U.S. patent application number 12/783494 was filed with the patent office on 2010-11-18 for attenuated listeria spp. and methods for using the same.
Invention is credited to IAN GLOMSKI, MARY O'RIORDAN, DANIEL A. PORTNOY.
Application Number | 20100291149 12/783494 |
Document ID | / |
Family ID | 29712144 |
Filed Date | 2010-11-18 |
United States Patent
Application |
20100291149 |
Kind Code |
A1 |
PORTNOY; DANIEL A. ; et
al. |
November 18, 2010 |
ATTENUATED LISTERIA SPP. AND METHODS FOR USING THE SAME
Abstract
Attenuated Listeria bacteria are provided. The subject bacteria
are characterized by having a mutation in a gene chosen from the
lplA gene and the hly gene. The subject bacteria find use in a
variety of applications, where representative applications of
interest include, but are not limited to: (a) use of the subject
bacteria as adjuvants; (b) use of the subject bacteria as delivery
vectors for introducing macromolecules into a cell; (c) use of the
subject bacteria as vaccines for eliciting or boosting a cellular
immune response; etc.
Inventors: |
PORTNOY; DANIEL A.; (ALBANY,
CA) ; O'RIORDAN; MARY; (ALAMEDA, CA) ;
GLOMSKI; IAN; (BERKELEY, CA) |
Correspondence
Address: |
UC Berkeley - OTL;Bozicevic, Field & Francis LLP
1900 University Avenue, Suite 200
East Palo Alto
CA
94303
US
|
Family ID: |
29712144 |
Appl. No.: |
12/783494 |
Filed: |
May 19, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10449710 |
May 29, 2003 |
7794728 |
|
|
12783494 |
|
|
|
|
60385183 |
May 29, 2002 |
|
|
|
Current U.S.
Class: |
424/234.1 ;
435/252.1; 435/252.3 |
Current CPC
Class: |
A61P 15/06 20180101;
A61K 2039/522 20130101; A61P 25/00 20180101; C12N 1/20 20130101;
C07K 14/195 20130101; A61K 2039/523 20130101; A61P 37/04 20180101;
A61P 31/04 20180101 |
Class at
Publication: |
424/234.1 ;
435/252.1; 435/252.3 |
International
Class: |
A61K 39/02 20060101
A61K039/02; C12N 1/20 20060101 C12N001/20; C12N 1/21 20060101
C12N001/21; A61P 37/04 20060101 A61P037/04; A61P 31/04 20060101
A61P031/04 |
Goverment Interests
ACKNOWLEDGMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with Government support under Grant
Nos. AI29619 and AI27655 awarded by the National Institute of
Health. The Government has certain rights in this invention.
Claims
1. An attenuated Listeria bacterium having a mutation in a gene
chosen from the lplA gene and/or the hly gene, wherein when said
mutation is in said hly gene, said mutation is not a deletion
mutation that removes said hly gene's entire PEST-like sequence
coding domain.
2. The attenuated Listeria bacterium according to claim 1, wherein
said bacterium comprises a mutation in said hly gene.
3. The attenuated Listeria bacterium according to claim 2, wherein
said mutated hly gene encodes an LLO product that is more hemolytic
than wild-type LLO.
4-6. (canceled)
7. The attenuated Listeria bacterium according to claim 2, where
said mutated hly gene comprises point mutation in said hly gene's
PEST-like sequence coding domain.
8-10. (canceled)
11. The attenuated Listeria bacterium according to claim 1, wherein
said bacterium comprises a mutation in said lplA gene.
12-14. (canceled)
15. The attenuated Listeria bacterium according to claim 1, wherein
said bacterium comprises a heterologous nucleic acid.
16. (canceled)
17. The attenuated Listeria bacterium according to claim 15,
wherein said heterologous nucleic acid encodes at least one
product.
18. The attenuated Listeria bacterium according to claim 17,
wherein said at least one product is an antigen.
19. A vaccine comprising attenuated Listeria bacteria having a
mutation in a gene chosen from the lplA gene and/or the hly
gene.
20. The vaccine according to claim 19, wherein said mutation is in
said hly gene.
21. The vaccine according to claim 20, wherein said mutated hly
gene encodes an LLO product that is more hemolytic than wild-type
LLO.
22-24. (canceled)
25. The vaccine according to claim 20, where said mutated hly gene
comprises point mutation in said hly gene's PEST-like sequence
coding domain.
26-28. (canceled)
29. The vaccine according to claim 19, wherein said mutation is in
said lplA gene.
30-31. (canceled)
32. The vaccine according to claim 19, wherein said bacteria are
Listeria monocytogenes.
33. (canceled)
34. A method of eliciting or boosting a cellular immune response in
a subject to an antigen, said method comprising: administering to
said subject an effective amount of said antigen in conjunction
with attenuated Listeria bacteria, wherein said attenuated Listeria
bacteria has a mutation in a gene chosen from the lplA gene and/or
the hly gene.
35. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority (pursuant to 35 U.S.C.
.sctn.119 (e)) to the filing date of the U.S. Provisional Patent
Application Ser. No. 60/385,183 filed May 29, 2002; the disclosure
of which is herein incorporated by reference.
INTRODUCTION
[0003] 1. Field of the Invention
[0004] The field of this invention is Listeria species, e.g.,
Listeria monocytogenes, particularly recombinant strains of
Listeria species, and methods for their construction and use.
[0005] 2. Background of the Invention
[0006] The use of vaccines is a cost-effective medical tool for the
management of infectious diseases, including infectious diseases
caused by bacteria, viruses, parasites, and fungi. In addition to
effecting protection against infectious diseases, effort is also
being expended to develop vaccines that stimulate the host's immune
system to intervene in tumor growth.
[0007] Host immune responses include both the humoral immune
response involving antibody production and the cell-mediated immune
response. Protective immunization via vaccine has usually been
designed to induce the formation of humoral antibodies directed
against infectious agents, tumor cells, or the action of toxins.
However, the control of certain diseases characterized by the
presence of tumor cells or by chronic infection of cells with
infectious agents, often requires a cell-mediated immune response
either in place of, or in addition to the generation of antibody.
While the humoral immune response may be induced using live
infectious agents and agents that have been inactivated, a cellular
immune response is most effectively induced through the use of live
agents as vaccines. Such live agents include live infectious agents
which may gain access to the cytoplasm of host cells where the
proteins encoded by these agents are processed into epitopes which
when presented to the cellular immune system, induce a protective
response.
[0008] Microorganisms, particularly Salmonella and Shigella, which
have been attenuated using a variety of mechanisms have been
examined for their ability to encode and express heterologous
antigens. Such bacteria may be useful as live attenuated bacterial
vaccines which serve to induce a cellular immune response directed
against a desired heterologous antigen.
[0009] Listeria monocytogenes is a Gram-positive, food-borne human
and animal pathogen responsible for serious infections in
immunocompromised individuals and pregnant women. Severe L.
monocytogenes infections in humans are characterized by meningitis,
meningoencephalitis, septicemia, and fetal death. L. monocytogenes
is ubiquitous in nature and, in addition, can be isolated from a
wide variety of warm-blooded animals. L. monocytogenes elicits a
predominantly cellular immune response when inoculated into an
animal.
[0010] As such, L. monocytogenes has been employed as a vector for
a variety of different applications. When used as a vector for the
transmission of genes encoding heterologous antigens derived from
infectious agents or derived from tumor cells, recombinant Listeria
encoding and expressing an appropriate heterologous antigen have
been shown to successfully protect mice against challenge by
lymphocytic choriomeningitis virus (Shen et al., 1995, Proc. Natl.
Acad. Sci. USA 92:3987-3991; Goossens et al., 1995, Int. Immunol.
7:797-802) and influenza virus (Ikonomidis et al., 1997, Vaccine
15:433-440). Furthermore, model tumor antigen-expressing
recombinant Listeria have been used to protect mice against lethal
tumor cell challenge (Pan et al., 1995, Nat. Med. 1:471-477;
Paterson and Ikonomidis, 1996, Curr. Opin. Immunol. 8:664-669, Gunn
et al., 2001 J. Immunol. 167:6471-6479). In addition, it is known
that a strong cell-mediated immune response directed against HIV-1
gag protein may be induced in mice infected with a recombinant L.
monocytogenes comprising HIV-1 gag (Frankel et al., 1995, J.
Immunol. 155:4775-4782, Friedman et al., 2000 J. Virol.
74:9987-9993).
[0011] As demonstrated in a significant body of published
literature (ibid) related to the application of Listeria as a
vaccine vector for the prevention and treatment of infectious
disease and cancer, this bacterial-based vector has significant
advantages over other recombinant vaccine delivery systems.
However, safety concerns regarding the use in vivo of this
bacterial vaccine vector remain an important issue. The use of the
most common wild-type strain of Listeria, L. monocytogenes, can be
accompanied by severe side effects, including the development of
listeriosis in the inoculated animal. This disease, which is
normally food-borne, is characterized by meningitis, septicemia,
abortion and often a high rate of mortality in infected
individuals. While natural infections by L. monocytogenes are
fairly rare and may be readily controlled by a number of
antibiotics, the organism may nevertheless be a serious threat in
immunocompromised or pregnant patients.
[0012] Thus, for broad application to vaccines against infectious
and malignant disease, there is an essential requirement for the
development of attenuated strains of L. monocytogenes.
RELEVANT LITERATURE
[0013] Patents and published patent applications of interest
include: U.S. Pat. Nos. 4,816,253; 5,830,702; 6,051,237 and
6,099,848; as well as published PCT application serial no.: WO
99/25376 and WO 00/09733.
SUMMARY OF THE INVENTION
[0014] Attenuated Listeria bacteria are provided. The subject
bacteria are characterized by having a mutation in a gene chosen
from the lplA gene and the hly gene. The subject bacteria find use
in a variety of applications, where representative applications of
interest include, but are not limited to: (a) use of the subject
bacteria as adjuvants; (b) use of the subject bacteria as delivery
vectors for introducing macromolecules into a cell; (c) use of the
subject bacteria as vaccines for eliciting or boosting a cellular
immune response; etc.
BRIEF DESCRIPTION OF THE FIGURES
[0015] FIGS. 1A and 1B. The LLO Mutants Permeabilize the Plasma
Membrane C57BL/6 bone-marrow-derived macrophages were infected for
4 hours without gentamicin then stained with the membrane
impermeant dye propidium iodide, which increases fluorescence when
it passes through the membrane and interacts with host DNA.
2.5.times.10.sup.4 cells were examined by flow cytometry, half of
which are displayed. The gray-shaded histogram represents
uninfected cells. The fluorescence range of cells scored as
permeabilized, indicated by the marker M1, was defined by adding
10.sup.6 hemolytic units of purified LLO L461T to the macrophages,
and displayed in 1A. The infecting strain and the percentage of
cells falling within marker M1 are indicated.
[0016] FIGS. 2A-2F. Growth of the Cytotoxic Mutants in J774
macrophage-like cells and C57BL/6 Mice. 2A) Colony forming units
found within a monolayer of J774 cells on a 12 mm glass coverslip,
at the indicated time, in the presence of the extracellular
antibiotic gentamicin added 1 hour post-infection. Data represents
the mean values derived from 3 coverslips. 2B) Colony forming units
found within a monolayer of J774 cells on a 12 mm glass coverslip,
at the indicated time, with gentamicin treatment from 1 hour to 2
hours post-infection. Data represents the mean values derived from
3 coverslips.
[0017] FIG. 3. The Greater the Cytotoxicity, the Less the Cytotoxic
Bacteria Grow in the Mouse. 1.times.10.sup.5 CFU of each strain was
injected into the tail vein of C57BL/6 mice. After 24 hours the
liver and spleen were removed, homogenized, and plated to determine
CFU in each organ. Error bars indicate standard deviation from five
mice.
[0018] FIGS. 4A-4C. The Greater the Cytotoxicity, the Greater the
Virulence Defect. A competitive index was established by injecting
both wild-type bacteria and erythromycin-resistance-marked mutants
into C57BL/6 mouse tail-veins. Competitive Index ratios were
established in the spleen and liver by competing 4A) wild-type
versus LLO L461T Erm, 4B) wild-type versus LLO S44A Erm, and 4C)
wild-type versus LLO S44A L461T Erm. The y-axis indicates the ratio
of the number of mutant CFU divided by the CFU of wild-type
bacteria isolated from the spleen or liver of mice at the indicated
time points on a log scale. Therefore, the nearer the bottom of the
graph, the fewer mutant bacteria were retrieved from the mouse
relative to the wild-type CFU. The ratio from each mouse is
indicated with a single marker for each the spleen and liver. The
"+RB6" mice were injected with the neutrophil depleting monoclonal
antibody RB6-8C5 6 hours before infection with L. monocytogenes
(Conlan and North, 1994). The bold horizontal line indicates a
competitive index of 1.
[0019] FIGS. 5A & 5B. Cytotoxic mutants are more sensitive to
Gentamicin. 5A) 1.times.10.sup.5 CFU wild-type bacteria were
injected into the tail vein of C57BL/6 mice. 1 mg of gentamicin was
injected subcutaneously, and at the indicated time the liver and
spleen were removed, homogenized, and plated to determine CFU in
each organ. Error bars indicate standard deviation from a minimum
of 7 mice. 5B) Competitive indexes were established at 48 hours as
described in FIG. 4. Data points labeled as "+RB6 gent" were
injected with RB6-8C5 monoclonal antibodies 6 hours pre-infection
as well as 1 mg gentamicin sulfate subcutaneously 6 hours before
organ harvesting. SALT indicates data from the LLO S44A L461T
strain.
[0020] FIGS. 6A & 6B. The Virulence Defect is not Due to
Defects in Cell-to-Cell Spread. Competitive indexes were performed
as described in FIG. 4. For data sets indicated by ".DELTA.ActA",
all strains including the reference strain, secreting wild-type
LLO, contained an in-frame deletion in actA that eliminated
actin-based motility. 6A) "24 hr" and "48 hr" indicate the time of
organ harvest. The data points represent the ratio of
erythromycin-resistant LLO L461T bacteria divided by the CFU of
wild-type bacteria in the spleen and liver. "24 hr .DELTA.ActA" and
"48 hr .DELTA.ActA" indicate the time of organ harvest and the
ratio of erythromycin resistant .DELTA.ActA LLO L461T bacteria
divided by wild-type LLO secreting bacteria without the ActA gene,
recovered from the spleen and liver. 6B) Competitive index ratios
established similar to A), but using LLO S44A erythromycin
resistant mutants.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS
[0021] Attenuated Listeria bacteria are provided. The subject
bacteria are characterized by having a mutation in a gene chosen
from the lplA gene and the hly gene. The subject bacteria find use
in a variety of applications, where representative applications of
interest include, but are not limited to: (a) use of the subject
bacteria as adjuvants; (b) use of the subject bacteria as delivery
vectors for introducing macromolecules into a cell; (c) use of the
subject bacteria as vaccines for eliciting or boosting an
antigen-specific humoral or cellular immune response; etc.
[0022] Before the subject invention is described further, it is to
be understood that the invention is not limited to the particular
embodiments of the invention described below, as variations of the
particular embodiments may be made and still fall within the scope
of the appended claims. It is also to be understood that the
terminology employed is for the purpose of describing particular
embodiments, and is not intended to be limiting. Instead, the scope
of the present invention will be established by the appended
claims.
[0023] In this specification and the appended claims, the singular
forms "a," "an" and "the" include plural reference unless the
context clearly dictates otherwise. Unless defined otherwise, all
technical and scientific terms used herein have the same meaning as
commonly understood to one of ordinary skill in the art to which
this invention belongs.
[0024] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range, and any other stated or intervening
value in that stated range, is encompassed within the invention.
The upper and lower limits of these smaller ranges may
independently be included in the smaller ranges, and are also
encompassed within the invention, subject to any specifically
excluded limit in the stated range. Where the stated range includes
one or both of the limits, ranges excluding either or both of those
included limits are also included in the invention.
[0025] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood to one of
ordinary skill in the art to which this invention belongs. Although
any methods, devices and materials similar or equivalent to those
described herein can be used in the practice or testing of the
invention, the preferred methods, devices and materials are now
described.
[0026] All publications mentioned herein are incorporated herein by
reference for the purpose of describing various invention
components that are described in the publications that might be
used in connection with the presently described invention.
[0027] In further describing the subject invention, the subject
attenuated bacteria are reviewed first in greater detail, followed
by a review of representative applications in which the subject
vectors and methods find use.
Attenuated Listeria Bacteria
[0028] As summarized above, the subject invention provides
attenuated Listeria bacteria. The term "attenuated," as used
herein, describes the diminution in the ability of the subject
bacteria to cause disease in an animal as a whole, e.g., as
measured by the LD.sub.50 of the bacteria, as described below. More
specifically, the pathogenic characteristics of the attenuated
Listeria strain, as viewed from the vantage of the host animal as a
whole (as opposed to a cell based perspective) have been lessened
compared with wild-type Listeria, although the attenuated Listeria
is capable of growth and maintenance in culture. In certain
embodiments, bacteria are considered to be attenuated if, upon the
intravenous inoculation of Balb/c mice (as described in the
experimental section, below), the lethal dose at which 50% of
inoculated animals survive (LD.sub.50) is increased above the
LD.sub.50 of wild-type Listeria by at least about 10-fold, such as
by at least about 100-fold, including by at least about 1,000 fold,
where in certain embodiments the magnitude of increase is at least
about 10,000 fold, such as at least about 100,000-fold, as
determined using the assay employed in the experimental section
below. An attenuated strain of Listeria according to the subject
invention is thus one which does not kill an animal to which it is
administered, or is one which kills the animal only when the number
of bacteria administered is vastly greater than the number of wild
type non-attenuated bacteria which would be required to kill the
same animal.
[0029] In certain embodiments, attenuated species according to the
subject invention are ones that exhibit a decreased virulence
compared to their corresponding wild type strain in the Competitive
Index Assay as described in Auerbach et al., "Development of a
Competitive Index Assay To Evaluate the Virulence of Listeria
monocytogenes actA Mutants during Primary and Secondary Infection
of Mice," Infection and Immunity, September 2001, p. 5953-5957,
Vol. 69, No. 9. In this assay, mice are inoculated with test and
reference, e.g., wild-type, strains of bacteria. Following a period
of time, e.g., 48 to 60 hours, the inoculated mice are sacrificed
and one or more organs, e.g., liver, spleen, are evaluated for
bacterial abundance. In these embodiments, a given bacterial strain
is considered to be less virulent if its abundance in the spleen is
at least about 50-fold, or more, such as 70-fold or more less than
that observed with the corresponding wild-type strain, and/or its
abundance in the liver is at least about 10-fold less, or more,
such as 20-fold or more less than that observed with the
corresponding wild-type strain.
[0030] In yet other embodiments, bacteria are considered to be less
virulent if they show abortive replication in less than about 8
hours, such as less than about 6 hours, including less than about 4
hours, as determined using the assay described in Jones and
Portnoy, Intracellular growth of bacteria. (1994b) Methods Enzymol.
236:463-467. In yet other embodiments, bacteria are considered to
be attenuated or less virulent if, compared to wild-type, they form
smaller plaques in the plaque assay employed in the Experimental
Section, below, where cells, such as murine L2 cells, are grown to
confluency, e.g., in six-well tissue culture dishes, and then
infected with bacteria. Subsequently, DME-agar containing
gentamicin is added and plaques are grown for a period of time,
e.g., 3 days. Living cells are then visualized by adding an
additional DME-agar overlay, e.g., containing neutral red (GIBCO
BRL) and incubated overnight. In such an assay, the magnitude in
reduction in plaque size observed with the attenuated mutant as
compared to the wild-type is, in certain embodiments, 10%,
including 15%, such as 25% or more.
[0031] The subject bacteria may be any Listeria species that is
rendered attenuated according to the subject invention. Thus,
strains of Listeria other than L. monocytogenes may be used for the
generation of attenuated mutants according to the present
invention. In certain embodiments, the Listeria strain is L.
monocytogenes.
[0032] In certain embodiments, the subject bacteria are cytotoxic.
A particular strain of bacteria is considered to be cytotoxic if it
compromises its host cell in a period of less than about 8 hours,
sometimes less than about 6 hours, e.g., in less than about 5
hours, less than about 4 hours, less than about 3 hours, less than
about two hours, or less than about 1 hour, as determined using the
cytotoxicity assay described below. Representative cytotoxic
bacterial strains according to the subject invention include those
hly mutant stains described below.
[0033] In certain embodiments, the subject bacteria comprise a
mutated hly gene, by which is meant that the bacteria comprise an
hly gene where the coding sequence of the gene has been altered to
encode an LLO product whose amino acid sequence differs from wild
type LLO by at least one residue, e.g, by missing the at least one
residue, by having a substitute for at least one residue, etc. In
certain embodiments, the encoded product is a deletion mutant, by
which is meant that one or more residues found in the wild type
protein are absent or missing in the mutant polypeptide, where the
missing residues are not replaced by substitute residues. In other
embodiments, the encoded product is a point mutant, by which is
meant that one or more residues of the wild type protein, which may
or may not be adjacent to one another, are substituted with a
different residue.
[0034] In certain embodiments, the mutant hly gene is one that
encodes a mutant LLO product that has more hemolytic activity at
neutral pH than the wild type LLO protein, where the hemolyticity
is determined using the assay described in Glomski et al., J. Cell
Biol. (Mar. 18, 2002) 156:1029-1038 and the Experimental Section,
below. As measured by this assay, the encoded mutant LLO protein of
the bacteria of these embodiments is at least about 2-fold,
sometimes at least about 5-fold and sometimes at least about
10-fold more hemolytic than the wild type LLO protein. In certain
of these embodiments, the mutation of the hly gene is one that
encodes a point mutant product, such that one or more residues in
the encoded product differs from the corresponding residue in the
wild type protein. In certain of these embodiments, a residue
falling between 450 and 470, often between 455 and 465 is
substituted, where in certain embodiments the substituted residue
is residue 461. In these embodiments, the L at position 461 is
substituted with a non-L residue, where the substituting residue
may be T, N, Q, S etc, but is T in certain embodiments. In certain
embodiments, the mutation is found in domain 3, or a residue that
interacts with a residue in domain 3.
[0035] In certain embodiments, the mutant My gene includes a
mutation in the PEST-like sequence encoding domain of the gene. The
PEST-like sequence of the encoded product is found in the
N-terminal 75 residues of the LLO protein, and more specifically in
the N-terminal 60 residues of the LLO protein, and more precisely
between residues 34 and 59. The mutation of the PEST-like sequence
encoding domain may be one that encodes a deletion mutant product
or a point mutation product.
[0036] In certain embodiments, mutation of the PEST-like sequence
encoding domain is one that disrupts a potential mitogen activated,
protein kinase (MAPK) phosphorylation site within the PEST-like
sequence. In certain of these embodiments, the mutation is one that
encodes a point mutant at a residue from position 30 and 60. In
certain embodiments, the residue that is substituted in the encoded
mutant product is residue 44. In these certain embodiments, the S
at position 44 is substituted with a non-S residue, where the
substituting residue may be A, G, I, F, C, L, M, V, etc, but is A
in certain embodiments. In certain embodiments, the mutation is one
that provides for more of the protein being produced. As such, in
these embodiments there may not be a codon mutation that results in
an altered residue, such as S44A, but instead results in a codon
selection that provides for more RNA as compared to wildtype, and
therefore ultimately more protein.
[0037] In certain embodiments, the mutation of the PEST-like
sequence-encoding domain is one that provides for a deletion of at
least a portion of, if not all of, the residues that make up the
PEST-like sequence. Thus, the mutation may be a deletion of one or
more residues, including all of the residues, from about 30 to
about 60, e.g., a deletion of residues 34 to 59. In certain
embodiments, however, the attenuated bacteria of interest are not
bacteria in which the entire PEST-like sequence has been deleted
from the encoded LLO product, such as the bacteria reported in
Decatur et al., Science (2000) 290:992-995.
[0038] In certain embodiments, the subject attenuated bacteria have
only a single type of hly mutation, as described above. In yet
other embodiments, the bacteria have two or more of the specific
hly mutations, as described above.
[0039] Specific attenuated bacteria of interest that include a
mutated hly gene include, but are not limited to: DP-L4017;
DP-L4057, DP-L4384; DP-L4038 and DP-L4042, where these specific
strains are described below in greater detail. DP-L4017 and
DP-L4038 are deposited with the American Type Culture Collection
depository (10801 University Boulevard, Manassas, Va. 20110-2209)
and have been assigned ATCC accession nos. ______ and ______,
respectively.
[0040] In certain embodiments, the attenuated bacteria include a
mutated lplA gene, where the mutation is one that results in an
attenuated bacteria, as described above. In many embodiments, the
attenuated bacteria display no defects in vegetative growth under
typical Listeria culture conditions, but with the mutated lplA gene
exhibit abortive replication a certain period of time, e.g., 2
hours, usually 4 hours, following infection, as determined using an
assay to measure bacterial intracellular growth within infected
J774 macrophages (ATCC #), as described in Glomski et al., 2002 J.
Cell Biol. 156:1029-1038); and form smaller plaques than wild type
strains in an assay for growth and cell to cell spread in the
murine L2 cell line, as described in the Experimental Section,
infra, where the smaller plaques are typically at least about 50
fold smaller, sometimes at least about 100 fold smaller and
sometimes undetectable as compared to those produced by wild type
bacteria in the same assay.
[0041] In certain embodiments, the lplA mutation is a mutation that
results in an lplA gene that no longer encodes a product. In other
embodiments where the lplA mutated gene still encodes a product,
the encoded product is a deletion mutant, by which is meant that
one or more residues found in the wild type protein are absent or
missing in the mutant polypeptide. In certain embodiments, the
percentage of residues that are deleted may be 10, 20, 30, 40, 50,
60, 70, 80, or 90% by number or more of the residues. In other
embodiments, the encoded product is a point mutant, by which is
meant that one or more residues of the wild type protein, which may
or may not be adjacent to one another, are substituted with a
different residue.
[0042] A specific representative attenuated bacteria having a
mutated lplA gene is DP-L4364, as described in the Experimental
Section, below, in greater detail. DP-L4364 is deposited with the
American Type Culture Collection depository (10801 University
Boulevard, Manassas, Va. 20110-2209) and has been assigned ATCC
accession no. ______.
[0043] The above-attenuated bacteria may be fabricated using a
variety of different protocols. As such, generation of the subject
attenuated bacteria may be accomplished in a number of ways that
are well known to those of skill in the art, including deletion
mutagenesis, insertion mutagenesis, and mutagenesis which results
in the generation of frameshift mutations, mutations which effect
premature termination of a protein, or mutation of regulatory
sequences which affect gene expression. Mutagenesis can be
accomplished using recombinant DNA techniques or using traditional
mutagenesis technology using mutagenic chemicals or radiation and
subsequent selection of mutants. Representative protocols of
different ways to generate attenuated bacteria according to the
present invention are provided in the Experimental Section,
below.
[0044] In certain embodiments, attenuated bacteria according to the
subject invention express a heterologous antigen. The heterologous
antigen is, in certain embodiments, one that is capable of
providing protection in an animal against challenge by the
infectious agent from which the heterologous antigen was derived,
or which is capable of affecting tumor growth and metastasis in a
manner which is of benefit to a host organism. Heterologous
antigens which may be introduced into a Listeria strain of the
subject invention by way of DNA encoding the same thus include any
antigen which when expressed by Listeria serves to elicit a
cellular immune response which is of benefit to the host in which
the response is induced. Heterologous antigens therefore include
those specified by infectious agents, wherein an immune response
directed against the antigen serves to prevent or treat disease
caused by the agent. Such heterologous antigens include, but are
not limited to, viral, bacterial, fungal or parasite surface
proteins and any other proteins, glycoproteins, lipoprotein,
glycolipids, and the like. Heterologous antigens also include those
which provide benefit to a host organism which is at risk for
acquiring or which is diagnosed as having a tumor that expresses
the said heterologous antigen(s). The host organism is preferably a
mammal and most preferably, is a human.
[0045] By the term "heterologous antigen," as used herein, is meant
a protein or peptide, a glycoprotein or glycopeptide, a lipoprotein
or lipopeptide, or any other macromolecule which is not normally
expressed in Listeria, which substantially corresponds to the same
antigen in an infectious agent, a tumor cell or a tumor-related
protein. The heterologous antigen is expressed by a strain of
Listeria according to the subject invention, and is processed and
presented to cytotoxic T-cells upon infection of mammalian cells by
the strain. The heterologous antigen expressed by Listeria species
need not precisely match the corresponding unmodified antigen or
protein in the tumor cell or infectious agent so long as it results
in a T-cell response that recognizes the unmodified antigen or
protein which is naturally expressed in the mammal. In other
examples, the tumor cell antigen may be a mutant form of that which
is naturally expressed in the mammal, and the antigen expressed by
the Listeria species will conform to that tumor cell mutated
antigen. By the term "tumor-related antigen," as used herein, is
meant an antigen which affects tumor growth or metastasis in a host
organism. The tumor-related antigen may be an antigen expressed by
a tumor cell, or it may be an antigen which is expressed by a
non-tumor cell, but which when so expressed, promotes the growth or
metastasis of tumor cells. The types of tumor antigens and
tumor-related antigens which may be introduced into Listeria by way
of incorporating DNA encoding the same, include any known or
heretofore unknown tumor antigen. In other examples, the
"tumor-related antigen" has no effect on tumor growth or
metastasis, but is used as a component of the Listeria vaccine
because it is expressed specifically in the tissue (and tumor) from
which the tumor is derived. In still other examples, the
"tumor-related antigen" has no effect on tumor growth or
metastasis, but is used as a component of the Listeria vaccine
because it is selectively expressed in the tumor cell and not in
any other normal tissues.
[0046] The heterologous antigen useful in vaccine development may
be selected using knowledge available to the skilled artisan, and
many antigenic proteins which are expressed by tumor cells or which
affect tumor growth or metastasis or which are expressed by
infectious agents are currently known. For example, viral antigens
which may be considered as useful as heterologous antigens include
but are not limited to the nucleoprotein (NP) of influenza virus
and the gag protein of HIV. Other heterologous antigens include,
but are not limited to, HIV env protein or its component parts
gp120 and gp41, HIV nef protein, and the HIV pol proteins, reverse
transcriptase and protease. Still other heterologous antigens can
be those related to hepatitis C virus (HCV), including but not
limited to the E1 and E2 glycoproteins, as well as non-structural
(NS) proteins, for example NS3. In addition, other viral antigens
such as herpesvirus proteins may be useful. The heterologous
antigens need not be limited to being of viral origin. Parasitic
antigens, such as, for example, malarial antigens, are included, as
are fungal antigens, bacterial antigens and tumor antigens.
[0047] As noted herein, a number of proteins expressed by tumor
cells are also known and are of interest as heterologous antigens
which may be inserted into the vaccine strain of the invention.
These include, but are not limited to, the bcr/abl antigen in
leukemia, HPVE6 and E7 antigens of the oncogenic virus associated
with cervical cancer, the MAGE1 and MZ2-E antigens in or associated
with melanoma, and the MVC-1 and HER-2 antigens in or associated
with breast cancer. Other coding sequences of interest include, but
are not limited to: costimulatory molecules, immunoregulatory
molecules, and the like.
[0048] The introduction of DNA encoding a heterologous antigen into
a strain of Listeria may be accomplished, for example, by the
creation of a recombinant Listeria in which DNA encoding the
heterologous antigen is harbored on a vector, such as a plasmid for
example, which plasmid is maintained and expressed in the Listeria
species, and in whose antigen expression is under the control of
prokaryotic promoter/regulatory sequences. Alternatively, DNA
encoding the heterologous antigen may be stably integrated into the
Listeria chromosome by employing, for example, transposon
mutagenesis, homologous recombination, or integrase mediated
site-specific integration (as described in application Ser. No.
10/136,860, the disclosure of which is herein incorporated by
reference).
[0049] Several approaches may be employed to express the
heterologous antigen in Listeria species as will be understood by
one skilled in the art once armed with the present disclosure. In
certain embodiments, genes encoding heterologous antigens are
designed to either facilitate secretion of the heterologous antigen
from the bacterium or to facilitate expression of the heterologous
antigen on the Listeria cell surface.
[0050] In certain embodiments, a fusion protein which includes the
desired heterologous antigen and a secreted or cell surface protein
of Listeria is employed. Listerial proteins which are suitable
components of such fusion proteins include, but are not limited to,
listeriolysin O (LLO) and phosphatidylinositol-specific
phospholipase (PI-PLC). A fusion protein may be generated by
ligating the genes which encode each of the components of the
desired fusion protein, such that both genes are in frame with each
other. Thus, expression of the ligated genes results in a protein
comprising both the heterologous antigen and the listerial protein.
Expression of the ligated genes may be placed under the
transcriptional control of a listerial promoter/regulatory sequence
such that expression of the gene is effected during growth and
replication of the organism. Signal sequences for cell surface
expression and/or secretion of the fused protein may also be added
to genes encoding heterologous antigens in order to effect cell
surface expression and/or secretion of the fused protein. When the
heterologous antigen is used alone (i.e., in the absence of fused
Listeria sequences), it may be advantageous to fuse thereto signal
sequences for cell surface expression and/or secretion of the
heterologous antigen. The procedures for accomplishing this are
well know in the art of bacteriology and molecular biology.
[0051] The DNA encoding the heterologous antigen which is expressed
is, in many embodiments, preceded by a suitable promoter to
facilitate such expression. The appropriate promoter/regulatory and
signal sequences to be used will depend on the type of listerial
protein desired in the fusion protein and will be readily apparent
to those skilled in the art of Listeria molecular biology. For
example, preferred L. monocytogenes promoter/regulatory and/or
signal sequences which may be used to direct expression of a fusion
protein include, but are not limited to, sequences derived from the
Listeria hly gene which encodes LLO, the Listeria p60 (iap) gene,
and the Listeria actA gene which encodes a surface protein
necessary for L. monocytogenes actin assembly. Other promoter
sequences of interest include the plcA gene which encodes PI-PLC,
the Listeria mpl gene, which encodes a metalloprotease, and the
Listeria inlA gene which encodes internalin, a listeria membrane
protein. The heterologous regulatory elements such as promoters
derived from phage and promoters or signal sequences derived from
other bacterial species may be employed for the expression of a
heterologous antigen by the Listeria species.
[0052] In certain embodiments, the attenuated Listeria include a
vector. The vector may include DNA encoding a heterologous antigen.
Typically, the vector is a plasmid that is capable of replication
in Listeria. The vector may encode a heterologous antigen, wherein
expression of the antigen is under the control of eukaryotic
promoter/regulatory sequences, e.g., is present in an expression
cassette. Typical plasmids having suitable promoters that are of
interest include, but are not limited to, pCMVbeta comprising the
immediate early promoter/enhancer region of human cytomegalovirus,
and those which include the SV40 early promoter region or the mouse
mammary tumor virus LTR promoter region.
[0053] As such, in certain embodiments, the subject bacteria
include at least one coding sequence for heterologous
polypeptide/protein, as described above. In many embodiments, this
coding sequence is part of an expression cassette, which provides
for expression of the coding sequence in the Listeria cell for
which the vector is designed. The term "expression cassette" as
used herein refers to an expression module or expression construct
made up of a recombinant DNA molecule containing at least one
desired coding sequence and appropriate nucleic acid sequences
necessary for the expression of the operably linked coding sequence
in a particular host organism, i.e., the Listeria cell for which
the vector is designed, such as the promoter/regulatory/signal
sequences identified above, where the expression cassette may
include coding sequences for two or more different polypeptides, or
multiple copies of the same coding sequence, as desired. The size
of the coding sequence and/or expression cassette that includes the
same may vary, but typically falls within the range of about 25-30
to about 6000 bp, usually from about 50 to about 2000 bp. As such,
the size of the encoded product may vary greatly, and a broad
spectrum of different products may be encoded by the expression
cassettes present in the vectors of this embodiment.
[0054] As indicated above, the vector may include at least one
coding sequence, where in certain embodiments the vectors include
two or more coding sequences, where the coding sequences may encode
products that act concurrently to provide a desired results. In
general, the coding sequence may encode any of a number of
different products and may be of a variety of different sizes,
where the above discussion merely provides representative coding
sequences of interest.
Utility
[0055] The above-described attenuated bacteria find use in a number
of different applications. Representative uses of the subject
bacteria include, but are not limited to: (a) immunogens for
generating antibodies to Listeria spp.; (b) adjuvant compositions
in immunizing protocols; (c) vectors for introducing
macromolecules, e.g., nucleic acids or proteins, into the cytoplasm
of target cells; and (d) vaccine compositions, e.g., for eliciting
or boosting a cellular immune response in a host. Each of these
representative applications is now further described separately
below. Uses for attenuated Listeria spp. are also described in U.S.
Pat. No. 6,099,848; the disclosure of which is herein incorporated
by reference, where the subject attenuated bacteria find use in the
applications described in this U.S. patent.
Generation of Listeria Specific Antibodies
[0056] The subject attenuated bacteria find use in the generation
of antibodies specific for Listeria spp. In these applications, the
attenuated bacteria are administered to a suitable host according
to known techniques, and resultant antibodies are harvested from
the immunized host. Immunization can be carried out in a variety of
ways with a number of different animals. Host animals of interest
include rabbits, mice, rats, goats and sheep, etc. Any mammal
capable of immune response can be employed as the host animal in
antibody production. For the most part for commercial production of
antibodies, relatively large animals are employed, such as equine,
bovine, porcine, canine, ovine, caprine, rodentia, rabbits and
hares. A representative antibody production protocol in which the
subject attenuated bacteria may be employed includes the antibody
generation protocol as described in U.S. Pat. No. 4,816,253; the
disclosure of which is herein incorporated by reference.
Adjuvant Compositions
[0057] The subject attenuated bacterial strains also find use as
immunopotentiating agents, i.e., as adjuvants. In such
applications, the subject attenuated bacteria may be administered
in conjunction with an immunogen, e.g., a tumor antigen, modified
tumor cell, etc., according to methods known in the art where live
bacterial strains are employed as adjuvants. See, e.g., Berd et
al., Vaccine 2001 Mar. 21; 19(17-19):2565-70.
[0058] In some embodiments, the attenuated bacterial strains are
employed as adjuvants by chemically coupled to a sensitizing
antigen. The sensitizing antigen can be any antigen of interest,
where representative antigens of interest include, but are not
limited to: viral agents, e.g., Herpes simplex virus; malaria
parasite; bacteria, e.g., staphylococcus aureus bacteria,
diphtheria toxoid, tetanus toxoid, shistosomula; tumor cells, e.g.
CAD.sub.2 mammary adenocarcinomia tumor cells, and hormones such as
thyroxine T.sub.4, triiiodothyronine T.sub.3, and cortisol. The
coupling of the sensitizing antigen to the immunopotentiating agent
can be accomplished by means of various chemical agents having two
reactive sites such as, for example, bisdiazobenzidine,
glutaraldehyde, di-iodoacetate, and diisocyanates, e.g.,
m-xylenediisocyanate and toluene-2,4-diisocyanate. Use of Listeria
spp. as adjuvants is further described in U.S. Pat. No. 4,816,253;
the disclosure of which is herein incorporated by reference.
Delivery Vehicles
[0059] The subject attenuated bacteria also find use as vectors or
delivery vehicles for delivery of macromolecules into target cells,
e.g., as described in: PCT publication no. WO 00/09733 (the
priority application of which is herein incorporated by reference);
and Dietrich et al., Nature Biotechnology (1998) 16: 181-185. A
variety of different types of macromolecules may be delivered,
including, but not limited to: nucleic acids,
polypeptides/proteins, etc., as described in these
publications.
Vaccines
[0060] The subject attenuated bacteria also find use as vaccines.
The vaccines of the present invention are administered to a
vertebrate by contacting the vertebrate with a sublethal dose of
the attenuated Listeria vaccine, where contact typically includes
administering the vaccine to the host. In many embodiments, the
attenuated bacteria are provided in a pharmaceutically acceptable
formulation. Administration can be oral, parenteral, intranasal,
intramuscular, intradermal, intraperitoneal, intravascular,
subcutaneous, direct vaccination of lymph nodes, administration by
catheter or any one or more of a variety of well-known
administration routes. In farm animals, for example, the vaccine
may be administered orally by incorporation of the vaccine in feed
or liquid (such as water). It may be supplied as a lyophilized
powder, as a frozen formulation or as a component of a capsule, or
any other convenient, pharmaceutically acceptable formulation that
preserves the antigenicity of the vaccine. Any one of a number of
well known pharmaceutically acceptable diluents or excipients may
be employed in the vaccines of the invention. Suitable diluents
include, for example, sterile, distilled water, saline, phosphate
buffered solution, and the like. The amount of the diluent may vary
widely, as those skilled in the art will recognize. Suitable
excipients are also well known to those skilled in the art and may
be selected, for example, from A. Wade and P. J. Weller, eds.,
Handbook of Pharmaceutical Excipients (1994) The Pharmaceutical
Press: London. The dosage administered may be dependent upon the
age, health and weight of the patient, the type of patient, and the
existence of concurrent treatment, if any. The vaccines can be
employed in dosage forms such as capsules, liquid solutions,
suspensions, or elixirs, for oral administration, or sterile liquid
for formulations such as solutions or suspensions for parenteral,
intranasal intramuscular, or intravascular use. In accordance with
the invention, the vaccine may be employed, in combination with a
pharmaceutically acceptable diluent, as a vaccine composition,
useful in immunizing a patient against infection from a selected
organism or virus or with respect to a tumor, etc. Immunizing a
patient means providing the patient with at least some degree of
therapeutic or prophylactic immunity against selected pathogens,
cancerous cells, etc.
[0061] The subject vaccines find use in methods for eliciting or
boosting a cellular immune response, e.g., a helper T cell or a
cytotoxic T-cell response to a selected agent, e.g., pathogenic
organism, tumor, etc., in a vertebrate, where such methods include
administering an effective amount of the Listeria vaccine. The
subject vaccines find use in methods for eliciting in a vertebrate
an innate immune response that augments the antigen-specific immune
response. Furthermore, the vaccines of the present invention may be
used for treatment post-exposure or post diagnosis. In general, the
use of vaccines for post-exposure treatment would be recognized by
one skilled in the art, for example, in the treatment of rabies and
tetanus. The same vaccine of the present invention may be used, for
example, both for immunization and to boost immunity after
exposure. Alternatively, a different vaccine of the present
invention may be used for post-exposure treatment, for example,
such as one that is specific for antigens expressed in later stages
of exposure. As such, the subject vaccines prepared with the
subject vectors find use as both prophylactic and therapeutic
vaccines to induce immune responses that are specific for antigens
that are relevant to various disease conditions.
[0062] The patient may be any human and non-human animal
susceptible to infection with the selected organism. The subject
vaccines will find particular use with vertebrates such as man, and
with domestic animals. Domestic animals include domestic fowl,
bovine, porcine, ovine, equine, caprine, Leporidate (such as
rabbits), or other animal which may be held in captivity.
[0063] In general, the subject vaccines find use in vaccination
applications as described U.S. Pat. Nos. 5,830,702 and 6,051,237,
the disclosure of which is herein incorporated by reference; as
well as PCT publication no WO 99/25376, the disclosures of the
priority applications of which are herein incorporated by
reference.
[0064] The following examples are offered by way of illustration
and not by way of limitation.
EXPERIMENTAL
I. Generation and Characterization of DP-L4017
A. Materials and Methods
1. Bacterial Strains, Growth Conditions, and Reagents
[0065] The wild-type L. monocytogenes strain used for these studies
was 10403S. L. monocytogenes strains with deletions of actA were
constructed by allelic exchange as described previously (Skoble,
J., D. A. Portnoy, and M. D. Welch. 2000. Three regions within ActA
promote Arp2/3 complex-mediated actin nucleation and Listeria
monocytogenes motility. J. Cell Biol. 150:527-538.) The L.
monocytogenes strain with an in-frame deletion of PI-PLC
(.DELTA.plcA, or DP-L1552) and strain ActA GGG (DP-L4032) were
previously described (Camilli, A., L. G. Tilney, and D. A. Portnoy.
1993. Dual roles of plcA in Listeria monocytogenes pathogenesis.
Mol. Microbial. 8:143-157.; Skoble et al., 2002, supra). The
merodiploid hly strain (DP-L4076) will be published in a subsequent
manuscript (Lauer, P., M. Y. N. Chow, M. J. Loessner, D. A.
Portnoy, and R. Calendar. "Construction, characterization and use
of two Listeria monocytogenes site-specific integration vectors," J
Bacteriol. 2002 August; 184(15):4177-86.). E. coli strains
DH5.sub..alpha. (GIBCO BRL) or XL-1 Blue (Stratagene) were used for
cloning. E. coli strains BL21(DE3) or BL21(DE3)PlysS (Stratagene)
were used for expression of proteins from pET vectors.
[0066] L. monocytogenes was grown in 3 ml brain heart infusion
broth (BHI; Becton Dickinson) slanted without agitation in 15 ml
conical tubes at 30.degree. C. overnight, unless otherwise noted.
All E. coli strains were grown in Luria-Bertani broth (LB; Becton
Dickinson) at 37.degree. C. shaking, unless otherwise noted. All
tissue culture cells were grown in DME (GIBCO BRL), containing 7.5%
heat-deactivated FBS (Hy-Clone) and 2 mM glutamine (DME; GIBCO
BRL), at 37.degree. C. and 5% CO.sub.2, unless otherwise noted. All
chemicals were purchased from Sigma-Aldrich, unless otherwise
noted.
B. Sequences
[0067] The GenBank/EMBL/DDBJ accession nos. for the proteins
examined in this study are the following: LLO, M29030; PFO, M36704;
ivanolysin O, X60461; seeligeriolysin O, X60462; streptolysin O,
M18638; pneumolysin, X52474; cereolysin, D21270; alveolysin,
M62709; suilysin, Z36907; and pyolysin, U84782.
C. Cloning
1. Construction of the LLO Expression Vector
[0068] DNA and protein analysis was performed using MacVector
software (Genetics Computer Group). The region of hly coding for
mature LLO was amplified by PCR, with the primers and templates as
described in Table III using Vent polymerase (New England Biolabs,
Inc.) to introduce a six histidine tag. The amplified fragment was
then cut with restriction enzymes and ligated into pET29b
(Novagen). This plasmid and all other plasmids were initially
cloned in E. coli strain XL-1 Blue and then transferred into E.
coli expression strain BL21(DE3), unless otherwise noted, to yield
strain DP-3570.
TABLE-US-00001 TABLE III Sequence Con- Number 5'.fwdarw.3'
(including enzyme site).sup.a struct 3140
GGAATTCCATATGAAGGATGCATCTGCATTCAAT His-LLO, (Nde1) p3570 SEQ ID NO:
01 3232 CGGGATCCTTATTAGTGGTGGTGGTGGTGGTGTT His-LLO,
CGATTGGATTATCTAC (BamH1) p3570 SEQ ID NO: 02 3541
GGAATTCCCATGGGAAAGGATATAACAGATAAAA His-PFO, ATCA (Nco1) p4167 SEQ
ID NO: 03 3542 CGGGATCCTTATTAGTGGTGGTGGTGGTGGTGAT His-PFO,
TGTAAGTAATACTAGATCCA (BamH1) p4167 SEQ ID NO: 04 3543
ACGCGTCGACTTATTAGTGGTGGTGGTGG His-LLO (Sal1) (1-3) SEQ ID NO: 05
PF04 3575 GGAATTCCATATGAAGGATGCATCTGCA His-LLO (Nde1) (1-3) SEQ ID
NO: 06 PF04 3578 ACTATGATCTAAGTTTATTTTTCCATCTGTATAA His-LLO GC
(1-3) SEQ ID NO: 07 PF04 3579 GCTTATACAGATGGAAAAATAAACTTAGATCATA
His-LLO GT (1-3) SEQ ID NO: 08 PF04 3740
GGAGGATACGTTGCTCAATTCGAAGTAGCCTGGG Chimera ATGAAGTAAATTATGAT 1 SEQ
ID NO: 09 3741 ATCATAATTTACTTCATCCCAGGCTACTTCGAAT Chimera
TGAGCAACGTATCCTCC 1 SEQ ID NO: 10 3742
AACATTTCTTGGGATGAAGTATCATATGACAAAG Chimera AAGGTAACGAAATTGTTCAA 2
SEQ ID NO: 11 3743 TTGAACAATTTCGTTACCTTCTTTGTCATATGAT Chimera
ACTTCATCCCAAGAAATGTT 2 SEQ ID NO: 12 3744
TATGATCCTGAAGGTAACGAAGTATTAACTCATA Chimera AAAACTGGAGCGAAAAC 3 SEQ
ID NO: 13 3745 GTTTTCGCTCCAGTTTTTATGAGTTAATACTTCG Chimera
TTACCTTCAGGATCATA 3 SEQ ID NO: 14 3746
AACGAAATTGTTCAACATAAAACATGGGATGGAA Chimera ACAATAAAAGCAAGCTAGCT 4
SEQ ID NO: 15 3747 AGCTAGCTTGCTTTTATTGTTTCCATCCCATGTT Chimera
TTATGTTGAACAATTTCGTT 4 SEQ ID NO: 16 3748
CATAAAAACTGGAGCGAAAACTATCAAGATAAAA Chimera CAGCTCATTTCACATCGTCCATC
5 SEQ ID NO: 17 3749 GATGGACGATGTGAAATGAGCTGTTTTATCTTGA Chimera
TAGTTTTCGCTCCAGTTTTTATG 5 SEQ ID NO: 18 3750
AATAAAAGCAAGCTAGCTCATTATTCAACAGTAA Chimera TCTATTTGCCTGGTAACGCG 6
SEQ ID NO: 19 3751 CGCGTTACCAGGCAAATAGATTACTGTTGAATAA Chimera
TGAGCTAGCTTGCTTTTATT 6 SEQ ID NO: 20 3752
GCTCATTTCACATCGTCCATCCCTCTTGAAGCTA Chimera ACGCGAGAAATATTAATGTT 7
SEQ ID NO: 21 3753 AACATTAATATTTCTCGCGTTAGCTTCAAGAGGG Chimera
ATGGACGATGTGAAATGAGC 7 SEQ ID NO: 22 3754
CCTGGTAACGCGAGAAATATTAGAATAAAAGCAA Chimera GGAAATGCACTGGTTTAGCTTGG
8 SEQ ID NO: 23 3755 CCAAGCTAAACCAGTGCATTCTCTTGCTTTTATT Chimera
CTAATATTTCTCGCGTTACCAGG 8 SEQ ID NO: 24 3756
TGGGAATGGTGGAGAGATGTAATTGATGACCGG Chimera SEQ ID NO: 25 9 3757
CCGGTCATCAATTACATCTCTCCACCATTCCCA Chimera SEQ ID NO: 26 9 3758
GGGAATGGTGGAGAACGGTAATTAGTGAATATGA Chimera
TGTTCCACTTGTGAAAAATAGAAAT 10 SEQ ID NO: 27 3759
ATTTCTATTTTTCACAAGTGGAACATCATATTCA Chimera
CTAATTACCGTTCTCCACCATTCCC 10 SEQ ID NO: 28 3760
GACCGGAACTTACCACTTACAAATAATATAAATA Chimera TCTCCATCTGGGGC 11 SEQ ID
NO: 29 3761 GCCCCAGATGGAGATATTTATATTATTTGTAAGT Chimera
TGGAAGTTCCGGTC 11 SEQ ID NO: 30 3580
AGATCCAGGGTATAAAGTGGTGCCCCAGATGGAG Chimera AT 12 SEQ ID NO: 31 3581
ATCTCCATCTGGGGCACCACTTTATACCCTGGAT Chimera CT 12 SEQ ID NO: 32 3799
GAAAACAATAAAAGCAAGACAGCTCATTTCACAT His- CGTCC L461T SEQ ID NO: 33
and DP-L4017 3800 GGACGATGTGAAATGAGCTGTCTTGCTTTTATTG His- TTTTC
L461T SEQ ID NO: 34 and DP-L4017 3931
TTTCTGCAGAGAAACACGCGGATGAAATCGATA DP-L4017 (Pst1) SEQ ID NO: 35
3932 AAAAGAGCTCTCTGGAATTGAGGATGATTTCTTT DP-L4017 (Sac1) SEQ ID NO:
36
2. Construction of the PFO Expression Vector.
[0069] Mature PFO was amplified by PCR from p1868 (Jones, S., and
D. A. Portnoy. 1994b. Intracellular growth of bacteria. Methods
Enzymol. 236:463-467), a plasmid carrying the coding sequence for
mature PFO from Clostridium perfringens, using the primers,
templates, and restriction sites. This fragment was ligated into
pET28a (Novagen) and later expressed with BL21(DE3)PlysS, strain
DP-4167.
3. Construction of the Domain Chimeras, Subdomain Chimeras, and
Single Amino Acid Mutation Expression Vectors
[0070] The fourth domain of LLO was replaced by PFO domain 4 using
splicing by overlap extension PCR (Horton, R. M., Z. L. Cai, S. N.
Ho, and L. R. Pease. 1990. Gene splicing by overlap extension:
tailor-made genes using the polymerase chain reaction.
Biotechniques. 8:528-535.). The subdomain chimeras and the single
amino acid mutations indicated in were constructed by modifying
p3570 with the protocol published in the Quickchange.TM.
site-directed mutagenesis kit (Stratagene) and the primers listed
in Table III.
4. Hemolytic Activity Screening of Recombinant Proteins
[0071] E. coli expression strains were grown overnight in LB
containing 30 .mu.g/ml kanamycin (LB-KAN). 400 .mu.l of the
overnight culture was added to 10 ml LB-KAN and grown for 1.5 h,
and then 1 mM IPTG was added. This culture was incubated at
30.degree. C., shaking for 3 h. Cultures were pelleted and then
resuspended in 1 ml storage buffer (140 mM sodium chloride, 4 mM
potassium chloride, 10 mM sodium phosphate, 0.5 mM DTT, pH 6.0)
with 1 mM PMSF. The samples were sonicated on ice and cleared by
centrifugation.
[0072] The quantitative assay was performed in a 96-well V-bottom
styrene plate (Corning Inc.) with either neutral hemolysis buffer
(35 mM sodium phosphate, 125 mM sodium chloride, 0.5 mg/ml BSA, pH
7.4, using acetic acid) or acidic hemolysis buffer (same as neutral
hemolysis buffer but pH 5.5). Samples were serially diluted, and
then 0.5% sheep red blood cells (HemoStat Laboratories) were added
to each well. The plate was incubated, shaking at 37.degree. C.,
and then pelleted in the V-bottom. Supernatant was transferred from
the V-bottom plate into equivalent locations in a flexible
polyvinyl chloride flat bottom 96-well plate (Becton Dickinson),
and the absorbance at 450 nm for each well was measured
(Spectramax340) and analyzed with SoftMax Pro v1.2 software
(Molecular Devices Corp.). Hemolytic units were defined as the
dilution of the sample at which 50% of the sheep red blood cells
had been lysed.
5. Overexpression and Purification of 6.times. his-Tagged LLO
Proteins and 6.times. his-Tagged PFO from E. coli
[0073] Recombinant strains were grown, shaking at 37.degree. C., in
LB-KAN to stationary phase. 20 ml of this culture was inoculated
into 1 liter of LB-KAN and incubated, shaking at 30.degree. C., for
90 min. Expression was induced by the addition of 1 mM IPTG, and
the culture was incubated, shaking at 30.degree. C., for 6 h. The
bacterial pellet was harvested by centrifugation, resuspended in 40
ml cold lysis buffer (50 mM sodium phosphate, pH 8.0, 1 M sodium
chloride, 20 mM imidazole, 10 mM 2-mercaptoethanol, 1 mM PMSF), and
lysed in a French pressure cell at 12,000 psi. The lysate was
centrifuged for 20 min at 17,000 g. The supernatant was collected
and mixed into 5 ml Ni-NTA resin (QIAGEN) equilibrated in lysis
buffer. The slurry was stirred at 4.degree. C. for 60 min to bind
his-tagged protein to the resin. To remove unbound protein, the
resin was packed into a column and washed with lysis buffer by
dropwise gravity flow until UV absorbance of the eluate reached
baseline, and then it was washed with wash buffer (lysis buffer, pH
6.0, 10% glycerol, 0.1% Tween 20). Washed resin was removed from
the column, resuspended in elution buffer (lysis buffer, pH 6.0,
and 800 mM imidazole), and incubated 10 min on ice, after which the
supernatant was collected. This procedure was performed twice,
yielding 6 ml eluate. Eluate was dialyzed in cassettes (Pierce
Chemical Co.) within autoclaved storage buffer (lysis buffer, pH
6.0, with 1 mM EDTA). Both the Bradford method and UV280 absorbance
determined protein concentrations. The procedure yielded .about.25
mg protein per liter starting culture. Aliquots not used
immediately were stored in storage buffer with 50% glycerol at
-80.degree. C.
6. Allelic Exchange of LLO L461T
[0074] To introduce the LLO L461T mutation onto the 10403S
chromosome, a DNA fragment was produced with the method of splicing
by overlap extension PCR, using the primers, templates, and
restriction enzymes in Table 1, and then ligated into the
temperature-sensitive plasmid vector pKSV7. Allelic exchange was
performed as described previously (Camilli, A., L. G. Tilney, and
D. A. Portnoy. 1993. Dual roles of plcA in Listeria monocytogenes
pathogenesis. Mol. Microbiol. 8:143-157.). Strains were verified
initially by detecting the loss of an Nhe1 site in a chromosomal
PCR product containing the mutation.
7. Animal Studies
[0075] LD.sub.50 by intravenous infection was established as
previously described using BALB/c mice (Portnoy, D. A., P. S.
Jacks, and D. J. Hinrichs. 1988. Role of hemolysin for the
intracellular growth of Listeria monocytogenes. J. Exp. Med.
167:1459-1471.).
8. Phagosomal Escape Assay
[0076] The percentage of bacteria that had escaped from the
phagosome was determined by evaluating the presence of
F-actin-coated bacteria within the macrophage, similar to an
experiment previously described (Jones, S., and D. A. Portnoy.
1994a. Characterization of Listeria monocytogenes pathogenesis in a
strain expressing perfringolysin O in place of listeriolysin O.
Infect. Immun. 62:5608-5613). C57/BL6 BMOs in DME, 10% FBS, with or
without 0.5 .mu.M bafilomycin A1 (Calbiochem), on a coverslip were
infected for 15 min, resulting in a bacterium within 10% of the
cultured macrophages. Macrophages were washed with Ringer's buffer
(5 mM NaCl, 5 mM KCl, 2 mM CaCl.sub.2, 1 mM MgCl.sub.2, 2 mM
NaH.sub.2PO.sub.4, 10 mM Hepes, 10 mM glucose, pH 7.2) and 25
.mu.g/ml gentamicin was added. At 120 min after infection, the
macrophages were fixed for 15 min with cytoskeletal fixative (40 mM
Hepes, 10 mM EGTA, 0.5 mM EDTA, 5 mM MgSO.sub.4, 33 mM potassium
acetate, 0.02% sodium azide, 5% polyethylene glycol 400, 4%
paraformaldehyde), washed, permeabilized with PBS, containing 2%
goat serum and 0.3% Triton X-100, and stained with Texas
red-phalloidin (Molecular Probes) and DAPI (Molecular Probes). A
total of 50 macrophages harboring bacteria were examined for each
bacterial strain in each of four experiments.
[0077] The determination of phagosomal pH was performed essentially
as previously described (Beauregard, K. E., K. D. Lee, R. J.
Collier, and J. A. Swanson. 1997. pH-dependent perforation of
macrophage phagosomes by listeriolysin O from Listeria
monocytogenes. J. Exp. Med. 186:1159-1163.) with the following
modifications. In brief, fluid-phase fluorescein dextran, molecular
weight 10,000 (Molecular Probes), was added to the
bacteria-containing media used to infect macrophages. Phagosomes
containing both 10-kD fluorescein dextran and bacteria were
photographed every 30 s with a Quantix cooled charge-couple device
camera (Photometrics) through fluorescent microscopy using a Nikon
TE300 inverted microscope (Nikon), with phase-contrast and
excitation wavelengths 485 and 440 nm and emission measurement at
520 nm. Images and the 485:440 ratio were collected until
perforation was indicated by loss of dye from the vacuole. The
485:440 ratio measured just before perforation was compared with a
standard curve to establish pH, as described in the published
methods.
9. Cytotoxicity Assays--Growth in J774 Macrophage-Like Cells.
[0078] Intracellular growth of L. monocytogenes was performed as
previously described (Jones and Portnoy, Intracellular growth of
bacteria. (1994b) Methods Enzymol. 236:463-467).
10. Flow Cytometry.
[0079] Flow cytometry was performed on cultures of BMOs from CD-1
mice as previously described (Portnoy, D. A., P. S. Jacks, and D.
J. Hinrichs. 1988. Role of hemolysin for the intracellular growth
of Listeria monocytogenes. J. Exp. Med. 167:1459-1471.). BMO were
chosen for this assay because infected J774 are difficult to remove
from tissue culture dishes without causing plasma membrane damage,
whereas BMO lift from the dish when incubated at 4.degree. C.
10.sup.6 macrophages were plated on 60-mm Lab-tek nontissue culture
dishes (Fisher Scientific) overnight in bone marrow macrophage
media (DME, 20% heat-deactivated FBS, 30% L cell supernatant
containing CSF-1 in DME, 2 mM glutamine, 1 mM pyruvate, 0.1%
2-mercaptoethanol). Monolayers were infected with 10.sup.7 washed
bacteria for 30 min resulting in at least one bacterium per cell.
60 min after infection, 50 .mu.g/ml gentamicin was added. 3 h after
infection, the cell monolayer was washed to remove the gentamicin,
and then fresh medium was added to the dish. 7 h after infection,
medium from each culture was collected. 4.degree. C. PBS was then
added and the dish was stored at 4.degree. C. for .about.30 min.
Release of macrophages from the dish was monitored by microscopy.
The macrophage-containing PBS was added to the previously removed
media and centrifuged at 4.degree. C. The pellet was washed with
4.degree. C. PBS, 10% FBS. Cell pellets were resuspended in PBS
(10% FBS) and passed through a 70-.mu.m cell strainer (Becton
Dickinson). 1 .mu.g propidium iodide (Molecular Probes) was added
to each sample. Samples were analyzed with a flow cytometer (EPICS
XL-MCL; Beckman Coulter).
11. LDH Release Assay
[0080] LDH release assays were performed using the Cytotox 96.RTM.
nonradioactive cytotoxicity assay (Promega), according to
manufacturer's instructions and methods described previously
(Decatur, A. L., and D. A. Portnoy. 2000. A PEST-like sequence in
listeriolysin O essential for Listeria monocytogenes pathogenicity.
Science. 290:992-995) with 2.times.10.sup.4 J774 cells per well
infected to achieve at least one bacterium per cell. Neutralizing
anti-LLO monoclonal antibodies were supplied by Brian Edelson and
Emil Unanue (Washington University School of Medicine, St. Louis,
Mo.).
12. Intracellular LLO Analysis
[0081] Intracellular levels of LLO were studied with previously
established methods (Moors, M. A., B. Levitt, P. Youngman, and D.
A. Portnoy. 1999. Expression of listeriolysin O and ActA by
intracellular and extracellular Listeria monocytogenes. Infect.
Immun. 67:131-139.) and the following modifications. In brief, J774
cells were infected with L. monocytogenes strains for 30 min and
then washed, and 50 .mu.g/ml gentamicin was added at 60 min. 4 h
after infection, methionine-starved cells were pulsed with
[.sup.35S]methionine (NEN Life Science Products) for 1 h. At 5 h,
macrophages were lysed, LLO was immunoprecipitated, and one half of
the sample was subjected to SDS-PAGE for autoradiography and the
other half run for analysis on a Phosphorimager 445 SI (Molecular
Dynamics) and analyzed using Imagequant software (Molecular
Dynamics). Monoclonal anti-LLO antibodies were supplied by Pascale
Cossart (Institute Pasteur, Paris, France). The relative number of
bacteria in each assay was established by lysing the infected J774
on coverslips in dishes processed in tandem with the radiolabeled
dishes. Lysate was subsequently plated on LB-agar plates to
determine colony-forming units.
13. Plaque Assay
[0082] Plaquing assays within L2 cell monolayers were performed as
described previously (Sun, A., A. Camilli, and D. A. Portnoy. 1990.
Isolation of Listeria monocytogenes small-plaque mutants defective
for intracellular growth and cell-to-cell spread. Infect. Immun.
58:3770-3778.), with modifications to the methods of measurement
(Skoble, J., D. A. Portnoy, and M. D. Welch. 2000. Three regions
within ActA promote Arp2/3 complex-mediated actin nucleation and
Listeria monocytogenes motility. J. Cell Biol. 150:527-538.). In
brief, L2 cells were grown to confluency in six-well tissue culture
dishes and then infected with bacteria for 1 h. Subsequently,
DME-agar containing gentamicin was added and plaques were grown for
3 d. Living cells were visualized by adding on day 3 an additional
DME-agar overlay containing neutral red (GIBCO BRL) and incubating
overnight.
B. Results
[0083] 1. Identification of Amino Acid Residues within LLO that
Confer an Acidic pH Optimum
[0084] We sought to isolate a mutation in LLO that increased its
activity at a neutral pH and thus caused LLO to act like PFO. We
began with the assumption that PFO contains a sequence that
facilitates its activity over a broad pH range, and placing this
sequence in LLO would alter LLO's pH profile. Because domain 4 of
PFO was implicated in membrane binding and insertion, it was deemed
a good candidate for regulating pH-dependent cytolysis. A chimeric
protein consisting of the first three domains of LLO and the fourth
domain of PFO was generated. The domain 4 chimera, LLO, and PFO
were expressed as COOH-terminally his-tagged recombinant proteins
in Escherichia coli and purified for analysis of hemolytic
activity. The domain 4 chimera was less active than either PFO or
LLO, yet its activity at both pH 5.5 and 7.4 was similar. We
interpreted these results to indicate that within the fourth domain
of LLO were sequences that control the pH activity profile.
[0085] Next, we divided the fourth domain of LLO into 12
subdomains, each containing amino acids dissimilar to those of PFO,
and swapped those regions of dissimilarity from PFO into LLO. Two
chimeras (5 and 10) showed a dramatic reduction in the ratio of
activity at an acidic pH to that at a neutral pH. However, chimera
10 was .about.10-fold less active than LLO and was not studied
further. The four amino acid changes in chimera 5 were then
individually introduced into LLO. A single amino acid change,
L461T, increased the hemolytic activity of LLO nearly 10-fold at a
neutral pH without decreasing specific activity at pH 5.5. Thus, a
single amino acid substitution is sufficient to confer the pH
activity profile of PFO onto LLO. Additionally, L461T is unique to
the CDC of the pathogenic species of the Listeria genus.
2. The L461T Mutation in LLO Reduces Virulence
[0086] Having established that the L461T mutation conferred greater
activity on purified LLO at a neutral pH, we introduced the
mutation onto the chromosome of L. monocytogenes by allelic
exchange. The resulting strain, DP-L4017, was used for further
studies. The mutation had no effect on bacterial growth in vitro.
Supernatant fluid derived from cultures of LLO L461T bacteria had a
quantity of LLO similar to the wild type and had hemolytic
activities at pH 5.5 and 7.4 similar to those of the purified
proteins from E. coli.
[0087] The capacity of the LLO L461T mutant to grow in animals was
evaluated by the lethal dose-50 (LD.sub.50) in the mouse
listeriosis model. In BALB/c mice, the LD.sub.50 of the LLO L461T
mutant was >3.times.10.sup.6 as compared with an LD.sub.50 of
1-3.times.10.sup.4 for wild-type bacteria. These data indicate that
LLO pH dependence contributes to the in vivo growth of L.
monocytogenes.
3. The LLO L461T Mutation does not Affect the Efficiency or pH of
Phagosomal Escape
[0088] Based on the observation that LLO has an acidic pH optimum
and the bacteria escape from phagosomes at an acidic pH (Beauregard
et al., Exp. Med. (1997) 186:1159-1163.), we hypothesized that a
mutant LLO with greater activity at a neutral pH may act
prematurely and not mediate escape efficiently. We used a
fluorescence-based assay to monitor escape from the phagosome based
on the observation that bacteria within the cytosol nucleate host
actin filaments on their surface, whereas bacteria in vacuoles do
not. We found that the LLO L461T mutant escaped from the phagosome
of bone marrow-derived macrophages (BMO) similarly to wild-type
bacteria, 72.+-.2% versus 76.+-.2%, respectively, after 2 h.
[0089] Previous studies have indicated that preventing
acidification of the phagosome with the vacuolar proton ATPase
inhibitor bafilomycin A1 limits L. monocytogenes escape to the
cytosol. We reasoned that escape of the LLO L461T mutant might not
be affected by bafilomycin A1 treatment because its cytolysin was
active at a neutral pH. However, when bafilomycin A1 was added to
the macrophages, both the mutant and the wild-type bacteria escaped
less efficiently. When bafilomycin A1 was present throughout the
assay, both strains escaped with about a third of the efficiency of
untreated controls.
[0090] Because treatment with bafilomycin A1 prevented escape of
the LLO L461T mutant as well as the wild-type bacteria, it would
appear that the additional activity of the mutant at a neutral pH
does not eliminate the requirement for phagosome acidification.
Therefore, we measured the pH of bacterium-containing phagosomes
using a pH-sensitive fluid-phase fluorescent dye to determine if
the LLO L461T mutant altered the phagosomal maturation process. We
found that phagosomes containing the LLO L461T mutant reached an
average minimum pH of 5.5.+-.0.3 before perforation, similar to
that of the wild type, which reached a minimum mean pH of
5.7.+-.0.2. We concluded that the LLO L461T mutation had no effect
on phagosomal acidification or escape, and that phagosomal
acidification was necessary for the escape of the LLO L461T mutant
as well as for wild type. Therefore, it is unlikely that the LLO
L461T mutant's virulence defect reflects a reduced ability to
escape from phagosomes or an effect on phagosome maturation. The
defect is likely due to the alteration of a different part of the
pathogenic life cycle.
4. L. monocytogenes LLO L461T Damages Host Cell Membranes
[0091] Because the LLO L461T mutant had no defect in phagosomal
escape, we next examined the capacity of the bacteria to grow in
host cells using a quantitative tissue culture assay (Portnoy et
al., 1988, supra). In this assay, adding the antibiotic gentamicin
to the culture medium kills extracellular bacteria but has no
measurable effect on the growth of intracellular wild-type
bacteria. Between 2 and 5 h after infection, the LLO L461T mutant
grew well within J774 macrophages with an average apparent doubling
time of 58.+-.8 min, slightly longer than the wild-type doubling
time of 42.+-.4 min. Strikingly, between 5 and 8 h after infection,
the LLO L461T mutant grew with a nearly twofold longer average
apparent doubling time (159.+-.30 min compared with the wild-type
doubling time of 83.+-.8 min). Additionally, the LLO L461T mutant
did not grow to as high a maximum number of bacteria.
[0092] We reasoned that the LLO L461T mutant's longer apparent
doubling times and lower maximum bacterial numbers could reflect
either a decrease in the overall growth rate or, more likely, an
increase in the death of a subpopulation of intracellular bacteria.
The analysis is complicated by the fact that after 5 h, L.
monocytogenes spread from cell to cell. To eliminate cell-to-cell
spread from the analysis, an in-frame deletion was introduced
within the actA gene. The resulting strain was fully capable of
vacuolar escape and intracellular growth within the original host
cell, but was unable to nucleate actin filaments and thus unable to
enter the secondary cell's double-membraned vesicle or spread from
cell to cell. As previously observed, a .DELTA.ActA strain
expressing wild-type LLO grew intracellularly for the first 8 h,
after which bacterial numbers rapidly dropped due to death of the
host cell and influx of gentamicin. A corresponding drop in the
number of LLO L461T .DELTA.ActA bacteria was observed, but the drop
occurred at 5 h instead of at 8 h observed for the wild type.
Treatment with the pharmacological inhibitor of actin
polymerization, cytochalasin D, which prevents bacterial
intracellular motility, led to similar growth defects as the
deletion of ActA (unpublished data). Thus, the growth defect of LLO
L461T bacteria was more pronounced when cell-to-cell spread was
inhibited. (As shown in the next section, the LLO L461T mutant is
not defective in the ability to spread from cell to cell.)
[0093] For both wild-type and LLO L461T bacteria, the drop in
colony-forming units was only observed when gentamicin was present
in the assay medium. When host membranes become permeabilized
during a cell culture infection, gentamicin present in the culture
medium enters the host cell and kills intracellular bacteria.
Therefore, the gentamicin-dependent drop in numbers of
intracellular bacteria suggested that host membranes had been
permeabilized. Because the LLO L461T .DELTA.ActA mutant died
earlier than the wild-type LLO .DELTA.ActA strain, and because this
occurred in a gentamicin-dependent manner, we hypothesized that the
greater activity of LLO L461T at a neutral pH led to earlier
permeabilization of the host cell membrane. If this hypothesis were
true, damage could be monitored by detecting release of the host
cell enzyme lactate dehydrogenase (LDH) from the cytosol of the
J774 cells into the culture medium. During a 7 h infection with
wild-type bacteria, very little LDH was released either in the
presence or absence of gentamicin. In the absence of gentamicin,
both the LLO L461T- and LLO L461T .DELTA.ActA-infected cells
released nearly 100% of their LDH, indicating a major disruption of
the host plasma membrane. Interestingly, when J774 cells were
incubated in the constant presence of gentamicin, very little LDH
was released during infection by any strain. Presumably,
permeabilization of the cell allowed the influx of gentamicin,
which then killed the intracellular bacteria and prevented further
permeabilization and LDH release. When gentamicin was removed after
2 h, only the J774 cells infected with the LLO L461T .DELTA.ActA
mutant released high quantities of LDH. When a monoclonal antibody
that neutralizes LLO activity was added extracellularly to the J774
cells, there was no effect on LDH release, indicating that toxicity
is mediated by intracellular LLO (unpublished data).
[0094] A more sensitive method to test the integrity of the plasma
membrane uses the membrane-impermeant dye propidium iodide. When
membrane integrity is compromised, the dye enters the cell and
increases its fluorescence upon binding cellular DNA. Staining can
be measured by flow cytometry. After infection with the wild-type
bacteria, most macrophage host cells still excluded the dye. In
contrast, infection with the LLO L461T mutant led to
permeabilization of about half of the macrophages, and infection
with the LLO L461T .DELTA.ActA mutant permeabilized most of the
macrophages.
[0095] To address the possibility that the LLO L461T molecule had
altered cytosolic stability, which could lead to increased
cytotoxicity, we infected J774 cells and examined the steady-state
quantity of cytosolic LLO. We found that there was approximately
twofold more cytosolic LLO L461T than wild type. However, when J774
cells were infected with a strain harboring two copies of the gene
encoding LLO, so that they produce twice as many hemolytic units, a
similar quantity of LLO to the LLO L461T mutant was observed.
However, despite the fact that infection with the merodiploid led
to a concentration of LLO in the cytosol similar to the mutant, the
merodiploid damaged the host cell's plasma membrane no more than
the wild-type bacteria. Together, these data suggested that the
decreased growth of the LLO L461T mutant was associated with
permeabilization of the host cells due to increased activity of the
LLO L461T at a neutral pH, and was not due to an increased
cytosolic concentration of LLO.
5. L. monocytogenes Strain LLO L461T is not Defective in
Cell-to-Cell Spread
[0096] LLO plays an essential role in the escape of L.
monocytogenes from both the primary phagosome and the secondary
double membrane-bound vesicle formed during cell-to-cell spread.
The results described above did not directly address whether the
LLO L461T mutation affects bacterial cell-to-cell spread. We
examined the ability of bacteria to spread from cell to cell by
measuring the diameter of plaques formed in L2 monolayers after 3 d
in the presence of different concentrations of gentamicin. Plaque
diameter is a measure of a bacterium's ability to grow, move
through the host cell cytosol, enter an adjacent cell, and escape
from the secondary vesicle formed in the adjacent cell. At low
gentamicin concentrations, the LLO L461T strain's plaque was equal
in diameter to the wild type, whereas at high concentrations the
mutant had a severe plaquing defect. Thus, the capacity of an LLO
L461T mutant to form plaques was gentamicin dependent.
[0097] Two L. monocytogenes mutants with slight defects in either
actin-based motility or escape from the double-membraned vesicle
were analyzed as controls. The corresponding reduction in the size
of plaques formed by these mutants was independent of gentamicin
concentration. Also, the merodiploid strain with two copies of LLO
formed plaques identical to wild type at each gentamicin
concentration. Therefore, we concluded that LLO L461T was fully
capable of mediating cell-to-cell spread and escape from the
double-membraned vesicle. Additionally, based on the data observed,
we concluded that the plaque defect seen at high gentamicin
concentrations reflected bacteriocidal activity of the antibiotic
on intracellular bacteria that entered cells subsequent to
LLO-mediated damage to the host cell membrane. Conversely, low
concentrations of gentamicin did not allow the influx of sufficient
quantities of the antibiotic to negatively affect the bacteria.
These conclusions agree with the results observed for the
merodiploid, which did not permeabilize host membranes to propidium
iodide nor form gentamicin-sensitive plaques.
C. Conclusion
[0098] The DP-L4017 strain expresses an LLO mutant which is 10-fold
more hemolytic at neutral pH, relative to wild type LLO, which
results in quicker damage to the host cell. This strain was also
found to be 100-fold less virulent, by LD50 in BALB/c mice, and by
48 hours was 74 and 21-fold less abundant in the spleen and liver,
respectively, than wild type bacteria, in a competitive index
assay. As such, the strain exhibits increased cytotoxity and
decreased virulence as compared to wild type. The strain
establishes an active infection in the mouse model that is limited
by its cytotoxicity and cleared efficiently from the host
system.
[0099] The above attributes make this strain an acceptable
attenuated Listeria strain for use in a variety of applications, as
described above.
II. DP-L4057
[0100] The DP-L4057 strain contains the mutation S44A in LLO
(serine to alanine amino acid change in LLO at amino acid position
44) and was constructed using protocols analogous to those
described above. The S44A mutation was constructed to interrupt a
potential mitogen-activated protein kinase (MAPK) phosphorylation
site with the PEST-like sequence at the N-termini of LLO, which has
been implicated in protein degradation within the cytosol of
mammalian cells. After 48 hours strain DP-L4057 is 580 and 740-fold
less abundant than wild type bacteria in the spleen and liver,
respectively, using a competitive index assay, as described
previously (Auerbuch, V., L. L. Lenz, and D. A. Portnoy 2001
Development of a competitive index assay to evaluate the virulence
of Listeria monocytogenes actA mutants during primary and secondary
infection of mice. Infect. Immun. 69: 5953-5957). As such, the
strain exhibits increased cytotoxity and decreased virulence as
compared to wild type. The strain establishes an active infection
in the mouse model that is limited by its cytotoxicity and cleared
efficiently from the host system.
[0101] The above attributes make this strain an acceptable
attenuated Listeria strain for use in a variety of applications, as
described above.
III. DP-L4384
[0102] The DP-L4384 strain contains both of the above described
mutations, i.e., mutation S44A and mutation L461T) in LLO and was
constructed using protocols analogous to those described above. The
strain incorporates all of the properties of the above two
described strains. After 48 hours strain DP-L4384 is
4.6.times.10.sup.5 and 1.7.times.10.sup.5-fold less abundant than
wild type bacteria in the spleen and liver, respectively, in a
competitive index assay (Auerbuch, V. et al, supra). As such, the
strain exhibits increased cytotoxity and decreased virulence as
compared to wild type. The strain establishes an active infection
in the mouse model that is limited by its cytotoxicity and cleared
efficiently from the host system.
[0103] The above attributes make this strain an acceptable
attenuated Listeria strain for use in a variety of applications, as
described above.
IV. DP-L4042
[0104] The DP-L4042 was constructed as described in Decatur &
Portnoy, Science (Nov. 3, 2000) 290: 992-995. This strain contains
a deletion of residues 34 to 59 of LLO, and therefore deletes the
entire PEST-like sequence found at the N-terminus of LLO. The
strain is extremely cytotoxic, and therefore is essentially
undetectable in the competitive index assay after 48 hours. The
strain has an LD.sub.50 of 2.times.10.sup.8, approximately 10,000
times higher than the wild-type bacteria. As such, the strain
exhibits increased cytotoxity and decreased virulence as compared
to wild type. The strain establishes an active infection in the
mouse model that is limited by its cytotoxicity and cleared
efficiently from the host system.
[0105] The above attributes make this strain an acceptable
attenuated Listeria strain for use in a variety of applications, as
described above.
V. ADDITIONAL CHARACTERIZATION OF LLO MUTANT STRAINS
A. Materials and Methods
1. Strains, Growth Conditions, and Reagents
[0106] The wild-type L. monocytogenes strain used for these studies
was 10403S (Portnoy, D. A., T. Chakraborty, W. Goebel, and P.
Cossart. 1992. Molecular determinants of Listeria monocytogenes
pathogenesis. Infect Immun 60:1263-1267). L. monocytogenes strains
with deletions of actA were constructed by allelic exchange as
described previously (Camilli, A., L. G. Tilney, and D. A. Portnoy.
1993. Dual roles of plcA in Listeria monocytogenes pathogenesis.
Mol Microbiol 8:143-157; Skoble, J., D. A. Portnoy, and M. D.
Welch. 2000. Three regions within ActA promote Arp2/3
complex-mediated actin nucleation and Listeria monocytogenes
motility. J Cell Biol 150:527-538). Strain LLO L461T (DP-L4017) was
described previously (Glomski, I. J., M. M. Gedde, A. W. Tsang, J.
A. Swanson, and D. A. Portnoy. 2002. The Listeria monocytogenes
hemolysin has an acidic pH optimum to compartmentalize activity and
prevent damage to infected host cells. J Cell Biol 156:1029-1038).
A summary of the strains used in this study can be found in Table
II. Bacteria were grown in 3 ml brain heart infusion broth (BHI;
Becton Dickinson, Sparks, Md.) slanted without agitation in 15 ml
conical tubes at 30.degree. C. overnight, unless otherwise
noted.
[0107] Tissue culture cells were grown in DMEM (Gibco-BRL) 7.5%
heat deactivated fetal bovine serum (FBS)(Hy-Clone, Logan, Utah) 2
mM glutamine (DMEM; Gibco-BRL) at 37.degree. C. and 5% CO.sub.2,
unless otherwise noted. All chemicals were purchased from
Sigma-Aldrich, St. Louis, Mo., unless otherwise noted.
[0108] 6 to 8 week old Female C57BL/6 (Jackson Labs, Bar Harbor,
Me.) mice were used for infection and bone marrow isolation, unless
otherwise noted, under the University of California, Berkeley
animal use protocol #R235-0701B. RB6-8C5 monoclonal antibodies were
produced (Strategic BioSolutions Newark, Del.) from a hybridoma
generously donated by Robert North and Ronald LaCourse of the
Trudeau Institute. The ascites was harvested from nude mice, and
then partially purified by precipitation with 45% ammonium sulfate
using endotoxin-free conditions. The antibody was subsequently
resuspended and dialyzed in PBS.
2. Construction of LLO Mutants
[0109] Strain LLO S44A (DP-L4057) was produced using splicing by
overlap extension PCR (Horton, R. M., Z. L. Cai, S. N. Ho, and L.
R. Pease. 1990. Gene splicing by overlap extension: tailor-made
genes using the polymerase chain reaction. Biotechniques 8:528-535)
to change serine 44 to alanine using the following oligo
nucleotides (Operon Technologies): DP-1569
GGGTCGACTCCTTTGATTAGTATATTCCT (Sal1) (SEQ ID NO:37), DP-1700
TTTGGATAAGCTTGAGCATATT (Hind3) (SEQ ID NO:38), DP-3820
GCACCACCAGCAGCTCCGCCTGCAAG (SEQ ID NO:39) and DP-3821
CTTGCAGGCGGAGCTGCTGGTGGTGC (SEQ ID NO:40). DP-1569 was paired with
DP-3821, and DP-3820 with DP-1700 to produce 382 and 480 bp. DNA
fragments, respectively, using pfu polymerase (Stratagene), and
genomic DNA from 10403S as a template. The two fragments were then
spliced to form a 862 bp fragment that was cut with Sal1 and Hind3
and ligated into a similarly cut pKSV7 plasmid for allelic exchange
(Camilli, et al., supra). The L. monocytogenes strains were
initially screened with Alu1 digestion, which was introduced by the
S44A mutation, then subsequently sequenced to verify the mutation.
Strain LLO S44A L461T (DP-L4384) was produced by introducing the
plasmid used to produce LLO L461T (p4005) into DP-L4057 for allelic
exchange (Glomski et al., supra). Clones were screened for the loss
of an Nhe1 site, introduced by the L461T mutation, and then
subsequently verified by sequencing.
[0110] All of the mutant LLO strains were marked for the
competitive index assay by transducing the gene for erythromycin
resistance from strain DP-L3903 using .left brkt-bot.U153, as
described by Hodgson (Auerbuch, V., L. Lenz, and D. Portnoy. 2001.
Development of a competitive index assay to evaluate the virulence
of Listeria monocytogenes actA mutants during primary and secondary
infection of mice. Infection and Immunity; Hodgson, D. A. 2000.
Generalized transduction of serotype 1/2 and serotype 4b strains of
Listeria monocytogenes. Mol Microbiol 35:312-323). Briefly, phage
U153 isolated from DP-L3903 were added to the recipient strain
while in mid-log growth, 10 mM CaCl.sub.2 and 10 mM MgCl.sub.2 were
added, and bacteria were incubated at room temperature for 1 hour,
with occasional mixing. After one hour, 0.1 .mu.g/ml erythromycin
was added for 30 minutes, and then the mixture was spread on 1
.mu.g/ml erythromycin BHI-agar plates and incubated at 37.degree.
for 2 days. Transduction of the erythromycin resistance gene was
verified by PCR analysis using the primers DP-4409
CCCAAGCTTCTAAAGTTATGGAAATAAGAC (SEQ ID NO:41) and DP-4410
CCGAGCTCACGGATTTTGGTACTTGAT (SEQ ID NO:42) that flank erm in
Tn917-LTV3. Additionally, the newly isolated resistant strain was
competed against the parental non-resistant strain in the mouse to
confirm that there was no alteration in virulence. The resulting
strains were named as follows: LLO L461T Erm (DP-L4157), LLO S44A
Erm (DP-L4382), and LLO S44A L461T Erm (DP-L4385).
3. Phagosomal Escape Assay
[0111] The percentage of bacteria that had escaped from the
phagosome was determined by indirect immunofluorescence as
described previously (Jones, S., and D. A. Portnoy. 1994.
Characterization of Listeria monocytogenes pathogenesis in a strain
expressing perfringolysin O in place of listeriolysin O. Infect
Immun 62:5608-5613). Briefly, bone-marrow derived macrophages
(described below) on a coverslip were infected for 30 minutes,
washed with PBS, and then 10 .mu.g/ml gentamicin was added at 60
minutes. At 90 minutes, the macrophages were fixed with 4%
formalin-PBS. Before permeabilization, extracellular bacteria were
bound with Bacto-Listeria O rabbit serum (Difco Laboratories), and
visualized with AMCA-conjugated donkey anti-rabbit secondary
antibodies (Jackson Immunoresearch Labs, West Grove, Pa.).
Subsequently, the macrophages were permeabilized with Triton-X100,
and stained with rhodamine phalloidin and Bacto-Listeria O rabbit
serum. Bacto-Listeria O serum bound to intracellular bacteria,
which is not bound by AMCA antibodies, was visualized with FITC
goat anti rabbit IgG serum. A minimum of 200 bacteria-associated
macrophages from nine different coverslips were examined for each
bacterial strain.
4. Plaque Assay
[0112] Plaquing assays within L2 cell monolayers were performed as
described previously (Jones, S., and D. A. Portnoy. 1994, supra),
with modifications to the methods of measurement (Skobel et al.,
supra). Briefly, L2 cells were grown to confluency in 6-well tissue
culture dishes, and then infected with bacteria for 1 hour.
Subsequently, DMEM agar containing 5 .mu.g/ml gentamicin was added
and plaques were grown for 3 days. Living cells were visualized by
adding on day 3 an additional DMEM-agar overlay containing neutral
red (Gibco-BRL) and incubating overnight.
5. Cytotoxicity Assays
i) Growth in J774 Macrophage-Like Cells
[0113] Intracellular growth of L. monocytogenes was performed as
described previously (Jones, S., and D. A. Portnoy. 1994.
Intracellular growth of bacteria. Methods Enzymol 236:463-467).
Infected J774s were visualized by Dif-Quick.RTM. staining (Fisher
Scientific, Pittsburg, Pa.) and photographed with a Hamamatsu CCD
camera on an inverted NikonTE300 microscope.
ii) Flow Cytometry
[0114] Flow cytometry was performed on cultures of
bone-marrow-derived macrophages (BMO) from C57BL/6 mice as
previously described (Portnoy, D. A., P. S. Jacks, and D. J.
Hinrichs. 1988. Role of hemolysin for the intracellular growth of
Listeria monocytogenes. J Exp Med 167:1459-1471). The assay was
performed as previously published (Glomski, et al., supra), with
the following modifications. In brief, BMO monolayers were infected
with bacteria for 30 minutes, then washed with PBS, and incubated
at 37.degree. until 4 hours post-infection. Unlike the previously
published assay, this assay was performed in a shorter time
interval and no gentamicin was added because the most cytotoxic
strains were adversely affected by the addition of gentamicin even
at the earliest time points. The cells were then removed from the
dish, stained with propidium iodide, and analyzed by flow cytometry
as described.
6. Mouse Infections
[0115] Lethal Dose 50 determination was performed by Cerus
Pharmaceuticals (Concord, Calif.) by tail vein injection in C57BL/6
mice as previously described (Portnoy et al., 1988, supra).
Competitive indexes of LLO mutants, marked with erythromycin
resistance, versus wild-type bacteria or single strain infections
were performed essentially as previously described (Auerbuch, et
al., supra), with the following modifications. Bacterial strains
intended for injection into the mouse were grown in BHI until they
reached an OD600 of 0.5, then 1 ml samples were frozen at
-80.degree. until subsequent use. These frozen samples were thawed
and used to inoculate 10 ml of BHI, and grown at 37.degree. until
an OD of 0.5. Wild type mice were infected by tail vein injection
of 5.times.10.sup.5 CFU. RB6-8C5 monoclonal antibody treated were
infected with 5.times.10.sup.3 CFU, since a dose of
5.times.10.sup.5 CFU lead to death before the 48-hour time point.
1.times.107 CFU were injected in the .DELTA.ActA competitive index
assay. The mutant bacteria were differentiated from the wild-type
bacteria in the competitive index by treating organ lysates with
0.1 .mu.g/ml erythromycin for 30 minutes to induce the resistance
gene, then plating the sample on LB-agar plates and 1 .mu.g/ml
erythromycin BHI-agar plates to establish a ratio of sensitive
(wild type) to resistant (mutant) bacteria at each respective time
point. Mice that were treated with RB6-8C5 were injected with 100
.mu.g monoclonal antibody via the tail vein 6 hours before
bacterial infection. Gentamicin-treated mice were injected with 1
mg Garamycin.RTM. (gentamicin sulfate, Schering Corporation,
Kenilworth, N.J.) in PBS subcutaneously six hours prior to organ
harvest. 12 hours after injection we found the concentration of
gentamicin to be 5.6 .mu.g/ml in the pooled serum of 3 mice
(performed by Debra Randall, Stanford University Hospital Clinical
Labs, Palo Alto, Calif.), which is sufficient to inhibit bacterial
growth.
7. Bacterial Growth in Serum
[0116] Mouse blood was removed by cardiac puncture on mice
anesthetized with isofluorane (Abbott Labs, IL), then allowed to
clot overnight at 4.degree.. The clot was removed and the samples
were centrifuged to allow separation of serum from any remaining
solids. 1.times.10.sup.3 bacteria were added to each sample of 50%
serum-PBS, and then time points were taken by plating dilutions on
LB-agar plates. Incubating the serum at 65.degree. for 30 minutes
produced heat-deactivated serum.
8. Tables
TABLE-US-00002 [0117] TABLE I Lysteria monocytogenes strains used
in study Strain Number Description 10403S Wild Type DP-L-3903 Wild
Type Erm.sup.ra DP-L2161 LLO.sup.b DP-L4017 LLO L461T DP-L4057 LLO
S44A DP-L4384 LLO S44A L461T DP-L4157 LLO L461T Erm.sup.r DP-L4382
LLO S44A Erm.sup.r DP-L4385 LLO S44A L461T Erm.sup.r DP-L3078
ActA.sup.c DP-L4038 ActA LLO L461T DP-L4396 ActA LLO S44A DP-L4397
ActA LLO S44A L461T DP-L4403 ActA LLO L461T Erm.sup.r DP-L4399 ActA
LLO S44A Erm.sup.r DP-L4400 ActA LLO S44A L461T Erm.sup.r
.sup.aErm.sup.r indicates erythromycin resistance .sup.bLLO
indicates that the hly gene has an in-frame deletion in the open
reading frame .sup.cActA indicates that the actA gene has an
in-frame deletion in the open reading frame
TABLE-US-00003 TABLE II Virulence and Escape Efficiency of
Cytotoxic L. monocytogenes Phagosomal Escape Strain Lethal
Dose-50.sup.a (%).sup.b Plaque Size.sup.c WildType 5 .times.
10.sup.4 51 .+-. 15 100% LLO.sup.d .sup. >1 .times. 10.sup.9 0
N.D..sup.e LLO L461T 7.5 .times. 10.sup.6 43 .+-. 9 100 .+-.
2%.sup.f LLO S44A 7.5 .times. 10.sup.7 63 .+-. 9 14 .+-. 5% LLO
S44A .sup. >1 .times. 10.sup.8 58 .+-. 8 N.D..sup. L461T
.sup.aLethal dose 50 is the quantity of bacteria injected into the
tail vein that leads to deact of 50% of C57BL/6 mice. .sup.bPercent
phagosomal escape (.+-. Std. Dev.) is the percentage of
actin-coated bacteria versus total bacteria at 90 min. post
infection. A minimum of 200 bacteria associated macrophage were
counted. .sup.cPlaque size, as a percentage of wild-type, in L2
monolayers after 3 days of bacterial growth with 5 .mu.g/ml
gentamicin, .+-. std. dev. .sup.dStrain LLO (DP-L2161) was
previously published in Jones and Portnoy (1994) .sup.eN.D.,
Plaques not measurable .sup.fThe plaque size of the LLO L461T
strain is sensitive to the gentamicin concentration, as seen in
Glomski et al., (2002).
B. Results
1 Construction and Characterization of Cytotoxic Strains in Cell
Culture
[0118] Four chromosomal alleles of LLO were used in this study
(Table I). Wild-type LLO has an acidic activity optimum and
mediates escape from a vacuole with little observed cytotoxicity to
the host during subsequent intracellular growth (Glomski, et al.,
supra; Geoffroy, C., J. L. Gaillard, J. E. Alouf, and P. Berche.
1987. Purification, characterization, and toxicity of the
sulfhydryl-activated hemolysin listeriolysin O from Listeria
monocytogenes. Infection and Immunity 55:1641-1646). The previously
characterized LLO L461T is active at neutral pH and exhibits some
cytotoxicity due to activity in the neutral pH of the host cytosol
(Glomski, et al., supra). LLO S44A has an acidic activity optimum,
like wild-type LLO, but due to a mutation in the PEST-like sequence
has increased levels of LLO in the host cytosol (Decatur, A. L.,
and D. A. Portnoy. 2000. A PEST-like sequence in listeriolysin O
essential for listeria monocytogenes pathogenicity [In Process
Citation]. Science 290:992-995). A double mutant, LLO S44A L461T,
containing both of the preceding mutations, exhibits the properties
of each of the independent mutations in one molecule, leading to
activity at neutral pH and greater quantities of LLO in the host
cytosol.
[0119] Each of the mutant strains displayed a growth defect in J774
macrophage-like cells over an 8-hour period (FIG. 1A). This growth
defect was not due to an inability to escape from the phagosome
(Table II), and was eliminated by the removal of the extracellular
antibiotic gentamicin (FIG. 1B). Sensitivity to gentamicin was also
observed when these strains were used to form plaques in cell
culture monolayers (Table II). As seen previously (Glomski et al.,
supra) the bacteria with the LLO L461T allele could form plaques of
equivalent size to wild-type bacteria after 3 days of growth at a
low gentamicin concentration, but the plaque size decreased with
increasing gentamicin. Bacteria with the LLO S44A allele could form
plaques 14% the diameter of wild-type bacteria, but only at the
lowest concentration of gentamicin, while the LLO S44A L461T
bacteria were unable to form plaques at all.
[0120] The gentamicin sensitivity of the mutant strains suggested
that these strains were damaging the host cell membrane and
allowing gentamicin to enter and inhibit the growth of the
intracellular bacteria. Thus, plasma membrane damage was assessed
by infecting bone marrow derived macrophages and monitoring host
DNA staining with the membrane impermeant dye propidium iodide
(FIG. 2). Using flow cytometry to quantify staining we found that
3.1% of the macrophages were permeabilized by wild-type bacteria,
while 17.7%, 23.2%, and 60% were permeabilized in 4 hours by
bacteria secreting LLO L461T, LLO S44A, and LLO S44A L461T,
respectively. We conclude from these collective observations that
these strains represent a range of bacterial cytotoxicity, starting
from the least cytotoxic to the most cytotoxic, the strains can be
placed in the following order: wild-type (10403S), LLO L461T, LLO
S44A, and LLO S44A L461T.
2. The Greater the Cytotoxicity the Greater the Virulence
Defect
[0121] We found that the more cytotoxic the strain the higher the
lethal-dose 50 (Table II). Since the measurement of mouse death
does not necessarily indicate the ability of bacteria to multiply
inside the mouse, mice were infected for 24 hours with each strain,
and colony-forming units were established for both the liver and
spleen. We found that the more cytotoxic the strain, the fewer
bacteria were found in both the spleen and the liver (FIG. 3). We
conclude that the more cytotoxic the strain of L. monocytogenes,
the less virulent the strain is in the mouse model of
listeriosis.
[0122] A competitive index assay was performed with each mutant
strain to establish a more accurate measurement of the mutants'
virulence defects relative to the wild-type bacteria (Auerbuch, V.,
L. Lenz, and D. Portnoy. 2001. Development of a competitive index
assay to evaluate the virulence of Listeria monocytogenes actA
mutants during primary and secondary infection of mice. Infection
and Immunity). In this assay, a one-to-one ratio of wild-type
bacteria and erythromycin (erm)-resistant mutants were coinjected
into mice, and the ratio of wild-type bacteria to erm-resistant
(mutant) bacteria was established in the spleen and liver. We found
the trend for the defect in virulence to be similar to the
LD.sub.50 (FIG. 4), where the greater the cytotoxicity of the
strain the fewer bacteria were recovered, relative to the wild-type
bacteria.
3. Granulocytes are a Major Contributor to the Cytotoxic Mutants'
Growth Defect in Mice
[0123] A number of previous studies have shown that neutrophils
contribute to early resistance to L. monocytogenes infection
(Conlan, J. W., and R. J. North. 1994. Neutrophils are essential
for early anti-Listeria defense in the liver, but not in the spleen
or peritoneal cavity, as revealed by a granulocyte-depleting
monoclonal antibody. J Exp Med 179:259-268; Czuprynski, C. J., J.
F. Brown, N. Maroushek, R. D. Wagner, and H. Steinberg. 1994.
Administration of anti-granulocyte mAb RB6-8C5 impairs the
resistance of mice to Listeria monocytogenes infection. J Immunol
152:1836-1846; Gregory, S. H., A. J. Sagnimeni, and E. J. Wing.
1996. Bacteria in the bloodstream are trapped in the liver and
killed by immigrating neutrophils. J Immunol 157:2514-2520).
Indeed, neutrophils readily phagocytose and kill extracellular L.
monocytogenes in vitro (Czuprynski, C. J., P. M. Henson, and P. A.
Campbell. 1984. Killing of Listeria monocytogenes by inflammatory
neutrophils and mononuclear phagocytes from immune and nonimmune
mice. J Leukoc Biol 35:193-208; Rogers, H. W., M. P. Callery, B.
Deck, and E. R. Unanue. 1996. Listeria monocytogenes induces
apoptosis of infected hepatocytes. J Immunol 156:679-684).
Therefore, since the cytotoxic strains were rapidly outcompeted by
wild-type bacteria, we hypothesized that the reduced virulence
observed for the cytotoxic mutants is due to sensitivity to
neutrophils. To address this hypothesis we eliminated neutrophil
infiltration by introducing the anti-GR1 monoclonal antibody
RB6-8C5 into mice 6 hours before infection. RB6-8C5 has been shown
to eliminate neutrophils from the circulation and prevent
infiltration into foci of L. monocytogenes infection (Conlan, J.
W., and R. J. North. 1994. Neutrophils are essential for early
anti-Listeria defense in the liver, but not in the spleen or
peritoneal cavity, as revealed by a granulocyte-depleting
monoclonal antibody. J Exp Med 179:259-268). In neutropenic mice
the relative virulence defect of the cytotoxic mutants was
eliminated 99% in the spleen, allowing the cytotoxic mutants to
grow much more similarly to the coinjected wild-type bacteria in
the competitive index assay (FIG. 4). Less of an effect was
observed in the liver, relative to the spleen, yet by 48 hours the
more cytotoxic mutants' (LLO S44A and LLO S44A L461T) relative
virulence increased 10-fold with the elimination of neutrophils.
These data suggest that the cytotoxic mutants are more susceptible
to neutrophil killing in immunocompetent mice.
4. A Larger Percentage of Cytotoxic Bacteria is Extracellular
[0124] The data described in the preceding section suggested that
cytotoxic strains were exposed to the extracellular environment,
where neutrophils could readily phagocytose and destroy the
bacteria. To further explore this possibility, we injected the
antibiotic gentamicin into infected mice. Gentamicin kills
extracellular bacteria without affecting intracellular bacteria
(Drevets, D. A., T. A. Jelinek, and N. E. Freitag. 2001. Listeria
monocytogenes-infected phagocytes can initiate central nervous
system infection in mice. Infect Immun 69:1344-1350), has no
significant affect on wild-type bacteria at 24 hours
post-infection, and decreases the number of wild-type bacteria in
the liver ten-fold at 48 hours (FIG. 5A). The sensitivity of the
cytotoxic mutants to gentamicin was examined in neutropenic mice
because neutrophils would likely phagocytose and destroy many
extracellular bacteria, thereby obscuring our ability to detect the
effects of gentamicin on extracellular bacteria. The treatment of
mice with gentamicin in a competitive index assay decreased the
ratio of the LLO S44A and the LLO S44A L461T mutants relative to
the wild-type bacteria in the competitive index assay (FIG. 5B). By
48 hours about 99% of the LLO S44A L461T bacteria in the spleen and
liver were sensitive to gentamicin, whereas LLO S44A mutants in the
spleen and the LLO L461T mutants in both organs were less affected
by gentamicin. However, the addition of gentamicin did not
completely reconstitute the resistance of the mice to the level
seen in mice containing active neutrophils.
5. The Virulence Defect of Cytotoxic Mutants is not Due to Defects
in Cell Spread
[0125] The defect observed in bacterial plaquing, in L2 monolayers,
raised the concern that the cytotoxic bacteria may be damaging
their host cells to such a degree that the cytoskeletal dynamics
may have been disrupted. The ability of bacteria to manipulate the
host cytoskeleton is vital to virulence, since bacteria that are
unable to form actin tails are 10,000-fold less virulent (Brundage,
R. A., G. A. Smith, A. Camilli, J. A. Theriot, and D. A. Portnoy.
1993. Expression and phosphorylation of the Listeria monocytogenes
ActA protein in mammalian cells. Proc Natl Acad Sci USA
90:11890-11894). Therefore, it is conceivable that the cytotoxic
mutants are less virulent because they spread less efficiently from
cell to cell. To address this question, we made an in-frame
deletion in the actA (.DELTA.ActA) of each of the cytotoxic mutants
to eliminate the influence of cell-to-cell spread, and then
performed the competitive index assay versus wild-type LLO
.DELTA.ActA. If cell spread was the major factor contributing to
the virulence defect of the cytotoxic mutants, then we would
predict that its elimination would render the mutants similarly
virulent to the .DELTA.ActA bacteria secreting wild-type LLO,
nearing a ratio of 1. This was not the case. Rather, eliminating
ActA function had little affect or increased the defect observed
for the cytotoxic mutants (FIG. 6). Both .DELTA.ActA cytotoxic
strains, secreting LLO L461T and LLO S44A, competed less well
against the .DELTA.ActA with wild type LLO. The LLO S44A L461T
.DELTA.ActA strain became so attenuated that there were
insufficient numbers of bacteria in the liver or spleen to
establish reliable colony forming units.
6. Growth of L. monocytogenes in Mouse Serum
[0126] Despite the fact that phagocytes are responsible for much of
the growth defect of the cytotoxic bacteria in the mouse, their
removal does not make the mutants grow as well as the wild-type
bacteria under any of our experimental conditions. We therefore
reasoned that cytotoxic bacteria might not divide at the rate
afforded by the intracellular environment. Thus, we determined the
doubling times of bacteria growing in mouse serum. We found that L.
monocytogenes grows in mouse serum--native, heat deactivated, or
derived from infected mice--but with a maximum doubling time of 58
minutes. This growth rate is significantly slower than the
previously published maximal intracellular doubling time of 42
minutes (Glomski et al., supra). Considering that bacterial growth
is exponential, a 16-minute difference in doubling time between the
two different environments can quickly lead to great differences in
bacterial numbers, and could thus account for some of the growth
defects we observe for the cytotoxic mutants. Interestingly,
bacteria grew well in fetal bovine serum and mouse serum
supplemented with BHI, with doubling times of 34 minutes and 31
minutes, respectively, suggesting that mouse serum did not have an
inhibitory effect, but was more likely to be nutrient limiting
C. Discussion
[0127] In this study we presented evidence that the
intracytoplasmic bacterial pathogen L. monocytogenes is less
virulent when it compromises its intracellular niche. We used
cytotoxic mutants with various levels of cytotoxicity to show that:
1) cytotoxic mutants were more sensitive to neutrophils, and 2)
cytotoxic mutants were more susceptible to the extracellular
antibiotic gentamicin. These data indicate that cytotoxic L.
monocytogenes mutants are exposed to the extracellular environment
and are susceptible to elimination by neutrophils. These
conclusions indicate the following model to explain why L.
monocytogenes (and possibly other intracellular pathogens) needs to
balance the activity of its cytolysin, LLO, between functionality
and cytotoxicity. When the cytolysin is inactive, or absent, the
bacteria are phagocytosed, and are trapped and later killed in the
phagosome, and thus cannot multiply. At the other extreme, an
overly active LLO, due to greater biochemical activity and/or
greater cytosolic quantity, are phagocytosed, escape from the
phagosome, and begin to grow in the cytosol. However, these
cytotoxic bacteria damage their host cell, which then exposes them
to the influence of extracellular defenses and nutrient limitation
that limits or terminates the infection. The wild-type bacteria
fall in between these two extremes, striking a balance, controlling
LLO activity to mediate the efficient lysis of the phagosome, while
limiting the function of LLO to avoid damage to the host cell. This
balance allows the wild-type bacteria to escape to the cytosol,
multiply, and spread from cell to cell. The wild-type bacteria
eventually cause enough damage to their host cell to expose them to
the same environment that adversely affects the cytotoxic mutants,
but it occurs at a time late enough to have allowed a larger number
of bacteria to grow and to spread out of the initial cell into new
host cells. As such, the wild-type bacteria can continue to spread
the infection through host tissues and continue to increase
bacterial numbers.
[0128] Implicit in the above model is the importance of bacterial
cell-to-cell spread, thus we explored the possibility that the
cytotoxic mutants' virulence defect was caused by cytotoxic
disruption of the actin based cell-spread process by eliminating
cell-to-cell spread via the deletion of ActA. If spreading from
cell to cell was the primary mechanism by which the cytotoxic
mutants were causing their growth defect, one would predict that
when actin based cell-to-cell spread was eliminated the cytotoxic
bacteria would grow more similarly to the .DELTA.ActA bacteria
secreting wild-type LLO. This was not the case. The growth of the
bacteria was unaffected or further decreased when ActA was deleted.
Indeed, we observed a striking 3-log decrease in growth of the LLO
S44A mutant at 24 hours, relative to a .DELTA.ActA wild-type LLO
strain. As seen in previous tissue culture assays, bacteria that
cannot nucleate actin are more cytotoxic, and thus the cytotoxicity
of the mutants may be exacerbated by the elimination of cell
spread. The simplest explanation for this observation is that the
elimination of the migration of a portion of the bacteria from the
initially infected cell into a new cell effectively increases the
number of bacteria within the initial cell. However, the increased
cytotoxicity of ActA-deleted bacteria may be more complicated than
this simple hypothesis and may instead suggest a link between ActA
and LLO function.
[0129] As reported previously, neutrophils were vital to limiting
bacterial growth. However, they were more effective at controlling
the cytotoxic mutants than wild-type bacteria, since their
elimination allowed the cytotoxic bacteria to grow at a rate more
similar to wild-type bacteria. We found that the cytotoxic mutants
were less sensitive to the function of neutrophils in the liver
than in the spleen. Based on our model, where cytotoxic mutants are
exposed to extracellular defenses, there are a number of
explanations that may account for these differences observed in
different tissues. One possibility is that hepatocytes are capable
of coping with cytotoxic bacteria better than splenic cells. If
hepatocytes repair damaged membranes or resist lysis, the cytotoxic
mutants would persist in a protected environment longer than in
cells that were more sensitive to the lytic activity of LLO.
Indeed, the ability of the liver to rapidly repair from toxic
insults and tissue damage is well documented. A second possibility
is that after bacteria lyse their initial host cell within the
liver they can be phagocytosed by neighboring cells more readily in
the liver, thus reducing their extracellular residence time. Rapid
phagocytosis in the liver may be aided by the function of the
bacterial protein lnlB, which mediates the uptake of L.
monocytogenes into hepatocytes, but does not mediate uptake into a
number of other cell types. Eliminating lnlB expression would help
to determine if lnlB-mediated hepatocyte phagocytosis allows
cytotoxic mutants to reduce their attenuation in the liver.
[0130] We did not directly address the mechanism by which
neutrophils preferentially eliminate cytotoxic mutants, but there
are a number of defense strategies that could be functioning. It
has been shown in previous studies that neutrophils are capable of
killing L. monocytogenes in vitro, yet are incapable of killing
intracellular bacteria within hepatocytes in tissue culture.
Therefore it is likely that neutrophils simply have greater access
to the cytotoxic mutants because the bacteria are extracellular.
However, the importance of neutrophils in controlling wild-type
infection also implies that wild-type bacteria will eventually have
some degree of extracellular exposure as well. It is also possible
that neutrophils selectively lyse cells infected with cytotoxic
bacteria. Previous publications reported that neutrophils are
capable of lysing L. monocytogenes-infected hepatocytes, though the
mechanism, whether direct or indirect, has not been established.
One might hypothesize that the lysis-targeting signal received by
neutrophils from infected cells may be elicited by cell damage.
Since the cytotoxic bacteria damage the host cell, the cells
infected by cytotoxic bacteria would thus be targeted for lysis
earlier than the wild-type bacteria.
[0131] Permeabilization of the host cell's plasma membrane may
allow the efflux of activated complement or bacterial components,
such as formylated peptides, that are chemoattractants of
neutrophils that have been shown to be important in the mouse's
resistance to L. monocytogenes. In this scenario, the cytotoxic
bacteria would be targeted for phagocytosis and destruction earlier
than the wild-type bacteria, since they would emit chemotactic
signals from within damaged cells. Exposure to the lytic functions
of complement is unlikely to directly affect L. monocytogenes since
we have described, in this study, that the bacteria grow at similar
rates in normal of heat-deactivated mouse serum. However, the
opsonizing properties of complement may act to target the cytotoxic
bacteria for more efficient phagocytosis.
[0132] An alternate explanation for the virulence defect of the
cytotoxic mutants is that they are a more visible threat than the
wild-type bacteria. By damaging their host cells the bacteria may
cause the liberation of more inflammatory cytokines, and thereby
recruit more inflammatory cells to the foci of infection, as well
as activate the function of those infiltrates. A number of
inflammatory cytokines, including TNF.alpha., IFN.gamma.,
IL-1.alpha./.beta. and IL-6, are vital for resistance to L.
monocytogenes. Thus, The greater presence of inflammatory cells,
such as neutrophils, that are activated to a greater degree would
then foster the greater clearance of the bacteria from the foci of
infection.
[0133] The antibiotic gentamicin has been used in both tissue
culture and in vivo as a means to eliminate extracellular bacteria.
In this study we found that our two most cytotoxic mutants,
secreting LLO S44A or LLO S44A L461T, were particularly sensitive
to gentamicin injected into infected mice. However, this effect was
only detectable when neutrophils were first eliminated. This
finding indicates that the same population of bacteria that are
sensitive to gentamicin are also sensitive to the activity of
neutrophils. Interestingly, gentamicin did not entirely restore
neutropenic mice to the level of resistance observed in
immunocompetent mice. This finding indicates, in agreement with the
rest of our data, that the virulence defect observed for the
cytotoxic mutants is multifactoral. Additionally, the lack of
gentamicin's ability to completely replace the activity of
neutrophils may indicate that neutrophils are playing a broader
role in bacterial clearance than simply phagocytosing and
destroying extracellular bacteria.
[0134] L. monocytogenes is naturally auxotrophic for several amino
acid and vitamins. Therefore, it is not surprising that these
bacteria do not replicate as well in mouse serum as in mammalian
cytoplasm. The importance of a hexose phosphate transporter (hpt)
for intracytoplasmic growth of L. monocytogenes has previously been
reported. HPT allows the bacteria to utilize glucose-1-phosphate,
which is a breakdown product of glycogen in the liver. Thus, there
is evidence that pathogens have not only evolved virulence factors
to customize their pathogenic niche, but they may have also tuned
their metabolism to each of their respective niches.
[0135] This study presents data that suggests that maintenance of
the cytoplasmic niche is vital to L monocytogenes pathogenesis. If
these bacteria do not properly manage the lytic effects of the
pore-forming cytolysin LLO, they compromise their ability to grow
in the host due to pressures from the extracellular defenses.
Similarly, if the host acts cytolytically on infected cells,
bacterial clearance is also achieved. Indeed, cytotoxic
T-lymphocytes are the primary effector cell of the adaptive immune
response to L. monocytogenes that function to target and lyse
infected cells. Thus, whether it is caused by the bacteria or by
the host, the movement of L. monocytogenes from an intracellular
compartment to an extracellular compartment reduces the ability of
the bacteria to grow. To reduce its extracellular residence time L.
monocytogenes has developed a number of virulence factors to ensure
that it becomes, thrives, and remains primarily intracellular.
D. Conclusions
[0136] In this study, a series of strains with mutations in LLO
were constructed with varying degrees of cytotoxicity. We found
that the more cytotoxic the strain in cell culture, the less
virulent they were in mice. Induction of neutropenia increased the
virulence of the cytotoxic strains 100-fold in the spleen and
10-fold in the liver. The virulence defect was partially restored
in neutropenic mice by adding gentamicin, an antibiotic that kills
extracellular bacteria. Additionally, L. monocytogenes grew more
slowly in extracellular fluid, mouse serum, than within tissue
culture cells. We conclude that L. monocytogenes controls the
cytolytic activity of LLO to maintain its intracellular
nutritionally rich niche and avoid extracellular defenses of the
host.
VI. lplA Mutants: DP-L2214 and DP-L4364
[0137] To identify genes important for intracellular growth, we
performed a modified intracellular methicillin selection on a
transposon insertion library of L. monocytogenes (A. Camilli, C. R.
Paynton, D. A. Portnoy, Proc Natl Acad Sci USA 86, 5522-6 (July,
1989)). A pool of Tn917-LTV3 insertion mutants was used to infect
the J774 mouse macrophage cell line. At 4 hours post infection
(h.p.i.), sufficient time to permit escape of bacteria from the
phagosome, the infected macrophages were treated with 1 mg/ml
methicillin to select against dividing bacteria. At 24 h.p.i.
bacteria were harvested from the macrophage monolayer by host cell
lysis and cultured in rich bacteriological media. The selection was
repeated twice before isolating individual bacterial colonies. We
identified three classes of mutants from the methicillin selection.
The first class of mutants was phenotypically non-hemolytic on
blood agar. Non-hemolytic strains of L. monocytogenes remain in the
vacuole where they are unable to replicate and thus would not be
susceptible to methicillin killing. The second class of mutants
isolated consisted of threonine and proline auxotrophs. A third
class of mutants was hemolytic and prototrophic, and therefore
likely contained transposon insertions in genes important
specifically for intracellular growth; one of these mutants,
DP-L2214, was selected for further analysis.
DP-L2214 exhibited normal growth in both rich and minimal
bacteriological media (data not shown). In contrast, replication of
DP-L2214 in J774 macrophages aborted at approximately 5 h.p.i.
Thus, DP-L2214 has a replication defect that is restricted to the
intracellular environment. By sequencing the DNA adjacent to the
transposon, we identified an open reading frame disrupted by the
Tn917-LTV3 insertion. A BLAST search of the L. monocytogenes genome
using this sequence revealed homology to the lipoate protein ligase
gene (lplA) of Escherichia coli, therefore we have termed this gene
lplA1 (L. monocytogenes EGD-e lmo0931) (Glaser et al., Science 294,
849-52 (Oct. 26, 2001)). The L. monocytogenes lplA1 protein and DNA
sequence are available on the Listeria genome website, Listilist,
which has a website having "genolist.pasteur.fr/ListiList/" after
"http://".
[0138] The published L. monocytogenes genome sequence also revealed
the existence of a second lplA-like gene, lplA2 (L. monocytogenes
EGD-e lmo0764) (Glaser et al., supra). To verify that the
intracellular replication defect of DP-L2214 was due to
interruption of the lplA1 open reading frame, we constructed an in
frame deletion of the lplA1 gene and were able to complement
DP-L2214 with a plasmid containing lplA1. The .DELTA.lplA1 strain
(DP-L4364) was characterized in an intracellular replication assay
in the J774 macrophage cell line. Growth of the lplA1 deletion
strain appeared similar to DP-L2214, in doubling time and kinetics.
.DELTA.lplA1 was also compared to DP-L2214 in a L2 fibroblast
plaquing assay that measures intracellular growth over a 3 day
infection. Both .DELTA.lplA1 and DP-L2214 exhibited plaque size
that was 56% and 58% of the wildtype plaque size respectively. In
addition, we observed a unique mixed plaquing phenotype associated
with both .DELTA.lplA1 and DP-L2214; the standard deviation from
the average plaque size was 3 times greater in the mutants than in
the wildtype strain. Surprisingly, plaque size and frequency of the
.DELTA.lplA1 mutant and DP-L2214, but not the wildtype strain, were
negatively affected by a decrease in thickness of the agar overlay.
Taken together, these results strongly suggest that disruption of
the lplA1 ORF by Tn917 in DP-L2214 resulted in a loss of function
and is responsible for the intracellular replication defect.
[0139] E. coli LplA ligates free lipoic acid to the E2 subunit of
pyruvate dehydrogenase (PDH) and other structurally related enzymes
(D. E. Brookfield, J. Green, S. T. Ali, R. S. Machado, J. R. Guest,
FEBS Lett 295, 13-6 (Dec. 16, 1991). Using an antibody that
recognizes lipoic acid, we analyzed the profile of lipoylated
proteins in L. monocytogenes grown in broth culture by Western
blot. In brain-heart infusion (BHI) broth, a rich bacteriological
media, the anti-LA antibody revealed one dominant protein that was
identified as the L. monocytogenes E2 subunit of pyruvate
dehydrogenase by mass spectroscopy. No difference in lipoylation of
E2 PDH was observed between the wildtype and the
.DELTA.lplA1strain. These data identify E2 PDH as a major target of
lipoic acid modification in L. monocytogenes, consistent with
reported observations in E. coli. We next determined the
lipoylation state of E2 PDH in L. monocytogenes during
intracellular growth. J774 macrophages were infected with either
wildtype L. monocytogenes or the .DELTA.lplA1mutant strain at high
multiplicity of infection (m.o.i.) such that the majority of cells
contained 1 or more bacteria. At 4 h.p.i. total cell lysates were
prepared from intracellular bacteria for SDS-PAGE and Western blot
analysis. Equivalent loading of bacterial proteins was confirmed by
Western Blot analysis of an unrelated protein, ActA. While
lipoylated E2 PDH was observed in wildtype bacteria grown in
macrophages, the modified form of E2 PDH was not present in
.DELTA.lplA1 lysates.
[0140] The pool of modified E2 PDH present in the bacterial
innoculum after overnight culture in rich media may have allowed
the .DELTA.lplA1 strain to undergo approximately 4 rounds of cell
division in the host cell over 5 hrs before depleting functional E2
PDH. If lipoylated E2 was depleted after several rounds of cells
division, .DELTA.lplA1 mutant bacteria isolated from host cells
should not be able to establish a productive infection. We isolated
wildtype and mutant bacteria from infected macrophages 4 h.p.i. and
used these bacteria to infect a new monolayer of macrophages.
During the subsequent infection the wildtype strain grew very
aggressively while the .DELTA.lplA1 strain did not replicate at
all. Thus, despite the presence of a second lipoate protein ligase
in the genome, we conclude that lplA1 performs a critical and
non-redundant function during intracellular growth that involves
modification of E2 pyruvate dehydrogenase.
[0141] Lipoic acid has been shown to have anti-oxidant properties
in mammalian cells (L. Packer, Drug Metab Rev 30, 245-75 (May,
1998)). Therefore, we considered the possibility that lipoic acid
in L. monocytogenes as part of the PDH complex might also act to
protect the bacteria from oxidative stress in the host cell. Host
cells may have several sources of oxidative stress. First,
macrophages are able to produce reactive oxygen and nitrogen
intermediates in response to phagocytosis. Secondly, all cells
produce reactive oxygen species as a normal by-product of oxidative
metabolism. We observed that in an L2 plaquing assay, a change in
the thickness of the agar overlay, which would increase oxygen
permeability to the fibroblast monolayer, caused a 25% decrease in
average plaque size and number of plaques formed by the
.DELTA.lplA1strain compared to wildtype. To further investigate the
role of LplA1 in protection from oxidative stress, we tested
intracellular bacteria for DNA damage using the TUNEL assay to
detect free 3'OH ends. Reactive oxygen species cause oxidation of
nucleic acids, as well as proteins and lipids; therefore, we
reasoned that bacteria in an environment of oxidative stress should
exhibit DNA strand breaks. Primary bone marrow derived macrophages
were infected with either wildtype L. monocytogenes or
.DELTA.lplA1. At 9 h.p.i., the macrophages were subjected to TUNEL
staining. We were able to observe TUNEL positive bacteria in
macrophages infected by the .DELTA.lplA1mutant strain, but not
macrophages infected by wildtype bacteria. Although the incidence
of TUNEL positive bacteria was rare, they occurred in clusters,
such that the TUNEL positive bacteria in one cluster were contained
within one host cell. The presence of DNA strand breaks in
.DELTA.lplA1mutant bacteria supports the hypothesis that
E2-lipoamide protects bacteria against oxidative stress.
[0142] Our cell culture assays revealed a role for lplA1 in
intracellular replication in macrophages. We also tested the
virulence of the .DELTA.lplA1mutant in an intravenous (i.v.) mouse
model of infection by determining the LD.sub.50. (See Auerbach et
al., supra). In the Balb/c background, the LD.sub.50 of the
lplA1mutant strains were 250 to 300-fold less virulent than the
wildtype parental L. monocytogenes strain (Table 4).
TABLE-US-00004 TABLE IV Strain Genotype Phenotype LD.sub.50 1040S
Wildtype Wildtype 2 .times. 10.sup.4 DP-L2214 lplA1::Tn917 Abortive
Growth 6 .times. 10.sup.6 DP-L4364 .DELTA.lplA1 Abortive Growth 5
.times. 10.sup.6
Although the lplA1 mutants were less virulent, they stimulated a
robust CD8.sup.+ T cell response suggesting that these strains may
be promising candidates for vaccine development (data not shown).
Our in vivo experiments highlight the important role of LplA1 in L.
monocytogenes pathogenesis and suggest that utilization of lipoic
acid is important for growth of bacterial pathogens in the
host.
[0143] All organisms have mechanisms to increase survival and
replication in response to stress. As an intracellular pathogen, L.
monocytogenes must be able replicate in cytosolic conditions.
Although it is difficult to define comprehensively what components
of the cytosol are required for bacterial growth and survival, the
methicillin selection allowed us to functionally identify genes
important for growth in the cytosol. The selection of the
lplA1::Tn917 mutant by methicillin, despite the presence of a
second lipoate protein ligase, lplA2, suggests that L.
monocytogenes encounters lipoic acid in a restricted form in the
host cytosol that requires an additional lipoate protein ligase
activity for intracellular growth. E. coli also has two lipoate
protein ligases, LplA and LipB, that transfer lipoic acid from
different sources to E2 PDH (T. W. Morris, K. E. Reed, J. E.
Cronan, Jr., J Bacteriol 177, 1-10 (January, 1995); K. E. Reed, J.
E. Cronan, Jr., J Bacteriol 175, 1325-36 (March, 1993)). E. coli
LipB utilizes de novo synthesized lipoic acid from octanoyl-acyl
carrier protein. E. coli LplA ligates scavenged free lipoic acid to
E2 PDH. L. monocytogenes is a lipoic acid auxotroph, and uses
lipoic acid scavenged from its environment; maintenance of two
lipoate protein ligase genes in the genome implies different
external sources of lipoic acid. Studies of lipoic acid metabolism
in mammalian cells suggest that very little free lipoic acid is
present in the cytosol under normal physiological conditions. Thus,
we hypothesize that in L. monocytogenes, LplA2 may play a role in
nutrient rich conditions when free lipoic acid is available, but
LplA1 is more important in the host cell where lipoyl groups may
have to be scavenged from peptides transported from the cytosol. L.
monocytogenes is known to use peptides from the host cytosol as a
source for amino acids. As E2 PDH is an abundant protein in all
organisms, it is likely that peptides modified by lipoamide would
be available in the host cytosol due to normal protein turnover.
The enzymatic specificities of LplA1 and LplA2 are unknown and will
be the subject of future investigation.
[0144] Our data show that E2 PDH is the primary target of LplA1 in
L. monocytogenes. Previous research has focused on the function of
PDH in intermediary metabolism in converting pyruvate into acetyl
CoA which represents the entry of carbon into the tricarboxylic
acid cycle. The metabolic function of PDH, which requires the E1,
E2 and E3 subunits, is important for aerobic growth, and lack of
PDH enzymatic activity is likely responsible for the abortive
growth phenotype we have observed in the .DELTA.lplA1mutant strain.
However recent studies have revealed novel functions for the E2
subunit of PDH that appear independent of the PDH holoenzyme. E2
and E3, required for the redox capacity of lipoamide, contribute to
the reducing capacity of a protein complex isolated from
Mycobacterium tuberculosis extracts. This reducing activity may
mediate M. tuberculosis resistance to oxidative stress in vivo. Our
data showing that the .DELTA.lplA1strain is more susceptible to
oxidative stress are consistent with this hypothesis. In addition,
studies in Pseudomonas aeruginosa, B. subtilis, and B. thuringensis
have revealed a role for E2 PDH in DNA binding and/or
transcriptional regulation. The requirement for lipoamide
modification in those processes is not known. The abortive growth
phenotype we observe in lplA1 mutants is due primarily to a defect
in PDH metabolic function. However, the possibility that
E2-lipoamide may also regulate other bacterial processes during an
L. monocytogenes infection, such as protection from oxidative
stress or transcriptional regulation, remains to be explored. Like
L. monocytogenes, some other bacterial species, including Chlamydia
trachomatis, Staphylococcus aureus and Streptococcus pyogenes, also
have two lplA-like genes but no lipB homolog, suggesting that
utilization of host derived lipoic acid may be critical for
replication of many bacterial pathogens.
VII. Use of DP-L4017 as a Vaccine
[0145] One hundred and twenty Balb/c mice are divided into three
groups of 40. One group is immunized with one-tenth of an LD.sub.50
of wild-type L. monocytogenes, one group is immunized with sterile
saline and the third group is immunized with a recombinant L.
monocytogenes vaccine vector which is based on the attenuated
DP-L4017 strain that is transformed to secrete influenza
nucleoprotein (LM-NP). After two weeks, each group receives a
similar booster immunization. This immunization schedule is
determined to produce strong CTL responses against influenza
nucleoprotein. Two weeks after the last immunization, animals in
each group are challenged subcutaneously with either CT26 or RENCA
tumor cell lines which have been transfected with the same
influenza nucleoprotein gene that was used to transform the L.
monocytogenes vector (CT26-NP or RENCA-NP, respectively) or with
the parental CT26 or RENCA line. Each mouse is administered
5.times.10.sup.5 tumor cells subcutaneously via the flank. Tumor
growth is monitored every two days in these six groups of animals
by direct measurement of the diameter of the tumor. Efficacy of the
vaccine is demonstrated by observing slower growing tumors or the
absence of tumors in mice vaccinated with LM-NP and administered a
tumor cell line expressing NP.
CTL Generated by Immunizing Balb/c Mice with LM-NP can Kill Tumor
Cells CT26 and RENCA that Express NP In Vitro
[0146] Mice are immunized with 0.1 LD.sub.50 of LM-NP. Two weeks
later, the mice are sacrificed and primary cultures are set up of
spleen cells with either influenza infected (A/PR8/34) splenocytes
or with a synthetic peptide 147-158 known to represent the
immunodominant epitope of the NP protein. After four days in
culture, the cytolytic activity of both populations is measured
against CT26-NP, RENCA-NP and the parental cell lines CT26 and
RENCA. A positive control is included (P815, a mastocytoma tumor
cell line known to be efficiently lysed by H-2.sup.d restricted CTL
in the presence of the peptide or when infected by A/PR8/34).
RENCA-NP and CT26-NP, but not the parental lines, are lysed by NP
specific effectors induced by immunizing with LM-NP and expanded
with A/PR8/34. A similar experiment in which the effectors are
expanded with peptide show similar results.
[0147] It is evident from the above results and discussion that the
present invention provides important attenuated Listeria strains
that find use in a variety of different applications. As such, the
present invention represents a significant contribution to the
art.
[0148] All publications and patent application cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference. The
citation of any publication is for its disclosure prior to the
filing date and should not be construed as an admission that the
present invention is not entitled to antedate such publication by
virtue of prior invention.
[0149] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it is readily apparent to those of ordinary skill
in the art in light of the teachings of this invention that certain
changes and modifications may be made thereto without departing
from the spirit or scope of the appended claims.
Sequence CWU 1
1
44134DNAL.monocytogenes 1ggaattccat atgaaggatg catctgcatt caat
34250DNAL.monocytogenes 2cgggatcctt attagtggtg gtggtggtgg
tgttcgattg gattatctac 50338DNAL.monocytogenes 3ggaattccca
tgggaaagga tataacagat aaaaatca 38454DNAL.monocytogenes 4cgggatcctt
attagtggtg gtggtggtgg tgattgtaag taatactaga tcca
54529DNAL.monocytogenes 5acgcgtcgac ttattagtgg tggtggtgg
29628DNAL.monocytogenes 6ggaattccat atgaaggatg catctgca
28736DNAL.monocytogenes 7actatgatct aagtttattt ttccatctgt ataagc
36836DNAL.monocytogenes 8gcttatacag atggaaaaat aaacttagat catagt
36951DNAL.monocytogenes 9ggaggatacg ttgctcaatt cgaagtagcc
tgggatgaag taaattatga t 511051DNAL.monocytogenes 10atcataattt
acttcatccc aggctacttc gaattgagca acgtatcctc c
511154DNAL.monocytogenes 11aacatttctt gggatgaagt atcatatgac
aaagaaggta acgaaattgt tcaa 541254DNAL.monocytogenes 12ttgaacaatt
tcgttacctt ctttgtcata tgatacttca tcccaagaaa tgtt
541351DNAL.monocytogenes 13tatgatcctg aaggtaacga agtattaact
cataaaaact ggagcgaaaa c 511451DNAL.monocytogenes 14gttttcgctc
cagtttttat gagttaatac ttcgttacct tcaggatcat a
511554DNAL.monocytogenes 15aacgaaattg ttcaacataa aacatgggat
ggaaacaata aaagcaagct agct 541654DNAL.monocytogenes 16agctagcttg
cttttattgt ttccatccca tgttttatgt tgaacaattt cgtt
541757DNAL.monocytogenes 17cataaaaact ggagcgaaaa ctatcaagat
aaaacagctc atttcacatc gtccatc 571857DNAL.monocytogenes 18gatggacgat
gtgaaatgag ctgttttatc ttgatagttt tcgctccagt ttttatg
571954DNAL.monocytogenes 19aataaaagca agctagctca ttattcaaca
gtaatctatt tgcctggtaa cgcg 542054DNAL.monocytogenes 20cgcgttacca
ggcaaataga ttactgttga ataatgagct agcttgcttt tatt
542154DNAL.monocytogenes 21gctcatttca catcgtccat ccctcttgaa
gctaacgcga gaaatattaa tgtt 542254DNAL.monocytogenes 22aacattaata
tttctcgcgt tagcttcaag agggatggac gatgtgaaat gagc
542357DNAL.monocytogenes 23cctggtaacg cgagaaatat tagaataaaa
gcaagagaat gcactggttt agcttgg 572457DNAL.monocytogenes 24ccaagctaaa
ccagtgcatt ctcttgcttt tattctaata tttctcgcgt taccagg
572533DNAL.monocytogenes 25tgggaatggt ggagagatgt aattgatgac cgg
332633DNAL.monocytogenes 26ccggtcatca attacatctc tccaccattc cca
332759DNAL.monocytogenes 27gggaatggtg gagaacggta attagtgaat
atgatgttcc acttgtgaaa aatagaaat 592859DNAL.monocytogenes
28atttctattt ttcacaagtg gaacatcata ttcactaatt accgttctcc accattccc
592948DNAL.monocytogenes 29gaccggaact taccacttac aaataatata
aatatctcca tctggggc 483048DNAL.monocytogenes 30gccccagatg
gagatattta tattatttgt aagtggtaag ttccggtc 483136DNAL.monocytogenes
31agatccaggg tataaagtgg tgccccagat ggagat 363236DNAL.monocytogenes
32atctccatct ggggcaccac tttataccct ggatct 363339DNAL.monocytogenes
33gaaaacaata aaagcaagac agctcatttc acatcgtcc
393439DNAL.monocytogenes 34ggacgatgtg aaatgagctg tcttgctttt
attgttttc 393533DNAL.monocytogenes 35tttctgcaga gaaacacgcg
gatgaaatcg ata 333634DNAL.monocytogenes 36aaaagagctc tctggaattg
aggatgattt cttt 343729DNAL.monocytogenes 37gggtcgactc ctttgattag
tatattcct 293822DNAL.monocytogenes 38tttggataag cttgagcata tt
223926DNAL.monocytogenes 39gcaccaccag cagctccgcc tgcaag
264026DNAL.monocytogenes 40cttgcaggcg gagctgctgg tggtgc
264130DNAL.monocytogenes 41cccaagcttc taaagttatg gaaataagac
304227DNAL.monocytogenes 42ccgagctcac ggattttggt acttgat
27433550DNAL. monocytogenes 43gaattcttct gcttgagcgt tcatgtctca
tcccccaatc gttttttatc gccctttttt 60aaaataccct aaaaacatta ggcagtaaca
acaattgtta gctgttgaaa gaaagtcacg 120ctaaatgatg ttttttacat
ataggatttt attatacaaa ttttgattcg caaaagaaat 180gcatacatat
ttaaaaacgg atttatttag atgttaaaat tgaaatagag ttagtatatg
240gttccgaggt tgctcggaga tatactaacc cttttttgta ggaataatat
atgttagttg 300aatttattgt tttttatgat gtttttaatt gtttgttttt
cggggaagtc catgattagt 360atgcctaatc ctcgaacttt ttccgatgtt
aagttgagta cgaattgctc tactttgttg 420tttaatgctg cagcatactg
acgaggtgtg aatgttaatg aagtggcgct aatatggtta 480agaaaaagtt
tattgtccgc tttggaagct tgataagcag tctggacaat ctctttgaat
540tttgttttct cactcggacc attgtagtca tcttgaatta cttggttagg
tgcgccgaac 600tgcatgccga atttgcgtga gttaatgact aatggctttt
ttgtgtggtt ctctgaaagt 660aataatattt ttccgcggac atcttttaat
gtagggattt tattgctcgt gtcagttctg 720ggagtagtgt aaaaataatc
tttataaatg ttgattagtg gttggatccg ataatcaaaa 780ctatcgttgc
tgttttgctc gtcttttaaa cgcataataa tggtttcttt tggatttttc
840tttaaaaatt gagtaatcgt ttctaataca cctgaaagtg atgcatttaa
aaaaattggc 900ccatggtaaa tgttgagatt gtcttttgct ctaatatcga
tgtaccgtat tcctgcttct 960agttgttggt acaatgacat cgtttgtgtt
tgagctagtg gtttggttaa tgtccatgtt 1020atgtctccgt tatagctcat
cgtatcatgt gtacctggta tagagagcgc tgctaggttt 1080gttgtgtcag
gtagagcgga catccattgt tttgtagtta cagagttctt tattggctta
1140ttccagttat taagcgaata tgcttttccg cctaatggga aagtaaaaaa
gtataaaata 1200aaacagagta ataaaactaa tgtgcgttgc aaataattct
tatacaaaat ggccccctcc 1260tttgattagt atattcctat cttaaagtga
cttttatgtt gaggcattaa catttgttaa 1320cgacgataaa gggacagcag
gactagaata aagctataaa gcaagcatat aatattgcgt 1380ttcatcttta
gaagcgaatt tcgccaatat tataattatc aaaagagagg ggtggcaaac
1440ggtatttggc attattaggt taaaaaatgt agaaggagag tgaaacccat
gaaaaaaata 1500atgctagttt ttattacact tatattagtt agtctaccaa
ttgcgcaaca aactgaagca 1560aaggatgcat ctgcattcaa taaagaaaat
tcaatttcat ccatggcacc accagcatct 1620ccgcctgcaa gtcctaagac
gccaatcgaa aagaaacacg cggatgaaat cgataagtat 1680atacaaggat
tggattacaa taaaaacaat gtattagtat accacggaga tgcagtgaca
1740aatgtgccgc caagaaaagg ttacaaagat ggaaatgaat atattgttgt
ggagaaaaag 1800aagaaatcca tcaatcaaaa taatgcagac attcaagttg
tgaatgcaat ttcgagccta 1860acctatccag gtgctctcgt aaaagcgaat
tcggaattag tagaaaatca accagatgtt 1920ctccctgtaa aacgtgattc
attaacactc agcattgatt tgccaggtat gactaatcaa 1980gacaataaaa
tcgttgtaaa aaatgccact aaatcaaacg ttaacaacgc agtaaataca
2040ttagtggaaa gatggaatga aaaatatgct caagcttatc caaatgtaag
tgcaaaaatt 2100gattatgatg acgaaatggc ttacagtgaa tcacaattaa
ttgcgaaatt tggtacagca 2160tttaaagctg taaataatag cttgaatgta
aacttcggcg caatcagtga agggaaaatg 2220caagaagaag tcattagttt
taaacaaatt tactataacg tgaatgttaa tgaacctaca 2280agaccttcca
gatttttcgg caaagctgtt actaaagagc agttgcaagc gcttggagtg
2340aatgcagaaa atcctcctgc atatatctca agtgtggcgt atggccgtca
agtttatttg 2400aaattatcaa ctaattccca tagtactaaa gtaaaagctg
cttttgatgc tgccgtaagc 2460ggaaaatctg tctcaggtga tgtagaacta
acaaatatca tcaaaaattc ttccttcaaa 2520gccgtaattt acggaggttc
cgcaaaagat gaagttcaaa tcatcgacgg caacctcgga 2580gacttacgcg
atattttgaa aaaaggcgct acttttaatc gagaaacacc aggagttccc
2640attgcttata caacaaactt cctaaaagac aatgaattag ctgttattaa
aaacaactca 2700gaatatattg aaacaacttc aaaagcttat acagatggaa
aaattaacat cgatcactct 2760ggaggatacg ttgctcaatt caacatttct
tgggatgaag taaattatga tcctgaaggt 2820aacgaaattg ttcaacataa
aaactggagc gaaaacaata aaagcaagct agctcatttc 2880acatcgtcca
tctatttgcc aggtaacgcg agaaatatta atgtttacgc taaagaatgc
2940actggtttag cttgggaatg gtggagaacg gtaattgatg accggaactt
accacttgtg 3000aaaaatagaa atatctccat ctggggcacc acgctttatc
cgaaatatag taataaagta 3060gataatccaa tcgaataatt gtaaaagtaa
taaaaaatta agaataaaac cgcttaacac 3120acacgaaaaa ataagcttgt
tttgcactct tcgtaaatta ttttgtgaag aatgtagaaa 3180caggcttatt
ttttaatttt tttagaagaa ttaacaaatg taaaagaata tctgactgtt
3240tatccatata atataagcat atcccaaagt ttaagccacc tatagtttct
actgcaaaac 3300gtataattta gttcccacat atactaaaaa acgtgtcctt
aactctctct gtcagattag 3360ttgtaggtgg cttaaactta gttttacgaa
ttaaaaagga gcggtgaaat gaaaagtaaa 3420cttatttgta tcatcatggt
aatagctttt caggctcatt tcactatgac ggtaaaagca 3480gattctgtcg
gggaagaaaa acttcaaaat aatacacaag ccaaaaagac ccctgctgat
3540ttaaaagctt 355044996DNAL. monocytogenes 44atgtatttta tagataacaa
taatgagaaa gatccacgta ttaatttagc ggtggaggaa 60tttattttaa cagaattaaa
tctggatgag cctgtgctgt tattttatat taataagcca 120tcgattatca
ttgggcgcaa ccaaaataca gtagaagaaa ttgatacaga gtatgtggag
180aaaaatgatg tcatcgttgt gcgcagactt tctggtggcg gcgcggttta
tcacgatgaa 240ggaaacttaa atttcagttt tatcacggaa gatgatggag
agtctttcca taattttgcg 300aaattcacac aaccgattgt ggaagctctg
aaacgtttag gcgtcaatgc ggaactaaaa 360gggcgtaatg atttattgat
tgatggcttc aaagtttccg gtaatgcgca atttgcaaca 420aaagggaaaa
tgttctcaca cggaacatta atgtatgatt tgaacttaga taatgttgct
480gcatcgctaa aaccacgtaa agataaaatc gaatcaaaag gaattaagtc
tgttcgtagt 540cgtgtagcga atatttctga tttcatggat caagaaatga
caaccgagga gtttcgagat 600ttactcttac tttatatttt tggcgtggaa
aaagtagaag acgtgaaaga atacaaacta 660actgccgcag attgggaaaa
aatccacgaa atctctgcta aacgttatgg taactgggac 720tggaattatg
ggaaatcgcc aaaatttgac ttaacacgta caaaacgttt cccagttggt
780gcagtagacg ttcgcttgaa tgtccaaaaa ggtgtgatta cagatatcaa
gatttttggt 840gacttcttcg gcgttaaaaa tgtggcagat atcgaggaga
aattagttaa tactacttat 900aaacgtgaag ttttggctga ggctttagta
gatatagacg taaaagaata ctttggtaat 960attactaaag atgaattttt
agatttactt tattaa 996
* * * * *