U.S. patent application number 12/580194 was filed with the patent office on 2010-11-04 for method for detection of melanoma.
This patent application is currently assigned to DermTech International. Invention is credited to Thomas Vogt.
Application Number | 20100279877 12/580194 |
Document ID | / |
Family ID | 23167380 |
Filed Date | 2010-11-04 |
United States Patent
Application |
20100279877 |
Kind Code |
A1 |
Vogt; Thomas |
November 4, 2010 |
Method for Detection of Melanoma
Abstract
The present invention provides non-invasive methods for
detecting, monitoring, staging, and diagnosing malignant melanoma
in a skin sample of a subject. The methods include analyzing
expression in skin sample of one or more melanoma skin markers. The
melanoma skin markers include IL-1 RI, endothelin-2, ephrin-A5, IGF
Binding Protein 7, HLA-A0202 heavy chain, Activin A (.beta.A
subunit), TNF RII, SPC4, and CNTF R.alpha.. The skin sample can
include nucleic acids, and can be a human skin sample from a lesion
suspected of being melanoma.
Inventors: |
Vogt; Thomas;
(Pentling-Grossberg, DE) |
Correspondence
Address: |
DLA PIPER LLP (US)
4365 EXECUTIVE DRIVE, SUITE 1100
SAN DIEGO
CA
92121-2133
US
|
Assignee: |
DermTech International
|
Family ID: |
23167380 |
Appl. No.: |
12/580194 |
Filed: |
October 15, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11940280 |
Nov 14, 2007 |
|
|
|
12580194 |
|
|
|
|
10184846 |
Jun 27, 2002 |
7297480 |
|
|
11940280 |
|
|
|
|
60302348 |
Jun 28, 2001 |
|
|
|
Current U.S.
Class: |
506/7 ;
435/6.14 |
Current CPC
Class: |
C12Q 2600/158 20130101;
G01N 33/5743 20130101; C12Q 1/6886 20130101; Y10S 435/912
20130101 |
Class at
Publication: |
506/7 ;
435/6 |
International
Class: |
C40B 30/00 20060101
C40B030/00; C12Q 1/68 20060101 C12Q001/68 |
Claims
1. A non-invasive method for detecting early stage melanoma in a
skin sample of a human subject, comprising: (a) obtaining a skin
sample by applying at least one application of an adhesive to the
skin of a human subject and removing the adhesive from the skin to
remove a skin sample comprising RNA; and (b) detecting the level of
RNA in the skin sample, wherein an increase in endothelin-2 RNA
level, as compared to the RNA level in a control sample, is
indicative of early stage melanoma, thereby detecting early stage
melanoma in the skin sample.
2. (canceled)
3. (canceled)
4. The method of claim 1, further comprising detecting the RNA
levels of IL1 RI, and ephrin-A5, wherein a decrease in the level of
IL-1 RI RNA, an increase in the level of endothelin-2 RNA or a
decrease in the level of ephrin-A5 RNA is indicative of early stage
melanoma.
5. The method of claim 1, further comprising detecting RNA levels
of one or more markers selected from IGF Binding Protein 7,
HLA-A0202 heavy chain, Activin A (.beta.A subunit), TNF RII, SPC4,
and CNTF R.alpha., wherein an increase in the RNA levels of the one
or more markers, as compared to the RNA levels in a control sample,
is indicative of melanoma.
6. (canceled)
7. The method of claim 1, wherein the sample is obtained in a
manner such that residual skin nucleic acid after removing the
adhesive is not affected.
8. The method of claim 1, wherein the skin sample is isolated by
applying the adhesive to the skin between one and two times to
obtain the skin sample.
9. The method of claim 1, wherein the adhesive comprises an
adhesive tape and the skin sample is isolated from a lesion
suspected to be melanoma.
10. (canceled)
11. The method of claim 1, further comprising analyzing expression
of one or more of the markers.
12. The method of claim 11, wherein the RNA comprises mRNA, and
expression is analyzed by analyzing mRNA levels of one or more of
the markers.
13. The method of claim 1, wherein expression of the markers is
analyzed by detecting polynucleotides encoding the markers.
14-18. (canceled)
19. A non-invasive method for monitoring the presence of melanoma
in a skin sample from a human subject, comprising: (a) obtaining a
first skin sample at a first time point by applying at least one
application of an adhesive to the skin of a human subject and
removing the adhesive from the skin to remove a skin sample
comprising RNA; (b) detecting RNA levels in the first skin sample
of the marker endothelin-2; (c) obtaining a second skin sample at a
second time point by applying at least one application of an
adhesive to the skin of said human subject and removing the
adhesive from the skin to remove a skin sample comprising RNA, (d)
detecting RNA levels in the second skin sample of the marker
endothelin-2; and (e) comparing the RNA level of endothelin-2 at
the first time point to the RNA level of endothelin-2 at the second
time point to thereby monitor the presence of melanoma in the human
subject, wherein an increase in the level of endothelin-2 RNA, as
compared to the RNA level in a control sample, is indicative of
early stage melanoma.
20. (canceled)
21. The method of claim 19, further comprising detecting the RNA
levels of IL 1 RI, and ephrin-A5, wherein an increase in the level
of endothelin-2 RNA, and a decrease in the level of IL-1 RI RNA or
a decrease in the level of ephrin-A5 RNA is indicative of early
stage melanoma.
22-24. (canceled)
25. The method of claim 19, further comprising detecting the RNA
levels of IL-1 RI, ephrin-A5, IGF Binding Protein 7, HLA-A0202
heavy chain, Activin A (.beta.A subunit), TNF RII, SPC4, and CNTF
R.alpha. in the nucleic acid sample, wherein an increase in the
level of SPC4 RNA and a decrease in the level of ephrin-A5 RNA is
indicative of early stage melanoma and an increase in the RNA
levels of IGF Binding Protein 7, HLA-A0202 heavy chain, Activin A
(.beta.A subunit), TNF RII, SPC4, and CNTF R.alpha. is indicative
of late stage melanoma.
26. A non-invasive method for staging malignant melanoma in a skin
sample of a human subject, comprising: a) obtaining a skin sample
by applying an adhesive surface to the skin of a human subject and
removing the adhesive surface from the skin such that a skin sample
comprising RNA in an amount sufficient for subsequent detection
adheres to the adhesive surface after its removal; and b) detecting
the level of endothelin-2 RNA in the skin sample, wherein an
increase in the level of endothelin-2 RNA, as compared to the RNA
level in a control sample, is indicative of early stage
melanoma.
27. The method of claim 26, wherein the sample is obtained in a
manner such that residual skin nucleic acid after removing the
adhesive is not affected, thereby obtaining a skin sample for use
in isolating or detecting RNA in a skin sample.
28. The method of claim 1, further comprising detecting RNA levels
of the markers IGF Binding Protein 7, HLA-A0202 heavy chain,
Activin A (.beta.A subunit), TNF RII, and CNTF R.alpha., wherein an
increase in the RNA levels of these markers, as compared to the RNA
levels in a control sample, is indicative of melanoma
29. The method of claim 5, wherein the RNA levels of the markers
are analyzed by applying the RNA to a microarray.
30. The method of claim 28, further comprising detecting the RNA
levels of the markers IL-1 RI and ephrin-A5, wherein a decrease in
the level of IL-1RI RNA or the level of ephrin-A5, as compared to
the RNA levels in a control sample, is indicative of early stage
melanoma.
31. The method of claim 19, wherein the skin sample is obtained in
a manner such that residual skin nucleic acid after removing the
adhesive is not affected, thereby obtaining a skin sample for use
in isolating or detecting RNA in a skin sample.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 11/940,280, which is a divisional application of U.S.
application Ser. No. 10/184,846 filed Jun. 27, 2002, now issued as
U.S. Pat. No. 7,297,480; which claims the benefit under 35 USC
.sctn.119(e) to U.S. Application Ser. No. 60/302,348 filed Jun. 28,
2001, now abandoned. The disclosure of each of the prior
applications is considered part of and is incorporated by reference
in the disclosure of this application.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] This invention relates to methods related to melanoma
patient for detecting expression of genes in a skin sample of the
epidermis related to malignant melanoma.
[0004] 2. Background Information
[0005] Malignant melanoma ranks second among adult cancers (behind
adult leukemia) in potential years of life lost. Each year, over
47,000 new cases are diagnosed, and the incidence of cutaneous
melanoma appears to be rising rapidly. Treatment of malignant
melanoma involves surgical excision of the primary lesion, and
vigilant monitoring to detect recurrence. Currently, there is no
approved therapy for patients having intermediate risk of relapse.
High-dose interferon, which can have serious side effects, is
approved for treatment of patients having high-risk melanoma. There
is no cure at this time for patients in whom metastasis to distant
sites has occurred.
[0006] Dermatologists recommend that early detection of melanoma is
the only way to reduce melanoma mortality by identifying curable
lesions (Weinstock, JAMA 284:886-889, 2000). In practice,
suspicious lesions are biopsied or excised, and examined by
histology. Clinical suspicion, however, largely depends on the
experience and the skills of the examining doctor. Very often the
number of nevi under suspicion by far exceeds the number of lesions
that could be removed. Erroneously excised lesions are costly for
the public and cause scars often in cosmetically important body
regions. A non-invasive molecular tool for diagnosis is therefore
desirable. Furthermore, even after a lesion is taken out
differentiation of benign melanocytic lesions from melanomas can be
very difficult in a subset of about 10-15%, even for skilled
dermatopathologists. If the diagnosis melanoma is made, tumor
thickness is among the most important factors to roughly evaluate
the prognosis of a melanoma patient (Breslow, Ann. Surg.
172:902-908, 1970). Molecular markers that could reflect the
prognosis more precisely have also not been established. In
addition, histological examination of cancer cells does not
adequately reflect the complicated series of molecular events
underlying the neoplastic process. Consequently, research efforts
are now being focused on molecular profiling of cancer cells using
DNA array technology, in which the activity of many genes or
proteins are studied in parallel. Molecular profiling of human
cancer has been recently reviewed (Liotta and Petricoin, Nature
Reviews/Genetics 1:48-56, 2000).
[0007] Several approaches have been taken to simplify the analysis
of gene expression profiles in tissue samples. Cell strains have
been cultured to focus on a specific cell of interest. For example,
some melanoma cell lines appear to accurately represent the
original primary material (Bittner et al 2000). However, cultured
cells lack the regulatory elements contributed by neighboring cells
that affect gene expression in vivo, such as cell-cell
communication molecules, soluble factors, and extracellular matrix
molecules.
[0008] More direct methods for gene expression profiling of
cellular subtypes include the global survey approach and
microdissection. In the global approach, the information content of
interacting cells is preserved by extracting RNA directly from a
heterogeneous piece of tissue. To normalize the data set for the
actual abundance of normal tissue, in relation to what is often
minor amounts of diseased tissue, a reference gene set is
constructed using RNA profiles extracted from a particular subtype
of cultured cells. Preservation of mRNA in tissue samples in the
clinical setting is challenging, since RNA is very labile and is
susceptible to abundant tissue RNases (Liotta and Petricoin, Nature
Reviews/Genetics 1:48-56, 2000).
[0009] An alternative approach, microdissection, utilizes
mechanical force or laser capture methods to select a cellular
subtype from a tissue sample, for subsequent molecular profiling.
Transition stages from normal cells through carcinoma in situ, to
invasive cancer can be identified microscopically, and profiled
with microdissection techniques to discover molecular events
occurring along the progression to malignancy. A disadvantage to
this approach is the level of expertise and instrumentation
required to select the pathological cells from the biopsied tissue
sample.
[0010] Therefore, there remains a need for effective methods to
detect malignant melanoma and to diagnose and stage melanoma from a
suspicious skin lesion.
SUMMARY OF THE INVENTION
[0011] The present specification discloses markers for early and
late stage malignant melanoma, and methods for detecting these
markers using non-invasive sampling procedures. Accordingly, the
present invention provides methods for detecting, staging,
monitoring, diagnosing, prognosing and assisting in the management
of malignant melanoma by analyzing a skin sample for gene
expression. For example, in one aspect, mRNAs of at least one of
IL-1 RI, endothelin-2, ephrin-A5, IGF Binding Protein 7, HLA-A0202
heavy chain, Activin A (.beta.A subunit), TNF RII, SPC4, and CNTF
R.alpha. are detected. In certain preferred embodiments, the skin
sample is a human skin sample from a lesion suspected of being
melanoma.
[0012] In one aspect, the present invention provides a non-invasive
method for detecting malignant melanoma in a skin sample of a
subject, typically a human subject. The method includes analyzing
expression in the skin sample, of one or more melanoma skin
markers. The melanoma skin markers include, but are not limited to,
IL-1 RI, endothelin-2, ephrin-A5, IGF Binding Protein 7, HLA-A0202
heavy chain, Activin A (.beta.A subunit), TNF RII, SPC4, and CNTF
R.alpha.. The melanoma skin markers exhibit different expression
levels in a skin sample at the site of a melanoma compared to
levels in a skin sample at the site of a benign lesion.
[0013] In one embodiment, the skin sample is obtained by applying
at least one application of an adhesive to the skin and removing
the adhesive from the skin, or scraping the skin with an instrument
to remove a sample comprising a nucleic acid from the skin.
Typically, nucleic acids, preferably ribonucleic acids (RNA), most
preferably messenger RNA (mRNA) from the skin sample are
analyzed.
[0014] In a preferred embodiment, the method includes analyzing
nucleic acids of the skin sample for expression levels of IL-1 RI,
endothelin-2, ephrin-A5, IGF Binding Protein 7, HLA-A0202 heavy
chain, Activin A (.beta.A subunit), TNF RII, SPC4, and CNTF
R.alpha.. In this embodiment, expression levels of the IL-1 RI,
endothelin-2, and ephrin-A5 are related to early stage melanoma,
and expression levels of IGF Binding Protein 7, HLA-A0202 heavy
chain, Activin A (.beta.A subunit), TNF RII, SPC4, and CNTF
R.alpha. are related to late stage melanoma. More particularly, an
increase in the expression levels of IGF Binding Protein 7,
HLA-A0202 heavy chain, Activin A (.beta.A subunit), TNF RII, SPC4,
and CNTF R.alpha. are related to late stage melanoma. Furthermore,
an increase in the expression levels of endothelin-2, and ephrin-A5
genes are related to early stage melanoma. Finally, a decrease in
levels of IL-1 RI are related to early stage melanoma.
[0015] In another aspect, the present invention provides a
non-invasive method for staging malignant melanoma in a subject
skin sample. The method includes analyzing expression in a nucleic
acid sample of one or more melanoma skin markers. The melanoma skin
markers include IL-1 RI, endothelin-2, ephrin-A5, IGF Binding
Protein 7, HLA-A0202 heavy chain, Activin A (.beta.A subunit), TNF
RII, SPC4, and CNTF R.alpha.. Expression of the melanoma skin
markers is related to melanoma.
[0016] In another aspect, the present invention provides a
non-invasive method for staging malignant melanoma in a skin sample
from a human subject. The method includes obtaining a skin sample
by applying an adhesive surface to the skin and removing the
adhesive surface from the skin such that a skin sample comprising
nucleic acid in an amount sufficient for subsequent detection
adheres to the adhesive surface after its removal. Then, analyzing
expression of melanoma skin markers in nucleic acids of the skin
sample. The melanoma skin markers include IL-1 RI, endothelin-2,
ephrin-A5, IGF Binding Protein 7, HLA-A0202 heavy chain, Activin A
(.beta.A subunit), TNF RII, SPC4, and CNTF R.alpha.. In this
aspect, expression of the IL-1 RI, endothelin-2, and ephrin-A5 is
related to early stage melanoma, and expression of IGF Binding
Protein 7, HLA-A0202 heavy chain, Activin A (.beta.A subunit), TNF
RI!, SPC4, and CNTF R.alpha. is related to late stage melanoma.
[0017] In another aspect, the present invention provides a
non-invasive method for monitoring a suspicious lesion of a
subject. The method includes analyzing expression of one or more
melanoma skin markers in a skin sample taken from the suspicious
lesion at a first time point and a second time point, and comparing
the expression at the first time point and the second time point.
The melanoma skin markers include IL-1 RI, endothelin-2, ephrin-A5,
IGF Binding Protein 7, HLA-A0202 heavy chain, Activin A (.beta.A
subunit), TNF RII, SPC4, and CNTF R.alpha.. Expression of the
melanoma skin markers is related to melanoma, such that a change in
the expression of one or more of the melanoma skin markers over
time is indicative of melanoma. In certain preferred embodiments,
the skin sample includes nucleic acids, and is a human skin
sample.
[0018] In another aspect, the present invention provides a
non-invasive method for detecting expression of IL-1 RI,
endothelin-2, ephrin-A5, IGF Binding Protein 7, HLA-A0202 heavy
chain, Activin A (.beta.A subunit), TNF RII, SPC4, and CNTF
R.alpha. genes in a skin sample. The method includes obtaining a
skin sample by applying an adhesive surface to the skin and
removing the adhesive surface from the skin such that a skin sample
comprising nucleic acid in an amount sufficient for subsequent
detection adheres to the adhesive surface after its removal. Then,
analyzing expression of IL-1 RI, endothelin-2, ephrin-A5, IGF
Binding Protein 7, HLA-A0202 heavy chain, Activin A (.beta.A
subunit), TNF RII, SPC4, and CNTF R.alpha. in the nucleic acids of
the skin sample. Typically, for this aspect of the invention, mRNA
from the skin sample are the analyzed nucleic acids.
[0019] In another aspect the present invention provides a kit for
detecting malignant melanoma. The kit includes one or more probes
or primers that selectively bind to one or more of Interleukin-1 RI
(IL-1 RI), endothelin-2, ephrin-A5, Insulin-like Growth Factor
(IGF) Binding Protein 7, Human Leukocyte Antigen (HLA)-A0202 heavy
chain, Activin A (.beta.A subunit), Tumor Necrosis Factor (TNF)
RII, SPC4, and Ciliary Neurotrophic Factor (CNTF) R.alpha.. The kit
can include a skin sample collection device, such as an adhesive
strip.
BRIEF DESCRIPTION OF DRAWINGS
[0020] FIG. 1 is an exposure of a gel representing the results for
ribonuclease protection assay (RPA) performed with RNA obtained by
tape stripping three different areas of the upper arms of the same
subject. Each of the three sites were stripped 12 times. Four
different RNA probes (IL-4, IL-8, L32, GADPH) were used for
hybridization to RNA samples obtained from the subject. Lane 1
shows the RNA isolated from an erythematous area of skin, read
clinically as 2+ erythema that was induced by squarate (ACD). Shown
in lane 3 is the RNA isolated from an ICD erythematous site (scored
2+) induced by 0.5% sodium lauryl sulfate (SLS). Both lanes
demonstrate a band for IL-8. Lane 2 represents sample obtained from
non-inflamed, normal appearing skin of the same subject. A band for
the cytokine, IL-4, can be seen in lane 1 which was derived from an
allergic reaction.
[0021] FIG. 2 shows results for RPA performed with RNA obtained by
tape stripping three different areas of the upper arm of four more
individuals. Riboprobes for 6 different RNAs (IL-4, IL-8, IL-9,
IL-13, IL-14 and an isoform of nitric oxide synthase (iNOS)) plus 2
housekeeping genes were included in this gel. The "+" indicates
that the skin harvested from the subject had been treated either
with SLS (second row at bottom of figure) or squarate (third row at
bottom of figure).
[0022] FIG. 3 shows quantitative analysis of expression of melanoma
skin markers (as indicated under bars) in nevi versus advanced
malignant melanoma samples. Dark bars are expression in adhesive
tape from advanced malignant melanoma. Light bars are expression in
adhesive tape from melanocytes nevi (benign controls). Gene
expression arbitrary units are based on phosphor imaging of
array.
[0023] FIG. 4 shows quantitative analysis of expression of melanoma
skin markers (as indicated under bars) in nevi versus early
malignant melanoma samples. Dark bars are expression in adhesive
tape from early malignant melanoma. Light bars are expression in
adhesive tape from melanocytes nevi (benign controls). Gene
expression arbitrary units are based on phosphor imaging of
array.
[0024] FIG. 5 shows semi quantitative real time PCR results for
expression of the IL1 RI gene in nevus versus melanoma samples.
Quantitation was based on SyBr green incorporation values,
normalized by GAPDH expression.
DETAILED DESCRIPTION OF THE INVENTION
[0025] In one aspect, the present invention provides a non-invasive
method for detecting malignant melanoma in a skin sample of a
subject. The method includes analyzing expression in skin sample of
one or more melanoma skin markers. The melanoma skin markers
include IL-1 RI, endothelin-2, ephrin-A5, IGF Binding Protein 7,
HLA-A0202 heavy chain, Activin A (.beta.A subunit), TNF RII, SPC4,
and CNTF R.alpha.. Expression of the melanoma skin markers is
related to melanoma. In certain preferred embodiments, the skin
sample includes nucleic acids, and is a human skin sample from a
lesion suspected of being melanoma.
[0026] In another aspect, the present invention provides a
non-invasive method for staging malignant melanoma in a skin sample
of a human subject. The method includes analyzing expression in the
skin sample of one or more melanoma skin markers. The melanoma skin
markers include IL-1 RI, endothelin-2, ephrin-A5, IGF Binding
Protein 7, HLA-A0202 heavy chain, Activin A (.beta.A subunit), TNF
RII, SPC4, and CNTF R.alpha.. Either an increase or a decrease in
expression of the melanoma skin markers, is related to melanoma. In
certain preferred embodiments, expression is analyzed by analyzing
mRNAs of one or more skin markers from the skin sample, and is a
human skin sample from a lesion suspected of being melanoma.
[0027] In a preferred embodiment, the method includes analyzing
expression in the skin sample by measuring expression levels of
IL-1 RI, endothelin-2, ephrin-A5, IGF Binding Protein 7, HLA-A0202
heavy chain, Activin A (.beta.A subunit), TNF RII, SPC4, and CNTF
R.alpha. mRNAs. Expression levels of the IL-1 RI, endothelin-2, and
ephrin-A5 genes are related to early stage melanoma, and expression
levels of the genes for IGF Binding Protein 7, HLA-A0202 heavy
chain, Activin A (.beta.A subunit), TNF RII, SPC4, and CNTF
R.alpha. are related to late stage melanoma. More particularly, an
increase in the expression levels of IGF Binding Protein 7,
HLA-A0202 heavy chain, Activin A (.beta.A subunit), TNF RII, SPC4,
and CNTF R.alpha. are related to late stage melanoma. Furthermore,
an increase in the expression levels of endothelin-2, and ephrin-A5
genes are related to early stage melanoma. Finally, a decrease in
levels of IL-1 RI are related to early stage melanoma. The method
can include the combination of all of the melanoma skin markers, or
all of the early stage melanoma skin markers, or all of the
late-stage melanoma skin markers, weighted according to F-power in
a multivariate analysis, to increase the accuracy of the
method.
[0028] In another preferred embodiment, the method includes
detecting expression of IL-1 RI, endothelin-2, and ephrin-A5 to
detect malignant melanoma in patients at risk for developing
malignant melanoma. These genes are identified herein as being
differentially expressed in early-stage melanoma. In another
preferred embodiment, the method includes detecting expression of
endothelin-2 and ephrin-A5.
[0029] The method for detecting malignant melanoma, may be a
molecular diagnostic screening test for early melanoma that
includes analyzing mRNAs of the markers IL-1 RI, endothelin-2, and
ephrin-A5 in nucleic acids, typically RNA extracted from a skin
sample of a patient population, such as those at risk for
developing malignant melanoma due to a family history of malignant
melanoma. The sample is preferably obtained using a non-invasive
skin surface sampling method, as described herein. The methods for
detecting malignant melanoma of the present invention, can serve as
aids for initial therapeutic decisions, saving many lives and
reducing the cost of this safety by avoiding unnecessary excisions
and biopsies.
[0030] The methods of the present invention are particularly useful
in the family practice setting for managing patients at risk for
developing melanoma. For example, the methods are useful in the
following patient groups: a) patients with multiple moles,
especially when excisions of all suspected moles can not be
performed or suspicious lesions reside in cosmetically
problematical body parts, e.g. the face, the breast, and decollete
in females etc.; b) patients with dysplastic nevus syndrome at
higher risk to get melanoma, c) patients who have suffered from
primary melanoma, and therefore are at increased risk to get a
second one; and d) patients with familial risk (i.e. genetic
predisposition) for melanoma.
[0031] The methods of the present invention use a non-invasive
method to obtain a sample of skin from a subject suspected of
having melanoma or at increased risk of developing melanoma. In
certain preferred embodiments, the skin sample is a human skin
sample from a lesion suspected of being melanoma. In preferred
embodiments, the skin sample includes nucleic acids, which can then
be analyzed using methods such as, but not limited to, those
described below. Levels of melanoma skin markers can be quantitated
in the sample by measuring their absolute or relative expression at
the protein or preferably RNA levels, and comparing these levels to
those of normal, control samples. As illustrated in Example 4
herein, information regarding expression of malignant melanoma skin
markers disclosed herein, provides information regarding the
presence and the stage of malignant melanoma. A decrease in
expression levels of IL-1 RI and/or an increase in expression
levels of endothelin-2 and/or ephrin-A5 is indicative of early
stage melanoma. An increase in expression levels of IGF Binding
Protein 7, HLA-A0202 heavy chain, Activin A (.beta.A subunit), TNF
RII, SPC4, and/or CNTF R.alpha. is indicative of late stage
melanoma.
[0032] It will be recognized that the non-invasive sample is
typically taken from below the stratum corneum of the skin. As
illustrated in Example 4, by using the methods of the invention it
is possible to detect and stage malignant melanoma by analyzing the
melanoma skin markers disclosed herein.
[0033] In one embodiment, expression is analyzed for at least one
of IL-1 RI, endothelin-2, and ephrin-A5. In another embodiment,
expression is analyzed for at least two, or all, of IL-1 RI,
endothelin-2, and ephrin-A5. In another embodiment, expression is
analyzed for one or both of endothelin-2 and ephrin-A5. In another
embodiment, expression is analyzed for at least one of IGF Binding
Protein 7, HLA-A0202 heavy chain, Activin A (.quadrature.A
subunit), TNF RII, SPC4, and CNTF R{tilde over (.quadrature.)}. In
another embodiment, expression is analyzed for IGF Binding Protein
7, HLA-A0202 heavy chain, Activin A (.quadrature.A subunit), TNF
RII, SPC4, and CNTF R{tilde over (.quadrature.)}. In another
embodiment, expression is analyzed for at least one of IGF Binding
Protein 7, HLA-A0202 heavy chain, Activin A (.quadrature.A
subunit), TNF RII, SPC4, and CNTF R{tilde over (.quadrature.)}. In
another embodiment, expression is analyzed for at least one of
endothelin-1, ephrin-A5, IGF Binding Protein 7, HLA-A0202 heavy
chain, Activin A (.quadrature.A subunit), TNF RII, SPC4, and CNTF
R{tilde over (.quadrature.)}.
[0034] A "melanoma skin marker" is a gene whose expression level is
different between skin surface samples at the site of malignant
melanoma and skin surface samples of normal skin or a lesion, which
is benign, such as a benign nevus. Therefore, expression of a
melanoma skin marker is related to, or indicative of, melanoma. As
discussed herein, all of the melanoma skin markers of the present
invention exhibit increased expression in melanoma cells as
compared to benign nevi, except for IL1 RI. Many statistical
techniques are known in the art, which can be used to determine
whether a statistically significant difference in expression is
observed at a 90% or preferably a 95% confidence level. Example 4
illustrates the use of a statistical test to identify melanoma skin
markers. An increase or decrease in expression of these genes is
related to malignant melanoma. In certain preferred embodiments,
there is at least a two-fold difference in levels between skin
sample near the site of malignant melanoma and skin samples from
normal skin.
[0035] Melanoma skin markers identified herein include
Interleukin-1 Receptor (IL-1 RI) (Genbank accession number X16896,
Human mRNA for interleukin-1 receptor); Endothelin-2 (Genbank
accession number M65199, Human endothelin 2 (ET2) mRNA); Ephrin-A5
(Genbank accession number U26403, Human receptor tyrosine kinase
ligand LERK-7 precursor (EPLG7) mRNA); Insulin-like Growth Factor
(IGF) Binding Protein 7 (Genbank accession number L19182, Human
MAC25 mRNA); Human Leukocyte Antigen (HLA)-A0202 heavy chain
(Genbank accession number M84379, Human MHC class I lymphocyte
antigen (HLA-A 0201) mRNA); Activin A (.beta.A subunit) (Genbank
accession number M13436, Human ovarian beta-A inhibin mRNA); Tumor
Necrosis Factor (TNF) RII (Genbank accession number M55994, Human
tumor necrosis factor receptor II (TNFrII) mRNA); SPC4 (Genbank
accession number M80482, Human subtilisin-like protein (PACE4)
mRNA); and Ciliary Neurotrophic Factor (CNTF) R.alpha. (Genbank
accession number M73238, Human ciliary neurotrohic factor receptor
(CNTFR) mRNA). One of ordinary skill in the art recognizes that
Genbank accession numbers refer to numbers used to identify
nucleotide sequences available in Genbank (Benson et al.,
"GenBank," Nucleic Acids. Res. 30(1):17-20 (2002)).
[0036] As used herein, the terms "nucleic acid," "polynucleotide,"
or "nucleic acid sequence" refer to a polymer of
deoxyribonucleotides or ribonucleotides, in the form of a separate
fragment or as a component of a larger construct. Polynucleotide or
nucleic acid sequences of the invention include DNA, RNA, including
mRNA and cDNA sequences. The polynucleotides of the sample of the
present invention are typically RNA.
[0037] As used herein, the term "polypeptide" refers to a polymer
of amino acid residues in the form of a separate fragment or
component of a larger construct. An example of a polypeptide
includes amino acid sequences encoding a cytokine or fragments
thereof. A polypeptide may encode for a functional protein or
fragments of a protein. For example, an endothelin-2 polypeptide
includes the full-length protein sequence of endothelin-2 as well
as fragments thereof consisting of a polymer of amino acids.
[0038] In a preferred embodiment, the skin sample is obtained by
applying at least one application of an adhesive to the skin and
removing the adhesive from the skin, or by scraping the skin with
an instrument to remove a sample comprising a nucleic acid from the
skin. The skin sample can be obtained by using a tape stripping
methodology in which one or more tape strips are applied to the
same skin site. Methods for non-invasively obtaining a skin sample
are discussed in U.S. patent application Ser. No. 09/375,609, filed
Aug. 17, 1999, incorporated herein by reference.
[0039] The skin sample can be obtained by applying the adhesive
surface to the skin between 1 and 50 times, preferably between 1
and 25 times. In certain preferred embodiments, the adhesive
surface is applied to the skin between 1 and 3, most preferably
between 1 and 2 times, to obtain the skin sample. Using a preferred
non-invasive sampling method, such as a tape-stripping methodology,
the sample is obtained in a manner such that the skin nucleic acid
profile after application is not affected for up to about one hour,
and typically for up to two hours.
[0040] Skin samples obtained on adhesive films can be frozen before
being analyzed using the methods of the present invention.
Typically, this is performed by snap-freezing a sample, as
illustrated in Example 4, using liquid nitrogen or dry ice.
[0041] The term "skin" means a tissue comprising a sheet of cells,
one or several layers thick, organized above a basal lamina, and
often specialized for mechanical protection or active transport. In
a preferred embodiment, the skin is mammalian skin. In a more
preferred embodiment the skin is human skin.
[0042] The epidermis of the human skin comprises several distinct
layers of skin tissue. The deepest layer is the stratum basalis
layer, which consists of columnar cells. The overlying layer is the
stratum spinosum, which is composed of polyhedral cells. Cells
pushed up from the stratum spinosum are flattened and synthesize
keratohyalin granules to form the stratum granulosum layer. As
these cells move outward, they lose their nuclei, and the
keratohyalin granules fuse and mingle with tonofibrils. This forms
a clear layer called the stratum lucidum. The cells of the stratum
lucidum are closely packed. As the cells move up from the stratum
lucidum, they become compressed into many layers of opaque squamae.
These cells are all flattened remnants of cells that have become
completely filled with keratin and have lost all other internal
structure, including nuclei. These squamae constitute the outer
layer of the epidermis, the stratum corneum. At the bottom of the
stratum corneum, the cells are closely compacted and adhere to each
other strongly, but higher in the stratum they become loosely
packed, and eventually flake away at the surface.
[0043] In preferred embodiments of the present invention, the skin
sample includes epidermal cells. The epidermis consists
predominantly of keratinocytes (>90%), which differentiate from
the basal layer, moving outward through various layers having
decreasing levels of cellular organization, to become the cornified
cells of the stratum corneum layer. Renewal of the epidermis occurs
every 20-30 days in normal skin. Other cell types present in the
epidermis include melanocytes, Langerhans cells, and Merkel cells.
Preferably, the skin sample of the methods of the present invention
is an epidermis skin sample.
[0044] The term "sample" refers to any preparation derived from
skin of a subject. For example, a sample of cells obtained using
the non-invasive method described above may be used to isolate
polynucleotides, polypeptides, or lipids, preferably
polynucleotides and polypeptides, most preferably polynucleotides,
for the methods of the present invention. In addition, the methods
of the invention can be used in vitro, for example with skin cells
cultured on a solid or semi-solid support and organotypic skin
constructs. In such instances, the skin cells may be from any
source suspected of being melanoma or from an individual at risk of
developing melanoma.
[0045] Samples for the present invention, typically are taken from
a mole, or from another type of suspicious lesion (i.e. lesion
suspected of being melanoma), especially one that resides in
cosmetically problematical body parts, e.g. the face, the breast,
decollete in females, etc. The samples are taken of the skin
surface of the suspicious lesion using non-invasive skin sampling
methods discussed herein.
[0046] A "skin lesion" is a change in the color or texture in an
area of skin. "Skin lesions suspected of being melanoma" are skin
lesions with characteristics of malignant melanoma, which are well
known to dermatologists and oncologists. Such lesions are sometimes
raised and can have a color that is different from the color of
normal skin of an individual (e.g. brown, black, red, or bluish).
Lesions suspected of being melanoma sometimes include a mixture of
colors, are often asymmetrical, can change in appearance over time,
and may bleed. A skin lesion suspected of being melanoma may be a
mole or nevus. Melanoma lesions are usually, but not always, larger
than 6 mm in diameter. Melanoma includes superficial spreading
melanoma, nodular melanoma, acral lentiginous melanoma, and
lentigo-maligna melanoma. Melanoma can occur on skin that has been
overexposed to the sun. Therefore, in one embodiment the skin
sample is taken from an area of skin that has been overexposed to
the sun.
[0047] Typically, prior to the present invention a skin biopsy and
histological examination was used to confirm diagnosis of a lesion
as malignant melanoma. Furthermore, an X-ray, CT scan, MRI, or
other procedures are sometimes indicated to determine if spreading
(metastasis) has occurred. Such methods could be used in
conjunction with the present invention, or could be eliminated as a
result of the present invention.
[0048] The methods of the present invention which detect the
melanoma skin markers identified herein have utility not only in
detecting and staging a skin sample from a mole or other lesion
suspected of being melanoma, but also in diagnosing, and prognosing
malignant melanoma.
[0049] Samples from a tissue can be isolated by any number of means
well known in the art. Invasive methods for isolating a sample
include the use of needles, for example during blood sampling, as
well as biopsies of various tissues. Due to the invasive nature of
these techniques there is an increased risk of mortality and
morbidity. The methods and kits of the present invention typically
use a non-invasive sampling method to obtain a skin sample.
[0050] Methods of the present invention can include a rapid,
non-invasive skin-sampling method for obtaining polynucleotides,
typically RNA, preferably mRNA. The process of tape stripping
itself has been shown not to affect the skin cytokine profile
during the first two hours after the procedure is done.
[0051] A non-invasive sampling method can include scraping
epidermal cells of the skin with a rigid instrument. The instrument
can be, for example, a sterile #15 scalpel. However, it will be
recognized that any number of rigid instruments capable of removing
only the surface layer (i.e., stratum corneum) of the skin may be
used. Alternatively, instead of scraping the skin, the skin's
epidermal layer may be removed by using an adhesive surface, such
as, but not limited to an adhesive tape, for example, but not
limited to, Duct tape (333 Duct tape, Nashua tape products),
Scotch.RTM. tape (3M Scotch 810, St. Paul, Minn.), or a similar
adhesive product. A preferred, but non-limiting example of an
adhesive tape is D-SQUAME.RTM. (CuDerm, Dallas, Tex.).
[0052] In this embodiment the skin is stripped with the tape and
the stripped cells and cellular material are then recovered from
the scalpel, tape or other item. For example, tape used to obtain
skin cells and cellular material can be centrifuged in a sterile
microfuge tube containing lysis buffer. In the case of the scalpel
the cells and cellular material can be transferred to a sterile
Petri dish and any cells present lysed therein with lysis buffer.
The same lysis buffer may be reused for each piece of tape or
scalpel used at a single skin site. For certain applications, the
tape stripping method can be combined with the scraping method for
removing cells and cellular material from the skin. The sample
obtained can then be further processed, for example to isolate
nucleic acids, polypeptides, or lipids. Preferably, the method
utilized does not adversely affect the polynucleotide, polypeptide,
or lipid level being measured.
[0053] Polynucleotides can be isolated from the lysed cells and
cellular material by any number of means well known to those
skilled in the art. For example, a number of commercial products
are available for isolating polynucleotides, including but not
limited to, TriReagent (Molecular Research Center, Inc.,
Cincinnati, Ohio) can be used. The isolated polynucleotides can
then be tested or assayed for particular nucleic acid sequences,
including a polynucleotide encoding a cytokine.
[0054] Expression of melanoma skin markers is analyzed in the
methods of the present invention. Analyzing expression includes any
qualitative or quantitative method for detecting expression of a
gene, many of which are known in the art. The method can include
analyzing expression of the melanoma skin markers by measuring
expression of the melanoma skin markers using a quantitative
method, or by using a qualitative method. Non-limiting methods for
analyzing polynucleotides and polypeptides are discussed below.
Preferably, expression is analyzed using methods that are directed
to polynucleotides.
[0055] The methods of analyzing expression of a malignant melanoma
of the present invention can utilize a biochip, or other miniature
high-throughput technology, for detecting expression of two or more
malignant melanoma skin markers. As illustrated in Example 4, the
manufacture and use of biochips such as those involving bioarrays,
are known in the art and commercially available (See e.g.,
bioarrays available from Sigma-Genosys (The Woodlands, Tex.);
Affymetrix (Santa Clara, Calif.), and Full Moon Biosystems
(Sunnyvale, Calif.)) (For reviews of Biochips and bioarrays see,
e.g., Kallioniemi O. P., "Biochip technologies in cancer research,"
Ann Med, Mar; 33(2):142-7 (2001); and Rudert F., "Genomics and
proteomics tools for the clinic," Curr Opin. Mol. Ther.,
December;2(6):633-42 (2000)).
[0056] Such bioarrays can be analyzed using blotting techniques
similar to those discussed below for conventional techniques of
detecting polynucleotides and polypeptides, as illustrated in
Example 4. Other microfluidic devices and methods for analyzing
gene expression, especially those in which more than one gene can
be analyzed simultaneously and those involving high-throughput
technologies, can be used for the methods of the present
invention.
[0057] Quantitative measurement of expression levels using
bioarrays is also known in the art, and typically involve a
modified version of a traditional method for measuring expression
as described herein. For example, such quantitation can be
performed by measuring a phosphor image of a radioactive-labeled
probe binding to a spot of a microarray, using a phospohor imager
and imaging software.
[0058] The method of the present invention typically employ RNA,
including messenger RNA (mRNA), isolated from a skin sample. The
RNA may be single stranded or double stranded. Enzymes and
conditions optimal for reverse transcribing the template to DNA
well known in the art can be used. Alternatively, the RNA can be
subjected to RNAse protection assays. A DNA-RNA hybrid that
contains one strand of each can also be used. A mixture of
polynucleotides can also be employed, or the polynucleotides
produced in a previous amplification reaction, using the same or
different primers may be so used. In the instance where the
polynucleotide sequence is to be amplified the polynucleotide
sequence may be a fraction of a melanoma skin marker, or can be
present initially as a discrete molecule, such that the specific
sequence is the entire nucleic acid. It is not necessary that the
sequence to be amplified be present initially in a pure form; it
may be a minor fraction of a complex mixture.
[0059] In addition, RNAse protection assays can be used if RNA is
the polynucleotide obtained from the sample. In this procedure, a
labeled antisense RNA probe is hybridized to the complementary
polynucleotide in the sample. The remaining unhybridized
single-stranded probe is degraded by ribonuclease treatment. The
hybridized, double stranded probe is protected from RNAse
digestion. After an appropriate time, the products of the digestion
reaction are collected and analyzed on a gel (see for example
Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, section
4.7.1 (1987)). As used herein, "RNA probe" refers to a
ribonucleotide capable of hybridizing to RNA in a sample of
interest. Those skilled in the art will be able to identify and
modify the RNAse protection assay specific to the polynucleotide to
be measured, for example, probe specificity may be altered,
hybridization temperatures, quantity of nucleic acid etc.
Additionally, a number of commercial kits are available, for
example, RiboQuant.TM. Multi-Probe RNAse Protection Assay System
(Pharmingen, Inc., San Diego, Calif.).
[0060] In another embodiment, the polynucleotide in the sample may
be analyzed by a blotting procedure, typically a Northern blot
procedure. For blotting procedures polynucleotides are separated on
a gel and then probed with a complementary polynucleotide to the
sequence of interest. For example, RNA is separated on a gel
transferred to nitrocellulose and probed with complementary DNA to
one of the melanoma differentially-diagnosed genes disclosed
herein. The complementary probe may be labeled radioactively,
chemically etc. Hybridization of the probe is indicative of the
presence of the melanoma of interest.
[0061] Detection of a polynucleotide encoding a melanoma skin
marker can be performed by standard methods such as size
fractionating the nucleic acid. Methods of size fractionating the
DNA and RNA are well known to those of skill in the art, such as by
gel electrophoresis, including polyacrylamide gel electrophoresis
(PAGE). For example, the gel may be a denaturing 7 M or 8 M
urea-polyacrylamide-formamide gel. Size fractionating the nucleic
acid may also be accomplished by chromatographic methods known to
those of skill in the art.
[0062] The detection of polynucleotides may optionally be performed
by using radioactively labeled probes. Any radioactive label may be
employed which provides an adequate signal. Other labels include
ligands, colored dyes, and fluorescent molecules, which can serve
as a specific binding pair member for a labeled ligand, and the
like. The labeled preparations are used to probe for a
polynucleotide by the Southern or Northern hybridization
techniques, for example. Nucleotides obtained from samples are
transferred to filters that bind polynucleotides. After exposure to
the labeled polynucleotide probe, which will hybridize to
nucleotide fragments containing target nucleic acid sequences, the
binding of the radioactive probe to target nucleic acid fragments
is identified by autoradiography (see Genetic Engineering, 1 ed.
Robert Williamson, Academic Press (1981), pp. 72-81). The
particular hybridization technique is not essential to the
invention. Hybridization techniques are well known or easily
ascertained by one of ordinary skill in the art. As improvements
are made in hybridization techniques, they can readily be applied
in the method of the invention.
[0063] Probes according to the present invention and used in a
method of the present invention selectively hybridize to the
melanoma skin markers disclosed herein. In preferred embodiments,
the probes are spotted on a bioarray using methods known in the
art. As used herein, the term "selective hybridization" or
"selectively hybridize," refers to hybridization under moderately
stringent or highly stringent conditions such that a nucleotide
sequence preferentially associates with a selected nucleotide
sequence over unrelated nucleotide sequences to a large enough
extent to be useful in detecting expression of a melanoma skin
marker. It will be recognized that some amount of non-specific
hybridization is unavoidable, but is acceptable provide that
hybridization to a target nucleotide sequence is sufficiently
selective such that it can be distinguished over the non-specific
cross-hybridization, for example, at least about 2-fold more
selective, generally at least about 3-fold more selective, usually
at least about 5-fold more selective, and particularly at least
about 10-fold more selective, as determined, for example, by an
amount of labeled oligonucleotide that binds to target nucleic acid
molecule as compared to a nucleic acid molecule other than the
target molecule, particularly a substantially similar (i.e.,
homologous) nucleic acid molecule other than the target nucleic
acid molecule.
[0064] Conditions that allow for selective hybridization can be
determined empirically, or can be estimated based, for example, on
the relative GC:AT content of the hybridizing oligonucleotide and
the sequence to which it is to hybridize, the length of the
hybridizing oligonucleotide, and the number, if any, of mismatches
between the oligonucleotide and sequence to which it is to
hybridize (see, for example, Sambrook et al., "Molecular Cloning: A
laboratory manual (Cold Spring Harbor Laboratory Press 1989)). An
example of progressively higher stringency conditions is as
follows: 2.times.SSC/0.1% SDS at about room temperature
(hybridization conditions); 0.2.times.SSC/0.1% SDS at about room
temperature (low stringency conditions); 0.2.times.SSC/0.1% SDS at
about 42EC (moderate stringency conditions); and 0.1.times.SSC at
about 68EC (high stringency conditions). Washing can be carried out
using only one of these conditions, e.g., high stringency
conditions, or each of the conditions can be used, e.g., for 10-15
minutes each, in the order listed above, repeating any or all of
the steps listed. However, as mentioned above, optimal conditions
will vary, depending on the particular hybridization reaction
involved, and can be determined empirically.
[0065] The polynucleotides encoding melanoma skin markers may be
amplified before they are detected. The term "amplified" refers to
the process of making multiple copies of the nucleic acid from a
single polynucleotide molecule. The amplification of
polynucleotides can be carried out in vitro by biochemical
processes known to those of skill in the art. The amplification
agent may be any compound or system that will function to
accomplish the synthesis of primer extension products, including
enzymes. Suitable enzymes for this purpose include, for example, E.
coli DNA polymerase I, Taq polymerase, Klenow fragment of E. coli
DNA polymerase I, T4 DNA polymerase, other available DNA
polymerases, polymerase muteins, reverse transcriptase, ligase, and
other enzymes, including heat-stable enzymes (i.e., those enzymes
that perform primer extension after being subjected to temperatures
sufficiently elevated to cause denaturation). Suitable enzymes will
facilitate combination of the nucleotides in the proper manner to
form the primer extension products that are complementary to each
mutant nucleotide strand. Generally, the synthesis will be
initiated at the 3'-end of each primer and proceed in the
5'-direction along the template strand, until synthesis terminates,
producing molecules of different lengths. There may be
amplification agents, however, that initiate synthesis at the
5'-end and proceed in the other direction, using the same process
as described above. In any event, the method of the invention is
not to be limited to the embodiments of amplification described
herein.
[0066] One method of in vitro amplification, which can be used
according to this invention, is the polymerase chain reaction (PCR)
described in U.S. Pat. Nos. 4,683,202 and 4,683,195. The term
"polymerase chain reaction" refers to a method for amplifying a DNA
base sequence using a heat-stable DNA polymerase and two
oligonucleotide primers, one complementary to the (+)-strand at one
end of the sequence to be amplified and the other complementary to
the (-)-strand at the other end. Because the newly synthesized DNA
strands can subsequently serve as additional templates for the same
primer sequences, successive rounds of primer annealing, strand
elongation, and dissociation produce rapid and highly specific
amplification of the desired sequence. The polymerase chain
reaction is used to detect the presence of polynucleotides encoding
cytokines in the sample. Many polymerase chain methods are known to
those of skill in the art and may be used in the method of the
invention. For example, DNA can be subjected to 30 to 35 cycles of
amplification in a thermocycler as follows: 95.degree. C. for 30
sec, 52.degree. to 60.degree. C. for 1 min, and 72.degree. C. for 1
min, with a final extension step of 72.degree. C. for 5 min. For
another example, DNA can be subjected to 35 polymerase chain
reaction cycles in a thermocycler at a denaturing temperature of
95.degree. C. for 30 sec, followed by varying annealing
temperatures ranging from 54-58.degree. C. for 1 min, an extension
step at 70.degree. C. for 1 min and a final extension step at
70.degree. C.
[0067] The primers for use in amplifying the polynucleotides of the
invention may be prepared using any suitable method, such as
conventional phosphotriester and phosphodiester methods or
automated embodiments thereof so long as the primers are capable of
hybridizing to the polynucleotides of interest. One method for
synthesizing oligonucleotides on a modified solid support is
described in U.S. Pat. No. 4,458,066. The exact length of primer
will depend on many factors, including temperature, buffer, and
nucleotide composition. The primer must prime the synthesis of
extension products in the presence of the inducing agent for
amplification.
[0068] Primers used according to the method of the invention are
complementary to each strand of nucleotide sequence to be
amplified. The term "complementary" means that the primers must
hybridize with their respective strands under conditions, which
allow the agent for polymerization to function. In other words, the
primers that are complementary to the flanking sequences hybridize
with the flanking sequences and permit amplification of the
nucleotide sequence. Preferably, the 3' terminus of the primer that
is extended has perfectly base paired complementarity with the
complementary flanking strand.
[0069] Primers and probes for the differentially expressed melanoma
skin markers of the present invention, can be developed using known
methods combined with the present disclosure. For example, but not
intended to be limiting, PCR primers for IL1 RI can include:
TABLE-US-00001 (SEQ ID NO: 1) Forward: TTCAGGACATTACTATTGCG (SEQ ID
NO: 2) (Target CGCAATAGTAATGTCCTGAA (SEQ ID NO: 3) Reverse:
TTCCACACTGTAATAGTCTTC (SEQ ID NO: 4) (Target
GAAGACTATTACAGTGTGGAA
[0070] Another non-limiting example of primers and probes of the
present invention, are primers and probes that selectively
hybridize to the target sequences identified above (SEQ ID NOS: 2
and 4).
[0071] Those of ordinary skill in the art will know of various
amplification methodologies that can also be utilized to increase
the copy number of target nucleic acid. The polynucleotides
detected in the method of the invention can be further evaluated,
detected, cloned, sequenced, and the like, either in solution or
after binding to a solid support, by any method usually applied to
the detection of a specific nucleic acid sequence such as another
polymerase chain reaction, oligomer restriction (Saiki et al.,
Bio/Technology 3:1008-1012 (1985)), allele-specific oligonucleotide
(ASO) probe analysis (Conner et al., Proc. Natl. Acad. Sci. USA 80:
278 (1983), oligonucleotide ligation assays (OLAs) (Landegren et
al., Science 241:1077 (1988)), RNAse Protection Assay and the like.
Molecular techniques for DNA analysis have been reviewed (Landegren
et al, Science 242: 229-237 (1988)). Following DNA amplification,
the reaction product may be detected by Southern blot analysis,
without using radioactive probes. In such a process, for example, a
small sample of DNA containing the polynucleotides obtained from
the tissue or subject are amplified, and analyzed via a Southern
blotting technique. The use of non-radioactive probes or labels is
facilitated by the high level of the amplified signal. In one
embodiment of the invention, one nucleoside triphosphate is
radioactively labeled, thereby allowing direct visualization of the
amplification product by autoradiography. In another embodiment,
amplification primers are fluorescently labeled and run through an
electrophoresis system. Visualization of amplified products is by
laser detection followed by computer assisted graphic display,
without a radioactive signal.
[0072] The methods of the present invention can involve a real-time
quantitative PCR assay, such as a Taqman.RTM. assay (Holland et
al., Proc Natl Acad Sci USA, 88(16):7276 (1991)). The assays can be
performed on an instrument designed to perform such assays, for
example those available from Applied Biosystems (Foster City,
Calif.). Primers and probes for such an assay can be designed
according to known procedures in the art. For example, primers and
probes for some of the differentially expressed melanoma skin
markers of the present invention can include, but are not limited
to, the following:
TABLE-US-00002 Endothelin 2 (SEQ ID NO: 5) Forward
CTGCCAAGGCGCTGTCA (SEQ ID NO: 6) (Target: TGACAGCGCCTTGGCAG) (SEQ
ID NO: 7) Reverse TCAGTCCAGGGCCTTCGA (SEQ ID NO: 8) (Target:
TCGAAGGCCCTGGACTGA) (SEQ ID NO: 9) Probe TGCCAGGGACCCC (SEQ ID NO:
10) (Target: GGGGTCCCTGGCA) Inhibin (Activin) (SEQ ID NO: 11)
Forward AACATGCTGCACTTGAAGAAGAGA (SEQ ID NO: 12) (Target:
TCTCTTCTTCAAGTGCAGCATGTT) (SEQ ID NO: 13) Reverse
GAAGCTTTCTGATCGCGTTCA (SEQ ID NO: 14) (Target:
TGAACGCGATCAGAAAGCTTC) (SEQ ID NO: 15) Probe CCGGCTGGGTGACAT (SEQ
ID NO: 16) (Target: ATGTCACCCAGCCGG) InsulinBindingProtein7 (SEQ ID
NO: 17) Forward GCGTGTGCGTGTGCAAGA (SEQ ID NO: 18) (Target:
TCTTGCACACGCACACGC) (SEQ ID NO: 19) Reverse CAGCCGCTCGGGTAGGT (SEQ
ID NO: 20) (Target: ACCTACCCGAGCGGCTG) (SEQ ID NO: 21) Probe
CGCTGCCGCACAC (SEQ ID NO: 22) (Target: GTGTGCGGCAGCG) IL1R1 (SEQ ID
NO: 23) Forward GCACAAGCCATATTTAAGCAGAAAC (SEQ ID NO: 24) (Target:
GTTTCTGCTTAAATATGGCTTGTGC) (SEQ ID NO: 25) Reverse
AACTCCATATAAGGGCACACAAGTC ((SEQ ID NO: 26) (Target:
GACTTGTGTGCCCTTATATGGAGTT (SEQ ID NO: 27) Probe CTCCGTCTCCTGCAAC
(SEQ ID NO: 28) (Target: GTTGCAGGAGACGGAG)
[0073] Another non-limiting example of primers and probes of the
present invention, are primers and probes that selectively
hybridize to the target sequences identified above (SEQ ID NOS: 6,
8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28).
[0074] Simple visualization of a gel containing the separated
products may be utilized to analyze the melanoma skin markers
according to the methods of the present invention. For example,
staining of a gel to visualize separated polynucleotides, a number
of stains are well known to those skilled in the art. However,
other methods known to those skilled in the art may also be used,
for example scanning densitometry, computer aided scanning and
quantitation as well as others.
[0075] The method for detecting one or more melanoma skin markers
may alternatively employ the detection of a polypeptide product of
one of these genes. The method for detecting a polypeptide derived
from a melanoma skin marker in cells is useful for detecting
melanoma by measuring the level of one or more melanoma skin marker
product, for example IL-1 RI, endothelin-2, ephrin-A5, IGF Binding
Protein 7, HLA-A0202 heavy chain, Activin A (.beta.A subunit), TNF
RII, SPC4, and CNTF R.alpha., in cells obtained from a subject
suspected of having, or at risk of having malignant melanoma. The
levels of such melanoma skin marker products are indicative of
malignant melanoma when compared to a normal or standard
polypeptide profiles in a similar tissue. Thus, the expression
pattern of a melanoma skin marker product will vary depending upon
the presence and stage of malignant melanoma.
[0076] In this regard, the sample, as described herein, can be used
as a source to isolate polypeptides. Measurement of a particular
polypeptide, for example IL-1 RI, endothelin-2, ephrin-A5, IGF
Binding Protein 7, HLA-A0202 heavy chain, Activin A (.beta.A
subunit), TNF RII, SPC4, and CNTF R.alpha., can serve as a method
of detecting, staging, diagnosing, monitoring, prognosing, or
otherwise assisting in management of malignant melanoma. For
example, following skin scraping or skin stripping, using the
methods described above, cells isolated from the stratum corneum
may be lysed by any number of means, and polypeptides obtained from
the cells. These polypeptides may then be quantified using methods
known to those of skill in the art, for example by ELISA.
[0077] Monoclonal antibodies to a particular polypeptide, for
example, example IL-1 RI, endothelin-2, ephrin-A5, IGF Binding
Protein 7, HLA-A0202 heavy chain, Activin A (.beta.A subunit), TNF
RII, SPC4, and CNTF R.alpha., can be used in immunoassays, such as
in liquid phase or bound to a solid phase carrier, to detect
polypeptide associated with a disorder, such as dermatitis. In
addition, the monoclonal antibodies in these immunoassays can be
detectably labeled in various ways. Examples of types of
immunoassays that can utilize monoclonal antibodies of the
invention are competitive and non-competitive immunoassays in
either a direct or indirect format. Examples of such immunoassays
are the radioimmunoassay (RIA) and the sandwich (immunometric)
assay. Detection of the polypeptide antigens using the monoclonal
antibodies of the invention can be done utilizing immunoassays,
which are run in either the forward, reverse, or simultaneous
modes, including immunohistochemical assays on physiological
samples. Those of skill in the art will know, or can readily
discern, other immunoassay formats without undue experimentation.
In addition, there are a number of commercially available
antibodies to cytokines of interest.
[0078] The term "immunometric assay" or "sandwich immunoassay"
includes simultaneous sandwich, forward sandwich and reverse
sandwich immunoassays. These terms are well understood by those
skilled in the art. Those of skill will also appreciate that
antibodies according to the present invention will be useful in
other variations and forms of assays which are presently known or
which may be developed in the future. These are intended to be
included within the scope of the present invention.
[0079] Monoclonal antibodies can be bound to many different
carriers and used to detect the presence of a cytokine polypeptide.
Examples of well-known carriers include glass, polystyrene,
polypropylene, polyethylene, dextran, nylon, amylases, natural and
modified celluloses, polyacrylamides, agaroses and magnetite. The
nature of the carrier can be either soluble or insoluble for
purposes of the invention. Those skilled in the art will know of
other suitable carriers for binding monoclonal antibodies, or will
be able to ascertain such using routine experimentation. A cytokine
polypeptide may be detected by the monoclonal antibodies when
present in biological fluids and tissues such as a skin sample.
[0080] In performing the assays it may be desirable to include
certain "blockers" in the incubation medium (usually added with the
labeled soluble antibody). The "blockers" are added to assure that
non-specific proteins, proteases, or anti-heterophilic
immunoglobulins to anti-cytokine immunoglobulins present in the
experimental sample do not cross-link or destroy the antibodies on
the solid phase support, or the radiolabeled indicator antibody, to
yield false positive or false negative results. The selection of
"blockers" therefore may add substantially to the specificity of
the assays.
[0081] It has been found that a number of nonrelevant (i.e.,
nonspecific) antibodies of the same class or subclass (isotype) as
those used in the assays (e.g., IgG1, IgG2a, IgM, etc.) can be used
as "blockers". The concentration of the "blockers" (normally 1-100
.mu.g/.mu.l) may be important, in order to maintain the proper
sensitivity yet inhibit any unwanted interference by mutually
occurring cross reactive proteins in the specimen.
[0082] "Cytokine" as used herein means any number of factors that
play a role in cellular regulation or differentiation. For example,
cytokines can include the family of interleukins (IL) including
IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-8, IL-9, IL-13, IL-14 as
well as factors belonging to the transforming growth factor beta
(TGF-.beta.) superfamily, GM-CSF and interferon.
[0083] As used herein, the term "biological factor" means a number
of factors that have biological activity or play a biological role.
For example, biological factor includes polynucleotides, such as
DNA, RNA, mRNA and cDNA, polypeptides, such as IL-4, IL-8, and
IL-13 proteins and fragments thereof, as well as lipids such as
cholesterol, fatty acids, and inflammatory mediators such as
leukotrienes, prostaglandins and others.
[0084] In another aspect, the present invention provides a
non-invasive method for monitoring a suspicious lesion of a
subject. The method includes analyzing expression of one or more
melanoma skin markers in a skin sample taken from the suspicious
lesion at a first time point and a second time point, and comparing
the expression at the first time point and the second time point.
The melanoma skin markers include IL-1 RI, endothelin-2, ephrin-A5,
IGF Binding Protein 7, HLA-A0202 heavy chain, Activin A (.beta.A
subunit), TNF RII, SPC4, and CNTF R.alpha.. Expression of the
melanoma skin markers is related to melanoma, such that a change in
the expression of one or more of the melanoma skin markers over
time is indicative of melanoma. In certain preferred embodiments,
the skin sample includes nucleic acids, and is a human skin
sample.
[0085] Time points can include any interval of time, but are
typically at least 2 weeks, and more typically at least 1 month
apart. For certain embodiments, time points are 2 months, 3 months,
6 months, 1 year, or 2 years apart. Samples can be taken at any
number of time points, including 2, 3, 4, 5, etc. time points.
Comparison of expression analysis data from different time points
can be performed using any of the known statistical methods for
comparing data points to assess differences in the data, including
time-based statistical methods such as control charting. Melanoma
can be identified in the time series, for example, by comparing
expression levels to a cut-off value, or by comparing changes in
expression levels to determine whether they exceed a cut-off change
value, such as a percent change cut-off value.
[0086] In another aspect, the present invention provides a
non-invasive method for detecting expression of IL-1 RI,
endothelin-2, ephrin-A5, IGF Binding Protein 7, HLA-A0202 heavy
chain, Activin A (.beta.A subunit), TNF RII, SPC4, and CNTF
R.alpha. in a skin sample. The method includes obtaining a skin
sample by applying an adhesive surface to the skin and removing the
adhesive surface from the skin such that a skin sample comprising
nucleic acid in an amount sufficient for subsequent detection
adheres to the adhesive surface after its removal. Then, analyzing
expression of IL-1 RI, endothelin-2, ephrin-A5, IGF Binding Protein
7, HLA-A0202 heavy chain, Activin A (.beta.A subunit), TNF RII,
SPC4, and CNTF R.alpha. in the nucleic acids of the skin sample. As
disclosed herein, this method is useful for detecting, diagnosing,
staging, monitoring, and managing malignant melanoma.
[0087] In another embodiment the invention provides a kit for
detecting malignant melanoma. The kit includes one or more
detection reagents, for example oligonucleotide primers or probes
that are complementary to a polynucleotide sequence encoding at
least one of IL-1 RI, endothelin-2, ephrin-A5, IGF Binding Protein
7, HLA-A0202 heavy chain, Activin A (.beta.A subunit), TNF RII,
SPC4, and CNTF R.alpha.. The oligonucleotide primers can be spotted
on a bioarray which is provided in the kit. The kit can include a
skin sample collection device and probes that selectively bind to
IL-1 RI, endothelin-2, and ephrin-A5. Such a kit may also include a
carrier means being compartmentalized to receive in close
confinement one or more containers such as vials, tubes, and the
like, each of the containers comprising one of the separate
elements to be used in the method. If present, a second container
may comprise a lysis buffer. The kit can alternatively include a
computer-type chip on which the lysis of the cell will be achieved
by means of an electric current.
[0088] The kit, in preferred embodiments, includes a skin sample
collection device such as a rigid instrument capable of removing
the epidermal layer of the skin (e.g. a sterile #15 scalpel),
and/or an adhesive surface, such as an adhesive tape, for example,
Duct tape (333 Duct tape, Nashua tape products), Scotch.RTM. tape
(3M Scotch 810, St. Paul, Minn.), or a similar product. A preferred
adhesive tape is D-SQUAME.RTM. (CuDerm, Dallas, Tex.). The kit can
also include a cell lysis buffer suitable for preserving nucleic
acids in the skin sample.
[0089] The kit can also have containers containing probes or
primers for amplification of or hybridization to the target nucleic
acid sequence which may or may not be labeled, or a container
comprising a reporter, such as a biotin-binding protein, such as
avidin or streptavidin, bound to a reporter molecule, such as an
enzymatic, florescent, or radionuclide label. The term "detectably
labeled deoxyribonucleotide" refers to a deoxyribonucleotides that
is associated with a detectable label for detecting the
deoxyribonucleotide. For example, the detectable label may be a
radiolabeled nucleotide or a small molecule covalently bound to the
nucleotide where the small molecule is recognized by a
well-characterized large molecule. Examples of these small
molecules are biotin, which is bound by avidin, and thyroxin, which
is bound by anti-thyroxin antibody. Other methods of labeling are
known to those of ordinary skill in the art, including enzymatic,
fluorescent compounds, chemiluminescent compounds, phosphorescent
compounds, and bioluminescent compounds.
[0090] The kit can include one or more primer pairs, including a
forward primer that selectively binds upstream of a melanoma skin
marker gene on one strand, and a reverse primer, that selectively
binds upstream of a melanoma skin marker gene on a complementary
strand. The melanoma skin marker genes are typically one or more of
Interleukin-1 RI (IL-1 RI), endothelin-2, ephrin-A5, Insulin-like
Growth Factor (IGF) Binding Protein 7, Human Leukocyte Antigen
(HLA)-A0202 heavy chain, Activin A (.beta.A subunit), Tumor
Necrosis Factor (TNF) RII, SPC4, and Ciliary Neurotrophic Factor
(CNTF) R.alpha.. Primer pairs according to this aspect of the
invention are typically useful for amplifying a polynucleotide that
corresponds to a melanoma skin marker genes using amplification
methods described herein.
[0091] In another aspect the invention provides a method of
screening for compounds or identifying compounds which may cause or
prevent malignant melanoma, or which may be used to treat malignant
melanoma. In this aspect, for example, cells of the skin, such as
epidermal cells, including keratinocytes and melanocytes, or dermal
cells, such as fibroblasts, are contacted with a test compound
under conditions which would induce malignant melanoma formation.
The expression of melanoma skin markers is then detected.
[0092] The conditions under which contact is made are variable and
will depend upon the type of compound, the type and amount of cells
in the skin to be tested, the concentration of the compound in the
sample to be tested, as well as the time of exposure to the
compound. The skill in the art in determining the proper conditions
under which a compound may cause melanoma are known and would
require only routine experimentation, if any. The skin cells may be
isolated using the techniques described above, e.g. by scraping or
tape stripping, the cells may then be exposed to the test compound
in vitro. Alternatively, cultured skin cells or skin constructs may
be used. For example, skin cells may be cultured from any source
under standard cell culture conditions on a solid or semi-solid
support until they become sufficiently confluent. Upon confluence
or subconfluence the cells are then exposed to the test compound.
Polynucleotides are then isolated from the cells which have been
exposed to the compound and quantitated as described above.
[0093] For example, and not by way of limitation, skin cells can be
isolated by the tape or scraping method above and mRNA isolated.
The mRNA can then be quantified using the probes for particular
melanoma skin markers. Alternatively, the mRNA may be amplified by
RT-PCR prior to detection of the polynucleotide. As described
above, quantitation of a polynucleotide derived from a melanoma
skin marker, can be used to detect, diagnose, stage, screen, and
assist in management, of malignant melanoma.
[0094] The present invention is not to be limited in scope by the
specific examples provided for below, which are intended as single
illustrations of individual aspects of the invention and
functionally equivalent methods and components are within the scope
of the invention.
Example 1
Non-Invasive Recovery of Sub-Stratum Corneum Cells
A. Recovery Using a Rigid Surface
[0095] Skin cells can be recovered non-invasively by scraping the
skin with a sterile #15 scalpel. The scalpel is held at an angle
approximately 15 degrees from horizontal and repeatedly but gently
scraped across an area of skin that is approximately 1.times.1 cm
in size. The epidermal cells are transferred to a sterile tissue
culture well by scraping the blade against the interior wall of the
well. When the glistening epidermal layer is reached, the scraping
is stopped prior to causing any bleeding, to avoid contaminating
the scraping(s) with blood. The cells are deposited in a sterile 1
cm petri dish and about 300 ml of lysis buffer is added to the
culture well. The lysis buffer is pipetted up and down until the
epidermal cells are completely lysed.
[0096] RNA lysis buffer is added within 10 minutes of initiation of
the scraping. The sterile tissue culture well is maintained on dry
ice. The cells are dissolved in the RNA lysis buffer, transferred
into RNAse free centrifuge tubes and the total RNA is
extracted.
B. Recovery Using an Adhesive Surface
[0097] Skin cells can be recovered non-invasively by using Duct
tape (333 Duct tape, Nashua tape products), Scotch.RTM. tape (3M
Scotch.RTM. 8 10, St. Paul, Minn.), D-SQUAME.RTM. (CuDerm, Dallas,
Tex.), or a similar product. The skin is stripped up to a maximum
25 times. Additionally, it will be recognized that the stickier the
tape, the fewer strippings are required. The skin cells were
recovered by vortexing and then centrifuging the tape in an
RNAse-free Eppendorf tube containing lysis buffer. The same lysis
buffer was reused for each piece of tape used at a single skin
site. The entire procedure was performed in less than 90 minutes.
The process of tape stripping itself does not affect the skin
cytokine profile during the first few hours after the procedure is
done. Moreover, during the early hours after stripping no
inflammatory cells migrate from the circulation into the dermis or
epidermis.
[0098] RNA was immediately extracted from cells adhering to the
strip by vigorously vortexing the tape in 0.5 ml TriReagent
(Molecular Research Center, Inc., Cincinnati, Ohio). Yeast transfer
RNA (4 .mu.g) was then added as carrier RNA before the total RNA
was isolated and purified according to the manufacturer's
instructions. The total isolated RNA from each sample was used in
an RNAse protection assay (RiboQuant.RTM. Multiprobe RNAse
Protection Assay System, PharMingen, Inc., San Diego, Calif.)
without prior measurement of the amount of RNA by OD measurement.
Assays were performed with samples on standard acrylamide
sequencing gels and used to identify digested cytokine messages.
Gels containing digested RNA bands were first exposed to a Phosphor
Screen (Molecular Dynamics, Inc., Sunnyvale, Calif.). The exposed
screen was then scanned with a phosphorimager Storm 860 (Molecular
Dynamics, Inc.). Intensities of bands in each sample were analyzed
with the software ImageQuant.TM. (Molecular Dynamics, Inc.).
[0099] Appropriate care should be taken to prevent RNAse
contamination of the samples since skin is a rich source of RNAse
that can quickly degrade RNA released from damaged epidermal cells.
The sample collection and extraction techniques described herein
demonstrate that skin RNA can indeed be obtained without
significant degradation as indicated by the ability to detect mRNA
by RPA.
[0100] Example 2
Analysis of Cells Obtained by Tape Stripping
[0101] Irritant contact dermatitis (ICD) was induced by applying
0.5% sodium lauryl sulfate (SLS) in distilled water for 72 hours to
the upper arm. After this exposure, the erythema was graded
according to standard scoring sales (Fisher's Contact Dermatitis.
4th ed. Rietschel, R. L. and Fowler, J. F. Jr. eds. Williams &
Wilkins, Baltimore, 1995, pg. 29). Allergic contact dermatitis
(ACD) was induced by applying dibutyl squarate in acetone to the
upper arm of the same subject under occlusion for 48 hours. The
upper arms of the same individual (subject #1) were tape stripped
12 times and processed as described in Example 2 above.
[0102] FIG. 1, lane 1 shows the RNA isolated from an ACD
erythematous area of skin, read clinically as 3+ erythema, that was
induced by squarate. Lane 3 is the RNA from ICD erythematous skin,
clinically scored as 2+ erythema, induced after exposure to 0.5%
SLS. After exposure of the x-ray film, the band for cytokine IL-4
can be clearly seen in lane 1, but not in lane 3 which contains RNA
from ICD cells. Thus, the cytokine pattern in the ACD reaction
clearly differed from the ICD reaction and normal skin seen in lane
2.
[0103] In a subsequent experiment, all subjects with dermatitis had
mRNA encoding the cytokine IL-4 in cells from skin in areas that
had demonstrated an ACD reaction (lanes 8, 11, 13 in FIG. 2). By
contrast, IL-4 was not visible in any of the ICD treated areas of
skin or in normal skin samples obtained from the same subjects.
Furthermore, in 4 of 5 subjects (subjects 2, 3, 4 and 5 in FIG. 2),
IL-8 was present in erythematous areas of skin, whether the
erythema was induced by an irritant or an allergic reaction, but
not in the RNA obtained from normal skin. Thus, IL-8 mRNA was
generically indicative of dermatitis.
[0104] The mRNA encoding IL-13, a cytokine secreted by activated T
cells, was present in 3 of the 4 erythematous areas of skin (lanes
5, 8, 11, 13 in FIG. 2) in which allergic inflammation had been
induced by squarate. A faint band could be seen in the approximate
area(s) expected to contain the mRNA with the molecular weight
associated with gamma interferon (IFN-.gamma.) (lanes 8 and 11 in
FIG. 2). These bands were present in the mRNA extracted from 2 of
the 5 squarate (ACD) treated skin samples. As was the case for
IL-13, the tentative band for IFN-.gamma. mRNA was seen in the same
lanes that also had mRNA for IL-4.
[0105] IL-14, a B cell growth factor, was present in some of the
squarate treated skin samples as well as some of the SLS treated
skin samples (FIG. 2). IL-9, a multifunctional cytokine, was
detected in all 13 samples that could be visualized in this
experiment. In addition, the mRNA for the inducible isoform of
nitric oxide synthase (iNOS) and IL-9 were seen in every lane that
could be visualized clearly (13 of 15 samples) (FIG. 2). The
presence of IL-4 in the same lanes as IL-13 strongly suggests that
these two cytokine markers were induced by an allergic reaction in
the skin from which the samples were obtained.
[0106] The clinical quantification of the erythema visualized in
the various skin reactions is documented in Tables 1 and 2.
TABLE-US-00003 TABLE 1 ACD REACTIONS SKIN SUBJECT REACTION IL-4
IL-8 IL-9 IL-13 iNOS IFN.gamma. #1 0 ND ND + ND + ND #2 2+ + + NT
NT NT NT #3 2+ + + + + + + #4 2+ + + * + * + #5 2+ + + + + + + ND =
not detected *gel not readable NT = not tested 2+ = moderate
erythema (red)
TABLE-US-00004 TABLE 2 ICD REACTIONS SKIN SUBJECT REACTION IL-4
IL-8 IL-9 IL-13 iNOS IFN.gamma. #1 0 ND ND + ND + ND #2 2+ + + NT
NT NT NT #3 1+ ND + + + + ND #4 1+(low) ND ND + ND ND ND #5 3+ * +
* * * * ND = not detected *gel not readable NT = not tested 1+ =
mild erythema (pinkish) 2+ = moderate erythema (red) 3+ = strong
erythema (beet red)
Example 3
[0107] To further examine the relationship between the cytokines
and the degree of inflammation in subject numbers 3-5, the IL-4,
IL-8 and IL-13 RNA levels were normalized to the corresponding
housekeeping gene levels (Table 3). Among the three subjects
analyzed, a correlation exists between the RNA levels and the
severity of the reactions. Table 2 shows that the samples from the
strongest skin reactions were also the ones that demonstrated the
largest relative amount of IL-8 in the ACD reaction. For example,
subject #4 with a 2+ reaction at the ACD site and only a slight
(low +1) reaction at the ICD site showed an approximate two fold
difference in the IL-8/GAPDH ratios when comparing the ICD and ACD
reactions using the RPA method described above. In addition, one
would predict an ACD reaction if, on the gel, there is a band for
IL-4 and a value for IL-4/GAPDH of about 0.001 or higher. Also, an
ACD reaction can be confirmed where there is an IL-13 band with an
IL-13/GAPDH value of about 0.13 or higher (Table 3).
TABLE-US-00005 TABLE 3 TYPE OF REACTION Subject ICD ACD 3
IL-4/GAPDH NC NC IL-8/GAPDH 0.3495 0.8867 iNOS/GAPDH 0.2202 0.2652
IL-13/GAPDH 0.070 0.251 4 IL-4/GAPDH 0 0.01559 IL-8/GAPDH 0.2879
0.61080 iNOS/GAPDH 0.07107 0.2661 IL-13/GAPDH 0.117 0.134 5
IL-4/GAPDH 0 0.07255 IL-8/GAPDH 0.2541 1.3023 iNOS/GAPDH 0.05315
0.1951 IL-13/GAPDH 0.055 0.158 NC = not calculated
[0108] A number of embodiments of the present invention have been
described. Nevertheless, it will be understood that various
modifications may be made without departing from the spirit and
scope of the invention. Accordingly, other embodiments are within
the scope of the following claims.
Example 4
[0109] This example identifies genes which are differentially
expressed at the mRNA level, in early or late stage melanoma cells
compared to normal cells. These genes are melanoma skin markers
according to the present invention. An adhesive tape was used to
obtain mRNA from frozen tissue samples of malignant melanoma and
control nevi, and skin surface gene expression profiling studies
(SSGEP) with a cDNA array were performed, to produce a set of
potential genetic markers that can be utilized for a non-invasive
molecular diagnostic screening procedure for melanoma. Candidate
genes that were identified on the cDNA array were further
investigated using RT-PCR with SYB-R green detection. The genes
encoding IL-1 RI, endothelin-2, and ephrin-A5 were found to be
differentially regulated between control nevi and early melanoma
using the SSGEP procedure on frozen tissue samples. Likewise, the
genes encoding IGF Binding Protein 7, HLA-A0202 heavy chain,
Activin A (.beta.A subunit), TNF RII, SPC4, and CNTF R.alpha. were
found to be differentially regulated between control nevi and
advanced melanoma. Identification of genes implicated in the
progression of early stage melanoma is important for developing
molecular diagnostic assays for screening and staging melanoma, as
well as for developing more effective therapeutics for this deadly
disease.
[0110] Since melanoma appears to modulate gene expression of
neighboring cells, it was hypothesized that it may be possible to
detect early melanoma by examining gene expression profiles of
outer skin cells overlying a suspicious lesion. Neighboring effects
are most obvious and well documented for various secreted
cytokines. For example, it has been previously described for the
expression of macrophage migratory inhibitory factor, MIF, that it
stimulates the expression of metalloproteinases in fibroblasts,
which may help to invade the dermis in case of a malignant tumor
that excessively produces MIF (Onodera S, et al., J. Biol. Chem.
275:444-450, 2000). MIF was found by our coworkers to be
overexpressed in highly tumorigenic variants of melanoma cell lines
if compared to less tumorigenic variants (Vogt et al., Submitted,
2001). Similar neighboring effects may happen in the keratinocyte
population, too: In the case of melanoma detection, basal cells
that were formerly in the vicinity of a melanocyte, and have
migrated into the upper epidermis through the differentiation
process, may preserve mRNA profiles induced in response to the
underlying melanoma, and paracrine effects of a plethora of
pathological cytokines may induce a characteristic profile of the
keratinocytes adjacent to the tumor and higher upwards in the
epidermis. This is reflected by the clinical finding, that advanced
tumors often lead to atrophy and erosion of the epidermis
overlaying the lesion.
[0111] Molecular analysis of cells in their native environment is
thought to provide the most accurate picture of the in vivo disease
state (Liotta and Petricoin, Nature Reviews/Genetics 1:48-56,
2000). Since biopsied tissues are three dimensional structures
containing numerous interacting cellular subpopulations, it is
difficult to isolate the molecular signatures of a particular cell
type. The present Example utilizes a method for obtaining a sample
from the surface of a suspected melanoma lesion or a control
nevi.
[0112] In order to develop a non-invasive molecular diagnostic
assay for early melanoma detection, the use of a skin surface
sampling method was combined with a specialized cDNA array to
determine differentially expressed genes between malignant melanoma
and normal nevi. The gene array contained approximately 600 genes,
specific for cytokines, receptors, and growth factors. An adhesive
tape was utilized to obtain skin cells. This technique is referred
to herein as skin surface gene expression profiling (SSGEP).
[0113] In SSGEP, epidermal cells are removed using a tape stripping
methodology in which successive tapes are applied to the same skin
site, and removed in a rapid progression, until a sufficient depth
is reached for sampling gene expression profiles (need tape
stripping reference). The epidermis consists predominantly of
keratinocytes (>90%), which differentiate from the basal layer,
moving outward through various layers having decreasing levels of
cellular organization, to become the cornified cells of the stratum
corneum layer. Renewal of the epidermis occurs every 20-30 days in
normal skin. Other cell types present in the epidermis include
melanocytes, Langerhans cells, and Merkel cells.
[0114] Since melanoma appears to modulate gene expression of
neighboring cells, it was hypothesized that it may be possible to
detect early melanoma by examining gene expression profiles of
outer skin cells overlying a suspicious lesion. Neighboring effects
are most obvious and well documented for various secreted
cytokines. For example, it has been previously described for the
expression of macrophage migratory inhibitory factor, MIF, that it
stimulates the expression of metalloproteinases in fibroblasts,
which may help to invade the dermis in case of a malignant tumor
that excessively produces MIF (Onodera et al., J. Biol. Chem.
275:444-450, 2000). MIF was found by our coworkers to be
overexpressed in highly tumorigenic variants of melanoma cell lines
if compared to less tumorigenic variants (Vogt et al., Submitted,
2001). Similar neighboring effects may happen in the keratinocyte
population, too. In the case of melanoma detection, basal cells
that were formerly in the vicinity of a melanocyte, and have
migrated into the upper epidermis through the differentiation
process, may preserve mRNA profiles induced in response to the
underlying melanoma, and paracrine effects of a plethora of
pathological cytokines may induce a characteristic profile of the
keratinocytes adjacent to the tumor and higher upwards in the
epidermis. This is reflected by the clinical finding, that advanced
tumors often lead to atrophy and erosion of the epidermis
overlaying the lesion.
Materials and Methods
Tape Stripping
[0115] Frozen tissue samples for gene expression profiling studies
of malignant melanoma were obtained from the University of
Regensburg Department of Dermatology. A group of six control benign
nevi, four early malignant melanoma samples (Pagetoid epidermal
scattering), and 4 advanced malignant melanoma samples (epidermal
atrophy) were randomly selected from the tissue collection.
D-squame tapes (Cu-Derm, Texas) were utilized to isolate skin cells
from the frozen biopsies for skin surface gene expression
profiling. The D-squames were cleaned with RNA zap (Ambion) prior
to use. The surface of the biopsy samples was cleaned with alcohol,
dried, and then moistened with a 1/10 dilution of commercial RNAse
inhibitor. Isolation of skin cells from the frozen biopsy samples
was performed in a cryostat by pressing a D-squame tape tightly
against the tissue, quickly removing the tape, and repeating this
tape-stripping procedure until the tape surface was covered with
cells. Up to 30 tapes were collected in this manner from a single
biopsy, and placed in a sterile RNase free culture dish. The
D-Squame tape samples were stored at -80.degree. C. until the next
processing step.
RNA Extraction
[0116] D-squame tape samples were brought to -20 in the cryostat.
For RNA extraction, tapes from a single biopsy sample were
successively submersed in one volume (750 .mu.l) of RLT lysis
buffer (Qiagen) in a microcentrifuge tube by placing the tapes
individually in the microcentrifuge tube containing the RLT buffer,
performing a rapid freeze-thaw cycle in liquid nitrogen, and
scraping the tape surface with a sterile inoculation loop. After
extraction, each tape was removed using forceps and discarded. The
procedure was repeated until all tapes in the pool were extracted.
RNA was isolated following the RNeasy protocol, with on column
DNAase digest. RNA was eluted from the column using 30 .mu.l of
RNAse free water (Promega), and concentrated to about 5 .mu.l at
4.degree. C. using a Speed Vic.
Synthesis of cDNA
[0117] Double-stranded cDNA was synthesized by reverse
transcription of the total RNA and subsequent amplification of the
first strand cDNA using the SMART PCR II kit (Clontech). The
optimum number of PCR cycles was determined by taking aliquots from
the PCR reaction after 10, 15, 20, and 25 reaction cycles, and
analyzing by gel electrophoresis. The lane on the gel having a
moderately strong smear of cDNA ranging from 0.5 to 6 kb, and
several bright bands, was chosen to represent the optimum number of
PCR cycles for an abundance of cDNA transcripts. A second reaction
was prepared and cycled to this optimal number of cycles. The
Qiagen PCR purification kit was utilized to purify the double
stranded cDNA (Becker et al., J. Invest. Dermatol. 116:983-988,
2001).
Probe Labeling
[0118] Approximately 25 ng of the double stranded cDNA from the PCR
reaction was labeled with a .sup.32P-deoxycytidine triphosphate
using randomly primed Klenow fragment synthesis. Non-incorporated
nucleotides were removed using the Nuctrap and beta shield kits
(Stratagene).
Array Hybridization
[0119] The Sigma Panorama array, containing 600 cytokines,
receptors, and growth factors was used to probe for differentially
expressed genes in the malignant melanoma biopsies (Sigma-Genosys,
The Woodlands, Tex.). The Sigma Panorama filter array was
prehybridized for 24 hours in 5 mL of Sigma-Genosys hybridization
solution at 65 C. The .sup.32P-labeled cDNA samples (probes) were
denatured for 2 minutes in a boiling water bath, and then applied
to the filter array for 48 hours at 65 C. The filter array was
washed three times with a 0.5.times.SSPE/1% SDS solution (RT
solution I) for 3 minutes, and once with RT Solution II at 65 C for
20 minutes (0.1.times.SSPE/1% SDS). The array filter was exposed to
autoradiography film for 24-48 hours and to phosphor imager
cassettes for quantitation.
Quantitation of Hybridization Signals
[0120] The hybridization signals were measured by a phosphor
imager, and analyzed using the AIDA Metrix.sup.R software
(Raytest). A background correction was performed, and the signals
were normalized using the signals from the housekeeping genes. For
each group of malignant melanoma samples (early and late stage),
pair-wise comparisons were made between the malignant melanoma
samples and the normal nevi control samples based on the normalized
integrated signal intensities. Signals for candidate genes
differing by more than a factor of three were identified, and
statistical significance was determined using a non-parametric test
(U test).
RT-PCR Confirmation of Markers
[0121] Real time RT-PCR with SyBr Green detection was utilized to
verify IL1-RI results in a semi-quantitative manner, the relative
abundance of the candidate marker genes with respect to the control
gene GAPDH. For example, for IL1 RI expression analysis using
RT-PCR, the primers of SEQ ID NO:1 and SEQ ID NO:3 were used.
Results
[0122] By comparing skin surface gene expression profiles in early
malignant melanoma with control nevi, three differentially
expressed genes were identified (Table 4). For advanced malignant
melanoma, six differentially expressed genes were identified by
comparison with the control nevi (Table 5). Each gene identified in
a malignant melanoma group (early or advanced) was differentially
expressed in all four of the melanoma samples. The differentially
expressed genes in the early malignant melanoma group were distinct
from those in the advanced group.
TABLE-US-00006 TABLE 4 Markers discriminating early melanomas from
nevi. Endothelin-2 p = 0.005 ephrin-A5 p = 0.009 IL-1 RI p =
0.009
TABLE-US-00007 TABLE 5 Markers discriminating advanced melanomas
from nevi. HLA-A 0201 heavy chain p = 0.002 Activin A (bA subunit)
p = 0.002 IGF Binding Protein 7 p = 0.003 TNF RII p = 0.03 SPC4 p =
0.03 CNTF Ra p = 0.03
[0123] Expression levels for all of the advanced stage melanoma
skin markers identified herein, in benign nevi versus advanced
malignant melanoma are shown in FIG. 3. The expression levels of
all of the advanced stage melanoma skin markers were higher in
advanced malignant melanoma samples than in benign nevi.
[0124] Expression levels for all of the early stage melanoma skin
markers identified herein, in benign nevi versus advanced malignant
melanoma are shown in FIG. 4. The expression levels of all of
endothelin-2 and ephrinA5 were higher in early stage malignant
melanoma samples than in benign nevi. The expression level of IL1
RI was lower in early stage melanoma than in benign nevi.
[0125] Semi-quantitative RT PCR of IL1 RI gene expression, was
performed on a set of tape sampled material different from that
used for the experiment described above. Among 11 patient tape
samples, IL1 RI gene expression was lower in melanoma samples than
in benign samples, except for one false negative (i.e. malignant
melanoma patient sample with an elevated IL1 RI reading), and one
false positive reading (i.e. benign nevi patient sample with a
depressed IL1 RI reading) (FIG. 5).
Discussion
[0126] Over 100 genes have been reported to have significance in
the progression of malignant melanoma (see Table 6). A few
potentially promising candidates under discussion, P16, CDKN2A,
melastatin, and the Mage-A family of genes are among those reported
to have potential diagnostic or prognostic value.
[0127] While germline mutations in p16 or CDKN2A are found in a
significant percentage of relatively rare melanoma families, p16
mutations are rare in sporadic tumors (Bataille, Clin. Exp.
Dermatol. 25(6):464-467, 2000). Deletion or inactivation of CDKN2A
appears to be involved in the progression rather than the
initiation of sporadic malignant melanoma (Cachia et al., Clin.
Cancer Res.6(9):3511-3515, 2000).
[0128] Based on in-situ hybridization studies with biopsy samples,
it was recently reported that melastatin mRNA expression appeared
to correlate with melanocytic tumor progression, melanoma tumor
thickness, and the potential for melanoma metastasis (Deeds et al.,
Human Pathology 31(11):1346-1356, 2000; Duncan et al., Journal of
Clinical Oncology 19(2):568-576, 2001). The loss of melastatin mRNA
expression correlated with poor prognosis. Downregulation of the
melastatin gene was originally observed using a mouse melanoma cell
line, B16, with high metastatic potential (Duncan et al., J Clin
Oncol, 19(2):568-76, 2001). Since the melastatin marker appears to
be melanocyte specific, a prognostic assay based on melastin mRNA
will most likely require a biopsy.
[0129] A genetic test based on three members of a family of cancer
related genes called MAGE-A was recently reported for the detection
of metastatic cancer in blood or tissue (Miyashiro et al., Clinical
Chemistry 47(3):505-512, 2001). A multiplex assay is advantageous,
since gene markers are often expressed at a low frequency, and
variations in gene expression profiles exist across individuals.
While 40% of the patients with stage IV melanoma had detectable
levels of Mage-A mRNAs in their blood samples, 0% of stage I
patients, and 14% of stage II or stage III patients exhibited
detectable Mage-A mRNAs.
[0130] Using a hierarchical clustering algorithm, it was recently
shown that differentially regulated genes in melanoma biopsy
samples were related to a vascular-like morphology that correlated
with motility and invasiveness (Bittner et al., Nature 406:536-540,
2000). However, the clustering pattern could not be correlated with
clinical or histological findings.
[0131] This example identifies three genes, IL-1 RI, endothelin-2,
and ephrin-A5, as being differentially regulated in early melanoma
(stage I, pT1) using a non-invasive skin sampling method. Although
endothelin-1 and endothelin-3 have been previously linked to
melanoma progression, an association between elevated levels of
ephrin-2 and early melanoma has not been reported.
[0132] Although IL-1 RI has been reported to be linked to melanoma
progression, these reports were based on cultured melanoma cells
and were not skin cells from sample obtained using a non-invasive
sampling method (Dekker et al., Melanoma Res. 7(3):223-230, 1997).
Furthermore, Dekkar et al. 1997, is silent as to differential
expression of IL-1 RI during a particular stage (i.e. early stage)
of melanoma progression.
[0133] Ephrin-A5 has been reported to modulate cell adhesion and
morphology (Robbins, EMBO J. 19(20):5396-5405, 2000). The ephrins
are ligands for the Eph receptors, which are the largest known
subfamily of receptor tyrosine kinases, ephrins are cell
surface-associated proteins important for development, particularly
in cell-cell interactions that promote processes such as nervous
system patterning, angiogenesis, and oncogenesis.
[0134] Up-regulation of ephrin-A 1 has been previously observed in
melanoma biopsies, in increasing amounts in more advanced melanomas
(Easty et al., Int. J. Cancer 84:494, 1999). Since the
pro-inflammatory cytokines TNF-.alpha. and IL-1.beta. both induce
ephrin-A1 expression in melanoma cells, it was postulated that
ephrin-A1 expression may be related to host inflammatory responses
to advanced lesions ephrin-A1 was also suspected to so promote
vascularization of the tumor, thus contributing to further growth
and metastasis (Easty et al., Int. J. Cancer 84:494, 1999). It is
likely that ephrin-A5 contributes to melanoma progression through a
similar mechanism.
[0135] The development of a molecular diagnostic screening test for
early melanoma comprising the markers IL-1 RI, endothelin-2, and
ephrin-A5, in combination with a non-invasive skin surface sampling
method is described here. While the samples described here were
obtained from frozen tissue, gene expression profiles are expected
to be identical in freshly isolated human skin cell samples on the
adhesive tape because the tissues used were snap frozen in Nitrogen
immediately after excision and kept at -80.degree. C. until the
study was performed. Skin samples isolated on tape appear to be
stable toward RNA degradation due to the relatively desiccated
nature of stratum corneum cells. The markers identified here have
utility in both diagnostic and prognostic applications and serve as
aids for initial therapeutic decisions possibly saving many lives
and reducing the cost of this safety by avoiding unnecessary
excisions and biopsies.
TABLE-US-00008 TABLE 6 Actin AX/.alpha./.beta./acidic Adenosin
Deaminase B2m BAGE BAX bcl-2 BFGF brn-2/N-Oct3 c-jun, c-fos, jun-B
c-k-ras c-kit c-met c-myc c-ski c-src-1 Calcyclin Calmodulin
Cathepsin B,D Cyclin A,B,D CDK4 E-Cadherin ECK Endothelin-1
Rezeptor EWS-ATF-1 FGF-Rezeptor-1 Sialyltransferase Familie GM-CSF
gro/MGSA H/Ki/K/N ras H-2Db/H-2Kb (MHC Klasse I) HER2/neu
(Rezeptortyrosinkinase) HOX Gene (Homeoboxgene) FGF Familie hst
ICAM1 IGF-1 IL1,2,6,8,10 IL4-Rezeptor Integrine z.B.
.alpha.V.beta.3 Interferon System MHC Klasse II Kollagenase
(Gelatinase A/B, Metalloproteinasen) rap1-Krev1 Laminine Lerk
Familie (Liganden der eph-verwandten Rezeptortyrosinkinasen) LRP
M-CSF MAGE1/2 MCAF MCP-1 mda-6 (p21), mda-7 MDR-1 Me14-D12 ME20
ME491 Mel-18 Melan-A Methallothionein MIA Mitochondriale Gene MnSOD
MRP MSH-R p15 (MTS2) MUC18/MCAM MYB MZ2-E,F n-myc NF-1 Nma Nmb NME
(nm23-1/2) NSE Ornithindecaboxylase p-Glycoproteine p16INK4
(CDKN2/MTS1) p97 PAIs PCNA PDGF PKC isoformen pp125FAK PRB
Ribosomale Gene S100 TAL1 TCL5 Tenascin TGF .alpha. TGF .beta.
1,2,3 TGF .beta. II Rezeptor Thrombospondin Thymosin .beta. 10
TIMP-1 TNF .alpha. TPA Transglutaminase-TT Tropomyosin 3
uPA-Rezeptoren VEGF-R Vinculin Vitronectin-Rezeptor VLA-1,2,4,5 WT1
Sequence CWU 1
1
28120DNAArtificial sequencePCR primer 1ttcaggacat tactattgcg
20220DNAArtificial sequenceTarget sequence 2cgcaatagta atgtcctgaa
20321DNAArtificial sequencePCR primer 3ttccacactg taatagtctt c
21421DNAArtificial sequenceTarget sequence 4gaagactatt acagtgtgga a
21517DNAArtificial sequencePCR primer 5ctgccaaggc gctgtca
17617DNAArtificial sequenceTarget sequence 6tgacagcgcc ttggcag
17718DNAArtificial sequencePCR primer 7tcagtccagg gccttcga
18818DNAArtificial sequenceTarget sequence 8tcgaaggccc tggactga
18913DNAArtificial sequenceProbe sequence 9tgccagggac ccc
131013DNAArtificial sequenceTarget sequence 10ggggtccctg gca
131124DNAArtificial sequencePCR primer 11aacatgctgc acttgaagaa gaga
241224DNAArtificial sequenceTarget sequence 12tctcttcttc aagtgcagca
tgtt 241321DNAArtificial sequencePCR sequence 13gaagctttct
gatcgcgttc a 211421DNAArtificial sequenceTarget sequence
14tgaacgcgat cagaaagctt c 211515DNAArtificial sequenceProbe
sequence 15ccggctgggt gacat 151615DNAArtificial sequenceTarget
sequence 16atgtcaccca gccgg 151718DNAArtificial sequencePCR primer
17gcgtgtgcgt gtgcaaga 181818DNAArtificial sequenceTarget sequence
18tcttgcacac gcacacgc 181917DNAArtificial sequencePCR primer
19cagccgctcg ggtaggt 172017DNAArtificial sequenceTarget sequence
20acctacccga gcggctg 172113DNAArtificial sequenceProbe sequence
21cgctgccgca cac 132213DNAArtificial sequenceTarget sequence
22gtgtgcggca gcg 132325DNAArtificial sequencePCR primer
23gcacaagcca tatttaagca gaaac 252425DNAArtificial sequenceTarget
sequence 24gtttctgctt aaatatggct tgtgc 252525DNAArtificial
sequencePCR primer 25aactccatat aagggcacac aagtc
252625DNAArtificial sequenceTarget sequence 26gacttgtgtg cccttatatg
gagtt 252716DNAArtificial sequenceProbe sequence 27ctccgtctcc
tgcaac 162816DNAArtificial sequencePCR sequence 28gttgcaggag acggag
16
* * * * *