Methods, Compositions, and Kits for Detecting Allelic Variants

Abstract

In some embodiments, the present inventions relates generally to compositions, methods and kits for use in discriminating sequence variation between different alleles. More specifically, in some embodiments, the present invention provides for compositions, methods and kits for quantitating rare (e.g., mutant) allelic variants, such as SNPs, or nucleotide (NT) insertions or deletions, in samples comprising abundant (e.g., wild type) allelic variants with high specificity and selectivity. In particular, in some embodiments, the invention relates to a highly selective method for mutation detection referred to as competitive allele-specific TaqMan PCR ("cast-PCR").

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] The present application is a continuation-in-part of U.S. application Ser. No. 12/641,321, filed Dec. 17, 2009 and claims the benefit of priority under 35 U.S.C. 119 to U.S. Provisional Application Nos. 61/258,582, filed Nov. 5, 2009; 61/253,501, filed Oct. 20, 2009; 61/251,623, filed Oct. 14, 2009; 61/186,775, filed Jun. 12, 2009; and 61/164,230, filed Mar. 27, 2009, all of which are incorporated herein by reference in their entireties.

BACKGROUND

[0002] Single nucleotide polymorphisms (SNPs) are the most common type of genetic diversity in the human genome, occurring at a frequency of about one SNP in 1,000 nucleotides or less in human genomic DNA (Kwok, P-Y, Ann Rev Genom Hum Genet 2001, 2: 235-258). SNPs have been implicated in genetic disorders, susceptibility to different diseases, predisposition to adverse reactions to drugs, and for use in forensic investigations. Thus, SNP (or rare mutation) detection provides great potentials in diagnosing early phase diseases, such as detecting circulating tumor cells in blood, for prenatal diagnostics, as well as for detection of disease-associated mutations in a mixed cell population.

[0003] Numerous approaches for SNP genotyping have been developed based on methods involving hybridization, ligation, or DNA polymerases (Chen, X., and Sullivan, P F, The Pharmacogeonomics Journal 2003, 3, 77-96.). For example, allele-specific polymerase chain reaction (AS-PCR) is a widely used strategy for detecting DNA sequence variation (Wu D Y, Ugozzoli L, Pal B K, Wallace R B., Proc Natl Acad Sci USA 1989; 86:2757-2760). AS-PCR, as its name implies, is a PCR-based method whereby one or both primers are designed to anneal at sites of sequence variations which allows for the ability to differentiate among different alleles of the same gene. AS-PCR exploits the fidelity of DNA polymerases, which extend primers with a mismatched 3' base at much lower efficiency, from 100 to 100,000 fold less efficient, than that with a matched 3' base (Chen, X., and Sullivan, P F, The Pharmacogeonomics Journal 2003; 3:77-96). The difficulty in extending mismatched primers results in diminished PCR amplification that can be readily detected.

[0004] The specificity and selectivity of AS-PCR, however, is largely dependent on the nature of exponential amplification of PCR which makes the decay of allele discriminating power rapid. Even though primers are designed to match a specific variant to selectively amplify only that variant, in actuality significant mismatched amplification often occurs. Moreover, the ability of AS-PCR to differentiate between allelic variants can be influenced by the type of mutation or the sequence surrounding the mutation or SNP (Ayyadevara S, Thaden J J, Shmookler Reis R J., Anal Biochem 2000; 284:11-18), the amount of allelic variants present in the sample, as well as the ratio between alternative alleles. Collectively, these factors are often responsible for the frequent appearance of false-positive results, leading many researchers to attempt to increase the reliability of AS-PCR (Orou A, Fechner B, Utermann G, Menzel H J., Hum Mutat 1995; 6:163-169) (Imyanitov E N, Busboy K G, Suspitsin E N, Kuligina E S, Belogubova E V, Grigoriev M Y, et al., Biotechniques 2002; 33:484-490) (McKinzie P B, Parsons B L. Detection of rare K-ras codon 12 mutations using allele-specific competitive blocker PCR. Mutat Res 2002; 517:209-220) (Latorra D, Campbell K, Wolter A, Hurley J M., Hum Mutat 2003; 22:79-85).

[0005] In some cases, the selectivity of AS-PCR has been increased anywhere from detection of 1 in 10 alleles to 1 in 100,000 alleles by using SNP-based PCR primers containing locked nucleic acids (LNAs) (Latorra, D., et al., Hum Mut 2003, 2:79-85; Nakiandwe, J. et al., Plant Method 2007, 3:2) or modified bases (Koizumi, M. et al. Anal Biochem. 2005, 340:287-294). However, these base "mimics" or modifications increase the overall cost of analysis and often require extensive optimization.

[0006] Another technology involving probe hybridization methods used for discriminating allelic variations is TaqMan.RTM. genotyping. However, like AS-PCR, selectivity using this method is limited and not suitable for detecting rare (1 in .gtoreq.1,000) alleles or mutations in a mixed sample.

SUMMARY

[0007] In some embodiments, the present inventions relates generally to compositions, methods and kits for use in discriminating sequence variation between different alleles. More specifically, in some embodiments, the present invention provides for compositions, methods and kits for quantitating rare (e.g., mutant) allelic variants, such as SNPs, or nucleotide (NT) insertions or deletions, in samples comprising abundant (e.g., wild type) allelic variants with high specificity. In particular, in some embodiments, the invention relates to a highly selective method for mutation detection referred to as competitive allele-specific TaqMan PCR ("cast-PCR").

[0008] In one aspect, the present invention provides compositions for use in identifying and/or quantitating allelic variants in nucleic acid samples. Some of these compositions can comprise: (a) an allele-specific primer; (b) an allele-specific blocker probe; (c) a detector probe; and/or (d) a locus-specific primer.

[0009] In some embodiments of the compositions, the allele-specific primer comprises a target-specific portion and an allele-specific nucleotide portion. In some embodiments, the allele-specific primer may further comprise a tail. In some exemplary embodiments, the tail is located at the 5' end of the allele-specific primer. In other embodiments, the tail of the allele-specific primer has repeated guanine and cytosine residues ("GC-rich"). In some embodiments, the melting temperature ("Tm") of the entire allele-specific primer ranges from about 50.degree. C. to 67.degree. C. In some embodiments, the allele-specific primer concentration is between about 20-900 nM.

[0010] In some embodiments of the compositions, the allele-specific nucleotide portion of the allele-specific primer is located at the 3' terminus. In some embodiments, the selection of the allele-specific nucleotide portion of the allele-specific primer involves the use of a highly discriminating base (e.g., for detection of A/A, A/G, G/A, G/G, A/C, or C/A alleles). In some embodiments, for example when the allele to be detected involves A/G or C/T SNPs, A or G is used as the 3' allele-specific nucleotide portion of the allele-specific primer (e.g., if A or T is the target allele), or C or T is used as the 3' allele-specific nucleotide portion of the allele-specific primer (e.g., if C or G is the target allele). In other embodiments, A is used as the discriminating base at the 3' end of the allele-specific primer when detecting and/or quantifying A/T SNPs. In other embodiments, G is used as the discriminating base at the 3' end of the allele-specific primer when detecting and/or quantifying C/G SNPs.

[0011] In some embodiments of the compositions, the allele-specific blocker probe comprises a non-extendable blocker moiety at the 3' terminus. In some exemplary embodiments, the non-extendable blocker moiety is a minor groove binder (MGB). In some embodiments, the target allele position is located about 6-10, such as about 6, about 7, about 8, about 9, or about 10 nucleotides away from the non-extendable blacker moiety of the allele-specific blocker probe. In some embodiments, the allele-specific blocker probe comprises an MGB moiety at the 5' terminus. In some exemplary embodiments, the allele-specific blocker probe is not cleaved during PCR amplification. In some embodiments, the Tm of the allele-specific blocker probe ranges from about 58.degree. C. to 66.degree. C.

[0012] In some embodiments of the compositions, the allele-specific blocker probe and/or allele-specific primer comprise at least one modified base. In some embodiments, the modified base(s) may increase the difference in the Tm between matched and mismatched target sequences and/or decrease mismatch priming efficiency, thereby improving not only assay specificity bust also selectivity. Such modified base(s) may include, for example, 8-Aza-7-deaza-dA (ppA), 8-Aza-7-deaza-dG (ppG), 2'-Deoxypseudoisocytidine (iso dC), 5-fluoro-2'-deoxyuridine (fdU), locked nucleic acid (LNA), or 2'-O,4'-C-ethylene bridged nucleic acid (ENA) bases (also see, for example, FIG. 4B). In some embodiments the modified base is located at (a) the 3'-end, (b) the 5'-end, (c) at an internal position or at any combination of (a), (b) or (c) within the allele-specific blocker probe and/or the allele-specific primer.

[0013] In some embodiments of the compositions, the detector probe is a sequence-based or locus-specific detector probe. In other embodiments the detector probe is a 5' nuclease probe. In some exemplary embodiments, the detector probe can comprises an MGB moiety, a reporter moiety (e.g., FAM.TM., TET.TM., JOE.TM., VTC.TM., or SYBR.RTM. Green), a quencher moiety (e.g., Black Hole Quencher.TM. or TAMRA.TM.;), and/or a passive reference (e.g., ROX.TM.). In some exemplary embodiments, the detector probe is designed according to the methods and principles described in U.S. Pat. No. 6,727,356 (the disclosure of which is incorporated herein by reference in its entirety). In some exemplary embodiments, the detector probe is a TaqMan.RTM. probe (Applied Biosystems, Foster City).

[0014] In some embodiments of the compositions, the composition can further comprise a polymerase; deoxyribonucleotide triphosphates (dNTPs); other reagents and/or buffers suitable for amplification; and/or a template sequence or nucleic acid sample. In some embodiments, the polymerase can be a DNA polymerase. In some other embodiments, the polymerase can be thermostable, such as Tag DNA polymerase. In other embodiments, the template sequence or nucleic acid sample can be DNA, such as genomic DNA (gDNA) or complementary DNA (cDNA). In other embodiments the template sequence or nucleic acid sample can be RNA, such as messenger RNA (mRNA).

[0015] In another aspect, the present disclosure provides methods for amplifying an allele-specific sequence. Some of these methods can include one or more of the following: (a) hybridizing an allele-specific primer to a first nucleic acid molecule comprising a first allele (allele-1); (b) hybridizing an allele-specific blocker probe to a second nucleic acid molecule comprising a second allele (allele-2), wherein allele-2 corresponds to the same loci as allele-1; (c) hybridizing a detector probe to the first nucleic acid molecule; (d) hybridizing a locus-specific primer to the extension product of the allele-specific primer; and (e) PCR amplifying the first nucleic acid molecule comprising allele-1.

[0016] In another aspect, the present invention provides methods for detecting and/or quantitating an allelic variant in a pooled or mixed sample comprising other alleles. Some of these methods can include one or more of the following: (a) in a first reaction mixture hybridizing a first allele-specific primer to a first nucleic acid molecule comprising a first allele (allele-1) and in a second reaction mixture hybridizing a second allele-specific primer to a first nucleic acid molecule comprising a second allele (allele-2), wherein allele-2 corresponds to the same locus as allele-1; (b) in the first reaction mixture hybridizing a first allele-specific blocker probe to a second nucleic acid molecule comprising allele-2 and in the second reaction mixture hybridizing a second allele-specific blocker probe to a second nucleic acid molecule comprising allele-1; (c) in the first reaction mixture, hybridizing a first detector probe to the first nucleic acid molecule and in the second reaction mixture and hybridizing a second detector probe to the first nucleic acid molecule; (d) in the first reaction mixture hybridizing a first locus-specific primer to the extension product of the first allele-specific primer and in the second reaction mixture hybridizing a second locus-specific primer to the extension product of the second allele-specific primer; and (e) PCR amplifying the first nucleic acid molecule to form a first set or sample of amplicons and PCR amplifying the second nucleic acid molecule to form a second set or sample of amplicons; and (f) comparing the first set of amplicons to the second set of amplicons to quantitate allele-1 in the sample comprising allele-2 and/or allele-2 in the sample comprising allele-1.

[0017] In some embodiments of the methods, the first and/or second allele-specific primer comprises a target-specific portion and an allele-specific nucleotide portion. In some embodiments, the first and/or second allele-specific primer may further comprise a tail. In some embodiments, the Tm of the entire first and/or second allele-specific primer ranges from about 50.degree. C. to 67.degree. C. In some embodiments the first and/or second allele-specific primer concentration is between about 20-900 nM.

[0018] In some embodiments of the methods, the target-specific portion of the first allele-specific primer and the target-specific portion of the second allele-specific primer comprise the same sequence. In other embodiments, the target-specific portion of the first allele-specific primer and the target-specific portion of the second allele-specific primer are the same sequence.

[0019] In some embodiments of the methods, the tail is located at the 5'-end of the first and/or second allele-specific primer. In some embodiments, the 5' tail of the first allele-specific primer and the 5' tail of the second allele-specific primer comprise the same sequence. In other embodiments, the 5' tail of the first allele-specific primer and the 5' tail of the second allele-specific primer are the same sequence. In other embodiments, the tail of the first and/or second allele-specific primer is GC-rich.

[0020] In some embodiments of the methods, the allele-specific nucleotide portion of the first allele-specific primer is specific to a first allele (allele-1) of a SNP and the allele-specific nucleotide portion of the second allele-specific primer is specific to a second allele (allele-2) of the same SNP. In some embodiments of the methods, the allele-specific nucleotide portion of the first and/or second allele-specific primer is located at the 3'-terminus. In some embodiments, the selection of the allele-specific nucleotide portion of the first and/or second allele-specific primer involves the use of a highly discriminating base (e.g., for detection of A/A, A/G, G/A, G/G, A/C, or C/A alleles). In some embodiments, for example when the allele to be detected involves A/G or C/T SNPs, A or G is used as the 3' allele-specific nucleotide portion of the first and/or second allele-specific primer (e.g., if A or T is the major allele), or C or T is used as the 3' allele-specific nucleotide portion of the first and/or second allele-specific primer (e.g., if C or G is the major allele). In other embodiments, A is used as the discriminating base at the 3' end of the first and/or second allele-specific primer when detecting and/or quantifying A/T SNPs. In other embodiments, G is used as the discriminating base at the 3' end of the first and/or second allele-specific primer when detecting and/or quantifying C/G SNPs.

[0021] In some embodiments of the methods, the first and/or second allele-specific blocker probe comprises a non-extendable blocker moiety at the 3' terminus. In some exemplary embodiments, the non-extendable blocker moiety is an MGB. In some embodiments, the target allele position is located about 6-10, such as about 6, about 7, about 8, about 9, or about 10 nucleotides away from the non-extendable blocker moiety of the first and/or second allele-specific blocker probe. In some embodiments, the first and/or second allele-specific blocker probe comprises an MGB moiety at the 5'-terminus. In other embodiments, the first and/or second allele-specific blocker probe is not cleaved during PCR amplification. In some embodiments, the Tm of the first and/or second allele-specific blocker probe ranges from about 58.degree. C. to 66.degree. C.

[0022] In some embodiments of the methods, the first and/or second allele-specific blocker probe and/or the first and/or second allele-specific primer comprises at least one modified base. In some embodiments, the modified base(s) may increase the difference in the Tm between matched and mismatched target sequences and/or decrease mismatch priming efficiency, thereby improving not only assay specificity, but also selectivity. Such modified base(s) may include, for example, 8-Aza-7-deaza-dA (ppA), 8-Aza-7-deaza-dG (ppG), 2'-Deoxypseudoisocytidine (iso dC), 5-fluoro-2'-deoxyuridine (fdU), locked nucleic acid (LNA), or 2'-O,4'-C-ethylene bridged nucleic acid (ENA) bases (see also, for example, FIG. 4B). In some embodiments the modified base is located at (a) the 3'-end, (b) the 5'-end, (c) at an internal position or at any combination of (a), (b) or (c) within said first and/or second allele-specific blocker probe and/or the first and/or second allele-specific primer.

[0023] In some embodiments of the methods, the specificity of allelic discrimination is improved by the inclusion of a modified base in the first and/or second allele-specific primer and/or first, and/or second allele-specific blocker probe as compared to the use of a non-modified allelic-specific primer or blocker probe. In some embodiments, the improvement in specificity is at least 2 fold.

[0024] In some embodiments of the methods, the specificity of allelic discrimination is at least 2 fold (e.g., 2 fold, 3 fold, 4, fold, 5 fold, and so on) better than the specificity of allelic discrimination using Allele-Specific PCR with a Blocking reagent (ASB-PCR) methods.

[0025] In some embodiments, the methods further comprise a 2-stage cycling protocol. In some embodiments, the number of cycles in the first stage of the 2-stage cycling protocol comprises fewer cycles than the number of cycles used in the second stage. In other embodiments, the number of cycles in the first stage is about 90% fewer cycles than the number of cycles in the second stage. In yet other embodiments, the number of cycles in the first stage is between 3-7 cycles and the number of cycles in the second stage is between 42-48 cycles.

[0026] In some embodiments, the annealing/extension temperature used during the first cycling stage of the 2-stage cycling protocol is between 1-3.degree. C. lower than the annealing/extension temperature used during the second stage. In preferred embodiments, the annealing/extension temperature used during the first cycling stage of the 2-stage cycling protocol is between 56-59.degree. C. and the annealing/extension temperature used during the second stage is between 60-62.degree. C.

[0027] In some embodiments, the methods further comprise a pre-amplification step. In preferred embodiments, the pre-amplification step comprises a multiplex amplification reaction that uses at least two complete sets of allele-specific primers and locus-specific primers, wherein each set is suitable or operative for amplifying a specific polynucleotide of interest. In other embodiments, the products of the multiplex amplification reaction are divided into secondary single-plex amplification reactions, such as a cast-PCR reaction, wherein each single-plex reaction contains at least one primer set previously used in the multiplex reaction. In other embodiments, the multiplex amplification reaction further comprises a plurality of allele-specific blocker probes. In some embodiments, the multiplex amplification reaction is carried out for a number of cycles suitable to keep the reaction within the linear phase of amplification.

[0028] In some embodiments of the methods, the first and/or second detector probes are the same. In some embodiments, the first and/or second detector probes are different. In some embodiments, the first and/or second detector probe is a sequence-based or locus-specific detector probe. In other embodiments the first and/or second detector probe is a 5' nuclease probe. In some exemplary embodiments, the first and/or second detector probes comprises an MGB moiety, a reporter moiety (e.g., FAM.TM., TET.TM., JOE.TM., VIC.TM., or SYBR.RTM. Green), a quencher moiety (e.g., Black Hole Quencher.TM. or TAMRA.TM.;), and/or a passive reference (e.g., ROX.TM.). In some exemplary embodiments, the first and/or second detector probe is designed according to the methods and principles described in U.S. Pat. No. 6,727,356 (the disclosure of which is incorporated herein by reference in its entirety). In some exemplary embodiments, the detector probe is a TaqMan.RTM. probe.

[0029] In some embodiments of the methods, the first locus-specific primer and the second locus-specific primer comprise the same sequence. In some embodiments the first locus-specific primer and the second locus-specific primer are the same sequence.

[0030] In some embodiments of the methods, the first and/or second reaction mixtures can further comprises a polymerase; dNTPs; other reagents and/or buffers suitable for PCR amplification; and/or a template sequence or nucleic acid sample. In some embodiments, the polymerase can be a DNA polymerase. In some embodiments, the polymerase can be thermostable, such as Taq DNA polymerase. In some embodiments, the template sequence or nucleic acid sample can be DNA, such as gDNA or cDNA. In other embodiments the template sequence or nucleic acid sample can be RNA, such as mRNA.

[0031] In some embodiments of the methods, the first allele-specific blocker probe binds to the same strand or sequence as the second allele-specific primer, while the second allele-specific blocker probe binds to the same strand or sequence as the first allele-specific primer. In some embodiments, the first and/or second allele-specific blocker probes are used to reduce the amount of background signal generated from either the second allele and/or the first allele, respectively. In some embodiments, first and/or second allele-specific blocker probes are non-extendable and preferentially anneal to either the second allele or the first allele, respectively, thereby blocking the annealing of, for example, the extendable first allele-specific primer to the second allele and/or the extendable second allele-specific primer to first allele.

[0032] In some exemplary embodiments, the first allele is a rare (e.g., minor) or mutant allele. In other exemplary embodiments the second allele is an abundant (e.g., major) or wild type allele.

[0033] In another aspect, the present invention provides kits for quantitating a first allelic variant in a sample comprising a second allelic variant involving: (a) a first allele-specific primer; (b) a second allele-specific primer; (e), a first locus-specific primer; (d) a second locus-specific primer; (e) a first allele-specific blocker probe; (f) a second allele-specific blocker probe; and (g) a first locus-specific detector probe and (h) a second locus-specific detector probe.

[0034] In some embodiments of the kits, the first and/or second allele-specific primer comprises a target-specific portion and an allele-specific nucleotide portion. In some embodiments, the first and/or second allele-specific primer may further comprise a tail. In some embodiments, the Tm of the entire first and/or second allele-specific primer ranges from about 50.degree. C. to 67.degree. C. In some embodiments the first and/or second allele-specific primer concentrations are between about 20-900 nM.

[0035] In some embodiments of the kits, the target-specific portion of the first allele-specific primer and the target-specific portion of the second allele-specific primer comprise the same sequence. In other embodiments, the target-specific portion of the first allele-specific primer and the target-specific portion of the second allele-specific primer are the same sequence.

[0036] in some embodiments of the kits, the tail is located at the 5' end of the first and/or second allele-specific primer. In some embodiments, the 5' tail of the first allele-specific primer and the 5' tail of the second allele-specific primer comprise the same sequence. In other embodiments, the 5' tail of the first allele-specific primer and the 5' tail of the second allele-specific primer are the same sequence. In other embodiments, the tail of the first and/or second allele-specific primer is GC rich.

[0037] In some embodiments of the kits, the allele-specific nucleotide portion of the first allele-specific primer is specific to a first allele (allele-1) of a SNP and the allele-specific nucleotide portion of the second allele-specific primer is specific to a second allele (allele-2) of the same SNP. In some embodiments of the disclosed methods, the allele-specific nucleotide portion of the first and/or second allele-specific primer is located at the 3' terminus. In some embodiments, the selection of the allele-specific nucleotide portion of the first and/or second allele-specific primer involves the use of a highly discriminating base (e.g., for detection of A/A, A/G, G/A, G/G, A/C, or C/A alleles) (FIG. 2). In some embodiments, for example when the allele to be detected involves A/G or C/T SNPs, A or G is used as the 3' allele-specific nucleotide portion of the first and/or second allele-specific primer (e.g., if A or T is the major allele), or C or T is used as the 3' allele-specific nucleotide portion of the first and/or second allele-specific primer (e.g., if C or G is the major allele). In other embodiments, A is used as the discriminating base at the 3' end of the first and/or second allele-specific primer when detecting and/or quantifying A/T SNPs. In other embodiments, G is used as the discriminating base at the 3' end of the first and/or second allele-specific primer when detecting and/or quantifying C/G SNPs.

[0038] In some embodiments of the kits, the first and/or second allele-specific blocker probe comprises a non-extendable blocker moiety at the 3' terminus. In some exemplary embodiments, the non-extendable blocker moiety is an MGB. In some embodiments, the target allele position is located about 6-10, such as about 6, about 7, about 8, about 9, or about 10 nucleotides away from the non-extendable blocker moiety of the first and/or second allele-specific blocker probe. In some embodiments, the first and/or second allele-specific blocker probe comprises an MGB moiety at the 5' terminus. In other embodiments, the first and/or second allele-specific blocker probe is not cleaved during PCR amplification. In some embodiments, the Tm of the first and/or second allele-specific blocker probe ranges from about 58.degree. C. to 66.degree. C.

[0039] In some embodiments of the kits, the allele-specific blocker probe and/or the first and/or second allele-specific primer comprises at least one modified base. In some embodiments, the modified base(s) may increase the difference in the Tm between matched and mismatched target sequences and/or decrease mismatch priming efficiency, thereby improving not only assay specificity bust also selectivity. Such modified base(s) may include, for example, 8-Aza-7-deaza-dA (ppA), 8-Aza-7-deaza-dG (ppG), 2'-Deoxypseudoisocytidine (iso dC), 5-fluoro-2'-deoxyuridine (fdU), locked nucleic acid (LNA), or 2'-O,4'-C-ethylene bridged nucleic acid (ENA) bases (see also, for example, FIG. 4B). In some embodiments the modified base is located at (a) the 3'-end, (b) the 5'-end, (c) at an internal position or at any combination of (a), (b) or (c) within said first and/or second allele-specific blocker probe and/or the first and/or second allele-specific primer.

[0040] In some embodiments of the kits, the first and/or second detector probes are the same. In some embodiments of the disclosed kits the first and/or second detector probes are different. In some embodiments of the disclosed kits, the first and/or second detector probes are sequence-based or locus-specific detector probes. In other embodiments the first and/or second detector probe are 5' nuclease probes. In some exemplary embodiments, the first and/or second detector probes comprise an MGB moiety, a reporter moiety (e.g., FAM.TM., TET.TM., JOE.TM., VIC.TM., or SYBR.RTM. Green), a quencher moiety (e.g., Black Hole Quencher.TM. or TAMRA.TM.;), and/or a passive reference (e.g., ROX.TM.). In some exemplary embodiments, the first and/or second detector probe are designed according to the methods and principles described in U.S. Pat. No. 6,727,356 (the disclosure of which is incorporated herein by reference in its entirety). In some exemplary embodiments, the detector probe is a TagMan.RTM. probe.

[0041] In some embodiments of the kits, the first locus-specific primer and the second locus-specific primer comprise the same sequence. In some embodiments the first locus-specific primer and the second locus-specific primer are the same sequence.

[0042] In some embodiments of the kits, the first and/or second reaction mixture can further comprise a polymerase; dNTPs; other reagents and/or buffers suitable for PCR amplification; and/or a template sequence or nucleic acid sample. In some embodiments, the polymerase can be a DNA polymerase. In some other embodiments, the polymerase can be thermostable, such as Tag DNA polymerase.

[0043] In some embodiments, the compositions, methods and kits of the present invention provide high allelic discrimination specificity and selectivity. In some embodiments, the quantitative determination of specificity and/or selectivity comprises a comparison of Ct values between a first set of amplicons and a second set of amplicons. In some embodiments, selectivity is at a level whereby a single copy of a given allele in about 1 million copies of another allele or alleles can be detected.

[0044] The foregoing has described various embodiments of the invention that provide improved detection and discrimination of allelic variants using one or more of the following: (a) tailed allele-specific primers; (b) low allele-specific primer concentration; (c) allele-specific primers designed to have lower Tms; (d) allele-specific primers designed to target discriminating bases; (e) allele-specific blocker probes containing MGB, designed to prevent amplification from alternative, and potentially more abundant, allelic variants in a sample; and (f) allele-specific blocker probes and/or allele-specific primers designed to comprise modified bases in order to increase the delta Tm between matched and mismatched target sequences.

[0045] While particular embodiments employing several of the above improvements have been discussed herein, it will be apparent to the skilled artisan that depending on the nature of the sample to be examined, various combinations of the above improvements can be combined to arrive at a favorable result. Thus, for example, non-MGB blocker probes can be used with an embodiment that include methods employing allele-specific primers containing modified bases to increase delta Tm; such primers can also be designed to target discriminating bases; and the primers can be used at low primer concentrations. Accordingly, alternative embodiments based upon the present disclosure can be used to achieve a suitable level of allelic detection.

[0046] The present disclosure provides the advantage that any of the combinations of listed improvements could be utilized by a skilled artisan in a particular situation. For example, the current invention can include a method or reaction mixture that employs improvements a, c, d and f; improvements b, c, and e; or improvements

[0047] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.

[0048] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several exemplary embodiments of the disclosure and together with the description, serve to explain certain teachings.

BRIEF DESCRIPTION OF THE DRAWINGS

[0049] The skilled artisan will understand that the drawings described below are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

[0050] FIG. 1 depicts a schematic of an illustrative embodiment of cast-PCR. In some embodiments, components of cast-PCR include the following: one locus-specific TaqMan probe (LST); two MGB blockers: one allele-1-specific MGB blocker (MGB1) and one allele-2-specific MGB blocker (MGB2); 3 PCR primers: one locus-specific PCR primer (LSP); one allele-1-specific primer (ASP1) and one allele-2-specific primer (ASP2).

[0051] FIG. 2 depicts a schematic of an illustrative embodiment of cast-PCR using allele-specific blocker probes comprising highly discriminating bases for detecting rare allelic variants. Highly discriminating bases may include, for example, A/A, A/G, G/A, G/G, A/C, C/A. The least discriminating bases may include, for example, C/C, T/C, G/T, T/G, C/T. In some embodiments, for example, for detection of A-G or C-T SNPs, A & G are used as the discriminating base if A//T is allelic variant (e.g., mutant allele); or C & T are used as the discriminating base if C//G allelic variant (e.g., mutant allele).

[0052] FIG. 3 depicts a schematic of an illustrative embodiment of cast-PCR using an allele-specific blocker probe with an MGB moiety at the 5' end. In some embodiments the blocker moiety at the 3'-end of the probe may include, for example, NH.sub.2, biotin, MGB, PO.sub.4, and PEG.

[0053] FIG. 4A depicts a schematic of an illustrative embodiment of cast-PCR using modified bases in an MGB blocker probe or allele-specific primer. (G* represents ppG.)

[0054] FIG. 4B depicts some examples of modified bases of an MGB blocker probe or allele-specific primer.

[0055] FIG. 5 depicts the TaqMan-like sensitivity and dynamic range of one exemplary embodiment of cast-PCR.

[0056] FIG. 6 depicts the sequence of KRAS mutations at codons 12 and 13 that are detectable using cast-PCR methods. KRAS mutations at codons 12 and 13 are associated with resistance to cetuxima or panitumumab in metastatic colorectal cancer (Di Nicolantonio F., et al., J Clin Oncol. 2008; 26:5705-12.)

[0057] FIG. 7 depicts the specificity of KRAS mutation detection using cast-PCR assays in one exemplary embodiment.

[0058] FIG. 8 depicts one exemplary embodiment using cast-PCR methods to detect a single copy of mutant DNA in 10.sup.6 copies of wild-type DNA.

[0059] FIG. 9 depicts detection of the relative copy number of mutant samples (KRAS-G12A) spiked in wild type samples using cast-PCR methods.

[0060] FIG. 10 depicts a number of different tumor markers (SNPs) detected in tumor samples using one exemplary embodiment of cast-PCR.

[0061] FIG. 11A-E shows a list of exemplary primers and probes used in cast-PCR assays. Nucleotides shown in lower case are the tailed portion of the primers. The nucleotide-portion of allele-specific primers (ASP) is at the 3'-most terminus of each primer and are indicated in bold. The allele positions of the blocker probes (MGB) are located at various internal positions relative to the blocker moieties, in some cases, are indicated in bold.

[0062] FIG. 12 depicts the specificity of allelic discrimination for samples that were pre-amplified prior to analysis by cast-PCR.

[0063] FIG. 13 depicts the specificity of allelic discrimination for cast-PCR assays performed using tailed versus non-tailed allele-specific primers.

[0064] FIG. 14 depicts the specificity of allelic discrimination for samples analyzed by cast-PCR versus samples analyzed by ASB-PCR methods.

[0065] FIG. 15 depicts the specificity of allelic discrimination for cast-PCR assays performed using MGB blocker probes or phosphate blocker probes.

[0066] FIG. 16 depicts the specificity of allelic discrimination for cast-PCR assays performed using LNA-modified allele-specific primers.

[0067] FIG. 17 compares the specificity of allelic discrimination for cast-PCR assays performed using various chemically-modified allele-specific primers.

[0068] FIG. 18A-B shows a list of exemplary allele-specific primers and probes used in pre-amplification and cast-PCR assays.

[0069] FIG. 19A-D shows a list of exemplary primers and probes used in cast-PCR assays using either tailed (ASP +tail) or non-tailed (ASP -tail) allele-specific primers. (The tailed portion of the ASP +tail primers are indicated in lower case lettering.)

[0070] FIG. 20A-C shows a list of exemplary primers and probes used in ASB-PCR. The blocker probes used in ASB-PCR comprise a phosphate group at the 3'-end of the blocker probes (PHOS).

[0071] FIG. 21A-C shows a list of exemplary primers and probes used in cast-PCR assays performed using LNA-modified allele-specific primers. In this exemplary embodiment, the LNA modifications of the ASP are at the 3'-ends. ("+" indicates the LNA modified nucleotide and are notated in parentheses.)

[0072] FIG. 22 shows a list of exemplary primers and probes used in cast-PCR assays performed using other chemically modified allele-specific primers. In this exemplary embodiment, the chemical modifications (e.g., ppA, ppG, fdU, and iso dC) of the ASP are at the 3'-ends. (The chemically modified nucleotides are shown in parentheses.)

DETAILED DESCRIPTION

I. Introduction

[0073] The selective amplification of an allele of interest is often complicated by factors including the mispriming and extension of a mismatched allele-specific primer on an alternative allele. Such mispriming and extension can be especially problematic in the detection of rare alleles present in a sample populated by an excess of another allelic variant. When in sufficient excess, the mispriming and extension of the other allelic variant may obscure the detection of the allele of interest. When using PCR-based methods, the discrimination of a particular allele in a sample containing alternative allelic variants relies on the selective amplification of an allele of interest, while minimizing or preventing amplification of other alleles present in the sample.

[0074] A number of factors have been identified, which alone or in combination, contribute to the enhanced discriminating power of allele-specific PCR. As disclosed herein, a factor which provides a greater .DELTA.Ct value between a mismatched and matched allele-specific primer is indicative of greater discriminating power between allelic variants. Such factors found to improve discrimination of allelic variants using the present methods include, for example, the use of one or more of the following: (a) tailed allele-specific primers; (b) low allele-specific primer concentration; (c) allele-specific primers designed to have lower Tms; (d) allele-specific primers designed to target discriminating bases; (e) allele-specific blocker probes designed to prevent amplification from alternative, and potentially more abundant, allelic variants in a sample; and (f) allele-specific blocker probes and/or allele-specific primers designed to comprise modified bases in order to increase the delta Tm between matched and mismatched target sequences.

[0075] The above-mentioned factors, especially when used in combination, can influence the ability of allele-specific PCR to discriminate between different alleles present in a sample. Thus, the present disclosure relates generally to novel amplification methods referred to as cast-PCR, which utilizes a combination of factors referred to above to improve discrimination of allelic variants during PCR by increasing .DELTA.Ct values. In some embodiments, the present methods can involve high levels of selectivity, wherein one mutant molecule in a background of at least 1,000 to 1,000,000, such as about 1000-10,000, about 10,000 to 100,000, about 20,000 to 250,000, about 30,000 to 300,000, about 40,000 to 400,000, about 50,000 to 500,000, about 75,000 to 750,000 or about 100,000 to 1,000,000 wild type molecules, or any fractional ranges in between can be detected. In some embodiments, the comparison of a first set of amplicons and a second set of amplicons involving the disclosed methods provides improvements in specificity from 1,000.times. to 100,000,000.times. fold difference, such as about 1000-10,000.times., about 10,000 to 100,000.times., about 20,000 to 250,000.times., about 30,000 to 300,000.times., about 40,000 to 400,000.times., about 50,000 to 500,000.times., about 75,000 to 750,000.times., about 100,000 to 1,000,000.times., about 2,000,000 to 25,000,000.times., about 3,000,000 to 30,000,000.times., about 4,000,000.times. to 40,000,000.times., about 5,000,000 to 50,000,000.times., about 7,5000,000 to 75,000,000.times. or about 10,000,000 to 100,000,000.times. fold difference, or any fractional ranges in between.

II. Definitions

[0076] For the purposes of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth below conflicts with the usage of that word in any other document, including any document incorporated herein by reference, the definition set forth below shall always control for purposes of interpreting this specification and its associated claims unless a contrary meaning is clearly intended.

[0077] As used herein, the term "allele" refers generally to alternative DNA sequences at the same physical locus on a segment of DNA, such as, for example, on homologous chromosomes. An allele can refer to DNA sequences which differ between the same physical locus found on homologous chromosomes within a single cell or organism or which differ at the same physical locus in multiple cells or organisms ("allelelic variant"). In some instances, an allele can correspond to a single nucleotide difference at a particular physical locus. In other embodiments and allele can correspond to nucleotide (single or multiple) insertion or deletion.

[0078] As used herein, the term "allele-specific primer" refers to an oligonucleotide sequence that hybridizes to a sequence comprising an allele of interest, and which when used in PCR can be extended to effectuate first strand cDNA synthesis. Allele-specific primers are specific for a particular allele of a given target DNA or loci and can be designed to detect a difference of as little as one nucleotide in the target sequence. Allele-specific primers may comprise an allele-specific nucleotide portion, a target-specific portion, and/or a tail.

[0079] As used herein, the terms "allele-specific nucleotide portion" or "allele-specific target nucleotide" refers to a nucleotide or nucleotides in an allele-specific primer that can selectively hybridize and be extended from one allele (for example, a minor or mutant allele) at a given locus to the exclusion of the other (for example, the corresponding major or wild type allele) at the same locus.

[0080] As used herein, the term "target-specific portion" refers to the region of an allele-specific primer that hybridizes to a target polynucleotide sequence. In some embodiments, the target-specific portion of the allele-specific primer is the priming segment that is complementary to the target sequence at a priming region 5' of the allelic variant to be detected. The target-specific portion of the allele-specific primer may comprise the allele-specific nucleotide portion. In other instances, the target-specific portion of the allele-specific primer is adjacent to the 3' allele-specific nucleotide portion.

[0081] As used herein, the terms "tail" or "5'-tail" refers to the non-3' end of a primer. This region typically will, although does not have to contain a sequence that is not complementary to the target polynucleotide sequence to be analyzed. The 5' tail can be any of about 2-30, 2-5, 4-6, 5-8, 6-12, 7-15, 10-20, 15-25 or 20-30 nucleotides, or any range in between, in length.

[0082] As used herein, the term "allele-specific blocker probe" (also referred to herein as "blocker probe," "blocker,") refers to an oligonucleotide sequence that binds to a strand of DNA comprising a particular allelic variant which is located on the same, opposite or complementary strand as that bound by an allelic-specific primer, and reduces or prevents amplification of that particular allelic variant. As discussed in greater detail herein, allele-specific blocker probes generally comprise modifications, e.g., at the 3'-OH of the ribose ring, which prevent primer extension by a polymerase. The allele-specific blocker probe can be designed to anneal to the same or opposing strand of what the allele-specific primer anneals to and can be modified with a blocking group (e.g., a "non-extendable blocker moiety") at its 3' terminal end. Thus, a blocker probe can be designed, for example, so as to tightly bind to a wild type allele (e.g., abundant allelic variant) in order to suppress amplification of the wild type allele while amplification is allowed to occur on the same or opposing strand comprising a mutant allele (e.g., rare allelic variant) by extension of an allele-specific primer. In illustrative examples, the allele-specific blocker probes do not include a label, such as a fluorescent, radioactive, or chemiluminescent label

[0083] As used herein, the term "non-extendable blocker moiety" refers generally to a modification on an oligonucleotide sequence such as a probe and/or primer which renders it incapable of extension by a polymerase, for example, when hybridized to its complementary sequence in a PCR reaction. Common examples of blocker moieties include modifications of the ribose ring 3'-OH of the oligonucleotide, which prevents addition of further bases to the '3-end of the oligonucleotide sequence a polymerase. Such 3'-OH modifications are well known in the art. (See, e.g., Josefsen, M., et al., Molecular and Cellular Probes, 23 (2009):201-223; McKinzie, P. et al., Mutagenesis. 2006, 21(6):391-7; Parsons, B. et al., Methods Mol Biol. 2005, 291:235-45; Parsons, B. et al., Nucleic Acids Res. 1992, 25:20(10):2493-6; and Morlan, J. et al., PLoS One 2009, 4 (2): e4584, the disclosures of which are incorporated herein by reference in their entireties.)

[0084] As used herein, the terms "MGB," "MGB group," "MGB compound," or "MBG moiety" refers to a minor groove binder. When conjugated to the 3' end of an oligonucleotide, an MGB group can function as a non-extendable blocker moiety.

[0085] An MGB is a molecule that binds within the minor groove of double stranded DNA. Although a general chemical formula for all known MGB compounds cannot be provided because such compounds have widely varying chemical structures, compounds which are capable of binding in the minor groove of DNA, generally speaking, have a crescent shape three dimensional structure. Most MGB moieties have a strong preference for A-T (adenine and thymine) rich regions of the B form of double stranded DNA. Nevertheless, MGB compounds which would show preference to C-G (cytosine and guanine) rich regions are also theoretically possible. Therefore, oligonucleotides comprising a radical or moiety derived from minor groove binder molecules having preference for C-G regions are also within the scope of the present invention.

[0086] Some MGBs are capable of binding within the minor groove of double stranded. DNA with an association constant of 10.sup.3M.sup.-1 or greater. This type of binding can be detected by well established spectrophotometric methods such as ultraviolet (UV) and nuclear magnetic resonance (NMR) spectroscopy and also by gel electrophoresis. Shifts in UV spectra upon binding of a minor groove binder molecule and NMR spectroscopy utilizing the "Nuclear Overhauser" (NOSEY) effect are particularly well known and useful techniques for this purpose. Gel electrophoresis detects binding of an MGB to double stranded DNA or fragment thereof, because upon such binding the mobility of the double stranded DNA changes.

[0087] A variety of suitable minor groove binders have been described in the literature. See, for example, Kutyavin, et al. U.S. Pat. No. 5,801,155; Wemmer, D. E., and Dervan P. B., Current Opinion in Structural Biology, 7:355-361 (1997); Walker, W. L., Kopka, J. L. and Goodsell, D. S., Biopolymers, 44:323-334 (1997); Zimmer, C.& Wahnert, U. Frog. Biophys. Molec. Bio. 47:31-112 (1986) and Reddy, B. S. P., Dondhi, S. M., and Lown, J. W., Pharmacol. Therap., 84:1-111 (1999) (the disclosures of which are herein incorporated by reference in their entireties). A preferred MGB in accordance with the present disclosure is DPI.sub.3. Synthesis methods and/or sources for such MGBs are also well known in the art. (See, e.g., U.S. Pat. Nos. 5,801,155; 6,492,346; 6,084,102; and 6,727,356, the disclosures of which are incorporated herein by reference in their entireties.)

[0088] As used herein, the term "MGB blocker probe," "MBG blocker," or "MGB probe" is an oligonucleotide sequence and/or probe further attached to a minor groove binder moiety at its 3' and/or 5' end. Oligonucleotides conjugated to MGB moieties form extremely stable duplexes with single-stranded and double-stranded DNA targets, thus allowing shorter probes to be used for hybridization based assays. In comparison to unmodified DNA, MGB probes have higher melting temperatures (Tin) and increased specificity, especially when a mismatch is near the MGB region of the hybridized duplex. (See, e.g., Kutyavin, I. V., et al., Nucleic Acids Research, 2000, Vol. 28, No. 2: 655-661).

[0089] As used herein, the term "modified base" refers generally to any modification of a base or the chemical linkage of a base in a nucleic acid that differs in structure from that found in a naturally occurring nucleic acid. Such modifications can include changes in the chemical structures of bases or in the chemical linkage of a base in a nucleic acid, or in the backbone structure of the nucleic acid. (See, e.g., Latorra, D. et al., Hum Mut 2003, 2:79-85. Nakiandwe, J. et al., Plant Method 2007, 3:2.)

[0090] As used herein, the term "detector probe" refers to any of a variety of signaling molecules indicative of amplification. For example, SYBR.RTM. Green and other DNA-binding dyes are detector probes. Some detector probes can be sequence-based (also referred to herein as "locus-specific detector probe"), for example 5' nuclease probes. Various detector probes are known in the art, for example (TaqMan.RTM. probes described herein (See also U.S. Pat. No. 5,538,848) various stem-loop molecular beacons (See, e.g., U.S. Pat. Nos. 6,103,476 and 5,925,517 and Tyagi and Kramer, Nature Biotechnology 1996, 14:303-308), stemless or linear beacons (See, e.g., WO 99/21881), PNA Molecular Beacons.TM. (See, e.g., U.S. Pat. Nos. 6,355,421 and 6,593,091), linear PNA beacons (See, e.g., Kubista et al., 2001, SPIE 4264:53-58), non-FRET probes (See, e.g., U.S. Pat. No. 6,150,097), Sunrise.RTM./Amplifluor.RTM. probes (U.S. Pat. No. 6,548,250), stem-loop and duplex Scorpion.TM. probes (Salinas et al., 2001, Nucleic Acids Research 29:E96 and U.S. Pat. No. 6,589,743), bulge loop probes (U.S. Pat. No. 6,590,091), pseudo knot probes (U.S. Pat. No. 6,589,250), cyclicons (U.S. Pat. No. 6,383,752), MGB Eclipse.TM. probe (Epoch Biosciences), hairpin probes (U.S. Pat. No. 6,596,490), peptide nucleic acid (PNA.) light-up probes, self-assembled nanoparticle probes, and ferrocene-modified probes described, for example, in U.S. Pat. No. 6,485,901; Mhlanga et al., 2001, Methods 25:463-471; Whitcombe et al., 1999, Nature Biotechnology. 17:804-807; Isacsson et al., 2000, Molecular Cell Probes. 14:321-328; Svanvik et al., 2000, Anal Biochem. 281:26-35; Wolffs et al., 2001, Biotechniques 766:769-771; Tsourkas et al., 2002, Nucleic Acids Research. 30:4208-4215; Riccelli et al., 2002, Nucleic Acids Research 30:4088-4093; Zhang et al., 2002 Shanghai. 34:329-332; Maxwell et al., 2002, J. Am. Chem. Soc. 124:9606-9612; Braude et al., 2002, Trends Biotechnol. 20:249-56; Huang et al., 2002, Chem Res. Toxicol. 15:118-126; and Yu et al., 2001, J. Am. Chem. Soc 14:11155-11161. Detector probes can comprise reporter dyes such as, for example, 6-carboxyfluorescein (6-FAM) or tetrachlorofluorescin (TET). Detector probes can also comprise quencher moieties such as tetramethylrhodamine (TAMRA), Black Hole Quenchers (Biosearch), Iowa Black (IDT), QSY quencher (Molecular Probes), and Dabsyl and Dabcel sulfonate/carboxylate Quenchers (Epoch). Detector probes can also comprise two probes, wherein for example a fluor is on one probe, and a quencher on the other, wherein hybridization of the two probes together on a target quenches the signal, or wherein hybridization on a target alters the signal signature via a change in fluorescence. Detector probes can also comprise sulfonate derivatives of fluorescein dyes with SO.sub.3 instead of the carboxylate group, phosphoramidite forms of fluorescein, phosphoramidite forms of CY5 (available, for example, from Amersham Biosciences-GE Healthcare).

[0091] As used herein, the term "locus-specific primer" refers to an oligonucleotide sequence that hybridizes to products derived from the extension of a first primer (such as an allele-specific primer) in a PCR reaction, and which can effectuate second strand cDNA synthesis of said product. Accordingly, in some embodiments, the allele-specific primer serves as a forward PCR primer and the locus-specific primer serves as a reverse PCR primer, or vice versa. In some preferred embodiments, locus-specific primers are present at a higher concentration as compared to the allele-specific primers.

[0092] As used herein, the term "rare allelic variant" refers to a target polynucleotide present at a lower level in a sample as compared to an alternative allelic variant. The rare allelic variant may also be referred to as a "minor allelic variant" and/or a "mutant allelic variant." For instance, the rare allelic variant may be found at a frequency less than 1/10, 1/100, 1/1,000, 1/10,000, 1/100,000, 1/1,000,000, 1/10,000,000, 1/100,000,000 or 1/1,000,000,000 compared to another allelic variant for a given. SNP or gene. Alternatively, the rare allelic variant can be, for example, less than 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 75, 100, 250, 500, 750, 1,000, 2,500, 5,000, 7,500, 10,000, 25,000, 50,000, 75,000, 100,000, 250,000, 500,000, 750,000, or 1,000,000 copies per 1, 10, 100, 1,000 micro liters of a sample or a reaction volume.

[0093] As used herein, the terms "abundant allelic variant" may refer to a target polynucleotide present at a higher level in a sample as compared to an alternative allelic variant. The abundant allelic variant may also be referred to as a "major allelic variant" and/or a "wild type allelic variant." For instance, the abundant allelic variant may be found at a frequency greater than 10.times., 100.times., 1,000.times., 10,000.times., 100,000.times., 1,000,000.times., 10,000,000.times., 100,000,000.times. or 1,000,000,000.times. compared to another allelic variant for a given SNP or gene. Alternatively, the abundant allelic variant can be, for example, greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 75, 100, 250, 500, 750, 1,000, 2,500, 5,000, 7,500, 10,000, 25,000, 50,000, 75,000, 100,000, 250,000, 500,000, 750,000, 1,000,000 copies per 1, 10, 100, 1,000 micro liters of a sample or a reaction volume.

[0094] As used herein, the terms "first" and "second" are used to distinguish the components of a first reaction (e.g., a "first" reaction; a "first" allele-specific primer) and a second reaction (e.g., a "second" reaction; a "second" allele-specific primer). By convention, as used herein the first reaction amplifies a first (for example, a rare) allelic variant and the second reaction amplifies a second (for example, an abundant) allelic variant or vice versa.

[0095] As used herein, both "first allelic variant" and "second allelic variant" can pertain to alleles of a given locus from the same organism. For example, as might be the case in human samples (e.g., cells) comprising wild type alleles, some of which have been mutated to form a minor or rare allele. The first and second allelic variants of the present teachings can also refer to alleles from different organisms. For example, the first allele can be an allele of a genetically modified organism, and the second allele can be the corresponding allele of a wild type organism. The first allelic variants and second allelic variants of the present teachings can be contained on gDNA, as well as mRNA and cDNA, and generally any target nucleic acids that exhibit sequence variability due to, for example, SNP or nucleotide(s) insertion and/or deletion mutations.

[0096] As used herein, the term "thermostable" or "thermostable polymerase" refers to an enzyme that is heat stable or heat resistant and catalyzes polymerization of deoxyribonucleotides to form primer extension products that are complementary to a nucleic acid strand. Thermostable DNA polymerases useful herein are not irreversibly inactivated when subjected to elevated temperatures for the time necessary to effect destabilization of single-stranded nucleic acids or denaturation of double-stranded nucleic acids during PCR amplification. Irreversible denaturation of the enzyme refers to substantial loss of enzyme activity. Preferably a thermostable DNA polymerase will not irreversibly denature at about 90.degree.-100.degree. C. under conditions such as is typically required for PCR amplification.

[0097] As used herein, the term "PCR amplifying" or "PCR amplification" refers generally to cycling polymerase-mediated exponential amplification of nucleic acids employing primers that hybridize to complementary strands, as described for example in Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press (1990). Devices have been developed that can perform thermal cycling reactions with compositions containing fluorescent indicators which are able to emit a light beam of a specified wavelength, read the intensity of the fluorescent dye, and display the intensity of fluorescence after each cycle. Devices comprising a thermal cycler, light beam emitter, and a fluorescent signal detector, have been described, e.g., in U.S. Pat. Nos. 5,928,907; 6,015,674; 6,174,670; and 6,814,934 and include, but are not limited to, the ABI Prism.RTM. 7700 Sequence Detection System (Applied Biosystems, Foster City, Calif.), the ABI GeneAmp.RTM. 5700 Sequence Detection System (Applied Biosystems, Foster City, Calif.), the ABI GeneAmp.RTM. 7300 Sequence Detection System (Applied Biosystems, Foster City, Calif.), the ABI GeneAmp.RTM. 7500 Sequence Detection System (Applied Biosystems, Foster City, Calif.), the StepOne.TM. Real-Time PCR System (Applied Biosystems, Foster City, Calif.) and the ABI GeneAmp.RTM. 7900 Sequence Detection System (Applied. Biosystems, Foster City, Calif.).

[0098] As used herein, the term "pre-amplification" or "pre-amplify" refers to a process wherein a plurality of primer pairs are included in a multiplexed PCR amplification reaction, and the multiplexed amplification reaction undergoes a limited number of cycles so that the PCR-based pre-amplification reaction ends prior to the PCR plateau and/or reagent depletion. The term "PCR-based pre-amplification" can be considered to indicate that a secondary amplification reaction is subsequently performed, typically of lower plexy level than the PCR-based pre-amplification reaction. This secondary amplification reaction, typically a plurality of separate secondary amplification reactions, can employ primer pairs encoded by the primers used in the multiplexed PCR-based pre-amplification reaction. However, each secondary amplification reaction typically comprises a single or a few primer pairs. Further examples of PCR-based pre-amplification approaches can be found, for example, in U.S. Pat. No. 6,605,451, and U.S. patent application Ser. No. 10/723,520, the disclosures of which are herein incorporated by reference in their entireties.

[0099] As used herein, the term "Tm'" or "melting temperature" of an oligonucleotide refers to the temperature (in degrees Celsius) at which 50% of the molecules in a population of a single-stranded oligonucleotide are hybridized to their complementary sequence and 50% of the molecules in the population are not-hybridized to said complementary sequence. The Tm of a primer or probe can be determined empirically by means of a melting curve. In some cases it can also be calculated using formulas well know in the art (See, e.g., Maniatis, T., et al., Molecular cloning: a laboratory manual/Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.: 1982).

[0100] As used herein, the term "sensitivity" refers to the minimum amount (number of copies or mass) of a template that can be detected by a given assay. As used herein, the term "specificity" refers to the ability of an assay to distinguish between amplification from a matched template versus a mismatched template. Frequently, specificity is expressed as .DELTA.C.sub.t=Ct.sub.mismatch-Ct.sub.match. An improvement in specificity or "specificity improvement" or "fold difference" is expressed herein as 2.sup.(.DELTA.Ct.sup.--.sup.condition1-(.DELTA.Ct.sup.--.sup.condition2). The term "selectivity" refers to the extent to which an AS-PCR assay can be used to determine minor (often mutant) alleles in mixtures without interferences from major (often wild type) alleles. Selectivity is often expressed as a ratio or percentage. For example, an assay that can detect 1 mutant template in the presence of 100 wild type templates is said to have a selectivity of 1:100 or 1%. As used herein, assay selectivity can also be calculated as 1/2.sup..DELTA.Ct or as a percentage using (1/2.sup..DELTA.Ct.times.100).

[0101] As used herein, the term "Ct" or "Ct value" refers to threshold cycle and signifies the cycle of a PCR amplification assay in which signal from a reporter that is indicative of amplicon generation (e.g., fluorescence) first becomes detectable above a background level. In some embodiments, the threshold cycle or "Ct" is the cycle number at which PCR amplification becomes exponential.

[0102] As used herein, the term "delta Ct" or ".DELTA.Ct" refers to the difference in the numerical cycle number at which the signal passes the fixed threshold between two different samples or reactions. In some embodiments delta Ct is the difference in numerical cycle number at which exponential amplification is reached between two different samples or reactions. The delta Ct can be used to identify the specificity between a matched primer to the corresponding target nucleic acid sequence and a mismatched primer to the same corresponding target nucleic acid sequence.

[0103] In some embodiments, the calculation of the delta Ct value between a mismatched primer and a matched primer is used as one measure of the discriminating power of allele-specific PCR. In general, any factor which increases the difference between the Ct value for an amplification reaction using a primer that is matched to a target sequence (e.g., a sequence comprising an allelic variant of interest) and that of a mismatched primer will result in greater allele discrimination power.

[0104] According to various embodiments, a Ct value may be determined using a derivative of a PCR curve. For example, a first, second, or nth order derivative method may be performed on a PCR curve in order to determine a Ct value. In various embodiments, a characteristic of a derivative may be used in the determination of a Ct value. Such characteristics may include, but are not limited by, a positive inflection of a second derivative, a negative inflection of a second derivative, a zero crossing of the second derivative, or a positive inflection of a first derivative. In various embodiments, a Ct value may be determined using a thresholding and baselining method. For example, an upper bound to an exponential phase of a PCR curve may be established using a derivative method, while a baseline for a PCR curve may be determined to establish a lower bound to an exponential phase of a PCR curve. From the upper and lower bound of a PCR curve, a threshold value may be established from which a Ct value is determined. Other methods for the determination of a Ct value known in the art, for example, but not limited by, various embodiments of a fit point method, and various embodiments of a sigmoidal method (See, e.g., U.S. Pat. Nos. 6,303,305; 6,503,720; 6,783,934, 7,228,237 and U.S. Application No. 2004/0096819; the disclosures of which are herein incorporated by reference in their entireties).

III. Compositions, Methods and Kits

[0105] In one aspect, the present invention provides compositions for use in identifying and/or quantitating an allelic variant in a nucleic acid sample. Some of these compositions can comprise: (a) an allele-specific primer; (b) an allele-specific blocker probe; (c) a detector probe; and (d) a locus-specific primer, or any combinations thereof. In some embodiments of the compositions, the compositions may further comprise a polymerase, dNTPs, reagents and/or buffers suitable for PCR amplification, and/or a template sequence or nucleic acid sample. In some embodiments, the polymerase can be thermostable.

[0106] In another aspect, the invention provides compositions comprising: (i) a first allele-specific primer, wherein an allele-specific nucleotide portion of the first allele-specific primer is complementary to the first allelic variant of a target sequence; and (ii) a first allele-specific blocker probe that is complementary to a region of the target sequence comprising the second allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the first allele-specific primer, and wherein the first allele-specific blocker probe comprises a minor groove binder.

[0107] In some illustrative embodiments, the compositions can further include a locus-specific primer that is complementary to a region of the target sequence that is 3' from the first allelic variant and on the opposite strand.

[0108] In further embodiments, the compositions can further include a detector probe.

[0109] In other embodiments, compositions for pre-amplification are further provided as described in further detail below.

[0110] In another aspect, the present invention provides methods for amplifying an allele-specific sequence. Some of these methods can include: (a) hybridizing an allele-specific primer to a first nucleic acid molecule comprising a target allele; (b) hybridizing an allele-specific blocker probe to a second nucleic acid molecule comprising an alternative allele wherein the alternative allele corresponds to the same loci as the target allele; (c) hybridizing a locus-specific detector probe to the first nucleic acid molecule; (d) hybridizing a locus-specific primer to the extension product of the allele-specific primer and (e) PCR amplifying the target allele.

[0111] In another aspect, the present invention provides methods for detecting and/or quantitating an allelic variant in a mixed sample. Some of these methods can involve: (a) in a first reaction mixture hybridizing a first allele-specific primer to a first nucleic acid molecule comprising a first allele (allele-1) and in a second reaction mixture hybridizing a second allele-specific primer to a first nucleic acid molecule comprising a second allele (allele-2), wherein the allele-2 corresponds to the same loci as allele-1; (b) in the first reaction mixture hybridizing a first allele-specific blocker probe to a second nucleic acid molecule comprising allele-2 and in the second reaction mixture hybridizing a second allele-specific blocker probe to a second nucleic acid molecule comprising allele-1; (c) in the first reaction mixture, hybridizing a first detector probe to the first nucleic acid molecule and in the second reaction mixture, hybridizing a second detector probe to the first nucleic acid molecule; (d) in the first reaction mixture hybridizing a first locus-specific primer to the extension product of the first allele-specific primer and in the second reaction mixture hybridizing a second locus-specific primer to the extension product of the second allele-specific primer; and (e) PCR amplifying the first nucleic acid molecule to form a first set or sample of amplicons and PCR amplifying the second nucleic acid molecule to form a second set or sample of amplicons; and (f) comparing the first set of amplicons to the second set of amplicons to quantitate allele-1 in the sample comprising allele-2 and/or allele-2 in the sample comprising allele-1.

[0112] In yet another aspect, the present invention provides methods for detecting and/or quantitating allelic variants. Some of these methods can comprise: (a) PCR amplifying a first allelic variant in a first reaction comprising (i) a low-concentration first allele-specific primer, (ii) a first locus-specific primer, and (iii) a first blocker probe to form first amplicons; (b) PCR amplifying a second allelic variant in a second reaction comprising (i) a low-concentration second allele-specific primer, (ii) a second locus-specific primer, and (iii) a second blocker probe to form second amplicons; and (d) comparing the first amplicons to the second amplicons to quantitate the first allelic variant in the sample comprising second allelic variants.

[0113] In yet another aspect, the present invention provides methods for detecting a first allelic variant of a target sequence in a nucleic acid sample suspected of comprising at least a second allelic variant of the target sequence. Methods of this aspect include forming a first reaction mixture by combining the following: (i) a nucleic acid sample; (ii) a first allele-specific primer, wherein an allele-specific nucleotide portion of the first allele-specific primer is complementary to the first allelic variant of the target sequence; (iii) a first allele-specific blocker probe that is complementary to a region of the target sequence comprising the second allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the first allele-specific primer, and wherein the first allele-specific blacker probe comprises a minor groove binder; (iv) a first locus-specific primer that is complementary to a region of the target sequence that is 3' from the first allelic variant and on the opposite strand; and (v) a first detector probe.

[0114] Next an amplification reaction, typically a PCR amplification reaction, is carried out on the first reaction mixture using the first locus-specific primer and the first allele-specific primer to form a first amplicon. Then, the first amplicon is detected by a change in a detectable property of the first detector probe upon binding to the amplicon, thereby detecting the first allelic variant of the target gene in the nucleic acid sample. The detector probe in some illustrative embodiments is a 5' nuclease probe. The detectable property in certain illustrative embodiments is fluorescence.

[0115] In some embodiments, the 3' nucleotide position of the 5' target region of the first allele-specific primer is an allele-specific nucleotide position. In certain other illustrative embodiments, including those embodiments where the 3' nucleotide position of the 5' target region of the first allele-specific primer is an allele-specific nucleotide position, the blocking region of the allele-specific primer encompasses the allele-specific nucleotide position. Furthermore, in illustrative embodiments, the first allele-specific blacker probe includes a minor groove binder. Furthermore, the allele-specific blocker probe in certain illustrative embodiments does not have a label, for example a fluorescent label, or a quencher.

[0116] In certain illustrative embodiments, the quantity of the first allelic variant is determined by evaluating the change in a detectable property of the first detector probe.

[0117] In certain illustrative embodiments, the method further includes forming a second reaction mixture by combining (i) the nucleic acid sample; (ii) a second allele-specific primer, wherein an allele-specific nucleotide portion of the second allele-specific primer is complementary to the second allelic variant of the target sequence; (iii) a second allele-specific blocker probe that is complementary to a region of the target sequence comprising the first allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the second allele-specific primer, and wherein the second allele-specific blocker probe comprises a minor groove binder; (iv) a second locus-specific primer that is complementary to a region of the target sequence that is 3' from the second allelic variant and on the opposite strand; and (v) a second detector probe. Next, an amplification reaction is carried out on the second reaction mixture using the second allele-specific primer and the locus-specific primer, to form a second amplicon. Then the second amplicon is detected by a change in a detectable property of the detector probe.

[0118] In certain embodiments, the method further includes comparing the change in a detectable property of the first detector probe in the first reaction mixture to the change in a detectable property of the second detector probe in the second reaction mixture.

[0119] In some preferred embodiments, the methods may include a 2-stage cycling protocol. In some embodiments, the methods for detecting an allelic variant in a target sequence in a nucleic acid sample comprises forming a reaction mixture comprising: [0120] i) a nucleic acid sample; [0121] ii) an allele-specific primer, wherein an allele-specific nucleotide portion of the allele-specific primer is complementary to the first allelic variant of the target sequence; [0122] iii) an allele-specific blocker probe that is complementary to a region of the target sequence comprising a second allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the allele-specific primer, and wherein the allele-specific blocker probe comprises a blocking moiety; [0123] iv) a locus-specific primer that is complementary to a region of the target sequence that is 3' from the first allelic variant and on the opposite strand; and [0124] v) a detector probe; [0125] b) PCR amplifying the target sequence using a 2-stage cycling protocol, comprising: [0126] i) a first amplification step comprising a first number of cycles run at a first annealing/extension temperature; and [0127] ii) a second amplification step comprising a second number of cycles run at a second annealing/extension temperature, [0128] wherein the first number of cycles is fewer than the second number of cycles and the first annealing/extension temperature is lower than said second annealing/extension temperature; and [0129] c) detecting a change in a detectable property of the detector probe in the amplified products of the target sequence produced by step (b).

[0130] In some embodiments, the cycling protocol comprises a first stage of amplification that employs an initial number of cycles at a lower annealing/extension temperature, followed by a second stage of amplification that employs a number of cycles at a higher annealing/extension temperature. Due to the lower Tm of cast-PCR allele-specific primers (e.g., 53-56.degree. C.), PCR may not be optimal at standard annealing/extension conditions (e.g., 60-64.degree. C.). Consequently, lower annealing/extension temperatures may be used during the initial cycling stage which improve cast-PCR efficiency significantly.

[0131] In some embodiments, the number of cycles used in the first stage of the cast-PCR cycling protocol is fewer than the number of cycles used in the second stage. In some embodiments of the cast-PCR methods, the number of cycles used in the first stage of the cycling protocol is about 2%-20%, 4%-18%, 6%-16%, 8%-14%, 10%-12%, or any percent in between, of the total number of cycles used in the second stage. In some embodiments, the first stage employs between 1 to 10 cycles, 2 to 8 cycles, 3 to 7 cycles, or 4 to 6 cycles, and all number of cycles in between, e.g., 2, 3, 4, 5, 6, or 7 cycles.

[0132] In some embodiments, the number of cycles used in the second stage of the cast-PCR cycling protocol is greater than the number of cycles used in the second stage. In some embodiments of the cast-PCR methods, the number of cycles used in the second stage of the cycling protocol is 5 times, 6 times, 8 times, 10 times, 12 times, 18 times, 25 times, or 30 times the number of cycles used in the first stage. In some embodiments, the second stage employs between 30 to 50 cycles, 35 to 48 cycles, 40 to 46 cycles, or any number of cycles in between, e.g., 42, 43, 44, 45, or 46 cycles.

[0133] In some embodiments, the lower annealing/extension temperature used during the first cycling stage is about 1.degree. C., about 2.degree. C., about 3.degree. C., about 4.degree. C., or about 5.degree. C. lower than the annealing/extension temperature used during the second cycling stage. In some preferred embodiments, the annealing/extension temperature of the first stage is between 50.degree. C. to 60.degree. C., 52.degree. C. to 58.degree. C., or 54.degree. C. to 56.degree. C., e.g., 53.degree. C., 54.degree. C., 55.degree. C. or 55.degree. C. In some preferred embodiments the annealing/extension temperature of the second stage is between 56.degree. C. to 66.degree. C., 58.degree. C. to 64.degree. C., or 60.degree. C. to 62.degree. C., e.g., 58.degree. C., 60.degree. C., 62.degree. C. or 64.degree. C.

[0134] There are several major advantages of this 2-stage PCR cycling protocol used in cast-PCR that make it better than conventional AS-PCR methods. First, it improves the detection sensitivity by lowering the Ct value for matched targets or alleles. Next, it improves the specificity of cast-PCR by increasing the .DELTA.Ct between Ct values of matched and mismatched sequences. Finally, it can improve the uniformity of cast-PCR by making it similarly efficient across various assays.

[0135] In some embodiments, the 2-stage cycling protocol improves cast-PCR efficiency (e.g. specificity and sensitivity). In some embodiments, the specificity is increased by 2-8.times., 3-7.times., or 4-6.times., or any number of times in between (e.g., 3.times., 4.times., 5.times., 6.times., or 7.times.), more than the specificity of cast-PCR reactions run without the 2-stage cycling protocol. In other embodiments, the sensitivity is increased by 1-3.times., (e.g., 1.times., 2.times., or 3.times.) more than the sensitivity of cast-PCR reactions run without the 2-stage cycling protocol. In some embodiments, the difference in .DELTA.Ct between assays run using cast-PCR with the 2-stage cycling protocol compared to cast-PCR assays run without the 2-stage cycling protocol is a .DELTA.Ct of 1, 2 or 3.

[0136] In yet another aspect, the present invention provides a reaction mixture that includes the following (i) nucleic acid molecule; (ii) an allele-specific primer, wherein an allele-specific nucleotide portion of the allele-specific primer is complementary to a first allelic variant of a target sequence; (iii) an allele-specific blocker probe that is complementary to a region of the target sequence comprising a second allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the allele-specific primer, and wherein the allele-specific blocker probe comprises a minor groove binder; (iv) a locus-specific primer that is complementary to a region of the target sequence that is 3' from the first allelic variant and on the opposite strand; and (v) a detector probe.

[0137] In certain embodiments, the methods of the invention are used to detect a first allelic variant that is present at a frequency less than 1/10, 1/100, 1/1,000, 1/10,000, 1/100,000, 1/1,000,000, 1/10,000,000, 1/100,000,000 or 1/1,000,000,000, and any fractional ranges in between, of a second allelic variant for a given SNP or gene. In other embodiments, the methods are used to detect a first allelic variant that is present in less than 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 75, 100, 250, 500, 750, 1,000, 2,500, 5,000, 7,500, 10,000, 25,000, 50,000, 75,000, 100,000, 250,000, 500,000, 750,000, 1,000,000 copies per 1, 10, 100, 1,000 micro liters, and any fractional ranges in between, of a sample or a reaction volume.

[0138] In some embodiments, the first allelic variant is a mutant. In some embodiments the second allelic variant is wild type. In some embodiments, the present methods can involve detecting one mutant molecule in a background of at least 1,000 to 1,000,000, such as about 1000 to 10,000, about 10,000 to 100,000, or about 100,000 to 1,000,000 wild type molecules, or any fractional ranges in between. In some embodiments, the methods can provide high sensitivity and the efficiency at least comparable to that of TaqMan.RTM.-based assays.

[0139] In some embodiments, the comparison of the first amplicons and the second amplicons involving the disclosed methods provides improvements in specificity from 1,000.times. to 1,000,000.times. fold difference, such as about 1000 to 10,000.times., about 10,000 to 100,000.times., or about 100,000 to 1,000,000.times. fold difference, or any fractional ranges in between. In some embodiments, the size of the amplicons range from about 60-120 nucleotides long.

[0140] In some embodiments, the methods can further include additional steps used for pre-amplification of cast-PCR reactions as described in further detail below.

[0141] In another aspect, the present invention provides kits for quantitating a first allelic variant in a sample comprising an alternative second allelic variants that include: (a) a first allele-specific primer; (b) a second allele-specific primer; (c) a first locus-specific primer; (d) a second locus-specific primer; (e) a first allele-specific blocker probe; (f) a second allele-specific blacker probe; and (g) a polymerase. In some embodiments of the disclosed kits, the kit further comprises a first locus-specific detector probe and a second locus-specific detector probe.

[0142] In another aspect, the present invention provides kits that include two or more containers comprising the following components independently distributed in one of the two or more containers: (i) a first allele-specific primer, wherein an allele-specific nucleotide portion of the first allele-specific primer is complementary to the first allelic variant of a target sequence; and (ii) a first allele-specific blocker probe that is complementary to a region of the target sequence comprising the second allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the first allele-specific primer, and wherein the first allele-specific blocker probe comprises a minor groove binder.

[0143] In some illustrative embodiments, the kits can further include a locus-specific primer that is complementary to a region of the target sequence that is 3' from the first allelic variant and on the opposite strand.

[0144] In other embodiments, the kits can further include a detector probe.

[0145] In some embodiments, the kits can further include additional components used for pre-amplification as described in further detail below.

[0146] In some embodiments, the compositions, methods, and/or kits can be used in detecting circulating cells in diagnosis. In one embodiment, the compositions, methods, and/or kits can be used to detect tumor cells in blood for early cancer diagnosis. In some embodiments, the compositions, methods, and/or kits can be used for cancer or disease-associated genetic variation or somatic mutation detection and validation. In some embodiments, the compositions, methods, and/or kits can be used for genotyping tera-, tri- and di-allelic SNPs. In other embodiments, the compositions, methods, and/or kits can be used for identifying single or multiple nucleotide insertion or deletion mutations. In some embodiments, the compositions, methods, and/or kits can be used for DNA typing from mixed DNA samples for QC and human identification assays, cell line QC for cell contaminations, allelic gene expression analysis, virus typing/rare pathogen detection, mutation detection from pooled samples, detection of circulating tumor cells in blood, and/or prenatal diagnostics.

[0147] In some embodiments, the compositions, methods, and/or kits are compatible with various instruments such as, for example, SDS instruments from Applied. Biosystems (Foster City, Calif.).

[0148] Allele-Specific Primers

[0149] Allele-specific primers (ASPS) designed with low Tms exhibit increased discrimination of allelic variants. In some embodiments, the allele-specific primers are short oligomers ranging from about 15-30, such as about 16-28, about 17-26, about 18-24, or about 20-22, or any range in between, nucleotides in length. In some embodiments, the Tm of the allele-specific primers range from about 50.degree. C. to 70.degree. C., such as about 52.degree. C. to 68.degree. C., about 54.degree. C. to 66.degree. C., about 56.degree. C. to 64.degree. C., about 58.degree. C. to 62.degree. C., or any temperature in between (e.g., 53.degree. C., 54.degree. C., 55.degree. C., 56.degree. C.). In other embodiments, the Tm of the allele-specific primers is about 3.degree. C. to 6.degree. C. higher than the anneal/extend temperature of the PCR cycling conditions employed during amplification.

[0150] Low allele-specific primer concentration can also improve selectivity. Reduction in concentration of allele-specific primers below 900 nM can increase the delta Ct between matched and mismatched sequences. In some embodiments of the disclosed compositions, the concentration of allele-specific primers ranges from about 20 nM to 900 nM, such as about 50 nM to 700 nM, about 100 nM to 500 nM, about 200 nM to 300 nM, about 400 nM to 500 nM, or any range in between. In some exemplary embodiments, the concentration of the allele-specific primers is between about 200 nM to 400 nM.

[0151] In some embodiments, allele-specific primers can comprise an allele-specific nucleotide portion that is specific to the target allele of interest. The allele-specific nucleotide portion of an allele-specific primer is complementary to one allele of a gene, but not another allele of the gene. In other words, the allele-specific nucleotide portion binds to one or more variable nucleotide positions of a gene that is nucleotide positions that are known to include different nucleotides for different allelic variants of a gene. The allele-specific nucleotide portion is at least one nucleotide in length. In exemplary embodiments, the allele-specific nucleotide portion is one nucleotide in length. In some embodiments, the allele-specific nucleotide portion of an allele-specific primer is located at the 3' terminus of the allele-specific primer. In other embodiments, the allele-specific nucleotide portion is located about 1-2, 3-4, 5-6, 7-8, 9-11, 12-15, or 16-20 nucleotides in from the 3' most-end of the allele-specific primer.

[0152] Allele-specific primers designed to target discriminating bases can also improve discrimination of allelic variants. In some embodiments, the nucleotide of the allele-specific nucleotide portion targets a highly discriminating base (e.g., for detection of A/A, A/G, G/A, G/G, A/C, or C/A alleles). Less discriminating bases, for example, may involve detection of C/C, T/C, G/T, T/G, C/T alleles. In some embodiments, for example when the allele to be detected involves A/G or C/T SNPs, A or G may be used as the 3' allele-specific nucleotide portion of the allele-specific primer (e.g., if A or T is the major allele), or C or T may be used as the 3' allele-specific nucleotide portion of the allele-specific primer (e.g., if C or G is the major allele). In other embodiments, A may be used as the nucleotide-specific portion at the 3' end of the allele specific primer (e.g., the allele-specific nucleotide portion) when detecting and/or quantifying A/T SNPs. In other embodiments, G may be used as the nucleotide-specific portion at the 3' end of the allele specific primer when detecting and/or quantifying C/G SNPs.

[0153] In some embodiments, the allele-specific primer can comprise a target-specific portion that is specific to the polynucleotide sequence (or locus) of interest. In some embodiments the target-specific portion is about 75-85%, 85-95%, 95-99% or 100% complementary to the target polynucleotide sequence of interest. In some embodiments, the target-specific portion of the allele-specific primer can comprise the allele-specific nucleotide portion. In other embodiments, the target-specific portion is located 5' to the allele-specific nucleotide portion. The target-specific portion can be about 4-30, about 5-25, about 6-20, about 7-15, or about 8-10 nucleotides in length. In some embodiments, the Tm of the target specific portion is about 5.degree. C. below the anneal/extend temperature used for PCR cycling. In some embodiments, the Tm of the target specific portion of the allele-specific primer ranges from about 51.degree. C. to 60.degree. C., about 52.degree. C. to 59.degree. C., about 53.degree. C. to 58.degree. C., about 54.degree. C. to 57.degree. C., about 55.degree. C. to 56.degree. C., or about 50.degree. C. to about 60.degree. C.

[0154] In some embodiments of the disclosed methods and kits, the target-specific portion of the first allele-specific primer and the target-specific portion of the second allele-specific primer comprise the same sequence. In other embodiments, the target-specific portion of the first allele-specific primer and the target-specific portion of the second allele-specific primer are the same sequence.

[0155] In some embodiments, the allele-specific primer comprises a tail. Allele-specific primers comprising tails, enable the overall length of the primer to be reduced, thereby lowering the Tm without significant impact on assay sensitivity.

[0156] In some exemplary embodiments, the tail is on the 5' terminus of the allele-specific primer. In some embodiments, the tail is located 5' of the target-specific portion and/or allele-specific nucleotide portion of the allele-specific primer. In some embodiments, the tail is about 65-75%, about 75-85%, about 85-95%, about 95-99% or about 100% non-complementary to the target polynucleotide sequence of interest. In some embodiments the tail can be about 2-40, such as about 4-30, about 5-25, about 6-20, about 7-15, or about 8-10 nucleotides in length. In some embodiments the tail is GC-rich. For example, in some embodiments the tail sequence is comprised of about 50-100%, about 60-100%, about 70-100%, about 80-100%, about 90-100% or about 95-100% G and/or C nucleotides.

[0157] The tail of the allele-specific primer may be configured in a number of different ways, including, but not limited to a configuration whereby the tail region is available after primer extension to hybridize to a complementary sequence (if present) in a primer extension product. Thus, for example, the tail of the allele-specific primer can hybridize to the complementary sequence in an extension product resulting from extension of a locus-specific primer.

[0158] In some embodiments of the disclosed methods and kits, the tail of the first allele-specific primer and the tail of the second allele-specific primer comprise the same sequence. In other embodiments, the 5' tail of the first allele-specific primer and the 5' tail of the second allele-specific primer are the same sequence.

[0159] Allele-Specific Blocker Probes

[0160] Allele-specific blocker probes (or ASBs) (herein sometimes referred to as "blocker probes") may be designed as short oligomers that are single-stranded and have a length of 100 nucleotides or less, more preferably 50 nucleotides or less, still more preferably 30 nucleotides or less and most preferably 20 nucleotides or less with a lower limit being approximately 5 nucleotides.

[0161] In some embodiments, the Tm of the blocker probes range from 58.degree. C. to 70.degree. C., 61.degree. C. to 69.degree. C., 62.degree. C. to 68.degree. C., 63.degree. C. to 67.degree. C., 64.degree. C. to 66.degree. C., or about 60.degree. C. to about 63.degree. C., or any range in between. In yet other embodiments, the Tm of the allele-specific blocker probes is about 3.degree. C. to 6.degree. C. higher than the anneal/extend temperature in the PCR cycling conditions employed during amplification.

[0162] In some embodiments, the blocker probes are not cleaved during PCR amplification. In some embodiments, the blocker probes comprise a non-extendable blocker moiety at their 3'-ends. In some embodiments, the blocker probes can further comprise other moieties (including, but not limited to additional non-extendable blocker moieties, quencher moieties, fluorescent moieties, etc) at their 3'-end, 5'-end, and/or any internal position in between. In some embodiments, the allele position is located about 5-15, such as about 5-11, about 6-10, about 7-9, about 7-12, or about 9-11, such as about 6, about 7, about 8, about 9, about 10, or about 11 nucleotides away from the non-extendable blocker moiety of the allele-specific blocker probes when hybridized to their target sequences. In some embodiments, the non-extendable blocker moiety can be, but is not limited to, an amine (NH.sub.2), biotin, PEG, DPI.sub.3, or PO.sub.4. In some preferred embodiments, the blocker moiety is a minor groove binder (MGB) moiety. (The oligonucleotide-MGB conjugates of the present invention are hereinafter sometimes referred to as "MGB blocker probes" or "MGB blockers.")

[0163] As disclosed herein, the use of MGB moieties in allele-specific blocker probes can increase the specificity of allele-specific PCR. One possibility for this effect is that, due to their strong affinity to hybridize and strongly bind to complementary sequences of single or double stranded nucleic acids, MGBs can lower the Tm of linked oligonucleotides (See, for example, Kutyavin, I., et al., Nucleic Acids Res., 2000, Vol. 28, No. 2: 655-661). Oligonucleotides comprising MGB moieties have strict geometric requirements since the linker between the oligonucleotide and the MGB moiety must be flexible enough to allow positioning of the MGB in the minor groove after DNA duplex formation. Thus, MGB blocker probes can provide larger Tm differences between matched versus mismatched alleles as compared to conventional DNA blocker probes.

[0164] In general, MGB moieties are molecules that bind within the minor groove of double stranded. DNA. Although a generic chemical formula for all known MGB compounds cannot be provided because such compounds have widely varying chemical structures, compounds which are capable of binding in the minor groove of DNA, generally speaking, have a crescent shape three dimensional structure. Most MGB moieties have a strong preference for A-T (adenine and thymine) rich regions of the B form of double stranded DNA. Nevertheless, MGB compounds which would show preference to C-G (cytosine and guanine) rich regions are also theoretically possible. Therefore, oligonucleotides comprising a radical or moiety derived from minor groove binder molecules having preference for C-G regions are also within the scope of the present invention.

[0165] Some MGBs are capable of binding within the minor groove of double stranded DNA with an association constant of 10.sup.3M.sup.-1 or greater. This type of binding can be detected by well established spectrophotometric methods such as ultraviolet (UV) and nuclear magnetic resonance (NMR) spectroscopy and also by gel electrophoresis. Shifts in UV spectra upon binding of a minor groove binder molecule and NMR spectroscopy utilizing the "Nuclear Overhauser" (NOSEY) effect are particularly well known and useful techniques for this purpose. Gel electrophoresis detects binding of an MGB to double stranded DNA or fragment thereof, because upon such binding the mobility of the double stranded DNA changes.

[0166] A variety of suitable minor groove binders have been described in the literature. See, for example, Kutyavin, et al. U.S. Pat. No. 5,801,155; Wemmer, D. E., and Dervan P. B., Current Opinion in Structural Biology, 7:355-361 (1997); Walker, W. L., Kopka, J. L. and Goodsell, D. S., Biopolymers, 44:323-334 (1997); Zimmer, C & Wahnert, U. Prog. Biophys. Molec. Bio. 47:31-112 (1986) and Reddy, B. S. P., Dondhi, S. M., and Lown, J. W., Pharmacol. Therap., 84:1-111 (1999). In one group of embodiments, the MGB is selected from the group consisting of CC1065 analogs, lexitropsins, distamycin, netropsin, berenil, duocarmycin, pentamidine, 4,6-diamino-2-phenylindole and pyrrolo[2,1-c][1,4]benzodiazepines. A preferred MGB in accordance with the present disclosure is DPI.sub.3 (see U.S. Pat. No. 6,727,356, the disclosure of which is incorporated herein by reference in its entirety).

[0167] Suitable methods for attaching MGBs through linkers to oligonucleotides or probes and have been described in, for example, U.S. Pat. Nos. 5,512,677; 5,419,966; 5,696,251; 5,585,481; 5,942,610; 5,736,626; 5,801,155 and 6,727,356. (The disclosures of each of which are incorporated herein by reference in their entireties.) For example, MGB-oligonucleotide conjugates can be synthesized using automated oligonucleotide synthesis methods from solid supports having cleavable linkers. In other examples, MGB probes can be prepared from an MGB modified solid support substantially in accordance with the procedure of Lukhtanov et al. Bioconjugate Chern., 7: 564-567 (1996). (The disclosure of which is also incorporated herein by reference in its entirety.) According to these methods, one or more MGB moieties can be attached at the 5'-end, the 3'-end and/or at any internal portion of the oligonucleotide.

[0168] The location of an MGB moiety within an MGB-oligonucleotide conjugate can affect the discriminatory properties of such a conjugate. An unpaired region within a duplex will likely result in changes in the shape of the minor groove in the vicinity of the mismatched base(s). Since MGBs fit best within the minor groove of a perfectly-matched DNA duplex, mismatches resulting in shape changes in the minor groove would reduce binding strength of an MGB to a region containing a mismatch. Hence, the ability of an MGB to stabilize such a hybrid would be decreased, thereby increasing the ability of an MGB-oligonucleotide conjugate to discriminate a mismatch from a perfectly-matched duplex. On the other hand, if a mismatch lies outside of the region complementary to an MGB-oligonucleotide conjugate, discriminatory ability for unconjugated and MGB-conjugated oligonucleotides of equal length is expected to be approximately the same. Since the ability of an oligonucleotide probe to discriminate single base pair mismatches depends on its length, shorter oligonucleotides are more effective in discriminating mismatches. The first advantage of the use of MGB-oligonucleotides conjugates in this context lies in the fact that much shorter oligonucleotides compared to those used in the art (i.e., 20-mers or shorter), having greater discriminatory powers, can be used, due to the pronounced stabilizing effect of MGB conjugation. Consequently, larger delta Tms of allele-specific blocker probes can improve AS-PCR assay specificity and selectivity.

[0169] Blocker probes having MGB at the 5' termini may have additional advantages over other blocker probes having a blocker moiety (e.g., MGB, PO.sub.4, NH.sub.2, PEG, or biotin) only at the 3' terminus. This is at least because blocker probes having MGB at the 5' terminus (in addition to a blocking moiety at the 3'-end that prevents extension) will not be cleaved during PCR amplification. Thus, the probe concentration can be maintained at a constant level throughout PCR, which may help maintain the effectiveness of blocking non-specific priming, thereby increasing cast-PCR assay specificity and selectivity (FIG. 3).

[0170] In some embodiments, as depicted in FIG. 4A, the allele-specific primer and/or the allele-specific blocker probe can comprise one or more modified nucleobases or nucleosidic bases different from the naturally occurring bases (i.e., adenine, cytosine, guanine, thymine and uracil). In some embodiments, the modified bases are still able to effectively hybridize to nucleic acid units that contain adenine, guanine, cytosine, uracil or thymine moieties. In some embodiments, the modified base(s) may increase the difference in the Tm between matched and mismatched target sequences and/or decrease mismatch priming efficiency, thereby improving not only assay specificity, bust also selectivity.

[0171] Modified bases are considered to be those that differ from the naturally-occurring bases by addition or deletion of one or more functional groups, differences in the heterocyclic ring structure (i.e., substitution of carbon for a heteroatom, or vice versa), and/or attachment of one or more linker arm structures to the base. In some embodiments, all tautomeric forms of naturally occurring bases, modified bases and base analogues may also be included in the oligonucleotide primers and probes of the invention.

[0172] Some examples of modified base(s) may include, for example, the general class of base analogues 7-deazapurines and their derivatives and pyrazolopyrimidines and their derivatives (described in PCT WO 90/14353; and U.S. application Ser. No. 09/054,630, the disclosures of each of which are incorporated herein by reference in their entireties). Examples of base analogues of this type include, for example, the guanine analogue 6-amino-1H-pyrazolo[3,4-d]pyrimidin-4(5H)-one (ppG), the adenine analogue 4-amino-1H-pyrazolo[3,4-d]pyrimidine (ppA), and the xanthine analogue 1H-pyrazolo[4,4-d]pyrimidin-4(5H)-6(7H)-dione (ppX). These base analogues, when present in an oligonucleotide of some embodiments of this invention, strengthen hybridization and can improve mismatch discrimination.

[0173] Additionally, in some embodiments, modified sugars or sugar analogues can be present in one or more of the nucleotide subunits of an oligonucleotide conjugate in accordance with the invention. Sugar modifications include, but are not limited to, attachment of substituents to the 2', 3' and/or 4' carbon atom of the sugar, different epimeric forms of the sugar, differences in the .alpha.- or .beta.-configuration of the glycosidic bond, and other anomeric changes. Sugar moieties include, but are not limited to, pentose, deoxypentose, hexose, deoxyhexose, ribose, deoxyribose, glucose, arabinose, pentofuranose, xylose, lyxose, and cyclopentyl.

[0174] Locked nucleic acid (LNA)-type modifications, for example, typically involve alterations to the pentose sugar of ribo- and deoxyribonucleotides that constrains, or "locks," the sugar in the N-type conformation seen in A-form DNA. In some embodiments, this lock can be achieved via a 2'-O, 4'-C methylene linkage in 1,2:5,6-di-O-isopropylene-.alpha.-D-allofuranose. In other embodiments, this alteration then serves as the foundation for synthesizing locked nucleotide phosphoramidite monomers. (See, for example, Wengel J., Ace. Chem. Res., 32:301-310 (1998), U.S. Pat. No. 7,060,809; Obika, et al., Tetrahedron Lett 39: 5401-5405 (1998); Singh, et al., Chem Commun 4:455-456 (1998); Koshkin, et al., Tetrahedron 54: 3607-3630 (1998), the disclosures of each of which are incorporated herein by reference in their entireties.)

[0175] In some preferred embodiments, the modified bases include 8-Aza-7-deaza-dA (ppA), 8-Aza-7-deaza-dG (ppG), 2'-Deoxypseudoisocytidine (iso dC), 5-fluoro-2'-deoxyuridine (fdU), locked nucleic acid (LNA), or 2'-O,4'-C-ethylene bridged nucleic acid (ENA) bases. Other examples of modified bases that can be used in the invention are depicted in FIG. 4B and described in U.S. Pat. No. 7,517,978 (the disclosure of which is incorporated herein by reference in its entirety).

[0176] Many modified bases, including for example, LNA, ppA, ppG, 5-Fluoro-dU (fdU), are commercially available and can be used in oligonucleotide synthesis methods well known in the art. In some embodiments, synthesis of modified primers and probes can be carried out using standard chemical means also well known in the art. For example, in certain embodiments, the modified moiety or base can be introduced by use of a (a) modified nucleoside as a DNA synthesis support, (b) modified nucleoside as a phosphoramidite, (c) reagent during DNA synthesis (e.g., benzylamine treatment of a convertible amidite when incorporated into a DNA sequence), or (d) by post-synthetic modification.

[0177] In some embodiments, the primers or probes are synthesized so that the modified bases are positioned at the 3' end. In some embodiments, the modified base are located between, 1-6 nucleotides, e.g., 2, 3, 4 or 5 nucleotides away from the 3'-end of the allele-specific primer or blocker probe. In some preferred embodiments, the primers or probes are synthesized so that the modified bases are positioned at the 3'-most end of the allele-specific primer or blocker probe.

[0178] Modified internucleotide linkages can also be present in oligonucleotide conjugates of the invention. Such modified linkages include, but are not limited to, peptide, phosphate, phosphodiester, phosphodiester, alkylphosphate, alkanephosphonate, thiophosphate, phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, substituted phosphoramidate and the like. Several further modifications of bases, sugars and/or internucleotide linkages, that are compatible with their use in oligonucleotides serving as probes and/or primers, will be apparent to those of skill in the art.

[0179] In addition, in some embodiments, the nucleotide units which are incorporated into the oligonucleotides of the allele-specific primers and/or blocker probes of the present invention may have a cross-linking function (an alkylating agent) covalently bound to one or more of the bases, through a linking arm.

[0180] In some embodiments of the methods and kits, the first allele-specific blocker probe binds to the same strand or sequence as the first allele-specific primer, while the second allele-specific blocker probe binds to the opposite strand and/or complementary sequence as the first allele-specific primer.

[0181] Detector Probes

[0182] In some embodiments, detector probe is designed as short oligomers ranging from about 15-30 nucleotides, such as about 16, about 18, about 22, about 24, about 30, or any number in between. In some embodiments, the Tm of the detector probe ranges from about 60.degree. C. to 70.degree. C., about 61.degree. C. to 69.degree. C., about 62.degree. C. to 68.degree. C., about 63.degree. C. to 67.degree. C., or about 64.degree. C. to 66.degree. C., or any temperature in between.

[0183] In some embodiments, the detector probe is a locus-specific detector probes (LST). In other embodiments the detector probe is a 5' nuclease probe. In some exemplary embodiments, the detector probe can comprises an MGB moiety, a reporter moiety (e.g., FAM.TM., TET.TM., JOE.TM., VIC.TM., or SYBR.RTM. Green), a quencher moiety (e.g., Black Hole Quencher.TM. or TAMRA.TM.;), and/or a passive reference (e.g., ROX.TM.). In some exemplary embodiments, the detector probe is designed according to the methods and principles described in U.S. Pat. No. 6,727,356 (the disclosure of which is incorporated herein by reference in its entirety). In some exemplary embodiments, the detector probe is a TaqMan.RTM. probe (Applied Biosystems, Foster City). In exemplary embodiments, the locus-specific detector probe can be designed according to the principles and methods described in U.S. Pat. No. 6,727,356 (the disclosure of which is incorporated herein by reference in its entirety). For example, fluorogenic probes can be prepared with a quencher at the 3' terminus of a single DNA strand and a fluorophore at the 5' terminus. In such an example, the 5'-nuclease activity of a Tag DNA polymerase can cleave the DNA strand, thereby separating the fluorophore from the quencher and releasing the fluorescent signal. In some embodiments, the detector probes are hybridized to the template strands during primer extension step of PCR amplification (e.g., at 60-65.degree. C.). In yet other embodiments, an MGB is covalently attached to the quencher moiety of the locus-specific detector probes (e.g., through a linker).

[0184] In some embodiments of the disclosed methods and kits, the first and second detector probes are the same and/or comprise the same sequence or are the same sequence.

[0185] Locus-Specific Primers

[0186] In some embodiments, locus-specific primer (LSP) is designed as a short oligomer ranging from about 15-30 nucleotides, such as about 16, about 18, about 22, about 24, about 30, or any number in between. In some embodiments, the Tm of the locus-specific primer ranges from about 60.degree. C. to 70.degree. C., about 61.degree. C. to 69.degree. C., about 62.degree. C. to 68.degree. C., about 63.degree. C. to 67.degree. C., or about 64.degree. C. to 66.degree. C., or any range in between.

[0187] In some other embodiments of the disclosed methods and kits, the first locus-specific detector probe and/or second locus-specific detector probes comprise the same sequence or are the same sequence.

[0188] Additional Components

[0189] Polymerase enzymes suitable for the practice of the present invention are well known in the art and can be derived from a number of sources. Thermostable polymerases may be obtained, for example, from a variety of thermophilic bacteria that are commercially available (for example, from American Type Culture Collection, Rockville, Md.) using methods that are well-known to one of ordinary skill in the art (See, e.g., U.S. Pat. No. 6,245,533). Bacterial cells may be grown according to standard microbiological techniques, using culture media and incubation conditions suitable for growing active cultures of the particular species that are well-known to one of ordinary skill in the art (See, e.g., Brock, T. D., and Freeze, H., J. Bacterial. 98(1):289-297 (1969); Oshima, T., and Imahori, K, Int. J. Syst. Bacteriol. 24(1):102-112 (1974)). Suitable for use as sources of thermostable polymerases are the thermophilic bacteria Thermus aquaticus, Thermus thermophilus, Thermococcus litoralis, Pyrococcus furiosus, Pyrococcus woosii and other species of the Pyrococcus genus, Bacillus stearothermophilus, Sulfolobus acidocaldarius, Thermoplasma acidophilum, Thermus flavus, Thermus ruber, Thermus brockianus, Thermotoga neapolitana, Thermotoga maritima and other species of the Thermotoga genus, and Methanobacterium thermoautotrophicum, and mutants of each of these species. Preferable thermostable polymerases can include, but are not limited to, Tag DNA polymerase, The DNA polymerase, Tma DNA polymerase, or mutants, derivatives or fragments thereof.

[0190] Various Sources and/or Preparation Methods of Nucleic Acids

[0191] Sources of nucleic acid samples in the disclosed compositions, methods and/or kits include, but are not limited to, human cells such as circulating blood, buccal epithelial cells, cultured cells and tumor cells. Also other mammalian tissue, blood and cultured cells are suitable sources of template nucleic acids. In addition, viruses, bacteriophage, bacteria, fungi and other micro-organisms can be the source of nucleic acid for analysis. The DNA may be genomic or it may be cloned in plasmids, bacteriophage, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs) or other vectors. RNA may be isolated directly from the relevant cells or it may be produced by in vitro priming from a suitable RNA promoter or by in vitro transcription. The present invention may be used for the detection of variation in genomic DNA whether human, animal or other. It finds particular use in the analysis of inherited or acquired diseases or disorders. A particular use is in the detection of inherited diseases.

[0192] In some embodiments, template sequence or nucleic acid sample can be gDNA. In other embodiments, the template sequence or nucleic acid sample can be cDNA. In yet other embodiments, as in the case of simultaneous analysis of gene expression by RT-PCR, the template sequence or nucleic acid sample can be RNA. The DNA or RNA template sequence or nucleic acid sample can be extracted from any type of tissue including, for example, formalin-fixed paraffin-embedded tumor specimens.

[0193] Pre-Amplification

[0194] In another aspect, additional compositions, methods and kits are provided for "boosting" or pre-amplifying cast-PCR amplification reactions. In some embodiments, pre-amplification of cast-PCR reactions is employed for limited quantity specimens having very low nucleic acid copy number.

[0195] In some embodiments, said "boosting" compositions, methods and kits involve a two-step amplification process comprising a first pre-amplification reaction (see, for example, U.S. Pat. Nos. 6,605,451 and 7,087,414 and U.S. Published Application No. 2004/0175733, the disclosures of which are herein incorporated by reference in their entireties), followed by a second amplification (i.e., cast-PCR) reaction.

[0196] In some embodiments, pre-amplification composition used in cast-PCR pre-amplification reactions comprise: [0197] i) a nucleic acid sample; and [0198] ii) at least two sets of primers wherein each set comprises (a) a first allele-specific primer and a second allele-specific primer, wherein the allele-specific nucleotide portion of said first and second allele-specific primers is complementary to a first allele and a second allele, respectively, of a given SNP within a target sequence; and (b) a locus-specific primer that is complementary to a region of said target sequence that is 3' from the first and second alleles and on the opposite strand; wherein the at least two sets of primers is each specific for a different target sequence.

[0199] In some embodiments, the cast-PCR pre-amplification methods comprise: [0200] a) forming in a single vessel a first reaction mixture comprising: [0201] i) a nucleic acid sample; and [0202] ii) at least two sets of primers wherein each set comprises (a) a first allele-specific primer and a second allele-specific primer, wherein the allele-specific nucleotide portion of said first and second allele-specific primers is complementary to a first allele and a second allele, respectively, of a given SNP within a target sequence; and (b) a locus-specific primer that is complementary to a region of said target sequence that is 3' from the first and second alleles and on the opposite strand; wherein the at least two sets of primers is each specific for a different target sequence; [0203] b) amplifying said different target sequences using a number of cycles suitable to keep the reaction within a linear phase; [0204] c) dividing the amplified products of step (b) into at least two separate vessels; [0205] d) adding to each of the divided products of step (c) [0206] i) at least one set of primers used in step (a), [0207] ii) an allele-specific blocker probe that is complementary to a region of said target sequence comprising a second allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the first allele-specific primer, and wherein the first allele-specific blocker probe comprises a minor groove binder; and [0208] iv) a detector probe [0209] to form a second and a third reaction mixture in the at least two separate vessels; [0210] e) amplifying said target sequence in said second and third reaction mixtures; and [0211] f) detecting a change in a detectable property of the detector probe in each of the amplified products of said target sequence produced by step (e), thereby detecting the allelic variant of the target gene in the nucleic acid sample.

[0212] In some embodiments, the first reaction is a multiplex reaction and said second reaction is a single-plex reaction. In some preferred embodiments, the multiplex reaction involves the use of at least two complete sets of primers (e.g., a set comprises one forward allele-1-specific primer, one forward allele-2-specific primer and one reverse locus-specific primer), each set of which is suitable or operative for amplifying a specific polynucleotide of interest. In other embodiments, the resultant multiplex products acquired in the first step are divided into optimized secondary single-plex cast-PCR amplification reactions, each containing at least one primer set previously used in the first multiplexing step and then PCR amplified using the cast-PCR methods described herein.

[0213] In other preferred embodiments, the first multiplex reaction is a cast-PCR amplification reaction (although other well known amplification methods such as, but not limited to PCR, RT-PCR, NASBA, SDA, TMA, CRCA, Ligase Chain Reaction, etc. can be used). In certain embodiments, the first multiplex reaction comprises a plurality of allele-specific primers, and locus-specific primers, each group of which is specific for a particular allele of interest and designed according to the cast-PCR methods described herein. Unlike single-plex cast-PCR reactions that generate a single amplified sequence, multiplex cast-PCR amplification reactions, by virtue of utilizing a plurality of different primer sets, can permit the simultaneous amplification of a plurality of different sequences of interest in a single reaction. Because a plurality of different sequences is amplified simultaneously in a single reaction, the multiplex amplifications can effectively increase the concentration or quantity of a sample available for downstream cast-PCR assays. Thus, in some preferred embodiments, significantly more analyses or assays can be performed with a pre-amplified cast-PCR sample than could have been performed with the original sample.

[0214] The number of different amplification primer pairs utilized in the multiplex amplification is not critical and can range from as few as two, to as many as tens, hundreds, thousands, or even more. Thus, depending upon the particular conditions, the multiplex amplifications permit the simultaneous amplification of from as few as two to as many as tens, hundreds, thousands, or even more polynucleotide sequences of interest.

[0215] The number of amplification cycles performed with a multiplex amplification may depend upon, among other factors, the degree of amplification desired. The degree of amplification desired, in turn, may depend upon such factors as the amount of polynucleotide sample to be amplified or the number of alleles or mutations to be detected using subsequent cast-PCR assays.

[0216] In preferred embodiments, it may be desirable to keep the multiplex amplification from progressing beyond the exponential phase or the linear phase. Indeed, in some embodiments, it may be desirable to carry out the multiplex amplification for a number of cycles suitable to keep the reaction within the exponential or linear phase. Utilization of a truncated multiplex amplification round can result in a sample having a boosted product copy number of about 100-1000 fold increase.

[0217] In many embodiments, pre-amplification permits the ability to perform cast-PCR assays or analyses that require more sample, or a higher concentration of sample, than was originally available. For example, after a 10.times., 100.times., 1000.times., 10,000.times., and so on, multiplex amplification, subsequent cast-PCR single-plex assays can then be performed using, respectively, a 10.times., 100.times., 1000.times., 10,000.times., and so on, less sample volume. In some embodiments, this allows each single-plex cast-PCR reaction to be optimized for maximum sensitivity and requires only one method of detection for each allele analyzed. This can be a significant benefit to cast-PCR analysis since, in some embodiments, it allows for the use of off-the-shelf commercially available cast-PCR reagents and kits to be pooled together and used in a multiplex amplification reaction without extensive effort toward or constraints against redesigning and/or re-optimizing cast-PCR assays for any given target sequence. Moreover, in some embodiments, the ability to carry out a multiplex amplification with reagents and kits already optimized for cast-PCR analysis permits the creation of multiplex amplification reactions that are ideally correlated or matched with subsequent single-plex cast-PCR assays.

[0218] In one aspect, kits are provided that include at least one separate container comprising the following components independently distributed in at least one of the separate containers: (i) a first allele-specific primer, wherein an allele-specific nucleotide portion of the first allele-specific primer is complementary to the first allelic variant of a target sequence; (ii) a second allele-specific primer wherein an allele-specific nucleotide portion of the second allele-specific primer is complementary to the second allelic variant of a target sequence; and (iii) a common locus-specific primer.

[0219] The following examples are intended to illustrate but not limit the invention.

EXAMPLES

I. General Cast-PCR Assay Design

[0220] The general schema for the cast-PCR assays used in the following examples is illustrated in FIG. 1. For each SNP that was analyzed, allele-specific primers (ASPs) were designed to target a first allele (i.e. allele-1) and a second allele (i.e. allele-2). The cast-PCR assay reaction mixture for allele-1 analysis included a 5'-tailed allele-1-specific primer (ASP1), one MGB allele-2 blocker probe (MGB2), one common locus-specific TaqMan probe (LST) and one common locus-specific primer (LSP). The cast-PCR assay reaction mixture for analysis of allele-2 included a 5'-tailed allele-2-specific primer (ASP2), one MGB allele-1 blacker probe (MGB1), one common locus-specific TaqMan probe (LST) and one common locus-specific primer (LSP).

II. Reaction Conditions

[0221] Each assay reaction mixture (10 .mu.l total) contained 1.times. TaqMan Genotyping Master Mixture (Applied Biosystems, Foster City, Calif.; P/N 437135), 0.5 ng/.mu.L genomic DNA or 1 million copies of plasmid DNA (or as indicated otherwise), 300 nM (unless specified otherwise) tailed-, or in some cases untailed-, allele-specific primer (ASP1 for detection of allele-1 or ASP2 for detection of allele-2), 200 nM TaqMan probe (LST), 900 nM locus-specific primer (LSP), 150 nM allele-specific MGB blocker probe (MGB1 for detection of allele-2 or MGB2 for detection of allele-1). The reactions were incubated in a 384-well plate at 95.degree. C. for 10 minutes, then for 5 cycles at 95.degree. C. for 15 seconds and 58.degree. C. for 1 minute, then by 45 cycles at 95.degree. C. for 15 seconds and 60.degree. C. for 1 minute. All reactions were run in duplicate or higher replication in an ABI PRISM 7900HT.RTM. Sequence Detection System, according to the manufacturer's instructions.

[0222] The 2-stage cycling protocol used in the following examples for cast-PCR amplification reactions is different from conventional allele-specific PCR (AS-PCR). The 2-stage cycling protocol comprises an initial 5 cycles at a lower annealing/extension temperature (e.g., 58.degree. C.), followed by 45 standard cycles at a higher annealing/extension temperature (e.g., 60.degree. C.). Due to the lower Tm of cast-PCR allele-specific primers (e.g., 53-56.degree. C.), PCR is not optimal at standard annealing/extension conditions (e.g., 60.degree. C.). Consequently, lower annealing/extension temperatures used during the initial 5 cycles increases overall cast-PCR efficiency.

III. Nucleic Acid Samples

[0223] Plasmids containing specific SNP sequences were designed and ordered from BlueHeron (Bothell, Wash.). (See Table 1 for a list of plasmids comprising SNPs used in some of the following examples.) The plasmids were quantified using TaqMan RNase P Assay (Applied Biosystems, Foster City, Calif.; P/N 4316838) according to the manufacturer's instructions and were used as templates (See Table 1, RNase P Control) to validate sensitivity, linear dynamic range, specificity, and selectivity of the given assays.

[0224] Genomic DNAs were purchased from Coriell Institute for Medical Research (Camden, N.J.; NA17203, NA17129, NA17201). The genotypes of target SNPs were validated with TaqMan SNP Genotyping Assays (Applied Biosystems, Foster City, Calif.; P/N 4332856) according to the manufacturer's instructions.

IV. Modified Oligonucleotides

[0225] Modified bases were purchased from Berry and Associates (ppA: P/N BA 0239; ppG: P/N BA 0242; fdU: P/N BA 0246; and iso dC: P/N BA 0236) or Exicon (LNA-T Amidite: P/N EQ-0064; LNA-mC Amidite: P/N EQ-0066; LNA-G Amidite: P/N EQ-0082; and LNA-A Amidite: P/N EQ-0063). Oligonucleotides comprising the modified nucleotides at their 3' ends were synthesized according to the manufacturer's instructions.

TABLE-US-00001 TABLE 1 Plasmid SNP Sequences (target alleles are indicated in brackets). SNP ID Sequence CV11201742 GCTCTGCTTCATTCCTGTCTGAAGAAGGGCAGATAGTTTGGCTGCTCCTGTG[C/T]TGTCAC- CTGCAATTCTCC CTTATCAGGGCCATTGGCCTCTCCCTTCTCTCTGTGAGGGATATTTTCTCTGACTTGTCAATCCACATCTTCC CV11349123 GGCTTGCAATGGCTCCAACCGGAAGGGCGGTGCTCGAGCTGTGGTGCGTGC[C/T]GCTAAGT- TGTGCGTTCCA GGGTGCACTCGC CV1207700 GCAACTATACCCTTGATGGATGGAGATTTA[C/T]GCAATGTGTTTTACTGGGTAGAGTGACAG- ACCTT CV25594064 CCTGAACTTATTTGGCAAGAGCGATGAGTACTCTTAAAATTACTATCTGGAAATTATATTATT- TAGAATCTGCC AATTACCTAGATCCCCCCT[C/G]AACAATTGTTTCACCAAGGAACTTCCTGAA CV25639181 GAATTGGTTGTCTCCTTATGGGAACTGGAAGTATTTTGACA[G/T]CTTTACCACATTTCTTC- ATGGGATAGTAA GTGTTAAACAGCTCTGAGCCATTTATTATCAGCTACTTGTAAATTAGCAGTAGAATTTTATTTTTATACTTGT- AA GTGGGCAGTTACCTTTTGAGAGGAATACCTATAG RNaseP Control GCGGAGGGAAGCTCATCAGTGGGGCCACGAGCTGAGTGCGTCCTGTCACTCCACTCCCATGTCCCTTGGGAAG GTCTGAGACTAGGG BRAF-1799TA TACTACACCTCAGATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAG [T/A]GAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGTAAGAA- TT GAGGCTATTTTTCCACTGATTAAATTTTTGGCCCTGAGATGCTGCTGAGTT CTNNB1-121AG TGCTAATACTGTTTCGTATTTATAGCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGG CTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACT[A/G]CCACAGCTC- CT TCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTCCCAAGTC CTNNB1-134-CT TTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTTAC CTGGACTCTGGAATCCATTCTGGTGCCACTACCACAGCTCCTT[C/T]TCTGAGTGGTAAAGGCAATCCTGAG- G AAGAGGATGTGGATACCTCCCAAGTCCTGTATGAGTGGGAA EGFR-2369CT GTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCA[C/T]GCAG- C TCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTACCTGCTCAA- C TGGTGTGTGCAGATCGCAAAGGTAATCAGGGAAGGGA EGFR-2573TG GCATGAACTACTTGGAGGACCGTCGCTTGGTGCACCGCGACCTGGCAGCCAGGAACGTACTGGTGAAAACACC GCAGCATGTCAAGATCACAGATTTTGGGC[T/G]GGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGC AGAAGGAGGCAAAGTAAGGAGGTG KRAS-176CG CAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGAC- ACAG[C/G]AG GTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCAT AAATAATACTAAATCATTTGAAGATATTC KRAS-183AC ACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTC- A[A/C]GAGG AGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATAC TAAATCATTTGAAGATATTCACCATTATAGGTGGGTTTAAATTGAATATAATAAGCTGACATTAA KRAS-34GA TATTAACCTTATGTGTGACATGTTCTAATATAGTCACATTTTCATTATTTTTATTATAAGGCCT- GCTGAAAATGA CTGAATATAAACTTGTGGTAGTTGGAGCT[G/A]GTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTC- A GAATCATTTTGTGGACGAATATGA KRAS-35GA TATTAACCTTATGTGTGACATGTTCTAATATAGTCACATTTTCATTATTTTTATTATAAGGCCT- GCTGAAAATGA CTGAATATAAACTTGTGGTAGTTGGAGCTG[G/A]TGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTC- A GAATCATTTTGTGGACGAATATGATC KRAS-38GA CATTATTTTTATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGG- TG[G/A]CGTA GGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGTAA ATCTTGTTTTAATATGCATATTACTGGTGCAGGACCATTCTTTGATACAGATAAAGGTTTCTCTGACCATTTT- CA TGAGTACTTAT NRAS-181CA ATTCTTACAGAAAACAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGGATACAG- CTGGA[C/A]A AGAAGAGTACAGTGCCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCCTCTGTGTATTTGCCATCAAT AATAGCAAGTCATTTGCGGATATTAACCTCTACAGGTACTAGGAGCATTATTTTCTCTGAAAGGATG NRAS-183AT TTACAGAAAACAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGG- ACA[A/T]GAA GAGTACAGTGCCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCCTCTGTGTATTTGCCATCAATAATA GCAAGTCATTTGCGGATATTAACCTCTACAGGTACTAGGAGCATTATTTTCTCTGAAAGGATG NRAS-35GA TGGTTTCCAACAGGTTCTTGCTGGTGTGAAATGACTGAGTACAAACTGGTGGTGGTTGGAGCAG- [G/A]TGGTG TTGGGAAAAGCGCACTGACAATCCAGCTAATCCAGAACCACTTTGTAGATGAATATGATCCCACCATAGAGGT GAGGCCCAGTGGTAGCCCG NRAS-38GA TTTCCAACAGGTTCTTGCTGGTGTGAAATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTG- [G/A]TGTTG GGAAAAGCGCACTGACAATCCAGCTAATCCAGAACCACTTTGTAGATGAATATGATCCCACCATAGAGGTGAG GCCCAGTGGTAGCCC TP53-524GA GGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGG- C[G/A]CTGC CCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAGCAGCTGGGGCTGGAGAGACGACAGGGCTGGTTGCCCA GGGTCCCCAGGCCTCTGATTCCTCACTGATTGCTCTTAGGTCTGGCC TP53-637CT CCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAAC- ACTTTT[C/T] GACATAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTCTGGTTTGCAACTGGGGTCTCTGGGAGGAGGGGTTA AGGGTGGTTGTCAGTGGCCCTC TP53-721TG CTTGGGCCTGTGTTATCTCCTAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGT- GTAACAGT[T/G] CCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCA CTTGCCACCCTGCACACTGGCCTGCTGTGCCCCAGCCTC TP53-733GA TAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGC- [G/A]GCATGA ACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTTGCCACCCTGCACACTG GCCTGCTGTGCCCCAGCCTC TP53-742CT CTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAAC[- C/T]GGAGGCC CATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTTGCCACCCTGCACACTGGCCTGCTGTG- C CCCAGCCTCTGCTTGCCTC TP53-743GA TGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACC[- G/A]GAGGCCC ATCCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTTGCCACCCTGCACACTGGCCTGCTGTGC- C CCAGCCTCTGCTTGCCTC TP53-817CT CCTCTTGCTTCTCTTTTCCTATCCTGAGTAGTGGTAATCTACTGGGACGGAACAGCTTTGAGG- TG[C/T]GTGTTT GTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCACCACGAGC TGCCCCCAGGGAGCACTAAGCGAGGTAAGCAA

[0226] Data Analysis:

[0227] An automatic baseline and manual threshold of 0.2 were used to calculate the threshold cycle (C.sub.t) which is defined as the fractional cycle number at which the fluorescence passes the fixed threshold. PCR reactions were run for a total of 50 cycles. For cast-PCR reactions, there was a pre-run of five cycles at a lower annealing/extension temperature followed by an additional 45 cycles at a higher annealing/extension temperature. The .DELTA.Ct between amplification reactions for matched vs. mismatched sequences is defined as the specificity of cast-PCR (.DELTA.Ct=Ct.sub.mismatch-Ct.sub.match). The larger the .DELTA.Ct between mismatched and matched targets, the better assay specificity. The 2.sup..DELTA.Ct value was used to estimate the power of discrimination (or selectivity) which is equal to 1/2.sup..DELTA.Ct or, in some cases, calculated as % (1/2.sup..DELTA.Ct.times.100).

Example 1

Tailed Primers Improve Discrimination of Allelic Variants

[0228] The following example demonstrates that the application of allele-specific primers comprising tails significantly improves the discrimination of allelic variants.

[0229] In conventional AS-PCR, the discrimination of 3' nucleotide mismatches is largely dependent on the sequence surrounding the SNP and the nature of the allele. The .DELTA.Ct between the amplification reactions for matched and mismatched primers varies. To improve the discrimination between the amplification of matched and mismatched sequences, allele-specific primers were designed to comprise tails at their 5' termini and then tested for their suitability in AS-PCR assays.

[0230] Assays were performed using the general experimental design and reaction conditions indicated above (with the exception that no blocker probes were included and either tailed or non-tailed allele-specific primers were added), using 0.5 ng/uL genomic DNA containing the hsv 11711720 SNP comprising one of three alleles (A, C, or T) as the nucleic acid template (see Table 2A). The three genotypes are indicated in Table 2B. Primers and probes were designed according to the sequences shown in Table 3.

TABLE-US-00002 TABLE 2A Genomic DNA Sequence for hsv11711720 SNP (target alleles are indicated in brackets). AGAAAATAACTAAGGGAAGGAGGAAAGTGGGGAGGAAGGAAGAACAGTGT GAAGACAATGGCCTGAAAACTGAAAAAGTCTGTTAAAGTTAATTATCAGT TTTTGAGTCCAAGAACTGGCTTTGCTACTTTCTGTAAGTTTCTAATTTAC TGAATAAGCATGAAAAAGATTGCTTTGAGGAATGGTTATAAACACATTCT TAGAGCATAGTAAGCAGTAGGGAGTAACAAAATAACACTGATTAGAATAC TTTACTCTACTTAATTAATCAATCATATTTAGTTTGACTCACCTTCCCAG [A/C/T]ACCTTCTAGTTCTTTCTTATCTTTCAGTGCTTGTCCAGACAAC ATTTTCATTTCAACAACTCCTGCTATTGCAATGATGGGTACAATTGCTAA GAGTAACAGTGTTAGTTGCCAACCATAGATGAAGGATATAATTATTCCTG TCCCAAGATTTGCTATATTCTGGGTAATTACAGCAAGCCTGGAACCTATA GCCTGCAAAACAAAACAAATTAGAGAAATTTTAAAAATATTATCTTCACA ACTCATGCTTCTATTTTCTGAAAACTCACCTTCATGAGACTATATTCATT ATTTTAT

TABLE-US-00003 TABLE 2B Genotypes of Genomic DNA Sequence for hsv11711720 SNP Genomic DNA ID Genotype NA17203 AA NA17129 CC NA17201 TT

TABLE-US-00004 TABLE 3 List and Sequences of Primers and Probes for genomic DNA: conventional allele-specific primers ("ASP"); tailed allele-specific primers ("tailASP"); locus-specific TaqMan probe (LST); locus-specific primer (LSP). The nucleotides shown in lower case are the tailed portion of the primers. The nucleotide-specific portion of each allele-specific primer is at the 3'-most terminus of each primer (indicated in bold). Primer/ Tm Probe ID Sequence (5' to 3') (.degree. C.) 17129-ASP ATATTTAGTTTGACTCACCTTCCCAGC 63.2 17129- accACTCACCTTTCCCAGC 63.0 tailASP 17203-ASP ATATTTAGTTTGACTCACCTTCCCAGA 62.0 17203- accACTCACCTTTCCCAGA 63.7 tailASP 17201-ASP ATATTTAGTTTGACTCACCTTCCCAGT 62.2 17201- accACTCACCTTTCCCAGT 64.0 tailASP LST (6-FAM)-TGGACAAGCACTGAAAGA-(MGB) 67.4 LSP GCAGGAGTTGTTGAAATGAAAATGTTG 62.5

[0231] As shown in Table 4, when using non-tailed ASPs ("ASP-tail"), the discrimination of 3' nucleotide mismatch is largely dependent on the nature of the allele, as a considerable range of .DELTA.Ct values is observed depending on the identity of the 3'-terminal base. The range of .DELTA.Ct values between matched and mismatched nucleotides ("NT") were from -0.1 to 10. However, with tailed ASPs (ASP+tail), the discrimination of 3' nucleotide mismatch was significantly improved. In fact, as Table 4 shows, the .DELTA.Ct value between matched and mismatched nucleotides was consistently equal to or greater than 10 when tailed ASPs were used. The Ct values for amplification of matched sequences using tailed ASPs were comparable to those using conventional or non-tailed ASPs. These results indicate that tailed ASP, can improve the specificity of AS-PCR, but may not improve the sensitivity of detection.

TABLE-US-00005 TABLE 4 Tailed allele-specific primers ("ASP") significantly improve discrimination of allelic variants. The specificity ("fold difference") was calculated based on the difference between Ct values using tailed vs. untailed primers (2.sup.(.DELTA.Ct(ASP+tail) - (.DELTA.Ct(ASP-tail)). The mismatched nucleotides of the 3' allele-specific nucleotide portion of the ASPs (+/- tail) and the target allele are also indicated ("NT mismatch"). NT .DELTA.Ct Specificity Improvement mismatch (ASP - tail) .DELTA.Ct (ASP + tail) (fold difference) C-A 0.9 11.5 1552.1 C-T 1.2 11.5 1278.3 A-C 10.0 11.9 3.7 A-G 9.8 11.9 4.3 T-G 2.3 11.5 588.1 T-C -0.1 11.5 3104.2 Average 4.0 11.6 1088.5

Example 2

Low Primer Concentrations Improve Discrimination of Allelic Variants

[0232] Assays were performed using the general experimental design and reaction conditions indicated above, in the presence of 1 million copies of plasmid DNA containing various SNP target sequences (see Table 1) and 200 nM or 800 nM tailed ASP (as indicated). Assay primers and probes were designed according to the sequences shown in FIG. 11A.

[0233] The effect of tailed ASP concentration on discrimination of allelic variants is summarized in Table 5. The .DELTA.Ct between the amplification reactions for matched and mismatched primers demonstrate that lower tailed ASP concentrations improve discrimination of allelic variants.

TABLE-US-00006 TABLE 5 Assay Results Using Different Concentrations of Tailed Allele-specific Primers .DELTA.Ct .DELTA.Ct Specificity Plasmid (ASP @ (ASP @ Improvement SNP ID 800 nM) 200 nM) (fold difference) CV11201742 14.1 15.2 2.14 CV11349123 8.2 10 3.48 CV1207700 5.2 6.6 2.64 CV25594064 20.1 19.1 0.5 CV25639181 11.9 12.9 2 Average 12.6 13.44 2.14

Example 3

Primers Designed with Reduced Tms Improves Discrimination of Allelic Variants

[0234] Assays were performed using the general experimental design and reaction conditions indicated above, in the presence of 1 million copies of plasmid DNA containing various SNP target sequences (see Table 1) using tailed ASP with a higher Tm (.about.57.degree. C.) or tailed ASP with a lower Tm (.about.53.degree. C.). Assay primers and probes were designed according to the sequences shown in FIG. 11B-E (see FIG. 11B for higher Tm ASP and FIG. 11C or lower Tm ASP).

[0235] The effect of allele-specific primer Tm on discrimination of allelic variants is summarized in Table 6. The .DELTA.Ct of allele-specific primers with a lower Tm are significantly higher than those of allele-specific primers with a higher Tm. Allele-specific primers designed with reduced Tms improved discrimination of allelic variants by as much as 118-fold in some cases or an average of about 13-fold difference.

TABLE-US-00007 TABLE 6 .DELTA.Ct Values Using Tailed ASPs with Lower Tm (~53.degree. C.) or with Higher Tm (~57.degree. C.) Specificity Plasmid .DELTA.Ct (ASP w/ .DELTA.Ct (ASP w/ Improvement SNP ID Tm ~57.degree. C.) Tm ~53.degree. C.) (fold difference) BRAF-1799TA 12.2 19.1 118.9 CTNNB1-121AG 11.6 14.9 10.0 KRAS-176CG 18.8 22.5 13.1 NRAS-35GA 13.0 14.0 1 TP53-721TG 14.7 19.1 20.6 CTNNB1-134CT 8.6 14.1 44.8 EGFR-2369CT 9.7 10.7 2 KRAS-183AC 22.2 23.1 1.8 NRAS-38GA 14.0 14.3 1.2 TP53-733GA 13.6 13.5 1.0 EGFR-2573TG 16.7 20.2 10.9 KRAS-34GA 14 14.8 1.8 KRAS-38GA 11.2 14.4 8.9 NRAS-181CA 24.0 27.1 8.6 TP53-742CT 9.1 8.0 0.5 KRAS-35GA 11.5 15.1 12.3 NRAS-183AT 23.6 22.7 0.5 TP53-524GA 11.4 13.5 4.6 TP53-637CT 11.4 14.4 7.8 TP53-743GA 10.1 13.2 8.4 TP53-817CT 13.6 13.9 1.2 Average 14.1 16.3 13.3

Example 4

Use of Blocker Probes Improves Discrimination of Allelic Variants

[0236] The following example illustrates that the use of MGB blocker probes improves the discrimination between 3' nucleotide mismatched and matched primers to target sequences in AS-PCR reactions.

[0237] Assays were performed using the general cast-PCR schema and reaction conditions indicated above, using 1 million copies of plasmid DNA containing various SNP target sequences (see Table 1) in the presence of MGB blocker probes or in the absence of MGB blacker probes. Assay primers and probes were designed according to the sequences shown in FIG. 11C-E.

[0238] To improve the selectivity of AS-PCR, blocker probes were synthesized to comprise an MGB group at their 3' terminus. (See, for example, Kutyavin, I. V., et al., Nucleic Acids Research, 2000, Vol. 28, No. 2: 655-661, U.S. Pat. Nos. 5,512,677; 5,419,966; 5,696,251; 5,585,481; 5,942,610 and 5,736,626.)

[0239] The results of cast-PCR using MGB blocker probes are summarized in Table 7. The .DELTA.Ct between cast-PCR with MGB blocker probes is larger than that without MGB blocker probes. As shown, MGB blocker probes improve the discrimination of allelic variants.

TABLE-US-00008 TABLE 7 MGB Blocker Probes Improve Discrimination of Allelic Variants Specificity .DELTA.Ct .DELTA.Ct (+MGB Improvement SNP ID (no MGB blocker) blocker) (fold difference) BRAF-1799TA 11.4 14.9 11.5 CTNNB1-121AG 11.6 14.1 5.4 KRAS-176CG 17.8 20.9 9 NRAS-35GA 13.9 14.3 1.4 TP53-721TG 12.5 14.7 4.4 CTNNB1-134CT 6.7 10.2 11.6 EGFR-2369CT 7.7 10.1 5.3 KRAS-183AC 22.4 23 1.5 NRAS-38GA 14.5 14.6 1.1 TP53-733GA 13.2 14.4 2.3 EGFR-2573TG 18.2 21.8 11.6 KRAS-34GA 14.4 15.1 1.7 KRAS-38GA 11.9 15.1 1.7 NRAS-181CA 19.3 24.2 30.2 TP53-742CT 12.7 13.6 1.9 KRAS-35GA 11.0 13.7 6.5 NRAS-183AT 20.2 21.7 2.9 TP53-524GA 13.5 13.5 1 TP53-637CT 9.3 12.1 7.0 TP53-743GA 9.9 11.5 3.1 TP53-817CT 12.6 13.2 1.5 Average 13.6 15.5 6.0

Example 5

Primers Designed to Target Discriminating Bases Improves Discrimination of Allelic Variants

[0240] Assays were performed using the general cast-PCR schema and reaction conditions indicated above, in the presence of 1 million copies of plasmid DNA containing SNP target sequences (see Table 1). Assay primers and probes were designed according to the sequences shown in FIG. 11C-E.

[0241] According to the data summarized in Table 8, the discrimination of cast-PCR was dependent on the nature of the allele being analyzed. As Table 8 indicates, the .DELTA.Ct between mismatched and matched sequences for allele-1 were different from .DELTA.Ct between mismatched and matched sequences for allele-2. However, both A and G bases, as compared to a T base, were highly discriminating for allele-1 and allele-2 in all four SNPs examined.

TABLE-US-00009 TABLE 8 Primers Designed to Target Discriminating Bases Improve Discrimination of Allelic Variants ASP design SNP allele-1 SNP allele-2 3' NT 3' NT .DELTA.Ct Specificity .DELTA.Ct Specificity of of Allele (Ct_mismatch - (fold Allele (Ct_mismatch - (fold SNP ID ASP1 ASP2 NT Ct_match) difference) NT Ct_match) difference) KRAS-38GA G A C 13.4 10809 T 8.2 294 NRAS-181CA C A G 27.5 189812531 T 9.8 891 NRAS-183AT A T T 17.9 244589 A 23.4 11068835 TP53-742CT C T G 12.3 5043 A 8.3 315

Example 6

Determination of the Sensitivity and Dynamic Range for Cast-PCR

[0242] In this example, the sensitivity and dynamic range of cast-PCR was determined by performing cast-PCR using various copy numbers of a target plasmid.

[0243] Assays were performed using the general cast-PCR schema and reaction conditions indicated above, using 1.times.10.sup.0 (1 copy) to 1.times.10.sup.7 copies of plasmid DNA containing the NRAS-181CA SNP target sequence (see Table 1). Assay primers and probes were designed according to the sequences shown in FIG. 11C-E.

[0244] As shown in FIG. 5, the use of tailed primers and MGB-blocker probes does not adversely affect the sensitivity of cast-PCR, as the sensitivity of cast-PCR is comparable to TaqMan assays which do not utilize tailed primers or blocker probes. Furthermore, FIG. 5 shows that the cast-PCR assay shows a linear dynamic range over at least 7 logs.

Example 7

Determination of the Specificity of Cast-PCR

[0245] In this example, the specificity of cast-PCR was determined by comparing the amplification of particular alleles of KRAS using either matched or mismatched ASPs to a given allele in the presence of their corresponding blocker probes.

[0246] Assays were performed using the general cast-PCR schema and reaction conditions indicated above, using 1.times.10.sup.6 copies of plasmid DNA containing either one of two alleles of the KRAS-183AC SNP target sequence (see Table 1). Assay primers and probes were designed according to the sequences shown in FIG. 11C-E.

[0247] The left panel of FIG. 7 shows the an amplification plot of cast-PCR on allele-1 DNA using matched (A1) primers in the presence of A2 blocker probes or mismatched (A2) primers in the presence of A1 blocker probes. The right hand panel shows a similar experiment in which cast-PCR was performed on allele-2 DNA. As indicated in the data summary in FIG. 7, a robust .DELTA.Ct values of over 20 were observed for cast-PCR on both alleles of KRAS-183AC tested. This corresponds to a specificity as determined by a calculation of 2.sup..DELTA.Ct of 9.times.10.sup.6, and 2.times.10.sup.6, respectively, for allele-1 and allele-2. Furthermore, a calculation of selectivity (1/2.sup..DELTA.Ct) indicates that values of 1/1.1.times.10.sup.7 and 1/5.0.times.10.sup.7 are observed for allele-1 and allele-2, respectively.

Example 8

Cast-PCR is Able to Detect a Single Copy Mutant DNA in One Million Copies of Wild Type DNA

[0248] In this example, the selectivity of cast-PCR, i.e., the ability of cast-PCR to detect a rare mutant DNA in an excess of wild type DNA, was determined.

[0249] Assays were performed using the general cast-PCR schema and reaction conditions indicated above, using various copy numbers of mutant KRAS-183AC plasmid DNA (1 copy to 1.times.10.sup.6 copies) mixed with 1.times.10.sup.6 copies of wild type KRAS-183AC plasmid DNA (see Table 1). Assay primers and probes were designed according to the sequences shown in FIG. 11C-E, and cast-PCR reactions were performed using wild type or mutant allele-specific primers and the corresponding MGB blocker probes.

[0250] FIG. 8 shows that cast-PCR is able to detect as little as one copy of a mutant DNA sequence, even when surrounded by a million-fold excess of a wild type sequence.

Example 9

Selectivity of Cast-PCR in Discriminating Tumor Cell DNA from Normal Cell DNA

[0251] In this example, the selectivity of cast-PCR was determined by performing assays on samples in which various amounts of tumor cell genomic DNA were mixed with or "spiked" into genomic DNA from normal cells. DNA samples were extracted using QIAmp DNA Mini Prep Kits (Qiagen). Wild type DNA was extracted from the SW48 cell line and mutant DNA was extracted the H1573 cell line.

[0252] The mutant DNA contained the KRAS-G12A mutation (See FIG. 6). The percentage of tumor cell DNA in the spiked samples varied from 0.5 to 100%. cast-PCR was used to detect the presence of tumor cell DNA when present in these percentages.

[0253] Assays were performed using the general cast-PCR schema and reaction conditions indicated above, using 30 ng of gDNA per reaction. Assay primers and probes were designed according to the sequences corresponding to KRAS-G12A SNP ID, as shown in FIG. 18A-B.

[0254] As shown in FIG. 9, tumor cell DNA, even when present only at a level of 0.5% as compared to normal cell DNA, is easily detected using cast-PCR.

Example 10

Use of Cast-PCR to Detect Tumor Cells in Tumor Samples

[0255] In this example, cast-PCR was used to detect and determine the percentage of tumor cells in tumor samples. Various normal and tumor samples were obtained and assayed by cast-PCR for the presence of a number of SNPs associated with cancer as shown in FIG. 10.

[0256] Assays were performed using the general cast-PCR schema and reaction conditions indicated above, using 5 ng of gDNA or 1.5 ng cDNA derived from either normal or tumor samples. Assay primers and probes corresponding to the SNPs shown in FIG. 10 were designed according to the sequences as shown in FIG. 11C-E.

[0257] The results shown in FIG. 10 indicate that cast-PCR has a low false positive rate as indicated by the failure of cast-PCR to detect the presence of mutant cells in normal samples. In contrast, cast-PCR was able to provide a determination of the percentage of tumor cells in various tumor samples that ranged from just under 2% for a tumor sample containing the NRAS-183AT SNP to greater than 80% for a sample containing the CTNNB1-134CT SNP.

Example 11

Use of Pre-Amplification in Cast-PCR

[0258] The following example demonstrates that pre-amplification combined with cast-PCR methods enables detection of multiple alleles from a limited amount of genomic DNA template.

[0259] Prior to conducting cast-PCR amplification, multiplex reactions were performed for 7 different KRAS mutations (see Table 9).

[0260] 10 .mu.l multiplex reactions were prepared in a single tube by combining into one reaction 45 nM of each allele-specific primer (including the allele-1-specific primer and the allele-2-specific primer) and 45 nM of each locus-specific primer, as listed in FIG. 18A-B for each of the seven different KRAS SNPs, 0.1 ng/.mu.L genomic DNA, and 1.times. Preamp Master Mix (Applied Biosystems, Foster City, Calif.; P/N 437135). The 10 .mu.l pre-amplification reactions were then incubated in an Applied Biosystems 9700 Thermocyler in a 96- or 384-well plate for 95.degree. C. for 10 minutes, followed by 10 cycles of 95.degree. C. for 15 seconds, 60.degree. C. for 4 minutes, and 99.9.degree. C. for 10 minutes, and then held at 4.degree. C. Next, 190 .mu.l of 0.1.times.TE pH 8.0 was added to each 10 .mu.l pre-amplification reaction (20.times. dilution). The diluted pre-amplification reaction products were then directly used in subsequent cast-PCR reactions or stored at -20.degree. C. for at least one week prior to use.

TABLE-US-00010 TABLE 9 KRAS SNP Sequences (target alleles are indicated in brackets). SNP ID SNP Sequence KRAS-G12A_GC TGACTGAATATAAACTTGTGGTAGTTGGAGCTG[G/C]TGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAA- T TCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGGTG- C AGGACCATTCTTTGATACA KRAS-G12R_GC TGACTGAATATAAACTTGTGGTAGTTGGAGCT[G/C]GTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAA- T TCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGGTG- C AGGACCATTCTTTGATACA KRAS-G12D_GA TGACTGAATATAAACTTGTGGTAGTTGGAGCTG[G/A]TGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAA- T TCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGGTG- C AGGACCATTCTTTGATACA KRAS-G12S_GA TGACTGAATATAAACTTGTGGTAGTTGGAGCT[G/A]GTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAA- T TCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGGTG- C AGGACCATTCTTTGATACA KRAS-G13D_GA TGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTG[G/A]CGTAGGCAAGAGTGCCTTGACGATACAGCTAA- T TCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGGTG- C AGGACCATTCTTTGATACA KRAS-G12C_GT GTGAGTTTGTATTAAAAGGTACTGGTGGAGTATNNGATAGTGTATTAACCTTATGTGTGACATGTTCTAATAT- A GTCACATTTTCATTATTTTTATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCT[- G/ T]GTGGCGTAGGCAAGAGT

[0261] Following pre-amplification, the diluted pre-amplification products were aliquotted into single-plex cast-PCR reactions. Individual assays were performed for each of the 7 different KRAS mutations using the general experimental design and reaction conditions indicated above (see section II of Examples). 10 .mu.L, cast-PCR reactions were run for assays containing, as the nucleic acid template, either 1 .mu.L 20.times. diluted pre-amplification reaction product (as prepared above) or, as a comparison, 0.07 ng genomic DNA. All assay primers and probes were designed according to the sequences shown in FIG. 18A-B.

[0262] As shown in FIG. 12, for assays without pre-amplification the average .DELTA.Ct of the 7 tested KRAS mutations was 12.0, whereas for assays using pre-amplification the average .DELTA.Ct was 17.0. Thus, the .DELTA..DELTA.Ct between the two gave an improvement of about 5, which is about a 32 fold increase in sensitivity, for the pre-amplified reactions over those without pre-amplification.

[0263] In an ideal situation (where PCR efficiency=100%), the copy number of the target gene increases about 1000 fold in 10 cycles. Under these conditions, if the starting copy number in a pre-amplification reaction is 0.1 ng/.mu.L (or approximately 33 copies/.mu.L), then after 10 cycles the copy number increases to approximately 33,000 copies/.mu.L. In the example above, the copy number of a 20 fold diluted pre-amplification product is estimated to be approximately 1,650 copies/.mu.L. Therefore, after adding 1 .mu.L of 1,650 copies/.mu.L diluted pre-amplification product into a cast-PCR reaction (final volume of 10 .mu.L), the concentration of the cast-PCR products is approximately 165 copies/.mu.L. Based on this estimation, 10 .mu.L of pre-amplification products from 1 ng/.mu.L genomic DNA can be diluted by as much as 200 fold, and still provide up to 2000 .mu.L of nucleic acid template for use in subsequent cast-PCR reactions.

Example 12

Effect of Tailed ASP on Cast-PCR Specificity

[0264] Assays were performed using the general cast-PCR schema and reaction conditions indicated above (see section II of Examples), using 1 million copies of plasmid DNA containing various SNP target sequences (see Table 10). Assay primers and probes were designed according to the sequences shown in FIG. 19A-D. For each SNP analyzed, the blocker probes, locus-specific probes and locus-specific primers were the same and only the allele-specific primers varied (e.g., tailed or non-tailed).

TABLE-US-00011 TABLE 10 Plasmid SNP Sequences (target alleles are indicated in brackets). SNP ID Sequence BRAF-1799TA_TP ATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAG[T/A]GAAATCTCGAT GGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTG CTNNB1-121AG_TP GTATCCACATCCTCTTCCTCAGGATTGCCTTTACCACTCAGAGAAGGAGCTGTGG[A/G]AGTGGCACCAG AATGGATTNCAGAGTNCAGGTAAGACTGTTGCTGCCAGTGACTA CTNNB1-134CT_TP CAGGACTTGGGAGGTATCCACATCCTCTTCCTCAGGATTGCCTTTACCACTCAGA[C/T]AAGGAGCTGTG GTAGTGGCACCAGAATGGATTNCAGAGTNCAGGTAAGACTGTTG EGFR-2369CT_TP CCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCA[C/T]GCAGCTCATGCC CTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATA EGFR-2573TG_TP TTACTTTGCCTCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAGCAGTTTGGCC[T/G]GCCCAAAATCT GTGATCTTGACATGCTGCGGTGTTTTCACCAGTACGTTCCTGG KRAS-176CG_TP AGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAG[C/G]AGGTCANGAG GAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGC KRAS-183AC_TP AAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCA[A/C]GAGGAGTACA GTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTT KRAS-34GA_TP CCACAAAATGATTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCAC[G/A]AGCTCCAACTAC CACAAGTTTATATTCAGTCATTTTCAGCAGGCCTTATAATAAAA KRAS-35GA_TP TCCACAAAATGATTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCA[G/A]CAGCTCCAACTA CCACAAGTTTATATTCAGTCATTTTCAGCAGGCCTTATAATAAA KRAS-3GA_TP ATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTG[G/A]CGTAGGCAA GAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGA NRAS-181CA_TP AACAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGGA[C/A]AAGAAGAGT ACAGTGCCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCC NRAS-183AT_TP CAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGGACA[A/T]GAAGAGTAC AGTGCCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCCTC BRAF-1799TA_TP ATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAG[T/A]GAAATCTCGAT GGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTG CTNNB1-121AG_TP GTATCCACATCCTCTTCCTCAGGATTGCCTTTACCACTCAGAGAAGGAGCTGTGG[A/G]AGTGGCACCAG AATGGATTNCAGAGTNCAGGTAAGACTGTTGCTGCCAGTGACTA CTNNB1-134CT_TP CAGGACTTGGGAGGTATCCACATCCTCTTCCTCAGGATTGCCTTTACCACTCAGA[C/T]AAGGAGCTGTG GTAGTGGCACCAGAATGGATTNCAGAGTNCAGGTAAGACTGTTG EGFR-2369CT_TP CCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCA[C/T]GCAGCTCATGCC CTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATA EGFR-2573TG_TP TTACTTTGCCTCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAGCAGTTTGGCC[T/G]GCCCAAAATCT GTGATCTTGACATGCTGCGGTGTTTTCACCAGTACGTTCCTGG KRAS-176CG_TP AGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAG[C/G]AGGTCANGAG GAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGC KRAS-183AC_TP AAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCA[C/G]GAGGAGTACA GTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTT KRAS-34GA_TP CCACAAAATGATTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCAC[G/A]AGCTCCAACTAC CACAAGTTTATATTCAGTCATTTTCAGCAGGCCTTATAATAAAA KRAS-35GA_TP TCCACAAAATGATTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCA[G/A]CAGCTCCAACTA CCACAAGTTTATATTCAGTCATTTTCAGCAGGCCTTATAATAAA KRAS-3GA_TP ATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTG[G/A]CGTAGGCAA GAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGA NRAS-181CA_TP AACAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGGA[C/A]AAGAAGAGT ACAGTGCCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCC NRAS-183AT_TP CAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGGACA[A/T]GAAGAGTAC AGTGCCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCCTC BRAF-1799TA_TP ATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAG[T/A]GAAATCTCGAT GGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTG CTNNB1-121AG_TP GTATCCACATCCTCTTCCTCAGGATTGCCTTTACCACTCAGAGAAGGAGCTGTGG[A/G]AGTGGCACCAG AATGGATTNCAGAGTNCAGGTAAGACTGTTGCTGCCAGTGACTA CTNNB1-134CT_TP CAGGACTTGGGAGGTATCCACATCCTCTTCCTCAGGATTGCCTTTACCACTCAGA[C/T]AAGGAGCTGTG GTAGTGGCACCAGAATGGATTNCAGAGTNCAGGTAAGACTGTTG EGFR-2369CT_TP CCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCA[C/T]GCAGCTCATGCC CTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATA EGFR-2573TG_TP TTACTTTGCCTCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAGCAGTTTGGCC[C/T]GCCCAAAATCT GTGATCTTGACATGCTGCGGTGTTTTCACCAGTACGTTCCTGG KRAS-176CG_TP AGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAG[T/G]AGGTCANGAG GAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGC KRAS-183AC_TP AAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCA[A/C]GAGGAGTACA GTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTT KRAS-34GA_TP CCACAAAATGATTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCAC[G/A]AGCTCCAACTAC CACAAGTTTATATTCAGTCATTTTCAGCAGGCCTTATAATAAAA KRAS-35GA_TP TCCACAAAATGATTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCA[G/A]CAGCTCCAACTA CCACAAGTTTATATTCAGTCATTTTCAGCAGGCCTTATAATAAA KRAS-3GA_TP ATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTG[G/A]CGTAGGCAA GAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGA NRAS-181CA_TP AACAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGGA[C/A]AAGAAGAGT ACAGTGCCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCC NRAS-183AT_TP CAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGGACA[A/T]GAAGAGTAC AGTGCCATGAGAGACCAATACATGAGGACAGGCGAAGGCTTCCTC

[0265] The results of cast-PCR using non-tailed ASP and cast-PCR using tailed-ASP are summarized in FIG. 13. In the cast-PCR reactions having no tailed primers, the average .DELTA.Ct of the 12 tested mutations was 10.3, whereas in the cast-PCR reactions with tailed primers the average .DELTA.Ct of 12 tested assays is 16.3. Thus, the average A.DELTA.Ct between cast-PCR comprising tailed ASP versus cast-PCR comprising non-tailed ASP was about 6.0, which is about a 64 fold improvement in specificity for reactions comprising ASP +tail primers.

Example 13

Comparison of Cast-PCR and ASB-PCR

[0266] Allelic discrimination for assays using cast-PCR methods was compared to assays using other Allele-Specific PCR with a Blocking reagent (ASB-PCR) methods (see, e.g., Morlan et al., 2009).

[0267] cast-PCR assays were performed using the general schema and reaction conditions indicated above, using 1 million copies of plasmid DNA containing various SNP target sequences (see Table 10). Assays were performed using the general experimental design and reaction conditions indicated above (see section II of Examples). Assay primers and probes were designed according to the sequences shown in FIG. 19B-D.

[0268] ASB-PCR assays were performed using 1 million copies of plasmid DNA containing various SNP target sequences (see Table 10), 900 nM non-tailed allele-specific primers (Tm 58.about.62.degree. C.), 3600 nM allele-specific phosphate blocker (Tm 58.about.62.degree. C.), 200 nM locus-specific TaqMan probe (Tm 70.about.74.degree. C.), and 900 nM locus-specific primers (Tm 60.about.63.degree. C.).

[0269] ASB-PCR assay primers and probes were designed according to the sequences shown in FIG. 20A-C. The ASB-PCR reactions were incubated in a 384-well plate at 95.degree. C. for 10 minutes, followed by 50 cycles of at 92.degree. C. for 20 seconds, 60.degree. C. for 45 seconds. All reactions were run in 4 replications in an ABI PRISM 7900HT.RTM. Sequence Detection System, according to the manufacturer's instructions.

[0270] The results for this example are summarized in FIG. 14. In the ASB-PCR assays, the average .DELTA.Ct of 12 different mutations was 14.1. In cast-PCR assays, the average .DELTA.Ct of the same 12 mutations was 16.3. The A.DELTA.Ct between ASB-PCR and cast-PCR was 2.2, which indicates that the specificity of cast-PCR was approximately 4.6 fold higher than that of the ASB-PCR assay.

Example 14

Comparison of MGB and Phosphate Blocker Probes in Cast-PCR

[0271] The use of MGB blocker probes was compared to the use of other types of blocker probes, such as PO.sub.4 blocker probes (e.g., Morlan et al., 2009), in cast-PCR assays.

[0272] All assays were performed using the general cast-PCR schema and reaction conditions indicated above (see Section II in Examples), using 1 million copies of plasmid DNA containing various SNP target sequences (see Table 10), except that reactions contained either 150 nm allele-specific MGB blocker probes or 150 nm allele-specific 3'-phosphate blocker probes. Assay primers and probes were designed according to the sequences shown in FIG. 19B-D (for cast-PCR using MGB blocker probes) or FIG. 19B-C and FIG. 20C (for cast-PCR using phosphate blocker probes; "PHOS1" to block allele-1 and "PHOS2" to block allele-2).

[0273] The results of assays with phosphate blocker probes or with MGB blocker probes are summarized in FIG. 15. In cast-PCR assays performed using phosphate blocker probes the average .DELTA.Ct of 12 different mutations was 15.1. In comparison, the average .DELTA.Ct for the same 12 mutations using cast-PCR assays performed with MGB blocker probes was slightly higher and gave a .DELTA.Ct of 15.8.

Example 15

Improving the Specificity of Cast-PCR Using Lna Modified Asp

[0274] LNA-modified cast-PCR assays were performed using the general experimental design and reaction conditions indicated above (see Section H in Examples), using 0.5 ng/.mu.L of genomic DNA. Assay primers and probes were designed according to the sequences shown in FIGS. 21A-C. For each SNP analyzed, the blocker probes, locus-specific probes and locus-specific primers were the same and only the allele-specific primers varied (i.e., with or without an LNA-modification at the 3' end.).

[0275] The effect of LNA modification of the ASP on the specificity of cast-PCR is summarized in FIG. 16. For the 12 cast-PCR assays performed using LNA-modified allele-specific primers, the average .DELTA.Ct was 16.3. In comparison, the average .DELTA.Ct for the same 12 mutations using cast-PCR assays performed allele-specific primers having no modifications the .DELTA.Ct was noticeably higher at 18.5. Based on the .DELTA..DELTA.Ct the assay specificity increased by approximately 4 fold for those assays that used LNA-modified allele-specific primers.

Example 16

Improving the Specificity of Cast-PCR Using Other Modified ASP

[0276] cast-PCR assays using other chemically-modified ASPs were performed using the general experimental design and reaction conditions indicated above conditions indicated above (see Section II in Examples), performed in the presence of 1 million copies of plasmid DNA containing various SNP target sequences (see Table 10). Assay primers and probes were designed according to the sequences shown in FIG. 22. For each SNP analyzed, the blocker probes, locus-specific probes and locus-specific primers were the same and only the allele-specific primers varied (i.e., with or without chemical modifications, i.e., ppA, ppG, iso dC or fdU, at the 3' end).

[0277] The results of cast-PCR assays using unmodified ASP and cast-PCR assays with modified ASP are summarized in FIG. 17. As shown, allele-specific primers having pyrophosphate modifications (ppA or ppG) at their 3'-ends increased .DELTA.Ct by 2-3, which is approximately a 4-6 fold increase in assay specificity.

[0278] It s noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the," include plural referents unless expressly and unequivocally limited to one referent. The use of "or" means "and/or" unless stated otherwise. The use of "comprise," "comprises," "comprising," "include," "includes," and "including" are interchangeable and not intended to be limiting. Furthermore, where the description of one or more embodiments uses the term "comprising," those skilled in the art would understand that, in some specific instances, the embodiment or embodiments can be alternatively described using the language "consisting essentially of" and/or "consisting of."

[0279] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, and treatises are hereby expressly incorporated by reference in their entirety for any purpose. In the event that one or more of the incorporated documents defines a term that contradicts that term's definition in this application, this application controls.

[0280] All references cited herein, including patents, patent applications, papers, text books, and the like, and the references cited therein, to the extent that they are not already, are hereby incorporated by reference in their entirety. In the event that one or more of the incorporated literature and similar materials differs.

Sequence CWU 1

1

6351144DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 1gctctgcttc attcctgtct gaagaagggc agatagtttg gctgctcctg tgytgtcacc 60tgcaattctc ccttatcagg gccattggcc tctcccttct ctctgtgagg gatattttct 120ctgacttgtc aatccacatc ttcc 144282DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 2ggcttgcaat ggctccaacc ggaagggcgg tgctcgagct gtggtgcgtg cygctaagtt 60gtgcgttcca gggtgcactc gc 82365DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 3gcaactatac ccttgatgga tggagattta ygcaatgtgt tttactgggt agagtgacag 60acctt 654124DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 4cctgaactta tttggcaaga gcgatgagta ctcttaaaat tactatctgg aaattatatt 60atttagaatc tgccaattac ctagatcccc cctsaacaat tgtttcacca aggaacttcc 120tgaa 1245180DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 5gaattggttg tctccttatg ggaactggaa gtattttgac akctttacca catttcttca 60tgggatagta agtgttaaac agctctgagc catttattat cagctacttg taaattagca 120gtagaatttt atttttatac ttgtaagtgg gcagttacct tttgagagga atacctatag 180687DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 6gcggagggaa gctcatcagt ggggccacga gctgagtgcg tcctgtcact ccactcccat 60gtcccttggg aaggtctgag actaggg 877192DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 7tactacacct cagatatatt tcttcatgaa gacctcacag taaaaatagg tgattttggt 60ctagctacag wgaaatctcg atggagtggg tcccatcagt ttgaacagtt gtctggatcc 120attttgtgga tggtaagaat tgaggctatt tttccactga ttaaattttt ggccctgaga 180tgctgctgag tt 1928198DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 8tgctaatact gtttcgtatt tatagctgat ttgatggagt tggacatggc catggaacca 60gacagaaaag cggctgttag tcactggcag caacagtctt acctggactc tggaatccat 120tctggtgcca ctrccacagc tccttctctg agtggtaaag gcaatcctga ggaagaggat 180gtggatacct cccaagtc 1989184DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 9tttgatggag ttggacatgg ccatggaacc agacagaaaa gcggctgtta gtcactggca 60gcaacagtct tacctggact ctggaatcca ttctggtgcc actaccacag ctccttytct 120gagtggtaaa ggcaatcctg aggaagagga tgtggatacc tcccaagtcc tgtatgagtg 180ggaa 18410181DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 10gtggacaacc cccacgtgtg ccgcctgctg ggcatctgcc tcacctccac cgtgcagctc 60atcaygcagc tcatgccctt cggctgcctc ctggactatg tccgggaaca caaagacaat 120attggctccc agtacctgct caactggtgt gtgcagatcg caaaggtaat cagggaaggg 180a 18111166DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 11gcatgaacta cttggaggac cgtcgcttgg tgcaccgcga cctggcagcc aggaacgtac 60tggtgaaaac accgcagcat gtcaagatca cagattttgg gckggccaaa ctgctgggtg 120cggaagagaa agaataccat gcagaaggag gcaaagtaag gaggtg 16612172DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 12caggattcct acaggaagca agtagtaatt gatggagaaa cctgtctctt ggatattctc 60gacacagsag gtcaagagga gtacagtgca atgagggacc agtacatgag gactggggag 120ggctttcttt gtgtatttgc cataaataat actaaatcat ttgaagatat tc 17213207DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 13acaggaagca agtagtaatt gatggagaaa cctgtctctt ggatattctc gacacagcag 60gtcamgagga gtacagtgca atgagggacc agtacatgag gactggggag ggctttcttt 120gtgtatttgc cataaataat actaaatcat ttgaagatat tcaccattat aggtgggttt 180aaattgaata taataagctg acattaa 20714169DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 14tattaacctt atgtgtgaca tgttctaata tagtcacatt ttcattattt ttattataag 60gcctgctgaa aatgactgaa tataaacttg tggtagttgg agctrgtggc gtaggcaaga 120gtgccttgac gatacagcta attcagaatc attttgtgga cgaatatga 16915171DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 15tattaacctt atgtgtgaca tgttctaata tagtcacatt ttcattattt ttattataag 60gcctgctgaa aatgactgaa tataaacttg tggtagttgg agctgrtggc gtaggcaaga 120gtgccttgac gatacagcta attcagaatc attttgtgga cgaatatgat c 17116230DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 16cattattttt attataaggc ctgctgaaaa tgactgaata taaacttgtg gtagttggag 60ctggtgrcgt aggcaagagt gccttgacga tacagctaat tcagaatcat tttgtggacg 120aatatgatcc aacaatagag gtaaatcttg ttttaatatg catattactg gtgcaggacc 180attctttgat acagataaag gtttctctga ccattttcat gagtacttat 23017210DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 17attcttacag aaaacaagtg gttatagatg gtgaaacctg tttgttggac atactggata 60cagctggama agaagagtac agtgccatga gagaccaata catgaggaca ggcgaaggct 120tcctctgtgt atttgccatc aataatagca agtcatttgc ggatattaac ctctacaggt 180actaggagca ttattttctc tgaaaggatg 21018206DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 18ttacagaaaa caagtggtta tagatggtga aacctgtttg ttggacatac tggatacagc 60tggacawgaa gagtacagtg ccatgagaga ccaatacatg aggacaggcg aaggcttcct 120ctgtgtattt gccatcaata atagcaagtc atttgcggat attaacctct acaggtacta 180ggagcattat tttctctgaa aggatg 20619162DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 19tggtttccaa caggttcttg ctggtgtgaa atgactgagt acaaactggt ggtggttgga 60gcagrtggtg ttgggaaaag cgcactgaca atccagctaa tccagaacca ctttgtagat 120gaatatgatc ccaccataga ggtgaggccc agtggtagcc cg 16220158DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 20tttccaacag gttcttgctg gtgtgaaatg actgagtaca aactggtggt ggttggagca 60ggtgrtgttg ggaaaagcgc actgacaatc cagctaatcc agaaccactt tgtagatgaa 120tatgatccca ccatagaggt gaggcccagt ggtagccc 15821189DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 21ggcacccgcg tccgcgccat ggccatctac aagcagtcac agcacatgac ggaggttgtg 60aggcrctgcc cccaccatga gcgctgctca gatagcgatg gtgagcagct ggggctggag 120agacgacagg gctggttgcc cagggtcccc aggcctctga ttcctcactg attgctctta 180ggtctggcc 18922165DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 22cctcctcagc atcttatccg agtggaagga aatttgcgtg tggagtattt ggatgacaga 60aacactttty gacatagtgt ggtggtgccc tatgagccgc ctgaggtctg gtttgcaact 120ggggtctctg ggaggagggg ttaagggtgg ttgtcagtgg ccctc 16523183DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 23cttgggcctg tgttatctcc taggttggct ctgactgtac caccatccac tacaactaca 60tgtgtaacag tkcctgcatg ggcggcatga accggaggcc catcctcacc atcatcacac 120tggaagactc caggtcagga gccacttgcc accctgcaca ctggcctgct gtgccccagc 180ctc 18324163DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 24taggttggct ctgactgtac caccatccac tacaactaca tgtgtaacag ttcctgcatg 60ggcrgcatga accggaggcc catcctcacc atcatcacac tggaagactc caggtcagga 120gccacttgcc accctgcaca ctggcctgct gtgccccagc ctc 16325163DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 25ctgactgtac caccatccac tacaactaca tgtgtaacag ttcctgcatg ggcggcatga 60acyggaggcc catcctcacc atcatcacac tggaagactc caggtcagga gccacttgcc 120accctgcaca ctggcctgct gtgccccagc ctctgcttgc ctc 16326162DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 26tgactgtacc accatccact acaactacat gtgtaacagt tcctgcatgg gcggcatgaa 60ccrgaggccc atcctcacca tcatcacact ggaagactcc aggtcaggag ccacttgcca 120ccctgcacac tggcctgctg tgccccagcc tctgcttgcc tc 16227176DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 27cctcttgctt ctcttttcct atcctgagta gtggtaatct actgggacgg aacagctttg 60aggtgygtgt ttgtgcctgt cctgggagag accggcgcac agaggaagag aatctccgca 120agaaagggga gcctcaccac gagctgcccc cagggagcac taagcgaggt aagcaa 17628601DNAHomo sapiens 28agaaaataac taagggaagg aggaaagtgg ggaggaagga agaacagtgt gaagacaatg 60gcctgaaaac tgaaaaagtc tgttaaagtt aattatcagt ttttgagtcc aagaactggc 120tttgctactt tctgtaagtt tctaatttac tgaataagca tgaaaaagat tgctttgagg 180aatggttata aacacattct tagagcatag taagcagtag ggagtaacaa aataacactg 240attagaatac tttactctac ttaattaatc aatcatattt agtttgactc accttcccag 300haccttctag ttctttctta tctttcagtg cttgtccaga caacattttc atttcaacaa 360ctcctgctat tgcaatgatg ggtacaattg ctaagagtaa cagtgttagt tgccaaccat 420agatgaagga tataattatt cctgtcccaa gatttgctat attctgggta attacagcaa 480gcctggaacc tatagcctgc aaaacaaaac aaattagaga aattttaaaa atattatctt 540cacaactcat gcttctattt tctgaaaact caccttcatg agactatatt cattatttta 600t 6012927DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 29atatttagtt tgactcacct tcccagc 273019DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 30accactcacc tttcccagc 193127DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 31atatttagtt tgactcacct tcccaga 273219DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 32accactcacc tttcccaga 193327DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 33atatttagtt tgactcacct tcccagt 273419DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 34accactcacc tttcccagt 193518DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 35tggacaagca ctgaaaga 183627DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 36gcaggagttg ttgaaatgaa aatgttg 2737163DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 37tgactgaata taaacttgtg gtagttggag ctgstggcgt aggcaagagt gccttgacga 60tacagctaat tcagaatcat tttgtggacg aatatgatcc aacaatagag gtaaatcttg 120ttttaatatg catattactg gtgcaggacc attctttgat aca 16338163DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 38tgactgaata taaacttgtg gtagttggag ctsgtggcgt aggcaagagt gccttgacga 60tacagctaat tcagaatcat tttgtggacg aatatgatcc aacaatagag gtaaatcttg 120ttttaatatg catattactg gtgcaggacc attctttgat aca 16339163DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 39tgactgaata taaacttgtg gtagttggag ctgrtggcgt aggcaagagt gccttgacga 60tacagctaat tcagaatcat tttgtggacg aatatgatcc aacaatagag gtaaatcttg 120ttttaatatg catattactg gtgcaggacc attctttgat aca 16340163DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 40tgactgaata taaacttgtg gtagttggag ctrgtggcgt aggcaagagt gccttgacga 60tacagctaat tcagaatcat tttgtggacg aatatgatcc aacaatagag gtaaatcttg 120ttttaatatg catattactg gtgcaggacc attctttgat aca 16341163DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 41tgactgaata taaacttgtg gtagttggag ctggtgrcgt aggcaagagt gccttgacga 60tacagctaat tcagaatcat tttgtggacg aatatgatcc aacaatagag gtaaatcttg 120ttttaatatg catattactg gtgcaggacc attctttgat aca 16342164DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 42gtgagtttgt attaaaaggt actggtggag tatnngatag tgtattaacc ttatgtgtga 60catgttctaa tatagtcaca ttttcattat ttttattata aggcctgctg aaaatgactg 120aatataaact tgtggtagtt ggagctkgtg gcgtaggcaa gagt 16443111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 43atatttcttc atgaagacct cacagtaaaa ataggtgatt ttggtctagc tacagwgaaa 60tctcgatgga gtgggtccca tcagtttgaa cagttgtctg gatccatttt g 11144111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 44gtatccacat cctcttcctc aggattgcct ttaccactca gagaaggagc tgtggragtg 60gcaccagaat ggattncaga gtncaggtaa gactgttgct gccagtgact a 11145111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 45caggacttgg gaggtatcca catcctcttc ctcaggattg cctttaccac tcagayaagg 60agctgtggta gtggcaccag aatggattnc agagtncagg taagactgtt g 11146111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 46cccacgtgtg ccgcctgctg ggcatctgcc tcacctccac cgtgcagctc atcaygcagc 60tcatgccctt cggctgcctc ctggactatg tccgggaaca caaagacaat a 11147111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 47ttactttgcc tccttctgca tggtattctt tctcttccgc acccagcagt ttggcckgcc 60caaaatctgt gatcttgaca tgctgcggtg ttttcaccag tacgttcctg g 11148111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 48aggaagcaag tagtaattga tggagaaacc tgtctcttgg atattctcga cacagsaggt 60cangaggagt acagtgcaat gagggaccag tacatgagga ctggggaggg c 11149111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 49aagtagtaat tgatggagaa acctgtctct tggatattct cgacacagca ggtcamgagg 60agtacagtgc aatgagggac cagtacatga ggactgggga gggctttctt t 11150111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 50ccacaaaatg attctgaatt agctgtatcg tcaaggcact cttgcctacg ccacragctc 60caactaccac aagtttatat tcagtcattt tcagcaggcc ttataataaa a 11151111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 51tccacaaaat gattctgaat tagctgtatc gtcaaggcac tcttgcctac gccarcagct 60ccaactacca caagtttata ttcagtcatt ttcagcaggc cttataataa a 11152111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 52attataaggc ctgctgaaaa tgactgaata taaacttgtg gtagttggag ctggtgrcgt 60aggcaagagt gccttgacga tacagctaat tcagaatcat tttgtggacg a 11153111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 53aacaagtggt tatagatggt gaaacctgtt tgttggacat actggataca gctggamaag 60aagagtacag tgccatgaga gaccaataca tgaggacagg cgaaggcttc c 11154111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 54caagtggtta tagatggtga aacctgtttg ttggacatac tggatacagc tggacawgaa 60gagtacagtg ccatgagaga ccaatacatg aggacaggcg aaggcttcct c 11155111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 55atatttcttc atgaagacct cacagtaaaa ataggtgatt ttggtctagc tacagwgaaa 60tctcgatgga gtgggtccca tcagtttgaa cagttgtctg gatccatttt g 11156111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 56gtatccacat cctcttcctc aggattgcct ttaccactca gagaaggagc tgtggragtg 60gcaccagaat ggattncaga gtncaggtaa gactgttgct gccagtgact a 11157111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 57caggacttgg gaggtatcca catcctcttc ctcaggattg cctttaccac tcagayaagg 60agctgtggta gtggcaccag aatggattnc agagtncagg taagactgtt g 11158111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 58cccacgtgtg ccgcctgctg ggcatctgcc tcacctccac cgtgcagctc atcaygcagc 60tcatgccctt cggctgcctc ctggactatg tccgggaaca caaagacaat a 11159111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 59ttactttgcc tccttctgca tggtattctt tctcttccgc acccagcagt ttggcckgcc 60caaaatctgt gatcttgaca tgctgcggtg ttttcaccag tacgttcctg g 11160111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 60aggaagcaag tagtaattga tggagaaacc tgtctcttgg atattctcga cacagsaggt 60cangaggagt acagtgcaat gagggaccag tacatgagga ctggggaggg c 11161111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 61aagtagtaat tgatggagaa acctgtctct tggatattct cgacacagca ggtcasgagg 60agtacagtgc aatgagggac cagtacatga ggactgggga gggctttctt t 11162111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide

62ccacaaaatg attctgaatt agctgtatcg tcaaggcact cttgcctacg ccacragctc 60caactaccac aagtttatat tcagtcattt tcagcaggcc ttataataaa a 11163111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 63tccacaaaat gattctgaat tagctgtatc gtcaaggcac tcttgcctac gccarcagct 60ccaactacca caagtttata ttcagtcatt ttcagcaggc cttataataa a 11164111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 64attataaggc ctgctgaaaa tgactgaata taaacttgtg gtagttggag ctggtgrcgt 60aggcaagagt gccttgacga tacagctaat tcagaatcat tttgtggacg a 11165111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 65aacaagtggt tatagatggt gaaacctgtt tgttggacat actggataca gctggamaag 60aagagtacag tgccatgaga gaccaataca tgaggacagg cgaaggcttc c 11166111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 66caagtggtta tagatggtga aacctgtttg ttggacatac tggatacagc tggacawgaa 60gagtacagtg ccatgagaga ccaatacatg aggacaggcg aaggcttcct c 11167111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 67atatttcttc atgaagacct cacagtaaaa ataggtgatt ttggtctagc tacagwgaaa 60tctcgatgga gtgggtccca tcagtttgaa cagttgtctg gatccatttt g 11168111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 68gtatccacat cctcttcctc aggattgcct ttaccactca gagaaggagc tgtggragtg 60gcaccagaat ggattncaga gtncaggtaa gactgttgct gccagtgact a 11169111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 69caggacttgg gaggtatcca catcctcttc ctcaggattg cctttaccac tcagayaagg 60agctgtggta gtggcaccag aatggattnc agagtncagg taagactgtt g 11170111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 70cccacgtgtg ccgcctgctg ggcatctgcc tcacctccac cgtgcagctc atcaygcagc 60tcatgccctt cggctgcctc ctggactatg tccgggaaca caaagacaat a 11171111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 71ttactttgcc tccttctgca tggtattctt tctcttccgc acccagcagt ttggccygcc 60caaaatctgt gatcttgaca tgctgcggtg ttttcaccag tacgttcctg g 11172111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 72aggaagcaag tagtaattga tggagaaacc tgtctcttgg atattctcga cacagkaggt 60cangaggagt acagtgcaat gagggaccag tacatgagga ctggggaggg c 11173111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 73aagtagtaat tgatggagaa acctgtctct tggatattct cgacacagca ggtcamgagg 60agtacagtgc aatgagggac cagtacatga ggactgggga gggctttctt t 11174111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 74ccacaaaatg attctgaatt agctgtatcg tcaaggcact cttgcctacg ccacragctc 60caactaccac aagtttatat tcagtcattt tcagcaggcc ttataataaa a 11175111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 75tccacaaaat gattctgaat tagctgtatc gtcaaggcac tcttgcctac gccarcagct 60ccaactacca caagtttata ttcagtcatt ttcagcaggc cttataataa a 11176111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 76attataaggc ctgctgaaaa tgactgaata taaacttgtg gtagttggag ctggtgrcgt 60aggcaagagt gccttgacga tacagctaat tcagaatcat tttgtggacg a 11177111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 77aacaagtggt tatagatggt gaaacctgtt tgttggacat actggataca gctggamaag 60aagagtacag tgccatgaga gaccaataca tgaggacagg cgaaggcttc c 11178111DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 78caagtggtta tagatggtga aacctgtttg ttggacatac tggatacagc tggacawgaa 60gagtacagtg ccatgagaga ccaatacatg aggacaggcg aaggcttcct c 11179290DNAHomo sapiens 79gtactggtgg agtatttgat agtgtattaa ccttatgtgt gacatgttct aatatagtca 60cattttcatt atttttatta taaggcctgc tgaaaatgac tgaatataaa cttgtggtag 120ttggagctgg tggcgtaggc aagagtgcct tgacgataca gctaattcag aatcattttg 180tggacgaata tgatccaaca atagaggtaa atcttgtttt aatatgcata ttactggtgc 240aggaccattc tttgatacag ataaaggttt ctctgaccat tttcatgagt 2908016DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 80cccgctgctc ctgtgc 168120DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 81acccaacgca caacttagcg 208225DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 82cccgccttga tggatggaga tttac 258324DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 83gcacccttgg tgaaacaatt gttg 248425DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 84cgccgaactg gaagtatttt gacag 258523DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 85tatccctcac agagagaagg gag 238619DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 86gcttgcaatg gctccaacc 198719DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 87ggagccattg caagccaag 198821DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 88tggcaagagc gatgagtact c 218925DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 89ctctcaaaag gtaactgccc actta 259016DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 90ctcctgtgct gtcacc 169115DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 91cttagcggca cgcac 159218DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 92ggagatttac gcaatgtg 189317DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 93acaattgttg agggggg 179420DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 94aagtattttg acagctttac 209517DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 95cccggctgct cctgtgt 179620DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 96gccgaacgca caacttagca 209725DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 97cccgccttga tggatggaga tttat 259825DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 98tgcacccttg gtgaaacaat tgttc 259925DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 99cgccgaactg gaagtatttt gacat 2510019DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 100atggccctga taagggaga 1910115DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 101agggcggtgc tcgag 1510219DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 102tgtcactcta cccagtaaa 1910321DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 103agaatctgcc aattacctag a 2110421DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 104acaagtagct gataataaat g 2110517DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 105gctcctgtgt tgtcacc 1710616DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 106cttagcagca cgcacc 1610719DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 107tggagattta tgcaatgtg 1910817DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 108acaattgttc agggggg 1710920DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 109aagtattttg acatctttac 2011024DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 110gcctgatttt ggtctagcta caga 2411119DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 111cgcgagaagg agctgtggt 1911221DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 112ccgtgccttt accactcaga g 2111318DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 113gcgcgtgcag ctcatcac 1811417DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 114cggcagcagt ttggccc 1711521DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 115gccggatatt ctcgacacag c 2111618DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 116gcggacacag caggtcaa 1811718DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 117gcggacacag caggtcaa 1811818DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 118cgccttgcct acgccact 1811916DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 119cgctgcctac gccacg 1612017DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 120gcgttgccta cgccacc 1712119DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 121cgcctcttgc ctacgccat 1912218DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 122gcgtcttgcc tacgccag 1812318DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 123gcgtcttgcc tacgccac 1812420DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 124cgcgtagttg gagctggtga 2012522DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 125ccgatactgg atacagctgg aa 2212620DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 126ccgtggatac agctggacaa 2012718DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 127ccgggtggtt ggagcaga 1812818DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 128ccgggttgga gcaggtga 1812918DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 129ccgggaggtt gtgaggca 1813023DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 130gccggatgac agaaacactt ttc 2313125DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 131gcgtacaact acatgtgtaa cagtg 2513217DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 132gccttcctgc atgggca 1713316DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 133gccggcggca tgaacc 1613416DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 134gccgcggcat gaacca 1613522DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 135gccgccaaca gctttgaggt gc 2213623DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 136ccggattttg gtctagctac agt 2313718DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 137gccagaagga gctgtggc 1813821DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 138ccgtgccttt accactcaga a 2113918DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 139gcgcgtgcag ctcatcat 1814017DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 140cggcagcagt ttggcca 1714122DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 141cgctggatat tctcgacaca gg 2214218DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 142gcggacacag caggtcac 1814318DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 143gcggacacag caggtcat 1814417DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 144gcgttgccta cgccacc 1714517DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 145gcgttgccta cgccacc 1714617DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 146gcgttgccta cgccaca 1714718DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 147gcgtcttgcc tacgccac 1814818DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 148gcgtcttgcc tacgccac 1814918DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 149gcgtcttgcc tacgccaa 1815019DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 150gcctagttgg agctggtgg 1915122DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 151ccgatactgg atacagctgg ac 2215221DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 152cgcctggata cagctggaca t 2115317DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 153cgcgtggttg gagcagg 1715417DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 154cgcgttggag caggtgg 1715517DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 155ggcgaggttg tgaggcg 1715624DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 156gcctggatga cagaaacact tttt 2415726DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 157ggcctacaac tacatgtgta acagtt 2615816DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 158gcctcctgca tgggcg 1615916DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 159gccggcggca tgaact 1616016DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 160gccgcggcat gaaccg 1616120DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 161cgcgaacagc tttgaggtgt 2016219DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 162cccgtggtct agctacaga 1916317DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 163ccccaaggag ctgtggt

1716420DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 164cgccccttta ccactcagag 2016518DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 165ggggatgcag ctcatcac 1816615DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 166ggcgcagttt ggccc 1516718DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 167cccgattctc gacacagc 1816817DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 168cgcccacagc aggtcaa 1716917DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 169tgcccacagc aggtcaa 1717015DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 170gccgcctacg ccact 1517115DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 171agcccctacg ccacg 1517215DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 172accccctacg ccacc 1517315DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 173ggctgcctac gccat 1517416DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 174gggctgccta cgccag 1617515DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 175ggctgcctac gccac 1517618DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 176ccccgttgga gctggtga 1817719DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 177cgggtggata cagctggaa 1917819DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 178gggcgataca gctggacaa 1917917DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 179gccctggttg gagcaga 1718017DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 180cccgttggag caggtga 1718116DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 181gccaggttgt gaggca 1618222DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 182tgccctgaca gaaacacttt tc 2218321DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 183cgccctacat gtgtaacagt g 2118415DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 184ccgcctgcat gggca 1518515DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 185cccgcggcat gaacc 1518615DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 186ccccggcatg aacca 1518717DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 187cgccagcttt gaggtgc 1718819DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 188cccgtggtct agctacagt 1918916DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 189ccccaggagc tgtggc 1619020DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 190cgccccttta ccactcagaa 2019119DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 191ggggagtgca gctcatcat 1919215DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 192ggcgcagttt ggcca 1519318DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 193cccgattctc gacacagg 1819417DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 194tgcccacagc aggtcac 1719517DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 195cgcccacagc aggtcat 1719614DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 196gcccctacgc cacc 1419715DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 197agcccctacg ccacc 1519815DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 198accgcctacg ccaca 1519916DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 199gggctgccta cgccac 1620015DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 200ggctgcctac gccac 1520116DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 201gggctgccta cgccaa 1620217DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 202ccccttggag ctggtgg 1720318DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 203cgggggatac agctggac 1820419DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 204gggcgataca gctggacat 1920516DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 205gcccggttgg agcagg 1620616DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 206cccttggagc aggtgg 1620716DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 207gccaggttgt gaggcg 1620822DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 208tgccctgaca gaaacacttt tt 2220921DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 209cgccctacat gtgtaacagt t 2121014DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 210ccgctgcatg ggcg 1421115DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 211cccgcggcat gaact 1521215DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 212ccccggcatg aaccg 1521317DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 213cgccagcttt gaggtgt 1721426DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 214agcctcaatt cttaccatcc acaaaa 2621522DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 215catggaacca gacagaaaag cg 2221622DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 216gtcactggca gcaacagtct ta 2221725DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 217tgggagccaa tattgtcttt gtgtt 2521823DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 218aggaacgtac tggtgaaaac acc 2321920DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 219ccctccccag tcctcatgta 2022041DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 220tcttcaaatg atttagtatt atttatggca aatacacaaa g 4122141DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 221tcttcaaatg atttagtatt atttatggca aatacacaaa g 4122228DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 222tgtgtgacat gttctaatat agtcacat 2822328DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 223tgtgtgacat gttctaatat agtcacat 2822428DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 224tgtgtgacat gttctaatat agtcacat 2822528DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 225tgtgtgacat gttctaatat agtcacat 2822628DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 226tgtgtgacat gttctaatat agtcacat 2822728DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 227tgtgtgacat gttctaatat agtcacat 2822822DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 228ggtcctgcac cagtaatatg ca 2222929DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 229gcaaatgact tgctattatt gatggcaaa 2923029DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 230gcaaatgact tgctattatt gatggcaaa 2923124DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 231agtggttctg gattagctgg attg 2423224DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 232gtggttctgg attagctgga ttgt 2423318DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 233gcaaccagcc ctgtcgtc 1823420DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 234agaccccagt tgcaaaccag 2023524DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 235ctggagtctt ccagtgtgat gatg 2423623DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 236ctggagtctt ccagtgtgat gat 2323717DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 237tgtgcagggt ggcaagt 1723817DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 238tgtgcagggt ggcaagt 1723924DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 239ctttcttgcg gagattctct tcct 2424019DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 240cagacaactg ttcaaactg 1924116DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 241ctggcagcaa cagtct 1624217DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 242tagtggcacc agaatgg 1724316DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 243cccttcggct gcctcc 1624417DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 244cagcatgtca agatcac 1724517DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 245ctggtccctc attgcac 1724616DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 246ccctccccag tcctca 1624716DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 247ccctccccag tcctca 1624815DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 248cctgctgaaa atgac 1524915DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 249cctgctgaaa atgac 1525015DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 250cctgctgaaa atgac 1525115DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 251cctgctgaaa atgac 1525215DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 252cctgctgaaa atgac 1525315DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 253cctgctgaaa atgac 1525418DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 254tcgtccacaa aatgattc 1825518DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 255ccttcgcctg tcctcatg 1825618DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 256ccttcgcctg tcctcatg 1825714DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 257cagtgcgctt ttcc 1425814DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 258cagtgcgctt ttcc 1425918DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 259ctgctcacca tcgctatc 1826017DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 260cctcaggcgg ctcatag 1726117DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 261atgggcctcc ggttcat 1726216DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 262accggaggcc catcct 1626316DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 263cacactggaa gactcc 1626416DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 264cacactggaa gactcc 1626515DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 265ctgtgcgccg gtctc 1526616DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 266gctacagaga aatctc 1626717DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 267gagctgtggt agtggca 1726816DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 268cactcagaga aggagc 1626916DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 269catcacgcag ctcatg 1627016DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 270agtttggccc gcccaa 1627117DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 271ctcgacacag caggtca 1727218DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 272gcaggtcaag aggagtac 1827318DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 273gcaggtcaag aggagtac 1827414DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 274cgccactagc tcca 1427516DNAArtificial SequenceDescription of Artificial Sequence

Synthetic probe 275ccacgagctc caacta 1627614DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 276acgccaccag ctcc 1427713DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 277cgccatcagc tcc 1327813DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 278cgccagcagc tcc 1327914DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 279cgccaccagc tcca 1428015DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 280gctggtgacg taggc 1528118DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 281gctggaaaag aagagtac 1828217DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 282cagctggaca agaagag 1728317DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 283ttggagcaga tggtgtt 1728416DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 284tggagcaggt gatgtt 1628513DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 285tgaggcactg ccc 1328626DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 286gaaacacttt tcgacatagt gtggtg 2628720DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 287tgtgtaacag tgcctgcatg 2028814DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 288gcatgggcag catg 1428915DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 289gcatgaaccg gaggc 1529015DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 290catgaaccag aggcc 1529118DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 291ttgaggtgcg tgtttgtg 1829216DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 292gctacagtga aatctc 1629316DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 293agctgtggca gtggca 1629416DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 294cactcagaaa aggagc 1629517DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 295tcatcatgca gctcatg 1729616DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 296agtttggcca gcccaa 1629717DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 297ctcgacacag gaggtca 1729817DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 298caggtcacga ggagtac 1729918DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 299gcaggtcatg aggagtac 1830013DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 300cgccaccagc tcc 1330116DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 301ccaccagctc caacta 1630216DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 302acgccacaag ctccaa 1630313DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 303cgccaccagc tcc 1330413DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 304cgccaccagc tcc 1330515DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 305cgccaacagc tccaa 1530615DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 306gctggtggcg taggc 1530718DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 307gctggacaag aagagtac 1830817DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 308cagctggaca tgaagag 1730916DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 309tggagcaggt ggtgtt 1631016DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 310tggagcaggt ggtgtt 1631113DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 311tgaggcgctg ccc 1331227DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 312agaaacactt tttgacatag tgtggtg 2731321DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 313atgtgtaaca gttcctgcat g 2131414DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 314gcatgggcgg catg 1431516DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 315gcatgaactg gaggcc 1631615DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 316catgaaccgg aggcc 1531720DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 317tttgaggtgt gtgtttgtgc 2031819DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 318ccctggtagt tggagctgg 1931920DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 319cgctgtggta gttggagctg 2032019DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 320gcccggtagt tggagctgg 1932120DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 321cgccgtggta gttggagctg 2032219DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 322ccccagttgg agctggtgg 1932317DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 323gccttgccta cgccaca 1732418DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 324gcctcttgcc tacgccaa 1832523DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 325aaagaatggt cctgcaccag taa 2332622DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 326ggtcctgcac cagtaatatg ca 2232723DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 327aaagaatggt cctgcaccag taa 2332823DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 328aaagaatggt cctgcaccag taa 2332923DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 329aaagaatggt cctgcaccag taa 2333029DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 330gagtttgtat taaaaggtac tggtggagt 2933129DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 331gagtttgtat taaaaggtac tggtggagt 2933219DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 332ccctggtagt tggagctgc 1933320DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 333cgctgtggta gttggagctc 2033419DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 334gcccggtagt tggagctga 1933520DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 335cgccgtggta gttggagcta 2033619DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 336ccccagttgg agctggtga 1933717DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 337gccttgccta cgccacc 1733818DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 338gcctcttgcc tacgccac 1833923DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 339atgcatatta aaacaagatt tac 2334020DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 340aacaatagag gtaaatcttg 2034123DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 341atgcatatta aaacaagatt tac 2334223DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 342atgcatatta aaacaagatt tac 2334323DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 343atgcatatta aaacaagatt tac 2334420DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 344accttatgtg tgacatgttc 2034520DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 345accttatgtg tgacatgttc 2034616DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 346tggagctgct ggcgta 1634716DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 347tggagctcgt ggcgta 1634817DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 348ttggagctga tggcgta 1734920DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 349tagttggagc tagtggcgta 2035017DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 350ttggagctgg tgacgta 1735114DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 351cgccaccagc tcca 1435215DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 352ctacgccacc agctc 1535316DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 353tggagctggt ggcgta 1635416DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 354tggagctggt ggcgta 1635516DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 355tggagctggt ggcgta 1635616DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 356tggagctggt ggcgta 1635716DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 357tggagctggt ggcgta 1635814DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 358cgccacaagc tcca 1435914DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 359tacgccaaca gctc 1436021DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 360tgattttggt ctagctacag a 2136116DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 361gagaaggagc tgtggt 1636218DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 362tgcctttacc actcagag 1836315DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 363cgtgcagctc atcac 1536414DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 364cagcagtttg gccc 1436518DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 365ggatattctc gacacagc 1836615DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 366gacacagcag gtcaa 1536715DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 367cttgcctacg ccact 1536816DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 368ctcttgccta cgccat 1636917DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 369gtagttggag ctggtga 1737019DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 370atactggata cagctggaa 1937117DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 371tggatacagc tggacaa 1737220DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 372gattttggtc tagctacagt 2037315DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 373agaaggagct gtggc 1537418DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 374tgcctttacc actcagaa 1837515DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 375cgtgcagctc atcat 1537614DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 376cagcagtttg gcca 1437719DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 377tggatattct cgacacagg 1937815DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 378gacacagcag gtcac 1537914DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 379ttgcctacgc cacc 1438015DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 380tcttgcctac gccac 1538116DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 381tagttggagc tggtgg 1638219DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 382atactggata cagctggac 1938318DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 383ctggatacag ctggacat 1838424DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 384gcctgatttt ggtctagcta caga 2438519DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 385cgcgagaagg agctgtggt 1938621DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 386ccgtgccttt accactcaga g

2138718DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 387gcgcgtgcag ctcatcac 1838817DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 388cggcagcagt ttggccc 1738921DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 389gccggatatt ctcgacacag c 2139018DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 390gcggacacag caggtcaa 1839118DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 391cgccttgcct acgccact 1839219DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 392cgcctcttgc ctacgccat 1939320DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 393cgcgtagttg gagctggtga 2039422DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 394ccgatactgg atacagctgg aa 2239520DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 395ccgtggatac agctggacaa 2039623DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 396ccggattttg gtctagctac agt 2339718DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 397gccagaagga gctgtggc 1839821DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 398ccgtgccttt accactcaga a 2139918DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 399gcgcgtgcag ctcatcat 1840017DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 400cggcagcagt ttggcca 1740122DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 401cgctggatat tctcgacaca gg 2240218DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 402gcggacacag caggtcac 1840317DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 403gcgttgccta cgccacc 1740418DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 404gcgtcttgcc tacgccac 1840519DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 405gcctagttgg agctggtgg 1940622DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 406ccgatactgg atacagctgg ac 2240721DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 407cgcctggata cagctggaca t 2140826DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 408agcctcaatt cttaccatcc acaaaa 2640922DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 409catggaacca gacagaaaag cg 2241022DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 410gtcactggca gcaacagtct ta 2241125DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 411tgggagccaa tattgtcttt gtgtt 2541223DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 412aggaacgtac tggtgaaaac acc 2341320DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 413ccctccccag tcctcatgta 2041441DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 414tcttcaaatg atttagtatt atttatggca aatacacaaa g 4141528DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 415tgtgtgacat gttctaatat agtcacat 2841628DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 416tgtgtgacat gttctaatat agtcacat 2841722DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 417ggtcctgcac cagtaatatg ca 2241829DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 418gcaaatgact tgctattatt gatggcaaa 2941929DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 419gcaaatgact tgctattatt gatggcaaa 2942019DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 420cagacaactg ttcaaactg 1942116DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 421ctggcagcaa cagtct 1642217DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 422tagtggcacc agaatgg 1742316DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 423cccttcggct gcctcc 1642417DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 424cagcatgtca agatcac 1742517DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 425ctggtccctc attgcac 1742616DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 426ccctccccag tcctca 1642715DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 427cctgctgaaa atgac 1542815DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 428cctgctgaaa atgac 1542918DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 429tcgtccacaa aatgattc 1843018DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 430ccttcgcctg tcctcatg 1843118DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 431ccttcgcctg tcctcatg 1843214DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 432ctacagagaa atct 1443314DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 433ctgtggtagt ggca 1443414DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 434ctcagagaag gagc 1443513DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 435atcacgcagc tca 1343611DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 436ggcccgccca a 1143714DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 437gacacagcag gtca 1443816DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 438caggtcaaga ggagta 1643913DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 439gccactagct cca 1344012DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 440gccatcagct cc 1244113DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 441tggtgacgta ggc 1344215DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 442gctggaaaag aagag 1544314DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 443ctggacaaga agag 1444414DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 444ctacagtgaa atct 1444513DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 445tgtggcagtg gca 1344614DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 446ctcagaaaag gagc 1444714DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 447catcatgcag ctca 1444812DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 448tggccagccc aa 1244914DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 449gacacaggag gtca 1445015DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 450aggtcacgag gagta 1545112DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 451ccaccagctc ca 1245211DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 452ccaccagctc c 1145313DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 453tggtggcgta ggc 1345414DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 454ctggacaaga agag 1445514DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 455ctggacatga agag 1445622DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 456gtgattttgg tctagctaca ga 2245719DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 457tcagagaagg agctgtggt 1945821DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 458gattgccttt accactcaga g 2145918DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 459caccgtgcag ctcatcac 1846018DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 460cacccagcag tttggccc 1846120DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 461ttggatattc tcgacacagc 2046218DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 462ctcgacacag caggtcaa 1846318DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 463actcttgcct acgccact 1846418DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 464cactcttgcc tacgccat 1846519DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 465tggtagttgg agctggtga 1946620DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 466catactggat acagctggaa 2046721DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 467atactggata cagctggaca a 2146822DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 468gtgattttgg tctagctaca gt 2246919DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 469tcagagaagg agctgtggc 1947021DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 470gattgccttt accactcaga a 2147118DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 471caccgtgcag ctcatcat 1847218DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 472cacccagcag tttggcca 1847321DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 473cttggatatt ctcgacacag g 2147419DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 474tctcgacaca gcaggtcac 1947518DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 475actcttgcct acgccacc 1847618DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 476cactcttgcc tacgccac 1847719DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 477tggtagttgg agctggtgg 1947820DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 478catactggat acagctggac 2047920DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 479tactggatac agctggacat 2048026DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 480agcctcaatt cttaccatcc acaaaa 2648122DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 481catggaacca gacagaaaag cg 2248222DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 482gtcactggca gcaacagtct ta 2248325DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 483tgggagccaa tattgtcttt gtgtt 2548423DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 484aggaacgtac tggtgaaaac acc 2348520DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 485ccctccccag tcctcatgta 2048641DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 486tcttcaaatg atttagtatt atttatggca aatacacaaa g 4148728DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 487tgtgtgacat gttctaatat agtcacat 2848828DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 488tgtgtgacat gttctaatat agtcacat 2848922DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 489ggtcctgcac cagtaatatg ca 2249029DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 490gcaaatgact tgctattatt gatggcaaa 2949129DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 491gcaaatgact tgctattatt gatggcaaa 2949219DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 492cagacaactg ttcaaactg 1949316DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 493ctggcagcaa cagtct 1649417DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 494tagtggcacc agaatgg 1749516DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 495cccttcggct gcctcc 1649617DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 496cagcatgtca agatcac 1749717DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 497ctggtccctc attgcac 1749816DNAArtificial SequenceDescription of Artificial Sequence Synthetic

probe 498ccctccccag tcctca 1649915DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 499cctgctgaaa atgac 1550015DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 500cctgctgaaa atgac 1550118DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 501tcgtccacaa aatgattc 1850218DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 502ccttcgcctg tcctcatg 1850318DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 503ccttcgcctg tcctcatg 1850421DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 504gctacagaga aatctcgatg g 2150517DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 505gagctgtggt agtggca 1750620DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 506ttaccactca gagaaggagc 2050717DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 507gctcatcacg cagctca 1750816DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 508ttggcccgcc caaaat 1650918DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 509gacacagcag gtcacgag 1851020DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 510cagcaggtca agaggagtac 2051119DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 511ctacgccact agctccaac 1951216DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 512ctacgccatc agctcc 1651317DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 513ctggtgacgt aggcaag 1751422DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 514ggatacagct ggaaaagaag ag 2251520DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 515agctggacaa gaagagtaca 2051622DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 516tagctacagt gaaatctcga tg 2251715DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 517gagctgtggc agtgg 1551821DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 518ttaccactca gaaaaggagc t 2151920DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 519cagctcatca tgcagctcat 2052019DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 520gtttggccag cccaaaatc 1952118DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 521gacacaggag gtcaggag 1852219DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 522cagcaggtca cgaggagta 1952317DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 523tacgccacca gctccaa 1752416DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 524tacgccacca gctcca 1652517DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 525ctggtggcgt aggcaag 1752621DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 526atacagctgg acaagaagag t 2152720DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 527agctggacat gaagagtaca 2052822DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 528ccccttttgg tctagctaca ga 2252918DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 529gcccgaagga gctgtggt 1853020DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 530cgccccttta ccactcagag 2053118DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 531gcgggtgcag ctcatcac 1853217DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 532cgggagcagt ttggccc 1753321DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 533gcccgatatt ctcgacacag c 2153418DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 534gcggacacag caggtcaa 1853516DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 535cggtgcctac gccact 1653617DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 536cgccttgcct acgccat 1753719DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 537gcccagttgg agctggtga 1953821DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 538cgccactgga tacagctgga a 2153920DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 539ccgcggatac agctggacaa 2054022DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 540ccccttttgg tctagctaca gt 2254118DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 541gcccgaagga gctgtggc 1854220DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 542cgccccttta ccactcagaa 2054318DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 543gcgggtgcag ctcatcat 1854417DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 544cgggagcagt ttggcca 1754521DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 545gcccgatatt ctcgacacag g 2154618DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 546gcggacacag caggtcac 1854716DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 547cggtgcctac gccacc 1654817DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 548cgccttgcct acgccac 1754919DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 549gcccagttgg agctggtgg 1955021DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 550cgccactgga tacagctgga c 2155120DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 551ccgcggatac agctggacat 2055226DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 552agcctcaatt cttaccatcc acaaaa 2655322DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 553catggaacca gacagaaaag cg 2255422DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 554gtcactggca gcaacagtct ta 2255525DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 555tgggagccaa tattgtcttt gtgtt 2555623DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 556aggaacgtac tggtgaaaac acc 2355720DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 557ccctccccag tcctcatgta 2055841DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 558tcttcaaatg atttagtatt atttatggca aatacacaaa g 4155928DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 559tgtgtgacat gttctaatat agtcacat 2856028DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 560tgtgtgacat gttctaatat agtcacat 2856122DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 561ggtcctgcac cagtaatatg ca 2256229DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 562gcaaatgact tgctattatt gatggcaaa 2956329DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 563gcaaatgact tgctattatt gatggcaaa 2956419DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 564cagacaactg ttcaaactg 1956516DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 565ctggcagcaa cagtct 1656617DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 566tagtggcacc agaatgg 1756716DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 567cccttcggct gcctcc 1656817DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 568cagcatgtca agatcac 1756917DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 569ctggtccctc attgcac 1757016DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 570ccctccccag tcctca 1657115DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 571cctgctgaaa atgac 1557215DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 572cctgctgaaa atgac 1557318DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 573tcgtccacaa aatgattc 1857418DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 574ccttcgcctg tcctcatg 1857518DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 575ccttcgcctg tcctcatg 1857614DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 576ctacagagaa atct 1457714DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 577ctgtggtagt ggca 1457814DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 578ctcagagaag gagc 1457913DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 579atcacgcagc tca 1358011DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 580ggcccgccca a 1158114DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 581gacacagcag gtca 1458216DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 582caggtcaaga ggagta 1658313DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 583gccactagct cca 1358412DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 584gccatcagct cc 1258513DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 585tggtgacgta ggc 1358615DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 586gctggaaaag aagag 1558714DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 587ctggacaaga agag 1458814DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 588ctacagtgaa atct 1458913DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 589tgtggcagtg gca 1359014DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 590ctcagaaaag gagc 1459114DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 591catcatgcag ctca 1459212DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 592tggccagccc aa 1259314DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 593gacacaggag gtca 1459415DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 594aggtcacgag gagta 1559512DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 595ccaccagctc ca 1259611DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 596ccaccagctc c 1159713DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 597tggtggcgta ggc 1359814DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 598ctggacaaga agag 1459914DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 599ctggacatga agag 1460022DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 600ccccttttgg tctagctaca ga 2260118DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 601gcccgaagga gctgtggu 1860220DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 602cgccccttta ccactcagag 2060318DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 603gcgggtgcag ctcatcac 1860417DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 604cgggagcagt ttggccc 1760521DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 605gcccgatatt ctcgacacag c 2160626DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 606agcctcaatt cttaccatcc acaaaa 2660722DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 607catggaacca gacagaaaag cg 2260822DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 608gtcactggca gcaacagtct ta 2260925DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 609tgggagccaa tattgtcttt gtgtt

2561023DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 610aggaacgtac tggtgaaaac acc 2361120DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 611ccctccccag tcctcatgta 2061214DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 612ctacagagaa atct 1461314DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 613ctgtggtagt ggca 1461414DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 614ctcagagaag gagc 1461513DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 615atcacgcagc tca 1361611DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 616ggcccgccca a 1161714DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 617gacacagcag gtca 1461822DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 618ccccttttgg tctagctaca gu 2261918DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 619gcccgaagga gctgtggc 1862020DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 620cgccccttta ccactcagaa 2062118DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 621gcgggtgcag ctcatcau 1862217DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 622cgggagcagt ttggcca 1762321DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 623gcccgatatt ctcgacacag g 2162419DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 624cagacaactg ttcaaactg 1962516DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 625ctggcagcaa cagtct 1662617DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 626tagtggcacc agaatgg 1762716DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 627cccttcggct gcctcc 1662817DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 628cagcatgtca agatcac 1762917DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 629ctggtccctc attgcac 1763014DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 630ctacagtgaa atct 1463113DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 631tgtggcagtg gca 1363214DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 632ctcagaaaag gagc 1463314DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 633catcatgcag ctca 1463412DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 634tggccagccc aa 1263514DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 635gacacaggag gtca 14

Claims

1. A method for detecting a first allelic variant of a target sequence in a nucleic acid sample suspected of comprising at least a second allelic variant of the target sequence, comprising: a) forming a first reaction mixture by combining: i) the nucleic acid sample; ii) a first allele-specific primer, wherein an allele-specific nucleotide portion of the first allele-specific primer is complementary to the first allelic variant of the target sequence; iii) a first allele-specific blocker probe that is complementary to a region of the target sequence comprising the second allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the first allele-specific primer, and wherein the first allele-specific blacker probe comprises a minor groove binder; iv) a first locus-specific primer that is complementary to a region of the target sequence that is 3' from the first allelic variant and on the opposite strand; and v) a first detector probe; b) carrying out an amplification reaction on the first reaction mixture using the first locus-specific primer and the first allele-specific primer to form a first amplicon; and c) detecting the first amplicon by detecting a change in a detectable property of the first detector probe, thereby detecting the first allelic variant of the target gene in the nucleic acid sample.

2. The method of claim 1, further comprising using the change in a detectable property of the first detector probe to quantitate the first allelic variant.

3. The method of claim 1, further comprising: d) forming a second reaction mixture by combining: i) the nucleic acid sample; ii) a second allele-specific primer, wherein an allele-specific nucleotide portion of the second allele-specific primer is complementary to the second allelic variant of the target sequence; iii) a second allele-specific blocker probe that is complementary to a region of the target sequence comprising the first allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the second allele-specific primer, and wherein the second allele-specific blocker probe comprises a minor groove binder; iv) a second locus-specific primer that is complementary to a region of the target sequence that is 3' from the second allelic variant and on the opposite strand; and v) a second detector probe; e) carrying out an amplification reaction on the second reaction mixture using the second allele-specific primer and the locus-specific primer, to form a second amplicon; and f) detecting the second amplicon by detecting a change in a detectable property of the detector probe, thereby detecting the second allelic variant of the target gene in the nucleic acid sample.

4. The method of claim 3, further comprising comparing the change in a detectable property of the first detector probe in the first reaction mixture to the change in a detectable property of the second detector probe in the second reaction mixture.

5. The method of claim 1 or 3, wherein said first, second or first and second allele-specific primer and/or said first, second, or first and second allele-specific blocker probe comprises at least one modified base.

6. The method of claim 5, wherein said modified base is an 8-aza-7-deaza-dN (ppN) base analog, where N is adenine (A), cytosine (C), guanine (G), or thymine (T).

7. The method of claim 5, wherein said modified base is a locked nucleic acid (LNA) base.

8. The method of claim 5, wherein said modified base is a fdU or iso dC base.

9. The method of claim 5, wherein said modified base is any modified base that increases the Tm between matched and mismatched target sequences or nucleotides.

10. The method of claim 5, wherein said modified base is located at (a) the 3'-end, (b) the 5'-end, (e) at an internal position or at any combination of (a), (b) or (c) within said allele-specific primer and/or allele-specific blocker probe.

11. The method of claim 5, wherein the specificity of said detecting is improved by the inclusion of said modified base in said first, second or first and second allele-specific primer and/or said first, second, or first and second allele-specific blocker probe as compared to when it is not.

12. The method of claim 11, wherein said improvement is at least 2 fold.

13. The method of claim 1 or 3, wherein the specificity of said detecting is improved by at least 2 fold as compared to the specificity of detecting an allelic variant in a nucleic acid sample using ASB-PCR methods.

14. The method of claim 1 or 3, wherein said carrying out an amplification reaction comprises a 2-stage cycling protocol.

15. The method of claim 14, wherein the number of cycles in the first stage of said 2-stage cycling protocol comprises fewer cycles than the number of cycles used in the second stage.

16. The method of claim 14, wherein said number of cycles in the first stage is about 90% fewer cycles than said number of cycles in the second stage.

17. The method of claim 14, wherein said number of cycles in the first stage is between 3-7 cycles and said number of cycles in the second stage is between 42-48 cycles.

18. The method of claim 14, wherein the annealing/extension temperature used during the first cycling stage of said 2-stage cycling protocol is between 1-3.degree. C. lower than the annealing/extension temperature used during the second stage.

19. The method of claim 14, wherein said annealing/extension temperature used during the first cycling stage of said 2-stage cycling protocol is between 56-59.degree. C. and said annealing/extension temperature used during said second stage is between 60-62.degree. C.

20. The method of claim 1, wherein said step (a) is preceded by a pre-amplification step.

21. The method of claim 20, wherein said pre-amplification step comprises a multiplex amplification reaction that uses at least two complete sets of allele-specific primers and locus-specific primers, wherein each set is suitable or operative for amplifying a specific polynucleotide of interest.

22. The method of claim 21, wherein the products of said multiplex amplification reaction are divided into secondary single-plex amplification reactions, wherein each single-plex amplification reaction contains at least one primer set previously used in said multiplex reaction.

23. The method of claim 21, wherein said multiplex amplification reaction further comprises a plurality of allele-specific blocker probes.

24. The method of claim 21, wherein said multiplex amplification reaction is carried out for a number of cycles suitable to keep the reaction within the linear phase of amplification.

25. A reaction mixture comprising: a) a nucleic acid molecule; b) an allele-specific primer, wherein an allele-specific nucleotide portion of the allele-specific primer is complementary to a first allelic variant of a target sequence; c) an allele-specific blocker probe that is complementary to a region of the target sequence comprising a second allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the allele-specific primer, and wherein the allele-specific blocker probe comprises a minor groove binder; d) a locus-specific primer that is complementary to a region of the target sequence that is 3' from the first allelic variant and on the opposite strand; and e) a detector probe.

26. The reaction mixture of claim 25, wherein said allele-specific primer and/or said allele-specific blocker probe comprises at least one modified base.

27. The reaction mixture of claim 26, wherein said modified base is an 8-aza-7-deaza-dN (ppN) base analog, where N is adenine (A), cytosine (C), guanine (G), or thymine (T).

28. The reaction mixture of claim 26, wherein said modified base is a locked nucleic acid (LNA) base.

29. The reaction mixture of claim 26, wherein said modified base is a fdU or iso dC base.

30. The reaction mixture of claim 26, wherein said modified base is any modified base that increases the Tm between matched and mismatched target sequences or nucleotides.

31. The reaction mixture of claim 26, wherein said modified base is located at (a) the 3'-end, (b) the 5'-end, (c) at an internal position or at any combination of (a), (b) or (c) within said allele-specific primer and/or allele-specific blacker probe.

32. A composition comprising: a) a first allele-specific primer, wherein an allele-specific nucleotide portion of the first allele-specific primer is complementary to the first allelic variant of a target sequence; b) a first allele-specific blocker probe that is complementary to a region of the target sequence comprising the second allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the first allele-specific primer, and wherein the first allele-specific blocker probe comprises a minor groove binder;

33. The composition of claim 32, further comprising a locus-specific primer that is complementary to a region of the target sequence that is 3' from the first allelic variant and on the opposite strand.

34. The composition of claim 32 or 33, wherein said first allele-specific primer and/or said first allele-specific blocker probe comprises at least one modified base.

35. The composition of claim 34, wherein said modified base is an 8-aza-7-deaza-dN (ppN) base analog, where N is adenine (A), cytosine (C), guanine (G), or thymine (T).

36. The composition of claim 34, wherein said modified base is a locked nucleic acid (LNA) base.

37. The composition of claim 34, wherein said modified base is a fdU or iso dC base.

38. The composition of claim 34, wherein said modified base is any modified base that increases the Tin between matched and mismatched target sequences or nucleotides.

39. The composition of claim 34, wherein said modified base is located at (a) the 3'-end, (b) the 5'-end, (c) at an internal position or at any combination of (a), (b) or (c) within said allele-specific primer and/or allele-specific blocker probe.

40. A kit comprising, two or more containers comprising the following components independently distributed in one of the two or more containers: a) a first allele-specific primer, wherein an allele-specific nucleotide portion of the first allele-specific primer is complementary to the first allelic variant of a target sequence; and b) a first allele-specific blocker probe that is complementary to a region of the target sequence comprising the second allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the first allele-specific primer, and wherein the first allele-specific blocker probe comprises a minor groove binder.

41. The kit of claim 40, further comprising a locus-specific primer that is complementary to a region of the target sequence that is 3' from the first allelic variant and on the opposite strand.

42. The kit of claim 41, wherein said first allele-specific primer and/or first allele-specific blocker probe comprises at least one modified base.

43. The kit of claim 42, wherein said modified base is a 8-aza-7-deaza-dN (ppN) base analog, where N is adenine (A), cytosine (C), guanine (G), or thymine (T).

44. The kit of claim 42, wherein said modified base is a locked nucleic acid (LNA) base.

45. The kit of claim 42, wherein said modified base is any modified base that increases the Tin between matched and mismatched target sequences and/or nucleotides.

46. The kit of claim 42, wherein said allele-specific blocker probe comprises an MGB moiety at the 3'-end, the 5'-end and/or at an internal position within said allele-specific blocker probe.

47. A method for detecting a first allelic variant in a target sequence in a nucleic acid sample, comprising: a) forming a reaction mixture comprising: i) a nucleic acid sample; ii) an allele-specific primer, wherein an allele-specific nucleotide portion of the allele-specific primer is complementary to the first allelic variant of the target sequence; iii) an allele-specific blocker probe that is complementary to a region of the target sequence comprising a second allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the allele-specific primer, and wherein the allele-specific blocker probe comprises a blocking moiety; iv) a locus-specific primer that is complementary to a region of the target sequence that is 3' from the first allelic variant and on the opposite strand; and v) a detector probe; b) PCR amplifying the target sequence using a 2-stage cycling protocol, comprising: i) a first amplification step comprising a first number of cycles run at a first annealing/extension temperature; and ii) a second amplification step comprising a second number of cycles run at a second annealing/extension temperature, wherein the first number of cycles is fewer than the second number of cycles and the first annealing/extension temperature is lower than said second annealing/extension temperature. c) detecting a change in a detectable property of the detector probe in the amplified products of the target sequence produced by step (b), thereby detecting the first allelic variant of the target gene in the nucleic acid sample.

48. The method of claim 47, wherein said number of cycles in the first step is about 90% fewer cycles than said number of cycles in the second step.

49. The method of claim 14, wherein said number of cycles in the first step is between 3-7 cycles and said number of cycles in the second step is between 42-48 cycles.

50. The method of claim 14, wherein the annealing/extension temperature used during the first step of said 2-stage cycling protocol is between 1-3.degree. C. lower than the annealing/extension temperature used during the second step.

51. The method of claim 14, wherein said annealing/extension temperature used during the first step of said 2-stage cycling protocol is between 56-59.degree. C. and said annealing/extension temperature used during said second step is between 60-62.degree. C.

52. A method for detecting an allelic variant of a target sequence in a nucleic acid sample, comprising: a) forming in a single vessel a first reaction mixture comprising: i) a nucleic acid sample; and ii) at least two sets of primers wherein each set comprises (a) a first allele-specific primer and a second allele-specific primer, wherein the allele-specific nucleotide portion of said first and second allele-specific primers is complementary to a first allele and a second allele, respectively, of a given SNP within a target sequence; and (b) a locus-specific primer that is complementary to a region of said target sequence that is 3' from the first and second alleles and on the opposite strand; wherein the at least two sets of primers is each specific for a different target sequence; b) amplifying said different target sequences using a number of cycles suitable to keep the reaction within a linear phase; c) dividing the amplified products of step (b) into at least two separate vessels; d) adding to each of the divided products of step (c) i) at least one set of primers used in step (a), ii) an allele-specific blocker probe that is complementary to a region of said target sequence comprising a second allelic variant, wherein said region encompasses a position corresponding to the binding position of the allele-specific nucleotide portion of the first allele-specific primer, and wherein the first allele-specific blacker probe comprises a minor groove binder; and iv) a detector probe to form a second and a third reaction mixture in the at least two separate vessels; e) amplifying said target sequence in said second and third reaction mixtures; and f) detecting a change in a detectable property of the detector probe in each of the amplified products of said target sequence produced by step (e), thereby detecting the allelic variant of the target gene in the nucleic acid sample.

53. The method of claim 52, wherein said first reaction mixture is a multiplex reaction and said second and third reaction mixtures are single-plea reactions.