U.S. patent application number 12/729903 was filed with the patent office on 2010-10-14 for labeling and detection of nucleic acids.
This patent application is currently assigned to LIFE TECHNOLOGIES CORPORATION. Invention is credited to Brian Agnew, Maura J. Ford, Kyle R. Gee, Kapil Kumar.
Application Number | 20100261181 12/729903 |
Document ID | / |
Family ID | 39705268 |
Filed Date | 2010-10-14 |
United States Patent
Application |
20100261181 |
Kind Code |
A1 |
Agnew; Brian ; et
al. |
October 14, 2010 |
LABELING AND DETECTION OF NUCLEIC ACIDS
Abstract
Provided in certain embodiments are new methods for forming
azido modified nucleic acid conjugates of reporter molecules,
carrier molecules or solid support. In other embodiments are
provided methods for enzymatically labeling nucleic acids with an
azide group.
Inventors: |
Agnew; Brian; (Eugen,
OR) ; Ford; Maura J.; (Eugene, OR) ; Gee; Kyle
R.; (Springfield, OR) ; Kumar; Kapil; (Eugene,
OR) |
Correspondence
Address: |
LIFE TECHNOLOGIES CORPORATION;C/O INTELLEVATE
P.O. BOX 52050
MINNEAPOLIS
MN
55402
US
|
Assignee: |
LIFE TECHNOLOGIES
CORPORATION
Carlsbad
CA
|
Family ID: |
39705268 |
Appl. No.: |
12/729903 |
Filed: |
March 23, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11674623 |
Feb 13, 2007 |
|
|
|
12729903 |
|
|
|
|
11674140 |
Feb 12, 2007 |
|
|
|
11674623 |
|
|
|
|
60804640 |
Jun 13, 2006 |
|
|
|
60772221 |
Feb 10, 2006 |
|
|
|
Current U.S.
Class: |
435/6.1 ;
435/183; 435/194; 435/6.18; 435/91.2; 436/94; 536/23.1 |
Current CPC
Class: |
G01N 2333/91245
20130101; C12Q 1/686 20130101; C07D 311/88 20130101; C07D 295/22
20130101; C07D 307/58 20130101; C12Q 1/68 20130101; C09B 11/24
20130101; C12Q 1/6806 20130101; G01N 33/531 20130101; C12Q 1/6841
20130101; C07D 263/32 20130101; G01N 33/5308 20130101; C07D 207/40
20130101; Y10T 436/143333 20150115 |
Class at
Publication: |
435/6 ; 435/91.2;
436/94; 536/23.1; 435/194; 435/183 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34; G01N 33/48 20060101
G01N033/48; C07H 21/00 20060101 C07H021/00; C12N 9/12 20060101
C12N009/12; C12N 9/00 20060101 C12N009/00 |
Claims
1. A method of forming a nucleic acid conjugate, wherein the method
comprises: a) incorporating an azide modified nucleotide into the
nucleic acid polymer by contacing the azide modified nucleotide
nucleotide with at least one other nucleotide in the presence of a
DNA amplification enzyme to form an azide modified nucleic acid
polymer; and b) contacting the azide modified nucleic acid polymer
with a reporter molecule, carrier molecule or solid support that
comprises an activated or terminal alkyne or phosphine moiety to
form a nucleic acid polymer-reporter molecule, carrier molecule,
solid support conjugate.
2. A method of forming a nucleic acid conjugate, wherein the method
comprises: a) incorporating a terminal alkyne modified nucleotide
into the nucleic acid polymer by contacing the terminal alkyne
modified nucleotide nucleotide with at least one other nucleotide
in the presence of a DNA amplification enzyme to form a terminal
alkyne modified nucleic acid polymer; and b) contacting the
terminal alkyne modified nucleic acid polymer with a reporter
molecule, carrier molecule or solid support that comprises an azido
moiety to form a nucleic acid polymer-reporter molecule, carrier
molecule, solid support conjugate.
3. A method of forming a nucleic acid conjugate, wherein the method
comprises: a) incorporating a phosphine modified nucleotide into
the nucleic acid polymer by contacing the phosphine modified
nucleotide nucleotide with at least one other nucleotide in the
presence of a DNA amplification enzyme to form a phosphine modified
nucleic acid polymer; and b) contacting the phosphine modified
nucleic acid polymer with a reporter molecule, carrier molecule or
solid support that comprises an azido moiety to form a nucleic acid
polymer-reporter molecule, carrier molecule, solid support
conjugate.
4. A method for making an azido, alkyne or phosphine modified
nucleic acid polymer, wherein the method comprises: incubating at
least one azido, alkyne or phosphine modified nucleotide in the
presence of a nucleic acid amplification enzyme to form an azido,
alkyne or phosphine modified nucleic acid polymer.
5. The method according to claim 4, wherein the nucleic acid enzyme
is a DNA polymerase.
6. The method according to claim 4, wherein the nucleic acid enzyme
is a RNA polymerase.
7. The method according to claim 4, wherein the melting temperature
of the azido, alkyne or phosphine modified nucleic acid polymer is
increased.
8. The method according to claim 1, wherein the reporter molecule
is a xanthene, cyanine, coumarin, borapolyazaindacene or pyrene
dye.
9. The method according to claim 1, wherein the reporter molecule
is an enzyme substrate or hapten.
10. The method according to claim 1, wherein the carrier molecule
is an amino acid, a peptide, a protein, a polysaccharide, a
nucleotide, a nucleoside, an oligonucleotide, a nucleic acid, a
hapten, a psoralen, a drug, a hormone, a lipid, a lipid assembly, a
synthetic polymer, a polymeric microparticle, a biological cell or
a virus.
11. The method according to claim 1, wherein the carrier molecule
comprises an antibody or fragment thereof, an avidin or
streptavidin, a biotin, a blood component protein, a dextran, an
enzyme, an enzyme inhibitor, a hormone, an IgG binding protein, a
fluorescent protein, a growth factor, a lectin, a
lipopolysaccharide, a microorganism, a metal binding protein, a
metal chelating moiety, a non-biological microparticle, a peptide
toxin, a phosphotidylserine-binding protein, a structural protein,
a small-molecule drug, or a tyramide.
12. The method according to claim 1, wherein the solid support is a
microfluidic chip, a silicon chip, a microscope slide, a microplate
well, silica gels, polymeric membranes, particles, derivatized
plastic films, glass beads, cotton, plastic beads, alumina gels,
polysaccharides, polyvinylchloride, polypropylene, polyethylene,
nylon, latex bead, magnetic bead, paramagnetic bead, or
superparamagnetic bead.
13. The method according to claim 1, wherein the solid support is
Sepharose, poly(acrylate), polystyrene, poly(acrylamide), polyol,
agarose, agar, cellulose, dextran, starch, FICOLL, heparin,
glycogen, amylopectin, mannan, inulin, nitrocellulose,
diazocellulose or starch.
14. A method of detecting an azido modified nucleic acid polymer,
comprising: a) forming an azide-alkyne cycloaddition reaction
mixture comprising: a reporter molecule that comprises a terminal
alkyne moiety: an azido modified nucleic acid polymer; b)
incubating the azide-alkyne cycloaddition reaction mixture for a
sufficient amount of time to form a nucleic acid polymer-reporter
molecule conjugate; c) separating the nucleic acid polymer-reporter
conjugate by size and/or weight of the nucleic acid
polymer-reporter-reporter molecule conjugate to form a separated
nucleic acid polymer-reporter-reporter molecule conjugate; d)
illuminating the separated nucleic acid polymer-reporter-reporter
molecule conjugate with an appropriate wavelength to form an
illuminated nucleic acid polymer-reporter- reporter molecule
conjugate; e) observing the illuminated nucleic acid
polymer-reporter-reporter molecule conjugate wherein the nucleic
acid polymer is detected.
16. The method according to claim 14, wherein step a) further
comprises a. copper ions; b. at least one reducing agent; and c. a
copper chelator.
16. The method according to claim 14, wherein the reporter molecule
is xanthene, cyanine, coumarin, borapolyazaindacene or pyrene
dye.
17. The method according to claim 14, wherein the reporter molecule
is an enzyme substrate, fluorescent protein or hapten.
18. The method according to claim 15, wherein the copper chelator
is a copper (I)chelator.
19. The method according to claim 15, wherein the copper chelator
is N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN), EDTA,
neocuproine, N-(2-acetamido)iminodiacetic acid (ADA),
pyridine-2,6-dicarboxylic acid (PDA), S-carboxymethyl-L-cysteine
(SCMC), 1,10 phenanthroline, or a derivative thereof, trientine,
glutathione, histadine, polyhistadine or tetra- ehylenepolyamine
(TEPA).
20. The method according to claim 15, wherein the copper chelator
is 1,10 phenanthroline, bathophenanthroline disulfonic acid
(4,7odiphenyl-1,10-phenanthroline disulfonic acid) or bathocuproine
disulfonic acid (2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline
disulfonate).
21. The method according to claim 15, wherein the reducing agent is
acorbate, Tris(2-Carboxyethyl) Phosphine (TCEP), TCP
(2,4,6-trichlorophenol), NADH, NADPH, thiosulfate,
2-mercaptoethanol, dithiothreotol, glutathione, cysteine, metallic
copper, quinone, hydroquinone, vitamin K.sub.1, Fe.sup.2+,
Co.sup.2+, or an applied electric potential.
22. The method according to claim 15, wherein the reducing agent is
ascorbate.
23. The method according to claim 14, wherein the separating step
comprises chromatography or electrophoresis.
24. The method according to claim 23, wherein the chromatography
comprises one or more of FPLC, HPLC, liquid chromatograpy (LC),
size exclusion chromatography, ion exchange chromatography, or
affinity chromatography.
25. The method according to claim 23, wherein electrophoresis
comprises gel electrophoresis, 1 dimensional (1D) gel
electrophoresis, 2 dimensional (2D) gel electrophoresis, native gel
electrophoresis, denaturing gel electrophoresis, isoelctric
focusing, or capillary electrophoresis.
26. An azide-alkyne cycloaddition reaction mixture comprising: a
reporter molecule that comprises a terminal alkyne moiety: an azido
modified nucleic acid; copper ions; at least one reducing agent;
and a copper chelator.
27. A method for detecting immobilized azido modified nucleic
acids, wherein the method comprises: a) immobilizing the azido
modified nucleic acids on a solid or semi-solid matrix to form an
immbolized azido modified nucleic acid; b) contacting the
immbolized azido modified nucleic acid with a reporter molecule
that contains an azide reactive group to form a contacted azido
modified nucleic acid; c) incubating the contacted azido modified
nucleic acid for a sufficient amount of time to form a reporter
molecule-nucleic acid conjugate; d) illuminating the reporter
molecule-nucleic acid conjugate with an appropriate wavelength to
form an illuminated reporter molecule-nucleic acid conjugate; e)
observing the illuminated reporter molecule-nucleic acid conjugate
whereby the immobilized azido modified nucleic acid is
detected.
28. A method for detecting immobilized alkyne modified nucleic
acids, wherein the method comprises: a) immobilizing the alkyne
modified nucleic acids on a solid or semi-solid matrix to form an
immbolized alkyne modified nucleic acid; f) contacting the
immbolized alkyne modified nucleic acid with a reporter molecule
that contains an azido group to form a contacted alkyne modified
nucleic acid; g) incubating the contacted alkyne modified nucleic
acid for a sufficient amount of time to form a reporter
molecule-nucleic acid conjugate; h) illuminating the reporter
molecule-nucleic acid conjugate with an appropriate wavelength to
form an illuminated reporter molecule-nucleic acid conjugate; i)
observing the illuminated reporter molecule-nucleic acid conjugate
whereby the immobilized alkyne modified nucleic acid is
detected.
29. The method according to claim 28, wherein the solid or
semi-solid support is a slide, an array, an agarose gel, a
polyacrylamide gel, a hydrogel, a polymeric particle or glass.
30. A kit comprising: Azide or alkyne-dUTP; a telomerase enzyme; an
azide or alkyne reactive reporter molecule, carrier molecule or
solid support.
31. A kit for labeling a nucleic acid polymer comprising: at least
one nucleotide analogue that comprises an azide, alkyne or
phosphine moiety; and a reporter molecule, carrier molecule or
solid support comprising an azide, alkyne or phosphine moiety.
32. The kit according to claim 31, further comprising a nucleici
acid amplification enzyme.
33. A method of measuring Telomerase Enzyme Activity, comprising
steps of: a) contacting a cell with an effective amount of a dNTP
nucleotide that comprises an azide group and a Telomerase enzyme
such that the dNTP nucleotide is incorporated into at least one
nucleic acid polymer; b) contacting the nucleic acid polymer with a
reporter molecule comprising an alkyne or phosphine moiety to form
a azido modified nucleic acid polymer reporter molecule conjugate;
c) separating the azido modified nucleic acid polymer reporter
molecule conjugate from nucleic acid polymers that do not comprise
a reporter molecule, and d) illuminating the azido modified nucleic
acid polymer reporter molecule conjugate to determine Telomerase
activity.
34. A method of measuring Telomerase Enzyme Activity, comprising
steps of: a) contacting a cell with an effective amount of a dNTP
nucleotide that comprises an alkyne or phosphine group and a
Telomerase enzyme such that the dNTP nucleotide is incorporated
into at least one nucleic acid polymer; b) contacting the nucleic
acid polymer with a reporter molecule comprising an azido moiety to
form an alkyne or phosphine modified nucleic acid polymer reporter
molecule conjugate; c) separating the alkyne or phosphine modified
nucleic acid polymer reporter molecule conjugate from nucleic acid
polymers that do not comprise a reporter molecule, and d)
illuminating the alkyne or phosphine modified nucleic acid polymer
reporter molecule conjugate to determine Telomerase activity.
Description
CROSS REFERENCE TO RELATED APPLICATION(S)
[0001] This application is a Continuation-in-Part of U.S. Ser. No.
11/674,140, filed Feb. 12, 2007, which claims priority to U.S.
Provisional Application No. 60/772,221, filed Feb. 10, 2006 and
U.S. Provisional Application No. 60/804,640, filed Jun. 13, 2006,
the contents of which are incorporated by reference as if set forth
fully herein.
FIELD OF THE INVENTION
[0002] The invention generally relates to methods of labeling
nucleic acid polymers and their use.
BACKGROUND INFORMATION
[0003] Conventional methods for labeling nucleotides are
straightforward, but have significant drawbacks. With direct
fluorophore labeling, the bulky dye molecule on the nucleotide
makes it difficult for the enzyme to incorporate nucleotides into
DNA or RNA strands. Additionally, protocols optimized for one
fluorophore may not be optimal for another, chemically different
fluorophore.
[0004] Various methods have been used to generate labeled probes
for hybridization to Southern blots and microarrays, for example,
5' and 3' end labeling with .sup.32P. Additionally, nick
translation uses DNAse I to generate single stranded nicks in the
nucleic acid starting material and DNA polymerase to fill in the
nicks. A labeled deoxynucleotide (for example dUTP-digoxigenin or
dUTP fluorescein) is included in the reaction mixture, along with
the other unlabeled deoxynucleotides. While these methods generate
labeled probes, they do not provide a method of amplifying the
starting material.
[0005] Polymerase chain reaction (PCR) in the presence of a mixture
of nucleotides (for example dATP, dCTP, dGTP, dTTP, and modified
dUTP-digoxigenin or fluorescein) can be used to synthesize copies
of a template strand. These amplicons can be used as probes for
hybridization assays. The mixture must contain unmodified dTTP in
addition to modified dUTP in order for the reaction to take
place.
[0006] PCR uses a double stranded DNA template as starting
material. This template can be made from RNA by reverse
transcription and subsequently labeled by PCR incorporation of
labeled nucleotides. While this method does result in an
amplification of the starting material, the substitution of the
deoxynucleotide fluorescent analogue is less than 100% and the
specific activity may be variable, depending on the label.
[0007] Accordingly, one object of the present invention is to
provide an improved method for nucleotide labeling that circumvents
problems associated with conventional methods. Preferably, the
methods will be amenable to a variety of uses including generating
FISH probes, generating probes for Southern blots, generating
probes for Northern blots, colorimetric in situ hybridization
probes (CISH), in situ PCR, isothermal amplification in situ, DNA
fingerprinting, and SNP detection.
SUMMARY OF THE INVENTION
[0008] One aspect of the invention provides a method of forming a
nucleic acid conjugate, wherein the method comprises: [0009]
incorporating an azide modified nucleotide into the nucleic acid
polymer by contacting the azide modified nucleotide nucleotide with
at least one other nucleotide in the presence of a DNA
amplification enzyme to form an azide modified nucleic acid
polymer; and [0010] contacting the azide modified nucleic acid
polymer with a reporter molecule, carrier molecule or solid support
that comprises an activated or terminal alkyne or phosphine moiety
to form a nucleic acid polymer-reporter molecule, carrier molecule,
solid support conjugate.
[0011] Another aspect of the invention provides method of forming a
nucleic acid conjugate, wherein the method comprises: [0012]
incorporating a terminal alkyne modified nucleotide into the
nucleic acid polymer by contacting the terminal alkyne modified
nucleotide nucleotide with at least one other nucleotide in the
presence of a DNA amplification enzyme to form a terminal alkyne
modified nucleic acid polymer; and [0013] contacting the terminal
alkyne modified nucleic acid polymer with a reporter molecule,
carrier molecule or solid support that comprises an azido moiety to
form a nucleic acid polymer-reporter molecule, carrier molecule,
solid support conjugate.
[0014] Another aspect of the invention provides a method of forming
a nucleic acid conjugate, wherein the method comprises: [0015]
incorporating a phosphine modified nucleotide into the nucleic acid
polymer by contacting the phosphine modified nucleotide nucleotide
with at least one other nucleotide in the presence of a DNA
amplification enzyme to form a phosphine modified nucleic acid
polymer; and [0016] contacting the phosphine modified nucleic acid
polymer with a reporter molecule, carrier molecule or solid support
that comprises an azido moiety to form a nucleic acid
polymer-reporter molecule, carrier molecule, solid support
conjugate.
[0017] Another aspect of the invention provides a method for making
an azido, alkyne or phosphine modified nucleic acid polymer,
wherein the method comprises: [0018] incubating at least one azido,
alkyne or phosphine modified nucleotide in the presence of a
nucleic acid amplification enzyme to form an azido, alkyne or
phosphine modified nucleic acid polymer.
[0019] In another embodiment, the nucleic acid enzyme is a DNA
polymerase.
[0020] In another embodiment, the nucleic acid enzyme is a RNA
polymerase.
[0021] In another embodiment, the melting temperature of the azido,
alkyne or phosphine modified nucleic acid polymer is increased.
[0022] In another embodiment, the reporter molecule is a xanthene,
cyanine, coumarin, borapolyazaindacene or pyrene dye. In another
embodiment, the reporter molecule is an enzyme substrate or
hapten.
[0023] In another embodiment, the carrier molecule is an amino
acid, a peptide, a protein, a polysaccharide, a nucleotide, a
nucleoside, an oligonucleotide, a nucleic acid, a hapten, a
psoralen, a drug, a hormone, a lipid, a lipid assembly, a synthetic
polymer, a polymeric microparticle, a biological cell or a virus.
In another embodiment, the carrier molecule comprises an antibody
or fragment thereof, an avidin or streptavidin, a biotin, a blood
component protein, a dextran, an enzyme, an enzyme inhibitor, a
hormone, an IgG binding protein, a fluorescent protein, a growth
factor, a lectin, a lipopolysaccharide, a microorganism, a metal
binding protein, a metal chelating moiety, a non-biological
microparticle, a peptide toxin, a phosphotidylserine-binding
protein, a structural protein, a small-molecule drug, or a
tyramide.
[0024] In another embodiment, the solid support is a microfluidic
chip, a silicon chip, a microscope slide, a microplate well, silica
gels, polymeric membranes, particles, derivatized plastic films,
glass beads, cotton, plastic beads, alumina gels, polysaccharides,
polyvinylchloride, polypropylene, polyethylene, nylon, latex bead,
magnetic bead, paramagnetic bead, or superparamagnetic bead.
[0025] In another embodiment, the solid support is Sepharose,
poly(acrylate), polystyrene, poly(acrylamide), polyol, agarose,
agar, cellulose, dextran, starch, FICOLL, heparin, glycogen,
amylopectin, mannan, inulin, nitrocellulose, diazocellulose or
starch.
[0026] Another aspect of the invention provides a method of
detecting an azido modified nucleic acid polymer, comprising:
[0027] forming an azide-alkyne cycloaddition reaction mixture
comprising: a reporter molecule that comprises a terminal alkyne
moiety: [0028] an azido modified nucleic acid polymer; [0029]
incubating the azide-alkyne cycloaddition reaction mixture for a
sufficient amount of time to form a nucleic acid polymer-reporter
molecule conjugate; [0030] separating the nucleic acid
polymer-reporter conjugate by size and/or weight of the nucleic
acid polymer-reporter-reporter molecule conjugate to form a
separated nucleic acid polymer-reporter-reporter molecule
conjugate; [0031] illuminating the separated nucleic acid
polymer-reporter-reporter molecule conjugate with an appropriate
wavelength to form an illuminated nucleic acid
polymer-reporter-reporter molecule conjugate; [0032] observing the
illuminated nucleic acid polymer-reporter-reporter molecule
conjugate wherein the nucleic acid polymer is detected.
[0033] In a more particular embodiment the forming step further
comprises [0034] a. copper ions; [0035] b. at least one reducing
agent; and [0036] c. a copper chelator.
[0037] In another embodiment, the reporter molecule is xanthene,
cyanine, coumarin, borapolyazaindacene or pyrene dye. In another
embodiment, the reporter molecule is an enzyme substrate,
fluorescent protein or hapten.
[0038] In another embodiment, the copper chelator is a copper (I)
chelator. In another embodiment, the copper chelator is
N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN), EDTA,
neocuproine, N-(2-acetamido)iminodiacetic acid (ADA),
pyridine-2,6-dicarboxylic acid (PDA), S-carboxymethyl-L-cysteine
(SCMC), 1,10 phenanthroline, or a derivative thereof, trientine,
glutathione, histadine, polyhistadine or tetra-ehylenepolyamine
(TEPA). In another embodiment, the copper chelator is 1,10
phenanthroline, bathophenanthroline disulfonic acid
(4,7odiphenyl-1,10-phenanthroline disulfonic acid) or bathocuproine
disulfonic acid (2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline
disulfonate).
[0039] In another embodiment, the reducing agent is acorbate,
Tris(2-Carboxyethyl) Phosphine (TCEP), TCP (2,4,6-trichlorophenol),
NADH, NADPH, thiosulfate, 2-mercaptoethanol, dithiothreotol,
glutathione, cysteine, metallic copper, quinone, hydroquinone,
vitamin K.sub.1, Fe.sup.2+, Co.sup.2+, or an applied electric
potential. In another embodiment, the reducing agent is
ascorbate.
[0040] In another embodiment, the separating step comprises
chromatography or electrophoresis. In another embodiment, the
chromatography comprises one or more of FPLC, HPLC, liquid
chromatograpy (LC), size exclusion chromatography, ion exchange
chromatography, or affinity chromatography.
[0041] In another embodiment, electrophoresis comprises gel
electrophoresis, 1 dimensional (1D) gel electrophoresis, 2
dimensional (2D) gel electrophoresis, native gel electrophoresis,
denaturing gel electrophoresis, isoelectric focusing, or capillary
electrophoresis.
[0042] Another aspect of the invention provides an azide-alkyne
cycloaddition reaction mixture comprising: [0043] a reporter
molecule that comprises a terminal alkyne moiety: [0044] an azido
modified nucleic acid; [0045] copper ions; [0046] at least one
reducing agent; and [0047] a copper chelator.
[0048] Another aspect of the invention provides a method for
detecting immobilized azido modified nucleic acids, wherein the
method comprises: [0049] immobilizing the azido modified nucleic
acids on a solid or semi-solid matrix to form an immobilized azido
modified nucleic acid; [0050] contacting the immobilized azido
modified nucleic acid with a reporter molecule that contains an
azide reactive group to form a contacted azido modified nucleic
acid; [0051] incubating the contacted azido modified nucleic acid
for a sufficient amount of time to form a reporter molecule-nucleic
acid conjugate; [0052] illuminating the reporter molecule-nucleic
acid conjugate with an appropriate wavelength to form an
illuminated reporter molecule-nucleic acid conjugate; [0053]
observing the illuminated reporter molecule-nucleic acid conjugate
whereby the immobilized azido modified nucleic acid is
detected.
[0054] Another aspect of the invention provides a method for
detecting immobilized alkyne modified nucleic acids, wherein the
method comprises: [0055] immobilizing the alkyne modified nucleic
acids on a solid or semi-solid matrix to form an immobilized alkyne
modified nucleic acid; [0056] contacting the immobilized alkyne
modified nucleic acid with a reporter molecule that contains an
azido group to form a contacted alkyne modified nucleic acid;
[0057] incubating the contacted alkyne modified nucleic acid for a
sufficient amount of time to form a reporter molecule-nucleic acid
conjugate; [0058] illuminating the reporter molecule-nucleic acid
conjugate with an appropriate wavelength to form an illuminated
reporter molecule-nucleic acid conjugate; [0059] observing the
illuminated reporter molecule-nucleic acid conjugate whereby the
immobilized alkyne modified nucleic acid is detected.
[0060] In another embodiment, the solid or semi-solid support is a
slide, an array, an agarose gel, a polyacrylamide gel, a hydrogel,
a polymeric particle or glass.
[0061] Another aspect of the invention provides a kit comprising:
[0062] Azide-dATP; [0063] a telomerase enzyme; [0064] an azide
reactive reporter molecule, carrier molecule or solid support.
[0065] Another aspect of the invention provides a kit for labeling
a nucleic acid polymer comprising: [0066] at least one nucleotide
analogue that comprises an azide, alkyne or phosphine moiety; and
[0067] a reporter molecule, carrier molecule or solid support
comprising an azide, alkyne or phosphine moiety.
[0068] A more particular embodiment thereof further comprises a
nucleic acid amplification enzyme.
[0069] Another aspect of the invention provides a method of
measuring Telomerase Enzyme Activity, comprising steps of: [0070]
a) contacting a cell with an effective amount of a dNTP nucleotide
that comprises an azide group and a Telomerase enzyme such that the
dNTP nucleotide is incorporated into at least one nucleic acid
polymer; [0071] b) contacting the nucleic acid polymer with a
reporter molecule comprising an alkyne or phosphine moiety to form
a azido modified nucleic acid polymer reporter molecule conjugate;
[0072] c) separating the azido modified nucleic acid polymer
reporter molecule conjugate from nucleic acid polymers that do not
comprise a reporter molecule, and [0073] d) illuminating the azido
modified nucleic acid polymer reporter molecule conjugate to
determine Telomerase activity.
[0074] Another aspect of the invention provides a method of
measuring Telomerase Enzyme Activity, comprising steps of: [0075]
a) contacting a cell with an effective amount of a dNTP nucleotide
that comprises an alkyne or phosphine group and a Telomerase enzyme
such that the dNTP nucleotide is incorporated into at least one
nucleic acid polymer; [0076] b) contacting the nucleic acid polymer
with a reporter molecule comprising an azido moiety to form an
alkyne or phosphine modified nucleic acid polymer reporter molecule
conjugate; [0077] c) separating the alkyne or phosphine modified
nucleic acid polymer reporter molecule conjugate from nucleic acid
polymers that do not comprise a reporter molecule, and [0078] d)
illuminating the alkyne or phosphine modified nucleic acid polymer
reporter molecule conjugate to determine Telomerase activity.
BRIEF DESCRIPTION OF THE DRAWINGS
[0079] FIG. (1): Shows in gel detection Telomerase incorporation of
N.sub.3-dATP.
[0080] FIG. (2): Shows in gel detection and dose-dependence of
Telomerase incorporation of N.sub.3-dATP and not N.sub.3-dAUP.
[0081] FIG. (3): Shows in gel detection and dose-dependence of
Telomerase incorporation of N.sub.3-dATP and labeled with
alkyne-TAMRA using "click" chemistry.
[0082] FIG. (4): Shows in gel detection of Telomerase incorporation
of ethynyl-dAUP and labeled with azide-TAMRA using "click"
chemistry.
[0083] FIG. (5): Shows in gel detection of Telomerase incorporation
of ethynyl-dAUP and labeled with azide-TAMRA using "click"
chemistry.
[0084] FIG. (6): Shows in gel detection of incorporation of
ethynyl-dAUP using linear amplification and various polymerases.
The ethynyl-dAUP was labeled with azide-TAMRA using "click"
chemistry.
[0085] FIG. (7): Shows that the presence of a copper chelator (BCS)
maintains Telomerase laddering.
[0086] FIG. (8): Is a schematic diagram showing amplification using
helicase enzyme.
[0087] FIG. (9): Is a schematic diagram showing Strand Displacement
Amplification (SDA)
[0088] FIG. (10): Illustration of the position of the primers used
in Example 13, giving a predicted amplicon size of 293 bp.
[0089] FIG. (11): Is a linear amplification plot showing that the
onset of exponential amplification or threshold cycle (CT) for the
click modified dUTP mix is very similar to that shown for the
unmodified dUTP mix. The average CT for click dUTP is 9.78 vs 10.97
for unmodified dUTP.
[0090] FIG. (12): Shows dissociation curves for the reactions in
Example 13, showing the change in fluorescence as a function of
temperature. Click modified dUTP mix melts at 93 C, vs unmodified
dUTP mix at 88 C.
[0091] FIG. (13): Gel analysis of real-time PCR products scanned
for TAMRA (left) or scanned after labeling with SYBR GOLD
(right).
[0092] FIG. (14). shows images of reaction tubes for TAMRA.
[0093] FIG. (15): shows a dot blot of reaction products scanned for
TAMRA.
[0094] FIG. (16): shows the experimental setup for Example 15.
DETAILED DESCRIPTION OF THE INVENTION
Definitions and Abbreviations
[0095] Before describing the present invention in detail, it is to
be understood that this invention is not limited to specific
compositions or process steps, as such may vary. It must be noted
that, as used in this specification and the appended claims, the
singular form "a", "an" and "the" include plural referents unless
the context clearly dictates otherwise. Thus, for example,
reference to "a ligand" includes a plurality of ligands and
reference to "a nucleic acid" includes a plurality of nucleic acids
and the like.
[0096] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention is related. The
following terms and abbreviations (Table 1) are defined for
purposes of the invention as described herein.
TABLE-US-00001 TABLE 1 List of Abbreviations Abbreviation Term.
E-dNTP ethynyl deoxynucleoside triphosphate E-ATP ethynyl
deoxyadenosine triphosphate E-GTP ethynyl deoxyguanosine
triphosphate E-CTP ethynyl deoxycytidine triphosphate E-TTP ethynyl
deoxythymidine triphosphate
[0097] Certain compounds of the present invention can exist in
unsolvated forms as well as solvated forms, including hydrated
forms. In general, the solvated forms are equivalent to unsolvated
forms and are encompassed within the scope of the present
invention. Certain compounds of the present invention may exist in
multiple crystalline or amorphous forms. In general, all physical
forms are equivalent for the uses contemplated by the present
invention and are intended to be within the scope of the present
invention.
[0098] Certain compounds of the present invention possess
asymmetric carbon atoms (optical centers) or double bonds; the
racemates, diastereomers, geometric isomers and individual isomers
are encompassed within the scope of the present invention.
[0099] The compounds described herein may be prepared as a single
isomer (e.g., enantiomer, cis-trans, positional, diastereomer) or
as a mixture of isomers. In a preferred embodiment, the compounds
are prepared as substantially a single isomer. Methods of preparing
substantially isomerically pure compounds are known in the art. For
example, enantiomerically enriched mixtures and pure enantiomeric
compounds can be prepared by using synthetic intermediates that are
enantiomerically pure in combination with reactions that either
leave the stereochemistry at a chiral center unchanged or result in
its complete inversion. Alternatively, the final product or
intermediates along the synthetic route can be resolved into a
single stereoisomer. Techniques for inverting or leaving unchanged
a particular stereocenter, and those for resolving mixtures of
stereoisomers are well known in the art and it is well within the
ability of one of skill in the art to choose and appropriate method
for a particular situation. See, generally, Furniss et al. (eds.),
VOGEL'S ENCYCLOPEDIA OF PRACTICAL ORGANIC CHEMISTRY 5.sup.TH ED.,
Longman Scientific and Technical Ltd., Essex, 1991, pp. 809-816;
and Heller, Acc. Chem. Res. 23: 128 (1990).
[0100] The compounds disclosed herein may also contain unnatural
proportions of atomic isotopes at one or more of the atoms that
constitute such compounds. For example, the compounds may be
radiolabeled with radioactive isotopes, such as for example tritium
(.sup.3H), iodine-125 (.sup.125I) or carbon-14 (.sup.14C). All
isotopic variations of the compounds of the present invention,
whether radioactive or not, are intended to be encompassed within
the scope of the present invention.
[0101] Where a disclosed compound includes a conjugated ring
system, resonance stabilization may permit a formal electronic
charge to be distributed over the entire molecule. While a
particular charge may be depicted as localized on a particular ring
system, or a particular heteroatom, it is commonly understood that
a comparable resonance structure can be drawn in which the charge
may be formally localized on an alternative portion of the
compound.
[0102] Selected compounds having a formal electronic charge may be
shown without an appropriate biologically compatible counterion.
Such a counterion serves to balance the positive or negative charge
present on the compound. As used herein, a substance that is
biologically compatible is not toxic as used, and does not have a
substantially deleterious effect on biomolecules. Examples of
negatively charged counterions include, among others, chloride,
bromide, iodide, sulfate, alkanesulfonate, arylsulfonate,
phosphate, perchlorate, tetrafluoroborate, tetraarylboride, nitrate
and anions of aromatic or aliphatic carboxylic acids. Preferred
counterions may include chloride, iodide, perchlorate and various
sulfonates. Examples of positively charged counterions include,
among others, alkali metal, or alkaline earth metal ions, ammonium,
or alkylammonium ions.
[0103] Where substituent groups are specified by their conventional
chemical formulae, written from left to right, they equally
encompass the chemically identical substituents, which would result
from writing the structure from right to left, e.g., --CH.sub.2O--
is intended to also recite --OCH.sub.2--.
[0104] The term "acyl" or "alkanoyl" by itself or in combination
with another term, means, unless otherwise stated, a stable
straight or branched chain, or cyclic hydrocarbon radical, or
combinations thereof, consisting of the stated number of carbon
atoms and an acyl radical on at least one terminus of the alkane
radical. The "acyl radical" is the group derived from a carboxylic
acid by removing the --OH moiety therefrom.
[0105] The term "alkyl," by itself or as part of another
substituent means, unless otherwise stated, a straight or branched
chain, or cyclic hydrocarbon radical, or combination thereof, which
may be fully saturated, mono- or polyunsaturated and can include
divalent ("alkylene") and multivalent radicals, having the number
of carbon atoms designated (i.e. C.sub.1-C.sub.10 means one to ten
carbons). Examples of saturated hydrocarbon radicals include, but
are not limited to, groups such as methyl, ethyl, n-propyl,
isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl,
(cyclohexyl)methyl, cyclopropylmethyl, homologs and isomers of, for
example, n-pentyl, n-hexyl, n-heptyl, n-octyl, and the like. An
unsaturated alkyl group is one having one or more double bonds or
triple bonds. Examples of unsaturated alkyl groups include, but are
not limited to, vinyl, 2-propenyl, crotyl, 2-isopentenyl,
2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1-
and 3-propynyl, 3-butynyl, and the higher homologs and isomers. The
term "alkyl," unless otherwise noted, is also meant to include
those derivatives of alkyl defined in more detail below, such as
"heteroalkyl." Alkyl groups that are limited to hydrocarbon groups
are termed "homoalkyl".
[0106] Exemplary alkyl groups of use in the present invention
contain between about one and about twenty five carbon atoms (e.g.
methyl, ethyl and the like). Straight, branched or cyclic
hydrocarbon chains having eight or fewer carbon atoms will also be
referred to herein as "lower alkyl". In addition, the term "alkyl"
as used herein further includes one or more substitutions at one or
more carbon atoms of the hydrocarbon chain fragment.
[0107] The term "amino" or "amine group" refers to the group
--NR'R'' (or NRR'R'') where R, R' and R'' are independently
selected from the group consisting of hydrogen, alkyl, substituted
alkyl, aryl, substituted aryl, aryl alkyl, substituted aryl alkyl,
heteroaryl, and substituted heteroaryl. A substituted amine being
an amine group wherein R' or R'' is other than hydrogen. In a
primary amino group, both R' and R'' are hydrogen, whereas in a
secondary amino group, either, but not both, R' or R'' is hydrogen.
In addition, the terms "amine" and "amino" can include protonated
and quaternized versions of nitrogen, comprising the group
--NRR'R'' and its biologically compatible anionic counterions.
[0108] The term "aryl" as used herein refers to cyclic aromatic
carbon chain having twenty or fewer carbon atoms, e.g., phenyl,
naphthyl, biphenyl, and anthracenyl. One or more carbon atoms of
the aryl group may also be substituted with, e.g., alkyl; aryl;
heteroaryl; a halogen; nitro; cyano; hydroxyl, alkoxyl or aryloxyl;
thio or mercapto, alkyl-, or arylthio; amino, alkylamino,
arylamino, dialkyl-, diaryl-, or arylalkylamino; aminocarbonyl,
alkylaminocarbonyl, arylaminocarbonyl, dialkylaminocarbonyl,
diarylaminocarbonyl, or arylalkylaminocarbonyl; carboxyl, or alkyl-
or aryloxycarbonyl; aldehyde; aryl- or alkylcarbonyl; iminyl, or
aryl- or alkyliminyl; sulfo; alkyl- or alkylcarbonyl; iminyl, or
aryl- or alkyliminyl; sulfo; alkyl- or arylsufonyl; hydroximinyl,
or aryl- or alkoximinyl. In addition, two or more alkyl or
heteroalkyl substituents of an aryl group may be combined to form
fused aryl-alkyl or aryl-heteroalkyl ring systems (e.g.,
tetrahydronaphthyl). Substituents including heterocyclic groups
(e.g., heteroaryloxy, and heteroaralkylthio) are defined by analogy
to the above-described terms.
[0109] The terms "alkoxy," "alkylamino" and "alkylthio" (or
thioalkoxy) are used in their conventional sense, and refer to
those alkyl groups attached to the remainder of the molecule via an
oxygen atom, an amino group, or a sulfur atom, respectively.
[0110] The term "heteroalkyl," by itself or in combination with
another term, means, unless otherwise stated, a straight or
branched chain, or cyclic carbon-containing radical, or
combinations thereof, consisting of the stated number of carbon
atoms and at least one heteroatom selected from the group
consisting of O, N, Si, P, S, and Se and wherein the nitrogen,
phosphorous, sulfur, and selenium atoms are optionally oxidized,
and the nitrogen heteroatom is optionally be quaternized. The
heteroatom(s) O, N, P, S, Si, and Se may be placed at any interior
position of the heteroalkyl group or at the position at which the
alkyl group is attached to the remainder of the molecule. Examples
include, but are not limited to, --CH.sub.2--CH.sub.2--O--CH.sub.3,
--CH.sub.2--CH.sub.2--NH--CH.sub.3,
--CH.sub.2--CH.sub.2--N(CH.sub.3)--CH.sub.3,
--CH.sub.2--S--CH.sub.2--CH.sub.3, --CH.sub.2--CH.sub.2,
--S(O)--CH.sub.3, --CH.sub.2--CH.sub.2--S(O).sub.2--CH.sub.3,
--CH.dbd.CH--O--CH.sub.3, --Si(CH.sub.3).sub.3,
--CH.sub.2--CH.dbd.N--OCH.sub.3, and
--CH.dbd.CH--N(CH.sub.3)--CH.sub.3. Up to two heteroatoms may be
consecutive, such as, for example, --CH.sub.2--NH--OCH.sub.3 and
--CH.sub.2--O--Si(CH.sub.3).sub.3. Similarly, the term
"heteroalkylene" by itself or as part of another substituent means
a divalent radical derived from heteroalkyl, as exemplified, but
not limited by, --CH.sub.2--CH.sub.2--S--CH.sub.2--CH.sub.2-- and
--CH.sub.2--S--CH.sub.2--CH.sub.2--NH--CH.sub.2--. For
heteroalkylene groups, heteroatoms can also occupy either or both
of the chain termini (e.g., alkyleneoxy, alkylenedioxy,
alkyleneamino, alkylenediamino, and the like). Still further, for
alkylene and heteroalkylene linking groups, no orientation of the
linking group is implied by the direction in which the formula of
the linking group is written. For example, the formula
--C(O).sub.2R'-- represents both --C(O).sub.2R'-- and
--R'C(O).sub.2--.
[0111] The terms "cycloalkyl" and "heterocycloalkyl", by themselves
or in combination with other terms, represent, unless otherwise
stated, cyclic versions of "alkyl" and "heteroalkyl", respectively.
Additionally, for heterocycloalkyl, a heteroatom can occupy the
position at which the heterocycle is attached to the remainder of
the molecule. Examples of cycloalkyl include, but are not limited
to, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl,
cycloheptyl, and the like. Examples of heterocycloalkyl include,
but are not limited to, 1-(1,2,5,6-tetrahydropyridyl),
1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl,
3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl,
tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl,
2-piperazinyl, and the like.
[0112] The term "aryl" means, unless otherwise stated, a
polyunsaturated, aromatic moiety that can be a single ring or
multiple rings (preferably from 1 to 3 rings), which are fused
together or linked covalently. The term "heteroaryl" refers to aryl
groups (or rings) that contain from one to four heteroatoms
selected from N, O, S, and Se, wherein the nitrogen, sulfur, and
selenium atoms are optionally oxidized, and the nitrogen atom(s)
are optionally quaternized. A heteroaryl group can be attached to
the remainder of the molecule through a heteroatom. Non-limiting
examples of aryl and heteroaryl groups include phenyl, 1-naphthyl,
2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl,
3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl,
4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl,
4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl,
2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl,
4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl,
2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl,
2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, tetrazolyl,
benzo[b]furanyl, benzo[b]thienyl, 2,3-dihydrobenzo[1,4]dioxin-6-yl,
benzo[1,3]dioxol-5-yl and 6-quinolyl. Substituents for each of the
above noted aryl and heteroaryl ring systems are selected from the
group of acceptable substituents described below.
[0113] For brevity, the term "aryl" when used in combination with
other terms (e.g., aryloxy, arylthioxy, arylalkyl) includes both
aryl and heteroaryl rings as defined above. Thus, the term
"arylalkyl" is meant to include those radicals in which an aryl
group is attached to an alkyl group (e.g., benzyl, phenethyl,
pyridylmethyl and the like) including those alkyl groups in which a
carbon atom (e.g., a methylene group) has been replaced by, for
example, an oxygen atom (e.g., phenoxymethyl, 2-pyridyloxymethyl,
3-(1-naphthyloxy)propyl, and the like).
[0114] Each of the above terms (e.g., "alkyl," "heteroalkyl,"
"aryl" and "heteroaryl") includes both substituted and
unsubstituted forms of the indicated radical. Preferred
substituents for each type of radical are provided below.
[0115] Substituents for the alkyl and heteroalkyl radicals
(including those groups often referred to as alkylene, alkenyl,
heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl,
heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) are
generically referred to as "alkyl group substituents," and they can
be one or more of a variety of groups selected from, but not
limited to: --OR', .dbd.O, .dbd.NR', .dbd.N--OR', --NR'R'', --SR',
-halogen, --SiR'R''R''', --OC(O)R', --C(O)R', --CO.sub.2R',
--CONR'R'', --OC(O)NR'R'', --NR''C(O)R', --NR'--C(O)NR''R''',
--NR''C(O).sub.2R', --NR--C(NR'R''R''').dbd.NR'''',
--NR--C(NR'R'').dbd.NR''', --S(O)R', --S(O).sub.2R',
--S(O).sub.2NR'R'', --NRSO.sub.2R', --CN and --NO.sub.2 in a number
ranging from zero to (2m'+1), where m' is the total number of
carbon atoms in such radical. R', R'', R''' and R'''' each
preferably independently refer to hydrogen, substituted or
unsubstituted heteroalkyl, substituted or unsubstituted aryl, e.g.,
aryl substituted with 1-3 halogens, substituted or unsubstituted
alkyl, alkoxy or thioalkoxy groups, or arylalkyl groups. When a
compound includes more than one R group, for example, each of the R
groups is independently selected as are each R', R'', R''' and
R'''' groups when more than one of these groups is present. When R'
and R'' are attached to the same nitrogen atom, they can be
combined with the nitrogen atom to form a 5-, 6-, or 7-membered
ring. For example, --NR'R'' is meant to include, but not be limited
to, 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of
substituents, one of skill in the art will understand that the term
"alkyl" is meant to include groups including carbon atoms bound to
groups other than hydrogen groups, such as haloalkyl (e.g.,
--CF.sub.3 and --CH.sub.2CF.sub.3) and acyl (e.g., --C(O)CH.sub.3,
--C(O)CF.sub.3, --C(O)CH.sub.2OCH.sub.3, and the like).
[0116] Similar to the substituents described for the alkyl radical,
substituents for the aryl and heteroaryl groups are generically
referred to as "aryl group substituents." The substituents are
selected from, for example: halogen, --OR', 'O, .dbd.NR',
.dbd.N--OR', --NR'R'', --SR', -halogen, --SiR'R''R''', --OC(O)R',
--C(O)R', --CO.sub.2R', --CONR'R'', --OC(O)NR'R'', --NR''C(O)R',
--NR'--C(O)NR''R''', --NR''C(O).sub.2R',
--NR--C(NR'R''R''').dbd.NR'''', --NR--C(NR'R'').dbd.NR''',
--S(O)R', --S(O).sub.2R', --S(O).sub.2NR'R'', --NRSO.sub.2R', --CN
and --NO.sub.2, --R', --N.sub.3, --CH(Ph).sub.2,
fluoro(C.sub.1-C.sub.4)alkoxy, and fluoro(C.sub.1-C.sub.4)alkyl, in
a number ranging from zero to the total number of open valences on
the aromatic ring system; and where R', R'', R''' and R'''' are
preferably independently selected from hydrogen, substituted or
unsubstituted alkyl, substituted or unsubstituted heteroalkyl,
substituted or unsubstituted aryl and substituted or unsubstituted
heteroaryl. When a compound includes more than one R group, for
example, each of the R groups is independently selected as are each
R', R'', R''' and R'''' groups when more than one of these groups
is present. In the schemes that follow, the symbol X represents "R"
as described above.
[0117] Two of the substituents on adjacent atoms of the aryl or
heteroaryl ring may optionally be replaced with a substituent of
the formula -T-C(O)--(CRR').sub.q--U--, wherein T and U are
independently --NR--, --O--, --CRR'-- or a single bond, and q is an
integer of from 0 to 3. Alternatively, two of the substituents on
adjacent atoms of the aryl or heteroaryl ring may optionally be
replaced with a substituent of the formula
-A-(CH.sub.2).sub.r--B--, wherein A and B are independently
--CRR'--, --O--, --NR--, --S--, --S(O)--, --S(O).sub.2--,
--S(O).sub.2NR'-- or a single bond, and r is an integer of from 1
to 4. One of the single bonds of the new ring so formed may
optionally be replaced with a double bond. Alternatively, two of
the substituents on adjacent atoms of the aryl or heteroaryl ring
may optionally be replaced with a substituent of the formula
--(CRR').sub.s--X--(CR''R''').sub.d--, where s and d are
independently integers of from 0 to 3, and X is --O--, --NR'--,
--S--, --S(O)--, --S(O).sub.2--, or --S(O).sub.2NR'--. The
substituents R, R', R'' and R''' are preferably independently
selected from hydrogen or substituted or unsubstituted
(C.sub.1-C.sub.6)alkyl.
[0118] As used herein, the term "heteroatom" includes oxygen (O),
nitrogen (N), sulfur (S), phosphorus (P), silicon (Si), and
selenium (Se).
[0119] The term "amino" or "amine group" refers to the group
--NR'R'' (or N.sup.+RR'R'') where R, R' and R'' are independently
selected from the group consisting of hydrogen, alkyl, substituted
alkyl, aryl, substituted aryl, aryl alkyl, substituted aryl alkyl,
heteroaryl, and substituted heteroaryl. A substituted amine being
an amine group wherein R' or R'' is other than hydrogen. In a
primary amino group, both R' and R'' are hydrogen, whereas in a
secondary amino group, either, but not both, R' or R'' is hydrogen.
In addition, the terms "amine" and "amino" can include protonated
and quaternized versions of nitrogen, comprising the group
--N.sup.+RR'R'' and its biologically compatible anionic
counterions.
[0120] The term "aqueous solution" as used herein refers to a
solution that is predominantly water and retains the solution
characteristics of water. Where the aqueous solution contains
solvents in addition to water, water is typically the predominant
solvent.
[0121] The term "Carboxyalkyl" as used herein refers to a group
having the general formula --(CH.sub.2).sub.nCOOH wherein n is
1-18.
[0122] The term "activated alkyne," as used herein, refers to a
chemical moiety that selectively reacts with an alkyne reactive
group, such as an azido moiety or an phosphine moiety, on another
molecule to form a covalent chemical bond between the activated
alkyne group and the alkyne reactive group. Examples of
alkyne-reactive groups include azides. "Alkyne-reactive" can also
refer to a molecule that contains a chemical moiety that
selectively reacts with an alkyne group. As used herein activated
alkyne encompasses any terminal alkynes or cyclooctynes
(dipolarophiles) that will react with 1,3-dipoles such as azides in
a facile fashion.
[0123] The term "aqueous solution," as used herein, refers to a
solution that is predominantly water and retains the solution
characteristics of water. Where the aqueous solution contains
solvents in addition to water, water is typically the predominant
solvent.
[0124] The term "azide reactive," as used herein, refers to a
chemical moiety that selectively reacts with an azido modified
group on another molecule to form a covalent chemical bond between
the azido modified group and the azide reactive group. Examples of
azide-reactive groups include alkynes and phospines (e.g. triaryl
phosphine). "Azide-reactive" can also refer to a molecule that
contains a chemical moiety that selectively reacts with an azido
group.
[0125] The term "buffer," as used herein, refers to a system that
acts to minimize the change in acidity or basicity of the solution
against addition or depletion of chemical substances.
[0126] The term "carrier molecule," as used herein, refers to a
biological or a non-biological component that is covalently bonded
to compound of the present invention. Such components include, but
are not limited to, an amino acid, a peptide, a protein, a
polysaccharide, a nucleoside, a nucleotide, an oligonucleotide, a
nucleic acid, a hapten, a psoralen, a drug, a hormone, a lipid, a
lipid assembly, a synthetic polymer, a polymeric microparticle, a
biological cell, a virus and combinations thereof.
[0127] The term, "chemical handle" as used herein refers to a
specific functional group, such as an azide, alkyne, activated
alkyne, phosphite, phosphine, and the like. The chemical handle is
distinct from the reactive group, defined below, in that the
chemical handle are moieties that are rarely found in
naturally-occurring biomolecules and are chemically inert towards
biomolecules (e.g, native cellular components), but when reacted
with an azide- or alkyne-reactive group the reaction can take place
efficiently under biologically relevant conditions (e.g., cell
culture conditions, such as in the absence of excess heat or harse
reactants).
[0128] The term "click chemistry," as used herein, refers to the
Huisgen cycloaddition or the 2,3-dipolar cycloaddition between an
azide and a terminal alkyne to form a 1,2,4-triazole. Such chemical
reactions can use, but are not limited to, simple heteroatomic
organic reactants and are reliable, selective, stereospecific, and
exothermic.
[0129] The term "cycloaddition" as used herein refers to a chemical
reaction in which two or more .pi.-electron systems (e.g.,
unsaturated molecules or unsaturated parts of the same molecule)
combine to form a cyclic product in which there is a net reduction
of the bond multiplicity. In a cycloaddition, the .pi. electrons
are used to form new sigma bonds. The product of a cycloaddition is
called an "adduct" or "cycloadduct". Different types of
cycloadditions are known in the art including, but not limited to,
[3+2] cycloadditions and Diels-Alder reactions. [3+2]
cycloadditions, which are also called 2,3-dipolar cycloadditions,
occur between a 1,3-dipole and a dipolarophile and are typically
used for the construction of five-membered heterocyclic rings. The
terms "[3+2] cycloaddition" also encompasses "copperless" [3+2]
cycloadditions between azides and cyclooctynes and
difluorocyclooctynes described by Bertozzi et al. J. Am. Chem.
Soc., 2004, 126:15046-15047.
[0130] The term "detectable response" as used herein refers to an
occurrence of, or a change in, a signal that is directly or
indirectly detectable either by observation or by instrumentation.
Typically, the detectable response is an occurrence of a signal
wherein the fluorophore is inherently fluorescent and does not
produce a change in signal upon binding to a metal ion or
biological compound. Alternatively, the detectable response is an
optical response resulting in a change in the wavelength
distribution patterns or intensity of absorbance or fluorescence or
a change in light scatter, fluorescence lifetime, fluorescence
polarization, or a combination of the above parameters. Other
detectable responses include, for example, chemiluminescence,
phosphorescence, radiation from radioisotopes, magnetic attraction,
and electron density.
[0131] The term "detectably distinct" as used herein refers to a
signal that is distinguishable or separable by a physical property
either by observation or by instrumentation. For example, a
fluorophore is readily distinguishable either by spectral
characteristics or by fluorescence intensity, lifetime,
polarization or photo-bleaching rate from another fluorophore in
the sample, as well as from additional materials that are
optionally present.
[0132] The term "directly detectable" as used herein refers to the
presence of a material or the signal generated from the material is
immediately detectable by observation, instrumentation, or film
without requiring chemical modifications or additional
substances.
[0133] The term "fluorophore" as used herein refers to a
composition that is inherently fluorescent or demonstrates a change
in fluorescence upon binding to a biological compound or metal ion,
i.e., fluorogenic. Fluorophores may contain substitutents that
alter the solubility, spectral properties or physical properties of
the fluorophore. Numerous fluorophores are known to those skilled
in the art and include, but are not limited to coumarin, cyanine,
benzofuran, a quinoline, a quinazolinone, an indole, a benzazole, a
borapolyazaindacene and xanthenes including fluoroscein, rhodamine
and rhodol as well as other fluorophores described in RICHARD P.
HAUGLAND, MOLECULAR PROBES HANDBOOK OF FLUORESCENT PROBES AND
RESEARCH CHEMICALS (10.sup.th edition, CD-ROM, September 2005),
which is herein incorporated by reference in its entirety.
[0134] The term "isolated", when used herein in reference to a
nucleic acid polymer, means a nucleic acid polymer, which by virtue
of its origin or manipulation is separated from at least some of
the components with which it is naturally associated or with which
it is associated when initially obtained. By "isolated", it is
alternatively or additionally meant that the nucleic acid polymer
of interest is produced or synthesized by the hand of man.
[0135] The term "kit," as used herein, refers to a packaged set of
related components, typically one or more compounds or
compositions.
[0136] The term "label," as used herein, refers to a chemical
moiety or protein that is directly or indirectly detectable (e.g.
due to its spectral properties, conformation or activity) when
attached to a target or compound and used in the present methods,
including reporter molecules and carrier molecules. The label can
be directly detectable (fluorophore) or indirectly detectable
(hapten or enzyme). Such labels include, but are not limited to,
radiolabels that can be measured with radiation-counting devices;
pigments, dyes or other chromogens that can be visually observed or
measured with a spectrophotometer; spin labels that can be measured
with a spin label analyzer; and fluorescent labels (fluorophores),
where the output signal is generated by the excitation of a
suitable molecular adduct and that can be visualized by excitation
with light that is absorbed by the dye or can be measured with
standard fluorometers or imaging systems, for example. The label
can be a chemiluminescent substance, where the output signal is
generated by chemical modification of the signal compound; a
metal-containing substance; or an enzyme, where there occurs an
enzyme-dependent secondary generation of signal, such as the
formation of a colored product from a colorless substrate. The term
label can also refer to a "tag" or hapten that can bind selectively
to a conjugated molecule such that the conjugated molecule, when
added subsequently along with a substrate, is used to generate a
detectable signal. For example, one can use biotin as a tag and
then use an avidin or streptavidin conjugate of horseradish
peroxidate (HRP) to bind to the tag, and then use a colorimetric
substrate (e.g., tetramethylbenzidine (TMB)) or a fluorogenic
substrate such as Amplex Red reagent (Molecular Probes, Inc.) to
detect the presence of HRP. Numerous labels are know by those of
skill in the art and include, but are not limited to, particles,
fluorophores, haptens, enzymes and their colorimetric, fluorogenic
and chemiluminescent substrates and other labels that are described
in RICHARD P. HAUGLAND, MOLECULAR PROBES HANDBOOK OF FLUORESCENT
PROBES AND RESEARCH PRODUCTS (10.sup.th edition, CD-ROM, September
2005), supra.
[0137] The term "linker" or "L", as used herein, refers to a single
covalent bond or a series of stable covalent bonds incorporating
1-30 nonhydrogen atoms selected from the group consisting of C, N,
O, S and P. In addition, the linker covalently attaches a carrier
molecule or solid support to the present azido or activated alkyne
modified nucleotides or nucleic acid polymers. Exemplary linking
members include a moiety that includes --C(O)NH--, --C(O)O--,
--NH--, --S--, --O--, and the like. A "cleavable linker" is a
linker that has one or more cleavable groups that may be broken by
the result of a reaction or condition. The term "cleavable group"
refers to a moiety that allows for release of a portion, e.g., a
reporter molecule, carrier molecule or solid support, of a
conjugate from the remainder of the conjugate by cleaving a bond
linking the released moiety to the remainder of the conjugate. Such
cleavage is either chemical in nature, or enzymatically mediated.
Exemplary enzymatically cleavable groups include natural amino
acids or peptide sequences that end with a natural amino acid. In
addition to enzymatically cleavable groups, it is within the scope
of the present invention to include one or more sites that are
cleaved by the action of an agent other than an enzyme. Exemplary
non-enzymatic cleavage agents include, but are not limited to,
acids, bases, light (e.g., nitrobenzyl derivatives, phenacyl
groups, benzoin esters), and heat. Many cleaveable groups are known
in the art. See, for example, Jung et al., Biochem. Biophys. Acta,
761: 152-162 (1983); Joshi et al., J. Biol. Chem., 265: 14518-14525
(1990); Zarling et al., J. Immunol., 124: 913-920 (1980); Bouizar
et al., Eur. J. Biochem., 155: 141-147 (1986); Park et al., J.
Biol. Chem., 261: 205-210 (1986); Browning et al., J. Immunol.,
143: 1859-1867 (1989). Moreover a broad range of cleavable,
bifunctional (both homo- and hetero-bifunctional) spacer arms are
commercially available. An exemplary cleavable group, an ester, is
cleavable group that may be cleaved by a reagent, e.g. sodium
hydroxide, resulting in a carboxylate-containing fragment and a
hydroxyl-containing product.
[0138] The term "nucleic acid polymer" as used herein refers to a
deoxyribonucleotide or ribonucleotide polymer in either single- or
double-stranded form, including DNA and RNA, and unless otherwise
stated encompasses nucleic acid-like structures with synthetic
backbones, as well as amplification products. In the context of the
present invention, a nucleic acid polymer may be an isolated
molecule, present in an amplification reaction or present in a
hybridization reaction.
[0139] As used herein, the term "nucleotide analogue" refers to a
molecule that is structurally similar to a natural nucleotide and
that can function in a similar manner as the naturally occurring
nucleotide (e.g., exhibits similar ability to base pair with one of
the naturally occurring bases). The term "nucleoside analogue", as
used herein, refers to a molecule that is structurally similar to a
natural nucleoside and that can function in a similar manner as the
naturally occurring nucleoside (e.g., exhibits similar ability to
be incorporated into DNA by DNA replication). The term "nucleotide"
refers to a monomeric unit of DNA or RNA containing a sugar moiety
(pentose), a phosphate or polyphosphate and a nitrogenous
heterocyclic base. The base is linked to the sugar moiety via the
glycosidic carbon (i.e., the 1'-carbon of the pentose) and that
combination of base and sugar is called a "nucleoside". The base
characterizes the nucleotide (or nucleoside) with the four bases of
DNA being adenine (or A), guanine (G), cytosine (C) and thymine
(T), and the four bases of RNA being adenine, guanine, cytosine,
and uracil (U). In certain embodiments of the present invention a
nucleotide analogue (or nucleoside analogue) comprises a chemical
handle and as used herein also referred to as "modified
nucleotides" or "modified nucleic acid polymers".
[0140] The term "reactive group" as used herein refers to a group
that is capable of reacting with another chemical group to form a
covalent bond, i.e. is covalently reactive under suitable reaction
conditions, and generally represents a point of attachment for
another substance. As used herein, reactive groups refer to
chemical moieties generally found in biological systems and that
react under normal biological conditions, these are herein
distinguished from the chemical handel, defined above, the azido
and activated alkyne moieties of the present invention. As referred
to herein the reactive group is a moiety, such as carboxylic acid
or succinimidyl ester, that is capable of chemically reacting with
a functional group on a different compound to form a covalent
linkage. Reactive groups generally include nucleophiles,
electrophiles and photoactivatable groups.
[0141] The term "reporter molecule" refers to any moiety capable of
being attached to a carrier molecule or solid support, such as a
modified nucleotide or nucleic acid polymer, and detected either
directly or indirectly. Reporter molecules include, without
limitation, a chromophore, a fluorophore, a fluorescent protein, a
phosphorescent dye, a tandem dye, a particle, a hapten, an enzyme
and a radioisotope. Preferred reporter molecules include
fluorophores, fluorescent proteins, haptens, and enzymes.
[0142] The term "sample" as used herein refers to any material that
may contain an analyte for detection or quantification or a
modified nucleotide or nucleic acid polymer. The analyte may
include a reactive group, e.g., a group through which a compound of
the invention can be conjugated to the analyte. The sample may also
include diluents, buffers, detergents, and contaminating species,
debris and the like that are found mixed with the target.
Illustrative examples include urine, sera, blood plasma, total
blood, saliva, tear fluid, cerebrospinal fluid, secretory fluids
from nipples and the like. Also included are solid, gel or sol
substances such as mucus, body tissues, cells and the like
suspended or dissolved in liquid materials such as buffers,
extractants, solvents and the like. Typically, the sample is a live
cell, a biological fluid that comprises endogenous host cell
proteins, nucleic acid polymers, nucleotides, oligonucleotides,
peptides and buffer solutions. The sample may be in an aqueous
solution, a viable cell culture or immobilized on a solid or semi
solid surface such as a polyacrylamide gel, membrane blot or on a
microarray.
[0143] The term "solid support," as used herein, refers to a
material that is substantially insoluble in a selected solvent
system, or which can be readily separated (e.g., by precipitation)
from a selected solvent system in which it is soluble. Solid
supports useful in practicing the present invention can include
groups that are activated or capable of activation to allow
selected one or more compounds described herein to be bound to the
solid support.
[0144] The term "Staudinger ligation" as used herein refers to a
chemical reaction developed by Saxon and Bertozzi (E. Saxon and C.
Bertozzi, Science, 2000, 287: 2007-2010) that is a modification of
the classical Staudinger reaction. The classical Staudinger
reaction is a chemical reaction in which the combination of an
azide with a phosphine or phosphite produces an aza-ylide
intermediate, which upon hydrolysis yields a phosphine oxide and an
amine. A Staudinger reaction is a mild method of reducing an azide
to an amine; and triphenylphosphine is commonly used as the
reducing agent. In a Staudinger ligation, an electrophilic trap
(usually a methyl ester) is appropriately placed on a
triarylphosphine aryl group (usually ortho to the phosphorus atom)
and reacted with the azide, to yield an aza-ylide intermediate,
which rearranges in aqueous media to produce a compound with amide
group and a phosphine oxide function. The Staudinger ligation is so
named because it ligates (attaches/covalently links) the two
starting molecules together, whereas in the classical Staudinger
reaction, the two products are not covalently linked after
hydrolysis.
[0145] The terms "structural integrity of the [nucleic acid] is not
reduced" or "preservation of the structural integrity of the
[nucleic acid]", as used herein, means that either: 1) when
analyzed by gel electrophoresis and detection (such as staining), a
band or spot arising from the labeled nucleic acid is not reduced
in intensity by more than 20%, and preferably not reduced by more
than 10%, with respect to the corresponding band or spot arising
from the same amount of the electrophoresed unlabeled nucleic acid,
arising from the labeled nucleic acid analyzed; or 2) when analyzed
by gel electrophoresis, a band or spot arising from the labeled
nucleic acid is not observed to be significantly less sharp than
the corresponding band or spot arising from the same amount of the
electrophoresed unlabeled nucleic acid, where " significantly less
sharp" (synonymous with "significantly more diffuse") means the
detectable band or spot takes up at least 5% more, preferably 10%
more, more preferably 20% more area on the gel than the
corresponding unlabeled nucleic acid. Other reproducible tests for
structural integrity of labeled nucleic acids include, without
limitation detection of released amino acids or peptides, or mass
spectrometry.
[0146] In general, for ease of understanding the present invention,
the metabolic and enzymatic labeling of nucleic acids with azide
moieties, alkyne moieties or phosphine, and the chemical labeling
of such moieties with azide reactive moieties, alkyne reactive
moieties or phosphine reactive moieties will first be described in
detail. This will be followed by some embodiments in which such
labeled nucleic acids can be detected, isolated and/or analyzed.
Exemplified methods are then disclosed.
Labeling of Nucleic Acid Polymer using [3+2] Cycloaddition
[0147] The nucleic acid polymers produced according to methods
described herein, or utilized in methods described herein, are
single- or double-stranded deoxyribonucleotide or ribonucleotide
polymers. As will be appreciated by one of ordinary skill in the
art, the nucleic acid polymers can be polynucleotides of any of a
wide range of sizes including short oligonucleotides comprising at
least about 8 nucleotides as well as full genomic DNA
molecules.
[0148] Some of the labeling methods described herein generally
include a [3+2] cycloaddition between a first reactive unsaturated
group on a nucleotide incorporated into a nucleic acid polymer and
a second reactive unsaturated group attached to a reporter
molecule, a carrier molecule and/or a solid support. Thus, in one
aspect the modified nucleic acid polymer comprises an azido group
with reacts with an activated alkyne on a reporter molecule, a
carrier molecule and/or a solid support to form a covalent bond. In
another aspect the modified nucleic acid polymer comprises an
activated alkynes that reacts with an azido moiety on reporter
molecule, a carrier molecule and/or a solid support to form a
covalent bond.
[0149] As described herein the tagging/labeling of nucleic acid
polymers, also referred to herein as nucleic acids, utilize the
incorporation of a bioorthoganol moieties into a nucleic acid
polymer followed by chemical attachment of a label. The
bioorthoganol moieties can be incorporated into a nucleic acid
using in vitro extension and/or amplification techniques including
but not limited to, polymerase chain reaction (PCR), ligation-based
thermocycling approaches, reverse transcription-PCR, real-time PCR,
linear amplification techniques and isothermal DNA amplification
techniques such as, by way of example only, real-time strand
displacement amplification (SDA), rolling-circle amplification
(RCA), multiple-displacement amplification (MDA), Q-beta replicase
amplification, automated Q-beta replicase amplification assay and
other RNA polymerase mediated techniques such as, for example,
nucleic acid sequence based amplification or NASBA and
transcription mediated amplification (TMA). In certain embodiments,
such bioorthoganol moieties are incorporated using telomerase based
incorporation. These bioorthogonol moieties are non-native,
non-perturbing chemical handles possessing unique chemical
functionality that can be modified through highly selective
reactions. Examples of such moieties includes, but is not limited
to hyrazide and aminooxy derivatives, azides that can be
selectively modified with phosphines (Staudinger ligation), azides
that can be selectively modified with activated alkynes, and azides
that can be selectively modified with terminal alkynes ("click"
chemistry). The nucleic acids in which such bioorthoganol moieties
can be incorporated into include, but are not limited to, DNA, RNA
and oligonuceotides.
[0150] In certain embodiments the isothermal DNA amplification
technology using Helicase Dependent amplification is used to
incorporate bioorthoganol moieties into a nucleic acid. Examples of
such Helicase Dependent amplification include: [0151] (a) mHDA
technology which amplifies DNA at a single temperature (37.degree.
C.) by utilizing the unwinding activity of a DNA Helicase and a DNA
synthesis activity of a DNA polymerase; [0152] (b) tHDA technology
which amplifies DNA at a single temperature (65.degree. C.) by
utilizing the unwinding activity of a thermo tolerant DNA Helicase
and a DNA synthesis activity of Bst DNA polymerase (from Bacillus
stearoethermophillus); [0153] (c) circular HDA in which DNA
amplification uses T7 Helicase and T7DNA polymerase and is similar
to rolling circle DNA amplification. Other accessory proteins in
this platform include T7 single strand DNA binding protein. This
platform can be used for in vitro amplification of plasmid or
covalent closed circular DNA. This technology has significant use
in clinical diagnostics and molecular biology e.g., in DNA
sequencing and mutagenesis, and [0154] d) rt-HDA takes advantage of
the reverse transcriptase activity of reverse transcriptase under
constant temperature conditions combined with polymerase activity
of Bst polymerase.
[0155] In certain embodiments the isothermal DNA amplification
technology Strand Displacement Amplification (SDA) is used to
incorporate bioorthoganol moieties into a nucleic acid. In SDA a
primer contains a restriction site is annealed to template.
Amplification primers are then annealed to 5' adjacent sequences
(form a nick) and start amplification at a fixed temperature. Newly
synthesized DNA are nicked by a restriction enzyme, polymerase
starts amplification again, displacing the newly synthesized
strands. 10.sup.9 copies of DNA can be made in one reaction.
[0156] In certain embodiments the isothermal DNA amplification
technology Loop mediated Isothermal DNA amplification is used to
incorporate bioorthoganol moieties into a nucleic acid.
Loop-mediated Isothermal Amplification (LAMP) uses 4 primers, which
recognize 6 distinct regions on the target gene and a DNA
polymerase with strand displacement activity to carry out reaction
under isothermal condition. Amplification and detection of gene can
be completed in a single step, by incubating the mixture of
samples, primers, DNA polymerase with strand displacement activity
and substrate at a constant temperature between 60-65.degree. C. It
provides high amplification efficiency, with DNA being amplified
109-1010 times in 15-60 minutes. Because of its high specificity,
the presence of amplified product can indicate the presence of
target gene. LAMP also uses Bst DNA polymerase.
[0157] In certain embodiments, rolling circle DNA
amplification/Phi29 based DNA whole genome (or partial genome)
amplification is used to incorporate bioorthoganol moieties into a
nucleic acid. This method uses phi 29 DNA polymerase and can
amplify DNA (Linear or circular) with high fidelity and efficiency.
Such amplification methods can be use for the preparation of DNA
probes from in situ hybridizations.
[0158] Nucleic acid polymers containing at least one nucleotide
analogue may be alternatively be prepared by any of a variety of
methods well known in the art including synthetic and enzymatic
methods (J. Sambrook et al., "Molecular Cloning: A Laboratory
Manual", 1989, 2.sup.nd Ed., Cold Spring Harbour Laboratory Press:
New York, N.Y.; "PCR Protocols: A Guide to Methods and
Applications", 1990, M. A. Innis (Ed.), Academic Press: New York,
N.Y.; P. Tijssen "Hybridization with Nucleic Acid
Probes--Laboratory Techniques in Biochemistry and Molecular Biology
(Parts I and II)", 1993, Elsevier Science; "PCR Strategies", 1995,
M. A. Innis (Ed.), Academic Press: New York, N.Y.; and "Short
Protocols in Molecular Biology", 2002, F. M. Ausubel (Ed.),
5.sup.th Ed., John Wiley & Sons: Secaucus, N.J.).
[0159] Nucleic acids used in the methods described herein may be
prepared using automated, solid-phase procedure based on the
phosphoramidite approach. In such a method, each nucleotide
(including nucleotide analogues) is individually added to the
5'-end of the growing polynucleotide chain, which is attached at
the 3'-end to a solid support. The added nucleotides are in the
form of trivalent 3'-phosphoramidites that are protected from
polymerization by a dimethoxytriyl (or DMT) group at the
5'-position. After base-induced phosphoramidite coupling, mild
oxidation to give a pentavalent phosphotriester intermediate, DMT
removal provides a new site for polynucleotide elongation. The
nucleic acid polymers are then cleaved off the solid support, and
the phosphodiester and exocyclic amino groups are deprotected with
ammonium hydroxide. These syntheses may be performed on oligo
synthesizers such as those commercially available from Perkin
Elmer/Applied Biosystems, Inc (Foster City, Calif.), DuPont
(Wilmington, Del.) or Milligen (Bedford, Mass.).
[0160] As will be appreciated by one of ordinary skill in the art,
nucleic acid polymers of the described herein may be prepared
either by a pre-synthetic modification method (i.e., incorporation
of nucleotides analogues into the nucleic acid molecule) or a
post-synthetic modification method (i.e., modification of naturally
occurring nucleotides to nucleotide analogues in the nucleic acid
molecule). Alternatively, nucleotide analogues can be incorporated
into the DNA of cells or living systems by DNA replication, or into
RNA by reaction, as described below.
[0161] Thus, in certain embodiments are provided methods for making
modified nucleic acid polymers and the polymers themselves.
[0162] In one aspect is a method for making an azido, alkyne or
phosphine modified nucleic acid polymer, wherein the method
comprises: [0163] incubating at least one azido, alkyne or
phosphine modified nucleotide in the presence of a nucleic acid
amplification enzyme to form an azido, alkyne or phosphine modified
nucleic acid polymer. In one aspect, the nucleic acid enzyme is a
DNA polymerase and in another aspect the nucleic acid enzyme is a
RNA polymerase. We have unexpectedly found that incorporation of
azido modified nucleotides into a nucleic acid polymer increases
the melting temperature of the polymer under hybridization
conditions. Thus, any application wherein a probes could be
utilized that has an increased melting temperature is invisioned in
the present methods of using the modified nucleic acid
polymers.
[0164] Isolation or purification of the nucleic acid polymers of
the present invention, where necessary, may be carried out by any
of a variety of methods well-known in the art. Purification of
nucleic acid polymers is typically performed either by native
acrylamide gel electrophoresis, agarose electrophoresis or by size
exclusion or by anion-exchange HPLC as described, for example by J.
D. Pearson and F. E. Regnier (J. Chrom., 1983, 255: 137-149) or by
reverse phase HPLC (G. D. McFarland and P. N. Borer, Nucleic Acids
Res., 1979, 7: 1067-1080).
[0165] If desired, the sequence of synthetic nucleic acid polymers
can be verified using any suitable sequencing method including, but
not limited to, chemical degradation (A. M. Maxam and W. Gilbert,
Methods of Enzymology, 1980, 65: 499-560), matrix-assisted laser
desorption ionization time-of-flight (MALDI-TOF) mass spectrometry
(U. Pieles et al., Nucleic Acids Res., 1993, 21: 3191-3196), mass
spectrometry following alkaline phosphatase and exonuclease
digestions (H. Wu and H. Aboleneen, Anal. Biochem., 2001, 290:
347-352), and the like.
[0166] Provided herein are methods and compositions for detection,
isolation and/or analysis of labeled nucleic acids facilitated by
the incorporation of nucleotides comprising azide moieties, alkyne
moieties, or phosphine moieties. In particular, presented are a
novel methods for A) amplification methods for incorporating a
nucleotide comprising an azide moiety into a nucleic acid, B)
labeling such azido modified nucleic acids in solution followed by
separation using methods known in the art for separating nucleic
acids, C) labeling immobilized modified nucleic acids and D) novel
methods for telomerase based assays using such modified nucleic
acids. In addition, these azide, activated alkyne or phosphine
modified nucleic acids can form conjugates with reporter molecules,
carrier molecules and/or solid supports using methods provided
herein. The reporter molecules can include, but are not limited to
labels, while the solid supports can include, but are not limited
to, solid support resins, microtiter plates and microarray slides.
The carrier molecules can include, but are not limited to, affinity
tags, nucleotides, oligonucleotides and polymers. In certain
embodiments, the nucleic acids are modified with alkyne containing
nucleotides, and in other embodiments, the nucleic acids are
modified with phosphine containing nucleotides.
Nucleoside and Nucleotide Analogues
[0167] Nucleoside analogues (or nucleotide analogues) suitable for
use in the methods described herein include any nucleoside analogue
(or nucleotide analogue), as defined herein, that contains a
reactive bioorthoganol moiety that can undergo a [3+2]
cycloaddition or Staudinger ligation. In some embodiments, the
reactive bioorthoganol moiety is carried by the base of the
nucleoside (or nucleotide). The base carrying the reactive
bioorthoganol moiety can be a purine (e.g., adenine or guanine) or
a pyrimidine (e.g., cytosine, uracil or thymine). In certain
embodiments, the base is uracil; in some such embodiments, uracil
carries the reactive bioorthoganol moiety on the 5-position. In
certain embodiments, the base is adenine; in some such embodiments,
adenine carries the reactive bioorthoganol moiety. In certain
embodiments, the bioorthoganol moiety is indirectly attached to the
base, while in other embodiments the bioorthoganol moiety is
directly covalently attached to the base. Non-limiting examples of
the nucleoside analogues that may be used in the methods described
herein include 5-ethynyl-2'deoxyuracil (also termed herein
ethynyluracil or EdU) and 5-azido-2'-deoxyuracil (also termed
herein azidouracil or AdU) as well as their triphosphate and
phosphoramidite forms. EdU can be synthesized essentially as
described by C.-S. Yu and F. Oberdorfer, Synlett, 2000, 1: 86-88;
and AdU can be synthesized using a method similar to that described
in P. Sunthankar et al., Anal. Biochem., 1998, 258: 195-201 to
synthesize azido-dUMP. EdU is also commercially available from
Berry and Associates, Inc. (Dexter, Mich.).
[0168] In certain embodiments, the reactive bioorthoganol moiety is
carried by the sugar (ribose and deoxyribose) of the nucleoside (or
nucleotide). In certain embodiments, the bioorthoganol moiety is
indirectly attached to the sugar, while in other embodiments the
bioorthoganol moiety is directly covalently attached to the sugar.
In certain embodiments, the nucleotide is a nucleotide
monophosphate with the reactive bioorthogal moiety attached to the
phosphate moiety. In certain embodiments, the nucleotide is a
nucleotide diphosphate with the reactive bioorthoganol moiety
attached to the terminal phosphate moiety. In certain embodiments,
the nucleotide is a nucleotide triphosphate with the reactive
bioorthoganol moiety attached to the terminal phosphate moiety. The
sugar carrying the reactive bioorthoganol moiety can covalently
attached to a purine (e.g., adenine or guanine) or a pyrimidine
(e.g., cytosine, uracil or thymine). In certain embodiments, the
base is uracil, while in other embodiments the base is adenine.
Non-limiting examples of the nucleotide triphosphate analogues that
may be used in the methods described herein (see FIG. 1) include
N.sub.3-dATP (azide-dATP), N.sub.3-dUTP (azide-dUTP), N.sub.3-dTTP,
N.sub.3-dGTP, N.sub.3-dCTP, E-dATP (ethynyl-dATP) and E-dUTP
(ethynyl-dUTP), E-dGTP, E-dCTP, E-dTTP.
[0169] The reactive bioorthoganol moiety can be a 1,3-dipole such
as a nitrile oxide, an azide, a diazomethane, a nitrone or a
nitrile imine. In certain embodiments, the 1,3-dipole is an azide.
Alternatively, the reactive bioorthoganol moiety can be a
dipolarophile such as an alkene (e.g., vinyl, propylenyl, and the
like) or an alkyne (e.g., ethynyl, propynyl, and the like). In
certain embodiments, the dipolarophile is an alkyne, such as, for
example, an ethynyl group.
Chemical modification of Nucleic Acids Containing Azide, Alkyne or
Phosphine Moieties
[0170] The nucleic acids that can be chemically modified using the
methods described herein contain azide moieties, alkyne moieties or
phosphine moieties that are incorporated into nucleic acids using
various amplification techniques utilizing nucleobases that contain
azide moieties, alkyne moieties or phosphine moieties. Such
nucleobases have been chemical synthesized as described herein.
These azide moieties, alkyne moieties and phosphine moieties are
non-native, non-perturbing bioorthogonol chemical moieties that
possess unique chemical functionality that can be modified through
highly selective reactions. Non-limiting examples of such reactions
used in the methods described herein are shown in FIG. 2, wherein
the chemical labeling of nucleic acids that contain azide moieties
or alkyne moieties utilize Copper(I)-catalyzed Azide-Alkyne
Cycloaddition, also referred to herein as "click" chemistry, the
chemical labeling of nucleic acids that contain azide moieties or
phosphine moieties utilize Staudinger ligation, and the chemical
labeling of nucleic acids that contain activated-alkyne moieties or
activated-alkyne reactive moieties.
"Click" Chemistry
[0171] Azides and terminal or internal alkynes can undergo a
1,3-dipolar cycloaddition (Huisgen cycloaddition) reaction to give
a 1,2,3-triazole. However, this reaction requires long reaction
times and elevated temperatures. Alternatively, azides and terminal
alkynes can undergo Copper(I)-catalyzed Azide-Alkyne Cycloaddition
(CuAAC) at room temperature. Such copper(I)-catalyzed azide-alkyne
cycloadditions, also known as "click" chemistry, is a variant of
the Huisgen 1,3-dipolar cycloaddition wherein organic azides and
terminal alkynes react to give 1,4-regioisomers of 1,2,3-triazoles.
Examples of "click" chemistry reactions are described by Sharpless
et al. (U.S. Patent Application Publication No. 20050222427,
published Oct. 6, 2005, PCT/US03/17311; Lewis W G, et al.,
Angewandte Chemie-Int'l Ed. 41 (6): 1053; method reviewed in Kolb,
H. C., et al., Angew. Chem. Inst. Ed. 2001, 40:2004-2021), which
developed reagents that react with each other in high yield and
with few side reactions in a heteroatom linkage (as opposed to
carbon-carbon bonds) in order to create libraries of chemical
compounds. As described herein, "click" chemistry is used in the
methods for labeling nucleic acids.
[0172] The copper used as a catalyst for the "click chemistry
reaction used in the methods described herein to conjugate a label
(reporter group, solid support or carrier molecule) to a nucleic
acid is in the Cu (I) reduction state. The sources of copper(I)
used in such copper(I)-catalyzed azide-alkyne cycloadditions can be
any cuprous salt including, but not limited to, cuprous halides
such as cuprous bromide or cuprous iodide. However, this
regioselective cycloaddition can also be conducted in the presence
of a metal catalyst and a reducing agent. In certain embodiments,
copper can be provided in the Cu (II) reduction state (for example,
as a salt, such as but not limited to Cu(NO.sub.3).sub.2
Cu(OAc).sub.2 or CuSO.sub.4), in the presence of a reducing agent
wherein Cu(I) is formed in situ by the reduction of Cu(II). Such
reducing agents include, but are not limited to, ascorbate,
Tris(2-Carboxyethyl)Phosphine (TCEP), 2,4,6-trichlorophenol (TCP),
NADH, NADPH, thiosulfate, metallic copper, quinone, hydroquinone,
vitamin K.sub.1, glutathione, cysteine, 2-mercaptoethanol,
dithiothreitol, Fe.sup.1+, Co.sup.2+, or an applied electric
potential. In other embodiments, the reducing agents include metals
selected from Al, Be, Co, Cr, Fe, Mg, Mn, Ni, Zn, Au, Ag, Hg, Cd,
Zr, Ru, Fe, Co, Pt, Pd, Ni, Rh, and W.
[0173] The copper(I)-catalyzed azide-alkyne cycloadditions for
labeling nucleic acids can be performed in water and a variety of
solvents, including mixtures of water and a variety of (partially)
miscible organic solvents including alcohols, dimethyl sulfoxide
(DMSO), dimethyl formamide (DMF), tert-butanol (tBuOH) and
acetone.
[0174] Without limitation to any particular mechanism, copper in
the Cu (I) state is a preferred catalyst for the
copper(I)-catalyzed azide-alkyne cycloadditions, or "click"
chemistry reactions, used in the methods described herein. Certain
metal ions are unstable in aqueous solvents, by way of example
Cu(I), therefore stabilizing ligands/chelators can be used to
improve the reaction. In certain embodiments at least one copper
chelator is used in the methods described herein, wherein such
chelators binds copper in the Cu (I) state. In certain embodiments
at least one copper chelator is used in the methods described
herein, wherein such chelators binds copper in the Cu(II) state. In
certain embodiments, the copper (I) chelator is a 1,10
phenanthroline-containing copper (I) chelator. Non-limiting
examples of such phenanthroline-containing copper (I) chelators
include, but are not limited to, bathophenanthroline disulfonic
acid (4,7-diphenyl-1,10-phenanthroline disulfonic acid) and
bathocuproine disulfonic acid (BCS;
2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline disulfonate). Other
chelators used in such methods include, but are not limited to,
N-(2-acetamido)iminodiacetic acid (ADA), pyridine-2,6-dicarboxylic
acid (PDA), S-carboxymethyl-L-cysteine (SCMC), trientine,
tetra-ehylenepolyamine (TEPA),
NNNN-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN), EDTA,
neocuproine, N-(2-acetamido)iminodiacetic acid (ADA),
pyridine-2,6-dicarboxylic acid (PDA), S-carboxymethyl-L-cysteine
(SCMC), tris-(benzyl-triazolylmethyl)amine (TBTA), or a derivative
thereof. Most metal chelators, a wide variety of which are known in
the chemical, biochemical, and medical arts, are known to chelate
several metals, and thus metal chelators in general can be tested
for their function in 1,3 cycloaddition reactions catalyzed by
copper. In certain embodiments, histidine is used as a chelator,
while in other embodiments glutathione is used as a chelator and a
reducing agent.
[0175] The concentration of the reducing agents used in the "click"
chemistry reaction described herein can be in the micromolar to
millimolar range. In certain embodiments the concentration of the
reducing agent is from about 100 micromolar to about 100
millimolar. In other embodiments the concentration of the reducing
agent is from about 10 micromolar to about 10 millimolar. In other
embodiments the concentration of the reducing agent is from about 1
micromolar to about 1 millimolar.
[0176] In certain embodiments, the methods describe herein for
labeling nucleic acids using "click" chemistry, at least one copper
chelator is added after copper(II) used in the reaction has been
contacted with a reducing agent. In other embodiments, at least one
copper chelator can be added immediately after contacting
copper(II) with a reducing agent. In other embodiments, the copper
chelator(s) is added between about five seconds and about
twenty-four hours after copper(II) and a reducing agent have been
combined in a reaction mixture. In other embodiments, at least one
copper chelator can be added any time to a reaction mixture that
includes copper(II) and a reducing agent, such as, by way of
example only, immediately after contacting copper(II) and a
reducing agent, or within about five minutes of contacting
copper(II) and a reducing agent in the reaction mixture. In some
embodiments, at least one copper chelator can be added between
about five seconds and about one hour, between about one minute and
about thirty minutes, between about five minutes and about one
hour, between about thirty minutes and about two hours, between
about one hour and about twenty-four hours, between about one hour
and about five hours, between about two hours and about eight
hours, after copper(II) and a reducing agent have been combined for
use in a reaction mixture.
[0177] In other embodiments, one or more copper chelators can be
added more than once to such "click" chemistry reactions. In
embodiments in which more than one copper chelator is added to a
reaction, two or more of the copper chelators can bind copper in
the Cu (I) state or, one or more of the copper chelators can bind
copper in the Cu (I) state and one or more additional chelators can
bind copper in the Cu (II) state. In certain embodiments, one or
more copper chelators can be added after the initial addition of a
copper chelator to the "click" chemistry reaction. In certain
embodiments, the one or more copper chelators added after the
initial addition of a copper chelator to the reaction can be the
same or different from a copper chelator added at an earlier time
to the reaction.
[0178] The concentration of a copper chelator used in the "click"
chemistry reaction described herein can be determined and optimized
using methods well known in the art, including those disclosed
herein using "click" chemistry to label nucleic acids followed by
detecting such labeled nucleic acids to determine the efficiency of
the labeling reaction and the integrity of the labeled nucleic
acid(s). In certain embodiments, the chelator concentrations used
in the methods described herein is in the micromolar to millimolar
range, by way of example only, from 1 micromolar to 100 millimolar.
In certain embodiments the chelator concentration is from about 10
micromolar to about 10 millimolar. In other embodiments the
chelator concentration is from about 50 micromolar to about 10
millimolar. In other embodiments the chelator, can be provided in a
solution that includes a water miscible solvent such as, alcohols,
dimethyl sulfoxide (DMSO), dimethyl formamide (DMF), tert-butanol
(tBuOH) and acetone. In other embodiments the chelator, can be
provided in a solution that includes a solvent such as, for
example, dimethyl sulfoxide (DMSO) or dimethylformamide (DMF).
[0179] In certain embodiments of the methods for labeling nucleic
acids utilizing "click" chemistry described herein, the nucleic
acid can possess an azide moiety, whereupon the label possesses an
alkyne moiety, whereas in other embodiments the nucleic acid can
possess an alkyne moiety, and the label possesses an azide
moiety.
[0180] In certain embodiments are provided methods for forming a
modified nucleic acid polymer conjugate, wherein the method
comprises:
[0181] incorporating an azide modified nucleotide into the nucleic
acid polymer by contacting the azide modified nucleotide nucleotide
with at least one other nucleotide in the presence of a DNA
amplification enzyme to form an azide modified nucleic acid
polymer; and
[0182] contacting the azide modified nucleic acid polymer with a
reporter molecule, carrier molecule or solid support that comprises
an activated or terminal alkyne or phosphine moiety to form a
nucleic acid polymer-reporter molecule, carrier molecule, solid
support conjugate.
[0183] In an alternative embodiment are provided methods for
forming a modified nucleic acid polymer conjugate, wherein the
method comprises:
[0184] incorporating a terminal alkyne modified nucleotide into the
nucleic acid polymer by contacting the terminal alkyne modified
nucleotide with at least one other nucleotide in the presence of a
DNA amplification enzyme to form a terminal alkyne modified nucleic
acid polymer; and
[0185] contacting the terminal alkyne modified nucleic acid polymer
with a reporter molecule, carrier molecule or solid support that
comprises an azido moiety to form a nucleic acid polymer-reporter
molecule, carrier molecule, solid support conjugate.
Staudinger Ligation
[0186] The Staudinger reaction, which involves reaction between
trivalent phosphorous compounds and organic azides (Staudinger et
al. Helv. Chim. Acta 1919, 2, 635), has been used for a multitude
of applications. (Gololobov et al. Tetrahedron 1980, 37, 437);
(Gololobov et al. Tetrahedron 1992, 48, 1353). There are almost no
restrictions on the nature of the two reactants. The Staudinger
ligation is a modification of the Staudinger reaction in which an
electrophilic trap (usually a methyl ester) is placed on a triaryl
phosphine. In the Staudinger ligation, the aza-ylide intermediate
rearranges, in aqueous media, to produce an amide linkage and the
phosphine oxide, ligating the two molecules together, whereas in
the Staudinger reaction the two products are not covalently linked
after hydrolysis. Such ligations have been described in U.S. Patent
Application No. 20060276658. In certain embodiments, the phosphine
can have a neighboring acyl group such as an ester, thioester or
N-acyl imidazole (i.e. a phosphinoester, phosphinothioester,
phosphinoimidazole) to trap the aza-ylide intermediate and form a
stable amide bond upon hydrolysis. In certain embodiments, the
phosphine can be a di- or triarylphosphine to stabilize the
phosphine. The phosphines used in the Staudinger ligation methods
described herein to conjugate a label to a nucleic acid include,
but are not limited to, cyclic or acyclic, halogenated,
bisphosphorus, or even polymeric. Similarly, the azides can be
alkyl, aryl, acyl or phosphoryl. In certain embodiments, such
ligations are carried out under oxygen-free anhydrous
conditions.
[0187] In certain embodiments of the methods for labeling nucleic
acid utilizing Staudinger ligation described herein, the nucleic
acid can possess an azide moiety, whereupon the label possesses a
phosphine moiety, whereas in other embodiments the nucleic acid can
possess a phosphine moiety, and the label possesses an azide
moiety.
[0188] In certain embodiments are provided methods for forming a
modified nucleic acid polymer conjugate, wherein the methods
comprises:
[0189] incorporating a phosphine modified nucleotide into the
nucleic acid polymer by contacting the phosphine modified
nucleotide nucleotide with at least one other nucleotide in the
presence of a DNA amplification enzyme to form a phosphine modified
nucleic acid polymer; and
[0190] contacting the phosphine modified nucleic acid polymer with
a reporter molecule, carrier molecule or solid support that
comprises an azido moiety to form a nucleic acid polymer-reporter
molecule, carrier molecule, solid support conjugate.
Activated-Alkyne Chemistry
[0191] Azides and alkynes can undergo catalyst-free [3+2]
cycloaddition by a using the reaction of activated alkynes with
azides. Such catalyst free [3+2] cycloaddition can be used in
methods described herein to conjugate a label (reporter molecule,
solid support or carrier molecule) to a nucleic acid. Alkynes can
be activated by ring strain such as, by way of example only, eight
membered ring structures, appending electron-withdrawing groups to
such alkyne rings, or alkynes can be activated by the addition of a
Lewis acid such as, by way of example only, Au(I) or Au(III).
[0192] In certain embodiments of the methods for labeling nucleic
acids utilizing activated alkynes described herein, the nucleic
acid can possess an azide moiety, whereupon the label possesses an
activated alkyne moiety, whereas in other embodiments the nucleic
acid can possess an activated alkyne moiety, and the label
possesses an azide moiety.
[0193] After nucleic acids have been modified with azide moieties,
alkyne moieties or phosphine moieties, they can be reacted under
appropriate conditions to form conjugates with reporter molecules,
solid supports or carrier molecules. In the methods and
compositions described herein the azide moiety, alkyne moiety or
phosphine moiety is used as a reactive functional group or chemical
handle on the modified nucleic acid wherein an azide reactive
moiety on a reporter molecule, a solid support or a carrier
molecule, or an alkyne reactive moiety on a reporter molecule, a
solid support or a carrier molecule, or a phosphine reactive moiety
on a reporter molecule, a solid support or a carrier molecule is
reacted with the modified nucleic acid to form a covalent conjugate
comprising the nucleic acid and at least one reporter molecule, at
least one solid support and/or at least one carrier molecule.
[0194] In certain embodiments, two azide-reactive groups are used
to label nucleic acids: the first is an alkyne moiety used in a
"click" chemistry reaction, and the second is a phosphine, such as
a triarylphosphine, used in a Staudinger ligation. In one
embodiment, "click" chemistry is utilized to form a conjugate with
a nucleic acid polymer containing an azide moiety and a reporter
molecule, solid support or carrier molecule, wherein the reporter
molecule, solid support and carrier molecule contain an alkyne
moiety. In another embodiment, "click" chemistry is utilized to
form a conjugate with a nucleic acid polymer containing an alkyne
moiety and a reporter molecule, solid support and/or carrier
molecule, wherein the reporter molecule, solid support and carrier
molecule contain an azide moiety. In another embodiment, a
Staudinger ligation is utilized to form a conjugate with a nucleic
acid polymer containing an azide moiety and a reporter molecule,
solid support and/or carrier molecule, wherein the reporter
molecule, solid support and carrier molecule contain an triaryl
phosphine moiety. In another embodiment, a Staudinger ligation is
utilized to form a conjugate with a nucleic acid polymer containing
a triaryl phosphine moiety and a reporter molecule, solid support
and/or carrier molecule, wherein the reporter molecule, solid
support and carrier molecule contain an azide moiety. The methods
described herein are not intended to be limited to these two
azide-reactive groups, or chemical reactions, but it is envisioned
that any chemical reaction utilizing an azide-reactive group
attached to a reporter molecule, solid support or carrier molecule
can be used with the azide, alkyne or phosphine modified nucleic
acid polymers described herein.
[0195] In certain embodiments are provided methods for forming a
modified nucleic acid polymer conjugate, wherein the method
comprises:
[0196] incorporating an azide modified nucleotide into the nucleic
acid polymer by contacting the azide modified nucleotide nucleotide
with at least one other nucleotide in the presence of a DNA
amplification enzyme to form an azide modified nucleic acid
polymer; and
[0197] contacting the azide modified nucleic acid polymer with a
reporter molecule, carrier molecule or solid support that comprises
an activated or terminal alkyne or phosphine moiety to form a
nucleic acid polymer-reporter molecule, carrier molecule, solid
support conjugate.
[0198] In an alternative embodiment are provided methods for
forming a modified nucleic acid polymer conjugate, wherein the
method comprises:
[0199] incorporating a terminal alkyne modified nucleotide into the
nucleic acid polymer by contacting the terminal alkyne modified
nucleotide with at least one other nucleotide in the presence of a
DNA amplification enzyme to form a terminal alkyne modified nucleic
acid polymer; and
[0200] contacting the terminal alkyne modified nucleic acid polymer
with a reporter molecule, carrier molecule or solid support that
comprises an azido moiety to form a nucleic acid polymer-reporter
molecule, carrier molecule, solid support conjugate.
[0201] The methods, as described herein, that utilize cycloaddition
reactions to label nucleic acids can be carried out at room
temperature in aqueous conditions with excellent regioselectivity
by the addition of catalytic amounts of Cu(I) salts to the reaction
mixture. See, e.g., Tomoe, et al., (2002) Org. Chem. 67:3057-3064;
and, Rostovtsev, et al., (2002) Angew. Chem. Int. Ed. 41:2596-2599.
The resulting five-membered ring resulting from "click" chemistry
cycloaddition is not generally reversible in reducing environments
and is stable against hydrolysis for extended periods in aqueous
environments. Thus, nucleic acids attached to a labeling agent, a
detection agent, a reporter molecule, a solid support or a carrier
molecule via such five-membered ring are stable.
[0202] The reporter molecules, solid supports and carrier molecules
used in the methods and compositions described herein, can contain
at least one alkyne moiety or at least one phosphine moiety capable
of reacting with an azide moiety. The reporter molecules, solid
supports and carrier molecules used in the methods and compositions
described herein, can contain at least one azide moiety capable of
reacting with an alkyne moiety or a phosphine moiety. The reporter
molecules, solid supports and carrier molecules used in the methods
and compositions described herein, can contain at least one
phosphine moiety capable of reacting with an azide moiety. In
certain embodiments, the phosphine moieties of the reporter
molecules solid supports and carrier molecules described herein are
triarylphosphine moieties.
[0203] In certain embodiments, the reporter molecules used in the
methods and compositions described herein can include, but are not
limited to labels, while the solid supports can include, but are
not limited to, solid support resins, microtiter plates and
microarray slides. The carrier molecules can include, but are not
limited to, affinity tags, nucleotides, oligonucleotides and
polymers.
Reporter Molecules
[0204] The reporter molecules used in the methods and compositions
provided herein include any directly or indirectly detectable
reporter molecule known by one skilled in the art that can be
covalently attached to a modified nucleic acid described herein. In
certain embodiments, the reporter molecules used in the methods and
compositions provided herein include any directly or indirectly
detectable reporter molecule known by one skilled in the art that
can be covalently attached to an azide modified nucleic acid, an
alkyne modified nucleic acid or a phosphine modified nucleic
acid.
[0205] Reporter molecules used in the methods and compositions
described herein can contain, but are not limited to, a
chromophore, a fluorophore, a fluorescent protein, a phosphorescent
dye, a tandem dye, a particle, a hapten, an enzyme and a
radioisotope. In certain embodiments, such reporter molecules
include fluorophores, fluorescent proteins, haptens, and
enzymes.
[0206] A fluorophore used in reporter molecule in the methods and
compositions described herein, can contain one or more aromatic or
heteroaromatic rings, that are optionally substituted one or more
times by a variety of substituents, including without limitation,
halogen, nitro, cyano, alkyl, perfluoroalkyl, alkoxy, alkenyl,
alkynyl, cycloalkyl, arylalkyl, acyl, aryl or heteroaryl ring
system, benzo, or other substituents typically present on
fluorophores known in the art.
[0207] A fluorophore used in reporter molecule in the methods and
compositions described herein, is any chemical moiety that exhibits
an absorption maximum at wavelengths greater than 280 nm, and
retains its spectral properties when covalently attached to a
modified nucleotide such as, by way of example only, an azide, and
alkyne or a phosphine. Fluorophores used as in reporter molecule in
the methods and compositions described herein include, without
limitation; a pyrene (including any of the corresponding derivative
compounds disclosed in U.S. Pat. No. 5,132,432), an anthracene, a
naphthalene, an acridine, a stilbene, an indole or benzindole, an
oxazole or benzoxazole, a thiazole or benzothiazole, a
4-amino-7-nitrobenz-2-oxa-1,3-diazole (NBD), a cyanine (including
any corresponding compounds in U.S. Ser. Nos. 09/968,401 and
09/969,853), a carbocyanine (including any corresponding compounds
in U.S. Ser. Nos. 09/557,275; 09/969,853 and 09/968,401; U.S. Pat.
Nos. 4,981,977; 5,268,486; 5,569,587; 5,569,766; 5,486,616;
5,627,027; 5,808,044; 5,877,310; 6,002,003; 6,004,536; 6,008,373;
6,043,025; 6,127,134; 6,130,094; 6,133,445; and publications WO
02/26891, WO 97/40104, WO 99/51702, WO 01/21624; EP 1 065 250 A1),
a carbostyryl, a porphyrin, a salicylate, an anthranilate, an
azulene, a perylene, a pyridine, a quinoline, a borapolyazaindacene
(including any corresponding compounds disclosed in U.S. Pat. Nos.
4,774,339; 5,187,288; 5,248,782; 5,274,113; and 5,433,896), a
xanthene (including any corresponding compounds disclosed in U.S.
Pat. No. 6,162,931; 6,130,101; 6,229,055; 6,339,392; 5,451,343 and
U.S. Ser. No. 09/922,333), an oxazine (including any corresponding
compounds disclosed in U.S. Pat. No. 4,714,763) or a benzoxazine, a
carbazine (including any corresponding compounds disclosed in U.S.
Pat. No. 4,810,636), a phenalenone, a coumarin (including an
corresponding compounds disclosed in U.S. Pat. Nos. 5,696,157;
5,459,276; 5,501,980 and 5,830,912), a benzofuran (including an
corresponding compounds disclosed in U.S. Pat. Nos. 4,603,209 and
4,849,362) and benzphenalenone (including any corresponding
compounds disclosed in U.S. Pat. No. 4,812,409) and derivatives
thereof. As used herein, oxazines include resorufins (including any
corresponding compounds disclosed in U.S. Pat. No. 5,242,805),
aminooxazinones, diaminooxazines, and their benzo-substituted
analogs.
[0208] Xanthene type fluorophores used in reporter molecule in the
methods and compositions described herein include, but are not
limited to, a fluorescein, a rhodol (including any corresponding
compounds disclosed in U.S. Pat. Nos. 5,227,487 and 5,442,045), or
a rhodamine (including any corresponding compounds in U.S. Pat.
Nos. 5,798,276; 5,846,737; U.S. Ser. No. 09/129,015). As used
herein, fluorescein includes benzo- or dibenzofluoresceins,
seminaphthofluoresceins, or naphthofluoresceins. Similarly, as used
herein rhodol includes seminaphthorhodafluors (including any
corresponding compounds disclosed in U.S. Pat. No. 4,945,171). In
certain embodiments, the fluorophore is a xanthene that is bound
via a linkage that is a single covalent bond at the 9-position of
the xanthene. In other embodiments, the xanthenes include
derivatives of 3H-xanthen-6-ol-3-one attached at the 9-position,
derivatives of 6-amino-3H-xanthen-3-one attached at the 9-position,
or derivatives of 6-amino-3H-xanthen-3-imine attached at the
9-position.
[0209] In certain embodiments, the fluorophores used in reporter
molecules in the methods and compositions described herein include
xanthene (rhodol, rhodamine, fluorescein and derivatives thereof)
coumarin, cyanine, pyrene, oxazine and borapolyazaindacene. In
other embodiments, such fluorophores are sulfonated xanthenes,
fluorinated xanthenes, sulfonated coumarins, fluorinated coumarins
and sulfonated cyanines
[0210] Non-limiting examples of the fluorophores used in reporter
molecules in the methods and compositions described herein are
shown in FIG. 3, wherein such fluorphores have been modified with
azide moieties, alkyne moieties or phosphine moieties. In certain
embodiments, the such fluorphores used in "click" chemistry
reactions form triazole products wherein the conjugate does not
requires UV excitation and any quenching effect due to conjugation
of azido or alkyne groups to the fluorescent .pi.-system is
overcome.
[0211] The choice of the fluorophore attached to the modified
nucleic acid will determine the absorption and fluorescence
emission properties of the modified nucleic acid. Physical
properties of a fluorophore label that can be used for detection of
modified nucleic acids include, but are not limited to, spectral
characteristics (absorption, emission and stokes shift),
fluorescence intensity, lifetime, polarization and photo-bleaching
rate, or combination thereof. All of these physical properties can
be used to distinguish one fluorophore from another, and thereby
allow for multiplexed analysis. In certain embodiments, the
fluorophore has an absorption maximum at wavelengths greater than
480 nm. In other embodiments, the fluorophore absorbs at or near
488 nm to 514 nm (particularly suitable for excitation by the
output of the argon-ion laser excitation source) or near 546 nm
(particularly suitable for excitation by a mercury arc lamp). In
other embodiment a fluorophore can emit in the NIR (near infra red
region) for tissue or whole organism applications.
[0212] Many of fluorophores can also function as chromophores and
thus the described fluorophores are also chromophores used in
reporter molecules in the methods and compositions described
herein.
[0213] In addition to fluorophores, enzymes also find use as labels
for the detection reagents/reporter molecules used in the methods
and compositions described herein. Enzymes are desirable labels
because amplification of the detectable signal can be obtained
resulting in increased assay sensitivity. The enzyme itself does
not produce a detectable response but functions to break down a
substrate when it is contacted by an appropriate substrate such
that the converted substrate produces a fluorescent, colorimetric
or luminescent signal. Enzymes amplify the detectable signal
because one enzyme on a labeling reagent can result in multiple
substrates being converted to a detectable signal. This is
advantageous where there is a low quantity of target present in the
sample or a fluorophore does not exist that will give comparable or
stronger signal than the enzyme. However, fluorophores are most
preferred because they do not require additional assay steps and
thus reduce the overall time required to complete an assay. The
enzyme substrate is selected to yield the preferred measurable
product, e.g. colorimetric, fluorescent or chemiluminescence. Such
substrates are extensively used in the art, many of which are
described in the MOLECULAR PROBES HANDBOOK, supra.
[0214] In certain embodiments, colorimetric or fluorogenic
substrate and enzyme combination use oxidoreductases such as, by
way of example only, horseradish peroxidase and a substrate such
as, by way of example only, 3,3'-diaminobenzidine (DAB) or
3-amino-9-ethylcarbazole (AEC), which yield a distinguishing color
(brown and red, respectively). Other colorimetric oxidoreductase
substrates used with the enzymatic reporter molecules described
herein include, but are not limited to:
2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS),
o-phenylenediamine (OPD), 3,3',5,5'-tetramethylbenzidine (TMB),
o-dianisidine, 5-aminosalicylic acid, 4-chloro-1-naphthol.
Fluorogenic substrates used with the enzymatic reporter molecules
described herein include, but are not limited to, homovanillic acid
or 4-hydroxy-3-methoxyphenylacetic acid, reduced phenoxazines and
reduced benzothiazines, including Amplex.RTM. Red reagent and its
variants (U.S. Pat. No. 4,384,042), Amplex UltraRed and its
variants in (WO05042504) and reduced dihydroxanthenes, including
dihydrofluoresceins (U.S. Pat. No. 6,162,931) and dihydrorhodamines
including dihydrorhodamine 123. Peroxidase substrates can be used
with the enzymatic reporter molecules described herein. Such
peroxide substrates include, but are not limited to, tyramides
(U.S. Pat. Nos. 5,196,306; 5,583,001 and 5,731,158) which represent
a unique class of peroxidase substrates in that they can be
intrinsically detectable before action of the enzyme but are "fixed
in place" by the action of a peroxidase in the process described as
tyramide signal amplification (TSA). These substrates are
extensively utilized to label targets in samples that are cells,
tissues or arrays for their subsequent detection by microscopy,
flow cytometry, optical scanning and fluorometry.
[0215] In other embodiments the colorimetric (and in some cases
fluorogenic) substrates and enzymes combination used in reporter
molecules described herein include a phosphatase enzyme such as, by
way of example only, an acid phosphatase, an alkaline phosphatase
or a recombinant version of such a phosphatase. A colorimetric
substrate used in combination with such phosphatases include, but
are not limited to, 5-bromo-6-chloro-3-indolyl phosphate (BCIP),
6-chloro-3-indolyl phosphate, 5-bromo-6-chloro-3-indolyl phosphate,
p-nitrophenyl phosphate, or o-nitrophenyl phosphate or with a
fluorogenic substrate such as 4-methylumbelliferyl phosphate,
6,8-difluoro-7-hydroxy-4-methylcoumarinyl phosphate (DiFMUP, U.S.
Pat. No. 5,830,912), fluorescein diphosphate, 3-O-methylfluorescein
phosphate, resorufin phosphate,
9H-(1,3-dichloro-9,9-dimethylacridin-2-one-7-yl) phosphate (DDAO
phosphate), or ELF 97, ELF 39 or related phosphates (U.S. Pat. Nos.
5,316,906 and 5,443,986).
[0216] Other enzymes used in reporter molecules described herein
include glycosidases, including, but not limited to,
beta-galactosidase, beta-glucuronidase and beta-glucosidase. The
colorimetric substrates used with such enzymes include, but are not
limited to, 5-bromo-4-chloro-3-indolylbeta-D-galactopyranoside
(X-gal) and similar indolyl galactosides, glucosides, and
glucuronides, o-nitrophenyl beta-D-galactopyranoside (ONPG) and
p-nitrophenyl beta-D-galactopyranoside. Preferred fluorogenic
substrates include resorufin beta-D-galactopyranoside, fluorescein
digalactoside (FDG), fluorescein diglucuronide and their structural
variants (U.S. Pat. Nos. 5,208,148; 5,242,805; 5,362,628; 5,576,424
and 5,773,236), 4-methylumbelliferyl beta-D-galactopyranoside,
carboxyumbelliferyl beta-D-galactopyranoside and fluorinated
coumarin beta-D-galactopyranosides (U.S. Pat. No. 5,830,912).
[0217] Additional enzymes used in reporter molecules described
herein include include, but are not limited to, hydrolases such as
cholinesterases and peptidases, oxidases such as glucose oxidase
and cytochrome oxidases, and reductases for which suitable
substrates are known.
[0218] Enzymes and their appropriate substrates that produce
chemiluminescence can also be used in reporter molecules described
herein. Such enzymes include, but are not limited to, natural and
recombinant forms of luciferases and aequorins. In addition, the
chemiluminescence-producing substrates for phosphatases,
glycosidases and oxidases such as those containing stable
dioxetanes, luminol, isoluminol and acridinium esters an also be
used in reporter molecules described herein.
[0219] In addition to enzymes, haptens can be used in
label/reporter molecules described herein. In certain embodiments,
such haptens include hormones, naturally occurring and synthetic
drugs, pollutants, allergens, affector molecules, growth factors,
chemokines, cytokines, lymphokines, amino acids, peptides, chemical
intermediates, nucleotides, digoxin, biotin and the like. Biotin is
useful because it can function in an enzyme system to further
amplify the detectable signal, and it can function as a tag to be
used in affinity chromatography for isolation purposes. For
detection purposes, an enzyme conjugate that has affinity for
biotin is used, such as, by way of example only, avidin-Horse
Radish Peroxidase (HRP). Subsequently a peroxidase substrate as
described herein can be added to produce a detectable signal.
[0220] Fluorescent proteins can also be used in label/reporter
molecules described herein for use in the methods, compositions and
modified nucleic acids described herein. Non-limiting examples of
such fluorescent proteins include green fluorescent protein (GFP)
and the phycobiliproteins and the derivatives thereof. The
fluorescent proteins, especially phycobiliprotein, are particularly
useful for creating tandem dye labeled modified nucleic acids.
These tandem dyes comprise a fluorescent protein and a fluorophore
for the purposes of obtaining a larger stokes shift wherein the
emission spectra is farther shifted from the wavelength of the
fluorescent protein's absorption spectra. This is particularly
advantageous for detecting a low quantity of a target in a sample
wherein the emitted fluorescent light is maximally optimized, in
other words little to none of the emitted light is reabsorbed by
the fluorescent protein. The fluorescent protein and fluorophore
function as an energy transfer pair wherein the fluorescent protein
emits at the wavelength that the fluorophore absorbs and the
fluorophore then emits at a wavelength farther from the fluorescent
proteins emission wavelength than could have been obtained with
only the fluorescent protein. A particularly useful combination is
the phycobiliproteins disclosed in U.S. Pat. Nos. 4,520,110;
4,859,582; 5,055,556 and the sulforhodamine fluorophores disclosed
in U.S. Pat. No. 5,798,276, or the sulfonated cyanine fluorophores
disclosed in U.S. Ser. Nos. 09/968/401 and 09/969/853; or the
sulfonated xanthene derivatives disclosed in U.S. Pat. No.
6,130,101 and those combinations disclosed in U.S. Pat. No.
4,542,104. Alternatively, the fluorophore functions as the energy
donor and the fluorescent protein is the energy acceptor.
Carrier Molecules: Azide Reactive, Alkyne reactive and Phosphine
Reactive
[0221] In the methods and compositions described herein the
modified nucleic acids can be conjugated to a carrier molecule. In
certain embodiments, the modified nucleic acids contain at least
one alkyne moiety or at least one phosphine moiety capable of
reacting with a carrier molecule containing an azide moiety. In
other embodiments, the modified nucleic acids contain at least one
azide moiety capable of reacting with a carrier molecule containing
an alkyne moiety or a phosphine moiety. In other embodiments, the
modified nucleic acids contain at least one phosphine moiety
capable of reacting with a carrier molecule containing an azide
moiety. In certain embodiments, the phosphine moieties of the
modified nucleic acids and carrier molecules are triaryl phosphine
moieties.
[0222] A variety of carrier molecules can be used in the methods
and compositions described herein, including, but not limited to,
antigens, steroids, vitamins, drugs, haptens, metabolites, toxins,
environmental pollutants, amino acids, peptides, proteins, nucleic
acids, nucleic acid polymers, carbohydrates, lipids, and polymers.
In certain embodiments, the carrier molecule contain an amino acid,
a peptide, a protein, a polysaccharide, a nucleoside, a nucleotide,
an oligonucleotide, a nucleic acid, a hapten, a psoralen, a drug, a
hormone, a lipid, a lipid assembly, a synthetic polymer, a
polymeric microparticle, a biological cell, a virus or combinations
thereof.
[0223] In other embodiments, the carrier molecule is selected from
a hapten, a nucleotide, an oligonucleotide, a nucleic acid polymer,
a protein, a peptide or a polysaccharide. In still other
embodiments, the carrier molecule is an amino acid, a peptide, a
protein, a polysaccharide, a nucleoside, a nucleotide, an
oligonucleotide, a nucleic acid, a hapten, a psoralen, a drug, a
hormone, a lipid, a lipid assembly, a tyramine, a synthetic
polymer, a polymeric microparticle, a biological cell, cellular
components, an ion chelating moiety, an enzymatic substrate or a
virus. In further embodiments, the carrier molecule is an antibody
or fragment thereof, an antigen, an avidin or streptavidin, a
biotin, a dextran, an IgG binding protein, a fluorescent protein,
agarose, and a non-biological microparticle.
[0224] In certain embodiments wherein the carrier molecule is an
enzymatic substrate, the enzymatic substrate is selected from an
amino acid, a peptide, a sugar, an alcohol, alkanoic acid,
4-guanidinobenzoic acid, a nucleic acid, a lipid, sulfate,
phosphate, --CH.sub.2OCO-alkyl and combinations thereof. In certain
embodiments, such enzyme substrates can be cleaved by enzymes
selected from peptidases, phosphatases, glycosidases, dealkylases,
esterases, guanidinobenzotases, sulfatases, lipases, peroxidases,
histone deacetylases, exonucleases, reductases,
endoglycoceramidases and endonucleases.
[0225] In other embodiments, the carrier molecule is an amino acid
(including those that are protected or are substituted by
phosphates, carbohydrates, or C.sub.1 to C.sub.22 carboxylic
acids), or a polymer of amino acids such as a peptide or protein.
In a related embodiment, the carrier molecule contains at least
five amino acids, more preferably 5 to 36 amino acids. Such
peptides include, but are not limited to, neuropeptides, cytokines,
toxins, protease substrates, and protein kinase substrates. Other
peptides may function as organelle localization peptides, that is,
peptides that serve to target the conjugated compound for
localization within a particular cellular substructure by cellular
transport mechanisms, including, but not limited to, nuclear
localization signal sequences. In certain embodiments, the protein
carrier molecules include enzymes, antibodies, lectins,
glycoproteins, histones, albumins, lipoproteins, avidin,
streptavidin, protein A, protein G, phycobiliproteins and other
fluorescent proteins, hormones, toxins and growth factors. In other
embodiments, the protein carrier molecule is an antibody, an
antibody fragment, avidin, streptavidin, a toxin, a lectin, or a
growth factor. In further embodiments, the carrier molecules
contain haptens including, but not limited to, biotin, digoxin,
digoxigenin and fluorophores.
[0226] The carrier molecules used in the methods and composition
described herein can also contain a nucleic acid base, nucleoside,
nucleotide or a nucleic acid polymer, optionally containing an
additional linker or spacer for attachment of a fluorophore or
other ligand, such as an alkynyl linkage (U.S. Pat. No. 5,047,519),
an aminoallyl linkage (U.S. Pat. No. 4,711,955) or other linkage.
In other embodiments, the nucleotide carrier molecule is a
nucleoside or a deoxynucleoside or a dideoxynucleoside, while in
other embodiments, the carrier molecule contains a peptide nucleic
acid (PNA) sequence or a locked nucleic acid (LNA) sequence. In
certain embodiments, the nucleic acid polymer carrier molecules are
single- or multi-stranded, natural or synthetic DNA or RNA
oligonucleotides, or DNA/RNA hybrids, or incorporating an unusual
linker such as morpholine derivatized phosphates (AntiVirals, Inc.,
Corvallis Oreg.), or peptide nucleic acids such as
N-(2-aminoethyl)glycine units, where the nucleic acid contains
fewer than 50 nucleotides, more typically fewer than 25
nucleotides.
[0227] The carrier molecules used in the methods and composition
described herein can also contain a carbohydrate or polyol,
including a polysaccharide, such as dextran, FICOLL, heparin,
glycogen, amylopectin, mannan, inulin, starch, agarose and
cellulose, or a polymer such as a poly(ethylene glycol). In certain
embodiments, the polysaccharide carrier molecule includes dextran,
agarose or FICOLL.
[0228] The carrier molecules used in the methods and composition
described herein can also include a lipid including, but not
limited to, glycolipids, phospholipids, and sphingolipids. In
certain embodiments, such lipids contain 6-25 carbons. In other
embodiments, the carrier molecules include a lipid vesicle, such as
a liposome,
[0229] The carrier molecules used in the methods and composition
described herein can also be a cell, cellular systems, cellular
fragment, or subcellular particles, including virus particles,
bacterial particles, virus components, biological cells (such as
animal cells, plant cells, bacteria, or yeast), or cellular
components. Non-limiting examples of such cellular components that
are useful as carrier molecules in the methods and composition
described herein include lysosomes, endosomes, cytoplasm, nuclei,
histones, mitochondria, Golgi apparatus, endoplasmic reticulum and
vacuoles.
[0230] The carrier molecules used in the methods and composition
described herein can also non-covalently associates with organic or
inorganic materials.
[0231] The carrier molecules used in the methods and composition
described herein can also include a specific binding pair member
wherein the nucleic acid can be conjugated to a specific binding
pair member and used in the formation of a bound pair. In certain
embodiments, the presence of a labeled specific binding pair member
indicates the location of the complementary member of that specific
binding pair; each specific binding pair member having an area on
the surface or in a cavity which specifically binds to, and is
complementary with, a particular spatial and polar organization of
the other. In certain embodiments, the dye compounds (fluorophores
or chromophores) described herein function as a reporter molecule
for the specific binding pair. Exemplary binding pairs are set
forth in Table 2.
TABLE-US-00002 TABLE 2 Representative Specific Binding Pairs
antigen antibody biotin avidin (or streptavidin or anti-biotin)
IgG* protein A or protein G drug drug receptor folate folate
binding protein toxin toxin receptor carbohydrate lectin or
carbohydrate receptor peptide peptide receptor protein protein
receptor enzyme substrate enzyme DNA (RNA) cDNA (cRNA).sup..dagger.
hormone hormone receptor ion chelator *IgG is an immunoglobulin
.sup..dagger.cDNA and cRNA are the complementary strands used for
hybridization
[0232] In a particular aspect the carrier molecule, used in the
methods and compositions described herein, is an antibody fragment,
such as, but not limited to, anti-Fc, an anti-Fc isotype, anti-J
chain, anti-kappa light chain, anti-lambda light chain, or a
single-chain fragment variable protein; or a non-antibody peptide
or protein, such as, for example but not limited to, soluble Fc
receptor, protein G, protein A, protein L, lectins, or a fragment
thereof In one aspect the carrier molecule is a Fab fragment
specific to the Fc portion of the target-binding antibody or to an
isotype of the Fc portion of the target-binding antibody (U.S. Ser.
No. 10/118,204). The monovalent Fab fragments are typically
produced from either murine monoclonal antibodies or polyclonal
antibodies generated in a variety of animals, for example but not
limited to, rabbit or goat. These fragments can be generated from
any isotype such as murine IgM, IgG.sub.1, IgG.sub.2a, IgG.sub.2b
or IgG.sub.3.
[0233] In alternative embodiments, a non-antibody protein or
peptide such as protein G, or other suitable proteins, can be used
alone or coupled with albumin. Preferred albumins include human and
bovine serum albumins or ovalbumin. Protein A, G and L are defined
to include those proteins known to one skilled in the art or
derivatives thereof that comprise at least one binding domain for
IgG, i.e. proteins that have affinity for IgG. These proteins can
be modified but do not need to be and are conjugated to a reactive
moiety in the same manner as the other carrier molecules
described.
[0234] In another aspect, the carrier molecules, used in the
methods and compositions described herein, can be whole intact
antibodies. Antibody is a term of the art denoting the soluble
substance or molecule secreted or produced by an animal in response
to an antigen, and which has the particular property of combining
specifically with the antigen that induced its formation.
Antibodies themselves also serve are antigens or immunogens because
they are glycoproteins and therefore are used to generate
anti-species antibodies. Antibodies, also known as immunoglobulins,
are classified into five distinct classes--IgG, IgA, IgM, IgD, and
IgE. The basic IgG immunoglobulin structure consists of two
identical light polypeptide chains and two identical heavy
polypeptide chains (linked together by disulfide bonds).
[0235] When IgG is treated with the enzyme papain a monovalent
antigen-binding fragment can be isolated, referred herein to as a
Fab fragment. When IgG is treated with pepsin (another proteolytic
enzyme), a larger fragment is produced, F(ab').sub.2. This fragment
can be split in half by treating with a mild reducing buffer that
results in the monovalent Fab' fragment. The Fab' fragment is
slightly larger than the Fab and contains one or more free
sulfhydryls from the hinge region (which are not found in the
smaller Fab fragment). The term "antibody fragment" is used herein
to define the Fab', F(ab').sub.2 and Fab portions of the antibody.
It is well known in the art to treat antibody molecules with pepsin
and papain in order to produce antibody fragments (Gorevic et al.,
Methods of Enzyol., 116:3 (1985)).
[0236] The monovalent Fab fragments used as carrier molecules in
the methods and compositions described herein are produced from
either murine monoclonal antibodies or polyclonal antibodies
generated in a variety of animals that have been immunized with a
foreign antibody or fragment thereof (U.S. Pat. No. 4,196,265
discloses a method of producing monoclonal antibodies). Typically,
secondary antibodies are derived from a polyclonal antibody that
has been produced in a rabbit or goat but any animal known to one
skilled in the art to produce polyclonal antibodies can be used to
generate anti-species antibodies. The term "primary antibody"
describes an antibody that binds directly to the antigen as opposed
to a "secondary antibody" that binds to a region of the primary
antibody. Monoclonal antibodies are equal, and in some cases,
preferred over polyclonal antibodies provided that the
ligand-binding antibody is compatible with the monoclonal
antibodies that are typically produced from murine hybridoma cell
lines using methods well known to one skilled in the art.
[0237] In one aspect the antibodies used as carrier molecules in
the methods and compositions described herein are generated against
only the Fc region of a foreign antibody. Essentially, the animal
is immunized with only the Fc region fragment of a foreign
antibody, such as murine. The polyclonal antibodies are collected
from subsequent bleeds, digested with an enzyme, pepsin or papain,
to produce monovalent fragments. The fragments are then affinity
purified on a column comprising whole immunoglobulin protein that
the animal was immunized against or just the Fc fragments.
Solid Supports: Azide Reactive, Alkyne Reactive or Phosphine
Reactive
[0238] In an aspect of the methods and composition described
herein, the modified nucleic acids can be covalently conjugated to
a solid support. This includes, but is not limited to, any azide
modified nucleic acid disclosed herein and any solid support
disclosed herein. In certain embodiments, the modified nucleic
acids contain at least one alkyne moiety or at least one phosphine
moiety capable of reacting with a solid support containing an azide
moiety. In other embodiments, the modified nucleic acids contain at
least one azide moiety capable of reacting with a solid support
containing an alkyne moiety or a phosphine moiety. In other
embodiments, the modified nucleic acids contain at least one
phosphine moiety capable of reacting with a solid support
containing an azide moiety. In certain embodiments, the phosphine
moieties of the modified nucleic acids and solid supports are
triarylphosphine moieties.
[0239] A variety of solid supports can be used in the methods and
compositions described herein. Such solid supports are not limited
to a specific type of support, and therefore a large number of
supports are available and are known to one of ordinary skill in
the art. Such solid supports include, but are not limited to, solid
and semi-solid matrixes, such as aerogels and hydrogels, resins,
beads, biochips (including thin film coated biochips), microfluidic
chip, a silicon chip, multi-well plates (also referred to as
microtitre plates or microplates), membranes, conducting and
nonconducting metals, glass (including microscope slides) and
magnetic supports. Other non-limiting examples of solid supports
used in the methods and compositions described herein include
silica gels, polymeric membranes, particles, derivatized plastic
films, derivatized glass, derivatized silica, glass beads, cotton,
plastic beads, alumina gels, polysaccharides such as Sepharose,
poly(acrylate), polystyrene, poly(acrylamide), polyol, agarose,
agar, cellulose, dextran, starch, FICOLL, heparin, glycogen,
amylopectin, mannan, inulin, nitrocellulose, diazocellulose,
polyvinylchloride, polypropylene, polyethylene (including
poly(ethylene glycol)), nylon, latex bead, magnetic bead,
paramagnetic bead, superparamagnetic bead, starch and the like. In
certain embodiments, the solid supports used in the methods and
compositions described herein are substantially insoluble in liquid
phases.
[0240] In certain embodiments, the solid support may include a
solid support reactive functional group, including, but not limited
to, hydroxyl, carboxyl, amino, thiol, aldehyde, halogen, nitro,
cyano, amido, urea, carbonate, carbamate, isocyanate, sulfone,
sulfonate, sulfonamide, sulfoxide, wherein such functional groups
are used to covalently attach the azide-containing nucleic acids
described herein. In other embodiments, the solid support may
include a solid support reactive functional group, including, but
not limited to, hydroxyl, carboxyl, amino, thiol, aldehyde,
halogen, nitro, cyano, amido, urea, carbonate, carbamate,
isocyanate, sulfone, sulfonate, sulfonamide, sulfoxide, wherein
such functional groups are used to covalently attach the
alkyne-containing nucleic acids described herein. In still other
embodiments, the solid support may include a solid support reactive
functional group, including, but not limited to, hydroxyl,
carboxyl, amino, thiol, aldehyde, halogen, nitro, cyano, amido,
urea, carbonate, carbamate, isocyanate, sulfone, sulfonate,
sulfonamide, sulfoxide, wherein such functional groups are used to
covalently attach the phosphine-containing nucleic acids described
herein. In other embodiments, the solid supports include azide,
alkyne or phosphine functional groups to covalently attach nucleic
acids modified with azide, alkyne or phosphine moieties.
[0241] A suitable solid phase support used in the methods and
compositions described herein, can be selected on the basis of
desired end use and suitability for various synthetic protocols. By
way of example only, where amide bond formation is desirable to
attach the modified nucleic acids described herein to the solid
support, resins generally useful in peptide synthesis may be
employed, such as polystyrene (e.g., PAM-resin obtained from Bachem
Inc., Peninsula Laboratories, etc.), POLYHIPE.TM. resin (obtained
from Aminotech, Canada), polyamide resin (obtained from Peninsula
Laboratories), polystyrene resin grafted with polyethylene glycol
(TentaGel.TM., Rapp Polymere, Tubingen, Germany),
polydimethyl-acrylamide resin (available from Milligen/Biosearch,
California), or PEGA beads (obtained from Polymer Laboratories). In
certain embodiments, the modified nucleic acids described herein
are deposited onto a solid support in an array format. In certain
embodiments, such deposition is accomplished by direct surface
contact between the support surface and a delivery mechanism, such
as a pin or a capillary, or by ink jet technologies which utilize
piezoelectric and other forms of propulsion to transfer liquids
from miniature nozzles to solid surfaces. In the case of contact
printing, robotic control systems and multiplexed printheads allow
automated microarray fabrication. For contactless deposition by
piezoelectric propulsion technologies, robotic systems also allow
for automatic microarray fabrication using either continuous and
drop-on-demand devices.
Compositions
[0242] In one aspect, the modified nucleic acids, reporter
molecules and carrier molecules provided herein can be used to form
a first composition that includes a modified nucleic acids, a first
reporter molecule, and a carrier molecule. In another embodiment, a
second nucleic acid that includes a first composition in
combination with a second conjugate, wherein the second conjugate
comprises a carrier molecule or solid support that is covalently
bonded to a second reporter molecule. The first and second reporter
molecules have different structures and preferably have different
emission spectra. In other embodiments, the first and second
reporter molecules are selected so that their fluorescence
emissions essentially do not overlap. In other embodiments, the
reporter molecules have different excitation spectra, while in
other embodiments the reporter molecules have similar excitation
wavelengths and are excited by the same laser. In such
compositions, the carrier molecule (or solid support) of the
conjugates in the second composition may be the same or a different
molecule. The discussion herein pertaining to the identity of
various carrier molecules is generally applicable to this
embodiment as well as other embodiments.
[0243] In another aspect, the modified nucleic acids, reporter
molecules and solid supports provided herein can be used to form a
first composition that comprises a modified nucleic acid, a first
reporter molecule, and a solid support. In another embodiment, a
second composition that includes a first composition in combination
with a second conjugate. The second conjugate comprises a solid
support or carrier molecule (described herein) that is covalently
bonded to a second reporter molecule. The first and second reporter
molecules have different structures and preferably have different
emission spectra. In other embodiments, the first and second
reporter molecules are selected so that their fluorescence
emissions essentially do not overlap. In other embodiments, the
reporter molecules have different excitation spectra, while in
other embodiments the reporter molecules have similar excitation
wavelengths and are excited by the same laser. In such composition,
the solid support (or carrier molecule) of the conjugates in the
second composition may be the same or a different molecule. The
discussion herein pertaining to the identity of various solid
supports is generally applicable to this embodiment of the
invention as well as other embodiments.
Labeling and Separating Modified Nucleic Acids
[0244] Methods for forming modified nucleic acid-label (reporter
molecule, solid support or carrier molecule) conjugates are
described herein. In one aspect the modified biomolecule-reporter
molecule conjugates are formed in solution and then separated using
methods known in the art. It was unexpectedly found that by adding
a copper chelator to the "click" chemistry conjugation reaction the
labeling efficiency of modified nucleic acids and their resolution
in gel electrophoresis improved as compared to those reactions
without the addition of a copper chelator. In certain embodiments,
the methods of labeling nucleic acids using "click" chemistry,
involve an azide modified nucleic acid and a label that includes a
terminal alkyne that are reacted in a mixture that includes copper
(II), a reducing agent, and at least one copper (I) chelator. In
other embodiments, novel methods are provided for forming
conjugates in solution with azide modified nucleic acids and a
reporter molecule comprising a terminal alkyne under "click"
chemistry conditions. In other embodiments, "click" chemistry is
used to form conjugates with alkyne modified nucleic acids and a
reporter molecule comprising an azide. In other embodiments,
Staudinger ligation is used to form conjugates with azide modified
nucleic acids and a reporter molecule comprising a phosphine, while
other embodiments use Staudinger ligation to form conjugates with
phosphine modified nucleic acids and a reporter molecule comprising
an azide. Still other embodiments use activated alkyne modified
nucleic acids to form conjugates with reporter molecules comprising
azides, or azide modified nucleic acids forming conjugates with
activated alkyne containing reporter molecules.
[0245] In other aspects provided herein, the methods of labeling
nucleic acids using "click" chemistry, wherein a nucleic acid that
includes an azido group and a label that comprises a terminal
alkyne are reacted in a mixture that includes copper (II), a
reducing agent, and at least one copper (I) chelator to produce a
labeled nucleic acid, results in the preservation of the structural
integrity of the labeled nucleic acid. In other embodiments,
methods of labeling glycoproteins wherein the structural integrity
of the nucleic acid after labeling is not reduced includes "click"
chemistry in which a nucleic acid that includes a terminal alkyne
and a label that comprises an azido group are reacted in a mixture
that includes copper (II), a reducing agent, and at least one
copper chelator.
[0246] The methods for labeling nucleic acids that comprise an
azido group using "click" chemistry described herein can also be
used for nucleic acids that comprise a terminal alkyne, wherein the
label to be reacted with the nucleic acid comprises an azido group.
The methods for labeling and detecting nucleic acids that comprise
an azido group using "click" chemistry described herein can also be
used for nucleic acids that comprise a terminal alkyne, wherein the
label to be reacted with the nucleic acid comprises an azido group.
In one embodiment, is a method using the "click" chemistry reaction
described herein to form nucleic acid-reporter molecule conjugates
in which the reaction mixture includes a reporter molecule with an
azide moiety, an alkyne modified nucleic acid, copper (II) ions, at
least one reducing agent and a copper chelator. In certain
embodiments, such alkyne modified nucleic acids are alkyne modified
glycoproteins and such reporter molecule with an azide moiety are
any reporter molecule described herein. In other embodiments, such
alkyne modified nucleic acids are alkyne modified glycoproteins and
such reporter molecule with an azide moiety are any fluorophore
based reporter molecule described herein.
[0247] Other methods provided herein, are methods for labeling and
detecting separated nucleic acids using the "click" chemistry
cycloaddition reaction described herein. The method includes:
combining in a reaction mixture a nucleic acid that comprises an
azido group, a label that includes a terminal alkyne group, copper
(II), a reducing agent, and a copper chelator; incubating the
reaction mixture under conditions that promote chemical conjugation
of the label to the nucleic acid, separating the nucleic acid using
one or more biochemical or biophysical separation techniques, and
detecting the nucleic acid. In other embodiments, the method
includes: combining in a reaction mixture a nucleic acid that
comprises an alkyne group, a label that includes an azide group,
copper (II), a reducing agent, and a copper chelator; incubating
the reaction mixture under conditions that promote chemical
conjugation of the label to the nucleic acid, separating the
nucleic acid using one or more biochemical or biophysical
separation techniques, and detecting the nucleic acid.
[0248] In one embodiment is a method for forming a modified nucleic
acid label (reporter molecule, solid support or carrier molecule)
conjugate, wherein the method includes the steps of: [0249] a)
forming an azide-alkyne cycloaddition reaction mixture that
includes a label having a terminal alkyne moiety, an azido modified
nucleic acid, copper(II) ions, at least one reducing agent and a
copper chelator; [0250] b) incubating the azide-alkyne
cycloaddition reaction mixture for a sufficient amount of time to
form a nucleic acid-label conjugate; [0251] c) separating the
nucleic acid-label conjugate to form a separated nucleic acid-label
conjugate wherein the nucleic acid label conjugated is formed and
separated.
[0252] In an alternative embodiment, step a) comprises a label
having an azido moiety and the modified nucleic acid comprises an
alkyne.
[0253] In another alternative embodiment, step a) comprises forming
a Staudinger ligation reaction.
[0254] In yet another embodiment, step a) does not comprise
copper(II) ions, at least one reducing agent and a copper chelator
wherein the label comprises an azido moiety or an activated alkyne
and the modified nucleic acid comprises an azido moiety or an
activated alkyne.
[0255] In another embodiment is a method for detecting modified
nucleic acids, wherein the method includes the steps of: [0256] a)
forming an azide-alkyne cycloaddition reaction mixture that
includes a reporter molecule having a terminal alkyne moiety, an
azido modified nucleic acid, copper(II) ions, at least one reducing
agent and a copper chelator; [0257] b) incubating the azide-alkyne
cycloaddition reaction mixture for a sufficient amount of time to
form a nucleic acid-reporter molecule conjugate; [0258] c)
separating the nucleic acid-reporter molecule conjugate to form a
separated nucleic acid-reporter molecule conjugate; [0259] d)
illuminating the separated nucleic acid-reporter molecule conjugate
with an appropriate wavelength to form an illuminated nucleic
acid-reporter molecule conjugate, and [0260] e) observing the
illuminated nucleic acid-reporter molecule conjugate wherein the
nucleic acids is detected.
[0261] In another embodiment is a method for detecting modified
nucleic acids, wherein the method includes the steps of: [0262] a)
forming an azide-alkyne cycloaddition reaction mixture that
includes a reporter molecule having an azide moiety, an alkyne
modified nucleic acid, copper(II) ions, at least one reducing agent
and a copper chelator; [0263] b) incubating the azide-alkyne
cycloaddition reaction mixture for a sufficient amount of time to
form a nucleic acid-reporter molecule conjugate; [0264] c)
separating the nucleic acid-reporter molecule conjugate to form a
separated nucleic acid-reporter molecule conjugate; [0265] d)
illuminating the separated nucleic acid-reporter molecule conjugate
with an appropriate wavelength to form an illuminated nucleic
acid-reporter molecule conjugate, and [0266] e) observing the
illuminated nucleic acid-reporter molecule conjugate wherein the
nucleic acid is detected.
[0267] In addition such "click" chemistry reaction mixtures can
include, without limitation, one or more buffers, polymers, salts,
detergents, or solubilizing agents. The reaction can be performed
under anaerobic conditions, such as under nitrogen or argon gas,
and can be performed for any feasible length of time, such as, for
example, from ten minutes to six hours, from about twenty minutes
to about three hours, or from about thirty minutes to about two
hours. The reaction can be performed at a wide range of
temperatures, for example ranging from about 4 degrees Celsius to
about 50 degrees Celsius, and is preferably performed at
temperatures between about 10 degrees and about 40 degrees, and
typically between about 15 degrees and about 30 degrees.
Separation and Detection
[0268] Another aspect provided herein are methods directed toward
detecting modified nucleic acids after the modified nucleic acids
have been labeled, using "click" chemistry reactions, Staudinger
ligation or activated alkyne reactions, and separated using, for
example, chromatographic methods or electrophoresis methods such
as, but not limited to, gel electrophoresis. In certain embodiments
such nucleic acids have been modified using the methods described
herein. The separation methods used to separate such modified
nucleic acids includes, but are not limited to, thin layer or
column chromatography (including, for example, size exclusion, ion
exchange, or affinity chromatography) or isoelectric focusing, gel
electrophoresis, capillary electrophoresis, capillary gel
electrophoresis, and slab gel electrophoresis. Gel electrophoresis
can be denaturing or nondenaturing gel electrophoresis, and can
include denaturing gel electrophoresis followed by nondenaturing
gel electrophoresis (e.g., "2D" gels). In certain embodiments, the
modified nucleic acids are used to form conjugates with a reporter
molecule, a carrier molecule and/or a solid support prior to
separation using the methods described herein. In other
embodiments, the modified nucleic acids are used to form conjugates
with a reporter molecule, a carrier molecule and/or a solid support
after separation using the methods described herein.
[0269] In other embodiments, the separation methods used in such
separation and detection methods can be any separation methods used
for nucleic acids, such as, for example, chromatography, capture to
solid supports, and electrophoresis. In certain embodiments of such
separation and detection methods, gel electrophoresis is used to
separate nucleic acids and the separated nucleic acids are detected
in the gel by the attached labels. By way of example only, nucleic
acids that have incorporated azido moieties can be labeled in a
solution reaction with a terminal alkyne-containing fluorophore,
and the nucleic acids can be optionally further purified from the
reaction mixture and electrophoresed. The nucleic acids can be
visualized in the gel using light of the appropriate wavelength to
stimulate the fluorophore label. Single or double stranded nucleic
acids can be attached to solid supports prior to incorporation of
azido or alkyne nucleotides followed by "click" reaction with a
respective azido or alkyne chemical or polymer. Nucleic acids that
have alkyne or azide-nucleotides can be attached to solid supports
before or after the click reaction.
[0270] Gel electrophoresis can use any feasible buffer system
described herein including, but not limited to, Tris-acetate EDTA,
Tris-borate EDTA, Tris-glycine, BisTris and Bistris-Tricine. In
certain embodiments, the electrophoresis gel used in the methods
described herein comprise acrylamide, including by way for example
only, acrylamide at a concentration from about 2.5% to about 30%,
or from about 5% to about 20%. In certain embodiments, such
polyacrylamide electrophoresis gel comprise 1% to 10% crosslinker,
including but not limited to, bisacrylamide. In certain
embodiments, the electrophoresis gel used in the methods described
herein comprises agarose, including by way for example only,
agarose at concentration from about 0.1% to about 5%, or from about
0.5% to about 4%, or from about 1% to about 3%. In certain
embodiments, the electrophoresis gel used in the methods described
herein comprises acrylamide and agarose, including by way for
example only, electrophoresis gels comprising from about 2.5% to
about 30% acrylamide and from about 0.1% to about 5% agarose, or
from about 5% to about 20% acrylamide and from about 0.2% to about
2.5% agarose. In certain embodiments, such polyacrylamide/agarose
electrophoresis gels comprise 1% to 10% crosslinker, including but
not limited to, bisacrylamide. In certain embodiments, the gels
used to separate nucleic acids can be gradient gels.
[0271] The methods described herein can be used to detect modified
nucleic acids for "in-gel" detection using slab gel electrophoresis
or capillary gel electrophoresis. In one aspect, the method
includes combining an azido modified nucleic acid, a label that
includes a terminal alkyne, copper (II), a reducing agent, and a
copper (I) chelator in a reaction mixture; incubating the reaction
mixture under conditions that promote chemical conjugation of the
label to the nucleic acid; separating the nucleic acid using one or
more biochemical separation techniques; and detecting the nucleic
acid. The label used in such methods can be any label described
herein. The copper (I) chelator used in such methods can be any
chelator described herein. In certain embodiments, the copper (I)
chelator use in such methods is a 1,10 phenanthroline-containing
copper (I) chelator. In other embodiments, the copper(I) chelator
is bathocuproine disulfonic acid (BCS;
2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline disulfonate). In
other embodiments, the copper (I) chelator used in such methods can
be used to chelate copper(II).
[0272] Without limitation to any specific mechanism, it is known
that copper can promote the cleavage of nucleic acids. The addition
of a copper chelator in such methods reduces the detrimental
effects of copper used in the "click" chemistry reactions, and
thereby preserves the structural integrity of the nucleic acids.
Thus, the methods described herein preserve the structural
integrity of labeled and detected nucleic acids, and thereby
provide improved methods of separating and detecting nucleic acids
labeled using "click" chemistry. In addition, the methods of
detecting separated nucleic acids using click chemistry, in which
the structural integrity of the separated molecules is preserved,
improves the detection of such nucleic acids.
[0273] In certain embodiments, the addition of a chelator
including, but not limited to BCS, preserves Telomerase Laddering
(see FIG. 10).
[0274] In another embodiment of "in-gel" detection, the method
includes combining an alkyne modified nucleic acid that comprises a
terminal alkyne, a label that includes an azido group, copper (II),
a reducing agent, and a copper (I) chelator in a reaction mixture;
incubating the reaction mixture under conditions that promote
chemical conjugation of the label to the nucleic acid; separating
the labeled nucleic acid using one or more biochemical separation
techniques; and detecting the nucleic acid. In these methods, the
structural integrity of labeled and detected nucleic acids is
preserved. The label used in such methods can be any label
described herein. The copper (I) chelator used in such methods can
be any chelator described herein. In certain embodiments, the
copper (I) chelator use in such methods is a 1,10
phenanthroline-containing copper (I) chelator. In other
embodiments, the copper(I) chelator is bathocuproine disulfonic
acid (BCS; 2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline
disulfonate. In other embodiments, the copper (I) chelator used in
such methods can be used to chelate copper(II).
[0275] In certain embodiments, in-gel fluorescence detection
utilizes fluorescent- and/or UV-excitable alkyne containing probes,
or fluorescent- and/or UV-excitable azide containing probes. In
certain embodiments, the labels used in such separation and
detection methods are any fluorophores described herein which has
been derivatized to contain an alkyne, an azide or a phosphine. In
certain embodiments, such fluorphores include, but are not limited
to, fluorescein, rhodamine, TAMRA, an Alexa dye, a SYPRO dye, or a
BODIPY dye.
[0276] The method described herein can be used for multiplexed
detection of nucleic acids, by labeling a modified nucleic acid
using the methods described herein, and then using a total nucleic
acid stain to stain the gel that includes the modified nucleic
acids labeled with a fluorophore having distinct spectral
emission.
[0277] In another aspect, nucleic acids can be labeled with an
azido tag, electrophoresed on gels, and the resulting gels can be
incubated with an alkyne tag, such as a fluorescent alkyne tag in
the presence of copper (I). Copper (I) can be added in its natural
form (e.g. CuBr) or can be produced in situ from copper (II)
compounds with the addition of a reducing agent. The reducing agent
used in such methods can be any reducing agent described herein,
including but not limited to, ascorbate or TCEP. Addition of a
chelator that stabilizes copper (I) can enhance the chemical
ligation. The fluorescent label used in such methods can be any
fluorophore described herein. The copper (I) chelator used in such
methods can be any chelator described herein. In certain
embodiments, the copper (I) chelator use in such methods is a 1,10
phenanthroline-containing copper (I) chelator. In other
embodiments, the copper(I) chelator is bathocuproine disulfonic
acid (BCS; 2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline
disulfonate). In other embodiments, the copper (I) chelator used in
such methods can be used to chelate copper(II). After the ligation
step, the gel is washed and the tagged proteins are visualized
using standard fluorescence scanning devices.
[0278] In other embodiments, nucleic acids can be labeled with an
alkyne tag, electrophoresed on gels, and the resulting gels can be
incubated with an azide tag, such as a fluorescent azide tag in the
presence of copper (I). Copper (I) can be added in its natural form
(e.g. CuBr) or can be produced in situ from copper (II) compounds
with the addition of a reducing agent. The reducing agent used in
such methods can be any reducing agent described herein, including
but not limited to, ascorbate or TCEP. Addition of a chelator that
stabilizes copper (I) can enhance the chemical ligation. The
fluorescent label used in such methods can be any fluorophore
described herein. The copper (I) chelator used in such methods can
be any chelator described herein. In certain embodiments, the
copper (I) chelator use in such methods is a 1,10
phenanthroline-containing copper (I) chelator. In other
embodiments, the copper(I) chelator is bathocuproine disulfonic
acid (BCS; 2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline
disulfonate. In other embodiments, the copper (I) chelator used in
such methods can be used to chelate copper(II). After the ligation
step, the gel is washed and the tagged proteins are visualized
using standard fluorescence scanning devices.
[0279] In further embodiments, nucleic acids can be labeled with an
azide tag, electrophoresed on gels, and the resulting gels can be
incubated with a phosphine tag, such as a fluorescent phosphine
containing tag, using Staudinger ligation. After the ligation step,
the gel is washed and the tagged nucleic acids are visualized using
standard fluorescence scanning devices. In such methods the use of
copper, which contributes to the degradation of nucleic acids such
as proteins, can be avoided.
[0280] In certain embodiments, a label attached to a nucleic acid
using a "click" chemistry reaction with a copper (I) chelator as
disclosed herein, can also be used for the separation of nucleic
acids. By way of example only, affinity chromatography or bead
capture techniques can be used to separate nucleic acids labeled
with biotin or other affinity tags using the methods described
herein. The captured molecules can be detected using the affinity
tags or by other means, and/or further analyzed for structure or
function.
Methods for Labeling Immobilized Modified Nucleic Acids
[0281] Another aspect provides a method for labeling modified
nucleic acids that have been immobilized on a solid support. Solid
supports used in such methods have been described herein, and can
be solid or semi-solid matrix. Such solid supports include, but are
not limited to, glass, slides, arrays, silica particles, polymeric
particles, microtiter plates and polymeric gels. In this aspect the
nucleic acids are modified using the methods described herein. In
certain aspects it is advantageous to first immobilize the modified
nucleic acids and then to subsequently form a nucleic acid
conjugate comprising the nucleic acid and a reporter molecule,
carrier molecule and the solid support, wherein the reporter
molecule, carrier molecule or solid support comprise a reactive
group used to form the conjugate. In certain embodiments such
reactive groups are alkynes for reacting with azides. In certain
embodiments such reactive groups are activated alkynes for reacting
with azides. In certain embodiments such reactive groups are
phosphines for reacting with azides. In certain embodiments such
reactive groups are azides for reacting with alkynes. In certain
embodiments, the conjugate is formed under "click" chemistry
conditions wherein the reporter molecule, carrier molecule or solid
support comprises an alkyne or an azide.
[0282] In another aspect the conjugate is formed under Staudinger
ligation conditions wherein the reporter molecule, carrier molecule
or solid support comprises a triaryl phosphine or an azide. In
another aspect the conjugate is formed using activated alkynes
wherein the reporter molecule, carrier molecule or solid support
comprises an activated alkyne or an azide.
[0283] In certain aspects it is advantageous to first immobilize
the modified nucleic acid and then to detect the immobilized
nucleic acid using standard hybridization techniques wherein the
hybridized probe is detected using methods well known in the art.
In this instance the modified nucleic acid comprises a a reactive
group that are alkynes for reacting with azides. In certain
embodiments such reactive groups are activated alkynes for reacting
with azides. In certain embodiments such reactive groups are
phosphines for reacting with azides. In certain embodiments such
reactive groups are azides for reacting with alkynes subsequently
form a nucleic acid conjugate comprising the nucleic acid and a
solid support, wherein the solid support comprises a reactive group
used to form the conjugate.
[0284] In certain embodiments, it is advantageous to first
immobilize the azido modified nucleic acids and then to
subsequently form the nucleic acid conjugate comprising a reporter
molecule, carrier molecule or solid support wherein the reporter
molecule, carrier molecule or solid support comprise an azide
reactive group prior to forming the conjugate. In certain
embodiments, the conjugate is formed under "click" chemistry
conditions wherein the reporter molecule, carrier molecule or solid
support comprises a terminal alkyne. In another aspect the
conjugate is formed under Staudinger ligation conditions wherein
the reporter molecule, carrier molecule or solid support comprises
a triaryl phosphine.
[0285] In another aspect, the modified nucleic acid is attached to
a solid support using functional groups other than functional
groups used in "click" chemistry or Staudinger ligation, whereupon
the attached modified nucleic acid is used to form a conjugate
under "click" chemistry conditions or Staudinger ligation with
reporter molecules, carrier molecule or another solid support that
have functional groups used in "click" chemistry or Staudinger
ligation. By way of example only, the modified nucleic acid can be
immobilized to a solid support using hydroxyl, carboxyl, amino,
thiol, aldehyde, halogen, nitro, cyano, amido, urea, carbonate,
carbamate, isocyanate, sulfone, sulfonate, sulfonamide or sulfoxide
functional groups. In certain embodiments the modified nucleic acid
is an azido modified nucleic acid, an alkyne modified nucleic acid
or a phosphine modified nucleic acid.
[0286] In certain embodiments, the azido modified nucleic acid is
attached to a solid support using functional groups other than
azide reactive functional groups, whereupon the attached azido
modified nucleic acid is used to form a conjugate under click
chemistry conditions wherein the reporter molecule, carrier
molecule or another solid support comprises a terminal alkyne. In
another embodiment the azido modified nucleic acid is attached to a
solid support using functional groups other than azide reactive
functional groups, whereupon the attached azido modified nucleic
acid is used to form a conjugate under Staudinger ligation
conditions wherein the reporter molecule, carrier molecule or other
solid support comprises a triaryl phosphine.
[0287] In another aspect is provided a method for detecting
immobilized azido modified nucleic acids, wherein the method
includes the following: [0288] a) immobilizing the azido modified
nucleic acids on a solid or semi-solid matrix to form an
immobilized azido modified nucleic acid; [0289] b) contacting the
immobilized azido modified nucleic acid with a reporter molecule
that contains an alkyne reactive group to form a contacted azido
modified nucleic acid; [0290] c) incubating the contacted azido
modified nucleic acid for a sufficient amount of time to form a
reporter molecule-nucleic acid conjugate; [0291] d) illuminating
the reporter molecule-nucleic acid conjugate with an appropriate
wavelength to form an illuminated reporter molecule-nucleic acid
conjugate, and [0292] e) observing the illuminated reporter
molecule-nucleic acid conjugate whereby the immobilized azido
modified nucleic acid is detected.
[0293] In another aspect is provided a method for detecting
immobilized alkyne modified nucleic acids, wherein the method
includes the following: [0294] a) immobilizing the alkyne modified
nucleic acids on a solid or semi-solid matrix to form an
immobilized alkyne modified nucleic acid; [0295] b) contacting the
immbolized alkyne modified nucleic acid with a reporter molecule
that contains an azide reactive group to form a contacted alkyne
modified nucleic acid; [0296] c) incubating the contacted alkyne
modified nucleic acid for a sufficient amount of time to form a
reporter molecule-nucleic acid conjugate; [0297] d) illuminating
the reporter molecule-nucleic acid conjugate with an appropriate
wavelength to form an illuminated reporter molecule-nucleic acid
conjugate, and [0298] e) observing the illuminated reporter
molecule-nucleic acid conjugate whereby the immobilized alkyne
modified nucleic acid is detected.
RNAi
[0299] RNAi is method for selectively decreasing gene expression
and is a cost effective method used to study specific gene targets.
Typically RNAi oligos are short 20 basepair nucleotides.
Hybridization of the oligonucleotide to a targeted gene triggers
specific degradation of the gene and thereby decreases gene
expression. Using Click modified oligos could potentially increase
the specificity of the Watson-Crick binding of these short
oligonucleotides by increasing the Tm. Similar types of experiments
have been done with locked nucleic acids (LNA) (Elmen, J. et al
2005, Nuc Acid Res). The Click modification could also potentially
decrease the susceptibility of the free RNAi oligos to destruction
by nucleases after transfection, thereby increasing the half life
and effectiveness of the oligonucleotides.
Methods Using Chemically Labeled Nucleic Acids
[0300] It was unexpectedly observed that azide modified-dATP and
alkyne modified-dUTP could be incorporated into a nucleic acid
polymer using amplification techniques including, but not limited
to PCR. It was also unexpectedly observed that azide modified-dATP
and alkyne modified-dUTP could be incorporated into a nucleic acid
polymer using a Telomerase resulting in Telomerase laddering (see
FIGS. 4-7 (Example 1-4). Telomerase is an enzyme that adds specific
DNA sequence repeats ("TTAGGG" in all vertebrates) to the 3'
("three prime") end of DNA strands in the telomere regions, which
are found at the ends of eukaryotic chromosomes. The enzyme is a
reverse transcriptase that carries its own RNA molecule, which is
used as a template when it elongates telomeres, which are shortened
after each replication cycle. Therfore, one aspect of the methods
of using the modified nucleotides described herein is in a
telomerase activity assay.
[0301] In another aspect, such modified nucleotides are labeled
using click-chemistry based, while in other embodiments such
modified nucleotides are labeled using Staudinger Ligation. In
still other embodiments, such modified nucleotides are labeled
using activated alkyne reactivity. In certain embodiments, the
modified nucleotides are azide modified nucleotides which are
labeled using click-chemistry, while in other embodiments such
modified nucleotides are azide nucleotides labeled using Staudinger
Ligation. In still other embodiments, such modified nucleotides are
azide modified nucleotides which are labeled using activated alkyne
reactivity. In certain embodiments, the modified nucleotides are
alkyne modified nucelotides which are labeled using
click-chemistry, while in other embodiments such modified
nucleotides are activated alkyne modified nucleotides which are
labeled using activated alkyne reactions with azides. In certain
embodiments, the modified nucleotides are azide modified-dATP which
are labeled using click-chemistry (see FIG. 6), while in other
embodiments such modified nucleotides are azide modified-dATP
labeled using Staudinger Ligation. In still other embodiments, such
modified nucleotides are azide modified-dATP which are labeled
using activated alkyne reactivity. In certain embodiments, the
modified nucleotides are alkyne modified-dATP which are labeled
using click-chemistry, while in other embodiments such modified
nucleotides are activated alkyne modified-dATP which are labeled
using activated alkyne reactions with azides. In certain
embodiments, the modified nucleotides are azide modified-dATP which
are labeled using click-chemistry, while in other embodiments such
modified nucleotides are azide modified-dUTP labeled using
Staudinger Ligation. In still other embodiments, such modified
nucleotides are azide modified-dATP or dUTP which are labeled using
activated alkyne reactivity. In certain embodiments, the modified
nucleotides are alkyne modified-dUTP which are labeled using
click-chemistry (see FIGS. 7-9), while in other embodiments such
modified nucleotides are activated alkyne modified-dUTP which are
labeled using activated alkyne reactions with azides. The
telomerase assay can serve as a highly significant cancer
diagnostic as this enzyme is activated in 90% of known human and
other animal cancers. The level of telomerase activity can be used
as a reliable biomarker that represents the different levels of the
cancer disease. Therefore, this assay can help diagnose and
evaluate the level of cancer progression in a patient and help
determine the response to anticancer treatments.
[0302] Thus, in one embodiment is provided a method of measuring
Telomerase Enzyme Activity, comprising steps of: [0303] a)
contacting a cell with an effective amount of a dNTP mix, a dNTP
that comprises an azide group or an alkyne group, a telomerase
substrate primer molecule that may contain a terminal biotin
molecule, a telomerase enzyme such that the azide or alkyne
modified dNTP is incorporated into at least one nucleic acid
polymer; [0304] b) contacting the nucleic acid polymer with a
reporter molecule comprising an alkyne, activated alkyne, azide, or
phosphine moiety to form a modified nucleic acid polymer reporter
molecule conjugate; [0305] c) separating the modified nucleic acid
polymer reporter molecule from free unreacted reporter; and [0306]
d) Detecting the labeled nucleic acid reporter molecule
conjugate.
[0307] In another aspect, such modified nucleotides described
herein are incorporated into nucleic acid polymers using the
methods described herein including, but not limited to, polymerase
chain reaction (PCR), ligation-based thermocycling approaches,
reverse transcription-PCR, real-time PCR, linear amplification
techniques and isothermal DNA amplification techniques such as, by
way of example only, real-time strand displacement amplification
(SDA), rolling-circle amplification (RCA), multiple-displacement
amplification (MDA), Q-beta replicase amplification, automated
Q-beta replicase amplification assay and other RNA polymerase
mediated techniques such as, for example, nucleic acid sequence
based amplification or NASBA. Such incorporated nucleotides are
then labeled using click-chemistry, while in other embodiments such
modified nucleotides are labeled using Staudinger Ligation. In
still other embodiments, such incorporated nucleotides are labeled
using activated alkyne reactivity. In certain embodiments, the
incorporated nucleotides are azide modified nucleotides which are
labeled using click-chemistry, while in other embodiments such
modified nucleotides are azide nucleotides labeled using Staudinger
Ligation. In still other embodiments, such incorporated nucleotides
are azide modified nucleotides which are labeled using activated
alkyne reactivity. In certain embodiments, the incorporated
nucleotides are alkyne modified nucelotides which are labeled using
click-chemistry, while in other embodiments such modified
nucleotides are activated alkyne modified nucleotides which are
labeled using activated alkyne reactions with azides. In certain
embodiments, the incorporated nucleotides are azide modified-dATP
which are labeled using click-chemistry (see FIG. 6), while in
other embodiments such modified nucleotides are azide modified-dATP
labeled using Staudinger Ligation. In still other embodiments, such
incorporated nucleotides are azide modified-dATP which are labeled
using activated alkyne reactivity. In certain embodiments, the
incorporated nucleotides are alkyne modified-dATP which are labeled
using click-chemistry, while in other embodiments such modified
nucleotides are activated alkyne modified-dATP which are labeled
using activated alkyne reactions with azides. In certain
embodiments, the incorporated nucleotides are azide modified-dUTP
which are labeled using click-chemistry, while in other embodiments
such modified nucleotides are azide modified-dUTP labeled using
Staudinger Ligation. In still other embodiments, such modified
nucleotides are azide modified-dUTP which are labeled using
activated alkyne reactivity. In certain embodiments, the
incorporated nucleotides are alkyne modified-dUTP which are labeled
using click-chemistry (see FIGS. 7-9), while in other embodiments
such modified nucleotides are activated alkyne modified-dUTP which
are labeled using activated alkyne reactions with azides.
[0308] In another aspect, such modified nucleotides described
herein are incorporated into nucleic acid polymers using isothermal
amplification. Such incorporated nucleotides are then labeled using
click-chemistry, while in other embodiments such modified
nucleotides are labeled using Staudinger Ligation. In still other
embodiments, such incorporated nucleotides are labeled using
activated alkyne reactivity. In certain embodiments, the
incorporated nucleotides are azide modified nucleotides which are
labeled using click-chemistry, while in other embodiments such
modified nucleotides are azide nucleotides labeled using Staudinger
Ligation. In still other embodiments, such incorporated nucleotides
are azide modified nucleotides which are labeled using activated
alkyne reactivity. In certain embodiments, the incorporated
nucleotides are alkyne modified nucelotides which are labeled using
click-chemistry, while in other embodiments such modified
nucleotides are activated alkyne modified nucleotides which are
labeled using activated alkyne reactions with azides. In certain
embodiments, the incorporated nucleotides are azide modified-dATP
which are labeled using click-chemistry, while in other embodiments
such modified nucleotides are azide modified-dATP labeled using
Staudinger Ligation. In still other embodiments, such incorporated
nucleotides are azide modified-dATP which are labeled using
activated alkyne reactivity. In certain embodiments, the
incorporated nucleotides are alkyne modified-dATP which are labeled
using click-chemistry, while in other embodiments such modified
nucleotides are activated alkyne modified-dATP which are labeled
using activated alkyne reactions with azides. In certain
embodiments, the incorporated nucleotides are azide modified-dUTP
which are labeled using click-chemistry, while in other embodiments
such modified nucleotides are azide modified-dUTP labeled using
Staudinger Ligation. In still other embodiments, such modified
nucleotides are azide modified-dUTP which are labeled using
activated alkyne reactivity. In certain embodiments, the
incorporated nucleotides are alkyne modified-dUTP which are labeled
using click-chemistry (see FIGS. 7-9), while in other embodiments
such modified nucleotides are activated alkyne modified-dUTP which
are labeled using activated alkyne reactions with azides. In
particular, FIG. 9 shows that E-dUTP can be incorporated using
various polymerases, thereby showing an isothermal DNA extension
assay for second strand cDNA synthesis using primer extension.
[0309] In certain embodiments, a mixture of modified nucleotides
are incorporated using the methods described herein including, but
not limited to, polymerase chain reaction (PCR), ligation-based
thermocycling approaches, reverse transcription-PCR, real-time PCR,
linear amplification techniques and isothermal DNA amplification
techniques such as, by way of example only, real-time strand
displacement amplification (SDA), rolling-circle amplification
(RCA), multiple-displacement amplification (MDA), Q-beta replicase
amplification, automated Q-beta replicase amplification assay and
other RNA polymerase mediated techniques such as, for example,
nucleic acid sequence based amplification or NASBA. In certain
embodiments the mixture of modified nucleotides is a mixture of
azide modified nucleotides, while in other embodiments the mixture
of modified nucleotides is a mixture of alkyne modified
nucleotides. In certain embodiments the mixture of modified
nucleotides is a mixture of azide modified dATP and dUTP
nucleotides, while in other embodiments the mixture of modified
nucleotides is a mixture of alkyne modified dATP and dUTP. In
certain embodiments, the nucleic acid polymers having a mixtures of
modified nucleotides is labeled as described above.
[0310] FIGS. 4 and 5 demonstrate that azido-dATP is incorporated by
telomerase enzyme which is a reverse transcriptase (RNA dependent
DNA polymerase), while FIG. 7 demonstrates that ethynyl-dUTP is
also incorporated by telomerase enzyme. Thus, another aspect of
methods using the modified nucleotides described herein is to
detect products of RT-PCR using a nucleotide mixtures containing
either an ethynyl or azido dNTP or enzymes such as reverse
transcriptase and DNA polymerase. The product of such an experiment
will be purified and then subjected to click based labeling method.
The final labeled product can be purified either by precipitation
or size exclusion chromatography. Additionally, the starting
telomerase primer can be biotinylated allowing for purification of
the telomerase modified product after the click reaction. The
method is an example of first strand cDNA synthesis (RT-PCR).
[0311] Another aspect using the modified nucleotides described
herein is "click" chemistry based oligonucleotide labeling for
Fluorescene In-Situ Hybridization (FISH) and Chromogenic In-Situ
Hybridization (CISH) and Silver In-situ Hybridization (SISH). In
such methods, standard polymerases including, but not limited to,
Klenow (Exo-), modified or wild type T7 DNA polymerase (Sequenase)
or Bst polymerase (Large fragment) are used to amplify a template
strand for a given sequence using primers as well as using ethynyl
or azido dNTPs. The prepared DNA fragments can then be purified and
subjected to the "click" reaction with either azido or alkyne
labels, fluorescent labels, Qdots and nanoparticles to create a
labeled probe. In certain embodiments, such probes are labeled
using Staudinger Ligation, while in other embodiments such probes
are labeled using activated alkyne reactions. Probes for methods
like insitu hybridization can also be created using PCR and all of
the commercially available PCR polymerases. Isothermal
amplification of plasmids or bacterial artificial chromosomes (BAC)
templates using phi29 DNA polymerase or other polymerases with
strand displacement activity can also be done. In certain
embodiments, labeling is done during a diagnostic or clinical
assay. In other embodiments, such labeling in FISH and CISH is an
automated in situ hybridization platforms where the hybridization
can be followed by the click reaction to generate the signal. By
way of example only, such automated systems are instruments from
Dako, Ventana Medical Systems, and Vision Biosystems.
[0312] In another aspect RNA probes can be used for FISH and CISH,
wherein such probes are labeled using "click" chemistry. In certain
embodiments, such probes are labeled using Staudinger Ligation,
while in other embodiments such probes are labeled using activated
alkyne reactions. In certain embodiments, such RNA probes are
prepared by the incorporation of modified nucleotides using
in-vitro transcription system to generate an RNA probe. Alternative
methods use small RNA oligonucleotides that can be labeled via
aminoallyl--NHS ester chemistry. In certain embodiments, DNA
dependent RNA polymerase from phage T7 or SP6 are used to
incorporate alkyne modified oligonucleotide, by way of example only
ethynyl oligonucleotides, or azido oligonucleotides to produce a
modified RNA probe. Such modified RNA probes are the labeled with
either azido or alkyne fluorescent or chromogenic labels using
"click chemistry", thereby generating fluoregenic or chromogenic
RNA probes.
Mofifying Phosphoproteins Using Nucleotide Analogs
[0313] In another aspect, phosphoproteins can be modified in vivo
or in vitro using alkyne or azide-tagged nucleotides whereby the
azide or alkyne moiety is placed on the gamma phosphate of
phosphoroproteins. By way of example only, such modifications can
be accomplished by adding one of the nucleotides shown in FIG. 1 to
a reaction mixture containing a protein kinase and a kinase target
molecule. In certain embodiments, the phophoroprotein is an
azide-containing phosphoroprotein that can be reacted under "click"
chemistry conditions with an alkyne containing label including, but
not limited to, fluorphores or affinity reagent for quantitation,
visualization, or enrichment. In certain embodiments, the
phophoroprotein is an alkyne-containing phosphoroprotein that can
be reacted under "click" chemistry conditions with an azide
containing label including, but not limited to, fluorphores or
affinity reagent for quantitation, visualization, or enrichment. In
other embodiments, such modified phosphoroproteins can be used to
form conjugates with a reporter molecule, a carrier molecule and/or
a solid substrate.
[0314] In one aspect, modified nucleotide substrates containing
azide or alkyne moieties are added directly to cultured cells for
metabolic incorporation of the tagged gamma-phosphate molecule into
cellular macromolecules including proteins. The process may involve
treatment of the cells with pharmacological agents to detect
alterations in phosphorylation dynamics. Entry of the compounds
into live cultured cells could be enhanced by modifying the
nucleotides with functional groups that would afford permeability,
or by concomitant addition of cell permeablizing agents.
[0315] In another aspect, the kinase reaction could be performed in
vitro using cellular extracts as the source of kinases and
substrates. The modified nucleotides would be added to the reaction
mixture and the reaction mixtures incubated with or without the
addition of pharmacological agents of interest. The in vitro
reaction may also entail adding an exogenous kinase or substrate
source to the cellular extract along with the nucleotide analogs.
In another application, the method could be used in vitro without
cellular extracts, using purified kinases and kinase substrates. In
certain embodiments, the kinase reaction can be conducted using
kinase substrates deposited as an array on a solid substrate.
[0316] In each of these aspects the reaction mix may contain a
buffer optimized for the particular kinase(s) of interest, a kinase
source, a metal ion source, glycerol, nucleotide ATP analog, and
ATP. The "click" detection reaction with an alkyne probe would be
performed in the presence of copper(I), or copper(II) in the
presence of a copper(II) reducing agent, a copper(I) chelating
agent, and an appropriate buffer to maintaing optimal pH
conditions.
[0317] In another aspect of methods using the modified nucleotides
described herein is the preparation of Peptide-nucleic Acid (PNA)
Conjugates using Click Chemistry, Staudinger Ligation or activated
alkyne reactions. In such methods, a peptide with an O-GlcNac
modification on one or more amino acids is subjected to a GalT1
reaction in the presence of UDP-GalNAz, resulting in an azido
modified peptide. Such Post-Translational modifications have been
described in the co-pending application entitled "Labeling of
Glycoproteins" with Ser. No. 60/772,221, which is herein
incorporated by reference in its entirety. In addition any
post-translationally modified protein described in the co-pending
application entitled "Labeling of Glcoproteins" with Ser. No.
60/772,221 can be used in the methods using modified nucleotide as
described herein In certain embodiments, a peptide-nucleic acid
conjugate is created by reacting the an azido-linked peptide with
an alkynyl modified oligonucleotides under "click" chemistry
reaction conditions. In certain embodiments, a peptide-nucleic acid
conjugate is created by reacting the an azido-linked peptide with
an alkynyl modified oligonucleotides in presence of 1 or 2 mM
copper, 10 mM Sodium Ascorbate and 20 mM BCS. In certain
embodiments, a peptide-nucleic acid conjugate is created by
reacting the an azido-linked peptide with an ethynyl modified
oligonucleotides under "click" chemistry reaction conditions. In
certain embodiments, a peptide-nucleic acid conjugate is created by
reacting the an azido-linked peptide with an ethynyl modified
oligonucleotides in presence of 1 or 2 mM copper, 10 mM Sodium
Ascorbate and 20 mM BCS.
[0318] In certain embodiments, a peptide-nucleic acid conjugate is
created by reacting the an alkyne-linked peptide with an azide
modified oligonucleotide under "click" chemistry reaction
conditions. In certain embodiments, a peptide-nucleic acid
conjugate is created by reacting the an alkyne-linked peptide with
an azide modified oligonucleotide in presence of 1 or 2 mM copper,
10 mM Sodium Ascorbate and 20 mM BCS. In certain embodiments, a
peptide-nucleic acid conjugate is created by reacting an
ethynyl-linked peptide with an azide modified oligonucleotides
under "click" chemistry reaction conditions. In certain
embodiments, a peptide-nucleic acid conjugate is created by
reacting the ethynyl-linked peptide with an azide modified
oligonucleotides in presence of 1 or 2 mM copper, 10 mM Sodium
Ascorbate and 20 mM BCS.
Samples and Sample Preparation
[0319] The end user will determine the choice of the sample and the
way in which the sample is prepared. Samples that can be used with
the methods and compositions described herein include, but are not
limited to, any biological derived material or aqueous solution
that contains a nucleic acid. In certain embodiments, a sample also
includes material in which a nucleic acid has been added. The
sample that can be used with the methods and compositions described
herein can be a biological fluid including, but not limited to,
whole blood, plasma, serum, nasal secretions, sputum, saliva,
urine, sweat, transdermal exudates, cerebrospinal fluid, or the
like. In other embodiments, the samples are biological fluids that
include tissue and cell culture medium wherein nucleic acid of
interest has been secreted into the medium. Cells used in such
cultures include, but are not limited to, prokaryotic cells and
eukaryotic cells that include primary cultures and immortalized
cell lines. Such eukaryotic cells include, without limitation,
ovary cells, epithelial cells, circulating immune cells, .beta.
cells, hepatocytes, and neurons. In certain embodiments, the sample
may be whole organs, tissue or cells from an animal, including but
not limited to, muscle, eye, skin, gonads, lymph nodes, heart,
brain, lung, liver, kidney, spleen, thymus, pancreas, solid tumors,
macrophages, mammary glands, mesothelium, and the like.
[0320] Various buffers can be used in the methods described herein,
including inorganic and organic buffers. In certain embodiments the
organic buffer is a zwitterionic buffer. By way of example only,
buffers that can be used in the methods described herein include
phosphate buffered saline (PBS), phosphate, succinate, citrate,
borate, maleate, cacodylate, N-(2-Acetamido)iminodiacetic acid
(ADA), 2-(N-morpholino)-ethanesulfonic acid (MES),
N-(2-acetamido)-2-aminoethanesulfonic acid (ACES),
piperazine-N,N'-2-ethanesulfonic acid (PIPES),
2-(N-morpholino)-2-hydroxypropanesulfonic acid (MOPSO),
N,N-bis-(hydroxyethyl)-2-aminoethanesulfonic acid (BES),
3-(N-morpholino)-propanesulfonic acid (MOPS),
N-tris-(hydroxymethyl)-2-ethanesulfonic acid (TES),
N-2-hydroxyethyl-piperazine-N-2-ethanesulfonic acid (HEPES),
3-(N-tris-(hydroxymethyl) methylamino)-2-hydroxypropanesulfonic
acid (TAPSO),
3-(N,N-Bis[2-hydroxyethyl]amino)-2-hydroxypropanesulfonic acid
(DIPSO), N-(2-Hydroxyethyl)piperazine-N'-(2-hydroxypropanesulfonic
acid) (HEPPSO), 4-(2-Hydroxyethyl)-1-piperazinepropanesulfonic acid
(EPPS), N-[Tris(hydroxymethyl)methyl]glycine (Tricine),
N,N-Bis(2-hydroxyethyl)glyeine (Bicine),
(2-Hydroxy-1,1-bis(hydroxymethyl)ethyl)amino]-1-propanesulfonic
acid (TAPS),
N-(1,1-Dimethyl-2-hydroxyethyl)-3-amino-2-hydroxypropanesulfonic
acid (AMPSO), tris (hydroxy methyl) amino-methane (Tris),
TRIS-Acetate-EDTA (TAE), glycine,
bis[2-hydroxyethyl]iminotris[hydroxymethyl]methane (BisTris), or
combinations thereof. In certain embodiments, wherein such buffers
are used in gel electrophoresis separations the buffer can also
include ethylene diamine tetraacetic acid (EDTA).
[0321] The concentration of such buffers used in the methods
described herein is from about 0.1 mM to 1 m. In certain
embodiments the concentration is between 10 mM to about 1 m. In
certain embodiments the concentration is between about 20 mM and
about 500 mM, and in other embodiments the concentration is between
about 50 mM and about 300 mM. In certain embodiments, the buffer
concentration is from about 0.1 mM to about 50 mM, while in other
embodiments the buffer concentration if from about 0.5 mM to about
20 mM.
[0322] The pH will vary depending upon the particular assay system,
generally within a readily determinable range wherein one or more
of the sulfonic acid moieties is deprotonated.
[0323] In certain embodiments, buffers used in the methods
described herein have a pH between 5 and 9 at ambient temperature.
In certain embodiments the buffer has a pH between 6 and 8.5 at
ambient temperature. In certain embodiments the buffer has a pH
between 6 and 8 at ambient temperature. In certain embodiments the
buffer has a pH between 6 and 7 at ambient temperature. In certain
embodiments the buffer has a pH between 5 and 9 at 25.degree. C. In
certain embodiments the buffer has a pH between 6 and 8.5 at
25.degree. C. In certain embodiments the buffer has a pH between 6
and 8 at 25.degree. C. In certain embodiments the buffer has a pH
between 6 and 7 at 25.degree. C.
[0324] In certain embodiments, the samples used in the methods
described herein have a non-ionic detergent to the sample.
Non-limiting examples of such non-ionic detergents added to the
samples used in the methods described herein are polyoxyalkylene
diols, ethers of fatty alcohols including alcohol ethoxylates
(Neodol from Shell Chemical Company and Tergitol from Union Carbide
Corporation), alkyl phenol ethoxylates (Igepal surfactants from
General Aniline and Film Corporation), ethylene oxide/propylene
oxide block copolymers (PLURONIC.TM. Series from BASF Wyandotte
Corporation), polyoxyethylene ester of a fatty acids (Stearox CD
from Monsanto Company), alkyl phenol surfactants (Triton series,
including Triton X-100from Rohm and Haas Company), polyoxyethylene
mercaptan analogs of alcohol ethoxylates (Nonic 218 and Stearox SK
from Monsanto Company), polyoxyethylene adducts of alkyl amines
(Ethoduomeen and Ethomeen surfactants from Armak Company),
polyoxyethylene alkyl amides, sorbitan esters (such as sorbitan
monolaurate) and alcohol phenol ethoxylate (Surfonic from Jefferson
Chemical Company, Inc.). Non-limiting examples of sorbitan esters
include polyoxyethylene(20) sorbitan monolaurate (TWEEN20),
polyoxyethylene(20) sorbitan monopalmitate (TWEEN40),
polyoxyethylene(20) sorbitan monostearate (TWEEN60) and
polyoxyethylene(20) sorbitan monooleate (TWEEN 80). In certain
embodiments, the concentration of such non-ionic detergents added
to a sample is from 0.01 to 0.5%. In other embodiments the
concentration is from about 0.01 to 0.4 vol. %. In other
embodiments the concentration is from about 0.01 to 0.3 vol. %. In
other embodiments the concentration is from about 0.01 to 0.2 vol.
%. In other embodiments the concentration is from about 0.01 to 0.1
vol. %.
Illumination
[0325] The compounds and compositions described herein may, at any
time before, after or during an assay, be illuminated with a
wavelength of light that results in a detectable optical response,
and observed with a means for detecting the optical response. In
certain embodiments, such illumination can be by a violet or
visible wavelength emission lamp, an arc lamp, a laser, or even
sunlight or ordinary room light, wherein the wavelength of such
sources overlap the absortion spectrum of a fluorpohore or
chromaphore of the compounds or compositions decribed herein. In
certain embodiments, such illumination can be by a violet or
visible wavelength emission lamp, an arc lamp, a laser, or even
sunlight or ordinary room light, wherein the fluorescent compounds,
including those bound to the complementary specific binding pair
member, display intense visible absorption as well as fluorescence
emission.
[0326] In certain embodiments, the sources used for illuminating
the fluorpohore or chromophore of the compounds or compositions
decribed herein include, but are not limited to, hand-held
ultraviolet lamps, mercury arc lamps, xenon lamps, argon lasers,
laser diodes, blue laser diodes, and YAG lasers. These illumination
sources are optionally integrated into laser scanners, flow
cytometer, fluorescence microplate readers, standard or mini
fluorometers, or chromatographic detectors. These fluorescence
emission of such fluorophores is optionally detected by visual
inspection, or by use of any of the following devices: CCD cameras,
video cameras, photographic film, laser scanning devices,
fluorometers, photodiodes, photodiode arrays, quantum counters,
epifluorescence microscopes, scanning microscopes, flow cytometers,
fluorescence microplate readers, or by means for amplifying the
signal such as photomultiplier tubes. Where the sample is examined
using a flow cytometer, a fluorescence microscope or a fluorometer,
the instrument is optionally used to distinguish and discriminate
between the fluorescent compounds of the invention and a second
fluorophore with detectably different optical properties, typically
by distinguishing the fluorescence response of the fluorescent
compounds of the invention from that of the second fluorophore.
Where a sample is examined using a flow cytometer, examination of
the sample optionally includes isolation of particles within the
sample based on the fluorescence response by using a sorting
device.
[0327] In certain embodiments, fluorescence is optionally quenched
using either physical or chemical quenching agents. Examples of
quenching moieties include, but are not limited to DABCYL (i.e.,
4-(4'-dimethylaminophenylazo)-benzoic acid) succinimidyl ester,
diarylrhodamine carboxylic acid, succinimidyl ester (or QSY-7), and
4',5'-dinitrofluorescein carboxylic acid, succinimidyl ester (or
QSY-33) (all available, for example, from Molecular Probes),
quencher1 (Q1; available from Epoch Biosciences, Bothell, Wash.),
or "Black hole quenchers" BHQ-1, BHQ-2, and BHQ-3 (available from
BioSearch Technologies, Inc., Novato, Calif.).
Kits of the Invention
[0328] In another aspect, the present invention provides kits that
include N.sub.3-dATP, an enzyme; an azide reactive reporter
molecule, carrier molecule or solid support.
[0329] In one aspect, the invention includes a kit for labeling a
nucleic acid that includes at least one label that comprises a
terminal alkyne, a solution comprising copper, and a solution that
comprises a copper (I) chelator. The kit can further comprise a
solution that comprises a reducing agent, one or more buffers, or
one or more detergents.
[0330] In one embodiment, an alkyne label provided in a kit is a
fluorophore, such as, but not limited to, a xanthene, coumarin,
borapolyazaindacene, pyrene and cyanine In one embodiment, a kit
provides two or more different terminal alkyne-containing labels
one or more of which is a fluorophore, In other embodiments, an
alkyne label provided in a kit is a tag, such as but not limited to
a peptide or a hapten, such as biotin.
[0331] In preferred embodiments, a copper (I) chelator provided in
the kit is a 1,10 phenanthroline, preferably bathocuproine
disulfonic acid. In some embodiments, copper is provided in the
form of a copper sulfate or copper acetate solution. In some
embodiments, a reducing agent is provided in the form of
ascorbate.
[0332] In another aspect, the invention includes a kit for labeling
a nucleic acid that includes at least one label that comprises an
azido group, a solution comprising copper, an a solution that
comprises a copper (I) chelator. The kit can further comprise a
solution that comprises a reducing agent, one or more buffers, or
one or more detergents.
[0333] In one embodiment of this aspect, an azido-containing label
provided in a kit is a fluorophore, such as, but not limited to, a
xanthene, coumarin, borapolyazaindacene, pyrene and cyanine In
other embodiments, an azido label provided in a kit is a tag, such
as but not limited to a peptide or a hapten, such as biotin.
[0334] In one embodiment, a kit provides two or more different
azido-containing labels one or more of which is a fluorophore, In
preferred embodiments, a copper (I) chelator provided in the kit is
a 1,10 phenanthroline, preferably bathocuproine disulfonic acid. In
some embodiments, copper is provided in the form of a copper
sulfate or copper acetate solution. In some embodiments, a reducing
agent is provided in the form of ascorbate.
[0335] A detailed description of the invention having been provided
above, the following examples are given for the purpose of
illustrating the invention and shall not be construed as being a
limitation on the scope of the invention or claims.
Examples
Example 1
Telomerase Assay with N.sub.3-dUTP and N.sub.3-dATP
[0336] TRAPeze.TM. TELOMERASE assays (Chemicon Kit 57700) were
performed with N.sub.3-dUTP and N.sub.3-dATP. Each reaction
contained the following: [0337] (a) 1.times. TRAP reaction buffer
(20 mM Tris-HCl, pH 8.3, 1.5 MgCl.sub.2 63 mM KCl, 0.05% Tween 20,
1 mM EGTA) [0338] (b) 50 .mu.M of different combinations of
deoxynucleoside triphosphates (see Table 1 for details) [0339] (c)
1 .mu.l of TS primer (TRAPeze Telomerase Kit, Chemicon) [0340] (d)
1 .mu.l of Primer Mix (contains three separate primers--a K1 Fwd
primer, RP Rev Primer and TSK 1 internal control primer from the
(TRAPeze Telomerase Kit, Chemicon) [0341] (e) 2 units of Taq DNA
polymerase [0342] (f) 2 .mu.l of positive control cells (500 cells)
of the TRAPeze Telomerase Kit
[0343] (Chemicon). The cell extract was prepared and further
diluted in CHAPS buffer, the components of which were 10 mM
Tris-HCl pH 7.5, 1 mM MgCl.sub.2, 1 mM EGTA, 0.1 mM Benzamidine, 5
mm .beta.-mercaptoethanol, 0.5% CHAPS and 10% Glycerol. [0344] (g)
PCR grade water as required to bring the volume of each reaction to
50 .mu.l.
[0345] The reaction was carried out in an Applied Biosystems PCR
instrument under the following conditions: 30.degree. C.-30
minutes-hold [0346] 32 cycles of 95.degree. C.-30 sec [0347]
59.degree. C.-30 sec [0348] 72.degree. C.-1 minute [0349] Followed
by: 4.degree. C.-infinity
[0350] The reactions were pulled out, mixed with TRACK-IT Cyan
orange loading dye. The reactions labeled 1,2,3,4 (see FIG. 4 and
Table 1) were subjected to a 4-20% Tri Borate EDTA--polyacrylamide
gel. The gel was run at 10V for 10 minutes; 190V for 90 minutes.
The gel was then pulled out of the cassette and stained with
1:10,000 fold dilution of stock SYBR GOLD in TBE for 20-30 minutes
and then scanned for a signal (Ex: 473, Em:520).
[0351] The results of the amplification are shown in FIG. 4, and
the listing of the dNTP combinations in each reaction (gel lane) is
given in Table 1.
TABLE-US-00003 TABLE 1 dNTP combinations in the reactions Lanes (in
gel) dNTPs 1 50 .mu.M of dATP dTTP, dCTP, and dGTP. 2 50 .mu.M of
N.sub.3-dUTP, dATP, dCTP, and dGTP 3 50 .mu.M of N.sub.3-dATP,
dATP, dCTP, and dGTP 4 50 .mu.M of N.sub.3-dUTP, N.sub.3-dATP,
dCTP, and dGTP
The left most lane labeled "L" on the gel is a 10 bp ss DNA ladder
(200 ng per lane).
[0352] From FIG. 4 it is seen that N.sub.3-dUTP is incorporated by
Taq polymerase (lane 2), and that N.sub.3-dATP is incorporated both
by telomerase and Taq polymerase (lane 3).
Example 2
Dose-Dependence of Telomerase Assay with N.sub.3-dUTP and
N.sub.3-dATP
[0353] TRAPeze.TM. TELOMERASE assays (Chemicon Kit 57700) were
performed with N.sub.3-dUTP and N.sub.3-dATP. Each reaction
contained the following: [0354] (a) 1.times. TRAP reaction buffer
(20 mM Tris-HCl, pH 8.3, 1.5 MgCl.sub.2 63 mM KCl, 0.05% Tween 20,
1 mM EGTA) [0355] (b) 50 .mu.M of deoxynucleoside triphosphates
(see Table 2 for details) [0356] (c) 1 .mu.l of TS primer (TRAPeze
Telomerase Kit, Chemicon) [0357] (d) 1 .mu.l of Primer Mix
(contains three separate primers--a K1 Fwd primer, RP Rev Primer
and TSK 1 internal control primer from the (TRAPeze Telomerase Kit,
Chemicon) [0358] (e) 2 units of Taq DNA polymerase [0359] (f) 2
.mu.l of positive control cells (500 cells) of the TRAPeze
Telomerase Kit
[0360] (Chemicon). The cell extract was prepared and further
diluted in CHAPS buffer, the components of which were 10 mM
Tris-HCl pH 7.5, 1 mM MgCl.sub.2, 1 mM EGTA, 0.1 mM Benzamidine, 5
mm .beta.-mercaptoethanol, 0.5% CHAPS, and 10% Glycerol [0361] (g)
PCR grade water as required to bring the volume of each reaction to
50 .mu.l.
[0362] The reaction was carried out in an Applied Biosystems PCR
instrument under the following conditions: 30.degree. C.-30
minutes-hold (At the end of the 30 minute Telomerase reaction,
appropriate volumes of azido-dNTPs were added to bring the final
concentration to 50 .mu.M. The PCR step was then carried out after
that) [0363] 32 cycles of 95.degree. C.-30 sec [0364] 59.degree.
C.-30 sec [0365] 72.degree. C.-1 minute [0366] Followed by:
4.degree. C.-infinity
[0367] The reactions were pulled out, mixed with TRACK-IT Cyan
orange loading dye. The reactions labeled 1,2,3,4 (see FIG. 5 and
Table 2) were subjected to a 4-20% Tris Borate EDTA--polyacrylamide
gel. The gel was run at 10V for 10 minutes; 190V for 90 minutes.
The gel was then pulled out of the cassette and stained with
1:10,000 fold dilution of stock SYBR GOLD in TBE for 20-30 minutes
and then scanned for a signal (Ex: 473, Em:520).
[0368] The results of the amplification are shown in FIG. 5, and
the listing of the dNTP combinations in each reaction (gel lane) is
given in Table 2.
TABLE-US-00004 TABLE 2 dNTP combinations in the reactions Lanes (in
gel) dNTPs 1 50 .mu.M of dATP, dTTP, dCTP, and dGTP. 2 50 .mu.M
N.sub.3-dUTP, dATP, dCTP, and dGTP 3 10 .mu.M N.sub.3-dUTP, 50
.mu.M dATP, dCTP, and dGTP 4 1 .mu.M N.sub.3-dUTP, 50 .mu.M dATP,
dCTP, and dGTP 5 0.1 .mu.M N.sub.3-dUTP, 50 .mu.M dATP, dCTP, and
dGTP 6 50 .mu.M N.sub.3-dATP, dTTP, dCTP, and dGTP 7 10 .mu.M
N.sub.3-dATP, 50 .mu.M dATP, dCTP, and dGTP 8 1 .mu.M N.sub.3-dATP,
50 .mu.M dATP, dCTP, and dGTP 9 0.1 .mu.M N.sub.3-dATP, 50 .mu.M
dATP, dCTP, and dGTP
The left most lane labeled "L" on the gel is a 10 bp ss DNA ladder
(200 ng per lane).
[0369] From FIG. 5 it is seen that N.sub.3-dUTP is not incorporated
by the Telomerase enzyme within a range of 100 nM to 50 micro
molar, but it is incorporated by Taq polymerase (lane 2-5).
However, N.sub.3-dATP is incorporated both by telomerase and Taq
polymerase (lanes 6-9).
Example 3
"Click"-Chemistry Based Telomerase Activity Assay
Dose-Dependence of Telomerase Assay with N.sub.3-dATP
[0370] TRAPeze.TM. TELOMERASE assays (Chemicon Kit 57700) were
performed with N.sub.3-dATP. Each reaction contained the following:
[0371] (a) 1.times. TRAP reaction buffer (20 mM Tris-HCl, pH 8.3,
1.5 MgCl.sub.2 63 mM KCl, 0.05% Tween 20, 1 mM EGTA) [0372] (b) 50
.mu.M of different combinations of deoxynucleoside triphosphates
(see Table 3 for details) [0373] (c) 1.mu.l of TS primer (TRAPeze
Telomerase Kit, Chemicon) [0374] (d) 1.mu.l of Primer Mix (contains
three separate primers--a K1 Fwd primer, RP Rev Primer and TSK 1
internal control primer from the (TRAPeze Telomerase Kit, Chemicon)
[0375] (e) 2 units of Taq DNA polymerase [0376] (f) 2 .mu.l of
positive control cells (500 cells) of the TRAPeze Telomerase Kit
(Chemicon). The cell extract was prepared and further diluted in
CHAPS buffer, the components of which were 10 mM Tris-HCl pH 7.5, 1
mM MgCl.sub.2, 1 mM EGTA, 0.1 mM Benzamidine, 5 mm
.beta.-mercaptoethanol, 0.5% CHAPS, and 10% Glycerol [0377] (g) PCR
grade water as required to bring the volume of each reaction to 50
.mu.l.
[0378] The reaction was carried out in an Applied Biosystems PCR
instrument under the following conditions: 30.degree. C.-30
minutes-hold [0379] 32 cycles of 95.degree. C.-30 sec [0380]
59.degree. C.-30 sec [0381] 72.degree. C.-1 minute [0382] Followed
by: 4.degree. C.-infinity
[0383] The reactions were cleaned through size exclusion columns
(Chromaspin TE30, Clonetech). The eluate was then subjected to
click reaction using a final concentration of 25% propylene glycol;
1 mM copper sulfate; 10 mM bathocuproinedisulfonic acid (BCS), 10
mM Sodium Ascorbate and 50 .mu.M alkyne-TAMRA. The reaction was
performed for 30 minutes at room temperature. This was followed by
clean up on a size exclusion as described above. The reactions were
pulled out, mixed with the TRACK-IT Cyan orange loading dye. The
reactions (see FIG. 6 and Table 3) were subjected to a 20%
TBE--polyacrylamide gel. The gel was run at 10V for 10 minutes;
190V for 90 minutes. The gel was pulled out of the cassette and
scanned for TAMRA (Ex: 530 nm Em: 580 nm). The same gel was then
stained with SYBR GOLD for 30 minutes and then scanned as described
above.
[0384] The results of the amplification are shown in FIG. 6, and
the listing of the dNTP combinations in each reaction (gel lane) is
given in Table 3.
TABLE-US-00005 TABLE 3 dNTP combinations in the reactions Lanes (in
gel) dNTPs 1 or a 50 .mu.M of dATP, dTTP, dCTP, and dGTP. 2 or b 50
.mu.M of dATP, dTTP, dCTP, and dGTP 3 or c 10 .mu.M N.sub.3-dATP +
40 .mu.M dATP, 50 .mu.M dATP, dCTP, and dGTP 4 or d 30 .mu.M dATP +
20 .mu.M N.sub.3-dATP, 50 .mu.M dTTP, dCTP, and dGTP 5 or e 25
.mu.M dATP + 25 .mu.M N.sub.3-dATP, 50 .mu.M dTTP, dCTP, and dGTP 6
or f 20 .mu.M dATP + 30 .mu.M N.sub.3-dATP, 50 .mu.M dTTP, dCTP,
and dGTP 7 or g 10 .mu.M dATP + 40 .mu.M N.sub.3-dATP, 50 .mu.M
dTTP, dCTP, and dGTP 8 or h 50 .mu.M N.sub.3-dATP, 50 .mu.M dTTP,
dCTP, and dGTP
The left most lane labeled "L" on the gel is a 10 bp ss DNA ladder
(200 ng per lane).
[0385] From FIG. 6 it is seen that there is a dose dependence of
the "click" reaction with the best signal coming from the 100% 50
.mu.M of N.sub.3-dATP. Also the PCR reaction with 50 .mu.M of
N.sub.3-dATP was not as efficient.
Example 4
"Click"-Chemistry Based Telomerase Activity Assay
Dose-Dependence of Telomerase Assay with E-dUTP
[0386] TRAPeze.TM. TELOMERASE assays (Chemicon Kit 57700) were
performed with ethynyl-dUTP. Each reaction contained the following:
[0387] (a) 1.times. TRAP reaction buffer (20 mM Tris-HCl, pH 8.3,
1.5 MgCl.sub.2 63 mM KCl, 0.05% Tween 20, 1 mM EGTA) [0388] (b) 50
.mu.M of different combinations of deoxynucleoside triphosphates
(see Table 4 for details) [0389] (c) 1 .mu.l of TS primer (TRAPeze
Telomerase Kit, Chemicon) [0390] (d) 1 .mu.l of Primer Mix
(contains three separate primers--a K1 Fwd primer, RP Rev Primer
and TSK 1 internal control primer from the (TRAPeze Telomerase Kit,
Chemicon) [0391] (e) 2 units of Taq DNA polymerase [0392] (f) 2
.mu.l of positive control cells (500 cells) of the TRAPeze
Telomerase Kit (Chemicon). The cell extract was prepared and
further diluted in CHAPS buffer, the components of which were 10 mM
Tris-HCl pH 7.5, 1 mM MgCl.sub.2, 1 mM EGTA, 0.1 mM Benzamidine, 5
mm .beta.-mercaptoethanol, 0.5% CHAPS, and 10% Glycerol [0393] (g)
PCR grade water as required to bring the volume of each reaction to
50 .mu.l.
[0394] The reaction was carried out in an Applied Biosystems PCR
instrument under the following conditions: 30.degree. C.-30
minutes-hold [0395] 32 cycles of 95.degree. C.-30 sec [0396]
59.degree. C.-30 sec [0397] 72.degree. C.-1 minute [0398] Followed
by: 4.degree. C.-infinity
[0399] The reactions were cleaned through size exclusion columns
(Chromaspin TE30, Clonetech). The eluate was then subjected to
click reaction using a final concentration of 25% propylene glycol;
1 mM copper sulfate; 10 mM BCS, 10 mM Sodium Ascorbate and 50 .mu.M
azido-TAMRA. The reaction was performed for 30 minutes at room
temperature. This was followed by clean up on a size exclusion as
described above. The reactions were pulled out, mixed with the
TRACK-IT Cyan orange loading dye. The reactions (see FIG. 7 and
Table 4) were subjected to a 20% TBE--polyacrylamide gel. The gel
was run at 10V for 10 minutes; 190V for 90 minutes. The gel was
pulled out of the cassette and scanned for TAMRA (Ex: 530 nm Em:
580 nm). The same gel was then stained with SYBR GOLD for 30
minutes and then scanned as described above.
[0400] The results of the amplification are shown in FIG. 7, and
the listing of the dNTP combinations in each reaction (gel lane) is
given in Table 4.
TABLE-US-00006 TABLE 4 dNTP combinations in the reactions Lanes (in
gel) dNTPs 1 or A 50 .mu.M of dATP, dTTP, dCTP, and dGTP. 2 or B 50
.mu.M of dATP, dTTP, dCTP, and dGTP 3 or C 40 .mu.M dTTP + 10 .mu.M
e-dUTP, 50 .mu.M dATP, dCTP, and dGTP 4 or D 30 .mu.M dTTP + 20
.mu.M e-dUTP, 50 .mu.M dATP, dCTP, and dGTP 5 or E 25 .mu.M dTTP +
25 .mu.M e-dUTP, 50 .mu.M dATP, dCTP, and dGTP 6 or F 20 .mu.M dTTP
+ 30 .mu.M e-dUTP, 50 .mu.M dATP, dCTP, and dGTP 7 or G 10 .mu.M
dTTP + 40 .mu.M e-dUTP, 50 .mu.M dATP, dCTP, and dGTP 8 or H 50
.mu.M e-dUTP, 50 .mu.M dTTP, dCTP, and dGTP
The left most lane labeled "L" on the gel is the 10 bp ss DNA
ladder (200 ng per lane).
[0401] From FIG. 7 it is seen that there is a dose dependence of
the click reaction with the best signal coming from the 100% 50
.mu.M of N.sub.3-dATP. Also the PCR reaction with 50 .mu.M of
E-dUTP was as efficient as with natural dNTPs.
Example 5
PCR Incorporation and Detection of Azide or Alkyne Nucleic
Acids
[0402] The reaction was carried out in an Applied Biosystems PCR
instrument under the following conditions: 30.degree. C.-30
minutes-hold [0403] 32 cycles of 95.degree. C.-30 sec [0404]
59.degree. C.-30 sec [0405] 72.degree. C.-1 minute [0406] Followed
by: 4.degree. C.-infinity In addition, PCR was preformed with Taq
and Pfu-turbo DNA polymerase. Briefly, a 1 pmol of either a 36
(lane 1/5/1/f) or 38 (lanes 2/6/b/g) or 44 (lanes 3/7/c/h)or 60 bp
(lanes 4/8/d/1) amplicon was amplified by PCR using 10 nmolar
forward and reverse Primer, 50 .mu.M modified dNTPs (e-dUTP, dTTP,
dCTP, and dGTP), 1.times. Taq or Pfu Turbo buffer and 1.5 mM MgCl2
(for Taq polymerase).
[0407] The reactions were cleaned through size exclusion columns
(Chromaspin TE30, Clonetech). The eluate was then subjected to
click reaction using a final concentration of 25% propylene glycol;
1 mM copper sulfate; 10 mM BCS, 10 mM Sodium Ascorbate and 50 .mu.M
azido-TAMRA or 50 .mu.M alkyne-TAMRA. The reaction was performed
for 30 minutes at room temperature. This was followed by clean up
on a size exclusion as described above. The reactions were pulled
out, mixed with the TRACK-IT Cyan orange loading dye. The reactions
(see FIG. 8 and Table 4) were subjected to a 20%
TBE--polyacrylamide gel. The gel was run at 10V for 10 minutes;
190V for 90 minutes. The gel was pulled out of the cassette and
scanned for TAMRA (Ex: 530 nm Em: 580 nm). The same gel was then
stained with SYBR GOLD for 30 minutes and then scanned as described
above.
[0408] FIG. 8 shows a 20% TBE PAGE that has been scanned for TAMRA
(left; Ex 532-Em 580) followed by staining with SYBR GOLD (right).
Lanes 1, 2, 3 and 4 (or a, b, c, d) have been loaded with 2 ul of
the PCR product while lanes 5,6,7 and 8 (or f, g, h, 1, k) have
been loaded with 6 ul of the PCR product. The fact that one can see
ladders or the 36 bp internal control band in a TRAP assay
indicates that not only can Telomerase incorporate azido or alkyne
modified compounds but Taq polymerase can also do the same, since
the subsequent step in TRAP assay after Telomerase reaction is the
PCR step.
Example 6
Incorporation of E-dUTP in an Isothermal Extension Assay Using
Different Polymerases
[0409] Single stranded DNA oligomers shown below were used for a
primer extension assay using "clickable" dNTPs. The oligos used
were designed to titrate the dUTP in the sequence.
Oligo 3
TABLE-US-00007 [0410] (SEQ ID NO: 1)
5'-TTAGGGTTAGGGTTAGGGTTTGGGTTTGGGTTTGGGTTTGGGTTT
GGGTTTGGGCTGGCCGTCGTTTTAC
Oligo 4
TABLE-US-00008 [0411] (SEQ ID NO: 2)
5'-TTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGGGTTT
GGGTTTGGGCTGGCCGTCGTTTTAC
M13 Primer for Annealing at the End of all of these Oligos
TABLE-US-00009 5'-GTAAAACGACGGCCAG-3' (SEQ ID NO: 3)
[0412] 100 pmol of Oligo 3 or 4 were annealed with the 500 pmol M13
primer in an annealing buffer (7 mM Tris-HCl pH 7.5, 2.5 mM MgCl2,
20 mM NaCl). The reaction mix was heated up to 95 C for 5 minutes,
20 minutes at 65 C and then cooled to ambient temperatures. All the
reactions were supplied with 50 uM dNTPs each. The dNTP mix
consisted of 50 uM of e-dUTP, dATP, dGTP, dCTP each. The reaction
was initiated by addition of the polymerase. Details of the
different reactions are given in Table 5:
TABLE-US-00010 TABLE 5 Lane Oligo polymerase Conditions of
experiment 1 or a O3 Klenow (Exo -ve) Annealing buffer/30 ` @37 C.
2 or b O3 Taq polymerase 1X TS buffer (1.5 mM MgCl2)/ 30 ` @72 C.
for 30, in a dry bath 3 or c O3 Pfu (Turbo) 1 X Pfu turbo buffer/95
C. for 30 seconds; 59 C. for 1 minute; 72 C. for 2` in an applied
biosystems PCR instrument 4 or d O3 Taq polymerase 1 X annealing
buffer (2.5 mM MgCl2)/same conditions as for reaction 3 5 or e O4
Klenow (Exo -ve) Annealing buffer/30 ` @37 C. 6 or f O4 Taq
polymerase 1X TS buffer (1.5 mM MgCl2)/ 30 ` @72 C. for 30, in a
dry bath 7 or g O4 Pfu (Turbo) 1 X Pfu turbo buffer/95 C. for 30
seconds; 59 C. for 1 minute; 72 C. for 2` in an applied biosystems
PCR instrument 8 or h O4 Pfu (Turbo) 1 X Pfu turbo buffer/95 C. for
30 seconds; 59 C. for 1 minute; 72 C. for 2` in an applied
biosystems PCR instrument
Lanes designated L.sub.a and L .sub.b are the 25 bp DNA ladder.
[0413] The extended dsDNA product was subjected to a "click"
reaction. The volume of the reaction product was brought to 25 of
50 ul. The final concentrations of the reaction components were 25%
propylene glycol, 1 mM Copper (II), 10 mM Sodium Ascorbate, 10 mM
BCS and 50 uM azido-TAMRA. The reactions were rocked on a tube
shaker for 30-60 minutes at room temperature. The contents of the
tube were then subjected to size exclusion chromatography using
Chroamspin columns. The purified ds DNA was then mixed with 1/10
volume of 10.times. blue juice and loaded on to a 2-% TBE PAGE
which was run at constant 200V for 2 hours.
[0414] After completion of the run the gel was scanned for TAMRA
(Ex: 530 nm and Em 580 nm), the results of which are shown on the
left part of FIG. 9. After scanning for TAMRA the gel was stained
with 1:10,000 fold dilution of SYBR GOLD in 1.times. TBE and
scanned for signal (Ex: 473 Em:580) shown on the right.
Example 7
Incorporation of Cu(I) Chelator BCS to Preserve TrAP Laddering
[0415] TRAPeze.TM. TELOMERASE assays (Chemicon Kit 57700) were
performed with BCS. Each reaction contained the following: [0416]
(a) 1.times. TRAP reaction buffer (20 mM Tris-HCl, pH 8.3, 1.5
MgCl.sub.2 63 mM KCl, 0.05% Tween 20, 1 mM EGTA) [0417] (b) 50 of
N.sub.3-dATP+50 .mu.M of dGTP, dCTP, dTTP. (see Table 6 for
details) [0418] (c) 1 .mu.l of TS primer (TRAPeze Telomerase Kit,
Chemicon) [0419] (d) 1 .mu.l of Primer Mix (contains three separate
primers--a K1 Fwd primer, RP Rev Primer and TSK 1 internal control
primer from the (TRAPeze Telomerase Kit, Chemicon) [0420] (e) 2
units of Taq DNA polymerase [0421] (f) 2 .mu.l of positive control
cells (500 cells) of the TRAPeze Telomerase Kit
[0422] (Chemicon). The cell extract was prepared and further
diluted in CHAPS buffer, the components of which were 10 mM
Tris-HCl pH 7.5, 1 mM MgCl.sub.2, 1 mM EGTA, 0.1 mM Benzamidine, 5
mm .beta.-mercaptoethanol, 0.5% CHAPS and 10% Glycerol.
[0423] (g) PCR grade water as required to bring the volume of each
reaction to 50 .mu.l.
[0424] The reaction was carried out in an Applied Biosystems PCR
instrument under the following conditions: 30.degree. C.-30
minutes-hold [0425] 32 cycles of 95.degree. C.-30 sec [0426]
59.degree. C.-30 sec [0427] 72.degree. C.-1 minute [0428] Followed
by: 4.degree. C.-infinity
[0429] The reactions were cleaned through size exclusion columns
(Chromaspin TE30, Clonetech). The eluate was then subjected to
click reaction using a final concentration of 25% propylene glycol;
1 mM copper sulfate; in presence or absence of 10 mM BCS (see Table
6), 10 mM Sodium Ascorbate and 50 .mu.M alkyne-TAMRA. The reaction
was performed for 30 minutes at room temperature. This was followed
by clean up on the size exclusion as described above. The reactions
were mixed with the TRACK-IT Cyan orange loading dye and were
subjected to a 20% TBE--polyacrylamide gel (see FIG. 10). The gel
was run at 10V for 10 minutes; 190V for 90 minutes. The gel was
pulled out of the cassette and scanned for TAMRA (Ex: 530 nm Em:
580 nm). The same gel was then stained with SYBR GOLD for 30
minutes and then scanned with an excitation source at 473 nm and
emission at 520 nm.
TABLE-US-00011 TABLE 6 Chelator for Lane Telomerase click labeling
Comments 1 or a 500 cells none All other components (Telomerase
+ve) of the click reaction 2 or b 500 cells 10 mM BCS are as
described (Telomerase +ve) 3 or c 500 cells None Sau 3 cells do not
express (Telomerase -ve) Telomerase. 4 or d 500 cells 10 mM BCS
(Telomerase -ve) 5 or e Heat inactivated None Telomerase enzyme is
cells sensitive to heat. Heating 6 or f Heat inactivated 10 mM BCS
the +ve control cells cells for 10 minutes at 80 C. destroys
telomerase activity.
[0430] The results of the amplification are shown in FIG. 10, where
the gel shows aa high molecular weight product that appears in the
absence of BCS irrespective of the activity of Telomerase. However,
the TRAP"laddering" pattern of the assay product is restored upon
addition of the BCS.
Example 8
Click Chemistry Based Detection of Amplified DNA Products Using
Isothermal DNA Amplification Technology-Helicase Dependent
Amplification (See FIG. 11)
[0431] 8a) Helicase Dependent amplification (see FIG. 11)
[0432] a. mHDA: A mixture of DNA Helicase, a DNA polymerase,
deoxyoligonucleotide primers and deoxynucleotide triphosphates with
either: (1) an azido-dATP or an ethylene-dUTP (in place of dTTP) or
(2) an azido-dUTP or ethylene-dUTP in addition to the four dNTPs
are added together. The reaction mixture is heated to 95.degree. C.
for 5 minutes followed by incubation of the reaction mix at
37.degree. C. for 1 to 3 hours depending upon the length of the
target and amount of final product required.
[0433] After completion the polymerase reaction is complete, Click
reaction components are added to the amplified DNA. The click
reaction components are CuSo4, BCS, Na-Ascorbate and either an
azido-fluorophore or an alkyne-flurophore. The reaction is then run
directly on an agarose gel or detected using a secondary
matrix.
[0434] 8b) b. tHDA: A mixture of DNA Helicase, Bst DNA polymerase
(from Bacillus stearoethermophillus), deoxyoligonucleotide primers
and deoxynucleotide triphosphates with either: (1) an azido-dATP or
an ethylene-dUTP (in place of dTTP) or (2) an azido-dUTP or
ethylene-dUTP in addition to the four dNTPs are added together. The
reaction mixture is heated to 95.degree. C. for 5 minutes followed
by incubation of the reaction mix at 65.degree. C. for 1 to 2 hours
depending upon the length of the target and amount of final product
required.
[0435] After completion the polymerase reaction is complete, Click
reaction components are added to the amplified DNA. The click
reaction components are CuSO.sub.4, BCS, Na-Ascorbate and either an
azido-fluorophore or an alkyne-flurophore. The reaction is then run
directly on an agarose gel.
[0436] c. Circular HDA: This method of DNA amplification uses T7
Helicase and T7DNA polymerase and is similar to rolling circle DNA
amplification. Other accessory proteins in this platform include T7
single strand DNA binding protein. This platform can be used for
invitro amplification of plasmid or covalent closed circular DNA.
This technology has significant use in clinical diagnostics and
molecular biology e.g., in DNA sequencing and mutagenesis. As
described above azido or alkyne modified nucleotides triphosphates
are used during the DNA amplification methods and then either the
alkyne or azido dye molecules are added to create a label on the
newly synthesized DNA.
[0437] d. rt-HDA: this method takes advantage of the reverse
transcriptase activity of reverse transcriptase under constant
temperature conditions combined with polymerase activity of Bst
polymerase. Detection of the amplified DNA is performed as
described above using an azido or alkyne dNTPs and azido/alkyne
dyes are added at the end of the amplification reaction under
conditions that promote a Click reaction between the modified dNTP
and the dye label.
[0438] Strand Displacement Amplification (SDA) (see FIG. 12):
[0439] SDA is an isothermal nucleic acid amplification method.
Primer containing a restriction site is annealed to template.
Amplification primers are then annealed to 5' adjacent sequences
(form a nick) and amplification is started at a fixed temperature.
Newly synthesized DNA are nicked by a restriction enzyme,
polymerase starts amplification again, displacing the newly
synthesized strands. One hundred and nine copies of DNA can be made
in one reaction. For better labeling and detection of the amplified
product, an azido or alkyne dUTP is added which will be
incorporated into the newly synthesized strand because the enzyme
is a member of a family of pol I DNA polymerases which have been
shown in the art to incorporate azido or alkyne modified dNTPs
using Taq polymerase. Once the amplification reaction is finished,
the azido or alkyne dNTP in the polymerized strand is ligated to an
azido or alkyne dye under conditions that will promote the Click
reaction.
[0440] Loop mediated Isothermal DNA amplification:
[0441] LAMP (Loop-mediated Isothermal Amplification) method is a
nucleic acid amplification method that uses 4 primers, which
recognize 6 distinct regions on the target gene and a DNA
polymerase with strand displacement activity to carry out reaction
under isothermal condition. Amplification and detection of a gene
can be completed in a single step, by incubating the mixture of
samples, primers, DNA polymerase with strand displacement activity
and substrate at a constant temperature between 60-65.degree. C.
The method provides high amplification efficiency, with DNA being
amplified 109-110 times in 15-60 minutes. Because of its high
specificity, the presence of amplified product can indicate the
presence of target gene. Since this also uses Bst DNA polymerase,
Click chemistry can be used to detect labeling.
[0442] Rolling circle DNA amplification/Phi29 based DNA
amplification:
[0443] This method uses phi 29 DNA polymerase and can amplify DNA
(Linear or circular) with high fidelity and efficiency. Many labs,
industrial and academic use it for clinical pathology, academic
research and preparation of DNA probes from in situ hybridizations.
We propose to do either of the following steps:
[0444] (1) add either an azido-dUTP or ethylene-dUTP to replace
dTTP in the reaction mix or
[0445] (2) add either an azido-dUTP or ethylene-dUTP in addition to
the four dNTPs
[0446] Once the polymerase reaction is complete, Click reaction
components are added to the amplified DNA. The Click reaction
components are CuSo.sub.4, BCS, Na-Ascorbate and either an
azido-fluorophore or an alkyne-flurophore. The reaction can then be
run directly on an agarose gel
[0447] As has been described above, Click chemistry can be used
between azido/alkyne nucleotides and alkyne/azido dyes to label and
detect DNA in other isothermal DNA amplification technologies such
as multiple displacement amplification, transcription mediated
amplification, etc.
[0448] Preparation of probes for ISH/FISH
[0449] The probes for in situ hybridization can also be made using
"Click" labeling. Using standard polymerases e.g., Klenow (Exo-),
T7 DNA polymerase (Sequenase) or Bst polymerase (Large fragment),
one can amplify a template strand for a given sequence using
primers as well as using ethynyl or azido dNTPs. The prepared DNA
fragments can then be purified and subjected to the click reaction
with either azido or alkyne dyes or nanoparticles to create a
labeled probe. This is suited to both chromogenically detectable in
situ hybridization as well as fluorescent (dyes and Qdots) based
probes.
[0450] A major advantage that is predicted is that this kind of
labeling can be done at the time of diagnostic or clinical assay.
In addition the applications include automated in situ
hybridization platforms such as instruments from Dako, Ventana
Medical Systems, and Vision Biosystems where the hybridization can
be followed by the Click reaction to generate the signal.
[0451] First strand cDNA synthesis (RT-PCR)
[0452] As has been demonstrated, ethynyl-dUTP or azido-dATP are
incorporated by the telomerase enzyme which is a reverse
transcriptase (RNA dependent DNA polymerase). Therefore, this
methodology can be used to detect products of RT-PCR. In this
method the nucleotide mix can contain either an ethynyl or azido
dNTP and enzymes such as reverse transcriptase and DNA polymerase.
The product of such an experiment is purified and then subjected to
the Click based labeling method. The final labeled product is
purified either by precipitation or size exclusion
chromatography.
[0453] Second Strand cDNA synthesis (primer extension)
[0454] The isothermal DNA extension assay shown above was carried
out with various different polymerase and serves as an example of
second strand cDNA synthesis.
[0455] Preparation of RNA probes for FISH
[0456] Currently, the two methods of choice for preparation of the
RNA FISH probes are the following:
[0457] (1) The small RNA oligonucleotides that can be labeled
either via aminoallyl--NHS ester chemistry.
[0458] (2) The incorporation of modified nucleotides using invitro
transcription system to generate a RNA probe.
[0459] Based on these two technologies and our understanding of the
"Clickable" nucleotides, DNA dependent RNA polymerase from phage T7
or SP6 is used to incorporate the ethynyl or azido oligonucleotides
to produce a modified RNA probe that is subjected to Click
chemistry using either azido or alkyne fluorescent or chromogenic
labels. This is used to generate fluoregenic or chromogenic RNA
probes.
[0460] Method to prepare Peptide-nucleic acid Conjugates using
Click Chemistry:
[0461] A peptide with a O-GlcNac modification on one or more amino
acids is subjected to a Gal T1 reaction in the presence of
UDP-GalNAz. This results in an azido modified peptide. As explained
above, an oligodeoxynucleotide can be created using either alkyne
or azido linked nucleotides. A peptide-nucleic acid conjugate is
then created by reacting the Azido-linked peptide and ethynyl
decorated oligonucleotides in presence of 1 or 2 mM copper, 10 mM
Sodium Ascorbate and 20 mM BCS.
Example 9
Apoptosis Assay
[0462] Induce apoptosis in cells using the desired method. It may
be desirable to prepare a negative control sample using the cell
line of interest by incubating cells in the absence of inducing
agent.
[0463] Suspend 1-2.times.10.sup.6 cells in 0.5 mL of
phosphate-buffered saline (PBS). Add the cell suspension into 5 mL
of 1% (w/v) paraformaldehyde in PBS and place on ice for 15
minutes. Centrifuge the cells for 5 minutes at 300.times.g and
discard the supernatant. Wash the cells in 5 mL of PBS then pellet
the cells by centrifugation. Repeat. Resuspend the cells in 0.5 ml
of PBS. Add the cells to 5 mL of ice-cold 70% (v/v) ethanol. Let
the cells stand for a minimum of 30 minutes on ice or in a
-20.degree. C. freezer. In some biological systems, storage of the
cells at -20.degree. C. in 70% (v/v) ethanol for at least 12-18
hours prior to performing the assay yields the best results. Cells
can be stored at -20.degree. C. for several days before use.
[0464] Resuspend the positive and negative control cells by
swirling the vials. Remove 1 mL aliquots of the control cell
suspensions (approximately 1.times.10.sup.6 cells/mL) and place in
12.times.75 mm flow cytometry centrifuge tubes. Centrifuge
(300.times.g) the control cell suspensions for 5 minutes and remove
the 70% (v/v) ethanol by aspiration, being careful to not disturb
the cell pellet. Resuspend the control cells of each tube with 1 mL
of Wash Buffer (Component H of Molecular Probes product A23210).
Centrifuge for 5 minutes at 300.times.g and remove the supernatants
by aspiration. Repeat. Prepare a DNA-labeling solution; a total
volume of 50 .mu.L is required for each sample. Mix 10 .mu.L of
reaction buffer (Compenent G, Molecular Probes Product A23210),
0.75 .mu.L of TdT enzyme (terminal deoxynucleotidyltransferase.
Component C, Molecular Probes Product A23210), 8.0 .mu.L of EdUTP
(violet cap) and 31.25 .mu.L of dH.sub.2O. The DNA-labeling
solution is active for approximately 24 hours. Resuspend the
control cell pellets of each tube in 50 .mu.L of the DNA-labeling
solution. Incubate the cells in the DNA-labeling solution for 60
minutes at 37.degree. C. in a temperature controlled bath. Shake
the samples every 15 minutes to keep the cells in suspension. For
samples other than the control cells, incubation times at
37.degree. C. may need to be adjusted to longer or shorter periods
depending on the characteristics of the experimental samples. The
DNA-labeling reaction for the control cells can also be carried out
at 22-24.degree. C. overnight. At the end of the incubation time
add 1.0 mL of Rinse Buffer (Compenent I, Molecular Probes product
A23210) to each tube and centrifuge at 300.times.g for 5 minutes.
Remove the supernatants by aspiration. Repeat the cell rinsing with
1.0 mL of Rinse Buffer. Centrifuge the samples at 300.times.g and
remove the supernatants by aspiration. Prepare 100 .mu.L of Click
Chemistry labeling solution for each sample by mixing 5.0 .mu.L of
the Alexa Fluor 488 dye-labeled azide with 95 .mu.L of Rinse
Buffer, containing copper sulfate, sodium ascorbate, and BCS in
concentrations and proportions as described above. Resuspend the
cell pellets in 100 .mu.L of the Click Chemistry labeling solution.
Incubate the cells in this solution for 1-3 hours at room
temperature. Protect the samples from light during the incubation.
Add 0.5 mL of the Propidium Iodide/RNase A Staining Buffer
(Compenent F, Molecular Probes product A23210) to each sample.
Incubate the cells for an additional 30 minutes at room
temperature. Protect the samples from light during the incubation.
Analyze the samples by flow cytometry. It is recommended that the
samples be analyzed within 3 hours of completing the staining
procedure. For microscopy applications, it is recommended that the
cells be deposited onto slides after the Click Chemistry labeling
staining step, but prior to the propidium iodide/RNase treatment.
Cells that have undergone apoptosis should fluorescence brightly
when viewed with filter sets appropriate for fluorescein. For
adherent cell lines, detached cells present in the supernatant have
a higher probability of being apoptotic than do cells that have
remained adherent. Detached cells should be collected prior to
trypsinization of the adherent cell layer.
Example 10
Digoxin Azide
[0465] Mild acid hydrolysis of digoxin will cleave the sugar
moieties and provide the known alcohol derivative. Reaction of this
alcohol with phosgene, followed by alkylation with
6-amino-hexanyl-1-azide trifluoroacetic acid salt, will provide the
desired azido-digoxin analogue.
##STR00001##
Example 11
Digoxin Alkyne
[0466] Mild acid hydrolysis of digoxin will effectively cleave the
sugar moieties and provide the known alcohol derivative. Reaction
of this alcohol with phosgene, followed by alkylation with
propargylamine will provide the desired alkynyl-digoxin
analogue.
##STR00002##
Example 12
Synthesis of Dapoxyl.RTM. alkyne
[0467] The synthesis of Dapoxyl.RTM. alkyne is shown in the
following reaction scheme.
##STR00003##
[0468] To a solution of Dapoxyl.RTM. carboxylic acid, succinimidyl
ester (50 mg, 0.12 mmol) in DMF (0.4 mL) at RT was added
propargylamine (42 .mu.L, 0.61 mmol). The initial clear orange
solution turned yellow and cloudy. After .about.15 min at RT the
reaction was complete, and the solution was concentrated to
dryness. The residue was purified via HPLC to afford the product
(36 mg, 84%). TLC (10% EtOAc, CHCl.sub.3) R.sub.f=0.30; ESI m/z 346
(M.sup.-, C.sub.21H.sub.19N.sub.3O.sub.2 requires 346).
Example 13
Synthesis of 5-Carboxytetramethyl Rhodamine Alkyne
(5-TAMRA-Alkyne)
[0469] The synthesis of 5-Carboxytetramethyl rhodamine alkyne
(5-TAMRA-alkyne) is shown in the following reaction scheme.
##STR00004##
[0470] To a solution of 5-carboxytetramethyl rhodamine,
succinimidyl ester (5-TAMRA-SE, 0.10 g, 0.19 mmol) in DMF (0.5 mL)
was added propargylamine (25 .mu.L, 0.38 mmol) and H.sub.2O (0.5
mL). After stirring the solution for 30 min at RT, the solution was
concentrated in vacuo. Purification via HPLC (Phenomenex Prodigy
ODS, internal diameter 21.2 mm, eluent 25-40% CH.sub.3CN in 25 mM
TEAA, pH 4.7, flow rate of 15 mL/min) gave 68 mg of product (82%, a
purple solid) t.sub.R=23-33 min. TLC (CH.sub.3CN:H.sub.2O, 8:2)
R.sub.f=0.67.
Example 14
Synthesis of Biotin Alkyne
[0471] The synthesis of Biotin alkyne is shown in the following
reaction scheme.
##STR00005##
[0472] To a solution of EZ-link NHS-PEO.sub.4-biotin (25 mg, 0.004
mmol, Pierce) in DMF (0.1 mL) was added propargylamine (0.1 mL).
After stirring the solution for 90 min at RT, some starting
material was still seen. Additional propargylamine (0.2 mL) was
added and the solution was stirred for another 60 min. The solution
was concentrated in vacuo. The crude material was purified via HPLC
to afford 14.4 mg (64%) of the product as a yellow solid. TLC
(CHCl.sub.3:MeOH, 7:1) R.sub.f=0.23; ESI m/z 529 (M.sup.+,
C.sub.24H.sub.40N.sub.4O.sub.7S requires 529).
Example 15
Synthesis of Compound 1
[0473] The synthesis of Compound 1 is shown in the following
reaction scheme.
##STR00006##
[0474] To a solution of Alexa Fluor.RTM. 488 carboxylic acid,
succinimidyl ester, dilithium salt (mixed isomers, 50 mg, 0.079
mmol) in DMF (2.0 mL) was added propargylamine (54 .quadrature.L,
0.79 mmol). The solution was stirred overnight at RT. The initial
deep red solution turned pale yellow in color and became clear. The
solution was concentrated in vacuo and purified via silica gel thin
layer chromatography (prep plate, 20% H.sub.2O, CH.sub.3CN) to
afford the product (20 mg, 44%) as an orange solid. TLC (3:1,
CH.sub.3CN:H.sub.2O) R.sub.f=0.70; ESI neg m/z 570 (M.sup.+,
C.sub.24H.sub.16N.sub.3O.sub.10S.sup.2- requires 570).
Example 16
Synthesis of Compound 2
[0475] The synthesis of Compound 2 is shown in the following
reaction scheme.
##STR00007##
[0476] To a solution of Alexa Fluor.RTM. 532 carboxylic acid,
succinimidyl ester (50 mg, 0.070 mmol) in DMF (2.2 mL) was added
propargylamine (100 .mu.L, 1.46 mmol). The solution was stirred
overnight at RT. H.sub.2O (1.0 mL) was added to the solution and
the solution was stirred an additional hour. The solution was
concentrated in vacuo and the crude material was purified via HPLC
to afford the product (30 mg, 65%). TLC (8:2, CH.sub.3CN:H.sub.2O)
R.sub.f=0.58; ESI m/z 664 (M.sup.+,
C.sub.33H.sub.33N.sub.3O.sub.8S.sub.2 requires 664).
Example 17
Synthesis of Compound 3
[0477] The synthesis of Compound 3 is shown in the following
reaction scheme.
##STR00008##
[0478] To a solution of Alexa Fluor.RTM. 633 carboxylic acid,
succinimidyl ester, bis(triethylammonium salt) (50 mg, 0.041 mmol)
in DMF (2.0 mL) was added propargylamine (28 .mu.L, 0.40 mmol). The
solution was stirred overnight at RT. H.sub.2O (1.0 mL) was added
to the solution and the solution was stirred an additional hour.
The solution was concentrated in vacuo and the product (39 mg,
99%). TLC (8:2,CH.sub.3CN:H.sub.2O) R.sub.f=0.66; ESI m/z 963
(M.sup.+, C.sub.40H.sub.34F.sub.2N.sub.3O.sub.11S.sub.6 requires
963).
Example 18
Synthesis of Triarylphosphine-TAMRA Dye for Staudinger Ligation
[0479] The synthesis of triarylphosphine-TAMRA dye is shown in the
reaction scheme below.
##STR00009##
[0480] To a solution of acid 1(ref: Science 2000, 287, 2007-2010)
(80 mg, 0.26 mmol) in CH.sub.2Cl.sub.2 (5 mL) was added
N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDCI,
75 mg, 0.39 mmol) and N-hydroxysuccinimide (NHS, 5 mg). The
solution was stirred at RT. After 2.5 h, amine 2 (50 .mu.L, 0.26
mmol) was added and the solution was stirred overnight. The
solution was partitioned between CHCl.sub.3 (15 mL) and H.sub.2O (5
mL). The organic layer was separated and the aqueous layer was
reextracted with CHCl.sub.3 (15 mL). The combined organic layers
were rinsed once with H.sub.2O (5 mL), followed by saturated
aqueous NaCl (5 mL). The organic layer was dried over
Na.sub.2SO.sub.4, decanted and concentrated. The crude was purified
via chromatography (silica, 2% MeOH, CHCl.sub.3) to afford the
product (99 mg, 71%) as a clear, yellow oil.
[0481] To a solution of 3 (10 mg, 0.018 mmol) in CH.sub.2Cl.sub.2
(1.0 mL) was added trifluoracetic acid (TFA, 0.5 mL) and the
solution was stirred at RT. After 30 min, the solution was
concentrated and reevaporated from toluene (2.times.2 mL). The
residue (4, 0.018 mmol) was dissolved in DMF (0.2 mL) and
N-ethyldiisopropylamine (DIEA, 12 .quadrature.L, 0.72 mmol), and
5-carboxytetramethyl rhodamine, succinimidyl ester (5-TAMRA-SE, 9
mg, 0.022 mmol) were added. The solution was stirred at RT for 2.5
h, concentrated and purified via silica gel (prep plate, 20%
H.sub.2O in CH.sub.3CN) to afford the product (7.4 mg, 48%). TLC
(20% H.sub.2O in CH.sub.3CN) R.sub.f=0.23; ESI m/z 529 (M.sup.+,
C.sub.24H.sub.40N.sub.4O.sub.7S requires 529).
Example 19
Synthesis of Triarylphosphine-Biotin for Staudinger Ligation
[0482] The synthesis of triarylphosphine-biotin is shown in the
following reaction scheme.
##STR00010##
[0483] To a solution of 3 (5.3 mg, 0.010 mmol) in CH.sub.2Cl.sub.2
(1.2 mL) was added trifluoracetic acid (TFA, 0.5 mL) and the
solution was stirred at RT. After 2 h, the solution was
concentrated and reevaporated from tolune (2.times.2 mL). The
residue (4, 0.010 mmol) was dissolved in DMF (0.1 mL) and
N-ethyldiisopropylamine (DIEA, 3 .quadrature.L, 0.02 mmol), and
EZ-link NHS-PEO.sub.4-biotin (7 mg, 0.012 mmol) were added. The
solution was stirred at RT for 1 h, quenched with saturated
NH.sub.4.sup.+Cl.sup.- and partitioned between CHCl.sub.3 (10 mL)
and H.sub.2O (1 mL). The aqueous layer was extracted repeatedly
with CHCl.sub.3 (10 mL per extraction) until no ultraviolet spot
was observed by TLC. The combined organic layers were concentrated
and purified via silica gel (prep plate, 7:1 CHCl.sub.3:MeOH) to
afford the product (2.2 mg, 25%). TLC (7:1 CHCl.sub.3:MeOH,
developed 3 times) R.sub.f=0.50; ESI m/z 909 (M+H.sup.+,
C.sub.46H.sub.63N.sub.5O.sub.10PS requires 909).
Example 20
Synthesis of Cy.TM.5.5Azide
##STR00011##
[0485] To a solution of 6-(amino)-hexanyl-1-azide trifluoroacetic
acid salt (see Scheme 1 for ynthesis, 0.034 mmol) in DMF (0.1 mL)
and DIEA (6.0 .mu.L, 0.034 mmol) was added Cy.TM.5.5 succinimidyl
ester (5 mg, 3.4 nmol). After stirring the solution at RT for 10
min, the reaction solution was concentrated in vacuo. The crude was
purified via HPLC.
Example 21
Synthesis of Cy.TM.3Azide
##STR00012##
[0487] To a solution of 6-(amino)-hexanyl-1-azide trifluoroacetic
acid salt (see Scheme 1 for synthesis, 0.052 mmol) in DMF (0.1 mL)
and DIEA (9.2 .mu.L, 0.052 mmol) was added Cy.TM.3 succinimidyl
ester (5.0 mg, 5.2 nmol). After stirring the solution at RT for 10
min, the reaction solution was concentrated in vacuo. The crude was
purified via HPLC.
Example 22
Synthesis of Cy.TM.5.5Alkyne
##STR00013##
[0489] To a solution of Cy.TM.5.5 succinimidyl ester (GE Amersham,
5.0 mg, 3.7 nmol) in DMF (0.1 mL) was added propargylamine (2.5
.mu.L, 0.037 mmol) and H.sub.2O (0.2 mL). The solution was stirred
at RT for 30 min then concentrated in vacuo. The crude was purified
via HPLC.
Example 23
Synthesis of Cy.TM.3Alkyne
##STR00014##
[0491] To a solution of Cy.TM.3 succinimidyl ester (GE Amersham,
5.0 mg, 5.7 nmol) in DMF (0.1 mL) was added propargylamine (3.9
.mu.L, 0.057 mmol) and H.sub.2O (0.2 mL). The solution was stirred
at RT for 30 min then concentrated in vacuo. The crude was purified
via HPLC.
Example 24
Succinimidyl Ester Azide Synthesis
[0492] The synthesis of succinimidyl ester azide is shown in the
following reaction scheme.
##STR00015##
6-(Boc-Amino)-hexanyl-1-p-toluenesulfonate
##STR00016##
[0494] To a solution of 6-(Boc-amino)-1-hexanol (3.0 g, 13.8 mmol)
in CHCl.sub.3 (50 mL) was added TEA (3.8 mL, 27.6 mmol) and
p-toluenesulfonyl chloride (3.9 g, 20.7 mmol). The solution was
stirred at RT overnight, diluted with CHCl.sub.3 (200 mL), washed
with H.sub.2O (4.times.50 mL), rinsed with brine (1.times.50 mL)
and dried over Na.sub.2SO.sub.4. The solution was decanted,
concentrated and purified via silica gel chromatography
(6.0.times.41 cm, 20-70% EtOAc/hexanes) to afford the product as a
white solid (3.5 g, 69%). TLC (35% EtOAC/hexanes) R.sub.f=0.72, UV
active.
6-(Boc-Amino)-hexanyl-1-azide
##STR00017##
[0496] To a solution of 6-(Boc-amino)-hexanyl-1-p-toluenesulfonate
(3.2 g, 8.63 mmol) in DMF (21 mL) was added sodium azide (1.12 g,
17.3 mmol). The solution was refluxed at 95.degree. C. overnight.
After cooling to RT, the solution was diluted with Et.sub.2O (160
mL) and washed with H.sub.2O (100 mL). The aqueous layer was
extracted a second time with Et.sub.2O (100 mL) and the combined
organics were dried over Na.sub.2SO.sub.4. After decanting and
concentrating, the crude material was purified via silica gel
chromatography (6.times.26 cm, 25-30% EtOAc/hexanes) to afford the
product as a clear, colorless oil (2.0 g, 97%). TLC, (35%
EtOAC/hexanes) R.sub.f=0.74, brown spot with ninhydrin stain.
6-(Amino)-hexanyl-1-azide trifluoroacetic acid salt
##STR00018##
[0498] To a solution of 6-(Boc-amino)-hexanyl-1-azide (0.2 g, 0.83
mmol) in CH.sub.2Cl.sub.2 (1.0 mL) was added TFA (1.0 mL). The
solution was stirred at RT for 2 h, evaporated to dryness and
re-evaporated twice from toluene. The product,
6-amino-hexanyl-1-azide trifluoroacetic acid salt (0.83 mmol) was
used directly without further purification/
[0499] (N-6-Azido-hexanyl)glutaramide
##STR00019##
[0500] 6-Amino-hexanyl-1-azide (0.83 mmol) was dissolved in THF
(1.0 mL) and N,N-diisopropylethylamine (0.29 mL, 1.65 mmol) was
added. The solution was stirred at RT for 10 min then glutaric
anhydride (0.47 g, 4.13 mmol) was added. The pale yellow solution
was stirred at RT overnight. The reaction solution was diluted with
CHCl.sub.3 (30 mL) and H.sub.2O (10 mL), and acidified to a pH of 1
with 1% HCl; the organic layer was removed. The aqueous layer was
extracted two more times with CHCl.sub.3 (2.times.30 mL). The
combined organic layers were rinsed with brine (2.times.10 mL) and
dried over Na.sub.2SO.sub.4. The solution was decanted, and
concentrated. The crude was purified via silica gel chromatography
(10% MeOH/CHCl.sub.3 containing 0.1% AcOH) to afford the product as
a clear, colorless oil (0.16 g, 75%). The column was loaded with
10% MeOH/CHCl.sub.3. TLC (10% MeOH/CHCl.sub.3with 0.1% AcOH)
R.sub.f=0.41, pink with p-anisaldehyde stain, no UV activity.
(N-6-Azido-hexanyl)glutaramide, succinimidyl ester
##STR00020##
[0502] To a solution of the (N-6-azido-hexanyl) glutaramide (75 mg,
0.29 mmol) in THF (4.0 mL) was added pyridine (110 .mu.L, 1.36
mmol) followed by succinimidyl trifluoroacetate (200 mg, 0.95
mmol). The clear, colorless solution was stirred at RT for 4 h. The
reaction solution was diluted with CHCl.sub.3 (20 mL) and rinsed
sequentially with 1% AcOH (2.times.5 mL), H.sub.2O (2.times.5 mL)
and brine (1.times.5 mL). The crude solution was dried over
Na.sub.2SO.sub.4, decanted, and concentrated to afford the product
as a clear, colorless oil (0.10 g, 99%). TLC: (1:1, EtOAc/hexanes)
R.sub.f=0.64, orange with ninhydrin, UV active.
Example 25
Succinimidyl Ester Alkyne Synthesis
[0503] The synthesis of succinimidyl ester alkyne is shown in the
following reaction scheme.
##STR00021##
10-Undecynoic Acid Succinimidyl Ester
##STR00022##
[0505] To a solution of 10-undecynoic acid (0.40 g, 2.2 mmol) in
CH.sub.3CN (10 mL) was added
O-(N-succinimidyl)-N,N,N,N'-tetramethyluronium tetrafluoroborate
(0.99 g, 3.29 mmol). After stirring for 2 min at RT, the reaction
was quenched with 1% AcOH and diluted with CHCl.sub.3 (150 mL). The
organic solution was then extracted with 1% AcOH (10 mL), rinsed
with H.sub.2O (2.times.40 mL), then dried over Na.sub.2SO.sub.4.
The solution was then decanted and concentrated. A quantitative
yield was assumed and the material was taken on directly to the
next step. TLC (10% MeOH/CHCl.sub.3) R.sub.f=0.90, UV active.
Tent-Butyl Alkyne
##STR00023##
[0507] To a solution of 10-undecynoic acid succinimidyl ester (0.61
g, 2.19 mmol) in CH.sub.3CN (8 mL) was added
amino-dPEG.TM..sub.2-tert-butyl ester (0.46 g, 1.97 mmol, Quanta
BioDesign) in CH.sub.3CN (2 mL) at RT. After 2 hrs, the solution
was diluted with CHCl.sub.3 (50 mL) and extracted with H.sub.2O (5
mL). The aqueous layer was reextracted with CHCl.sub.3 (2.times.50
mL). Combined organics were dried over Na.sub.2SO.sub.4, decanted
and concentrated. The crude was purified via silica gel
chromatography (2.5% MeOH/CHCl.sub.3) to afford the product as a
clear, pale yellow oil (0.48 g, 55%). TLC (9:1 CH.sub.3CN:H.sub.2O)
R.sub.f=0.81.
Succinimidyl Ester Alkyne
##STR00024##
[0509] To a solution of tert-butyl alkyne (0.48 g, 1.2 mmol) in
CH.sub.2Cl.sub.2 (2.0 mL) was added TFA (2.0 mL). The solution was
stirred for 1 h, then concentrated and reevaporated from toluene
(2.times.1 mL). The resulting brown residue was dissolved in
CH.sub.3CN (5.0 mL) and N,N-diisopropylethylamine (0.84 mL, 4.83
mmol) was added. The solution was stirred at RT for 2 min, and then
O-(N-succinimidyl)-N,N,N,N'-tetramethyluronium tetrafluoroborate
(0.47 g, 1.56 mmol) was added. After 15 min the reaction was
quenched and acidified with 1% AcOH to a pH of 4-5. The solution
was extracted with CHCl.sub.3 (3.times.50 mL). The combined
organics were reextracted with H.sub.2O (1.times.10 mL), then dried
over Na.sub.2SO.sub.4, decanted and concentrated to afford a tan
solid (0.46 g, 87%). The crude material was pure enough for testing
without further purification. TLC (8:2 CH.sub.3CN/H.sub.2O)
R.sub.f=0.79.
Example 26
Iodoacetamide Aazide Synthesis
[0510] The synthesis of Iodoacetamide azide is shown in the
following reaction scheme.
##STR00025##
6-(iodoacetamide)-aminohexanyl-1-azide
##STR00026##
[0512] To a solution of 6-amino-hexanyl-1-azide trifluoroacetic
acid salt (35 mg, 0.14 mmol) in DMF (0.1 mL) was added iodoacetic
anhydride (0.10 g, 0.28 mmol) in the dark. After 2 hr, the reaction
was stopped and the solution was partitioned between CHCl.sub.3 (10
mL) and H.sub.2O (10 mL). The organic layer was removed and the
aqueous layer was reextracted with CHCl.sub.3 (1.times.10 mL). The
combined organics were rinsed with saturated NaCl (1.times.5 mL),
dried over Na.sub.2SO.sub.4, decanted and concentrated.
Purification via silica gel chromatography (2% MeOH/CHCl.sub.3
containing 0.1% AcOH) provided the product (35 mg, 81%) as a yellow
oil. TLC (10% MeOH/CHCl.sub.3) R.sub.f=0.75.
Example 27
Iodoacetamide Alkyne Synthesis
[0513] The synthesis of Iodoacetamide alkyne is shown in the
following reaction scheme.
##STR00027##
[0514] N-(iodoacetamide)-propargylamine. To a solution of
propargylamine in DMF was added iodoacetic anhydride in the dark.
After 2 hr, the reaction was stopped and the solution was
partitioned between CHCl.sub.3 and H.sub.2O. The organic layer was
removed and the aqueous layer was reextracted with CHCl.sub.3. The
combined organics were rinsed with saturated NaCl, dried over
Na.sub.2SO.sub.4, decanted and concentrated.
Example 28
Maleimide Alkyne Synthesis
[0515] The synthesis of Maleimide alkyne is shown in the following
reaction scheme.
##STR00028##
[0516] Propargylamine maleimide. After the reaction of
propargylamine and maleic anhydride in the presence of TEA, the
intermediate acid was cyclized in the presence of acetic anhydride
and sodium acetate at 70.degree. C., to afford the desired
propargylamine maleimide.
Example 29
Maleimide Azide Synthesis
[0517] The synthesis of Maleimide azide is shown in the following
reaction scheme.
##STR00029##
[0518] N-(6-Azido-aminohexyl)maleimide. After the reaction of
6-amino-hexanyl-1-azide trifluoroacetic acid salt and maleic
anhydride in the presence of TEA, the intermediate acid was
cyclized in the presence of acetic anhydride and sodium acetate at
70.degree. C., to afford the desired
N-(6-azido-aminohexyl)maleimide.
Example 30
Azido Dyes
##STR00030##
[0520] 5-TAMRA azide. To a solution of 6-(amino)-hexanyl-1-azide
trifluoroacetic acid salt (see Scheme 1 for synthesis, 0.19 mmol)
in DMF (0.5 mL) and DIEA (33 .mu.L, 0.19 mmol) was added
5-carboxytetramethylrhodamine, succinimidyl ester (5-TAMRA-SE, 50
mg, 0.094 mmol). After stirring the solution at RT for 10 min, the
reaction solution was concentrated in vacuo. The crude was purified
via silica gel chromatography (prep plate, 9:1 CH.sub.3CN:H.sub.2O)
to afford the product as a pink solid (45.6 mg, 87%). TLC
(CH.sub.3CN:H.sub.2O, 8:2) R.sub.f=0.61, pink fluorescent spot;
ESI-pos m/z 555 M.sup.+, C.sub.31H.sub.35N.sub.6O.sub.4 (requires
555).
[0521] It is envisioned that any reporter molecule comprising a
succinimidyl ester can be azido modified using the methods
described herein. Provided below are additional non-limiting
examples.
##STR00031##
[0522] PEG-biotin azide. To a solution of 6-(amino)-hexanyl-1-azide
trifluoroacetic acid salt (see Scheme 1 for synthesis, 0.17 mmol)
in DMF (0.5 mL) and DIEA (60 .mu.L, 0.34 mmol) was added
NHS-PEO.sub.4-biotin (Pierce, 50 mg, 0.08 mmol). After stirring the
solution at RT overnight, the solution was concentrated in vacuo.
The crude was purified via silica gel chromatography (7:1
CHCl.sub.3:MeOH) to afford the product as a cloudy, white residue
(12.3 mg, 12%). TLC (7:1, CHCl.sub.3:MeOH, 8:2) R.sub.f=0.54, faint
UV active spot, stains pink with biotin dip; ESI-pos m/z 616
M.sup.+, C.sub.27H.sub.49N.sub.7O.sub.7S (requires 616).
##STR00032##
[0523] Rhodamine Green.TM. azide (mix of 5- and 6-isomers). To a
solution of 6-(amino)-hexanyl-1-azide trifluoroacetic acid salt
(see Scheme 1 for synthesis, 0.20 mmol) in DMF (0.5 mL) and DIEA
(50 .mu.L, 0.28 mmol) was added Rhodamine Green.TM. carboxylic
acid, succinimidyl ester, hydrochloride (mix of 5- and 6-isomers,
50 mg, 0.10 mmol). After stirring the solution at RT for 2 h the
solution was concentrated in vacuo. HPLC (Phenomenex Prodigy ODS,
internal diameter 21.2 mm, eluent 5-50% CH.sub.3CN (over 60 min) in
25 mM TEAA, pH=4.7, flow rate of 20 mL/min) gave 21.1 mg of product
(43%) t.sub.R=43-47 min; TLC (CH.sub.3CN:H.sub.2O:AcOH, 8:1:1)
R.sub.f=0.74, fluorescent yellow spot; ESI-pos m/z 499 (M+H,
C.sub.27H.sub.27N.sub.6O.sub.4 requires 499).
##STR00033##
[0524] Alexa Fluor.RTM. 488 azide (5 isomer). To a solution of
6-(amino)-hexanyl-1-azide trifluoroacetic acid salt (see Scheme 1
for synthesis, 0.44 mmol) in DMF (0.5 mL) and DIEA (0.11 mL, 0.88
mmol) was added Alexa Fluor.RTM. 488 5-carboxylic acid,
2,3,5,6-tetrafluorophenyl ester, bis(triethylammonium salt) (200
mg, 0.22 mmol). After stirring the solution at RT for 1 h, the
solution was concentrated in vacuo. HPLC (Phenomenex Prodigy ODS,
internal diameter 21.2 mm, eluent 0-60% CH.sub.3CN (over 30 min) in
25 mM TEAA, pH=4.7, flow rate of 20 mL/min) gave 58.1 mg of product
(30%) t.sub.R=23-27 min; TLC (CH.sub.3CN:H.sub.2O, 8:2)
R.sub.f=0.58, fluorescent yellow spot; ESI-neg m/z 657 (M.sup.-,
C.sub.27H.sub.25N.sub.6O.sub.10S.sub.2.sup.-requires 657).
##STR00034##
[0525] Alexa Fuor.RTM. 546 azide. To a solution of
6-(amino)-hexanyl-1-azide trifluoroacetic acid salt (see Scheme 1
for synthesis, 0.093 mmol) in DMF (0.5 mL) and DIEA (32 .mu.L, 0.19
mmol) was added Alexa Fluor.RTM. 546 carboxylic acid, succinimidyl
ester, (50 mg, 0.05 mmol). After stirring the solution at RT for 2
h, the solution was concentrated in vacuo.
[0526] HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm,
eluent 10-60% CH.sub.3CN (over 60 min) in 25 mM TEAA, pH=4.7, flow
rate of 20 mL/min) gave 27.2 mg of product (54%) t.sub.R=48-52 min;
TLC (CH.sub.3CN:H.sub.2O, 9:1) R.sub.f=0.24, fluorescent pink spot;
ESI-neg m/z 1084 (M.sup.-,
C.sub.46H.sub.55Cl.sub.3N.sub.7O.sub.11S.sub.3.sup.-requires
1084).
##STR00035##
[0527] Alexa Fluor.RTM. 594 azide (5 isomer). To a solution of
6-(amino)-hexanyl-1-azide trifluoroacetic acid salt (see Scheme 1
for synthesis, 0.12 mmol) in DMF (0.5 mL) and DIEA (42 .mu.L, 0.24
mmol) was added Alexa Fluor.RTM. 594 carboxylic acid, succinimidyl
ester *5-isomer* (50 mg, 0.06 mmol). After stirring the solution at
RT for 2 h, the solution was concentrated in vacuo. HPLC
(Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 25-60%
CH.sub.3CN (over 30 min) in 25 mM TEAA, pH=4.7, flow rate of 20
mL/min) gave 16.5 mg of product (32%) t.sub.R=23-25 min; TLC
(CH.sub.3CN:H.sub.2O, 9:1) R.sub.f=0.36, fluorescent red spot;
ESI-neg m/z 845 (M.sup.-, C.sub.41H.sub.45N.sub.6O.sub.10S.sub.2
requires 845).
##STR00036##
[0528] Dapoxyl azide. To a solution of 6-(amino)-hexanyl-1-azide
trifluoroacetic acid salt (see Scheme 1 for synthesis, 0.25 mmol)
in DMF (0.5 mL) and DIEA (43 .mu.L, 0.25 mmol) was added
Dapoxyl.RTM. carboxylic acid, succinimidyl ester (50 mg, 0.12
mmol). After stirring the solution at RT for 1 h, the solution was
concentrated in vacuo. Purified by SPE (Supelco C18 DSC) to give
41.6 mg of product (78%); ESI-pos m/z 433 (M.sup.+,
C.sub.24H.sub.28N.sub.6O.sub.2 requires 433).
##STR00037##
[0529] Alexa Fluor.RTM. 568-azide. To a solution of
6-(amino)-hexanyl-1-azide (see Scheme 1 for synthesis, 0.04 mmol)
in DMF (0.2 mL) and DIEA (7 82 L, 0.04 mmol) was added Alexa
Fluor.RTM. 568 carboxylic acid, succinimidyl ester (mix of isomers,
25 mg, 0.02 mmol). After stirring the solution at RT for 2.5 h,
H.sub.2O (0.2 mL) was added and the solution was concentrated in
vacuo. HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm,
eluent 20-35% CH.sub.3CN in 25 mM NH.sub.4Ac, pH 4.7, flow rate of
15 mL/min) gave 15.3 mg of product (99%) t.sub.R=24-30 min; TLC
(CH.sub.3CN:H.sub.2O, 8:2) R.sub.f=0.63, fluorescent pink spot;
ESI-neg m/z 817 (M-2, C.sub.39H.sub.41N.sub.6O.sub.10S.sub.2
requires 817).
Example 31
Alkyne Dyes
##STR00038##
[0531] Oregon Green.RTM. 488-alkyne. To a solution of Oregon
Green.RTM. 488 carboxylic acid, succinimidyl ester (50 mg, 0.98
mmol) in DMF (0.5 mL) was added propargylamine (0.26 .mu.L, 0.40
mmol) and H.sub.2O (0.1 mL). After stirring at RT for 15 min, the
solution was concentrated. HPLC (Phenomenex Prodigy ODS, internal
diameter 21.2 mm, eluent 15-30% CH3Cn in 25 mM TEAA pH 4.7, flow
rate of 15 mL/min) gave 44.5 mg of product (99%) t.sub.R=5-13 min;
TLC (CH.sub.3CN:H.sub.2O, 8:2) R.sub.f=0.60, fluorescent yellow
spot; ESI-neg m/z 448 (M-H.sup.+,
C.sub.24H.sub.12F.sub.2NO.sub.6.sup.-requires 448).
[0532] It is envisioned that any reporter molecule comprising a
succinimidyl ester can be alkyne modified using the methods
described herein. Provided below are additional non-limiting
examples.
##STR00039##
[0533] Alkynyl-PEG-biotin. To a solution of NHS-PEO.sub.4-biotin
(Pierce, 25 mg, 0.004 mmol) in DMF (0.1 mL) at RT was added
propargylamine (0.3 mL, 4.5 mmol). After stirring for 3 h, the
solution was concentrated in vacuo and re-evaporated twice from
toluene. HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm,
eluent 35-50% MeOH in 25 mM NH.sub.4Ac, pH 6.5, flow rate of 15
mL/min) gave 14.4 mg, (64%, a white solid) t.sub.R=26-30 min; TLC
(CHCl.sub.3:MeOH, 7:1) R.sub.f=0.20, UV active spot; ESI m/z 529 (M
+H.sup.+, C.sub.24H.sub.40N.sub.4O.sub.7S requires 529).
##STR00040##
[0534] 5-TAMRA-alkyne. To a solution of
5-carboxytetramethylrhodamine, succinimidyl ester (5-TAMRA-SE, 0.10
g, 0.19 mmol) in DMF (0.5 mL) was added propargylamine (25 82 L,
0.38 mmol) and H.sub.2O (0.5 mL). After stirring the solution for
30 min at RT, the solution was concentrated in vacuo. HPLC
(Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 25-40%
CH.sub.3CN in 25 mM TEAA, pH 4.7, flow rate of 15 mL/min) gave 68
mg of product (82%, a purple solid) t.sub.R=23-33 min; TLC
(CH.sub.3CN:H.sub.2O, 8:2) R.sub.f=0.67, fluorescent orange spot;
ESI m/z 469 (M+H.sup.+, C.sub.28H.sub.26N.sub.3O.sub.4 requires
469).
##STR00041##
[0535] Oregon Green.RTM. 488-alkyne. To a solution of Oregon
Green.RTM. 488 carboxylic acid, succinimidyl ester (50 mg, 0.98
mmol) in DMF (0.5 mL) was added propargylamine (0.26 .mu.L, 0.40
mmol) and H.sub.2O (0.1 mL). After stirring at RT for 15 min, the
solution was concentrated. HPLC (Phenomenex Prodigy ODS, internal
diameter 21.2 mm, eluent 15-30% CH3Cn in 25 mM TEAA pH 4.7, flow
rate of 15 mL/min) gave 44.5 mg of product (99%) t.sub.R=5-13 min;
TLC (CH.sub.3CN:H.sub.2O, 8:2) R.sub.f=0.60, fluorescent yellow
spot; ESI-neg m/z 448 (M-H.sup.+,
C.sub.24H.sub.12F.sub.2NO.sub.6.sup.-requires 448).
##STR00042##
[0536] Alexa Fluor.RTM. 532-alkyne. To a solution of Alexa
Fluor.RTM. 532 carboxylic acid, succinimidyl ester (51 mg, 0.07
mmol) in DMF (4.0 mL) was added propargylamine (0.1 mL) and
H.sub.2O (1.0 mL). The solution was stirred at RT for 1 h then
concentrated in vacuo to afford the crude product. HPLC (Phenomenex
Prodigy ODS, internal diameter 21.2 mm, eluent 25-40% CH.sub.3CN in
25 mM NH.sub.4Ac, pH 4.7, flow rate of 15 mL/min) gave 30 mg of
product (65%, a red solid) t.sub.R=23-30 min; TLC
(CH.sub.3CN:H.sub.2O, 1:1) R.sub.f=0.58, fluorescent red spot; ESI
m/z 664 (M.sup.+, C.sub.33H.sub.34N.sub.3O.sub.8S.sub.2 requires
664).
##STR00043##
[0537] Alexa Fluor.RTM. 488-alkyne. To a solution of Alexa
Fluor.RTM. 488 carboxylic acid, succinimidyl ester, dilithium salt,
mixed isomers, (51 mg, 0.08 mmol) in DMF (2.0 mL) was added
propargylamine (54 .mu.L, 0.80 mmol). The solution was stirred at
RT for 4 h then concentrated in vacuo. The crude product was
purified using column chromatography on silica gel
(CH.sub.3CN:H.sub.2O, 8:2) to afford 20 mg (44%, an orange solid).
TLC (CH.sub.3CN:H.sub.2O, 3:1) R.sub.f=0.68; ESI-neg m/z 570 (M-2,
C.sub.24H.sub.16N.sub.3O.sub.10S.sub.2.sup.2-requires 570).
Example 32
Triarylphosphine Dye
##STR00044##
[0539] 5-TAMRA-triarylphosphine. To a solution of
N-Boc-triarylphosphine-amine (see Scheme 2 for synthesis, 10 mg,
0.018 mmol) in CH.sub.2Cl.sub.2 (1.0 mL) was added TFA (0.5 mL).
The reaction solution was stirred at RT for 30 min, concentrated in
vacuo, and re-evaporated twice from toluene. The crude amine (0.018
mmol, 99%) was used directly in the next reaction without further
purification.
[0540] To a solution of triarylphosphine-amine (0.018 mmol) in DMF
(0.2 mL) and DIEA (12 .mu.L, 0.089 mmol) was added
5-carboxytetramethyl rhodamine, succinimidyl ester (5-TAMRA-SE, 9
mg, 0.022 mmol). After stirring the solution at RT for 2.5 h, the
solution was concentrated in vacuo. HPLC (Phenomenex Luna C18(2),
internal diameter 10 mm, eluent 40-55% CH.sub.3CN in 25 mM
NH.sub.4Ac, pH=7, flow rate of 5.0 mL/min) gave 4.1 mg of product
(27%) t.sub.R=32-34 min; TLC (MeOH:CHCl.sub.3, 1:9) R.sub.f=0.67,
fluorescent pink spot; ESI m/z 848 (M+H.sup.+,
C.sub.50H.sub.48N.sub.4O.sub.7P requires 848).
Example 33
[0541] A solid silica glass surface such as a glass slide is
derivatized with 3-azidopropyl(triethoxy)silane, using standard
conditions for covalent attachment of alkyl(trialkoxy)silanes to
glass. The residual labeling reagents are rinsed thoroughly, and
the azide-derivatized glass is stored under subdued light. The
azide functionalized glass surfaces are incubated in water or
organic solvent such as methanol with excess
acetylene-functionalized partners such as small molecules, dyes,
peptides, proteins, enzymes, and nucleic acids over the course of
1-2 days in darkness in the presence of excess BCS and Cu(I), which
is formed in situ from copper sulfate and sodium ascorbate. The
derivatized glass surface is rinsed thoroughly with water, and
stored cold either dry or suspended in solution so as to optimize
the lifetime of the bound partner.
##STR00045##
Example 34
[0542] A solid silica glass surface such as a glass slide is
derivatized with 3-alkynylpropyl(triethoxy)silane, using standard
conditions for covalent attachment of alkyl(trialkoxy)silanes to
glass. The residual labeling reagents are rinsed thoroughly, and
the alkyne-derivatized glass is stored cold. The
alkyne-functionalized glass surfaces are incubated in water or
organic solvent such as methanol with excess azido-functionalized
partners such as small molecules, dyes, peptides, proteins,
enzymes, and nucleic acids over the course of 1-2 days in darkness
in the presence of excess BCS and Cu(I), which is formed in situ
from copper sulfate and sodium ascorbate. The derivatized glass
surface is rinsed thoroughly with water, and stored cold either dry
or suspended in solution so as to optimize the lifetime of the
bound partner.
##STR00046##
Example 35
Electrophoretic Mobility Shift Assays (EMSA)
[0543] This assay is used to determine the specificity and
identification of protein binding sites on a given ds or ss DNA/RNA
molecule. Currently the technique uses radiolabeled DNA which is
laborious, tedious and requires high level of safety. With the
advent of Click chemistry in DNA labeling one can perform the same
technique with great ease and convenience.
[0544] A ss or ds nucleic acid oligo can be synthesized e.g., by
IDT or Invitrogen or Sigma that has a 5' E-dUMP followed by the
sequence of interest to the end user. The oligo can then be labeled
with and azido Fluorphore and further used for binding to the
protein of interest followed by PAGE and EMSA. Alternativley the
putative sequence of DNA to which the protein binds can be designed
to have a singly azido or alkyne nulcoetide. If the protein binds
to the sequence it would block access to the azido dye or tag
resulting in no labeling. If the protein does not bind to the
sequence then the DNA will get readily labeled in the click
reaction giving a clear cut result.
Example 36
Click Labeling by PCR
[0545] The reaction was set up as follows:
[0546] A 2X SYBR Greener mastermix was used. It was prepared with
the same components as the commercial mix (Taq polymerase, buffer,
MgCl2, SYBR Greener dye) but without dNTPs and the passive
reference dye ROX. The reaction mixes were prepared according to
the following table:
TABLE-US-00012 [final] Unmodified dUTP dH2O 6.75 2X mix no ROX 12.5
1X dNTP unmodified mix 25 mM 0.2 200 uM each 10 uM B act 300
primers F + R 0.5 200 nM each 25 uM ROX 0.05 50 nM 20 Add template
5 Click modified dUTP dH2O 2.95 2X mix no ROX 12.5 1X Modified dNTP
mix 1.2 mM 4 200 uM each 10 uM B act 300 primers F + R 0.5 200 nM
each 25 uM ROX 0.05 50 nM 20 Add template 5
[0547] The template used was Invitrogen qPCR standards, containing
50,000,000 (5E7) copies of plasmid with the human B actin CDS,
shown below. The samples were run as 3 replicates. The location of
the primers is shown in FIG. 16, giving a predicted amplicon size
of 293 bp.
[0548] The cycling conditions were:
[0549] Initial denaturation and activation of Taq: [0550] 95 C 10
minutes [0551] Amplification: [0552] 1) 95 C 15 seconds [0553] 2)
60 C 30 seconds, fluorescence captured at the end of this step
Repeated for 45 cycles
[0554] Melting curve:
[0555] The amplicon was heated from 55 C to 95 C in 2 C/minute
steps, with fluorescence captured at each step. SBR Green and ROX
band pass filters were used to measure fluorescence, on a MX3000P
machine (Stratagene).
[0556] Results: The data are shown in FIG. 11 and FIG. 12. The
linear amplification plot shown in FIG. 11 shows that the onset of
exponential amplification or threshold cycle (CT) for the click
modified dUTP mix is very similar to that shown for the unmodified
dUTP mix. The average CT for click dUTP is 9.78 vs 10.97 for
unmodified dUTP.
[0557] The data from the melting curve of FIG. 12 suggests a
potential application for Click modified nucleotides as a way to
increase the Tm of oligonucleotides. For example, if designing PCR
primers in an A-T rich region, this modification could be used to
raise the Tm of the primers so that shorter primers could be made
that would show the same melting temperature as longer primers.
[0558] The higher Tm could be used for generating a cDNA library
through random priming. Normally, random 6-8 mers are used. These
will naturally have a very low Tm. However the click modified
random primers could potentially be used at a higher temperature
for greater specificity. Researchers are using octamers to get
longer and more specific reads during random priming but the click
modified oligos could provide the enhanced specificity without the
need for longer oligos. Thus, the advantage of using short oligos
(more matches) can be combined with enhanced hybridization
stability.
Example 37
Labeling of Real-Time PCR Products
[0559] The product from the real time PCR experiment was either
directly or indirectly labeled (PCR product cleaned up using
Invitrogen PCR purification kit prior to Click) with azido-TAMRA in
the presence of "Click" conditions. The labeling reaction was
composed of a final concentration of 25% propylene glycol; 2 mM
copper (II); 10 mM BCS, 10 mM Sodium Ascorbate and 50 .mu.M
azido-TAMRA. The reaction was performed for 60 minutes at room
temperature. This was followed by precipitation of the DNA using 3M
sodium acetate, glucagon as a carrier and 100% ethanol. The final
DNA pellet was washed twice with 70% ethanol. The pellet was then
dissolved in 50 ul of 10 mM TE buffer pH 8.0. The DNA solution was
warmed up to enhance dissolution of the DNA pellet. 27 ul of the
solution was mixed with 3 ul of 10.times. Blue Juice loading buffer
(Invitrogen). 6 ul of the sample was loaded on to a 4-20%
TBE--polyacrylamide gel. The gel was run at 10V for 10 minutes;
190V for 90 minutes. The gel was pulled out of the cassette and
scanned for TAMRA (Ex: 530 nm Em: 580 nm), which is shown as the
left image of FIG. 13. The same gel was then stained with SYBR GOLD
for 30 minutes and then scanned as described above, as shown in the
right image of FIG. 13. Lanes 1 and 2 are the PCR products that
have been generated using ethynyl dUTP and other dNTPs. L is the 25
bp ladder DNA marker. The arrows point to the .about.300 bp labeled
product. FIG. 13 also illustrates that there is no quenching of the
signal.
Example 38
PCR Free Telomerase Assay
[0560] TRAPeze.TM. TELOMERASE assay Chemicon Kit 57700. The
experiment is summarized in FIG. 22.
[0561] A 250 ul reaction mix (5.times.) for each of the three
different reaction variables was composed as follows. 25 .mu.l of
10.times. Trap buffer was mixed with 50 uM e-dNTPs (50 .mu.M of
ethynyl dUTP+50 .mu.M of each of dATP, dGTP, and dCTP) and 344 nM
of either the TS primer or biotinylated TS primer. 5 .mu.l of
Primer Mix (contains three separate primers--a K1 Fwd primer, RP
Rev Primer and TSK 1 internal control primer from the (TRAPeze
Telomerase Kit, Chemicon). The source of telomerase was 1000
positive control cells that are supplied with the Chemicon
TRAPeze.TM. TELOMERASE assay kit. Sau3 cells were used as a
negative control as they do not express any Telomerase enzyme. Each
of the three reactions also contained 10 units of Taq DNA
polymerase. 1.times. TRAP reaction buffer (20 mM Tris-HCl, pH 8.3,
1.5 MgCl2 63 mM KCl, 0.05% Tween 20, 1 mM EGTA)
[0562] The three different reactions were based on
[0563] (a) TS primer with +ve control cells (b) Biotinylated TS
primer with +ve control cells (c) Biotinylated primer with Sau 3
cells.
[0564] After the three reaction were set up, 1/5th volume of each
of the reaction was subjected to PCR aided Telomerase assay as has
been discussed above. The other 4/5 volumes of each the three
reactions were incubated at 300 C for 30 minutes and then heated at
950 C for 10 minutes. As shown in the flow chart above, one half of
each of the three reactions was cleaned using size exclusion
"Chromaspin" columns. The eluate was then subjected to click
reaction using a final concentration of 25% propylene glycol; 2 mM
copper (II); 10 mM BCS, 10 mM Sodium Ascorbate and 50 .mu.M
azido-TAMRA. The reaction was performed for 30 minutes at room
temperature. This was followed by clean up on a size exclusion as
described above. The TAMRA labeled dsDNA (PCR aided Telomerase
products) or ss DNA (PCR free Telomerase products) were blotted on
to a Biodyne plus nucleic acid binding membrane. The membrane was
scanned for a TAMRA signal.
[0565] The other half of the three reactions were incubated with 25
.mu.l of the streptavidin coated polystyrene beads (Spherotek) and
incubated at 40 C for over night. The beads were washed five times
with 50 mM Tris pH 8.0. Click chemistry was performed on the oligos
attached to the beads using the exact same reaction composition and
conditions as described above. After incubation, the labeled beads
were washed 5 times with 50 mM Tris pH 8.0. The beads were semi
dried in the speed vac and then scanned for TAMRA.
[0566] As seen in FIG. 14, the tube containing beads coated with
biotinylated TS primer show a signal for TAMRA, while the tubes
with either TS primer or negative control cells do not show the
signal.
[0567] Additionally, as shown in FIG. 15, spots on the PCR aided
+ve control and TS biotinylated primer show TAMRA signal on the
Biodyne nucleic acid membrane. The signal intensity from the PCR
positive control is far greater than PCR free Telomerase assay.
Example 39
Tagging Phosphoproteins Using Nucleotide Analogs
[0568] Phosphoproteins are labeled in vivo or in vitro using alkyne
or azide-tagged nucleotides whereby the azide or alkyne moiety is
placed on the gamma phosphate. For example one of the nucleotides
shown below is added to a reaction mixture containing a protein
kinase and a kinase target molecule. After tagging the molecule is
reacted with the appropriate alkyne or azide detection or affinity
reagent for quantitation, visualization, or enrichment. In one
example reaction, modified nucleotide substrates may be added
directly to cultured cells for metabolic incorporation of the
tagged gamma-phosphate molecule into cellular macromolecules
including proteins. The process may involve treatment of the cells
with pharmacological agents to detect alterations in
phosphorylation dynamics. Entry of the compounds into live cultured
cells could be enhanced by modifying the nucleotides with
functional groups that would afford permeability, or by concomitant
addition of cell permeablizing agents. In another example reaction,
the kinase reaction could be performed in vitro using cellular
extracts as the source of kinases and substrates. The modified
nucleotides is added to the reaction mixture and the reaction
mixtures incubated with or without the addition of pharmacological
agents of interest. The in vitro reaction optionally entails adding
an exogenous kinase or substrate source to the cellular extract
along with the nucleotide analogs. In another application, the
method is used in vitro without cellular extracts, using purified
kinases and kinase substrates. In all of the disclosed examples the
reaction mix may contain a buffer optimized for the particular
kinases of interest, a kinase source, a metal ion source, glycerol,
nucleotide ATP analog, and ATP. The "click" detection reaction with
an alkyne probe would be performed in the presence of copper(I), or
copper(II) in the presence of a copper(II) reducing agent, a
copper(I) chelating agent, and an appropriate buffer to maintaing
optimal pH conditions.
##STR00047##
[0569] The reagents employed in the examples are commercially
available or can be prepared using commercially available
instrumentation, methods, or reagents known in the art. The
foregoing examples illustrate various aspects of the invention and
practice of the methods of the invention. The examples are not
intended to provide an exhaustive description of the many different
embodiments of the invention. Thus, although the forgoing invention
has been described in some detail by way of illustration and
example for purposes of clarity of understanding, those of ordinary
skill in the art will realize readily that many changes and
modifications can be made thereto without departing from the spirit
or scope of the appended claims.
[0570] Each of the references cited herein are hereby incorporated
by reference as if set forth fully herein.
Sequence CWU 1
1
3170DNAArtificialOligo 3 1ttagggttag ggttagggtt tgggtttggg
tttgggtttg ggtttgggtt tgggctggcc 60gtcgttttac
70270DNAArtificialOligo 3 2tttgggtttg ggtttgggtt tgggtttggg
tttgggttag ggtttgggtt tgggctggcc 60gtcgttttac
70316DNAArtificialOligo 3 3gtaaaacgac ggccag 16
* * * * *