U.S. patent application number 12/760461 was filed with the patent office on 2010-10-21 for enhanced homologous recombination mediated by lambda recombination proteins.
This patent application is currently assigned to The Gov. of the USA as represented by the Secretary of the Dept of Health and Human Services. Invention is credited to Neal G. Copeland, Donald L. Court, Hilary M. Ellis, Nancy A. Jenkins, E-Chiang Lee, Pentao Liu, Daiguan Yu.
Application Number | 20100267093 12/760461 |
Document ID | / |
Family ID | 26919354 |
Filed Date | 2010-10-21 |
United States Patent
Application |
20100267093 |
Kind Code |
A1 |
Court; Donald L. ; et
al. |
October 21, 2010 |
ENHANCED HOMOLOGOUS RECOMBINATION MEDIATED BY LAMBDA RECOMBINATION
PROTEINS
Abstract
Disclosed herein are methods for generating recombinant DNA
molecules in cells using homologous recombination mediated by
recombinases and similar proteins. The methods promote high
efficiency homologous recombination in bacterial cells, and in
eukaryotic cells such as mammalian cells. The methods are useful
for cloning, the generation of transgenic and knockout animals, and
gene replacement. The methods are also useful for subcloning large
DNA fragments without the need for restriction enzymes. The methods
are also useful for repairing single or multiple base mutations to
wild type or creating specific mutations in the genome. Also
disclosed are bacterial strains and vectors which are useful for
high-efficiency homologous recombination.
Inventors: |
Court; Donald L.;
(Frederick, MD) ; Yu; Daiguan; (The Woodlands,
TX) ; Lee; E-Chiang; (The Woodland, TX) ;
Ellis; Hilary M.; (San Ramon, CA) ; Jenkins; Nancy
A.; (Ijamsville, MD) ; Liu; Pentao;
(Frederick, MD) ; Copeland; Neal G.; (Ijamsville,
MD) |
Correspondence
Address: |
KLARQUIST SPARKMAN, LLP (OTT-NIH)
121 S.W. SALMON STREET, SUITE #1600
PORTLAND
OR
97204-2988
US
|
Assignee: |
The Gov. of the USA as represented
by the Secretary of the Dept of Health and Human Services
|
Family ID: |
26919354 |
Appl. No.: |
12/760461 |
Filed: |
April 14, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10692553 |
Oct 23, 2003 |
|
|
|
12760461 |
|
|
|
|
10366044 |
Feb 12, 2003 |
7144734 |
|
|
10692553 |
|
|
|
|
PCT/US01/25507 |
Aug 14, 2001 |
|
|
|
10366044 |
|
|
|
|
60225164 |
Aug 14, 2000 |
|
|
|
60271632 |
Feb 26, 2001 |
|
|
|
Current U.S.
Class: |
435/91.41 ;
435/463; 435/471 |
Current CPC
Class: |
C12N 2830/002 20130101;
C12N 15/66 20130101; C12N 2830/60 20130101; C12N 2800/30 20130101;
C12N 2830/55 20130101; C12N 15/8213 20130101; C12N 2800/204
20130101; A01K 67/0275 20130101; C12N 2840/203 20130101; C12N
15/902 20130101; A01K 2217/05 20130101 |
Class at
Publication: |
435/91.41 ;
435/471; 435/463 |
International
Class: |
C12N 15/87 20060101
C12N015/87 |
Claims
1. A method of altering a eukaryotic nucleic acid sequence,
comprising: introducing a nucleic acid of interest into a host
cell, wherein the host cell comprises an extrachromosomal element
comprising at least one intron, at least one exon, or both an
intron and an exon of the eukaryotic nucleic acid sequence, wherein
the nucleic acid of interest is a single stranded nucleic acid in
length or wherein the nucleic acid of interest is a double stranded
DNA comprising a single stranded overhang, and wherein the nucleic
acid of interest comprises a sufficient number of nucleotides
homologous to the eukaryotic nucleic acid sequence to mediate
homologous recombination, and wherein the nucleic acid of interest
is at least 30 nucleotides in length, and wherein the host cell
comprises a pL promoter operably linked to a nucleic acid sequence
encoding a recombinase; and activating expression of the
recombinase from the de-repressible promoter; wherein expression of
the recombinase results in the nucleic acid of interest undergoing
homologous recombination with the eukaryotic nucleic acid sequence,
thereby altering the eukaryotic nucleic acid sequence in the
extrachromosmal element.
2. The method of claim 1, wherein the recombinase is a
single-stranded DNA binding protein.
3. The method of claim 1, wherein the recombinase is a
double-strand break repair recombinase.
4. The method of claim 1, wherein the DNA encoding the recombinase
encodes lambda Beta.
5. The method of claim 4, wherein the DNA encoding the nucleic acid
sequence further encodes lambda Exo.
6. The method of claim 4, wherein the DNA encoding the recombinase
further encodes lambda Gam.
7. The method of claim 1, wherein the extachromosomal element is a
bacterial artificial chromosome, a yeast artificial chromosome, a
P1 artificial chromosome, a plasmid, or a cosmid.
8. The method of claim 61, wherein the eukaryotic nucleic acid
sequence is a mammalian nucleic acid sequence.
9. The method of claim 1, wherein the recombinase is lambda Beta,
and wherein the pL promoter operably linked to the nucleic acid
sequence encoding the recombinase is a mini-lambda.
10. The method of claim 1, wherein the host cell is a bacterial
cell.
11. The method of claim 10, and wherein the bacterial cell
comprises a lambda prophage, and wherein the lambda prophage does
not comprise cro through attR, and does not comprise bioA, and
wherein the prophage comprises a selectable marker substituted for
a cro-bioA segment.
12. The method of claim 10, wherein the bacterial cell is
RecA-.
13. The method of claim 1, wherein the selectable marker confers
tetracycline resistance to the bacterial cell.
14. The method of claim 1, wherein the nucleic acid of interest
encodes an epitope tag.
15. A method of subcloning a DNA sequence, comprising: providing a
bacterial cell comprising a nucleic acid sequence encoding lambda
Exo, Beta and Gam operably linked to pL, and wherein the bacterial
cell further comprises a DNA molecule with a target nucleic acid
sequence, wherein the DNA molecule is located extrachromosomally;
introducing into the bacterial cell a linear plasmid vector with a
5' and a 3' end, wherein the linear plasmid vector comprises an
origin of replication, wherein the linear plasmid vector comprises
a nucleotide sequence homologous to the target nucleic acid
sequence on the 5' end and a nucleic acid sequence homologous to
the target nucleic acid sequence on the 3' end; inducing the
expression of the nucleic acid encoding Exo, Beta and Gam, thereby
inducing homologous recombination between the linear plasmid vector
and the target nucleic acid sequence; thereby inserting the target
nucleic acid into the linear plasmid vector, thereby forming a
circularized plasmid vector; and isolating the circularized plasmid
vector, wherein the circularized plasmid vector comprises a
selectable marker, thereby subcloning the DNA sequence.
16. The method of claim 15, wherein the DNA molecule comprises at
least about 20 kb of DNA.
17. The method of claim 15, wherein the DNA molecule comprises at
least about 40 kb of DNA.
18. The method of claim 15, wherein the DNA comprises at least
about 80 kb of DNA.
19. The method of claim 15, wherein the extrachromosomal DNA is a
bacterial artificial chromosome.
20. The method of claim 15, wherein the bacterial cell is an E.
coli cell.
21. The method of claim 15, wherein the E. coli cell is a recBC
sbcC strain.
22. The method of claim 15, wherein the nucleotide sequence
homologous to the target nucleic acid sequence on the 5' end and
the nucleotide sequence homologous to the target nucleic acid
sequence on the 3' end are single stranded.
23. The method of claim 20, wherein the E. coli cell comprises a
lambda prophage, and wherein the lambda prophage does not comprise
cro through attR, and does not comprise bioA, and wherein the
prophage comprises a selectable marker substituted for a cro-bioA
segment.
24. The method of claim 15, wherein the DNA sequence encodes a
therapeutic protein.
25. The method of claim 15, wherein a human chromosomal nucleic
acid sequence comprises the target nucleic acid sequence.
26. The method of claim 1, wherein the eukaryotic nucleic acid
sequence encodes a therapeutic protein.
27. The method of claim 1, wherein the eukaryotic nucleic acid
sequence is a human nucleic acid sequence.
Description
PRIORITY CLAIM
[0001] This application is a divisional of U.S. patent application
Ser. No. 10/692,553, filed Oct. 23, 2003, which is a continuation
of U.S. patent application Ser. No. 10/366,044, filed Feb. 12,
2003, which issued as U.S. Pat. No. 7,144,773, which is a
continuation-in-part of International Application No.
PCT/US01/25507, filed Aug. 14, 2001, which was published in English
under PCT Article 21(2), and which claims the benefit of U.S.
Provisional Application No. 60/225,164, filed Aug. 14, 2000, and
claims the benefit of U.S. Provisional Application No. 60/271,632,
filed Feb. 26, 2001. All of the prior applications are incorporated
by reference herein in their entirety.
FIELD
[0002] The present disclosure relates to methods to enhance
homologous recombination in bacteria and eukaryotic cells using
recombination proteins, such as those derived from bacteriophage
lambda. It also relates to methods for modifying genomic DNA in
bacterial artificial chromosomes (BACs) and to subcloning of
genomic DNA from BACs into multicopy plasmids.
BACKGROUND OF THE INVENTION
[0003] Concerted use of restriction endonucleases and DNA ligases
allows in vitro recombination of DNA sequences. The recombinant DNA
generated by restriction and ligation may be amplified in an
appropriate microorganism such as E. coli, and used for diverse
purposes including gene therapy. However, the restriction-ligation
approach has two practical limitations: first, DNA molecules can be
precisely combined only if convenient restriction sites are
available; second, because useful restriction sites often repeat in
a long stretch of DNA, the size of DNA fragments that can be
manipulated are limited, usually to less than about 25
kilobases.
[0004] Homologous recombination, generally defined as an exchange
between homologous segments anywhere along a length of two DNA
molecules, provides an alternative method for engineering DNA. In
generating recombinant DNA with homologous recombination, a
microorganism such as E. coli, or a eukaryotic cell such as a yeast
or vertebrate cell, is transformed with exogenous DNA. The center
of the exogenous DNA contains the desired transgene, whereas each
flank contains a segment of homology with the cell's DNA. The
exogenous DNA is introduced into the cell with standard techniques
such as electroporation or calcium phosphate-mediated transfection,
and recombines into the cell's DNA, for example with the assistance
of recombination-promoting proteins in the cell.
[0005] In generating recombinant DNA by homologous recombination,
it is often advantageous to work with short linear segments of DNA.
For example, a mutation may be introduced into a linear segment of
DNA using polymerase chain reaction (PCR) techniques. Under proper
circumstances, the mutation may then be introduced into cellular
DNA by homologous recombination. Such short linear DNA segments can
transform yeast, but subsequent manipulation of recombinant DNA in
yeast is laborious. It is generally easier to work in bacteria, but
linear DNA fragments do not readily transform bacteria (due in part
to degradation by bacterial exonucleases). Accordingly,
recombinants are rare, require special poorly-growing strains (such
as RecBCD-mutant strains) and generally require thousands of base
pairs of homology. Thus, improved methods of promoting homologous
recombination in bacteria are needed.
[0006] In eukaryotic cells, targeted homologous recombination
provides a basis for targeting and altering essentially any desired
sequence in a duplex DNA molecule, such as targeting a DNA sequence
in a chromosome for replacement by another sequence. The approach
may be useful for treating human genetic diseases.
[0007] Homologous recombination has been used to create knock-out
mutants and transgenic animals, and thereby has played a critically
important role in understanding gene function. Transgenic animals
are organisms that contain stably integrated copies of genes or
gene constructs derived from another species in the chromosome of
the transgenic animal. These animals can be generated by
introducing cloned DNA constructs of the foreign genes into
totipotent cells by a variety of methods, including homologous
recombination.
[0008] Currently, methods for producing transgenics have been
performed on totipotent embryonic stem cells (ES) and with
fertilized zygotes. ES cells have an advantage in that large
numbers of cells can be manipulated in vitro before they are used
to generate transgenics. Alternatively, DNA can also be introduced
into fertilized oocytes by micro-injection into pronuclei, or
injection into the germline of organisms including C. elegans or
Drosophila species.
[0009] Several methods have been developed to detect and/or select
for targeted site-specific recombinants between vector DNA and the
target homologous chromosomal sequence (Capecchi, Science 244:1288,
1989). Cells that exhibit a specific phenotype after recombination,
such as occurs with alteration of the hypoxanthine phosphoribosyl
transferase (hprt) gene, can be obtained by direct selection on the
appropriate growth medium. Alternatively, a selectable marker such
as neomycin resistance can be incorporated into a vector under
promoter control, and successful transfection can be scored by
selecting G418-resistant cells (Joyner et al., Nature 338:153,
1989). Numerous other selection procedures have been described
(Jasin and Berg, Genes and Development 2:1353, 1988; Doetschman et
al., Proc. Natl. Acad. Sci. U.S.A. 85:8583, 1988; Dorini et al.,
Science 243:1357, 1989; Itzhaki and Porter, Nucl. Acids Res.
19:3835, 1991). Unfortunately, exogenous sequences transferred into
eukaryotic cells undergo homologous recombination only at very low
frequencies, even when very long homology regions are present
(Koller et al., Proc. Natl. Acad. Sci. U.S.A., 88:10730, 1991, and
Snouwaert et al., Science 257:1083, 1992). Thus, large numbers of
cells must be transfected, selected, and screened in order to
generate a correctly targeted homologous recombinant.
SUMMARY OF THE DISCLOSURE
[0010] The present disclosure provides methods for cloning DNA
molecules in cells having DNA encoding lambda recombinases operably
linked to a de-repressible promoter, for example the lambda pL
promoter. The pL promoter is activated, for example by temperature
shift, thereby leading to expression of lambda recombinases. The
lambda recombinases promote homologous recombination between
nucleic acids in the cell. The nucleic acids undergoing
recombination may be intrachromosomal, or may be extrachromosomal,
for example in a bacterial artificial chromosome.
[0011] The present disclosure also provides methods for inducing
homologous recombination using single-stranded DNA molecules, by
introducing into the cell DNA capable of undergoing homologous
recombination, and a single-stranded DNA binding polypeptide
capable of promoting homologous recombination. Such single-stranded
DNA binding polypeptides include lambda Beta, RecT, P22 Erf, and
Rad52, as well as functional fragments and variants of
single-stranded DNA binding polypeptides.
[0012] The present disclosure also provides bacterial cells that
promote efficient homologous recombination. These bacterial cells
contain one or more genes or promoters from a defective lambda
prophage within the bacterial chromosome.
[0013] The disclosure also provides methods for altering eukaryotic
genes by expressing recombinases operably linked to a
de-repressible promoter in bacterial cells. Eukaryotic genes thus
modified can be used to modify eukaryotic cells, for example to
generate transgenic or knockout animals.
BRIEF DESCRIPTION OF THE FIGURES
[0014] FIG. 1 is a linear depiction of the defective lambda
prophage as it is integrated on the E. coli chromosome. Prophage
genes are indicated by the solid line, and E. coli genes by broken
lines. The coding regions for the lambda recombination genes exo,
bet and gam are approximately in the center of the defective
prophage. Lambda genes cro through attR, deleted from the defective
prophage, are enclosed within parentheses together with the E. coli
bioA gene to indicate their deletion.
[0015] FIG. 2A is a schematic diagram showing classical recombinant
technology, and FIG. 2B is a schematic diagram showing
"recombineering" using homologous recombination, as disclosed
herein.
[0016] FIG. 3 is a graph that shows the effect of induction time of
the lambda proteins Beta, Exo, and Gam on recombination efficiency.
A linear chloramphenicol resistance cassette was used to target
prophage genes, and was electroporated into cells after the cells
had been heated to 42.degree. C. for the time indicated. Time of
induction (temperature shift to 42.degree. C.) is plotted on the
x-axis, against number of chloramphenicol-resistant recombinants
obtained on the y-axis.
[0017] FIG. 4 is a graph that shows the effect of linear DNA amount
on recombination. The E. Coli strain DY330 was induced at
42.degree. C. for 15 minutes, and DNA encoding a linear
chloramphenicol resistance cassette (<cat>) at the indicated
concentration was electroporated into cells. DNA concentration
encoding <cat> is plotted on the x-axis, against number of
chloramphenicol-resistant recombinants obtained on the y-axis.
[0018] FIG. 5 is a graph which shows the effect of homologous arm
length on recombination in E. coli cells induced for expression of
lambda recombination proteins Beta, Exo, and Gam. A chloramphenicol
resistance cassette was synthesized with homologous arms of the
indicated length at its 5' and 3' end. Homologous arm length was
varied from 0 to 1,000 base pairs. Length of homologous arms is
plotted on the x-axis, against number of chloramphenicol-resistant
recombinants (log scale) on the y-axis.
[0019] FIG. 6 is a linear depiction of the modified defective
lambda prophage as integrated on the E. coli chromosome of DY380,
EL250, and EL350 cells. This figure illustrates that the defective
prophages used for BAC engineering contain the .lamda. genes from
cI857 to int. P.sub.L (or pL) and P.sub.R denote the lambda left
and right promoters, respectively. The gam and red genes, exo and
bet are under the control of P.sub.L, which is repressed by the
temperature-sensitive repressor, cI857 at 32.degree. C. and
de-repressed at 42.degree. C. tet replaces the segment from
cro-bioA in DY380 cells. The araC-P.sub.BADflpe cassette or the
araC-P.sub.BADcre cassette replaces the segment from cro-bioA in
EL250 or EL350 cells, respectively. The promoter of the araBAD
operon (P.sub.BAD), which can be induced by L-arabinose, controls
the expression of the flpe or Cre genes. Thick black lines
designate the prophage while thin lines represent E. coli sequence.
< > defines the ends of the cro-bioA region that was replaced
with tet, araC-P.sub.BAD flpe, or araC-P.sub.BAD cre.
[0020] FIG. 7 illustrates a strategy for BAC engineering. This
figure illustrates the relative position of the Eno2 gene in the
fully sequenced 250-kbp BAC, 284H12 and the different steps used to
introduce Cre into the last exon of Eno2. In the targeting
cassette, frt sites are denoted by ellipses, the kan gene by a red
rectangle and the GFPcre fusion gene by a blue rectangle. The green
boxes represent Eno2 exons.
[0021] FIG. 8 is a schematic diagram illustrating the use of the
gap repair to subclone fragments as large as 80 kbp from BACs. FIG.
8A shows as short thick black arrows the location of the 5'
homologies on the amplification primers used to amplify pBR322 for
subcloning by gap repair. Each primer also contains 20 nt segments
at its 3' end to prime pBR322. NotI and SalI cleavage sites were
included in these primers to facilitate release of the subcloned
fragments from the plasmid backbone. The location of SpeI
restriction sites near Eno2 is also shown ("S"). SpeI restriction
sites are not present on the linear amplified pBR322 vector. FIG.
8B shows an intermediate step in gap repair, pairing between a
typical amplified pBR322 targeting cassette and the modified Eno2
BAC. Ap, amp resistance gene; ORI, origin of replication.
[0022] FIG. 9 is a schematic diagram of a defective .lamda.
prophage. The defective prophage DY380 expressing the Exo, Beta,
and Gam functions is shown with the genes under P.sub.L promoter
control and the temperature sensitive repressor, CI857. Advantages
and disadvantages of the systems are described. The genes encoding
Cre and Flpe are present on other derivatives of DY380 (EL250 and
EL350) and replace the tet gene as shown.
[0023] FIG. 10 is a schematic diagram of in vivo cloning by
recombination using gap repair of a linear vector plasmid. The
method of in vivo cloning uses two linear DNAs, a vector and a
target DNA, that have homologies to each other at their ends. Both
are electroporated into competent cells to allow recombination and
gap repair of the plasmid. The linear vector is made in a similar
way to that shown in FIG. 8.
[0024] FIG. 11 is a schematic diagram of in vivo retrieving of DNA
from BAC clones. Retrieving of segments up to 80 kbp from BACs into
PCR-amplified vectors has been possible using recombineering
techniques disclosed herein. Here only the plasmid is linearized
and transformed into a recombination competent cell containing the
BAC. Recombination occurs between homologies on the end of the
linear vector and the BAC. This method eliminates standard cloning
technology from the BAC, and importantly, the cloned segment is
never replicated in vitro, thereby reducing the chance of
extraneous changes in the sequence.
[0025] FIG. 12 is a schematic diagram of a mini-lambda DNA circle.
This lambda DNA element is not a plasmid and lacks any replication
origin activity. It does contain the lambda cI857 repressor and the
pL operon that the repressor controls. It also contains a cassette
encoding a drug marker, in this case the tet genes. This DNA when
transformed into most strains including the BAC strains makes Int
protein allowing integration of the circular DNA at the .lamda.
attachment site on the bacterial chromosome, and cI857 repressor to
allow repression of pL. The integrated mini-lambda is stable but
able to be induced at 42.degree. C. to activate Gam, Beta, and Exo
expression to make the cell recombination competent.
[0026] FIG. 13 is a schematic diagram of recombination of ssDNA
into the genome. When ssDNA is electroporated into cells, it is
bound by Beta protein and recombined into the genome or into a BAC
plasmid by homology. Evidence suggests that Beta-bound ssDNA
anneals to its ssDNA complement at the replication fork. The strand
of DNA corresponding to that made by lagging strand synthesis is
most recombinogenic suggesting that Beta simply anneals the ssDNA
to a gap caused by DNA replication.
[0027] FIG. 14 is a schematic diagram of subcloning a DNA fragment
from a BAC into pBluescript (pSK.sup.+) by gap repair with short
homology arms via recombineering. Primers that have 20 bp of
homology (arrows) to pBluescript (circle) at their 3' end, and 50
bp (dark area) of homology at their 5' ends to one of two ends of
the BAC DNA to be subcloned (thinner areas, exon 4 in center), are
used to amplify pBluescript. The PCR-amplified, linearized,
pBluescript containing the two homology arms is then transformed
into recombination-competent cells that carry the BAC. Gap-repaired
plasmids are selected by their ampicillin resistance. The black bar
denotes the location of Evi9 exon 4.
[0028] FIG. 15 is a schematic diagram of an improved procedure for
subcloning DNA from BACs and for constructing cko-targeting
vectors. The homology arms used for gap repair (subcloning) and for
targeting, are PCR-amplified from BAC DNA. The two-homology arms
(arrow, segments ending with AB or YZ, homologies indicated by
light lines to plasmid), amplified using primers A and B or primers
Y and Z, were cloned into a MC1TK-containing plasmid, to generate
the gap repair (retrieval) plasmid for subcloning. The gap repair
plasmid was linearized with HindIII to create a DNA double strand
break for gap repair. A mini-targeting vector was constructed by
ligating together the two PCR products generated by amplification
of BAC DNA with primers C and D (segment indicated as ending with
CD) or primers E and F (segments indicated as ending with EF), a
floxed Neo selection cassette (black arrow: LoxP site), and
pBluescript. A BglII restriction site was included in the
mini-targeting vector for diagnosing gene targeting in ES cells.
The black arrows denote LoxP sites. The targeting cassette was
excised by NotI and SalI digestion, or by PCR amplification, using
primers C and F. The gap-repaired plasmid, and the excised
targeting cassette, were co-transformed into
recombination-competent DY380 or EL350 cells. The recombinants had
a floxed Neo cassette inserted between primers D and E and can be
selected on kanamycin plates. The Neo cassette was excised with Cre
recombinase, leaving a single LoxP site at the targeted locus (see
FIG. 16). Similarly, a Neo selection cassette can be inserted
between primers H and I using homology arms amplified by primers G,
H (segment indicated as ending with GH), and I, J (segments
indicated as ending with IJ).
[0029] FIGS. 16A and 16B are sets of schematic diagrams and a
digital image of the construction of an Evi9 conditional knockout
allele. FIG. 16A is a set of schematic diagrams of the 11.0 kb
genomic DNA fragment containing Evi9 exon 4 was subcloned from
BAC-A12 using gap repair. EcoRV digestion of the gap-repaired
plasmid generates 7.6 kb and 8.8 kb fragments. The 7.6 kb fragment
contains Evi9 exon 4 sequences, while the 8.8 kb fragment, common
to all lanes contains plasmid sequences and Evi9 sequences located
upstream of exon 4. The floxed Neo cassette of PL452 was targeted
upstream of Evi9 exon 4. In the targeted plasmid, the 7.6 kb EcoRV
fragment increases in size to 9.6 kb due to the addition of the
floxed Neo cassette. Excision of the floxed Neo cassette leaves
behind a single LoxP (black arrow) at the targeted locus, and the
normal EcoRV digestion pattern is restored. Next, the PL451
selection cassette containing the Neo gene flanked by frt sites
(grey arrow) and a downstream LoxP, was targeted downstream of Evi9
exon 4. The PL451 selection cassette contains an EcoRV site, which
results in the production of 6.5 kb and 3.1 kb fragments following
EcoRV digestion. This is the Evi9 cko-targeting vector. To test the
functionality of the frt sites in the cko-targeting vector, the
PL451 selection cassette was excised from the cko-targeting vector
by FLP recombinase following electroporation into EL250 cells. This
reduces the size of the 6.5 kb EcoRV fragment to 4.5 kb. Finally,
electroporation of the cko-targeting cassette into EL350 cells
expressing Cre recombinase excises the entire DNA between the
two-LoxP sites, creating a 4.6 kb EcoRV fragment. FIG. 16B is a
digital image of EcoRV-digestion patterns of the plasmids at every
stage of the targeting vector construction.
[0030] FIGS. 17A and 17B are a schematic diagram and digital image
showing the identification of correctly targeted ES cell clones.
FIG. 17A is a schematic diagram of homologous recombination between
the Evi9 cko-targeting vector and the Evi9 genomic locus. Correctly
targeted ES cells (cko allele) have a 5.5 kb BglII band, in
addition to an 18.1 kb wild type band, following hybridization with
the 5' probe. These cko clones also have a 6.3 kb EcoRV-targeted
band, as well as a 7.3 kb wild type band, following hybridization
with the 3' probe. FIG. 17B is a digital image of a Southern blot
analysis of the ES cell clones. The 5' probe was used in the left
panel and a 3' probe was used in the right panel. wt: wild type ES
clones, cko: conditional knockout ES clones.
[0031] FIG. 18 is a flow chart of making a conditional knockout
vector based on recombineering.
DETAILED DESCRIPTION OF SPECIFIC EMBODIMENTS
[0032] There exists a need in the art for methods of precisely and
efficiently altering predetermined endogenous genetic sequences by
homologous recombination in vivo. There independently exists a need
in the art for high-efficiency gene targeting, so as to avoid
complex in vitro or in vivo selection protocols. Methods are
disclosed herein for cloning DNA molecules in cells using
homologous recombination mediated by lambda recombinases and
similar proteins.
[0033] One such method uses a cell having DNA encoding functional
Beta and optionally Exo, and Gam, or functional fragments or
variants thereof, operably linked to the a de-repressible promoter
(such as, but not limited to, the pL promoter). De-repression of
the de-repressible promoter (e.g. the induction of transcription
from the pL promoter by inactivation of cI) induces expression of
exo, bet and gam and in some embodiments may be selectively
activated for this purpose. A nucleic acid (such as a
polynucleotide which is homologous to a target DNA sequence)
capable of undergoing homologous recombination is introduced into
the cell, and cells in which homologous recombination has occurred
are either selected or found by direct screening of cells. In
particular embodiments, the nucleic acid introduced into the cell
may be double strand DNA, or DNA with 5' overhangs.
[0034] In additional particular embodiments, at least 1 in 5000
cells contain DNA in which homologous recombination has occurred.
In further embodiments, at least 1 in 1,000 cells, or 1 in 500
cells, 1 in 100 cells, or 1 in 20 cells contain DNA in which
homologous recombination has occurred.
[0035] The cell may be a eukaryotic cell, or a prokaryotic cell,
such as a bacterial cell, for example an E. coli strain. The DNA
encoding the lambda recombination proteins and pL promoter may be
intrachromosomal or extrachromosomal. Similarly, the target DNA
sequence may be intrachromosomal or extrachromosomal; for example,
the target DNA sequence may be found in a chromosome of the cell or
a plasmid (including derivatives of colE1, pSC101, p15A and shuttle
vectors that replicate in both bacteria and eucaryotic cells),
bacterial artificial chromosome, P1 artificial chromosome, yeast
artificial chromosome, cosmid or the like.
[0036] In additional particular embodiments, the nucleic acid
introduced into the cell may be double-stranded DNA or DNA with a
5' overhang, and may include a positive or negative selectable
marker. The introduced nucleic acid may alter the function of a
nucleic acid sequence such as a gene in the cell, or add a gene to
the DNA of the cell. The cell may be treated to enhance
macromolecular uptake, for example using electroporation, calcium
phosphate-DNA coprecipitation, liposome mediated transfer, or other
suitable methods. In other particular embodiments, the method may
produce homologous recombination that alters the function of a gene
in the cell, or adds a gene to the cell.
[0037] In further particular embodiments, the cell may be treated
to enhance macromolecular uptake, for example with electroporation,
calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated
transfection, polybrene-mediated transfection, microinjection,
liposome fusion, lipofection, protoplast fusion, inactivated
adenovirus-mediated transfer, HVJ-liposome mediated transfer, and
biolistics.
[0038] Another such method that meets one or more of the
above-mentioned needs includes methods that introduce into the cell
DNA capable of undergoing homologous recombination and a ssDNA
binding polypeptide capable of promoting homologous recombination.
In particular embodiments, the DNA is ssDNA or DNA having 3'
overhangs.
[0039] The single stranded DNA (ssDNA) binding polypeptide is a
type of DNA binding polypeptide which mediates double strand break
repair homologous recombination by binding to ssDNA or a 3'
overhang in dsDNA and promoting recombination. It promotes
recombination by annealing the bound ssDNA to its complement in the
cell. Examples of such ssDNA binding polypeptide include lambda
Beta, E. coli RecT, Erf of bacteriophage P22, and Rad52. The ssDNA
binding polypeptide may be introduced as a nucleic acid. For
example, a nucleic acid that expresses the ssDNA binding
polypeptide is introduced into a cell, such as a eukaryotic cell.
Expression of the ssDNA binding polypeptide from a nucleic acid may
be induced, for example, by activation of an inducible promoter. In
particular embodiments, the nucleic acid may further include lambda
exo and gam, and the inducible promoter may be the lambda pL
promoter. In other embodiments, the ssDNA binding polypeptide is
introduced into the cell as a polypeptide.
[0040] The cell used in methods disclosed herein may be a bacterial
cell such as an E. coli strain, or a eukaryotic cell such as a
mammalian cell, a stem cell, or virtually any other eukaryotic cell
type. The DNA used in the method may be a single oligonucleotide
sequence, or may be two or more overlapping sequences, for example
with more than 10, or more than 20 base pairs of complementary
overlap at either their 5' or 3' termini (in specific examples of
the 5' case, the nucleic acid includes exo and bet nucleic acid
sequences). The DNA may comprise a selectable marker, and
homologous recombination with the ssDNA may confer a selectable
phenotype upon the cell. In particular embodiments, the cell may be
treated to enhance macromolecular uptake, such as with
electroporation, calcium phosphate-DNA coprecipitation, liposome
mediated transfer, or other suitable methods. The effect of
homologous recombination may be to alter the function of a gene in
the cell, or add a gene to the cell.
[0041] In particular examples, the ssDNA is used in an amount of
about 0.01 .mu.M to about 10 mM; or from about 0.1 .mu.M to about 1
mM; or from about 1 .mu.M to about 100 .mu.M. In other examples,
the ssDNA binding polypeptide is used in an amount of 0.001 .mu.M
to about 0.01 .mu.M, or from about 0.01 .mu.M to about 10 mM; or
from about 0.1 .mu.M to about 1 mM; or from about 1 .mu.M to about
100 .mu.M.
[0042] Also disclosed are bacterial cells that may be useful in
practicing the disclosed methods. These include bacterial cells
harboring a defective lambda prophage of genotype .lamda.cI857
.DELTA.(cro-bioA). In particular examples, the bacterial cells may
have a selectable marker, such as an antibiotic resistance marker,
upstream of the cI857 gene. In some particular examples, the
disclosed bacterial cells include an inducible promoter upstream of
the cI857 gene, which may be operably connected to a gene encoding
a recombinase, such as flp, flpe, or Cre, or a gene encoding
functional fragments or variants of these recombinases. In other
particular examples, the bacterial cells may contain a bacterial
artificial chromosome, which may have a selectable marker, LoxP,
and/or frt sites. In particular embodiments, the selectable marker
on the bacterial artificial chromosome is excisable by a
recombinase. In other particular examples, the bacterial artificial
chromosome may have at least one exon or at least one intron of a
mammalian gene.
[0043] The disclosure also includes methods of altering eukaryotic
genes by expressing in a bacterial cell an intrachromosomal gene
encoding a recombinase operably linked to a pL promoter. The
bacterial cell also includes an extrachromosomal eukaryotic gene or
gene fragment (having at least one intron or at least one exon of a
eukaryotic gene). A nucleic acid capable of undergoing homologous
recombination with the eukaryotic gene is introduced into the
bacterial cell, and the nucleic acid undergoes homologous
recombination with the eukaryotic gene or gene fragment. In a
particular embodiment, the nucleic acid undergoes homologous
recombination with a targeting frequency of at least about 1 in
1,000.
[0044] In one embodiment, the expressed recombinase is a double
strand break repair recombinase, such as lambda Beta or other
single-stranded DNA binding protein; lambda Exo, or lambda Gam. In
another embodiment, the extrachromosomal eukaryotic gene or gene
fragment may be located on a bacterial artificial chromosome, yeast
artificial chromosome, P1 artificial chromosome, plasmid or cosmid.
In yet another embodiment, the eukaryotic gene or gene fragment is
derived from a mammalian organism, such as a mouse or human.
[0045] In several additional embodiments, the nucleic acid
undergoing homologous recombination may encode a recombinase,
functional fragments or variants of a recombinase, or an epitope
tag.
[0046] Also disclosed are methods of altering intrachromosomal DNA
of a eukaryotic cell. In these methods, an altered eukaryotic gene
or gene fragment is introduced into the eukaryotic cell. The
introduced eukaryotic gene or gene fragment has been altered by
homologous recombination using the methods of this disclosure.
[0047] For example, extrachromosomal DNA including the eukaryotic
gene or gene fragment is introduced into a bacterial cell having an
intrachromosomal gene encoding a recombinase operably linked to a
de-repressible promoter. The bacterial cell is then induced to
express the recombinase. A nucleic acid molecule capable of
undergoing homologous recombination with the eukaryotic gene or
gene fragment is introduced into the bacterial cell. The eukaryotic
gene or gene fragment undergoes homologous recombination with the
nucleic acid, and altered eukaryotic gene or gene fragment may then
be isolated and introduced into a eukaryotic cell.
[0048] In one embodiment, the eukaryotic gene or gene fragment
introduced into the eukaryotic cell is located on a bacterial
artificial chromosome. The eukaryotic gene or gene fragment is
capable of undergoing homologous recombination with a target gene
in the cell, thereby altering the nucleic acid sequence of the
eukaryotic cell's intrachromosomal DNA. In specific, non-limiting
examples, the eukaryotic cell is a mammalian cell, an embryonic
stem cell, or a zygote.
[0049] Also disclosed are mutant mammals which have had one or more
of their genes altered by homologous recombination with a bacterial
artificial chromosome carrying a eukaryotic gene or gene fragment
that has been altered by the disclosed methods. The gene alteration
can introduce a recombinase into the mutant mammal, such as a
site-specific recombinase.
[0050] A mobilizable lambda DNA is also disclosed herein that is
isolated as a mini-lambda prophage. The mobilizable lambda DNA can
be transformed into any bacterial strain of interest. The lambda
DNA integrates into the bacterial chromosome to generate a
defective prophage that expresses the recombinase.
[0051] The present disclosures provide methods of enhancing the
efficiency of homologous recombination. The disclosures will be
better understood by reference to the following explanation of
terms used and detailed description of methods for carrying out the
invention.
[0052] Unless otherwise noted, technical terms are used according
to conventional usage. Definitions of common terms in molecular
biology may be found in Benjamin Lewin, Genes V, published by
Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al.
(eds.), The Encyclopedia of Molecular Biology, published by
Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A.
Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive
Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN
1-56081-569-8).
I. Terms
[0053] 3' overhang: Two nucleic acid sequences which when annealed
are partially double-stranded and partially single-stranded. The
single-stranded end or ends extend away from the double-stranded
segment in a 5' to 3' direction.
[0054] 5' overhang: Two nucleic acid sequences which when annealed
are partially double-stranded and partially single-stranded. The
single-stranded end or ends extend away from the double-stranded
segment in a 3' to 5' direction.
[0055] Antibiotic Resistance Cassette: A nucleic acid sequence
encoding a selectable marker which confers resistance to that
antibiotic in a host cell in which the nucleic acid is translated.
Examples of antibiotic resistance cassettes include, but are not
limited to: kanamycin, ampicillin, tetracycline, chloramphenicol,
neomycin, hygromycin, and zeocin.
[0056] Arabinose: A simple 5-carbon sugar metabolized by E. coli.
In one embodiment, it is used as a chemical to inactivate
repression and to induce and activate expression from the promoter
pBAD.
[0057] Attachment Site (att): A site specific site for
recombination that occurs on either a phage or a chromosome. An
attachment site on lambda is termed "attP", while an attachment
site of a bacterial chromosome is "attB." Integrase mediated
recombination of an attP site with an attB site leads to
integration of the prophage in the bacterial chromosome.
[0058] Bacterial artificial chromosome (BAC): Bacterial artificial
chromosomes (BACs) have been constructed to allow the cloning of
large DNA fragments in E. coli, as described in O'Conner et al.,
Science 244:1307-12, 1989; Shizuya et al., Proc. Natl. Acad. Sci.
U.S.A. 89:8794-7, 1992; Hosoda et al., Nucleic Acids Res.
18:3863-9, 1990; and Ausubel et al., eds., Current Protocols In
Molecular Biology, John Wiley & Sons .COPYRGT. 1998
(hereinafter Ausubel et al., herein incorporated in its entirety).
This system is capable of stably propagating mammalian DNA over 300
kb. In one embodiment, a BAC carries the F replication and
partitioning systems that ensure low copy number and faithful
segregation of plasmid DNA to daughter cells. Large genomic
fragments can be cloned into F-type plasmids, making them of use in
constructing genomic libraries.
[0059] Beta: The 28 kDa lambda Beta ssDNA binding polypeptide (and
nucleic acid encoding lambda beta) involved in double strand break
repair homologous recombination. DNA encoding Beta (bet) and
polypeptide chains having lambda Beta activity are also referred to
herein as bet. See Examples 1 and 14 and references therein for
further information. The lambda Beta protein binds to
single-stranded DNA and promotes renaturation of complementary
single strand regions of DNA (see also Karakousis et al., J. Mol.
Biol. 276:721-733, 1998; Li et al., J. Mol. Biol. 276:721-733,
1998; Passy et al., PNAS 96:4279-4284, 1999).
[0060] Functional fragments and variants of Beta include those
variants that maintain their ability to bind to ssDNA and mediate
the recombination function of lambda Beta as described herein, and
in the publications referenced herein. It is recognized that the
gene encoding Beta may be considerably mutated without materially
altering the ssDNA binding function or homologous recombination
function of lambda Beta. First, the genetic code is well-known to
be degenerate, and thus different codons encode the same amino
acids. Second, even where an amino acid mutation is introduced, the
mutation may be conservative and have no material impact on the
essential functions of lambda Beta. See Stryer, Biochemistry 3rd
Ed., .COPYRGT. 1988. Third, part of the lambda Beta polypeptide
chain may be deleted without impairing or eliminating its ssDNA
binding protein function, or its recombination function. Fourth,
insertions or additions may be made in the lambda Beta polypeptide
chain--for example, adding epitope tags--without impairing or
eliminating its essential functions (see Ausubel et al., 1997,
supra).
[0061] Biolistics: Insertion of DNA into cells using DNA-coated
micro-projectiles. Also known as particle bombardment or
microparticle bombardment. The approach is further described and
defined in U.S. Pat. No. 4,945,050, which is herein incorporated by
reference.
[0062] cDNA (complementary DNA): A piece of DNA lacking internal,
non-coding segments (introns) and regulatory sequences that
determine transcription. cDNA may be synthesized in the laboratory
by reverse transcription from messenger RNA extracted from
cells.
[0063] Cosmid: Artificially constructed cloning vector containing
the cos gene of phage lambda. Cosmids can be packaged in lambda
phage particles for infection into E. coli; this permits cloning of
larger DNA fragments (up to 45 kb) than can be introduced into
bacterial hosts in plasmid vectors.
[0064] Cre: The Cre recombinase is a site-specific recombinase. It
recognizes and binds to specific sites called LoxP. Two LoxP sites
recombine at nearly 100% efficiency in the presence of Cre, thus,
permitting DNA cloned between two such sites to be efficiently
removed by the Cre-mediated recombination.
[0065] De-repressible Promoter: When a repressor is bound to a
de-repressible promoter transcription is substantially decreased as
compared to transcription from the de-repressible promoter in the
absence of repressor. By regulating the binding of the repressor,
such as by changing the environment, the repressor is released from
the de-repressible promoter, and transcription increases. As used
herein, a de-repressible promoter does not require an activator for
transcription. One specific, non-limiting example is the pL
promoter, which is regulated by the repressor cI, but is not
activated by an activator. The arabinose promoter is not a simple
de-repressible promoter as arabinose inactivates the repressor AraC
and converts it to an activator.
[0066] In one embodiment, the de-repressible promoter is a
temperature sensitive de-repressible promoter. For example, by
increasing the temperature, the repressor is released from the
promoter, or can no longer bind to the promoter with a high
affinity, and transcription is increased from the promoter. One
specific, non-limiting example is the induction of pL promoter
activity by increasing the temperature of the cell. Increased
temperature inactivates the temperature-sensitive repressor cI,
allowing genes that are operably linked to the pL promoter to be
expressed at increased levels. One of skill in the art can readily
identify a repressible promoter.
[0067] In one embodiment, a de-repressible promoter is
auto-regulated. One specific, non-limiting example of an
auto-regulated de-repressible promoter is pL. If only one copy of a
gene encoding cI is present, yet many copies of the pL promoter are
present, expression of cI is upregulated such that transcription is
blocked from any of the pL promoters.
[0068] Double-strand break repair recombination: A type of
homologous recombination exemplified by the lambda recombination
proteins Exo, Beta and Gam, and shared by numerous other
recombinase systems. A double strand break is the initiation point
for concerted action of recombination proteins. Typically, an
exonuclease degrades processively from the 5' ends of these break
sites, and ssDNA binding polypeptide binds to the remaining 3'
single strand tail, protecting and preparing the recessed DNA for
homologous strand invasion (Szostak et al., Cell 33:25-35, 1983;
Little, J. Biol. Chem. 242:679-686, 1967; Carter et al., J. Biol.
Chem. 246:2502-2512, 1971; Lindahl et al., Science 286:1897-1905,
1999). Examples of ssDNA binding polypeptides which bind to either
ssDNA and/or dsDNA with 3' overhangs and promote double-strand
break repair recombination include lambda Beta, RecT of E. coli,
Erf of phage p22, and Rad52 in various eukaryotic cells including
yeast and mammalian cells.
[0069] Electrocompetent: Cells capable of macromolecular uptake
upon treatment with electroporation.
[0070] Electroporation: A method of inducing or allowing a cell to
take up macromolecules by applying electric fields to reversibly
permeabilize the cell walls. Various methods and apparatuses used
are further defined and described in: U.S. Pat. No. 4,695,547; U.S.
Pat. No. 4,764,473; U.S. Pat. No. 4,882,28; U.S. Pat. No.
4,946,793; U.S. Pat. No. 4,906,576; U.S. Pat. No. 4,923,814; and
U.S. Pat. No. 4,849,089, all of which are herein incorporated by
reference.
[0071] Eukaryotic cell: A cell having an organized nucleus bounded
by a nuclear membrane. These include lower organisms such as
yeasts, slime molds, and the like, as well as cells from
multicellular organisms such as invertebrates, vertebrates, and
mammals. They include a variety of tissue types, such as, but not
limited to, endothelial cell, smooth muscle cell, epithelial cell,
hepatocyte, cells of neural crest origin, tumor cell, hematopoetic
cell, immunologic cell, T cell, B cell, monocyte, macrophage,
dendritic cell, fibroblast, keratinocyte, neuronal cell, glial
cell, adipocyte, myoblast, myocyte, chondroblast, chondrocyte,
osteoblast, osteocyte, osteoclast, secretory cell, endocrine cell,
oocyte, and spermatocyte. These cell types are described in
standard histology texts, such as McCormack, Introduction to
Histology, .COPYRGT. 1984 by J.P. Lippincott Co.; Wheater et al.,
eds., Functional Histology, 2nd Ed., .COPYRGT. 1987 by Churchill
Livingstone; Fawcett et al., eds., Bloom and Fawcett: A Textbook of
Histology, .COPYRGT. 1984 by William and Wilkins, all of which are
incorporated by reference in their entirety. In one specific,
non-limiting example, a eukaryotic cell is a stem cell, such as an
embryonic stem cell.
[0072] Exo: The exonuclease of lambda (and the nucleic acid
encoding the exonuclease protein) involved in double strand break
repair homologous recombination. See Example 1 and references
therein for further description.
[0073] Exogenous: The term "exogenous" as used herein with
reference to nucleic acid and a particular cell refers to any
nucleic acid that does not originate from that particular cell as
found in nature. Thus, a non-naturally-occurring nucleic acid is
considered to be exogenous to a cell once introduced into the cell.
Nucleic acid that is naturally-occurring also can be exogenous to a
particular cell. For example, an entire chromosome isolated from a
cell of subject X is an exogenous nucleic acid with respect to a
cell of subject Y once that chromosome is introduced into Y's
cell.
[0074] Extrachromosomal: Not incorporated into the chromosome or
chromosomes of a cell. In the context of nucleic acids,
extrachromosomal indicates an DNA oligonucleotide that is not
covalently incorporated into the chromosome or chromosomes of a
cell. Intrachromosomal refers to material such as an
oligonucleotide that is incorporated into the chromosome or
chromosomes of a cell, such as a DNA oligonucleotide covalently
incorporated into the chromosomal DNA of a cell.
[0075] Flanking: A nucleic acid sequence located both 5' and 3' of
a nucleic acid sequence of interest. Thus, in the sequence "A-B-A",
nucleic acid sequence "A" flanks nucleic acid sequence "B". In one
specific, non-limiting example, nucleic acid sequence "A" is
located immediately adjacent to nucleic acid "B." In another
specific, non-limiting example, an linker sequence of not more than
500 nucleotides is between each copy of "A" and "B," such as a
linker sequences of about 200, about 100, about 50, or about 10
nucleotides in length. Nucleotide sequences "A" and "B" can be of
any length.
[0076] Flanked nucleic acid or flanked transgene: A nucleic acid
sequence flanked at a 5'- and 3'-portion by recombining sites. In
one embodiment, the nucleic acid is a transgene. In another
embodiment, the nucleic acid is an antibiotic resistance cassette.
In a further embodiment, the nucleic acid is a BAC DNA, or a gene
on a BAC DNA. In one specific, non-limiting example, the
recombining site is Lox.
[0077] fLOXed nucleic acid or transgene: A nucleic acid sequence,
such as a transgene, which is flanked at a 5'- and 3'-portion by
Lox recombining sites.
[0078] Gam: A lambda protein (and nucleic acid encoding Gam)
involved in double strand break repair homologous recombination. It
is believe to inhibit cellular nuclease activity such as that
encoded by the recBCD and sbcC system of E. coli. See Examples 1, 7
and 14 and references therein for further description. Gam
function, when expressed in the cell, is extremely toxic to the
cell, and prevents growth. For this reason tight controls over its
expression are always required. As described herein, pL and cI 857
are able to regulate Gam expression
[0079] Functional fragments and variants of Exo and Gam: As
discussed for Beta (see "Functional fragments And Variants Of
Beta"), it is recognized that genes encoding Exo or Gam may be
considerably mutated without materially altering their function,
because of genetic code degeneracy, conservative amino acid
substitutions, noncritical deletions or insertions, etc. Unless the
context makes otherwise clear, the term lambda Exo, Exo, or lambda
exonuclease are all intended to include the native lambda
exonuclease, and all fragments and variants of lambda
exonuclease.
[0080] Gene: A nucleic acid encoding a protein product. In a
specific non-limiting example, a gene includes at least one
expression control sequence, such as a promoter, enhancer or a
repressor. In another specific, non-limiting example, a gene
includes at least one intron and at least on exon.
[0081] Homologous arm: Nucleotides at or near 5' or 3' end of a
polynucleotide which are identical or similar in sequence to the
target nucleic acid in a cell, and capable of mediating homologous
recombination with the target nucleic acid. Homologous arms are
also referred to as homology arms. In one embodiment, a homology
arm includes at least 20 bases of a sequence homologous to a
nucleic acid of interest. In another embodiment, the homology arm
includes at least 30 base pairs of a sequence homologous to a
nucleic acid of interest. In yet another embodiment, a homology arm
includes at least 40 base pairs of a sequence homologous to a
nucleic acid of interest. In a further embodiment, a homology arm
includes from about 50 to about 100 base pairs of a sequence
homologous to a nucleic acid of interest.
[0082] Homologous recombination: An exchange of homologous
polynucleotide segments anywhere along a length of two nucleic acid
molecules. In one embodiment, two homologous sequences are 100%
identical. In another embodiment, two homologous sequences are
sufficiently identical such that they can undergo homologous
recombination. Specific, non-limiting examples of homologous
sequences are nucleic acid sequences that are at least 95%
identical, such as about 99% identical, about 98% identical, about
97% identical, or about 96% identical.
[0083] Host cell: A cell that is used in lab techniques such as DNA
cloning to receive exogenous nucleic acid molecules. In one
embodiment a host cell is used to maintain or allow the
reproduction of a vector, or to facilitate the manipulation of
nucleic acid molecules in vitro. A host cell can be a prokaryotic
or a eukaryotic cell.
[0084] HVJ-mediated gene transfer: A method of macromolecular
transfer into cells using inactivated hemagglutinating virus of
Japan and liposomes, as described in Morishita et al., J. Clin.
Invest. 91:2580-2585, 1993; Morishita et al., J. Clin. Invest.
94:978-984, 1994; which are herein incorporated by reference.
[0085] Inducible promoter: A promoter whose activity may be
increased (or that may be de-repressed) by some change in the
environment of the cell. Examples of inducible promoters abound in
nature, and a broad range of environmental or hormonal changes may
activate or repress them.
[0086] Intron: An intragenic nucleic acid sequence in eukaryotes
that is not expressed in a mature RNA molecule. Introns of the
present disclosure include full-length intron sequences, or a
portion thereof, such as a part of a full-length intron
sequence.
[0087] Isolated: An "isolated" biological component (such as a
nucleic acid or protein) has been substantially separated or
purified away from other biological components in the cell of the
organism in which the component naturally occurs, i.e., other
chromosomal and extra-chromosomal DNA and RNA, and proteins. Thus,
nucleic acids and proteins that have been "isolated" include
nucleic acids and proteins purified by standard purification
methods. The term also embraces nucleic acids and proteins prepared
by recombinant expression in a host cell as well as chemically
synthesized nucleic acids.
[0088] Knockout: Inactivation of a gene such that a functional
protein product cannot be produced. A conditional knockout is a
gene that is inactivated under specific conditions, such as a gene
that is inactivated in a tissue-specific or a temporal-specific
pattern. A conditional knockout vector is a vector including a gene
that can be inactivated under specific conditions. A conditional
knockout transgenic animal is a transgenic animal including a gene
that can be inactivated in a tissue-specific or a temporal-specific
manner.
[0089] Linear plasmid vector: A DNA sequence (1) containing a
bacterial plasmid origin of replication, (2) having a free 5' and
3' end, and (3) capable of circularizing and replicating as a
bacterial plasmid by joining its free 5' and 3' ends. Examples of
linear plasmid vectors include the linearized pBluescript vector
and linearized pBR322 vectors described herein.
[0090] Lipofection: The process of macromolecular transfer into
cells using liposomes. See U.S. Pat. No. 5,651,981, which is herein
incorporated by reference.
[0091] Lox: A target recombining site sequence recognized by the
bacterial Cre recombinase (Cre). Specific, non-limiting examples
include, but are not limited to, the sequence listed as GenBank
Accession No. M10494.1; LoxP (GenBank Accession No. U51223); Lox
511 (Bethke and Sauer, Nuc. Acid. Res. 25:282-34, 1997);
.psi.LOXh7q21 (Thyagarajan et al., Gene 244:47-54, 2000),
.psi.Coreh7q21 (Thyagarajan et al., Gene 244:47-54, 2000) as well
as the Lox sites disclosed in Table 1 of Thyagarajan et al. (Gene
244:47-54, 2000, herein incorporated by reference). In one example,
LoxP sites are defined by the sequence
ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO: 51).
[0092] A "minimal" Lox sequence is the minimal sequence recognized
by Cre. In one emb example, minimal Lox sequence is as described in
Hoekstra et al., Proc. Nat. Acad. Sci. U.S.A. 88:5457-61, 1991. In
another example, 5' and 3' Lox sequences are identical.
[0093] As used herein, Lox sequences are located upstream and
downstream (5' and 3', respectively) to a nucleic acid sequence,
for example a nucleic acid sequence encoding a transgene, such as a
transgene encoding a therapeutic polypeptide, or a marker
polypeptide.
[0094] Mini lambda: A derivative of lambda (2) wherein most of the
viral lytic genes, including those required for replication and
lysis, are deleted. A mini-lambda maintains the red functions
(Beta, Exo, and Gam) for homologous recombination and maintains the
integration/excision functions (e.g. att, integrase (int). and
excisionase (xis)) to insert and excise its DNA from the
chromosome.
[0095] Nucleic acid: A deoxyribonucleotide or ribonucleotide
polymer in either single or double stranded form, including known
analogs of natural nucleotides unless otherwise indicated.
[0096] Oligonucleotide (oligo): A single-stranded nucleic acid
ranging in length from 2 to about 500 bases, for example,
polynucleotides that contain at least 20 or 40 nucleotides (nt).
Oligonucleotides are often synthetic but can also be produced from
naturally occurring polynucleotides.
[0097] Operably linked: A first nucleic acid sequence is operably
linked with a second nucleic acid sequence when the first nucleic
acid sequence is placed in a functional relationship with the
second nucleic acid sequence. For instance, a promoter is operably
linked to a coding sequence if the promoter affects the
transcription or expression of the coding sequence. Generally,
operably linked DNA sequences are contiguous and, where necessary
to join two protein-coding regions, in the same reading frame.
[0098] Phagemid artificial chromosome: Also referred to as P1
artificial chromosome. A type of artificial chromosome allowing for
stable cloning of very large DNA fragments. Phagemid artificial
chromosomes are further described in Shepherd, et al., Proc. Natl.
Acad. Sci. U.S.A. 92:2629, 1994; Iannou et al., Nature Genetics
6:84-89, 1994.
[0099] Phage-based recombination systems: Bacteria such as E. coli
encode their own homologous recombination systems, which are used
in repair of DNA damage and to maintain a functional chromosome.
The viruses or phages that inhabit bacteria often carry their own
recombination functions. Phage .lamda. carries the Red
recombination system. These phage systems can work with the
bacterial recombination functions or independently of them.
[0100] pL promoter: The major leftward promoter of bacteriophage
lambda. Once the lambda DNA is incorporated into the bacterial
chromosome, transcription from this promoter is substantially
repressed by the cI repressor. Upon inactivation of the cI
repressor, for example by heat shock of a temperature sensitive
mutant, transcription from the pL promoter is activated, leading to
expression of lambda genes. See FIG. 1; Sambrook et al.,
Bacteriophage Lambda Vectors, Chapter 2 in Molecular Cloning: a
Laboratory Manual, 2nd Ed., .COPYRGT. 1989 (hereinafter Sambrook et
al.); Stryer, Control of Gene Expression in Procaryotes, Chapter 32
in Biochemistry 3rd Ed., pp. 799-823, .COPYRGT. 1988 (hereinafter
Stryer); and Court and Oppenheim, pp. 251-277 in Hendrix et al.
eds., Lambda II, Cold Spring Harbor Lab Press, .COPYRGT. 1983
(hereinafter Court and Oppenheim).
[0101] Plasmid: Autonomously replicating, extrachromosomal DNA
molecules, distinct from the normal bacterial genome and
nonessential for bacterial cell survival under nonselective
conditions.
[0102] Polynucleotide: A double stranded or single stranded nucleic
acid sequence of any length. Therefore, a polynucleotide includes
molecules which are 15, 50, 100, 200 nucleotides long
(oligonucleotides) and also nucleotides as long as a full length
cDNA.
[0103] Unless specified otherwise, the left-hand end of
single-stranded polynucleotide sequences is the 5' end; the
left-hand direction of double-stranded polynucleotide sequences is
referred to as the 5' direction. The direction of 5' to 3' addition
of nascent RNA transcripts is referred to as the transcription
direction. A nucleotide sequence 5' of a second nucleotide sequence
is referred to as "upstream sequences;" a nucleotide sequence 3' to
a second nucleotide sequence is referred to as "downstream
sequences."
[0104] Polypeptide: Any chain of amino acids, regardless of length
or post-translational modification (e.g., glycosylation or
phosphorylation).
[0105] Prokaryote: Cell or organism lacking a membrane-bound,
structurally discrete nucleus and other subcellular
compartments.
[0106] Probes and primers: A nucleic acid probe comprises an
isolated nucleic acid attached to a detectable label or reporter
molecule. Typical labels include radioactive isotopes, ligands,
chemiluminescent agents, and enzymes. Methods for labeling and
guidance in the choice of labels appropriate for various purposes
are discussed, e.g., in Sambrook et al., (1989) and Ausubel et al.,
(1997).
[0107] Primers are short nucleic acids, preferably DNA
oligonucleotides 15 nucleotides or more in length. Primers may be
annealed to a complementary target DNA strand by nucleic acid
hybridization to form a hybrid between the primer and the target
DNA strand. The 3' hydroxyl end of the primer may be then extended
along the target DNA strand through the use of a DNA polymerase
enzyme. Primer pairs (one on either side of the target nucleic acid
sequence) can be used for amplification of a nucleic acid sequence,
e.g., by the polymerase chain reaction (PCR) or other nucleic-acid
amplification methods known in the art.
[0108] Methods for preparing and using probes and primers are
described, for example, in Sambrook et al. (1989), Ausubel et al.
(1987). PCR primer pairs can be derived from a known sequence, for
example, by using computer programs intended for that purpose such
as Primer (Version 0.5, .COPYRGT. 1991, Whitehead Institute for
Biomedical Research, Cambridge, Mass.). Under appropriate
conditions, the specificity of a particular probe or primer
increases with its length. Thus, in order to obtain greater
specificity, probes and primers may be selected that comprise 20,
25, 30, 35, 40, 50 or more consecutive nucleotides of related cDNA
or gene sequence.
[0109] Promoter: An array of nucleic acid control sequences which
direct transcription of a nucleic acid. A promoter includes
necessary nucleic acid sequences near the start site of
transcription, such as in the case of a polymerase II type
promoter, a TATA element. Enhancer and repressor elements can be
located adjacent or distal to the promoter, and can be located as
much as several thousand base pairs from the start site of
transcription. Examples of promoters include, but are not limited
to, the SV40 promoter, the CMV promoter, the .beta.-actin promoter,
and tissue-specific promoters. Examples of tissue-specific
promoters include, but are not limited to: probasin (which is
promotes expression in prostate cells), an immunoglobulin promoter;
a whey acidic protein promoter; a casein promoter; glial fibrillary
acidic protein promoter; albumin promoter; .beta.-globin promoter;
an insulin promoter; and the MMTV promoter. In yet another
embodiment, a promoter is a hormone-responsive promoter, which
promotes transcription only when exposed to a hormone. Examples of
hormone-responsive promoters include, but are not limited to:
probasin (which is responsive to testosterone and other androgens);
MMTV promoter (which is responsive to dexamethazone, estrogen, and
androgens); and the whey acidic protein promoter and casein
promoter (which are responsive to estrogen).
[0110] A hybrid promoter is a promoter that directs transcription
of a nucleic acid in both eukaryotic and prokaryotic cells. One
specific, non-limiting example of a hybrid promoter is a PGK-EM7
promoter. Another specific, non-limiting example of a hybrid
promoter is PGK-Tnf.
[0111] Purified: The term purified does not require absolute
purity; rather, it is intended as a relative term. Thus, for
example, a purified lambda Beta preparation or ssDNA binding
polypeptide is one in which the protein is more enriched than the
protein is in its natural environment within a cell. Preferably, a
preparation of lambda Beta is purified such that the polypeptide
represents at least 50% of the total protein content of the
preparation.
[0112] RecA: The RecA protein is a central protein that has an
activity as in the recombination function of E. coli. Homologues
are found in all other organisms. RecA protein allows two
homologous DNAs to find each other among non-homologous DNAs and
then trade or transfer strands with each other. This exchange
occurs by RecA binding to a single stranded region in one of the
DNAs and using that strand to search for its dsDNA homolog, binding
to the dsDNA and causing the single strand to pair with its
complement in the dsDNA ultimately displacing the identical strand
of the duplex. This strand transfer generates a key intermediate in
the RecA-mediated recombination process.
[0113] recE recT genes and the Rac prophage: E. coli and other
bacteria contain in their chromosomes remnants of viruses. These
viruses or prophages are for the most part defective and may
contain only a few genes of the original virus. In E. coli, one
defective prophage is called Rac. Two genes, recE and recT of the
Rac prophage, encode homologous recombination functions. These
genes are normally silent but the sbcA mutation activates their
constitutive expression. Thus, the sbcA mutant is active for
recombination.
[0114] Recombinases: Proteins that, when included with an exogenous
targeting polynucleotide, provide a measurable increase in the
recombination frequency between two or more oligonucleotides that
are at least partially homologous. A recombinase catalyses
recombination of recombining sites (reviewed in Kilby et al., TIG
9:413-21, 1993; Landy, Curr. Opin. Genet. Devel. 3:699-707, 1993;
Argos et al., EMBO J. 5:433-40, 1986). One specific, non-limiting
example of a recombinase is Cre. Another specific, non-limiting
example of a recombinase is a Flp protein. Other specific,
non-limiting examples of a recombinase are Tn3 recombinase, the
recombinase of transposon gamma/delta, and the recombinase from
transposon mariner.
[0115] The Cre and Flp proteins belong to the lambda/integrase
family of DNA recombinases. The Cre and Flp recombinases are
similar in the types of reactions they carry out, the structure of
their target sites, and their mechanism of recombination (Jayaram,
TIBS 19:78-82, 1994; Lee et al., J. Biol. Chem. 270:4042-52, 1995).
For instance, the recombination event is independent of replication
and exogenous energy sources such as ATP, and functions on both
supercoiled and linear DNA templates.
[0116] Recombinases exert their effects by promoting recombination
between two of their recombining sites. In the case of Cre, the
recombining site is a Lox site (see U.S. Pat. No. 4,959,317), and
in the case of Flp the recombining site is a frt site. Similar
sites are found in transposon gamma/delta, TN3, and transposon
mariner. These recombining sites are comprised of inverted
palindromes separated by an asymmetric sequence (Mack et al., Nuc.
Acids Res. 20:4451-5, 1992; Hoess et al., Nuc. Acids Res.
14:2287-300, 1986; Kilby et al., TIG 9:413-21, 1993). Recombination
between target sites arranged in parallel (so-called "direct
repeats") on the same linear DNA molecule results in excision of
the intervening DNA sequence as a circular molecule. Recombination
between direct repeats on a circular DNA molecule excises the
intervening DNA and generates two circular molecules. Both the
Cre/Lox and flp/frt recombination systems have been used for a wide
array of purposes such as site-specific integration into plant,
insect, bacterial, yeast and mammalian chromosomes (Sauer et al.,
Proc. Natl. Acad. Sci. U.S.A. 85:5166-70, 1988). Positive and
negative strategies for selecting or screening recombinants have
been developed (Sauer et al., J. Mol. Biol. 223:911-28, 1992). The
use of the recombinant systems or components thereof in transgenic
mice, plants and insects among others reveals that hosts express
the recombinase genes with no apparent deleterious effects, thus
confirming that the proteins are generally well-tolerated (Orban et
al., Proc. Natl. Acad. Sci. U.S.A. 89:6861-5, 1992).
[0117] Recombining site: Nucleic acid sequences that include
inverted palindromes separated by an asymmetric sequence (such as a
transgene) at which a site-specific recombination reaction can
occur. In one specific, non-limiting example, a recombining site is
a Lox site, such as LoxP or Lox 511 (see above). In another
specific non-limiting example, a recombining site is a frt site. A
frt site consists of two inverted 13-base-pair (bp) repeats and an
8-bp spacer that together comprise the minimal frt site, plus an
additional 13-bp repeat which may augment reactivity of the minimal
substrate (e.g. see U.S. Pat. No. 5,654,182). In other, specific
non-limiting examples, a recombining site is a recombining site
from a Tn3, a mariner, or a gamma/delta transposon.
[0118] Selection markers or selectable markers: nucleic acid
sequences which upon intracellular expression are capable of
conferring either a positive or negative selection marker or
phenotypic characteristic for the cell expressing the sequence. The
term "selection marker" or "selectable marker" includes both
positive and negative selection markers. A "positive selection
marker" is a nucleic acid sequence that allows the survival of
cells containing the positive selection marker under growth
conditions that kill or prevent growth of cells lacking the marker.
An example of a positive selection marker is a nucleic acid
sequence which promotes expression of the neomycin resistance gene,
or the kanamycin resistance gene. Cells not containing the neomycin
resistance gene are selected against by application of G418,
whereas cells expressing the neomycin resistance gene are not
harmed by G418 (positive selection). A "negative selection marker"
is a nucleic acid sequence that kills, prevents growth of or
otherwise selects against cells containing the negative selection
marker, usually upon application of an appropriate exogenous agent.
An example of a negative selection marker is a nucleic acid
sequence which promotes expression of the thymidine kinase gene of
herpes simplex virus (HSV-TK). Cells expressing HSV-TK are selected
against by application of ganciclovir (negative selection), whereas
cells not expressing the gene are relatively unharmed by
ganciclovir. The terms are further defined, and methods further
explained, by U.S. Pat. No. 5,464,764, which is herein incorporated
by reference.
[0119] Selectable phenotype: A cell with a selectable phenotype is
one that expresses a positive or negative selection marker.
[0120] Sequence identity: The similarity between two nucleic acid
sequences, or two amino acid sequences is expressed in terms of the
similarity between the sequences, otherwise referred to as sequence
identity. Sequence identity is frequently measured in terms of
percentage identity (or similarity or homology); the higher the
percentage, the more similar are the two sequences.
[0121] Methods of alignment of sequences for comparison are
well-known in the art. Various programs and alignment algorithms
are described in: Smith and Waterman, Adv. Appl. Math. 2:482, 1981;
Needleman and Wunsch, J. Mol. Bio. 48:443, 1970; Pearson and
Lipman, Methods in Molec. Biology 24:307-331, 1988; Higgins and
Sharp, Gene 73:237-244, 1988; Higgins and Sharp, CABIOS 5:151-153,
1989; Corpet et al., Nucleic Acids Research 16:10881-90, 1988;
Huang et al., Computer Applications in BioSciences 8:155-65, 1992;
and Pearson et al., Methods in Molecular Biology 24:307-31, 1994.
Altschul et al. (Nature Genet., 6: 119-29, 1994) presents a
detailed consideration of sequence alignment methods and homology
calculations.
[0122] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul
et al., J. Mol. Biol. 215:403-410, 1990) is available from several
sources, including the National Center for Biological Information
(NBCI, Bethesda, Md.) and on the Internet, for use in connection
with the sequence analysis programs blastp, blastn, blastx, tblastn
and tblastx. It can be accessed at the NCBI website, together with
a description of how to determine sequence identity using this
program.
[0123] Homologues of lambda Beta, Exo and Gam, and ssDNA binding
proteins typically possess at least 60% sequence identity counted
over full-length alignment with the amino acid sequence of the
protein being evaluated (that is, lambda Beta, Exo or Gam, or ssDNA
binding protein such as P22 Erf, RecT, and Rad52) using the NCBI
Blast 2.0, gapped blastp set to default parameters. For comparisons
of amino acid sequences of greater than about 30 amino acids, the
Blast 2 sequences function is employed using the default BLOSUM62
matrix set to default parameters, (gap existence cost of 11, and a
per residue gap cost of 1). When aligning short peptides (fewer
than around 30 amino acids), the alignment should be performed
using the Blast 2 sequences function, employing the PAM30 matrix
set to default parameters (open gap 9, extension gap 1 penalties).
Proteins with even greater similarity to the reference sequence
will show increasing percentage identities when assessed by this
method, such as at least 70%, at least 75%, at least 80%, at least
90%, at least 95%, at least 98%, or at least 99% sequence identity.
When less than the entire sequence is being compared for sequence
identity, homologs will typically possess at least 75% sequence
identity over short windows of 10-20 amino acids, and may possess
sequence identities of at least 85% or at least 90% or 95%
depending on their similarity to the reference sequence. Methods
for determining sequence identity over such short windows are
described at the NCBI website
[0124] One of skill in the art will appreciate that these sequence
identity ranges are provided for guidance only; it is entirely
possible that strongly significant homologs or other variants could
be obtained that fall outside of the ranges provided.
[0125] Single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA):
ssDNA is DNA in a single polynucleotide chain; the DNA bases are
not involved in Watson-Crick base pairing with another
polynucleotide chain. dsDNA involves two or more complementary
polynucleotide chains, in which the two polynucleotide chains are
at least partially Watson-Crick base-paired to each other. Note
that a segment of DNA may be partially ssDNA and partially dsDNA,
for example if there are gaps in one polynucleotide chain of a
segment of dsDNA, or there are 5' or 3' overhangs. ssDNA and dsDNA
may contain nucleotide analogs, nonnaturally occurring or synthetic
nucleotides, biotin, or epitope or fluorescent tags. ssDNA or dsDNA
may be labeled; typical labels include radioactive isotopes,
ligands, chemiluminescent agents, and enzymes.
[0126] Target nucleic acid sequence: The nucleic acid segment which
is targeted for homologous recombination. Typically, this is a
segment of chromosomal or extrachromosomal DNA in a cell.
Extrachromosomal DNA harboring target nucleic acid sequences may
include episomal DNA, plasmid DNA, bacterial artificial chromosome,
phagemid artificial chromosomes, yeast artificial chromosomes,
cosmids, and the like. The target nucleic acid sequence usually
harbors a gene or gene fragment which will be mutated in some
fashion upon homologous recombination. Examples of target nucleic
acid sequences include DNA sequences surrounding the tyr 145 UAG
amber mutation of galK, as described in Yu et al., PNAS
97:5798-5983, 2000, and in Example 3 of this application; the
second exon of mouse hox 1.1 gene, as described in U.S. Pat. No.
5,464,764; the human hemoglobin S gene mutation as described in
Example 15 of this application.
[0127] Targeting frequency: The frequency with which a target
nucleic acid sequence undergoes homologous recombination. For
example, extrachromosomal DNA is introduced into a eukaryotic cell.
The extrachromosomal DNA has sequences capable of undergoing
homologous recombination with a target intrachromosomal DNA
sequence. After introducing the extrachromosomal DNA and allowing
homologous recombination to proceed, the total number of cells may
be determined, and the number of cells having the target DNA
sequence altered by homologous recombination may be determined The
targeting frequency is the number of cells having the target DNA
sequence altered, divided by the total number of cells. For
example, if there are a total number of one million cells, and
1,000 of these cells have the target DNA sequence altered, then the
targeting frequency is 1 in 1,000, or 10.sup.-3.
[0128] Transformed: As used herein, the term transformation
encompasses all techniques by which a nucleic acid molecule might
be introduced into such a cell, including transfection with viral
vectors, transformation with plasmid vectors, and introduction of
DNA (including DNA linked to Beta protein) by electroporation,
lipofection, and biolistics.
[0129] Transgene: A foreign gene that is placed into an organism by
introducing the foreign gene into embryonic stem (ES) cells, newly
fertilized eggs or early embryos. In one embodiment, a transgene is
a gene sequence, for example, a sequence that encodes a marker
polypeptide that can be detected using methods known to one of
skill in the art. In another embodiment, the transgene is a
conditional knockout allele.
[0130] Transgenic Animal: An animal, for example, a non-human
animal such as, but not limited to, a mouse, that has had DNA
introduced into one or more of its cells artificially. By way of
example, this is commonly done by random integration or by targeted
insertion. DNA can be integrated in a random fashion by injecting
it into the pronucleus of a fertilized ovum. In this case, the DNA
can integrate anywhere in the genome, and multiple copies often
integrate in a head-to-tail fashion. There is no need for homology
between the injected DNA and the host genome. In most cases, the
foreign transgene is transmitted to subsequence generations in a
Mendelian fashion (a germ-line transgenic).
[0131] Targeted insertion, the other common method of producing
transgenic animals, is accomplished by introducing the DNA into
embryonic stem (ES) cells and selecting cells in which the DNA has
undergone homologous recombination with matching genomic sequences.
For this to occur, there is homology between the exogenous and
genomic DNA, and positive selectable markers are often included. In
addition, negative selectable markers can be used to select against
cells that have incorporated DNA by non-homologous recombination
(random insertion).
[0132] Upstream: Refers to nucleic acid sequences that preceed the
codons that are transcribed into a RNA of interest, or to a nucleic
acid sequences 5' of a nucleic acid of interest. Similarly,
"downstream" refers to nucleic acid sequences that follow codons
that are transcribed into a RNA of interest, or to nucleic acid
sequences 3' of a nucleic acid of interest.
[0133] Variants of Amino Acid and Nucleic Acid Sequences: The
production of lambda Beta, Exo or Gam, or other ssDNA binding
polypeptide can be accomplished in a variety of ways. DNA sequences
which encode for the protein, or a fragment of the protein, can be
engineered such that they allow the protein to be expressed in
eukaryotic cells, bacteria, insects, and/or plants. In order to
accomplish this expression, the DNA sequence can be altered and
operably linked to other regulatory sequences. The final product,
which contains the regulatory sequences and the nucleic acid
encoding the therapeutic protein, is operably linked into a vector,
allowing stable maintenance in a cell. This vector can then be
introduced into the eukaryotic cells, bacteria, insect, and/or
plant. Once inside the cell, the vector allows the protein to be
produced.
[0134] One of ordinary skill in the art will appreciate that the
DNA can be altered in numerous ways without affecting the
biological activity of the encoded protein. For example, PCR may be
used to produce variations in the DNA sequence which encodes lambda
Beta, Exo or Gam, or other ssDNA binding proteins. Such variants
may be variants that are optimized for codon preference in a host
cell that is to be used to express the protein, or other sequence
changes that facilitate expression.
[0135] In one example, two types of cDNA sequence variants may be
produced. In the first type, the variation in the cDNA sequence is
not manifested as a change in the amino acid sequence of the
encoded polypeptide. These silent variations are simply a
reflection of the degeneracy of the genetic code. In the second
type, the cDNA sequence variation does result in a change in the
amino acid sequence of the encoded protein. In such cases, the
variant cDNA sequence produces a variant polypeptide sequence. In
order to preserve the functional and immunologic identity of the
encoded polypeptide, such amino acid substitutions are ideally
conservative in highly conserved regions. Conservative
substitutions replace one amino acid with another amino acid that
is similar in size, hydrophobicity, etc. Outside of highly
conserved regions, non-conservative substitutions can more readily
be made without affecting function of the protein. Examples of
conservative substitutions are shown in Table 1 below.
TABLE-US-00001 TABLE 1 Original Residue Conservative Substitution
Ala Ser Arg Lys Asn Gln, His Asp Glu Cys Ser Gln Asn Glu Asp Gly
Pro His Asn; Gln Ile Leu, Val Leu Ile; Val Lys Arg; Gln; Glu Met
Leu; Ile Phe Met; Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val
Ile; Leu
[0136] Variations in the cDNA sequence that result in amino acid
changes, whether conservative or not, should be minimized in order
to preserve the functional and immunologic identity of the encoded
protein. The immunologic identity of the protein may be assessed by
determining whether it is recognized by an antibody to the protein;
a variant that is recognized by such an antibody is immunologically
conserved. Particular examples of cDNA sequence variants introduce
no more than 20, fewer than 10 amino acid substitutions, fewer than
five amino acid substitutions, or about a single amino acid
substitution, into the encoded polypeptide. Variant amino acid
sequences may, for example, be at least 80, 90 or even 95%
identical to the native amino acid sequence.
[0137] Yeast artificial chromosome (YAC): A vector used to clone
DNA fragments (up to 400 kb); it is constructed from the telomeric,
centromeric, and replication origin sequences needed for
replication in yeast cells (see Ausubel et al.).
Use of the Lambda-Encoded Red Recombination System in
Recombineering Mediated by a Defective Prophage
[0138] Bacteriophage .lamda. contains a homologous recombination
system termed Red, which is functionally analogous to the RecET
recombination system of Rac. Like RecET, Red recombination requires
two genes: red.alpha. or exo, which is analogous to recE, and
red.beta. (or bet), which is analogous to recT). Exo is a 5'-3'
exonuclease that acts processively on linear dsDNA. Beta binds to
the ssDNA overhangs created by Exo and stimulates annealing to a
complementary strand but cannot promote direct strand invasion and
exchange on its own. The recombination functions of Exo and Beta
are again assisted by .lamda. phage-encoded Gam, which inhibits the
RecBCD activity of the host cell. .lamda. Red-mediated
recombination events are 10 to 1000 times more efficient than those
observed in recBC sbcBC or recD strains. Because homologous
recombination is increased dramatically by the addition to the host
of phage-encoded protein functions, this procedure is widely
applicable to any E. coli strain and to other bacterial species as
well.
[0139] A defective .lamda. prophage-based system is disclosed
herein for Red-mediated recombineering (see FIG. 2). In this
system, Gam, Beta, and Exo are encoded by a defective lambda
prophage, which is integrated into the E. coli chromosome of a
bacterial cell (e.g. E. coli) (see FIG. 6 and FIG. 9). Expression
of Gam, Beta, and Exo is under the tight control of a
de-repressible promoter. In the example shown, the de-repressible
pL promoter is under the control of the temperature-sensitive
.lamda. cI857 repressor. At 32.degree. C., when the repressor is
active, expression of the pL promoter and these genes is
undetectable. However, when the cells are shifted to 42.degree. C.
for about a 15 minute period, the repressor is inactivated and the
genes are expressed at very high levels. In contrast, promoters
that can be activated, which are present on plasmids, are
notoriously difficult to control and Red and Gam functions would be
expressed even in the absence of the inducer, such as arabinose.
Low-level expression of Gam causes a RecBCD defect, a condition
that results in plasmid instability and loss of cell viability.
[0140] The tight regulation afforded by the prophage system,
combined with the fact that the .lamda. promoter, which drives Gam
and Red expression is a very strong promoter, makes it possible to
achieve recombination frequencies that are at least 50-fold higher
than those found with the plasmid-based system used previously (see
Muyrers et al, Nucleic Acids Res 27:1555-1557, 1999; Yu et al. Proc
Natl Acad Sci U.S.A. 97:5978-5983, 2000), and several orders of
magnitude higher than previously described strains in which linear
recombination has been studied. The prophage itself is genetically
stable, unlike plasmids, and does not rely on the presence of drug
selection for maintenance.
[0141] FIG. 2 illustrates the design of primers for amplification
of a dsDNA recombination cassette, and a strategy for generating
recombinant DNA molecules and gene replacement. The steps are
outlined below.
[0142] Classical recombinant DNA technology or genetic engineering
has primarily relied upon the presence of restriction enzyme
cleavage sites to judiciously cleave DNA and the use of DNA ligase
to covalently join different DNAs to make the recombinants wanted.
The ability to do genetic engineering has been simplified by the
polymerase chain reaction (PCR), which allows restriction sites to
be incorporated into linear PCR products thereby allowing more
precise positioning of those sites. All genetic engineering
technology breaks down, however, when cloning vehicles and the
target contain hundreds of kilobases of DNA. Examples include the
bacterial chromosome and large genomic BAC clones. Even rare
restriction enzyme sites occur frequently on such large DNA
molecules making the effort to use unique sites impossible.
Furthermore, the in vitro manipulation of linear DNAs of this
length is also extremely difficult. Therefore, once large BAC
cloning technology became available in E. coli, modification of the
BAC clones became the primary problem. Initially a combination of
genetic engineering technology and classical homologous
recombination techniques were adapted to modify the large genomic
clones. Classical homologous recombination in E. coli depends upon
significant (>500 bp) stretches of homology between DNAs.
[0143] FIG. 2A depicts a typical genetic engineering protocol to
modify a target on a BAC clone with a cassette and compares that
technology with the recombineering technology disclosed herein that
uses special phage recombination functions. In general, there are
many steps required for classical engineering, and the final
product cannot be engineered as precisely as by the new
recombineering technology. An advance in the recombineering
methodology is the use of phage recombination functions that
generate recombination products using homologies of 50 bp (or
less). Note that the target homologies in FIG. 2A and FIG. 2B are
represented by the striped boxes. In the method outlined in FIG.
2A, those boxes must be at least 500 bp long, whereas in the method
outlined in FIG. 2B, they need only be about 40 to about 50 bp
long.
[0144] Thus, in one example, genetic engineering steps to generate
BAC recombinant include cleavage of the cassette DNA by a
restriction enzyme, cleavage of target on plasmid by a restriction
enzyme (wherein the vector has been pre-engineered to contain
target fragments). The cassette is joined to the plasmid by DNA
ligase, and the DNA is introduced into cells. Drug resistant
(drug.sup.R) clones are selected, and the plasmid is isolated. The
cloned cassette is verified and subsequently transformed into the
BAC strain. Several recombination steps are used to introduce the
cloned cassette into the BAC.
[0145] In contrast, in one non-limiting example, recombineering
steps to generate BAC recombinants can include the generation of
two primers (white and black arrows, FIG. 2B), and the generation
of a PCR amplified cassette with flanking homologies. In the
example pictured in FIG. 2B, exemplary striped homology segments
shown are 50 base pairs long, but they can be about 100 base pairs
in length, or from about 200 to about 500 base pairs in length.
Phage recombination functions are induced into a BAC strain or BAC
DNA is introduced into strain carrying recombination functions. The
cells containing the BAC and the recombination functions are
transformed with a PCR cassette. A recombinant is generated in
vivo, and can then be detected by selection or counter-selection,
by direct screening (colony hybridization), or by detecting a label
on the nucleic acid (e.g. when DNA includes a DNA adduct or a
marker such as biotin)
[0146] As disclosed herein, in one specific, non-limiting example,
the defective .lamda. prophage was transferred to the BAC host
strain DH10B so that it can be used for BAC engineering. The
modified DH10B strain called DY380 can be transformed with BAC DNA
at efficiencies of 10.sup.-6 to 10.sup.-4. The utility of DY380
cells for BAC engineering has been demonstrated by introducing a
250 kbp mouse BAC that contains the neuronal-specific enolase 2
(Eno2) gene into DY380 cells by electroporation and then modifying
the BAC by introducing a Cre-expressing targeting cassette into the
3' end of the Eno2 gene using Red recombination (see Example 20).
The targeting cassette was PCR-amplified from a template plasmid
using chimeric 63 nucleotide (nt) primers. The 3' 21 nucleotides of
each primer was homologous to the targeting cassette, while the 5'
42 nucleotides was homologous to the last exon of Eno2 where the
cassette was to be targeted (see FIG. 10). DY380 cells were then
electroporated with the amplified targeting cassette and correctly
targeted colonies were obtained at an efficiency approaching
10.sup.-4 following the induction of Red expression; no targeted
colonies were obtained in uninduced cells.
[0147] As also disclosed herein, the modified full length BAC was
purified and injected in mouse zygotes and a BAC transgenic line
established. Two other transgenic lines carrying a shorter 25 kbp
subclone of the modified Eno2 gene on pBR322 were also established
as controls. The 25 kbp subclone carries the entire modified Eno2
coding region as well as 10 kbp of 5' flanking sequence and 5 kbp
of 3' flanking sequence. The activity of the Cre gene in the
different transgenic lines was then assessed by crossing the mice
to ROSA26 reporter mice. These mice carry a lacZ reporter that can
be activated by Cre recombinase. In mice carrying the full length
BAC transgene, Cre activity was detected in all Eno2-positive
neurons. In contrast, not all Eno2-positive neurons expressed Cre
in the transgenic mice carrying the smaller 25 kbp subclone, and
the pattern of Cre expression varied between the two different 25
kbp subclone lines. These results are consistent with previous
studies showing that regulatory sequences can be located hundreds
of kilobases from a gene, and highlight the usefulness of BAC
engineering for in this case generating Cre-expressing lines for
use in conditional knockout experiments.
[0148] Arabinose-inducible flpe or Cre genes have also been
introduced into the defective prophage carried in strain DY380.
flpe is a genetically engineered flp that has a higher
recombination frequency than the original flp (Buchholz et al., Nat
Biotechnol 16:657-662, 1998, herein incorporated by reference). The
site-specific recombinases Flpe and Cre are important tools used to
add or delete DNA segments (e.g. drug cassettes). Flpe and Cre
expression can be induced by the addition of arabinose and used to
remove the selection marker from the targeted locus. This will be
especially important in cases where the selection marker interferes
with the expression of the targeted locus. However, even excision
of the selectable marker by Flpe or Cre recombination leaves behind
the frt or LoxP site as a scar on the targeted locus.
[0149] Using the methods disclosed herein, conditional knockout
alleles (cko alleles) can be produced. These alleles allow
inactivation of a gene of interest under specified biological
conditions. Typically, a condition knockout (cko) allele is made by
inserting recombination sites, such as, but not limited to, LoxP
sites into two introns of a gene, flanking an exon, or at the
opposite ends of a gene. Genes of interest include, but are not
limited to, genes encoding polypeptides including, but not limited
to cytokines, hormones, structural molecules, enzymes,
transcriptional factors (e.g. Evi9) and others.
[0150] Expression of a recombinase, such as, but not limited to,
Cre, in mice carrying the cko allele catalyzes recombination
between the LoxP sites and inactivates the gene. In one embodiment,
transgenic animals, such as, but not limited to, transgenic mice
(cko mice), can be produced including a cko allele. These mice
allow a gene to be inactivated in a tissue- or temporal-specific
fashion. In one specific, non-limiting example, the mice include a
tissue-specific, or temporal-specific promoter operably linked to a
nucleic acid encoding a recombinase. Thus, the gene of interest is
inactivated when the recombinase is expressed.
[0151] In one example of a method to produce a cko allele, two sets
of PCR primers are produced and used to amplify two homologous
regions of a BAC DNA. The two homologous regions can be about 100
to about 500 base pairs in length, such as about 200 to about 500
base pairs, or about 100 base pair regions. These regions of
homology are used to subclone a BAC of interest into a vector, such
as a plasmid in a cell. In one embodiment, a genomic fragment of
about 5 to about 20 kilobases is inserted into a vector, such as a
genomic fragment of about 10 to 15 kilobases in length. A LoxP site
is then introduced into the subcloned BAC DNA by introducing a
nucleic acid sequence encoding a selection marker flanked by two
recombination sites, such as, but not limited to, LoxP sites (e.g.,
a fLOXed nucleic acid encoding a selection marker), using
homologous recombination.
[0152] To introduce the nucleic acid sequence encoding a selection
marker, a vector is utilized that includes a selection marker
flanked by two recombination sites (recombination site 1), which
are in turn flanked by sequences homologous to the BAC (homology
arms). The homology arms include more than 100 base pairs
homologous to the BAC DNA, such as about 200 to about 500 base
pairs that are homologous to the BAC DNA.
[0153] This vector is utilized to introduce the selection marker
flanked by the two recombining sites into the BAC DNA in a host
cell. Specifically, expression of Red recombination functions in a
cell, such as a bacterial cell, is used to induce recombination. In
this manner, homologous recombination is used to introduce the
selection marker flanked by two recombination sites (two
recombination site 1) into the BAC DNA. The selectable marker can
be used to identify cells that have undergone homologous
recombination.
[0154] Following homologous recombination, expression of a
recombinase in the cell results in the excision of the selection
marker. In one specific, non-limiting example, the recombinase is
Cre, and the recombination sites are LoxP sites. In another
specific, non-limiting example, the recombinase is Flpe, and the
recombination sites are frt recombination sites. Following
expression of the recombinase, such as, but not limited to, Cre, a
single recombination site (recombination site 1), such as, but not
limited to, a LoxP site, remains in the BAC DNA.
[0155] A second corresponding recombination site (recombination
site 1, e.g. a LoxP site) is introduced at a second (e.g., a
downstream) site in the BAC DNA. In one specific, non-limiting
example, the first and the second recombination sites are
introduced into the BAC DNA such that they flank at least one exon
included in the BAC DNA. In another specific, non-limiting example,
the first and the second recombination sites are introduced into a
first and a second intron of a single gene, respectively, wherein
the first and the second intron are not the same intron.
[0156] To introduce the second recombination site, a nucleic acid
sequence including (1) a selectable maker flanked by a second pair
of recombination sites (recombination site 2) is introduced into
the BAC DNA, and (2) a second recombination site (recombination
site 1), is introduced into the BAC DNA. In one embodiment, a
vector is utilized including, in 5' to 3' orientation, a first
recombining site, a hybrid promoter operably linked to a nucleic
acid encoding a selection marker, a second recombining site, and a
third recombining site, wherein the first recombining site and the
second recombining site can undergo recombination with each other
in the presence of a single recombinase.
[0157] To introduce the nucleic acid sequence including the second
recombination site the vector further includes the selection marker
flanked by two recombination sites (recombination site 2) and
another recombination site (recombination site 1). All of these
elements (e.g., 5'-recombination site 2-selection
marker-recombination site 2-recombination site 1-3', or
5'-recombination site 1-recombination site 2-selection
marker-recombination site 2-3' are in turn flanked by homology
arms. The homology arms include more than 100 base pairs homologous
to the BAC DNA, such as about 200 to about 500 base pairs that are
homologous to the BAC DNA.
[0158] Thus, in one specific, non-limiting example, a vector is
introduced into a cell that includes:
[0159] 5'-nucleic acid homologous to the BAC DNA-recombination site
2-nucleic acid encoding the selectable marker-recombination site
2-recombination site 1-nucleic acid homologous to the BAC
DNA-3'
[0160] Expression of Red recombination functions in a cell such as
a bacterial cell, can be used to induce recombination, thereby
inserting the selection marker flanked by two recombination sites
(recombination site 2) and the additional recombination site
(recombination site 1) into the BAC DNA. In one specific,
non-limiting example, a nucleic acid is introduced into the BAC DNA
having a configuration: 5'-recombination site 2-selectable
marker-recombination site 2-recombination site 1-3'. In another
embodiment, a nucleic acid is introduced into the BAC DNA having a
configuration: 5'-recombination site 1-recombination site
2-selectable marker-recombination site 2-3'. The selectable marker
can be used to select those cells having undergone
recombination.
[0161] Recombination is then induced at recombination sites 2 using
a site specific recombinase. In one specific, non-limiting example,
if recombination sites 2 are frt recombination sites, Flpe is used
to induce recombination. In another specific, non-limiting example,
recombination sites 2 are LoxP sites and Cre is used to induce
recombination. Following recombination, a recombination site
(recombination site 1) remains in the BAC DNA.
[0162] In this manner, a first recombination site and a second
recombination site (two copies of recombination site that can be
recombined using a recombinase, e.g. recombination site 1) are
introduced in the BAC DNA to produce a "conditional knockout
vector." The first recombination site and the second recombination
site can be introduced flanking an exon of a gene of interest.
Alternatively, the first recombination site and the second
recombination site can be inserted each into a different exon. Upon
induction of the expression of a recombinase that specifically
induces recombination at the recombination sites, a "knockout" of a
gene included in the BAC DNA, as no functional protein can be
produced following transcription. A diagram of this process is
shown in FIGS. 17 and 18. The conditional knockout vector can be
linearized such that the BAC DNA including the gene of interest
with the inserted recombination sites remains intact.
[0163] In one embodiment, a linearized conditional knockout vector
is introduced into embryonic stem cells. Homologous recombination
can occur either upstream or downstream of the gene of interest
with the inserted recombination sites to stably integrate these
nucleic acid sequences into a chromosome of the embryonic stem
cell. The embryonic stem cell can be used to produce a transgenic
animal. Any animal can be of use in the methods disclosed herein,
including human and non-human animals. A "non-human animal"
includes, but is not limited to, a non-human primate, a farm animal
such as swine, cattle, and poultry, a sport animal or pet such as
dogs, cats, horses, hamsters, rodents, or a zoo animal such as
lions, tigers, or bears. In one specific, non-limiting example, the
non-human animal is a transgenic animal, such as, but not limited
to, a transgenic mouse, cow, sheep, or goat. In one specific,
non-limiting example, the transgenic animal is a mouse.
[0164] Advances in technologies for embryo micromanipulation permit
introduction of heterologous DNA into fertilized mammalian ova. For
instance, totipotent or pluripotent stem cells, such as embryonic
stem cells, can be transformed by microinjection, calcium phosphate
mediated precipitation, liposome fusion, retroviral infection or
other means. In one embodiment, homologous recombination is induced
in an embryonic stem cell, such that an exongenous DNA is
integrated into a chromosome of the embryonic stem cell. The
transformed cells are then introduced into the embryo, and the
embryo then develops into a transgenic animal. Reviews of standard
laboratory procedures for the introduction of heterologous DNAs
into mammalian (mouse, pig, rabbit, sheep, goat, cow) fertilized
ova include: Hogan et al., Manipulating the Mouse Embryo, Cold
Spring Harbor Press, 1986; Krimpenfort et al., Bio/Technology 9:86,
1991; Palmiter et al., Cell 41:343, 1985; Kraemer et al., Genetic
Manipulation of the Early Mammalian Embryo, Cold Spring Harbor
Laboratory Press, 1985; Hammer et al., Nature 315:680, 1985; Purcel
et al., Science 244:1281, 1986; Wagner et al., U.S. Pat. No.
5,175,385; Krimpenfort et al., U.S. Pat. No. 5,175,384.
[0165] Thus, in one specific, non-limiting example, a "conditional
knockout transgenic animal" is generated including the gene of
interest including the two recombination sites (e.g. including two
copies of recombination site 1 in a gene of interest, such as
flanking an exon of a gene included in the BAC). To knockout
expression of the gene of interest in the transgenic animal, a
recombinase is expressed in a cell of the transgenic animal. In one
specific, non-limiting example, to generate a mouse wherein this
knockout can occur, a conditional knockout transgenic mouse can be
mated to a second transgenic mouse carrying a transgene including a
temporal- or tissue-specific promoter operably linked to a
transgene encoding the recombinase. Offspring are selected that
carry the gene of interest including the two recombination sites,
and the gene encoding the recombinase. In these animals, the gene
is knocked out in those cells wherein the recombinase is
expressed.
[0166] Selection cassettes, and vectors including these selection
cassettes, for use in these methods disclosed herein are also
provided by this specification. In one embodiment, the cassette
includes:
[0167] Recombinations site 2-hybrid promoter-selection marker
1-recombination site 2-recombination site 1.
[0168] Suitable recombination sites include, but are not limited
to, frt, LoxP, or Tn3, ISCF-1, a mariner, or a gamma/delta
transposon recombination site. In the selection cassette described
above, the sequences of recombination site 2 and recombination site
1 differ from each other, and are recognized by different
recombinases. Suitable hybrid promoters include PGK-EM7, for
example, as included in PL451 (ATCC Deposit No. PTA-4996, deposited
Feb. 5, 2003), PL450, PL452 (ATCC Deposit No. PTA-4997, deposited
Feb. 5, 2003), and PL459. Suitable selection markers include
neomycin resistance, ampicillin resistance, kanamycin resistance,
or any sequence that produces sensitivity or resistance to an
antibiotic when introduced into a cell. Selection markers further
include any polypeptide sequence for which a selection system is
available (e.g. beta-galactosidase).
[0169] An example of this selection cassette is: [0170] frt-hybrid
promoter-selection marker-frt-LoxP or [0171] frt-PGK-EM7-selection
marker-frt-LoxP or [0172] frt PGK-EM7-neo-frt LoxP or [0173]
LoxP-hybrid promoter-selection marker LoxP-frt. Exemplary selection
cassettes of use in the methods disclosed herein are PL451 PL451
(ATCC Deposit No. PTA-4996, deposited Feb. 5, 2003) and PL452 PL451
(ATCC Deposit No. PTA-4997, deposited Feb. 5, 2003).
BAC Modification without Leaving Markers or `Scars` at the Target
Site and Direct Genomic Modification
[0174] A two-step procedure for BAC targeting has been developed
wherein many kinds of mutations can be introduced into BACs without
leaving behind a selectable marker, such as a drug selection
marker, at the targeted locus. In one embodiment, a two-step
procedure is utilized. This is exemplified in the following
specific, non-limiting example. A PCR-generated targeting cassette
containing a sacB-neo fusion gene was targeted to a BAC or other
DNA. Cells containing the sacB-neo cassette targeted to the genomic
DNA of the BAC were then transformed with a second targeting DNA to
the same region. This cassette was designed to replace the sacB-neo
cassette, and in one instance, contained short genomic sequences
that carried a more subtle mutation, such as a small insertion. By
placing these newly transformed cells on media with 7% sucrose,
selective pressure was applied against SacB expression, which
converts sucrose to a bacteriotoxin (Muyrers et al., EMBO Rep
1:239-243, 2000). Growth on sucrose plates thus selected for cells
that have potentially replaced the sacB-neo targeting cassette with
the second targeting cassette containing the small insertion.
Because spontaneous mutations occur in sacB to cause sucrose
resistance at frequencies approaching 1 in 10.sup.4, recombinants
were identified among sucrose resistant colonies as those that have
also become neomycin sensitive. As disclosed herein, by combining
the power of Red recombination with selection/counterselection
using sacB-neo, other kinds of genetic changes besides insertions
can also be generated, including deletions and point mutations, and
these mutations can be introduced into virtually any large DNA
molecule such as a BAC, PAC, or the E. coli chromosome without any
accompanying selectable marker.
[0175] The high frequency of recombination generated by the
defective prophage system described herein also makes it possible
to modify a bacterial genome or a BAC in a single step without drug
selection or counterselection. In one specific, non-limiting
example, a 24-bp flag tag was introduced into a 125-kbp BAC
directly by recombination, without selection into the 5' end of the
SRY-box containing gene 4 (Sox4) (e.g., see Examples 17 and 22).
The recombinants were found by screening individual cells from the
BAC electroporated culture.
[0176] Because homologies involved in Red-mediated recombination
can be very short, targeting cassettes can also be made by simply
annealing two complementary synthetic ssDNA oligonucleotides
together. As described herein, a 70 bp targeting cassette
constructed in this manner recombines with the E. coli chromosome
to create point mutations at frequencies approaching one in a
thousand electroporated cells. Point mutations corresponding to
human disease-causing mutations can thus be introduced into any
human or mammalian gene carried on a BAC with ease and the affect
of this mutation on gene function assayed in a transgenic that
carries a null mutation in the corresponding mouse gene.
Cloning DNA by Gap Repair
[0177] Fragments can be subcloned from BACs by Red-mediated
recombination without the use of restriction enzymes or DNA
ligases. Thus, any region of the BAC is amenable to subcloning, and
subcloning does not depend on the placement of appropriate
restriction enzyme sites. Subcloning relies on gap repair to
recombine the free ends of a linear plasmid vector with homologous
sequences carried on the BAC. An example is shown in FIGS. 8 and
10. The linear plasmid vector with, for example, an amp selectable
marker and an origin of replication carries the recombinogenic
ends. The vector is generated, for example, by polymerase chain
reaction (PCR) amplification using two chimeric primers. The 5' end
of each primer has homology to the extremities of the BAC sequence
to be subcloned; the 3' end of each primer is used to prime and
amplify the linear plasmid DNA. Recombination generates a circular
plasmid in which the DNA insert is retrieved from the BAC via gap
repair. Circular recombinant plasmids are selected by their drug
resistance (e.g. Amp.sup.R) phenotype. Different sizes of fragments
that can be subcloned depending on the cloning vector utilized.
With a high copy vector such as pBluescript, fragments up to about
25 kbp are subcloned. However, with a lower copy vector such as
pBR322 is used, fragments as large as about 80 kbp can be
subcloned. These larger fragments were shown to be more accurately
expressed in a tissue specific manner (as was the entire BAC clone,
see above).
A Mobilizable Lambda Prophage
[0178] As disclosed herein, recombination functions were expressed
from their native location in the pL operon of a lambda prophage
using the natural .lamda. repressor controls (FIG. 9). However, one
limitation of the defective prophage system as disclosed in FIGS. 6
and 9 is that BACs under study must be moved into
recombination-proficient DY380 cells before the BAC can be
manipulated. In order to overcome this limitation, a novel prophage
derivative has been generated that is isolated as a mini-lambda
circle DNA carrying a selectable marker (e.g. a drug-resistance
marker such as tet.sup.R cassette) and containing the exo, bet, and
gam genes under control of the temperature inducible cI857
repressor (FIG. 12). This mini-lambda can be transformed into any
bacterial cell, such as a DH10B cell that carry a BAC. The
mini-lambda then integrates at the lambda attachment site to
generate the defective prophage. This mobilizable prophage makes it
possible to introduce the prophage into BAC-containing DH10B
libraries and obviates the need to transfer the BAC to DY380
cells.
Recombineering Using ssDNA
[0179] Recombineering, or the use of a recombinase to mediate
recombination using homology arms sufficient to induce
recombination, as disclosed herein, can be performed using
single-stranded oligos as the targeting cassette). As described in
the Examples below (e.g., see Example 3), in E. coli, a single base
change has been substituted in the galK gene and a 3.3 kbp
insertion removed from the galK gene using single-stranded oligos.
Single-stranded oligos have also been used to cure 5 different Tn10
insertions at different places on the E. coli chromosome.
Recombineering using single-stranded oligos is very efficient with
up to 6% of the electroporated cells being recombinant. Whereas
Exo, Beta, and Gam facilitate recombination of PCR amplified dsDNA
cassettes with flanking homologies, only Beta is required for ssDNA
recombination (see FIG. 13). Maximum recombination is achieved with
oligonucleotides of about 70 bases in length, although
oligonucleotides of about forty to sixty bases in length can also
be used to achieve recombination, albeit at a 5-fold lower
frequency. In one embodiment, ssDNA of about 40 to about 70
nucleotides in length is utilized. In another embodiment, ssDNA of
about 70 to about 100 nucleotides in length is utilized. In a
further embodiment, a ssDNA of about 70 to about 1,000 nucleotides
in length is utilized. Interestingly, Beta-mediated recombination
activity is less efficient when ssDNA molecules are about 1,000
bases in length. In yet another embodiment, the ssDNA is labeled,
such as with a biotinylated nucleotide, a methylated nucleotide, or
a DNA adduct.
[0180] Recombination with either of two complementary DNA
oligonucleotides has revealed that although either strand can be
efficiently used for recombination, one strand is more competent
for recombination than the other. This strand bias has been
examined at several positions around the bacterial chromosome with
the result that the preferred strand correlates with the lagging
strand of DNA replication for each site tested. Without being bound
by theory, these results indicated that strand bias is associated
with the replication direction through the region being targeted
and that ssDNA recombination occurs efficiently near the
replication fork. The process of DNA replication results in
transient regions of ssDNA that may be accessible to Beta-mediated
annealing of the ssDNA oligo. Although recombination occurs on the
leading strand, the increased recombination efficiency of the
lagging strand oligos may reflect the increased frequency of
single-stranded regions during lagging versus leading strand
synthesis (FIG. 13). DNA polymerase and DNA ligase could then
complete the joining of the annealed oligo to the lagging strand.
Without being bound by theory, the increased frequency of ssDNA
recombination probably reflects the fact that ssDNA recombination
occurs through a simpler mechanism than dsDNA recombination. The
ssDNA recombination may require only annealing of one
single-stranded oligo to single-stranded regions in the replicating
target DNA. Moreover, ssDNA recombination also occurs in yeast with
a strand bias that may also be dependent upon replication. The
yeast functions required for this recombination are, however,
unknown making the finding that only the Beta function from phage
is required in E. coli that much more significant.
[0181] Using the methods disclosed herein, point mutations can be
introduced into a nucleic acid sequence of interest. In one
specific, non-limiting example, a point mutation was engineered
into the mouse Brca2 carried on a BAC using a 70 nt oligo. The
targeting efficiency was several times higher than would be found
with dsDNA created by annealing oligos and at least 50 times higher
than with dsDNA generated by PCR and containing large regions of
nonhomology in their center. A 140 nt oligonucleotide has also been
used to introduce a 29 amino acid in-frame deletion into exon11 of
the Brca2 gene and a 1.93 kb deletion into the BAC vector backbone
(Swaminathan et al. Genesis 29:14-21, 2001, herein incorporated by
reference). Finally, a 164 nt oligo has been used to introduce a 24
bp flag tag into the 5' end of Brca2. The targeting efficiency for
the 164 nt oligo (7.7.times.10.sup.-3) was nearly the same as the
targeting efficiency for generating deletions using 140 nt oligos
(8.3.times.10.sup.-3 and 5.4.times.10.sup.-3, respectively).
[0182] The disclosure is illustrated by the following non-limiting
Examples.
Examples
Example 1
Modified Lambda Prophage for Defined Expression of Recombination
Proteins
[0183] The molecular genetics of lambda bacteriophage, including
its lytic and lysogenic growth cycles, is described in Sambrook et
al., Bacteriophage Lambda Vectors, Chapter 2 in Molecular Cloning:
a Laboratory Manual, 2nd Ed., .COPYRGT. 1989 (hereinafter Sambrook
et al., Ch. 2); Stryer, Control of Gene Expression in Procaryotes,
Chapter 32 in Biochemistry 3rd Ed., pp. 799-823, .COPYRGT. 1988
(hereinafter Stryer); and Court and Oppenheim, pp. 251-277 in
Hendrix et al. eds., Lambda II, Cold Spring Harbor Lab Press,
.COPYRGT. 1983 (hereinafter Court and Oppenheim). The complete
sequence of lambda is known (see GenBank Accession No. NC 001416,
herein incorporated by reference).
[0184] Phage lambda has a well-characterized homologous
recombination system. Double strand breaks in DNA are the
initiation sites for this recombination (Thaler et al., J. Mol.
Biol. 195:75-87, 1987). Lambda exonuclease (Exo) degrades
processively from the 5' ends of these break sites, and lambda Beta
binds to the remaining 3' single strand tail, protecting and
preparing the recessed DNA for homologous strand invasion (Little,
J. Biol. Chem. 242:679-686, 1967; Carter et al., J. Biol. Chem.
246:2502-2512, 1971).
[0185] The lambda recombination system containing exo and bet
without gam is efficient at gene replacement using linear
substrates with homology arms of more than 1,000 bp in a strain
lacking RecBCD nuclease (Murphy, Journal of Bacteriology
180:2063-2071, 1998). To test homology arms of less than 100 bp
long as substrates for lambda-mediated recombination, a lambda
prophage was modified to express high levels of phage recombination
functions for a defined amount of time.
[0186] FIG. 1 depicts the defective .lamda. prophage on the E. coli
chromosome. The defective prophage contains .lamda. genes from cI
to int. The pL operon is intact and expressed under control of the
temperature-sensitive lambda cI-repressor (allele cI857). A
deletion (dotted line) removes the right side of the prophage from
cro through attR and including bioA (Patterson et al., Gene
132:83-87, 1993). On the chromosome, the nadA and gal operons are
to the left of the prophage, and the bio genes without bioA are to
the right. Genes of the .lamda. prophage are shown on the solid
line, and genes of the host are shown on the broken line. pL and PR
indicate the early left and right promoters of .lamda.. attL and
attR indicate the left and right attachment sites of .lamda.. The
lambda genes and functions are described in Sambrook et al.,
chapter 2, Stryer, and Court and Oppenheim.
[0187] The absence of cro-repressor allows pL operon expression to
be fully de-repressed when the temperature sensitive cI-repressor
is inactivated at 42.degree. C. The cro to bioA deletion removes
the replication and lytic genes of the prophage. The functions
encoded by these lytic genes are toxic to the cell and cause cell
death within 7 minutes after a normal prophage induction. Functions
present in the pL operon are also toxic but kill cells only after
60 minutes of continuous induction (Greer, Virology 66:589-604,
1975; Kourilsky et al., Biochimie 56:1517-1523, 1974). Thus,
shifting of cells containing the pL operon construct from repressed
conditions at 32.degree. C. to induced conditions at 42.degree. C.
allows pL operon expression. Shifting the cells back from
42.degree. C. to 32.degree. C. (or lower) within 60 minutes
reestablishes repression and prevents cell death.
[0188] As the following examples will demonstrate, this modified
lambda prophage has produced unexpected advantages in mediating
homologous recombination. These unexpected advantages include
surprisingly high recombination efficiency, precise control of
recombination functions, effective recombination with short
homology arms, and ability to generate homologous recombinants with
polynucleotides other than long double-stranded DNA. Without
wishing to be bound by a single explanation of the observed
effects, it is likely that these unexpected advantages accrue from
incorporation of the lambda red genes on the prophage in their
native context, thereby limiting the number of copies of the lambda
recombination genes. In addition, use of the pL promoter confers
the ability to precisely control the timing and production of large
amounts of lambda recombination gene expression.
[0189] This system is not limited to expression in E. coli, but can
also work in other bacteria, such as Salmonella and others. It can
also work in eukaryotic cells, such as yeast or mammalian cells,
with selection of appropriate promoters, and with other
modifications of the present to allow expression of the lambda
recombinase genes. In one specific, non-limiting example, in
another bacteria, genes between gam and N (including N but not gam)
can be deleted to remove transcription terminators.
[0190] Although the pL promoter is used to illustrate the
invention, other de-repressible, inducible or constitutive
promoters could be used. Specific, non-limiting examples of
inducible promoters are drug inducible promoters (e.g. a
tetracycline inducible promoter) metal inducible promoters (e.g.
the metallathione promoter), or a hormone inducible promoter (e.g.
a steroid responsive element).
[0191] The pL promoter could also be used to drive expression of,
for example, P22 genes such as erf, or of RecE and RecT.
Example 2
Bacterial Strains, Expression of pL Operon, Electroporation
Methods, Identification of Recombinants
[0192] Bacterial strains used in this work are listed in Table
2.
TABLE-US-00002 TABLE 2 Strains Genotype WJW23 his ilv rpsl
.DELTA.(argF-lac)U169 nadA::Tn10 gal490 .lamda.cI857
.DELTA.(cro-bioA) ZH1141 W3110 .DELTA.(argF-lac)U169 gal490
.lamda.N:lacZ .DELTA.(N-int) cI857 .DELTA.(cro-bioA) BR3677
lacl.sup.q lacZ(M15) .DELTA.(srl-recA)301::Tn10 DY329 W3110
.DELTA.(argF-lac)U169 nadA::Tn10 gal490 .lamda.cI857
.DELTA.(cro-bioA) DY330 W3110 .DELTA.(argF-lac)U169 gal490
.lamda.cI857 .DELTA.(cro-bioA) DY331 W3110 .DELTA.(argF-lac)U169
.DELTA.srl-recA)301::Tn10 gal490 .lamda.cI857 .DELTA.(cro-bioA)
DY378 W3110 .lamda.cI857 .DELTA.(cro-bioA) W3110 "Wild-type" HME5
.DELTA.(argF-lac)U169 .lamda.cI857 .DELTA.(cro-bioA) HME6
.DELTA.(argF-lac)U169 galK.sub.tyr145UAG .lamda.cI857
.DELTA.(cro-bioA) HME9 .DELTA.(argF-lac)U169 galK.sub.tyr145UAG
.lamda.cI857 .DELTA.(cro-bioA) tyrTV<>cat HME10
.DELTA.(argF-lac)U169 galK.sub.tyr145UAG .lamda.cI857
.DELTA.(cro-bioA) tyrTV<>cat .DELTA.(srl-recA)301::Tn10 HME31
.DELTA.(argF-lac)U169 galK><catsacB .lamda.cI857
.DELTA.(cro-bioA) HME40 .DELTA.(argF-lac)U169 INgal[galM.sup.+
K.sub.tyr145UAGT.sup.+ E.sup.+] .lamda.cI857 .DELTA.(cro-bioA)
HME43 .DELTA.(argF-lac)U169 galK.sub.tyr145UAG .lamda.
(exo-int)<>cat .DELTA. (gam-N) cI857.DELTA.(cro-bioA) HME47
galK 34<>kan .lamda.exo<>cat cI857.DELTA.(cro-bioA)
DY411 galK 34<>kan .lamda.cI857 .DELTA. (cro-bioA) DH10B P
mcrA .DELTA.(mrr-hsdRMS-mcrBC) .phi.80dlacZ.DELTA.M15 .DELTA.lacX74
deoR recA1 endA1 araD139 .DELTA.(ara, leu)7649 galU galK rspL nupG
DY303 DH10B [.lamda.cl857recA*] DY374 W3110 gal490 nadA::Tn10
[.lamda.cl857 .DELTA.(cro-bioA)] DY363 W3110 .DELTA.lacU169 gal490
[.lamda.cl857 (cro-bioA)<>tet.sup.a] DY380 DH10B
[.lamda.cl857 (cro-bioA)<>tet] EL11 DH10B [.lamda.cl857
(cro-bioA)<>cat-sacB] EL250 DH10B [.lamda.cl857
(cro-bioA)<>araC-P.sub.BADflpe.sup.b] EL350 DH10B
[.lamda.cl857 (cro-bioA)<>araC-P.sub.BADcre]
.sup.a(cro-bioA)<>tet indicates substitution of cro-bioA with
tet. .sup.bP.sub.BAD represents the promoter of araBAD.
[0193] Strain DY329 was constructed by transduction of ZH1141 with
P1 phage grown on WJW23, selecting for nadA::Tn10 tetracycline
resistance (Tet.sup.R) at 32.degree. C. and then screening for the
presence of a defective lambda prophage which causes temperature
sensitive cell growth at 42.degree. C. Similar P1 transduction was
used to create other strains described in Table 2 using standard
media, methods, and selections (Sambrook et al., Molecular Cloning:
a Laboratory Manual, 2.sup.nd Ed., .COPYRGT. 1989; Miller,
Experiments in Molecular Genetics, Cold Springs Harbor Lab Press,
.COPYRGT. 1972). The symbol < > is used to indicate a
replacement generated by homologous recombination. The symbol >
< indicates an insertion generated by homologous recombination.
A deletion at the point of insertion is indicated in parenthesis
following the inserted gene. The entire gal operon in HME40 is
inverted (IN).
[0194] To induce expression from the pL operon and prepare
electroporation-competent cells, overnight cultures grown at
32.degree. C. from isolated colonies were diluted 50-fold in LB
medium and were grown at 32.degree. C. with shaking to an
OD.sub.600 of about 0.4-0.8. Induction was performed on a 10 ml
culture in a baffled conical flask (50 ml) by placing the flask in
a water bath at 42.degree. C. with shaking (200 revolutions/min)
for 15 minutes Immediately after the 15 minute induction, the flask
was swirled in an ice water slurry to cool for 10 minutes. An
uninduced control culture, maintained at 32.degree. C. throughout,
was also placed into the ice slurry. The cooled 10 ml cultures were
centrifuged for 8 minutes at 5,500.times.g at 4.degree. C. Each
cell pellet was suspended in 1 ml of ice-cold sterile water,
transferred to a 1.5 ml plastic microcentrifuge tube, and was spun
for 20 seconds at 4.degree. C. at maximum speed in a
microcentrifuge. After washing the cell pellets as described two
more times, the cells were suspended in 100 .mu.l of ice cold
sterile water. This volume of competent cells is sufficient for two
standard electroporation reactions (.about.10.sup.8 cells per
reaction). Larger cultures can be prepared for a greater number of
reactions or for storage of electrocompetent cells at -80.degree.
C. with 12% glycerol present. Fresh competent cells give highest
efficiencies of recombination. To transform cells by
electroporation, purified linear donor DNA (1 to 10 .mu.l) was
mixed with competent cells in a final volume of 50 .mu.l on ice,
and then pipetted into a pre-cooled electroporation cuvette (0.1
cm). The amount of donor DNA used per reaction (usually 1 to 100
ng) is indicated for relevant experiments. Electroporation was
performed using a Bio-Rad Gene Pulser set at 1.8 kV, 25 .mu.F with
Pulse controller of 200 ohms Two protocols have been used
interchangeably to allow segregation of recombinant from parental
chromosomes within the electroporated cells. In both protocols, the
electroporated cells were immediately diluted with 1 ml of LB
medium. In one, the cells were incubated for 1 to 2 hours at
32.degree. C. before selecting for recombinants. In the other, the
cells were immediately diluted and spread on sterile nitrocelluose
filters (100 mm) on LB agar. After a 2 hour incubation at
32.degree. C., the filters were transferred to the appropriate agar
plates required to select for recombinants. Aliquots were also
directly spread on LB agar and incubated at 32.degree. C. to
determine and examine total viable cells after electroporation. For
drug resistant selection, each ml of LB medium contained 10 .mu.g
of chloramphenicol, 12.5 .mu.g of tetracycline, 20 .mu.g of
kanamycin, 30 .mu.g of ampicillin, or 50 g of spectinomycin.
[0195] Although recombinants were verified by more than one method,
the primary detection was for an altered phenotype caused by the
modified target gene. Disruption or mutation of the galK gene was
confirmed by the presence of white colonies on MacConkey galactose
indicator agar, disruption of the rnc gene for the endoribonuclease
RNaseIII was confirmed by the inability of lambdoid type phage to
lysogenize (Court, pp. 71-116 in Belasco et al., eds., Control of
Messenger RNA Stability, .COPYRGT. 1993, Academic Press, New York),
and deletion of gam, kil, and cIII in the pL operon was scored as
an ability of the .lamda. lysogen to survive growth at 42.degree.
C. (Court and Oppenheim; Greer, Virology 66:589-604, 1975). PCR
analysis was used to confirm the altered structure caused by
replacement of a gene. Southern hybridization analyses of parental
and recombinant DNAs confirmed structural changes, and DNA from the
recombinant clones can be amplified by PCR and sequenced.
[0196] In addition to electroporation, any suitable method for
macromolecular transfer into bacterial cells would be effective for
practicing the methods herein disclosed. For example, such methods
may include exposure to divalent cations, DMSO and the like as
described in a variety of standard laboratory publications, such as
Sambrook et al. (see particularly pages 1.74-1.84) and Ausubel et
al., eds., Current Protocols In Molecular Biology, John Wiley &
Sons .COPYRGT. 1998 (hereinafter Ausubel et al.), herein
incorporated in their entirety.
Example 3
Homologous Recombination with Short Linear DNA Fragments
[0197] The recombination system described in Examples 1 and 2 were
used to generate a single by mutation in the bacterial galK
gene.
[0198] The galK gene encodes a galactokinase that phosphorylates
galactose and its derivatives. The galK galactokinase
phosphorylates 2-deoxygalactose to generate 2-deoxygalactose
phosphate (2DGP). While unphosphorylated 2-deoxygalactose has no
impact on cell growth, 2DGP is a nonmetabolized sugar phosphate
that inhibits cell growth. Thus, cells containing a wild type galK
gene grow poorly on 2-deoxygalactose, a phenotype referred to
herein as Gal+. In contrast, mutants defective in galK grow well in
the presence of 2-deoxygalactose (Dog), and have a phenotype
referred to herein as DogR--(Adhya, pages 1503-1512 in Escherichia
coli and Salmonella typhimurium: Cellular and Molecular Biology,
Neihardt et al. eds., American Society of Microbiology, 1987). The
DogR-phenotype enables ready selection of cells harboring
successful recombination events.
[0199] Complementary 70 base pair oligonucleotides were synthesized
and annealed to each other. The annealed DNA was homologous to an
internal coding segment of the bacterial galK gene, except that a
UAU codon (TYR-145) was changed to a UAG amber codon. A homologous
recombination event between this 70 base pair DNA fragment and the
galK gene introduces a premature stop codon in the galK gene, and
is referred to herein as the galK amber mutation. This mutation
produces a truncated galK gene product that lacks function.
[0200] The 70-bp DNA fragment was transferred by electroporation
into galK+ cells (HME5) that had been induced for lambda pL operon
expression by growth at 42.degree. C. for 15 minutes. After
electroporation with the mutant DNA (100 ng) or mock
electroporation without DNA, the cells were spread on minimal 0.4%
glycerol agar medium with 0.2% 2-deoxygalactose present.
Spontaneous resistant mutants occurred frequently (10.sup.-4) in
the absence of mutant DNA. Despite this, the addition of the mutant
DNA enhanced the frequency of resistant mutants dramatically,
generating one mutant per 500 electroporated cells.
[0201] To determine that temperature induction was required,
another batch of cells that had not been induced for recombination
function was tested in the same way. In this treatment, no
discernible effect of added mutant DNA was observed. This indicated
that both induction of pL operon expression and mutant DNA addition
were required for the enhanced survival. Without wishing to be
bound by a single explanation of the observed effects, it is
believed that the expressed lambda functions allowed for efficient
recombination of this short linear mutant DNA with the chromosomal
galK gene.
[0202] Colonies surviving 2-deoxygalactose treatment were screened
for their Gal phenotype on indicator plates, and all tested had the
Gal- phenotype expected for a galK amber mutant. To test
specifically whether the galK amber mutation was present, four
independent Gal- colonies were tested by transducing cultures of
each with a lambdaimm21 phage that carries the tRNA.sub.tyr
suppressor allele supF. The four mutants tested were suppressed to
a Gal+ phenotype. Finally, the presence of the amber mutation in
galK was verified by PCR amplification and sequence analysis of the
galK gene segment from the chromosome.
[0203] This example demonstrates that controlled expression of
lambda recombination genes from a defective lambda prophage
promotes surprisingly efficient homologous recombination in
bacterial cells, even with short linear segments of DNA having very
short homology arms.
[0204] Importantly, the high recombination frequency indicates that
recombinants were identified without the need to apply positive or
negative selection methods. DNA hybridization probes are thus
designed to detect point mutations, deletions, insertions or other
modifications of cellular DNA. Standard colony hybridization or in
situ hybridization techniques can be used to detect cells in which
recombination has occurred. Alternatively, enrichment methods for
mutation detection are used, particularly for detecting point
mutations. Such enrichment methods are described in Gocke et al.,
Annals of the New York Academy of Sciences 906:31-38, 2000, which
is herein incorporated by reference in its entirety. One example of
a suitable enrichment is the mismatch amplification mutation assay
described by Cha et al., PCR Applications and Methods 2:14-20,
1992, herein incorporated by reference in its entirety.
[0205] The fact that the DNA fragments with short homology arms are
able to recombine in vivo opens a vast array of new possibilities
for generating recombinant DNA. Several steps normally involved in
generating recombinant DNA molecules are eliminated. Restriction
enzyme digests are not required to generate DNA fragments, and DNA
ligase reactions are not required to join different DNA fragments
at novel junctions. The cell generates the completed recombinant
precisely joined through homologous recombination.
[0206] The efficiency of recombination approaches 0.1% of surviving
cells from a standard electroporation. At this efficiency,
unselected colonies could be screened for recombinant DNA using
colony hybridization techniques, eliminating the need for selection
steps. Thus, this recombination protocol makes the bacterial
chromosome and plasmid DNA amenable to almost any type of desired
change. This includes directed mutagenesis of a gene, a gene
segment, or even a base.
Example 4
Preparation of Linear DNA Cassettes Greater than 1000 bp in
Length
[0207] Standard Polymerase Chain Reaction (PCR) conditions were
used to amplify linear DNA fragments with the Expand.TM. High
Fidelity PCR system of Boehringer Mannheim. The chloramphenicol
resistant (Cm.sup.R) cassette cat was amplified from pPCR-Script
Cam (Stratagene) with primers 5'TGTGACGGAAGATCACTTCG (SEQ ID NO: 1)
and 5'ACCAGCAATAGACATAAGCG (SEQ ID NO: 2). The tetracycline
resistant (Tet.sup.R) cassette tet was amplified from Tn10 with
primers 5'CTCTTGGGTTATCAAGAGGG (SEQ ID NO: 3) and
5'ACTCGACATCTTGGTTACCG (SEQ ID NO: 4). The ampicillin resistant
(Ap.sup.R) cassette amp was amplified from pBluescript (Stratagene)
with primers 5'CATTCAAATATGTATCCGCTC (SEQ ID NO: 5) and
5'AGAGTTGGTAGCTCTTGATC (SEQ ID NO: 6). The kanamycin resistant
cassette kan was amplified from Tn5 with primers
5'TATGGACAGCAAGCGAACCG (SEQ ID NO: 7) and 5'TCAGAAGAACTCGTCAAGAAG
(SEQ ID NO: 8). PCR products were purified using Qiagen PCR
purification kits and concentrated if necessary by ethanol
precipitation. The amplified linear DNAs were suspended in sterile
water or TE buffer (10 mM Tris-Cl pH7.5; 1 mM EDTA) and quantified
by spectroscopy. DNA in water was stored at -20.degree. C. The
inventors avoided PCR product purification schemes from gels in
which the DNA is subject to ultraviolet irradiation.
[0208] In order to design primers for amplification of a
recombination cassette, recombinant oligonucleotides were
chemically synthesized with the 5' 30 to 50 nucleotides identical
to sequences at the target nucleic acid sequence, and with the 3'
20 nucleotides homologous to the ends of the cassette to be
introduced. A cassette is generated by PCR that is flanked by the
30 to 50 base homologies present at the target.
[0209] Cells carrying the target DNA either on the chromosome or on
a plasmid are induced for Exo, Beta and Gam function. These cells
are made competent for electroporation and mixed with the amplified
cassette. Following electroporation, recombination occurs between
the homologous sequences on the linear cassette and the target
replaces the target segment with the cassette.
[0210] The 50 nt galK homology segments (rectangles) used for the
experiment described in Table 3 are:
TABLE-US-00003 (SEQ ID NO: 9)
5'GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGG AGTGTAAGAA and (SEQ ID
NO: 10) 5''TTCATATTGTTCAGCGACAGCTTGCTGTACGGCAGGCACC AGCTCTTCCG
[0211] In one embodiment, the cassette is a drug resistance marker
but can be any DNA if the target sequence in the subsequent steps
can be counter-selected. The transcription of the marker cassette
has been oriented arbitrarily in the same direction as the target
region being replaced. The primers contain two parts: a 5' end
homologous to flanking regions of the target DNA, and a 3' end that
primes the cassette DNA for replication. The PCR using these
primers and a DNA template containing the marker cassette generates
a linear DNA product with the cassette flanked by target homology.
Note that if transformation with the template DNA will generate the
selected phenotype (for example, the template is a plasmid), the
template is then eliminated. Plasmid template DNA can be destroyed
by treatment with DpnI following the PCR; DpnI cuts methylated GATC
template DNA leaving the newly replicated unmethylated DNA intact.
Once a linear cassette has been generated, it can be stored and
used as the template for subsequent PCRs.
Example 5
Gene Replacement by Targeted Homologous Recombination
[0212] Having demonstrated in Example 3 that 70-bp linear DNA can
direct mutations to a specific target, a synthetic DNA having 50-bp
galK DNA segments flanking the cat (chloramphenicol resistance, or
Cm.sup.R) cassette was constructed for targeting a galK gene
replacement by cat.
[0213] The linear cat cassette with flanking galK DNA was made by
PCR using chemically synthesized primers, as described in Example
4.
[0214] Data from these experiments are presented in Table 3. DY330
competent cells were electroporated with 100 ng of the cat cassette
targeted to replace either galK (galK<>cat) or prophage genes
cIII kil gam (cIII kil gam<>cat; see FIG. 1 for map of
prophage genes). Total recombinants per electroporation are shown
in the rightmost column, "CmR recombinants." The cat cassette was
transferred by electroporation into galK+ cells which had either
been heat-induced for pL operon expression (15 minute temperature
shift to 42.degree. C., as indicated by "15" in the center column
of Table 3) or not induced (maintained at 32.degree. C.; indicated
by "0" in the center column of Table 3). See also Example 2 for
description of induction and other methods. After electroporation,
Cm.sup.R recombinants were selected at 32.degree. C., and then
quantified.
[0215] As shown in Table 3, Cm.sup.R colonies were only found in
the heat-induced culture. All 50 Cm.sup.R colonies tested had a
Gal- phenotype on MacConkey galactose indicator agar, indicating
the presence of the galK<>cat replacement. The symbol
<>indicates a replacement generated by homologous
recombination techniques, for example, galK<>cat indicates
that the bacterial galK gene is replaced by cat using homologous
recombination techniques.
TABLE-US-00004 TABLE 3 Target Site* 42.degree. C., min Cm.sup.R
Recombinants GalK 0 <1 GalK 15 2.5 .times. 10.sup.4 CIII kil gam
0 <1 CIII kil gam 15 5.0 .times. 10.sup.4
[0216] In similar experiments using the same 50-bp homologous arms,
the galK has been exchanged for kan, amp, and tet cassettes by
selecting for Km.sup.R, Amp.sup.R, and Tet.sup.R, creating
galK<>kan, galK<>amp, and galK<>tet replacements,
respectively.
[0217] To test whether this approach also works at other positions
on the bacterial chromosome, a linear cat cassette was created
flanked by 50-bp DNA segments found immediately upstream and
downstream of the mc gene encoding RNaseIII. The mc gene is thought
to be non-essential (Takiff et al., Journal of Bacteriology
171:2581-2590, 1989); therefore, it was tested whether an exact
substitution of the cat coding region for the mc coding region
(from AUG to codon 224) could be made using the recombination
techniques herein described. In this construct, cat is transcribed
from the mc promoter, and the 5' primer used to generate cat
started at the cat initiation codon.
[0218] Following procedures used for galK as described in Examples
2 and 3, Cm.sup.R colonies were found, but only in the induced
culture. The Cm.sup.R colonies tested had a Rnc mutant phenotype,
as described in Example 2.
[0219] Two other mc<>cat recombinants were made. One replaced
sequence from the AUG start to codon 126 of mc, and the other from
the AUG start to codon 192 of mc. These two recombinants generate
cat::rnc gene fusions with an mc mutant phenotype. Different sets
of primers were chosen to detect unambiguously the wild type and/or
recombinant alleles. This PCR procedure follows guidelines set
forth by yeast researchers in characterizing chromosomal
replacements in yeast (Winzeler et al., Science 285: 901-906,
1989). The PCR analysis of the recombinants verified the loss of
the rnc+ gene and the predicted structures of the three
mc<>cat gene replacements.
[0220] In this example, several different genes on the bacterial
chromosome and on plasmids have been substituted with drug
resistance markers. However, it is also possible to create
recombinants in which the desired product does not include a
selectable marker. Genes have been fused to cassettes encoding
specific tags such as the green fluorescent protein. Fusion tags
can be placed precisely in the gene to be modified, for example, by
any of the following strategies. In one, the unselected cassette is
joined to a selectable drug marker, and both are recombined into
the chosen location selecting for drug resistance. In another, the
cassette is recombined into its location by substituting it for a
negative selection marker like sacB (Bloomfield et al., Mol
Microbiol 5:1447-57, 1991). This strategy permits cloning of any
DNA. In a third strategy, the recombinants are screened
non-selectively by DNA hybridization with probes specific to the
cassette.
[0221] In these experiments, the desired recombination product was
usually obtained. However, some recombination products were
unexpected. In two cases, an attempt was made to knockout essential
genes, and surprisingly it was possible to select a few rare
recombinants. These turned out to be diploid for the region of the
targeted gene, since they carried the wild type and the mutant copy
of the gene as determined by PCR analysis. Rare diploid regions of
the bacterial chromosome are known to occur spontaneously in
growing cells at a frequency of about 0.1% (Haack and Roth,
Genetics 14:1245-1252, 1995). Because an essential gene was
targeted, these rare diploids were selected. This was only possible
because the recombination is so efficient.
[0222] This example demonstrates that the methods of this invention
can be used to promote efficient gene replacement by homologous
recombination. The gene replacements were made throughout the
bacterial chromosome. In Example 7, it is shown that the methods
can be used to modify extrachromosomal nucleic acids, such as
plasmids, bacterial artificial chromosomes, cosmids, phagemids, and
the like.
Example 6
Induction Time, DNA Amount, and Homology Arm Length Affect
Targeting Efficiency
[0223] Induction time. FIG. 3 shows the effect of induction time on
recombination. The strain DY330 was grown at 32.degree. C. to
OD.sub.600=0.4 to 0.8, heat-induced at 42.degree. C. for the times
indicated and then made electrocompetent (see Example 2 for
description of methods). A linear cat cassette (10 ng) was used to
target the cIII kil gam genes of the prophage. Total Cm.sup.R
recombinants were plotted versus the time of induction.
[0224] Induction of pL operon expression for only five minutes
enhanced recombination activity. FIG. 3 reveals that by 7 5 minutes
of heat induction a maximum efficiency is reached. This maximum
level is maintained for induction times from 7.5 to 17 5 minutes
with some reduction occurring for times longer than 17.5 minutes.
Expression of the pL operon for longer than 60 minutes causes cell
death.
[0225] Cells harboring the defective lambda prophage may be grown
at temperatures other than 32.degree. C. In general, it is
undesirable to grow cells at temperatures >37.degree. C.,
because such temperatures lead to partial inactivation of the cI
repressor, and leaky expression from the pL promoter. In general,
it is also undesirable to grow cells at temperatures below
20.degree. C., because of slow growth. One skilled in the art would
also recognize that there is a considerable degree of latitude with
regard to time and temperature of induction. For example,
expression of lambda recombination genes from the pL operon could
be induced at temperatures as low as 38.degree. C., generally
allowing for longer times of induction. The limit for protein
expression in E. coli is about 45.degree. C.
[0226] Donor DNA amount. FIG. 4 shows the effect of amount of the
linear DNA cassette on recombination. The strain DY330 was grown at
32.degree. C. to OD.sub.600=0.4 to 0.8, induced at 42.degree. C.
for 15 minutes and then made electrocompetent. Different amounts
(1, 10, 100, 300, 1,000 ng) of a linear cat cassette (1 kbp in
length) were used to target the cIII kil gam genes of the prophage.
Total Cm.sup.R recombinants were plotted versus the DNA amount at
42.degree. C.
[0227] FIG. 4 shows that targeting efficiency increased in a near
linear relationship with increasing concentration of donor DNA in
the range from 10.sup.8 (1 ng) to 10.sup.10 (100 ng) molecules per
electroporation. A saturating level of linear DNA is reached at
3.times.10.sup.10 molecules yielding 7.5.times.10.sup.4
recombinants per .about.2.times.10.sup.8 cells electroporated.
Thus, the methods of this invention may be practiced over a broad
range of oligonucleotide concentrations.
[0228] Homology length. FIG. 5 shows the effect of homologous arm
length on recombination. The strains DY330 (recA+)(filled circles)
and DY331 (recA-)(open circles) were grown at 32.degree. C.,
induced at 42.degree. C. for 15 minutes and then made
electrocompetent. A linear cat cassette (100 ng) was used to target
the cIII kil gam genes of the prophage. The homologous arm length
of the cassette was varied from 0 to 1,000 bp. The primers
containing the 0 to 50 by homologies were chemically synthesized as
described (FIG. 2). The cassette containing 1,000 by homologous
arms was made by PCR using primers 1,000 by away on each side of an
existing (cIII kil gam)<>cat disruption in the cell. Total
Cm.sup.R recombinants were plotted versus the homologous arm
length.
[0229] Several pairs of primers were made to amplify the cat
cassette for targeting the chromosome and designed each pair with a
different length of flanking homology. The length of the homology
segment on the primers varied by increments of 10 bases from 10 to
50 bases. A nested set of linear cat cassettes was made with the
primers. Another linear cat cassette was constructed flanked by
1,000 by of homology. This set of linear DNAs was then tested for
recombinational targeting efficiency as shown in FIG. 5. No
recombinants were found with 10 by of homology and less than ten
recombinants were found in each of three experiments with 20 by of
homology. From 20 by to 40 by of homology, homologous recombination
increased by four orders of magnitude. From 40 by to 1,000 by of
homology, recombination increased 10-fold.
[0230] These data indicate that the methods herein disclosed may be
practiced with surprisingly short homology arms, as few as 20-40
residues. However, homology arms of 30 or greater residues increase
efficiency.
Example 7
Gene Replacement on Plasmids and BACs: In Vivo Cloning
[0231] To determine if this method could be used to modify plasmid
DNA, the procedures described in Examples 2-3 were followed to
modify plasmid pGB2, a derivative of pSC101 (Bernardi et al.,
Nucleic Acids Res. 12:9415-9426, 1984). A cat cassette was
synthesized in vitro and recombined in vivo with pGB2 to replace
the spectinomycin resistance gene with cat conferring Cm.sup.R on
the cell carrying the recombinant plasmid.
[0232] The same experiment, performed on pBR322 derivatives,
generated recombinants, but they were joined in tandem to
non-recombinant plasmids as dimers and higher multimers. Induction
of Gam expression from our prophage inactivates RecBCD nuclease. In
the absence of RecBCD, pBR322 derivatives replicate by a rolling
circle mode (Feiss et al, Gene 17:123-130, 1982), and the plasmid
converts from monomers to multimers. This is specific for
pBR322-type replicons as the pGB2 type did not form multimers.
[0233] To generate simple recombinants of pBR322 derivatives, the
protocol was modified by coelectroporating the recA.sup.- strain
DY331 with circular plasmid DNA (0.1 ng) and a linear drug
cassette. Recombinant plasmid monomers were readily selected and
isolated.
[0234] In addition to plasmids, the method is also suitable for
targeting genes on bacterial artificial chromosomes, phagemid
artificial chromosomes, yeast artificial chromosomes, cosmids, and
the like. Homologous recombination between target nucleic acid
sequences on BACs and synthetic oligonucleotides (such as ds DNA
fragments or PCR fragments) is carried out in bacterial cells
bearing the defective lambda prophage shown in FIG. 1 and described
in Example 1. Synthetic oligonucleotides (such as short annealed
dsDNA fragments or PCR fragments) are electroporated into bacterial
cells as described in Example 2. Analysis for successful
recombination events is by selective PCR amplification using
specific primers for the introduced sequence, or by selective
amplification approaches such as the mismatch amplification
mutation assay described by Cha et al., PCR Applications and
Methods 2:14-20, 1992, or by direct hybridization using specific
probes. Using this approach recombination frequencies of up to
1:500 have been observed, regardless of the strand targeted. Thus,
this system is extremely useful in manipulation of and rapid
screening for recombinants in BAC vectors. The unexpectedly high
efficiencies eliminate the need for introducing selectable markers,
or modifying such markers on the BAC.
Example 8
Requirement of RecA for Targeted Recombination
[0235] The requirement for RecA were tested in targeted homologous
recombination by repeating the experiment described in FIG. 5 but
using a recA.sup.- strain. Surprisingly, recombination efficiency
was depressed only about 10-fold in the recA- mutant for the arm
lengths tested (FIG. 5). Thus, RecA function is not required, and
recA- strains mediate efficient homologous recombination with
linear DNA fragments having homology arms of 30 by or greater.
[0236] This result was unexpected. The .lamda. recombination system
is known to function in cells lacking the bacterial RecA function
(Brooks and Clark, J. Virol. 1:283-293, 1967). However, the
recombination in recA mutants under conditions used by others is
reduced more than 50-fold relative to levels in recA.sup.+ cells
(Stahl et al., Genetics 77:395-408, 1974; Murphy, J. Bacteriol.
180:2063-2071, 1998).
Example 9
Lambda Genes Promote Targeted Recombination of dsDNA in Wild Type
E. coli
[0237] To determine which lambda genes promote targeted
recombination of dsDNA, a set of replacement deletions were
generated in the pL operon of the prophage using cat and amp
cassettes. In the center column of Table 4, the parentheses
indicate the deletions made by the recombination event within the
prophage (refer to FIG. 1 for a linear map of the prophage genes).
Each of these newly made deletions was verified structurally by PCR
analysis and tested for targeted recombination of a tet gene
cassette into galK.
[0238] Electrocompetent cells from strains indicated in Table 4
were heat-induced for 15 minutes at 42.degree. C., and
electroporated with 10 ng of linear galK<>tet. The results
are presented as total number of Tet.sup.R recombinants per
electroporation in the right hand column of Table 4.
TABLE-US-00005 TABLE 4 Strain Prophage Recombinant DY330 wild-type
4,100 DY392 (hin-int)<>amp 2,000 DY351 (sieB-kil)<>cat
4,400 DY386 (hin-int)<>amp 1,650 (sieB-kil)<>cat DY349
(gam)<>cat 0 DY360 (bet)<>cat 0 DY359 (exo)<>cat
0
[0239] Table 4 shows that only exo, bet, and gam deletions affected
galK<>tet targeted recombination. Deletion of any one of
these three genes eliminated the recombination, whereas deletion of
all other genes in the pL operon had little if any effect.
[0240] To show that the gam<>cat substitution was not polar
on bet and exo, the gam gene was expressed in trans and shown to
complement the defect. Thus, although the entire pL operon was used
in studies described here, only exo bet and gam functions are
needed for recombination with double-stranded DNA cassettes
>100-200 by made by PCR.
Example 10
Efficient Recombination with Single-Strand DNA
[0241] To evaluate recombination between exogenous single-strand
DNA and the E. coli chromosome, the experiments described in this
Example were performed. In addition, the experiments also address
the role of the bacterial recA recombination genes in mediating the
observed effects.
[0242] Expression from the pL operon was heat-induced, cells were
made electroporation-competent, and 70-mer oligonucleotides were
electroporated into cells, all as described in Example 2. Strains
HME9 and HME10 both harbor the galK amber mutation, and are
therefore Gal- in phenotype. They differ from each other in that
HME9 is recA+, whereas HME10 is recA-. Thus in this experiment
recombination efficiencies in recA+ and recA-cells are
compared.
[0243] The 70-mer single-stranded oligonucleotides used in this
experiment were designed to restore wild type galK gene activity
(hereinafter galK+) upon successful recombination, thereby
producing a Gal+ phenotype (i.e., ability to grow on minimal media
with galactose as the sole carbon source). The 70-mer corresponding
to the transcriptional non-template DNA strand of galK was
TABLE-US-00006 (SEQ ID NO: 11)
5'AAGTCGCGGTCGGAACCGTATTGCAGCAGCTTTATCATCTGCCGCTGG
ACGGCGCACAAATCGCGCTTAA.
[0244] 70-mer single-stranded DNA of either SEQ ID NO: 11 or its
complement was electroporated into cells. Alternatively, the two
70-mers were first annealed to each other and then electroporated
into cells as double strand DNA. A successful recombination event
was identified by restoration of the Gal+ phenotype. Table 5
indicates the number of galK+ recombinants per viable cell, x
10.sup.-4.
[0245] Table 5 presents the number of recombinants observed x
10.sup.4 after electroporation of the HME9 or HME10 strains with
DNA in the indicated forms. Efficient recombination was observed
with double strand DNA, similar to that previously described in
Examples 3 and 5. Surprisingly, single-strand DNA was about equally
or even more efficient than double-stranded DNA in producing
homologous recombination, regardless of strand used. In this
experiment, recombination efficiencies for the double-stranded DNA
was about 1 in 3800 cells (2.6-2.7.times.10.sup.-4), whereas
recombination efficiency for single-stranded counterclockwise DNA
was 3-to 7-fold higher. In other strains (e.g. DY374) recombination
of single strand linear DNA as frequent as one nadA.sup.+
recombinant per 20 viable cells has been observed. In addition,
efficient recombination was observed in both recA+ and recA- cells,
establishing that the recombination events did not require the
bacterial recA gene products.
TABLE-US-00007 TABLE 5 DNA used in electroporation dsDNA cc-ssDNA
cw-ssDNA (about (about (about Strain Used 1 .mu.g) 0.7 .mu.g) 0.6
.mu.g) HME9 2.6 18.5 2.2 galK.sup.am.lamda.CI857.DELTA.(cro-bio)
HME10 2.7 9 0.35 galK.sup.am.lamda.CI857.DELTA.(cro-bio) recA.sup.-
cc = clockwise (strand with the 5' to 3' orientation relative to
transcription) cw = counterclockwise (strand with the 3' to 5'
orientation)
Example 11
Efficient Generation of Large Deletions by Recombination with
Single-Strand DNA
[0246] Example 10 demonstrates efficient lambda-mediated
recombination using ssDNA to generate a single base change in the
E. coli chromosome. This example demonstrates similar high
efficiency when the approach is used to generate large
deletions.
[0247] Using the methods described in Examples 2, 3, and 10, lambda
operon expression was heat-induced, cells were rendered
electroporation-competent, and 70-mer single-stranded DNA of either
SEQ ID NO: 11 or its complement was electroporated into cells. The
DNA was electroporated into two strains: one containing the galK
amber mutation, and one in which the galK gene was interrupted by a
cat-sacB cassette precisely inserted at the position of the amber
mutation in galK. The strains were otherwise genetically identical.
A successful recombination event was identified by restoration of
the Gal+ phenotype. Table 6 indicates the number of galK+
recombinants per viable cell, x 10.sup.-4.
[0248] The data in Table 6 demonstrate that recombination
efficiency is similar using the same oligonucleotide, regardless of
whether lambda-mediated ssDNA recombination is being used to
generate a single base change or a large deletion, removal of the
3264 by cat-sacB cassette. In both cases, the method is highly
efficient in generating recombinants.
TABLE-US-00008 TABLE 6 DNA used in electroporation cc-ssDNA
cw-ssDNA Strain Used (200 ng) (200 ng) HME6 15 3
galK.sup.am.lamda.CI857.DELTA.(cro-bio) HME31 10 0.5
galK<>catsacB .lamda.CI857.DELTA.(cro-bio)
[0249] The length that is reasonable to synthesize chemically
limits the length of single strand oligonucleotides used for
recombination. It is demonstrated herein that two oligonucleotides
that have a complementary overlap region at their 3' ends, when
co-electroporated into DY411 cells, can anneal and generate
recombinants with chromosomal or extrachromosomal DNA (FIG. 14).
This recombination requires the induction of the pL operon and the
Gam, Beta, and Exo functions. A galK mutation in which the kan
cassette was placed in galK in a way to delete 34 by of the galK
gene was created by recombineering. Two oligos were synthesized
that were 70 bases long, with 34 bases of the deleted region at
their 3' ends, that were complementary and can act to anneal the
two oligos together. The 5' end of each oligo contained 36 bases of
homology to each side of the 34 bp deletion caused by kan. Each
oligo alone cannot generate gal+ recombinants but mixed together
they generated up to 10.sup.5 recombinants per 10.sup.8 cells
electroporated. Oligos with the same sequence but shortened from
their 3' end to overlap by only 2 bases did not yield recombinants.
However, overlaps of 10 bases or more generated recombinants.
Preannealing was not required and the two oligos can be mixed and
used directly for electroporation.
[0250] If the ends of the overlaps are filled in by DNA polymerase
a 104 by duplex is generated. This dsDNA generates only slightly
more recombinants then the DNA with 10 to 34 base overhangs. Thus,
multiple overlapping (by >10 bases) oligonucleotides of any even
number can be used to yeild recombinants, in which the most outside
oligonucleotides have 5' overlaps. The end oligonucleotides also
have 30-50 bases of homology to the targeted region. The use of
multiple overlapping oligonucleotides allows production of long
recombination substrates without use of PCR. The central
oligonucleotide(s) can be any cassette envisioned to be used for
dsDNA recombination. This recombination with overlapping
oligonucleotides having outside 5' overhangs is most efficient with
Exo, Beta, and Gam, but can be recombined by Beta alone (without
Exo and Gam) in the cell. This greatly simplifies the recombination
procedure (as only Beta is required). Although the 104 by duplex
DNA recombines more efficiently if Exo, Beta and Gam are present,
recombination also occurs in the absence of Gam, albeit at a lower
efficiency (the duplex requires both Exo and Beta for
recobination).
[0251] Similar overlapping synthetic oligonucleotides can be
generated with 3' overhangs of 34 bases that can be
coelectroporated into cells. These are also recombined into targets
defined by homology at the ends. Again, only Beta is required for
this recombination. In this case, Exo is not required, and further
Exo does not stimulate recombination. In one embodiment, multiple
oligonucleotides can be overlapped as above to span longer
distance. As long as the outermost oligonucleotides have 3'
overhangs, recombination will be Exo independent. The efficiencies
of the present system allows the detection of recombinants in this
case.
[0252] Examples 10 and 11, taken together, document that the
methods disclosed herein can be practiced with ssDNA
oligonucleotides. This surprising result enables high efficiency
homologous recombination with synthetic DNA of single or double
strandedness.
[0253] The present system allows the limit of synthetic
oligonucleotide size to be increased dramatically by overlapping
oligonucleotides. In addition, the system allows recombination of
these DNAs to be carried out with Beta alone, or Exo with Beta but
without Gam. Recombination without the requirement for Gam is
important because Gam is the toxic function that was a limiting
factor in the previously described methods. As the present system
requires only Beta, a constitutive promoter can be utilized.
Example 12
Effect of ssDNA Length on Recombination Efficiency
[0254] In Examples 10 and 11, lambda-mediated recombination was
used to efficiently incorporate 70-mer ssDNAs into the E. coli
chromosome. In this example, the effect of oligonucleotide length
on recombination efficiency was investigated.
[0255] Using the methods described in Examples 2, 3, 5, 10 and 11,
lambda operon expression was heat-induced, cells were rendered
electroporation-competent, and ssDNA oligonucleotides (200 ng each)
were electroporated into E. coli HME9 strain cells. The
electroporated ssDNA oligonucleotides included the 70-mer of SEQ ID
NO: 11, a 60-mer constructed by removing the last 5 nucleotides
from both the 5' and 3' ends of SEQ ID NO: 11, and a 50-mer,
40-mer, 30-mer, or 20-mer constructed by removing the last 10, 15,
20, or 25 nucleotides, respectively, from both the 5' and 3' ends
of SEQ ID NO: 11. As in example 10, the ssDNA oligonucleotides used
in this experiment were all designed to restore the galK+ gene upon
successful recombination, thereby conferring upon the cell a Gal+
phenotype. Table 7 indicates the number of galK+ recombinants per
viable cell, x 10.sup.-4.
TABLE-US-00009 TABLE 7 Oligonucleotide length 0 20 30 40 50 60 70
Efficiency 0.004 0.01 0.47 4 4 6 22 (.times.10.sup.-4)
[0256] As the data in Table 7 demonstrate, recombination efficiency
increases with increasing ssDNA length. Recombination efficiency
was low when the ssDNA used was a 20-mer, but increased
considerably with a 30-mer. Efficiency was near optimal with a
40-mer, and increased to 1 in 450 viable cells with a 70-mer.
Hence, specific examples of the invention use single-stranded DNA
molecules at least about 40 nucleotides in length.
[0257] Without wishing to be bound by a single explanation of the
observed effects, the inventors currently believe that observed
length-efficiency relationship may reflect published data
indicating that lambda Beta protein binds stably to DNA sequences
of 36 bases or longer, but does not bind as well to shorter
oligonucleotides (Mythili et al., Gene 182:81-87, 1996).
Example 13
Lambda Beta Protein Mediates Efficient Recombination with ssDNA
[0258] To determine whether lambda Beta protein was sufficient to
mediate recombination between exogenous ssDNA and the E. coli
chromosome, the efficiency of recombination was investigated in a
strain that expressed lambda Beta, but not Exo or Gam.
[0259] For these experiments, the HME43 strain was used. Its
genotype is identical to the HME6 strain, except that the lambda
prophage contains additional genetic deletions, from int through
exo and from gam through N (see FIG. 1). In addition, the cat gene
conferring the CmR phenotype is inserted between attL and bet.
[0260] Using the methods described in Examples 2, 3, and 10-12,
expression of the modified lambda operon was heat-induced, cells
were rendered electroporation-competent, and 70-mer ssDNA of SEQ ID
NO: 11 (200 ng) was electroporated into cells. Using this
procedure, the HME43 strain expresses lambda Beta protein, but does
not express gam, exo, or any other prophage encoded genes. A
successful recombination event was identified by restoration of the
Gal+ phenotype. Table 8 indicates the number of galK+ recombinants
per viable cell, x 10.sup.-4.
TABLE-US-00010 TABLE 8 Recombination Strain Prophage Modifications
Efficiency (.times.10.sup.-4) HME43 (int-exo)<>cat,
(gam-N)<>.DELTA. 7.7
[0261] In contrast to Example 9 using PCR-generated double-stranded
DNA, the data presented in this example establish that lambda Beta
alone is sufficient to mediate efficient recombination between
ssDNA and the E. coli chromosome. Moreover, two or more overlapping
oligonucleotides may be used, if they have a 3' overhang and more
than about 10 by of overlap. Overlapping oligonucleotides with a 5'
overhang also promote homologous recombination with Beta alone.
However, for 5' overhangs, exo and gam (or a similar exonuclease
and RecBCD-inhibition function) appear to enhance maximal
efficiency.
[0262] A modification of the method is to place DNA encoding other
ssDNA binding polypeptides under control of the pL promoter. For
example, the strain HME43 is further modified to delete bet and
insert DNA encoding P22 Erf, RecT, or Rad52. Expression of the
ssDNA binding polypeptide is induced by temperature shift as it is
for induction of lambda bet expression. Exo and Gam, or proteins
with similar function, can also be placed under control of the pL
promoter. Moreover, other inducible or constituitive promoters can
be used.
Example 14
Ex Vivo Combination of ssDNA with Lambda Beta Mediates Efficient
Homologous Recombination
[0263] Single-strand DNA can be combined with lambda Beta protein
prior to electroporation into cells, and mediated efficient
recombination between the ssDNA and the host DNA.
[0264] Lambda Beta proteins may be prepared by techniques known in
the art (Karakousis et al., J. Mol. Biol. 276:721-731, 1998), and
preincubated at 37.degree. C. with single-strand oligonucleotides
of 20-mer or greater length. In this example, ssDNA
oligonucleotides of SEQ ID NO: 11, a 60-mer constructed by removing
the last 5 nucleotides from both the 5' and 3' ends of SEQ ID NO:
11, and a 50-mer constructed by removing the last 10 nucleotides
from both the 5' and 3' ends of SEQ ID NO: 11 were used. Typically,
lambda Beta protein concentration is about 2.5 .mu.M and DNA
concentration about 5 .mu.M, but the method is effective with a
broad range of protein and DNA concentrations (for example, from
0.1 .mu.M to 10 mM protein, and 0.01 .mu.M to 10 mM ssDNA).
Alternatively, the Beta protein and ssDNA can be coelectroporated
into cells without premixture or preincubation.
[0265] The DNA and protein is electoporated into E. coli using
methods described in Examples 2 and 3. In this example HME 43
strain is used, but numerous other strains are suitable. Expression
of the modified lambda operon is one set of cells is heat-induced,
and a second set of cells is maintained at 32.degree. C. Both sets
of cells are rendered electroporation-competent, and 70-mer ssDNA
of SEQ ID NO: 11 (200 ng) is electroporated into both heat-induced
and uninduced cells. Using this procedure, the HME43 strain
expresses lambda Beta protein upon temperature shift to 42.degree.
C., but does not express Beta from bet or any other
prophage-encoded genes in the absence of a temperature shift. A
successful recombination event is identified by restoration of the
Gal+ phenotype.
[0266] In this experiment, high efficiency recombination is
observed in both heat-induced and uninduced cells. Moreover, it is
believed that approximately equally high efficiency recombination
is observed when these techniques are followed in E. coli strains
that contain no lambda prophage genes.
[0267] This approach can be modified by substituting other ssDNA
binding polypeptides for lambda Beta, such as p22 Erf, RecT and
Rad52. The target nucleic acid sequence may be on the bacterial
chromosome, or on exogenous DNA such as a bacterial artificial
chromosome, phagemid artificial chromosome, plasmid, cosmid, or the
like. Moreover, there is no particular requirement for a specific
bacterial species; these single-strand DNA binding polypeptides
will mediate efficient recombination in a broad range of bacteria.
Indeed, these polypeptides will mediate efficient recombination in
eukaryotic cells as well, as in Example 15.
Example 15
Lambda Beta Protein Mediates Efficient Homologous Recombination in
Eukaryotic Cells
[0268] The ex vivo approach described in Example 14 may be used to
target genes in eukaryotic cells for homologous recombination. In
eukaryotic cells, transfection of the ssDNA with lambda Beta
protein may be accomplished by electroporation as in Examples 2, 3
and 14, or by the methods of Chang et al., Biochimica et Biophysica
Acta, 153-160, 1992, Keating and Toneguzzo, Bone Marrow Purging and
Processing, 491-498, 1990, or other electroporation protocols known
in the art. In addition, a variety of means for macromolecular
transfer methods are known to the art, including calcium
phosphate-DNA co-precipitation (Ausubel et al.),
DEAE-dextran-mediated transfection (Matthews et al., Experimental
Hematology 21:697-702, 1993) polybrene-mediated transfection
(Costello et al., Gene Therapy 7:596-604, 2000), microinjection
(Davis et al., Blood 95:437-44, 2000), liposome fusion and
lipofection (Veit et al., Cardiovascular Research 43:808-22, 1999),
protoplast fusion (Schaffner, Proc. Natl. Acad. Sci. U.S.A.
77:2163, 1980), inactivated adenovirus-mediated transfer (Wagner et
al., Proc Natl Acad Sci U.S.A. 89:6099-6103, 1992), hemagglutin
virus of Japan-(HVJ)-mediated transfer (Morishita et al., Journal
of Clinical Investigation 93:1458-1464, 1994), biolistics (particle
bombardment) and the like. Any such macromolecular transfer
approach is suitable. Design of dsDNA molecules for facilitating
homologous recombination with eukaryotic genes is well known in the
art (for example, as described in Mansour, Nature 336:348-352,
1988; Shesely, PNAS 88:4294-4298, 1991; Capecchi, M. R., Trends in
Genetics 5:70-76, 1989; U.S. Pat. No. 6,063,630).
[0269] Cells to be transfected with exogenous DNA are combined with
a DNA construct comprising the exogenous DNA, targeting DNA
sequences and, optionally, DNA encoding one or more selectable
markers. The resulting combination is treated in such a manner that
the DNA construct enters the cells. This is accomplished by
subjecting the combination to electroporation, microinjection, or
other method of introducing DNA into vertebrate cells. Once in the
cell, the exogenous ssDNA is integrated into cellular DNA by
homologous recombination between DNA sequences in the DNA construct
and DNA sequences in the cellular DNA.
[0270] For example, the target nucleic acid is the beta-globin gene
in hematopoietic stem cells from a patient with sickle cell anemia
(Beutler, Disorders of Hemoglobin, Ch. 107 in Harrison's Principles
of Internal Medicine, 14.sup.th ed. .COPYRGT.1998, herein
incorporated by reference). The sickle cell Beta globin gene
harbors a point mutation that substitutes a Val for Glu at position
six of the polypeptide chain, resulting in an abnormal hemoglobin
which is prone to inappropriate polymerization. The methods of this
invention can be used to correct the mutation.
[0271] Hematopoetic stem cells from a sickle cell patient are
isolated, cultured, and expanded ex vivo as is known in the art
(Brugger, Seminars in Hematology 37[1 Suppl 2]:42-49, 2000; Dao et
al., Blood 92:4612-21, 1998; Aglietta et al., Haematologica
83:824-48, 1998; Emerson, Blood 87:3082-8, 1996). A 60-mer ssDNA
oligonucleotide of SEQ ID NO: 12 (AACAGACACC ATGGTGCACC TGACTCCTGA
GGAGAAGTCT GCCGTTACTG CCCTGTGGGG) is synthesized and partially
purified by standard techniques (Pfleiderer et al., Acta Biochimica
Polonica 43:37-44, 1996; Anderson et al., Applied Biochemistry
& Biotechnology 54:19-42, 1995, herein incorporated by
reference).
[0272] After culture and ex vivo expansion, about 10.sup.6
hematopoetic stem cells are suspended in 0.4 mL PBS containing 0.1%
glucose, about 10 .mu.M purified lambda Beta protein, and about 1
.mu.g ssDNA oligonucleotide of SEQ ID NO: 12. The cell suspension
is electroporated in a 1-mL cuvette at 280V and 250 .mu.F with a
Gene Pulser (Bio-Rad Laboratories Inc., Hercules, Calif., USA).
Cells are then plated and cultured. Homologous recombinants
harboring the mutation are identified and clonally isolated,
further expanded ex vivo, and may be returned to the patient, or
cultured for additional in vitro study.
[0273] Those skilled in the art will recognize that a broad range
of ssDNA and ssDNA binding polypeptide concentrations will be
effective, as in Example 14. For example, both ssDNA and ssDNA
binding protein may be present in concentrations ranging from 0.001
.mu.M to 100 mM; or from 0.1 mM to 1 .mu.M; or from 1 .mu.M to 100
.mu.M. Oligonucleotide length can be varied in accordance with
parameters presented in Example 12. There is no particular upper
limit on oligonucleotide length. In addition, two or more
oligonucleotides can be included which have complementary 5' ends,
thereby creating 3' overhangs which are effective substrates for
ssDNA binding polypeptides such as lambda Beta. In addition, RecT,
P22 Erf, Rad52, and other double strand break repair ssDNA binding
polypeptides may be substituted for lambda Beta. Culture and
electroporation conditions are readily variable without materially
reducing homologous recombination. Moreover, nucleic acid may be
introduced into the cell by any suitable macromolecular transfer
method.
[0274] Other types of stem cells can be used to correct the
specific gene defects associated with cells derived from such stem
cells. Such other stem cells include epithelial, liver, lung,
muscle, endothelial, mesenchymal, neural and bone stem cells.
[0275] Alternatively, certain disease states can be treated by
modifying the genome of cells in a way that does not correct a
genetic defect per se but provides for the supplementation of the
gene product of a defective gene. For example, endothelial cells
can be used as targets for human gene therapy to treat disorders
affecting factors normally present in the systemic circulation. In
model studies using both dogs and pigs endothelial cells have been
shown to form primary cultures, to be transformable with DNA in
culture, and to be capable of expressing a transgene upon
re-implantation in arterial grafts into the host organism (Wilson
et al., Science 244:1344, 1989; Nabel et al., Science 244:1342,
1989). Since endothelial cells form an integral part of the graft,
such transformed cells can be used to produce proteins to be
secreted into the circulatory system and thus serve as therapeutic
agents in the treatment of genetic disorders affecting circulating
factors. Examples of such diseases include insulin-deficient
diabetes, alpha-1-antitrypsin deficiency, and hemophilia.
Epithelial cells, myocytes and hepatocytes are also useful cell
types for therapeutic production of proteins.
[0276] The method is also useful for knockout or modification of
genes in embryonic stem (ES) cells. Such cells have been
manipulated to introduce transgenes. ES cells are obtained from
pre-implantation embryos cultured in vitro (Evans et al., Nature
292:154-156, 1981; Bradley et al., Nature 309:255-258, 1984;
Gossler et al., Proc. Natl. Acad. Sci. U.S.A. 83:9065-9069, 1986;
Robertson et al., Nature 322:445-448, 1986; U.S. Pat. No.
5,464,764). Oligonucleotides designed to target specific gene
segments in the ES cell are combined with lambda Beta protein or
other ssDNA binding polypeptide and introduced into ES cells by
electroporation or other transformation methods. The
oligonucleotides may be designed as a series of overlapping
segments with 3' overhangs. Such transformed ES cells can
thereafter be combined with blastocysts from a non-human animal.
The ES cells thereafter colonize the embryo and can contribute to
the germ line of the resulting chimeric animal (Jaenisch, Science
240:1468-1474, 1988).
[0277] For example, sequences encoding positive selection marker
neomycin resistance gene are synthesized as a series of overlapping
70-mer oligonucleotides, 20 base pairs of overlap and 3' overhangs.
The 3' terminal oligonucleotides are designed to insert into the
second exon of the mouse hox 1.1 gene as described in U.S. Pat. No.
5,464,764. Because the overlapping oligonucleotides combine to
encode a promoterless neomycin resistance gene, only those that
successfully incorporate into the targeted mouse hox 1.1 second
exon will express the neo gene product and have the neomycin
resistance phenotype. The targeting is designed to provide the
synthetic neomycin resistance gene with an operable promoter and
translation start derived from the mouse hox 1.1 gene. The
targeting DNA is also designed so that random incorporations
elsewhere in the ES cell genome are unlikely to be operably linked
to any promoter to allow transcription and translation.
[0278] The series of overlapping oligonucleotides with 3' overhangs
(about 200 nanograms each) are combined with 10 .mu.M lambda Beta
protein and introduced into ES cells by electroporation using the
Promega Biotech X-Cell 2000. Rapidly growing cells are trypsinized,
washed in DMEM, counted and resuspended in buffer containing 20 mM
HEPES (pH 7.0), 137 mM NaCl, 5 mM KCl, 0.7 mM Na.sub.2HPO.sub.4, 6
mM dextrose, and 0.1 mM .beta-mercaptoethanol. Just prior to
electroporation, the oligonucleotides and lambda Beta protein are
added to 10.sup.7 ES cells in each 1 ml-cuvette. Cells and DNA are
exposed to two sequential 625 V/cm pulses at room temperature,
allowed to remain in the buffer for 10 minutes, then plated in
non-selective media onto feeder cells.
[0279] Following two days of non-selective growth, the cells are
trypsinized and replated onto G418 (250 .mu.g/ml) media. The
positive-selection is applied for three days. Because of the high
efficiency of lambda Beta-mediated recombination, the need for
further selection (for example, negative selection by introducing a
thymidine kinase gene and selecting with ganciclovir) can be
obviated. Appropriately transformed, G418-resistant cells are grown
in non-selective media for 2-5 days prior to injection into
blastocysts (according to the method of Bradley in:
Teratocarcinomas and Embryonic Stem Cells, A Practical Approach,
edited by E. J. Robertson, IRL Press, Oxford (1987), p. 125).
[0280] Blastocysts containing the targeted ES cells are implanted
into pseudo-pregnant females and allowed to develop to term.
Chimeric offspring are identified by coat-color markers and those
males showing chimerism were selected for breeding offspring. Those
offspring which carry the mutant allele can be identified by coat
color, and the presence of the mutant allele reaffirmed by DNA
analysis by tail-blot, DNA analysis.
[0281] Thus, the method markedly simplifies the construction of
gene knockouts and gene modifications in ES cells. In addition to
its possible relevance to plant, animal and human gene therapy, the
method will simplify the construction of transgenic animals
harboring either gene knockouts or gene modifications.
[0282] As described for stem cells and in Example 14, a broad range
of ssDNA and ssDNA binding polypeptide concentrations will be
effective. For example, both ssDNA and ssDNA binding protein may be
present in amounts ranging from 0.001 .mu.M to 100 mM; or from 0.1
.mu.M to 1 .mu.M; or from 1 .mu.M to 100 .mu.M. Oligonucleotide
length can be varied in accordance with parameters presented in
Example 12. There is no particular upper limit on oligonucleotide
length. In addition, two or more oligonucleotides can be included
which have complementary 5' ends (for example with 10, 20, 30, 40
by complementary 5' ends), thereby creating 3' overhangs which are
effective substrates for ssDNA binding polypeptides such as lambda
Beta. In addition, RecT, P22 Erf, Rad52, and other double strand
break repair ssDNA binding polypeptides can be substituted for
lambda Beta, in the same ranges described for lambda Beta. Those
skilled in the art will recognize that culture and electroporation
conditions are readily variable without materially reducing
homologous recombination. Moreover, nucleic acid may be introduced
into the cell by any suitable macromolecular transfer method.
Example 16
[0283] Homologous Recombination in Plants
[0284] The methods disclosed herein are also applicable to the
manipulation of plant cells and ultimately the genome of the entire
plant. A wide variety of transgenic plants have been reported,
including herbaceous dicots, woody dicots and monocots. For a
summary, see Gasser et al., Science 244:1293-1299 (1989). A number
of different gene transfer techniques have been developed for
producing such transgenic plants and transformed plant cells. One
technique used Agrobacterium tumefaciens as a gene transfer system
(Rogers et al., Methods Enzymol. 118, 627-640, 1986). A closely
related transformation utilizes the bacterium Agrobacterium
rhizogenes. In each of these systems a Ti or Ri plant
transformation vector can be constructed containing border regions
which define the DNA sequence to be inserted into the plant genome.
These systems previously have been used to randomly integrate
exogenous DNA to plant genomes.
[0285] Preferably, DNA designed for homologous recombination with a
target DNA sequence in plants are combined with lambda Beta protein
or other ssDNA protein and directly transferred to plant
protoplasts by way of methods analogous to that previously used to
introduce transgenes into protoplasts. Concentration of the DNA and
ssDNA binding proteins are as described in Example 15 (see, e.g.
Paszkowski et al., EMBO J., 3:2717-2722, 1984; Hain et al., Mol.
Gen. Genet., 199, 161-168, 1985; Shillito et al. Bio./Technology
3:1099-1103, 1985; and Negrutiu et al., Plant Mol. Bio. 8:363-373,
1987). Alternatively, the PNS vector is contained within a liposome
which can be fused to a plant protoplast (see, e.g. Deshayes et
al., EMBO J. 4:2731-2738, 1985) or is directly inserted to plant
protoplast by way of intranuclear microinjection (see, e.g.
Crossway et al., Mol. Gen Genet. 202:179-185, 1986, and Reich et
al., Bio/Technology 4:1001-1004, 1986). Microinjection can be used
for transfecting protoplasts. The DNA and ssDNA binding proteins
can also be microinjected into meristematic inflorescences. De la
Pena et al., Nature 325:274-276, 1987. Finally, tissue explants can
be transfected by way of a high velocity microprojectile coated
with the DNA and ssDNA binding proteins analogous to the methods
used for insertion of transgenes (see, e.g. Vasil, Bio/Technology
6:397, 1988; Klein et al., Nature 327:70, 1987; Klein et al., Proc.
Natl. Acad. Sci. U.S.A. 85:8502, 1988; McCabe et al.,
Bio/Technology 6:923, 1988; and Klein et al., Genetic Engineering,
Vol 11, J. K. Setlow editor (Academic Press, N.Y., 1989)). Such
transformed explants can be used to regenerate for example various
serial crops. Vasil, Bio/Technology 6:397, 1988.
[0286] Once the DNA and ssDNA binding protein have been inserted
into the plant cell by any of the foregoing methods, homologous
recombination targets the oligonucleotide to the appropriate site
in the plant genome. As in previous examples, the oligonucleotide
may be a series of overlapping ssDNAs with 5' or 3' overhangs.
Depending upon the methodology used to transfect, selection is
performed on tissue cultures of the transformed protoplast or plant
cell. In some instances, cells amenable to tissue culture may be
excised from a transformed plant either from the F0 or a subsequent
generation.
[0287] The amino acid composition of various storage proteins in
wheat and corn, for example, which are known to be deficient in
lysine and tryptophan may also be modified. PNS vectors can be
readily designed to alter specific codons within such storage
proteins to encode lysine and/or tryptophan thereby increasing the
nutritional value of such crops. For example, the zein protein in
corn (Pederson et al., Cell 29:1015, 1982) can be modified to have
a higher content of lysine and tryptophan by the vectors and
methods disclosed herein.
Example 17
Materials and Methods Used in Examples 18-22
[0288] Bacterial strains. All of the strains used except DH10B were
maintained at 32.degree. C. because of the temperature inducible
prophage. DY303 was constructed by infecting DH10B cells (Gibco)
with a .lamda. phage carrying recA (.lamda.cI857 recA.sup.+) (a
gift from F. W. Stahl) and lysogens were selected. Strain EL11 was
constructed by replacing the tet gene of DY380 with a cassette
containing the cat and sacB genes by selecting CmR. EL11 cells are
Tet.sup.S, Cm.sup.R and sensitive to 2% sucrose. Strain EL250 was
constructed by replacing the cat-sacB cassette of EL11 cells with
araC and the arabinose promoter-driven flpe recombinase gene
(P.sub.BADflpe) selecting in the presence of sucrose. EL250 cells
are resistant to 2% sucrose. Strain EL350 was constructed in a
similar manner except for Cre instead of flpe.
[0289] Construction of plasmids. The IRES-eGFPcre-FRT-kan-FRT
targeting cassette was PCR amplified from pICGN21, which was
constructed by subcloning a 1.9 kbp HindIII/AccI-digested and
filled-in FRT-kan-FRT fragment from pFRTneo into the
NotI/BclI-digested and filled-in cloning site of pIRESeGC. The
FRTneo was constructed by amplifying the kan gene along with the
Beta lactamase promotor from pEGFP-C1 (Clontech) with primers
5'CTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCGTCAGGTGGC ACTTTCGGG (SEQ ID
NO: 13) and 5'CTCAGAAGAACTCGTCAAGAAGG (SEQ ID NO: 14). The
amplified fragment was then targeted between the frt sites in
pNeo.beta.-gal (Stratagene). The pIRESeGC was generated by
inserting the 2 kbp NheI/MluI-digested and filled-in eGFPcre
fragment from pEGC into the 3.5 kbp BamHI-digested and filled-in
cloning site of pNTRlacZPGKneoloxP (Arango et al., Cell 99: 409-19,
1999). The pEGC was generated by subcloning a 1.05 kbp EcoRI/KpnI
PCR fragment containing the Cre gene from pGKmncre into the
EcoRI/KpnI site of pEGFP-C1. This PCR fragment was generated by
amplifying the Cre gene from pGKmncre with primers
5'GTAGGTACCTCGAGAATCGCCATCTTCCAGCAGGC (SEQ ID NO: 15) and
5'TCGAATTTTCTGCATCCAATTTACTGACCGTACACC (SEQ ID NO: 16), which
contain EcoRI and KpnI cleavage sites, respectively, at their 5'
ends.
[0290] To construct the pTamp vector, the amp-targeted pBeloBAC11
was first generated by replacing the LoxP site in pBeloBAC11
(Shizuya et al., Proc. Natl. Acad. Sci. 89: 8794-7, 1992) with the
PCR amplified amp gene from pEGFP (Clontech). The primers used for
amplification are 5'
GCAAGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGTCTTA
GACGTCAGGTGGCAC (SEQ ID NO: 17) and 5'
CATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGAACCTCAC
GTTAAGGGATTTTGGTC (SEQ ID NO: 18), which are homologous to the amp
gene of pEGFP (in plain) and to sequences flanking the LoxP site in
pBeloBAC11 (in italic). A 2.4-kbp PCR fragment amplified from
amp-targeted pBeloBac11 with primers
5'GCAGGATCCAGTTTGCTCCTGGAGCGACA (SEQ ID NO: 19) and
5'TGCAGGTCGACTCTAGAGGATC (SEQ ID NO: 20) was then cloned into the
XhoI/XbaI and filled-in site of pCS (Stratagene) to create the
pTamp vector. The 2.4 kbp amp cassette containing an amp gene along
with 920 by of 5', and 370 by of 3', pBe10BAC11 vector sequence
flanking the LoxP site can be released by BamH1 digestion and used
directly to replace the LoxP site in any pBeloBAC11-derived BACs
with amp.
[0291] The pKO4 vector containing the cat-sacB targeting cassette
is a derivative of pKO3 (Link et al., J. Bacteriol. 179: 6228-37,
1997) in which 605 by had been deleted between cat and sacB.
[0292] The araC-P.sub.BADflpe targeting cassette was amplified from
pBADflpe, which was constructed by subcloning a 1.4 kb PstI/KpnI
fragment from pOGFlpe (Buchholz et al., Nat. Biotechnol. 16:
657-62, 1998) into pBAD/MycHis-A (Invitrogen). The
araC-P.sub.BADcre targeting cassette was amplified from pBADcre,
which was constructed by introducing a 1.2 kb HindIII/NcoI fragment
from pGKmncre into pBAD/His-C (Invitrogene).
[0293] Amplification primers for targeting or GAP repair cassette
DNAs. For all primers listed below, nucleotides in italics are
homologous to the targeted sequence, while those in plain text are
homologous to amplification cassettes. The Tet.sup.R cassette used
for targeting cro-bio in DY330 was amplified from Tn10 with
primers:
TABLE-US-00011 (SEQ ID NO: 21)
5'TGGCGGTGATAATGGTTGCATGTACTAAGGAGGTTGTATGCTCTTGGG ATTATCAGAGGG and
(SEQ ID NO: 22) 5'GGCGCTGCAAAAATTCTTGTCGAACAGGGTGTCTGGATCACTCGACAT
CTTGGTTACCG.
[0294] The cat-sacB cassette used for replacing the tet gene in
DY363 was amplified from pKO4 with primers:
TABLE-US-00012 (SEQ ID NO: 23)
5'TGGCGGTGATAATGGTTGCATGTACTAAGGAGGTTGTATGCTGTGACG GAAGATCACTTCG
and (SEQ ID NO: 24)
5'GGCGCTGCAAAAATTCTTTGTCGAACAGGGTGTCTGGATCCTGAGGTT
CTTATGGCTCTTG.
[0295] The araC-P.sub.BADflpe and araC-P.sub.BADcre cassettes used
for replacing the cat-sacB in EL11 were amplified from pBADflpe and
pBADcre with primers:
TABLE-US-00013 (SEQ ID NO: 25)
5'TGGCGGTGATAATGGTTGCATGTACTAAGGAGGTTGTATGAAGCGGCA TGCATAATGTGC and
(SEQ ID NO: 26) 5'GGCGCTGCAAAAATTCTTTGTCGAACAGGGTGTCTGGATCCTGTGTCC
TACTCAGGAGAGCGTTC.
[0296] The IRES-eGFPcre-FRT-kan-FRT cassette used for targeting the
Eno2 locus was amplified from pIGCN21 with primers:
TABLE-US-00014 (SEQ ID NO: 27)
5'CGCTTCGCGGGACATAATTTCCGAAATCCCAGTGTGCTGTGAGCCAAG CTATCGAATTCCGCC
and (SEQ ID NO: 28)
5'GAGGCTCCAGGAGAATGAGATGTTCCCGCGTTCAGGCAAGCGCTATTC
CAGAAGTAGTGAGGA.
[0297] The oligonucleotides used to target the flag cassette into
the 5' end of the Sox4 gene were annealed and polymerase-extended
using primers:
TABLE-US-00015 (SEQ ID NO: 29)
5'GCGAGCGTGTGAGCGCGCGTGGGCGCCCGGCAAGCCGGGGCCATGGAT
TACAAGGATGACGACGATAAGGTACAACAGA and (SEQ ID NO: 30)
5'GGCCAGCAGAGCCTCAGTGTTCTCCGCGTTGTTGGTCTGTTGTACCTT
ATCGTCGTCATCCTTGTAATCCATGGCCCCC.
[0298] The linear pBR322 derivative used to subclone the 25-kbp
fragment from the modified Eno2 locus was amplified with
primers:
TABLE-US-00016 (SEQ ID NO: 31)
5'CTCTCCATGCCTGTCTGGGTGAGGGTGGCCCAGGGGCGATGGCTATGA
GAGAGGTCGACTTCTTAGACGTCAGGTGGCAC (Eno2-C-L1) and (SEQ ID NO: 32)
GCAATGCAGAGAAGCCTTGTACTGGGATGACAGAGACGGAGGGGAAGAGG
AGGCGGCCGCGATACGCGAGCGAACGTGA (Eno2-C-R1/2).
[0299] The amplification primers for the other experiments were:
48-kbp modified fragment,
5'GACTTCTATGACCTGTACGGAGGGGAGAAGTTTGCGACGTGACAGAGCTGGTC
GTCGACTTCTTAGACGTCAGGTGGCAC (SEQ ID NO: 33) (Eno2-C-L2/3/4) and
Eno2-C-R1/2; 60-kbp modified fragment, Eno2-C-L2/3/4 and
5'GCCCCATACACGTAAATGTACATAGAATCACACAGCATCACTTCTATGGATGCG
GCGGCCGCGATACGCGAGCGAACGTGA (SEQ ID NO: 34) (Eno2-C-R3); 80-kbp
modified fragment, Eno2-C-L2/3/4 and
5'CATCCAGTAGAACTTGGGAGTGAAGCTAGAGCCAAGGCCATCTAAGTGACAGG
CGGCCGCGATACGCGAGCGAACGTGA (SEQ ID NO: 35) (Eno2-C-R4). These
primers contained 5' regions homologous to the target sequence and
3' regions homologous to pBR322. PCR products were purified using a
Qiaex II gel extraction kit (Qiagen) and digested with DpnI to
remove contaminated template.
[0300] Preparation of electrocompetent cells and generation of
recombinants. For BAC modification, overnight cultures containing
the BAC were grown from single colonies and were diluted 50-fold in
LB medium and grown to an OD.sub.600=0.5-0.7. 10-ml cultures were
then induced for Beta, Exo, and Gam expression by shifting the
cells to 42.degree. C. for 15 minutes followed by chilling on ice
for 20 minutes. Cells then were centrifuged for 5 minutes at 5,500
g at 4.degree. C. and washed with 1.5 ml of ice-cold sterile water
three times. Cells were then resuspended in 50 .mu.l of ice-cold
sterile water and electroporated. For BAC transformation, the
induction step was omitted.
[0301] Cell transformation was performed by electroporation of
100-300 ng linear DNA into 50 .mu.l of ice-cold competent cells in
cuvettes (0.1 cm) using a Bio-Rad gene pulser set at 1.75 kV, 25
.mu.F with pulse controller set at 200 ohms 1 ml of LB medium was
added after electroporation. Cells were incubated at 32.degree. C.
for 1.5 hours with shaking and spread on appropriate selective or
nonselective agar media.
[0302] Production of transgenic mice. Modified BAC and the p25-kbp
subclone DNAs were purified using cesium chloride gradients as
described (Antoch et al., 1997). The 25-kbp subclone DNA was
linearized by NotI digestion before microinjection. BAC DNA (1
.mu.g/ml) and 25-kbp subclone DNA (2 .mu.g/ml) were microinjected
into the pronucleus of (C3H/HeN-Mtv.sup.- X C57BL/6Ncr) F.sub.2
zygotes. Transgenic founders were subsequently identified by
Southern analysis using a Cre probe or by PCR using primers
5'CTGCTGGAAGATGGCGATTCTCG (SEQ ID NO: 36) and
5'AACAGCAGGAGCGGTGAGTC (SEQ ID NO: 37) that flank the 3'
insertional junction.
[0303] Histochemical analysis of .beta.-galactosidase expression.
Mice at 4 to 5 weeks of age were sacrificed in CO.sub.2 and
perfused with 4% paraformaldehyde in PBS (pH 7.3). The brains,
spinal cords and eyes were removed and postfixed for 3 hours.
Vibratome sections (20 .mu.m) of brains were mounted on slides and
used directly for X-gal staining or for immunocytochemistry. For
spinal cords and eyes, cryostat sections (20 .mu.m) were used that
were made by cryoprotecting tissues in 30% sucrose in PBS overnight
and embedding the tissues in freezing compound (OCT, Sakura).
Before X-gal staining, samples on slides were postfixed with 0.25%
glutaraldehyde in PBS and briefly washed with rinse solution (0.1
phosphate buffer pH7.3, 0.1% deoxycholic acid, 0.2% NP40 and 2 mM
MgCl.sub.2). X-gal staining was performed by incubating samples in
staining buffer (2.5 mg/ml X-gal, 5 mM potassium ferricyanide and 5
mM potassium ferrocyanide in staining buffer) for 2 hours at
37.degree. C. followed by counterstaining with 0.25% eosin
(Fisher).
[0304] Immunocytochemistry Immunostaining was carried out using the
ABC Vectastain kit (Vector Labs) on 20 .mu.m vibratome sections.
Sections were blocked with PBS (pH7.3 containing 0.2% Triton X-100,
1.5% bovine serum albumin and 5% normal goat serum) at room
temperature for 2 hours and incubated with primary Eno2 antibody, a
poly clonal rabbit anti-Eno2 antiserum (Chemicon) at 1:100 dilution
in PBS solution. After incubation with a secondary biotinylated
antibody and the ABC reagent, peroxidase was reacted with 0.05%
diaminobenzidine tetrahydrochloride (DAB) and 0.003% hydrogen
peroxide.
Example 18
Creation of Improved Bacterial Host Strains for Lambda-Mediated
Recombination in BACs
Transfer of Lambda Recombination Genes to DH10B Cells.
[0305] To facilitate the use of lambda-mediated recombination with
BACs, an improved phage-mediated recombination system has been
created for efficient recombination using BACs. The DH10B strain
unlike most other strains of E. coli is efficiently transformed
with BAC DNA and contains many of the BAC genomic libraries; it was
judged to be a good host strain for subsequent modification.
[0306] Because DH10B is recA defective, standard genetic crosses
cannot be used to place the defective lambda prophage used for
lambda-mediated recombination into the DH10B strain of E. coli. To
circumvent this problem, DH10B was first converted to recA+, then
the lambda recombination genes were crossed in and the strain was
again made recA- but now carrying the lambda genes.
[0307] To make DH10B recA+, a lambda transducing phage carrying the
recA+ gene was used to lysogenize DH10B creating the derivative
DY303. In strain DY330 used for .lamda. mediated recombination, the
tet gene conferring tetracycline resistance was inserted by
homologous recombination where the cro-bioA deletion exists
creating strain DY363. A P1 lysate made on DY363 was used to infect
DY303 and by standard bacterial genetics the tet gene in the
cro-bioA deletion was crossed into DY303. This deletes a large
segment of the .lamda. DNA of the lysogen including the recA+ gene.
This new derivative of DH10B and DY303 is named DY380, is RecA- and
carries the tet selectable marker substituted for the cro-bioA
segment. It was observed that DY380 cells were transformed with BAC
DNA at efficiencies of 10.sup.-6 to 10.sup.-4.
Creation of DY380 Derivatives Containing Arabinose-Inducible Cre or
flpe Genes
[0308] BAC targeting often makes use of a selectable marker to
introduce the targeting cassette into the targeted locus. The
selectable marker can, however, interfere with the subsequent
function of the targeted locus. To circumvent this problem, the
inventors noted that a selectable marker flanked with either frt or
LoxP sites can be removed by either Flp or Cre recombinases,
respectively. Thus, the inventors have created two new strains,
EL250 and EL350, by ultimately replacing the tet gene in DY380 with
araC and placing the flpe and Cre genes under an
arabinose-inducible promoter. The genotypes of DY380, EL250, and
EL350 are shown schematically in FIG. 6. Although the
arabinose-inducible promoter p.sub.BAD was used in this example,
essentially any inducible promoter may be used to activate flpe and
Cre expression.
[0309] In DY380's prophage, tet is located between cI857 and bioA.
In EL250's prophage, flpe replaces tet (flpe is a genetically
engineered flp that has a higher recombination efficiency than the
original flp gene; Buchholz et al., Nature Biotechnology
16:657-662, 1998). Thus, as illustrated in FIG. 6, both EL250 and
EL350 have heat-inducible homologous recombination (the .lamda. red
genes) and arabinose-inducible site-specific recombination (flpe or
Cre) functions. This dual regulation allows both selective
targeting by recombination as well as the subsequent removal of the
selection marker from the targeted locus by site-specific
recombination.
Improved Approach for Introducing Defective Lambda Prophages into
Bacteria: Mini Lambda Circles
[0310] A method has been developed for introducing the
.lamda.-mediated recombination system directly into nearly any E.
coli strain including recA defective DH10B derivatives. These
derivatives can carry BACs, PACs, or other vectors.
[0311] The DY330 strain carries deletion of prophage genes from cro
through bioA. This deleted segment of .lamda. and bioA were
replaced to create a derivative that contains a fully normal
.lamda.cI857 single-copy lysogen. Lysogens of this type can be
induced at 42.degree. C. to express .lamda. functions including the
Red recombination functions. Because the .lamda. carries all of the
replication and lytic genes, induction for longer than 6 minutes
causes death of cells carrying the lysogen. However, by inducing
for less than 6 minutes, for example 4 minutes, recombination
functions are only partially activated, but cells survive when
returned to grow at 32.degree. C. Using, for example, a 4-minute
time of induction, .lamda.-mediated recombinants can be generated
between linear, electroporated DNA and the chromosome including the
DNA of the prophage. Thus, phage lambda itself can be used to
lysogenize and generate recombinants in BAC strains. However,
recombination efficiency would be low because of the short
induction time.
[0312] PCR cassettes containing 5 genes for different drug
resistance markers were amplified [cat, kan, amp, tet, spec
(strep)] with flanking homologies so as to replace prophage genes
from cro through ea59 with the respective drug markers selecting
with that drug for resistant recombinants at 32.degree. C. A
contiguous prophage DNA segment from base position 38,044 of the
.lamda. map in cro to base position 25,737 of the .lamda. map in
sib are replaced by the drug cassettes (see Court and Oppenheim).
This deletion eliminates all replication and lysis genes of the
prophage creating a defective prophage similar to that of the
original DY330. The difference is that this prophage has both
attachment sites attL and attR at the termini of the prophage
whereas DY330 has attR through bioA deleted as part of the cro-bioA
deletion.
[0313] This set of strains (with respective drug cassettes) can be
induced for longer times than the complete lambda without killing
the cells thereby providing maximal homologous recombination
activity just as with DY330. The p.sub.L operon of these prophages
include the int and xis genes. Induction activates their expression
and because both attL and attR are present causes site specific
excision of the prophage as a DNA circle carrying its associated
drug marker. Cells undergoing induction for 15 minutes may lose the
original prophage. This happens in about 50% of the cells. The
other 50% still have the prophage. The 50% with the prophage are
likely to occur by reintegration of the circular DNA at the vacated
attB site through Intmediated site specific recombination.
[0314] The defective prophage DNA can be isolated and purified from
these lysogens, if after a 15 minute induction, cells are lysed and
DNA is isolated by plasmid purification protocols, i.e. by Qiagen
columns The circular phage DNA with its drug markers can be
purified. This DNA cannot replicate upon retransfection into E.
coli strains but it can express its pL operon and Int function to
allow integration of the circular DNA by site specific
recombination between attP in the circular DNA and attB in the
bacterial chromosome. Only Int and the host IHF functions are
required for site-specific recombination. Such integrated DNAs are
stable, are immune and can be selected by the drug marker each
carries.
[0315] Because RecA is not required for site specific Int-mediated
recombination, DH10B derivatives can be used for transformation and
for integration of the circular defective phage DNA selecting for
its appropriate drug marker.
[0316] The defective mini-prophage can also be induced as part of a
di-lysogen in which a complete .lamda. cI857 phage is also present.
The phage lysate created by this 90 minutes induction at 42 degrees
in L-Broth generates normal lambda phage particles as well as
particles that contain the defective mini-prophage DNA (in .lamda.
terminology docL particles). Infection of these lysates into cells
(e.g. DH10B) allows DNA injection of the mini-prophage DNA, site
specific recombination, and selection for the drug marker carried
on that DNA.
Example 19
An Improved Strategy and Improved Reagents for BAC Engineering
[0317] To test the prophage system of Example 17 in BAC
engineering, the efficiency of BAC recombination in EL250 cells was
investigated. In the experiments described in this example, a
selectable cassette was targeted to a mouse neuron-specific locus
in a 250 kb BAC. The BAC was then further modified to enhance its
usefulness in subsequent mouse genetic studies. These experiments
validated an improved strategy and provided improved reagents for
BAC engineering using the lambda recombination system.
[0318] The Eno2 gene is located in the middle of 284H12, a fully
sequenced BAC (obtained from Research Genetics; Ansari-Lari et al.,
Genome Research 8:29-40, 1998). The Eno2 gene was targeted because
it is neural-specific and expressed in most mature neurons
(Marangos and Schmechel, Annual Review of Neuroscience 10:269-295,
1987). By knocking out eno2 and replacing it with a Cre-containing
cassette, a BAC transgenic line that expresses Cre in all mature
neurons was created (described in Example 21). This BAC transgenic
line is useful for subsequent conditional knockout studies. The
inventors used a BAC approach in part because BACs are large enough
to contain all the important regulatory sequences required for
proper regulation of gene expression.
[0319] The following describes the construction of the BAC
transgenic line with neuronal-specific Cre expression.
Generation of the Targeting Cassette and BAC-Containing EL250
Cells
[0320] The IRES-eGFPcre-FRT-kan-FRT targeting cassette was PCR
amplified from pICGN21, which was constructed by subcloning a 1.9
kbp HindIII/AccI-digested and filled-in FRT-kan-FRT fragment from
pFRTneo into the NotI/BclI-digested and filled-in cloning site of
pIRESeGC. The IRES-eGFPcre-FRT-kan-FRT cassette was amplified using
chimeric 63 nt primers. The 3' 21 nt of each primer was homologous
to the targeting cassette used for amplification while the 5' 42 nt
was homologous to the last exon of Eno2 where the cassette was to
be targeted by recombination. The primers were designed to
precisely target the cassette downstream of the Eno2 stop codon and
upstream of its polyA site.
[0321] The Eno2-containing 284H12 BAC was electroporated into EL250
cells and six chloramphenicol resistant (Cm.sup.R) colonies
selected. Digestion of BAC DNA from six Cm.sup.R colonies with
EcoRI or HindIII showed that one had an abnormal digestion pattern.
However, in other BAC electroporation experiments involving the
analysis of more than 76 additional colonies, no abnormal BACs were
identified. These results indicate that BAC rearrangements during
electroporation are rare. Subsequent experiments were carried out
with Cm.sup.R-resistant EL250 colonies harboring BACs having proper
EcoRI and/or HindIII digestion patterns.
Generating and Isolating a BAC with a Disrupted eno2 Locus
[0322] Next, the 284H12 BAC was modified to disrupt the eno2 locus
with the IRES-eGFPcre-FRT-kan-FRT targeting cassette. The methods
used in these experiments were similar to those described
extensively herein (and in Yu et al., Proc. Natl. Acad. Sci. U.S.A.
97:5978-5983, 2000). The approach is illustrated schematically in
FIG. 7.
[0323] EL250 cells carrying the 284H12 BAC were shifted to
42.degree. C. for 15 minutes to induce lambda Exo, Beta, and Gam
expression. The cells were then electroporated with 300 ng of the
amplified IRES-eGFPcre-FRT-kan-FRT cassette, and
kanamycin-resistant (Km.sup.R) colonies were selected. A
kanamycin-resistant phenotype indicated that the targeting cassette
was successfully integrated into the 284H12 BAC (illustrated as
"Targeting," FIG. 7, middle). Approximately 5200 Km.sup.R colonies
were obtained from 10.sup.8 electroporated cells for a targeting
efficiency of about 10.sup.-5. No colonies were obtained from
control cells that were not heat-induced. Thus, lambda recombinase
expression was required for efficient recombination.
[0324] Twenty-four kanamycin resistant colonies were analyzed with
whole-cell PCR using primers that flanked the targeted locus. The
PCR results indicated that all were correctly targeted. Sequencing
of the targeted region from six colonies, however, showed that
three carried point mutations. To determine whether these point
mutations were introduced during PCR amplification or during
homologous recombination, the targeting was repeated. This time,
however, the PCR-amplified IRES-eGFPcre-FRT-kan-FRT cassette was
subcloned into the SmaI site of pBluescript by blunt-end ligation
before targeting, and plasmids carrying wild type amplified
cassettes identified by DNA sequencing. These cassettes were then
released from the plasmid by BamHI digestion and used for
targeting. Using this two-step method, all twelve targeted BACs
that were subsequently sequenced contained wild type
IRES-eGFPcre-FRT-kan-FRT cassettes. These results indicate that the
point mutations were introduced by the primers used or during PCR
amplification of the targeting cassette rather than during
targeting.
Removing the Kanamycin-Resistance Marker
[0325] Next, the kan selectable marker was removed from the BAC to
prevent it from possibly interfering with Cre expression. This
process was initiated by arabinose treatment, which induces EL250
cells to express the Flpe recombinase. The process is illustrated
in FIG. 7, bottom line ("Flip-out of kan").
[0326] Overnight cultures from single Km.sup.R colonies were
diluted 50-fold in LB medium and grown till OD.sub.600=0.5. Flpe
expression from the EL250 cells was then induced by incubating the
cultures with 0.1% L-arabinose for 1 hour. The bacterial cells were
subsequently diluted 10-fold in LB medium, grown for an additional
hour, and spread on chloramphenicol plates (12.5 ug/ml). The next
day, 100 Cm.sup.R colonies were picked and replated on kan plates
(25 ug/ml) to test for loss of kanamycin resistance.
Chloramphenicol resistance indicates that the cell retained the
BAC, whereas kanamycin sensitivity indicates that kan has been
successfully removed from the BAC. All colonies were Km.sup.s and
contained a single frt site at the targeted locus.
[0327] Without being bound by theory, it is likely that the
surprisingly high recombination efficiency reflects the tight
control of Flpe expression afforded by the single copy P.sub.BAD
promoter and flpe gene, and the fact that the frt sites are located
in cis rather than in trans to each other.
Removing an Undesirable LoxP Site in the BAC Vector Backbone
[0328] A LoxP site contained in the BAC vector backbone
(pBeloBAC11; Shizuya et al., Proc. Natl. Acad. Sci. U.S.A.
89:8794-8797, 1992) was removed by a final round of gene
targeting.
[0329] To facilitate the removal of this undesirable LoxP site, a
new plasmid, pTamp, was constructed that contains an amp gene
flanked by 920 by of pBeloBAC11 sequence located 5' of the LoxP
site and 370 by of pBeloBAC11 sequence located 3' of the LoxP site.
This amp insert can be released from pTamp by BamHI digestion and
used to replace the LoxP site in the BAC transgene by gene
targeting. This targeting reaction is very efficient due to the
large amount of homology between the amp cassette and the
pBeloBAC11 vector (56,200 colonies per 10.sup.8 electroporated
cells).
[0330] Upon removal of the undesirable LoxP site, the modified
284H12 BAC was used in the transgenic mouse studies described in
Example 21.
Example 20
Subcloning by GAP Repair
[0331] This .lamda.-mediated recombination system can also be used
to subclone fragments from BACs without the use of restriction
enzymes or DNA ligases. This form of subcloning relies on gap
repair to recombine the free ends of a linear plasmid vector with
homologous sequences carried on the BAC (FIG. 8). The method is
readily adaptable to other forms of intramolecular and
extrachromosomal DNA, such as plasmids, yeast artificial
chromosomes, P1 artificial chromosomes, and cosmids. This novel
method combines lambda mediated recombination with gap repair to
enable recombination of very large DNA segments onto an
extrachromosomal vector.
[0332] The linear plasmid vector with an amp selectable marker and
an origin of replication carries the recombinogenic ends (FIG. 8B).
The vector is generated by PCR amplification using two chimeric
primers. The 5' 45-52 nt of each primer is homologous to the two
ends of the BAC sequence to be subcloned while the 3' 20 nt is
homologous to plasmid DNA. Recombination generates a circular
plasmid in which the DNA insert was retrieved from the BAC DNA via
gap repair. Circular plasmids are selected by their Amp.sup.R.
[0333] To determine the maximum sized fragment that can be
subcloned from BACs using this method, several different pairs of
primers were generated in which the homology segments were located
25 kb, 48 kb, 60 kb, or 80 kb apart in the Eno2 BAC DNA (FIG. 8A).
Rare cutter NocI and SalI restriction sites were also incorporated
into these primers so that the subcloned fragments could be
released from the recombinant clones intact. Using pBluescript as
the cloning vector, it was possible to subclone the 25 kb fragment.
However, attempts to subclone larger fragments were unsuccessful.
As a possible explanation for this result, it was hypothesized that
subclones containing larger fragments on a high copy vector such as
pBluescript were toxic to the cell.
[0334] To determine if the hypothesis was correct, a lower copy
number vector (pBR322, with its copy number control element intact)
was used as the cloning vector. Fragments as large as 80 kb could
be subcloned with a pBR322 vector. Not all subclones obtained by
gap repair had the correct inserts (as determined by restriction
enzyme pattern analysis). Some subclones lacked inserts while
others contained inserts with aberrant restriction patterns. In
order to confirm that the correct insert has been subcloned, when
using subcloning by gap repair, a method of screening subclones can
be used to assure that the selected subcloned contains the desired
insert. Such methods include restriction mapping, sequencing, PCR
analysis, Southern analysis, etc., and other methods well known to
those of skill in the art.
[0335] The ability to subclone large fragments of genomic DNA by
gap repair should facilitate many studies in genome research that
were difficult or impossible to perform previously. For example,
Gap repair for cloning on to vectors can be used with many
different vectors used for protein expression in bacteria, plants
and animal cells, mutagenesis, cloning, transcription, etc.
Targeting vectors or transgenic constructs can be subcloned with
ease, and virtually any region of the engineered BAC can now be
included in the desired subclone.
[0336] Lambda mediated recombination combined with gap repair makes
it possible to subclone fragments from complex mixtures without
first purifying the DNA to be subcloned. This greatly facilitates
the subcloning process and allows for high throughput subcloning of
tens of thousands of genes or DNA molecules into many different
vector backbones. This will greatly facilitate studies designed to
determine the function of genes uncovered in large scale sequencing
projects. For example, cDNA clones for genes of unknown function
can be subcloned into many different expression vectors and the
function of these genes studies in cell-based assays in vitro or in
the whole animal. This type of subcloning does not rely on PCR
amplification, which can introduce unwanted mutations into the
subcloned sequences.
[0337] Subcloning by gap repair also facilitates the identification
of locus control regions or other regulatory elements that may be
located at some distance from the gene. Many such potential
elements are presently being identified by techniques such as
comparative genome sequencing. Examples include pathogenicity
islands, replicative origins and segregation elements. The ability
to modify precisely these regulatory sequences on BACs, combined
with the ability to include or exclude them during the subcloning
process, will make it possible to dissect the function of these
sequences in the whole animal or in vitro at a level not previously
possible.
Example 21
[0338] Production of Transgenic Mice Using BACs
[0339] Examples 18-20 describe the construction of a modified BAC
believed to contain all of the regulatory sequences needed for
neural-specific Cre expression in transgenic mice. To investigate
this hypothesis, the modified BAC described in Example 18 was
injected into (C3H/HeN-Mtv.sup.-X C57BL/6Ncr) F.sub.2 zygotes. A
BAC transgenic line carrying approximately two copies of the
transgene was then established.
[0340] In addition to the BAC transgenic line, two transgenic lines
carrying 25-kbp subclones of the BAC were also established. The
25-kbp subclones contains the entire modified Eno2 coding region as
well as 10 kbp of 5' and 5 kbp of 3' flanking sequences,
respectively. One transgenic line, 25kbp-1 carries approximately
four copies of the transgene, while the second, 25kbp-2 carries
approximately five copies of the transgene. Thus, Cre expression in
the BAC transgenic line could be compared to Cre expression in the
transgenic lines carrying the subclone.
[0341] The transgenic mice were crossed to ROSA26 reporter mice,
which contain a lacZ reporter that can be activated by Cre
recombinase (Soriano, Nature Genetics 221:70-71, 1999). Double
heterozygotes were subsequently analyzed by X-gal staining at 4
weeks of age.
[0342] Several different tissues were examined for X-gal expression
including the brain, spinal cord, eye, lung, heart, intestine,
muscle, liver, spleen, and kidney. Blue stained cells were found
only in neural tissue in the three transgenic lines, indicating
that both the BAC and the 25-kbp subclone contain the regulatory
elements needed for neural-specific expression. The pattern of Cre
activity was, however, different in the three lines. Vibratome
sections of the brain from the BAC transgenic mice showed
blue-stained cells throughout the gray matter but not in the white
matter, indicative of Cre activity in most neurons but not in glial
cells. In contrast, X-gal staining in the 25 kbp-1 and 25 kbp-2
transgenic mice was present in only a subset of neurons and
expression was variable between the two different lines.
[0343] Higher power magnification of the cerebellum of the BAC
transgenic mice showed that Cre was expressed in virtually all
neuronal cells. This included Purkinje cells in the Purkinje cell
layer, granule and Golgi cells in the granular layer, basket cells
and stellate cells in the molecular layer and neurons of the deep
cerebellar nuclei. In contrast, in the 25 kbp-1 line, Cre was
expressed in only a subset of Golgi cells in addition to a few
cells in the granule and Purkinje cell layers. Glial cells of white
matter also expressed Cre indicative of leaky expression. In the 25
kbp-2 line, Cre expression was limited to the gray matter and
included a variety of neuronal cell types, including most basket
cells, stellate cells, Purkinje cells and neurons of the deep
cerebellar nuclei. In contrast, few granule cells and Golgi cells
in the granule layer expressed Cre.
[0344] Higher power magnification of the hippocampus and cortex
showed similar results. In the hippocampus of BAC transgenic mice,
virtually all neurons in the cornu Ammonis (CA) region and the
dentate gyms (DG) expressed Cre. The same was true in the cortex,
where all six layers of the cortex that contained neurons (layers
II-VI) expressed Cre. In contrast, the hippocampus of 25 kbp-1
transgenic mice showed reduced Cre expression in the DG (FIG. 4E)
and layers II and III of cortex. The 25 kbp-2 transgenic mice
showed even lower levels of Cre expression in the DG. The CA1 and
CA2 regions of the CA also failed to express Cre. Cre expression
was also greatly reduced in the cortex, with layers II and III
showing most the reduction.
[0345] Cre activity in the spinal cord, dorsal root ganglion (DRG)
and retina of the transgenic mice was also examined in order to
determine whether Cre was expressed in mature neurons within the
peripheral nervous system. Similar to what was observed for the
central nervous system, Cre was expressed in most mature peripheral
neurons in the BAC transgenic mice while fewer peripheral neurons
expressed Cre in the two 25 kbp transgenic lines.
[0346] To determine whether Cre was expressed in all Eno2
protein-positive neurons, a section from the brain of a BAC
transgenic animal was immunostained with an anti-Eno2 antibody
followed by X-gal staining for Cre activity. Virtually all
Eno2-positive neurons were active for Cre. Thus, Cre expression in
BAC transgenic animals correlated tightly with native mouse Eno2
promoter-enhancer activity.
[0347] The present application, particularly Examples 17-20,
describes a highly efficient recombination system for manipulating
BAC DNA in E. coli. The recombination system uses a defective
.lamda. prophage to supply functions that protect and recombine the
electroporated linear DNA targeting cassette with the BAC sequence.
Because the recombination functions are expressed from a defective
prophage rather that a plasmid, the recombination functions are not
lost during cell growth as often happens with plasmid-based
systems. Another advantage of this prophage system is that the
.lamda. gam and red recombination genes are under the control of
the temperature sensitive .lamda. repressor that provides a much
tighter control of gam and red expression than can be obtained on
plasmids. This tight regulation, combined with the strong .lamda.
pL promoter, which drives gam and red expression to very high
levels, makes it possible to achieve recombination frequencies that
are surprisingly efficient (at least 50-100 fold higher than those
obtained with plasmid-based systems; Narayanan et al., Gene Therapy
6:446: 442-447,1999; Muyers et al., Nucleic Acids Research
27:1555-1557, 1999). The tight control prevents expression of any
recombination functions except for the 15 minute temperature
induction.
[0348] The ability to precisely manipulate large fragments of
genomic DNA, independent of the location of appropriate restriction
enzyme sites, has many applications for functional genomics, both
in the mouse and in other organisms. As shown herein, Cre can be
introduced into the coding regions of genes carried on BACs
facilitating the generation of Cre-expressing transgenic lines for
use in conditional knockout studies or for use in conditional gene
expression studies. Genes can also be epitope tagged and
microinjected into the germline of mice carrying a mutation in the
gene. If the epitope tagged transgene rescues the mutant phenotype,
the epitope tagged protein is functional and the epitope tag can
serve as a marker for expression of the gene. Likewise, a gene
carried on a BAC can be replaced with another gene and the function
of the "knock-in" mutation assayed in transgenic mice.
[0349] This recombination system also facilitates the generation of
complicated conditional targeting vectors. While the generation of
such vectors often used to take several months it can now be done
in a only few weeks time. The ability to reversibly express Cre or
Flpe recombinases in E. coli speeds this process even further.
Moreover, as demonstrated in Example 18, a selectable marker
flanked with LoxP or frt sites can be now be introduced into an
intron of a gene and then removed by transient Cre or Flpe
expression leaving behind a solo LoxP or frt site in the intron
(see also Examples 24-27).
Example 22
BAC Recombination without Drug Selection
[0350] The high efficiency of recombination described in Example 18
and elsewhere in these examples suggested that targeting could be
done without drug selection. Direct targeting without drug
selection would offer a number of significant advantages. In
particular, it would facilitate genomic experiments in which the
presence of a selectable marker, or even a frt or LoxP, scar might
be undesirable.
[0351] To demonstrate that targeting can be achieved without drug
selection, a 24 by FLAG tag was targeted to the 5' end of the
SRY-box containing gene 4 (Sox4) gene carried on a 125 kb BAC. For
these experiments, a 114 by targeting cassette was generated in
which two 45-bp arms homologous to the Sox4 gene flanked the 24-bp
FLAG sequence. This DNA fragment was created by synthesizing two
79-bp oligonucleotides that overlapped at their 3' ends by 44 bp.
These overlaps were annealed and filled in by Taq polymerase.
[0352] Expression of lambda recombinase genes from the defective
prophage was heat-induced in DY380 cells carrying the Sox4 BAC.
Then, the FLAG-tagged cassette was introduced into the cells by
electroporation. The cells were then spread on LB plates to a
density of .about.2,000 cells per plate. Colonies containing the
FLAG tag were subsequently identified by colony hybridization using
a 30-bp FLAG-specific oligonucleotide probe (24 by FLAG tag and 3
by on each side that was homologous to the Sox4 targeted site).
[0353] Among 3,800 colonies screened from uninduced cells, no
FLAG-positive colonies were identified. In contrast, seven
FLAG-positive colonies were identified in 4,210 colonies obtained
from induced cells for an overall targeting frequency of
1.7.times.10.sup.-3. PCR amplification and direct sequencing showed
that each of the seven FLAG-positive colonies was correctly
targeted.
[0354] As unequivocally demonstrated in this example, the
surprisingly high recombination efficiency offered by this
recombination system makes it possible to manipulate BAC or other
DNA without drug selection. Point mutations, deletions, or
insertions can now be engineered into any gene on a BAC in the
absence of a confounding linked drug selection marker or a LoxP or
frt site. In cases where the gene is mutated in human disease, the
exact disease-causing mutations can be engineered on the BAC and
the effect of these mutations analyzed in transgenic mice.
Example 23
Materials and Methods for Examples 24-27
[0355] Bacterial Strains: The E. coli strains used in Examples
24-27 are listed in Table 9, below.
TABLE-US-00017 TABLE 9 Recombineering reagents Genotype Strains
DH10B F.sup.- mcrA .DELTA.(mrr-hsdRMS-mcrBC) O80dlacZ.DELTA.M15
.DELTA.lacX74 deoR recA1 endA1 araD139 .DELTA.(ara, leu)7649 galU
galK rspL nupG DY380 DH10B [.lamda. cI857 (cro-bioA < > tet]
EL250 DH10B [[.lamda. cI857 (cro-bioA < > araC-P.sub.BADflpe]
EL350 DH10B [[.lamda. cI857 (cro-bioA < > araC-P.sub.BADcre]
Selection Cassettes PL451 FRT-PGK-EM7-NeobpA-FRT-loxP PL452
LoxP-PGK-EM7-NeobpA-loxP Other Plasmids pSK+ pBluescript PL253
Modified MC1TK
[0356] EL350 cells were derived by transferring the defective
.lamda. prophage present in DY330 cells (Yu et al., Proc Natl Acad
Sci U.S.A. 97:5978-5983, 2000) into DH10B cells, to create DY380
cells (Lee et al., Genomics 73: 56-65, 2001). An
arabinose-inducible Cre gene (P.sub.BAD-cre) was then introduced
into the defective .lamda. prophage present in DY380 cells to
create EL350 cells (Lee et al., supra, 2001). DH10B cells have been
used to construct most BAC libraries and are highly permissive for
BAC transformation, while DY330 cells are relatively resistant to
BAC transformation. BACs were identified from the CITB BAC library
constructed from CJ7 (129/Sv) ES cells (Research Genetics). DH10B
electrocompetent cells were purchased from Invitrogen.
[0357] Construction of Retrieval and Targeting Vectors: PCR primers
were designed using MacVector. Primer sequences used for
constructing the Evi9 conditional knockout vector are listed
below:
TABLE-US-00018 Primer A: NotIEvi9-ex4-Ret-5'-1, (SEQ ID NO: 38)
5'-ATAAGCGGCCGCTCTAATACAGAC-TGGCACCTG-3'; Primer B:
H3Evi9-ex4-ret-5'-2, (SEQ ID NO: 39)
5'-GTCAAGCTTTAAAGA-GATCCCTGCTATAAA-3'; Primer Y:
H3Evi9-ex4-Ret-3'-1, (SEQ ID NO: 40)
5'-GTCAAGCTTCCTGTTTCCAGCGTAG-GTGAA-3'; Primer Z:
SpeIEvi9-ex4-ret-3'-2, (SEQ ID NO: 41)
5'-TCTACTAGTCTCACC-ACCTGTACAGTAAGT-3'; Primer C:
NotIEvi9-ex4-5'L-1, (SEQ ID NO: 42)
5'ATAAGCGGCC-GCAACAATTAGTGTGTTTCCAGTT-3'; Primer D:
EcoRI-BglII-Evi9-ex4-5'L-2, (SEQ ID NO: 44)
5'-GTCGAATTCAGATCTAAATGG-GGTACTGAGACAAG-3'; Primer E:
BamHIEvi9-ex4-5'R-1, (SEQ ID NO: 45)
5'-ATAGGATC-CAACCAATGAGACAGTGGCACA-3'; Primer F:
SalIEvi9-ex4-5'R-2, (SEQ ID NO: 46)
5'-GTC-GTCGCACTTATTCATGTTCCAAC-AA-CCA-3; Primer G:
NotIEvi9-ex4-3'L-1 (SEQ ID NO: 47)
5'-ATAAGCGGCCGCCTTAACT-TAGACAGCATGTAT-3', Primer H:
EcoRI-Evi9-exon4-3'L-2, (SEQ ID NO: 48)
5'-GTCGAAT-TCGTCTGCAGAGGGTTAGTCAA-3'; Primer I:
BamHI-Evi9-ex4-3'R-1, (SEQ ID NO: 49)
5'-ATAGGATCCAGAGCAGATAGCAGTGAAAA-3'; Primer J: SalIEvi9-ex4-3'R-2,
(SEQ ID NO: 50) 5' GTCGTCGCATATTACCTCACCCAATGC-TA-G-3'.
These primers amplify the following size fragments: 500 by with
primers A, B; 295 by with primers Y, Z; 222 by with primers C, D;
276 by with primers E, F; 277 by with primers G, H; and 227 by with
primers I, J.
[0358] PCR amplification: (ROCHE Expand High-Fidelity Taq kit) was
performed by setting up the first reaction mixture containing 1
.mu.l dNTP (10 mM), 1 .mu.l DNA (10 ng BAC DNA), 1 .mu.l (10 .mu.M)
of each primer, and 21 .mu.l water. Then, a second reaction mixture
was set up that contained 5 .mu.l of 10.times. PCR buffer (#2),
0.75 .mu.l high-fidelity Taq (5 u/.mu.l), and 20 .mu.l water. The
two reaction mixtures were then combined. PCR was performed using a
PE-9700 PCR machine with the following settings: 94.degree. C. for
2 minutes, then 10 cycles of 94.degree. C. for 15 seconds,
55.degree. C. for 30 seconds, 70.degree. C. for 1 minutes. This was
followed by 15 cycles of 94.degree. C. for 15 seconds, 55.degree.
C. for 30 seconds, 70.degree. C. for 1 minutes, with an additional
5 sec extension time each cycle. 5 .mu.l of the 50 .mu.l PCR
reaction mixture was loaded onto a gel to check the PCR reaction.
The remaining 45 .mu.l was mixed with 225 .mu.l PB from Qiagen and
loaded onto a Qiagen mini-preparation spin column After a 30-second
spin, the column was washed once with 750 .mu.l PE buffer. The PCR
fragments were eluted using 30 .mu.l of EB from Qiagen. 3 .mu.l of
restriction buffer (10.times.) and 1 .mu.l of restriction enzyme
was added and the mixture incubated at 37.degree. C. for 1 hour.
The digested PCR fragments were purified again with the columns and
were ready for ligation.
[0359] The retrieval vector was generated by mixing 3 .mu.l of PCR
product 1 (left arm, NotI/HindIII), 3 .mu.l PCR product 2 (right
arm, HindIII/SpeI), 2 .mu.l MCITK (PL253) (NotI/SpeI), 1 .mu.l
10.times. ligation buffer and 1 .mu.l T4 DNA ligase.
[0360] The Neo-targeting vector was generated by mixing 3 .mu.l of
PCR product 1 (left arm, NotI/EcoRI), 3 .mu.l PCR product 2 (right
arm, BamHI/SalI), 2 .mu.l foxed Neo cassette (PL452 or PL451)
(EcoRI/BamHI), 1 .mu.l pSK+ (NotI/SalI), 1.2 .mu.l 10.times.
ligation buffer and 1 .mu.l T4 DNA ligase. The ligation mixtures
were incubated at 16.degree. C. for 2 hours and 0.5 .mu.l was
transformed into electro-competent DH10B cells (Invitrogen).
[0361] Transformation of BAC or Plasmid DNA into Recombinogenic
Strains: E. coli cells with BACs were grown overnight in 5 ml LB
broth with chloramphenicol. The LB broth used in contained only 5 g
NaCl per liter. Cells were collected in three eppendorf tubes (2
ml) and were resuspended in 250 .mu.l P1 from Qiagen. 250 .mu.l P2
and 350 .mu.l P3 were then added to each tube and the tubes spun
for 4 minutes. The supernatant fluid from these tubes was
transferred to new 1.5 ml eppendorf tubes, which were spun for
another 4 minutes to clear the supernatant fluids. Finally, 750
.mu.l isopropanol was added to precipitate the DNA (room
temperature for 10 minutes) and the DNA collected by spinning the
tubes for 10 minutes at the maximal speed. The DNA pellet was
washed once with 1.0 ml 70% ethanol, dried and resuspended in 50
.mu.l TE (total from 3 tubes). 1 .mu.l DNA was used for
electroporation and 10 .mu.l for digestion (20 ng RNase was added
to clear the RNA). Only freshly prepared BAC DNA was used for
transformation.
[0362] EL350 or DY380 cells were grown in 5 ml LB broth in a Falcon
14 ml polypropylene round-bottom tube at 32.degree. C. overnight
with shaking. The next day the cells (OD600 =1.2) were collected by
centrifuging at 4000 rpm (0.degree. C.) for 5 minutes in Oak Ridge
tubes. Cell pellets were resuspended in 888 .mu.l ice-cold water.
Cells were transferred to a 1.5 ml eppendorf tube (on ice) and
centrifuged using a benchtop centrifuge for 15-20 seconds at room
temperature. The tubes were placed on ice and the supernatant
fluids aspirated. The process was repeated two more times. Finally,
the cell pellet was resuspended in 50 .mu.l ice-cold water and
transferred to a pre-cooled electroporation cuvette (0.1 cm gap). 1
.mu.l BAC DNA (100 ng) or plasmid DNA (1.0 ng) was added and mixed.
Electroporation was performed using a BIO-RAD electroporator under
the following condition: 1.75 kV, 25 uF with pulse controller set
at 200 ohms The time constant was usually set at 4.0. 1.0 ml LB was
added to each cuvette, which was incubated at 32.degree. C. for one
hour. Cells were spread on plates with the appropriate
antibiotics.
[0363] Retrieving: EL350 cells containing BAC-A12 were inoculated
into 5 ml of LB broth in a Falcon 14 ml polypropylene round-bottom
tube and grown at 32.degree. C. overnight with shaking. The next
day, 1.0 ml of the overnight culture (OD600 =1.2) was transferred
to 20 ml LB (OD600=0.05-0.1) and incubated for 2 hours with shaking
(180 rpm, OD600=0.5). 10 ml of the cells were then transferred to a
new flask and shaken in a 42.degree. C. water bath for 15 minutes.
The cells were put into wet ice and the flask shaken to make sure
that the temperature of the flask dropped as fast as possible. The
flask was left in wet ice for another 5 minutes. The cells were
transferred to 25 ml glass centrifuge tubes and spun at 4000 rpm
(0.degree. C.) for 5 minutes (with rubber adaptors). Cells were
resuspended in 888 .mu.l ice-cold water and transferred to a 1.5 ml
eppendorf tube (on ice) and washed three times with ice-cold water
as described above. Finally, the cell pellet was resuspended in 50
.mu.l ice-cold water. 1-2 .mu.l of the purified PCR or plasmid
fragment was added and electroporated as described above.
[0364] Targeting: Frozen EL350 electro-competent cells were used
for targeting in co-electroporation. The frozen cells were produced
by adding a 10 ml overnight culture of EL350 (grown in two 14 ml
tubes, OD600=1.2) to 500 ml LB broth in a 2-liter flask. The
culture was then placed in a waterbath shaker at 32.degree. C.
until OD600=0.5 (.about.2.0 hour). The flask was then transferred
to a 42.degree. C. waterbath shaker and incubated for 15 minutes.
The flask was immediately put into an ice slurry and shaken for 5
minutes by hand to make sure the temperature dropped as fast as
possible. The flask was put on ice for an additional 10 minutes.
Cells were collected at 4000 rpm at 0.degree. C. for 5 minutes and
washed three times with ice-cold water and once with cold 15%
glycerol in water. Finally, cells were resuspended in 4 ml ice-cold
15% glycerol in water. 50 n1 of the cells were aliquoted to
pre-cooled eppendorf tubes (80 tubes total) and stored at
-80.degree. C.
[0365] For electroporation, the frozen cells were thawed at room
temperature and quickly put on ice. Co-transformation of the
purified targeting cassette (100 ng in 1 WEB) and the template
plasmid DNA (10 ng in 1 .mu.l EB) was performed using with a
BIO-RAD electroporator as described previously.
[0366] Excision of the Neo Cassette: Frozen EL350 cells induced for
Cre expression by prior growth in arabinose-containing medium were
used for excision of the floxed Neo cassette. A 10 ml overnight
culture of EL350 cells was added to 500 ml of LB broth in a 2-liter
flask. The culture was placed in a water bath shaker at 32.degree.
C. until OD600=0.4 (2.0 hours, 180 rpm). 5 ml of 10% L(+)arabinose
(Sigma A-3256) in H.sub.2O was added to the culture to a final
concentration of 0.1% and shaken at 32.degree. C. for another hour.
Cells were collected, cell pellets washed, and frozen as described
above. 1 ng plasmid DNA was electroporated into 50 .mu.l frozen
competent cells. 1.0 ml LB broth was added to the electroporation
cuvette. 10-100 .mu.l of the cells were subsequently plated on an
ampicillin plate and 100 .mu.l on a kanamycin plate and incubated
at 32.degree. C. overnight. The ampicillin plate ideally has 10-100
colonies, and no colonies on the kanamycin plate. The following
antibiotic concentrations were used in the experiments: kanamycin
and chloramphenicol, 12.5 .mu.g/ml for BACs, 25 .mu.g/ml for
multicopy plasmids; Ampicillin, 25 .mu.g/ml for BACs, 100 .mu.g/ml
for pBluescript.
[0367] Gene Targeting in Mouse ES Cells: 20 ug NotI-linearized Evi9
cko-targeting vector (PL460) DNA was electroporated into
10.times.10.sup.6 CJ7 ES cells that were growing on
mitomycin-C-inactivated STO cells. Transfectants were selected in
M15 medium (15% fetal bovine serum in DMEM with 2 mM L-glutamine)
with G418 (180 .mu.g/ml) and ganciclovir (2 .mu.M). Targeted clones
were identified on Southern blots with the 5' and 3' probes.
Example 24
Subcloning DNA by GAP Repair
[0368] Conditional knockout (cko) targeting vectors can be made by
using recombineering to introduce LoxP sites, and positive and
negative selection markers, into BAC DNA by homologous
recombination. The region of the BAC containing the LoxP sites, and
positive and negative selection markers, is then excised from the
BAC and transformed into ES cells. The introduction of LoxP sites
into BACs is complicated, however, because most BAC vector
backbones carry Lox sites. These sites must be removed before any
further Lox sites are introduced into the BAC DNA. Additionally,
BAC integrity needs to be examined after each modification, and
this is difficult when the BAC inserts are large. By subcloning a
10-15 kb fragment of BAC DNA into a high copy plasmid vector such
as pBluescript (pSK+) before the Lox sites are introduced, these
problems can be eliminated.
[0369] Homologous recombination via a process known as gap repair
provides a convenient method for subcloning DNA from BACs into
pBluescript. The gap repair method used previously for subcloning
BAC DNA is shown in FIG. 14. Here, the linearized pBluescript
vector used for gap repair is generated by PCR amplification using
two chimeric primers (Zhang et al., Nat Genet 30: 31-39, 2000; Lee
et al., Genomics 73:56-65 2001). The 5' 50 nucleotides of each
primer are homologous to the two ends of the BAC sequence to be
subcloned, while the 3' 20 nucleotides of each primer are
homologous to pBluescript DNA. The linearized, PCR-amplified
pBluescript vector is electroporated into E. coli cells induced for
exo, bet, and gam expression, and which carry the BAC. Homologous
recombination between the BAC DNA and the linearized pBluescript
vector generates a circular plasmid that can replicate in E. coli.
Ampicillin resistance (Amp.sup.r) can be used to select these
circular products (FIG. 14).
[0370] In order to make subcloning by GAP repair possible, a BAC
must be first transferred from its strain of origin (DH10B) into an
E. coli strain that contains exo, bet, and gam. In the experiments
described herein, BACs are transferred into EL350 E. coli cells
(Examples 20-21). EL350 cells were made by constructing a defective
lambda prophage in DH10B cells, to create DY380 cells (Example 18)
since DH10B is one of the few E. coli strains known that can be
efficiently transformed with BAC DNA. A Cre gene under the control
of the arabinose inducible promoter, P.sub.BAD, was then introduced
into the defective prophage carried in DY380 cells, to produce
EL350 cells (Lee et al., Genomics 73:56-65, 2001). In EL350 cells,
the homologous recombination functions encoded by the red genes can
be controlled by temperature, while the Cre gene can be controlled
by arabinose. As disclosed herein, it is much easier to transform
electro-competent EL350 or DY380 cells produced from overnight
cultures, than from exponentially growing cells. When BAC DNA is
electroporated into stationary electro-competent cells and the
BAC-containing cells selected using the chloramphenicol resistance
(Cam.sup.r) gene that is carried in the BAC vector backbone, 100 to
1000 Cam.sup.r colonies are routinely obtained from 50 ng of BAC
DNA, and virtually all of the colonies contain unrearranged BACs. A
complete list of the reagents used in these studies can be found in
Table 9.
[0371] An alternative method was used to subclone an 11.0 kb
fragment of Evi9 spanning exon4, an alternative method for
generating gap-repaired plasmids was designed that makes use of
longer homology arms (200-500 bp; FIG. 17). As shown below, these
larger homology arms significantly increase the frequency of
subcloning by gap repair, and because of this, unwanted
recombination products were rare. Another advantage of this
alternative method is that the gap repair plasmid is not PCR
amplified, which eliminates potential PCR artifacts introduced into
the plasmid by PCR. In this alternative method, two sets of PCR
primers were produced and used to amplify two 200-500 by regions of
the BAC (primers A and B and Y and Z; FIG. 15). Ultimately these
two regions will mark the ends of the fragment to be subcloned by
gap repair. The PCR products were purified using spin columns and
digested with either Nod and HindIII or HindIII and SpeI.
Restriction sites for these enzymes were included in the
amplification primers in order to permit directional cloning of the
PCR products into pBluescript. The digested-fragments were again
purified and ligated to NocI- and SpeI-cut pBluescript DNA that
also has a TK gene (MCI TK) gene for use in negative selection in
ES cells. The retrieval vector was subsequently linearized with
HindIII to create a DNA double strand break for gap repair.
[0372] When 1 .mu.l (50-100 ng) of the linear gap repair plasmid
was electroporated into electro-competent EL350 cells, which
contained Evi9 BAC A12, and which had been induced for exo, bet,
and gam expression by prior growth at 42.degree. C. for 15 minutes
(FIG. 14), it was found that several thousand Amp.sup.r colonies
were routinely generated in a single electroporation experiment.
About 5% of these Amp.sup.r colonies were background colonies
derived either from self-ligation of the linearized gap repair
plasmid or from uncut DNA. The other 95% of the colonies contained
gap-repaired plasmids with the expected genomic inserts (FIG. 16B,
lane 1).
[0373] During the gap repair process, RecBCD is inhibited by Gam so
that the linear gap repair plasmid is stable. However, in the
absence of RecBCD, ColE1-derivative plasmids such as pBluescript
can replicate by rolling circle replication. This type of
replication will eventually convert the plasmid monomers into
plasmid multimers (Feiss et al. Gene 17:123-130, 1982). As a
result, huge plasmid complexes are produced in RecBCD-deficient
cells. To select against these plasmid multimers following gap
repair, a small amount of the gap-repaired plasmid DNA (ing) was
re-transformed into wild type DH10B cells, and Amp.sup.r colonies
selected. Empirically, it was determined that re-transformation
selects for plasmids monomers and eliminates plasmid multimers.
Example 25
Targeting the First LoxP Site into the Subcloned Plasmid DNA
[0374] The next step in creating a cko-targeting vector is the
introduction of a LoxP site into the subcloned DNA: in this case,
5' of Evi9 exon 4 (FIG. 15A). This is accomplished by introducing a
floxed neomycin resistance (Neo) cassette (PL452) via homologous
recombination into the subcloned plasmid DNA, and by removing the
Neo gene via Cre recombinase. The floxed Neo gene in PL452 is
expressed from a hybrid PGK-EM7 promoter. PGK permits efficient Neo
expression in mammalian cells, while EM7 allows Neo to be expressed
in bacterial cells. Subsequent removal of the floxed Neo gene via
Cre recombinase leaves behind a single LoxP site at the targeted
locus. In order to introduce a floxed Neo gene at the correct
location, it is first flanked with 100-300 by arms that are
homologous to the targeting site. These homology arms, as described
above, are generated by PCR amplification of the BAC DNA. In this
case, the PCR primer pairs were engineered to contain Nod and EcoRI
(primers C and D) or BamHI and SalI (primers E and F) restriction
sites (FIG. 14). These restriction sites allow for the directional
cloning of the homology arms, and the floxed Neo gene, into
pBluescript. Primer D also contains a BglII site internal to the
EcoRI site. The BglII site marks the presence of the LoxP site at
the targeted locus following recombination in ES cells (see below).
An EcoRV site was also incorporated into primer G for 3' side
diagnosis of the targeting in ES cells (see below). Following PCR
amplification, the products were purified, restriction digested and
ligated to the floxed Neo cassette excised from PL452 with EcoRI
and BamHI, and to pBluescript that was linearized by NotI and SalI
digestion (FIG. 14). Four to six colonies selected by their
kanamycin resistance, conferred by Neo, were picked and checked by
restriction enzyme digestion to ensure that they were properly
constructed. Usually, all of the Kan.sup.r colonies were properly
constructed. This plasmid was referred to as the mini-targeting
vector. The floxed Neo gene, together with the homology arms, was
excised from pBluescript by Nod and SaIl digestion, and
gel-purified. The purified Neo cassette (150 ng) was
co-electroporated along with the gap-repaired subcloned DNA (PL441,
10 ng) into EL350 cells, which had been induced for Red
recombination functions by prior growth at 42.degree. C. for 15
minutes, and frozen at -80.degree. C. Transformants were selected
on kanamycin plates.
[0375] In one experiment, 84 Kan.sup.r colonies were obtained
following electroporation of induced EL350 cells, while only 6
colonies were obtained from uninduced cells. All the six colonies
were identical to the original mini-targeting vector, suggesting
that they represented uncut plasmid. Plasmids from six of the
Kan.sup.r colonies from induced EL350 cells were examined by
restriction enzyme digestion to make sure they were the correct
recombinants. All 6 colonies gave the expected restriction patterns
(FIG. 16B, lane 2).
[0376] Not all plasmids in a Kan.sup.r cell will carry the Neo
cassette. This is especially true for high copy plasmids such as
pBluescript since one recombinant plasmid molecule will render the
cell Kan.sup.r. The cells will therefore carry mixtures of targeted
and non-targeted plasmids following recombination. This problem can
be reduced if only a small amount of the gap-repaired subcloned
plasmid DNA (1 ng) is used for co-electroporation. Alternatively,
the mixed plasmids can be retransformed into DH10B cells and grown
on kanamycin plates. Since most transformed cells will only receive
one plasmid, growth of the transformed cells on kanamycin plates
will select against cells that receive non-targeted plasmids, and
the surviving colonies will carry pure populations of targeted
plasmids.
[0377] Excision of the Neo cassette from the subcloned DNA was
accomplished by electroporating the targeted plasmid DNA into EL350
cells, which had been induced for Cre expression by prior growth in
arabinose-containing media for one hour. The electroporated cells
were plated on either ampicillin or kanamycin plates. Cre-mediated
recombination is highly efficient; therefore, the kanamycin plates
usually do not have any colonies. Colonies from the ampicillin
plates were checked for their kanamycin sensitivity and restriction
digestion patterns to make sure that the floxed Neo cassette was
properly excised. All 12 Amp.sup.r colonies picked for analysis in
this experiment were kanamycin sensitive, and contained a single
LoxP site at the targeted locus (FIG. 16B, lane 3).
Example 26
Targeting a Second LoxP Site Downstream of Evi9 Exon 4
[0378] The final step in this example of the construction of the
cko-targeting vector is the introduction of a second LoxP into the
subcloned DNA; in this case, downstream of Evi9 exon 4 (FIG. 16A).
One way to accomplish this task is to again introduce a floxed Neo
gene into the subcloned DNA, and then remove the floxed Neo gene
via Cre recombinase, leaving behind a LoxP site at the second
targeted locus. This is, however, complicated by the fact that the
Neo gene serves as the selectable marker for gene targeting in ES
cells; therefore the Neo gene can only be removed after Neo
positive ES cells are selected and homologous recombinants
identified. Transient expression of Cre recombinase in ES cells can
generate three different excision products: two recombination
products are generated by recombination between the LoxP site
located upstream of Evi9 exon 4 and the two LoxP sites located
downstream of Evi9 exon 4, which flank the Neo gene. The third, and
desired recombination product, results from recombination between
the two-LoxP sites located on either side of the Neo gene. Often,
it seems that most recombination products are the undesired ones,
and in some cases, it can be difficult to obtain ES cells that
contain the desired product. Another problem stems from the fact
that the Neo gene in a previously constructed cassette
(PGK-Tn5-Kan-bpA) is optimized for expression in E. coli.
Generally, 90% less ES colonies are obtained when this cassette is
used than when a conventional PGKNeobpA is used.
[0379] To overcome these problems, a new selection cassette (PL451)
was constructed. PL451 was constructed by introducing a frt site
upstream of Neo, and frt and LoxP sites downstream of Neo, in
PGKNeobpA, a selection cassette that is commonly used for gene
targeting in ES cells (FIG. 16A). Similar to PL452, a bacterial EM7
promoter was introduced in between the PGK promoter and the coding
sequence of Neo. This selection cassette works efficiently in both
E. coli and mouse ES cells. frt is the DNA recognition site for Flp
recombinase. DNA located between two frt sites in mouse ES cells
can be excised by transient expression of a genetically enhanced
Flp recombinase (Flpe) (Buchholz et al., Nat Biotechnol 16:657-662
1998), that works well in ES cells. In this case, single frt and
single LoxP sites, were left behind at the targeted locus (FIG.
16A). Only one Flpe recombination product is possible, which
ensures that all excision products are the correct ones.
Alternatively, the PL451 selection cassette can be removed after
the conditional allele is introduced into the mouse germ line by
breeding the mice to one of the mouse strains that expresses Flpe
in the mouse germ line (Rodriguez et al., 2000). Subsequent
expression of Cre recombinase will excise the entire DNA between
the LoxP sites located on either side of Evi9 exon 4, and create an
Evi9 null allele. Cre can be expressed in the mouse germ line to
create a germ line null allele, or in somatic cells.
[0380] The PL451 selection cassette was introduced into the
subcloned DNA in the same manner used to introduce the floxed Neo
gene upstream of Evi9 exon 4. Evi9 exon 4, including both targeted
regions, was sequenced to make sure that no undesired mutations
were introduced during the recombination process. To functionally
test the LoxP and FRT sites in the targeting vector, the
cko-targeting vector plasmid DNA was transformed into
arabinose-induced EL350 and EL250 cells (EL250 cells have a Flpe
gene under the control of the arabinose inducible promoter,
P.sub.BAD (Lee et al., 2001)), respectively. Cells were plated on
ampicillin plates to select for the plasmid. Plasmid DNA was
prepared and digested to confirm the expected recombination
patterns (FIG. 16B, lanes 5 and 6).
Example 27
Gene Targeting in ES Cells
[0381] The cko-targeting vector was subsequently linearized with
Nod, electroporated into CJ7 ES cells, and the transformants
selected for their G418 and ganciclovir (Ganc) resistance.
Homologous recombination can occur either upstream or downstream of
the LoxP site located 5' of Evi9 exon 4. Since a BglII site was
introduced along with the upstream LoxP site, homologous
recombinants carrying this LoxP site (the cko allele) will generate
a 18.1 kb (wild type) and a 5.5 kb (mutant) BglII fragment using a
5' probe (FIG. 17A). Since an EcoRV site was introduced along with
the selection cassette to the region downstream of exon 4, targeted
clones will also have a 6.3 kb EcoRV fragment detected by the 3'
probe (FIG. 17A). In one electroporation experiment, 300 G418.sup.r
Gartc.sup.r colonies were obtained following electroporation.
Eighty colonies were picked for Southern analysis. Twenty-four out
of the 80 colonies (30%) had the Evi9 cko allele (FIG. 17B).
[0382] Thus, a rapid and efficient method for generating
cko-targeting vectors is disclosed herein. This method relies on E.
coli recombineering rather than restriction enzymes and DNA ligases
for vector construction (FIG. 18). This method makes use of high
copy plasmids rather than BAC DNA to generate the targeting vector,
200-500 by of homology for subcloning (gap repair), and 100-300 by
of homology for targeting, rather than the 45-50 by of homology
used in previous experiments (e.g. see Example 5). By using high
copy plasmid DNA for vector construction, the problem caused by Lox
sites present in the BAC vector backbone is eliminated, and by
using longer homology arms, as many as 10,000 colonies can be
obtained from a single subcloning experiment with only 50-100 ng of
retrieving plasmid DNA. In addition, more than 95% of the colonies
are correctly constructed. This is in contrast to previous
subcloning methods using shorter regions of homology. Moreover,
using these longer homology arms, targeting frequencies as high as
1.times.10.sup.-2 can be obtained with as little as 100 ng of
targeting DNA (i.e., targeting a floxed Neo cassette to a BAC).
[0383] In order to use high copy plasmids such as pBluescript for
vector construction, modifications were made in the way the .lamda.
Red system was used. For example, co-electroporation was used to
target the floxed Neo cassette to the plasmid, instead of
introducing the Neo cassette into cells that already carried the
plasmid. Induction of the .lamda. Red genes into cells that carry
multiple plasmids can cause the formation of plasmid complexes due
to rolling-circle replication (Feiss et al., Gene 17:123-130,
1992). Co-transformation of the Neo cassette and the plasmid
minimizes this problem, but still provides a high enough frequency
of homologous recombination to generate the targeted plasmid.
Cre-expressing EL350 cells were also used to excise the floxed Neo
cassette from the targeted plasmid. When multiple plasmid molecules
containing LoxP sites are present in a cell expressing Cre,
intermolecular recombination between the LoxP sites can occur,
resulting in plasmid loss. Electroporation of a small amount of
plasmid DNA containing the floxed Neo cassette into Cre-expressing
EL350 cells avoids this problem, yet still allows for the efficient
excision of the Neo cassette. Two new selection cassettes
(loxP-PGK-EM7-NeobpA-loxP and FRT-PGK-EM7-NeobpA-FRT-loxP) were
also constructed that worked well in both E. coli and mouse ES
cells. The second selection cassette contains two frt sites and one
LoxP site that flank the selection cassette. This makes it possible
to remove this selection cassette following homologous
recombination in ES with Flpe recombinase, leaving behind frt-LoxP
sites at the targeted locus.
[0384] Additionally, 200-500 by homology arms that contain SINE,
LINE or short DNA repeats such as CA repeats have been used for
retrieving and targeting. Efficient recombination was still
achieved in all cases. In some circumstances, longer homology arms
can help in avoiding problems created by sequencing errors in the
public databases, or strain polymorphisms. This can be of use when
modifying human DNA where polymorphisms are common. With its high
efficiency and reliability, more than ten cko-targeting vectors
have been constructed. Four of the cko-targeting vectors have been
introduced into ES cells for homologous recombination. All four
targeting constructs gave rise to highly efficient gene targeting
frequencies in mouse ES cells: the frequency of cko alleles ranged
from 20 to 40% of the G418.sup.r, Gartc.sup.r colonies.
[0385] The most time-consuming step in constructing the
cko-targeting vector using this method is in the production of the
retrieval vector and the two mini-targeting vectors. However, since
all of the homology arms used in the construction of these vectors
are PCR-amplified from BAC DNA, only single PCR products are
usually obtained, and the PCR products can thus be easily purified
using spin columns All six PCR reactions needed to construct a cko
vector, including digestion of the PCR products and ligation and
transformation, can be done in one day. Typically, it takes less
than two weeks to construct a cko-targeting vector using this
method, and multiple cko vectors can be generated simultaneously.
An alternative way to generate longer homology arms for homologous
recombination is by using two-step fusion PCR originally designed
for enhanced homologous recombination in yeast (Wach, Yeast
12:259-265, 1996). With two-step fusion PCR, the two PCR products
are amplified that serve as homology regions. Since about 26 base
pairs of selection marker sequences are included in two of the four
primers used to amplify the homology regions, one strand of each of
the two PCR products can serve as the primer for amplifying the
selection marker (Wach, Yeast 12:259-265, 1996).
[0386] By using BACs rather than phage libraries for vector
construction, one can precisely choose a genomic region to retrieve
for further manipulation. Moreover, BACs, and DNA subcloned from
BACs into high copy plasmids, can be rapidly modified using the
methods described here to create knock-in mutations and transgene
constructs, as well as expedite the analysis of regulatory elements
and functional domains in or near genes via deletion analysis.
[0387] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, suitable methods and materials are described below. All
publications, patent applications, patents, and other references
mentioned herein are incorporated by reference in their entirety.
In case of conflict, the present specification, including
definitions, will control. In addition, the materials, methods, and
examples are illustrative only and not intended to be limiting.
Sequence CWU 1
1
50120DNAArtificial sequenceprimer 1tgtgacggaa gatcacttcg
20220DNAArtificial sequenceprimer 2accagcaata gacataagcg
20320DNAArtificial sequenceprimer 3ctcttgggtt atcaagaggg
20420DNAArtificial sequenceprimer 4actcgacatc ttggttaccg
20521DNAArtificial sequenceprimer 5cattcaaata tgtatccgct c
21620DNAArtificial sequenceprimer 6agagttggta gctcttgatc
20720DNAArtificial sequenceprimer 7tatggacagc aagcgaaccg
20821DNAArtificial sequenceprimer 8tcagaagaac tcgtcaagaa g
21950DNAArtificial sequenceprimer 9gtttgcgcgc agtcagcgat atccattttc
gcgaatccgg agtgtaagaa 501050DNAArtificial sequenceprimer
10ttcatattgt tcagcgacag cttgctgtac ggcaggcacc agctcttccg
501170DNAArtificial sequenceprimer 11aagtcgcggt cggaaccgta
ttgcagcagc tttatcatct gccgctggac ggcgcacaaa 60tcgcgcttaa
701260DNAArtificial sequenceprimer 12aacagacacc atggtgcacc
tgactcctga ggagaagtct gccgttactg ccctgtgggg 601356DNAArtificial
sequenceprimer 13ctgcaaggcg attaagttgg gtaacgccag ggttttcgtc
aggtggcact ttcggg 561423DNAArtificial sequenceprimer 14ctcagaagaa
ctcgtcaaga agg 231535DNAArtificial sequenceprimer 15gtaggtacct
cgagaatcgc catcttccag caggc 351636DNAArtificial sequenceprimer
16tcgaattttc tgcatccaat ttactgaccg tacacc 361767DNAArtificial
sequenceprimer 17gcaagtgtgt cgctgtcgac gagctcgcga gctcggacat
gaggttgtct tagacgtcag 60gtggcac 671869DNAArtificial sequenceprimer
18catagttaag ccagccccga cacccgccaa cacccgctga cgcgaacctc acgttaaggg
60attttggtc 691929DNAArtificial sequenceprimer 19gcaggatcca
gtttgctcct ggagcgaca 292022DNAArtificial sequenceprimer
20tgcaggtcga ctctagagga tc 222160DNAArtificial sequenceprimer
21tggcggtgat aatggttgca tgtactaagg aggttgtatg ctcttgggtt atcaagaggg
602260DNAArtificial sequenceprimer 22ggcgctgcaa aaattctttg
tcgaacaggg tgtctggatc actcgacatc ttggttaccg 602361DNAArtificial
sequenceprimer 23tggcggtgat aatggttgca tgtactaagg aggttgtatg
ctgtgacgga agatcacttc 60g 612461DNAArtificial sequenceprimer
24ggcgctgcaa aaattctttg tcgaacaggg tgtctggatc ctgaggttct tatggctctt
60g 612560DNAArtificial sequenceprimer 25tggcggtgat aatggttgca
tgtactaagg aggttgtatg aagcggcatg cataatgtgc 602665DNAArtificial
sequenceprimer 26ggcgctgcaa aaattctttg tcgaacaggg tgtctggatc
ctgtgtccta ctcaggagag 60cgttc 652763DNAArtificial sequenceprimer
27cgcttcgcgg gacataattt ccgaaatccc agtgtgctgt gagccaagct atcgaattcc
60gcc 632863DNAArtificial sequenceprimer 28gaggctccag gagaatgaga
tgttcccgcg ttcaggcaag cgctattcca gaagtagtga 60gga
632979DNAArtificial sequenceprimer 29gcgagcgtgt gagcgcgcgt
gggcgcccgg caagccgggg ccatggatta caaggatgac 60gacgataagg tacaacaga
793079DNAArtificial sequenceprimer 30ggccagcaga gcctcagtgt
tctccgcgtt gttggtctgt tgtaccttat cgtcgtcatc 60cttgtaatcc atggccccc
793180DNAArtificial sequenceprimer 31ctctccatgc ctgtctgggt
gagggtggcc caggggcgat ggctatgaga gaggtcgact 60tcttagacgt caggtggcac
803279DNAArtificial sequenceprimer 32gcaatgcaga gaagccttgt
actgggatga cagagacgga ggggaagagg aggcggccgc 60gatacgcgag cgaacgtga
793380DNAArtificial sequenceprimer 33gacttctatg acctgtacgg
aggggagaag tttgcgacgt gacagagctg gtcgtcgact 60tcttagacgt caggtggcac
803481DNAArtificial sequenceprimer 34gccccataca cgtaaatgta
catagaatca cacagcatca cttctatgga tgcggcggcc 60gcgatacgcg agcgaacgtg
a 813579DNAArtificial sequenceprimer 35catccagtag aacttgggag
tgaagctaga gccaaggcca tctaagtgac aggcggccgc 60gatacgcgag cgaacgtga
793623DNAArtificial sequenceprimer 36ctgctggaag atggcgattc tcg
233720DNAArtificial sequenceprimer 37aacagcagga gcggtgagtc
203833DNAArtificial sequenceprimer 38ataagcggcc gctctaatac
agactggcac ctg 333930DNAArtificial sequenceprimer 39gtcaagcttt
aaagagatcc ctgctataaa 304030DNAArtificial sequenceprimer
40gtcaagcttc ctgtttccag cgtaggtgaa 304130DNAArtificial
sequenceprimer 41tctactagtc tcaccacctg tacagtaagt
304234DNAArtificial sequenceprimer 42ataagcggcc gcaacaatta
gtgtgtttcc agtt 344335DNAArtificial sequenceprimer 43gtcgaattca
gatctaaatg gggtactgag acaag 354430DNAArtificial sequenceprimer
44ataggatcca accaatgaga cagtggcaca 304531DNAArtificial
sequenceprimer 45gtcgtcgcac ttattcatgt tccaacaacc a
314633DNAArtificial sequenceprimer 46ataagcggcc gccttaactt
agacagcatg tat 334729DNAArtificial sequenceprimer 47gtcgaattcg
tctgcagagg gttagtcaa 294829DNAArtificial sequenceprimer
48ataggatcca gagcagatag cagtgaaaa 294930DNAArtificial
sequenceprimer 49gtcgtcgcat attacctcac ccaatgctag
305034DNAArtificial sequenceprimer 50ataacttcgt ataatgtatg
ctatacgaag ttat 34
* * * * *