U.S. patent application number 12/676209 was filed with the patent office on 2010-11-18 for methods and compositions based on culturing microorganisms in low sedimental fluid shear conditions.
This patent application is currently assigned to Arizona Board of Regents, for and on behalf of Arizona State University. Invention is credited to Eric A. Nauman, Mayra A. Nelman-Gonzalez, Cheryl A. Nickerson, Mark C. Ott, Shameema Sarker, Michael J. Schurr, James W. Wilson.
Application Number | 20100290996 12/676209 |
Document ID | / |
Family ID | 40452444 |
Filed Date | 2010-11-18 |
United States Patent
Application |
20100290996 |
Kind Code |
A1 |
Nickerson; Cheryl A. ; et
al. |
November 18, 2010 |
METHODS AND COMPOSITIONS BASED ON CULTURING MICROORGANISMS IN LOW
SEDIMENTAL FLUID SHEAR CONDITIONS
Abstract
This invention is directed to applying a low sedimental fluid
shear environment to manipulate microorganisms, and to
microorganisms and compositions obtained based on such
manipulation. Specifically, the present invention provides methods
of modifying a molecular genetic or phenotypic characteristic
(e.g., virulence, stress resistance or biofilm formation) of a
microorganism by culturing in a low sedimental shear environment.
One or more ion concentrations in the culture can be modulated in
order to inhibit or amplify the extent of the modification. The
present invention also provides microorganisms obtained from a low
sedimental shear culture, which exhibit modified and desirable
phenotypic characteristics, as well as therapeutic, vaccine and
bioindustrial products prepared from such microorganisms. Further,
the present invention provides methods for identifying molecules
that modulate responses of a microorganism to a low sedimental
shear environment and for determining the relevance of such
molecules to pathogenenicity of the microorganism.
Inventors: |
Nickerson; Cheryl A.;
(Phoenix, AZ) ; Wilson; James W.; (Wilmington,
DE) ; Ott; Mark C.; (Houston, TX) ; Nauman;
Eric A.; (West Lafayette, IN) ; Schurr; Michael
J.; (Aurora, CO) ; Nelman-Gonzalez; Mayra A.;
(Seabrook, TX) ; Sarker; Shameema; (Chandler,
AZ) |
Correspondence
Address: |
GEORGE A LEONE, SR;CITADEL PATENT LAW
9124 Gravelly Lake Drive SW, SUITE 102
Lakewood
WA
98499
US
|
Assignee: |
Arizona Board of Regents, for and
on behalf of Arizona State University
Tempe
AZ
|
Family ID: |
40452444 |
Appl. No.: |
12/676209 |
Filed: |
September 10, 2008 |
PCT Filed: |
September 10, 2008 |
PCT NO: |
PCT/US08/75818 |
371 Date: |
July 26, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60993208 |
Sep 10, 2007 |
|
|
|
61079160 |
Jul 9, 2008 |
|
|
|
61032252 |
Feb 28, 2008 |
|
|
|
61045419 |
Apr 16, 2008 |
|
|
|
Current U.S.
Class: |
424/9.2 ;
424/235.1; 435/252.8; 435/253.3; 435/253.4; 435/255.2; 435/255.21;
435/255.4; 435/29; 435/32; 435/6.16; 435/7.1; 506/9 |
Current CPC
Class: |
C12N 15/01 20130101;
C12N 1/38 20130101; C12N 1/36 20130101; C12Q 1/025 20130101 |
Class at
Publication: |
424/9.2 ;
424/235.1; 435/6; 435/7.1; 435/29; 435/32; 435/252.8; 435/253.3;
435/253.4; 435/255.2; 435/255.21; 435/255.4; 506/9 |
International
Class: |
A61K 49/00 20060101
A61K049/00; A61K 39/112 20060101 A61K039/112; C12Q 1/68 20060101
C12Q001/68; G01N 33/53 20060101 G01N033/53; C12Q 1/02 20060101
C12Q001/02; C12Q 1/18 20060101 C12Q001/18; C12N 1/20 20060101
C12N001/20; C12N 1/18 20060101 C12N001/18; C12N 1/16 20060101
C12N001/16; C40B 30/04 20060101 C40B030/04 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0001] This invention was made with Government support under
Contract No. NASA grant NCC2-1362 awarded by the United States
NASA. The Government has certain rights in this invention.
Claims
1. A method of modifying a phenotypic characteristic of a
microorganism, comprising culturing said microorganism in a low
sedimental shear environment and harvesting said microorganism from
the culture.
2. The method of claim 1, wherein said low sedimental shear
environment is spaceflight.
3. The method of claim 2, wherein said low sedimental shear
environment is provided by a rotating wall vessel bioreactor.
4. The method of claim 1, wherein said microorganism is selected
from bacteria, fungi, viruses, protozoa, protists and worms.
5. The method of claim 4, wherein said microorganism is selected
from the group consisting of Salmonella sp., Streptococcus
pneumoniae, Pseudomonas aeruginosa, Candida albicans, and
Saccharomyces cerevisiae.
6. The method of claim 1, wherein said phenotypic characteristic of
said microorganism is selected from the group consisting of
virulence, immunogenicity, stress resistance, resistance to a drug
or disinfectant, and biofilm formation in culture.
7. The method of claim 1, wherein the virulence of said
microorganism is increased as a result of the culturing.
8. The method of claim 1, wherein the immunogenicity of said
microorganism is increased as a result of the culturing.
9. The method of claim 1, wherein the stress resistance of said
microorganism is altered as a result of the culturing.
10. The method of claim 1, wherein biofilm formation in culture by
said microorganism is increased as a result of the culturing.
11. The method of claim 1, wherein the fluid shear level in said
environment is adjusted to be 100 dynes per cm.sup.2 or lower.
12. A method of modifying a phenotypic characteristic of a
microorganism in a low sedimental shear environment, comprising
altering the concentrations of one or more ions to which said
microorganism is exposed to in said environment.
13. The method of claim 12, wherein said low sedimental shear
environment is spaceflight.
14. The method of claim 12, wherein said low sedimental shear
environment is provided by a rotating wall vessel bioreactor.
15. The method of claim 12, wherein said low sedimental shear
environment is an environment within a host during infection by
said microorganism.
16. The method of claim 12, wherein said ions are selected from the
group consisting of phosphate, chloride, sulfate/sulfur, bromide,
nitrate-n, o-phosphate, pH/hydrogen ion, calcium, chromium, copper,
iron, lithium, fluoride, magnesium, manganese, molybdenum, nickel,
potassium, sodium and zincions.
17. The method of claim 12, wherein said microorganism is selected
from bacteria, fungi, viruses, protozoa, protists and worms.
18. The method of claim 17, wherein said microorganism is selected
from the group consisting of Salmonella sp., Streptococcus
pneumoniae, Pseudomonas aeruginosa, Candida albicans, and
Saccharomyces cerevisiae.
19. The method of claim 12, wherein said phenotypic characteristic
of said microorganism is selected from the group consisting of
virulence, immunogenicity, stress resistance, resistance to a drug,
and biofilm formation in culture.
20. A microorganism harvested from a culture of said microorganism
grown in a low sedimental shear environment.
21. The microorganism of claim 20, wherein said low sedimental
shear environment is spaceflight or provided by a rotating wall
vessel bioreactor.
22. The microorganism of claim 20, wherein said microorganism is
selected from bacteria, fungi, viruses, protozoa, protists and
worms.
23. The microorganism of claim 22, wherein said microorganism is
selected from the group consisting of Salmonella sp., Streptococcus
pneumoniae, Pseudomonas aeruginosa, Candida albicans, and
Saccharomyces cerevisiae.
24. The microorganism of claim 20, wherein said microorganism is an
attenuated vaccine strain.
25. A therapeutic composition comprising the microorganism
according to any one of claims 20-24.
26. A method of identifying a gene of a microorganism which
modulates the response of said microorganism to a low sedimental
shear environment, comprising culturing said microorganism a low
sedimental shear environment, comparing expression of candidate
genes in said microorganism in said low sedimental shear
environment relative to control sedimental shear environment,
identifying said gene based on differential expression of said
gene.
27. The method of claim 26, wherein said low sedimental shear
environment is a spaceflight or provided by a rotating wall vessel
bioreactor.
28. The method of claim 1, wherein said gene is selected from the
group consisting of virulence genes, iron metabolism genes, ion
response or utilization genes, cell surface polysaccharide genes,
protein secretion genes, flagellar genes, stress genes, genes
coding for ribosomal proteins, genes coding for fimbrial proteins,
transcriptional regulator genes, genes involved in extracellular
matrix/biofilm synthesis, stress response genes, sigma factors,
genes encoding RNA binding proteins, genes encoding small noncoding
regulatory RNAs (small RNAs), DNA polymerase genes, RNA polymerase
genes, plasmid transfer/conjugation genes, genes encoding chaperone
proteins, carbon utilization genes, metabolic pathway genes, energy
metabolism genes, chemotaxis genes, genes encoding heat shock
proteins, genes encoding putative proteins, genes encoding
recombination proteins, genes encoding transport system proteins,
genes encoding membrane proteins, genes encoding cell wall
components (including LPS), housekeeping genes, genes encoding
structural proteins and enzymes, and plasmid genes.
29. The method of claim 28, wherein said gene encodes a small
regulatory RNA binding protein or a regulatory RNA.
30. The method of claim 26, wherein gene expression is determined
in a microarray analysis of mRNA, RT-PCR, qRT-PCR, Western blot
analysis, and proteomic analysis.
31. The method of claim 26, further determining whether said gene
is involved in establishing infection of said microorganism by
generating a mutant microorganism which comprises an inactivating
mutation in said gene, and assessing the infectivity of said mutant
microorganism in a host.
32. The method of claim 31, wherein said host is selected from the
group consisting of an animal or an animal analog, a plant, and a
cell or tissue culture.
33. A vaccine composition comprising a microorganism which has been
modified by inactivating a gene involved in establishing infection,
wherein said gene has been identified according to the method of
claim 31.
34. The vaccine composition of claim 33, wherein said microorganism
is Salmonella sp., and said gene is Hfq.
35. A method of assessing the efficacy of a candidate compound
against infection by a microorganism, comprising culturing said
microorganism in a low sedimental shear environment, contacting
said microorganism in the culture with said compound, and
determining the inhibitory effect of said compound on the growth of
said microorganism as indicative of the therapeutic efficacy of
said compound.
36. A method of assessing interactions between a host and a
microorganism pathogen or an attenuated vaccine strain, comprising
placing said host in contact with said microorganism pathogen or
said attenuated vaccine strain in a low sedimental shear
environment, and evaluating interactions between said host and said
microorganism pathogen or said attenuated vaccine strain in said
environment.
37. The method of claim 36, wherein said microorganism pathogen has
been cultured in said environment prior to said contact.
38. The method of claim 36, wherein said attenuated vaccine strain
is a recombinant attenuated vaccine strain.
39. The method of claim 36, wherein said host is selected from the
group consisting of animals, animal analogs, plants, and cell
and/or tissue cultures from animals, animal analogs or plants.
Description
FIELD OF THE INVENTION
[0002] This invention generally relates to microbial culturing.
More particularly, the present invention is directed to applying a
low sedimental fluid shear environment to manipulate
microorganisms. Microorganisms obtained from a low sedimental fluid
shear culture, which exhibit modified phenotypic and molecular
genetic characteristics, are useful for the development of novel
and improved diagnostics, therapeutics, vaccines and bioindustrial
products. Further, application of low sedimental fluid conditions
to microorganisms permits identification of molecules uniquely
expressed under these conditions, providing a basis for the design
of new therapeutic targets.
BACKGROUND OF THE INVENTION
[0003] Environmental conditions and crewmember immune dysfunction
associated with spaceflight may increase the risk of infectious
disease during a long-duration mission. Previous studies using the
enteric bacterial pathogen, Salmonella enterica serovar
Typhimurium, showed that growth in a ground-based spaceflight
analog bioreactor, termed the rotating wall vessel (RWV), induced
molecular genetic and phenotypic changes in this organism.
Specifically, S. typhimurium grown in this spaceflight analog
culture environment, described as low shear modeled microgravity
(LSMMG), exhibited increased virulence, increased resistance to
environmental stresses (acid, osmotic, and thermal), increased
survival in macrophages, and global changes in gene expression at
the transcriptional and translational levels. However, our
knowledge of microbial changes in response to spaceflight or
spaceflight analog conditions and the corresponding changes to
infectious disease risk is still limited and unclear. Elucidation
of such risks and the mechanisms behind any spaceflight or
spaceflight analog-induced changes to microbial pathogens holds the
potential to decrease risk for human exploration of space and
provide insight into how pathogens cause infections in Earth-based
environments.
SUMMARY OF THE INVENTION
[0004] The present invention is directed to applying a low
sedimental shear environment to manipulate microorganisms, and to
microorganisms and compositions obtained based on such
manipulation.
[0005] In one aspect, the present invention provides a method for
modifying or manipulating a microorganism by culturing the
microorganism under low sedimental fluid shear conditions, and
harvesting the cultured microorganism. The present method applies
to microorganism including but not limited to bacteria, viruses,
fungi, protozoa, protists, and worms (such as helminthes), among
others. Examples of microorganisms contemplated by the present
invention include Salmonella sp. (particularly Salmonella
typhimurium), Streptococcus pneumoniae, Pseudomonas aeruginosa,
Candida albicans, and Saccharomyces cerevisiae.
[0006] In one embodiment, the fluid shear level in the low
sedimental shear environment in which the microorganism is being
cultured is adjusted to be 100 dynes per cm.sup.2 or lower,
preferably lower than 50 dynes per cm.sup.2, more preferably lower
than 20 dynes per cm.sup.2, even more preferably 10 dynes per
cm.sup.2 or lower, or even lower than 0.1 dynes per cm.sup.2.
[0007] In another aspect, the present invention provides methods of
modifying a phenotypic characteristic of a microorganism by
culturing the microorganism in low sedimental shear environments.
Phenotypic characteristics that can be modified in accordance with
the present invention include but are not limited to, virulence,
immunogenicity, stress resistance (such as thermal, acid or
oxidative stress resistance), resistance to drugs including
anti-microbial compounds (e.g., resistance of a fungus to an
anti-fungal compound), ability of a bacterium to form biofilm in
culture, metabolic capabilities, among others.
[0008] In a specific embodiment, low sedimental shear conditions
are applied to an attenuated vaccine strain of a microorganism to
enhance the efficacy of the vaccine strain.
[0009] In a further aspect, the present invention is directed to
the modulation of one or more ion concentrations to manipulate,
e.g., to amplify or inhibit, responses of microorganisms to low
sedimental shear environments. Ions which can be manipulated to
achieve modification of microorganisms include but are not limited
to phosphate, chloride, sulfate/sulfur, bromide, nitrate-n,
o-phosphate, pH/hydrogen ion, calcium, chromium, copper, iron,
lithium, fluoride, magnesium, manganese, molybdenum, nickel,
potassium, sodium and zinc, among others.
[0010] In another aspect, the present invention provides
microorganisms harvested from a low sedimental shear culture.
[0011] In still another aspect, the present invention provides a
therapeutic composition, including a vaccine composition, comprised
of a microorganism obtained from a low sedimental shear culture.
Microorganisms suitable for use in the therapeutic composition of
the present invention include, for example, Salmonella sp.
(particularly Salmonella typhimurium), including an attenuated
Salmonella vaccine strain, Streptococcus pneumonia, Pseudomonas
aeruginosa, Candida albicans and Saccharomyces cerevisiae,
harvested from a culture grown under low sedimental shear
conditions.
[0012] In another aspect, the present invention provides other
compositions formulated with a microorganism obtained from a low
sedimental shear culture, useful for various bioindustrial
applications.
[0013] In a further aspect, the present invention provides a method
for identifying a gene of a microorganism which modulates the
response of the microorganism to low sedimental shear environments.
The method includes culturing the microorganism in a low sedimental
shear environment, comparing expression of candidate genes in the
microorganism in the low sedimental shear environment relative to
control sedimental shear conditions, and identifying genes that
exhibit differential expression. Functional categories of genes
that have been or can be identified as differentially expressed in
accordance with the present invention include, without limitation,
virulence genes, iron metabolism genes, ion response or utilization
genes, cell surface polysaccharide genes, protein secretion genes,
flagellar genes, stress genes, genes coding for ribosomal proteins,
genes coding for fimbrial proteins, transcriptional regulator
genes, genes involved in extracellular matrix/biofilm synthesis,
stress response genes, sigma factors, genes encoding RNA binding
proteins, genes encoding small noncoding regulatory RNAs (small
RNAs), DNA polymerase genes, RNA polymerase genes, plasmid
transfer/conjugation genes, chaperone proteins, carbon utilization
genes, Metabolic pathway genes, energy metabolism genes, chemotaxis
genes, genes encoding heat shock proteins, genes encoding putative
proteins, genes encoding recombination proteins, genes encoding
transport system proteins, genes encoding membrane proteins, genes
encoding cell wall components (including LPS), housekeeping genes,
genes encoding structural proteins and enzymes, and plasmid
genes.
[0014] In another aspect, the present invention is directed to the
use of a host, including during space flight, to study interactions
between the host and a microorganism pathogen or an attenuated
vaccine strain when both are simultaneously placed in a low
sedimental shear environment. The pathogen can, for this purpose,
also have been manipulated in an RWV or similar analog. According
to this aspect of the invention, hosts include animals, animal
analogs, plants, insects, and cell and/or tissue cultures from
animals, animal analogs or plants.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1. Experimental setup for STS-115 Salmonella
typhimurium microarray and virulence experiments. This flowchart
displays a timeline of how STS experiments were designed and
organized. Fluid processing apparatuses (FPAs) were loaded as in
FIG. 2 and delivered to Shuttle, activated during spaceflight, and
recovered upon landing as outlined in the flowchart. A more
detailed description of the FPA activation and
fixation/supplementation steps is provided in FIG. 2. OES: Orbital
Environmental Simulator (this is a climate-controlled room at
Kennedy Space Center that houses ground controls and is maintained
at the same temperature and humidity as the Space Shuttle via
real-time communications). STS: Space Transport System, refers here
to the Shuttle. SLSL: Space Life Sciences Lab.
[0016] FIG. 2A-2C. Diagram and photographs of fluid processing
apparatuses (FPAs) used in the STS experiments. Panel 2A: Schematic
diagram of an FPA. An FPA consists of a glass barrel that contains
a short bevel on one side and stoppers inside that separate
individual chambers containing fluids used in the experiment. The
glass barrel loaded with stoppers and fluids is housed inside a
lexan sheath containing a plunger that pushes on the top stopper to
facilitate mixing of fluids at the bevel. The bottom stopper in the
glass barrel (and also the bottom of the lexan sheath) is designed
to contain a gas-permeable membrane that allows air exchange during
bacterial growth. In the STS experiments, the bottom chamber
contained media, the middle chamber contained the bacterial
inoculum suspended in PBS (or water for yeast/fungi), and the top
chamber contained either RNA/protein fixative or additional media.
Upon activation, the plunger was pushed down so that only the
middle chamber fluid was mixed with the bottom chamber to allow
media inoculation and bacterial growth. At this step, the plunger
was pushed until the bottom of the middle rubber stopper was at the
top part of the bevel. After the 25-hour growth period, the plunger
was pushed until the bottom of the top rubber stopper was at the
top part of the bevel such that the top chamber fluid was added.
Panel 2B: Photograph of FPAs in pre-flight configuration. Panel 2C:
Photograph of FPAs in post-flight configuration showing that all
stoppers have been pushed together and the entire fluid sample is
in the bottom chamber.
[0017] FIGS. 3A-3C. The rotating wall vessel (RWV) bioreactor and
power supply. Panel 3A: The cylindrical culture vessel is
completely filled with culture medium through ports on the face of
the vessel and operates by rotating around a central axis. Cultures
are aerated through a hydrophobic membrane that covers the back of
the cylinder. The power supply is shown below the bioreactor. Panel
3B: The two operating orientations of the RWV are depicted. In the
LSMMG orientation (panel i), the axis of rotation of the RWV is
perpendicular to the direction of the gravity force vector. In the
normal gravity (or 1.times.g) orientation (panel ii), the axis of
rotation is parallel with the gravity vector. Panel 3C: The effect
of RWV rotation on particle suspension is depicted. When the RWV is
not rotating, or rotating in the 1.times.g orientation (panel i),
the force of gravity will cause particles in apparatus to sediment
and eventually settle on the bottom of the RWV. When the RWV is
rotating in the LSMMG position (panel ii), particles are
continually suspended in the media. The media within the RWV
rotates as a single body, and the sedimentation of the particle due
to gravity is offset by the upward forces of rotation. The result
is low shear aqueous suspension that is strikingly similar to what
would occur in true microgravity, and is also relevant to certain
areas in the human body, including those routinely encountered by
pathogens--such as GI and urogenital tracts.
[0018] FIGS. 4A-4E. Data from STS-115 Salmonella typhimurium
experiments. Panel 4A: Map of the 4.8 Mb circular Salmonella
typhimurium genome with the locations of the genes belonging to the
spaceflight transcriptional stimulon indicated as black hatch
marks. Panel 4B: Decreased time-to-death in mice infected with
flight S. typhimurium as compared to identical ground controls.
Female Balb/c mice perorally infected with 10.sup.7 bacteria from
either spaceflight or ground cultures were monitored every 6-12
hours over a 30 day period and the percent survival of the mice in
each group was graphed versus number of days. Panel 4C: Increased
percent mortality of mice infected with spaceflight cultures across
a range of infection dosages. Groups of mice were infected with
increasing dosages of bacteria from spaceflight and ground cultures
and monitored for survival over 30 days. The percent mortality
(calculated as in (23)) of each dosage group is graphed versus the
dosage amount. Panel 4D: Decreased LD.sub.50 value (calculated as
in (23)) for spaceflight bacteria in murine infection model. Panel
4E: Scanning electron microscopy (3500.times. magnification) of
spaceflight and ground S. typhimurium bacteria showing the
formation of an extracellular matrix and associated cellular
aggregation of spaceflight cells relevant to biofilm formation.
[0019] FIGS. 5A-5B. Hfq is required for S. typhimurium
LSMMG-induced phenotypes in RWV culture. Panel 5A: The survival
ratio of wild type and isogenic hfq, hfq 3' Cm, and invA mutant
strains in acid stress after RWV culture in the LSMMG and 1.times.g
positions is plotted (ANOVA p-value<0.05). Panel 5B: Fold
intracellular replication of S. typhimurium strains hfq 3'Cm and
.DELTA.hfq in J774 macrophages after RWV culture as above.
Intracellular bacteria were quantitated at 2 hours and 24 hours
post-infection, and the fold increase in bacterial numbers between
those two time periods was calculated (ANOVA p-value<0.05).
[0020] FIGS. 6A-6C. Increased virulence of S. typhimurium in
response to spaceflight in LB medium is not observed in M9 minimal
medium or LB medium supplemented with M9 salts. 6A, Ratio of
LD.sub.50 values of S. typhimurium spaceflight and ground cultures
grown in LB, M9, or LB-M9 salts media. Female Balb/c mice were
perorally infected with a range of bacterial doses from either
spaceflight or ground cultures and monitored over a 30-day period
for survival. 6B, Time-to-death curves of mice infected with
spaceflight and ground cultures from STS-115 (infectious dosage:
10.sup.7 bacteria for both media). 6C, Time-to-death curves of mice
infected with spaceflight and ground cultures from STS-123
(infectious dosage: 10.sup.6 bacteria for LB and 10.sup.7bacteria
for M9 and LB-M9 salts).
[0021] FIG. 7. qRT-PCR analysis of S. typhimurium genes altered in
response to spaceflight as compared to ground controls in LB and M9
cultures. Total RNA harvested from spaceflight and ground cultures
in the indicated media was converted to single-stranded cDNA and
used as a template in qRT-PCR analysis with primers hybridizing to
the indicated genes. PCR product levels were normalized to the 16S
rRNA product and a ratio of each gene level in flight and ground
cultures was calculated. All differences in expression between
spaceflight and ground cultures were found to be statistically
significant using student's t-test (p-value<0.05).
[0022] FIG. 8. Altered acid tolerance of S. typhimurium in
ground-based spaceflight analog culture is not observed in the
presence of increased phosphate ion concentration. Cultures of S.
typhimurium grown in the indicated medium in the rotating wall
vessel in the low-shear modeled microgravity (LSMMG) or control
orientation were subjected to acid stress (pH 3.5) immediately upon
removal from the apparatus. A ratio of percent survival of the
bacteria cultured at each orientation in each media is
presented.
[0023] FIG. 9. Microscopic images of cells of a recombinant
attenuated Salmonella anti-pneumococcal vaccine strain scraped off
of the hydrophobic membranes of the RWV cultured in 1.times.G or
LSMMG conditions.
[0024] FIG. 10. Scanning electron microscopy (SEM) shows profound
hyphal formation of C. albicans during spaceflight culture--but no
hyphal formation is evident during ground culture of identical
controls.
DETAILED DESCRIPTION OF THE INVENTION
[0025] The present invention is predicated in part on the discovery
of global changes in microorganisms which resulted from growth in
spaceflight or spaceflight analogs which produce low sedimental
shear environments around the microorganisms, including phenotypic
(such as virulence and stress resistance) and molecular genetic
(gene expression) changes. Specifically, during spaceflight aboard
the Space Shuttle mission STS-115 and STS-123 and on the ground
using a spaceflight analogue bioreactor, the Rotating Wall Vessel,
changes were observed in gene expression (mRNA and protein),
virulence, and stress resistance using the microorganism Salmonella
typhimurium, for example. Further, a conserved global regulator,
the Hfq protein, has been identified to be involved in the response
to the environment of low sedimental shear stress during
spaceflight and spaceflight analogue culture. Conventional culture
conditions, which are currently available in the marketplace, do
not have the capability to grow microorganisms in low sedimental
shear environments, and therefore are unable to recapitulate low
fluid shear levels found within an infected host. The recognition
of the phenotypic and molecular genetic changes of microorganisms
in response to low sedimental shear environments allows the
development of modified microorganism with desirable and improved
phenotypic characteristics, such as enhanced immunogenicity and
protection against infection, altered stress resistance, altered
metabolic capabilities, and altered ability to form biofilms. The
modified microorganism can be used in formulating therapeutic and
vaccine compositions, as well as bioindustrial products. Further,
the use of low sedimental shear environments in accordance with the
present invention permits identification of novel target molecules
for vaccine and therapeutic development, which would not have been
possible using conventional culture conditions.
[0026] In one aspect, the present invention provides a method for
modifying or manipulating a microorganism by culturing the
microorganism under low sedimental fluid shear conditions, and
harvesting the cultured microorganism. This aspect of the invention
excludes culturing a Salmonella sp., particularly a wild type
(i.e., naturally occurring, unmodified Salmonella sp.) in a low
sedimental fluid shear environment created by a rotating wall
vessel bioreactor.
[0027] "Low sedimental fluid shear conditions" and "low sedimental
fluid shear environments", or in short, "low sedimental shear"
conditions or environments, contemplated by the present invention
include space flight and space flight analogs which produce low
sedimental shear environments. Examples of space flight analog
include commercial analog bioreactors such as rotating wall vessels
(RWV), and other art-recognized low sedimental shear environments
as understood by the skilled artisan. The RWV is a rotating
bioreactor (FIG. 3) in which cells are maintained in suspension in
a gentle fluid orbit that creates a sustained low-fluid-shear and
microgravity environment. The level of fluid shear force within the
bioreactor can be increased in a controlled and quantitative manner
by adding beads (e.g., polypropylene beads) of a selected size to
the RWV (Nauman et al., Applied and Environmental Microbiology 73:
699-705, 2007). By using beads of different sizes, a range of fluid
shear levels can be achieved, which can be relevant to those
encountered by a microorganism in an infected host. For example,
fluid shear levels in the RWV can be adjusted from lower than 0.01
dynes per cm.sup.2 in the absence of beads, to 5.2 dynes per
cm.sup.2 by adding 3/32-inch beads, to 7.8 dynes per cm.sup.2 by
adding 1/8-inch beads, as determined and described by Nauman et al.
(2007), incorporated herein in its entirety by reference. According
to the present invention, fluid shear levels of 100 dynes per
cm.sup.2 or lower, preferably lower than 50 dynes per cm.sup.2,
more preferably lower than 20 dynes per cm.sup.2, even more
preferably 10 dynes per cm.sup.2 or lower, or even lower than 0.1
dynes per cm.sup.2, are considered low shear levels.
[0028] The term "microorganism" includes bacteria, viruses, fungi,
protozoa, protists, and worms (such as helminthes), among others.
Examples of microorganisms contemplated by the present invention
include Salmonella sp. (particularly Salmonella typhimurium),
Streptococcus pneumoniae, Pseudomonas aeruginosa, Candida albicans,
and Saccharomyces cerevisiae.
[0029] In one embodiment, modification of the microorganism is
achieved by altering the fluid shear levels in the low sedimental
shear environment in which the microorganism is being cultured. The
fluid shear level in the culture can be adjusted to 100 dynes per
cm.sup.2 or lower, preferably lower than 50 dynes per cm.sup.2,
more preferably lower than 20 dynes per cm.sup.2, even more
preferably 10 dynes per cm.sup.2 or lower, or even lower than 0.1
dynes per cm.sup.2.
[0030] In accordance with the present invention, culturing a
microorganism in low sedimental shear environments induces both
phenotypic and molecular genetic changes. Accordingly, in a further
aspect, the present invention provides methods of modifying a
phenotypic characteristic of a microorganism by culturing the
microorganism in low sedimental shear environments.
[0031] A "phenotypic characteristic" of a microorganism, as would
be understood by those skilled in the art, include any observable
or detectable physical or biochemical characteristics of a
microorganism, including but not limited to, virulence,
immunogenicity, stress resistance (such as thermal, acid or
oxidative stress resistance), resistance to drugs including
anti-microbial compounds (e.g., resistance of a fungus to an
anti-fungal compound), ability of a bacterium to form biofilm in
culture, among others.
[0032] Changes in phenotypic characteristics are often associated
with or caused by molecular genetic changes. As used herein, the
term "molecular genetic changes" refer to changes in gene
expression, which manifest at any or a combination of mRNA, rRNA,
tRNA, small non-coding RNA levels and protein levels.
[0033] The present inventors have demonstrated global changes in
gene expression, virulence and stress resistance characteristics of
Salmonella typhimurium, which resulted from growth in a spaceflight
or spaceflight analog (RWV) which produces low sedimental shear
environments around the cells. A conserved global regulator, the
Hfq protein, has been identified to be involved in the response to
the environment of low sedimental shear stress during spaceflight
and spaceflight analogue culture. While Salmonella typhimurium has
been used as an example to illustrate the phenotypic and genetic
changes, due to the nature of the effect and the conservation of
global regulators between different organisms, multiple organisms
should display similar changes in characteristics in response to
low sedimental shear environments.
[0034] In one embodiment, low sedimental shear conditions are
applied to a microorganism to alter (increase or decrease) the
virulence of the microorganism. In a specific embodiment, low
sedimental shear conditions are applied to a microorganism to
increase the virulence of the microorganism. By "virulence" it is
meant the ability of a microorganism to cause disease. Virulence of
a microorganism can be determined by any of the art-recognized
methods, including suitable animal models. The ability of low
sedimental shear conditions to increase virulence of a
microorganism allows for the development of new therapeutic
compositions. Without being bound to any particular theory, the
global changes of a microorganism resulting from culturing in a low
sedimental shear environment may include expression of antigens by
the microorganism that would not be expressed under conventional
culturing conditions but are possibly expressed during infection of
a host by the microorganism. In addition, a microorganism exhibits
enhanced stress resistance and improved ability of survival after
being cultured in a low sedimental shear environment. As a result,
a vaccine prepared using such microorganism is able to survive
longer in a recipient host to induce desirable protective
immunity.
[0035] In one embodiment, low sedimental shear conditions are
applied to an attenuated vaccine strain of microorganism to enhance
the efficacy of the vaccine strain. Enhanced vaccine efficacy
includes, but is not limited to improved immunogenicity (i.e.
ability of the vaccine strain to provoke immune response), and/or
improved protection against subsequent challenges. Attenuated
microbial vaccine strains are well-documented in the art and can be
prepared by various well-known methods, such as serial passaging or
site-directed mutagenesis.
[0036] In a specific embodiment, the present invention provides a
method of enhancing the immunogenicity and/or protection of an
attenuated Salmonella vaccine strain by culturing the attenuated
Salmonella vaccine strain in a low sedimental shear environment and
harvesting the cultured strain.
[0037] In another specific embodiment, the present invention
provides a method of enhancing the immunogenicity and/or protection
of a recombinant attenuated Salmonella vaccine strain expressing
one or more antigens from other pathogens by culturing the
attenuated recombinant Salmonella vaccine strain in a low
sedimental shear environment and harvesting the cultured
strain.
[0038] In another embodiment, low sedimental shear conditions are
applied to a microorganism to enhance stress resistance of the
microorganism. The resulting, more resilient microorganism is
particularly useful for the development of biomedical products like
vaccines and bioindustrial products, such as biofuels. Enhanced
performance and robustness of consortia of microorganisms are also
useful for bioremediation.
[0039] In still another embodiment, low sedimental shear conditions
are applied to a microorganism to modify the ability of the
microorganism to form biofilm. In a specific embodiment, low
sedimental shear conditions are applied to a microorganism to
enhance the ability of the microorganism to form biofilm. As
illustrated hereinbelow, S. typhimurium strain X3339, which does
not form biofilm when cultured in the LB medium in ground, is able
to form biofilm after grown in spaceflight. On the other hand, an
attenuated S. typhimurium strain vaccine strain X9558pYA4088, which
forms biofilm in 1.times.g culture in the RWV, showed reduced
ability to form biofilm after grown in LSMMG. Accordingly, one
could employ low sedimental shear conditions to manipulate the
ability of the microorganism to form biofilm, either to increase
such ability in order to develop bioindustrial products useful for
sewage treatment and pollution control, or to decrease the ability
to form biofilm. Altered biofilm production could be important for
enhanced efficacy and robustness of microbial consortia for
bioremediation, sewage treatment, microbial fuel cells, and
possibly vaccines.
[0040] In a further aspect, the present invention is directed to
the modulation of one or more ion concentrations to manipulate,
e.g., to amplify or inhibit, responses of microorganisms to low
sedimental shear environments.
[0041] The present inventors have discovered that the environmental
ion concentration during microbial growth strongly influences the
intensity of changes in virulence and gene expression profiles in
response to low sedimental shear conditions. For example, higher
concentrations of phosphate ions altered the ability of S.
typhimurium to respond to spaceflight and minimized its
pathogenic-related effects. The term "ions" as used herein is not
limited to one particular type of ion, and includes, e.g.,
phosphate, chloride, sulfate/sulfur, bromide, nitrate-n,
o-phosphate, pH/hydrogen ion, calcium, chromium, copper, iron,
lithium, fluoride, magnesium, manganese, molybdenum, nickel,
potassium, sodium and zinc, among others.
[0042] In one embodiment, one or more ion concentrations are
modulated to inhibit pathogenic responses of microorganisms to low
sedimental shear environments. Such modulations are useful in human
spaceflight to mitigate the adverse effects of microorganisms
necessarily present and undergoing the subject pathogenic responses
during and because of such flight. Such modulations are also useful
to counteract pathogenic responses of microorganisms to low
sedimental shear environments encountered during infection of a
host, in which case, modulation of ion concentrations can be
achieved by oral administration to the host with compositions
containing one or more ions, or ion chelators.
[0043] In one embodiment, one or more ion concentrations are
modulated to modulate, i.e., to amplify or decrease, the responses
of microorganisms to low sedimental shear environments. Such
modulations are useful, e.g., to enhance the immunogenicity of a
strain for the development of vaccine or other therapeutic
products, to enhance the stress resistance of a microorganism for
the development of bioindustrial products.
[0044] In a further aspect, the present invention provides
microorganisms harvested from a low sedimental shear culture.
[0045] In one embodiment, the present invention provides Salmonella
sp. obtained from a culture grown in spaceflight. In a preferred
embodiment the microorganism is Salmonella typhimurium. Salmonella
sp., particularly wild type (native) Salmonella sp., obtained from
a culture grown under low sedimental shear conditions provided by
the RWVs is excluded from the scope of the present invention. In
another embodiment, the present invention provides Streptococcus
pneumonia harvested from a culture grown under low sedimental shear
conditions. In still another embodiment, the present invention
provides Pseudomonas aeruginosa harvested from a culture grown
under low sedimental shear conditions. In yet another embodiment,
the present invention provides a fungus, such as Candida albicans
and Saccharomyces cerevisiae, harvested from a culture grown under
low sedimental shear conditions.
[0046] In another aspect, the present invention provides a
therapeutic composition comprised of a microorganism obtained from
a low sedimental shear culture. The therapeutic composition can be
a vaccine composition with improved efficacy as compared to a
vaccine made of the same microorganism grown in a control (normal)
sedimental shear culture. In one embodiment, the present invention
provides a vaccine composition containing Salmonella sp. obtained
from a culture grown under low sedimental shear conditions. In a
preferred embodiment the microorganism is Salmonella typhimurium.
In another preferred embodiment, the present invention provides a
vaccine composition containing a recombinant attenuated Salmonella
anti-pneumococcal vaccine strain harvested from a culture grown
under low sedimental shear conditions. In another embodiment, the
present invention provides a vaccine containing Streptococcus
pneumonia harvested from a culture grown under low sedimental shear
conditions. In still another embodiment, the present invention
provides a vaccine containing Pseudomonas aeruginosa harvested from
a culture grown under low sedimental shear conditions. In yet
another embodiment, the present invention provides a therapeutic
composition containing a fungus, such as Candida albicans and
Saccharomyces cerevisiae, harvested from a culture grown under low
sedimental shear conditions.
[0047] Other compositions formulated with a microorganism obtained
from a low sedimental shear culture, useful for various
bioindustrial applications, are also included within the scope of
the present invention.
[0048] In a further aspect, the present invention provides a method
for identifying a gene of a microorganism which modulates the
response of the microorganism to low sedimental shear
environments.
[0049] Conventional culture conditions, which are currently
available in the marketplace, do not have the capability to grow
microorganisms in low sedimental shear environments, and therefore
are unable to recapitulate low fluid shear levels found within an
infected host. Thus, many of the genes that could be expressed or
proteins that could be functional are not documented or
investigated. These genes are critical to understanding microbial
responses during growth in many unique conditions, such as
spaceflight, and in many common conditions encountered during the
course of microbial natural lifecycles, such as locations in the
host during microbial infection. Low sedimental shear environments
are useful to identify classes of genes (including regulatory RNAs)
and proteins that have heretofore not been recognized,
characterized or understood from microorganisms cultured in
standard culture conditions.
[0050] As demonstrated by the present inventors, the
space-traveling Salmonella had changed expression of 167 genes, as
compared to bacteria that remained on Earth. A conserved global
regulator, the Hfq protein, has been identified to be involved in
the response to the environment of low sedimental shear stress
during spaceflight and spaceflight analogue culture. Bacteria that
lack the
[0051] Hfq gene did not respond to the low sedimental shear
conditions. These results highlight Hfq as a therapeutic target. In
addition, a number of genes have been identified in accordance with
the present invention to respond in the same direction in both RWV
microarray analysis and spaceflight analysis, including dps, fimA,
hfq, ptsH, rplD, and yaiV. Several genes have been identified to be
regulated in different directions in the two conditions (i.e. up in
RWV, but down in flight or vice versa), including ppiB, sipD and
frdC.
[0052] According to the present invention, microbial genes that
modulate the response of a microorganism to low sedimental shear
environments can be identified by culturing the microorganism in a
low sedimental shear environment, and comparing expression (at mRNA
or protein level) of candidate genes in the microorganism in the
low sedimental shear environment relative to ground control
conditions. Those that exhibit differential expression can be
identified from candidate genes. The embodiment of identifying
modulator genes by culturing a Salmonella species in a low
sedimental shear environment provided by the RWV is excluded from
this aspect of the invention.
[0053] Gene expression can be determined by a variety of
art-recognized techniques, including but not limited to, microarray
analysis of mRNA, rRNA, tRNA, or small non-coding RNA, RT-PCR or
qRT-PCR, Western blot, and proteomics analysis. By "differential
expression" it is meant that the ratio of the levels of expression
under two different conditions is at least 1.5, preferably at least
2.0, more preferably at least 3.0, even more preferably 5.0 or
more. After microorganisms are harvested from a spaceflight or
spaceflight analog (such as the RWV bioreactor described above),
cells are processed so as to retain the expression profile from a
low sedimental shear culture, prior to a specific target
identification assay is being performed. For example, for
microarray analysis, cells are fixed immediately in RNA Later.TM.
or other relevant fixative. Total RNA is isolated from cells,
labeled with fluorescent dyes (such as Cy3 and Cy 5), and used to
hybridize to microarrays with genomic DNA. Two assays are
performed, one for LSS (low sedimental shear) and one for CSS
(control sedimental shear) cultured cells, respectively. After
quantitation, the ratio of expression of LSS to CSS is determined.
Genes with ratios of 2 or greater (or 0.5 or less) (either up or
down-regulated in LSS, respectively) can be identified, for
example. For proteomics, cells are fixed using RNA Later or similar
fixative, or fixed by flash freezing and storage at -80 degrees C.
Cells are lysed and proteins are precipitated with acetone. After
digestion with trypsin, the protein samples are subjected to a
proteomic assay of choice: MudPIT, LC/MS-MS, 2-D gels followed by
MALDI, for example. Proteins that are present under LSS conditions
and not in CSS (or vice-versa) can be identified. For Western
blotting, cells are fixed using RNA Later or similar fixative, or
by flash freezing and storage at -80 degrees C. Fixed cells are
resuspended in a protein sample buffer for SDS-PAGE and run on gel,
followed by Western blot analysis using antisera from
patients/animals or immunizations against prominent antigens.
Prominent proteins bands in LSS samples as compared to CSS samples
will correspond to proteins that are recognized by the
patient/animal and up-regulated under LSS conditions. Protein bands
can be cut out and are subjected to MALDI to identify the molecular
nature of the underlying protein(s).
[0054] Functional categories of genes that have been or can be
identified as differentially expressed in accordance with the
present invention include, without limitation, virulence genes,
iron metabolism genes, ion response or utilization genes, cell
surface polysaccharide genes, protein secretion genes, flagellar
genes, stress genes, genes coding for ribosomal proteins, genes
coding for fimbrial proteins, transcriptional regulator genes,
genes involved in extracellular matrix/biofilm synthesis, stress
response genes, sigma factors, genes encoding RNA binding proteins,
genes encoding small noncoding regulatory RNAs (small RNAs), DNA
polymerase genes, RNA polymerase genes, plasmid
transfer/conjugation genes, chaperone proteins, carbon utilization
genes, Metabolic pathway genes, energy metabolism genes, chemotaxis
genes, genes encoding heat shock proteins, genes encoding putative
proteins, genes encoding recombination proteins, genes encoding
transport system proteins, genes encoding membrane proteins, genes
encoding cell wall components (including LPS), housekeeping genes,
genes encoding structural proteins and enzymes, and plasmid
genes.
[0055] In certain instances, the functions of identified genes may
have been already documented. In other cases, the functions are
unknown, or their unique expression in LSS conditions is unknown.
The functions of differentially expressed genes identified from LSS
cultures can be further characterized by making a mutant
microorganism in which a particular gene of interest is mutated
(e.g., completely knocked out), and assessing whether the mutant
microorganism exhibits any change in virulence, stress resistance
or any other phenotypic characteristics, and therefore determining
whether this gene is involved in establishing infection, for
example. Alternatively, the expression of a gene of interest, which
has been identified from LSS cultures, can be altered by mutating
its promoter, or completing replacing its promoter with a
heterologous promoter, to increase or decrease its expression in
order to determine the role of the gene in establishing
infection.
[0056] If a gene differentially expressed in LSS conditions is
determined to be involved in establishing infection, such gene
makes a good target, because a loss of function in this gene will
be expected to decrease the ability of the microorganism to cause
infection. This will provide a basis for intelligent design of
pharmaceutical compounds for treating and preventing infection by
this microorganism.
[0057] Further, proteins identified as uniquely expressed in LSS
conditions can be used as antigen for immunizations.
[0058] In still a further aspect of the present invention, LSS
cultures are used for screening for new drugs against infection by
a microorganism. This is achieved by culturing the microorganism in
a LSS environment, contacting the microorganism in the culture with
a candidate compound, and determining the inhibitory effect of the
compound on the growth of the microorganism as indicative of the
therapeutic efficacy of the compound. This method of the present
invention has the advantage to be able to select compounds that are
effective against the microorganism in an in vivo LSS environment
during infection.
[0059] In another aspect, the present invention is directed to the
use of a host, including during space flight, to study interactions
between the host and a microorganism pathogen or an attenuated
vaccine strain when both are simultaneously placed in a low
sedimental shear environment. The pathogen can, for this purpose,
also have been manipulated in an RWV or similar analog.
[0060] According to this aspect of the invention, hosts include
animals, animal analogs, plants, insects, and cell and/or tissue
cultures from animals, animal analogs or plants.
[0061] In one embodiment, the invention is directed to the use of
animal models, including during space flight, as hosts to study
interactions between the host and a microorganism pathogen in a low
sedimental shear environment. Animal models include those typically
used by the art, and include without limitation, animals of the
class Mammalia; preferably rodents such as mice, rats and the
like.
[0062] In another embodiment, the present invention is directed to
the use of so-called animal model analogs as hosts, including
during spaceflight, to examine the host-pathogen interaction.
Animal model analogs as hosts include those known in the art, such
as without limitation, invertebrates, e.g. from the class Nematoda
and the like, for the purpose herein.
[0063] In still another embodiment, the invention contemplates the
use of plants as hosts, including during space flight, to examine
the effect of space flight on the host-pathogen interaction, e.g.,
that leads to infection and disease.
[0064] In yet another embodiment, the invention is directed to the
use of cell and/or tissue cultures from animals (including
mammals), animal analogs (e.g. invertebrates such as nematodes and
the like) and/or plants as hosts, including during space flight, to
examine the effect of space flight on the host-pathogen
interaction.
[0065] This invention is further illustrated by the following
examples, which are not to be construed in any way as imposing
limitations upon the scope thereof. All the publications mentioned
in the present disclosure are incorporated herein by reference.
Example 1
Spaceflight Alters Bacterial Gene Expression and Virulence and
Reveals Role for Global Regulator Hfq
[0066] This example describes experiments conducted with the
bacterial pathogen Salmonella typhimurium which was grown aboard
Space Shuttle mission STS-115 and compared to identical ground
control cultures. Global microarray and proteomic analyses revealed
167 transcripts and 73 proteins changed expression with the
conserved RNA-binding protein Hfq identified as a likely global
regulator involved in the response to the spaceflight environment.
Hfq involvement was confirmed with a ground based microgravity
culture model. Spaceflight samples exhibited enhanced virulence in
a murine infection model and extracellular matrix accumulation
consistent with a biofilm.
Materials and Methods
Strains, Media, and Chemical Reagents
[0067] The virulent, mouse-passaged Salmonella typhimurium
derivative of SL1344 termed .chi.3339 was used as the wild type
strain in all flight and ground-based experiments (5). Isogenic
derivatives of SL1344 with mutations .DELTA.hfq, hfq 3'Cm, and invA
Km were used in ground-based experiments (13, 22). The .DELTA.hfq
strain contains a deletion of the hfq open reading frame (ORF) and
replacement with a chloramphenicol resistance cassette, and the hfq
3'Cm strain contains an insertion of the same cassette immediately
downstream of the WT hfq ORF. The invA Km strain contains a
kanamycin resistance cassette inserted in the invA ORF. Lennox
broth (LB) was used as the growth media in all experiments (5) and
phosphate buffered saline (PBS) (Invitrogen, Carlsbad, Calif.) was
used to resuspend bacteria for use as inoculum in the FPAs. The RNA
fixative RNA Later II (Ambion, Austin, Tex.), glutaraldehyde (16%)
(Sigma, St. Louis, Mo.), and formaldehyde (2%) (Ted Pella Inc.,
Redding, Calif.) were used as fixatives in flight experiments.
Loading of Fluid Processing Apparatus (FPA)
[0068] An FPA consists of a glass barrel that can be divided into
compartments via the insertion of rubber stoppers and a lexan
sheath into which the glass barrel is inserted. Each compartment in
the glass barrel was filled with a solution in an order such that
the solutions would be mixed at specific timepoints in flight via
two actions: (1) downward plunging action on the rubber stoppers
and (2) passage of the fluid in a given compartment through a bevel
on the side of the glass barrel such that it was released into the
compartment below. Glass barrels and rubber stoppers were coated
with a silicone lubricant (Sigmacote, Sigma, St. Louis, Mo.) and
autoclaved separately before assembly. A stopper with a gas
exchange membrane was inserted just below the bevel in the glass
barrel before autoclaving. FPA assembly was performed aseptically
in a laminar flow hood in the following order: 2.0 ml LB media on
top of the gas exchange stopper, one rubber stopper, 0.5 ml PBS
containing bacterial inoculum (approximately 6.7.times.10.sup.6
bacteria), another rubber stopper, 2.5 ml of either RNA fixative or
LB media, and a final rubber stopper. Syringe needles (gauge 255/8)
were inserted into rubber stoppers during this process to release
air pressure and facilitate assembly. To facilitate group
activation of FPAs during flight and to ensure proper containment
levels, sets of 8 FPAs were loaded into larger containers termed
group activation packs (GAPs).
Murine Infection Assay
[0069] Six to eight week old female Balb/c mice (housed in the
Animal Facility at the Space Life Sciences Lab at Kennedy Space
Center) were fasted for approximately 6 hours and then per-orally
infected with increasing dosages of S. typhimurium harvested from
flight and ground FPA cultures and resuspended in buffered saline
gelatin (5). Ten mice per infectious dosage were used, and food and
water were returned to the animals within 30 minutes
post-infection. The infected mice were monitored every 6-12 hours
for 30 days. The LD.sub.50 value was calculated using the formula
of Reed and Muench (23).
Scanning Electron Microscopy
[0070] A portion of cells from the viable, media-supplemented
cultures from flight and ground FPAs were fixed for scanning
electron microscopic analysis using 8% glutaraldehyde and 1%
formaldehyde and were processed for SEM as described previously
(24).
Microarray Analysis
[0071] Total cellular RNA purification, preparation of
fluorescently-labeled, single stranded cDNA probes, probe
hybridization to whole genome S. typhimurium microarrays, and image
acquisition was performed as previously described (7) using three
biological and three technical replicates for each culture
condition. Flow cytometric analysis revealed that cell numbers in
flight and ground biological replicate cultures were not
statistically different (using SYTO-BC dye per manufacturer's
recommendations; Invitrogen, Carlsbad, Calif.). Data from stored
array images were obtained via QuantArray software (Packard
Bioscience, Billerica, Mass.) and statistically analyzed for
significant gene expression differences using the Webarray suite as
described previously (25). GeneSpring software was also used to
validate the genes identified with the Webarray suite. To obtain
the genes comprising the spaceflight stimulon as listed in Table 1,
the following parameters were used in Webarray: a fold increase or
decrease in expression of 2 fold or greater, a spot quality
(A-value) of greater than 9.5, and p-value of less than 0.05. For
some genes listed in Table 1, the following parameters were used: a
fold increase or decrease in expression of value greater than 1.6
or less then 0.6 respectively, an A-value of 8.5 or greater, and
p-value of less then 0.1. The vast majority of genes listed in
Table 1 had an A-value of greater than 9.0 (with most being greater
than 9.5) and a p-value of 0.05 or less. The exceptions were as
follows: sbmA (p-value=0.06), oxyS (A-value=8.81), rplY
(A-value=8.95), cspD (A-value=8.90), yfiA (p-value=0.08), ompX
(p-value=0.09), has (p-value=0.08), rmf (A-value=8.82), wcaD
(p-value 0.09), and fliE (A-value=8.98). To identify spaceflight
stimulon genes also contained in the Hfq regulon, proteins or genes
found to be regulated by Hfq or RNAs found to be bound by Hfq as
reported in the indicated references were scanned against the
spaceflight microarray data for expression changes within the
parameters above (8, 12, 13, 16, 26).
Multidimensional Protein Identification (MudPIT) Analysis Via
Tandem Mass Spectrometry Coupled to Dual Nano-Liquid Chromatography
(LC-LC-MS/MS)
[0072] Acetone-protein precipitates from whole cell lysates
obtained from flight and ground cultures (representing three
biological replicates) were subjected to MudPIT analysis using the
LC-LC-MS/MS technique as described previously (27, 28). Tandem MS
spectra of peptides were analyzed with TurboSEQUEST.TM. v 3.1 and
XTandem software, and the data were further analyzed and organized
using the Scaffold program (29, 30). See Table 2 for the specific
parameters used in Scaffold to identify the proteins in this
study.
Ground-Based RWV Cultures and Acid Stress and Macrophage Survival
Assays
[0073] S. typhimurium cultures were grown in rotating wall vessels
in the LSMMG and 1.times.g orientations and assayed for resistance
to pH=3.5 and survival inside J774 macrophages as described
previously (5), except that the RWV cultures were grown for 24
hours at 37 degrees C. For acid stress assays, the percentage of
surviving bacteria present after 45-60 minutes acid stress
(compared to the original number of bacteria before addition of the
stress) was calculated. A ratio of the percent survival values for
the LSMMG and 1.times.g cultures was obtained (indicating the fold
difference in survival between these cultures) and is presented as
the acid survival ratio in FIG. 5A. The mean and standard deviation
from three independent experimental trials is presented. For
macrophage survival assays, the number of bacteria present inside
J774 macrophages at 2 hours and 24 hours post-infection was
determined, and the fold difference between these two numbers was
calculated. The mean and standard deviation of values from three
independent experimental trials (each done in triplicate tissue
culture wells) is presented. The statistical differences observed
in the graphs in FIG. 5 were calculated at p-values less than
0.05.
Results
Whole-Genome Transcriptional and Proteomic Analysis of Spaceflight
and Ground Cultures.
[0074] To determine which genes changed expression in response to
spaceflight, total bacterial RNA was isolated from the fixed flight
and ground samples, qualitatively analyzed to ensure lack of
degradation via denaturing gel electrophoresis, quantitated, and
then reversed transcribed into labeled, single-stranded cDNA. The
labeled cDNA was co-hybridized with differentially-labeled S.
typhimurium genomic DNA to whole genome S. typhimurium microarray
slides. The cDNA signal hybridizing to each gene spot was
quantitated, and the normalized, background-subtracted data was
analyzed for statistically-significant, 2-fold or greater
differences in gene expression between the flight and ground
samples. 167 genes were found to be differentially-expressed in
flight as compared to ground controls from a variety of functional
categories (69 up-regulated and 98 down-regulated) (Table 1). The
proteomes of fixed cultures were also obtained via
multi-dimensional protein identification (MudPIT) analysis. Among
251 proteins expressed in the flight and ground cultures, 73 were
present at different levels in these samples (Table 2). Several of
the genes encoding these proteins were also identified via
microarray analysis. Collectively, these gene expression changes
form the first documented bacterial spaceflight stimulon indicating
that bacteria respond to this environment with widespread
alterations of expression of genes distributed globally throughout
the chromosome (FIG. 4, Panel A).
Involvement of Hfq in Spaceflight and LSMMG Responses
[0075] The data indicated that a pathway involving the conserved
RNA-binding regulatory protein Hfq played a role in this response
(Table 3). Hfq is an RNA chaperone that binds to small regulatory
RNA and mRNA molecules to facilitate mRNA translational regulation
in response to envelope stress (in conjunction with the specialized
sigma factor RpoE), environmental stress (via alteration of RpoS
expression), and changes in metabolite concentrations, such as iron
levels (via the Fur pathway) (8-12). Hfq is also involved in
promoting the virulence of several pathogens including S.
typhimurium (13), and Hfq homologues are highly conserved across
species of prokaryotes and eukaryotes (14). The data strongly
supported a role for Hfq in the response to spaceflight: (1) The
expression of hfq was decreased in flight, and this finding matched
previous results in which S. typhimurium hfq gene expression was
decreased in a ground-based model of microgravity (7); (2)
Expression of 64 genes in the Hfq regulon was altered in flight
(32% of the total genes identified), and the directions of
differential changes of major classes of these genes matched
predictions associated with decreased hfq expression (see
subsequent examples); (3) several small regulatory RNAs that
interact with Hfq were differentially regulated in flight as would
be predicted if small RNA/Hfq pathways are involved in a
spaceflight response; (4) The levels of OmpA, OmpC, and OmpD mRNA
and protein are classic indicators of the RpoE-mediated periplasmic
stress response which involves Hfq (15). Transcripts encoding OmpA,
OmpC, and OmpD (and OmpC protein level) were up-regulated in
flight, correlating with hfq down-regulation; (5) Hfq promotes
expression of a large class of ribosomal structural protein genes
(12), and many such genes exhibited decreased expression in flight;
(6) Hfq is a negative regulator of the large tra operon encoding
the F plasmid transfer apparatus (16), and several tra genes from
related operons on two plasmids present in S. typhimurium .chi.3339
were up regulated in flight; (7) Hfq is intimately involved in a
periplasmic stress signaling pathway that is dependent on the
activity levels of three key proteins, RpoE, DksA, and RseB:
differential expression of these genes was observed in flight (8,
12); (8) Hfq regulates the expression of the Fur protein and other
genes involved in the iron response pathway, and several iron
utilization/storage genes were found to have altered expression in
flight (9, 11). This finding also matched previous results in which
iron pathway genes in S. typhimurium changed expression in a
ground-based model of microgravity, and the Fur protein was shown
to play a role in stress resistance alterations induced in the same
model (7).
[0076] Experiments were performed to verify a role for Hfq in the
spaceflight response using a cellular growth apparatus that serves
as a ground-based model of microgravity conditions termed the
rotating wall vessel (RWV) bioreactor (FIG. 2). Designed by NASA,
the RWV has been extensively used in this capacity to study the
effects of a biomedically relevant low fluid shear growth
environment (which closely models the liquid growth environment
encountered by cells in the microgravity environment of spaceflight
as well as by pathogens during infection of the host) on various
types of cells (6, 17-19). Studies with the RWV involve using two
separate apparatus: one is operated in the modeled microgravity
position (termed low-shear modeled microgravity or LSMMG) and one
is operated as a control in a position (termed 1.times.g) where
sedimentation due to gravity is not offset by the rotating action
of the vessel. LSMMG-induced alterations in acid stress resistance
and macrophage survival of S. typhimurium have previously been
shown to be associated with global changes in gene expression and
virulence (5, 7).
[0077] Wild type and isogenic hfq mutant strains of S. typhimurium
were grown in the RWV in the LSMMG and 1.times.g positions and
assayed for the acid stress response and macrophage survival. While
the wild type strain displayed a significant difference in acid
resistance between the LSMMG and 1.times.g cultures, this response
was not observed in the hfq mutant, which contains a deletion of
the hfq gene and replacement with a Cm-r cassette (FIG. 5, Panel
A). Two control strains, hfq 3'Cm (containing an insertion of the
Cm-r cassette just downstream of the WT hfq gene) and invA Km
(containing a Km-r insertion in a gene unrelated to stress
resistance), gave the same result as the WT strain. Intracellular
replication of the LSMMG-grown WT (hfq 3'Cm) strain in infected
J774 macrophages was also increased as compared to the 1.times.g
control, and this phenotype was not observed in the hfq mutant
strain (FIG. 5, Panel B). Collectively, these data indicate that
Hfq is involved in the bacterial spaceflight response as confirmed
in a ground-based model of microgravity conditions. In addition,
the intracellular replication phenotype inside macrophages
correlates with the finding that spaceflight and LSMMG cultures
exhibit increased virulence in mice (see text below).
Increased Virulence of S. typhimurium Grown in Spaceflight as
Compared to Ground Controls.
[0078] Since growth during spaceflight and potential global
reprogramming of gene expression in response to this environment
could alter the virulence of a pathogen, we compared the virulence
of S. typhimurium spaceflight samples to identical ground controls
as a second major part of our study. Bacteria from flight and
ground cultures were harvested and immediately used to inoculate
female Balb/c mice via a per-oral route of infection on the same
day as Shuttle landing. Two sets of mice were infected at
increasing dosages of either flight or ground cultures, and the
health of the mice was monitored every 6-12 hours for 30 days. Mice
infected with bacteria from the flight cultures displayed a
decreased time to death (at the 10.sup.7 dosage), increased percent
mortality at each infection dosage and a decreased LD.sub.50 value
compared to those infected with ground controls (FIG. 4, Panels
B,C,D). These data indicate increased virulence for spaceflight S.
typhimurium samples and are consistent with previous studies in
which the same strain of S. typhimurium grown in the RWV under
LSMMG conditions displayed enhanced virulence in a murine model as
compared to 1.times.g controls (5).
Scanning Electron Microscopy of Spaceflight and Ground
Cultures.
[0079] To determine any morphological differences between flight
and ground cultures, scanning electron microscopic (SEM) analysis
of bacteria from these samples was performed. While no difference
in the size and shape of individual cells in both cultures was
apparent, the flight samples demonstrated clear differences in
cellular aggregation and clumping that was associated with the
formation of an extracellular matrix (FIG. 4, Panel E). Consistent
with this finding, several genes associated with surface
alterations related to biofilm formation changed expression in
flight (up-regulation of wca/wza colonic acid synthesis operon,
ompA, fimII; down-regulation of motility genes) (Table 3). SEM
images of other bacterial biofilms show a similar matrix
accumulation (20, 21). Since extracellular matrix/biofilm formation
can help to increase survival of bacteria under various conditions,
this phenotype indicates a change in bacterial community
potentially related to the increased virulence of the flight
bacteria in the murine model.
TABLE-US-00001 TABLE 1 Salmonella typhimurium genes
differentially-regulated during spaceflight mission STS-115 Gene
Fold Gene number change name Known or putative function
UP-regulated Secreted proteins: STM1959 (SEQ ID NO: 1) 2.10 fliC
flagellar biosynthesis; flagellin, filament structural protein
STM2066 (SEQ ID NO: 2) 2.31 sopA Secreted effector protein of
Salmonella dublin STM2883 (SEQ ID NO: 3) 2.57 sipD cell invasion
protein STM2884 (SEQ ID NO: 4) 6.28 sipC cell invasion protein
Membrane proteins: STM0374 (SEQ ID NO: 5) 2.04 yaiV putative inner
membrane protein STM1070 (SEQ ID NO: 6) 2.05 ompA putative
hydrogenase, membrane component STM1572 (SEQ ID NO: 7) 3.34 ompD
outer membrane protein; bacterial porin STM2267 (SEQ ID NO: 8) 2.44
ompC outer membrane protein 1b (ib; c), porin STM3420 (SEQ ID NO:
9) 3.12 secY preprotein translocase of IISP family, putative
membrane ATPase Other function: STM0152 (SEQ ID NO: 10) 2.18 aceE
pyruvate dehydrogenase, decarboxylase component STM0182 (SEQ ID NO:
11) 2.21 panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
STM0240 (SEQ ID NO: 12) 2.02 yaeJ putative-tRNA hydrolase domain
STM0272 (SEQ ID NO: 13) 2.36 putative ATPase with chaperone
activity; homologue of Yersinia clpB STM0596 (SEQ ID NO: 14) 2.24
entE 2,3-dihydroxybenzoate-AMP ligase STM0730 (SEQ ID NO: 15) 4.75
gltA citrate synthase STM1040 (SEQ ID NO: 16) 2.12 Gifsy-2
prophage; probable minor tail protein STM1290 (SEQ ID NO: 17) 7.67
gapA glyceraldehyde-3-phosphate dehydrogenase A STM1749 (SEQ ID NO:
18) 4.76 adhE iron-dependent alcohol dehydrogenase of AdhE STM2106
(SEQ ID NO: 19) 2.07 wcaI putative glycosyl transferase in colanic
acid biosynthesis STM2118 (SEQ ID NO: 20) 2.30 wza putative
polysaccharide export protein, outer membrane STM2181 (SEQ ID NO:
21) 2.06 yohJ putative effector of murein hydrolase LrgA STM2282
(SEQ ID NO: 22) 2.58 glpQ glycerophosphodiester phosphodiesterase,
periplasmic STM2314 (SEQ ID NO: 23) 2.58 putative chemotaxis signal
transduction protein STM2708 (SEQ ID NO: 24) 2.03 Fels-2 prophage:
similar to tail fiber protein (gpI) in phage P2 STM2719 (SEQ ID NO:
25) 2.12 Fels-2 prophage: similar to gpR in phage 186 STM2843 (SEQ
ID NO: 26) 2.03 hydN electron transport protein (FeS senter) from
formate to hydrogen STM2846 (SEQ ID NO: 27) 2.26 hycH processing of
HycE (part of the FHL complex) STM2855 (SEQ ID NO: 28) 3.25 hypB
hydrogenase-3 accessory protein, assembly of metallocenter STM4311
(SEQ ID NO: 29) 3.58 tnpA IS200 transposase STM4325 (SEQ ID NO: 30)
6.39 dcuA Dcu family, anaerobic dicarboxylate transport protein
STM4415 (SEQ ID NO: 31) 2.71 fbp fructose-bisphosphatase STM4466
(SEQ ID NO: 32) 4.07 putative carbamate kinase SSL_2286 (SEQ ID NO:
33) 2.97 orf36 putative phage replicase Putative, unknown function:
STM0289 (SEQ ID NO: 34) 2.08 putative cytoplasmic protein STM0699
(SEQ ID NO: 35) 2.76 putative cytoplasmic protein STM2744 (SEQ ID
NO: 36) 2.44 putative cytoplasmic protein STM3752 (SEQ ID NO: 37)
2.05 putative cytoplasmic protein SSL_T1747 (SEQ ID NO: 38) 4.06
putative cytoplasmic protein Plasmid genes: Plasmid 1 (pSLT):
PSLT011 (SEQ ID NO: 39) 2.20 srgA sdiA-regulated gene; putative
thiol-disulfide isomerase or thioredoxin PSLT015 (SEQ ID NO: 40)
4.44 orf5 putative outer membrane protein PSLT039 (SEQ ID NO: 41)
2.21 spvB Salmonella plasmid virulence: hydrophilic protein PSLT043
(SEQ ID NO: 42) 4.21 putative phosphoribulokinase/uridine kinase
family PSLT044 (SEQ ID NO: 43) 4.43 putative integrase protein
PSLT054 (SEQ ID NO: 44) 2.37 samB mutagenesis by UV and mutagens;
related to umuDC operon PSLT068 (SEQ ID NO: 45) 2.04 putative
ParB-like nuclease domain PSLT072 (SEQ ID NO: 46) 2.11 putative
transglycosylase PSLT081 (SEQ ID NO: 47) 4.71 traB conjugative
transfer: assembly PSLT095 (SEQ ID NO: 48) 4.24 traN conjugative
transfer: aggregate stability PSLT099 (SEQ ID NO: 49) 2.32 trbB
conjugative transfer PSLT100 (SEQ ID NO: 50) 2.59 traH conjugative
transfer: assembly PSLT101 (SEQ ID NO: 51) 2.20 traG conjugative
transfer: assembly abd aggregate stability PSLT104 (SEQ ID NO: 52)
2.87 traD conjugative transfer: DNA transport PSLT110 (SEQ ID NO:
53) 2.37 traX conjugative transfer: fimbrial acetylation Plasmid 2:
SSL_36 (SEQ ID NO: 54) 2.02 colIb colicin Ib protein SSL_T3 (SEQ ID
NO: 55) 2.68 trbC conjugative transfer SSL_T5 (SEQ ID NO: 56) 3.14
trbA conjugative transfer SSL_T12 (SEQ ID NO: 57) 2.34 traT
conjugative transfer SSL_T20 (SEQ ID NO: 58) 2.91 traK conjugative
transfer SSL_T24 (SEQ ID NO: 59) 2.10 traF conjugative transfer
SSL_T35 (SEQ ID NO: 60) 3.03 pilL lipoprotein SSL_T45 (SEQ ID NO:
61) 2.32 yagA unknown function SSL_T52 (SEQ ID NO: 62) 2.17 stbA
plasmid stability SSL_T53 (SEQ ID NO: 63) 5.31 orf05 unknown
function SSL_T66 (SEQ ID NO: 64) 2.93 ygbA unknown function Plasmid
3: SSL_T69 (SEQ ID NO: 65) 2.39 tnpB putative transposase SSL_T70
(SEQ ID NO: 66) 14.1 strB streptomycin resistance SSL_T71 (SEQ ID
NO: 67) 3.55 strA streptomycin resistance SSL_T72 (SEQ ID NO: 68)
7.43 sulII sulphonamide resistance SSL_5085 (SEQ ID NO: 69) 2.08
repA plasmid replication DOWN-regulated Protein secretion: STM1153
(SEQ ID NO: 70) 0.342 msyB suppresses protein export mutants
STM2895 (SEQ ID NO: 71) 0.417 invB surface presentation of
antigens; secretory proteins STM3293 (SEQ ID NO: 72) 0.432 secG
preprotein translocase IISP family STM3701 (SEQ ID NO: 73) 0.473
secB molecular chaperone in protein export STM3974 (SEQ ID NO: 74)
0.445 tatB component of Sec-independent protein secretion pathway
STM4147 (SEQ ID NO: 75) 0.392 secE preprotein translocase IISP
family, membrane subunit Flagella: STM1916 (SEQ ID NO: 76) 0.458
cheY chemotaxis regulator, transmits signals to flagelllar motor
STM1925 (SEQ ID NO: 77) 0.356 flhD regulator of flagellar
biosynthesis, acts on class 2 operons STM1962 (SEQ ID NO: 78) 0.443
fliT flagellar biosynthesis; possible export chaperone for FliD
Fimbrial: STM0543 (SEQ ID NO: 79) 0.434 fimA major type 1 subunit
fimbrin (pilin) Stress proteins: STM0831 (SEQ ID NO: 80) 0.273 dps
stress response DNA-binding protein STM1652 (SEQ ID NO: 81) 0.200
ynaF putative universal stress protein Regulatory: STM_sRNA (SEQ ID
NO: 82) 0.458 RFN putative small regulatory RNA STM_sRNA (SEQ ID
NO: 83) 0.499 rne5 putative small regulatory RNA STM_sRNA (SEQ ID
NO: 84) 0.318 csrB regulatory RNA STM0473 (SEQ ID NO: 85) 0.389 hha
hemolysin expression modulating protein STM0606 (SEQ ID NO: 86)
0.493 ybdO putative transcriptional regulator, LysR family STM0959
(SEQ ID NO: 87) 0.415 lrp regulator for lrp regulon (AsnC family)
STM1444 (SEQ ID NO: 88) 0.391 slyA transcriptional regulator for
hemolysin (MarR family) STM1660 (SEQ ID NO: 89) 0.494 fnr
transcriptional regulator STM2640 (SEQ ID NO: 90) 0.402 rpoE sigma
E (sigma 24) factor of RNA polymerase STM3466 (SEQ ID NO: 91) 0.438
crp catabolite activator protein (CAP), cyclic AMP protein (CRP
family) STM4315 (SEQ ID NO: 92) 0.445 rtsA AraC-type DNA-binding
domain-containing protein STM4361(SEQ ID NO: 93) 0.298 hfq host
factor I for bacteriophage Q beta replication Ribosomal: STM0216
(SEQ ID NO: 94) 0.344 rpsB 30S ribosomal subunit protein S2 STM0469
(SEQ ID NO: 95) 0.474 rpmE2 putative 50S ribosomal protein L31
(second copy) STM2675 (SEQ ID NO: 96) 0.356 rimM 16S rRNA
processing protein STM3345 (SEQ ID NO: 97) 0.310 rplM 50S ribosomal
subunit protein L13 STM3425 (SEQ ID NO: 98) 0.403 rplF 50S
ribosomal subunit protein L6 STM3428 (SEQ ID NO: 99) 0.438 rplE 50S
ribosomal subunit protein L5 STM3430 (SEQ ID NO: 100) 0.182 rplN
50S ribosomal subunit protein L14 STM3433 (SEQ ID NO: 101) 0.422
rplP 50S ribosomal subunit protein L16 STM3436 (SEQ ID NO: 102)
0.289 rpsS 30S ribosomal subunit protein S19 STM3438 (SEQ ID NO:
103) 0.457 rplW 50S ribosomal subunit protein L23 STM3439 (SEQ ID
NO: 104) 0.393 rplD 50S ribosomal subunit protein L4, regulates S10
expression STM3448 (SEQ ID NO: 105) 0.250 rpsL 30S ribosomal
subunit protein S12 STM4150 (SEQ ID NO: 106) 0.423 rplA 50S
ribosomal subunit protein L1, regulates L1 and L11 STM4391 (SEQ ID
NO: 107) 0.401 rpsF 30S ribosomal subunit protein S6
Membrane/periplasmic proteins: STM1164 (SEQ ID NO: 108) 0.340 yceB
putative outer membrane lipoprotein STM1249 (SEQ ID NO: 109) 0.443
putative periplasmic protein STM1432 (SEQ ID NO: 110) 0.464 ydhO
putative cell wall-associated hydrolase STM1460 (SEQ ID NO: 111)
0.408 ydgK putative inner membrane protein STM1732 (SEQ ID NO: 112)
0.276 ompW outer membrane protein W; colicin S4 receptor STM1798
(SEQ ID NO: 113) 0.471 ycgR putative inner membrane protein STM2505
(SEQ ID NO: 114) 0.410 putative inner membrane protein STM2685 (SEQ
ID NO: 115) 0.411 smpA small membrane protein A STM2802 (SEQ ID NO:
116) 0.453 ygaM putative inner membrane protein STM2870 (SEQ ID NO:
117) 0.462 putative inner membrane protein STM3107 (SEQ ID NO: 118)
0.460 yggN putative periplasmic protein STM3228 (SEQ ID NO: 119)
0.378 yqjC putative periplasmic protein STM3229 (SEQ ID NO: 120)
0.485 yqjD putative inner membrane protein STM3231 (SEQ ID NO: 121)
0.457 yqjK putative inner membrane protein STM3347 (SEQ ID NO: 122)
0.393 yhcB putative periplasmic protein STM4378 (SEQ ID NO: 123)
0.328 yjfN putative inner membrane protein STM4561 (SEQ ID NO: 124)
0.319 osmY hyperosmotically inducible periplasmic protein Other
function: STM0186 (SEQ ID NO: 125) 0.406 dksA dnaK suppressor
protein STM0368 (SEQ ID NO: 126) 0.386 prpB putative
carboxyphosphonoenolpyruvate mutase STM0369 (SEQ ID NO: 127) 0.403
prpC putative citrate synthase STM0417 (SEQ ID NO: 128) 0.382 ribH
riboflavin synthase, beta chain STM0536 (SEQ ID NO: 129) 0.483 ppiB
peptidyl-prolyl cis-trans isomerase B (rotamase B) STM0665 (SEQ ID
NO: 130) 0.480 gltI ABC superfamily (bind_prot),
glutamate/aspartate transporter STM0759 (SEQ ID NO: 131) 0.492 ybgS
putative homeobox protein STM0803 (SEQ ID NO: 132) 0.408 moaB
molybdopterin biosynthesis, protein B STM0966 (SEQ ID NO: 133)
0.497 dmsC anaerobic dimethyl sulfoxide reductase, subunit C
STM1196 (SEQ ID NO: 134) 0.336 acpP acyl carrier protein STM1291
(SEQ ID NO: 135) 0.474 yeaA putative peptide methionine sulfoxide
reductase STM1569 (SEQ ID NO: 136) 0.458 fdnH formate
dehydrogenase-N, Fe--S beta subunit, nitrate- inducible STM1783
(SEQ ID NO: 137) 0.478 pth peptidyl-tRNA hydrolase STM2488 (SEQ ID
NO: 138) 0.436 nlpB lipoprotein-34 STM2542 (SEQ ID NO: 139) 0.495
nifU NifU homologs involved in Fe--S
cluster formation STM2549 (SEQ ID NO: 140) 0.460 asrB anaerobic
sulfide reductase STM2646 (SEQ ID NO: 141) 0.294 yfiD putative
formate acetyltransferase STM2746 (SEQ ID NO: 142) 0.344 putative
Excinuclease ATPase subunit STM2767 (SEQ ID NO: 143) 0.491 putative
Superfamily I DNA and RNA helicase STM3039 (SEQ ID NO: 144) 0.455
idi isopentenyldiphosphate isomerase STM3054 (SEQ ID NO: 145) 0.431
gcvH glycine cleavage complex protein H STM3241 (SEQ ID NO: 146)
0.458 tdcE pyruvate formate-lyase 4/2-ketobutyrate formate- lyase
STM3443 (SEQ ID NO: 147) 0.404 bfr bacterioferrin, an iron storage
homoprotein STM3702 (SEQ ID NO: 148) 0.453 grxC glutaredoxin 3
STM3703 (SEQ ID NO: 149) 0.321 yibN putative Rhodanese-related
sulfurtransferases STM3870 (SEQ ID NO: 150) 0.484 atpE
membrane-bound ATP synthase, F0 sector, subunit c STM3915 (SEQ ID
NO: 151) 0.492 trxA thioredoxin 1, redox factor STM4341 (SEQ ID NO:
152) 0.411 frdC fumarate reductase, anaerobic, membrane anchor
polypeptide STM4414 (SEQ ID NO: 153) 0.475 ppa inorganic
pyrophosphatase Putative ORF, unknown function: STM0474 (SEQ ID NO:
154) 0.435 ybaJ putative cytoplasmic protein STM1367 (SEQ ID NO:
155) 0.378 ydiH putative cytoplasmic protein STM1583 (SEQ ID NO:
156) 0.441 putative cytoplasmic protein STM2390 (SEQ ID NO: 157)
0.290 yfcZ putative cytoplasmic protein STM2801 (SEQ ID NO: 158)
0.451 ygaC putative cytoplasmic protein STM3461 (SEQ ID NO: 159)
0.493 putative cytoplasmic protein STM3654 (SEQ ID NO: 160) 0.341
pseudogene; in-frame stop following codon 23 STM3995 (SEQ ID NO:
161) 0.459 yihD putative cytoplasmic protein STM4002 (SEQ ID NO:
162) 0.172 putative cytoplasmic protein STM4088 (SEQ ID NO: 163)
0.357 yiiU putative cytoplasmic protein STM4239 (SEQ ID NO: 164)
0.334 putative cytoplasmic protein STM4240 (SEQ ID NO: 165) 0.411
yjbJ putative cytoplasmic protein STM4250 (SEQ ID NO: 166) 0.422
yjbQ putative cytoplasmic protein STM4499 (SEQ ID NO: 167) 0.494
yeeN putative cytoplasmic protein
TABLE-US-00002 TABLE 2 Salmonella typhimurium proteins identified
in flight and ground total cell samples from STS-115 using MudPIT
analysis (251 proteins total) Protein Ground Flight molecular total
cell total cell Accession weight protein ID protein ID Protein name
number (Daltons) probability* probability* aspartate ammonia-lyase
gi|16767575 (SEQ ID NO: 168) 52268.1 100% 100% translation
elongation factor EF-Tu.A gi|96718 (SEQ ID NO: 169) 43233.6 100%
100% elongation factor G gi|16766735 (SEQ ID NO: 170) 77582 100%
100% putative hydrogenase membrane component precursor gi|16764429
(SEQ ID NO: 171) 37497.2 100% 100% GroEL protein gi|16767579 (SEQ
ID NO: 172) 57267.8 100% 100% 30S ribosomal protein S1
gi|16764341(SEQ ID NO: 173) 61154.4 100% 100% L-asparaginase
gi|16766407 (SEQ ID NO: 174) 36908.5 100% 100% phosphoenolpyruvate
carboxykinase gi|16766788 (SEQ ID NO: 175) 59559.8 100% 100%
enolase gi|16766258 (SEQ ID NO: 176) 45468 100% 100% glyceraldehyde
3-phosphate dehydrogenase A gi|16764641 (SEQ ID NO: 177) 35568.6
100% 100% periplasmic glycerophosphodiester phosphodiesterase
gi|16765609 (SEQ ID NO: 178) 40407.8 100% 100% molecular chaperone
DnaK gi|16763402 (SEQ ID NO: 179) 69241.2 100% 100% 30S ribosomal
protein S3 gi|16766723 (SEQ ID NO: 180) 25965.5 100% 100% formate
acetyltransferase 1 gi|16764333 (SEQ ID NO: 181) 84989.4 100% 100%
50S ribosomal subunit protein L7/L12 gi|16767406 (SEQ ID NO: 182)
12281 100% 100% ribosomal protein S7 gi|16766736 (SEQ ID NO: 183)
17572.5 100% 100% histone like DNA-binding protein HU-alpha (NS2)
(HU-2) gi|16767424 (SEQ ID NO: 184) 9503.1 100% 100% glycerol
kinase gi|16767352 (SEQ ID NO: 185) 56046.2 100% 100%
dihydrolipoamide dehydrogenase gi|16763544 (SEQ ID NO: 186) 50621.8
100% 100% sn-glycerol-3-phosphate dehydrogenase gi|16766813 (SEQ ID
NO: 187) 56908.5 100% 100% trigger factor gi|16763828 (SEQ ID NO:
188) 48048.1 100% 100% cold shock protein gi|16765178 (SEQ ID NO:
189) 7384.3 100% 100% DNA-binding protein HLP-II gi|16765095 (SEQ
ID NO: 190) 15525 100% 100% ATP synthase beta subunit gi|16767149
(SEQ ID NO: 191) 50265.5 100% 100% phosphoglycerate kinase
gi|16766370 (SEQ ID NO: 192) 41115.1 100% 100% iron-dependent
alcohol dehydrogenase AdhE gi|16765093 (SEQ ID NO: 193) 96199.8
100% 100% 50S ribosomal subunit protein L1 gi|16767404 (SEQ ID NO:
194) 24710.5 100% 100% 30S ribosomal protein S4 gi|16766705 (SEQ ID
NO: 195) 23467.7 100% 100% 50S ribosomal subunit protein L13
gi|16766640 (SEQ ID NO: 196) 16000.7 100% 100% putative outer
membrane porin precursor gi|16764916 (SEQ ID NO: 197) 39662.7 99%
99% FKBP-type peptidyl-prolyl cis-trans isomerase gi|16766742 (SEQ
ID NO: 198) 28928.6 100% 100% transketolase 1 isozyme gi|16766377
(SEQ ID NO: 199) 72117 100% 100% 50S ribosomal subunit protein L5
gi|16766717 (SEQ ID NO: 200) 20300.6 100% 100% DNA-directed RNA
polymerase beta' subunit gi|16767408 (SEQ ID NO: 201) 155220 100%
100% 30S ribosomal protein S13 gi|16766707 (SEQ ID NO: 202) 13144.1
100% 100% alkyl hydroperoxide reductase C22 subunit gi|16763985
(SEQ ID NO: 203) 20729.7 100% 100% 30S ribosomal subunit protein S5
gi|16766712 (SEQ ID NO: 204) 17585 100% 100% 50S ribosomal protein
L24 gi|16766718 (SEQ ID NO: 205) 11298.3 100% 100% DNA protection
during starvation protein gi|16764193 (SEQ ID NO: 206) 18699.8 100%
100% ribosomal protein L19 gi|16765988 (SEQ ID NO: 207) 13112 100%
100% acyl carrier protein gi|16764551 (SEQ ID NO: 208) 8621.4 100%
100% isocitrate dehydrogenase gi|16764593 (SEQ ID NO: 209) 45771
100% 93% triosephosphate isomerase gi|16767347 (SEQ ID NO: 210)
26899 100% 100% 50S ribosomal subunit protein L3 gi|16766729 (SEQ
ID NO: 211) 22228.7 100% 100% 30S ribosomal protein S2 gi|16763606
(SEQ ID NO: 212) 26741.2 100% 100% lysine decarboxylase gi|16765879
(SEQ ID NO: 213) 81220.5 100% 100% putative universal stress
protein gi|16763991 (SEQ ID NO: 214) 15882.8 100% 100% putative
thiol-alkyl hydroperoxide reductase gi|16763782 (SEQ ID NO: 215)
22299 100% 100% 50S ribosomal protein L9 gi|16767640 (SEQ ID NO:
216) 15765.8 100% 100% 50S ribosomal subunit protein L10
gi|16767405 (SEQ ID NO: 217) 17782.8 100% 100% 30S ribosomal
subunit protein S16 gi|16765991 (SEQ ID NO: 218) 9216.7 100% 100%
50S ribosomal protein L20 gi|16764687 (SEQ ID NO: 219) 13479.6 100%
100% pyruvate kinase gi|16764728 (SEQ ID NO: 220) 50639.5 100% 98%
6-phosphogluconate dehydrogenase gi|16765411 (SEQ ID NO: 221)
51379.2 100% 93% inorganic pyrophosphatase gi|16767660 (SEQ ID NO:
222) 19658.8 100% 100% 50S ribosomal protein L4 gi|16766728 (SEQ ID
NO: 223) 22068.6 100% 100% 50S ribosomal protein L11 gi|16767403
(SEQ ID NO: 224) 14857.5 100% 100% 50S ribosomal subunit protein
L17 gi|16766703 (SEQ ID NO: 225) 14377.2 100% 100% succinyl-CoA
synthetase beta chain gi|16764108 (SEQ ID NO: 226) 41462.8 100%
100% 50S ribosomal subunit protein L6 gi|16766714 (SEQ ID NO: 227)
18841.3 100% 100% fructose 1,6-bisphosphate aldolase gi|16766369
(SEQ ID NO: 228) 39138.4 100% 100% aconitate hydratase 2
gi|16763548 (SEQ ID NO: 229) 93513.7 100% 100% iron superoxide
dismutase gi|16764779 (SEQ ID NO: 230) 21290.4 100% 100% 50S
ribosomal protein L22 gi|16766724 (SEQ ID NO: 231) 12208.6 100%
100% sn-glycerol-3-phosphate dehydrogenase large subunit
gi|16765611 (SEQ ID NO: 232) 59039.6 100% 100% RNA polymerase,
alpha subunit gi|16766704 (SEQ ID NO: 233) 36494.1 100% 100% 30S
ribosomal protein S10 gi|16766730 (SEQ ID NO: 234) 11748.8 100%
100% RNA polymerase, beta subunit gi|16767407 (SEQ ID NO: 235)
150586.6 100% 99% polynucleotide phosphorylase gi|16766580 (SEQ ID
NO: 236) 77020.9 100% 100% Lpp1 murein lipoprotein gi|16764727 (SEQ
ID NO: 237) 8373.6 100% 93% malate dehydrogenase gi|16766654 (SEQ
ID NO: 238) 32457.8 100% 100% citrate synthase gi|16764100 (SEQ ID
NO: 239) 48089.9 100% 100% GroES protein gi|16767578 (SEQ ID NO:
240) 10300.1 100% 100% putative glutamic dehyrogenase-like protein
gi|16765136 (SEQ ID NO: 241) 48020.6 100% 100% succinyl-CoA
synthetase alpha subunit gi|16764109 (SEQ ID NO: 242) 29757.8 99%
100% transaldolase B gi|16763397 (SEQ ID NO: 243) 35154.5 100% 100%
glycine dehydrogenase gi|16766354 (SEQ ID NO: 244) 104270.1 93%
100% transcription elongation factor NusA gi|16766585 (SEQ ID NO:
245) 55408.3 100% 100% flagellar biosynthesis filament structural
protein gi|16766083 (SEQ ID NO: 246) 52518.5 100% 100% elongation
factor Ts gi|16763607 (SEQ ID NO: 247) 30339.6 100% 100%
N-acetylneuraminate lyase gi|16766634 (SEQ ID NO: 248) 32437.7 100%
100% 50S ribosomal subunit protein L32 gi|16764546 (SEQ ID NO: 249)
6428.4 100% 100% ATP synthase alpha subunit gi|16767151 (SEQ ID NO:
250) 55096 100% 97% 50S ribosomal subunit protein L14 gi|16766719
(SEQ ID NO: 251) 13550.2 99% 100% phosphate acetyltransferase
gi|16765792 (SEQ ID NO: 252) 82305.8 100% 100% 50S ribosomal
subunit protein L15 gi|16766710 (SEQ ID NO: 253) 14948.9 100% 100%
ribose-phosphate pyrophosphokinase gi|16765121 (SEQ ID NO: 254)
34198.6 100% 88% thioredoxin gi|16767191** (SEQ ID NO: 255) 11789.4
100% 0 arginine-binding periplasmic protein 1 precursor gi|16764251
(SEQ ID NO: 256) 26979.4 0 93% hydrogenase-2 large subunit
gi|16766447 (SEQ ID NO: 257) 62420.6 100% 100% cytoplasmic ferritin
gi|16765276 (SEQ ID NO: 258) 19262.5 100% 100% riboflavin synthase
subunit beta gi|16763797 (SEQ ID NO: 259) 15990.5 100% 97% 50S
ribosomal subunit protein L29 gi|16766721 (SEQ ID NO: 260) 7242.6
100% 93% putative universal stress protein gi|16764996 (SEQ ID NO:
261) 15696.7 93% 100% periplasmic nitrate reductase gi|16765587
(SEQ ID NO: 262) 92856.9 100% 93% hyperosmotically-inducible
periplasmic protein gi|16767802 (SEQ ID NO: 263) 21430.3 93% 93%
ornithine carbamoyltransferase gi|16767710 (SEQ ID NO: 264) 36798.4
100% 100% 30S ribosomal protein S11 gi|16766706 (SEQ ID NO: 265)
13812.8 100% 100% formate dehydrogenase alpha subunit gi|16767302
(SEQ ID NO: 266) 112357.4 100% 100% nucleoside diphosphate kinase
(ndk) gi|16765846 (SEQ ID NO: 267) 15503.7 100% 100% putative
pyruvate-flavodoxin oxidoreductase gi|16764995 (SEQ ID NO: 268)
128563.7 55% 100% glycoprotein/polysaccharide metabolism protein
gi|16763846 (SEQ ID NO: 269) 19458.9 100% 100% O-acetyl serine
sulfhydrylase gi|11514514 (SEQ ID NO: 270) 34414.7 93% 100% 30S
ribosomal subunit protein S21 gi|16766509 (SEQ ID NO: 271) 8482.1
100% 100% ornithine decarboxylase isozyme gi|16764071 (SEQ ID NO:
272) 82432.6 100% 99% fumarate reductase gi|16767591 (SEQ ID NO:
273) 27157.3 100% 100% anaerobic glycerol-3-phosphate dehydrogenase
subunit B gi|16765612 (SEQ ID NO: 274) 45653.3 100% 100%
glucose-specific PTS system enzyme IIA component gi|16765753 (SEQ
ID NO: 275) 18229.5 100% 100% DNA-directed RNA polymerase omega
subunit gi|16767026 (SEQ ID NO: 276) 10218.3 100% 100% FKBP-type
peptidyl-prolyl cis-trans isomerase gi|16766744 (SEQ ID NO: 277)
20767.9 100% 100% pyruvate dehydrogenase E1 component gi|16763542
(SEQ ID NO: 278) 99564 100% 97% phosphate acetyltransferase
gi|16765665 (SEQ ID NO: 279) 77261.1 100% 93% cold shock-like
protein cspE gi|16764006 (SEQ ID NO: 280) 7433.5 0 93%
glucose-6-phosphate isomerase gi|16767471 (SEQ ID NO: 281) 61412.3
100% 93% putative oxidase gi|16764715 (SEQ ID NO: 282) 113118.3 93%
99% 50S ribosomal subunit protein L16 gi|16766722 (SEQ ID NO: 283)
15176.6 100% 100% enterobactin synthetase component F gi|16763965
(SEQ ID NO: 284) 141727.2 78% 99% 50S ribosomal subunit protein L2
gi|16766726 (SEQ ID NO: 285) 29802.1 93% 100% acetyl-coenzyme A
carboxylase subunit alpha gi|16763622 (SEQ ID NO: 286) 35327.3 100%
59% aldose 1-epimerase gi|16764640 (SEQ ID NO: 287) 32541.6 100% 0
pyruvate kinase gi|16765230 (SEQ ID NO: 288) 51369.5 100% 93% outer
membrane protein C gi|16765595** (SEQ ID NO: 289) 41222.1 0 93%
serine hydroxymethyltransferase gi|16765875 (SEQ ID NO: 290) 45437
100% 93% 50S ribosomal subunit protein L28 gi|16767013 (SEQ ID NO:
291) 9032.6 93% 93% isoaspartyl dipeptidase gi|16767756 (SEQ ID NO:
292) 40306.8 100% 93% sensory histidine kinase gi|16765598 (SEQ ID
NO: 293) 106264.3 100% 79% putative inner membrane lipoprotein
gi|16765852 (SEQ ID NO: 294) 179631.1 87% 87% Initiation factor
IF-3 gi|16419853 (SEQ ID NO: 295) 16619.9 100% 100% putative
protease gi|16764427 (SEQ ID NO: 296) 65586.3 99% 97% thiosulfate
reductase electron transport protein PhsB gi|16765394 (SEQ ID NO:
297) 21300.7 93% 100% dihydrolipoamide acetyltransferase
gi|16764107 (SEQ ID NO: 298) 43839.8 100% 100% protein-export
protein SecB gi|16766986 (SEQ ID NO: 299) 17227 100% 100%
cytochrome d terminal oxidase polypeptide subunit I gi|16764110
(SEQ ID NO: 300) 58299.5 100% 100% putative detox protein in
ethanolamine utilization gi|16765785 (SEQ ID NO: 301) 9824.4 100%
100% galactose transport protein gi|16765520 (SEQ ID NO: 302)
35796.1 100% 99% putative translation initiation inhibitor
gi|16767703 (SEQ ID NO: 303) 13557.2 100% 93% dihydrolipoamide
acetyltransferase gi|16763543 (SEQ ID NO: 304) 66121.5 100% 93%
glutamine ABC transporter periplasmic-binding protein gi|16764192
(SEQ ID NO: 305) 27245.6 93% 93% putative selenocysteine synthase
gi|16767692 (SEQ ID NO: 306) 39874.5 47% 93% lysine decarboxylase 2
gi|16763624 (SEQ ID NO: 307) 80747.8 0 93% putative integral
membrane protein gi|16764196 (SEQ ID NO: 308) 59589.3 0 93% 30S
ribosomal protein S20 gi|16763433 (SEQ ID NO: 309) 9637.9 100% 93%
NADH dehydrogenase I chain G gi|16420864 (SEQ ID NO: 310) 100254.5
100% 100% acetyl-CoA carboxylase gi|16766675 (SEQ ID NO: 311)
49245.8 99% 100% phosphopentomutase gi|16767810 (SEQ ID NO: 312)
44227.1 100% 0 RNase E gi|16764541 (SEQ ID NO: 313) 119381.7 100%
100% fructose-1,6-bisphosphatase gi|16767661 (SEQ ID NO: 314)
36781.5 100% 100% phosphoenolpyruvate synthase gi|16764700 (SEQ ID
NO: 315) 87191.6 100% 100% putative formate acetyltransferase
gi|16765966 (SEQ ID NO: 316) 14326.2 100% 93% aminopeptidase B
gi|16765856 (SEQ ID NO: 317) 46339 0 93% lipoprotein gi|16765808
(SEQ ID NO: 318) 36919.8 100% 93% D-ribose-binding protein
gi|1070661 (SEQ ID NO: 319) 28512.8 93% 0 oriT nickase/helicase
gi|16445291 (SEQ ID NO: 320) 191664 100% 0 sensory transduction
histidine kinase gi|16764736 (SEQ ID NO: 321) 65221.8
93% 54% sensory kinase in two-component system with CreB
gi|16767830 (SEQ ID NO: 322) 51666.7 93% 59% agmatinase gi|16766379
(SEQ ID NO: 323) 33585.5 100% 100% aminoacyl-histidine dipeptidase
gi|16763698 (SEQ ID NO: 324) 52419.9 93% 100% DNA polymerase I
gi|16767264 (SEQ ID NO: 325) 103114.9 93% 0 glycerate kinase II
gi|16763905 (SEQ ID NO: 326) 39003.1 0 99% 30S ribosomal subunit
protein S19 gi|16766725 (SEQ ID NO: 327) 10398.5 100% 93% ATPase
subunit gi|7594817 (SEQ ID NO: 328) 46171.1 100% 0
glucose-1-phosphate adenylyltransferase gi|16766822 (SEQ ID NO:
329) 48444.5 100% 83% phosphoglyceromutase gi|16766989 (SEQ ID NO:
330) 56237.5 100% 0 acetate kinase gi|16765664 (SEQ ID NO: 331)
43240.3 100% 92% ABC superfamily peptide transport protein
gi|16765039 (SEQ ID NO: 332) 30654.8 48% 100%
potassium-transporting ATPase subunit B gi|16764075 (SEQ ID NO:
333) 72125 99% 74% adenylosuccinate synthetase gi|16767612 (SEQ ID
NO: 334) 47359.7 100% 100% putative periplasmic protein gi|16765796
(SEQ ID NO: 335) 38706.3 100% 0 ATP synthase delta subunit
gi|16767152 (SEQ ID NO: 336) 19394.2 97% 100% glycerol
dehydrogenase gi|16767374 (SEQ ID NO: 337) 38723.5 100% 96%
inositol-5-monophosphate dehydrogenase gi|16765831 (SEQ ID NO: 338)
51930.1 100% 0 succinate dehydrogenase catalytic subunit
gi|16764105 (SEQ ID NO: 339) 26847.2 100% 93% FkbP-type
peptidyl-prolyl cis-trans isomerase gi|16767643 (SEQ ID NO: 340)
23719.2 100% 93% putative sigma(54) modulation protein gi|16765980
(SEQ ID NO: 341) 12634.6 100% 93% putative ATP-dependent helicase
gi|16765162 (SEQ ID NO: 342) 70268.1 93% 0 ATP synthase epsilon
subunit gi|16767148 (SEQ ID NO: 343) 15046.6 100% 93% putative
cytoplasmic protein gi|16765717 (SEQ ID NO: 344) 10269.4 100% 93%
needle complex major subunit PrgI gi|16766179 (SEQ ID NO: 345)
8839.3 93% 100% cytochrome o ubiquinol oxidase subunit I
gi|16763823 (SEQ ID NO: 346) 74265.7 93% 100% hydrogenase 3 large
subunit gi|16766155 (SEQ ID NO: 347) 65003.1 100% 0
mannose-specific enzyme IIAB gi|16765171 (SEQ ID NO: 348) 34969.2
100% 0 30s ribosomal protein S6 gi|16767637** (SEQ ID NO: 349)
15154.9 100% 0 fumarate reductase, flavoprotein subunit gi|16767592
(SEQ ID NO: 350) 65473.9 93% 100% putative lipoprotein gi|16764058
(SEQ ID NO: 351) 12218.6 72% 96% dipeptide transport protein
gi|16766917 (SEQ ID NO: 352) 60202.5 100% 0 phase 1 flagellin
gi|16765297 (SEQ ID NO: 353) 51594.5 100% 100% transcription
termination factor Rho gi|16767192 (SEQ ID NO: 354) 46977.2 100%
100% arginine deiminase gi|16767712 (SEQ ID NO: 355) 45544.5 99%
100% D-fructose-6-phosphate amidotransferase gi|16767145 (SEQ ID
NO: 356) 66860.7 100% 0 tetrathionate reductase subunit A (TtrA)
gi|16764733 (SEQ ID NO: 357) 110976.9 97% 0 uridine phosphorylase
gi|16422527 (SEQ ID NO: 358) 27205.9 100% 0 ecotin precursor
gi|16765590 (SEQ ID NO: 359) 18199.7 0 100% anaerobic dimethyl
sulfoxide reductase chain B gi|16764326** (SEQ ID NO: 360) 22761.6
100% 0 serine endoprotease gi|16766643 (SEQ ID NO: 361) 47310.1 93%
100% putative fructose-1,6-bisphosphate aldolase gi|16767344 (SEQ
ID NO: 362) 31725.2 93% 100% NADH dehydrogenase I chain F
gi|16765651 (SEQ ID NO: 363) 49229.2 100% 93% small membrane
protein A gi|16766000 (SEQ ID NO: 364) 12327 93% 100% single-strand
DNA-binding protein gi|16767506 (SEQ ID NO: 365) 19055.5 93% 100%
aldehyde oxidoreductase gi|3885918 (SEQ ID NO: 366) 49239.5 93%
100% virulence-associated protein mkfB gi|7443056 (SEQ ID NO: 367)
62570.6 100% 0 3,4-dihydroxy-2-butanone 4-phosphate synthase
gi|16766495 (SEQ ID NO: 368) 23292.3 0 86% PilQ ATP-binding protein
gi|32470257 (SEQ ID NO: 369) 58267.7 98% 86% prolyl-tRNA synthetase
gi|16763631 (SEQ ID NO: 370) 63522.6 100% 0 BipA GTPase gi|16767274
(SEQ ID NO: 371) 67359.4 100% 66% 2-oxoglutarate dehydrogenase
gi|16764106 (SEQ ID NO: 372) 104805.9 0 100% cytosine deaminase
gi|16766629 (SEQ ID NO: 373) 47608 100% 0 ribosome recycling factor
gi|16763609 (SEQ ID NO: 374) 20538 100% 0 dihydrodipicolinate
synthase gi|16765809** (SEQ ID NO: 375) 31276.4 100% 0 putative
dehydrogenase gi|16765715 (SEQ ID NO: 376) 77238.8 99% 0 TrpR
binding protein WrbA gi|16764477 (SEQ ID NO: 377) 20849.7 100% 93%
outer membrane-bound fatty acid transporter gi|16765718 (SEQ ID NO:
378) 47688.5 93% 0 catalase HPII gi|16764669 (SEQ ID NO: 379)
83610.2 93% 100% putative cytoplasmic protein gi|16763672** (SEQ ID
NO: 380) 79560.5 99% 0 D-ribose-binding periplasmic protein
gi|16767168 (SEQ ID NO: 381) 30944.8 0 99%
2-dehydro-3-deoxyphosphooctonate aldolase gi|16765113 (SEQ ID NO:
382) 30777.4 93% 0 flagellar hook-associated protein gi|16765298
(SEQ ID NO: 383) 49818.7 0 87% cysteine desulfurase gi|16765863
(SEQ ID NO: 384) 45075.7 0 83% ethanolamine utilization protein
EutL gi|16765776 (SEQ ID NO: 385) 22678 100% 81% nikB plasmid
protein gi|20521580 (SEQ ID NO: 386) 103992.3 79% 100% periplasmic
maltose-binding protein gi|16767479 (SEQ ID NO: 387) 43468 100% 0
hydrogenase-3 accessory protein gi|16766161** (SEQ ID NO: 388)
31375.2 0 99% chemotactic response protein gi|16765257** (SEQ ID
NO: 389) 23902.4 100% 0 putative acetyltransferase gi|16765805 (SEQ
ID NO: 390) 74000 100% 0 putative imidazolonepropionase or
amidohydrolase gi|16767659 (SEQ ID NO: 391) 42408 0 100%
phosphoglucosamine mutase gi|16766590 (SEQ ID NO: 392) 47424.2 100%
0 ATP-dependent RNA helicase gi|16765963 (SEQ ID NO: 393) 50040.2
100% 0 asparagine synthetase B gi|16764050 (SEQ ID NO: 394) 62555.9
0 100% 50S ribosomal subunit protein L30 gi|16766711** (SEQ ID NO:
395) 6495.8 0 100% glutamine synthetase gi|16767272 (SEQ ID NO:
396) 51768.7 100% 0 outer membrane protein Tsx gi|16763793 (SEQ ID
NO: 397) 32761.5 100% 0 ribonuclease R (RNase R) gi|16767614 (SEQ
ID NO: 398) 92033.1 99% 0 DNA-binding protein HU-beta gi|16763832
(SEQ ID NO: 399) 9222 99% 0 50S ribosomal subunit protein L23
gi|16766727** (SEQ ID NO: 400) 11194.9 0 100% membrane-bound ATP
synthase, epsilon-subunit gi|6625704 (SEQ ID NO: 401) 14848.1 0
100% hydrogenase-2 small chain protein gi|16766450 (SEQ ID NO: 402)
39604.2 0 100% ATP synthase subunit C gi|16767150 (SEQ ID NO: 403)
31538 0 100% putative zinc-binding dehydrogenase gi|16764887 (SEQ
ID NO: 404) 37229 100% 0 transcriptional repressor for rbs operon
(GalR/LacI family) gi|16767170 (SEQ ID NO: 405) 36702.1 100% 0
ubiquinone/menaquinone methyltransferase UbiE gi|16767240 (SEQ ID
NO: 406) 28118.9 100% 0 phosphoheptose isomerase gi|16763693 (SEQ
ID NO: 407) 20878.5 100% 0 ClpB ATP-dependent protease gi|16765976
(SEQ ID NO: 408) 95421.8 99% 0 putative pyrophosphatase gi|16766260
(SEQ ID NO: 409) 30812.9 99% 0 precorrin-8X methylmutase
gi|16765363 (SEQ ID NO: 410) 23016.8 0 99% translation initiation
factor IF-2 gi|16766584 (SEQ ID NO: 411) 97383.5 0 99% putative
GTP-binding protein gi|16766597 (SEQ ID NO: 412) 43086.7 99% 0
ethanolamine ammonia-lyase heavy chain gi|16765778 (SEQ ID NO: 413)
49432 0 99% putative copper-transporting ATPase gi|16763878 (SEQ ID
NO: 414) 87893 0 99% putative 5'-nucleotidase/2',3'-cyclic
phosphodiesterase gi|16767370 (SEQ ID NO: 415) 56560 98% 0
hypothetical ABC transporter ATP-binding protein gi|16763887 (SEQ
ID NO: 416) 24467.3 98% 0 putative glycosyl transferase gi|16765625
(SEQ ID NO: 417) 36500 98% 0 citrate lyase alpha chain gi|56967225
(SEQ ID NO: 418) 54561.7 97% 0 *Peptide samples obtained from
MudPIT were analyzed using Sequest and X!Tandem software, and the
data organized using the Scaffold program. To be considered a
positive identification in Scaffold, the following parmeters were
used: a minumum of 2 peptides from a given protein identified with
peptide and protein thresholds of 80% to give an overall protein
identification (ID) probability of at least 80%. Note that a
protein ID probability of greater than 80% in at least one of the
samples warranted inclusion in the table so as to allow
identification of possible differential expression of a given
protein. **Proteins identified via MuDPIT analysis as
differentially expressed that also displayed differential
expression via microarray analysis.
TABLE-US-00003 TABLE 3 Spaceflight stimulon genes belonging to Hfq
regulon or involved with iron utilization or biofilm formation Fold
Gene* change Function Hfq regulon genes Up-regulated Outer membrane
proteins ompA (SEQ ID NO: 419) 2.05 outer membrane porin ompC (SEQ
ID NO: 420) 2.44 outer membrane porin ompD (SEQ ID NO: 421) 3.34
outer membrane porin Plasmid transfer apparatus traB (SEQ ID NO:
422) 4.71 conjugative transfer, assembly traN (SEQ ID NO: 423) 4.24
conjugative transfer, aggregate formation trbA (SEQ ID NO: 424)
3.14 conjugative transfer traK (SEQ ID NO: 425) 2.91 conjugative
transfer traD (SEQ ID NO: 426) 2.87 conjugative transfer, DNA
transport trbC (SEQ ID NO: 427) 2.68 conjugative transfer traH (SEQ
ID NO: 428) 2.59 conjugative transfer, assembly traX (SEQ ID NO:
429) 2.37 conjugative transfer, fimbrial acetylation traT (SEQ ID
NO: 430) 2.34 conjugative transfer trbB (SEQ ID NO: 431) 2.32
conjugative transfer traG (SEQ ID NO: 432) 2.21 conjugative
transfer, assembly traF (SEQ ID NO: 433) 2.11 conjugative transfer
traR (SEQ ID NO: 434) 1.79 conjugative transfer Various cellular
functions gapA (SEQ ID NO: 435) 7.67 glyceraldehyde-3-phosphate
dehydrogenase A sipC (SEQ ID NO: 436) 6.27 cell invasion protein
adhE (SEQ ID NO: 18) 4.75 iron-dependent alcohol dehydrogenase of
AdhE glpQ (SEQ ID NO: 22) 2.58 glycerophosphodiester
phosphodiesterase, periplasmic fliC (SEQ ID NO: 1) 2.11 flagellin,
filament structural protein sbmA (SEQ ID NO: 437) 1.67 putative ABC
superfamily transporter Down-regulated Small RNAs alpha RBS (SEQ ID
NO: 438) 0.305 small RNA rnaseP (SEQ ID NO: 439) 0.306 small RNA
regulatory csrB (SEQ ID NO: 84) 0.318 small RNA regulatory tke1
(SEQ ID NO: 440) 0.427 small RNA oxyS (SEQ ID NO: 441) 0.432 small
RNA regulatory RFN (SEQ ID NO: 442) 0.458 small RNA rne5 (SEQ ID
NO: 443) 0.499 small RNA Ribosomal proteins rpsL (SEQ ID NO: 105)
0.251 30S ribosomal subunit protein S12 rpsS (SEQ ID NO: 102) 0.289
30S ribosomal subunit protein S19 rplD (SEQ ID NO: 104) 0.393 50S
ribosomal subunit protein L4 rpsF (SEQ ID NO: 107) 0.401 30S
ribosomal subunit protein S6 rplP (SEQ ID NO: 101) 0.422 50S
ribosomal subunit protein L16 rplA (SEQ ID NO: 106) 0.423 50S
ribosomal subunit protein L1 rpme2 (SEQ ID NO: 95) 0.473 50S
ribosomal protein L31 (second copy) rplY (SEQ ID NO: 444) 0.551 50S
ribosomal subunit protein L25 Various cellular functions ynaF (SEQ
ID NO: 81) 0.201 putative universal stress protein ygfE (SEQ ID NO:
445) 0.248 putative cytoplasmic protein dps (SEQ ID NO: 80) 0.273
stress response DNA-binding protein hfq (SEQ ID NO: 446) 0.298 host
factor for phage replication, RNA chaperone osmY (SEQ ID NO: 124)
0.318 hyperosmotically inducible periplasmic protein mysB (SEQ ID
NO: 70) 0.341 suppresses protein export mutants rpoE (SEQ ID NO:
90) 0.403 sigma E (sigma 24) factor of RNA polymerase cspD (SEQ ID
NO: 447) 0.421 similar to CspA but not cold shock induced Nlpb (SEQ
ID NO: 138) 0.435 lipoprotein-34 ygaC (SEQ ID NO: 158) 0.451
putative cytoplasmic protein ygaM (SEQ ID NO: 116) 0.453 putative
inner membrane protein gltI (SEQ ID NO: 130) 0.479 ABC superfamily,
glutamate/aspartate transporter ppiB (SEQ ID NO: 129) 0.482
peptidyl-prolyl cis-trans isomerase B (rotamase B) atpE (SEQ ID NO:
150) 0.482 membrane-bound ATP synthase, F0 sector, subunit c yfiA
(SEQ ID NO: 448) 0.482 ribosome associated factor, stabilizes
against dissociation trxA (SEQ ID NO: 151) 0.493 thioredoxin 1,
redox factor nifU (SEQ ID NO: 139) 0.496 NifU homologs involved in
Fe--S cluster formation rbfA (SEQ ID NO: 449) 0.506
ribosome-binding factor, role in processing of 10S rRNA rseB (SEQ
ID NO: 450) 0.514 anti-sigma E factor yiaG (SEQ ID NO: 451) 0.528
putative transcriptional regulator ompX (SEQ ID NO: 452) 0.547
outer membrane protease, receptor for phage OX2 rnpA (SEQ ID NO:
453) 0.554 RNase P, protein component (protein C5) hns (SEQ ID NO:
454) 0.554 DNA-binding protein; pleiotropic regulator lamB (SEQ ID
NO: 455) 0.566 phage lambda receptor protein; maltose high-affinity
receptor rmf (SEQ ID NO: 456) 0.566 ribosome modulation factor tpx
(SEQ ID NO: 457) 0.566 thiol peroxidase priB (SEQ ID NO: 458) 0.571
primosomal replication protein N Iron utilization/storage genes
adhE (SEQ ID NO: 18) 4.76 iron-dependent alcohol dehydrogenase of
AdhE entE (SEQ ID NO: 14) 2.24 2,3-dihydroxybenzoate-AMP ligase
hydN (SEQ ID NO: 26) 2.03 electron transport protein (FeS senter)
from formate to hydrogen dmsC (SEQ ID NO: 133) 0.497 anaerobic
dimethyl sulfoxide reductase, subunit C nifU (SEQ ID NO: 139) 0.495
NifU homologs involved in Fe--S cluster formation Fnr (SEQ ID NO:
89) 0.494 transcriptional regulator, iron-binding fdnH (SEQ ID NO:
136) 0.458 formate dehydrogenase-N, Fe--S beta subunit,
nitrate-inducible frdC (SEQ ID NO: 152) 0.411 fumarate reductase,
anaerobic, membrane anchor polypeptide Bfr (SEQ ID NO: 147) 0.404
bacterioferrin, an iron storage homoprotein ompW (SEQ ID NO: 112)
0.276 outer membrane protein W; colicin S4 receptor Dps (SEQ ID NO:
80) 0.273 stress response DNA-binding protein and ferritin Genes
implicated in/associated with biofilm formation Wza (SEQ ID NO: 20)
2.30 putative polysaccharide export protein, outer membrane wcaI
(SEQ ID NO: 19) 2.07 putative glycosyl transferase in colanic acid
biosynthesis ompA (SEQ ID NO: 6) 2.06 outer membrane protein wcaD
(SEQ ID NO: 459) 1.82 putative colanic acid polymerase wcaH (SEQ ID
NO: 460) 1.76 GDP-mannose mannosyl hydrolase in colanic acid
biosynthesis manC (SEQ ID NO: 461) 1.71 mannose-1-phosphate
guanylyltransferase wcaG (SEQ ID NO: 462) 1.68 bifunctional GDP
fucose synthetase in colanic acid biosyntheis wcaB (SEQ ID NO: 463)
1.64 putative acyl transferase in colanic acid biosynthesis fimH
(SEQ ID NO: 464) 1.61 fimbrial subunit fliS (SEQ ID NO: 465) 0.339
flagellar biosynthesis flgM (SEQ ID NO: 466) 0.343 flagellar
biosynthesis flhD (SEQ ID NO: 467) 0.356 flagellar biosynthesis
fliE (SEQ ID NO: 468) 0.438 flagellar biosynthesis fliT (SEQ ID NO:
469) 0.444 flagellar biosynthesis cheY (SEQ ID NO: 76) 0.461
chemotaxic response cheZ (SEQ ID NO: 470) 0.535 chemotaxic
response
REFERENCES
[0080] 1. Grigoriev, A. I., Svetaylo, E. N. & Egorov, A. D.
(1998) Environ Med 42, 83-94. [0081] 2. Sonnenfeld, G. &
Shearer, W. T. (2002) Nutrition 18, 899-903. [0082] 3. Taylor, G.
R. (1993) J Leukoc Biol 54, 202-8. [0083] 4. Taylor, G. R.,
Konstantinova, I., Sonnenfeld, G. & Jennings, R. (1997) Adv
Space Biol Med 6, 1-32. [0084] 5. Nickerson, C. A., Ott, C. M.,
Mister, S. J., Morrow, B. J., Burns-Keliher, L. & Pierson, D.
L. (2000) Infect Immun 68, 3147-52. [0085] 6. Nickerson, C. A.,
Ott, C. M., Wilson, J. W., Ramamurthy, R. & Pierson, D. L.
(2004) Microbiol Mol Biol Rev 68, 345-61. [0086] 7. Wilson, J. W.,
Ramamurthy, R., Porwollik, S., McClelland, M., Hammond, T., Allen,
P., Ott, C. M., Pierson, D. L. & Nickerson, C. A. (2002) Proc
Natl Acad Sci USA 99, 13807-12. [0087] 8. Figueroa-Bossi, N.,
Lemire, S., Maloriol, D., Balbontin, R., Casadesus, J. & Bossi,
L. (2006) Mol Microbiol 62, 838-52. [0088] 9. Masse, E. &
Gottesman, S. (2002) Proc Natl Acad Sci USA 99, 4620-5. [0089] 10.
Muffler, A., Traulsen, D. D., Fischer, D., Lange, R. &
Hengge-Aronis, R. (1997) J Bacteriol 179, 297-300. [0090] 11.
Vecerek, B., Moll, I., Afonyushkin, T., Kaberdin, V. & Blasi,
U. (2003) Mol Microbiol 50, 897-909. [0091] 12. Guisbert, E.,
Rhodius, V. A., Ahuja, N., Witkin, E. & Gross, C. A. (2007) J
Bacteriol 189, 1963-73. [0092] 13. Sittka, A., Pfeiffer, V., Tedin,
K. & Vogel, J. (2007) Mol Microbiol 63, 193-217. [0093] 14.
Valentin-Hansen, P., Eriksen, M. & Udesen, C. (2004) Mol
Microbiol 51, 1525-33. [0094] 15. Valentin-Hansen, P., Johansen, J.
& Rasmussen, A. A. (2007) Curr Opin Microbiol 10, 152-5. [0095]
16. Will, W. R. & Frost, L. S. (2006) J Bacteriol 188, 124-31.
[0096] 17. Hammond, T. G. & Hammond, J. M. (2001) Am J Physiol
Renal Physiol 281, F12-25. [0097] 18. Nickerson, C. A. & Ott,
C. M. (2004) ASM News 70, 169-175. [0098] 19. Nickerson, C. A.,
Ott, C. M., Wilson, J. W., Ramamurthy, R., LeBlanc, C. L., Honer zu
Bentrup, K., Hammond, T. & Pierson, D. L. (2003) J Microbiol
Methods 54, 1-11. [0099] 20. Little, B., Wagner, P., Ray, R., Pope,
R. & Scheetz, R. (1991) J Ind Microbiol 8, 213-222. [0100] 21.
Priester, J. H., Horst, A. M., Van de Werfhorst, L. C., Saleta, J.
L., Mertes, L. A. & Holden, P. A. (2007) J Microbiol Methods
68, 577-87. [0101] 22. Wilson, J. W. & Nickerson, C. A. (2006)
BMC Evol Biol 6, 2. [0102] 23. Reed, L. J. & Muench, H. (1938)
Am J Hyg 27, 493-497. [0103] 24. Nickerson, C. A., Goodwin, T. J.,
Terlonge, J., Ott, C. M., Buchanan, K. L., Uicker, W. C., Emami,
K., LeBlanc, C. L., Ramamurthy, R., Clarke, M. S., Vanderburg, C.
R., Hammond, T. & Pierson, D. L. (2001) Infect Immun 69,
7106-20. [0104] 25. Navarre, W. W., Porwollik, S., Wang, Y.,
McClelland, M., Rosen, H., Libby, S. J. & Fang, F. C. (2006)
Science 313, 236-8. [0105] 26. Zhang, A., Wassarman, K. M.,
Rosenow, C., Tjaden, B. C., Storz, G. & Gottesman, S. (2003)
Mol Microbiol 50, 1111-24. [0106] 27. Cooper, B., Eckert, D.,
Andon, N. L., Yates, J. R. & Haynes, P. A. (2003) J Am Soc Mass
Spectrom 14, 736-41. [0107] 28. Qian, W. J., Liu, T., Monroe, M.
E., Strittmatter, E. F., Jacobs, J. M., Kangas, L. J., Petritis,
K., Camp, D. G., 2nd & Smith, R. D. (2005) J Proteome Res 4,
53-62. [0108] 29. Craig, R. & Beavis, R. C. (2004)
Bioinformatics 20, 1466-7. [0109] 30. Eng, J. K., McCormack, A. L.
& Yates, J. R. (1994) J Am Soc Mass Spectrom 5, 976-989.
Example 2
Media Ion Content Inhibits Increased Microbial Virulence During
Spaceflight
[0110] This example describes experiments designed to test the
hypothesis that ion concentrations could be manipulated to prevent
the enhanced Salmonella virulence imparted during flight.
Salmonella cultured in varying media conditions aboard STS-115 and
STS-123 were analyzed. These experiments allowed the identification
of a) media ion composition that prevents spaceflight-induced
increases in Salmonella virulence, and b) commonalities and
differences in Salmonella gene expression between growths of the
same pathogen in different media during spaceflight. As with
spaceflight growth in LB, Salmonella grown in M9 media during
flight displayed differential expression of many genes, including
those associated with either the regulation of, or regulation by
the Hfq protein and small regulatory RNAs. Salmonella grown in
various media demonstrated that ion concentrations had a direct
effect on the virulence of the cultures. Moreover, higher
concentrations of phosphate ions present in M9 medium during
spaceflight analogue culture altered its pathogenic-related
effects, thus providing the first evidence of a mechanism behind
this response.
Material and Methods
[0111] Strains and Media. The virulent, mouse-passaged Salmonella
typhimurium derivative of SL1344 termed F3339 was used in all
experiments.sup.18. Lennox broth (LB) (10 g tryptone, 5 g yeast
extract, 5 g NaCl).sup.19, M9 medium (0.4% glucose).sup.9, or LB-M9
salts medium were used as the growth media in all experiments.
Phosphate buffered saline (PBS) (Invitrogen, Carlsbad, Calif.) was
used to resuspend bacteria for use as inoculum in the flight and
ground hardware. The LB-M9 salts medium consisted of LB medium
supplemented with the following amounts of ions: 8.54 mM NaCl,
25.18 mM NaH.sub.2PO.sub.4, 18.68 mM NH.sub.4Cl, 22 mM
KH.sub.2PO.sub.4, and 2 mM MgSO.sub.4. The RNA fixative RNA Later
II (Ambion, Austin, Tex.), was used to preserve nucleic acid and
protein. Bacterial cell culture, microarray analysis, MudPIT
proteomics, murine infections, and acid stress assays were
performed as described previously.sup.1. qRT-PCR analysis was
performed with primers hybridizing to the indicated genes as
described previously using the 16S rRNA gene to normalize
samples.sup.20. Data from three to nine separate technical
replicate reactions was used for each gene in FIG. 7, and the
differences in expression were found to be statistically
significant using student's t-test (p-value<0.05). The sequences
of the primers used here are as follows. Determination of inorganic
ion levels in LB and M9 media was performed using inductively
coupled plasma (ICP) spectrometry and ion chromatography (IC) as
described previously.sup.21.
TABLE-US-00004 Primers used in this study for qRT-PCR 5Sal16S (SEQ
ID No: 865) gtaacggctcaccaaggcgacgatccctag Sal16S3 (SEQ ID No: 866)
cttcgccaccggtattcctccagatctctac 5STM1724 (for trpD) (SEQ ID No:
867) agcgcctttgtcgcggcggcctgtgga STM17243 (for trpD) (SEQ ID No:
868) gttgatcagcgggccgagtacgttgaacag 5rnpB (SEQ ID No: 869)
gtcgtggacagtcattcatctaggccagca rnpB3 (SEQ ID No: 870)
ctccatagggcagggtgccaggtaacgcct 5csrB (SEQ ID No: 871)
tttcctgtgaccttacggcctgttcatcctg csrB3 (SEQ ID No: 872)
agcaggacacgccaggatggtgttacaagg 5yfiD (SEQ ID No: 873)
tacgagcgataacgtcgcgctgctgttccg yfiD3 (SEQ ID No: 874)
gctgaattccttctggctgctggacagcga
[0112] Bacterial cell culture. Spaceflight and ground cultures were
grown in specialized hardware termed fluid processing apparatus
(FPA) as described previously.sup.1. Briefly, an FPA consists of a
glass barrel that can be divided into compartments via the
insertion of rubber stoppers and a lexan sheath into which the
glass barrel is inserted. Each compartment in the glass barrel was
filled with a solution in an order such that the solutions would be
mixed at specific time points in flight via two actions: (1)
downward plunging action on the rubber stoppers and (2) passage of
the fluid in a given compartment through a bevel on the side of the
glass barrel such that it was released into the compartment below.
Glass barrels and rubber stoppers were coated with a silicone
lubricant (Sigmacote, Sigma, St. Louis, Mo.) and autoclaved
separately before assembly. A stopper with a gas exchange membrane
was inserted just below the bevel in the glass barrel before
autoclaving. FPA assembly was performed aseptically in a laminar
flow hood in the following order: 2.0 ml media (either LB, M9 or
LB-M9) on top of the gas exchange stopper, one rubber stopper, 0.5
ml PBS containing bacterial inoculum (approximately
6.7.times.10.sup.6 bacteria), another rubber stopper, 2.5 ml of
either RNA fixative (for gene expression analysis) or media (either
LB, M9 or LB-M9 for virulence studies), and a final rubber stopper.
Syringe needles (gauge 255/8) were inserted into rubber stoppers
during this process to release air pressure and facilitate
assembly. To facilitate group activation of FPAs and to ensure
proper containment levels, sets of 8 FPAs were loaded into larger
containers termed group activation packs (GAPs). All ground control
cultures were incubated in the Orbital Environmental Simulator
(OES) room at the Kennedy Space Center, which is linked in
real-time to the Shuttle and maintains identical temperature and
humidity conditions. After activation, cultures were grown for 25
hours in either spaceflight or ground until either fixation or
media supplementation. Upon landing, cultures were received for
processing approximately 2.5 hours after Shuttle touchdown.
[0113] Microarray analysis. Total cellular RNA purification from
cultures grown in M9 media, preparation of fluorescently labeled,
single stranded cDNA probes, probe hybridization to whole genome S.
typhimurium microarrays, and image acquisition was performed as
previously described.sup.1,8 using three biological and three
technical replicates for each culture condition. Direct microscopic
cell counting and spectrophotometric readings indicated that cell
numbers in flight and ground biological replicate cultures differed
by less than 2-fold. Data analysis was performed using software as
described previously.sup.1. To obtain the genes comprising the
spaceflight stimulon in M9 media, the following parameters were
used in Webarray software.sup.22: an expression ratio of flight to
ground of 1.8 fold or greater or 0.6 or less; a spot quality
(Avalue) of greater than 9.5, and p-value of less than 0.05. To
identify spaceflight stimulon genes also contained in the Hfq
regulon, proteins or genes found to be regulated by Hfq or RNAs
found to be bound by Hfq as reported in the indicated references
were scanned against the spaceflight microarray data for expression
changes within the parameters above.sup.11-14.
[0114] Multidimensional protein identification (MudPIT) analysis
via tandem mass spectrometry coupled to dual nano-liquid
chromatography (LC-LC-MS/MS). Acetone-protein precipitates from
whole cell lysates obtained from flight and ground cultures grown
in M9 media (representing three biological replicates) were
subjected to MudPIT analysis using the LC-LC-MS/MS technique (three
technical replicates) as described previously.sup.1,23,24. Tandem
MS spectra of peptides were analyzed with TurboSEQUEST.TM. v 3.1
and XTandem software, and the data were further analyzed and
organized using the Scaffold program.sup.1,23,24. Table 6 describes
the specific parameters used in Scaffold to identify the proteins
in this study.
[0115] Murine infection assay. Six to eight week old female Balb/c
mice (housed in the Animal Facility at the Space Life Sciences Lab
at Kennedy Space Center) were deprived of food and water for
approximately 6 hours and then per-orally infected with increasing
dosages of S. typhimurium harvested from either flight or ground
FPA cultures and resuspended in buffered saline gelatin.sup.1.
Infectious dosages increasing ten-fold in a range between
approximately 1.times.10.sup.4 and 1.times.10.sup.9 bacteria (thus
comprising six infectious dosages per bacterial culture) were used
in the infections. Ten mice per infectious dosage were used, 20
.mu.l per dose, and food and water were returned to the animals
within 30 minutes post-infection. The infected mice were monitored
every 6-12 hours for 30 days. The LD.sub.50 value was calculated
using the formula of Reed and Muench.sup.25.
[0116] Ground based RWV cultures and acid stress assays. S.
typhimurium cultures were grown in rotating wall vessels (RWVs) for
24 hours at 37 degrees C. in the LSMMG and 1.times.g orientations
in LB, M9, or LB media supplemented with the indicated ions from M9
salts (LB-M9 salts media) and assayed for resistance to pH 3.5 as
described previously.sup.1,15. The percentage of surviving bacteria
present after 45-60 minutes acid stress (compared to the original
number of bacteria before addition of the stress) was calculated
via serial dilution and CFU plating. A ratio of the percent
survival values for the LSMMG and 1.times.g cultures in all three
growth media was obtained (indicating the fold difference in
survival between these cultures) and is presented as the acid
survival ratio in FIG. 8. The mean and standard deviation from
between two and five independent experimental trials per culture is
presented with observed differences in survival ratios being
statistically-significant at p-value<0.05.
Results
[0117] Media and virulence in spaceflight.+-.LB. Previous flight
experiments aboard STS-115 indicated that S. typhimurium cultured
during spaceflight exhibited increased virulence in a murine model
of infection.sup.1. Briefly, bacteria cultured in LB during
spaceflight and identical ground control cultures were harvested
and immediately used to inoculate female Balb/c mice via a per-oral
route of infection on the same day as Shuttle landing. Mice were
infected at increasing dosages of either flight or ground cultures
(10 mice per dose), and the health of the mice was monitored every
6-12 hours for 30 days. Previous results showed that mice infected
with S. typhimurium grown in LB media in spaceflight aboard STS-115
displayed a decreased time to death and a 2.7 fold decrease in LD50
value compared with those infected with ground control
cultures.sup.1. To confirm these findings, the identical flight
experiment was performed again aboard STS-123. In agreement with
the previous experiment, mice infected with S. typhimurium grown in
spaceflight aboard STS-123 displayed a decreased time to death and
a 6.9 fold decrease in LD50 value compared with those infected with
ground control cultures (FIG. 6, panels 6A, 6B, and 6C, LB
medium).
[0118] Media and virulence in spaceflight.+-.M9. Because of the
strong association between nutrient composition of the growth media
and the extent of changes observed in S. typhimurium responses in
ground-based studies in the RWV, we evaluated S. typhimurium
virulence using cultures grown in M9 minimal media in separate
experiments aboard Space Shuttle missions STS-115 and STS-123. The
procedures were otherwise identical to those described for LB media
growth. However, M9 cultures from both missions displayed
dramatically different virulence characteristics from those
observed with LB cultured bacteria (FIGS. 6A-6C). Specifically, for
infection of mice with spaceflight and ground Salmonella cultures
grown in M9 media, the time to death curves overlapped and did not
display the decreased time to death as seen in the LB spaceflight
infections in both STS-115 and STS-123. Likewise, in contrast to
observations with the LB media cultures, M9 grown cultures of S.
typhimurium grown in spaceflight displayed no consistent difference
in LD50 from ground controls.
[0119] To further elucidate the effect of media composition on the
virulence characteristics of S. typhimurium grown during
spaceflight, an additional growth medium was used that consisted of
LB media supplemented with specific salts used in the preparation
of M9 media. These specific salts were chosen because our
quantitative trace elemental analysis showed them to be at
significantly different levels in the two media. Specifically, the
elemental analysis indicated that the M9 medium had dramatically
higher concentrations of phosphate (61-fold higher than the LB
media) and magnesium (18-fold higher than the LB media). Other
notable differences in the M9 medium included higher levels of
sulfate (3.6-fold higher than the LB media), chloride (3-fold
higher than the LB media), and potassium (2.4-fold higher than the
LB media). Thus, as follow-up flight experiment aboard STS-123, S.
typhimurium virulence was evaluated using cultures grown in LB
media supplemented with 25.18 mM NaH.sub.2PO.sub.4, 22 mM
KH.sub.2PO.sub.4, 18.68 mM NH.sub.4Cl, 8.54 mM NaCl, and 2 mM
MgSO.sub.4 (designated as LB-M9 salts media), thereby bringing the
levels of these salts in LB media to the same as those in M9 media.
Interestingly, Salmonella cultured in LB-M9 salts media displayed
virulence characteristics similar to those observed when only the
M9 media was used (FIGS. 6A and 6C). Specifically, as seen with
cultures grown in only M9 media, mice infected with spaceflight and
ground cultures grown in LB-M9 salts media did not display the
decreased time to death with spaceflight grown cultures as seen in
the LB infections. Also in contrast to the LB media cultures,
cultures of S. typhimurium grown in LB-M9 salts media during
spaceflight did not display a decreased LD50 value compared to
ground controls using the same media (similar to the results with
M9 media). Since nutrient composition could influence the virulence
of S. typhimurium.sup.10, the LD50 values were compared for all
media from flight and all media from ground controls from the
STS-123 flight to highlight the effect of spaceflight on virulence
(Table 4). A comparison of LD50 values from ground controls
suggests that indeed media plays a role in LD50 levels, with a 5.7
fold difference between LB media and M9 media (with LB showing
lower LD50 values). However, a comparison of LD50 values of
cultures grown during spaceflight shows a dramatic difference
approximately 10 times greater than those observed in ground
cultures, as shown with a 56.8 fold difference between LB media and
M9 media. This difference suggests that while media composition
does affect LD50 values, the difference is exacerbated by the
spaceflight environment. This indicates that there was something
unique about the spaceflight environment that led to increased
virulence in Salmonella.
[0120] Transcriptional and proteomic analysis. To determine which
Salmonella genes changed expression in response to spaceflight
culture in M9 minimal media, total bacterial RNA was isolated from
fixed flight and ground samples, qualitatively analyzed to ensure
lack of degradation, quantified, and then reversed transcribed into
labeled, single-stranded cDNA. The labeled cDNA was co-hybridized
with differentially-labeled S. typhimurium genomic DNA to whole
genome S. typhimurium microarray slides. Statistically-significant
differences in gene expression between the flight and ground M9
samples (above 1.8-fold increase and below 0.6-fold decrease in
expression) were obtained (see Materials and Methods for details).
38 genes were found differentially-expressed in flight M9 cultures
as compared to identical ground controls under these conditions
(Table 5). Most notably, several genes involved in motility (9
genes: flgA, flgC, flgF, flgG, cheY, fliC, fliT, fliM, fljB), the
formation of the Hyc hydrogenase (4 genes: hydN, hycF, hycD, hyB),
and the Suf membrane transporter (3 genes: sufA, sufC, yhnA/sufE)
were identified as differentially expressed. In addition, several
genes encoding small regulatory RNA molecules (THI, csrB, rnpB,
tke1) were also identified. The proteomes of fixed cultures from M9
flight and ground samples were also obtained via multi-dimensional
protein identification (MudPIT) analysis. 173 proteins were
identified as expressed in the flight and ground cultures, with 81
being present at statistically different levels in these samples
(Table 6) indicating differential expression or stability. Notably,
several proteins involved iron utilization and uptake (Fur,
cytoplasmic ferritin, F--S cluster formation, bactoferrin,
siderophore receptor TonB, iron transport protein, iron-dependent
alcohol dehydrogenase, and ferric enterobactin receptor) and
ribosome structure (L7, L32, S20, S13, S11 S19, L14, L33, S4, L4)
were identified as differentially expressed. Collectively, these
transcriptional and proteomic gene expression changes form the
first documented bacterial spaceflight stimulon in minimal growth
media.
[0121] The LB and M9 spaceflight stimulons. The S. typhimurium gene
expression data from the analysis above in M9 medium were compared
with the results from our previous gene expression analysis in LB
medium for spaceflight and RWV cultures. Genes from each data set
were cross-compared to each other to identify common genes that
were present as differentially-expressed in both media. After this
analysis, 15 genes (including adjacent genes) of the 38 identified
as transcriptionally altered in response to spaceflight in M9
medium were also identified as differentially expressed in either
spaceflight or ground-based microgravity analogue RWV culture in LB
medium. This represents 39% ( 15/38) of the total genes found in
the M9 transcriptional analysis.
[0122] This analysis was subsequently extended to include genes
that also belong to the same directly-related functional or
regulatory gene group (i.e. not necessarily the same gene or
operon, but genes that function or are regulated as part of the
same mechanism such as motility), and discovered that the
percentage of common genes between analysis in M9 and LB media was
73% ( 28/38) (Table 5). The functional groups of genes that we
identified as regulated by spaceflight or ground-based spaceflight
analogue culture in both M9 and LB media included those involved in
flagellar-based motility, Hyc hydrogenase formation, Suf
transporter formation and other ABC transporters, and small
regulatory RNA molecules (genes indicated in the section above).
Additionally, there are also 8 "stand alone" genes that are
believed to be not co-regulated with these gene groups and include
four genes encoding putative, uncharacterized proteins (yaiA, trpD,
yfiA, yhcB, grxB, acpP, yfiD, STM4002). Several genes encoding
proteins identified in the spaceflight and ground proteomic
analysis of M9 cultures were also identified in the gene expression
analysis of M9 and LB cultures as well (Table 6).
[0123] Results from our previous studies indicated that 32% of the
S. typhimurium genes identified as differentially regulated in
spaceflight in LB medium belonged to a regulon of genes controlled
by the conserved RNA-binding protein Hfq.sup.1. A requirement of
hfq for alterations in Salmonella acid resistance and macrophage
survival was demonstrated in response to a ground-based
microgravity analogue model.sup.1. Therefore, the results of our
spaceflight M9 microarray and proteomic analysis were scanned for
members of a regulon of genes whose expression and activity is
regulated by or regulates Hfq, or whose protein products form a
functional regulatory complex with Hfq.sup.11-14. Consistent with
the previous observations in LB, four small non-coding regulatory
RNA genes (THI, csrB, rnpB, tke1) and three mRNA transcripts (rpoS,
sufE, fliC) regulated by Hfq were observed in the microarray
analysis in M9 media (7 of 38 or 18%).
[0124] When the hits from the proteomic analysis were scanned for
relationships to the Hfq regulon, 28 of the 81 proteins (34%) found
to be differentially expressed in response to spaceflight in M9
media belonged to the Hfq regulon, or are part of a directly
related functional group of proteins that are regulated by Hfq.
Several observations led to the Hfq regulon members being
highlighted in our M9 proteomic analysis: 1) Hfq promotes the
expression of a large class of ribosomal structural proteins, and
we found differential expression of several of these genes in
spaceflight (L7/L12, L32, S20, S13, S11, S19, SA, L14, L33, S4,
L4); 2) Hfq regulates the expression of the Fur protein and other
genes involved in iron metabolism, and we found that Fur and other
iron-related genes are differentially regulated by spaceflight in
M9 medium (Fur, Dps, NifU, FepA); 3) Several other proteins encoded
by genes belonging to the Hfq regulon were also found in this
analysis: NmpC, Tpx, PtsI, PtsH, SucC, LeuB, CysP, DppA, OppA,
RpoZ, CsrA, RpoB, NlpB. This data, taken together with the
microarray data, indicates the commonalities of the spaceflight
response in Salmonella in both LB and M9 media, and represents the
first common genes that have been identified to be regulated by
spaceflight and/or ground based spaceflight analogue culture in
both rich and minimal media.
[0125] Real time PCR analysis. To further confirm the commonalities
observed in global gene expression analysis in response to
spaceflight in both LB and M9 media, targeted quantitative real
time PCR assays were performed using cDNA synthesized from total
RNA harvested from spaceflight and ground cultures in LB and M9
media as templates (FIG. 7). The csrB, yfiD, rnpB genes
(down-regulated), and the trpD gene (up-regulated) were found to be
differentially-regulated in response to spaceflight as compared to
ground cultures in both LB and M9 media using global
transcriptional analysis. These results were also found using real
time PCR (FIG. 7).
[0126] Role of phosphate ion. Salmonella was previously
demonstrated to consistently and reproducibly alter its acid
tolerance response when grown in the RWV using LB medium.sup.15. To
support findings from spaceflight that the supplementation of LB
media with selected M9 salts disrupts S. typhimurium responses to
this environment, cultures containing LB media, M9 media, and LB-M9
salts media were grown in the RWV at low shear modeled microgravity
(LSMMG) and control orientations and evaluated for changes in acid
tolerance. As demonstrated previously, cultures of S. typhimurium
grown in LB media in the RWV (LSMMG) displayed altered acid
resistance as compared to control cultures. However, no difference
in acid tolerance was observed with cultures grown in M9 media or
in LB-M9 salts media (FIG. 8). LB media supplemented with different
combinations of M9 salts were then used to determine which of these
ions was responsible for disruption of the acid tolerance response
observed in LB medium (FIG. 8). The results indicate that the
presence of phosphate from two different sources (NaH.sub.2PO.sub.4
and KH.sub.2PO.sub.4) is sufficient to disrupt the altered acid
tolerance in response to LSMMG. Although hydrogen ions are present
in each of these compounds, we found no correlation between the pH
of the different media before or after culture and the observed
phenotypes. Likewise, this indicates that the buffering capacity of
phosphate is not responsible for this phenotype and that the
presence of the phosphate ion itself is responsible for the acid
tolerance alteration. In addition, increased osmolarity of the
media is not the cause of this phenotype, since raising the level
of NaCl to 25 mM (the same level as Na.sub.2HPO.sub.4 and
KH.sub.2PO.sub.4) did not show the same phenotype as the presence
of the phosphate-containing compounds (FIG. 8).
Conclusion
[0127] It was found that the increased S. typhimurium virulence
observed with cultures grown in spaceflight in LB medium as
compared to identical ground controls is not exhibited with
cultures grown in M9 medium. Based upon the quantified differences
in ion concentrations between LB and M9 media, LB medium was
supplemented with inorganic ions to the same levels as those found
in M9 medium. This supplementation was sufficient to prevent the
enhanced Salmonella virulence imparted during flight. Subsequent
testing in ground-based spaceflight analogue culture conditions
indicted that the altered acid tolerance exhibited by Salmonella
during culture in LB alone was prevented with the addition of
inorganic phosphate. These results demonstrate a direct correlation
between phosphate ion concentration and the phenotypic response of
Salmonella to the environment of spaceflight analogue culture. The
spaceflight-induced molecular genetic responses of S. typhimurium
cultured in different growth media (LB versus M9) were also
compared using whole genome transcriptional and proteomic analyses.
Despite the multiple phenotypic differences in response to
spaceflight between the two media, several common genes and gene
families were altered in expression in both media during
spaceflight culture. Identification of these genes whose expression
is commonly regulated by the low fluid shear environment of
spaceflight provides key targets whose expression can be
manipulated to control microbial responses, including use for
development of vaccines and therapeutics. As identified in this
study, these targets include gene systems involved in
flagellar-based motility, Hyc hydrogenase formation, Suf
transporter formation and other ABC transporters, ribosomal
structure, iron utilization, and small regulatory RNA molecule
expression and function. Many of the genes that were found
differentially expressed during spaceflight culture of S.
typhimurium in M9 media were also consistent with those reported in
LB culture for this same organism under identical conditions. In
both cases, many of these genes are found in regulons that are
controlled by or regulate the activity of the Hfq protein. The
findings further highlight Hfq as a global regulator to target for
further study to understand the mechanism used by Salmonella to
respond to spaceflight, spaceflight analogue systems, and other
physiological low fluid shear environments.
TABLE-US-00005 TABLE 4 LD50 comparison of S. typhimurium cultured
in M9 media or LB-M9 salts media relative to cultures grown only in
LB media. Media Growth Location LD50 (CFU) Media - Flight Fold
Increase Relative to LB LB media Flight 5.81 .times. 10.sup.4 1.0
LB-M9 salts Flight 7.45 .times. 10.sup.5 12.8 media M9 media Flight
3.30 .times. 10.sup.6 56.8 Fold Increase Relative to LB Media -
Ground LB media Ground 4.02 .times. 10.sup.5 1.0 LB-M9 salts Ground
5.73 .times. 10.sup.5 1.4 media M9 media Ground 2.30 .times.
10.sup.6 5.7
TABLE-US-00006 TABLE 5 Salmonella typhimurium genes altered in
expression during growth in M9 minimal media in spaceflight Fold
Identified in Gene STM gene change LB analysis* name Gene function
Up-regulated STM_sRNA_THI (SEQ ID NO: 2.69 x THI** small RNA 471)
STM0007 (SEQ ID NO: 472) 1.91 talB transaldolase B STM0389 (SEQ ID
NO: 473) 1.85 x yaiA putative cytoplasmic protein STM1161.S (SEQ ID
NO: 474) 2.64 yceP putative cytoplasmic protein STM1369 (SEQ ID NO:
475) 2.81 x sufA putative HesB-like domain STM1371 (SEQ ID NO: 476)
2.65 x sufC putative ABC superfamily (atp_bind) transport protein
STM1374 (SEQ ID NO: 477) 1.84 x ynhA putative SufE protein probably
involved in Fe--S center assembly STM1724 (SEQ ID NO: 478) 1.96 x
trpD anthranilate synthase, component II, bifunctional STM2665 (SEQ
ID NO: 448) 2.53 x yfiA ribosome associated factor, stabilizes
ribosomes against dissociation STM2924 (SEQ ID NO: 479) 2.55 rpoS
sigma S (sigma 38) factor of RNA polymerase STM3347 (SEQ ID NO:
122) 1.83 x yhcB putative periplasmic protein STM3559 (SEQ ID NO:
480) 2.05 yhhV putative cytoplasmic protein STM3809.S (SEQ ID NO:
481) 1.83 ibpA small heat shock protein STM4161 (SEQ ID NO: 482)
2.00 putative involved in thiamine biosynthesis Down-regulated
STM_PSLT014 (SEQ ID NO: 0.52 orf6 putative outer membrane protein
483) STM_sRNA_CsrB (SEQ ID 0.51 x csrB regulatory RNA NO: 84)
STM_sRNA_RNaseP (SEQ ID 0.44 x rnpB regulatory RNA NO: 484)
STM_sRNA_tke1 (SEQ ID NO: 0.58 x tke1 small RNA 440) STM1078 (SEQ
ID NO: 485) 0.43 putative cytoplasmic protein STM1165 (SEQ ID NO:
486) 0.57 x grxB glutaredoxin 2 STM1173 (SEQ ID NO: 487) 0.57 x
flgA flagellar biosynthesis; assembly of basal-body periplasmic P
ring STM1175 (SEQ ID NO: 488) 0.37 x flgC flagellar biosynthesis,
cell-proximal portion of basal- body rod STM1178 (SEQ ID NO: 489)
0.52 x flgF flagellar biosynthesis, cell-proximal portion of basal-
body rod STM1179 (SEQ ID NO: 490) 0.47 x flgG flagellar
biosynthesis, cell-distal portion of basal-body rod STM1196 (SEQ ID
NO: 134) 0.59 x acpP acyl carrier protein STM1466 (SEQ ID NO: 491)
0.59 ydgA putative periplasmic protein STM1916 (SEQ ID NO: 76) 0.55
x cheY chemotaxis regulator, transmits chemoreceptor signals to
flagelllar motor STM1959 (SEQ ID NO: 1) 0.44 x fliC flagellar
biosynthesis; flagellin, filament structural protein STM1962 (SEQ
ID NO: 78) 0.54 x fliT flagellar biosynthesis; possible export
chaperone for FliD STM1976 (SEQ ID NO: 492) 0.59 x fliM flagellar
biosynthesis, component of motor switch and energizing STM2646 (SEQ
ID NO: 141) 0.44 x yfiD putative formate acetyltransferase STM2771
(SEQ ID NO: 493) 0.31 x fljB Flagellar synthesis: phase 2 flagellin
(filament structural protein) STM2843 (SEQ ID NO: 26) 0.49 x hydN
electron transport protein (FeS senter) from formate to hydrogen
STM2848 (SEQ ID NO: 494) 0.59 x hycF hydrogenase 3, putative
quinone oxidoreductase STM2850 (SEQ ID NO: 495) 0.59 x hycD
hydrogenase 3, membrane subunit (part of FHL complex) STM2852 (SEQ
ID NO: 496) 0.52 x hycB hydrogenase-3, iron-sulfur subunit (part of
FHL complex) STM4002 (SEQ ID NO: 162) 0.53 x putative cytoplasmic
protein STM4063 (SEQ ID NO: 497) 0.55 sbp ABC superfamily
(bind_prot), sulfate transport protein *Genes, operons, or
directly-related functional groups identified as also being
differnetially-regulated during growth in spaceflight or
ground-based modeled microgravity in LB medium **STM genome
coordinates: 4382782-4382542
TABLE-US-00007 TABLE 6 Salmonella typhimurium proteins identified
via MudPit analysis as present during growth in M9 minimal media in
spaceflight (173 proteins total) Protein Flight Ground molecular
total cell total cell Accession weight protein ID protein ID
Protein name number (Daltons) probability* probability*
sn-glycerol-3-phosphate dehydrogenase gi|16766813 (SEQ ID NO: 187)
57 kDa 100% (100%) 99% (99%) branched-chain-amino-acid transaminase
gi|96710 (SEQ ID NO: 498) 34 kDa 99% (99%) 100% (100%) putative
periplasmic protein gi|16764930 (SEQ ID NO: 499) 39 kDa 100% (100%)
100% (100%) 6,7-dimethyl-8-ribityllumazine synthase gi|16501685
(SEQ ID NO: 500) 16 kDa 100% (100%) 100% (100%) thioredoxin
reductase gi|16502122 (SEQ ID NO: 501) 35 kDa 100% (100%) 100%
(100%) 50S ribosomal subunit protein L2 gi|16505152 (SEQ ID NO:
502) 30 kDa 100% (100%) 100% (100%) 30S ribosomal protein S10
gi|68057571 (SEQ ID NO: 503) 12 kDa 100% (100%) 100% (100%) 50S
ribosomal protein L24 gi|15803836 (SEQ ID NO: 504) 11 kDa 100%
(100%) 100% (100%) serine hydroxymethyltransferase gi|16503768 (SEQ
ID NO: 505) 45 kDa 100% (100%) 100% (100%) 30s ribosomal protein S6
gi|16505516 (SEQ ID NO: 506) 15 kDa 100% (100%) 100% (100%) 30S
ribosomal protein S22 gi|16502603 (SEQ ID NO: 507) 5 kDa 100%
(100%) 100% (100%) 2,3,4,5-tetrahydropyridine-2-carboxylate N-
gi|16763603 (SEQ ID NO: 508) 30 kDa 100% (100%) 100% (100%)
succinyltransferase peptidyl-prolyl cis-trans isomerase B
gi|16501803 (SEQ ID NO: 509) 18 kDa 100% (100%) 100% (100%)
FKBP-type peptidyl-prolyl cis-trans isomerase gi|16766744 (SEQ ID
NO: 277) 21 kDa 100% (100%) 100% (100%) ribosome recycling factor
gi|16501500 (SEQ ID NO: 510) 21 kDa 100% (100%) 100% (100%)
carbamoyl-phosphate synthase large subunit gi|16763457 (SEQ ID NO:
511) 118 kDa 100% (100%) 100% (100%) ATP synthase delta subunit
gi|16504763 (SEQ ID NO: 512) 19 kDa 100% (100%) 100% (100%)
FKBP-type peptidyl-prolyl cis-trans isomerase gi|16766742 (SEQ ID
NO: 513) 29 kDa 99% (99%) 100% (100%) putative cytoplasmic protein
gi|56383221 (SEQ ID NO: 514) 12 kDa 99% (99%) 100% (100%)
D-3-phosphoglycerate dehydrogenase gi|16766363 (SEQ ID NO: 515) 44
kDa 100% (100%) 100% (100%) 50S ribosomal subunit protein L3
gi|16505149 (SEQ ID NO: 516) 22 kDa 100% (100%) 100% (100%) ATP
synthase alpha subunit gi|16504764 (SEQ ID NO: 517) 55 kDa 100%
(100%) 100% (100%) serine endoprotease gi|16766643 (SEQ ID NO: 361)
47 kDa 100% (100%) 100% (100%) putative ABC-type transport system
ATPase gi|16763890 (SEQ ID NO: 518) 30 kDa 99% (99%) 100% (100%)
ATP synthase subunit B gi|16504762 (SEQ ID NO: 519) 17 kDa 99%
(99%) 100% (100%) malate dehydrogenase gi|16766654 (SEQ ID NO: 238)
32 kDa 99% (99%) 100% (100%) RNase E gi|16764541 (SEQ ID NO: 313)
119 kDa 100% (100%) 100% (100%) osmotically inducible protein C
gi|16502605 (SEQ ID NO: 520) 15 kDa 99% (99%) 100% (100%)
polynucleotide phosphorylase gi|16766580 (SEQ ID NO: 236) 77 kDa
100% (100%) 100% (100%) glutamate dehydrogenase gi|16764650 (SEQ ID
NO: 521) 49 kDa 100% (100%) 100% (100%) menaquinone biosynthesis
protein gi|16504650 (SEQ ID NO: 522) 17 kDa 99% (99%) 100% (100%)
50S ribosomal subunit protein L18 gi|16505166 (SEQ ID NO: 523) 13
kDa 99% (99%) 100% (100%) phospho-2-dehydro-3-deoxyheptonate
aldolase gi|16503824 (SEQ ID NO: 524) 39 kDa 99% (99%) 100% (100%)
transketolase gi|16766377 (SEQ ID NO: 199) 72 kDa 99% (99%) 100%
(100%) acetylglutamate kinase gi|16767387 (SEQ ID NO: 525) 27 kDa
99% (99%) 100% (100%) 50S ribosomal protein L11 gi|15804573 (SEQ ID
NO: 526) 15 kDa 99% (99%) 100% (100%) cold shock protein CspC
gi|15802236 (SEQ ID NO: 527) 7 kDa 100% (100%) 100% (100%) unnamed
protein product gi|47736 (SEQ ID NO: 528) 16 kDa 100% (100%) 100%
(100%) dihydrolipoamide dehydrogenase gi|16763544 (SEQ ID NO: 186)
51 kDa 100% (100%) 100% (100%) 50S ribosomal subunit protein L29
gi|16505157 (SEQ ID NO: 260) 7 kDa 100% (100%) 100% (100%)
arginine-binding periplasmic protein 1 precursor gi|16502093 (SEQ
ID NO: 529) 27 kDa 100% (100%) 100% (100%) 50S ribosomal subunit
protein L10 gi|47916 (SEQ ID NO: 530) 18 kDa 100% (100%) 100%
(100%) hyperosmotically-inducible periplasmic protein gi|16505665
(SEQ ID NO: 531) 21 kDa 100% (100%) 100% (100%) bacterioferritin
comigratory protein gi|16503708 (SEQ ID NO: 532) 18 kDa 100% (100%)
100% (100%) glutamate/aspartate transporter gi|16764042 (SEQ ID NO:
533) 34 kDa 100% (100%) 100% (100%) 50S ribosomal subunit protein
L17 gi|16505176 (SEQ ID NO: 534) 14 kDa 100% (100%) 100% (100%) 50S
ribosomal subunit protein L6 gi|16505165 (SEQ ID NO: 535) 19 kDa
100% (100%) 100% (100%) fructose 1,6-bisphosphate aldolase
gi|16504152 (SEQ ID NO: 536) 39 kDa 100% (100%) 100% (100%) 30S
ribosomal protein S3 gi|16131193 (SEQ ID NO: 537) 26 kDa 100%
(100%) 100% (100%)
5-methyltetrahydropteroyltriglutamate--homocysteine gi|16767235
(SEQ ID NO: 538) 85 kDa 100% (100%) 100% (100%) methyltransferase
phosphate acetyltransferase gi|16765665 (SEQ ID NO: 279) 77 kDa 99%
(99%) 100% (100%) inorganic pyrophosphatase gi|16505542 (SEQ ID NO:
539) 20 kDa 100% (100%) 100% (100%) phase 1 flagellin gi|50830926
(SEQ ID NO: 540) 52 kDa 99% (99%) 100% (100%) histone like
DNA-binding protein HU-alpha gi|16504591 (SEQ ID NO: 541) 10 kDa
100% (100%) 100% (100%) (NS2) (HU-2) Iron transport protein,
periplasmic-binding protein gi|16503939 (SEQ ID NO: 542) 34 kDa
100% (100%) 100% (100%) conserved hypothetical protein gi|16503804
(SEQ ID NO: 543) 14 kDa 100% (100%) 100% (100%) ribosomal protein
S7 gi|47922 (SEQ ID NO: 544) 18 kDa 100% (100%) 100% (100%) ATP
synthase beta subunit gi|16504766 (SEQ ID NO: 545) 50 kDa 100%
(100%) 100% (100%) 30S ribosomal protein S2 gi|16501497 (SEQ ID NO:
546) 27 kDa 100% (100%) 100% (100%) glucose-specific PTS system
enzyme IIA component gi|47658 (SEQ ID NO: 547) 18 kDa 100% (100%)
100% (100%) probable peroxidase gi|16501671 (SEQ ID NO: 548) 22 kDa
100% (100%) 100% (100%) 50S ribosomal subunit protein L5
gi|16505162 (SEQ ID NO: 549) 20 kDa 100% (100%) 100% (100%)
argininosuccinate lyase gi|16767388 (SEQ ID NO: 550) 50 kDa 100%
(100%) 100% (100%) RNA polymerase, alpha subunit gi|24053769 (SEQ
ID NO: 551) 37 kDa 100% (100%) 100% (100%) glycine/betaine/proline
transport protein gi|16766122 (SEQ ID NO: 552) 36 kDa 100% (100%)
100% (100%) elongation factor Ts gi|16501498 (SEQ ID NO: 553) 30
kDa 100% (100%) 100% (100%) inositol-5-monophosphate dehydrogenase
gi|16765831 (SEQ ID NO: 338) 52 kDa 100% (100%) 100% (100%)
putative outer membrane lipoprotein gi|16763634 (SEQ ID NO: 554) 29
kDa 100% (100%) 100% (100%) DNA-directed RNA polymerase,
beta-subunit gi|16504603 (SEQ ID NO: 555) 155 kDa 100% (100%) 100%
(100%) GroEL protein gi|16505460 (SEQ ID NO: 556) 57 kDa 100%
(100%) 100% (100%) enolase gi|16504025 (SEQ ID NO: 557) 46 kDa 100%
(100%) 100% (100%) glyceraldehyde 3-phosphate dehydrogenase A
gi|16502901 (SEQ ID NO: 558) 36 kDa 100% (100%) 100% (100%)
translation elongation factor EF-Tu.A gi|96718 (SEQ ID NO: 169) 43
kDa 100% (100%) 100% (100%) iron-dependent alcohol dehydrogenase
gi|16765093 (SEQ ID NO: 193) 96 kDa 100% (100%) 100% (100%)
phosphoglycerate kinase gi|16504153 (SEQ ID NO: 559) 41 kDa 100%
(100%) 100% (100%) putative hydrogenase membrane component
precurosr gi|16764429 (SEQ ID NO: 171) 38 kDa 100% (100%) 100%
(100%) formate acetyltransferase 1 gi|16502136 (SEQ ID NO: 560) 85
kDa 100% (100%) 100% (100%) 30S ribosomal protein S1 gi|16502144
(SEQ ID NO: 561) 61 kDa 100% (100%) 100% (100%) elongation factor G
gi|47923 (SEQ ID NO: 562) 78 kDa 100% (100%) 100% (100%) 30S
ribosomal subunit protein S5 gi|24053777 (SEQ ID NO: 563) 18 kDa
100% (100%) 100% (100%) O-Acetylserine Sulfhydrylase gi|11514514
(SEQ ID NO: 270) 34 kDa 100% (100%) 100% (100%) trigger factor
gi|16501718 (SEQ ID NO: 564) 48 kDa 100% (100%) 100% (100%)
Glutamine Synthetase gi|9256972 (SEQ ID NO: 565) 52 kDa 100% (100%)
100% (100%) molecular chaperone DnaK gi|16763402 (SEQ ID NO: 179)
69 kDa 100% (100%) 100% (100%) arginine-binding periplasmic protein
2 precursor gi|16502090 (SEQ ID NO: 566) 27 kDa 100% (100%) 100%
(100%) alkyl hydroperoxide reductase c22 protein gi|16501859 (SEQ
ID NO: 567) 21 kDa 100% (100%) 100% (100%) 50S ribosomal protein L9
gi|16767640 (SEQ ID NO: 216) 16 kDa 100% (100%) 100% (100%) outer
membrane protein OmpH precursor gi|16501506 (SEQ ID NO: 568) 18 kDa
100% (100%) 100% (100%) glutamine-binding periplasmic protein
precursor gi|16502041 (SEQ ID NO: 569) 27 kDa 100% (100%) 100%
(100%) GroES protein gi|16505459 (SEQ ID NO: 570) 10 kDa 100%
(100%) 100% (100%) 50S ribosomal subunit protein L1 gi|16504607
(SEQ ID NO: 571) 25 kDa 100% (100%) 100% (100%) outer membrane
protein C gi|16503494 (SEQ ID NO: 572) 41 kDa 100% (100%) 100%
(100%) dipeptide transport protein gi|16766917 (SEQ ID NO: 352) 60
kDa 100% (100%) PTS system protein HPr gi|24052838 (SEQ ID NO: 573)
9 kDa 100% (100%) 50S ribosomal subunit protein L7/L12 gi|47917
(SEQ ID NO: 574) 12 kDa 100% (100%) 50S ribosomal subunit protein
L32 gi|24051382 (SEQ ID NO: 575) 6 kDa 100% (100%) oligopeptide
transport protein gi|39546324 (SEQ ID NO: 576) 61 kDa 100% (100%)
high-affinity branched-chain amino acid transporter gi|16766853
(SEQ ID NO: 577) 39 kDa 100% (100%) 30S ribosomal protein S20
gi|16501327 (SEQ ID NO: 578) 10 kDa 100% (100%)
phosphoribosylaminoimidazole carboxylase catalytic gi|16763914 (SEQ
ID NO: 579) 18 kDa 100% (100%) subunit putative translation
initiation inhibitor gi|16505567 (SEQ ID NO: 580) 14 kDa 100%
(100%) putative multicopper oxidase gi|16763558 (SEQ ID NO: 581) 59
kDa 100% (100%) DNA protection during starvation protein
gi|16502042 (SEQ ID NO: 582) 19 kDa 100% (100%) thioredoxin
gi|67005950 (SEQ ID NO: 583) 12 kDa 100% (100%) sulfate transport
protein gi|16767329 (SEQ ID NO: 584) 37 kDa 100% (100%)
ribulose-phosphate 3-epimerase gi|16766771 (SEQ ID NO: 585) 24 kDa
99% (99%) cytoplasmic ferritin gi|16765276 (SEQ ID NO: 258) 19 kDa
99% (99%) osmotically inducible lipoprotein E precursor gi|16502880
(SEQ ID NO: 586) 12 kDa 100% (100%) fructose-bisphosphate aldolase
class I gi|16503381 (SEQ ID NO: 587) 38 kDa 100% (100%) 30S
ribosomal protein S13 gi|16766707** (SEQ ID NO: 202) 13 kDa 100%
(100%) thiosulfate transport protein gi|16765764 (SEQ ID NO: 588)
38 kDa 100% (100%) histidine-binding periplasmic protein gi|47731
(SEQ ID NO: 589) 28 kDa 100% (100%) RecA protein gi|16503906 (SEQ
ID NO: 590) 38 kDa 100% (100%) aspartate semialdehyde dehydrogenase
gi|2353187 (SEQ ID NO: 591) 43 kDa 100% (100%) transcription
elongation factor NusA gi|16766585** (SEQ ID NO: 245) 55 kDa 100%
(100%) pyruvate kinase gi|16764728 (SEQ ID NO: 220) 51 kDa 99%
(99%) 30S ribosomal protein S11 gi|16766706** (SEQ ID NO: 265) 14
kDa 99% (99%) DNA-directed RNA polymerase omega subunit gi|15804190
(SEQ ID NO: 592) 10 kDa 99% (99%) single-strand DNA-binding protein
gi|16505243 (SEQ ID NO: 593) 19 kDa 99% (99%) DNA-binding protein
HU-beta gi|581767 (SEQ ID NO: 594) 9 kDa 99% (99%) putative
cytoplasmic protein gi|6851082 (SEQ ID NO: 595) 19 kDa 99% (99%)
succinyl-CoA synthetase beta chain gi|16501970 (SEQ ID NO: 596) 41
kDa 99% (99%) 50S ribosomal subunit protein A gi|56383471 (SEQ ID
NO: 597) 7 kDa 99% (99%) ATPase subunit gi|7594817 (SEQ ID NO: 328)
46 kDa 99% (99%) ketol-acid reductoisomerase gi|16767185 (SEQ ID
NO: 598) 54 kDa 98% (98%)
DNA ligase gi|16765747 (SEQ ID NO: 599) 73 kDa 99% (99%) 30S
ribosomal subunit protein S19 gi|16505153 (SEQ ID NO: 600) 10 kDa
100% (100%) NifU-like protein involved in Fe--S cluster formation
gi|16503756 (SEQ ID NO: 601) 14 kDa 99% (99%) putative sigma(54)
modulation protein gi|16503819 (SEQ ID NO: 602) 13 kDa 99% (99%)
3-isopropylmalate dehydrogenase gi|16763502** (SEQ ID NO: 603) 40
kDa 99% (99%) bacterioferrin gi|16766732** (SEQ ID NO: 604) 18 kDa
99% (99%) glycerate kinase II gi|16763905** (SEQ ID NO: 326) 39 kDa
99% (99%) DNA polymerase I gi|16767264 (SEQ ID NO: 325) 103 kDa 99%
(99%) putative periplasmic protein gi|16764812 (SEQ ID NO: 605) 54
kDa 99% (99%) threonine dehydratase gi|16767181 (SEQ ID NO: 606) 56
kDa 98% (98%) putative universal stress protein UspA gi|16501866
(SEQ ID NO: 607) 16 kDa 99% (99%) ferric uptake regulator Fur
gi|16501929 (SEQ ID NO: 608) 17 kDa 99% (99%) Cell division
protease ftsH gi|16504361 (SEQ ID NO: 609) 71 kDa 99% (99%)
flavodoxin gi|16764064 (SEQ ID NO: 610) 20 kDa 99% (99%) nitrate
reductase 2 beta subunit gi|16764922 (SEQ ID NO: 611) 59 kDa 99%
(99%) keto-hydroxyglutarate-aldolase/keto-deoxy- gi|16765226 (SEQ
ID NO: 612) 22 kDa 99% (99%) phosphogluconate aldolase carbon
storage regulator CsrA gi|24053109 (SEQ ID NO: 613) 7 kDa 99% (99%)
rmlC dTDP-4,deoxyrhamnose 3,5 epimerase gi|581655 (SEQ ID NO: 614)
21 kDa 99% (99%) TonB-dependent siderophore receptor protein
gi|16766089 (SEQ ID NO: 615) 79 kDa 100% N-succinyldiaminopimelate-
gi|16766756 (SEQ ID NO: 616) 44 kDa 100%
aminotransferase/acetylornithine transaminase DNA-directed RNA
polymerase beta subunit gi|16767407 (SEQ ID NO: 235) 151 kDa 100%
argininosuccinate synthase gi|39546365 (SEQ ID NO: 617) 50 kDa 100%
outer membrane lipoprotein SlyB precursor gi|16502764 (SEQ ID NO:
618) 16 kDa 100% thiol peroxidase gi|16765025 (SEQ ID NO: 619) 18
kDa 100% 50S ribosomal subunit protein L14 gi|49613467 (SEQ ID NO:
620) 14 kDa 100% triosephosphate isomerase gi|16767347 (SEQ ID NO:
210) 27 kDa 100% lipoprotein gi|16765808** (SEQ ID NO: 216) 37 kDa
100% oligopeptidase A gi|1676688** (SEQ ID NO: 621) 77 kDa 100%
phosphoribosylamine--glycine ligase gi|16767429 (SEQ ID NO: 622) 46
kDa 100% phosphoglyceromutase gi|16764136 (SEQ ID NO: 623) 28 kDa
100% cystathionine gamma-synthase gi|16767366 (SEQ ID NO: 624) 42
kDa 100% glucose-6-phosphate isomerase gi|16767471 (SEQ ID NO: 281)
61 kDa 100% 50S ribosomal subunit protein L33 gi|24054147 (SEQ ID
NO: 625) 6 kDa 100% ribosomal protein S4 gi|2780215 (SEQ ID NO:
626) 23 kDa 100% PEP-protein phosphotransferase gi|16765752** (SEQ
ID NO: 627) 63 kDa 100% Lpp1 major outer membrane lipoprotein
gi|37785814 (SEQ ID NO: 628) 8 kDa 100% aldose 1-epimerase
gi|16764640** (SEQ ID NO: 287) 33 kDa 100% putative outer membrane
porin precursor gi|16764916** (SEQ ID NO: 197) 40 kDa 99% 50S
ribosomal protein L4 gi|15803846 (SEQ ID NO: 629) 22 kDa 100% outer
membrane ferric enterobactin receptor precursor gi|16763962 (SEQ ID
NO: 630) 83 kDa 100% hypothetical protein STM2795 putative LysM
domain gi|16766106** (SEQ ID NO: 631) 16 kDa 100%
phosphoribosylaminoimidazole-succinocarboxamide gi|16503704 (SEQ ID
NO: 632) 27 kDa 100% synthase arnithine carbamoyltransferase
gi|312706 (SEQ ID NO: 633) 24 kDa 100% ribonucleoside-diphosphate
reductase gi|1184247 (SEQ ID NO: 634) 81 kDa 100% biotin
carboxylase gi|16504442 (SEQ ID NO: 635) 49 kDa 100%
3-ketoacyl-(acyl-carrier-protein) reductase gi|16764550 (SEQ ID NO:
636) 26 kDa 100% 6-phosphofructokinase II gi|16764677 (SEQ ID NO:
637) 33 kDa 100% uroporphyrinogen III methylase gi|16767207 (SEQ ID
NO: 42 kDa 100% 638) *Peptide samples obtained from MudPIT were
analyzed using Sequest and X!Tandem software, and the data was
organized using the Scaffold program. To be considered a positive
identification in Scaffold, the following parameters were used: a
minimum of 2 peptides from a given protein identified with peptide
and protein thresholds of 80% to give an overall protein
identification (ID) probability of at least 80%. Note that a
protein ID probability of greater than 80% in at least one of the
samples warranted inclusion in the table so as to allow
identification of possible differential expression of a given
protein. **Peptides encoded by genes or operons also found to be
differentially regulated in spaceflight or ground based modeled
microgravity in LB medium
REFERENCES
[0128] 1. Wilson, J. W. et al. Space flight alters bacterial gene
expression and virulence and reveals a role for global regulator
Hfq. Proc Natl Acad Sci USA 104 (41), 16299-16304 (2007). [0129] 2.
Aertsen, A & Michiels, CW Stress and how bacteria cope with
death and survival. Crit Rev Microbiol 30, 263-273 (2004). [0130]
3. Rychlik, I. & Barrow, P. A. Salmonella stress management and
its relevance to behaviour during intestinal colonisation and
infection. FEMS Microbiol Rev 29 (5), 1021-1040 8 (2005). [0131] 4.
Foster, J. W. Escherichia coli acid resistance: tales of an amateur
acidophile. Nat Rev Microbiol 2 (11), 898-907 (2004). [0132] 5.
Beeson, J. G. et al. Adhesion of Plasmodium falciparum-infected
erythrocytes to hyaluronic acid in placental malaria. Nat Med 6
(1), 86-90 (2000). [0133] 6. Cai, Z., Xin, J., Pollock, D. M.,
& Pollock, J. S. Shear stress-mediated NO production in inner
medullary collecting duct cells. Am J Physiol Renal Physiol 279
(2), F270-274 15 (2000). [0134] 7. Guo, P., Weinstein, A. M., &
Weinbaum, S. A hydrodynamic mechanosensory hypothesis for brush
border microvilli. Am J Physiol Renal Physiol 279 (4), F698-712 18
(2000). [0135] 8. Wilson, J. W. et al. Microarray analysis
identifies Salmonella genes belonging to the low-shear modeled
microgravity regulon. Proc Natl Acad Sci USA 99 (21), 1380721 13812
(2002). [0136] 9. Wilson, J. W. et al. Low-Shear modeled
microgravity alters the Salmonella enterica serovar typhimurium
stress response in an RpoS-independent manner. Appl Environ 24
Microbiol 68 (11), 5408-5416 (2002). [0137] 10. Adkins, J. N. et
al. Analysis of the Salmonella typhimurium Proteome through
Environmental Response toward Infectious Conditions. Mol Cell
Proteomics 5 (8), 145027 1461 (2006). [0138] 11. Figueroa-Bossi, N.
et al. Loss of Hfq activates the sigmaE-dependent envelope stress
response in Salmonella enterica. Mol Microbiol 62 (3), 838-852
(2006). [0139] 12. Guisbert, E. et al. Hfq modulates the
sigmaE-mediated envelope stress response and the sigma-mediated
cytoplasmic stress response in Escherichia coli. J Bacteriol 189
(5), 32 1963-1973 (2007). [0140] 13. Sittka, A., Pfeiffer, V.,
Tedin, K., & Vogel, J. The RNA chaperone Hfq is essential for
the virulence of Salmonella typhimurium. Mol Microbiol 63 (1),
193-217 (2007). [0141] 14. Zhang, A. et al. Global analysis of
small RNA and mRNA targets of Hfq. Mol Microbiol 50 (4), 1111-1124
(2003). [0142] 15. Nickerson, C. A. et al. Microgravity as a novel
environmental signal affecting Salmonella enterica serovar
Typhimurium virulence. Infect Immun 68 (6), 3147-3152 (2000).
[0143] 16. Ruiz, Natividad & Silhavy, Thomas J. Constitutive
Activation of the Escherichia coli Pho Regulon Upregulates rpoS
Translation in an Hfq-Dependent Fashion. J. Bacteriol. 185 41 (20),
5984-5992 (2003). [0144] 17. Vanderpool, C. K. & Gottesman, S.
Involvement of a novel transcriptional activator and small RNA in
post-transcriptional regulation of the glucose phosphoenolpyruvate
phosphotransferase system. Mol Microbiol 54 (4), 1076-1089 (2004).
[0145] 18. Gulig, P. A. & Curtiss, R., 3rd Plasmid-associated
virulence of Salmonella typhimurium. Infect Immun 55 (12),
2891-2901 (1987). [0146] 19. Lennox, E. S. Transduction of linked
genetic characters of the host by bacteriophage P1. Virology 1 (2),
190-206 (1955). [0147] 20. Crabbe, A. et al. Use of the rotating
wall vessel technology to study the effect of shear stress on
growth behaviour of Pseudomonas aeruginosa PA01. Environ Microbiol
(2008). [0148] 21. ASTM Method D4327, Standard Test Method for
Anions in Water by Chemically Suppressed Ion Chromatography. ASTM
Method D4327, Standard Test Method for Anions in Water by
Chemically Suppressed Ion Chromatography, ASTM International, West
Conshohocken, Pa., www.astm.org. [0149] 22. Xia, X, McClelland, M,
& Wang, Y WebArray: an online platform for microarray data
analysis. BMC Bioinformatics 6, 306 (2005). [0150] 23. Keller, A.,
Nesvizhskii, A. I., Kolker, E., & Aebersold, R. Empirical
statistical model to estimate the accuracy of peptide
identifications made by MS/MS and database search. Anal Chem 74
(20), 5383-5392 (2002). [0151] 24. Nesvizhskii, A. I., Keller, A.,
Kolker, E., & Aebersold, R. A statistical model for identifying
proteins by tandem mass spectrometry. Anal Chem 75 (17), 4646-4658
(2003). [0152] 25. Reed, L. J. & Muench, H. A simple method of
estimating fifty percent endpoints. Am J Hyg 27, 493-497
(1938).
Example 3
[0153] This example describes a general protocol for culturing a
live attenuated Salmonella enterica serovar Typhimurium vaccine
strain under low sedimental shear conditions, and to evaluate the
immunogenicity of the vaccine strain cultured in this manner in a
mouse model. A recombinant attenuated Salmonella enterica serovar
Typhimurium anti-pneumococcal vaccine strain x9558 (.DELTA.pmi-2426
.DELTA.(gmd-fcl)-26 .DELTA.Pfur.sub.33::TTaraCP.sub.BADfur
.DELTA.Pcrp.sub.527::TTaraCP.sub.BADcrp
.delta.asdA27::TTaraCP.sub.BADc2 .DELTA.araE25 .DELTA.araBAD23
.DELTA.relA198::araCP.sub.BADlacITT .DELTA.sopB1925
.DELTA.agfBAC811 .DELTA.fliC180 .DELTA.fljB217) encoding
pneumococcal antigen (pspA capsular gene) on plasmid pYA4088 is
used in this example as illustration. However, any live attenuated
bacterial vaccine strain can be used that carries one or more
attenuating mutations of interest--including heterologous
recombinant vaccine strains that express foreign antigens to elicit
innate humoral and cellular immune responses. Moreover, Lennox
broth is used for Salmonella strain culture in this example, any
growth media and incubation conditions required to cultivate the
strain of interest can be used. In addition, while the Rotating
Wall Vessel bioreactor is used as the culture modality to achieve
low sedimental shear stress, other culture environments that
achieve this environment can also be used (including the
spaceflight environment).
[0154] Live attenuated bacterial vaccine strain growth conditions.
The attenuated Salmonella vaccine strain is first grown in Lennox
broth (L-broth) as a static or aerated overnight culture at
37.degree. C. Cultures are then inoculated at a dilution of 1:200
into 50 ml of L broth and subsequently introduced into the RWV
bioreactor. Care is taken to ensure that the reactor is completely
filled with culture media and no bubbles are present (i.e. zero
headspace). The reactor vessel is oriented to grow cells under
conditions of low sedimental shear or control sedimental shear. Two
different RWV bioreactors, one in each physical orientation (low
sedimental shear or control sedimental shear, respectively), should
be simultaneously inoculated with the bacterial strain. Incubations
in the RWV are at 37.degree. C. or room temperature with a rotation
rate of 25 rpm. Culture times are for 10 hours (which corresponds
to mid-log phase growth) or 24 hours (which corresponds to
stationary phase). Cell density is measured as viable bacterial
counts plated on L agar for colony forming units per ml (CFU/ml).
This is done to ensure that low sedimental shear and control
sedimental shear-grown Salmonella are in the same phase of growth
for use in subsequent experiments.
[0155] Modulations in low shear sedimental culture conditions.
Bacterial strains can be grown under the identical conditions above
with the exception that the manipulations of the low sedimental
shear environments are made within physiological ranges encountered
by pathogens in the mammalian host. This can be done by the
inclusion of inert beads of different sizes in the RWV bioreactor
during cell culture, but other approaches are also possible.
[0156] Oral immunization of mice with attenuated Salmonella vaccine
strains and protection against challenge with a virulent wild-type
strain. Protective immunity elicited by attenuated Salmonella
strains cultured under low shear sedimental and control shear
sedimental conditions will determined in BALB/c mice following
peroral (p.o.) inoculation. Six-to-ten-week-old female BALB/c mice
(Charles River Laboratories, Wilmington, Mass.) will be immunized
by peroral (p.o.) administration of serial dilutions of a low
sedimental shear or control sedimental shear grown attenuated
Salmonella vaccine strain. While this example focuses on oral
infection of mice, other immunization methods can also be used,
including peroral, intraperitoneal, nasal, vaginal administration,
among others. Likewise, other hosts can be used for infection,
including but not limited to, other animals, animal analogues,
plants, insects, nematodes, and cell and tissue cultures from
animals, animal analogues and plants. In addition, infections can
be administered while both the host and pathogen are simultaneously
in a low shear sedimental environment, including spaceflight. Mice
are housed in autoclavable micro-isolator cages with free access to
standard laboratory food and water for one week before use to allow
acclimation. Bacteria for use in these studies are grown in the RWV
under the conditions described above, harvested from the bioreactor
by dispensing into a 50 ml polypropylene conical tube, and
immediately harvested by centrifugation at room temperature for 10
minutes at 7,974.times.g. Bacteria are immediately resuspended in
1.0 ml buffered saline with gelatin (BSG).
[0157] Specifically, mice to be used in p.o. immunization with
attenuated live vaccine strains or inoculation with challenge
strains are deprived of food and water for 4-6 h. An attenuated
Salmonella vaccine strain is grown simultaneously in the RWV
bioreactors in the low shear sedimental conditions and control
shear sedimental conditions and harvested as described above.
Appropriate dilutions of the bacteria (low shear sedimental or
control shear sedimental) will be prepared for p.o. inoculation of
mice. Results will be obtained from ten mice/inoculum dose.
Specifically, ten mice per group will be perorally inoculated with
10.sup.6, 10.sup.7, 10.sup.8, and 10.sup.9 CFU of the attenuated
Salmonella vaccine strain grown under low shear sedimental or
control shear sedimental conditions, respectively. Challenge with
fully virulent wild-type Salmonella is given orally 30 days after
immunization and mice are observed for four weeks thereafter.
(Other routes of challenge may also be used). (In the case of
recombinant attenuated Salmonella vaccine strain encoding
heterologous antigen against another pathogen, challenge will also
be with the fully virulent pathogen for which Salmonella carries
the heterologous antigen. For example, for the recombinant
attenuated Salmonella anti-pneumococcal vaccine strain, challenge
would be with fully virulent Streptococcus pneumoniae.) Following
challenge, mice will be monitored for signs of disease at least
twice daily. These include a hunched posture, scruffy coat, and
unwillingness to open eyes or move around. Mortality of the mice
will be observed for 30 days. The median lethal dose will be
determined by the method of Reed and Muench.
[0158] Enumeration of bacteria in mouse tissues. The effect of low
sedimental shear on the tissue distribution and persistence of
Salmonella in mice will be assessed in vivo by peroral inoculation
into six-to-ten-week-old female BALB/c mice. Bacteria are grown and
harvested as described above. Quantitation of viable Salmonella in
tissues and organs will be performed as described previously from
two groups of five mice each in two independent trials. The mice
will be euthanized by CO.sub.2 asphyxiation at 3, 5, and 7 days
postinfection for subsequent harvesting of tissues and enumeration
of bacteria to determine colonization of Salmonella. Thereafter, to
determine persistence of Salmonella in mice, tissues will be
harvested from mice weekly through through 60 days. Fecal pellets
will also be collected to monitor shedding of Salmonella throughout
the entire duration of the study. The number of Salmonella present
in the tissues will be determined by viable counting of serial
dilutions of the homogenates on MacConkey agar (Difco, Detroit,
Mich.) supplemented with lactose at 1% final concentration. Murine
tissues that will be analyzed include Peyer's patches, intestinal
epithelium (minus Peyer's patches), liver, spleen and mesenteric
lymph nodes.
[0159] Measurement and duration of antibody responses by ELISA
following infection of animals with live attenuated recombinant
bacterial vaccine strains carrying heterologous antigens. Groups of
eight mice each will be immunized orally with different doses of a
live attenuated Salmonella recombinant vaccine strain carrying a
foreign antigen of interest and grown and harvested as described
above. The live attenuated recombinant S. typhimurium vaccine
strain used for the teaching the claims in this application express
the pneumococcal PspA capsular antigen, however, any antigen(s)
from any pathogen of interest could be used in these studies.
Animal immunizations will be carried out perorally as described
above. Booster immunizations may be given to enhance antibody
responses to the foreign antigen. Serum samples (retroorbital
puncture) and vaginal washings will be collected 2, 4, 6, and 8
weeks after immunization as described previously. Humoral, mucosal
and cellular immune responses can be measured against Salmonella
and/or to the heterologous antigen that it encodes.
[0160] The levels of antibodies present in mouse sera against the
pneumococcal PspA capsular antigen and S. typhimurium LPS will be
determined using enzyme-linked immunosorbent assay (ELISA) as
follows. Ninety-six well Immulon plates (Dynatech, Chantilly, Va.)
will be coated with 10 .mu.g of a recombinant pneumococcal PspA
capsular surface protein (rPspA) in 0.2 M bicarbonate/carbonate
buffer (pH 9.6) at 4.degree. C. overnight. Nonspecific binding
sites will be blocked with 1% BSA in phosphate buffered saline
(PBS)+0.1% Tween20 (pH 7.4) (blocking buffer) at room temperature
for 1 h. Serum samples and vaginal washings will be diluted 1:100
and 1:10, respectively, in blocking buffer. One hundred microliters
of the diluted samples will be added in duplicate to the plates and
incubated at 37.degree. C. for 2 h. The plates are then washed with
PBS+0.1% Tween20 three times. One hundred microliters of
biotin-labeled goat anti-mouse IgA or IgG will be added,
respectively, and incubated at 4.degree. C. overnight. Alkaline
phosphatase-labeled ExtrAvidin (Sigma, St. Louis, Mo.) is added to
the plates and incubated at room temperature for 1 h. Substrate
solution (0.1 ml) containing p-nitro-phenylphosphate (1 mg/ml) in
0.1 M diethanolamine buffer (pH 9.8) will be added and the optical
density of the resulting substrate reaction is read at 405 nm with
an automated ELISA reader (BioTech, Burlington, Vt.).
[0161] Measurement of central memory T cells following infection of
animals with live attenuated recombinant bacterial vaccine strains
carrying heterologous antigens. The induction of memory responses
is critical for the long-term protective efficacy of vaccines. In
particular, the CD4+ CD44.sub.high CD62L.sub.high and CD8315
+CD44.sub.highCD62L.sub.high central memory T cells play a central
role in the recall response (Krishnan, L., K. Gurnani, C. J.
Dicaire, H. van Faassen, A. Zafer, C. J. Kirschning, S. Sad, and G.
D. Sprott. 2007. Rapid clonal expansion and prolonged maintenance
of memory CD8+ T Cells of the effector (CD44.sub.highCD62L.sub.low)
and central (CD44.sub.highCD62L.sub.high phenotype by an
archaeosome adjuvant independent of TLR2. J. Immunol.
178:2396-2406). Thus, the effect of low sedimental shear
cultivation of the vaccine strain on stimulation of a memory T cell
response will be evaluated. Eight weeks after immunization, spleens
will be isolated from mice and compared to control (unimmunized and
mock infected) mice. Splenic cells will be stimulated with antigen
(rPspA) and then examined by FACS analysis for T cell markers
indicative of memory cells.
[0162] Measurement of innate immune responses/cytokines following
infection of animals with live attenuated recombinant bacterial
vaccine strains carrying heterologous antigens. Six weeks after
immunization, sera from immunized and control mice will be
subjected to Bio-Plex Protein Array System (Bio-Rad, Hercules,
Calif.) or ELISPOT analysis to determine antigen stimulation of
cytokine production as described previously (Li Y, Wang S, Xin W,
Scarpellini G, Shi Z, Gunn B, Roland K L, Curtiss R III. A sopB
Deletion Mutation Enhances the Immunogenicity and Protective
Efficacy of a Heterologous Antigen Delivered by Live Attenuated
Salmonella enterica Vaccines. Infect Immun. 2008 Sep. 2. Epub ahead
of print). The cytokine secretion profiles from splenic lymphocytes
will be compared (other tissues may also be utilized). Both Th1 and
Th2 cytokines will be profiled. Briefly, samples will be incubated
with antibody-coupled beads for 1 h with shaking. Beads will be
washed 3.times. with wash buffer to remove unbound protein and
subsequently incubated with biotinylated detection
cytokine-specific antibody for 1 h with shaking. The beads will
then be washed once more followed by incubation for 10 min with
streptavidin-phycoerythrin. After this incubation, beads will be
washed and resuspended in assay buffer, and the contents of each
well will be subjected to the flow-based Bio-Plex Suspension Array
System, which identifies each different color bead as a population
of protein and quantifies each protein target based on secondary
antibody fluorescence. Cytokine concentrations will be calculated
by Bio-Plex Manager software using a standard curve derived from a
recombinant cytokine standard.
[0163] Immunoblotting for detection and quantiation of heterologous
antigens carried by attenuated Salmonella vaccine strains from
serum of infected animals. For immunoblotting, the S. typhimurium
recombinant attenuated strain x9558 that carries the pneumococcal
capsular antigen on plasmid pYA4088 will be grown with aeration
overnight at 37.degree. C. Five hundred microliters of each culture
will be pelleted and resuspended in 2.times. sample loading buffer
and boiled for 5 min. Protein preparations will be separated by
sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis
(PAGE) (12.5% polyacrylamide) and prepared for Coomassie brilliant
blue staining or Western blot analysis. In addition to heterologous
antigen detection, detection of Salmonella antigens can also be
performed using Salmonella outer membrane protein antigens or
LPS.
Example 4
[0164] This example describes the stress response phenotypes
observed for a recombinant attenuated Salmonella anti-pneumococcal
vaccine strain, X9558 pYA4088 (.DELTA.pmi-2426 .DELTA.(gmd-fcl)-26
.DELTA.Pfur.sub.33::TTaraCP.sub.BADfur
.DELTA.Pcrp.sub.527::TTaraCP.sub.BADcrp
.DELTA.asdA27::TTaraCP.sub.BADc2 .DELTA.araE25 .DELTA.araBAD23
.DELTA.relA198::araCP.sub.BADlacITT .DELTA.sopB1925
.DELTA.agfBAC811 .DELTA.fliC180 .DELTA.fljB217) during low fluid
shear culture in the RWV bioreactor. The results indicate that low
fluid shear culture in the RWV confers increased protection to the
strain to survive virulence-related stress responses, including an
increased ability to survive acid stress, thermal stress, and
oxidative stress. In addition, low fluid shear culture of this
strain decreased its biofilm formation. These low fluid
shear-conferred phenotypes are all important features that could
significantly enhance the immunogenicity and protection of this
vaccine strain.
Biofilm Formation
[0165] Differences in the O.D. readings before and after the RWVs
were stopped:
TABLE-US-00008 O.D. before O.D. after stopping Duration of stopping
HARV HARV experiment 1XG 0.495 0.923 25 hours 25 min LSMMG 1.376
1.462
[0166] There is a marked difference in the O.D. reading for the
1.times.G condition before and after the RWV was stopped. This
difference in OD was due to the enhanced biofilm formation in the
1.times.g condition as compared to the LSMMG condition, and not
differences in cell numbers--as the cells were in the same phase of
growth under the two conditions, however, most of the cells were
sessile (attached to the membrane) in the 1.times.g RWV, leaving
fewer cells in the supernatant (planktonic cells) for cell
counting. When the RWVs were taken apart, a biofilm like substance
was observed on the membrane with the 1.times.G culture. No such
biofilm formation was observed for the LSMMG cultures. FIG. 9
presents microscopic images of cells scraped off of the membranes
and stained with crystal violet.
Thermal Stress Assay Data:
TABLE-US-00009 [0167] Time (min) 30 60 90 LSMMG (37.degree. C.)
3.10E+08 2.67E+08 3.18E+08 1XG (37.degree. C.) 3.00E+08 3.35E+08
2.70E+08 LSMMG (55.degree. C.) 3.80E+06 2.70E+05 0.00E+00 1XG
(55.degree. C.) 7.60E+05 8.30E+04 0.00E+00
[0168] The data show that the cells can withstand thermal stress in
the LSMMG condition much better as compared to the 1.times.G
condition at 55.degree. C.
Acid Stress Assay Data:
[0169] In this experiment, LSMMG and 1.times.g cultures were
subjected to acid stress and assayed for resistance to pH 3.5 (by
addition of an amount of concentrated citrate buffer that has been
previously determined to give this pH value) as described
previously (Nickerson et al., Infection and Immunity, 2000; Wilson
et al, Applied and Environmental Microbiology, 2002). The pH level
during the assay was monitored using pH strips, and then confirmed
with a pH electrode at the end of the assay. The percentage of
surviving bacteria present after 30, 45, 60 and 90 minutes of acid
stress (compared to the original number of bacteria before addition
of the stress) was calculated via serial dilution and CFU plating.
These results were compared identical control cultures that were
not subjected to acid stress (no citrate buffer was added), but
instead were allowed to sit on the bench top statically and at time
points 30, 60 and 90 minutes about 100 ul were taken out and added
to 9.9 ml of PBS. It can be seen that the LSMMG cells survive acid
stress better than 1.times.G grown cells
TABLE-US-00010 Time (min) 0 30 45 60 90 1XG 2.72E+06 2.66E+06
2.72E+06 3.35E+06 (Contro LSMMG 3.80E+06 3.37E+06 3.66E+06 3.66E+06
(Co 1XG 2.72E+06 2.07E+06 2.18E+06 2.27E+06 2.60E+06 LSMMG 3.80E+06
2.90E+06 3.26E+06 3.47E+06 2.82E+06 indicates data missing or
illegible when filed
Oxidative Stress Data:
[0170] In a separate experiment, oxidative stress (in the form of
hydrogen peroxide) was applied to cells.
TABLE-US-00011 Time (min) 0 30 60 90 120 1XG 6.13E+06 6.67E+06
6.72E+06 5.89E+06 7.10E+06 (Contro LSMMG 6.30E+06 6.65E+06 6.19E+06
5.67E+06 6.49E+06 (Co 1XG 6.13E+06 2.29E+04 0.00E+00 0.00E+00
0.00E+00 LSMMG 6.30E+06 1.43E+06 3.90E+05 2.10E+05 2.10E+05
indicates data missing or illegible when filed
[0171] It can be seen that the LSMMG cells survive the oxidative
stress much better than the 1.times.G grown cells after 30 min.
[0172] The above results were obtained using the recombinant
attenuated Salmonella anti-pneumococcal vaccine strain X9558 that
carries the pneumococcal capsular antigen on plasmid pYA4088. The
S. typhimurium UK-1 wild-type parent strain showed similar
results.
Example 5
Spaceflight Alters Expression of Genes in the Hfq Regulon in
Pseudomonas aeruginosa
[0173] Cultures of P. aeruginosa flew in the same flight experiment
with S. typhimurium aboard STS-115 to determine changes in gene
expression compared to otherwise identical ground controls.
Preliminary results from microarray analysis indicate that of the
226 P. aeruginosa genes that were differentially regulated during
spaceflight, 59 (.about.23%) are regulated by Hfq--including those
encoding ribosomal proteins, iron metabolic pathways, carbon
metabolic pathways, cytoplasmic and periplasmic sigma factors, and
ion response pathways. See Tables 7 and 8. In addition, it has been
shown that LSMMG-cultured P. aeruginosa demonstrated an increased
sensitivity to acid stress as compared to the control orientation.
Collectively, these data supports an association between the gene
expression and phenotypic response of P. aeruginosa during flight
and LSMMG culture and the Hfq regulon.
Example 6
Spaceflight May Alter the Virulence Potential of Candida
albicans
[0174] Scanning electron microscopy (SEM) (FIG. 10) shows profound
hyphal formation of C. albicans during spaceflight culture--but no
hyphal formation is evident during ground culture of identical
controls. Hyphal formation is known to be associated with increased
virulence.
Example 7
Phosphate Ion Modulates the LSMMG Response of the Gram Positive
Pathogen, Staphylococcus aureus
[0175] Initial studies were performed on S. aureus N315 to
determine phenotypic responses to culture in LSMMG and 1.times.G.
When grown in LSMMG, S. aureus displayed a distinct decrease in the
golden carotenoid pigmentation compared to growth in the control
orientation, based upon a colorimetric assay for the primary
carotenoid, staphyloxanthin. Notably, the addition of phosphate ion
(25 mM Na.sub.2HPO.sub.4) to the media increased both the
pigmentation of the LSSMG and 1.times.G control cultures. This
latter finding is in agreement with the finding described above
that environmental ions modulate the LSMMG acid stress response in
Salmonella.
TABLE-US-00012 TABLE 7 sig- sig- sig- sig- T- T- Mann- Mann- % P
Test Test Whitney Whitney sig log sig log sig log ground- P Change
P Change % MD/D- ratio- ratio- ratio- Percent Value Direction Value
Direction Percent Average Median Stdev PA4243_secY_at (SEQ ID No:
639) 100 0.262 None 0.05 Down 100 -4.3 -4.56 1.38 PA4242_rpmJ_at
(SEQ ID No: 640) 100 0.206 None 0.05 Down 100 -4.63 -4.55 1.23
PA5049_rpmE_at (SEQ ID No: 641) 100 0.304 None 0.05 Down 88 -4.14
-4.54 1.39 PA3745_rpsP_at (SEQ ID No: 642) 100 0.275 None 0.05 Down
100 -4.43 -4.52 1.32 PA3744_rimM_at (SEQ ID No: 643) 100 0.261 None
0.05 Down 100 -4.27 -4.5 1.32 PA4568_rplU_at (SEQ ID No: 644) 100
0.256 None 0.05 Down 100 -4.55 -4.47 1.25 PA2966_acpP_at (SEQ ID
No: 645) 100 0.213 None 0.05 Down 100 -4.21 -4.46 0.93 PA0492_at
(SEQ ID No: 646) 100 0.045 Down 0.05 Down 100 -4.29 -4.43 0.78
PA4563_rpsT_at (SEQ ID No: 647) 100 0.186 None 0.05 Down 100 -4.67
-4.43 1.31 PA4245_rpmD_at (SEQ ID No: 648) 100 0.241 None 0.05 Down
100 -4.12 -4.42 1.16 PA3656_rpsB_at (SEQ ID No: 649) 100 0.233 None
0.05 Down 100 -4.09 -4.4 1.14 PA2971_at (SEQ ID No: 650) 100 0.331
None 0.05 Down 66 -4.03 -4.39 1.3 PA4433_rplM_at (SEQ ID No: 651)
100 0.228 None 0.05 Down 100 -4.62 -4.38 1.16 PA5570_rpmH_at (SEQ
ID No: 652) 100 0.234 None 0.05 Down 66 -4.58 -4.37 1.03
PA4240_rpsK_at (SEQ ID No: 653) 100 0.26 None 0.05 Down 77 -4.07
-4.37 1.1 PA4239_rpsD_at (SEQ ID No: 654) 100 0.201 None 0.05 Down
100 -4.29 -4.37 0.99 PA4262_rplD_at (SEQ ID No: 655) 100 0.278 None
0.05 Down 100 -4.04 -4.25 1.1 PA4268_rpsL_at (SEQ ID No: 656) 100
0.278 None 0.05 Down 100 -4.38 -4.24 1.27 PA4247_rplR_at (SEQ ID
No: 657) 100 0.232 None 0.05 Down 100 -4.14 -4.24 1 PA4263_rplC_at
(SEQ ID No: 658) 100 0.261 None 0.05 Down 100 -4.02 -4.22 1.18
PA3162_rpsA_at (SEQ ID No: 659) 100 0.257 None 0.05 Down 77 -3.94
-4.17 0.99 PA5316_rpmB_at (SEQ ID No: 660) 100 0.271 None 0.05 Down
100 -4.3 -4.17 1.21 Pae_tRNA_Gln_s_at (SEQ ID No: 661) 100 0.331
None 0.05 Down 88 -4.25 -4.14 1.56 PA4671_at (SEQ ID No: 662) 100
0.196 None 0.05 Down 88 -3.88 -4.14 0.94 PA4272_rplJ_at (SEQ ID No:
663) 100 0.256 None 0.05 Down 88 -3.84 -4.14 0.97 PA2619_infA_at
(SEQ ID No: 664) 100 0.175 None 0.05 Down 100 -4.31 -4.13 1.17
PA4241_rpsM_at (SEQ ID No: 665) 100 0.237 None 0.05 Down 88 -3.87
-4.12 1.11 PA4482_gatC_at (SEQ ID No: 666) 100 0.285 None 0.05 Down
77 -4.01 -4.11 0.84 PA2743_infC_at (SEQ ID No: 667) 100 0.326 None
0.05 Down 66 -3.92 -4.1 1.1 PA3742_rplS_at (SEQ ID No: 668) 100
0.263 None 0.05 Down 66 -3.74 -4.1 0.89 PA5491_at (SEQ ID No: 669)
100 0.248 None 0.05 Down 88 -3.97 -4.1 1.21 PA4238_rpoA_at (SEQ ID
No: 670) 100 0.258 None 0.05 Down 88 -3.74 -4.1 0.99 PA2321_at (SEQ
ID No: 671) 100 0.165 None 0.05 Down 100 -4.16 -4.1 1.04
PA5276_lppL_i_at (SEQ ID No: 672) 100 0.12 None 0.05 Down 55 -4.05
-4.09 0.98 PA3743_trmD_at (SEQ ID No: 673) 100 0.301 None 0.05 Down
88 -4.19 -4.09 1.39 PA2639_nuoD_at (SEQ ID No: 674) 100 0.045 Down
0.05 Down 100 -3.9 -4.09 0.68 PA1800_tig_at (SEQ ID No: 675) 100
0.34 None 0.05 Down 100 -3.79 -4.06 1.05 PA5555_atpG_at (SEQ ID No:
676) 100 0.246 None 0.05 Down 66 -3.82 -4.04 1.02 PA2970_rpmF_at
(SEQ ID No: 677) 100 0.258 None 0.05 Down 100 -4.1 -4.04 1.19
PA1582_sdhD_at (SEQ ID No: 678) 100 0.145 None 0.05 Down 100 -3.83
-4.04 1.01 PA4246_rpsE_at (SEQ ID No: 679) 100 0.185 None 0.05 Down
66 -3.73 -4.01 1.06 PA0579_rpsU_at (SEQ ID No: 680) 100 0.273 None
0.05 Down 77 -4.25 -4.01 1.23 PA2634_at (SEQ ID No: 681) 100 0.008
Down 0.05 Down 100 -3.84 -3.99 0.66 PA1581_sdhC_at (SEQ ID No: 682)
100 0.264 None 0.05 Down 88 -3.91 -3.98 0.97 PA5557_atpH_at (SEQ ID
No: 683) 100 0.318 None 0.05 Down 55 -3.67 -3.97 0.97
Pae_tRNA_Gly_s_at (SEQ ID No: 684) 100 0.32 None 0.05 Down 66 -4.48
-3.97 1.63 PA5298_at (SEQ ID No: 685) 100 0.072 None 0.05 Down 77
-3.74 -3.97 1.06 PA4846_aroQ1_at (SEQ ID No: 686) 100 0.153 None
0.05 Down 88 -4.04 -3.93 0.87 PA0493_at (SEQ ID No: 687) 100 0.007
Down 0.05 Down 100 -4.05 -3.93 0.87 PA3266_capB_at (SEQ ID No: 688)
100 0.178 None 0.05 Down 66 -4.01 -3.91 1.16 PA4267_rpsG_at (SEQ ID
No: 689) 100 0.229 None 0.05 Down 55 -3.82 -3.9 0.97 PA4748_tpiA_at
(SEQ ID No: 690) 100 0.339 None 0.05 Down 55 -3.72 -3.9 1.26
PA4847_accB_at (SEQ ID No: 691) 100 0.165 None 0.05 Down 77 -3.77
-3.9 0.74 Pae_tRNA_Val_f_at (SEQ ID No: 692) 100 0.323 None 0.05
Down 66 -3.8 -3.88 1.25 PA4249_rpsH_at (SEQ ID No: 693) 100 0.286
None 0.05 Down 77 -3.83 -3.84 1.25 PA0856_at (SEQ ID No: 694) 100
0.041 Down 0.05 Down 100 -3.71 -3.84 0.77 PA5569_rnpA_at (SEQ ID
No: 695) 100 0.282 None 0.05 Down 55 -3.82 -3.83 1.18
PA0896_aruF_at (SEQ ID No: 696) 100 0.047 Down 0.05 Down 77 -3.99
-3.83 1.32 PA4430_at (SEQ ID No: 697) 100 0.142 None 0.05 Down 77
-3.9 -3.81 0.86 PA4935_rpsF_at (SEQ ID No: 698) 100 0.305 None 0.05
Down 55 -3.57 -3.8 0.92 PA4031_ppa_at (SEQ ID No: 699) 100 0.146
None 0.05 Down 66 -3.54 -3.78 0.76 PA2744_thrS_at (SEQ ID No: 700)
100 0.239 None 0.05 Down 55 -3.48 -3.76 0.96 PA4942_hflK_at (SEQ ID
No: 701) 100 0.245 None 0.05 Down 55 -3.57 -3.75 0.99 PA1557_at
(SEQ ID No: 702) 100 0.073 None 0.05 Down 55 -3.87 -3.74 0.75
PA4406_lpxC_at (SEQ ID No: 703) 100 0.215 None 0.05 Down 66 -3.62
-3.74 0.95 PA3621_fdxA_at (SEQ ID No: 704) 100 0.157 None 0.05 Down
88 -3.76 -3.73 0.98 PA3644_lpxA_at (SEQ ID No: 705) 100 0.238 None
0.05 Down 88 -3.63 -3.73 1.06 PA4053_ribE_at (SEQ ID No: 706) 100
0.233 None 0.05 Down 88 -3.57 -3.73 0.83 PA4276_secE_at (SEQ ID No:
707) 100 0.334 None 0.05 Down 55 -3.87 -3.69 1.36 PA3811_hscB_at
(SEQ ID No: 708) 100 0.281 None 0.05 Down 55 -3.45 -3.69 0.93
PA3645_fabZ_at (SEQ ID No: 709) 100 0.207 None 0.05 Down 66 -3.6
-3.69 0.99 PA4431_at (SEQ ID No: 710) 100 0.201 None 0.05 Down 77
-3.51 -3.69 0.8 PA1156_nrdA_at (SEQ ID No: 711) 100 0.137 None 0.05
Down 88 -3.74 -3.69 0.83 PA4762_grpE_at (SEQ ID No: 712) 100 0.289
None 0.05 Down 88 -3.64 -3.68 1.02 PA3159_wbpA_at (SEQ ID No: 713)
100 0.339 None 0.05 Down 55 -3.49 -3.67 0.88 PA4944_at (SEQ ID No:
714) 100 0.304 None 0.05 Down 66 -3.54 -3.66 0.97 PA3636_kdsA_at
(SEQ ID No: 715) 100 0.125 None 0.05 Down 66 -3.52 -3.66 0.87
PA4261_rplW_at (SEQ ID No: 716) 100 0.29 None 0.05 Down 77 -3.8
-3.65 1.14 PA4252_rplX_at (SEQ ID No: 717) 100 0.003 Down 0.05 Down
100 -3.95 -3.65 1.08 PA4745_nusA_at (SEQ ID No: 718) 100 0.301 None
0.05 Down 55 -3.38 -3.62 0.97 PA3635_eno_at (SEQ ID No: 719) 100
0.269 None 0.05 Down 55 -3.28 -3.62 0.9 PA0336_at (SEQ ID No: 720)
100 0.289 None 0.05 Down 77 -3.43 -3.62 0.85 ig_5207621_5208463_at
100 0.202 None 0.05 Down 55 -3.5 -3.61 0.95 (SEQ ID No: 721)
PA5558_atpF_at (SEQ ID No: 722) 100 0.304 None 0.05 Down 77 -3.51
-3.61 0.96 PA2968_fabD_at (SEQ ID No: 723) 100 0.202 None 0.05 Down
66 -3.6 -3.6 0.93 PA3832_holC_at (SEQ ID No: 724) 100 0.017 Down
0.05 Down 88 -3.55 -3.59 0.66 PA4483_gatA_at (SEQ ID No: 725) 100
0.153 None 0.05 Down 66 -3.62 -3.58 0.76 PA2747_at (SEQ ID No: 726)
100 0.085 None 0.05 Down 66 -3.76 -3.57 0.82 Pae_tRNA_His_f_at (SEQ
ID No: 727) 100 0.184 None 0.05 Down 66 -3.66 -3.57 1.04
PA2624_idh_at (SEQ ID No: 728) 100 0.177 None 0.05 Down 77 -3.32
-3.57 0.67 PA2453_at (SEQ ID No: 729) 100 0.23 None 0.05 Down 88
-3.52 -3.56 0.82 PA4258_rplV_at (SEQ ID No: 730) 100 0.3 None 0.05
Down 55 -3.57 -3.55 0.99 PA4743_rbfA_at (SEQ ID No: 731) 100 0.229
None 0.05 Down 55 -3.52 -3.55 1.06 PA1533_at (SEQ ID No: 732) 100
0.147 None 0.05 Down 77 -3.69 -3.54 0.94 PA1123_at (SEQ ID No: 733)
100 0.004 Down 0.05 Down 88 -3.49 -3.54 0.72 PA5490_cc4_at (SEQ ID
No: 734) 100 0.114 None 0.05 Down 88 -3.59 -3.54 0.8 PA3001_at (SEQ
ID No: 735) 100 0.078 None 0.05 Down 100 -3.74 -3.54 0.87
PA1013_purC_at (SEQ ID No: 736) 100 0.199 None 0.05 Down 88 -3.35
-3.53 0.6 PA3987_leuS_at (SEQ ID No: 737) 100 0.079 None 0.05 Down
55 -3.59 -3.52 1.14 PA4761_dnaK_at (SEQ ID No: 738) 100 0.152 None
0.05 Down 66 -3.46 -3.52 0.8 PA3701_prfB_at (SEQ ID No: 739) 100
0.117 None 0.05 Down 66 -3.42 -3.51 0.72 PA5128_secB_at (SEQ ID No:
740) 100 0.054 None 0.05 Down 100 -3.66 -3.51 0.71 PA4253_rplN_at
(SEQ ID No: 741) 100 0.255 None 0.05 Down 66 -3.57 -3.5 0.97
PA4386_groES_at (SEQ ID No: 742) 100 0.228 None 0.05 Down 77 -3.65
-3.5 0.94 PA5067_hisE_at (SEQ ID No: 743) 100 0.148 None 0.05 Down
77 -3.31 -3.5 0.77 PA4880_at (SEQ ID No: 744) 100 0.1 None 0.05
Down 88 -3.49 -3.5 0.94 PA1610_fabA_at (SEQ ID No: 745) 100 0.118
None 0.05 Down 100 -3.77 -3.5 1 PA3807_ndk_at (SEQ ID No: 746) 100
0.279 None 0.05 Down 66 -3.56 -3.49 0.95 PA4266_fusA1_at (SEQ ID
No: 747) 100 0.284 None 0.05 Down 77 -3.69 -3.48 1.05
PA0972_tolB_at (SEQ ID No: 748) 100 0.198 None 0.05 Down 66 -3.52
-3.47 0.95 PA4232_ssb_at (SEQ ID No: 749) 100 0.114 None 0.05 Down
88 -3.46 -3.47 0.75 PA3700_lysS_at (SEQ ID No: 750) 100 0.251 None
0.05 Down 55 -3.5 -3.45 0.9 PA4460_at (SEQ ID No: 751) 100 0.147
None 0.05 Down 66 -3.42 -3.45 0.88 PA5069_tatB_at (SEQ ID No: 752)
100 0.233 None 0.05 Down 66 -3.65 -3.44 0.94 PA4853_fis_at (SEQ ID
No: 753) 100 0.188 None 0.05 Down 66 -3.37 -3.44 0.9 PA0019_def_at
(SEQ ID No: 754) 100 0.037 Down 0.05 Down 77 -3.43 -3.44 0.57
PA0595_ostA_at (SEQ ID No: 755) 100 0.182 None 0.05 Down 55 -3.42
-3.43 0.98 PA4848_accC_at (SEQ ID No: 756) 100 0.109 None 0.05 Down
77 -3.57 -3.43 0.88 PA1580_gltA_at (SEQ ID No: 757) 100 0.162 None
0.05 Down 77 -3.38 -3.43 0.8 PA4259_rpsS_at (SEQ ID No: 758) 100
0.152 None 0.05 Down 55 -3.74 -3.41 0.92 PA2976_rne_at (SEQ ID No:
759) 100 0.096 None 0.05 Down 66 -3.44 -3.41 0.74 PA1574_at (SEQ ID
No: 760) 100 0.015 Down 0.05 Down 77 -3.47 -3.41 1.07
PA2023_galU_at (SEQ ID No: 761) 100 0.029 Down 0.05 Down 77 -3.46
-3.41 0.64 PA4740_pnp_at (SEQ ID No: 762) 100 0.194 None 0.05 Down
77 -3.45 -3.4 0.74 PA3907_at (SEQ ID No: 763) 100 0.158 None 0.05
Down 55 -3.26 -3.39 0.72 PA2960_pilZ_at (SEQ ID No: 764) 100 0.079
None 0.05 Down 66 -3.48 -3.38 0.84 PA4425_at (SEQ ID No: 765) 100
0.111 None 0.05 Down 55 -3.46 -3.37 0.82 PA5068_tatA_at (SEQ ID No:
766) 100 0.159 None 0.05 Down 55 -3.37 -3.37 0.76 PA3686_adk_at
(SEQ ID No: 767) 100 0.177 None 0.05 Down 88 -3.73 -3.37 0.88
PA4759_dapB_at (SEQ ID No: 768) 100 0.043 Down 0.05 Down 77 -3.38
-3.36 0.83 PA4292_at (SEQ ID No: 769) 100 0.155 None 0.05 Down 77
-3.41 -3.36 0.94 PA1552_at (SEQ ID No: 770) 100 0.024 Down 0.05
Down 88 -3.55 -3.36 0.87 PA5143_hisB_at (SEQ ID No: 771) 100 0.03
Down 0.05 Down 66 -3.4 -3.35 0.78 PA3014_faoA_at (SEQ ID No: 772)
100 0.104 None 0.05 Down 66 -3.34 -3.35 0.73
PA1505_moaA2_at (SEQ ID No: 773) 100 0.082 None 0.05 Down 66 -3.3
-3.34 0.87 PA3981_at (SEQ ID No: 774) 100 0.038 Down 0.05 Down 77
-3.51 -3.34 0.91 PA2965_fabF1_at (SEQ ID No: 775) 100 0.265 None
0.05 Down 55 -3.33 -3.3 0.92 PA0857_bolA_at (SEQ ID No: 776) 100
0.103 None 0.05 Down 66 -3.36 -3.3 0.75 PA5315_rpmG_at (SEQ ID No:
777) 100 0.052 None 0.05 Down 77 -3.47 -3.3 0.87 PA3861_rhlB_at
(SEQ ID No: 778) 100 0.059 None 0.05 Down 66 -3.32 -3.28 0.85
Pae_tRNA_Asn_s_at (SEQ ID No: 779) 100 0.081 None 0.05 Down 55
-3.28 -3.27 0.79 PA3575_at (SEQ ID No: 780) 100 0.092 None 0.05
Down 88 -3.48 -3.27 0.88 PA1774_at (SEQ ID No: 781) 100 0.167 None
0.05 Down 55 -3.21 -3.26 0.73 PA4333_at (SEQ ID No: 782) 100 0.248
None 0.05 Down 66 -3.26 -3.25 0.91 PA2667_at (SEQ ID No: 783) 100
0.115 None 0.05 Down 66 -3.24 -3.24 0.65 PA2979_kdsB_at (SEQ ID No:
784) 100 0.065 None 0.05 Down 55 -3.36 -3.23 0.87 PA4006_at (SEQ ID
No: 785) 100 0.184 None 0.05 Down 66 -3.48 -3.23 1.07 PA1008_bcp_at
(SEQ ID No: 786) 100 0.032 Down 0.05 Down 66 -3.26 -3.22 0.72
PA4271_rplL_at (SEQ ID No: 787) 100 0.271 None 0.05 Down 66 -3.55
-3.22 1.02 PA3480_at (SEQ ID No: 788) 100 0.124 None 0.05 Down 77
-3.49 -3.22 1.04 PA4503_at (SEQ ID No: 789) 100 0.178 None 0.05
Down 77 -3.25 -3.22 0.72 PA5119_glnA_at (SEQ ID No: 790) 100 0.071
None 0.05 Down 88 -3.32 -3.22 0.68 PA5054_hslU_at (SEQ ID No: 791)
100 0.088 None 0.05 Down 100 -3.5 -3.22 0.83 PA2950_at (SEQ ID No:
792) 100 0.159 None 0.05 Down 55 -3.2 -3.21 0.65 PA1609_fabB_at
(SEQ ID No: 793) 100 0.054 None 0.05 Down 77 -3.23 -3.2 0.55
PA3637_pyrG_at (SEQ ID No: 794) 100 0.147 None 0.05 Down 88 -3.52
-3.2 0.86 PA5429_aspA_at (SEQ ID No: 795) 100 0.058 None 0.05 Down
77 -3.44 -3.19 0.72 PA5322_algC_at (SEQ ID No: 796) 100 0.084 None
0.05 Down 100 -3.5 -3.19 0.63 PA0429_at (SEQ ID No: 797) 100 0.148
None 0.05 Down 66 -3.49 -3.18 1.03 PA3369_at (SEQ ID No: 798) 100
0.079 None 0.05 Down 77 -3.3 -3.18 0.74 PA4559_lspA_at (SEQ ID No:
799) 100 0.279 None 0.05 Down 55 -3.28 -3.17 0.8 PA1659_at (SEQ ID
No: 800) 100 0.064 None 0.05 Down 77 -3.26 -3.17 0.56
PA0357_mutM_at (SEQ ID No: 801) 100 0.078 None 0.05 Down 55 -3.26
-3.16 0.72 PA5063_ubiE_at (SEQ ID No: 802) 100 0.024 Down 0.05 Down
100 -3.25 -3.16 0.74 PA0555_fda_at (SEQ ID No: 803) 100 0.094 None
0.05 Down 77 -3.21 -3.13 0.72 PA3440_at (SEQ ID No: 804) 100 0.121
None 0.05 Down 88 -3.38 -3.13 0.91 PA1009_at (SEQ ID No: 805) 100
0.077 None 0.05 Down 55 -3.14 -3.12 0.76 PA1010_dapA_at (SEQ ID No:
806) 100 0.114 None 0.05 Down 66 -3.41 -3.12 0.7 PA3626_at (SEQ ID
No: 807) 100 0.094 None 0.05 Down 55 -3.16 -3.1 0.66 PA1462_at (SEQ
ID No: 808) 100 0.131 None 0.05 Down 77 -3.23 -3.1 0.75
PA4264_rpsJ_at (SEQ ID No: 809) 100 0.301 None 0.05 Down 55 -3.69
-3.09 1.31 PA5078_at (SEQ ID No: 810) 100 0.081 None 0.05 Down 100
-3.34 -3.09 0.78 PA0766_mucD_at (SEQ ID No: 811) 100 0.1 None 0.05
Down 66 -3.14 -3.08 0.64 PA1183_dctA_at (SEQ ID No: 812) 100 0.053
None 0.05 Down 77 -3.39 -3.08 0.88 PA5000_at (SEQ ID No: 813) 100
0.075 None 0.05 Down 55 -3.29 -3.07 1.1 PA3770_guaB_at (SEQ ID No:
814) 100 0.076 None 0.05 Down 66 -3.32 -3.07 0.76 PA5323_argB_at
(SEQ ID No: 815) 100 0.071 None 0.05 Down 66 -3.19 -3.07 0.76
PA5174_at (SEQ ID No: 816) 100 0.029 Down 0.05 Down 55 -3.18 -3.06
0.91 PA3171_ubiG_at (SEQ ID No: 817) 100 0.034 Down 0.05 Down 55
-3.25 -3.05 0.65 PA1482_ccmH_at (SEQ ID No: 818) 100 0.099 None
0.05 Down 55 -3.34 -3.04 0.79 PA2646_nuoK_at (SEQ ID No: 819) 100
0.225 None 0.05 Down 55 -3.25 -3.04 0.9 PA2612_serS_at (SEQ ID No:
820) 100 0.228 None 0.05 Down 66 -3.29 -3.03 0.75 PA0527_dnr_at
(SEQ ID No: 821) 100 0.164 None 0.05 Down 88 -3.13 -3.03 0.64
PA1660_at (SEQ ID No: 822) 100 0.024 Down 0.05 Down 77 -3.4 -3.02
0.67 PA3962_at (SEQ ID No: 823) 100 0.01 Down 0.05 Down 77 -3.35
-3.02 0.79 PA3031_at (SEQ ID No: 824) 100 0.073 None 0.05 Down 88
-3.28 -3.02 0.79 PA2780_at (SEQ ID No: 825) 100 0.07 None 0.05 Down
88 -3.37 -2.99 0.88 PA2649_nuoN_at (SEQ ID No: 826) 100 0.101 None
0.05 Down 55 -3.25 -2.98 0.75 PA2644_nuoI_at (SEQ ID No: 827) 100
0.092 None 0.05 Down 66 -3.12 -2.97 0.62 PA0730_at (SEQ ID No: 828)
100 0.128 None 0.05 Down 66 -3.23 -2.94 0.93 PA4403_secA_at (SEQ ID
No: 829) 100 0.058 None 0.05 Down 66 -3.13 -2.93 0.79
PA3476_rhlL_at (SEQ ID No: 830) 100 0.029 Down 0.05 Down 100 -3.29
-2.93 0.73 PA3286_at (SEQ ID No: 831) 100 0.018 Down 0.05 Down 66
-3.22 -2.92 0.87 PA2980_at (SEQ ID No: 832) 100 0.058 None 0.05
Down 66 -3.16 -2.91 0.8 PA1642_selD_at (SEQ ID No: 833) 100 0.006
Down 0.05 Down 55 -3.03 -2.9 0.66 PA0537_at (SEQ ID No: 834) 100
0.061 None 0.05 Down 66 -3.12 -2.9 0.75 PA3524_gloA1_at (SEQ ID No:
835) 100 0.07 None 0.05 Down 77 -3.2 -2.9 0.79 PA5134_at (SEQ ID
No: 836) 100 0.023 Down 0.05 Down 55 -3.12 -2.89 0.79
PA5038_aroB_at (SEQ ID No: 837) 100 0.044 Down 0.05 Down 66 -3.18
-2.89 0.7 PA5076_at (SEQ ID No: 838) 100 0.114 None 0.05 Down 66
-3.19 -2.89 0.78 PA2528_at (SEQ ID No: 839) 100 0.024 Down 0.05
Down 55 -3.11 -2.88 0.77 PA1504_at (SEQ ID No: 840) 100 0.146 None
0.05 Down 66 -3.11 -2.88 0.79 PA1102_fliG_at (SEQ ID No: 841) 100
0.136 None 0.05 Down 55 -3.13 -2.87 0.81 PA1421_speB2_at (SEQ ID
No: 842) 100 0.089 None 0.05 Down 88 -3.18 -2.87 0.79
PA0582_folB_at (SEQ ID No: 843) 100 0.036 Down 0.05 Down 55 -3.21
-2.86 0.87 PA4411_murC_at (SEQ ID No: 844) 100 0.019 Down 0.05 Down
55 -3.11 -2.86 0.86 PA4054_ribB_at (SEQ ID No: 845) 100 0.031 Down
0.05 Down 55 -3.05 -2.84 0.59 PA1677_at (SEQ ID No: 846) 100 0.108
None 0.05 Down 55 -3.07 -2.84 0.73 PA5224_pepP_at (SEQ ID No: 847)
100 0.06 None 0.05 Down 55 -3.06 -2.84 0.62 PA0943_at (SEQ ID No:
848) 100 0.164 None 0.05 Down 55 -3.01 -2.82 0.78 PA1420_at (SEQ ID
No: 849) 100 0.058 None 0.05 Down 66 -3.15 -2.81 0.69 PA5064_at
(SEQ ID No: 850) 100 0.059 None 0.05 Down 66 -3.13 -2.81 0.86
PA4423_at (SEQ ID No: 851) 100 0.075 None 0.05 Down 55 -3 -2.79
0.72 PA3566_at (SEQ ID No: 852) 100 0.012 Down 0.05 Down 88 -3.06
-2.78 0.61 PA0900_at (SEQ ID No: 853) 100 0.055 None 0.05 Down 66
-3.02 -2.77 0.7 PA2953_at (SEQ ID No: 854) 100 0.072 None 0.05 Down
55 -3.09 -2.74 0.86 PA5344_at (SEQ ID No: 855) 100 0.07 None 0.05
Down 55 -3.02 -2.74 0.66 PA4345_at (SEQ ID No: 856) 100 0.097 None
0.05 Down 55 -2.95 -2.73 0.6 PA3262_at (SEQ ID No: 857) 100 0.06
None 0.05 Down 55 -3.04 -2.68 0.62 PA5227_at (SEQ ID No: 858) 100
0.193 None 0.05 Down 55 -2.98 -2.68 0.74 PA0083_at (SEQ ID No: 859)
100 0.023 Down 0.05 Down 55 -3.07 -2.65 0.79 PA2379_at (SEQ ID No:
860) 100 0.048 Down 0.05 Down 77 -3.18 -2.64 0.86 PA5479_gltP_at
(SEQ ID No: 861) 100 0.139 None 0.05 Down 55 -3.05 -2.62 0.93
PA2322_at (SEQ ID No: 862) 100 0.168 None 0.05 Down 77 -3.07 -2.62
0.88 Description PA4243 /GENE = secY /DEF = secretion protein SecY
/FUNCTION = Membrane proteins; Protein secretion/export apparatus
(SEQ ID No: 639) PA4242/GENE = rpmJ /DEF = 50S ribosomal protein
L36 /FUNCTION = Translation, post-translational modification,
degradation (SEQ ID No: 640) PA5049/GENE = rpmE /DEF = 50S
ribosomal protein L31 /FUNCTION = Translation, post-translational
modification, degradation (SEQ ID No: 641) PA3745/GENE = rpsP /DEF
= 30S ribosomal protein S16 /FUNCTION = Translation,
post-translational modification, degradation; DNA replication,
recombination, modification and repair (SEQ ID No: 642) PA3744
/GENE = rimM /DEF = 16S rRNA processing protein /FUNCTION =
Transcription, RNA processing and degradation (SEQ ID No: 643)
PA4568/GENE = rplU /DEF = 50S ribosomal protein L21 /FUNCTION =
Translation, post-translational modification, degradation (SEQ ID
No: 644) PA2966/GENE = acpP /DEF = acyl carrier protein /FUNCTION =
Fatty acid and phospholipid metabolism (SEQ ID No: 645) PA0492/DEF
= conserved hypothetical protein /FUNCTION = Hypothetical,
unclassified, unknown (SEQ ID No: 646) PA4563/GENE = rpsT /DEF =
30S ribosomal protein S20 /FUNCTION = Translation,
post-translational modification, degradation; Central intermediary
metabolism (SEQ ID No: 647) PA4245/GENE = rpmD /DEF = 50S ribosomal
protein L30 /FUNCTION = Translation, post-translational
modification, degradation (SEQ ID No: 648) PA3656/GENE = rpsB /DEF
= 30S ribosomal protein S2 /FUNCTION = Translation,
post-translational modification, degradation (SEQ ID No: 649)
PA2971/DEF = conserved hypothetical protein /FUNCTION =
Hypothetical, unclassified, unknown (SEQ ID No: 650) PA4433 /GENE =
rplM /DEF = 50S ribosomal protein L13 /FUNCTION = Translation,
post-translational modification, degradation (SEQ ID No: 651)
PA5570/GENE = rpmH /DEF = 50S ribosomal protein L34 /FUNCTION =
Central intermediary metabolism; Translation, post-translational
modification, degradation (SEQ ID No: 652) PA4240/GENE = rpsK /DEF
= 30S ribosomal protein S11 /FUNCTION = Translation,
post-translational modification, degradation (SEQ ID No: 653)
PA4239/GENE = rpsD /DEF = 30S ribosomal protein S4 /FUNCTION =
Translation, post-translational modification, degradation (SEQ ID
No: 654) PA4262/GENE = rplD /DEF = 50S ribosomal protein L4
/FUNCTION = Transcription, RNA processing and degradation;
Translation, post-translational modification, degradation (SEQ ID
No: 655) PA4268 /GENE = rpsL /DEF = 30S ribosomal protein S12
/FUNCTION = Translation, post-translational modification,
degradation (SEQ ID No: 656) PA4247/GENE = rplR /DEF = 50S
ribosomal protein L18 /FUNCTION = Translation, post-translational
modification, degradation (SEQ ID No: 657) PA4263/GENE = rplC /DEF
= 50S ribosomal protein L3 /FUNCTION = Translation,
post-translational modification, degradation (SEQ ID No: 658)
PA3162/GENE = rpsA /DEF = 30S ribosomal protein S1 /FUNCTION =
Translation, post-translational modification, degradation (SEQ ID
No: 659) PA5316/GENE = rpmB /DEF = 50S ribosomal protein L28
/FUNCTION = Translation, post-translational modification,
degradation (SEQ ID No: 660) tRNA_Glutamine, 5238277-5238351 (+)
strand (SEQ ID No: 661) PA4671/DEF = probable ribosomal protein L25
/FUNCTION = Adaptation, protection; Translation, post-translational
modification, degradation (SEQ ID No: 662) PA4272/GENE = rplJ /DEF
= 50S ribosomal protein L10 /FUNCTION = Translation,
post-translational modification, degradation (SEQ ID No: 663)
PA2619/GENE = infA /DEF = initiation factor /FUNCTION =
Translation, post-translational modification, degradation (SEQ ID
No: 664) PA4241/GENE = rpsM /DEF = 30S ribosomal protein S13
/FUNCTION = Translation, post-translational modification,
degradation (SEQ ID No: 665) PA4482/GENE = gatC /DEF = Glu-tRNA
(Gln) amidotransferase subunit C /FUNCTION = Translation,
post-translational modification, degradation (SEQ ID No: 666)
PA2743/GENE = infC /DEF = translation initiation factor IF-3
/FUNCTION = Translation, post-translational modification,
degradation (SEQ ID No: 667) PA3742/GENE = rplS /DEF = 50S
ribosomal protein L19 /FUNCTION = Translation, post-translational
modification, degradation (SEQ ID No: 668) PA5491/DEF = probable
cytochrome /FUNCTION = Energy metabolism (SEQ ID No: 669)
PA4238/GENE = rpoA /DEF = DNA-directed RNA polymerase alpha chain
/FUNCTION = Transcription, RNA processing and degradation (SEQ ID
No: 670) PA2321/DEF = gluconokinase /FUNCTION = Carbon compound
catabolism; Energy metabolism (SEQ ID No: 671) PA5276 /GENE = lppL
/DEF = lipopeptide LppL precursor /FUNCTION = Cell wall/LPS/capsule
(SEQ ID No: 672) PA3743/GENE = trmD /DEF = tRNA
(guanine-N1)-methyltransferase /FUNCTION = Transcription, RNA
processing and degradation (SEQ ID No: 673) PA2639/GENE = nuoD /DEF
= NADH dehydrogenase I chain C, D /FUNCTION = Energy metabolism
(SEQ ID No: 674) PA1800/GENE = tig /DEF = trigger factor /FUNCTION
= Cell division; Chaperones & heat shock proteins (SEQ ID No:
675) PA5555/GENE = atpG /DEF = ATP synthase gamma chain /FUNCTION =
Energy metabolism (SEQ ID No: 676) PA2970/GENE = rpmF /DEF = 50S
ribosomal protein L32 /FUNCTION = Translation, post-translational
modification, degradation (SEQ ID No: 677) PA1582/GENE = sdhD /DEF
= succinate dehydrogenase (D subunit) /FUNCTION = Energy metabolism
(SEQ ID No: 678) PA4246/GENE = rpsE /DEF = 30S ribosomal protein S5
/FUNCTION = Translation, post-translational modification,
degradation (SEQ ID No: 679) PA0579/GENE = rpsU /DEF = 30S
ribosomal protein S21 /FUNCTION = Hypothetical, unclassified,
unknown (SEQ ID No: 680) PA2634/DEF = probable isocitrate lyase
/FUNCTION = Putative enzymes (SEQ ID No: 681) PA1581/GENE = sdhC
/DEF = succinate dehydrogenase (C subunit) /FUNCTION = Energy
metabolism (SEQ ID No: 682) PA5557/GENE = atpH /DEF = ATP synthase
delta chain /FUNCTION = Energy metabolism (SEQ ID No: 683)
tRNA_Glycine, 4785688-4785761 (-) strand (SEQ ID No: 684)
PA5298/DEF = xanthine phosphoribosyltransferase /FUNCTION =
Nucleotide biosynthesis and metabolism (SEQ ID No: 685) PA4846/GENE
= aroQ1 /DEF = 3-dehydroquinate dehydratase /FUNCTION = Amino acid
biosynthesis and metabolism (SEQ ID No: 686) PA0493/DEF = probable
biotin-requiring enzyme /FUNCTION = Putative enzymes (SEQ ID No:
687) PA3266/GENE = capB /DEF = cold acclimation protein B /FUNCTION
= Adaptation, protection; Transcriptional regulators (SEQ ID No:
688) PA4267/GENE = rpsG /DEF = 30S ribosomal protein S7 /FUNCTION =
Translation, post-translational modification, degradation (SEQ ID
No: 689) PA4748/GENE = tpiA /DEF = triosephosphate isomerase
/FUNCTION = Central intermediary metabolism; Energy metabolism (SEQ
ID No: 690) PA4847/GENE = accB /DEF = biotin carboxyl carrier
protein (BCCP) /FUNCTION = Fatty acid and phospholipid metabolism
(SEQ ID No: 691) tRNA_Valine, 3650815-3650890 (-) strand (SEQ ID
No: 692) PA4249/GENE = rpsH /DEF = 30S ribosomal protein S8
/FUNCTION = Translation, post-translational modification,
degradation (SEQ ID No: 693) PA0856/DEF = hypothetical protein
/FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No: 694)
PA5569/GENE = rnpA /DEF = ribonuclease P protein component
/FUNCTION = Translation, post-translational modification,
degradation (SEQ ID No: 695) PA0896/GENE = aruF /DEF =
arginine/ornithine succinyltransferase Al subunit /FUNCTION = Amino
acid biosynthesis and metabolism (SEQ ID No: 696) PA4430/DEF =
probable cytochrome b /FUNCTION = Energy metabolism (SEQ ID No:
697) PA4935/GENE = rpsF /DEF = 30S ribosomal protein S6 /FUNCTION =
Translation, post-translational modification, degradation (SEQ ID
No: 698) PA4031/GENE = ppa /DEF = inorganic pyrophosphatase
/FUNCTION = Central intermediary metabolism (SEQ ID No: 699)
PA2744/GENE = thrS /DEF = threonyl-tRNA synthetase /FUNCTION =
Amino acid biosynthesis and metabolism; Translation,
post-translational modification, degradation (SEQ ID No: 700)
PA4942/GENE = hflK /DEF = protease subunit HflK /FUNCTION = Cell
division; Translation, post-translational modification, degradation
(SEQ ID No: 701) PA1557/DEF = probable cytochrome oxidase subunit
(cbb3-type) /FUNCTION = Energy metabolism (SEQ ID No: 702)
PA4406/GENE = lpxC /DEF = UDP-3-O-acyl-N-acetylglucosamine
deacetylase /FUNCTION = Cell wall / LPS / capsule (SEQ ID No: 703)
PA3621/GENE = fdxA /DEF = ferredoxin I /FUNCTION = Energy
metabolism (SEQ ID No: 704) PA3644/GENE = lpxA /DEF =
UDP-N-acetylglucosamine acyltransferase /FUNCTION = Cell wall / LPS
/ capsule (SEQ ID No: 705) PA4053/GENE = ribE /DEF =
6,7-dimethyl-8-ribityllumazine synthase /FUNCTION = Biosynthesis of
cofactors, prosthetic groups and carriers (SEQ ID No: 706)
PA4276/GENE = secE /DEF = secretion protein SecE /FUNCTION =
Protein secretion/export apparatus (SEQ ID No: 707) PA3811/GENE =
hscB /DEF = heat shock protein HscB /FUNCTION = Chaperones &
heat shock proteins (SEQ ID No: 708) PA3645/GENE = fabZ /DEF =
(3R)-hydroxymyristoyl-[acyl carrier protein] dehydratase /FUNCTION
= Cell wall / LPS / capsule; Fatty acid and phospholipid metabolism
(SEQ ID No: 709) PA4431/DEF = probable iron-sulfur protein
/FUNCTION = Putative enzymes (SEQ ID No: 710) PA1156/GENE = nrdA
/DEF = ribonucleoside reductase, large chain /FUNCTION = Nucleotide
biosynthesis and metabolism (SEQ ID No: 711) PA4762/GENE = grpE
/DEF = heat shock protein GrpE /FUNCTION = DNA replication,
recombination, modification and repair; Chaperones & heat shock
proteins (SEQ ID No: 712) PA3159/GENE = wbpA /DEF = probable
UDP-glucose/GDP-mannose dehydrogenase WbpA /FUNCTION = Cell wall /
LPS / capsule; Putative enzymes (SEQ ID No: 713) PA4944/DEF =
conserved hypothetical protein /FUNCTION = Hypothetical,
unclassified, unknown (SEQ ID No: 714) PA3636/GENE = kdsA /DEF =
2-dehydro-3-deoxyphosphooctonate aldolase /FUNCTION = Energy
metabolism; Translation, post-translational modification,
degradation; Carbon compound catabolism (SEQ ID No: 715)
PA4261/GENE = rplW /DEF = 50S ribosomal protein L23 /FUNCTION =
Translation, post-translational modification, degradation (SEQ ID
No: 716) PA4252/GENE = rplX /DEF = 50S ribosomal protein L24
/FUNCTION = Translation, post-translational modification,
degradation (SEQ ID No: 717) PA4745/GENE = nusA /DEF = N
utilization substance protein A /FUNCTION = Transcription, RNA
processing and degradation (SEQ ID No: 718) PA3635/GENE = eno /DEF
= enolase /FUNCTION = Energy metabolism; Translation,
post-translational modification, degradation; Carbon compound
catabolism (SEQ ID No: 719) PA0336/DEF = conserved hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No:
720) Intergenic region between PA4674 and PA4675, 5207621-5208463,
(+) strand (SEQ ID No: 721) PA5558/GENE = atpF /DEF = ATP synthase
B chain /FUNCTION = Energy metabolism (SEQ ID No: 722) PA2968/GENE
= fabD /DEF = malonyl-CoA-[acyl-carrier-protein] transacylase
/FUNCTION = Fatty acid and phospholipid metabolism (SEQ ID No: 723)
PA3832/GENE = holC /DEF = DNA polymerase III, chi subunit /FUNCTION
= DNA replication, recombination, modification and repair (SEQ ID
No: 724) PA4483/GENE = gatA /DEF = Glu-tRNA (Gln) amidotransferase
subunit A /FUNCTION = Translation, post-translational modification,
degradation (SEQ ID No: 725) PA2747/DEF = hypothetical protein
/FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No: 726)
tRNA_Histidine, 1947729-1947804 (+) strand (SEQ ID No: 727)
PA2624/GENE = idh /DEF = isocitrate dehydrogenase /FUNCTION =
Energy metabolism (SEQ ID No: 728) PA2453/DEF = hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No:
729) PA4258/GENE = rplV /DEF = 50S ribosomal protein L22 /FUNCTION
= Translation, post-translational modification, degradation (SEQ ID
No: 730) PA4743/GENE = rbfA /DEF = ribosome-binding factor A
/FUNCTION = Adaptation, protection; Translation, post-translational
modification, degradation (SEQ ID No: 731) PA1533/DEF = conserved
hypothetical protein /FUNCTION = Hypothetical, unclassified,
unknown (SEQ ID No: 732) PA1123/DEF = hypothetical protein
/FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No: 733)
PA5490/GENE = cc4 /DEF = cytochrome c4 precursor /FUNCTION = Energy
metabolism (SEQ ID No: 734) PA3001/DEF = probable
glyceraldehyde-3-phosphate dehydrogenase /FUNCTION = Putative
enzymes (SEQ ID No: 735) PA1013/GENE = purC /DEF =
phosphoribosylaminoimidazole-succinocarboxamide synthase /FUNCTION
= Nucleotide biosynthesis and metabolism (SEQ ID No: 736)
PA3987/GENE = leuS /DEF = leucyl-tRNA synthetase /FUNCTION = Amino
acid biosynthesis and metabolism; Translation, post-translational
modification, degradation (SEQ ID No: 737) PA4761/GENE = dnaK /DEF
= DnaK protein /FUNCTION = Adaptation, protection; Chaperones &
heat shock proteins; DNA replication, recombination, modification
and repair (SEQ ID No: 738) PA3701/GENE = prfB /DEF = peptide chain
release factor 2 /FUNCTION = Translation, post-translational
modification, degradation (SEQ ID No: 739) PA5128/GENE = secB /DEF
= secretion protein SecB /FUNCTION = Protein secretion/export
apparatus (SEQ ID No: 740) PA4253/GENE = rplN /DEF = 50S ribosomal
protein L14 /FUNCTION = Translation, post-translational
modification, degradation (SEQ ID No: 741) PA4386 /GENE = groES
/DEF = GroES protein /FUNCTION = Chaperones & heat shock
proteins (SEQ ID No: 742) PA5067/GENE = hisE /DEF =
phosphoribosyl-ATP pyrophosphohydrolase /FUNCTION = Amino acid
biosynthesis and metabolism (SEQ ID No: 743) PA4880/DEF = probable
bacterioferritin /FUNCTION = Central intermediary metabolism (SEQ
ID No: 744) PA1610/GENE = fabA /DEF = beta-hydroxydecanoyl-ACP
dehydrase /FUNCTION = Fatty acid and phospholipid metabolism (SEQ
ID No: 745) PA3807/GENE = ndk /DEF = nucleoside diphosphate kinase
/FUNCTION = Nucleotide biosynthesis and metabolism (SEQ ID No: 746)
PA4266/GENE = fusA1 /DEF = elongation factor G /FUNCTION =
Translation, post-translational modification, degradation (SEQ ID
No: 747) PA0972/GENE = tolB /DEF = TolB protein /FUNCTION =
Transport of small molecules (SEQ ID No: 748) PA4232/GENE = ssb
/DEF = single-stranded DNA-binding protein /FUNCTION = DNA
replication, recombination, modification and repair (SEQ ID No:
749) PA3700/GENE = lysS /DEF = lysyl-tRNA synthetase /FUNCTION =
Amino acid biosynthesis and metabolism; Translation,
post-translational modification, degradation (SEQ ID No: 750)
PA4460/DEF = conserved hypothetical protein /FUNCTION =
Hypothetical, unclassified, unknown (SEQ ID No: 751) PA5069/GENE =
tatB /DEF = translocation protein TatB /FUNCTION = Protein
secretion/export apparatus (SEQ ID No: 752) PA4853/GENE = fis /DEF
= DNA-binding protein Fis /FUNCTION = DNA replication,
recombination, modification and repair; Transcriptional regulators
(SEQ ID No: 753) PA0019/GENE = def /DEF = polypeptide deformylase
/FUNCTION = Translation, post-translational modification,
degradation (SEQ ID No: 754) PA0595/GENE = ostA /DEF = organic
solvent tolerance protein OstA precursor /FUNCTION = Adaptation,
protection (SEQ ID No: 755) PA4848/GENE = accC /DEF = biotin
carboxylase /FUNCTION = Fatty acid and phospholipid metabolism (SEQ
ID No: 756) PA1580/GENE = gltA /DEF = citrate synthase /FUNCTION =
Energy metabolism (SEQ ID No: 757) PA4259/GENE = rpsS /DEF = 30S
ribosomal protein S19 /FUNCTION = Translation, post-translational
modification, degradation (SEQ ID No: 758) PA2976/GENE = rne /DEF =
ribonuclease E /FUNCTION = Transcription, RNA processing and
degradation (SEQ ID No: 759) PA1574/DEF = conserved hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No:
760) PA2023 /GENE = galU /DEF = UTP--glucose-1-phosphate
uridylyltransferase /FUNCTION = Central intermediary metabolism
(SEQ ID No: 761) PA4740/GENE = pnp /DEF = polyribonucleotide
nucleotidyltransferase /FUNCTION = Transcription, RNA processing
and degradation (SEQ ID No: 762) PA3907/DEF = hypothetical protein
/FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No: 763)
PA2960/GENE = pilZ /DEF = type 4 fimbrial biogenesis protein PilZ
/FUNCTION = Motility & Attachment (SEQ ID No: 764) PA4425/DEF =
probable phosphoheptose isomerase /FUNCTION = Putative enzymes (SEQ
ID No: 765) PA5068/GENE = tatA /DEF = translocation protein TatA
/FUNCTION = Protein secretion/export apparatus (SEQ ID No: 766)
PA3686/GENE = adk /DEF = adenylate kinase /FUNCTION = Nucleotide
biosynthesis and metabolism (SEQ ID No: 767) PA4759/GENE = dapB
/DEF = dihydrodipicolinate reductase /FUNCTION = Amino acid
biosynthesis and metabolism (SEQ ID No: 768) PA4292/DEF = probable
phosphate transporter /FUNCTION = Membrane proteins; Transport of
small molecules (SEQ ID No: 769) PA1552/DEF = probable cytochrome c
/FUNCTION = Energy metabolism (SEQ ID No: 770) PA5143/GENE = hisB
/DEF = imidazoleglycerol-phosphate dehydratase /FUNCTION = Amino
acid biosynthesis and metabolism (SEQ ID No: 771) PA3014/GENE =
faoA /DEF = fatty-acid oxidation complex alpha-subunit /FUNCTION =
Amino acid biosynthesis and metabolism; Fatty acid and phospholipid
metabolism (SEQ ID No: 772) PA1505/GENE = moaA2 /DEF =
molybdopterin biosynthetic protein A2 /FUNCTION = Biosynthesis of
cofactors, prosthetic groups and carriers (SEQ ID No: 773)
PA3981/DEF = conserved hypothetical protein /FUNCTION =
Hypothetical, unclassified, unknown (SEQ ID No: 774) PA2965 /GENE =
fabF1 /DEF = beta-ketoacyl-acyl carrier protein synthase II
/FUNCTION = Fatty acid and phospholipid metabolism (SEQ ID No: 775)
PA0857/GENE = bolA /DEF = morphogene protein BolA /FUNCTION = Cell
division (SEQ ID No: 776) PA5315/GENE = rpmG /DEF = 50S ribosomal
protein L33 /FUNCTION = Translation, post-translational
modification, degradation (SEQ ID No: 777) PA3861/GENE = rhlB /DEF
= ATP-dependent RNA helicase RhlB /FUNCTION = Transcription, RNA
processing and degradation (SEQ ID No: 778) tRNA_Asparagine,
3524012-3524087 (+) strand (SEQ ID No: 779) PA3575/DEF =
hypothetical protein /FUNCTION = Hypothetical, unclassified,
unknown; Membrane proteins (SEQ ID No: 780) PA1774 /DEF =
hypothetical protein /FUNCTION = Hypothetical, unclassified,
unknown; Membrane proteins (SEQ ID No: 781) PA4333/DEF = probable
fumarase /FUNCTION = Energy metabolism (SEQ ID No: 782) PA2667/DEF
= conserved hypothetical protein /FUNCTION = Transcriptional
regulators (SEQ ID No: 783) PA2979/GENE = kdsB /DEF =
3-deoxy-manno-octulosonate cytidylyltransferase /FUNCTION = Cell
wall / LPS / capsule (SEQ ID No: 784) PA4006/DEF = hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No:
785) PA1008/GENE = bcp /DEF = bacterioferritin comigratory protein
/FUNCTION = Adaptation, protection (SEQ ID No: 786) PA4271/GENE =
rplL /DEF = 50S ribosomal protein L7 / L12 /FUNCTION = Translation,
post-translational modification, degradation (SEQ ID No: 787)
PA3480/DEF = probable deoxycytidine triphosphate deaminase
/FUNCTION = Nucleotide biosynthesis and metabolism (SEQ ID No: 788)
PA4503/DEF = probable permease of ABC transporter /FUNCTION =
Membrane proteins; Transport of small molecules (SEQ ID No: 789)
PA5119/GENE = glnA /DEF = glutamine synthetase /FUNCTION = Amino
acid biosynthesis and metabolism (SEQ ID No: 790) PA5054/GENE =
hslU /DEF = heat shock protein HslU /FUNCTION = Chaperones &
heat shock proteins (SEQ ID No: 791) PA2950/DEF = hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No:
792) PA1609/GENE = fabB /DEF = beta-ketoacyl-ACP synthase I
/FUNCTION = Fatty acid and phospholipid metabolism (SEQ ID No: 793)
PA3637/GENE = pyrG /DEF = CTP synthase /FUNCTION = Nucleotide
biosynthesis and metabolism (SEQ ID No: 794) PA5429/GENE = aspA
/DEF = aspartate ammonia-lyase /FUNCTION = Amino acid biosynthesis
and metabolism (SEQ ID No: 795)
PA5322/GENE = algC /DEF = phosphomannomutase AlgC /FUNCTION = Amino
acid biosynthesis and metabolism; Cell wall / LPS / capsule;
Secreted Factors (toxins, enzymes, alginate) (SEQ ID No: 796)
PA0429/DEF = hypothetical protein /FUNCTION = Hypothetical,
unclassified, unknown (SEQ ID No: 797) PA3369/DEF = hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown; Membrane
proteins (SEQ ID No: 798) PA4559/GENE = lspA /DEF = prolipoprotein
signal peptidase /FUNCTION = Protein secretion/export apparatus;
Translation, post-translational modification, degradation (SEQ ID
No: 799) PA1659/DEF = hypothetical protein /FUNCTION =
Hypothetical, unclassified, unknown (SEQ ID No: 800) PA0357/GENE =
mutM /DEF = formamidopyrimidine-DNA glycosylase /FUNCTION = DNA
replication, recombination, modification and repair (SEQ ID No:
801) PA5063/GENE = ubiE /DEF = ubiquinone biosynthesis
methyltransferase UbiE /FUNCTION = Biosynthesis of cofactors,
prosthetic groups and carriers; Energy metabolism (SEQ ID No: 802)
PA0555/GENE = fda /DEF = fructose-1,6-bisphosphate aldolase
/FUNCTION = Carbon compound catabolism; Central intermediary
metabolism (SEQ ID No: 803) PA3440/DEF = conserved hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No:
804) PA1009/DEF = hypothetical protein /FUNCTION = Hypothetical,
unclassified, unknown (SEQ ID No: 805) PA1010 /GENE = dapA /DEF =
dihydrodipicolinate synthase /FUNCTION = Amino acid biosynthesis
and metabolism (SEQ ID No: 806) PA3626/DEF = conserved hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No:
807) PA1462/DEF = probable plasmid partitioning protein /FUNCTION =
Cell division (SEQ ID No: 808) PA4264/GENE = rpsJ /DEF = 30S
ribosomal protein S10 /FUNCTION = Translation, post-translational
modification, degradation; Transcription, RNA processing and
degradation (SEQ ID No: 809) PA5078/DEF = conserved hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No:
810) PA0766/GENE = mucD /DEF = serine protease MucD precursor
/FUNCTION = Cell wall / LPS / capsule; Putative enzymes; Secreted
Factors (toxins, enzymes, alginate) (SEQ ID No: 811) PA1183/GENE =
dctA /DEF = C4-dicarboxylate transport protein /FUNCTION =
Transport of small molecules (SEQ ID No: 812) PA5000/DEF = probable
glycosyl transferase /FUNCTION = Putative enzymes (SEQ ID No: 813)
PA3770/GENE = guaB /DEF = inosine-5-monophosphate dehydrogenase
/FUNCTION = Nucleotide biosynthesis and metabolism (SEQ ID No: 814)
PA5323/GENE = argB /DEF = acetylglutamate kinase /FUNCTION = Amino
acid biosynthesis and metabolism (SEQ ID No: 815) PA5174/DEF =
probable beta-ketoacyl synthase /FUNCTION = Fatty acid and
phospholipid metabolism (SEQ ID No: 816) PA3171/GENE = ubiG /DEF =
3-demethylubiquinone-9 3-methyltransferase /FUNCTION = Biosynthesis
of cofactors, prosthetic groups and carriers; Energy metabolism
(SEQ ID No: 817) PA1482/GENE = ccmH /DEF = cytochrome C-type
biogenesis protein CcmH /FUNCTION = Energy metabolism (SEQ ID No:
818) PA2646/GENE = nuoK /DEF = NADH dehydrogenase I chain K
/FUNCTION = Energy metabolism (SEQ ID No: 819) PA2612/GENE = serS
/DEF = seryl-tRNA synthetase /FUNCTION = Amino acid biosynthesis
and metabolism; Translation, post-translational modification,
degradation (SEQ ID No: 820) PA0527/GENE = dnr /DEF =
transcriptional regulator Dnr /FUNCTION = Transcriptional
regulators (SEQ ID No: 821) PA1660/DEF = hypothetical protein
/FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No: 822)
PA3962/DEF = hypothetical protein /FUNCTION = Hypothetical,
unclassified, unknown (SEQ ID No: 823) PA3031/DEF = hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No:
824) PA2780/DEF = hypothetical protein /FUNCTION = Hypothetical,
unclassified, unknown (SEQ ID No: 825) PA2649/GENE = nuoN /DEF =
NADH dehydrogenase I chain N /FUNCTION = Energy metabolism (SEQ ID
No: 826) PA2644/GENE = nuoI /DEF = NADH Dehydrogenase I chain I
/FUNCTION = Energy metabolism (SEQ ID No: 827) PA0730/DEF =
probable transferase /FUNCTION = Putative enzymes (SEQ ID No: 828)
PA4403/GENE = secA /DEF = secretion protein SecA /FUNCTION =
Protein secretion/export apparatus (SEQ ID No: 829) PA3476/GENE =
rhlL /DEF = autoinducer synthesis protein RhlL /FUNCTION =
Adaptation, protection (SEQ ID No: 830) PA3286 /DEF = hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No:
831) PA2980/DEF = conserved hypothetical protein /FUNCTION =
Hypothetical, unclassified, unknown (SEQ ID No: 832) PA1642/GENE =
selD /DEF = selenophosphate synthetase /FUNCTION = Translation,
post-translational modification, degradation (SEQ ID No: 833)
PA0537/DEF = conserved hypothetical protein /FUNCTION =
Hypothetical, unclassified, unknown (SEQ ID No: 834) PA3524/GENE =
gloA1 /DEF = lactoylglutathione lyase /FUNCTION = Central
intermediary metabolism (SEQ ID No: 835) PA5134/DEF = probable
carboxyl-terminal protease /FUNCTION = Translation,
post-translational modification, degradation (SEQ ID No: 836)
PA5038 /GENE = aroB /DEF = 3-dehydroquinate synthase /FUNCTION =
Amino acid biosynthesis and metabolism (SEQ ID No: 837) PA5076/DEF
= probable binding protein component of ABC transporter /FUNCTION =
Transport of small molecules (SEQ ID No: 838) PA2528/DEF = probable
RND efflux membrane fusion protein precursor /FUNCTION = Transport
of small molecules (SEQ ID No: 839) PA1504/DEF = probable
transcriptional regulator /FUNCTION = Transcriptional regulators
(SEQ ID No: 840) PA1102/GENE = fliG /DEF = flagellar motor switch
protein FliG /FUNCTION = Motility & Attachment; Cell wall / LPS
/ capsule (SEQ ID No: 841) PA1421/GENE = speB2 /DEF = agmatinase
/FUNCTION = Amino acid biosynthesis and metabolism (SEQ ID No: 842)
PA0582/GENE = folB /DEF = dihydroneopterin aldolase /FUNCTION =
Biosynthesis of cofactors, prosthetic groups and carriers (SEQ ID
No: 843) PA4411/GENE = murC /DEF = UDP-N-acetylmuramate--alanine
ligase /FUNCTION = Cell wall / LPS / capsule (SEQ ID No: 844)
PA4054/GENE = ribB /DEF = GTP cyclohydrolase
II/3,4-dihydroxy-2-butanone 4-phosphate synthase /FUNCTION =
Biosynthesis of cofactors, prosthetic groups and carriers (SEQ ID
No: 845) PA1677/DEF = conserved hypothetical protein /FUNCTION =
Hypothetical, unclassified, unknown (SEQ ID No: 846) PA5224/GENE =
pepP /DEF = aminopeptidase P /FUNCTION = Translation,
post-translational modification, degradation (SEQ ID No: 847)
PA0943/DEF = hypothetical protein /FUNCTION = Hypothetical,
unclassified, unknown (SEQ ID No: 848) PA1420/DEF = hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No:
849) PA5064/DEF = hypothetical protein /FUNCTION = Hypothetical,
unclassified, unknown (SEQ ID No: 850) PA4423/DEF = conserved
hypothetical protein /FUNCTION = Hypothetical, unclassified,
unknown (SEQ ID No: 851) PA3566/DEF = conserved hypothetical
protein /FUNCTION = Hypothetical, unclassified, unknown (SEQ ID No:
852) PA0900/DEF = hypothetical protein /FUNCTION = Hypothetical,
unclassified, unknown (SEQ ID No: 853) PA2953/DEF = electron
transfer flavoprotein-ubiquinone oxidoreductase /FUNCTION = Energy
metabolism (SEQ ID No: 854) PA5344/DEF = probable transcriptional
regulator /FUNCTION = Transcriptional regulators (SEQ ID No: 855)
PA4345/DEF = hypothetical protein /FUNCTION = Hypothetical,
unclassified, unknown (SEQ ID No: 856) PA3262/DEF = probable
peptidyl-prolyl cis-trans isomerase, FkbP-type /FUNCTION =
Translation, post-translational modification, degradation;
Chaperones & heat shock proteins (SEQ ID No: 857) PA5227/DEF =
conserved hypothetical protein /FUNCTION = Hypothetical,
unclassified, unknown (SEQ ID No: 858) PA0083/DEF = conserved
hypothetical protein /FUNCTION = Hypothetical, unclassified,
unknown (SEQ ID No: 859) PA2379/DEF = probable oxidoreductase
/FUNCTION = Putative enzymes (SEQ ID No: 860) PA5479/GENE = gltP
/DEF = proton-glutamate symporter /FUNCTION = Membrane proteins;
Transport of small molecules (SEQ ID No: 861) PA2322/DEF =
gluconate permease /FUNCTION = Transport of small molecules (SEQ ID
No: 862)
TABLE-US-00013 TABLE 8 % P flight- sig-Mann- Percent sig-T-Test
sig-Mann- Whitney sig-T- Change Whitney Change % I/MI- sig log
ratio- sig log ratio- Test P Value Direction P Value Direction
Percent Average Median PA0523_norC_at (SEQ ID No: 863) 100 0.191
None 0.05 Up 88 0.28 0.92 PA0524_norB_at (SEQ ID No: 864) 100 0.094
None 0.05 Up 88 -0.36 0.25
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20100290996A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20100290996A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References