U.S. patent application number 12/765914 was filed with the patent office on 2010-11-18 for genotyping assay to predict gamma glutamyl hydrolase (ggh) activity.
Invention is credited to QING CHENG, WILLIAM EDWARD EVANS, MARY RELLING.
Application Number | 20100291574 12/765914 |
Document ID | / |
Family ID | 35541803 |
Filed Date | 2010-11-18 |
United States Patent
Application |
20100291574 |
Kind Code |
A1 |
EVANS; WILLIAM EDWARD ; et
al. |
November 18, 2010 |
Genotyping Assay to Predict Gamma Glutamyl Hydrolase (GGH)
Activity
Abstract
Single nucleotide polymorphisms (SNPs) in the gene encoding
gamma glutamyl hydrolase (GGH) associated with reduced GGH activity
are disclosed. The primary SNP is a change from a cytosine to a
thymine at a position corresponding to nucleotide 511 of Genbank
sequence accession no. NM 003878. Methods and kits for detecting
these SNPs are provided, along with primers useful in detecting
these SNP and for amplifying portions of the GGH gene containing
these SNPs.
Inventors: |
EVANS; WILLIAM EDWARD;
(CORDOVA, TN) ; RELLING; MARY; (CORDOVA, TN)
; CHENG; QING; (MEMPHIS, TN) |
Correspondence
Address: |
J. SCOTT ELMER;ST. JUDE CHILDREN'S RESEARCH HOSPITAL
332 N. LAUDERDALE, MAILSTOP 742
MEMPHIS
TN
38105
US
|
Family ID: |
35541803 |
Appl. No.: |
12/765914 |
Filed: |
April 23, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10887002 |
Jul 8, 2004 |
7741032 |
|
|
12765914 |
|
|
|
|
Current U.S.
Class: |
435/6.12 ;
536/23.2 |
Current CPC
Class: |
C12Q 2600/112 20130101;
C12Q 1/6886 20130101 |
Class at
Publication: |
435/6 ;
536/23.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/04 20060101 C07H021/04 |
Goverment Interests
GOVERNMENT INTEREST
[0001] This invention was made in part with U.S. Government support
under National Institutes of Health grant nos. CA36401, CA78224,
CA51001, and GM61393. The U.S. Government may have certain rights
in this invention.
Claims
1-6. (canceled)
7. An isolated oligonucleotide molecule comprising a mutant allele
of gamma glutamyl hydrolase (GGH) or a fragment thereof, which is
at least ten consecutive bases long and contains a point mutation
at the position corresponding to nucleotide 511 of Genbank sequence
accession no. NM 003878 (position 511 of SEQ ID No. 1).
8. The isolated oligonucleotide molecule of claim 7, wherein said
point mutation is a thymine substitution for cytosine.
9. The isolated oligonucleotide molecule of claim 8, wherein said
oligonucleotide molecule has a sequence selected from the group
consisting of SEQ ID No. 7 and SEQ ID No. 8.
10. The isolated oligonucleotide molecule of claim 7, wherein said
oligonucleotide molecule is at least 15 bases long.
11. The isolated oligonucleotide molecule of claim 7, wherein said
oligonucleotide molecule is at least 20 bases long.
12. The isolated oligonucleotide molecule of claim 7, wherein said
oligonucleotide molecule is at least 50 bases long.
13. The isolated oligonucleotide molecule of claim 7, wherein said
oligonucleotide molecule is at least 100 bases long.
14. A kit for determining the gamma glutamyl hydrolase (GGH)
genotype of a subject comprising a carrier means having in close
confinement therein at least two container means, wherein a first
container means contains a first oligonucleotide molecule
comprising a mutant allele of GGH or a fragment thereof, which is
at least ten consecutive bases long and contains a point mutation
at the position corresponding to nucleotide 511 of Genbank sequence
accession no. NM 003878 (position 511 of SEQ ID No. 1), or a
oligonucleotide molecule complementary thereto and a second
container means containing a second oligonucleotide molecule
encoding a wild-type allele of GGH, a fragment thereof, or an
oligonucleotide molecule complementary thereto which is at least
ten consecutive bases long and includes the position corresponding
to nucleotide 511 of Genbank sequence accession no. NM 003878
(position 511 of SEQ ID No. 1).
15. The kit of claim 14 wherein said point mutation is a thymine
substitution for cytosine.
16. The kit of claim 15 wherein said first oligonucleotide molecule
has a sequence selected from the group consisting of SEQ ID No. 7
and SEQ ID No. 8.
17. A kit for determining the gamma glutamyl hydrolase (GGH)
genotype of a subject comprising a carrier means having in close
confinement therein at least two container means, wherein a first
container means contains a first oligonucleotide primer at least
ten consecutive bases long suitable for use in a polymerase chain
reaction (PCR) corresponding to a portion of the GGH gene 5' and
adjacent to the position corresponding to nucleotide 511 of Genbank
sequence accession no. NM 003878 (position 511 of SEQ ID No. 1) and
a second container means containing a second oligonucleotide primer
at least ten consecutive bases long suitable for use in a PCR
corresponding to a portion of the GGH gene 3' and adjacent to the
position corresponding to nucleotide 511 of Genbank sequence
accession no. NM 003878 (position 511 of SEQ ID No. 1), wherein
said first oligonucleotide primer and said second oligonucleotide
primer can be used to amplify a portion of the GGH gene comprising
the position corresponding to nucleotide 511 of Genbank sequence
accession no. NM 003878 (position 511 of SEQ ID No. 1) in a
PCR.
18. The kit of claim 16 wherein said first oligonucleotide primer
has a sequence selected from the group consisting of SEQ ID No. 3
and SEQ ID No. 5 and said second oligonucleotide primer has a
sequence selected from the group consisting of SEQ ID No. 4 and SEQ
ID No. 6.
Description
FIELD OF THE INVENTION
[0002] This invention relates generally to the field of diagnostics
based on the detection of DNA sequence polymorphisms.
BACKGROUND
[0003] Methotrexate (MTX) is an antifolate that is used essentially
in all treatment protocols for childhood acute lymphoblastic
leukemia (ALL). After its entry into cells, MTX is rapidly
converted to .gamma.-glutamyl polyglutamates through the action of
folypolyglutamate synthetase (FPGS). Long chain polyglutamates
(MTXPG.sub.4-7) are more avid inhibitors of folate-dependent
enzymes and are also retained longer within cells, thereby
increasing and prolonging MTX's antifolate effects. Higher
accumulation of MTXPG has been associated with increased
cytotoxicity and treatment response in childhood ALL.
[0004] Significant lineage and ploidy differences have been
observed in MTX-PG accumulation in ALL cells, with T-lineage ALL
having the lowest MTX-PG accumulation and hyperdiploid (>50
chromosomes) and B-lineage ALL having the highest MTX-PG
accumulation. The underlying mechanisms for these differences
include lower FPGS activity in T-ALL. However, following uniform
treatment with HDMTX, there remain substantial inter-individual
differences in MTX-PG accumulation within each of the three lineage
and ploidy subtypes of ALL, for reasons that have not been fully
elucidated.
[0005] One potential cause of inter-individual differences in
MTX-PG accumulation is heterogeneity in .gamma.-Glutamyl hydrolase
(GGH, also known as folypolyglutamate hydrolase, FPGH, EC
3.4.19.9), a lysosomal peptidase that catalyzes the removal of
.gamma.-linked polyglutamates, converting long-chain MTX-PG into
shorter-chain MTX-PG and ultimately to MTX. This allows MTX to be
effluxed from cells and thereby reduces the overall effectiveness
of MTX. The human GGH gene spans 24 kb on chromosome 8
(q12.23-0.13.1) and comprises nine exons (Yin, D. et al.,
"Structural organization of the human gamma-glutamyl hydrolase
gene" Gene 238: 463-470 (1999)). The crystal structure of human GGH
has been determined and a model for substrate recognition and
hydrolysis has been proposed (Li, H. et al., "Three-dimensional
structure of human gamma-glutamyl hydrolase. A class I glatamine
amidotransferase adapted for a complex substate" J Biol Chem 277:
24522-24529 (2002); Chave, K. J, et al., "Molecular modeling and
site-directed mutagenesis define the catalytic motif in human
gamma-glutamyl hydrolase" J Biol Chem 275:40365-40370 (2000)).
Cellular GGH is predominantly lysosomal, with an acidic pH optimum,
functioning as either an endopeptidase or exopeptidase, exhibiting
species differences in these functions. Human GGH has a higher
affinity for the longer chain MTX polyglutamates, cleaving multiple
glutamyl residues, having its highest activity at the outermost or
two outermost residues in the polyglutamate chain (Panetta, J. C.,
et al., id).
[0006] Polymorphisms within the GGH gene have been reported (Chave,
K. J. et al., "Identification of single nucleotide polymorphisms in
the human gamma-glutamyl hydrolase gene and characterization of
promoter polymorphisms". Gene 319: 167-175 (2003)). These
polymorphisms which occurred in the promoter region of the GGH gene
were reported as potentially affecting expression of the GGH
protein, while a polymorphism occurring in the coding region which
caused a codon change (452 C>T; T127I) was reported as not
changing GGH activity (Chave, K. J. et al., 2003, id). This report
indicates that GGH promoter polymorphisms may play a role in
inter-individual differences in MTX-PG accumulation, but that the
coding region polymorphism does not since it did not change GGH
activity.
SUMMARY OF THE INVENTION
[0007] The present invention relates to the association of a point
mutation or single nucleotide polymorphism (SNP) in an exon of the
gamma glutamyl hydrolase (GGH) gene which causes a substitution in
the amino acid sequence of GGH. The presence of this mutant allele
is directly correlated with lower levels of GGH activity.
[0008] This polymorphism occurs at a position in exon 5 of the
human GGH gene that corresponds to nucleotide 511 of Genbank
sequence accession no. NM 003878 (position 511 of SEQ ID No. 1). In
the wildtype GGH gene the nucleotide at this position is a cytosine
and is part of the three nucleotide codon ACT which encodes a
threonine (THR) in the GGH protein. The mutation identified herein
associated with lower levels of GGH activity is a change in the
nucleotide at this position to a thymine, which changes the
corresponding codon to ATT which encodes an isoleucine (ILE) in the
mutant GGH protein.
[0009] The present invention includes a method for determining the
gamma glutamyl hydrolase (GGH) genotype of an individual with
respect to this mutation. A method for predicting the level of
gamma glutamyl hydrolase (GGH) activity in a subject based on the
presence or absence of this mutation on one or both alleles is also
provided.
[0010] In another aspect a kit useful for performing these methods
is provide. In yet another aspect, hybridisation primers at least
10 nucleotides long corresponding to a portion of the GGH gene
containing this SNP are provided. In yet another aspect,
polynucleotide primers at least 10 nucleotides long useful in
amplifying the portion of the GGH gene containing this SNP via
polymerase chain reaction (PCR) or similar means.
[0011] In addition to the primary SNP associated with low GGH
activity, two additional SNPs within the GGH gene associated with
low GGH activity are provided. One of these SNPs occurs in exon 2
of the human GGH gene at a position corresponding to nucleotide 233
of Genbank sequence accession no. NM 003878 (position 233 of SEQ ID
No. 1) and involves a change from a guanine to an adenine. The
other SNP identified by the inventors as associated with low GGH
activity occurs in the 3' untranslated region of the GGH gene at a
position corresponding to nucleotide 1161 of Genbank sequence
accession no. NM 003878 (position 1161 of SEQ ID No. 1) and
involves a change from an adenine to a guanine. The present
invention also extends to diagnostic assays, kits and methods for
determining the gamma glutamyl hydrolase (GGH) genotype of a
subject with respect to these two additional SNPs.
DESCRIPTION OF THE FIGURE
[0012] FIG. 1 correlates the level of gamma glutamyl hydrolase
(GGH) activity in patients with various subtypes of acute
lymphoblastic leukemia (ALL) with the presence of a mutated GGH
allele (cytosine to thymine) at the position corresponding to
position 511 of SEQ ID No. 1. For the entire group of ALL patients
studied (n=66), there was a significant difference in frequency of
the mutated GGH allele among patients with low, intermediate and
high GGH activity (p=0.025 by Exact chi square test).
DESCRIPTION OF THE SEQUENCE LISTING
[0013] SEQ ID No. 1 is a reproduction of the human gamma glutamyl
hydrolase (GGH) gene sequence deposited as Genbank sequence
accession no. NM 003878. For purposes of this invention, the
critical nucleotide is the cytosine located at position 511 and
underlined in the following reproduction of nucleotides 500-520
from SEQ ID No. 1: (GTGCTTATTAACTGCCACAGA). The mutation identified
herein associated with lower levels of GGH activity is a change
from a cytosine (C) to a thymine (T) at this position.
[0014] SEQ ID No. 2 is the amino acid sequence of the human GGH
protein encoded by the coding portion of SEQ ID No. 1 (i.e. from
nucleotide 60 to nucleotide 1013 of SEQ ID No. 1).
[0015] SEQ ID No. 3 is an oligonucleotide having the sequence
TGTTTTCTGTGTGTGTATGGGTCGG designed for use with SEQ ID No. 4 as a
forward primer for amplifying a portion of the GGH gene containing
the polymorphism that corresponds to nucleotide 511 of Genbank
sequence accession no. NM 003878 (position 511 of SEQ ID No.
1).
[0016] SEQ ID No. 4 is an oligonucleotide having the sequence
TGCTACTTACTAATCCTGCCCAGCA designed for use with SEQ ID No. 3 as a
reverse primer for amplifying a portion of the GGH gene containing
the polymorphism that corresponds to nucleotide 511 of Genbank
sequence accession no. NM 003878 (position 511 of SEQ ID No.
1).
[0017] SEQ ID No. 5 is an oligonucleotide having the sequence
TGTTTTCCAGCCTGTGTGGGAG designed for use with SEQ ID No. 6 as a
forward primer for amplifying a portion of the GGH gene containing
the polymorphism that corresponds to nucleotide 511 of Genbank
sequence accession no. NM 003878 (position 511 of SEQ ID No.
1).
[0018] SEQ ID No. 6 is an oligonucleotide having the sequence
GGATGGTCATTCACATCTTCAACC designed for use with SEQ ID No. 5 as a
reverse primer for amplifying a portion of the GGH gene containing
the polymorphism that corresponds to nucleotide 511 of Genbank
sequence accession no. NM 003878 (position 511 of SEQ ID No.
1).
[0019] SEQ ID No. 7 is an oligonucleotide having the sequence
GTGGAGAGTGCTTATTAATTGCCACAGATACTGTTGAC designed for use with SEQ ID
No. 8 as a forward primer for mutagenizing the GGH gene at the
position corresponding to nucleotide 511 of Genbank sequence
accession no. NM 003878 (position 511 of SEQ ID No. 1; see
underlined nucleotide). This oligonucleotide can also be used to
determine the identity of the nucleotide at this position of the
GGH gene in a DNA sample.
[0020] SEQ ID No. 8 is an oligonucleotide having the sequence
GTCAACAGTATCTGTGGCAATTAATAAGCACTCTCCAC designed for use with SEQ ID
No. 7 as a reverse primer for mutagenizing the GGH gene at the
position corresponding to nucleotide 511 of Genbank sequence
accession no. NM 003878 (position 511 of SEQ ID No. 1; see
underlined nucleotide). This oligonucleotide can also be used to
determine the identity of the nucleotide at this position of the
GGH gene in a DNA sample.
DETAILED DESCRIPTION OF THE INVENTION
[0021] In accordance with the present invention there may be
employed conventional molecular biology, microbiology, and
recombinant DNA techniques within the skill of the art. Such
techniques are explained fully in the literature. See, e.g.,
Sambrook et al, "Molecular Cloning: A Laboratory Manual" (1989);
"Current Protocols in Molecular Biology" Volumes I-III [Ausubel, R.
M., ed. (1994)]; "Cell Biology: A Laboratory Handbook" Volumes
I-III [J. E. Celis, ed. (1994))]; "Current Protocols in Immunology"
Volumes I-III [Coligan, J. E., ed. (1994)]; "Oligonucleotide
Synthesis" (M. J. Gait ed. 1984); "Nucleic Acid Hybridization" [B.
D. Hames & S. J. Higgins eds. (1985)]; "Transcription And
Translation" [B. D. Hames & S. J. Higgins, eds. (1984)];
"Animal Cell Culture" [R. I. Freshney, ed. (1986)]; "Immobilized
Cells And Enzymes" [IRL Press, (1986)]; B. Perbal, "A Practical
Guide To Molecular Cloning" (1984).
[0022] Definitions: The terms and phrases used herein to describe
and claim the present invention shall have the meanings set forth
below.
[0023] By "oligonucleotide," is meant a molecule comprised of two
or more ribonucleotides, preferably more than three. Its exact size
will depend upon many factors which, in turn, depend upon the
ultimate function and use of the oligonucleotide. The
oligonucleotides of the invention useful as primers or
hybridization probes are preferably from 10 to 50 nucleotides in
length, even more preferably from 20-30 nucleotides in length or
from 15-25 nucleotides in length, and may be DNA, RNA or synthetic
nucleic acid, and may be chemically or biochemically modified or
may contain non-natural or derivatized nucleotide bases, as will be
appreciated by those skilled in the art. Also included are
synthetic molecules that mimic polynucleotides in their ability to
bind to a designated sequence to form a stable hybrid. Such
molecules are known in the art and include, for example, peptide
nucleic acids (PNAs) in which peptide linkages substitute for
phosphate linkages in the backbone of the molecule.
[0024] By "polynucleotide" is meant the polymeric form of
deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in
either its single stranded form, or a double-stranded helix. This
term refers only to the primary and secondary structure of the
molecule, and does not limit it to any particular tertiary fours.
Thus, this term includes double-stranded DNA found, inter alia, in
linear. DNA molecules (e.g., restriction fragments), viruses,
plasmids, and chromosomes. In discussing the structure of
particular double-stranded DNA molecules, sequences may be
described herein according to the normal convention of giving only
the sequence in the 5' to 3' direction along the non-transcribed
strand of DNA (i.e., the strand having a sequence homologous to the
mRNA).
[0025] By "primer" is meant an oligonucleotide, whether occurring
naturally as in a purified restriction digest or produced
synthetically, which is capable of acting as a point of initiation
of synthesis when placed under conditions in which synthesis of a
primer extension product, which is complementary to a nucleic acid
strand, is induced, i.e., in the presence of nucleotides and an
inducing agent such as a DNA polymerase and at a suitable
temperature and pH. The primer may be either single-stranded or
double-stranded and must be sufficiently long to prime the
synthesis of the desired extension product in the presence of the
inducing agent. The exact length of the primer will depend upon
many factors, including temperature, source of primer and use of
the method. For example, for diagnostic applications, depending on
the complexity of the target sequence, the oligonucleotide primer
typically contains 10 or more nucleotides, preferably 15-100
nucleotides and more preferably 15-25 nucleotides, although it may
contain fewer nucleotides or more nucleotides.
[0026] The primers herein are selected to be "substantially"
complementary to different strands of a particular target DNA
sequence. This means that the primers must be sufficiently
complementary to hybridize with their respective strands.
Therefore, the primer sequence need not reflect the exact sequence
of the template. For example, a non-complementary nucleotide
fragment may be attached to the 5' end of the primer, with the
remainder of the primer sequence being complementary to the strand.
Alternatively, non-complementary bases or longer sequences can be
interspersed into the primer, provided that the primer sequence has
sufficient complementarity with the sequence of the strand to
hybridize therewith and thereby form the template for the synthesis
of the extension product.
[0027] A labeled oligonucleotide or primer may be utilized in the
methods, assays and kits of the present invention. The labeled
oligonucleotide may be utilized as a primer in PCR or other method
of amplification and may be utilized in analysis, as a reactor or
binding partner of the resulting amplified product. In certain
methods, where sufficient concentration or sequestration of the
subject nucleic acid has occurred, and wherein the oligonucleotide
label and methods utilized are appropriately and sufficiently
sensitive, the nucleic acid may be directly analyzed, with the
presence of or presence of a particular label indicative of the
result and diagnostic of the presence or absence of a particular
single nucleotide polymorphism (SNP). After the labeled
oligonucleotide or primer has had an opportunity to react with
sites within the sample, the resulting product may be examined by
known techniques, which may vary with the nature of the label
attached. The label utilized may be radioactive or non-radioactive,
including fluorescent, colorimetric or enzymatic. In addition, the
label may be, for instance, a physical or antigenic tag which is
characterized by its activity or binding.
[0028] In the instance where a radioactive label, such as the
isotopes .sup.3H, .sup.14C, .sup.32P, .sup.35S, .sup.36Cl,
.sup.51Cr, .sup.57Co, .sup.58Co, .sup.59Fe, .sup.90Y, .sup.125I,
.sup.131I, .sup.186Re are used, known currently available counting
procedures may be utilized. In the instance where the label is an
enzyme, detection may be accomplished by any of the presently
utilized colorimetric, spectrophotometric,
fluorospectrophotometric, amperometric or gasometric techniques
known in the art.
DESCRIPTION
[0029] The present invention extends to diagnostic assays, kits and
methods for determining the gamma glutamyl hydrolase (GGH) genotype
of a subject with respect to the single nucleotide polymorphism
(SNP) identified at a position in exon 5 of the human GGH gene
corresponding to nucleotide 511 of Genbank sequence accession no.
NM 003878 (position 511 of SEQ ID No. 1; also referred to herein in
Example 1 as 452C>T and T127I), thereby providing a means to
determine the expression or activity of GGH in the subject. This is
particularly relevant in determining and assessing interpatient
variation in the metabolism of drugs which involves GGH
activity.
[0030] In the wildtype GGH gene the nucleotide at the position
corresponding to nucleotide 511 of Genbank sequence accession no.
NM 003878 (position 511 of SEQ ID No. 1) is a cytosine and is part
of the three nucleotide codon ACT which encodes a threonine (THR)
in the GGH protein. The mutation identified herein associated with
lower levels of GGH activity is a change in the nucleotide at this
position to a thymine, which changes the corresponding codon to ATT
which encodes an isoleucine (ILE) in the mutant GGH protein.
[0031] Subjects who have a cytosine on each GGH allele at the
position corresponding to position 511 of SEQ ID No. 1 are expected
to have high levels of GGH activity relative to subjects who have a
thymine on each GGH allele at this position. Subjects who have a
cytosine on one. GGH allele at this position and a thymine on the
other GGH allele at this position are expected to have an
intermediate level of GGH activity lower than subjects who have a
cytosine on each GGH allele at this position and higher than
subjects who have a thymine on each GGH allele at this position.
Therefore one can predict the relative level of GGH activity in a
subject by determining the identity of the nucleotide corresponding
to position 511 of SEQ ID No. 1 in each GGH allele of the genome of
the subject.
[0032] The nucleotide at this position in the GGH gene can be
identified from a sample of nucleic acid obtained from a subject
(DNA or RNA) by any desired conventional means applicable to this
polymorphism. This includes determining the identity of this
nucleotide using standard sequencing techniques, restriction
fragment length polymorphism (RFLP) analysis, PCR-RFLP analysis,
bioelectronic microchip analysis (see U.S. Pat. No. 6,468,742
granted Oct. 22, 2002), degradation of a fluorescent or tagged
sequence (see U.S. Pat. No. 6,682,887 granted Jan. 27, 2004 and
U.S. Pat. No. 6,322,980 granted Nov. 27, 2001), mass spectrometry
(see U.S. Pat. No. 6,613,509 granted Sep. 2, 2003), single-strand
conformational polymorphism analysis, single base extension, Taq
Man real-time PCR genotyping, heteroduplex analysis, allele
specific amplification, single molecule dilution, coupled
amplification and sequencing, or any other standard hybridization
technique using oligonucleotide primers designed to differentially
hybridise to the GGH gene or a fragment thereof depending upon the
identity of the nucleotide at this position. Preferably, the method
of identification used will allow identification of this nucleotide
on each allele of the GGH gene in the nucleic acid sample. However,
methods which allow detection of the presence or absence of the
mutant nucleotide (thymine) at this position on either of the GGH
alleles present in a nucleic acid sample are useful.
[0033] An Ase1 restriction, site (ATTAAT) is created by the
presence of a thymine at the position on the GGH gene corresponding
to position 511 of SEQ ID No. 1. RFLP analysis can be used to
detect the presence or absence of this Ase1 restriction site at
this location on the GGH gene. The presence of an Ase1 restriction
site at this location indicates that the GGH gene has a thymine at
the position corresponding to position 511 of SEQ ID No. 1. The
absence of an Ase1 restriction site at this location indicates that
the GGH gene has a cytosine at the position corresponding to
position 511 of SEQ ID No. 1.
[0034] To facilitate detection, the portion of the GGH gene
containing this SNP can be amplified from a nucleic acid sample
using standard polymerase chain reaction (PCR) techniques. See
Bruce Alberts, Alexander Johnson, Julian Lewis, Martin Raff, Keith
Roberts, Peter Walter (eds), Molecular Biology of THE CELL (4th
edition), pub. by Garland Science, NY pp. 508-509 (2002).
Application of these techniques involves the use of oligonucleotide
primers which hybridise to portions of the GGH gene on either side
of the SNP. These oligonucleotide primers represent another aspect
of the present invention.
[0035] In addition to the primary SNP associated with low GGH
activity, the inventors also identified two additional SNPs within
the GGH gene associated with low GGH activity. These SNPs can be
detected using the same methods described above for the primary
SNP. The present invention extends to diagnostic assays, kits and
methods for determining the gamma glutamyl hydrolase (GGH) genotype
of a subject with respect to these two additional SNPs.
[0036] One of these SNPs occurs in exon 2 of the human GGH gene at
a position corresponding to nucleotide 233 of Genbank sequence
accession no. NM 003878 (position 233 of SEQ ID No. 1; also
referred to herein in Example 1 as 174G>A and A34A). In the
wildtype GGH gene the nucleotide at this position is a guanine. The
mutation identified herein associated with lower levels of GGH
activity is a change in the nucleotide, at this position to an
adenine, which is a silent mutation that does not change the amino
acid encoded by the corresponding codon.
[0037] The other SNP identified by the inventors as associated with
low GGH activity occurs in the 3' untranslated region of the GGH
gene at a position corresponding to nucleotide 1161 of Genbank
sequence accession no. NM 003878 (position 1161 of SEQ ID No. 1;
also referred to herein in Example 1 as 1102A>G). In the
wildtype GGH gene the nucleotide at this position is an adenine.
The mutation identified herein associated with lower levels of GGH
activity is a change in the nucleotide at this position to a
guanine.
[0038] Kits useful for determining the genotype of the GGH gene at
the polymorphic locations taught herein as associated with low GGH
activity are also provided. Such kits may contain oligonucleotide
primers that can be used to determine the identity of the
nucleotide at the polymorphic location of interest. For example, a
kit designed for determining the identity of the nucleotide at the
position corresponding to nucleotide 511 of SEQ ID No. 1 could
contain an oligonuceotide primer having the sequence set forth in
SEQ ID No. 7 or SEQ ID No. 8. Such kits may also contain forward
and reverse oligonucleotide primers designed to amplify the portion
of the GGH gene containing the polymorphism(s) of interest. For
example a kit designed for determining the genotype of the GGH gene
at the polymorphic location corresponding to nucleotide 511 of SEQ
ID No. 1 could contain a forward oligonucleotide primer having the
sequence set forth in SEQ ID No. 3 and a reverse forward
oligonucleotide primer having the sequence set forth in SEQ ID No.
4, or a forward oligonucleotide primer having the sequence set
forth in SEQ ID No. 5 and a reverse forward oligonucleotide primer
having the sequence set forth in SEQ ID No. 6. Such kits may also
include other standard components useful in the amplification
process, such as appropriate buffer solutions and polymerases used
to catalyze the DNA amplification process. Such kits may also
include standard components for sequencing the amplified portion of
the GGH gene or for determining the identity of the nucleotide at
the polymorphic position on the amplified portion of the GGH
gene.
[0039] The present invention may be better understood by reference
to the following non-limiting examples. These examples are
presented in order to more fully illustrate the invention through
the description of particular embodiments. These examples should in
no way be construed as limiting the scope of the invention.
EXAMPLES
Example 1
A Substrate Specific Functional Polymorphism of Human
.gamma.-Glutamyl Hydrolase Alters Catalytic Activity and
Methotrexate Polyglutamate Accumulation in Acute Lymphoblastic
Leukemia Cells
Summary
[0040] A significant inverse relationship was found between
.gamma.-glutamyl hydrolase (GGH) activity and the accumulation of
long-chain methotrexate polyglutamates (MTX-PG.sub.4-7) in
non-hyperdiploid B-lineage ALL leukemia cells after uniform
treatment with high-dose methotrexate (HDMTX) (1 g/m.sup.2 IV). To
identify genetic polymorphisms that alter the function of human GGH
the GGH exons from children with acute lymphoblastic leukemia
(ALL), who had a 7.8-fold range of GGH activity in their ALL cells
at diagnosis, were sequenced. SNP 452C>T (T127I; a change from a
cytosine to a thymine at a position corresponding to nucleotide 511
of Genbank sequence accession no. NM 003878) was found among
patients with low GGH activity, but not found in patients with high
GGH activity. Computational modeling indicated that the T127I
substitution alters the molecular surface conformation at the
catalytic cleft-tail on GGH, which is predicted to alter binding
affinity with long chain methotrexate polyglutamates. Enzyme
kinetic analysis of heterologously expressed GGH revealed a
significantly higher K.sub.m (2.7-fold) and lower catalytic
efficiency (V.sub.max/K.sub.m reduced 67%) of the T127I variant
compared to wild-type GGH using MTX-PG.sub.5 as substrate. SNP
452C>T was also associated with lower GGH activity in
hyperdiploid B-lineage and T lineage ALL leukemia cells. Caucasians
(10.0%; 95% CI: 6.7-13.3%; n=155) were found to have significantly
higher frequency of the Ile127 allele than African-Americans (4.4%;
95% CI: 1.2-7.5%; n=80) (p=0.033). These studies have demonstrated
a substrate specific functional SNP (452C>T) in the human GGH
gene, that is associated with lower catalytic activity and higher
accumulation of long-chain MTX-PG in leukemia cells of patients
treated with HDMTX.
Introduction
[0041] Methotrexate (MTX) is an antifolate that is used essentially
in all treatment protocols for childhood acute lymphoblastic
leukemia (ALL) (Chabner, B. A. et al., "Polyglutamation of
methotrexate. Is methotrexate a prodrug?" J Clin Invest 76: 907-912
(1985); Gorlick, R. et al., "Intrinsic and acquired resistance to
methotrexate in acute leukemia". N Engl J Med 335:1041-1048 (1996);
Bertino, J. R., Karnofsky memorial lecture. Ode to methotrexate. J
Clin Oncol 11:5-14 (1993); Camitta, B. et al., "Intensive
intravenous methotrexate and mercaptopurine treatment of
higher-risk non-T, non-B acute lymphocytic leukemia: A Pediatric
Oncology Group study" J Clin Oncol 12:1383-1389 (1994); Schorin M.
A., et al., "Treatment of childhood acute lymphoblastic leukemia:
results of Dana-Farber Cancer Institute/Children's Hospital Acute
Lymphoblastic Leukemia Consortium Protocol 85-01" J Clin Oncol
12:740-747 (1994); Niemeyer, C. M. et al., "Low-dose versus
high-dose methotrexate during remission induction in childhood
acute lymphoblastic leukemia (Protocol 81-01 update)" Blood
78:2514-2519 (1991); Mahoney, D. H., Jr., et al.,
"Intermediate-dose intravenous methotrexate with intravenous
mercaptopurine is superior to repetitive low-dose oral methotrexate
with intravenous mercaptopurine for children with lower-risk
B-lineage acute lymphoblastic leukemia: a Pediatric Oncology Group
phase III trial". J Clin Oncol 16: 246-254 (1998); Evans, W. E. et
al., "Conventional compared with individualized chemotherapy for
childhood acute lymphoblastic leukemia" N Engl J Med 338:499-505
(1998); Pui, C. H. et al., "Acute lymphoblastic leukemia" N Engl J
Med 339: 605-615 (1998)).
[0042] After its entry into cells, MTX is rapidly converted to
.gamma.-glutamyl polyglutamates through the action of
folypolyglutamate synthetase (FPGS, EC 6.3.2.17), which
sequentially adds up to 6 glutamyl residues to MTX (Goldman, I. D.
et al., "Carrier-mediated transport of the folic acid analogue,
methotrexate, in the L1210 leukemia cell" J Biol Chem 243:5007-5017
(1968); Zhao, R. et al., "Resistance to antifolates" Oncogene
22:7431-7457 (2003); Shane, B., "Folylpolyglutamate synthesis and
role in the regulation of one-carbon metabolism", Vitam Horm
45:263-335 (1989)).
[0043] Long chain polyglutamates (MTXPG.sub.4-7) are more avid
inhibitors of folate-dependent enzymes and are also retained longer
within cells, thereby increasing MTX's prolonging their antifolate
effects (Chabner, B. A. et al., id; Masson, E. et al.,
"Accumulation of methotrexate polyglutamates in lymphoblasts is a
determinant of antileukemic effects in vivo. A rationale for
high-dose methotrexate" J Clin Invest 97:73-80 (1996)). Higher
accumulation of MTXPG has been associated with increased
cytotoxicity and treatment response in childhood ALL (Masson, E. et
al., id; Whitehead, V. M. et al., "Accumulation of methotrexate and
methotrexate polyglutamates in lymphoblasts at diagnosis of
childhood acute lymphoblastic leukemia: a pilot prognostic factor
analysis" Blood 76:44-49 (1990)).
[0044] Significant lineage and ploidy differences have been
observed in MTX-PG accumulation in ALL cells, with T-lineage ALL
having the lowest MTX-PG accumulation and hyperdiploid (>50
chromosomes) B-lineage ALL having the highest MTX-PG accumulation
(Synold, T. W. et al., "Blast cell methotrexate-polyglutamate
accumulation in vivo differs by lineage, ploidy, and methotrexate
dose in acute lymphoblastic leukemia". J Clin Invest 94:1996-2001
(1994); Whitehead, V. M. et al., "Accumulation of high levels of
methotrexate polyglutamates in lymphoblasts from children with
hyperdiploid (greater than 50 chromosomes) B-lineage acute
lymphoblastic leukemia: a Pediatric Oncology Group study" Blood
80:1316-1323 (1992)). The underlying mechanisms for these
differences include lower FPGS activity in T-ALL (Barredo, S. C. et
al., "Differences in constitutive and post-methotrexate
folylpolyglutamate synthetase activity in B-lineage and T-lineage
leukemia" Blood 84:564-569 (1994)) and higher reduced folate
carrier (RFC) expression in hyperdiploid B-lineage ALL (Belkov, V.
M. et al., "Reduced folate carrier expression in acute
lymphoblastic leukemia: a mechanism for ploidy but not lineage
differences in methotrexate accumulation" Blood 93:1643-1650
(1999)). However, following uniform treatment with HDMTX, there
remain substantial inter-individual differences in MTX-PG
accumulation within each of the three lineage and ploidy subtypes
of ALL, for reasons that have not been fully elucidated.
[0045] .gamma.-Glutamyl hydrolase (GGH, also known as
folypolyglutamate hydrolase, FPGH, EC 3.4.19.9) is a lysosomal
peptidase that catalyzes the removal of .gamma.-linked
polyglutamates, converting long-chain MTX-PG into shorter-chain
MTX-PG and ultimately to MTX. This allows MTX to be effluxed from
cells and thereby reduces the overall effectiveness of MTX
(Galivan, J. et al., "Glutamyl hydrolase: properties and
pharmacologic impact" Semin Oncol 26.33-37 (1999); Rhee, M. S. et
al., "Characterization of human cellular gamma-glutamyl hydrolase"
Mol Pharmacol 53:1040-1046 (1998); Panetta, J. C. et al.,
"Methotrexate intracellular disposition in acute lymphoblastic
leukemia: a mathematical model of gamma-glutamyl hydrolase
activity" Clin Cancer Res 8:2423-2429 (2002)). The human GGH gene
spans 24 kb on chromosome 8 (q1223-13.1) and comprises nine exons
(Yin, D. et al., "Structural organization of the human
gamma-glutamyl hydrolase gene" Gene 238: 463-470 (1999)). The
crystal structure of human GGH has been determined and a model for
substrate recognition and hydrolysis has been proposed (Li, H. et
al., "Three-dimensional structure of human gamma-glutamyl
hydrolase. A class I glatamine amidotransferase adapted for a
complex substate" J Biol Chem 277: 24522-24529 (2002); Chave, K. J,
et al., "Molecular modeling and site-directed mutagenesis define
the catalytic motif in human gamma-glutamyl hydrolase" J Biol Chem
275:40365-40370 (2000)). Cellular GGH is predominantly lysosomal,
with an acidic pH optimum, functioning as either an endopeptidase
or exopeptidase, exhibiting species differences in these functions
(Elsenhans, B. et al., "Isolation and characterization of
pteroylpolyglutamate hydrolase from rat intestinal mucosa" J Biol
Chem 259:6364-6368 (1984); Samuels, L. L. et al., "Hydrolytic
cleavage of methotrexate gamma-polyglutamates by folylpolyglutamyl
hydrolase derived from various tumors and normal tissues of the
mouse" Cancer Res 46:2230-2235 (1986); Bhandari, S. D. et al.,
"Properties of pteroylpolyglutamate hydrolase in pancreatic juice
of the pig" J Nutr 120:467-475 (1990); Yao, R. et al., "Human
gamma-glutamyl hydrolase: cloning and characterization of the
enzyme expressed in vitro" Proc Natl Acad Sci USA 93:10134-10138
(1996)). Human GGH has a higher affinity for the longer chain MTX
polyglutamates, cleaving multiple glutamyl residues, with highest
activity at the outermost or two outermost residues in the
polyglutamate chain (Panetta, J. C., et al., id).
[0046] The current study reveals marked heterogeneity of GGH
activity in human ALL cells and documents a significant inverse
relation between GGH activity and MTX-PG.sub.4-7 in
non-hyperdiploid B-lineage ALL. Further, we identified several
germ-line polymorphisms in the human GGH gene, one of which
(452C>T, T127I) significantly alters GGH catalytic activity, and
is associated with low GGH activity and high MTXPG accumulation in
ALL blasts of patients treated with high-dose MTX. This establishes
a previously unrecognized inherited determinant of MTX disposition
in human leukemia cells, providing new insights toward optimizing
treatment with this widely used antileukemic agent.
Methods
[0047] Patients, treatment and isolation of leukemia cells:
Leukemia cells were isolated by bone marrow aspirates from children
with newly diagnosed ALL who were treated on St Jude Children's
Research Hospital Total XV protocol (Pui, C. H. et al., "Rational
and design of total therapy study XV for newly diagnosed acute
lyphoblastic leukemia" Annals of Hematology 2003), after approval
by our institutional review board and appropriate informed consent.
All patients received initial therapy with high-dose intravenous
MTX (1 g/m.sup.2), with supportive care as previously reported
(Cheok, M. H. et al., "Treatment-specific changes in gene
expression discriminate in vivo drug response in human leukemia
cells" Nat Genet. 2003; 34: 85-90). Bone marrow aspirates were
obtained at diagnosis and 42 h after the start of MTX therapy. The
diagnosis of ALL, including immunophenotyping, and cytogenetic
analyses, were performed as previously described (Pui, C. H. et al.
1998, id; Yeoh, E. J. et al., "Classification, subtype discovery,
and prediction of outcome in pediatric acute lymphoblastic leukemia
by gene expression profiling" Cancer Cell 1:133-143 (2002)).
Leukemic blast cells were isolated by Ficoll-Hypaque gradient as
previously described (Synold, T. W. et al., id)).
[0048] Analysis of human GGH activity and MTXPG accumulation in ALL
cells: 5-10.times.10.sup.6 lymphoblast cells isolated from
diagnostic bone marrows were resuspended in sucrose solution (0.25
M sucrose, 1 mM EDTA, 10 mM Hepes-NaOH, pH 7.4). Total cell lysate
was obtained by treating with 0.1% triton x-100, Human GGH activity
was determined using MTEN buffer with 2 mM DTT and the reaction
products were analyzed by HPLC, as previously described (Panetta,
J. C. et al., id). GGH activity was calculated as the total amount
of product formed per hour per .mu.g protein.
[0049] MTX-PGs were measured in bone marrow ALL blasts obtained 42
h from the start of MTX. MTX and its polyglutamated metabolites
were separated by HPLC and quantitated by radioenzymatic assay
(Synold, T. W. et al., id). The limit of detection of this assay
was 0.02 pmol/10.sup.6 cells. All results are expressed as
picomoles MTXPG per 10.sup.9 cells.
[0050] Identification of genetic polymorphisms and GGH genotyping:
Genomic DNA was extracted from normal blood cells with TriReagent
(MRC, OH). Using Vector NTI Advance (InforMax. MD), primers were
designed for PCR amplification of human GGH exons including
intron/exon boundaries in genomic DNA. PCR amplification was
performed according to the manufacturer's protocol, using Expand
High Fidelity PCR system or GC-RICH PCR System (Roche, Ind.).
Sequence analysis was performed on an ABI Prism 3700 Automated
Sequencer using the PCR primers. The nucleotide sequences were
assembled using the Phred-Phrap Consed package
(http://droog.mbt.washington.edu/PolyPhred.html University of
Washington, Seattle) for the detection of heterozygous single
nucleotide polymorphisms. GenBank accession numbers: GGH genomic
DNA, NT.sub.--008183.17; GGH promoter region, AF147081.
[0051] Genotyping for the single nucleotide polymorphism (SNP)
452CT in exon 5 was carried out by direct sequencing using the
following two sets of primers:
TABLE-US-00001 Region: Exon 4 and Exon 5 Forward Primer (5'-3'):
TGTTTTCTGTGTGTGTATGGGTCGG (SEQ ID No. 3) Reverse Primer (5'-3'):
TGCTACTTACTAATCCTGCCCAGCA (SEQ ID No. 4) Region: Exon 5 Forward
Primer (5'-3'): TGTTTTCCAGCCTGTGTGGGAG (SEQ ID No. 5) Reverse
Primer (5'-3'): GGATGGTCATTCACATCTTCAACC (SEQ ID No. 6)
[0052] Allele and genotype frequency were calculated based on the
observed number of the two different alleles, Thr127 and Ile127,
which were derived from genotype data in each ethnic group. Exact
chi square test and Fisher's exact test were used to compare the
observed and expected allele and genotype frequencies among
different populations. Statistical analyses were performed using
software R (http://www.r-project.org).
[0053] Structural modeling and docking: Structural modeling of the
variant GGH containing T127I amino acid change was built on
Swiss-Model server for automatic model building
(http://www.expasy.org/swissmod/SWISS-MODEL.html). The model was
built based on sequence alignment using wild type GGH (PDB code:
1L9X) as the template. The reported model was visualized using
SYBYL program. Computational docking was performed using the
flexible docking method FlexX (Rarey, M. et al., "A fast flexible
docking method using an incremental construction algorithm" J Mol
Biol 261:470-489 (1996)). Cscore uses five different scoring
functions to quantify the affinity of a small molecule ligand to
the protein active site. A model with the highest Cscore was
selected to represent the intermediate complex for the cleavage of
the gamma-glutamyl link. Residues Gly74-Arg79, Cys110-Leu118,
Ala168-Trp173, His220 and Glu222 were defined as active sites of
GGH with a sphere of 6.5 .ANG. around each residue to generate
docking model. The MTX-PG.sub.5 and MTX-PG.sub.2 substrates were
prepared in the SYBYL mol2 format, with all hydrogens added and
formal charges assigned after energy minimization. It has been
proposed that the substrate binding and catalytic mechanism of
human GGH is similar to the GATase domains of carbamoyl-phosphate
synthetase (eCPS) (Li, H. et al., id). To examine the accuracy of
the interaction model of MTX-PG.sub.5 with GGH, the crystal
structure of carbamoyl-phosphate synthetase (eCPS) variant
H353N-glutamine thioester complex (PDB code:1A9X) was superimposed
onto the GGH containing MTX-PG.sub.5 substrate by least-squares
fitting of .alpha.-carbons of 20 residues around the active
site.
[0054] The binding free energy is calculated by using SYBYL
minimize function. All energy minimization was carried out using
Tripos force-field (Clark, M. et al., "Validation of the
General-Purpose Tripos 5.2 Force-Field" Journal of Computational
Chemistry 10:982-1012 (1989)) with a distance dependent dielectric
constant "D=80.0" and Gasteiger-Huckel charge
(http://www.tripos.com). The binding free energy per molecule was
computed using the formula:
.DELTA..DELTA.G=.DELTA.G.sub.complex-.DELTA.G.sub.protein-.DELTA.G.sub.l-
igand
All minimization energies were obtained after 1000 maximum
iterations with a termination gradient of 0.005 kcals/mol.
Wild-type human GGH cloning and site-directed mutagenesis: A cDNA
encoding the 294 amino acids of human GGH (with out leading
peptide) was cloned by RT-PCR and TA cloning (Invitrogen, Carlsbad,
Calif.) using RNA isolated from human CEM cells. Plasmid DNA was
purified using the mini prep kit (Qiagen, Santa Clarita, Calif.).
After sequencing, the selected cDNA clone was subcloned into the
pET28b vector (Novagen, Madison, Wis.) from Nde1 and BamH1 sites,
and an N-terminal HisTag was added. This HisTag enabled the
purification of large quantities of protein and had no effect on
GGH activity (Chave, K. J. et al., 2000, id). Site-directed
mutagenesis was performed with the QuickChange II kit (Stratagene,
La Jolla, Calif.) according to the manufacturer's protocol. The
primers used for mutagenesis of wild-type human GGH to T127I
were
TABLE-US-00002 5'-GTGGAGAGTGCTTATTAATTGCCACAGATACTGTTGAC-3'
(forward; SEQ ID No. 7); and
5'-GTCAACAGTATCTGTGGCAATTAATAAGCACTCTCCAC-3' (reverse; SEQ ID No.
8).
Both wild-type and recombinant variant form of human GGH clones
were further confirmed by sequencing.
[0055] Expression and characterization of T127I variant GGH:
Plasmids carrying wild-type and T127I variant GGH were used to
transform E. coli strain BL21(DE3)pLysS competent cells (Novagen,
Madison, Wis.). The E. coli cells were grown in LB medium
containing 30 .mu.g/ml kanamycin and 34 .mu.g/ml chloramphenicol at
37.degree. C. to OD.sub.600 about 0.6 and expression was induced
with 1 mM isopropyl-.beta.-D-thiogalactoside for 3 h. Cells were
harvested by centrifugation at 5,000 g for 5 min at 4.degree. C.;
and were kept as a frozen pellet at -70.degree. C. Target proteins
were extracted using BugBuster His-Bind Purification kit (Novagen,
Madison, Wis.), followed by gel filtration chromatography at
4.degree. C. on a HiLoad 26/60 S200 Superdex column (Amersham
Pharmacia Biotech, Sweden) in 0.05 M sodium acetate buffer, pH5.5,
containing 0.05 M 2-mercaptoethanol, 1 M NaCl, and 1 mM EDTA.
Fractions containing target proteins were pooled and proteins were
concentrated using Viva Cell 70 ml Concentrator, followed by Viva
Cpin 2 ml Concentrator (Vivascience, Edgewood, N.Y.).
[0056] Wild-type and T127I variant forms of human GGH were
separated using NuPAGE.TM. 4-12% Bis-Tris Gel (Invitrogen,
Carlsbad, Calif.). Protein bands were visualized by silver staining
(Amersham Pharmacia Biotech, Sweden). Western blot was carried out
as described (Tai, H. L. et al., "Thiopurine S-methyltransferase
deficiency: two nucleotide transitions define the most prevalent
mutant allele associated with loss of catalytic activity in
Caucasians" Am J Hum Genet 58:694-702 (1996)). Polyclonal
anti-human GGH rabbit antibody was kindly provided by Drs Thomas J.
Ryan and John. GGH activity was measured using MTEN buffer with 25
mM DTT. The assay mixture without substrate was incubated at
37.degree. C. for 20 min, followed by incubation with substrate at
37.degree. C. for 5 min and boiling for 5 min. In each experiment,
wild-type and variant GGH were analyzed in parallel using varying
concentrations of MTX-PG.sub.5 or MTX-PG.sub.2 as substrate. The
substrate and the reaction products were analyzed by HPLC, and GGH
activity was calculated by total amount of product formed per min
per .mu.g protein. Two independent experiments were carried on with
each substrate. Nonlinear least-squares regression was used to
estimate K.sub.m and V.sub.max by fitting a Michaels-Menten model
as described earlier (Panetta, J. C. et al., id).
Results
[0057] GGH activity in lineage and ploidy subtypes of ALL: GGH
activity was significantly different among ALL subtypes
(Kruskal-Wallis test, p=0.025), with T lineage ALL cells having
significantly higher GGH activity compared to B lineage ALL
(Mann-Whitney U test, p=0.011). There was also substantial
heterogeneity in GGH activity in ALL cells within each of these ALL
subtypes. The largest range of GGH activity was found among
patients with non-hyperdiploid B-lineage ALL (7.8 fold), compared
to patients with T lineage ALL (3.7 fold) and hyperdiploid
B-lineage ALL (3.0 fold).
[0058] MTX-PG accumulation and GGH activity among non-hyperdiploid
B-lineage ALL patients: There was a 14.6 fold range of long chain
MTX-PG (MTX-PG.sub.4-7) accumulation following uniform treatment
with HDMTX, among patients with non-hyperdiploid B-lineage ALL.
When these patients were sub-divided according to their ALL GGH
activity (i.e., low, intermediate and high GGH activity defined as
the top 25%, intermediate 50%, and bottom 25%), accumulation of
long-chain MTX-PG.sub.4-7 in ALL blasts was inversely related to
GGH activity. Similarly, there was an 18.5 fold range of total
MTX-PG (MTX-PG.sub.2-7) accumulation, which was inversely related
to GGH activity in ALL cells. In contrast, there was not a
significant relation between GGH activity and short chain MTX-PG
(MTX-PG.sub.2-3) accumulation.
[0059] Polymorphisms in human GGH: By sequencing GGH exons and
intron/exon boundaries in genomic DNA from five patients with high
GGH activity and four with low GGH activity, five SNPs were
identified, at bases 16T>C, 91G>A, 174G>A, 452C>T and
1102A>G, relative to the A of the translation start codon.
16T>C, 452C>T and 1102A>G are recently reported by another
group (Chave, K. J. et al., "Identification of single nucleotide
polymorphisms in the human gamma-glutamyl hydrolase gene and
characterization of promoter polymorphisms". Gene 319: 167-175
(2003)).
[0060] The SNP (452C>T) producing a non-conservative amino acid
substitution of threonine (Thr ACT) to isoleucine (Ile ATT) at
position 127 in exon 5 of human GGH, was only detected in patients
with low GGH activity (2 of 4), but in none of the 5 patients with
high GGH activity. A novel synonymous SNP in exon 2 (174G>A,
A34A) and a SNP located in the 3'UTR (1102A>G, exon 9) were also
found only in patients with low GGH activity (1 of 4, and 2 of 4,
respectively). A novel non-synonymous SNP (91G>A, A7T) located
in exon 1 was found in 2 of 4 patients with low GGH activity and 1
of 5 with high GGH activity. The non-synonymous SNP (16T>C)
(dbSNP Ref# rs1800909) in the endoplasmic reticulum targeting
sequence of human GGH was found in 3 patients with low GGH activity
and 4 patients with high GGH activity.
[0061] Structural model of the T127I variant GGH and its
interaction with MTX-PG: Using crystal structure wild-type GGH, we
established a computational model of the T127I variant GGH. The
model estimated that the T127I substitution changes the side chain
orientation of residues Cys 124 and Leu125, resulting in an
alteration of molecular surface around the mutated residue, from a
flat to a protruded conformation.
[0062] In order to estimate how these conformational changes alter
substrate binding, the FlexX program was used to build a binding
model of MTX-PG.sub.5 onto wild-type GGH. The model indicated that
the third glutamate in MTX-PG.sub.5 can overlap onto the glutamine
thioester intermediate, within 4 .ANG. from Cys110, which is an
acceptable range for the Cys110 nucleophilic attacking cleavage
site between the third and fourth glutamate. To fit the GGH
substrate binding cleft well without steric conflicts, the
p-aminobenzoyl group of MTX-PG.sub.5 was stacked in the patch of
hydrophobic residues including Cys124, Leu125, Leu126 and Trp173,
while the pterin group was flexibly placed outside of the cleft.
The accuracy of this interaction model was examined by
superimposing a crystal structure of eCPS variant H353N-glutamine
thioester complex onto the GGH containing MTX-PG.sub.5 substrate.
In T127I variant GGH, side chain shift at Cys124 and Leu125
narrowed the gap between Leu125 and Trp173 from 11.3 .ANG. in
wild-type to 7 .ANG. in T127I variant, reducing the space for
accommodating the p-aminobenzoyl group of MTXPG.sub.5. The binding
free energy of MTX-PG.sub.5 was increased from -48.7 kcals/mol with
wild-type GGH to -30.8 kcals/mol with T127I variant. Thus, the
structural modeling indicates that the T127I mutation may reduce
GGH catalytic activity for long chain MTX-PG by affecting substrate
binding affinity.
[0063] We also constructed a binding model of MTX-PG.sub.2 onto
wild-type and T127I variant GGH. With only two glutamate residues,
the pteroyl group of MTX-PG.sub.2 was placed into the tail pocket,
surrounded by residues of Asp77, Leu78, Arg79, Leu111, Leu126 and
Trp173. This estimated that local conformational changes at loop
124-127 in the T127I variant have a very modest affect on the
interaction between MTX-PG.sub.2 and GGH. The estimated binding
free energy of MTX-PG.sub.2 with wild-type and T127I GGH were -29.4
kcals/mol, and -30.5 kcals/mol respectively.
[0064] Expression and functional characterization of T127I variant
protein: We cloned the wild-type human GGH and constructed T127I
variant protein by site directed mutagenesis. The two expressed
proteins were separated by SDS-PAGE gel electrophoresis, and
detected in equal quantities by silver staining and Western
blot.
[0065] Both wild-type and T127I variant human GGH protein exhibited
Michaelis-Menten kinetics with MTXPG (PG.sub.2 or PG.sub.5) as
substrate. T127I variant significantly increased K.sub.m for
MTXPG.sub.5 (2.7 fold, p=0.021), but there was not a significant
difference in V.sub.max between the wild-type and T127I variant.
The catalytic efficiency (V.sub.max/K.sub.m) of T127I variant for
MTXPG.sub.5 was significantly reduced (by 67.5%, p=0.003).
Consistent with our structural modeling, enzyme kinetic analysis
indicated that the T127I variant significantly reduced GGH binding
affinity for long chain MTX-PG (MTX-PG.sub.5), but had less effect
on short-chain MTX-PG.sub.2, for which there was not a significant
difference in K.sub.m, V.sub.max or catalytic efficiency.
[0066] Concordance of phenotype and genotype for SNP
452C>T(T127I): The 452C>T genotype was determined in 66
patients with ALL (38 non-hyperdiploid B-lineage; 12 hyperdiploid
B-lineage; 16 T lineage), in whom leukemia cell GGH activity was
measured in ALL cells. Within each ALL subtype, when patients were
grouped as low, intermediate and high GGH activity, the 452C>T
SNP (T127I) was not found in any patients with high GGH activity
(FIG. 1). In contrast, the allele frequency of this SNP was higher
among patients with low GGH activity, in non-hyperdiploid
B-lineage, hyperdiploid B-lineage or T lineage ALL (20.0%, 16.7%
and 12.5% respectively, FIG. 1). The 452C>T SNP was also found
in patients with intermediate GGH activity, but at a frequency
intermediate to the low and high GGH activity patients (11.1%, 8.3%
and 6.3% respectively; FIG. 1). For the entire group of patients
studied (n=66), the frequency of the 452C>T SNP was
significantly different among patients with low (17.6%),
intermediate (9.4%) and high (0%) GGH activity respectively (Exact
chi square test, p=0.025).
[0067] The allele and genotype frequencies of the human GGH
Thr127Ile polymorphism among 235 children with ALL (155 Caucasians
and 80 African-Americans) revealed significant ethnic differences.
Caucasians had a significantly higher frequency of the Ile127
allele (10.0%, 95% CI: 6.7%-13.3%) than in African-American (4.4%,
95% CI: 1.2-7.5%) (Fisher's exact test, p=0.033). The allele and
genotype frequencies for these two ethnic groups were in
Hardy-Weinberg equilibrium (all p=1).
Discussion
[0068] In the present study, a non-synonymous SNP 452C>T(T127I)
was identified in the human GGH gene that significantly alters
catalytic activity for cleavage of long-chain MTXPG and is
associated with altered in vivo GGH activity and long-chain MTXPG
accumulation in ALL cells. We documented a 7.8-fold range of GGH
activity in ALL cells obtained at diagnosis from children with
non-hyperdiploid B-lineage ALL, a 14.6 fold range of long-chain
methotrexate polyglutamate (MTX-PG.sub.4-7) accumulation, and a
significant inverse relation between GGH activity and
MTX-PG.sub.4-7 accumulation in ALL cells after uniform HDMTX
treatment (1 g/m.sup.2 IV). We also documented substantial
heterogeneity in GGH activity in other subtypes of ALL (i.e., 3.0
fold range in hyperdiploid B-lineage and 3.7 fold range in T
lineage ALL), but the number of available patients precluded
assessment of the relation between GGH activity and MTXPG
accumulation in these more rare subtypes of ALL.
[0069] Because cellular accumulation of long-chain MTXPG is
advantageous in ALL therapy, and human GGH has a different affinity
for longer-chain and short-chain MTX polyglutamates (Panetta, J. C.
et al., id), we used MTX-PG.sub.5 as the substrate for measuring
GGH activity in ALL cells. The 452C>T SNP was found in a higher
frequency among patients with low GGH activity, and was not found
in patients with high GGH activity. For the entire group of
patients studied, the frequency of the 452C>T SNP was
significantly different among patients with low (17.6%),
intermediate (9.4%) and high (0%) GGH activity, respectively
(Fisher chi square test, p=0.025). Among patients with
non-hyperdiploid B-lineage, hyperdiploid B-lineage and T lineage
childhood ALL, the allele frequency of the 452C>T (T127I) SNP
was 20.0%, 16.7% and 12.5% in patients with low GGH activity, and
11.1%, 8.3% and 6.3% in patients with intermediate GGH activity,
and not detected in any patient with high GGH activity (FIG. 1).
Recently, the 452C>T SNP was also identified in human GGH from
breast cancer tissue and leukemia cell lines (Chave, K. J. et al.,
"Identification of single nucleotide polymorphisms in the human
gamma-glutamyl hydrolase gene and characterization of promoter
polymorphisms". Gene 319:167-175 (2003)). Using short chain MTXPG
(MTXPG.sub.2) as the substrate for measuring GGH activity, Chave et
al. reported that T127I mutation did not change GGH activity
(Chave, K. J. et al., 2003, id). Our findings by both biochemical
analysis and structure modeling reveal a significant influence of
the 452C>T SNP on GGH hydrolysis of the more pharmacologically
important long-chain polyglutamate substrate.
[0070] Human GGH contains an L-shaped catalytic cleft on the
surface, which comprises loops 74-79, 124-127 and strand .beta.9
168-173 with one end closed (cleft-head) and the other end open
(cleft-tail) (Li, H. et al., id). Subtracts interaction model
indicated p-aminobenzoyl group of MTX-PG.sub.5 was stacked in the
patch of hydrophobic residues around Leu125 and Trp173. The
substitution of Thy127 by Ile narrows the open end of the
cleft-tail by changing the side chain orientation of Cys124 and
Leu125, reducing the gap between Leu125 and Trp173 to 7 .ANG. in
the T127I variant. The binding free energy of MTX-PG.sub.5 with
T127I variant was increased by 36.8%. Enzyme kinetic analysis
revealed a significantly higher K.sub.m (2.7-fold) and lower
catalytic efficiency (V.sub.max/K.sub.m reduced 67.5%) of T127I
recombinant GGH when MTX-PG.sub.5 was used as a substrate. With
only two glutamate residues, the pteroyl group of MTX-PG.sub.2 was
placed into the tail pocket. The T127I mutation did not
significantly change K.sub.m or catalytic efficiency when short
chain MTX-PG (MTX-PG.sub.2) was used as a substrate. These data
establish that the functional consequences of the 452C>T genetic
polymorphism in human GGH is substrate specific, having a greater
effect on the more active long-chain MTX-PG.
[0071] The identification of a single nucleotide polymorphism that
alters the function of human GGH and the disposition of
methotrexate in leukemia cells in vivo, represents a new genetic
polymorphism that alters drug disposition and effects in humans
(Evans, W. E. et al., "Pharmacogenomics--drug disposition, drug
targets, and side effects" N Engl J Med 348: 538-549 (2003); Evans,
W. E. et al., "Pharmacogenomics: translating functional genomics
into rational therapeutics" Science 286:487-491 (1999)).
Differences in the pharmacokinetics and pharmacodynamics of ALL
chemotherapy contribute to inter-individual differences in drug
effects (Brenner, T. et al., "Pharmacogenomics of childhood acute
lymphoblastic leukemia" Curr Opin Mol Ther 6:567-578 (2002)) Which
can alter treatment outcome (Pui, C. H. et al., 1998, id) and may
also contribute to racial differences in treatment response (Pui,
C. H. et al., "Results of therapy for acute lymphoblastic leukemia
in black and white children" JAMA 290: 2001-2007 (2003);
Kadan-Lottick, N. S. et al., "Survival variability by race and
ethnicity in childhood acute lymphoblastic leukemia" JAMA 290:
2008-2014 (2003)). The frequency of the 452C>T(T127I) SNP was
estimated to be 10.0% (95% CI: 6.7-13.3; n=155) among Caucasians,
and 4.4% (95% CI: 1.2-7.5%; n=80) among African-Americans in our
study. Thus, this GGH SNP is a relatively common genetic
polymorphism with functional consequences that may contribute to
inter-individual differences in the disposition and effects of MTX,
which may extend to a wide spectrum of malignant and non-malignant
diseases for which MTX is given. Because GGH catalyzes the
hydrolysis of normal folate polyglutamates, in addition to
antifolate polyglutamates, it may have functional consequences for
folate homeostasis as well. The fact that this SNP significantly
lowers but does not abolish GGH activity, likely means that this
SNP will have its most pronounced effects on MTX disposition and
effects in patients who have inherited non-functional hypomorphic
variants of other genes involved in MTX disposition or folate
homeostasis.
[0072] Indeed, genetic polymorphisms have been found in several
genes involved in the pharmacokinetics or pharmacodynamics of MTX,
but this is the first functional polymorphism reported for GGH. For
example, a SNP (80G>A, H27R) in the human reduced folate carrier
(RFC), the major transporter of MTX into cells, has been associated
with higher MTX plasma concentrations in children with ALL and with
a worse prognosis (Laverdiere, C. et al., "Polymorphism G80A in the
reduced folate carrier gene and its relationship to methotrexate
plasma levels and outcome of childhood acute lymphoblastic
leukemia" Blood 100:3832-3834 (2002)). The frequency of the
80G>A SNP was approximately 58% in genomic DNA from individuals
with and without leukemia (Laverdierre, C. et al., id). However, in
vitro assays did not reveal any functional changes in MTX transport
associated with the RFC 80G>A SNP (Whetstine, J. R. et al.,
"Single nucleotide polymorphisms in the human reduced folate
carrier: characterization of a high-frequency G/A variant at
position 80 and transport properties of the His(27) and Arg(27)
carriers" Clin Cancer Res 7:3416-3422 (2001)); so the mechanism of
this association is not known. Two SNPs have been identified in the
human methylenetetrahydrofolate reductase (MTHFR) gene, and linked
to differences in either the toxicity or efficacy of methotrexate
in patients with rheumatoid arthritis (Urano, W. et al.,
"Polymorphisms in the methylenetetrahydrofolate reductase gene were
associated with both the efficacy and the toxicity of methotrexate
used for the treatment of rheumatoid arthritis, as evidenced by
single locus and haplotype analyses" Pharmacogenetics 12:183-190
(2002)). SNP 677C>T (A222V) renders the MTHFR enzyme more
thermolabile (Frosst, P. et al., "A candidate genetic risk factor
for vascular disease: a common mutation in
methylenetetrahydrofolate reductase" Nat Genet 10:111-113 (1995)),
and is associated with lower cellular pools of
methyltetrahydrofolate (Bagley, P. J. et al., "A common mutation in
the methylenetetrahydrofolate reductase gene is associated with an
accumulation of formylated tetrahydrofolates in red blood cells"
Proc Natl Acad Sci USA 95:13217-13220 (1998)). This SNP has been
associated with increased toxicity from low-dose MTX (Urano, W. et
al., id; Weisberg, I. et al., "A second genetic polymorphism in
methylenetetrahydrofolate reductase (MTHFR) associated with
decreased enzyme activity" Mol Genet Metab 64:169-172 (1998);
Ulrich, C. M. et al., "Pharmacogenetics of methotrexate: toxicity
among marrow transplantation patients varies with the
methylenetetrahydrofolate reductase C677T polymorphism" Blood
98:231-234 (2001)), but has not been associated with increased
toxicity when leucovorin (reduced folate) is given after high-dose
MTX (Evans, W. E., "Differing effects of methylenetetrahydrofolate
reductase single nucleotide polymorphisms on methotrexate efficacy
and toxicity in rheumatoid arthritis" Pharmacogenetics 12:181-182
(2002)). Another MTHFR SNP (1298 A>C, E429A) leads to reduced
enzyme activity (van der Put, N. M. et al., "A second common
mutation in the methylenetetrahydrofolate reductase gene: an
additional risk factor for neural-tube defects?" Am J Hum Genet 62:
1044-1051 (1998)), and has been associated with better efficacy in
rheumatoid arthritis patients treated with low-dose MTX (Urano, W.,
et al., id). A tandem-repeat polymorphism in thymidylate synthase
(TS) promoter has been linked to interindividual variability in
response to MTX, patients homozygous for a triple repeat are
reported to have increased expression of TS and a worse reponse to
high-dose MTX (Krajinovic, M. et al., "Polymorphism of the
thymidylate synthase gene and outcome of acute lymphoblastic
leukaemia" Lancet 359: 1033-1034 (2002)). A G>C SNP in the
second of three tandem-repeats has been shown to abolish the
increased expression of TS (Mandola, M. V. et al., "A novel single
nucleotide polymorphism within the 5' tandem repeat polymorphism of
the thymidylate synthase gene abolishes USF-1 binding and alters
transcriptional activity" Cancer Res 63: 2898-2904 (2003)). These
findings point to the potential of polygenic studies to reveal more
robust and predictive pharmacogenetic models of MTX effects.
[0073] It is known that MTX-PG accumulation in leukemia cells
differs by ALL lineage (B versus T lineage) and ploidy (.ltoreq.50
versus >50 chromosomes). T-lineage ALL accumulates lower MTXPG
than B-lineage ALL, in part because of lower expression of
folylpolyglutamate synthetase in T-ALL (Barredo, J. C. et al., id),
whereas hyper-diploid B-lineage ALL exhibits higher MTX-PG
accumulation than non-hyperdiploid B-lineage ALL due to higher
expression of the reduced folate carrier (Belkov, V. M. et al.,
id). However, as documented in the current study and others
(Synold, T. W. et al., id), there is substantial heterogeneity
within each of these ALL subtypes in the accumulation of MTX-PG
after uniform HDMTX therapy. Our current findings indicate that
some of the unexplained variability in MTX-PG accumulation can be
accounted for by differences in GGH-catalyzed degradation of MTX-PG
in ALL cells, which is related in part to a common genetic
polymorphism that causes low GGH catalytic activity. This
previously unrecognized genetic determinant of the inter-individual
differences in MTX disposition in ALL cells, provides new insights
into the pharmacogenomics of ALL treatment.
Various publications, patent applications and patents are cited
herein, the disclosures of which are incorporated by reference in
their entireties.
Sequence CWU 1
1
811280DNAHomo sapiensCDS(60)..(1016) 1tgccgcagcc cccgcccgcc
cgcagagctt ttgaaaggcg gcgggaggcg gcgagcgcc 59atg gcc agt ccg ggc
tgc ctg ctg tgc gtg ctg ggc ctg cta ctc tgc 107Met Ala Ser Pro Gly
Cys Leu Leu Cys Val Leu Gly Leu Leu Leu Cys1 5 10 15ggg gcg gcg agc
ctc gag ctg tct aga ccc cac ggc gac acc gcc aag 155Gly Ala Ala Ser
Leu Glu Leu Ser Arg Pro His Gly Asp Thr Ala Lys 20 25 30aag ccc atc
atc gga ata tta atg caa aaa tgc cgt aat aaa gtc atg 203Lys Pro Ile
Ile Gly Ile Leu Met Gln Lys Cys Arg Asn Lys Val Met 35 40 45aaa aac
tat gga aga tac tat att gct gcg tcc tat gta aag tac ttg 251Lys Asn
Tyr Gly Arg Tyr Tyr Ile Ala Ala Ser Tyr Val Lys Tyr Leu 50 55 60gag
tct gca ggt gcg aga gtt gta cca gta agg ctg gat ctt aca gag 299Glu
Ser Ala Gly Ala Arg Val Val Pro Val Arg Leu Asp Leu Thr Glu65 70 75
80aaa gac tat gaa ata ctt ttc aaa tct att aat gga atc ctt ttc cct
347Lys Asp Tyr Glu Ile Leu Phe Lys Ser Ile Asn Gly Ile Leu Phe Pro
85 90 95gga gga agt gtt gac ctc aga cgc tca gat tat gct aaa gtg gcc
aaa 395Gly Gly Ser Val Asp Leu Arg Arg Ser Asp Tyr Ala Lys Val Ala
Lys 100 105 110ata ttt tat aac ttg tcc ata cag agt ttt gat gat gga
gac tat ttt 443Ile Phe Tyr Asn Leu Ser Ile Gln Ser Phe Asp Asp Gly
Asp Tyr Phe 115 120 125cct gtg tgg ggc aca tgc ctt gga ttt gaa gag
ctt tca ctg ctg att 491Pro Val Trp Gly Thr Cys Leu Gly Phe Glu Glu
Leu Ser Leu Leu Ile 130 135 140agt gga gag tgc tta tta act gcc aca
gat act gtt gac gtg gca atg 539Ser Gly Glu Cys Leu Leu Thr Ala Thr
Asp Thr Val Asp Val Ala Met145 150 155 160ccg ctg aac ttc act gga
ggt caa ttg cac agc aga atg ttc cag aat 587Pro Leu Asn Phe Thr Gly
Gly Gln Leu His Ser Arg Met Phe Gln Asn 165 170 175ttt cct act gag
ttg ttg ctg tca tta gca gta gaa cct ctg act gcc 635Phe Pro Thr Glu
Leu Leu Leu Ser Leu Ala Val Glu Pro Leu Thr Ala 180 185 190aat ttc
cat aag tgg agc ctc tcc gtg aag aat ttt aca atg aat gaa 683Asn Phe
His Lys Trp Ser Leu Ser Val Lys Asn Phe Thr Met Asn Glu 195 200
205aag tta aag aag ttt ttc aat gtc tta act aca aat aca gat ggc aag
731Lys Leu Lys Lys Phe Phe Asn Val Leu Thr Thr Asn Thr Asp Gly Lys
210 215 220att gag ttt att tca aca atg gaa gga tat aag tat cca gta
tat ggt 779Ile Glu Phe Ile Ser Thr Met Glu Gly Tyr Lys Tyr Pro Val
Tyr Gly225 230 235 240gtc cag tgg cat cca gag aaa gca cct tat gag
tgg aag aat ttg gat 827Val Gln Trp His Pro Glu Lys Ala Pro Tyr Glu
Trp Lys Asn Leu Asp 245 250 255ggc att tcc cat gca cct aat gct gtg
aaa acc gca ttt tat tta gca 875Gly Ile Ser His Ala Pro Asn Ala Val
Lys Thr Ala Phe Tyr Leu Ala 260 265 270gag ttt ttt gtt aat gaa gct
cgg aaa aac aac cat cat ttt aaa tct 923Glu Phe Phe Val Asn Glu Ala
Arg Lys Asn Asn His His Phe Lys Ser 275 280 285gaa tct gaa gag gag
aaa gca ttg att tat cag ttc agt cca att tat 971Glu Ser Glu Glu Glu
Lys Ala Leu Ile Tyr Gln Phe Ser Pro Ile Tyr 290 295 300act gga aat
att tct tca ttt cag caa tgt tac ata ttt gat tga 1016Thr Gly Asn Ile
Ser Ser Phe Gln Gln Cys Tyr Ile Phe Asp305 310 315aagtcttcaa
tttgttaaca gagcaaattt gaataattcc atgattaaac tgttagaata
1076acttgctact catggcaaga ttaggaagtc acagattctt ttctataatg
tgcctggctc 1136tgattcttca ttatgtatgt gactatttat ataacattag
ataattaaat agtgagacat 1196aaatagagtg ctttttcatg gaaaagcctt
cttatatctg aagattgaaa aataaattta 1256ctgaaataca aaaaaaaaaa aaaa
12802318PRTHomo sapiens 2Met Ala Ser Pro Gly Cys Leu Leu Cys Val
Leu Gly Leu Leu Leu Cys1 5 10 15Gly Ala Ala Ser Leu Glu Leu Ser Arg
Pro His Gly Asp Thr Ala Lys 20 25 30Lys Pro Ile Ile Gly Ile Leu Met
Gln Lys Cys Arg Asn Lys Val Met 35 40 45Lys Asn Tyr Gly Arg Tyr Tyr
Ile Ala Ala Ser Tyr Val Lys Tyr Leu 50 55 60Glu Ser Ala Gly Ala Arg
Val Val Pro Val Arg Leu Asp Leu Thr Glu65 70 75 80Lys Asp Tyr Glu
Ile Leu Phe Lys Ser Ile Asn Gly Ile Leu Phe Pro 85 90 95Gly Gly Ser
Val Asp Leu Arg Arg Ser Asp Tyr Ala Lys Val Ala Lys 100 105 110Ile
Phe Tyr Asn Leu Ser Ile Gln Ser Phe Asp Asp Gly Asp Tyr Phe 115 120
125Pro Val Trp Gly Thr Cys Leu Gly Phe Glu Glu Leu Ser Leu Leu Ile
130 135 140Ser Gly Glu Cys Leu Leu Thr Ala Thr Asp Thr Val Asp Val
Ala Met145 150 155 160Pro Leu Asn Phe Thr Gly Gly Gln Leu His Ser
Arg Met Phe Gln Asn 165 170 175Phe Pro Thr Glu Leu Leu Leu Ser Leu
Ala Val Glu Pro Leu Thr Ala 180 185 190Asn Phe His Lys Trp Ser Leu
Ser Val Lys Asn Phe Thr Met Asn Glu 195 200 205Lys Leu Lys Lys Phe
Phe Asn Val Leu Thr Thr Asn Thr Asp Gly Lys 210 215 220Ile Glu Phe
Ile Ser Thr Met Glu Gly Tyr Lys Tyr Pro Val Tyr Gly225 230 235
240Val Gln Trp His Pro Glu Lys Ala Pro Tyr Glu Trp Lys Asn Leu Asp
245 250 255Gly Ile Ser His Ala Pro Asn Ala Val Lys Thr Ala Phe Tyr
Leu Ala 260 265 270Glu Phe Phe Val Asn Glu Ala Arg Lys Asn Asn His
His Phe Lys Ser 275 280 285Glu Ser Glu Glu Glu Lys Ala Leu Ile Tyr
Gln Phe Ser Pro Ile Tyr 290 295 300Thr Gly Asn Ile Ser Ser Phe Gln
Gln Cys Tyr Ile Phe Asp305 310 315325DNAHomo sapiens 3tgttttctgt
gtgtgtatgg gtcgg 25425DNAHomo sapiensmisc_featureOligo 4tgctacttac
taatcctgcc cagca 25522DNAHomo sapiensmisc_featureOligo 5tgttttccag
cctgtgtggg ag 22624DNAHomo sapiensmisc_featureOligo 6ggatggtcat
tcacatcttc aacc 24738DNAHomo sapiens 7gtggagagtg cttattaatt
gccacagata ctgttgac 38838DNAHomo sapiens 8gtcaacagta tctgtggcaa
ttaataagca ctctccac 38
* * * * *
References