U.S. patent application number 12/777074 was filed with the patent office on 2010-11-11 for immunoglobulin fusion proteins.
This patent application is currently assigned to BOLDER BIOTECHNOLOGY, INC.. Invention is credited to George N. Cox, III, Daniel H. Doherty.
Application Number | 20100285014 12/777074 |
Document ID | / |
Family ID | 22504169 |
Filed Date | 2010-11-11 |
United States Patent
Application |
20100285014 |
Kind Code |
A1 |
Cox, III; George N. ; et
al. |
November 11, 2010 |
IMMUNOGLOBULIN FUSION PROTEINS
Abstract
The present invention relates to novel methods for making fusion
proteins comprising a cytokine or growth factor fused to an
immunoglobulin domain. The growth factor/cytokine can be fused
directly to an immunoglobulin domain or through a peptide linker.
The purified growth factor/cytokine-IgG fusion proteins produced by
the novel methods are biologically active and can be used to treat
diseases for which the non-fused growth factor/cytokine are
useful.
Inventors: |
Cox, III; George N.;
(Louisville, CO) ; Doherty; Daniel H.; (Boulder,
CO) |
Correspondence
Address: |
SHERIDAN ROSS PC
1560 BROADWAY, SUITE 1200
DENVER
CO
80202
US
|
Assignee: |
BOLDER BIOTECHNOLOGY, INC.
Boulder
CO
|
Family ID: |
22504169 |
Appl. No.: |
12/777074 |
Filed: |
May 10, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10031154 |
Apr 24, 2002 |
7754855 |
|
|
PCT/US00/19336 |
Jul 13, 2000 |
|
|
|
12777074 |
|
|
|
|
60143458 |
Jul 13, 1999 |
|
|
|
Current U.S.
Class: |
424/134.1 ;
435/325; 435/69.6; 530/387.3; 536/23.4 |
Current CPC
Class: |
A61P 35/00 20180101;
A61P 7/04 20180101; C07K 14/5431 20130101; C07K 2319/30 20130101;
C07K 14/521 20130101; C07K 2319/00 20130101; A61P 7/00 20180101;
C07K 14/524 20130101; C07K 14/505 20130101; A61P 37/02 20180101;
A61P 25/00 20180101; A61K 38/00 20130101; C07K 14/565 20130101;
A61P 31/12 20180101; C07K 14/61 20130101; C07K 14/475 20130101;
C07K 14/56 20130101; C07K 14/535 20130101 |
Class at
Publication: |
424/134.1 ;
530/387.3; 536/23.4; 435/325; 435/69.6 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C07K 16/18 20060101 C07K016/18; C07H 21/00 20060101
C07H021/00; C12N 5/10 20060101 C12N005/10; C12P 21/00 20060101
C12P021/00; A61P 37/02 20060101 A61P037/02 |
Claims
1.-37. (canceled)
38. A fusion protein comprising a granulocyte colony-stimulating
factor protein joined without an intervening peptide linker to a
immunoglobulin (Ig) domain that does not contain a variable
region.
39. The fusion protein of claim 38, wherein the Ig domain is
selected from the group consisting of IgG-Fc, IgG-C.sub.H and
IgG-C.sub.L.
40. A pharmaceutical composition comprising the fusion protein of
claim 38 in a pharmaceutically acceptable carrier.
41. A composition comprising the fusion protein of claim 38,
wherein said fusion protein is dimeric and wherein said composition
is essentially free of monomeric fusion protein.
42. A nucleic acid encoding the fusion protein of claim 38.
43. An isolated host cell transfected or transformed with the
nucleic acid of claim 42, enabling the host cell to express the
fusion protein.
44. The isolated host cell of claim 43, wherein the host cell is a
eukaryotic cell.
45. The isolated host cell of claim 44, wherein the eukaryotic cell
is a mammalian cell.
46. A method of producing a fusion protein of claim 38, comprising:
a) transfecting or transforming a host cell with an expression
vector comprising at least one nucleic acid encoding the fusion
protein of claim 38; b) culturing the host cell under conditions
effective to express said fusion protein; and c) harvesting the
fusion protein expressed by the host cell.
47. A method of purifying the fusion protein of claim 38,
comprising: a) obtaining a composition comprising the fusion
protein; and b) isolating the fusion protein from contaminants by
column chromatography.
48. The method of claim 47, wherein the fusion protein is isolated
from contaminants by size-exclusion chromatography.
49. The fusion protein of claim 38, wherein the granulocyte
colony-stimulating factor is a full-length human granulocyte
colony-stimulating factor.
50. The fusion protein of claim 38 wherein the fusion protein has
an EC.sub.50 of less than about 300 ng/ml in a granulocyte
colony-stimulating factor-dependent in vitro bioassay using a
murine NFS60 cell line that proliferates in response to granulocyte
colony-stimulating factor.
51. The fusion protein of claim 38, wherein said fusion protein has
an EC.sub.50 of less than 30 ng/ml in a granulocyte
colony-stimulating factor-dependent in vitro bioassay using a
murine NFS60 cell line that proliferates in response to granulocyte
colony-stimulating factor.
52. The fusion protein of claim 38, wherein said fusion protein has
an EC.sub.50 within 4 fold of the EC.sub.50 of non-fused
granulocyte colony-stimulating factor, on a molar basis, in a
granulocyte colony-stimulating factor-dependent in vitro bioassay
using a murine NFS60 cell line that proliferates in response to
granulocyte colony-stimulating factor.
53. A fusion protein comprising a granulocyte colony-stimulating
factor protein joined without an intervening peptide linked to a
immunoglobulin (Ig) domain that does not contain a variable region
wherein the Ig domain is selected from the group consisting of
full-length IgG-Fc, IgG-C.sub.H and IgG-C.sub.L, wherein the fusion
protein comprises the natural granulocyte colony-stimulating factor
amino acid sequence and the natural immunoglobulin domain amino
acid sequence at the junction of the fusion protein, and wherein
the fusion protein has an EC.sub.50 of less than about 1000 ng/ml
in a granulocyte colony-stimulating factor-dependent in vitro
bioassay using a murine NFS60 cell line that proliferates in
response to granulocyte colony-stimulating factor.
54. The fusion protein of claim 38, wherein a serine is substituted
for cysteine-17 of granulocyte colony-stimulating factor.
55. A method of treating a condition treatable with granulocyte
colony-stimulating factor, comprising administering an effective
amount of the fusion protein of claim 38 to a patient in need
thereof.
56. The method of claim 55, wherein the condition is a deficient
white blood cell count, and wherein administration of the fusion
protein increases the number of white blood cells of the
patient.
57. A fusion protein comprising granulocyte colony-stimulating
factor joined at its carboxy-terminus by a peptide linker to the
amino terminus of an immunoglobulin domain that does not contain a
variable region, wherein the peptide linker is selected from the
group consisting of SerGly, SerGlyGlySer (SEQ ID NO:1) and
Ser(GlyGlySer).sub.2 (SEQ ID NO:3).
Description
FIELD OF THE INVENTION
[0001] This invention relates generally to methods for constructing
chimeric proteins and more specifically to methods for constructing
recombinant immunoglobulin fusion proteins.
BACKGROUND OF THE INVENTION
[0002] Prolonging the circulating half-lives of protein
pharmaceuticals is of interest to patients and healthcare
providers. Long acting protein therapeutics should require less
frequent injections and can be effective at lower doses than
proteins with shorter circulating half-lives. It is known that
increasing the effective size of a protein can increase its
circulating half-life by preventing removal of the protein by the
kidney (Knauf et al., 1988; Mahmood, 1998). One method that can be
used to increase the effective size of a protein is to use
recombinant DNA technology to covalently fuse the protein of
interest to a second protein. The larger fusion protein often has a
longer circulating half-life than the non-fused protein (Capon et
al., 1989; Zeng et al., 1995). One class of proteins that has been
used frequently to create fusion proteins is immunoglobulins (Ig),
which are major components of blood. Immunoglobulins occur in
various classes known as IgG, IgM, IgA, IgD, and IgE (Roitt et al.,
1989). Human IgGs can be further divided into various types known
as IgG1, IgG2, IgG3 and IgG4, which are products of distinct genes.
IgG1 is the most common immunoglobulin in serum (70% of total IgG)
and has a serum half-life of 21 days (Capon et al., 1989; Roitt et
al., 1989). Although less abundant, IgG4 also has a long
circulating half-life of 21 days (Roitt et al., 1989)
[0003] Human IgGs have a multidomain structure, comprising two
light chains disulfide-bonded to two heavy chains (referred to
herein as a "tetramer"; reviewed in Roitt et al., 1989). Each light
chain and each heavy chain contains a variable region joined to a
constant region. The variable regions are located at the N-terminal
ends of the light and heavy chains. The heavy chain constant region
is further divided into CH1, Hinge, CH2 and CH3 domains. The CH1,
CH2 and CH3 domains are discreet domains that fold into a
characteristic structure. The Hinge region is a region of
considerable flexibility. Flexibility of the hinge can vary
depending upon the IgG isotype (Oi et al., 1984; Dangl et al.,
1988). IgG heavy chains normally form disulfide-linked dimers
through cysteine residues located in the Hinge region. The various
heavy chain domains are encoded by different exons in the IgG genes
(Ellison et al., 1981; 1982).
[0004] Proteins have been fused to the heavy chain constant region
of IgGs at the junction of the variable and constant regions (thus
containing the CH1-Hinge-CH2-CH3 domains--referred to herein as the
IgG-C.sub.H fusions) at the junction of the CH1 and Hinge domains
(thus containing the Hinge-CH2-CH3 domains--referred to herein as
IgG-Fc fusions), and at the C-terminus of the IgG heavy chain
(referred to herein as IgG-C-terminal fusions).
[0005] IgG fusion proteins have been created most often with the
extracellular domains of cell surface receptors (reviewed in Chamow
and Ashkenaki, 1996). Examples of extracellular domains of cell
surface receptors that have been joined using recombinant DNA
technology to the C.sub.H or Fc domains of human or mouse IgGs
include CD4 (Capon et al., 1989), tumor necrosis factor receptors
(Mohler et al., 1993), CTLA4 (Linsley et al., 1991a), CD80 (Linsley
et al., 1991b), and CD86 (Morton et al., 1996). Extracellular
domains of receptors evolved to function when fused to other amino
acids, i.e., the transmembrane and intracellular domains of the
receptor; therefore it is not surprising that extracellular
domain's retain their ligand binding properties when fused to other
protein domains such as IgG domains. Despite this, differences in
ligand binding properties have been noted for certain extracellular
domains. For example, a fusion protein comprised of the
extracellular domain of CD4 to human IgG1-C.sub.H had 2-fold
reduced affinity for the CD4 ligand gp120 than non-fused CD4 (Capon
et al., 1989).
[0006] There are far fewer examples of proteins that are normally
soluble, e.g., growth factors, cytokines and the like, which have
been fused to IgG domains and retained full biological activity.
Soluble proteins did not evolve to function when fused to other
proteins and there is no reason to expect them to retain biological
activity when fused to other proteins. In fact, in the majority of
the published examples, biological activity of the fused
cytokine/growth factor was significantly reduced relative to the
non-fused cytokine/growth factor. Whether or not the
cytokine/growth factor will function properly when fused to another
protein will depend upon many factors, including whether the
amino-terminus or carboxy-terminus of the cytokine/growth factor is
exposed on the surface of the protein, whether these regions are
important for biological activity of the cytokine/growth factor and
whether the cytokine/growth factor is able to fold properly when
fused to another protein. By their very nature, such factors will
be highly protein-specific and unpredictable. Results with the few
growth factor/cytokine fusion proteins that have been studied have
shown how protein-specific biological activity of the fusion
protein can be. In the majority of cases, biological activity of
the fused growth factor/cytokine is severely reduced, whereas, in
the minority of cases full biological activity of the growth
factor/cytokine is retained. In one case where biological activity
of the fusion protein was significantly reduced, modifying the
amino acids at the junction between the cytokine/growth factor and
the IgG domain resulted in a fusion protein with improved
biological activity (Chen et al., 1994) This same modification did
not improve biological activity of a second cytokine fused to the
same IgG domain. [(Chen et al., 1994)
[0007] Growth factors that have been fused to IgGs include
keratinocyte growth factor (KGF), fibroblast growth factor (FGF)
and insulin-like growth factor (IGF-I). A KGF-mouse IgG1-Fc fusion
protein was created by LaRochelle et al. (1995). On a molar basis,
the fusion protein was 4-5-fold less active than KGF in stimulating
proliferation of Balb/MK cells in an in vitro bioassay. The
KGF-IgG-Fc fusion also had approximately 10-fold lower affinity for
the KGF receptor on cells than did KGF. A fibroblast growth
factor-human IgG-Fc fusion was constructed by Dikov et al. (1998).
On a molar basis the FGF-IgG1-Fc fusion protein was approximately
3-fold less active than FGF in in vitro assays in stimulating DNA
synthesis in NIH 3T3 cells. Shin and Morrison (1990) fused IGF-1 to
the C-terminus of IgG and found that the IGF-I-IgG C-terminal
fusion protein had less than 1% of the in vitro biological activity
of IGF-I.
[0008] Examples of cytokines that have been fused to IgG domains
include IL-2, IL-4, IL-10 and GM-CSF. Landolphi (1991; 1994)
described an IL-2-IgG1-C.sub.H fusion protein, which included an
extra serine between the C-terminus of IL-2 and the N-terminus of
the IgG-C.sub.H domain. The IL-2-IgG1-C.sub.H fusion protein was
purported to be as active, on a molar basis, in in vitro bioassays
as IL-2, but no details were provided as to how protein
concentrations were quantitated (Landolphi, 1991; 1994). Zeng et
al. (1995) fused mouse IL-10 directly to the Fc region of mouse
IgG2a; however the first amino acid of the Fc hinge region was
changed from Glu to Asp. Zeng et al (1995) reported that the
IL-10-IgG2a fusion protein was fully active in in vitro bioassays;
however, only two concentrations of the fusion protein were
studied, both of which were saturating. Given these high protein
concentrations, only major differences (e.g., 100-fold) in
bioactivities between the IL-10-mouse IgG2a fusion protein and
IL-10 could have been detected. To detect smaller differences in
bioactivities, one needs to analyze serial dilutions of the
proteins in in vitro bioassays and calculate EC.sub.50s (the
concentration of protein required for half-maximal stimulation) or
IC.sub.50s (the concentration of protein required for half-maximal
inhibition). EC.sub.50s of the IL-10-IgG2a and IL-10 were not
reported by Zheng et al. (1995). Chen et al. (1994) also
constructed an IL-2-IgG fusion protein and reported that this
fusion protein was fully active. Gillies et al. (1993) also
reported creating a fully active IL-2 fusion protein comprising
IL-2 fused to the C-terminus of an antiganglioside IgG antibody.
Unexpectedly, Gillies et al. (1993) found that a fusion between the
same antibody and GM-CSF displayed only 20% of wild type GM-CSF
bioactivity. Chen et al. (1994) were able to create a fully active
IgG-C-terminal-GM-CSF fusion protein by inserting four amino acids
between the antibody molecule and GM-CSF. Unexpectedly, they
reported that fusion of IL-4 to the same antibody using the same
four amino acid linker resulted in an IL-4 protein with 25-fold
reduced biological activity (Chen et al., 1994).
[0009] Qiu et al. (1998) described homodimeric erythropoietin (EPO)
proteins in which two EPO proteins were fused together using
flexible peptide linkers of 3-7 glycine residues. The peptide
linker joined the C-terminus of one EPO protein to the N-terminus
of the second EPO protein. In vitro bioactivities of the fusion
proteins were significantly reduced (at least 4- to 10-fold)
relative to wild type EPO (Qiu et al., 1998).
[0010] Thus, the literature indicates that the amino acids at the
junction between the growth factor/cytokine domain and the IgG
domain can have a profound influence on the biological activity of
the fused growth factor/cytokine.
[0011] For use as human therapeutics, it is desirable that
bioactivity of a growth factor/cytokine-IgG fusion protein be as
close to wild type, i.e., the non-fused protein, as possible.
Fusion proteins with high activity can produce greater therapeutic
benefits at lower doses than fusion proteins with lower specific
activities. This will reduce the cost of medicines and provide
patients with greater therapeutic benefits. For use as a human
therapeutic it also is advantageous that the protein be as
homogeneous and pure as possible. Ig fusion proteins are
synthesized as monomers, which can assemble to form
disulfide-linked dimers and tetramers, depending upon the type of
fusion protein. The relative proportions of monomers, dimers and
tetramers can vary from lotto lot, depending upon manufacturing
conditions. Lot to lot variability can result in heterogeneous
product mixtures with varying activities. Because of their larger
size, tetramers are expected to have longer circulating half-lives
in the body than dimers or monomers, and dimers are expected to
have longer circulating half-lives than monomers. For this reason,
tetramers, dimers and monomers may produce different therapeutic
effects in vivo. Purified, homogeneous preparations of tetramers,
dimers or monomers are preferred as therapeutics because they will
have defined specific activities. For use as human therapeutics it
also may be beneficial to keep the length of any linker sequence
joining the growth factor/cytokine domain to the Ig domain to a
minimum to reduce the possibility of developing an immune response
to the non-natural amino acids in the linker sequence. Joining the
two proteins without an intervening linker sequence, referred to
herein as a "direct fusion", eliminates the possibility of
developing an immune response to a non-natural linker and thus is
one preferred form of an Ig fusion protein.
[0012] The literature on Ig fusion proteins merely provides
examples for making "non-direct" cytokine/growth factor-Ig fusion
protein, i.e., fusion proteins in which the growth factor/cytokine
is joined to an Ig domain through a peptide linker. WO 99/02709
provides examples for joining EPO to an Ig domain by using a Bam HI
restriction enzyme site to join DNA sequences encoding the
proteins. This method can be used to create EPO-Ig fusion proteins
containing linkers. Because Bam HI has a specific DNA recognition
sequence, GGATCC, which is not present at the junctions of the EPO
or Ig-Fc, Ig-C.sub.H or light chain constant regions, this method
is not useful for constructing EPO-Ig direct fusions.
[0013] EP 0464533A provides examples for making Ig fusion proteins
that contain the specific three amino acid linker, AspProGlu,
between the cytokine and Ig domains. The methods described in EP
0464533A rely on RNA splicing of separate exons encoding the
cytokine and the Ig domain to create the fusion protein. The
AspProGlu linker was required at the end of the cytokine/growth
factor coding region because the RNA splicing reaction has specific
sequence requirements at the splice site; the AspProGlu linker is
encoded by nucleotides that may allow RNA splicing to occur. EP
0464533A provides an example for making an EPO-Ig fusion protein
containing an AspProGlu linker using this method. The EPO coding
region was modified to delete Arg166 and add the amino acid linker,
ProGlu, immediately following Asp165 of the EPO coding sequence.
This resulted in the creation of an EPO-Ig fusion protein
containing an AspProGlu linker (Asp165 of the EPO coding sequence
provided the Asp of the linker sequence). The methods described by
EP 0464533A are, therefore, not useful for creating Ig direct
fusions or Ig fusions that do not contain AspProGlu or ProGlu
linkers.
[0014] U.S. Pat. No. 5,349,053 describes methods for creating an
IL-2-IgG-C.sub.H fusion protein that contains a Ser linker between
the IL-2 and Ig domains. The methods described in U.S. Pat. No.
5,349,053 rely on RNA splicing of separate exons encoding the IL-2
and the IgG-C.sub.H domain. Because the RNA splicing reaction has
specific sequence requirements at the splice site, the IL-2 coding
region needed to be modified to add a TCA codon encoding serine to
the carboxy terminus of the IL-2 coding region. The TCA codon was
engineered to be followed by an intron splice junction sequence.
This resulted in the creation of an IL-2-IgG-C.sub.H fusion protein
containing a Ser linker. The methods described in U.S. Pat. No.
5,349,053 are not useful for creating cytokine/growth factor-Ig
direct fusions, or cytokine/growth factor-Ig fusions that do not
contain a Ser linker.
[0015] Growth factor/cytokine-IgG fusion proteins, including
EPO-IgG and G-CSF-IgG fusion proteins, are contemplated in EP 0 464
533 A, WO99/02709 and Landolphi (1991; 1994). None of these
references present any data regarding expression, purification and
bioactivities of the contemplated EPO-IgG and G-CSF-IgG fusion
proteins. Landolphi (1991; 1994) present bioactivity data for an
IL-2-IgG1-C.sub.H fusion protein, but not for any other IgG fusion
protein. The EPO-IgG1-Fc fusion protein contemplated by EP 0 464
533 A contains the two amino acid linker, ProGlu, between Asp165 of
the EPO coding sequence and the beginning of the IgG1-Fc hinge
region. The carboxy-terminal amino acid in EPO, Arg166 would be
deleted. EP 0 464 533 A does not provide any information as to how
the G-CSF coding region would be joined to the IgG1-Fc hinge
region. Bioactivity data for neither protein is provided in EP 0
464 533. WO 99/02709 describes an EPO-mouse IgG2a-Fc fusion
protein, but not an EPO-human IgG fusion protein. Bioactivity data
for the EPO-mouse IgG2a-Fc fusion protein are not presented. WO
99/02709 also does not provide details as to the source of the EPO
cDNA or human IgG genes used to construct the contemplated fusion
proteins or the precise amino acids used to join EPO to the IgG
domain. The reference cited in WO 99/02709 (Steurer et al., 1995)
also does not provide this information.
[0016] WO 99/02709 postulates that a flexible peptide linker of
1-20 amino acids can be used to join EPO to an Ig domain; however
the amino acids to be used to create the flexible linkers are not
specified in WO 99/02709. Qiu et al. (1998) reported that EPO
fusion proteins joined by flexible linkers of 3-7 glycine residues
have significantly reduced biological activities (4-10-fold)
relative to wild type EPO.
[0017] WO 99/02709 provides methods for using conditioned media
from COS cells transfected with plasmids encoding hypothetical
EPO-IgG fusion proteins to increase the hematocrit of a mouse. Such
conditioned media will contain mixtures of monomeric and dimeric
EPO-IgG fusion proteins as well as many other proteins. WO 99/02709
does not provide any evidence demonstrating that the methods taught
are effective.
[0018] Thus, despite considerable effort, a need still exists for
improved methods for creating growth factor/cytokine-Ig fusion
proteins directly or with a variety of different linker types that
preserve biological activity of the growth factor/cytokine domain
of the Ig fusion protein. The present invention satisfies this need
and provides related advantages.
BRIEF DESCRIPTION OF THE DRAWING
[0019] FIG. 1 is a diagram showing the amplification of two DNA
fragments (CH1-Hinge and Hinge-CH2-CH3) that share a region of
partial overlap (a portion of the Hinge region) using PCR and
oligonucleotide primers a and b to generate a larger DNA fragment
that includes CH1-Hinge-CH2-CH3.
SUMMARY OF THE INVENTION
[0020] The present invention discloses novel Ig fusion proteins in
which a soluble protein is joined directly to an Ig domain or by an
amino acid linker that is not AspProGlu or Ser. The soluble protein
is a growth factor, a cytokine or an active variant of a growth
factor or cytokine. Useful linkers include a mixture of Glycine and
Serine residues, preferably SerGly and
Ser(GlyGlySer).sub.n(SEQ.ID.NO.1), where n can be 1-7. The Ig
domain preferably includes the constant region and is preferably
selected from IgG-Fc, IgG-C.sub.H or C.sub.L. Examples of growth
factors and cytokines and their active fragments that substantially
retain biological activity of the non-fused proteins when joined to
Ig domains as direct fusions or through these linker sequences
include members of the growth hormone (GH) supergene family such
as, for example, G-CSF, EPO, GH, alpha interferon, beta interferon,
gamma interferon, GM-CSF, IL-11, TPO, SCF and Flt3 ligand.
[0021] For example, EPO-IgG-Fc fusion proteins and G-CSF-IgG-Fc
fusion proteins have biological activities, on a molar basis,
equivalent to non-fused EPO and G-CSF. IgG-C.sub.H fusions of EPO
and G-CSF surprisingly have in vitro biological activities within
2-4-fold of non-fused EPO and G-CSF. Growth Hormone-IgG-Fc and
Growth Hormone-IgG-C.sub.H fusion proteins unexpectedly have
biological activities within 4- to 17-fold of non-fused Growth
Hormone. Similarly, biologically active IgG-Fc, IgG-C.sub.H, and
Ig-C.sub.L fusion constructs using IFN-.alpha.2 and IFN-.beta. are
also provided.
[0022] IgG-Fc fusions of EPO, G-CSF and Growth Hormone are more
active than identical IgG-C.sub.H fusions of these growth
factors/cytokines. Ig-C.sub.L fusions of IFN-.alpha. are more
active than identical IgG-Fc or IgG-C.sub.H fusions of IFN-.alpha..
The bioactivity differences between IgG-Fc, IgG-C.sub.H and
Ig-C.sub.L fusion proteins were also unexpected. In addition,
preferred sites for constructing EPO-IgG, G-CSF-IgG, Growth
Hormone-IgG, and IFN-.alpha.-Ig fusion proteins that maximize
bioactivity of the fused EPO, G-CSF, Growth Hormone and IFN-.alpha.
domains have now been identified.
[0023] The invention further provides novel growth
factor/cytokine-Ig fusion proteins comprising multimers of heavy
and light chain fusion proteins as well as methods for preparing
preparations of dimeric growth factor/cytokine-Ig fusion proteins
that are essentially free of monomeric fusion proteins, aggregates
and contaminating proteins. "Essentially free" is used herein to
mean at least 90% pure. The invention also provides novel
multimeric growth factors/cytokines where two or more
cytokines/growth factors are joined as direct fusions or by using
an amino acid linker.
[0024] Methods of treating various conditions are also provided in
which an effective amount of an Ig fusion protein of the present
invention are administered to a patient in need of such
therapy.
DETAILED DESCRIPTION OF THE INVENTION
[0025] In work described herein, it has now been discovered that
bioactivities of growth factor/cytokine-Ig fusion proteins can vary
depending upon the isotype of the IgG domain, where the growth
factor/cytokine is attached to the IgG domain, and whether the
protein is attached to the constant region of an Ig light chain or
an Ig heavy chain. These results were not predicted from the
literature. Although not wishing to be bound by any particular
theory, the inventors postulate that the bioactivity variability
they observed may relate to the flexibility and other physical
properties of the region in the Ig domain used to join to the
fusion proteins. Based upon these findings, it is believed that
bioactivity of an Ig fusion proteins created using mouse Ig domains
cannot be used to predict bioactivity of a Ig fusion proteins
created human Ig domains.
[0026] Accordingly, the invention generally relates to novel
methods for constructing Ig fusion proteins comprising a soluble
protein joined to an Ig domain and to the novel Ig fusion proteins
obtained by the methods. The methods involve the joining of a
soluble protein to an Ig domain as a direct fusion or with an
intervening amino acid linker.
[0027] The methods of the present invention are useful for
constructing Ig fusion proteins containing one or more growth
factors and/or cytokines, including, without limitation, EPO,
Growth Hormone (GH), G-CSF, IL-11, thrombopoietin (TPO), Stem Cell
Factor, Flt3 Ligand, GM-CSF and interferon, especially alpha, beta
and gamma interferon. Other proteins for which the methods are
useful include other members of the GH supergene family. Members of
the GH supergene family include GH, prolactin, placental lactogen,
erythropoietin (EPO), thrombopoietin (TPO), interleukin-2 (IL-2),
IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-11, IL-12 (p35
subunit), IL-13, IL-15, oncostatin M, ciliary neurotrophic factor,
leukemia inhibitory factor, alpha interferon, beta interferon,
gamma interferon, omega interferon, tau interferon,
granulocyte-colony stimulating factor (G-CSF),
granulocyte-macrophage colony stimulating factor (GM-CSF),
macrophage colony stimulating factor (M-CSF), cardiotrophin-1
(CT-1), Stem Cell Factor and the flt3/flk2 ligand (Bazan (1990;
1991; 1992; Mott and Campbell (1995); Silvennoinen and Ihle (1996);
Martin et al., 1990; Hannum et al., 1994). It is anticipated that
additional members of this gene family will be identified in the
future through gene cloning and sequencing. Members of the GH
supergene family have similar secondary and tertiary structures,
despite the fact that they generally have limited amino acid or DNA
sequence identity. The shared structural features of members of the
GH supergene family, which are described in Bazan (1990; 1991;
1992), Mott and Campbell (1995) and Silvennoinen and Ihle (1996),
allow new members of the gene family to be readily identified. The
methods described herein also are useful for creating Ig fusion
proteins with proteins that are normally soluble and are not
members of the GH supergene family. Active variants of these
proteins can also be used in constructing the Ig fusion proteins of
the present invention. The term "active variant" means a fragment
of a soluble protein that substantially retains the biological
activity of the full length protein and is described in more detail
below.
[0028] The methods disclosed herein also can be used to join a
growth factor/cytokine to an Ig domain using a linker of any amino
acid sequence and of any length as long as the linkers are not
AspProGlu or Ser. Preferred linkers are 1-50 amino acids in length,
and more preferably 1-22 amino acids in length. Preferably the
linker will not adversely affect bioactivity of the growth
factor/cytokine or Ig domain. Preferred linkers contain mixtures of
glycine and serine residues. Other amino acids that could be
incorporated into useful linkers include threonine and alanine
residues. One preferred linker disclosed herein is the two amino
acid linker SerGly. Other preferred linkers disclosed herein are
linkers of the motif Ser(GlyGlySer).sub.n(SEQ.ID.NO.1) where n can
be 1-7.
[0029] The Ig domains of the present invention include the constant
region such as, for example, an IgG-Fc, IgG-C.sub.H, an Fc or
C.sub.H domain from another Ig class, i.e., IgM, IgA, IgE, IgD or a
light chain constant domain. Truncations and amino acid variants or
substitutions of these domains also are included in this
invention.
[0030] In another aspect of the invention, IgG-Fc and IgG-C.sub.H
fusion proteins, for example, are synthesized as monomers that can
assemble to form dimers. Typically, the dimers are joined by
disulfide bonds in the IgG Hinge region. Conditioned media from
cells secreting the IgG fusion proteins can contain mixtures of IgG
fusion protein monomers and dimers. For use as human therapeutics
it will be desirable to use homogeneous populations of either IgG
fusion protein monomers or dimers, but not mixtures of the two
forms. Methods for obtaining essentially pure preparations of
dimeric growth factor/cytokine-IgG fusion proteins are also
provided. The methods are generally accomplished by obtaining a
host cell capable of expressing the IgG fusion protein, collecting
the conditioned media, and purifying the dimeric fusion protein
from monomeric fusion protein, aggregates and contaminating
proteins by column chromatography procedures. Suitable host cells
for expressing the IgG fusion proteins include yeast, insect,
mammalian or other eukaryotic cells. Preferably, the host cell is a
mammalian cell, particularly COS or CHO cells.
[0031] In one embodiment, EPO is joined directly to an Ig-Fc
domain, for example an IgG-Fc domain, and has an EC.sub.50 less
than 1,000 ng/ml, preferably less than 100 ng/ml, more preferably
less than 10 ng/ml and most preferably less than 4 ng/ml. In
another embodiment EPO is preferably joined to an IgG-Fc or
IgG-C.sub.H domain through a peptide linker of 2 to 7 amino acids
and has an EC.sub.50 less than 1,000 ng/ml, preferably less than
100 ng/ml, more preferably less than 10 ng/ml and most preferably
less than 4 ng/ml.
[0032] In another embodiment, G-CSF is joined directly to an Ig-Fc
domain, for example an IgG-Fc domain, and has an EC.sub.50 less
than 300 ng/ml, preferably less than 30 ng/ml, more preferably less
than 3 ng/ml and most preferably less than 300 pg/ml. In another
embodiment G-CSF is preferably joined to an IgG-Fc or IgG-C.sub.H
domain through a peptide linker of 2 to 7 amino acids and has an
EC.sub.50 less than 300 ng/ml, preferably less than 30 ng/ml, more
preferably less than 3 ng/ml and most preferably less than 300
pg/ml.
[0033] In another embodiment, GH is joined to an Ig-Fc or
Ig-C.sub.H domain, for example an IgG-Fc or IgG-C.sub.H domain,
through a peptide linker of 2 to 7 amino acids and has an EC.sub.50
less than 1,000 ng/ml, preferably less than 100 ng/ml, and most
preferably less than 10 ng/ml.
[0034] In another embodiment, IFN-.alpha. is joined to an Ig-Fc or
Ig-C.sub.H domain, for example an IgG-Fc or IgG-C.sub.H domain,
through a peptide linker of 2 to 7 amino acids and has an IC.sub.50
less than 1,000 ng/ml, preferably less than 100 ng/ml, more
preferably less than 40 ng/ml and most preferably less than 10
ng/ml. In another embodiment IFN-.alpha. is joined to a light chain
constant region though a peptide linker of 2 to 7 amino acids and
the fusion protein has an IC.sub.50 less than 100 ng/ml, preferably
less than 10 ng/ml, more preferably less than 1 ng/ml and most
preferably less than 100 pg/ml.
[0035] In another embodiment, IFN-.beta. is joined to an IgG-Fc or
IgG-C.sub.H domain through a peptide linker of 2 to 7 amino acids
and has an IC.sub.50 less than 10,000 ng/ml, preferably less than
1,000 ng/ml, more preferably less than 100 ng/ml and most
preferably less than 30 ng/ml.
[0036] It has now been discovered that purified GH-, EPO- and
G-CSF-IgG-C.sub.H fusion proteins have reduced specific activities
in in vitro biological assays compared to the non-fused proteins
and IgG-Fc fusion proteins. The invention further provides novel,
multimeric IgG-C.sub.H/Ig light chain constant domain fusion
proteins with improved biological activities. The invention also
relates to growth factor/cytokine-IgG fusion proteins in which the
IgG domain has been altered to reduce its ability to activate
complement and bind Fc receptors. The alteration of the IgG domain
for this purpose is described in Example 6 below.
[0037] Novel multimeric growth factor and/or cytokine fusion
proteins are also provided. In one embodiment two or more growth
factors and/or cytokines are joined directly to each other without
an intervening peptide linker. In another embodiment two or more
growth factors and/or cytokines are joined to each other through a
peptide linker of 1 to 50 amino acids, and more preferably through
a peptide linker of 1 to 7 amino acids. Particularly useful linkers
for this purpose include SerGly and
Ser(GlyGlySer).sub.n(SEQ.ID.NO.1), where n can be 1-7.
[0038] This invention includes active variants of the proteins and
immunoglobulin domains that possess some or all of the biological
properties of the corresponding full length or wild-type proteins
or immunoglobulin domains. Such variants include, but are not
limited to, amino acid variants, amino acid substitutions,
truncations, additions, changes in carbohydrate, phosphorylation or
other attached groups found on natural proteins, and any other
variants disclosed herein. In some cases the variants may possess
additional properties, e.g., improved stability or bioactivity, not
shared by the original protein. For example, Mark et al. (1984)
disclose an IFN-.beta. mutein in which cysteine at position 17 is
replaced by serine. IFN-.beta. (Ser-17) displays improved stability
relative to wild type IFN-.beta.. Similarly, replacing cysteine-125
of IL-2 yields a more stable IL-2 protein (Landolphi, 1991; 1994).
Lu et al. (1992) disclose a G-CSF mutein in which cysteine at
position 17 is replaced by serine. Kuga et al. (1989), Hanazono et
al. (1990) and Okabe et al. (1990) describe additional G-CSF
muteins with enhanced biological properties. Elliot and Byrne
(1995) have described mutants of EPO with enhanced biological
activities.
[0039] Methods of producing and purifying the Ig fusion proteins
are also provided. Such methods are generally accomplished by
obtaining a transformed or transfected host cell with at least one
nucleic acid encoding a growth factor or a cytokine that is not
IL-10 and an Ig domain. The host cell is cultured until the desired
fusion protein is expressed, followed by the purification or
isolation of the Ig fusion protein by any means known in the art or
as described in the Examples below. In one embodiment, methods of
purifying the fusion proteins include obtaining a composition
containing recombinantly produced Ig fusion proteins and isolating
the desired Ig fusion proteins from various contaminants using
column chromatography procedures, for example, a sizing column with
a desired molecular weight cutoff. The host cell can be any
suitable prokaryotic or eukaryotic cell line known to those skilled
in the art, including without limitation, bacterial, insect or
mammalian cells. Particularly useful cells are eukaryotic cells,
preferably mammalian cells, and more preferably COS or CHO
cells.
[0040] The Ig fusion proteins produced by the present methods can
be used for a variety of in vitro and in vivo uses. The proteins of
the present invention can be used for research, diagnostic or
therapeutic purposes that are known for their wildtype, natural, or
previously known modified counterparts.
[0041] In vitro uses include, for example, the use of the protein
for screening, detecting and/or purifying other proteins. The Ig
fusion proteins described herein also are useful as diagnostic
reagents for identifying cells expressing receptors for EPO, G-CSF
and GH, GM-CSF, IL-11, TPO, SCF, Flt3 ligand and alpha, beta and
gamma interferon. The Ig fusion proteins also are useful as in
vitro reagents for studying cell proliferation and
differentiation.
[0042] The Ig fusion proteins described herein can be used to treat
the same human conditions as the non-fused proteins. For example,
the EPO-IgG fusion proteins can be used to treat anemia resulting
from kidney failure, chemotherapy, radiation and drug
complications. The EPO-IgG fusion proteins also can be used to
stimulate red blood cell formation in normal individuals who wish
to enhance their red blood cell count or hematocrit prior to
surgery. The G-CSF-IgG fusion proteins can be used to treat
neutropenia resulting from chemotherapy, radiation and drug
complications, for mobilization of progenitor cells for collection
in peripheral blood progenitor cell transplants and for treatment
of severe chronic neutropenia. The GH-IgG fusion proteins can be
used to treat short stature and cachexia. The IFN-.alpha.-IgG
fusion proteins can be used to treat viral diseases and cancer. The
IFN-.beta.-IgG fusion protein can be used to treat multiple
sclerosis, viral diseases and cancer. The GM-CSF-IgG fusion
proteins can be used to treat neutropenia resulting from
chemotherapy, radiation and drug complications, for mobilization of
progenitor cells for collection in peripheral blood progenitor cell
transplants, for treatment of severe chronic neutropenia and as an
adjuvant for cancer vaccines. The SCF-IgG and Flt3 ligand-IgG
fusion proteins can be used to mobilize hematopoietic progenitor
cells for collection in peripheral blood progenitor cell
transplants. The IL-11-IgG and TPO-IgG fusion proteins can be used
for treating thrombocytopenia.
[0043] The Ig fusion proteins described herein will possess longer
circulating half-lives in patients, which will allow the fusion
proteins to be administered less frequently and/or in effective
lower doses than the non-fused proteins. Typically, GH and G-CSF
are administered by daily injections and EPO is administered by
thrice weekly injections. One skilled in the art can readily
determine the appropriate dose, frequency of dosing and route of
administration. Factors in making such determinations include,
without limitation, the nature and specific activity of the protein
to be administered, the condition to be treated, potential patient
compliance, the age and weight of the patient, and the like. The
compounds of the present invention can also be used as delivery
vehicles for enhancement of the circulating half-life of the
therapeutics that are attached or for directing delivery to a
specific target within the body.
[0044] Pharmaceutical compositions containing the Ig fusion
proteins of the present invention in a pharmaceutically acceptable
carrier are also provided. Those skilled in the art can readily
identify such pharmaceutically acceptable carriers, which include
without limitation physiological saline, Ringer's solution and the
like. Other agents can also be included in the pharmaceutical
compositions, including drugs, reagents, and therapeutic
agents.
[0045] Detailed methods for constructing the Ig fusion proteins of
the present invention are provided in the following examples, which
are intended to illustrate without limiting the present
invention.
Example 1
Construction of Growth Factor/Cytokine-IgG Gene Fusions
A. General Strategy.
[0046] Growth factor/cytokine (GF)-IgG gene fusions were
constructed as described below. The general strategy employed for
these constructions is outlined here and the specifics of
individual cloning steps are detailed below. Cloning of the
IgG4-C.sub.H coding sequence involved additional variations to the
general strategy and these variations are described below. The
human growth factor genes (GH, EPO and G-CSF) were cloned as cDNAs
from various RNA sources detailed below. PCR primers used in these
clonings added an optimized Kozak sequence (GCCACC; Kozak, 1991)
and a Hind III restriction site to the 5' end of each these clones
and a portion of a peptide linker (ser-gly-gly-ser) (SEQ.ID.NO.1)
terminating in a Bam HI restriction site, to the 3' end of each of
these clones. The growth factor genes were cloned as Hind III-Bam
HI fragments into the mammalian cell expression vector pCDNA3.1(+)
(Invitrogen, Inc., San Diego, Calif.) and sequenced. In parallel,
IgG coding sequences (IgG1-Fc, IgG1-C.sub.H, IgG4-Fc, IgG4-C.sub.H)
were cloned from cDNAs generated from human leukocyte RNA. PCR
forward primers used in these clonings incorporated a portion of a
peptide linker (gly-ser-gly-gly-ser) (SEQ.ID.NO.2) containing a Bam
HI restriction site at the 5' end of each of these clones. The
reverse PCR primers were designed to anneal to the 3' untranslated
regions of the IgG1 and IgG4 mRNAs (about 40 bp downstream of the
translational stop codon) and included an Xba I restriction site.
The IgG coding sequences were cloned into pCDNA3.1(+) as Bam HI-Xba
I fragments and confirmed by DNA sequencing. The fusion genes were
then constructed by excising the IgG coding sequences as Bam HI-Xba
I fragments and cloning these fragments into the pCDNA::GF
recombinant plasmids that had been cut with Bam HI and Xba I. In
the resulting pCDNA3.1 constructs the fusion genes are transcribed
by the strong cytomeglovirus immediate early promoter present in
pCDNA3.1(+) upstream of the cloned fusion gene. Ligation of the two
fragments through the Bam HI site within the linker sequence
results in a seven amino acid linker (ser-gly-gly-ser-gly-gly-ser)
(SEQ.ID.NO.3) at the fusion junction.
B. Cloning of Growth Hormone, EPO and G-CSF
[0047] 1. Cloning of human Growth Hormone: A cDNA encoding human
Growth Hormone (GH) was amplified from human pituitary
single-stranded cDNA (CLONTECH, Inc, Palo Alto, Calif.), using the
polymerase chain reaction (PCR) technique and primers BB87
(5>GCAAGCTTGCCACCATGGCTACAGGCTCCCGGACG 3) (SEQ.ID.NO.4) and BB88
(5>CGCGGATCCTCCGGAGAA GCCACAGCTGCCCTCCAC>3) (SEQ.ID.NO.5).
Primer BB87 anneals to the 5' end of the coding sequence for the
hGH secretion signal, whereas the reverse primer, BB88, anneals to
the 3' end of the GH coding sequence. The resulting .about.680 bp
PCR product was digested with Hind III and Bam HI, gel purified and
cloned into pCDNA3.1(+) vector (Invitrogen, Inc., Carlsbad, Calif.)
that had been digested with Hind III and Bam HI, alkaline
phosphatase treated, and gel purified. A clone with the correct DNA
sequence (Martial et al., 1979; Roskam and Rougeon, 1979; Seeburg,
1982; DeNoto et al., 1981) was designated pCDNA3.1(+)::GHfus or
pBBT159.
[0048] 2. Cloning of human Erythropoietin. A cDNA encoding human
erythropoietin (EPO) was cloned by PCR using forward primer BB45
(5>CCCGGAT CCATGGGGGTGCACGAATGTCCTG>3) (SEQ.ID.NO.6) and
reverse primer BB47 (5>CCCGAATTCTATGCCCAGGT GGACACACCTG>3)
(SEQ.ID.NO.7). BB45 anneals to the DNA sequence encoding the
initiator methionine and amino terminal portion of the EPO signal
sequence and contains a Bam HI site for cloning purposes. BB47
anneals to the 3' untranslated region of the EPO mRNA immediately
downstream of the translational stop signal and contains an Eco RI
restriction site for cloning purposes. Total RNA isolated from the
human liver cell line Hep3B was used in first strand synthesis of
single-stranded cDNA for PCR. For preparation of total cellular
RNA; Hep3B cells (available from the American Type Culture
Collection, Rockville, Md.) were grown in Delbecco's Modified
Eagle's media (DMEM) supplemented with 10% fetal bovine serum
(FBS). EPO expression was induced by treating the cells for 18 h
with 130 .mu.M Deferoxamine or 100 .mu.M cobalt chloride (Wang and
Semenza, 1993). RNA was isolated from the cells using an RNeasy
Mini kit (Qiagen, Santa Clarita, Calif.), following the
manufacturer's directions. Approximately 320 .mu.g of total RNA was
isolated from 1.4.times.10.sup.7 cells treated with cobalt chloride
and 270 .mu.g of total RNA isolated from 1.4.times.10.sup.7 cells
treated with Deferoxamine.
[0049] First strand synthesis of single-stranded cDNA was
accomplished using a 1st Strand cDNA Synthesis Kit for RT-PCR (AMV)
from Boehringer Mannheim Corporation (Indianapolis, Ind.) and
random hexamers were used as the primer. Subsequent PCR reactions
using the products of the first strand syntheses as templates were
carried out with primers BB45 and BB47. The expected approximately
(.about.) 600 bp PCR product was observed when reaction products
were run out on an agarose gel. Both RNA preparations yielded an
EPO PCR product. The PCR product was digested with Bam HI and Eco
RI and cloned into vector pUC19 that had been cut with Bam HI and
Eco RI and treated with alkaline phosphatase. DNA sequencing
identified a clone containing the correct coding sequence for the
EPO gene. This plasmid was designated pBBT131.
[0050] Plasmid pBBT131was used as template in a PCR reaction with
primers BB89 (5>CGCAAGCTTGCCACCATGGGGGTGC ACGAATGTCCT>3)
(SEQ.ID.NO.8) and BB90
(5>CGCGGATCCTCCGGATCTGTCCCCTGTCCTGCAGGC>3) (SEQ.ID.NO.9) to
construct a modified EPO cDNA suitable for fusion with IgG genes.
Primer BB89 anneals to the 5' end of the coding sequence for the
EPO secretion signal and the reverse primer, BB90, anneals to the
3' end of the EPO coding sequence. The resulting .about.610 bp PCR
product was digested with Hind III and Bam HI, gel purified and
cloned into pCDNA3.1(+) vector that had been digested with Hind III
and Bam HI, alkaline phosphatase treated, and gel purified. A clone
with the correct DNA sequence (Lin et al., 1985) was designated
pCDNA3.1(+)::EPOfus or pBBT176.
[0051] Similar procedures can be used to create modified EPO cDNAs
in which Arg166 is deleted. In this case a primer with the sequence
(5>CGCGGATCCTCCGGATCTGTCCCCTGTCCTG CAGGCCTC>3) (SEQ.ID.NO.10)
can be used in place of primer BB90.
[0052] 3. Cloning of human Granulocyte Colony-Stimulating Factor. A
cDNA encoding human Granulocyte Colony Stimulating Factor (G-CSF)
was amplified by PCR from total RNA isolated from the human bladder
carcinoma cell line 5637 (available from the American Type Culture
Collection, Rockville, Md.). The cells were grown in Roswell Park
Memorial Institute (RPMI) 1640 media supplemented with 10% FBS, 50
units/ml penicillin and 50 .mu.g/ml streptomycin. RNA was isolated
from the cells using an RNeasy Mini RNA isolation kit purchased
from Qiagen, Inc. (Santa Clarita, Calif.) following the
manufacturer's directions. Approximately 560 .mu.g of total RNA was
isolated from 4.5.times.10.sup.7 cells. First strand synthesis of
single-stranded cDNA was accomplished using a 1st Strand cDNA
Synthesis Kit for RT-PCR (AMV) from Boehringer Mannheim Corp
(Indianapolis, Ind.) and random hexamers were used as the primer.
Subsequent PCR reactions using the products of the first strand
synthesis as template were carried out with forward primer BB91
(5>CGCAAGCTTGCCACCATGGCTGGACC TGCCACCCAG>3) (SEQ.ID.NO.11)
and reverse primer BB92
(5>CGCGGATCCTCCGGAGGGCTGGGCAAGGTGGCGTAG>3) (SEQ.ID.NO.12).
Primer BB91 anneals to the 5' end of the coding sequence for the
G-CSF secretion signal and the reverse primer, BB92, anneals to the
3' end of the G-CSF coding sequence. The resulting .about.640 bp
PCR product was digested with Hind III and Bam HI, gel purified and
cloned into pCDNA3.1(+) vector that had been digested with Hind III
and Bam HI, alkaline phosphatase treated, and gel purified. A clone
with the correct. DNA sequence (Souza et al., 1986; Nagata et al.,
1986a,b) was designated pCDNA3.1(+)::G-CSFfus or pBBT165.
C. Cloning of IgG Coding Sequences.
[0053] 1. Cloning of IgG1-Fc coding sequences. A cDNA encoding
IgG1-Fc (hinge-CH2-CH3 domains) was amplified from human leukocyte
single-stranded cDNA (CLONTECH, Inc., Palo Alto, Calif.) by PCR
using primers BB83 (5>CGCGGATCCG
GTGGCTCAGAGCCCAAATCTTGTGACAAAACT>3) (SEQ.ID.NO.13) and BB82
(5>CGCTCTAG AGGTACGTGCCAAGCA TCCTCG>3) (SEQ.ID.NO.14).
Forward primer BB83 anneals to the 5' end of the coding sequence of
the hinge domain of IgG1, whereas the reverse primer BB82 anneals
to the 3' untranslated region of IgG1 and IgG4 mRNA 45 bp
downstream of the translational stop codon. The IgG1 and IgG4
sequences are identical over the 21 bp segment to which BB82
anneals. The 790 bp PCR product was digested with Bam HI and Xba I,
gel purified and cloned into pCDNA3.1(+) vector that had been
digested with Bam HI and Xba I, alkaline phosphatase treated, and
gel purified. Two clones were sequenced but each contained a single
base pair substitution that resulted in an amino acid substitution
mutation. Otherwise the sequences matched the published human IgG1
genomic DNA sequence (Ellison et al., 1982). The relative positions
of the mutations in the two clones allowed us to use convenient
unique restriction sites (Sac II in the CH2 domain of IgG1 and Bgl
II in the pCDNA3.1(+) vector) to construct a full length IgG1-Fc
clone in pCDNA3.1(+) via in vitro recombination. The resulting
clone, which had the correct IgG1-Fc sequence, was designated
pCDNA3.1(+)::fusIgG1-Fc or pBBT167.
[0054] 2. Cloning of IgG4-Fc coding sequences. A cDNA encoding
IgG4-Fc (hinge-CH2-CH3 domains) was amplified from human leukocyte
single-stranded cDNA (CLONTECH) by PCR using primers BB84
(5>CGCGGATCCGG TGGCTCAGAGTCCAAATATGGTCCCCCATGC>3)
(SEQ.ID.NO.15) and BB82 (5>CGCTCTAG AGGTACGTGCCAAGCA
TCCTCG>3) (SEQ.ID.NO.14). Forward primer BB84 anneals to the 5'
end of the coding sequence of the hinge domain of IgG4. The reverse
primer BB82 is described above. The .about.790 bp PCR product was
digested with Bam HI and Xba I and cloned into pCDNA3.1(+) that had
been similarly digested. A clone with the correct DNA sequence
(Ellison et al., 1981) was designated pCDNA3.1(+)::fusIgG4-Fc or
pBBT158.
[0055] 3. Cloning of IgG1-C.sub.H coding sequences. A cDNA encoding
IgG1-C.sub.H (CH1-hinge-CH2-CH3 domains) was amplified from human
leukocyte single-stranded cDNA (CLONTECH) by PCR using BB81
(5>CGCGGATCC GGTGGCTCAGCCTCCACCAAGGGCCCATC>3) (SEQ.ID.NO.16)
and BB82(5>CGCTCTAGAGGTACGTGCCAAGC ATCCTCG>3) (SEQ.ID.NO.14).
Forward primer BB81 anneals to the 5' end of the coding sequence of
the CH1 domain of IgG1 and IgG4. The sequences at the 5' end of the
CH1 domains of these two exons are almost identical: 19/20
nucleotides match. The reverse primer, BB82, is described above.
The .about.1080 bp PCR product was digested with Bam HI and Xba I,
gel purified and cloned into pCDNA3.1(+) that had been digested
similarly. These primers in principle could amplify both IgG1 and
IgG4 sequences. Since IgG1 is much more abundant in serum than IgG4
(Roitt et al., 1989) we expected that most clones would encode
IgG1. The first two clones sequenced were IgG1 but each contained a
single base pair substitution that resulted in an amino acid
substitution mutation. Otherwise the sequences obtained matched the
published human IgG1 genomic DNA sequence (Ellison et al., 1982).
The relative positions of the mutations in the two clones allowed
us to use convenient unique restriction sites (Age I in the CH1
domain of IgG1 and Bst BI in the pCDNA3.1(+) vector) to construct a
full length IgG1-C.sub.H clone in pCDNA3.1(+) via in vitro
recombination. A clone with the correct IgG1-C.sub.H sequence was
designated pCDNA3.1(+)::fusIgG1-C.sub.H or pBBT166.
[0056] 4. Cloning of IgG4-C.sub.H coding sequences. The near
identity of the DNA sequences encoding the 5' ends of the IgG1 and
IgG4 CH1 domains and the relatively low abundance of the IgG4 mRNA
led to an alternative strategy for cloning the IgG4-C.sub.H coding
sequences. PCR-based site directed mutagenesis was used to change
the DNA sequence of the cloned IgG1 CH1 domain to match the amino
acid sequence of the IgG4 CH1 domain. The CH1 domains differ at
only 8 of 98 amino acids and these positions are clustered, so that
one round of PCR using two mutagenic oligos can convert the IgG1
CH1 sequence into the IgG4 CH1 sequence. A second round of PCR
added the Bam HI site and linker sequence to the 5' end of the IgG4
CH1 and 21 bp of sequence from the IgG4 Hinge domain to the 3' end.
The technique of "gene splicing by overlap extension" (Horton et
al., 1993; Innis et al., 1990) was then employed to recombine the
engineered IgG4 CH1 domain with the IgG4 Fc (Hinge-CH2-CH3)
sequence. In this technique two separate fragments sharing a
segment of identical sequence, the "overlap", at one end are
extended through the annealed overlap regions in a PCR reaction as
diagrammed in FIG. 1.
[0057] To construct the IgG4 CH1 sequence, mutagenic primers BB119
(5>TCCACCAAG GGCCCATCCGT
CTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCCGAGAGC ACAGCC>3)
(SEQ.ID.NO.17) and BB120 (5>TCTCTTG
TCCACCTTGGTGTTGCTGGGCTTGTGATC TACGTTGCAGGTGTAGGTCTTCGTGCCCAA>3)
(SEQ.ID.NO.18) were used in PCR reactions with pBBT166, which
carries the cloned IgG1-C.sub.H sequence as described above.
Forward primer BB119 anneals to the sequence encoding amino acids 2
through 23 of the CH1 domain and encodes 4 amino acid
substitutions: S14C, K16R, G20E and G21S. Reverse primer BB120
anneals to the sequence encoding amino acids 76 through 97 of the
CH1 domain and encodes 4 additional amino acid substitutions: Q79K,
I82T, N86D and K97R. The .about.290 bp product of this PCR reaction
was gel purified and used as template in a PCR reaction with
primers BB81(see above; Example 1, C.3) and
BB121(5>TGGGGGACCATATTTG GACTCAACTCTCTTGTCCACCTT>3)
(SEQ.ID.NO.19). Reverse primer BB121 anneals to the 3' end of the
CH1 domain of IgG4, adds amino acid 98 of the CH1 domain and 21 bp
extending into the Hinge domain of IgG4. The .about.330 bp product
of this reaction was gel purified and used as one of the template
molecules in the PCR splicing reaction. The other template for the
splicing reaction was generated by PCR of the cloned IgG4-Fc
sequence of pBBT158 (described above, Example 1, C.2.) with primers
BB84 and BB82 which amplify the IgG4 Fc domain as described above.
The resulting .about.790 bp product consists of the IgG4
hinge-CH2-CH3 sequence. This fragment was gel purified and used as
one of the template molecules in the PCR splicing reaction. This
reaction employed the primers BB81 and BB82 and generated a
full-length "spliced" product of .about.1075 bp. To minimize the
DNA sequencing required to confirm this product, the PCR fragment
was digested with Bam HI and Sac II and the .about.530 bp fragment
(containing the complete CH1 and hinge domains and a portion of the
CH2 domain) was cloned into pBC-SK+ (Stratagene) for sequencing.
The sequence of the Bam HI-Sac II fragment was confirmed for one
clone which was the designated pBBT182. The Bam HI-Sac II fragment
of pBBT182 was then used convert the GF-IgG4-Fc clones to full
length GF-IgG4-C.sub.H clones as detailed below.
D. Construction of Growth Hormone-, EPO- and G-CSF-IgG Fusions.
[0058] Most (9/12) of the EPO-, G-CSF- and GH-IgG gene fusions were
generated by excising the IgG coding sequences cloned in
pCDNA3.1(+) as Bam HI-Xba I fragments and cloning these fragments
into the pCDNA::[GF] recombinant plasmids which had been cut with
Bam HI and Xba I. The fusions of the three growth factor genes to
IgG4-C.sub.H were constructed by excising the .about.530 bp Bam
HI-Sac II fragment of pBBT182 and replacing the .about.240 bp Bam
HI-Sac II fragments of the three pCDNA::[GF]-IgG4-Fc clones with
this .about.530 bp Bam HI-Sac II fragment. The resulting plasmids
and the GF-IgG fusion proteins they encode are listed in Table
1.
E. G-CSF (C17S)-IgG Fusion Proteins
[0059] G-CSF-IgG fusions in which cysteine-17 of G-CSF is replaced
by serine [G-CSF (C17S)] can be constructed by PCR mutagenesis
using the following two oligonucleotide primers: C17S-F
(5'TTCCTGCTCAAGTCCTTAGAGCAAGTG-3') (SEQ.ID.No.20) and C17S-R
(5'CACTTGCTCTAAGGACTTGAGCAGGAA-3') (SEQ.ID.NO.21). For example, a
G-CSF (C17S)-IgG1-Fc fusion can be constructed by performing two
separate PCR reactions using pBBT174 as template. One reaction can
use oligo C17S-F in combination with BB82. The second PCR reaction
can use ligo C17S-R in combination with BB91. The PCR products of
these reactions can be gel-purified, mixed and reamplified with
BB82 and BB91. The .about.1300 bp product can be digested with
HindIII and PflMI, the HindIII/PflMI band gel-purified, and cloned
into similarly cut plasmid pBBT174. After transformation of E. coli
DH5.alpha., a plasmid clone containing the C17S mutation can be
identified by DNA sequencing. Similar mutagenesis procedures can be
used to change cysteine-17 to another amino acid by substituting
the appropriate nucleotides (sense and antisense nucleotides
encoding the desired amino acid) for the underlined nucleotides in
oligos C17S-F and C17S-R.
Example 2
Expression and Purification of GF-IgG Fusion Proteins
A. Small Scale Transfection of COS Cells
[0060] Expression and bioactivity of the GF-IgG fusion proteins
were assessed initially by small-scale transfection of COS cells.
Endotoxin-free plasmid DNAs were prepared using an "Endo-Free
Plasmid Purification Kit" (Qiagen, Inc.) according to the vendor
protocol and used to transfect COS-1 cells (available from the
American Type Culture Collection, Rockville, Md.). The COS-1 cells
were grown in Delbecco's Modified Eagle's Media supplemented with
10% FBS, 50 units/ml penicillin, 50 .mu.g/ml streptomycin and 2 mM
glutamine (COS cell growth media). Initial transfection experiments
were carried out in Costar 6 well tissue culture plates (VWR
Scientific) using the following protocol. Briefly,
2-3.times.10.sup.5 cells were seeded into each well in 2 ml of COS
cell growth media and allowed to incubate overnight at 37.degree.
C. and 5% CO.sub.2 by which time the cells had reached 50-60%
confluency. For each well, 0.8 .mu.g of plasmid DNA was complexed
with 6 .mu.l of LipofectAMINE reagent (Gibco BRL, Gaithersburg,
Md.) in 186 .mu.l of OPTI-MEM I Reduced Serum Medium (Gibco BRL,
Gaithersburg, Md.) for 30-45 minutes at room temperature. COS-1
cells were washed one time with 2 ml of OPTI-MEM I per well and
then 1.8 ml of OPTI-MEM I was added to each well. The complex
mixture was then added to the well and left at 37.degree. C., 5%
CO.sub.2 for approximately 4-5 hours. After the incubation period,
the mixture was replaced with 2 ml of COS cell growth media per
well and left overnight at 37.degree. C., 5% CO.sub.2. The next day
the cells were washed twice with 2 ml of DMEM (no additives) per
well. Following the wash steps, 2 ml of serum-free COS cell growth
media was added to each well and the cells left at 37.degree. C.,
5% CO.sub.2. Conditioned media containing the GF-IgG-fusion
proteins were harvested after 72 hours and analyzed by SDS-PAGE and
Western blot to confirm expression of the GF-IgG-fusion proteins.
The parent plasmid, pCDNA 3.1(+) (Invitrogen) was used as a
negative control. Transfection efficiency was estimated to be
.about.15%, using pCMV.beta. (Clontech), which expresses E. coli
.beta.-galactosidase. Transfected cells expressing
.beta.-galactosidase were identified using a .beta.-Gal Staining
Set (Boehringer Mannheim, Indianapolis, Ind.).
[0061] Samples of the conditioned media were prepared in SDS-PAGE
sample buffer with the addition of 1% .beta.-mercaptoethanol (BME)
when desirable and electrophoresed on precast 14% Tris-glycine
polyacrylamide gels (Novex). Western blots using appropriate
antisera demonstrated expression of all of the GF-IgG fusion
proteins. The GH-IgG fusion proteins were detected using a
polyclonal rabbit anti-synthetic-hGH antiserum (kindly provided by
Dr. A. F. Parlow and the National Hormone and Pituitary Program).
The EPO- and G-CSF-IgG fusion proteins were detected using
polyclonal antisera purchased from R&D Systems (Minneapolis,
Minn.). Serial dilutions of the conditioned media were analyzed in
the appropriate in vitro bioassays described later. These assays
demonstrated significant activity in the conditioned media.
B. Large Scale Transfection of COS-1 Cells
[0062] Large scale transfections were carried out using Corning 100
mm tissue culture dishes or Corning T-75 tissue culture flasks (VWR
Scientific). For 100 mm dishes, 1.6.times.10.sup.6 cells were
plated in 10 ml of COS cell growth media per dish and incubated at
37.degree. C., 5% CO.sub.2 overnight. For each 100 mm dish, 6.7
.mu.g of endotoxin-free plasmid DNA was complexed with 50 .mu.l of
LipofecAMINE reagent in 1.5 ml of OPTI-MEM I for 30-45minutes at
room temperature. The COS-1 cells were washed one time with 10 ml
OPTI-MEM per dish and then replaced with 6.6 ml of OPTI-MEM I.
Following complex formation, 1.67 ml of the complex was added to
each dish and left at 37.degree. C., 5% CO.sub.2 for 4-5 hours.
After the incubation period, the reaction mixture was replaced with
10 ml of serum containing COS cell growth media per dish and left
at 37.degree. C., 5% CO.sub.2 overnight. The next day the cells
were washed twice with 10 ml of DMEM (no additives) per dish.
Following the wash steps, 10 ml of serum-free COS cell growth media
was added to each dish and incubated at 37.degree. C., 5% CO.sub.2.
Conditioned media were harvested routinely every three days (on
days 3, 6, 9 and 12) and fresh serum-free COS cell growth media
added to the cells. Transfections in T-75 culture flasks were
identical to the 100 mm dish protocol with the following
exceptions: Cells were plated at 2.times.10.sup.6 cells per flask
and 9.35 .mu.g of endotoxin-free plasmid DNA was complexed with 70
.mu.l of LipofectAMINE reagent in 2.1 ml of OPTI-MEM I for each
T-75 flask. Following complex formation, 2.3 ml of the complex was
added to each flask containing 7.7 ml of OPTI-MEM I. Transfection
efficiency was determined to be .about.15% using pCMV.beta. and
staining for .beta.-galactosidase expression as described earlier.
The 12 plasmids listed in Table 1 were transfected into COS-1 cells
using the large-scale format to generate protein for purification.
The conditioned media were clarified by centrifugation and stored
at -80.degree. C. for later purification. Western blots were used
to confirm expression of the IgG-fusion proteins.
C. Purification of GF-IgG-Fusion Proteins
[0063] Approximately 300 ml of transfected COS-1 cell conditioned
media for each IgG-fusion protein was pooled and concentrated using
an Ultrafiltration cell and either a YM3 or YM30 DIAFLO
Ultrafiltration membrane (Amicon, Beverly, Mass.). Concentrated
pools were then loaded onto a 1 ml Pharmacia HiTrap recombinant
Protein A column previously equilibrated with 20 mM NaPhosphate pH
7.0. The column was washed with 20 mM NaPhosphate until the
A.sub.230 had reached baseline. Bound protein was eluted with 100
mM NaCitrate pH 3.0 and collected into sufficient 1M Tris pH 9.0 to
achieve a final pH of approximately 7.0. Each fusion protein was
purified using a dedicated column to avoid any possibility of
cross-contamination. All of the IgG fusion proteins chromatographed
similarly, yielding a single peak in the elution step. Column
fractions were analyzed using 8-16% precast Tris-glycine SDS-PAGE
and fractions enriched for the IgG-fusion protein were pooled.
Protein concentrations of the pooled fractions were determined by
Bradford assay (Bio-Rad Laboratories, Richmond, Calif.) using
bovine serum albumin (BSA) as the standard.
[0064] The purified GF-IgG fusion proteins were analyzed by
SDS-PAGE under reducing and non-reducing conditions and stained
with Coomassie blue. All of the GF-IgG fusion proteins were
recovered principally as disulfide-linked dimers (typically,
>90% of the recovered IgG fusion proteins were dimeric). The
apparent molecular weights of the proteins ranged from 115-190 kDa
kDa under non-reducing conditions (disulfide-linked dimers) and
50-75 kDa under reducing conditions (monomers), and were largely
consistent with the molecular weights predicted in Table 1. The
size differences between monomers and dimers allowed monomers and
dimers to be easily distinguished by SDS-PAGE. The apparent
molecular weights of the monomeric and dimeric GH-IgG-Fc fusion
proteins were approximately 50 kDa and 115 kDa, respectively. The
apparent molecular weights of the monomeric and dimeric
G-CSF-IgG-Fc fusion proteins also were approximately 50 kDa and 115
kDa, respectively. The apparent molecular weights of the dimeric
IgG-C.sub.H fusions were larger than expected: approximately 160
kDa for the GH-IgG-C.sub.H and G-CSF-IgG-C.sub.H fusions and
approximately 180 kDa for the EPO-IgG-C.sub.H fusions. The
EPO-IgG-C.sub.H fusion monomer also was larger than expected,
possessing an apparent molecule weight of approximately 74 kDa. The
molecular weights of the EPO-IgG-Fc fusion proteins also were
larger than predicted (apparent monomer and dimer molecular weights
of 62 kDa and 130 kDa, respectively). The larger than expected
sizes of the EPO-Ig fusion proteins presumably are due to extensive
glycosylation of the EPO domain. Monomeric fusion proteins were
present in all of the purified protein samples, but were more
abundant with the IgG4 fusion proteins. The sizes of the major IgG
fusion protein bands were different from the molecular weights of
bovine IgG, indicating that the proteins purified were not
contaminating bovine IgGs from serum used in the experiments. The
major IgG fusion protein bands also reacted with antisera specific
for GH, EPO and G-CSF in Western blots of the samples. Purity of
the IgG fusion proteins was estimated to be at least 90% from
Coomassie blue staining of the gels.
[0065] All of the GF-IgG-C.sub.H fusions contained a large
aggregate that migrated at the top of the gel when the samples were
analyzed under non-reducing conditions. This aggregate disappeared
when the samples were analyzed under reducing conditions and the
amount of protein at the molecular weight of the major
GF-IgG-C.sub.H bands seemed to increase proportionately. The
aggregates also reacted with antisera specific for the various
growth factors. These data suggest the aggregates are
disulfide-linked multimers of the GF-IgG-C.sub.H fusion proteins.
Under reducing SDS-PAGE conditions, all of the GF-IgG-C.sub.H
fusions show a diffuse band approximately 20 kDa larger than the
main GF-IgG-C.sub.H band. This band reacted with antisera against
the growth factors and may be related to the aggregates.
TABLE-US-00001 TABLE 1 Predicted Molecular Weights and Recoveries
of GF-IgG Fusion Proteins Predicted Molecular Expression IgG-Fusion
Weight (kDa) .sup.1 Plasmid Protein Monomer Dimer PBBT 171
GH-IgG1-C.sub.H 58,706 117,412 PBBT 172 GH-IgG1-Fc 48,693 97,386
PBBT 183 GH-IgG4-C.sub.H 58,541 117,082 PBBT 163 GH-IgG4-Fc 48,365
96,730 PBBT 173 G-CSF-IgG1-C.sub.H 55,564 111,128 PBBT 174
G-CSF-IgG1-Fc 45,551 91,102 PBBT 184 G-CSF-IgG4-C.sub.H 55,399
110,798 PBBT 175 G-CSF-IgG4-Fc 45,222 90,444 PBBT 179
EPO-IgG1-C.sub.H 54,972 109,944 PBBT 180 EPO-IgG1-Fc 44,960 89,920
PBBT 185 EPO-IgG4-C.sub.H 54,808 109,616 PBBT 181 EPO-IgG4-Fc
44,632 89,264 .sup.1 Does not include molecular weight
contributions due to of glycosylation.
Example 3
In Vitro Bioactivities of Purified GF-IgG Fusion Proteins
A. General Strategy
[0066] Cell proliferation assays were developed to measure in vitro
bioactivities of the IgG fusion proteins. The assays measure uptake
and bioreduction of the tetrazolium salt MTS
[3-(4,5-dimethylthiazol-2-yl)-5-3-carboxyphenyl)-2-(4-sulphenyl)-2H-tetra-
zolium]. In the presence of an electron coupler such as phenazine
methosulfate (PMS), MTS is converted to a formazan product that is
soluble in tissue culture media and can be measured directly at 490
nm. Cell number is linear with absorbance values up to about 2. For
EPO and G-CSF we were able to use existing cell lines to develop
the bioassays. For GH, we needed to create a cell line that
proliferates in response to GH. Such a cell line was created by
stably transforming a murine leukemia cell line with a rabbit GH
receptor.
[0067] In general, the bioassays were set up by washing the
appropriate cells three times with media (no additives) and
resuspending the cells at a concentration of
0.7-1.times.10.sup.5/ml in media with additives (media used for
each cell line is given below). Fifty .mu.l (3.5-5.times.10.sup.3
cells) of the cell suspension was aliquotted per test well of a
flat bottom 96 well tissue culture plate. Serial dilutions of the
protein samples to be tested were prepared in serum-containing
media. Fifty .mu.l of the diluted protein samples were added to the
test wells and the plates incubated at 37.degree. C. in a
humidified 5% CO.sub.2 tissue culture incubator. Protein samples
were assayed in triplicate wells. After 60-72 h, 20 .mu.l of an
MTS/PMS mixture (CellTiter 96 AQueous One Solution, Promega
Corporation, Madison, Wis.) was added to each well and the plates
incubate at 37.degree. C. in the tissue culture incubator for 1-4
h. Absorbance of the wells was read at 490 nm using a microplate
reader. Control wells contained media but no cells. Mean absorbance
values for the triplicate control wells were subtracted from mean
values obtained for the test wells. EC.sub.50s, the amount of
protein required for half maximal stimulation, was calculated for
each sample and used to compare bioactivities of the proteins.
Non-glycosylated molecular weights were used in the molar ratio
calculations for consistency. Non-glycosylated molecular weights of
18,936, 18,987 and 22,129 were assumed for EPO, G-CSF and GH,
respectively. Monomer molecular weights were used in the
calculations for the IgG fusion proteins. Using molecular weights
of the monomer fusion proteins estimated from SDS gels (50-70 kDa)
and glycosylated molecular weights of 35 kDa for EPO and 19.7 kDa
for G-CSF (GH is not glycosylated) gave similar activity
ratios.
B. Bioactivities of EPO-IgG Fusion Proteins
[0068] The human UT7/epo cell line was obtained from Dr. F. Bunn of
Harvard Medical School, Boston, Mass. This cell line proliferates
in response to EPO and is dependent upon EPO for cell survival
(Boissel et al., 1993). The cells were maintained in Iscove's
Modified Delbecco's Media (IMDM) supplemented with 10% FBS, 50
units/ml penicillin, 50 .mu.g/ml streptomycin and 1 unit/ml
recombinant human EPO (CHO cell-expressed; R&D Systems).
Bioassays were performed in cell maintenance media using the
procedures described above. Serial dilutions of recombinant CHO
cell-expressed human rEPO (R&D Systems) were analyzed in
parallel.
[0069] The UT7/epo cell line shows a strong proliferative response
to rEPO, as evidenced by a dose-dependent increase in cell number
and absorbance values. In the absence of rEPO, the majority of
UT7/epo cells die, giving absorbance values less than 0.1.
Commercial CHO cell-expressed rEPO had a mean EC.sub.50 of
approximately 0.6 ng/ml in the bioassay (Table 2). This value
agrees with EC.sub.50 values reported in the R&D Systems
specifications (0.05-0.1 unit/ml or approximately 0.4-0.8 ng/ml).
The EPO-IgG1-Fc and IgG4-Fc fusion proteins had identical
EC.sub.50's of approximately 1.3 ng/ml in the bioassay (Table 2).
On a molar basis, the EC.sub.50s of CHO-cell expressed rEPO and the
EPO-IgG-Fc fusions were indistinguishable (approximately 30 pM;
Table 2). The EPO-IgG1-C.sub.H fusion protein had an EC.sub.50 of
3.1 ng/ml or 60 pM (Table 2), which represents an approximate
2-fold reduction in specific activity relative to the EPO-IgG-Fc
fusion proteins and non-fused rEPO. The EPO-IgG4-C.sub.H fusion
protein had a mean EC.sub.50 of 2.05 ng/ml.
TABLE-US-00002 TABLE 2 Bioactivities of EPO-IgG Fusion Proteins
EC.sub.50 Range Mean EC.sub.50 Clone Protein (ng/ml) .sup.1 ng/ml
pM -- RhEPO (CHO) 0.52, 0.55, 0.60 0.56 30 pBBT180 EPO-IgG1-Fc 1.1,
1.2, 1.5 1.27 28 pBBT181 EPO-IgG4-Fc 1.1, 1.2, 1.5 1.27 29 pBBT179
EPO-IgG1-C.sub.H 2.9, 3.0, 3.5 3.13 57 pBBT185 EPO-IgG4-C.sub.H
2.0, 2.1 2.05 37 .sup.1 Data from individual experiments
C. Bioactivities of G-CSF-IgG Fusion Proteins
[0070] The murine NFS60 cell line was obtained from Dr. J. Bile of
the University of Tennessee Medical School, Memphis Tenn. This cell
line proliferates in response to human or mouse G-CSF or IL-3
(Weinstein et al., 1986). The cells were maintained in RPMI 1640
media supplemented with 10% FBS, 50 units/ml penicillin, 50
.mu.g/ml streptomycin and 17-170 units/ml mouse IL-3 (R&D
Systems). Assays were performed in RPMI 1640 media supplemented
with 10% FBS, 50 units/ml penicillin and 50 .mu.g/ml streptomycin
using the procedures described above. Serial dilutions of
recombinant human G-CSF (E. coli-expressed; R&D Systems) were
analyzed in parallel.
[0071] The NFS60 cell line shows a strong proliferative response to
rhG-CSF, as evidenced by a dose-dependent increase in cell number
and absorbance values. rhG-CSF had a mean EC.sub.50 of 18 pg/ml in
the bioassay (Table 3). This value agrees with the EC.sub.50 value
reported in the R&D Systems specifications (10-30 pg/ml). The
G-CSF-IgG1-Fc and G-CSF-IgG4-Fc fusion proteins had mean
EC.sub.50's of 38 and 57 pg/ml, respectively, in the bioassay
(Table 3). On a molar basis, the EC.sub.50s of rhG-CSF and the
G-CSF-IgG1-Fc fusions were similar (approximately 0.9 pM; Table 3),
whereas the EC.sub.50 of the G-CSF-IgG4-Fc fusion protein was
reduced slightly (1.25 pM). The G-CSF-IgG1-C.sub.H fusion protein
had a mean EC.sub.50 of 182 pg/ml or 3.2 pM (Table 3), which
represents an approximate 3-fold reduction in specific activity
relative to G-CSF-IgG1-Fc fusion protein and non-fused rhG-CSF. The
G-CSF-IgG4-C.sub.H fusion protein had a mean EC.sub.50 of 182 pg/ml
or 3.9 pM (Table 3)
TABLE-US-00003 TABLE 3 Bioactivities of G- CSF-IgG Fusion EC.sub.50
Range Mean EC.sub.50 Proteins Clone Protein (pg/ml) .sup.1 pg/ml pM
-- rhG-CSF 17, 18, 18 17.7 0.93 PBBT174 G-CSF-IgG1-Fc 34, 39, 42
38.3 0.84 PBBT175 G-CSF-IgG4-Fc 50, 59, 61 56.7 1.25 PBBT173
G-CSF-IgG1-C.sub.H 160, 190, 195 182 3.2 PBBT184 G-CSF-IgG4-C.sub.H
200, 230 215 3.9 .sup.1 Data from individual experiments
D. Bioactivities of GH-IgG Fusion Proteins:
[0072] The GH-R4 cell line is described in PCT/US98/14497 and
PCT/US00/00931. This cell line is a derivative of the murine FDC-P1
cell line that is stably transformed with the rabbit GH receptor.
This cell line proliferates in response to hGH. The cell line is
maintained in RPMI 1640 media containing 10% horse serum, 50
units/ml penicillin, 50 .mu.g/ml streptomycin, 2 mM glutamine, 400
.mu.g/ml G418 and 2-5 nM pituitary hGH. GH-IgG fusion protein
samples were assayed as described in PCT/US98/14497 and
PCT/US00/00931, incorporated herein by reference, using RPMI media
supplemented with 10% horse serum, 50 units/ml penicillin, 50
.mu.g/ml streptomycin and 400 .mu.g/ml G418. All assays included a
human pituitary GH standard. Pituitary GH stimulates proliferation
of GH-R4 cells, with an EC.sub.50 of 0.75-0.85 ng/ml (0.03-0.04
nM), similar to what has been reported in the literature (Rowlinson
et al., 1995).
[0073] All of the GH-IgG fusion proteins tested stimulated
proliferation of GH-R4 cells (Table 4). The GH-IgG1-Fc fusion
protein was the most active, possessing an EC.sub.50 of 7-8 ng/ml
(.about.0.16 nM). The GH-IgG4-Fc fusion protein was about two-fold
less active than the IgG1 fusion protein, with a mean EC.sub.50 of
17 ng/ml (0.35 nM). The GH-IgG1-C.sub.H fusion protein had the
lowest activity, with an EC.sub.50 of 35 ng/ml (0.6 nM). On a molar
basis, bioactivities of the fusion proteins were reduced 4-fold
(GH-IgG1-Fc), 10-fold (GH-IgG4-Fc) and 17-fold (GH-IgG1-C.sub.H)
relative to pituitary hGH.
TABLE-US-00004 TABLE 4 Bioactivities of GH-IgG Fusion Proteins
EC.sub.50 Range Mean EC.sub.50 Clone Protein (ng/ml) .sup.1 ng/ml
nM -- Pituitary hGH 0.75, 0.75, 0.85, 0.85 0.8 0.036 PBBT172
GH-IgG1-Fc 6.5, 7.0, 7.8, 9 7.6 0.160 PBBT163 GH-IgG4-Fc 15, 16,
18, 18 17 0.350 PBBT171 GH-IgG1-C.sub.H 28, 32, 40, 40 35 0.600
.sup.1 Data from individual experiments
Example 4
Eliminate or Minimize the Linker in the GF-IgG Fusion Proteins
[0074] GF-IgG fusion proteins in which the 7 amino acid linker
[ser-gly-gly-ser-gly-gly-ser] that fuses the GF to the IgG domain
is eliminated (direct fusions) or reduced to 2 to 4 amino acids can
be constructed as described below. Similar methods can be used to
create linkers shorter than 7 amino acids, to create linkers longer
than 7 amino acids and to create linkers containing other amino
acid sequences. The experiments described below use IgG1-Fc and EPO
and G-CSF as examples, however, similar procedures can be used for
other GF or IgG domains, and domains for other IgG subtypes and
domains from IgM, IgA, IgD and IgE antibodies. The modified fusion
proteins can be expressed, purified and their specific activities
determined in in vitro bioassays as described in the Examples.
[0075] 1. Direct Fusions: GF-IgG fusions without a linker can be
created using PCR based "gene splicing by overlap extension" as
described in Example 1 (Horton et al., 1993). One can generate PCR
products consisting of the IgG1-Fc coding sequence with a short 5'
extension, consisting of the 3' terminal .about.15 bp of coding
sequence of EPO or G-CSF fused directly to the hinge coding
sequence. At the same time one can generate PCR products consisting
of the EPO or G-CSF coding sequences with a short 3' extension
consisting of the first 15 bp of the hinge coding sequence fused
directly to the EPO or G-CSF coding sequence. The growth factor
fragments and the IgG1-Fc fragments can then be spliced together
via PCR "Sewing" (Horton et al., 1993) to generate direct fusions.
These PCR products can be digested with appropriate restriction
enzymes to generate relatively small DNA segments that span the
fusion point and which can be readily cloned into similarly cut
vectors pCDN3.1(+)::EPO-IgG1-Fc and pCDNA3.1(+)::G-CSF-IgG1-Fc for
sequence confirmation and COS cell expression. Cloning these
smaller DNA fragments will minimize the sequencing that will need
to be done to confirm the sequences of the direct fusions.
1. A. EPO-IgG Direct Fusions
[0076] An EPO-IgG1-Fc direct fusion was created by PCR using
plasmid pBBT180 as the DNA template. One PCR reaction used oligos
BB198 (5'-AGGACAGGGGACAGAGAGCCCAAA TCTTGTGACAAA-3') (SEQ.ID.NO.22)
and BB82. The second PCR reaction used oligos BB199
(5'ACAAGATTTGGGCTCTCTGTCCCCTGTCCTGCAGGC-3') (SEQ.ID.NO.23) and
BB89. The products from these PCR reactions were gel-purified,
mixed and subjected to a third PCR reaction using oligos BB82 and
BB89. The approximate 1300 bp PCR product was gel-purified,
digested with and Bsr GI and Sac II, and cloned into similarly cut
pBBT180 that had been treated with calf intestinal phosphatase. A
clone with the correct insert was identified by DNA sequencing and
named pBBT356.
[0077] An EPO-IgG4-Fc direct fusion was created by PCR using
plasmid pBBT181 as the DNA template. One PCR reaction used oligos
BB200 (5'-AGGACAGGGGACAGAGAGTCCAAATAT GGTCCCCCA-3') (SEQ.ID.NO.24)
and BB82. The second PCR reaction used oligos BB201
(5'-ACCATATTTGGACTCTCTGTCCCCTGTCCTGCAGGC-3') (SEQ.ID.NO.25) and
BB89. The products from these PCR reactions were gel-purified,
mixed and subjected to a third PCR reaction using oligos BB82 and
BB89. The approximate 1300 bp PCR product was gel-purified,
digested with and Bsr GI and Sac II, and cloned into similarly cut
pBBT181 that had been treated with calf intestinal phosphatase. A
clone with the correct insert was identified by DNA sequencing and
named pBBT357. A clone with a correct EPO sequence, but a mutation
in the IgG4-Fc region (Phe-25 changed to Ser) was named pBBT
273.
[0078] COS cells were transfected with pBBT273 and the EPO-IgG4-Fc
fusion protein purified as described in Example 2. The purified
protein, which consisted primarily of a disulfide-linked dimer
(>90%), stimulated proliferation of UT7/epo cells with an
EC.sub.50 of 2 ng/ml. The bioassay was performed as described in
Example 3.
[0079] An EPO (des-Arg-166)-IgG1-Fc direct fusion can be created as
described above for the EPO-IgG1-Fc direct fusion except that
oligonucleotide EPODFE (5'-TGCAGGACAGGGGACGAGCCCAAAT
CTTGTGACAAA-3') (SEQ.ID.NO.26) can be substituted for BB198 and
EPODFF (5'-ACAAGATTTGGGCTCGTCCCCTGTCCTGCAGGCCTC-3') (SEQ.ID.NO.27)
can be substituted for BB199. Similarly, EPO(des-Arg-166)-IgG4-Fc
direct fusions can be constructed as described above for
EPO-IgG4-Fc fusions except that EPODFG
(5'-TGCAGGACAGGGGACGAGTCCAAATAT GGTCCCCCA-3') (SEQ.ID.NO.28) can be
substituted for BB200 and EPODFH
(5'-ACCATATTTGGACTCGTCCCCTGTCCTGCAGGCCTC-3') (SEQ.ID.NO.29) can be
substituted for BB201.
1. B. G-CSF Direct Fusions
[0080] A G-CSF-IgG1-Fc direct fusion was created by PCR using
plasmid pBBT174 as the DNA template. One PCR reaction used oligos
BB202 (5'-CACCTTGCCCAGCCCGAGCCCAAA TCTTGTGACAAAA-3') (SEQ.ID.NO.30)
and BB82. The second PCR reaction used oligos BB203
(5'-ACAAGATTTGGGCTCGGGCTGGGCAAG GTGGCGTAG-3') (SEQ.ID.NO.31) and
BB91. The products from these PCR reactions were gel-purified,
mixed and subjected to a third PCR reaction using oligos BB82 and
BB91. The approximate 1300 bp PCR product was gel-purified,
digested with PflMI and Sac II, and the .about.400 bp PflMI/Sac II
fragment gel-purified. This fragment was cloned into similarly cut
pBBT174 that had been treated with calf intestinal phosphatase. A
clone with the correct insert was identified by DNA sequencing and
named pBBT299.
[0081] A G-CSF-IgG4-Fc direct fusion was created by PCR using
plasmid pBBT175 as the DNA template. One PCR reaction used oligos
BB204 (5'-CACCTTGCCCAGCCCGAGTCCAAATATGGT CCCCCA-3') (SEQ.ID.NO.32)
and BB82. The second PCR reaction used oligos BB205
(5'-ACCATATTTGGGACTCGGGCTGGGCAAG GTGGCGTAG-3') (SEQ.ID.NO.33) and
BB91. The products from these PCR reactions were gel-purified,
mixed and subjected to a third PCR reaction using oligos BB82 and
BB91. The approximate 1300 bp PCR product was gel-purified,
digested with and PflMI and Sac II, and the .about.400 bp PflMI/Sac
II fragment gel-purified. This fragment was cloned into similarly
cut pBBT175 that had been treated with calf intestinal phosphatase.
A clone with the correct insert was identified by DNA sequencing
and named pBBT300.
[0082] COS cells were transfected with pBBT299 and pBBT300 and the
G-CSF-IgG1-Fc and G-CSF-IgG4-Fc direct fusion proteins purified as
described in Example 2. The purified proteins, which consisted
primarily (>90%) of disulfide-linked dimers, stimulated
proliferation of NFS60 cells with an EC.sub.50 of 50-60 pg/ml
(G-CSF-IgG1-Fc direct fusion) and 43-50 pg/ml (G-CSF-IgG4-Fc direct
fusion). The bioassay was performed as described in Example 3.
2. GF-IgG Fusion Proteins Containing Two or Four Amino Acid
Linkers
[0083] To construct a di-peptide [ser-gly] linker, one can PCR the
IgG1-Fc sequence with a 5' oligonucleotide that adds the 5'
extension CGCTCCGGA to the hinge coding sequence. The TCCGGA
hexanucleotide is a cleavage site for the restriction endonuclease
Bsp EI and encodes amino acids ser-gly. This PCR fragment can be
digested with Bsp EI and Sac II and the .about.240 bp fragment
cloned into similarly cut pCDN3.1(+)::EPO-IgG1-Fc and
pCDNA3.1(+)::G-CSF-IgG1-Fc. The unique Bsp EI site in each of these
plasmids occurs at the first ser-gly in the linker
[ser-gly-gly-ser-gly-gly-ser] so that the resulting recombinants
will contain this 2 amino acid, ser-gly, linker. The sequence of
the newly inserted .about.250 bp Bsp El-Sac II fragment can be
verified.
[0084] A similar procedure can be used to construct the 4 amino
acid [ser-gly-gly-ser] linker. One can PCR the IgG1-Fc sequence
with a 5' oligonucleotide that adds the 5' extension CGCGGATCC to
the hinge coding sequence. The GGATCC hexanucleotide is a cleavage
site for the restriction endonuclease Bam HI and encodes amino
acids gly-ser. This PCR fragment can be digested with Bam HI and
Sac II and the .about.240 bp fragment cloned into similarly cut
pCDN3.1(+)::EPO-IgG1-Fc and pCDNA3.1(+)::G-CSF-IgG1-Fc. The unique
Bam HI site in each of these plasmids occurs at the first gly-ser
in the linker [ser-gly-gly-ser-gly-gly-ser] so the recombinants
will contain the 4 amino acid (ser-gly-gly-ser) linker. The
sequence of the inserted .about.250 bp Bam HI-Sac II piece can be
verified.
[0085] An IgG1-Fc domain that can be used to construct fusion
proteins containing a two amino acid SerGly linker between the
growth factor/cytokine domain and the IgG1-Fc domain was created by
PCR. The PCR reaction used primers BB 194
(5'-CGCGAATTCCGGAGAGCCCAAATCTT GTGACAAA3') (SEQ.ID.NO.34) and BB
82. The DNA template was pBBT195. The PCR products were put through
a PCR clean-up kit (Qiagen, Inc.) and digested with EcoRI and
SacII. The restriction digest was put through a PCR clean-up kit
and cloned into similarly cut pBC SK(+) (Stratagene, Inc.) DNA that
had been treated with calf intestinal phosphatase. The ligations
were used to transform E. coli JM109. Transformants were selected
on LB agar plates containing 50 .mu.g/ml chloramphenicol. A clone
with the correct sequence was identified by DNA sequencing and
named pBBT242.
[0086] An IgG1-Fc domain that can be used to construct fusion
proteins containing the four amino acid linker, Ser-Gly-Gly-Ser
(SEQ.ID.NO.1), between the growth factor/cytokine domain and the
IgG1-Fc domain was created by PCR. The PCR reaction used primers BB
195 (5'-CGCGGATCC GAGCCCAAATCTTGTGACAAA-3') (SEQ.ID.NO.35) and BB
82. The DNA template was pBBT195. The PCR products were put through
a PCR clean-up kit (Qiagen, Inc.) and digested with BamHI and Sac
II. The restriction digest was put through a PCR clean-up kit and
cloned into similarly cut pBC SK(+) DNA that had been treated with
calf intestinal phosphatase. The ligations were used to transform
E. coli JM109. Transformants were selected on LB agar plates
containing 50 .mu.g/ml chloramphenicol. A clone with the correct
sequence was identified by DNA sequencing and named pBBT243.
[0087] An IgG4-Fc domain that can be used to construct fusion
proteins containing the two amino acid linker, SerGly, between the
growth factor/cytokine domain and the IgG4-Fc domain was created by
PCR. The PCR reaction used primers BB 196
(5'-CGCGAATTCCGGAGAGTCCAAATATGG TCCCCCA-3') (SEQ.ID.NO.36) and BB
82. The DNA template was pBBT196. The PCR products were put through
a PCR clean-up kit (Qiagen, Inc.) and digested with EcoRI and
SacII. The restriction digest was put through a PCR clean-up kit
and cloned into similarly cut pBC (SK+) DNA that had been treated
with calf intestinal phosphatase. The ligations were used to
transform E. coli JM109. Transformants were selected on LB agar
plates containing 50 .mu.g/ml chloramphenicol. A clone with the
correct sequence was identified by DNA sequencing and named
pBBT244.
[0088] An IgG4-Fc domain that can be used to construct fusion
proteins containing the four amino acid linker, ser-gly-gly-ser,
between the growth factor/cytokine domain and the IgG4-Fc domain
was created by PCR. The PCR reaction used primers BB 197
((5'-CGCGGATCCGAGTCCAAATATGGT CCCCCA-3') (SEQ.ID.NO.37) and BB 82.
The DNA template was pBBT196. The PCR products were put through a
PCR clean-up kit (Qiagen, Inc.) and digested with BamHI and Sac II.
The restriction digest was put through a PCR clean-up kit and
cloned into similarly cut pBC (SK+) DNA that had been treated with
calf intestinal phosphatase. The ligations were used to transform
E. coli JM109. Transformants were selected on LB agar plates
containing 50 .mu.g/ml chloramphenicol. A clone with the correct
sequence was identified by DNA sequencing and named pBBT245.
[0089] The modified IgG domains described above were used to
construct EPO-IgG and G-CSF-IgG fusion proteins containing four
amino acid linkers. Plasmids pBBT174 and pBBT180 were digested with
BamHI and SacII and treated with calf intestinal phosphatase. The 6
kb vector bands were gel-purified and ligated with the .about.800
bp IgG insert from pBBT243, which had been gel-purified following
digestion of pBBT243 DNA with BamHI and SacII. Similarly, plasmids
pBBT175 and pBBT181 were digested with BamHI and SacII and treated
with calf intestinal phosphatase. The .about.6 kb vector bands were
gel-purified and ligated with the .about.800 bp IgG insert from
pBBT245, which had been gel-purified following digestion of pBBT245
DNA with BamHI and SacII. The ligations were used to transform E.
coli DH5.alpha. and transformants selected on LB agar plates
containing 100 .mu.g/ml ampicillin. Clones containing the correct
sequences were identified by restriction mapping and DNA
sequencing. The EPO-IgG1-Fc and EPO-IgG4-Fc fusions containing the
4 amino acid linker were named pBBT279 and pBBT280, respectively.
The G-CSF-IgG1-Fc and G-CSF-IgG4-Fc fusions containing the 4 amino
acid linker were named pBBT277 and pBBT278, respectively.
[0090] The modified IgG domains described above can be used to
construct EPO-IgG and G-CSF-IgG fusion proteins containing two
amino acid linkers. Plasmids pBBT174 and pBBT180 can be digested
with BspEI and SacII and treated with calf intestinal phosphatase.
The .about.6 kb vector bands can be gel-purified and ligated with
the .about.800 bp IgG insert from pBBT242, which had been
gel-purified following digestion of pBBT242 DNA with BspEI and Sac
II. Similarly, plasmids pBBT175 and pBBT181 can be digested with
BspEI and Sac II and treated with calf intestinal phosphatase. The
.about.6 kb vector bands can be gel-purified and ligated with the
.about.800 bp IgG insert from pBBT244, which has been gel-purified
following digestion of pBBT244 DNA with Bsp EI and Sac II. The
ligations can be used to transform E. coli DH5.alpha. and
transformants selected on LB agar plates containing 100 .mu.g/ml
ampicillin.
[0091] The recombinant fusion proteins can be used to transfect COS
cells and be purified as described in Example 2. In vitro and in
vivo bioactivities of these fusion proteins can be determined as
described in the Examples 3 and 8.
Example 5
Methods to Improve Bioactivities of IgG-C.sub.H Fusion Proteins
[0092] All of the IgG-C.sub.H fusion proteins appeared to aggregate
during purification and the specific activities of the fused growth
factors were reduced .about.2-3-fold as compared to the analogous
IgG-Fc fusions. Aggregation may be due to hydrophobic interactions
involving the CH1 domain that normally interfaces with the light
chain. Coexpression of Ig light chains with the GF-IgG-C.sub.H
fusions can prevent aggregation. We describe three ways to
coexpress Ig light chains and Ig heavy chains below. The
experiments described below use IgG-Fc, IgG-C.sub.H, EPO and G-CSF
as examples, however, similar procedures can be used for other GF
or IgG domains, and domains for other IgG subtypes and domains from
IgM, IgA, IgD and IgE antibodies. The DNA sequences of human kappa
and lambda light chains are known (Heiter et al., 1980). cDNA
sequences encoding the human kappa and/or lambda light chain
constant (CL) regions can be obtained by PCR amplification from the
human leukocyte single-stranded cDNA (Clontech) or human genomic
DNA (Clontech). The DNA sequences of the cloned CL domains can be
confirmed prior to use in the experiments described below. The
modified fusion proteins can be expressed, purified and their
specific activities determined in in vitro bioassays as described
in Examples 2 and 3.
[0093] 1. Co-expression of the light chain constant region. A Kozak
sequence (Kozak, 1991) and a secretion signal can be added to the
5' end of the light chain constant region to enhance translational
initiation and direct the secretion of the light chain constant
region. A translational stop codon can be added to the 3' end of
the sequence. Appropriate cloning sites can be added to the 5' and
3' ends to allow cloning into the mammalian cell expression vector
pREP4 (Invitrogen) under control of the RSV promoter and preceding
the SV40 derived polyA addition site. This construct can be used to
cotransfect COS cells along with pCDNA3.1(+) derivatives that
express, for example, EPO-IgG-C.sub.H and G-CSF-IgG-C.sub.H.
Alternatively, both light and heavy chains can be expressed from a
single plasmid construct. In this case, the light chain sequence
and the flanking promoter and polyA sites from pREP4 can be excised
with appropriate restriction enzymes and cloned into pCDNA3.1(+).
The EPO-IgG-C.sub.H and G-CSF-IgG-C.sub.H coding sequences could
then cloned into the pCDNA3.1(+) polylinker under control of the
CMV promoter.
[0094] DNA encoding the constant region of the human Kappa light
chain (IgKC) was amplified from human genomic DNA as described
below in Section 2 of this Example. This sequence was modified by
PCR to create a construct suitable for expression of the light
chain constant region. A Kozak sequence (Kozak, 1991) and the human
Growth Hormone secretion signal were added to the 5' end of the
light chain constant region. These modifications were made via two
sequential PCR reactions. In the first the cloned and sequenced
pCDNA3.1(+)::fusIgKC DNA was used as template. The primers were
BB169 (5>GCTTTTGGCCTGCTCTGCCTGCCC
TGGCTTCAAGAGGGCAGTGCCACTGTGGCTGCACCATCT>3) (SEQ.ID.NO.38) and
BB150 BB150 (5>CGCTCTAGACTA ACACTCTCCCCTGTTGAA>3)
(SEQ.ID.NO.39). Forward primer BB169 anneals to the 5' end of the
light chain constant region and adds sequence encoding 15 amino
acids of the hGH leader sequence. Reverse primer BB150 anneals to
the 3' end of the coding sequence for the constant region of the
human Kappa light chain and includes a translational stop codon
followed by an Xba I site. The product of this PCR reaction was
gel-purified and used as template in a second PCR reaction with
primers BB168 (5>CGCAAGCTTGCCACCATGGCTACAGGC
TCCCGGACGTCCCTGCTCCTGGCTITTGGCCTGCTCTGC>3) (SEQ.ID.NO.40) and
BB150. Forward primer BB168 adds the remainder of the hGH leader
sequence as well as a Kozak sequence and contains a Hin dIII site
for cloning purposes. Reverse primer BB150 is described above. The
product of this PCR reaction was digested with Hin dIII and Xba I
and cloned into vector pCDNA3.1(+) that had been digested with Hin
dIII and Xba I and treated with alkaline phosphatase. The DNA
sequence was verified for one such clone.
[0095] 2. Co-expression of GF-light chain constant region fusion
proteins. An alternative mode of light chain expression would be to
modify the 5' end to add a portion of a flexible peptide linker
sequence fused to the amino-terminus of the CL coding sequence and
add a translational stop codon to the 3' end of the sequence.
Appropriate cloning sites can be added as well to the 5' and 3'
ends to allow cloning as an in frame fusion to the EPO and G-CSF
genes cloned in the plasmids pCDNA3.1(+)::EPOfus and
pCDNA3.1(+)::G-CSFfus. This plasmid can be cotransfected into COS
cells with plasmids that express, for example, EPO-IgG1-C.sub.H and
G-CSF-IgG1-C.sub.H. In this instance both heavy and light chains
will contain growth factor fusions. The light and heavy chains also
could be expressed from a single pCDNA3.1 (+) construct as
described above. EPO and G-CSF also can be expressed as direct
fusions with Ig-C.sub.L using procedures similar to those described
elsewhere in the Examples.
[0096] DNA encoding the constant region of the human Kappa light
chain (IgKC) was amplified from human genomic DNA (CLONTECH, Inc.,
Palo alto, Calif.) by PCR using primers BB149
(5>CGCGGATCCGGTGGCTCAACTGTGGCTGCACCATCTGT>3) (SEQ.ID.NO.41)
and BB150 (5>CGCTCTAGACTA ACACTCTCCCCTGTTGAA>3)
(SEQ.ID.NO.42). Forward primer BB149 anneals to the 5' end of the
coding sequence for the constant region of the human Kappa light
chain and includes a portion of the peptide linker
(gly-ser-gly-gly-ser) (SEQ.ID.NO.2) containing a Bam HI site at the
5' end. Reverse primer BB150 anneals to the 3' end of the coding
sequence for the constant region of the human Kappa light chain and
includes a translational stop codon followed by an Xba I site. The
resulting .about.330 bp PCR product was digested with Bam HI and
Xba I, gel purified and cloned into vector pCDNA3.1(+) that had
been digested with Bam HI and Xba I, alkaline phosphatase treated,
and gel purified. One clone was sequenced and found to match the
published human IgKC genomic DNA sequence (Hieter et al., 1980).
The .about.330 Bam HI-Xba I fragment was subsequently excised from
this plasmid, termed pCDNA3.1(+)::fusIgKC, and cloned into pBBT190,
pBBT191, and PBBT192 (described in Example 10 below) resulting in
fusion of the IgKC domain to IFN-.alpha., and IFN-.gamma.
respectively. Similar procedures can be used to construct other
growth factor/cytokine-IgKC fusion proteins.
[0097] 3. Light chain-heavy chain fusions. A third mode of
"co-expression" would be to modify the 5' and 3' ends of the CL
coding sequence to incorporate portions of a flexible peptide
linker at both ends. By also incorporating appropriate cloning
sites (e.g. Bsp EI and Bam HI) such a construct can be inserted
into the Bsp EI and Bam HI sites within the flexible peptide
linkers of the EPO-IgG-C.sub.H and G-CSF-IgG-C.sub.H fusions in
pCDNA3.1(+). The resulting constructs would encode, for example,
single polypeptide [EPO]-[CL]-[IgG-C.sub.H] and
[G-CSF]-[CL]-[IgG-C.sub.H] fusions. The fusion of the
carboxy-terminus of the light chain constant region to the
amino-terminus of the heavy chain CH1 domain would be analogous to
single chain Fv polypeptides. Flexible peptide linkers of the
(ser-gly-gly) motif on the order 14 to 20 residues in length have
been used to fuse the carboxy-terminus of the light chain variable
region to the amino-terminus of the heavy chain variable domain
(Stewart et al., 1995) and could be used to join the CL domain to
the IgG-C.sub.H domain.
Example 6
GF-IgG Fusion Proteins With Reduced Complement Binding and Fc
Receptor Binding Properties
[0098] Certain GF-IgG1 fusion proteins may be toxic or lack
efficacy in the animal models due to activation of complement or
immune processes related to Fc receptor binding. For this reason,
GF-IgG4 fusion proteins may be preferred because IgG4 is less
efficient at complement activation and Fc receptor binding than is
IgG1 (Roit et al., 1989). The EPO- and G-CSF-IgG4-Fc fusion
proteins are as potent or nearly as potent as the IgG1-Fc fusion
proteins in in vitro bioassays. Alternatively, one can perform in
vitro mutagenesis experiments, as detailed below, to change
specific amino acids in the IgG domains known to be responsible for
complement activation and Fc receptor binding. The modified fusion
proteins can be expressed, purified and their specific activities
determined in in vitro bioassays as described in Examples 2 and
3.
[0099] A. Complement Binding. Amino acids in IgGs that play a role
in complement activation have been localized to the IgG CH2 domain.
Specifically, amino acids Glu318, Lys320, Lys322, Ala330 and Pro331
in human IgG1 have been implicated as contributing to complement
activation (Isaacs et al., 1998). Substitution of Glu318, Lys320
and Lys322 in IgG1 with alanine residues results in IgG proteins
possessing reduced ability to activate complement (Isaacs et al.,
1998). The amino acid sequence of IgG4 is identical to IgG1 in this
region, yet IgG4 does not activate complement. As an alternative to
using IgG4, one can change Glu318, Lys320 and Lys 322 (alone or in
combination) of IgGs that have these residues to alanine residues
or other amino acids that reduce complement activation using the
PCR-based mutagenesis strategies described in Example 1.
[0100] B. Fc Receptor Binding. Human IgG subclasses differ in their
ability to bind Fc receptors and stimulate antibody-dependent
cell-mediated cytotoxity (ADCC). IgG1, IgG3 and IgG4 are best at
stimulating ADCC, whereas IgG2 has significantly reduced ability to
stimulate ADCC (Roit et al., 1989). ADCC occurs through a mechanism
that involves binding of the antibody to Fc receptors on immune
cells. Amino acids responsible for Fc receptor have been localized
to the CH2 domain of the IgG molecule. Specifically, amino acids
233-235 have been implicated in Fc receptor binding. Human IgG1 has
the amino acid sequence GluLeuLeu in this region, whereas IgG2,
which does not bind Fc receptors, has the sequence ProAlaVal. IgG4
has the sequence GluPheLeu in this region and is 10-fold less
efficient at binding Fc receptors than IgG1. Substitution of the
IgG2 sequence ProAlaVal for GluLeuLeu at positions 233-235 in IgG1
or IgG4 results in IgG1 and IgG4 antibodies with significantly
reduced capacity for Fc receptor binding and ADCC (Isaacs et al.,
1998). One can introduce some or all of these amino acid changes
into the GF-IgG fusion protein constructs using the PCR-based
mutagenesis strategy described in Example 1. Alternatively one can
construct modified GF-IgG fusion proteins in which glycosylation of
asparagine 297 in the IgG1 CH2 domain (or the equivalent asparagine
residue in the other IgG subclasses) is prevented. Aglycosylated
IgG1 antibodies display significantly reduced binding to Fc
receptors and ability to lyse target cells as compared to
glycosylated IgG1 antibodies (Isaacs et al., 1998). One can
construct aglycosylated versions of the GF-IgG fusion proteins by
changing asparagine-297 to glutamine or another amino acid, or by
changing threonine-299, which is part of the glycosylation
recognition sequence (Asparagine-X-Serine/Threonine), to alanine or
to an amino acid other than serine. The amino acid in the X
position of the glycosylation recognition sequence, i.e, amino acid
298, also could be changed to proline to prevent glycosylation of
asparagine 297 in the IgG CH2 domain.
Example 7
Pharmacokinetic Experiments With GF-IgG Fusion Proteins
[0101] Pharmacokinetic experiments can be performed to demonstrate
that the GF-IgG fusion proteins have longer circulating half-lives
than the corresponding non-fused proteins. Both intravenous and
subcutaneous pharmacokinetic data can be obtained. Terminal
pharmacokinetic parameters can be calculated from the intravenous
delivery data.
[0102] For the intravenous delivery studies, rats (.about.350 g)
can receive an intravenous bolus injection (0.1 mg/kg) of the
IgG1-Fc fusion protein (EPO or G-CSF) or the corresponding
non-fused protein (EPO or G-CSF) and circulating levels of the
proteins measured over the course of 144 h. Three rats can be used
for each protein sample. Blood samples can be drawn at 0, 0.08,
0.5, 1.5, 4, 8, 12, 24, 48, 72, 96, 120, and 144 h following
intravenous administration. Serum levels of the test proteins can
be quantitated using commercially available EPO and G-CSF ELISA
kits (R & D Systems). Serial dilutions of each blood sample can
be analyzed initially in the in vitro bioassays to identify
dilutions that will fall within the linear range of the ELISAs.
(0.025 to 1.6 ng/ml for EPO and 0.04 to 2.5 ng/ml for G-CSF).
Titration experiments can be performed to determine the relative
sensitivities of the ELISAs for detecting the IgG1-Fc fusion
proteins and the corresponding non-fused proteins. The subcutaneous
delivery studies can follow the same protocol as the intravenous
studies except for the route of delivery. Serum levels of the test
proteins can be quantitated by ELISA as described above.
Example 8
Animal Efficacy Models
[0103] In vivo efficacy of the EPO-IgG1-Fc and G-CSF-IgG1-Fc fusion
proteins can be demonstrated in normal rats and mice. These studies
can use a variety of doses and dosing schedules to identify the
proper doses and dosing schedules. Efficacy of the EPO-IgG and
G-CSF-IgG fusion proteins also can be demonstrated in appropriate
disease models--anemia for EPO-IgG1-Fc and neutropenia for
G-CSF-IgG1-Fc. The pharmacokinetic experiments will provide
guidance in deciding dosing schedules for the IgG1 fusion proteins
to be used for the animal studies. From published results with
other IgG-Fc fusion proteins (Richter et al., 1999; Zeng et al.,
1995) the EPO-IgG and G-CSF-IgG fusion proteins can be effective
when administered every other day or every third day and possibly
less often, e.g. a single injection. The dosing schedules may have
to be modified depending upon the results of the pharmacokinetic
studies and initial animal efficacy results. The dose of protein
administered per injection to the rodents also may have to be
modified based upon the results of the pharmacokinetic experiments
and initial animal efficacy results
A. EPO Animal Efficacy Models--Normal Rats
1. Single Injection:
[0104] Groups of three male Sprague Dawley rats, weighing
.about.320 g each, received a single intravenous injection (lateral
tail vein) of wild type recombinant EPO containing the amino acid
sequence
ser-gly-gly-ser-gly-gly-ser-asp-tyr-lys-asp-asp-asp-asp-lys
(SEQ.ID.NO.43) at its carboxy end (rEPO-FLAG), or EPO-IgG1-Fc at a
dose of 100 .mu.g/kg. The rEPO-FLAG was expressed by transfection
of COS-1 cells and purified by affinity chromatography using an
anti-FLAG monoclonal antibody. Protein concentrations of rEPO-FLAG
and EPO-IgG1-Fc were determined using a Bradford dye binding assay
and bovine serum albumin as the standard. At selected time points
blood samples (0.3 to 0.4 ml) were drawn from the rats into EDTA
anti-coagulant tubes. Aliquots of the blood samples were analyzed
for a complete blood cell (CBC) count. The remainder of the blood
sample was centrifuged and the plasma frozen at -80.degree. C.
Blood samples were drawn at 0.25, 2, 4, 10, 24, 48, 72, 96, 120,
144, 168 and 192 h post-injection. A 0 h baseline sample was
obtained .about.24 h prior to injection of the test compounds.
Table 4 shows the mean blood hematocrits (+/-SE) for the different
test groups at 0 hour and at 192 h post-injection. The group
receiving EPO-IgG1-Fc showed a significant increase in hematocrit
levels at 192 h compared to 0 hour (p<0.05). The group receiving
rEPO-FLAG did not show a significant increase in hematocrit levels
between the 0 and 192 hour time points.
TABLE-US-00005 TABLE 4 Hematocrit (%) Group 0 hour 192 hour
rEPO-FLAG 42.9 +/- 0.85 44.4 +/- 1.007 EPO-IgG1-Fc 44.7 +/- 0.296
.sup.a 48.0 +/- 0.95 .sup. .sup.a p < 0.05 versus 0 hour time
point.
Similar studies can be performed using lower or higher doses (0.001
to 10 mg/kg) of the proteins. Similar studies also can be performed
using the subcutaneous route of administration of the proteins.
2. Daily, Every Other Day or Every Third Day Dosing Schedules
[0105] Sprague-Dawley rats (.about.200 g) can be purchased from a
commercial supplier such as Charles River (Wilmington, Mass.).
Previous studies have shown that administration of 100-1000 IU/kg
(approximately 800 ng-8 .mu.g/kg) of rEPO once per day (160 ng-1.6
.mu.g SID/200 g rat) by subcutaneous injection gives a significant
increase in hematocrit and erythropoiesis in rodents (Matsumoto et
al., 1990; Vaziri et al., 1994; Baldwin et al., 1998; Sytkowski et
al., 1998). Groups of 5 rats can receive subcutaneous injections of
rEPO, rEPO-FLAG, EPO-IgG1-Fc or placebo (vehicle solution) at
specified intervals (daily, every other day or every third day) for
five to nine days. A dose equivalent to a molar ratio of EPO (400
ng-4 .mu.g/200 g rat of the EPO-IgG1-Fc fusion protein) can be
tested. Higher or lower doses also can be tested. A wide range of
EPO-IgG1-Fc doses (over 500-fold variation) can be tested in these
initial experiments to increase the likelihood that one of the
doses will be effective. It is possible that administration of too
much EPO-IgG1-Fc will impede erythropoiesis due to toxicity.
Control rats can receive vehicle solution only. Additional control
groups can receive daily injections of rEPO (160 ng-1.6 .mu.g/200 g
rat for 5-9 days) and 160 ng-1.6 .mu.g rEPO using the same dosing
regimen as EPO-IgG1-Fc. One to two days after the final injection
the animals can be sacrificed and blood samples collected for
hematocrit and complete blood cell count (CBC) analysis.
Hematopoietic tissues (liver and spleen) can be collected, weighed
and fixed in formalin for histopathologic analyses to look for
evidence of increased erythropoiesis. Bone marrow can be removed
from various long bones and the sternum for unit particle preps and
histopathologic analysis to look for evidence of increased
erythropoiesis. Comparisons between groups can be made using a
Students T test for single comparisons and one-way analysis of
variance for multiple comparisons. P<0.05 can be considered
significant.
[0106] Daily injections of rEPO can stimulate increases in
hematocrit and erythropoiesis in the rats, whereas less frequent
administration of the same dose of rEPO can not, or do so to a
lesser extent. Dose-dependent increases in these parameters can be
observed in the EPO-IgG-Fc-treated animals. Greater increases in
these parameters may be observed in the EPO-IgG1-Fc-treated animals
than in animals treated with EPO using the less frequent dosing
schedules. Significantly less EPO-IgG1-Fc may be required to
achieve the same increases in these parameters obtained with daily
injections of EPO.
[0107] Additional experiments with less frequent dosing, e.g., a
single injection, could be performed.
B. EPO Efficacy Experiment--Anemic Rat Model
[0108] Cisplatin-induced anemia is a well-characterized rodent
model of chemotherapy-induced anemia and has direct relevance to
the human clinical setting. rEPO reverses the anemia in this model
when administered at daily doses of 100-1,000 Units/kg (Matsumoto
et al., 1990; Vaziri et al., 1994; Baldwin et al., 1998).
EPO-IgG-Fc also will be effective at reversing anemia in this model
using once per day, every other day or every third day dosing
schedules. The dosing schedule for EPO-IgG-Fc to be used in this
experiment could be the one that worked best in the normal rat
experiments. Sprague-Dawley rats (200 g) can be treated on day 0
with an intraperitoneal injection of Cisplatin (3.5 mg/kg) to
induce anemia and randomized to various treatment groups. Rats can
receive daily, every other day or every third day injections of
EPO-IgG-Fc, rEPO or saline for up to 9 days at a dose of 2 .mu.g-20
.mu.g/kg. One control group of rats can receive daily subcutaneous
injections of rEPO (100-1,000 Units/kg). Another control group can
not receive the initial Cisplatin injection but can receive
injections of saline using the same dosing schedule as the other
test proteins. On day 9 the rats can be sacrificed and blood and
tissue samples obtained for comprehensive CBC and histopathology
analyses. Ten to one hundred fold higher or lower doses of the
EPO-IgG1-Fc fusion proteins also could be tested.
C. G-CSF Animal Efficacy Models
[0109] In vivo efficacy of the G-CSF-IgG fusion proteins (C17 or
C17S versions) can be measured in normal or neutropenic rodents
such as mice or rats by demonstrating that the proteins stimulate
increases in circulating neutrophil levels and granulopoiesis
compared to vehicle-treated animals. G-CSF stimulates neutrophil
levels in normal and neutropenic rodents at a dose of 100 .mu.g/kg
(Kubota et al., 1990; Kang et al., 1995). Mice or rats can be used
for these experiments. One can extrapolate pharmacokinetic data
from the rat to the mouse because protein clearance is proportional
to body weight (Mahmood, 1998). One can demonstrate efficacy of
G-CSF-IgG1-Fc in normal animals using daily, every other day or
every third day dosing schedules. Efficacy also can be demonstrated
following a single injection. Effectiveness of G-CSF-IgG1-Fc in a
mouse neutropenia model also can be demonstrated using daily, every
other day or every third day dosing schedules.
C. 1. Efficacy in Normal Rats Following a Single Injection
[0110] Groups of three male Sprague Dawley rats, weighing
.about.320 g each, received a single intravenous injection (lateral
tail vein) of wild type recombinant G-CSF (prepared by Bolder
BioTechnology), Neupogen.RTM. (a recombinant G-CSF sold by Amgen,
Inc.) or G-CSF-IgG1-Fc, each at a dose of 100 .mu.g/kg. Protein
concentrations were determined using a Bradford dye binding assay
using bovine serum albumin as the standard. At selected time points
blood samples (0.3 to 0.4 ml) were drawn from the rats into EDTA
anti-coagulant tubes. Aliquots of the blood samples were analyzed
for a complete blood cell (CBC) count. The remainder of the blood
sample was centrifuged and the plasma frozen at -80.degree. C.
Blood samples were drawn at 0.25, 1.5, 4, 8, 12, 16, 24, 48, 72,
96, 120 and 144 h post-injection. A 0 h baseline sample was
obtained .about.24 h prior to injection of the test compounds.
Tables 5, 6 and 7 show the mean blood neutrophil, total white blood
cell counts and blood monocyte counts for the different test groups
over time. All three test compounds stimulated an increase in
peripheral white blood cells and neutrophils over baseline values.
White blood cell and neutrophil counts for the test groups
receiving wild type recombinant G-CSF and Neupogen.RTM. peaked
.about.24 h post-injection and returned to baseline values by
.about.48 h. In contrast, white blood cell and neutrophil counts
for the rats receiving G-CSF-IgG1-Fc peaked .about.48 h
post-injection and did not return to baseline values until
.about.96 h post-injection. Peak white blood cell and neutrophil
levels observed in the rats receiving G-CSF-IgG1 were significantly
higher than for the groups receiving wild type recombinant G-CSF or
Neupogen.RTM. (p<0.05). The data indicate that G-CSF-IgG1 is
capable of stimulating an increase in circulating neutrophil and
white blood cells, and that the absolute increase in peripheral
white blood cell counts and neutrophils is greater and longer
lasting than that seen with recombinant wild type G-CSF or
Neupogen.RTM., even when using a lower molar dose of the fusion
protein. G-CSF-IgG1-Fc also stimulated a significant increase in
blood monocyte levels over time (Table 7). Similar experiments can
be performed to demonstrate efficacy of other G-CSF-IgG and G-CSF
(C17S)-IgG fusion proteins (Fc or C.sub.H versions). Similar
studies also can be performed using the subcutaneous route for
administration of the proteins.
TABLE-US-00006 TABLE 5 Effects of G-CSF, Neupogen .RTM. and
G-CSF-IgG1-Fc on Neutrophil Blood Cell Counts Following Single
Intravenous Administration of the Proteins (100 .mu.g/kg)
Neutrophils Time Mean +/- SE (cells/.mu.l blood) (Hr) G-CSF .sup.a
Neupogen G-CSF-IgG1-Fc 0 1,147 +/- 167 1,906 +/- 564 2,951 +/- 342
4 6,752 +/- 923 4,504 +/- 549 .sup.b 4,484 +/- 328 .sup. 8 8,437
+/- 546 5,525 +/- 894 .sup.b 7,309 +/- 890 .sup. 12 10,744 +/- 549
11,891 +/- 1,545 .sup. .sup.b 9,796 +/- 1,649 24 11,035 +/- 788
11,148 +/- 977 .sup.b 13,655 +/- 2,367.sup. 48 2,355 +/- 218 2,610
+/- 245 .sup.b, c 14,554 +/- 1,683 .sup. 72 2,113 +/- 438 3,077 +/-
590 .sup.b, c 6,235 +/- 797 .sup. 96 2,086 +/- 496 2,675 +/- 673
3,292 +/- 309 120 2,179 +/- 373 2,063 +/- 469 3,115 +/- 342 .sup.a
Wild type G-CSF prepared by Bolder BioTechnology, Inc. .sup.b p
< 0.05 versus 0 hour neutrophil levels .sup.c p < 0.05 versus
G-CSF and Neupogen at same time point
TABLE-US-00007 TABLE 6 Effects of G-CSF, Neupogen .RTM. and
G-CSF-IgG1-Fc on White Blood Cell Counts Following Single
Intravenous Administration of the Proteins (100 .mu.g/kg) White
Blood Cells Time Mean +/- SE (cells/.mu.l blood) (Hr) G-CSF .sup.a
Neupogen G-CSF-IgG1-Fc 0 11,100 +/- 252 11,100 +/- 829 14,000 +/-
669 .sup. 4 .sup. 16,000 +/- 1,059 13,600 +/- 570 13,600 +/- 186
.sup. 8 15,200 +/- 371 14,900 +/- 260 15,300 +/- 1,670 12 18,400
+/- 240 20,100 +/- 674 19,400 +/- 2,058 24 .sup. 23,900 +/- 1,110
.sup. 25,500 +/- 1,734 .sup.b 29,300 +/- 2,894 .sup. 48 14,700 +/-
426 .sup. 15,300 +/- 1,715 .sup.b, c 33,100 +/- 2,099 72 15,300 +/-
426 14,800 +/- 764 .sup.b, c 21,200 +/- 2,228 96 .sup. 14,200 +/-
1,000 14,700 +/- 689 15,400 +/- 133 .sup. 120 .sup. 11,000 +/-
2,651 .sup. 11,300 +/- 1,477 12,900 +/- 2,052 .sup.a Wild type
G-CSF prepared by Bolder BioTechnology, Inc. .sup.b p < 0.05
versus 0 hour white blood cell levels .sup.c p < 0.05 versus
G-CSF and Neupogen at same time point
TABLE-US-00008 TABLE 7 Effects of G-CSF, Neupogen .RTM. and
G-CSF-IgG1-Fc on Blood Monocyte Cell Counts Following Single
Intravenous Administration of the Proteins (100 .mu.g/kg) Monocytes
Time Mean +/- SE (cells/.mu.l blood) (Hr) G-CSF .sup.a Neupogen
G-CSF-IgG1-Fc 0 622 +/- 255 675 +/- 163 .sup. 804 +/- 208 4 1,837
+/- 60 1,320 +/- 215.sup. 1,364 +/- 296 8 1,519 +/- 168 1,044 +/-
79 1,025 +/- 234 12 1,166 +/- 51 1,482 +/- 315.sup. .sup. 999 +/-
273 24 1,283 +/- 140 1,092 +/- 5 1,463 +/- 145 48 638 +/- 68 825
+/- 147 3,167 +/- 111 72 820 +/- 293 1,079 +/- 80 2,416 +/- 323 96
893 +/- 363 1,175 +/- 147.sup. 1,118 +/- 57 120 786 +/- 56 557 +/-
64 1,208 +/- 294 .sup.a Wild type G-CSF prepared by Bolder
BioTechnology, Inc.
[0111] Plasma G-CSF and G-CSF-IgG protein levels can be quantitated
using commercially available G-CSF ELISA kits (R & D Systems,
Inc.). Titration experiments can be performed to determine the
relative sensitivity of the ELISA for detecting wild type G-CSF and
G-CSF-IgG fusion proteins. Similar studies can be performed using
the subcutaneous route of administration of the proteins.
C. 2. G-CSF-IgG Fusion Protein Efficacy in Normal Mice
[0112] For demonstrating efficacy in normal mice, groups of 5 mice
(weighing .about.20 g each) can receive subcutaneous injections of
G-CSF, Neupogen, G-CSF-IgG fusion proteins or placebo (vehicle
solution) at specified intervals for up to five days. Normal mice
such as ICR mice can be purchased from a commercial vendor such as
Jackson Laboratories, Charles River or Harland Sprague Dawley. On
day 6 the animals can be sacrificed and blood samples collected for
complete blood cell count (CBC) analysis. Hematopoietic tissues
(liver and spleen) can be collected, weighed and fixed in formalin
for histopathologic analyses to look for evidence of increased
granulopoiesis. Bone marrow can be removed from various long bones
and the sternum for unit particle preps and histopathologic
analysis to look for evidence of increased granulopoiesis.
Comparisons between groups can be made using a Students T test for
single comparisons and one-way analysis of variance for multiple
comparisons. P<0.05 can be considered significant. The G-CSF-IgG
fusion proteins can stimulate greater increases in circulating
neutrophil levels and granulopoiesis in the mice compared to the
vehicle-treated mice. Efficacy of the G-CSF-IgG fusion proteins can
be tested when administered once on day 1, once per day on days
1-5, every other day on days 1, 3 and 5, or every third day on days
1 and 4. In initial experiments, different groups of mice (weighing
.about.20 g each) can receive subcutaneous injections of 0.008 to
20 .mu.g per injection of the G-CSF-IgG fusion proteins. Control
mice can receive vehicle solution only. Additional control groups
can receive wild type G-CSF or Neupogen (2 .mu.g/every day for 5
days) and 2 .mu.g wild type G-CSF using the same dosing regimen as
the G-CSF-IgG fusion proteins.
[0113] Daily injections of rG-CSF can stimulate increases in
circulating neutrophils and granulopoieis in the mice, whereas less
frequent administration of the same dose of rG-CSF can not, or can
do so to a lesser extent. Dose-dependent increases in these
parameters can be observed in the G-CSF-IgG1-Fc-treated animals.
Greater increases in these parameters may be observed in the
G-CSF-IgG1-Fc-treated animals than in animals treated with rG-CSF
using the less frequent dosing schedules. Significantly less
G-CSF-IgG1-Fc may give the same increases in these parameters
obtained with daily injections of rG-CSF.
[0114] 3. G-CSF-IgG Fusion Protein Efficacy in Neutropenic Mice:
Efficacy of G-CSF-IgG1-Fc also can be demonstrated in neutropenic
animals. Neutropenia can be induced by treatment with
cyclophosphamide (CPA; 100 mg/kg), which is a commonly used
chemotherapeutic agent that is myelosuppressive and relevant to the
human clinical setting. G-CSF accelerates recovery of normal
neutrophil levels in cyclophosphamide-treated animals (Kubota et
al., 1990; Kang et al., 1995). Mice (.about.20 g) can receive an
intraperitoneal injection of cyclophosphamide on day 0 to induce
neutropenia. The animals can be divided into different groups of 5
animals each, which will receive subcutaneous injections of G-CSF,
G-CSF-IgG1-Fc or placebo for up to five days post-CPA treatment.
One control group can not receive cyclophosphamide but can receive
placebo injections. The exact dosing schedule to be used can be
determined by the results of the pharmacokinetic experiments and
normal mouse efficacy studies described above. Experiments can be
performed using every day, every other day or every third day
dosing schedules over the course of five days. Doses of
G-CSF-IgG1-Fc to be tested can be 0.008-20 .mu.g/injection. On day
six the animals can be sacrificed and blood and tissue samples
analyzed as described above. Alternatively, five mice per group can
be sacrificed on days 0-10 and blood and tissue samples analyzed as
described for the normal mouse experiments above. The G-CSF-IgG
fusion proteins can stimulate an accelerated increase in
circulating neutrophil levels and granulopoiesis in the mice
compared to the vehicle-injected, CPA-injected control group.
C. GH-IgG Fusion Protein Efficacy
[0115] In vivo efficacy of the GH-IgG fusion proteins can be tested
in hypophysectomized (HYPDX) rats. This is a well-characterized
model of GH deficiency (Cox et al., 1994; Clark et al., 1996). GH
stimulates body weight gain and bone and cartilage growth in HYPDX
rats (Cox et al., 1994; Clark et al., 1996). Hypophysectomized
Sprague-Dawley rats can be purchased from a commercial supplier
such as Charles River (Wilmington, Mass.). Typically, rats are
hypophysectomized between 40 and 50 days of age and weigh
approximately 100-120 g. Groups of 5-8 rats can receive
subcutaneous injections of rhGH, GH-IgG or placebo (vehicle
solution) at specified intervals and weight gain measured daily
over a 10 day period. Rats can be weighed daily at the same time
per day to minimize possible variables associated with feeding. In
addition to overall weight gain, bone growth (tibial epiphysis
width) can be measured. At time of sacrifice, the right and left
proximal tibial epiphyses can be removed and fixed in formalin. The
fixed tibias can be split at the proximal end in a saggital plane,
stained with silver nitrate and exposed to a strong light
(Greenspan et al., 1949). The width of the cartilaginous epiphyseal
plate can be measured using a stereomicroscope equipped with a
micrometer eyepiece. Ten measurements can be made for each
epiphysis and the means+/-SEM for the combined values for the left
and right tibias can be calculated. Comparisons between groups can
be made using a Students T test for single comparisons and one-way
analysis of variance for multiple comparisons. P<0.05 can be
considered significant.
[0116] Efficacy of the GH-IgG fusion proteins can be tested by
administering the proteins to the rats daily, every other day,
every third day, every fourth day or following a single injection.
Five .mu.g of hGH administered twice a day (10 .mu.g/day) by
subcutaneous injection gives a strong growth response in the HYPDX
rat model (Cox et al., 1994; Clark et al., 1996). In initial
experiments different groups of rats can receive subcutaneous
injections of various doses of GH-IgG ranging from 0.2 to 200
.mu.g/injection/rat. Control rats can receive vehicle solution
only. Additional control groups can receive rhGH (5 .mu.g BID) and
10 .mu.g hGH using the same dosing regimen as the GH-IgG fusion
proteins. Administration of the GH-IgG fusion proteins to the HYPDX
rats can result in an increase in body weight gain and tibial
epyphysis width growth compared to the vehicle-treated group.
[0117] Efficacy of the GH-IgG fusion proteins also can be tested in
rodent models of cachexia. Dexamethasone (DEX) can be administered
to the rats to induce weight loss. Groups of normal Sprague-Dawley
rats (200-225 g) can receive daily subcutaneous injections of
dexamethasone (200 .mu.g/rat; approximately 1 mg/kg). This amount
of dexamethasone can induce a loss of approximately 5-6 g over an 8
d period. Vehicle or varying doses of the GH-IgG can be
administered to the rats once, daily, every other day, every third
day or every fourth day in different experiments. Different groups
of rats can receive subcutaneous injections of 0.2 to 400 .mu.g of
the GH-IgG fusion proteins/injection/rat. Additional controls can
include a group of rats that will receive no DEX or injections, a
group of rats that receives DEX and rhGH (5 .mu.g BID or 10 .mu.g
SID) and a group of rats that receives DEX and rhGH (10 .mu.g
daily, every other day, every third day, or every fourth day,
depending upon the experiment, i.e., frequency that the GH-IgG
fusion proteins are administered). Animals can be weighed daily.
Food and water consumption can be monitored daily. At time of
sacrifice, internal organs can be weighed. Statistical analyses can
be performed as described for the HYPDX rat studies. Animals
treated with the GH-IgG fusion proteins can lose less weight than
the vehicle-treated animals.
Example 9
Further Purification of IgG fusion Protein Dimers
[0118] The final purification scheme for the growth
factor/cytokine-IgG fusion proteins could include additional column
chromatography steps in addition to affinity chromatography to
remove protein contaminants and aggregates and to prepare purer
preparations of fusion protein tetramers, dimers and monomers.
Purer preparations of the Ig fusion proteins can improve their
specific activities in in vitro bioassays. For use as human
therapeutics it will be preferable to obtain preparations of growth
factor/cytokine-IgG monomers substantially free from fusion protein
dimers, and preparations of IgG fusion protein dimers substantially
free from fusion protein monomers. Growth factor/cytokine-IgG
dimers can be separated from IgG fusion protein monomers using a
variety of column chromatography procedures known to those with
skill in the art. Chromatography procedures also can be used to
purify Ig fusion proteins from aggregates and other contaminating
proteins. Examples of such chromatography procedures include
ion-exchange, size exclusion, hydrophobic interaction, reversed
phase, metal chelation, affinity columns, lectin affinity, hydroxy
apatite and immobilized dye affinity chromatography. Other useful
separation procedures known to those skilled in the art include
salt precipitation, solvent precipitation/extraction and
polyethylene glycol precipitation. Endotoxin levels in the purified
proteins can be tested using commercially available kits to ensure
that they are not pyrogenic.
[0119] The EPO-IgG4-Fc direct fusion described in Example 4
(encoded by pBBT273) was purified by Protein A affinity
chromatography as described in Example 2. The purified protein was
further purified by size exclusion chromatography using a Superdex
200 HR 10/30 column. The buffer was 20 mM NaPO4, pH 7.0, 150 mM
NaCl. The column volume was 24 ml. The column was eluted with 1.5
column volumes of buffer at a flow rate of 0.5 ml/minute. Fractions
of 0.5 ml were collected. A single major protein peak was observed,
which eluted with an apparent molecular weight of 204 kDa. The
column was calibrated using protein standards purchased from Sigma
Chemical Company (catalogue #MW-GF-200). SDS-PAGE analysis under
reducing and non-reducing conditions indicated that the major
protein peak consisted primarily of disulfide-linked EPO-IgG4-Fc
dimers (at least 90%, and probably >95% by non-reducing
SDS-PAGE). Large molecular weight contaminants (apparent molecular
weights >200 kDa by non-reducing SDS-PAGE) and low molecular
weight contaminants (apparent molecular weights <50 kDa by
non-reducing SDS-PAGE) were largely removed by this column
step.
[0120] Similar experiments were performed with the EPO-IgG1-Fc
fusion protein encoded by pBBT180, the G-CSF-IgG1-Fc fusion protein
encoded by pBBT174 and the G-CSF-IgG4-Fc fusion protein encoded by
pBBT175. These proteins were purified by Protein A affinity
chromatography as described in Example 2 and then further purified
by size-exclusion chromatography as described above. The
EPO-IgG1-Fc fusion protein eluted from the sizing column with an
apparent molecular weight of 219 kDa and consisted primarily of
EPO-IgG1-Fc dimers (>95% by non-reducing SDS-PAGE). The
G-CSF-IgG1-Fc fusion protein eluted with an apparent molecular
weight of 148 kDa and consisted primarily of G-CSF-IgG1-Fc dimers
(>95% by non-reducing SDS-PAGE). The G-CSF-IgG4-Fc fusion
protein eluted with an apparent molecular weight of 135 kDa and
consisted primarily of G-CSF-IgG4-Fc dimers (at least 90%, and
probably >95% by non-reducing SDS-PAGE). Large molecular weight
contaminants (apparent molecular weights >200 kDa by
non-reducing SDS-PAGE) and low molecular weight contaminants
(apparent molecular weights <50 kDa by non-reducing SDS-PAGE)
were largely removed by this column step.
Example 10
[0121] The procedures described in the preceding examples can, with
minor modifications, be used to created IgG fusions with other
proteins. Examples of other IgG fusion proteins that would find
therapeutic uses in humans include IgG fusions of other members of
the GH supergene family, including interferons alpha, beta and
gamma, IL-11, TPO, GM-CSF, Stem cell factor and flt3 ligand. DNAs
encoding these proteins can be cloned as described below and fused
to the various IgG domains described in Example 1. The recombinant
fusion proteins can be expressed and purified as described in
Example 2 and 9. The purified fusion proteins can be tested in
appropriate in vitro bioassays to determine their specific
activities. DNA sequences, amino acid sequences and appropriate in
vitro and in vivo bioassays for these proteins are well known in
the art and are described in Aggarwal and Gutterman (1992; 1996),
Aggarwal (1998), and Silvennoimem and Ihle (1996). Bioassays for
these proteins also are provided in catalogues of commercial
suppliers of these proteins such as R&D Systems, Inc, Endogen,
Inc., and Gibco BRL.
[0122] 1. Cloning human alpha interferon. Alpha interferon is
produced by leukocytes and has antiviral, anti-tumor and
immunomodulatory effects. There are at least 20 distinct alpha
interferon genes that encode proteins that share 70% or greater
amino acid identity. Amino acid sequences of the known alpha
interferon species is given in Blatt et al., 1996). A "consensus"
interferon that incorporates the most common amino acids into a
single polypeptide chain has been described (Blatt et al, 1996). A
hybrid alpha interferon protein may be produced by splicing
different parts of alpha interferon proteins into a single protein
(Horisberger and Di Marco, 1995). The following example describes
construction of an alpha 2 interferon IgG fusion protein. Similar
procedures can be used to create IgG fusions of other alpha
interferon proteins.
[0123] DNA encoding human alpha interferon (IFN-.alpha.2) was
amplified by PCR from human genomic DNA (CLONTECH). PCR reactions
were carried out with BB93 (5>CGCGAATTCGGATATGT
AAATAGATACACAGTG>3SEQ.ID.NO.44) and BB94
(5>CGCAAGCTTAAAAGATTTA AATCGTGTCATGGT>3) (SEQ.ID.NO.45). BB93
anneals to genomic sequences .about.300 bp upstream (i.e. 5' to) of
the IFN-alpha2 coding sequence and contains an Eco RI site for
cloning purposes. BB94 anneals to genomic sequences .about.100 bp
downstream (i.e. 3' to) of the IFN-alpha2 coding sequence and
contains a Hind III site for cloning purposes. The PCR reaction
employed 1.times. PCR reaction buffer (Promega Corp., Madison
Wis.), 1.5 mM MgCl.sub.2, 0.2 mM dNTPs, 0.2 .mu.M of each
oligonucleotide primer, 0.33 .mu.g of genomic DNA and 0.4 units of
Taq polymerase (Promega) in a 33 .mu.l reaction. The reaction
consisted of 96.degree. C. for 3 minutes followed by 35 cycles of:
[95.degree. C. for 60 sec., 58.degree. C. for 75 sec., 72.degree.
C. for 90 sec.] followed by chilling the sample to 6.degree. C.
Reactions were carried out in a "Robocycler" thermal cycler
(Stratagene Inc., San Diego, Calif.). The resulting .about.1 kb PCR
product was digested with Eco RI and Hind III and cloned into
similarly digested, and alkaline phosphatased, pCDNA3.1(+)
(Invitrogen, San Diego, Calif.). A clone having the correct DNA
sequence for IFN-.alpha.2 (Henco et al, 1985) was identified and
designated pBBT160.
[0124] In order to construct and express gene fusions of
IFN-.alpha.2 with IgG coding sequences the IFN-.alpha.2 gene was
modified at the 5' and 3' ends using PCR based mutagenesis. pBBT160
plasmid DNA was used as template for PCR with forward primer BB108
(5' CGCAAGCTTGCCACCATGGCCTT GACCTTT GCTTTA-3') and reverse primer
BB109 (5'-CGCGGATCCTCCGGATTCCTTACTT CTTAAACTTTC-3'). Primer BB108
anneals to the 5' end of the coding sequence for the IFN-.alpha.2
secretion signal and the reverse primer, BB109, anneals to the 3'
end of the IFN-.alpha.2 coding sequence. The resulting PCR product
was digested with Hind III and Bam HI, gel purified and cloned into
pCDNA3.1(+) vector that had been digested with Hind III and Bam HI,
alkaline phosphatase treated, and gel purified. A clone with the
correct DNA sequence (Henco et al., 1985) was designated
pCDNA3.1(+)::IFNAfus or pBBT190.
[0125] 2. Cloning human beta interferon. Beta interferon is
produced by fibroblasts and exhibits antiviral, antitumor and
immunomodulatory effects. Beta interferon is the product of a
single gene. DNA encoding human beta interferon (IFN-.beta.) was
amplified by PCR from human genomic DNA (CLONTECH). PCR reactions
were carried out with forward primer BB110
(5'-CGCAAGCTTGCCACCATGACCAACAAGTGTCTCCTC-3') (SEQ.ID.NO.48) and
reverse primer BB111 (5'-CGCGGATCCTCCGGAGTTTCGGAGGTAACCTGTAAG-3')
(SEQ.ID.NO.49). Primer BB110 anneals to the 5' end of the coding
sequence for the IFN-.beta. secretion signal and the reverse
primer, BB111, anneals to the 3' end of the IFN-.beta. coding
sequence. The resulting PCR product was digested with Hind III and
Bam HI, gel purified and cloned into pCDNA3.1(+) vector that had
been digested with Hind III and Bam HI, alkaline phosphatase
treated, and gel purified. A clone with the correct DNA sequence
(Derynck et al., 1980) was designated pCDNA3.1(+)::IFNBfus or
pBBT191.
[0126] 3. Cloning human gamma interferon. Gamma interferon is
produced by activated T cells and exhibits anti-viral, antitumor
and immunomodulatory effects. A cDNA encoding human gamma
interferon (IFN-.gamma.) was amplified by PCR from total RNA
isolated from the human Jurkat T cell line (available from the
American Type Culture Collection, Rockville, Md.). The cells were
grown in RPMI media supplemented with 10% FBS, 50 units/ml
penicillin and 50 .mu.g/ml streptomycin. The cells were activated
in vitro for 6 hours with 1 .mu.g/ml PHA-L (Sigma chemical Company,
catalogue L-4144) and 50 ng/ml PMA (phorbol 12-myristate
13-acetate, Sigma Chemical Company, catalogue #P-1585) to induce
IFN-.gamma. expression prior to RNA isolation (Weiss et al., 1984;
Wiskocil et al., 1985). RNA was isolated from the cells using an
RNeasy Mini RNA isolation kit purchased from Qiagen, Inc. (Santa
Clarita, Calif.) following the manufacturer's directions.
Approximately 104 .mu.g of total RNA was isolated from
2.4.times.10.sup.7 cells. First strand synthesis of single-stranded
cDNA was accomplished using a 1st Strand cDNA Synthesis Kit for
RT-PCR (AMV) from Boehringer Mannheim Corp (Indianapolis, Ind.) and
random hexamers were used as the primer. Subsequent PCR reactions
using the products of the first strand synthesis as template were
carried out with forward primer BB112
(5'-CGCAAGCTTGCCACCATGAAATATACAAGTTATATC-3') (SEQ.ID.NO.50) and
reverse primer BB113 (5'-CGCGGATCCTCCGGACTGGGATGCTCTTCGACCTTG-3')
(SEQ.ID.NO.51). Primer BB112 anneals to the 5' end of the coding
sequence for the IFN-.gamma. secretion signal and the reverse
primer, BB113, anneals to the 3' end of the IFN-.gamma. coding
sequence. The resulting PCR product was digested with Hind III and
Bam HI, gel purified and cloned into pCDNA3.1(+) vector that had
been digested with Hind III and Bam HI, alkaline phosphatase
treated, and gel purified. A clone with the correct DNA sequence
(Gray et al., 1982) was designated pCDNA3.1(+)::IFNGfus or
pBBT192.
[0127] 4. Construction of Interferon-IgG fusions. The IgG1-Fc
coding sequence was fused to the carboxyterminus of IFN-.alpha.2,
IFN-.beta., and IFN-.gamma.. The .about.790 bp Bam HI-Xba I
fragment was excised from plasmid pBBT167 [described above in
Example 1] and cloned into pBBT190, pBBT191 and pBBT192 which had
been digested with Bam HI and Xba I, and treated with alkaline
phosphatase. Similarly, IgG4-Fc coding sequence also was fused to
IFN-.alpha.2, IFN-.beta., and IFN-.gamma.. The .about.790 bp Bam
HI-Xba I fragment of plasmid pBBT158 [described above in Example 1]
was excised, gel-purified and cloned into pBBT190, pBBT191 and
pBBT192 which had been digested with Bam HI and Xba I, and treated
with alkaline phosphatase. The IgG1-C.sub.H coding sequence was
fused to the carboxyterminus of IFN-.alpha.2, IFN-.beta., and
IFN-.gamma.. The .about.1080 bp Bam HI-Xba I fragment of plasmid
pBBT166 [described above in Example 1] was excised and cloned into
pBBT190, pBBT191 and pBBT192 which had been digested with Bam HI
and Xba I, and treated with alkaline phosphatase. The structures of
the resulting recombinant plasmids were verified by restriction
endonuclease digestions and agarose gel electrophoresis. These
plasmids and the IFN-IgG fusion proteins that they encode are
listed in Table 8.
TABLE-US-00009 TABLE 8 Interferon - IgG Fusion Proteins Expression
Plasmid IFN-Fusion Protein pBBT193 IFN-.alpha.2-IgG1-Fc pBBT194
IFN-.alpha.2-IgG4-Fc pBBT220 IFN-.alpha.2-IgG1-C.sub.H pBBT195
IFN-.beta.-IgG1-Fc pBBT196 IFN-.beta.-IgG4-Fc pBBT221
IFN-.beta.-IgG1-C.sub.H pBBT209 IFN-.gamma.-IgG1-Fc pBBT210
IFN-.gamma.-IgG4-Fc pBBT222 IFN-.gamma.-IgG1-C.sub.H
5. Bioactivities of Interferon-IgG Fusion Proteins.
5.A. In Vitro Bioactivities
[0128] In vitro biological assays for interferons include antiviral
assays and cell proliferation inhibition assays. Proliferation of
the human Daudi cell line (American Type Culture Collection,
Rockville, Md.) is inhibited by alpha, beta and gamma interferon
and can be used to assay these proteins (Horoszewicz et al., 1979;
Evinger and Pestka, 1981). Daudi cells are maintained in RPMI 1640
media supplemented with 10% FBS, 50 units/ml penicillin and 50
.mu.g/ml streptomycin. Bioassays are performed in this media using
the procedures described above except that the number of cells
added to each well of a 96 well plate can be 5-20.times.10.sup.3
and the plates incubated at 37.degree. C. for 3 to 4 days. The
Daudi cells can be at early saturation density (1-2.times.10.sup.6
cells/ml) before use in the assays for optimum effectiveness of the
interferon. Serial dilutions of recombinant alpha, beta and gamma
interferon (Endogen; R&D Systems; GibcoBRL, US Biological) can
be analyzed in parallel. Recombinant alpha interferon has an
IC.sub.50 (the concentration of protein required to inhibit
proliferation by 50%) of approximately 5-30 pg/ml.
[0129] Bioactivities of alpha, beta and gamma interferons also can
be measured using viral plaque inhibition assays. These assays
measure the ability of the interferon protein to protect cells from
viral infection. Methods for performing these assays are described
in Ozes et al., (1992) and Lewis (1987; 1995). Human HeLa or WISH
cells (available from the American Type Culture Collection) can be
plated in 96-well plates (3.times.10.sup.4 cells/well) and grown to
near confluency at 37.degree. C. The cells can be washed and
treated for 24 hour with serial 2-3-fold dilutions of each IFN-IgG
fusion protein preparation. Vesicular stomatitis virus (VSV) or
encephalomyocarditis virus (EMCV) can then be added at a
multiplicity of infection of 0.1 and the plates incubated for a
further 24-48 hours at 37.degree. C. Additional controls can
include samples without virus. When 90% or more of the cells have
been killed in the virus-treated, no IFN control wells (determined
by visual inspection of the wells), the cell monolayer can be
stained with crystal violet (0.5% in 20% methanol) and absorbance
of the wells read using a microplate reader. Alternatively, 20
.mu.l of MTS/PMS mixture (CellTiter 96 AQueous One Solution,
Promega Corporation, Madison, Wis.) can be added to the cell
monolayers and absorbance the wells read at 490 nm after 1-4 hours
later as described in Example 3. EC.sub.50 values (the amount of
protein required to inhibit the cytopathic effect of the virus by
50%) can be used to compare the relative potencies of the fusion
proteins and non-fused wild type proteins. Wild type IFN proteins
protect cells from the cytopathic effects of VSV and EMCV and have
specific activities of approximately 1.times.10.sup.7 to
2.times.10.sup.8 units/mg in this assay, depending upon the IFN
species (Ozes et al., 1992).
[0130] The IFN-.alpha.-IgG and IFN-.beta.-IgG fusion proteins
listed in Table 8 were expressed in COS cells and purified as
described in Examples 1 and 2. Non-reducing SDS-PAGE analysis
showed that the IFN-.alpha.-IgG1-Fc and IFN-.alpha.-IgG1-C.sub.H
fusion proteins consisted predominantly of disulfide-linked dimers;
however small amounts (<10%) of monomeric fusion protein was
observed in all of the samples by non-reducing SDS-PAGE. The
IFN-.alpha.-IgG1-C.sub.H fusion protein also contained a
significant amount of disulfide-linked aggregates, which failed to
enter the gel. The IFN-.alpha.-IgG4-Fc fusion protein also was
predominantly dimeric; more monomer was present in this sample than
in the IFN-.alpha.-IgG1-Fc samples. The IFN-.beta.-IgG1-Fc and
IFN-.beta.-IgG1-C.sub.H fusion proteins also were largely dimeric,
with small amounts of monomeric fusion protein present in each
sample. In contrast, the majority of the purified
IFN-.beta.-IgG4-Fc fusion protein was monomeric; the remainder was
dimeric. Significant amounts of disulfide-linked aggregates were
present in all of the purified IFN-.beta.-IgG fusion proteins.
[0131] The purified IFN-.alpha.-IgG and IFN-.beta.-IgG fusion
proteins were assayed using the Daudi cell growth inhibition assay
described above. All of the IFN-.alpha.-IgG and IFN-.beta.-IgG
fusion proteins were biologically active. IC.sub.50 values for each
protein were calculated and are shown in Table 9. Control
recombinant IFN-.alpha. and IFN-.beta. were purchased from Endogen,
Inc. (Woburn, Mass.) and US Biological (Swampscott, Mass.),
respectively.
TABLE-US-00010 TABLE 9 Bioactivities of IFN-.alpha.-IgG and
IFN-.beta.-IgG Fusion Proteins IC.sub.50 Range Mean IC.sub.50 Clone
Protein (ng/ml) .sup.1 (ng/ml) -- rhIFN-a 0.015, 0.010 0.013
PBBT193 IFN-.alpha.2-IgG1-Fc 1.8, 2.5 2.1 PBBT194
IFN-.alpha.2-IgG4-Fc 2.5, 3.5 3.0 PBBT220 IFN-.alpha.2-IgG1-C.sub.H
3.5 3.5 -- rhIFN-.beta. 0.18, 0.3 0.24 PBBT195 IFN-.beta.-IgG1-Fc
175, 200 188 PBBT196 IFN-.beta.-IgG4-Fc 15, 15 15 PBBT221
IFN-.beta.-IgG1-C.sub.H 90 90 .sup.1 Data from individual
assays
[0132] IFN-gamma-IgG fusion proteins can be expressed in COS cells
and purified by Protein A affinity chromatography as described in
Example 2. Since IFN-gamma is sensitive to low pH, the fusion
protein can be eluted from the affinity column using elution
conditions that do not include low pH. One such method would be to
elute the gamma interferon-IgG fusion protein with the Gentle Ag/Ab
elution buffers available from Pierce Chemical Company (catalogue
#21013 and 21014), followed by desalting of the protein on a
desalting column.
5. B. In Vitro Activity of IFN-.alpha.-IgKC
[0133] Plasmid DNA encoding the IFN-.alpha.-IgKC fusion protein
described in Example 5 was transfected into COS cells and
conditioned media collected after three days. Serial dilutions of
the conditioned media were tested in the Daudi cell growth
inhibition assay. Concentrations of the fusion protein were
measured using an IFN-.alpha.2 ELISA kit purchased from Endogen,
Inc. The conditioned media inhibited proliferation of the Daudi
cells. The IC.sub.50 for the IFN-.alpha.-IgKC fusion was estimated
to be approximately 20 pg/ml (.about.0.69 pM). The control
non-fused IFN-.alpha.protein inhibited Daudi cell proliferation
with an IC.sub.50 of 6.5 pg/ml (.about.0.33 pM) in these
experiments.
5. C. In Vivo Activity of IFN-IgG Fusion Proteins
[0134] IFN-.alpha. biological activity is relatively
species-specific, which limits the range of preclinical animal
models that can be studied. One model that can be used to measure
in vivo efficacy of IFN-.alpha.-IgG fusion proteins is inhibition
of human tumor xenograft growth in athymic nude mice. Human
IFN-.alpha.2 is not active on mouse cells and inhibition of human
tumor xenograft growth in nude mice occurs through a direct
antiproliferative effect on the human tumor cells. IFN-.alpha.2
inhibits growth of a variety of primary human tumor xenografts and
human tumor cell lines in athymic mice (Balkwill et al., 1985;
Balkwill, 1986; Johns et al., 1992; Lindner and Borden, 1997). The
primary endpoint for the studies can be tumor volume in treated
mice. Administration of the IFN-.alpha.-IgG fusion proteins will
inhibit tumor growth (as measured by tumor volume) in the mice
relative to vehicle-treated animals. Athymic nude mice can be
purchased from a commercial vendor such as Charles River. Each
mouse can be injected with 2.times.10.sup.6 NIH-OVCAR-3 or MCF-7
tumor cells (these cell lines are available from the American Type
Culture collection) on day 0 and randomly assigned to test groups,
consisting of ten mice each. An appropriate number of cells from
another IFN-.alpha.-responsive tumor type can be substituted for
the NIH-OVCAR-3 or MCF-7 cells. Tumor volumes can be determined at
4 day intervals by measuring the length and width of the tumors
with calipers, as described by Linder and Borden (1997). At time of
sacrifice, the tumors can be excised and weighed. Mean tumor
volumes+/-SEM for each test group can be calculated for each
sampling point. Comparisons between groups can be made using a
Students T test for single comparisons and one-way analysis of
variance for multiple comparisons. Five .mu.g of IFN-.alpha.2
administered once per day by subcutaneous injection inhibits growth
of NIH-OVCAR-3 cells and MCF-7 cells in athymic mice by 80% after 6
weeks (Lindner and Borden, 1997). Either cell line can be used for
these studies. The NIH-OVCAR-3 line (available from the ATCC) does
not require estrogen for growth, as do the MCF-7 cells. Xenograft
experiments with MCF-7 cells require that the mice be
oophorectomized and implanted with estrogen pellets (Lindner and
Borden, 1997). In initial experiments, different groups of mice can
receive subcutaneous injections of 1 or 5 .mu.g per injection of
rIFN-.alpha.2, or 0.1 to 100 .mu.g per injection IFN-.alpha.-IgG
fusion proteins using every day, every other day or every third day
dosing schedules. Dosing can begin on day 2 following injection of
the tumor cells into the mice. Control mice can receive vehicle
solution only. In the every other day and every third day dosing
experiments, an additional positive control group can receive daily
subcutaneous injections of 5 .mu.g rIFN-.alpha.2.
[0135] In vivo efficacy of the IFN-.beta.-IgG fusion proteins can
be demonstrated in the same tumor xenograft model using similar
doses and dosing schedules.
6. IL-11-IgG Fusion Proteins
[0136] 6.A. Cloning IL-11. IL-11 stimulates development of
megakaryocyte precursors of platelets. A cDNA encoding human IL-11
can be amplified by PCR from RNA isolated from human cell lines
that express IL-11 such as the human bladder carcinoma cell line
5637 and the HL60 and U937 leukemia cell lines (available from the
American Type Culture Collection). PCR reactions can be carried out
with forward primer IL-11F
(5'-CGCAAGCTTGCCACCATGAACTGTGTTTGCCGCCTG-3') (SEQ.ID.NO.52) and
reverse primer IL-11R (5'-CGCGGATCCTCCGGACAGCCGAGTCTTCAGCAGCAG-3')
(SEQ.ID.NO.53). Primer IL-11F anneals to the 5' end of the coding
sequence for the IL-11 secretion signal and the reverse primer,
IL-11R, anneals to the 3' end of the IL-11 coding sequence. The
resulting PCR product can be digested with Hind III and Bam HI, gel
purified and cloned into pCDNA3.1(+) vector that has been digested
with Hind III and Bam HI, alkaline phosphatase treated, and gel
purified. Several clones can be sequenced to identify one with the
correct DNA sequence.
[0137] Alternatively, the IL-11coding sequence was amplified by PCR
as two segments which were then subsequently spliced together to
generate the full length clone by the technique of "overlap
extension" as described above in Example 1, section C4 and by
Horton et al. (1993). One segment, encoding amino acids 1 through
147, was amplified by PCR from single-stranded cDNA derived from
total RNA extracted from the human bladder carcinoma cell line 5637
as detailed in Section 2 B. above. A PCR reaction using the
products of the first strand synthesis as template was carried out
with forward primer BB265 (5>CGCAAGCTTGCCACCATGAACTG
TGTTTGCCGCCTG>3) (SEQ.ID.NO.54) and reverse primer BB273
(5>GCGGGACATCAGGAG CTGCAGCCGGCGCAG>3) (SEQ.ID.NO.55). Primer
BB265 anneals to the 5' end of the coding sequence for the IL-11
secretory signal sequence and the reverse primer, BB273, anneals to
sequence encoding amino acids 138-147 and spans the junction of
exons 4 and 5 (McKinley et al., 1992). The .about.450 bp product of
this reaction was gel-purified and used in subsequent splicing
reactions. The second segment, containing DNA sequences encoding
encoding amino acids 142 through 197, was amplified by PCR from
human genomic DNA (STRATAGENE). A PCR reaction using human genomic
DNA as template was carried out with forward primer BB272
(5>CAGCTCCTGATGTCCCGCC TGGCCCTG>3) (SEQ.ID.NO.56) and reverse
primer BB274 (5>AGTCTTCAGCAGCAGCAGTCCCC TCAC>3)
(SEQ.ID.NO.57). BB272 anneals to sequence encoding amino acids
142-150 and spans the junction of exons 4 and 5. BB274 anneals to
sequence encoding amino acids 189-197. The .about.170 bp product of
this reaction was gel-purified and used in subsequent splicing
reactions.
[0138] The gel purified .about.450 bp and .about.170 bp products
were spliced together in a PCR reaction which included the
.about.450 bp and .about.170 bp products as template and forward
primer BB265 (described above) and reverse primer BB275
(5>CGCGGATCCTCC GGACAGCCGAGTCTTCAGCAGCAG>3) (SEQ.ID.NO.58).
BB275 anneals to the DNA sequence encoding amino acids 191-199. The
.about.620 bp product of this reaction was gel-purified, digested
with Hin dIII and Bam HI and cloned into pCDNA3.1(+) vector that
had been digested with Hind III and Bam HI, alkaline phosphatase
treated, and gel purified. A clone with the correct DNA sequence
was designated pCDNA3.1(+)::IL-11fus or pBBT298.
[0139] 6.B. Construction of IL-11-IgG fusions. The IgG1-Fc coding
sequence was fused to the carboxyterminus of IL-11. The .about.790
bp Bam HI-Xba I fragment was excised from plasmid pBBT174
[described above in Example 2, see Table 1] and cloned into pBBT298
which had been digested with Bam HI and Xba I, and treated with
alkaline phosphatase. Similarly, IgG4-Fc coding sequence also was
fused to the carboxyterminus of IL-11. The .about.790 bp Bam HI-Xba
I fragment of plasmid pBBT175 [described above in Example 2, see
Table 1] was excised, gel-purified and cloned into pBBT298 which
had been digested with Bam HI and Xba I, and treated with alkaline
phosphatase. The IgG1-C.sub.H and IgG4-C.sub.H coding sequences
also were fused to the carboxyterminus of IL-11. The IgG1-C.sub.H
and IgG4-C.sub.H coding sequences were excised as .about.1080 bp
Bam HI-Xba I fragments from plasmids pBBT173 and pBBT184 [described
above in Example 2, see Table 1] respectively, and cloned into
pBBT298 which had been digested with Bam HI and Xba I, and treated
with alkaline phosphatase. The structures of all the resulting
recombinant plasmids were verified by restriction endonuclease
digestions and agarose gel electrophoresis. These plasmids and the
IL-11-IgG fusion proteins they encode are listed in Table 10.
TABLE-US-00011 TABLE 10 IL-11 - IgG Fusion Proteins Expression
Plasmid IL-11-Fusion Protein pBBT336 IL-11-IgG1-Fc pBBT337
IL-11-IgG4-Fc pBBT338 IL-11-IgG1-C.sub.H pBBT339
IL-11-IgG4-C.sub.H
[0140] An IL-11-IgG1-Fc direct fusion can be created by PCR using
plasmid pBBT336 as the DNA template. One PCR reaction can use
oligos IL11DFA (5' CTGAAGACTCGGCTGGA GCCCAAATCTTGTGACAAA-3')
(SEQ.ID.NO.59) and BB82. The second PCR reaction can use oligos
IL11DFB (5' ACAAGATTTGGGCTCCAGCCGAGTCTTCAGCAGCAG-3) (SEQ.ID.NO.60)
and BB272. The products from these PCR reactions can be
gel-purified, mixed and subjected to a third PCR reaction using
oligos BB82 and BB272. The approximate 800 bp PCR product can be
gel-purified, digested with and Sgr AI III and Sac II, and cloned
into similarly cut pBBT336 that had been treated with calf
intestinal phosphatase. A clone with the correct insert can be
identified by DNA sequencing.
[0141] An IL11-IgG4-Fc direct fusion can be created by PCR using
plasmid pBBT337 as the DNA template. One PCR reaction can use
oligos IL11DFC (5-CTGAAGACTCGGCTGGAGTC CAAATATGGTCCCCCA-3')
(SEQ.ID.NO.61) and BB82. The second PCR reaction can use oligos
IL11DFD (5'-ACCATATTTGGACTCCAGCCGAGTCTTCAGCAGCAG-3') (SEQ.ID.NO.62)
and BB272. The products from these PCR reactions can be
gel-purified, mixed and subjected to a third PCR reaction using
oligos BB82 and BB272. The approximate 800 bp PCR product can be
gel-purified, digested with and Sgr AI and Sac II, and cloned into
similarly cut pBBT337 that has been treated with calf intestinal
phosphatase. A clone with the correct insert can be identified by
DNA sequencing.
[0142] The B9-11 cell line (Lu et al., 1994), the T11 cell line (R
& D Systems) or another IL-11-dependent cell line can be used
to measure bioactivities of the IL-11-IgG fusion proteins. An
IL-11-dependent cell line can be created by culturing the B9 cell
line (available from the German Collection of Microorganisms and
Cell Cultures, Braunschweig, Germany) in RPMI 1640 media containing
10% FBS, 50 units/ml penicillin and 50 .mu.g/ml streptomycin and
50-100 ng/ml of IL-11 for several days to several months, followed
by limiting dilution cloning of the cells to select for individual
lines.
6.C. In Vivo Efficacy of IL-11-IgG Fusion Proteins
[0143] The IL-11-IgG fusion proteins will stimulate increases in
circulating platelets and megakaryopoiesis in normal mice or rats,
similar to what is seen for hIL-11 and hTPO (Lok et al., 1994;
Kaushansky et al., 1994; Neben et al., 1993; Yonemura et al.,
1993). Efficacy of the IL-11-IgG fusion proteins can be tested in
normal animals using every other day, every third day or single
injection dosing schedules. Effectiveness of the IL-11-IgG fusion
proteins also can be demonstrated in rodent chemotherapy-induced
thrombocytopenia models (Hangoc et al., 1993; Leonard et al.,
1994), using every other day, every third day or single injection
dosing schedules.
[0144] Groups of mice or rats can receive subcutaneous injections
of rhIL-11, IL-11-IgG fusion protein or placebo (vehicle solution)
at specified intervals (daily, every other day, every third day)
for up to seven days. A wide range of IL-11-IgG fusion protein
doses can be tested in these initial experiments to increase the
likelihood that one of the doses will be effective. The dose range
of the IL-11-IgG fusion proteins to be tested can range from
0.002.times. to 25.times. the optimum dose of IL-11 previously
determined for these animal models. It is possible that
administration of too much of the fusion proteins will impede
megakarypoiesis due to toxicity. Control animals can receive
vehicle solution only. Additional control groups can receive daily
subcutaneous injections of rhIL-1. On day 7 the animals can be
sacrificed and blood samples collected for complete blood cell
count analysis. Hematopoietic tissues (liver and spleen) can be
collected, weighed and fixed in formalin for histopathologic
analyses to look for evidence of increased megakaryopoiesis. Bone
marrow can be removed from various long bones and the sternum for
unit particle preps and histopathologic analysis to look for
evidence of increased megakaryopoiesis. Comparisons between groups
can be made using a Students T test for single comparisons and
one-way analysis of variance for multiple comparisons. P<0.05
will be considered significant. The IL-11-IgG fusion proteins will
stimulate increases in circulating platelets and megakaryopoiesis
in the animals.
7. TPO-IgG Fusion Proteins
[0145] 7. A. Cloning TPO. Thrombopoietin (TPO) stimulates
development of megakaryocyte precursors of platelets. A cDNA
encoding human TPO was amplified by PCR from single-stranded cDNA
prepared from human adult and fetal liver (CLONTECH, Inc.).
Single-stranded cDNA prepared from fetal or adult kidney (CLONTECH)
also can be used to amplify TPO. PCR reactions were carried out
with forward primer BB343
(5'-CGCAAGCTTGCCACCATGGAGCTGACTGAATTGCTC-3') (SEQ.ID.NO.63) and
reverse primer BB344 (5'-CGCGGATCCTCCGGACCCTTCC TGAGACAGATTCTG-3')
(SEQ.ID.NO.64). Primer BB343 anneals to the 5' end of the coding
sequence for the TPO secretion signal and the reverse primer,
BB344, anneals to the 3' end of the TPO coding sequence.
[0146] The sequence encoding TPO contains an internal Bam HI site
and this site was used to clone the .about.1000 bp TPO coding
sequence as two segments; an amino-terminal Hind III-Bam HI
fragment of .about.400 bp and a carboxy-terminal Bam HI fragment of
.about.600 bp. Each of these fragments was first cloned and
sequenced and subsequently ligated together through the internal
Bam HI site to generate the complete TPO coding sequence. The
.about.1,000 bp PCR product was digested with Hin dIII and Bam HI
to generate a Hin dIII-Bam HI fragment of .about.400 bp and a Bam
HI fragment of .about.600. These fragments were gel-purified and
cloned into pCDNA3.1(+) vector that had been digested with Hind III
and Bam HI, or only Bam HI, respectively, alkaline phosphatase
treated, and gel purified. Clones with the correct DNA sequences
(Foster et al., 1994; Sohma et al., 1994) for each fragment were
identified. The 600 bp Bam HI fragment was then excised from the
sequence-verified clone and cloned into Bam HI-cut, alkaline
phosphatase-treated and gel-purified pCDNA3.1(+) derivative
containing the sequence verified 400 bp Hin dIII-Bam HI fragment.
The resulting clones were analyzed by restriction endonuclease
digestion and PCR to identify those that carried the 600 bp Bam HI
fragment cloned in the proper orientation i.e., so that the coding
sequence for TPO is properly reconstituted. One properly oriented
clone was designated pCDNA3.1(+)::TPOfus, or pBBT355, and used in
further constructions.
[0147] 7. B. Construction of TPO-IgG fusions. Fusions of IgG coding
sequences to the carboxy-terminus of TPO were constructed using
procedures analogous to those used to construct the IL-11-IgG
fusions with the exception that restriction endonuclease Bsp EI was
used in place of Bam HI because the coding sequence for TPO
contains a Bam HI site. The sequence employed to encode the
ser-gly-gly-ser-gly-gly-ser (SEQ.ID.NO.3) linker peptide in all of
the constructs described in Examples 1, 2 and 10 contains a single
Bsp EI recognition site (TCCGGA) and this site does not occur
within the pCDNA3.1(+) vector or the IgG1-Fc, IgG4-Fc,
IgG1-C.sub.H, and IgG4-C.sub.H coding sequences.
[0148] The IgG1-Fc coding sequence was fused to the carboxyterminus
of TPO. The .about.790 bp Bsp EI-Xba I fragment was excised from
plasmid pBBT174 [described above in Example 2, see Table 1] and
cloned into pBBT355 which had been digested with Bsp EI and Xba I,
and treated with alkaline phosphatase. Similarly, IgG4-Fc coding
sequence also was fused to the carboxyterminus of TPO. The
.about.790 bp Bsp EI-Xba I fragment of plasmid pBBT175 [described
above in Example 2, see Table 1] was excised, gel-purified and
cloned into pBBT355 which had been digested with Bsp EI and Xba I,
and treated with alkaline phosphatase. The IgG1-C.sub.H and
IgG4-C.sub.H coding sequences also were fused to the
carboxyterminus of TPO. The IgG1-C.sub.H and IgG4-C.sub.H coding
sequences were excised as .about.1080 bp Bsp EI-Xba I fragments
from plasmids pBBT173 and pBBT184 [described above in Example 2,
see Table 1] respectively, and cloned into pBBT355 which had been
digested with Bsp EI and Xba I, and treated with alkaline
phosphatase. The structures of all the resulting recombinant
plasmids were verified by restriction endonuclease digestions and
agarose gel electrophoresis. Table 11 lists these plasmids and the
TPO-IgG fusion proteins they encode.
TABLE-US-00012 TABLE 11 TPO - IgG Fusion Proteins Expression
Plasmid TPO Fusion Protein pBBT340 TPO-IgG1-Fc pBBT341 TPO-IgG4-Fc
pBBT342 TPO-IgG1-C.sub.H pBBT343 TPO-IgG4-C.sub.H
[0149] The amino-terminal domain of TPO, consisting of amino acids
1-153 of the mature TPO protein has been shown to be sufficient for
megakaryopoiesis (Bartley et al., 1994, de Sauvage et al., 1994).
This domain could be subcloned by PCR from the TPO coding sequence
in pBBT355 (described above) and fused to immunoglobulin sequences.
The PCR reaction would be carried out using forward primer BB343
(described above) and reverse primer TPO153rev (5>CGC GGA TCC
TCC GGA CCT GAC GCA GAG GGT GGA CCC>3) (SEQ.ID.NO.65). Primer
TPO153rev anneals to the TPO sequence encoding amino acids 147
through 153 and adds a portion of the flexible linker containing a
Bam HI site. The template for this reaction would be pBBT355 DNA.
The resulting PCR product of 600 bp would be digested with Bam HI
and the resulting .about.105 bp Bam HI fragment would be gel
purified, cloned in pUC18 and sequenced. A clone having the correct
sequence would then be used as a source of plasmid DNA from which
the .about.105 bp Bam HI fragment would be gel purified. This
fragment would be used to replace the .about.600 bp Bam HI fragment
present in pBBT340, pBBT341, pBBT342 and pBBT343 (which are all
described above). This will result in construction of fusion
proteins consisting of amino acids 1-153 of TPO fused via the
ser-gly-gly-ser-gly-gly-ser linker to IgG1-Fc, IgG4-Fc,
IgG1-C.sub.H, and IgG4-C.sub.H respectively.
[0150] A TPO-IgG1-Fc direct fusion can be created by PCR using
plasmid pBBT340 as the DNA template. One PCR reaction can use
oligos TPODFA (5' CTGTCTCAGGAAGGGGAG CCCAAATCTTGTGACAAA-3')
(SEQ.ID.NO.66) and BB82. The second PCR reaction can use oligos
TPODFB (5' ACAAGATTTGGGCTCCCCTTCCTGAGACAGATTCTG-3) (SEQ.ID.NO.67)
and BB91. The products from these PCR reactions can be
gel-purified, mixed and subjected to a third PCR reaction using
oligos BB82 and BB91. The approximate 1700 bp PCR product can be
gel-purified, digested with and Hind III and Sac II, and cloned
into similarly cut pBBT340 that had been treated with calf
intestinal phosphatase. A clone with the correct insert can be
identified by DNA sequencing.
[0151] A TPO-IgG4-Fc direct fusion can be created by PCR using
plasmid pBBT341 as the DNA template. One PCR reaction can use
oligos TPODFC (5-CTGTCTCAGGAAGGGGAGTCCAAA TATGGTCCCCCA-3')
(SEQ.ID.NO.68) and BB82. The second PCR reaction can use oligos
TPODFD (5'-ACCATATTTGGACTCCCCTTCCTGAGACAGATTCTG-3'SEQ.ID.NO.69) and
BB91. The products from these PCR reactions can be gel-purified,
mixed and subjected to a third PCR reaction using oligos BB82 and
BB91. The approximate 2000 bp PCR product can be gel-purified,
digested with and Hind III and Sac II, and cloned into similarly
cut pBBT341 that has been treated with calf intestinal phosphatase.
A clone with the correct insert can be identified by DNA
sequencing.
[0152] Similar methods could be used to construct analogous direct
fusions encoding only amino acids 1-153 of TPO fused to IgG-Fc
domains.
[0153] The cell line M-O7e (Avanzi et al., 1988; available from the
German Collection of Microorganisms and Cell Cultures,
Braunschweig, Germany) can be used to measure TPO-IgG fusion
protein bioactivity.
7.C. In Vivo Efficacy of TPO-IgG Fusion Proteins
[0154] The TPO-IgG fusion proteins will stimulate increases in
circulating platelets and megakaryopoiesis in normal mice or rats,
similar to what is seen for hIL-11 and hTPO (Lok et al., 1994;
Kaushansky et al., 1994; Neben et al., 1993; Yonemura et al., 1993;
Kaszubska et al., 2000). Efficacy of the TPO-IgG fusion proteins
can be tested in normal animals using every other day, every third
day or single injection dosing schedules. Effectiveness of the
TPO-IgG fusion proteins also can be demonstrated in rodent
chemotherapy-induced thrombocytopenia models (Hanggoc et al., 1993;
Leonard et al., 1994), using every other day, every third day or
single injection dosing schedules.
[0155] Groups of mice or rats can receive subcutaneous injections
of rhTPO, TPO-IgG fusion protein or placebo (vehicle solution) at
specified intervals (daily, every other day, every third day) for
up to seven days. A wide range of TPO-IgG fusion protein doses can
be used in these initial experiments to increase the likelihood
that one of the doses will be effective. The dose range of the
TPO-IgG fusion proteins to be tested can range from 0.002.times. to
25.times. the optimum dose of TPO previously determined for these
animal models. It is possible that administration of too much of
the fusion proteins will impede megakarypoiesis due to toxicity.
Control animals can receive vehicle solution only. Additional
control groups can receive daily subcutaneous injections of rhTPO.
On day 7 the animals can be sacrificed and blood samples collected
for complete blood cell count analysis. Hematopoietic tissues
(liver and spleen) can be collected, weighed and fixed in formalin
for histopathologic analyses to look for evidence of increased
megakaryopoiesis. Bone marrow can be removed from various long
bones and the sternum for unit particle preps and histopathologic
analysis to look for evidence of increased megakaryopoiesis.
Comparisons between groups can be made using a Students T test for
single comparisons and one-way analysis of variance for multiple
comparisons. P<0.05 will be considered significant. The TPO-IgG
fusion proteins will stimulate increases in circulating platelets
and megakaryopoiesis in the animals.
8. GM-CSF-IgG Fusion Proteins
[0156] 8.A. Cloning GM-CSF: A cDNA encoding human Granulocyte
Macrophage Colony Stimulating Factor (GM-CSF) was amplified by PCR
from total RNA prepared from the human bladder carcinoma cell line
5637 as detailed in Section 2B. above. A PCR reaction using the
products of the first strand synthesis as template was carried out
with forward primer BB263 (5>CGCAAGCTTGCCACCATGTGGCTGCAGAGC
CTGCTG>3) (SEQ.ID.NO.70) and reverse primer BB264
(5>CGCGGATCCTCCGGACTCCTGGACTGGCT CCCAGCA>3) (SEQ.ID.NO.71).
Primer BB263 anneals to the 5' end of the coding sequence for the
GM-CSF secretion signal and the reverse primer, BB264, anneals to
the 3' end of the GM-CSF coding sequence. The resulting .about.450
bp PCR product was digested with Hind III and Bam HI, gel purified
and cloned into pCDNA3.1(+) vector that had been digested with Hind
III and Bam HI, alkaline phosphatase treated, and gel purified. A
clone with the correct DNA sequence (Cantrell et al., 1985) was
designated pCDNA3.1(+)::GM-CSFfus or pBBT267.
[0157] Alternatively, a cDNA encoding human GM-CSF can be amplified
by PCR from RNA isolated from a cell line that expresses GM-CSF
such as the human T cell line HUT 102 (available from American Type
Culture Collection) or from human peripheral blood lymphocytes or
the human Jurkat T cell line that had been activated with 20
.mu.g/ml concanavalin A (Sigma Chemical Company) and 40 ng/ml
phorbol myristate acetate (PMA, Sigma Chemical Company). PCR
reactions can be carried out with forward primer BB263and reverse
primer BB264. The resulting .about.450 bp PCR product can be
digested with Hind III and Bam HI, gel purified and cloned into
pCDNA3.1(+) vector that has been digested with Hind III and Bam HI,
alkaline phosphatase treated, and gel purified. Several clones can
be sequenced to identify one with the correct DNA sequence.
[0158] 8. B. Construction of GM-CSF-IgG (GF-IgG) fusions. The
IgG1-Fc coding sequence can be fused to the carboxy-terminus of
GM-CSF. The .about.790 bp Bam HI-Xba I fragment excised from
plasmid pBBT174 [described above in Example 2, see Table 1] can be
cloned into pBBT267 that has been digested with Bam HI and Xba I,
and treated with alkaline phosphatase. Similarly, IgG4-Fc coding
sequence also can be fused to the carboxy-terminus of GM-CSF. The
.about.790 bp Bam HI-Xba I fragment excised from plasmid pBBT175
[described above in Example 2, see Table 1] can be cloned into
pBBT267 that has been digested with Bam HI and Xba I, and treated
with alkaline phosphatase. The IgG1-C.sub.H and IgG4-C.sub.H coding
sequences also can be fused to the carboxy-terminus of GM-CSF. The
IgG1-C.sub.H and IgG4-C.sub.H coding sequences were excised as
.about.1080 bp Bam HI-Xba I fragments from plasmids pBBT173 and
pBBT184 [described above in Example 2, see Table 1] respectively,
and can be cloned into pBBT267 that has been digested with Bam HI
and Xba I, and treated with alkaline phosphatase. The structures of
all the resulting recombinant plasmids can be verified by
restriction endonuclease digestions and agarose gel
electrophoresis. Bioactivity of the GM-CSF-IgG fusion proteins can
be measured using the TF-1 cell line (available from the American
Type Culture Collection).
[0159] A GM-CSF-IgG1-Fc direct fusion can be created by PCR using
plasmid pcDNA3.1::GM-CSF-IgG1-Fc as the DNA template. One PCR
reaction can use oligos GMCSFDFA (5' GAGCCAGTCCAGGAG
GAGCCCAAATCTTGTGACAAA-3') and BB82. The second PCR reaction can use
oligos GMCSFDFB (5' ACAAGATTTGGGCTCCTCCTGGACTGGCTCCCAGCA-3) and
BB91. The products from these PCR reactions can be gel-purified,
mixed and subjected to a third PCR reaction using oligos BB82 and
BB91. The approximate 1150 bp PCR product can be gel-purified,
digested with and Hind III and Sac II, the resulting .about.675 bp
Hind III/Sac II fragment gel-purified and cloned into similarly cut
plasmid pcDNA3.1::GM-CSF-IgG1-Fc that had been treated with calf
intestinal phosphatase. A clone with the correct insert can be
identified by DNA sequencing.
[0160] A GM-CSF-IgG4-Fc direct fusion can be created by PCR using
plasmid pcDNA3.1::GM-CSF-IgG4-Fc as the DNA template. One PCR
reaction can use oligos GMCSFDFC
(5GAGCCAGTCCAGGAGGAGTCCAAATATGGTCCCCCA-3') (SEQ.ID.NO.76) and BB82.
The second PCR reaction can use oligos GMCSFDFD
(5'-ACCATATTTGGACTCCTCCT GGACTGGCTCCCAGCA-3') (SEQ.ID.NO.77) and
BB91. The products from these PCR reactions can be gel-purified,
mixed and subjected to a third PCR reaction using oligos BB82 and
BB91. The approximate 1150 bp PCR product can be gel-purified,
digested with and Hind III and Sac II, the .about.675 bp Hind
III/Sac II fragment gel-purified and cloned into similarly cut
plasmid pcDNA3.1::GM-CSF-IgG4-Fc that has been treated with calf
intestinal phosphatase. A clone with the correct insert can be
identified by DNA sequencing.
[0161] Bioactivity of the GM-CSF-IgG fusion proteins can be
measured using the TF-1 cell line (available from the American Type
Culture Collection).
8. C. In Vivo Efficacy of GM-CSF-IgG Fusion Proteins
[0162] GM-CSF stimulates granulopoiesis and an increase in
circulating neutrophil levels in normal and neutropenic humans and
animals. Efficacy of the human GM-CSF-IgG fusion proteins can be
determined in non-human primates (Donahue et al., 1986a, 1986b ;
Mayer et al., 1987a, 1987b) and dogs (Schuening et al., 1989; Mayer
et al., 1990), where injection of the protein can stimulate an
increase in circulating neutrophil levels over time. Alternatively,
analogous IgG fusion proteins to those described here can be made
using mouse GM-CSF (Gough et al., 1984; 1985; Kajigaya et al.,
1986; Cantrell et al., 1985) and the proteins expressed and
purified as described for the human GM-CSF cysteine muteins. In
vitro bioactivities of the proteins can be measured using the
murine NFS60 or DA-3 cells lines. Efficacy of the mouse GM-CSF-IgG
fusion proteins can be measured in mice made neutropenic by
injection of cyclophosphamide at a dose of 200 mg/kg (Mayer et al.,
1991; Gamba-Vitalo et al., 1991) using once per day, every other
day or every third day dosing schedules for the murine GM-CSF-IgG
fusion proteins. Doses of the GM-CSF-IgG fusion proteins ranging
from 0.5 .mu.g/kg to 650 .mu.g/kg per injection can be tested.
9. Stem Cell Factor-IgG Fusion Proteins
[0163] 9. A. Cloning Stem Cell Factor (SCF): SCF regulates
development of hematopoietic progenitor cells, A cDNA encoding
human SCF can be amplified by RT-PCR using RNA isolated from HepG2,
5637 or HT-1080 cell lines (Martin et al., 1990; the HepG2 and 5637
cell lines are available from the ATCC, Rockville, Md.). PCR
reactions can be carried out with forward primer SCF-F
(5'-CGCAAGCTTGCCACCATGAAGAAG ACACAAACT-3') (SEQ.ID.NO.78) and
reverse primer SCF-R (5'-CGCGGATCCTCCGGA GTGTAGGCTGGAGTCTCCAGG-3')
(SEQ.ID.NO.79). SCF DNA sequences in the primers are underlined.
Primer SCF-F anneals to the 5' end of the coding sequence for the
SCF secretion signal and the reverse primer, SCF-R, anneals to the
3' end of the SCF coding sequence, beginning at the junction of the
extracellular and transmembrane domains. Other reverse PCR primers
can be used to create truncated forms of the SCF extracellular
domain, in particular a form that terminates following Ala-174 of
the mature protein, by substituting appropriate nucleotides for the
SCF DNA sequence listed in SCF-R. The resulting PCR product can be
digested with Hind III and Bam HI, gel purified and cloned into
pCDNA3.1(+) vector that has been digested with Hind III and Bam HI,
alkaline phosphatase treated, and gel purified. Several clones can
be sequenced to identify one with the correct DNA sequence.
IgG1-Fc, IgG4-Fc, IgG1-C.sub.H, IgG4-C.sub.H and kappa light chain
constant regions can be fused to the carboxy-terminus of the
extracellular domain of SCF as described in Examples 1 and 5. The
cell line TF-1 (Kitamura, 1989; available from the American Type
Culture Collection, Rockville, Md.) can be used to measure
bioactivity of SCF-IgG fusion proteins.
[0164] Direct fusions of the extracellular domain of SCF to various
IgG domains can be constructed using procedures similar to those
described in Example 4 for constructing EPO-IgG and G-CSF-IgG
direct fusions. A SCF-IgG1-Fc direct fusion can be created by PCR
using plasmid pcDNA3.1::SCF-IgG1-Fc7AA as the DNA template. One PCR
reaction can use oligos SCFDFF
(5'-GACTCCAGCCTACACGAGCCCAAATCTTGTGACAAA-3') (SEQ.ID.NO.80) and
BB82. The second PCR reaction used oligos SCFDFR
(5'-ACAAGATTTGGGCTCGTGT AGGCTGGAGTCTCCAGG-3'SEQ.ID.NO.81) and BB91.
The products from these PCR reactions can be gel-purified, mixed
and subjected to a third PCR reaction using oligos BB82 and BB91.
The PCR product can be gel-purified, digested with and Hind III and
Sac II, and cloned into similarly cut pcDNA3.1::SCF-IgG1-Fc7AA that
had been treated with calf intestinal phosphatase. A clone with the
correct insert can be identified by DNA sequencing.
[0165] A SCF-IgG4-Fc direct fusion can be created by PCR using
plasmid pcDNA3.1::SCF-IgG4-Fc7AA as the DNA template. One PCR
reaction can use oligos SCFDFC
(5'-GACTCCAGCCTACACGAGTCCAAATATGGTCCCCCA-3') (SEQ.ID.NO.82) and
BB82. The second PCR reaction can use oligos SCFDFD
(5'-ACCATATTTGGACTCGTGTA GGCTGGAGTCTCCAGG-3') (SEQ.ID.NO.83) and
BB91. The products from these PCR reactions can be gel-purified,
mixed and subjected to a third PCR reaction using oligos BB82 and
BB91. The PCR product can be gel-purified, digested with and Hind
III and Sac II, and cloned into similarly cut
pcDNA3.1::SCF-IgG4-Fc7AA that has been treated with calf intestinal
phosphatase. A clone with the correct insert can be identified by
DNA sequencing.
[0166] 10. Flt-3L-IgG fusion Proteins: Flt-3L (Lyman et al., 1993;
Hannum et al., 1994) is a membrane bound cytokine that regulates
development of hematopoietic stem cells. A cDNA encoding human
Flt-3L can be amplified by PCR from single-stranded cDNA prepared
from adult or fetal liver, kidney, heart, lung, or skeletal muscle,
which is available from commercial sources such as CLONTECH and
Stratagene, Inc. PCR reactions can be carried out with forward
primer fltF (5'-CGCAAGCTTGCCACCATGACAGTGCTGGCGCCAGCC-3')
(SEQ.ID.NO.84) and reverse primer fltR
(5'-CGCGGATCCTCCGGAAGGGGGCTGCGGGGCTGTCGG-3') (SEQ.ID.NO.85). Flt-3L
DNA sequences in the primers are underlined. Primer fltF anneals to
the 5' end of the coding sequence for the Flt-3L secretion signal
and the reverse primer, fltR, anneals to the 3' end of the Flt3
coding sequence, beginning at the junction of the extracellular and
transmembrane domains. Other reverse PCR primers can be used to
create truncated forms of the Flt-3L extracellular domain by
substituting appropriate nucleotides for the Flt-3L DNA sequence
listed in primer fltR. The resulting PCR product can be digested
with Hind III and Bam HI, gel purified and cloned into pCDNA3.1(+)
vector that has been digested with Hind HI and Bam HI, alkaline
phosphatase treated, and gel purified. Several clones can be
sequenced to identify one with the correct DNA sequence. IgG1-Fc,
IgG4-Fc, IgG1-C.sub.H, IgG4-C.sub.H and kappa light chain constant
regions can be fused to the carboxy-terminus of the extracellular
domain of Flt-3L as described in Examples 1 and 5. Ba/F3 cells
transfected with the human Flt-3 receptor (Lyman et al.,1993;
Hannum et al., 1994) can be can be used to measure bioactivity of
Flt-3L-IgG fusion proteins. Ba/F3 cells are available from the
German Collection of Microorganisms and Cell Cultures
(Braunschweig, Germany).
[0167] Direct fusions of the extracellular domain of Flt-3L to
various IgG domains can be constructed using procedures similar to
those described in Example 4 for constructing EPO-IgG and G-CSF-IgG
direct fusions. A Flt-3L-IgG1-Fc direct fusion can be created by
PCR using the pcDNA3.1::Flt-3L-IgG1 plasmid described above as the
DNA template. One PCR reaction can use oligos FltDFA
(5'-GCCCCGCAGCCCCCTGAGCCCAAA TCTTGTGACAAA-3'(SEQ.ID.NO.86) and
BB82. The second PCR reaction can use oligos Flt3DFB
(5'-ACAAGATTTGGGCTCAGGGGGCTGCGGGGCTGTCGG-3') (SEQ.ID.NO.87) and
BB91. The products from these PCR reactions can be gel-purified,
mixed and subjected to a third PCR reaction using oligos BB82 and
BB91. The PCR product can be gel-purified, digested with and Hind
III and Sac II, and cloned into similarly cut
pcDNA3.1::SCF-IgG1-Fc7AA that had been treated with calf intestinal
phosphatase. A clone with the correct insert can be identified by
DNA sequencing.
[0168] A Flt-3L-IgG4-Fc direct fusion can be created by PCR using
plasmid pcDNA3.1::Flt3-IgG4-Fc7AA as the DNA template. One PCR
reaction can use oligos FltDFC (5'-GCCCCGCAGCCCCCT
GAGTCCAAATATGGTCCCCCA-3') (SEQ.ID.NO.88) and BB82. The second PCR
reaction can use oligos FltDFD
(5'-ACCATATTTGGACTCAGGGGGCTGCGGGGCTGTCGG-3') (SEQ.ID.NO.89) and
BB91. The products from these PCR reactions can be gel-purified,
mixed and subjected to a third PCR reaction using oligos BB82 and
BB91. The PCR product can be gel-purified, digested with Hind III
and Sac II, and cloned into similarly cut pcDNA3.1::SCF-IgG4-Fc7AA
that has been treated with calf intestinal phosphatase. A clone
with the correct insert can be identified by DNA sequencing.
Example 11
Multimeric Cytokine and Growth Factor Fusion Proteins
[0169] Bioactive fusion proteins also can be created by
constructing multimeric fusion proteins of the growth factors and
cytokines mentioned in this application. These multimeric fusion
proteins can be constructed as described for the IgG fusion
proteins except that a second growth factor/cytokine protein can be
substituted for the IgG domain. The two growth factors/cytokines
can be joined together with or without linker amino acids between
the two growth factors/cytokines. Suitable peptide linkers include
those described in Examples 1 and 4. The fusion proteins can be
homodimeric, heterodimeric, homomultimeric (comprising three or
more copies of the same growth factor/cytokine) or heteromultimeric
(comprising two or more different growth factors/cytokines). The
most carboxy-terminal cytokine/growth factor domain can be modified
using procedures such as PCR to delete the protein's natural signal
sequence and add, if desired, a short peptide linker sequence
preceding the first amino acid of the mature protein sequence. The
linker sequence could include a restriction enzyme site to
facilitate joining to the amino-terminal cytokine/growth factor
domain. In multimeric fusion proteins the cytokine/growth factor
domains not at the amino- or carboxy-terminus of the protein can be
modified to delete the natural signal sequence and termination
codon and add, if desired, peptide linkers to the amino- and
carboxy-termini of the protein. The fusion proteins can expressed
in COS cells following transfection, purified and tested in
appropriate in vitro bioassays. The fusion proteins also can be
expressed in stably transformed eukaryotic cells such as mammalian
cells, as described in Example 12.
Example 12
Expression of IgG Fusion Proteins and Multimeric Growth
Factors/Cytokines in Stably Transformed Eukaryotic Cells
[0170] The IgG Fusion proteins and mutimeric cytokines/growth
factors described in the preceding Examples also can be expressed
in stably transformed eukaryotic cells such as insect cells or
mammalian cells using well established procedures. The IgG fusion
proteins and multimeric cytokines/growth factors are then purified
from the conditioned media. Stably transfected CHO cell lines are
widely used for high-level expression of recombinant proteins
(Geisse et al. 1996; Trill et al. 1995). In CHO cells, high level
expression of chromosomally integrated heterologous genes can be
achieved by gene amplification. Typically the gene of interest is
linked to a marker gene for which amplification is selectable. A
variety of genes which provide selections for amplification have
been described (Kaufman 1990) but murine dihydrofolate reductase
(dhfr) is frequently employed. Amplification of this gene confers
resistance to the folate analog methotrexate (MTX) and the level of
resistance increases with dhfr gene copy number (Alt et al., 1978).
Utility of MTX selection is enhanced by the availability of CHO
cell lines that are deficient in dhfr (Urlaub and Chasin,
1980).
[0171] One skilled in the art can construct expression vectors for
the IgG fusion proteins or multimeric cytokines/growth factors that
incorporate the murine dhfr gene into-the commercially available
pCDNA3.1 expression vector (Invitrogen), which includes the
neomycin phosphotransferase (NPT) gene that confers resistance to
G418. The murine dhfr expression vector pdhfr2.9 is available from
the American Type Culture Collection (catalogue No.37165). This
dhfr gene is selectable in dhfr.sup.- CHO cell lines and can be
amplified by standard selections for MTX resistance (Crouse et al
1983). The dhfr coding sequence can be excised from pdhfr2.9 as a
.about.900 bp Bgl II fragment and cloned into the unique Bam HI
site of the polylinker of the expression vector pREP4 (Invitrogen).
This construct will position the gene downstream of the strong RSV
promoter, which is known to function in CHO cells (Trill et al,
1995) and upstream of a polyadenylation site derived from SV40.
This dhfr expression cassette can then be excised from pREP4 as a
Sal I fragment since Sal I sites closely flank the promoter and
polyA addition site. Using oligonucleotide linkers this Sal I
fragment can be cloned into the unique Bgl II site of pCDNA3.1,
creating pCDNA3.1(+)::dhfr.sup.+. DNA encoding the IgG fusion
protein or mutimeric cytokine/growth factor can subsequently be
cloned into the polylinker region of this pCDNA3.1(+) derivative
under the control of the CMV promoter. For example, the EPO-IgG1-Fc
or G-CSF-IgG1-Fc genes could be excised from plasmids pBBT180 and
pBBT174, respectively as Hind III-Xba I fragments and cloned into
Hind III-Xba I-cut pCDNA3.1(+)::dhfr.sup.+. Other unique
restriction enzyme sites can be used if these restriction enzyme
sites are present in the genes of interest. Alternatively,
co-transfection of pCDNA3.1(+)::dhfr.sup.+ and pCDNA3.1 derivatives
expressing the IgG fusion proteins or mutimeric cytokines/growth
factors could be employed to obtain dhfr.sup.+ CHO cell lines
expressing the protein of interest (Kaufmann, 1990).
[0172] Endotoxin free plasmid DNAs are preferred for transfecting
mammalian cells such as COS or dhfr.sup.- CHO cells. Dhfr.sup.- CHO
cell lines can be obtained from a number of sources such as Dr. L.
Chasin at Columbia University (CHO K1 DUKX B11) or from the
American Type Culture Collection (CHO duk.sup.-, ATCC No.
CRL-9096). The cells can be cultured in F12/DMEM medium
supplemented with 10% FBS, glutamine, glycine, hypoxanthine, and
thymidine (Lucas et al., 1996). Transfections can be carried out by
electroporation or by using transfection reagents well known to
those of skill in the art such as LipofectAMINE (Gibco BRL), using
the vendor protocols and/or those described in the literature
(Kaufman, 1990). One can select for dhfr.sup.+ transfectants in
F12/DMEM supplemented with 7% dialyzed FCS and lacking glutamine,
glycine, hypoxanthine, and thymidine (Lucas et al., 1996).
Alternatively one can select for G418 resistance (encoded by the
NPT gene of pCDNA3.1) and subsequently screen transfectants for the
dhfr.sup.+ phenotype. Dhfr.sup.+ clones can be expanded in
selection medium and culture supernatants screened for expression
of the IgG fusion proteins or multimeric cytokines/growth factors
using commercially available ELISA kits specific for the growth
factor or cytokine (available from R & D Systems, Endogen, Inc.
and Diagnostic Systems Laboratories) or by Western blot using
appropriate antisera (available from R&D Systems, Endogen, Inc.
and Diagnostic Systems Laboratories). Clones expressing the IgG
fusion proteins or mutimeric cytokines/growth factors can then be
pooled and subjected to multiple rounds of selection for MTX
resistance at increasing drug concentration as described by Kaufman
(1990). After each round of MTX selection, individual clones can be
tested for expression of the IgG fusion proteins or mutimeric
cytokines/growth factors. These procedures are well described in
the literature and have been used to express a variety of
heterologous protein in CHO cells (reviewed in Kaufman, 1990).
[0173] The IgG fusion proteins can be purified from the conditioned
medium of CHO cells. After removal of the CHO cells by
centrifugation, the IgG fusion proteins can be purified from the
supernatant by Protein A affinity column chromatography using
protocols similar to those described in Example 2, followed by
additional chromatgraphy steps as needed. Dimeric IgG-Fc and
IgG-C.sub.H fusions can be purified further by size-exclusion
chromatography to remove monomers and aggregates. Additional column
chromatography steps could include Blue Sepharose, hydroxyapatite,
reversed phase, hydrophobic interaction, and ion-exchange
chromatography. These techniques are well known to those of skill
in the art.
[0174] Mutimeric cytokines/growth factors and cytokine/growth
factor-light chain constant region fusions also can be purified
from the conditioned medium of CHO cells. After removal of the CHO
cells by centrifugation, the mutimeric cytokines/growth factors and
cytokine/growth factor-light chain constant region fusions can be
purified from the supernatant by column chromatography using
techniques well known to those of skill in the art. These column
chromatography steps could include Blue Sepharose, hydroxyapatite,
reversed phase, hydrophobic interaction, size exclusion and
ion-exchange chromatography. The proteins also can be purified by
affinity chromatography using monoclonal antibodies specific for
the cytokine/growth factor or light chain constant region.
REFERENCES
[0175] Aggarwal, B. B. (1998) Human Cytokines. Handbook for Basic
and Clinical Research. Volume III. Blackwell Science, Malden, Mass.
[0176] Aggarwal, B. B. and Gutterman, J. U. (1992) Human Cytokines.
Handbook for Basic and Clinical Research. Volume I. Blackwell
Science, Malden, Mass. [0177] Aggarwal, B. B. and Gutterman, J. U.
(1996) Human Cytokines. Handbook for Basic and Clinical Research.
Volume II. Blackwell Science, Malden, Mass. [0178] Alt, F. W.,
Kellems, R. E., Bertino, J. R., and Schimke, R. T. (1978) J. Biol.
Chem. 253:1357-1370. [0179] Avanzi, G. C., Lista, P., Giovinazzo,
B., Miniero, R., Saglio, G., Benetton, G., Coda, R., Cattoretti, G.
and Pegorara, L. (1988) Br. J. Haematology 69: 359-356. [0180]
Baldwin, M. D., Zhou, X. J., Ing, T. S. and Vaziri, N. D. (1998)
ASAIO J. 44: 44-47. [0181] Balkwill, F. R., Goldstein, L. and
Stebbing, N. (1985) Int. J. Cancer 35: 613-617. [0182] Balkwill, F.
R. (1986) Methods Enzymology 119: 649-657. [0183] Bartley, T. D.,
Bogenberger, J., Hunt, P., Li, Y.-S., et al. (1994) Cell 77:
1117-1124. [0184] Bazan, F. (1990) Immunology Today 11: 350-354.
[0185] Bazan, J. F. (1991) Cell 65: 9-10. [0186] Bazan, J. F.
(1992) Science 257: 410-411. [0187] Blatt, L. M., Davis, J. M.,
Klein, S. B. and Taylor, M. W. (1996) J. Interferon and Cytokine
Research 16: 489-499. [0188] Boissel, J.-P., Lee, W.-R., Presnell,
S. R., Cohen, F. E. and Bunn, H. F. (1993) J. Biol. Chem. 268:
15983-15993. [0189] Cantrell, M. A., Anderson, D. and Cerretti, D.
P (1985) Proc. Natl. Acad. Sci. USA 82: 6250-6254. [0190] Capon, D.
J., Chamow, S. C., Mordenti, J., Marsters, S. A., Gregory, T.,
Mitsuya, H., Byrn, R. A., Lucas, C., Wurm, F. M., Groopman, J. E.,
Broder, S. and Smith, D. H. (1989) Nature 337: 525-531. [0191]
Chamow, S. M. and Ashkenazi, A. (1996) Trends in Biotech. 14:
52-60. [0192] Chen, T. T., Tao, and Levy, R. (1994) J. Immunology
153: 4775-4787. [0193] Clark, R., Olson, K., Fuh, G., Marian, M.,
Mortensen, D., Teshima, G., Chang, S., Chu, H., Mukku, V.,
Canova-Davis, E., Somers, T., Cronin, M., Winkler, M. and Wells, J.
A. (1996) J. Biol. Chem. 271: 21969-21977. [0194] Cox, G. N. and
McDermott, M. J. (1994) WO 9412219. [0195] Cox, G. N., McDermott,
M. J., Merkel, E., Stroh, C. A., Ko, S. C., Squires, C. H.,
Gleason, T. M. and Russell, D. (1994) Endocrinology 135: 1913-1920.
[0196] Crouse, G. F., McEwan, R. N., and Pearson, M. L. (1983) Mol.
Cell. Biol. 3:257-266. [0197] Dangl, J. L., Wensel, T. G.,
Morrison, S. L., Stryer, L., Herzenberg, L. A. and Oi, V. T. (1988)
EMBO J. 7: 1989-1994. [0198] DeNoto, F. M., Moore, D. D. and
Goodman, H. M. (1981) Nucleic Acids Research 9: 3719-3730. [0199]
Derynnck, R., Content, J., DeClercq, E., Volckaert, G., Tavernier,
J. DeVos, R. and Fiers, W. (1980) Nature 285: 542-547. [0200] de
Sauvage, F. J., Hass, P. E., Spencer, S. D., Malloy, B. E. et al.
(1994) Nature 369: 589-596. [0201] Dikov, M. M., Reich, M. B.,
Dworkin, L., Thomas, J. W., and Miller, G. G. (1998) J. Biol. Chem.
273: 15811-15817. [0202] Donahue, R. E., Wang E. A., Stone, D. K.,
Kamen, R., Wong, G. G., Sehgal, P. K., Nathan, D. G. and Clark, S.
C. (1986a) Nature 321:872-5 [0203] Donahue, R. E., Wang, E. A.,
Kaufaman, R. J., Foutch, L., Leary, A. C. and Witek-Giannetti, J.
S. (1986b) Cold Spring Harbor Symp. Quant. Biol. 51: 685-692.
[0204] Elliot, S. G. and Byrne, T. E. (1995) European Patent
Application #94112732.6 [0205] Ellison, J., Buxbaum, J. and Hood,
L. (1991) DNA 1: 11-18. [0206] Ellison, J. W., Berson, B. J. and
Hood, L. E. (1982) Nucleic Acids Research 10: 4071-4079. [0207]
Evinger, M. and Pestka, S. (1981) Methods Enzymology 79: 362-368.
[0208] Foster, D. C., Sprecher, C. A., Grant, F. J., Kramer, J. M
et al. (1994) Proc. Natl. Acad. Sci. USA 91: 13023-13027. [0209]
Gamba-Vitalo, C., DiGiovanna, M. P., and Sartorelli, A. C. (1991)
Blood Cells 17:193-205. [0210] Geisse, S., Gram, H., Kleuser, B.
and Kocher, H. P. (1996) Prot. Express. Purif. 8:271-282. [0211]
Gillies, S. D., Young, D., Lo, K.-M. and Roberts, S. (1993)
Bioconjugate Chem. 4: 230-235. [0212] Gray, P. W., Leung, D. W.,
Pennica, D., Yelverton, E., Najarian, R., Simonsen, C. C., Derynck,
R., Sherwood, P. J., Wallace, D. M., Berger, S. L., Levinson, A. D.
and Goeddel, D. V. (1982) Nature 295: 503-508. [0213] Greenspan, F.
S., Li., C. H., Simpson, M. E. and Evans, H. M. (1949)
Endocrinology 45:455-463. [0214] Gough, N. M., Metcalf, D., Gough,
J., Grail, D. and Dunn, A. R. (1985) EMBO J. 4: 645-53. [0215]
Gough, N. M., Gough, J., Metcalf, D., Kelso, A., Grail, D., Nicola,
N. A., Burgess, A. W. and Dunn, A. R. (1984) Nature 309:763-7.
[0216] Hangcoc, G., Yin, T., Cooper, S., Schendel, P., Yang, Y.-C.
and Broxmeyer, H. E. (1993) Blood 81: 965-972. [0217] Hannum, C.,
Culpepper, J., Campbell, D., McClanahan, T., Zurawski, S. et al.
(1994) Nature 368: 643-648 [0218] Hanzazono, Y., Hosoi, T., Kuwaki,
T., Matsuki, S., Miyazono, K., Miyagawa, K., and Takaku, F. (1990)
Exp. Hematol. 18: 1097-1103. [0219] Henco, K., Brosius, J.,
Fujisawa, A., Fujisawa, J.-I., Haynes, J. R., Hochstadt, J.,
Kovacic, T., Pasek, M., Schambock, A., Schmid, J., Todokoro, K.,
Walchli, M., Nagata, S. and Weissman, C. (1985) J. Mol. Biol. 185:
227-260. [0220] Hieter, P. Max, E. Seidman, J. Maizel, J and Leder,
P. (1980) Cell 22: 197-207. [0221] Horisberger, M. A. and Di Marco,
S. (1995) Pharmac. Ther. 66: 507-534. [0222] Horoszewicz, J. S.,
Leong, S. S. and Carter, W. A. (1979) Science 206: 1091-1093.
[0223] Horton, R. M. (1993) in "Methods in Molecular Biology",
White, B. A., ed. (Humana Press, Totawa, N.J.) 15:214-250. [0224]
Innis, M. A., Gelfand, D. H, Sninsky, J. J. and White, T. J. eds.
(1990) "PCR Protocols: A Guide to Methods and Applications"
(Academic Press, San Diego, Calif.). [0225] Isaacs, J. D.,
Greenwood, J. and Waldmann, H. (1998) J. Immunol. 161:3862-3869.
[0226] Johns, T. G., Mackay, I. R., Callister, K. A., Hertzog, P.
J., Devenish, R. J. and Linnane, A. W. (1992) J. Natl. Cancer
Institute 84: 1185-1190. [0227] Kajigaya, S., Suda, T., Suda, J.,
Saito, M., Miura, Y., Iizuka, M., Kobayashi, S., Minato, N. and
Sudo, T. (1986) J Exp Med 164:1102-13. [0228] Kang, S.-H., Na,
K.-H., Park, J.-H., Park, C.-I., Lee, S.-Y. and Lee, Y.-I. (1995)
Biotechnology Letters 17: 687-692. [0229] Kaufman, R. J. (1990)
Meth. Enzymol. 185:537-566. [0230] Kasbzubska, W., Zhang, H.,
Patterson, R. L., Suhar, T. S. et al., (2000) Protein Expression
and Purification 18: 213-220. [0231] Kaushansky, K., Lok, S.,
Holly, R. D. et al., (1994) Nature 369: 568-571. [0232] Knauf, M.
J., Bell, D. P., Hirtzer, P., Luo, Z.-P., Young, J. D., and Katres,
N. V. (1988) J. Biol. Chem. 263:15064-15070. [0233] Kozak, M.
(1991) J. Biol. Chem. 266: 19867-19870. [0234] Kubota, N., Orita,
T., Hattori, K., Oh-eda, M., Ochi, N. and Yamazaki, T. (1990) J.
Biochem. 107: 486-492. [0235] Kuga, T., Komatsu, Y., Yamasaki, M.,
De4kine, S., Miyaji, H., Nishi, T., Sato, M., Yokoo, Y., Asano, M.,
Okabe, M., Morimoto, M. and Itoh, S. (1989) Bioch. Biophys. Res.
Comm. 159: 103-111. [0236] Landolphi, N. F. (1991) J. immunology
146: 915-919. [0237] Landolfi, N. F. (1994) U.S. Pat. No.
5,349,053. [0238] LaRochelle, W. J., Dirsch, O. R., Finch, P. W.,
Cheon, H.-G., May M., Marchese, C., Pierce, J. H. and Aaronson, S.
A. (1995) J. Cell Biol. 129: 357-366. [0239] Leonard, J. P.,
Quinto, C. M., Kozitza, M. K., Neben, T. Y. and Goldman, S. J.
(1994) Blood 83: 1499-1506. [0240] Lewis, J. A. (1987) Chapter 6.
Lymphokines and Interferons: A Practical approach. Eds: Clemens, M.
J., Morris, A. G. and Gearing, A. J. H., IRL Press Ltd., Oxford,
England. [0241] Lewis, J. A. (1995) Chapter 9: Antiviral activity
of cytokines. pp. 129-141. [0242] Lin, F.-K., Suggs, S., Lin,
C.-H., Browne, J. K., Smalling, R., Egrie, J. C., Chen, K. K., Fox,
G. M., Martin, F., Stabinsky, Z., Badrawi, S. M., Lai, P.-H. and
Goldwasser, E. (1985) Proc. Natl. Acad. Sci. USA 82: 7580-7584.
[0243] Lindner, D. J. and Borden, E. C. (1997) J. Interferon and
Cytokine Research 17:681-693. [0244] Linsley, P. S., Brady, W.,
Grosmaire, L., Aruffo, A., Damle, N. K. and Ledbetter, J. A.
(1991a) J. Exp. Med. 173: 721-730. [0245] Linsley, P. S., Brady,
W., Umes, M., Grosmaire, L. S., Damle, N. K. and Ledbetter, J. A.
(1991b) J. Exp. Med. 174:561-569. [0246] Lok, S., Kaushansky, K.,
Holly, R. D., et al. (1994) Nature 369: 565-568. [0247] Lu, H. S.,
Clogston, C. L., Narhi, L. O., Merewether, L. A., Pearl, W. R. and
Boone, T. C. (1992) J. Biol. Chem. 267: 8770-8777. [0248] Lu,
Z.-Y., zhang, X.-G., Gu, Z.-J., Yazukawa, K., Amiot, M., Etrillard,
M., Bataille, R. and Klein, B. (1994) J. Immunol. Methods 173:
19026. [0249] Lucas, B. K., Giere, L. M., DeMarco, M. A., Shen, A.,
Chisolm, V., and Crowley, C. W. (1996) Nucleic Acids Res.
24:1774-1779. [0250] Lyman, S. D., James, L., Vanden Bos, T., de
Vries, P. et al. (1993) Cell 1157-1167. [0251] Mahmood, I. (1998)
Life Sciences 63:2365-2371. [0252] Mark, D. F., Lu, S. D., Creasey,
A. A., Yamamoto, R. and Lin, L. S. (1984) Proc. Natl. Acad. Sci.
81: 5662-5666. [0253] Martial, J. A., Hallewell, R. A., Baxter, J.
D. and Goodman, H. M. (1979) Science 205: 602-607. [0254] Martin,
F. H., Suggs, S. V., Langley, K. E., Lu, H. S., Ting, J., Okino, K.
H., Morris, F. C., McNiece, I. K., Jacobsen, F. W., Mendiaz, E. A.,
Birkett, N. C. et al., (1990) Cell 63: 203-211. [0255] Matsumoto,
T., Endoh, K., Kamisango, K., Akamatsu, K., Koizumi, K., Higuchi,
M., Imai, N., Misui, H. and Kawaguchi, T. (1990) Br. J. Haematol.
75: 463-468. [0256] Mayer, P., Lam, C., Obenaus, H., Liehl, E., and
Besemer, J. (1987a) Ann N Y Acad Sci 511:17-29. [0257] Mayer, P.,
Lam, C., Obenaus, H., Liehl, E., and Besemer, J. (1987b) Blood
70:206-13. [0258] Mayer, P., Schutz, E., Lam, C., Kricek, F., and
Liehl, E. (1991) J. Infect. Dis. 163:584-590. [0259] Mayer, P.,
Werner, F., Lam, C., and Besemer, J. (1990) Exp. Hematol.
18:1026-1033. [0260] McKinley, D., Wu, Q., Yang-Feng, T. and Yang,
Y.-C. (1992) Genomics 13: 814-819. [0261] Mohler, K. M., Torrance,
D. S., Smith, C. A., Goodwin, R. G., Stremler, K. E., Fung, V. P.,
Madani, H. and Widmer, M. B. (1993) J. Immunology 151: 1548-1561.
[0262] Morenti, J., Chen, S. A. Moore, J. A., Frerraiolo, B. L. and
Green J. D. (1991) Pharm Res. 8:1351-1359. [0263] Morton, P. A.,
Fu., X.-T., Stewart, J. A., Giacoletto, K. S., White, S. L.,
Leysath, S. E., Evans, R. J., [0264] Shieh, J.-J. and Karr, R. W.
(1996) J. Immunology 156: 1047-1054. [0265] Mott, H. R. and
Campbell, I. D. (1995) Current Opinion in Structural Biology 5:
114-121. [0266] Nagata, S. (1994) in Cytokines and Their Receptors,
N. A. Nicola ed., Oxford University Press, Oxford, pp. 158-160.
[0267] Nagata, S., Tsuchiya; M., Asano, S., Kziro, Y., Yamazaki,
T., Yamamoto, O., Hirata, Y., Kubota, N., Oh-eda, M., Nomura, H.
and Ono, M. (1986a) Nature 319: 415-418. [0268] Nagata, S.,
Tsuchiya, M., Asano, S., Yamamoto, O., Hirata, Y., Kubota, N.,
Oh-eda, M., Nomura, H. and Yamazaki, T. (1986b) EMBO J. 5: 575-581.
[0269] Neben, T. Y., Loebelenz, J., Hayes, L., McCarthy, K.,
Stoudmire, J., Schaub, R. and Goldman, S. J. (1993) Blood
81:901-908. [0270] Oi, V. T., Vuong, T. M., Hardy, R., Reidler, J.,
Dangl, J., Herzenberg, L. A. and Stryer, L. (1984) Nature 307:
136-140. [0271] Okabe, M., Asano, M., Kuga, T., Komatsu, Y.,
Yamasaki, M., Yokoo, Y., Itoh, S., Morimoto, M and Oka, T. (1990)
Blood 75: 1788-1793. [0272] Ozes, O. S., Reiter, Z., Klein, S.,
Blatt, L. M. and Taylor, M. W. (1992) J. Interferon Research 12:
55-59. [0273] Qiu, H., Belanger, A., Yoon, H.-W. P. and Bunn, H. F.
(1998) J. Biol. Chem. 273: 11179-11176. [0274] Richter, W. F.,
Gallati, H., Schiller, C. (1999) Drug Metabolism and Disposition
27: 21-25 [0275] Roitt, I., Brostoff, J. and Male, D. eds. (1989)
"Immunology" (Gower Medical Publishing, London, U.K.; New York,
N.Y.) [0276] Roskam, W. G. and Rougeon, F. (1979) Nucleic Acids
Research 7: 305-320. [0277] Rowlinson, S. W. Barnard, R., Bastiras,
S., Robins, A. J., Brinkworth, R. and Waters, M. J. (1995) J. Biol.
Chem. 270: 16833-16839. [0278] Schuening, F. G., Storb, R., Goehle,
S., Nash, R., Graham, T. C., Appelbaum, F. R., Hackman, R.,
Sandmaier, B. M., and Urdal, D. L. (1989) Exp. Hematol. 17:889-894.
[0279] Seeburg, P. H. (1982) DNA 1: 239-249. [0280] Shin, S.-U.,
and Morrison, S. L. (1990) Proc. Natl. Acad. Sci. USA 87:
5322-5326. [0281] Silvennoinen, O. and Ihle, J. N. (1996)
Signalling by Hematopoietic Cytokine Receptors, R.G. Landes
Company, Austin, Tex. [0282] Sohma, Y., Akahori, H., Seki, N.,
Hori, T., Ogami, K., Kato, T., Shimada, Y., Kawamura, K. and
Miyaki, H. (1994) FEBS Letters 353: 57-61. [0283] Souza, L. M.,
Boone, T. C., Gabrilove, J., Lai, P. H., Zsebo, K. M., Murdock, D.
C., Chazin, V. R., Bruszewski, J., Lu, H., Chen, K. K., Barendt,
J., Platzer, E., Moore, M. A. S., Mertelsmann, R. and Welte, K.
(1986) Science 232: 61-65. [0284] Stewart, J. D., Lee, I., Posner,
B. A. and Benkovic, S. J. (1995) Meth. Enzymol. 249:507-519. [0285]
Steurer, W., Nickerson, P. W., Steele, A. W., Steiger, J., Zheng,
X. X. and Strom, T. B. (1995) J. Immunology 155: 1165-1174. [0286]
Sytkowski, A. J., Lunn, E. D. Davis, K. L. Feldman, L. and Siekman,
S. (1998) PNAS 95:1184-1188. [0287] Trill, J. J., Shatzman, A. R.,
and Ganguly, S. (1995) Curr. Opin. Biotechnol. 6:553-560. [0288]
Urlaub, G. and Chasin, L. A. (1980) Proc. Natl. Acad. Sci. USA
77:4216-4220. [0289] Vaziri, N. D., Zhou, X. J., and Liao, S. Y.
(1994) Am. J. Physiol. 266: F360-366. [0290] Wang, G. L. and
Semenza, G. L. (1993) Blood: 82: 3610-3615. [0291] Weinstein, Y.,
Ihle, J. N., Lavus, S. and Reddy, E. P. (1986) PNAS 83: 5010-5014.
[0292] Weiss, A., Wiskocil, R. L. and Stobo, J. D. (1984) J.
Immunology 133: 123-128. [0293] Wisckocil, R., Weiss, A., Imboden,
J., Kamin-Lewis, R. a. and Stobo, J. (1985) J. Immunology 134:
1599-1603. [0294] Yonemura, Y., Kawakita, M., Masuda, T., Fujimoto,
K., and Takatsuki, K. (1993) Br. J. Haematol 84: 16-23. [0295]
Zeng, X. X., Steele, A. W., Nickerson, P. W., Steurer, W., Steiger,
J. and Strom, T. B. (1995) J. Immunology 154:5590-5600. [0296]
Kitamura, T., Tange, T., Terasawa, T., Chiba, S., Kuwaki, T.,
Miyagawa, K., Piao, Y. F., Miyazono, K., Urabe, A. and Takaku, F.
(1989) J. Cell. Physiol. 140:323-334.
[0297] While various embodiments of the present invention have been
described in detail, it is apparent that modifications and
adaptations of those embodiments will occur to those skilled in the
art. It is to be expressly understood, however, that such
modifications and adaptations are within the scope of the present
invention.
Sequence CWU 1
1
8714PRTArtificial sequencePEPTIDE(1)..(4)linker 1Ser Gly Gly
Ser125PRTArtificial sequencePEPTIDE(1)..(5)linker 2Gly Ser Gly Gly
Ser1 537PRTArtificial sequencePEPTIDE(1)..(7)linker 3Ser Gly Gly
Ser Gly Gly Ser1 5435DNAArtificial
sequencemisc_feature(1)..(35)primer 4gcaagcttgc caccatggct
acaggctccc ggacg 35536DNAArtificial
sequencemisc_feature(1)..(36)primer 5cgcggatcct ccggagaagc
cacagctgcc ctccac 36631DNAArtificial
sequencemisc_feature(1)..(31)primer 6cccggatcca tgggggtgca
cgaatgtcct g 31731DNAArtificial sequencemisc_feature(1)..(31)primer
7cccgaattct atgcccaggt ggacacacct g 31836DNAArtificial
sequencemisc_feature(1)..(36)primer 8cgcaagcttg ccaccatggg
ggtgcacgaa tgtcct 36936DNAArtificial
sequencemisc_feature(1)..(36)primer 9cgcggatcct ccggatctgt
cccctgtcct gcaggc 361039DNAArtificial
sequencemisc_feature(1)..(39)primer 10cgcggatcct ccggatctgt
cccctgtcct gcaggcctc 391136DNAArtificial
sequencemisc_feature(1)..(36)primer 11cgcaagcttg ccaccatggc
tggacctgcc acccag 361236DNAArtificial
sequencemisc_feature(1)..(36)primer 12cgcggatcct ccggagggct
gggcaaggtg gcgtag 361342DNAArtificial
sequencemisc_feature(1)..(42)primer 13cgcggatccg gtggctcaga
gcccaaatct tgtgacaaaa ct 421430DNAArtificial
sequencemisc_feature(1)..(30)primer 14cgctctagag gtacgtgcca
agcatcctcg 301542DNAArtificial sequencemisc_feature(1)..(42)primer
15cgcggatccg gtggctcaga gtccaaatat ggtcccccat gc
421638DNAArtificial sequencemisc_feature(1)..(38)primer
16cgcggatccg gtggctcagc ctccaccaag ggcccatc 381766DNAArtificial
sequencemisc_feature(1)..(66)primer 17tccaccaagg gcccatccgt
cttccccctg gcgccctgct ccaggagcac ctccgagagc 60acagcc
661866DNAArtificial sequencemisc_feature(1)..(66)primer
18tctcttgtcc accttggtgt tgctgggctt gtgatctacg ttgcaggtgt aggtcttcgt
60gcccaa 661939DNAArtificial sequencemisc_feature(1)..(39)primer
19tgggggacca tatttggact caactctctt gtccacctt 392027DNAArtificial
sequencemisc_feature(1)..(27)primer 20ttcctgctca agtccttaga gcaagtg
272127DNAArtificial sequencemisc_feature(1)..(27)primer
21cacttgctct aaggacttga gcaggaa 272236DNAArtificial
sequencemisc_feature(1)..(36)primer 22aggacagggg acagagagcc
caaatcttgt gacaaa 362336DNAArtificial
sequencemisc_feature(1)..(36)primer 23acaagatttg ggctctctgt
cccctgtcct gcaggc 362436DNAArtificial
sequencemisc_feature(1)..(36)primer 24aggacagggg acagagagtc
caaatatggt ccccca 362536DNAArtificial
sequencemisc_feature(1)..(36)primer 25accatatttg gactctctgt
cccctgtcct gcaggc 362636DNAArtificial
sequencemisc_feature(1)..(36)primer 26tgcaggacag gggacgagcc
caaatcttgt gacaaa 362736DNAArtificial
sequencemisc_feature(1)..(36)primer 27acaagatttg ggctcgtccc
ctgtcctgca ggcctc 362836DNAArtificial
sequencemisc_feature(1)..(36)primer 28tgcaggacag gggacgagtc
caaatatggt ccccca 362936DNAArtificial
sequencemisc_feature(1)..(36)primer 29accatatttg gactcgtccc
ctgtcctgca ggcctc 363036DNAArtificial
sequencemisc_feature(1)..(36)primer 30caccttgccc agcccgagcc
caaatcttgt gacaaa 363136DNAArtificial
sequencemisc_feature(1)..(36)primer 31acaagatttg ggctcgggct
gggcaaggtg gcgtag 363236DNAArtificial
sequencemisc_feature(1)..(36)primer 32caccttgccc agcccgagtc
caaatatggt ccccca 363336DNAArtificial
sequencemisc_feature(1)..(36)primer 33accatatttg gactcgggct
gggcaaggtg gcgtag 363434DNAArtificial
sequencemisc_feature(1)..(34)primer 34cgcgaattcc ggagagccca
aatcttgtga caaa 343530DNAArtificial
sequencemisc_feature(1)..(30)primer 35cgcggatccg agcccaaatc
ttgtgacaaa 303634DNAArtificial sequencemisc_feature(1)..(34)primer
36cgcgaattcc ggagagtcca aatatggtcc ccca 343730DNAArtificial
sequencemisc_feature(1)..(30)primer 37cgcggatccg agtccaaata
tggtccccca 303863DNAArtificial sequencemisc_feature(1)..(63)primer
38gcttttggcc tgctctgcct gccctggctt caagagggca gtgccactgt ggctgcacca
60tct 633930DNAArtificial sequencemisc_feature(1)..(30)primer
39cgctctagac taacactctc ccctgttgaa 304066DNAArtificial
sequencemisc_feature(1)..(66)primer 40cgcaagcttg ccaccatggc
tacaggctcc cggacgtccc tgctcctggc ttttggcctg 60ctctgc
664138DNAArtificial sequencemisc_feature(1)..(38)primer
41cgcggatccg gtggctcaac tgtggctgca ccatctgt 384230DNAArtificial
sequencemisc_feature(1)..(30)primer 42cgctctagac taacactctc
ccctgttgaa 304315PRTArtificial sequencePEPTIDE(1)..(15)linker 43Ser
Gly Gly Ser Gly Gly Ser Asp Tyr Lys Asp Asp Asp Asp Lys1 5 10
154433DNAArtificial sequencemisc_feature(1)..(33)primer
44cgcgaattcg gatatgtaaa tagatacaca gtg 334533DNAArtificial
sequencemisc_feature(1)..(33)primer 45cgcaagctta aaagatttaa
atcgtgtcat ggt 334636DNAArtificial
sequencemisc_feature(1)..(36)primer 46cgcaagcttg ccaccatggc
cttgaccttt gcttta 364736DNAArtificial
sequencemisc_feature(1)..(36)primer 47cgcggatcct ccggattcct
tacttcttaa actttc 364836DNAArtificial
sequencemisc_feature(1)..(36)primer 48cgcaagcttg ccaccatgac
caacaagtgt ctcctc 364936DNAArtificial
sequencemisc_feature(1)..(36)primer 49cgcggatcct ccggagtttc
ggaggtaacc tgtaag 365036DNAArtificial
sequencemisc_feature(1)..(36)primer 50cgcaagcttg ccaccatgaa
atatacaagt tatatc 365136DNAArtificial
sequencemisc_feature(1)..(36)primer 51cgcggatcct ccggactggg
atgctcttcg accttg 365236DNAArtificial
sequencemisc_feature(1)..(36)primer 52cgcaagcttg ccaccatgaa
ctgtgtttgc cgcctg 365336DNAArtificial
sequencemisc_feature(1)..(36)primer 53cgcggatcct ccggacagcc
gagtcttcag cagcag 365436DNAArtificial
sequencemisc_feature(1)..(36)primer 54cgcaagcttg ccaccatgaa
ctgtgtttgc cgcctg 365530DNAArtificial
sequencemisc_feature(1)..(30)primer 55gcgggacatc aggagctgca
gccggcgcag 305627DNAArtificial sequencemisc_feature(1)..(27)primer
56cagctcctga tgtcccgcct ggccctg 275727DNAArtificial
sequencemisc_feature(1)..(27)primer 57agtcttcagc agcagcagtc ccctcac
275836DNAArtificial sequencemisc_feature(1)..(36)primer
58cgcggatcct ccggacagcc gagtcttcag cagcag 365936DNAArtificial
sequencemisc_feature(1)..(36)primer 59ctgaagactc ggctggagcc
caaatcttgt gacaaa 366036DNAArtificial
sequencemisc_feature(1)..(36)primer 60acaagatttg ggctccagcc
gagtcttcag cagcag 366136DNAArtificial
sequencemisc_feature(1)..(36)primer 61ctgaagactc ggctggagtc
caaatatggt ccccca 366236DNAArtificial
sequencemisc_feature(1)..(36)primer 62accatatttg gactccagcc
gagtcttcag cagcag 366336DNAArtificial
sequencemisc_feature(1)..(36)primer 63cgcaagcttg ccaccatgga
gctgactgaa ttgctc 366436DNAArtificial
sequencemisc_feature(1)..(36)primer 64cgcggatcct ccggaccctt
cctgagacag attctg 366536DNAArtificial
sequencemisc_feature(1)..(36)primer 65cgcggatcct ccggacctga
cgcagagggt ggaccc 366636DNAArtificial
sequencemisc_feature(1)..(36)primer 66ctgtctcagg aaggggagcc
caaatcttgt gacaaa 366736DNAArtificial
sequencemisc_feature(1)..(36)primer 67acaagatttg ggctcccctt
cctgagacag attctg 366836DNAArtificial
sequencemisc_feature(1)..(36)primer 68ctgtctcagg aaggggagtc
caaatatggt ccccca 366936DNAArtificial
sequencemisc_feature(1)..(36)primer 69accatatttg gactcccctt
cctgagacag attctg 367036DNAArtificial
sequencemisc_feature(1)..(36)primer 70cgcaagcttg ccaccatgtg
gctgcagagc ctgctg 367136DNAArtificial
sequencemisc_feature(1)..(36)primer 71cgcggatcct ccggactcct
ggactggctc ccagca 367236DNAArtificial
sequencemisc_feature(1)..(36)primer 72gagccagtcc aggaggagcc
caaatcttgt gacaaa 367336DNAArtificial
sequencemisc_feature(1)..(36)primer 73acaagatttg ggctcctcct
ggactggctc ccagca 367436DNAArtificial
sequencemisc_feature(1)..(36)primer 74gagccagtcc aggaggagtc
caaatatggt ccccca 367536DNAArtificial
sequencemisc_feature(1)..(36)primer 75accatatttg gactcctcct
ggactggctc ccagca 367633DNAArtificial
sequencemisc_feature(1)..(33)primer 76cgcaagcttg ccaccatgaa
gaagacacaa act 337736DNAArtificial
sequencemisc_feature(1)..(36)primer 77cgcggatcct ccggagtgta
ggctggagtc tccagg 367836DNAArtificial
sequencemisc_feature(1)..(36)primer 78gactccagcc tacacgagcc
caaatcttgt gacaaa 367936DNAArtificial
sequencemisc_feature(1)..(36)primer 79acaagatttg ggctcgtgta
ggctggagtc tccagg 368036DNAArtificial
sequencemisc_feature(1)..(36)primer 80gactccagcc tacacgagtc
caaatatggt ccccca 368136DNAArtificial
sequencemisc_feature(1)..(36)primer 81accatatttg gactcgtgta
ggctggagtc tccagg 368236DNAArtificial
sequencemisc_feature(1)..(36)primer 82cgcaagcttg ccaccatgac
agtgctggcg ccagcc 368336DNAArtificial
sequencemisc_feature(1)..(36)primer 83cgcggatcct ccggaagggg
gctgcggggc tgtcgg 368436DNAArtificial
sequencemisc_feature(1)..(36)primer 84gccccgcagc cccctgagcc
caaatcttgt gacaaa 368536DNAArtificial
sequencemisc_feature(1)..(36)primer 85acaagatttg ggctcagggg
gctgcggggc tgtcgg 368636DNAArtificial
sequencemisc_feature(1)..(36)primer 86gccccgcagc cccctgagtc
caaatatggt ccccca 368736DNAArtificial
sequencemisc_feature(1)..(36)primer 87accatatttg gactcagggg
gctgcggggc tgtcgg 36
* * * * *