U.S. patent application number 11/655413 was filed with the patent office on 2010-10-28 for viable non-toxic gram-negative bacteria.
This patent application is currently assigned to Regents of the University of Michigan. Invention is credited to Parag Aggarwal, Timothy Charles Meredith, Ronald Wesley Woodard.
Application Number | 20100272758 11/655413 |
Document ID | / |
Family ID | 38288246 |
Filed Date | 2010-10-28 |
United States Patent
Application |
20100272758 |
Kind Code |
A1 |
Woodard; Ronald Wesley ; et
al. |
October 28, 2010 |
Viable non-toxic gram-negative bacteria
Abstract
The present invention provides non-toxic Gram-negative bacteria.
In particular, the present invention provides viable Gram-negative
bacteria (e.g., E. coli) substantially lacking lipopolysaccharide
(LPS, endotoxin) within the outer membrane. The present invention
further provides methods of generating viable non-toxic
Gram-negative bacteria and uses thereof. The present invention also
provides compositions and methods for inducing immune responses and
for researching and developing therapeutic agents.
Inventors: |
Woodard; Ronald Wesley; (Ann
Arbor, MI) ; Meredith; Timothy Charles; (Ann Arbor,
MI) ; Aggarwal; Parag; (Frederick, MI) |
Correspondence
Address: |
Frank S. DiGiglio;Scully, Scott, Murphy & Presser, P.C.
Suite 300, 400 Garden City Plaza
Garden City
NY
11530
US
|
Assignee: |
Regents of the University of
Michigan
Ann Arbor
MI
|
Family ID: |
38288246 |
Appl. No.: |
11/655413 |
Filed: |
January 19, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60760314 |
Jan 19, 2006 |
|
|
|
Current U.S.
Class: |
424/249.1 ;
424/234.1; 424/251.1; 424/252.1; 424/253.1; 424/256.1; 424/257.1;
424/258.1; 424/259.1; 424/260.1; 424/261.1; 424/263.1; 435/134;
435/252.1; 435/252.3; 435/252.33; 435/317.1; 435/32 |
Current CPC
Class: |
Y02A 50/403 20180101;
Y02A 50/478 20180101; Y02A 50/407 20180101; A61P 1/12 20180101;
A61P 31/00 20180101; A61K 39/0258 20130101; Y02A 50/476 20180101;
C12N 1/20 20130101; A61K 39/00 20130101; C12N 15/52 20130101; A61P
31/04 20180101; Y02A 50/474 20180101; Y02A 50/30 20180101; C12N
1/36 20130101 |
Class at
Publication: |
424/249.1 ;
424/257.1; 424/253.1; 424/252.1; 424/260.1; 424/256.1; 424/251.1;
424/261.1; 424/259.1; 424/234.1; 424/258.1; 424/263.1; 435/317.1;
435/252.1; 435/252.3; 435/134; 435/252.33; 435/32 |
International
Class: |
A61K 39/095 20060101
A61K039/095; A61K 39/108 20060101 A61K039/108; A61K 39/10 20060101
A61K039/10; A61K 39/104 20060101 A61K039/104; A61K 39/102 20060101
A61K039/102; A61K 39/02 20060101 A61K039/02; A61K 39/106 20060101
A61K039/106; A61K 39/112 20060101 A61K039/112; A61K 39/118 20060101
A61K039/118; A61P 31/00 20060101 A61P031/00; A61P 1/12 20060101
A61P001/12; C12N 1/00 20060101 C12N001/00; C12N 1/20 20060101
C12N001/20; C12N 1/21 20060101 C12N001/21; C12P 7/64 20060101
C12P007/64; C12Q 1/18 20060101 C12Q001/18 |
Goverment Interests
[0002] This invention was made with government support under Grant
No. GM53609 awarded by the National Institutes of Health.
Claims
1. A composition comprising an outer membrane of viable Escherichia
coli substantially lacking lipopolysaccharide.
2. The composition of claim 1, comprising viable Escherichia coli
substantially lacking lipopolysaccharide.
3. A composition comprising viable Gram-negative bacteria having a
disruption in the KDO.sub.2-LipidIV.sub.A biosynthetic pathway or
having a disruption to prevent O-acylation of
KDO.sub.2-LipidIV.sub.A.
4. The composition of claim 3, wherein said viable Gram-negative
bacteria lacks D-arabinose 5-phosphate isomerase (API)
expression.
5. The composition of claim 3, wherein said viable Gram-negative
bacteria comprises mutations such that said strain is substantially
free of KDO.
6. (canceled)
7. The composition of claim 3, wherein said viable Gram-negative
bacteria comprises mutations such that said mutations eliminate
association between KDO.sub.2 and Lipid IV.sub.A.
8. The composition of claim 7, wherein said mutations is at least
one gene mutation selected from the group consisting of a mutated
gutQ gene, a mutated kdsD gene, a mutated msbA gene, a mutated kdsA
gene, a mutated kdsB gene, a mutated waaA gene, a mutated yhjD
gene, a mutated lpxL gene, and a mutated lpxM gene.
9-13. (canceled)
14. The composition of claim 3, wherein the outer membrane of said
viable Gram-negative bacteria expresses Lipid IV.sub.A.
15. A method of producing Lipid IV.sub.A, comprising extracting
Lipid IV.sub.A from said viable Gram-negative bacteria of claim
14.
16-21. (canceled)
22. A method for inducing an immune response in a subject
comprising administering a composition of claim 1 to said subject
such that said administration induces an immune response.
23. The composition of claim 3, wherein said Gram-negative bacteria
is a species selected from the group consisting of Escherichia
spp., Shigella spp., Salmonella spp., Campylobacter spp., Neisseria
spp., Haemophilus spp., Aeromonas spp., Francisella spp., Yersinia
spp., Klebsiella spp., Bordetella spp., Legionella spp.,
Corynebacteria spp., Citrobacter spp., Chlamydia spp., Brucella
spp., Pseudomonas spp., Helicobacter spp. and Vibrio spp.
24. A viable Gram-negative bacterial strain having a disruption in
the KDO.sub.2-LipidIV.sub.A biosynthetic pathway or having a
disruption to prevent O-acylation of KDO.sub.2-LipidIV.sub.A,
wherein said viable Gram-negative bacterial strain comprises a gene
of interest coupled with a promoter.
25. The viable Gram-negative bacterial strain of claim 24, wherein
said gene of interest is expressed via a plasmid.
26. A viable Gram-negative bacterial strain having a disruption in
the KDO.sub.2-LipidIV.sub.A biosynthetic pathway or having a
disruption to prevent O-acylation of KDO.sub.2-LipidIV.sub.A,
wherein said viable Gram-negative bacterial strain is designed to
optimize plasmid DNA production, having mutations in one or both of
the genes recA and/or endA.
27. The viable Gram-negative bacterial strain of claim 24, wherein
said strain is an E. coli strain.
28. The viable Gram-negative bacterial strain of claim 24, wherein
said gene of interest comprises DNA for mammalian cell
transfection.
29. The viable Gram-negative bacterial strain of claim 26, wherein
said plasmid comprises DNA for mammalian cell transfection.
30. The viable Gram-negative bacterial strain of claim 27, wherein
said plasmid comprises DNA for mammalian cell transfection.
31. The viable Gram-negative bacterial strain of claim 24, wherein
said viable Gram-negative bacteria lacks D-arabinose 5-phosphate
isomerase (API) expression.
32. The viable Gram-negative bacterial strain of claim 24, wherein
said viable Gram-negative bacteria comprises mutations such that
said strain is substantially free of KDO.
33. The viable Gram-negative bacterial strain of claim 32, wherein
said mutations is at least one gene mutation selected from the
group consisting of a mutated gutQ gene, a mutated kdsD gene, a
mutated msbA gene, a mutated kdsA gene, a mutated kdsB gene, a
mutated waaA gene, a mutated yhjD gene, a mutated lpxL gene, and a
mutated lpxM gene.
34. The viable Gram-negative bacterial strain of claim 32, wherein
said viable Gram-negative bacteria comprises mutations such that
said mutations eliminate association between KDO.sub.2 and Lipid
IV.sub.A.
35. The viable Gram-negative bacterial strain of claim 24, wherein
the outer membrane of said viable Gram-negative bacteria expresses
Lipid IV.sub.A.
36. The viable Gram-negative bacterial strain of claim 24, wherein
said viable Gram-negative bacteria is a species selected from the
group consisting of Escherichia spp., Shigella spp., Salmonella
spp., Campylobacter spp., Neisseria spp., Haemophilus spp.,
Aeromonas spp., Francisella spp., Yersinia spp., Klebsiella spp.,
Bordetella spp., Legionella spp., Corynebacteria spp., Citrobacter
spp., Chlamydia spp., Brucella spp., Pseudomonas spp., Helicobacter
spp. and Vibrio spp.
37. A composition for inducing an immune response comprising viable
Gram-negative bacteria having a disruption in the
KDO.sub.2-LipidIV.sub.A biosynthetic pathway or having a disruption
to prevent O-acylation of KDO.sub.2-LipidIV.sub.A.
38. The composition of claim 37, wherein said viable Gram-negative
bacteria lacks D-arabinose 5-phosphate isomerase (API)
expression.
39. The composition of claim 37, wherein said viable Gram-negative
bacteria comprises mutations such that said strain is substantially
free of KDO.
40. The composition of claim 37, wherein said mutations is at least
one gene mutation selected from the group consisting of a mutated
gutQ gene, a mutated kdsD gene, a mutated msbA gene, a mutated kdsA
gene, a mutated kdsB gene, a mutated waaA gene, a mutated yhjD
gene, a mutated lpxL gene, and a mutated lpxM gene.
41. The composition of claim 37, wherein said viable Gram-negative
bacteria comprises mutations such that said mutations eliminate
association between KDO.sub.2 and Lipid IV.sub.A.
42. The composition of claim 37, wherein the outer membrane of said
viable Gram-negative bacteria expresses Lipid IV.sub.A.
43. The composition of claim 37, wherein said Gram-negative
bacteria is a species selected from the group consisting of
Escherichia spp., Shigella spp., Salmonella spp., Campylobacter
spp., Neisseria spp., Haemophilus spp., Aeromonas spp., Francisella
spp., Yersinia spp., Klebsiella spp., Bordetella spp., Legionella
spp., Corynebacteria spp., Citrobacter spp., Chlamydia spp.,
Brucella spp., Pseudomonas spp., Helicobacter spp. and Vibrio
spp.
44. A method for immunizing subjects at risk of acquiring a
condition selected from the group consisting of: i) septic shock,
wherein said Gram-negative bacteria is E. coli; ii) whooping cough,
wherein said Gram-negative bacteria is a Bordetella sp.; iii)
brucellosis or endotoxic shock, wherein said Gram-negative bacteria
is a Brucella sp.; iv) pulmonary and respiratory infections,
wherein said Gram-negative bacteria is selected from the group
consisting of a Pseudomonas sp., Haemophilus sp., and a Moraxella
sp.; v) cholera, wherein said Gram-negative bacteria is a Vibrio
sp.; vi) pneumonia, wherein said Gram-negative bacteria is selected
from the group consisting of Klebsiella sp., and Haemophilus sp.;
vii) stomach ulcer, wherein said Gram-negative bacteria is a
Helicobacter sp.; viii) meningitis, wherein said Gram-negative
bacteria is selected from the group consisting of Neisseria sp.,
and Haemophilus sp.; ix) otitis media, wherein said Gram-negative
bacteria is selected from the group consisting of Haemophilus sp.,
and Moraxella sp.; x) dysentery and/or diarrhea, wherein said
Gram-negative bacteria is selected from the group consisting of
Shigella sp., E. coli, Vibrio sp., Campylobacter sp., and Yersenia
sp.; xi) enteric fevers, wherein said Gram-negative bacteria is a
Salmonella sp.; xii) trachoma and/or sexually transmitted diseases,
wherein said Gram-negative bacteria is a Chlamydia sp.; xiii)
tularemia, wherein said Gram-negative bacteria is a Franciscella
sp.; and xiv) the plague, wherein said Gram-negative bacteria is a
Yersinia sp.; said method comprising administering to said subjects
a composition of claim 37.
45. A method for identifying anti-bacterial agents, comprising: a)
providing i) a composition comprising a viable Gram-negative
bacterial strain having a disruption in the KDO.sub.2-LipidIV.sub.A
biosynthetic pathway or having a disruption to prevent O-acylation
of KDO.sub.2-LipidIV.sub.A, and ii) a candidate anti-bacterial
agent; b) exposing said candidate compound to said composition; and
c) assessing the viability of said Gram-negative bacterial strain
following exposure to said candidate compound; and d) identifying
said compound as an anti-bacterial compound If said Gram-negative
bacterial strain is assessed as inviable.
46. The method of claim 45, wherein said viable Gram-negative
bacteria lacks D-arabinose 5-phosphate isomerase (API)
expression.
47. The method of claim 45, wherein said viable Gram-negative
bacteria comprises mutations such that said strain is substantially
free of KDO.
48. The method of claim 45, wherein said viable Gram-negative
bacteria comprises mutations such that said mutations eliminate
association between KDO.sub.2 and Lipid IV.sub.A.
49. The method of claim 45, wherein said mutations is at least one
gene mutation selected from the group consisting of a mutated gutQ
gene, a mutated kdsD gene, a mutated msbA gene, a mutated kdsA
gene, a mutated kdsB gene, a mutated waaA gene, a mutated yhjD
gene, a mutated lpxL gene, and a mutated lpxM gene.
50. The method of claim 45, wherein the outer membrane of said
viable Gram-negative bacteria expresses Lipid IV.sub.A.
51. The method of claim 45, wherein said Gram-negative bacteria is
a species selected from the group consisting of Escherichia spp.,
Shigella spp., Salmonella spp., Campylobacter spp., Neisseria spp.,
Haemophilus spp., Aeromonas spp., Francisella spp., Yersinia spp.,
Klebsiella spp., Bordetella spp., Legionella spp., Corynebacteria
spp., Citrobacter spp., Chlamydia spp., Brucella spp., Pseudomonas
spp., Helicobacter spp. and Vibrio spp.
Description
[0001] The present application claims priority to U.S. Provisional
Application 60/760,314, filed Jan. 19, 2006, incorporated by
reference herein in its entirety.
FIELD OF THE INVENTION
[0003] The present invention provides non-toxic Gram-negative
bacteria. In particular, the present invention provides viable
Gram-negative bacteria (e.g., E. coli) substantially lacking
lipopolysaccharide (LPS, endotoxin) within the outer membrane. The
present invention further provides methods of generating viable
non-toxic Gram-negative bacteria and uses thereof. The present
invention also provides compositions and methods for inducing
immune responses and for researching and developing therapeutic
agents.
BACKGROUND OF THE INVENTION
[0004] Lipopolysaccharide (LPS, endotoxin) is the major antigen of
Gram-negative bacteria. LPS is a glycophospholipid consisting of an
antigenic, variable size, carbohydrate chain covalently linked to
lipid A, the conserved hydrophobic region structurally defined as
N,O-acyl beta-1,6-D-glucosamine 1,4'-bisphosphate. Toxicity of LPS
is expressed by lipid A through the interaction with B-cells and
macrophages of the mammalian immune system, a process leading to
the secretion of proinflammatory cytokines, mainly TNF, which may
have fatal consequences for the host. Lipid A also activates human
T-lymphocytes (Th-1) "in vitro" as well as murine CD4+ and CD8+
T-cell "in vivo", a property which allows the host's immune system
to mount a specific, anamnestic IgG antibody response to the
variable-size carbohydrate chain of LPS. On these bases, LPS has
been recently recognized as a T-cell dependent antigen "in
vivo".
[0005] In order to fully express toxicity, LPS must retain its
supramolecular architecture, through the association of several
units of glycophospholipid monomers forming the lipid A structure.
This conformational rearrangement of the molecule is also
fundamental for full expression of the immunogenic
characteristic.
[0006] Sepsis and septic shock are well defined clinical conditions
that are caused by bacteria and by LPS, which is the endotoxin
elaborated by the bacteria responsible for the above-mentioned
pathologies.
[0007] The clinical signs of sepsis and septic shock vary,
depending on the amount of endotoxin present and the time elapsed
in the disease process. The earliest clinical signs of an infection
may be fever, mild depression, and lack of appetite. Further into
the disease process, the patient will exhibit more obvious signs of
shock, including increased heart rate, weak pulse pressure,
dehydration, darkening of the gums, cold feet and ears,
below-normal temperature, increased respiratory rate, or diarrhea.
Once a patient has exhibited signs of endotoxic shock, it should be
considered an emergency and a physician should be contacted
immediately.
[0008] Despite the judicious use of antibiotics and other
therapeutic measures, mortality from endotoxin related disorders
remains a significant problem. Antibiotic resistance of bacteria,
severity of the underlying diseased processes, and inadequate
administration of supportive therapy account in part for the
failure of conventional treatments. What is needed is an improved
understanding of the Gram-negative bacteria that cause endotoxin
related disorders. Additionally, improved treatment for endotoxin
related disorders are needed.
SUMMARY OF THE INVENTION
[0009] The present invention provides non-toxic Gram-negative
bacteria. In particular, the present invention provides viable
Gram-negative bacteria (e.g., E. coli) substantially lacking
lipopolysaccharide (LPS, endotoxin) within the outer membrane. The
present invention further provides methods of generating viable
non-toxic Gram-negative bacteria and uses thereof. The present
invention also provides compositions and methods for inducing
immune responses and for researching and developing therapeutic
agents.
[0010] Embodiments of the present invention provide a wide range of
method and composition employing Gram-negative bacteria (e.g., E.
coli) lacking an LPS. Exemplary embodiments are described below in
the Summary of the Invention, the Detailed Description of the
Invention and the Examples section below. The present invention is
not limited to these exemplary embodiments. The Gram-negative
bacteria lacking LPS may be generated by any mechanism. A diverse
variety of different mechanisms for generating such bacteria are
described herein. For example, in some embodiments, genes are
mutated (e.g., so as to reduce or eliminate expression of
functional protein) that are involved in KDO synthesis. In some
embodiments, genes are mutated that are involved in association of
KDO with Lipid IV.sub.A. In some embodiments, genes are mutated
that are involved in Lipid IV.sub.A synthesis. In some embodiments,
other genes involved in LPS production or presentation are mutated.
The present invention is not limited to gene mutation. In some
embodiments, expression is altered using RNA interference or other
techniques. In some embodiments, protein function is altered by
providing inhibitors (e.g., synthetic or natural competitive or
non-competitive ligands, antibodies, etc.). In some embodiments,
modified bacteria are further supplied with nutrients, other
modifications, or other components useful for maintaining health,
growth, etc. in view of the alterations made to affect LPS status.
Embodiments of the present invention are not limited to these
mechanisms unless specified otherwise. The present invention
demonstrates that bacteria lacking LPS are viable, may be made
through a variety of routes, and find use in a variety of
settings.
[0011] The LPS layer is essential to both the form and function of
the outer membrane of Gram-negative bacteria. In addition to being
a main mediator of Gram-negative pathogenesis, an LPS (endotoxin)
structure consisting of at least KDO.sub.2-lipid A [2-keto
3-deoxy-D-manno-octulosonate (KDO)] has long been recognized as the
minimal structure necessary in Escherichia coli for sustained
growth.
[0012] In some embodiments, the present invention provides a viable
Gram-negative bacterial strain lacking KDO despite exclusively
elaborating the endotoxically inactive LPS precursor lipid
IV.sub.A, a known antagonist of LPS-induced sepsis in humans. In
some embodiments, the present invention provides viable
Gram-negative bacteria lacking D-arabinose 5-phosphate isomerase
(API) expression. In some embodiments, the viable Gram-negative
bacteria comprises mutations such that the strain is substantially
free of KDO. In some embodiments, the mutations include one or more
mutations in one or more genes involved in KDO synthesis or
modification. In some embodiments, the viable Gram-negative
bacteria comprises mutations wherein the mutations prevent
association between KDO.sub.2 and Lipid IV.sub.A in the LPS
biosynthetic pathway, such that Lipid IV.sub.A alone is transported
to the outer membrane. In some embodiments, one or more mutations
in KDO synthesis genes, or one or more mutations in the LPS
biosynthetic pathway, include mutations in, but not limited to, the
genes gutQ, kdsD (yrbH), kdsA, kdsB, waaA, msbA, and yhjD, or any
other biosynthetic, processing, or trafficking gene. In some
embodiments, the strain lacks or substantially lacks synthesis of
KDO proteins. In some embodiments, the Outer membrane of the viable
Gram-negative bacteria expresses lipid IVa. In some embodiments,
the Gram-negative bacteria is E. coli.
[0013] In certain embodiments, the present invention provides a
method of producing lipid IVa, comprising extracting lipid IVa from
viable Gram-negative bacteria.
[0014] In certain embodiments, the present invention provides a
method of treating an endotoxin related disorder, comprising
administering to a subject with an endotoxin related disorder a
composition comprising lipid IVa isolated from Gram-negative
bacteria.
[0015] In certain embodiments, the present invention provides an
outer membrane vaccine or other composition for inducing an immune
response against a Gram-negative bacteria, the compositions
comprising an outer membrane of viable Gram-negative bacteria of
the invention. Such compositions may be used to induce immune
responses in research, drug-screening, and therapeutic
settings.
[0016] In certain embodiments, the present invention provides an
adjuvant comprising lipid IVa isolated from Gram-negative
bacteria.
[0017] In certain embodiments, the present invention provides
viable Gram-negative bacteria lacking expression of one or more
genes of gutQ, kdsD (yrbH), kdsA, kdsB, waaA, msbA, and/or yhjD, or
expression of any other biosynthetic, processing, or trafficking
genes associated with outer membrane LPS presentation. The bacteria
of the invention, or portions thereof (e.g., membrane fractions)
find use in research and therapeutic applications.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 presents characterization of LPS samples extracted
from KPM22. FIG. 1A: Inner core-lipid A sugar composition of LPS
from phenol extract post-dialysis. GlcN-D-glucosamine; KDO-2-keto
3-deoxy-D-manno-octulosonate; L-glycero-D-manno-heptose-heptose.
FIG. 1B: SDS-PAGE analysis of LPS from proteinase K treated
whole-cell lysates. Top panel was silver stained, while middle and
bottom panels are immunoblots developed using the mAB A6 directed
against the nonglycosylated 1,4'-bisphosphorylated
.beta.-1,6-linked GlcN disaccharide backbone of lipid A. The middle
panel membrane was treated with 1% acetic acid to release lipid A
prior to immunological reactions. Lanes 1-5 are Salmonella enterica
serovar reference strains of different LPS chemotypes [1. 3749
(Ra); 2. 3750 (Rb2); 3. 3748 (Rb3); 4. 3769 (Rd1), 5. 1102 (Re)],
6. wild-type BW30270, 7. KPM22, 8. KPM25, 9. KPM22 with A5P in the
growth media, 10. KPM31, 11. KPM34, 12. KPM31 with A5P in the
growth media, 13. KPM40, 14. KPM42, 15. KPM40 with A5P in the
growth media, 16. 200 ng of chemically synthesized lipid IVa
(compound 406).
[0019] FIG. 2 presents characterization of the LPS precursor in
KPM22. Charge deconvoluted electrospray ionization Fourier
transform ion cyclotron (ESI FT-ICR) mass spectra in negative ion
mode of purified LPS samples. Mass numbers given refer to the
monoisotopic masses of the neutral molecules. FIG. 2A: BW30270
(inset isotopic distribution of glycoform I; 3915.71 u). FIG. 2B:
KPM22 (inset structure of lipid IVa; 1404.86 u). FIG. 2C: KPM25
(inset Wild-type LPS with chemical structure of KDO.sub.2-lipid A
(Re endotoxin) depicted and heptose attachment point indicated by
arrow. Red, blue, and green peak labels correspond to the peak
families of glycoforms I, IV, and II, respectively (see, e.g., S.
Muller-Loennies, B. Lindner, H. Brade, J. Biol. Chem. 278, 34090
(2003); herein incorporated by reference in its entirety).
Individual structure peak assignments are listed in Table 9.
PE--phosphatidylethanolamine; P--phosphate;
P-EtN--phosphoethanolamine; LA.sub.tri, LA.sub.tetra, LA.sub.penta,
LA.sub.hexa--acylation state of lipid A.
[0020] FIG. 3 presents sucrose gradient separation of the inner and
outer membranes of wildtype BW30270 (a) and KPM22 (b). Fractions
were assayed for total protein content (X), outer membrane
phospholipase A (OMPLA) (.largecircle.), and inner membrane NADH
oxidase (.tangle-solidup.). SDS-PAGE gels (12%) of protein samples
were run under reducing conditions. Molecular mass protein markers
(kDa) are listed on the left side of each gel. Arrows indicate the
position of OMP proteins (.about.35 kDa) [Q2].
[0021] FIG. 4 presents characterization of KPM22. Transmission
electron microscopy (TEM) images of wild-type BW30270 (panels A and
B) and of KPM22 (panels C and D). Arrows indicate outer membrane
vesicles (OMV) at the OM surface of KPM22 (panel C). IM--Inner
membrane, OM--Outer membrane, PG--peptidoglycan. Scale bars=50
nm.
[0022] FIG. 5 presents characterization of KPM22. FIG. 5A: Colanic
acid production estimated as .mu.g of methylpentose (L-fucose) per
mL per OD of culture of suspended cells. FIG. 5B: Immunoblot of
enterobacterial common antigen (ECA) using the mAb 898 antibody.
Lane 1 (BW30270), Lane 2 (KPM22), Lane 3 (KPM25).
[0023] FIG. 6 presents ESI FT-ICR mass spectra of phenol phase
extracts. Charge deconvoluted negative ion ESI FT-ICR mass spectra
of phenol phase from BW30270 (A), KPM22 (B), and KPM25 (C). LPS was
precipitated from crude phenol extracts by the dropwise addition of
water. After clarification by centrifugation, the phenol
supernatant was dialyzed and treated as described above. Note lipid
IVa was not precipitated from the phenol phase by water during this
procedure (B). ECA.sub.cyc--cyclic enterobacterial common antigen
(ECA).
[0024] FIG. 7 presents hTNF.alpha. cytokine inducing capabilities
of LPS preparations. Human mononuclear cells (MNC) were challenged
with various concentrations of LPS preparations isolated as
described above. hTNF.alpha. release was quantitated using an ELISA
based assay. Data points were collected in duplicate. (Shaded
bars--BW30270, Empty bars--KPM22, Hatched bars--KPM25).
[0025] FIG. 8 shows the effect of gutQ on D-glucitol utilization
and LPS biosynthesis. (A) Diauxic growth curves for BW30270
(.quadrature.), BW30270(.DELTA.gutQ) (.largecircle.), and
BW30270(pT7-gutQ) (.DELTA.). Overnight cultures grown in M9 minimal
media supplemented with 1 .mu.g/mL thiamine and 10 mM D-glucose
were diluted into fresh media with 2 mM D-glucose and 2 mM
D-glucitol as dual carbon sources. Cell growth was monitored by
measuring the turbidity at 600 nm. (B) Silver stained tricine
SDS-PAGE LPS gels of proteinase K-treated whole cell lysates from
BW30270 (WT), BW30270(.DELTA.gutQ), and BW30270(.DELTA.kdsD). Equal
amounts of bacterial cells growing in minimal media (0.2% glycerol)
with (+) or without (-) D-glucitol (10 mM) were harvested in early
log phase and processed as described in Experimental
procedures.
[0026] FIG. 9 shows growth and LPS synthesis in the .DELTA.API
strain BW30270(.DELTA.gutQ .DELTA.kdsD). (A) Growth curve of E.
coli BW30270(.DELTA.gutQ .DELTA.yrbH) in MOPS minimal medium with
thiamine (1 ug/mL) and glycerol (0.1%) as sole carbon source. Sugar
phosphates were supplemented in the media with either 10 .mu.M G6P
(.DELTA.), 15 .mu.M A5P (.quadrature.), or with both
(.largecircle.). (B) Titration of LPS with A5P. A stationary phase
culture grown in MOPS minimal media (0.2% glycerol, 5 .mu.M A5P, 10
.mu.M G6P) that had ceased dividing was diluted into fresh media
containing G6P (10 .mu.M) and varying concentrations of A5P (0.1,
1, 10, 50, and 100 .mu.M) and shaken for 6 hours. LPS samples were
prepared from the same number of cells based on OD and analyzed by
tricine SDS-PAGE and silver staining. (C) LPS tricine SDS-PAGE and
(D) qualitative RT-PCR of gutD analysis of samples prepared from
wildtype BW30270 (lanes 1 and 2) and BW30270(.DELTA.gutQ
.DELTA.kdsD) (lanes 3 and 4). BW30270(.DELTA.gutQ .DELTA.kdsD) were
preinduced with 10 .mu.M G6P and 5 .mu.M A5P, pelleted, resuspended
in fresh MOPS minimal media (0.2% glycerol) with only A5P and 10 mM
D-glucitol as indicated, and shaken for an additional 4 hours
before harvesting for analyses. S--0.1-1 kb DNA molecular weight
markers; Con--Genomic DNA as template.
[0027] FIG. 10 shows the gut operon of E. coli K-12 MG1655.
Transcription initiation sites were determined using reverse
transcriptase mapping by Yamada and Saier (see, e.g., Yamada, M.
& Saier, M. H., Jr. (1988) J Mol Biol 203, 569-83; herein
incorporated by reference in its entirety), and are indicated by
arrows.
[0028] FIG. 11 shows the biosynthesis and incorporation of Kdo into
LPS. Enzymes involved are (1) D-arabinose 5-phosphate isomerase
(KdsD/GutQ), (2) Kdo8P synthase (KdsA), (3) Kdo8P phosphatase
(KdsC), and (4) CMP-Kdo synthetase (KdsB). In E. coli, two
molecules of activated Kdo are then sequentially transferred to
lipid IV.sub.A by (5) Kdo transferase (WaaA) before the stepwise
addition of the secondary acyl chains (6) laurate (LpxL) and (7)
myristate (LpxM).
DEFINITIONS
[0029] To facilitate understanding of the invention, a number of
terms are defined below.
[0030] As used herein, the terms "subject" and "patient" refer to
any animal, such as a mammal like a dog, cat, bird, livestock, and
preferably a human.
[0031] As used herein, the terms, "LPS related disorder",
"condition associated with endotoxin", "endotoxin associated
disorder", "endotoxin-related disorder", "sepsis", "sepsis related
disorder", or similar terms, describes any condition associated
with LPS, e.g., a condition associated with bacteremia or
introduction of lipopolysaccharide into the blood stream or onto an
extra-gastrointestinal mucosal surface (e.g., the lung). Such
disorders include, but are not limited to, endotoxin-related shock,
endotoxin-related disseminated intravascular coagulation,
endotoxin-related anemia, endotoxin-related thrombocytopenia,
endotoxin-related adult respiratory distress syndrome,
endotoxin-related renal failure, endotoxin-related liver disease or
hepatitis, systemic immune response syndrome (SIRS) resulting from
Gram-negative infection, Gram-negative neonatal sepsis,
Gram-negative meningitis, Gram-negative pneumonia, neutropenia
and/or leucopenia resulting from Gram-negative infection,
hemodynamic shock and endotoxin-related pyresis.
[0032] The term, "viable non-toxic Gram-negative bacteria" refers
to a viable Gram-negative bacterial strain comprising an outer
membrane substantially free of LPS.
[0033] The terms "cells" and "host cells" and "recombinant host
cells", which are used interchangeably herein, refer to cells that
are capable of or have been transformed with a vector, typically an
expression vector. The host cells used herein are preferably
Gram-negative bacteria. It is understood that such terms refer not
only to the particular subject cell, but to the progeny or
potential progeny of such a cell. Because certain modifications may
occur in succeeding generations due to either mutation or
environmental influences, such progeny may not, in fact, be
identical to the parent cell, but are still included within the
scope of the term as used herein.
[0034] The term "culture medium" is recognized in the art, and
refers generally to any substance or preparation used for the
cultivation of living cells.
[0035] The term "derived from," as used, for example, in the
context of deriving lipid IVa from a strain of Gram-negative
bacteria, refers to lipid IVa that can be obtained from the
bacteria or the protein, and is intended to include fragments or
portions of proteins.
[0036] The term "defective" as used herein, with regard to a gene
or gene expression, means that the gene is not a wildtype gene and
that the organism does not have a wildtype genotype and/or a
wildtype phenotype. The defective gene, genotype or phenotype may
be the consequence of a mutation in that gene, or of a gene that
regulates the expression of that gene (e.g., transcriptional or
post-transcriptional), such that its normal expression is disrupted
or extinguished. "Disrupted gene expression" is intended to include
both complete inhibition and decreased gene expression (e.g., as in
a leaky mutation), below wildtype gene expression.
[0037] The term "Gram-negative bacteria" is recognized in the art,
and refers generally to bacteria that do not retain Gram stain
(e.g., the deposition of a colored complex between crystal violet
and iodine). In an exemplary Gram stain, cells are first fixed to a
slide by heat and stained with a basic dye (e.g., crystal violet),
which is taken up by all bacteria (i.e., both Gram-negative and
Gram-positive). The slides are then treated with an iodine-KI
mixture to fix the stain, washed with acetone or alcohol, and
finally counterstained with a paler dye of different color (e.g.,
safranin). Gram-positive organisms retain the initial violet stain,
while Gram-negative organisms are decolorized by the organic
solvent and hence show the counterstain. Exemplary Gram-negative
bacteria and cell lines include, but are not limited to,
Escherichia spp., Shigella spp., Salmonella spp., Campylobacter
spp., Neisseria spp., Haemophilus spp., Aeromonas spp., Francisella
spp., Yersinia spp., Klebsiella spp., Bordetella spp., Legionella
spp., Corynebacteria spp., Citrobacter spp., Chlamydia spp.,
Brucella spp., Pseudomonas spp., Helicobacter spp. and Vibrio
spp.
[0038] The term "mutant Gram-negative bacteria" "LPS mutant
Gram-negative bacteria", "kdsD and gutQ mutant Gram-negative
bacteria", "API mutant Gram-negative bacteria" or similar terms, as
used herein, includes Gram-negative bacteria of the invention that
have been mutated one or more times in, for example, one or more of
the gutQ, kdsD, kdsA, kdsB, waaA, msbA, yhjD genes, of any other
biosynthetic, processing, or trafficking gene thereby producing an
outer membrane substantially lacking LPS protein expression.
[0039] An "immunogenic portion of a molecule" refers to a portion
of the molecule that is capable of eliciting an immune reaction
against the molecule in a subject.
[0040] The term "isolated" as applied to LPS or lipid IVa
molecules, refers to LPS or lipid IVa which has been isolated
(e.g., partial or complete isolation) from other bacterial
components, in particular from the outer membrane.
[0041] As used herein, the term "portion" when used in reference to
a sequence (e.g., an amino acid sequence of a protein, a nucleic
acid sequence of a gene) represents any amount of the referenced
sequence (e.g., 0.001%, 0.1%, 1%, 10%, 30%, 50%, 75%, 80%, 85%,
90%, 95%, 98%, 99.999% of an amino acid sequence or nucleic acid
sequence).
[0042] The term "modulation" as used herein refers to both
upregulation (i.e., activation or stimulation (e.g., by agonizing
or potentiating)) and downregulation (i.e., inhibition or
suppression (e.g., by antagonizing, decreasing or inhibiting)). The
term "inducible" refers in particular to gene expression which is
not constitutive but which takes place in response to a stimulus
(e.g., temperature, heavy metals or other medium additive).
[0043] The term "non-human animals" includes any animal that can be
treated or used in testing the present invention, including mammals
such as non-human primates, rodents, sheep, dogs, cows, pigs,
chickens, as well as amphibians, reptiles, etc. Preferred non-human
animals are selected from the primate family or rodent family
(e.g., rat and mouse).
[0044] The term "nucleic acid" refers to polynucleotides or
oligonucleotides such as deoxyribonucleic acid (DNA), and, where
appropriate, ribonucleic acid (RNA). The term should also be
understood to include, as equivalents, analogs of either RNA or DNA
made from nucleotide analogs and as applicable to the embodiment
being described, single (sense or antisense) and double-stranded
polynucleotides.
[0045] The term "pharmaceutically acceptable" means a material that
is not biologically or otherwise undesirable, i.e., the material
may be administered to an individual along with the selected
compound without causing any undesirable biological effects or
interacting in a deleterious manner with any of the other compounds
of the pharmaceutical composition in which it is contained.
[0046] The term "pyrogenic" or "pyrogenicity" refers to the ability
of a compound to induce fever or a febrile response when
administered to a subject. Such febrile responses are generally
mediated by the host proinflammatory cytokines IL-1, IL-6 and/or
TNF-.alpha., the secretion of which is induced, e.g., by LPS.
[0047] A substance having "reduced pyrogenicity" or a "reduced
pyrogenic derivative" refers to a substance having less pyrogenic
activity than the counterpart substance, e.g., less than about 80%
pyrogenic relative to a counterpart substance, preferably less than
about 70% pyrogenic, more preferably less than about 60% pyrogenic,
more preferably less than about 50.degree. pyrogenic, more
preferably less than about 40% pyrogenic, and even more preferably
less than about 30% pyrogenic. In other terms, a substance having
reduced pyrogenicity is at least about 20%, 30%, 40%, 50%, 60%, or
70% less pyrogenic than the corresponding substance as determined
by any of the assays described herein or known in the art.
[0048] "Substantially reduced pyrogenicity" or "substantially
reduced pyrogenic derivative" refers to a substance (e.g., produced
by viable non-toxic Gram-negative bacteria) which has been altered
such that it has less than 20% pyrogenicity relative to the
wildtype substance, preferably less than 10% pyrogenicity,
preferably less than 1% pyrogenicity, preferably less than
10.sup.-1% pyrogenicity, preferably less than 10.sup.-2%
pyrogenicity, preferably less than 10.sup.-3% pyrogenicity,
preferably less than 10.sup.-4% pyrogenicity, preferably less than
10.sup.-5% pyrogenicity, and most preferably less than 10.sup.-6%
pyrogenicity relative to the wildtype substance. In other terms, a
substance that has substantially reduced pyrogenicity is at least
about 90%, 99%, 10 fold, about 10.sup.-2 fold, about 10.sup.-3
fold, at least about 10.sup.-4 fold, at least about 10.sup.-5 fold,
at least about 10.sup.-6 fold less pyrogenic relative to the
corresponding unaltered substance as determined by any of the
assays described herein or known in the art.
[0049] As used herein, the term "transfection" means the
introduction of a nucleic acid (e.g., via an expression vector)
into a recipient cell by nucleic acid-mediated gene transfer.
"Transformation", as used herein, refers to a process in which a
cell's genotype is changed as a result of the cellular uptake of
exogenous DNA or RNA. In an illustrative embodiment, a transformed
cell is one that expresses a mutant form of one or more of the kdsD
and gutQ genes. A transformed cell can also be one that expresses a
nucleic acid that interferes with the expression of an gutQ, kdsD,
kdsA, kdsB, waaA, msbA, ynjD gene of any other biosynthetic,
processing, or trafficking gene.
[0050] As used herein, the term "transgene" means a nucleic acid
(e.g., a mutant kdsD, gutQ, kdsA, kdsB, waaA, msbA, ynjD gene of
any other biosynthetic, processing, or trafficking gene, or an
antisense transcript thereto) that has been introduced into a cell.
A transgene could be partly or entirely heterologous, i.e.,
foreign, to the transgenic animal or cell into which it is
introduced, or, can be homologous to an endogenous gene of the
organism or -cell into which it is introduced, but which is
designed to be inserted, or is inserted, into the animal or cell's
genome in such a way as to alter the genome of the cell into which
it is inserted. A transgene can also be present in a cell in the
form of an epi some.
[0051] The term "treating" a subject for a condition or disease, as
used herein, is intended to encompass curing, as well as
ameliorating at least one symptom of the condition or disease.
[0052] The term "vector" refers to a nucleic acid molecule, which
is capable of transporting another nucleic acid to which it has
been linked. Vectors capable of directing the expression of genes
to which they are operatively linked are referred to herein as
"expression vectors." The term "expression system" as used herein
refers to an expression vector under conditions whereby an mRNA may
be transcribed and/or an mRNA may be translated into protein,
structural RNA, or other cellular component. The expression system
may be an in vitro expression system, which is commercially
available or readily made according to art known techniques, or may
be an in vivo expression system, such as a eukaryotic or
prokaryotic cell containing the expression vector. In general,
expression vectors of utility in recombinant DNA techniques are
often in the form of "plasmids" which refer generally to circular
double stranded DNA loops that, in their vector form, are not bound
to the chromosome. In the present specification, "plasmid" and
"vector" are used interchangeably as the plasmid is the most
commonly used form of vector. However, the invention is intended to
include such other forms of expression vectors which serve
equivalent functions and are well known in the art or which become
known in the art subsequently hereto (e.g., cosmid, phagemid and
bacteriophage vectors).
DETAILED DESCRIPTION OF THE INVENTION
[0053] The present invention provides non-toxic Gram-negative
bacteria. In particular, the present invention provides viable
Gram-negative bacteria (e.g., E. coli) substantially lacking
lipopolysaccharide (LPS, endotoxin) within the outer membrane. The
present invention further provides methods of generating viable
non-toxic Gram-negative bacteria and uses thereof. The present
invention also provides compositions and methods for inducing
immune responses and for researching and developing therapeutic
agents.
[0054] Gram-negative bacteria possess an asymmetric lipid bilayer
that surrounds the peptidoglycan, the outer membrane (OM). The OM
inner leaflet is primarily composed of various
glycerophospholipids, whereas the outer leaflet predominantly
contains the unique amphiphilic macromolecule, lipopolysaccharide
(LPS). In Escherichia coli and other closely related enteric
bacteria, there are .about.10.sup.6 LPS molecules per cell covering
nearly 75% of the total cell surface area, accounting for
.about.30% of the OM gross weight (see, e.g., S. M. Galloway, C. R.
Raetz, J. Biol. Chem. 265, 6394 (1990); L. Leive, Ann. N.Y. Acad.
Sci. 235, 109 (1974); H. Nikaido, in Escherichia coli and
Salmonella typhimurium: cellular and molecular biology, F. C.
Neidhardt, Ed. (American Society for Microbiology, Washington,
D.C., 1987), vol. 1, pp. 29-47; each herein incorporated by
reference in their entireties). The exposed location at the
interface between the bacterial cell and the aqueous environment
presents LPS as a main OM-associated surface antigen. LPS is
involved in a diverse spectrum of pathological and physiological
activities associated with the host immune response (see, e.g., A.
Wiese, et al., Biol. Chem. 380, 767 (1999); H. Heine, et al., Mol.
Biotechnol. 19, 279 (2001); each herein incorporated by reference
in their entireties). LPS is an immunostimulatory/inflammatory
molecule recognized as a mediator of Gram-negative pathogenesis and
generalized inflammation, and as such the term endotoxin is often
used interchangeably with LPS. The LPS layer is essential to both
the form and function of the OM of Gram-negative bacteria. Thus, in
addition to being a key player in Gram-negative pathogenesis, LPS
is also a critical determinant of the survival of the
bacterium.
[0055] LPS of various Gram-negative bacteria conform to a common
structural architecture conceptually divided into three regions:
the OM-embedded lipid A, an oligosaccharide core, followed by an
O-specific hydrophilic polysaccharide chain consisting of n-repeat
units in Enterobacteriaceae or short branched oligosaccharides in
certain bacteria, comprising human mucosal pathogens such as
Neisseria meningitis, N. gonorrhoeae, Haemophilus influenzae,
Bordetella pertussis, and Chlamydia spp. Lipid A is the most
conserved LPS domain amongst Gram-negative bacterial genera, and
being the structural component responsible for the biological
activities within the host, represents an endotoxic principle of
LPS. In enteric bacteria, lipid A consists of a .beta.-1,6-linked
D-glucosamine disaccharide backbone which is acylated with four
(R)-3-hydroxy-myristic acids in ester-(3,3') or amide-(2,2')
linkages. Mature lipid A molecules of E. coli wild-type strains
typically contain two additional acyl chains, primarily laurate and
myristate, attached to the (R)-3-hydroxymyristoyl group of the
nonreducing glucosamine to form the characteristic acyloxyacyl
units of lipid A. The oligosaccharide core connects lipid A to the
hypervariable polysaccharide chain, and is further divided into the
inner and outer oligosaccharide core regions. Whereas the outer
core is less well conserved, varying both in saccharide composition
and glycosidic linkages, the majority of Gram-negative bacteria
elaborate an inner core containing at least one 2-keto
3-deoxy-D-manno-octulosonate (KDO) molecule.
[0056] KDO is an essential component of LPS that is a conserved
residue found in nearly all LPS structures (see, e.g., O. Hoist,
Trends Glycosci. Glycotechnol. 14, 87 (2002); herein incorporated
by reference in its entirety). The minimal LPS structure required
for growth of E. coli is two KDO residues attached to lipid A
(KDO.sub.2-lipid A or Re endotoxin) (see, e.g., C. R. Raetz, C.
Whitfield, Annu. Rev. Biochem. 71, 635 (2002); S. Gronow, H. Brade,
J. Endotoxin Res. 7, 3 (2001); each herein incorporated by
reference in their entireties), emphasizing the importance of KDO
in maintaining the integrity and viability of the bacterial cell.
L-API is encoded by the kdsD gene in E. coli K-12 (see, e.g.,
Meredith, T. C. & Woodard, R. W. (2003) J Biol Chem 278,
32771-7; herein incorporated by reference in its entirety).
[0057] The ubiquitous nature of KDO within LPS structures has
prompted investigation into its biosynthesis. The pathway is
initiated by the enzyme d-arabinose 5-phosphate (A5P) isomerase
(API), which converts the pentose pathway intermediate D-ribulose
5-phosphate into A5P. Subsequently, A5P is condensed with
phosphoenolpyruvate to form Kdo 8-phosphate (Kdo8P) (KdsA),
hydrolyzed to Kdo (KdsC), activated as the sugar nucleotide CMP-Kdo
(KdsB), before finally being transferred from CMP-Kdo to the
acceptor lipid IVA (WaaA) (FIG. 11). The late acyltransferases LpxL
and LpxM next transfer the fatty acids laurate and myristate,
respectively, to Kdo2-lipid IVA to form the characteristic
acyloxyacyl units of hexaacylated Kdo-lipid A. In E. coli K-12,
there are two API genes (kdsD and gutQ).
[0058] It was speculated that other APIs may exist in E. coli based
on homology searches. In particular, the final open reading of the
glucitol operon gutQ has significant homology (45% identity) to
kdsD (formerly yrbH). G-API is the last gene product of the
gutAEBDMRQ operon, which contains seven convergently transcribed
genes (FIG. 10). As shown in Table 1, gutQ and kdsD share similar
biochemical properties.
TABLE-US-00001 TABLE 1 Biochemical Properties of kdsD and gutQ
Property kdsD .sup.a gutQ K.sub.m (A5P) 0.61 .+-. 0.06 mM 1.2 .+-.
0.1 mM K.sub.m (Ru5P) 0.35 .+-. 0.08 mM 0.64 .+-. 0.08 mM k.sub.cat
(A5P to Ru5P) 157 .+-. 4 sec.sup.-1 218 .+-. 4 sec.sup.-1 k.sub.cat
(Ru5P to A5P) 255 .+-. 16 sec.sup.-1 242 .+-. 11 sec.sup.-1
K.sub.eq (calc.) .sup.b 0.47 (0.35) 0.47 (0.48) Optimum pH 8.4 8.25
Specific for Yes Yes A5P/Ru5P .sup.c Equiv. of 1.0 .+-. 0.1 1.4
.+-. 0.2 Zn.sup.2+/subunit .sup.d Inhibition by Yes Yes 10 .mu.M
Zn.sup.2+ .sup.e Activation by Yes Yes EDTA .sup.f Subunit MW 35104
Da 33909 Da (calc.) .sup.g (35196 Da) (34031 Da) Native MW .sup.h
122 .+-. 5 kDa 133 .+-. 4 kDa (tetramer) (tetramer) .sup.a Data
from Yamada, M., Yamada, Y. & Saier, M. H., Jr. (1990) DNA Seq
1, 141-5; herein incorporated by reference in its entirety .sup.b
Measured by 31P NMR; calculated from Haldane relationship
(Ru5P/A5P) .sup.c See experimental procedures for tested substrates
.sup.d Equivalents of Zn.sup.2+ per monomer as determined by
high-resolution inductively coupled plasma-mass spectrometry .sup.e
Less than 5% activity remaining .sup.f As isolated enzyme with 10
.mu.M EDTA .sup.g Determined by electrospray ionization mass
spectrometry; calculated from protein sequence .sup.h Determined by
gel filtration
The glucitol operon expresses a phosphoenolpyruvate:sugar
phosphotransferase system (PTS) that is responsible for the
coordinated uptake and catabolism of D-glucitol from the
environment (see, e.g., T. C. Meredith, R. W. Woodard, J. Biol.
Chem. 278, 32771 (2003); herein incorporated by reference in its
entirety). The operon was originally studied by Lengeler (see,
e.g., C. Galanos, et al., Eur. J. Biochem. 9, 245 (1969); S.
Muller-Loennies, et al., J. Biol. Chem. 278, 34090 (2003); each
herein incorporated by reference in their entireties) and
subsequently by Saier (see, e.g., K. A. Brozek, C. R. Raetz, J.
Biol. Chem. 265, 15410 (1990); H. Nikaido, Microbiol. Mol. Biol.
Rev. 67, 593 (2003); each herein incorporated by reference in their
entireties), and is known to consist of seven convergently
transcribed genes, gutAEBDMRQ. The EII.sup.Gut complex is formed by
gutA (EIIC1 domain), gutE (EIIBC2 domains), and gutB (EIIA domain),
and transports D-glucitol across the inner membrane and into the
cell as D-glucitol 6-phosphate. D-Glucitol 6-phosphate is then
further metabolized by gutD, an NADH dependent dehydrogenase, to
the glycolytic intermediate D-fructose 6-phosphate. Expression of
the gut operon is tightly controlled by a complex multicomponent
regulatory system, consisting of a transcriptional repressor (gutR)
and a transcriptional activator (gutM) in addition to cAMP-CAP
(cyclic adenosine monophosphate-catabolite activator protein)
mediated regulation (see, e.g., C. J. Belunis, et al., J. Biol.
Chem. 270, 27646 (1995); herein incorporated by reference in its
entirety). However, the function of gutQ remains unknown (see,
e.g., R. C. Goldman, W. E. Kohlbrenner, J. Bacteriol. 163, 256
(1985); herein incorporated by reference in its entirety).
[0059] In experiments conducted during the development of
embodiments of the present invention, viable Gram-negative bacteria
substantially lacking outer membrane LPS expression were
constructed despite exclusively elaborating the endotoxically
inactive LPS precursor lipid IVa, a known antagonist of LPS-induced
sepsis in humans. The present invention is not limited to
particular methods of constructing viable Gram-negative bacteria
substantially lacking outer membrane LPS expression (e.g., through
suppression of API expression; through mutation of the gutQ and/or
kdsD genes; through suppression of KDO expression; through
inhibiting associations between KDO and Lipid IV.sub.A; through
mutations of the kdsA, and/or kdsB, and/or waaA and/or msbA and/or
yhjD genes, or other biosynthetic, processing, or trafficking
genes; through suppression of lipid IV.sub.A expression; through
mutations of the lpxM gene, or other biosynthetic, processing, or
trafficking genes for lipid IV.sub.A).
[0060] The present invention contemplates the use of any type of
Gram-negative bacterial strain in the construction of viable
Gram-negative bacteria substantially lacking outer membrane LPS
expression. Examples of Gram-negative bacteria useful in the
present invention include, but are not limited to, Escherichia
spp., Shigella spp., Salmonella spp., Campylobacter spp., Neisseria
spp., Haemophilus spp., Aeromonas spp., Francisella spp., Yersinia
spp., Klebsiella spp., Bordetella spp., Legionella spp.,
Corynebacteria spp., Citrobacter spp., Chlamydia spp., Brucella
spp., Pseudomonas spp., Helicobacter spp. and Vibrio spp. In
preferred embodiments, Escherichia coli is used. Examples of
Escherichia strains which can be used include, but are not limited
to, Escherichia coli (E. coli) strains DH5a, HB 101, HS-4, 4608-58,
1-184-68, 53638-C-17, 13-80, and 6-81 (see, e.g., Sambrook, et al.,
(Eds.), 1993, In: Molecular Cloning, Cold Spring Harbor Press, Cold
Spring Harbor, N.Y.); Grant, et al., 1990, Proc. Natl. Acad. Sci.,
USA, 87:4645; Sansonetti, et al., 1982, Ann. Microbiol. (Inst.
Pasteur), 132A:351), enterotoxigenic E. coli (Evans, et al., 1975,
Infect. Immun., 12:656), enteropathogenic E. coli (Donnenberg, et
al., 1994, J. Infect. Dis., 169:831; each herein incorporated by
reference in their entireties) and enterohemorrhagic E. coli (see,
e.g., McKee and O'Brien, 1995, Infect. Immun., 63:2070).
[0061] The present invention is not limited to specific culture
conditions for the growth of mutant Gram-negative bacterial strains
(e.g., Gram-negative bacterial strains with mutations in the kdsD
and/or gutQ, kdsA, kdsB, waaA, msbA, ynjD genes, or other
biosynthetic, processing, or trafficking genes). For illustrative
purposes, bacteria can be grown in any standard liquid medium
suitable for bacterial growth, such a LB medium (Difco, Detroit
Mich.), Nutrient broth (Difco), Tryptic Soy broth (Difco), or M9
minimal broth (Difco), using conventional culture techniques that
are appropriate for the bacterial strain being grown (Miller, 1991,
supra). As an alternative, the bacteria can be cultured on solid
media such as L-agar (Difco), Nutrient agar (Difco), Tryptic Soy
agar (Difco), or M9 minimal agar (Difco). For Gram-negative
bacterial strains wherein said strain comprises the mutations kdsD
and/or gutQ, an exogenous D-arabinose 5-phosphate source is used
for bacterial growth and survival (Meredith et al., 2006, ACS Chem.
Biol. 1:33-42; incorporated herein by reference in its entirety).
Alternatively, experiments conducted during the development of some
embodiments of the invention show that overexpression of the msbA
gene in strains comprising the kdsD and/or gutQ mutations is an
alternative to supplementation by D-arabinose 5-phosphate for
bacterial growth and survival.
[0062] In some embodiments, the present invention provides viable
Gram-negative bacteria with mutations in the gutQ, kdsD (yrbH),
kdsA, kdsB, waaA, msbA, and/or yhjD genes, or mutations in any
other biosynthetic, processing, or trafficking gene. In some
embodiments, mutations of the gutQ and kdsD genes inhibit API
expression within the bacterial strain, which inhibits KDO
expression, which inhibits outer membrane LPS expression. In some
embodiments, the present invention provides viable Gram-negative
bacteria with mutations in the kdsA gene. In some embodiments, the
present invention provides viable Gram-negative bacteria with
mutations in the kdsB gene. In some embodiments, the present
invention provides viable Gram-negative bacteria with mutations in
the waaA gene. Experiments conducted during the development of the
embodiments of the present invention showed that mutations of kdsA,
kdsB, and/or waaA inhibit the LPS biosynthetic pathway by
preventing production of KDO or association between KDO.sub.2 and
Lipid IV.sub.A such that Lipid IV.sub.A alone is transported to the
outer membrane. The bacterial cells survive and are LPS free and
non-toxic. In some embodiments, the present invention provides
viable Gram-negative bacteria with mutations in the gutQ, kdsD,
kdsA, kdsB, and/or waaA genes, and further comprises a mutation in
the msbA gene. In some embodiments the present invention provides
viable Gram-negative bacteria with mutations in the gutQ, kdsD,
kdsA, kdsB, or waaA genes, and further comprises a mutation in the
yhjD gene.
[0063] The present invention contemplates the use of any technique
for introducing genetic mutations within Gram-negative bacteria.
Such techniques include, but are not limited to, non-specific
mutagenesis, using chemical agents such as N-methyl-N'-nitro
N-nitrosoguanidine, acridine orange, ethidium bromide, or
non-lethal exposure to ultraviolet light (see, e.g., Miller (Ed.),
1991, In: A Short Course in Bacterial Genetics, Cold Spring Harbor
Press, Cold Spring Harbor, N.Y.; herein incorporated by reference
in its entirety). Alternatively, the mutations can be introduced
using Tn10 mutagenesis, bacteriophage-mediated transduction, lambda
phage-mediated allelic exchange, or conjugational transfer, or site
directed mutagenesis using recombinant DNA techniques (see, e.g.,
Miller (Ed.), 1991, supra; Hone, et al., 1987, J. Infect. Dis.,
156:167; Noriega, et al, 1994, Infect. Immun., 62:5168; Hone, et
al., 1991, Vaccine, 9:810; Chatfield, et al., 1992, Vaccine, 10:53;
Pickard, et al., 1994, Infect. Immun., 62:3984; Odegaard, et al.,
1997, J. Biol. Chem., 272:19688; Lee, et al., 1995, J. Biol. Chem.,
270:27151; Garrett, et al., 1998, J. Biol. Chem., 273:12457; each
herein incorporated by reference in their entireties). Any method
for introducing mutations may be used and the mutations can be
introduced in conjunction with one or more additional mutations.
For example, in some embodiments the present invention provides
viable Gram-negative bacteria with more than one mutation such as
mutations in the gutQ, kdsD, kdsA, kdsB, waaA msbA, yhjD genes, or
mutations in any other biosynthetic, processing, or trafficking
gene.
[0064] In some embodiments, mutations within Gram-negative bacteria
(e.g., mutations of the gutQ, kdsD (yrbH), kdsA, kdsB, waaA, msbA,
and/or yhjD genes, or mutations of any other biosynthetic,
processing, or trafficking genes) are either constitutively
expressed or under the control of inducible promoters, such as, for
example, the temperature sensitive heat shock family of promoters,
or the anaerobically-induced nirB promoter (see, e.g., Harborne, et
al., 1992, Mol. Micro., 6:2805; herein incorporated by reference in
its entirety) or repressible promoters, such as uapA (see, e.g.,
Gorfinkiel, et al., 1993, J. Biol. Chem., 268:23376; herein
incorporated by reference in its entirety) or gcv (see, e.g.,
Stauffer, et al., 1994, J. Bact, 176:6159; herein incorporated by
reference in its entirety). Selection of an appropriate promoter
will depend on the host bacterial strain and will be obvious to
those skilled in the art.
[0065] In some embodiments, the present invention provides viable
Gram-negative bacteria (e.g., E. coli) lacking API expression. The
present invention is not limited to a particular method of
inhibiting API expression. In some embodiments, API expression is
inhibited through suppression of KDO protein expression. The
present invention is not limited to a particular method of
suppressing KDO protein expression. In some embodiments, KDO
protein expression is suppressed through, for example, mutation of
the gutQ gene, kdsD gene, kdsA gene or kdsB gene, or mutations in
any other KDO biosynthetic gene.
[0066] In some embodiments, the present invention provides viable
non-toxic (e.g., endotoxin free) Gram-negative bacteria (e.g., E.
coli). The present invention is not limited to a particular method
of providing viable non-toxic Gram-negative bacteria. In some
embodiments, viable non-toxic Gram-negative bacteria are provided
through suppression of LPS expression in the outer membrane. The
present invention is not limited to a particular method of
suppressing LPS expression in the outer membrane. In some
embodiments, LPS expression is suppressed through suppression of
API protein expression. The present invention is not limited to a
particular method of suppressing API expression. In some
embodiments, API expression is suppressed through suppression of
KDO protein expression. The present invention is not limited to a
particular method of suppressing KDO protein expression. In some
embodiments, KDO protein expression is suppressed through, for
example, mutation of the gutQ gene and the kdsD gene. In some
embodiments, KDO protein expression at the outer membrane does not
occur due to the KDO protein not associating with Lipid IV.sub.A,
such that only Lipid IV.sub.A is transported to the outer membrane.
For example, mutations in gutQ, kdsD, kdsA, kdsB, waaA msbA, and/or
yhjD genes or mutations of any other biosynthetic, processing, or
trafficking genes eliminate the formation of or membrane
presentation of the KDO.sub.2-Lipid IV.sub.A complex, resulting in,
for example, only the Lipid IV.sub.A molecule being transported to
the outer membrane and no subsequent LPS formation.
[0067] In some embodiments, the viable non-toxic Gram-negative
bacteria can be genetically engineered via cloning methods known to
those skilled in the art (see Sambrook et al., Molecular Cloning; A
Laboratory Manual, Cold Spring Harbor Laboratory Press;
incorporated herein by reference in its entirety) to express,
produce and display non-native proteins and peptides such as, but
not limited to, LPS from other bacterial organisms, unique lipid
derivatives, human protein or peptide production, non-human protein
or peptide production, vaccine production, and the like. Such
products produced find utility in a variety of applications,
including but not limited to, clinical therapeutics and basic
research endeavors.
[0068] In some embodiments, the present invention provides viable
Gram-negative bacteria (e.g., E. coli) comprising an outer membrane
expressing lipid IVa. The present invention is not limited to a
particular method of providing viable Gram-negative bacteria
comprising an outer membrane expressing lipid IVa. In some
embodiments, viable Gram-negative bacteria comprising an outer
membrane expressing lipid IVa is accomplished through suppression
of API protein expression. The present invention is not limited to
a particular method of suppressing API protein expression. The
present invention is not limited to a particular method of
suppressing API expression. In some embodiments, API expression is
suppressed through suppression of KDO protein expression. The
present invention is not limited to a particular method of
suppressing KDO protein expression. In some embodiments, KDO
protein expression is suppressed through, for example, mutation of
the gutQ, kdsD, kdsA, kdsB, waaA, msbA, and/or yhjD gene or
mutations of any other biosynthetic, processing, or trafficking
genes. In some embodiments, LPS free viable Gram-negative bacteria
comprising an outer membrane expressing Lipid IV.sub.A is
accomplished by inhibiting the association between KDO and Lipid
IV.sub.A, such that only Lipid IV.sub.A is transported to the outer
membrane (e.g., without KDO). The present invention is not limited
to a particular method of inhibiting the association between KDO
and Lipid IV.sub.A. In some embodiments, the association of KDO and
Lipid IV.sub.A is inhibited by, for example, mutations in the gutQ,
kdsD, kdsA, kdsB, waaA, msbA and/or yhjD genes, or any or mutations
of any other biosynthetic, processing, or trafficking genes. In
some embodiments, the present invention provides lipid IVa isolated
from viable non-toxic Gram-negative bacteria (e.g., E. coli). Lipid
IVa is used, for example, in studying mammalian septic shock
signaling pathways, and as a building block in the synthesis of
LPS-type molecules. Current methods for isolating lipid IVa involve
traditional total organic synthesis, degradation of mature LPS, or
purification from conditional mutants that elaborate a
heterogeneous LPS layer that contains a fraction of the desired
lipid IVa. Drawbacks for such methods include low lipid IVa yield
and high amounts of labor. Isolation of lipid IVa from the viable
non-toxic Gram-negative bacteria of the present invention
represents a significant improvement over such methods due to the
outer membrane presence of lipid IVa.
[0069] In some embodiments, the present invention provides outer
membrane vesicles isolated from viable non-toxic Gram-negative
bacteria (e.g., E. coli). Lipid IVa is an antagonist of septic
shock signaling pathways, and a viable approach to treating
patients with acute sepsis is to block the signaling pathway
involving LPS. In some embodiments, isolated outer membrane
vesicles from viable Gram-negative bacteria comprising an outer
membrane expressing lipid IVa are used to treat, or
prophylactically prevent, sepsis related disorders. Outer membrane
vesicles prepared from the viable non-toxic Gram-negative bacteria
of the present invention (e.g., the .DELTA.API strain) contain
lipid IVa as an LPS antagonist.
[0070] In some embodiments, outer membrane vesicles isolated from
viable Gram-negative bacteria (e.g., E. coli) are used for purposes
of improved outer membrane vesicle based vaccines. OMV based
vaccines are often "detoxified` by stripping away the LPS by harsh
chemical treatments. Stripping methods, however, have a deleterious
affect on protein components of the OMV vaccine, which can be good
candidates to target antibodies against, particularly of cloned
outer membrane proteins from other Gram-negative pathogens.
Detoxification would not be necessary with the .DELTA.API mutant
strain as hosts, providing an additional level of safety.
[0071] In some embodiments, the present invention provides
Gram-negative bacteria comprising an outer membrane with both lipid
IVa and LPS expression. Separating the toxicity of LPS from the
immunostimulatory properties is a major challenge to developing LPS
based adjuvants or LPS based vaccines. Since the block in the
.DELTA.API strain is early in the LPS pathway, enzymes from other
bacteria (which modify LPS with phosphate groups, ethanolamine,
L-4-deoxy arabinose, different acyl chain lengths, etc.) and
mutated enzymes with altered activities can be used to generate an
array of LPS molecules with unique biological activities inside the
cell. Many methods for such genetic manipulations already exist in
Escherichia coli. Further, mature LPS synthesis can be restored by
inclusion of D-arabinose 5-phosphate in the growth media, allowing
one to control and optimize the amount and ratio of LPS derivatives
to mature LPS. Such LPS "blends" may achieve the desired balance
between immunostimulatory activity while retaining acceptable low
levels of potential toxicity.
[0072] In some embodiments, viable non-toxic Gram-negative bacteria
are used as hosts for the production of endotoxin free therapeutic
molecules. The present invention is not limited to particular
therapeutic molecules. Traditionally, the production of therapeutic
molecules in Gram-negative bacteria, whether it be OM vesicles for
vaccines, LPS type molecules (such as monophosphoryl lipid A
(MPLA)) to be used as adjuvants, recombinant pharmaceutical
proteins, macromolecules, or DNA for mammalian cell
transfection/gene therapy, is plagued by the presence of endotoxin
from the bacterial host. Contamination of the therapeutic molecule
with endotoxin is a concern, as the immunogenic potential of LPS is
well documented. Current production strategies to alleviate
endotoxin contamination include various purification techniques,
such as the kits marketed for endotoxin free DNA plasmid
purification, followed by assays to measure endotoxin levels. As
the .DELTA.API strain does not produce endotoxin, such purification
steps are not required. As such, the viable non-toxic Gram-negative
bacterial strains of the present invention (e.g., the .DELTA.API
strain) provide improved methods of isolating endotoxin free
therapeutic molecules (e.g., lipid IVa). For example, the
.DELTA.API strain is contemplated to be a host for the production
of commercially important therapeutic molecules in an
endotoxin-free environment using the well-studied Gram-negative
bacteria. Additionally, strains comprising a mutation in gutQ,
kdsD, kdsA, kdsB, waaA msbA, yhjD genes, or mutations in any other
biosynthetic, processing, or trafficking bacterial genes are
contemplated to be hosts for the production of commercially
important therapeutic molecules in an endotoxin-free environment
using Gram-negative bacteria.
[0073] In some embodiments, the viable non-toxic Gram-negative
bacteria can be used for production of vaccines or other
compositions that stimulate the immune response. For example, a
less toxic vaccine against typhoid fever is produced using the
Gram-negative bacteria as described herein. Current vaccines for
typhoid fever cause side effects due to endotoxins present in the
vaccine preparation. It is contemplated that utilizing the viable
non-toxic Gram-negative bacteria or portions thereof as described
herein where no LPS (e.g., endotoxin) is presented on the outer
membrane bypasses side effects caused by endotoxin laced vaccine
preparations. The present invention finds utility in any vaccine
preparation or other composition where endotoxin contamination is
typically found. The viable non-toxic Gram-negative bacteria of the
present invention are also contemplated to find utility as live
attenuated vaccines due to their LPS deficiency phenotype.
[0074] As such, the present invention finds use in developing OM
vaccines and other compositions for inducing immune responses that
are free of endotoxin contamination that can be administered to
subjects for immunization and research purposes. For example,
attenuated or OM vaccines can be prepared using procedures as
described in US Patent Application 2005/0013831 or U.S. Pat. No.
6,558,677, incorporated herein by reference in their entireties.
For example, such a vaccine finds utility in immunizing subjects at
risk of acquiring septic shock (e.g., from E. coli), such as
surgery patients. Further, endotoxin free attenuated or OM vaccines
can be developed for immunization against, for example, whooping
cough (e.g., Bordetella sp.), brucellosis or endotoxic shock (e.g.,
Brucella sp.), pulmonary and respiratory infections (e.g.,
Pseudomonas sp., Haemophilus sp., Moraxella sp.), cholera (e.g.,
Vibrio sp.), pneumonia (e.g., Klebsiella sp., Haemophilus sp.),
stomach ulcers (e.g., Helicobacter sp.), meningitis (e.g.,
Neisseria sp., Haemophilus sp.), otitis media (e.g., Haemophilus
sp., Moraxella sp.), dysentery and diarrhea (e.g., Shigella sp., E.
coli, Vibrio sp., Campylobacter sp., Yersenia sp.), enteric fevers
(e.g., Salmonella sp.), trachoma and sexually transmitted diseases
(e.g., Chlamydia sp.), tularemia (e.g., Franciscella sp.), and
plague (e.g., Yersinia sp.).
[0075] In some embodiments, the non-toxic viable Gram-negative
bacteria as described herein find utility in generating therapeutic
antibodies for therapeutic and research applications. For example,
in some embodiments subjects are actively immunized using the
non-toxic Gram-negative bacteria or portions thereof (e.g.,
membrane preparations), and antibodies prepared from human
hyper-immune sera are then used to passively protect subjects
against bacterial infection and sepsis. However, the generation of
therapeutic antibodies is more traditionally accomplished in host
animals such as, but are not limited to, primates, rabbits, dogs,
guinea pigs, mice, rats, sheep, goats, etc. Therapeutic antibodies,
for example, are created using the non-toxic viable Gram-negative
bacteria as immunogens themselves for creating antibodies in host
animals for administration to human subjects. Non-toxic viable
Gram-negative bacteria as described herein additionally find
utility as hosts for presenting a foreign antigen (e.g.,
immunogenic peptide or protein) that is used to create therapeutic
antibodies in a host animal. For example, the non-toxic viable
Gram-negative bacteria, besides being substantially deficient in
LPS, can be genetically manipulated (e.g., via established cloning
methods known to those skilled in the art) to express non-native
proteins and peptides that find use as immunogens for antibody
production. Such immunogens include, but are not limited to,
peptides for targeting antibodies to cancer cells and other disease
causing cells, viral coat proteins for viral cell targeting, and
the like.
[0076] In some embodiments, the present invention provides
non-toxic viable Gram-negative bacteria useful for presenting
immunogenic proteins for therapeutic antibody production. An
antibody against an immunogenic protein may be any monoclonal or
polyclonal antibody, as long as it can recognize the antigenic
protein. Antibodies can be produced according to a conventional
antibody or antiserum preparation process known to those skilled in
the art.
[0077] In some embodiments, viable Gram-negative bacteria (e.g., E.
coli) comprising an outer membrane expressing lipid IVa are used
for purposes of pharmaceutical screening (e.g., screening for
anti-pyrogenic agents). The .DELTA.API mutant strain has a very low
permeability barrier, making it particularly susceptible to large,
hydrophobic drug molecules that normally cannot penetrate the OM.
Whole cell bioassays of compound libraries normally use
permeabilizing agents such as toluene, EDTA, cationic peptides,
etc. to help identify hits by facilitating penetration of the OM.
Once parent lead hits are made, medicinal chemistry can be used to
improve the solubility, partitioning, size, etc. to produce an
antibiotic. Many potential leads from these screens are missed
because the compound cannot gain access to its protein target
inside the OM. Using, for example, the .DELTA.API mutant strain in
such screens alleviates OM permeability problems by lowering the
permeability barrier without the need for providing additional
reagents. Similarly, such low OM permeability of the .DELTA.API is
an advantage when transforming, for example, the .DELTA.API mutant
strain with DNA plasmids during the generation of DNA libraries.
High transformation efficiency cells are essential to all
recombination DNA technologies, and the .DELTA.API strain is a
useful host for such applications.
EXAMPLES
Example I
[0078] This example describes the .DELTA.API mutants TCM15 and
KPM22. An auxotrophic .DELTA.API mutant with both G-API and L-API
deleted, TCM15, was constructed which became dependent on exogenous
A5P for growth in accordance with the established KDO.sub.2-lipid A
dogma for E. coli. TCM15 was incapable of forming colonies on solid
media, regardless of the growth media, incubation temperature, or
time without including A5P. When cultured in liquid MOPS-minimal
media with 0.2% glycerol as a sole carbon source, cell division
routinely resumed after a 32-48 hour lag despite the lack of
A5P.
[0079] The E. coli KPM22 strain was shown to be a non-conditional
.DELTA.API mutant capable of sustained growth in rich media without
an initial lag at 37.degree. C. although there remained no
measurable API activity in cellular extracts. As shown in Table 2,
the doubling time increased to nearly twice that of the parent
wild-type strain in LB media.
TABLE-US-00002 TABLE 2 Generation Times in LB media at Various
Temperatures Strain 30.degree. C. (min) 37.degree. C. (min)
42.degree. C. (min) BW30270 39 24 22 KPM22 55 38 N/A .sub.a KPM25
40 25 23 .sub.a After 2-3 generations, growth rate was
non-exponential.
After shifting to non-permissive temperatures (42.degree. C.),
exponential growth rates were not maintained after 2 to 3
generations. Growth was restored to KPM22 at elevated temperatures
by a plasmid encoding kdsD (KPM25), suggesting a defective cell
envelope due to the block in KDO synthesis.
[0080] To further investigate KPM22, LPS samples were extracted
from cells using the phenol-chloroform-petroleum ether (PCP)
extraction method (see, e.g., C. Galanos, et al., Eur. J. Biochem.
9, 245 (1969); herein incorporated by reference in its entirety).
The saccharide composition of the LPS extract was determined for
the inner core sugar constituents [KDO and
L-glycero-D-manno-heptose (heptose)] and lipid A [D-glucosamine
(GlcN)] (see FIG. 1A). The ratios for both wild-type BW30270 [1
GlcN: 0.9 KDO: 2.2 heptose] and KPM25 [1.0 GlcN: 1.0 KDO: 2.5
heptose] were consistent with the ratio for the predominant LPS
species (glycoform I) elaborated by E. coli K-12 [1.0 GlcN: 1.0
KDO: 2.0 heptose] (see, e.g., S. Muller-Loennies, et al., J. Biol.
Chem. 278, 34090 (2003); herein incorporated by reference in its
entirety). Only traces of KDO or heptose were detected in
comparison for KPM22, though GlcN was still present suggesting that
the lipid A backbone was intact.
[0081] Silver stained SDS-PAGE analysis of LPS samples prepared
from proteinase K treated whole-cell lysates detected no bands for
KPM22 (see, FIG. 1B; top panel). Blotted membranes were treated
with acid to cleave the saccharide core before being probed with
the mAb A6 antibody, which recognized the nonglycosylated
1,4'-bisphosphorylated .beta.-1,6-linked GlcN disaccharide backbone
of lipid A. A single band from KPM22 that migrated faster than the
Re endotoxin standard but at the same level as synthetic lipid IVa
was recognized by the antibody (FIG. 1B, middle panel, lanes 6 and
16, respectively). Only LPS samples prepared from KPM22 together
with synthetic lipid IVa were recognized by mAb A6 when the acid
hydrolysis step was omitted, confirming the native lipid A
structure was nonglycosylated (FIG. 1B, bottom panel).
[0082] The chemotype of the LPS precursor in KPM22 was determined
by electrospray ionization Fourier transform ion cyclotron (ESI
FT-ICR) mass spectrometry in negative ion mode using purified LPS
samples (see, FIG. 2, Table 3).
TABLE-US-00003 TABLE 3 ESI FT-ICR MS Peak List Obs. Mass .sub.a, b
Calc. Mass .sub.a Chemical Composition .sub.c Label .sub.c 703.52
703.517 phospholipid, PE (33:1) (e.g. 1* 16:0 + 1*17:1) PE 1178.67
1178.661 2*GlcN, 2*P, 3* (OH)-14:0 LA.sub.tri 1360.83 1360.828
2*GlcN, 2*P, 3* (OH)-14:0, 1* 12:0 LA.sub.tetra 1404.86 1404.854
2*GlcN, 2*P, 4* (OH)-14:0 Lipid IVa 1527.87 1527.863 2*GlcN, 2*P,
4* (OH)-14:0, 1* P-EtN 1587.02 1587.021 2*GlcN, 2*P, 4* (OH)-14:0,
1*12:0 LA.sub.penta 1797.22 1797.219 2*GlcN, 2*P, 4* (OH)-14:0,
1*12:0, 1* 14:0 LA.sub.hexa 3813.75 3813.734 LA.sub.hexa + 1*Gal,
3*Glc, 4*Hep, 2*KDO, 2*P Glycoform I 3893.72 3893.700 LA.sub.hexa +
1*Gal, 3*Glc, 4*Hep, 2*KDO, 3*P Glycoform I 3915.71 3915.699
LA.sub.hexa + 1*Gal, 3*Glc, 4*Hep, 2*KDO, 3*P, +1*Na Glycoform I
3995.63 3995.653 LA.sub.hexa + 1*Gal, 3*Glc, 4*Hep, 2*KDO, 4*P,
+1*Na Glycoform I 4017.66 4017.645 LA.sub.hexa + 1*Gal, 3*Glc,
4*Hep, 2*KDO, 4*P, +2*Na Glycoform I 4038.69 4038.697 LA.sub.hexa +
1*Gal, 3*Glc, 4*Hep, 2*KDO, 5*P, 1*P-EtN + 1*Na Glycoform I 3927.68
3927.689 LA.sub.hexa + 1*Gal, 2*Glc, 3*Hep, 1*Rha, 3*KDO, 3*P +
1*Na Glycoform IV 4007.67 4007.655 LA.sub.hexa + 1*Gal, 2*Glc,
3*Hep, 1*Rha, 3*KDO, 4*P + 1*Na Glycoform IV 4029.64 4029.654
LA.sub.hexa + 1*Gal, 2*Glc, 3*Hep, 1*Rha, 3*KDO, 4*P + 2*Na
Glycoform IV 4050.70 4050.698 LA.sub.hexa + 1*Gal, 2*Glc, 3*Hep,
1*Rha, 3*KDO, 3P + 1*P-EtN, +1*Na Glycoform IV 4140.67 4140.722
LA.sub.hexa + 1*GlcNAc, 1*Gal, 3*Glc, 4*Hep, 2*KDO, 3*P, +2*Na
Glycoform II 4198.74 4198.735 LA.sub.hexa + 1*GlcNAc, 1*Gal, 3*Glc,
4*Hep, 2*KDO, 4*P, +1*Na Glycoform II 4220.73 4220.724 LA.sub.hexa
+ 1*GlcNAc, 1*Gal, 3*Glc, 4*Hep, 2*KDO, 4*P, +2*Na Glycoform II
4300.68 4300.698 LA.sub.hexa + 1*GlcNAc, 1*Gal, 3*Glc, 4*Hep,
2*KDO, 5*P, +2*Na Glycoform II 4241.81 4241.778 LA.sub.hexa +
1*GlcNAc, 1*Gal, 3*Glc, 4*Hep, 2*KDO, 3*P, 1*P-EtN + 1*Na Glycoform
II 4321.73 4321.745 LA.sub.hexa + 1*GlcNAc, 1*Gal, 3*Glc, 4*Hep,
2*KDO, 4*P, 1*P-EtN + 1*Na Glycoform II 4343.74 4343.734
LA.sub.hexa + 1*GlcNAc, 1*Gal, 3*Glc, 4*Hep, 2*KDO, 4*P, 1*P-EtN +
2*Na Glycoform II .sub.a Mass numbers given refer to the
monoisotopic masses of the neutral molecules which were deduced
from the negative ion ESI FT-ICR mass spectra of the LPS fraction
after charge deconvolution. .sub.b Bold type peaks are labeled on
FIG. 4 in text. .sub.c Abbreviations: PE--phosphatidylethanolamine;
GlcN--D-glucosamine; P--phosphate; P-EtN--phosphoethanolamine;
Gal--D-galactose; Glc--D-glucose; Hep--L-glycero-D-manno-heptose;
KDO--2-keto 3-deoxy-D-manno-octulosonate; Rha--rhamnose;
GlcNAc--N-acetyl D-glucosamine; LA.sub.tri, .sub.tetra, .sub.penta,
.sub.hexa--acylation state of lipid A.
The spectra of both wild-type BW30270 and KPM25 displayed similar
peak patterns and heterogeneity within the characteristic mass
range [.about.3900 to .about.4300 u] of the different glycoforms of
mature E. coli K-12 LPS core (see, FIGS. 2A,C). One LPS related
peak in KPM22 had a molecular mass of 1404.86 u which was
consistent with the structure of 1,4'-bisphosphorylated
tetraacylated lipid A (lipid IVa, calculated mass 1404.854 u) (see,
FIG. 2B).
[0083] Lipid IVa is an intermediate in the LPS pathway that serves
as the acceptor for the sequential addition of two KDO residues to
form KDO.sub.2-lipid IVa, wherein the late acyltransferases LpxL
and LpxM next transfer the fatty acids laurate and myristate,
respectively, to KDO.sub.2-lipid IVa forming hexaacylated
KDO.sub.2-lipid A. Raetz and coworkers have shown that both enzymes
from E. coli display an absolute substrate requirement for KDO in
the lipid substrate for activity (see, e.g., K. A. Brozek, C. R.
Raetz, J. Biol. Chem. 265, 15410 (1990); herein incorporated by
reference in its entirety), explaining the lack of secondary acyl
chains in lipid A from KPM22.
[0084] In order to address the subcellular location of lipid IVA
and determine whether it is transported to the OM of KPM22,
discontinuous sucrose gradient centrifugation was used to separate
the OM from the inner membrane (IM) (see, FIG. 3). Both membranes
were well resolved, though the OM for KPM22 did not migrate as far
as the wildtype OM, suggesting a decrease in buoyant density. Aside
from an increase in the amount of OM porin (OMP) proteins
(.about.35 kDa) remaining localized in the IM at the expense of
accumulating in the OM, the overall total protein content and
constitution as analyzed by SDS-PAGE was similar. As it has been
shown that many OM proteins depend on the molecular chaperone
properties of LPS for both their folding and function (see, e.g.,
H. de Cock, J. Tommassen, Embo J. 15, 5567 (1996); P. V. Bulieris,
et al., J. Biol. Chem. 278, 9092 (2003); K. Sen, H. Nikaido, J.
Bacteriol. 173, 926 (1991); herein incorporated by reference in
their entireties), the decrease in OMPs may reflect a decrease in
protein transport rates and/or insertion efficiency into the OM of
KPM22. Isolated OM fractions were assayed for the presence of
3-hydroxy myristate (3-OH C14:0), a characteristic LPS/lipid IVA
fatty acid marker. The OM of wildtype and KPM22 contained 11.7 and
31.1 .mu.g of 3-OH C14:0 per mg of dried membrane, respectively,
suggesting substantial quantities of lipid WA at least equal to the
amount of LPS in wildtype are in fact present in the OM of KPM22.
Further, ESI FT-ICR mass spectrometry revealed peaks for lipid IVA
in both the OM and IM of KPM22, whereas no peaks attributable to
lipid WA were detected in either membrane fraction from wildtype.
Collectively, this indicates that while lipid IVA is transported to
the OM of KPM22, the rate of lipid IVA transport has become
uncoupled to its rate of synthesis.
[0085] Secondary acyl chains are implicated in maintaining a low
degree of fluidity within the OM by increasing the number of acyl
chains (see, e.g., H. Nikaido, Microbiol. Mol. Biol. Rev. 67, 593
(2003); herein incorporated by reference in its entirety), a
condition required for function. The tight packing of saturated
acyl chains induces a network of hydrophobic interactions that that
maintains the integrity of the OM outer leaflet through van der
Waals forces. Despite containing only four acyl chains and no inner
saccharide core, lipid IVa is transported to and is then capable of
supporting OM biogenesis in KPM22. The unprecedented nature of a
lipid IVa layer in the OM of KPM22 redefines the requisite LPS
structure for viability in Enterobacteriaceae.
[0086] KDO is normally considered an essential component of a
functional LPS layer as only conditional mutants of KDO
biosynthetic enzymes in E. coli have been constructed to date (see,
e.g., C. J. Belunis, et al., J. Biol. Chem. 270, 27646 (1995); R.
C. Goldman, W. E. Kohlbrenner, J. Bacteriol. 163, 256 (1985); P. D.
Rick, M. J. Osborn, Proc. Natl. Acad. Sci. U.S.A. 69, 3756 (1972);
each herein incorporated by reference in their entireties). This
has been attributed to the role of KDO (and arguably in part to
other sugars attached distal to KDO) in maintaining a low degree of
fluidity within the lipid bilayer (see, e.g., H. Nikaido,
Microbiol. Mol. Biol. Rev. 67, 593 (2003); herein incorporated by
reference in its entirety). Divalent cations, namely Mg.sup.2+ and
Ca.sup.2+, are believed to form ionic bridges with the negative
charges contributed by both the phosphorylated lipid A backbone and
the carboxylate of KDO, minimizing electrostatic repulsion and
fostering strong lateral interactions. Further, the location of KDO
at the surface of the OM places KDO in close proximity to OM
proteins, many of which depend on the molecular chaperone
properties of core-containing LPS for both their folding and
function (see, e.g., H. de Cock, J. Tommassen, Embo J. 15, 5567
(1996); P. V. Bulieris, et al., J. Biol. Chem. 278, 9092 (2003); K.
Sen, H. Nikaido, J. Bacteriol. 173, 926 (1991); herein incorporated
by reference in their entireties).
[0087] To verify the nonessential nature of KDO in KPM22, genes
encoding the first committed step (kdsA) and the last step (waaA)
in KDO biosynthesis were disrupted. In contrast to KPM22/KPM25
(FIG. 1B, lanes 8, 9), neither exogenous A5P nor plasmid borne API
restored mature LPS synthesis in either KPM31/KPM40 (lanes 12, 15)
or KPM34/KPM42 (lanes 11, 14), respectively, consistent with the
ability of KPM22 to survive without the entire KDO pathway.
[0088] The cell morphology of KPM22 was examined by transmission
electron microscopy (TEM). Overall, the structure of KPM22 was
quite similar to the parent strain (FIG. 4). Obvious division
defects were not observed by TEM and cells maintained the normal
rod shape. Two clearly distinct membranes were discerned for KPM22
(FIG. 4D), as well as a region between the two membranes
representing the periplasm. The periplasmic volume was uniformly
compressed in comparison to wild-type. OM instability was suggested
by the small membrane vesicles appearing at the surface of KPM22
(FIG. 4C). Outer membrane vesicle (OMV) formation may have been
caused by electrostatic repulsion between the 1,4'-GlcN phosphates
of neighboring lipid IVa molecules that are not compensated by
stabilizing interactions of the saccharide core, increasing the
membrane curvature, and resulting in vesicle extrusion from the
bacterial surface. Charge repulsion was particularly relevant for
KPM22 considering that ESI-MS analysis detected no 4-amino
4-deoxy-L-arabinose and only minimal phosphoethanolamine
modifications, both of which served to reduce the amount of net
negative charge (see, e.g., C. R. Raetz, C. Whitfield, Annu. Rev.
Biochem. 71, 635 (2002); herein incorporated by reference in its
entirety).
[0089] Compensatory mechanisms in KPM22 to accommodate the loss in
OM integrity due to the extreme LPS truncation invoked
stabilization with other OM-bound glycolipids. In an LPS-deficient
mutant from N. meningitidis, it was reported that capsular
polysaccharide synthesis became absolutely necessary for viability
(see, e.g., P. van der Ley, L. Steeghs, J. Endotoxin. Res. 9, 124
(2003). E. coli K-12 did not synthesize a capsular polysaccharide,
but there are two other cell surface polysaccharides in addition to
LPS, namely the stress-induced slime exopolysaccharide colanic acid
(M-antigen) (see, e.g., A. Markovitz, in Surface carbohydrates of
the prokaryotic cell I. W. Sutherland, Ed. (Academic Press, Inc.,
New York, N.Y., 1977), vol. I, pp. 415-462); herein incorporated by
reference in its entirety) and the phosphoglyceride-linked
enterobacterial common antigen (ECA) (see, e.g., H. M. Kuhn, et
al., FEMS Microbiol. Rev. 4, 195 (1988); herein incorporated by
reference in its entirety). There was no difference in the level of
nondialyzable methylpentose (FIG. 5A), a constituent carbohydrate
marker of colanic acid (see, e.g., S. Gottesman, et al., J.
Bacteriol. 162, 1111 (1985); herein incorporated by reference in
its entirety). Immunoblot analysis of cell lysates revealed that
the amount of glycerophosphatidyl-bound ECA was actually diminished
in KPM22 (FIG. 5B), consistent with the disappearance of cyclic-ECA
containing four trisaccharide repeating units (2429.89 u) from the
KPM22 spectrum of the phenol extract (FIG. 6). Thus, in addition to
lipid IVa, the OM of KPM22 contained trace levels of ECA and
comparably low wild-type levels of colanic acid. Collectively, the
KPM22 envelope represents the most minimal OM glycolipid content
reported in E. coli capable of sustaining viability.
[0090] A main function of the LPS layer is to act as a permeability
barrier towards the diffusion of both large, hydrophobic molecules
and defensins (polycationic peptides) into the cell as well as to
retain the contents of the periplasmic compartment. The strong
lateral interactions between adjacent LPS molecules within the OM
makes the LPS layer particularly well suited for such a function,
in addition to providing a measure of nonspecific defense against
host responses. Selective permeation of small hydrophilic
molecules, nutrients, and antibiotics is achieved through outer
membrane porin (OMP) protein channels. A panel of antibiotics and
detergents were screened against KPM22 to gauge the effectiveness
of lipid IVa as a permeability barrier (see Table 4).
TABLE-US-00004 TABLE 4 Permeability Barrier Properties of KPM22
Minimum Inhibitory Concentration (.mu.g/mL) KPM22 MW BW30270 (.mu.g
Fold Compound (g mol.sup.-1) XlogP (.mu.g mL.sup.-1) mL.sup.-1)
Difference Rifampin 822.9 3.72 16 0.03 512 Fusidic Acid 516.7 3.7
512 2 256 Novobiocin 612.6 2.74 256 1 256 Erythromycin 733.9 1.98
128 1 128 Bacitracin .sup.a 1422.7 -1.03 4096 512 8 Vancomycin
1449.3 -0.47 256 32 8 Kanamycin 16 1 16 Chloramphenicol 323.1 1.476
8 2 4 Ampicillin 349.4 0.255 4 2 2 Cephaloridine 416.5 1.73 4 4 1
Sodium dodecyl >32000 8 >4000 sulfate (SDS) Bile Salts .sup.b
16000 128 125 Polymyxin E .sup.c 0.25 0.06 4 .sup.a 74,000 units/g.
.sup.b Mixture of sodium cholate and deoxycholate. .sup.c Colistin;
20,261 units/mg
KPM22 was super susceptible to a number of large, hydrophobic
antibiotics that typically have reasonable efficacy against only
Gram-positive bacteria. Normally denied access to their sites of
action by the OM, these compounds accessed intracellular targets in
KPM22. Access to the membrane surface was not impeded by the
saccharide core, further facilitating the partitioning and
subsequent permeation through the compromised lipid bilayer.
However, the minimum inhibitory concentration (MIC) of small
(<600 Da), relatively hydrophilic compounds that gain passage
across the OM primarily through OMPs were at best only modestly
decreased. A notable exception was the positively charged
aminoglycoside kanamycin. It has been suggested that
aminoglycosides gain entry primarily through a self-promoted
mechanism of uptake involving initial charge pairing interactions
with LPS independent of OMPs (see, e.g., R. E. Hancock, et al.,
Antimicrob. Agents. Chemother. 35, 1309 (1991); herein incorporated
by reference in its entirety). KPM22 was particularly sensitive to
detergents, with over a 4000-fold decrease in the MIC for sodium
dodecyl sulfate. Since the concentration of bile salts (cholesterol
metabolites) in the human intestinal tract ranges from 4 to 16 mM
(.about.1650-6650 .mu.g/mL) (see, e.g., B. Borgstrom, Acta Med.
Scand. 196, 1 (1974); herein incorporated by reference in its
entirety), the compromised OM of KPM22 would no longer be suited to
protect the cell from its host environment. Surprisingly, the MIC
of polymyxin E (colistin), a cationic peptide with a detergent-like
mechanism of action, was depressed only .about.4 fold in KPM22.
Accumulation of polymyxins at the membrane surface to the critical
aggregate concentration is pertinent to forming micellar lesions
within the lamellar bilayer, that subsequently act as channels for
self-promoted transport through the OM (see, e.g., A. Wiese et al.,
J. Membr. Biol. 162, 127 (1998); herein incorporated by reference
in its entirety). Lipid IVa has a decreased charge to surface area
ratio in comparison to LPS, highlighting the role of the negatively
charged inner core residues in polymyxin binding. As the
antibiotics chosen have various mechanisms of action, the changes
in MICs among hydrophobic compounds is likely a consequence of
changes in permeability as opposed to a reflection of general
fitness or drug efflux mechanisms. The permeability properties of
KPM22 demonstrate the potential of KDO biosynthesis inhibition as a
means to broaden the spectrum of activity of antibiotics that
already exist by lowering the intrinsic resistance of the OM
barrier.
[0091] Bacterial endotoxins are potent proinflammatory molecules
that elicit an innate immune response in humans even when present
in only trace amounts (see, e.g., E. S. Van Amersfoort, et al.,
Clin. Microbiol. Rev. 16, 379 (2003); herein incorporated by
reference in its entirety). Gram-negative bacterial induced septic
shock results from an imbalanced, dysregulated immune response. In
part, this pathophysiological cascade is triggered by the
activation of macrophages by LPS, which in turn secrete an array of
inflammatory mediators. One of the first cytokines released by
macrophages is the pleiotropic cytokine TNF-.alpha. (tumor necrosis
factor). The endotoxic potential of LPS preparations were measured
using an ELISA based assay for hTNF-.alpha. secretion from
stimulated human mononuclear cells (FIG. 7). Preparations from
KPM22 were endotoxically inactive at concentrations up to 1
.mu.g/mL, consistent with earlier studies using chromatographically
purified lipid IVa (see, e.g., D. T. Golenbock, et al., J. Biol.
Chem. 266, 19490 (1991); herein incorporated by reference in its
entirety). In E. coli and related bacteria, KDO inhibition not only
increased the susceptibility of the bacteria to both host responses
and antibiotics, but also has the potential to decrease the risk of
sepsis by lowering the endotoxin burden.
[0092] The inner membrane ABC (ATP binding cassette) transporter
that flips LPS from the cytoplasm to the periplasmic face of the IM
is highly selective for hexaacylated LPS/lipid A substrates in
vitro (see, e.g., Zhou Zhou, Z., et al., J. Biol. Chem. 273,
12466-12475 (1998); Doerrler, W. T., et al., J. Biol. Chem. 277,
36697-36705 (2002); each herein incorporated by reference in their
entireties). MsbA was originally identified as a multicopy
suppressor of LpxL (HtrB) temperature sensitive phenotypes (see,
e.g., Polissi, A., and Georgopoulos, C. Mol. Microbiol. 20,
1221-1233 (1998); herein incorporated by reference in its
entirety). Complementation of the auxotrophic TCM15 strain with a
cosmid library of KPM22 genomic DNA revealed that MsbA was a
multicopy suppressor of the .DELTA.Kdo phenotype. Seventeen
separate cosmid clones were isolated containing the msbA locus. A
cosmid subclone (pMMW52), containing a 3.5 kb insert with only an
intact wildtype msbA sequence identical to the wildtype, was able
to directly rescue TCM15 without the need to develop the presumed
suppressor mutation(s), as indicated by loss of A5P auxotrophy and
restoration of colony-forming ability on solid agar (Table 5). The
growth rate of TCM15(pMMW52) is similar to KPM22 (Tables 2 and 5).
These results indicate that while lipid IVA is a poor substrate in
vitro (see, Doerrler, W. T., and Raetz, C. R., J. Biol. Chem. 277,
36697-36705 (2002); herein incorporated by reference in its
entirety), lipid IVa becomes a substrate for MsbA in vivo when
present in high concentrations by simple mass action.
TABLE-US-00005 TABLE 5 Multicopy suppression of TCM15 auxotrophy by
MsbA Colony forming units (cfu) mL.sup.-1a Growth in liquid LB
media.sup.b Strain LB Only LB + A5P/G6P.sup.c,d LB.sup.d LB +
A5P/G6P.sup.c,d TCM15 0 8.7 .times. 10.sup.7 +++ (23) TCM15 0 2.1
.times. 10.sup.6 +++ (22) (pMBL19).sup.e TCM15 4.4 .times. 10.sup.3
3.1 .times. 10.sup.5 ++ +++ (23) (pMMW52).sup.f (33) .sup.aCfu
values correspond to either direct plating (TCM15) or
post-electrotransformation; .sup.bWhere measurable, generation
times (min) at 37.degree. C. are listed in parentheses; .sup.c15
.mu.M A5P, 10 .mu.M G6P. .sup.dAmp (100 .mu.g mL - 1) was included
for strains carrying plasmid; .sup.eCloning vector; .sup.fSubclone
containing msbA.
Example II
[0093] This example describes the bacterial strains, plasmids, and
primers used in the studies involving KPM22 and TCM15. The
bacterial strains, plasmids, and primers used in the studies
involving KPM22 and TCM15 are listed in Table 6.
TABLE-US-00006 TABLE 6 Bacterial Strains, Plasmids, and Primers
Strain/ Plasmid/ Primer Description .sup.a Source or Reference
BW30270 E. coli K-12 MG1655; rph.sup.+ fnr.sup.+ E. coli Genetic
Stock Center (CGSC#7925) SL3749 S. enterica sv. Typhimurium
(rfaL446, Salmonella Genetic Stock Center Ra chemotype of LPS)
(SGSC#228) SL3750 S. enterica sv. Typhimurium (rfaJ417, Salmonella
Genetic Stock Center Rb2 chemotype of LPS) (SGSC#229) SL3748 S.
enterica sv. Typhimurium (rfaI432, Salmonella Genetic Stock Center
Rb3 chemotype of LPS) (SGSC#227) SL3769 S. enterica sv. Typhimurium
(rfaG471, Salmonella Genetic Stock Center Rdl chemotype of LPS)
(SGSC#231) SL1102 S. enterica sv. Typhimurium (rfaE543, Salmonella
Genetic Stock Center Re chemotype of LPS) (SGSC#258) TCM15
BW30270(.DELTA.gutQ .DELTA.kdsD); A5P T. C. Meredith and R. W.
auxotroph Woodard, J. Bacteriol., in press, (2005); herein
incorporated by reference in its entirety) KPM22 TCM15 MOPS minimal
media Experiments conducted during derivative the course of the
present invention KPM25 KPM22 with pT7kdsD Experiments conducted
during the course of the present invention KPM31 KPM22(.DELTA.kdsA)
Experiments conducted during the course of the present invention
KPM34 KPM31 with pT7kdsD Experiments conducted during the course of
the present invention KPM40 KPM22(.DELTA.waaA) Experiments
conducted during the course of the present invention KPM42 KPM40
with pT7kdsD Experiments conducted during the course of the present
invention PT7kdsD pT7-7 with E. coli K-12 kdsD; Amp.sup.R T. C
Meredith and R. W. Woodard, J. Biol. Chem., 278, 32771 (2003);
herein incorporated by reference in its entirety) P1
GCTGCATTAATTAATCGACATTTT Invitrogen ACTCAAGATTAAGGCGATCCTGT
GTAGGCTGGAGCTGCTTC (SEQ ID NO: 9) P2 GTCTTAACGCAGAACGCTAATACT
Invitrogen TTATTTTTCAAGCAAAAAAGAATT CCGGGGATCCGTCGACC (SEQ ID NO:
10) P3 ACAGCTAAATACATAGAATCCCC MWG Biotech AGCACATCCATAAGTCAGCTATTT
ACTGTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 11) P4 TAATGGGATCGAAAGTACCCGGA
MWG Biotech TAAATCGCCCGTTTTTGCATAACA ACCCATATGAATATCCTCCTTAG (SEQ
ID NO: 12) .sup.a Homology regions are underlined.
All strains were grown in standard Luria-Bertani media (10 g
Tryptone, 5 g Yeast Extract, 10 g NaCl) or MOPS-minimal media (see,
e.g., F. C. Neidhardt, P. L. Bloch, D. F. Smith, J. Bacteriol. 119,
736 (1974); herein incorporated by reference in its entirety) with
0.2% glycerol as the sole carbon source. E. coli strain KPM22 was
used as the host for chromosomal kdsA and waaA gene disruptions
using the phage .lamda. Red recombinase system according to the
procedure of Datsenko and Wanner (see, e.g., K. A. Datsenko, B. L.
Wanner, Proc. Natl. Acad. Sci. U.S.A. 97, 6640 (2000); herein
incorporated by reference in its entirety). Kanamycin and
ampicillin were used at 15 .mu.g/mL and 100 .mu.g/mL, respectively.
Primer pairs P1/P2 with pKD13(kan) or P3/P4 with pKD4(kan) as
templates were used to construct insert cassettes for KPM31 and
KPM40, respectively. Antibiotic resistance markers were excised
using the FLP recombinase system as described (see, e.g., K. A.
Datsenko, B. L. Wanner, Proc. Natl. Acad. Sci. U.S.A. 97, 6640
(2000); herein incorporated by reference in its entirety), except
all plasmids were cured at 37.degree. C.
Example III
[0094] This example describes the growth of KPM22. Growth of KPM22
involved exponentially dividing cultures of TCM15 in MOPS-minimal
media supplemented with 10 .mu.M D-glucose 6-phosphate and 15 .mu.M
D-arabinose 5-phosphate at 37.degree. C. were diluted (1:200 v/v)
into the same media lacking the sugar phosphate supplements. After
an initial lag lasting from 24-32 hours, growth resumed and
cultures were colony purified on LB agar plates.
Example IV
[0095] This example describes the growth rate determinations for
experiments involving KPM22. Overnight cultures were grown at
30.degree. C. and used to inoculate fresh prewarmed LB media
(30.degree. C., 37.degree. C., or 42.degree. C.) to an OD.sub.600
nm equal to 0.05-0.1. Growth was monitored by measuring the change
in OD.sub.600 nm and cultures were diluted as the OD approached
.about.0.7 to maintain exponential growth. Doubling times are
listed in Table 7.
TABLE-US-00007 TABLE 7 Generation Times in LB media at Various
Temperatures Strain 30.degree. C. (min) 37.degree. C. (min)
42.degree. C. (min) BW30270 39 24 22 KPM22 55 38 N/A .sub.a KPM25
40 25 23 .sub.a After 2-3 generations, growth rate was
non-exponential.
Example V
[0096] This example describes LPS purification for experiments
involving KPM22 and TCM15. Samples were routinely prepared by
growing 500 mL of each strain in LB media at 37.degree. C. with
constant aeration at 250 rpm. Cells from stationary phase cultures
were collected by centrifugation (10 min, 8000.times.g, 4.degree.
C.), washed in distilled water, and recentrifuged. The biomass was
dehydrated by treatment with ethanol (95%), acetone, and diethyl
ether as described previously (see, e.g., U. Zahringer et al., J.
Biol. Chem. 279, 21046 (2004); herein incorporated by reference in
its entirety). Isolation of LPS was performed by extraction of the
dried cells according to the phenol-chloroform-petroleum ether
procedure (see, e.g., C. Galanos, O. Luderitz, O. Westphal, Eu.r J.
Biochem. 9, 245 (1969); herein incorporated by reference in its
entirety). Aliquots of the crude phenol extract to be analyzed for
carbohydrate composition (FIG. 1A) were extensively dialyzed
against distilled water (MWCO=1000 Da), and collected by
lyophilization. LPS samples for mass spectrometry analysis and
measurement of human TNF.alpha. cytokine release were purified from
the crude phenol phase by precipitation via the dropwise addition
of water. A flocculent precipitate only formed for BW30270 and
KPM25, which was collected by centrifugation and successively
washed with 80% phenol and then acetone. Precipitates were
dissolved in water, and dialyzed separately from their respective
phenol phase mother liquor. After lyophilization, samples were
resuspended in buffer (20 mM Tris-HCl, pH=7.5, 10 mM NaCl, 10 mM
MgCl.sub.2), treated with DNase I (20 .mu.g/mL) and RNase A (20
.mu.g/mL) for 8 hours at 37.degree. C., followed by proteinase K
(100 .mu.g/mL) for 16 hours. LPS samples were collected by
ultracentrifugation (SW 41 Ti swingbucket rotor, 200,000.times.g, 2
hours, 15.degree. C.), washed three times with distilled water, and
extensively dialyzed against water before lyophilization.
Representative LPS purification yields are listed in Table 8.
TABLE-US-00008 TABLE 8 LPS Purification Summary Wet Dry Phenol LPS
Purified Final Cell Mass Cell Mass Ppt. .sub.a Soluble ppt. Yield
.sub.b % Strain OD.sub.600 nm (g) (g) Observed (mg) (mg) (mg) Yield
.sub.c BW30270 5.27 2.50 0.56 + 7.0 13.5 12.1 2.1 KPM22 3.61 1.88
0.43 - 13.3 N/A 7.2 1.7 KPM25 5.75 2.58 0.65 + 9.1 15.7 13.0 2.0
.sub.a Ppt.--precipitate. .sub.b After DNase I/RNase A/proteinase K
treatment. .sub.c Based on dry cell mass.
Example VI
[0097] This example describes the carbohydrate composition analysis
for experiments involving KPM22 and TCM15. The D-glucosamine
(GlcN), 2-keto 3-deoxy-D-manno-octulosonate (KDO), and
L-glycero-D-manno-heptose (heptose) content of LPS samples from the
crude phenol extract were determined using colorimetric chemical
assays. GlcN content was determined by hydrolysis of LPS samples
(.about.1 mg) in 500 .mu.L of 4 M HCl at 100.degree. C. for 18
hours. Liberated GlcN was quantitated using the acetyl amino sugar
assay (see, e.g., J. L. Strominger, J. T. Park, R. E. Thompson, J.
Biol. Chem. 234, 3263 (1959); herein incorporated by reference in
its entirety). KDO content was measured using the LPS-adapted
thiobarbituric acid assay (see, e.g., Y. D. Karkhanis, J. Y.
Zeltner, J. J. Jackson, D. J. Carlo, Anal. Biochem. 85, 595 (1978);
herein incorporated by reference in its entirety), while the amount
of heptose was estimated using the modified cysteine-sulfuric acid
assay (see, e.g., M. J. Osborn, Proc. Natl. Acad. Sci. U.S.A. 50,
499 (1963); herein incorporated by reference in its entirety).
Example VII
[0098] This example describes SDS-PAGE Electrophoresis and Lipid
A/ECA Immunoblots for experiments involving KPM22 and TCM15. The
LPS profiles of whole-cell lysates were analyzed by SDS-PAGE
according to the method of Hitchcock and Brown (see, e.g., P. J.
Hitchcock, T. M. Brown, J. Bacteriol. 154, 269 (1983); herein
incorporated by reference in its entirety). Briefly, colonies of
each sample were scraped from LB agar plates and suspended to equal
turbidities in Dulbecco phosphate-buffered saline. Washed cell
pellets were collected by centrifugation, lysis buffer (50 .mu.l
62.5 mM Tris-HCl, pH 6.8, 2% SDS, 5% 2-mercaptoethanol, 10%
glycerol, 0.002% bromphenolblue) was added, and samples were heated
in a boiling water bath for 10 minutes. Proteinase K (25 .mu.g, 10
.mu.l of 2.5 mg/ml) was added to each whole cell lysate and
incubated for 1 hour at 56.degree. C. Identical volumes were loaded
onto 13% SDS-PAGE gels and then run at constant current (15 mA).
Gels were silver stained for LPS analysis (see, e.g., P. J.
Hitchcock, T. M. Brown, J. Bacteriol. 154, 269 (1983); herein
incorporated by reference in its entirety), or were
electrotransferred at constant voltage (26 V) from gels to
polyvinylidene difluoride membranes using Tris-glycine buffer (20
mM Tris, 150 mM glycine, pH 8.3, 20% methanol) as described (see,
e.g., H. Towbin, T. Staehelin, J. Gordon, Proc. Natl. Acad. Sci.
U.S.A. 76, 4350 (1979); herein incorporated by reference in its
entirety). Prior to incubation of the blots with mAb A6, which
recognizes the nonglycosylated 1,4'-bisphosphorylated
.beta.1,6-linked GlcN disaccharide backbone of lipid A (see, e.g.,
L. Brade, O. Hoist, H. Brade, Infect. Immun. 61, 4514 (1993);
herein incorporated by reference in its entirety), the membranes
were boiled for 1 hour in 1% acetic acid to cleave the .alpha.
2,6-KDO-GlcN linkage before being developed by the usual
immuno-procedure (see, e.g., R. Pantophlet, L. Brade, H. Brade, J.
Endotoxin Res. 4, 89 (1997); herein incorporated by reference in
its entirety). Authentic synthetic lipid IVa (compound 406) was
used as a standard (see, e.g., M. Imoto et al., Bull. Chem. Soc.
Japan 60, 2197 (1987); herein incorporated by reference in its
entirety). Enterobacterial common antigen (ECA) immunoblot was
probed using mAb 898 (see, e.g., H. Peters et al., Infect. Immun.
50, 459 (1985); herein incorporated by reference in its entirety).
Immunoblots were incubated with alkaline phosphatase-conjugated
goat anti-mouse IgG (H+L) and developed in the presence of
nitroblue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate
substrate.
Example VIII
[0099] This example describes Electrospray Ionization Fourier
Transform Ion Cyclotron Mass Spectrometry (ESI FT-ICR MS) used in
experiments conducted during the course of the present invention.
ESI FT-ICR MS was performed in the negative ion mode using an APEX
II-Instrument (Bruker Daltonics, Billerica, USA) equipped with a 7
Tesla actively shielded magnet and an Apollo ion source. Mass
spectra were acquired using standard experimental sequences as
provided by the manufacturer. Samples were dissolved at a
concentration of .about.10 ng/.mu.l in a 50:50:0.001 (v/v/v)
mixture of 2-propanol, water, and triethylamine and sprayed at a
flow rate of 2 .mu.l/min. Capillary entrance voltage was set to 3.8
kV, and dry gas temperature to 150.degree. C. The spectra were
charge deconvoluted and mass numbers given refer to neutral
monoisotopic masses. Peak assignments were interpreted on the basis
of the previously published detailed structural analysis of LPS
from E. coli K-12 strain W3100 (see, e.g., S. Muller-Loennies, B.
Lindner, H. Brade, J. Biol. Chem. 278, 34090 (2003); herein
incorporated by reference in its entirety). Only the most abundant
ions are summarized in Table 9 as there were some molecular species
with overlapping isotopic peaks that could not be identified
unequivocally.
TABLE-US-00009 TABLE 9 ESI FT-ICR MS Peak List Obs. Mass .sub.a, b
Calc. Mass .sub.a Chemical Composition .sub.c Label .sub.c 703.52
703.517 phospholipid, PE (33:1) (e.g. 1* 16:0 + 1*17:1) PE 1178.67
1178.661 2*GlcN, 2*P, 3* (OH)-14:0 LA.sub.tri 1360.83 1360.828
2*GlcN, 2*P, 3* (OH)-14:0, 1* 12:0 LA.sub.tetra 1404.86 1404.854
2*GlcN, 2*P, 4* (OH)-14:0 Lipid IVa 1527.87 1527.863 2*GlcN, 2*P,
4* (OH)-14:0, 1* P-EtN 1587.02 1587.021 2*GlcN, 2*P, 4* (OH)-14:0,
1*12:0 LA.sub.penta 1797.22 1797.219 2*GlcN, 2*P, 4* (OH)-14:0,
1*12:0, 1* 14:0 LA.sub.hexa 3813.75 3813.734 LA.sub.hexa + 1*Gal,
3*Glc, 4*Hep, 2*KDO, 2*P Glycoform I 3893.72 3893.700 LA.sub.hexa +
1*Gal, 3*Glc, 4*Hep, 2*KDO, 3*P Glycoform I 3915.71 3915.699
LA.sub.hexa + 1*Gal, 3*Glc, 4*Hep, 2*KDO, 3*P, +1*Na Glycoform I
3995.63 3995.653 LA.sub.hexa + 1*Gal, 3*Glc, 4*Hep, 2*KDO, 4*P,
+1*Na Glycoform I 4017.66 4017.645 LA.sub.hexa + 1*Gal, 3*Glc,
4*Hep, 2*KDO, 4*P, +2*Na Glycoform I 4038.69 4038.697 LA.sub.hexa +
1*Gal, 3*Glc, 4*Hep, 2*KDO, 5*P, 1*P-EtN + 1*Na Glycoform I 3927.68
3927.689 LA.sub.hexa + 1*Gal, 2*Glc, 3*Hep, 1*Rha, 3*KDO, 3*P +
1*Na Glycoform IV 4007.67 4007.655 LA.sub.hexa + 1*Gal, 2*Glc,
3*Hep, 1*Rha, 3*KDO, 4*P + 1*Na Glycoform IV 4029.64 4029.654
LA.sub.hexa + 1*Gal, 2*Glc, 3*Hep, 1*Rha, 3*KDO, 4*P + 2*Na
Glycoform IV 4050.70 4050.698 LA.sub.hexa + 1*Gal, 2*Glc, 3*Hep,
1*Rha, 3*KDO, 3P + 1*P-EtN, +1*Na Glycoform IV 4140.67 4140.722
LA.sub.hexa + 1*GlcNAc, 1*Gal, 3*Glc, 4*Hep, 2*KDO, 3*P, +2*Na
Glycoform II 4198.74 4198.735 LA.sub.hexa + 1*GlcNAc, 1*Gal, 3*Glc,
4*Hep, 2*KDO, 4*P, +1*Na Glycoform II 4220.73 4220.724 LA.sub.hexa
+ 1*GlcNAc, 1*Gal, 3*Glc, 4*Hep, 2*KDO, 4*P, +2*Na Glycoform II
4300.68 4300.698 LA.sub.hexa + 1*GlcNAc, 1*Gal, 3*Glc, 4*Hep,
2*KDO, 5*P, +2*Na Glycoform II 4241.81 4241.778 LA.sub.hexa +
1*GlcNAc, 1*Gal, 3*Glc, 4*Hep, 2*KDO, 3*P, 1*P-EtN + 1*Na Glycoform
II 4321.73 4321.745 LA.sub.hexa + 1*GlcNAc, 1*Gal, 3*Glc, 4*Hep,
2*KDO, 4*P, 1*P-EtN + 1*Na Glycoform II 4343.74 4343.734
LA.sub.hexa + 1*GlcNAc, 1*Gal, 3*Glc, 4*Hep, 2*KDO, 4*P, 1*P-EtN +
2*Na Glycoform II .sub.a Mass numbers given refer to the
monoisotopic masses of the neutral molecules which were deduced
from the negative ion ESI FT-ICR mass spectra of the LPS fraction
after charge deconvolution. .sub.b Bold type peaks are labeled on
FIG. 4 in text. .sub.c Abbreviations: PE--phosphatidylethanolamine;
GlcN--D-glucosamine; P--phosphate; P-EtN--phosphoethanolamine;
Gal--D-galactose; Glc--D-glucose; Hep--L-glycero-D-manno-heptose;
KDO--2-keto 3-deoxy-D-manno-octulosonate; Rha--rhamnose;
GlcNAc--N-acetyl D-glucosamine; LA.sub.tri, .sub.tetra, .sub.penta,
.sub.hexa--acylation state of lipid A.
Example IX
[0100] This example describes the quantitation of colonic acid in
experiments involving KPM22 and TCM15. Colanic acid was estimated
by a modification of the method reported by Kang and Markovitz
(see, e.g., S. Kang, A. Markovitz, J. Bacteriol. 93, 584 (1967);
herein incorporated by reference in its entirety). Colonies from LB
agar plates were scraped and resuspended in 10 mL of distilled
water to identical turbidities (OD.sub.600nm), immersed in a
boiling water bath for 15 minutes to release extracellular
polysaccharides, and clarified by centrifugation (10 min,
8000.times.g). The supernatant was assayed for methylpentose
(L-fucose), a constituent of colanic acid, by a specific
colorimetric reaction using authentic L-fucose as standard (see,
e.g., Z. Dische, L. B. Shettles, J. Biol. Chem. 175, 595 (1948);
herein incorporated by reference in its entirety). A mucoid isolate
of BW30270 was included as a positive control.
Example X
[0101] This example describes Transmission Electron Microscopy
(TEM) used in experiments conducted during the course of the
present invention. Cultures of cells growing in early log phase in
LB media at 37.degree. C. were fixed in 2% osmium tetroxide for 90
minutes at room temperature. Cells were washed 3 times with
distilled water before being incubated with 2% uranyl acetate
contrast solution for 1 hour at room temperature. Cells were once
again washed 3 times with distilled water, and then dehydrated by a
series of increasing ethanol washes (30%, 50%, 70%, 90% and abs.
ethanol for 15 min each at room temperature). Dehydrated cells were
twice bathed in propylene oxide for 15 min each at room
temperature, followed by impregnation in a propylene oxide/Epon
mixture (1:1, v/v) by overnight incubation at 4.degree. C.
Polymerization was then performed overnight at 60.degree. C. The
block was sliced into ultra-thin sections (80-100 nm), placed on
grids, and contrasted in a lead citrate solution. Images were
acquired on a Philips CM-100 transmission electron microscope
equipped with an automated compustage and Kodak 1.6 Megaplus
high-resolution digital camera.
Example XI
[0102] This example describes Minimum Inhibitory Concentration
(MIC) Determinations used in experiments conducted during the
course of the present invention. The antibiotics used were from
Sigma with the exception of cephaloridine, which was obtained from
MicroSource Discovery Systems. Antibiotics were chosen based on
their varying mode of action and entry into the cell. The MICs of
all antibiotics and drugs studied were measured in LB media using
the standard serial microdilution method as described (see, e.g.,
R. Vuorio, M. Vaara, Antimicrob. Agents Chemother. 36, 826 (1992);
herein incorporated by reference in its entirety). Colonies from LB
agar plate were scraped and suspended in media (.about.10.sup.4
cells per mL) with varying concentrations of antibiotics. Cultures
were incubated with shaking (.about.200 rpm) at 37.degree. C. for
18 hours at which point growth was scored by visual inspection. The
reported MIC values reported were interpreted as the lowest
concentration of a drug that completely inhibited growth.
Example XII
[0103] This example describes a Human TNF.alpha. Cytokine Assay
used in experiments conducted during the course of the present
invention. The tumor necrosis factor (TNF) .alpha.
cytokine-inducing capabilities of LPS preparations isolated as
described above on human mononuclear cells (MNCs) were measured
using an enzyme-linked immunoabsorbent assay (ELISA). LPS samples
were resuspended in Hanks' Balanced Salt Solution by vigorous
vortexing and aged overnight at 4.degree. C. before being subjected
to sonication/vortexing immediately prior to use. Heparinized blood
drawn from healthy donors was directly mixed with an equal volume
of Hanks' balanced salt solution and isolated by differential
gradient centrifugation using the Leucosep system with Lymphoprep
media from Greiner Bio-One according to the manufacturer's
instructions. MNCs were washed twice with RPMI 1640 (3 mM
L-glutamine, 100 units/mL penicillin, 100 .mu.g/mL streptomycin)
and were transferred to 96-well culture plates (7.5.times.10.sup.5
cells/well). Stimulation of MNCs was performed as previously
described (see, e.g., M. Mueller et al., J. Biol. Chem. 279, 26307
(2004); herein incorporated by reference in its entirety), and the
supernatant was stored at 4.degree. C. overnight. The hTNF.alpha.
production was determined by an ELISA as described by Copeland, et
al. (see, e.g., S. Copeland, H. S. Warren, S. F. Lowry, S. E.
Calvano, D. Remick, Clin. Diagn. Lab. Immunol. 12, 60 (2005);
herein incorporated by reference in its entirety). Data was
collected in duplicate in three separate experiments with a
representative data set reported in FIG. 7.
Example XIII
[0104] This Example describes the construction of the KPM22 Cosmid
Library. A cosmid library was constructed from KPM22 genomic DNA by
partial digestion with Sau3A, ligation into SuperCos1, and packaged
using the Gigapack III XL packaging extract as described by the
manufacturer (Stratagene). TCM15 was prepared for phage infection
by growth in LB media containing 0.2% (w/v) maltose and 10 mM MgSO4
as well as additionally supplemented with A5P and G6P.
Transformants were selected for growth on LB plates lacking
supplemental sugar phosphates, along with the cosmid vector
antibiotic resistance marker (100 .mu.g mL-1 Amp). Cosmids were
subcloned by partial Sau3A digestion followed by ligation into the
BamHI site of the medium-copy number pMBL19 cloning vector (see,
e.g., Nakano, Y., et al., Gene 162, 157-158 (1995); herein
incorporated by reference in its entirety).
Example XIV
[0105] This example describes the materials used in experiments
involving the gutQ gene. Primers were synthesized by Invitrogen.
Genomic E. coli K-12 MG1655 DNA was purchased from American Type
Culture Collection (ATCC 700926D). The Promega Wizard DNA
purification kit was utilized for plasmid purification. Chemically
competent E. coli XL1-Blue (Stratagene) and E. coli BL21(DE3)
(Novagen) were used to host plasmid and protein expression,
respectively. Strain BW30270 (rph.sup.+, fnr.sup.+), a derivative
of E. coli K-12 MG1655, was obtained from the E. coli Genetic Stock
Center (CGSC#7925). Sugar and sugar phosphates were purchased from
Sigma-Aldrich, except for D-glucitol 6-phosphate which was prepared
by the sodium tetraborohydride reduction of the D-glucose
6-phosphate (see, e.g., Bigham, E. C., et al., (1984) J Med Chem
27, 717-26; herein incorporated by reference in its entirety),
purified by anion exchange chromatography (AG MP-1, Bio-Rad), and
desalted by gel filtration (Bio-Gel P-2, Bio-Rad). Protein
concentrations were determined using the Bio-Rad Protein Assay
Reagent with BSA as the standard.
Example XV
[0106] This example describes the cloning, overexpression, and
purification of the gutQ gene. The gutQ gene was amplified using
standard PCR methodology with the F-R primer pair (Table 10),
restricted with Nde I and BamH I, and directly ligated into
similarly restricted linearized pT7-7 expression vector that had
been treated with calf alkaline phosphatase.
TABLE-US-00010 TABLE 10 Nucleotide Sequences of Primers Primer
Sequence (5'-3') F (SEQ ID NO: 1)
GGTGCTAGAATTCATATGAGTGAAGCACTACTGAACG .sup.a R (SEQ ID NO: 2)
GAATTCGGATCCAAGTTAAATAATCCCGGCCTGATAGAAATCCTGC .sup.b GQF (SEQ ID
NO: 3) GATCGATGTGATCATAACCGGAGAGAGCAATGAGTGAAGCGTGTAGGCTGGAGCT
GCTTC GQR (SEQ ID NO: 4)
CGGCTGGCGAAACGTCTGGGATTGAAGGATTAAATAATCCATTCCGGGGATCCGT CGACC KDF
(SEQ ID NO: 5)
GCGATGTTGTACTGGTTATCGCCAATACTCGTTGAATAACTGGAAACGCATTGTGT
AGGCTGGAGCTGCTTCG KDR (SEQ ID NO: 6)
GCGACGCACCTGCTTTGCTCATTGTTGTTTATCCTTGAATCTTTACACTACGGATAT
GAATATCCTCCTTAG GDF (SEQ ID NO: 7) ATGAATCAGGTTGCCGTTGTC GDR (SEQ
ID NO: 8) CACCAGATTCACCTGTAGCG .sup.a Nde I site underlined. .sup.b
BamH I site underlined.
The ligation mixtures were used to transform chemically competent
E. coli XL1-Blue cells, and transformants harboring the pT7-gutQ
plasmid were identified by restriction analysis and DNA sequencing.
E. coli BL21(DE3) cells were transformed with plasmid, rechecked by
restriction analysis, and stored at -80.degree. C. E. coli
BL21(DE3)/pT7-gutQ cells were grown in 2.times.YT medium containing
ampicillin (100 mg/L) at 37.degree. C. with shaking (250 rpm). Once
the culture reached the mid-logarithmic growth phase
(OD.sub.600.about.0.7-0.9), the culture was allowed to cool to
18.degree. C. before being induced with
isopropyl-.beta.-D-thiogalactoside at a final concentration of 0.4
mM. After 16 hours of growth at 18.degree. C., the cells were
harvested by centrifugation (6,500.times.g, 15 min, 4.degree. C.).
The cell pellet was suspended in 20 mL of buffer A (20 mM Tris-HCl;
1 mM DL-dithiothreitol (DTT); pH=8.0) and then sonicated on ice
(5.times.30 seconds; 2 minute pauses between pulses). Cellular
debris was removed by centrifugation (29,000.times.g, 40 min,
4.degree. C.) and the supernatant was filtered through a 0.22 .mu.M
Millex.RTM. filter. The solution was loaded onto a Hi Load.TM.
(16/10) Q Sepharose fast flow column that had been pre-equilibrated
with buffer A. Protein was eluted using a 0-900 mM gradient of NaCl
in buffer A over 120 minutes. Fractions containing primarily
recombinant protein (.about.33 kDa) as determined by SDS-PAGE were
pooled. A saturated solution of ammonium sulfate was slowly added
with stirring at room temperature until 15% saturation was reached.
The solution was clarified by centrifugation (29,000.times.g, 30
min, 22.degree. C.), and the supernatant was bought to 30%
saturation. The protein pellet was collected by centrifugation
(29,000.times.g, 30 min, 22.degree. C.), resuspended in buffer A,
and dialyzed against 2 L of buffer A overnight at 4.degree. C.
Preparations were greater than .about.95% homogeneous as judged by
SDS-PAGE with a yield of 180 mg gutQ/L of cell culture.
Example XVI
[0107] This example describes gel electrophoresis methods used in
experiments conducted during the course of the present invention.
SDS-PAGE was performed on protein samples (.about.5-10 .mu.g) under
reducing conditions on a 12% polyacrylamide gel and stained with
0.25% Coomassie brilliant blue R250 solutions. LPS samples were
analyzed by tricine-SDS PAGE (stacking 4% T, 3% C; separating 16.5%
T, 6% C) (see, e.g., Lesse, A. J., et al., (1990) J Immunol Methods
126, 109-17; herein incorporated by reference in its entirety), and
visualized by silver staining (see, e.g., Hitchcock, P. J. &
Brown, T. M. (1983) J Bacteriol 154, 269-77; herein incorporated by
reference in its entirety).
Example XVII
[0108] This example describes enzyme assays used in experiments
conducted during the course of the present invention. API activity
was determined by the discontinuous cysteine-carbazole colorimetric
assay (see, e.g., Dische, Z., Borenfreund, E. (1951) J Biol Chem
192, 583-587; herein incorporated by reference in its entirety)
adapted to 96-well microplates as previously described (see, e.g.,
Meredith, T. C. & Woodard, R. W. (2003) J Biol Chem 278,
32771-7; herein incorporated by reference in its entirety). All
plates contained internal Ru5P standards and appropriate A5P
controls in triplicate. One unit of enzyme activity is defined as
the conversion of 1 .mu.mol of sugar phosphate per minute at
37.degree. C.
[0109] A second more sensitive coupled assay was developed to
determine API activity in crude cell extracts that utilized
3-deoxy-D-manno-octulosonate 8-phosphate synthase (kdsA) from
Arabidopsis thaliana. This enzyme catalyzes the irreversible
stereospecific condensation of A5P and PEP to form
3-deoxy-D-manno-octulosonate 8-phosphate (KDO8P) and inorganic
phosphate. Reaction mixtures containing 5 .mu.L of a purified kdsA
solution (3 mg/mL; 10 U/mg), 10 mM Ru5P, 6 mM PEP, and 1 mM EDTA in
40 uL of 100 mM Tris-HCl (pH=8.25) was incubated for 3 minutes at
37.degree. C. The reaction was initiated by the addition of 10
.mu.L of cell extract. After 5 minutes, reactions were quenched by
adding 50 .mu.L of 10% (w/v) trichloroacetic acid. KDO8P produced
was determined by the Aminoff periodate-thiobarbituric acid assay
(see, e.g., Sheflyan, G. Y., et al., (1998) Journal of the American
Chemical Society 120, 11027-11032; herein incorporated by reference
in its entirety). Under these conditions, kdsA was not rate
limiting in the formation of KDO8P.
[0110] D-Glucitol 6-phosphate dehydrogenase (gutD) activity was
measured using a continuous spectrophotometric assay by monitoring
the formation of NADH at 340 nm. Enzyme solutions (100 mM Tris-HCl,
pH=8.7, 5 mM NAD.sup.+) were preincubated at 25.degree. C. for 2
minutes before the reactions were initiated by the addition of
D-glucitol 6-phosphate at a final concentration of 20 mM.
Example XVIII
[0111] This example describes the characterization of gutQ. The
characterization of gutQ was similarly performed according to
methods reported for ksdD (see, e.g., Meredith, T. C. &
Woodard, R. W. (2003) J Biol Chem 278, 32771-7; herein incorporated
by reference in its entirety). Briefly, for substrate specificity
enzyme samples were diluted in 100 mM Trizma-HCl buffer (pH=8.25)
and assayed by initiating the reaction with substrate (15 nM gutQ,
10 mM sugar, 1 mM EDTA). After 10 minutes at 37.degree. C.,
reactions containing the potential alternate substrates
D-arabinose, D-ribose 5-phosphate, D-glucose 6-phosphate (G6P),
D-glucose 1-phosphate, D-glucosamine 6-phosphate, or D-mannose
6-phosphate were quenched and the presence of ketose was
determined. Product appearance for D/L-glyceraldehyde 3-phosphate,
D-erythrose 4-phosphate, and D-fructose 6-phosphate was assayed by
.sup.31P NMR. Kinetic constants were determined at 37.degree. C.
using the discontinuous microplate assay and were initiated by the
addition of substrate. Concentrations typically ranged from
0.2K.sub.m to 10K.sub.m. After 2 minutes, the reactions (50 mM
Tris-HCl at pH=8.25, 5 nM gutQ, 1 mM EDTA) were quenched, at which
point approximately less than 10% of substrate had been consumed.
Initial rates (v.sub.0) were determined in triplicate and fit to
the standard Michaelis-Menten equation using nonlinear
least-squares regression to determine K.sub.m and k.sub.cat values
for both the formation and disappearance of Ru5P. The equilibrium
constant (K.sub.eq) was determined using .sup.31P NMR as described
for kdsD (see, e.g., Meredith, T. C. & Woodard, R. W. (2003) J
Biol Chem 278, 32771-7; herein incorporated by reference in its
entirety). The pH optimum of gutQ was determined by diluting the
enzyme in BTP buffer solutions of varying pH values (pH=6.25 to 10,
adjusted at 37.degree. C.). Activity was measured as outlined above
in triplicate with a reaction time of 3 minutes (100 mM BTP, 15 nM
gutQ, 10 mM A5P, 1 mM EDTA). Enzyme samples of gutQ as isolated
were diluted in 100 mM Trizma-HCl buffer (pH=8.25) and incubated
with various divalent metals or EDTA for 30 minutes at 4.degree. C.
Remaining activity was then assayed at 37.degree. C. under
saturating substrate conditions in triplicate with a 3 minute
reaction time (15 nM gutQ, 10 mM A5P, 10 .mu.M metal or EDTA).
Example XIX
[0112] This example describes E. coli strain construction and
growth conditions for experiments involving gutQ. E. coli strain
BW30270 was used as the host for chromosomal gutQ and kdsD gene
disruptions using the phage .lamda. Red recombinase system
according to the procedure of Datsenko and Wanner (see, e.g.,
Datsenko, K. A. & Wanner, B. L. (2000) Proc Natl Acad Sci USA
97, 6640-5; herein incorporated by reference in its entirety).
Kanamycin and chloramphenicol were used at 50 .mu.g/mL. Primer
pairs GQF-GQR and KDF-KDR with either pKD13(kan) or pKD3(cat) as
template, respectively, were used to construct
BW30270(.DELTA.gutQ::kan) and BW30270(.DELTA.kdsD::cat) and are
listed in Table 10. The resistance markers were then excised using
the FLP recombinase system as described (see, e.g., Datsenko, K. A.
& Wanner, B. L. (2000) Proc Natl Acad Sci USA 97, 6640-5;
herein incorporated by reference in its entirety).
BW30270(.DELTA.gutQ .DELTA.kdsD) was similarly constructed from
BW30270(.DELTA.kdsD) using the GQF-GQR PCR product insert except
media and plates were supplemented at all times with G6P (10 .mu.M)
and A5P (15 .mu.M) for subsequent manipulations performed after
electrotransformation. All strains used were colony purified,
tested for loss of all antibiotic resistances, and the relevant
locus sequenced to confirm expected deletion site.
[0113] Cultures were grown in either M9 minimal media (26) or MOPS
minimal media (see, e.g., Neidhardt, F. C., Bloch, P. L. &
Smith, D. F. (1974) J Bacteriol 119, 736-47; herein incorporated by
reference in its entirety) supplemented with thiamine (1 .mu.g/mL)
and the indicated carbon source(s) at 37.degree. C. with shaking
(250 rpm). BW30270(.DELTA.gutQ .DELTA.kdsD) cultures were
additionally supplemented with G6P (10 .mu.M) and A5P (5-50 .mu.M).
Ampicillin (100 .mu.g/mL) was added to those strains carrying the
pT7-7 (Amp.sup.R) plasmid.
Example XX
[0114] This example describes the preparation of cellular extracts
for enzymatic assays, LPS analysis, and RT-PCR. Overnight cultures
were grown in minimal media with glycerol (0.2%) as the sole carbon
source and the indicated supplements. Cultures were diluted (1:20
v/v) into fresh minimal media and shaken for two hours at
37.degree. C. to allow the bacteria to return to exponential
growth. Cultures of BW30270(.DELTA.gutQ .DELTA.kdsD) were
preinduced during this period in order to upregulate the hexose
phosphate transport system (uhp) by adding A5P (5 .mu.M) and G6P
(10 .mu.M). Cells were pelleted by centrifugation to remove traces
of G6P (6,500.times.g, 5 min, 22.degree. C.), and then innoculated
into fresh media. Where indicated, 10 mM D-glucitol was added to
the cultures, and growth continued for an additional four to six
hours to allow for upregulation of the gut operon at which point
culture all cultures were in early to mid log growth. Cells were
harvested by centrifugation (6,500.times.g, 5 min, 4.degree. C.).
Fractions to be assayed for API and gutD activity were twice washed
with a chilled 1% NaCl solution, and then resuspended in buffer (20
mM Tris-HCl, 1 mM DTT, pH=8.0). Cells were disrupted by sonication,
clarified by centrifugation (29,000.times.g, 20 min, 4.degree. C.),
and frozen. Samples for LPS analysis were washed twice with
Dulbecco phosphate-buffered saline, the pellets resuspended in
lysis buffer (200 mM Tris (pH=6.8), 2% SDS, 4% 2-mercaptoethanol,
10% glycerol). Equal numbers of cells based on OD.sub.600 nm were
processed according to the method of Hitchcock and Brown (see,
e.g., Hitchcock, P. J. & Brown, T. M. (1983) J Bacteriol 154,
269-77; herein incorporated by reference in its entirety). Cell
pellets to be analyzed for RNA were rapidly resuspended in Max
Bacterial Enhancement reagent and extracted using TRIzol
(Invitrogen) according to the manufacturer's protocol. RNA samples
were further purified by digestion with RNase-free DNase and
isolated using the RNeasy mini kit (Qiagen). The quality of the RNA
was inspected by agarose electrophoresis and quantified by UV
absorbance at 260 nm. Qualitative RT-PCR was performed using the
Superscript II One-Step RT-PCR system (Invitrogen) as directed with
1 pg of purified total RNA as template and GDF-GDR primers (0.2
.mu.M) to amplify the first 342 base pairs of the gutD gene.
Example XXI
[0115] This example describes the purification and characterization
of gutQ. Purification to homogeneity was achieved in two steps
using Q-Sepharose anion exchange chromatography followed by
ammonium sulfate precipitation. The protein appeared as a single,
sharp high molecular weight band by SDS-PAGE (.about.33 kDa) and
the specific activity was 329 U/mg. The biochemical properties of
gutQ were determined to be similar to those of kdsD. The kinetic
parameters, pH optima, lack of cofactor requirement, and quaternary
structure were all comparable. Monosaccharides that share common
functionalities with A5P were tested as potential alternative
substrates for gutQ. In the cysteine-carbazole colorimetric assay,
2-ketohexoses and 2-ketopentoses form purple-red chromophores which
absorb light at 540 nm (see, e.g., Dische, Z., Borenfreund, E.
(1951) J Biol Chem 192, 583-587; herein incorporated by reference
in its entirety). The conversion of aldose to ketose can be
observed by measuring the increase in the ratio of absorbance at
A.sup.540 nm of sample to control. None of the sugars tested were
converted to their respective ketose forms. The short chain
phosphorylated aldoses D/L-glyceraldehyde 3-phosphate and
D-erythrose 4-phosphate as well as D-fructose 6-phosphate served as
alternate substrates as determined by .sup.31P-NMR. Within the
limits of detection, gutQ was shown to be a specific phosphosugar
aldol-ketol isomerase for A5P and Ru5P.
Example XXII
[0116] This example demonstrates that gutQ is capable of sustaining
lipopolysaccharide biosynthesis. In order to assess the ability of
gutQ to function as an API in vivo, BW30270(.DELTA.gutQ) and to
BW30270(.DELTA.kdsD) were constructed using the .lamda. Red
(.gamma., .beta., exo) homologous recombination system (see, e.g.,
Datsenko, K. A. & Wanner, B. L. (2000) Proc Natl Acad Sci USA
97, 6640-5; herein incorporated by reference in its entirety).
Neither mutation was lethal, signaling the presence of other API
encoding genes that can provide sufficient quantities of A5P needed
for essential LPS biosynthesis. LPS gels indicated nearly equal
amounts of the wild-type K-12 LPS core regardless of whether the
gut operon was induced (see, FIG. 8A), suggesting A5P synthesis was
not rate limiting in any of the strains under these growth
conditions. Basal levels of gutQ in BW30270(.DELTA.kdsD) were
adequate to supply enough A5P to sustain viability and elaborate a
functional LPS layer, strongly suggesting that gutQ functions as an
API inside the cell.
Example XXIII
[0117] This example describes LPS biosynthesis in .DELTA.API strain
BW30270(.DELTA.gutQ .DELTA.kdsD). Both gutQ and kdsD genes in
BW30270 were disrupted by utilizing the G6P inducible hexose
phosphate transporter (uhp) to supply exogenous A5P. A5P is a high
affinity, though non-inducible, substrate of the hexose phosphate
transport system (uhp) (see, e.g., Kadner, R. J., Murphy, G. P.
& Stephens, C. M. (1992) J Gen Microbiol 138 (Pt 10), 2007-14;
Rick, P. D. & Osborn, M. J. (1972) Proc Natl Acad Sci USA 69,
3756-60; Eidels, L., Rick, P. D., Stimler, N. P. & Osborn, M.
J. (1974) J Bacteriol 119, 138-43; each herein incorporated by
reference in their entireties). MOPS-minimal media, which has a low
concentration of inorganic phosphate (1.3 mM), was used to prevent
inhibition of uhp mediated transport by inorganic phosphate (see,
e.g., Shattuck-Eidens, D. M. & Kadner, R. J. (1981) J Bacteriol
148, 203-9; herein incorporated by reference in its entirety). The
natural substrate of the uhp transporter G6P was required for
efficient induction and transport of A5P into the cells. A5P or G6P
alone was unable to restore growth as there was no detectable
growth in the time course of study unless both A5P and G6P were
included in the media (see, FIG. 9A). Thus, gutQ and kdsD were the
sole intracellular sources of A5P for KDO synthesis. Cultures were
supplemented with A5P in the media in order to enable
lipopolysaccharide biosynthesis. By using overnight cultures from
which A5P has been exhausted from the media as the innoculant and
extended incubation times, the amount of mature LPS being
synthesized in BW30270(.DELTA.gutQ .DELTA.kdsD) was dependent on
the amount of A5P included in the media (FIG. 9B).
Example XXIV
[0118] This example describes expression of the gut operon.
BW30270, BW30270(.DELTA.gutQ), and BW30270(pT7-gutQ) were grown in
M9 minimal media containing dual carbon sources, D-glucose and
D-glucitol. All three strains grew at nearly identical rates, and
exhibited the characteristic unusually long diauxic lag time of
approximately 40 minutes after D-glucose had been exhausted from
the media (see, e.g., Lengeler, J. & Lin, E. C. (1972) J
Bacteriol 112, 840-8; herein incorporated by reference in its
entirety). Under these conditions, induction was not influenced by
gutQ. Strains BW30270, BW30270(.DELTA.gutQ), and
BW30270(.DELTA.kdsD) were grown in M9 minimal media with glycerol
as the carbon source. Glycerol is a class B carbon source and does
not cause significant catabolite repression (see, e.g., Lengeler,
J. W. (1986) Methods Enzymol 125, 473-85; herein incorporated by
reference in its entirety), facilitating induction of the gut
operon by D-glucitol through elevated cAMP levels. Total API (kdsD
and/or gutQ) and gutD specific activities were measured in all
three strains (Table 11).
TABLE-US-00011 TABLE 11 Specific activity of gutD and API in cell
extracts E. coli gutD Strains .sup.a Glucitol .sup.b Activity
.sup.c API Activity .sup.c, d WT -- >1 14 .+-. 3 + 242 .+-. 14
48 .+-. 5 .DELTA.gutQ -- >1 13 .+-. 3 + 374 .+-. 13 15 .+-. 2
.DELTA.kdsD -- >1 2 .+-. 1 + 581 .+-. 48 46 .+-. 5 pT7-gutQ --
>1 2573 .+-. 78 + 323 .+-. 28 2457 .+-. 117 .sup.a Strains were
grown in M9 minimal media with 0.2% glycerol as carbon source.
.sup.b D-glucitol was added at 10 mM to the cultures where
indicated (+) 4 hours before harvesting. .sup.c Specific activity
reported in nmoles/min/mg. .sup.d Values include kdsD and/or gutQ
activity.
The gut operons of BW30270(.DELTA.gutQ) and BW30270(.DELTA.kdsD)
remained inducible, with only a 2-fold difference in degree of
induction as estimated by gutD activity when compared to the parent
BW30270 strain. Total API activity levels increased in both BW30270
and BW30270(.DELTA.kdsD) when D-glucitol was added to the media,
indicating gutQ is upregulated along with gutD. There was no change
in observed API levels in BW30270(.DELTA.gutQ) upon the addition of
D-glucitol though the strain remains capable of upregulating gutD.
A majority of API activity was attributable to kdsD in media
lacking D-glucitol, confirming the identification of kdsD as the
constitutively expressed LPS biosynthetic enzyme. BW30270(pT7-gutQ)
was used to investigate the effect of elevated API levels on the
gut operon (Table 10). Basal levels of API levels were increased
.about.250-fold in BW30270(pT7-gutQ) though no appreciable
difference was observed in gutD levels as the operon remained
repressed unless D-glucitol was provided in the media.
Example XXV
[0119] This example shows that A5P is important for upregulation of
the gut operon. As no difference was observed in the regulation
when a single API gene was disrupted, failure to directly observe
the phenotype may have been due to suppression by the second copy
of API. The inducibility of the gut operon was investigated in
BW30270(.DELTA.gutQ .DELTA.kdsD). Overnight cultures were grown in
MOPS minimal media (0.2% glycerol, 15 .mu.M A5P, 10 .mu.M G6P), and
diluted into fresh media (0.2% glycerol, 5 .mu.M A5P, 10 .mu.M G6P)
to return the cells to exponential growth. After 2 hours of
shaking, the cells were harvested and used to innoculate media
containing only glycerol and A5P. Since the cells were preinduced
for the uhp transporter genes, no G6P was added. Two concentrations
of A5P (5 and 50 .mu.M) were chosen so that differences in the
level of LPS and growth rates were minimal under the time course of
study. At 50 .mu.M A5P, gutD remained inducible to near wildtype
levels (Table 12).
TABLE-US-00012 TABLE 12 Specific activity of gutD and gutQ.sup.321
in .DELTA.API cell extracts E. coli Strains .sup.a glucitol .sup.b
A5P (.mu.M) gutD Activity .sup.c gutQ Activity .sup.c .DELTA.gutQ
.DELTA.kdsD -- 50 >1 N.D. .sup.d + 50 278 .+-. 33 N.D. .sup.d --
5 >1 N.D. .sup.d + 5 9.8 .+-. 1 N.D. .sup.d .DELTA.gutQ
.DELTA.kdsD -- 5 >1 1366 .+-. 180 pT7-gutQ + 5 356 .+-. 27 976
.+-. 101 .sup.a Strains were grown in MOPS minimal media with 0.2%
glycerol and preinduced with 10 .mu.M G6P/5 .mu.M A5P .sup.b
D-glucitol was added at 10 mM to the cultures where indicated (+) 4
hours before harvesting. .sup.c Specific activity reported in
nmoles/min/mg. .sup.d N.D. = no activity detected.
The gutQ protein product itself was not necessary for expression.
When the A5P concentration was decreased to 5 .mu.M, there was a
marked and reproducible decrease in gutD activity in D-glucitol
grown cells. The level of LPS, however, was only slightly reduced
in comparison (FIG. 9C). This indicated a direct correlation
between A5P levels and the amount of gutD, and that the difference
was not due to the consequence of pleiotropic effects stemming from
a depleted LPS layer. Analysis of the expression level of the gutD
gene indicated the decrease in measured specific activity of gutD
was correlated to the amount of mRNA (FIG. 9D). The gut operon
remained inducible under the same growth conditions when
complemented by a plasmid encoding gutQ.
Example XXVI
[0120] This example shows that the gene msbA, when overexpressed,
allows .DELTA.KDO E. coli bacterial cells to grow on agar without
D-arabinose 5-phosphate media supplementation.
[0121] MsbA was originally identified as a multicopy suppressor of
LpxL (HtrB) temperature-sensitive phenotypes (Polissi et al., 1996,
Mol. Microbiol. 20:1221-1233, incorporated herein by reference in
its entirety). Complementation of the auxotrophic TCM15 (E. coli)
strain with a cosmid library of KPM22 genomic DNA revealed that
msbA was a multicopy suppressor of the .DELTA.Kdo phenotype.
Seventeen separate cosmid clones were isolated containing the msbA
locus. A cosmid subclone (pMMW52), containing a 3.5 kb insert with
only an intact wildtype msbA sequence identical to the wildtype,
was able to directly rescue TCM15, as judged by loss of A5P
auxotrophy and restoration of colony-forming ability on solid agar.
The growth rate of TCM15 (pMMW52) is strikingly similar to KPM22 E.
coli strain (Meredith et al., 2006, ACS Chem. Biol. 1:33-42,
incorporated herein by reference in its entirety).
[0122] All publications and patents mentioned in the above
specification are herein incorporated by reference. Although the
invention has been described in connection with specific preferred
embodiments, it should be understood that the invention as claimed
should not be unduly limited to such specific embodiments. Indeed,
various modifications of the described modes for carrying out the
invention that are obvious to those skilled in the relevant fields
are intended to be within the scope of the following claims.
Sequence CWU 1
1
12137DNAArtificial SequenceSynthetic 1ggtgctagaa ttcatatgag
tgaagcacta ctgaacg 37246DNAArtificial SequenceSynthetic 2gaattcggat
ccaagttaaa taatcccggc ctgatagaaa tcctgc 46360DNAArtificial
SequenceSynthetic 3gatcgatgtg atcataaccg gagagagcaa tgagtgaagc
gtgtaggctg gagctgcttc 60460DNAArtificial SequenceSynthetic
4cggctggcga aacgtctggg attgaaggat taaataatcc attccgggga tccgtcgacc
60573DNAArtificial SequenceSynthetic 5gcgatgttgt actggttatc
gccaatactc gttgaataac tggaaacgca ttgtgtaggc 60tggagctgct tcg
73672DNAArtificial SequenceSynthetic 6gcgacgcacc tgctttgctc
attgttgttt atccttgaat ctttacacta cggatatgaa 60tatcctcctt ag
72721DNAArtificial SequenceSynthetic 7atgaatcagg ttgccgttgt c
21820DNAArtificial SequenceSynthetic 8caccagattc acctgtagcg
20965DNAArtificial SequenceSynthetic 9gctgcattaa ttaatcgaca
ttttactcaa gattaaggcg atcctgtgta ggctggagct 60gcttc
651065DNAArtificial SequenceSynthetic 10gtcttaacgc agaacgctaa
tactttattt ttcaagcaaa aaagaattcc ggggatccgt 60cgacc
651170DNAArtificial SequenceSynthetic 11acagctaaat acatagaatc
cccagcacat ccataagtca gctatttact gtgtaggctg 60gagctgcttc
701270DNAArtificial SequenceSynthetic 12taatgggatc gaaagtaccc
ggataaatcg cccgtttttg cataacaacc catatgaata 60tcctccttag 70
* * * * *