U.S. patent application number 12/718308 was filed with the patent office on 2010-10-28 for method of immunization against the 4 dengue serotypes.
This patent application is currently assigned to SANOFI PASTEUR SA. Invention is credited to Veronique Barban, Remi Forrat, Bruno Guy, Jean Lang.
Application Number | 20100270202 12/718308 |
Document ID | / |
Family ID | 38222583 |
Filed Date | 2010-10-28 |
United States Patent
Application |
20100270202 |
Kind Code |
A1 |
Guy; Bruno ; et al. |
October 28, 2010 |
Method of Immunization Against the 4 Dengue Serotypes
Abstract
The invention relates to a method for inducing a protection
against the 4 dengue serotypes in a patient, comprising (a) a first
series of administrations (i) of a dose of a vaccinal dengue virus
of a first serotype and of a dose of a vaccinal dengue virus of a
second serotype, and (ii) of a dose of a vaccinal dengue virus of a
third serotype and of a dose of a vaccinal dengue virus of a fourth
serotype, and (b) a second series of administrations of doses (i)
and (ii), in which the doses (i) and (ii) are administered
simultaneously at separate anatomical sites, and in which the
second series (b) is implemented at least 30 days to at most 12
months after the first series (a).
Inventors: |
Guy; Bruno; (Lyon, FR)
; Forrat; Remi; (Serezin du Rhone, FR) ; Lang;
Jean; (Moins, FR) ; Barban; Veronique;
(Craponne, FR) |
Correspondence
Address: |
MCDONNELL BOEHNEN HULBERT & BERGHOFF LLP
300 S. WACKER DRIVE, 32ND FLOOR
CHICAGO
IL
60606
US
|
Assignee: |
SANOFI PASTEUR SA
LYON CEDEX 07
FR
|
Family ID: |
38222583 |
Appl. No.: |
12/718308 |
Filed: |
March 5, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11866382 |
Oct 2, 2007 |
7718358 |
|
|
12718308 |
|
|
|
|
60867312 |
Nov 27, 2006 |
|
|
|
Current U.S.
Class: |
206/570 ;
424/218.1 |
Current CPC
Class: |
A61K 2039/5254 20130101;
A61K 2039/70 20130101; A61P 31/12 20180101; A61P 37/04 20180101;
Y02A 50/388 20180101; A61P 31/14 20180101; Y02A 50/386 20180101;
C12N 2770/24134 20130101; A61K 2039/54 20130101; A61K 2039/5256
20130101; A61K 39/12 20130101 |
Class at
Publication: |
206/570 ;
424/218.1 |
International
Class: |
B65D 71/00 20060101
B65D071/00; A61K 39/12 20060101 A61K039/12; A61P 31/14 20060101
A61P031/14 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 4, 2006 |
FR |
06 08660 |
Claims
1-13. (canceled)
14. A kit for immunization against the dengue virus, comprising a
container containing at least the vaccinal dengue viruses serotypes
1, 2, 3 and 4 (a) in the form of monovalent compositions contained
in 4 separate containers, or (b) in the form of two bivalent
compositions contained in 2 separate containers.
15. The kit as claimed in claim 14, comprising at least: (a) a
first container containing a bivalent vaccine comprising a CYD
DEN-1 and a CYD DEN-2, and (b) a second container containing a
bivalent vaccine comprising a CYD DEN-3 and a CYD DEN-4.
16. The kit as claimed in claim 14, comprising at least: (a) a
first container containing a bivalent vaccine comprising a CYD
DEN-1 and a CYD DEN-3, and (b) a second container containing a
bivalent vaccine comprising a CYD DEN-2 and a CYD DEN-4.
17. A kit for immunization against the dengue virus, comprising a
container containing at least the vaccinal dengue viruses of a
first serotype and of a second serotype, (a) in the form of two
monovalent compositions contained in 2 separate containers, or (b)
in the form of a bivalent composition contained in 1 single
container.
18. The kit as claimed in claim 17, comprising at least: (a) a
container containing a bivalent vaccine comprising a CYD DEN-1 and
a CYD DEN-3, or (b) a container containing a bivalent vaccine
comprising a CYD DEN-2 and a CYD DEN-4, or (c) a container
containing a bivalent vaccine comprising a CYD DEN-1 and a CYD
DEN-2, or (d) a container containing a bivalent vaccine comprising
a CYD DEN-3 and a CYD DEN-4.
19. A bivalent vaccine comprising an immunoeffective amount of the
vaccinal dengue viruses of a first serotype and of a second
serotype and a pharmaceutically acceptable excipient.
20. The bivalent vaccine as claimed in claim 19, comprising the
vaccinal viruses selected from the group consisting of: CYD DEN-1
and CYD DEN-3; or CYD DEN-2 and CYD DEN-4; or CYD DEN-1 and CYD
DEN-2; or CYD DEN-3 and CYD DEN-4.
21. (canceled)
Description
[0001] This application claims the benefit of priority of U.S.
provisional application 60/867,312, filed Nov. 27, 2006.
[0002] The invention relates to a method for inducing a protection
against the 4 dengue serotypes in a patient, comprising
[0003] (a) a first series of administrations (i) of a dose of a
vaccinal dengue virus of a first serotype and of a dose of a
vaccinal dengue virus of a second serotype, and (ii) of a dose of a
vaccinal dengue virus of a third serotype and of a dose of a
vaccinal dengue virus of a fourth serotype, and
[0004] (b) a second series of administrations of doses (i) and
(ii), in which the doses (i) and (ii) are administered
simultaneously at separate anatomical sites, and
[0005] in which the second series (b) is implemented at least 30
days to at most 12 months after the first series (a).
[0006] Dengue diseases are caused by four viruses of the flavivirus
genus, of the serological type, which are similar but distinct from
an antigenic point of view (Gubler et al., 1988 In: Epidemiology of
arthropod-borne viral disease. Monath TPM, editor, Boca Raton (FL):
CRC Press: 223-60; Kautner et al., 1997, J. of Pediatrics,
131:516-524; Rigau-Perez et al., 1998, Lancet; 352: 971-977; Vaughn
et al., 1997, J Infect Dis; 176: 322-30). Infection with a dengue
serotype can produce a clinical disease spectrum ranging from a
nonspecific viral syndrome to a severe hemorrhagic disease which is
fatal. The incubation period of dengue fever after a mosquito bite
is approximately 4 days (ranging from 3 to 14 days). Dengue fever
is characterized by a biphasic fever, headaches, pain in various
parts of the body, prostration, eruptions, lymphadenopathy and
leukopenia (Kautner et al., 1997, J. of Pediatrics, 131:516-524;
Rigau-Perez et al., 1998, Lancet; 352: 971-977). The viremia period
is the same as the febrile period (Vaughn et al., 1997, J. Infect.
Dis.; 176: 322-30). Recovery from dengue fever occurs after 7 to 10
days, but there is usually a prolonged asthenia. Decreases in
leukocyte and platelet count are common.
[0007] Hemorrhagic dengue is a severe febrile disease characterized
by anomalies in homeostasis and an increase in vascular
permeability which can result in hypovolemia and in hypotension
(dengue with shock syndrome) often complicated by severe internal
hemorrhaging. The mortality rate of hemorrhagic dengue can be up to
10% without treatment, but is 1% in most centers with experience in
treatment (WHO technical Guide, 1986. Dengue haemorrhagic fever:
diagnosis, treatment and control, p1-2. World Health Organization,
Geneva, Switzerland).
[0008] The routine laboratory diagnosis of dengue is based on
isolation of the virus and/or detection of antibodies specific for
the dengue virus.
[0009] Dengue is the second most common tropical infectious disease
after malaria, more than half the world's population living in
regions where there is a risk of epidemic transmission. Each year,
cases of dengue are estimated at 50-100 million, cases of patients
hospitalized for hemorrhagic dengue at 500 000, and the number of
deaths at 25 000. Dengue is endemic in Asia, in the Pacific region,
in Africa, in Latin America and in the Caribbean. More than 100
tropical countries are endemic for dengue virus infections and
hemorrhagic dengue has been documented in 60 of these countries
(Gubler, 2002, TRENDS in Microbiology. 10:100-103; Monath, 1994,
Proc. Natl. Acad. Sci.; 91: 2395-2400). A certain number of
well-described factors appear to be involved in dengue: population
growth; unplanned and uncontrolled urbanization, in particular in
combination with poverty; an increase in air travel; the lack of
effective control of mosquitoes and the deterioration of hygiene
infrastructures and of public health (Gubler, 2002, TRENDS in
Microbiology. 10:100-103). Individuals who travel and expatriates
are increasingly warned about dengue (Shirtcliffe et al., 1998, J.
Roy. Coll. Phys. Lond.; 32: 235-237). Dengue has constituted one of
the main causes of febrile diseases in American troops during
deployments in tropical zones endemic for dengue (DeFraites et al.,
1994, MMWR 1994; 43: 845-848).
[0010] The viruses are maintained in a cycle which involves humans
and Aedes aegypti, a domestic mosquito which bites during the day,
and which prefers to feed off humans. The infection in humans is
initiated by injection of the virus while an infected Aedes aegypti
mosquito feeds on the blood. The virus in the saliva is deposited
mainly in the extravascular tissues. The first category of cells
infected after inoculation are dendritic cells, which then migrate
to the lymph nodes (Wu et al., 2000, Nature Med.; 7:816-820). After
an initial replication in the skin and in the lymph nodes, the
virus appears in the blood during the acute febrile phase,
generally for 3 to 5 days.
[0011] Monocytes and macrophages are, with dendritic cells, among
the first targets of the dengue virus. Protection against a
homotypic reinfection is complete and probably lasts for a
lifetime, but crossprotection between the various dengue types
lasts less than a few weeks to a few months (Sabin, 1952, Am. J.
Trop. Med. Hyg.; 1: 30-50). Consequently, an individual can
experience an infection with a different serotype. A second
infection with dengue is in theory a risk factor for developing a
severe dengue disease. However, hemorrhagic dengue is
multifactorial: these factors include the strain of the virus
involved, and also the age, the immune status and the genetic
predisposition of the patient. Two factors play a major role in the
occurrence of hemorrhagic dengue: rapid viral replication with a
high viremia (the severity of the disease being associated with the
level of viremia; Vaughn et al., 2000, J. Inf. Dis.; 181: 2-9) and
a substantially inflammatory response with the release of high
levels of inflammatory mediators (Rothman and Ennis, 1999,
Virology; 257: 1-6). There is no specific treatment against dengue.
The treatment for dengue fever is symptomatic with confinement to
bed, control of the fever and of the pain with antipyretics and
analgesics, and adequate fluid intake. The treatment for
hemorrhagic dengue requires equilibration of fluid losses,
replacement of clotting factors and heparin infusion.
[0012] Preventive measures are currently based on controlling the
vector and taking personal protection steps which are difficult to
implement and expensive. No vaccine against dengue has been
approved at this time. Given that the four dengue serotypes are in
circulation in the world and since they have been reported as being
involved in cases of dengue hemorrhagic fever, immunization should
ideally confer protection against the four serotypes of the dengue
virus.
[0013] The use of different anatomical sites for the administration
of dengue virus has already been described in the literature.
[0014] Thus, Halstead et al. (1973, Am. J. Trop. Med. Hyg.,
22:375-381) have shown that an administration of wild-type dengue
viruses carried out at 2 or 4 separate anatomical sites for the 4
different serotypes induces protection against a subsequent
infection. However, the authors observe no superiority of this type
of separate immunization compared with an immunization carried out
at a single site.
[0015] Attenuated viral forms of dengue viruses result in
interferences in humans when they are administered in the form of a
tetravalent vaccine. This phenomenon has in particular been
described in the following publications: Gubler D. J. Clin.
Microbiol. Rev. 1998; 11 (3):480-96; Rothman A. L. et al Vaccine
2001; 19:4694-9.
[0016] Zhou H and Deem M W. (Vaccine. 2006 Mar. 24; 24(14):2451-9)
have developed a mathematical model based only on the use of the
CD8 epitopes and aimed at simulating the interferences between the
CD8 epitopes of the 4 dengue serotypes. According to this
theoretical model, the best way of avoiding the interferences would
be to carry out a primary immunization using a non-dominant CD8
epitope, followed by a booster by means of an administration at
different anatomical sites of the same CD8 epitopes of each of the
4 serotypes.
[0017] There exists, therefore, a need for a method for reducing
the interferences between the various serotypes and for inducing
neutralizing antibodies against the 4 dengue serotypes.
[0018] The inventors have demonstrated that it is possible to
generate a homologous immune response comprising antibodies that
neutralize the 4 serotypes where the latter are administered
simultaneously in pairs at separate anatomical sites in a first
series of administrations and then in a second series of
administrations implemented 30 days to 12 months after the first
administration of the 4 serotypes.
[0019] The inventors have in particular shown that a DEN-1,2
bivalent immunization concomitant with a DEN-3,4 bivalent
immunization, carried out at two separate anatomical sties and
followed by a booster of the same vaccinal doses under the same
conditions, induces high responses against the four serotypes in
all the monkeys immunized with the exception of one serotype in one
animal. Conversely, a tetravalent immunization carried out at a
single site made it possible to induce a satisfactory response only
against two serotypes out of 4.
[0020] The immune response generated by the method according to the
present invention is therefore quantitatively and qualitatively
greater (covers all the serotypes).
[0021] According to a first aspect, the present invention relates
to a method for inducing a homologous protection against the 4
dengue serotypes in a patient, comprising
[0022] (a) a first series of administrations (i) of a dose of a
vaccinal dengue virus of a first serotype and of a dose of a
vaccinal dengue virus of a second serotype, and (ii) of a dose of a
vaccinal dengue virus of a third serotype and of a dose of a
vaccinal dengue virus of a fourth serotype, and
[0023] (b) a second series of administrations of doses (i) and
(ii), in which the doses (i) and (ii) are administered
simultaneously at separate anatomical sites, and
[0024] in which the second series is implemented at least 30 days
and at most 12 months after the first series.
[0025] According to another embodiment of the method according to
the invention, the vaccinal dengue viruses (i) are administered in
the form of a single bivalent vaccinal dose.
[0026] According to another embodiment of the method according to
the invention, the vaccinal dengue viruses (ii) are administered in
the form of a single bivalent vaccinal dose.
[0027] According to one specific embodiment of the immunization
method according to the invention, said vaccinal dengue virus
serotype 1 is selected from the group consisting of the VDV1 strain
and of a Chimerivax.TM. DEN-1.
[0028] According to another specific embodiment of the method
according to the invention, said vaccinal dengue virus serotype 2
is selected from the group consisting of the VDV2 strain and of a
Chimerivax.TM. DEN-2.
[0029] According to another specific embodiment of the method
according to the invention, said vaccinal dengue virus serotype 1
is the VDV1 strain and said vaccinal dengue virus serotype 2 is the
VDV2 strain.
[0030] According to another specific embodiment of the method
according to the invention, said vaccinal dengue virus serotype 1
is a Chimerivax.TM. DEN-1 and said vaccinal dengue virus serotype 2
is a Chimerivax.TM. DEN-2.
[0031] According to another specific embodiment of the method
according to the invention, said vaccinal dengue virus serotype 3
is a Chimerivax.TM. DEN-3.
[0032] According to another specific embodiment of the method
according to the invention, said vaccinal dengue virus serotype 4
is a Chimerivax.TM. DEN-4.
[0033] According to another specific embodiment of the method
according to the invention, the first and second serotypes are,
respectively, CYD DEN-1 and CYD DEN-2 and the third and fourth
serotypes are, respectively, CYD DEN-3 and CYD DEN-4.
[0034] According to another specific embodiment of the method
according to the invention, the first and second serotypes are,
respectively, CYD DEN-1 and CYD DEN-3 and the third and fourth
serotypes are, respectively, CYD DEN-2 and CYD DEN-4.
[0035] According to another specific embodiment of the method
according to the invention, the amount of vaccinal dengue viruses
serotypes 1, 2, 3 and 4 is within a range of from 10.sup.3 to
10.sup.6 CCID.sub.50.
[0036] According to another embodiment of the method according to
the invention, the vaccinal viruses used in the second series of
administrations are identical to those used in the first series of
administrations.
[0037] According to another embodiment of the method according to
the invention, the second series of administrations is implemented
30 to 60 days after the first series of administrations.
[0038] An aspect of the present invention is also a kit for
immunization against the dengue virus, comprising a container
containing at least the vaccinal dengue viruses serotypes 1, 2, 3
and 4
[0039] (a) in the form of monovalent compositions containing 4
separate containers, or
[0040] (b) in the form of two bivalent compositions containing 2
separate containers.
[0041] According to one embodiment, the kit according to the
invention comprises at least:
[0042] (a) a first container containing a bivalent vaccine
comprising a Chimerivax.TM. DEN-1 and a Chimerivax.TM. DEN-2,
and
[0043] (b) a second container containing a bivalent vaccine
comprising a Chimerivax.TM. DEN-3 and a Chimerivax.TM. DEN-4.
[0044] According to another embodiment, the kit according to the
invention comprises at least:
[0045] (a) a first container containing a bivalent vaccine
comprising a Chimerivax.TM. DEN-1 and a Chimerivax.TM. DEN-3,
and
[0046] (b) a second container containing a bivalent vaccine
comprising a Chimerivax.TM. DEN-2 and a Chimerivax.TM. DEN-4.
[0047] An aspect of the present invention is also a kit for
immunization against the dengue virus, comprising a container
containing at least the vaccinal dengue viruses of a first serotype
and of a second serotype,
[0048] (a) in the form of 2 monovalent compositions contained in 2
separate containers, or
[0049] (b) in the form of a bivalent composition contained in 1
single container.
[0050] According to one embodiment, the kit comprises at least:
[0051] (a) a container containing a bivalent vaccine comprising a
Chimerivax.TM. DEN-1 and a Chimerivax.TM. DEN-3, or
[0052] (b) a container containing a bivalent vaccine comprising a
Chimerivax.TM. DEN-2 and a Chimerivax.TM. DEN-4, or
[0053] (c) a container containing a bivalent vaccine comprising a
Chimerivax.TM. DEN-1 and a Chimerivax.TM. DEN-2, or
[0054] (d) a container containing a bivalent vaccine comprising a
Chimerivax.TM. DEN-3 and a Chimerivax.TM. DEN-4.
[0055] The present invention also provides a bivalent composition
or a bivalent vaccine comprising an immunoeffective amount of the
dengue vaccinal viruses of a first serotype and of a second
serotype and a pharmaceutically acceptable excipient.
[0056] According to a specific embodiment, the bivalent composition
or vaccine comprises the vaccinal viruses selected from the group
consisting of: Chimerivax.TM. DEN-1 and Chimerivax.TM. DEN-3; or
Chimerivax.TM. DEN-2 and Chimerivax.TM. DEN-4; or Chimerivax.TM.
DEN-1 and a Chimerivax.TM. DEN-2; or Chimerivax.TM. DEN-3 and
Chimerivax.TM. DEN-4.
[0057] The invention will be described in further detail in the
description which follows.
DEFINITIONS
[0058] In the context of the present invention, two anatomical
sites are "separate" if they are drained by different lymph nodes.
For example, the right arm and the left arm are considered to be
separate sites. The following separate sites are non-limiting
examples: right arm/right thigh; left arm/left thigh, left
arm/right thigh.
[0059] In the context of the present invention, the term
"simultaneous administrations" is intended to mean administrations
implemented on the same day (i.e. at most 24 h). Simultaneous
administrations are advantageously carried out at most 1 hour
apart, conventionally 1-5 minutes apart.
[0060] In the context of the present invention, the doses (i) are
administered at a first anatomical site, either in the form of two
monovalent doses or in the form of a single bivalent dose. The
doses (ii) are, for their part, administered simultaneously at a
second anatomical site, either in the form of two monovalent doses
or in the form of a single bivalent dose, the first and second
sites being separate sites as defined above.
[0061] "Dengue viruses" or "DENs" are positive, single-stranded RNA
viruses belonging to the Flavivirus genus of the flaviviridae
family. The genomic RNA contains a type I cap at the 5' end but
lacks a poly-A tail at the 3' end. The genomic organization
consists of the following elements: 5' noncoding region (NCR),
structural proteins (capsid (C), premembrane/membrane (prM/M),
envelope (E)) and nonstructural proteins
(NS1-NS2A-NS2B-NS3-NS4A-NS4B-NS5), and 3' NCR. The genomic viral
RNA is associated with the capsid proteins so as to form a
nucleocapsid. As for the other flaviviruses, the DEN viral genome
encodes an uninterrupted coding region which is translated into a
single polyprotein.
[0062] In the context of the present invention, the term "vaccinal
dengue virus" is intended to mean any viral form of the dengue
virus capable of inducing a specific homologous immune response,
preferably any viral form of the dengue virus that can be used in
the context of an immunization program in humans against dengue
virus infection. The term "vaccinal dengue viruses" is therefore
intended to mean inactivated viruses, attenuated viruses, or
recombinant proteins such as the dengue virus envelope protein.
[0063] A vaccinal virus is considered to be "inactivated" if it no
longer replicates on permissive cells.
[0064] A vaccinal virus is considered to be "attenuated" if, after
growth at 37.degree. C. or 39.degree. C. on Huh-7, VERO and/or
C6/36 hepatic cells, said vaccinal virus has a maximum titer that
is at least 10-fold less than the maximum titer obtained with the
wild-type parental strain under the same culture conditions and as
measured using the tittering method. A vaccinal virus that exhibits
decreased growth on at least one of the three cell types identified
above is therefore considered to be "attenuated" in the context of
the present invention.
[0065] A vaccinal virus that can be used in humans has a positive
benefit/risk ratio, said ratio generally making it possible to
comply with the regulatory requirements for obtaining a marketing
authorization. A vaccinal dengue virus used in the context of the
present invention is preferably an attenuated virus such that it
does not induce the disease in humans. Advantageously, said
vaccinal virus produces only side effects that are at most of
moderate intensity (i.e., moderate to weak, or even zero) in the
majority of the individuals immunized, while at the same time
conserving its ability to induce a neutralizing antibody
response.
[0066] By way of nonlimiting examples of vaccinal dengue virus that
can be used in the context of the present invention, mention may be
made of: inactivated vaccinal viruses, attenuated vaccinal viruses
such as the attenuated strains VDV-1 or VDV-2, the strains
described, for example, in applications: WO02/66621, WO0057904,
WO0057908, WO0057909; WO0057910, WO02/0950075 and WO02/102828, or
chimeras. Chimeric viruses have the particularity of having the
characteristics of the attenuated viruses as defined above. Any
chimeric virus expressing the dengue virus envelope protein and
inducing an immune response comprising antibodies that neutralize
the serotype from which the envelope protein is derived can
therefore be used in the context of the present invention. By way
of nonlimiting examples, mention may be made of: the dengue
Chimerivax.TM. products as described, for example, in patent
application WO 98/37911, and the dengue/dengue chimeras as
described, for example, in patent applications WO 9640933 and
WO0160847. The vaccinal dengue virus serotype 1 may, for example,
be the VDV1 vaccinal strain or a Chimerivax.TM. DEN-1, in
particular a YF17D/DEN-1 virus, or else a 16007/PDK13 DEN-1 strain.
The vaccinal dengue virus serotype 2 may, for example, be the VDV2
vaccinal strain or a Chimerivax.TM. DEN-2, in particular a
YF17D/DEN-2 virus, or else a 16681/PDK53 DEN-2 strain. The vaccinal
dengue virus serotype 3 may be a Chimerivax.TM. DEN-3, in
particular a YF17D/DEN-3 virus. The vaccinal dengue virus serotype
4 may be a Chimerivax.TM. DEN-4, in particular a YF17D/DEN-4 virus.
This strain was described in patent application EP1159968 in the
name of Mahidol University and was deposited with the Collection
Nationale de Cultures de Microorganismes (CNCM) [National
Collection of Microorganism Cultures] under the number I-2483.
[0067] "VDV" or "Vero dengue vaccine" denotes a live attenuated
dengue viral strain adapted on Vero cells and capable of inducing a
specific humoral response, including the induction of neutralizing
antibodies, in primates and in particular in humans.
[0068] "VDV-1" is a strain obtained from a wild-type strain DEN-1
16007 which was subjected to 11 passages on PDK cells (DEN-1
16007/PDK11), which was then amplified on Vero cells at 32.degree.
C., and the RNA of which was purified and transfected into Vero
cells. The VDV-1 strain has 14 additional mutations compared to the
vaccinal strain DEN-1 16007/PDK13 (13 passages on PDK--Primary Dog
Kidney--cells). The DEN-1 16007/PDK13 strain, also called "LAV1",
was described in patent application EP1159968 in the name of
Mahidol University and was deposited with the Collection Nationale
de Cultures de Microorganismes (CNCM) under the number 1-2480. The
complete sequence of the VDV-1 strain is given in the sequence SEQ
ID NO:1. Said strain can be readily reproduced from said sequence.
A method of preparation and the characterization of the VDV-1
strain have been described in the International patent application
filed under the names of Sanofi-Pasteur and of the Center for
Disease Control and Prevention under the number PCT/IB
2006/001313.
[0069] "VDV-2" is a strain obtained from a wild-type strain DEN-2
16681 which was subjected to 50 passages on PDK cells (DEN-2
16681/PDK50), and plaque-purified, and the RNA of which was
extracted and purified before being transfected into Vero cells.
The VDV-2 strain was then obtained by plaque-purification and
amplification on Vero cells. The VDV-2 strain has 10 additional
mutations compared with the vaccinal strain DEN-2 16681/PDK53 (53
passages on PDK cells), 4 mutations of which are silent. The DEN-2
16681/PDK53 strain, also called "LAV2", was described in patent
application EP1159968 in the name of Mahidol University and was
deposited with the Collection Nationale de Cultures de
Microorganismes (CNCM) under the number I-2481. The complete
sequence of the VDV-2 strain is shown in the sequence SEQ ID NO:2.
The VDV-2 strain can be readily reproduced from said sequence. A
method of preparation and of characterization of the VDV-2 strain
has been described in the International patent application filed in
the names of Sanofi-Pasteur and of the Center for Disease Control
and Prevention under the number PCT/IB 2006/001513.
[0070] The VDV 1 and 2 strains are prepared by amplification on
Vero cells. The viruses produced are harvested and clarified with
respect to cell debris by filtration. The DNA is digested by
enzymatic treatment. The impurities are removed by ultrafiltration.
The infectious titers can be increased by means of a method of
concentration. After the addition of a stabilizer, the strains are
stored in lyophilized or frozen form before use, and then
reconstituted extemporaneously.
[0071] The term "ChimeriVax.TM. dengue" or "CYD" denotes a chimeric
yellow fever (YF) virus which comprises the backbone of a YF virus
in which the sequences encoding the premembrane and envelope
proteins have been replaced with those of a DEN virus. The term
"CYD-1 or CYD DEN1" is thus used to describe a chimeric YF virus
containing the prM and E sequences of a dengue serotype 1 strain
(DEN-1). The term "CYD-2 or CYD DEN2" is used to describe a
chimeric YF virus containing the prM and E sequences of a DEN-2
strain. The term "CYD-3 or CYD DEN3" is used to describe a chimeric
YF virus containing the prM and E sequences of a DEN-3 strain. The
term "CYD-4 or CYD DEN4" is used to describe a chimeric YF virus
containing the prM and E sequences of a DEN-4 strain. The
preparation of these ChimeriVax.TM. dengues has been described in
detail in International patent applications WO 98/37911 and WO
03/101397, to which reference may be made for a precise description
of the method for preparing them. The chimeras described in the
examples were generated using the prM and E sequences derived from
the DEN1 PUO359 (TYP1140), DEN2 PUO218, DEN3 PaH881/88 and DEN4
1288 (TVP 980) strains. Any strain of the dengue virus could be
used in the context of the present invention for the construction
of the chimeras.
[0072] Preferably, the chimeric YF virus comprises the backbone of
an attenuated yellow fever strain YF17D (Theiler M, and Smith HH
(1937) J. Exp. Med. 65, p 767-786.) (YF17D/DEN-1, YF17D/DEN-2,
YF17D/DEN-3, YF17D/DEN-4 virus). Examples of YF17D strains which
can be used include YF17D204 (YF-Vax.RTM., Sanofi-Pasteur,
Swifwater, Pa., USA; Stamaril.RTM., Sanofi-Pasteur, Marcy I'Etoile,
France; ARILVAX.TM. Chiron, Speke, Liverpool, UK; FLAVIMUN.RTM.,
Berna Biotech, Bern, Switzerland); YF17D-204 France
(X15067,X15062); YF17D-204,234 US (Rice et al., 1985, Science,
229:726-733), or else related strains YF17DD (Genbank accession
number U17066), YF17D-213 (Genbank accession number U17067) and the
YF17DD strains described by Galler et al. (1998, Vaccines
16(9/10):1024-1028). Any other yellow fever virus strain attenuated
for use in humans can be used in the context of the present
invention for the construction of the chimeras.
[0073] An aspect of the present invention is therefore also a
bivalent composition or vaccine comprising an immunoeffective
amount of a vaccinal dengue virus of a first serotype and of a
vaccinal dengue virus of a second serotype and a pharmaceutically
acceptable excipient.
[0074] For a description of the vaccinal viruses that can be used
in the vaccines according to the invention, reference may be made
to the description given thereof in the context of the method of
immunization according to the invention.
[0075] According to a specific embodiment, the bivalent composition
or vaccine according to the invention comprises CYD DEN-1 and CYD
DEN-2, or CYD DEN-3 and CYD DEN-4, or CYD DEN-1 and CYD DEN-3 or
CYD DEN-2 and CYD DEN-4; advantageously, the vaccinal viruses are
present in the vaccine in an amount of 10.sup.5 CCID.sub.50.
[0076] Each ChimeriVax.TM. monovalent vaccinal dengue virus
(serotypes 1, 2, 3 and 4) was prepared by amplification of each
serotype on Vero cells. More specifically, the four viruses are
produced separately on adherent Vero cells in serum-free medium.
The viral harvest, clarified with respect to cell debris by
filtration, is then concentrated and purified by ultrafiltration
and chromatography in order to remove the host cell DNA. After the
addition of a stabilizer, the vaccinal strains are stored in frozen
or lyophilized form before use, and are then reconstituted
extemporaneously. The same method is applied for the four
chimeras.
[0077] A dose, a composition or a vaccine is "monovalent" when it
contains, in addition to a pharmaceutically acceptable excipient, a
single dengue virus serotype. A dose, a composition or a vaccine is
"bivalent" when it contains two different dengue virus serotypes. A
dose, a composition or a vaccine is "trivalent" when it contains
three different dengue virus serotypes. A dose, a composition or a
vaccine is "tetravalent" when it contains four different dengue
virus serotypes. The multivalent compositions are obtained by
simply mixing the monovalent compositions.
[0078] The term "patient" denotes an individual (child or adult)
who may be infected with dengue, in particular an individual at
risk of infection, such as, for example, an individual who travels
in regions where dengue is present or an inhabitant of these
regions. This term therefore encompasses individuals who are naive
and also individuals who are non-naive with respect to the dengue
virus.
Sequential Immunization at Separate Anatomical Sites
[0079] The inventors have shown in particular that the
administration of the 4 serotypes in the form of two simultaneous
bivalent administrations at separate anatomical sites, followed by
a booster 30 days to 12 months after the first series of
administrations, makes it possible to obtain an effective
homologous protection against the 4 serotypes. The method according
to the present invention is therefore most particularly valuable in
the context of an immunization strategy against dengue.
[0080] According to the present invention, the 4 dengue serotypes
can be administered in any order provided that they are
administered in pairs (i.e. doses (i) and (ii), respectively, in
the form of two monovalent doses or of a single bivalent dose)
simultaneously at separate sites.
[0081] The method according to the present invention can therefore
be implemented with the embodiments described below: [0082] (i)
serotypes 1 and 2; (ii) serotypes 3 and 4; or [0083] (i) serotypes
1 and 3; (ii) serotypes 2 and 4; or [0084] (i) serotypes 1 and 4;
(ii) serotypes 2 and 3; or [0085] (i) serotypes 2 and 3; (ii)
serotypes 1 and 4; or [0086] (i) serotypes 2 and 4; (ii) serotypes
1 and 3; or [0087] (i) serotypes 3 and 4; (ii) serotypes 1 and
2.
[0088] Preferably, the method according to the present invention
comprises the administration of the following vaccinal dengue
viruses: (i) serotypes 1 and 2; (ii) serotypes 3 and 4 or (i)
serotypes 1 and 3; (ii) serotypes 2 and 4. The doses (i) and (ii)
are advantageously in the form of bivalent doses.
[0089] According to specific embodiments the present invention
therefore covers the following schemes: [0090] (i) CYD DEN-1 and
CYD DEN-2; (ii) CYD DEN-3 and CYD DEN-4 [0091] (i) CYD DEN-1 and
CYD DEN-3; (ii) CYD DEN-2 and CYD DEN-4 [0092] (i) CYD DEN-1 and
CYD DEN-4; (ii) CYD DEN-2 and CYD DEN-3 [0093] (i) CYD DEN-2 and
CYD DEN-3; (ii) CYD DEN-1 and CYD DEN-4 [0094] (i) CYD DEN-2 and
CYD DEN-4; (ii) CYD DEN-1 and CYD DEN-3 [0095] (i) CYD DEN-3 and
CYD DEN-4; (ii) CYD DEN-1 and CYD DEN-2 [0096] (i) VDV-1 and CYD
DEN-2; (ii) CYD DEN-3 and CYD DEN-4 [0097] (i) VDV-1 and CYD DEN-3;
(ii) CYD DEN-2 and CYD DEN-4 [0098] (i) VDV-1 and CYD DEN-4; (ii)
CYD DEN-2 and CYD DEN-3 [0099] (i) CYD DEN-2 and CYD DEN-3; (ii)
VDV-1 and CYD DEN-4 [0100] (i) CYD DEN-2 and CYD DEN-4; (ii) VDV-1
and CYD DEN-3 [0101] (i) CYD DEN-3 and CYD DEN-4; (ii) VDV-1 and
CYD DEN-2 [0102] (i) CYD DEN-1 and VDV-2; (ii) CYD DEN-3 and CYD
DEN-4 [0103] (i) CYD DEN-1 and CYD DEN-3; (ii) VDV-2 and CYD DEN-4
[0104] (i) CYD DEN-1 and CYD DEN-4; (ii) VDV-2 and CYD DEN-3 [0105]
(i) VDV-2 and CYD DEN-3; (ii) CYD DEN-1 and CYD DEN-4 [0106] (i)
VDV-2 and CYD DEN-4; (ii) CYD DEN-1 and CYD DEN-3 [0107] (i) CYD
DEN-3 and CYD DEN-4; (ii) CYD DEN-1 and VDV-2 [0108] (i) VDV-1 and
VDV-2; (ii) CYD DEN-3 and CYD DEN-4 [0109] (i) VDV-1 and CYD DEN-3;
(ii) VDV-2 and CYD DEN-4 [0110] (i) VDV-1 and CYD DEN-4; (ii) VDV-2
and CYD DEN-3 [0111] (i) VDV-2 and CYD DEN-3; (ii) VDV-1 and CYD
DEN-4 [0112] (i) VDV-2 and CYD DEN-4; (ii) VDV-1 and CYD DEN-3 and
[0113] (i) CYD DEN-3 and CYD DEN-4; (ii) VDV-1 and VDV-2.
[0114] Preferably, the method of immunization according to the
invention comprises the administration of the following vaccinal
dengue viruses: (i) CYD DEN-1 and CYD DEN 2; (ii) CYD DEN-3 and CYD
DEN-4; or (i) CYD DEN-1 and CYD DEN-3; (ii) CYD DEN-2 and CYD
DEN-4. The doses (i) and (ii) are advantageously in the form of
bivalent doses.
[0115] The method of immunization according to the present
invention comprises a second series of administrations implemented
from 30 days to 12 months, advantageously from 30 days to 3 months,
preferably 30 days, 45 days or 60 days, after the first series of
administrations (i and ii), which advantageously comprises the
administration of the same compositions as those used in the first
series, which are advantageously administered under the same
conditions.
[0116] In the context of the present invention, the term "dose of
vaccinal virus" is intended to mean a composition comprising an
"immunoeffective amount" of the vaccinal dengue virus, i.e. an
amount of dengue virus sufficient to induce a homologous
neutralizing antibody response, which can be demonstrated, for
example, by means of the seroneutralization test as described below
in example 1. A serum is considered to be positive for the presence
of neutralizing antibodies when the neutralizing antibody titer
thus determined is greater than or equal to 1:10 (unit:
1/dilution).
[0117] Vaccinal strain amounts are commonly expressed in terms of
viral plaque-forming units (PFU) or of 50% tissue culture
infectious dose, or else of 50% cell culture infectious dose
(CCID.sub.50). For example, the compositions according to the
invention can contain from 10 to 10.sup.6 CCID.sub.50, in
particular from 10.sup.3 to 10.sup.5 CCID.sub.50 of vaccinal dengue
virus serotype 1, 2, 3 or 4 for a monovalent or bivalent
composition. Thus, in the compositions or use according to the
invention, the doses of vaccinal dengue viruses serotypes 1, 2, 3
and 4 are preferably each within a range of from 10 to 10.sup.6
CCID.sub.50, such as 10, 10.sup.1, 10.sup.2, 10.sup.3, 10.sup.4,
10.sup.5 or 10.sup.6 CCID.sub.50, in particular in a range from
10.sup.3 to 10.sup.5 CCID.sub.50. The vaccinal viruses can be used
at identical or different doses, which can be adjusted according to
the nature of the vaccinal virus used and to the strength of the
immune response obtained.
[0118] According to a specific embodiment of the method according
to the present invention, the monovalent or bivalent doses of
vaccinal viruses comprise, respectively, 10.sup.5 CCID.sub.50 of
CYD DEN-1, of CYD DEN-2, of CYD DEN-3 and of CYD DEN-4.
[0119] The neutralizing antibody response is advantageously a
lasting response, i.e. it can be detected in the serum at least 6
months after the second series of administrations (i) and (ii).
[0120] The dose of a vaccinal dengue virus of a first serotype and
the dose of a vaccinal dengue virus of a second serotype (i.e.
dose(s) (i)) are administered simultaneously in the form of two
monovalent compositions, or advantageously in the form of a single
bivalent composition or dose.
[0121] Similarly, the dose of a vaccinal dengue virus of a third
serotype and the dose of a vaccinal dengue virus of a fourth
serotype (i.e. dose(s) (ii)) are administered simultaneously in the
form of two monovalent vaccinal compositions, or advantageously in
the form of a single bivalent vaccinal composition.
[0122] The vaccinal viruses are administered in the form of
vaccinal compositions or vaccinal virus doses which can be prepared
according to any method known to those skilled in the art. Usually,
the viruses, generally in lyophilized form, are mixed with a
pharmaceutically acceptable excipient, such as water or a phosphate
buffered saline solution, wetting agents or stabilizers. The term
"pharmaceutically acceptable excipient" is intended to mean any
solvent, dispersing medium, filler, etc., which does not produce a
side reaction, for example an allergic reaction, in humans or
animals. The excipient is selected according to the pharmaceutical
form chosen, and to the method and route of administration.
Appropriate excipients and also the requirements in terms of
pharmaceutical formulation are described in "Remington: The Science
& Practice of Pharmacy", for example, which represents a
reference work in the field.
[0123] Preferably, the vaccinal compositions are prepared in an
injectable form, and can be liquid solutions, suspensions or
emulsions. The compositions can include, in particular include an
aqueous solution buffered so as to maintain a pH of between
approximately 6 and 9 (as determined with a pH meter at ambient
temperature).
[0124] Although it is not necessary to add an adjuvant, the
compositions can nevertheless include such a compound, i.e. a
substance which increases, stimulates or strengthens the cellular
or humoral immune response induced by the vaccinal strain
administered simultaneously. It is a routine matter for those
skilled in the art to select, from the adjuvants conventionally
used in the field of vaccines, an adjuvant which may be suitable in
the context of the present invention.
[0125] The vaccinal compositions according to the invention can be
administered according to any route normally used in immunization,
for example parenterally (in particular intradermally,
subcutaneously or intramuscularly), advantageously subcutaneously.
Preferably, the vaccinal compositions are injectable compositions
administered subcutaneously in the left deltoid and the right
deltoid region.
[0126] The volume of composition administered depends on the route
of administration. For subcutaneous injections, the volume is
generally between 0.1 and 1.0 ml, preferably approximately 0.5
ml.
[0127] The optimal period for the administration of all the
serotypes 1 to 4, is approximately 1 to 3 months before exposure to
the dengue virus. The vaccines can be administered as a
prophylactic treatment for infection with a dengue virus in adults
and children. Target populations therefore include individuals who
may be naive (i.e. not previously immunized) or non-naive with
respect to the dengue virus.
[0128] Vaccinal dengue virus serotypes 1 to 4 booster
administrations can also be carried out, for example, between 6
months and 10 years, for example 6 months, 1 year, 3 years, 5 years
or 10 years, after administration of the second series of
administrations according to the invention. The booster
administrations will advantageously be implemented using the same
vaccinal compositions (i.e. the same vaccinal viruses) and
preferably under the same administration conditions (anatomical
sites and routes of administration) as those used for the 1st and
2nd series of administrations.
[0129] The interference phenomena can be explained by the dominance
of one or more serotypes compared with others, and are therefore
independent of the technology used to manufacture the vaccine
candidate (for example, VDV or chimerivax). The method according to
the present invention can therefore apply in general to any
vaccinal dengue virus.
[0130] An aspect of the present invention is therefore also the use
of doses of vaccinal dengue virus for the preparation of a vaccine
for inducing a protection against the 4 dengue serotypes,
comprising:
[0131] (a) a first series of administrations (i) of a dose of a
vaccinal dengue virus of a first serotype and of a dose of a
vaccinal dengue virus of a second serotype, and (ii) of a dose of a
vaccinal dengue virus of a third serotype and of a dose of a
vaccinal dengue virus of a fourth serotype, and
[0132] (b) a second series of administrations of doses (i) and
(ii),
[0133] in which the doses (i) and (ii) are administered
simultaneously at separate anatomical sites, and
[0134] in which the second series is implemented at least 30 days
to at most 12 months after the first series.
[0135] For a description of the vaccinal dengue viruses that can be
used in the context of the present invention, reference may be made
to the description given thereof in relation to the method of
immunization according to the invention.
[0136] An aspect of the present invention is also a kit for
immunization against the four dengue virus serotypes. The kit
according to the present invention comprises the doses as defined
above in relation to the method of immunization proposed. The kit
according to the invention therefore comprises a container
containing the various containers containing the vaccinal doses
and, optionally, an instruction leaflet containing the information
useful for administration of the vaccines.
[0137] According to one embodiment, the kit according to the
invention comprises a container containing at least the vaccinal
dengue viruses serotypes 1, 2, 3 and 4
[0138] (a) in the form of monovalent compositions contained in 4
separate containers, or
[0139] (b) in the form of two bivalent compositions contained in 2
separate containers.
[0140] According to another embodiment, the kit according to the
invention comprises a container containing at least the vaccinal
dengue viruses of a first serotype and of a second serotype,
[0141] (a) in the form of two monovalent compositions contained in
2 separate containers, or
[0142] (b) in the form of a bivalent composition contained in 1
single container.
[0143] For a description of the vaccinal dengue viruses that can be
used in the kit according to the invention, reference may be made
to the description of the vaccinal viruses given above in relation
to the method of immunization according to the invention.
[0144] According to a specific embodiment, the kit according to the
present invention therefore comprises at least:
[0145] (a) a first container containing a bivalent vaccine
comprising a Chimerivax.TM. DEN-1 and a Chimerivax.TM. DEN-2,
and
[0146] (b) a second container containing a bivalent vaccine
comprising a Chimerivax.TM. DEN-3 and a Chimerivax.TM. DEN-4.
[0147] According to another embodiment, the kit according to the
invention comprises at least:
[0148] (a) a first container containing a bivalent vaccine
comprising a Chimerivax.TM. DEN-1 and a Chimerivax.TM. DEN-3,
and
[0149] (b) a second container containing a bivalent vaccine
comprising a Chimerivax.TM. DEN-2 and a Chimerivax.TM. DEN-4.
[0150] According to another embodiment, the kit according to the
invention comprises at least:
[0151] (a) a container containing a bivalent vaccine comprising a
Chimerivax.TM. DEN-1 and a Chimerivax.TM. DEN-3, or
[0152] (b) a container containing a bivalent vaccine comprising a
Chimerivax.TM. DEN-2 and a Chimerivax.TM. DEN-4, or
[0153] (c) a container containing a bivalent vaccine comprising a
Chimerivax.TM. DEN-1 and a Chimerivax.TM. DEN-2, or
[0154] (d) a container containing a bivalent vaccine comprising a
Chimerivax.TM. DEN-3 and a Chimerivax.TM. DEN-4.
[0155] The kits according to the invention may contain a single
example or several examples of the containers as described
above.
[0156] If the vaccines used are in lyophilized form, the kit will
advantageously comprise at least one additional container
containing the diluent for reconstituting an injectable vaccinal
dose. Any pharmaceutically acceptable diluent may be used to do
this, conventionally water or a phosphate buffered aqueous
solution.
[0157] The invention is illustrated by means of the following
examples.
EXAMPLES
Example 1
Immunization in Monkeys by Simultaneous Injection of Two Bivalent
Compositions at Separate Anatomical Sites
[0158] The viremia and the immunogenicity were tested in a monkey
model. The viremia, in particular, was identified as one of the
factors associated with the virulence and the severity of the
disease in man and therefore constitutes an important parameter to
be taken into consideration. The immunogenicity is, for its part, a
key parameter in the context of the evaluation of the protection
conferred.
[0159] 1.1 Materials and Methods:
[0160] The experiments in monkeys were carried out according to the
European Directives relating to animal experimentation. The
immunizations were carried out in cynomolgus monkeys (Macaca
fascicularis) originating from Mauritania. The monkeys were placed
in quarantine for six weeks before immunization.
[0161] The monkeys were immunized subcutaneously in the arms with
0.5 ml of vaccinal composition. After a light anesthesia with
ketamine (Imalgene, Merial), blood was collected by puncture from
the inguinal or saphenous veins. At day 0 and 28 following each
immunization, 5 ml of blood were sampled in order to evaluate the
antibody responses, while, between days 2 and 10, 1 ml of blood was
sampled in order to evaluate the viremia. The blood was collected
on ice and stored on ice until serum separation. To do this, the
blood was centrifuged for 20 minutes at 4.degree. C. and the serum
collected was stored at -80.degree. C. until the time of the
tests.
[0162] Measurement of Viremia
[0163] The post-vaccinal viremias were monitored by quantitative
real-time RP-PCR (qRT-PCR). Two sets of primers and of probes
located in the NS5 gene of the DEN1 and DEN2 strains were used to
quantify the VDV-1 RNA and VDV-2 RNA, respectively. A third set of
2 primers and of 1 probe located in the NS5 gene of the YF virus
was used to quantify the CYD RNA. Finally, 4 sets of primers and of
probes specific for the various CYD serotypes, located at the
junction of the E (DEN)/NS1 (YF) genes were used to identify the
serotype in the samples positive for the YF NS5 RNA (see also table
I). 7 plasmids containing, under the control of the T7 promoter,
the region targeted by each PCR were transcribed in vitro so as to
generate a series of synthetic RNAs which were included as an
internal reference in each RT-PCR assay. These synthetic RNAs were
assayed by spectrophotometry, and the amount of RNA obtained was
converted to number of RNA copies and expressed as GEQ (genomic
equivalents).
[0164] 0.140 ml of monkey serum was extracted using the Macherey
Nagel "Nucleospin 96 Virus.TM." RNA extraction kit, according to
the manufacturer's instructions, and then the purified RNA was
eluted with 0.140 ml (0.090 ml, then 0.05 ml) of RNase-free water.
In order to avoid repeated freezing/thawing cycles, a first
quantification was carried out immediately after the extraction, on
5 .mu.l of said RNA preparation. The remaining volume was frozen at
70.degree. C.
[0165] The reaction mixtures contained, in addition to the
components of the "Qiagen Qauntitect.TM. probes" RT-PCR
quantification kit (Qiagen), 10 picomol of each primers, 4 picomol
of each probe and 5 .mu.l of RNA, in the total volume of 25 .mu.l.
In the case of the RNAs to be tested, 5 .mu.l of the purified
preparation were directly introduced into the reaction mixture,
without any prior dilution step. The synthetic RNAs were diluted to
1/10 in RNAse-free water, and 7 dilutions containing approximately
10 to 10.sup.6 GEQ in 5 .mu.l were quantified in parallel in order
to generate the standard curve.
[0166] The quantification reactions were carried out on the Applied
Biosystem ABIPrism 700.TM. device, using the following program:
50.degree. C./30 min, 95.degree. C./15 min, then 40 cycles of
95.degree. C./15 sec-60.degree. C./60 sec.
[0167] The limit of quantification of the viral RNA in this test is
from 2.9 to 3.3 log.sub.10GEQ/ml (800 to 2000 GEQ/ml; 4 to 10
GEQ/reaction), according to the PCR targets (standard deviation:
+/-0.3 log.sub.10).
[0168] The correlation between the infectious titer and the viral
RNA quantification was established in parallel to the assays, by
analysis of 0.140 ml of negative monkey serum samples (DO) to which
a known amount of infectious particles of the viruses which were
used for the immunization (CYD or VDV) were added. Said control
sera were prepared at two dilutions containing approximately 1 PFU
and approximately 100 PFU in 5 .mu.l (2.3 and 4.3 log.sub.10PFU/ml,
respectively).
[0169] In the tests used in the examples, the correlation between
GEQ and PFU is the following: GEQ/PFU ratio of 2.7 log.sub.10
(i.e.: 1 PFU=500 GEQ) for the sera positive for YF or CYDs. GEQ/PFU
ratio of 2.5 log.sub.10 (i.e.: 1 PFU=320 GEQ) for the sera positive
for VDV1 or VDV2.
[0170] The quantification limits being <3.3 log.sub.10GEQ/ml
(i.e.: <4 PFU/ml) for qRT-PCR YF and CYDs and <2.9
log.sub.10GEQ/ml (i.e.: <2.5 PFU/ml) for qRT-PCR VDV1 and
VDV2.
[0171] The primers and probes used are given in table 1 below, in
which are listed, in order, for each assay, the sense and antisense
primers and the probe.
TABLE-US-00001 TABLE 1 sequence Y YF-NS5 sense 5'
GCACGGATGTAACAGACTGAAGA (23 bases) F YF NS5 anti 5'
CCAGGCCGAACCTGTCAT (18 bases) YF-NS5 5'
Fam-CGACTGTGTGGTCCGGCCCATC-Tamra (22 bases) CYD1 CYD1- sense 5' CAT
TGC AGT TGG CCT GGT AA (20 b) spe CYD1- anti 5' CTT TGG CAA GAG AGA
GCT CAA GT (23 b) CYD1- 5' Fam-CCG ATC AAG GAT GCG CCA TCA-Tamra
(21 b) CYD2 CYD2- sense 5' GTG GGA GTC GTG ACG CTG TA (20 b) spe
CYD2- anti 5' GTT GAT GGC GCA TCC TTG ATC (21 b) CYD2 5' Fam-TGG
GAG TTA TGG TGG GCG CCG-Tamra (21 b) CYD3 CYD3- sense 5' AAA ACA
CTT CCA TGT CAT TTT CAT G (25 b) spe CYD3- anti 5' GTT GAT GGC GCA
TCC TTG ATC (21 b) CYD3-
5'Fam-TGCGATAGGAATTATCACACTCTATCTGGGAGC-Tamra (33 b) CYD4 CYD4-
sense 5' CTT AGT ATT GTG GAT TGG CAC GAA (24 b) spe CYD4- anti 5'
GCG CCA ACT GTG AAA CCT AGA (21 b) CYD4-
5'-Fam-AGAAACACTTCAATGGCAATGACGTGCAT-Tamra (29 b) VDV1 VDV1-NS5
sense 5' TCG CAA CAG CCT TAA CAG C (19 b) spe VDV1-NS5 anti 5' ACT
ATC TCC CTC CCA TCC TTC (21 b) VDV1-NS5 5' Fam-TTC ACA CCA CTT CCA
C-M GB/NFQ (16 b) VDV2 VDV2-NS5 sense 5' AAT GAC AGA CAC GAC TCC
(18 b) spec VDV2-NS5 anti 5' CCC AAA ACC TAC TAT CTT CAA C (22 b)
VDV2-NS5 5' Fam-TGG AAG TCG GCA CGT GA-MGB/NFQ (17 b)
[0172] Measurement of Neutralizing Antibodies (Seroneutralization
Test) (SN50)
[0173] Conventionally, the dengue antibody measurement is
established using the PRNT50 (50% PFU number reduction
neutralization test). Since this test is laborious and uses up a
lot of material, we developed the SN50 test, based on 50% reduction
in the number of units measured in a CCID50 test.
[0174] In a 96-well plate, 0.120 ml of each decomplemented serum is
added to 0.480 ml of diluent (ISCOVE 4% FCS) per well. 6-fold
serial dilutions are prepared by transfer of 0.150 ml of serum into
0.450 ml of diluent. 450 .mu.l of virtual dilution at 2.7
log.sub.10 CCID50/ml are added to each well so as to obtain 25
CCID50/well. The plate is incubated at 37.degree. C. for 1 hour.
0.1 ml of each dilution is then distributed into 6 wells of a
96-well plate into which VERO cells had been seeded 3 days before
the beginning of the experiment at a density of 8000 cells/well, in
0.1 ml of ISCOVE medium containing 4% FCS. After incubation at
37.degree. C. for 6 days, in the presence of 5% CO.sub.2, the cells
are fixed with an ethanol/acetone (70/30) mixture at 4.degree. C.
for 15 minutes, and then washed 3 times in PBS and incubated for 1
h at 37.degree. C. in the presence of 0.05 ml of a 1/2000 dilution
of an anti-flavivirus monoclonal antibody (mAb 4G2). The plates are
then washed twice and incubated for 1 h at 37.degree. C. in the
presence of 0.05 ml of a 1/1000 dilution of an alkaline
phosphatase-conjugated anti-mouse IgG. The lysis plaques are
visualized by adding 0.05 ml of a colored substrate: BCIP/NBT. The
neutralizing antibody titers are calculated using the Karber
formula as defined below:
log.sub.10SN50=d+f/N(X+N/2),
in which: d represents the dilution resulting in 100%
neutralization (i.e. 6 negative replicates, i.e. replicates
exhibiting no sign of infection) f: represents the dilution factor
in log 10 (e.g. dilution factor of 1:4, f=0.6) N: represents the
number of replicates/dilution (N=6) X: total number of wells
exhibiting no sign of infection, with the exception of the dilution
d
[0175] The limit of viral detection is 10 SN50 (i.e. 1.0
log.sub.10SN50).
[0176] The viral strains which were used for the neutralization are
the DEN1 16007, DEN2 16681, DEN3 16562 or DEN4 1036 strains.
For the controls, the initial viral dilutions were re-titrated. The
correlation between the neutralizing titer measured in the SN50
test and the neutralizing titer measured conventionally in the
PRNT50 test is: log.sub.10PRNT50=log.sub.10SN50+0.2
[0177] The mean titer (GMT) is established by calculating the
geometric mean of the titers expressed in linear value; the samples
for which the titer is less than the detection threshold are, by
convention, assigned a value equal to half this threshold.
[0178] 1.2 Evaluation of the Sequential Immunizations
[0179] 2 groups of 4 monkeys of equivalent age and weight were
immunized (see table 2).
[0180] The immunization was carried out subcutaneously in the arm,
with a 23G1 needle, at a dose of 10.sup.5 CCID.sub.50 for each
serotype for the CYD DEN 1 to 4 vaccines.
TABLE-US-00002 TABLE 2 Composition of the groups and immunization
protocol Monkeys Immunizations Group D 0 D 58 1 CYD-1, 2 in one arm
CYD-1, 2 in one arm CYD-3, 4 in the other arm CYD-3, 4 in the other
arm 2 CYD-1, 2, 3, 4 CYD-1, 2, 3, 4
[0181] The immunogenicity results obtained after one immunization
(D28) and two immunizations (D86) are given in table 3.
[0182] The viremia results are given in table 4.
TABLE-US-00003 TABLE 3 SN50 neutralizing titer (units 1/dil)
Monkeys Immunizations D + 28 D58 + 28 Group ID D0 D58 DEN-1 DEN-2
DEN-3 DEN-4 DEN-1 DEN-2 DEN-3 DEN-4 2001 AP545 CYD-1,2 CYD-1,2 20
25 -- 50 40 50 -- 319 AO949 in one in one 20 -- -- 20 319 20 13 100
AP335 arm arm 20 -- -- 252 100 16 10 200 AP817 CYD-3,4 CYD-3,4 20
16 32 40 319 25 32 402 geometric in the in the 20 10 8 56 142 25 12
225 mean other other arm arm 2402 AP676 CYD- CYD- 63 -- -- 126 100
-- -- 40 AQ005 1,2,3,4 1,2,3,4 25 -- -- 63 50 -- -- 63 AP961 50 --
-- 158 80 -- 80 400 AN073AQ163 63 -- -- 40 100 -- 16 252 geometric
47 <10 <10 84 80 <10 13 126 mean --: titer < 10
TABLE-US-00004 TABLE 4 Viremia analysis (units: log10 GEQ/ml)
Primary immunization Booster Group Monkey D2 D3 D4 D6 D7 D8 D9 D10
D58 D59 D62 D63 D64 D65 D66 1 AP545 3.17 -- -- -- 3.12 3.67 4.55
4.59 -- -- -- -- -- -- -- CYD1, 2 + AO949 3.93 3.66 3.34 4.57 -- --
-- -- -- -- -- -- -- -- -- CYD3, 4 AP335 3.36 3.06 3.34 3.83 4.05
4.41 4.24 3.64 -- -- -- -- -- -- -- 2 points of AP817 4.17 3.99
3.61 -- -- -- -- 2.89 -- -- -- -- -- -- -- injection 2 AP676 -- --
-- -- -- -- 3.65 -- -- -- -- -- -- -- -- CYD 1, 2, 3, 4 AQ005 3.19
-- 3.35 -- -- -- -- 3.41 -- -- -- -- -- -- -- 1 point of AP961 --
-- -- -- 3.86 3.42 3.29 3.56 -- -- -- -- -- -- -- injection AQ163
3.18 3.16 -- 3.30 3.60 2.95 3.00 -- -- -- -- -- -- -- -- Serotypes
CYD1 CYD2 CYD3 CYD4 CYD1 + 4
[0183] Briefly, the results can be summarized as follows: [0184]
The administration scheme according to the present invention makes
it possible to qualitatively and quantitatively increase the
homologous neutralizing antibody response which is obtained with
the tetravalent immunization. [0185] The bivalent immunization
CYD-1,2 concomitant with a CYD-3,4 immunization carried out at a
separate anatomical site induces, after booster, homologous
responses against the four serotypes in all the monkeys, except for
serotype 3 in one animal. [0186] Furthermore, the responses against
serotypes 1 and 4 have a tendency to be higher in the case of
simultaneous bivalent immunizations than with tetravalent
immunization at a single site. [0187] The viremia (table 4) is
predominantly caused by CYD-4 whether this is after simultaneous
bivalent administration or tetravalent administration. It can
therefore be concluded therefrom that separation of the serotypes
does not promote the emergence of a serotype 1, 2 and 3
viremia.
[0188] The examples therefore show that the method of immunization
according to the present invention improves the immunogenicity of
the vaccinal dengue viruses without impairing the safety of the
latter.
Example 2
Immunization by Simultaneous Injection of Two Bivalent Compositions
CYD-1,4 and CYD-2,3 at Separate Anatomical Sites in Monkeys
[0189] The viremia and the immunogenicity were tested in the monkey
model as in example 1. In the present example, the bivalent
compositions tested contain, respectively, the most immunogenic
vaccinal viruses (CYD-1,4) and the least immunogenic vaccinal
viruses (CYD-2,3).
[0190] 2.1 Materials and Methods: Identical to Example 1
[0191] 2.2 Evaluation of the Simultaneous Immunizations
[0192] 2 groups of 4 monkeys of equivalent age and weight were
immunized (see table 5).
[0193] The immunization was carried out as described in example
1.
TABLE-US-00005 TABLE 5 Composition of the groups and immunization
protocol Monkeys Immunizations Group D 0 D 58 1 CYD 1, 4 in one arm
CYD 1, 4 in one arm CYD 2, 3 in the other arm CYD 2, 3 in the other
arm 2 CYD 1, 2, 3, 4 CYD 1, 2, 3, 4
[0194] The immunogenicity results obtained after one immunization
(D28) and two immunizations (D86) are given in table 6.
[0195] The viremia results are similar to those obtained in example
1, showing a viremia induced by serotype 4 and no significant
differences between the two groups.
TABLE-US-00006 TABLE 6 SN50 neutralizing titer (units 1/dil)
Monkeys Immunizations D0 + 28 D58 + 28 Group ID D0 D58 DEN-1 DEN-2
DEN-3 DEN-4 DEN-1 DEN-2 DEN-3 DEN-4 1 AR465 CYD 1, 2, 3, 4 CYD 1,
2, 3, 4 63 10 < 100 200 25 10 126 AR558 13 < < 126 401
< 20 160 AR559 < < < 100 13 < < 50 AR639 25 <
< 318 201 < < 201 Geometric 20 < < 142 119 < <
119 mean 2 AR083 CYD 1, 4 in CYD 1, 4 in 63 < < 201 100 16 10
126 AR506 one arm one arm 63 25 13 638 126 100 32 201 AR610 CYD 2,
3 in CYD 2, 3 in 63 20 < 100 159 50 40 253 AR644 the other arm
the other arm 40 < < 40 505 80 40 100 Geometric 56 < <
150 178 50 27 159 mean <: titer < 10
[0196] The results support those obtained in example 1 and can be
summarized as follows: [0197] The administration scheme makes it
possible to qualitatively and quantitatively increase the
homologous neutralizing antibody response which is obtained with
the tetravalent immunization. [0198] The bivalent immunization
CYD-1,4 concomitant with a CYD-2,3 immunization carried out at a
separate anatomical site induces, after booster, homologous
responses against the four serotypes in all the monkeys, which is
not the case in the conventional tetravalent group, as seen in
example 1. [0199] Compared with those of the group of monkeys
having received two bivalents CYD-1,2 and CYD-3,4 in example 1, the
antibody titers observed after bivalent immunization CYD-1,4
concomitant with an immunization CYD-2,3 are higher for serotypes
1, 2 and 3 and lower for serotype 4, which shows a response that is
better balanced between the 4 serotypes, with 4 being less
dominant. [0200] The separation of the dominant serotypes from the
others in such an immunization scheme allowed a balanced response
between the 4 serotypes to be obtained.
[0201] The two examples above therefore show that the method of
immunization according to the present invention improves the
immunogenicity of the vaccinal dengue viruses without impairing the
safety of the latter as evaluated by measuring the viremia.
Sequence CWU 1
1
2110735DNADengue virus 1agttgttagt ctacgtggac cgacaagaac agtttcgaat
cggaagcttg cttaacgtag 60ttctaacagt tttttattag agagcagatc tctgatgatc
aaccaacgaa aaaagacggg 120tcgaccgtct ttcaatatgc tgaaacgcgc
gagaaaccgc gtgtcaactg tttcacagtt 180ggcgaagaga ttctcaaaag
gattgctctc aggccaagga cccatgaaat tggtgatggc 240tttcatagca
ttcttaagat ttctagccat acccccaaca gcaggaattt tggctagatg
300gggctcattc aagaagaatg gagcgattaa agtgttacgg ggtttcaaga
gagaaatctc 360aaacatgcta aacataatga acaggaggaa aagatccgtg
accatgctcc ttatgctgct 420gcccacagcc ctggcgttcc atctgacgac
acgaggggga gagccgcata tgatagttag 480caagcaggaa agaggaaagt
cacttttgtt caagacctct gcaggtgtca acatgtgcac 540cctcattgcg
atggatttgg gagagttgtg tgaggacacg atgacctaca aatgcccccg
600gatcactgag gcggaaccag atgacgttga ctgttggtgc aatgccacgg
acacatgggt 660gacctatgga acgtgctctc aaactggcga acaccgacga
gacaaacgtt ccgtcgcatt 720ggccccacac gtggggcttg gcctagaaac
aagagccgaa acgtggatgt cctctgaagg 780tgcttggaaa cagatacaaa
aagtagagac ttgggctctg agacatccag gattcacggt 840gatagccctt
tttctagcac atgccatagg aacatccatc acccagaaag ggatcatttt
900cattttgctg atgctggtaa caccatctat ggccatgcga tgcgtgggaa
taggcaacag 960agacttcgtg gaaggactgt caggagcaac atgggtggat
gtggtactgg agcatggaag 1020ttgcgtcacc accatggcaa aaaacaaacc
aacactggac attgaactct tgaagacgga 1080ggtcacaaac cctgcagttc
tgcgtaaatt gtgcattgaa gctaaaatat caaacaccac 1140caccgattcg
agatgtccaa cacaaggaga agccacactg gtggaagaac aagacgcgaa
1200ctttgtgtgc cgacgaacgt tcgtggacag aggctggggc aatggctgtg
ggctattcgg 1260aaaaggtagt ctaataacgt gtgccaagtt taagtgtgtg
acaaaactag aaggaaagat 1320agctcaatat gaaaacctaa aatattcagt
gatagtcacc gtccacactg gagatcagca 1380ccaggtggga aatgagacta
cagaacatgg aacaactgca accataacac ctcaagctcc 1440tacgtcggaa
atacagctga ccgactacgg aacccttaca ttagattgtt cacctaggac
1500agggctagat tttaacgaga tggtgttgct gacaatgaaa aagaaatcat
ggcttgtcca 1560caaacagtgg tttctagact taccactgcc ttggacctct
ggggctttaa catcccaaga 1620gacttggaac agacaagatt tactggtcac
atttaagaca gctcatgcaa agaagcagga 1680agtagtcgta ctaggatcac
aagaaggagc aatgcacact gcgctgactg gagcgacaga 1740aatccaaacg
tcaggaacga caacaatttt cgcaggacac ctaaaatgca gactaaaaat
1800ggacaaacta actttaaaag ggatgtcata tgtgatgtgc acaggctcat
tcaagttaga 1860gaaagaagtg gctgagaccc agcatggaac tgttctggtg
caggttaaat atgaaggaac 1920agacgcacca tgcaagattc ccttttcgac
ccaagatgag aaaggagcaa cccagaatgg 1980gagattaata acagccaacc
ccatagtcac tgacaaagaa aaaccagtca atattgaggc 2040agaaccaccc
tttggtgaga gctacatcgt ggtaggagca ggtgaaaaag ctttgaaact
2100aagctggttc aagaaaggaa gcagcatagg gaaaatgttt gaagcaactg
cccgaggagc 2160acgaaggatg gccattctgg gagacaccgc atgggacttc
ggttctatag gaggagtgtt 2220cacgtctatg ggaaaactgg tacaccaggt
ttttggaact gcatatggag ttttgtttag 2280cggagtttct tggaccatga
aaataggaat agggattctg ctgacatggc taggattaaa 2340ttcaaggaac
acgtcccttt cggtgatgtg catcgcagtt ggcatggtca cactgtacct
2400aggagtcatg gttcaggcag attcgggatg tgtaatcaac tggaaaggca
gagaacttaa 2460atgtggaagc ggcatttttg tcactaatga agttcacact
tggacagagc aatacaaatt 2520ccaggctgac tcccccaaga gactatcagc
agccattggg aaggcatggg aggagggtgt 2580gtgtggaatc cgatcagcca
ctcgtctcga gaacatcatg tggaaacaaa tatcaaatga 2640attgaaccac
atcctacttg aaaatgacat gaaatttaca gtggtcgtgg gagacgttag
2700tggaatcttg gcccaaggaa aaaaaatgat taggccacaa cccatggaac
acaaatactc 2760gtggaaaagc tggggaaaag ctaaaatcat aggagcggat
gtacagaaca ccaccttcat 2820catcgacggc ccaaacaccc cagaatgccc
tgacaatcaa agagcatgga atatttggga 2880agtagaggac tatggatttg
ggattttcac gacaaacata tggttgaaat tgcgtgactc 2940ctacacccaa
gtatgtgacc accggctgat gtcagctgcc attaaggaca gcaaggcagt
3000ccatgctgac atggggtact ggatagaaag tgaaaagaac gagacatgga
agttggcgag 3060agcctccttt atagaagtta agacatgcat ctggccaaaa
tcccacactc tatggagcaa 3120tggagttctg gaaagtgaaa tgataattcc
aaagatatat ggaggaccaa tatctcagca 3180caactacaga ccaggatatt
tcacacaaac agcagggccg tggcacctag gcaagttgga 3240actagatttc
gatttttgtg aaggtaccac agttgttgtg gatgaacatt gtggaaatcg
3300aggaccatct ctcagaacca caacagtcac aggaaagata atccatgaat
ggtgctgcag 3360atcttgtacg ctaccccccc tacgtttcaa aggggaagac
gggtgttggt acggcatgga 3420aatcagacca gtgaaggaca aggaagagaa
cctggtcaag tcaatggtct ctgcagggtc 3480aggagaagtg gacagctttt
cactaggact gctatgcata tcaataatga ttgaagaagt 3540gatgagatcc
agatggagca aaaaaatgct gatgactgga acactggctg tgttcctcct
3600tcttataatg ggacaattga catggagtga tctgatcagg ttatgtatta
tggttggagc 3660caacgcttca gacaagatgg ggatgggaac aacgtaccta
gctttaatgg ccactttcaa 3720aatgagacca atgttcgccg tcgggctatt
atttcgcaga ctaacatcta gagaagttct 3780tcttcttaca attggcttga
gcctggtggc atccgtggag ctaccaagtt ccctagagga 3840gctgggggat
ggacttgcaa taggcatcat gatgttgaaa ttattgactg attttcagtc
3900acaccagcta tgggctactc tgctatcctt gacatttatt aaaacaactt
tttcattgca 3960ctatgcatgg aagacaatgg ctatggtact gtcaattgta
tctctcttcc ctttatgcct 4020gtccacgacc tctcaaaaaa caacatggct
tccggtgctg ttgggatctc ttggatgcaa 4080accactaccc atgtttctta
taacagaaaa caaaatctgg ggaaggaaga gttggcccct 4140caatgaagga
attatggctg ttggaatagt tagtattcta ctaagttcac ttttaaaaaa
4200tgatgtgccg ctagccggcc cattaatagc tggaggcatg ctaatagcat
gttatgtcat 4260atccggaagc tcagctgatt tatcactgga gaaagcggct
gaggtctcct gggaggaaga 4320agcagaacac tcaggcgcct cacacaacat
actagtagag gttcaagatg atggaaccat 4380gaagataaaa gatgaagaga
gagatgacac gctcaccatt ctccttaaag caactctgct 4440ggcagtctca
ggggtgtacc caatgtcaat accagcgacc ctttttgtgt ggtatttttg
4500gcagaaaaag aaacagagat caggagtgct atgggacaca cccagccccc
cagaagtgga 4560aagagcagtt cttgatgatg gcatctatag aattttgcaa
agaggactgt tgggcaggtc 4620ccaagtagga gtaggagttt tccaagaagg
cgtgttccac acaatgtggc acgtcactag 4680gggagctgtc ctcatgtatc
aaggaaaaag gctggaacca agctgggcca gtgtcaaaaa 4740agacttgatc
tcatatggag gaggttggag gtttcaagga tcctggaaca cgggagaaga
4800agtacaggtg attgctgttg aaccgggaaa aaaccccaaa aatgtacaaa
caacgccggg 4860taccttcaag acccctgaag gcgaagttgg agccatagcc
ttagacttta aacctggcac 4920atctggatct cccatcgtaa acagagaggg
aaaaatagta ggtctttatg gaaatggagt 4980ggtgacaaca agcggaactt
acgttagtgc catagctcaa gctaaggcat cacaagaagg 5040gcctctacca
gagattgagg acaaggtgtt taggaaaaga aacttaacaa taatggacct
5100acatccagga tcgggaaaaa caagaagata ccttccagcc atagtccgtg
aggccataaa 5160aaggaagctg cgcacgctaa tcctagctcc cacaagagtt
gtcgcttctg aaatggcaga 5220ggcactcaag ggagtgccaa taaggtatca
gacaacagca gtgaagagtg aacacacagg 5280aaaggagata gttgacctta
tgtgccacgc cactttcacc atgcgcctcc tgtctcccgt 5340gagagttccc
aattataaca tgattatcat ggatgaagca cacttcaccg atccagccag
5400catagcagcc agagggtaca tctcaacccg agtgggtatg ggtgaagcag
ctgcgatctt 5460tatgacagcc actcccccag gatcggtgga ggcctttcca
cagagcaatg caattatcca 5520agatgaggaa agagacattc ctgagagatc
atggaactca ggctatgact ggatcactga 5580ttttccaggt aaaacagtct
ggtttgttcc aagcatcaaa tcaggaaatg acattgccaa 5640ctgtttaaga
aaaaacggga aacgggtgat ccaattgagc agaaaaacct ttgacactga
5700gtaccagaaa acaaaaaaca acgactggga ctatgtcgtc acaacagaca
tttccgaaat 5760gggagcaaat ttccgggccg acagggtaat agacccaagg
cggtgtctga aaccggtaat 5820actaaaagat ggtccagagc gcgtcattct
agccggaccg atgccagtga ctgtggccag 5880tgccgcccag aggagaggaa
gaattggaag gaaccaaaac aaggaaggtg atcagtatat 5940ttacatggga
cagcctttaa aaaatgatga ggaccacgct cattggacag aagcaaagat
6000gctccttgac aatataaaca caccagaagg gattatccca gccctctttg
agccggagag 6060agaaaagagt gcagctatag acggggaata cagactgcgg
ggtgaagcaa ggaaaacgtt 6120cgtggagctc atgagaagag gggatctacc
agtctggcta tcctacaaag ttgcctcaga 6180aggcttccag tactccgaca
gaaggtggtg cttcgatggg gaaaggaaca accaggtgtt 6240ggaggagaac
atggacgtgg agatctggac aaaagaagga gaaagaaaga aactacgacc
6300tcgctggttg gacgccagaa catactctga cccactggct ctgcgcgagt
ttaaagagtt 6360tgcagcagga agaagaagcg tctcaggtga cctaatatta
gaaataggga aacttccaca 6420acatttgacg caaagggccc agaatgcttt
ggacaacttg gtcatgttgc acaattccga 6480acaaggagga aaagcctata
gacatgctat ggaagaactg ccagacacaa tagaaacgtt 6540gatgctccta
gccttgatag ctgtgttgac tggtggagtg acgctgttct tcctatcagg
6600aagaggtcta ggaaaaacat ctatcggctt actctgcgtg atggcctcaa
gcgcactgtt 6660atggatggcc agtgtggagc cccattggat agcggcctcc
atcatactgg agttctttct 6720gatggtactg cttattccag agccagacag
acagcgcact ccacaggaca accagctagc 6780atatgtggtg ataggtctgt
tattcgtgat attgacagtg gcagccaatg agatgggatt 6840attggaaacc
acaaagaaag acctggggat tggccatgta gctgctgaaa accaccacca
6900tgctacaatg ctggacgtag acctacatcc agcttcagcc tggaccctct
atgcagtggc 6960cacaacaatc atcactccta tgatgagaca cacaattgaa
aacacaacgg caaatatttc 7020cctgacagcc atcgcaaacc aagcagctat
attgatggga cttgacaagg gatggccaat 7080atcgaagatg gacataggag
ttccacttct cgccttgggg tgctattccc aagtgaatcc 7140gctgacactg
atagcggcag tattgatgct agtagctcat tacgccataa ttggacctgg
7200actgcaagca aaagctacta gagaagctca aaaaagaaca gcggctggaa
taatgaaaaa 7260tccaactgtc gacgggattg ttgcaataga cttagatccc
gtggtttacg atgcaaaatt 7320tgaaaaacag ctaggccaaa taatgttgtt
gatactttgc acatcacaga ttcttttgat 7380gcggactaca tgggccttgt
gtgaatccat cacattggct actggacctc tgaccactct 7440ttgggaggga
tctccaggaa aattctggaa caccacaata gcggtatcca tggcaaacat
7500tttcaggggg agttatctag caggagcagg tctggccttc tcattaatga
aatctctagg 7560aggaggtagg agaggcacgg gagcccaagg ggaaacactg
ggagaaaaat ggaaaagaca 7620actaaaccaa ctgagcaagt cagaattcaa
tacttacaag aggagtggga ttatggaggt 7680ggatagatcc gaagccaaag
agggactgaa aagaggagaa acaaccaaac acgcagtatc 7740gagaggaacg
gccaaactga ggtggttcgt ggagaggaac cttgtgaaac cagaagggaa
7800agtcatagac ctcggttgtg gaagaggtgg ctggtcatat tattgcgctg
ggctgaagaa 7860agtcacagaa gtgaaaggat acacaaaagg aggacctgga
catgaggaac caatcccaat 7920ggcgacctat ggatggaacc tagtaaggct
gcactccgga aaagatgtat tttttatacc 7980acctgagaaa tgtgacaccc
ttttgtgtga tattggtgag tcctctccga acccaactat 8040agaggaagga
agaacgttac gtgttctgaa aatggtggaa ccatggctca gaggaaacca
8100attttgcata aaaattctaa atccctatat gccgagcgtg gtagaaactc
tggaacaaat 8160gcaaagaaaa catggaggaa tgctagtgcg aaacccactc
tcaagaaatt ccacccatga 8220aatgtactgg gtttcatgtg gaacaggaaa
cattgtgtca gcagtaaaca tgacatctag 8280aatgttgcta aatcggttca
caatggctca caggaagcca acatatgaaa gagacgtgga 8340cttaggcgct
ggaacaagac atgtggcagt agaaccagag gtagccaacc tagatatcat
8400tggccagagg atagagaata taaaaaatga acataagtca acatggcatt
atgatgagga 8460caatccatac aaaacatggg cctatcatgg atcatatgag
gttaagccat caggatcggc 8520ctcatccatg gtcaatggcg tggtgagatt
gctcaccaaa ccatgggatg ttatccccat 8580ggtcacacaa atagccatga
ctgataccac accctttgga caacagaggg tgtttaaaga 8640gaaagttgac
acgcgcacac caaaagcaaa acgtggcaca gcacaaatta tggaagtgac
8700agccaggtgg ttatggggtt tcctttctag aaacaaaaaa cccagaattt
gcacaagaga 8760ggagtttaca agaaaagtta ggtcaaacgc agctattgga
gcagtgttcg ttgatgaaaa 8820tcaatggaac tcggcaaaag aagcagtgga
agacgaacgg ttctgggaac ttgtccacag 8880agagagggag cttcataaac
aggggaaatg tgccacgtgt gtctacaata tgatggggaa 8940gagagagaaa
aaattaggag agttcggaaa ggcaaaagga agtcgtgcaa tatggtacat
9000gtggttggga gcacgcttcc tagagtttga agcccttggt ttcatgaatg
aagatcactg 9060gttcagtaga gagaattcac tcagtggagt ggaaggagaa
ggactccaca aacttggata 9120catactcaga gacatatcaa ggattccagg
ggggaacatg tatgcagatg acacagccgg 9180atgggacaca agaataacag
aggatgatct ccagaatgag gctaaaatca ctgacatcat 9240ggagcccgaa
catgccctgc tggctacgtc aatctttaag ctgacctacc aaaataaggt
9300ggtaagggtg cagagaccag caaaaaatgg aaccgtgatg gatgttatat
ccagacgtga 9360ccagagaggc agtggacagg ttggaactta tggcttaaac
actttcacca acatggaggc 9420ccaactgata agacaaatgg agtctgaggg
aatcttttta cccagcgaat tggaaacccc 9480aaatctagcc ggaagagttc
tcgactggtt ggaaaaatat ggtgtcgaaa ggctgaaaag 9540aatggcaatc
agcggagatg actgtgtggt gaaaccaatt gatgacaggt tcgcaacagc
9600cttaacagct ttgaatgaca tgggaaaagt aagaaaagac ataccacaat
gggaaccttc 9660aaaaggatgg aatgattggc aacaagtgcc tttctgttca
caccacttcc accagctaat 9720tatgaaggat gggagggaga tagtggtgcc
atgccgcaac caagatgaac ttgtggggag 9780ggccagagta tcacaaggcg
ccggatggag cctgagagaa accgcatgcc taggcaagtc 9840atatgcacaa
atgtggcagc tgatgtattt ccacaggaga gacctgagac tggcggctaa
9900cgctatttgt tcagccgttc cagttgattg ggtcccaacc agccgcacca
cctggtcgat 9960ccatgcccat caccaatgga tgacaacaga agacatgtta
tcagtatgga atagggtctg 10020gatagaggaa aacccatgga tggaggataa
gactcatgtg tccagttggg aagaagttcc 10080atacctagga aagagggaag
atcagtggtg tggatccctg ataggcttaa cagcaagggc 10140cacctgggcc
actaatatac aagtggccat aaaccaagtg agaaggctca ttgggaatga
10200gaattatcta gattacatga catcaatgaa gagattcaag aatgagagtg
atcccgaagg 10260ggcactctgg taagtcaaca cattcacaaa ataaaggaaa
ataaaaaatc aaatgaggca 10320agaagtcagg ccagattaag ccatagtacg
gtaagagcta tgctgcctgt gagccccgtc 10380caaggacgta aaatgaagtc
aggccgaaag ccacggtttg agcaagccgt gctgcctgtg 10440gctccatcgt
ggggatgtaa aaacccggga ggctgcaacc catggaagct gtacgcatgg
10500ggtagcagac tagtggttag aggagacccc tcccaagaca caacgcagca
gcggggccca 10560acaccagggg aagctgtacc ctggtggtaa ggactagagg
ttagaggaga ccccccgcgt 10620aacaataaac agcatattga cgctgggaga
gaccagagat cctgctgtct ctacagcatc 10680attccaggca cagaacgcca
gaaaatggaa tggtgctgtt gaatcaacag gttct 10735210723DNADengue virus
2agttgttagt ctacgtggac cgacaaagac agattctttg agggagctaa gctcaatgta
60gttctaacag ttttttaatt agagagcaga tctctgatga ataaccaacg gaaaaaggcg
120aaaaacacgc ctttcaatat gctgaaacgc gagagaaacc gcgtgtcgac
tgtgcaacag 180ctgacaaaga gattctcact tggaatgctg cagggacgag
gaccattaaa actgttcatg 240gccctggtgg cgttccttcg tttcctaaca
atcccaccaa cagcagggat attgaagaga 300tggggaacaa ttaaaaaatc
aaaagctatt aatgttttga gagggttcag gaaagagatt 360ggaaggatgc
tgaacatctt gaataggaga cgcagatctg caggcatgat cattatgctg
420attccaacag tgatggcgtt ccatttaacc acacgtaacg gagaaccaca
catgatcgtc 480agcagacaag agaaagggaa aagtcttctg tttaaaacag
aggttggcgt gaacatgtgt 540accctcatgg ccatggacct tggtgaattg
tgtgaagaca caatcacgta caagtgtccc 600cttctcaggc agaatgagcc
agaagacata gactgttggt gcaactctac gtccacgtgg 660gtaacttatg
ggacgtgtac caccatggga gaacatagaa gagaaaaaag atcagtggca
720ctcgttccac atgtgcgaat gggactggag acacgaactg aaacatggat
gtcatcagaa 780ggggcctgga aacatgtcca gagaattgaa acttggatct
tgagacatcc aggcttcacc 840atgatggcag caatcctggc atacaccata
ggaacgacac atttccaaag agccctgatt 900ttcatcttac tgacagctgt
cactccttca atgacaatgc gttgcatagg aatgtcaaat 960agagactttg
tggaaggggt ttcaggagga agctgggttg acatagtctt agaacatgga
1020agctgtgtga cgacgatggc aaaaaacaaa ccaacattgg attttgaact
gataaaaaca 1080gaagccaaac agcctgccac cctaaggaag tactgtatag
aggcaaagct aaccaacaca 1140acaacagaat ctcgctgccc aacacaaggg
gaacccagcc taaatgaaga gcaggacaaa 1200aggttcgtct gcaaacactc
catggtagac agaggatggg gaaatggatg tggactattt 1260ggaaagggag
gcattgtgac ctgtgctatg ttcagatgca aaaagaacat ggaaggaaaa
1320gttgtgcaac cagaaaactt ggaatacacc attgtgataa cacctcactc
aggggaagag 1380catgcagtcg gaaatgacac aggaaaacat ggcaaggaaa
tcaaaataac accacagagt 1440tccatcacag aagcagaatt gacaggttat
ggcactgtca caatggagtg ctctccaaga 1500acgggcctcg acttcaatga
gatggtgttg ctgcagatgg aaaataaagc ttggctggtg 1560cacaggcaat
ggttcctaga cctgccgtta ccatggttgc ccggagcgga cacacaagag
1620tcaaattgga tacagaagga gacattggtc actttcaaaa atccccatgc
gaagaaacag 1680gatgttgttg ttttaggatc ccaagaaggg gccatgcaca
cagcacttac aggggccaca 1740gaaatccaaa tgtcatcagg aaacttactc
ttcacaggac atctcaagtg caggctgaga 1800atggacaagc tacagctcaa
aggaatgtca tactctatgt gcacaggaaa gtttaaagtt 1860gtgaaggaaa
tagcagaaac acaacatgga acaatagtta tcagagtgca atatgaaggg
1920gacggctctc catgcaagat cccttttgag ataatggatt tggaaaaaag
acatgtctta 1980ggtcgcctga ttacagtcaa cccaattgtg acagaaaaag
atagcccagt caacatagaa 2040gcagaacctc catttggaga cagctacatc
atcataggag tagagccggg acaactgaag 2100ctcaactggt ttaagaaagg
aagttctatc ggccaaatgt ttgagacaac aatgaggggg 2160gcgaagagaa
tggccatttt aggtgacaca gcctgggatt ttggatcctt gggaggagtg
2220tttacatcta taggaaaggc tctccaccaa gtctttggag caatctatgg
agctgccttc 2280agtggggttt catggactat gaaaatcctc ataggagtca
ttatcacatg gataggaatg 2340aattcacgca gcacctcact gtctgtgaca
ctagtattgg tgggaattgt gacactgtat 2400ttgggagtca tggtgcaggc
cgatagtggt tgcgttgtga gctggaaaaa caaagaactg 2460aaatgtggca
gtgggatttt catcacagac aacgtgcaca catggacaga acaatacaaa
2520ttccaaccag aatccccttc aaaactagct tcagctatcc agaaagccca
tgaagaggac 2580atttgtggaa tccgctcagt aacaagactg gagaatctga
tgtggaaaca aataacacca 2640gaattgaatc acattctatc agaaaatgag
gtgaagttaa ctattatgac aggagacatc 2700aaaggaatca tgcaggcagg
aaaacgatct ctgcggcctc agcccactga gctgaagtat 2760tcatggaaaa
catggggcaa agcaaaaatg ctctctacag agtctcataa ccagaccttt
2820ctcattgatg gccccgaaac agcagaatgc cccaacacaa atagagcttg
gaattcgttg 2880gaagttgaag actatggctt tggagtattc accaccaata
tatggctaaa attgaaagaa 2940aaacaggatg tattctgcga ctcaaaactc
atgtcagcgg ccataaaaga caacagagcc 3000gtccatgccg atatgggtta
ttggatagaa agtgcactca atgacacatg gaagatagag 3060aaagcctctt
tcattgaagt taaaaactgc cactggccaa aatcacacac cctctggagc
3120aatggagtgc tagaaagtga gatgataatt ccaaagaatc tcgctggacc
agtgtctcaa 3180cacaactata gaccaggcta ccatacacaa ataacaggac
catggcatct aggtaagctt 3240gagatggact ttgatttctg tgatggaaca
acagtggtag tgactgagga ctgcggaaat 3300agaggaccct ctttgagaac
aaccactgcc tctggaaaac tcataacaga atggtgctgc 3360cgatcttgca
cattaccacc gctaagatac agaggtgagg atgggtgctg gtacgggatg
3420gaaatcagac cattgaagga gaaagaagag aatttggtca actccttggt
cacagctgga 3480catgggcagg tcgacaactt ttcactagga gtcttgggaa
tggcattgtt cctggaggaa 3540atgcttagga cccgagtagg aacgaaacat
gcaatactac tagttgcagt ttcttttgtg 3600acattgatca cagggaacat
gtcctttaga gacctgggaa gagtgatggt tatggtaggc 3660gccactatga
cggatgacat aggtatgggc gtgacttatc ttgccctact agcagccttc
3720aaagtcagac caacttttgc agctggacta ctcttgagaa agctgacctc
caaggaattg 3780atgatgacta ctataggaat tgtactcctc tcccagagca
ccataccaga gaccattctt 3840gagttgactg atgcgttagc cttaggcatg
atggtcctca aaatggtgag aaatatggaa 3900aagtatcaat tggcagtgac
tatcatggct atcttgtgcg tcccaaacgc agtgatatta 3960caaaacgcat
ggaaagtgag ttgcacaata ttggcagtgg tgtccgtttc cccactgttc
4020ttaacatcct cacagcaaaa aacagattgg ataccattag cattgacgat
caaaggtctc 4080aatccaacag ctatttttct aacaaccctc tcaagaacca
gcaagaaaag gagctggcca 4140ttaaatgagg ctatcatggc agtcgggatg
gtgagcattt tagccagttc tctcctaaaa 4200aatgatattc ccatgacagg
accattagtg gctggagggc tcctcactgt gtgctacgtg 4260ctcactggac
gatcggccga
tttggaactg gagagagcag ccgatgtcaa atgggaagac 4320caggcagaga
tatcaggaag cagtccaatc ctgtcaataa caatatcaga agatggtagc
4380atgtcgataa aaaatgaaga ggaagaacaa acactgacca tactcattag
aacaggattg 4440ctggtgatct caggactttt tcctgtatca ataccaatca
cggcagcagc atggtacctg 4500tgggaagtga agaaacaacg ggccggagta
ttgtgggatg ttccttcacc cccacccatg 4560ggaaaggctg aactggaaga
tggagcctat agaattaagc aaaaagggat tcttggatat 4620tcccagatcg
gagccggagt ttacaaagaa ggaacattcc atacaatgtg gcatgtcaca
4680cgtggcgctg ttctaatgca taaaggaaag aggattgaac caacatgggc
ggacgtcaag 4740aaagacctaa tatcatatgg aggaggctgg aagttagaag
gagaatggaa ggaaggagaa 4800gaagtccagg tattggcact ggagcctgga
aaaaatccaa gagccgtcca aacgaaacct 4860ggtcttttca aaaccaacgc
cggaacaata ggtgctgtat ctctggactt ttctcctgga 4920acgtcaggat
ctccaattat cgacaaaaaa ggaaaagttg tgggtcttta tggtaatggt
4980gttgttacaa ggagtggagc atatgtgagt gctatagccc agactgaaaa
aagcattgaa 5040gacaacccag agatcgaaga tcacattttc cgaaagagaa
gactgaccat catggacctc 5100cacccaggag cgggaaagac gaagagatac
cttccggcca tagtcagaga agctataaaa 5160cggggtttga gaacattaat
cttggccccc actagagttg tggcagctga aatggaggaa 5220gcccttagag
gacttccaat aagataccag accccagcca tcagagctga gcacaccggg
5280cgggagattg tggacctaat gtgtcatgcc acatttacca tgaggctgct
atcaccagtt 5340agagtgccaa actacaacct gattatcatg gacgaagccc
atttcacaga cccagcaagt 5400atagcagcta gaggatacat ctcaactcga
gtggagatgg gtgaggcagc tgggattttt 5460atgacagcca ctcccccggg
aagcagagac ccatttcctc agagcaatgc accaatcata 5520gatgaagaaa
gagaaatccc tgaacgctcg tggaattccg gacatgaatg ggtcacggat
5580tttaaaggga agactgtttg gttcgttcca agtataaaag caggaaatga
tatagcagct 5640tgcctgagga aaaatggaaa gaaagtgata caactcagta
ggaagacctt tgattctgag 5700tatgtcaaga ctagaaccaa tgattgggac
ttcgtggtta caactgacat ttcagaaatg 5760ggtgccaatt tcaaggctga
gagggttata gaccccagac gctgcatgaa accagtcata 5820ctaacagatg
gtgaagagcg ggtgattctg gcaggaccta tgccagtgac ccactctagt
5880gcagcacaaa gaagagggag aataggaaga aatccaaaaa atgagaatga
ccagtacata 5940tacatggggg aacctctgga aaatgatgaa gactgtgcac
actggaaaga agctaaaatg 6000ctcctagata acatcaacac gccagaagga
atcattccta gcatgttcga accagagcgt 6060gaaaaggtgg atgccattga
tggcgaatac cgcttgagag gagaagcaag gaaaaccttt 6120gtagacttaa
tgagaagagg agacctacca gtctggttgg cctacagagt ggcagctgaa
6180ggcatcaact acgcagacag aaggtggtgt tttgatggag tcaagaacaa
ccaaatccta 6240gaagaaaacg tggaagttga aatctggaca aaagaagggg
aaaggaagaa attgaaaccc 6300agatggttgg atgctaggat ctattctgac
ccactggcgc taaaagaatt taaggaattt 6360gcagccggaa gaaagtctct
gaccctgaac ctaatcacag aaatgggtag gctcccaacc 6420ttcatgactc
agaaggcaag agacgcactg gacaacttag cagtgctgca cacggctgag
6480gcaggtggaa gggcgtacaa ccatgctctc agtgaactgc cggagaccct
ggagacattg 6540cttttactga cacttctggc tacagtcacg ggagggatct
ttttattctt gatgagcgca 6600aggggcatag ggaagatgac cctgggaatg
tgctgcataa tcacggctag catcctccta 6660tggtacgcac aaatacagcc
acactggata gcagcttcaa taatactgga gttttttctc 6720atagttttgc
ttattccaga acctgaaaaa cagagaacac cccaagacaa ccaactgacc
6780tacgttgtca tagccatcct cacagtggtg gccgcaacca tggcaaacga
gatgggtttc 6840ctagaaaaaa cgaagaaaga tctcggattg ggaagcattg
caacccagca acccgagagc 6900aacatcctgg acatagatct acgtcctgca
tcagcatgga cgctgtatgc cgtggccaca 6960acatttgtta caccaatgtt
gagacatagc attgaaaatt cctcagtgaa tgtgtcccta 7020acagctatag
ccaaccaagc cacagtgtta atgggtctcg ggaaaggatg gccattgtca
7080aagatggaca tcggagttcc ccttctcgcc attggatgct actcacaagt
caaccccata 7140actctcacag cagctctttt cttattggta gcacattatg
ccatcatagg gccaggactc 7200caagcaaaag caaccagaga agctcagaaa
agagcagcgg cgggcatcat gaaaaaccca 7260actgtcgatg gaataacagt
gattgaccta gatccaatac cttatgatcc aaagtttgaa 7320aagcagttgg
gacaagtaat gctcctagtc ctctgcgtga ctcaagtatt gatgatgagg
7380actacatggg ctctgtgtga ggctttaacc ttagctaccg ggcccatctc
cacattgtgg 7440gaaggaaatc cagggaggtt ttggaacact accattgcgg
tgtcaatggc taacattttt 7500agagggagtt acttggccgg agctggactt
ctcttttcta ttatgaagaa cacaaccaac 7560acaagaaggg gaactggcaa
cataggagag acgcttggag agaaatggaa aagccgattg 7620aacgcattgg
gaaaaagtga attccagatc tacaagaaaa gtggaatcca ggaagtggat
7680agaaccttag caaaagaagg cattaaaaga ggagaaacgg accatcacgc
tgtgtcgcga 7740ggctcagcaa aactgagatg gttcgttgag agaaacatgg
tcacaccaga agggaaagta 7800gtggacctcg gttgtggcag aggaggctgg
tcatactatt gtggaggact aaagaatgta 7860agagaagtca aaggcctaac
aaaaggagga ccaggacacg aagaacccat ccccatgtca 7920acatatgggt
ggaatctagt gcgtcttcaa agtggagttg acgttttctt catcccgcca
7980gaaaagtgtg acacattatt gtgtgacata ggggagtcat caccaaatcc
cacagtggaa 8040gcaggacgaa cactcagagt ccttaactta gtagaaaatt
ggttgaacaa caacactcaa 8100ttttgcataa aggttctcaa cccatatatg
ccctcagtca tagaaaaaat ggaagcacta 8160caaaggaaat atggaggagc
cttagtgagg aatccactct cacgaaactc cacacatgag 8220atgtactggg
tatccaatgc ttccgggaac atagtgtcat cagtgaacat gatttcaagg
8280atgttgatca acagatttac aatgagatac aagaaagcca cttacgagcc
ggatgttgac 8340ctcggaagcg gaacccgtaa catcgggatt gaaagtgaga
taccaaacct agatataatt 8400gggaaaagaa tagaaaaaat aaagcaagag
catgaaacat catggcacta tgaccaagac 8460cacccataca aaacgtgggc
ataccatggt agctatgaaa caaaacagac tggatcagca 8520tcatccatgg
tcaacggagt ggtcaggctg ctgacaaaac cttgggacgt tgtccccatg
8580gtgacacaga tggcaatgac agacacgact ccatttggac aacagcgcgt
ttttaaagag 8640aaagtggaca cgagaaccca agaaccgaaa gaaggcacga
agaaactaat gaaaataaca 8700gcagagtggc tttggaaaga attagggaag
aaaaagacac ccaggatgtg caccagagaa 8760gaattcacaa gaaaggtgag
aagcaatgca gccttggggg ccatattcac tgatgagaac 8820aagtggaagt
cggcacgtga ggctgttgaa gatagtaggt tttgggagct ggttgacaag
8880gaaaggaatc tccatcttga aggaaagtgt gaaacatgtg tgtacaacat
gatgggaaaa 8940agagagaaga agctagggga attcggcaag gcaaaaggca
gcagagccat atggtacatg 9000tggcttggag cacgcttctt agagtttgaa
gccctaggat tcttaaatga agatcactgg 9060ttctccagag agaactccct
gagtggagtg gaaggagaag ggctgcacaa gctaggttac 9120attctaagag
acgtgagcaa gaaagaggga ggagcaatgt atgccgatga caccgcagga
9180tgggatacaa aaatcacact agaagaccta aaaaatgaag agatggtaac
aaaccacatg 9240gaaggagaac acaagaaact agccgaggcc attttcaaac
taacgtacca aaacaaggtg 9300gtgcgtgtgc aaagaccaac accaagaggc
acagtaatgg acatcatatc gagaagagac 9360caaagaggta gtggacaagt
tggcacctat ggactcaata ctttcaccaa tatggaagcc 9420caactaatca
gacagatgga gggagaagga gtctttaaaa gcattcagca cctaacaatc
9480acagaagaaa tcgctgtgca aaactggtta gcaagagtgg ggcgcgaaag
gttatcaaga 9540atggccatca gtggagatga ttgtgttgtg aaacctttag
atgacaggtt cgcaagcgct 9600ttaacagctc taaatgacat gggaaagatt
aggaaagaca tacaacaatg ggaaccttca 9660agaggatgga atgattggac
acaagtgccc ttctgttcac accatttcca tgagttaatc 9720atgaaagacg
gtcgcgtact cgttgttcca tgtagaaacc aagatgaact gattggcaga
9780gcccgaatct cccaaggagc agggtggtct ttgcgggaga cggcctgttt
ggggaagtct 9840tacgcccaaa tgtggagctt gatgtacttc cacagacgcg
acctcaggct ggcggcaaat 9900gctatttgct cggcagtacc atcacattgg
gttccaacaa gtcgaacaac ctggtccata 9960catgctaaac atgaatggat
gacaacggaa gacatgctga cagtctggaa cagggtgtgg 10020attcaagaaa
acccatggat ggaagacaaa actccagtgg aaacatggga ggaaatccca
10080tacttgggga aaagagaaga ccaatggtgc ggctcattga ttgggttaac
aagcagggcc 10140acctgggcaa agaacatcca agcagcaata aatcaagtta
gatcccttat aggcaatgaa 10200gaatacacag attacatgcc atccatgaaa
agattcagaa gagaagagga agaagcagga 10260gttctgtggt agaaagcaaa
actaacatga aacaaggcta gaagtcaggt cggattaagc 10320catagtacgg
aaaaaactat gctacctgtg agccccgtcc aaggacgtta aaagaagtca
10380ggccatcata aatgccatag cttgagtaaa ctatgcagcc tgtagctcca
cctgagaagg 10440tgtaaaaaat ccgggaggcc acaaaccatg gaagctgtac
gcatggcgta gtggactagc 10500ggttagggga gacccctccc ttacaaatcg
cagcaacaat gggggcccaa ggcgagatga 10560agctgtagtc tcgctggaag
gactagaggt tagaggagac ccccccgaaa caaaaaacag 10620catattgacg
ctgggaaaga ccagagatcc tgctgtctcc tcagcatcat tccaggcaca
10680gaacgccaga aaatggaatg gtgctgttga atcaacaggt tct 10723
* * * * *