U.S. patent application number 12/602239 was filed with the patent office on 2010-10-28 for sequences and methods for detecting influenza a and influenza b virus.
This patent application is currently assigned to BECTON, DICKINSON AND COMPANY. Invention is credited to Tobin Hellyer, Erika L. Jones, James A. Price, JR..
Application Number | 20100273156 12/602239 |
Document ID | / |
Family ID | 40094129 |
Filed Date | 2010-10-28 |
United States Patent
Application |
20100273156 |
Kind Code |
A1 |
Hellyer; Tobin ; et
al. |
October 28, 2010 |
SEQUENCES AND METHODS FOR DETECTING INFLUENZA A AND INFLUENZA B
VIRUS
Abstract
Nucleic acid amplification primers and methods for specific
detection of influenza A and influenza B nucleic acid targets are
disclosed. The primer-target binding sequences are useful for
detection of influenza A and influenza B targets in a variety of
amplification and hybridization reactions. The oligonucleotide
sequences are able to differentiate between influenza A and
influenza B strains through specific hybridization to one or the
other virus strain, enabling specific detection of the presence of
influenza A and/or influenza B in a specimen.
Inventors: |
Hellyer; Tobin;
(Westminster, MD) ; Price, JR.; James A.;
(Lutherville, MD) ; Jones; Erika L.; (Windsor
Mill, MD) |
Correspondence
Address: |
David W. Highet, VP & Chief IP Counsel;Becton, Dickinson and Company
(Lerner David Littenberg), 1 Becton Drive , MC 110
Franklin Lakes
NJ
07417-1880
US
|
Assignee: |
BECTON, DICKINSON AND
COMPANY
Franklin Lakes
NJ
|
Family ID: |
40094129 |
Appl. No.: |
12/602239 |
Filed: |
May 30, 2008 |
PCT Filed: |
May 30, 2008 |
PCT NO: |
PCT/US2008/065289 |
371 Date: |
November 30, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60941270 |
May 31, 2007 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
435/188; 435/6.16; 435/91.2; 536/22.1 |
Current CPC
Class: |
C12Q 1/701 20130101 |
Class at
Publication: |
435/6 ; 536/22.1;
435/188; 435/91.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/00 20060101 C07H021/00; C12N 9/96 20060101
C12N009/96; C12P 19/34 20060101 C12P019/34 |
Claims
1. An oligonucleotide selected from at least one of the following
groups, the first group consisting of: a) an oligonucleotide
consisting essentially of a nucleic acid sequence of any one of SEQ
ID NOS: 19-24 or the complement thereof; and b) an oligonucleotide
having a nucleic acid sequence that specifically hybridizes to a
nucleic acid sequence consisting essentially of SEQ ID NOS: 19-24,
or to the complement thereof under conditions of 50 to 500 mM
alkali metal ion at between 50.degree. C. to 70.degree. C.; and the
second group consisting of: c) an oligonucleotide having a nucleic
acid sequence selected from the group consisting of: SEQ ID NOS:
3-6 or the complement thereof; and d) an oligonucleotide having a
nucleic acid sequence that specifically hybridizes to any one of
SEQ ID NOS: 3-6, or to the complement thereof, under conditions of
50 to 500 mM alkali metal ion at between 50.degree. C. to
70.degree. C.; and the third group consisting of: e) an
oligonucleotide having a nucleic acid sequence selected from the
group consisting of: SEQ ID NOS: 7-10 or the complement thereof;
and f) an oligonucleotide having a nucleic acid sequence that
specifically hybridizes to any one of SEQ ID NOS: 7-10, or to the
complement thereof, under conditions of 50 to 500 mM alkali metal
ion at between 50.degree. C. to 70.degree. C.; and combinations
thereof.
2. (canceled)
3. (canceled)
4. The oligonucleotide according to claim 1, wherein said
oligonucleotide further comprises a detectable moiety wherein said
detectable moiety is selected from the group consisting of:
fluorescein isothiocyante (FITC)/tretramethykhodamine
isothiocyanate (TRITC), FITC/Texas Red, FITC/N-hydroxysuccinimidyl
1-pyrenebutyrate (PYB), FITC/eosin isothiocyanate (EITC),
FITC/rhodamine X, FITC/tetramethylrhodamine (TAMRA), P-(dimethyl
aminophenylazo) benzoic acid (DABCYL), 5-(2'-aminoetlryl)
aminonapthalene, rhodamine, fluorescein, .sup.32P, .sup.35S,
horseradish peroxidase, alkaline phosphatase, glucose oxidase,
.beta.-galactosidase, soybean peroxidase, luciferase, digoxigenin,
biotin and 2,4-dinitrophenyl.
5. (canceled)
6. The oligonucleotide according to claim 4, wherein said
oligonucleotide further comprises a restriction enzyme cleavage
site wherein said restriction enzyme cleavage site is selected from
the group of sites consisting essentially of: BsoBi, HincII, AvaI,
NciI and Fnu4HI.
7. (canceled)
8. (canceled)
9. (canceled)
10. (canceled)
11. (canceled)
12. (canceled)
13. A method for detecting the presence of influenza A or influenza
B in a sample, said method comprising: a) amplifying a nucleic acid
present in said sample using at least two nucleic acid primers,
said nucleic acid primers consisting essentially of nucleic acid
sequences selected from at least one of the groups consisting of:
i) SEQ ID NOS: 19 and 20 ii) SEQ ID NOS: 21 and 22, iii) SEQ ID
NOS: 23 and 20, and iv) SEQ ID NOS: 24 and 20; and b) detecting an
amplified nucleic acid product, wherein detection of amplified
product indicates presence of influenza A or influenza B in said
sample.
14. (canceled)
15. The method according to claim 13, wherein detecting said
amplified nucleic acid product is conducted by hybridizing said
amplified nucleic acid product with at least one reporter probe
comprising an oligonucleotide consisting essentially of a nucleic
acid sequence of any one of SEQ ID NOS: 11, 12 or 19-24, and a
reporter moiety.
16. (canceled)
17. (canceled)
18. (canceled)
19. A method for specifically amplifying a target nucleic acid
sequence of influenza A and/or influenza B, wherein said method
comprises: a) hybridizing to said nucleic acid i) at least two
amplification primers consisting essentially of a target binding
sequence selected from at least one of each of the groups of
sequences consisting of: SEQ ID NOS: 19 and 20, SEQ ID NOS: 23 and
20, and SEQ ID NOS: 24 and 20, and optionally, an additional
sequence, and/or ii) at least two amplification primers consisting
essentially of a target binding sequence selected from the group
consisting of SEQ ID NOS: 21 and 22, and, optionally, an additional
sequence, and; b) extending the hybridized amplification primers on
the target nucleic acid sequence to amplify said target nucleic
acid sequence.
20. The method according to claim 19, further comprising detecting
the amplified target nucleic acid by hybridization of the amplified
target nucleic acid sequence to at least one reporter probe
oligonucleotide.
21. The method according to claim 20, wherein the reporter probe
oligonucleotide comprises a nucleic acid sequence according to SEQ
ID NO: 15, optionally further comprising a detectable moiety.
22. The method of claim 21 wherein the detectable moiety is an
additional sequence comprising a recognition site for a restriction
endonuclease that is nickable by a restriction endonuclease.
23. (canceled)
24. The method according to claim 19, wherein the target nucleic
acid is amplified by Polymerase Chain Reaction, Nucleic Acid
Sequence Based Amplification, Transcription-Mediated Amplification,
Rolling Circle Amplification, Strand Displacement Amplification or
Ligation-Mediated Amplification.
25. A kit comprising at least one oligonucleotide, wherein said
oligonucleotide comprises a sequence selected from the group of
sequences consisting of: SEQ ID NOS: 7-10 and 17-24.
26. The kit according to claim 25, wherein said at least one
oligonucleotide comprises oligonucleotides comprising sequences
selected from one of the groups of sequences consisting of: a) SEQ
ID NOS: 3, 4, 7, 8, 17 and 18, and b) SEQ ID NOS: 5, 6, 9 and 10
and further comprising a reporter probe comprising a detectable
moiety.
27. (canceled)
28. The kit according to claim 25, further comprising
oligonucleotides that hybridize to a matrix protein gene of
influenza A or influenza B.
29. The kit according to claim 25, further comprising one or more
oligonucleotides comprising nucleotide sequences selected from the
group consisting of: SEQ ID NOS: 15 and 16.
30. The kit according to claim 26, wherein said detectable moiety
is selected from the group consisting of: fluorescein isothiocyante
(FITC)/tretamethylrhodamine isothiocyanate (TRITC), FITC/Texas Red,
FITC/N-hydroxysuccinimidyl 1-pyrenebutyrate (PYB), FITC/eosin
isotbiocyanate (EITC), FITC/rhodamine X, FITC/tetramethylrhodamine
(TAMRA), P-(dimethyl aminophenylazo) benzoic acid (DABCYL),
5-(2'-aminoethyl) aminonapthalene, rhodamine, fluorescein,
.sup.32P, .sup.35S, horseradish peroxidase, alkaline phosphatase,
glucose oxidase, .beta.-galactosidase, soybean peroxidase,
luciferase, digoxigenin, biotin and 2,4-dinitrophenyl.
31. The kit according to claim 25, wherein said kit further
comprises one or more oligonucleotides consisting essentially of a
nucleic acid sequence selected from the group consisting of SEQ ID
NOS: 3-6.
32. The kit according to claim 25, wherein said kit further
comprises oligonucleotides consisting essentially of a nucleic acid
sequence selected from the group consisting of SEQ ID NOS:
11-16.
33. (canceled)
34. (canceled)
35. An oligonucleotide consisting essentially of a nucleotide
sequence selected from the group consisting of SEQ ID NOS:
3-24.
36. An oligonucleotide comprising the sequence according to any one
of SEQ ID NOS: 27-46, 63-68, 69 and 74-77.
37. The oligonucleotide according to claim 36, wherein the
oligonucleotide comprises one or more substitutions selected from
the group consisting of: position 3 of SEQ ID NOS: 27-30
substituted with inosine or xanthine, position 16 of SEQ ID NOS:
27-30 substituted with inosine or xanthine, position 3 of SEQ ID
NOS: 31-46 substituted with inosine or xanthine, position 5 of SEQ
ID NOS: 31-46 substituted, with inosine, position 6 of SEQ ID
NOS:31-46 substituted with inosine or xanthine, position 15 of SEQ
ID NOS: 31-46 substituted with inosine or xanthine, position 13 of
SEQ ID NOS: 47-62 substituted with inosine or xanthine, position 16
of SEQ ID NOS:47-62 substituted with inosine, position 17 of SEQ ID
NOS: 47-62 substituted with inosine, position 26 of SEQ ID NOS:
47-62 substituted with inosine, position 14 of SEQ ID NOS: 63 and
64 substituted with inosine, position 11 of SEQ ID NOS: 65-68
substituted with inosine, position 14 of SEQ ID NOS:65-68
substituted with inosine or xanthine, position 20 of SEQ ID NOS:
70-73 substituted with inosine or xanthine, position 21 of SEQ ID
NOS: 70-73 substituted with inosine, position 1 of SEQ ID NOS:
74-77 substituted with inosine and position 13 of SEQ ID NOS: 74-77
substituted with inosine or xanthine.
38. At least one oligonucleotide selected from each of the group of
oligonucleotides a), b) and c), comprising: a) an oligonucleotide
comprising the sequence according to any one of SEQ ID NOS: 27-46,
b) an oligonucleotide comprising the sequence according to any one
of SEQ ID NOS: 47-62, and c) an oligonucleotide comprising the
sequence according to any one of SEQ ID NOS: 63-68.
39. The oligonucleotides according to claim 38, wherein the
oligonucleotide comprises one or more substitutions selected from
the group consisting of: position 3 of SEQ ID NOS: 27-30
substituted with inosine or xanthine, position 16 of SEQ ID NOS:
27-30 substituted with inosine or xanthine, position 3 of SEQ ID
NOS: 31-46 substituted with inosine or xanthine, position 5 of SEQ
ID NOS: 31-46 substituted with inosine, position 6 of SEQ ID NOS:
31-46 substituted with inosine or xanthine, position 15 of SEQ ID
NOS: 31-46 substituted with inosine or xanthine, position 13 of SEQ
ID NOS: 47-62 substituted with inosine or xanthine, position 16 of
SEQ ID NOS: 47-62 substituted with inosine, position 17 of SEQ ID
NOS: 47-62 substituted with inosine, position 26 of SEQ ID NOS:
47-62 substituted with inosine, position 14 of SEQ ID NOS: 63 and
64 substituted with inosine, position 11 of SEQ ID NOS: 65-68
substituted with inosine and position 14 of SEQ ID NOS: 65-68
substituted with inosine or xanthine.
40. A collection of oligonucleotides comprising at least one
oligonucleotide selected from each of the group of oligonucleotides
a), b) and c), comprising: a) an oligonucleotide comprising the
sequence according to SEQ ID NO: 69 b) an oligonucleotide
comprising the sequence according to any one of SEQ ID NOS: 70-73,
and c) an oligonucleotide comprising the sequence according to any
one of SEQ ID NOS: 74-77.
41. The collection of oligonucleotides according to claim 40,
wherein at least one oligonucleotide comprises one or more
substitutions selected from the group consisting of: position 20 of
SEQ ID NOS: 70-73 substituted with inosine or xanthine, position 21
of SEQ ID NOS: 70-73 substituted with inosine, position 1 of SEQ ID
NOS: 74-77 substituted with inosine and position 13 of SEQ ID NOS:
74-77 substituted with inosine or xanthine.
42. A method for detecting the presence of influenza A in a sample,
said method comprising: a) amplifying a nucleic acid present in
said sample using at least two oligonucleotide primers, said
oligonucleotide primers consisting essentially of nucleic acid
sequences, at least one selected from each of the three groups
consisting of: i) SEQ ID NOS: 27-46, and ii) SEQ ID NOS: 63-68; and
b) detecting an amplified nucleic acid product by hybridization to
an oligonucleotide probe consisting essentially of a sequence
selected from the group consisting of SEQ ID NOS: 47-62, wherein
detection of amplified product indicates presence of influenza A in
said sample.
43. A method for detecting the presence of influenza B in a sample,
said method comprising: a) amplifying a nucleic acid present in
said sample using at least two oligonucleotide primers, said
oligonucleotide primers consisting essentially of nucleic acid
sequences, at least one selected from each of the groups consisting
of: i) SEQ ID NO: 69 and ii) SEQ ID NOS: 74-77; and b) detecting an
amplified nucleic acid product by hybridization to an
oligonucleotide probe consisting essentially of a sequence selected
from the group consisting of SEQ ID NOS: 70-73, wherein detection
of amplified product indicates presence of influenza B in said
sample.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to nucleic acid primers and
probes derived from influenza A and influenza B viruses and methods
for specific detection of influenza using nucleic acids that
hybridize specifically to either influenza A or influenza B nucleic
acids. The oligonucleotides and methods disclosed are useful for
detection of influenza A and influenza B targets in a variety of
amplification and hybridization reactions. The oligonucleotide
sequences are able to differentiate between influenza A and
influenza B strains through specific hybridization to influenza A
or influenza B nucleic acids, enabling specific detection of the
presence of influenza A and/or influenza B in a specimen.
BACKGROUND
[0002] There are three known influenza genera: genus A, genus B and
genus C. Influenza belongs to the family of viruses referred to as
myxoviruses, and more specifically to orthomyxoviruses. This family
also includes "Thogoto-like" viruses. The orthomyxoviruses infect
vertebrates. Virions in this family have a genome containing 7 to 8
segments of linear, negative-sense, single stranded RNA. (See, FIG.
2). Genomes of the influenza viruses are from 12000 to 15000
nucleotides in length.
[0003] Influenza types A and B are distinguishable based on the
surface antigens hemagglutinin (H), which binds to host cells, and
neuraminidase (N), which cleaves budding viruses from infected
cells. Influenza A may be further classified into subtypes H1 to
H16 and N1 to N9 based on the virus-encoded hemagglutinin and
neuraminidase proteins, respectively. The influenza B virus is not
further classified into subtypes. The influenza virus genome
mutates continuously, resulting in frequent appearance of new
antigenic variants and causing seasonal epidemics.
[0004] The oligonucleotides and methods disclosed are useful for
detection of influenza A and influenza B nucleic acid targets in a
variety of amplification and hybridization reactions. The present
invention provides a more rapid and sensitive means of specifically
detecting influenza A and 13 compared to previously known
techniques (immunological and culture-based methods). Furthermore,
the nucleic acids of the present invention are useful in various
nucleotide amplification techniques, as described in further detail
herein.
DESCRIPTION OF THE FIGURES
[0005] FIG. 1. Schematic representation of Strand Displacement DNA
Amplification (SDA). A. B1 and B2 symbolize "bumper" primers. A1
and A2 symbolize "amplification" primers. Primers A1 and A2 may
contain a restriction enzyme recognition site, for instance, the
nucleotide sequence 5'-C-T-C-G-G-G-3 (SEQ ID NO:1), which
corresponds to the BsoBI restriction enzyme recognition site. The
complementary nucleotide sequence generated during SDA in the
presence of phosphorothioate-modified nucleotides contains the
complementary sequence to the restriction enzyme recognition site.
If this site is BsoBI, the complementary sequence generated is
5'--Cs--Cs--Cs-G-A-G-3' (SEQ ID NO:2), wherein "s" preferably
symbolizes a phosphorothioate linkage. Restriction enzyme BsoB1
cleaves nucleotides between the first and second nucleotide at the
5' end of the recognition sequence but cannot cleave between
nucleotides joined by a phosphorothioate bond. (1) Bumper primer B1
hybridizes to single-stranded DNA target sequence upstream of S1.
(2) DNA polymerase extension from the 3' ends of B1 and A1 results
in the displacement of the A1 extension product into solution. (3)
A2 and upstream B2 hybridize to the displaced A1 extension product.
(4) Extension from the 3' end of B2 displaces the downstream A2
extension product. (5) Hybridization of an A1 primer to the
displaced A2 extension product. (6) Extension from the 3' end of
hybridized A1 results in the formation of a double-stranded
molecule with nickable restriction sites at either end. (7) Nicking
of the unmodified DNA strands by the restriction enzyme and
polymerase extension from the restriction sites displaces
single-stranded molecules into solution that possess partial
restriction enzyme recognition sites at either end. These
single-stranded molecules then feed into the exponential phase of
SDA depicted in FIG. 1B, while the double-stranded parent molecule
is regenerated and becomes available for subsequent rounds of
nicking, extension and displacement. B. Exponential Amplification.
(1) Displaced single-stranded molecules generated by the sequence
of events depicted in FIG. 1A hybridize to amplification primers A1
and A2. (2) The 3' ends of the amplification primer and the
displaced strand are extended by DNA polymerase, creating
double-stranded target fragments, each of which is flanked by a
hemi-modified restriction enzyme recognition site that is in turn
nicked by the restriction enzyme. Polymerase extends from the 3'
end at the site of the nick, regenerating the double-stranded
fragment (including the nickable restriction site) and
simultaneously displacing the downstream DNA strand into solution.
(3) Displaced single-stranded molecules with partial restriction
enzyme recognition sites at either end circulate back into step (1)
to bring about exponential amplification. C. SDA with universal
detection. (1-3) A signal primer, S1, comprising a target-specific
3' sequence, T, and a 5' generic (or "universal") tail (the adapter
sequence), G, that hybridizes to the amplified target downstream of
an amplification primer, A1. DNA polymerase extension from the 3'
ends of both the signal primer and upstream amplification primer
results in displacement of the signal primer extension product into
solution, which in turn, hybridizes to a complementary
amplification primer, A2. (4) Extension from the 3' ends of the
amplification primer and signal primer extension product generates
the complement of the 5' adapter tail sequence and a
double-stranded restriction recognition site. (5) Nicking of the
restriction site and extension from the nick displaces a
single-stranded copy of the signal primer complement into solution.
(6) The displaced sequence hybridizes to a complementary
fluorescent reporter probe that possesses the generic sequence G at
its 3' end. (7) Extension from the 3' ends of the reporter probe
and its target sequence results in generation of a double stranded
restriction recognition sequence. (8) Maximum fluorescence is
obtained by complete separation of the quencher and fluorophore via
cleavage of the double-stranded reporter probe restriction site. D.
Direct detection with a target-specific reporter probe. (1)
Reporter probe R hybridizes downstream of A1. (2) DNA polymerase
extends from the 3' ends of S1 and R. Extension of S1 displaces the
downstream extension product of R into solution where it hybridizes
to a complementary amplification primer, A2. (3) Extension from the
3' end of A2 results in formation of a double stranded restriction
site. (4-5) Fluorescent signal is generated by cleavage of the
restriction site and complete separation of the fluorophore and
quencher.
[0006] FIG. 2. Schematic representation of the Influenza A (A/Ong
Kong/1073/99, H9N2) and B (B/Memphis/12/97) virus RNA genomes.
Based on GenBank Accession Nos. NC.sub.--004906-NC004912 and
NC.sub.--004783-NC004790, respectively. (Source:
www.uq.edu.au/vdu/VDUInfluenza.htm).
[0007] FIG. 3. Partial nucleotide sequence map of a representative
influenza A matrix gene showing the location of primers
corresponding to the regions of complementarity to the influenza A
RNA sequences (not including additional 5' and 3' non-influenza
sequences). FAM-FB=5' bumper primer, FAM-FP=5' amplification
primer, FAM-AD=signal primer for universal detection of Influenza
A, FAM-RP=3' amplification primer, FAM-RB=3' bumper primer. The
Reporter Probe MPC D/R that hybridizes to the complement of the 5'
tail of the signal primer (the adapter sequence) is not shown.
[0008] FIG. 4. Partial nucleotide sequence map of influenza B
matrix gene showing location of primers corresponding to the
regions of complementarity to influenza RNA sequences (not
including additional 5' and 3' non-influenza sequences). FBM-FB=5'
bumper primer, FBM-FP=5' amplification primer, FBM-AD=signal primer
for universal detection of influenza RNA, FBM-RP=3' amplification
primer, FBM-RB=3' bumper primer. The Reporter Probe MPC D/R that
hybridizes to the complement of the 5' tail of the signal primer
(the adapter sequence) is not shown.
DETAILED DESCRIPTION OF THE INVENTION
[0009] The present invention provides nucleotide primers and probes
derived from influenza A and influenza B virus genomes and methods
for specific detection of influenza A and influenza B through
hybridization and/or nucleotide amplification. The primer-target
binding sequences are useful in methods for specifically amplifying
and/or hybridizing to influenza A and influenza B genome sequence
targets in a variety of amplification and detection reactions or
direct hybridization assays. The primer-target binding sequences
allow specific detection of influenza A and/or influenza B target
nucleic acids and enable determination of the presence of either
influenza A or influenza B, or both, in a specimen containing one
or both of influenzas A and B and/or other unrelated viruses and/or
microscopic organisms. Kits comprising the primers and probes of
the present invention are also disclosed and are useful in
performing the methods of the present invention.
[0010] The present invention may be described by, but not
necessarily limited to, the following exemplary embodiments. Any
one embodiment of the invention might not exhibit all of the
advantages provided by the invention, and different embodiments may
provide different advantages. While the invention is described in
certain embodiments herein, this invention can be further modified
within the spirit and scope of this disclosure. This invention is
therefore intended to encompass any variations, uses, or
adaptations of the invention using the invention's general
principles. Further, this invention includes such variations on the
present disclosure as come within known or customary practice in
the art to which this invention pertains and which fall within the
limits of the appended claims.
[0011] The present invention discloses novel oligonucleotides
useful as primers and probes and methods of specifically detecting
influenza A and B in a sample containing either one or both strains
of influenza and/or other unrelated viruses/microscopic organisms.
The present invention further discloses kits comprising the novel
oligonucleotides of the present invention useful in performing the
methods of the present invention. The nucleotide sequences of the
primers and probes of the present invention are designed to
hybridize specifically to regions of the influenza A and influenza
B genomes that are unique to the genome of each strain, but which
are also conserved across many viruses within each strain. Thus,
one embodiment of the present invention is oligonucleotide probes
and primers which specifically hybridize to these taxonomically
unique regions of the influenza A and influenza B genome and which
are therefore useful in detecting the presence of influenza A
and/or influenza B in a sample. Thus, the oligonucleotides of the
present invention do not cross-hybridize under assay conditions as
described herein to nucleic acids from other influenza virus types.
Furthermore, the oligonucleotides of the present invention do not
cross-hybridize under assay conditions as described herein to
nucleic acids from viruses that are not related to influenza.
[0012] The oligonucleotides of the present invention may be used in
various nucleic acid amplification techniques known in the art,
such as, for example, Polymerase Chain Reaction (PCR), Nucleic Acid
Sequence Based Amplification (NASBA), Transcription-Mediated
Amplification (TMA), Rolling Circle Amplification (RCA), Strand
Displacement Amplification (SDA), thermophilic SDA (tSDA) or
Ligation-Mediated Amplification (LMA). The oligonucleotides of the
present invention may also be used in a variety of methods known to
one of ordinary skill in the art for direct detection of influenza
A and B without amplification through direct hybridization with
viral nucleic acids, or to detect DNA or RNA copies of viral
nucleic acids, or their complements.
[0013] Furthermore, kit embodiments of the invention comprise one
or more of the oligonucleotides of the present invention that
enable specific detection of either influenza A or influenza B or
both strains. The kits allow specific detection of influenza A
and/or influenza B such that there are minimal false positive
results in a detection assay, preferably none, caused by
cross-hybridization with nucleic acids of other influenza types or
of other viruses, or organisms not related to influenza.
[0014] In a further embodiment, the oligonucleotides of the present
invention may be utilized in any of the various amplification
and/or hybridization detection reactions to determine whether only
influenza A is present in a sample. Also, kits are disclosed which
provide for the specific detection of only influenza A through
amplification and/or hybridization techniques.
[0015] In a further embodiment, the oligonucleotides of the present
invention may be utilized in any of the various amplification
and/or detection reactions mentioned to determine whether only
influenza B is present in a sample. Also, kits are disclosed which
provide for the specific detection of only influenza B through
amplification and/or hybridization techniques.
[0016] The specimen from which nucleic acid material is tested may
be any biological specimen, such as, but not limited to,
nasopharyngeal, nasal and throat swabs as well as nasopharyngeal
aspirates and washes. The specimen may undergo preliminary
processing prior to testing (several preliminary processing
protocols are known) to allow more efficient detection of the viral
nucleic acid. For example, the sample may be collected and may be
added to transport medium to stabilize the virus. Nasopharyngeal,
nasal and throat swabs are preferably added to a transport medium.
Nasopharyngeal aspirates and washes may or may not be stabilized by
addition of transport medium. Once received at the testing
laboratory, the virus may be inactivated and lysed to liberate the
viral RNA. The nucleic acid may optionally then be extracted to
remove potential inhibitors or other interfering agents of later
assay steps. To perform the methods of the invention, viral nucleic
acids may be mixed with components essential for specific detection
of influenza A and/or influenza B.
[0017] The oligonucleotides of the present invention also include
oligonucleotides comprising detectable moieties. For instance,
detectable moieties useful in the present invention may include,
but are not limited to, donor-quencher dye pairs such as
fluorescein isothiocyanate (FITC)/tetramethylrhodamine
isothiocyanate (TRITC), FITC/Texas Red.TM. (Molecular Probes),
FITC/N-hydroxysuccinimidyl 1-pyrenebutyrate (PYB), FITC/eosin
isothiocyanate (EITC), FITC/rhodamine X, FITC/tetramethylrhodamine
(TAMRA), and others. P-(dimethyl aminophenylazo) benzoic acid
(DABCYL) is a non-fluorescent quencher dye that effectively
quenches fluorescence from an adjacent fluorophore such as
fluorescein, 5-(2'-aminoethyl) aminonaphthalene or rhodamine. Other
preferred oligonucleotide labels include, but are not limited to,
single fluorophores such as fluorescein and rhodamine, radioactive
labels such as .sup.32P and .sup.35S, enzymes such as horseradish
peroxidase, alkaline phosphatase, glucose oxidase,
.beta.-galactosidase, soybean peroxidase or luciferase and haptens
such as digoxigenin, biotin and 2,4-dinitrophenyl.
[0018] Oligonucleotides of the present invention include SEQ ID
NOS:3-24 and 27-77 and oligonucleotides that specifically hybridize
to nucleic acids having sequences that are the complement of SEQ ID
NOS: 3-24 and 27-77 under assay conditions. Assay conditions
include, for example, those used for tSDA reactions conducted at
52.5.degree. C.: 143 mM bieine, 82 mM KOH, 24.5 mM KPO.sub.4, 12.5%
DMSO, 1.67% glycerol, 100 ng/.mu.l BSA, 2 ng/.mu.l yeast RNA, 100
nM each of dATP, dGTP, dTTP, 500 nM dCsTP, and 6.7 mM magnesium
acetate.
[0019] The oligonucleotides of the present invention include
target-binding sequences such as SEQ ID NOS: 19-24 and 27-77. These
sequences correspond to influenza A and B matrix gene sequences
which are highly conserved within either A- or B-type influenza.
For instance, SEQ ID NOS: 19, 20, 23 and 24 are highly conserved
within the Influenza A type. The nucleotide sequence of SEQ ID
NO:19 corresponds to nucleotides 119-133 of an influenza A matrix
gene as provided in SEQ ID NO:25, and as depicted in FIG. 3.
Further, the target-binding sequence of SEQ ID NO:20 is the same as
SEQ ID NO:19 except that one nucleotide is changed. Thus, primers
consisting essentially of these sequences will hybridize to a
sequence complementary to the same region of SEQ ID NO:25.
Furthermore, SEQ ID NO:23 corresponds to nucleotide positions
117-131 of SEQ ID NO:25 and SEQ ID NO:24 corresponds to nucleotide
positions 159-173 of SEQ ID NO:25. It is expected that these
target-binding regions within the influenza A matrix gene may be
adjusted by as many as 12 nucleotides in either the 5' or 3'
direction, or both, within SEQ ID NO:25, or a region corresponding
to this sequence within any influenza A matrix gene, and the same
results of the present invention may be achieved. Regarding
influenza B target-binding sequences SEQ ID NOS: 21 and 22,
corresponding to nucleotide positions 22-37 and 92-106 of SEQ ID
NO:26, it is expected that oligonucleotides of the present
invention designed to hybridize specifically to these regions may
be adjusted by up to 12 nucleotides in length or position in either
the 5' or 3' direction, or both, within SEQ ID NO:26, or a region
corresponding to this sequence within any corresponding influenza B
matrix gene, and the same specificity for hybridizing to influenza
B type may be achieved.
[0020] Furthermore, oligonucleotides of the present invention
comprising these target-binding sequences, such as, for instance,
SEQ ID NO:9, corresponding to the 3' amplification primer, as
listed in Table 1, below, which has an underlined portion
corresponding to the target-binding sequence CTTTCCCACCGAACC (SEQ
ID NO:21), may likewise have a sequence corresponding to this
target-binding sequence which is altered by extending or shifting
this underlined portion in either the 5' or 3' direction, or both,
to encompass up to 12 additional nucleotides in either direction.
This would apply to any oligonucleotide comprising the
target-binding sequence of the present invention, such as the
oligonucleotides corresponding to SEQ ID NOS: 7-10.
[0021] Oligonucleotides of the present invention also include
bumper primers that may be used in methods according to the present
invention. A bumper primer consisting essentially of the sequence
according to SEQ ID NO:3 is exemplary of a 5' bumper primer that
could be used in a detection method to specifically detect the
presence of influenza A, and corresponds to nucleotides 49-65 of
the influenza A matrix gene (SEQ ID NO:25). Other bumper primers
disclosed herein as examples include SEQ ID NO:4, corresponding to
nucleotides 190-206 of the influenza A matrix gene (SEQ ID NO:25),
SEQ ID NO:5, corresponding to nucleotides 2-18 of the influenza B
matrix gene (SEQ ID NO:26), and SEQ ID NO:6, corresponding to
nucleotides 170-187 of the influenza B matrix gene (SEQ ID NO:26).
As with the target-binding sequences and amplification primers
discussed above, it is expected that each one of these bumper
primers may be adjusted in either the 5' or 3' direction, or both,
by about 12 nucleotides, or more, and still function to achieve the
desired method results, i.e. to specifically detect the presence of
either influenza A or influenza B, or both.
[0022] That is, it is expected that the oligonucleotides of the
present invention, designed to specifically hybridize to either
influenza A or influenza B matrix gene sequences, according to, for
instance, SEQ ID NOS:19, 20, 23 and 24 for the influenza A type,
and 21 and 22 for influenza B type, may be adjusted in position and
length and still achieve specific hybridization to influenza A or
influenza B matrix genes. Oligonucleotides of the present invention
encompass these variations as one of ordinary skill in the art
knows that specificity may be achieved using such altered
oligonucleotides.
[0023] Hybridization and/or amplification using the
oligonucleotides of the present invention can be achieved over a
broad range of chemistry and thermal conditions using thermophilic
SDA, mesophilic SDA and PCR conditions. Several examples in which
thermophilic SDA has been employed to hybridize and amplify DNA or
RNA target sequences have been reported. (See, Spargo, C. A. et
al., Molecular and Cellular Probes, 10:247-256, 1996; Nadeau, J. G.
et al., Analytical Biochemistry, 276:177-187, 1999; Nycz, C. M. et
al., Analytical Biochemistry, 259:226-234, 1998; and Hellyer, T. J.
et al., Journal of Clinical Microbiology, 37: 518-523, 1999).
[0024] Examples describing reaction conditions for hybridization
and/or amplification using mesophilic SDA have also been reported.
Mesophilic SDA requires modification of the 5' (non-hybridization
region) sequence within the amplification primers and reporter
probes and use of alternative restriction enzymes such as, for
example, Ava I, that perform optimally at lower temperatures
relative to thermophilic SDA, as well as use of a polymerase enzyme
with a temperature optimum in the desired range (e.g.,
exo.sup.--Klenow polymerase for temperatures between approximately
35-42.degree. C.). Use of alternative restriction enzymes may also
require incorporation of an alternative modified nucleotide such
as, for example, mesophilic SDA with the HincII restriction enzyme
requires use of thioated-dATP in place of the dCsTP used with
thermophilic BsoBI-based assay systems. (See, Walker, G. T. et al.,
Nucleic Acids Research, 20:1691-1696, 1992; Mehrpouyan, M. et al.,
Molecular and Cellular Probes, 11:337-347, 1997; Little, M. C. et
al., Clinical Chemistry, 45:777-784, 1999; and Wang, Sha-Sha et
al., Clinical Chemistry, 49:1599-1607, 2003).
[0025] The oligonucleotides of the present invention can also be
used in a broad range of PCR conditions to hybridize and/or amplify
target sequences. Such conditions have been reported previously
concerning the design of PCR conditions and troubleshooting
techniques that can be used to optimize hybridization and/or
amplification of target sequences. (See, Cha, R. S, and Thilly, W.
G., 1995, "Specificity, Efficiency, and Fidelity of PCR," PCR
Primer: A Laboratory Manual., at pp. 37-62, Cold Spring Harbor
Laboratory Press, Plainview, N.Y.; Roux, K., Id. at pp. 37-62;
Bustin, S. A. and Nolan, T., 2004, "Basic RT-PCR Considerations,"
A-Z of Quantitative PCR, at pp. 359-395, International University
Line, La Jolla, Calif.; and Altshuler, M. L., 2006, PCR
Troubleshooting: The Essential Guide, Caister Academic Press,
Norfolk, UK).
[0026] One of ordinary skill in the art knows that nucleic acids do
not require complete complementarity in order to hybridize. Thus,
the probe and primer sequences disclosed herein may be modified
without loss of utility as influenza matrix gene-specific probes
and primers. One of ordinary skill in the art also knows that
hybridization of complementary and nucleic acid sequences that are
not 100% complementary may be obtained by adjustment of the
hybridization conditions to increase or decrease stringency. Absent
indications to the contrary, such minor modifications of the
disclosed sequences and any necessary adjustments of hybridization
conditions to maintain influenza virus specificity are considered
variation within the scope of the invention.
[0027] Oligonucleotides of one embodiment of the present invention
that may be used, for instance, in an SDA reaction, are as shown in
Table 1. Regions of complementarity to influenza RNA sequences are
underlined, restriction enzyme recognition sites (such as BsoBI)
are italicized. Intentional mutations made to the internal control
signal primers relative to the influenza signal primers are in bold
type, and are designed to hybridize to internal nucleic acids
optionally added to an assay, in a manner mimicking amplification
of target sequence and using the same amplification and bumper
primers.
TABLE-US-00001 TABLE 1 SEQ ID NO: NAME DESCRIPTION & SEQUENCE 3
FAM-FB Influenza A 5' bumper primer TCAGGCCCCCTCAAAGC 4 FAM-RB
Influenza A 3' bumper primer GGCACGGTGAGCGTGAA 5 FBM-FB Influenza B
5' bumper primer TGTCGCTGTTTGGAGAC 6 FBM-RB Influenza B 3' bumper
primer AGGCACCAATTAGTGCTT 7 FAM-FP Influenza A 5' amplification
primer CGATTCCGCTCCAGACTTCTCGGGAGGCTCTCATGGAAT 8 FAM-RP Influenza A
3 ' amplification primer ACCGCATCGAATGACTGTCTCGGGCCCTTAGTCAGAGGT 9
FBM-RP Influenza B 3' amplification primer
ACCGCATCGAATGACTGTCTCGGGCTTTCCCACCGAACC 10 FBM-FP Influenza B 5'
amplification primer CGATTCCGCTCCAGACTTCTCGGGATTGCCTACCTGCTTT 11
FAM-AD Influenza A signal primer for universal detection of
influenza A RNA ACGTTAGCCACCATACTTGAGACAGGATTGGTCTTGTCTTT 12 FBM-AD
Influenza B signal primer for universal detection of influenza B
RNA ACGTTAGCCACCATACTTGAGTTCTGCTTTGCCTTCTCCATC 13 FBM- Influenza A
signal primer for detection ICA.2 of internal control RNA
ACTGATCCGCACTAACGACTGACAGGATTGGTCTATCTACA 14 FBM- Influenza B
signal primer for detection ICA.2 of internal control RNA
ACTGATCCGCACTAACGACTAGTTCTGCTTTGCCTTCCACCT 17 FAM- Influenza A 5'
amplification primer FP2 CGATTCCGCTCCAGACTTCTCGGGAGGCTCTCATGGAGT 18
FAM- Influenza A 5' amplification primer FP3
CGATTCCGCTCCAGACTTCTCGGGTGAGGCTCTCATGGA
[0028] In one embodiment, oligonucleotides of the present invention
may consist of a sequence selected from among SEQ ID NOS: 19-24 and
additionally may comprise additional nucleotides such as,
especially, a restriction enzyme recognition site (RERS). In one
embodiment of the present invention, the RERS is a BsoBI site.
Other restriction enzyme sites useful in the present invention
include, but are not limited to, for example, HincII, AvaI (an
isoschizomer of BsoBI), NciI and Fnu4HI.
[0029] In another embodiment, oligonucleotides of the invention may
consist of, or consist essentially of, one or more polynucleotides
having the nucleotide sequence of SEQ ID NOS:3-24 and 27-77. In yet
another embodiment, oligonucleotides having the nucleic acid
sequences according to SEQ ID NOS: 3-24 may be utilized in an SDA
reaction to determine whether influenza A and/or influenza B is
present in a sample. (See, for instance, the methods of Nadeau et
al. as disclosed in U.S. Pat. Nos. 5,547,861, 6,656,680, 6,743,582
and 6,316,200). SDA is illustrated schematically in FIGS. 1A and
1B. For example, the disclosed primers and probes can be used in
SDA in a manner that is analogous to the signal primer reaction
described in U.S. Pat. No. 5,547,861.
[0030] In essence, a signal primer (S1) having a 3' target binding
sequence and a noneomplementary 5' tail hybridizes to the target
sequence downstream from an amplification primer (A1). (FIG. 1C,
Step (1)). As illustrated in FIG. 1C, the entire hybridization site
of the signal primer is downstream from the hybridization site of
the amplification primer. However, the hybridization sites of the
signal primer and the amplification primer on the target may also
partially overlap (typically only by several nucleotides,
preferably from about 1 to about 12 nucleotides) without
significantly affecting the methods of the invention. As used
herein, the term "downstream from," with respect to the
hybridization sites of the signal primer and the amplification
primer on the target, generally encompasses nonoverlapping and
partially overlapping sequences in the target.
[0031] In Step (2), of FIG. 1C, the amplification primer and the
signal primer are simultaneously extended by polymerase reaction.
Extension of the amplification primer displaces the single-stranded
signal primer extension product (FIG. 1C, Step (2)). In the third
step, the second amplification primer (A2) hybridizes to the signal
primer extension product (FIG. 1C, Step (3)). Step (4) provides for
extension of the amplification primer and signal primer extension
product to produce a double-stranded secondary amplification
product with a hemimodified RERS at one end (FIG. 1C, Step (4)).
Nicking of the unmodified S2 strand of the RERS, extension from the
nick and displacement of the downstream strand produces a
single-stranded oligonucleotide that comprises the complement of
the signal primer (FIG. 1C, Step (5)) and which in turn hybridizes
to the 3' tail of the reporter probe (FIG. 1C, Step (6)). Extension
from the 3' ends of the reporter probe and signal primer complement
results in formation of a double-stranded restriction site (FIG.
1C, Step (7)). Fluorescent signal is generated through the
double-stranded cleavage of the restriction site and separation of
the fluorophore and quencher moieties (FIG. 1C, Step (8)). The
complement of the signal primer and the double-stranded secondary
amplification product are produced only when the target is present
and amplified. These oligonucleotides can therefore be detected as
an indication of target amplification.
[0032] According to the detection method depicted in FIG. 1C, the
double-stranded secondary amplification product may be detected.
However, this is only meant to be illustrative of one of several
possible embodiments of this one type of detection method. There
are many different possible detection methods for which the
oligonucleotides of the present invention may be useful.
[0033] For instance, in another embodiment of the method depicted
by FIG. 1B, the single-stranded oligonucleotides of Step (3) may be
detected directly by hybridization to a reporter molecule (FIG.
1D).
[0034] In a further embodiment of the method depicted in FIG. 1, a
hairpin reporter detectable moiety labeled with a donor/quencher
pair, which are typically dyes, may be utilized such that donor
fluorescence is quenched in the SDA reaction. (See, for instance,
U.S. Pat. No. 5,928,869). It will be appreciated by one of ordinary
skill in the art that it may not be necessary for the detectable
moiety to be rendered entirely double-stranded to be detected. For
example, a partial complement of the hairpin structure can be
sufficient to keep the arms of the stem of the hairpin from
hybridizing to each other.
[0035] As used herein, "double-stranded reporter moiety" is
intended to encompass both fully and partially double-stranded
reporter moieties provided they are sufficiently double-stranded to
render the reporter moiety detectable. When the reporter moiety is
rendered double-stranded in the primer extension reaction, the
hairpin is unfolded. Upon unfolding, the donor and quencher become
sufficiently spatially separated to reduce or eliminate quenching
of donor fluorescence by the quencher. The resulting increase in
donor fluorescence, or a change in another fluorescence parameter
associated with a change in fluorescence quenching (such as, for
example, fluorescence lifetime, fluorescence polarization or a
change in emission of the quencher/acceptor), may be detected as an
indication of amplification of the target sequence.
[0036] In addition, multiple detectable reporter moieties may be
combined in a single reporter probe. For example, a labeled hairpin
may comprise a single-stranded RERS in the single-stranded "loop."
In this embodiment synthesis of the complement of the reporter
moiety not only unfolds the hairpin to produce an increase in
fluorescence, the RERS concurrently becomes cleavable or nickable,
which may produce an additional fluorescence increase.
[0037] In another embodiment, the folded detectable reporter moiety
(e.g., a hairpin) of the reporter probe does not hybridize to the
complement of an adapter sequence. However, in an alternative
embodiment, the adapter sequence may be selected so that its
complementary sequence will hybridize to all or part of a folded
reporter moiety of the reporter probe. In this embodiment,
hybridization alone will unfold or partially unfold the reporter
moiety to produce a signal without the need for
polymerase-catalyzed extension following hybridization. The folded
detectable reporter moiety in this embodiment may comprise all or
part of the reporter probe's sequence. In an example of such an
embodiment, the reporter probe may be a molecular beacon, a hairpin
oligonucleotide in which the loop of the beacon hairpin comprises
all or part of the adapter sequence. (See, for example, Tyagi and
Kramer, Nature Biotech., 14:303-308, 1996). As the complement of
the adapter sequence is synthesized during target amplification, it
binds to the molecular beacon and unfolds the structure, producing
increased fluorescence.
[0038] Thermophilic Strand Displacement Assays, as described in
U.S. Pat. Nos. 5,648,211 and 5,744,311, may also be performed using
the nucleic acids of the present invention. Because the enzymes
employed are thermolabile (i.e., temperature sensitive),
conventional mesophilic SDA as described by Walker et al. (Nucleic
Acids Research, 20:1691-1696, 1998) is conducted at a constant
temperature between about 37.degree. C. and 42.degree. C. The
enzymes that drive the amplification reaction are inactivated as
the reaction temperature is increased. However, the ability to
conduct isothermal SDA at higher temperatures using thermostable
enzymes, such as the restriction enzyme BsoBI and Bst DNA
polymerase, has several advantages. For example, amplification at
elevated temperatures allows for more stringent annealing between
amplification primers and template DNA, thereby improving the
specificity of the amplification process and potentially reducing
background reactions. A significant source of background reactions
are short "primer dimers" that are generated when the amplification
primers interact with one another, impairing the efficiency of the
desired amplification of the target sequence through the
consumption of rate limiting reagents. The formation of such primer
dimers is more likely at lower temperatures because the reduced
stringency of the reaction allows increased possibility of
transient hybridization between sequences with limited homology.
The ability to conduct SDA at higher temperatures reduces the
likelihood of primer dimer interactions, suppresses background
amplification and improves the efficiency of amplification of
specific target. In addition, amplifying at higher temperatures in
the range of 50.degree. C. to 70.degree. C. is likely to facilitate
strand displacement by the polymerase which, in turn, would
increase the efficiency of target amplification and result in
increased yields of amplified product.
[0039] Thus, in some embodiments of the invention, the
oligonucleotides of the present invention will anneal to their
intended targets under conditions appropriate for use of
thermostable enzymes. It is considered that, at least for specific
target-binding sequences, the annealing will be specific to the
degree that influenza A-specific oligonucleotides anneal to
influenza A nucleic acid and not to influenza B nucleic acid,
influenza C nucleic acid, or non-influenza nucleic acids, at a
temperature of from about 50.degree. C. to about 70.degree. C. in a
solution of from about 50 to about 500 mM alkali metal ion (usually
potassium ion), preferably about 100 to 200 mM alkali metal ion, or
equivalent solution conditions.
[0040] In another embodiment of the method of the present
invention, the reporter probe may be designed to comprise a
single-stranded sequence 3' to the folded reporter moiety such that
both the single-stranded sequence and all or part of the folded
reporter moiety hybridize to the sequence complementary to the
adapter sequence as it is produced during amplification.
[0041] In other alternative embodiments, other reporter moieties
may be substituted in the reaction scheme shown in FIG. 1. For
example, other folded nucleic acid structures, such as G-quartets,
may be substituted and unfolded in a similar target-dependent
manner to reduce fluorescence quenching. Alternatively, a
specialized linear sequence may be used as the reporter moiety, for
example a RERS, as depicted in FIG. 1C. When a RERS is used as the
reporter moiety, the donor and quencher are linked flanking a
cleavage site so that when the RERS is rendered double-stranded and
cleaved in a target-dependent manner the donor and quencher are
separated onto separate nucleic acid fragments. These alternative
structures may also be combined with specialized sequences, such as
an RERS in a G-quartet. The RERS may alternatively be rendered
nickable rather than cleavable in its double-stranded form. This is
a particularly suitable embodiment for use in SDA, as incorporation
of modified nucleotides and production of nickable RERS's are an
integral part of the amplification reaction in the SDA method.
[0042] These embodiments are merely variations of a myriad
different methods of detection utilizing the oligonucleotides of
the present invention and available to one of ordinary skill in the
art for the specific detection and/or amplification of influenza
genomes. Further variations of standard methods of Polymerase Chain
Reaction (PCR), Nucleic Acid Sequence Based Amplification (NASBA),
Transcription-Mediated Amplification (TMA), Rolling Circle
Amplification (RCA) or Ligation-Mediated Amplification (LMA) may
also be utilized as well as other methods of detection by
amplification or direct hybrization.
[0043] For instance, oligonucleotides consisting of, or consisting
essentially of, one or more of the nucleotide sequences of SEQ ID
NOS:27-77 may be used as primers in a PCR reaction designed to
specifically amplify either influenza A DNA or influenza 13 DNA or
both, in samples containing a mixture of the two viruses or just
one of the viruses or no virus (as a control). In addition to these
oligonucleotides, oligonucleotides comprising such analogs as
xanthine and/or inosine at positions of degeneracy may be employed.
Such an embodiment allows sensitive and specific detection of these
viruses in a sample using standard PCR techniques.
[0044] In another embodiment, influenza A and influenza B are
detected in a single multiplex reaction. For example, influenza A
and B may be detected in the same SDA reaction using amplification
and signal primers that are specific for each organism. Reporter
probes labeled, for example, with different dyes then enable the
detection and distinction of amplified products from the two
different species in the same reaction vessel.
[0045] In yet another embodiment an internal amplification control
is included in the same reaction i.e., in a triplex reaction, such
that detection of the internal amplification control can be used to
verify the performance of the assay. In the absence of either of
the specific analytes (i.e., influenza A and B), detection of the
amplification control serves to verify that conditions were
appropriate for success of the reaction.
[0046] In another embodiment, detection of influenza A and B may be
conducted in a reaction mixture which also contains primers and
probes for the detection of other viral respiratory and/or
non-respiratory analytes such as, for example, coronaviruses
(including, for example, Severe Acute Respiratory
Syndrome-associated Coronavirus), parainfluenza viruses 1, 2, 3 and
4, respiratory syncytial virus, adenoviruses, rhinoviruses,
parvoviruses, rotaviruses, noroviruses, herpes viruses and
enteroviruses.
[0047] In a further embodiment, detection of influenza A and B is
conducted in a reaction mixture which also contains primers and
probes for the detection of respiratory and/or non-respiratory
bacterial or fungal analytes such as, but not limited to,
Legionella spp., Streptococcus spp., Mycoplasma spp., Chlamydia
spp., Bordetella spp, Pneumococcus spp., Cryptococcus spp., Candida
spp. and Pneumocystis spp.
[0048] In another embodiment of the invention, detection of
influenza A and B may be conducted using a microarray that is
coated with specific capture probes. Different capture probes for
different viral, bacterial or fungal analytes are deposited at
different locations on the surface of the array. Isolated nucleic
acid from the analytes of interest may be hybridized directly to
the surface of the microarray or may undergo amplification by
methods known in the art, as already disclosed herein, such as PCR,
SDA, TMA, NASBA or rolling circle amplification. Hybridization of
nucleic acid to the specific capture probes may be detected by a
variety of different methods including, but not limited to, the use
of fluorescently-labeled reporter probes, chemiluminescence and
electrochemistry. In these embodiments, one or more of the
oligonucleotides of the present invention may be used as a capture
probe or as a detection reagent.
DEFINITIONS
[0049] Influenza A and B are enveloped viruses consisting of
segmented, negative strand RNA and are the causative agents of
highly contagious, acute respiratory disease. Influenza A and B
viruses are morphologically indistinguishable. These viruses are
classified based on antigenic differences in the nucleoprotein (NP)
and matrix (M) protein. Influenza A viruses are further classified
into subtypes according to properties of the two major
glycoproteins expressed on the surface of the viruses:
hemagglutinin and neuraminidase.
[0050] An "amplification primer" is a primer for amplification of a
target sequence by extension of the primer after hybridization to a
target sequence. For SDA, the 3' end of the amplification primer
(the target-binding sequence) hybridizes to the intended target at
the 3' end of the target-binding sequence. The amplification primer
may comprise a recognition site for a restriction endonuclease near
its 5' end. The recognition site is for a restriction endonuclease
which will cleave one strand of a DNA duplex when the recognition
site is hemimodified ("nicking"), as described in, for example,
U.S. Pat. No. 5,455,166 and U.S. Pat. No. 5,270,184 and EP 0684315.
As no special sequences or structures are required to drive the
amplification reaction, amplification primers for PCR may consist
only of target binding sequences. Amplification primers for 3 SR
and NASBA, in contrast, may further comprise an RNA polymerase
promoter near the 5' end. The promoter is appended to the
target-binding sequence and serves to drive the amplification
reaction by directing transcription of multiple RNA copies of the
target. Amplification primers are approximately 10-75 nucleotides
in length, preferably about 15-50 nucleotides in length. Typically
a stretch of contiguous nucleotides of about 10-25 nucleotides in
length hybridizes to the target and confers specificity of
hybridization to the amplification primer.
[0051] A "signal primer" according to the present invention
comprises a 3' target binding sequence that hybridizes to a
complementary sequence in the target and further comprises a 5'
tail sequence that is not complementary to the target (the adapter
sequence). The adapter sequence is selected such that its
complementary sequence will hybridize to the 3' end of the reporter
probe described below. In some embodiments of the present
invention, the signal primer does not comprise a detectable label.
Signal primers are typically approximately 10-75 nucleotides in
length, preferably about 15-50 nucleotides in length. The typical
length of a signal primer depends on the method in which it is
used. The length of a signal primer for SDA, for instance, is
typically about 25-50 nucleotides. The 3' end of a signal primer is
the target binding sequence and hybridizes to the target sequence.
Typically a stretch of contiguous nucleotides of about 10-25
nucleotides in length hybridizes to the target and confers
hybridization specificity on the signal primer. The specificity of
a signal primer may be different from the specificity of an
amplification primer used in the same assay. For example,
amplification primer target binding sequences might be specific to
influenza A or B, while signal primer target binding sequences
might be specific for influenza A and B.
[0052] In SDA-type methods, a signal primer according to the
present invention may comprise a 5' tail sequence that is not
complementary to the target, called an "adapter sequence." The
adapter sequence is selected such that its complementary sequence
will hybridize to the 3' end of a reporter probe and may constitute
a detectable label. In various embodiments of the present
invention, the adapter sequence is selected such that its
complementary sequence binds to both the 3' end of the reporter
probe and to a sequence within the reporter moiety of a reporter
probe. In some embodiments of the invention, the signal primer does
not comprise a detectable label.
[0053] The "target binding sequence" of a primer is the portion
that determines the target-specificity of the primer. That is, the
essential function of a target-specific sequence is to specifically
bind or hybridize to the target nucleic acid. For amplification
methods that do not require specialized sequences at the ends of
the target binding sequence, the amplification primer generally
consists essentially of only the target binding sequence. For
example, amplification of a target sequence using PCR according to
the present invention may employ amplification primers consisting
essentially of the target binding sequences. In such instances, the
amplification primer may be labeled with a directly detectable
label, such as a fluorophore or a radioisotope, an enzyme or an
immunologic tag such as a hapten or peptide epitope. Some
amplification methods require specialized sequences appended to the
target binding sequence, such as than the nickable restriction
endonuclease recognition site and the tail of a primer appropriate
for use in SDA, or e.g., an RNA polymerase promoter for 3SR, NASBA
or TAS, the required specialized sequence may be linked to the
target binding sequence using routine methods for preparation of
oligonucleotides without altering the hybridization specificity of
the primer.
[0054] As used herein, the terms "primer" and "probe" refer to
functions of an oligonucleotide. A primer is typically extended by
a polymerase enzyme or by ligation following hybridization to a
target sequence. A probe might or might not be extended. A
hybridized oligonucleotide may function as a probe if it is used to
capture or detect a target sequence, and the same oligonucleotide
may function as a primer when it is employed as a target binding
sequence of an amplification primer. It will therefore be
appreciated that any of the target binding sequences disclosed
herein for amplification, detection or quantitation of influenza
may also be used either as hybridization probes or as target
binding sequences in primers for detection or amplification,
optionally linked to a specialized sequence required by the
selected amplification reaction or to facilitate detection.
[0055] A "bumper primer" is a primer used to displace primer
extension products in isothermal amplification reactions, such as
SDA. As described in U.S. Pat. No. 5,744,311, the bumper primer
anneals to a target sequence upstream of the amplification primer
such that extension of the bumper primer displaces the downstream
amplification primer and its extension product. In other
embodiments of the present invention, extension of bumper primers
may also be used to displace the downstream extension products of
signal primers as described in U.S. Pat. No. 6,316,200. Bumper
primers may optionally be target-specific.
[0056] The terms "target" or "target sequence" refer to nucleic
acid sequences to be amplified or detected. These include the
original nucleic acid sequence to be amplified, its complement and
either strand of a copy of the original sequence, which is produced
by replication, or amplification. These copies serve as further
amplifiable targets because they contain copies of the sequence to
which the amplification primers hybridize. Copies of the target
sequence which are generated during the amplification reaction are
referred to as "amplification products," "amplimers," or
"amplicons." In the context of the present invention, the terms
target or target sequence refer to specific nucleic acid sequences
to which primers or probes hybridize and which exhibit homology or
complementarity to a part of the genomes of either influenza A or
influenza B, or to a transcript or clone of one (or perhaps both)
of these viruses. In addition, a target sequence may also be
derived from some other source, in order to serve as either a
positive control or as a normalizing control in a quantitative
assay. Furthermore, in a multiplex format assay, a plurality of
analytes, which may include non-influenza A, non-influenza B
analytes, may be present in a sample, and primer and probe
sequences may be appropriately derived for such additional
targets.
[0057] The term "extension product" refers to the copy of a target
sequence produced by hybridization of a primer and extension of the
primer by a polymerase enzyme using the target sequence and
sequences adjacent thereto as a template.
[0058] The term "assay probe" refers to any oligonucleotide used to
facilitate detection or identification of a nucleic acid sequence.
Signal primers as described above, and detector probes, detector
primers, capture probes and reporter probes as described below are
examples of assay probes.
[0059] The terms "amplicon," "amplification product" and "amplimer"
refer to the product of the amplification reaction generated
through the extension of either or both of a pair of amplification
primers. An amplicon may contain exponentially amplified nucleic
acids generated by two or more primers that hybridize to a target
sequence. Alternatively, amplicons may be generated by linear
amplification by hybridization of a single primer to the target
sequence. Thus, the term amplicon is used generically herein and
does not imply the presence of exponentially amplified nucleic
acids.
[0060] A "reporter probe" according to the present invention
comprises a label which is preferably at least one donor/quencher
dye pair, i.e., a fluorescent donor dye and a quencher for the
donor fluorophore. The label is linked to a structure in the
reporter probe (the "reporter moiety"), which does not hybridize
directly to the target sequence. This structure may be a nucleotide
sequence.
[0061] In one embodiment of the invention, the sequence of the
reporter probe 3' to the reporter moiety is selected to hybridize
to the complement of the signal primer adapter sequence. In general
in this embodiment, the 3' end of the reporter probe does not
contain sequences with any significant complementarity to the
target sequence. In some instances, however, the reporter probe may
contain the sequence that hybridizes to the adapter complement and
another short sequence at the 3' end that hybridizes to a short
segment of the target complement. In this case, the region of
target complementarity is not large enough to permit significant
hybridization without concurrent hybridization of the
adapter-specific region of the reporter probe. The label of the
reporter probe is detected as an indication of the presence of a
complement of the reporter moiety that renders it double-stranded,
thereby indicating the presence of or the amplification of the
target.
[0062] Any nucleic acid sequence or structure, which can be labeled
such that the presence of its complement, generated according to
the methods of the invention, indicates the presence of the target
sequence, can serve as the reporter moiety of the reporter probe.
Preferably, the reporter moiety is labeled with a donor/quencher
dye pair such that donor fluorescence is quenched prior to
detection of a target and such that quenching of donor fluorescence
is reduced as an indication of the presence of the target. The
reporter moiety may be a secondary structure at the 5' end of the
reporter probe, such as a stem-loop (or hairpin) as described in,
for instance, U.S. Pat. No. 5,928,869, or a G-quartet as described
in, for example, U.S. Pat. No. 5,691,145. The secondary structure
may be labeled such that the donor and quencher are in close
proximity when the secondary structure is folded, resulting in
quenching of donor fluorescence. In the presence of target, the
secondary structure may then be unfolded in a target-dependent
primer extension reaction so that the distance between the donor
and quencher is increased. This decreases quenching and produces an
increase in donor fluorescence that can be detected as an
indication of the presence of the target sequence.
[0063] Alternatively, the reporter moiety may be a single-stranded
sequence at the 5' end of the reporter probe which is labeled with
the donor and quencher in sufficiently close proximity to produce
quenching and which contains a single-stranded RERS as described in
U.S. Pat. No. 5,846,726 and U.S. Pat. No. 5,919,630. In the
single-stranded reporter probe, the RERS is not cleavable. However,
in the presence of target, the single-stranded RERS is converted to
double-stranded form in a target-dependent primer extension
reaction and thereby becomes cleavable. Treatment with the
appropriate restriction endonuclease cleaves the RERS between the
two dyes, separating them into separate nucleic acid fragments. The
associated increase in distance between the dyes results in reduced
quenching of donor fluorescence which can be detected as an
indication of the presence of the target sequence. In a further
embodiment, an RERS reporter moiety may be rendered nickable in the
target-dependent primer extension reaction, as taught in U.S. Pat.
Nos. 5,846,726 and 5,919,630. In this embodiment, when the RERS is
rendered double-stranded the restriction endonuclease nicks the
strand to which the donor and quencher are linked. Polymerase
extends from the nick, displacing from the reporter probe a
single-stranded fragment linked to one of the dyes. This also
increases the distance between the donor and quencher and results
in an increase in donor fluorescence due to decreased
quenching.
[0064] In some embodiments, such as PCR using detection by the
real-time hybridization of a reporter probe (e.g. TAQMAN.RTM.
detection, F. Hoffman-La Roche, Ltd. through exclusive licensee
Applied Biosystems, Foster City, Calif.), the reporter probe may
contain a sequence that is identical to a sequence present in
either strand of the amplicon. In such embodiments, the reporter
probe may have a sequence specific to the target sequence, or may
have a sequence common to a class of amplified nucleic acids, such
as a sequence common to the genomes of influenza viruses. In the
latter embodiments, specificity of the detection to a particular
strain or the like can be obtained by the use of specific primer
sequences. The label of the reporter probe is detected as an
indication of the presence of a complement of the reporter probe,
thereby indicating the presence of or the amplification of the
target.
[0065] In SDA embodiments of the invention, the 3' terminus of the
reporter probe may be capped to prevent extension by polymerase or
it may be made extendible through the incorporation of a 3'
terminal hydroxyl group. Capping may enhance performance in SDA
embodiments by reducing background signal and the nonproductive
consumption of reagents in spurious side-reactions resulting from
the formation of primer dimers and other errant priming events.
Examples of caps that prevent 3' extension of the reporter probe by
polymerase enzymes include: substitution of the 3'-hydroxyl with a
phosphate group, 3'-biotinyiation or incorporation of a
non-extendable inverted nucleotide base (3'-5'' linkage) at the 3'
end of the probe.
[0066] Any nucleic acid sequence or structure that may be labeled
such that the presence of its complement, generated according to
the methods of the invention, indicates the presence of the target
sequence, may serve as a basis for a reporter probe.
[0067] In a further embodiment, a RERS reporter moiety may be
rendered nickable in the target-dependent primer extension
reaction, as taught in, for example, U.S. Pat. Nos. 5,846,726 and
5,919,630. In this embodiment, when the RERS is rendered
double-stranded the restriction endonuclease nicks the strand to
which the donor and quencher are linked. A polymerase extends from
the nick, displacing from the reporter probe a single-stranded
fragment linked to the fluorophore or to the quencher. This also
increases the distance between the donor and quencher and results
in an increase in a fluorescence signal due to decreased
quenching.
[0068] In embodiments using direct detection of the amplicon, the
reporter moiety may be a directly emitting moiety, such as, for
instance, a fluorescent or chemiluminescent molecule. The reporter
moiety could alternatively be a short nucleotide sequence that is
distinct from the target sequence, or may be a molecule that is one
member of a complex, such that the reporter is detected or
quantified by measuring complex formation. Examples of such
embodiments include hapten-antibody complexes and peptide-aptamer
complexes.
[0069] Primers of the present invention typically are preferably
designed with a minimum melting temperature (T.sub.m) for the
annealing region of 44.degree. C., for use at an optimum
temperature for SDA of 52.5.degree. C. under the reaction
conditions described in Examples 4 and 5.
EXAMPLES
[0070] The present invention is exemplified by the following
examples. The examples set forth herein are illustrative only and
are not intended to in any way limit the scope of the present
invention.
Example 1
Primer Design
[0071] The primers and probes of the present invention, exemplified
by those listed in Table 1, are designed by alignment of published
matrix gene sequences using Lasergene MegAlign.TM. Software V5.06
(DNAStar.RTM., Madison Wis.). Three thousand and thirty one
influenza A, and seventy one influenza B matrix gene sequences were
aligned by the ClustalW method to identify conserved regions of
homology within each species. (See, Higgins et al., CABIOS,
5(2):151-153, 1989). For influenza A, separate alignments are
performed for each of three source species: human (1392 sequences
covering 7 subtypes), swine (162 sequences covering 9 subtypes) and
avian (1477 sequences covering 95 subtypes); for influenza B a
single alignment event was performed (71 sequences). These strains
were selected for inclusion in the influenza A and B alignments to
maximize amplification efficiency for all relevant influenza
strains in each of the influenza A and B RT-SDA designs.
[0072] Primer and probe sequences for reverse transcriptase-SDA
(RT-SDA) are designed to enable detection of all strains of
influenza A and B and to enable discrimination between influenza A
and influenza B. The aligned sequences are screened for BsoBI
restriction recognition sites that would preclude their use in
SDA-based amplification systems that employ the BsoBI restriction
enzyme. Because both (+) and (-) strand viral RNA may be present in
a clinical specimen, complementary amplification primers are
designed for both strands of RNA, to facilitate cDNA synthesis. In
RT-SDA, hybridization and extension of the amplification primers by
the reverse transcriptase enzyme leads to displacement into
solution of the downstream extension products of the signal
primers, thereby facilitating subsequent amplification. (See,
Hellyer T J. & Gillespie S H (ed), "Antibiotic Resistance
methods and Protocols," Humana, Totowa, N.J., pp. 141-155,
2000).
[0073] For both influenza A and influenza B, amplification primers
are designed to amplify conserved regions of the matrix gene such
that there are a minimal number of mismatches between the primers
and the target sequence. For both influenza A and B,
oligonucleotide primers are positioned such that any mismatches
with the target sequence are located away from the 3' terminus of
the hybridization region. Thus, these possible mismatches have
minimal impact on primer extension efficiency. Additionally, the
length of the SDA amplicons is minimized to provide optimum
amplification efficiency. Primers are screened for potential dimer
formation using OLIGO.RTM. V6.67 software (Molecular Biology
Insights, Inc., Cascade Colo.). Primers exemplified as those listed
as SEQ ID NOS: 3-14, 17 and 18 are designed with a minimum melting
temperature (T.sub.m) for the annealing region of 44.degree. C.,
for use at an optimum temperature for SDA of 52.5.degree. C. under
the reaction conditions described in Examples 4 and 5.
Example 2
Cloning of an Influenza A Target Sequence
[0074] Nucleic acid is isolated from an influenza A viral stock
obtained from the American Type Culture Collection (ATCC) (culture
number VR-547), using a QIAamp.RTM. Viral RNA Minikit (QIAGEN.RTM.,
Valencia, Calif., USA). Oligonucleotides FAM-BL and FAM-RB (SEQ ID
NOS: 3 and 4, respectively) are used to amplify a 158 base pair
fragment by reverse transcription PCR.
[0075] Amplified DNA is cloned into Escherichia coli using a
pCR.RTM. II-TOPO.RTM. vector (INVITROGEN.TM., Carlsbad, Calif.,
USA). Cloned plasmid DNA is purified and linearized by digestion
with EcoRV restriction enzyme. Following repurification using a
QIAquick.RTM. spin column (QIAGEN.RTM.) to remove the restriction
enzyme, the DNA is then used as a template for generation of in
vitro transcripts using a MEGASCRIPT.RTM. SP6 Kit (AMBION.RTM.,
Austin, Tex., USA). Briefly, RNA polymerase is used to generate
multiple RNA copies of the DNA template beginning at the SP6
promoter site upstream of the cloned influenza target sequence and
extending through to the 3' end of the linearized plasmid. The RNA
transcripts are then quantified by ultraviolet spectrophotometry
and diluted to working concentration in water containing 10
ng/.mu.l yeast RNA as a carrier.
Example 3
Cloning of an Influenza B Target Sequence
[0076] Nucleic acid is isolated from an influenza B viral stock
obtained from the ATCC (culture number B/HIC/5/72) using a
QIAAMP.RTM. Viral RNA Minikit (QIAGEN.RTM.). Oligonucleotides
FBM-LB and FBM-RB (SEQ ID NOS: 5 and 6, respectively) are then used
to amplify a 187 base pair fragment by reverse transcription
PCR.
[0077] Amplified DNA is inserted into the pCR II-TOPO vector.
Plasmid DNA is purified and linearized by digestion with BamHI
restriction enzyme. The DNA is then repurified using a
QIAQUICK.RTM. spin column (QIAGEN.RTM.) and quantified by
ultraviolet analysis.
[0078] In vitro transcripts are then generated from the BamHI
digested influenza B plasmid using a MEGASCRIPT T7 Kit
(AMBION.RTM.). The RNA are quantified by ultraviolet
spectrophotometry and diluted to working concentration in water
containing 10 ng/.mu.l yeast RNA as a carrier.
Example 4
Amplification of Cloned Influenza A and Influenza B RNA
Influenza A
[0079] Following a pre-warming step of microtiter plate wells
containing avian myeloblastosis virus-RT (AMV-RT), ribonuclease
inhibitor protein and all the oligonucleotides required for RT-SDA
of influenza A RNA, a two-step RT-SDA assay is performed in which
75 copies of in vitro transcript RNA are first copied to cDNA using
AMV-RT and then amplified in a conventional SDA reaction. Reverse
transcription is carried out in microtiter wells with 10 units of
AMV-RT in buffer containing: 120 mM bicine, 25 mM KOH, 43.5 mM
KPO.sub.4, 5% glycerol, 5% DMSO, 150 ng/.mu.l BSA, 6 ng/.mu.l yeast
RNA, 5 mM magnesium acetate, 300 nM each of the following
nucleotides: dATP, dGTP, and dTTP, 1500 nM dCsTP, 300 nM
amplification primer FAM-BL (SEQ ID NO:2), 300 nM amplification
primer FAM-RB (SEQ ID NO:3), 1500 nM signal primer FAM-LP (SEQ ID
NO:7), 300 nM signal primer FAM-RP (SEQ ID NO:8), 750 nM adapter
primer FAM-AD (SEQ ID NO:11), 750 nM adapter primer FAMICA.2 (SEQ
ID NO: 13), 900 nM target detector mpc.DR (SEQ ID NO:15) and 900 nM
internal control detector mpc2.FD (SEQ ID NO:16).
[0080] In vitro cloned internal control transcript is incorporated
into the influenza A reverse transcription reaction at 7.5
copies/.mu.L. In vitro cloned internal control transcript is
incorporated into the influenza B reverse transcription reaction at
2.0 copies/.mu.L.
[0081] The influenza A internal control molecule is constructed by
inverse-PCR site-directed mutagenesis of the clone of the influenza
A target region described in Example 2. Design of outward-facing
PCR primers incorporate a 7-base mutation at the 3' end of the
influenza A signal primer hybridization region. Inverse PCR is
performed with Pfil DNA polymerase (STRATAGENE.RTM.) and the ends
of the product are ligated to generate a circular plasmid molecule.
The circular plasmid molecule is then electroporated into E. coli.
The transformed E. coli is then grown to confluence and the plasmid
is isolated and purified. Linearizing the cloned plasmid using EcoR
V restriction enzyme, and performing an in vitro transcription
reaction using an Ambion MEGAscript.TM. SP6 Kit, according to the
manufacturer's instructions, generates in vitro transcripts. The
resulting internal amplification control transcripts amplify and
can be detected with similar efficiency to native influenza A
target RNA but the two can be distinguished when co-amplified in
the same RT-SDA reaction using specific signal primers and reporter
probes labeled with different dyes. For detection of the influenza
A internal amplification control, signal primer FAMICA.2 (SEQ ID
13) and reporter probe mpc2.FD (SEQ ID 16) are included in the
reaction mixture, as described above.
[0082] Reverse transcription reactions are incubated at 52.degree.
C. for 5 minutes, then 100 .mu.l buffer is added to modify
conditions to those suitable for SDA (143 mM bicine, 82 mM KOH,
24.5 mM KPO.sub.4, 12.5% DMSO, 1.67% glycerol). Microtiter plate
wells were immediately transferred to 72.degree. C. for 10 minutes
to denature the AMV-RT enzyme and eliminate non-specific
hybridization of primers. The reaction (100 .mu.l ) is then
transferred to wells, pre-warmed to 52.degree. C., containing Bst
polymerase and BsoBI restriction enzyme to bring the final
conditions to 143 mM bicine, 82 mM KOH, 24.5 mM KPO.sub.4, 12.5%
DMSO, 1.67% glycerol, 100 ng/.mu.l BSA, 2 ng/.mu.l yeast RNA, 100
nM each of dATP, dGTP, dTTP, 500 nM dCsTP, 6.7 mM magnesium
acetate, 100 nM amplification primer FAM-BL (SEQ ID NO:3), 100 nM
amplification primer FAM-RB (SEQ ID NO:4), 500 nM signal primer
FAM-LP (SEQ ID NO:7), 100 nM signal primer FAM-RP (SEQ ID NO:8),
250 nM adapter primer FAM-AD (SEQ ID NO:11), 250 nM adapter primer
FAMICA.2 (SEQ ID NO: 13), 300 nM target reporter mpc.DR (SEQ ID
NO:15), 300 nM internal control reporter mpc2.FD (SEQ ID NO:16),
approximately 800 units Bst and approximately 265 units BsoBI.
[0083] Reactions are sealed and incubated at 52.degree. C. for 60
minutes in a BD PROBETEC.TM. ET fluorescence reader
(BECTON-DICKINSON.RTM., Franklin Lakes, N.J., US). Fluorescence is
monitored over 60 passes of the instrument and results are
expressed in terms of PAT scores (defined as 60-(number of passes
required for relative fluorescent signal to pass a predetermined
threshold)). PAT values equal to zero are considered negative
whereas PAT scores greater than zero are considered positive.
Results are shown in Tables 2 and 4.
Influenza B
[0084] A two-step RT-SDA assay is performed, as described above for
influenza A, in which RNA is first copied to cDNA using AMV-RT. The
reaction is conducted essentially as disclosed above for influenza
A, with the exception that bumper primers FBM-LB (SEQ ID NO: 5) and
FBM-RB (SEQ ID NO:6), amplification primers FBM-LP (SEQ ID NO:10)
and FBM-RP (SEQ ID NO:11) and signal primers FBM-AD (SEQ ID NO:12)
and FBMICA.2 (SEQ ID NO:14) are substituted for the corresponding
influenza A-specific primers.
[0085] The approach to design and cloning of the influenza B
internal control is similar to that adopted for the influenza A
RT-SDA assay. The influenza B internal amplification control
molecule is constructed by inverse PCR mutagenesis of a 6-base
sequence that corresponds to the 3' end of the influenza B specific
signal primer hybridization region. In vitro transcripts are
generated using an AMBION MEGASCRIPT.RTM. T7 Kit as described by
the manufacturer. For detection of the influenza B internal
amplification control, signal primer FBMICA.2 (SEQ ID 14) and
reporter probe mpc2.FD (SEQ ID 16) are included in the reaction
mixture. Results are shown in Tables 3 and 5.
Example 5
Specificity of the Influenza A and B RT-SDA Assay
[0086] RNA is extracted from cultured stocks of influenza A and B
using a QIAGEN.RTM. QIAAMP.RTM. viral RNA minikit procedure
modified to include an on-column DNase treatment using 27.3 Kunitz
units of RNase-free DNase I (QIAGEN.RTM., Valencia, Calif., US)
following the initial wash step with buffer AW1. A 15 minute DNase
incubation at ambient temperature is performed after an initial
Buffer AW1 wash step. Following the DNase incubation, a second
Buffer AW1 wash step is performed and the standard QIAAMP.RTM.
Viral RNA Mini Kit procedure is followed, with the exception that
the purified nucleic acid is eluted in 80 .mu.L Buffer AVE.
[0087] Nucleic acid is similarly isolated from stocks of other
viruses and bacteria that commonly cause respiratory infections
except that for bacterial species, no DNase treatment (and, thus,
no second Buffer AW1 wash step) is performed. Purified nucleic acid
is tested in each of the RT-SDA influenza A and influenza B assays
in a similar manner to that described in Example 4, with the
exception that no pre-incubation of microwells is performed prior
to reverse transcription.
[0088] Influenza A and B purified RNAs are tested in their
respective assays: at approximately 500 genome equivalents per test
for Influenza A and 250 genome equivalents per test for Influenza
B. All other purified nucleic acid stocks are tested at
approximately 10.sup.6 genome equivalents per reaction. The
influenza A and B assays are performed in similar manner to that
described in Example 4.
General Conclusions
[0089] All stocks of influenza A tested in the influenza A assay
yielded positive results at 500 particles per test with no false
positive signals from the non-influenza A organisms, including
influenza B. (See, Tables 2-9). Similarly, all stocks of influenza
B tested in the influenza B assay gave positive results at 250
particles per test with no false positive results generated by
non-influenza B organisms, including influenza A. (See, Tables
2-9).
Example 6
Specific Amplification of Cloned Influenza A and Influenza B RNA by
RT-PCR
[0090] Influenza A: RT-PCR is performed wherein 10, 100, 500 and
1000 copies of in vitro transcript RNA are copied to form the
related cDNA and amplified, using Brilliant.TM. QRT-PCR Master Mix
(Stratagene), in a single-step, homogeneous reaction. RNA
transcripts containing the targeted sequence within the matrix gene
of the influenza A genome are prepared from a plasmid DNA clone as
described in Example 2. Dilutions of target transcript RNA are
prepared in nuclease-free water (Ambion, Inc.). PCR primers and
TAQMAN.TM. probe (SEQ ID NOS:27-77), reverse transcriptase mix, and
PCR master mix are combined with target RNA transcript in a single
PCR tube in a total reaction volume of 50 .mu.L. The final
concentrations of primer FluATMLP1 (for instance, any one of SEQ ID
NOS:27-30), primer FluATMRP2 (for instance, any one of SEQ ID
NOS:65-68) and TAQMAN.TM. probe FluATMProbe3 (for instance, any one
of SEQ ID NOS:47-62) are 200 nM, 200 nM and 100 nM, respectively.
Reaction mixtures without reverse transcriptase enzyme are included
to control for the presence of contaminating DNA from the parental
plasmid clone of the target transcripts. RT-PCR is carried out in a
Stratagene Mx3005P real-time PCR instrument. Reverse transcription
is performed at 48.degree. C. for 30 minutes, after which PCR
amplification is conducted under the following cycling parameters:
95.degree. C. for 10 minutes, then 40 cycles of 95.degree. C. for
15 seconds and 59.degree. C. for 1 minute.
[0091] Results are expressed in terms of cycle threshold (Ct); the
point at which the background-corrected fluorescent signal crossed
a predetermined threshold. The algorithm used to compute Ct values
first identifies the portion of the amplification plots where all
of the data curves within a run display an exponential increase in
fluorescence, then calculates the threshold value that minimizes
the standard deviation for Ct values within a given set of
replicates. All (100%) reactions containing .gtoreq.100 RNA
transcripts yielded positive results, with a mean Ct value of 34.3.
None of the replicates of the "No Reverse Transcriptase" control
generated positive results.
[0092] These data empirically demonstrate the ability to detect the
targeted sequence of the influenza A matrix gene using the
disclosed primers and detector probe.
[0093] Influenza B: RT-PCR is performed in which 10, 100, 500 and
1000 copies of in vitro transcript RNA were copied into cDNA and
amplified, using BRILLIANT.TM. QRT-PCR Master Mix (Stratagene), in
a single-step, homogeneous reaction, RNA transcripts containing the
targeted sequence within the matrix gene of the influenza B genome
are prepared from a plasmid DNA as described in Example 2.
Dilutions of target transcript RNA are prepared in nuclease-free
water (Ambion, Inc.). PCR primers, TAQMAN.TM. probe, reverse
transcriptase mix, and PCR master mix are combined with target RNA
transcript in a single PCR tube in a total reaction volume of 50
.mu.L. The final concentrations of primer FluBTMLP1 (SEQ ID NO:69),
primer FluBTMRP1 (for instance, any one of SEQ ID NOS:74-77) and
TAQMAN.TM. probe FluBTMProbe3 (for instance, any one or more of SEQ
ID NOS:70-73) are 200 nM, 200 nM and 100 nM, respectively. Reaction
mixtures without reverse transcriptase enzyme are included to
control for the presence of contaminating DNA from the parental
plasmid clone of the target transcripts. RT-PCR is carried out in a
Stratagene Mx3005P real-time PCR instrument. Reverse transcription
is performed at 48.degree. C. for 30 minutes, after which PCR
amplification is conducted under the following cycling parameters:
95.degree. C. for 10 minutes, then 40 cycles of 95.degree. C. for
15 seconds and 59.degree. C. for 1 minute.
[0094] Results are expressed in cycle threshold (Ct), the point at
which the background-corrected fluorescent signal crossed a
predetermined threshold. The algorithm used to compute Ct values
first identifies the portion of the amplification plots where all
of the data curves within a run display an exponential increase in
fluorescence, then calculates the threshold value that minimizes
the standard deviation for Ct values within a given set of
replicates. All (100%) reactions containing .gtoreq.100 RNA
transcripts yielded positive results, with a mean Ct value of 31.4.
Two of four replicates of the "No Reverse Transcriptase" control
crossed the positive threshold with Ct scores >37, indicating
the presence of low levels of DNA contamination. Assuming an
amplification efficiency of 2, these results indicate approximately
a 64-fold difference in input target level between these samples
and those containing 100 copies of transcript RNA.
[0095] These data demonstrate the ability to detect the targeted
sequence of the influenza B matrix gene using the disclosed primers
and detector probe.
[0096] All references, including publications, patents, and patent
applications, cited herein are hereby incorporated by reference to
the same extent as if the disclosure each reference were
individually and specifically indicated to be incorporated by
reference and were set forth in its entirety herein.
TABLE-US-00002 TABLE 2 Influenza A Assay PAT Score Target Target
Internal Control Result No target spike 0.0 43.3 Negative No target
spike 0.0 44.1 Negative No target spike 0.0 47.5 Negative No target
spike 0.0 48.0 Negative No target spike 0.0 47.0 Negative No target
spike 0.0 46.1 Negative No target spike 0.0 48.0 Negative No target
spike 0.0 46.1 Negative 750 copies/reaction 48.2 44.1 Positive 750
copies/reaction 44.7 15.4 Positive 750 copies/reaction 45.0 28.9
Positive 750 copies/reaction 40.7 39.7 Positive 750 copies/reaction
48.8 43.1 Positive 750 copies/reaction 49.4 48.7 Positive 750
copies/reaction 49.1 47.2 Positive 750 copies/reaction 49.8 38.1
Positive
TABLE-US-00003 TABLE 3 Influenza B Assay PAT Score Target Target
Internal Control Result No target spike 0.0 49.1 Negative No target
spike 0.0 49.2 Negative No target spike 0.0 49.1 Negative No target
spike 0.0 48.6 Negative No target spike 0.0 42.5 Negative No target
spike 0.0 49.2 Negative No target spike 0.0 49.3 Negative No target
spike 0.0 49.9 Negative 200 copies/reaction 42.9 46.8 Positive 200
copies/reaction 41.5 48.2 Positive 200 copies/reaction 47.5 45.7
Positive 200 copies/reaction 47.8 47.4 Positive 200 copies/reaction
44.1 48.6 Positive 200 copies/reaction 42.1 48.3 Positive 200
copies/reaction 45.6 48.1 Positive 200 copies/reaction 46.6 47.4
Positive
TABLE-US-00004 TABLE 4 Influenza A Viral Stocks Tested in the
Influenza A RT-SDA Assay Mean PAT # Replicates Virus ID test level
Score Positive Influenza A ATCC VR219 500 genome equivalents/test
45.5 4 Influenza A ATCC VR897 500 genome equivalents/test 42.9 4
Influenza A ATCC VR544 500 genome equivalents/test 43.9 4 Influenza
A ATCC VR547 500 genome equivalents/test 44.4 4 Influenza A ATCC
VR825 500 genome equivalents/test 45.6 4 Influenza A ATCC VR1520
500 genome equivalents/test 39.8 4
TABLE-US-00005 TABLE 5 Influenza B Viral Stocks Tested in the
Influenza A RT-SDA Assay Mean PAT # Replicates Virus ID test level
Score Positive Influenza B ATCC VR101 10.sup.6 genome
equivalents/test 0 4 Influenza B ATCC VR790 10.sup.6 genome
equivalents/test 0 4 Influenza B CDC 98010029 10.sup.6 genome
equivalents/test 0 4
TABLE-US-00006 TABLE 6 Non-influenza Bacterial and Viral Stocks
Tested in the Influenza A RT-SDA Assay Mean PAT Replicates Organism
ID test level Score Negative Staphylococcus aureus 12598 10.sup.6
genome equivalents/reaction 0 2 Streptococcus pneumoniae ATCC 6303
9.22 .times. 10.sup.6 genome equivalents/reaction 0 2 Chlamydia
psittaci VR-601 10.sup.6 genome equivalents/reaction 0 2 Legionella
pneumophila ATCC 33152 10.sup.6 genome equivalents/reaction 0 2
Legionella micdadei ATCC 33204 10.sup.6 genome equivalents/reaction
0 2 Bordatella bronchiseptica ATCC 10580 10.sup.6 genome
equivalents/reaction 0 2 Chlamydophila pneumoniae TW-183 10.sup.6
genome equivalents/reaction 0 2 Haemophilus influenza ATCC 33533
10.sup.6 genome equivalents/reaction 0 2 Bordatella pertussis 53984
10.sup.6 genome equivalents/reaction 0 2 Mycoplasma pneumoniae
29342 10.sup.6 genome equivalents/reaction 0 2 Rhinovirus 1A
10.sup.6 genome equivalents/reaction 0 2 Rhinovirus 70 10.sup.6
genome equivalents/reaction 0 2
TABLE-US-00007 TABLE 7 Influenza B Viral Stocks Tested in the
Influenza B RT-SDA Assay Mean PAT # Replicates Virus ID test level
Score Positive Influenza B ATCC VR101 250 genome equivalents/test
48.1 4 Influenza B ATCC VR790 250 genome equivalents/test 43.8 4
Influenza B CDC 98010029 250 genome equivalents/test 49.6 4
TABLE-US-00008 TABLE 8 Influenza A Viral Stocks Tested in the
Influenza B RT-SDA Assay Mean PAT # Replicates Virus ID test level
Score Negative Influenza A ATCC VR219 10.sup.6 genome
equivalents/test 0.0 4 Influenza A ATCC VR897 10.sup.6 genome
equivalents/test 0.0 4 Influenza A ATCC VR544 10.sup.6 genome
equivalents/test 0.0 4 Influenza A ATCC VR547 10.sup.6 genome
equivalents/test 0.0 4 Influenza A ATCC VR825 10.sup.6 genome
equivalents/test 0.0 4 Influenza A ATCC VR1520 10.sup.6 genome
equivalents/test 0.0 4
TABLE-US-00009 TABLE 9 Non-Influenza Bacterial and Viral Stocks
Tested in the Influenza B RT-SDA Assay Mean PAT Replicates Organism
ID test level Score Negative Staphylococcus aureus 12598 10.sup.6
genome equivalents/reaction 0 2 Streptococcus pneumoniae ATCC 6303
9.22 .times. 10.sup.5 genome equivalents/reaction 0 2 Chlamydia
psittaci VR-601 10.sup.6 genome equivalents/reaction 0 2 Legionella
pneumophila ATCC 33152 10.sup.6 genome equivalents/reaction 0 2
Legionella micdadei ATCC 33204 10.sup.6 genome equivalents/reaction
0 2 Bordatella bronchiseptica ATCC 10580 10.sup.6 genome
equivalents/reaction 0 2 Chlamydophila pneumoniae TW-183 10.sup.6
genome equivalents/reaction 0 2 Haemophilus influenza ATCC 33533
10.sup.6 genome equivalents/reaction 0 2 Bordatella pertussis 53984
10.sup.6 genome equivalents/reaction 0 2 Mycoplasma pneumoniae
29342 10.sup.6 genome equivalents/reaction 0 2 Rhinovirus 1A
10.sup.6 genome equivalents/reaction 0 2 Rhinovirus 70 10.sup.6
genome equivalents/reaction 0 2
Sequence CWU 1
1
7716DNAArtificial SequenceDescription of Artificial Sequence BsoBI
restriction enzyme recognition site 1ctcggg 626DNAArtificial
SequenceDescription of Artificial Sequence Modified BsoB1 site with
phosphorothioate linkages 2gagnnn 6317DNAArtificial
SequenceDescription of Artificial Sequence Influenza A 5' bumper
primer 3tcaggccccc tcaaagc 17417DNAArtificial SequenceDescription
of Artificial Sequence Influenza A 3' bumper primer 4ggcacggtga
gcgtgaa 17517DNAArtificial SequenceDescription of Artificial
Sequence Influenza B 5' bumper primer 5tgtcgctgtt tggagac
17618DNAArtificial SequenceDescription of Artificial Sequence
Influenza B 3' bumper primer 6aggcaccaat tagtgctt
18739DNAArtificial SequenceDescription of Artificial Sequence
Influenza A 5' amplification primer 7cgattccgct ccagacttct
cgggaggctc tcatggaat 39839DNAArtificial SequenceDescription of
Artificial Sequence Influenza A 3' amplification primer 8accgcatcga
atgactgtct cgggccctta gtcagaggt 39939DNAArtificial
SequenceDescription of Artificial Sequence Influenza B 5'
amplification primer 9accgcatcga atgactgtct cgggctttcc caccgaacc
391040DNAArtificial SequenceDescription of Artificial Sequence
Influenza B 3' amplification primer 10cgattccgct ccagacttct
cgggattgcc tacctgcttt 401141DNAArtificial SequenceDescription of
Artificial Sequence Influenza A adapter primer for universal
detection of influenza A RNA 11acgttagcca ccatacttga gacaggattg
gtcttgtctt t 411242DNAArtificial SequenceDescription of Artificial
Sequence Influenza B signal primer for universal detection of
influenza B RNA 12acgttagcca ccatacttga gttctgcttt gccttctcca tc
421341DNAArtificial SequenceDescription of Artificial Sequence
Influenza A signal primer for detection of internal control RNA
13actgatccgc actaacgact gacaggattg gtctatctac a 411442DNAArtificial
SequenceDescription of Artificial Sequence Influenza B signal
primer for detection of internal control RNA 14actgatccgc
actaacgact agttctgctt tgccttccac ct 421529DNAArtificial
SequenceDescription of Artificial Sequence Target Reporter Probe
15tccccgagta cgttagccac catacttga 291629DNAArtificial
SequenceDescription of Artificial Sequence Internal Control
Reporter Probe 16tccccgagta ctgatccgca ctaacgact
291739DNAArtificial SequenceDescription of Artificial Sequence
Influenza A 5' Amplification primer #2 17cgattccgct ccagacttct
cgggaggctc tcatggagt 391839DNAArtificial SequenceDescription of
Artificial Sequence Influenza A 5' Amplification primer #2
18cgattccgct ccagacttct cgggtgaggc tctcatgga 391915DNAArtificial
SequenceDescription of Artificial Sequence Influenza A 5' target
sequence 19aggctctcat ggaat 152015DNAArtificial SequenceDescription
of Artificial Sequence Influenza A 3' target sequence 20cccttagtca
gaggt 152115DNAArtificial SequenceDescription of Artificial
Sequence Influenza B 5' target sequence 21ctttcccacc gaacc
152216DNAArtificial SequenceDescription of Artificial Sequence
Influenza B 3' target sequence 22attgcctacc tgcttt
162315DNAArtificial SequenceDescription of Artificial Sequence
Influenza A 5' target sequence 23aggctctcat ggagt
152415DNAArtificial SequenceDescription of Artificial Sequence
Influenza A 5' target sequence 24tgaggctctc atgga
1525719DNAArtificial SequenceDescription of Artificial Sequence
Fig. 3 - influenza A matrix gene 25atgagccttc taaccgaggt cgaaacgtgt
gttctctcta tcgttccatc aggccccctc 60aaagccgaaa tcgcgcagag acttgaagat
gtctttgctg ggaaaaacac agatcttgag 120gctctcatgg aatggctaaa
gacaagacca attctgtcac ctctgactaa ggggattttg 180gggtttgtgt
tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc
240caaaatgccc tcaatgggaa tggggatcca aataacatgg acaaagcagt
taaactgtat 300agaaaactta agagggagat aacattccat ggggccaaag
aaatagcact cagttattct 360gctggtgcac ttgctagttg catgggcctc
atatacaata ggatgggggc tgtaaccacc 420gaagtggcat ttggcctggt
atgtgcaaca tgtgaacaga ttgctgactc ccagcacagg 480tctcataggc
aaatggtggc aacaaccaat ccattaataa aacatgagaa cagaatggtt
540ttggccagca ctacagctaa agctatggag caaatggctg gatcaagtga
gcaggcagcg 600gaggccatgg agattgctag tcaggccagg caaatggtgc
aggcaatgag aaccgttggg 660actcatccta gttccagtac tggtctaaga
gatgatcttc ttgaaaattt gcagaccta 71926891DNAArtificial
SequenceDescription of Artificial Sequence Fig. 4 - influenza B
matrix gene 26atgtcgctgt ttggagacac aattgcctac ctgctttcat
tgacagaaga tggagaaggc 60aaagcagaac tagcagaaaa attacactgt tggttcggtg
ggaaagaatt tgacctagac 120tctgccttgg aatggataaa aaacaaaaga
tgcttaactg atatacaaaa agcactaatt 180ggtgcctcta tatgcttttt
aaaacccaaa gaccaggaaa ggaaaagaag attcatcaca 240gagcctctat
caggaatggg aacaacagca acaaaaaaga aaggcctgat tctagctgag
300agaaaaatga gaagatgtgt gagctttcat gaagcatttg aaatagcaga
aggccatgaa 360agctcagcgc tactgtattg tctcatggtc atgtacctga
atcctggaaa ttattcaatg 420caagtaaaac taggaacgct ctgtgctttg
tgcgagaaac aagcatcaca ttcacacagg 480gctcatagca gagcagcgag
atcttcagtg cccggagtga gacgagaaat gcagatggtc 540tcagctatga
acacagcaaa aacaatgaat ggaatgggaa aaggagaaga cgtccaaaag
600ctggcagaag agctgcaaag caacattgga gtgttgagat ctctcggagc
aagtcaaaag 660aatggggaag gaattgcaaa ggatgtaatg gaagtgctaa
agcagagctc tatgggaaat 720tcagctcttg tgaagaaata tctataatgc
tcgaaccatt tcagattctt tcaatttgtt 780cttttatctt atcagctctc
cacttcatgg cttggacaat agggcatttg aatcaaataa 840aaagaggagt
aaacatgaaa atacgaataa aaggtccaaa caaagagaca a 8912716DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 27tcaggccccc tcaaag 162816DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 28tcgggccccc tcaaag 162916DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 29tcgggccccc tcaaaa 163016DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 30tcaggccccc tcaaaa 163118DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 31gaggctctca tggaatgg 183218DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 32gaagctctca tggaatgg 183318DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 33gaagttctca tggaatgg 183418DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 34gaagcactca tggaatgg 183518DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 35gaagctctca tggagtgg 183618DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 36gaagtactca tggaatgg 183718DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 37gaagtactca tggagtgg 183818DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 38gaagcactca tggagtgg 183918DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 39gaagttctca tggagtgg 184018DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 40gaggttctca tggaatgg 184118DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 41gaggtactca tggaatgg 184218DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 42gaggttctca tggagtgg 184318DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 43gaggtactca tggagtgg 184418DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 44gaggcactca tggaatgg 184518DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 45gaggcactca tggagtgg 184618DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 46gaggctctca tggagtgg 184726DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR
oligonucleotide primer 47aaagacaaga ccaatcctgt cacctc
264826DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 48aaagacaaga ccgatcctgt cacctc
264926DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 49aaagacaaga ccgattctgt cacctc
265026DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 50aaagacaaga ccgatcttgt cacctc
265126DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 51aaagacaaga ccgatcctgt cacctt
265226DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 52aaagacaaga ccgattttgt cacctc
265326DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 53aaagacaaga ccgattttgt cacctt
265426DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 54aaagacaaga ccgattctgt cacctt
265526DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 55aaagacaaga ccgatcttgt cacctt
265626DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 56aaagacaaga ccaattctgt cacctc
265726DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 57aaagacaaga ccaattttgt cacctc
265826DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 58aaagacaaga ccaattttgt cacctt
265926DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 59aaagacaaga ccaattctgt cacctt
266026DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 60aaagacaaga ccaatcttgt cacctc
266126DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 61aaagacaaga ccaatcttgt cacctt
266226DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 62aaagacaaga ccaatcctgt cacctt
266316DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide primer 63tgggcacggt gagcgt
166416DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide primer 64tgggcacggt gagtgt
166516DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide primer 65gcacggtgag cgtgaa
166616DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide primer 66gcacggtgag tgtgaa
166716DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide primer 67gcacggtgag tgtaaa
166816DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide primer 68gcacggtgag cgtaaa
166919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide primer 69tgtcgctgtt tggagacac
197024DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 70atggagaagg caaagcagaa ctag
247124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 71atggagaagg caaagcagag ctag
247224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 72atggagaagg caaagcagag ttag
247324DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide probe 73atggagaagg caaagcagaa ttag
247418DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide primer 74ttctttccca ccgaacca
187518DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide primer 75ctctttccca ccgaacca
187618DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide primer 76ctctttccca ccaaacca
187718DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR oligonucleotide primer 77ttctttccca ccaaacca 18
* * * * *
References