U.S. patent application number 12/768800 was filed with the patent office on 2010-11-04 for method of enhancing proliferation and/or hematopoietic differentiation of stem cells.
This patent application is currently assigned to CHILDREN'S MEDICAL CENTER CORPORATION. Invention is credited to George Q. Daley, Alan J. Davidson, Leonard I. Zon.
Application Number | 20100278792 12/768800 |
Document ID | / |
Family ID | 32043295 |
Filed Date | 2010-11-04 |
United States Patent
Application |
20100278792 |
Kind Code |
A1 |
Zon; Leonard I. ; et
al. |
November 4, 2010 |
METHOD OF ENHANCING PROLIFERATION AND/OR HEMATOPOIETIC
DIFFERENTIATION OF STEM CELLS
Abstract
The present invention provides a method for enhancing the
proliferation and/or hematopoietic differentiation and/or
maintenance of mammalian stem cells. The method is useful for
generating expanded populations of hematopoietic stem cells (HSCs)
and thus mature blood cell lineages. This is desirable where a
mammal has suffered a decrease in hematopoietic or mature blood
cells as a consequence of disease, radiation or chemotherapy. The
method of the present invention comprises increasing the
intracellular level of a cdx in stem cells, including hematopoietic
stem cells, in culture, either by providing an exogenous cdx
protein to the cell, or by introduction into the cell of a genetic
construct encoding a cdx. The cdx is selected from the cdx family
and includes cdx1, cdx2, or cdx4. The cdx may be a wild type
protein appropriate for the species from which the cells are
derived, or a mutant form of the protein.
Inventors: |
Zon; Leonard I.; (Wellesley,
MA) ; Davidson; Alan J.; (West Roxbury, MA) ;
Daley; George Q.; (Weston, MA) |
Correspondence
Address: |
DAVID S. RESNICK
NIXON PEABODY LLP, 100 SUMMER STREET
BOSTON
MA
02110-2131
US
|
Assignee: |
CHILDREN'S MEDICAL CENTER
CORPORATION
Boston
MA
|
Family ID: |
32043295 |
Appl. No.: |
12/768800 |
Filed: |
April 28, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12191402 |
Aug 14, 2008 |
|
|
|
12768800 |
|
|
|
|
10528808 |
Mar 23, 2005 |
7427603 |
|
|
PCT/US03/29185 |
Sep 18, 2003 |
|
|
|
12191402 |
|
|
|
|
60413816 |
Sep 26, 2002 |
|
|
|
Current U.S.
Class: |
424/93.21 ;
424/93.7; 435/366; 435/375; 435/377 |
Current CPC
Class: |
C12N 2510/00 20130101;
A61K 38/00 20130101; C12N 2506/02 20130101; A61P 7/06 20180101;
A61P 7/00 20180101; C12N 5/0647 20130101; C12N 2501/60 20130101;
C12N 2799/027 20130101; C07K 14/705 20130101 |
Class at
Publication: |
424/93.21 ;
435/377; 435/366; 435/375; 424/93.7 |
International
Class: |
A61K 35/12 20060101
A61K035/12; C12N 5/10 20060101 C12N005/10; C12N 5/071 20100101
C12N005/071; A61P 7/06 20060101 A61P007/06 |
Claims
1. A method for enhancing proliferation or hematopoietic
differentiation of a mammalian stem cell comprising, transfecting
said stem cells in an in vitro culture medium with an exogenous
nucleic acid comprising a cdx coding sequence operably linked to a
promoter.
2. The method of claim 1, wherein the stem cell is a hematopoietic
stem cell.
3. The method of claim 1, wherein the cell is a CD34.sup.+
cell.
4. The method of claim 1, wherein the cell is autologous.
5. The method of claim 1, wherein the cell is obtained from a
human.
6. The method of claim 5, wherein the human is suffering from, or
is susceptible to, decreased blood cell levels.
7. The method of claim 6, wherein the decreased blood cell levels
are caused by chemotherapy, radiation therapy, bone marrow
transplantation therapy or congenital anemia.
8. The method of claim 1, wherein the exogenous nucleic acid is a
retroviral vector.
9. The method of claim 1, wherein the exogenous nucleic acid is an
episomal vector.
10. The method of claim 1, wherein the stem cell is an embryonic
stem cell.
11. The method of claim 1, wherein the cdx is selected from the
group consisting of cdx 1 and cdx 2.
12. A method of treating a mammal in need of improved hematopoietic
capability, comprising the steps of: (a) removing hematopoietic
stem cells from the mammal; (b) transfecting said stem cells with
exogenous nucleic acid comprising cdx sequences; (c) culturing said
transfected stem cells to form an expanded population of stem
cells; and (d) returning said expanded cells to the mammal, whereby
hematopoietic capability is improved.
13. The method of claim 12, wherein the mammal is a human.
14. The method of claim 12, wherein the exogenous nucleic acid is a
retroviral vector.
15. The method of claim 12, wherein the cdx is selected from the
group consisting of cdx 1 and cdx 2.
16. A method for enhancing proliferation or hematopoietic
differentiation of a mammalian stem cell comprising, treating said
stem cells by addition in an in vitro culture medium of an
exogenous cdx peptide.
17. The method of claim 16, wherein the stem cell is a
hematopoietic stem cell.
18. The method of claim 16, wherein the cell is a CD34.sup.+
cell.
19. The method of claim 16, wherein the cell is autologous.
20. The method of claim 16, wherein the cell is obtained from a
human.
21. The method of claim 20, wherein the human is suffering from, or
is susceptible to, decreased blood cell levels.
22. The method of claim 21, wherein the decreased blood cell levels
are caused by chemotherapy, radiation therapy, bone marrow
transplantation therapy, or congenital anemia.
23. The method of claim 16, wherein the stem cell is an embryonic
stem cell.
24. The method of claim 16, wherein said cdx is genetically fused
to a transport moiety.
25. The method of claim 24, wherein said transport moiety is a
fragment of HIV tat protein.
26. The method of claim 16, wherein the cdx is selected from the
group consisting of cdx 1 and cdx 2.
27. A method of treating a mammal in need of improved hematopoietic
capability, comprising the steps of: (a) removing hematopoietic
stem cells from the mammal; (b) treating said stem cells by
administration of exogenous cdx4 peptide; (c) culturing said stem
cells to form an expanded population of stem cells; and (d)
returning said expanded cells to the mammal, whereby hematopoietic
capability is improved.
28. The method of claim 27, wherein the mammal is a human.
29. The method of claim 27, wherein the cdx is selected from the
group consisting of cdx 1 and cdx 2.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Continuation application of co-pending
U.S. patent application Ser. No. 12/191,402 filed Aug. 14, 2008,
which is a Continuation application of U.S. patent application Ser.
No. 10/528,808 filed Mar. 23, 2005 now issued as U.S. Pat. No.
7,427,603 issued on Sep. 23, 2008, which is U.S. National Stage
Entry under 35 U.S.C. .sctn.371 of International Application No.
PCT/US03/29185, filed Sep. 18, 2003, which claims priority from
U.S. Provisional Application No. 60/413,816, filed on Sep. 26,
2002.
BACKGROUND OF THE INVENTION
[0002] Chemo- and radiation therapies cause dramatic reductions in
blood cell populations in cancer patients. At least 500,000 cancer
patients undergo chemotherapy and radiation therapy in the US and
Europe each year and another 200,000 in Japan. Bone marrow
transplantation therapy of value in aplastic anemia, primary
immunodeficiency and acute leukemia (following total body
irradiation) is becoming more widely practiced by the medical
community. At least 15,000 Americans have bone marrow transplants
each year. Other diseases can cause a reduction in entire or
selected blood cell lineages. Examples of these conditions include
anemia (including macrocytic and aplastic anemia);
thrombocytopenia; hypoplasia; immune (autoimmune) thrombocytopenic
purpura (ITP); and HIV induced ITP.
[0003] Pharmaceutical products are needed which are able to enhance
reconstitution of blood cell populations of these patients.
SUMMARY OF THE INVENTION
[0004] The present invention provides a method for enhancing the
proliferation and/or hematopoietic differentiation and/or
maintenance of mammalian stem cells. The method is useful for
generating expanded populations of hematopoietic stem cells (HSCs)
and thus mature blood cell lineages. This is desirable where a
mammal has suffered a decrease in hematopoietic or mature blood
cells as a consequence of disease, radiation or chemotherapy. The
method of the present invention comprises increasing the
intracellular level of a cdx in stem cells, including hematopoietic
stem cells, in culture, either by providing an exogenous cdx
protein to the cell, or by introduction into the cell of a genetic
construct encoding a cdx. The cdx is selected from the cdx family
and includes cdx1, cdx2, or cdx4. The cdx may be a wild type
protein appropriate for the species from which the cells are
derived, or a mutant form of the protein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0005] FIGS. 1-5 show that cdx4 alters hox gene expression in
zebrafish and mouse cells and induces blood development in embryoid
bodies.
[0006] FIG. 1 shows effect of cdx4 and HoxB4 overexpression on
hematopoietic progenitors derived from embryoid bodies (EBs).
Colony forming units scored are macrophage (Mac), megakaryocytes
and mixed lineage (Meg-mix), granulocyte, macrophage (GM), and
granulocyte, macrophage, megakaryocyte (GEMM). Photographs of
representative colonies are shown below the graph.
[0007] FIG. 2 shows quantitative PCR analysis of the expression of
selected HoxA, HoxB, and HoxC cluster genes in EBs overexpressing
cdx4.
[0008] FIG. 3 shows RT-PCR analysis of cdx4 expression during EB
development.
[0009] FIG. 4 shows the effect of cdx4 overexpression on
hematopoietic development during different stages of EB development
using tetracycline-inducible murine embryonic stem cell lines. cdx4
expression was induced by the addition of doxycycline between the
days indicated below the graph and hematopoietic colony formation
was assayed at day 6. The types of colonies scored were the same as
above, which the addition of primitive and definitive erythroid
colonies (Ery-P and Ery-D, respectively) and mast cell colonies
(Mast).
[0010] FIG. 5 shows a model for the role of cdx4 in AP patterning
and blood development. Signaling molecules such as FGFs, Wnts, and
retinoic acid (RA) are known to regulate the expression of cdx4,
which in turn establishes the correct expression domains of hox
genes necessary for blood development. In the absence of cdx4
(right panel), hox expression domains are shifted and fewer
erythroid cells are formed.
DETAILED DESCRIPTION OF THE INVENTION
[0011] The present invention provides a method for enhancing the
proliferation and/or hematopoietic differentiation and/or
maintenance of mammalian stem cells. The method is useful for
generating expanded populations of hematopoietic stem cells (HSCs)
and thus mature blood cell lineages. This is desirable where a
mammal has suffered a decrease in hematopoietic or mature blood
cells as a consequence of disease, radiation, chemotherapy or
congenital anemia (e.g., Diamond Blackfan Anemia). The method of
the present invention comprises increasing the intracellular level
of a cdx in stem cells, including hematopoietic stem cells, in
culture, either by providing an exogenous cdx protein to the cell,
or by introduction into the cell of a genetic construct encoding a
cdx. The cdx is selected from the cdx family and includes cdx1,
cdx2, or cdx4. The cdx may be a wild type protein appropriate for
the species from which the cells are derived, or a mutant form of
the protein.
[0012] The differentiated and expanded cell populations are useful
as a source of hematopoietic stem cells, which may be used in
transplantation to restore hematopoietic function to autologous or
allogeneic recipients.
[0013] In one embodiment, mammalian stem cells are differentiated
to HSCs in vitro by increasing the level of cdx in the cell. In
another embodiment, the number of HSCs in a culture is expanded by
increasing the levels of cdx in the cell. The intracellular levels
of cdx may be manipulated by providing exogenous cdx protein to the
cell, or by introduction into the cell of a genetic construct
encoding a cdx. The cdx may be a wild-type or a mutant form of the
protein.
[0014] The term cdx, as used herein, is intended to refer to both
wild-type and mutant forms of the cdx protein family, and to fusion
proteins and derivatives thereof. Usually the protein will be of
mammalian origin, although the protein from other species may find
use. The sequences of many cdx proteins are publicly known.
Preferably, the mammal is a human and the cdx is selected from the
group consisting of cdx1(GenBank accession number NM.sub.--001804;
Suh et al., J. Biol. Chem. 277:35795 (2002)), cdx2 (GenBank
accession number NM.sub.--001265; Yamamoto et al., Biochem.
Biophys. Res. Commun. 300(4):813 (2003)), or cdx4 (GenBank
accession number NM.sub.--005193; Horn et al., Hum. Mol. Genet.
4(6), 1041-1047 (1995)).
[0015] In one embodiment of the invention, the cdx is delivered to
the targeted stem cells by introduction of an exogenous nucleic
acid expression vector into the cells. Many vectors useful for
transferring exogenous genes into target mammalian cells are
available. The vectors may be episomal, e.g. plasmids, virus
derived vectors such cytomegalovirus, adenovirus, etc., or may be
integrated into the target cell genome, through homologous
recombination or random integration, e.g. retrovirus derived
vectors such MMLV, HIV-1, ALV, etc.
[0016] Retrovirus based vectors have been shown to be particularly
useful when the target cells are hematopoietic stem cells. For
example, see Baum et al. (1996) J Hematother 5(4):323-9;
Schwarzenberger et al. (1996) Blood 87:472-478; Nolta et al. (1996)
P.N.A.S. 93:2414-2419; and Maze et al. (1996) P.N.A.S. 93:206-210.
Lentivirus vectors have also been described for use with
hematopoietic stem cells, for example see Mochizuki et al. (1998) J
Virol 72(11):8873-83. The use of adenovirus based vectors with
hematopoietic cells has also been published, see Ogniben and Haas
(1998) Recent Results Cancer Res 144:86-92.
[0017] Various techniques known in the art may be used to transfect
the target cells, e.g. electroporation, calcium precipitated DNA,
fusion, transfection, lipofection and the like. The particular
manner in which the DNA is introduced is not critical to the
practice of the invention.
[0018] Combinations of retroviruses and an appropriate packaging
line may be used, where the capsid proteins will be functional for
infecting the target cells. Usually, the cells and virus will be
incubated for at least about 24 hours in the culture medium.
Commonly used retroviral vectors are "defective", i.e. unable to
produce viral proteins required for productive infection.
Replication of the vector requires growth in the packaging cell
line.
[0019] The host cell specificity of the retrovirus is determined by
the envelope protein, env (p120). The envelope protein is provided
by the packaging cell line. Envelope proteins are of at least three
types, ecotropic, amphotropic and xenotropic. Retroviruses packaged
with ecotropic envelope protein, e.g. MMLV, are capable of
infecting most murine and rat cell types. Ecotropic packaging cell
lines include BOSC23 (Pear et al. (1993) P.N.A.S. 90:8392-8396).
Retroviruses bearing amphotropic envelope protein, e.g. 4070A
(Danos et al, supra.), are capable of infecting most mammalian cell
types, including human, dog and mouse. Amphotropic packaging cell
lines include PA12 (Miller et al. (1985) Mol. Cell. Biol.
5:431-437); PA317 (Miller et al. (1986) Mol. Cell. Biol.
6:2895-2902) GRIP (Danos et al. (1988) PNAS 85:6460-6464).
Retroviruses packaged with xenotropic envelope protein, e.g. AKR
env, are capable of infecting most mammalian cell types, except
murine cells.
[0020] The sequences at the 5' and 3' termini of the retrovirus are
long terminal repeats (LTR). A number of LTR sequences are known in
the art and may be used, including the MMLV-LTR; HIV-LTR; AKR-LTR;
FIV-LTR; ALV-LTR; etc. Specific sequences may be accessed through
public databases. Various modifications of the native LTR sequences
are also known. The 5' LTR acts as a strong promoter, driving
transcription of the cdx gene after integration into a target cell
genome. For some uses, however, it is desirable to have a
regulatable promoter driving expression. Where such a promoter is
included, the promoter function of the LTR will be inactivated.
This is accomplished by a deletion of the U3 region in the 3' LTR,
including the enhancer repeats and promoter, that is sufficient to
inactivate the promoter function. After integration into a target
cell genome, there is a rearrangement of the 5' and 3' LTR,
resulting in a transcriptionally defective provirus, termed a
"self-inactivating vector".
[0021] Suitable inducible promoters are activated in a desired
target cell type, either the transfected cell, or progeny thereof.
By transcriptional activation, it is intended that transcription
will be increased above basal levels in the target cell by at least
about 100 fold, more usually by at least about 1000 fold. Various
promoters are known that are induced in hematopoietic cell types,
e.g. IL-2 promoter in T cells, immunoglobulin promoter in B cells,
etc.
[0022] In an alternative method, expression vectors that provide
for the transient expression in mammalian cells may be used. In
general, transient expression involves the use of an expression
vector that is able to replicate efficiently in a host cell, such
that the host cell accumulates many copies of the expression vector
and, in turn, synthesizes high levels of a desired polypeptide
encoded by the expression vector. Transient expression systems,
comprising a suitable expression vector and a host cell, allow for
the convenient short term expansion of cells, but do not affect the
long term genotype of the cell.
[0023] In some cases it may be desirable to provide exogenous cdx
protein, rather than transducing the cells with an expression
construct. The cdx protein may be added to the culture medium at
high levels. Preferably the cdx protein is modified so as to
increase its transport into the cells. See, for example, US
2002/0086383.
[0024] In one embodiment of the invention, tat protein is used to
deliver cdx. The preferred transport polypeptides are characterized
by the presence of the tat basic region amino acid sequence (amino
acids 49-57 of naturally-occurring tat protein); the absence of the
tat cysteine-rich region amino acid sequence (amino acids 22-36 of
naturally-occurring tat protein) and the absence of the tat exon
2-encoded carboxy-terminal domain (amino acids 73-86 of
naturally-occurring tat protein). Transport polypeptides are
attached to cdx by chemical cross-linking or by genetic fusion,
where the cdx moiety may be a wild-type or stabilized form. A
unique terminal cysteine residue is a preferred means of chemical
cross-linking.
[0025] The term stem cell is used herein to refer to a mammalian
cell that has the ability both to self-renew, and to generate
differentiated progeny (see Morrison et al. (1997) Cell
88:287-298). Generally, stem cells also have one or more of the
following properties: an ability to undergo asynchronous, or
symmetric replication, that is where the two daughter cells after
division can have different phenotypes; extensive self-renewal
capacity; capacity for existence in a mitotically quiescent form;
and clonal regeneration of all the tissue in which they exist, for
example the ability of hematopoietic stem cells to reconstitute all
hematopoietic lineages. "Progenitor cells" differ from stem cells
in that they typically do not have the extensive self-renewal
capacity, and often can only regenerate a subset of the lineages in
the tissue from which they derive, for example only lymphoid, or
erythroid lineages in a hematopoietic setting.
[0026] Stem cells may be characterized by both the presence of
markers associated with specific epitopes identified by antibodies
and the absence of certain markers as identified by the lack of
binding of specific antibodies. Stem cells may also be identified
by functional assays both in vitro and in vivo, particularly assays
relating to the ability of stem cells to give rise to multiple
differentiated progeny.
[0027] Stem cells can be derived from a human donor, e.g.,
pluripotent hematopoietic stem cells, adult somatic stem cells, and
the like. Embryonic stem cells may also be used. Stem cells can
also be obtained from umbilical cord blood, amniotic fluid,
chorionic villus and placenta. See, WO03042405.
[0028] Other hematopoietic "progenitor" cells of interest include
cells dedicated to lymphoid lineages, e.g. immature T cell and B
cell populations. The methods of the present invention are useful
in expanding selected populations of these cells.
[0029] Purified populations of stem or progenitor cells may be used
to initiate the cultures. For example, human hematopoietic stem
cells may be positively selected using antibodies specific for
CD34, thy-1; or negatively selected using lineage specific markers
which may include glycophorin A, CD3, CD24, CD16, CD14, CD38,
CD45RA, CD36, CD2, CD19, CD56, CD66a, and CD66b.
[0030] The cells of interest are typically mammalian, where the
term refers to any animal classified as a mammal, including humans,
domestic and farm animals, and zoo, laboratory, sports, or pet
animals, such as dogs, horses, cats, cows, mice, rats, rabbits,
etc. Preferably, the mammal is human.
[0031] The cells which are employed may be fresh, frozen, or have
been subject to prior culture. They may be fetal, neonate, adult.
Hematopoietic cells may be obtained from fetal liver, bone marrow,
blood, particularly G-CSF or GM-CSF mobilized peripheral blood,
cord blood or any other conventional source. The manner in which
the stem cells are separated from other cells of the hematopoietic
or other lineage is not critical to this invention. As described
above, a substantially homogeneous population of stem or progenitor
cells may be obtained by selective isolation of cells free of
markers associated with differentiated cells, while displaying
epitopic characteristics associated with the stem cells.
[0032] The stem or progenitor cells are grown in vitro in an
appropriate liquid nutrient medium. Generally, the seeding level
will be at least about 10 cells/ml, more usually at least about 100
cells/ml and generally not more than about 10.sup.5 cells/ml,
usually not more than about 10.sup.4 cells/ml.
[0033] Various media are commercially available and may be used,
including Ex vivo serum free medium; Dulbecco's Modified Eagle
Medium (DMEM), RPMI, Iscove's medium, etc. The medium may be
supplemented with serum or with defined additives. Appropriate
antibiotics to prevent bacterial growth and other additives, such
as pyruvate (0.1-5 mM), glutamine (0.5-5 mM), 2-mercaptoethanol may
also be included.
[0034] Culture in serum-free medium is of particular interest. The
medium may be any conventional culture medium, generally
supplemented with additives such as iron-saturated transferrin,
human serum albumin, soy bean lipids, linoleic acid, cholesterol,
alpha thioglycerol, crystalline bovine hemin, etc., that allow for
the growth of hematopoietic cells.
[0035] Preferably the expansion medium is free of cytokines,
particularly cytokines that induce cellular differentiation. The
term cytokine may include lymphokines, monokines and growth
factors. Included among the cytokines are thrombopoietin (TPO);
nerve growth factors; platelet-growth factor; transforming growth
factors (TGFs); erythropoietin (EPO); interferons such as
interferon-.alpha., .beta., and .gamma.; colony stimulating factors
(CSFs) such as macrophage-CSF (M-CSF); granulocyte-macrophage-CSF
(GM-CSF); and granulocyte-CSF (G-CSF); interleukins (ILs) such as
IL-1, IL-1.gamma., IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9,
IL-11, IL-12; etc. In some circumstances, proliferative factors
that do not induce cellular differentiation may be included in the
cultures, e.g. c-kit ligand, LIF, and the like.
[0036] Frequently stem cells are isolated from biological sources
in a quiescent state. Certain expression vectors, particularly
retroviral vectors, do not effectively infect non-cycling cells.
Cultures established with these vectors as a source of cdx
sequences are induced to enter the cell cycle by a short period of
time in culture with growth factors. For example, hematopoietic
stem cells are induced to divide by culture with c-kit ligand,
which may be combined with LIF, IL-11 and thrombopoietin. After 24
to 72 hours in culture with cytokines, the medium is changed, and
the cells are exposed to the retroviral culture, using culture
conditions as described above.
[0037] After seeding the culture medium, the culture medium is
maintained under conventional conditions for growth of mammalian
cells, generally about 37.degree. C. and 5% CO.sub.2 in 100%
humidified atmosphere. Fresh media may be conveniently replaced, in
part, by removing a portion of the media and replacing it with
fresh media. Various commercially available systems have been
developed for the growth of mammalian cells to provide for removal
of adverse metabolic products, replenishment of nutrients, and
maintenance of oxygen. By employing these systems, the medium may
be maintained as a continuous medium, so that the concentrations of
the various ingredients are maintained relatively constant or
within a pre-described range. Such systems can provide for enhanced
maintenance and growth of the subject cells using the designated
media and additives.
[0038] These cells may find various applications for a wide variety
of purposes. The cell populations may be used for screening various
additives for their effect on growth and the mature differentiation
of the cells. In this manner, compounds which are complementary,
agonistic, antagonistic or inactive may be screened, determining
the effect of the compound in relationship with one or more of the
different cytokines.
[0039] The populations may be employed as grafts for
transplantation. For example, hematopoietic cells are used to treat
malignancies, bone marrow failure states and congenital metabolic,
immunologic and hematologic disorders. Marrow samples may be taken
from patients with cancer, and enriched populations of
hematopoietic stem cells isolated by means of density
centrifugation, counterflow centrifugal elutriation, monoclonal
antibody labeling and fluorescence activated cell sorting. The stem
cells in this cell population are then expanded in vitro and can
serve as a graft for autologous marrow transplantation. The graft
will be infused after the patient has received curative
chemo-radiotherapy.
[0040] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention nor are they intended to represent that the
experiments below are all or the only experiments performed.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g. amounts, temperature, etc.) but some experimental errors
and deviations should be accounted for. Unless indicated otherwise,
parts are parts by weight, molecular weight is weight average
molecular weight, temperature is in degrees Centigrade, and
pressure is at or near atmospheric.
[0041] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference.
EXAMPLES
Introduction
[0042] The formation of blood cells during vertebrate development
occurs in successive stages in anatomically distinct sites.sup.6.
In amniotes, the first wave (known as primitive or embryonic
hematopoiesis) originates in the yolk sac blood islands and is
characterized by the formation of erythroid and endothelial cells.
The coincident onset of both hematopoiesis and vasculogenesis in
the yolk sac has led to the hypothesis that both cell types are
derived from a common precursor, termed the hemangioblast.sup.7. In
zebrafish, embryonic hematopoiesis occurs in an intra-embryonic
location known as the intermediate cell mass (ICM). The ICM
develops along the trunk midline by the convergence of bilateral
stripes of hematopoietic and vascular precursors. One of the
earliest molecular markers of these ICM precursors is the stem cell
leukemia (scl) gene, which encodes a basic helix-loop-helix
transcription factor.sup.8, 9. Gene targeting studies in mice have
demonstrated that scl is necessary for the development of all
hematopoietic lineages. In contrast, endothelial cells are present
in scl null embryos but fail to remodel properly in the yolk
sac.sup.10, 11. Studies in zebrafish have shown that overexpression
of scl during development is sufficient to induce ectopic blood and
vascular cells and these findings have led to the suggestion that
scl is capable of specifying hemangioblast fate from
mesoderm.sup.8.
[0043] While fate-mapping studies in zebrafish have shown that
embryonic blood cells arise from ventral mesoderm of the late
blastula.sup.12, 13 the molecular pathways responsible for inducing
the early expression of scl are largely unknown. In general,
posterior tissues of mesodermal origin are derived from ventral
mesoderm whereas anterior tissues descend from more dorsal
mesoderm. Consistent with this, genes that `ventralize` the early
gastrula embryo, such as the bone morphogenetic proteins (BMPs),
induce an expansion of blood and posterior tissues at the expense
of more anterior structures such as the head.sup.14. Thus, factors
that determine posterior cell fates along the anteroposterior (AP)
axis must also be intimately connected with genes that specify
ventral fates including blood.
[0044] The establishment of tissues along the AP axis of the embryo
is dependent upon the homeobox transcription factors encoded by the
hox genes.sup.15. Within the genome, these genes are grouped
together in clusters (HoxA, HoxB, HoxC and HoxD) and are expressed
in overlapping domains along the AP axis with their anterior
expression limits correlating to their physical order within the
cluster. Perturbations in these anterior expression boundaries
result in changes in cell fate and this has led to the `Hox code`
hypothesis, in which specific combinations of Hox genes are
believed to specify tissue identities along the AP axis.sup.15.
Despite being held as critical regulators of embryonic patterning,
the effects of germline disruptions of Hox genes in the mouse are
largely restricted to the axial skeleton, neural crest, central
nervous system, and limbs.sup.3, 15. The relatively mild phenotypes
of single Hox gene knockouts in mice can be explained by extensive
functional redundancy between paralogous genes within each
cluster.
[0045] A number of studies have demonstrated that ectopically
expressed hox genes can influence hematopoietic lineage
decisions.sup.4, 5. For example, overexpression of HoxA9, HoxB4,
and HoxB7 has been shown to modulate the proliferation/self-renewal
of mouse hematopoietic stem cells.sup.16-19. In addition,
ectopically expressed HoxB4 can induce embryonic hematopoietic
progenitors to acquire properties characteristic of adult
hematopoietic stem cells.sup.20. Deregulated Hox gene expression is
also associated with leukemia transformation.sup.4, 5.
Overexpression of HoxA9.sup.18, 21 or HoxA10.sup.22 in murine bone
marrow ultimately leads to acute myeloid leukemia (AML) whereas
proviral activation of HoxA7 has been implicated in myeloid
leukaemia.sup.23. A subset of human AML is associated with a fusion
of the NUP98 gene, which encodes a component of the nuclear pore
complex, to a number of different HOX genes including HOXA9.sup.24.
Translocations involving the MLL gene, a homologue of MLL that is
required for the maintenance of HOX gene expression, have also been
implicated in certain human leukemias.sup.25.
[0046] In this study we have characterized the zebrafish kugelig
(kgg) mutant, which exhibits reduced scl expression, severe anemia,
and a shortened AP axis. We identify the kgg locus as the
caudal-related homeobox gene cdx4 and show that the defect in
erythropoiesis is associated with aberrant hox gene expression.
Overexpressing scl in kgg mutants fails to rescue blood development
indicating that the specification of hematopoeitic cell fate is
dependent upon cdx4 function. In contrast, erythropoiesis in kgg
mutants can be robustly rescued by overexpressing hoxb7a and hoxa9a
but not hoxb8a, suggesting that the hematopoietic defects result
directly from perturbations in hox gene expression. Overexpression
of cdx4 during zebrafish development or in mouse embryonic stem
cells induces blood formation and alters hox gene expression
patterns. Taken together, our findings demonstrate that cdx4 is
both necessary and sufficient for the formation of embryonic blood
cells during vertebrate development.
Example 1
Methods
[0047] Computer analysis. The genetic map position of kgg was
obtained from the Max-Planck-Institut fur Entwicklungsbiologie
(Tubingen, Germany) website. Genomic sequence of the cdx4 locus was
obtained from the Wellcome Trust Sanger Institute website. RH
mapping data was provided by the Children's Hospital Genome
Initiative (Boston, Mass.) website. Protein sequence prediction and
alignment were performed using DNAstar software.
[0048] Deletion analysis and genotyping. The following primers to
each exon of the cdx4 gene were used to determine the extent of the
kgg.sup.tv205 deletion by PCR: exon one (forward
5'-AGCTCCTTTTGGACTATTAC-3' (SEQ ID NO: 1); reverse
5'-CCAACGTACATGATTTGGAA-3' (SEQ ID NO: 2)), exon two (forward
5'-ATACCTTTTGGAGAAAGAGG-3' (SEQ ID NO: 3); reverse
5'-CCGGTTGATGACGACTGGAC-3' (SEQ ID NO: 4)), exon three (forward
5'-CAAAACGAGAACGAAGGAGA-3' (SEQ ID NO: 5); reverse
5'-ACCTGTCTCTCTGAAAGCCC-3' (SEQ ID NO: 6)), and exon four (forward
5'-TAAGATCTGGTTTCAGAACC-3' (SEQ ID NO: 7); reverse
5'-TGGATGATCCAAGTTCGAGT-3' (SEQ ID NO: 8)). Exon three forward and
exon four reverse primers were used to genotype kgg.sup.tv205
embryos. Primers specific to the ESTs fj63c09, fb79h04, flk1
(fk52c05), fb75e05, chic1 (fj33g02), fc54b04, and fi30c11 were
obtained from the WashU Zebrafish Genome Resources Project website,
while primer sequences for the markers z20545 and z11437 were
obtained from the Massachusetts General Hospital Zebrafish Server
website. 3' rapid amplification of cDNA ends (RACE) was performed
using the SMART RACE kit (Clontech), cDNA prepared from 14-15
somite stage kgg.sup.tv205 mutants, and the cdx4-specific primer
5'-AGCCTCGGACCTCCAAATTC-3' (SEQ ID NO: 9). PCR products were
subcloned in the pGEM-T easy vector (Promega, Madison, Wis.) and
sequenced.
[0049] Electrophoretic mobility shift assays. EMSAs were performed
using the Gel Shift Assay System (Promega, Madison, Wis.) and in
vitro translated (IVT) proteins prepared using the TNT SP6 Quick
Coupled Transcription/Translation System (Promega, Madison, Wis.).
Double-stranded oligonucleotide probes contained a single consensus
cdx binding site (5'-GAGAAATTTATATTGT-3' (SEQ ID NO: 10); binding
site consensus is underlined) or mutated site
(5'-GAGAAATCCATATTGT-3' (SEQ ID NO: 11); mutated nucleotides are
underlined)..sup.35 S-methionine-labelled IVT cdx4 (wt) and the
F(170)L mutant proteins were resolved on a 10-20% Tris-HCl
polyacrylamide gel (Ready Gels, Biorad, Hercules, Calif.) alongside
prestained broad range standards (Biorad) and analyzed by
autoradiography.
[0050] Fish strains. The kgg.sup.tv205 and kgg.sup.tl240 mutant
lines were obtained from the Tubingen stock center (Tubingen,
Germany) and exhibit a similar severity of phenotype. Wild-type
strains were AB, Tu, and WIK. Fish maintenance, breeding, and
embryo staging were performed according to standard procedures.
[0051] Inducible cdx4 ES cell lines and colony assays. The
inducible cdx4-targeting plasmid (plox-cdx4) was generated by
subcloning mouse cdx4 into the EcoRI/XbaI site of the plox
vector.sup.20. To make the tetracycline-inducible cdx4 ES cell
line, Ainv15 ES cells were electroporated with 20 ug of plox-cdx4
and 20 ug of pSalk-Cre, followed by selection with G418 (400 ug/ml)
in ES culture medium. Colonies positive for plox-cdx4 were
confirmed by RT-PCR. The tetracycline-inducible cdx4 ES cells and
EBs were maintained and produced as described previously.sup.20.
Briefly, day 2 EBs from hanging-drops were harvested and cultured
in rotating Petri dishes. Doxycycline was added into EB medium for
the indicated time periods and then removed by three washes of PBS,
followed by ES culture medium. EBs were collected at day 6 by
collagenase treatment and plated into Methocult GF M3434 (StemCell
Technologies). The colonies were scored 6-9 days later.
[0052] Microinjection. Wild-type and F(170)L mutant cdx4 cDNAs were
subcloned into the expression vector pCS2.sup.+, linearized with
NotI, and synthetic mRNA made using the mMessage mMachine kit
(Ambion, Austin, Tex.). Capped RNA was resuspended in sterile water
and 500 pl was injected between the one- to four-cell stages at a
concentration of 30 ng/.mu.l. Full-length hoxb6b, hoxb7a hoxb8a,
and hoxa9a were amplified from 5-somite stage cDNA by RT-PCR using
forward (hoxb6b: 5'-ATGCGAATTCCCCATGAGTTCCTATTTCGTCA-3' (SEQ ID NO:
12); hoxb7a: 5'-ATGCGAATTCACCATGAGTTCATTGTATTATGCG-3' (SEQ ID NO:
13); hoxb8a: 5'-ATGCGAATTCACCATGAGCTCATATTTCGTCAAC-3' (SEQ ID NO:
14); hoxa9a: 5'-ATGCGAATTCACCATGTCGACATCCGGAGCT-3' (SEQ ID NO: 15);
start codon underlined)) and reverse (hoxb6b:
5'-GCATCTCGAGCTACATTCTACATGTTATGTAC-3' (SEQ ID NO: 16); hoxb7a:
5'-GACTCTCGAGCTACTCATCATCTTCTTCTTC-3' (SEQ ID NO: 17); hoxb8a:
5'-GCATCTCGAGCTACATTTGTTTTGCCTTGTC-3' (SEQ ID NO: 18); hoxa9a:
5'-GATCTCTAGATTAGTCTTCCTTCGTTTC-3' (SEQ ID NO: 19); stop codon
underlined) primers and subcloned (along with scl) into pCS2+.
Synthetic mRNAs were prepared as above and 500 pl was injected at a
concentration of 200, 6 and 2-4 ng/.mu.l, for scl, hoxb7a/hoxa9a,
and hoxb6b/hoxb8a, respectively. The cdx4 morpholinos
(CGTACATGATTTGGAAGAAACCCCT (SEQ ID NO: 20); start codon underlined)
were obtained from Gene Tools LLC (Corvallis, Oreg.) and
solubilized in 1.times. Danieau solution (58 mM NaCl, 0.7 mM KCl,
0.4 mM MgSO4, 5 mM HEPES, pH 7.6) at a stock concentration of 35
mg/ml. One- to four-cell stage embryos were injected with 1 nl of
cdx4 morpholino or an unrelated control morpholino (provided by
Gene Tools LLC) at a concentration of 0.2 mg/ml. Injections were
performed on a PLI-100 microinjector (Medical systems corp.,
NY).
[0053] Mutation analysis by RT-PCR. Total RNA was prepared from
kgg.sup.tv205 and kgg.sup.tl240 mutant and wild-type embryos at 24
h.p.f. using established procedures and reverse transcribed using
Superscript II RNAse H-reverse transcriptase (Invitrogen, Carlsbad,
Calif.). The cdx4 ORF was amplified using forward
(5'-CATGTACGTTGGATACCTTTTGG-3' (SEQ ID NO: 21)) and reverse
(5'-TCCACAACCCACGCCTCTTATT-3' (SEQ ID NO: 22)) primers, subcloned
into the pGEM-T easy vector (Promega, Madison, Wis.) and sequenced.
Our cDNA sequence of wild-type cdx4 differs from the published
sequence (Genbank accession number NM.sub.--131109) by the addition
of two cytosine nucleotides at +709-710. These extra nucleotides
are also found in the cdx4 genomic sequence deposited in the Sanger
Center database. The resulting frameshift changes the open reading
frame of the carboxy terminus to give a predicted protein of 271
residues rather than the published length of 301 resides.sup.32.
The F(170)L mutation of the kgg.sup.tl240 allele was confirmed by
sequencing six independent clones.
[0054] Radiation hybrid mapping. The cdx4 gene was mapped onto the
Goodfellow RH panel by the Children's Hospital Genome Initiative
group (Boston, Mass.) using the following forward
(5'-AGGCGTGGGTTGTGGATTAC-3' (SEQ ID NO: 23)) and reverse
(5'-GATACACTCACCACATACAG-3' (SEQ ID NO: 24)) primers. The contig
encoding the foreign exon spliced onto exon 2 of cdx4 in
kgg.sup.tl240 mutants was mapped using forward
(5'-GTGATCAACAACACGTCC-3' (SEQ ID NO: 25)) and reverse primers
(5'-GGAATCTCCTGTCAGCTG-3' (SEQ ID NO: 26)).
[0055] Retroviral expression of cdx4 in ES cells and quantitative
PCR. Murine cdx4 was subcloned into the retroviral expression
vector MSCV-IRES-GFP (pMIG) and retroviruses were generated using
an ecotropic packaging vector and co-transfection to make viral
supernatents. Embryoid bodies were formed from wild-type (RW4) ES
cells by differentiating for 6 days and then definitive
hematopoietic cells were enriched using an anti-CD41 magnetic
strategy resulting in a 10-fold enrichment of CD41/c-Kit.sup.+
cells. Approximately one million enriched cells were plated on OP9
monolayers in a 6-well dish and subjected to two rounds of
retroviral infection with either GFP only or cdx4/GFP retroviral
supernatants. After 48 hours, GFP cells were sorted and were either
directly lysed in Trizol (Invitrogen, Carlsbad, Calif.) for RNA
preparation, or were plated in methylcellulose (M3434, StemCell
Technologies) and scored for colony types 3-7 days later.
Representative colonies were cytospun and stained using Jorvet
J-322 Dip Quik, (Jorgensen Laboratories Inc., Loveland, Colo.). To
quantitate the relative level of Hox gene mRNA, random
hexamer-primed cDNA was prepared from total RNA from either GFP
expressing or cdx4/GFP-expressing cells. Real time PCR measurements
were performed with an ABI Prism 7700 Sequence Detector and dual
labeled probes (sequence available on request), with the exception
of HoxB4, which was quantitated using Sybr green reagents (Applied
Biosystems). PCR reactions were performed in triplicate with
internal references (GAPDH) used to normalize samples. Hox
expression levels are expressed in arbitrary units (relative to the
lowest sample) using the comparative C.sub.T method.
[0056] In situ hybridization and sectioning. In situ hybridization
of mouse embryos was performed as previously described.sup.56.
Whole mount In situ hybridization of zebrafish embryos was
performed with double staining using the red substrate BCIP-INT.
Embryos were fixed overnight in 4% paraformaldehyde, transferred to
glycerol, flat-mounted under glass coverslips when possible, and
photographed. The following riboprobes were used: cdx4, cxcr4,
flk1, fli1, gata1, globin e3, hoxb5a, hoxb6b, hoxb7a, hoxb8a,
hoxa9a, myoD, par1, pax2.1, runx1, scl, and wt1. Full-length cDNAs
of the following hox genes were isolated by RT-PCR from 5-somite
stage cDNA and subcloned into pCS2+ for riboprobe synthesis: hoxb4
(forward 5'-ATGCGAATTCACCATGGCCATGAGTTCCTATTTG-3' (SEQ ID NO: 27);
reverse 5'-GCATCTCGAGCTATAGACTTGGCGGAGGTCC-3' (SEQ ID NO: 28)),
hoxb8b (forward 5'-ATGCGAATTCACCATGAGTTCCTACTTCGTCAAT-3' (SEQ ID
NO: 29); reverse 5'-GCATCTCGAGCTATTTAGAATTGCTAGAAGC-3' (SEQ ID NO:
30)). Embryos to be sectioned were infiltrated in JB-4 resin, cut
at a thickness of 5 .mu.m, and then counterstained in 0.5% Safranin
O before being mounted.
Results
Characterization of the kgg Mutant
[0057] We found that embryos homozygous for kugelig (kgg), an
autosomal recessive mutation that was initially identified due to
tail defects.sup.26, exhibit severe anemia within the first day of
development. Two kgg alleles, kgg.sup.tv205 and kgg.sup.tl240, of
equal severity have been isolated.sup.26. Although blood cell
numbers begin to recover by 5 days post-fertilization (d. p. f),
all mutants die between 7-10 d. p. f. To investigate the
hematopoietic defect in kgg, we examined the expression of scl,
gata1, and runx1. At the 5-somite stage, the bilateral stripes of
scl.sup.+ cells are thinner in kgg.sup.tv205 embryos compared to
wild-type (wt) controls. In addition, kgg.sup.tv205 mutants show a
decreased number of gata1.sup.+ erythroid precursors and a complete
absence of runx1 expression in blood and neuronal cells. Consistent
with the neuronal loss of runx1 expression there are reduced
numbers of Rohon-Beard cells at later stages. By 24 hours
post-fertilization (h. p. f.), kgg.sup.tv205 mutants have a severe
reduction in the number of globin-expressing erythroid cells
compared to wt siblings. In contrast, normal numbers of pu.1.sup.+
myeloid cells.sup.27, 28 are formed from the cephalic mesoderm in
kgg.sup.tv205 embryos. Similarly, markers of definitive
hematopoietic lineages, such as c-myb and rag1, are expressed in
kgg.sup.tv205 mutants at 36 h. p. f and 6 d. p. f., respectively.
To study the development of the vasculature in the mutant, we
examined the expression of the VEGF receptor, flk1. At the 10- and
15-somite stages, kgg.sup.tv205 embryos have relatively normal
numbers of angioblasts, although their convergence to the midline
is delayed. By 24 h. p. f., the vasculature appears well formed in
the mutants and the few blood cells that develop circulate
normally. The pronephric kidney arises from mesoderm adjacent to
the ICM precursors.sup.29. In kgg.sup.tv205 mutants, the expression
domains of the pronephric duct markers pax2.1.sup.30 and
cxcr4b.sup.31 are shortened, although unlike the scl stripes, the
width of the pax2.1 stripe is unaffected. Transcripts for the
glomerulus marker wt1.sup.29, which are normally expressed in
mesoderm adjacent to somites one through four, extend from somites
one through six in kgg.sup.tv205 embryos suggesting that the
kgg.sup.tv205 mutation leads to an expansion of anterior kidney
fates at the expense of more posterior fates. Other structures such
as the head, notochord, and somites appear grossly normal in
kgg.sup.tv205 embryos, although the length of the embryo is
shortened compared to wt embryos.
Identification of cdx4 as the Gene Defective in kgg Mutants
[0058] The kgg mutation maps to linkage group 14 near a number of
candidate genes including cdx4.sup.32, smad5.sup.33, and
wnt8.sup.34. An analysis of the cDNA sequence of wnt8 and smad5
from kgg mutants did not identify any mutations. cdx4 belongs to
the caudal family of homeobox genes that have been implicated in AP
patterning.sup.35-37. Three caudal paralogues exist in mammals
(cdx1, cdx2, and cdx4) and mouse gene-targeting studies of cdx1 and
cdx2 (cdx4 has yet to be targeted) have demonstrated a role for
these genes in the AP patterning of the axial skeleton.sup.38-40.
In addition, cdx2.sup.+/- mice develop hamartomatous polyps in the
colon that result from a transformation of the intestinal
epithelium to a more anterior (gastric) fate.sup.39, 41, 42.
Sequence analysis of the cdx4 gene from kgg.sup.tl240 mutants
revealed a T to A transversion in nucleotide +510, changing a
conserved F(170) residue in the homeodomain to a leucine. This
mutation prevents the protein from binding to a cdx4 consensus
binding site in gel shift experiments. A partial deletion of the
cdx4 gene, and at least one other neighboring gene (chic1), was
found in kgg.sup.tv205 mutants. To characterize this deletion in
more detail we isolated the cdx4 transcript in kgg.sup.tv205
mutants by 3' RACE and found that exon 2 had become spliced onto
downstream sequence that extended the cdx4 open reading frame by 11
amino acids (GFSSVFQSQSD-stop (SEQ ID NO. 31)). Radiation hybrid
(RH) mapping of this foreign sequence placed it 20 cR away from the
cdx4 locus. This analysis confirms that the kgg .sup.tv205 mutant
protein is truncated prior to the homeodomain and indicates that
the deletion responsible for the mutation is small (.about.0.5 cM).
To provide further evidence that the kgg phenotype is caused by
defects in cdx4, we injected wt embryos with cdx4 antisense
morpholinos and found that the resulting morphants phenotypically
resembled kgg embryos.
[0059] We next examined the expression pattern of cdx4 during
development. Transcripts for cdx4 are first detected in the early
gastrula but become restricted to the posterior-most cells during
gastrulation and early somitogenesis. Double whole mount In situ
hybridization and sectioning at the 3-somite stage revealed that
the cdx4 expression domain initially includes cells in the
posterior mesoderm that express scl. However, from the 5-somite
stage onward the expression domains of cdx4 and scl are largely
non-overlapping. Similar expression profiles were found for the
mouse orthologues of cdx4 and Scl during early embryogenesis. At
the late primitive streak stage (E7.25), cdx4 transcripts are
confined to mesodermal cells of the posterior embryo, the
allantois, and the forming yolk sac wall. While cdx4 is not
expressed in the nascent blood islands, its expression domain does
partially overlap with Scl in mesodermal cells of the posterior
primitive streak and the posterior yolk sac. Taken together, these
observations are consistent with a conserved, early role for cdx4
during the specification of hematopoietic fate.
Overexpression of cdx4 Induces Ectopic Blood Cells
[0060] To further explore the function of cdx4 during embryonic
hematopoiesis, we examined the effect of cdx4 overexpression in wt
embryos. Embryos injected with cdx4 mRNA (7, 15, or 30 pg) display
a range of "posteriorized" phenotypes. In contrast, embryos
injected with 15 pg of F(170)L mutant mRNA all exhibit a wt
morphology (n=60/60 embryos injected; data not shown). The effect
of cdx4 overexpression (15 pg) on blood development was examined at
the 5- to 12-somite stages. Surprisingly, 12-20% of the injected
embryos showed ectopic scl (n=24/118), gata1 (n=7/59), and fli1
(n=4/26) expression near the midline in a stripe that ran parallel
to the endogenous blood precursors. Cross sections revealed that
the ectopic scl.sup.+ cells were unilaterally located adjacent to
the notochord. The reason for this restricted localization is
currently unclear, however the genes induced appear specific to the
hematopoietic program as ectopic flk1 expression was confined to
the upper trunk region (n=11/69), whereas no ectopic expression of
pax2.1 was found (n=0/55). In contrast, 11-22% of the injected
embryos exhibited decreased expression of scl, gata1, fli1, flk1,
and pax2.1. The disrupted tissue development in these embryos may
result from abnormal gastrulation, or the conversion of mesoderm to
an extreme posterior fate. To assess the ability of cdx4 to rescue
kgg.sup.tv205 mutants, we injected 15 pg of cdx4 mRNA and assayed
the number of scl.sup.+ and gata1.sup.+ cells at the 5- and
10-somite stages, respectively. Consistent with cdx4 being the gene
defective in kgg mutants, the hematopoietic defects were partially
rescued in approximately 80% of injected mutants (n=15/19 mutants
for scl and n=27/33 mutants for gata1).
kgg Mutants Have Abnormal hox Gene Expression
[0061] In a number of metazoans, caudal homologues have been
implicated in AP patterning by regulating the expression of hox
genes.sup.38, 43-45. To investigate hox gene expression in kgg
mutants we examined the expression of selected hoxb cluster genes
and hoxa9a, as many of these hox genes are known to affect
haematopoiesis.sup.5. All of the hox genes examined (hoxb4, hoxb5a,
hoxb6b, hoxb7a, hoxb8a, hoxb8b, and hoxa9a) display altered
expression patterns in kgg.sup.tv205 embryos. For instance, the
mesodermal expression of hoxb5a normally includes somites two and
three, the notochord, and the tailbud region, but in kgg.sup.tv205
mutants, hoxb5a expression is expanded to include somites two to
five, is absent from the notochord, and is reduced in the tailbud.
In the case of hoxb6b and hoxa9a, the expression of these hox genes
is almost absent in kgg .sup.tv205 mutants.
Overexpression of hox Genes Rescues Erythropoiesis in kgg
Mutants
[0062] To further understand how the stripe of
hematopoietic/vascular precursors is affected by changes in AP
patterning, we examined the scl.sup.+ populations in more detail.
During normal development, transcripts for scl are first detected
around the 3-somite stage in stripes of mesoderm adjacent to the
future site of somite six. At the 5-somite stage, de novo
expression of scl occurs adjacent to somites one to five. These
cells are most likely angioblasts as they express flk1 but not
gata1. Transcripts for flk1 and gata1 in cells of the posterior
scl.sup.+ stripe appear mutually exclusive, suggesting that this
stripe is comprised of juxtaposed populations of angioblasts and
hematopoietic precursors.
[0063] In kgg mutants, there is a preferential loss of gata1.sup.+
hematopoietic cells from the posterior stripe with little effect on
the adjacent angioblasts. This blood loss in kgg mutants may
result, in part, from a posterior shift in the boundary between the
anterior (angioblast) and posterior (blood and angioblast)
scl.sup.+ populations. In support of this, the expression domains
of hoxb6b, hoxb7a, and hoxa9a, which share an anterior expression
limit with gata1, are significantly reduced in kgg.sup.tv205
mutants as early as the 3-somite stage. In contrast, the scl.sup.+
anterior angioblasts are found rostral to the hoxb7a expression
domain but at a similar AP level as hoxb5a. Given that hox gene
overexpression can transform cell fates.sup.15 and that a number of
hox genes are expressed during mouse yolk sac
haematopoiesis.sup.46, we examined whether overexpression of hox
paralogues from the 6.sup.th, 7.sup.th, 8.sup.th, or 9.sup.th
groups were capable of rescuing the blood defect in kgg.sup.tv205
mutants. Mutants injected with 3 pg of hoxb7a and hoxa9a mRNA
displayed an almost complete rescue of gata1.sup.+ blood cells at
the 18-somite stage (65%; n=13/20 mutants and 100%; n=18/18,
respectively), although the axial and tail defects were not
rescued. In contrast, the highest non-toxic dose of hoxb6b mRNA
(1-2 pg; 64%; n=7/11) led to a small increase in gata1.sup.+ blood
cells, whereas the highest non-toxic level of hoxb8a mRNA (1-2 pg)
failed to rescue the blood defects (n=0/22 mutants; data not
shown). Taken together, these findings suggest that the
specification of hematopoietic cell fate is dependent upon the
proper expression of hox genes such hoxb7a and hoxa9a in the
posterior mesoderm and that overexpression of any one of these cdx4
targets can rescue erythropoiesis in kgg mutants.
[0064] To provide further evidence that cdx4 and hox genes function
together in a common pathway, we examined whether cdx4
overexpression (15 pg) could rescue the expression of hoxb6b,
hoxb7a, and hoxa9a in cdx4 morphants. We found a restoration of
hoxb6b, hoxb7a, and hoxa9a expression domains in cdx4-rescued
morphants. Interestingly, approximately 80% of the injected embryos
also displayed ectopic hoxb7a expression in the forebrain and/or
hindbrain regions (n=31/39), thus supporting a role for cdx4 in the
induction of hox gene expression.
Overexpression of scl Fails to Rescue Erythropoiesis in kgg
Mutants
[0065] In zebrafish, overexpression of scl leads to an expansion of
hematopoietic cells in the posterior lateral plate mesoderm.sup.8.
We examined whether scl overexpression could rescue erythropoiesis
in kgg mutants. Wild-type embryos injected with scl mRNA (100 pg),
display an expanded number of gata1.sup.+ erythroid precursors at
the 10 somite stage. In contrast, no such expansion in erythroid
cell numbers was found in scl-injected kgg embryos. Given that cdx4
expression precedes that of scl in the posterior mesoderm, our
results suggest that the specification of hematopoietic fate by scl
is dependent on cdx4.
cdx4 Expands Multipotential Hematopoietic Progenitors Derived from
Murine ES Cells
[0066] Several studies have shown that retroviral expression of
Hoxb4 in hematopoietic stem cells or multipotential progenitors
enhances the self-renewal/proliferation of these cells.sup.16, 19,
47. To examine whether cdx4 has a similar activity, we retrovirally
transduced embryoid body (EB) hematopoietic cells with cdx4 and
assayed the effect on multilineage hematopoietic colony formation.
In this system, cdx4 induced a pronounced expansion of
hematopoietic progenitors, including a 13-fold increase in CFU-GEMM
(colony forming
unit-granulocyte/erythroid/macrophage/megakaryocyte) colonies and a
11-fold increase in CFU-GM colonies compared to GFP-only transduced
control cells (FIG. 1). The cdx4-mediated expansion of multilineage
progenitors and colony size was more potent than that observed with
Hoxb4, which induced a 9-fold increase in CFU-GEMM (FIG. 1). We
next examined changes in the expression of selected HoxA, HoxB, and
HoxC cluster genes in the cdx4-transduced cells using quantitative
PCR. Consistent with the role of cdx4 as a Hox gene regulator, we
found widespread alterations in Hox expression levels in cells
transduced with cdx4 compared to controls (FIG. 2). Notably, cdx4
induced a marked increase in the expression of HoxB4 (30-fold),
HoxB3 (19-fold), HoxB8 (5-fold) and HoxA9 (4.1-fold), all of which
have been implicated in hematopoietic stem cell or immature
progenitor expansion.sup.18, 48, 49. Taken together, these results
suggest that cdx4 can enhance the proliferation of early
hematopoietic progenitors by up-regulating the expression of target
Hox genes.
[0067] In EBs, precursors committed to primitive and definitive
hematopoietic fates arise between day 3 and 4 of
differentiation.sup.50. Consistent with our expression analyses in
vivo, we find endogenous expression of cdx4 at day 3 and 4 of EB
development (FIG. 3). To more closely investigate the time window
during EB differentiation in which cdx4 can enhance multilineage
hematopoietic colony formation we engineered ES cells to express
cdx4 under the control of a tetracycline-inducible promoter. A
`pulse` of cdx4 expression was induced at different intervals
during EB differentiation and hematopoietic colony formation was
assayed at day 6 (FIG. 4). The strongest effect of cdx4
overexpression on colony formation was found between day 4 and 5 of
EB development with increased multipotent progenitors (CFU-GEMM),
CFU-GM, and primitive erythroid colonies compared to uninduced EBs
(FIG. 4). These findings are consistent with cdx4 acting at early
stages of hematopoietic development to expand the number of
multipotential progenitor cells and perhaps, hematopoietic stem
cells.
Discussion
[0068] Our studies demonstrate that cdx4 is essential for
hematopoietic development during vertebrate embryogenesis. Defects
in cdx4 lead to an early deficit in scl-expressing hematopoietic
precursors, whereas overexpression of cdx4 in zebrafish embryos or
mouse ES cells induces blood formation. Loss of cdx4 function is
also associated with widespread perturbations in the expression
patterns of multiple hox genes. Furthermore, ectopic expression of
cdx4 in both zebrafish and mouse cells alters hox gene expression.
The rescue of blood development in kgg mutants by overexpressing
specific hox genes suggests a pathway in which cdx4 acts upstream
of the hox genes to control embryonic blood development.
[0069] Genetic studies in Drosophila led to the proposal that hox
genes function in specific combinations to confer tissue identities
along the AP axis.sup.1, 2. In kgg mutants, the expression domains
of hox genes expressed in the anterior trunk, such as hoxb4 and
hoxb5a, are expanded towards the posterior while others such as
hoxb6b, hoxb7a and hoxa9a are severely reduced. With regard to the
development of ICM precursors, these perturbations in hox
expression domains appear to cause a posterior shift in the
boundary between the anterior endothelial population and the more
posterior populations of blood and endothelial cells. In addition,
there is an overall reduction in erythroid cell numbers
(schematically represented in FIG. 5). The blood defects in kgg
mutants can be restored to almost wild-type levels by
overexpressing hoxa9a and hoxb7a, whereas hoxb6b rescues poorly and
hoxb8a fails to rescue. These observations suggest that multiple
hox genes with redundant activities participate in blood
development. In support of this redundancy, the targeted disruption
of HoxB6, HoxB7, or HoxA9 in mice does not block early embryonic
haematopoiesis.sup.51-53. Similarly, using morpholinos to
knock-down multiple hox genes we have been unable to find single or
combinations of hox genes that are required for blood formation
during zebrafish development. However, there are technical
limitations to this approach as non-specific toxicity makes it
difficult to inject more than three morpholinos simultaneously.
[0070] Our finding that scl overexpression fails to rescue blood
development in kgg mutants suggests that the cdx4-hox pathway may
be required to make the posterior lateral plate mesoderm competent
to respond to factors that specify hematopoietic fate. In addition
to scl, these factors are likely to include other molecules such as
BMPs, as we have found that enhancing BMP signaling also fails to
rescue the blood defect in kgg mutants. A role for hox genes as
`competence` factors during blood development may explain the
restricted localization of ectopic blood cells induced by cdx4
overexpression. Rather than being distributed throughout the
embryo, the ectopic blood forms a stripe near the midline that is
parallel to the endogenous stripes of hematopoietic precursors. The
parallel nature of the cdx4-induced blood cells suggests that the
genes responsible for patterning the endogenous stripes may also be
responsible for restricting the localization of the ectopic blood.
In this model, cdx4 overexpression would induce a combination of
hox genes that renders the injected cells competent to respond to
other pathways acting upstream of scl. The spatial localization of
these signals and the influence of other patterning factors would
then account for the restricted stripe of cdx4-induced blood.
[0071] Our results have implications for the concept of the
hemangioblast, a putative bipotential cell that is thought to
express scl and give rise to both blood and vascular lineages in
vivo.sup.54. kgg mutants display a reduced number of scl.sup.+
cells with a selective loss of blood but not angioblasts. This
finding suggests that if hemangioblasts exist in vivo then they
must arise prior to the onset of scl expression and that cdx4 is
necessary for this putative population to differentiate into an
scl.sup.+ hematopoietic precursor. Alternatively, the blood and
vascular lineages may arise independently from the posterior
mesoderm with cdx4 being required solely for the specification of
hematopoietic fate. Either model does not rule out the possibility
that early scl.sup.+ cells still retain the plasticity to form both
blood and vascular lineages if transplanted or cultured in a
suitable environment.
[0072] Our experiments support a conserved role for cdx4 in the
formation of hematopoietic cells during vertebrate embryogenesis.
Like the zebrafish orthologue, mouse cdx4 expression overlaps with
scl in posterior regions of the conceptus. In addition, cdx4
transcripts are enriched in the Rhodamine-123 low fraction of adult
mouse bone marrow, which contains the long term repopulating stem
cell (Thor Lemischka pers. comm.). Overexpression of cdx4 in EBs
promotes the formation of multilineage progenitors and alters the
expression of multiple Hox genes. The induction of hematopoietic
progenitors by cdx4 is similar to that seen with HoxB4
overexpression. Furthermore, cdx4 is able to upregulate the
expression of HoxB4 in EBs, raising the possibility that HoxB4
mediates the effect of cdx4 on multilineage progenitor expansion.
Given that HoxB4 can also confer upon primitive progenitors the
ability to engraft lethally irradiated adults.sup.20, it will be
interesting to examine the long-term, multilineage potential of
cdx4-expressing progenitors in this assay. Unlike HoxB4,
overexpression of cdx4 in EBs leads to significantly more CFU-GM
colonies compared to the control. This difference may result from
other Hox genes, or combinations of Hox genes, that are induced by
cdx4.
[0073] Deregulated expression of Hox genes by retroviral
activation, chromosomal translocation, or upregulation as a result
of mutations in upstream activators have all been implicated in
leukemic transformation.sup.5. The function of cdx genes as
transcriptional regulators of hox genes raises the possibility that
this family may also participate in leukemogenesis. In support of
this, a fusion of CDX2 to TEL/ETV6, a gene frequently rearranged in
hematological malignancies, has been found in a patient with acute
myeloid leukaemia.sup.55. CDX2 expression, which is not normally
found in hematopoietic cells, was also observed in a case of
leukemia lacking the translocation, suggesting that ectopic
expression of CDX2 can also occur by other mechanisms.sup.55. The
challenge for future studies will be to better understand how hox
genes downstream of cdx genes regulate commitment to a
hematopoietic fate and participate in leukemia.
Example 2
[0074] Injection of cdx2 morpholinos into kugelig/cdx4 mutants
(resulting in cdx2 and cdx4 deficient embryos) results in a
complete absence of gata1.sup.+ erythroid precursors and a more
severe shortening of the embryonic axis at the 10 somite stage. In
contrast, vascular progenitors and kidney duct precursors appear to
be little, or unaffected, compared to kgg single mutants. Embryos
deficient in just cdx2 display normal blood development. Expression
of cdx2 and cdx4 overlaps during gastrulation and early somite
formation at the time that hematopoietic cells arise during
embryogenesis. Taken together, these findings suggest that cdx2 and
cdx4 act redundantly during development to control the formation of
blood cells.
REFERENCES
[0075] The references cited below and incorporated throughout the
application are incorporated herein by reference. [0076] 1. Lewis,
E. A gene complex controlling segmentation in Drosophila. Nature
276, 565-570 (1978). [0077] 2. Struhl, G. Genes controlling
segmental specification in Drosophila thorax. Proc. Natl. Acad.
Sci. USA 79, 7380-7384 (1982). [0078] 3. Hunt, P. & Krumlauf,
R. Deciphering the Hox code: clues to patterning branchial regions
of the head. Cell 66, 1075-1078 (1991). [0079] 4. Buske, C. &
Humphries, R. K. Homeobox genes in leukemogenesis. Int. J. Hematol.
71, 301-308 (2000). [0080] 5. Owens, B. M. & Hawley, R. G. HOX
and Non-Hox Homeobox Genes in Leukemic
[0081] Hematopoiesis. Stem Cells 20, 364-379 (2002). [0082] 6.
Galloway, J. L. & Zon, L. I. Ontogeny of hematopoiesis:
examining the emergence of hematopoietic cells in the vertebrate
embryo. Curr. Top. Dev. Biol. 53, 139-158 (2003). [0083] 7. Choi,
K., Kennedy, M., Kazarov, A., Papadimitriou, J. C. & Keller, G.
A common precursor for hematopoietic and endothelial cells.
Development 125, 725-732 (1998). [0084] 8. Gering, M., Rodaway, A.
R. F., Gottgens, B., Patient, R. K. & Green, A. R. The SCL gene
specifies haemangioblast development from early mesoderm. EMBO J.
17, 4029-4045 (1998). [0085] 9. Liao, E. C. et al. SCL/Tal-1
transcription factor acts downstream of cloche to specify
hematopoietic and vascular progenitors in zebrafish. Genes Dev. 12,
621-6 (1998). [0086] 10. Shivdasani, R. A., Mayer, E. L. &
Orkin, S. H. Absence of blood formation in mice lacking the T-cell
leukemia oncoprotein tal-1/SCL. Nature 373, 432-434 (1995). [0087]
11. Robb, L. et al. Absence of yolk sac hematopoiesis from mice
with a targeted disruption of the scl gene. Proc. Natl Acad. Sci.
U.S.A. 92, 7075-7079 (1995). [0088] 12. Kimmel, C. B. Origin and
organization of the zebrafish fate map. Development 108, 581-594
(1990). [0089] 13. Warga, R. M. & Nusslein-Volhard, C. Origin
and development of the zebrafish endoderm. Development 126, 827-838
(1999). [0090] 14. Hammerschmidt, M., Serbedzija, G. N. &
McMahon, A. P. Genetic analysis of dorsoventral pattern formation
in the zebrafish: requirement of a BMP-like ventralizing activity
and its dorsal repressor. Genes Dev. 10, 2452-61 (1996). [0091] 15.
Krumlauf, R. Hox genes in vertebrate development. Cell 78, 191-201
(1994). [0092] 16. Sauvageau, G. et al. Overexpression of HOXB4 in
hematopoietic cells causes the selective expansion of more
primitive populations in vitro and in vivo. Genes Dev. 9, 1753-1765
(1995). [0093] 17. Care, A. et al. Enforced expression of HOXB7
promotes hematopoietic stem cell proliferation and
myeloid-restricted progenitor differentiation. Oncogene 18,
1993-2001 (1999). [0094] 18. Thorsteinsdottir, U. et al.
Overexpression of the myeloid leukemia-associated Hoxa9 gene in
bone marrow cells induces stem cell expansion. Blood 99, 121-129
(2002). [0095] 19. Antonchuk, J., Sauvageau, G. & Humphries, R.
K. HOXB4-induced expansion of adult hematopoietic stem cells ex
vivo. Cell 109, 39-45 (2002). [0096] 20. Kyba, M., Perlingeiro, R.
C. & Daley, G. Q. HoxB4 confers definitive lymphoid-myeloid
engraftment potential on embryonic stem cell and yolk sac
hematopoietic progenitors. Cell 109, 29-37 (2002). [0097] 21.
Kroon, E. et al. Hoxa9 transforms primary bone marrow cells through
specific collaboration with Meis1a but not Pbx1b. EMBO J. 17,
3714-3725 (1998). [0098] 22. Thorsteinsdottir, U. et al.
Overexpression of HOXA10 in murine hematopoietic cells perturbs
both myeloid and lymphoid differentiation and leads to acute
myeloid leukemia. Mol. Cell Biol. 17, 495-505 (1997). [0099] 23.
Nakamura, T., Largaespada, D. A., Shaughnessy, J. D. J., Jenkins,
N. A. & Copeland, N. G. Cooperative activation of Hoxa and
Pbx1-related genes in murine myeloid leukaemias. Nat. Genet. 12,
149-153 (1996). [0100] 24. Lam, D. H. & Aplan, P. D. NUP98 gene
fusions in hematologic malignancies. Leukemia 15, 1689-1695 (2001).
[0101] 25. Ziemin-van der Poel, S. et al. Identification of a gene,
MLL, that spans the breakpoint in 11q23 translocations associated
with human leukemias. Proc. Natl Acad. Sci. U.S.A. 88, 10735-10739
(1991). [0102] 26. Hammerschmidt, M. et al. Mutations affecting
morphogenesis during gastrulation and tail formation in the
zebrafish, Danio rerio. Development 123, 143-51 (1996). [0103] 27.
Bennett, C. M. et al. Myelopoiesis in the zebrafish, Danio rerio.
Blood 98, 643-651 (2001). [0104] 28. Lieschke, G. J., Oates, A. C.,
Crowhurst, M. O., Ward, A. C. & Layton, J. E. Morphologic and
functional characterization of granulocytes and macrophages in
embryonic and adult zebrafish. Blood 98, 3087-3096 (2001). [0105]
29. Serluca, F. C. & Fishman, M. C. Pre-pattern in the
pronephric kidney field of zebrafish. Development 128, 2233-2241
(2001). [0106] 30. Krauss, S., Johansen, T., Korzh, V. & Fjose,
A. Expression of the zebrafish paired box gene pax[zf-b] during
early neurogenesis. Development 113, 1193-1206 (1991). [0107] 31.
Chong, S. W., Emelyanov, A., Gong, Z. & Korzh, V. Expression
pattern of two zebrafish genes, cxcr4a and cxcr4b. Mech Dev. 109,
347-354 (2001). [0108] 32. Joly, J. S. et al. Expression of a
zebrafish caudal homeobox gene correlates with the establishment of
posterior cell lineages at gastrulation. Differentiation 50, 75-87
(1992). [0109] 33. Hild, M. et al. The smad5 mutation somitabun
blocks Bmp2b signaling during early dorsoventral patterning of the
zebrafish embryo. Development 126, 2149-2159 (1999). [0110] 34.
Postlethwait, J. H. et al. Vertebrate genome evolution and the
zebrafish gene map. Nat. Genet. 18, 345-9 (1998). [0111] 35.
Mlodzik, M., Fjose, A. & Gehring, W. J. Isolation of caudal, a
Drosophila homeo box-containing gene with maternal expression whose
transcripts form a concentration gradient at the pre-blastoderm
stage. EMBO J. 4, 2961-2969 (1985). [0112] 36. Katsuyama, Y., Sato,
Y., Wada, S. & Saiga, H. Ascidian tail formation requires
caudal function. Dev. Biol. 213, 257-268 (1999). [0113] 37. Edgar,
L. G., Carr, S., Wang, H. & Wood, W. B. Zygotic expression of
the caudal homolog pal-1 is required for posterior patterning in
Caenorhabditis elegans embryogenesis. Dev. Biol. 229, 71-88 (2001).
[0114] 38. Subramanian, V., Meyer, B. I. & Gruss, P. Disruption
of the murine homeobox gene cdx1 affects axial skeletal identities
by altering the mesodermal expression domains of Hox genes. Cell
83, 641-653 (1995). [0115] 39. Chawengsaksophak, K., James, R.,
Hammond, V. E., Kontgen, F. & Beck, F. Homeosis and intestinal
tumours in cdx2 mutant mice. Nature 386, 84-87 (1997). [0116] 40.
van den Akker, E. et al. cdx1 and cdx2 have overlapping functions
in anteroposterior patterning and posterior axis elongation.
Development 129, 2181-2193 (2002). [0117] 41. Beck, F.,
Chawengsaksophak, K., Waring, P., Playford, R. J. & Furness, J.
B. Reprogramming of intestinal differentiation and intercalary
regeneration in cdx2 mutant mice. Proc. Natl. Acad. Sci. U.S.A. 96,
7318-7323 (1999). [0118] 42. Tamai, Y. et al. Colonic hamartoma
development by anomalous duplication in cdx2 knockout mice. Cancer
Res. 59, 2965-2970 (1999). [0119] 43. Charite, J. et al.
Transducing positional information to the Hox genes: critical
interaction of cdx gene products with position-sensitive regulatory
elements. Development 125, 4349-4358 (1998). [0120] 44. Hunter, C.
P., Harris, J. M., Maloof, J. N. & Kenyon, C. Hox gene
expression in a single Caenorhabditis elegans cell is regulated by
a caudal homolog and intercellular signals that inhibit Wnt
signaling. Development 126, 805-814 (1999). [0121] 45. Isaacs, H.
V., Pownall, M. E. & Slack, J. M. W. Regulation of Hox gene
expression and posterior development by the Xenopus caudal
homologue Xcad3. EMBO J. 17, 3413-3427 (1998). [0122] 46. McGrath,
K. E. & Palis, J. Expression of homeobox genes, including an
insulin promoting factor, in the murine yolk sac at the time of
hematopoietic initiation. Mol. Reprod. Dev. 48, 145-153 (1997).
[0123] 47. Buske, C. et al. Deregulated expression of HOXB4
enhances the primitive growth activity of human hematopoietic
cells. Blood 100, 862-868 (2002). [0124] 48. Bjornsson, J. M. et
al. Reduced proliferative capacity of hematopoietic stem cells
deficient in hoxb3 and hoxb4. Mol. Cell Biol. 23, 3872-3883 (2003).
[0125] 49. Perkins, A. C. & Cory, S. Conditional
immortalization of mouse myelomonocytic, megakaryocytic and mast
cell progenitors by the Hox-2.4 homeobox gene. EMBO J. 12,
3835-3846 (1993). [0126] 50. Kennedy, M. et al. A common precursor
for primitive erythropoiesis and definitive hematopoiesis. Nature
386, 488-493 (1997). [0127] 51. Chen, F., Greer, J. & Capecchi,
M. R. Analysis of Hoxa7/Hoxb7 mutants suggests periodicity in the
generation of the different sets of vertebrae. Mech. Dev. 77, 49-57
(1998). [0128] 52. Kappen, C. Disruption of the homeobox gene
Hoxb-6 in mice results in increased numbers of early erythrocyte
progenitors. Am. J. Hematol. 65, 111-118 (2000). [0129] 53.
Lawrence, H. J. et al. Mice bearing a targeted interruption of the
homeobox gene HOXA9 have defects in myeloid, erythroid, and
lymphoid hematopoiesis. Blood 89, 1922-1930 (1997). [0130] 54.
Choi, K. The hemangioblast: a common progenitor of hematopoietic
and endothelial cells. J. Hematother. Stem Cell Res. 11, 91-101
(2002). [0131] 55. Chase, A. et al. Fusion of ETV6 to the
caudal-related homeobox gene CDX2 in acute myeloid leukemia with
the t(12;13)(p13;q12). Blood 93, 1025-1031 (1999). [0132] 56.
Kingsley, P. D. et al. Subtractive hybridization reveals
tissue-specific expression of ahnak during embryonic development.
Dev. Growth Diff. 43, 133-143 (2001).
[0133] The present invention has been described in terms of
particular embodiments found or proposed by the present inventor to
comprise preferred modes for the practice of the invention. It will
be appreciated by those of skill in the art that, in light of the
present disclosure, numerous modifications and changes can be made
in the particular embodiments exemplified without departing from
the intended scope of the invention. For example, due to codon
redundancy, changes can be made in the underlying DNA sequence
without affecting the protein sequence. Moreover, due to biological
functional equivalency considerations, changes can be made in
protein structure without affecting the biological action in kind
or amount. All such modifications are intended to be included
within the scope of the appended claims.
Sequence CWU 1
1
31120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1agctcctttt ggactattac 20220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2ccaacgtaca tgatttggaa 20320DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 3ataccttttg gagaaagagg
20420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4ccggttgatg acgactggac 20520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5caaaacgaga acgaaggaga 20620DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 6acctgtctct ctgaaagccc
20720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7taagatctgg tttcagaacc 20820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8tggatgatcc aagttcgagt 20920DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 9agcctcggac ctccaaattc
201016DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 10gagaaattta tattgt 161116DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
11gagaaatcca tattgt 161232DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 12atgcgaattc cccatgagtt
cctatttcgt ca 321334DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 13atgcgaattc accatgagtt cattgtatta tgcg
341434DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 14atgcgaattc accatgagct catatttcgt caac
341531DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 15atgcgaattc accatgtcga catccggagc t
311632DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 16gcatctcgag ctacattcta catgttatgt ac
321731DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 17gactctcgag ctactcatca tcttcttctt c
311831DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 18gcatctcgag ctacatttgt tttgccttgt c
311928DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 19gatctctaga ttagtcttcc ttcgtttc
282025DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 20cgtacatgat ttggaagaaa cccct 252123DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
21catgtacgtt ggataccttt tgg 232222DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 22tccacaaccc acgcctctta tt
222320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 23aggcgtgggt tgtggattac 202420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
24gatacactca ccacatacag 202518DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 25gtgatcaaca acacgtcc
182618DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 26ggaatctcct gtcagctg 182734DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27atgcgaattc accatggcca tgagttccta tttg 342831DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
28gcatctcgag ctatagactt ggcggaggtc c 312934DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
29atgcgaattc accatgagtt cctacttcgt caat 343031DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
30gcatctcgag ctatttagaa ttgctagaag c 313111PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 31Gly
Phe Ser Ser Val Phe Gln Ser Gln Ser Asp1 5 10
* * * * *