant" refers to cDNA
molecules produced from a RNA molecules initially transcribed from
the same genomic DNA sequence which have undergone alternative RNA
splicing. Alternative RNA splicing occurs when a primary RNA
transcript undergoes splicing, generally for the removal of
introns, which results in the production of more than one mRNA
molecule each of which may encode different amino acid sequences.
The term "splice variant" also refers to the proteins encoded by
the above cDNA molecules.
[0040] Unless indicated, "GMAD proteins" and "GMAD polypeptides"
refer to all fragments and variants of the protein of SEQ ID NO:2,
as well as to proteins resulting from the alternate splicing of the
genomic DNA sequences encoding proteins having regions of amino
acid sequence identity and GMAD activity which correspond to the
protein of SEQ ID NO:2 as well as GMAD allellic variants.
Antibody Structure
[0041] The basic antibody structural unit is known to comprise a
tetramer. Each tetramer is composed of two identical pairs of
polypeptide chains, each pair having one "light" (about 25 kDa) and
one "heavy" chain (about 50-70 kDa). The amino-terminal portion of
each chain includes a variable region of about 100 to 110 or more
amino acids primarily responsible for antigen recognition. The
carboxy-terminal portion of each chain defines a constant region
primarily responsible for effector function. Human light chains are
classified as kappa and lambda light chains. Heavy chains are
classified as mu, delta, gamma, alpha, or epsilon, and define the
antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively.
See generally, Fundamental Immunology Ch. 7 (Paul, W., ed., 2nd ed.
Raven Press, N.Y. (1989)) (incorporated by reference in its
entirety for all purposes). The variable regions of each
light/heavy chain pair form the antibody binding site.
[0042] Thus, an intact IgG antibody has two binding sites. Except
in bifunctional or bispecific antibodies, the two binding sites are
the same.
[0043] The chains all exhibit the same general structure of
relatively conserved framework regions (FR) joined by three hyper
variable regions, also called complementarity determining regions
or CDRs. The CDRs from the heavy and the ligt chains of each pair
are aligned by the framework regions, enabling binding to a
specific epitope. From N-terminal to C-terminal, both light and
heavy chains comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3
and FR4. The assignment of amino acids to each domain is in
accordance with the definitions of Kabat Sequences of Proteins of
Immunological Interest (National Institutes of Health, Bethesda,
Md. (1987 and 1991)), or Chothia & Lesk J Mol. Biol.
196:901-917 (1987); Chothia et al. Nature 342:878-883 (1989).
[0044] A bispecific or bifunctional antibody is an artificial
hybrid antibody having two different heavy/light chain pairs and
two different binding sites. Bispecific antibodies can be produced
by a variety of methods including fusion of hybridomas or linking
of Fab' fragments. See, e.g., Songsivilai & Lachmann Clin. Exp.
Immunol. 79: 315-321 (1990), Kostelny et al. J Immunol. 148:1547
1553 (1992). In addition, bispecific antibodies may be formed as
"diabodies" (Holliger et al. "'Diabodies': small bivalent and
bispecific antibody fragments" PNAS USA 90:6444-6448 (1993)) or
"Janusins" (Traunecker et al. "Bispecific single chain molecules
(Janusins) target cytotoxic lymphocytes on HIV infected cells" EMBO
J 10:3655-3659 (1991) and Traunecker et al. "Janusin: new molecular
design for bispecific reagents" Int J Cancer Suppl 7:51-52
(1992)).
[0045] Production of bispecific antibodies can be a relatively
labor intensive process compared with production of conventional
antibodies and yields and degree of purity, are generally lower for
bispecific antibodies. Bispecific antibodies do not exist in the
form of fragments having a single binding site (e.g., Fab, Fab',
and Fv).
Anti-GMAD Antibodies
[0046] Using phage display technology, single chain antibody
molecules ("scFvs") that immunospecifically bind to GMAD
polypeptides (or fragments or variants thereof) have been
identified. Molecules comprising, or alternatively consisting of,
fragments or variants of these scFvs (e.g., including VH domains,
VH CDRs, VL domains, or VL CDRs having an amino acid sequence of
any one of those referred to in Table 1), that immunospecifically
bind to one or more GMAD polypeptides (or fragments or variants
thereof) are also encompassed by the invention, as are nucleic acid
molecules that encode these scFvs, and/or molecules.
[0047] In particular, the invention also relates to scFvs
comprising, or alternatively consisting of, an amino acid sequence
selected from the group consisting of SEQ ID NOS: 40-136 as
referred to in Table 1 below. scFvs corresponding to SEQ ID
NO:40-136 were selected for their ability to specifically bind GMAD
polypeptide. Molecules comprising, or alternatively consisting of,
fragments or variants of these scFvs (e.g., including VH domains,
VH CDRs, VL domains, or VL CDRs having an amino acid sequence of
any one of those referred to in Table 1), that specifically bind to
one or more GMAD polypeptide are also encompassed by the invention,
as are nucleic acid molecules that encode these scFvs, and/or
molecules (e.g., SEQ ID NOS: 137-233).
[0048] The present invention provides antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) that immunospecifically bind to a
GMAD polypeptide or a polypeptide fragment or variants of GMAD. In
particular, the invention provides antibodies corresponding to the
scFvs referred to in Table 1, such scFvs may routinely be
"converted" to immunoglobulin molecules by inserting, for example,
the nucleotide sequences encoding the VH and/or VL domains of the
scFv into an expression vector containing the constant domain
sequences and engineered to direct the expression of the
immunoglobulin molecule, as described in more detail in Example 2
below.
[0049] NSO cell lines that express IgG1 antibodies that comprise
the VH and VL domains of scFvs of the invention have been deposited
with the American Type Culture Collection ("ATCC") on the dates
listed in Table 1 and given the ATCC Deposit Numbers identified in
Table 1. The ATCC is located at 10801 University Boulevard,
Manassas, Va. 20110-2209, USA. The ATCC deposit was made pursuant
to the terms of the Budapest Treaty on the International
Recognition of the Deposit of Microorganisms for Purposes of Patent
Procedure.
[0050] Accordingly, in one embodiment, the invention provides
antibodies that comprise the VH and VL domains of scFvs of the
invention.
TABLE-US-00001 TABLE 1 scFv scFv protein DNA AAs of AAs of AAs of
AAs of AAs of AAs of AAs of AAs of Cell Line ATCC ATCC SEQ ID SEQ
ID VH VH VH VH VL VL VL VL Expressing Deposit Deposit scFv NO: NO:
Domain CDR1 CDR2 CDR3 Domain CDR1 CDR2 CDR3 antibody Number Date
GMBC603 40 137 1-123 31-35 50-66 99-112 139-249 161-174 190-196
229-238 GMBC604 41 138 1-117 31-35 50-66 99-106 133-243 155-168
184-190 223-232 GMBC605 42 139 1-121 31-35 50-68 101-110 137-247
159-172 188-194 227-236 GMBC606 43 140 1-119 31-35 50-66 99-108
135-242 156-166 182-188 221-231 GMBC607 44 141 1-121 31-35 50-68
101-110 137-247 159-172 188-194 227-236 GMBC608 45 142 1-123 31-35
50-66 99-112 139-246 160-170 186-192 225-235 GMBC609 46 143 1-121
31-35 50-68 101-110 137-247 159-171 187-193 226-236 GMBC610 47 144
1-118 31-35 50-66 99-107 134-241 155-165 181-187 220-230 GMBC612 48
145 1-116 31-35 50-66 99-105 132-239 155-165 181-187 220-229
GMBC613 49 146 1-122 31-35 50-66 99-111 138-245 159-169 185-191
224-234 GMBC614 50 147 1-121 31-35 50-68 101-110 137-247 159-172
188-194 227-236 GMBC615 51 148 1-121 31-35 50-68 101-110 137-247
159-172 188-194 227-236 GMBC616 52 149 1-121 31-35 50-68 101-110
137-247 159-172 188-194 227-236 GMBC617 53 150 1-117 31-35 50-65
98-106 133-243 155-168 184-190 223-232 GMBC618 54 151 1-121 31-35
50-68 101-110 137-247 159-171 187-193 226-236 GMBC619 55 152 1-121
31-35 50-66 99-110 137-244 158-168 184-190 223-233 GMBC620 56 153
1-121 31-35 50-68 101-110 137-247 159-172 188-194 227-236 GMBC621
57 154 1-118 31-35 50-66 99-107 134-241 155-165 181-187 220-230
GMBC625 58 155 1-121 31-35 50-68 101-110 137-247 159-172 188-194
227-236 GMBC626 59 156 1-121 31-35 50-68 101-110 137-247 159-172
188-194 227-236 GMBC627 60 157 1-118 31-35 50-66 99-107 134-244
156-169 185-191 224-233 GMBC628 61 158 1-126 31-35 50-66 99-115
142-249 163-173 189-195 228-238 GMBC629 62 159 1-121 31-35 50-68
101-110 137-244 158-168 184-190 223-233 GMBC630 63 160 1-119 31-35
50-66 99-108 135-242 156-166 182-188 221-231 GMBC632 64 161 1-121
31-35 50-68 101-110 137-244 158-168 184-190 223-233 GMBC634 65 162
1-121 31-35 50-68 101-110 137-247 159-172 188-194 227-236 GMBC635
66 163 1-121 31-35 50-68 101-110 137-244 158-168 184-190 223-233
GMBC638 67 164 1-121 31-35 50-68 101-110 137-247 159-172 188-194
227-236 GMBC639 68 165 1-130 31-35 50-66 99-119 146-253 167-177
193-199 232-242 GMBC641 69 166 1-120 31-35 50-66 99-109 136-243
157-167 183-189 222-232 GMBC642 70 167 1-120 31-35 50-66 99-109
136-243 157-167 183-189 222-232 GMBC645 71 168 1-121 31-35 50-68
101-110 137-247 159-172 188-194 227-236 GMBC646 72 169 1-118 31-35
50-66 99-107 134-241 157-167 183-189 222-231 GMBC647 73 170 1-121
31-35 50-68 101-110 137-247 159-172 188-194 227-236 GMBC648 74 171
1-121 31-35 50-68 101-110 137-244 158-168 184-190 223-233 GMBC649
75 172 1-121 31-35 50-68 101-110 137-247 159-172 188-194 227-236
GMBC651 76 173 1-121 31-35 50-68 101-110 137-247 159-172 188-194
227-236 GMBC652 77 174 1-121 31-35 50-68 101-110 137-247 159-172
188-194 227-236 GMBC653 78 175 1-119 31-35 50-66 99-108 135-246
157-169 185-191 224-235 GMBC654 79 176 1-121 31-35 50-68 101-110
137-247 159-172 188-194 227-236 GMBC655 80 177 1-116 31-35 50-66
99-105 132-239 155-165 181-187 220-229 GMBC657 81 178 1-121 31-35
50-68 101-110 137-244 158-168 184-190 223-233 GMBC658 82 179 1-121
31-35 50-68 101-110 137-247 159-172 188-194 227-236 GMBC659 83 180
1-121 31-35 50-68 101-110 137-247 159-172 188-194 227-236 GMBC660
84 181 1-121 31-35 50-68 101-110 137-247 159-172 188-194 227-236
GMBC662 85 182 1-117 31-35 50-66 99-106 133-243 155-168 184-190
223-232 GMBC664 86 183 1-121 31-35 50-68 101-110 137-247 159-172
188-194 227-236 GMBC665 87 184 1-121 31-35 50-68 101-110 137-244
158-168 184-190 223-233 GMBC666 88 185 1-121 31-35 50-68 101-110
137-247 159-171 187-193 226-236 GMBC667 89 186 1-121 31-35 50-68
101-110 137-247 159-172 188-194 227-236 GMBC668 90 187 1-121 31-35
50-68 101-110 137-244 158-168 184-190 223-233 GMBC669 91 188 1-121
31-35 50-68 101-110 137-247 159-172 188-194 227-236 GMBC670 92 189
1-121 31-35 50-68 101-110 137-247 159-172 188-194 227-236 GMBC672
93 190 1-121 31-35 50-68 101-110 137-247 159-172 188-194 227-236
GMBC673 94 191 1-122 31-35 50-66 99-111 138-243 159-169 185-191
224-232 GMBC676 95 192 1-121 31-35 50-68 101-110 137-247 159-172
188-194 227-236 GMBC678 96 193 1-121 31-35 50-68 101-110 137-247
159-172 188-194 227-236 GMBC679 97 194 1-121 31-35 50-68 101-110
137-247 159-172 188-194 227-236 GMBC681 98 195 1-117 31-35 50-66
99-106 133-240 156-166 182-188 221-230 GMBC682 99 196 1-121 31-35
50-68 101-110 137-244 158-168 184-190 223-233 GMBC683 100 197 1-118
31-35 50-66 99-107 134-241 155-165 181-187 220-230 GMBC684 101 198
1-121 31-35 50-68 101-110 137-247 159-172 188-194 227-236 GMBC685
102 199 1-121 31-35 50-68 101-110 137-244 158-168 184-190 223-233
GMBC686 103 200 1-121 31-35 50-68 101-110 137-247 159-172 188-194
227-236 GMBC687 104 201 1-124 31-35 50-66 99-113 140-247 163-173
189-195 228-237 GMBC689 105 202 1-121 31-35 50-68 101-110 137-247
159-172 188-194 227-236 GMBC690 106 203 1-121 31-35 50-68 101-110
137-247 159-172 188-194 227-236 GMBC691 107 204 1-130 31-35 50-66
99-119 146-253 167-177 193-199 232-242 GMBC692 108 205 1-121 31-35
50-68 101-110 137-247 159-172 188-194 227-236 GMBC693 109 206 1-121
31-35 50-68 101-110 137-247 159-172 188-194 227-236 GMBC696 110 207
1-118 31-35 50-66 99-107 134-241 155-165 181-187 220-230 GMBC725
111 208 1-119 31-35 50-66 99-108 135-242 156-166 182-188 221-231
GMBC727 112 209 1-121 31-35 50-68 101-110 137-247 159-172 188-194
227-236 GMBC729 113 210 1-121 31-35 50-68 101-110 137-244 158-168
184-190 223-233 GMBC730 114 211 1-121 31-35 50-68 101-110 137-247
159-172 188-194 227-236 GMCC101 115 212 1-118 31-35 50-66 99-107
134-245 157-169 185-191 224-234 GMCC102 116 213 1-133 31-35 50-66
99-122 149-260 172-184 200-206 239-249 GMCC105 117 214 1-123 31-35
50-66 99-112 139-250 163-173 189-195 228-239 GMCC106 118 215 1-118
31-36 51-66 99-107 134-245 157-169 185-191 224-234 GMCC107 119 216
1-122 31-35 50-66 99-111 138-250 161-174 190-196 229-239 GMCC108
120 217 1-128 31-35 50-66 99-117 144-255 167-177 193-199 232-244
GMCC109 121 218 1-122 31-35 50-66 99-111 138-244 161-171 187-193
226-233 GMCC110 122 219 1-125 31-37 52-67 100-114 141-250 165-175
191-197 230-239 GMCC112 123 220 1-120 31-35 50-65 98-109 136-245
161-172 188-194 227-235 GMCC114 124 221 1-124 31-36 51-67 100-113
140-250 164-174 190-196 229-239 GMCC118 125 222 1-127 31-35 50-68
101-116 143-251 166-176 192-198 231-240 GMCC119 126 223 1-125 31-35
50-66 99-114 141-252 164-177 193-199 232-241 GMCC124 127 224 1-124
31-35 50-66 99-113 140-251 163-175 191-197 230-240 GMCC125 128 225
1-120 31-35 50-66 99-109 136-247 160-170 186-192 225-236 GMCC126
129 226 1-123 31-36 51-66 99-112 139-246 162-172 188-194 227-235
GMCC127 130 227 1-116 31-35 50-66 99-105 132-242 156-166 182-188
221-231 GMCC129 131 228 1-119 31-35 50-66 99-108 135-246 159-169
185-191 224-235 GMCC131 132 229 1-120 31-35 50-65 98-109 136-248
159-172 188-194 227-237 GMCC136 133 230 1-120 31-35 50-66 99-109
136-245 161-171 187-193 226-235 GMCC138 134 231 1-122 31-37 52-67
100-111 138-248 162-172 188-194 227-237 GMCC142 135 232 1-121 31-35
50-66 99-110 137-246 161-171 187-193 226-235 GMCC151 136 233 1-123
31-35 50-66 99-112 139-250 163-173 189-195 228-239
[0051] The present invention encompasses antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) that specifically bind to a GMAD
polypeptide or a fragment, variant, or fusion protein thereof. A
GMAD polypeptide includes, but is not limited to, GMAD (SEQ ID
NO:2) or the polypeptide encoded by the GMAD cDNA contained in ATCC
Deposit No. 209215 on Aug. 21, 1997. GMAD may be produced through
recombinant expression of nucleic acids encoding the polypeptide of
SEQ ID NO:2 (e.g., the GMAD cDNA in the ATCC Deposit Number
209215). Antibodies of the invention may specifically bind GMAD as
well as fragments and variants thereof, and are described in more
detail below.
GMAD Polypeptides
[0052] In certain embodiments of the present invention, the
antibodies of the present invention bind GMAD polypeptide, or
fragments or variants thereof The following section describes the
GMAD polypeptides, fragments and variants that the antibodies of
the invention may bind in more detail.
[0053] In certain embodiments, the antibodies of the present
invention specifically bind GMAD polypeptide. An antibody that
specifically binds GMAD may, in some embodiments, bind fragments,
variants (including species orthologs and allelic variants of
GMAD), multimers or modified forms of GMAD. For example, an
antibody specific for GMAD may bind the GMAD moiety of a fusion
protein comprising all or a portion of GMAD.
[0054] GMAD proteins may be found as homodimers. Accordingly, the
present invention relates to antibodies that bind GMAD proteins
found as homodimers. In specific embodiments, antibodies of the
invention bind GMAD homodimers.
[0055] GMAD proteins may also be found as monomers or multimers
(i.e., dimers, trimers, tetramers, and higher multimers).
Accordingly, the present invention relates to antibodies that bind
GMAD proteins found as monomers or as part of multimers. In
specific embodiments, antibodies of the invention bind GMAD
monomers, dimers, trimers or tetramers. In additional embodiments,
antibodies of the invention bind at least dimers, at least trimers,
or at least tetramers containing one or more GMAD polypeptides.
[0056] Antibodies of the invention may bind GMAD homomers or
heteromers. As used herein, the term homomer, refers to a multimer
containing only GMAD proteins of the invention (including GMAD
fragments, variants, and fusion proteins, as described herein).
These homomers may contain GMAD proteins having identical or
different polypeptide sequences. In a specific embodiment, a
homomer of the invention is a multimer containing only GMAD
proteins having an identical polypeptide sequence. In another
specific embodiment, antibodies of the invention bind GMAD homomers
containing GMAD proteins having different polypeptide sequences. In
specific embodiments, antibodies of the invention bind a GMAD
homodimer (e.g., containing GMAD proteins having identical or
different polypeptide sequences) or a homotrimer (e.g., containing
GMAD proteins having identical or different polypeptide sequences).
In additional embodiments, antibodies of the invention bind at
least a homodimer, at least a homotrimer, or at least a
homotetramer of GMAD.
[0057] As used herein, the term heteromer refers to a multimer
containing heterologous proteins (i.e., proteins containing
polypeptide sequences that do not correspond to GMAD polypeptide
sequences) in addition to the GMAD proteins of the invention. In a
specific embodiment, antibodies of the invention bind a
heterodimer, a heterotrimer, or a heterotetramer. In additional
embodiments, the antibodies of the invention bind at least a
homodimer, at least a homotrimer, or at least a homotetramer
containing one or more GMAD polypeptides.
[0058] Antibodies of the invention may bind GMAD protein multimers
that are the result of hydrophobic, hydrophilic, ionic and/or
covalent associations and/or may be indirectly linked, by for
example, liposome formation. Thus, in one embodiment, antibodies of
the invention may bind multimers, such as, for example, homodimers
or homotrimers, that are formed when GMAD proteins contact one
another in solution. In another embodiment, antibodies of the
invention may bind heteromultimers, such as, for example,
heterotrimers or heterotetramers, that are formed when proteins of
the invention contact antibodies to GMAD polypeptides (or
antibodies to the heterologous polypeptide sequence in a fusion
protein) in solution. In other embodiments, multimers that one or
more antibodies of the invention may bind are formed by covalent
associations with and/or between the GMAD proteins of the
invention. Such covalent associations may involve one or more amino
acid residues contained in the polypeptide sequence of the protein
(e.g., the polypeptide sequence recited in SEQ ID NO:2 or the
polypeptide encoded by the deposited GMAD cDNA clone of ATCC
Deposit 209215). In one instance, the covalent associations are
cross-linking between cysteine residues located within the
polypeptide sequences of the proteins which interact in the native
(i.e., naturally occurring) polypeptide. In another instance, the
covalent associations are the consequence of chemical or
recombinant manipulation. Alternatively, such covalent associations
may involve one or more amino acid residues contained in the
heterologous polypeptide sequence in a GMAD fusion protein. In one
example, covalent associations are between the heterologous
sequence contained in a fusion protein (see, e.g., U.S. Pat. No.
5,478,925). In a specific example, the covalent associations are
between the heterologous sequence contained in a GMAD-Fc fusion
protein (as described herein). In another specific example,
covalent associations of fusion proteins are between heterologous
polypeptide sequences from another GMAD-related polypeptides (e.g.,
other FIZZ, RELM family) that are capable of forming covalently
associated multimers, such as for example, oseteoprotegerin (see,
e.g., International Publication No. WO 98/49305, the contents of
which are herein incorporated by reference in its entirety).
[0059] Antibodies of the invention may bind GMAD protein multimers
that were generated using chemical techniques known in the art. For
example, proteins desired to be contained in the multimers of the
invention may be chemically cross-linked using linker molecules and
linker molecule length optimization techniques known in the art
(see, e.g., U.S. Pat. No. 5,478,925, which is herein incorporated
by reference in its entirety). Additionally, multimers that may be
bound by one or more antibodies of the invention may be generated
using techniques known in the art to form one or more
inter-molecule cross-links between the cysteine residues located
within the polypeptide sequence of the proteins desired to be
contained in the multimer (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety).
Further, proteins that may be bound by one or more antibodies of
the invention may be routinely modified by the addition of cysteine
or biotin to the C terminus or N-terminus of the polypeptide
sequence of the protein and techniques known in the art may be
applied to generate multimers containing one or more of these
modified proteins (see, e.g., U.S. Pat. No. 5,478,925, which is
herein incorporated by reference in its entirety). Additionally,
techniques known in the art may be applied to generate liposomes
containing the protein components desired to be contained in the
multimer that one or more antibodies of the invention may bind
(see, e.g., U.S. Pat. No. 5,478,925, which is herein incorporated
by reference in its entirety).
[0060] Alternatively, antibodies of the invention may bind GMAD
protein multimers that were generated using genetic engineering
techniques known in the art. In one embodiment, proteins contained
in multimers that may be bound by one or more antibodies of the
invention are produced recombinantly using fusion protein
technology described herein or otherwise known in the art (see,
e.g., U.S. Pat. No. 5,478,925, which is herein incorporated by
reference in its entirety). In a specific embodiment,
polynucleotides coding for a homodimer that may be bound by one or
more antibodies of the invention are generated by ligating a
polynucleotide sequence encoding a GMAD polypeptide to a sequence
encoding a linker polypeptide and then further to a synthetic
polynucleotide encoding the translated product of the polypeptide
in the reverse orientation from the original C-terminus to the
N-terminus (see, e.g., U.S. Pat. No. 5,478,925, which is herein
incorporated by reference in its entirety). In another embodiment,
recombinant techniques described herein or otherwise known in the
art are applied to generate recombinant GMAD polypeptides which
contain a transmembrane domain and which can be incorporated by
membrane reconstitution techniques into liposomes (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). In another embodiment, two or more GMAD polypeptides
are joined through synthetic linkers (e.g., peptide, carbohydrate
or soluble polymer linkers). Examples include those peptide linkers
described in U.S. Pat. No. 5,073,627 (hereby incorporated by
reference). Proteins comprising multiple GMAD polypeptides
separated by peptide linkers may be produced using conventional
recombinant DNA technology. In specific embodiments, antibodies of
the invention bind proteins comprising multiple GMAD polypeptides
separated by peptide linkers.
[0061] Another method for preparing multimer GMAD polypeptides
involves use of GMAD polypeptides fused to a leucine zipper or
isoleucine polypeptide sequence. Leucine zipper domains and
isoleucine zipper domains are polypeptides that promote
multimerization of the proteins in which they are found. Leucine
zippers were originally identified in several DNA-binding proteins
(Landschulz et al., Science 240:1759, (1988)), and have since been
found in a variety of different proteins. Among the known leucine
zippers are naturally occurring peptides and derivatives thereof
that dimerize or trimerize. Examples of leucine zipper domains
suitable for producing soluble multimeric GMAD proteins are those
described in PCT application WO 94/10308, hereby incorporated by
reference. Recombinant fusion proteins comprising a soluble GMAD
polypeptide fused to a peptide that dimerizes or trimerizes in
solution are expressed in suitable host cells, and the resulting
soluble multimeric GMAD is recovered from the culture supernatant
using techniques known in the art. In specific embodiments,
antibodies of the invention bind GMAD-leucine zipper fusion protein
monomers and/or GMAD-leucine zipper fusion protein multimers.
[0062] Other peptides derived from naturally occurring trimeric
proteins may be employed in preparing trimeric GMAD. In specific
embodiments, antibodies of the invention bind GMAD-fusion protein
monomers and/or GMAD fusion protein trimers.
[0063] Antibodies that bind GMAD polypeptides may bind them as
isolated polypeptides or in their naturally occurring state. For,
example antibodies of the present invention may bind recombinantly
produced GMAD polypeptides. In a specific embodiment, antibodies of
the present invention bind a GMAD polypeptide purified from a cell
culture wherein cells in said cell culture comprise a
polynucleotide encoding amino acids 1 to 108 of SEQ ID NO:2
operably associated with a regulatory sequence that controls
expression of said polynucleotide. Antibodies of the present
invention may bind GMAD polypeptide fragments comprising or
alternatively, consisting of, the amino acid sequence of SEQ ID
NO:2, encoded by the GMAD cDNA contained in ATCC Deposit Number
209215, or encoded by nucleic acids which hybridize (e.g., under
stringent hybridization conditions) to the GMAD nucleotide sequence
contained in ATCC Deposit Number 209215, or the complementary
strand thereto. Protein fragments may be "free-standing," or
comprised within a larger polypeptide of which the fragment forms a
part or region, most preferably as a single continuous region.
Antibodies of the present invention may bind polypeptide fragments,
including, for example, fragments that comprise or alternatively,
consist of from about amino acid residues: 1 to 23, 24 to 43, 44 to
63, 64 to 83 and/or 84 to 108, of SEQ ID NO:2. In this context
"about" includes the particularly recited value, larger or smaller
by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at
both extremes. Moreover, polypeptide fragments that antibodies of
the invention may bind can be at least about 10, 20, 30, 40, 50,
60, 70, 80, 90, or 100 amino acids in length. In this context
"about" includes the particularly recited value, larger or smaller
by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at
both extremes.
[0064] Preferably, antibodies of the present invention bind
polypeptide fragments selected from the group: a polypeptide
comprising or alternatively, consisting of, a fragment of the
predicted mature GMAD polypeptide, wherein the fragment has a GMAD
functional activity (e.g., antigenic activity or biological
acitivity); or a polypeptide comprising, or alternatively,
consisting of, one, two, three, four or more, epitope bearing
portions of the GMAD protein. The amino acid residues constituting
the preferred epitopes have been predicted by computer analysis.
Thus, as one of ordinary skill would appreciate, the amino acid
residues constituting these domains may vary slightly (e.g., by
about 1 to about 15 amino acid residues) depending on the criteria
used to define each epitope. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0065] In another preferred embodiment, antibodies of the present
invention bind GMAD polypeptides comprising, or alternatively
consisting of, the expressed and/or mature polypeptide of GMAD
(amino acid residues 21-108 of SEQ ID NO:2). In highly preferred
embodiments, the antibodies of the invention that bind all or a
portion of the mature GMAD polypeptide and inhibit GMAD-induced
insulin resistance (i.e. gradual reduction in insulin uptake) in
cells expressing GMAD (e.g., adipocytes). In other highly preferred
embodiments, the antibodies of the invention that bind all or a
portion of the mature GMAD polypeptide and inhibit GMAD-induced
glucose resistance (i.e. gradual reduction in insulin-mediated
glucose uptake) in cells expressing GMAD (e.g., adipocytes).
[0066] Antibodies of the invention may also bind fragments
comprising, or alternatively, consisting of, structural or
functional attributes of GMAD. Such fragments include amino acid
residues that comprise alpha-helix and alpha-helix forming regions
("alpha-regions"), beta-sheet and beta-sheet-forming regions
("beta-regions"), turn and turn-forming regions ("turn-regions"),
coil and coil-forming regions ("coil-regions"), hydrophilic
regions, hydrophobic regions, alpha amphipathic regions, beta
amphipathic regions, surface forming regions, and high antigenic
index regions (i.e., containing four or more contiguous amino acids
having an antigenic index of greater than or equal to 1.5, as
identified using the default parameters of the Jameson-Wolf
program) of complete (i.e., full-length) GMAD. Certain preferred
regions are those set out in Table 2 and include, but are not
limited to, regions of the aforementioned types identified by
analysis of the amino acid sequence depicted in (SEQ ID NO:2), such
preferred regions include; Garnier-Robson predicted alpha-regions,
beta-regions, turn-regions, and coil-regions; Chou-Fasman predicted
alpha-regions, beta-regions, and turn-regions; Kyte-Doolittle
predicted hydrophilic regions; Eisenberg alpha and beta amphipathic
regions; Emini surface-forming regions; and Jameson-Wolf high
antigenic index regions, as predicted using the default parameters
of these computer programs.
[0067] The data representing the structural or functional
attributes of GMAD set forth in Table 2, as described above, was
generated using the various modules and algorithms of the DNA*STAR
set on default parameters. Column I represents the results of a
Gamier-Robson analysis of alpha helical regions; Column II
represents the results of a Chou-Fasman analysis of alpha helical
regions; Column III represents the results of a Gamier Robson
analysis of beta sheet regions; Column IV represents the results of
a Chou-Fasman analysis of beta sheet regions; Column V represents
the results of a Gamier Robson analysis of turn regions; Column VI
represents the results of a Chou-Fasman analysis of turn regions;
Column VII represents the results of a Gamier Robson analysis of
coil regions; Column VIII represents a Kyte-Doolittle
hydrophilicity plot; Column; Column IX represents a Hopp-Woods
hydrophobicity plot; Column X represents the results of an
Eisenberg analysis of alpha amphipathic regions; Column XI
represents the results of an Eisenberg analysis of beta amphipathic
regions; Column XII represents the results of a Karplus-Schultz
analysis of flexible regions; Column XIII represents the
Jameson-Wolf antigenic index score; and Column XIV represents the
Emini surface probability plot.
[0068] In a preferred embodiment, the data presented in columns
VIII, XIII, and XIV of Table 2 can be used to determine regions of
GMAD which exhibit a high degree of potential for antigenicity.
Regions of high antigenicity are determined from the data presented
in columns VIII, XIII, and/or XIV by choosing values which
represent regions of the polypeptide which are likely to be exposed
on the surface of the polypeptide in an environment in which
antigen recognition may occur in the process of initiation of an
immune response.
[0069] The above-mentioned preferred regions set out in Table 2
include, but are not limited to, regions of the aforementioned
types identified by analysis of the amino acid sequence set out in
SEQ ID NO:2. As set out in Table 2, such preferred regions include
Garnier-Robson alpha-regions, beta-regions, turn-regions, and
coil-regions, Chou-Fasman alpha-regions, beta-regions, and
turn-regions, Kyte-Doolittle hydrophilic regions, Eisenberg alpha-
and beta-amphipathic regions, Karplus-Schulz flexible regions,
Jameson-Wolf regions of high antigenic index and Emini
surface-forming regions. Among preferred polypeptide fragments that
one or more antibodies of the invention may bind are those that
comprise regions of GMAD that combine several structural features,
such as several (e.g., 1, 2, 3, or 4) of the same or different
region features set out above and in Table 2.
TABLE-US-00002 TABLE 2 Res Position I II III IV V VI VII VIII IX X
XI XII XIII XIV Met 1 A A . . . . . -0.68 0.09 . . . -0.30 0.62 Lys
2 A A . . . . . -1.10 0.23 . . . -0.30 0.26 Ala 3 A A . . . . .
-1.52 0.49 * . . -0.60 0.17 Leu 4 A A . . . . . -1.94 0.74 . . .
-0.60 0.14 Cys 5 A A . . . . . -2.37 0.81 . . . -0.60 0.06 Leu 6 A
A . . . . . -1.98 1.50 * . . -0.60 0.05 Leu 7 . A B . . . . -2.88
1.43 . . . -0.60 0.09 Leu 8 . A B . . . . -3.10 1.39 . . . -0.60
0.12 Leu 9 . A B . . . . -2.63 1.50 . . . -0.60 0.12 Pro 10 . A B .
. . . -2.78 1.24 . . . -0.60 0.15 Val 11 . A B . . . . -2.78 1.24 .
. . -0.60 0.15 Leu 12 . A B . . . . -2.82 1.24 . . . -0.60 0.15 Gly
13 . A B . . . . -2.31 1.20 . . . -0.60 0.07 Leu 14 . A B . . . .
-1.80 1.16 . . . -0.60 0.13 Leu 15 . A B . . . . -1.54 0.90 . . .
-0.60 0.21 Val 16 . . B . . T . -1.00 0.21 . . . 0.10 0.42 Ser 17 .
. B . . T . -1.00 0.27 . . F 0.25 0.73 Ser 18 A . . . . T . -1.32
0.27 . . F 0.25 0.73 Lys 19 A . . . . T . -0.81 0.16 . . F 0.25
0.53 Thr 20 A . . B . . . -0.60 -0.10 . . F 0.45 0.53 Leu 21 A . .
B . . . 0.26 0.13 . . . -0.30 0.39 Cys 22 A . . B . . . 0.56 -0.26
* . . 0.30 0.34 Ser 23 A . . B . . . 0.27 -0.26 * . . 0.30 0.40 Met
24 A A . . . . . -0.67 -0.24 * . . 0.30 0.49 Glu 25 A A . . . . .
-0.36 -0.24 * . . 0.30 0.65 Glu 26 A A . . . . . 0.46 -0.41 . * .
0.30 0.77 Ala 27 A A . . . . . 1.23 -0.80 . * . 0.75 1.36 Ile 28 A
A . . . . . 0.64 -1.41 * * . 0.75 1.53 Asn 29 A A . . . . . 1.24
-0.73 * * . 0.60 0.62 Glu 30 A A . . . . . 1.24 -0.33 * * F 0.60
1.06 Arg 31 A A . . . . . 0.39 -0.83 * * F 0.90 2.63 Ile 32 A A . .
. . . 0.39 -0.87 * * F 0.90 1.21 Gln 33 A A . . . . . 0.93 -0.77 *
* F 0.75 0.71 Glu 34 A A . . . . . 0.63 -0.34 * * . 0.30 0.36 Val
35 A A . . . . . -0.18 0.04 * . . -0.30 0.68 Ala 36 A A . . . . .
-1.18 0.04 * * . -0.30 0.33 Gly 37 A A . B . . . -0.99 0.33 * * .
-0.30 0.13 Ser 38 A A . B . . . -0.88 1.11 * * . -0.60 0.15 Leu 39
A A . B . . . -1.47 0.47 * * . -0.60 0.30 Ile 40 . A B B . . .
-1.50 0.47 * * . -0.60 0.30 Phe 41 . A B B . . . -1.21 0.73 * . .
-0.60 0.16 Arg 42 . A B B . . . -1.17 0.73 * * . -0.60 0.26 Ala 43
. A B B . . . -1.76 0.43 * * . -0.60 0.49 Ile 44 . A B B . . .
-1.29 0.43 * * . -0.60 0.40 Ser 45 . A B B . . . -0.29 0.07 * . .
-0.30 0.20 Ser 46 . . . B . . C 0.07 0.07 * * F 0.05 0.39 Ile 47 .
. . B . . C -0.34 0.00 * . F 0.05 0.55 Gly 48 . . . . . T C 0.24
-0.30 * . F 1.05 0.55 Arg 49 . . . . . T C 0.83 -0.69 * * F 1.35
0.72 Gly 50 . . . . . T C 0.28 -0.69 * . F 1.50 1.37 Ser 51 . . . .
. T C 0.27 -0.73 * . F 1.50 1.03 Glu 52 . . B B . . . 0.86 -0.67 *
* F 1.09 0.76 Ser 53 . . B B . . . 1.31 -0.29 * * F 1.28 1.02 Val
54 . . B B . . . 0.86 -0.71 * * F 1.92 1.50 Thr 55 . . B B . . .
1.20 -0.67 . * F 2.11 0.85 Ser 56 . . . . T T . 0.69 -0.67 . * F
3.40 1.07 Arg 57 . . . . T T . 0.10 -0.37 . * F 2.76 1.18 Gly 58 .
. . . T T . 0.09 -0.51 . * F 2.57 0.83 Asp 59 . . . . T T . 0.28
-0.51 . * F 2.23 0.89 Leu 60 . . B . . . . 0.38 -0.33 . * F 0.99
0.24 Ala 61 . . B . . . . 0.79 0.10 . * . -0.10 0.38 Thr 62 . . B .
. . . 0.33 -0.33 * * . 0.50 0.45 Cys 63 . . B . . T . -0.02 0.10 *
* . 0.10 0.54 Pro 64 . . . . T T . -0.61 0.20 * . F 0.65 0.46 Arg
65 . . . . T T . -0.66 0.20 * . F 0.65 0.32 Gly 66 . . . . T T .
-0.38 0.36 . . . 0.50 0.45 Phe 67 . . B B . . . -0.41 0.27 . . .
-0.30 0.42 Ala 68 . . B B . . . -0.41 0.27 . . . -0.30 0.21 Val 69
. . B B . . . -0.51 0.84 . . . -0.60 0.11 Thr 70 . . B B . . .
-1.29 0.90 . . . -0.60 0.19 Gly 71 . . B B . . . -1.29 0.69 . . .
-0.60 0.10 Cys 72 . . . . T T . -0.89 0.61 . . . 0.20 0.13 Thr 73 .
. . . T T . -0.89 0.36 . . . 0.50 0.12 Cys 74 . . . . T T . -0.70
0.37 . . . 0.50 0.13 Gly 75 . . . . T T . -0.73 0.51 . . . 0.20
0.13 Ser 76 . . . . T . . -0.69 0.37 . . . 0.30 0.09 Ala 77 . . . .
T . . -0.31 0.27 . . . 0.30 0.22 Cys 78 . . . . T T . 0.00 0.61 . *
. 0.20 0.23 Gly 79 . . . . T T . -0.19 0.19 . * . 0.50 0.29 Ser 80
. . . . T T . 0.27 0.44 . * . 0.20 0.21 Trp 81 . . B . . T . -0.02
-0.06 . * . 0.70 0.78 Asp 82 . A B B . . . 0.57 -0.13 . * . 0.30
0.79 Val 83 A A . B . . . 0.92 -0.56 . * . 0.75 1.02 Arg 84 A A . B
. . . 0.96 -0.46 . * . 0.45 1.41 Ala 85 A A . . . . . 0.59 -0.89 .
* F 0.90 1.21 Glu 86 . A . . T . . 0.84 -0.31 . * F 0.85 0.88 Thr
87 . A . . T . . 0.18 -0.46 . * F 0.85 0.61 Thr 88 . A . . T . .
1.03 0.11 . * . 0.10 0.32 Cys 89 . . . . T T . 0.26 0.01 . * . 0.50
0.32 His 90 . . . . T T . 0.26 0.59 . . . 0.20 0.12 Cys 91 . . B .
. T . -0.09 0.60 . . . -0.20 0.08 Gln 92 . . B . . T . -0.38 0.54 .
. . -0.20 0.16 Cys 93 . . . . T . . -0.07 0.59 . . . 0.00 0.11 Ala
94 . . . . T . . 0.31 0.09 . . . 0.30 0.35 Gly 95 . . . . T T .
0.03 0.43 . . . 0.20 0.21 Met 96 . . . . T T . 0.36 0.51 . . . 0.42
0.57 Asp 97 . . . . T T . -0.23 0.37 . . . 0.94 0.56 Trp 98 . . . .
T T . 0.54 0.37 . . . 1.16 0.57 Thr 99 . . . . T . . 0.47 -0.06 . .
. 1.93 1.14 Gly 100 . . . . T T . 0.14 -0.10 * . . 2.20 0.37 Ala
101 . . . . T T . 0.86 0.47 * . . 1.08 0.19 Arg 102 . . . . T T .
0.00 -0.44 . . . 1.76 0.25 Cys 103 . . . . T T . 0.29 -0.29 . . .
1.54 0.19 Cys 104 . . . . T . . 0.39 -0.31 * . . 1.12 0.32 Arg 105
. . B . . . . 0.34 -0.39 * . . 0.50 0.26 Val 106 . . B . . . . 0.54
0.04 * . . -0.10 0.61 Gln 107 . . B . . . . 0.04 -0.10 * . . 0.65
1.46 Pro 108 . . B . . . . 0.32 -0.24 . * . 0.50 0.95
[0070] In another aspect, the invention provides an antibody that
binds a peptide or polypeptide comprising an epitope-bearing
portion of a polypeptide described herein. The epitope of this
polypeptide portion is an immunogenic or antigenic epitope of a
polypeptide of the invention. An "immunogenic epitope" is defined
as a part of a protein that elicits an antibody response when the
whole protein is the immunogen. On the other hand, a region of a
protein molecule to which an antibody can bind is defined as an
"antigenic epitope." The number of immunogenic epitopes of a
protein generally is less than the number of antigenic epitopes.
See, for instance, Geysen et al., Proc. Natl. Acad. Sci. USA
81:3998- 4002 (1983).
[0071] As to the selection of peptides or polypeptides bearing an
antigenic epitope (i.e., that contain a region of a protein
molecule to which an antibody can bind), it is well known in that
art that relatively short synthetic peptides that mimic part of a
protein sequence are routinely capable of eliciting an antiserum
that reacts with the partially mimicked protein. See, for instance,
Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner, R. A.
(1983) Antibodies that react with predetermined sites on proteins.
Science 219:660-666. Peptides capable of eliciting protein-reactive
sera are frequently represented in the primary sequence of a
protein, can be characterized by a set of simple chemical rules,
and are confined neither to immunodominant regions of intact
proteins nor to the amino or carboxyl terminals.
[0072] Antigenic epitope-bearing peptides and polypeptides are
therefore useful to raise antibodies, including monoclonal
antibodies, that bind to a GMAD polypeptide of the invention. See,
for instance, Wilson et al., Cell 37:767-778 (1984) at 777.
Antigenic epitope-bearing peptides and polypeptides preferably
contain a sequence of at least seven, more preferably at least nine
and most preferably between at least about 15 to about 30 amino
acids contained within the amino acid sequence of SEQ ID NO:2.
[0073] Antibodies of the invention may bind one or more antigenic
GMAD polypeptides or peptides including, but not limited to: a
polypeptide comprising amino acid residues from about 54 to about
59 of SEQ ID NO:2. In this context "about" includes the
particularly recited range, larger or smaller by several (5, 4, 3,
2, or 1) amino acids, at either terminus or at both termini. As
indicated above, the inventors have determined that the above
polypeptide fragments are antigenic regions of the GMAD protein.
Epitope-bearing GMAD peptides and polypeptides may be produced by
any conventional means. Houghten, R. A., "General method for the
rapid solid-phase synthesis of large numbers of peptides:
specificity of antigen-antibody interaction at the level of
individual amino acids," Proc. Natl. Acad. Sci. USA 82:5131-5135
(1985). This "Simultaneous Multiple Peptide Synthesis (SMPS)"
process is further described in U.S. Pat. No. 4,631,211 to Houghten
et al. (1986).
[0074] As one of skill in the art will appreciate, GMAD
polypeptides and the epitope-bearing fragments thereof described
herein can be combined with parts of the constant domain of
immunoglobulins (IgG), resulting in chimeric polypeptides. These
fusion proteins facilitate purification and show an increased
half-life in vivo. This has been shown, e.g., for chimeric proteins
consisting of the first two domains of the human CD4-polypeptide
and various domains of the constant regions of the heavy or light
chains of mammalian immunoglobulins (EPA 394,827; Traunecker et
al., Nature 331:84-86 (1988)). Fusion proteins that have a
disulfide-linked dimeric structure due to the IgG part can also be
more efficient in binding and neutralizing other molecules than the
monomeric GMAD protein or protein fragment alone (Fountoulakis et
al., J Biochem 270:3958-3964 (1995)). Thus, antibodies of the
invention may bind fusion proteins that comprise all or a portion
of a GMAD polypeptide.
[0075] Recombinant DNA technology known to those skilled in the art
can be used to create novel mutant proteins or "muteins" including
single or multiple amino acid substitutions, deletions, additions
or fusion proteins. Such modified polypeptides can show, e.g.,
enhanced activity or increased stability. In addition, they may be
purified in higher yields and show better solubility than the
corresponding natural polypeptide, at least under certain
purification and storage conditions. Antibodies of the present
invention may also bind such modified GMAD polypeptides or GMAD
polypeptide fragments or variants.
[0076] For instance, for many proteins, including the extracellular
domain of a membrane associated protein or the mature form(s) of a
secreted protein, it is known in the art that one or more amino
acids may be deleted from the N-terminus or C-terminus without
substantial loss of biological function, or loss of the ability to
be bound by a specific antibody. For instance, Ron et al., J. Biol.
Chem., 268:2984-2988 (1993) reported modified KGF proteins that had
heparin binding activity even if 3, 8, or 27 amino-terminal amino
acid residues were missing.
[0077] However, even if deletion of one or more amino acids from
the N-terminus of a protein results in modification or loss of one
or more biological functions of the protein, other functional
activities (e.g., biological activities, ability to multimerize,
ability to reduce insulin and/or cellular glucose uptake) may still
be retained. For example, the ability of shortened GMAD
polypeptides to induce and/or bind to antibodies which recognize
the complete or mature forms of the GMAD polypeptides generally
will be retained when less than the majority of the residues of the
complete or mature polypeptide are removed from the N-terminus.
Whether a particular polypeptide lacking N-terminal residues of a
complete polypeptide retains such immunologic activities can
readily be determined by routine methods described herein and
otherwise known in the art. It is not unlikely that a GMAD
polypeptide with a large number of deleted N-terminal amino acid
residues may retain some biological or immunogenic activities. In
fact, peptides composed of as few as six GMAD amino acid residues
may often evoke an immune response.
[0078] Accordingly, the present invention further provides
antibodies that bind polypeptides having one or more residues
deleted from the amino terminus of the GMAD amino acid sequence of
SEQ ID NO:2 up to the arginine residue at position number 102 and
polynucleotides encoding such polypeptides. In particular, the
present invention provides antibodies that bind polypeptides
comprising the amino acid sequence of residues n.sup.1-108 of SEQ
ID NO:2, where n.sup.1 is an integer from 2 to 103 corresponding to
the position of the amino acid residue in SEQ ID NO:2.
[0079] More in particular, the invention provides antibodies that
bind polypeptides comprising, or alternatively consisting of, the
amino acid sequence of residues of K-2 to P-108; A-3 to P-108; L-4
to P-108; C-5 to P-108; L-6 to P-108; L-7 to P-108; L-8 to P-108;
L-9 to P-108; P-10 to P-108; V-11 to P-108; L-12 to P-108; G-13 to
P-108; L-14 to P-108; L-15 to P-108; V-16 to P-108; S-17 to P-108;
S-18 to P-108; K-19 to P-108; T-20 to P-108; L-21 to P-108; C-22 to
P-108; S-23 to P-108; M-24 to P-108; E-25 to P-108; E-26 to P-108;
A-27 to P-108; 1-28 to P-108; N-29 to P-108; E-30 to P-108; R-31 to
P-108; I-32 to P-108; Q-33 to P-108; E-34 to P-108; V-35 to P-108;
A-36 to P-108; G-37 to P-108; S-38 to P-108; L-39 to P-108; 1-40 to
P-108; F-41 to P-108; R-42 to P-108; A-43 to P-108; I-44 to P-108;
S-45 to P-108; S-46 to P-108; 1-47 to P-108; G-48 to P-108; A-43 to
P-108; G-50 to P-108; S-51 to P-108; E-52 to P-108; S-53 to P-108;
V-54 to P-108; T-55 to P-108; S-56 to P-108; R-57 to P-108; G-58 to
P-108; D-59 to P-108; L-60 to P-108; A-61 to P-108; T-62 to P-108;
C-63 to P-108; P-64 to P-108; R-65 to P-108; G-66 to P-108; F-67 to
P-108; A-68 to P-108; V-69 to P-108; T-70 to P-108; G-71 to P-108;
C-72 to P-108; T-73 to P-108; C-74 to P-108; G-75 to P-108; S-76 to
P-108; A-77 to P-108; C-78 to P-108; G-79to P-108; S-80 to P-108;
W-81 to P-108; D-82 to P-108; V-83 to P-108; R-84 to P-108;A-85 to
P-108; E-86 to P-108; T-87 to P-108; T-88 to P-108; C-89 to P-108;
H-90 to P-108; C-91 to P-108; Q-92 to P-108; C-93 to P-108; A-94 to
P-108; G-95 to P-108; M-96 to P-108; D-97 to P-108; W-98 to P-108;
T-99 to P-108; G-100 to P-108; A-101 to P-108; R-102 to P-108;
C-103 to P-108; of the GMAD sequence of SEQ ID NO:2.
[0080] As mentioned above, even if deletion of one or more amino
acids from the C-terminus of a protein results in modification of
loss of one or more biological functions of the protein, other
functional activities (e.g., biological activities such as the
ability to induce resistance to cellular insulin and/or glucose
uptake) may still be retained. For example the ability of the
shortened GMAD polypeptide to induce and/or bind to antibodies
which recognize the complete or mature forms of the GMAD
polypeptide generally will be retained when less than the majority
of the residues of the complete or mature polypeptide are removed
from the C-terminus. Whether a particular polypeptide lacking
C-terminal residues of a complete polypeptide retains such
immunologic activities can readily be determined by routine methods
described herein and otherwise known in the art. It is not unlikely
that a GMAD polypeptide with a large number of deleted C-terminal
amino acid residues may retain some biological or immunogenic
activities. In fact, peptides composed of as few as six GMAD amino
acid residues may often evoke an immune response.
[0081] In another embodiment, antibodies of the invention bind
C-terminal deletions of the GMAD polypeptide that can be described
by the general formula 1-m.sup.1 where m.sup.1 is a number from 7
to 102 corresponding to the amino acid sequence identified of SEQ
ID NO:2. In specific embodiments, the invention provides antibodies
that bind GMAD polypeptides comprising, or alternatively consisting
of, the amino acid sequence of residues: M-1 to R-102; M-1 to
A-101; M-1 to G-100; M-1 to T-99; M-1 to W-98; M-1 to D-97; M-1 to
M-96; M-1 to G-95; M-1 to A-94; M-1 to C-93; M-1 to Q-92; M-1 to
C-91; M-1 to H-90; M-1 to C-89; M-1 to T-88; M-1 to T-87; M-1 to
E-86; M-1 to A-85; M-1 to R-84; M-1 to V-83; M-1 to D-82; M-1 to
W-81; M-1 to S-80; M-1 to G-79; M-1 to C-78; M-1 to A-77; M-1 to
S-76; M-1 to G-75; M-1 to C-74; M-1 to T-73; M-1 to C-72; M-1 to
G-71; M-1 to T-70; M-1 to V-69; M-1 to A-68; M-1 to F-67; M-1 to
G-66; M-1 to R-65; M-1 to P-64; M-1 to C-63; M-1 to T-62; M-1 to
A-61; M-1 to L-60; M-1 to D-59; M-1 to G-58; M-1 to R-57; M-1 to
S-56; M-1 to T-55; M-1 to V-54; M-1 to S-53; M-1 to E-52; M-1 to
S-51; M-1 to G-50; M-1 to R-49; M-1 to G-48; M-1 to I-47; M-1 to
S-46; M-1 to S-45; M-1 to I-44; M-1 to A-43; M-1 to R-42; M-1 to
F-41; M-1 to I-40; M-1 to L-39; M-1 to S-38; M-1 to G-37; M-1 to
A-36; M-1 to V-35; M-1 to E-34; M-1 to Q-33; M-1 to I-32; M-1 to
R-31; M-1 to E-30; M-1 to N-29; M-1 to I-28; M-1 to A-27; M-1 to
E-26; M-1 to E-25; M-1 to M-24; M-1 to S-23; M-1 to C-22; M-1 to
L-21; M-1 to T-20; M-1 to K-19; M-1 to S-18; M-1 to S-17; M-1 to
V-16; M-1 to L-15; M-1 to L-14; M-1 to G-13; M-1 to L-12; M-1 to
V-11; M-1 to P-10; M-1 to L-9; M-1 to L-8; M-1 to L-7; of the GMAD
sequence of SEQ ID NO:2.
[0082] The invention also provides antibodies that bind
polypeptides having one or more amino acids deleted from both the
amino and the carboxyl termini of a GMAD polypeptide, which may be
described generally as having residues n.sup.1-m.sup.1 of SEQ ID
NO:2, where n.sup.1, and m.sup.1 are integers as described
above.
[0083] Preferably, antibodies of the present invention bind
fragments of GMAD comprising a portion of the secreted protein;
i.e., within residues 21-108 of SEQ ID NO:2, since any portion
therein is expected to be expressed, and secreted.
[0084] It will be recognized in the art that some amino acid
sequence of GMAD can be varied without significant effect of the
structure or function of the protein. If such differences in
sequence are contemplated, it should be remembered that there will
be critical areas on the protein which determine activity. Such
areas will usually comprise residues which make up the ligand
binding site or which form tertiary structures which affect these
domains.
[0085] Thus, the invention further includes antibodies that bind
variations of the GMAD protein which show substantial GMAD protein
activity or which include regions of GMAD such as the protein
fragments discussed below. Such mutants include deletions,
insertions, inversions, repeats, and type substitution. Guidance
concerning which amino acid changes are likely to be phenotypically
silent can be found in Bowie, J. U. et al., Science 247:1306-1310
(1990).
[0086] Thus, antibodies of the present invention may bind a
fragment, derivative, or analog of the polypeptide of SEQ ID NO:2,
or that encoded by the GMAD cDNA in ATCC deposit 209215. Such
fragments, variants or derivatives may be (i) one in which at least
one or more of the amino acid residues are substituted with a
conserved or non-conserved amino acid residue (preferably a
conserved amino acid residue(s), and more preferably at least one
but less than ten conserved amino acid residues) and such
substituted amino acid residue may or may not be one encoded by the
genetic code, or (ii) one in which one or more of the amino acid
residues includes a substituent group, or (iii) one in which the
mature polypeptide is fused with another compound, such as a
compound to increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptide, such as an IgG Fc fusion
region peptide or leader or secretory sequence or a sequence which
is employed for purification of the mature polypeptide or a
proprotein sequence. Such fragments, derivatives and analogs are
deemed to be within the scope of those skilled in the art from the
teachings herein.
[0087] Of particular interest are substitutions of charged amino
acids with another charged amino acid and with neutral or
negatively charged amino acids. The latter results in proteins with
reduced positive charge to improve the characteristics of the GMAD
protein. The prevention of aggregation is highly desirable.
Aggregation of proteins not only results in a loss of activity but
can also be problematic when preparing pharmaceutical formulations,
because they scan be immunogenic. (Pinckard et al., Clin Exp.
Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36:838-845
(1987); Cleland et al. Crit. Rev. Therapeutic Drug Carrier Systems
10:307-377 (1993)).
[0088] In addition, antibodies of the present invention may bind a
GMAD polypeptide that contains one or more amino acid
substitutions, deletions or additions, either from natural
mutations or human manipulation.
[0089] As indicated, changes are preferably of a minor nature, such
as conservative amino acid substitutions that do not significantly
affect the folding or activity of the protein (see Table 3).
TABLE-US-00003 TABLE 3 Conservative Amino Acid Substitutions.
Aromatic Phenylalanine Tryptophan Tyrosine Hydrophobic Leucine
Isoleucine Valine Polar Glutamine Asparagine Basic Arginine Lysine
Histidine Acidic Aspartic Acid Glutamic Acid Small Alanine Serine
Threonine Methionine Glycine
[0090] In specific embodiments, the number of substitutions,
additions or deletions in the amino acid sequence of SEQ ID NO:2
and/or any of the polypeptide fragments described herein is 75, 70,
60, 50, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or
30-20, 20-15, 20-10, 15-10, 10-1, 5-10, 1-5, 1-3 or 1-2.
[0091] In specific embodiments, the antibodies of the invention
bind GMAD polypeptides or fragments or variants thereof (especially
a fragment comprising or alternatively consisting of, the
secreted,.mature form of GMAD), that contains any one or more of
the following conservative mutations in GMAD: M1 replaced with A,
G, I, L, S, T, or V; 1(2 replaced with H, or R; A3 replaced with G,
I, L, S, T, M, or V; L4 replaced with A, G, I, S, T, M, or V; L6
replaced with A, G, 1, S, T, M, or V; L7 replaced with A, G, I, S,
T, M, or V; L8 replaced with A, G, I, S, T, M, or V; L9 replaced
with A, G, I, S, T, M, or V; V11 replaced with A, G, I, L, S, T, or
M; L12 replaced with A, G, I, S, T, M, or V; G13 replaced with A,
I, L, S, T, M, or V; L14 replaced with A, G, I, S, T, M, or V; L15
replaced with A, G, I, S, T, M, or V; V16 replaced with A, G, I, L,
S, T, or M; S17 replaced with A, G, I, L, T, M, or V; S18 replaced
with A, G, I, L, T, M, or V; K19 replaced with H, or R; T20
replaced with A, G, I, L, S, M, or V; L21 replaced with A, G, I, S,
T, M, or V; S23 replaced with A, G, I, L, T, M, or V; M24 replaced
with A, G, I, L, S, T, or V; E25 replaced with D; E26 replaced with
D; A27 replaced with G, I, L, S, T, M, or V; 128 replaced with A,
G, L, S, T, M, or V; N29 replaced with Q; E30 replaced with D; R31
replaced with H, or K; 132 replaced with A, G, L, S, T, M, or V;
Q33 replaced with N; E34 replaced with D; V35 replaced with A, G,
I, L, S, T, or M; A36 replaced with G, I, L, S, T, M, or V; G37
replaced with A, I, L, S, T, M, or V; S38 replaced with A, G, I, L,
T, M, or V; L39 replaced with A, G, I, S, T, M, or V; I40 replaced
with A, G, L, S, T, M, or V; F41 replaced with W, or Y; R42
replaced with H, or K; A43 replaced with G, I, L, S, T, M, or V;
I44 replaced with A, G, L, S, T, M, or V; S45 replaced with A, G,
I, L, T, M, or V; S46 replaced with A, G, I, L, T, M, or V; I47
replaced with A, G, L, S, T, M, or V; G48 replaced with A, I, L, S,
T, M, or V; R49 replaced with H, or K; G50 replaced with A, I, L,
S, T, M, or V; S51 replaced with A, G, I, L, T, M, or V; E52
replaced with D; S53 replaced with A, G, I, L, T, M, or V; V54
replaced with A, G, I, L, S, T, or M; T55 replaced with A, G, I, L,
S, M, or V; S56 replaced with A, G, I, L, T, M, or V; R57 replaced
with H, or K; G58 replaced with A, I, L, S, T, M, or V; D59
replaced with E; L60 replaced with A, G, I, S, T, M, or V; A61
replaced with G, I, L, S, T, M, or V; T62 replaced with A, G, I, L,
S, M, or V; R65 replaced with H, or K; G66 replaced with A, I, L,
S, T, M, or V; F67 replaced with W, or Y; A68 replaced with G, I,
L, S, T, M, or V; V69 replaced with A, G, I, L, S, T, or M; T70
replaced with A, G, I, L, S, M, or V; G71 replaced with A, I, L, S,
T, M, or V; T73 replaced with A, G, I, L, S, M, or V; G75 replaced
with A, I, L, S, T, M, or V; S76 replaced with A, G, I, L, T, M, or
V; A77 replaced with G, I, L, S, T, M, or V; G79 replaced with A,
I, L, S, T, M, or V; S80 replaced with A, G, I, L, T, M, or V; W81
replaced with F, or Y; D82 replaced with E; V83 replaced with A, G,
I, L, S, T, or M; R84 replaced with H, or K; A85 replaced with G,
I, L, S, T, M, or V; E86 replaced with D; T87 replaced with A, G,
I, L, S, M, or V; T88 replaced with A, G, I, L, S, M, or V; H90
replaced with K, or R; Q92 replaced with N; A94 replaced with G, I,
L, S, T, M, or V; G95 replaced with A, I, L, S, T, M, or V; M96
replaced with A, G, I, L, S, T, or V; D97 replaced with E; W98
replaced with F, or Y; T99 replaced with A, G, I, L, S, M, or V;
G100 replaced with A, I, L, S, T, M, or V; A101 replaced with G, I,
L, S, T, M, or V; R102 replaced with H, or K; R105 replaced with H,
or K; V106 replaced with A, G, I, L, S, T, or M; and/or Q107
replaced with N; of SEQ ID NO:2.
[0092] In specific embodiments, the antibodies of the invention
bind GMAD polypeptides or fragments or variants thereof (especially
a fragment comprising or alternatively consisting of, the secreted,
mature form of GMAD), that contains any one or more of the
following non-conservative mutations in GMAD: M1 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; K2 replaced with D, E, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, P, or C; A3 replaced with D, E, H, K,
R, N, Q, F, W, Y, P, or C; L4 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; C5 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, or P; L6 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; L7 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
L8 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L9 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; P10 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; V11 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; L12 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; G13 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; L14 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; L15 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; V16 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S17
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S18 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; K19 replaced with D, E,
A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; T20 replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; L21 replaced with D, E, H,
K, R, N, Q, F, W, Y, P, or C; C22 replaced with D, E, H, K, R, A,
G, I, L, S, T, M, V, N, Q, F, W, Y, or P; S23 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; M24 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; E25 replaced with H, K, R, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, P, or C; E26 replaced with H, K, R, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A27 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; I28 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; N29 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, F, W, Y, P, or C; E30 replaced with H, K, R, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R31 replaced with D, E,
A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I32 replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; Q33 replaced with D, E, H,
K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; E34 replaced with
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; V35
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A36 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; G37 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; S38 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; L39 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; I40 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; F41 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M,
V, P, or C; R42 replaced with D, E, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, P, or C; A43 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; I44 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
S45 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S46
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I47 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; G48 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; R49 replaced with D, E, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, P, or C; G50 replaced with D, E, H,
K, R, N, Q, F, W, Y, P, or C; S51 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; E52 replaced with H, K, R, A, G, I, L, S, T,
M, V, N, Q, F, W, Y, P, or C; S53 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; V54 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; T55 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; S56 replaced with D, E, H, K, R, N, Q, F, W, V, P, or C; R57
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
G58 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D59
replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or
C; L60 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A61
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T62 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; C63 replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; P64 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C;
R65 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P,
or C; G66 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F67
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
A68 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V69
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T70 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; G71 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; C72 replaced with D, E, H, K, R,
A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; T73 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; C74 replaced with D, E, H, K,
R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; G75 replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; S76 replaced with D, E, H,
K, R, N, Q, F, W, Y, P, or C; A77 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; C78 replaced with D, E, H, K, R, A, G, I, L,
S, T, M, V, N, Q, F, W, Y, or P; G79 replaced with D, E, H, K, R,
N, Q, F, W, Y, P, or C; S80 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C; W81 replaced with D, E, H, K, R, N, Q, A, G, I, L,
S, T, M, V, P, or C; D82 replaced with H, K, R, A, G, I, L, S, T,
M, V, N, Q, F, W, Y, P, or C; V83 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; R84 replaced with D, E, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, P, or C; A85 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; E86 replaced with H, K, R, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, P, or C; T87 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; T88 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; C89 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, or P; H90 replaced with D, E, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, P, or C; C91 replaced with D, E, H, K, R, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, or P; Q92 replaced with D, E, H,
K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; C93 replaced with
D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; A94
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G95 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; M96 replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; D97 replaced with H, K, R, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; W98 replaced with D, E,
H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T99 replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; G100 replaced with D, E, H,
K, R, N, Q, F, W, Y, P, or C; A101 replaced with D, E, H, K, R, N,
Q, F, W, Y, P, or C; R102 replaced with D, E, A, G, I, L, S, T, M,
V, N, Q, F, W, Y, P, or C; C103 replaced with D, E, H, K, R, A, G,
I, L, S, T, M, V, N, Q, F, W, Y, or P; C104 replaced with D, E, H,
K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; R105 replaced
with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; V106
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q107 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; P108
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or C; of SEQ ID NO:2.
[0093] Amino acids in the GMAD protein of the present invention
that are essential for function can be identified by methods known
in the art, such as site-directed mutagenesis or alanine-scanning
mutagenesis (Cunningham and Wells, Science 244:1081-1085 (1989)).
The latter procedure introduces single alanine mutations at every
residue in the molecule. The resulting mutant molecules are then
tested for biological activity such as receptor binding or in
vitro, or in vivo proliferative activity. Sites that are critical
for ligand-receptor binding can also be determined by structural
analysis such as crystallization, nuclear magnetic resonance or
photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899-904
(1992) and de Vos et al. Science 255:306-312 (1992)). In preferred
embodiments, antibodies of the present invention bind regions of
GMAD that are essential for GMAD function. In other preferred
embodiments, antibodies of the present invention bind regions of
GMAD that are essential for GMAD function and inhibit or abolish
GMAD function. In other preferred embodiments, antibodies of the
present invention bind regions of GMAD that are essential for GMAD
function and enhance GMAD function.
[0094] Additionally, protein engineering may be employed to improve
or alter the characteristics of GMAD polypeptides. Recombinant DNA
technology known to those skilled in the art can be used to create
novel mutant proteins or muteins including single or multiple amino
acid substitutions, deletions, additions or fusion proteins. Such
modified polypeptides can show, e.g., enhanced activity or
increased stability. In addition, they may be purified in higher
yields and show better solubility than the corresponding natural
polypeptide, at least under certain purification and storage
conditions. Antibodies of the present invention may bind such
modified GMAD polypeptides.
[0095] Non-naturally occurring variants of GMAD may be produced
using art-known mutagenesis techniques, which include, but are not
limited to oligonucleotide mediated mutagenesis, alanine scanning,
PCR mutagenesis, site directed mutagenesis (see e.g., Carter et
al., Nucl. Acids Res. 13:4331 (1986); and Zoller et al., Nucl.
Acids Res. 10:6487 (1982)), cassette mutagenesis (see e.g., Wells
et al., Gene 34:315 (1985)), restriction selection mutagenesis (see
e.g., Wells et al., Philos. Trans. R. Soc. London SerA 317:415
(1986)).
[0096] Thus, the invention also encompasses antibodies that bind
GMAD derivatives and analogs that have one or more amino acid
residues deleted, added, and/or substituted to generate GMAD
polypeptides that are better suited for binding activity,
therapeutic activity or expression, scale up, etc., in the host
cells chosen. For example, cysteine residues can be deleted or
substituted with another amino acid residue in order to eliminate
disulfide bridges; N-linked glycosylation sites can be altered or
eliminated to achieve, for example, expression of a homogeneous
product that is more easily recovered and purified from yeast hosts
which are known to hyperglycosylate N-linked sites. To this end, a
variety of amino acid substitutions at one or both of the first or
third amino acid positions on any one or more of the glycosylation
recognition sequences in the GMAD polypeptides and/or an amino acid
deletion at the second position of any one or more such recognition
sequences will prevent glycosylation of GMAD at the modified
tripeptide sequence (see, e.g., Miyajimo et al., EMBO J
5(6):1193-1197). Additionally, one or more of the amino acid
residues of GMAD polypeptides (e.g., arginine and lysine residues)
may be deleted or substituted with another residue to eliminate
undesired processing by proteases such as, for example, furins or
kexins.
[0097] The antibodies of the present invention also include
antibodies that bind a polypeptide comprising, or alternatively,
consisting of, the polypeptide encoded by the deposited GMAD cDNA
(the deposit having ATCC Accession Number 209215); a polypeptide
comprising, or alternatively, consisting of, the polypeptide of SEQ
ID NO:2 minus the amino terminal methionine; a polypeptide
comprising, or alternatively, consisting of the secreted form of
GMAD; a polypeptide comprising, or alternatively, consisting of,
the mature form of GMAD; as well as polypeptides which are at least
80% identical, more preferably at least 90% or 95% identical, still
more preferably at least 96%, 97%, 98% or 99% identical to the
polypeptides described above (e.g., the polypeptide encoded by the
deposited GMAD cDNA clone (the deposit having ATCC Accession Number
209215), the polypeptide of SEQ ID NO:2, and portions of such
polypeptides with at least 30 amino acids and more preferably at
least 50 amino acids.
[0098] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a reference amino acid sequence of a
GMAD polypeptide is intended that the amino acid sequence of the
polypeptide is identical to the reference sequence except that the
polypeptide sequence may include up to five amino acid alterations
per each 100 amino acids of the reference amino acid of the GMAD
polypeptide. In other words, to obtain a polypeptide having an
amino acid sequence at least 95% identical to a reference amino
acid sequence, up to 5% of the amino acid residues in the reference
sequence may be deleted or substituted with another amino acid, or
a number of amino acids up to 5% of the total amino acid residues
in the reference sequence may be inserted into the reference
sequence. These alterations of the reference sequence may occur at
the amino or carboxy terminal positions of the reference amino acid
sequence or anywhere between those terminal positions, interspersed
either individually among residues in the reference sequence or in
one or more contiguous groups within the reference sequence.
[0099] As a practical matter, whether any particular polypeptide is
at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance,
the amino acid sequence shown in SEQ ID NO:2 or to the amino acid
sequence encoded by deposited cDNA clones can be determined
conventionally using known computer programs such the Bestfit
program (Wisconsin Sequence Analysis Package, Version 8 for Unix,
Genetics Computer Group, University Research Park, 575 Science
Drive, Madison, Wis. 53711. When using Bestfit or any other
sequence alignment program to determine whether a particular
sequence is, for instance, 95% identical to a reference sequence
according to the present invention, the parameters are set, of
course, such that the percentage of identity is calculated over the
full length of the reference amino acid sequence and that gaps in
homology of up to 5% of the total number of amino acid residues in
the reference sequence are allowed.
[0100] In a specific embodiment, the identity between a reference
(query) sequence (a sequence of the present invention) and a
subject sequence, also referred to as a global sequence alignment,
is determined using the FASTDB computer program based on the
algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
Preferred parameters used in a FASTDB amino acid alignment are:
Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1, Joining Penalty=20,
Randomization Group Length=0, Cutoff Score=1, Window Size=sequence
length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or
the length of the subject amino acid sequence, whichever is
shorter. According to this embodiment, if the subject sequence is
shorter than the query sequence due to N- or C-terminal deletions,
not because of internal deletions, a manual correction is made to
the results to take into consideration the fact that the FASTDB
program does not account for N- and C-terminal truncations of the
subject sequence when calculating global percent identity. For
subject sequences truncated at the N- and C-termini, relative to
the query sequence, the percent identity is corrected by
calculating the number of residues of the query sequence that are
N- and C-terminal of the subject sequence, which are not
matched/aligned with a corresponding subject residue, as a percent
of the total bases of the query sequence. A determination of
whether a residue is matched/aligned is determined by results of
the FASTDB sequence alignment. This percentage is then subtracted
from the percent identity, calculated by the above FASTDB program
using the specified parameters, to arrive at a final percent
identity score. This final percent identity score is what is used
for the purposes of this embodiment. Only residues to the N- and
C-termini of the subject sequence, which are not matched/aligned
with the query sequence, are considered for the purposes of
manually adjusting the percent identity score. That is, only query
residue positions outside the farthest N- and C-terminal residues
of the subject sequence. For example, a 90 amino acid residue
subject sequence is aligned with a 100 residue query sequence to
determine percent identity. The deletion occurs at the N-terminus
of the subject sequence and therefore, the FASTDB alignment does
not show a matching/alignment of the first 10 residues at the
N-terminus. The 10 unpaired residues represent 10% of the sequence
(number of residues at the N- and C- termini not matched/total
number of residues in the query sequence) so 10% is subtracted from
the percent identity score calculated by the FASTDB program. If the
remaining 90 residues were perfectly matched the final percent
identity would be 90%. In another example, a 90 residue subject
sequence is compared with a 100 residue query sequence. This time
the deletions are internal deletions so there are no residues at
the N- or C-termini of the subject sequence which are not
matched/aligned with the query. In this case, the percent identity
calculated by FASTDB is not manually corrected. Once again, only
residue positions outside the N- and C-terminal ends of the subject
sequence, as displayed in the FASTDB alignment, which are not
matched/aligned with the query sequence are manually corrected for.
No other manual corrections are made for the purposes of this
embodiment.
[0101] The present application is also directed to antibodies that
bind proteins containing polypeptides at least 90%, 95%, 96%, 97%,
98% or 99% identical to the GMAD polypeptide sequence set forth
herein as n.sup.1-m.sup.1. In preferred embodiments, the
application is directed to antibodies that bind proteins containing
polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to
polypeptides having the amino acid sequence of the specific GMAD N-
and C-terminal deletions recited herein.
[0102] In certain preferred embodiments, antibodies of the
invention bind GMAD fusion proteins as described above wherein the
GMAD portion of the fusion protein are those described as
n.sup.1-m.sup.1 herein.
Antibodies of the Invention May Bind Modified GMAD Polypeptides
[0103] It is specifically contemplated that antibodies of the
present invention may bind modified forms of the GMAD protein (SEQ
ID NO:2)
[0104] In specific embodiments, antibodies of the present invention
bind GMAD polypeptides (such as those described above) including,
but not limited to naturally purified GMAD polypeptides, GMAD
polypeptides produced by chemical synthetic procedures, and GMAD
polypeptides produced by recombinant techniques from a prokaryotic
or eukaryotic host, including, for example, bacterial, yeast,
higher plant, insect and mammalian cells using, for example, the
recombinant compositions and methods described above. Depending
upon the host employed in a recombinant production procedure, the
polypeptides may be glycosylated or non-glycosylated. In addition,
GMAD polypeptides may also include an initial modified methionine
residue, in some cases as a result of host-mediated processes.
[0105] In addition, GMAD proteins that antibodies of the present
invention may bind can be chemically synthesized using techniques
known in the art (e.g., see Creighton, Proteins: Structures and
Molecular Principles, W.H. Freeman & Co., N.Y. (1983), and
Hunkapiller, et al., Nature 310:105-111 (1984)). For example, a
peptide corresponding to a fragment of a GMAD polypeptide can be
synthesized by use of a peptide synthesizer. Furthermore, if
desired, nonclassical amino acids or chemical amino acid analogs
can be introduced as a substitution or addition into the GMAD
polypeptide sequence. Non-classical amino acids include, but are
not limited to, to the D-isomers of the common amino acids,
2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric
acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic
acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid,
ornithine, norleucine, norvaline, hydroxyproline, sarcosine,
citrulline, homocitrulline, cysteic acid, t-butylglycine,
t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine,
fluoro-amino acids, designer amino acids such as b-methyl amino
acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid
analogs in general. Furthermore, the amino acid can be D
(dextrorotary) or L (levorotary).
[0106] The invention additionally, encompasses antibodies that bind
GMAD polypeptides which are differentially modified during or after
translation, e.g., by glycosylation, acetylation, phosphorylation,
amidation, derivatization by known protecting/blocking groups,
proteolytic cleavage, linkage to an antibody molecule or other
cellular ligand, etc. Any of numerous chemical modifications may be
carried out by known techniques, including but not limited to,
specific chemical cleavage by cyanogen bromide, trypsin,
chymotrypsin, papain, V8 protease, NaBH.sub.4, acetylation,
formylation, oxidation, reduction, metabolic synthesis in the
presence of tunicamycin; etc.
[0107] Additional post-translational modifications to GMAD
polypeptides for example, e.g., N-linked or O-linked carbohydrate
chains, processing of N-terminal or C-terminal ends), attachment of
chemical moieties to the amino acid backbone, chemical
modifications of N-linked or O-linked carbohydrate chains, and
addition or deletion of an N-terminal methionine residue as a
result of procaryotic host cell expression. The polypeptides may
also be modified with a detectable label, such as an enzymatic,
fluorescent, isotopic or affinity label to allow for detection and
isolation of the protein.
[0108] Also provided by the invention are antibodies that bind
chemically modified derivatives of GMAD polypeptide which may
provide additional advantages such as increased solubility,
stability and circulating time of the polypeptide, or decreased
immunogenicity (see U.S. Pat. No. 4,179,337). The chemical moieties
for derivitization may be selected from water soluble polymers such
as polyethylene glycol, ethylene glycol/propylene glycol
copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and
the like. The polypeptides may be modified at random positions
within the molecule, or at predetermined positions within the
molecule and may include one, two, three or more attached chemical
moieties.
[0109] The polymer may be of any molecular weight, and may be
branched or unbranched. For polyethylene glycol, the preferred
molecular weight is between about 1 kDa and about 100 kDa (the term
"about" indicating that in preparations of polyethylene glycol,
some molecules will weigh more, some less, than the stated
molecular weight) for ease in handling and manufacturing. Other
sizes may be used, depending on the desired therapeutic profile
(e.g., the duration of sustained release desired, the effects, if
any on biological activity, the ease in handling, the degree or
lack of antigenicity and other known effects of the polyethylene
glycol to a therapeutic protein or analog). For example, the
polyethylene glycol may have an average molecular weight of about
200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000,
5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000,
10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000,
14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000,
18,500, 19,000, 19,500, 20,000, 25,000, 30,000, 35,000, 40,000,
50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000,
90,000, 95,000, or 100,000 kDa.
[0110] As noted above, the polyethylene glycol may have a branched
structure. Branched polyethylene glycols are described, for
example, in U.S. Pat. No. 5,643,575; Morpurgo et al., Appl.
Biochem. Biotechnol. 56:59-72. (1996); Vorobjev et al., Nucleosides
Nucleotides 18:2745-2750 (1999); and Caliceti et al., Bioconjug.
Chem. 10:638-646 (1999), the disclosures of each of which are
incorporated herein by reference.
[0111] The polyethylene glycol molecules (or other chemical
moieties) should be attached to the protein with consideration of
effects on functional or antigenic domains of the protein. There
are a number of attachment methods available to those skilled in
the art, e.g., EP 0 401 384, herein incorporated by reference
(coupling PEG to G-CSF), see also Malik et al., Exp. Hematol.
20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl
chloride). For example, polyethylene glycol may be covalently bound
through amino acid residues via a reactive group, such as, a free
amino or carboxyl group. Reactive groups are those to which an
activated polyethylene glycol molecule may be bound. The amino acid
residues having a free amino group may include lysine residues and
the N-terminal amino acid residues; those having a free carboxyl
group may include aspartic acid residues, glutamic acid residues
and the C-terminal amino acid residue. Sulfhydryl groups may also
be used as a reactive group for attaching the polyethylene glycol
molecules. Preferred for therapeutic purposes is attachment at an
amino group, such as attachment at the N-terminus or lysine
group.
[0112] As suggested above, polyethylene glycol may be attached to
proteins via linkage to any of a number of amino acid residues. For
example, polyethylene glycol can be linked to a protein via
covalent bonds to lysine, histidine, aspartic acid, glutamic acid,
or cysteine residues. One or more reaction chemistries may be
employed to attach polyethylene glycol to specific amino acid
residues (e.g., lysine, histidine, aspartic acid, glutamic acid, or
cysteine) of the protein or to more than one type of amino acid
residue (e.g., lysine, histidine, aspartic acid, glutamic acid,
cysteine and combinations thereof) of the protein.
[0113] One may specifically desire proteins chemically modified at
the N-terminus. Using polyethylene glycol as an illustration of the
present composition, one may select from a variety of polyethylene
glycol molecules (by molecular weight, branching, etc.), the
proportion of polyethylene glycol molecules to protein (or peptide)
molecules in the reaction mix, the type of pegylation reaction to
be performed, and the method of obtaining the selected N-terminally
pegylated protein. The method of obtaining the N-terminally
pegylated preparation (i.e., separating this moiety from other
monopegylated moieties if necessary) may be by purification of the
N-terminally pegylated material from a population of pegylated
protein molecules. Selective proteins chemically modified at the
N-terminus modification may be accomplished by reductive alkylation
which exploits differential reactivity of different types of
primary amino groups (lysine versus the N-terminal) available for
derivatization in a particular protein. Under the appropriate
reaction conditions, substantially selective derivatization of the
protein at the N-terminus with a carbonyl group containing polymer
is achieved.
[0114] As indicated above, pegylation of the proteins of the
invention may be accomplished by any number of means. For example,
polyethylene glycol may be attached to the protein either directly
or by an intervening linker. Linkerless systems for attaching
polyethylene glycol to proteins are described in Delgado et al.,
Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992); Francis et
al., Intern. J. of Hematol. 68:1-18 (1998); U.S. Pat. No.
4,002,531; U.S. Pat. No. 5,349,052; WO 95/06058; and WO 98/32466,
the disclosures of each of which are incorporated herein by
reference.
[0115] One system for attaching polyethylene glycol directly to
amino acid residues of proteins without an intervening linker
employs tresylated MPEG, which is produced by the modification of
monmethoxy polyethylene glycol (MPEG) using tresylchloride
(ClSO.sub.2CH.sub.2CF.sub.3). Upon reaction of protein with
tresylated MPEG, polyethylene glycol is directly attached to amine
groups of the protein. Thus, the invention includes
protein-polyethylene glycol conjugates produced by reacting
proteins of the invention with a polyethylene glycol molecule
having a 2,2,2-trifluoreothane sulphonyl group.
[0116] Polyethylene glycol can also be attached to proteins using a
number of different intervening linkers. For example, U.S. Pat. No.
5,612,460, the entire disclosure of which is incorporated herein by
reference, discloses urethane linkers for connecting polyethylene
glycol to proteins. Protein-polyethylene glycol conjugates wherein
the polyethylene glycol is attached to the protein by a linker can
also be produced by reaction of proteins with compounds such as
MPEG-succinimidylsuccinate, MPEG activated with
1,1'-carbonyldiimidazole, MPEG-2,4,5-trichloropenylcarbonate,
MPEG-p-nitrophenolcarbonate, and various MPEG-succinate
derivatives. A number additional polyethylene glycol derivatives
and reaction chemistries for attaching polyethylene glycol to
proteins are described in WO 98/32466, the entire disclosure of
which is incorporated herein by reference. Pegylated protein
products produced using the reaction chemistries set out herein are
included within the scope of the invention.
[0117] The number of polyethylene glycol moieties attached to each
GMAD polypeptide (i.e., the degree of substitution) may also vary.
For example, the pegylated proteins of the invention may be linked,
on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, or
more polyethylene glycol molecules. Similarly, the average degree
of substitution within ranges such as 1-3, 2-4, 3-5, 4-6, 5-7, 6-8,
7-9, 8-10, 9-11, 10-12, 11-13, 12-14, 13-15, 14-16, 15-17, 16-18,
17-19, or 18-20 polyethylene glycol moieties per protein molecule.
Methods for determining the degree of substitution are discussed,
for example, in Delgado et al., Crit. Rev. Thera. Drug Carrier Sys.
9:249-304 (1992).
[0118] As mentioned the antibodies of the present invention may
bind GMAD polypeptides that are modified by either natural
processes, such as posttranslational processing, or by chemical
modification techniques which are well known in the art. It will be
appreciated that the same type of modification may be present in
the same or varying degrees at several sites in a given GMAD
polypeptide. GMAD polypeptides may be branched, for example, as a
result of ubiquitination, and they may be cyclic, with or without
branching. Cyclic, branched, and branched cyclic GMAD polypeptides
may result from posttranslation natural processes or may be made by
synthetic methods. Modifications include acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin,
covalent attachment of a heme moiety, covalent attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid
or lipid derivative, covalent attachment of phosphotidylinositol,
cross-linking, cyclization, disulfide bond formation,
demethylation, formation of covalent cross-links, formation of
cysteine, formation of pyroglutamate, formylation,
gamma-carboxylation, glycosylation, GPI anchor formation,
hydroxylation, iodination, methylation, myristoylation, oxidation,
pegylation, proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, transfer-RNA mediated
addition of amino acids to proteins such as arginylation, and
ubiquitination. (See, for instance, PROTEINS--STRUCTURE AND
MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and
Company, New York (1993); POSTTRANSLATIONAL COVALENT MODIFICATION
OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, pgs.
1-12 (1983); Seifter et al., Meth Enzymol 182:626-646 (1990);
Rattan et al., Ann NY Acad Sci 663:48-62 (1992)).
Anti-GMAD Antibodies:
[0119] In one embodiment, the invention provides antibodies (e.g.,
antibodies comprising two heavy chains and two light chains linked
together by disulfide bridges) that specifically bind a GMAD
polypeptide (e.g., SEQ ID NO:2) or fragments or variants thereof,
wherein the amino acid sequence of the heavy chain and the amino
acid sequence of the light chain are the same as the amino acid
sequence of a heavy chain and a light chain of one or more scFvs
referred to in Table 1. In another embodiment, the invention
provides antibodies (each consisting of two heavy chains and two
light chains linked together by disulfide bridges to form an
antibody) that specifically bind a GMAD polypeptide (e.g., SEQ ID
NO:2) or fragments or variants thereof, wherein the amino acid
sequence of the heavy chain or the amino acid sequence of the light
chain are the same as the amino acid sequence of a heavy chain or a
light chain of one or more scFvs referred to in Table 1. Specific
binding to GMAD polypeptides may be determined by immunoassays
known in the art or described herein for assaying specific
antibody-antigen binding. Molecules comprising, or alternatively
consisting of, fragments or variants of these antibodies that
specifically bind to GMAD are also encompassed by the invention, as
are nucleic acid molecules encoding these antibodies molecules,
fragments and/or variants (e.g., SEQ ID NOS:137-233).
[0120] In one embodiment of the present invention, antibodies that
specifically bind to GMAD or a fragment or variant thereof,
comprise a polypeptide having the amino acid sequence of any one of
the heavy chains of at least one of the scFvs referred to in Table
1 and/or any one of the light chains of at least one of the scFvs
referred to in Table 1.
[0121] In another embodiment of the present invention, antibodies
that specifically bind to GMAD or a fragment or variant thereof,
comprise a polypeptide having the amino acid sequence of any one of
the VH domains of at least one of the scFvs referred to in Table 1
and/or any one of the VL domains of at least one of the scFvs
referred to in Table 1. In preferred embodiments, antibodies of the
present invention comprise the amino acid sequence of a VH domain
and VL domain from a single scFv referred to in Table 1. In
alternative embodiments, antibodies of the present invention
comprise the amino acid sequence of a VH domain and a VL domain
from different scFvs referred to in Table 1. Molecules comprising,
or alternatively consisting of, antibody fragments or variants of
the VH and/or VL domains of at least one of the scFvs referred to
in Table 1 that specifically bind to GMAD are also encompassed by
the invention, as are nucleic acid molecules encoding these VH and
VL domains, molecules, fragments and/or variants.
[0122] The present invention also provides antibodies that
specifically bind to a polypeptide, or polypeptide fragment or
variant of GMAD, wherein said antibodies comprise, or alternatively
consist of, a polypeptide having an amino acid sequence of any one,
two, three, or more of the VH CDRs contained in a VH domain of one
or more scFvs referred to in Table 1. In particular, the invention
provides antibodies that specifically bind GMAD, comprising, or
alternatively consisting of, a polypeptide having the amino acid
sequence of a VH CDR1 contained in a VH domain of one or more scFvs
referred to in Table 1. In another embodiment, antibodies that
specifically bind GMAD, comprise, or alternatively consist of, a
polypeptide having the amino acid sequence of a VH CDR2 contained
in a VH domain of one or more scFvs referred to in Table 1. In a
preferred embodiment, antibodies that specifically bind GMAD,
comprise, or alternatively consist of, a polypeptide having the
amino acid sequence of a VH CDR3 contained in a VH domain of one or
more scFvs referred to in Table 1. Molecules comprising, or
alternatively consisting of, these antibodies, or antibody
fragments or variants thereof, that specifically bind to GMAD or a
GMAD fragment or variant thereof are also encompassed by the
invention, as are nucleic acid molecules encoding these antibodies,
molecules, fragments and/or variants (e.g., SEQ ID
NOS:137-233).
[0123] The present invention also provides antibodies that
specifically bind to a polypeptide, or polypeptide fragment or
variant of GMAD, wherein said antibodies comprise, or alternatively
consist of, a polypeptide having an amino acid sequence of any one,
two, three, or more of the VL CDRs contained in a VL domain of one
or more scFvs referred to in Table 1. In particular, the invention
provides antibodies that specifically bind GMAD, comprising, or
alternatively consisting of, a polypeptide having the amino acid
sequence of a VL CDR1 contained in a VL domain of one or more scFvs
referred to in Table 1. In another embodiment, antibodies that
specifically bind GMAD, comprise, or alternatively consist of, a
polypeptide having the amino acid sequence of a VL CDR2 contained
in a VL domain of one or more scFvs referred to in Table 1. In a
preferred embodiment, antibodies that specifically bind GMAD,
comprise, or alternatively consist of, a polypeptide having the
amino acid sequence of a VL CDR3 contained in a VL domain of one or
more scFvs referred to in Table 1. Molecules comprising, or
alternatively consisting of, these antibodies, or antibody
fragments or variants thereof, that specifically bind to GMAD or a
GMAD fragment or variant are also encompassed by the invention, as
are nucleic acid molecules encoding these antibodies, molecules,
fragments and/or variants (e.g., SEQ ID NOS:137-233).
[0124] The present invention also provides antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants) that specifically bind to a GMAD polypeptide
or polypeptide fragment or variant of GMAD, wherein said antibodies
comprise, or alternatively consist of, one, two, three, or more VH
CDRs and one, two, three or more VL CDRs, as contained in a VH
domain or VL domain of one or more scFvs referred to in Table 1. In
particular, the invention provides for antibodies that specifically
bind to a polypeptide or polypeptide fragment or variant of GMAD,
wherein said antibodies comprise, or alternatively consist of, a VH
CDR1 and a VL CDR1, a VH CDR1 and a VL CDR2, a VH CDR1 and a VL
CDR3, a VH CDR2 and a VL CDR1, VH CDR2 and VL CDR2, a VH CDR2 and a
VL CDR3, a VH CDR3 and a VH CDR1, a VH CDR3 and a VL CDR2, a VH
CDR3 and a VL CDR3, or any combination thereof, of the VH CDRs and
VL CDRs contained in a VH domain or VL domain of one or more scFvs
referred to in Table 1. In a preferred embodiment, one or more of
these combinations are from the same antibody as disclosed in Table
1. Molecules comprising, or alternatively consisting of, fragments
or variants of these antibodies, that specifically bind to GMAD are
also encompassed by the invention, as are nucleic acid molecules
encoding these antibodies, molecules, fragments or variants (e.g.,
SEQ ID NOS:137-233).
Nucleic Acid Molecules Encoding anti-GMAD Antibodies
[0125] The present invention also provides for nucleic acid
molecules, generally isolated, encoding an antibody of the
invention (including molecules comprising, or alternatively
consisting of, antibody fragments or variants thereof). In specific
embodiments, the nucleic acid molecules encoding an antibody of the
invention comprise, or alternatively consist of SEQ ID NOS:137-233
or fragments or variants thereof.
[0126] In a specific embodiment, a nucleic acid molecule of the
invention encodes an antibody (including molecules comprising, or
alternatively consisting of, antibody fragments or variants
thereof), comprising, or alternatively consisting of, a VH domain
having an amino acid sequence of any one of the VH domains of at
least one of the scFvs referred to in Table 1 and a VL domain
having an amino acid sequence of VL domain of at least one of the
scFvs referred to in Table 1. In another embodiment, a nucleic acid
molecule of the invention encodes an antibody (including molecules
comprising, or alternatively consisting of, antibody fragments or
variants thereof), comprising, or alternatively consisting of, a VH
domain having an amino acid sequence of any one of the VH domains
of at least one of the scFvs referred to in Table 1 or a VL domain
having an amino acid sequence of a VL domain of at least one of the
scFvs referred to in Table 1.
[0127] The present invention also provides antibodies that
comprise, or alternatively consist of, variants (including
derivatives) of the antibody molecules (e.g., the VH domains and/or
VL domains) described herein, which antibodies specifically bind to
GMAD or fragment or variant thereof. Standard techniques known to
those of skill in the art can be used to introduce mutations in the
nucleotide sequence encoding a molecule of the invention,
including, for example, site-directed mutagenesis and PCR-mediated
mutagenesis which result in amino acid substitutions. Preferably,
the variants (including derivatives) encode less than 50 amino acid
substitutions, less than 40 amino acid substitutions, less than 30
amino acid substitutions, less than 25 amino acid substitutions,
less than 20 amino acid substitutions, less than 15 amino acid
substitutions, less than 10 amino acid substitutions, less than 5
amino acid substitutions, less than 4 amino acid substitutions,
less than 3 amino acid substitutions, or less than 2 amino acid
substitutions relative to the reference VH domain, VHCDR1, VHCDR2,
VHCDR3, VL domain, VLCDR1, VLCDR2, or VLCDR3. A "conservative amino
acid substitution" is one in which the amino acid residue is
replaced with an amino acid residue having a side chain with a
similar charge. Families of amino acid residues having side chains
with similar charges have been defined in the art. These families
include amino acids with basic side chains (e.g., lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine, threonine, tyrosine, cysteine), nonpolar side
chains (e.g., alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophan), beta-branched side chains
(e.g., threonine, valine, isoleucine) and aromatic side chains
(e.g., tyrosine, phenylalanine, tryptophan, histidine).
Alternatively, mutations can be introduced randomly along all or
part of the coding sequence, such as by saturation mutagenesis, and
the resultant mutants can be screened for biological activity to
identify mutants that retain activity (e.g., the ability to induce
resistance to cellular insulin and/or glucose uptake).
[0128] For example, it is possible to introduce mutations only in
framework regions or only in CDR regions of an antibody molecule.
Introduced mutations may be silent or neutral missense mutations,
i.e., have no, or little, effect on an antibody's ability to bind
antigen. These types of mutations may be useful to optimize codon
usage, or improve a hybridoma's antibody production. Alternatively,
non-neutral missense mutations may alter an antibody's ability to
bind antigen. The location of most silent and neutral missense
mutations is likely to be in the framework regions, while the
location of most non-neutral missense mutations is likely to be in
CDR, though this is not an absolute requirement. One of skill in
the art would be able to design and test mutant molecules with
desired properties such as no alteration in antigen binding
activity or alteration in binding activity (e.g, improvements in
antigen binding activity or change in antibody specificity).
Following mutagenesis, the encoded protein may routinely be
expressed and the functional and/or biological activity of the
encoded protein, (e.g., ability to specifically bind GMAD) can be
determined using techniques described herein or by routinely
modifying techniques known in the art.
[0129] In a specific embodiment, an antibody of the invention
(including a molecule comprising, or alternatively consisting of,
an antibody fragment or variant thereof), that specifically binds
GMAD polypeptides or fragments or variants thereof, comprises, or
alternatively consists of, an amino acid sequence encoded by a
nucleotide sequence that hybridizes to a nucleotide sequence that
is complementary to that encoding one of the VH or VL domains of
one or more scFvs referred to in Table 1, under stringent
conditions, e.g., hybridization to filter-bound DNA in
6.times.sodium chloride/sodium citrate (SSC) at about 45.degree. C.
followed by one or more washes in 0.2.times.SSC/0.1% SDS at about
50-65.degree. C., under highly stringent conditions, e.g.,
hybridization to filter-bound nucleic acid in 6.times.SSC at about
45.degree. C. followed by one or more washes in 0.1.times.SSC/0.2%
SDS at about 68.degree. C., or under other stringent hybridization
conditions which are known to those of skill in the art (see, for
example, Ausubel, F. M. et al., eds., 1989, Current Protocols in
Molecular Biology, Vol. I, Green Publishing Associates, Inc. and
John Wiley & Sons, Inc., New York at pages 6.3.1-6.3.6 and
2.10.3). Nucleic acid molecules encoding these antibodies are also
encompassed by the invention.
[0130] It is well known within the art that polypeptides, or
fragments or variants thereof, with similar amino acid sequences
often have similar structure and many of the same biological
activities. Thus, in one embodiment, an antibody (including a
molecule comprising, or alternatively consisting of, an antibody
fragment or variant thereof), that specifically binds to a GMAD
polypeptide or a fragment or variant of a GMAD polypeptide,
comprises, or alternatively consists of, a VH domain having an
amino acid sequence that is at least 35%, at least 40%, at least
45%, at least 50%, at least 55%, at least 60%, at least 65%, at
least 70%, at least 75%, at least 80%, at least 85%, at least 90%,
at least 95%, or at least 99% identical, to the amino acid sequence
of a VH domain of at least one of the scFvs referred to in Table
1.
[0131] In another embodiment, an antibody (including a molecule
comprising, or alternatively consisting of, an antibody fragment or
variant thereof), that specifically binds to a GMAD polypeptide or
a fragment or variant of a GMAD polypeptide, comprises, or
alternatively consists of, a VL domain having an amino acid
sequence that is at least 35%, at least 40%, at least 45%, at least
50%, at least 55%, at least 60%, at least 65%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
or at least 99% identical, to the amino acid sequence of a VL
domain of at least one of the scFvs referred to in Table 1.
Methods of Producing Antibodies
[0132] Antibodies in accordance with the invention are preferably
prepared using a phage scFv display library. Technologies utilized
for achieving the same are disclosed in the patents, applications,
and references disclosed herein.
[0133] In phage display methods, functional antibody domains are
displayed on the surface of phage particles which carry the
polynucleotide sequences encoding them. In particular, DNA
sequences encoding VH and VL domains are amplified from animal cDNA
libraries (e.g., human or murine cDNA libraries of lymphoid
tissues) or synthetic cDNA libraries. The DNA encoding the VH and
VL domains are joined together by an scFv linker by PCR and cloned
into a phagemid vector (e.g., p CANTAB 6 or pComb 3 HSS). The
vector is electroporated in E. coli and the E. coli is infected
with helper phage. Phage used in these methods are typically
filamentous phage including fd and M13 and the VH and VL domains
are usually recombinantly fused to either the phage gene III or
gene VIII. Phage expressing an antigen binding domain that binds to
an antigen of interest (i.e., a GMAD polypeptide or a fragment
thereof) can be selected or identified with antigen, e.g., using
labeled antigen or antigen bound or captured to a solid surface or
bead. Examples of phage display methods that can be used to make
the antibodies of the present invention include, but are not
limited to, those disclosed in Brinkman et al., J. Immunol. Methods
182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-186
(1995); Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994);
Persic et al., Gene 187 9-18 (1997); Burton et al., Advances in
Immunology 57:191-280(1994); PCT application No. PCT/GB91/O1134;
PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO
92/18719; WO 93/11236; WO 95/15982; WO 95/20401; WO97/13844; and
U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717;
5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,717;
5,780,225; 5,658,727; 5,735,743 and 5,969,108; each of which is
incorporated herein by reference in its entirety.
[0134] For some uses, such as for in vitro affinity maturation of
an antibody of the invention, it may be useful to express the VH
and VL domains of one or more scFvs referred to in Table 1 as
single chain antibodies or Fab fragments in a phage display
library. For example, the cDNAs encoding the VH and VL domains of
the scFvs referred to in Table 1 may be expressed in all possible
combinations using a phage display library, allowing for the
selection of VH/VL combinations that bind a GMAD polypeptide with
preferred binding characteristics such as improved affinity or
improved off rates. Additionally, VH and VL segments--the CDR
regions of the VH and VL domains of the scFvs referred to in Table
1, in particular, may be mutated in vitro. Expression of VH and VL
domains with "mutant" CDRs in a phage display library allows for
the selection of VH/VL combinations that bind a GMAD polypeptides
with preferred binding characteristics such as improved affinity or
improved off rates.
Additional Methods of Producing Antibodies
[0135] Antibodies of the invention (including antibody fragments or
variants) can be produced by any method known in the art. For
example, it will be appreciated that antibodies in accordance with
the present invention can be expressed in cell lines including but
not limited to myeloma cell lines and hybridoma cell lines.
Sequences encoding the cDNAs or genomic clones for the particular
antibodies can be used for transformation of a suitable mammalian
or nonmammalian host cells or to generate phage display libraries,
for example. Additionally, polypeptide antibodies of the invention
may be chemically synthesized or produced through the use of
recombinant expression systems.
[0136] One way to produce the antibodies of the invention would be
to clone the VH and/or VL domains of the scFvs referred to in Table
1. In order to isolate the VH and VL domains from bacteria
transfected with a vector containing the scFv, PCR primers
complementary to VH or VL nucleotide sequences (See Example 2), may
be used to amplify the VH and VL sequences. The PCR products may
then be cloned using vectors, for example, which have a PCR product
cloning site consisting of a 5' and 3' single T nucleotide
overhang, that is complementary to the overhanging single adenine
nucleotide added onto the 5' and 3' end of PCR products by many DNA
polymerases used for PCR reactions. The VH and VL domains can then
be sequenced using conventional methods known in the art.
Alternatively, the VH and VL domains may be amplified using vector
specific primers designed to amplify the entire scFv, (i.e. the VH
domain, linker and VL domain.)
[0137] The cloned VH and VL genes may be placed into one or more
suitable expression vectors. By way of non-limiting example, PCR
primers including VH or VL nucleotide sequences, a restriction
site, and a flanking sequence to protect the restriction site may
be used to amplify the VH or VL sequences. Utilizing cloning
techniques known to those of skill in the art, the PCR amplified VH
domains may be cloned into vectors expressing the appropriate
immunoglobulin constant region, e.g., the human IgG1 or IgG4
constant region for VH domains, and the human kappa or lambda
constant regions for kappa and lambda VL domains, respectively.
Preferably, the vectors for expressing the VH or VL domains
comprise a promoter suitable to direct expression of the heavy and
light chains in the chosen expression system, a secretion signal, a
cloning site for the immunoglobulin variable domain, immunoglobulin
constant domains, and a selection marker such as neomycin. The VH
and VL domains may also be cloned into a single vector expressing
the necessary constant regions. The heavy chain conversion vectors
and light chain conversion vectors are then co-transfected into
cell lines to generate stable or transient cell lines that express
full-length antibodies, e.g., IgG, using techniques known to those
of skill in the art (See, for example, Guo et al., J. Clin.
Endocrinol. Metab. 82:925-31 (1997), and Ames et al., J. Immunol.
Methods 184:177-86 (1995) which are herein incorporated in their
entireties by reference).
[0138] The invention provides polynucleotides comprising, or
alternatively consisting of, a nucleotide sequence encoding an
antibody of the invention (including molecules comprising, or
alternatively consisting of, antibody fragments or variants
thereof). The invention also encompasses polynucleotides that
hybridize under high stringency, or alternatively, under
intermediate or lower stringency hybridization conditions, e.g., as
defined supra, to polynucleotides complementary to nucleic acids
having a polynucleotide sequence that encodes an antibody of the
invention or a fragment or variant thereof.
[0139] The polynucleotides may be obtained, and the nucleotide
sequence of the polynucleotides determined, by any method known in
the art. If the amino acid sequences of the VH domains, VL domains
and CDRs thereof, are known, nucleotide sequences encoding these
antibodies can be determined using methods well known in the art,
i.e., the nucleotide codons known to encode the particular amino
acids are assembled in such a way to generate a nucleic acid that
encodes the antibody, of the invention. Such a polynucleotide
encoding the antibody may be assembled from chemically synthesized
oligonucleotides (e.g., as described in Kutmeier et al.,
BioTechniques 17:242 (1994)), which, briefly, involves the
synthesis of overlapping oligonucleotides containing portions of
the sequence encoding the antibody, annealing and ligating of those
oligonucleotides, and then amplification of the ligated
oligonucleotides by PCR.
[0140] Alternatively, a polynucleotide encoding an antibody
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof) may be generated from
nucleic acid from a suitable source. If a clone containing a
nucleic acid encoding a particular antibody is not available, but
the sequence of the antibody molecule is known, a nucleic acid
encoding the immunoglobulin may be chemically synthesized or
obtained from a suitable source (e.g., an antibody cDNA library, or
a cDNA library generated from, or nucleic acid, preferably poly A+
RNA, isolated from, any tissue or cells expressing the antibody,
such as hybridoma cells or Epstein Barr virus transformed B cell
lines that express an antibody of the invention) by PCR
amplification using synthetic primers hybridizable to the 3' and 5'
ends of the sequence or by cloning using an oligonucleotide probe
specific for the particular gene sequence to identify, e.g., a cDNA
clone from a cDNA library that encodes the antibody. Amplified
nucleic acids generated by PCR may then be cloned into replicable
cloning vectors using any method well known in the art.
[0141] Once the nucleotide sequence of the antibody (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) is determined, the nucleotide
sequence of the antibody may be manipulated using methods well
known in the art for the manipulation of nucleotide sequences,
e.g., recombinant DNA techniques, site directed mutagenesis, PCR,
etc. (see, for example, the techniques described in Sambrook et
al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold
Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et
al., eds., 1998, Current Protocols in Molecular Biology, John Wiley
& Sons, NY, which are both incorporated by reference herein in
their entireties), to generate antibodies having a different amino
acid sequence, for example to create amino acid substitutions,
deletions, and/or insertions.
[0142] In a specific embodiment, VH and VL domains of heavy and
light chains of one or, more scFvs referred to in Table 1, or
fragments or variants thereof, are inserted within framework
regions using recombinant DNA techniques known in the art. In a
specific embodiment, one, two, three, four, five, six, or more of
the CDRs of heavy and light chains of one or more scFvs referred to
in Table 1, or fragments or variants thereof, is inserted within
framework regions using recombinant DNA techniques known in the
art. The framework regions may be naturally occurring or consensus
framework regions, and preferably are human framework regions (see,
e.g., Chothia et al., J. Mol. Biol. 278: 457-479 (1998) for a
listing of human framework regions, the contents of which are
hereby incorporated by reference in its entirety). Preferably, the
polynucleotides generated by the combination of the framework
regions and CDRs encode an antibody (including molecules
comprising, or alternatively consisting of, antibody fragments or
variants thereof) that specifically binds to GMAD. Preferably, as
discussed supra, polynucleotides encoding variants of antibodies or
antibody fragments having one or more amino acid substitutions may
be made within the framework regions, and, preferably, the amino
acid substitutions do not significantly alter binding of the
antibody to its antigen. Additionally, such methods may be used to
make amino acid substitutions or deletions of one or more variable
region cysteine residues participating in an intrachain disulfide
bond to generate antibody molecules, or antibody fragments or
variants, lacking one or more intrachain disulfide bonds. Other
alterations to the polynucleotide are encompassed by the present
invention and fall within the ordinary skill of the art.
XenoMouse Technology
[0143] The ability to clone and reconstruct megabase-sized human
loci in YACs and to introduce them into the mouse germline provides
a powerful approach to elucidating the functional components of
very large or crudely mapped loci as well as generating useful
models of human disease. Furthermore, the utilization of such
technology for substitution of mouse loci with their human
equivalents could provide unique insights into the expression and
regulation of human gene products during development, their
communication with other systems, and their involvement in disease
induction and progression.
[0144] An important practical application of such a strategy is the
"humanization" of the mouse humoral immune system. Introduction of
human immunoglobulin (Ig) loci into mice in which the endogenous Ig
genes have been inactivated offers the opportunity to study the
mechanisms underlying programmed expression and assembly of
antibodies as well as their role in B cell development.
Furthermore, such a strategy could provide an ideal source for
production of fully human monoclonal antibodies (Mabs) an important
milestone towards fulfilling the promise of antibody therapy in
human disease.
[0145] Fully human antibodies are expected to minimize the
immunogenic and allergic responses intrinsic to mouse or
mouse-derivatized Monoclonal antibodies and thus to increase the
efficacy and safety of the administered antibodies. The use of
fully human antibodies can be expected to provide a substantial
advantage in the treatment of chronic and recurring human diseases,
such as cancer, which require repeated antibody
administrations.
[0146] One approach towards this goal was to engineer mouse strains
deficient in mouse antibody production with large fragments of the
human Ig loci in anticipation that such mice would produce a large
repertoire of human antibodies in the absence of mouse antibodies.
Large human Ig fragments would preserve the large variable gene
diversity as well as the proper regulation of antibody production
and expression. By exploiting the mouse machinery for antibody
diversification and selection and the lack of immunological
tolerance to human proteins, the reproduced human antibody
repertoire in these mouse strains should yield high affinity
antibodies against any antigen of interest, including human
antigens. Using the hybridoma technology, antigen-specific human
Monoclonal antibodies with the desired specificity could be readily
produced and selected.
[0147] This general strategy was demonstrated in connection with
the generation of the first XenoMouse.TM. strains as published in
1994. See Green et al. Nature Genetics 7:13-21 (1994). The
XenoMouse.TM. strains were engineered with yeast artificial
chromosomes (YACS) containing 245 kb and10 190 kb-sized germline
configuration fragments of the human heavy chain locus and kappa
light chain locus, respectively, which contained core variable and
constant region sequences. Id. The human Ig containing YACs proved
to be compatible with the mouse system for both rearrangement and
expression of antibodies and were capable of substituting for the
inactivated mouse Ig genes. This was demonstrated by their ability
to induce B-cell development, to produce an adult-like human
repertoire of fully human antibodies, and to generate
antigen-specific human monoclonal antibodies. These results also
suggested that introduction of larger portions of the human Ig loci
containing greater numbers of V genes, additional regulatory
elements, and human Ig constant regions might recapitulate
substantially the full repertoire that is characteristic of the
human humoral response to infection and immunization. The work of
Green et al. was recently extended to the introduction of greater
than approximately 80% of the human antibody repertoire through
introduction of megabase sized, germline configuration YAC
fragments of the human heavy chain loci and kappa light chain loci,
respectively, to produce XenoMouse.TM. mice. See Mendez et al.
Nature Genetics 15:146-156 (1997), Green and Jakobovits J Exp. Med.
188:483-495 (1998), Green, Journal of Immunological Methods
231:11-23 (1999) and U.S. patent application Ser. No. 08/759,620,
filed Dec. 3, 1996, the disclosures of which are hereby
incorporated by reference.
[0148] Such approach is further discussed and delineated in U.S.
patent application Ser. Nos. 07/466,008, filed Jan. 12, 1990,
07/710,515, filed Nov. 8, 1990, 07/919,297, filed Jul. 24, 1992,
07/922,649, filed Jul. 30, 1992, filed 08/031,801, filed Mar.
15,1993, 08/112,848, filed Aug. 27, 1993, 08/234,145, filed Apr.
28, 1994, 08/376,279, filed Jan. 20, 1995, 08/430, 938, Apr. 27,
1995, 0-8/464,584, filed Jun. 5, 1995, 08/464,582, filed Jun. 5,
1995, 08/471,191, filed Jun. 5, 1995, 08/462,837, filed Jun. 5,
1995, 08/486,853, filed Jun. 5, 1995, 08/486,857, filed Jun. 5,
1995, 08/486,859, filed Jun. 5, 1995, 08/462,513, filed Jun. 5,
1995, 08/724,752, filed Oct. 2, 1996, and 08/759,620, filed Dec. 3,
1996. See also Mendez et al. Nature Genetics 15:146-156 (1997) and
Green and Jakobovits J Exp. Med. 188:483 495 (1998). See also
European Patent No., EP 0 471 151 B1, grant published June 12,
1996, International Patent Application No., WO 94/02602, published
Feb. 3, 1994, International Patent Application No., WO 96/34096,
published Oct. 31, 1996, and WO 98/24893, published Jun. 11, 1998.
The disclosures of each of the above-cited patents, applications,
and references are hereby incorporated by reference in their
entirety.
[0149] Human anti-mouse antibody (HAMA) responses have led the
industry to prepare chimeric or otherwise humanized antibodies.
While chimeric antibodies have a human constant region and a murine
variable region, it is expected that certain human anti-chimeric
antibody (HACA) responses will be observed, particularly in chronic
or multi-dose utilizations of the antibody. Thus, it would be
desirable to provide fully human antibodies against GMAD
polypeptides in order to vitiate concerns and/or effects of HAMA or
HACA responses.
[0150] Monoclonal antibodies specific for GMAD polypeptides may be
prepared using hybridoma technology. (Kohler et al., Nature 256:495
(1975); Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et
al., Eur. J. Immunol. 6:292 (1976); Hammerling et al., in:
Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp.
571-681 (1981)). Briefly, mice such as XenoMouse.TM. mice may be
immunized with GMAD polypeptides. After immunization, the
splenocytes of such mice may be extracted and fused with a suitable
myeloma cell line. Any suitable myeloma cell line may be employed
in accordance with the present invention; however, it is preferable
to employ the parent myeloma cell line (SP2O), available from the
ATCC. After fusion, the resulting hybridoma cells are selectively
maintained in HAT medium, and then cloned by limiting dilution as
described by Wands et al. (Gastroenterology 80:225-232 (1981)). The
hybridoma cells obtained through such a selection are then assayed
to identify clones which secrete antibodies capable of binding the
GMAD polypeptides.
[0151] For some uses, including in vivo use of antibodies in humans
and in vitro detection assays, it may be preferable to use human or
chimeric antibodies. Completely human antibodies are particularly
desirable for therapeutic treatment of human patients. See also,
U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT publications WO
98/46645, WO 98/50435, WO 98/24893, WO98/16654, WO 96/34096, WO
96/35735, and WO 91/10741; each of which is incorporated herein by
reference in its entirety. In a specific embodiment, antibodies of
the present invention comprise one or more VH and VL domains of the
invention and constant regions from another immunoglobulin
molecule, preferably a human immunoglobulin molecule. In a specific
embodiment, antibodies of the present invention comprise one or
more CDRs corresponding to the VH and VL domains of the invention
and framework regions from another immunoglobulin molecule,
preferably a human immunoglobulin molecule. In other embodiments,
an antibody of the present invention comprises one, two, three,
four, five, six or more VL CDRs or VH CDRs corresponding to one or
more of the VH or VL domains of one or more scFvs referred to in
Table 1, or fragments or variants thereof, and framework regions
(and, optionally one or more CDRs not present in the scFvs referred
to in Table 1) from a human immunoglobulin molecule. In a preferred
embodiment, an antibody of the present invention comprises a VH
CDR3, VL CDR3, or both, corresponding to the same scFv, or
different scFvs selected from the scFvs referred to in Table 1, or
fragments or variants thereof, and framework regions from a human
immunoglobulin.
[0152] A chimeric antibody is a molecule in which different
portions of the antibody are derived from different immunoglobulin
molecules such as antibodies having a human variable region and a
non-human (e.g., murine) immunoglobulin constant region or vice
versa. Methods for producing chimeric antibodies are known in the
art. See e.g., Morrison, Science 229:1202 (1985); Oi et al.,
BioTechniques 4:214 (1986); Gillies et al., J. Immunol. Methods
125:191-202 (1989); U.S. Pat. Nos. 5,807,715; 4,816,567; and
4,816,397, which are incorporated herein by reference in their
entirety. Chimeric antibodies comprising one or more CDRs from
human species and framework regions from a non-human immunoglobulin
molecule (e.g., framework regions from a murine, canine or feline
immunoglobulin molecule) (or vice versa) can be produced using a
variety of techniques known in the art including, for example,
CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Pat.
Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or resurfacing
(EP 592,106; EP 519,596; Padlan, Molecular Immunology
28(4/5):489-498 (1991); Studnicka et al., Protein Engineering
7(6):805-814 (1994); Roguska et al., PNAS 91:969-973 (1994)), and
chain shuffling (U.S. Pat. No. 5,565,352). In a preferred
embodiment, chimeric antibodies comprise a human CDR3 having an
amino acid sequence of any one of the VH CDR3s or VL CDR3s of a VH
or VL domain of one or more of the scFvs referred to in Table 1, or
a variant thereof, and non-human framework regions or human
framework regions different from those of the frameworks in the
corresponding scFvs disclosed in Table 1. Often, framework residues
in the framework regions will be substituted with the corresponding
residue from the CDR donor antibody to alter, preferably improve,
antigen binding. These framework substitutions are identified by
methods well known in the art, e.g., by modeling of the
interactions of the CDR and framework residues to identify
framework residues important for antigen binding and sequence
comparison to identify unusual framework residues at particular
positions. (See, e.g., Queen et al., U.S. Pat. No. 5,585,089;
Riechmann et al., Nature 352:323 (1988), which are incorporated
herein by reference in their entireties.)
[0153] Intrabodies are antibodies, often scFvs, that are expressed
from a recombinant nucleic acid molecule and engineered to be
retained intracellularly (e.g., retained in the cytoplasm,
endoplasmic reticulum, or periplasm). Intrabodies may be used, for
example, to ablate the function of a protein to which the intrabody
binds. The expression of intrabodies may also be regulated through
the use of inducible promoters in the nucleic acid expression
vector comprising the intrabody. Intrabodies of the invention can
be produced using methods known in the art, such as those disclosed
and reviewed in Chen et al., Hum. Gene Ther. 5:595-601 (1994);
Marasco, W. A., Gene Ther. 4:11-15 (1997); Rondon and Marasco,
Annu. Rev. Microbio!. 51:257-283 (1997); Proba et al., J. Mol.
Biol. 275:245-253 (1998); Cohen et al., Oncogene 17:2445-2456
(1998); Ohage and Steipe, J. Mol. Biol. 291:1119-1128 (1999); Ohage
et al., J. Mol. Biol. 291:1129-1134 (1999); Wirtz and Steipe,
Protein Sci. 8:2245-2250 (1999); Thu et al., J. Immunol. Methods
231:207-222 (1999); and references cited therein.
[0154] Recombinant expression of an antibody of the invention
(including antibody fragments or variants thereof (e.g., a heavy or
light chain of an antibody of the invention), requires construction
of an expression vector(s) containing a polynucleotide that encodes
the antibody. Once a polynucleotide encoding an antibody molecule
(e.g., a whole antibody, a heavy or light chain of an antibody, or
portion thereof (preferably, but not necessarily, containing the
heavy or light chain variable domain)), of the invention has been
obtained, the vector(s) for the production of the antibody molecule
may be produced by recombinant DNA technology using techniques well
known in the art. Thus, methods for preparing a protein by
expressing a polynucleotide containing an antibody encoding
nucleotide sequence are described herein. Methods which are well
known to those skilled in the art can be used to construct
expression vectors containing antibody coding sequences and
appropriate transcriptional and translational control signals.
These methods include, for example, in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of
the invention (e.g., a whole antibody, a heavy or light chain of an
antibody, a heavy or light chain variable domain of an antibody, or
a portion thereof, or a heavy or light chain CDR, a single chain
Fv, or fragments or variants thereof), operably linked to a
promoter. Such vectors may include the nucleotide sequence encoding
the constant region of the antibody molecule (see, e.g., PCT
Publication WO 86/05807; PCT Publication WO 89/01036; and U.S. Pat.
No. 5,122,464, the contents of each of which are hereby
incorporated by reference in its entirety) and the variable domain
of the antibody may be cloned into such a vector for expression of
the entire heavy chain, the entire light chain, or both the entire
heavy and light chains.
[0155] The expression vector(s) is(are) transferred to a host cell
by conventional techniques and the transfected cells are then
cultured by conventional techniques to produce an antibody of the
invention. Thus, the invention includes host cells containing
polynucleotide(s) encoding an antibody of the invention (e.g.,
whole antibody, a heavy or light chain thereof, or portion thereof,
or a single chain antibody, or a fragment or variant thereof),
operably linked to a heterologous promoter. In preferred
embodiments, for the expression of entire antibody molecules,
vectors encoding both the heavy and light chains may be
co-expressed in the host cell for expression of the entire
immunoglobulin molecule, as detailed below.
[0156] A variety of host-expression vector systems may be utilized
to express the antibody molecules of the invention. Such
host-expression systems represent vehicles by which the coding
sequences of interest may be produced and subsequently purified,
but also represent cells which may, when transformed or transfected
with the appropriate nucleotide coding sequences, express an
antibody molecule of the invention in situ. These include, but are
not limited to, bacteriophage particles engineered to express
antibody fragments or variants thereof (single chain antibodies),
microorganisms such as bacteria (e.g., E. coli, B. subtilis)
transformed with recombinant bacteriophage DNA, plasmid DNA or
cosmid DNA expression vectors containing antibody coding sequences;
yeast (e.g., Saccharomyces, Pichia) transformed with recombinant
yeast expression vectors containing antibody coding sequences;
insect cell systems infected with recombinant virus expression
vectors (e.g., baculovirus) containing antibody coding sequences;
plant cell systems infected with recombinant virus expression
vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic
virus, TMV) or transformed with recombinant plasmid expression
vectors (e.g., Ti plasmid) containing antibody coding sequences; or
mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3, NSO cells)
harboring recombinant expression constructs containing promoters
derived from the genome of mammalian cells (e.g., metallothionein
promoter) or from mammalian viruses (e.g., the adenovirus late
promoter; the vaccinia virus 7.5K promoter). Preferably, bacterial
cells such as Escherichia coli, and more preferably, eukaryotic
cells, especially for the expression of whole recombinant antibody
molecule, are used for the expression of a recombinant antibody
molecule. For example, mammalian cells such as Chinese hamster
ovary cells (CHO), in conjunction with a vector such as the major
intermediate early gene promoter element from human cytomegalovirus
is an effective expression system for antibodies (Foecking et al.,
Gene 45:101 (1986); Cockett et al., Bio/Technology 8:2 (1990);
Bebbington et al., Bio/Techniques 10:169 (1992); Keen and Hale,
Cytotechnology 18:207 (1996)). These references are incorporated in
their entireties by reference herein.
[0157] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
antibody molecule being expressed. For example, when a large
quantity of such a protein is to be produced, for the generation of
pharmaceutical compositions of an antibody molecule, vectors which
direct the expression of high levels of fusion protein products
that are readily purified may be desirable. Such vectors include,
but are not limited to, the E. coli expression vector pUR278
(Ruther et al., EMBO 1. 2:1791 (1983)), in which the antibody
coding sequence may be ligated individually into the vector in
frame with the lac Z coding region so that a fusion protein is
produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res.
13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem.
24:5503-5509 (1989)); and the like. pGEX vectors may also be used
to express foreign polypeptides as fusion proteins with glutathione
5-transferase (GST). In general, such fusion proteins are soluble
and can easily be purified from lysed cells by adsorption and
binding to matrix glutathione agarose beads followed by elution in
the presence of free glutathione. The pGEX vectors are designed to
include thrombin or factor Xa protease cleavage sites so that the
cloned target gene product can be released from the GST moiety.
[0158] In an insect system, Autographa californica nuclear
polyhedrosis virus (AcNPV) may be used as a vector to express
foreign genes. The virus grows in Spodoptera frugiperda cells.
Antibody coding sequences may be cloned individually into
non-essential regions (for example, the polyhedrin gene) of the
virus and placed under control of an AcNPV promoter (for example,
the polyhedrin promoter).
[0159] In mammalian host cells, a number of viral-based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, the antibody coding sequence of interest may be
ligated to an adenovirus transcription/translation control complex,
e.g., the late promoter and tripartite leader sequence. This
chimeric gene may then be inserted in the adenovirus genome by in
vitro or in vivo recombination. Insertion in a non-essential region
of the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing the
antibody molecule in infected hosts (e.g., see Logan & Shenk,
Proc. Natl. Acad. Sci. USA 8 1:355-359 (1984)). Specific initiation
signals may also be required for efficient translation of inserted
antibody coding sequences. These signals include the ATG initiation
codon and adjacent sequences. Furthermore, the initiation codon
must be in phase with the reading frame of the desired coding
sequence to ensure translation of the entire insert. These
exogenous translational control signals and initiation codons can
be of a variety of origins, both natural and synthetic. The
efficiency of expression may be enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (see, e.g., Bittner et al., Methods in Enzymol.
153:51-544 (1987)).
[0160] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include, but are not limited to, CHO, VERY, BHK, Hela,
COS, NSO, MDCK, 293, 3T3, and W138.
[0161] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the antibody may be engineered. Rather than
using expression vectors which contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1-2 days in an
enriched media, and then are switched to a selective media. The
selectable marker in the recombinant plasmid confers resistance to
the selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci which in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines which express the antibody molecule.
Such engineered cell lines may be particularly useful in screening
and evaluation of compositions that interact directly or indirectly
with the antibody molecule.
[0162] A number of selection systems may be used, including but not
limited to, the herpes simplex virus thymidine kinase (Wigler et
cd., Cell 11:223 (1977)), hypoxanthineguanine
phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl.
Acad. Sci. USA 48:202 (1992)), and adenine
phosphoribosyltransferase (Lowy et al., Cell 22:8 17 (1980)) genes
can be employed in tk-, hgprt- or aprt-cells, respectively. Also,
antimetabolite resistance can be used as the basis of selection for
the following genes: dhfr, which confers resistance to methotrexate
(Wigler et cd., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al.,
Proc. Natl. Acad. Sci. USA 78:1527 (1981)); gpt, which confers
resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl.
Acad. Sci. USA 78:2072 (1981)); neo, which confers resistance to
the aminoglycoside G-418 (Clinical Pharmacy 12:488-505; Wu and Wu,
Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol.
Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993);
and Morgan and Anderson, Arm. Rev. Biochem. 62: 191-217 (1993); TIB
TECH 11(5):155-2 15 (May, 1993)); and hygro, which confers
resistance to hygromycin (Santerre et al., Gene 30:147 (1984)).
Methods commonly known in the art of recombinant DNA technology may
be routinely applied to select the desired recombinant clone, and
such methods are described, for example, in Ausubel et al. (eds.),
Current Protocols in Molecular Biology, John Wiley & Sons, NY
(1993); Kriegler, Gene Transfer and Expression, A Laboratory
Manual, Stockton Press, NY (1990); and in Chapters 12 and 13,
Dracopoli et al. (eds), Current Protocols in Human Genetics, John
Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol.
150:1 (1981), which are incorporated by reference herein in their
entireties.
[0163] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see Bebbington and
Hentschel, "The use of vectors based on gene amplification for the
expression of cloned genes in mammalian cells" in DNA Cloning,
Vol.3. (Academic Press, New York, 1987)). When a marker in the
vector system expressing antibody is amplifiable, increase in the
level of inhibitor present in culture of host cell will increase
the number of copies of the marker gene. Since the amplified region
is associated with the coding sequence of the antibody, production
of the antibody will also increase (Crouse et al., Mol. Cell. Biol.
3:257 (1983)).
[0164] Vectors which use glutamine synthase (GS) or DHFR as the
selectable markers can be amplified in the presence of the drugs
methionine sulphoximine or methotrexate, respectively. An advantage
of glutamine synthase based vectors are the availability of cell
lines (e.g., the murine myeloma cell line, NSO) which are glutamine
synthase negative. Glutamine synthase expression systems can also
function in glutamine synthase expressing cells (e.g. Chinese
Hamster Ovary (CHO) cells) by providing additional inhibitor to
prevent the functioning of the endogenous gene. A glutamine
synthase expression system and components thereof are detailed in
PCT publications: WO87/04462; WO86/05807; WO89/01036; WO89/10404;
and WO91/06657 which are incorporated in their entireties by
reference herein. Additionally, glutamine synthase expression
vectors that may be used according to the present invention are
commercially available from suppliers, including, for example Lonza
Biologics, Inc. (Portsmouth, N.H.). Expression and production of
monoclonal antibodies using a GS expression system in murine
myeloma cells is described in Bebbington et al., Bio/technology
10:169(1992) and in Biblia and Robinson Biotechnol. Prog. 11:1
(1995) which are incorporated in their entireties by reference
herein.
[0165] The host cell may be co-transfected with two expression
vectors of the invention, the first vector encoding a heavy chain
derived polypeptide and the second vector encoding a light chain
derived polypeptide. The two vectors may contain identical
selectable markers which enable equal expression of heavy and light
chain polypeptides. Alternatively, a single vector may be used
which encodes, and is capable of expressing, both heavy and light
chain polypeptides. In such situations, the light chain is
preferably placed before the heavy chain to avoid an excess of
toxic free heavy chain (Proudfoot, Nature 322:52 (1986); Kohler,
Proc. Natl. Acad. Sci. USA 77:2 197 (1980)). The coding sequences
for the heavy and light chains may comprise cDNA or genomic
DNA.
[0166] Once an antibody molecule of the invention (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) has been chemically synthesized or
recombinantly expressed, it may be purified by any method known in
the art for purification of an immunoglobulin molecule, or more
generally, a protein molecule, such as, for example, by
chromatography (e.g., ion exchange, affinity, particularly by
affinity for the specific antigen after Protein A, and sizing
column chromatography), centrifugation, differential solubility, or
by any other standard technique for the purification of proteins.
Further, the antibodies of the present invention may be fused to
heterologous polypeptide sequences described herein or otherwise
known in the art, to facilitate purification.
[0167] Antibodies of the present invention include naturally
purified products, products of chemical synthetic procedures, and
products produced by recombinant techniques from a prokaryotic or
eukaryotic host, including, for example, bacterial, yeast, higher
plant, insect and mammalian cells. Depending upon the host employed
in a recombinant production procedure, the antibodies of the
present invention may be glycosylated or may be non-glycosylated.
In addition, antibodies of the invention may also include an
initial modified methionine residue, in some cases as a result of
host-mediated processes.
[0168] Antibodies of the invention can be chemically synthesized
using techniques known in the art (e.g., see Creighton, 1983,
Proteins: Structures and Molecular Principles, W.H. Freeman &
Co., N.Y., and Hunkapiller, M., et al., 1984, Nature 310:105-111).
For example, a peptide corresponding to a fragment of an antibody
of the invention can be synthesized by use of a peptide
synthesizer. Furthermore, if desired, nonclassical amino acids or
chemical amino acid analogs can be introduced as a substitution or
addition into the antibody polypeptide sequence. Non-classical
amino acids include, but are not limited to, to the D-isomers of
the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric
acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx,
6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino
propionic acid, ornithine, norleucine, norvaline, hydroxyproline,
sarcosine, citrulline, homocitrulline, cysteic acid,
t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine,
b-alanine, fluoro-amino acids, designer amino acids such as
b-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids,
and amino acid analogs in general. Furthermore, the amino acid can
be D (dextrorotary) or L (levorotary).
[0169] The invention encompasses antibodies which are
differentially modified during or after translation, e.g., by
glycosylation, acetylation, phosphorylation, amidation,
derivatization by known protecting/blocking groups, proteolytic
cleavage, linkage to an antibody molecule or other cellular ligand,
etc. Any of numerous chemical modifications may be carried out by
known techniques, including but not limited, to specific chemical
cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8
protease, NaBH4, acetylation, formylation, oxidation, reduction,
metabolic synthesis in the presence of tunicamycin, etc.
[0170] Additional post-translational modifications encompassed by
the invention include, for example, e.g., N-linked or O-linked
carbohydrate chains, processing of N-terminal or C-terminal ends),
attachment of chemical moieties to the amino acid backbone,
chemical modifications of N-linked or O-linked carbohydrate chains,
and addition or deletion of an N-terminal methionine residue as a
result of procaryotic host cell expression. The antibodies may also
be modified with a detectable label, such as an enzymatic,
fluorescent, radioisotopic or affinity label to allow for detection
and isolation of the antibody.
[0171] Examples of suitable enzymes include horseradish peroxidase,
alkaline phosphatase, beta-galactosidase, glucose oxidase or
acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include biotin, umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin; and examples of suitable radioactive
material include a radioactive metal ion, e.g., alpha-emitters such
as, for example, .sup.213Bi, or other radioisotopes such as, for
example, iodine (.sup.131I, .sup.125I, .sup.123I, .sup.121I),
carbon (.sup.14C), sulfur (.sup.35S), tritium (.sup.3H), indium
(.sup.115mIn, .sup.113mIn, .sup.112In, .sup.111In), and technetium
(.sup.99Tc, .sup.99nTc), thallium (.sup.201Ti), gallium (.sup.68Ga,
.sup.67Ga), palladium (.sup.103Pd), molybdenum (.sup.99Mo), xenon
(.sup.133Xe), fluorine (.sup.18F), .sup.153Sm, .sup.177Lu,
.sup.159Gd, .sup.149Pm, .sup.140La, .sup.175Yb, .sup.166Ho,
.sup.90Y, .sup.47Sc, .sup.186Re, .sup.188Re, .sup.142Pr,
.sup.105Rh, .sup.97Ru, .sup.68Ge, .sup.57Co, .sup.65Zn, .sup.85Sr,
.sup.32P, .sup.153Gd, .sup.169Yb, .sup.51Cr, .sup.54Mn, .sup.75Se,
.sup.113Sn, and .sup.117Tin.
[0172] In specific embodiments, antibodies of the invention may be
labeled with Europium. For example, antibodies of the invention may
be labelled with Europium using the DELFIA Eu-labeling kit
(catalog#1244-302, Perkin Elmer Life Sciences, Boston, Mass.)
following manufacturer's instructions.
[0173] In specific embodiments, antibodies of the invention are
attached to macrocyclic chelators useful for conjugating radiometal
ions, including but not limited to, .sup.111In, .sup.177Lu,
.sup.90Y, .sup.166Ho, .sup.153Sm, .sup.215Bi and .sup.225Ac to
polypeptides. In a preferred embodiment, the radiometal ion
associated with the macrocyclic chelators attached to antibodies of
the invention is .sup.111In. In another preferred embodiment, the
radiometal ion associated with the macrocyclic chelator attached to
antibodies polypeptides of the invention is .sup.90Y. In specific
embodiments, the macrocyclic chelator is
1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetic acid
(DOTA). In specific embodiments, the macrocyclic chelator is
.alpha.-(5-isothiocyanato-2-methoxyphenyl)-1,4,7,10-tetraaza-cyclododecan-
e-1,4,7,10-tetraacetic acid. In other specific embodiments, the
DOTA is attached to the antibody of the invention via a linker
molecule. Examples of linker molecules useful for conjugating a
macrocyclic chelator such as DOTA to a polypeptide are commonly
known in the art--see, for example, DeNardo et al., Clin Cancer
Res. 4(10):2483-90, 1998; Peterson et al., Bioconjug. Chem.
10(4):553-7, 1999; and Zimmerman et al, Nucl. Med. Biol.
26(8):943-50, 1999 which are hereby incorporated by reference in
their entirety. In addition, U.S. Pat. Nos. 5,652,361 and
5,756,065, which disclose chelating agents that may be conjugated
to antibodies, and methods for making and using them, are hereby
incorporated by reference in their entireties.
[0174] In one embodiment, antibodies of the invention are labeled
with biotin. In other related embodiments, biotinylated antibodies
of the invention may be used, for example, as an imaging agent or
as a means of identifying one or more TRAIL receptor coreceptor or
ligand molecules.
[0175] Also provided by the invention are chemically modified
derivatives of antibodies of the invention which may provide
additional advantages such as increased solubility, stability and
in vivo or in vitro circulating time of the polypeptide, or
decreased immunogenicity (see U.S. Pat. No. 4,179,337). The
chemical moieties for derivitization may be selected from water
soluble polymers such as polyethylene glycol, ethylene
glycol/propylene glycol copolymers, carboxymethylcellulose,
dextran, polyvinyl alcohol and the like. The antibodies may be
modified at random positions within the molecule, or at
predetermined positions within the molecule and may include one,
two, three or more attached chemical moieties.
[0176] The polymer may be of any molecular weight, and may be
branched or unbranched. For polyethylene glycol, the preferred
molecular weight is between about 1 kDa and about 100 kDa (the term
"about" indicating that in preparations of polyethylene glycol,
some molecules will weigh more, some less, than the stated
molecular weight) for ease in handling and manufacturing. Other
sizes may be used, depending on the desired therapeutic profile
(e.g., the duration of sustained release desired, the effects, if
any on biological activity, the ease in handling, the degree or
lack of antigenicity and other known effects of the polyethylene
glycol to a therapeutic protein or analog). For example, the
polyethylene glycol may have an average molecular weight of about
200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000,
5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000,
10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000,
14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000,
18,500, 19,000, 19,500, 20,000, 25,000, 30,000, 35,000, 40,000,
50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000,
90,000, 95,000, or 100,000 kDa.
[0177] As noted above, the polyethylene glycol may have a branched
structure. Branched polyethylene glycols are described, for
example, in U.S. Pat. No. 5,643,575; Morpurgo et al., Appl.
Biochem. Biotechnol. 56:59-72 (1996); Vorobjev et al., Nucleosides
Nucleotides 18:2745-2750 (1999); and Caliceti et al., Bioconjug.
Chem. 10:638-646 (1999), the disclosures of each of which are
incorporated herein by reference.
[0178] The polyethylene glycol molecules (or other chemical
moieties) should be attached to the antibody with consideration of
effects on functional or antigenic domains of the antibody. There
are a number of attachment methods available to those skilled in
the art, e.g., EP 0 401 384, herein incorporated by reference
(coupling PEG to G-CSF), see also Malik et al., Exp. Hematol.
20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl
chloride). For example, polyethylene glycol may be covalently bound
through amino acid residues via a reactive group, such as, a free
amino or carboxyl group. Reactive groups are those to which an
activated polyethylene glycol molecule may be bound. The amino acid
residues having a free amino group may include, for example, lysine
residues and the N-terminal amino acid residues; those having a
free carboxyl group may include aspartic acid residues, glutamic
acid residues, and the C-terminal amino acid residue. Sulfhydryl
groups may also be used as a reactive group for attaching the
polyethylene glycol molecules. Preferred for therapeutic purposes
is attachment at an amino group, such as attachment at the
N-terminus or lysine group.
[0179] As suggested above, polyethylene glycol may be attached to
proteins, e.g., antibodies, via linkage to any of a number of amino
acid residues. For example, polyethylene glycol can be linked to a
proteins via covalent bonds to lysine, histidine, aspartic acid,
glutamic acid, or cysteine residues. One or more reaction
chemistries may be employed to attach polyethylene glycol to
specific amino acid residues (e.g., lysine, histidine, aspartic
acid, glutamic acid, or cysteine) of the protein or to more than
one type of amino acid residue (e.g., lysine, histidine, aspartic
acid, glutamic acid, cysteine and combinations thereof) of the
protein.
[0180] One may specifically desire antibodies chemically modified
at the N-terminus of either the heavy chain or the light chain or
both. Using polyethylene glycol as an illustration, one may select
from a variety of polyethylene glycol molecules (by molecular
weight, branching, etc.), the proportion of polyethylene glycol
molecules to protein (or peptide) molecules in the reaction mix,
the type of pegylation reaction to be performed, and the method of
obtaining the selected N-terminally pegylated protein. The method
of obtaining the N-terminally pegylated preparation (i.e.,
separating this moiety from other monopegylated moieties if
necessary) may be by purification of the N-terminally pegylated
material from a population of pegylated protein molecules.
Selective chemical modification at the N-terminus may be
accomplished by reductive alkylation which exploits differential
reactivity of different types of primary amino groups (lysine
versus the N-terminal) available for derivatization in a particular
protein. Under the appropriate reaction conditions, substantially
selective derivatization of the protein at the N-terminus with a
carbonyl group containing polymer is achieved.
[0181] As indicated above, pegylation of the antibodies of the
invention may be accomplished by any number of means. For example,
polyethylene glycol may be attached to the antibody either directly
or by an intervening linker. Linkerless systems for attaching
polyethylene glycol to proteins are described in Delgado et al.,
Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992); Francis et
al., Intern. J. of Hematol. 68:1-18 (1998); U.S. Pat. No.
4,002,531; U.S. Pat. No. 5,349,052; WO 95/06058; and WO 98/32466,
the disclosures of each of which are incorporated herein by
reference.
[0182] One system for attaching polyethylene glycol directly to
amino acid residues of antibodies without an intervening linker
employs tresylated MPEG, which is produced by the modification of
monmethoxy polyethylene glycol (MPEG) using tresylchloride
(ClSO2CH2CF3). Upon reaction of protein with tresylated MPEG,
polyethylene glycol is directly attached to amine groups of the
protein. Thus, the invention includes antibody-polyethylene glycol
conjugates produced by reacting antibodies of the invention with a
polyethylene glycol molecule having a 2,2,2-trifluoreothane
sulphonyl group.
[0183] Polyethylene glycol can also be attached to antibodies using
a number of different intervening linkers. For example, U.S. Pat.
No. 5,612,460, the entire disclosure of which is incorporated
herein by reference, discloses urethane linkers for connecting
polyethylene glycol to proteins. Antibody-polyethylene glycol
conjugates wherein the polyethylene glycol is attached to the
antibody by a linker can also be produced by reaction of antibodies
with compounds such as MPEG-succinimidylsuccinate, MPEG activated
with 1,1'-carbonyldiimidazole, MPEG-2,4,5-trichloropenylcarbonate,
MPEG-p-nitrophenolcarbonate, and various MPEG-succinate
derivatives. A number additional polyethylene glycol derivatives
and reaction chemistries for attaching polyethylene glycol to
proteins are described in WO 98/32466, the entire disclosure of
which is incorporated herein by reference. Pegylated antibody
products produced using the reaction chemistries set out herein are
included within the scope of the invention.
[0184] The number of polyethylene glycol moieties attached to each
antibody of the invention (i.e., the degree of substitution) may
also vary. For example, the pegylated antibodies of the invention
may be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12,
15, 17, 20, or more polyethylene glycol molecules. Similarly, the
average degree of substitution within ranges such as 1-3, 2-4, 3-5,
4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 11-13, 12-14, 13-15, 14-16,
15-17, 16-18, 17-19, or 18-20 polyethylene glycol moieties per
antibody molecule. Methods for determining the degree of
substitution are discussed, for example, in Delgado et al., Crit.
Rev. Thera. Drug Carrier Sys. 9:249-304 (1992).
Characterization of Anti-GMAD Antibodies
[0185] Antibodies of the present invention (including molecules
comprising, or alternatively consisting of, antibody fragments or
variants thereof) may also be described or specified in terms of
their binding to GMAD polypeptides or fragments or variants of GMAD
polypeptides. In specific embodiments, antibodies of the invention
bind GMAD polypeptides, or fragments or variants thereof, with a
dissociation constant or K.sub.D of less than or equal to
5.times.10.sup.-2 M, 10.sup.-2 M, 5.times.10.sup.-3 M, 10.sup.-3 M,
5.times.10.sup.-4 M, 10.sup.-4 M, 5.times.10.sup.-5 M, or 10.sup.-5
M. More preferably, antibodies of the invention bind GMAD
polypeptides or fragments or variants thereof with a dissociation
constant or K.sub.D less than or equal to 5.times.10.sup.-6 M,
10.sup.-6 M, 5.times.10.sup.-7 M, 10.sup.-7 M, 5.times.10.sup.-8 M,
or 10.sup.-8 M. Even more preferably, antibodies of the invention
bind GMAD polypeptides or fragments or variants thereof with a
dissociation constant or K.sub.D less than or equal to
5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10 M, 10.sup.-10
M, 5.times.10.sup.-11 M, 10.sup.-11 M, 5.times.10.sup.-12 M,
10.sup.-12 M, 5.times..sup.-13 M, 10.sup.-13 M, 5.times.10.sup.-14
M, 10.sup.-14 M, 5.times.10.sup.-15 M, or 10.sup.-15 M. The
invention encompasses antibodies that bind GMAD polypeptides with a
dissociation constant or K.sub.D that is within any one of the
ranges that are between each of the individual recited values.
[0186] In specific embodiments, antibodies of the invention bind
GMAD polypeptides or fragments or variants thereof with an off rate
(k.sub.off) of less than or equal to 5.times.10.sup.-2 sec.sup.-1,
10.sup.-2 sec.sup.-1, 5.times.10.sup.-3 sec.sup.-1 or 10.sup.-3
sec.sup.-1. More preferably, antibodies of the invention bind GMAD
polypeptides or fragments or variants thereof with an off rate
(k.sub.off) less than or equal to 5.times.10.sup.-4 sec.sup.-1,
10.sup.-4 sec.sup.-1, 5.times.10.sup.-5 sec.sup.-1, or 10.sup.-5
sec.sup.-1 5.times.10.sup.-6 sec.sup.-1, 10.sup.-6 sec.sup.-1,
5.times.10.sup.-7 sec.sup.-1 or 10.sup.-7 sec.sup.-1. The invention
encompasses antibodies that bind GMAD polypeptides with an off rate
(k.sub.off) that is within any one of the ranges that are between
each of the individual recited values.
[0187] In other embodiments, antibodies of the invention bind GMAD
polypeptides or fragments or variants thereof with an on rate
(K.sub.on) of greater than or equal to 10.sup.3 M.sup.-1
sec.sup.-1, 5.times.10.sup.3 M.sup.-1 sec.sup.-1, 10.sup.4 M.sup.-1
sec.sup.-1 or 5.times.10.sup.4 M.sup.-1 sec.sup.-1. More
preferably, antibodies of the invention bind GMAD polypeptides or
fragments or variants thereof with an on rate (k.sub.on) greater
than or equal to 10.sup.5 M.sup.-1 sec.sup.-1, 5.times.10.sup.5
M.sup.-1 sec.sup.-1, 10.sup.6 M.sup.-1 sec.sup.-1, or
5.times.10.sup.6 M.sup.-1 sec.sup.-1 or 10.sup.7 M.sup.-1
sec.sup.-1. The invention encompasses antibodies that bind GMAD
polypeptides with on rate (k.sub.on) that is within any one of the
ranges that are between each of the individual recited values.
[0188] The antibodies of the invention (including molecules
comprising, or alternatively consisting of, antibody fragments or
variants thereof) specifically bind to a polypeptide or polypeptide
fragment or variant of a human GMAD polypeptide (SEQ ID NO:2). In
another embodiment, the antibodies of the invention specifically
bind to a polypeptide or polypeptide fragment or variant of a
simian GMAD polypeptide. In yet another embodiment, the antibodies
of the invention specifically bind to a polypeptide or polypeptide
fragment or variant of a murine GMAD polypeptide. In one
embodiment, the antibodies of the invention bind specifically to
human and simian GMAD polypeptides. In another embodiment, the
antibodies of the invention bind specifically to human GMAD
polypeptides and murine GMAD polypeptides. More preferably,
antibodies of the invention, preferentially bind to human GMAD
polypeptides compared to murine GMAD polypeptides.
[0189] In preferred embodiments, the antibodies of the present
invention (including molecules comprising, or alternatively
consisting of, antibody fragments or variants thereof),
specifically bind to GMAD polypeptides and do not cross-react with
any other antigens. In preferred embodiments, the antibodies of the
invention specifically bind to GMAD polypeptides (e.g., SEQ ID NO:2
or fragments or variants thereof) and do not cross-react with one
or more GMAD-related (e.g., other FIZZ or RELM family)
polypeptides.
[0190] By way of non-limiting example, an antibody may be
considered to bind a first antigen preferentially if it binds said
first antigen with a dissociation constant (K.sub.D) that is less
than the antibody's K.sub.D for the second antigen. In another
non-limiting embodiment, an antibody may be considered to bind a
first antigen preferentially if it binds said first antigen with an
affinity (i.e., K.sub.D) that is at least one order of magnitude
less than the antibody's K.sub.D for the second antigen. In another
non-limiting embodiment, an antibody may be considered to bind a
first antigen preferentially if it binds said first antigen with an
affinity (i.e., K.sub.D) that is at least two orders of magnitude
less than the antibody's K.sub.D for the second antigen.
[0191] In another non-limiting embodiment, an antibody may be
considered to bind a first antigen preferentially if it binds said
first antigen with an off rate (k.sub.off) that is less than the
antibody's k.sub.off for the second antigen. In another
non-limiting embodiment, an antibody may be considered to bind a
first antigen preferentially if it binds said first antigen with a
k.sub.off that is at least one order of magnitude less than the
antibody's k.sub.off for the second antigen. In another
non-limiting embodiment, an antibody may be considered to bind a
first antigen preferentially if it binds said first antigen with a
k.sub.off that is at least two orders of magnitude less than the
antibody's k.sub.off for the second antigen.
[0192] The invention also encompasses antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) that have one or more of the same
biological characteristics as one or more of the antibodies
described herein. By "biological characteristics" is meant, the in
vitro or in vivo activities or properties of the antibodies, such
as, for example, the ability to antagonize GMAD action (see, e.g.,
Example 3), the ability to increase insulin action, the ability to
increase cellular uptake of insulin, the ability increase cellular
uptake of glucose (e.g. glucose transport), the ability to inhibit
cell-specific (e.g., adipocytes) GMAD secretion, and/or the ability
to inhibit differentiation of GMAD or GMAD receptor expressing
cells (e.g., adipocytes). Other biological activities that
anti-GMAD antibodies may have, include, but are not limited to, the
ability to stimulate GMAD mediated biological activity (e.g., the
ability to decrease insulin action.) Optionally, the antibodies of
the invention will bind to the same epitope as at least one of the
antibodies specifically referred to herein. Such epitope binding
can be routinely determined using assays known in the art.
[0193] The present invention provides for antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof), that inhibit one or more GMAD
polypeptide mediated biological activities. In one embodiment, an
antibody that inhibits one or more GMAD polypeptide mediated
biological activities comprises, or alternatively consists of, a VH
and/or a VL domain of at least one of the scFvs referred to in
Table 1, or fragment or variant thereof. In a specific embodiment,
an antibody that inhibits one or more GMAD polypeptide mediated
biological activities comprises, or alternatively consists of, a VH
and a VL domain of any one of the scFvs referred to in Table 1, or
fragment or variant thereof. Nucleic acid molecules encoding these
antibodies are also encompassed by the invention.
[0194] The present invention also provides for antibodies
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof), that increase insulin
action. In one embodiment, an antibody that increases insulin
action comprises, or alternatively consists of, a VH and/or a VL
domain of any one of the scFvs referred to in Table 1, or fragment
or variant thereof. In a specific embodiment, an antibody that
increases insulin action comprises, or alternatively consists of, a
VH and a VL domain of any one of the scFvs referred to in Table 1,
or fragment or variant thereof. Nucleic acid molecules encoding
these antibodies are also encompassed by the invention.
[0195] The present invention also provides for antibodies
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof), that increase cellular
glucose uptake. In one embodiment, an antibody that increases
cellular glucose uptake comprises, or alternatively consists of, a
VH and/or a VL domain of any one of the scFvs referred to in Table
1, or fragment or variant thereof. In a specific embodiment, an
antibody that increases cellular glucose uptake comprises, or
alternatively consists of, a VH and a VL domain of any one of the
scFvs referred to in Table 1, or fragment or variant thereof.
Nucleic acid molecules encoding these antibodies are also
encompassed by the invention.
[0196] The present invention also provides for antibodies
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof) that decrease cell-specific
(e.g., adipocytes) GMAD expression. In one embodiment, an antibody
that decreases cell-specific (e.g., adipocyte) GMAD expression, or
alternatively consists of, a VH and/or a VL domain of any one of
the scFvs referred to in Table 1, or fragment or variant thereof.
In a specific embodiment, an antibody that decreases cell-specific
(e.g., adipocyte) GMAD expression comprises, or alternatively
consists of, a VH and a VL domain of any one of the scFvs referred
to in Table 1, or fragment or variant thereof. Nucleic acid
molecules encoding these antibodies are also encompassed by the
invention.
[0197] The present invention also provides for antibodies
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof), that inhibit
differentiation of GMAD or GMAD receptor expressing cells (e.g.,
adipocyte). In one embodiment, an antibody that inhibits
differentiation of GMAD or GMAD receptor expressing cells
comprises, or alternatively consists of, a VH and/or a VL domain of
any one of the scFvs referred to in Table 1, or fragment or variant
thereof. In a specific embodiment, an antibody that inhibits
differentiation of GMAD or GMAD receptor expressing cells
comprises, or alternatively consists of, a VH and a VL domain of
any one of the scFvs referred to in Table 1, or fragment or variant
thereof. Nucleic acid molecules encoding these antibodies are also
encompassed by the invention.
[0198] The present invention also provides for antibodies
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof), which decrease insulin
action. In one embodiment, an antibody that decreases insulin
action comprises, or alternatively consists of, a VH and/or a VL
domain of any one of the scFvs referred to in Table 1, or fragment
or variant thereof. In a specific embodiment, an antibody that
decreases insulin action comprises, or alternatively consists of, a
VH and a VL domain of any one of the scFvs referred to in Table 1,
or fragment or variant thereof. Nucleic acid molecules encoding
these antibodies are also encompassed by the invention.
[0199] Antibodies of the present invention (including antibody
fragments or variants thereof) may be characterized in a variety of
ways. In particular, antibodies and related molecules of the
invention may be assayed for the ability to specifically bind to
GMAD polypeptides or a fragment or variant of a GMAD polypeptide
using techniques described herein or routinely modifying techniques
known in the art. Assays for the ability of the antibodies of the
invention to specifically bind GMAD polypeptides or a fragment of
GMAD polypeptides may be performed in solution (e.g., Houghten,
Bio/Techniques 13:412-421(1992)), on beads (e.g., Lam, Nature
354:82-84 (1991)), on chips (e.g., Fodor, Nature 364:555-556
(1993)), on bacteria (e.g., U.S. Pat. No. 5,223,409), on spores
(e.g., U.S. Pat. Nos. 5,571,698; 5,403,484; and 5,223,409), on
plasmids (e.g., Cull et al., Proc. Natl. Acad. Sci. USA
89:1865-1869 (1992)) or on phage (e.g., Scott and Smith, Science
249:386-390 (1990); Devlin, Science 249:404-406 (1990); Cwirla et
al., Proc. Natl. Acad. Sci. USA 87:7178-7182 (1990); and Felici, J.
Mol. Biol. 222:301-310 (1991)) (each of these references is
incorporated herein in its entirety by reference). Such assays may
be used to identify antibodies that specifically bind to GMAD
polypeptides or a fragment or variant of a GMAD polypeptide.
[0200] The antibodies of the invention may be assayed for specific
binding to GMAD polypeptides and cross-reactivity with other
antigens by any method known in the art. Immunoassays which can be
used to analyze specific binding and cross-reactivity include, but
are not limited to, competitive and non-competitive assay systems
using techniques such as BIAcore analysis, FACS (fluorescence
activated cell sorter) analysis, immunofluorescence,
immunocytochemistry, radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoprecipitation
assays, western blots, precipitin reactions, gel diffusion
precipitin reactions, immunodiffusion assays, agglutination assays,
complement-fixation assays, immunoradiometric assays, fluorescent
immunoassays, and protein A immunoassays, to name but a few. Such
assays are routine and well known in the art (see, e.g., Ausubel et
al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1,
John Wiley & Sons, Inc., New York, which is incorporated by
reference herein in its entirety). Exemplary immunoassays are
described briefly below (but are not intended by way of
limitation).
[0201] ELISAs comprise preparing antigen, coating the well of a
96-well microtiter plate with the antigen, washing away antigen
that did not bind the wells, adding the antibody of interest
conjugated to a detectable compound such as an enzymatic substrate
(e.g., horseradish peroxidase or alkaline phosphatase) to the wells
and incubating for a period of time, washing away unbound
antibodies or non-specifically bound antibodies, and detecting the
presence of the antibodies specifically bound to the antigen
coating the well. In ELISAs, the antibody of interest does not have
to be conjugated to a detectable compound; instead, a second
antibody (which recognizes the antibody of interest) conjugated to
a detectable compound may be added to the well. Alternatively, the
antigen need not be directly coated to the well; instead the ELISA
plates may be coated with an anti-Ig Fc antibody, and the antigen,
in the form of a GMAD-Fc fusion protein, may be bound to the
anti-Ig Fc coated to the plate. This may be desirable so as to
maintain the antigen protein (e.g., a GMAD polypeptide) in a more
native conformation than it may have when it is directly coated to
a plate. In another alternative, instead of coating the well with
the antigen, the antibody may be coated to the well. In this case,
the detectable molecule could be the antigen conjugated to a
detectable compound such as an enzymatic substrate (e.g.,
horseradish peroxidase or alkaline phosphatase). One of skill in
the art would be knowledgeable as to the parameters that can be
modified to increase the signal detected as well as other
variations of ELISAs known in the art. For further discussion
regarding ELISAs see, e.g., Ausubel et al., eds, 1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons,
Inc., New York at 11.2.1.
[0202] The binding affinity of an antibody (including an scFv or
other molecule comprising, or alternatively consisting of, antibody
fragments or variants thereof) to an antigen and the off-rate of an
antibody-antigen interaction can be determined by competitive
binding assays. One example of a competitive binding assay is a
radioimmunoassay comprising the incubation of labeled antigen
(e.g., antigen labeled with .sup.3H or .sup.125I), or fragment or
variant thereof with the antibody of interest in the presence of
increasing amounts of unlabeled antigen, and the detection of the
antibody bound to the labeled antigen. The affinity of the antibody
of the present invention for GMAD and the binding off-rates can be
determined from the data by Scatchard plot analysis. Competition
with a second antibody can also be determined using
radioimmunoassays. In this case, GMAD polypeptide is incubated with
an antibody of the present invention conjugated to a labeled
compound (e.g., compound labeled with .sup.3H or .sup.125I) in the
presence of increasing amounts of an unlabeled second anti-GMAD
antibody. This kind of competitive assay between two antibodies,
may also be used to determine if two antibodies bind the same,
closely associated (e.g, overlapping), or different epitopes.
[0203] In a preferred embodiment, BIAcore kinetic analysis is used
to determine the binding on and off rates of antibodies (including
antibody fragments or variants thereof) to GMAD, or fragments of
GMAD. BIAcore kinetic analysis comprises analyzing the binding and
dissociation of antibodies from chips with immobilized GMAD on
their surface.
[0204] Immunoprecipitation protocols generally comprise lysing a
population of cells in a lysis buffer such as RIPA buffer (1% NP-40
or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl,
0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with
protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium vanadate), adding the antibody of interest to the
cell lysate, incubating for a period of time (e.g., 1 to 4 hours)
at 40 degrees C., adding protein A and/or protein G sepharose beads
to the cell lysate, incubating for about an hour or more at 40
degrees C., washing the beads in lysis buffer and resuspending the
beads in SDS/sample buffer. The ability of the antibody of interest
to immunoprecipitate a particular antigen can be assessed by, e.g.,
western blot analysis. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase
the binding of the antibody to an antigen and decrease the
background (e.g., pre-clearing the cell lysate with sepharose
beads). For further discussion regarding immunoprecipitation
protocols see, e.g., Ausubel et al., eds, 1994, Current Protocols
in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York
at 10.16.1.
[0205] Western blot analysis generally comprises preparing protein
samples, electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the
antigen), transferring the protein sample from the polyacrylamide
gel to a membrane such as nitrocellulose, PVDF or nylon, blocking
the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat
milk), washing the membrane in washing buffer (e.g., PBS-Tween 20),
blocking the membrane with primary antibody (the antibody of
interest) diluted in blocking buffer, washing the membrane in
washing buffer, blocking the membrane with a secondary antibody
(which recognizes the primary antibody, e.g., an anti-human
antibody) conjugated to an enzymatic substrate (e.g., horseradish
peroxidase or alkaline phosphatase) or radioactive molecule (e.g.,
.sup.32P or .sup.125I) diluted in blocking buffer, washing the
membrane in wash buffer, and detecting the presence of the antigen.
One of skill in the art would be knowledgeable as to the parameters
that can be modified to increase the signal detected and to reduce
the background noise. For further discussion regarding western blot
protocols see, e.g., Ausubel et al., eds, 1994, Current Protocols
in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York
at 10.8.1.
Antibody Conjugates
[0206] The present invention encompasses antibodies (including
antibody fragments or variants thereof), recombinantly fused or
chemically conjugated (including both covalent and non-covalent
conjugations) to a heterologous polypeptide (or portion thereof,
preferably at least 10, at least 20, at least 30, at least 40, at
least 50, at least 60, at least 70, at least 80, at least 90 or at
least 100 amino acids of the polypeptide) to generate fusion
proteins. The fusion does not necessarily need to be direct, but
may occur through linker sequences. For example, antibodies of the
invention may be used to target heterologous polypeptides to
particular cell types (e.g., cancer cells), either in vitro or in
vivo, by fusing or conjugating the heterologous polypeptides to
antibodies of the invention that are specific for particular cell
surface antigens or which bind antigens that bind particular cell
surface receptors. Antibodies of the invention may also be fused to
albumin (including but not limited to recombinant human serum
albumin (see, e.g., U.S. Pat. No. 5,876,969, issued Mar. 2, 1999,
EP Patent 0 413 622, and U.S. Pat. No. 5,766,883, issued Jun. 16,
1998, herein incorporated by reference in their entirety)),
resulting in chimeric polypeptides. In a preferred embodiment,
polypeptides and/or antibodies of the present invention (including
fragments or variants thereof) are fused with the mature form of
human serum albumin (i.e., amino acids 1-585 of human serum albumin
as shown in FIGS. 1 and 2 of EP Patent 0 322 094) which is herein
incorporated by reference in its entirety. In another preferred
embodiment, polypeptides and/or antibodies of the present invention
(including fragments or variants thereof) are fused with
polypeptide fragments comprising, or alternatively consisting of,
amino acid residues 1-z of human serum albumin, where z is an
integer from 369 to 419, as described in U.S. Pat. No. 5,766,883
herein incorporated by reference in its entirety. Polypeptides
and/or antibodies of the present invention (including fragments or
variants thereof) may be fused to either the N- or C-terminal end
of the heterologous protein (e.g., immunoglobulin Fc polypeptide or
human serum albumin polypeptide). Polynucleotides encoding fusion
proteins of the invention are also encompassed by the invention.
Such fusion proteins may, for example, facilitate purification and
may increase half-life in vivo. Antibodies fused or conjugated to
heterologous polypeptides may also be used in in vitro immunoassays
and purification methods using methods known in the art. See e.g.,
Harbor et al., supra, and PCT publication WO 93/2 1232; EP 439,095;
Naramura et at, Immunol. Lett. 39:91-99 (1994); U.S. Pat. No.
5,474,981; Gillies et at, PNAS 89:1428-1432 (1992); Fell et al., J.
Immunol. 146:2446-2452 (1991), which are incorporated by reference
in their entireties.
[0207] The present invention further includes compositions
comprising, or alternatively consisting of, heterologous
polypeptides fused or conjugated to antibody fragments. For
example, the heterologous polypeptides may be fused or conjugated
to a Fab fragment, Fd fragment, Fv fragment, F(ab).sub.2 fragment,
or a portion thereof. Methods for fusing or conjugating
polypeptides to antibody portions are known in the art. See, e.g.,
U.S. Pat. Nos. 5,356,603; 5,622,929; 5,359,046; 5,349,053;
5,447,851; 5,112,946; EP 307,434; EP 367,166; PCT publications WO
96/04388; WO 91/06570; Ashkenazi et at, Proc. Natl. Acad. Sci. USA
88: 10535-10539 (1991); Zheng et al., J. Immunol. 154:5590-5600
(1995); and Vil et al., Proc. Natl. Acad. Sci. USA 89:11357-11341
(1992) (said references incorporated by reference in their
entireties).
[0208] Additional fusion proteins of the invention may be generated
through the techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling"). DNA shuffling may be employed to modulate the
activities of antibodies (including molecules comprising, or
alternatively consisting of, antibody fragments or variants
thereof), such methods can be used to generate antibodies with
altered activity (e.g., antibodies with higher affinities and lower
dissociation rates). See, generally, U.S. Pat. Nos. 5,605,793;
5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al.,
Curr. Opinion Biotechnol. 8:724-35 (1997); Harayama, Trends
Biotechnol. 16(2):76-82 (1998); Hansson, et al., J. Mol. Biol.
287:265-76 (1999); and Lorenzo and Blasco, Biotechniques
24(2):308-13 (1998) (each of these patents and publications are
hereby incorporated by reference in its entirety). In one
embodiment, polynucleotides encoding antibodies of the invention
may be altered by being subjected to random mutagenesis by
error-prone PCR, random nucleotide insertion or other methods prior
to recombination. In another embodiment, one or more portions of a
polynucleotide encoding an antibody which portions specifically
bind to GMAD may be recombined with one or more components, motifs,
sections, parts, domains, fragments, etc. of one or more
heterologous molecules.
[0209] Moreover, the antibodies of the present invention (including
antibody fragments or variants thereof) can be fused to marker
sequences, such as a polypeptides to facilitate purification. In
preferred embodiments, the marker amino acid sequence is a
hexa-histidine polypeptide, such as the tag provided in a pQE
vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, Calif., 91311),
among others, many of which are commercially available. As
described in Gentz et cd., Proc. Natl. Acad. Sci. USA 86:821-824
(1989), for instance, hexa-histidine provides for convenient
purification of the fusion protein. Other peptide tags useful for
purification include, but are not limited to, the hemagglutinin
"HA" tag, which corresponds to an epitope derived from the
influenza hemagglutinin protein (Wilson et al., Cell 37:767 (1984))
and the FLAG.RTM. tag (Stratagene, La Jolla, Calif.).
[0210] The present invention further encompasses antibodies
(including antibody fragments or variants thereof), conjugated to a
diagnostic or therapeutic agent. The antibodies can be used
diagnostically to, for example, monitor or prognose the development
or progression of a tumor as part of a clinical testing procedure
or monitor or prognose type II diabetes to, e.g., determine the
efficacy of a given treatment regimen. Detection can be facilitated
by coupling the antibody to a detectable substance. Examples of
detectable substances include, but are not limited to, various
enzymes, prosthetic groups, fluorescent materials, luminescent
materials, bioluminescent materials, radioactive materials,
positron emitting metals using various positron emission
tomographies, and nonradioactive paramagnetic metal ions. The
detectable substance may be coupled or conjugated either directly
to the antibody or indirectly, through an intermediate (such as,
for example, a linker known in the art) using techniques known in
the art. See, for example, U.S. Pat. No. 4,741,900 for metal ions
which can be conjugated to antibodies for use as diagnostics
according to the present invention. Examples of suitable enzymes
include, but are not limited to, horseradish peroxidase, alkaline
phosphatase, beta-galactosidase, or acetylcholinesterase; examples
of suitable prosthetic group complexes include, but are not limited
to, streptavidin/biotin and avidin/biotin; examples of suitable
fluorescent materials include, but are not limited to,
umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes, but
is not limited to, luminol; examples of bioluminescent materials
include, but are not limited to, luciferase, luciferin, and
aequorin; and examples of suitable radioactive material include,
but are not limited to, iodine (.sup.121I, .sup.123I, .sup.125I,
.sup.131I), carbon (.sup.14C), sulfur (.sup.35S), tritium
(.sup.3H), indium (.sup.111In, .sup.112In, .sup.113mIn,
.sup.115mIn), technetium (.sup.99Tc, .sup.99mTc), thallium
(.sup.201Ti), gallium (.sup.68Ga, .sup.67Ga), palladium
(.sup.103Pd), molybdenum (.sup.99Mo), xenon (.sup.135Xe), fluorine
(.sup.18F), .sup.153Sm, .sup.177Lu, .sup.159Gd, .sup.149Pm,
.sup.140La, .sup.175Yb, .sup.166Ho, .sup.90Y, .sup.47Sc,
.sup.186Re, .sup.188Re, .sup.142Pr, .sup.105Rh, and .sup.97Ru.
[0211] Further, an antibody of the invention (including antibody
fragments or variants thereof), may be coupled or conjugated to a
therapeutic moiety such as a cytotoxin, e.g., a cytostatic or
cytocidal agent, a therapeutic agent or a radioactive metal ion,
e.g., alpha-emitters such as, for example, .sup.213Bi, or other
radioisotopes such as, for example, .sup.103Pd, .sup.135Xe,
.sup.131I, .sup.68Ge, .sup.57Co, .sup.65Zn, .sup.85Sr, .sup.32P,
.sup.35S, .sup.90Y, .sup.153Sm, .sup.153Gd, .sup.169Yb, .sup.51Cr,
.sup.54Mn, .sup.75Se, .sup.113Sn, .sup.90Y, .sup.117Tin,
.sup.186Re, .sup.188Re and .sup.166Ho. In specific embodiments, an
antibody or fragment thereof is attached to macrocyclic chelators
that chelate radiometal ions, including but not limited to,
.sup.177Lu, .sup.90Y, .sup.166Ho, and .sup.153Sm, to polypeptides.
In specific embodiments, the macrocyclic chelator is
1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetic acid
(DOTA). In other specific embodiments, the DOTA is attached to the
an antibody of the invention or fragment thereof via a linker
molecule. Examples of linker molecules useful for conjugating DOTA
to a polypeptide are commonly known in the art--see, for example,
DeNardo et al., Clin Cancer Res. 4(10):2483-90, 1998; Peterson et
al., Bioconjug. Chem. 10(4):553-7, 1999; and Zimmerman et al.,
Nucl. Med. Biol. 26(8):943-50, 1999 which are hereby incorporated
by reference in their entirety.
[0212] A cytotoxin or cytotoxic agent includes any agent that is
detrimental to cells. Examples include, but are not limited to,
paclitaxol, cytochalasin B, gramicidin D, ethidium bromide,
emetine, mitomycin, etoposide, tenoposide, vincristine,
vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy
anthracin dione, mitoxantrone, mithramycin, actinomycin D,
1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, thymidine kinase, endonuclease, RNAse, and
puromycin and frragments, variants or homologs thereof. Therapeutic
agents include, but are not limited to, antimetabolites (e.g.,
methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine,
5-fluorouracil decarbazine), alkylating agents (e.g.,
mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU)
and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol,
streptozotocin, mitomycin C, and cisdichlorodiamine platinum (II)
(DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly
daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin
(formerly actinomycin), bleomycin, mithramycin, and anthramycin
(AMC)), and anti-mitotic agents (e.g., vincristine and
vinblastine).
[0213] Techniques known in the art may be applied to label
antibodies of the invention. Such techniques include, but are not
limited to, the use of bifunctional conjugating agents (see e.g.,
U.S. Pat. Nos. 5,756,065; 5,714,711; 5,696,239; 5,652,371;
5,505,931; 5,489,425; 5,435,990; 5,428,139; 5,342,604; 5,274,119;
4,994,560; and 5,808,003; the contents of each of which are hereby
incorporated by reference in its entirety) and direct coupling
reactions (e.g., Bolton-Hunter and Chloramine-T reaction).
[0214] The antibodies of the invention which are conjugates can be
used for modifying a given biological response, the therapeutic
agent or drug moiety is not to be construed as limited to classical
chemical therapeutic agents. For example, the drug moiety may be a
protein or polypeptide possessing a desired biological activity.
Such proteins may include, but are not limited to, for example, a
toxin such as abrin, ricin A, alpha toxin, pseudomonas exotoxin, or
diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral
protein, alpha-sarcin and cholera toxin; a protein such as tumor
necrosis factor, alpha-interferon, beta-interferon, nerve growth
factor, platelet derived growth factor, tissue plasminogen
activator, an apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I
(see, International Publication No. WO 97/35899), Fas Ligand
(Takahashi et al., Int. Immunol., 6:1567-1574 (1994)), VEGI (see,
International Publication No. WO 99/23105), a thrombotic agent or
an anti-angiogenic agent, e.g., angiostatin or endostatin; or,
biological response modifiers such as, for example, lymphokines,
interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-6 (IL-6),
granulocyte macrophage colony stimulating factor (GM-CSF),
granulocyte colony stimulating factor (G-CSF), or other growth
factors.
[0215] Antibodies of the invention (including antibody fragments or
variants thereof), may also be attached to solid supports, which
are particularly useful for immunoassays or purification of the
target antigen. Such solid supports include, but are not limited
to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl
chloride or polypropylene.
[0216] Techniques for conjugating a therapeutic moiety to
antibodies are well known, see, e.g., Arnon et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies
For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe,
"Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506 (1985);
"Analysis, Results, And Future Prospective Of The Therapeutic Use
Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp. 303-16 (Academic Press 1985), and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev. 62:119-58 (1982).
[0217] Alternatively, an antibody of the invention can be
conjugated to a second antibody to form an antibody heteroconjugate
as described by Segal in U.S. Pat. No. 4,676,980, which is
incorporated herein by reference in its entirety.
[0218] An antibody of the invention (including an other molecules
comprising, or alternatively consisting of, an antibody fragment or
variant thereof), with or without a therapeutic moiety conjugated
to it, administered alone or in combination with cytotoxic
factor(s) and/or cytokine(s) can be used as a therapeutic.
Uses of Antibodies of the Invention
[0219] Antibodies of the present invention may be used, for
example, but not limited to, to purify, detect, and target the
polypeptides of the present invention, including both in vitro and
in vivo diagnostic and therapeutic methods. For example, the
antibodies have use in immunoassays for qualitatively and
quantitatively measuring levels of GMAD polypeptides in biological
samples. See, e.g., Harlow et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incorporated
by reference herein in its entirety).
Immunophenotyping
[0220] The antibodies of the invention may be utilized for
immunophenotyping of cell lines and biological samples. The
translation product of the gene of the present invention may be
useful as a cell specific marker, or more specifically as a
cellular marker that is differentially expressed at various stages
of differentiation and/or maturation of particular cell types,
particularly of adipose cells. Monoclonal antibodies directed
against a specific epitope, or combination of epitopes, will allow
for the screening of cellular populations expressing the marker.
Various techniques can be utilized using monoclonal antibodies to
screen for cellular populations expressing the marker(s), and
include magnetic separation using antibody-coated magnetic beads,
"panning" with antibody attached to a solid matrix (i.e., plate),
and flow cytometry (See, e.g., U.S. Pat. No. 5,985,660; and
Morrison et al., Cell, 96:737-49 (1999)).
[0221] These techniques allow for the screening of particular
populations of cells, such as adipocytes (e.g., in Type I or II
diabetes patients). Alternatively, these techniques allow for the
screening of mast cells, eosinophils, lymphocytes and bronchial
tissue for the expression of GMAD.
Epitope Mapping
[0222] The present invention provides antibodies (including
antibody fragments or variants thereof), which can be used to
identify epitopes of a GMAD polypeptide. In particular, the
antibodies of the present invention can be used to identify
epitopes of a human GMAD polypeptide (e.g., SEQ ID NO:2) or a GMAD
polypeptide expressed on human cells; a murine GMAD or a GMAD
polypeptide expressed on murine cells; a rat GMAD polypeptide or a
GMAD polypeptide expressed on rat cells; or a monkey GMAD
polypeptide or a GMAD polypeptide expressed on monkey cells, using
techniques described herein or otherwise known in the art.
Fragments which function as epitopes may be produced by any
conventional means. (See, e.g., Houghten, Proc. Natl. Acad. Sci.
USA 82:5131-5135 (1985), further described in U.S. Pat. No.
4,711,211.) Identified epitopes of antibodies of the present
invention may, for example, be used as vaccine candidates, i.e., to
immunize an individual to elicit antibodies against the naturally
occurring forms of GMAD polypeptides.
Diagnostic Uses of Antibodies
[0223] Labeled antibodies of the invention (including molecules
comprising, or alternatively consisting of, antibody fragments or
variants thereof) which specifically bind to a GMAD polypeptide can
be used for diagnostic purposes to detect, diagnose, prognose, or
monitor diseases and/or disorders. In specific embodiments, labeled
antibodies of the invention (including molecules comprising, or
alternatively consisting of, antibody fragments or variants
thereof) which specifically bind to a GMAD polypeptide can be used
for diagnostic purposes to detect, diagnose, prognose, or monitor
diseases and/or disorders associated with the aberrant expression
and/or activity of a GMAD polypeptide.
[0224] Thus, the invention provides a diagnostic method of a
disorder, which involves (a) assaying the expression level of a
polypeptide of the present invention in cells or body fluid of an
individual; and (b) comparing the assayed polypeptide expression
level with a standard polypeptide expression level, whereby an
increase or decrease in the assayed polypeptide expression level
compared to the standard expression level is indicative of a
disorder. In certain embodiments, the disorder diagnosed according
to a method of the invention is selected from the group: diabetes
(e.g., Non-Insulin-Dependent Diabetes Mellitus (NIDDM)), insulin
insensitivity (i.e,. insulin resistance), hyperinsulinemia,
hyperglycemia, dyslipidemia, hypertension, coronary artery disease,
renal failure, neuropathy (e.g., autonomic neuropathy,
parasympathetic neuropathy, and polyneuropathy), a metabolic
disorder (e.g., a glucose metabolic disorder), an endocrine
disorder, obesity, weight loss, a liver disorder (e.g., liver
disease, cirrhosis of the liver, and a disorder associated with
liver transplant), and/or a condition associated with one or more
of these disorders.
[0225] In particular embodiments, the invention provides a
diagnostic method of a metabolic disorder, which involves (a)
assaying the expression level of a polypeptide of the present
invention in cells or body fluid of an individual; and (b)
comparing the assayed polypeptide expression level with a standard
polypeptide expression level, whereby an increase or decrease in
the assayed polypeptide expression level compared to the standard
expression level is indicative of a metabolic disorder.
[0226] In other embodiments, the invention provides a diagnostic
method useful for diagnosis of insulin responsiveness, which
involves (a) assaying the expression level of a polypeptide of the
present invention in cells or body fluid of an individual; and (b)
comparing the assayed polypeptide expression level with a standard
polypeptide expression level, whereby an increase in the assayed
polypeptide expression level compared to the standard expression
level is indicative of an insulin responsiveness disorder (e.g.,
insulin resistance).
[0227] In other embodiments, the invention provides a diagnostic
method useful for diagnosis of diabetes, which involves (a)
assaying the expression level of a polypeptide of the present
invention in cells or body fluid of an individual; and (b)
comparing the assayed polypeptide expression level with a standard
polypeptide expression level, whereby an increase in the assayed
polypeptide expression level compared to the standard expression
level is indicative of diabetes.
[0228] In other embodiments, the invention provides a diagnostic
method useful for diagnosis and/or prognosis of a predisposition
for diabetes, which involves (a) assaying the expression level of a
polypeptide of the present invention in cells or body fluid of an
individual; and (b) comparing the assayed polypeptide expression
level with a standard polypeptide expression level, whereby a
decrease in the assayed polypeptide expression level compared to
the standard expression level is indicative of a predisposition for
diabetes.
[0229] The invention provides for the detection of expression of a
GMAD polypeptide comprising: (a) assaying the expression of a GMAD
polypeptide in a biological sample from an individual using one or
more antibodies of the invention that specifically binds to a GMAD
polypeptide; and (b) comparing the level of a GMAD polypeptide with
a standard level of a GMAD polypeptide, (e.g., the level in normal
biological samples).
[0230] The invention provides for the detection of aberrant
expression of a GMAD polypeptide comprising: (a) assaying the
expression of a GMAD polypeptide in a biological sample from an
individual using one or more antibodies of the invention that
specifically binds to a GMAD polypeptide; and (b) comparing the
level of a GMAD polypeptide with a standard level of a GMAD
polypeptide, e.g., in normal biological samples, whereby an
increase or decrease in the assayed level of a GMAD polypeptide
compared to the standard level of a GMAD polypeptide is indicative
of aberrant expression.
[0231] By "biological sample" is intended any fluids and/or cells
obtained from an individual, body fluid, body tissue, body cell,
cell line, tissue culture, or other source that may contain a GMAD
polypeptide protein or mRNA. Body fluids include, but are not
limited to, sera, plasma, urine, synovial fluid, spinal fluid,
saliva, and mucous. Tissues samples may be taken from virtually any
tissue in the body. Tissue samples may also be obtained from
autopsy material. Methods for obtaining tissue biopsies and body
fluids from mammals are well known in the art. Where the biological
sample is to include mRNA, a tissue biopsy is the preferred
source.
[0232] One aspect of the invention is the detection and diagnosis
of a disease or disorder associated with aberrant expression of a
GMAD polypeptide or a GMAD polypeptide receptor in an animal,
preferably a mammal and most preferably a human. In one embodiment,
diagnosis comprises: a) administering (for example, parenterally,
subcutaneously, or intraperitoneally) to a subject an effective
amount of a labeled antibody of the invention (including molecules
comprising, or alternatively consisting of, antibody fragments or
variants thereof) that specifically binds to a GMAD polypeptide; b)
waiting for a time interval following the administering for
permitting the labeled antibody to preferentially concentrate at
sites in the subject where GMAD polypeptide is expressed (and for
unbound labeled molecule to be cleared to background level); c)
determining background level; and d) detecting the labeled antibody
in the subject, such that detection of labeled antibody or fragment
thereof above the background level and above or below the level
observed in a person without the disease or disorder indicates that
the subject has a particular disease or disorder associated with
aberrant expression of a GMAD polypeptide or a GMAD polypeptide
receptor. Background level can be determined by various methods
including, comparing the amount of labeled molecule detected to a
standard value previously determined for a particular system.
[0233] It will be understood in the art that the size of the
subject and the imaging system used will determine the quantity of
imaging moiety needed to produce diagnostic images. In the case of
a radioisotope moiety, for a human subject, the quantity of
radioactivity injected will normally range from about 5 to 20
millicuries of .sup.99Tc. The labeled antibody will then
preferentially accumulate at the location of cells which contain
the specific protein. In vivo tumor imaging is described in S. W.
Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies
and Their Fragments." (Chapter 13 in Tumor Imaging: The
Radiochemical Detection of Cancer, S. W. Burchiel and B. A. Rhodes,
eds., Masson Publishing Inc. (1982).
[0234] Depending on several variables, including the type of label
used and the mode of administration, the time interval following
the administration for permitting the labeled molecule to
preferentially concentrate at sites in the subject and for unbound
labeled molecule to be cleared to background level is 6 to 48 hours
or 6 to 24 hours or 6 to 12 hours. In another embodiment the time
interval following administration is 5 to 20 days or 5 to 10
days.
[0235] In one embodiment, monitoring of the disease or disorder is
carried out by repeating the method for diagnosing the disease or
disorder, for example, one month after initial diagnosis, six
months after initial diagnosis, one year after initial diagnosis,
etc.
[0236] Presence of the labeled molecule can be detected in the
patient using methods known in the art for in vivo scanning. These
methods depend upon the type of label used. Skilled artisans will
be able to determine the appropriate method for detecting a
particular label. Methods and devices that may be used in the
diagnostic methods of the invention include, but are not limited
to, computed tomography (CT), whole body scan such as position
emission tomography (PET), magnetic resonance imaging (MRI), and
sonography.
[0237] In a specific embodiment, the molecule is labeled with a
radioisotope and is detected in the patient using a radiation
responsive surgical instrument (Thurston et al., U.S. Pat. No.
5,441,050). In another embodiment, the molecule is labeled with a
fluorescent compound and is detected in the patient using a
fluorescence responsive scanning instrument. In another embodiment,
the molecule is labeled with a positron emitting metal and is
detected in the patient using positron emission-tomography. In yet
another embodiment, the molecule is labeled with a paramagnetic
label and is detected in a patient using magnetic resonance imaging
(MRI).
Therapeutic Uses of Antibodies
[0238] One or more antibodies of the present invention (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) that specifically bind to GMAD may
be used locally or systemically in the body as a therapeutic. The
present invention is further directed to antibody-based therapies
which involve administering antibodies of the invention (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) to an animal, preferably a mammal,
and most preferably a human, for preventing or treating one or more
of the disclosed diseases, disorders, or conditions. Therapeutic
compounds of the invention include, but are not limited to,
antibodies of the invention and nucleic acids encoding antibodies
(and anti-idiotypic antibodies) of the invention as described
herein. In one embodiment, the antibodies of the invention can be
used to treat, ameliorate or prevent diseases, disorders or
conditions, including, but not limited to, any one or more of the
diseases, disorders, or conditions described herein. The treatment
and/or prevention of diseases, disorders, or conditions includes,
but is not limited to, alleviating symptoms associated with those
diseases, disorders or conditions. Antibodies of the invention may
be provided in pharmaceutically acceptable compositions as known in
the art or as described herein. In certain embodiments, properties
of the antibodies of the present invention, as detailed in the
Examples below, make the antibodies better therapeutic agents than
previously described GMAD binding antibodies.
Type I and Type II Diabetes Mellitus
[0239] In highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof, especially neutralizing or antagonistic antibodies) may be
used to diagnose, prognose, treat, prevent, or ameliorate diabetes
mellitus (type I and type II) as well as conditions associated with
diabetes mellitus (type I and type H), including, but not limited
to, diabetic ketoacidosis, diabetic coma, nonketotic
hyperglycemic-hyperosmolar coma, seizures, mental confusion,
drowsiness, cardiovascular disease (e.g., heart disease,
atherosclerosis, microvascular disease, hypertension, stroke, and
other cardiovascular diseases and disorders), dyslipidemia, kidney
disease (e.g., renal failure, nephropathy other renal disorders),
nerve damage, neuropathy, vision impairment (e.g., diabetic
retinopathy and blindness), ulcers and impaired wound healing,
infections (e.g., infectious diseases and infectious diseases,
especially of the urinary tract and skin), carpal tunnel syndrome
and Dupuytren's contracture.
[0240] In highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are administered to a patient (preferably a human) to
treat or prevent an insulin related disease, disorder, or
condition. In specific embodiments, the compositions of the
invention are administered to treat or prevent a disorder
characterized by a state of insulin resistance. Disorders
characterized by insulin resistance that may be treated (e.g.,
ameliorated), prevented, diagnosed, and/or prognosed using the
compositions of the invention include, but are not limited to,
NIDDM, obesity, hypertension, renal failure, androgen excess, and
liver cirrhosis or liver disease, injury and/or complications
associated with transplantation. In further, specific embodiments,
the compositions of the invention are administered to treat or
prevent hyperinsulinemia or a disorder or condition associated
therewith.
[0241] In highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) may be used to diagnose, prognose, treat, prevent, or
ameliorate diseases and disorders associated with aberrant glucose
metabolism or glucose uptake into cells.
[0242] In other highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are administered to an animal, preferably a mammal, and
most preferably a human, in order to regulate the animal's weight.
In specific embodiments, the antibodies, polynucleotides and/or
polypeptides corresponding to this gene and/or agonists or
antagonists thereof are administered to an animal, preferably a
mammal, and most preferably a human, in order to control the
animal's weight by modulating a biochemical pathway involving
insulin. In still other embodiments the antibodies polynucleotides
and/or polypeptides corresponding to this gene and/or agonists or
antagonists thereof are administered to an animal, preferably a
mammal, and most preferably a human, in order to control the
animal's weight by modulating a biochemical pathway involving
insulin-like growth factor.
[0243] In highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are used to diagnose, treat, prevent, or prognose or
monitor non-insulin dependent diabetes (NIDDM) or a condition
associated with NIDDM.
[0244] In highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are administered to a patient (preferably a human) to
treat or prevent non-insulin dependent diabetes (NIDDM) or a
condition associated with NIDDM.
[0245] In other preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are used to diagnose, treat, prevent, or prognose or
monitor insulin dependent diabetes (IDDM) or a condition associated
with IDDM.
[0246] In other preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are administered to a patient (preferably a human) to
treat or prevent insulin dependent diabetes (IDDM) or a condition
associated with IDDM.
[0247] In highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are used to treat, prevent, ameliorate, diagnose and/or
prognose diseases and disorders associated with aberrant glucose
metabolism or glucose uptake into cells. In other preferred
embodiments, the antibodies of the invention (including fragments,
variants, and fusion proteins thereof) are used to treat, prevent,
ameliorate, diagnose and/or prognose diseases and disorders
associated with aberrant glucose metabolism or glucose uptake into
cells.
[0248] In other highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are administered to a patient (preferably a human) to
regulate glucose metabolism. In highly preferred embodiments, the
antibodies of the invention (including fragments, variants, and
fusion proteins thereof) are administered to a patient (preferably
a human) to increase glucose metabolism.
[0249] In other highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are used treat, prevent, ameliorate, diagnose and/or
prognose hyperglycemia.
[0250] In other highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are used to diagnose, treat, prevent, or prognose or
monitor dyslipidemia or a condition associated with
dyslipidemia.
[0251] Additionally, in highly preferred embodiments, the
antibodies of the invention (including fragments, variants, and
fusion proteins thereof) are used to diagnose, treat, prognose or
monitor obesity.
[0252] In other highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are administered to a patient (preferably a human) to
treat obesity or a condition associated with obesity.
[0253] In other highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are administered to a patient (preferably a human) to
limit weight gain.
[0254] In other highly preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) to suppress appetite.
[0255] In other preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are administered to a patient (preferably a human) to
increase appetite.
[0256] In other preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are administered to a patient (preferably a human) to
alter or regulate nutritional partitioning in the patient. In one
embodiment, the antibodies of the invention (including fragments,
variants, and fusion proteins thereof) are administered according
to this method to reduce fat mass. In another embodiment, the
antibodies of the invention (including fragments, variants, and
fusion proteins thereof) are administered according to this method
to increase muscle mass.
[0257] In other preferred embodiments, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are administered to a patient (preferably a human) to
promote weight gain.
[0258] In other embodiments, the antibodies of the invention
(including fragments, variants, and fusion proteins thereof) are
used to diagnose, treat, prevent, or prognose or monitor
hypertension or a condition associated with hypertension.
[0259] In other embodiments, the antibodies of the invention
(including fragments, variants, and fusion proteins thereof) are
used to diagnose, treat, prevent, or prognose or monitor coronary
artery disease or a condition associated with coronary artery
disease.
[0260] In other embodiments, the antibodies of the invention
(including fragments, variants, and fusion proteins thereof) are
used to diagnose, treat, prevent, or prognose or monitor a
neuropathy, neural injury, or a condition associated with a
neuropathy or neural injury. Neuropathies that can be diagnosed,
treated, prevented, or prognosed using the compositions of the
invention include, but are not limited to, autonomic neuropathy,
parasympathetic neuropathy, and polyneuropathy. In preferred
embodiments, the compositions of the invention are used to
diagnose, treat, prevent, or prognose parasympathetic neuropathy or
parasympathetic neural injury or conditions associated with
parasympathetic neuropathy or parasympathetic neural injury. In
highly preferred embodiments, the compositions of the invention are
used to diagnose, treat, prevent, or prognose hepatic
parasympathetic neuropathy or hepatic parasympathetic neural
injury, and/or conditions associated with hepatic parasympathetic
neuropathy or hepatic parasympathetic neural injury.
[0261] In one embodiment, the antibodies of the invention
(including fragments, variants, and fusion proteins thereof) are
administered to a patient (preferably a human) to increase glucose
production in adipocytes and/or other cells.
[0262] Additionally, in one embodiment, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are administered to a patient (preferably a human) to
increase gluconeogenesis in adipocytes and/or other cells.
[0263] In a highly preferred embodiment, the antibodies of the
invention (including fragments, variants, and fusion proteins
thereof) are administered to a patient (preferably a human) to
modulate (e.g., increase) the effect of insulin on blood glucose
levels.
[0264] A highly preferred embodiment of the invention is a method
of increasing glucose uptake of a cell comprising contacting a cell
with one or more GMAD polypeptides of the invention. A specific
embodiment is this method performed in vitro. A specific embodiment
is this method performed in vivo. A specific embodiment is where
the cell is a liver cell, or where the cell is an adipocyte, or
where the cell is a kidney cell, or where the cell is a muscle
cell.
[0265] In one embodiment, the invention provides a method of
increasing glucose production of a cell comprising contacting a
cell with a GMAD antibody. In one embodiment, this method is
performed in vitro. In another embodiment this method is performed
in vivo. In specific embodiments, the cell contacted according to
this method is a liver cell, an adipocyte, a kidney cell, or a
muscle cell.
[0266] In another embodiment, the invention provides a method of
decreasing glucose uptake by a cell comprising contacting a cell
with a GMAD antibody of the invention (including fragments,
variants, and fusion proteins as described herein). In one
embodiment, this method is performed in vitro. In another
embodiment this method is performed in vivo. In specific
embodiments, the cell contacted according to this method is a liver
cell, an adipocyte, a kidney cell, a skin cell, a bone cell, or a
skeletal muscle cell.
[0267] In another embodiment, the invention provides a method of
increasing the sensitivity of a cell to insulin comprising
contacting a cell with a GMAD antibody of the invention (including
fragments, variants, and fusion proteins as described herein). In
one embodiment, this method is performed in vitro. In another
embodiment this method is performed in vivo. In specific
embodiments, the cell contacted according to this method is a liver
cell, an adipocyte, a kidney cell, a skin cell, a bone cell, or a
skeletal muscle cell.
[0268] In another highly preferred embodiment, the antibodies of
the invention are used to treat, prevent, diagnose, or ameliorate
cardiovascular disease.
[0269] In another highly preferred embodiment, the antibodies of
the invention are used to treat, prevent, diagnose, or ameliorate
complications associated with diabetes (e.g., diabetic retinopathy,
diabetic nephropathy, kidney disease (e.g., renal failure,
nephropathy and/or other diseases and disorders as described in the
"Renal Disorders" section below), diabetic neuropathy, nerve
disease and nerve damage (e.g., due to diabetic neuropathy), blood
vessel blockage, heart disease, stroke, impotence (e.g., due to
diabetic neuropathy or blood vessel blockage), seizures, mental
confusion, drowsiness, nonketotic hyperglycemic-hyperosmolar coma,
cardiovascular disease (e.g., heart disease, atherosclerosis,
microvascular disease, hypertension, stroke, and other diseases and
disorders as described in the "Cardiovascular Disorders" section
below), dyslipidemia, endocrine disorders (as described in the
"Endocrine Disorders" section below), neuropathy, vision impairment
(e.g., diabetic retinopathy and blindness), ulcers and impaired
wound healing, infection (e.g., an infectious disease or disorder
as described in the "Infectious Diseases" section below, especially
of the urinary tract and skin), carpal tunnel syndrome and
Dupuytren's contracture).
[0270] In another highly preferred embodiment, the antibodies of
the invention are used to treat, prevent, diagnose, or ameliorate
obesity and/or complications associated with obesity.
[0271] In additional highly preferred embodiments, the antibodies
of the invention are used to treat, prevent, diagnose, or
ameliorate weight loss or alternatively, weight gain.
[0272] In additional highly preferred embodiments, the antibodies
of the invention are used to treat, prevent, diagnose, or
ameliorate complications associated with insulin resistance.
[0273] In additional highly preferred embodiments, the antibodies
of the invention are used to treat, prevent, diagnose, or
ameliorate complications associated with hyperglycemia.
[0274] In additional highly preferred embodiments, the antibodies
of the invention are used to treat, prevent, diagnose, or
ameliorate complications associated with obesity.
[0275] In additional preferred embodiments, the antibodies of the
invention are used to treat, prevent, diagnose, or ameliorate
Fragile X Syndrome.
[0276] In additional preferred embodiments, the antibodies of the
invention are used to treat, prevent, diagnose, or ameliorate
disorders of the musculoskeletal systems including myopathies,
muscular dystrophy, and/or as described herein.
[0277] In additional highly preferred embodiments, the antibodies
of the invention are used to treat, prevent, diagnose, or
ameliorate glycogen storage disease (e.g., glycogenoses),
hepatitis, gallstones, cirrhosis of the liver, degenerative or
necrotic liver disease, alcoholic liver diseases, fibrosis, liver
regeneration, metabolic disease, dyslipidemia and cholesterol
metabolism, and hepatocarcinomas.
[0278] In additional preferred embodiments, the antibodies of the
invention are used to treat, prevent, diagnose, or ameliorate liver
disorders, including, but not limited to, cirrhosis,
hepatoblastoma, hepatocarcinoma, jaundice, hepatitis, liver
metabolic diseases, and conditions that are attributable to the
differentiation of hepatocyte progenitor cells.
Endocrine Disorders
[0279] In preferred embodiments, antibodies of the present
invention, are used to treat, prevent, diagnose, and/or prognose
disorders and/or diseases related to hormone imbalance, and/or
disorders or diseases of the endocrine system.
[0280] Hormones secreted by the glands of the endocrine system
control physical growth, sexual function, metabolism, and other
functions. Disorders may be classified in two ways: disturbances in
the production of hormones, and the inability of tissues to respond
to hormones. The etiology of these hormone imbalance or endocrine
system diseases, disorders or conditions may be genetic, somatic,
such as cancer and some autoimmune diseases, acquired (e.g., by
chemotherapy, injury or toxins), or infectious. Moreover,
polynucleotides, polypeptides, antibodies, and/or agonists or
antagonists of the present invention can be used as a marker or
detector of a particular disease or disorder related to the
endocrine system and/or hormone imbalance.
[0281] Endocrine system and/or hormone imbalance and/or diseases
encompass disorders of uterine motility including, but not limited
to: complications with pregnancy and labor (e.g., pre-term labor,
post-term pregnancy, spontaneous abortion, and slow or stopped
labor); and disorders and/or diseases of the menstrual cycle (e.g.,
dysmenorrhea and endometriosis).
[0282] Endocrine system and/or hormone imbalance disorders and/or
diseases include disorders and/or diseases of the pancreas, such
as, for example, diabetes mellitus, diabetes insipidus, congenital
pancreatic agenesis, pheochromocytoma--islet cell tumor syndrome;
disorders and/or diseases of the adrenal glands such as, for
example, Addison's Disease, corticosteroid deficiency, virilizing
disease, hirsutism, Cushing's Syndrome, hyperaldosteronism,
pheochromocytoma; disorders and/or diseases of the pituitary gland,
such as, for example, hyperpituitarism, hypopituitarism, pituitary
dwarfism, pituitary adenoma, panhypopituitarism, acromegaly,
gigantism; disorders and/or diseases of the thyroid, including but
not limited to, hyperthyroidism, hypothyroidism, Plummer's disease,
Graves' disease (toxic diffuse goiter), toxic nodular goiter,
thyroiditis (Hashimoto's thyroiditis, subacute granulomatous
thyroiditis, and silent lymphocytic thyroiditis), Pendred's
syndrome, myxedema, cretinism, thyrotoxicosis, thyroid hormone
coupling defect, thymic aplasia, Hurthle cell tumours of the
thyroid, thyroid cancer, thyroid carcinoma, Medullary thyroid
carcinoma; disorders and/or diseases of the parathyroid, such as,
for example, hyperparathyroidism, hypoparathyroidism; disorders
and/or diseases of the hypothalamus.
[0283] In addition, endocrine system and/or hormone imbalance
disorders and/or diseases may also include disorders and/or
diseases of the testes or ovaries, including cancer. Other
disorders and/or diseases of the testes or ovaries further include,
for example, ovarian cancer, polycystic ovary syndrome,
Klinefelter's syndrome, vanishing testes syndrome (bilateral
anorchia), congenital absence of Leydig's cells, cryptorchidism,
Noonan's syndrome, myotonic dystrophy, capillary haemangioma of the
testis (benign), neoplasias of the testis and neo-testis.
[0284] Moreover, endocrine system and/or hormone imbalance
disorders and/or diseases may also include disorders and/or
diseases such as, for example, polyglandular deficiency syndromes,
pheochromocytoma, neuroblastoma, multiple Endocrine neoplasia, and
disorders and/or cancers of endocrine tissues.
Inflammation and Inflammatory Disorders
[0285] In other embodiments, the antibodies of the invention
(including fragments and variants thereof) may be used in the
diagnosis, prognosis, prevention, and/or treatment of inflammatory
disorders, as described herein.
[0286] In highly preferred embodiments, allergic reactions and
conditions, such as asthma (particularly allergic asthma) or other
respiratory problems, may also be treated, prevented, and/or
diagnosed using polypeptides, antibodies, or polynucleotides of the
invention, and/or agonists or antagonists thereof. Moreover, these
molecules can be used to treat, prevent, and/or diagnose
anaphylaxis, hypersensitivity to an antigenic molecule, or blood
group incompatibility.
[0287] Allergic reactions and conditions, such as asthma
(particularly allergic asthma) or other respiratory problems, may
also be treated, prevented, and/or diagnosed using antibodies of
the invention. Moreover, these molecules can be used to treat,
prevent, and/or diagnose anaphylaxis, hypersensitivity to an
antigenic molecule, or blood group incompatibility.
[0288] Additionally, antibodies of the invention, may be used to
treat or prevent IgE-mediated allergic reactions. Such allergic
reactions include, but are not limited to, asthma, rhinitis, and
eczema. In specific embodiments, polynucleotides, polypeptides,
antibodies, and/or agonists or antagonists of the present invention
may be used to modulate IgE concentrations in vitro or in vivo.
[0289] Moreover, antibodies of the present invention have uses in
the diagnosis, prognosis, prevention, and/or treatment of
inflammatory conditions. For example, since polypeptides,
antibodies, or polynucleotides of the invention, and/or agonists or
antagonists of the invention may inhibit the activation,
proliferation and/or differentiation of cells involved in an
inflammatory response, these molecules can be used to diagnose,
prognose, prevent, and/or treat chronic and acute inflammatory
conditions. Such inflammatory conditions include, but are not
limited to, for example, inflammation associated with infection
(e.g., septic shock, sepsis, or systemic inflammatory response
syndrome), ischemia-reperfusion injury, endotoxin lethality,
complement-mediated hyperacute rejection, nephritis, cytokine or
chemokine induced lung injury, inflammatory bowel disease, Crohn's
disease, over production of cytokines (e.g., TNF or IL-1.),
respiratory disorders (such as, e.g., asthma and allergy);
gastrointestinal disorders (such as, e.g., inflammatory bowel
disease); cancers (such as, e.g., gastric, ovarian, lung, bladder,
liver, and breast); CNS disorders (such as, e.g., multiple
sclerosis; ischemic brain injury and/or stroke; traumatic brain
injury; neurodegenerative disorders, such as, e.g., Parkinson's
disease and Alzheimer's disease; AIDS-related dementia; and prion
disease); cardiovascular disorders (such as, e.g., atherosclerosis,
myocarditis, cardiovascular disease, and cardiopulmonary bypass
complications); as well as many additional diseases, conditions,
and disorders that are characterized by inflammation (such as,
e.g., hepatitis, rheumatoid arthritis, gout, trauma, pancreatitis,
sarcoidosis, dermatitis, renal ischemia-reperfusion injury, Grave's
disease, systemic lupus erythematosis, diabetes mellitus, and
allogenic transplant rejection).
[0290] Because inflammation is a fundamental defense mechanism,
inflammatory disorders can effect virtually any tissue of the body.
Accordingly, antibodies of the invention have uses in the treatment
of tissue-specific inflammatory disorders, including, but not
limited to, adrenalitis, alveolitis, angiocholecystitis,
appendicitis, balanitis, blepharitis, bronchitis, bursitis,
carditis, cellulitis, cervicitis, cholecystitis, chorditis,
cochlitis, colitis, conjunctivitis, cystitis, dermatitis,
diverticulitis, encephalitis, endocarditis, esophagitis,
eustachitis, fibrositis, folliculitis, gastritis, gastroenteritis,
gingivitis, glossitis, hepatosplenitis, keratitis, labyrinthitis,
laryngitis, lymphangitis, mastitis, media otitis, meningitis,
metritis, mucitis, myocarditis, myosititis, myringitis, nephritis,
neuritis, orchitis, osteochondritis, otitis, pericarditis,
peritendonitis, peritonitis, pharyngitis, phlebitis, poliomyelitis,
prostatitis, pulpitis, retinitis, rhinitis, salpingitis, scleritis,
sclerochoroiditis, scrotitis, sinusitis, sponylitis, steatitis,
stomatitis, synovitis, syringitis, tendonitis, tonsillitis,
urethritis, and vaginitis.
[0291] In specific embodiments, antibodies of the invention, are
useful to treat, diagnose, and/or prevent organ transplant
rejections and graft-versus-host disease. Organ rejection occurs by
host immune cell destruction of the transplanted tissue through an
immune response. Similarly, an immune response is also involved in
GVHD, but, in this case, the foreign transplanted immune cells
destroy the host tissues. Polypeptides, antibodies, or
polynucleotides of the invention, and/or agonists or antagonists
thereof, that inhibit an immune response, particularly the
activation, proliferation, differentiation, or chemotaxis of
T-cells, may be an effective therapy in preventing organ rejection
or GVHD. In specific embodiments, polypeptides, antibodies, or
polynucleotides of the invention, and/or agonists or antagonists
thereof, that inhibit an immune response, particularly the
activation, proliferation, differentiation, or chemotaxis of
T-cells, may be an effective therapy in preventing experimental
allergic and hyperacute xenograft rejection.
[0292] In another specific embodiment, antibodies of the invention
are used as an agent to induce higher affinity antibodies.
[0293] In another specific embodiment, antibodies of the invention
are used as an agent to increase serum immunoglobulin
concentrations.
Cardiovascular Disorders
[0294] Antibodies of the invention may be used to treat
cardiovascular disorders, including peripheral artery disease, such
as limb ischemia.
[0295] Cardiovascular disorders include cardiovascular
abnormalities, such as arterio-arterial fistula, arteriovenous
fistula, cerebral arteriovenous malformations, congenital heart
defects, pulmonary atresia, and Scimitar Syndrome. Congenital heart
defects include aortic coarctation, cortriatriatum, coronary vessel
anomalies, crisscross heart, dextrocardia, patent ductus
arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic
left heart syndrome, levocardia, tetralogy of fallot, transposition
of great vessels, double outlet right ventricle, tricuspid atresia,
persistent truncus arteriosus, and heart septal defects, such as
aortopulmonary septal defect, endocardial cushion defects,
Lutembacher's Syndrome, trilogy of Fallot, ventricular heart septal
defects.
[0296] Cardiovascular disorders also include heart disease, such as
arrhythmias, carcinoid heart disease, high cardiac output, low
cardiac output, cardiac tamponade, endocarditis (including
bacterial), heart aneurysm, cardiac arrest, congestive heart
failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac
edema, heart hypertrophy, congestive cardiomyopathy, left
ventricular hypertrophy, right ventricular hypertrophy,
post-infarction heart rupture, ventricular septal rupture, heart
valve diseases, myocardial diseases, myocardial ischemia,
pericardial effusion, pericarditis (including constrictive and
tuberculous), pneumopericardium, postpericardiotomy syndrome,
pulmonary heart disease, rheumatic heart disease, ventricular
dysfunction, hyperemia, cardiovascular pregnancy complications,
Scimitar Syndrome, cardiovascular syphilis, and cardiovascular
tuberculosis.
[0297] Arrhythmias include sinus arrhythmia, atrial fibrillation,
atrial flutter, bradycardia, extrasystole, Adams-Stokes Syndrome,
bundle-branch block, sinoatrial block, long QT syndrome,
parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type
pre-excitation syndrome, Wolff-Parkinson-White syndrome, sick sinus
syndrome, tachycardias, and ventricular fibrillation. Tachycardias
include paroxysmal tachycardia, supraventricular tachycardia,
accelerated idioventricular rhythm, atrioventricular nodal reentry
tachycardia, ectopic atrial tachycardia, ectopic junctional
tachycardia, sinoatrial nodal reentry tachycardia, sinus
tachycardia, Torsades de Pointes, and ventricular tachycardia.
[0298] Heart valve disease include aortic valve insufficiency,
aortic valve stenosis, hear murmurs, aortic valve prolapse, mitral
valve prolapse, tricuspid valve prolapse, mitral valve
insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary
valve insufficiency, pulmonary valve stenosis, tricuspid atresia,
tricuspid valve insufficiency, and tricuspid valve stenosis.
[0299] Myocardial diseases include alcoholic cardiomyopathy,
congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic
subvalvular stenosis, pulmonary subvalvular stenosis, restrictive
cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis,
endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion
injury, and myocarditis.
[0300] Myocardial ischemias include coronary disease, such as
angina pectoris, coronary aneurysm, coronary arteriosclerosis,
coronary thrombosis, coronary vasospasm, myocardial infarction and
myocardial stunning.
[0301] Cardiovascular diseases also include vascular diseases such
as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis,
Hippel-Lindau Disease, Klippel-Trenaunay-Weber Syndrome,
Sturge-Weber Syndrome, angioneurotic edema, aortic diseases,
Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial
occlusive diseases, arteritis, enarteritis, polyarteritis nodosa,
cerebrovascular disorders, diabetic angiopathies, diabetic
retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids,
hepatic veno-occlusive disease, hypertension, hypotension,
ischemia, peripheral vascular diseases, phlebitis, pulmonary
veno-occlusive disease, Raynaud's disease, CREST syndrome, retinal
vein occlusion, Scimitar syndrome, superior vena cava syndrome,
telangiectasia, atacia telangiectasia, hereditary hemorrhagic
telangiectasia, varicocele, varicose veins, varicose ulcer,
vasculitis, and venous insufficiency.
[0302] Aneurysms include dissecting aneurysms, false aneurysms,
infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral
aneurysms, coronary aneurysms, heart aneurysms, and iliac
aneurysms.
[0303] Arterial occlusive diseases include arteriosclerosis,
intermittent claudication, carotid stenosis, fibromuscular
dysplasias, mesenteric vascular occlusion, Moyamoya disease, renal
artery obstruction, retinal artery occlusion, and thromboangiitis
obliterans.
[0304] Cerebrovascular disorders include carotid artery diseases,
cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia,
cerebral arteriosclerosis, cerebral arteriovenous malformation,
cerebral artery diseases, cerebral embolism and thrombosis, carotid
artery thrombosis, sinus thrombosis, Wallenberg's syndrome,
cerebral hemorrhage, epidural hematoma, subdural hematoma,
subaraxhnoid hemorrhage, cerebral infarction, cerebral ischemia
(including transient), subclavian steal syndrome, periventricular
leukomalacia, vascular headache, cluster headache, migraine, and
vertebrobasilar insufficiency.
[0305] Embolisms include air embolisms, amniotic fluid embolisms,
cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary
embolisms, and thromoboembolisms. Thrombosis include coronary
thrombosis, hepatic vein thrombosis, retinal vein occlusion,
carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome,
and thrombophlebitis.
[0306] Ischemia includes cerebral ischemia, ischemic colitis,
compartment syndromes, anterior compartment syndrome, myocardial
ischemia, reperfusion injuries, and peripheral limb ischemia.
Vasculitis includes aortitis, arteritis, Behcet's Syndrome,
Churg-Strauss Syndrome, mucocutaneous lymph node syndrome,
thromboangiitis obliterans, hypersensitivity vasculitis,
Schoenlein-Henoch purpura, allergic cutaneous vasculitis, and
Wegener's granulomatosis.
[0307] Antibodies of the invention are especially effective for the
treatment of critical limb ischemia and coronary disease.
[0308] Antibodies of the invention may be administered using any
method known in the art, including, but not limited to, direct
needle injection at the delivery site, intravenous injection,
topical administration, catheter infusion, biolistic injectors,
particle accelerators, gelfoam sponge depots, other commercially
available depot materials, osmotic pumps, oral or suppositorial
solid pharmaceutical formulations, decanting or topical
applications during surgery, aerosol delivery. Such methods are
known in the art. Polypeptides may be administered as part of a
Therapeutic, described in more detail below. Methods of delivering
polynucleotides are described in more detail herein.
Additional Therapeutic Uses of Antibodies
[0309] The present invention is directed to a method for inhibiting
GMAD-mediated insulin resistance, which involves administering to a
cell (which expresses a GMAD polypeptide in vitro or in vivo), an
effective amount of an antibody of the invention, capable of
decreasing GMAD mediated signaling (through a GMAD receptor).
Preferably, GMAD mediated signaling is decreased to treat a disease
wherein increased GMAD expression is exhibited.
[0310] The antibodies of the invention can be used to treat,
ameliorate or prevent diseases, disorders or conditions associated
with aberrant expression and/or activity of GMAD, including, but
not limited to, any one or more of the diseases, disorders, or
conditions described herein. The treatment and/or prevention of
diseases, disorders, or conditions associated with aberrant GMAD
expression and/or activity includes, but is not limited to,
alleviating symptoms associated with those diseases, disorders or
conditions. Antibodies of the invention may be provided in
pharmaceutically acceptable compositions as known in the art or as
described herein.
[0311] Further, antibodies of the present invention (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) which inhibit GMAD-mediated
biological activities (e.g., the inhibition of insulin action) can
be administered to an animal to treat, prevent or ameliorate a
disease or disorder described herein, particularly Type I and II
Diabetes Mellitus and inflammatory disorders. These antibodies may
diminish either all or a subset of the biological activities of
GMAD, for example, by inducing a conformational change in GMAD. In
a specific embodiment, an antibody of the present invention that
inhibits GMAD activity by at least 5%, at least 10%, at least 15%,
at least 20%, at least 25%, at least 30%, at least 35%, at least
40%, at least 45%, at least 50%, at least 55%, at least 60%, at
least 65%, at least 70%, at least 75%, at least 80%, at least 85%,
at least 90%, at least 95%, at least 99%, at least two-fold, at
least three-fold, at least four fold, at least five fold, at least
ten-fold, at least twenty-fold, at least fifty-fold, or at least
one hundred-fold relative to GMAD activity in absence of the
antibody is administered to an animal to treat, prevent or
ameliorate a disease or disorder. In another embodiment, a
combination of antibodies, a combination of antibody fragments, a
combination of antibody variants, or a combination of antibodies,
antibody fragments and/or antibody variants that inhibit GMAD
activity by at least 5%, at least 10%, at least 15%, at least 20%,
at least 25%, at least 30%, at least 35%, at least 40%, at least
45%, at least 50%, at least 55%, at least 60%, at least 65%, at
least 70%, at least 75%, at least 80%, at least 85%, at least 90%,
at least 95%, at least 99%, at least two-fold, at least three-fold,
at least four fold, at least five fold, at least ten-fold, at least
twenty-fold, at least fifty-fold, or at least one hundred-fold
relative to GMAD activity in absence of the said antibodies or
antibody fragments and/or antibody variants is administered to an
animal to treat, prevent or ameliorate a disease or disorder.
[0312] Further, antibodies of the present invention (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) which inhibit GMAD-mediated
biological activities (e.g., the inhibition of insulin action) can
be administered to an animal to treat, prevent or ameliorate a
disease or disorder associated with aberrant GMAD expression,
excess or aberrant GMAD function, or aberrant GMAD receptor
expression. These antibodies may diminish either all or a subset of
the biological activities of GMAD, for example, by preventing GMAD
interaction with its receptor. In a specific embodiment, an
antibody of the present invention that diminishes GMAD activity by
at least 5%, at least 10%, at least 15%, at least 20%, at least
25%, at least 30%, at least 35%, at least 40%, at least 45%, at
least 50%, at least 55%, at least 60%, at least 65%, at least 70%,
at least 75%, at least 80%, at least 85%, at least 90%, at least
95%, at least 99%, at least two-fold, at least three-fold, at least
four fold, at least five fold, at least ten-fold, at least
twenty-fold, at least fifty-fold, or at least one hundred-fold
relative to GMAD activity in absence of the antibody is
administered to an animal to treat, prevent or ameliorate a disease
or disorder associated with aberrant GMAD expression, excess GMAD
function, or aberrant GMAD receptor expression. In another
embodiment, a combination of antibodies, a combination of antibody
fragments, a combination of antibody variants, or a combination of
antibodies, antibody fragments and/or antibody variants that
diminish GMAD activity by at least 5%, at least 10%, at least 15%,
at least 20%, at least 25%, at least 30%, at least 35%, at least
40%, at least 45%, at least 50%, at least 55%, at least 60%, at
least 65%, at least 70%, at least 75%, at least 80%, at least 85%,
at least 90%, at least 95%, at least 99%, at least two-fold, at
least three-fold, at least four fold, at least five fold, at least
ten-fold, at least twenty-fold, at least fifty-fold, or at least
one hundred-fold relative to GMAD activity in absence of the said
antibodies or antibody fragments and/or antibody variants is
administered to an animal to treat, prevent or ameliorate a disease
or disorder associated with aberrant GMAD expression or excess GMAD
function or aberrant GMAD receptor expression.
[0313] Antibodies of the present invention (including molecules
comprising, or alternatively consisting of, antibody fragments or
variants thereof) that function as agonists or antagonists of GMAD,
preferably of GMAD signal transduction, can be administered to an
animal to treat, prevent or ameliorate a disease or disorder
associated with aberrant GMAD expression, lack of GMAD function, or
aberrant GMAD receptor expression. For example, antibodies of the
invention that act as GMAD agonists may be administered to an
animal to treat, prevent or ameliorate a disease or disorder
associated with aberrant GMAD expression, lack of GMAD function, or
aberrant GMAD receptor expression. As an alternative example,
antibodies of the invention which disrupt or prevent the
interaction between GMAD and its receptor or inhibit, reduce, or
prevent signal transduction through one or more GMADs, may be
administered to an animal to treat, prevent or ameliorate a disease
or disorder associated with aberrant GMAD expression, lack of GMAD
function, or aberrant GMAD receptor expression. Antibodies of the
invention which do not prevent GMAD from binding its receptor but
inhibit or downregulate GMAD signal transduction can be
administered to an animal to treat, prevent or ameliorate a disease
or disorder associated with aberrant GMAD expression, lack of GMAD
function or aberrant GMAD receptor expression. The ability of an
antibody of the invention to enhance, inhibit, upregulate or
downregulate GMAD signal transduction may be determined by
techniques described herein or otherwise known in the art. For
example, GMAD-induced receptor activation and the activation of
signaling molecules can be determined by detecting the association
of adaptor proteins with the GMAD receptors, by immunoprecipitation
followed by western blot analysis (for example, as described
herein).
[0314] Further, antibodies of the present invention (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof) which activate GMAD-mediated
biological activities (e.g., the inhibition of insulin action) can
be administered to an animal to treat, prevent or ameliorate a
disease or disorder associated with aberrant GMAD expression, or
aberrant GMAD receptor expression. These antibodies may potentiate
or activate either all or a subset of the biological activities of
GMAD, for example, by inducing a conformational change in GMAD. In
a specific embodiment, an antibody of the present invention that
increases GMAD activity by at least 5%, at least 10%, at least 15%,
at least 20%, at least 25%, at least 30%, at least 35%, at least
40%, at least 45%, at least 50%, at least 55%, at least 60%, at
least 65%, at least 70%, at least 75%, at least 80%, at least 85%,
at least 90%, at least 95%, at least 99%, at least two-fold, at
least three-fold, at least four fold, at least five fold, at least
ten-fold, at least twenty-fold, at least fifty-fold, or at least
one hundred-fold relative to GMAD activity in absence of the
antibody is administered to an animal to treat, prevent or
ameliorate a disease or disorder associated with aberrant GMAD
expression, lack of GMAD function, or aberrant GMAD receptor
expression. In another embodiment, a combination of antibodies, a
combination of antibody fragments, a combination of antibody
variants, or a combination of antibodies, antibody fragments and/or
antibody variants that increase GMAD activity by at least 5%, at
least 10%, at least 15%, at least 20%, at least 25%, at least 30%,
at least 35%, at least 40%, at least 45%, at least 50%, at least
55%, at least 60%, at least 65%, at least 70%, at least 75%, at
least 80%, at least 85%, at least 90%, at least 95%, at least 99%,
at least two-fold, at least three-fold, at least four fold, at
least five fold, at least ten-fold, at least twenty-fold, at least
fifty-fold, or at least one hundred-fold relative to GMAD activity
in absence of the said antibodies or antibody fragments and/or
antibody variants is administered to an animal to treat, prevent or
ameliorate a disease or disorder associated with aberrant GMAD
expression or lack of GMAD function or aberrant GMAD receptor
expression.
[0315] In a specific embodiment, an antibody of the present
invention (including molecules comprising, or alternatively
consisting of, antibody fragments or variants thereof) that
inhibits or downregulates, in full or in part, GMAD activity (e.g.,
inhibition of insulin action) by at least 95%, at least 90%, at
least 85%, at least 80%, at least 75%, at least 70%, at least 60%,
at least 50%, at least 45%, at least 40%, at least 45%, at least
35%, at least 30%, at least 25%, at least 20%, or at least 10%
relative to GMAD activity in absence of the antibody is
administered to an animal to treat, prevent or ameliorate a disease
or disorder associated with aberrant GMAD expression, excessive
GMAD function, aberrant GMAD receptor expression, or excessive GMAD
receptor function. In another embodiment, a combination of
antibodies, a combination of antibody fragments, a combination of
antibody variants, or a combination of antibodies, antibody
fragments, and/or variants that inhibit or downregulate GMAD
activity by at least 95%, at least 90%, at least 85%, at least 80%,
at least 75%, at least 70%, at least 65%, at least 60%, at least
55%, at least 50%, at least 45%, at least 40%, at least 45%, at
least 35%, at least 30%, at least 25%, at least 20%, or at least
10% relative to GMAD activity in absence of said antibodies,
antibody fragments, and/or antibody variants are administered to an
animal to treat, prevent or ameliorate a disease or disorder
associated with aberrant GMAD expression, excessive GMAD function,
aberrant GMAD receptor expression, or excessive GMAD receptor
function.
Therapeutic/Prophylactic Compositions and Administration
[0316] The invention provides methods of treatment, inhibition and
prophylaxis by administration to a subject of an effective amount
of antibody (or fragment or variant thereof) or pharmaceutical
composition of the invention, preferably an antibody of the
invention. In a preferred aspect, an antibody or fragment or
variant thereof is substantially purified (i.e., substantially free
from substances that limit its effect or produce undesired
side-effects). The subject is preferably an animal, including but
not limited to, animals such as cows, pigs, horses, chickens, cats,
dogs, etc., and is preferably a mammal, and most preferably a
human.
[0317] Formulations and methods of administration that can be
employed when the compound comprises a nucleic acid or an
immunoglobulin are described above; additional appropriate
formulations and routes of administration can be selected from
among those described herein below.
[0318] Various delivery systems are known and can be used to
administer an antibody of the invention or a fragment or variant
thereof, e.g., encapsulation in liposomes, microparticles,
microcapsules, recombinant cells capable of expressing the antibody
or antibody fragment, receptor-mediated endocytosis (see, e.g., Wu
and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction of a
nucleic acid as part of a retroviral or other vector, etc. Methods
of introduction include, but are not limited to, intradermal,
intramuscular, intraperitoneal, intravenous, subcutaneous,
intranasal, epidural, and oral routes. The compositions may be
administered by any convenient route, for example by infusion or
bolus injection, by absorption through epithelial or mucocutaneous
linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and
may be administered together with other biologically active agents.
Administration can be systemic or local. In addition, it may be
desirable to introduce the pharmaceutical compositions of the
invention into the central nervous system by any suitable route,
including intraventricular and intrathecal injection;
intraventricular injection may be facilitated by an
intraventricular catheter, for example, attached to a reservoir,
such as an Ommaya reservoir. Pulmonary administration can also be
employed, e.g., by use of an inhaler or nebulizer, and formulation
with an aerosolizing agent.
[0319] In a specific embodiment, it may be desirable to administer
the pharmaceutical compositions of the invention locally to the
area in need of treatment; this may be achieved by, for example,
and not by way of limitation, local infusion during surgery,
topical application, e.g., in conjunction with a wound dressing
after surgery, by injection, by means of a catheter, by means of a
suppository, or by means of an implant, said implant being of a
porous, non-porous, or gelatinous material, including membranes,
such as sialastic membranes, or fibers. Preferably, when
administering a protein, including an antibody, of the invention,
care must be taken to use materials to which the protein does not
absorb.
[0320] In another embodiment, the composition can be delivered in a
vesicle, in particular a liposome (see Langer, Science
249:1527-1535 (1990); Treat et al., in Liposomes in the Therapy of
Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.),
Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp.
317-327; see generally ibid.).
[0321] In yet another embodiment, the composition can be delivered
in a controlled release system. In one embodiment, a pump may be
used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:20
1 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N.
Engl. J. Med. 321:574 (1989)). In another embodiment, polymeric
materials can be used (see Medical Applications of Controlled
Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla.
(1974); Controlled Drug Bioavailability, Drug Product Design and
Performance, Smolen and Ball (eds.), Wiley, N.Y. (1984); Ranger and
Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:71 (1983); see
also Levy et al., Science 228:190 (1985); During et al., Ann.
Neurol. 25:35 1 (1989); Howard et al., J. Neurosurg. 7 1:105
(1989)). In yet another embodiment, a controlled release system can
be placed in proximity of the therapeutic target, i.e., the brain,
thus requiring only a fraction of the systemic dose (see, e.g.,
Goodson, in Medical Applications of Controlled Release, supra, vol.
2, pp. 115-138 (1984)).
[0322] Other controlled release systems are discussed in the review
by Langer (Science 249:1527-1535 (1990)).
[0323] In a specific embodiment where the composition of the
invention is a nucleic acid encoding an antibody, the nucleic acid
can be administered in vivo to promote expression of its encoded
antibody, by constructing it as part of an appropriate nucleic acid
expression vector and administering it so that it becomes
intracellular, e.g., by use of a retroviral vector (see U.S. Pat.
No. 4,980,286), or by direct injection, or by use of microparticle
bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with
lipids or cell-surface receptors or transfecting agents, or by
administering it in linkage to a homeobox-like peptide which is
known to enter the nucleus (see e.g., Joliot et al., Proc. Natl.
Acad. Sci. USA 88:1864-1868 (1991)), etc. Alternatively, a nucleic
acid can be introduced intracellularly and incorporated within host
cell DNA for expression, by homologous recombination.
[0324] The present invention also provides pharmaceutical
compositions. Such compositions comprise a therapeutically
effective amount of an antibody or a fragment thereof, and a
pharmaceutically acceptable carrier. In a specific embodiment, the
term "pharmaceutically acceptable" means approved by a regulatory
agency of the Federal or a state government or listed in the U.S.
Pharmacopeia or other generally recognized pharmacopeia for use in
animals, and more particularly in humans. The term "carrier" refers
to a diluent, adjuvant, excipient, or vehicle with which the
therapeutic is administered. Such pharmaceutical carriers can be
sterile liquids, such as water and oils, including those of
petroleum, animal, vegetable or synthetic origin, such as peanut
oil, soybean oil, mineral oil, sesame oil and the like. Water is a
preferred carrier when the pharmaceutical composition is
administered intravenously. Saline solutions and aqueous dextrose
and glycerol solutions can also be employed as liquid carriers,
particularly for injectable solutions. Suitable pharmaceutical
excipients include starch, glucose, lactose, sucrose, gelatin,
malt, rice, flour, chalk, silica gel, sodium stearate, glycerol
monostearate, talc, sodium chloride, dried skim milk, glycerol,
propylene, glycol, water, ethanol and the like. The composition, if
desired, can also contain minor amounts of wetting or emulsifying
agents, or pH buffering agents. These compositions can take the
form of solutions, suspensions, emulsion, tablets, pills, capsules,
powders, sustained-release formulations and the like. The
composition can be formulated as a suppository, with traditional
binders and carriers such as triglycerides. Oral formulation can
include standard carriers such as pharmaceutical grades of
mannitol, lactose, starch, magnesium stearate, sodium saccharine,
cellulose, magnesium carbonate, etc. Examples of suitable
pharmaceutical carriers are described in "Remington's
Pharmaceutical Sciences" by E. W. Martin. Such compositions will
contain a therapeutically effective amount of the antibody or
fragment thereof, preferably in purified form, together with a
suitable amount of carrier so as to provide the form for proper
administration to the patient. The formulation should suit the mode
of administration.
[0325] In a preferred embodiment, the composition is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
may also include a solubilizing agent and a local anesthetic such
as lignocamne to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule or sachette indicating the quantity of active agent. Where
the composition is to be administered by infusion, it can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0326] The compositions of the invention can be formulated as
neutral or salt forms. Pharmaceutically acceptable salts include
those formed with anions such as those derived from hydrochloric,
phosphoric, acetic, oxalic, tartaric acids, etc., and those formed
with cations such as those derived from sodium, potassium,
ammonium, calcium, ferric hydroxides, isopropylamine,
triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
[0327] The amount of the composition of the invention which will be
effective in the treatment, inhibition and prevention of a disease
or disorder associated with aberrant expression and/or activity of
a polypeptide of the invention can be determined by standard
clinical techniques. In addition, in vitro assays may optionally be
employed to help identify optimal dosage ranges. The precise dose
to be employed in the formulation will also depend on the route of
administration, and the seriousness of the disease or disorder, and
should be decided according to the judgment of the practitioner and
each patient's circumstances. Effective doses may be extrapolated
from dose-response curves derived from in vitro or animal model
test systems.
[0328] For antibodies, the dosage administered to a patient is
typically 0.1 mg/kg to 100 mg/kg of the patient's body weight.
Preferably, the dosage administered to a patient is between 0.1
mg/kg and 20 mg/kg of the patient's body weight, more preferably 1
mg/kg to 10 mg/kg of the patient's body weight. Generally, human
antibodies have a longer half-life within the human body than
antibodies from other species due to the immune response to the
foreign polypeptides. Thus, lower dosages of human antibodies and
less frequent administration is often possible. Further, the dosage
and frequency of administration of therapeutic or pharmaceutical
compositions of the invention may be reduced by enhancing uptake
and tissue penetration (e.g., into the brain) of the antibodies by
modifications such as, for example, lipidation.
[0329] Generally, administration of products of a species origin or
species reactivity (in the case of antibodies) that is the same
species as that of the patient is preferred. Thus, in a preferred
embodiment, human antibodies, fragments, or variants, (e.g.,
derivatives), or nucleic acids, are administered to a human patient
for therapy or prophylaxis.
[0330] It is preferred to use high affinity and/or potent in vivo
inhibiting and/or neutralizing antibodies of the invention
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof) that specifically bind to
one or more GMAD polypeptides, or polynucleotides encoding
antibodies that specifically bind to one or more GMAD polypeptides,
for both immunoassays and therapy of disorders related to GMAD
polynucleotides or polypeptides, including fragments thereof. Such
antibodies will preferably have an affinity for GMAD polypeptides
and/or GMAD polypeptide fragments. Preferred binding affinities
include those with a dissociation constant or K.sub.D of less than
or equal to 5.times.10.sup.-2 M, 10.sup.-2 M, 5.times.10.sup.-3 M,
10.sup.-3 M, 5.times.10.sup.-4 M, 10.sup.-4 M, 5.times.10.sup.-5 M,
or 10.sup.-5 M. More preferably, antibodies of the invention bind
GMAD polypeptides or fragments or variants thereof with a
dissociation constant or K.sub.D less than or equal to
5.times.10.sup.-6 M, 10.sup.-6 M, 5.times.10 .sup.-7 M, 10.sup.-7
M, 5.times.10.sup.-8 M, or 10.sup.-8 M. Even more preferably,
antibodies of the invention bind GMAD polypeptides or fragments or
variants thereof with a dissociation constant or K.sub.D less than
or equal to 5.times.10.sup.-9 M, 10.sup.-9 M, 5.times.10.sup.-10 M,
10.sup.-10 M, 5.times.10.sup.-11 M, 10.sup.-11 M,
5.times.10.sup.-12 M, 10.sup.-12 M, 5.times..sup.-13 M, 10.sup.-13
M, 5.times.10.sup.-14 M, 10.sup.-14 M, 5.times.10.sup.-15 M, or
10.sup.-15 M. In a preferred embodiment, antibodies of the
invention inhibit proliferation, differentiation, and/or apoptosis
of GMAD receptor expressing cells. In an additional preferred
embodiment, antibodies of the invention induce differentiation of
GMAD receptor expressing cells.
[0331] As discussed in more detail below, the antibodies of the
present invention may be used either alone or in combination with
other compositions. The antibodies may further be recombinantly
fused to a heterologous polypeptide at the N- or C-terminus or
chemically conjugated (including covalent and non-covalent
conjugations) to polypeptides or other compositions. For example,
antibodies of the present invention may be recombinantly fused or
conjugated to molecules useful as labels in detection assays and
effector molecules such as heterologous polypeptides, drugs,
radionuclides, or toxins. See, e.g., PCT publications WO 92/08495;
WO 91/14438; WO 89/12624; U.S. Pat. No. 5,314,995; and EP
396,387.
[0332] The antibody and antibody compositions of the invention may
be administered alone or in combination with other therapeutic
agents, including but not limited to anti-diabetic agents,
chemotherapeutic agents, antibiotics, antivirals, anti-retroviral
agents, steroidal and non-steroidal anti-inflammatories,
conventional immunotherapeutic agents and cytokines. Combinations
may be administered either concomitantly, e.g., as an admixture,
separately but simultaneously or concurrently; or sequentially.
This includes presentations in which the combined agents are
administered together as a therapeutic mixture, and also procedures
in which the combined agents are administered separately but
simultaneously, e.g., as through separate intravenous lines into
the same individual. Administration "in combination" further
includes the separate administration of one of the compounds or
agents given first, followed by the second.
Combination Therapies with Anti-GMAD Antibodies, Anti-Diabetic
Drugs, and/or Immunomodulatory Agents,
[0333] Anti-GMAD antibodies may be administered in combination with
other anti-GMAD antibodies, GMAD, and/or anti-diabetic drugs.
[0334] In specific embodiments, an antibody of the invention that
specifically binds GMAD is used or administered in combination with
a second antibody that specifically binds GMAD. In another
embodiment, the antibodies specific for GMAD are antagonistic
antibodies that inhibit GMAD secretion and/or GMAD biological
activity (e.g., inhibition of insulin action, inhibition of glucose
uptake). In a specific embodiment, the combination of anti-GMAD
treatment inhibits more GMAD biological activity than either
anti-GMAD antibody treatment alone.
[0335] In another embodiment, the antibodies specific for GMAD are
agonistic antibodies that stimulate cellular insulin resistance. In
a specific embodiment, the combination of anti-GMAD treatment
sitmulates more insulin resistance than either anti-GMAD antibody
treatment alone. The anti-GMAD antibodies can be administered
either simultaneously, sequentially, or a combination of
simultaneous or sequential administration throughout the dosage
regimen. In another specific embodiment anti-GMAD antibodies are
used or administered in combination with a chemotherapeutic drug,
antidiabetic drug, and/or immunomodulatory drug. In a particular
embodiment, the synergistic inhibition of insulin resistance from
anti-GMAD antibody treatment, is more evident or more pronounced
when the anti-GMAD antibodies are used or administered in
combination with an antidiabetic drug, a chemotherapeutic agent,
immunomodulatory drug, and/or a cross-linking reagent.
[0336] In one embodiment, the compositions of the invention are
administered in combination with other antidiabetic drugs,
including, but not limited to Thiazolidinediones, or TZDs including
but not limited to, rosiglitazone, piogliatazone, and troglitazone.
In another specific embodiment, compositions of the invention are
used in combination with oral hypoglycemic sulfonylurea drugs
including, but not limited to, acarbose, acetohexamide,
chlorpropamide, glimepiride, glipizide, glyburide, metformin,
tolazamide, and/or tolbutamide. In another specific embodiment,
compositions of the invention are used in combination with insulin,
insulin derivatives, and/or insulin substitutes, In still other
embodiments, compositions of the invention are administered in
combination with one or more of the following, Acenorm.TM.;
Acenorm.TM. Cor.TM.; Acepress.TM.; Acepril.TM.; Aceten.TM.;
Adocor.TM.; Alopresin.TM.; Angiopril.TM.; Apuzin.TM.; Asisten.TM.;
Capace.TM.; Capoten.TM.; Capotena.TM.; Capril.TM.; Captensin.TM.;
Captoflux.TM.; Captolane.TM.; Captolong.TM.; Captopress.TM.;
Captopril.TM.; Captoprilan.TM.; Captoril.TM.; Captral.TM.;
Cardipril.TM.; Cesplon.TM.; Cryopril.TM.; Debax.TM.; Dexacap.TM.;
Ecapres.TM.; Ecaten.TM.; Epicordin.TM.; Epsitron.TM.;
Farcopril.TM.; Farmoten.TM.; Hiperil.TM.; Hypotensor.TM.;
Inhibace.TM.; Isopresol.TM.; Katopil.TM.; Lopirin.TM.; Lopril.TM.;
Medepres.TM.; Mereprine.TM.; Minitent.TM.; Praten.TM.;
Precaptil.TM.; Rilcapton.TM.; Ropril.TM.; Smarten.TM.;
Tensicap.TM.; Tensiomen.TM.; Tensobon.TM.; Tenzib.TM.; and
Zorkaptil.TM.. In still other embodiments, compositions of the
invention are administered in combination with one or more of the
following: a biguanide antidiabetic agent, a glitazone antidiabetic
agent, and a sulfonylurea antidiabetic agent.
[0337] In other embodiments, antibody compositions of the invention
may be administered in combination with anti-opportunistic
infection agents. Anti-opportunistic agents that may be
administered in combination with the albumin fusion proteins and/or
polynucleotides of the invention, include, but are not limited to,
TRIMETHOPRIM-SULFAMETHOXAZOLE.TM., DAPSONE.TM., PENTAMIDINE.TM.,
ATOVAQUONE.TM., ISONIAZID.TM., RIFAMPIN.TM., PYRAZINAMIDE.TM.,
ETHAMBUTOL.TM., RIFABUTIN.TM., CLARITHROMYCIN.TM.,
AZITHROMYCIN.TM., GANCICLOVIR.TM., FOSCARNET.TM., CIDOFOVIR.TM.,
FLUCONAZOLE.TM., ITRACONAZOLE.TM., KETOCONAZOLE.TM., ACYCLOVIR.TM.,
FAMCICOLVIR.TM., PYRIMETHAMINE.TM., LEUCOVORIN.TM., NEUPOGEN.TM.
(filgrastim/G-CSF), and LEUKINE.TM. (sargramostim/GM-CSF).
[0338] In a specific embodiment, antibody and antibody compositions
of the invention are administered in combination with steroids,
cyclosporine, cyclosporine analogs, cyclophosphamide
methylprednisone, prednisone, azathioprine, FK-506,
15-deoxyspergualin, and other immunosuppressive agents that act by
suppressing the function of responding T cells. Other
immunosuppressive agents that may be administered in combination
with the compositions of the invention include, but are not limited
to, prednisolone, methotrexate, thalidomide, methoxsalen,
rapamycin, leflunomide, mizoribine (BREDININ.TM.), brequinar,
deoxyspergualin, and azaspirane (SKF 105685), ORTHOCLONE OKT.RTM. 3
(muromonab-CD3), SANDIMMUNE.TM., NEORAL.TM., SANGDYA.TM.
(cyclosporine), PROGRAF.RTM. (FK506, tacrolimus), CELLCEPT.RTM.
(mycophenolate motefil, of which the active metabolite is
mycophenolic acid), IMURAN.TM. (azathioprine),
glucocorticosteroids, adrenocortical steroids such as DELTASONE.TM.
(prednisone) and HYDELTRASOL.TM. (prednisolone), FOLEX.TM. and
MEXATE.TM. (methotrxate), OXSORALEN-ULTRA.TM. (methoxsalen) and
RAPAMUNE.TM. (sirolimus). In a specific embodiment,
immunosuppressants may be used to prevent rejection of organ or
bone marrow transplantation.
[0339] In an additional embodiment, the antibody and antibody
compositions of the invention are administered alone or in
combination with an anti-inflammatory agent. Anti-inflammatory
agents that may be administered with the antibody and antibody
compositions of the invention include, but are not limited to,
glucocorticoids and the nonsteroidal anti-inflammatories,
aminoarylcarboxylic acid derivatives, arylacetic acid derivatives,
arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic
acid derivatives, pyrazoles, pyrazolones, salicylic acid
derivatives, thiazinecarboxamides, e-acetamidocaproic acid,
S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrine,
bendazac, benzydamine, bucolome, difenpiramide, ditazol,
emorfazone, guaiazulene, nabumetone, nimesulide, orgotein,
oxaceprol, paranyline, perisoxal, pifoxime, proquazone, proxazole,
and tenidap.
Additional Combination Therapies
[0340] The antibodies of the invention (including molecules
comprising, or alternatively consisting of, antibody fragments or
variants thereof) may be administered alone or in combination with
other therapeutic or prophylactic regimens (e.g., radiation
therapy, chemotherapy, hormonal therapy, immunotherapy, anti-tumor
agents, anti-angiogenesis and anti-inflammatory agents). Such
combinatorial therapy may be administered sequentially and/or
concomitantly.
[0341] The invention also encompasses combining the polynucleotides
and/or antibodies of the invention with other proposed or
conventional diabetic therapies. Thus, for example, the
polynucleotides and/or antibodies of the invention can be combined
with compounds that singly exhibit insulin stimulatory effects, and
or glucose-transport action.
[0342] The antibodies and/or antibody compositions of the invention
and/or agonists or antagonists thereof is administered to the
patient by any suitable technique, including but not limited to,
parenteral, sublingual, topical, intrapulmonary and intranasal, and
those techniques further discussed herein.
[0343] In an additional embodiment, the antibody and antibody
compositions of the invention are administered alone or in
combination with an anti-angiogenic agent(s). Anti-angiogenic
agents that may be administered with the antibody and antibody
compositions of the invention include, but are not limited to,
Angiostatin (Entremed, Rockville, Md.), Troponin-1 (Boston Life
Sciences, Boston, Mass.), anti-Invasive Factor, retinoic acid and
derivatives thereof, paclitaxel (Taxol), Suramin, Tissue Inhibitor
of Metalloproteinase-1, Tissue Inhibitor of Metalloproteinase-2,
VEGI, Plasminogen Activator Inhibitor-1, Plasminogen Activator
Inhibitor-2, and various forms of the lighter "d group" transition
metals. Lighter "d group" transition metals include, for example,
vanadium, molybdenum, tungsten, titanium, niobium, and tantalum
species. Such transition metal species may form transition metal
complexes. Suitable complexes of the above-mentioned transition
metal species include oxo transition metal complexes.
[0344] Representative examples of vanadium complexes include oxo
vanadium complexes such as vanadate and vanadyl complexes. Suitable
vanadate complexes include metavanadate and orthovanadate complexes
such as, for example, ammonium metavanadate, sodium metavanadate,
and sodium orthovanadate. Suitable vanadyl complexes include, for
example, vanadyl acetylacetonate and vanadyl sulfate including
vanadyl sulfate hydrates such as vanadyl sulfate mono- and
trihydrates. Representative examples of tungsten and molybdenum
complexes also include oxo complexes. Suitable oxo tungsten
complexes include tungstate and tungsten oxide complexes. Suitable
tungstate complexes include ammonium tungstate, calcium tungstate,
sodium tungstate dihydrate, and tungstic acid. Suitable tungsten
oxides include tungsten (IV) oxide and tungsten (VI) oxide.
Suitable oxo molybdenum complexes include molybdate, molybdenum
oxide, and molybdenyl complexes. Suitable molybdate complexes
include ammonium molybdate and its hydrates, sodium molybdate and
its hydrates, and potassium molybdate and its hydrates. Suitable
molybdenum oxides include molybdenum (VI) oxide, molybdenum (VI)
oxide, and molybdic acid. Suitable molybdenyl complexes include,
for example, molybdenyl acetylacetonate. Other suitable tungsten
and molybdenum complexes include hydroxo derivatives derived from,
for example, glycerol, tartaric acid, and sugars.
[0345] A wide variety of other anti-angiogenic factors may also be
utilized within the context of the present invention.
Representative examples include, but are not limited to, platelet
factor 4; protamine sulphate; sulphated chitin derivatives
(prepared from queen crab shells), (Murata et al., Cancer Res.
51:22-26, 1991); Sulphated Polysaccharide Peptidoglycan Complex
(SP-PG) (the function of this compound may be enhanced by the
presence of steroids such as estrogen, and tamoxifen citrate);
Staurosporine; modulators of matrix metabolism, including for
example, proline analogs, cishydroxyproline, d,
L-3,4-dehydroproline, Thiaproline, alpha,alpha-dipyridyl,
aminopropionitrile fumarate;
4-propyl-5-(4-pyridinyl)-2(3H)-oxazolone; Methotrexate;
Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3
(Pavloff et al., J. Bio. Chem. 267:17321-17326, 1992); Chymostatin
(Tomkinson et al., Biochem J. 286:475-480, 1992); Cyclodextrin
Tetradecasulfate; Eponemycin; Camptothecin; Fumagillin (Ingber et
al., Nature 348:555-557, 1990); Gold Sodium Thiomalate ("GST";
Matsubara and Ziff, J. Clin. Invest. 79:1440-1446, 1987);
anticollagenase-serum; alpha2-antiplasmin (Holmes et al., J. Biol.
Chem. 262(4):1659-1664, 1987); Bisantrene (National Cancer
Institute); Lobenzarit disodium
(N-(2)-carboxyphenyl-4-chloroanthronilic acid disodium or "CCA";
(Takeuchi et al., Agents Actions 36:312-316, 1992); and
metalloproteinase inhibitors such as BB94.
[0346] Additional anti-angiogenic factors that may also be utilized
within the context of the present invention include Thalidomide,
(Celgene, Warren, N.J.); Angiostatic steroid; AGM-1470 (H. Brem and
J. Folkman J Pediatr. Surg. 28:445-51 (1993)); an integrin alpha v
beta 3 antagonist (C. Storgard et al., J Clin. Invest. 103:47-54
(1999)); carboxynaminolmidazole; Carboxyamidotriazole (CAI)
(National Cancer Institute, Bethesda, Md.); Conbretastatin A-4
(CA4P) (OXiGENE, Boston, Mass.); Squalamine (Magainin
Pharmaceuticals, Plymouth Meeting, Pa.); TNP-470, (Tap
Pharmaceuticals, Deerfield, Ill.); ZD-0101 AstraZeneca (London,
UK); APRA (CT2584); Benefin, Byrostatin-1 (SC359555); CGP-41251
(PKC 412); CM101; Dexrazoxane (ICRF187); DMXAA; Endostatin;
Flavopridiol; Genestein; GTE; ImmTher; Iressa (ZD1839); Octreotide
(Somatostatin); Panretin; Penacillamine; Photopoint; PI-88;
Prinomastat (AG-3540) Purlytin; Suradista (FCE26644); Tamoxifen
(Nolvadex); Tazarotene; Tetrathiomolybdate; Xeloda (Capecitabine);
and 5-Fluorouracil.
[0347] Anti-angiogenic agents that may be administered in
combination with the antibodies and/or the compositions of the
invention may work through a variety of mechanisms including, but
not limited to, inhibiting proteolysis of the extracellular matrix,
blocking the function of endothelial cell-extracellular matrix
adhesion molecules, by antagonizing the function of angiogenesis
inducers such as growth factors, and inhibiting integrin receptors
expressed on proliferating endothelial cells. Examples of
anti-angiogenic inhibitors that interfere with extracellular matrix
proteolysis and which may be administered in combination with the
antibody and antibody compositions of the invention include, but
are not limited to, AG-3540 (Agouron, La Jolla, Calif.),
BAY-12-9566 (Bayer, West Haven, Conn.), BMS-275291 (Bristol Myers
Squibb, Princeton, N.J.), CGS-27032A (Novartis, East Hanover,
N.J.), Marimastat (British Biotech, Oxford, UK), and Metastat
(Aetema, St-Foy, Quebec). Examples of anti-angiogenic inhibitors
that act by blocking the function of endothelial cell-extracellular
matrix adhesion molecules and which may be administered in
combination with the antibody and antibody compositions of the
invention include, but are not limited to, EMD-121974 (Merck KcgaA
Darmstadt, Germany) and Vitaxin (Ixsys, La Jolla, Calif./Medimmune,
Gaithersburg, Md.). Examples of anti-angiogenic agents that act by
directly antagonizing or inhibiting angiogenesis inducers and which
may be administered in combination with the antibody and antibody
compositions of the invention include, but are not limited to,
Angiozyme (Ribozyme, Boulder, Colo.), Anti-VEGF antibody
(Genentech, S. San Francisco, Calif.), PTK-787/ZK-225846 (Novartis,
Basel, Switzerland), SU-101 (Sugen, S. San Francisco, Calif.),
SU-5416 (Sugen/Pharmacia Upjohn, Bridgewater, N.J.), and SU-6668
(Sugen). Other anti-angiogenic agents act to indirectly inhibit
angiogenesis. Examples of indirect inhibitors of angiogenesis which
may be administered in combination with the antibody and antibody
compositions of the invention include, but are not limited to,
IM-862 (Cytran, Kirkland, Wash.), Interferon-alpha, IL-12 (Roche,
Nutley, N.J.), and Pentosan polysulfate (Georgetown University,
Washington, D.C.).
[0348] In a further embodiment, the antibody and antibody
compositions of the invention are administered in combination with
an antibiotic agent. Antibiotic agents that may be administered
with the antibody and antibody compositions of the invention
include, but are not limited to, amoxicillin, aminoglycosides,
beta-lactam (glycopeptide), beta-lactamases, Clindamycin,
chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin,
erythromycin, fluoroquinolones, macrolides, metronidazole,
penicillins, quinolones, rifampin, streptomycin, sulfonamide,
tetracyclines, trimethoprim, trimethoprim-sulfamthoxazole, and
vancomycin.
[0349] In a preferred embodiment, the antibody and antibody
compositions of the invention are administered in combination with
steroid therapy. Steroids that may be administered in combination
with the antibody and antibody compositions of the invention,
include, but are not limited to, oral corticosteroids, prednisone,
and methylprednisolone (e.g., IV methylprednisolone). In a specific
embodiment, antibody and antibody compositions of the invention are
administered in combination with prednisone.
[0350] The antibodies and antibody compositions of the invention
may be administered alone or in combination with other adjuvants.
Adjuvants that may be administered with the antibody and antibody
compositions of the invention include, but are not limited to,
alum, alum plus deoxycholate (ImmunoAg), MTP-PE (Biocine Corp.),
QS21 (Genentech, Inc.), BCG, and MPL. In a specific embodiment,
antibody and antibody compositions of the invention are
administered in combination with alum. In another specific
embodiment, antibody and antibody compositions of the invention are
administered in combination with QS-21. Further adjuvants that may
be administered with the antibody and antibody compositions of the
invention include, but are not limited to, Monophosphoryl lipid
immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, Aluminum
salts, MF-59, and Virosomal adjuvant technology. Vaccines that may
be administered with the antibody and antibody compositions of the
invention include, but are not limited to, vaccines directed toward
protection against MMR (measles, mumps, rubella), polio, varicella,
tetanus/diptheria, hepatitis A, hepatitis B, haemophilus influenzae
B, whooping cough, pneumonia, influenza, Lyme's Disease, rotavirus,
cholera, yellow fever, Japanese encephalitis, poliomyelitis,
rabies, typhoid fever, and pertussis, and/or PNEUMOVAX-23.TM..
Combinations may be administered either concomitantly, e.g., as an
admixture, separately but simultaneously or concurrently; or
sequentially. This includes presentations in which the combined
agents are administered together as a therapeutic mixture, and also
procedures in which the combined agents are administered separately
but simultaneously, e.g., as through separate intravenous lines
into the same individual. Administration "in combination" further
includes the separate administration of one of the compounds or
agents given first, followed by the second.
[0351] In another specific embodiment, antibody and antibody
compositions of the invention are used in combination with
PNEUMOVAX-23.TM. to treat, prevent, and/or diagnose infection
and/or any disease, disorder, and/or condition associated
therewith. In one embodiment, antibody and antibody compositions of
the invention are used in combination with PNEUMOVAX-23.TM. to
treat, prevent, and/or diagnose any Gram positive bacterial
infection and/or any disease, disorder, and/or condition associated
therewith. In another embodiment, antibody and antibody
compositions of the invention are used in combination with
PNEUMOVAX-23.TM. to treat, prevent, and/or diagnose infection
and/or any disease, disorder, and/or condition associated with one
or more members of the genus Enterococcus and/or the genus
Streptococcus. In another embodiment, antibody and antibody
compositions of the invention are used in any combination with
PNEUMOVAX-23.TM. to treat, prevent, and/or diagnose infection
and/or any disease, disorder, and/or condition associated with one
or more members of the Group B streptococci. In another embodiment,
antibody and antibody compositions of the invention are used in
combination with PNEUMOVAX-23.TM. to treat, prevent, and/or
diagnose infection and/or any disease, disorder, and/or condition
associated with Streptococcus pneumoniae.
[0352] In a preferred embodiment, the antibody and antibody
compositions of the invention are administered in combination with
CD40 ligand (CD40L), a soluble form of CD40L (e.g., AVREND.TM.),
bioloigically active fragments, variants, or derivatives of CD40L,
anti-CD40L antibodies (e.g., agonistic or antagonistic antibodies),
and/or anti-CD40 antibodies (e.g., agonistic or antagonistic
antibodies).
[0353] In a nonexclusive embodiment, the antibody and antibody
compositions of the invention are administered in combination with
one, two, three, four, five, ten, or more of the following drugs:
NRD-101 (Hoechst Marion Roussel), diclofenac (Dimethaid), oxaprozin
potassium (Monsanto), mecasermin (Chiron), T-714 (Toyama),
pemetrexed disodium (Eli Lilly), atreleuton (Abbott), valdecoxib
(Monsanto), eltenac (Byk Gulden), campath, AGM-1470 (Takeda),
CDP-571 (Celltech Chiroscience), CM-101 (CarboMed), ML-3000
(Merckle), CB-2431 (KS Biomedix), CBF-BS2 (KS Biomedix), IL-1Ra
gene therapy (Valentis), JTE-522 (Japan Tobacco), paclitaxel
(Angiotech), DW-166HC (Dong Wha), darbufelone mesylate
(Warner-Lambert), soluble TNF receptor 1 (synergen; Amgen),
IPR-6001 (Institute for Pharmaceutical Research), trocade
(Hoffman-La Roche), EF-5 (Scotia Pharmaceuticals), BIIL-284
(Boehringer Ingelheim), BIIF-1149 (Boehringer Ingelheim), LeukoVax
(Inflammatics), MK-671 (Merck), ST-1482 (Sigma-Tau), and butixocort
propionate (WarnerLambert).
[0354] In a preferred embodiment, the antibody and antibody
compositions of the invention are administered in combination with
one, two, three, four, five or more of the following drugs:
methotrexate, sulfasalazine, sodium aurothiomalate, auranofin,
cyclosporine, penicillamine, azathioprine, an antimalarial drug,
cyclophosphamide, chlorambucil, gold, ENBREL.TM. (Etanercept),
anti-TNF antibody, LJP 394 (La Jolla Pharmaceutical Company, San
Diego, Calif.) and prednisolone.
[0355] In an additional embodiment, antibody and antibody
compositions of the invention are administered alone or in
combination with one or more intravenous immune globulin
preparations. Intravenous immune globulin preparations that may be
administered with the antibody and antibody compositions of the
invention include, but not limited to, GAMMAR.TM., IVEEGAM.TM.,
SANDOGLOBULIN.TM., GAMMAGARD S/D.TM., and GAMIMUNE.TM.. In a
specific embodiment, antibody and antibody compositions of the
invention are administered in combination with intravenous immune
globulin preparations in transplantation therapy (e.g., bone marrow
transplant).
[0356] In an additional embodiment, the antibody and antibody
compositions of the invention are administered in combination with
other polypeptides, polynucleotides or antibodies used to treat
diagnose or ameliorate diabetes, including, but not limited to RELM
and/or other FIZZ family polpeptides, Apo-lipoprotein, Insulin,
Interferon Alpha, M-CSF, Platelet factor 4, IL-2, Resistin, AC2
Inhibitor, Leptin, IL-1 Receptor Agonist, HLDOU18, HCE-IP80, GLP-1,
ABC1, Adiposin, CNTF, CTLA4, Decorin, GGF-2, Glucagon, IL-10,
IL2-Diptheria Toxin Chimera, IL-4, Microsomal Transfer Protein,
NGF, NT-3, PAF acetyl hydrolase, PDGF, Prosaptide, TGF Beta 2,
Troponin 1, Lp-PLA2, Fas, FasL, TR6, HNHFE71, HLWCF05,
Preproapolipoprotein, BMP-1, BMP-2B, BMP-4, BMP-5, BMP-6,
Osteogenic protein-2, GDF-1, BMP-9, BMP-10, BMP-12, BMP-15, BMP-17,
BMP-18, APM-1, ACRP-30, Calpain 10a, Calpain-10b, Calpain-10c, and
VEGF-1.
Demonstration of Therapeutic or Prophylactic Utility of a
Composition
[0357] The compounds of the invention are preferably tested in
vitro, and then in vivo for the desired therapeutic or prophylactic
activity, prior to use in humans. For example, in vitro assays
which can be used to determine whether administration of a specific
antibody or composition of the present invention is indicated,
include in vitro cell culture assays in which a patient tissue
sample is grown in culture, and exposed to or otherwise
administered an antibody or composition of the present invention,
and the effect of such an antibody or composition of the present
invention upon the tissue sample is observed. In various specific
embodiments, in vitro assays can be carried out with representative
cells of cell types involved in a patient's disorder, to determine
if an antibody or composition of the present invention has a
desired effect upon such cell types. Preferably, the antibodies or
compositions of the invention are also tested in in vitro assays
and animal model systems prior to administration to humans (See,
e.g., Examples 6 and 9).
[0358] Antibodies or compositions of the present invention for use
in therapy can be tested for their toxicity in suitable animal
model systems, including but not limited to rats, mice, chicken,
cows, monkeys, and rabbits. For in vivo testing of an antibody or
composition's toxicity any animal model system known in the art may
be used.
[0359] Antibodies or compositions of the invention can be tested
for their ability to reduce tumor formation in in vitro, ex vivo
and in vivo assays. Antibodies or compositions of the invention can
also be tested for their ability to inhibit viral replication or
reduce viral load in in vitro and in vivo assays. Antibodies or
compositions of the invention can also be tested for their ability
to reduce bacterial numbers in in vitro and in vivo assays known to
those of skill in the art. Antibodies or compositions of the
invention can also be tested for their ability to alleviate of one
or more symptoms associated with diabetes (e.g., insulin
resistance). Antibodies or compositions of the invention can also
be tested for their ability to decrease the time course of the
infectious disease. Further, antibodies or compositions of the
invention can be tested for their ability to increase the survival
period of animals suffering from disease or disorder, including
cancer, an immune disorder or an infectious disease. Techniques
known to those of skill in the art can be used to analyze the
function of the antibodies or compositions of the invention in
vivo.
[0360] Antigen expression can be assayed, for example, by
immunoassays including, but not limited to, competitive and
non-competitive assay systems using techniques such as western
blots, immunohistochemistry radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoprecipitation
assays, precipitin reactions, gel diffusion precipitin reactions,
immunodiffusion assays, agglutination assays, complement-fixation
assays, immunoradiometric assays, fluorescent immunoassays, protein
A immunoassays and FACS analysis. The activation of signaling
molecules can be assayed, for example, by kinase assays and
electrophoretic shift assays (EMSAs). In a preferred embodiment,
the ability of an antibody or composition of the invention to
induce B-cell proliferation is measured. In another preferred
embodiment, the ability of an antibody or composition of the
invention to modulate immunoglobulin expression is measured.
Panels/Mixtures
[0361] The present invention also provides for mixtures of
antibodies (including scFvs and other molecules comprising, or
alternatively consisting of, antibody fragments or variants
thereof) that specifically bind to GMAD or a fragment or variant
thereof, wherein the mixture has at least one, two, three, four,
five or more different antibodies of the invention. In specific
embodiments, the invention provides mixtures of at least 2,
preferably at least 4, at least 6, at least 8, at least 10, at
least 12, at least 15, at least 20, or at least 25 different
antibodies that specifically bind to GMAD or fragments or variants
thereof, wherein at least 1, at least 2, at least 4, at least 6, or
at least 10, antibodies of the mixture is an antibody of the
invention. In a specific embodiment, each antibody of the mixture
is an antibody of the invention.
[0362] The present invention also provides for panels of antibodies
(including scFvs and other molecules comprising, or alternatively
consisting of, antibody fragments or variants thereof) that
specifically bind to GMAD or a fragment or variant thereof, wherein
the panel has at least one, two, three, four, five or more
different antibodies of the invention. In specific embodiments, the
invention provides for panels of antibodies that have different
affinities for GMAD, different specificities for GMAD, or different
dissociation rates. The invention provides panels of at least 10,
preferably at least 25, at least 50, at least 75, at least 100, at
least 125, at least 150, at least 175, at least 200, at least 250,
at least 300, at least 350, at least 400, at least 450, at least
500, at least 550, at least 600, at least 650, at least 700, at
least 750, at least 800, at least 850, at least 900, at least 950,
or at least 1000, antibodies. Panels of antibodies can be used, for
example, in 96 well plates for assays such as ELISAs.
[0363] The present invention further provides for compositions
comprising, one or more antibodies (including molecules comprising,
or alternatively consisting of, antibody fragments or variants of
the invention). In one embodiment, a composition of the present
invention comprises, one, two, three, four, five, or more
antibodies that comprise or alternatively consist of, a polypeptide
having an amino acid sequence of any one or more of the VH domains
of a heavy chain of one or more of the scFvs referred to in Table
1, or a variant thereof. In another embodiment, a composition of
the present invention comprises, one, two, three, four, five, or
more antibodies that comprise, or alternatively consist of, a
polypeptide having an amino acid sequence of any one or more of the
VH CDR1s of a heavy chain of one or more of the scFvs referred to
in Table 1, or a variant thereof. In another embodiment, a
composition of the present invention comprises, one, two, three,
four, five or more antibodies that comprise, or alternatively
consist of, a polypeptide having an amino acid sequence of any one
or more of the VH CDR2s of a heavy chain of of one or more of the
scFvs referred to in Table 1, or a variant thereof. In a preferred
embodiment, a composition of the present invention comprises, one,
two, three, four, five, or more antibodies that comprise, or
alternatively consist of, a polypeptide having an amino acid
sequence of any one or more of the VH CDR3s as of a heavy chain of
of one or more of the scFvs referred to in Table 1, or a variant
thereof.
[0364] Other embodiments of the present invention providing for
compositions comprising, one or more antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants of the invention) are listed below. In
another embodiment, a composition of the present invention
comprises, one, two, three, four, five, or more antibodies that
comprise, or alternative consist of, a polypeptide having an amino
acid sequence of any one or more of the VL domains of a light chain
of one or more of the scFvs referred to in Table 1, or a variant
thereof. In another embodiment, a composition of the present
invention comprises, one, two, three, four, five, or more
antibodies that comprise, or alternatively consist of, a
polypeptide having an amino acid sequence of any one or more of the
VL CDR1s domains of a light chain of one or more of the scFvs
referred to in Table 1, or a variant thereof. In another
embodiment, a composition of the present invention comprises, one,
two, three, four, five, or more antibodies that comprise, or
alternatively consist of, a polypeptide having an amino acid
sequence of any one or more of the VL CDR2s of a light chain of one
or more of the scFvs referred to in Table 1, or a variant thereof.
In a preferred embodiment, a composition of the present invention
comprises, one, two, three, four, five, or more antibodies that
comprise, or alternatively consist of, a polypeptide having an
amino acid sequence of any one or more of the VL CDR3s domains of a
light chain of one or more of the scFvs referred to in Table 1, or
a variant thereof.
Kits
[0365] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Optionally associated with such container(s) can be a notice in the
form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products,
which notice reflects approval by the agency of manufacture, use or
sale for human administration.
[0366] The present invention provides kits that can be used in the
above methods. In one embodiment, a kit comprises an antibody of
the invention, preferably a purified antibody, in one or more
containers. In an alterative embodiment, a kit comprises an
antibody fragment that specifically binds to GMAD polypeptides or
fragments or variants thereof. In a specific embodiment, the kits
of the present invention contain a substantially isolated GMAD
polypeptide or fragment or variant thereof as a control.
Preferably, the kits of the present invention further comprise a
control antibody which does not react with any, some or all GMAD.
In another specific embodiment, the kits of the present invention
contain a means for detecting the binding of an antibody to GMAD
polypeptides (e.g., the antibody may be conjugated to a detectable
substrate such as a fluorescent compound, an enzymatic substrate, a
radioactive compound or a luminescent compound, or a second
antibody which recognizes the first antibody may be conjugated to a
detectable substrate). In specific embodiments, the kit may include
a recombinantly produced or chemically synthesized GMAD. The GMAD
provided in the kit may also be attached to a solid support. In a
more specific embodiment the detecting means of the above-described
kit includes a solid support to which GMAD is attached. Such a kit
may also include a non-attached reporter-labeled anti-human
antibody. In this embodiment, binding of the antibody to GMAD can
be detected by binding of the said reporter-labeled antibody.
[0367] In an additional embodiment, the invention includes a
diagnostic kit for use in screening serum containing antigens of
the polypeptide of the invention. The diagnostic kit includes a
substantially isolated antibody specifically immunoreactive with
GMAD, and means for detecting the binding of GMAD polypeptides to
the antibody. In one embodiment, the antibody is attached to a
solid support. In a specific embodiment, the antibody may be a
monoclonal antibody. The detecting means of the kit may include a
second, labeled monoclonal antibody. Alternatively, or in addition,
the detecting means may include a labeled, competing antigen.
[0368] In one diagnostic configuration, test serum is reacted with
a solid phase reagent having surface-bound GMAD obtained by the
methods of the present invention. After GMAD polypeptides bind to a
specific antibody, the unbound serum components are removed by
washing, reporter-labeled anti-human antibody is added, unbound
anti-human antibody is removed by washing, and a reagent is reacted
with reporter-labeled anti-human antibody to bind reporter to the
reagent in proportion to the amount of bound anti-GMAD antibody on
the solid support. Typically, the reporter is an enzyme which is
detected by incubating the solid phase in the presence of a
suitable fluorometric, luminescent or colorimetric substrate.
[0369] The solid surface reagent in the above assay is prepared by
known techniques for attaching protein material to solid support
material, such as polymeric beads, dip sticks, 96-well plate or
filter material. These attachment methods generally include
non-specific adsorption of the protein to the support or covalent
attachment of the protein, typically through a free amine group, to
a chemically reactive group on the solid support, such as an
activated carboxyl, hydroxyl, or aldehyde group. Alternatively,
streptavidin coated plates can be used in conjunction with
biotinylated antigen(s).
[0370] Thus, the invention provides an assay system or kit for
carrying out this diagnostic method. The kit generally includes a
support with surface-bound recombinant GMAD, and a reporter-labeled
anti-human antibody for detecting surface-bound anti-GMAD
antibody.
Gene Therapy
[0371] In a specific embodiment, nucleic acids comprising sequences
encoding antibodies or functional derivatives thereof, are
administered to treat, inhibit or prevent a disease or disorder
associated with aberrant expression and/or activity of GMAD and/or
its receptors, by way of gene therapy. Gene therapy refers to
therapy performed by the administration to a subject of an
expressed or expressible nucleic acid. In this embodiment of the
invention, the nucleic acids produce their encoded protein that
mediates a therapeutic effect.
[0372] Any of the methods for gene therapy available in the art can
be used according to the present invention. Exemplary methods are
described below.
[0373] For general reviews of the methods of gene therapy, see
Goldspiel et al., Clinical Pharmacy 12:488-505 (1993); Wu and Wu,
Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol.
Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993);
and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May,
TIBTECH 1 1(5):155-215 (1993). Methods commonly known in the art of
recombinant DNA technology which can be used are described in
Ausubel et al. (eds.), Current Protocols in Molecular Biology, John
Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and
Expression, A Laboratory Manual, Stockton Press, NY (1990).
[0374] In a preferred aspect, a composition of the invention
comprises, or alternatively consists of, nucleic acids encoding an
antibody, said nucleic acids being part of an expression vector
that expresses the antibody or fragments or chimeric proteins or
heavy or light chains thereof in a suitable host. In particular,
such nucleic acids have promoters, preferably heterologous
promoters, operably linked to the antibody coding region, said
promoter being inducible or constitutive, and, optionally,
tissue-specific. In another particular embodiment, nucleic acid
molecules are used in which the antibody coding sequences and any
other desired sequences are flanked by regions that promote
homologous recombination at a desired site in the genome, thus
providing for intrachromosomal expression of the antibody encoding
nucleic acids (Koller and Smithies, Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438 (1989). In
specific embodiments, the expressed antibody molecule is an scFv;
alternatively, the nucleic acid sequences include sequences
encoding both the heavy and light chains, or fragments or variants
thereof, of an antibody.
[0375] Delivery of the nucleic acids into a patient may be either
direct, in which case the patient is directly exposed to the
nucleic acid or nucleic acid-carrying vectors, or indirect, in
which case, cells are first transformed with the nucleic acids in
vitro, then transplanted into the patient. These two approaches are
known, respectively, as in vivo or ex vivo gene therapy.
[0376] In a specific embodiment, the nucleic acid sequences are
directly administered in vivo, where it is expressed to produce the
encoded product. This can be accomplished by any of numerous
methods known in the art, e.g., by constructing them as part of an
appropriate nucleic acid expression vector and administering it so
that they become intracellular, e.g., by infection using defective
or attenuated retrovirals or other viral vectors (see U.S. Pat. No.
4,980,286), or by direct injection of naked DNA, or by use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or
coating with lipids or cell-surface receptors or transfecting
agents, encapsulation in liposomes, microparticles, or
microcapsules, or by administering them in linkage to a peptide
which is known to enter the nucleus, by administering it in linkage
to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu
and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to
target cell types specifically expressing the receptors), etc. In
another embodiment, nucleic acid-ligand complexes can be formed in
which the ligand comprises a fusogenic viral peptide to disrupt
endosomes, allowing the nucleic acid to avoid lysosomal
degradation. In yet another embodiment, the nucleic acid can be
targeted in vivo for cell specific uptake and expression, by
targeting a specific receptor (see, e.g., PCT Publications WO 92/06
180; WO 92/22715; W092/203 16; W093/14188, WO 93/20221).
Alternatively, the nucleic acid can be introduced intracellularly
and incorporated within host cell DNA for expression, by homologous
recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA
86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438
(1989)).
[0377] In a specific embodiment, viral vectors that contains
nucleic acid sequences encoding an antibody of the invention or
fragments or variants thereof are used. For example, a retroviral
vector can be used (see Miller et al., Meth. Enzymol. 217:581-599
(1993)). These retroviral vectors contain the components necessary
for the correct packaging of the viral genome and integration into
the host cell DNA. The nucleic acid sequences encoding the antibody
to be used in gene therapy are cloned into one or more vectors,
which facilitates delivery of the gene into a patient. More detail
about retroviral vectors can be found in Boesen et al., Biotherapy
6:29 1-302 (1994), which describes the use of a retroviral vector
to deliver the mdr 1 gene to hematopoietic stem cells in order to
make the stem cells more resistant to chemotherapy. Other
references illustrating the use of retroviral vectors in gene
therapy are: Clowes et al., J. Clin. Invest. 93:644-651(1994);
Klein e al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human
Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin.
in Genetics and Devel. 3:110-114 (1993).
[0378] Adenoviruses are other viral vectors that can be used in
gene therapy. Adenoviruses are especially attractive vehicles for
delivering genes to respiratory epithelia. Adenoviruses naturally
infect respiratory epithelia where they cause a mild disease. Other
targets for adenovirus-based delivery systems are liver, the
central nervous system, endothelial cells, and muscle. Adenoviruses
have the advantage of being capable of infecting non-dividing
cells. Kozarsky and Wilson, Current Opinion in Genetics and
Development 3:499-503 (1993) present a review of adenovirus-based
gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994)
demonstrated the use of adenovirus vectors to transfer genes to the
respiratory epithelia of rhesus monkeys. Other instances of the use
of adenoviruses in gene therapy can be found in Rosenfeld et al.,
Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155
(1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT
Publication W094/12649; and Wang, et al., Gene Therapy 2:775-783
(1995). In a preferred embodiment, adenovirus vectors are used.
[0379] Adeno-associated virus (AAV) has also been proposed for use
in gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med.
204:289-300 (1993); U.S. Pat. No. 5,436,146).
[0380] Another approach to gene therapy involves transferring a
gene to cells in tissue culture by such methods as electroporation,
lipofection, calcium phosphate mediated transfection, or viral
infection. Usually, the method of transfer includes the transfer of
a selectable marker to the cells. The cells are then placed under
selection to isolate those cells that have taken up and are
expressing the transferred gene. Those cells are then delivered to
a patient.
[0381] In this embodiment, the nucleic acid is introduced into a
cell prior to administration in vivo of the resulting recombinant
cell. Such introduction can be carried out by any method known in
the art, including but not limited to transfection,
electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell
fusion, chromosome-mediated gene transfer, microcell-mediated gene
transfer, spheroplast fusion, etc. Numerous techniques are known in
the art for the introduction of foreign genes into cells (see,
e.g., Loeffler and Behr, Meth. Enzymol. 217:599-718 (1993); Cohen
et al., Meth. Enzymol. 217:718-644 (1993); Clin. Pharma. Ther.
29:69-92m (1985)) and may be used in accordance with the present
invention, provided that the necessary developmental and
physiological functions of the recipient cells are not disrupted.
The technique should provide for the stable transfer of the nucleic
acid to the cell, so that the nucleic acid is expressible by the
cell and preferably heritable and expressible by its cell
progeny.
[0382] The resulting recombinant cells can be delivered to a
patient by various methods known in the art. Recombinant blood
cells (e.g., hematopoietic stem or progenitor cells) are preferably
administered intravenously. The amount of cells envisioned for use
depends on the desired effect, patient state, etc., and can be
determined by one skilled in the art.
[0383] Cells into which a nucleic acid can be introduced for
purposes of gene therapy encompass any desired, available cell
type, and include but are not limited to epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells,
hepatocytes; blood cells such as T lymphocytes, B lymphocytes,
monocytes, macrophages, neutrophils, eosinophils, megakaryocytes,
granulocytes; various stem or progenitor cells, in particular
hematopoietic stem or progenitor cells, e.g., as obtained from bone
marrow, umbilical cord blood, peripheral blood, fetal liver,
etc.
[0384] In a preferred embodiment, the cell used for gene therapy is
autologous to the patient.
[0385] In an embodiment in which recombinant cells are used in gene
therapy, nucleic acid sequences encoding an antibody or fragment
thereof are introduced into the cells such that they are
expressible by the cells or their progeny, and the recombinant
cells are then administered in vivo for therapeutic effect. In a
specific embodiment, stem or progenitor cells are used. Any stem
and/or progenitor cells which can be isolated and maintained in
vitro can potentially be used in accordance with this embodiment of
the present invention (see e.g. PCT Publication WO 94/08598;
Stemple and Anderson, Cell 7 1:973-985 (1992); Rheinwald, Meth.
Cell Bio. 21A:229 (1980); and Pittelkow and Scott, Mayo Clinic
Proc. 71:771 (1986)).
[0386] In a specific embodiment, the nucleic acid to be introduced
for purposes of gene therapy comprises an inducible promoter
operably linked to the coding region, such that expression of the
nucleic acid is controllable by controlling the presence or absence
of the appropriate inducer of transcription.
Examples
Example 1
Isolation of scFvs that Specifically Bind GMAD
General Methods
[0387] Rescue of the Library.
[0388] A library of scFvs is constructed from the RNA of human PBLs
as described in WO92/01047 (which is hereby incorporated by
reference in its entirety). To rescue phage displaying antibody
fragments, approximately 10.sup.9 E. coli harboring the phagemid
are used to inoculate 50 ml of 2.times.TY containing 1% glucose and
100 micrograms/ml of ampicillin (2.times.TY-AMP-GLU) and grown to
an O.D. of 0.8 with shaking. Five ml of this culture is used to
inoculate 50 ml of 2.times.TY-AMP-GLU, 2.times.10.sup.8 TU of delta
gene 3 helper (M13 delta gene III, see WO92/01047) are added and
the culture incubated at 37.degree. C. for 45 minutes without
shaking and then at 37.degree. C. for 45 minutes with shaking. The
culture is centrifuged at 4000 r.p.m. for 10 min. and the pellet
resuspended in 2 liters of 2.times.TY containing 100 micrograms/ml
ampicillin and 50 micrograms/ml kanamycin and grown overnight.
Phage are prepared as described in WO92/01047.
[0389] M13 delta gene HI is prepared as follows: M13 delta gene III
helper phage does not encode gene III protein, hence the phage(mid)
displaying antibody fragments have a greater avidity of binding to
antigen. Infectious M13 delta gene III particles are made by
growing the helper phage in cells harboring a pUC19 derivative
supplying the wild type gene III protein during phage
morphogenesis. The culture is incubated for 1 hour at 37.degree. C.
without shaking and then for a further hour at 37.degree. C. with
shaking. Cells were spun down (IEC-Centra 8, 4000 revs/min for 10
min), resuspended in 300 ml 2.times.TY broth containing 100
micrograms ampicillin/ml and 25 micrograms kanamycin/ml
(2.times.TY-AMP-KAN) and grown overnight, shaking at 37.degree. C.
Phage particles are purified and concentrated from the culture
medium by two PEG-precipitations (Sambrook et al., 1990),
resuspended in 2 ml PBS and passed through a 0.45 micrometer filter
(Minisart NML; Sartorius) to give a final concentration of
approximately 10.sup.13 transducing units/ml (ampicillin-resistant
clones).
[0390] Panning the Library.
[0391] Immunotubes (Nunc) are coated overnight in PBS with 4 ml of
either 100 micrograms/ml or 10 micrograms/ml of a polypeptide of
the present invention. Tubes are blocked with 2% Marvel-PBS for 2
hours at 37.degree. C. and then washed 3 times in PBS.
Approximately 10.sup.13 TU of phage is applied to the tube and
incubated for 30 minutes at room temperature tumbling on an over
and under turntable and then left to stand for another 1.5 hours.
Tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with
PBS. Phage are eluted by adding 1 ml of 100 mM triethylamine and
rotating 15 minutes on an under and over turntable after which the
solution is immediately neutralized with 0.5 ml of 1.0M Tris-HCl,
pH 7.4. Phage are then used to infect 10 ml of mid-log E. coli TG1
by incubating eluted phage with bacteria for 30 minutes at
37.degree. C. The E. coli are then plated on TYE plates containing
1% glucose and 100 micrograms/ml ampicillin. The resulting
bacterial library is then rescued with delta gene 3 helper phage as
described above to prepare phage for a subsequent round of
selection. This process is usually repeated for a total of 2-4
rounds of affinity purification.
[0392] Characterization of Binders.
[0393] Eluted phage from the final rounds of selection are used to
infect E. coli HB 2151 and soluble scFv is produced (Marks, et al.,
1991) from single colonies for assay. ELISAs are performed with
microtiter plates coated with either 10 picograms/ml of the
polypeptide of the present invention in 50 mM bicarbonate pH 9.6.
Clones positive in ELISA are further characterized by PCR
fingerprinting (see e.g., WO92/01047) and then by sequencing.
[0394] Isolation of scFvs referred to in Table 1
[0395] The scFvs presented in Table 1 were isolated using a methods
similar to those described above. Briefly, Flag-tagged recombinant
human GMAD was immobilized in Immuno tubes. Three phage display
libraries from Cambridge Antibody Technology (Cambridgeshire,
United Kingdom) were screened for GMAD binding scFvs. Prior to
panning the phage libraries on FLAG tagged GMAD, the phage
libraries were each incubated with Flag peptide (SEQ ID NO:39) for
deselection. Three rounds of selection for phage expressing scFv
that bind GMAD were performed by panning the phage libraries on
flag-tagged GMAD.
[0396] After the first and second round of panning, bound phages
were eluted and amplified in E. coli for the subsequent pannings.
After round two of panning, four 96-well plates of single bacterial
colonies (each infected with an scFv expressing phage particle)
were isolated and grown. Similarly, eight 96-well plates of single
bacterial colonies were isolated and grown up after round three of
panning. The scFvs contained in each of the bacterial colonies were
then sequenced. Certain of the scFvs had identical sequences, so a
panel of phage expressing unique scFv sequences was created and
further characterized.
[0397] The individual phage isolates in the panel of phage, each
phage expressing a unique scFv that bound to flag-tagged GMAD, were
tested to ensure specificity for GMAD using an ELISA assay. The
scFvs were tested in an ELISA for their ability to bind a
heterologous flag-tagged protein, in this case--immobilized soluble
TL3 (amino acids 105-251 of SEQ ID NO:234, GenBank Accesion Number
NP.sub.--003799, also described in International Patent Application
Publication Number WO97/33902 and WO2001/96528 which are herein
incorporated by reference in their entireties). ScFvs specific for
GMAD (i.e., that bind flag tagged GMAD but not flagged tagged TL-3
and/or flag-tagged TR2) in this ELISA assay were identified and
resequenced for confirmation. The scFvs that specifically bind GMAD
identified in this manner are listed in Table 1 and the sequences
of these scFvs are shown in SEQ ID NOS:40-136 (amino acid
sequences) and SEQ ID NOS: 136-233 (nucleotide sequences).
Example 2
Identification and Cloning of VH and VL Domains
[0398] One method to identify and clone VH and VL domains from cell
lines expressing a particular antibody is to perform PCR with VH
and VL specific primers on cDNA made from the antibody expressing
cell lines. Briefly, RNA is isolated from the cell lines and used
as a template for RT-PCR designed to amplify the VH and VL domains
of the antibodies of the EBV cell lines. Cells may lysed in the
TRIzol.RTM. reagent (Life Technologies, Rockville. Md.) and
extracted with one fifth volume of chloroform. After addition of
chloroform, the solution is allowed to incubate at room temperature
for 10 minutes, and the centrifuged at 14,000 rpm for 15 minutes at
4.degree. C. in a tabletop centrifuge. The supematant is collected
and RNA is precipitated using an equal volume of isopropanol.
Precipitated RNA is pelleted by centrifuging at 14,000 rpm for 15
minutes at 4.degree. C. in a tabletop centrifuge. Following
centrifugation, the supernatant is discarded and washed with 75%
ethanol. Follwing washing, the RNA is centrifuged again at 800 rpm
for 5 minutes at 4.degree. C. The supernatant is discarded and the
pellet allowed to air dry. RNA is the dissolved in DEPC water and
heated to 60.degree. C. for 10 minutes. Quantities of RNA can
determined using optical density measurements.
[0399] cDNA may be synthesized, according to methods well-known in
the art, from 1.5-2.5 micrograms of RNA using reverse transciptase
and random hexamer primers. cDNA is then used as a template for PCR
amplification of VH and VL domains. Primers used to amplify VH and
VL genes are shown in Table 8. Typically a PCR reaction makes use
of a single 5' primer and a single 3' primer. Sometimes, when the
amount of available RNA template is limiting, or for greater
efficiency, groups of 5' and/or 3' primers may be used. For
example, sometimes all five VH-5' primers and all JH3' primers are
used in a single PCR reaction. The PCR reaction is carried out in a
50 microliter volume containing 1.times.PCR buffer, 2 mM of each
dNTP, 0.7 units of High Fidelity Taq polymerse, 5' primer mix, 3'
primer mix and 7.5 microliters of cDNA. The 5' and 3' primer mix of
both VH and VL can be made by pooling together 22 pmole and 28
pmole, respectively, of each of the individual primers. PCR
conditions are: 96.degree. C. for 5 minutes; followed by 25 cycles
of 94.degree. C. for 1 minute, 50.degree. C. for 1 minute, and
72.degree. C. for 1 minute; followed by an extension cycle of
72.degree. C. for 10 minutes. After the reaction is completed,
sample tubes were stored 4.degree. C.
TABLE-US-00004 TABLE 6 Primer Sequences Used to Amplify VH and VL
domains. Primer name SEQ ID NO Primer Sequence (5'-3') VH Primers
Hu VH1-5' 3 CAGGTGCAGCTGGTGCAGTCTGG Hu VH2-5' 4
CAGGTCAACTTAAGGGAGTCTGG Hu VH3-5' 5 GAGGTGCAGCTGGTGGAGTCTGG Hu
VH4-5' 6 CAGGTGCAGCTGCAGGAGTCGGG Hu VH5-5' 7
GAGGTGCAGCTGTTGCAGTCTGC Hu VH6-5' 8 CAGGTACAGCTGCAGCAGTCAGG Hu
JH1,2-5' 9 TGAGGAGACGGTGACCAGGGTGCC Hu JH3-5' 10
TGAAGAGACGGTGACCATTGTCCC Hu JH4,5-5' 11 TGAGGAGACGGTGACCAGGGTTCC Hu
JH6-5' 12 TGAGGAGACGGTGACCGTGGTCCC VL Primers Hu Vkappa1-5' 13
GACATCCAGATGACCCAGTCTCC Hu Vkappa2a-5' 14 GATGTTGTGATGACTCAGTCTCC
Hu Vkappa2b-5' 15 GATATTGTGATGACTCAGTCTCC Hu Vkappa3-5' 16
GAAATTGTGTTGACGCAGTCTCC Hu Vkappa4-5' 17 GACATCGTGATGACCCAGTCTCC Hu
Vkappa5-5' 18 GAAACGACACTCACGCAGTCTCC Hu Vkappa6-5' 19
GAAATTGTGCTGACTCAGTCTCC Hu Vlambda1-5' 20 CAGTCTGTGTTGACGCAGCCGCC
Hu Vlambda2-5' 21 CAGTCTGCCCTGACTCAGCCTGC Hu Vlambda3-5' 22
TCCTATGTGCTGACTCAGCCACC Hu Vlambda3b-5' 23 TCTTCTGAGCTGACTCAGGACCC
Hu Vlambda4-5' 24 CACGTTATACTGACTCAACCGCC Hu Vlambda5-5' 25
CAGGCTGTGCTCACTCAGCCGTC Hu Vlambda6-5' 26 AATTTTATGCTGACTCAGCCCCA
Hu Jkappa1-3' 27 ACGTTTGATTTCCACCTTGGTCCC Hu Jkappa2-3' 28
ACGTTTGATCTCCAGCTTGGTCCC Hu Jkappa3-3' 29 ACGTTTGATATCCACTTTGGTCCC
Hu Jkappa4-3' 30 ACGTTTGATCTCCACCTTGGTCCC Hu Jkappa5-3' 31
ACGTTTAATCTCCAGTCGTGTCCC Hu Jlambda1-3' 32 CAGTCTGTGTTGACGCAGCCGCC
Hu Jlambda2-3' 33 CAGTCTGCCCTGACTCAGCCTGC Hu Jlambda3--3' 34
TCCTATGTGCTGACTCAGCCACC Hu Jlambda3b-3' 35 TCTTCTGAGCTGACTCAGGACCC
Hu Jlambda4-3' 36 CACGTTATACTGACTCAACCGCC Hu Jlambda5-3' 37
CAGGCTGTGCTCACTCAGCCGTC Hu Jlambda6-3' 38
AATTTTATGCTGACTCAGCCCCA
[0400] PCR samples are then electrophoresed on a 1.3% agarose gel.
DNA bands of the expected sizes (.about.506 base pairs for VH
domains, and 344 base pairs for VL domains) can be cut out of the
gel and purified using methods well known in the art. Purified PCR
products can be ligated into a PCR cloning vector (TA vector from
Invitrogen Inc., Carlsbad, Calif.). Individual cloned PCR products
can be isolated after transfection of E. coli and blue/white color
selection. Cloned PCR products may then be sequenced using methods
commonly known in the art.
Example 3
[.sup.3H]-2-Deoxyglucose Uptake Assay
[0401] Adipose, skeletal muscle, and liver are insulin-sensitive
tissues. Insulin can stimulate glucose uptake/transport into these
tissues. In the case of adipose and skeletal muscle, insulin
initiates the signal transduction that eventually leads to the
translocation of the glucose transporter 4 molecule, GLUT4, from a
specialized intracellular compartment to the cell surface. Once on
the cell surface, GLUT4 allows for glucose uptake/transport.
[0402] A number of adipose and muscle related cell-lines can be
used to test for glucose uptake/transport activity in the absence
or presence of a combination of any one or more of the therapeutic
drugs listed for the treatment of diabetes mellitus. In particular,
the 3T3-L1 murine fibroblast cells and the L6 murine skeletal
muscle cells can be differentiated into 3T3-L1 adipocytes and into
myotubes, respectively, to serve as appropriate in vitro models for
the [.sup.3H]-2-deoxyglucose uptake assay (Garcia de Herreros et
al., J. Biol. Chem. 264(33):19994-19999 (1989); Urso et al., J Biol
Chem, 274(43): 30864-73 (1999); Wang et al., J Mol Endocrinol,
19(3): 241-8 (1997); Haspel et al., J Membr Biol, 169 (1): 45-53
(1999); Tsakiridis et al., Endocrinology, 136(10): 4315-22
(1995)).
Differentiation of 3T3L-1
[0403] Murine 3T3-L1 fibroblast are induced to differentiate into
adipocytes according to the protocol described in Garcia de
Herreros et al., J. Biol. Chem. 264(33):19994-19999 (1989) which is
hereby incorporated by reference in its entirety. Alternatively,
human adipocytes can be purchased from Zen-Bio, INC (#SA-1096).
[.sup.3H]-2-Deoxyglucose Uptake
[0404] Briefly, 2.times.10.sup.5 cells/100 .mu.L of adipocytes or
differentiated 3T3-L1 cells are transferred to 96-well
Tissue-Culture, "TC", treated, i.e., coated with 50 microgramr/mL
of poly-L-lysine, plates in (DMEM+10% FBS) and are incubated
overnight at 37.degree. C. in 5% CO.sub.2. The cells are first
washed once with serum free low glucose DMEM medium and are then
placed into 100 microliter/well of the same serum free low glucose
DMEM medium containing anti-GMAD antibodies of the invention,
and/or fragments and variants thereof (e.g. 250 ng/ml, 500 ng/ml or
1 microgram/ml), for 16 hours at 37.degree. C. in the absence or
presence GMAD (e.g., 500 ng/microliter). The plates are then washed
three times with HEPES buffered saline. Insulin is added at 1-100
nM in HEPES buffered saline for 30 min at 37.degree. C. The cells
are again washed washed three times with HEPES buffered saline. 10
.mu.M labeled [.sup.3H]-2-deoxyglucose (Amersham, #TRK672) and 10
.mu.M unlabeled 2-deoxyglucose (SIGMA, D-3179) are added and
allowed to incubate at room temperature for 10 minutes. Next, the
cells are washed threes times in cold PBS. As controls, the same
conditions are carried out except in the absence of insulin or
GMAD. The cells are lysed upon the addition of 150 microliter/well
of 0.2 N NaOH and subsequent incubation with shaking for 20 minutes
at room temperature. Samples are then transferred to a
scintillation vial to which is added 5 mL of scintillation fluid.
The vials are counted in a Beta-Scintillation counter. Uptake in
duplicate conditions, the difference being the absence or presence
of insulin, is determined with the following equation: [(Insulin
counts per minute "cpm"-Non-Specific cpm)/(No Insulin
cp-Non-Specific cpm)]. Non-specific uptake was measured in the
presence of 10 micromolar cytochalasin B (SIGMA, C6762). Average
responses fall within the limits of about 5-fold and 3-fold that of
controls for adipocytes and myotubes, respectively.
Example 4
Assaying for Glycosuria
[0405] Glycosuria (i.e., excess sugar in the urine), can be readily
assayed to provide an index of the disease state of diabetes
mellitus. Excess sugar in the urine of a patient as compared with a
normal patient is symptomatic of IDDM and NIDDM. Efficacy of
treatment of such a patient having IDDM and NIDDM is indicated by a
resulting decrease in the amount of excess glucose in the urine. In
a preferred embodiment for IDDM and NIDDM monitoring, urine samples
from patients are assayed for the presence of glucose using
techniques known in the art. Glycosuria in humans is defined by a
urinary glucose concentration exceeding 100 mg per 100 ml. Excess
sugar levels in those patients exhibiting glycosuria can be
measured even more precisely by obtaining blood samples and
assaying serum glucose.
Example 5
Occurrence of Diabetes in NOD Mice
[0406] Female NOD (non-obese diabetic) mice are characterized by
displaying IDDM with a course which is similar to that found in
humans, although the disease is more pronounced in female than male
NOD mice. Hereinafter, unless otherwise stated, the term "NOD
mouse" refers to a female NOD mouse. NOD mice have a progressive
destruction of beta cells which is caused by a chronic autoimmune
disease. Thus, NOD mice begin life with euglycemia, or normal blood
glucose levels. By about 15 to 16 weeks of age, however, NOD mice
start becoming hyperglycemic, indicating the destruction of the
majority of their pancreatic beta cells and the corresponding
inability of the pancreas to produce sufficient insulin. Thus, both
the cause and the progression of the disease are similar to human
IDDM patients.
[0407] In vivo assays of efficacy of anti-GMAD antibody therapy can
be assessed in female NOD/LtJ mice (commercially available from The
Jackson Laboratory, Bar Harbor, Me.). In the literature, it's
reported that 80% of female mice develop diabetes by 24 weeks of
age and onset of insulitis begins between 6-8 weeks age. NOD mice
are inbred and highly responsive to a variety of immunoregulatory
strategies. Adult NOD mice (6-8 weeks of age) have an average mass
of 20-25 g.
[0408] These mice can be either untreated (control), treated with
the therapeutics of the subject invention (e.g., specific GMAD
antibodies and/or fragments and variants thereof), alone or in
combination with other therapeutic compounds stated above. The
effect of these various treatments on the progression of diabetes
can be measured as follows:
[0409] At 14 weeks of age, the female NOD mice can be phenotyped
according to glucose tolerance. Glucose tolerance can be measured
with the intraperitoneal glucose tolerance test (IPGTT). Briefly,
blood is drawn from the paraorbital plexus at 0 minutes and 60
minutes after the intraperitoneal injection of glucose (1 g/kg body
weight). Normal tolerance is defined as plasma glucose at 0 minutes
of less than 144 mg %, or at 60 minutes of less than 160 mg %.
Blood glucose levels are determined with a Glucometer Elite
apparatus.
[0410] Based upon this phenotypic analysis, animals can be
allocated to the different experimental groups. In particular,
animals with more elevated blood glucose levels can be assigned to
the impaired glucose tolerance group. The mice can be fed ad
libitum and can be supplied with acidified water (pH 2.3).
[0411] The glucose tolerant and intolerant mice can be further
subdivided into control, and treatment groups (e.g. with anti-GMAD
antibodies of the invention) in the presence or absence of other
anti-diabetic drugs. Mice in the control group can receive an
interperitoneal injection of vehicle daily, six times per week.
Mice in the treatment group can receive an interperitoneal
injection of the specific anti-GMAD antibodies and fragments and
variants thereof, in vehicle daily, six times per week.
[0412] The level of urine glucose in the NOD mice can be determined
on a bi-weekly basis using Labstix (Bayer Diagnostics, Hampshire,
England). Weight and fluid intake can also be determined on a
bi-weekly basis. The onset of diabetes is defined after the
appearance of glucosuria on two consecutive determinations. After
10 weeks of treatment, an additional IPGTT can be performed and
animals can be sacrificed the following day.
[0413] Over the 10 week course of treatment, control animals in
both the glucose tolerant and glucose intolerant groups develop
diabetes at a rate of 60% and 86%, respectively (see U.S. Pat. No.
5,866,546, Gross et al.). Thus, high rates of diabetes occur even
in NOD mice which are initially glucose tolerant if no intervention
is made.
[0414] Results can be confirmed by the measurement of blood glucose
levels in NOD mice, before and after treatment. Blood glucose
levels are measured as described above in both glucose tolerant and
intolerant mice in all groups described.
[0415] Additionally, the therapeutics of the subject invention
(e.g., specific GMAD antibodies and fragments and variants thereof)
can be quantified using spectrometric analysis and appropriate
protein quantities can be resuspended prior to injection in 50
microliter phosphate buffered saline (PBS) per dose. Two
injections, one week apart, can be administered subcutaneously
under the dorsal skin of each mouse. Monitoring can be performed on
two separate occasions prior to immunization and can be performed
weekly throughout the treatment and continued thereafter. Urine can
be tested for glucose every week (Keto-Diastix.RTM.; Miles Inc.,
Kankakee, Ill.) and glycosuric mice can be checked for serum
glucose (ExacTech.RTM., MediSense, Inc., Waltham, Mass.). Diabetes
is diagnosed when fasting glycemia is greater than 2.5 g/L.
Example 6
Histological Examination of NOD Mice
[0416] Histological examination of tissue samples from NOD mice can
demonstrate the ability of the compositions of the present
invention, and/or a combination of the compositions of the present
invention with other therapeutic agents for diabetes, to increase
the relative concentration of beta cells in the pancreas. The
experimental method is as follows:
[0417] The mice from Example 6 can be sacrificed at the end of the
treatment period and tissue samples can be taken from the pancreas.
The samples can be fixed in 10% formalin in 0.9% saline and
embedded in wax. Two sets of 5 serial 5 micron sections can be cut
for immunolabelling at a cutting interval of 150 microns. Sections
can be immunolabelled for insulin (guinea pig anti-insulin antisera
dilution 1:1000, ICN Thames U.K.) and glucagon (rabbit
anti-pancreatic glucagon antisera dilution 1:2000) and detected
with peroxidase conjugated anti-guinea pig (Dako, High Wycombe,
U.K.) or peroxidase conjugated anti-rabbit antisera (dilution 1:50,
Dako).
[0418] The composition of the present invention may or may not have
as strong an effect on the visible mass of beta cells as it does on
the clinical manifestations of diabetes in glucose tolerant and
glucose intolerant animals.
Example 7
In vivo Mouse Model of NIDDM
[0419] Male C57BL/6J mice from Jackson Laboratory (Bar Harbor, Me.)
can be obtained at 3 weeks of age and fed on conventional chow or
diets enriched in either fat (35.5% wt/wt; Bioserv.Frenchtown,
N.J.) or fructose (60% wt/wt; Harlan Teklad, Madison, Wis.). The
regular chow is composed of 4.5% wt/wt fat, 23% wt/wt protein,
31.9% wt/wt starch, 3.7% wt/wt fructose, and 5.3% wt/wt fiber. The
high-fat (lard) diet is composed of 35.5% wt/wt fat, 20% wt/wt
protein, 36.4% wt/wt starch, 0.0% wt/wt fructose, and 0.1% wt/wt
fiber. The high-fructose diet is composed of 5% wt/wt fat, 20%
wt/wt protein, 0.0% wt/wt starch, 60% wt/wt fructose, and 9.4%
wt/wt fiber. The mice may be housed no more than five per cage at
22.degree.+/-3.degree. C. temperature- and 50%+/-20%
humidity-controlled room with a 12-hour light (6 am to 6 pm)/dark
cycle (Luo et al., Metabolism 47(6): 663-8 (1998), "Nongenetic
mouse models of non-insulin-dependent diabetes mellitus"; Larsen et
al., Diabetes 50(11): 2530-9 (2001), "Systemic administration of
the long-acting GLP-1 derivative NN2211 induces lasting and
reversible weight loss in both normal and obese rats"). After
exposure to the respective diets for 3 weeks, mice can be injected
intraperitoneally with either streptozotocin, "STZ" (Sigma, St.
Louis, Mo.), at 100 mg/kg body weight or vehicle (0.05 mol/L citric
acid, pH 4.5) and kept on the same diet for the next 4 weeks. Under
nonfasting conditions, blood is obtained 1, 2, and 4 weeks post-STZ
by nipping the distal part of the tail. Samples are used to measure
nonfasting plasma glucose and insulin concentrations. Body weight
and food intake are recorded weekly.
[0420] To directly determine the effect of the high-fat diet on the
ability of insulin to stimulate glucose disposal, the experiments
can be initiated on three groups of mice, fat-fed, chow-fed
injected with vehicle, and fat-fed injected with STZ at the end of
the 7-week period described above. Mice can be fasted for 4 hours
before the experiments. In the first series of experiments, mice
can be anesthetized with methoxyflurane (Pitman-Moor, Mundelein,
Ill.) inhalation. Regular insulin (Sigma) can be injected
intravenously ([IV] 0.1 U/kg body weight) through a tail vein, and
blood can be collected 3, 6, 9, 12, and 15 minutes after the
injection from a different tail vein. Plasma glucose concentrations
can be determined on these samples, and the half-life (t1/2) of
glucose disappearance from plasma can be calculated using WinNonlin
(Scientific Consulting, Apex, N.C.), a
pharmacokinetics/pharmacodynamics software program.
[0421] In the second series of experiments, mice can be
anesthetized with intraperitoneal sodium pentobarbital (Sigma). The
abdominal cavity is opened, and the main abdominal vein is exposed
and catheterized with a 24-gauge IV catheter (Johnson-Johnson
Medical, Arlington, Tex.). The catheter is secured to muscle tissue
adjacent to the abdominal vein, cut on the bottom of the syringe
connection, and hooked to a prefilled PE50 plastic tube, which in
turn is connected to a syringe with infusion solution. The
abdominal cavity is then sutured closed. With this approach, there
would be no blockage of backflow of the blood from the lower part
of the body. Mice can be infused continuously with glucose (24.1
mg/kg/min) and insulin (10 mU/kg/min) at an infusion volume of 10
.mu.L/min. Retro-orbital blood samples (70 .mu.L each) can be taken
90, 105, 120, and 135 minutes after the start of infusion for
measurement of plasma glucose and insulin concentrations. The mean
of these four samples is used to estimate steady-state plasma
glucose (SSPG) and insulin (SSPI) concentrations for each
animal.
[0422] Finally, experiments to evaluate the ability of the antibody
of the present application, either alone or in combination with any
one or more of the therapeutic drugs listed for the treatment of
diabetes mellitus, to decrease plasma glucose can be performed in
the following two groups of "NIDDM" mice models that are
STZ-injected: (1) fat-fed C57BL/6J, and (2) fructose-fed C57BL/6J.
Plasma glucose concentrations of the mice for these studies may
range from 255 to 555 mg/dL. Mice are randomly assigned to
treatment with either vehicle, antibodies of the present invention
either alone or in combination with any one or more of the
therapeutic drugs listed for the treatment of diabetes mellitus. A
total of three doses may be administered. Tail vein blood samples
can be taken for measurement of the plasma glucose concentration
before the first dose and 3 hours after the final dose.
[0423] Plasma glucose concentrations can be determined using the
Glucose Diagnostic Kit from Sigma (Sigma No. 315), an enzyme
colorimetric assay. Plasma insulin levels can be determined using
the Rat Insulin RIA Kit from Linco Research (#RI-13K; St. Charles,
Mo.).
[0424] It will be clear that the invention may be practiced
otherwise than as particularly described in the foregoing
description and examples.
[0425] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, are within the scope of the appended claims.
[0426] The entire disclosure of all publications (including
patents, patent applications, journal articles, laboratory manuals,
books, or other documents) cited herein are hereby incorporated by
reference.
[0427] Further, the Sequence Listing submitted herewith, in both
computer and paper forms, is hereby incorporated by reference in
its entirety.
[0428] The entire disclosures (including the specification,
sequence listing, and drawings) of International Application No.
PCT/US03/09625, filed Mar. 28, 2003, and U.S. Provisional
Application No. 60/368,813 filed Apr. 1, 2002 are herein
incorporated by reference in their entirety:
Sequence CWU 1
1
2341553DNAhomo sapiensCDS(47)..(373) 1gtgtgccgga tttggttagc
tgagcccacc gagaggcgcc tgcagg atg aaa gct 55 Met Lys Ala 1ctc tgt
ctc ctc ctc ctc cct gtc ctg ggg ctg ttg gtg tct agc aag 103Leu Cys
Leu Leu Leu Leu Pro Val Leu Gly Leu Leu Val Ser Ser Lys 5 10 15acc
ctg tgc tcc atg gaa gaa gcc atc aat gag agg atc cag gag gtc 151Thr
Leu Cys Ser Met Glu Glu Ala Ile Asn Glu Arg Ile Gln Glu Val20 25 30
35gcc ggc tcc cta ata ttt agg gca ata agc agc att ggc ctg gag tgc
199Ala Gly Ser Leu Ile Phe Arg Ala Ile Ser Ser Ile Gly Leu Glu Cys
40 45 50cag agc gtc acc tcc agg ggg gac ctg gct act tgc ccc cga ggc
ttc 247Gln Ser Val Thr Ser Arg Gly Asp Leu Ala Thr Cys Pro Arg Gly
Phe 55 60 65gcc gtc acc ggc tgc act tgt ggc tcc gcc tgt ggc tcg tgg
gat gtg 295Ala Val Thr Gly Cys Thr Cys Gly Ser Ala Cys Gly Ser Trp
Asp Val 70 75 80cgc gcc gag acc aca tgt cac tgc cag tgc gcg ggc atg
gac tgg acc 343Arg Ala Glu Thr Thr Cys His Cys Gln Cys Ala Gly Met
Asp Trp Thr 85 90 95gga gcg cgc tgc tgt cgt gtg cag ccc tga
ggtcgcgcgc agtggcaaca 393Gly Ala Arg Cys Cys Arg Val Gln Pro100
105gcgcgggcgg aggcggctcc aggtccggag ggttgcgggg gagctggaaa
taaacctgga 453gatgatgatg atgatgatga tggaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa 513aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa 5532108PRThomo sapiens 2Met Lys Ala Leu Cys Leu Leu Leu
Leu Pro Val Leu Gly Leu Leu Val1 5 10 15Ser Ser Lys Thr Leu Cys Ser
Met Glu Glu Ala Ile Asn Glu Arg Ile 20 25 30Gln Glu Val Ala Gly Ser
Leu Ile Phe Arg Ala Ile Ser Ser Ile Gly 35 40 45Leu Glu Cys Gln Ser
Val Thr Ser Arg Gly Asp Leu Ala Thr Cys Pro 50 55 60Arg Gly Phe Ala
Val Thr Gly Cys Thr Cys Gly Ser Ala Cys Gly Ser65 70 75 80Trp Asp
Val Arg Ala Glu Thr Thr Cys His Cys Gln Cys Ala Gly Met 85 90 95Asp
Trp Thr Gly Ala Arg Cys Cys Arg Val Gln Pro 100 105323DNAArtificial
sequenceprimer useful to amplify VH and VL domains 3caggtgcagc
tggtgcagtc tgg 23423DNAArtificial sequenceprimer useful to amplify
VH and VL domains 4caggtcaact taagggagtc tgg 23523DNAArtificial
sequenceprimer useful to amplify VH and VL domains 5gaggtgcagc
tggtggagtc tgg 23623DNAArtificial sequenceprimer useful to amplify
VH and VL domains 6caggtgcagc tgcaggagtc ggg 23723DNAArtificial
sequenceprimer useful to amplify VH and VL domains 7gaggtgcagc
tgttgcagtc tgc 23823DNAArtificial sequenceprimer useful to amplify
VH and VL domains 8caggtacagc tgcagcagtc agg 23924DNAArtificial
sequenceprimer useful to amplify VH and VL domains 9tgaggagacg
gtgaccaggg tgcc 241024DNAArtificial sequenceprimer useful to
amplify VH and VL domains 10tgaagagacg gtgaccattg tccc
241124DNAArtificial sequenceprimer useful to amplify VH and VL
domains 11tgaggagacg gtgaccaggg ttcc 241224DNAArtificial
sequenceprimer useful to amplify VH and VL domains 12tgaggagacg
gtgaccgtgg tccc 241323DNAArtificial sequenceprimer useful to
amplify VH and VL domains 13gacatccaga tgacccagtc tcc
231423DNAArtificial sequenceprimer useful to amplify VH and VL
domains 14gatgttgtga tgactcagtc tcc 231523DNAArtificial
sequenceprimer useful to amplify VH and VL domains 15gatattgtga
tgactcagtc tcc 231623DNAArtificial sequenceprimer useful to amplify
VH and VL domains 16gaaattgtgt tgacgcagtc tcc 231723DNAArtificial
sequenceprimer useful to amplify VH and VL domains 17gacatcgtga
tgacccagtc tcc 231823DNAArtificial sequenceprimer useful to amplify
VH and VL domains 18gaaacgacac tcacgcagtc tcc 231923DNAArtificial
sequenceprimer useful to amplify VH and VL domains 19gaaattgtgc
tgactcagtc tcc 232023DNAArtificial sequenceprimer useful to amplify
VH and VL domains 20cagtctgtgt tgacgcagcc gcc 232123DNAArtificial
sequenceprimer useful to amplify VH and VL domains 21cagtctgccc
tgactcagcc tgc 232223DNAArtificial sequenceprimer useful to amplify
VH and VL domains 22tcctatgtgc tgactcagcc acc 232323DNAArtificial
sequenceprimer useful to amplify VH and VL domains 23tcttctgagc
tgactcagga ccc 232423DNAArtificial sequenceprimer useful to amplify
VH and VL domains 24cacgttatac tgactcaacc gcc 232523DNAArtificial
sequenceprimer useful to amplify VH and VL domains 25caggctgtgc
tcactcagcc gtc 232623DNAArtificial sequenceprimer useful to amplify
VH and VL domains 26aattttatgc tgactcagcc cca 232724DNAArtificial
sequenceprimer useful to amplify VH and VL domains 27acgtttgatt
tccaccttgg tccc 242824DNAArtificial sequenceprimer useful to
amplify VH and VL domains 28acgtttgatc tccagcttgg tccc
242924DNAArtificial sequenceprimer useful to amplify VH and VL
domains 29acgtttgata tccactttgg tccc 243024DNAArtificial
sequenceprimer useful to amplify VH and VL domains 30acgtttgatc
tccaccttgg tccc 243124DNAArtificial sequenceprimer useful to
amplify VH and VL domains 31acgtttaatc tccagtcgtg tccc
243223DNAArtificial sequenceprimer useful to amplify VH and VL
domains 32cagtctgtgt tgacgcagcc gcc 233323DNAArtificial
sequenceprimer useful to amplify VH and VL domains 33cagtctgccc
tgactcagcc tgc 233423DNAArtificial sequenceprimer useful to amplify
VH and VL domains 34tcctatgtgc tgactcagcc acc 233523DNAArtificial
sequenceprimer useful to amplify VH and VL domains 35tcttctgagc
tgactcagga ccc 233623DNAArtificial sequenceprimer useful to amplify
VH and VL domains 36cacgttatac tgactcaacc gcc 233723DNAArtificial
sequenceprimer useful to amplify VH and VL domains 37caggctgtgc
tcactcagcc gtc 233823DNAArtificial sequenceprimer useful to amplify
VH and VL domains 38aattttatgc tgactcagcc cca 23398PRTArtificial
sequenceFlag peptide 39Asp Tyr Lys Asp Asp Asp Asp Lys1
540249PRTArtificial sequencescFv protein GMBC603 40Gln Val Gln Leu
Val Gln Ser Gly Gly Gly Val Val Arg Pro Gly Gly1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30Gly Met
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser
Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val 50 55
60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr65
70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr Tyr
Cys 85 90 95Ala Lys Asp Leu Asn Tyr Asp Phe Trp Ser Gly Ser Gly Met
Asp Val 100 105 110Trp Gly Arg Gly Thr Leu Val Thr Val Ser Ser Gly
Gly Gly Gly Ser 115 120 125Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln 130 135 140Pro Ala Ser Val Ser Gly Ser Pro
Gly Gln Ser Ile Thr Ile Ser Cys145 150 155 160Thr Gly Thr Ser Ser
Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr 165 170 175Gln Gln His
Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser 180 185 190Lys
Arg Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly 195 200
205Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala
210 215 220Asp Tyr Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly225 230 235 240Gly Gly Thr Lys Leu Thr Val Leu Gly
24541243PRTArtificial sequencescFv protein GMBC604 41Glu Val Gln
Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu1 5 10 15Ser Leu
Arg Ile Ser Cys Lys Gly Ser Gly Tyr Thr Phe Thr Asn Tyr 20 25 30Trp
Ile Asn Trp Val Arg Gln Val Pro Gly Lys Gly Leu Glu Trp Met 35 40
45Gly Met Ile Asp Pro Thr Asp Ser Tyr Ala Lys Tyr Ser Pro Ser Phe
50 55 60Gln Gly His Val Thr Ile Ser Thr Asp Lys Ser Val Ser Thr Ala
Tyr65 70 75 80Leu Gln Trp Arg Ser Leu Gln Ala Ser Asp Ser Ala Ile
Tyr Tyr Cys 85 90 95Val Arg Gly Tyr Ser Tyr Asp Leu Asp Tyr Trp Gly
Lys Gly Thr Leu 100 105 110Val Thr Val Ser Ser Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly 115 120 125Gly Gly Gly Ser Gln Ser Val Leu
Thr Gln Pro Ala Ser Val Ser Gly 130 135 140Ser Pro Gly Gln Ser Ile
Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp145 150 155 160Val Gly Gly
Tyr Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys 165 170 175Ala
Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg Pro Ser Gly Val 180 185
190Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr
195 200 205Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys
Ser Ser 210 215 220Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly
Thr Lys Leu Thr225 230 235 240Val Leu Gly42247PRTArtificial
sequencescFv protein GMBC605 42Gln Val Gln Leu Val Gln Ser Gly Gly
Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Glu Thr
Ser Gly Phe Lys Phe Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys
Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg
Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu
Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys
Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110Arg Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Ala 130 135 140Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile
Ser Cys Thr Gly145 150 155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn
Tyr Val Ser Trp Tyr Gln Gln 165 170 175His Pro Gly Lys Ala Pro Lys
Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185 190Pro Ser Gly Val Ser
Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu
Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr
Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230
235 240Thr Lys Leu Thr Val Leu Gly 24543242PRTArtificial
sequencescFv protein GMBC606 43Glu Val Gln Leu Val Gln Ser Gly Gly
Gly Val Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Phe Ile Arg Tyr Asp
Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr
Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys
Ser Ser Ser Phe Ala Asn Ala Phe Asp Ile Trp Gly Gln Gly 100 105
110Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
115 120 125Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala
Val Ser 130 135 140Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln
Gly Asp Ser Leu145 150 155 160Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln
Gln Lys Pro Gly Gln Ala Pro 165 170 175Val Leu Val Ile Tyr Gly Lys
Asn Asn Arg Pro Ser Gly Ile Pro Asp 180 185 190Arg Phe Ser Gly Ser
Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr 195 200 205Gly Ala Gln
Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp 210 215 220Ser
Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val225 230
235 240Leu Gly44247PRTArtificial sequencescFv protein GMBC607 44Glu
Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala
20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr
Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser
Lys Asn Met65 70 75 80Leu Tyr Leu Glu Met Asn Ser Leu Lys Thr Glu
Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr
Gly Met Asn Val Trp Gly 100 105 110Gln Gly Thr Met Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly
Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly
Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr
Ser Ser Asp Val Gly Asp Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170
175His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg
180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly
Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp
Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr
Arg Val Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
24545246PRTArtificial sequencescFv protein GMBC608 45Glu Val Gln
Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ser 20 25 30Tyr
Met Thr Trp Ile Arg Gln Ala Pro Gly Glu Gly Leu Glu Phe Val 35 40
45Ser Tyr Ile Ser Ser Gly Ser Ser Thr Thr Tyr Tyr Thr Asp Ser Val
50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Pro Glu Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Ala Arg Arg Ser Ile Ser Ser Asp Tyr Tyr Ser Tyr
Tyr Leu Asp Val 100 105 110Trp Gly Lys Gly Thr Leu Val Thr Val Ser
Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Ser Glu Leu Thr Gln Asp 130 135 140Pro Ala Val Ser Val Ala
Leu Gly Gln Thr Val Arg Ile Thr Cys Gln145
150 155 160Gly Asp Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln
Lys Pro 165 170 175Gly Gln Ala Pro Val Leu Val Ile Tyr Gly Lys Asn
Asn Arg Pro Ser 180 185 190Gly Ile Pro Asp Arg Phe Ser Gly Ser Ser
Ser Gly Asn Thr Ala Ser 195 200 205Leu Thr Ile Thr Gly Ala Gln Ala
Glu Asp Glu Ala Asp Tyr Tyr Cys 210 215 220Asn Ser Arg Asp Ser Ser
Gly Asn His Val Val Phe Gly Gly Gly Thr225 230 235 240Lys Leu Thr
Val Leu Gly 24546247PRTArtificial sequencescFv protein GMBC609
46Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Glu1
5 10 15Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Phe Glu Phe Asn Tyr
Ala 20 25 30Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45Gly Arg Ser Arg Ser Glu Ala Ser Gly Gly Thr Thr Asp
Tyr Ala Ala 50 55 60Pro Leu Gln Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Val Asn Ser Leu Lys Ile
Glu Asp Thr Gly Val Tyr 85 90 95Phe Cys Lys Trp Glu Lys Ser Glu Tyr
Tyr Gly Met Asp Val Trp Gly 100 105 110Arg Gly Thr Pro Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Pro 130 135 140Ser Val Ser
Ala Ala Pro Gly Gln Lys Val Thr Ile Ser Cys Ser Gly145 150 155
160Ser Thr Ser Asn Ile Gly Asn Asn Tyr Val Ser Trp Tyr Gln Gln His
165 170 175Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Asp Val Ser Lys
Arg Pro 180 185 190Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser
Gly Asn Ser Ala 195 200 205Ser Leu Asp Ile Ser Gly Leu Gln Ser Glu
Asp Glu Ala Asp Tyr Tyr 210 215 220Cys Ala Ala Trp Asp Asp Ser Leu
Ser Glu Phe Leu Phe Gly Thr Gly225 230 235 240Thr Lys Leu Thr Val
Leu Gly 24547241PRTArtificial sequencescFv protein GMBC610 47Gln
Val Thr Leu Lys Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5 10
15Ser Val Lys Val Ser Cys Lys Thr Ser Gly Phe Thr Phe Gly Ala Tyr
20 25 30Tyr Ile His Trp Val Arg Gln Val Pro Gly Gln Gly Leu Glu Trp
Met 35 40 45Gly Trp Ile Asp Pro Asn Asn Gly Gly Thr Asn Tyr Ala Gln
Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Met Ser Thr Thr
Thr Thr Tyr65 70 75 80Met Glu Val Ser Gly Leu His Ser Asp Asp Thr
Ala Val Tyr Tyr Cys 85 90 95Ala Arg Ala Arg Val Ala Thr Ile Leu Glu
Tyr Trp Gly Arg Gly Thr 100 105 110Leu Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly Gly Ser Pro
Glu Leu Thr Gln Asp Pro Ala Val Ser Val 130 135 140Ala Leu Gly Gln
Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg145 150 155 160Ser
Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val 165 170
175Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg
180 185 190Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile
Thr Gly 195 200 205Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn
Ser Arg Asp Ser 210 215 220Ser Gly Asn His Val Val Phe Gly Gly Gly
Thr Lys Leu Thr Val Leu225 230 235 240Gly48239PRTArtificial
sequencescFv protein GMBC612 48Glu Val Gln Leu Val Glu Ser Gly Gly
Gly Val Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Ser Phe Ser Ser Tyr 20 25 30Gly Met Gln Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Phe Ile Arg Tyr Asp
Gly Ser Ile Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr
Val Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg
Gly Tyr Arg Ile Val Asp Tyr Trp Gly Gln Gly Thr Leu Val 100 105
110Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu
Ser Pro 130 135 140Ser Ile Gly Asp Arg Val Thr Ile Thr Cys Arg Ala
Ser Glu Gly Ile145 150 155 160Tyr His Trp Leu Ala Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Pro Lys 165 170 175Leu Leu Ile Tyr Lys Ala Ser
Ser Leu Ala Ser Gly Ala Pro Ser Arg 180 185 190Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser 195 200 205Leu Gln Pro
Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Ser Asn 210 215 220Tyr
Pro Leu Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg225 230
23549245PRTArtificial sequencescFv protein GMBC613 49Lys Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Ile Ser Ser His 20 25 30Trp
Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Ala Ser Ile Lys Gln Asp Gly Arg Glu Lys His Phe Val Asp Ser Val
50 55 60Lys Gly Arg Phe Ser Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu
Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Ala Arg Glu Thr Tyr Gly Gly Tyr Tyr Tyr Tyr Phe
Met Asp Val Trp 100 105 110Gly Lys Gly Thr Leu Val Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly 115 120 125Gly Gly Gly Ser Gly Gly Gly Gly
Ser Ser Glu Leu Thr Gln Asp Pro 130 135 140Ala Val Ser Val Ala Leu
Gly Gln Thr Val Arg Ile Thr Cys Gln Gly145 150 155 160Asp Ser Leu
Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly 165 170 175Gln
Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly 180 185
190Ile Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu
195 200 205Thr Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr
Cys Asn 210 215 220Ser Arg Asp Ser Ser Gly Asn His Val Val Phe Gly
Gly Gly Thr Lys225 230 235 240Leu Thr Val Leu Gly
24550247PRTArtificial sequencescFv protein GMBC614 50Glu Val Gln
Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala
50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr
Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met
Asn Val Trp Gly 100 105 110Arg Gly Thr Met Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly Ser Pro
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr Ser Ser
Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170 175His
Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185
190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr
195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala
Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
24551247PRTArtificial sequencescFv protein GMBC615 51Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Lys Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala
50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr
Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met
Asn Val Trp Gly 100 105 110Lys Gly Thr Leu Val Ala Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly Ser Pro
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr Ser Ser
Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170 175His
Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185
190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr
195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala
Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
24552247PRTArtificial sequencescFv protein GMBC616 52Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Thr Asp Tyr Ala Ala
50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Glu Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr
Ala Val Tyr 85 90 95Tyr Cys Thr Trp Asp His Ser Tyr Tyr Tyr Asp Met
Ala Val Trp Gly 100 105 110Arg Gly Thr Leu Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Pro 130 135 140Phe Val Ser Gly Ser Pro
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr Ser Ser
Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170 175His
Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185
190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr
195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala
Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
24553243PRTArtificial sequencescFv protein GMBC617 53Glu Val Gln
Leu Val Glu Thr Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Val Ser Ser Asn 20 25 30Tyr
Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Ser Val Ile Tyr Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys
50 55 60Gly Arg Phe Thr Ile Ser Arg His Asn Ser Lys Asn Thr Leu Tyr
Leu65 70 75 80Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
Tyr Cys Ala 85 90 95Arg Gly Leu Trp Phe Gly Glu Leu Leu Tyr Trp Gly
Gln Gly Thr Leu 100 105 110Val Thr Val Ser Ser Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly 115 120 125Gly Gly Gly Ser Gln Ser Ala Leu
Thr Gln Pro Ala Ser Val Ser Gly 130 135 140Ser Arg Gly Gln Ser Ile
Thr Ile Ser Cys Thr Gly Thr Thr Gly Asp145 150 155 160Val Gly Gly
Tyr Asp Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys 165 170 175Ala
Pro Lys Leu Leu Ile Tyr Gly Asn Ser Asn Arg Pro Ser Gly Val 180 185
190Pro Asp Arg Phe Ser Ala Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr
195 200 205Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Phe Cys
Ser Thr 210 215 220Tyr Ala Pro Pro Gly Ile Ile Met Phe Gly Gly Gly
Thr Lys Leu Thr225 230 235 240Val Leu Gly54247PRTArtificial
sequencescFv protein GMBC618 54Glu Val Gln Leu Val Gln Ser Gly Gly
Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Lys Phe Asp Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys
Arg Ser Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg
Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu
Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys
Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110Arg Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Pro 130 135 140Ser Ala Ser Gly Thr Pro Gly Gln Arg Val Thr Ile
Ser Cys Ser Gly145 150 155 160Ser Ser Ser Asn Ile Gly Ser Asn Thr
Val Asn Trp Tyr Gln Arg Leu 165 170 175Pro Gly Ala Ala Pro Gln Leu
Leu Ile Tyr Asn Asn Asp Gln Arg Pro 180 185 190Ser Gly Ile Pro Asp
Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Gly 195 200 205Ser Leu Val
Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala Asp Tyr Tyr 210 215 220Cys
Ala Ser Trp Asp Asp Ser Leu Asn Gly Arg Val Phe Gly Gly Gly225 230
235 240Thr Lys Leu Thr Val Leu Gly 24555244PRTArtificial
sequencescFv protein GMBC619 55Glu Val Gln Leu Val Glu Ser Gly Gly
Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Arg Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Thr Tyr Asp
Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr
Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met
Asn Ser Leu Arg Ala Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg
Asp Gly Gly Gly Trp Tyr His Pro Arg Leu Asp Tyr Trp Gly 100 105
110Gln Gly Thr Met Val Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly
Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140Val Ser Val Ala Leu
Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155 160Ser Leu
Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln 165 170
175Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile
180 185 190Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser
Leu Thr 195 200 205Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr
Tyr Cys Asn Ser 210 215 220Arg Asp Ser Ser Gly Asn His Val Val Phe
Gly Gly Gly Thr Lys Leu225 230 235 240Thr Val Leu
Gly56247PRTArtificial sequencescFv protein GMBC620 56Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala
50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr
Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met
Asn Val Trp Gly 100 105 110Arg Gly Thr Met Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly Ser Pro
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr Ser Ser
Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170 175His
Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185
190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr
195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala
Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
24557241PRTArtificial sequencescFv protein GMBC621 57Glu Val Gln
Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly
Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr65 70 75 80Leu Gln Met Asp Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Phe Cys 85 90 95Ala Lys Arg Gly Leu Trp Thr Pro Ile Asp Tyr Trp
Gly Lys Gly Thr 100 105 110Leu Val Thr Val Ser Ser Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly Gly Ser Ser Glu Leu
Thr Gln Asp Pro Ala Val Ser Val 130 135 140Ala Leu Gly Gln Thr Val
Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg145 150 155 160Ser Tyr Tyr
Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val 165 170 175Leu
Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg 180 185
190Phe Ser Gly Ser Asn Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly
195 200 205Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg
Asp Ser 210 215 220Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys
Leu Thr Val Leu225 230 235 240Gly58247PRTArtificial sequencescFv
protein GMBC625 58Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val
Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe
Thr Phe Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly
Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Arg Ser Gly
Gly Thr Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile
Ser Arg Asp Asp Ser Lys Asp Thr65 70 75 80Met Tyr Leu Gln Met Asn
Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp
Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110Gln Gly Thr
Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly
Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135
140Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr
Gly145 150 155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser
Trp Tyr Gln Gln 165 170 175His Pro Gly Lys Ala Pro Lys Leu Met Ile
Tyr Glu Gly Ser Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe
Phe Gly Ser Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser
Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser
Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240Thr
Lys Leu Thr Val Leu Gly 24559247PRTArtificial sequencescFv protein
GMBC626 59Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro
Gly Glu1 5 10 15Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Phe Glu Phe
Asn Tyr Ala 20 25 30Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45Gly Arg Ser Arg Ser Glu Ala Ser Gly Gly Thr
Thr Asp Tyr Ala Ala 50 55 60Pro Leu Gln Asp Arg Phe Thr Ile Ser Arg
Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Val Asn Ser Leu
Lys Ile Glu Asp Thr Gly Val Tyr 85 90 95Phe Cys Lys Trp Glu Lys Ser
Glu Tyr Tyr Gly Met Asp Val Trp Gly 100 105 110Arg Gly Thr Pro Val
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser
Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser
Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150
155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln
Gln 165 170 175His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly
Ser Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser
Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Arg
Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr
Lys Ser Thr Gln Val Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr
Val Leu Gly 24560244PRTArtificial sequencescFv protein GMBC627
60Gly Val Gln Leu Val Gln Ser Gly Gly Glu Val Lys Lys Pro Gly Ala1
5 10 15Ser Val Arg Val Ser Cys Lys Ala Ser Arg Tyr Ile Phe Ser Asn
Tyr 20 25 30Gly Phe Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45Gly Ser Ile Arg Asn Asp Lys Gly Ser Thr Asn Tyr Ala
Gln Gly Phe 50 55 60Gln Asp Arg Leu Thr Met Thr Thr Asp Thr Ser Thr
Asn Thr Val Phe65 70 75 80Met Glu Leu Arg Ser Leu Ser Ser Asp Asp
Thr Ala Val Tyr Tyr Cys 85 90 95Ala Ser Ala Pro Tyr Tyr Tyr Gly Met
Gly Ile Trp Gly Lys Gly Thr 100 105 110Leu Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Ala Ser Val Ser 130 135 140Gly Ser Ser
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser145 150 155
160Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly
165 170 175Lys Ala Pro Lys Leu Met Ile Tyr Glu Val Gly Asn Arg Pro
Ser Gly 180 185 190Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn
Thr Ala Ser Leu 195 200 205Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu
Ala Asp Tyr Tyr Cys Ser 210 215 220Ser Tyr Thr Thr Arg Ser Thr Arg
Val Phe Gly Gly Gly Thr Lys Leu225 230 235 240Thr Val Leu
Gly61249PRTArtificial sequencescFv protein GMBC628 61Gln Val Gln
Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5 10 15Ser Val
Arg Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30Gly
Phe Ser Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met 35 40
45Gly Trp Ile Ser Ala Tyr Lys Gly Asn Ala Asn Tyr Ala Glu Lys Phe
50 55 60Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Asn Thr Ala
Tyr65 70 75 80Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Ala Arg Thr Arg Ile Ser Val Ala Gly Leu Asp Tyr
Tyr Tyr Tyr Gly 100 105 110Leu Asp Val Trp Gly Arg Gly Thr Leu Val
Thr Val Ser Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Ser Glu Leu 130 135 140Thr Gln Asp Pro Ala Val
Ser Val Ala Leu Gly Gln Thr Val Arg Ile145 150 155 160Thr Cys Gln
Gly Asp Ser Leu Arg Ser Tyr Tyr Thr Asn Trp Phe Gln 165 170 175Gln
Lys Pro Gly Gln Ala Pro Leu Leu Val Val Tyr Ala Lys Asn Asn 180 185
190Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn
195 200 205Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu Asp Glu
Ala Asp 210 215 220Tyr Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn His
Val Val Phe Gly225 230 235 240Gly Gly Thr Lys Leu Thr Val Leu Gly
24562244PRTArtificial sequencescFv protein GMBC629 62Gln Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Gly Ser Gly Phe Lys Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Glu Tyr Ala Val
50 55 60Pro Val Lys Asp Arg Phe Ile Ile Ser Arg Asp Asp Ser Lys Asp
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr
Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met
Asn Val Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140Val Ser Val Ala Leu Gly
Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155 160Ser Leu Arg
Ser Tyr Tyr Thr Asn Trp Phe Gln Gln Lys Pro Gly Gln 165 170 175Ala
Pro Leu Leu Val Val Tyr Ala Lys Asn Lys Arg Pro Ser Gly Ile 180 185
190Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr
195 200 205Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys
His Ser 210 215 220Arg Asp Ser Ser Gly Asn His Val Leu Phe Gly Gly
Gly Thr Lys Leu225 230 235 240Thr Val Leu Gly63242PRTArtificial
sequencescFv protein GMBC630 63Gln Val Gln Leu Val Glu Ser Gly Gly
Gly Leu Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Pro Cys Ala Ala
Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Ser Tyr Asp
Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr
Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys
Ala Thr Ser Leu Leu Asn Ala Phe Asp Ile Trp Gly Arg Gly 100 105
110Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
115 120 125Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala
Val Ser 130 135 140Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln
Gly Asp Ser Leu145 150 155 160Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln
Gln Lys Pro Gly Gln Ala Pro 165 170 175Val Leu Val Ile Tyr Gly Lys
Asn Asn Arg Pro Ser Gly Ile Pro Asp 180 185 190Arg Phe Ser Gly Ser
Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr 195 200 205Gly Ala Gln
Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp 210 215 220Ser
Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val225 230
235 240Leu Gly64244PRTArtificial sequencescFv protein GMBC632 64Gln
Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Lys Phe Ser Asp Ala
20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Glu Tyr
Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Ile Ile Ser Arg Asp Asp Ser
Lys Asp Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu
Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr
Asp Met Asn Val Trp Gly 100 105 110Gln Gly Thr Met Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly
Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140Val Ser Val Ala
Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155 160Ser
Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln 165 170
175Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile
180 185 190Pro Asp Arg Phe Phe Gly Ser Ser Ser Gly Asn Thr Ala Ser
Leu Thr 195 200 205Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr
Tyr Cys Asn Ser 210 215 220Arg Asp Ser Ser Gly Asn His Val Val Phe
Gly Gly Gly Thr Lys Leu225 230 235 240Thr Val Leu
Gly65247PRTArtificial sequencescFv protein GMBC634 65Gln Val Gln
Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala
50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr
Ala
Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn
Val Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Gln
Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly Ser Pro Gly
Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr Ser Ser Asp
Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170 175His Pro
Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185
190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr
195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala
Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
24566244PRTArtificial sequencescFv protein GMBC635 66Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala
50 55 60Pro Val Lys Asp Arg Tyr Thr Ile Ser Arg Asp Asp Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr
Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met
Asn Val Trp Gly 100 105 110Lys Gly Thr Met Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140Val Ser Val Ala Leu Gly
Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155 160Ser Leu Arg
Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln 165 170 175Ala
Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile 180 185
190Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr
195 200 205Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys
Asn Ser 210 215 220Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly
Gly Thr Lys Leu225 230 235 240Thr Val Leu Gly67247PRTArtificial
sequencescFv protein GMBC638 67Gln Val Gln Leu Val Gln Ser Gly Gly
Gly Leu Val Lys Pro Gly Glu1 5 10 15Ser Leu Arg Leu Ser Cys Glu Ala
Ser Gly Phe Glu Phe Asn Tyr Ala 20 25 30Trp Met Ser Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ser Arg Ser Val
Ala Ser Gly Gly Thr Thr Asp Tyr Ala Ala 50 55 60Pro Leu Gln Asp Arg
Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu
Gln Val Asn Ser Leu Lys Ile Glu Asp Thr Gly Val Tyr 85 90 95Phe Cys
Lys Trp Glu Lys Ser Glu Tyr Tyr Gly Met Asp Val Trp Gly 100 105
110Arg Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Ala 130 135 140Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile
Ser Cys Thr Gly145 150 155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn
Tyr Val Ser Trp Tyr Gln Gln 165 170 175His Pro Gly Lys Ala Pro Lys
Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185 190Pro Ser Gly Val Ser
Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu
Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr
Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230
235 240Thr Lys Leu Thr Val Leu Gly 24568253PRTArtificial
sequencescFv protein GMBC639 68Gly Val Gln Leu Val Gln Ser Gly Ala
Glu Val Lys Thr Pro Gly Ala1 5 10 15Ser Val Lys Val Ser Cys Lys Ala
Ser Gly Tyr Thr Phe Thr Asn His 20 25 30Tyr Met His Trp Val Arg Gln
Ala Pro Gly Gln Gly Ile Glu Trp Val 35 40 45Gly Val Ile Asn Pro Ser
Gly Asp Gly Ser Ser Tyr Ala Gln Thr Phe 50 55 60Gln Gly Arg Val Thr
Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr65 70 75 80Met Glu Leu
Arg Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg
Asp Leu Phe Tyr Asp Phe Trp Ser Asp Tyr Tyr Arg Asn Asp 100 105
110Gln Tyr Tyr Tyr Met Asp Val Trp Gly Lys Gly Thr Leu Val Thr Val
115 120 125Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly 130 135 140Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val
Ala Leu Gly Gln145 150 155 160Ala Val Arg Ile Thr Cys Gln Gly Asp
Ser Leu Arg Ser Tyr Tyr Ala 165 170 175Ser Trp Tyr Gln Gln Lys Pro
Gly Gln Ala Pro Val Leu Val Ile Tyr 180 185 190Gly Lys Asn Asn Arg
Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser 195 200 205Ser Ser Gly
Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu 210 215 220Asp
Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn His225 230
235 240Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 245
25069243PRTArtificial sequencescFv protein GMBC641 69Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Val Val Arg Pro Gly Arg1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser Ser Tyr 20 25 30Gly
Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Phe Cys 85 90 95Ala Lys Gly Gly Asp Arg Ser Phe Arg Ala Phe Asp
Phe Trp Gly Gln 100 105 110Gly Thr Met Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly Gly 115 120 125Gly Ser Gly Gly Gly Gly Ser Ser
Glu Leu Thr Gln Asp Pro Ala Val 130 135 140Ser Val Ala Leu Gly Gln
Thr Val Arg Ile Thr Cys Gln Gly Asp Ser145 150 155 160Leu Arg Ser
Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala 165 170 175Pro
Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro 180 185
190Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile
195 200 205Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn
Ser Arg 210 215 220Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly
Thr Lys Leu Thr225 230 235 240Val Leu Gly70243PRTArtificial
sequencescFv protein GMBC642 70Gln Val Gln Leu Gln Gln Ser Gly Ala
Glu Val Lys Lys Pro Gly Ala1 5 10 15Ser Val Lys Val Ser Cys Lys Ala
Ser Gly Tyr Thr Phe Thr Ile His 20 25 30Tyr Met His Trp Val Arg Gln
Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Ile Ile Asn Pro Gly
Asp Gly Ser Thr Ser Tyr Ala Gln Asn Phe 50 55 60Gln Gly Arg Val Thr
Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr65 70 75 80Met Glu Leu
Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg
Ala Gly Arg Thr Val Thr Ser His Phe Asp Tyr Trp Gly Arg 100 105
110Gly Thr Leu Ala Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly
115 120 125Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro
Ala Val 130 135 140Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys
Gln Gly Asp Ser145 150 155 160Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr
Gln Gln Lys Pro Gly Gln Ala 165 170 175Pro Val Leu Val Ile Tyr Gly
Lys Asn Asn Arg Pro Ser Gly Ile Pro 180 185 190Asp Arg Phe Ser Gly
Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile 195 200 205Thr Gly Ala
Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg 210 215 220Asp
Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr225 230
235 240Val Leu Gly71247PRTArtificial sequencescFv protein GMBC645
71Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Lys Phe Ser Asp
Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Glu
Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Ile Ile Ser Arg Asp Asp
Ser Lys Asp Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110Arg Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240Thr Glu Leu Thr Val
Leu Gly 24572241PRTArtificial sequencescFv protein GMBC646 72Gly
Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5 10
15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30Tyr Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp
Met 35 40 45Gly Ile Ile Asn Pro Ser Gly Gly Thr Thr Ser Tyr Ala Gln
Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser
Thr Val Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr
Ala Met Tyr Tyr Cys 85 90 95Ala Arg Glu Arg Phe Leu Arg Gly Met Asp
Val Trp Gly Arg Gly Thr 100 105 110Met Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly Gly Ser Asp
Ile Val Met Thr Gln Ser Pro Ser Thr Leu 130 135 140Ser Ala Ser Val
Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln145 150 155 160Gly
Ile Ser Ser Trp Leu Ala Trp Tyr Gln Gln Lys Pro Gly Arg Ala 165 170
175Pro Lys Val Leu Ile Tyr Lys Ala Ser Thr Leu Glu Ser Gly Val Pro
180 185 190Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile 195 200 205Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr
Cys Gln Gln Ser 210 215 220Tyr Ser Thr Pro Trp Thr Phe Gly Gln Gly
Thr Lys Leu Glu Ile Lys225 230 235 240Arg73247PRTArtificial
sequencescFv protein GMBC647 73Glu Val Gln Leu Val Glu Ser Gly Gly
Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys
Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg
Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu
Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys
Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Ala 130 135 140Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile
Ser Cys Thr Gly145 150 155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn
Tyr Val Ser Trp Tyr Gln Gln 165 170 175His Pro Gly Lys Ala Pro Lys
Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185 190Pro Ser Gly Val Ser
Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu
Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr
Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230
235 240Thr Lys Leu Thr Val Leu Gly 24574244PRTArtificial
sequencescFv protein GMBC648 74Gln Val Gln Leu Val Glu Ser Gly Gly
Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys
Arg Ser Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg
Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu
Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys
Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110Gln Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp
Pro Thr 130 135 140Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr
Cys Gln Gly Asp145 150 155 160Ser Leu Arg Ser Tyr Tyr Ala Ser Trp
Tyr Gln Gln Lys Pro Gly Gln 165 170 175Ala Pro Val Leu Val Ile Tyr
Gly Lys Asn Asn Arg Pro Ser Gly Ile 180 185 190Pro Asp Arg Phe Ser
Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr 195 200 205Ile Thr Gly
Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser 210 215 220Arg
Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu225 230
235 240Thr Val Leu Gly75247PRTArtificial sequencescFv protein
GMBC649 75Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro
Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser
Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Thr
Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met
Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp
Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110Arg Gly
Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120
125Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala
130 135 140Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys
Thr Gly145 150 155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val
Ser Trp Tyr Gln Gln 165 170 175His Pro Gly Lys Ala Pro Lys Leu Met
Ile Tyr Glu Gly Ser Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg
Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile
Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser
Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230 235
240Thr Lys Leu Thr Val Leu Gly 24576247PRTArtificial sequencescFv
protein GMBC651 76Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val
Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe
Thr Phe Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly
Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly
Gly Thr Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile
Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn
Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp
Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110Arg Gly Thr
Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly
Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135
140Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr
Gly145 150 155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser
Trp Tyr Gln Gln 165 170 175His Pro Gly Lys Ala Pro Lys Leu Met Ile
Tyr Glu Gly Ser Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe
Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser
Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser
Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240Thr
Lys Leu Thr Val Leu Gly 24577247PRTArtificial sequencescFv protein
GMBC652 77Gly Val Gln Leu Val Gln Ser Gly Gly Val Val Val Lys Pro
Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr
Thr Asp Tyr Ala Ala 50 55 60Pro Val Lys Gly Arg Phe Thr Ile Ser Arg
Asp Asp Ser Glu Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu
Lys Thr Glu Asp Thr Ala Val Tyr 85 90 95Tyr Cys Thr Trp Asp His Ser
Tyr Tyr Tyr Asp Met Ala Val Trp Gly 100 105 110Arg Gly Thr Met Val
Thr Ala Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser
Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser
Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150
155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln
Gln 165 170 175His Pro Gly Lys Ala Pro Lys Phe Met Ile Tyr Asp Val
Ser Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser
Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Val Gln
Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Ser
Ala Ser Thr Val Ile Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr
Val Leu Gly 24578246PRTArtificial sequencescFv protein GMBC653
78Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1
5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly
Tyr 20 25 30Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala
Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile
Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Arg Leu Arg Ser Asp Asp
Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Gly Gly Ser Arg Tyr Tyr Gly
Met Asp Val Trp Ser Arg Gly 100 105 110Thr Leu Val Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125Ser Gly Gly Gly Gly
Ser Ser Tyr Val Leu Thr Gln Pro Pro Ser Val 130 135 140Ser Gly Thr
Pro Gly Gln Arg Val Thr Ile Ser Cys Ser Gly Gly Arg145 150 155
160Ser Asn Ile Gly Ser Asn Thr Val Lys Trp Tyr Gln Gln Leu Pro Gly
165 170 175Ala Ala Pro Lys Leu Leu Ile Tyr Gly Asn Asp Gln Arg Pro
Ser Gly 180 185 190Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr
Ser Ala Ser Leu 195 200 205Ala Ile Thr Gly Val Gln Ala Glu Asp Glu
Ala Asp Tyr Tyr Cys Gln 210 215 220Ser Tyr Asp Ser Ser Leu Arg Gly
Ser Arg Val Phe Gly Thr Gly Thr225 230 235 240Lys Val Thr Val Leu
Gly 24579247PRTArtificial sequencescFv protein GMBC654 79Glu Val
Gln Leu Val Glu Thr Gly Gly Gly Leu Val Glu Pro Gly Gly1 5 10 15Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25
30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45Gly Arg Ile Lys Ser Lys Arg Ser Gly Gly Thr Ile Asp Tyr Ala
Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys
Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Ile Glu Asp
Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly
Met Asn Val Trp Gly 100 105 110Lys Gly Thr Thr Val Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly
Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly Ser
Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr Ser
Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170
175His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg
180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly
Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp
Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr
Arg Val Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
24580239PRTArtificial sequencescFv protein GMBC655 80Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly
Met Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Gln Glu Trp Val 35 40
45Ser Ala Ile Ser Gly Ser Gly Gly Ser Ala Tyr Tyr Ala Asp Ser Val
50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Ala Lys Ala Tyr Ser Ser Glu Asp Tyr Trp Gly Arg
Gly Thr Met Val 100 105 110Thr Val Ser Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Asn Ile Gln Met Thr
Gln Ser Pro Ser Phe Leu Ser Ala 130 135 140Ser Val Gly Asp Arg Val
Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile145 150 155 160Asn Asn Tyr
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Arg Ala Pro Lys 165 170 175Leu
Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg 180 185
190Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser
195 200 205Leu Gln Pro Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr
Ser Asn 210 215 220Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Leu Glu
Ile Lys Arg225 230 23581244PRTArtificial sequencescFv protein
GMBC657 81Gln Met Gln Leu Met Gln Ser Gly Gly Gly Leu Val Lys Pro
Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Lys Phe
Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr
Ile Glu Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Ile Ile Ser Arg
Asp Asp Ser Lys Asp Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu
Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp
Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110Gln Gly Thr Leu Val
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser
Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140Val
Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150
155 160Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly
Gln 165 170 175Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro
Ser Gly Ile 180 185 190Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn
Thr Ala Ser Leu Thr 195 200 205Ile Thr Gly Ala Gln Ala Glu Asp Glu
Ala Asp Tyr Tyr Cys Asn Ser 210 215 220Arg Asp Ser Ser Gly Asn His
Val Val Phe Gly Gly Gly Thr Lys Leu225 230 235 240Thr Val Leu
Gly82247PRTArtificial sequencescFv protein GMBC658 82Glu Val Gln
Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala
50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr
Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met
Asn Val Trp Gly 100 105 110Arg Gly Thr Thr Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly Ser Pro
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr Ser Ser
Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170 175His
Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185
190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr
195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala
Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
24583247PRTArtificial sequencescFv protein GMBC659 83Gln Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Glu1 5 10 15Ser Leu
Arg Leu Ser Cys Glu Ala Ser Gly Phe Glu Phe Asn Tyr Ala 20 25 30Trp
Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ser Arg Ser Glu Ala Ser Gly Gly Thr Thr Asp Tyr Ala Ala
50 55 60Pro Leu Gln Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Val Asn Ser Leu Lys Ile Glu Asp Thr
Gly Val Tyr 85 90 95Phe Cys Lys Trp Glu Lys Ser Glu Tyr Tyr Gly Met
Asp Val Trp Gly 100 105 110Arg Gly Thr Leu Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly Ser Pro
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr Ser Ser
Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170 175His
Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185
190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr
195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala
Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
24584247PRTArtificial sequencescFv protein GMBC660 84Glu Val Gln
Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Ile Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala
50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr
Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met
Asn Val Trp Gly 100 105 110Gln Gly Thr Pro Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly Ser Pro
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr Ser Ser
Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170 175His
Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185
190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr
195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala
Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
24585243PRTArtificial sequencescFv protein GMBC662 85Gly Val Gln
Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly
Ser1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser
Ser Tyr 20 25 30Thr Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu
Glu Trp Met 35 40 45Gly Arg Ile Ile Pro Ile Leu Gly Ile Ala Asn Tyr
Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser
Thr Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Glu
Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Glu Lys Leu Arg Asp Phe
Gln His Trp Gly Gln Gly Thr Leu 100 105 110Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 115 120 125Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Ala Ser Val Ser Gly 130 135 140Ser Pro
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp145 150 155
160Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys
165 170 175Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg Pro Ser
Gly Ile 180 185 190Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr
Ala Ser Leu Thr 195 200 205Ile Ser Arg Leu Gln Ala Glu Asp Glu Ala
Asp Tyr Tyr Cys Ser Ser 210 215 220Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly Gly Gly Thr Lys Leu Thr225 230 235 240Val Leu
Gly86247PRTArtificial sequencescFv protein GMBC664 86Glu Val Gln
Leu Val Glu Thr Gly Gly Ala Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala
50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr
Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met
Asn Val Trp Ser 100 105 110Arg Gly Thr Met Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly Ser Pro
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr Ser Ser
Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170 175His
Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185
190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr
195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala
Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
24587244PRTArtificial sequencescFv protein GMBC665 87Glu Val Gln
Leu Val Glu Thr Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala
50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr
Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met
Asn Val Trp Gly 100 105 110Gln Gly Thr Met Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140Val Ser Val Ala Leu Gly
Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155 160Ser Leu Arg
Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln 165 170 175Ala
Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile 180 185
190Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr
195 200 205Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys
Asn Ser 210 215 220Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly
Gly Thr Lys Leu225 230 235 240Thr Val Leu Gly88247PRTArtificial
sequencescFv protein GMBC666 88Glu Val Gln Leu Val Glu Ser Gly Gly
Gly Leu Ala Lys Pro Gly Glu1 5 10 15Ser Leu Arg Leu Ser Cys Glu Ala
Ser Gly Phe Glu Phe Asn Tyr Ala 20 25 30Trp Met Ser Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ser Arg Ser Glu
Ala Ser Gly Gly Thr Thr Asp Tyr Ala Ala 50 55 60Pro Leu Gln Asp Arg
Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu
Gln Val Asn Ser Leu Lys Ile Glu Asp Thr Gly Val Tyr 85 90 95Phe Cys
Lys Trp Glu Lys Ser Glu Tyr Tyr Gly Met Asp Val Trp Gly 100 105
110Lys Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Pro 130 135 140Ser Val Ser Ala Ala Pro Gly Gln Lys Val Thr Ile
Ser Cys Ser Gly145 150 155 160Ser Thr Ser Asn Ile Gly Asn Asn Tyr
Val Ser Trp Tyr Gln Gln His 165 170 175Pro Gly Lys Ala Pro Lys Leu
Met Ile Tyr Asp Val Ser Lys Arg Pro 180 185 190Ser Gly Val Pro Asp
Arg Phe Ser Gly Ser Lys Ser Gly Asn Ser Ala 195 200 205Ser Leu Asp
Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala Asp Tyr Tyr 210 215 220Cys
Ala Ala Trp Asp Asp Ser Leu Ser Glu Phe Leu Phe Gly Thr Gly225 230
235 240Thr Lys Leu Thr Val Leu Gly 24589247PRTArtificial
sequencescFv protein GMBC667 89Gln Val Gln Leu Gln Glu Ser Gly Gly
Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Gly
Ser Gly Phe Pro Phe Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys
Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg
Phe Arg Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu
Gln Met Asn Ser Leu Asn Ile Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys
Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Ala 130 135 140Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile
Ser Cys Thr Gly145 150 155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn
Tyr Val Ser Trp Tyr Gln Gln 165 170 175His Pro Gly Lys Ala Pro Lys
Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185 190Pro Ser Gly Val Ser
Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu
Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr
Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230
235 240Thr Lys Leu Thr Val Leu Gly 24590244PRTArtificial
sequencescFv protein GMBC668 90Glu Val Gln Leu Val Glu Ser Gly Gly
Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys
Gly Ser Gly Gly Thr Thr Asp Tyr Ala Ala 50 55 60Pro Val Lys Gly Arg
Phe Thr Ile Ser Arg Asp Asp Ser Glu Asn Thr65 70 75 80Leu Tyr Leu
Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85 90 95Tyr Cys
Thr Trp Asp His Ser Tyr Tyr Tyr Asp Met Ala Val Trp Gly 100 105
110Arg Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp
Pro Ala 130 135 140Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr
Cys Gln Gly Asp145 150 155 160Ser Leu Arg Ser Tyr Tyr Ala Ser Trp
Tyr Gln Gln Lys Pro Gly Gln 165 170 175Ala Pro Val Leu Val Ile Tyr
Gly Lys Asn Asn Arg Pro Ser Gly Ile 180 185 190Pro Asp Arg Phe Ser
Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr 195 200 205Ile Thr Gly
Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser 210 215 220Arg
Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu225 230
235 240Thr Val Leu Gly91247PRTArtificial sequencescFv protein
GMBC669 91Gln Val Gln Leu Val Glu Ser Gly Gly Ala Leu Val Lys Pro
Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr
Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg
Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu
Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp
Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110Gln Gly Thr Leu Val
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser
Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Pro 130 135 140Ser
Ala Ser Gly Ser Pro Gly Gln Ser Val Thr Ile Ser Cys Thr Gly145 150
155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln
Gln 165 170 175His Pro Gly Lys Ala Pro Lys Phe Met Ile Tyr Asp Val
Ser Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser
Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Val Gln
Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Ser
Ala Ser Thr Val Ile Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr
Val Leu Gly 24592247PRTArtificial sequencescFv protein GMBC670
92Glu Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Ile Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Val Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val
Leu Gly 24593247PRTArtificial sequencescFv protein GMBC672 93Gln
Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala
20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr
Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser
Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu
Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr
Gly Met Asn Val Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly
Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly
Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr
Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170
175His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg
180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly
Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp
Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr
Arg Val Phe Gly Glu Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
24594243PRTArtificial sequencescFv protein GMBC673 94Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Gln Thr Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Pro Ile Gly Ser His 20 25 30Trp
Met Ser Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Ala Ser Ile Lys Gln Asp Gly Arg Glu Lys His Phe Val Asp Ser Val
50 55 60Lys Gly Arg Phe Gly Ile Ser Arg Asp Asn Ala Lys Asp Ser Leu
Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ile Glu Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Ala Arg Glu Thr Tyr Gly Gly Tyr Tyr Tyr Tyr Phe
Met Asp Val Trp 100 105 110Gly Arg Gly Thr Leu Val Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly 115 120 125Gly Gly Gly Ser Gly Gly Gly Gly
Ser Ser Glu Leu Thr Gln Asp Pro 130 135 140Ala Val Ser Val Ala Leu
Gly Gln Thr Val Arg Ile Thr Cys Gln Gly145 150 155 160Asp Ser Leu
Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly 165 170 175Gln
Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly 180 185
190Ile Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu
195 200 205Thr Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr
Tyr
Cys Gln 210 215 220Thr Trp Gly Pro Gly Ile Arg Val Phe Gly Gly Gly
Thr Lys Leu Thr225 230 235 240Val Leu Gly95247PRTArtificial
sequencescFv protein GMBC676 95Glu Val Gln Leu Val Gln Ser Gly Gly
Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser His Ala 20 25 30Trp Met Asn Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys
Ala Ser Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg
Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu
His Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys
Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110Arg Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Ala 130 135 140Ser Val Ser Gly Ser Pro Gly Gln Pro Ile Thr Ile
Ser Cys Thr Gly145 150 155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn
Tyr Val Ser Trp Tyr Gln Gln 165 170 175His Pro Gly Lys Ala Pro Lys
Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185 190Pro Ser Gly Val Ser
Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu
Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr
Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230
235 240Thr Lys Leu Thr Val Leu Gly 24596247PRTArtificial
sequencescFv protein GMBC678 96Glu Val Gln Leu Val Glu Ser Gly Gly
Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys
Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg
Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu
Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys
Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Pro 130 135 140Ser Ala Ser Gly Ser Pro Gly Gln Ser Val Thr Ile
Ser Cys Thr Gly145 150 155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn
Tyr Val Ser Trp Tyr Gln Gln 165 170 175His Pro Gly Lys Ala Pro Lys
Phe Met Ile Tyr Asp Val Ser Lys Arg 180 185 190Pro Ser Gly Val Ser
Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu
Thr Ile Ser Gly Val Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr
Cys Ser Ser Tyr Thr Ser Ala Ser Thr Val Ile Phe Gly Gly Gly225 230
235 240Thr Lys Leu Thr Val Leu Gly 24597247PRTArtificial
sequencescFv protein GMBC679 97Gln Val Gln Leu Val Glu Ser Gly Gly
Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys
Gly Ser Gly Gly Thr Thr Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg
Phe Thr Ile Ser Arg Asp Asp Ser Glu Asn Thr65 70 75 80Leu Tyr Leu
Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85 90 95Tyr Cys
Thr Trp Asp His Ser Tyr Tyr Tyr Asp Met Ala Val Trp Gly 100 105
110Arg Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Ala 130 135 140Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile
Ser Cys Thr Gly145 150 155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn
Tyr Val Ser Trp Tyr Gln Gln 165 170 175His Pro Gly Lys Ala Pro Lys
Leu Val Ile Tyr Glu Gly Ser Lys Arg 180 185 190Pro Ser Gly Val Ser
Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu
Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr
Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230
235 240Thr Lys Leu Thr Val Leu Gly 24598240PRTArtificial
sequencescFv protein GMBC681 98Gln Val Gln Leu Val Gln Ser Gly Gly
Gly Val Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Phe Ile Arg Tyr Asp
Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr
Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys
Gly Gly Thr Gly Tyr Phe Asp Leu Trp Gly Arg Gly Thr Leu 100 105
110Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
115 120 125Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro Ser Thr
Leu Ser 130 135 140Ala Ser Ile Gly Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Glu Gly145 150 155 160Ile Tyr His Trp Leu Ala Trp Tyr Gln
Gln Lys Pro Gly Lys Ala Pro 165 170 175Lys Leu Leu Ile Tyr Lys Ala
Ser Ser Leu Ala Ser Gly Ala Pro Ser 180 185 190Arg Phe Ser Gly Ser
Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 195 200 205Ser Leu Gln
Pro Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Ser 210 215 220Asn
Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg225 230
235 24099244PRTArtificial sequencescFv protein GMBC682 99Gln Val
Gln Leu Val Glu Ser Gly Gly Gly Val Val Lys Pro Gly Gly1 5 10 15Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Lys Phe Ser Asp Ala 20 25
30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala
Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys
Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp
Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly
Met Asn Val Trp Gly 100 105 110Arg Gly Thr Leu Val Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly
Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140Val Ser Val Ala Leu
Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155 160Ser Leu
Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln 165 170
175Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile
180 185 190Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser
Leu Thr 195 200 205Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr
Tyr Cys Asn Ser 210 215 220Arg Asp Ser Ser Gly Asn His Val Val Phe
Gly Gly Gly Thr Lys Leu225 230 235 240Thr Val Leu
Gly100241PRTArtificial sequencescFv protein GMBC683 100Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly
Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Ala Lys Arg Ala Ala Ala Gly Thr Leu Asp Tyr Trp
Gly Gln Gly Thr 100 105 110Thr Val Thr Val Ser Ser Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly Gly Ser Ser Glu Leu
Thr Gln Asp Pro Ala Val Ser Val 130 135 140Ala Leu Gly Gln Thr Val
Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg145 150 155 160Ser Tyr Tyr
Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val 165 170 175Leu
Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg 180 185
190Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly
195 200 205Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg
Asp Ser 210 215 220Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys
Leu Thr Val Leu225 230 235 240Gly101247PRTArtificial sequencescFv
protein GMBC684 101Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val
Lys Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe
Lys Phe Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly
Lys Gly Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly
Gly Thr Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile
Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn
Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp
Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110Gln Gly Thr
Pro Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly
Gly Ser Gly Gly Gly Gly Ser Gln Ser Ala Leu Thr Gln Pro Ala 130 135
140Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr
Gly145 150 155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser
Trp Tyr Gln Gln 165 170 175His Pro Gly Lys Ala Pro Lys Leu Met Ile
Tyr Glu Gly Ser Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe
Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser
Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser
Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240Thr
Lys Leu Thr Val Leu Gly 245102244PRTArtificial sequencescFv protein
GMBC685 102Gln Val Gln Leu Val Glu Ser Gly Gly Val Val Val Gln Pro
Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr
Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg
Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu
Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp
Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110Lys Gly Thr Met Val
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser
Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140Val
Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150
155 160Ser Leu Arg Ser Tyr Tyr Thr Asn Trp Phe Gln Gln Lys Pro Gly
Gln 165 170 175Ala Pro Leu Leu Val Val Tyr Ala Lys Asn Lys Arg Pro
Ser Gly Ile 180 185 190Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn
Thr Ala Ser Leu Thr 195 200 205Ile Thr Gly Ala Gln Ala Glu Asp Glu
Ala Asp Tyr Tyr Cys His Ser 210 215 220Arg Asp Ser Ser Gly Asn His
Val Leu Phe Gly Gly Gly Thr Lys Leu225 230 235 240Thr Val Leu
Gly103247PRTArtificial sequencescFv protein GMBC686 103Glu Val Gln
Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala
50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr
Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met
Asn Val Trp Gly 100 105 110Gln Gly Thr Thr Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly Ser Pro
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr Ser Ser
Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170 175His
Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185
190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr
195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala
Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
245104247PRTArtificial sequencescFv protein GMBC687 104Gln Val Gln
Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1 5 10 15Ser Val
Lys Val Ser Cys Lys Ala Pro Gly Asp Thr Phe Ser Asn Tyr 20 25 30Ile
Phe Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40
45Gly Gly Ile Ile Pro Lys Phe Gly Thr Val Asn Asp Ala His Lys Phe
50 55 60Gln Asp Arg Val Thr Ile Ala Ala Asp Glu Ser Thr Asn Thr Ala
Ser65 70 75 80Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Ala Cys Glu Pro Ile Pro Lys Asp Tyr Gly Asp Val
Asn Gly Leu Glu 100 105 110Ile Trp Gly Lys Gly Thr Met Val Thr Val
Ser Ser Gly Gly Gly Gly 115 120 125Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Asp Ile Gln Met Thr 130 135 140Gln Ser Pro Ser Thr Leu
Ser Ala Ser Ile Gly Asp Arg Val Thr Ile145 150 155 160Thr Cys Arg
Ala Ser Glu Gly Ile Tyr His Trp Leu Ala Trp Tyr Gln 165 170 175Gln
Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr
Lys Ala Ser Ser 180 185 190Leu Ala Ser Gly Ala Pro Ser Arg Phe Ser
Gly Ser Gly Ser Gly Thr 195 200 205Asp Phe Thr Leu Thr Ile Ser Ser
Leu Gln Pro Asp Asp Phe Ala Thr 210 215 220Tyr Tyr Cys Gln Gln Tyr
Ser Asn Tyr Pro Leu Thr Phe Gly Gly Gly225 230 235 240Thr Lys Leu
Glu Ile Lys Arg 245105247PRTArtificial sequencescFv protein GMBC689
105Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Pro 130 135 140Ser Ala Ser
Gly Ser Pro Gly Gln Ser Val Thr Ile Ser Cys Thr Gly145 150 155
160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175His Pro Gly Lys Ala Pro Lys Phe Met Ile Tyr Asp Val Ser
Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Val Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Ser Ala
Ser Thr Val Val Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val
Leu Gly 245106247PRTArtificial sequencescFv protein GMBC690 106Glu
Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10
15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala
20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr
Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser
Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu
Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr
Gly Met Asn Val Trp Gly 100 105 110Arg Gly Thr Leu Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly
Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser Gly
Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160Thr
Ser Ser Asp Val Gly Gly Tyr Ile Tyr Val Ser Trp Tyr Gln Gln 165 170
175His Pro Gly Arg Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg
180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly
Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp
Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr
Arg Val Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val Leu Gly
245107253PRTArtificial sequencescFv protein GMBC691 107Glu Val Gln
Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5 10 15Ser Met
Lys Val Ser Cys Lys Thr Ser Gly Asp Thr Phe Asn Gly Phe 20 25 30Tyr
Val His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40
45Gly Arg Ile Asn Pro Asn Gly Gly Gly Thr Asn Tyr Ala Gln Lys Phe
50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Met Asn Thr Ala
Tyr65 70 75 80Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Ala Arg Asp Leu Phe Tyr Asp Phe Trp Ser Asp Tyr
Tyr Arg Asn Asp 100 105 110Gln Tyr Tyr Tyr Met Asp Val Trp Gly Arg
Gly Thr Leu Val Thr Val 115 120 125Ser Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly 130 135 140Ser Ser Glu Leu Thr Gln
Asp Pro Ala Val Ser Val Ala Leu Gly Gln145 150 155 160Thr Val Arg
Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Ala 165 170 175Ser
Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr 180 185
190Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser
195 200 205Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln
Ala Glu 210 215 220Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser
Ser Gly Asn His225 230 235 240Val Val Phe Gly Gly Gly Thr Lys Leu
Thr Val Leu Gly 245 250108247PRTArtificial sequencescFv protein
GMBC692 108Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro
Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
Ser Asp Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr
Ile Asp Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg
Asp Asp Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu
Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp
Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110Arg Gly Thr Leu Val
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser
Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser
Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150
155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln
Gln 165 170 175His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly
Ser Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser
Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln
Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr
Arg Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr
Val Leu Gly 245109247PRTArtificial sequencescFv protein GMBC693
109Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110Lys Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asp Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val
Leu Gly 245110241PRTArtificial sequencescFv protein GMBC696 110Glu
Val Gln Leu Val Gln Ser Arg Ala Glu Val Lys Lys Pro Gly Ala1 5 10
15Ser Val Lys Val Ser Cys Lys Thr Ser Gly Tyr Thr Phe Asn Gly Tyr
20 25 30Tyr Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp
Met 35 40 45Gly Trp Ile Asp Pro Ile Asn Ser Val Thr Asn Tyr Ala Gln
Asn Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Asn
Thr Ala Tyr65 70 75 80Met Glu Leu Ser Arg Leu Thr Ser Asp Asp Thr
Ala Val Tyr Tyr Cys 85 90 95Ala Arg Ala Arg Val Ser Thr Ile Leu Gln
Tyr Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly Gly Ser Ser
Glu Leu Thr Gln Asp Pro Ala Val Ser Val 130 135 140Ala Leu Gly Gln
Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg145 150 155 160Ser
Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val 165 170
175Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg
180 185 190Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile
Thr Gly 195 200 205Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn
Ser Arg Asp Ser 210 215 220Ser Gly Asn His Val Val Phe Gly Gly Gly
Thr Lys Leu Thr Val Leu225 230 235 240Gly111242PRTArtificial
sequencescFv protein GMBC725 111Glu Val Gln Leu Val Gln Thr Gly Gly
Gly Val Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Phe Ile Leu Tyr Asp
Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr
Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys
Ser Ser Ser Ser Ala Ser Ala Phe Asp Ile Trp Arg Gln Arg 100 105
110Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
115 120 125Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala
Val Ser 130 135 140Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln
Gly Asp Ser Leu145 150 155 160Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln
Gln Lys Pro Gly Gln Ala Pro 165 170 175Val Leu Val Ile Tyr Gly Lys
Asn Asn Arg Pro Ser Gly Ile Pro Asp 180 185 190Arg Phe Ser Gly Ser
Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr 195 200 205Gly Ala Gln
Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp 210 215 220Ser
Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val225 230
235 240Leu Gly112247PRTArtificial sequencescFv protein GMBC727
112Glu Val Gln Leu Val Glu Ser Gly Gly Asp Thr Val Lys Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45Gly Arg Met Lys Ser Lys Gly Ser Gly Gly Thr Arg Asp
Tyr Ala Ala 50 55 60Pro Val Asn Gly Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Asn Thr
Glu Asp Thr Gly Val Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110Arg Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240Thr Lys Leu Thr Val
Leu Gly 245113244PRTArtificial sequencescFv protein GMBC729 113Gln
Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Lys Phe Ser Asp Ala
20 25 30Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Glu Tyr
Ala Ala 50 55 60Pro Val Lys Asp Arg Phe Ile Ile Ser Arg Asp Asp Ser
Lys Asp Thr65 70 75 80Leu Tyr Leu Gln Met Asp Ser Leu Lys Thr Glu
Asp Thr Ala Leu Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr
Gly Met Asn Val Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly
Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140Val Ser Val Ala
Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155 160Ser
Leu Arg Asn Tyr Tyr Thr Asn Trp Phe Gln Gln Lys Pro Gly Gln 165 170
175Ala Pro Leu Leu Val Val Tyr Ala Lys Asn Lys Arg Pro Ser Gly Ile
180 185 190Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser
Leu Thr 195 200 205Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr
Tyr Cys His Ser 210 215 220Arg Asp Ser Ser Gly Asn His Val Leu Phe
Gly Gly Gly Thr Lys Leu225 230 235 240Thr Val Leu
Gly114247PRTArtificial sequencescFv protein GMBC730 114Gln Val Gln
Leu Val Glu Ser Gly Gly Asp Ser Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Arg Met Lys Ser Lys Gly Ser Gly Gly Thr Arg Asp Tyr Ala Ala
50 55 60Pro Val Asn Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Asn Thr Glu Asp Thr
Gly Val Tyr 85 90 95Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met
Asp Val Trp Gly 100 105 110Lys Gly Thr Thr Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Ala 130
135 140Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr
Gly145 150 155 160Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser
Trp Tyr Gln Gln 165 170 175His Pro Gly Lys Ala Pro Lys Leu Met Ile
Tyr Glu Gly Ser Lys Arg 180 185 190Pro Ser Gly Val Ser Asn Arg Phe
Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205Ala Ser Leu Thr Ile Ser
Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Ser Ser
Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240Thr
Lys Leu Thr Val Leu Gly 245115245PRTArtificial sequencescFv protein
GMCC101 115Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro
Gly Ser1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe
Arg Thr Tyr 20 25 30Ala Ile Thr Trp Val Arg Gln Ala Pro Gly Gln Gly
Leu Glu Trp Met 35 40 45Gly Gly Ile Ile Pro Ile Ser Ala Thr Ala Asn
Tyr Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Ile Thr Ala Asp Glu
Ser Met Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser
Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Arg Glu Pro His
Tyr Phe Asp Asn Trp Gly Arg Gly Thr 100 105 110Met Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly
Gly Ser Ala Leu Pro Val Leu Thr Gln Pro Pro Ser Val 130 135 140Ser
Glu Ala Pro Arg Gln Gly Val Thr Ile Ser Cys Ser Gly Ser Ser145 150
155 160Ser Asn Ile Gly Asn Asn Ala Val Ser Trp Tyr Gln Gln Leu Pro
Gly 165 170 175Gln Ala Pro Lys Leu Leu Ile Tyr Tyr Asp Asp Leu Leu
Pro Ser Gly 180 185 190Val Ser Asp Arg Phe Ser Ala Ser Lys Ser Gly
Thr Ser Ala Ser Leu 195 200 205Ala Ile Ser Gly Leu Gln Ser Glu Asp
Glu Ala Asp Tyr Tyr Cys Ala 210 215 220Ala Trp Asp Asp Ser Leu Asn
Gly Val Ile Phe Gly Gly Gly Thr Gln225 230 235 240Leu Thr Val Leu
Ser 245116260PRTArtificial sequencescFv protein GMCC102 116Gln Val
Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5 10 15Ser
Val Lys Val Ser Cys Lys Ala Pro Gly Tyr Thr Phe Thr Ser Tyr 20 25
30Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45Gly Ile Ile Asn Pro Ser Gly Gly Ser Thr Ser Tyr Ala Gln Lys
Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr
Val Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala
Val Tyr Tyr Cys 85 90 95Ala Arg Gly Gly Ala Arg Ser Asn Asp Ser Ser
Gly Tyr Tyr Lys Ser 100 105 110Pro Leu Ser Tyr Tyr Tyr Gly Met Asp
Val Trp Gly Arg Gly Thr Met 115 120 125Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser Gly 130 135 140Gly Gly Gly Ser Ala
Gln Ser Val Leu Thr Gln Pro Pro Ser Ala Ser145 150 155 160Gly Thr
Pro Gly Gln Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser 165 170
175Asn Ile Gly Ser Asn Thr Val Asn Trp Tyr Gln Gln Leu Pro Gly Thr
180 185 190Ala Pro Lys Leu Leu Ile Tyr Ser Asn Asn Gln Arg Pro Ser
Gly Val 195 200 205Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser
Ala Ser Leu Ala 210 215 220Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala
Asp Tyr Tyr Cys Ala Ala225 230 235 240Trp Asp Asp Ser Leu Asn Gly
Val Val Phe Gly Gly Gly Thr Lys Val 245 250 255Thr Val Leu Gly
260117250PRTArtificial sequencescFv protein GMCC105 117Gln Val Gln
Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu
Arg Leu Ser Cys Thr Ala Ser Gly Phe Asn Leu Gly Ser His 20 25 30Gly
Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Ala Val Ile Gly Phe Asp Gly Thr Thr Lys Tyr Tyr Val Asp Ser Val
50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu
Ser65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Val Arg Glu Asp Tyr Tyr Tyr Asp Ser Ser Gly Tyr
Tyr Phe Asp Tyr 100 105 110Trp Gly Arg Gly Thr Leu Val Thr Val Ser
Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Ala Leu Ser Ser Glu Leu 130 135 140Thr Gln Asp Pro Phe Val
Ser Val Ala Leu Gly Gln Thr Val Arg Ile145 150 155 160Ala Cys Arg
Gly Asp Ser Leu Arg Asp Ser Tyr Ala Ser Trp Tyr Gln 165 170 175Gln
Lys Pro Gly Gln Ala Pro Arg Leu Leu Val Tyr Gly Asn Asn Leu 180 185
190Arg Pro Ser Gly Ile Pro Gly Arg Phe Ser Gly Ser Ser Ser Gly Asp
195 200 205Thr Ala Ser Leu Ser Ile Thr Glu Thr Gln Ala Gly Asp Glu
Ala Asp 210 215 220Tyr Tyr Cys Ser Ser Arg Gly Asn Ser Thr Ser Arg
Leu Tyr Val Phe225 230 235 240Gly Thr Gly Thr Lys Leu Thr Val Leu
Gly 245 250118245PRTArtificial sequencescFv protein GMCC106 118Gln
Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly1 5 10
15Thr Leu Ser Leu Thr Cys Ala Val Ser Val Gly Ser Ile Asn Glu Ser
20 25 30Asn Trp Trp Ser Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu
Trp 35 40 45Ile Gly Glu Ile Tyr Pro Thr Gly Thr Thr Asn Tyr Asn Pro
Ser Leu 50 55 60Glu Ser Arg Val Thr Ile Ser Val Asp Lys Ser Arg Asn
Leu Phe Ser65 70 75 80Leu Lys Leu Lys Ser Val Thr Ala Ala Asp Ser
Ala Met Tyr Phe Cys 85 90 95Ala Arg Asp Arg Trp Ala Gly Gly Phe Asp
Leu Trp Gly Arg Gly Thr 100 105 110Met Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly Gly Ser Ala
Gln Ser Val Leu Thr Gln Pro Pro Ser Ala 130 135 140Ser Gly Thr Pro
Gly Gln Arg Val Thr Ile Ser Cys Ser Gly Ser Ser145 150 155 160Ser
Asn Ile Gly Ser Asn Ser Val Tyr Trp Tyr Gln Gln Leu Pro Gly 165 170
175Thr Ala Pro Lys Leu Leu Ile Tyr Arg Asn Asn Gln Arg Pro Ser Gly
180 185 190Val Pro Asp Arg Phe Ser Ala Ser Lys Ser Gly Thr Ser Ala
Ser Leu 195 200 205Ala Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp
Tyr Tyr Cys Ala 210 215 220Ala Trp Asp Asp Ser Leu Ser Gly Leu Val
Phe Gly Gly Gly Thr Lys225 230 235 240Leu Thr Val Leu Gly
245119250PRTArtificial sequencescFv protein GMCC107 119Gln Val Gln
Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5 10 15Ser Val
Lys Val Ser Cys Arg Thr Ser Gly Tyr Thr Phe Thr Asp His 20 25 30Ser
Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Phe Glu Trp Met 35 40
45Gly Trp Ile Gly Ala Asp Ser Gly Ser Thr Gln Tyr Ser Arg Asn Phe
50 55 60Gln Gly Arg Leu Thr Ile Gly Arg Asp Thr Ser Ala Ser Thr Val
Tyr65 70 75 80Met Glu Leu Thr Ser Leu Arg Ser Glu Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Ala Arg Val Gly Gly Gly Gln Gly Trp Tyr Ser Gly
Met Asp Val Trp 100 105 110Gly Arg Gly Thr Leu Val Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly 115 120 125Gly Gly Gly Ser Gly Gly Gly Gly
Ser Ala Gln Ala Val Leu Thr Gln 130 135 140Pro Ser Ser Val Ser Gly
Ala Pro Gly Gln Arg Val Thr Ile Ser Cys145 150 155 160Thr Gly Ser
Ser Ser Asn Ile Gly Ala Ser Tyr Asp Val His Trp Tyr 165 170 175Gln
Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu Ile Tyr Asn Asn Asn 180 185
190Asn Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Arg Ser Gly
195 200 205Thr Ser Ala Ser Leu Ala Ile Thr Gly Leu Gln Ala Glu Asp
Glu Ala 210 215 220Asp Tyr Tyr Cys His Ser Tyr Asp Ser Asn Leu Ser
Gly Asp Val Phe225 230 235 240Gly Ser Gly Thr Lys Leu Thr Val Leu
Gly 245 250120255PRTArtificial sequencescFv protein GMCC108 120Glu
Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Glu Pro Gly Ala1 5 10
15Ser Val Thr Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ile Ser Tyr
20 25 30His Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp
Met 35 40 45Gly Ile Ile Asn Pro Ser Gly Gly Asp Thr Thr Tyr Ala Gln
Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser
Thr Val Tyr65 70 75 80Met Glu Leu Arg Ser Leu Arg Phe Glu Asp Thr
Ala Arg Tyr Tyr Cys 85 90 95Ala Arg Asp Leu Lys Phe Tyr Asp Phe Arg
Ser Gly Lys Tyr Gln Asp 100 105 110Tyr Gly Met Asp Val Trp Gly Gln
Gly Thr Leu Val Thr Val Ser Ser 115 120 125Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala 130 135 140Gln Ser Val Leu
Thr Gln Pro Pro Ser Leu Ser Val Ala Pro Gly Gln145 150 155 160Thr
Ala Ser Ile Thr Cys Gly Gly Asn Asp Ile Gly Thr Lys Ser Val 165 170
175His Trp Tyr Gln Leu Lys Pro Gly Gln Ala Pro Val Leu Val Val Tyr
180 185 190Asp Asn Arg Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser
Gly Ser 195 200 205Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Arg
Val Glu Gly Gly 210 215 220Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp
Asp Ser Ser Ile Asp His225 230 235 240Ser Glu Tyr Val Phe Gly Thr
Gly Thr Lys Leu Thr Val Leu Gly 245 250 255121244PRTArtificial
sequencescFv protein GMCC109 121Gln Val Gln Leu Gln Glu Ser Gly Gly
Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ala Met Ser Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Ala Ile Ser Gly Ser
Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr
Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys
Ser Gln Trp Ser Gly Ser Tyr Tyr Gly Ser Phe Asp Tyr Trp 100 105
110Gly Arg Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly
115 120 125Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Gln Ser Val Leu
Thr Gln 130 135 140Pro Pro Ser Val Ser Val Ser Pro Gly Gln Thr Ala
Thr Ile Thr Cys145 150 155 160Ser Gly Asp Lys Leu Gly Asp Lys Tyr
Val Ser Trp Tyr Gln Lys Lys 165 170 175Pro Gly Gln Ala Pro Val Leu
Val Ile Tyr Gln Asp Asp Lys Arg Pro 180 185 190Ser Gly Ile Pro Glu
Arg Phe Ser Gly Ser Asn Ser Gly Asn Thr Ala 195 200 205Thr Leu Thr
Ile Ser Gly Thr Gln Ala Met Asp Glu Gly Asp Tyr Tyr 210 215 220Cys
Gln Ala Trp Asp Arg Ser Val Ile Phe Gly Gly Gly Thr Lys Val225 230
235 240Thr Val Leu Gly122250PRTArtificial sequencescFv protein
GMCC110 122Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro
Ser Gln1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Ala Ser Ile
Ser Ser Gly 20 25 30Gly Tyr Arg Trp Ile Trp Ile Arg Gln His Pro Gly
Gln Gly Leu Glu 35 40 45Trp Ile Gly Asp Ile His Tyr Ser Gly Ser Thr
Gln Tyr Asn Pro Ser 50 55 60Leu Lys Ser Arg Val Ala Leu Thr Leu Asp
Arg Ser Lys Asn Gln Phe65 70 75 80Ser Leu Gln Leu Ser Ser Val Thr
Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95Cys Ala Arg Asp Pro Arg Gly
His Thr Tyr Gly Tyr Gly Tyr Tyr Phe 100 105 110Asp Tyr Trp Gly Lys
Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly 115 120 125Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Leu Ser Ser 130 135 140Glu
Leu Thr Gln Asp Pro Asp Val Ser Val Ala Leu Gly Gln Thr Val145 150
155 160Thr Ile Thr Cys Gln Gly Asp Arg Leu Arg Arg Tyr Tyr Ala Ser
Trp 165 170 175Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile
Phe Arg Lys 180 185 190Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe
Ser Gly Ser Ser Ser 195 200 205Gly Asp Thr Ala Ser Leu Thr Ile Thr
Gly Ala Gln Ala Glu Asp Glu 210 215 220Ala Asp Tyr Tyr Cys Asn Ser
Arg Asp Thr Ser Gly Thr Leu Ser Phe225 230 235 240Gly Gly Gly Thr
Gln Leu Thr Val Leu Ser 245 250123245PRTArtificial sequencescFv
protein GMCC112 123Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val
Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe
Ser Phe Ser Thr Tyr 20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly
Lys Gly Leu Glu Trp Val 35 40 45Ser Gly Val Ser Asp Gly Gly Asp Thr
Phe Tyr Ala Asp Ser Val Arg 50 55 60Gly Arg Phe Thr Leu Ser Arg Asp
Asn Ala Lys Asn Thr Leu Phe Leu65 70 75 80Gln Met Asn Ser Leu Thr
Ala Glu Asp Thr Ala Thr Tyr Tyr Cys Ala 85 90 95Lys Glu Ile Ala Arg
Ile Gly Val Pro Asn Phe Asp His Trp Gly Gln 100 105 110Gly Thr Leu
Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120 125Gly
Ser Gly Gly Gly Gly Ser Ala Leu Glu Thr Thr Leu Thr Gln Ser 130 135
140Pro Gly Thr Leu Ser Leu Ser Pro Gly Asp Arg Ala Thr Leu Ser
Cys145 150 155 160Arg Ala Ser Gln Ser Ile Arg Asn Asn Asp Val Ala
Trp Tyr Gln Gln 165 170 175Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile
Tyr Ser Ala Ser Arg Arg 180 185 190Ala Thr Asp Ile Pro Asp Arg Phe
Ser Gly Ser Ala Ser Gly Thr Asp 195 200 205Phe Thr Leu Thr Ile Ser
Arg Leu Glu Pro Glu Asp Phe Ala Met Tyr 210 215 220Tyr Cys Gln Gln
Tyr Gly Gly Ser Ala Ser Phe Gly Gln Gly Thr Arg225 230 235 240Leu
Glu Ile Lys Arg 245124250PRTArtificial sequencescFv protein GMCC114
124Glu Val Gln Leu Val Glu Ser Gly Pro Glu Val Lys Lys Pro Gly Ser1
5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Ala Ala Ala Phe Ser
Ser 20 25 30Tyr Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu
Glu Trp 35 40
45Met Gly Gly Ile Ile Pro Ile Ser Asp Thr Pro Lys Tyr Ala His Lys
50 55 60Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Thr Thr
Val65 70 75 80Phe Met Glu Val Ser Gly Leu Arg Ser Asp Asp Thr Ala
Val Tyr Tyr 85 90 95Cys Ala Thr Thr Thr Arg Tyr Gly Ser Gly Thr Tyr
Asp Tyr Met Asp 100 105 110Val Trp Gly Gln Gly Thr Met Val Thr Val
Ser Ser Gly Gly Gly Gly 115 120 125Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Ala Leu Ser Ser Glu 130 135 140Leu Thr Gln Asp Pro Ala
Val Ser Val Ala Leu Gly Gln Thr Val Arg145 150 155 160Ile Thr Cys
Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr 165 170 175Gln
Gln Lys Pro Gly Gln Ala Pro Val Leu Val Phe Tyr Gly Lys Asn 180 185
190Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser Thr Ser Gly
195 200 205Asn Thr Ala Ser Leu Ser Ile Thr Gly Ala Leu Ala Asp Asp
Glu Ala 210 215 220Asp Tyr Tyr Cys His Ser Arg Asp Thr Ser Gly Ala
Gln Ile Leu Phe225 230 235 240Gly Gly Gly Thr Lys Leu Thr Val Leu
Gly 245 250125251PRTArtificial sequencescFv protein GMCC118 125Glu
Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Phe Ser Phe Thr Asn Ala
20 25 30Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Gly Arg Ile Lys Ser Arg Asn Asp Gly Gly Ala Thr Asp Tyr
Ala Ala 50 55 60Pro Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser
Lys Asn Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Asp
Asp Thr Ala Val Tyr 85 90 95Tyr Cys Thr Thr Asp Asn Phe Pro Leu Arg
Phe Leu Glu Trp Leu Ser 100 105 110His Pro Asp Tyr Trp Gly Gln Gly
Thr Met Val Thr Val Ser Ser Gly 115 120 125Gly Gly Gly Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser Ala Gln 130 135 140Ala Val Leu Thr
Gln Pro Ser Ser Val Ser Val Ser Pro Gly Gln Thr145 150 155 160Val
Thr Ile Thr Cys Ser Gly Glu Lys Leu Asp Asn Lys Tyr Ile Ser 165 170
175Trp Tyr Gln Gln Arg Pro Gly Arg Ser Pro Ile Leu Val Ile Tyr Gln
180 185 190Asp Arg Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly
Ser Asn 195 200 205Ser Gly Asn Thr Ala Thr Leu Thr Ile Thr Gly Ser
Gln Pro Leu Asp 210 215 220Glu Ala Asp Tyr Tyr Cys Gln Ala Trp Asp
Ser Ser Thr Ala Trp Glu225 230 235 240Phe Gly Gly Gly Thr Lys Leu
Thr Val Leu Gly 245 250126252PRTArtificial sequencescFv protein
GMCC119 126Glu Val Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro
Gly Ala1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Asn Tyr Thr Phe
Thr Thr Tyr 20 25 30Asp Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly
Leu Glu Trp Met 35 40 45Gly Trp Ile Ser Thr Tyr Ser Gly Asn Thr Lys
Tyr Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr
Ser Thr Ser Ala Ala Tyr65 70 75 80Met Glu Leu Arg Asn Leu Arg Ser
Asp Asp Thr Ala Val Tyr Phe Cys 85 90 95Ala Arg Asp Ile Arg Val Trp
Arg Gly Ser Gly Ser Val His Tyr Phe 100 105 110Asp Pro Trp Gly Arg
Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly 115 120 125Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Gln Ser Ala 130 135 140Leu
Thr Gln Pro Arg Ser Val Ser Gly Ser Pro Gly Gln Ser Val Thr145 150
155 160Ile Ser Cys Thr Gly Thr Ser Asn Asp Val Gly Gly Tyr Asn Phe
Val 165 170 175Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu
Met Val Tyr 180 185 190Asn Val Ser Lys Arg Pro Ser Gly Val Pro Asp
Arg Phe Ser Gly Ser 195 200 205Lys Ser Gly Asn Thr Ala Ser Leu Thr
Ile Ser Gly Leu Gln Ala Glu 210 215 220Asp Glu Ala Asp Tyr Tyr Cys
Ser Ser Tyr Ala His Ser Tyr Thr Leu225 230 235 240Val Phe Gly Gly
Gly Thr Lys Val Thr Val Leu Gly 245 250127251PRTArtificial
sequencescFv protein GMCC124 127Gln Val Thr Leu Lys Glu Ser Gly Ala
Glu Val Lys Lys Pro Gly Ala1 5 10 15Ser Val Lys Val Ser Cys Lys Ala
Ser Gly Tyr Thr Phe Thr Asp Asn 20 25 30Ala Leu His Trp Val Arg Gln
Ala Pro Gly Gln Arg Pro Glu Trp Met 35 40 45Ala Trp Ile Asn Thr Ala
Asn Gly Asn Thr Arg Tyr Ser Gln Lys Phe 50 55 60Gln Gly Arg Leu Thr
Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Phe65 70 75 80Met Asp Leu
Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg
Gln Lys Ala Tyr Lys Asn Tyr Tyr Tyr Tyr Tyr Gly Met Asp 100 105
110Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly
115 120 125Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Gln Ser
Val Val 130 135 140Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln
Lys Val Thr Ile145 150 155 160Ser Cys Ser Gly Ser Ser Ser Asn Ile
Gly Asn Asn Tyr Val Ser Trp 165 170 175Tyr Gln Gln Leu Pro Gly Thr
Ala Pro Lys Leu Leu Ile Tyr Glu Asn 180 185 190Asn Lys Arg Pro Ser
Gly Ile Pro Asp Arg Phe Ser Gly Ser Gln Ser 195 200 205Gly Thr Ser
Ala Thr Leu Gly Ile Ser Gly Leu Gln Thr Gly Asp Glu 210 215 220Ala
Asp Tyr Tyr Cys Gly Thr Trp Asp Ser Ser Leu Arg Ala Gly Val225 230
235 240Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 245
250128247PRTArtificial sequencescFv protein GMCC125 128Glu Val Gln
Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser Asp Tyr 20 25 30Ser
Met His Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Leu 35 40
45Ser His Ile Gly Thr Ser Thr Ser Tyr Thr Asn Tyr Ala Asp Ser Val
50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Phe
Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Val Asp Asp Thr Ala Val
Tyr Phe Cys 85 90 95Ala Arg Gly Phe Gly Gly Leu Arg Gly Tyr Phe Asp
Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly Gly 115 120 125Gly Ser Gly Gly Gly Gly Ser Ala
Leu Ser Ser Glu Leu Thr Gln Asp 130 135 140Pro Ala Val Ser Val Ala
Leu Gly Gln Thr Val Lys Ile Thr Cys Gln145 150 155 160Gly Asp Arg
Leu Arg Arg Phe Tyr Ala Ser Trp Tyr Gln Gln Lys Pro 165 170 175Gly
Gln Ala Pro Leu Leu Leu Ile Tyr Gly Lys Asn Ser Arg Pro Ser 180 185
190Gly Ile Pro Asp Arg Phe Ser Gly Ser Thr Ser Gly Ala Thr Ala Ser
195 200 205Leu Thr Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr
Tyr Cys 210 215 220Asn Ser Arg Asp Ser Ser Gly Ser Leu His Ser Val
Phe Gly Thr Gly225 230 235 240Thr Lys Val Thr Val Leu Gly
245129246PRTArtificial sequencescFv protein GMCC126 129Gln Val Gln
Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln1 5 10 15Thr Leu
Ser Leu Ser Cys Ala Val Ser Gly Phe Ser Val Thr Ser Gly 20 25 30His
Tyr Trp Gly Trp Ile Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp 35 40
45Ile Gly Asn Ile Tyr His Thr Gly Ser Thr Arg Tyr Asn Pro Ser Leu
50 55 60Glu Ser Arg Val Ser Met Ser Val Asp Thr Ser Lys Asn Gln Phe
Ser65 70 75 80Leu Arg Leu Thr Ser Val Thr Ala Ala Asp Thr Ala Ile
Tyr Tyr Cys 85 90 95Ala Arg Val Gly Arg Gly Gln His Leu Val Arg Gly
Asp Phe Asp Tyr 100 105 110Trp Gly Arg Gly Thr Leu Val Thr Val Ser
Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Ala Gln Ser Val Leu Thr 130 135 140Gln Pro Pro Ser Ile Ser
Val Ser Pro Gly Gln Thr Ala Ser Ile Thr145 150 155 160Cys Ser Gly
Asp Glu Leu Gly His Lys Tyr Ala Ser Trp Tyr Gln Gln 165 170 175Lys
Pro Gly Gln Ser Pro Val Val Val Val Tyr Gln Asp Asn Lys Arg 180 185
190Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr
195 200 205Ala Thr Leu Thr Ile Ser Gly Thr Gln Ala Val Asp Glu Ala
Asp Tyr 210 215 220Phe Cys Gln Ala Trp Asp Ser Ser Ala Val Val Phe
Gly Gly Gly Thr225 230 235 240Lys Leu Thr Val Leu Gly
245130242PRTArtificial sequencescFv protein GMCC127 130Gln Val Gln
Leu Val Gln Ser Gly Gly Gly Val Val Arg Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30Gly
Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val
50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu
Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Ala Arg Arg Arg Tyr Ala Leu Asp Tyr Trp Gly Arg
Gly Thr Leu Val 100 105 110Thr Val Ser Ser Gly Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Ala Leu Ser Ser Glu
Leu Thr Gln Asp Pro Ala Val Ser 130 135 140Val Ala Leu Gly Gln Ala
Val Arg Ile Thr Cys Gln Gly Asp Ser Leu145 150 155 160Arg Thr Asn
Tyr Ala Ser Trp Tyr Gln Gln Arg Pro Gly Gln Ala Pro 165 170 175Val
Leu Val Ile Arg Gly Asn Asn Asn Arg Pro Ser Gly Ile Pro Asp 180 185
190Arg Phe Ser Gly Ser Asn Ser Gly Asp Thr Val Ser Leu Thr Ile Thr
195 200 205Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser
Arg Asp 210 215 220Thr Ser Gly Tyr His Tyr Val Phe Gly Thr Gly Thr
Lys Leu Thr Val225 230 235 240Leu Gly131246PRTArtificial
sequencescFv protein GMCC129 131Glu Val Gln Leu Val Glu Thr Gly Gly
Gly Leu Ala Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Glu Ala
Ser Gly Phe Thr Phe Asn Asn Tyr 20 25 30Ala Met Ser Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Gly Ile Ser Ile Ser
Gly Tyr Ser Thr Phe Tyr Thr Asp Ser Val 50 55 60Gln Gly Arg Phe Thr
Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met
Asn Ser Leu Gly Val Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys
Arg Arg Gly Glu Gly Gly Asp Phe Asp Tyr Trp Gly Arg Gly 100 105
110Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
115 120 125Ser Gly Gly Gly Gly Ser Ala Leu Ser Ser Glu Leu Thr Gln
Asp Pro 130 135 140Ala Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile
Thr Cys Gln Gly145 150 155 160Asp Ser Leu Arg Gly Tyr Tyr Ala Ser
Trp Tyr Gln Gln Lys Ala Gly 165 170 175Gln Ala Pro Val Leu Val Ile
Tyr Gly Lys Asn Asn Arg Pro Ser Gly 180 185 190Ile Pro Asp Arg Phe
Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu 195 200 205Thr Ile Thr
Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Tyr 210 215 220Ser
Arg Asp Arg Ser Gly Asn His Leu Gly Met Phe Gly Gly Gly Thr225 230
235 240Lys Val Thr Val Leu Gly 245132248PRTArtificial sequencescFv
protein GMCC131 132Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val
Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly
Ser Ile Arg Ser His 20 25 30Tyr Trp Ser Trp Met Arg Gln Pro Pro Gly
Lys Gly Leu Glu Trp Ile 35 40 45Gly Tyr Val Tyr Tyr Thr Gly Ser Thr
Asn Tyr Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Met Ser Val Asp
Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Asn Leu Ser Ser Val Thr
Ala Ala Asp Thr Ala Ile Tyr Tyr Cys Ala 85 90 95Arg Phe Pro Tyr Ser
Ser Gly Ser Asn Pro Leu Asp Tyr Trp Gly Arg 100 105 110Gly Thr Leu
Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120 125Gly
Ser Gly Gly Gly Gly Ser Ala Gln Ser Val Leu Thr Gln Pro Pro 130 135
140Ser Val Ser Ala Ala Pro Gly Gln Arg Val Thr Ile Ser Cys Thr
Gly145 150 155 160Ser Ser Ser Asn Ile Gly Ala Arg Tyr Asp Val His
Trp Tyr Gln His 165 170 175Leu Pro Gly Thr Ala Pro Lys Leu Leu Ile
Tyr Gly Asp Ser Asn Arg 180 185 190Pro Ser Gly Val Pro Asp Arg Phe
Ser Gly Ser Lys Ser Gly Thr Ser 195 200 205Ala Ser Leu Ala Ile Thr
Gly Leu Gln Pro Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Gln Ser
Tyr Asp Ser Ser Leu Ser Gly Val Val Phe Gly Gly225 230 235 240Gly
Thr Lys Val Thr Val Leu Gly 245133245PRTArtificial sequencescFv
protein GMCC136 133Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val
Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe
Thr Phe Ser Ser Tyr 20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly
Lys Gly Leu Glu Trp Val 35 40 45Ser Ala Ile Ser Gly Ser Gly Gly Ser
Thr Tyr Ser Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg
Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu
Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys Cys Trp Arg
Ser Gly Thr Ser Cys Pro Asp Gly Trp Gly Lys 100 105 110Gly Thr Met
Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120 125Gly
Ser Gly Gly Gly Gly Ser Ala Leu Glu Ile Val Leu Thr Gln Ser 130 135
140Pro Ala Thr Leu Ser Val Ser Pro Gly Glu Arg Ala Thr Leu Ser
Cys145 150 155 160Arg Thr Ser Gln Ser Val Gly Ser Lys Leu Ala Trp
Tyr Gln Gln Lys 165 170 175Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr
Asp Ala Ser Thr Gly Ala 180 185 190Thr Gly Asp Pro Ala Arg Phe Ser
Gly Ser Gly Ser Gly Thr Glu Phe 195 200 205Thr Leu Thr Ile Ser Asn
Leu Gln Ser Glu Asp Leu Ala Ile Tyr Tyr 210 215 220Cys Gln Gln Tyr
His
Lys Trp Pro Ile Thr Phe Gly Gln Gly Thr Arg225 230 235 240Leu Glu
Ile Lys Arg 245134248PRTArtificial sequencescFv protein GMCC138
134Glu Val Gln Leu Val Glu Thr Gly Pro Gly Leu Val Lys Pro Ser Gln1
5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser
Gly 20 25 30Gly Tyr Tyr Trp Ser Trp Ile Arg Gln Val Pro Gly Lys Gly
Leu Glu 35 40 45Trp Ile Gly Tyr Asn Phe Tyr Asn Gly Ser Thr Tyr Phe
Asn Pro Ser 50 55 60Leu Lys Ser Arg Ala Thr Ile Ser Ile Asp Thr Thr
Lys Asn Gln Phe65 70 75 80Ser Leu Lys Leu Ser Ser Val Thr Ala Ala
Asp Thr Ala Val Tyr Tyr 85 90 95Cys Ala Arg Gly Asn Gly Tyr Arg Tyr
Gly Arg Trp Phe Asp Pro Trp 100 105 110Gly Arg Gly Thr Leu Val Thr
Val Ser Ser Gly Gly Gly Gly Ser Gly 115 120 125Gly Gly Gly Ser Gly
Gly Gly Gly Ser Ala Leu Ser Tyr Glu Leu Thr 130 135 140Gln Pro Pro
Ser Val Ser Val Ser Pro Gly Gln Thr Ala Arg Ile Thr145 150 155
160Cys Ser Gly Asp Ala Leu Pro Lys Gln Tyr Ala Tyr Trp Tyr Gln Gln
165 170 175Lys Pro Gly Gln Ala Pro Val Leu Val Ile Ser Lys Asp Ser
Glu Arg 180 185 190Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Ser
Ser Gly Thr Thr 195 200 205Val Thr Leu Thr Ile Ser Gly Val Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220Tyr Cys Gln Ser Ala Asp Ser Ser
Gly Thr Tyr Trp Val Phe Gly Gly225 230 235 240Gly Thr Lys Val Thr
Val Leu Gly 245135246PRTArtificial sequencescFv protein GMCC142
135Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1
5 10 15Ser Val Thr Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ala
Tyr 20 25 30Tyr Ile Tyr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45Gly Met Ser Asn Pro Asn Gly Gly Tyr Thr Val Tyr Pro
Pro Asn Phe 50 55 60Leu Gly Arg Val Thr Thr Thr Pro Asp Thr Ser Thr
Asn Thr Ile Tyr65 70 75 80Met Glu Leu Arg Ser Leu Arg Ser Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Gly Arg Gly Arg Ala Pro Ser
Asn Ala Phe Asp Phe Trp Gly 100 105 110Arg Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125Gly Gly Ser Gly Gly
Gly Gly Ser Ala Leu Ser Ser Glu Leu Thr Gln 130 135 140Asp Pro Ala
Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys145 150 155
160Gln Gly Asp Ser Leu Lys Phe Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys
165 170 175Pro Gly Gln Ala Pro Val Leu Val Leu His Gly Lys Asn Asn
Arg Pro 180 185 190Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser Thr Ser
Arg Asp Thr Ala 195 200 205Ser Leu Thr Ile Thr Gly Thr Gln Ala Glu
Asp Glu Ala Asp Tyr Tyr 210 215 220Cys Asn Ser Arg Asp Asn Ser Asp
Asn Ile Val Phe Gly Thr Gly Thr225 230 235 240Lys Leu Thr Val Leu
Gly 245136250PRTArtificial sequencescFv protein GMCC151 136Gln Val
Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser
Leu Arg Leu Ser Cys Thr Ala Ser Gly Phe Asn Leu Gly Ser His 20 25
30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45Ala Val Ile Gly Phe Asp Gly Thr Thr Lys Tyr Tyr Val Asp Ser
Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr
Leu Ser65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala
Val Tyr Tyr Cys 85 90 95Val Arg Glu Asp Tyr Tyr Tyr Asp Ser Ser Gly
Tyr Tyr Phe Asp Tyr 100 105 110Trp Gly Arg Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser 115 120 125Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Ala Leu Ser Ser Glu Leu 130 135 140Thr Gln Asp Pro Phe
Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile145 150 155 160Ala Cys
Arg Gly Asp Ser Leu Arg Asp Ser Tyr Ala Ser Trp Tyr Gln 165 170
175Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Val Tyr Gly Asn Asn Leu
180 185 190Arg Pro Ser Gly Ile Pro Gly Arg Xaa Ser Gly Phe Ser Ser
Gly Asp 195 200 205Thr Ser Ser Leu Ala Ile Thr Glu Thr Gln Ala Gly
Asp Glu Ala Asp 210 215 220Tyr Tyr Cys Ser Ser Arg Gly Asn Ser Thr
Ser Arg Leu Tyr Val Phe225 230 235 240Gly Thr Gly Thr Lys Leu Thr
Val Leu Gly 245 250137747DNAArtificial
sequenceCDS(1)..(747)Polynucleotide encoding GMBC603 scFv protein
137cag gtc cag ctg gta cag tct ggg gga ggt gtg gta cgg cct ggg ggg
48Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Arg Pro Gly Gly1
5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga ttc aca ttt gat gat
tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp
Tyr 20 25 30ggc atg agc tgg gtc cgc caa gct cca ggg aag ggg ctg gag
tgg gtc 144Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45tct ggt att aat tgg aat ggt ggt agc aca ggt tat gca
gac tct gtg 192Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala
Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc aga gac aac gcc aag
aac tcc ctc tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys
Asn Ser Leu Tyr65 70 75 80ctc caa atg aac agt ctg aga gct gag gac
acc gcc ttg tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Leu Tyr Tyr Cys 85 90 95gca aaa gat ctg aat tac gat ttt tgg
agt ggt tcc ggt atg gac gtc 336Ala Lys Asp Leu Asn Tyr Asp Phe Trp
Ser Gly Ser Gly Met Asp Val 100 105 110tgg ggc cga gga acc ctg gtc
acc gtc tcc tca ggt gga ggc ggt tca 384Trp Gly Arg Gly Thr Leu Val
Thr Val Ser Ser Gly Gly Gly Gly Ser 115 120 125ggc gga ggt ggc agc
ggc ggt ggc gga tcg cag tct gtg ctg act cag 432Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln 130 135 140cct gcc tcc
gtg tct ggg tct cct gga cag tcg atc acc atc tcc tgc 480Pro Ala Ser
Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys145 150 155
160act gga acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac
528Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr
165 170 175caa caa cac cca ggc aaa gcc ccc aaa ctc atg att tat gag
ggc agt 576Gln Gln His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu
Gly Ser 180 185 190aag cgg ccc tca ggg gtt tct aat cgc ttc tct ggc
tcc aag tct ggc 624Lys Arg Pro Ser Gly Val Ser Asn Arg Phe Ser Gly
Ser Lys Ser Gly 195 200 205aac acg gcc tcc ctg aca atc tct ggg ctc
cag gct gag gac gag gct 672Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu
Gln Ala Glu Asp Glu Ala 210 215 220gat tat tac tgc agc tca tat aca
acc agg agc act cga gtt ttc ggc 720Asp Tyr Tyr Cys Ser Ser Tyr Thr
Thr Arg Ser Thr Arg Val Phe Gly225 230 235 240gga ggg acc aag ctg
acc gtc cta ggt 747Gly Gly Thr Lys Leu Thr Val Leu Gly
245138729DNAArtificial sequenceCDS(1)..(729)Polynucleotide encoding
GMBC604 scFv protein 138gaa gtg cag ctg gtg cag tct ggg gca gag gtg
aaa aag ccc ggg gag 48Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val
Lys Lys Pro Gly Glu1 5 10 15tcc ctg agg atc tca tgt aag ggt tct gga
tac acc ttt acc aac tac 96Ser Leu Arg Ile Ser Cys Lys Gly Ser Gly
Tyr Thr Phe Thr Asn Tyr 20 25 30tgg atc aac tgg gtg cgc cag gtg ccc
gga aaa ggc ctg gag tgg atg 144Trp Ile Asn Trp Val Arg Gln Val Pro
Gly Lys Gly Leu Glu Trp Met 35 40 45ggg atg att gat cct act gac tct
tat gcc aaa tac agc ccg tcc ttc 192Gly Met Ile Asp Pro Thr Asp Ser
Tyr Ala Lys Tyr Ser Pro Ser Phe 50 55 60caa ggc cac gtc acc atc tca
act gac aag tcc gtc agc act gcc tac 240Gln Gly His Val Thr Ile Ser
Thr Asp Lys Ser Val Ser Thr Ala Tyr65 70 75 80ctg cag tgg aga agc
ctg cag gcc tcg gac agc gcc ata tat tat tgt 288Leu Gln Trp Arg Ser
Leu Gln Ala Ser Asp Ser Ala Ile Tyr Tyr Cys 85 90 95gtg agg gga tac
agt tat gac ctt gac tac tgg ggc aag gga acc ctg 336Val Arg Gly Tyr
Ser Tyr Asp Leu Asp Tyr Trp Gly Lys Gly Thr Leu 100 105 110gtc acc
gtc tcg agt ggt gga ggc ggt tca ggc gga ggt ggc agc ggc 384Val Thr
Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 115 120
125ggt ggc gga tcg cag tct gtg ctg act cag cct gcc tcc gtg tct ggg
432Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala Ser Val Ser Gly
130 135 140tct cct gga cag tcg atc acc atc tcc tgc act gga acc agc
agt gac 480Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser
Ser Asp145 150 155 160gtt ggt ggt tat aac tat gtc tcc tgg tat caa
caa cac cca ggc aaa 528Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln
Gln His Pro Gly Lys 165 170 175gcc ccc aaa ctc atg att tat gag ggc
agt aag cgg ccc tcg ggg gtt 576Ala Pro Lys Leu Met Ile Tyr Glu Gly
Ser Lys Arg Pro Ser Gly Val 180 185 190tct aat cgc ttc tct ggc tcc
aag tct ggc aac acg gcc tcc ctg aca 624Ser Asn Arg Phe Ser Gly Ser
Lys Ser Gly Asn Thr Ala Ser Leu Thr 195 200 205atc tct ggg ctc cag
gct gag gac gag gct gat tat tac tgc agc tca 672Ile Ser Gly Leu Gln
Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser 210 215 220tat aca acc
agg agc act cga gtt ttc ggc gga ggg acc aag ctg acc 720Tyr Thr Thr
Arg Ser Thr Arg Val Phe Gly Gly Gly Thr Lys Leu Thr225 230 235
240gtc cta ggt 729Val Leu Gly139741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC605 scFv protein
139cag gtg cag ctg gtg cag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gaa acc tct ggt ttc aaa ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Glu Thr Ser Gly Phe Lys Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110aga ggc acc ctg gtc acc gtc
tcc tca ggt gga ggc ggt tca ggc gga 384Arg Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245140726DNAArtificial
sequenceCDS(1)..(726)Polynucleotide encoding GMBC606 scFv protein
140gag gtc cag ctg gtg cag tct ggg gga ggc gtg gtc cag cct ggg ggg
48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Gly1
5 10 15tcc ctg aga ctc tcc tgt gca gcg tct gga ttc acc ttc agt agc
tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser
Tyr 20 25 30ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg gag
tgg gtg 144Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45gca ttt ata cgg tat gat gga agt aat aaa tac tat gca
gac tcc gtg 192Ala Phe Ile Arg Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala
Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc aga gac aat tcc aag
aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr Leu Tyr65 70 75 80ctg caa atg aac agc ctg aga gct gag gac
acg gct gtg tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg aaa tcc tcg tcc ttt gcc aat gct
ttt gat atc tgg ggc caa gga 336Ala Lys Ser Ser Ser Phe Ala Asn Ala
Phe Asp Ile Trp Gly Gln Gly 100 105 110acc acg gtc acc gtc tcc tca
ggt gga ggc ggt tca ggc gga ggt ggc 384Thr Thr Val Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125agc ggc ggt ggc gga
tcg tct gag ctg act cag gac cct gct gtg tct 432Ser Gly Gly Gly Gly
Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser 130 135 140gtg gcc ttg
gga cag aca gtc agg atc aca tgc caa gga gac agc ctc 480Val Ala Leu
Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu145 150 155
160aga agc tat tat gcg agc tgg tac cag cag aag cca gga cag gcc cct
528Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro
165 170 175gta ctt gtc atc tat ggt aaa aac aac cgg ccc tca ggg atc
cca gac 576Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile
Pro Asp 180 185 190cga ttc tct ggc tcc agc tca gga aac aca gct tcc
ttg acc atc act 624Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser
Leu Thr Ile Thr 195 200 205ggg gct cag gcg gaa gat gag gct gac tat
tac tgt aac tcc cgg gac 672Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr
Tyr Cys Asn Ser Arg Asp 210 215 220agc agt ggt aac cat gtg gta ttc
ggc gga ggg acc aag ctg acc gtc 720Ser Ser Gly Asn His Val Val Phe
Gly Gly Gly Thr Lys Leu Thr Val225 230 235 240cta ggt 726Leu
Gly141741DNAArtificial sequenceCDS(1)..(741)Polynucleotide encoding
GMBC607 scFv protein 141gag gtg cag ctg gtg cag tct ggg gga ggc ttg
gta aag ccg ggg ggg 48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu
Val Lys Pro Gly Gly1 5 10
15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac gcc
96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala
20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag tgg
gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac tac
gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr
Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat tca
aaa aac atg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser
Lys Asn Met65 70 75 80ctg tat ctg gaa atg aac agt ctg aaa acc gag
gac aca gcc ctg tat 288Leu Tyr Leu Glu Met Asn Ser Leu Lys Thr Glu
Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tat tac
ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr
Gly Met Asn Val Trp Gly 100 105 110caa ggg aca atg gtc acc gtc tct
tca ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Met Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt ggc
gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly Gly
Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct ggg
tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser Gly
Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160acc
agc agt gac gtt ggt gat tat aac tat gtc tcc tgg tac caa caa 528Thr
Ser Ser Asp Val Gly Asp Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170
175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt aag cgg
576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg
180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag tct ggc
aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly
Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct gag gac
gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp
Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg agc act
cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr
Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc cta ggt
741Thr Lys Leu Thr Val Leu Gly 245142738DNAArtificial
sequenceCDS(1)..(738)Polynucleotide encoding GMBC608 scFv protein
142gaa gtg cag ctg gtg cag tct ggg gga ggc ttg gta cag cct ggc agg
48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg1
5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttt agt gac
tcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ser 20 25 30tac atg acc tgg atc cgc cag gct cca ggg gag ggg ctg gag
ttt gtt 144Tyr Met Thr Trp Ile Arg Gln Ala Pro Gly Glu Gly Leu Glu
Phe Val 35 40 45tca tat att agt agt ggt agt agt acc act tac tat aca
gac tct gtg 192Ser Tyr Ile Ser Ser Gly Ser Ser Thr Thr Tyr Tyr Thr
Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc agg gac aat tcc aaa
aac act ctg tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr Leu Tyr65 70 75 80cta caa atg aac agc ctg aga cct gag gac
acg gct gtg tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Pro Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg agg aga agc atc tcg tcc gac tac
tac tcc tac tac ttg gac gtc 336Ala Arg Arg Ser Ile Ser Ser Asp Tyr
Tyr Ser Tyr Tyr Leu Asp Val 100 105 110tgg ggc aag gga acc ctg gtc
acc gtc tcc tca ggt gga ggc ggt tca 384Trp Gly Lys Gly Thr Leu Val
Thr Val Ser Ser Gly Gly Gly Gly Ser 115 120 125ggc gga ggt ggc agc
ggc ggt ggc gga tcg tct gag ctg act cag gac 432Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp 130 135 140cct gct gtg
tct gtg gcc ttg gga cag aca gtc agg atc aca tgc caa 480Pro Ala Val
Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln145 150 155
160gga gac agc ctc aga agc tat tat gca agc tgg tac cag cag aag cca
528Gly Asp Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro
165 170 175gga cag gcc cct gta ctt gtc atc tat ggt aaa aac aac cgg
ccc tca 576Gly Gln Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg
Pro Ser 180 185 190ggg atc cca gac cga ttc tct ggc tcc agc tca gga
aac aca gct tcc 624Gly Ile Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly
Asn Thr Ala Ser 195 200 205ttg acc atc act ggg gct cag gcg gaa gat
gag gct gac tat tac tgt 672Leu Thr Ile Thr Gly Ala Gln Ala Glu Asp
Glu Ala Asp Tyr Tyr Cys 210 215 220aac tcc cgg gac agc agt ggt aac
cat gtg gta ttc ggc gga ggg acc 720Asn Ser Arg Asp Ser Ser Gly Asn
His Val Val Phe Gly Gly Gly Thr225 230 235 240aag ctg acc gtc cta
ggt 738Lys Leu Thr Val Leu Gly 245143741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC609 scFv protein
143cag gtg cag ctg gtg gag tct ggg gga ggc ttg gta aag cct ggg gag
48Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Glu1
5 10 15tca ctg aga ctc tcc tgt gaa gcc tct gga ttc gaa ttt aat tat
gcc 96Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Phe Glu Phe Asn Tyr
Ala 20 25 30tgg atg agt tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtt 144Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt agt aga agc gaa gct agt ggt ggg aca aca gac
tac gct gca 192Gly Arg Ser Arg Ser Glu Ala Ser Gly Gly Thr Thr Asp
Tyr Ala Ala 50 55 60ccc ctg caa gac aga ttc acc atc tca aga gat gat
tca aaa aac aca 240Pro Leu Gln Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat cta caa gtc aac agc ctg aaa atc
gag gac aca ggc gtg tat 288Leu Tyr Leu Gln Val Asn Ser Leu Lys Ile
Glu Asp Thr Gly Val Tyr 85 90 95ttc tgt aag tgg gag aaa tca gag tac
tac ggt atg gac gtc tgg ggc 336Phe Cys Lys Trp Glu Lys Ser Glu Tyr
Tyr Gly Met Asp Val Trp Gly 100 105 110cgg gga acc ccg gtc acc gtc
tcc tca ggt gga ggc ggt tca ggc gga 384Arg Gly Thr Pro Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ttg acg cag ccg ccc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Pro 130 135 140tca gtg tct
gcg gcc cca gga cag aag gtc acc att tcc tgc tct gga 480Ser Val Ser
Ala Ala Pro Gly Gln Lys Val Thr Ile Ser Cys Ser Gly145 150 155
160agc acc tcc aac att ggg aat aat tat gtc tcc tgg tac caa cag cac
528Ser Thr Ser Asn Ile Gly Asn Asn Tyr Val Ser Trp Tyr Gln Gln His
165 170 175cca ggc aaa gcc ccc aaa ctc atg att tat gat gtc agt aag
cgg ccc 576Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Asp Val Ser Lys
Arg Pro 180 185 190tca ggg gtc cct gac cga ttc tct ggc tcc aag tct
ggc aac tca gcc 624Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser
Gly Asn Ser Ala 195 200 205tcc ctg gac atc agt ggg ctc cag tct gag
gat gag gct gat tat tac 672Ser Leu Asp Ile Ser Gly Leu Gln Ser Glu
Asp Glu Ala Asp Tyr Tyr 210 215 220tgt gca gca tgg gat gac agc ctg
agt gaa ttt ctc ttc gga act ggg 720Cys Ala Ala Trp Asp Asp Ser Leu
Ser Glu Phe Leu Phe Gly Thr Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245144723DNAArtificial
sequenceCDS(1)..(723)Polynucleotide encoding GMBC610 scFv protein
144cag gtc acc ttg aag gag tct ggg gct gaa gtg aag aag cct ggg gcc
48Gln Val Thr Leu Lys Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1
5 10 15tca gtg aaa gtt tcc tgt aag act tct gga ttc aca ttc ggc gcc
tac 96Ser Val Lys Val Ser Cys Lys Thr Ser Gly Phe Thr Phe Gly Ala
Tyr 20 25 30tac atc cac tgg gtg cga cag gtc cct gga caa ggg ctt gag
tgg atg 144Tyr Ile His Trp Val Arg Gln Val Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45gga tgg atc gac cct aac aat ggt ggc aca aac tat gca
cag aaa ttt 192Gly Trp Ile Asp Pro Asn Asn Gly Gly Thr Asn Tyr Ala
Gln Lys Phe 50 55 60cag ggc agg gtc acc atg acc agg gac atg tcc acc
acc aca acc tac 240Gln Gly Arg Val Thr Met Thr Arg Asp Met Ser Thr
Thr Thr Thr Tyr65 70 75 80atg gag gtc agt ggg cta cat tct gac gac
acg gcc gtg tat tac tgt 288Met Glu Val Ser Gly Leu His Ser Asp Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg agg gcc aga gtg gcg aca atc ctt
gaa tat tgg ggc agg ggc acc 336Ala Arg Ala Arg Val Ala Thr Ile Leu
Glu Tyr Trp Gly Arg Gly Thr 100 105 110ctg gtc acc gtc tcc tca ggt
gga ggc ggt tca ggc gga ggt ggc agc 384Leu Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125ggc ggt ggc gga tcg
cct gag ctg act cag gac cct gct gtg tct gtg 432Gly Gly Gly Gly Ser
Pro Glu Leu Thr Gln Asp Pro Ala Val Ser Val 130 135 140gcc ttg gga
cag aca gtc agg atc aca tgc caa gga gac agc ctc aga 480Ala Leu Gly
Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg145 150 155
160agc tat tat gca agc tgg tac cag cag aag cca gga cag gcc cct gta
528Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val
165 170 175ctt gtc atc tat ggt aaa aac aac cgg ccc tca ggg atc cca
gac cga 576Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro
Asp Arg 180 185 190ttc tct ggc tcc agc tca gga aac aca gct tcc ttg
acc atc act ggg 624Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu
Thr Ile Thr Gly 195 200 205gct cag gcg gaa gat gag gct gac tat tac
tgt aac tcc cgg gac agc 672Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr
Cys Asn Ser Arg Asp Ser 210 215 220agt ggt aac cat gtg gta ttc ggc
gga ggg acc aag ctg acc gtc cta 720Ser Gly Asn His Val Val Phe Gly
Gly Gly Thr Lys Leu Thr Val Leu225 230 235 240ggt
723Gly145717DNAArtificial sequenceCDS(1)..(717)Polynucleotide
encoding GMBC612 scFv protein 145gag gtg cag ctg gtg gag tct ggg
gga ggc gtg gtc cag cct ggg ggg 48Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Val Val Gln Pro Gly Gly1 5 10 15tcc ctg aga ctc tcc tgt gca
gcg tct gga ttc agc ttc agt agt tat 96Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Phe Ser Phe Ser Ser Tyr 20 25 30ggc atg caa tgg gtc cgc
cag gct cca ggc aag ggg ctg gag tgg gtg 144Gly Met Gln Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45gca ttt ata cgg tat
gat gga agt att aaa tac tat gca gac tcc gtg 192Ala Phe Ile Arg Tyr
Asp Gly Ser Ile Lys Tyr Tyr Ala Asp Ser Val 50 55 60aag ggc cga ttc
acc gtc tcc aga gac aac tcc aag aac acg ctg tat 240Lys Gly Arg Phe
Thr Val Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg caa
atg aac agc ctg aga gcc gag gac acg gct gtc tat tac tgt 288Leu Gln
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg
aga ggt tat cga atc gtt gac tac tgg ggc caa gga acc ctg gtc 336Ala
Arg Gly Tyr Arg Ile Val Asp Tyr Trp Gly Gln Gly Thr Leu Val 100 105
110acc gtc tcc tca ggt gga ggc ggt tca ggc gga ggt ggc agc ggc ggt
384Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125ggc gga tcg gac atc cag atg acc cag tct cct tcc acc ctg
tcc cca 432Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu
Ser Pro 130 135 140tct att gga gac aga gtc acc atc acc tgc cgg gcc
agt gag ggt att 480Ser Ile Gly Asp Arg Val Thr Ile Thr Cys Arg Ala
Ser Glu Gly Ile145 150 155 160tat cac tgg ttg gcc tgg tat cag cag
aag cca ggg aaa gcc cct aaa 528Tyr His Trp Leu Ala Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Pro Lys 165 170 175ctc ctg atc tat aag gcc tct
agt tta gcc agt ggg gcc cca tca agg 576Leu Leu Ile Tyr Lys Ala Ser
Ser Leu Ala Ser Gly Ala Pro Ser Arg 180 185 190ttc agc ggc agt gga
tct ggg aca gat ttc act ctc acc atc agc agc 624Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser 195 200 205ctg cag cct
gat gat ttt gca act tat tac tgc caa caa tat agt aat 672Leu Gln Pro
Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Ser Asn 210 215 220tat
ccg ctc act ttc ggc gga ggg acc aag ctg gag atc aaa cgt 717Tyr Pro
Leu Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg225 230
235146735DNAArtificial sequenceCDS(1)..(735)Polynucleotide encoding
GMBC613 scFv protein 146aag gtg cag ctg gtg gag tct ggg gga ggc ttg
gtc cag cct ggg ggg 48Lys Val Gln Leu Val Glu Ser Gly Gly Gly Leu
Val Gln Pro Gly Gly1 5 10 15tcc ctg aga ctc tct tgt gca gcc tct gga
ttc acc att agt agc cat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Ile Ser Ser His 20 25 30tgg atg agc tgg gtc cgc cag gct ccg
ggg aag ggg ctg gag tgg gtg 144Trp Met Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45gcc agt ata aag caa gat gga cgt
gag aaa cac ttt gtg gat tct gtg 192Ala Ser Ile Lys Gln Asp Gly Arg
Glu Lys His Phe Val Asp Ser Val 50 55 60aag ggc cga ttc agc atc tcc
aga gac aac gcc aag aac tca ctg tat 240Lys Gly Arg Phe Ser Ile Ser
Arg Asp Asn Ala Lys Asn Ser Leu Tyr65 70 75 80ctg caa atg aac agc
ctg aga acc gag gac acg gct gtc tac tac tgt 288Leu Gln Met Asn Ser
Leu Arg Thr Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gag acg
tac ggg gga tac tac tat tac ttc atg gac gtc tgg 336Ala Arg Glu Thr
Tyr Gly Gly Tyr Tyr Tyr Tyr Phe Met Asp Val Trp 100 105 110ggc aaa
gga acc ctg gtc acc gtc tcc tca ggt gga ggc ggt tca ggc 384Gly Lys
Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly 115 120
125gga ggt ggc agc ggc ggt ggc gga tcg tct gag ctg act cag gac cct
432Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro
130 135 140gct gtg tct gtg gcc ttg gga cag aca gtc agg atc aca tgc
caa gga 480Ala Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys
Gln Gly145 150 155 160gac agc ctc aga agc tat tat gca agc tgg tac
cag cag aag cca gga 528Asp Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr
Gln Gln Lys Pro Gly 165 170 175cag gcc cct gta ctt gtc atc tat ggt
aaa aac aac cgg ccc tca ggg 576Gln Ala Pro Val Leu Val Ile Tyr Gly
Lys Asn Asn Arg Pro Ser Gly 180 185 190atc cca gac cga ttc tct ggc
tcc agc tca gga aac aca gct tcc ttg 624Ile Pro Asp Arg Phe Ser Gly
Ser Ser Ser Gly Asn Thr Ala Ser Leu 195 200 205acc atc act ggg gct
cag gcg gaa gat gag gct gac tat tac tgt aac 672Thr Ile Thr Gly Ala
Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn 210 215 220tcc cgg gac
agc agt ggt aac cat gtg gta ttc ggc gga ggg acc aag 720Ser Arg Asp
Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys225 230 235
240ctg acc gtc cta ggt 735Leu Thr Val Leu Gly
245147741DNAArtificial sequenceCDS(1)..(741)Polynucleotide encoding
GMBC614 scFv protein 147gag gtg cag ctg gtg cag tct ggg gga ggc ttg
gta aag ccg ggg ggg 48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu
Val Lys Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt
ttc act ttc agt gac gcc
96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala
20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag tgg
gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac tac
gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr
Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat tca
aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser
Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc gag
gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu
Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac tac
ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr
Gly Met Asn Val Trp Gly 100 105 110cga ggg aca atg gtc acc gtc tcg
agt ggt gga ggc ggt tca ggc gga 384Arg Gly Thr Met Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt ggc
gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly Gly
Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct ggg
tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser Gly
Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160acc
agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa 528Thr
Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170
175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt aag cgg
576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg
180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag tct ggc
aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly
Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct gag gac
gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp
Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg agc act
cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr
Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc cta ggt
741Thr Lys Leu Thr Val Leu Gly 245148741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC615 scFv protein
148gag gtg cag ctg gtg gag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc aaa ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Lys Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110aaa ggc acc ctg gtc gcc gtc
tcc tca ggt gga ggc ggt tca ggc gga 384Lys Gly Thr Leu Val Ala Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245149741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC616 scFv protein
149gag gtg cag ctg gtg gag tct ggg gga ggc ttg gta aag cct ggg ggg
48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agt aaa ggt agt ggt ggg aca aca gac
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Thr Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca aga gat gat
tca gaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Glu Asn Thr65 70 75 80ctg tat cta caa atg aac agc ctg aaa acc
gag gac aca gcc gta tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Val Tyr 85 90 95tac tgt acg tgg gac cat agt tat tat
tat gat atg gcc gtc tgg ggc 336Tyr Cys Thr Trp Asp His Ser Tyr Tyr
Tyr Asp Met Ala Val Trp Gly 100 105 110cgg gga acc ctg gtc acc gtc
tcc tca ggt gga ggc ggc tca ggc gga 384Arg Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct ccc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Pro 130 135 140ttc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Phe Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245150729DNAArtificial
sequenceCDS(1)..(729)Polynucleotide encoding GMBC617 scFv protein
150gag gtg cag ctg gtg gag act gga gga ggc ttg gtc cag cct ggg ggg
48Glu Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Gln Pro Gly Gly1
5 10 15tcc ctg aga ctc tcc tgt gca gcc tct ggg ttc acc gtc agt agc
aac 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Val Ser Ser
Asn 20 25 30tac atg agc tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45tca gtt att tat agc ggt ggt agc aca tac tac gca gac
tcc gtg aag 192Ser Val Ile Tyr Ser Gly Gly Ser Thr Tyr Tyr Ala Asp
Ser Val Lys 50 55 60ggc cga ttc acc atc tcc aga cac aat tcc aag aac
acg ctg tat ctt 240Gly Arg Phe Thr Ile Ser Arg His Asn Ser Lys Asn
Thr Leu Tyr Leu65 70 75 80caa atg aac agc ctg aga gct gag gac acg
gcc gtg tat tac tgt gcg 288Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys Ala 85 90 95aga ggt cta tgg ttc ggg gag tta ttg
tac tgg ggc cag ggc acc ctg 336Arg Gly Leu Trp Phe Gly Glu Leu Leu
Tyr Trp Gly Gln Gly Thr Leu 100 105 110gtc acc gtc tcc tca ggt gga
ggc ggt tca ggc gga ggt ggc agc ggc 384Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser Gly 115 120 125ggt ggc gga tcg cag
tct gcc ctg act cag cct gcc tcc gtg tct gga 432Gly Gly Gly Ser Gln
Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly 130 135 140tct cgt gga
cag tcg atc acc atc tcc tgc act gga acc act ggt gac 480Ser Arg Gly
Gln Ser Ile Thr Ile Ser Cys Thr Gly Thr Thr Gly Asp145 150 155
160gtt ggt ggt tat gac tat gtc tcc tgg tac caa cag cac cca ggc aaa
528Val Gly Gly Tyr Asp Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys
165 170 175gcc ccc aaa ctc ctc atc tat ggt aac agc aat cgg ccc tca
ggg gtc 576Ala Pro Lys Leu Leu Ile Tyr Gly Asn Ser Asn Arg Pro Ser
Gly Val 180 185 190cct gat cgc ttc tct gcc tcc aag tcc ggc aat acg
gcc tcc ctg acc 624Pro Asp Arg Phe Ser Ala Ser Lys Ser Gly Asn Thr
Ala Ser Leu Thr 195 200 205atc tct gga ctc cag gct gag gat gag gct
gat tat ttc tgc agc aca 672Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala
Asp Tyr Phe Cys Ser Thr 210 215 220tat gca ccc ccc ggt att att atg
ttc ggc gga ggg acc aag ctg acc 720Tyr Ala Pro Pro Gly Ile Ile Met
Phe Gly Gly Gly Thr Lys Leu Thr225 230 235 240gtc cta ggt 729Val
Leu Gly151741DNAArtificial sequenceCDS(1)..(741)Polynucleotide
encoding GMBC618 scFv protein 151gaa gtg cag ctg gtg cag tct ggg
gga ggc ttg gta aag ccg ggg ggg 48Glu Val Gln Leu Val Gln Ser Gly
Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca
gcc tct ggt ttc aaa ttc gat gac gcc 96Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Phe Lys Phe Asp Asp Ala 20 25 30tgg atg aac tgg gtc cgc
cag gct cca ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agc
aaa cgt agt ggt ggg aca ata gac tac gct gca 192Gly Arg Ile Lys Ser
Lys Arg Ser Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac
aga ttc acc atc tca cga gat gat tca aaa aac acg 240Pro Val Lys Asp
Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat
ctg caa atg aat agt ctg aga acc gag gac aca gcc ttg tat 288Leu Tyr
Leu Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Leu Tyr 85 90 95tac
tgt acg tgg gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr
Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110aga ggc acc ctg gtc acc gtc tcc tca ggc gga ggc ggt tca ggc gga
384Arg Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125ggt ggc agc ggc ggt ggc gga tcg cag tct gtg ctg act cag
cca ccc 432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Pro 130 135 140tca gcg tct ggg acc ccc ggg cag agg gtc acc atc
tct tgt tct gga 480Ser Ala Ser Gly Thr Pro Gly Gln Arg Val Thr Ile
Ser Cys Ser Gly145 150 155 160agc agc tcc aac atc ggg agt aac act
gta aac tgg tac cag cga ctc 528Ser Ser Ser Asn Ile Gly Ser Asn Thr
Val Asn Trp Tyr Gln Arg Leu 165 170 175cca gga gcg gcc ccc caa ctc
ctc atc tac aat aat gac cag cgg ccc 576Pro Gly Ala Ala Pro Gln Leu
Leu Ile Tyr Asn Asn Asp Gln Arg Pro 180 185 190tca ggg atc cct gac
cga ttc tct ggc tcc aag tct ggc acc tca ggc 624Ser Gly Ile Pro Asp
Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Gly 195 200 205tcc ctg gtc
atc agt ggg ctc cag tct gaa gat gag gct gat tac tac 672Ser Leu Val
Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala Asp Tyr Tyr 210 215 220tgt
gcg tca tgg gat gac agt ctg aat ggt cgg gtg ttc ggc gga ggg 720Cys
Ala Ser Trp Asp Asp Ser Leu Asn Gly Arg Val Phe Gly Gly Gly225 230
235 240acc aag ctg acc gtc cta ggt 741Thr Lys Leu Thr Val Leu Gly
245152732DNAArtificial sequenceCDS(1)..(732)Polynucleotide encoding
GMBC619 scFv protein 152gag gtc cag ctg gtg gag tct ggg gga ggc gtg
gtc cag cct ggg agg 48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val
Val Gln Pro Gly Arg1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga
ttc acc ttc agg agc tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Arg Ser Tyr 20 25 30ggc atg cac tgg gtc cgc cag gct cca
ggc aag ggg ctg gag tgg gtg 144Gly Met His Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45gca gtt ata aca tat gat gga agt
aat aaa tac tat gca gac tcc gtg 192Ala Val Ile Thr Tyr Asp Gly Ser
Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc
aga gac aat tcc aag aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg caa atg aac agc
ctg aga gct gac gac acg gct gtg tat tac tgt 288Leu Gln Met Asn Ser
Leu Arg Ala Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gat ggg
ggt ggc tgg tac cac ccg agg ctt gac tac tgg ggc 336Ala Arg Asp Gly
Gly Gly Trp Tyr His Pro Arg Leu Asp Tyr Trp Gly 100 105 110caa ggg
aca atg gtc acc gtc tcg agt ggt gga ggc ggt tca ggc gga 384Gln Gly
Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120
125ggt ggc agc ggc ggt ggc gga tcg tct gag ctg act cag gac cct gct
432Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala
130 135 140gtg tct gtg gcc ttg gga cag aca gtc agg atc aca tgc caa
gga gac 480Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln
Gly Asp145 150 155 160agc ctc aga agc tat tat gca agc tgg tac cag
cag aag cca gga cag 528Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln
Gln Lys Pro Gly Gln 165 170 175gcc cct gta ctt gtc atc tat ggt aaa
aac aac cgg ccc tca ggg atc 576Ala Pro Val Leu Val Ile Tyr Gly Lys
Asn Asn Arg Pro Ser Gly Ile 180 185 190cca gac cga ttc tct ggc tcc
agc tca gga aac aca gct tcc ttg acc 624Pro Asp Arg Phe Ser Gly Ser
Ser Ser Gly Asn Thr Ala Ser Leu Thr 195 200 205atc act ggg gct cag
gcg gaa gat gag gct gac tat tac tgt aac tcc 672Ile Thr Gly Ala Gln
Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser 210 215 220cgg gac agc
agt ggt aac cat gtg gta ttc ggc gga ggg acc aag ctg 720Arg Asp Ser
Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu225 230 235
240acc gtc cta ggt 732Thr Val Leu Gly153741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC620 scFv protein
153gag gtg cag ctg gtg gag tcc ggg gga ggc ttg gta aag ccg ggg ggg
48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca
gcc tct ggt ttc act ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cgc
cag gct cca ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agc
aaa ggt agt ggt ggg aca ata gac tac gcc gcg 192Gly Arg Ile Lys Ser
Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac
aga ttc acc atc tca cga gat gat tca aaa aac acg 240Pro Val Lys Asp
Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat
ctg caa atg aac agt ctg aaa acc gag gac aca gcc ctg tat 288Leu Tyr
Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95tac
tgt acg tgg gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr
Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110cgg ggg aca atg gtc acc gtc tcg agt ggt gga ggc ggt tca ggc gga
384Arg Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125ggt ggc agc ggc ggt ggc gga tcg cag tct gtg ctg act cag
cct gcc 432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Ala 130 135 140tcc gtg tct ggg tct cct gga cag tcg atc acc atc
tcc tgc act gga 480Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile
Ser Cys Thr Gly145 150 155 160acc agc agt gac gtt ggt ggt tat aac
tat gtc tcc tgg tac caa caa 528Thr Ser Ser Asp Val Gly Gly Tyr Asn
Tyr Val Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aaa gcc ccc aaa
ctc atg att tat gag ggc agt aag cgg 576His Pro Gly Lys Ala Pro Lys
Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185 190ccc tca ggg gtt tct
aat cgc ttc tct ggc tcc aag tct ggc aac acg 624Pro Ser Gly Val Ser
Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205gcc tcc ctg
aca atc tct ggg ctc cag gct gag gac gag gct gat tat 672Ala Ser Leu
Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac
tgc agc tca tat aca acc agg agc act cga gtt ttc ggc gga ggg 720Tyr
Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230
235 240acc aag ctg acc gtc cta ggg 741Thr Lys Leu Thr Val Leu Gly
245154723DNAArtificial sequenceCDS(1)..(723)Polynucleotide encoding
GMBC621 scFv protein 154gaa gtg cag ctg gtg cag tct ggg gga ggc gtg
gtc cag cct ggg agg 48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val
Val Gln Pro Gly Arg1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga
ttc acc ttc agt agc tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Ser Tyr 20 25 30ggc atg cac tgg gtc cgc cag gct cca
ggc aag ggg ctg gag tgg gtg 144Gly Met His Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45gca gtt ata tca tat gat gga agt
aat aaa tac tat gca gac tcc gtg 192Ala Val Ile Ser Tyr Asp Gly Ser
Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc
aga gac aat tcc aag aat acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg caa atg gac agc
ctg aga gcc gag gac acg gcc gta tat ttc tgt 288Leu Gln Met Asp Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr Phe Cys 85 90 95gcg aaa aga ggt
cta tgg acg cca att gac tac tgg ggc aaa gga acc 336Ala Lys Arg Gly
Leu Trp Thr Pro Ile Asp Tyr Trp Gly Lys Gly Thr 100 105 110ctg gtc
acc gtc tcc tca ggt gga ggc ggt tca ggc gga ggt ggc agc 384Leu Val
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120
125ggc ggt ggc gga tcg tct gag ctg act cag gac cct gct gtg tct gtg
432Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val
130 135 140gcc ttg gga cag aca gtc agg atc aca tgc caa gga gac agc
ctc aga 480Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser
Leu Arg145 150 155 160agc tat tat gca agc tgg tac cag cag aag cca
gga cag gcc cct gta 528Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro
Gly Gln Ala Pro Val 165 170 175ctt gtc atc tat ggt aaa aac aac cgg
ccc tca ggg atc cca gac cga 576Leu Val Ile Tyr Gly Lys Asn Asn Arg
Pro Ser Gly Ile Pro Asp Arg 180 185 190ttc tct ggc tcc aac tca gga
aac aca gct tcc ttg acc atc act ggg 624Phe Ser Gly Ser Asn Ser Gly
Asn Thr Ala Ser Leu Thr Ile Thr Gly 195 200 205gct cag gcg gaa gat
gag gct gac tat tac tgt aac tcc cgg gac agc 672Ala Gln Ala Glu Asp
Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser 210 215 220agt ggt aac
cat gtg gta ttc ggc gga ggg acc aag ctg acc gtc cta 720Ser Gly Asn
His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu225 230 235
240ggt 723Gly155741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC625 scFv protein
155gaa gtg cag ctg gtg cag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agt aaa cgt agt ggt ggg aca ata gac
tac gcc gca 192Gly Arg Ile Lys Ser Lys Arg Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa gac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asp Thr65 70 75 80atg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Met Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110caa ggg aca atg gtc acc gtc
tcg agt ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Met Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc ttt ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Phe Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245156741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC626 scFv protein
156gaa gtg cag ctg gtg cag tct ggg gga ggc ttg gta aag cct ggg gag
48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Glu1
5 10 15tca ctg aga ctc tcc tgt gaa gcc tct gga ttc gaa ttt aat tat
gcc 96Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Phe Glu Phe Asn Tyr
Ala 20 25 30tgg atg agt tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtt 144Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt agt aga agc gaa gct agt ggt ggg aca aca gac
tac gct gca 192Gly Arg Ser Arg Ser Glu Ala Ser Gly Gly Thr Thr Asp
Tyr Ala Ala 50 55 60ccc ctg caa gac aga ttc acc atc tca aga gat gat
tca aaa aac aca 240Pro Leu Gln Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat cta caa gtc aac agc ctg aaa atc
gag gac aca ggc gtg tat 288Leu Tyr Leu Gln Val Asn Ser Leu Lys Ile
Glu Asp Thr Gly Val Tyr 85 90 95ttc tgt aag tgg gag aaa tca gag tac
tac ggt atg gac gtc tgg ggc 336Phe Cys Lys Trp Glu Lys Ser Glu Tyr
Tyr Gly Met Asp Val Trp Gly 100 105 110cgg gga acc ccg gtc acc gtc
tcc tca ggt gga ggc ggt tca ggc gga 384Arg Gly Thr Pro Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aag gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cgg gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Arg Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc aag
agc act caa gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Lys
Ser Thr Gln Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245157732DNAArtificial
sequenceCDS(1)..(732)Polynucleotide encoding GMBC627 scFv protein
157ggg gtc cag ctg gta cag tct gga ggt gag gtg aag aag cct ggg gcc
48Gly Val Gln Leu Val Gln Ser Gly Gly Glu Val Lys Lys Pro Gly Ala1
5 10 15tca gtg agg gtc tcc tgc aag gct tcc cgt tac atc ttt agt aac
tat 96Ser Val Arg Val Ser Cys Lys Ala Ser Arg Tyr Ile Phe Ser Asn
Tyr 20 25 30ggt ttc agc tgg gtg cga cag gcc ccc gga caa ggg ctt gag
tgg atg 144Gly Phe Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45ggg tcg atc agg aat gac aaa ggt agc aca aat tat gca
cag ggg ttc 192Gly Ser Ile Arg Asn Asp Lys Gly Ser Thr Asn Tyr Ala
Gln Gly Phe 50 55 60cag gac aga ctc acc atg acc aca gac aca tcc acg
aac aca gtc ttc 240Gln Asp Arg Leu Thr Met Thr Thr Asp Thr Ser Thr
Asn Thr Val Phe65 70 75 80atg gag ctg agg agc ctg agt tct gac gac
acg gcc gtg tat tac tgt 288Met Glu Leu Arg Ser Leu Ser Ser Asp Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg agt gcc ccc tac tat tac ggt atg
ggc atc tgg ggc aag gga acc 336Ala Ser Ala Pro Tyr Tyr Tyr Gly Met
Gly Ile Trp Gly Lys Gly Thr 100 105 110ctg gtc acc gtc tcg agt ggt
gga ggc ggt tca ggc gga ggt ggc agc 384Leu Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125ggc ggt ggc gga tcg
cag tct gtg ctg act cag cct gcc tcc gtg tct 432Gly Gly Gly Gly Ser
Gln Ser Val Leu Thr Gln Pro Ala Ser Val Ser 130 135 140ggg tct tct
gga cag tcg atc acc atc tcc tgc act gga acc agc agt 480Gly Ser Ser
Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser145 150 155
160gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa cac cca ggc
528Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly
165 170 175aaa gcc ccc aaa ctc atg att tat gag gtc ggt aat cgg ccc
tca ggg 576Lys Ala Pro Lys Leu Met Ile Tyr Glu Val Gly Asn Arg Pro
Ser Gly 180 185 190gtt tct aat cgc ttc tct ggc tcc aag tct ggc aac
acg gcc tcc ctg 624Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn
Thr Ala Ser Leu 195 200 205aca atc tct ggg ctc cag gct gag gac gag
gct gat tat tac tgc agc 672Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu
Ala Asp Tyr Tyr Cys Ser 210 215 220tca tat aca acc agg agc act cga
gtt ttc ggc gga ggg acc aag ctg 720Ser Tyr Thr Thr Arg Ser Thr Arg
Val Phe Gly Gly Gly Thr Lys Leu225 230 235 240acc gtc cta ggt
732Thr Val Leu Gly158747DNAArtificial
sequenceCDS(1)..(747)Polynucleotide encoding GMBC628 scFv protein
158cag gta cag ctg cag cag tca ggg gct gag gtg aag aag cct ggg gcc
48Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1
5 10 15tca gtg agg gtc tcc tgc aag gct tct ggt tac acc ttt acc agc
tat 96Ser Val Arg Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser
Tyr 20 25 30ggt ttc agc tgg gtg cga cag gcc cct ggg caa agg ctt gag
tgg atg 144Gly Phe Ser Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu
Trp Met 35 40 45gga tgg atc agc gct tac aaa gga aac gcg aac tat gca
gag aag ttc 192Gly Trp Ile Ser Ala Tyr Lys Gly Asn Ala Asn Tyr Ala
Glu Lys Phe 50 55 60cag ggc aga gtc acc atg acc aca gac aca tcc acg
aac aca gcc tac 240Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr
Asn Thr Ala Tyr65 70 75 80atg gaa ctg agg agc ctg aga tct gac gac
acg gcc gtg tat tac tgt 288Met Glu Leu Arg Ser Leu Arg Ser Asp Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga act cgg ata tca gtg gct ggc
cta gac tac tac tac tac ggt 336Ala Arg Thr Arg Ile Ser Val Ala Gly
Leu Asp Tyr Tyr Tyr Tyr Gly 100 105 110ttg gac gtc tgg ggg agg gga
acc ctg gtc acc gtc tcc tca ggt gga 384Leu Asp Val Trp Gly Arg Gly
Thr Leu Val Thr Val Ser Ser Gly Gly 115 120 125ggc ggt tca ggc gga
ggt ggc agc ggc ggt ggc gga tcg tct gag ctg 432Gly Gly Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu 130 135 140act cag gac
cct gct gtg tct gtg gcc ttg gga cag aca gtc agg atc 480Thr Gln Asp
Pro Ala Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile145 150 155
160act tgc caa gga gac agt ctc aga agc tat tac aca aac tgg ttc cag
528Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Thr Asn Trp Phe Gln
165 170 175cag aag cca gga cag gcc cct cta ctt gtc gtc tat gct aaa
aac aac 576Gln Lys Pro Gly Gln Ala Pro Leu Leu Val Val Tyr Ala Lys
Asn Asn 180 185 190cgg ccc tca ggg atc cca gac cga ttc tct ggc tcc
agc tca gga aac 624Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser
Ser Ser Gly Asn 195 200 205aca gct tcc ttg acc atc act ggg gct caa
gcg gaa gat gag gct gac 672Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln
Ala Glu Asp Glu Ala Asp 210 215 220tat tac tgt aac tcc cgg gac agc
agt ggt aac cat gtg gta ttc ggc 720Tyr Tyr Cys Asn Ser Arg Asp Ser
Ser Gly Asn His Val Val Phe Gly225 230 235 240gga ggg acc aag ctg
acc gtc cta ggt 747Gly Gly Thr Lys Leu Thr Val Leu Gly
245159732DNAArtificial sequenceCDS(1)..(732)Polynucleotide encoding
GMBC629 scFv protein 159cag gtg cag ctg gtg gag tct ggg gga ggc ttg
gta aag ccg ggg ggg 48Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu
Val Lys Pro Gly Gly1 5 10
15tcc ctt aga ctc tcc tgt gca ggc tct ggt ttc aaa ttc agt gac gcc
96Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Lys Phe Ser Asp Ala
20 25 30tgg atg aat tgg gtc cgc cag gct cca ggg aag ggg ctg gag tgg
gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gag tac
gct gta 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Glu Tyr
Ala Val 50 55 60ccc gtg aaa gac aga ttc atc atc tca cga gat gat tca
aaa gac acg 240Pro Val Lys Asp Arg Phe Ile Ile Ser Arg Asp Asp Ser
Lys Asp Thr65 70 75 80ttg tat ctg caa atg aac agt ctg aaa acc gag
gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu
Asp Thr Ala Leu Tyr 85 90 95tat tgt acg tgg gac tgg gat ttc tac tac
ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr
Gly Met Asn Val Trp Gly 100 105 110cag gga acc ctg gtc acc gtc tcg
agt ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Leu Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt ggc
gga tcg tct gag ctg act cag gac cct gct 432Gly Gly Ser Gly Gly Gly
Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140gtg tct gtg gcc
ttg gga cag aca gtc agg atc act tgc caa gga gac 480Val Ser Val Ala
Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155 160agt
ctc aga agc tat tac aca aac tgg ttc cag cag aag cca gga cag 528Ser
Leu Arg Ser Tyr Tyr Thr Asn Trp Phe Gln Gln Lys Pro Gly Gln 165 170
175gcc cct cta ctt gtc gtc tat gct aaa aat aag cgg ccc tca ggg atc
576Ala Pro Leu Leu Val Val Tyr Ala Lys Asn Lys Arg Pro Ser Gly Ile
180 185 190cca gac cga ttc tct ggc tcc agc tca gga aac aca gct tcc
ttg acc 624Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser
Leu Thr 195 200 205atc act ggg gct cag gcg gaa gat gag gct gac tat
tac tgt cat tcc 672Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr
Tyr Cys His Ser 210 215 220cgg gac agc agt ggt aac cat gtg ctt ttc
ggc gga ggg acc aaa ctg 720Arg Asp Ser Ser Gly Asn His Val Leu Phe
Gly Gly Gly Thr Lys Leu225 230 235 240acc gtc cta ggt 732Thr Val
Leu Gly160726DNAArtificial sequenceCDS(1)..(726)Polynucleotide
encoding GMBC630 scFv protein 160cag gtg cag ctg gtg gag tct ggg
gga ggc ttg gtc cag cct ggg agg 48Gln Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Arg1 5 10 15tcc ctg aga ctc ccc tgt gca
gcc tct gga ttc act ttc agt agc tat 96Ser Leu Arg Leu Pro Cys Ala
Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30ggc atg cac tgg gtc cgc
cag gct cca ggc aag ggg ctg gag tgg gtg 144Gly Met His Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45gca gtt ata tca tat
gat gga agt aat aaa tac tat gca gac tcc gtg 192Ala Val Ile Ser Tyr
Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60aag ggc cga ttc
acc atc tcc aga gac aat tcc aag aac acg ctg tat 240Lys Gly Arg Phe
Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg caa
atg aac agc ctg aga gct gag gac acg gct gtg tat tac tgt 288Leu Gln
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg
aag gct act tct ttg cta aat gct ttt gat atc tgg ggc cgg gga 336Ala
Lys Ala Thr Ser Leu Leu Asn Ala Phe Asp Ile Trp Gly Arg Gly 100 105
110acc atg gtc acc gtc tct tca ggt gga ggc ggt tca ggc gga ggt ggc
384Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
115 120 125agc ggc ggt ggc gga tcg tct gag ctg act cag gac cct gct
gtg tct 432Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala
Val Ser 130 135 140gtg gcc ttg gga cag aca gtc agg atc aca tgc caa
gga gac agc ctc 480Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln
Gly Asp Ser Leu145 150 155 160aga agc tat tat gca agc tgg tac cag
cag aag cca gga cag gcc cct 528Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln
Gln Lys Pro Gly Gln Ala Pro 165 170 175gta ctt gtc atc tat ggt aaa
aac aac cgg ccc tca ggg atc cca gac 576Val Leu Val Ile Tyr Gly Lys
Asn Asn Arg Pro Ser Gly Ile Pro Asp 180 185 190cga ttc tct ggc tcc
agc tca gga aac aca gct tcc ttg acc atc act 624Arg Phe Ser Gly Ser
Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr 195 200 205ggg gct cag
gcg gaa gat gag gct gac tat tac tgt aac tcc cgg gac 672Gly Ala Gln
Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp 210 215 220agc
agt ggt aac cat gtg gta ttc ggc gga ggg acc aag ctg acc gtc 720Ser
Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val225 230
235 240cta ggt 726Leu Gly161732DNAArtificial
sequenceCDS(1)..(732)Polynucleotide encoding GMBC632 scFv protein
161cag gtc cag ctg gtg cag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca ggc tct ggt ttc aaa ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Lys Phe Ser Asp
Ala 20 25 30tgg atg aat tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gag
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Glu
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc atc atc tca cga gat gat
tca aaa gac acg 240Pro Val Lys Asp Arg Phe Ile Ile Ser Arg Asp Asp
Ser Lys Asp Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tat tgt acg tgg gac tgg gat ttc tac
tac gat atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Asp Met Asn Val Trp Gly 100 105 110cag ggg aca atg gtc acc gtc
tcc tca ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Met Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg tct gag ctg act cag gac cct gct 432Gly Gly Ser Gly Gly
Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140gtg tct gtg
gcc ttg gga cag aca gtc agg atc aca tgc caa gga gac 480Val Ser Val
Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155
160agc ctc aga agc tat tat gca agc tgg tac cag cag aag cca gga cag
528Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln
165 170 175gcc cct gta ctt gtc atc tat ggt aaa aac aac cgg ccc tca
ggg atc 576Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser
Gly Ile 180 185 190cca gac cga ttc ttt ggc tcc agc tca gga aac aca
gct tcc ttg acc 624Pro Asp Arg Phe Phe Gly Ser Ser Ser Gly Asn Thr
Ala Ser Leu Thr 195 200 205atc act ggg gct cag gcg gaa gat gag gct
gac tat tac tgt aac tcc 672Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala
Asp Tyr Tyr Cys Asn Ser 210 215 220cgg gac agc agt ggt aac cat gtg
gta ttc ggc gga ggg acc aag ctg 720Arg Asp Ser Ser Gly Asn His Val
Val Phe Gly Gly Gly Thr Lys Leu225 230 235 240acc gtc cta ggt
732Thr Val Leu Gly162741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC634 scFv protein
162cag gtg cag ctg gtg cag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110caa ggc acc ctg gtc acc gtc
tcg agt ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245163732DNAArtificial
sequenceCDS(1)..(732)Polynucleotide encoding GMBC635 scFv protein
163gag gtg cag ctg gtg gag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac
tac gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga tac acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Tyr Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110aag ggg aca atg gtc acc gtc
tcg agt ggt gga ggc ggt tca ggc gga 384Lys Gly Thr Met Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg tct gag ctg act cag gac cct gct 432Gly Gly Ser Gly Gly
Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140gtg tct gtg
gcc ttg gga cag aca gtc agg atc aca tgc caa gga gac 480Val Ser Val
Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155
160agc ctc aga agc tat tat gca agc tgg tac cag cag aag cca gga cag
528Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln
165 170 175gcc cct gta ctt gtc atc tat ggt aaa aac aac cgg ccc tca
ggg atc 576Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser
Gly Ile 180 185 190cca gac cga ttc tct ggc tcc agc tca gga aac aca
gct tcc ttg acc 624Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr
Ala Ser Leu Thr 195 200 205atc act ggg gct cag gcg gaa gat gag gct
gac tat tac tgt aac tcc 672Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala
Asp Tyr Tyr Cys Asn Ser 210 215 220cgg gac agc agt ggt aac cat gtg
gta ttc ggc gga ggg acc aag ctg 720Arg Asp Ser Ser Gly Asn His Val
Val Phe Gly Gly Gly Thr Lys Leu225 230 235 240acc gtc cta ggt
732Thr Val Leu Gly164741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC638 scFv protein
164cag gtg cag ctg gtg caa tct ggg gga ggc ttg gta aag cct ggg gag
48Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Glu1
5 10 15tca ctg aga ctc tcc tgt gaa gcc tct gga ttc gaa ttt aat tat
gcc 96Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Phe Glu Phe Asn Tyr
Ala 20 25 30tgg atg agt tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtt 144Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt agt aga agc gta gct agt ggt ggg aca aca gac
tac gct gcg 192Gly Arg Ser Arg Ser Val Ala Ser Gly Gly Thr Thr Asp
Tyr Ala Ala 50 55 60ccc ctg caa gac aga ttc acc atc tca aga gat gat
tca aaa aac aca 240Pro Leu Gln Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat cta caa gtc aac agc ctg aaa atc
gag gac aca ggc gtg tat 288Leu Tyr Leu Gln Val Asn Ser Leu Lys Ile
Glu Asp Thr Gly Val Tyr 85 90 95ttc tgt aag tgg gag aaa tca gag tac
tac ggt atg gac gtc tgg ggc 336Phe Cys Lys Trp Glu Lys Ser Glu Tyr
Tyr Gly Met Asp Val Trp Gly 100 105 110cga ggg aca atg gtc acc gtc
tcg agt ggt gga ggc ggt tca ggc gga 384Arg Gly Thr Met Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245165759DNAArtificial
sequenceCDS(1)..(759)Polynucleotide encoding GMBC639 scFv protein
165gga gtg cag ctg gtg cag tct ggg gct gag gtg aag acg cct ggg gcc
48Gly Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Thr Pro Gly Ala1
5 10 15tca gtg aag gtt tcc tgc aag
gca tct gga tac act ttc acc aac cac 96Ser Val Lys Val Ser Cys Lys
Ala Ser Gly Tyr Thr Phe Thr Asn His 20 25 30tat atg cac tgg gtg cga
cag gcc cct gga caa gga att gag tgg gtg 144Tyr Met His Trp Val Arg
Gln Ala Pro Gly Gln Gly Ile Glu Trp Val 35 40 45gga gta atc aat cct
agt ggt gat ggt tca agc tac gca cag acg ttc 192Gly Val Ile Asn Pro
Ser Gly Asp Gly Ser Ser Tyr Ala Gln Thr Phe 50 55 60cag ggc aga gtc
acc atg acc agg gac acg tcc acg agc aca gtt tac 240Gln Gly Arg Val
Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr65 70 75 80atg gag
ttg agg agc ctg aga tct gac gac acg gcc gtc tac tac tgt 288Met Glu
Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg
aga gat ctg ttt tac gat ttt tgg agt gat tat tat cga aat gat 336Ala
Arg Asp Leu Phe Tyr Asp Phe Trp Ser Asp Tyr Tyr Arg Asn Asp 100 105
110cag tac tac tac atg gac gtc tgg ggc aag ggc acc ctg gtc acc gtc
384Gln Tyr Tyr Tyr Met Asp Val Trp Gly Lys Gly Thr Leu Val Thr Val
115 120 125tct tca ggt gga ggc ggt tca ggc gga ggt ggc agc ggc ggt
ggc gga 432Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly 130 135 140tcg tct gag ctg act cag gac cct gct gtg tct gtg
gcc ttg gga cag 480Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val
Ala Leu Gly Gln145 150 155 160gca gtc agg atc aca tgc caa gga gac
agc ctc aga agc tat tat gca 528Ala Val Arg Ile Thr Cys Gln Gly Asp
Ser Leu Arg Ser Tyr Tyr Ala 165 170 175agc tgg tac cag cag aag cca
gga cag gcc cct gta ctt gtc atc tat 576Ser Trp Tyr Gln Gln Lys Pro
Gly Gln Ala Pro Val Leu Val Ile Tyr 180 185 190ggt aaa aac aac cgg
ccc tca ggg atc cca gac cga ttc tct ggc tcc 624Gly Lys Asn Asn Arg
Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser 195 200 205agc tca gga
aac aca gct tcc ttg acc atc act ggg gct cag gcg gaa 672Ser Ser Gly
Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu 210 215 220gat
gag gct gac tat tac tgt aac tcc cgg gac agc agt ggt aac cat 720Asp
Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn His225 230
235 240gtg gta ttc ggc gga ggg acc aag ctg acc gtc cta ggt 759Val
Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 245
250166729DNAArtificial sequenceCDS(1)..(729)Polynucleotide encoding
GMBC641 scFv protein 166gag gtg cag ctg gtg gag tct ggg gga ggc gtg
gtc cgg cct ggg agg 48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val
Val Arg Pro Gly Arg1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga
ttc agc ttc agt agc tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Ser Phe Ser Ser Tyr 20 25 30ggc atg cac tgg gtc cgc cag gct cca
ggg aag ggg ctg gag tgg gtc 144Gly Met His Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45tca gct att agt ggt agt ggt ggt
agc aca tac tac gca gac tcc gtg 192Ser Ala Ile Ser Gly Ser Gly Gly
Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60aag ggc cgg ttc acc atc tcc
aga gac aat tcc aag aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg caa atg aac agt
ctg aga gcc gag gac acg gct gtg tat ttc tgt 288Leu Gln Met Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr Phe Cys 85 90 95gca aag ggt gga
gac cgg agc ttc cgt gct ttt gat ttc tgg ggc cag 336Ala Lys Gly Gly
Asp Arg Ser Phe Arg Ala Phe Asp Phe Trp Gly Gln 100 105 110ggg aca
atg gtc acc gtc tcc tca ggt gga ggc ggt tca ggc gga ggt 384Gly Thr
Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120
125ggc agc ggc ggt ggc gga tcg tct gag ctg act cag gac cct gct gtg
432Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala Val
130 135 140tct gtg gcc ttg gga cag aca gtc agg atc aca tgc caa gga
gac agc 480Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly
Asp Ser145 150 155 160ctc aga agc tat tat gca agc tgg tac cag cag
aag cca gga cag gcc 528Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln
Lys Pro Gly Gln Ala 165 170 175cct gta ctt gtc atc tat ggt aaa aac
aac cgg ccc tca ggg atc cca 576Pro Val Leu Val Ile Tyr Gly Lys Asn
Asn Arg Pro Ser Gly Ile Pro 180 185 190gac cga ttc tct ggc tcc agc
tca gga aac aca gct tcc ttg acc atc 624Asp Arg Phe Ser Gly Ser Ser
Ser Gly Asn Thr Ala Ser Leu Thr Ile 195 200 205act ggg gct cag gcg
gaa gat gag gct gac tat tac tgt aac tcc cgg 672Thr Gly Ala Gln Ala
Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg 210 215 220gac agc agt
ggt aac cat gtg gta ttc ggc gga ggg acc aag ctg acc 720Asp Ser Ser
Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr225 230 235
240gtc cta ggt 729Val Leu Gly167729DNAArtificial
sequenceCDS(1)..(729)Polynucleotide encoding GMBC642 scFv protein
167cag gta cag ctg cag cag tca ggg gct gag gtg aag aag cct ggg gcc
48Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1
5 10 15tca gtg aag gtt tcc tgc aag gca tct gga tac acc ttc acc atc
cac 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ile
His 20 25 30tat atg cat tgg gtg cga cag gcc cct gga caa gga ctt gag
tgg atg 144Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45gga ata atc aac cct ggt gat ggt agc act agt tac gca
cag aac ttc 192Gly Ile Ile Asn Pro Gly Asp Gly Ser Thr Ser Tyr Ala
Gln Asn Phe 50 55 60cag ggc aga gtc acc atg acc agg gac acg tcc acg
agc aca gtc tat 240Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr
Ser Thr Val Tyr65 70 75 80atg gag ctg agc agc ctg aga tct gag gac
acg gcc gtg tat tac tgt 288Met Glu Leu Ser Ser Leu Arg Ser Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gca ggg cga act gtg act tct
cac ttt gac tac tgg ggc cga 336Ala Arg Ala Gly Arg Thr Val Thr Ser
His Phe Asp Tyr Trp Gly Arg 100 105 110ggc acc ctg gcc acc gtc tcc
tca ggt gga ggc ggt tca ggc gga ggt 384Gly Thr Leu Ala Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120 125ggc agc ggc ggt ggc
gga tcg tct gag ctg act cag gac cct gct gtg 432Gly Ser Gly Gly Gly
Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala Val 130 135 140tct gtg gcc
ttg gga cag aca gtc agg atc aca tgc caa gga gac agc 480Ser Val Ala
Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser145 150 155
160ctc aga agc tat tat gca agc tgg tac cag cag aag cca gga cag gcc
528Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala
165 170 175cct gta ctt gtc atc tat ggt aaa aac aac cgg ccc tca ggg
atc cca 576Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly
Ile Pro 180 185 190gac cga ttc tct ggc tcc agc tca gga aac aca gct
tcc ttg acc atc 624Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala
Ser Leu Thr Ile 195 200 205act ggg gct cag gcg gaa gat gag gct gac
tat tac tgt aac tcc cgg 672Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp
Tyr Tyr Cys Asn Ser Arg 210 215 220gac agc agt ggt aac cat gtg gta
ttc ggc gga ggg acc aag ctg acc 720Asp Ser Ser Gly Asn His Val Val
Phe Gly Gly Gly Thr Lys Leu Thr225 230 235 240gtc cta ggt 729Val
Leu Gly168741DNAArtificial sequenceCDS(1)..(741)Polynucleotide
encoding GMBC645 scFv protein 168gag gtg cag ctg gtg gag tcc ggg
gga ggc ttg gta aag ccg ggg ggg 48Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca
ggc tct ggt ttc aaa ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala
Gly Ser Gly Phe Lys Phe Ser Asp Ala 20 25 30tgg atg aat tgg gtc cgc
cag gct cca ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agc
aaa ggt agt ggt ggg aca ata gag tac gct gca 192Gly Arg Ile Lys Ser
Lys Gly Ser Gly Gly Thr Ile Glu Tyr Ala Ala 50 55 60ccc gtg aaa gac
aga ttc atc atc tca cga gat gat tca aaa gac acg 240Pro Val Lys Asp
Arg Phe Ile Ile Ser Arg Asp Asp Ser Lys Asp Thr65 70 75 80ctg tat
ctg caa atg aac agt ctg aaa acc gag gac aca gcc ctg tat 288Leu Tyr
Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95tat
tgt acg tgg gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr
Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110agg gga acc ctg gtc acc gtc tcg agt ggt gga ggc ggt tca ggc gga
384Arg Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125ggt ggc agc ggc ggt ggc gga tcg cag tct gtg ctg act cag
cct gcc 432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Ala 130 135 140tcc gtg tct ggg tct cct gga cag tcg atc acc atc
tcc tgc act gga 480Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile
Ser Cys Thr Gly145 150 155 160acc agc agt gac gtt ggt ggt tat aac
tat gtc tcc tgg tac caa caa 528Thr Ser Ser Asp Val Gly Gly Tyr Asn
Tyr Val Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aaa gcc ccc aaa
ctc atg att tat gag ggc agt aag cgg 576His Pro Gly Lys Ala Pro Lys
Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185 190ccc tca ggg gtt tct
aat cgc ttc tct ggc tcc aag tct ggc aac acg 624Pro Ser Gly Val Ser
Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205gcc tcc ctg
aca atc tct ggg ctc cag gct gag gac gag gct gat tat 672Ala Ser Leu
Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac
tgc agc tca tat aca acc agg agc act cga gtt ttc ggc gga ggg 720Tyr
Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230
235 240acc gag ctg acc gtc cta ggt 741Thr Glu Leu Thr Val Leu Gly
245169723DNAArtificial sequenceCDS(1)..(723)Polynucleotide encoding
GMBC646 scFv protein 169ggg gtc cag ctg gtg cag tct ggg gct gag gtg
aag aag cct ggg gcc 48Gly Val Gln Leu Val Gln Ser Gly Ala Glu Val
Lys Lys Pro Gly Ala1 5 10 15tca gtg aag gtt tcc tgc aag gca tct gga
tac acc ttc acc agc tac 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly
Tyr Thr Phe Thr Ser Tyr 20 25 30tat atc cac tgg gtg cga cag gcc cct
gga caa ggg ctt gag tgg atg 144Tyr Ile His Trp Val Arg Gln Ala Pro
Gly Gln Gly Leu Glu Trp Met 35 40 45gga ata atc aac cct agt ggt ggt
acc aca agc tac gca cag aag ttc 192Gly Ile Ile Asn Pro Ser Gly Gly
Thr Thr Ser Tyr Ala Gln Lys Phe 50 55 60cag ggc aga gtc acc atg acc
agg gac acg tcc acg agc aca gtc tac 240Gln Gly Arg Val Thr Met Thr
Arg Asp Thr Ser Thr Ser Thr Val Tyr65 70 75 80atg gag ctg agc agc
ctg aga tct gag gac acg gcc atg tat tac tgt 288Met Glu Leu Ser Ser
Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95gcg aga gag cgc
ttc ctg cgc ggt atg gac gtc tgg ggc cga ggg aca 336Ala Arg Glu Arg
Phe Leu Arg Gly Met Asp Val Trp Gly Arg Gly Thr 100 105 110atg gtc
acc gtc tcg agt ggt gga ggc ggt tca ggc gga ggt ggc agc 384Met Val
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120
125ggc ggt ggc gga tcg gac atc gtg atg acc cag tct cct tcc acc ctg
432Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro Ser Thr Leu
130 135 140tct gca tct gta gga gac aga gtc acc atc act tgc cgg gcc
agt cag 480Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala
Ser Gln145 150 155 160ggc att agt agc tgg ttg gcc tgg tat cag cag
aaa cca ggg aga gcc 528Gly Ile Ser Ser Trp Leu Ala Trp Tyr Gln Gln
Lys Pro Gly Arg Ala 165 170 175cct aag gtc ttg atc tat aag gca tct
act tta gaa agt ggg gtc cca 576Pro Lys Val Leu Ile Tyr Lys Ala Ser
Thr Leu Glu Ser Gly Val Pro 180 185 190tca agg ttc agc ggc agt gga
tct ggg aca gat ttc act ctc acc atc 624Ser Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile 195 200 205agc agt ctg caa cct
gaa gat ttt gca act tac tac tgt caa cag agt 672Ser Ser Leu Gln Pro
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser 210 215 220tac agt acc
ccg tgg acg ttc ggc caa ggg acc aag ctg gag atc aaa 720Tyr Ser Thr
Pro Trp Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys225 230 235
240cgt 723Arg170741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC647 scFv protein
170gag gtg cag ctg gtg gag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac
tac gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggg 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110caa ggg acc acg gtc acc gtc
tcg agt ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Thr Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245171732DNAArtificial
sequenceCDS(1)..(732)Polynucleotide encoding GMBC648 scFv protein
171cag gtg cag ctg gtg gag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10
15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac gcc
96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala
20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag tgg
gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45ggc cgt att aaa agc aaa cgt agt ggt ggg aca ata gac tac
gcc gca 192Gly Arg Ile Lys Ser Lys Arg Ser Gly Gly Thr Ile Asp Tyr
Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat tca
aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser
Lys Asn Thr65 70 75 80ttg tat ctg caa atg aac agt ctg aaa acc gag
gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu
Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac tac
ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr
Gly Met Asn Val Trp Gly 100 105 110caa ggg aca atg gtc acc gtc tct
tct ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Met Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt ggc
gga tcg tct gag ctg act cag gac cct act 432Gly Gly Ser Gly Gly Gly
Gly Ser Ser Glu Leu Thr Gln Asp Pro Thr 130 135 140gtg tct gtg gcc
ttg gga cag aca gtc agg atc aca tgc caa gga gac 480Val Ser Val Ala
Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155 160agc
ctc aga agc tat tat gca agc tgg tac cag cag aag cca gga cag 528Ser
Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln 165 170
175gcc cct gta ctt gtc atc tat ggt aaa aac aac cgg ccc tca ggg atc
576Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile
180 185 190cca gac cga ttc tct ggc tcc agc tca gga aac aca gct tcc
ttg acc 624Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser
Leu Thr 195 200 205atc act ggg gct cag gcg gaa gat gag gct gac tat
tac tgt aac tcc 672Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr
Tyr Cys Asn Ser 210 215 220cgg gac agc agt ggt aac cat gtg gta ttc
ggc gga ggg acc aag ctg 720Arg Asp Ser Ser Gly Asn His Val Val Phe
Gly Gly Gly Thr Lys Leu225 230 235 240acc gtc cta ggt 732Thr Val
Leu Gly172741DNAArtificial sequenceCDS(1)..(741)Polynucleotide
encoding GMBC649 scFv protein 172cag gtc cag ctg gtg cag tct ggg
gga ggc ttg gta aag ccg ggg ggg 48Gln Val Gln Leu Val Gln Ser Gly
Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca
gcc tct ggt ttc act ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cgc
cag gct cca ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agc
aaa ggt agt ggt ggg aca ata gac tac gcc gca 192Gly Arg Ile Lys Ser
Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac
aga ttc acc atc tca cga gat gat tca aaa aac acg 240Pro Val Lys Asp
Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat
ctg caa atg aac agt ctg aaa acc gag gac aca gcc ctg tat 288Leu Tyr
Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95tac
tgt acg tgg gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr
Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110cga gga acc ctg gtc acc gtc tcg agt ggt gga ggc ggt tca ggc gga
384Arg Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125ggt ggc agc ggc ggt ggc gga tca cag tct gtg ctg act cag
cct gcc 432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Ala 130 135 140tcc gtg tct ggg tct cct gga cag tcg atc acc atc
tcc tgc act gga 480Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile
Ser Cys Thr Gly145 150 155 160acc agc agt gac gtt ggt ggc tat aac
tat gtc tcc tgg tac caa caa 528Thr Ser Ser Asp Val Gly Gly Tyr Asn
Tyr Val Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aaa gcc ccc aaa
ctc atg att tat gag ggc agt aag cgg 576His Pro Gly Lys Ala Pro Lys
Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185 190ccc tca ggg gtt tct
aat cgc ttc tct ggc tcc aag tct ggc aac acg 624Pro Ser Gly Val Ser
Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205gcc tcc ctg
aca atc tct ggg ctc cag gct gag gac gag gct gat tat 672Ala Ser Leu
Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac
tgc agc tca tat aca acc agg agc act cga gtt ttc ggc gga ggg 720Tyr
Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230
235 240acc aag ctg acc gtc cta ggt 741Thr Lys Leu Thr Val Leu Gly
245173741DNAArtificial sequenceCDS(1)..(741)Polynucleotide encoding
GMBC651 scFv protein 173gag gtg cag ctg gtg gag tct ggg gga ggc ttg
gta cag cct ggg ggg 48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu
Val Gln Pro Gly Gly1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct ggt
ttc act ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca
ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agt aaa ggt agt
ggt ggg aca ata gac tac gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser
Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc
atc tca cga gat gat tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr
Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg
aac agt ctg aaa acc gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met
Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg
gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp
Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110cgg ggg
aca atg gtc acc gtc tct tca ggt gga ggc ggt tca ggc gga 384Arg Gly
Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120
125ggt ggc agc ggc ggt ggc gga tcg cag tct gtg ctg act cag cct gcc
432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala
130 135 140tcc gtg tct ggg tct cct gga cag tcg atc acc atc tcc tgc
act gga 480Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys
Thr Gly145 150 155 160acc agc agt gac gtt ggt ggt tat aac tat gtc
tcc tgg tac caa caa 528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val
Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aaa gcc ccc aaa ctc atg
att tat gag ggc agt aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met
Ile Tyr Glu Gly Ser Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc
ttc tct ggc tcc aag tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg
Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc
tct ggg ctc cag gct gag gac gag gct gat tat 672Ala Ser Leu Thr Ile
Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc
tca tat aca acc agg agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser
Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230 235
240acc aag ctg acc gtc cta ggt 741Thr Lys Leu Thr Val Leu Gly
245174741DNAArtificial sequenceCDS(1)..(741)Polynucleotide encoding
GMBC652 scFv protein 174ggg gtg cag ctg gtg cag tct ggg gga gtc gtg
gta aag cct ggg ggg 48Gly Val Gln Leu Val Gln Ser Gly Gly Val Val
Val Lys Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt
ttc act ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cga cag gct cca
ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agt aaa ggt agt
ggt ggg aca aca gac tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser
Gly Gly Thr Thr Asp Tyr Ala Ala 50 55 60ccc gtg aaa ggc aga ttc acc
atc tca aga gat gat tca gaa aac acg 240Pro Val Lys Gly Arg Phe Thr
Ile Ser Arg Asp Asp Ser Glu Asn Thr65 70 75 80ctg tat ctg caa atg
aac agc ctg aaa acc gag gac aca gcc gta tat 288Leu Tyr Leu Gln Met
Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85 90 95tac tgt acg tgg
gac cac agt tac tac tac gat atg gcc gtc tgg ggc 336Tyr Cys Thr Trp
Asp His Ser Tyr Tyr Tyr Asp Met Ala Val Trp Gly 100 105 110cga ggg
acg atg gtc acc gcc tcc tca ggt gga ggc ggt tca ggc gga 384Arg Gly
Thr Met Val Thr Ala Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120
125ggt ggc agc ggc ggt ggc gga tcg cag tct gtg ctg act cag cct gcc
432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala
130 135 140tcc gtg tct ggg tct cct gga cag tcg atc acc atc tcc tgc
act gga 480Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys
Thr Gly145 150 155 160acc agc agt gat gtt ggt ggt tat aac tat gtc
tcc tgg tac caa cag 528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val
Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aaa gcc ccc aaa ttc atg
att tat gat gtc agt aag cgg 576His Pro Gly Lys Ala Pro Lys Phe Met
Ile Tyr Asp Val Ser Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc
ttc tct ggc tcc aag tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg
Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205gcg tcc ctg acc atc
tct ggg gtc cag gcc gag gac gag gct gat tat 672Ala Ser Leu Thr Ile
Ser Gly Val Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc
tca tat aca agc gcc agc act gtg ata ttc ggc gga ggg 720Tyr Cys Ser
Ser Tyr Thr Ser Ala Ser Thr Val Ile Phe Gly Gly Gly225 230 235
240acc aag ctg acc gtc cta ggt 741Thr Lys Leu Thr Val Leu Gly
245175738DNAArtificial sequenceCDS(1)..(738)Polynucleotide encoding
GMBC653 scFv protein 175cag gtg cag ctg gtg caa tct ggg gct gag gtg
aag aag cct ggg gcc 48Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val
Lys Lys Pro Gly Ala1 5 10 15tca gtg aag gtc tcc tgc aag gct tct gga
tac acc ttc acc ggc tac 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly
Tyr Thr Phe Thr Gly Tyr 20 25 30tat atg cac tgg gtg cga cag gcc cct
gga caa ggg ctt gag tgg atg 144Tyr Met His Trp Val Arg Gln Ala Pro
Gly Gln Gly Leu Glu Trp Met 35 40 45gga tgg atc aac cct aac agt ggt
ggc aca aac tat gca cag aag ttt 192Gly Trp Ile Asn Pro Asn Ser Gly
Gly Thr Asn Tyr Ala Gln Lys Phe 50 55 60cag ggc agg gtc acc atg acc
agg gac acg tcc atc agc aca gcc tac 240Gln Gly Arg Val Thr Met Thr
Arg Asp Thr Ser Ile Ser Thr Ala Tyr65 70 75 80atg gag ctg agc agg
ctg aga tct gac gac acg gcc gtg tat tac tgt 288Met Glu Leu Ser Arg
Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga ggt ggt
agc cgc tac tac ggt atg gac gtc tgg agc cga gga 336Ala Arg Gly Gly
Ser Arg Tyr Tyr Gly Met Asp Val Trp Ser Arg Gly 100 105 110acc ctg
gtc acc gtc tct tca ggt gga ggc ggt tca ggc gga ggt ggc 384Thr Leu
Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120
125agc ggc ggt ggc gga tcg tcc tat gtg ctg act cag ccc ccc tca gtg
432Ser Gly Gly Gly Gly Ser Ser Tyr Val Leu Thr Gln Pro Pro Ser Val
130 135 140tct ggg acc ccc ggg cag aga gtc acc atc tct tgt tct gga
ggc aga 480Ser Gly Thr Pro Gly Gln Arg Val Thr Ile Ser Cys Ser Gly
Gly Arg145 150 155 160tcc aac atc ggc agt aat act gta aag tgg tat
cag cag ctc cca gga 528Ser Asn Ile Gly Ser Asn Thr Val Lys Trp Tyr
Gln Gln Leu Pro Gly 165 170 175gcg gcc ccc aaa ctc ctc atc tat ggc
aat gat cag cgg ccc tca ggg 576Ala Ala Pro Lys Leu Leu Ile Tyr Gly
Asn Asp Gln Arg Pro Ser Gly 180 185 190gtc cct gac cga ttc tct ggc
tcc aag tct ggc acc tca gcc tcc ctg 624Val Pro Asp Arg Phe Ser Gly
Ser Lys Ser Gly Thr Ser Ala Ser Leu 195 200 205gcc atc act ggg gtc
cag gct gaa gac gag gct gac tat tac tgc cag 672Ala Ile Thr Gly Val
Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Gln 210 215 220tca tat gac
agc agc ctg agg ggt tcg agg gtc ttc gga act ggg acc 720Ser Tyr Asp
Ser Ser Leu Arg Gly Ser Arg Val Phe Gly Thr Gly Thr225 230 235
240aag gtc acc gtc cta ggt 738Lys Val Thr Val Leu Gly
245176741DNAArtificial sequenceCDS(1)..(741)Polynucleotide encoding
GMBC654 scFv protein 176gag gtg cag ctg gtg gag acc ggg gga ggc ttg
gta gag ccg ggg ggg 48Glu Val Gln Leu Val Glu Thr Gly Gly Gly Leu
Val Glu Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt
ttc act ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca
ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agc aaa cgt agt
ggt ggg aca ata gac tac gcc gca 192Gly Arg Ile Lys Ser Lys Arg Ser
Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc
atc tca cga gat gat tca aaa aat acg 240Pro Val Lys Asp Arg Phe Thr
Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg
aac agt ctg aaa att gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met
Asn Ser Leu Lys Ile Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg
gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp
Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110aaa ggg
acc acg gtc acc gtc tcc tca ggt gga ggc ggt tca ggc gga 384Lys Gly
Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120
125ggt ggc agc ggc ggt ggc gga tcg cag tct gtg ctg act cag cct gcc
432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala
130 135 140tcc gtg tct gga tct cct gga cag tcg atc acc atc tcc tgc
act gga 480Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys
Thr Gly145 150 155 160acc agc agt gac gtt ggt ggt tat aac tat gtc
tcc tgg tac caa caa 528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val
Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aaa gcc ccc aaa ctc atg
att tat gag ggc agt aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met
Ile Tyr Glu Gly Ser Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc
ttc tct ggc tcc aag tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg
Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc
tct ggg ctc cag gct gag gac gag gct gat tat 672Ala Ser Leu Thr Ile
Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc
tca tat aca acc agg agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser
Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230 235
240acc aag ctg acc gtc cta ggt 741Thr Lys Leu Thr Val Leu Gly
245177717DNAArtificial sequenceCDS(1)..(717)Polynucleotide encoding
GMBC655 scFv protein 177gag gtg cag ctg gtg gag tct ggg gga ggc ctg
gtc aag cct ggg ggg 48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu
Val Lys Pro Gly Gly1
5 10 15tcc ctg aga ctc tct tgt gca gcg tct gga ttc acc ttc agt agc
tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser
Tyr 20 25 30ggc atg agc tgg atc cgc cag gct cca ggg aag ggg cag gag
tgg gtc 144Gly Met Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Gln Glu
Trp Val 35 40 45tca gct att agt ggt agt ggt ggt agc gca tac tac gca
gac tcc gtg 192Ser Ala Ile Ser Gly Ser Gly Gly Ser Ala Tyr Tyr Ala
Asp Ser Val 50 55 60aag ggc cgg ttc acc att tcc aga gac aat tcc aag
aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr Leu Tyr65 70 75 80ctg caa atg aac agc ctg aga gct gag gac
acg gct gtg tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg aaa gcc tat agc agt gaa gac tac
tgg ggc agg ggg aca atg gtc 336Ala Lys Ala Tyr Ser Ser Glu Asp Tyr
Trp Gly Arg Gly Thr Met Val 100 105 110acc gtc tct tca ggt gga ggc
ggt tca ggc gga ggt ggc agc ggc ggt 384Thr Val Ser Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggc gga tcg aac atc
cag atg acc cag tct cca tcc ttc ctg tct gca 432Gly Gly Ser Asn Ile
Gln Met Thr Gln Ser Pro Ser Phe Leu Ser Ala 130 135 140tct gta gga
gac aga gtc acc atc act tgc cgg gcc agt cag ggc att 480Ser Val Gly
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile145 150 155
160aac aat tat tta gcc tgg tat cag caa aaa cca ggg aga gcc cct aag
528Asn Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Arg Ala Pro Lys
165 170 175ctc ctg atc tac gct gca tcc agt tta caa agt ggg gtc cca
tca agg 576Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro
Ser Arg 180 185 190ttc agc ggc agt gga tct ggc aca gat ttc act ctc
acc atc agc agc 624Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Thr Ile Ser Ser 195 200 205ctg cag cct gat gat ttt gca act tat tac
tgc caa caa tat agt aat 672Leu Gln Pro Asp Asp Phe Ala Thr Tyr Tyr
Cys Gln Gln Tyr Ser Asn 210 215 220tat ccg ctc act ttc ggc gga ggg
acc aag ctg gag atc aaa cgt 717Tyr Pro Leu Thr Phe Gly Gly Gly Thr
Lys Leu Glu Ile Lys Arg225 230 235178732DNAArtificial
sequenceCDS(1)..(732)Polynucleotide encoding GMBC657 scFv protein
178cag atg cag ctg atg cag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Gln Met Gln Leu Met Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca ggc tct ggt ttc aaa ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Lys Phe Ser Asp
Ala 20 25 30tgg atg aat tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gag
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Glu
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc atc atc tca cga gat gat
tca aaa gac acg 240Pro Val Lys Asp Arg Phe Ile Ile Ser Arg Asp Asp
Ser Lys Asp Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tat tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110cag gga acc ctg gtc acc gtc
tcc tca ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg tct gag ctg act cag gac cct gct 432Gly Gly Ser Gly Gly
Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140gtg tct gtg
gcc ttg gga cag aca gtc agg atc aca tgc caa gga gac 480Val Ser Val
Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155
160agc ctc aga agc tat tat gca agc tgg tac cag cag aag cca gga cag
528Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln
165 170 175gcc cct gta ctt gtc atc tat ggt aaa aac aac cgg ccc tca
ggg atc 576Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser
Gly Ile 180 185 190cca gac cga ttc tct ggc tcc agc tca gga aac aca
gct tcc ttg acc 624Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr
Ala Ser Leu Thr 195 200 205atc act ggg gct cag gcg gaa gat gag gct
gac tat tac tgt aac tcc 672Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala
Asp Tyr Tyr Cys Asn Ser 210 215 220cgg gac agc agt ggt aac cat gtg
gta ttc ggc gga ggg acc aag ctg 720Arg Asp Ser Ser Gly Asn His Val
Val Phe Gly Gly Gly Thr Lys Leu225 230 235 240acc gtc cta ggt
732Thr Val Leu Gly179741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC658 scFv protein
179gag gtc cag ctg gtg cag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctt tcc tgt gca gcc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110cgg ggg acc acg gtc acc gtc
tcc tca ggt gga ggc ggt tca ggc gga 384Arg Gly Thr Thr Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggt tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245180741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC659 scFv protein
180cag gtg cag ctg gtg gag tct ggg gga ggc ttg gta aag cct ggg gag
48Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Glu1
5 10 15tca ctg aga ctc tcc tgt gaa gcc tct gga ttc gaa ttt aat tat
gcc 96Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Phe Glu Phe Asn Tyr
Ala 20 25 30tgg atg agt tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtt 144Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt agt aga agc gaa gct agt ggt ggg aca aca gac
tac gct gca 192Gly Arg Ser Arg Ser Glu Ala Ser Gly Gly Thr Thr Asp
Tyr Ala Ala 50 55 60ccc ctg caa gac aga ttc acc atc tca aga gat gat
tca aaa aac aca 240Pro Leu Gln Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat cta caa gtc aac agc ctg aaa atc
gag gac aca ggc gtg tat 288Leu Tyr Leu Gln Val Asn Ser Leu Lys Ile
Glu Asp Thr Gly Val Tyr 85 90 95ttc tgt aag tgg gag aaa tca gag tac
tac ggt atg gac gtc tgg ggc 336Phe Cys Lys Trp Glu Lys Ser Glu Tyr
Tyr Gly Met Asp Val Trp Gly 100 105 110aga ggc acc ctg gtc acc gtc
tcg agt ggt gga ggc ggt tca ggc gga 384Arg Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245181741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC660 scFv protein
181gag gtg cag ctg gtg cag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc att ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ile Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac
tac gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt cta aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110cag ggc acc ccg gtc acc gtc
tcc tca ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Pro Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtc ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245182729DNAArtificial
sequenceCDS(1)..(729)Polynucleotide encoding GMBC662 scFv protein
182ggg gtc cag ctg gtg cag tct ggg gct gag gtg aag aag cct ggg tcc
48Gly Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1
5 10 15tcg gtg aag gtc tcc tgc aag gct tct gga ggc acc ttc agc agc
tat 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser
Tyr 20 25 30act atc agc tgg gtg cga cag gcc cct gga caa ggg ctt gag
tgg atg 144Thr Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45gga agg atc atc cct atc ctt ggt ata gca aac tac gca
cag aag ttc 192Gly Arg Ile Ile Pro Ile Leu Gly Ile Ala Asn Tyr Ala
Gln Lys Phe 50 55 60cag ggc aga gtc acg att acc gcg gac aaa tcc acg
agc aca gcc tac 240Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr
Ser Thr Ala Tyr65 70 75 80atg gag ctg agc agc ctg aga tct gag gac
acg gcc gtg tat tac tgt 288Met Glu Leu Ser Ser Leu Arg Ser Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gaa aag ttg agg gac ttc cag
cac tgg ggc caa gga acc ctg 336Ala Arg Glu Lys Leu Arg Asp Phe Gln
His Trp Gly Gln Gly Thr Leu 100 105 110gtc acc gtc tct tca ggt gga
ggc ggt tca ggc gga ggt ggc agc ggc 384Val Thr Val Ser Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser Gly 115 120 125ggt ggc gga tcg cag
tct gtg ctg act cag cct gcc tcc gtg tct ggg 432Gly Gly Gly Ser Gln
Ser Val Leu Thr Gln Pro Ala Ser Val Ser Gly 130 135 140tct cct gga
cag tcg atc acc atc tcc tgc act gga acc agc agt gac 480Ser Pro Gly
Gln Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp145 150 155
160gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa cac cca ggc aaa
528Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys
165 170 175gcc ccc aaa ctc atg att tat gag ggc agt aag cgg ccc tca
ggg att 576Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg Pro Ser
Gly Ile 180 185 190tct aat cgc ttc tct ggc tcc aag tct ggc aac acg
gcc tcc ctg aca 624Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr
Ala Ser Leu Thr 195 200 205atc tct agg ctc cag gct gag gac gag gct
gat tat tac tgc agc tca 672Ile Ser Arg Leu Gln Ala Glu Asp Glu Ala
Asp Tyr Tyr Cys Ser Ser 210 215 220tat aca acc agg agc act cga gtt
ttc ggc gga ggg acc aag ctg acc 720Tyr Thr Thr Arg Ser Thr Arg Val
Phe Gly Gly Gly Thr Lys Leu Thr225 230 235 240gtc cta ggt 729Val
Leu Gly183741DNAArtificial sequenceCDS(1)..(741)Polynucleotide
encoding GMBC664 scFv protein 183gag gtg cag ctg gtg gag acc ggg
gga gcc ttg gta aag ccg ggg ggg 48Glu Val Gln Leu Val Glu Thr Gly
Gly Ala Leu Val Lys Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca
gcc tct ggt ttc act ttc agt gac gcc
96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala
20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag tgg
gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac tac
gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp Tyr
Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat tca
aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp Ser
Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc gag
gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu
Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac tac
ggt atg aac gtc tgg agc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr Tyr
Gly Met Asn Val Trp Ser 100 105 110cgg ggg aca atg gtc acc gtc tcg
agt ggt gga ggc ggt tca ggc gga 384Arg Gly Thr Met Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt ggc
gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly Gly
Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct ggg
tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser Gly
Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155 160acc
agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa 528Thr
Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln 165 170
175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt aag cgg
576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser Lys Arg
180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag tct ggc
aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly
Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct gag gac
gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp
Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg agc act
cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr
Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc cta ggt
741Thr Lys Leu Thr Val Leu Gly 245184732DNAArtificial
sequenceCDS(1)..(732)Polynucleotide encoding GMBC665 scFv protein
184gag gtg cag ctg gtg gag act ggg gga ggc ttg gta aag ccg ggg ggg
48Glu Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agt aaa ggt agt ggt ggg aca ata gac
tac gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110caa ggg aca atg gtc acc gtc
tct tca ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Met Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg tct gag ctg act cag gac cct gct 432Gly Gly Ser Gly Gly
Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140gtg tct gtg
gcc ttg gga cag aca gtc agg atc aca tgc caa gga gac 480Val Ser Val
Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155
160agc ctc aga agc tat tat gca agc tgg tac cag cag aag cca gga cag
528Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln
165 170 175gcc cct gta ctt gtc atc tat ggt aaa aac aac cgg ccc tca
ggg atc 576Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser
Gly Ile 180 185 190cca gac cga ttc tct ggc tcc agc tca gga aac aca
gct tcc ttg acc 624Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr
Ala Ser Leu Thr 195 200 205atc act ggg gct cag gcg gaa gat gag gct
gac tat tac tgt aac tcc 672Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala
Asp Tyr Tyr Cys Asn Ser 210 215 220cgg gac agc agt ggt aac cat gtg
gta ttc ggc gga ggg acc aag ctg 720Arg Asp Ser Ser Gly Asn His Val
Val Phe Gly Gly Gly Thr Lys Leu225 230 235 240acc gtc cta ggt
732Thr Val Leu Gly185741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC666 scFv protein
185gag gtg cag ctg gtg gag tct ggg gga ggc ttg gca aag cct ggg gag
48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Ala Lys Pro Gly Glu1
5 10 15tca ctg aga ctc tcc tgt gaa gcc tct gga ttc gaa ttt aat tat
gcc 96Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Phe Glu Phe Asn Tyr
Ala 20 25 30tgg atg agt tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtt 144Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt agt aga agc gaa gct agt ggt ggg aca aca gac
tac gct gca 192Gly Arg Ser Arg Ser Glu Ala Ser Gly Gly Thr Thr Asp
Tyr Ala Ala 50 55 60ccc ctg caa gac aga ttc acc atc tca aga gat gat
tca aaa aac aca 240Pro Leu Gln Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat cta caa gtc aac agc ctg aaa atc
gag gac aca ggc gtg tat 288Leu Tyr Leu Gln Val Asn Ser Leu Lys Ile
Glu Asp Thr Gly Val Tyr 85 90 95ttc tgt aag tgg gag aaa tca gag tac
tac ggt atg gac gtc tgg ggc 336Phe Cys Lys Trp Glu Lys Ser Glu Tyr
Tyr Gly Met Asp Val Trp Gly 100 105 110aaa ggg aca atg gtc acc gtc
tcg agt ggt gga ggc ggt tca ggc gga 384Lys Gly Thr Met Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ttg acg cag ccg ccc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Pro 130 135 140tca gtg tct
gcg gcc cca gga cag aag gtc acc att tcc tgc tct gga 480Ser Val Ser
Ala Ala Pro Gly Gln Lys Val Thr Ile Ser Cys Ser Gly145 150 155
160agc acc tcc aac att ggg aat aat tat gtc tcc tgg tac caa cag cac
528Ser Thr Ser Asn Ile Gly Asn Asn Tyr Val Ser Trp Tyr Gln Gln His
165 170 175cca ggc aaa gcc ccc aaa ctc atg att tat gat gtc agt aag
cgg ccc 576Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Asp Val Ser Lys
Arg Pro 180 185 190tca ggg gtc cct gac cga ttc tct ggc tcc aag tct
ggc aac tca gcc 624Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser
Gly Asn Ser Ala 195 200 205tcc ctg gac atc agt ggg ctc cag tct gag
gat gag gct gat tat tac 672Ser Leu Asp Ile Ser Gly Leu Gln Ser Glu
Asp Glu Ala Asp Tyr Tyr 210 215 220tgt gca gca tgg gat gac agc ctg
agt gaa ttt ctc ttc gga act ggg 720Cys Ala Ala Trp Asp Asp Ser Leu
Ser Glu Phe Leu Phe Gly Thr Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245186741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC667 scFv protein
186cag gtg cag ctg cag gag tcc ggg gga ggc ctg gta aag ccg ggg ggg
48Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctg tcc tgt gca ggc tct ggt ttc cct ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Pro Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agt aaa ggt agt ggt ggg aca ata gac
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc agg atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Arg Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aac atc
gag gac aca gcc ctc tat 288Leu Tyr Leu Gln Met Asn Ser Leu Asn Ile
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggg 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110cag ggg acc acg gtc acc gtc
tct tca ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Thr Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245187732DNAArtificial
sequenceCDS(1)..(732)Polynucleotide encoding GMBC668 scFv protein
187gag gtg cag ctg gtg gag tct ggg gga ggc ttg gta aag cct ggg ggg
48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgg cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agt aaa ggt agt ggt ggg aca aca gac
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Thr Asp
Tyr Ala Ala 50 55 60ccc gtg aaa ggc aga ttc acc atc tca aga gat gat
tca gaa aac acg 240Pro Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp
Ser Glu Asn Thr65 70 75 80ctg tat ctg caa atg aac agc ctg aaa acc
gag gac aca gcc gta tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Val Tyr 85 90 95tac tgt acg tgg gac cac agt tac tac
tac gat atg gcc gtc tgg ggc 336Tyr Cys Thr Trp Asp His Ser Tyr Tyr
Tyr Asp Met Ala Val Trp Gly 100 105 110cga ggc acc ctg gtc acc gtc
tcg agt ggt gga ggc ggt tca ggc gga 384Arg Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg tct gag ctg act cag gac cct gct 432Gly Gly Ser Gly Gly
Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140gtg tct gtg
gcc ttg gga cag aca gtc agg atc aca tgc caa gga gac 480Val Ser Val
Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155
160agc ctc aga agc tat tat gca agc tgg tac cag cag aag cca gga cag
528Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln
165 170 175gcc cct gta ctt gtc atc tat ggt aaa aac aac cgg ccc tca
ggg atc 576Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser
Gly Ile 180 185 190cca gac cga ttc tct ggc tcc agc tca gga aac aca
gct tcc ttg acc 624Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr
Ala Ser Leu Thr 195 200 205atc act ggg gct cag gcg gaa gat gag gct
gac tat tac tgt aac tcc 672Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala
Asp Tyr Tyr Cys Asn Ser 210 215 220cgg gac agc agt ggt aac cat gtg
gta ttc ggc gga ggg acc aag ctg 720Arg Asp Ser Ser Gly Asn His Val
Val Phe Gly Gly Gly Thr Lys Leu225 230 235 240acc gtc cta ggt
732Thr Val Leu Gly188741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC669 scFv protein
188cag gtg cag ctg gtg gag tct ggg gga gcc ttg gta aag ccg ggg ggg
48Gln Val Gln Leu Val Glu Ser Gly Gly Ala Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110caa ggc acc ctg gtc acc gtc
tcg agt ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct ccc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Pro 130 135 140tcc gcg tcc
ggg tct cct gga cag tca gtc acc atc tcc tgc act gga 480Ser Ala Ser
Gly Ser Pro Gly Gln Ser Val Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gat gtt ggt ggt tat aac tat gtc tcc tgg tac caa cag
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ttc atg att tat gat gtc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Phe Met Ile Tyr Asp Val Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcg tcc ctg acc atc tct ggg gtc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Val Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca agc gcc
agc act gtg ata ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Ser Ala
Ser Thr Val Ile Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245189741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC670 scFv protein
189gag gtg cag ctg gtg gag act ggg gga ggc ttg gta aag ccg ggg ggg
48Glu Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gta
gcc tct ggt ttc act ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Val
Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cgc
cag gct cca ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agt
aaa ggt agt ggt ggg aca ata gac tac gct gca 192Gly Arg Ile Lys Ser
Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac
aga ttc att atc tca cga gat gat tca aaa aac acg 240Pro Val Lys Asp
Arg Phe Ile Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat
ctg caa gtg aac agt ctg aaa acc gag gac aca gcc cta tat 288Leu Tyr
Leu Gln Val Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95tat
tgt acg tgg gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr
Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110caa ggc acc ctg gtc acc gtc tcc tct ggt gga ggc ggt tca ggc gga
384Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125ggt ggc agc ggc ggt ggc gga tcg cag tct gtg ctg act cag
cct gcc 432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln
Pro Ala 130 135 140tcc gtg tct ggg tct cct gga cag tcg atc acc atc
tcc tgc act gga 480Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile
Ser Cys Thr Gly145 150 155 160acc agc agt gac gtt ggt ggt tat aac
tat gtc tcc tgg tac caa caa 528Thr Ser Ser Asp Val Gly Gly Tyr Asn
Tyr Val Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aaa gcc ccc aaa
ctc atg att tat gag ggc agt aag cgg 576His Pro Gly Lys Ala Pro Lys
Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185 190ccc tca ggg gtt tct
aat cgc ttc tct ggc tcc aag tct ggc aac acg 624Pro Ser Gly Val Ser
Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205gcc tcc ctg
aca atc tct ggg ctc cag gct gag gac gag gct gat tat 672Ala Ser Leu
Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac
tgc agc tca tat aca acc agg agc act cga gtt ttc ggc gga ggg 720Tyr
Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230
235 240acc aag ctg acc gtc cta ggt 741Thr Lys Leu Thr Val Leu Gly
245190741DNAArtificial sequenceCDS(1)..(741)Polynucleotide encoding
GMBC672 scFv protein 190cag gtc cag ctg gta cag tct ggg gga ggc ttg
gta aag ccg ggg ggg 48Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu
Val Lys Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt
ttc act ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca
ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt
ggt ggg aca ata gac tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser
Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc
atc tca cga gat gat tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr
Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg
aat agt ctg aaa acc gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met
Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg
gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp
Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110cag gga
acc ctg gtc acc gtc tcg agt ggt gga ggc ggt tca ggc gga 384Gln Gly
Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120
125ggt ggc agc ggc ggt ggc gga tcg cag tct gtg ctg act cag cct gcc
432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala
130 135 140tcc gtg tct ggg tct cct gga cag tcg atc acc atc tcc tgc
act gga 480Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys
Thr Gly145 150 155 160acc agc agt gac gtt ggt ggt tat aac tat gtc
tcc tgg tac caa caa 528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val
Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aaa gcc ccc aaa ctc atg
att tat gag ggc agt aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met
Ile Tyr Glu Gly Ser Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc
ttc tct ggc tcc aag tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg
Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc
tct ggg ctc cag gct gag gac gag gct gat tat 672Ala Ser Leu Thr Ile
Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc
tca tat aca acc agg agc act cga gtt ttc ggc gaa ggg 720Tyr Cys Ser
Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Glu Gly225 230 235
240acc aag ctg acc gtc cta ggt 741Thr Lys Leu Thr Val Leu Gly
245191729DNAArtificial sequenceCDS(1)..(729)Polynucleotide encoding
GMBC673 scFv protein 191gag gtg cag ctg gtg gag tct ggg gga ggc ttg
gta cag act ggg ggg 48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu
Val Gln Thr Gly Gly1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga
ttt ccc att ggc agt cac 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Pro Ile Gly Ser His 20 25 30tgg atg agc tgg gtc cgc cag tct ccg
ggg aag ggg ctg gag tgg gtg 144Trp Met Ser Trp Val Arg Gln Ser Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45gcc agc atc aag caa gat gga cgt
gag aag cac ttt gtg gac tct gtg 192Ala Ser Ile Lys Gln Asp Gly Arg
Glu Lys His Phe Val Asp Ser Val 50 55 60aag ggc cga ttc ggc atc tcc
aga gac aac gcc aag gac tca ctg tat 240Lys Gly Arg Phe Gly Ile Ser
Arg Asp Asn Ala Lys Asp Ser Leu Tyr65 70 75 80ctc caa atg aac agc
ctg aga atc gag gac acg gct gtc tac tac tgt 288Leu Gln Met Asn Ser
Leu Arg Ile Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gag acg
tac ggg gga tac tac tat tac ttc atg gac gtc tgg 336Ala Arg Glu Thr
Tyr Gly Gly Tyr Tyr Tyr Tyr Phe Met Asp Val Trp 100 105 110ggc cga
ggc acc ctg gtc acc gtc tcg agt ggt gga ggc ggt tca ggc 384Gly Arg
Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly 115 120
125gga ggt ggc agc ggc ggt ggc gga tcg tct gag ctg act cag gac cct
432Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro
130 135 140gct gtg tct gtg gcc ttg gga cag aca gtc agg atc aca tgc
caa gga 480Ala Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys
Gln Gly145 150 155 160gac agc ctc aga agc tat tat gca agc tgg tac
cag cag aag cca gga 528Asp Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr
Gln Gln Lys Pro Gly 165 170 175cag gcc cct gta ctt gtc atc tat ggt
aaa aac aac cgg ccc tca ggg 576Gln Ala Pro Val Leu Val Ile Tyr Gly
Lys Asn Asn Arg Pro Ser Gly 180 185 190atc cca gac cga ttc tct ggc
tcc agc tca gga aac aca gct tcc ttg 624Ile Pro Asp Arg Phe Ser Gly
Ser Ser Ser Gly Asn Thr Ala Ser Leu 195 200 205acc atc act ggg gct
cag gcg gaa gat gag gct gac tat tac tgt cag 672Thr Ile Thr Gly Ala
Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Gln 210 215 220acc tgg ggc
cct ggc att cga gtg ttc ggc gga ggg acc aag ctg acc 720Thr Trp Gly
Pro Gly Ile Arg Val Phe Gly Gly Gly Thr Lys Leu Thr225 230 235
240gtc cta ggt 729Val Leu Gly192741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC676 scFv protein
192gag gtg cag ctg gtg cag tct ggg gga ggc ttg gta cag cct ggg ggg
48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1
5 10 15tcc ctg aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt cac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser His
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa gct agt ggt ggg aca ata gac
tac gcc gca 192Gly Arg Ile Lys Ser Lys Ala Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg cac atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu His Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggg 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110cgg ggg aca atg gtc acc gtc
tct tca ggt gga ggc ggt tca ggc gga 384Arg Gly Thr Met Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag ccg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Pro Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245193741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC678 scFv protein
193gag gtg cag ctg gtg gag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agt aaa ggt agt ggt ggg aca ata gac
tac gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110cag gga acc ctg gtc acc gtc
tcc tca ggt ggg ggc ggt tca ggc gga 384Gln Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct ccc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Pro 130 135 140tcc gcg tcc
ggg tct cct gga cag tca gtc acc atc tcc tgc act gga 480Ser Ala Ser
Gly Ser Pro Gly Gln Ser Val Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gat gtt ggt ggt tat aac tat gtc tcc tgg tac caa cag
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ttc atg att tat gat gtc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Phe Met Ile Tyr Asp Val Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcg tcc ctg acc atc tct ggg gtc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Val Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca agc gcc
agc act gtg ata ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Ser Ala
Ser Thr Val Ile Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245194741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC679 scFv protein
194cag gtg cag ctg gtg gag tct ggg gga ggc ttg gta aag cct ggg ggg
48Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agt aaa ggt agt ggt ggg aca aca gac
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Thr Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca aga gat gat
tca gaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Glu Asn Thr65 70 75 80ctg tat cta caa atg aac agc ctg aaa acc
gag gac aca gcc gta tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Val Tyr 85 90 95tac tgt acg tgg gac cat agt tat tat
tat gat atg gcc gtc tgg ggc 336Tyr Cys Thr Trp Asp His Ser Tyr Tyr
Tyr Asp Met Ala Val Trp Gly 100 105 110cga ggc acc ctg gtc acc gtc
tcc tca ggt gga ggc ggt tca ggc gga 384Arg Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc gtg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Val Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245195720DNAArtificial
sequenceCDS(1)..(720)Polynucleotide encoding GMBC681 scFv protein
195cag gtg cag ctg gtg cag tct ggg gga ggc gtg gtc cag cct ggg ggg
48Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Gly1
5 10
15tcc ctg aga ctc tcc tgt gca gcg tct gga ttc acc ttc agt agc tat
96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg gag tgg
gtg 144Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45gca ttt ata cgg tat gat gga agt aat aaa tac tat gca gac
tcc gtg 192Ala Phe Ile Arg Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp
Ser Val 50 55 60aag ggc cga ttc acc atc tcc aga gac aat tcc aag aac
acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Tyr65 70 75 80ctg caa atg aac agc ctg aga gct gag gac acg
gct gtg tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys 85 90 95gcg aaa gga gga act ggc tac ttc gat ctc
tgg ggc cga gga acc ctg 336Ala Lys Gly Gly Thr Gly Tyr Phe Asp Leu
Trp Gly Arg Gly Thr Leu 100 105 110gtc acc gtc tcc tca ggt gga ggc
ggt tca ggc gga ggt ggc agc ggc 384Val Thr Val Ser Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gly 115 120 125ggt ggc gga tcg gac atc
cag atg acc cag tct cct tcc acc ctg tct 432Gly Gly Gly Ser Asp Ile
Gln Met Thr Gln Ser Pro Ser Thr Leu Ser 130 135 140gca tct att gga
gac aga gtc acc atc acc tgc cgg gcc agt gag ggt 480Ala Ser Ile Gly
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Glu Gly145 150 155 160att
tat cac tgg ttg gcc tgg tat cag cag aag cca ggg aaa gcc cct 528Ile
Tyr His Trp Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro 165 170
175aaa ctc ctg atc tat aag gcc tct agt tta gcc agt ggg gcc cca tca
576Lys Leu Leu Ile Tyr Lys Ala Ser Ser Leu Ala Ser Gly Ala Pro Ser
180 185 190agg ttc agc ggc agt gga tct ggg aca gat ttc act ctc acc
atc agc 624Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
Ile Ser 195 200 205agc ctg cag cct gat gat ttt gca act tat tac tgc
caa caa tat agt 672Ser Leu Gln Pro Asp Asp Phe Ala Thr Tyr Tyr Cys
Gln Gln Tyr Ser 210 215 220aat tat ccg ctc act ttc ggc gga ggg acc
aag ctg gag atc aaa cgt 720Asn Tyr Pro Leu Thr Phe Gly Gly Gly Thr
Lys Leu Glu Ile Lys Arg225 230 235 240196732DNAArtificial
sequenceCDS(1)..(732)Polynucleotide encoding GMBC682 scFv protein
196cag gtg cag ctg gtg gag tct ggg gga ggc gtg gta aag ccg ggg ggg
48Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc aaa ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Lys Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110cgg gga acc ctg gtc acc gtc
tcc tca ggt gga ggc ggt tca ggc gga 384Arg Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg tct gag ctg act cag gac cct gct 432Gly Gly Ser Gly Gly
Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140gtg tct gtg
gcc ttg gga cag aca gtc agg atc aca tgc caa gga gac 480Val Ser Val
Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155
160agc ctc aga agc tat tat gca agc tgg tac cag cag aag cca gga cag
528Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln
165 170 175gcc cct gta ctt gtc atc tat ggt aaa aac aac cgg ccc tca
ggg atc 576Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser
Gly Ile 180 185 190cca gac cga ttc tct ggc tcc agc tca gga aac aca
gct tcc ttg acc 624Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr
Ala Ser Leu Thr 195 200 205atc act ggg gct cag gcg gaa gat gag gct
gac tat tac tgt aac tcc 672Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala
Asp Tyr Tyr Cys Asn Ser 210 215 220cgg gac agc agt ggt aac cat gtg
gta ttc ggc gga ggg acc aag ctg 720Arg Asp Ser Ser Gly Asn His Val
Val Phe Gly Gly Gly Thr Lys Leu225 230 235 240acc gtc cta ggt
732Thr Val Leu Gly197723DNAArtificial
sequenceCDS(1)..(723)Polynucleotide encoding GMBC683 scFv protein
197gag gtg cag ctg gtg gag tcc ggg gga ggc ttg gtc cag cct ggg agg
48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg1
5 10 15tcc ctg aga ctc tcc tgt gca gcg tct gga ttc acc ttc agt agc
tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser
Tyr 20 25 30ggc atg cac tgg gtc cgc cag gct cca ggc aag ggg ctg gag
tgg gtg 144Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45gca gtt ata tca tat gat gga agt aat aaa tac tat gca
gac tcc gtg 192Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala
Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc aga gac aat tcc aag
aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr Leu Tyr65 70 75 80ctg caa atg aac agc ctg aga gct gag gac
acg gct gtg tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg aaa cgg gca gca gct ggt acc ctt
gac tac tgg ggg cag ggg acc 336Ala Lys Arg Ala Ala Ala Gly Thr Leu
Asp Tyr Trp Gly Gln Gly Thr 100 105 110acg gtc acc gtc tcg agt ggt
gga ggc ggt tca ggc gga ggt ggc agc 384Thr Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125ggc ggt ggc gga tcg
tct gag ctg act cag gac cct gct gtg tct gtg 432Gly Gly Gly Gly Ser
Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val 130 135 140gcc ttg gga
cag aca gtc agg atc aca tgc caa gga gac agt ctc aga 480Ala Leu Gly
Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg145 150 155
160agc tat tat gca agc tgg tac cag cag aag cca gga cag gcc cct gta
528Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val
165 170 175ctt gtc atc tat ggt aaa aac aac cgg ccc tca ggg atc cca
gac cga 576Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro
Asp Arg 180 185 190ttc tct ggc tcc agc tca gga aac aca gct tcc ttg
acc atc act ggg 624Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu
Thr Ile Thr Gly 195 200 205gct cag gcg gaa gat gag gct gac tat tac
tgt aac tcc cgg gac agc 672Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr
Cys Asn Ser Arg Asp Ser 210 215 220agt ggt aac cat gtg gta ttc ggc
gga ggg acc aag ctg acc gtc cta 720Ser Gly Asn His Val Val Phe Gly
Gly Gly Thr Lys Leu Thr Val Leu225 230 235 240ggt
723Gly198741DNAArtificial sequenceCDS(1)..(741)Polynucleotide
encoding GMBC684 scFv protein 198cag gtg cag ctg gtg caa tct ggg
gga ggc ttg gta aag ccg ggg ggg 48Gln Val Gln Leu Val Gln Ser Gly
Gly Gly Leu Val Lys Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca
gcc tct ggt ttc aaa ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Phe Lys Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cgc
cag gct cca ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agc
aaa ggt agt ggc ggg aca ata gac tac gct gca 192Gly Arg Ile Lys Ser
Lys Gly Ser Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac
aga ttc acc atc tca cga gat gat tca aaa aac acg 240Pro Val Lys Asp
Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat
ctg caa atg aac agt ctg aaa acc gag gac aca gcc cta tat 288Leu Tyr
Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95tac
tgt acg tgg gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr
Cys Thr Trp Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105
110caa gga acc ccg gtc acc gtc tcg agt ggt gga ggc ggt tca ggc gga
384Gln Gly Thr Pro Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125ggt ggc agc ggc ggt ggc gga tcg cag tct gcg ctg act cag
cct gcc 432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Ala Leu Thr Gln
Pro Ala 130 135 140tcc gtg tct ggg tct cct gga cag tcg atc acc atc
tcc tgc act gga 480Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile
Ser Cys Thr Gly145 150 155 160acc agc agt gac gtt ggt ggt tat aac
tat gtc tcc tgg tac caa caa 528Thr Ser Ser Asp Val Gly Gly Tyr Asn
Tyr Val Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aaa gcc ccc aaa
ctc atg att tat gag ggc agt aag cgg 576His Pro Gly Lys Ala Pro Lys
Leu Met Ile Tyr Glu Gly Ser Lys Arg 180 185 190ccc tca ggg gtt tct
aat cgc ttc tct ggc tcc aag tct ggc aac acg 624Pro Ser Gly Val Ser
Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205gcc tcc ctg
aca atc tct ggg ctc cag gct gag gac gag gct gat tat 672Ala Ser Leu
Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac
tgc agc tca tat aca acc agg agc act cga gtt ttc ggc gga ggg 720Tyr
Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230
235 240acc aag ctg acc gtc cta ggt 741Thr Lys Leu Thr Val Leu Gly
245199732DNAArtificial sequenceCDS(1)..(732)Polynucleotide encoding
GMBC685 scFv protein 199cag gtg cag ctg gtg gag tct ggg gga gtc gtg
gta cag cct ggg ggg 48Gln Val Gln Leu Val Glu Ser Gly Gly Val Val
Val Gln Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt
ttc act ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca
ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt
ggt ggg aca ata gac tac gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser
Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc
atc tca cga gat gat tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr
Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg
aac agt ctg aaa acc gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met
Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg
gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp
Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110aag ggg
aca atg gtc acc gtc tcg agt ggt gga ggc ggt tca ggc gga 384Lys Gly
Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120
125ggt ggc agc ggc ggt ggc gga tcg tct gag ctg act cag gac cct gct
432Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala
130 135 140gtg tct gtg gcc ttg gga cag aca gtc agg atc act tgc caa
gga gac 480Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln
Gly Asp145 150 155 160agt ctc aga agc tat tac aca aac tgg ttc cag
cag aag cca gga cag 528Ser Leu Arg Ser Tyr Tyr Thr Asn Trp Phe Gln
Gln Lys Pro Gly Gln 165 170 175gcc cct cta ctt gtc gtc tat gct aaa
aat aag cgg ccc tca ggg atc 576Ala Pro Leu Leu Val Val Tyr Ala Lys
Asn Lys Arg Pro Ser Gly Ile 180 185 190cca gac cga ttc tct ggc tcc
agc tca gga aac aca gct tcc ttg acc 624Pro Asp Arg Phe Ser Gly Ser
Ser Ser Gly Asn Thr Ala Ser Leu Thr 195 200 205atc act ggg gct cag
gcg gaa gat gag gct gac tat tac tgt cat tcc 672Ile Thr Gly Ala Gln
Ala Glu Asp Glu Ala Asp Tyr Tyr Cys His Ser 210 215 220cgg gac agc
agt ggt aac cat gtg ctt ttc ggc gga ggg acc aag ctg 720Arg Asp Ser
Ser Gly Asn His Val Leu Phe Gly Gly Gly Thr Lys Leu225 230 235
240acc gtc cta ggt 732Thr Val Leu Gly200741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC686 scFv protein
200gag gtg cag ctg gtg cag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gac
tac gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Asp
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc atc tca cga gat gat
tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110cag ggg acc acg gtc acc gtc
tcc tca ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Thr Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245201741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC687 scFv protein
201cag gtg cag ctg gtg cag tct ggg gca gag gtg aag aag cct ggg tcc
48Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1
5 10 15tcg gtg aaa gtc tcc tgc aag gct cct gga gac acc ttc agc aac
tat 96Ser Val Lys Val Ser Cys Lys
Ala Pro Gly Asp Thr Phe Ser Asn Tyr 20 25 30att ttc aac tgg gtg cga
cag gcc cct gga caa gga ctt gag tgg atg 144Ile Phe Asn Trp Val Arg
Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45gga ggg atc atc cca
aag ttt ggt aca gta aat gat gca cac aag ttc 192Gly Gly Ile Ile Pro
Lys Phe Gly Thr Val Asn Asp Ala His Lys Phe 50 55 60caa gac aga gtc
acc att gcc gct gac gaa tcc acg aac acg gcc tcc 240Gln Asp Arg Val
Thr Ile Ala Ala Asp Glu Ser Thr Asn Thr Ala Ser65 70 75 80atg gag
ctg agc agc ctg aca tct gag gac acg gcc gtt tat tac tgt 288Met Glu
Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg
tgc gaa ccc att ccc aag gac tac ggt gac gtt aat ggt ctt gaa 336Ala
Cys Glu Pro Ile Pro Lys Asp Tyr Gly Asp Val Asn Gly Leu Glu 100 105
110atc tgg ggc aaa ggg aca atg gtc acc gtc tct tca ggt gga ggc ggt
384Ile Trp Gly Lys Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly
115 120 125tca ggc gga ggt ggc agc ggc ggt ggc gga tcg gac atc cag
atg acc 432Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln
Met Thr 130 135 140cag tct cct tcc acc ctg tct gca tct att gga gac
aga gtc acc atc 480Gln Ser Pro Ser Thr Leu Ser Ala Ser Ile Gly Asp
Arg Val Thr Ile145 150 155 160acc tgc cgg gcc agt gag ggt att tat
cac tgg ttg gcc tgg tat cag 528Thr Cys Arg Ala Ser Glu Gly Ile Tyr
His Trp Leu Ala Trp Tyr Gln 165 170 175cag aag cca ggg aaa gcc cct
aaa ctc ctg atc tat aag gcc tct agt 576Gln Lys Pro Gly Lys Ala Pro
Lys Leu Leu Ile Tyr Lys Ala Ser Ser 180 185 190tta gcc agt ggg gcc
cca tca agg ttc agc ggc agt gga tct ggg aca 624Leu Ala Ser Gly Ala
Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr 195 200 205gat ttc act
ctc acc atc agc agc ctg cag cct gat gat ttt gca act 672Asp Phe Thr
Leu Thr Ile Ser Ser Leu Gln Pro Asp Asp Phe Ala Thr 210 215 220tat
tac tgc caa caa tat agt aat tat ccg ctc act ttc ggc gga ggg 720Tyr
Tyr Cys Gln Gln Tyr Ser Asn Tyr Pro Leu Thr Phe Gly Gly Gly225 230
235 240acc aag ctg gag atc aaa cgt 741Thr Lys Leu Glu Ile Lys Arg
245202741DNAArtificial sequenceCDS(1)..(741)Polynucleotide encoding
GMBC689 scFv protein 202cag gtg cag ctg gtg gag tct ggg gga ggc ttg
gta aag ccg ggg ggg 48Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu
Val Lys Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt
ttc act ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca
ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt
ggt ggg aca ata gac tac gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser
Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc
atc tca cga gat gat tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr
Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg
aac agt ctg aaa acc gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met
Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg
gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp
Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110cag gga
acc ctg gtc acc gtc tcg agt ggt gga ggc ggt tca ggc gga 384Gln Gly
Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120
125ggt ggc agc ggc ggt ggc gga tcg cag tct gtg ctg act cag cct ccc
432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Pro
130 135 140tcc gcg tcc ggg tct ccc gga cag tca gtc acc atc tcc tgc
act gga 480Ser Ala Ser Gly Ser Pro Gly Gln Ser Val Thr Ile Ser Cys
Thr Gly145 150 155 160acc agc agt gat gtt ggt ggt tat aac tat gtc
tcc tgg tac caa cag 528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val
Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aaa gcc ccc aaa ttc atg
att tat gat gtc agt aag cgg 576His Pro Gly Lys Ala Pro Lys Phe Met
Ile Tyr Asp Val Ser Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc
ttc tct ggc tcc aag tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg
Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205gcg tcc ctg acc atc
tct ggg gtc cag gct gag gac gag gct gat tat 672Ala Ser Leu Thr Ile
Ser Gly Val Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc
tca tat aca agc gcc agc act gtg gta ttc ggc gga ggg 720Tyr Cys Ser
Ser Tyr Thr Ser Ala Ser Thr Val Val Phe Gly Gly Gly225 230 235
240acc aag ctg acc gtc cta ggt 741Thr Lys Leu Thr Val Leu Gly
245203741DNAArtificial sequenceCDS(1)..(741)Polynucleotide encoding
GMBC690 scFv protein 203gaa gtg cag ctg gtg cag tct ggg gga ggc gtg
gtc cag cct ggg agg 48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val
Val Gln Pro Gly Arg1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct ggt
ttc act ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca
ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt
ggt ggg aca ata gac tac gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser
Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc
atc tca cga gat gat tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr
Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg
aac agt ctg aaa acc gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met
Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg
gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp
Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110aga ggc
acc ctg gtc act gtc tct tca ggc gga ggc ggt tca ggc gga 384Arg Gly
Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120
125ggt ggc agc ggc ggt ggc gga tcg cag tct gtg ctg act cag cct gcc
432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala
130 135 140tcc gtg tct ggg tct cct gga cag tcg atc acc atc tcc tgc
act gga 480Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys
Thr Gly145 150 155 160acc agc agt gac gtt ggt ggt tat atc tat gtc
tcc tgg tac caa caa 528Thr Ser Ser Asp Val Gly Gly Tyr Ile Tyr Val
Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aga gcc ccc aaa ctc atg
att tat gag ggc agt aag cgg 576His Pro Gly Arg Ala Pro Lys Leu Met
Ile Tyr Glu Gly Ser Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc
ttc tct ggc tcc aag tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg
Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc
tct ggg ctc cag gct gag gac gag gct gat tat 672Ala Ser Leu Thr Ile
Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc
tca tat aca acc agg agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser
Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230 235
240acc aag ctg acc gtc cta ggt 741Thr Lys Leu Thr Val Leu Gly
245204759DNAArtificial sequenceCDS(1)..(759)Polynucleotide encoding
GMBC691 scFv protein 204gaa gtg cag ctg gtg cag tct ggg gct gag gtg
aag aag cct ggg gcc 48Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val
Lys Lys Pro Gly Ala1 5 10 15tca atg aaa gtc tcc tgc aag act tct gga
gac acc ttc aac ggc ttt 96Ser Met Lys Val Ser Cys Lys Thr Ser Gly
Asp Thr Phe Asn Gly Phe 20 25 30tat gta cac tgg gtg cga cag gcc cct
ggc caa ggg ctt gag tgg atg 144Tyr Val His Trp Val Arg Gln Ala Pro
Gly Gln Gly Leu Glu Trp Met 35 40 45gga cgg atc aac cct aat ggt ggt
ggc aca aac tat gca cag aaa ttt 192Gly Arg Ile Asn Pro Asn Gly Gly
Gly Thr Asn Tyr Ala Gln Lys Phe 50 55 60cag ggc agg gtc acc atg acc
agg gac acg tcc atg aac aca gcc tac 240Gln Gly Arg Val Thr Met Thr
Arg Asp Thr Ser Met Asn Thr Ala Tyr65 70 75 80atg gag ttg agg agc
ctg aga tct gac gac acg gcc gtc tac tac tgt 288Met Glu Leu Arg Ser
Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gat ctg
ttt tac gat ttt tgg agt gat tat tat cga aat gat 336Ala Arg Asp Leu
Phe Tyr Asp Phe Trp Ser Asp Tyr Tyr Arg Asn Asp 100 105 110cag tac
tac tac atg gac gtc tgg ggc cgg ggc acc ctg gtc acc gtc 384Gln Tyr
Tyr Tyr Met Asp Val Trp Gly Arg Gly Thr Leu Val Thr Val 115 120
125tcg agt ggt gga ggc ggt tca ggc gga ggt ggc agc ggc ggt ggc gga
432Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
130 135 140tcg tct gag ctg act cag gac cct gct gtg tct gtg gcc ttg
gga cag 480Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu
Gly Gln145 150 155 160aca gtc agg atc aca tgc caa gga gac agc ctc
aga agc tat tat gca 528Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu
Arg Ser Tyr Tyr Ala 165 170 175agc tgg tac cag cag aag cca gga cag
gcc cct gta ctt gtc atc tat 576Ser Trp Tyr Gln Gln Lys Pro Gly Gln
Ala Pro Val Leu Val Ile Tyr 180 185 190ggt aaa aac aac cgg ccc tca
ggg atc cca gac cga ttc tct ggc tcc 624Gly Lys Asn Asn Arg Pro Ser
Gly Ile Pro Asp Arg Phe Ser Gly Ser 195 200 205agc tca gga aac aca
gct tcc ttg acc atc act ggg gct cag gcg gaa 672Ser Ser Gly Asn Thr
Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu 210 215 220gat gag gct
gac tat tac tgt aac tcc cgg gac agc agt ggt aac cat 720Asp Glu Ala
Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn His225 230 235
240gtg gta ttc ggc gga ggg acc aag ctg acc gtc cta ggt 759Val Val
Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 245
250205741DNAArtificial sequenceCDS(1)..(741)Polynucleotide encoding
GMBC692 scFv protein 205gag gtg cag ctg gtg cag tct ggg gga ggc ttg
gta aag ccg ggg ggg 48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu
Val Lys Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt
ttc act ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca
ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt
ggt ggg aca ata gac tac gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser
Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc
atc tca cga gac gat tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr
Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg
aac agt ctg aaa acc gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met
Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg
gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp
Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110agg gga
acc ctg gtc acc gtc tcg agt ggt gga ggc ggt tca ggc gga 384Arg Gly
Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120
125ggt ggc agc ggc ggt ggc gga tcg cag tct gtg ctg act cag cct gcc
432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala
130 135 140tcc gtg tct ggg tct cct gga cag tcg atc acc atc tcc tgc
act gga 480Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys
Thr Gly145 150 155 160acc agc agt gac gtt ggt ggt tat aac tat gtc
tcc tgg tac caa caa 528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val
Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aaa gcc ccc aaa ctc atg
att tat gag ggc agt aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met
Ile Tyr Glu Gly Ser Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc
ttc tct ggc tcc aag tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg
Phe Ser Gly Ser Lys Ser Gly Asn Thr 195 200 205gcc tcc cta aca atc
tct ggg ctc cag gct gag gac gag gct gat tat 672Ala Ser Leu Thr Ile
Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc
tca tat aca acc agg agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser
Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230 235
240acc aag ctg acc gtc cta ggt 741Thr Lys Leu Thr Val Leu Gly
245206741DNAArtificial sequenceCDS(1)..(741)Polynucleotide encoding
GMBC693 scFv protein 206cag gtg cag ctg gtg gag tct ggg gga ggc ttg
gta aag ccg ggg ggg 48Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu
Val Lys Pro Gly Gly1 5 10 15tcc ctt aga ctc tcc tgt gca gcc tct ggt
ttc act ttc agt gac gcc 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Asp Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca
ggg aag ggg ctg gag tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt
ggt ggg aca ata gac tac gcc gca 192Gly Arg Ile Lys Ser Lys Gly Ser
Gly Gly Thr Ile Asp Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc acc
atc tca cga gat gat tca aaa aac acg 240Pro Val Lys Asp Arg Phe Thr
Ile Ser Arg Asp Asp Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg
aac agt ctg aaa acc gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met
Asn Ser Leu Lys Thr Glu Asp Thr Ala Leu Tyr 85 90 95tac tgt acg tgg
gac tgg gat ttc tac tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp
Asp Trp Asp Phe Tyr Tyr Gly Met Asn Val Trp Gly 100 105 110aaa ggc
acc ctg gtc acc gtc tcc tca ggt gga ggc ggt tca ggc gga 384Lys Gly
Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120
125ggt ggc agc ggc ggt ggc gga tcg cag tct gtg ctg act cag cct gcc
432Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala
130 135 140tcc gtg tct ggg tct cct gga cag tcg atc acc atc tcc tgc
act gga 480Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys
Thr Gly145 150 155 160acc agc agt gac gtt ggt ggt tat aac tat gtc
tcc tgg tac caa caa 528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val
Ser Trp Tyr Gln Gln 165 170 175cac cca ggc aaa gcc ccc aaa ctc atg
att tat gag ggc agt aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met
Ile Tyr Glu Gly Ser Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc
ttc tct ggc tcc aag tct ggc gac acg 624Pro Ser Gly Val Ser Asn Arg
Phe Ser Gly Ser Lys Ser Gly Asp Thr 195 200 205gcc tcc ctg aca atc
tct ggg ctc cag gct gag gac gag gct gat tat 672Ala Ser Leu Thr Ile
Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc
tca tat aca acc agg agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser
Ser Tyr Thr Thr Arg Ser Thr Arg Val Phe Gly Gly Gly225 230 235
240acc aag ctg acc gtc cta ggt 741Thr Lys Leu Thr Val Leu Gly
245207723DNAArtificial sequenceCDS(1)..(723)Polynucleotide encoding
GMBC696 scFv protein 207gaa gtg cag ctg gtg cag tct agg gct gag gtg
aag aag cct ggg gcc 48Glu Val Gln Leu Val Gln Ser Arg Ala Glu Val
Lys Lys Pro Gly Ala1
5 10 15tca gtg aag gtc tcc tgc aaa acc tct gga tac acc ttc aac ggc
tac 96Ser Val Lys Val Ser Cys Lys Thr Ser Gly Tyr Thr Phe Asn Gly
Tyr 20 25 30tat ata cac tgg gtg cga cag gcc cct gga cag ggg ctt gag
tgg atg 144Tyr Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45gga tgg atc gac cct atc aat agt gtc acg aac tat gca
cag aac ttt 192Gly Trp Ile Asp Pro Ile Asn Ser Val Thr Asn Tyr Ala
Gln Asn Phe 50 55 60cag ggc agg gtc acc atg act agg gac acg tcc atc
aac acg gcc tac 240Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile
Asn Thr Ala Tyr65 70 75 80atg gag ctg agc cgg ctg aca tct gac gac
acg gcc gtc tat tac tgt 288Met Glu Leu Ser Arg Leu Thr Ser Asp Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg agg gcc aga gtg tct acg att ctt
caa tac tgg ggc cag ggc acc 336Ala Arg Ala Arg Val Ser Thr Ile Leu
Gln Tyr Trp Gly Gln Gly Thr 100 105 110ctg gtc acc gtc tcc tca ggt
gga ggc ggt tca ggc gga ggt ggc agc 384Leu Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125ggc ggt ggc gga tcg
tct gag ctg act cag gac cct gct gtg tct gtg 432Gly Gly Gly Gly Ser
Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val 130 135 140gcc ttg gga
cag aca gtc agg atc aca tgc caa gga gac agc ctc aga 480Ala Leu Gly
Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg145 150 155
160agc tat tat gca agc tgg tac cag cag aag cca gga cag gcc cct gta
528Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val
165 170 175ctt gtc atc tat ggt aaa aac aac cgg ccc tca ggg atc cca
gac cga 576Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro
Asp Arg 180 185 190ttc tct ggc tcc agc tca gga aac aca gct tcc ttg
acc atc act ggg 624Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu
Thr Ile Thr Gly 195 200 205gct cag gcg gaa gat gag gct gac tat tac
tgt aac tcc cgg gac agc 672Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr
Cys Asn Ser Arg Asp Ser 210 215 220agt ggt aac cat gtg gta ttc ggc
gga ggg acc aag ctg acc gtc cta 720Ser Gly Asn His Val Val Phe Gly
Gly Gly Thr Lys Leu Thr Val Leu225 230 235 240ggt
723Gly208726DNAArtificial sequenceCDS(1)..(726)Polynucleotide
encoding GMBC725 scFv protein 208gag gtg cag ctg gtg cag acc ggg
gga ggc gtg gtt cag cct ggg ggg 48Glu Val Gln Leu Val Gln Thr Gly
Gly Gly Val Val Gln Pro Gly Gly1 5 10 15tcc ctg aga ctc tcc tgt gca
gcg tct gga ttc acc ttc agt agc tat 96Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30ggc atg cac tgg gtc cgc
cag gct cca ggc aag ggg ctg gag tgg gtg 144Gly Met His Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45gca ttt ata cta tat
gat gga agt aat aaa tac tat gca gac tcc gtg 192Ala Phe Ile Leu Tyr
Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60aag ggc cga ttc
acc atc tcc aga gac aat tcc aag aac acg ctg tat 240Lys Gly Arg Phe
Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg caa
atg aac agc ctg aga gct gag gac acg gct gtg tat tac tgt 288Leu Gln
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg
aaa tcc tcg tca tca gcc agt gct ttt gat atc tgg agg caa aga 336Ala
Lys Ser Ser Ser Ser Ala Ser Ala Phe Asp Ile Trp Arg Gln Arg 100 105
110acc acg gtc act gtc tcc tca ggt gga ggc ggt tca ggc gga ggt ggc
384Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
115 120 125agc ggc ggt ggc gga tcg tct gag ctg act cag gac cct gct
gtg tct 432Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala
Val Ser 130 135 140gtg gcc ttg gga cag aca gtc agg atc aca tgc caa
gga gac agc ctc 480Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln
Gly Asp Ser Leu145 150 155 160aga agc tat tat gcg agc tgg tac cag
cag aag cca gga cag gcc cca 528Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln
Gln Lys Pro Gly Gln Ala Pro 165 170 175gta ctt gtc atc tat ggt aaa
aac aac cgg ccc tca ggg atc cca gac 576Val Leu Val Ile Tyr Gly Lys
Asn Asn Arg Pro Ser Gly Ile Pro Asp 180 185 190cga ttc tct ggc tcc
agc tca gga aac aca gct tcc ttg acc atc act 624Arg Phe Ser Gly Ser
Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr 195 200 205ggg gct cag
gcg gaa gat gag gct gac tat tac tgt aac tcc cgg gac 672Gly Ala Gln
Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp 210 215 220agc
agt ggt aac cat gtg gta ttc ggc gga ggg acc aag ctg acc gtc 720Ser
Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val225 230
235 240cta ggt 726Leu Gly209741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC727 scFv protein
209gag gtg cag ctg gtg gag tct ggg gga gac acg gta aag cct ggg gga
48Glu Val Gln Leu Val Glu Ser Gly Gly Asp Thr Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca ggc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag gga ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgc atg aaa agc aag ggt agt ggt ggg aca aga gac
tac gcc gca 192Gly Arg Met Lys Ser Lys Gly Ser Gly Gly Thr Arg Asp
Tyr Ala Ala 50 55 60ccc gtg aat ggc aga ttc acc atc tca aga gat gat
tca aaa aat acg 240Pro Val Asn Gly Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctt tat ctg caa atg aac agc ctg aat acc
gag gac aca ggc gta tat 288Leu Tyr Leu Gln Met Asn Ser Leu Asn Thr
Glu Asp Thr Gly Val Tyr 85 90 95tat tgt acc tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110agg ggc acc ctg gtc acc gtc
tcg agt gga gga ggc ggt tca ggc gga 384Arg Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245210732DNAArtificial
sequenceCDS(1)..(732)Polynucleotide encoding GMBC729 scFv protein
210cag gtg cag ctg cag gag tcg ggg gga ggc ttg gta aag ccg ggg ggg
48Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca ggc tct ggt ttc aaa ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Lys Phe Ser Asp
Ala 20 25 30tgg atg aat tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aaa ggt agt ggt ggg aca ata gag
tac gct gca 192Gly Arg Ile Lys Ser Lys Gly Ser Gly Gly Thr Ile Glu
Tyr Ala Ala 50 55 60ccc gtg aaa gac aga ttc atc atc tca cga gat gat
tca aaa gac acg 240Pro Val Lys Asp Arg Phe Ile Ile Ser Arg Asp Asp
Ser Lys Asp Thr65 70 75 80ctg tat ctg caa atg gac agt ctg aaa acc
gag gac aca gcc ctg tat 288Leu Tyr Leu Gln Met Asp Ser Leu Lys Thr
Glu Asp Thr Ala Leu Tyr 85 90 95tat tgt acg tgg gac tgg gat ttc tac
tac ggt atg aac gtc tgg ggc 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asn Val Trp Gly 100 105 110cag gga acc ctg gtc acc gtc
tcg agt ggt gga ggc ggt tca ggc gga 384Gln Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg tct gag ctg act cag gac cct gct 432Gly Gly Ser Gly Gly
Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala 130 135 140gtg tct gtg
gcc ttg gga cag aca gtc agg atc act tgc caa gga gac 480Val Ser Val
Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp145 150 155
160agt ctc aga aac tat tac aca aac tgg ttc cag cag aag cca gga cag
528Ser Leu Arg Asn Tyr Tyr Thr Asn Trp Phe Gln Gln Lys Pro Gly Gln
165 170 175gcc cct cta ctt gtc gtc tat gct aaa aat aag cgg ccc tca
ggg atc 576Ala Pro Leu Leu Val Val Tyr Ala Lys Asn Lys Arg Pro Ser
Gly Ile 180 185 190cca gac cga ttc tct ggc tcc agc tca gga aac aca
gct tcc ttg acc 624Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr
Ala Ser Leu Thr 195 200 205atc act ggg gct cag gcg gaa gat gag gct
gac tat tac tgt cat tcc 672Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala
Asp Tyr Tyr Cys His Ser 210 215 220cgg gac agc agt ggt aac cat gtg
ctt ttc ggc gga ggg acc aag ctg 720Arg Asp Ser Ser Gly Asn His Val
Leu Phe Gly Gly Gly Thr Lys Leu225 230 235 240acc gtc cta ggt
732Thr Val Leu Gly211741DNAArtificial
sequenceCDS(1)..(741)Polynucleotide encoding GMBC730 scFv protein
211cag gtg cag ctg gtg gag tct ggg gga gac tcg gta aag cct ggg gga
48Gln Val Gln Leu Val Glu Ser Gly Gly Asp Ser Val Lys Pro Gly Gly1
5 10 15tcc ctt aga ctc tcc tgt gca ggc tct ggt ttc act ttc agt gac
gcc 96Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30tgg atg aac tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt atg aaa agc aag ggt agt ggt ggg aca aga gac
tac gct gca 192Gly Arg Met Lys Ser Lys Gly Ser Gly Gly Thr Arg Asp
Tyr Ala Ala 50 55 60ccc gtg aat ggc aga ttc acc atc tca aga gat gat
tca aaa aac acg 240Pro Val Asn Gly Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ctg tat ctg caa atg aac agc ctg aat acc
gag gac aca ggc gta tat 288Leu Tyr Leu Gln Met Asn Ser Leu Asn Thr
Glu Asp Thr Gly Val Tyr 85 90 95tat tgt acg tgg gac tgg gat ttc tac
tac ggt atg gac gtc tgg ggg 336Tyr Cys Thr Trp Asp Trp Asp Phe Tyr
Tyr Gly Met Asp Val Trp Gly 100 105 110aag ggg acc acg gtc acc gtc
tcg agt ggt gga ggc ggt tca ggc gga 384Lys Gly Thr Thr Val Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125ggt ggc agc ggc ggt
ggc gga tcg cag tct gtg ctg act cag cct gcc 432Gly Gly Ser Gly Gly
Gly Gly Ser Gln Ser Val Leu Thr Gln Pro Ala 130 135 140tcc gtg tct
ggg tct cct gga cag tcg atc acc atc tcc tgc act gga 480Ser Val Ser
Gly Ser Pro Gly Gln Ser Ile Thr Ile Ser Cys Thr Gly145 150 155
160acc agc agt gac gtt ggt ggt tat aac tat gtc tcc tgg tac caa caa
528Thr Ser Ser Asp Val Gly Gly Tyr Asn Tyr Val Ser Trp Tyr Gln Gln
165 170 175cac cca ggc aaa gcc ccc aaa ctc atg att tat gag ggc agt
aag cgg 576His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Gly Ser
Lys Arg 180 185 190ccc tca ggg gtt tct aat cgc ttc tct ggc tcc aag
tct ggc aac acg 624Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys
Ser Gly Asn Thr 195 200 205gcc tcc ctg aca atc tct ggg ctc cag gct
gag gac gag gct gat tat 672Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc agc tca tat aca acc agg
agc act cga gtt ttc ggc gga ggg 720Tyr Cys Ser Ser Tyr Thr Thr Arg
Ser Thr Arg Val Phe Gly Gly Gly225 230 235 240acc aag ctg acc gtc
cta ggt 741Thr Lys Leu Thr Val Leu Gly 245212735DNAArtificial
sequenceCDS(1)..(735)Polynucleotide encoding GMCC101 scFv protein
212gaa gtg cag ctg gtg cag tct ggg gct gag gtg aag aag cct ggg tcc
48Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1
5 10 15tcg gtg aag gtc tcc tgc aag gct tct gga ggc acc ttc agg acc
tat 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Arg Thr
Tyr 20 25 30gct atc acc tgg gtg cga cag gcc cct gga caa ggg ctt gag
tgg atg 144Ala Ile Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45gga ggg atc atc cct atc tct gcc aca gca aac tac gca
cag aag ttc 192Gly Gly Ile Ile Pro Ile Ser Ala Thr Ala Asn Tyr Ala
Gln Lys Phe 50 55 60cag ggc aga gtc acg att acc gcg gac gag tca atg
agc aca gcc tac 240Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Met
Ser Thr Ala Tyr65 70 75 80atg gaa ctg agc agc ctg aga tct gaa gac
acg gcc gtg tat tac tgt 288Met Glu Leu Ser Ser Leu Arg Ser Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gat cgg gag ccc cac tac ttt
gac aac tgg ggc cgg ggg aca 336Ala Arg Asp Arg Glu Pro His Tyr Phe
Asp Asn Trp Gly Arg Gly Thr 100 105 110atg gtc acc gtc tcg agt gga
ggc ggc ggt tca ggc gga ggt ggc tct 384Met Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125ggc ggt ggc gga agt
gca ctg cct gtg ctg act cag cca ccc tcg gtg 432Gly Gly Gly Gly Ser
Ala Leu Pro Val Leu Thr Gln Pro Pro Ser Val 130 135 140tct gaa gcc
ccc agg cag ggg gtc acc atc tcc tgt tct gga agc agc 480Ser Glu Ala
Pro Arg Gln Gly Val Thr Ile Ser Cys Ser Gly Ser Ser145 150 155
160tcc aac atc gga aat aat gct gta agc tgg tac cag cag ctc cca gga
528Ser Asn Ile Gly Asn Asn Ala Val Ser Trp Tyr Gln Gln Leu Pro Gly
165 170 175cag gct ccc aaa ctc ctc atc tat tat gat gat ctg ctg ccc
tca ggg 576Gln Ala Pro Lys Leu Leu Ile Tyr Tyr Asp Asp Leu Leu Pro
Ser Gly 180 185 190gtc tct gac cga ttc tct gcc tcc aag tct ggc acc
tca gcc tcc ctg 624Val Ser Asp Arg Phe Ser Ala Ser Lys Ser Gly Thr
Ser Ala Ser Leu 195 200 205gcc atc agt ggg ctc cag tct gag gat gag
gct gat tat tac tgt gca 672Ala Ile Ser Gly Leu Gln Ser Glu Asp Glu
Ala Asp Tyr Tyr Cys Ala 210 215 220gca tgg gat gac agt ctg aat ggt
gtg ata ttc ggc gga ggg acc cag 720Ala Trp Asp Asp Ser Leu Asn Gly
Val Ile Phe Gly Gly Gly Thr Gln225 230 235 240ctc acc gtt tta agt
735Leu Thr Val Leu Ser 245213780DNAArtificial
sequenceCDS(1)..(780)Polynucleotide encoding GMCC102 scFv protein
213cag gtc cag ctg gtg cag tct ggg gct gag gtg aag aag cct ggg gcc
48Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly
Ala1
5 10 15tca gtg aag gtt tcc tgc aag gca cct gga tac acc ttc acc agc
tac 96Ser Val Lys Val Ser Cys Lys Ala Pro Gly Tyr Thr Phe Thr Ser
Tyr 20 25 30tat atg cac tgg gtg cga cag gcc cct gga caa ggg ctt gag
tgg atg 144Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45gga ata atc aac cct agt ggt ggt agc aca agc tac gca
cag aag ttc 192Gly Ile Ile Asn Pro Ser Gly Gly Ser Thr Ser Tyr Ala
Gln Lys Phe 50 55 60cag ggc aga gtc acc atg acc agg gac acg tcc acg
agc aca gtc tac 240Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr
Ser Thr Val Tyr65 70 75 80atg gag ctg agc agc ctg aga tct gag gac
acg gcc gtg tat tac tgt 288Met Glu Leu Ser Ser Leu Arg Ser Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga ggt ggg gcc aga agc aat gat
agt agt ggt tat tac aaa tca 336Ala Arg Gly Gly Ala Arg Ser Asn Asp
Ser Ser Gly Tyr Tyr Lys Ser 100 105 110ccc ctc tcc tac tac tac ggt
atg gac gtc tgg ggc cgg ggg aca atg 384Pro Leu Ser Tyr Tyr Tyr Gly
Met Asp Val Trp Gly Arg Gly Thr Met 115 120 125gtc acc gtc tcg agt
gga ggc ggc ggt tca ggc gga ggt ggc tct ggc 432Val Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 130 135 140ggt ggc gga
agt gca cag tct gtg ctg act cag cca ccc tca gcg tct 480Gly Gly Gly
Ser Ala Gln Ser Val Leu Thr Gln Pro Pro Ser Ala Ser145 150 155
160ggg acc ccc ggg cag agg gtc acc atc tct tgt tct gga agc agc tcc
528Gly Thr Pro Gly Gln Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser
165 170 175aac atc ggg agt aat act gta aac tgg tac cag cag ctc cca
gga acg 576Asn Ile Gly Ser Asn Thr Val Asn Trp Tyr Gln Gln Leu Pro
Gly Thr 180 185 190gcc ccc aaa ctc ctc atc tat agt aat aat cag cgg
ccc tca ggg gtc 624Ala Pro Lys Leu Leu Ile Tyr Ser Asn Asn Gln Arg
Pro Ser Gly Val 195 200 205cct gac cga ttc tct ggc tcc aag tct ggc
acc tca gcc tcc ctg gcc 672Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly
Thr Ser Ala Ser Leu Ala 210 215 220atc agt ggg ctc cag tct gag gat
gag gct gat tat tac tgt gca gca 720Ile Ser Gly Leu Gln Ser Glu Asp
Glu Ala Asp Tyr Tyr Cys Ala Ala225 230 235 240tgg gat gac agc ctg
aat ggt gtg gta ttc ggc gga ggg acc aag gtc 768Trp Asp Asp Ser Leu
Asn Gly Val Val Phe Gly Gly Gly Thr Lys Val 245 250 255acc gtc cta
ggt 780Thr Val Leu Gly 260214750DNAArtificial
sequenceCDS(1)..(750)Polynucleotide encoding GMCC105 scFv protein
214cag gtc cag ctg gtg cag tct ggg gga gga gtg gtc cag cct ggg agg
48Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg1
5 10 15tcc ctg aga ctc tcc tgc aca gcc tct gga ttc aac ctc ggt tcc
cat 96Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Phe Asn Leu Gly Ser
His 20 25 30ggc atg cac tgg gtc cgc cag gct ccc ggc aag ggg ctg gag
tgg gtg 144Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45gca gtt ata gga ttt gat gga acg act aaa tat tat gtg
gac tcc gtg 192Ala Val Ile Gly Phe Asp Gly Thr Thr Lys Tyr Tyr Val
Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc agg gac aac tcc agg
aac acc cta tct 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg
Asn Thr Leu Ser65 70 75 80ctg caa atg aac agc ctg aga gct gag gac
acg gct gtc tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gtg aga gaa gat tac tac tat gat agt
agt ggt tat tac ttt gac tac 336Val Arg Glu Asp Tyr Tyr Tyr Asp Ser
Ser Gly Tyr Tyr Phe Asp Tyr 100 105 110tgg ggc cga gga acc ctg gtc
acc gtc tcg agt gga ggc ggc ggt tca 384Trp Gly Arg Gly Thr Leu Val
Thr Val Ser Ser Gly Gly Gly Gly Ser 115 120 125ggc gga ggt ggc tct
ggc ggt ggc gga agt gca ctt tct tct gag ctg 432Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Ala Leu Ser Ser Glu Leu 130 135 140act cag gac
cct ttc gtg tct gtt gcc ttg gga cag aca gtc agg atc 480Thr Gln Asp
Pro Phe Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile145 150 155
160gca tgc cga gga gac agc ctc aga gat tct tat gca agt tgg tac cag
528Ala Cys Arg Gly Asp Ser Leu Arg Asp Ser Tyr Ala Ser Trp Tyr Gln
165 170 175cag aag cca gga cag gcc cct cga ctt ctc gtc tat gga aac
aat ctt 576Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Val Tyr Gly Asn
Asn Leu 180 185 190cgg ccc tcc ggg atc cct ggc cgg ttc tct ggc tcc
agc tca gga gac 624Arg Pro Ser Gly Ile Pro Gly Arg Phe Ser Gly Ser
Ser Ser Gly Asp 195 200 205aca gct tcc ttg tcc atc act gag act cag
gcg gga gat gag gct gac 672Thr Ala Ser Leu Ser Ile Thr Glu Thr Gln
Ala Gly Asp Glu Ala Asp 210 215 220tat tac tgc agt tcc cgg ggc aac
agt acc tct cgc ctc tat gtc ttc 720Tyr Tyr Cys Ser Ser Arg Gly Asn
Ser Thr Ser Arg Leu Tyr Val Phe225 230 235 240gga act ggg acc aag
ctg acc gtc cta ggt 750Gly Thr Gly Thr Lys Leu Thr Val Leu Gly 245
250215735DNAArtificial sequenceCDS(1)..(735)Polynucleotide encoding
GMCC106 scFv protein 215cag gtg cag ctg cag gag tcg ggt cca gga ctg
gtg aag cct tcg ggg 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu
Val Lys Pro Ser Gly1 5 10 15acc ctg tcc ctc act tgc gct gtc tct gtt
ggc tcc atc aac gaa agt 96Thr Leu Ser Leu Thr Cys Ala Val Ser Val
Gly Ser Ile Asn Glu Ser 20 25 30aac tgg tgg agt tgg gtt cgc cag tcc
cca ggg aag gga ctg gag tgg 144Asn Trp Trp Ser Trp Val Arg Gln Ser
Pro Gly Lys Gly Leu Glu Trp 35 40 45att gga gaa atc tat cct act ggg
acc acc aac tac aac ccg tcc ctg 192Ile Gly Glu Ile Tyr Pro Thr Gly
Thr Thr Asn Tyr Asn Pro Ser Leu 50 55 60gag agt cgg gtc acg ata tca
gta gac aag tcc agg aac ctc ttc tcc 240Glu Ser Arg Val Thr Ile Ser
Val Asp Lys Ser Arg Asn Leu Phe Ser65 70 75 80ctg aaa ctg aag tct
gtg acc gcc gcg gac tcg gcc atg tat ttc tgt 288Leu Lys Leu Lys Ser
Val Thr Ala Ala Asp Ser Ala Met Tyr Phe Cys 85 90 95gcg aga gat cgg
tgg gct ggt ggt ttt gat ctc tgg ggc aga ggg aca 336Ala Arg Asp Arg
Trp Ala Gly Gly Phe Asp Leu Trp Gly Arg Gly Thr 100 105 110atg gtc
acc gtc tcg agt gga ggc ggc ggt tca ggc gga ggt ggc tct 384Met Val
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120
125ggc ggt ggc gga agt gca cag tct gtg ttg acg cag ccg ccc tca gcg
432Gly Gly Gly Gly Ser Ala Gln Ser Val Leu Thr Gln Pro Pro Ser Ala
130 135 140tct ggg acc ccc ggg cag agg gtc acc atc tct tgt tct gga
agc agc 480Ser Gly Thr Pro Gly Gln Arg Val Thr Ile Ser Cys Ser Gly
Ser Ser145 150 155 160tcc aac atc gga agt aat tct gta tac tgg tac
cag cag ctc cca gga 528Ser Asn Ile Gly Ser Asn Ser Val Tyr Trp Tyr
Gln Gln Leu Pro Gly 165 170 175acg gcc ccc aaa ctc ctc atc tat agg
aat aat cag cgg ccc tca ggg 576Thr Ala Pro Lys Leu Leu Ile Tyr Arg
Asn Asn Gln Arg Pro Ser Gly 180 185 190gtc cct gac cga ttc tct gct
tcc aag tct ggc acc tca gcc tcc ctg 624Val Pro Asp Arg Phe Ser Ala
Ser Lys Ser Gly Thr Ser Ala Ser Leu 195 200 205gcc atc agt ggg ctc
cgg tcc gag gat gag gct gat tat tac tgt gca 672Ala Ile Ser Gly Leu
Arg Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala 210 215 220gca tgg gat
gac agc ctg agt ggt ctg gtc ttc ggc gga ggg acc aag 720Ala Trp Asp
Asp Ser Leu Ser Gly Leu Val Phe Gly Gly Gly Thr Lys225 230 235
240ctg acc gtc cta ggt 735Leu Thr Val Leu Gly
245216750DNAArtificial sequenceCDS(1)..(750)Polynucleotide encoding
GMCC107 scFv protein 216cag gtc cag ctg gtg cag tct ggg gct gag gtg
aag aag cct ggg gcc 48Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val
Lys Lys Pro Gly Ala1 5 10 15tca gtg aag gtc tcc tgc agg acc tct gga
tac acc ttc act gac cat 96Ser Val Lys Val Ser Cys Arg Thr Ser Gly
Tyr Thr Phe Thr Asp His 20 25 30tct atg cat tgg gtg cgc cag gcc ccc
gga cag agg ttt gag tgg atg 144Ser Met His Trp Val Arg Gln Ala Pro
Gly Gln Arg Phe Glu Trp Met 35 40 45gga tgg atc ggc gct gac agt ggt
tcc aca cag tat tca cgg aac ttc 192Gly Trp Ile Gly Ala Asp Ser Gly
Ser Thr Gln Tyr Ser Arg Asn Phe 50 55 60cag ggc aga ctc acc att ggc
agg gac aca tcc gcg agc aca gtg tac 240Gln Gly Arg Leu Thr Ile Gly
Arg Asp Thr Ser Ala Ser Thr Val Tyr65 70 75 80atg gag ctg acc agt
ctg aga tct gaa gac acg gct gtc tat tac tgt 288Met Glu Leu Thr Ser
Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aga gtg ggg
gga ggt cag ggg tgg tac tcc ggc atg gac gtc tgg 336Ala Arg Val Gly
Gly Gly Gln Gly Trp Tyr Ser Gly Met Asp Val Trp 100 105 110ggc aga
ggc acc ctg gtc acc gtc tcg agt gga ggc ggc ggt tca ggc 384Gly Arg
Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly 115 120
125gga ggt ggc tct ggc ggt ggc gga agt gca cag gct gtg ctg act cag
432Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Gln Ala Val Leu Thr Gln
130 135 140ccg tcc tca gtg tct ggg gcc cca ggg cag agg gtc acc atc
tcc tgc 480Pro Ser Ser Val Ser Gly Ala Pro Gly Gln Arg Val Thr Ile
Ser Cys145 150 155 160act ggg agc agc tcc aac atc ggg gca agt tat
gat gta cac tgg tac 528Thr Gly Ser Ser Ser Asn Ile Gly Ala Ser Tyr
Asp Val His Trp Tyr 165 170 175cag cag ctt cca gga aca gcc ccc aaa
ctc ctc atc tat aat aac aat 576Gln Gln Leu Pro Gly Thr Ala Pro Lys
Leu Leu Ile Tyr Asn Asn Asn 180 185 190aat cgg ccc tca ggg gtc cct
gac cga ttc tct ggc tcc agg tct ggc 624Asn Arg Pro Ser Gly Val Pro
Asp Arg Phe Ser Gly Ser Arg Ser Gly 195 200 205acc tca gcc tcc ctg
gcc atc act ggg ctc cag gct gag gat gag gct 672Thr Ser Ala Ser Leu
Ala Ile Thr Gly Leu Gln Ala Glu Asp Glu Ala 210 215 220gat tat tac
tgc cac tcc tat gac agc aac ctg agt ggt gat gtc ttc 720Asp Tyr Tyr
Cys His Ser Tyr Asp Ser Asn Leu Ser Gly Asp Val Phe225 230 235
240gga tct ggg acc aag ctg acc gtc cta ggt 750Gly Ser Gly Thr Lys
Leu Thr Val Leu Gly 245 250217765DNAArtificial
sequenceCDS(1)..(765)Polynucleotide encoding GMCC108 scFv protein
217gaa gtg cag ctg gtg cag tct ggg gca gag gtg aag gag cct ggg gcc
48Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Glu Pro Gly Ala1
5 10 15tca gtg acc gtt tcc tgc aag gct tct gga tac acc ttc att agt
tac 96Ser Val Thr Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ile Ser
Tyr 20 25 30cac atg cac tgg gtt cga cag gcc cct gga caa ggg ctt gag
tgg atg 144His Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu
Trp Met 35 40 45gga ata atc aat cct agt ggt ggt gac aca acc tac gca
cag aag ttc 192Gly Ile Ile Asn Pro Ser Gly Gly Asp Thr Thr Tyr Ala
Gln Lys Phe 50 55 60cag ggc aga gtc acc atg acc agg gac acg tca acg
agc aca gtt tac 240Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr
Ser Thr Val Tyr65 70 75 80atg gag ctg agg agc ctg aga ttt gag gac
acg gcc agg tat tac tgt 288Met Glu Leu Arg Ser Leu Arg Phe Glu Asp
Thr Ala Arg Tyr Tyr Cys 85 90 95gcg aga gat cta aag ttc tac gat ttt
cgg agt gga aag tat cag gac 336Ala Arg Asp Leu Lys Phe Tyr Asp Phe
Arg Ser Gly Lys Tyr Gln Asp 100 105 110tac gga atg gat gtc tgg ggc
cag gga acc ctg gtc acc gtc tcg agt 384Tyr Gly Met Asp Val Trp Gly
Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125gga ggc ggc ggt tca
ggc gga ggt ggc tct ggc ggt ggc gga agt gca 432Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala 130 135 140cag tct gtg
ctg act cag cca ccg tcg ctg tca gtg gcc cca gga cag 480Gln Ser Val
Leu Thr Gln Pro Pro Ser Leu Ser Val Ala Pro Gly Gln145 150 155
160acg gcc agt att acc tgt ggg gga aac gac att gga act aaa agt gta
528Thr Ala Ser Ile Thr Cys Gly Gly Asn Asp Ile Gly Thr Lys Ser Val
165 170 175cac tgg tac cag ctg aag cca ggc cag gcc cct gtg ttg gtc
gtc tat 576His Trp Tyr Gln Leu Lys Pro Gly Gln Ala Pro Val Leu Val
Val Tyr 180 185 190gat aat aga gac cgg ccc tca ggg atc cct gag cga
ttc tct ggc tcc 624Asp Asn Arg Asp Arg Pro Ser Gly Ile Pro Glu Arg
Phe Ser Gly Ser 195 200 205aac tct ggg aac acg gcc acc cta acc atc
agc agg gtc gaa ggc ggg 672Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile
Ser Arg Val Glu Gly Gly 210 215 220gat gag gcc gac tat tat tgt cag
gtg tgg gat agt agt att gat cat 720Asp Glu Ala Asp Tyr Tyr Cys Gln
Val Trp Asp Ser Ser Ile Asp His225 230 235 240tcc gaa tat gtc ttc
gga act ggg acc aag ctg acc gtc cta ggt 765Ser Glu Tyr Val Phe Gly
Thr Gly Thr Lys Leu Thr Val Leu Gly 245 250 255218732DNAArtificial
sequenceCDS(1)..(732)Polynucleotide encoding GMCC109 scFv protein
218cag gtg cag ctg cag gag tcg ggg gga ggc ttg gta cag cct ggg ggg
48Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1
5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttt agc agc
tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser
Tyr 20 25 30gcc atg agc tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45tca gct att agt ggt agt ggt ggt agc aca tac tac gca
gac tcc gtg 192Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala
Asp Ser Val 50 55 60aag ggc cgg ttc acc atc tcc aga gac aat tcc aag
aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr Leu Tyr65 70 75 80ctg caa atg aac agc ctg aga gcc gag gac
acg gcc gta tat tac tgt 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg aaa agt caa tgg agt ggg agc tac
tac ggc tca ttt gac tac tgg 336Ala Lys Ser Gln Trp Ser Gly Ser Tyr
Tyr Gly Ser Phe Asp Tyr Trp 100 105 110ggc cgg ggg aca atg gtc acc
gtc tcg agt gga ggc ggc ggt tca ggc 384Gly Arg Gly Thr Met Val Thr
Val Ser Ser Gly Gly Gly Gly Ser Gly 115 120 125gga ggt ggc tct ggc
ggt ggc gga agt gca cag tct gtg ctg act cag 432Gly Gly Gly Ser Gly
Gly Gly Gly Ser Ala Gln Ser Val Leu Thr Gln 130 135 140cca ccc tca
gtg tcc gtt tct cca gga cag aca gcc acc atc acc tgc 480Pro Pro Ser
Val Ser Val Ser Pro Gly Gln Thr Ala Thr Ile Thr Cys145 150 155
160tct gga gac aaa ttg ggg gat aaa tat gtt tcc tgg tat cag aag aag
528Ser Gly Asp Lys Leu Gly Asp Lys Tyr Val Ser Trp Tyr Gln Lys Lys
165 170 175cca gga cag gcc cct gtg ctg gtc atc tat caa gat gac aag
cgg ccg 576Pro Gly Gln Ala Pro Val Leu Val Ile Tyr Gln Asp Asp Lys
Arg Pro 180 185 190tca ggg atc cct gag cga ttc tct ggc tcc aac tct
ggg aac aca gcc 624Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Asn Ser
Gly Asn Thr Ala 195 200 205act ctg acc atc agc ggg acc cag gct atg
gat gag ggt gac tat tac 672Thr Leu Thr Ile Ser Gly Thr Gln Ala Met
Asp Glu Gly Asp Tyr Tyr 210 215 220tgt cag gcg tgg gac aga agt gtg
ata ttc ggc gga ggg acc aag gtc 720Cys Gln Ala Trp Asp Arg Ser Val
Ile Phe Gly Gly Gly Thr Lys Val225 230
235 240acc gtc cta ggt 732Thr Val Leu Gly219750DNAArtificial
sequenceCDS(1)..(750)Polynucleotide encoding GMCC110 scFv protein
219cag gtg cag ctg cag gag tcg ggc ccg gga ctg gtg aag cct tca cag
48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln1
5 10 15acc ctg tcc ctc acc tgc act gtc tct ggt gcc tcc atc agt agt
gga 96Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Ala Ser Ile Ser Ser
Gly 20 25 30ggt tac cgc tgg atc tgg att cgc cag cac cca ggg cag ggg
ctg gag 144Gly Tyr Arg Trp Ile Trp Ile Arg Gln His Pro Gly Gln Gly
Leu Glu 35 40 45tgg att ggg gac atc cat tac agt ggg agc acc cag tac
aac ccg tcc 192Trp Ile Gly Asp Ile His Tyr Ser Gly Ser Thr Gln Tyr
Asn Pro Ser 50 55 60ctc aag agt cga gtt gcc ttg aca ctg gac agg tct
aaa aac caa ttc 240Leu Lys Ser Arg Val Ala Leu Thr Leu Asp Arg Ser
Lys Asn Gln Phe65 70 75 80tcc ctg cag ctg agc tct gtg acg gcc gcg
gac acg gcc gtc tac tat 288Ser Leu Gln Leu Ser Ser Val Thr Ala Ala
Asp Thr Ala Val Tyr Tyr 85 90 95tgt gcg aga gat ccg cgt gga cac acg
tat ggt tat ggt tac tac ttt 336Cys Ala Arg Asp Pro Arg Gly His Thr
Tyr Gly Tyr Gly Tyr Tyr Phe 100 105 110gac tac tgg ggc aaa ggc acc
ctg gtc acc gtc tcg agt gga ggc ggc 384Asp Tyr Trp Gly Lys Gly Thr
Leu Val Thr Val Ser Ser Gly Gly Gly 115 120 125ggt tca ggc gga ggt
ggc tct ggc ggt ggc gga agt gca ctt tct tct 432Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Ala Leu Ser Ser 130 135 140gag ctg act
cag gac cct gat gtg tct gtg gcc ttg gga cag aca gtc 480Glu Leu Thr
Gln Asp Pro Asp Val Ser Val Ala Leu Gly Gln Thr Val145 150 155
160acg atc aca tgc caa gga gac aga ctc aga aga tat tat gca agc tgg
528Thr Ile Thr Cys Gln Gly Asp Arg Leu Arg Arg Tyr Tyr Ala Ser Trp
165 170 175tac cag cag aag cca gga cag gcc cct gtg ctt gtc atc ttt
cgt aaa 576Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Phe
Arg Lys 180 185 190aac aac cgg ccc tca ggg atc cca gac cga ttc tct
ggc tcc agc tca 624Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser
Gly Ser Ser Ser 195 200 205gga gac aca gct tcc ttg acc atc act ggg
gct cag gcg gaa gat gag 672Gly Asp Thr Ala Ser Leu Thr Ile Thr Gly
Ala Gln Ala Glu Asp Glu 210 215 220gct gac tat tac tgt aac tca cgg
gac acc agt ggt acc ctt tca ttc 720Ala Asp Tyr Tyr Cys Asn Ser Arg
Asp Thr Ser Gly Thr Leu Ser Phe225 230 235 240ggc gga ggg acc cag
ctc acc gtt tta agt 750Gly Gly Gly Thr Gln Leu Thr Val Leu Ser 245
250220735DNAArtificial sequenceCDS(1)..(735)Polynucleotide encoding
GMCC112 scFv protein 220cag gtc cag ctg gta cag tct ggg gga ggc ttg
gta cag ccg ggg ggg 48Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu
Val Gln Pro Gly Gly1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga
ttc agc ttt agt act tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Ser Phe Ser Thr Tyr 20 25 30gcc atg agt tgg gtc cgc cag gct cca
ggg aag gga ctg gag tgg gtc 144Ala Met Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45tca ggc gtt agt gat ggt ggt gac
aca ttc tac gca gac tcc gta agg 192Ser Gly Val Ser Asp Gly Gly Asp
Thr Phe Tyr Ala Asp Ser Val Arg 50 55 60ggc cgc ttc acc ctc tcc aga
gac aac gcc aag aac acg ctg ttt ctg 240Gly Arg Phe Thr Leu Ser Arg
Asp Asn Ala Lys Asn Thr Leu Phe Leu65 70 75 80caa atg aac agc ctg
aca gcc gag gac acg gcc aca tat tac tgt gcg 288Gln Met Asn Ser Leu
Thr Ala Glu Asp Thr Ala Thr Tyr Tyr Cys Ala 85 90 95aaa gag ata gca
aga att gga gtt cca aat ttc gac cac tgg ggc cag 336Lys Glu Ile Ala
Arg Ile Gly Val Pro Asn Phe Asp His Trp Gly Gln 100 105 110ggc acc
ctg gtc acc gtc tcg agt gga ggc ggc ggt tca ggc gga ggt 384Gly Thr
Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120
125ggc tct ggc ggt ggc gga agt gca ctt gaa acg aca ctc acg cag tct
432Gly Ser Gly Gly Gly Gly Ser Ala Leu Glu Thr Thr Leu Thr Gln Ser
130 135 140ccg ggc acc ttg tct ttg tct cca ggg gac aga gcc acc ctc
tcc tgc 480Pro Gly Thr Leu Ser Leu Ser Pro Gly Asp Arg Ala Thr Leu
Ser Cys145 150 155 160agg gcc agt cag agt att aga aat aac gac gtc
gcc tgg tac cag cag 528Arg Ala Ser Gln Ser Ile Arg Asn Asn Asp Val
Ala Trp Tyr Gln Gln 165 170 175aaa cct ggc cag gca ccc aga ctc ctc
atc tat agt gca tcc agg cgc 576Lys Pro Gly Gln Ala Pro Arg Leu Leu
Ile Tyr Ser Ala Ser Arg Arg 180 185 190gcc act gac atc cca gac agg
ttc agt ggc agt gcc tct ggg aca gac 624Ala Thr Asp Ile Pro Asp Arg
Phe Ser Gly Ser Ala Ser Gly Thr Asp 195 200 205ttc act ctc acc atc
agc aga ctg gag cct gag gat ttt gcg atg tac 672Phe Thr Leu Thr Ile
Ser Arg Leu Glu Pro Glu Asp Phe Ala Met Tyr 210 215 220tac tgt cag
cag tat ggc ggc tcg gcc tcc ttc ggc caa ggg aca cga 720Tyr Cys Gln
Gln Tyr Gly Gly Ser Ala Ser Phe Gly Gln Gly Thr Arg225 230 235
240ctg gag att aaa cgt 735Leu Glu Ile Lys Arg
245221750DNAArtificial sequenceCDS(1)..(750)Polynucleotide encoding
GMCC114 scFv protein 221gag gtg cag ctg gtg gag tcc ggg cct gag gtg
aag aag cct ggg tcc 48Glu Val Gln Leu Val Glu Ser Gly Pro Glu Val
Lys Lys Pro Gly Ser1 5 10 15tcg gtt aag gtc tcc tgc aag gct tct ggt
gcc gcc gcc ttc agc agc 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly
Ala Ala Ala Phe Ser Ser 20 25 30tat gca atc agc tgg gtg cgt cag gcc
cct gga cga ggg ctt gag tgg 144Tyr Ala Ile Ser Trp Val Arg Gln Ala
Pro Gly Arg Gly Leu Glu Trp 35 40 45atg ggc ggc atc atc ccc atc tct
gat aca cca aag tat gca cat aag 192Met Gly Gly Ile Ile Pro Ile Ser
Asp Thr Pro Lys Tyr Ala His Lys 50 55 60ttc cag ggc aga gtc aca att
acc gcg gac gaa tcc acg acc aca gtc 240Phe Gln Gly Arg Val Thr Ile
Thr Ala Asp Glu Ser Thr Thr Thr Val65 70 75 80ttc atg gag gtg agc
ggc ctg aga tct gac gac acg gcc gtc tat tac 288Phe Met Glu Val Ser
Gly Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr 85 90 95tgt gcg aca acc
aca agg tat ggt tcg ggc act tat gat tac atg gac 336Cys Ala Thr Thr
Thr Arg Tyr Gly Ser Gly Thr Tyr Asp Tyr Met Asp 100 105 110gtc tgg
ggc caa ggg aca atg gtc acc gtc tcg agt gga ggc ggc ggt 384Val Trp
Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly 115 120
125tca ggc gga ggt ggc tct ggc ggt ggc gga agt gca ctt tct tct gag
432Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Leu Ser Ser Glu
130 135 140ctg act cag gac cct gct gtg tct gtg gcc ttg gga cag aca
gtc agg 480Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln Thr
Val Arg145 150 155 160atc aca tgc caa gga gac agc ctc aga agt tat
tat gca agt tgg tat 528Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr
Tyr Ala Ser Trp Tyr 165 170 175caa cag aag cca gga cag gcc ccg gta
ctt gtc ttc tat ggt aaa aac 576Gln Gln Lys Pro Gly Gln Ala Pro Val
Leu Val Phe Tyr Gly Lys Asn 180 185 190aag cgg ccc tcg ggg atc cca
gac cga ttc tcg ggc tcc acc tca gga 624Lys Arg Pro Ser Gly Ile Pro
Asp Arg Phe Ser Gly Ser Thr Ser Gly 195 200 205aac aca gct tcc ttg
tcc atc acc ggg gct ctg gcg gat gat gag gcc 672Asn Thr Ala Ser Leu
Ser Ile Thr Gly Ala Leu Ala Asp Asp Glu Ala 210 215 220gac tat tac
tgt cac tcc cgt gac acc agt ggt gcc cag att ctt ttc 720Asp Tyr Tyr
Cys His Ser Arg Asp Thr Ser Gly Ala Gln Ile Leu Phe225 230 235
240ggc gga ggg acc aag ctg acc gtc cta ggt 750Gly Gly Gly Thr Lys
Leu Thr Val Leu Gly 245 250222753DNAArtificial
sequenceCDS(1)..(753)Polynucleotide encoding GMCC118 scFv protein
222gag gtg cag ctg gtg cag tct ggg gga ggc ttg gta aag ccg ggg ggg
48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15tca ctt aga ctc tcc tgt aca gcc tct gga ttc agt ttc act aac
gcc 96Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Phe Ser Phe Thr Asn
Ala 20 25 30tgg atg agc tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtt 144Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45ggc cgt att aaa agc aga aat gat ggt ggg gca aca gac
tac gct gca 192Gly Arg Ile Lys Ser Arg Asn Asp Gly Gly Ala Thr Asp
Tyr Ala Ala 50 55 60ccc gtg aaa ggc aga ttc acc atc tca aga gat gat
tca aaa aac acg 240Pro Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Asn Thr65 70 75 80ttg tat ctg caa atg aat agc ctg aaa acc
gac gac aca gcc gta tac 288Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr
Asp Asp Thr Ala Val Tyr 85 90 95tac tgt acc aca gat aac ttc cca tta
cga ttt ttg gag tgg tta tcc 336Tyr Cys Thr Thr Asp Asn Phe Pro Leu
Arg Phe Leu Glu Trp Leu Ser 100 105 110cat cct gac tac tgg ggc caa
ggg aca atg gtc acc gtc tcg agt gga 384His Pro Asp Tyr Trp Gly Gln
Gly Thr Met Val Thr Val Ser Ser Gly 115 120 125ggc ggc ggt tca ggc
gga ggt ggc tct ggc ggt ggc gga agt gca cag 432Gly Gly Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Gln 130 135 140gct gtg ctg
act cag ccg tcc tca gtg tcc gtg tcc cca gga cag aca 480Ala Val Leu
Thr Gln Pro Ser Ser Val Ser Val Ser Pro Gly Gln Thr145 150 155
160gtc acc atc acc tgc tct ggg gaa aaa ttg gac aat aaa tat att tcc
528Val Thr Ile Thr Cys Ser Gly Glu Lys Leu Asp Asn Lys Tyr Ile Ser
165 170 175tgg tat caa cag agg cca ggc cgg tcc cct atc ctg gtc att
tat caa 576Trp Tyr Gln Gln Arg Pro Gly Arg Ser Pro Ile Leu Val Ile
Tyr Gln 180 185 190gat cgg aag cgg ccc tca ggg atc cct gag cga ttc
tct ggc tcc aac 624Asp Arg Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe
Ser Gly Ser Asn 195 200 205tcc ggg aac aca gcc act ctg acc atc acc
ggg tcc cag cct ttg gat 672Ser Gly Asn Thr Ala Thr Leu Thr Ile Thr
Gly Ser Gln Pro Leu Asp 210 215 220gag gct gac tat tac tgt cag gcg
tgg gac agc agc act gct tgg gag 720Glu Ala Asp Tyr Tyr Cys Gln Ala
Trp Asp Ser Ser Thr Ala Trp Glu225 230 235 240ttc ggc gga ggg acc
aag ctg acc gtc cta ggt 753Phe Gly Gly Gly Thr Lys Leu Thr Val Leu
Gly 245 250223756DNAArtificial sequenceCDS(1)..(756)Polynucleotide
encoding GMCC119 scFv protein 223gaa gtg cag ctg gtg cag tct ggg
cct gag gtg aag aag cca ggg gcc 48Glu Val Gln Leu Val Gln Ser Gly
Pro Glu Val Lys Lys Pro Gly Ala1 5 10 15tca gtg aag gtc tcc tgc aag
gct tct aat tac acc ttc acc acc tac 96Ser Val Lys Val Ser Cys Lys
Ala Ser Asn Tyr Thr Phe Thr Thr Tyr 20 25 30gac atc agc tgg gtg cga
cag gcc cct gga caa ggg ctt gag tgg atg 144Asp Ile Ser Trp Val Arg
Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45gga tgg atc agc aca
tat agt ggg aac aca aag tat gca cag aag ttc 192Gly Trp Ile Ser Thr
Tyr Ser Gly Asn Thr Lys Tyr Ala Gln Lys Phe 50 55 60cag ggc aga gtc
acc atg acc aga gac acg tcc acg agc gca gcc tac 240Gln Gly Arg Val
Thr Met Thr Arg Asp Thr Ser Thr Ser Ala Ala Tyr65 70 75 80atg gag
ctg agg aac ctg aga tct gac gac acg gcc gtt tat ttc tgt 288Met Glu
Leu Arg Asn Leu Arg Ser Asp Asp Thr Ala Val Tyr Phe Cys 85 90 95gcg
aga gat atc cgt gtg tgg cgt ggt tcg ggc agt gtc cac tac ttc 336Ala
Arg Asp Ile Arg Val Trp Arg Gly Ser Gly Ser Val His Tyr Phe 100 105
110gac ccc tgg ggg cga ggg acc acg gtc acc gtc tcg agt gga ggc ggc
384Asp Pro Trp Gly Arg Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly
115 120 125ggt tca ggc gga ggt ggc tct ggc ggt ggc gga agt gca caa
tct gcc 432Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Gln
Ser Ala 130 135 140ctg act cag cct cgc tca gtg tcc ggg tct cct gga
cag tca gtc acc 480Leu Thr Gln Pro Arg Ser Val Ser Gly Ser Pro Gly
Gln Ser Val Thr145 150 155 160atc tcc tgc act gga acc agc aat gat
gtt ggt ggt tat aac ttt gtc 528Ile Ser Cys Thr Gly Thr Ser Asn Asp
Val Gly Gly Tyr Asn Phe Val 165 170 175tcc tgg tac caa caa cac cca
ggc aaa gcc ccc aaa ctc atg gtt tat 576Ser Trp Tyr Gln Gln His Pro
Gly Lys Ala Pro Lys Leu Met Val Tyr 180 185 190aat gtc agt aag cgg
ccc tca ggg gtc cct gat cgc ttc tct ggc tcc 624Asn Val Ser Lys Arg
Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser 195 200 205aag tct ggc
aac acg gcc tcc ctg acc atc tct ggg ctc cag gct gag 672Lys Ser Gly
Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu 210 215 220gat
gag gct gat tat tac tgc tcc tca tat gca cac agc tac acc ttg 720Asp
Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Ala His Ser Tyr Thr Leu225 230
235 240gtc ttc ggc gga ggg acc aag gtc acc gtc cta ggt 756Val Phe
Gly Gly Gly Thr Lys Val Thr Val Leu Gly 245 250224753DNAArtificial
sequenceCDS(1)..(753)Polynucleotide encoding GMCC124 scFv protein
224cag gtc acc ttg aag gag tct ggg gct gag gtg aag aag cct ggg gcc
48Gln Val Thr Leu Lys Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1
5 10 15tca gtg aag gtt tcc tgc aag gct tct gga tac acc ttc aca gac
aat 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp
Asn 20 25 30gct cta cat tgg gtg cgt cag gcc ccc gga caa agg cca gag
tgg atg 144Ala Leu His Trp Val Arg Gln Ala Pro Gly Gln Arg Pro Glu
Trp Met 35 40 45gca tgg atc aac act gcc aat gga aac aca aga tat tca
caa aag ttc 192Ala Trp Ile Asn Thr Ala Asn Gly Asn Thr Arg Tyr Ser
Gln Lys Phe 50 55 60cag ggc aga ctc acc att acc agg gac aca tcc gcg
agc aca gcc ttc 240Gln Gly Arg Leu Thr Ile Thr Arg Asp Thr Ser Ala
Ser Thr Ala Phe65 70 75 80atg gat ctg agc agc cta aga tct gag gac
acg gct gta tat tac tgt 288Met Asp Leu Ser Ser Leu Arg Ser Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg agg cag aaa gcc tac aag aat tac
tac tac tac tac ggt atg gac 336Ala Arg Gln Lys Ala Tyr Lys Asn Tyr
Tyr Tyr Tyr Tyr Gly Met Asp 100 105 110gtc tgg ggc caa ggc acc ctg
gtc acc gtc tcg agt gga ggc ggc ggt 384Val Trp Gly Gln Gly Thr Leu
Val Thr Val Ser Ser Gly Gly Gly Gly 115 120 125tca ggc gga ggt ggc
tct ggc ggt ggc gga agt gca cag tct gtc gtg 432Ser Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser Ala Gln Ser Val Val 130 135 140acg cag ccg
ccc tca gtg tct gcg gcc cca gga cag aag gtc acc atc 480Thr Gln Pro
Pro Ser Val Ser Ala Ala Pro Gly Gln Lys Val Thr Ile145 150 155
160tcc tgc tct gga agc agc tcc aac att ggg aat aat tat gta tcc tgg
528Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Asn Asn Tyr Val Ser Trp
165 170 175tac cag cag ctc cca gga aca gcc ccc aaa ctc ctc atc tat
gaa aat 576Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu Ile Tyr
Glu Asn 180 185 190aat aag cga ccc tca gga att cct gac cga ttc tcg
ggc tcc cag tct 624Asn Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser
Gly Ser Gln Ser 195 200 205ggc acg tca gcc acc ctg ggc atc tcc gga
ctc cag act ggg gac gag 672Gly Thr Ser Ala Thr Leu Gly Ile Ser Gly
Leu Gln Thr Gly Asp Glu 210
215 220gcc gat tat tac tgc gga aca tgg gat agc agc ctg cgt gct ggg
gtg 720Ala Asp Tyr Tyr Cys Gly Thr Trp Asp Ser Ser Leu Arg Ala Gly
Val225 230 235 240ttc ggc gga ggg acc aag ctg acc gtc cta ggt
753Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 245
250225741DNAArtificial sequenceCDS(1)..(741)Polynucleotide encoding
GMCC125 scFv protein 225gag gtg cag ctg gtg cag tct ggg gga ggc ttg
gtc aag cct gga ggg 48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu
Val Lys Pro Gly Gly1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga
ttc agc ttc agt gac tac 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Ser Phe Ser Asp Tyr 20 25 30tcc atg cac tgg atc cgc cag gct cca
ggg aag ggg ctg gag tgg ctt 144Ser Met His Trp Ile Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Leu 35 40 45tca cac att ggt aca agt act tct
tac aca aac tac gca gat tct gtg 192Ser His Ile Gly Thr Ser Thr Ser
Tyr Thr Asn Tyr Ala Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc
aga gac aac gcc aag aac tct ttc tat 240Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asn Ala Lys Asn Ser Phe Tyr65 70 75 80ctc caa atg aac agc
ctg aga gtc gac gac acg gct gtg tat ttc tgt 288Leu Gln Met Asn Ser
Leu Arg Val Asp Asp Thr Ala Val Tyr Phe Cys 85 90 95gcg agg gga ttc
ggg ggc ctc cgg ggc tac ttt gac tac tgg ggc cag 336Ala Arg Gly Phe
Gly Gly Leu Arg Gly Tyr Phe Asp Tyr Trp Gly Gln 100 105 110ggc acc
ctg gtc acc gtc tcg agt gga ggc ggc ggt tca ggc gga ggt 384Gly Thr
Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120
125ggc tct ggc ggt ggc gga agt gca ctt tct tct gag ctg act cag gac
432Gly Ser Gly Gly Gly Gly Ser Ala Leu Ser Ser Glu Leu Thr Gln Asp
130 135 140cct gct gtg tct gtg gcc ttg gga cag aca gtc aaa atc aca
tgc caa 480Pro Ala Val Ser Val Ala Leu Gly Gln Thr Val Lys Ile Thr
Cys Gln145 150 155 160gga gac aga ctc cga aga ttt tat gca agc tgg
tac cag cag aag cca 528Gly Asp Arg Leu Arg Arg Phe Tyr Ala Ser Trp
Tyr Gln Gln Lys Pro 165 170 175ggc cag gcc cct cta ctt ctc atc tat
ggt aaa aat agt cgg ccc tca 576Gly Gln Ala Pro Leu Leu Leu Ile Tyr
Gly Lys Asn Ser Arg Pro Ser 180 185 190ggg atc ccg gac cga ttc tct
ggc tcc acc tcg gga gcc aca gct tcc 624Gly Ile Pro Asp Arg Phe Ser
Gly Ser Thr Ser Gly Ala Thr Ala Ser 195 200 205ttg acc atc act ggg
gct cag gcg gaa gac gag gct gat tat tac tgt 672Leu Thr Ile Thr Gly
Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys 210 215 220aac tcc cgg
gac agt tcc ggc agc ctc cat tct gtc ttc gga act ggg 720Asn Ser Arg
Asp Ser Ser Gly Ser Leu His Ser Val Phe Gly Thr Gly225 230 235
240acc aag gtc acc gtc cta ggt 741Thr Lys Val Thr Val Leu Gly
245226738DNAArtificial sequenceCDS(1)..(738)Polynucleotide encoding
GMCC126 scFv protein 226cag gtg cag ctg cag gag tcg ggc cca gga ctg
gtg aag cct tcg cag 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu
Val Lys Pro Ser Gln1 5 10 15acc ctg tcc ctc tcc tgc gct gtt tct ggt
ttt tcc gtc acc agt ggt 96Thr Leu Ser Leu Ser Cys Ala Val Ser Gly
Phe Ser Val Thr Ser Gly 20 25 30cac tac tgg ggc tgg atc cgg cag tcc
cca ggg aag ggc ctg gag tgg 144His Tyr Trp Gly Trp Ile Arg Gln Ser
Pro Gly Lys Gly Leu Glu Trp 35 40 45att gga aat atc tat cat act ggg
agc acc agg tac aat ccg tcc ctc 192Ile Gly Asn Ile Tyr His Thr Gly
Ser Thr Arg Tyr Asn Pro Ser Leu 50 55 60gag agt cga gtc tcc atg tca
gta gac acg tcc aag aac cag ttc tcc 240Glu Ser Arg Val Ser Met Ser
Val Asp Thr Ser Lys Asn Gln Phe Ser65 70 75 80ctg agg ttg act tct
gtg acc gcc gca gac acg gcc atc tat tat tgt 288Leu Arg Leu Thr Ser
Val Thr Ala Ala Asp Thr Ala Ile Tyr Tyr Cys 85 90 95gcg aga gtg ggc
cga ggg cag cat ctg gta cgg ggg gac ttt gac tac 336Ala Arg Val Gly
Arg Gly Gln His Leu Val Arg Gly Asp Phe Asp Tyr 100 105 110tgg ggc
cga ggc acc ctg gtc acc gtc tcg agt gga ggc ggc ggt tca 384Trp Gly
Arg Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser 115 120
125ggc gga ggt ggc tct ggc ggt ggc gga agt gca cag tct gtg ctg act
432Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Gln Ser Val Leu Thr
130 135 140cag cca ccc tca ata tcc gtg tcc cca gga cag aca gcc agc
atc acc 480Gln Pro Pro Ser Ile Ser Val Ser Pro Gly Gln Thr Ala Ser
Ile Thr145 150 155 160tgc tct gga gat gaa ttg ggg cat aag tat gct
tcc tgg tat cag cag 528Cys Ser Gly Asp Glu Leu Gly His Lys Tyr Ala
Ser Trp Tyr Gln Gln 165 170 175aag cca ggc cag tcc cct gtg gtg gtc
gtc tat caa gat aac aag cga 576Lys Pro Gly Gln Ser Pro Val Val Val
Val Tyr Gln Asp Asn Lys Arg 180 185 190ccc tca ggg atc cct gag cga
ttc tct ggc tcc agt tct ggg aac aca 624Pro Ser Gly Ile Pro Glu Arg
Phe Ser Gly Ser Ser Ser Gly Asn Thr 195 200 205gcc act ctg acc atc
agc ggg acc cag gct gtg gat gag gct gat tat 672Ala Thr Leu Thr Ile
Ser Gly Thr Gln Ala Val Asp Glu Ala Asp Tyr 210 215 220ttc tgt cag
gcg tgg gac agc agc gct gtg gtc ttc ggc gga ggg acc 720Phe Cys Gln
Ala Trp Asp Ser Ser Ala Val Val Phe Gly Gly Gly Thr225 230 235
240aag ctg acc gtc cta ggt 738Lys Leu Thr Val Leu Gly
245227726DNAArtificial sequenceCDS(1)..(726)Polynucleotide encoding
GMCC127 scFv protein 227cag gtc cag ctg gtg cag tct ggg gga ggt gtg
gta cgg cct ggg ggg 48Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val
Val Arg Pro Gly Gly1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga
ttc acc ttt gat gat tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Asp Asp Tyr 20 25 30ggc atg agc tgg gtc cgc caa gct cca
ggg aag ggg ctg gag tgg gtc 144Gly Met Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45tct ggt att aat tgg aat ggt ggt
agc aca ggt tat gca gac tct gtg 192Ser Gly Ile Asn Trp Asn Gly Gly
Ser Thr Gly Tyr Ala Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc
aga gac aac gcc aag aac tcc ctg tat 240Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asn Ala Lys Asn Ser Leu Tyr65 70 75 80ctg caa atg aac agt
ctg aga gcc gag gac aca gcc gtg tat tac tgt 288Leu Gln Met Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gca aga agg cgg
tat gcg ttg gat tat tgg ggc cgg ggc acc ctg gtc 336Ala Arg Arg Arg
Tyr Ala Leu Asp Tyr Trp Gly Arg Gly Thr Leu Val 100 105 110acc gtc
tcg agt gga ggc ggc ggt tca ggc gga ggt ggc tct ggc ggt 384Thr Val
Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 115 120
125ggc gga agt gca ctt tct tct gag ctg act cag gac cct gct gtg tct
432Gly Gly Ser Ala Leu Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser
130 135 140gtg gcc ttg gga cag gca gtc agg atc aca tgc caa gga gac
agt ctc 480Val Ala Leu Gly Gln Ala Val Arg Ile Thr Cys Gln Gly Asp
Ser Leu145 150 155 160aga acc aat tat gca agc tgg tac cag cag agg
cca gga cag gcc cct 528Arg Thr Asn Tyr Ala Ser Trp Tyr Gln Gln Arg
Pro Gly Gln Ala Pro 165 170 175gtt ctt gtc atc cgt ggt aac aac aac
cgg ccc tca ggg atc cca gac 576Val Leu Val Ile Arg Gly Asn Asn Asn
Arg Pro Ser Gly Ile Pro Asp 180 185 190cga ttc tct ggc tcc aac tca
gga gac aca gtt tcc ctg acc atc act 624Arg Phe Ser Gly Ser Asn Ser
Gly Asp Thr Val Ser Leu Thr Ile Thr 195 200 205ggg gct cag gcg gaa
gat gag gct gac tat tat tgt aac tcc cgg gac 672Gly Ala Gln Ala Glu
Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp 210 215 220acc agt ggt
tac cat tat gtc ttc gga act ggg acc aag ctg acc gtc 720Thr Ser Gly
Tyr His Tyr Val Phe Gly Thr Gly Thr Lys Leu Thr Val225 230 235
240cta ggt 726Leu Gly228738DNAArtificial
sequenceCDS(1)..(738)Polynucleotide encoding GMCC129 scFv protein
228gag gtg cag ctg gtg gag acc ggg gga ggc ttg gca cag ccg ggg ggg
48Glu Val Gln Leu Val Glu Thr Gly Gly Gly Leu Ala Gln Pro Gly Gly1
5 10 15tcc ctg aga ctc tcc tgt gaa gcc tct gga ttc acc ttt aat aac
tat 96Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Phe Thr Phe Asn Asn
Tyr 20 25 30gcc atg agc tgg gtc cgc cag gct cca ggg aag ggg ctg gag
tgg gtc 144Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45tca ggt att agt att agt ggt tat agt aca ttc tac aca
gac tcc gtg 192Ser Gly Ile Ser Ile Ser Gly Tyr Ser Thr Phe Tyr Thr
Asp Ser Val 50 55 60cag ggc cgg ttc acc atc tcc aga gac aat tcc aag
aac acg ctg tat 240Gln Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr Leu Tyr65 70 75 80ttg caa atg aac agc ctg gga gtc gac gac
acg gcc gta tat tac tgt 288Leu Gln Met Asn Ser Leu Gly Val Asp Asp
Thr Ala Val Tyr Tyr Cys 85 90 95gcg aaa cgc cgt gga gag ggc ggc gac
ttt gac tac tgg ggc cgg ggg 336Ala Lys Arg Arg Gly Glu Gly Gly Asp
Phe Asp Tyr Trp Gly Arg Gly 100 105 110aca atg gtc acc gtc tcg agt
gga ggc ggc ggt tca ggc gga ggt ggc 384Thr Met Val Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125tct ggc ggt ggc gga
agt gca ctt tct tct gag ctg act cag gac cct 432Ser Gly Gly Gly Gly
Ser Ala Leu Ser Ser Glu Leu Thr Gln Asp Pro 130 135 140gct gtg tct
gtg gcc ttg ggg cag aca gtc agg atc aca tgc caa gga 480Ala Val Ser
Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly145 150 155
160gac agc ctc aga ggc tat tat gca agc tgg tac caa cag aag gca gga
528Asp Ser Leu Arg Gly Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Ala Gly
165 170 175cag gcc cct gta ctt gtc atc tat ggt aag aac aac cgg ccc
tca ggg 576Gln Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro
Ser Gly 180 185 190atc cca gac cga ttc tct ggc tcc agc tca gga aac
aca gct tcc ttg 624Ile Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn
Thr Ala Ser Leu 195 200 205acc atc act ggg gct cag gcg gaa gat gag
gct gac tat tac tgt tac 672Thr Ile Thr Gly Ala Gln Ala Glu Asp Glu
Ala Asp Tyr Tyr Cys Tyr 210 215 220tcc cgg gac aga agt ggt aac cat
cta gga atg ttc ggc gga ggg acc 720Ser Arg Asp Arg Ser Gly Asn His
Leu Gly Met Phe Gly Gly Gly Thr225 230 235 240aag gtc acc gtc cta
ggt 738Lys Val Thr Val Leu Gly 245229744DNAArtificial
sequenceCDS(1)..(744)Polynucleotide encoding GMCC131 scFv protein
229cag gtg cag ctg cag gag tcc ggc cca gga ctg gtg aag cct tcg gag
48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1
5 10 15acc ctg tcc ctc acc tgc agt gtc tct ggt ggc tcc atc aga agt
cat 96Thr Leu Ser Leu Thr Cys Ser Val Ser Gly Gly Ser Ile Arg Ser
His 20 25 30tac tgg agt tgg atg cgg caa ccc cca ggg aag gga ctg gag
tgg att 144Tyr Trp Ser Trp Met Arg Gln Pro Pro Gly Lys Gly Leu Glu
Trp Ile 35 40 45gga tac gtc tat tac act ggg agt acc aac tac aat ccg
tcc ctc aag 192Gly Tyr Val Tyr Tyr Thr Gly Ser Thr Asn Tyr Asn Pro
Ser Leu Lys 50 55 60agt cga gtc acc atg tca gta gac acg tcc aag aac
cag ttc tcg ctg 240Ser Arg Val Thr Met Ser Val Asp Thr Ser Lys Asn
Gln Phe Ser Leu65 70 75 80aac ctg agc tct gtg acc gct gcg gac acg
gcc att tat tac tgt gcg 288Asn Leu Ser Ser Val Thr Ala Ala Asp Thr
Ala Ile Tyr Tyr Cys Ala 85 90 95aga ttc cca tat agc agt ggc tcg aac
ccg ctt gac tac tgg ggc cgg 336Arg Phe Pro Tyr Ser Ser Gly Ser Asn
Pro Leu Asp Tyr Trp Gly Arg 100 105 110gga acc ctg gtc acc gtc tcg
agt gga ggc ggc ggt tca ggc gga ggt 384Gly Thr Leu Val Thr Val Ser
Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120 125ggc tct ggc ggt ggc
gga agt gca cag tct gtg ctg acg cag ccg ccc 432Gly Ser Gly Gly Gly
Gly Ser Ala Gln Ser Val Leu Thr Gln Pro Pro 130 135 140tca gtg tct
gcg gcc cca gga cag agg gtc acc atc tcc tgc act ggg 480Ser Val Ser
Ala Ala Pro Gly Gln Arg Val Thr Ile Ser Cys Thr Gly145 150 155
160agc agc tcc aac atc ggg gca cgt tat gat gta cac tgg tac cag cac
528Ser Ser Ser Asn Ile Gly Ala Arg Tyr Asp Val His Trp Tyr Gln His
165 170 175ctg cca gga acc gcc ccc aaa ctc ctc atc tac ggt gac agc
aat cga 576Leu Pro Gly Thr Ala Pro Lys Leu Leu Ile Tyr Gly Asp Ser
Asn Arg 180 185 190ccc tca ggg gtc cct gac cga ttc tct ggt tcc aag
tct ggc acc tca 624Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys
Ser Gly Thr Ser 195 200 205gcc tcc ctg gcc atc act ggg ctc cag cct
gag gat gag gct gat tat 672Ala Ser Leu Ala Ile Thr Gly Leu Gln Pro
Glu Asp Glu Ala Asp Tyr 210 215 220tac tgc cag tcc tat gac agc agc
ctg agt ggt gtg gta ttc ggc gga 720Tyr Cys Gln Ser Tyr Asp Ser Ser
Leu Ser Gly Val Val Phe Gly Gly225 230 235 240ggg acc aag gtc acc
gtc cta ggt 744Gly Thr Lys Val Thr Val Leu Gly
245230735DNAArtificial sequenceCDS(1)..(735)Polynucleotide encoding
GMCC136 scFv protein 230gaa gtg cag ctg gtg cag tct ggg gga ggc ttg
gta cag cct ggg ggg 48Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu
Val Gln Pro Gly Gly1 5 10 15tcc ctg aga ctc tcc tgt gca gcc tct gga
ttc acc ttt agc agc tat 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Ser Tyr 20 25 30gcc atg agc tgg gtc cgc cag gct cca
ggg aag ggg ctt gag tgg gtc 144Ala Met Ser Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45tca gct att agt ggt agt ggt ggt
agc aca tac tcc gcc gac tcc gtg 192Ser Ala Ile Ser Gly Ser Gly Gly
Ser Thr Tyr Ser Ala Asp Ser Val 50 55 60aag ggc cgg ttc acc atc tcc
aga gac aat tcc aag aac acg ctg tat 240Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80ctg caa atg aac agc
ctg aga gcc gag gac acg gcc gta tat tac tgt 288Leu Gln Met Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg aaa tgc tgg
cgt agt ggt acc agc tgc ccg gac ggc tgg ggc aaa 336Ala Lys Cys Trp
Arg Ser Gly Thr Ser Cys Pro Asp Gly Trp Gly Lys 100 105 110ggg aca
atg gtc acc gtc tcg agt gga ggc ggc ggt tca ggc gga ggt 384Gly Thr
Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120
125ggc tct ggc ggt ggc gga agt gca ctt gaa att gtg ttg acg cag tct
432Gly Ser Gly Gly Gly Gly Ser Ala Leu Glu Ile Val Leu Thr Gln Ser
130 135 140cca gcc acc ctg tct gtg tct cca ggg gaa aga gcc acc ctc
tcc tgc 480Pro Ala Thr Leu Ser Val Ser Pro Gly Glu Arg Ala Thr Leu
Ser Cys145 150 155 160agg acc agt cag agt gtt ggc agc aag tta gcc
tgg tac cag cag aaa 528Arg Thr Ser Gln Ser Val Gly Ser Lys Leu Ala
Trp Tyr Gln Gln Lys 165 170 175cct ggc cag gct ccc agg ctc ctc atc
tat gat gca tcc acc ggg gcc 576Pro Gly Gln Ala Pro Arg Leu Leu Ile
Tyr Asp Ala Ser Thr Gly Ala 180 185 190act ggt gac cca gcc agg ttc
agt ggc agt ggg tct ggg aca gag ttc 624Thr Gly Asp Pro Ala Arg Phe
Ser Gly Ser Gly Ser Gly Thr Glu Phe 195 200 205act ctc acc atc agc
aac ctg cag tct gaa gat ctt gca att
tat tac 672Thr Leu Thr Ile Ser Asn Leu Gln Ser Glu Asp Leu Ala Ile
Tyr Tyr 210 215 220tgt cag cag tat cat aag tgg ccg atc acc ttc ggc
caa ggg aca cga 720Cys Gln Gln Tyr His Lys Trp Pro Ile Thr Phe Gly
Gln Gly Thr Arg225 230 235 240ctg gag att aaa cgt 735Leu Glu Ile
Lys Arg 245231744DNAArtificial sequenceCDS(1)..(744)Polynucleotide
encoding GMCC138 scFv protein 231gag gtg cag ctg gtg gag acc ggc
cca gga ctg gtg aag ccc tca cag 48Glu Val Gln Leu Val Glu Thr Gly
Pro Gly Leu Val Lys Pro Ser Gln1 5 10 15acc cta tcc ctc acc tgc act
gtg tct ggt ggc tcc atc agc agt ggt 96Thr Leu Ser Leu Thr Cys Thr
Val Ser Gly Gly Ser Ile Ser Ser Gly 20 25 30ggt tat tac tgg agc tgg
atc cgc cag gtc cca ggg aag ggc ctg gag 144Gly Tyr Tyr Trp Ser Trp
Ile Arg Gln Val Pro Gly Lys Gly Leu Glu 35 40 45tgg att ggg tac aac
ttt tac aat ggg agc acg tac ttc aac ccg tcc 192Trp Ile Gly Tyr Asn
Phe Tyr Asn Gly Ser Thr Tyr Phe Asn Pro Ser 50 55 60ctc aag agt cga
gct acc ata tca att gac acg act aag aac cag ttc 240Leu Lys Ser Arg
Ala Thr Ile Ser Ile Asp Thr Thr Lys Asn Gln Phe65 70 75 80tcc ctg
aag ttg agc tct gtg acc gcc gcg gac acg gcc gtc tat tat 288Ser Leu
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95tgt
gcg agg ggt aat gga tat agg tat ggt cgg tgg ttc gac ccc tgg 336Cys
Ala Arg Gly Asn Gly Tyr Arg Tyr Gly Arg Trp Phe Asp Pro Trp 100 105
110ggc agg ggc acc ctg gtc acc gtc tcg agt gga ggc ggc ggt tca ggc
384Gly Arg Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly
115 120 125gga ggt ggc tct ggc ggt ggc gga agt gca ctt tcc tat gag
ctg act 432Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Leu Ser Tyr Glu
Leu Thr 130 135 140cag cca ccc tcg gtg tca gtg tcc cca gga cag acg
gcc agg atc acc 480Gln Pro Pro Ser Val Ser Val Ser Pro Gly Gln Thr
Ala Arg Ile Thr145 150 155 160tgc tct gga gat gca ttg cca aag caa
tat gct tat tgg tac cag cag 528Cys Ser Gly Asp Ala Leu Pro Lys Gln
Tyr Ala Tyr Trp Tyr Gln Gln 165 170 175aag cca ggc cag gcc cct gtg
ctg gtg ata tct aaa gac agt gag agg 576Lys Pro Gly Gln Ala Pro Val
Leu Val Ile Ser Lys Asp Ser Glu Arg 180 185 190ccc tca ggg atc cct
gag cga ttc tct ggc tcc agc tca ggg aca aca 624Pro Ser Gly Ile Pro
Glu Arg Phe Ser Gly Ser Ser Ser Gly Thr Thr 195 200 205gtc acg ttg
acc atc agt gga gtc cag gca gaa gac gag gct gac tat 672Val Thr Leu
Thr Ile Ser Gly Val Gln Ala Glu Asp Glu Ala Asp Tyr 210 215 220tac
tgt caa tca gca gac agc agt ggt act tat tgg gtg ttc ggc gga 720Tyr
Cys Gln Ser Ala Asp Ser Ser Gly Thr Tyr Trp Val Phe Gly Gly225 230
235 240ggg acc aag gtc acc gtc cta ggt 744Gly Thr Lys Val Thr Val
Leu Gly 245232738DNAArtificial sequenceCDS(1)..(738)Polynucleotide
encoding GMCC142 scFv protein 232gag gtc cag ctg gtg cag tct gga
gct gag gtg aag aag cct ggg gcc 48Glu Val Gln Leu Val Gln Ser Gly
Ala Glu Val Lys Lys Pro Gly Ala1 5 10 15tca gtg act att tcc tgc aag
gca tct gga tac acc ttc acc gcc tac 96Ser Val Thr Ile Ser Cys Lys
Ala Ser Gly Tyr Thr Phe Thr Ala Tyr 20 25 30tat ata tac tgg gtg cga
cag gcc cct gga caa ggg ctt gag tgg atg 144Tyr Ile Tyr Trp Val Arg
Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45gga atg agc aac cct
aat ggt ggt tac aca gtg tac cca ccg aat ttc 192Gly Met Ser Asn Pro
Asn Gly Gly Tyr Thr Val Tyr Pro Pro Asn Phe 50 55 60ctg ggc aga gtc
acc acg acc ccg gac acg tca acg aac aca ata tat 240Leu Gly Arg Val
Thr Thr Thr Pro Asp Thr Ser Thr Asn Thr Ile Tyr65 70 75 80atg gag
ctg aga agc ctg aga tct gaa gac acg gcc gtg tat tac tgt 288Met Glu
Leu Arg Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gcg
aga ggt cgg ggg cgg gcc ccc agc aat gct ttt gac ttc tgg ggc 336Ala
Arg Gly Arg Gly Arg Ala Pro Ser Asn Ala Phe Asp Phe Trp Gly 100 105
110cga gga acc ctg gtc acc gtc tcg agt gga ggc ggc ggt tca ggc gga
384Arg Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125ggt ggc tct ggc ggt ggc gga agt gca ctt tct tct gag ctg
act cag 432Gly Gly Ser Gly Gly Gly Gly Ser Ala Leu Ser Ser Glu Leu
Thr Gln 130 135 140gac cct gct gtg tct gtg gcc ttg gga cag aca gtc
agg atc aca tgc 480Asp Pro Ala Val Ser Val Ala Leu Gly Gln Thr Val
Arg Ile Thr Cys145 150 155 160caa gga gac agc ctc aaa ttc tat tat
gca agc tgg tat caa cag aag 528Gln Gly Asp Ser Leu Lys Phe Tyr Tyr
Ala Ser Trp Tyr Gln Gln Lys 165 170 175cca gga cag gcc cct gta ctt
gtc ctc cat ggt aaa aat aac cgg ccc 576Pro Gly Gln Ala Pro Val Leu
Val Leu His Gly Lys Asn Asn Arg Pro 180 185 190tca ggg atc cca gac
cga ttc tct ggc tcc acc tca aga gac aca gct 624Ser Gly Ile Pro Asp
Arg Phe Ser Gly Ser Thr Ser Arg Asp Thr Ala 195 200 205tcc ttg acc
atc act ggg act cag gcg gaa gat gag gct gac tat tac 672Ser Leu Thr
Ile Thr Gly Thr Gln Ala Glu Asp Glu Ala Asp Tyr Tyr 210 215 220tgt
aac tcc cgg gac aac agt gac aac att gtc ttc gga act ggg acc 720Cys
Asn Ser Arg Asp Asn Ser Asp Asn Ile Val Phe Gly Thr Gly Thr225 230
235 240aag ctg acc gtc cta ggt 738Lys Leu Thr Val Leu Gly
245233750DNAArtificial sequenceCDS(1)..(750)Polynucleotide encoding
GMCC151 scFv protein 233cag gtc cag ctg gtg cag tct ggg gga gga gtg
gtc cag cct ggg agg 48Gln Val Gln Leu Val Gln Ser Gly Gly Gly Val
Val Gln Pro Gly Arg1 5 10 15tcc ctg aga ctc tcc tgc aca gcc tct gga
ttc aac ctc ggt tcc cat 96Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly
Phe Asn Leu Gly Ser His 20 25 30ggc atg cac tgg gtc cgc cag gct ccc
ggc aag ggg ctg gag tgg gtg 144Gly Met His Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45gca gtt ata gga ttt gat gga acg
act aaa tat tat gtg gac tcc gtg 192Ala Val Ile Gly Phe Asp Gly Thr
Thr Lys Tyr Tyr Val Asp Ser Val 50 55 60aag ggc cga ttc acc atc tcc
agg gac aac tcc agg aac acc cta tct 240Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asn Ser Arg Asn Thr Leu Ser65 70 75 80ctg caa atg aac agc
ctg aga gct gag gac acg gct gtc tat tac tgt 288Leu Gln Met Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95gtg aga gaa gat
tac tac tat gat agt agt ggt tat tac ttt gac tac 336Val Arg Glu Asp
Tyr Tyr Tyr Asp Ser Ser Gly Tyr Tyr Phe Asp Tyr 100 105 110tgg ggc
cga gga acc ctg gtc acc gtc tcg agt gga ggc ggc ggt tca 384Trp Gly
Arg Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser 115 120
125ggc gga ggt ggc tct ggc ggt ggc gga agt gca ctt tct tct gag ctg
432Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Leu Ser Ser Glu Leu
130 135 140act cag gac cct ttc gtg tct gtt gcc ttg gga cag aca gtc
agg atc 480Thr Gln Asp Pro Phe Val Ser Val Ala Leu Gly Gln Thr Val
Arg Ile145 150 155 160gca tgc cga gga gac agc ctc aga gat tct tat
gca agt tgg tac cag 528Ala Cys Arg Gly Asp Ser Leu Arg Asp Ser Tyr
Ala Ser Trp Tyr Gln 165 170 175cag aag cca gga cag gcc cct cga ctt
ctc gtc tat gga aac aat ctt 576Gln Lys Pro Gly Gln Ala Pro Arg Leu
Leu Val Tyr Gly Asn Asn Leu 180 185 190cgg ccc tcc ggg atc cct ggc
cgg ntc tct ggc ttc agc tca gga gac 624Arg Pro Ser Gly Ile Pro Gly
Arg Xaa Ser Gly Phe Ser Ser Gly Asp 195 200 205acc agt tcc ctg gcc
atc act gag act cag gcg gga gat gag gct gac 672Thr Ser Ser Leu Ala
Ile Thr Glu Thr Gln Ala Gly Asp Glu Ala Asp 210 215 220tat tac tgc
agt tcc cgg ggc aac agt acc tct cgc ctc tat gtc ttc 720Tyr Tyr Cys
Ser Ser Arg Gly Asn Ser Thr Ser Arg Leu Tyr Val Phe225 230 235
240gga act ggg acc aag ctg acc gtc cta ggt 750Gly Thr Gly Thr Lys
Leu Thr Val Leu Gly 245 250234250PRThomo sapiens 234Met Pro Ala Ser
Ser Pro Phe Leu Leu Ala Pro Lys Gly Pro Pro Gly1 5 10 15Asn Met Gly
Gly Pro Val Arg Glu Pro Ala Leu Ser Val Ala Leu Trp 20 25 30Leu Ser
Trp Gly Ala Ala Leu Gly Ala Val Ala Cys Ala Met Ala Leu 35 40 45Leu
Thr Gln Gln Thr Glu Leu Gln Ser Leu Arg Arg Glu Val Ser Arg 50 55
60Leu Gln Gly Thr Gly Gly Pro Ser Gln Asn Gly Glu Gly Tyr Pro Trp65
70 75 80Gln Ser Leu Pro Glu Gln Ser Ser Asp Ala Leu Glu Ala Trp Glu
Asn 85 90 95Gly Glu Arg Ser Arg Lys Arg Arg Ala Val Leu Thr Gln Lys
Gln Lys 100 105 110Lys Gln His Ser Val Leu His Leu Val Pro Ile Asn
Ala Thr Ser Lys 115 120 125Asp Asp Ser Asp Val Thr Glu Val Met Trp
Gln Pro Ala Leu Arg Arg 130 135 140Gly Arg Gly Leu Gln Ala Gln Gly
Tyr Gly Val Arg Ile Gln Asp Ala145 150 155 160Gly Val Tyr Leu Leu
Tyr Ser Gln Val Leu Phe Gln Asp Val Thr Phe 165 170 175Thr Met Gly
Gln Val Val Ser Arg Glu Gly Gln Gly Arg Gln Glu Thr 180 185 190Leu
Phe Arg Cys Ile Arg Ser Met Pro Ser His Pro Asp Arg Ala Tyr 195 200
205Asn Ser Cys Tyr Ser Ala Gly Val Phe His Leu His Gln Gly Asp Ile
210 215 220Leu Ser Val Ile Ile Pro Arg Ala Arg Ala Lys Leu Asn Leu
Ser Pro225 230 235 240His Gly Thr Phe Leu Gly Phe Val Lys Leu 245
250
* * * * *