U.S. patent application number 12/758000 was filed with the patent office on 2010-10-14 for production of commercial biodiesel from genetically modified microorganisms.
This patent application is currently assigned to LS9, Inc.. Invention is credited to Wei Huang, Fernando Sanchez-Riera, Vineet Shastry.
Application Number | 20100257777 12/758000 |
Document ID | / |
Family ID | 42933202 |
Filed Date | 2010-10-14 |
United States Patent
Application |
20100257777 |
Kind Code |
A1 |
Sanchez-Riera; Fernando ; et
al. |
October 14, 2010 |
PRODUCTION OF COMMERCIAL BIODIESEL FROM GENETICALLY MODIFIED
MICROORGANISMS
Abstract
The invention provides a fermentation and recovery process for
the production of biodiesel of commercial grade quality according
to commercial and environmental standards (e.g., ASTM ANP, or EPA
trace elements and emissions standards), by fermentation of
carbohydrates using a genetically modified microorganism. The
process provides a direct route for the production of fatty esters,
without the need for producing oils which are later chemically
transesterified with the concomitant production of large quantities
of glycerin and other undesirable side-products.
Inventors: |
Sanchez-Riera; Fernando;
(South San Francisco, CA) ; Huang; Wei; (South San
Francisco, CA) ; Shastry; Vineet; (South San
Francisco, CA) |
Correspondence
Address: |
LS9, Inc.
600 Gateway Boulevard
South San Francisco
CA
94080
US
|
Assignee: |
LS9, Inc.
South San Francisco
CA
|
Family ID: |
42933202 |
Appl. No.: |
12/758000 |
Filed: |
April 11, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61168293 |
Apr 10, 2009 |
|
|
|
61226749 |
Jul 20, 2009 |
|
|
|
61227025 |
Jul 20, 2009 |
|
|
|
61262544 |
Nov 19, 2009 |
|
|
|
Current U.S.
Class: |
44/388 |
Current CPC
Class: |
C10L 2290/26 20130101;
Y02E 50/13 20130101; Y02P 30/20 20151101; C12P 7/649 20130101; C10L
1/026 20130101; C10L 2270/026 20130101; C10L 2200/0476 20130101;
Y02E 50/10 20130101 |
Class at
Publication: |
44/388 |
International
Class: |
C10L 1/19 20060101
C10L001/19 |
Claims
1. A composition produced by a microorganism, wherein the
composition comprises one or more fatty esters.
2. The composition of claim 1, wherein the composition comprises
less than or equal to about 10 mg/kg of calcium and magnesium
combined.
3. The composition of claim 1, wherein the composition comprises
less than or equal to about 500 ppm of sulfur.
4. The composition of claim 3, wherein the composition comprises
less than or equal to about 15 ppm of sulfur.
5. The composition of claim 1, wherein the composition comprises
less than or equal to about 0.02 wt. % of sulfated ash.
6. The composition of claim 1, wherein the composition comprises
less than or equal to about 0.05 vol. % of water and sediment.
7. The composition of claim 1, wherein the composition comprises
less than or equal to about 0.02 wt. % of free glycerin.
8. The composition of claim 1, wherein the composition comprises
less than or equal to about 0.38 wt. % of total glycerin.
9. The composition of claim 1, wherein the composition has a
kinematic viscosity of about 1.9 mm.sup.2/s or more.
10. The composition of claim 1, wherein the composition has a
kinematic viscosity of about 6 mm.sup.2/s or less.
11. The composition of claim 1, wherein the composition has a
kinematic viscosity of about 1.9 mm.sup.2/s to about 6
mm.sup.2/s.
12. The composition of claim 1, wherein the composition has an acid
number of less than or equal to about 0.8 mg KOH/g.
13. The composition of claim 1, wherein the composition comprises
less than or equal to about 10 mg/kg of phosphorous.
14. The composition of claim 1, wherein the composition comprises
less than or equal to about 10 mg/kg sodium and potassium
combined.
15. The composition of claim 1, wherein the composition has a
cetane number of about 47 or more.
16. The composition of claim 1, wherein the composition has an
oxidation stability of about 3 hours or more.
17. The composition of claim 1, wherein the composition has a cloud
point of about 10.degree. C. or less.
18. The composition of claim 1, wherein the composition comprises
less than or equal to about 24 mg/kg of contaminants in the middle
distillates.
19. The composition of claim 1, wherein the composition comprises
less than or equal to about 0.1 wt. % of carbon residue.
20. The composition of claim 1, wherein the composition has a
density at 15.degree. C. of about 860 kg/m.sup.3 or more.
21. The composition of claim 1, wherein the composition has a
density at 20.degree. C. of about 865 kg/m.sup.3 or more.
22. The composition of claim 1, wherein the composition has a flash
point of about 100.degree. C. or more.
23. The composition of claim 1, wherein the composition comprises a
total ester content of about 96.5 wt. % or more.
24. The composition of claim 1, wherein the composition has a cold
filter plugging point of about 5.degree. C. or less.
25. The composition of claim 1, wherein the composition has a
copper strip corrosion rating of class 3 or lower.
26. The composition of claim 1, wherein the composition has a
methanol/ethanol content of equal to or less than about 0.5 wt.
%.
27. The composition of claim 1, wherein the composition has an
iodine value of equal to or less than about 120 g/100 g.
28. The composition of claim 1, wherein the composition comprises
less than or equal to about 0.02 ppm of copper.
29. The composition of claim 1, wherein the composition comprises
less than or equal to about 2 ppm of boron.
30. The composition of claim 1, wherein the composition comprises
less than or equal to about 2.0 ppm of chromium.
31. The composition of claim 1, wherein the composition comprises
less than or equal to about 5 ppm of iron.
32. The composition of claim 1, wherein the composition comprises
less than or equal to about 2 ppm of molybdenum.
33. The composition of claim 1, wherein the composition comprises
less than or equal to about 35 ppm of nitrogen.
34. The composition of claim 1, wherein the composition comprises
less than or equal to about 35 ppm of total halogens.
35. The composition of claim 1, wherein the composition comprises
less than or equal to about 2.5 ppm of zinc.
36. The composition of claim 1, wherein the composition emits about
2.3 g/bph-hr or less of NO.sub.X gases.
37. The composition of claim 1, wherein the composition emits equal
to or less than 2 g/bhp-hr of total hydrocarbon.
38. The composition of claim 1, wherein the composition emits about
0.007 g/bhp-hr or less of particulate matter.
39. The composition of claim 1, wherein the composition emits about
0.001 to about 0.007 g/bhp-hr of particulate matter.
40. The composition of claim 1, wherein the composition emits about
0.4 g/bhp-hr or less of CO.
41. The composition of claim 1, wherein the composition emits 0.25
to about 0.4 g/bhp-hr of CO.
42. The composition of claim 1, wherein the composition comprises
less than or equal to about 15 ppm of benzene.
43. A biofuel composition comprising the composition of any one of
claims 1-42.
44. The biofuel composition of claim 43 further comprising
petroleum diesel.
45. The biofuel composition of claim 43, further comprising one or
more fuel additives selected from: engine performance additives,
detergents, dispersants, antiwear agents, viscosity index
modifiers, friction modifiers, antioxidants, rust inhibitors,
antifoaming agents, seal fixes, lubricity additives, pour point
depressants, cloud point reducers, smoke suppressants, drag
reducing additives, metal deactivators, biocides and
demulsifiers.
46. The biofuel composition of claim 45, wherein the one or more
fuel additives are first blended into a fuel additive package,
wherein the additive package comprises a major amount of one or
more base oils and a minor amount of one or more additives.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application Nos. 61/168,293, filed Apr. 10, 2009, 61/266,749, filed
Jul. 20, 2009, 61/227,025, filed Jul. 20, 2009, and 61/262,544,
filed Nov. 19, 2009, the entire content of each is hereby
incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] Petroleum is a limited, natural resource found in the Earth
in liquid, gaseous, or solid forms. Petroleum is primarily composed
of hydrocarbons, which are comprised mainly of carbon and hydrogen.
It also contains significant amounts of other elements, such as,
nitrogen, oxygen, or sulfur, in different forms.
[0003] Petroleum is a valuable resource, but petroleum products are
developed at considerable costs, both financial and environmental.
First, sources of petroleum must be discovered. Petroleum
exploration is an expensive and risky venture. The cost of
exploring deep water wells can exceed $100 million. In addition to
the economic cost, petroleum exploration carries a high
environmental cost. For example, offshore exploration disturbs the
surrounding marine environments.
[0004] After a productive well is discovered, the petroleum must be
extracted from the Earth at great expense. Even under the best
circumstances, only 50% of the petroleum in a well can be
extracted. Petroleum extraction also carries an environmental cost.
For example, petroleum extraction can result in large seepages of
petroleum rising to the surface. Offshore drilling involves
dredging the seabed which disrupts or destroys the surrounding
marine environment.
[0005] After extraction, petroleum must be transported over great
distances from petroleum producing regions to petroleum consuming
regions. In addition to the shipping costs, there is also the
environmental risk of devastating oil spills.
[0006] In its natural form, crude petroleum extracted from the
Earth has few commercial uses. It is a mixture of hydrocarbons
(e.g., paraffins (or alkanes), olefins (or alkenes), alkynes,
napthenes (or cylcoalkanes), aliphatic compounds, aromatic
compounds, etc.) of varying length and complexity. In addition,
crude petroleum contains other organic compounds (e.g., organic
compounds containing nitrogen, oxygen, sulfur, etc.) and impurities
(e.g., sulfur, salt, acid, metals, etc.).
[0007] Hence, crude petroleum must be refined and purified before
it can be used commercially. Due to its high energy density and its
easy transportability, most petroleum is refined into fuels, such
as transportation fuels (e.g., gasoline, diesel, aviation fuel,
etc.), heating oil, liquefied petroleum gas, etc.
[0008] Crude petroleum is also a primary source of raw materials
for producing petrochemicals. The two main classes of raw materials
derived from petroleum are short chain olefins (e.g., ethylene and
propylene) and aromatics (e.g., benzene and xylene isomers). These
raw materials are derived from the longer chain hydrocarbons in
crude petroleum by cracking the long chain hydrocarbons at
considerable expense using a variety of methods, such as catalytic
cracking, steam cracking, or catalytic reforming. These raw
materials are used to make petrochemicals, which cannot be directly
refined from crude petroleum, such as monomers, solvents,
detergents, or adhesives.
[0009] One example of a raw material derived from crude petroleum
is ethylene. Ethylene is used to produce petrochemicals such as,
polyethylene, ethanol, ethylene oxide, ethylene glycol, polyester,
glycol ether, ethoxylate, vinyl acetate, 1,2-dichloroethane,
trichloroethylene, tetrachloroethylene, vinyl chloride, and
polyvinyl chloride. Another example of a raw material derived from
crude petroleum is propylene. Propylene is used to produce
isopropyl alcohol, acrylonitrile, polypropylene, propylene oxide,
propylene glycol, glycol ethers, butylene, isobutylene,
1,3-butadiene, synthetic elastomers, polyolefins, alpha-olefins,
fatty alcohols, acrylic acid, acrylic polymers, allyl chloride,
epichlorohydrin, and epoxy resins.
[0010] Petrochemicals can be used to make specialty chemicals, such
as plastics, resins, fibers, elastomers, pharmaceuticals,
lubricants, or gels. Examples of specialty chemicals which can be
produced from petrochemical raw materials are: fatty acids,
hydrocarbons (e.g., long chain hydrocarbons, branched chain
hydrocarbons, saturated hydrocarbons, unsaturated hydrocarbons,
etc.), fatty alcohols, esters, fatty aldehydes, ketones,
lubricants, etc.
[0011] Specialty chemicals have many commercial uses. Fatty acids
are used commercially as surfactants. Surfactants can be found in
detergents and soaps. Fatty acids can also be used as additives in
fuels, lubricating oils, paints, lacquers, candles, salad oils,
shortenings, cosmetics, and emulsifiers. In addition, fatty acids
are used as accelerator activators in rubber products. Fatty acids
can also be used as a feedstock to produce methyl esters, amides,
amines, acid chlorides, anhydrides, ketene dimers, and peroxy acids
and esters.
[0012] Hydrocarbons have many commercial uses. For example, shorter
chain alkanes are used as fuels. Methane and ethane are the main
constituents of natural gas. Longer chain alkanes (e.g., from five
to sixteen carbons) are used as transportation fuels (e.g.,
gasoline, diesel, or aviation fuel). Alkanes having more than
sixteen carbon atoms are important components of fuel oils and
lubricating oils. Even longer alkanes, which are solid at room
temperature, can be used, for example, as a paraffin wax. Alkanes
that contain approximately thirty-five carbons are found in
bitumen, which is used for road surfacing. In addition, longer
chain alkanes can be cracked to produce commercially useful shorter
chain hydrocarbons.
[0013] Like short chain alkanes, short chain alkenes are used in
transportation fuels. Longer chain alkenes are used in plastics,
lubricants, and synthetic lubricants. In addition, alkenes are used
as a feedstock to produce alcohols, esters, plasticizers,
surfactants, tertiary amines, enhanced oil recovery agents, fatty
acids, thiols, alkenylsuccinic anhydrides, epoxides, chlorinated
alkanes, chlorinated alkenes, waxes, fuel additives, and drag flow
reducers.
[0014] Fatty alcohols have many commercial uses. The shorter chain
fatty alcohols are used in the cosmetic and food industries as
emulsifiers, emollients, and thickeners. Due to their amphiphilic
nature, fatty alcohols behave as nonionic surfactants, which are
useful in detergents. In addition, fatty alcohols are used in
waxes, gums, resins, pharmaceutical salves and lotions, lubricating
oil additives, textile antistatic and finishing agents,
plasticizers, cosmetics, industrial solvents, and solvents for
fats.
[0015] Esters have many commercial uses. For example, biodiesel, an
alternative fuel, is comprised of esters (e.g., fatty acid methyl
ester, fatty acid ethyl esters, etc.). Some low molecular weight
esters are volatile with a pleasant odor which makes them useful as
fragrances or flavoring agents. In addition, esters are used as
solvents for lacquers, paints, and varnishes. Furthermore, some
naturally occurring substances, such as waxes, fats, and oils are
comprised of esters. Esters are also used as softening agents in
resins and plastics, plasticizers, flame retardants, and additives
in gasoline and oil. In addition, esters can be used in the
manufacture of polymers, films, textiles, dyes, and
pharmaceuticals.
[0016] Aldehydes are used to produce many specialty chemicals. For
example, aldehydes are used to produce polymers, resins, dyes,
flavorings, plasticizers, perfumes, pharmaceuticals, and other
chemicals. Some are used as solvents, preservatives, or
disinfectants. Some natural and synthetic compounds, such as
vitamins and hormones, are aldehydes. In addition, many sugars
contain aldehyde groups.
[0017] Ketones are used commercially as solvents. For example,
acetone is frequently used as a solvent, but it is also a raw
material for making polymers. Ketones are also used in lacquers,
paints, explosives, perfumes, and textile processing. In addition,
ketones are used to produce alcohols, alkenes, alkanes, imines, and
enamines.
[0018] In addition, crude petroleum is a source of lubricants.
Lubricants derived petroleum are typically composed of olefins,
particularly polyolefins and alpha-olefins. Lubricants can either
be refined from crude petroleum or manufactured using the raw
materials refined from crude petroleum.
[0019] Obtaining these specialty chemicals from crude petroleum
requires a significant financial investment as well as a great deal
of energy. It is also an inefficient process because frequently the
long chain hydrocarbons in crude petroleum are cracked to produce
smaller monomers. These monomers are then used as the raw material
to manufacture the more complex specialty chemicals.
[0020] In addition to the problems with exploring, extracting,
transporting, and refining petroleum, petroleum is a limited and
dwindling resource. One estimate of current world petroleum
consumption is 30 billion barrels per year. By some estimates, it
is predicted that at current production levels, the world's
petroleum reserves could be depleted before the year 2050.
[0021] Finally, the burning of petroleum based fuels releases
greenhouse gases (e.g., carbon dioxide) and other forms of air
pollution (e.g., carbon monoxide, sulfur dioxide, etc.). As the
world's demand for fuel increases, the emission of greenhouse gases
and other forms of air pollution also increases. The accumulation
of greenhouse gases in the atmosphere leads to an increase in
global warming Hence, in addition to damaging the environment
locally (e.g., oil spills, dredging of marine environments, etc.),
burning petroleum also damages the environment globally.
[0022] Due to the inherent challenges posed by petroleum, there is
a need for a renewable petroleum source which does not need to be
explored, extracted, transported over long distances, or
substantially refined like petroleum. There is also a need for a
renewable petroleum source that can be produced economically. In
addition, there is a need for a renewable petroleum source that
does not create the type of environmental damage produced by the
petroleum industry and the burning of petroleum based fuels. For
similar reasons, there is also a need for a renewable source of
chemicals that are typically derived from petroleum.
SUMMARY OF THE INVENTION
[0023] The invention provides a fermentation and recovery process
for the production of biodiesel of commercial grade quality
according to commercial standards (e.g., ASTM or ANP) as well as
environmental standards (e.g., those promulgated by the United
States Environmental Protection Agency (EPA), and similar agencies
elsewhere) by fermentation of carbohydrates using a genetically
modified microorganism. The process provides a direct route for the
production of fatty esters, for example fatty acid esters, and
especially fatty acid methyl esters, without the need for producing
oils which are later chemically transesterified with the
concomitant production of large quantities of glycerol. The
biodiesels produced, alone or blended with petroleum diesel
according to customary proportions, result in clean emissions
profiles and low amounts of impurities and/or undesirable
contaminants.
[0024] The invention provides a recombinant cell comprising (a) at
least one gene encoding a fatty acid derivative enzyme, which gene
is modified such that the gene is overexpressed, and (b) a gene
encoding a fatty acid degradation enzyme, which gene is modified
such that expression of the gene is attenuated.
[0025] The invention also provides a recombinant cell capable of
producing esters, wherein the cell is modified to include at least
one exogenous nucleic acid sequence encoding a fatty acid
derivative enzyme.
[0026] The invention further provides a recombinant cell comprising
(a) an exogenous nucleic acid sequence encoding a thioesterase; (b)
an exogenous nucleic acid sequence encoding an acyl-CoA synthase;
(c) an exogenous nucleic acid sequence encoding a wax synthase; and
(d) a gene encoding a fatty acid degradation enzyme, wherein the
gene is modified such that expression of the gene is
attenuated.
[0027] The invention additionally provides a composition produced
by the recombinant cell as described herein, comprising fatty
esters produced from the recombinant cell.
[0028] The invention further provides a fuel composition,
including, for example, a biodiesel composition, comprising the
fatty esters produced by the recombinant cells in accordance to the
description herein. In certain embodiments, the fuel composition
also comprises one or more suitable fuel additives.
[0029] The invention also provides a method for producing fatty
esters in a recombinant cell comprising (a) obtaining the
recombinant cell, (b) culturing the recombinant cell under suitable
conditions for expression, and (c) obtaining fatty esters.
[0030] The drawings and examples provided herein are intended
solely to illustrate the features of the present invention. They
are not intended to be limiting.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0031] FIG. 1 is a diagram illustrating the cloning methods used to
generate the plasmid pCLTFWcat.
[0032] FIG. 2 is a diagram illustrating the cloning methods used to
generate the integration fragment lacZ:: tesA fadD atfA1.
[0033] FIG. 3 is the nucleotide sequence of the integration
fragment lacZ:: tesA fadD atfA1.
[0034] FIG. 4 shows the cycle engine speed and torque of the 2008
model year 9.3 L 330 horsepower International MaxxForce 10 engine,
which was used in the emissions testing conducted by National
Renewable Energy Laboratory of Denver, Colo.
[0035] FIG. 5 indicates and compares the levels of NO.sub.X and CO
emissions as well as the levels of fuel consumption by (1) the 2007
Certification Ultra Low Sulfur Diesel (ULSD, Haltermann Product,
Channelview, Tex.), which was used as a baseline fuel and a
petroleum-based blend stock for the biodiesel blends in the
emissions testing; (2) the SOY B20 biodiesel blend; and (3) the FAE
B20 biodiesel blend.
[0036] FIG. 6 lists the nucleotide sequence of the plasmid pLacZ
(SEQ ID NO:28).
DETAILED DESCRIPTION OF THE INVENTION
Abbreviations and Terms
[0037] The following explanations of terms and methods are provided
to facilitate understanding of the present disclosure and to guide
those of ordinary skill in the art in the practice of the present
disclosure.
[0038] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0039] As used herein, the term "alcohol dehydrogenase" (EC
1.1.1.*) is a peptide capable of catalyzing the conversion of a
fatty aldehyde to an alcohol (e.g., fatty alcohol). Additionally,
one of ordinary skill in the art will appreciate that some alcohol
dehydrogenases will catalyze other reactions as well. For example,
some alcohol dehydrogenases will accept other substrates in
addition to fatty aldehydes. Such non-specific alcohol
dehydrogenases are, therefore, also included in this
definition.
[0040] As used herein, the term "aldehyde" means a hydrocarbon
having the formula RCHO characterized by an unsaturated carbonyl
group (C.dbd.O). In a preferred embodiment, the aldehyde is any
aldehyde made from a fatty acid or fatty acid derivative.
[0041] In one embodiment, the R group is at least about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
carbons in length. R can be straight or branched chain. The
branched chains may have one or more points of branching. In
addition, the branched chains may include cyclic branches.
Furthermore, R can be saturated or unsaturated. If unsaturated, the
R can have one or more points of unsaturation.
[0042] In one embodiment, the fatty aldehyde is produced
biosynthetically.
[0043] Fatty aldehydes have many uses. For example, fatty aldehydes
can be used to produce many specialty chemicals. For example, fatty
aldehydes are used to produce polymers, resins, dyes, flavorings,
plasticizers, perfumes, pharmaceuticals, and other chemicals. Some
are used as solvents, preservatives, or disinfectants. Some natural
and synthetic compounds, such as vitamins and hormones, are
aldehydes.
[0044] As used herein, an "aldehyde biosynthetic gene" or an
"aldehyde biosynthetic polynucleotide" is a nucleic acid that
encodes an aldehyde biosynthetic polypeptide.
[0045] As used herein, an "aldehyde biosynthetic polypeptide" is a
polypeptide that is a part of the biosynthetic pathway of an
aldehyde. Such polypeptides can act on a biological substrate to
yield an aldehyde. In some instances, the aldehyde biosynthetic
polypeptide has reductase activity.
[0046] As used herein, the term "alkane" means a hydrocarbon
containing only single carbon-carbon bonds.
[0047] As used herein, an "alkane biosynthetic gene" or an "alkane
biosynthetic polynucleotide" is a nucleic acid that encodes an
alkane biosynthetic polypeptide.
[0048] As used herein, an "alkane biosynthetic polypeptide" is a
polypeptide that is a part of the biosynthetic pathway of an
alkane. Such polypeptides can act on a biological substrate to
yield an alkane. In some instances, the alkane biosynthetic
polypeptide has decarbonylase activity.
[0049] As used herein, an "alkene biosynthetic gene" or an "alkene
biosynthetic polynucleotide" is a nucleic acid that encodes an
alkene biosynthetic polypeptide.
[0050] As used herein, an "alkene biosynthetic polypeptide" is a
polypeptide that is a part of the biosynthetic pathway of an
alkene. Such polypeptides can act on a biological substrate to
yield an alkene. In some instances, the alkene biosynthetic
polypeptide has decarbonylase activity.
[0051] As used herein, the term "attenuate" means to weaken,
reduce, or diminish For example, a polypeptide can be attenuated by
modifying the polypeptide to reduce its activity (e.g., by
modifying a nucleotide sequence that encodes the polypeptide).
[0052] As used herein, the term "base oil" refers to a building
block of a lubricant or fuel additive. A base oil is typically used
as a solvent for formulating an additive package for. Depending on
the grade and/or type of base oil, it may provide a varying degree
of performance benefit to an additive package, including, for
example, extreme temperature benefits, anti-oxidative benefits, or
a suitable pour point. Additive packages are commonly used to
improve the service life and performance of finished oil or fuel
products.
[0053] As used herein, the term "biocrude" refers to a product
derived from biomass, biomass derivatives, or other biological
sources that, like petroleum crude, can be converted into other
fuels. For example, biocrude can be converted into gasoline,
diesel, jet fuel, or heating oil. Moreover, biocrude, like
petroleum crude, can be converted into other industrially useful
chemicals for use in, for example, pharmaceuticals, cosmetics,
consumer goods, industrial processes, and the like.
[0054] Biocrude may include, for example, hydrocarbons, hydrocarbon
products, fatty acid esters, and/or aliphatic ketones. In a
preferred embodiment, biocrude is comprised of hydrocarbons, for
example aliphatic (e.g., alkanes, alkenes, alkynes) or aromatic
hydrocarbons.
[0055] As used herein, the term "biodiesel" means a biofuel that
can be a substitute of diesel, which is derived from petroleum.
Biodiesel can be used in internal combustion diesel engines in
either a pure form, which is referred to as "neat" biodiesel, or as
a mixture in any concentration with petroleum-based diesel. In one
embodiment, biodiesel can include esters or hydrocarbons, such as
aldehydes, alkanes, or alkenes.
[0056] As used herein, the term "biofuel" refers to any fuel
derived from biomass, biomass derivatives, or other biological
sources. Biofuels can be substituted for petroleum based fuels. For
example, biofuels are inclusive of transportation fuels (e.g.,
gasoline, diesel, jet fuel, etc.), heating fuels, and
electricity-generating fuels. Biofuels are a renewable energy
source.
[0057] As used herein, the term "biomass" refers to a carbon source
derived from biological material. Biomass can be converted into a
biofuel. One exemplary source of biomass is plant matter. For
example, corn, sugar cane, or switchgrass can be used as biomass.
Another non-limiting example of biomass is animal matter, for
example cow manure. Biomass also includes waste products from
industry, agriculture, forestry, and households. Examples of such
waste products that can be used as biomass are fermentation waste,
straw, lumber, sewage, garbage, and food leftovers. Biomass also
includes sources of carbon, such as carbohydrates (e.g.,
monosaccharides, disaccharides, or polysaccharides).
[0058] As used herein, the phrase "carbon source" refers to a
substrate or compound suitable to be used as a source of carbon for
prokaryotic or simple eukaryotic cell growth. Carbon sources can be
in various forms, including, but not limited to polymers,
carbohydrates, acids, alcohols, aldehydes, ketones, amino acids,
peptides, and gases (e.g., CO and CO.sub.2). These include, for
example, various monosaccharides, such as glucose, fructose,
mannose, and galactose; oligosaccharides, such as
fructo-oligosaccharide and galacto-oligosaccharide; polysaccharides
such as xylose and arabinose; disaccharides, such as sucrose,
maltose, and turanose; cellulosic material, such as methyl
cellulose and sodium carboxymethyl cellulose; saturated or
unsaturated fatty acid esters, such as succinate, lactate, and
acetate; alcohols, such as methanol, ethanol, propanol, or mixtures
thereof. The carbon source can also be a product of photosynthesis,
including, but not limited to, glucose. A preferred carbon source
is biomass. Another preferred carbon source is glucose.
[0059] As used herein, a "cloud point lowering additive" is an
additive added to a composition to decrease or lower the cloud
point of a solution.
[0060] As used herein, the phrase "cloud point of a fluid" means
the temperature at which dissolved solids are no longer completely
soluble. Below this temperature, solids begin precipitating as a
second phase giving the fluid a cloudy appearance. In the petroleum
industry, cloud point refers to the temperature below which a
solidified material or other heavy hydrocarbon crystallizes in a
crude oil, refined oil, or fuel to form a cloudy appearance. The
presence of solidified materials influences the flowing behavior of
the fluid, the tendency of the fluid to clog fuel filters,
injectors, etc., the accumulation of solidified materials on cold
surfaces (e.g., a pipeline or heat exchanger fouling), and the
emulsion characteristics of the fluid with water.
[0061] A nucleotide sequence is "complementary" to another
nucleotide sequence if each of the bases of the two sequences
matches (e.g., is capable of forming Watson Crick base pairs). The
term "complementary strand" is used herein interchangeably with the
term "complement". The complement of a nucleic acid strand can be
the complement of a coding strand or the complement of a non-coding
strand.
[0062] The terms "comprising," "having," "including," and
"containing" are to be construed as open-ended terms (e.g., meaning
"including, but not limited to,") unless otherwise noted.
[0063] As used herein, the term "conditions sufficient to allow
expression" means any conditions that allow a host cell to produce
a desired product, such as a polypeptide, aldehyde, or alkane
described herein. Suitable conditions include, for example,
fermentation conditions. Fermentation conditions can comprise many
parameters, such as temperature ranges, levels of aeration, and
media composition. Each of these conditions, individually and in
combination, allows the host cell to grow. Exemplary culture media
include broths or gels. Generally, the medium includes a carbon
source, such as glucose, fructose, cellulose, or the like, that can
be metabolized by a host cell directly. In addition, enzymes can be
used in the medium to facilitate the mobilization (e.g., the
depolymerization of starch or cellulose to fermentable sugars) and
subsequent metabolism of the carbon source.
[0064] To determine if conditions are sufficient to allow
expression, a host cell can be cultured, for example, for about 4,
8, 12, 24, 36, or 48 hours. During and/or after culturing, samples
can be obtained and analyzed to determine if the conditions allow
expression. For example, the host cells in the sample or the medium
in which the host cells were grown can be tested for the presence
of a desired product. When testing for the presence of a product,
assays, such as, but not limited to, TLC, HPLC, GC/FID, GC/MS,
LC/MS, MS, can be used.
[0065] It is understood that the polypeptides described herein may
have additional conservative or non-essential amino acid
substitutions, which do not have a substantial effect on the
polypeptide functions. Whether or not a particular substitution
will be tolerated (e.g., will not adversely affect desired
biological properties, such as decarboxylase activity) can be
determined as described in Bowie et al., Science (1990) 247:1306
1310. A "conservative amino acid substitution" is one in which the
amino acid residue is replaced with an amino acid residue having a
similar side chain. Families of amino acid residues having similar
side chains have been defined in the art. These families include
amino acids with basic side chains (e.g., lysine, arginine, and
histidine), acidic side chains (e.g., aspartic acid and glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine, threonine, tyrosine, and cysteine), nonpolar
side chains (e.g., alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, and tryptophan), beta-branched side
chains (e.g., threonine, valine, and isoleucine), and aromatic side
chains (e.g., tyrosine, phenylalanine, tryptophan, and
histidine).
[0066] As used herein, "conditions that permit product production"
refers to any fermentation conditions that allow a production host
to produce a desired product, such as acyl-CoA or fatty acid
derivatives (e.g., fatty acids, hydrocarbons, fatty alcohols,
waxes, or fatty esters). Fermentation conditions usually comprise
many parameters. Exemplary conditions include, but are not limited
to, temperature ranges, levels of aeration, and media composition.
Each of these conditions, individually and/or in combination,
allows the production host to grow.
[0067] Exemplary media include broths and/or gels. Generally, a
suitable medium includes a carbon source (e.g., glucose, fructose,
cellulose, etc.) that can be metabolized by the microorganism
directly. In addition, enzymes can be used in the medium to
facilitate the mobilization (e.g., the depolymerization of starch
or cellulose to fermentable sugars) and subsequent metabolism of
the carbon source.
[0068] To determine if the fermentation conditions permit product
production, the production host can be cultured for about 4, 8, 12,
24, 36, or 48 hours. During culturing or after culturing, samples
can be obtained and analyzed to determine if the fermentation
conditions have permitted product production. For example, the
production hosts in the sample or the medium in which the
production hosts are grown can be tested for the presence of the
desired product. Exemplary assays, such as TLC, HPLC, GC/FID,
GC/MS, LC/MS, MS, as well as those provided herein, can be used
identify and quantify the presence of a product.
[0069] As used herein, "control element" means a transcriptional
control element. Control elements include promoters and enhancers.
The term "promoter element," "promoter," or "promoter sequence"
refers to a DNA sequence that functions as a switch that activates
the expression of a gene. If the gene is activated, it is said to
be transcribed or participating in transcription. Transcription
involves the synthesis of mRNA from the gene. A promoter,
therefore, serves as a transcriptional regulatory element and also
provides a site for initiation of transcription of the gene into
mRNA. Control elements interact specifically with cellular proteins
involved in transcription (Maniatis et al., Science 236:1237,
1987).
[0070] As used herein, the term "deletion," or "knockout" means
modifying or inactivating a polynucleotide sequence that encodes a
target protein in order to reduce or eliminate the function of the
target protein. A polynucleotide deletion can be performed by
methods well known in the art (See, e.g., Datsenko et al., Proc.
Nat. Acad. Sci. USA, 97:6640-45, 2000 or International Patent
Application Nos. PCT/US2007/011923 and PCT/US2008/058788)
[0071] As used herein, the term "demulsifier" refers to a
surfactant that breaks an emulsion formed when an oil or a
hydrophobic substance (e.g., a fuel) is mixed with water or an
aqueous substance. A demulsifier allows the oil and water phases to
separate.
[0072] As used herein, the term "a dispersant additive" means a
surface active agent added to a suspending medium to promote
uniform and maximum separation of extremely fine solid particles,
often of colloidal size. A dispersant additive can be used to
maintain a suspension of insoluble materials produced from the
oxidation and degradation of fuel that occurs when a diesel engine
is operated. The dispersant additive can prevent sludge
flocculation and precipitation or deposition on metal parts. In a
preferred embodiment, ashless dispersant additives are used. An
ashless dispersant additive is a dispersant that does not contain
metal ions, but typically comprises a material having an
oil-soluble polymeric hydrocarbon backbone with functional groups
that are capable of associating with the particles to be dispersed.
Many ashless dispersant additives are well known in the art. They
include, without limitation, carboxylic dispersants, succinimide
dispersants, amine dispersants, and Mannich dispersants.
[0073] As used herein, the term "endogenous" means a polynucleotide
that is in the cell and was not introduced into the cell using
recombinant genetic engineering techniques. For example, a gene
that was present in the cell when the cell was originally isolated
from nature. A polynucleotide is still considered endogenous if the
control sequences, such as a promoter or enhancer sequences which
activate transcription or translation, have been altered through
recombinant techniques.
[0074] As used herein, the term "ester synthase" means a peptide
capable of producing fatty esters. More specifically, an ester
synthase is a peptide which converts a thioester to a fatty ester.
In a preferred embodiment, the ester synthase converts a thioester
(e.g., acyl-CoA) to a fatty ester.
[0075] In an alternate embodiment, an ester synthase uses a
thioester and an alcohol as substrates to produce a fatty ester.
Ester synthases are capable of using short and long chain
thioesters as substrates. In addition, ester synthases are capable
of using short and long chain alcohols as substrates.
[0076] Non-limiting examples of ester synthases are wax synthases,
wax-ester synthases, acyl CoA:alcohol transacylases,
acyltransferases, and fatty acyl-coenzyme A:fatty alcohol
acyltransferases. Exemplary ester synthases are classified in
enzyme classification number EC 2.3.1.75. A number of these
enzymes, as well as other useful enzymes for making the products
described herein, have been disclosed in, for example,
International Patent Application Nos. PCT/US2007/011923 and
PCT/US2008/058788, which are incorporated herein by reference.
[0077] As used herein, the term "exogenous" means a polynucleotide
that does not originate from a particular cell as found in nature.
For example, "exogenous polynucleotide" could refer to a
polynucleotide that was inserted within the genomic polynucleotide
sequence of a microorganism or to an extra chromosomal
polynucleotide that was introduced into the microorganism. Thus, a
non-naturally-occurring polynucleotide is considered to be
exogenous to a cell once introduced into the cell. A polynucleotide
that is naturally-occurring can also be exogenous to a particular
cell. For example, an entire polynucleotide isolated from a first
cell can be an exogenous polynucleotide with respect to a second
cell if that polynucleotide from the first cell is introduced into
the second cell.
[0078] As used herein, the term "fatty acid" means a carboxylic
acid having the formula RCOOH. R represents an aliphatic group,
preferably an alkyl group. R can comprise between about 4 and about
22 carbon atoms. Fatty acids can be saturated, monounsaturated, or
polyunsaturated. In a preferred embodiment, the fatty acid is made
from a fatty acid biosynthetic pathway.
[0079] As used herein, the term "fatty acid biosynthetic pathway"
means a biosynthetic pathway that produces fatty acids. The fatty
acid biosynthetic pathway includes fatty acid enzymes that can be
engineered, as described herein, to produce fatty acids, and in
some embodiments can be expressed with additional enzymes to
produce fatty acids having desired carbon chain
characteristics.
[0080] As used herein, the term "fatty acid degradation enzyme"
means an enzyme involved in the breakdown or conversion of a fatty
acid or fatty acid derivative into another product. A nonlimiting
example of a fatty acid degradation enzyme is an acyl-CoA synthase.
A number of these enzymes, as well as other useful enzymes for
making the products described herein, have been disclosed in, for
example, International Patent Application Nos. PCT/US2007/011923
and PCT/US2008/058788, which are incorporated herein by reference.
Additional examples of fatty acid degradation enzymes are described
herein.
[0081] As used herein, the term "fatty acid derivative" means
products made in part from the fatty acid biosynthetic pathway of
the production host organism. "Fatty acid derivative" also includes
products made in part from acyl-ACP or acyl-ACP derivatives. The
fatty acid biosynthetic pathway includes fatty acid synthase
enzymes which can be engineered as described herein to produce
fatty acid derivatives, and in some examples can be expressed with
additional enzymes to produce fatty acid derivatives having desired
carbon chain characteristics. Exemplary fatty acid derivatives
include for example, fatty acids, acyl-CoAs, fatty aldehydes, short
and long chain alcohols, hydrocarbons, fatty alcohols, ketones, and
esters (e.g., waxes, fatty acid esters, or fatty esters).
[0082] As used herein, the term "fatty acid derivative enzymes"
means all enzymes that may be expressed or overexpressed in the
production of fatty acid derivatives. These enzymes are
collectively referred to herein as fatty acid derivative enzymes.
These enzymes may be part of the fatty acid biosynthetic pathway.
Non-limiting examples of fatty acid derivative enzymes include
fatty acid synthases, thioesterases, acyl-CoA synthases, acyl-CoA
reductases, alcohol dehydrogenases, alcohol acyltransferases,
carboxylic acid reductases, fatty alcohol-forming acyl-CoA
reductase, ester synthases, aldehyde biosynthetic polypeptides, and
alkane biosynthetic polypeptides. Fatty acid derivative enzymes
convert a substrate into a fatty acid derivative. In some examples,
the substrate may be a fatty acid derivative which the fatty acid
derivative enzyme converts into a different fatty acid derivative.
A number of these enzymes, as well as other useful enzymes for
making the products described herein, have been disclosed in, for
example, International Patent Application Nos. PCT/US2007/011923
and PCT/US2008/058788, which are incorporated herein by
reference.
[0083] As used herein, "fatty acid enzyme" means any enzyme
involved in fatty acid biosynthesis. Fatty acid enzymes can be
expressed or overexpressed in host cells to produce fatty acids.
Non-limiting examples of fatty acid enzymes include fatty acid
synthases and thioesterases. A number of these enzymes, as well as
other useful enzymes for making the products described herein, have
been disclosed in, for example, International Patent Application
Nos. PCT/US2007/011923 and PCT/US2008/058788, which are
incorporated herein by reference.
[0084] As used herein, the term "fatty alcohol" means an alcohol
having the formula ROH. In a preferred embodiment, the fatty
alcohol is any alcohol made from a fatty acid or fatty acid
derivative.
[0085] In one embodiment, the R group is at least about 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbons in length.
R can be straight or branched chain. The branched chains may have
one or more points of branching. In addition, the branched chains
may include cyclic branches. Furthermore, R can be saturated or
unsaturated. If unsaturated, the R can have one or more points of
unsaturation.
[0086] In one embodiment, the fatty alcohol is produced
biosynthetically.
[0087] Fatty alcohols have many uses. For example, fatty alcohols
can be used to produce many specialty chemicals. For example, fatty
alcohols are used as a biofuel; as solvents for fats, waxes, gums,
and resins; in pharmaceutical salves, emollients and lotions; as
lubricating-oil additives; in detergents and emulsifiers; as
textile antistatic and finishing agents; as plasticizers; as
nonionic surfactants; and in cosmetics, for examples as
thickeners.
[0088] As used herein, the term "fatty ester" means an ester. In a
preferred embodiment, a fatty ester is any ester made from a fatty
acid to produce, for example, a fatty acid ester. In one
embodiment, a fatty ester contains an A side (i.e., the carbon
chain attached to the carboxylate oxygen) and a B side (i.e., the
carbon chain comprising the parent carboxylate). In a preferred
embodiment, when the fatty ester is derived from the fatty acid
biosynthetic pathway, the A side is contributed by an alcohol, and
the B side is contributed by a fatty acid. Any alcohol can be used
to form the A side of the fatty esters. For example, the alcohol
can be derived from the fatty acid biosynthetic pathway.
Alternatively, the alcohol can be produced through non-fatty acid
biosynthetic pathways. Moreover, the alcohol can be provided
exogenously. For example, the alcohol can be supplied in the
fermentation broth in instances where the fatty ester is produced
by an organism that can also produce the fatty acid. Alternatively,
a carboxylic acid, such as a fatty acid or acetic acid, can be
supplied exogenously in instances where the fatty ester is produced
by an organism that can also produce alcohol.
[0089] The carbon chains comprising the A side or B side can be of
any length. In one embodiment, the A side of the ester is at least
about 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 14, 16, or 18 carbons in
length. The B side of the ester is at least about 4, 6, 8, 10, 12,
14, 16, 18, 20, 22, 24, or 26 carbons in length. The A side and/or
the B side can be straight or branched chain. The branched chains
may have one or more points of branching. In addition, the branched
chains may include cyclic branches. Furthermore, the A side and/or
B side can be saturated or unsaturated. If unsaturated, the A side
and/or B side can have one or more points of unsaturation.
[0090] In one embodiment, the fatty ester is produced
biosynthetically. In this embodiment, first the fatty acid is
"activated." Non-limiting examples of "activated" fatty acids are
acyl-CoA, acyl-ACP, and acyl phosphate. Acyl-CoA can be a direct
product of fatty acid biosynthesis or degradation. In addition,
acyl-CoA can be synthesized from a free fatty acid, a CoA, or an
adenosine nucleotide triphosphate (ATP). An example of an enzyme
which produces acyl-CoA is acyl-CoA synthase
[0091] After the fatty acid is activated, it can be readily
transferred to a recipient nucleophile. Exemplary nucleophiles are
alcohols, thiols, or phosphates.
[0092] In one embodiment, the fatty ester is a wax. The wax can be
derived from a long chain alcohol and a long chain fatty acid. In
another embodiment, the fatty ester can be derived from a fatty
acyl-thioester and an alcohol. In another embodiment, the fatty
ester is a fatty acid thioester, for example fatty acyl Coenzyme A
(CoA). In other embodiments, the fatty ester is a fatty acyl
panthothenate, an acyl carrier protein (ACP), or a fatty phosphate
ester. Fatty esters have many uses. For example, fatty esters can
be used as biofuels, surfactants, or formulated into additives that
provide lubrication and other benefits to fuels and industrial
chemicals.
[0093] As used herein, "fraction of modern carbon" or "f.sub.M" has
the same meaning as defined by National Institute of Standards and
Technology (NIST) Standard Reference Materials (SRMs) 4990B and
4990C, known as oxalic acids standards HOxI and HOxII,
respectively. The fundamental definition relates to 0.95 times the
.sup.14C/.sup.12C isotope ratio HOxI (referenced to AD 1950). This
is roughly equivalent to decay-corrected pre-Industrial Revolution
wood. For the current living biosphere (e.g., plant material),
f.sub.M is approximately 1.1.
[0094] Calculations of "homology" between two sequences can be
performed as follows. The sequences are aligned for optimal
comparison purposes (e.g., gaps can be introduced in one or both of
a first and a second amino acid or nucleic acid sequence for
optimal alignment and non-homologous sequences can be disregarded
for comparison purposes). In a preferred embodiment, the length of
a reference sequence that is aligned for comparison purposes is at
least about 30%, preferably at least about 40%, more preferably at
least about 50%, even more preferably at least about 60%, and even
more preferably at least about 70%, at least about 80%, at least
about 90%, or about 100% of the length of the reference sequence.
The amino acid residues or nucleotides at corresponding amino acid
positions or nucleotide positions are then compared. When a
position in the first sequence is occupied by the same amino acid
residue or nucleotide as the corresponding position in the second
sequence, then the molecules are identical at that position (as
used herein, amino acid or nucleic acid "identity" is equivalent to
amino acid or nucleic acid "homology"). The percent identity
between the two sequences is a function of the number of identical
positions shared by the sequences, taking into account the number
of gaps and the length of each gap, which need to be introduced for
optimal alignment of the two sequences.
[0095] The comparison of sequences and determination of percent
homology between two sequences can be accomplished using a
mathematical algorithm. In a preferred embodiment, the percent
homology between two amino acid sequences is determined using the
Needleman and Wunsch (1970), J. Mol. Biol. 48:444 453, algorithm
that has been incorporated into the GAP program in the GCG software
package, using either a Blossum 62 matrix or a PAM250 matrix, and a
gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1,
2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent
homology between two nucleotide sequences is determined using the
GAP program in the GCG software package, using a NWSgapdna. CMP
matrix and a gap weight of about 40, 50, 60, 70, or 80 and a length
weight of about 1, 2, 3, 4, 5, or 6. A particularly preferred set
of parameters (and the one that should be used if the practitioner
is uncertain about which parameters should be applied to determine
if a molecule is within a homology limitation of the claims) are a
Blossum 62 scoring matrix with a gap penalty of 12, a gap extend
penalty of 4, and a frameshift gap penalty of 5.
[0096] Other methods for aligning sequences for comparison are well
known in the art. Various programs and alignment algorithms are
described in, for example, Smith & Waterman, Adv. Appl. Math.
2:482, 1981; Pearson & Lipman, Proc. Natl. Acad. Sci. USA
85:2444, 1988; Higgins & Sharp, Gene 73:237 244, 1988; Higgins
& Sharp, CABIOS 5:151-153, 1989; Corpet et al., Nucleic Acids
Research 16:10881-10890, 1988; Huang et al., CABIOS 8:155-165,
1992; and Pearson et al., Methods in Molecular Biology 24:307-331,
1994. and Altschul et al., J. Mol. Biol. 215:403-410, 1990.
[0097] As used herein, a "host cell" is a cell used to produce a
product described herein (e.g., an aldehyde or alkane). A host cell
can be modified to express or overexpress selected genes or to have
attenuated expression of selected genes. Non-limiting examples of
host cells include plant, animal, human, bacteria, cyanobacteria,
yeast, or filamentous fungi cells.
[0098] As used herein, the term "hybridizes under low stringency,
medium stringency, high stringency, or very high stringency
conditions" describes conditions for hybridization and washing.
Guidance for performing hybridization reactions can be found, for
example, in Current Protocols in Molecular Biology, John Wiley
& Sons, N.Y. (1989), 6.3.1-6.3.6. Aqueous and nonaqueous
methods are described in that reference and either method can be
used. Specific hybridization conditions referred to herein are as
follows: 1) low stringency hybridization conditions in 6.times.
sodium chloride/sodium citrate (SSC) at about 45.degree. C.,
followed by two washes in 0.2.times.SSC, 0.1% SDS at least at
50.degree. C. (the temperature of the washes can be increased to
55.degree. C. for low stringency conditions); 2) medium stringency
hybridization conditions in 6.times.SSC at about 45.degree. C.,
followed by one or more washes in 0.2.times.SSC, 0.1% SDS at
60.degree. C.; 3) high stringency hybridization conditions in
6.times.SSC at about 45.degree. C., followed by one or more washes
in 0.2..times.SSC, 0.1% SDS at 65.degree. C.; and preferably 4)
very high stringency hybridization conditions are 0.5M sodium
phosphate, 7% SDS at 65.degree. C., followed by one or more washes
at 0.2.times.SSC, 1% SDS at 65.degree. C. Very high stringency
conditions (4) are the preferred conditions unless otherwise
specified.
[0099] The term "isolated" as used herein with respect to nucleic
acids, such as DNA or RNA, refers to molecules separated from other
DNAs or RNAs, respectively, that are present in the natural source
of the nucleic acid. Moreover, an "isolated nucleic acid" includes
nucleic acid fragments, such as fragments that are not naturally
occurring. The term "isolated" is also used herein to refer to
polypeptides, which are isolated from other cellular proteins, and
encompasses both purified endogenous polypeptides and recombinant
polypeptides. The term "isolated" as used herein also refers to a
nucleic acid or polypeptide that is substantially free of cellular
material, viral material, or culture medium when produced by
recombinant DNA techniques. The term "isolated" as used herein also
refers to a nucleic acid or polypeptide that is substantially free
of chemical precursors or other chemicals when chemically
synthesized.
[0100] As used herein, the "level of expression of a gene in a
cell" refers to the level of mRNA, pre-mRNA nascent transcript(s),
transcript processing intermediates, mature mRNA(s), and/or
degradation products encoded by the gene in the cell.
[0101] As used herein, the term "microorganism" means prokaryotic
and eukaryotic microbial species from the domains Archaea, Bacteria
and Eucarya, the latter including yeast and filamentous fungi,
protozoa, algae, or higher Protista. The term "microbial cell", as
used herein, means a cell from a microorganism.
[0102] As used herein, the term "nucleic acid" refers to a
polynucleotide, such as deoxyribonucleic acid (DNA), and, where
appropriate, ribonucleic acid (RNA). The term also includes analogs
of either RNA or DNA made from nucleotide analogs, and, as
applicable to the embodiment being described, single (sense or
antisense) and double-stranded polynucleotides, ESTs, chromosomes,
cDNAs, mRNAs, and rRNAs. The term "nucleic acid" may be used
interchangeably with "polynucleotide," "DNA," "nucleic acid
molecule," "nucleotide sequence," and/or "gene" unless otherwise
indicated herein or otherwise clearly contradicted by context.
[0103] As used herein, the term "operably linked" means that a
selected nucleotide sequence (e.g., encoding a polypeptide
described herein) is in proximity with a promoter to allow the
promoter to regulate expression of the selected nucleotide
sequence. In addition, the promoter is located upstream of the
selected nucleotide sequence in terms of the direction of
transcription and translation. By "operably linked" is meant that a
nucleotide sequence and a regulatory sequence(s) are connected in
such a way as to permit gene expression when the appropriate
molecules (e.g., transcriptional activator proteins) are bound to
the regulatory sequence(s).
[0104] The term "or" is used herein to mean, and is used
interchangeably with, the term "and/or," unless context clearly
indicates otherwise.
[0105] As used herein, "overexpress" means to express or cause to
be expressed or produced a nucleic acid, polypeptide, or
hydrocarbon in a cell at a greater concentration than is normally
expressed in a corresponding wild-type cell. For example, a
polypeptide can be "overexpressed" in a recombinant host cell when
the polypeptide is present in a greater concentration in the
recombinant host cell compared to its concentration in a
non-recombinant host cell of the same species.
[0106] As used herein, "partition coefficient" or "P," is defined
as the equilibrium concentration of a compound in an organic phase
divided by the concentration at equilibrium in an aqueous phase
(e.g., fermentation broth). In one embodiment of a bi-phasic system
described herein, the organic phase is formed by the aldehyde or
alkane during the production process. However, in some examples, an
organic phase can be provided, such as by providing a layer of
octane, to facilitate product separation. When describing a two
phase system, the partition characteristics of a compound can be
described as logP. For example, a compound with a logP of 1 would
partition 10:1 to the organic phase. A compound with a logP of -1
would partition 1:10 to the organic phase. By choosing an
appropriate fermentation broth and organic phase, an organic fatty
acid derivative or product with a high logP value can separate into
the organic phase even at very low concentrations in the
fermentation vessel.
[0107] As used herein, the term "polypeptide" may be used
interchangeably with "protein," "peptide," and/or "enzyme" unless
otherwise indicated herein or otherwise clearly contradicted by
context.
[0108] As used herein, the term "production host" means a cell used
to produce the products disclosed herein. The production host is
modified to express, overexpress, attenuate or delete expression of
selected polynucleotides. Non-limiting examples of production hosts
include plant, algal, animal, human, bacteria, yeast, and
filamentous fungi cells.
[0109] As used herein, the term "purify," "purified," or
"purification" means the removal or isolation of a molecule from
its environment by, for example, isolation or separation.
"Substantially purified" molecules are at least about 60% free,
preferably at least about 75% free, and more preferably at least
about 90% free from other components with which they are
associated. As used herein, these terms also refer to the removal
of contaminants from a sample. For example, the removal of
contaminants can result in an increase in the percentage of a fatty
acid derivative or product in a sample. For example, when a fatty
acid derivatives or products are produced in a host cell, the fatty
acid derivatives or products can be purified by the removal of host
cell proteins. After purification, the percentage of fatty acid
derivatives or products in the sample is increased.
[0110] The terms "purify," "purified," and "purification" do not
require absolute purity. They are relative terms. Thus, for
example, when the fatty acid derivatives or products are produced
in host cells, a purified fatty acid derivative or product is one
that is substantially separated from other cellular components
(e.g., nucleic acids, polypeptides, lipids, carbohydrates, or other
fatty acid derivatives or products). In another example, a purified
fatty acid derivative or purified product preparation is one in
which the fatty acid derivative or product is substantially free
from contaminants, such as those that might be present following
fermentation. In some embodiments, a fatty acid derivative or
product is purified when at least about 50% by weight of a sample
is composed of the fatty acid derivative or product. In other
embodiments, a fatty acid derivative or product is purified when at
least about 60%, 70%, 80%, 85%, 90%, 92%, 95%, 98%, or 99% or more
by weight of a sample is composed of the fatty acid derivative or
product.
[0111] As used herein, the term "recombinant polypeptide" refers to
a polypeptide that is produced by recombinant DNA techniques,
wherein generally DNA encoding the expressed polypeptide or RNA is
inserted into a suitable expression vector and that is in turn used
to transform a host cell to produce the polypeptide or RNA.
[0112] As used herein, the term "substantially identical" (or
"substantially homologous") is used to refer to a first amino acid
or nucleotide sequence that contains a sufficient number of
identical or equivalent (e.g., with a similar side chain) amino
acid residues (e.g., conserved amino acid substitutions) or
nucleotides to a second amino acid or nucleotide sequence such that
the first and second amino acid or nucleotide sequences have
similar activities.
[0113] As used herein, the term "surfactants" means a substance
capable of reducing the surface tension of a liquid in which it is
dissolved. A surfactant is typically composed of a water-soluble
head and a hydrocarbon chain or tail. The water soluble head is
hydrophilic and can be either ionic or nonionic. The hydrocarbon
chain is hydrophobic. Surfactants are used in a variety of
products. For example, surfactants are used in the compositions or
manufacture of detergents, cleaners, textiles, leather, paper,
cosmetics, pharmaceuticals, processed foods, and agricultural
products. In addition, surfactants can be used in the extraction
and isolation of crude oils.
[0114] There are four major categories of surfactants which are
characterized by their uses. Anionic surfactants have
detergent-like activity and are generally used for cleaning
applications. Cationic surfactants contain long chain hydrocarbons
and are often used to treat proteins and synthetic polymers or are
components of fabric softeners and hair conditioners. Amphoteric
surfactants also contain long chain hydrocarbons, but are typically
used in shampoos. Non-ionic surfactants are generally used in
cleaning products.
[0115] As used herein, the term "synthase" means an enzyme which
catalyzes a synthesis process. As used herein, the term synthase
includes synthases, synthetases, and ligases.
[0116] As used herein, the term "transfection" means the
introduction of a nucleic acid (e.g., via an expression vector)
into a recipient cell by nucleic acid-mediated gene transfer.
[0117] As used herein, the term "transformation" refers to a
process in which a cell's genotype is changed as a result of the
cellular uptake of exogenous nucleic acid. This may result in the
transformed cell expressing a recombinant form of a RNA or
polypeptide. In the case of antisense expression from the
transferred gene, the expression of a naturally-occurring form of
the polypeptide is disrupted.
[0118] As used herein, the term "transport protein" means a
polypeptide that facilitates the movement of one or more compounds
in and/or out of a cellular organelle and/or a cell. A number of
these proteins, as well as other useful proteins for making the
products described herein, have been disclosed in, for example,
International Patent Application Nos. PCT/US2007/011923 and
PCT/US2008/058788, which are incorporated herein by reference.
[0119] As used herein, the term "unrefined, refined and re-refined
oils" refers to natural oil, synthetic oil, or a mixture thereof,
which may be used as a base oil in blending additive packages.
Unrefined oils are those obtained directly from a natural or
synthetic source without further purification treatment. Refined
oils are similar to the unrefined oils except that they have been
further treated in one or more purification steps. These
purification steps include, for example, solvent extraction,
secondary distillation, acid or base extraction, filtration,
percolation, or other methods well known in the art. Re-refined
oils are oils that have been used, but are subsequently treated so
that they may be reused. Re-refined oils are also known as
reclaimed or reprocessed oils.
[0120] As used herein, a "variant" of polypeptide X refers to a
polypeptide having the amino acid sequence of polypeptide X in
which one or more amino acid residues is altered. The variant may
have conservative changes or nonconservative changes. Guidance in
determining which amino acid residues may be substituted, inserted,
or deleted without affecting biological activity may be found using
computer programs well known in the art, for example, LASERGENE
software (DNASTAR).
[0121] The term "variant," when used in the context of a
polynucleotide sequence, may encompass a polynucleotide sequence
related to that of a gene or the coding sequence thereof. This
definition may also include, for example, "allelic," "splice,"
"species," or "polymorphic" variants. A splice variant may have
significant identity to a reference polynucleotide, but will
generally have a greater or fewer number of polynucleotides due to
alternative splicing of exons during mRNA processing. The
corresponding polypeptide may possess additional functional domains
or an absence of domains. Species variants are polynucleotide
sequences that vary from one species to another. The resulting
polypeptides generally will have significant amino acid identity
relative to each other. A polymorphic variant is a variation in the
polynucleotide sequence of a particular gene between individuals of
a given species.
[0122] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of useful vector is an episome (i.e., a
nucleic acid capable of extra-chromosomal replication). Useful
vectors are those capable of autonomous replication and/or
expression of nucleic acids to which they are linked. Vectors
capable of directing the expression of genes to which they are
operatively linked are referred to herein as "expression vectors".
In general, expression vectors of utility in recombinant DNA
techniques are often in the form of "plasmids," which refer
generally to circular double stranded DNA loops that, in their
vector form, are not bound to the chromosome. In the present
specification, "plasmid" and "vector" are used interchangeably, as
the plasmid is the most commonly used form of vector. However, also
included are such other forms of expression vectors that serve
equivalent functions and that become known in the art subsequently
hereto.
[0123] As used herein, the term "wax" means a composition comprised
of fatty esters. In a preferred embodiment, the fatty ester in the
wax is comprised of medium to long carbon chains. In addition to
fatty esters, a wax may comprise other components (e.g.,
hydrocarbons, sterol esters, aliphatic aldehydes, alcohols,
ketones, beta-diketones, triacylglycerols, etc.).
[0124] Throughout the specification, a reference may be made using
an abbreviated gene name or polypeptide name, but it is understood
that such an abbreviated gene or polypeptide name represents the
genus of genes or polypeptides. Such gene names include all genes
encoding the same polypeptide and homologous polypeptides having
the same physiological function. Polypeptide names include all
polypeptides that have the same activity (e.g., that catalyze the
same fundamental chemical reaction).
[0125] The accession numbers referenced herein are derived from the
NCBI database (National Center for Biotechnology Information)
maintained by the National Institute of Health, U.S.A. Unless
otherwise indicated, the accession numbers are as provided in the
database as of April 2009.
[0126] EC numbers are established by the Nomenclature Committee of
the International Union of Biochemistry and Molecular Biology
(NC-IUBMB) (available at http://www.chem.qmul.ac.uk/iubmb/enzyme/).
The EC numbers referenced herein are derived from the KEGG Ligand
database, maintained by the Kyoto Encyclopedia of Genes and
Genomics, sponsored in part by the University of Tokyo. Unless
otherwise indicated, the EC numbers are as provided in the database
as of April 2009.
[0127] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
[0128] Although methods and materials similar or equivalent to
those described herein can be used in the practice or testing of
the present invention, suitable methods and materials are described
below. All methods described herein can be performed in any
suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context.
[0129] Unless otherwise stated, amounts listed in percentage (%)
are in weight percent, based on the total weight of the
composition.
[0130] All publications, patent applications, patents, and other
references mentioned herein are incorporated by reference in their
entirety. In case of conflict, the present specification, including
definitions, will control. In addition, the materials, methods, and
examples are illustrative only and not intended to be limiting.
[0131] Recitation of ranges of values herein are merely intended to
serve as a shorthand method of referring individually to each
separate value falling within the range, unless otherwise indicated
herein, and each separate value is incorporated into the
specification as if it were individually recited herein.
[0132] The use of any and all examples, or exemplary language
(e.g., "such as") provided herein, is intended merely to better
illuminate the invention and does not pose a limitation on the
scope of the invention unless otherwise claimed. No language in the
specification should be construed as indicating any non-claimed
element as essential to the practice of the invention.
[0133] Other features and advantages of the invention will be
apparent from the following detailed description and from the
claims.
Genetically Modified Microorganism
[0134] The invention provides a recombinant cell comprising at
least one gene encoding a fatty acid derivative enzyme, which gene
is modified such that the gene is overexpressed. In one embodiment,
the modified gene encoding a fatty acid derivative enzyme is a gene
encoding an acyl-CoA synthase, a thioesterase, an ester synthase,
an alcohol acyltransferase, an alcohol dehydrogenase, an acyl-CoA
reductase, or a fatty-alcohol forming acyl-CoA reductase. For
example, the modified gene encoding a fatty acid derivative enzyme
can be a gene encoding an acyl-CoA synthase, a thioesterase, or an
ester synthase.
[0135] The acyl-CoA synthase gene can be fadD, fadK, BH3103, yhfL,
Pfl-4354, EAV15023, fadD1, fadD2, RPC.sub.--4074, fadDD35, fadDD22,
faa3p, or a gene encoding ZP.sub.--01644857. Preferably, the
acyl-CoA synthase gene is fadDD35 from M. tuberculosis HR7Rv
[NP.sub.--217021], yhfL from B. subtilis [NP.sub.--388908], fadD1
from P. aeruginosa PAO1 [NP.sub.--251989], a gene encoding
ZP.sub.--01644857 from Stenotrophomonas maltophilia R551-3, or
faa3p from Saccharomyces cerevisiae [NP.sub.--012257].
[0136] The thioesterase gene can be tesA, 'tesA, tesB, fatB, fatB2,
fatB3, fatB [M141T], fatA or fatA1.
[0137] The ester synthase gene can be obtained from a variety of
organisms including, without limitation, Acidobacteria,
Acidothermus, Acinetobacter, Aeromonas, Alcaligenes, Alcanivorax,
Alteromonas, Anaeromyxobacter, Arabidopsis, Bradyrhizobium,
Cryptococcus, Erythrobacter, Frankia, Fundibacter, gamma
proteobacterium, Hahella, Homo sapiens, Janibacter, Limnobacter,
marine gamma proteobacterium, Marinobacter, Methylibium,
Microscilla, Moritella, Mus musculus, Mycobacterium, Myxococcus,
Natronomonas, Nocardia, Nocardioides, Photobacterium, Plesiocystis,
Polaromonas, Psudomonas, Psychrobacter, Reinekea, Rhodococcus,
Rhodoferax, Roseiflexus, Saccharomyces, Saccharopolyspora,
Salinibacter, Simmodsia, Solibacter, Sphingopyxis, Stigmatella,
Streptomyces, Tenacibaculum, or Ustilago. Preferably, the ester
synthase gene is wax/dgat. The ester synthase gene also can be
obtained from Mortierella alpina, Cryptococcus curvatus,
Alcanivorax jadensis, Acinetobacter sp. HO1-N or Rhodococcus
opacus. For example, the ester synthase gene can be a bifunctional
ester synthase/acyl-CoA:diacylglycerol acyltransferase from
Simmondsia chinensis, Acinetobacter sp. strain ADP1, Alcanivorax
borkumensis, Pseudomonas aeruginosa, Fundibacter jadensis,
Arabidopsis thaliana, or Alkaligenes eutrophus.
[0138] In another embodiment, the cell comprises a second modified
fatty acid derivative enzyme gene, wherein the second gene encodes
an acyl-CoA synthase, a thioesterase, or an ester synthase. For
example, the cell can comprise a modified gene encoding an acyl-CoA
synthase and a modified gene encoding a thioesterase or an ester
synthase.
[0139] In another embodiment, the cell comprises a modified gene
encoding an acyl-CoA synthase, a modified gene encoding a
thioesterase, and a modified gene encoding an ester synthase. The
modified gene encoding an ester synthase can be a gene encoding a
wax synthase, a wax-ester synthase, an acyl-CoA:alcohol
transacylases, an alcohol O-fatty acid acyltransferase, an
acyltransferases, or a fatty acyl-coenzyme A:fatty alcohol
acyltransferase.
[0140] The invention also provides a recombinant cell capable of
producing esters, wherein the cell is modified to comprise at least
one exogenous nucleic acid sequence encoding a fatty acid
derivative enzyme. In one embodiment, the exogenous nucleic acid
sequence encoding a fatty acid derivative encodes an acyl-CoA
synthase, a thioesterase, an ester synthase, an alcohol
acyltransferase, an alcohol dehydrogenase, an acyl-CoA reductase,
or a fatty-alcohol forming acyl-CoA reductase.
[0141] In some embodiments, the cell is modified to comprise at
least two, at least three, or at least four exogenous nucleic acid
sequences encoding a fatty acid derivative enzyme. In one
embodiment, the cell is modified to comprise a first exogenous
nucleic acid sequences encoding an acyl-CoA synthase, e.g., fadD,
and a second exogenous nucleic acid sequence encoding a
thioesterase or an ester synthase.
[0142] In some embodiments, the cell is modified to include at
least three exogenous nucleic acid sequences encoding a fatty acid
derivative enzyme. For example, the cell can be modified to
comprise an acyl-CoA synthase, a thioesterase, and an ester
synthase.
[0143] The exogenous nucleic acid sequences can be from
Arthrobacter, Rhodotorula glutinins, Acinetobacter sp., Alcanivorax
borkumensis, E. coli, or Candida lipolytica. In one embodiment, the
exogenous nucleic acid sequence is stably incorporated into the
genome of the cell.
[0144] The invention also provides a recombinant cell capable of
producing esters. The recombinant cell can comprise an exogenous
nucleic acid sequence encoding a thioesterase, an exogenous nucleic
acid sequence encoding an acyl-CoA synthase, and an exogenous
nucleic acid sequence encoding an ester synthase.
[0145] In some embodiments, the cell optionally comprises a gene
encoding a fatty acid degradation enzyme, which gene is modified
such that expression of the gene is attenuated. The gene encoding a
fatty acid degradation enzyme can be obtained from any organism,
for example, from Saccharomyces cerevisiae, Candida lipolytica,
Escherichia coli, Arthrobacter, Rhodotorula glutinins,
Acinetobacter, Candida lipolytica, Botryococcus braunii, Vibrio
furnissii, Micrococcus leuteus, Stenotrophomonas maltophilia, or
Bacillus subtilis. For example, the gene encoding a fatty acid
degradation enzyme can be fadD.
[0146] In some embodiments, the cell optionally comprises a gene
encoding an outer membrane protein receptor, wherein the gene is
modified such that expression of the gene is attenuated. The
modified gene encoding an outer membrane protein receptor can be a
gene encoding an outer membrane protein receptor for ferrichrome,
colicin M, phage T1, phage T5, or phage phi80. The outer membrane
protein receptor gene can be obtained from any organism, for
example, from Saccharomyces cerevisiae, Candida lipolytica,
Escherichia coli, Arthrobacter, Rhodotorula glutinins,
Acinetobacter, Candida lipolytica, Botryococcus braunii, Vibrio
furnissii, Vibrio harveyi, Micrococcus leuteus, Stenotrophomonas
maltophilia, or Bacillus subtilis. For example, the gene encoding
the outer membrane protein receptor is fhuA (or tonA).
[0147] In some embodiments, the cell optionally comprises a gene
encoding a DNA-binding transcriptional repressor, wherein the gene
is modified such that expression of the gene is attenuated. The
DNA-binding transcriptional repressor gene can be obtained from any
organism, for example, Saccharomyces cerevisiae, Candida
lipolytica, Escherichia coli, Arthrobacter, Rhodotorula glutinins,
Acinetobacter, Candida lipolytica, Botryococcus braunii, Vibrio
furnissii, Micrococcus leuteus, Stenotrophomonas maltophilia, or
Bacillus subtilis. For example, the modified gene encoding a
DNA-binding transcriptional repressor is fabR.
[0148] For example, the cell can comprise a deletion in a gene
encoding a fatty acid degradation enzyme, an outer membrane
protein, and/or a DNA-binding transcriptional repressor. In one
embodiment, the cell comprises an attenuated gene encoding a fatty
acid degradation enzyme and an attenuated gene encoding an outer
membrane protein receptor.
[0149] The cell can be a Saccharomyces cerevisiae, Candida
lipolytica, Escherichia coli, Arthrobacter, Rhodotorula glutinins,
Acinetobacter, Candida lipolytica, Botryococcus braunii, Vibrio
furnissii, Micrococcus leuteus, Stenotrophomonas maltophilia or
Bacillus subtilis cell. Preferably the cell is an Arthrobacter AK
19, Acinetobacter sp. strain M-1, E. coli B, E. coli C, E. coli K
or E. coli W cell. The cell also can be a cyanobacterial cell, such
as a Synechocystis sp. PCC6803, a Synechococcus sp. PCC7002, or a
Synechococcus elongatus PCC7942 cell. The cell also can be a plant,
animal, or human cell. Preferred cells can be those selected from,
for example, Arabidopsis thaliana, Panicum virgatum, Miscanthus
giganteus, Zea mays, Botryococcus braunii, Chlamydomonas
reinhardtii, Dunaliela salina, Synchococcus sp.,
Thermosynechococcus elongatus, Chlorobium tepidium, Chloroflexus
aurauntieus, Chromatium tepidum, Chromatium vinosum, Rhodospirillum
rubrum, Rhodobacter capsulatus, and Rhodopseudomonas palusris. The
cell can, in addition, be a cell of a synthetic microorganism such
as, for example, synthetic cells produced by synthetic genomes as
described in, for example, U.S. Patent Publication Nos.:
2007/0264688, and 2007/0269862. In a further embodiment, the cell
can be from those microorganisms that can be engineered to fix
carbon dioxide, including, for example, E. coli, Acetobacter aceti,
Bacillus subtilis, yeast and fungi such as Clostridium ljungdahlii,
Clostridium thermocellum, Penicillium chrysogenum, Pichia pastoris,
Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pseudomonas
fluorescenes, or Zymomonas mobilis.
[0150] In one embodiment, the cell is a microorganism cell from a
cyanobacterium, bacterium, yeast, or filamentous fungi. For
example, the recombinant cell can be a genetically modified
microorganism. In some embodiments, the gene encoding a fatty acid
derivative enzyme is codon-optimized, or modified to be optimized
for expression in the recombinant cell.
[0151] In a further embodiment, the invention provides a
genetically engineered microorganism, which can be cultured under
appropriate conditions (e.g., in according to the culture and
fermentation conditions described herein) to produce fatty esters.
In certain embodiments, the microorganism comprising an exogenous
control sequence stably incorporated into the genomic DNA of the
microorganism upstream of one or more of at least one of a gene
encoding a thioesterase, a gene encoding an acyl-CoA synthase, and
a gene encoding an ester synthase, wherein the microorganism
produces an increased level of a fatty ester relative to a
wild-type microorganism. In certain embodiments, the exogenous
control sequence can be a promoter, for example, a
developmentally-regulated, organelle-specific, tissue-specific,
inducible, constitutive, or cell-specific promoter. In some
embodiments, the microorganism can be engineered such that it
expresses, relative to a wild type microorganism, a decreased level
of at least one of a gene encoding an acyl-CoA dehydrogenase, a
gene encoding an outer membrane protein receptor, and a gene
encoding a transcriptional regulator of fatty acid biosynthesis. In
certain embodiments, the gene encoding an acyl-CoA dehydrogenase is
fadE. In certain embodiments, the gene encoding an outer membrane
protein receptor is fhuA. In further embodiments, the gene encoding
a transcriptional regulator of fatty acid biosynthesis is fabR.
[0152] In some embodiments, the genetically engineered
microorganism is selected from a Gram-negative or a Gram-positive
bacterium. In alternative embodiments, the genetically engineered
microorganism is selected from an E. coli, mycrobacterium, Nocardia
sp., Nocardia farcinica, Streptomyces griseus, Salinispora
arenicola, Clavibacter michiganenesis, Acinetobacter, Alcanivorax,
Alcaligenes, Arabidopsis, Fundibacter, Marinobacter, Mus musculus,
Pseudomonas, or Simmodsia, Yarrowia, Candida, Rhodotorula,
Rhodosporidium, Cryptococcus, Trichosporon, or Lipomyces.
[0153] The invention also provides a method for producing fatty
esters in a recombinant cell. The method comprises (a) obtaining a
recombinant cell as described herein, (b) culturing the recombinant
cell under suitable conditions for expression, and (c) obtaining
fatty esters. The production and isolation of fatty esters can be
enhanced by employing specific fermentation techniques. For
example, a fermentation process was developed to produce a mix of
fatty acid methyl esters (FAME) for use as a biodiesel using the
recombinant cells described herein.
[0154] In another embodiment, the invention also features a method
of producing a fatty ester by culturing the genetically engineered
microorganism herein in the presence of a suitable alcohol
substrate and isolating the fatty ester.
[0155] A fermentation and recovery process that can be used to
produce biodiesel of commercial grade quality is described below.
The biodiesel produced by these methods satisfies the ASTM
standards and other engine performance standards, and meets the
environmental standards set by the EPA and other environmental
standard-setting agencies, as well as demonstrates, in a standard
diesel engine test, an improved emission profile as compared to a
diesel produced using the standard transesterifcation
processes.
Fermentation
[0156] The fermentation process can be optimized in lab scale
fermentors of 2 to 5 L of volume. The process can then be scaled up
in similar ways as those used in any other E. coli fermentation,
using methods well known to one of ordinary skill in the art.
[0157] For fermentation, E. coli cells can be grown in any suitable
medium. For example, the medium can comprise 1.5 g/L of
KH.sub.2PO.sub.4, 4.54 g/L of K.sub.2HPO.sub.4 trihydrate, 4 g/L of
(NH.sub.4).sub.2SO.sub.4, 0.15 g/L of MgSO.sub.4 heptahydrate, 20
g/L of glucose, 200 mM of Bis-Tris buffer (pH 7.2), 1.25, and 1.25
mL/L of a vitamin solution. The vitamin solution can comprise, for
example, 0.42 g/L of riboflavin, 5.4 g/L of pantothenic acid, 6 g/L
of niacin, 1.4 g/L of pyridoxine, 0.06 g/L of biotin, and 0.04 g/L
of folic acid.
[0158] An overnight starter culture of any volume (e.g., about 50
mL) can be used to inoculate a larger culture of the same medium,
wherein the medium optionally has a reduced glucose concentration
(e.g., 5 g/L of glucose) than, for example, the medium described
above, in a fermentor with temperature, pH, agitation, aeration and
dissolved oxygen controls. The preferred conditions in the
fermentor are set at about 32.degree. C., about pH 6.8, and a
dissolved oxygen (DO) level of about 30% of saturation. The pH can
be maintained by the addition of NH.sub.4OH, which also serves as a
nitrogen source for cell growth. When the initial glucose is almost
consumed, a feed consisting of, for example, 60% glucose, 3.9 g/L
MgSO.sub.4 heptahydrate and 10 mL/L of the trace minerals solution
is supplied to the fermentor. The trace metals solution can
comprise, for example, 27 g/L of FeCl.sub.3.6H.sub.2O, 2 g/L of
ZnCl.sub.2.4H.sub.2O, 2 g/L of CaCl.sub.2.6H.sub.2O, 2 g/L of
Na.sub.2MoO.sub.4.2H.sub.2O, 1.9 g/L of CuSO.sub.4.5H.sub.2O, 0.5
g/L of H.sub.3BO.sub.3, and 100 mL/L of concentrated HCl. The feed
rate should be set up to match the cells growth rate and avoid
accumulation of glucose in the fermentor. By avoiding glucose
accumulation, it is possible to reduce or eliminate the formation
of by-products such as, for example, acetate, formate and ethanol,
which are otherwise typically produced by E. coli. In the early
phases of the growth, the production of FAME can be induced by the
addition of 1 mM IPTG and 20 mL/L of pure methanol. The
fermentation can be continued for a period of about 3 days.
Methanol can be added several times during the run to replenish the
methanol consumed by the cells for the production of FAME and/or
lost by evaporation in the off-gas. The additions should be
targeted to maintain the concentration of methanol in the
fermentation broth at between about 10 and about 30 mL/L, which
serves to insure a good balance between efficient production and
avoidance of cell grown inhibition.
[0159] The progression of fermentation can be followed by measuring
OD.sub.600 (optical density at 600 nm), glucose consumption, and/or
ester production.
[0160] The fermentation protocol can be scaled up to a larger
fermentor (e.g., to a size of about 700 L), which allows the
generation of enough biodiesel for quality testing. Analytical
methods that can be utilized to continuously monitor the
fermentation process, and an exemplary set of suitable methods are
described below.
Analysis
[0161] Glucose consumption can be analyzed throughout the
fermentation process by High Pressure Liquid Chromatography (HPLC).
The HPLC analysis can be performed according to methods commonly
used in the art for various sugars and organic acids. In an
exemplary embodiment, the HPLC conditions can be as follows: [0162]
a. Instrument: Agilent HPLC 1200 Series with Refractive Index
detector; [0163] b. Column: Aminex HPX-87H, 300 mm.times.7.8 mm;
[0164] c. Column temperature: 350.degree. C.; [0165] d. Mobile
phase: 0.01M H.sub.2SO.sub.4 (aqueous); [0166] e. Flow rate: 0.6
mL/min; [0167] f. Injection volume: 20 .mu.L.
[0168] The production of fatty acid methyl and ethyl esters can be
monitored and/or analyzed by gas chromatography with a flame
ionization detector (GC-FID). The samples from fermentation broth
can be extracted with ethyl acetate in a ratio of 1:1 vol/vol.
After vigorous vortexing, the samples can be centrifuged and the
organic phase can be analyzed by gas chromatography (GC). An
exemplary set of analysis conditions are listed below: [0169] a.
Instrument: Trace GC Ultra, Thermo Electron Corporation with Flame
ionization detector (FID) detector; [0170] b. Column: DB-1 (1%
diphenyl siloxane; 99% dimethyl siloxane) CO1 UFM 1/0.1/5 01 DET
from Thermo Electron Corporation, phase pH 5, FT: 0.4 .mu.m, length
5 m, id: 0.1 mm; [0171] c. Inlet conditions: 250.degree. C.
splitless, 3.8 min 1/25 split method used depending upon sample
concentration with split flow of 75 mL/min; [0172] d. Carrier gas
& flow rate: Helium, 3.0 mL/min; [0173] e. Block temperature:
330.degree. C.; [0174] f. Oven temperature: 0.5 minute hold at
50.degree. C.; 100.degree. C/minute to 330.degree. C.; 0.5 minute
hold at 330.degree. C.; [0175] g. Detector temperature: 300.degree.
C.; [0176] h. Injection volume: 2 .mu.L; run time/flow rate: 6.3
min/3.0 mL/min (in a splitless method), 3.8 min/1.5 mL/min (in a
split 1/25 method), 3.04 min/1.2 mL/min (in a split 1/50
method).
Recovery
[0177] Following fermentation, the broth can be centrifuged to
separate the lighter phase containing methyl esters from the
heavier phase containing water, salts and the bulk of the microbial
biomass. The lighter phase can be centrifuged again to recover the
biodiesel. It is also possible to obtain clear biodiesel in a
single-step centrifugation and without any pretreatment.
[0178] Centrifugation can be performed using any suitable
centrifuge. For example, centrifugation can be performed in
disk-stacked continuous centrifuges of pilot scale capacity, (with,
for example, a fixed centrifugal force of .about.10,000 g), with
flows from about 1 to about 5 L per min. Normal adjustments to
centrifugation configurations and conditions (including, for
example, to gravity ring sizes, back pressure in outlets, flow,
etc.) which are well known to one of ordinary skill in the art, can
be performed, such that the most favorable separation in terms of
recovery efficiency and cleanness of the product is achieved.
[0179] The fermentation broth can be directly centrifuged without
any physical or chemical adjustments beforehand. Alternatively,
suitable pretreatments can be applied to the light phase to help
with the separation during the second centrifugation step. These
pretreatments can, in one exemplary embodiment, include the
following steps but not necessarily in the listed order: [0180] a.
heating to about 60 to about 80.degree. C.; [0181] b. adjusting the
pH to 2.0 to 2.5 using sulfuric acid; and [0182] c. addition of
suitable demulsifiers (for example, ARB-8285 (Baker Hughes,
Houston, Tex.)) to less than 1% of the emulsion/light phase volume.
In a further example, the temperature of step a. can be held for 1
to 2 hrs before the second centrifugation.
[0183] FAME produced from the fermentation broth can be separated
by decanting, filtration, or other separation methods known to
those of ordinary skill in the art.
Polishing
[0184] The biodiesel obtained from the harvesting step described
above has characteristics similar to the commercial standards and
environmental benchmarks for biodiesels. The inherent properties of
this biodiesel, as well as other purity-related parameters
typically would meet the commercial and environmental standards for
biodiesel. Those properties include, for example, cetane number,
kinematic viscosity, flash point, oxidation stability, copper
corrosion, free and total glycerin, methanol, phosphorous, sulfate,
K.sup.+ and Na.sup.+ content, trace element content, and emissions
profile. Therefore, few if any purification steps for the
elimination of other impurities are required. Optional purification
steps include, for example, lime washing or acid methylation to
eliminate residual free fatty acids, dilute acid washing to remove
excess calcium, tangential filtration, washing with water, drying
to remove remaining free acids added during methylation or acid
washing steps, and using suitable resins to remove of other minor
impurities by absorption/adsorption. Not all the optional
purification steps are necessary to purify the biodiesel produced
every time, and whether one or more of the optional steps are used
depends on the characteristics of the product at the end of the
fermentation process.
[0185] Small quantities of free fatty acids may be produced during
fermentation, and they are separated from the biodiesel along with
the esters. The ASTM standards mandate that a biodiesel have a low
acid number, as measured by a standard testing method ASTM D 664.
Thus, if the free fatty acids level in the FAME after the
centrifugation step is, as it typically may be, about 1 to about
2%, one or more of the optional purification steps described above
may need to be applied. Standards are also stringent for the
calcium and magnesium contents. Although neither calcium nor
magnesium is present in the fermentation product, they can be
introduced into the product mixture during the lime wash, making it
necessary to perform the dilute acid wash step. In the same manner,
excess free acids (e.g., sulfuric, phosphoric, and/or lactic acids)
may be introduced to the product mixture during the acid wash or as
a catalyst when acid methylation is used as a means to reduce the
level of free fatty acids, and they need to be removed from the
product mixture by further washing with water. A final treatment
with absorbent/adsorbent resins, such as Magnesol.TM. (The Dallas
Group, Whitehouse, N.J.), Amberlist.TM. BD20 (Dow Chemicals,
Philadelphia, Pa.), Biosil.TM. (Polymer Technology Group, Berkeley,
Calif.), or other similar adsorbent/absorption resins, assures
elimination of water, methanol, sulfur or other small impurities
yet present. Some of the common impurities can also be reduced by
modifications made to the fermentation process.
Fatty Esters
[0186] The invention provides a composition produced by a
recombinant cell as described herein, wherein the composition
comprises fatty esters produced from the recombinant cell.
[0187] As described herein, production hosts can be engineered
using known peptides to produce fatty esters from acyl-CoA and
alcohols. One of ordinary skill in the art will appreciate that
structurally, fatty esters have an A side and a B side (or an A
group and a B group, respectively). In some embodiments, the fatty
esters comprise, consist essentially of, or consist of the
following formula: BCOOA.
[0188] B is an aliphatic group. In some embodiments, B is a carbon
chain. In some embodiments, B comprises a carbon chain that is at
least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 carbons in length. A
comprises at least one carbon atom. In some embodiments, A is an
aliphatic group. In some embodiments, A is an alkyl group. In some
embodiments, the alkyl group comprises, consists essentially of, or
consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, or 20 carbon atoms. In some embodiments, any of the
above B groups can be combined with any of the above A groups. In
some embodiments, A comprises, consists essentially of, or consists
of a carbon chain having a number of carbons selected from the
group consisting of 1, 2, 3, 4, and 5 carbon atoms, while B
comprises, consists essentially of, or consists of at least 12, 13,
14, 15, 16, 17, 18, 19, or 20 carbon atoms.
[0189] In some embodiments, the fatty esters comprise a plurality
of individual fatty esters. In some embodiments, the methods
described herein permit production of a plurality of fatty esters
of varied length. In some embodiments, the fatty ester product
comprises saturated or unsaturated fatty esters product(s) having a
carbon atom content limited to between 5 and 25 carbon atoms. In
other words, the invention provides a composition comprising
C.sub.5-C.sub.25 fatty esters (e.g., C.sub.10-C.sub.20 fatty
esters, or C.sub.12-C.sub.18 fatty esters).
[0190] In some embodiments, the fatty esters comprise one or more
fatty esters having a double bond at one or more points in the
carbon chain. Thus, in some embodiments, a 6-, 7-, 8-, 9-, 10-,
11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-, 21-, 22-, 23-,
24-, 25-, 26-, 27-, 28-, 29-, or 30-carbon chain can have 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, or 24 double bonds, and 1-24 of the aforesaid double bonds
can be located following carbon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
or 29. In some embodiments, a 1-, 2-, 3-, 4-, or 5-carbon chain for
A can have 1, 2, 3, or 4 double bonds and 1-4 of the double bonds
can be located following carbon 1, 2, 3, or 4. In some embodiments,
any of the above A groups can be combined with any of the above B
groups.
[0191] In certain preferred embodiments, the B group can have 12,
13, 14, 15, 16, 17, 18 carbon atoms in a chain. In other
embodiments, the A group can have one or two carbon atoms.
[0192] In some preferred embodiments, the B group can have one
double bond at one or more points in the carbon chain. In more
preferred embodiments, the B group can have one double bond at
position 7 of the carbon chain, numbering from the reduced end of
the carbon chain. One of ordinary skill in the art will recognize
that one end of the B group will have a methyl group, and the other
end of the B group will have a carboxyl group (C(.dbd.O)O--). The
end of the B group which is a methyl group is the reduced end of
the carbon chain comprising the B group, thus, the double bond is
at carbon 7 counting from the methyl group terminus of the B group
(e.g., at between carbons 7 and 8 of the B group). The double bond
can have any geometry, thus, the double bond in the B group can be
cis or trans.
[0193] In some embodiments, the fatty esters comprise straight
chain fatty esters. In some embodiments, the fatty esters comprise
branched chain fatty esters. In some embodiments, the fatty esters
comprise cyclic moieties.
[0194] In certain preferred embodiments, the fatty esters can be
selected from the group consisting of methyl dodecanoate, methyl
5-dodecenoate, methyl tetradecanoate, methyl 7-tetradecenoate,
methyl hexadecanoate, methyl 9-hexadecenoate, methyl octadecanoate,
methyl 11-octadecenoate, and combinations thereof.
[0195] In some embodiments, the fatty ester composition comprises
about 5 wt. % or more methyl dedecanoate. In some embodiments, the
fatty ester composition comprises about 25% or more methyl
dedecanoate. In some embodiments, the fatty ester composition
comprises about 5 wt. % to about 25 wt. % methyl dodecanoate.
[0196] In some embodiments, the fatty ester composition comprises
about 10 wt. % or less methyl dodec-7-enoate. In some embodiments,
the fatty ester composition comprises about 0 wt. % to about 10 wt.
% methyl dodec-7-enoate.
[0197] In some embodiments, the fatty ester composition comprises
about 30 wt. % or more methyl tetradecanoate. In some embodiments,
the fatty ester composition comprises about 50 wt. % or less methyl
tetradecanoate. In some embodiments, the fatty ester composition
comprises about 30 wt. % to about 50 wt. % methyl
tetradecanoate.
[0198] In some embodiments, the fatty ester composition comprises
about 10 wt. % or less methyl tetradec-7-enoate. In some
embodiments, the fatty ester composition comprises about 0 wt. % to
about 10 wt. % methyl tetradec-7-enoate.
[0199] In some embodiments, the fatty ester composition comprises
about 15 wt. % or less methyl hexadecanoate. In some embodiments,
the fatty ester composition comprises about 0 wt. % to about 15 wt.
% methyl hexadecanoate.
[0200] In some embodiments, the fatty ester composition comprises
about 10 wt. % or more methyl hexadec-7-enoate. In some
embodiments, the fatty ester composition comprises about 40 wt. %
or less methyl hexadec-7-enoate. In some embodiments, the fatty
ester composition comprises about 10 wt. % to about 40 wt. % methyl
hexadec-7-enoate.
[0201] In some embodiments, the fatty ester composition comprises
about 15 wt. % or less methyl octadec-7-enoate. In some
embodiments, the fatty ester composition comprises about 0 wt. % to
about 15 wt. % methyl octadec-7-enoate.
Carbon Chain Characteristics
[0202] In some embodiments, the hydrocarbons, fatty alcohols, fatty
esters, and waxes disclosed herein are useful as biofuels and
specialty chemicals. The products can be produced such that they
contain desired branch points, levels of saturation, and carbon
chain lengths. Therefore, these products can be desirable starting
materials for use in many applications. One of ordinary skill in
the art will appreciate that some of the genes that are used to
alter the structure of the fatty acid derivative can also increase
the production of fatty acid derivatives.
[0203] Furthermore, biologically produced fatty esters represent a
new feedstock for fuels, such as alcohols, diesel and gasoline.
Fatty esters have not been produced from renewable sources and, as
such, are new compositions of matter. These new fatty esters and
fuels can be distinguished from fatty esters and fuels derived from
petrochemical carbon on the basis of dual carbon-isotopic
fingerprinting. Additionally, the specific source of biosourced
carbon (e.g., glucose vs. glycerol) can be determined by dual
carbon-isotopic fingerprinting (see, U.S. Pat. No. 7,169,588, which
is herein incorporated by reference). The following discussion
generally outlines two options for distinguishing
chemically-identical materials (that have the same structure, but
different isotopes). In some embodiments, this apportions carbon in
products by source (and possibly year) of growth of the biospheric
(plant) component.
[0204] The isotopes, .sup.14C and .sup.13C, bring complementary
information to this examination. The radiocarbon dating isotope
(.sup.14C), with its nuclear half life of 5730 years, clearly
allows one to apportion specimen carbon between fossil ("dead") and
biospheric ("alive") feedstocks (see, e.g., Currie, L. A. "Source
Apportionment of Atmospheric Particles," Characterization of
Environmental Particles, J. Buffle and H. P. van Leeuwen, Eds., 1
of Vol. I of the IUPAC Environmental Analytical Chemistry Series
(Lewis Publishers, Inc) (1992) 3, 74). The basic understanding in
radiocarbon dating is that the constancy of .sup.14C concentration
in the atmosphere leads to the constancy of .sup.14C in living
organisms. When dealing with an isolated sample, the age of a
sample can be deduced approximately by the relationship
t=(-5730/0.693)ln(A/A.sub.0) (Equation 1) where t=age, 5730 years
is the half-life of radiocarbon, and A and A.sub.0 are the specific
.sup.14C activity of the sample and of the modern standard,
respectively (see, e.g., Hsieh, Y., Soil Sci. Soc. Am J., 56, 460,
(1992)). However, because of atmospheric nuclear testing since 1950
and the burning of fossil fuel since 1850, .sup.14C has acquired a
second, geochemical time characteristic. Its concentration in
atmospheric CO.sub.2, and hence in the living biosphere,
approximately doubled at the peak of nuclear testing, in the
mid-1960s. It has since been gradually returning to the
steady-state cosmogenic (atmospheric) baseline isotope rate
(.sup.14C/.sup.12C) of ca. 1.2.times.10.sup.12 with an approximate
relaxation "half-life" of 7-10 years. The latter half-life cannot
be taken literally; rather, one should use the detailed atmospheric
nuclear input/decay function to trace the variation of atmospheric
and biospheric .sup.14C since the onset of the nuclear age. It is
this latter biospheric .sup.14C time characteristic that holds out
the promise of annual dating of recent biospheric carbon. .sup.14C
can be measured by accelerator mass spectrometry (AMS) with results
given in units of "fraction of modem carbon" (f ). f is defined by
National Institute of Standards and Technology (NIST) Standard
Reference Materials (SRMs) 4990B and 4990C, known as oxalic acids
standards HOxI and HOxII, respectively. The fundamental definition
relates to 0.95 times the .sup.14C/.sup.12C isotope ratio HOxI
(referenced to AD 1950). This is roughly equivalent to
decay-corrected pre-Industrial Revolution wood. For the current
living biosphere (plant material), IM is approximately 1.1. The
stable carbon isotope ratio (.sup.13C/.sup.12C) provides a
complementary route to source discrimination and apportionment. The
.sup.13C/.sup.2C ratio in a given biosourced material is a
consequence of the .sup.13C/.sup.12C ratio in atmospheric carbon
dioxide at the time the carbon dioxide is fixed and also reflects
the precise metabolic pathway. Regional variations also occur.
Petroleum, C3 plants (the broadleaf), C4 plants (the grasses), and
marine carbonates all show significant differences in
.sup.13C/.sup.12C and their corresponding delta.sup.13C values.
Furthermore, lipid matter of C3 and C4 plants analyze differently
than materials derived from the carbohydrate components of the same
plants as a consequence of the metabolic pathway. Within the
precision of measurement, .sup.13C shows large variations due to
isotopic fractionation effects, the most significant of which for
the instant invention is the photosynthetic mechanism. The major
cause of differences in the carbon isotope ratio in plants is
closely associated with differences in the pathway of
photosynthetic carbon metabolism in the plants, particularly the
reaction occurring during the primary carboxylation (i.e., the
initial fixation of atmospheric CO.sub.2). Two large classes of
vegetation are those that incorporate the "C3" (or Calvin-Benson)
photosynthetic cycle and those that incorporate the "C4" (or
Hatch-Slack) photosynthetic cycle. C3 plants, such as hardwoods and
conifers, are dominant in the temperate climate zones. In C3
plants, the primary CO.sub.2 fixation or carboxylation reaction
involves the enzyme ribulose-1,5-diphosphate carboxylase and the
first stable product is a 3-carbon compound. C4 plants, on the
other hand, include such plants as tropical grasses, corn and sugar
cane. In C4 plants, an additional carboxylation reaction involving
another enzyme, phosphoenol-pyruvate carboxylase, is the primary
carboxylation reaction. The first stable carbon compound is a
4-carbon acid which is subsequently decarboxylated. The CO.sub.2
thus released is refixed by the C3 cycle.
[0205] Both C4 and C3 plants exhibit a range of .sup.13C/.sup.12C
isotopic ratios, but typical values are about -10 to -14 per mil
(C4) and -21 to -26 per mil (C3) (Weber et al., J. Agric. Food
Chem., 45, 2942 (1997)). Coal and petroleum fall generally in this
latter range. The .sup.13C measurement scale was originally defined
by a zero set by pee dee belemnite (PDB) limestone, where values
were given in parts per thousand deviations from this material. The
".delta..sup.13", values are in parts per thousand (per mil),
abbreviated % o, and are calculated as follows:
.delta..sup.13C=[(.sup.13C/.sup.12C)sample-(.sup.13C/.sup.12C)standard]/-
(.sup.13C/.sup.12C)standard.times.1000
[0206] Since the PDB reference material (RM) has been exhausted, a
series of alternative RMs have been developed in cooperation with
the IAEA, USGS, NIST, and other selected international isotope
laboratories. Notations for the per mil deviations from PDB is
S.sup.1. Measurements are made on CO.sub.2 by high precision stable
ratio mass spectrometry (IRMS) on molecular ions of masses 44, 45,
and 46.
[0207] In some embodiments, the inventive fatty esters have a
.delta..sup.13 of about -10.9 to about -15.4. In certain other
embodiments, the inventive fatty esters have a .delta..sup.13 of
-27 to about -24. In yet further embodiments, the inventive fatty
esters have a .delta..sup.13 of about -10. In some embodiments, the
fatty esters have a .delta..sup.13 of about -28 or greater. (e.g.,
about -18).
[0208] The fatty esters and the associated biofuels, chemicals, and
mixtures can be distinguished from their petrochemical derived
counterparts on the basis of .sup.14C (fM) and dual carbon-isotopic
fingerprinting, indicating new compositions of matter.
[0209] In some embodiments, the fatty esters described herein have
utility in the production of biofuels and chemicals. The new fatty
ester based product compositions provided herein additionally can
be distinguished on the basis of dual carbon-isotopic
fingerprinting from those materials derived solely from
petrochemical sources. The ability to distinguish these products is
beneficial in tracking these materials in commerce. For example,
fuels or chemicals comprising both "new" and "old" carbon isotope
profiles can be distinguished from fuels and chemicals made only of
"old" materials. Hence, the instant materials can be followed in
commerce on the basis of their unique profile.
[0210] In some examples, a biofuel composition is made, which
includes a fatty ester having .delta..sup.13 of from about -10.9 to
about -15.4, wherein the fatty ester accounts for at least about
85% by volume of biosourced material (derived from a renewable
resource such as cellulosic materials and sugars) in the
composition. In some embodiments, the fatty ester is additionally
characterized as having a .delta..sup.13 of from about -10.9 to
about -15.4; and the fatty ester accounts for at least about 85% by
volume of biosourced material in the composition. In some
embodiments, the fatty ester in the biofuel composition is
characterized by having a fraction of modern carbon (fM .sup.14C)
of at least about 1, about 1.003, about 1.010, or about 1.5. In
some embodiments, the fatty ester in the biofuel composition is
characterized by having a fraction of modern carbon (fM .sup.14C)
is about 1 to about 1.5 (e.g., about 1.04 to about 1.18, or about
1.111 to about 1.124).
Post Production Processing
[0211] The fatty esters produced during production can be separated
from the production media. Any technique known for separating fatty
esters from aqueous media can be used. One exemplary separation
process provided herein is a two-phase separation process. This
process involves processing the genetically engineered production
hosts under conditions sufficient to produce a fatty ester (e.g., a
fatty ester), allowing the derivative to collect in an organic
phase, and separating the organic phase from the aqueous production
broth. This method can be practiced in both a batch and continuous
production setting.
[0212] The fatty esters produced by the methods described herein
will be relatively immiscible in the production broth, as well as
in the cytoplasm. Therefore, the fatty esters will collect in an
organic phase either intracellularly or extracellularly.
[0213] After completion of the fermentation, the fermentation broth
can be centrifuged to separate the lighter phase containing the
fatty esters from the heavier phase consisting of water, salts, and
the bulk of the microbial biomass. While a single centrifugation
step may provide fatty esters suitable for use as a fuel, in some
cases a second centrifugation step is carried out to provide a more
complete separation of the fatty esters.
[0214] The centrifugation can be carried out using any suitable
centrifugation apparatus, many of which are well known in the art.
An example of a suitable centrifugation apparatus is a disk-stacked
continuous centrifuge having pilot scale capacity, such as the
Westfalia.TM. SA1 (GEA Westfalia Separator, Inc., Northvale, N.J.)
or the Alfa-Laval.TM. LAPX 404 (Alfa Laval AB, Lund, Sweden)
centrifuges. Centrifugation can be performed at, for example,
centrifugal force of 10,000 g and a flow rate of from about 1 to
about 5 L/min
[0215] In some cases, depending on the fermentation
characteristics, it may be necessary to provide pretreatments in
order to facilitate breaking of an emulsion. An example of a
suitable pretreatment includes heating the fermentation broth
(e.g., to 60-80.degree. C.), adjusting the pH to 2.0-2.5 with
sulfuric acid, and addition of demulsifiers such as
phenol-formaldehyde resins, polyamines, polyols, and the like, and
then holding the mixture at elevated temperature for 1-2 hrs before
centrifugation.
[0216] In some instances, the fatty esters contain as impurities
free fatty acids. Removal of free fatty acids from the fatty esters
can be accomplished using any suitable method, including lime
washing or acid-catalyzed esterification (e.g., methylation). Lime
washing can be conducted by heating a mixture comprising fatty
esters and free fatty acids and then contacting the mixture with an
aqueous slurry of lime (i.e., calcium hydroxide and/or calcium
carbonate), followed by centrifugation to separate the purified
fatty esters.
[0217] Lime washing can introduce undesirable levels of calcium
and/or magnesium ions into the fatty esters. The calcium and/or
magnesium ions can be removed from the fatty esters by first
washing the fatty esters with dilute acid, such as sulfuric acid,
followed by a final water wash. The fatty esters can be separated
from the aqueous washes in both steps by centrifugation.
[0218] Acid-catalyzed esterification can be conducted by addition
of an alcohol, such as methanol or ethanol, and an acid catalyst,
such as sulfuric acid, phosphoric acid, or lactic acid, to the
fatty esters, followed by heating of the resulting mixture in order
to esterify any free fatty acids present in the fatty esters.
Following acid-catalyzed esterification of free fatty acids, the
fatty esters can be washed with water as described herein.
[0219] A final treatment of the fatty esters with
absorbent/adsorbent resins such as Magnesol.TM. (The Dallas Group,
Inc., Whitehouse, N.J.) or Amberlyst.TM. BD20 (Dow Chemicals,
Philadelphia, Pa.), Biosil.TM. (Polymer Technology Group, Berkeley,
Calif.), and other similar adsorbent/absorption resins can be
performed to reduce or eliminate trace amounts of water, methanol,
sulfur, or impurities yet present in the fatty esters.
[0220] In some embodiments, the fatty ester composition can be
further processed to remove fine solids that might affect fuel
injectors or prefilters in engines. In some embodiments, the fatty
ester composition can also be processed to remove species that have
poor volatility and that could lead to deposit formation in
engines. In some embodiments, traces of sulfur compounds that may
be present can be removed. Examples of suitable treatments include
washing, adsorption, distillation, filtration, centrifugation,
settling, and coalescence.
[0221] In other embodiments, the fatty esters can be subjected to
lime washing followed by cross flow filtration, also referred to as
tangential flow filtration, in place of centrifugation. In these
embodiments, a mixture of fatty esters can be treated with an
aqueous lime slurry and then pumped through the lumen of a
cylindrical ceramic membrane. The fatty esters that permeate the
ceramic membrane are collected as the product.
[0222] Accordingly, in certain embodiments, the present invention
also pertains to A method of producing the fatty ester compositions
of the invention, comprising: (a) culturing the microorganism under
conditions sufficient to allow expression; and (b) obtaining the
fatty esters. In certain embodiments, the obtaining the fatty
esters comprises one or more polishings. In certain embodiments,
the one or more polishings comprise one or more of the following
steps: (a) a lime wash, (b) an acid methylation, (c) a dilute acid
wash, (d) a tangential filtration, (e) a water wash, (f) a final
drying, and (g) an adsorption or adsorption with suitable resins.
In certain embodiments, the obtaining the fatty esters comprises
one or more separations. For example, the one or more separations
comprise one or more of the following steps: (a) centrifugations,
(b) decantations, (c) distillations, and (d) filtrations. In
further embodiments, the obtaining the fatty esters comprise one or
more pretreatments. For example, the one or more pretreatments
comprise one or more acid pretreatments. In another example, the
one or more pretreatments comprise one or more heat
pretreatments.
Biodiesel Fuel Performance Standards
[0223] The American Society for Testing and Materials ("ASTM") has
published a standard specification for biodiesel (B 100) Grades S15
and S500 for use as a blend component for middle distillate fuels,
with the specification designated as D 6751. The amount of
biodiesel present in any fuel mix is designated using a "B" factor.
For example, 100% biodiesel is labeled B 100. A fuel mixture
containing 20% biodiesel is labeled B20. The D 6751 specification
provides upper limits or ranges for minor components found in
biodiesels such as sulfur, phosphorous, calcium and magnesium,
sodium and potassium, and carbon residue, as well as specifications
for distillation temperature, cetane number, and viscosity. The
ASTM D 6751 biodiesel standard must be met in order for a biodiesel
to be suitable for use as an engine fuel in the United States.
[0224] Similar to the United States, other countries and regions of
the world, including, for example, the European Union, also publish
standard specifications for biodiesel used in their jurisdictions.
Specifically, the European Union's biodiesel standards closely
track the ASTM D 6751 standards.
[0225] For example, the Brazilian Agencia Nacional do Petroleo, Gas
Natural e Biocombustiveis ("ANP") has published ANP 7 which
describes the specifications for biodiesel to be used in Brazil.
The ANP 7 specification provides upper limits or ranges for minor
components found in biodiesels such as micro carbon residue,
sulfated ash, glycerin, sodium, potassium, calcium and magnesium,
phosphorus, methanol, iodine, and sulfur. In addition, ANP 7
provides specifications for biodiesel characteristics, such as acid
number, oxidation stability, ester content, ignition delay, density
of liquids at 20.degree. C., viscosity, flash point, corrosion, and
cold filter plugging. The ANP biodiesel standard must be met in
order for a biodiesel to be suitable for use as an engine fuel in
Brazil. The cetane number is one of the most commonly cited
indicators of diesel fuel quality. The cetane number measures the
readiness of the fuel to autoignite when injected into a diesel
engine. Unlike a gasoline engine, a diesel engine operates without
the use of spark ignition of the fuel/air mixture. Generally, the
cetane number is dependent on the composition of the fuel and can
impact engine startability, noise level, and exhaust emissions. A
commonly used test procedure for determination of cetane number is
designated as ASTM D 613.
[0226] The fatty ester produced as described herein desirably
contain low levels of impurities.
[0227] In some embodiments, the fatty ester produced as described
herein contain less than or equal to about 10 mg/kg (e.g., less
than or equal to about 10 mg/kg, less than or equal to about 9
mg/kg, less than or equal to about 8 mg/kg, less than or equal to
about 7 mg/kg, less than or equal to about 6 mg/kg, less than or
equal to about 5 mg/kg, less than or equal to about 4 mg/kg, less
than or equal to about 3 mg/kg, less than or equal to about 2
mg/kg, or less than or equal to about 1 mg/kg) of total calcium and
magnesium combined.
[0228] In some embodiments, the fatty esters produced as described
herein contain less than or equal to about 500 ppm (e.g., less than
or equal to about 500 ppm, less than or equal to about 400 ppm, or
less than or equal to about 300 ppm, less than or equal to about
200 ppm, less than or equal to about 100 ppm, less than or equal to
about 50 ppm, less than or equal to about 25 ppm, or less than or
equal to about 20 ppm, less than or equal to about 15 ppm, less
than or equal to about 10 ppm, less than or equal to about 8 ppm,
less than or equal to about 6 ppm, less than or equal to about 5
ppm, less than or equal to about 4 ppm, less than or equal to about
3 ppm, less than or equal to about 2 ppm) of sulfur.
[0229] In some embodiments, the fatty esters produced as described
herein contain less than or equal to about 0.02 wt. % (e.g., less
than or equal to about 0.02 wt. %, less than or equal to about
0.015 wt. %, less than or equal to about 0.012 wt. %, less than or
equal to about 0.01 wt. %, less than or equal to about 0.008 wt. %,
less than or equal to about 0.006 wt. %, less than or equal to
about 0.004 wt. %, less than or equal to about 0.002 wt. %, less
than or equal to about 0.001 wt. %, less than or equal to about
0.0005 wt. %) of sulfated ash.
[0230] In some embodiments, the fatty esters produced as described
herein contain less than or equal to about 0.05 vol. % (e.g., less
than or equal to about 0.04 vol. %, or less than or equal to about
0.03 vol. %, or less than or equal to about 0.02 vol. %, or less
than or equal to about 0.01 vol. %) of water and sediment.
[0231] In some embodiments, the fatty esters produced as described
herein contain less than or equal to about 0.02 wt. % (e.g., less
than or equal to about 0.02 wt. %, less than or equal to about
0.018 wt. %, less than or equal to about 0.015 wt. %, less than or
equal to about 0.012 wt. %, less than or equal to about 0.01 wt. %,
less than or equal to about 0.008 wt. %, less than or equal to
about 0.006 wt. %, less than or equal to about 0.004 wt. %, less
than or equal to about 0.002 wt. %) of free glycerin.
[0232] In some embodiments, the fatty esters produced as described
herein contain less than or equal to about 0.38 wt. % (e.g., less
than or equal to about 0.38 wt. %, less than or equal to about 0.35
wt. %, less than or equal to about 0.30 wt. %, less than or equal
to about 0.25 wt. %, less than or equal to about 0.20 wt. %, less
than or equal to about 0.15 wt. %, less than or equal to about 0.10
wt. %, less than or equal to about 0.05 wt. %, less than or equal
to about 0.04 wt. %, less than or equal to about 0.03 wt. %, less
than or equal to about 0.02 wt. %, less than or equal to about 0.01
wt. %) of total glycerin.
[0233] In some embodiments, the fatty esters produced as described
herein contain less than or equal to about 10 mg/kg (e.g., less
than or equal to about 10 mg/kg, less than or equal to about 9
mg/kg, less than or equal to about 8 mg/kg, less than or equal to
about 7 mg/kg, less than or equal to about 6 mg/kg, less than or
equal to about 5 mg/kg, less than or equal to about 4 mg/kg, less
than or equal to about 3 mg/kg, less than or equal to about 2
mg/kg, less than or equal to about 1 mg/kg) of phosphorous.
[0234] In some embodiments, the fatty esters produced as described
herein contain less than or equal to about 10 mg/kg (e.g., less
than or equal to about 10 mg/kg, less than or equal to about 9
mg/kg, less than or equal to about 8 mg/kg, less than or equal to
about 7 mg/kg, less than or equal to about 6 mg/kg, less than or
equal to about 5 mg/kg, less than or equal to about 4 mg/kg, less
than or equal to about 3 mg/kg, less than or equal to about 2
mg/kg, less than or equal to about 1 mg/kg, or less than or equal
to about 0.5 mg/kg) of total sodium and potassium combined.
[0235] The fatty esters produced as described herein desirably have
a total contamination in middle distillates of about 24 mg/kg or
less (e.g., about 22 mg/kg or less, about 20 mg/kg or less, about
18 mg/kg or less, about 16 mg/kg or less, about 14 mg/kg or less,
about 12 mg/kg or less, about 10 mg/kg or less).
[0236] The fatty esters produced as described herein desirably have
a carbon residue of about 0.1 wt. % or less (e.g., about 0.1 wt. %
or less, about 0.08 wt. % or less, about 0.06 wt. % or less, about
0.05 wt. % or less, about 0.04 wt. % or less, about 0.03 wt. % or
less, about 0.02 wt. % or less, about 0.01 wt. % or less, about
0.005 wt. % or less, about 0.002 wt. %).
[0237] Suitable test methods for determination of impurities as
described herein are set forth in the Table below.
TABLE-US-00001 TABLE Impurity Test Method(s) Calcium and Magnesium
(combined) EN 14538, UOP 389 Sulfur D 5453, D 7039 Sulfated Ash D
874, EN 3987 Water and Sediment D 2709, D 1796 Free Glycerin D 6584
Total Glycerin D 6584 Phosphorous D 4951, EN 14107 Sodium and
Potassium (combined) EN 14108, EN 14109, EN 14538, UOP 391 Total
Contamination in Middle Distillates EN 12662 Carbon Residue D
4530
[0238] The fatty esters produced as described herein desirably have
a kinematic viscosity of equal to about 3.5 mm.sup.2/s or higher
(e.g., equal to about 3.5 mm.sup.2/s or higher, about 3.2
mm.sup.2/s or higher, about 3.0 mm.sup.2/s or higher, about 2.8
mm.sup.2/s or higher, about 2.5 mm.sup.2/s or higher, about 2.2
mm.sup.2/s or higher, about 2.0 mm.sup.2/s or higher, about 1.9
mm.sup.2/s or higher). In an alternative embodiment, the fatty
esters produced as described herein desirably have a kinematic
viscosity of less than or equal to about 6.0 mm.sup.2/s (e.g., less
than or equal to about 6.0 mm.sup.2/s, less than or equal to about
5.0 mm.sup.2/s, less than or equal to about 4.0 mm.sup.2/s, less
than or equal to about 3.5 mm.sup.2/s, less than or equal to about
3.0 mm.sup.2/s, less than or equal to about 2.0 mm.sup.2/s). In a
further embodiment, the fatty esters produced as described herein
desirably have a kinematic viscosity of between about 3.0 and 6.0
mm.sup.2/s (e.g., between about 3.0 and 5.5 mm.sup.2/s, between
about 3.0 and 5.0 mm.sup.2/s, between about 3.0 and 4.5 mm.sup.2/s,
between about 3.0 and 4.0 mm.sup.2/s). The kinematic viscosity can
be determined by use of test method D 445 or EN 3104.
[0239] The fatty esters produced as described herein desirably have
an acid number of less than or equal to about 0.80 mg KOH/g (e.g.,
less than or equal to about 0.80 mg KOH/g, less than or equal to
about 0.70 mg KOH/g, less than or equal to about 0.60 mg KOH/g,
less than or equal to about 0.50 mg KOH/g, less than or equal to
about 0.40 mg KOH/g, less than or equal to about 0.30 mg KOH/g,
less than or equal to about 0.20 mg KOH/g, less than or equal to
about 0.10 mg KOH/g, less than or equal to about 0.05 mg KOH/g).
The acid number can be determined by use of test methods D 664, D
3242, D 974, EN 14104.
[0240] The fatty esters produced as described herein desirably have
a boiling point at 760 mm Hg of about 360.degree. C. or lower
(e.g., about 350.degree. C. or lower, about 340.degree. C. or
lower, about 330.degree. C. or lower, or about 325.degree. C. or
lower).
[0241] The fatty esters produced as described herein desirably have
a cetane number of about 40 or higher (e.g., about 41 or higher,
about 42 or higher, about 45 or higher, about 47 or higher, about
50 or higher). The cetane number can be determined by use of test
methods D 613 or D 6890.
[0242] The fatty esters produced as described herein desirably have
an oxidation stability of about 3 hours or longer (e.g., about 3
hours or longer, about 4 hours or longer, about 5 hours or longer,
about 6 hours or longer, about 7 hours or longer). The oxidation
stability can be determined using any suitable method, for example,
by using test method EN 14112.
[0243] The fatty esters produced as described herein desirably have
a cloud point of about 10.degree. C. or lower (e.g., about
8.degree. C. or lower, about 5.degree. C. or lower, about 4.degree.
C. or lower, about 3.degree. C. or lower, about 2.degree. C. or
lower, about 1.degree. C. or lower, about 0.degree. C. or lower,
about -1.degree. C. or lower, about -2.degree. C. or lower, about
-3.degree. C. or lower about -4.degree. C. or lower about
-5.degree. C. or lower). The cloud point is the temperature at
which wax crystals begin to form in a petroleum product as it is
cooled. The cloud point can be determined using any suitable
method, for example, by using test method D 2500 or D 6890.
[0244] The fatty esters produced as described herein desirably have
a density of liquid at 15.degree. C. of about 860 kg/m.sup.3 or
more (e.g., about 860 kg/m.sup.3 or more, about 865 kg/m.sup.3 or
more, about 870 kg/m.sup.3 or more, about 875 kg/m.sup.3 or more,
about 880 kg/m.sup.3 or more, about 885 mg/m.sup.3 or more, about
890 kg/m.sup.3 or more, about 895 kg/m.sup.3 or more). In an
alternative embodiment, the fatty esters produced as described
herein desirably have a density of liquid of about 900 kg/m.sup.3
or less (e.g., about 900 kg/m.sup.3 or less, about 890 kg/m.sup.3
or less, about 880 kg/m.sup.3 or less, about 870 kg/m.sup.3 or
less, about 865 kg/m.sup.3 or less). In a further embodiment, the
fatty esters produced as described herein desirably have a density
of liquid at 20.degree. C. of about 865 kg/m.sup.3 or more (e.g.,
about 865 kg/m.sup.3 or more, about 870 kg/m.sup.3 or more, about
875 kg/m.sup.3 or more, about 878 kg/m.sup.3 or more). In yet a
further embodiment, the fatty esters produced as described herein
desirably have a density of liquid at 20.degree. C. of about 880
kg/m.sup.3 or less (e.g., about 880 kg/m.sup.3 or less, about 875
kg/m.sup.3 or less, about 870 kg/m.sup.3 or less, about 868
kg/m.sup.3 or less). The density of liquid at 20.degree. C. can be
determined using any suitable method, for example, by using test
method D 1298, D 4052, EN 3675, or EN 12185.
[0245] The fatty esters produced as described herein desirably have
a flash point of about about 100.degree. C. or higher (e.g., about
110.degree. C. or higher, about 120.degree. C. or higher, about
130.degree. C. or higher, about 140.degree. C. or higher). The
flash point can be determined using any suitable method, for
example, by using test method D 93 or EN 3679.
[0246] The fatty esters produced as described herein desirably have
a total ester content of about 96.5 wt. % or more (e.g., about 96.6
wt. % or more). The total ester content can be determined using any
suitable method, for example, by using test method EN 14103. An
exemplary B 100 biodiesel of the present invention comprising the
fatty esters produced as described herein has a total ester content
of about 97.5 wt. % or more.
[0247] The fatty esters produced as described herein des.sup.irably
have a cold filter plugging point of about 5.degree. C. or lower
(e.g., about 4.degree. C. or lower, about 2.degree. C. or lower,
about 0.degree. C. or lower, about -2.degree. C. or lower, about
-3.degree. C. or lower, about -4.degree. C. or lower, about
-5.degree. C. or lower). The cold filter plugging point can be
determined using any suitable method, for example, by using test
me.sup.thod D 6371 or EN 116.
[0248] The fatty esters produced as described herein de.sup.sirably
have a copper strip corrosion rating of class 3 or lower (e.g.,
class 3 or lower, class 2 or lower, or class 1) in a standard
copper strip test, for example, using test method ASTM D 130.
[0249] The fatty esters produced as described herein desirably have
a methanol or ethanol level of about 0.5 wt. % or lower (e.g.,
about 0.5 wt. % or lower, about 0.4 wt. % or lower, about 0.3 wt. %
or lower, about 0.2 wt. % or lower, about 0.1 wt. % or lower, about
0.08 wt. % or lower, about 0.05 wt. % or lower, about 0.04 wt. % or
lower, about 0.03 wt. % or lower, about 0.02 wt. % or lower), as
measured in a standard method, for example, EN 14110.
[0250] The fatty esters produced as described herein desirably has
an iodine value of about 120 g/100 g or less (e.g., about 120 g/100
g or less, about 110 g/100 g or less, about 100 g/100 g or less,
about 95 g/100 g or less, about 90 g/100 g or less, about 85 g/100
g or less, about 80 g/100 g or less, about 75 g/100 g or less,
about 70 g/100 g or less), as measured in a standard test to
determine the level of unsaturation in the fatty ester content of a
fuel, such as, for example, EN 14111.
Environmental Standards
[0251] The United States Environmental Protection Agency ("EPA")
sets purity and emissions standards for all diesel fuels, including
biodiesel fuels, and related products marketed in the United
States. By requiring producers and importers of fuels or additives
to register their product with the EPA, the agency acts within the
authority provided by section 211 of the Clean Air Act, (42 U.S.C.
.sctn.7401 et seq. (1970)), to regulate fuels and fuel additives,
to obtain information about emissions and health effects when
appropriate, and to reduce the risk to public health from exposure
to their emissions.
Trace Elements
[0252] The fatty esters produced as described herein desirably
contain substantially lower levels of trace elements than those in
other biofuels derived from triglycerides, such as fuels derived
from vegetable oils and fats. Specifically, the crude fatty ester
biofuels described herein (prior to mixing with other fuels, such
as, for example, petroleum-based fuels) desirably contain less
heavy metal elements such as, for example, copper than crude
biodiesels derived from other biomass, such as, for example, those
derived from soy. The crude fatty ester biofuels described herein
also desirably contain less transesterification catalyst than
petrochemical diesel or biodiesel. For example, the fatty ester can
contain less than about 2%, 1.5%, 1.0%, 0.5%, 0.3%, 0.1%, 0.05%, or
0% of a transesterification catalyst or an impurity resulting from
a transesterification catalyst. In certain embodiments, the fatty
ester produced according to the disclosures herein contains no
impurity resulting from a transesterification catalyst.
Non-limiting examples of transesterification catalysts include
hydroxide catalysts, such as NaOH, KOH, and LiOH; and acidic
catalysts, such as mineral acid catalysts and Lewis acid catalysts,
Non-limiting examples of catalysts and impurities resulting from
transesterification catalysts include tin, lead, mercury, cadmium,
zinc, titanium, zirconium, hafnium, boron, iron, aluminum,
phosphorus, arsenic, antimony, bismuth, calcium, magnesium,
strontium, uranium, potassium, sodium, lithium, and combinations
thereof.
[0253] Furthermore, the crude fatty ester biofuels described herein
contains low amounts of other trace elements, including, for
example, chromium, molybdenum, nitrogen, and halogen ions, and
therefore posing little or no health and environmental threat as
biodiesel fuels.
[0254] In some embodiments, the fatty esters produced as described
herein contain less than or equal to about 0.02 ppm of copper
(e.g., less than or equal to about 2 ppm, less than or equal to
about 0.019 ppm, or less than or equal to about 0.0188 ppm, or less
than or equal to about 0.0186 ppm of copper).
[0255] In some embodiments, the fatty esters produced as described
herein contain less than or equal to about 2 ppm of boron (e.g.,
less than or equal to about 2 ppm, less than or equal to about 1.9
ppm of boron, less than or equal to about 1.8 ppm of boron, less
than o equal to about 1.7 ppm of boron, less than or equal to about
1.6 ppm of boron).
[0256] In some embodiments, the fatty esters produced as described
herein contain less than or equal to about 2 ppm of chromium (e.g.,
less than or equal to about 2 ppm, less than or equal to about 1.9
ppm, less than or equal to about 1.8 ppm, less than or equal to
about 1.7 ppm, less than or equal to about 1.6 ppm, less than or
equal to about 1.5 ppm of chromium).
[0257] In certain embodiments, the fatty esters produced as
described herein contain less than or equal to about 5 ppm of iron
(e.g.,less than or equal to about 5 ppm, less than or equal to
about 4 ppm, less than or equal to about 3.5 ppm, or less than or
equal to about 3.3 ppm of iron).
[0258] In certain embodiments, the fatty esters produced as
described herein contain less than or equal to about 2 ppm of
molybdenum (e.g., less than or equal to about 2 ppm, less than or
equal to about 1.9 ppm, less than or equal to about 1.8 ppm, less
than or equal to about 1.7 ppm, less than or equal to about 1.6
ppm, less than or equal to about 1.5 ppm of molybdenum).
[0259] In certain embodiments, the fatty esters produced as
described herein contain less than or equal to about 35 ppm of
nitrogen (e.g., less than or equal to about 35 ppm, less than or
equal to about 34 ppm, less than or equal to about 33 ppm, less
than or equal to about 32 ppm, less than or equal to about 31 ppm,
less than or equal to about 29 ppm of nitrogen). Alternatively, the
fatty esters produced as described herein contain less than or
equal to about 1.0% of nitrogen (e.g., less than or equal to about
0.9%, less than or equal to about 0.8%, less than or equal to about
0.7%, less than or equal to about 0.6%, less than or equal to about
0.5% of nitrogen).
[0260] In certain embodiments, the fatty esters produced as
described herein contain less than or equal to about 35 ppm of
total halogens (e.g., less than or equal to about 35 ppm, less than
or equal to about 34 ppm, less than or equal to about 33 ppm, less
than or equal to about 32 ppm, or less than or equal to about 31
ppm of total halogens).
[0261] In certain embodiments, the fatty esters produced as
described herein contain less than or equal to about 2.5 ppm of
zinc (e.g., less than or equal to about 2.5 ppm, less than or equal
to about 2.4 ppm, less than or equal to about 2.3 ppm, less than or
equal to about 2.2 ppm, or less than or equal to about 2.1 ppm of
zinc).
Emissions
[0262] Evaporative emissions from operating diesel engines include
hydrocarbon (HC) vapors that escape from a fuel tank or permeate
through hoses and connections in diesel engines. Evaporative
emissions are regulated by the EPA because they contribute to the
formation of ground-level ozone, a key component of smog.
Combustion emissions are released through vehicle tailpipes or
equipment exhaust systems when fuel is burned in a diesel engine.
They include CO, NO.sub.X and particulate matters (PM), which are
regulated by the EPA because they impact ground level ozone and
human health. In recent years, as these emissions are increasingly
recognized as hazardous to the environment and human health, the
EPA has imposed aggressively and incrementally stricter standards
on diesel fuels manufactured and sold in the United States. For
example, in 1984, the NO.sub.X emission upper limit for heavy duty
diesel engines was 10.7 gram per brake horsepower hour (g/bhp-hr).
But by 1991, that upper limit was reduced to 5 g/bhp-hr; by 2004,
to 2 g/bhp-hr. In another example, in 1984, the upper limit for PM
for heavy duty diesel engines was 0.6 g/bhp-hr, but by 1991, that
upper limit was reduced 0.25 g/bhp-hr; by 1994, to 0.10
g/bph-hr.
[0263] As used herein, the term "emission" or "emit" refers to the
total amount of substances discharged from a standard diesel engine
run under standard testing conditions. The emission may include the
substances discharged from the diesel engine via evaporative
emission and combustion emission.
[0264] The fatty esters described herein, after blended/formulated
into B20 biodiesels, emit less NO.sub.X and HC than a certified
Ultra Low Sulfur Diesel (ULSD, Haltermann Products, Channelview,
Tex., 2007 certification), and a B20 biodiesel formulated with 20%
of a biodiesel derived from soy. Thus, in some embodiments, the
fatty esters produced in accordance with the present disclosures
have cleaner or comparable emissions profile of known pollutants as
compared to biodiesels derived from other sources.
[0265] NO.sub.X gases are formed when oxygen and nitrogen in the
air react with each other during combustion. The most abundant
pollutant, nitric oxide (NO) oxidizes in the atmosphere to form
nitrogen dioxide (NO.sub.2), which can oxidize to form ozone or
particles known as PM.sub.2.5. The formation of NO.sub.X is most
common when there are high temperatures and excess oxygen. Because
NO.sub.X is most abundant when combustion temperatures are high and
hydrocarbon or total hydrocarbon (THC) and CO are most abundant
when temperatures are low, there is a trade-off among these
emissions.
[0266] In some embodiments, a fatty ester composition the fatty
esters described herein emits NO.sub.X at about 2.3 g/bph-hr or
less (e.g., at about 2.3 g/bph-hr or less, at about 2.2 g/bph-hr or
less, at about 2.1 g/bph-hr or less). In certain embodiments, the
fatty esters described herein emits about 2 to about 2.3 g/bph-hr
of NO.sub.X (e.g., about 2.15 to about 2.2 g/bph-hr).
[0267] In certain embodiments, a B20 biodiesel blended with the
fatty esters described herein achieves at least about 2.0%
reduction of NO.sub.X emission (e.g., at least about 2.5%, at least
about 2.8%, at least about 3.0%, at least about 3.2%, or at least
about 3.3% reduction in NO.sub.X emission) as compared to the
baseline certified petroleum-based diesel fuel ULSD. Alternatively,
a B20 biodiesel blended with the fatty esters described herein
achieves at least about 2.0% reduction (e.g., at least about 2.5%,
at least about 2.8%, at least about 3.0%, or at least about 3.1%)
of NO.sub.X emission as compared to a B20 biodiesel blended with
soy-derived biodiesel.
[0268] Hydrocarbon pollution results when unburned or partially
burned fuel is emitted from the engine as exhaust and when fuel
evaporates directly into the atmosphere. Hydrocarbon pollutants
also react with NO.sub.X in the presence of sunlight to form ozone.
In some embodiments, the fatty esters described herein emits less
than or equal to about 2 g/bhp-hr of total hydrocarbon (THC) (e.g.,
less than or equal to about 2 g/bph-hr, less than or equal to about
1.8 g/bhp-hr, less than or equal to about 1.5 g/bhp-hr, less than
1.0 g/bhp-hr, or less than or equal to about 0.5 g/bhp-hr) of total
hydrocarbon (THC).
[0269] In certain embodiments, a B20 biodiesel blended with the
fatty esters described herein achieves at least about 90% reduction
of THC emission (e.g., at least about 95%, at least about 100%, at
least about 105%, at least about 110%, at least about 115%, or at
least about 120% reduction in THC emission) as compared to the THC
emission of the baseline certified all petroleum-based diesel fuel
ULSD. Alternatively, a B20 biodiesel blended with the fatty esters
described herein achieves at least about 50% reduction (e.g., at
least about 55%, at least about 60%, at least about 62%, or at
least about 65% reduction) in THC emission as compared to the THC
emission of a B20 biodiesel blended with soy-derived biodiesel.
[0270] Particulate matter (PM) is a common pollutant emitted by
diesel-fueled vehicles and industrial equipment. PM is typically
made up of small particles that contain a variety of chemical
components. Larger particles are visible as smoke or dust, and
settle out relatively rapidly. Smaller particles, such as
PM.sub.2.5, can be suspended in the air for long periods of time
and inhaled into the lungs by humans and animals. Low levels of PM,
however, can be effectively removed using particulate filters or
other after-treatment devices suitable for removing diesel soot. In
some embodiments, the fatty esters described herein emits equal to
or less than about about 0.007 g/bhp-hr of PM (e.g., equal to or
less than about 0.007 g/bhp-hr, equal to or less than about 0.006
g/bhp-hr, equal to or less than about 0.005 g/bhp-hr, equal to or
less than about 0.004 g/bhp-hr, equal to or less than about 0.003
g/bhp-hr, equal to or less than about 0.002 g/bhp-hr) of PM. In
some embodiments, the fatty esters as described herein emits about
0.001 to about 0.007 g/bhp-hr (e.g., about 0.001 to about 0.006,
about 0.001 to about 0.005, about 0.001 to about 0.004) or PM.
[0271] In certain embodiments, a B20 biodiesel blended with the
fatty esters described herein produced a somewhat increased amount
(e.g., about 90% more PM) of particulates as compared to the amount
of particulates generated by the baseline certified all
petroleum-based diesel fuel ULSD, but a comparable level (e.g.,
about 10 to 15% more) of PM as compared to the amount of
particulates generated by a B20 biodiesel blended with soy-derived
biodiesel.
[0272] Carbon monoxide forms when the carbon in the fuel is not
burned completely due to a lack of oxygen. The level of CO produced
is typically not a concern unless the fuel and the engine using it
are operated at high altitudes where less oxygen is present to
promote combustion. In some embodiments, the fatty esters described
herein emits about 0.4 g/bhp-hr or less (e.g., about 0.3 g/bph-hr
or less, about 0.25 g/bph-hr or less) of CO. In some embodiments,
the fatty esters described herein emits about 0.25 to about 0.40
g/bhp-hr (e.g., about 0.25 to about 0.35 g/bhp-hr, about 0.25 to
about 0.3 g/bhp-hr) of CO.
[0273] In certain embodiments, a B20 biodiesel blended with the
fatty esters described herein emits a comparable amount (e.g.,
about 10% to about 25% increase) of CO produced as compared to the
amount of CO generated by the baseline certified fuel ULSD, but a
somewhat increased level (e.g., about 30% to 40% increase) of CO as
compared to the amount of CO generated by a B20 biodiesel blended
with soy-derived biodiesel.
Other Harmful Substances
[0274] The fatty esters produced as described herein desirably
contains substantially lower levels of certain toxic chemical
substances that are known to be harmful to the human or animal
health, such as, for example, are carcinogenic. An exemplary
harmful substance that is present at low or negligible level is
benzene, which is a known carcinogen and neurotoxin. The fatty
esters and compositions described herein contains less than about
15 ppm (e.g., less than about 12 ppm, less than about 10 ppm) of
benzene.
Fuel Compositions
[0275] The fatty esters described herein can be used as a fuel. One
of ordinary skill in the art will appreciate that, depending upon
the intended purpose of the fuel, different fatty esters can be
produced and used. For example, for motor fuel intended to use in
cold climates, a branched fatty ester can be desirable. Moreover,
the fatty ester-based fuels can be combined with other fuels or
fuel additives to produce fuels having desired properties.
[0276] The fatty esters described herein can also be blended with
other biofuels, which refer to any fuel derived from biomass such
as, for example, plant matters, animal matters, waste products from
industry, agriculture, forestry, and households, as well as sources
of carbon, such as carbohydrates. Corn, sugar cane, and switchgrass
are examples of plant matters that can be used as biomass from
which the other biofuel may be derived. Cow manure or other animal
wastes are examples of animal matters that can serve as biomass. In
limited circumstances, certain Fischer-Tropsch fuels can also serve
as the other biofuel if they are derived from biomass using the
catalyzed gasification process and/or the Fischer-Tropsch
process.
[0277] The fatty esters described herein can alternatively or
additionally be blended with fuels derived from non-biomass
sources, including, for example, fuels derived from coal, natural
gas, and fossil. These fuels may include, for example,
petroleum-based diesel, and Fischer-Tropsch diesel fuel made from
gasification of coal and natural gas.
[0278] In certain embodiments, a biofuel composition of the
invention comprises petroleum diesel. In some embodiment, the
biofuel composition comprises about 95% or less of petroleum
diesel. For example, the biofuel composition comprises about 95% or
less, about 90% or less, about 85% or less, about 80% or less,
about 75% or less, about 70% or less, about 65% or less, about 60%
or less, about 55% or less, about 50% or less, about 45% or less,
about 40% or less, about 35% or less, about 30% or less, about 25%
or less, or about 20% or less of petroleum diesel.
[0279] The fatty esters described herein can be blended with other
fuels in customary proportions. The amount of biodiesel (or fuel
derived from biomass) present in any fuel mix is designated using a
"B" factor. Accordingly, a fuel that is 100% biodiesel is labeled B
100, whereas a fuel mixture containing equal to or no more than 20%
biodiesel is labeled B20. It is within the present invention that a
B100 biodiesel comprises about 5%, 10%, 15%, 20%, 25%, 30%, 35%,
40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more
of the fatty esters described here, with the remaining part of the
B 100 biodiesel being one or more diesels derived from other types
biomass or derived from biomass using methods that differ from the
ones described herein. Also, a B20 biodiesel may comprise about 1%,
2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%,
17%, 18%, 19% or 20% of the fatty esters described here, with about
19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%,
5%, 4%, 3%, 2%, 1%, or 0% of one or more diesels derived from other
types of biomass or derived from biomass using methods that differ
from the ones described here. In some embodiments, a B20 biodiesel
of the present invention is a biodiesel composition comprising
equal to about 20% of the fatty esters produced in accordance with
the present description. In alternative embodiments, a B20
biodiesel of the present invention comprises up to about 20% but no
more than about 20% of the fatty esters produced according to the
description herein, for example, comprise about 10-20%, about
12-20%, about 14-20%, about 16-20%, about 18-20%, or about 20% of
the fatty esters produced according to the descriptions herein. In
a particular embodiment, a B20 biodiesel of the present invention
comprises about 20% of the fatty esters produced according to the
description herein.
[0280] In certain embodiments, the present invention features a
biofuel composition comprising a fatty ester produced in accordance
with the description herein. In some embodiments, the biofuel
composition of the present invention further comprises suitable
fuel additives that not only afford improved performance but also
compatibility with the other components in the diesel fuel and
other devices that are typically associated with diesel
engines.
[0281] One prominent example of such a device is a catalytic
converter, which contains one or more oxidation catalysts, NO.sub.X
storage catalysts, and/or NH.sub.3 reduction catalysts (e.g., a
combination of catalytic metals such as platinum, and metal
oxides). Catalytic converters are installed in the exhaust systems,
for example, the exhaust pipes of automobiles, to convert the toxic
gases to nontoxic gases. The catalysts, however, can be poisoned
and rendered less effective, if not useless, as a result of
exposure to certain elements or compounds, especially phosphorus
compounds and compounds that produces sulfated ash. Among the many
ways phosphorus compounds may be introduced into the exhaust gas is
the degradation of phosphorus-containing additives. Examples of
phosphorus lubricating oil additives include zinc
dialkyldithiophosphates, which are among the most effective and
conventionally used antioxidants and antiwear agents. Examples of
sulfur and sulfur containing compounds that produces sulfated ash
in the exhaust gas include various sulfur-containing additives such
as, for instance, magnesium sulfonate and other sulfated or
sulfonated detergents. Suitable types and amounts of fuel additives
can be determined in order to insure a reasonable service life for
the catalytic converters.
[0282] Particulate traps are usually installed in the exhaust
system, especially in diesel engines, to prevent the carbon black
particles or very fine condensate particles or agglomerates thereof
(i. e., "diesel soot") from being released into the environment.
These traps, however, can be blocked by metallic ash, which is the
degradation product of metal-containing additives including common
ash-producing detergent additives. Accordingly, low ash or
preferably ashless additives should be chosen for compatibility
with particulate traps.
[0283] Conventionally, fuel additives can be formulated into
"additive packages," each comprising a major part (i.e., >50%)
of one or more base oil and a minor part (i.e., <50%) of various
additives. These additive packages can then be added to a blended
fuel composition, such as, for example, a B20 biodiesel fuel, to
enhance the overall performance of the fuel or engine. The additive
packages are typically added to a fuel in an amount that is less
than 10 wt. % , preferably less than 7 wt. %, more preferably less
than 5 wt. % of the final fuel composition.
[0284] The preparation of additive packages for use with diesel
fuels is within the knowledge of a person ordinarily skilled in the
art. For example, one or more base oils can be used in a single
additive package. The base oils are selected from a variety of oils
of lubricating viscosity. The one or more base oils typically are
present in the additive package in a major amount (i.e., an amount
greater than about 50 wt. %), preferably in an amount greater than
about 60 wt. %, or greater than about 70 wt. %, or greater than
about 80 wt. % of the additive package. The sulfur content of the
base oil is typically less than about 1.0 wt. %, preferably less
than about 0.6 wt. %, more preferably less than about 0.4 wt. %,
and particularly preferably less than about 0.3 wt. %.
[0285] Suitable base oils are those that have a viscosity of at
least about 2.5 cSt. (i.e., mm.sup.2/s), or at least about 3.0 cSt.
at 40.degree. C. Suitable base oils are ones that have pour points
below about 20.degree. C., or below about 10.degree. C., or even
below about 5.degree. C., such as below about 0.degree. C.
[0286] The base oil used in the additive package may be a natural
oil, a synthetic oil, or a mixture thereof, provided that the
sulfur content of such an oil does not exceed the above-indicated
sulfur concentration limit such that the additive package does not
contribute to the emission of sulfate and production of sulfated
ash. Suitable natural oils include animal oils, vegetable oils
(e.g., castor oil, lard oil), mineral oils, and solvent-treated or
acid-treated mineral oils. Oils derived from coal or shale can also
be used. Synthetic oils include hydrocarbon oils such as
polymerized and interpolymerized olefins, poly(1-hexenes),
poly-(1-octenes), poly(1-decenes), etc. and mixtures thereof;
alkylbenzenes; polyphenyls; alkylated diphenyl ethers and the
derivatives, analogs and homologs thereof; and the like. Synthetic
lubricating oils also include oils prepared by Fischer-Tropsch
gas-to-liquid synthetic procedure. Suitable synthetic lubricating
oils also include, for example, alkylene oxide polymers and
interpolymers and derivatives thereof where the terminal hydroxyl
groups have been modified by a process such as esterification or
etherification. Other suitable synthetic oils include esters of
dicarboxylic acids with a variety of alcohols. The synthetic oil
can also be a poly-alpha-olefin (PAO). Examples of useful PAOs
include those derived from octane, decene, mixtures, and the like,
which may have a viscosity from 2 to 15, or from 3 to 12, or from 4
to 8 mm.sup.2/s (cSt.) at 100.degree. C. Unrefined, refined and
rerefined oils, either natural or synthetic (as well as mixtures of
two or more) of the types of oils disclosed above can be used as
the base oil.
[0287] Fuel additives can be blended into the additive package in a
minor amount (i.e., <50 wt. % of the additive package). They can
be used to alter the freezing/gelling point, cloud point,
lubricity, viscosity, oxidative stability, ignition quality, cetane
level, and flash point. Accordingly, fuel additives can include,
for example, lubricants, dispersants, emulsifiers, corrosion
inhibitors, oxidation inhibitors, friction modifiers, demulsifiers,
anti-wear agents, anti-foam agents, detergents, rust inhibitors,
and the like.
[0288] Engine performance additives can be added to improve diesel
engine performance. They are often also referred to as diesel
ignition improvers or cetane number improvers, which are added to
reduce combustion noise and smoke. 2'-Ethylhexyl nitrate (EHN),
also called octyl nitrate, is the most widely used cetane number
improver. Cetane number improvers are typically used in the
concentration range of about 0.05 wt. % to about 0.4 wt. % in the
final fuel composition, giving rise to an about 3 to about 8 (e.g.,
about 3, 4, 5, 6, 7, or 8) cetane number benefit. Other alkyl
nitrates, ether nitrates, some nitroso compounds, and di-tertiary
butyl peroxide can also be used.
[0289] Various detergents or dispersants known to those skilled in
the art can be used to remove deposits that form in the nozzle area
of the fuel injectors and other diesel engine parts. They also
serve as acid neutralizers or rust inhibitors, thereby reducing
wear and corrosion and extending diesel engine life. Suitable
detergents typically comprise a polar head comprising a metal salt
of an acidic organic compound, and a long hydrophobic tail. The
metal salts may be, for example, Group 1 and Group 2 metal salts,
preferably, sodium, potassium, lithium, copper, or magnesium,
calcium, barium or zinc, and particularly sodium and calcium salts.
Exemplary detergents include borated carbonate salts (see, e.g.,
U.S. Pat. No. 4,744,920) and borated sulfonate salts (see, e.g.,
U.S. Pat. No. 4,965,003). To provide an increased
acid-neutralization capacity, suitable detergents can be overbased,
such that the detergent has a total base number (TBN) of 10 or
higher, 60 or higher, 100 or higher, 200 or higher, 300 or higher,
400 or higher, or even 500 or higher. It is within the knowledge of
an ordinarily skilled person in the art to overbase detergents and
measure the TBN in accordance with well known methods, such as, for
example, ASTM test D 2896 and other equivalent procedures.
[0290] The additive package of the present invention thus may
suitably include ashless dispersants, such as nitrogen-containing
detergents, which are basic, contribute to the TBN of a fuel to
which they are added, without introducing additional ash. An
ashless dispersant generally comprises an oil-soluble polymeric
hydrocarbon backbone having functional groups that are capable of
associating with particles to be dispersed. Many types of ashless
dispersants are known in the art. They include, without limitation,
carboxylic dispersants, succinimide dispersants, amine dispersants,
Mannich dispersants. Carboxylic dispersants are imide, amide, or
ester reaction products of carboxylic acylating agents, comprising
at least 34 and preferably at least 54 carbon atoms, with nitrogen
containing compounds, organic hydroxyl compounds (e.g., aliphatic
compounds), and/or basic inorganic materials. Succinimide
dispersants are a type of carboxylic dispersants, produced by
reacting hydrocarbyl-substituted succinic acylating agent with
organic hydroxyl compounds, or with amine comprising at least one
hydrogen attached to a nitrogen atom, or with a mixture of the
hydroxyl compounds and amines (see, e.g., U.S. Pat. Nos. 3,172,892,
3,219,666, 3,272,746, 4,234,435, 6,440,905, and 6,165,235, the
disclosures of which, to the extent they pertain to succinimide
dispersants, are incorporated by reference). Amine dispersants are
products of relatively high molecular weight aliphatic halides and
amines, preferably polyalkelene polyamines (see, e.g., U.S. Pat.
Nos. 3,275,544, 3.438,757, 3,565,804, the disclosures of which, to
the extent they pertain to amine dispersants, are incorporated by
reference herein). Mannich disperstants are reaction products of
alkyl phenols in which the alkyl group contains at least 30 carbon
atoms with aldehydes (especially formaldehyde) and amines
(especially polyalkylene polyamines), as described in, for example,
U.S. Pat. Nos. 3,036,003, 3,586,629, 3,591,598, 3,980,569, the
disclosures of which, to the extent they pertain to Mannich
dispersants, are incorporated by reference). Suitable dispersants
may also include post-treated dispersants, which are obtained by
reacting the above-mentioned dispersants with reagents such as
dimercaptothioazoles, urea, thiourea, carbon disulfide, aldehydes,
ketones, carboxylic acids, hydrocarbon-substituted succinic
anhydrides, nitrile epoxides, boron compounds and the like. See,
e.g., U.S. Pat. Nos. 3,329,658, 3,449,250, 3,666,730, and the like,
the disclosures of which, to the extent they pertains to
post-treated dispersants, are incorporated by reference. Suitable
ashless dispersants may be polymeric, such as, for example,
interpolymers of oil-solublizing monomers such as decyl
methacrylate, vinyl decyl ether and high molecular weight olefins
with monomers containing polar substitutes. Suitable ashless
dispersants can be present in an amount of about 0.025 wt. % to
about 0.5 wt. % (e.g., about 0.025, 0.030, 0.035, 0.040, 0.045,
0.050, or 0.055 wt. %) of the overall fuel.
[0291] The additive package may further comprise one or more
antiwear agents. Dihydrocarbyl dithiophosphate metal salts, and
especially alkali or alkaline earth metal salts, such as zinc,
aluminum, or copper salts, are often used to provide antiwear
benefits as well as to serve as antioxidant agents. Methods of
making these agents are well known in the art, and they may be
included in the additive package in an amount of about 12 to about
24 mM (e.g., about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, or 25 mM). See, e.g., U.S. Pat. No. 5,898,023, the content
of which, to the extent it relates to antiwear agents, is
incorporated by reference.
[0292] The additive package to be blended into a biodiesel fuel may
further comprise one or more viscosity index modifiers, friction
modifiers, antioxidants, and minor amounts of other additives,
including, without limitation, rust inhibitors, antifoaming agents,
and seal fixes.
[0293] Viscosity index improvers (VII's) are typically polymeric
materials of number average molecular weights of from about 5,000
to about 250,000 (e.g., about 5,000, 7,500, 10,000, 15,000, 20,000,
30,000, 50,000, 75,000, 100,000, 150,000, 200,000, or 250,000).
[0294] Friction modifiers are typically sulfur-containing
organo-molybdenum compounds that are known to also provide antiwear
and antioxidant credits.
[0295] In addition to the other multi-purpose additives (e.g.,
those described herein) that impart antioxidation properties, the
additive package may also suitably contain one or more dedicated
antioxidant additives, which further reduces the tendency of
deterioration of the fuels. They may be hindered phenols, alkaline
earth metal salts of alkylphenolthioeters having C.sub.5 to
C.sub.12 alkyl side chains, calcium nonylphenol sulfides, oil
soluble phenates and sulfurized phenates, phosphosulfurized or
sulfurized hydrocarbons or esters, phosphorous esters, metal
thiocarbamates, as well as oil soluble copper compounds as
described in, for example, U.S. Pat. No. 4,867,892. Also suitable
are aromatic amines with at least two aromatic groups attached
directly to the nitrogen. They are typically used in a range of
about 10 ppm to about 80 ppm (e.g., about 8, 10, 20, 30, 40, 50,
60, 70, 80, or 90 ppm).
[0296] Rust inhibitors or anticorrosion agents may be a non-ionic
polyoxyethylene surface active agent. They can be included in the
additive package and added to a biodiesel fuel composition in a
concentration range of about 5 ppm to about 15 ppm (e.g., about 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 ppm).
[0297] Foam inhibitors typically include alkyl methacrylate
polymers and dimethyl silicon polymers. They can be included in the
additive package and added to a biodiesel fuel composition at a
concentration of about 10 ppm or less.
[0298] Seal fixes, seal swelling agents, or seal pacifiers are
often employed to insure proper elastomer sealing, and prevent
premature seal failure and leakages, and these agents may also be a
part of the additive package. They may be, for example,
oil-soluble, saturated, aliphatic, or aromatic hydrocarbon esters
such as di-2-ethylhexylphthalate, mineral oils with aliphatic
alcohols such as tridecyl alcohol, triphosphite ester in
combination with a hydrocarbonyl-substituted phenol, and
di-2-ethylhexylsebacate.
[0299] Lubricity additives, which are typically fatty acids and/or
fatty esters, for example, polyol esters of C.sub.12-C.sub.28
acids, can be applied in the concentration range of about 10 ppm to
about 50 ppm (e.g., about 10, 20, 30, 40, or 50 ppm) for the acids,
and about 50 ppm to about 250 ppm (e.g., about 50, 75, 100, 125,
150, 175, 200, 225, 250 ppm) for the esters.
[0300] Some organometallic compounds, for example, barium or other
metal (e.g., iron, cerium, platinum, etc.) organometallics, can act
as combustion catalysts, and can be used as smoke suppressants,
which reduce the black smoke emissions that result from incomplete
combustion.
[0301] In addition, low molecular weight alcohols or glycerols can
be added to diesel fuel to prevent ice formation in low temperature
applications.
[0302] Other additives can be used to lower a diesel fuel's pour
point or cloud point, or improve its cold flow properties. These
additives are typically additives capable of interacting with the
wax crystals that form in diesel fuels when they are cooled below
the cloud points.
[0303] Drag reducing additives can also be added to increase the
volume of the product that can be delivered. They may be included
in the additive package and added to a biodiesel fuel at
concentrations below about 15 ppm.
[0304] Metal deactivators can be used to chelate various metal
impurities, neutralizing their catalytic effects on fuel
performance. They can also be included in the additive package and
added to a biodiesel fuel in the concentration range of about 1 ppm
to about 15 ppm (e.g., about 1, 3, 5, 7, 9, 11, 13, or 15 ppm).
[0305] Biocides, which preferably dissolve in both the fuel and
water, can be used when contamination by microorganisms reaches
problem levels. They can be added to a biodiesel fuel at a
concentration range of about 200 ppm to about 600 ppm (e.g., about
180, 200, 250, 300, 350, 400, 500, or 600 ppm).
[0306] Demulsifiers are surfactants that break the emulsions and
allow fuel and water phases to separate. They are typically used in
the concentration range of about 5 ppm to about 30 ppm.
[0307] Pour point depressants such as C.sub.8-C.sub.18 dialkyl
fumarate vinyl acetate copolymers, polymethacrylates and wax
naphthalene are well known to those skilled in the art.
[0308] In the United States, all fuel additives must be registered
with the Environmental Protection Agency (EPA). Companies that sell
fuel additives and the name of the fuel additive are publicly
available on the EPA's web site or also by contacting the EPA. One
of ordinary skill in the art will appreciate that the fatty esters
described herein can be mixed with one or more such additives to
impart a desired quality.
[0309] The fuel additives described herein can be prepared by
mixing between about 80% to 99.7% biodiesel fuel and between about
0.3 to about 20% of the additive package, each by volume. The
components can be mixed in any suitable manner. Optimal selection
of an appropriate ratio of fuel vs. fuel additive package will
depend on a variety of factors, including the season (i.e., winter,
summer, spring, or fall), altitude, in which the fuel composition
is used. It also depends upon the types of fatty esters made
according to the present invention, and the types of fuels that are
blended. The amount of additives added may be determined by
following the cetane value or other performance parameters of the
diesel fuel composition as the additive package is gradually and
continuously added and blended into the fuel. Means of mixing or
blending the components are well known to those skilled in the art.
During blending, it may be advantageous to remove aliquots of the
blended fuel and measure various properties, such as vapor pressure
and cetane values, to insure that the blend has the desired
properties.
[0310] One of ordinary skill in the art will also appreciate that
the fatty esters described herein can be mixed with other fuels,
such as biodiesel derived from triglycerides, various alcohol, such
as ethanol and butanol, and petroleum derived products, such as
petroleum diesel. In some examples, fatty esters, such as those
having C16:1 ethyl ester or C18:1 ethyl ester, can be mixed with
petroleum derived diesel to provide a mixture that is at least and
often greater than 5% biodiesel. In some examples, the mixture
includes at least about 20% or greater of the fatty esters. In some
examples, the mixture comprises about 95% (e.g., about 80% to about
95%) or less petroleum diesel. In this regard, the percentage of
biodiesel and/or of petroleum diesel can be based on weight percent
or volume percent.
[0311] As will be appreciated by one of ordinary skill in the art,
any of the above fatty esters and fatty ester compositions can be
converted into a biofuel, or more specifically biodiesel, if
desired. Thus, the corresponding biofuels and biodiesels are also
provided herein.
[0312] Embodiments of the invention are also described in WO
2009/042950 A1, WO 2009/009391 A2, WO 2008/147781 A2, WO
2008/119082 A2, WO 2008/113041 A2, WO 2008/100251 A1, WO
2007/136762 A2, which are incorporated herein by reference in their
entirety.
[0313] The following examples further illustrate the invention but,
of course, should not be construed as in any way limiting its
scope.
Example 1
[0314] This example describes the construction of a genetically
engineered microorganism wherein the expression of a fatty acid
degradation enzyme is attenuated.
[0315] The fadE gene of E. coli MG1655 (an E. coli K strain) was
deleted using the Lambda Red system described in Datsenko et al.,
Proc. Natl. Acad. Sci. USA 97: 6640-6645 (2000), with the following
modifications.
[0316] Two primers were used to create the deletion:
TABLE-US-00002 Del-fadE-F (SEQ ID NO: 1)
5'-AAAAACAGCAACAATGTGAGCTTTGTTGTAATTATATTGTAAACATA
TTGATTCCGGGGATCCGTCGACC Del-fadE-R (SEQ ID NO: 2)
5'-AAACGGAGCCTTTCGGCTCCGTTATTCATTTACGCGGCTTCAACTTT
CCTGTAGGCTGGAGCTGCTTC
[0317] The Del-fadE-F and Del-fadE-R primers were used to amplify
the Kanamycin resistance (Km.sup.R) cassette from plasmid pKD13 (as
described in Datsenko et al., supra) by PCR. The PCR product was
then used to transform electrocompetent E. coli MG1655 cells
containing pKD46 (described in Datsenko et al., supra). These cells
had been previously induced with arabinose for 3-4 h. Following a
3-h outgrowth in a super optimal broth with catabolite repression
(SOC) medium at 37.degree. C., the cells were plated on Luria agar
plates containing 50 .mu.g/mL Kanamycin. Resistant colonies were
identified and isolated after an overnight incubation at 37.degree.
C. Disruption of the fadE gene was confirmed in select colonies
using PCR amplification with primers fadE-L2 and fadE-R1, which
were designed to flank the fadE gene:
TABLE-US-00003 fadE-L2 5'-CGGGCAGGTGCTATGACCAGGAC (SEQ ID NO: 3)
fadE-R1 5'-CGCGGCGTTGACCGGCAGCCTGG (SEQ ID NO: 4)
[0318] After the fadE deletion was confirmed, a single colony was
used to remove the Km.sup.R marker, using the pCP20 plasmid as
described in Datsenko et al., supra. The resulting MG1655 E. coli
strain with the fadE gene deleted and the Km.sup.R marker removed
was named E. coli MG1655 4fadE , or E. coli MG1655 D1.
Example 2
[0319] This example describes the construction of a genetically
engineered microorganism in which the expression of a fatty acid
degradation enzyme and an outer membrane protein receptor are
attenuated.
[0320] The fhuA (also known as tonA) gene of E. coli MG1655, which
encodes a ferrichrome outer membrane transporter (GenBank Accession
No. NP.sub.--414692), was deleted from strain E. coli MG1655 D1 of
Example 1 using the Lambda Red system described in Datsenko et al.,
supra, but with the following modifications.
[0321] Two primers were used to create the deletion:
TABLE-US-00004 Del-fhuA-F (SEQ ID NO: 5)
5'-ATCATTCTCGTTTACGTTATCATTCACTTTACATCAGAGATATACCA
ATGATTCCGGGGATCCGTCGACC; Del-fhuA-R (SEQ ID NO: 6)
5'-GCACGGAAATCCGTGCCCCAAAAGAGAAATTAGAAACGGAAGGTTGC
GGTTGTAGGCTGGAGCTGCTTC
[0322] The Del-fhuA-F and Del-fhuA-R primers were used to amplify
the Km.sup.R cassette from plasmid pKD13 by PCR. The PCR product
obtained was used to transform the electrocompetent E. coli MG1655
D1 cells containing pKD46 (see Example 1). These cells had been
previously induced with arabinose for 3-4 h. Following a 3-h
outgrowth in SOC medium at 37.degree. C., the cells were plated on
Luria agar plates containing 50 .mu.g/mL Kanamycin. Kanamycin
resistant colonies were identified and isolated after an overnight
incubation at 37.degree. C. Disruption of the fhuA gene was
confirmed in select colonies by PCR amplification with primers
fhuA-verF andfhuA-verR, which were designed to flank the fhuA
gene.
[0323] Confirmation of the deletion was performed using the
following primers:
TABLE-US-00005 fhuA-verF 5'-CAACAGCAACCTGCTCAGCAA (SEQ ID NO: 7)
fhuA-verR 5'-AAGCTGGAGCAGCAAAGCGTT (SEQ ID NO: 8)
[0324] After the fhuA deletion was confirmed, a single colony was
used to remove the Km.sup.R marker, using the pCP20 plasmid as
described in Datsenko et al., supra. The resulting MG1655 E. coli
strain having the fadE and fhuA gene deletions was named E. coli
MG1655 AfadE AfhuA, or E. coli MG1655 DV2.
Example 3
[0325] This example describes the construction of a genetically
engineered microorganism in which nucleotide sequences encoding a
thioesterase, an acyl-CoA synthase, and an ester synthase are
integrated into the microorganism's chromosome.
[0326] The following nucleotide sequences, 'tesA, fadD, and aftA1,
were integrated into the chromosome of E. coli MG1655 .DELTA.fadE
.DELTA.fhuA strain (or DV2 strain, see Example 2) at the lacZ
locus. The sequences were integrated in the order of 'tesA,
followed by fadD, and followed by aftA1.
[0327] 'tesA is a nucleotide sequence comprising a leaderless E.
coli tesA (GenBank entry AAC73596, refseq accession U00096.2).
'tesA encodes an E. coli thioesterase (EC 3.1.1.5, 3.1.2.-) in
which the first twenty-five amino acids were deleted and the amino
acid in position 26, alanine, was replaced with methionine. That
methionine then became the first amino acid of 'tesA. See Cho et
al., J. Biol. Chem., 270:4216-4219 (1995).
[0328] E. coli fadD (GenBank entry AAC74875; REFSEQ: accession
U00096.2) encodes an acyl-CoA synthase.
[0329] Alcanivorax borkumensis strain SK2 atfA1 (GenBank entry
YP.sub.--694462; REFSEQ: accession NC.sub.--008260.1) encodes an
ester synthase.
[0330] 'tesA, fadD, and atfA1 were integrated into the chromosome
of E. coli MG1655 DV2 at the lacZ locus, all under the control of a
Trc promoter, as described below.
[0331] Design and Creation of a 'tesA, fadD, atfA1 Integreation
Cassette
Construction of the 'tesA Plasmid
[0332] 'tesA was amplified from a pETDuet-1-'tesA plasmid
constructed as described below. (see also, e.g., WO 2007/136762 A2,
which is incorporated by reference). The 'tesA gene was cloned into
an Ndel/AvrII digested pETDuet-1 plasmid (Novagen, Madison,
Wis.).
Construction of the fadD Plasmid
[0333] fadD was amplified from a pHZ1.61 plasmid constructed as
described below. A fadD gene was cloned into a pCDFDuet-1 plasmid
(Novagen, Madison, Wis.) under the control of a T7 promoter,
generating a pHZ1.61 plasmid containing the following nucleotide
sequence:
TABLE-US-00006 (SEQ ID NO: 9)
GGGGAATTGTGAGCGGATAACAATTCCCCTGTAGAAATAATTTTGTTTAA
CTTTAATAAGGAGATATACCATGGTGAAGAAGGTTTGGCTTAACCGTTAT
CCCGCGGACGTTCCGACGGAGATCAACCCTGACCGTTATCAATCTCTGGT
AGATATGTTTGAGCAGTCGGTCGCGCGCTACGCCGATCAACCTGCGTTTG
TGAATATGGGGGAGGTAATGACCTTCCGCAAGCTGGAAGAACGCAGTCGC
GCGTTTGCCGCTTATTTGCAACAAGGGTTGGGGCTGAAGAAAGGCGATCG
CGTTGCGTTGATGATGCCTAATTTATTGCAATATCCGGTGGCGCTGTTTG
GCATTTTGCGTGCCGGGATGATCGTCGTAAACGTTAACCCGTTGTATACC
CCGCGTGAGCTTGAGCATCAGCTTAACGATAGCGGCGCATCGGCGATTGT
TATCGTGTCTAACTTTGCTCACACACTGGAAAAAGTGGTTGATAAAACCG
CCGTTCAGCACGTAATTCTGACCCGTATGGGCGATCAGCTATCTACGGCA
AAAGGCACGGTAGTCAATTTCGTTGTTAAATACATCAAGCGTTTGGTGCC
GAAATACCATCTGCCAGATGCCATTTCATTTCGTAGCGCACTGCATAACG
GCTACCGGATGCAGTACGTCAAACCCGAACTGGTGCCGGAAGATTTAGCT
TTTCTGCAATACACCGGCGGCACCACTGGTGTGGCGAAAGGCGCGATGCT
GACTCACCGCAATATGCTGGCGAACCTGGAACAGGTTAACGCGACCTATG
GTCCGCTGTTGCATCCGGGCAAAGAGCTGGTGGTGACGGCGCTGCCGCTG
TATCACATTTTTGCCCTGACCATTAACTGCCTGCTGTTTATCGAACTGGG
TGGGCAGAACCTGCTTATCACTAACCCGCGCGATATTCCAGGGTTGGTAA
AAGAGTTAGCGAAATATCCGTTTACCGCTATCACGGGCGTTAACACCTTG
TTCAATGCGTTGCTGAACAATAAAGAGTTCCAGCAGCTGGATTTCTCCAG
TCTGCATCTTTCCGCAGGCGGAGGGATGCCAGTGCAGCAAGTGGTGGCAG
AGCGTTGGGTGAAACTGACAGGACAGTATCTGCTGGAAGGCTATGGCCTT
ACCGAGTGTGCGCCGCTGGTCAGCGTTAACCCATATGATATTGATTATCA
TAGTGGTAGCATCGGTTTGCCGGTGCCGTCGACGGAAGCCAAACTGGTGG
ATGATGATGATAATGAAGTACCACCGGGTCAACCGGGTGAGCTTTGTGTC
AAAGGACCGCAGGTGATGCTGGGTTACTGGCAGCGTCCGGATGCTACAGA
TGAGATCATCAAAAATGGCTGGTTACACACCGGCGACATCGCGGTGATGG
ATGAAGAAGGGTTCCTGCGCATTGTCGATCGTAAAAAAGACATGATTCTG
GTTTCCGGTTTTAACGTCTATCCCAACGAGATTGAAGATGTCGTCATGCA
GCATCCTGGCGTACAGGAAGTCGCGGCTGTTGGCGTACCTTCCGGCTCCA
GTGGTGAAGCGGTGAAAATCTTCGTAGTGAAAAAAGATCCATCGCTTACC
GAAGAGTCACTGGTGACCTTTTGCCGCCGTCAGCTCACGGGCTACAAAGT
ACCGAAGCTGGTGGAGTTTCGTGATGAGTTACCGAAATCTAACGTCGGAA
AAATTTTGCGACGAGAATTACGTGACGAAGCGCGCGGCAAAGTGGACAAT
AAAGCCTGAAAGCTTGCGGCCGCATAATGCTTAAGTCGAACAGAAAGTAA
TCGTATTGTACACGGCCGCATAATCGAAATTAATACGACTCACTATAGGG
GAATTGTGAGCGGATAACAATTCCCCATCTTAGTATATTAGTTAAGTATA
AGAAGGAGATATACATATGCGCCCATTACATCCGATTGATTTTATATTCC
TGTCACTAGAAAAAAGACAACAGCCTATGCATGTAGGTGGTTTATTTTTG
TTTCAGATTCCTGATAACGCCCCAGACACCTTTATTCAAGATCTGGTGAA
TGATATCCGGATATCAAAATCAATCCCTGTTCCACCATTCAACAATAAAC
TGAATGGGCTTTTTTGGGATGAAGATGAAGAGTTTGATTTAGATCATCAT
TTTCGTCATATTGCACTGCCTCATCCTGGTCGTATTCGTGAATTGCTTAT
TTATATTTCACAAGAGCACAGTACGCTGCTAGATCGGGCAAAGCCCTTGT
GGACCTGCAATATTATTGAAGGAATTGAAGGCAATCGTTTTGCCATGTAC
TTCAAAATTCACCATGCGATGGTCGATGGCGTTGCTGGTATGCGGTTAAT
TGAAAAATCACTCTCCCATGATGTAACAGAAAAAAGTATCGTGCCACCTT
GGTGTGTTGAGGGAAAACGTGCAAAGCGCTTAAGAGAACCTAAAACAGGT
AAAATTAAGAAAATCATGTCTGGTATTAAGAGTCAGCTTCAGGCGACACC
CACAGTCATTCAAGAGCTTTCTCAGACAGTATTTAAAGATATTGGACGTA
ATCCTGATCATGTTTCAAGCTTTCAGGCGCCTTGTTCTATTTTGAATCAG
CGTGTGAGCTCATCGCGACGTTTTGCAGCACAGTCTTTTGACCTAGATCG
TTTTCGTAATATTGCCAAATCGTTGAATGTGACCATTAATGATGTTGTAC
TAGCGGTATGTTCTGGTGCATTACGTGCGTATTTGATGAGTCATAATAGT
TTGCCTTCAAAACCATTAATTGCCATGGTTCCAGCCTCTATTCGCAATGA
CGATTCAGATGTCAGCAACCGTATTACGATGATTCTGGCAAATTTGGCAA
CCCACAAAGATGATCCTTTACAACGTCTTGAAATTATCCGCCGTAGTGTT
CAAAACTCAAAGCAACGCTTCAAACGTATGACCAGCGATCAGATTCTAAA
TTATAGTGCTGTCGTATATGGCCCTGCAGGACTCAACATAATTTCTGGCA
TGATGCCAAAACGCCAAGCCTTCAATCTGGTTATTTCCAATGTGCCTGGC
CCAAGAGAGCCACTTTACTGGAATGGTGCCAAACTTGATGCACTCTACCC
AGCTTCAATTGTATTAGACGGTCAAGCATTGAATATTACAATGACCAGTT
ATTTAGATAAACTTGAAGTTGGTTTGATTGCATGCCGTAATGCATTGCCA
AGAATGCAGAATTTACTGACACATTTAGAAGAAGAAATTCAACTATTTGA
AGGCGTAATTGCAAAGCAGGAAGATATTAAAACAGCCAATTAAAAACAAT
AAACTTGATTTTTTAATTTATCAGATAAAACTAAAGGGCTAAATTAGCCC
TCCTAGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGC
CTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAACCTCAGGCATTTGAGA
AGCACACGGTCACACTGCTTCCGGTAGTCAATAAACCGGTAAACCAGCAA
TAGACATAAGCGGCTATTTAACGACCCTGCCCTGAACCGACGACCGGGTC
ATCGTGGCCGGATCTTGCGGCCCCTCGGCTTGAACGAATTGTTAGACATT
ATTTGCCGACTACCTTGGTGATCTCGCCTTTCACGTAGTGGACAAATTCT
TCCAACTGATCTGCGCGCGAGGCCAAGCGATCTTCTTCTTGTCCAAGATA
AGCCTGTCTAGCTTCAAGTATGACGGGCTGATACTGGGCCGGCAGGCGCT
CCATTGCCCAGTCGGCAGCGACATCCTTCGGCGCGATTTTGCCGGTTACT
GCGCTGTACCAAATGCGGGACAACGTAAGCACTACATTTCGCTCATCGCC
AGCCCAGTCGGGCGGCGAGTTCCATAGCGTTAAGGTTTCATTTAGCGCCT
CAAATAGATCCTGTTCAGGAACCGGATCAAAGAGTTCCTCCGCCGCTGGA
CCTACCAAGGCAACGCTATGTTCTCTTGCTTTTGTCAGCAAGATAGCCAG
ATCAATGTCGATCGTGGCTGGCTCGAAGATACCTGCAAGAATGTCATTGC
GCTGCCATTCTCCAAATTGCAGTTCGCGCTTAGCTGGATAACGCCACGGA
ATGATGTCGTCGTGCACAACAATGGTGACTTCTACAGCGCGGAGAATCTC
GCTCTCTCCAGGGGAAGCCGAAGTTTCCAAAAGGTCGTTGATCAAAGCTC
GCCGCGTTGTTTCATCAAGCCTTACGGTCACCGTAACCAGCAAATCAATA
TCACTGTGTGGCTTCAGGCCGCCATCCACTGCGGAGCCGTACAAATGTAC
GGCCAGCAACGTCGGTTCGAGATGGCGCTCGATGACGCCAACTACCTCTG
ATAGTTGAGTCGATACTTCGGCGATCACCGCTTCCCTCATACTCTTCCTT
TTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATA
CATATTTGAATGTATTTAGAAAAATAAACAAATAGCTAGCTCACTCGGTC
GCTACGCTCCGGGCGTGAGACTGCGGCGGGCGCTGCGGACACATACAAAG
TTACCCACAGATTCCGTGGATAAGCAGGGGACTAACATGTGAGGCAAAAC
AGCAGGGCCGCGCCGGTGGCGTTTTTCCATAGGCTCCGCCCTCCTGCCAG
AGTTCACATAAACAGACGCTTTTCCGGTGCATCTGTGGGAGCCGTGAGGC
TCAACCATGAATCTGACAGTACGGGCGAAACCCGACAGGACTTAAAGATC
CCCACCGTTTCCGGCGGGTCGCTCCCTCTTGCGCTCTCCTGTTCCGACCC
TGCCGTTTACCGGATACCTGTTCCGCCTTTCTCCCTTACGGGAAGTGTGG
CGCTTTCTCATAGCTCACACACTGGTATCTCGGCTCGGTGTAGGTCGTTC
GCTCCAAGCTGGGCTGTAAGCAAGAACTCCCCGTTCAGCCCGACTGCTGC
GCCTTATCCGGTAACTGTTCACTTGAGTCCAACCCGGAAAAGCACGGTAA
AACGCCACTGGCAGCAGCCATTGGTAACTGGGAGTTCGCAGAGGATTTGT
TTAGCTAAACACGCGGTTGCTCTTGAAGTGTGCGCCAAAGTCCGGCTACA
CTGGAAGGACAGATTTGGTTGCTGTGCTCTGCGAAAGCCAGTTACCACGG
TTAAGCAGTTCCCCAACTGACTTAACCTTCGATCAAACCACCTCCCCAGG
TGGTTTTTTCGTTTACAGGGCAAAAGATTACGCGCAGAAAAAAAGGATCT
CAAGAAGATCCTTTGATCTTTTCTACTGAACCGCTCTAGATTTCAGTGCA
ATTTATCTCTTCAAATGTAGCACCTGAAGTCAGCCCCATACGATATAAGT
TGTAATTCTCATGTTAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTG
GGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTG
AGCTAACTTACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGG
AAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAG
GCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGAC
GGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCA
AGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTG
GTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCAC
TACCGAGATGTCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCA
TTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACG
ATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGGACATGGCACT
CCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGAT
ATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGG
CCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCAC
GCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTG
TCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCT
TCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCC
ACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGA
CGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCG
GCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAG
ACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTT
GTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACT
TTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGA
AACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGTATAACGTTA
CTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCAT
GCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTCGAC
GCTCTCCCTTATGCGACTCCTGCATTAGGAAATTAATACGACTCACTATA
Construction of the atfA1 Plasmid
[0334] atfAl was amplified from a pHZ1.97-atfA1 plasmid constructed
as described below. The atfA1 gene was synthesized by DNA2.0 (Menlo
Park, Calif.) and cloned into an NdeI and AvrII digested
pCOLA-Duet-1 plasmid (Novagen, Madison, Wis.), generating a
pHZ1.97-atfA1plasmid having the following nucleotide sequence:
TABLE-US-00007 (SEQ ID NO: 10)
GGGGAATTGTGAGCGGATAACAATTCCCCTGTAGAAATAATTTTGTTTAA
CTTTAATAAGGAGATATACCATGGGCAGCAGCCATCACCATCATCACCAC
AGCCAGGATCCGAATTCGAGCTCGGCGCGCCTGCAGGTCGACAAGCTTGC
GGCCGCATAATGCTTAAGTCGAACAGAAAGTAATCGTATTGTACACGGCC
GCATAATCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAA
CAATTCCCCATCTTAGTATATTAGTTAAGTATAAGAAGGAGATATACATA
TGAAAGCGCTTAGCCCAGTGGATCAACTGTTCCTGTGGCTGGAAAAACGA
CAGCAACCCATGCACGTAGGCGGTTTGCAGCTGTTTTCCTTCCCGGAAGG
TGCCGGCCCCAAGTATGTGAGTGAGCTGGCCCAGCAAATGCGGGATTACT
GCCACCCAGTGGCGCCATTCAACCAGCGCCTGACCCGTCGACTCGGCCAG
TATTACTGGACTAGAGACAAACAGTTCGATATCGACCACCACTTCCGCCA
CGAAGCACTCCCCAAACCCGGTCGCATTCGCGAACTGCTTTCTTTGGTCT
CCGCCGAACATTCCAACCTGCTGGACCGGGAGCGCCCCATGTGGGAAGCC
CATTTGATCGAAGGGATCCGCGGTCGCCAGTTCGCTCTCTATTATAAGAT
CCACCATTCGGTGATGGATGGCATATCCGCCATGCGTATCGCCTCCAAAA
CGCTTTCCACTGACCCCAGTGAACGTGAAATGGCTCCGGCTTGGGCGTTC
AACACCAAAAAACGCTCCCGCTCACTGCCCAGCAACCCGGTTGACATGGC
CTCCAGCATGGCGCGCCTAACCGCGAGCATAAGCAAACAAGCTGCCACAG
TGCCCGGTCTCGCGCGGGAGGTTTACAAAGTCACCCAAAAAGCCAAAAAA
GATGAAAACTATGTGTCTATTTTTCAGGCTCCCGACACGATTCTGAATAA
TACCATCACCGGTTCACGCCGCTTTGCCGCCCAGAGCTTTCCATTACCGC
GCCTGAAAGTTATCGCCAAGGCCTATAACTGCACCATTAACACCGTGGTG
CTCTCCATGTGTGGCCACGCTCTGCGCGAATACTTGATTAGCCAACACGC
GCTGCCCGATGAGCCACTGATTGCAATGGTGCCCATGAGCCTGCGGCAGG
ACGACAGCACTGGCGGCAACCAGATCGGTATGATCTTGGCTAACCTGGGC
ACCCACATCTGTGATCCAGCTAATCGCCTGCGCGTCATCCACGATTCCGT
CGAGGAAGCCAAATCCCGCTTCTCGCAGATGAGCCCGGAAGAAATTCTCA
ATTTCACCGCCCTCACTATGGCTCCCACCGGCTTGAACTTACTGACCGGC
CTAGCGCCAAAATGGCGGGCCTTCAACGTGGTGATTTCCAACATACCCGG
GCCGAAAGAGCCGCTGTACTGGAATGGTGCACAGCTGCAAGGAGTGTATC
CAGTATCCATTGCCTTGGATCGCATCGCCCTAAATATCACCCTCACCAGT
TATGTAGACCAGATGGAATTTGGGCTTATCGCCTGCCGCCGTACTCTGCC
TTCCATGCAGCGACTACTGGATTACCTGGAACAGTCCATCCGCGAATTGG
AAATCGGTGCAGGAATTAAATAGTAACCTAGGCTGCTGCCACCGCTGAGC
AATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTT
TTGCTGAAACCTCAGGCATTTGAGAAGCACACGGTCACACTGCTTCCGGT
AGTCAATAAACCGGTAAACCAGCAATAGACATAAGCGGCTATTTAACGAC
CCTGCCCTGAACCGACGACAAGCTGACGACCGGGTCTCCGCAAGTGGCAC
TTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATAC
ATTCAAATATGTATCCGCTCATGAATTAATTCTTAGAAAAACTCATCGAG
CATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATT
TTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTC
CATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAAC
ATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTG
AGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTA
TGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATC
AAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAG
CGAGACGAAATACGCGGTCGCTGTTAAAAGGACAATTACAAACAGGAATC
GAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACC
TGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCG
CAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATG
GTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATC
TGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTG
GCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCG
ACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGA
ATTTAATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATAC
TCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATG
AGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGCATGCT
AGCGCAGAAACGTCCTAGAAGATGCCAGGAGGATACTTAGCAGAGAGACA
ATAAGGCCGGAGCGAAGCCGTTTTTCCATAGGCTCCGCCCCCCIGACGAA
CATCACGAAATCTGACGCTCAAATCAGTGGTGGCGAAACCCGACAGGACT
ATAAAGATACCAGGCGTTTCCCCCTGATGGCTCCCTCTTGCGCTCTCCTG
TTCCCGTCCTGCGGCGTCCGTGTTGTGGTGGAGGCTTTACCCAAATCACC
ACGTCCCGTTCCGTGTAGACAGTTCGCTCCAAGCTGGGCTGTGTGCAAGA
ACCCCCCGTTCAGCCCGACTGCTGCGCCTTATCCGGTAACTATCATCTTG
AGTCCAACCCGGAAAGACACGACAAAACGCCACTGGCAGCAGCCATTGGT
AACTGAGAATTAGTGGATTTAGATATCGAGAGTCTTGAAGTGGTGGCCTA
ACAGAGGCTACACTGAAAGGACAGTATTTGGTATCTGCGCTCCACTAAAG
CCAGTTACCAGGTTAAGCAGTTCCCCAACTGACTTAACCTTCGATCAAAC
CGCCTCCCCAGGCGGTTTTTTCGTTTACAGAGCAGGAGATTACGACGATC
GTAAAAGGATCTCAAGAAGATCCTTTACGGATTCCCGACACCATCACTCT
AGATTTCAGTGCAATTTATCTCTTCAAATGTAGCACCTGAAGTCAGCCCC
ATACGATATAAGTTGTAATTCTCATGTTAGTCATGCCCCGCGCCCACCGG
AAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGG
TGCCTAATGAGTGAGCTAACTTACATTAATTGCGTTGCGCTCACTGCCCG
CTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAA
CGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTT
TCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGA
GAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATC
CTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTAT
CGTCGTATCCCACTACCGAGATGTCCGCACCAACGCGCAGCCCGGACTCG
GTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCAT
CGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAAC
CGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGA
TTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGAC
AGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGA
CCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATA
CTGTTGATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATT
AGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGT
TAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCT
TTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGC
ACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCG
CGTGCAGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTG
CCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCAT
CGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGT
TCACCACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACA
TCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTC
CGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGT
CCGGGATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAATTAAT
ACGACTCACTATA
Construction of pACYC-PTrc Plasmid Containing 'tesA, fadD, and
atfA1
[0335] A pACYC-PTrc vector having the following sequence was used
to construct a pACYC-PTrc-'tesA-fadD-atfA1 plasmid. The nucleotide
sequence of the pACYC-PTrc vector is as follows:
TABLE-US-00008 (SEQ ID NO: 11)
ACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAA
TTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACT
TCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACA
TGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAA
GCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAAC
AACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGC
AACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTG
CGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGG
TGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGC
CCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGAT
GAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTG
GTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAAC
TTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTC
ATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCC
CTTAATAAGATGATCTTCTTGAGATCGTTTTGGTCTGCGCGTAATCTCTT
GCTCTGAAAACGAAAAAACCGCCTTGCAGGGCGGTTTTTCGAAGGTTCTC
TGAGCTACCAACTCTTTGAACCGAGGTAACTGGCTTGGAGGAGCGCAGTC
ACCAAAACTTGTCCTTTCAGTTTAGCCTTAACCGGCGCATGACTTCAAGA
CTAACTCCTCTAAATCAATTACCAGTGGCTGCTGCCAGTGGTGCTTTTGC
ATGTCTTTCCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGC
GGTCGGACTGAACGGGGGGTTCGTGCATACAGTCCAGCTTGGAGCGAACT
GCCTACCCGGAACTGAGTGTCAGGCGTGGAATGAGACAAACGCGGCCATA
ACAGCGGAATGACACCGGTAAACCGAAAGGCAGGAACAGGAGAGCGCACG
AGGGAGCCGCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTT
TCGCCACCACTGATTTGAGCGTCAGATTTCGTGATGCTTGTCAGGGGGGC
GGAGCCTATGGAAAAACGGCTTTGCCGCGGCCCTCTCACTTCCCTGTTAA
GTATCTTCCTGGCATCTTCCAGGAAATCTCCGCCCCGTTCGTAAGCCATT
TCCGCTCGCCGCAGTCGAACGACCGAGCGTAGCGAGTCAGTGAGCGAGGA
AGCGGAATATATCCTGTATCACATATTCTGCTGACGCACCGGTGCAGCCT
TTTTTCTCCTGCCACATGAAGCACTTCACTGACACCCTCATCAGTGCCAA
CATAGTAAGCCAGTATACACTCCGCTAGCGCTGAGGTCTGCCTCGTGAAG
AAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAG
AAAGTGAGGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTT
GGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAA
GATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAA
AGCCACGTTGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAA
TATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAA
GGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGA
TTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGA
TAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCG
ATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGAT
GTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCT
TCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCA
CCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCT
GATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTT
GCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTC
GTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGT
GATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGA
AATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTG
ATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGT
ATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCAT
CCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTT
TTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCAT
TTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACA
CTGGCAGAGCATTACGCTGACTTGACGGGACGGCGGCTTTGTTGAATAAA
TCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCTTCCCGACAACG
CAGACCGTTCCGTGGCAAAGCAAAAGTTCAAAATCACCAACTGGTCCACC
TACAACAAAGCTCTCATCAACCGTGGCTCCCTCACTTTCTGGCTGGATGA
TGGGGCGATTCAGGCCTGGTATGAGTCAGCAACACCTTCTTCACGAGGCA
GACCTCAGCGCTCAAAGATGCAGGGGTAAAAGCTAACCGCATCTTTACCG
ACAAGGCATCCGGCAGTTCAACAGATCGGGAAGGGCTGGATTTGCTGAGG
ATGAAGGTGGAGGAAGGTGATGTCATTCTGGTGAAGAAGCTCGACCGTCT
TGGCCGCGACACCGCCGACATGATCCAACTGATAAAAGAGTTTGATGCTC
AGGGTGTAGCGGTTCGGTTTATTGACGACGGGATCAGTACCGACGGTGAT
ATGGGGCAAATGGTGGTCACCATCCTGTCGGCTGTGGCACAGGCTGAACG
CCGGAGGATCCTAGAGCGCACGAATGAGGGCCGACAGGAAGCAAAGCTGA
AAGGAATCAAATTTGGCCGCAGGCGTACCGTGGACAGGAACGTCGTGCTG
ACGCTTCATCAGAAGGGCACTGGTGCAACGGAAATTGCTCATCAGCTCAG
TATTGCCCGCTCCACGGTTTATAAAATTCTTGAAGACGAAAGGGCCTCGT
GATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGA
CGTCTTAATTAATCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGA
AAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGT
TCCCTACTCTCGCATGGGGAGACCCCACACTACCATCGGCGCTACGGCGT
TTCACTTCTGAGTTCGGCATGGGGTCAGGTGGGACCACCGCGCTACTGCC
GCCAGGCAAATTCTGTTTTATCAGACCGCTTCTGCGTTCTGATTTAATCT
GTATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACAGCCAAGCTGGAGA
CCGTTTAAACTCAATGATGATGATGATGATGGTCGACGGCGCTATTCAGA
TCCTCTTCTGAGATGAGTTTTTGTTCGGGCCCAAGCTTCGAATTCCCATA
TGGTACCAGCTGCAGATCTCGAGCTCGGATCCATGGTTTATTCCTCCTTA
TTTAATCGATACATTAATATATACCTCTTTAATTTTTAATAATAAAGTTA
ATCGATAATTCCGGTCGAGTGCCCACACAGATTGTCTGATAAATTGTTAA
AGAGCAGTGCCGCTTCGCTTTTTCTCAGCGGCGCTGTTTCCTGTGTGAAA
TTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTG
TCAACAGCTCATTTCAGAATATTTGCCAGAACCGTTATGATGTCGGCGCA
AAAAACATTATCCAGAACGGGAGTGCGCCTTGAGCGACACGAATTATGCA
GTGATTTACGACCTGCACAGCCATACCACAGCTTCCGATGGCTGCCTGAC
GCCAGAAGCATTGGTGCACCGTGCAGTCGATGATAAGCTGTCAAACCAGA
TCAATTCGCGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTC
CAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGC
GGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACC
AGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAG
TTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTT
TGATGGTGGTTGACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCG
TATCCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTCGGTAAT
GGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAG
TGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGGAC
ATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCG
AGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAAC
TTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGA
TGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTT
GATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGC
AGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATG
ATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACA
GGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCA
GTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGC
AGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGC
CAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCG
CTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACC
ACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGTA
TAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGC
GCTATCATGCCATACCGCGAAAGGTTTTGCACCATTCGATGGTGTCAACG
TAAATGCATGCCGCTTCGCCTTCGCGCGCGAATTGATCTGCTGCCTCGCG
CGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGAC
GGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGG
GCGCGTCAGCGGGTGTTGGCGGGGCCGGCCTCG
[0336] The 'tesA, fadD, and atfA1 genes were amplified using high
fidelity Phusion.TM. polymerase (New England Biolabs, Inc.,
Ipswich, Mass.), with the following primers from their respective
plasmids, pETDuet-1-'tesA, pHZ1.61, and pHZ1.97
TABLE-US-00009 `tesAForward- (SEQ ID NO: 12)
5'-CTCTAGAAATAATTTAACTTTAAGTAGGAGAUAGGTACCCATGGCGG ACACGTTATTGAT
`tesAReverse- (SEQ ID NO: 13)
5'-CTTCGAATTCCATTTAAATTATTTCTAGAGTCATTATGAGTCATGAT TTACTAAAGGC
fadDForward- (SEQ ID NO: 14)
5'-CTCTAGAAATAATTTTAGTTAAGTATAAGAAGGAGATATACCATGGT
GAAGAAGGTTTGGCTTAA fadDReverse- (SEQ ID NO: 15)
5'-CTTCGAATTCCATTTAAATTATTTCTAGAGTTATCAGGCTTTATTGT CCAC
atfA1Forward- (SEQ ID NO: 16)
5'-CTCTAGAAATAATTTAGTTAAGTATAAGAAGGAGATATACAT atfA1Reverse- (SEQ ID
NO: 17) 5'-CTTCGAATTCCATTTAAATTATTTCTAGAGTTACTATTTAATTCCTG
CACCGATTTCC
Insertion of 'tesA into pACYC-Ptrc Plasmid
[0337] Using NcoI and EcoRI sites on both the insert and vector,
the 'tesA PCR product amplified from pETDuet-1-'tesA was cloned
into the initial position of pACYC-PTrc vector (SEQ ID NO:11). A T4
DNA ligase (New England Biolabs, Ipswich, Mass.) was then used to
ligate the pACYC-PTrc vector and 'tesA, producing a
pACYC-PTrc-'tesA plasmid. Following overnight ligation, the DNA
product was transformed into Top 10 One Shot.RTM. cells
(Invitrogen, Carlsbad, Calif.). The 'tesA insertion into the
pACYC-PTrc vector was confirmed by restriction digestion. An Swal
restriction site as well as overlapping fragments for In-Fusion.TM.
cloning (Clontech, Mountain View, Calif.) was also created at the
3' end of the 'tesA insert.
Construction of pACYC-PTrc-'tesA-fadD-atfA1
[0338] The pACYC-PTrc-'tesA plasmid was then subject to an
overnight digestion by SwaI. fadD amplified from pHZ1.61was cloned
after the 'tesA gene using In-Fusion.TM. cloning. This insertion of
fadD was verified with restriction digestion. The insertion of fadD
destroys the SwaI site following the 'tesA gene, but recreates a
new Swal site at the 3' end of fadD.
[0339] The pACYC-PTrc-'tesA fadD plasmid was again linearized by
SwaI, and OM amplified from pHZ1.97-atfA1 was cloned after the fadD
gene using In-Fusion.TM. cloning. The proper insertion of atfAlwas
verified by restriction digestion.
Construction of the pOP-80 (pCL) Plasmid
[0340] A low copy plasmid pCL1920 (in accordance with Lerner et
al., Nucleic Acids Res. 18:4631 (1990)) carrying a strong
transcriptional promoter was digested with restriction enzymes
AflII and SfoI (New England BioLabs Inc. Ipswich, Mass.). Three DNA
sequence fragments were produced by this digestion, among which a
3737 by fragment was gel-purified using a gel-purification kit
(Qiagen, Inc. Valencia, Calif.).
[0341] In parallel, a fragment containing the Trc-promoter and lacI
region from the commercial plasmid pTrcHis2 (Invitrogen, Carlsbad,
Calif.) was amplified by PCR using the following primers:
TABLE-US-00010 (SEQ ID NO: 18) LF302:
5'-ATATGACGTCGGCATCCGCTTACAGACA-3' (SEQ ID NO: 19) LF303
(5'-AATTCTTAAGTCAGGAGAGCGTTCACCGACAA-3'.
[0342] These two primers also introduced recognition sites for ZraI
(gacgtc) and AflII (cttaag), at the end of the PCR product. The PCR
product was purified using a PCR-purification kit (Qiagen, Inc.
Valencia, Calif.) and digested with ZraI and AflII following the
recommendations of the supplier (New England BioLabs Inc., Ipswich,
Mass.). The digested PCR product was then gel-purified and ligated
with the 3737 by DNA sequence fragment derived from pCL1920. The
ligation mixture was transformed in TOP10 chemically competent
cells (Invitrogen, Carlsbad, Calif.), and the transformants were
plated on Luria agar plates containing 100 .mu.g/mL spectinomycin.
After overnight incubation at 37.degree. C., a number of colonies
were visible. A select number of these colonies were purified,
analyzed with restriction enzymes, and sequenced. One of the
plasmids was retained and given the name pOP-80.
Construction of pCL-TFW-atfA1
[0343] The operon 'tesA-fadD-atfA1 was removed from
pACYC-'tesA-fadD-atfA1 using restriction digestion with MluI and
EcoRI (New England Biolabs, Inc., Ipswich, Mass.). It was then
cloned into complementary sites on pOP-80 to create the plasmid
pCL-TFW-atfA].
Integration of the PTrc-'tesA-fadD-atfA1 Operon into the E. coli
MG1655 .DELTA.fadE .DELTA.fhuA Chromosome at the LacI-LacZ
Locus
[0344] Plasmid pCL-TFW-atfA1 was digested with restriction enzyme
HindIII (New England Biolabs, Inc., Ipswich). In parallel, a
chloramphenicol gene cassette was obtained from plasmid pLoxPcat2
(Genbank Accession No. AJ401047) by digestion with restriction
enzymes BamHI and AvrII (New England Biolabs, Inc., Ipswich,
Mass.). Both DNA fragments were blunt-ended using the DNA
polymerase Klenow fragment. The resulting fragments were ligated
and transformed to generate plasmid pCLTFWcat (see, FIG. 1).
[0345] Plasmid placZ was designed and synthesized by DNA2.0 (Menlo
Park, Calif.) in accordance with SEQ ID NO:28. This plasmid was
used as a template for PCR amplification of the region shown in
FIG. 2. PCR primers LacZFnotI and pKDRspeI were designed to create
restriction sites for the NotI and SpeI, respectively:
TABLE-US-00011 (SEQ ID NO: 20) LacZFnotI
5'-CAACCAGCGGCCGCGCAGACGATGGTGCAGGATATC (SEQ ID NO: 21) pKDRspeI
5'-CCACACACTAGTCAGATCTGCAGAATTCAGGCTGTC
[0346] The resulting DNA fragment was ligated with a DNA fragment
from plasmid pCLTFWcat digested with Spel and Nod enzymes.
[0347] The ligation mixture was used as a template for another PCR
reaction using primers lacIF and lacZR located on the lad and lacZ
regions.
TABLE-US-00012 lacIF 5'-GGCTGGCTGGCATAAATATCTC (SEQ ID NO: 22)
lacZR 5'-CATCGCGTGGGCGTATTCG (SEQ ID NO: 23)
[0348] The resulting PCR product ("Integration Cassette") contains
approximately 500 bases of homology to lacI or lacZ at each end.
This PCR product was used to transform E. coli MG1655 .DELTA.fadE
.DELTA.fhuA (DV2) cells that were made hypercompetent with plasmid
pKD46 (see, Example 2).
[0349] This example demonstrate the construction of E. coli MG1655
.DELTA.fadE, .DELTA.fhuA, lacZ:: 'tes.DELTA.fadD atfA1, which is a
genetically engineered microorganism in which a fatty acid
degradation enzyme and an outer membrane protein receptor for
ferrichrome are attenuated and nucleotide sequences encoding a
thioesterase, an acyl-CoA synthase, and an ester synthase are
integrated into the microorganism's chromosome. This strain was
given the name "IDV2."
Example 4
[0350] This example describes processes that can be used to produce
a fatty ester composition using the genetically modified
microorganisms described herein.
[0351] The fatty ester composition produced by the processes
described herein may produce a fatty ester composition comprising
fatty acid methyl esters (FAME) and/or fatty acid ethyl esters
(FAEE). This fatty ester composition may then be used as
biodiesel.
Fermentation
[0352] The fermentation process described herein can be carried out
by using methods well known to those of ordinary skill in the art.
For example, a fermentation process can be carried out in a 2 to 5
L lab-scale fermentor. Alternatively, a fermentation process can be
scaled up using the methods described herein or alternative methods
known in the art.
[0353] In one embodiment, various fermentation steps were carried
out in 2 L fermentor. E. coli cells from a frozen stock were grown
overnight in a defined medium consisting of: 1.5 g/L of
KH.sub.2PO.sub.4, 4.54 g/L of K.sub.2HPO.sub.4 trihydrate, 4 g/L of
(NH.sub.4).sub.2SO.sub.4, 0.15 g/L of MgSO.sub.4 heptahydrate, 20
g/L of glucose, 200 mM of Bis-Tris buffer (pH 7.2), and 1.25 mL/L
of a vitamin solution. The vitamin solution comprised 0.42 g/L of
riboflavin, 5.4 g/L of pantothenic acid, 6 g/L of niacin, 1.4 g/L
of pyridoxine, 0.06 g/L of biotin, and 0.04 g/L of folic acid.
[0354] 50 mL of the culture grown overnight from the frozen stock
was then used to inoculate 1 L of medium in a fermentor with
controlled temperature, pH, agitation, aeration and dissolved
oxygen concentration. The medium was similar to the one described
above except that it contained 5 g/L of glucose. In a preferred
embodiment, the fermentation conditions were: 32.degree. C., pH
6.8, and dissolved oxygen (DO) equal to 30% of saturation. pH was
maintained by addition of NH.sub.4OH, which also acted as a
nitrogen source for cell growth.
[0355] When the initial supply of glucose is almost exhausted, a
feed consisting of 60% glucose, 3.9 g/L MgSO.sub.4 heptahydrate,
and 10 mL/L of the trace metals solution described above is
supplied to the fermentor. The trace metals solution comprises 27
g/L of FeCl.sub.3.6H.sub.2O, 2 g/L of ZnCl.sub.2.4H.sub.2O, 2 g/L
of CaCl.sub.2.6H.sub.2O, 2 g/L of Na.sub.2MoO.sub.4.2H.sub.2O, 1.9
g/L of CuSO.sub.4.5H.sub.2O, 0.5 g/L of H.sub.3BO.sub.3, and 100
mL/L of concentrated HCl.
[0356] The feed rate is set up to match the cells' growth rate, and
to avoid accumulation of glucose in the fermentor. By avoiding
glucose accumulation, it is possible to reduce or eliminate the
formation of by-products that are otherwise commonly produced by E.
coli, such as, for example, acetate, formate, and/or ethanol. In
the early phases of cell growth, the production of esters, such as
FAME, is induced by the addition of 1 mM IPTG and 20 mL/L of pure
methanol. The fermentation step is carried out for about 3 days.
Methanol is added several times during the fermentation step to
replenish both the methanol consumed by the cells during the
production of FAME and the methanol lost by evaporation in the
off-gas. Additional methanol is provided to the fermentation broth
to maintain the concentration of methanol at between about 10 and
about 30 mL/L Maintaining the concentration of methanol assists in
the efficient production of FAME while avoiding inhibition of cell
growth.
[0357] In one embodiment, this fermentation protocol was scaled up
to a 700 L fermentor using methods known in the art.
Analysis of Fermentation
[0358] The analytical methods utilized to monitor the fermentation
performance are described below.
[0359] The progress of the fermentation was monitored by measuring
.sub.OD600 (optical density at 600 nm), glucose consumption, and
fatty ester production.
[0360] OD.sub.600 was measured by methods well known in art.
[0361] Glucose consumption throughout the fermentation process was
analyzed by High Pressure Liquid Chromatography (HPLC). The HPLC
analysis was performed according to methods well known in the art
for measuring the contents of sugars (e.g., glucose) and organic
acids. For example, HPLC analysis was conducted under the following
conditions: [0362] a. Instrument: Agilent HPLC 1200 Series with
Refractive Index detector; [0363] b. Column: Aminex HPX-87H, 300
mm.times.7.8 mm; [0364] c. Column temperature: 350.degree. C.;
[0365] d. Mobile phase: 0.01M H.sub.2SO.sub.4 (aqueous); [0366] e.
Flow rate: 0.6 mL/min; [0367] f. Injection volume: 20 .mu.L.
[0368] The production of FAME and FAEE was followed and analyzed by
gas chromatography with a flame ionization detector (GC-FID).
Samples from the fermentation broth were extracted with ethyl
acetate in a ratio of 1:1 vol/vol. After vigorous vortexing, the
samples were centrifuged. Next, the organic phase was analyzed by
GC-FID. The analysis conditions were as follows: [0369] a.
Instrument: Trace GC Ultra, Thermo Electron Corporation with Flame
ionization detector (FID) detector; [0370] b. Column: DB-1 (1%
diphenyl siloxane; 99% dimethyl siloxane) CO1 UFM 1/0.1/5 01 DET
from Thermo Electron Corporation, phase pH 5, FT: 0.4 .mu.m, length
5 m, id: 0.1 mm; [0371] c. Inlet conditions: 250.degree. C.
splitless, 3.8 min 1/25 split method was used depending on the
sample concentration with split flow of 75 mL/min; [0372] d.
Carrier gas & flow rate: helium, at 3.0 mL/min; [0373] e. Block
temperature: 330.degree. C.; [0374] f. Oven temperature: 0.5 minute
hold at 50.degree. C.; 100.degree. C/min to 330.degree. C.; 0.5 min
hold at 330.degree. C.; [0375] g. Detector temperature: 300.degree.
C.; [0376] h. Injection volume: 2 .mu.L; [0377] i. Run time &
flow rate: 6.3 min & 3.0 mL/min (using the splitless method);
3.8 min & 1.5 mL/min (using the split 1/25 method); 3.04 min
& 1.2 mL/min (using the split 1/50 method).
Recovery
[0378] After fermentation, the fatty ester composition may be
suitably separated from the fermentation broth using various
methods well known in the art.
[0379] In one embodiment, the fermentation broth is centrifuged to
separate a first light phase comprising the esters from a first
heavy phase comprising water, salt(s), and microbial biomass.
[0380] The first light phase is centrifuged a second time to
separate a second light phase from a second heavy phase. The second
light phase comprises a mixture of fatty esters. In one embodiment,
the second light phase comprises a mixture of esters which can be
used as biodiesel. In an alternate embodiment, the second light
phase is subject to one or more polishing steps before it can be
used as biodiesel.
[0381] In one embodiment, the centrifugation step is performed in
disk-stacked continuous centrifuges of pilot scale capacity (e.g.,
fixed centrifugal force .about.10,000 g, etc.) with flows from
about 1 to about 5 L/min. The same centrifuge can be used for the
first and second centrifugation steps. Normal adjustments to
centrifugation configurations and conditions (e.g., gravity ring
size, back pressure in outlets, flow rate, etc.), which are well
known to those of ordinary skill in the art, can be performed in
each case to achieve the most favorable separation conditions with
respect to recovery efficiency and purity of the product. For the
first centrifugation step, the fermentation broth is sent directly
from the fermentor to the centrifuge without any physical or
chemical adjustments.
[0382] In alternate embodiments, depending on the fermentation
broth characteristics, it is more difficult to break the emulsion
to obtain the second light phase. In these embodiments, the first
light phase is pretreated to help separate the second light phase
from the second heavy phase during the second centrifugation step.
The pretreatments consisted of one or more of the following:
heating to about 60 to about 80.degree. C., adjusting pH to about
2.0 to about 2.5 with acid (e.g., sulfuric acid), and/or addition
of demulsifiers (e.g., ARB-8285 (Baker Hughes, Tex.), less than 1%
of the emulsion/light phase volume). The temperature was held for
about 1 to about 2 h before the second centrifugation step is
performed.
[0383] The fatty esters separated from the fermentation broth can
also be separated by other methods well known in the art, including
steps such as decanting, distillation, and/or filtration. In
alternate embodiments, a single-step centrifugation can be
employed.
Polishing
[0384] In some instances, the recovered ester composition is
further subjected to optional polishing step(s). These polishing
step(s) are well known in the art.
[0385] In certain instances, the second light phase obtained from
the second centrifugation step has characteristics close to a
commercial-grade biodiesel, such as a biodiesel conforming to the
ASTM D 6751 standard, having low levels of trace elements, or
meeting the requirements of the emission standards set by various
environmental regulatory agencies. For example, the second light
phase may meet or exceed the following ASTM D 6751 standards:
cetane number, kinematic viscosity, flash point, oxidation
stability, copper corrosion, free and total glycerin content,
methanol content, phosphorous content, sulfate content, K.sup.+
content, and/or Na.sup.+ content.
[0386] In certain instances, only minor additional purification or
polishing steps are required to eliminate a few other impurities.
The optional polishing step(s) that were performed on the second
light phase in order to eliminate any remaining impurities include:
lime wash or acid methylation to remove free fatty acids, dilute
acid wash to remove excess calcium, tangential filtration to remove
remaining free acid introduced during the acid methylation or
dilute acid wash, water wash, final drying, and/or
absorption/adsorption with resin to remove other minor impurities.
These step(s) are optional and thus are not necessarily performed
each time depending on the result of analysis obtained from the
second light phase prior to polishing.
[0387] To comply with ASTM D 6751 or with the EPA trace element and
emission standards additional polishing step(s) were sometimes
performed. For example, ASTM D 6751 requires a low calcium and
magnesium content in biodiesel. In some embodiments, the calcium
and/or magnesium content may be minimal in the first or second
light phase, but the calcium and/or magnesium content may increase
during polishing (e.g., during the lime wash). Thus, in some
embodiments, a dilute acid wash is carried out to remove excess
calcium and/or magnesium.
[0388] In other embodiments, small quantities of free fatty acids
are produced during the fermentation and contained in either the
first or second light phase. ASTM D 6751 establishes a low limit
for acid content in biodiesel, which is termed the Acid Number and
measured using the standard procedure described in ASTM D 664.
Thus, even in instances where the free fatty acid level in the
second light phase are as low as 1 to 2%, the above mentioned
polishing step(s), such as, for example, acid methylation, is
required to produce a biodiesel meeting ASTM D 6571.
[0389] In some embodiments, the dilute acid wash may result in an
excess amount of free acid (e.g., sulfuric acid, phosphoric acid,
or lactic acid). In alternate embodiments, the content of free acid
may increase when acid methylation is used as a means to reduce the
level of free fatty acids. In other embodiments, the removal of
this excess free acid may require washing with water.
[0390] In some embodiments, a final treatment step using
absorbent/adsorbent resins such as Magnesol.TM. (the Dallas Group
of America, Inc., Whitehouse, N.J.), Amberlist.TM. BD20 (Dow
Chemicals, Philadelphia, Pa.), Biosil.TM. (Polymer Technology
Group, Berkeley, Calif.), or other similar adsorbent/absorption
resins well known in the art are employed to remove excess water,
methanol, sulfur, and/or other minor impurities present. In other
embodiments, some of the potential impurities are reduced by
modifications to the fermentation process to avoid their presence
in the first place.
Fatty Ester Composition
[0391] In certain instances, the genetically modified strains of E.
coli described herein when fermented, recovered, and/or polished as
described herein produced a mixture of FAME with the following
composition profile: [0392] Methyl dodecanoate (C12:0): 5-25%
[0393] Methyl dodecenoate (C12:1): 0-10% [0394] Methyl
tetradecanoate (C14:0): 30-50% [0395] Methyl 7-tetradecenoate
(C14:1): 0-10% [0396] Methyl hexadecanoate (C16:0): 0-15% [0397]
Methyl 9-hexadecenoate (C16:1): 10-40% [0398] Methyl
11-octadecenoate (C18:1): 0-15%
[0399] The actual composition of the FAME mixture was dependent on
the specific E. coli strain used for production, but not on the
conditions of the fermentation process or recovery. Accordingly,
the lots of biodiesel produced from a given E. coli strain were
consistent from batch to batch.
Example 5
[0400] This example illustrates the impurity profile of the fatty
ester composition produced using the genetically modified
microorganism described in Example 3.
[0401] A fatty ester composition was produced as described herein.
After isolation of the fatty ester composition after two
centrifugations, the fatty ester composition was subjected to
analysis. The results of the analysis are set forth in Table E5.
The test methods followed the protocols set out in the ASTM D 6571
biodiesel standard.
TABLE-US-00013 TABLE E5 Component Test Method Results Sulfur D 5453
23 ppm Sulfated Ash D 874 <0.001 Microcarbon Residue D 4530 0.07
wt. % Water and Sediment D 2709 0.01 vol. % Sodium EN 14538 2.3 ppm
Potassium EN 14538 <0.1 ppm Magnesium EN 14538 <0.1 ppm
Calcium EN 14538 0.8 ppm Methanol content EN 14110 0.03 vol. %
Phosphorous D 4951 <0.0001 wt. %
Example 6
[0402] This example illustrates the performance profile of the
fatty ester composition produced using the genetically modified
microorganism described in Example 3.
[0403] A fatty ester composition was produced as described herein.
The fatty ester composition was obtained by centrifuging the
fermentation broth a first time to obtain a first light phase. The
first light phase was then pretreated by adjusting the pH of the
first light phase to about 2.0 and heating the first light phase to
about 80.degree. C. for 2 h. After pretreatment, the first light
phase was centrifuged a second time to obtain a second light phase.
The second light phase was subjected to two lime washes. The fatty
ester composition obtained was analyzed using the methods described
herein.
[0404] The results of the analysis are set forth in Table E6. The
test methods followed the protocols set out in the ASTM D 6571
biodiesel standard.
TABLE-US-00014 TABLE E6 Component Test Method Results Flash Point D
93A >320 Kinematic Viscosity @ 40.0.degree. C. D 445 3.181 Cloud
Point D 2500 +1 Copper Corrosion D 130 1b Derived Cetane Number D
6890 61.8 Sulfur D 5453 18 ppm Acid Number D 664 0.04 mg KOH/g
Sulfated Ash D 874 0.012 wt. % Microcarbon Residue D 4530 0.07 wt.
% Water and Sediment D 2709 0.02 vol. % Sodium EN 14538 0.5 ppm
Potassium EN 14538 <0.1 ppm Magnesium EN 14538 0.3 ppm Calcium
EN 14538 65 ppm Oxidation Stability EN 14112 6+ Methanol Content EN
14110 <0.01 vol. % Phosphorous D 4951 0.5 ppm
Example 7
[0405] The fatty ester composition of Example 6 was subjected to a
further dilute acid wash. Following isolation of the fatty ester
composition, the calcium content of the fatty ester composition, as
determined by test method EN 14538, was 7.4 mg/kg.
Example 8
[0406] A fatty ester composition was produced using the genetically
engineered microorganism of Example 3. The fatty ester composition
was sequentially treated with (1) a lime wash, (2) a dilute acid
wash, (3) a water wash, (4) treatment with Magnesol.TM. D60 (The
Dallas Group, Whitehouse, N.J.) one or more times, and (5)
filtration. The processed fatty ester composition was subjected to
analysis. The results of the analysis are set forth in Table E8.
The test methods followed the protocols set out in the ASTM D 6571
biodiesel standard.
TABLE-US-00015 TABLE E8 Component or Property Test Method Results
Flash Point D 93A 142.degree. C. Calcium and Magnesium EN 14538
<1 Combined Water and Sediment D 2709 <0.05 vol. % Sulfur D
5453 12 ppm Kinematic Viscosity @ 40.0.degree. C. D 445 3.326 Acid
Number D 664 0.08 mg KOH/g Sulfated Ash D 874 0.001 wt. % Copper
Corrosion D 130 .sup. 1a Derived Cetane Number D 6890 69.9 Cloud
Point D 2500 +2.degree. C. Microcarbon Residue D 4530 <0.01 wt.
% Free Glycerin D 6584 0.002 wt. % Total Glycerin D 6584 0.007 wt.
% Phosphorous D 4951 <0.001 wt. % Vacuum Distillation 90% (AET)
D 1160 323.degree. C. Sodium and Potassium Combined EN 14538 <1
ppm Oxidation Stability EN 14112 6.1 h Annex A1 Cold Soak
Filtration D 6751-08 86 seconds (time for 300 mL)
Example 9
[0407] A fatty ester composition was produced using the genetically
engineered microorganism of Example 3.
[0408] A fatty ester composition was produced as described herein.
The fatty ester composition was obtained by centrifuging the
fermentation broth a first time to obtain a first light phase. The
first light phase was then pretreated by heating the first light
phase to about 80.degree. C. for 2 h. After pretreatment, the first
light phase was centrifuged a second time to obtain a second light
phase. The second light phase was sequentially treated with (1) a
lime wash, (2) a dilute acid wash, (3) a water wash, and (4) a
Magnesol.TM. D60 (The Dallas Group, Whitehouse, N.J.) treatment.
The resulting fatty ester composition was subjected to analysis.
The results of the analysis are set forth in Table E9. The test
methods followed the protocols set out in the Brazilian ANP 7
biodiesel standard.
TABLE-US-00016 TABLE E9 Test Method Result Density of Liquids by
Digital Density Meter ASTM D 4052 0.8728 g/cm.sup.3 Density @
20.degree. C. Kinematic Viscosity @ 104.degree. F./40.degree. C.
ASTM D 445 3.465 mm.sup.2/s Water and Sediment in Middle Distillate
Fuels (Centrifuge Method) Pensky-Martens Closed Cup Flash Point
ASTM D 93 147.degree. C. Micro Carbon Residue ASTM D 4530 0.00 Wt %
Sulfated Ash from Lubricating Oils and ASTM D 874 0.001 Wt %
Additives Cold Filter Plugging Point of Diesel and ASTM D 6371
-4.degree. C. Heating Fuels Acid Number of Petroleum Products by
ASTM D 664 0.15 mg KOH/g Potentiometric Titration Determination of
Free and Total Glycerin in ASTM D 6584 B-100 Biodiesel Methyl
Esters By Gas Chromatography Free Glycerin <0.005 Wt % Total
Glycerin <0.050 Wt % Determination of Oxidation Stability EN
14112 7.2 h (Accelerated Oxidation Test) Determination of Na
Content by Atomic EN 14108 <1.0 mg/kg Absorption Determination
of K Content by AA EN 14109 <0.5 mg/kg Spectrometry
Determination of Total Contamination in EN 12662: 2008 19.3 mg/kg
Middle Distillates Determination of Ester Content EN 14103 96.7%
(m/m) Determination of Ca and Mg Content by ICP EN 14538
<2.0000000000 mg/kg OES Determination of Phosphorus Content by
EN 14107 <4.0 mg/kg (ICP) Emission Spectrometry Determination of
Methanol Content EN 14110 0.01% (m/m) Determination of Iodine Value
EN 14111 52 g I2/100 g Determination of Ca and Mg Content by ICP EN
14538 <2.0000000000 mg/kg OES Sulfur Content by UV Fluorescence
ASTM D 5453 15 mg/kg
Example 10
[0409] This example illustrates the amounts of various trace
elements that were present in the fatty ester composition produced
by the genetically modified microorganism of Examples 3.
[0410] A fatty ester composition was produced as described herein.
The composition was obtained by centrifuging the fermentation broth
a first time to obtain a first light phase. The first light phase
was then pretreated by adjusting the pH of the first light phase to
about 2.0 and heating the first light phase to about 80.degree. C.
for 2 h. After pretreatment, the first light phase was centrifuged
a second time to obtain a second light phase. The second light
phase was subjected to a four-step process: (1) a lime wash, (2) a
dilute acid wash, (3) a water wash, and (4) a Magnesol.TM. D60 (The
Dallas Group, Whitehouse, N.J.) treatment.
[0411] The fatty ester composition thus obtained was sent to
Galbraith Laboratories, Inc. (Knoxville, Tenn.), an EPA approved
testing laboratory, for quantitative elemental analysis of trace
elements, including, for example, boron, chromium, iron,
molybdenum, nitrogen, total halogens, zinc, and copper. Preparatory
and analytical methods are described below. Results are show in
Table E10-6. Boron, chromium, iron, molybdenum, total halogens, and
zinc, if existed in the sample at all, were below the level of
quantitation (LOQ). The amount of nitrogen was below the LOQ of
standard testing method ME-2, but was detected using a dramatically
more sensitive method. Thus, the fatty ester compositions prepared
in accordance with the present disclosures contain low levels of
trace elements.
Method ME-2, Rev. 20: Carbon, Hydrogen, and Nitrogen Determination
Using PerkinElmer 240 Elemental Analyzer
[0412] A PerkinElmer 240 Elemental Analyzer was used to burn
samples in pure oxygen at 950.degree. C. under static conditions to
produce combustion products of CO.sub.2, H.sub.2O and N.sub.2. The
instrument automatically analyzed these products in a
self-integrating, steady-state thermal conductivity analyzer. In
certain instances, Tungstic anhydride was added as combustion
aid.
TABLE-US-00017 TABLE E10-1 Sample Introduction Weighed 1.0-2.5 mg
into AI capsule; crimped for liquids; washed with solvent prior to
weighing upon request. Decomposition Combustion at >950.degree.
C., reduction at >675.degree. C. = CO.sub.2, H.sub.2O, N.sub.2
Calibration Acetanilide (1-2.5 mg) Control s-1409, s-1410:
cyclohexanone-2,4-dinitrophenyl-hydrazone (51.79% C, 5.07% H,
20.14% N) Determination CO.sub.2; H.sub.2O; N.sub.2 by thermal
conductivity analyzer LOQ 0.5% C, 0.5% H, 0.5% N Instrument 1
Instrument 2 Precision/Accuracy C H N C H N RSD (%) 0.28 1.26 0.39
0.35 1.12 0.41 Mean Recovery (%) 99.94 101.25 99.86 100.13 100.40
100.04 Interference Metals and some halogens cause incomplete
combustion. Combustion aids and/or an extended combustion time can
be used to alleviate this problem.
Method: ME-13, Rev. 3: Total Halogens Measurement by MCC-TOX-100
Analyzer
[0413] A MCC-TOX-100 Analyzer was used to determine the total
halogen content (including any halides). The results were expressed
as chlorine or chloride. The sample was heated in a quartz
combustion tube to 950.degree. C. in an oxygen atmosphere. The
combustion process converted the halogens to halides and
oxyhalides, which were directed into a coulometric titration cell
where they react quantitatively with silver irons. Total organic
halogens in aqueous samples were determined by first passing the
sample through a carbon column followed by washing with nitrate
solution to desorb the inorganic halide ions. The LOQ of this
method is 31 ppm.
TABLE-US-00018 TABLE E10-2 Preparation Direction injections were
made by microsyringe or difference weighing into quartz carrier
boat Decomposition Performed using O.sub.2 combustion train at 900
to 950.degree. C. Calibration Cell calibration by sodium chloride
solution injection (into cell) Determination For total halogens:
microcoulometric cell trapping and titration of combustion gases
Precision/Accuracy RSD RE p-1702 Total halogens 7.76% 0.64% p-1703
Total halides 5.80% 0.46% Interferences Extremely high levels of
S
Method ME-30, Rev. 0: Method for Testing Elements in Digestates by
Inductively Coupled Plasma Mass Spectrometry
[0414] Samples were introduced into a PerkinElmer Sciex Elan 6100
ICP Mass Spectrometer by pneumatic nebulization into a radio
frequency plasma where energy transfer processes caused
desolvation, atomization, and ionization. The ions were extracted
from the plasma through a differentially pumped vacuum interface
and separated on the basis of their mass-to-charge ratio by a
quadrupole mass spectrometer.
TABLE-US-00019 TABLE E10-3 Decomposition Performed with an
appropriate solubilizer and digestion method Calibration 10-20-100
ppb Sample Pesistaltic pump, cross flow II nebulizer introduction
Determination Quadrupole mass spectrometer LOQ limit 1.04 .mu.g/l,
mass 120 Precision/accuracy RE 1.21%; RSD 5.64% Interference Te
Method ME-70, Rev. 5: Inductively Coupled Plasma Atomic Emission
Spectrometry
[0415] Multi-elemental determinations were carried out by ICP-AES
using simultaneous optical systems and axial or radial viewing of
the plasma. The instrument measured the characteristic emission
spectra by optical spectrometry. Samples were nebulized and the
resulting aerosols were transported to the plasma torch.
Element-specific emission spectra were produced by radio-frequency
inductively coupled plasma. The spectra were dispersed by a grating
spectrometer, and the intensities of the emission lines were
monitored by photosensitive devices. Background corrections were
required for trace element detection, which was measured adjacent
to analyte lines on the samples during the analyses. The LOQ limit
of this method is 0.01-2 ppm, but the upper limit is extendable by
sample dilution.
TABLE-US-00020 TABLE E10-4 Decomposition Prior to analysis, samples
were acidified or digested using appropriate sample preparation
methods. Calibration 0.01 ppm-100 ppm plus matrix specific
calibrations Sample Pesistaltic pump, cross flow nebulizer, gemcone
Introduction nebulizer, scott ryton spray chamber and quartz
cylonic spray chamber Determination Atomic emission by radio
frequency inductively coupled plasma of element-specific emission
spectra through a grating spectrometer monitored by photo-
sensitive devices LOQ limit Element and calibration specific
ranging from 0.01 to 2 ppm Precision/Accuracy .+-.10% RSD
Interferences Spectral, chemical, physical, memory
Method E7-6, Rev. 2: Determination of Trace Nitrogen by Kjeldahl
Digestion and Ion-Selective Electrode
[0416] This method, which involved Kjeldahl digestion, was employed
to determine the trace amount of organic nitrogen in the samples.
This method was used because the standard ME-2 method for nitrogen
detection was insufficiently sensitive because the low levels of
trace nitrogen in the samples were below the detection limit. The
LOQ limit of this method is 0.7 mg/L nitrogen.
TABLE-US-00021 TABLE E10-5 Instrument Ammonium electrode, Orion
Model 95-12 or equivalent; pH meter, Fischer Accumet 950, or
equivalent Decomposition The sample was digested in a mixture of
concentrated sulfuric acid, sodium sulfate, and copper sulfate. The
organic material was oxidized and the nitrogen converted to
ammonium sulfate. Excess sodium hydroxide was added, and the
ammonia was distilled and absorbed in a boric acid solution
Determination The pH of the sample was adjusted to be greater than
11. After rinsing the ammonium electrode, the electrode was
immersed in the sample. The concentration of ammonium was read from
the electrode. LOQ limit 0.7 mg/L nitrogen Calibration 0.1-20.0
mg/L nitrogen Precision/Accuracy RSD RE Kjeldahl Nitrogen k-0702
1.26% N/A (E7-6) k-0703 3.21% k-0704 4.69% Interference Hg & Ag
interfere by complexing with NH.sub.4; excess NaOH eliminates the
interference
[0417] Results of the trace element analysis according to the
methods listed above are shown in the Table E10-6 below.
TABLE-US-00022 TABLE E10-6 Element Method Result Boron ME-70
<1.6 ppm Chromium ME-70 <1.5 ppm Iron ME-70 <3.3 ppm
Molybdenum ME-70 <1.5 ppm Nitrogen ME-2 <0.5% Nitrogen,
Kjeldahl E7-6 29 ppm Copper ME-30 0.086 ppm Total Halogens ME-13
<31 ppm Zinc ME-70 <2.1 ppm Results in the above table, when
indicated with "<" before the numbers, were below the detection
limit (or LOQ) of the specified methods used to make the
measurement.
Example 11
[0418] This example illustrates the amount of benzene that was
present in the fatty ester composition produced by the genetically
modified microorganism of Examples 3.
[0419] A fatty ester composition was produced as described. The
composition was obtained by centrifuging the fermentation broth a
first time to obtain a first light phase. The first light phase was
then pretreated by adjusting the pH of the first light phase to
about 2.0 and heating the first light phase to about 80.degree. C.
for 2 h. After pretreatment, the first light phase was centrifuged
a second time to obtain a second light phase. The second light
phase was then subjected to a four-step process: (1) a lime wash,
(2) a dilute acid wash, (3) a water wash, and (4) a Magnesol.TM.
D60 (The Dallas Group, Whitehouse, N.J.) treatment.
[0420] The fatty ester composition was sent to Galbraith
Laboratories, Inc. (Knoxville, Tenn.), an EPA approved testing
laboratory, for quantitative analysis of the presence of benzene
using the protocol in (Method GC-100H) Table E11-1 below:
TABLE-US-00023 TABLE E11-1 Instrument Hewlett-Packard Model
5890/6890 Gas Chromatograph Analytical column J&W DB-624, 30
m/0.53 mm/5 .mu.M) Detection Flame ionization (FID) Preparation
Samples were mixed well, weighed into crimped vials and dissolved
in solvent. Sample introduction Headspace analysis, HP 7694 Sampler
Determination Quantitation was performed by comparison to an
external linear regression cali- bration curve. The instrument
signal output was processed by HP ChemStation software. Limit of
quantitation The practical limit of quantitation is equal to the
concentration of the lowest point of calibration divided by the
amount of sample used in grams. Quality control A reference
standard, independent from standard the calibration standard, was
analyzed under the same condition as the sample. Blanks and
calibration verifications were analyzed at appropriate intervals.
Interferences Potential interferences from coeluting volatile
compounds could not be ruled out. Calculations External standard:
ppm = mass of analyte (mg/.mu.L .times. dilution factor)/mass of
sample (g)
[0421] The LOQ in this case was 15 ppm. The analysis indicated that
the amount of benzene present in the fatty acid composition
produced by the genetically modified microorganism of Example 3 was
less than 15 ppm.
Example 12
[0422] This example illustrates an emissions profile of the fatty
ester composition produced by the genetically modified
microorganism of Example 3.
[0423] A fatty ester composition was produced as described herein.
The composition was obtained by centrifuging the fermentation broth
a first time to obtain a first light phase. The first light phase
was then pretreated by adjusting the pH of the first light phase to
about 2.0 and heating the first light phase to about 80.degree. C.
for 2 h. After pretreatment, the first light phase was centrifuged
a second time to obtain a second light phase. The second light
phase was subjected to a four-step process: (1) a lime wash, (2) a
dilute acid wash, (3) a water wash, and (4) a Magnesol.TM. D60 (The
Dallas Group, Whitehouse, N.J.) treatment.
[0424] A sample of the resulting composition was submitted to the
ReFUEL Laboratory of the National Renewable Energy Laboratory
(Denver, Colo.) for engine testing. Regulated emissions
measurements were performed using procedures consistent with the
Code of Federal Regulations Title 40, Section 86, Subpart N. The
test engine used was a 2008 model year 9.3L 330 horsepower
International MaxxForce 10, with properties shown below in Table
E1.2-1.
TABLE-US-00024 TABLE E12-1 Specifications International MaxxForce
10 Serial Number 570HM2U3058670 Displacement L 9.3 Cylinders 6
Rated Power, kW 246 at 2000 rpm Rated Torque 1560 N-m at 1160 rpm
Bore .times. Stroke 11.7 .times. 14.6 cm Compression Ratio 17.2:1
Fuel System Common Rail
[0425] The engine employs cooled high pressure exhaust gas
recirculation (EGR), a variable geometry turbocharger, electronic
control, and high-pressure common rail direct fuel injection. The
engine, designed and calibrated to meet the 2007 U.S. heavy-duty
emissions standards, also uses an actively regenerated diesel
particulate filter (DPF) for reduction of particulate matter (PM),
which captures and stores diesel soot under low exhaust temperature
conditions. On occasions, the DPF may reach a high soot loading,
and with the exhaust temperatures elevated to sufficiently high,
the stored soot in the DPF may be oxidized. This is referred to as
a DPF regenerating event. For the purpose of the present example,
the state of the DPF was managed by the engine controller, which
used a late in-cylinder fuel injection as the primary means for
active DPF regeneration. The state of the DPF and occurrences of
regeneration events have caused variations in engine emissions
measurements.
[0426] Testing was performed with three fuels. The baseline fuel
was a 2007 Certification Ultra Low Sulfur Diesel (ULSD) (Haltermann
Products, Channelview, Tex.). This fuel was used for two purposes:
(1) for baseline comparison; and (2) as diesel blend stock for the
biodiesel blends. Two B20 biodiesel fuel samples were prepared. In
the first sample, a soy-based diesel fuel (referred to herein as
"SOY fuel") was blended into the baseline ULSD at a 20% blend by
volume. In the second sample, and a fatty ester composition
obtained from the microorganism of Example 3 in accordance with the
description herein (referred to herein as "FAE fuel"), was blended
into the baseline ULSD at a 20% blend by volume.
[0427] Testing was conducted over a heavy duty Federal Testing
Procedure (FTP) transient cycle. The cycle engine speed and torque
are shown in FIG. 4. A minimum of 3 consecutive hot start repeats
were conducted for each fuel on the first day of testing. On the
second day of testing, three additional hot start repeats were
conducted for each fuel, but in reverse order. A thorough fuel swap
procedure was performed between experiments with each test fuel,
including flushing 3x the volumetric capacity of the entire fueling
system, which included the fuel lines, the fuel meter and the
engine. Measurements of NO.sub.X, PM, THC, CO and CO.sub.2
emissions were collected. In addition measurements of fuel
consumption was collected. NO.sub.R emissions were determined by
chemiluminescence detection (CLD), THC by flame ionization
detection (FID) and CO and CO.sub.2 by non-dispersive infrared
(NDIR). Mass emissions levels were determined through dilute
Constant Volume Sampling (CVS) with Critical Flow Venturis.
Background and humidity corrections were applied to all emissions
data. PM was collected on Pall 47 mm and 2.0 pm filters. Particle
filter handling and weighing were conducted in an environmental
chamber/clean room with constant humidity, barometric pressure and
temperature control. Filter weighing was conducted on a Sartorious
microbalance with a readability of 0.1 .mu.g. Fuel consumption was
measured with a Pierburg fuel metering system, which measured
volumetric fuel flow and density with an accuracy of +/-0.5% of
reading.
[0428] A lack of consistency in emissions performance was observed
with the data before the DPF regeneration event on the first day.
This was determined by the ReFUEL Laboratory to be an inherent
characteristic of the test engine as well as most modern diesel
engines. Thus, emissions performance data collected after the DPF
regeneration event on the first day is reported below in Table
E12-2 and the levels of NO.sub.X and CO emissions as well as the
levels of fuel consumption were indicated in FIG. 5.
TABLE-US-00025 TABLE E12-2 NO.sub.x THC CO CO.sub.2 Fuel (g/bhp-
(g/bhp- (g/bhp- (g/bhp- PM Fuel Cons (g/bhp-hr) hr) hr) hr) hr)
(g/bhp-hr) (g/bhp-hr) ULSD 2.32 -0.01 0.29 647.23 0.0024 197.44 Soy
2.32 0.00 0.28 644.54 0.0041 202.11 FAE 2.24 0.00 0.35 646.96
0.0047 203.60
[0429] When compared to the baseline certification fuel ULSD, the
SOY fuel resulted in an about 0.2% reduction of NO.sub.X emissions,
an about 69.3% increase of PM emission, and an about 164% or about
11% reduction in THC or CO emissions, respectively,. When compared
to the certification fuel ULSD, the FAE fuel prepared in accordance
with the description herein resulted in about a 3.34% or about a
121.9% reduction in NO.sub.X or THC, respectively, and about a
98.8% or about 22.6% increase in PM or CO emissions, respectively,.
Both the SOY and the FAE fuels resulted in somewhat higher fuel
consumption than that of the ULSD: about 2.37% increase for the SOY
fuel, and about 3.12% increase for the FAE fuel.
[0430] All references, including publications, patent applications,
and patents, cited herein are hereby incorporated by reference to
the same extent as if each reference were individually and
specifically indicated to be incorporated by reference and were set
forth in its entirety herein.
[0431] Preferred embodiments of this invention are described
herein, including the best mode known to the inventors for carrying
out the invention. Variations of those preferred embodiments may
become apparent to those of ordinary skill in the art upon reading
the foregoing description. The inventors expect skilled artisans to
employ such variations as appropriate, and the inventors intend for
the invention to be practiced otherwise than as specifically
described herein. Accordingly, this invention includes all
modifications and equivalents of the subject matter recited in the
claims appended hereto as permitted by applicable law. Moreover,
any combination of the above-described elements in all possible
variations thereof is encompassed by the invention unless otherwise
indicated herein or otherwise clearly contradicted by context.
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 28 <210> SEQ ID NO 1 <211> LENGTH: 70 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic primer
<400> SEQUENCE: 1 aaaaacagca acaatgtgag ctttgttgta attatattgt
aaacatattg attccgggga 60 tccgtcgacc 70 <210> SEQ ID NO 2
<211> LENGTH: 68 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 2 aaacggagcc
tttcggctcc gttattcatt tacgcggctt caactttcct gtaggctgga 60 gctgcttc
68 <210> SEQ ID NO 3 <211> LENGTH: 23 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 3 cgggcaggtg ctatgaccag gac 23 <210> SEQ ID NO 4
<211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 4 cgcggcgttg
accggcagcc tgg 23 <210> SEQ ID NO 5 <211> LENGTH: 70
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 5 atcattctcg tttacgttat cattcacttt
acatcagaga tataccaatg attccgggga 60 tccgtcgacc 70 <210> SEQ
ID NO 6 <211> LENGTH: 69 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic primer <400> SEQUENCE: 6
gcacggaaat ccgtgcccca aaagagaaat tagaaacgga aggttgcggt tgtaggctgg
60 agctgcttc 69 <210> SEQ ID NO 7 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 7 caacagcaac ctgctcagca a 21
<210> SEQ ID NO 8 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 8 aagctggagc agcaaagcgt t 21 <210> SEQ ID NO 9
<211> LENGTH: 6700 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: pHZ1.61 plasmid <400> SEQUENCE: 9
ggggaattgt gagcggataa caattcccct gtagaaataa ttttgtttaa ctttaataag
60 gagatatacc atggtgaaga aggtttggct taaccgttat cccgcggacg
ttccgacgga 120 gatcaaccct gaccgttatc aatctctggt agatatgttt
gagcagtcgg tcgcgcgcta 180 cgccgatcaa cctgcgtttg tgaatatggg
ggaggtaatg accttccgca agctggaaga 240 acgcagtcgc gcgtttgccg
cttatttgca acaagggttg gggctgaaga aaggcgatcg 300 cgttgcgttg
atgatgccta atttattgca atatccggtg gcgctgtttg gcattttgcg 360
tgccgggatg atcgtcgtaa acgttaaccc gttgtatacc ccgcgtgagc ttgagcatca
420 gcttaacgat agcggcgcat cggcgattgt tatcgtgtct aactttgctc
acacactgga 480 aaaagtggtt gataaaaccg ccgttcagca cgtaattctg
acccgtatgg gcgatcagct 540 atctacggca aaaggcacgg tagtcaattt
cgttgttaaa tacatcaagc gtttggtgcc 600 gaaataccat ctgccagatg
ccatttcatt tcgtagcgca ctgcataacg gctaccggat 660 gcagtacgtc
aaacccgaac tggtgccgga agatttagct tttctgcaat acaccggcgg 720
caccactggt gtggcgaaag gcgcgatgct gactcaccgc aatatgctgg cgaacctgga
780 acaggttaac gcgacctatg gtccgctgtt gcatccgggc aaagagctgg
tggtgacggc 840 gctgccgctg tatcacattt ttgccctgac cattaactgc
ctgctgttta tcgaactggg 900 tgggcagaac ctgcttatca ctaacccgcg
cgatattcca gggttggtaa aagagttagc 960 gaaatatccg tttaccgcta
tcacgggcgt taacaccttg ttcaatgcgt tgctgaacaa 1020 taaagagttc
cagcagctgg atttctccag tctgcatctt tccgcaggcg gagggatgcc 1080
agtgcagcaa gtggtggcag agcgttgggt gaaactgaca ggacagtatc tgctggaagg
1140 ctatggcctt accgagtgtg cgccgctggt cagcgttaac ccatatgata
ttgattatca 1200 tagtggtagc atcggtttgc cggtgccgtc gacggaagcc
aaactggtgg atgatgatga 1260 taatgaagta ccaccgggtc aaccgggtga
gctttgtgtc aaaggaccgc aggtgatgct 1320 gggttactgg cagcgtccgg
atgctacaga tgagatcatc aaaaatggct ggttacacac 1380 cggcgacatc
gcggtgatgg atgaagaagg gttcctgcgc attgtcgatc gtaaaaaaga 1440
catgattctg gtttccggtt ttaacgtcta tcccaacgag attgaagatg tcgtcatgca
1500 gcatcctggc gtacaggaag tcgcggctgt tggcgtacct tccggctcca
gtggtgaagc 1560 ggtgaaaatc ttcgtagtga aaaaagatcc atcgcttacc
gaagagtcac tggtgacctt 1620 ttgccgccgt cagctcacgg gctacaaagt
accgaagctg gtggagtttc gtgatgagtt 1680 accgaaatct aacgtcggaa
aaattttgcg acgagaatta cgtgacgaag cgcgcggcaa 1740 agtggacaat
aaagcctgaa agcttgcggc cgcataatgc ttaagtcgaa cagaaagtaa 1800
tcgtattgta cacggccgca taatcgaaat taatacgact cactataggg gaattgtgag
1860 cggataacaa ttccccatct tagtatatta gttaagtata agaaggagat
atacatatgc 1920 gcccattaca tccgattgat tttatattcc tgtcactaga
aaaaagacaa cagcctatgc 1980 atgtaggtgg tttatttttg tttcagattc
ctgataacgc cccagacacc tttattcaag 2040 atctggtgaa tgatatccgg
atatcaaaat caatccctgt tccaccattc aacaataaac 2100 tgaatgggct
tttttgggat gaagatgaag agtttgattt agatcatcat tttcgtcata 2160
ttgcactgcc tcatcctggt cgtattcgtg aattgcttat ttatatttca caagagcaca
2220 gtacgctgct agatcgggca aagcccttgt ggacctgcaa tattattgaa
ggaattgaag 2280 gcaatcgttt tgccatgtac ttcaaaattc accatgcgat
ggtcgatggc gttgctggta 2340 tgcggttaat tgaaaaatca ctctcccatg
atgtaacaga aaaaagtatc gtgccacctt 2400 ggtgtgttga gggaaaacgt
gcaaagcgct taagagaacc taaaacaggt aaaattaaga 2460 aaatcatgtc
tggtattaag agtcagcttc aggcgacacc cacagtcatt caagagcttt 2520
ctcagacagt atttaaagat attggacgta atcctgatca tgtttcaagc tttcaggcgc
2580 cttgttctat tttgaatcag cgtgtgagct catcgcgacg ttttgcagca
cagtcttttg 2640 acctagatcg ttttcgtaat attgccaaat cgttgaatgt
gaccattaat gatgttgtac 2700 tagcggtatg ttctggtgca ttacgtgcgt
atttgatgag tcataatagt ttgccttcaa 2760 aaccattaat tgccatggtt
ccagcctcta ttcgcaatga cgattcagat gtcagcaacc 2820 gtattacgat
gattctggca aatttggcaa cccacaaaga tgatccttta caacgtcttg 2880
aaattatccg ccgtagtgtt caaaactcaa agcaacgctt caaacgtatg accagcgatc
2940 agattctaaa ttatagtgct gtcgtatatg gccctgcagg actcaacata
atttctggca 3000 tgatgccaaa acgccaagcc ttcaatctgg ttatttccaa
tgtgcctggc ccaagagagc 3060 cactttactg gaatggtgcc aaacttgatg
cactctaccc agcttcaatt gtattagacg 3120 gtcaagcatt gaatattaca
atgaccagtt atttagataa acttgaagtt ggtttgattg 3180 catgccgtaa
tgcattgcca agaatgcaga atttactgac acatttagaa gaagaaattc 3240
aactatttga aggcgtaatt gcaaagcagg aagatattaa aacagccaat taaaaacaat
3300 aaacttgatt ttttaattta tcagataaaa ctaaagggct aaattagccc
tcctaggctg 3360 ctgccaccgc tgagcaataa ctagcataac cccttggggc
ctctaaacgg gtcttgaggg 3420 gttttttgct gaaacctcag gcatttgaga
agcacacggt cacactgctt ccggtagtca 3480 ataaaccggt aaaccagcaa
tagacataag cggctattta acgaccctgc cctgaaccga 3540 cgaccgggtc
atcgtggccg gatcttgcgg cccctcggct tgaacgaatt gttagacatt 3600
atttgccgac taccttggtg atctcgcctt tcacgtagtg gacaaattct tccaactgat
3660 ctgcgcgcga ggccaagcga tcttcttctt gtccaagata agcctgtcta
gcttcaagta 3720 tgacgggctg atactgggcc ggcaggcgct ccattgccca
gtcggcagcg acatccttcg 3780 gcgcgatttt gccggttact gcgctgtacc
aaatgcggga caacgtaagc actacatttc 3840 gctcatcgcc agcccagtcg
ggcggcgagt tccatagcgt taaggtttca tttagcgcct 3900 caaatagatc
ctgttcagga accggatcaa agagttcctc cgccgctgga cctaccaagg 3960
caacgctatg ttctcttgct tttgtcagca agatagccag atcaatgtcg atcgtggctg
4020 gctcgaagat acctgcaaga atgtcattgc gctgccattc tccaaattgc
agttcgcgct 4080 tagctggata acgccacgga atgatgtcgt cgtgcacaac
aatggtgact tctacagcgc 4140 ggagaatctc gctctctcca ggggaagccg
aagtttccaa aaggtcgttg atcaaagctc 4200 gccgcgttgt ttcatcaagc
cttacggtca ccgtaaccag caaatcaata tcactgtgtg 4260 gcttcaggcc
gccatccact gcggagccgt acaaatgtac ggccagcaac gtcggttcga 4320
gatggcgctc gatgacgcca actacctctg atagttgagt cgatacttcg gcgatcaccg
4380 cttccctcat actcttcctt tttcaatatt attgaagcat ttatcagggt
tattgtctca 4440 tgagcggata catatttgaa tgtatttaga aaaataaaca
aatagctagc tcactcggtc 4500 gctacgctcc gggcgtgaga ctgcggcggg
cgctgcggac acatacaaag ttacccacag 4560 attccgtgga taagcagggg
actaacatgt gaggcaaaac agcagggccg cgccggtggc 4620 gtttttccat
aggctccgcc ctcctgccag agttcacata aacagacgct tttccggtgc 4680
atctgtggga gccgtgaggc tcaaccatga atctgacagt acgggcgaaa cccgacagga
4740 cttaaagatc cccaccgttt ccggcgggtc gctccctctt gcgctctcct
gttccgaccc 4800 tgccgtttac cggatacctg ttccgccttt ctcccttacg
ggaagtgtgg cgctttctca 4860 tagctcacac actggtatct cggctcggtg
taggtcgttc gctccaagct gggctgtaag 4920 caagaactcc ccgttcagcc
cgactgctgc gccttatccg gtaactgttc acttgagtcc 4980 aacccggaaa
agcacggtaa aacgccactg gcagcagcca ttggtaactg ggagttcgca 5040
gaggatttgt ttagctaaac acgcggttgc tcttgaagtg tgcgccaaag tccggctaca
5100 ctggaaggac agatttggtt gctgtgctct gcgaaagcca gttaccacgg
ttaagcagtt 5160 ccccaactga cttaaccttc gatcaaacca cctccccagg
tggttttttc gtttacaggg 5220 caaaagatta cgcgcagaaa aaaaggatct
caagaagatc ctttgatctt ttctactgaa 5280 ccgctctaga tttcagtgca
atttatctct tcaaatgtag cacctgaagt cagccccata 5340 cgatataagt
tgtaattctc atgttagtca tgccccgcgc ccaccggaag gagctgactg 5400
ggttgaaggc tctcaagggc atcggtcgag atcccggtgc ctaatgagtg agctaactta
5460 cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg
tgccagctgc 5520 attaatgaat cggccaacgc gcggggagag gcggtttgcg
tattgggcgc cagggtggtt 5580 tttcttttca ccagtgagac gggcaacagc
tgattgccct tcaccgcctg gccctgagag 5640 agttgcagca agcggtccac
gctggtttgc cccagcaggc gaaaatcctg tttgatggtg 5700 gttaacggcg
ggatataaca tgagctgtct tcggtatcgt cgtatcccac taccgagatg 5760
tccgcaccaa cgcgcagccc ggactcggta atggcgcgca ttgcgcccag cgccatctga
5820 tcgttggcaa ccagcatcgc agtgggaacg atgccctcat tcagcatttg
catggtttgt 5880 tgaaaaccgg acatggcact ccagtcgcct tcccgttccg
ctatcggctg aatttgattg 5940 cgagtgagat atttatgcca gccagccaga
cgcagacgcg ccgagacaga acttaatggg 6000 cccgctaaca gcgcgatttg
ctggtgaccc aatgcgacca gatgctccac gcccagtcgc 6060 gtaccgtctt
catgggagaa aataatactg ttgatgggtg tctggtcaga gacatcaaga 6120
aataacgccg gaacattagt gcaggcagct tccacagcaa tggcatcctg gtcatccagc
6180 ggatagttaa tgatcagccc actgacgcgt tgcgcgagaa gattgtgcac
cgccgcttta 6240 caggcttcga cgccgcttcg ttctaccatc gacaccacca
cgctggcacc cagttgatcg 6300 gcgcgagatt taatcgccgc gacaatttgc
gacggcgcgt gcagggccag actggaggtg 6360 gcaacgccaa tcagcaacga
ctgtttgccc gccagttgtt gtgccacgcg gttgggaatg 6420 taattcagct
ccgccatcgc cgcttccact ttttcccgcg ttttcgcaga aacgtggctg 6480
gcctggttca ccacgcggga aacggtctga taagagacac cggcatactc tgcgacatcg
6540 tataacgtta ctggtttcac attcaccacc ctgaattgac tctcttccgg
gcgctatcat 6600 gccataccgc gaaaggtttt gcgccattcg atggtgtccg
ggatctcgac gctctccctt 6660 atgcgactcc tgcattagga aattaatacg
actcactata 6700 <210> SEQ ID NO 10 <211> LENGTH: 4963
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: pHZ1.97-atfA1
plasmid <400> SEQUENCE: 10 ggggaattgt gagcggataa caattcccct
gtagaaataa ttttgtttaa ctttaataag 60 gagatatacc atgggcagca
gccatcacca tcatcaccac agccaggatc cgaattcgag 120 ctcggcgcgc
ctgcaggtcg acaagcttgc ggccgcataa tgcttaagtc gaacagaaag 180
taatcgtatt gtacacggcc gcataatcga aattaatacg actcactata ggggaattgt
240 gagcggataa caattcccca tcttagtata ttagttaagt ataagaagga
gatatacata 300 tgaaagcgct tagcccagtg gatcaactgt tcctgtggct
ggaaaaacga cagcaaccca 360 tgcacgtagg cggtttgcag ctgttttcct
tcccggaagg tgccggcccc aagtatgtga 420 gtgagctggc ccagcaaatg
cgggattact gccacccagt ggcgccattc aaccagcgcc 480 tgacccgtcg
actcggccag tattactgga ctagagacaa acagttcgat atcgaccacc 540
acttccgcca cgaagcactc cccaaacccg gtcgcattcg cgaactgctt tctttggtct
600 ccgccgaaca ttccaacctg ctggaccggg agcgccccat gtgggaagcc
catttgatcg 660 aagggatccg cggtcgccag ttcgctctct attataagat
ccaccattcg gtgatggatg 720 gcatatccgc catgcgtatc gcctccaaaa
cgctttccac tgaccccagt gaacgtgaaa 780 tggctccggc ttgggcgttc
aacaccaaaa aacgctcccg ctcactgccc agcaacccgg 840 ttgacatggc
ctccagcatg gcgcgcctaa ccgcgagcat aagcaaacaa gctgccacag 900
tgcccggtct cgcgcgggag gtttacaaag tcacccaaaa agccaaaaaa gatgaaaact
960 atgtgtctat ttttcaggct cccgacacga ttctgaataa taccatcacc
ggttcacgcc 1020 gctttgccgc ccagagcttt ccattaccgc gcctgaaagt
tatcgccaag gcctataact 1080 gcaccattaa caccgtggtg ctctccatgt
gtggccacgc tctgcgcgaa tacttgatta 1140 gccaacacgc gctgcccgat
gagccactga ttgcaatggt gcccatgagc ctgcggcagg 1200 acgacagcac
tggcggcaac cagatcggta tgatcttggc taacctgggc acccacatct 1260
gtgatccagc taatcgcctg cgcgtcatcc acgattccgt cgaggaagcc aaatcccgct
1320 tctcgcagat gagcccggaa gaaattctca atttcaccgc cctcactatg
gctcccaccg 1380 gcttgaactt actgaccggc ctagcgccaa aatggcgggc
cttcaacgtg gtgatttcca 1440 acatacccgg gccgaaagag ccgctgtact
ggaatggtgc acagctgcaa ggagtgtatc 1500 cagtatccat tgccttggat
cgcatcgccc taaatatcac cctcaccagt tatgtagacc 1560 agatggaatt
tgggcttatc gcctgccgcc gtactctgcc ttccatgcag cgactactgg 1620
attacctgga acagtccatc cgcgaattgg aaatcggtgc aggaattaaa tagtaaccta
1680 ggctgctgcc accgctgagc aataactagc ataacccctt ggggcctcta
aacgggtctt 1740 gaggggtttt ttgctgaaac ctcaggcatt tgagaagcac
acggtcacac tgcttccggt 1800 agtcaataaa ccggtaaacc agcaatagac
ataagcggct atttaacgac cctgccctga 1860 accgacgaca agctgacgac
cgggtctccg caagtggcac ttttcgggga aatgtgcgcg 1920 gaacccctat
ttgtttattt ttctaaatac attcaaatat gtatccgctc atgaattaat 1980
tcttagaaaa actcatcgag catcaaatga aactgcaatt tattcatatc aggattatca
2040 ataccatatt tttgaaaaag ccgtttctgt aatgaaggag aaaactcacc
gaggcagttc 2100 cataggatgg caagatcctg gtatcggtct gcgattccga
ctcgtccaac atcaatacaa 2160 cctattaatt tcccctcgtc aaaaataagg
ttatcaagtg agaaatcacc atgagtgacg 2220 actgaatccg gtgagaatgg
caaaagttta tgcatttctt tccagacttg ttcaacaggc 2280 cagccattac
gctcgtcatc aaaatcactc gcatcaacca aaccgttatt cattcgtgat 2340
tgcgcctgag cgagacgaaa tacgcggtcg ctgttaaaag gacaattaca aacaggaatc
2400 gaatgcaacc ggcgcaggaa cactgccagc gcatcaacaa tattttcacc
tgaatcagga 2460 tattcttcta atacctggaa tgctgttttc ccggggatcg
cagtggtgag taaccatgca 2520 tcatcaggag tacggataaa atgcttgatg
gtcggaagag gcataaattc cgtcagccag 2580 tttagtctga ccatctcatc
tgtaacatca ttggcaacgc tacctttgcc atgtttcaga 2640 aacaactctg
gcgcatcggg cttcccatac aatcgataga ttgtcgcacc tgattgcccg 2700
acattatcgc gagcccattt atacccatat aaatcagcat ccatgttgga atttaatcgc
2760 ggcctagagc aagacgtttc ccgttgaata tggctcatac tcttcctttt
tcaatattat 2820 tgaagcattt atcagggtta ttgtctcatg agcggataca
tatttgaatg tatttagaaa 2880 aataaacaaa taggcatgct agcgcagaaa
cgtcctagaa gatgccagga ggatacttag 2940 cagagagaca ataaggccgg
agcgaagccg tttttccata ggctccgccc ccctgacgaa 3000 catcacgaaa
tctgacgctc aaatcagtgg tggcgaaacc cgacaggact ataaagatac 3060
caggcgtttc cccctgatgg ctccctcttg cgctctcctg ttcccgtcct gcggcgtccg
3120 tgttgtggtg gaggctttac ccaaatcacc acgtcccgtt ccgtgtagac
agttcgctcc 3180 aagctgggct gtgtgcaaga accccccgtt cagcccgact
gctgcgcctt atccggtaac 3240 tatcatcttg agtccaaccc ggaaagacac
gacaaaacgc cactggcagc agccattggt 3300 aactgagaat tagtggattt
agatatcgag agtcttgaag tggtggccta acagaggcta 3360 cactgaaagg
acagtatttg gtatctgcgc tccactaaag ccagttacca ggttaagcag 3420
ttccccaact gacttaacct tcgatcaaac cgcctcccca ggcggttttt tcgtttacag
3480 agcaggagat tacgacgatc gtaaaaggat ctcaagaaga tcctttacgg
attcccgaca 3540 ccatcactct agatttcagt gcaatttatc tcttcaaatg
tagcacctga agtcagcccc 3600 atacgatata agttgtaatt ctcatgttag
tcatgccccg cgcccaccgg aaggagctga 3660 ctgggttgaa ggctctcaag
ggcatcggtc gagatcccgg tgcctaatga gtgagctaac 3720 ttacattaat
tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg tcgtgccagc 3780
tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg cgccagggtg
3840 gtttttcttt tcaccagtga gacgggcaac agctgattgc ccttcaccgc
ctggccctga 3900 gagagttgca gcaagcggtc cacgctggtt tgccccagca
ggcgaaaatc ctgtttgatg 3960 gtggttaacg gcgggatata acatgagctg
tcttcggtat cgtcgtatcc cactaccgag 4020 atgtccgcac caacgcgcag
cccggactcg gtaatggcgc gcattgcgcc cagcgccatc 4080 tgatcgttgg
caaccagcat cgcagtggga acgatgccct cattcagcat ttgcatggtt 4140
tgttgaaaac cggacatggc actccagtcg ccttcccgtt ccgctatcgg ctgaatttga
4200 ttgcgagtga gatatttatg ccagccagcc agacgcagac gcgccgagac
agaacttaat 4260 gggcccgcta acagcgcgat ttgctggtga cccaatgcga
ccagatgctc cacgcccagt 4320 cgcgtaccgt cttcatggga gaaaataata
ctgttgatgg gtgtctggtc agagacatca 4380 agaaataacg ccggaacatt
agtgcaggca gcttccacag caatggcatc ctggtcatcc 4440 agcggatagt
taatgatcag cccactgacg cgttgcgcga gaagattgtg caccgccgct 4500
ttacaggctt cgacgccgct tcgttctacc atcgacacca ccacgctggc acccagttga
4560 tcggcgcgag atttaatcgc cgcgacaatt tgcgacggcg cgtgcagggc
cagactggag 4620 gtggcaacgc caatcagcaa cgactgtttg cccgccagtt
gttgtgccac gcggttggga 4680 atgtaattca gctccgccat cgccgcttcc
actttttccc gcgttttcgc agaaacgtgg 4740 ctggcctggt tcaccacgcg
ggaaacggtc tgataagaga caccggcata ctctgcgaca 4800 tcgtataacg
ttactggttt cacattcacc accctgaatt gactctcttc cgggcgctat 4860
catgccatac cgcgaaaggt tttgcgccat tcgatggtgt ccgggatctc gacgctctcc
4920 cttatgcgac tcctgcatta ggaaattaat acgactcact ata 4963
<210> SEQ ID NO 11 <211> LENGTH: 5733 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: pACYC-PTrc vector <400>
SEQUENCE: 11 actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa
ttatgcagtg 60 ctgccataac catgagtgat aacactgcgg ccaacttact
tctgacaacg atcggaggac 120 cgaaggagct aaccgctttt ttgcacaaca
tgggggatca tgtaactcgc cttgatcgtt 180 gggaaccgga gctgaatgaa
gccataccaa acgacgagcg tgacaccacg atgcctgcag 240 caatggcaac
aacgttgcgc aaactattaa ctggcgaact acttactcta gcttcccggc 300
aacaattaat agactggatg gaggcggata aagttgcagg accacttctg cgctcggccc
360 ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtggg
tctcgcggta 420 tcattgcagc actggggcca gatggtaagc cctcccgtat
cgtagttatc tacacgacgg 480 ggagtcaggc aactatggat gaacgaaata
gacagatcgc tgagataggt gcctcactga 540 ttaagcattg gtaactgtca
gaccaagttt actcatatat actttagatt gatttaaaac 600 ttcattttta
atttaaaagg atctaggtga agatcctttt tgataatctc atgaccaaaa 660
tcccttaacg tgagttttcg ttccactgag cgtcagaccc cttaataaga tgatcttctt
720 gagatcgttt tggtctgcgc gtaatctctt gctctgaaaa cgaaaaaacc
gccttgcagg 780 gcggtttttc gaaggttctc tgagctacca actctttgaa
ccgaggtaac tggcttggag 840 gagcgcagtc accaaaactt gtcctttcag
tttagcctta accggcgcat gacttcaaga 900 ctaactcctc taaatcaatt
accagtggct gctgccagtg gtgcttttgc atgtctttcc 960 gggttggact
caagacgata gttaccggat aaggcgcagc ggtcggactg aacggggggt 1020
tcgtgcatac agtccagctt ggagcgaact gcctacccgg aactgagtgt caggcgtgga
1080 atgagacaaa cgcggccata acagcggaat gacaccggta aaccgaaagg
caggaacagg 1140 agagcgcacg agggagccgc cagggggaaa cgcctggtat
ctttatagtc ctgtcgggtt 1200 tcgccaccac tgatttgagc gtcagatttc
gtgatgcttg tcaggggggc ggagcctatg 1260 gaaaaacggc tttgccgcgg
ccctctcact tccctgttaa gtatcttcct ggcatcttcc 1320 aggaaatctc
cgccccgttc gtaagccatt tccgctcgcc gcagtcgaac gaccgagcgt 1380
agcgagtcag tgagcgagga agcggaatat atcctgtatc acatattctg ctgacgcacc
1440 ggtgcagcct tttttctcct gccacatgaa gcacttcact gacaccctca
tcagtgccaa 1500 catagtaagc cagtatacac tccgctagcg ctgaggtctg
cctcgtgaag aaggtgttgc 1560 tgactcatac caggcctgaa tcgccccatc
atccagccag aaagtgaggg agccacggtt 1620 gatgagagct ttgttgtagg
tggaccagtt ggtgattttg aacttttgct ttgccacgga 1680 acggtctgcg
ttgtcgggaa gatgcgtgat ctgatccttc aactcagcaa aagttcgatt 1740
tattcaacaa agccacgttg tgtctcaaaa tctctgatgt tacattgcac aagataaaaa
1800 tatatcatca tgaacaataa aactgtctgc ttacataaac agtaatacaa
ggggtgttat 1860 gagccatatt caacgggaaa cgtcttgctc gaggccgcga
ttaaattcca acatggatgc 1920 tgatttatat gggtataaat gggctcgcga
taatgtcggg caatcaggtg cgacaatcta 1980 tcgattgtat gggaagcccg
atgcgccaga gttgtttctg aaacatggca aaggtagcgt 2040 tgccaatgat
gttacagatg agatggtcag actaaactgg ctgacggaat ttatgcctct 2100
tccgaccatc aagcatttta tccgtactcc tgatgatgca tggttactca ccactgcgat
2160 ccccgggaaa acagcattcc aggtattaga agaatatcct gattcaggtg
aaaatattgt 2220 tgatgcgctg gcagtgttcc tgcgccggtt gcattcgatt
cctgtttgta attgtccttt 2280 taacagcgat cgcgtatttc gtctcgctca
ggcgcaatca cgaatgaata acggtttggt 2340 tgatgcgagt gattttgatg
acgagcgtaa tggctggcct gttgaacaag tctggaaaga 2400 aatgcataag
cttttgccat tctcaccgga ttcagtcgtc actcatggtg atttctcact 2460
tgataacctt atttttgacg aggggaaatt aataggttgt attgatgttg gacgagtcgg
2520 aatcgcagac cgataccagg atcttgccat cctatggaac tgcctcggtg
agttttctcc 2580 ttcattacag aaacggcttt ttcaaaaata tggtattgat
aatcctgata tgaataaatt 2640 gcagtttcat ttgatgctcg atgagttttt
ctaatcagaa ttggttaatt ggttgtaaca 2700 ctggcagagc attacgctga
cttgacggga cggcggcttt gttgaataaa tcgaactttt 2760 gctgagttga
aggatcagat cacgcatctt cccgacaacg cagaccgttc cgtggcaaag 2820
caaaagttca aaatcaccaa ctggtccacc tacaacaaag ctctcatcaa ccgtggctcc
2880 ctcactttct ggctggatga tggggcgatt caggcctggt atgagtcagc
aacaccttct 2940 tcacgaggca gacctcagcg ctcaaagatg caggggtaaa
agctaaccgc atctttaccg 3000 acaaggcatc cggcagttca acagatcggg
aagggctgga tttgctgagg atgaaggtgg 3060 aggaaggtga tgtcattctg
gtgaagaagc tcgaccgtct tggccgcgac accgccgaca 3120 tgatccaact
gataaaagag tttgatgctc agggtgtagc ggttcggttt attgacgacg 3180
ggatcagtac cgacggtgat atggggcaaa tggtggtcac catcctgtcg gctgtggcac
3240 aggctgaacg ccggaggatc ctagagcgca cgaatgaggg ccgacaggaa
gcaaagctga 3300 aaggaatcaa atttggccgc aggcgtaccg tggacaggaa
cgtcgtgctg acgcttcatc 3360 agaagggcac tggtgcaacg gaaattgctc
atcagctcag tattgcccgc tccacggttt 3420 ataaaattct tgaagacgaa
agggcctcgt gatacgccta tttttatagg ttaatgtcat 3480 gataataatg
gtttcttaga cgtcttaatt aatcaggaga gcgttcaccg acaaacaaca 3540
gataaaacga aaggcccagt ctttcgactg agcctttcgt tttatttgat gcctggcagt
3600 tccctactct cgcatgggga gaccccacac taccatcggc gctacggcgt
ttcacttctg 3660 agttcggcat ggggtcaggt gggaccaccg cgctactgcc
gccaggcaaa ttctgtttta 3720 tcagaccgct tctgcgttct gatttaatct
gtatcaggct gaaaatcttc tctcatccgc 3780 caaaacagcc aagctggaga
ccgtttaaac tcaatgatga tgatgatgat ggtcgacggc 3840 gctattcaga
tcctcttctg agatgagttt ttgttcgggc ccaagcttcg aattcccata 3900
tggtaccagc tgcagatctc gagctcggat ccatggttta ttcctcctta tttaatcgat
3960 acattaatat atacctcttt aatttttaat aataaagtta atcgataatt
ccggtcgagt 4020 gcccacacag attgtctgat aaattgttaa agagcagtgc
cgcttcgctt tttctcagcg 4080 gcgctgtttc ctgtgtgaaa ttgttatccg
ctcacaattc cacacattat acgagccgga 4140 tgattaattg tcaacagctc
atttcagaat atttgccaga accgttatga tgtcggcgca 4200 aaaaacatta
tccagaacgg gagtgcgcct tgagcgacac gaattatgca gtgatttacg 4260
acctgcacag ccataccaca gcttccgatg gctgcctgac gccagaagca ttggtgcacc
4320 gtgcagtcga tgataagctg tcaaaccaga tcaattcgcg ctaactcaca
ttaattgcgt 4380 tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg
ccagctgcat taatgaatcg 4440 gccaacgcgc ggggagaggc ggtttgcgta
ttgggcgcca gggtggtttt tcttttcacc 4500 agtgagacgg gcaacagctg
attgcccttc accgcctggc cctgagagag ttgcagcaag 4560 cggtccacgc
tggtttgccc cagcaggcga aaatcctgtt tgatggtggt tgacggcggg 4620
atataacatg agctgtcttc ggtatcgtcg tatcccacta ccgagatatc cgcaccaacg
4680 cgcagcccgg actcggtaat ggcgcgcatt gcgcccagcg ccatctgatc
gttggcaacc 4740 agcatcgcag tgggaacgat gccctcattc agcatttgca
tggtttgttg aaaaccggac 4800 atggcactcc agtcgccttc ccgttccgct
atcggctgaa tttgattgcg agtgagatat 4860 ttatgccagc cagccagacg
cagacgcgcc gagacagaac ttaatgggcc cgctaacagc 4920 gcgatttgct
ggtgacccaa tgcgaccaga tgctccacgc ccagtcgcgt accgtcttca 4980
tgggagaaaa taatactgtt gatgggtgtc tggtcagaga catcaagaaa taacgccgga
5040 acattagtgc aggcagcttc cacagcaatg gcatcctggt catccagcgg
atagttaatg 5100 atcagcccac tgacgcgttg cgcgagaaga ttgtgcaccg
ccgctttaca ggcttcgacg 5160 ccgcttcgtt ctaccatcga caccaccacg
ctggcaccca gttgatcggc gcgagattta 5220 atcgccgcga caatttgcga
cggcgcgtgc agggccagac tggaggtggc aacgccaatc 5280 agcaacgact
gtttgcccgc cagttgttgt gccacgcggt tgggaatgta attcagctcc 5340
gccatcgccg cttccacttt ttcccgcgtt ttcgcagaaa cgtggctggc ctggttcacc
5400 acgcgggaaa cggtctgata agagacaccg gcatactctg cgacatcgta
taacgttact 5460 ggtttcacat tcaccaccct gaattgactc tcttccgggc
gctatcatgc cataccgcga 5520 aaggttttgc accattcgat ggtgtcaacg
taaatgcatg ccgcttcgcc ttcgcgcgcg 5580 aattgatctg ctgcctcgcg
cgtttcggtg atgacggtga aaacctctga cacatgcagc 5640 tcccggagac
ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg 5700
gcgcgtcagc gggtgttggc ggggccggcc tcg 5733 <210> SEQ ID NO 12
<211> LENGTH: 60 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 12 ctctagaaat
aatttaactt taagtaggag auaggtaccc atggcggaca cgttattgat 60
<210> SEQ ID NO 13 <211> LENGTH: 58 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 13 cttcgaattc catttaaatt atttctagag tcattatgag tcatgattta
ctaaaggc 58 <210> SEQ ID NO 14 <211> LENGTH: 65
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 14 ctctagaaat aattttagtt aagtataaga
aggagatata ccatggtgaa gaaggtttgg 60 cttaa 65 <210> SEQ ID NO
15 <211> LENGTH: 51 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic primer <400> SEQUENCE: 15
cttcgaattc catttaaatt atttctagag ttatcaggct ttattgtcca c 51
<210> SEQ ID NO 16 <211> LENGTH: 42 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 16 ctctagaaat aatttagtta agtataagaa ggagatatac at 42
<210> SEQ ID NO 17 <211> LENGTH: 58 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 17 cttcgaattc catttaaatt atttctagag ttactattta attcctgcac
cgatttcc 58 <210> SEQ ID NO 18 <211> LENGTH: 28
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 18 atatgacgtc ggcatccgct tacagaca 28
<210> SEQ ID NO 19 <211> LENGTH: 32 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 19 aattcttaag tcaggagagc gttcaccgac aa 32 <210> SEQ
ID NO 20 <211> LENGTH: 36 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic primer <400> SEQUENCE: 20
caaccagcgg ccgcgcagac gatggtgcag gatatc 36 <210> SEQ ID NO 21
<211> LENGTH: 36 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 21 ccacacacta
gtcagatctg cagaattcag gctgtc 36 <210> SEQ ID NO 22
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 22 ggctggctgg
cataaatatc tc 22 <210> SEQ ID NO 23 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 23 catcgcgtgg gcgtattcg 19 <210>
SEQ ID NO 24 <400> SEQUENCE: 24 000 <210> SEQ ID NO 25
<400> SEQUENCE: 25 000 <210> SEQ ID NO 26 <400>
SEQUENCE: 26 000 <210> SEQ ID NO 27 <400> SEQUENCE: 27
000 <210> SEQ ID NO 28 <211> LENGTH: 4311 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: pLacZ plasmid <400>
SEQUENCE: 28 ctagtaacgg ccgccagtgt gctggaattc aggcagttca acctgttgat
agtacgtact 60 aagctctcat gtttcacgta ctaagctctc atgtttaacg
tactaagctc tcatgtttaa 120 cgaactaaac cctcatggct aacgtactaa
gctctcatgg ctaacgtact aagctctcat 180 gtttcacgta ctaagctctc
atgtttgaac aataaaatta atataaatca gcaacttaaa 240 tagcctctaa
ggttttaagt tttataagaa aaaaaagaat atataaggct tttaaagctt 300
ttaaggttta acggttgtgg acaacaagcc agggatgtaa cgcactgaga agcccttaga
360 gcctctcaaa gcaattttca gtgacacagg aacacttaac ggctgacagc
ctgaattctg 420 cagatctggc gtaatagcga agaggcccgc accgatcgcc
cttcccaaca gttgcgcagc 480 ctgaatggcg aatggcgctt tgcctggttt
ccggtaccag aagcggtgcc ggaaagctgg 540 ctggagtgcg atcttcctga
ggccgatact gtcgtcgtcc cctcaaactg gcagatgcac 600 ggttacgatg
cgcccatcta caccaacgta acctatccca ttacggtcaa tccgccgttt 660
gttcccacgg agaatccgac gggttgttac tcgctcacat ttaatgttga tgaaagctgg
720 ctacaggaag gccagacgcg aattattttt gatggcgtta actcggcgtt
tcatctgtgg 780 tgcaacgggc gctgggtcgg ttacggccag gacagtcgtt
tgccgtctga atttgacctg 840 agcgcatttt tacgcgccgg agaaaaccgc
ctcgcggtga tggtgctgcg ttggagtgac 900 ggcagttatc tggaagatca
ggatatgtgg cggatgagcg gcattttccg tgacgtctcg 960 ttgctgcata
aaccgactac acaaatcagc gatttccatg ttgccactcg ctttaatgat 1020
gatttcagcc gcgctgtact ggaggctgaa gttcagatgt gcggcgagtt gcgtgactac
1080 ctacgggtaa cagtttcttt atggcagggt gaaacgcagg tcgccagcgg
caccgcgcct 1140 ttcggcggtg aaattatcga tgagcgtggt ggttatgccg
atcgcgtcac actacgtctg 1200 aacgtcgaaa acccgaaact gtggagcgcc
gaaatcccga atctctatcg tgcggtggtt 1260 gaactgcaca ccgccgacgg
cacgctgatt gaagcagaag cctgcgatgt cggtttccgc 1320 gaggtgcgga
ttgaaaatgg tctgctgctg ctgaacggca agccgttgct gattcgaggc 1380
gttaaccgtc acgagcatca tcctctgcat ggtcaggtca tggatgagca gacgatggtg
1440 caggatatcc tgctgatgaa gcagaacaac tttaacgccg tgcgctgttc
gcattatccg 1500 aaccatccgc tgtggtacac gctgtgcgac cgctacggcc
tgtatgtggt ggatgaagcc 1560 aatattgaaa cccacggcat ggtgccaatg
aatcgtctga ccgatgatcc gcgctggcta 1620 ccggcgatga gcgaacgcgt
aacgcgaatg gtgcagcgcg atcgtaatca cccgagtgtg 1680 atcatctggt
cgctggggaa tgaatcaggc cacggcgcta atcacgacgc gctgtatcgc 1740
tggatcaaat ctgtcgatcc ttcccgcccg gtgcagtatg aaggcggcgg agccgacacc
1800 acggccaccg atattatttg cccgatgtac gcgcgcgtgg atgaagacca
gcccttcccg 1860 gctgtgccga aatggtccat caaaaaatgg ctttcgctac
ctggagagac gcgcccgctg 1920 atcctttgcg aatacgccca cgcgatgggt
aacagtcttg gcggtttcgc taaatactgg 1980 caggcgtttc gtcagtatcc
ccgtttacag ggcggcttcg tctgggactg ggtggatcag 2040 tcgctgatta
aatatgatga aaacggcaac ccgtggtcgg cttacggcgg tgattttggc 2100
gatacgccga acgatcgcca gttctgtatg aacggtctgg tctttgccga ccgcacgccg
2160 catccagcgc tgacggaagc aaaacaccag cagcagtttt tccagttccg
tttatccggg 2220 caaaccatcg aagtgaccag cgaatacctg ttccgtcata
gcgataacga gctcctgcac 2280 tggatggtgg cgctggatgg taagccgctg
gcaagcggtg aagtgcctct ggatgtcgct 2340 ccacaaggta aacagttgat
tgaactgcct gaactaccgc agccggagag cgccgggcaa 2400 ctctggctca
cagtacgcgt agtgcaaccg aacgcgaccg catggtcaga agccgggcac 2460
atcagcgcct ggcagcagtg gcgtctggcg gaaaacctca gtgtgacgct ccccgccgcg
2520 tcccacgcca tcccgcatct gaccaccagc gaaatggatt tttgcatcga
gctgggtaat 2580 aagcgttggc aatttaaccg ccagtcaggc tttctttcac
agatgtggat tggcgataaa 2640 aaacaactgc tgacgccgct gcgcgatcag
ttcacccgtg cacgtctgct gtcagataaa 2700 gtctcccgtg aactttaccc
ggtggtgcat atcggggatg aaagctggcg catgatgacc 2760 accgatatgg
ccagtgtgcc ggtctccgtt atcggggaag aagtggctga tctcagccac 2820
cgcgaaaatg acatcaaaaa cgccattaac ctgatgttct ggggaatata aatgtcaggc
2880 atgagattat caaaaaggat cttcacctag atccttttca cgtagaaagc
cagtccgcag 2940 aaacggtgct gaccccggat gaatgtcagc tactgggcta
tctggacaag ggaaaacgca 3000 agcgcaaaga gaaagcaggt agcttgcagt
gggcttacat ggcgatagct agactgggcg 3060 gttttatgga cagcaagcga
accggaattg ccagctgggg cgccctctgg taaggttggg 3120 aagccctgca
aagtaaactg gatggctttc tcgccgccaa ggatctgatg gcgcagggga 3180
tcaagctctg atcaagagac aggatgagga tcgtttcgca tgattgaaca agatggattg
3240 cacgcaggtt ctccggccgc ttgggtggag aggctattcg gctatgactg
ggcacaacag 3300 acaatcggct gctctgatgc cgccgtgttc cggctgtcag
cgcaggggcg cccggttctt 3360 tttgtcaaga ccgacctgtc cggtgccctg
aatgaactgc aagacgaggc agcgcggcta 3420 tcgtggctgg ccacgacggg
cgttccttgc gcagctgtgc tcgacgttgt cactgaagcg 3480 ggaagggact
ggctgctatt gggcgaagtg ccggggcagg atctcctgtc atctcacctt 3540
gctcctgccg agaaagtatc catcatggct gatgcaatgc ggcggctgca tacgcttgat
3600 ccggctacct gcccattcga ccaccaagcg aaacatcgca tcgagcgagc
acgtactcgg 3660 atggaagccg gtcttgtcga tcaggatgat ctggacgaag
agcatcaggg gctcgcgcca 3720 gccgaactgt tcgccaggct caaggcgagc
atgcccgacg gcgaggatct cgtcgtgacc 3780 catggcgatg cctgcttgcc
gaatatcatg gtggaaaatg gccgcttttc tggattcatc 3840 gactgtggcc
ggctgggtgt ggcggaccgc tatcaggaca tagcgttggc tacccgtgat 3900
attgctgaag agcttggcgg cgaatgggct gaccgcttcc tcgtgcttta cggtatcgcc
3960 gctcccgatt cgcagcgcat cgccttctat cgccttcttg acgagttctt
ctgaattatt 4020 aacgcttaca atttcctgat gcggtatttt ctccttacgc
atctgtgcgg tatttcacac 4080 cgcatacagg tggcactttt cggggaaatg
tgcgcggaac ccctatttgt ttatttttct 4140 aaatacattc aaatatgtat
ccgctcatga gacaataacc ctgataaatg cttcaataat 4200 agcacgtgag
gagggccacc atggccaagt tgaccagtgc cgttccggtg ctcaccgcgc 4260
gcgacgtcgc cggagcggtc gagttctgga ccgaccggct cgggttctcc c 4311
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 28 <210>
SEQ ID NO 1 <211> LENGTH: 70 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 1 aaaaacagca acaatgtgag ctttgttgta attatattgt aaacatattg
attccgggga 60 tccgtcgacc 70 <210> SEQ ID NO 2 <211>
LENGTH: 68 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic primer <400> SEQUENCE: 2 aaacggagcc tttcggctcc
gttattcatt tacgcggctt caactttcct gtaggctgga 60 gctgcttc 68
<210> SEQ ID NO 3 <211> LENGTH: 23 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 3 cgggcaggtg ctatgaccag gac 23 <210> SEQ ID NO 4
<211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 4 cgcggcgttg
accggcagcc tgg 23 <210> SEQ ID NO 5 <211> LENGTH: 70
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 5 atcattctcg tttacgttat cattcacttt
acatcagaga tataccaatg attccgggga 60 tccgtcgacc 70 <210> SEQ
ID NO 6 <211> LENGTH: 69 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic primer <400> SEQUENCE: 6
gcacggaaat ccgtgcccca aaagagaaat tagaaacgga aggttgcggt tgtaggctgg
60 agctgcttc 69 <210> SEQ ID NO 7 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 7 caacagcaac ctgctcagca a 21
<210> SEQ ID NO 8 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 8 aagctggagc agcaaagcgt t 21 <210> SEQ ID NO 9
<211> LENGTH: 6700 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: pHZ1.61 plasmid <400> SEQUENCE: 9
ggggaattgt gagcggataa caattcccct gtagaaataa ttttgtttaa ctttaataag
60 gagatatacc atggtgaaga aggtttggct taaccgttat cccgcggacg
ttccgacgga 120 gatcaaccct gaccgttatc aatctctggt agatatgttt
gagcagtcgg tcgcgcgcta 180 cgccgatcaa cctgcgtttg tgaatatggg
ggaggtaatg accttccgca agctggaaga 240 acgcagtcgc gcgtttgccg
cttatttgca acaagggttg gggctgaaga aaggcgatcg 300 cgttgcgttg
atgatgccta atttattgca atatccggtg gcgctgtttg gcattttgcg 360
tgccgggatg atcgtcgtaa acgttaaccc gttgtatacc ccgcgtgagc ttgagcatca
420 gcttaacgat agcggcgcat cggcgattgt tatcgtgtct aactttgctc
acacactgga 480 aaaagtggtt gataaaaccg ccgttcagca cgtaattctg
acccgtatgg gcgatcagct 540 atctacggca aaaggcacgg tagtcaattt
cgttgttaaa tacatcaagc gtttggtgcc 600 gaaataccat ctgccagatg
ccatttcatt tcgtagcgca ctgcataacg gctaccggat 660 gcagtacgtc
aaacccgaac tggtgccgga agatttagct tttctgcaat acaccggcgg 720
caccactggt gtggcgaaag gcgcgatgct gactcaccgc aatatgctgg cgaacctgga
780 acaggttaac gcgacctatg gtccgctgtt gcatccgggc aaagagctgg
tggtgacggc 840 gctgccgctg tatcacattt ttgccctgac cattaactgc
ctgctgttta tcgaactggg 900 tgggcagaac ctgcttatca ctaacccgcg
cgatattcca gggttggtaa aagagttagc 960 gaaatatccg tttaccgcta
tcacgggcgt taacaccttg ttcaatgcgt tgctgaacaa 1020 taaagagttc
cagcagctgg atttctccag tctgcatctt tccgcaggcg gagggatgcc 1080
agtgcagcaa gtggtggcag agcgttgggt gaaactgaca ggacagtatc tgctggaagg
1140 ctatggcctt accgagtgtg cgccgctggt cagcgttaac ccatatgata
ttgattatca 1200 tagtggtagc atcggtttgc cggtgccgtc gacggaagcc
aaactggtgg atgatgatga 1260 taatgaagta ccaccgggtc aaccgggtga
gctttgtgtc aaaggaccgc aggtgatgct 1320 gggttactgg cagcgtccgg
atgctacaga tgagatcatc aaaaatggct ggttacacac 1380 cggcgacatc
gcggtgatgg atgaagaagg gttcctgcgc attgtcgatc gtaaaaaaga 1440
catgattctg gtttccggtt ttaacgtcta tcccaacgag attgaagatg tcgtcatgca
1500 gcatcctggc gtacaggaag tcgcggctgt tggcgtacct tccggctcca
gtggtgaagc 1560 ggtgaaaatc ttcgtagtga aaaaagatcc atcgcttacc
gaagagtcac tggtgacctt 1620 ttgccgccgt cagctcacgg gctacaaagt
accgaagctg gtggagtttc gtgatgagtt 1680 accgaaatct aacgtcggaa
aaattttgcg acgagaatta cgtgacgaag cgcgcggcaa 1740 agtggacaat
aaagcctgaa agcttgcggc cgcataatgc ttaagtcgaa cagaaagtaa 1800
tcgtattgta cacggccgca taatcgaaat taatacgact cactataggg gaattgtgag
1860 cggataacaa ttccccatct tagtatatta gttaagtata agaaggagat
atacatatgc 1920 gcccattaca tccgattgat tttatattcc tgtcactaga
aaaaagacaa cagcctatgc 1980 atgtaggtgg tttatttttg tttcagattc
ctgataacgc cccagacacc tttattcaag 2040 atctggtgaa tgatatccgg
atatcaaaat caatccctgt tccaccattc aacaataaac 2100 tgaatgggct
tttttgggat gaagatgaag agtttgattt agatcatcat tttcgtcata 2160
ttgcactgcc tcatcctggt cgtattcgtg aattgcttat ttatatttca caagagcaca
2220 gtacgctgct agatcgggca aagcccttgt ggacctgcaa tattattgaa
ggaattgaag 2280 gcaatcgttt tgccatgtac ttcaaaattc accatgcgat
ggtcgatggc gttgctggta 2340 tgcggttaat tgaaaaatca ctctcccatg
atgtaacaga aaaaagtatc gtgccacctt 2400 ggtgtgttga gggaaaacgt
gcaaagcgct taagagaacc taaaacaggt aaaattaaga 2460 aaatcatgtc
tggtattaag agtcagcttc aggcgacacc cacagtcatt caagagcttt 2520
ctcagacagt atttaaagat attggacgta atcctgatca tgtttcaagc tttcaggcgc
2580 cttgttctat tttgaatcag cgtgtgagct catcgcgacg ttttgcagca
cagtcttttg 2640 acctagatcg ttttcgtaat attgccaaat cgttgaatgt
gaccattaat gatgttgtac 2700 tagcggtatg ttctggtgca ttacgtgcgt
atttgatgag tcataatagt ttgccttcaa 2760 aaccattaat tgccatggtt
ccagcctcta ttcgcaatga cgattcagat gtcagcaacc 2820 gtattacgat
gattctggca aatttggcaa cccacaaaga tgatccttta caacgtcttg 2880
aaattatccg ccgtagtgtt caaaactcaa agcaacgctt caaacgtatg accagcgatc
2940 agattctaaa ttatagtgct gtcgtatatg gccctgcagg actcaacata
atttctggca 3000 tgatgccaaa acgccaagcc ttcaatctgg ttatttccaa
tgtgcctggc ccaagagagc 3060 cactttactg gaatggtgcc aaacttgatg
cactctaccc agcttcaatt gtattagacg 3120 gtcaagcatt gaatattaca
atgaccagtt atttagataa acttgaagtt ggtttgattg 3180 catgccgtaa
tgcattgcca agaatgcaga atttactgac acatttagaa gaagaaattc 3240
aactatttga aggcgtaatt gcaaagcagg aagatattaa aacagccaat taaaaacaat
3300 aaacttgatt ttttaattta tcagataaaa ctaaagggct aaattagccc
tcctaggctg 3360 ctgccaccgc tgagcaataa ctagcataac cccttggggc
ctctaaacgg gtcttgaggg 3420 gttttttgct gaaacctcag gcatttgaga
agcacacggt cacactgctt ccggtagtca 3480 ataaaccggt aaaccagcaa
tagacataag cggctattta acgaccctgc cctgaaccga 3540 cgaccgggtc
atcgtggccg gatcttgcgg cccctcggct tgaacgaatt gttagacatt 3600
atttgccgac taccttggtg atctcgcctt tcacgtagtg gacaaattct tccaactgat
3660 ctgcgcgcga ggccaagcga tcttcttctt gtccaagata agcctgtcta
gcttcaagta 3720 tgacgggctg atactgggcc ggcaggcgct ccattgccca
gtcggcagcg acatccttcg 3780 gcgcgatttt gccggttact gcgctgtacc
aaatgcggga caacgtaagc actacatttc 3840 gctcatcgcc agcccagtcg
ggcggcgagt tccatagcgt taaggtttca tttagcgcct 3900 caaatagatc
ctgttcagga accggatcaa agagttcctc cgccgctgga cctaccaagg 3960
caacgctatg ttctcttgct tttgtcagca agatagccag atcaatgtcg atcgtggctg
4020 gctcgaagat acctgcaaga atgtcattgc gctgccattc tccaaattgc
agttcgcgct 4080 tagctggata acgccacgga atgatgtcgt cgtgcacaac
aatggtgact tctacagcgc 4140 ggagaatctc gctctctcca ggggaagccg
aagtttccaa aaggtcgttg atcaaagctc 4200 gccgcgttgt ttcatcaagc
cttacggtca ccgtaaccag caaatcaata tcactgtgtg 4260 gcttcaggcc
gccatccact gcggagccgt acaaatgtac ggccagcaac gtcggttcga 4320
gatggcgctc gatgacgcca actacctctg atagttgagt cgatacttcg gcgatcaccg
4380 cttccctcat actcttcctt tttcaatatt attgaagcat ttatcagggt
tattgtctca 4440 tgagcggata catatttgaa tgtatttaga aaaataaaca
aatagctagc tcactcggtc 4500 gctacgctcc gggcgtgaga ctgcggcggg
cgctgcggac acatacaaag ttacccacag 4560 attccgtgga taagcagggg
actaacatgt gaggcaaaac agcagggccg cgccggtggc 4620 gtttttccat
aggctccgcc ctcctgccag agttcacata aacagacgct tttccggtgc 4680
atctgtggga gccgtgaggc tcaaccatga atctgacagt acgggcgaaa cccgacagga
4740 cttaaagatc cccaccgttt ccggcgggtc gctccctctt gcgctctcct
gttccgaccc 4800 tgccgtttac cggatacctg ttccgccttt ctcccttacg
ggaagtgtgg cgctttctca 4860 tagctcacac actggtatct cggctcggtg
taggtcgttc gctccaagct gggctgtaag 4920 caagaactcc ccgttcagcc
cgactgctgc gccttatccg gtaactgttc acttgagtcc 4980 aacccggaaa
agcacggtaa aacgccactg gcagcagcca ttggtaactg ggagttcgca 5040
gaggatttgt ttagctaaac acgcggttgc tcttgaagtg tgcgccaaag tccggctaca
5100 ctggaaggac agatttggtt gctgtgctct gcgaaagcca gttaccacgg
ttaagcagtt 5160 ccccaactga cttaaccttc gatcaaacca cctccccagg
tggttttttc gtttacaggg 5220 caaaagatta cgcgcagaaa aaaaggatct
caagaagatc ctttgatctt ttctactgaa 5280 ccgctctaga tttcagtgca
atttatctct tcaaatgtag cacctgaagt cagccccata 5340 cgatataagt
tgtaattctc atgttagtca tgccccgcgc ccaccggaag gagctgactg 5400
ggttgaaggc tctcaagggc atcggtcgag atcccggtgc ctaatgagtg agctaactta
5460 cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg
tgccagctgc 5520 attaatgaat cggccaacgc gcggggagag gcggtttgcg
tattgggcgc cagggtggtt 5580 tttcttttca ccagtgagac gggcaacagc
tgattgccct tcaccgcctg gccctgagag 5640 agttgcagca agcggtccac
gctggtttgc cccagcaggc gaaaatcctg tttgatggtg 5700 gttaacggcg
ggatataaca tgagctgtct tcggtatcgt cgtatcccac taccgagatg 5760
tccgcaccaa cgcgcagccc ggactcggta atggcgcgca ttgcgcccag cgccatctga
5820 tcgttggcaa ccagcatcgc agtgggaacg atgccctcat tcagcatttg
catggtttgt 5880 tgaaaaccgg acatggcact ccagtcgcct tcccgttccg
ctatcggctg aatttgattg 5940 cgagtgagat atttatgcca gccagccaga
cgcagacgcg ccgagacaga acttaatggg 6000 cccgctaaca gcgcgatttg
ctggtgaccc aatgcgacca gatgctccac gcccagtcgc 6060 gtaccgtctt
catgggagaa aataatactg ttgatgggtg tctggtcaga gacatcaaga 6120
aataacgccg gaacattagt gcaggcagct tccacagcaa tggcatcctg gtcatccagc
6180 ggatagttaa tgatcagccc actgacgcgt tgcgcgagaa gattgtgcac
cgccgcttta 6240 caggcttcga cgccgcttcg ttctaccatc gacaccacca
cgctggcacc cagttgatcg 6300 gcgcgagatt taatcgccgc gacaatttgc
gacggcgcgt gcagggccag actggaggtg 6360 gcaacgccaa tcagcaacga
ctgtttgccc gccagttgtt gtgccacgcg gttgggaatg 6420 taattcagct
ccgccatcgc cgcttccact ttttcccgcg ttttcgcaga aacgtggctg 6480
gcctggttca ccacgcggga aacggtctga taagagacac cggcatactc tgcgacatcg
6540 tataacgtta ctggtttcac attcaccacc ctgaattgac tctcttccgg
gcgctatcat 6600 gccataccgc gaaaggtttt gcgccattcg atggtgtccg
ggatctcgac gctctccctt 6660 atgcgactcc tgcattagga aattaatacg
actcactata 6700 <210> SEQ ID NO 10 <211> LENGTH: 4963
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: pHZ1.97-atfA1
plasmid <400> SEQUENCE: 10 ggggaattgt gagcggataa caattcccct
gtagaaataa ttttgtttaa ctttaataag 60 gagatatacc atgggcagca
gccatcacca tcatcaccac agccaggatc cgaattcgag 120 ctcggcgcgc
ctgcaggtcg acaagcttgc ggccgcataa tgcttaagtc gaacagaaag 180
taatcgtatt gtacacggcc gcataatcga aattaatacg actcactata ggggaattgt
240 gagcggataa caattcccca tcttagtata ttagttaagt ataagaagga
gatatacata 300 tgaaagcgct tagcccagtg gatcaactgt tcctgtggct
ggaaaaacga cagcaaccca 360 tgcacgtagg cggtttgcag ctgttttcct
tcccggaagg tgccggcccc aagtatgtga 420 gtgagctggc ccagcaaatg
cgggattact gccacccagt ggcgccattc aaccagcgcc 480 tgacccgtcg
actcggccag tattactgga ctagagacaa acagttcgat atcgaccacc 540
acttccgcca cgaagcactc cccaaacccg gtcgcattcg cgaactgctt tctttggtct
600 ccgccgaaca ttccaacctg ctggaccggg agcgccccat gtgggaagcc
catttgatcg 660 aagggatccg cggtcgccag ttcgctctct attataagat
ccaccattcg gtgatggatg 720 gcatatccgc catgcgtatc gcctccaaaa
cgctttccac tgaccccagt gaacgtgaaa 780 tggctccggc ttgggcgttc
aacaccaaaa aacgctcccg ctcactgccc agcaacccgg 840 ttgacatggc
ctccagcatg gcgcgcctaa ccgcgagcat aagcaaacaa gctgccacag 900
tgcccggtct cgcgcgggag gtttacaaag tcacccaaaa agccaaaaaa gatgaaaact
960 atgtgtctat ttttcaggct cccgacacga ttctgaataa taccatcacc
ggttcacgcc 1020 gctttgccgc ccagagcttt ccattaccgc gcctgaaagt
tatcgccaag gcctataact 1080 gcaccattaa caccgtggtg ctctccatgt
gtggccacgc tctgcgcgaa tacttgatta 1140 gccaacacgc gctgcccgat
gagccactga ttgcaatggt gcccatgagc ctgcggcagg 1200 acgacagcac
tggcggcaac cagatcggta tgatcttggc taacctgggc acccacatct 1260
gtgatccagc taatcgcctg cgcgtcatcc acgattccgt cgaggaagcc aaatcccgct
1320 tctcgcagat gagcccggaa gaaattctca atttcaccgc cctcactatg
gctcccaccg 1380 gcttgaactt actgaccggc ctagcgccaa aatggcgggc
cttcaacgtg gtgatttcca 1440 acatacccgg gccgaaagag ccgctgtact
ggaatggtgc acagctgcaa ggagtgtatc 1500 cagtatccat tgccttggat
cgcatcgccc taaatatcac cctcaccagt tatgtagacc 1560 agatggaatt
tgggcttatc gcctgccgcc gtactctgcc ttccatgcag cgactactgg 1620
attacctgga acagtccatc cgcgaattgg aaatcggtgc aggaattaaa tagtaaccta
1680 ggctgctgcc accgctgagc aataactagc ataacccctt ggggcctcta
aacgggtctt 1740 gaggggtttt ttgctgaaac ctcaggcatt tgagaagcac
acggtcacac tgcttccggt 1800 agtcaataaa ccggtaaacc agcaatagac
ataagcggct atttaacgac cctgccctga 1860 accgacgaca agctgacgac
cgggtctccg caagtggcac ttttcgggga aatgtgcgcg 1920 gaacccctat
ttgtttattt ttctaaatac attcaaatat gtatccgctc atgaattaat 1980
tcttagaaaa actcatcgag catcaaatga aactgcaatt tattcatatc aggattatca
2040 ataccatatt tttgaaaaag ccgtttctgt aatgaaggag aaaactcacc
gaggcagttc 2100 cataggatgg caagatcctg gtatcggtct gcgattccga
ctcgtccaac atcaatacaa 2160 cctattaatt tcccctcgtc aaaaataagg
ttatcaagtg agaaatcacc atgagtgacg 2220 actgaatccg gtgagaatgg
caaaagttta tgcatttctt tccagacttg ttcaacaggc 2280 cagccattac
gctcgtcatc aaaatcactc gcatcaacca aaccgttatt cattcgtgat 2340
tgcgcctgag cgagacgaaa tacgcggtcg ctgttaaaag gacaattaca aacaggaatc
2400 gaatgcaacc ggcgcaggaa cactgccagc gcatcaacaa tattttcacc
tgaatcagga 2460 tattcttcta atacctggaa tgctgttttc ccggggatcg
cagtggtgag taaccatgca 2520 tcatcaggag tacggataaa atgcttgatg
gtcggaagag gcataaattc cgtcagccag 2580 tttagtctga ccatctcatc
tgtaacatca ttggcaacgc tacctttgcc atgtttcaga 2640 aacaactctg
gcgcatcggg cttcccatac aatcgataga ttgtcgcacc tgattgcccg 2700
acattatcgc gagcccattt atacccatat aaatcagcat ccatgttgga atttaatcgc
2760 ggcctagagc aagacgtttc ccgttgaata tggctcatac tcttcctttt
tcaatattat 2820 tgaagcattt atcagggtta ttgtctcatg agcggataca
tatttgaatg tatttagaaa 2880 aataaacaaa taggcatgct agcgcagaaa
cgtcctagaa gatgccagga ggatacttag 2940 cagagagaca ataaggccgg
agcgaagccg tttttccata ggctccgccc ccctgacgaa 3000 catcacgaaa
tctgacgctc aaatcagtgg tggcgaaacc cgacaggact ataaagatac 3060
caggcgtttc cccctgatgg ctccctcttg cgctctcctg ttcccgtcct gcggcgtccg
3120 tgttgtggtg gaggctttac ccaaatcacc acgtcccgtt ccgtgtagac
agttcgctcc 3180 aagctgggct gtgtgcaaga accccccgtt cagcccgact
gctgcgcctt atccggtaac 3240 tatcatcttg agtccaaccc ggaaagacac
gacaaaacgc cactggcagc agccattggt 3300 aactgagaat tagtggattt
agatatcgag agtcttgaag tggtggccta acagaggcta 3360 cactgaaagg
acagtatttg gtatctgcgc tccactaaag ccagttacca ggttaagcag 3420
ttccccaact gacttaacct tcgatcaaac cgcctcccca ggcggttttt tcgtttacag
3480 agcaggagat tacgacgatc gtaaaaggat ctcaagaaga tcctttacgg
attcccgaca 3540 ccatcactct agatttcagt gcaatttatc tcttcaaatg
tagcacctga agtcagcccc 3600 atacgatata agttgtaatt ctcatgttag
tcatgccccg cgcccaccgg aaggagctga 3660 ctgggttgaa ggctctcaag
ggcatcggtc gagatcccgg tgcctaatga gtgagctaac 3720 ttacattaat
tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg tcgtgccagc 3780
tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg cgccagggtg
3840 gtttttcttt tcaccagtga gacgggcaac agctgattgc ccttcaccgc
ctggccctga 3900 gagagttgca gcaagcggtc cacgctggtt tgccccagca
ggcgaaaatc ctgtttgatg 3960 gtggttaacg gcgggatata acatgagctg
tcttcggtat cgtcgtatcc cactaccgag 4020 atgtccgcac caacgcgcag
cccggactcg gtaatggcgc gcattgcgcc cagcgccatc 4080 tgatcgttgg
caaccagcat cgcagtggga acgatgccct cattcagcat ttgcatggtt 4140
tgttgaaaac cggacatggc actccagtcg ccttcccgtt ccgctatcgg ctgaatttga
4200 ttgcgagtga gatatttatg ccagccagcc agacgcagac gcgccgagac
agaacttaat 4260 gggcccgcta acagcgcgat ttgctggtga cccaatgcga
ccagatgctc cacgcccagt 4320 cgcgtaccgt cttcatggga gaaaataata
ctgttgatgg gtgtctggtc agagacatca 4380 agaaataacg ccggaacatt
agtgcaggca gcttccacag caatggcatc ctggtcatcc 4440
agcggatagt taatgatcag cccactgacg cgttgcgcga gaagattgtg caccgccgct
4500 ttacaggctt cgacgccgct tcgttctacc atcgacacca ccacgctggc
acccagttga 4560 tcggcgcgag atttaatcgc cgcgacaatt tgcgacggcg
cgtgcagggc cagactggag 4620 gtggcaacgc caatcagcaa cgactgtttg
cccgccagtt gttgtgccac gcggttggga 4680 atgtaattca gctccgccat
cgccgcttcc actttttccc gcgttttcgc agaaacgtgg 4740 ctggcctggt
tcaccacgcg ggaaacggtc tgataagaga caccggcata ctctgcgaca 4800
tcgtataacg ttactggttt cacattcacc accctgaatt gactctcttc cgggcgctat
4860 catgccatac cgcgaaaggt tttgcgccat tcgatggtgt ccgggatctc
gacgctctcc 4920 cttatgcgac tcctgcatta ggaaattaat acgactcact ata
4963 <210> SEQ ID NO 11 <211> LENGTH: 5733 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: pACYC-PTrc vector
<400> SEQUENCE: 11 actcaccagt cacagaaaag catcttacgg
atggcatgac agtaagagaa ttatgcagtg 60 ctgccataac catgagtgat
aacactgcgg ccaacttact tctgacaacg atcggaggac 120 cgaaggagct
aaccgctttt ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt 180
gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg atgcctgcag
240 caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta
gcttcccggc 300 aacaattaat agactggatg gaggcggata aagttgcagg
accacttctg cgctcggccc 360 ttccggctgg ctggtttatt gctgataaat
ctggagccgg tgagcgtggg tctcgcggta 420 tcattgcagc actggggcca
gatggtaagc cctcccgtat cgtagttatc tacacgacgg 480 ggagtcaggc
aactatggat gaacgaaata gacagatcgc tgagataggt gcctcactga 540
ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt gatttaaaac
600 ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc
atgaccaaaa 660 tcccttaacg tgagttttcg ttccactgag cgtcagaccc
cttaataaga tgatcttctt 720 gagatcgttt tggtctgcgc gtaatctctt
gctctgaaaa cgaaaaaacc gccttgcagg 780 gcggtttttc gaaggttctc
tgagctacca actctttgaa ccgaggtaac tggcttggag 840 gagcgcagtc
accaaaactt gtcctttcag tttagcctta accggcgcat gacttcaaga 900
ctaactcctc taaatcaatt accagtggct gctgccagtg gtgcttttgc atgtctttcc
960 gggttggact caagacgata gttaccggat aaggcgcagc ggtcggactg
aacggggggt 1020 tcgtgcatac agtccagctt ggagcgaact gcctacccgg
aactgagtgt caggcgtgga 1080 atgagacaaa cgcggccata acagcggaat
gacaccggta aaccgaaagg caggaacagg 1140 agagcgcacg agggagccgc
cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt 1200 tcgccaccac
tgatttgagc gtcagatttc gtgatgcttg tcaggggggc ggagcctatg 1260
gaaaaacggc tttgccgcgg ccctctcact tccctgttaa gtatcttcct ggcatcttcc
1320 aggaaatctc cgccccgttc gtaagccatt tccgctcgcc gcagtcgaac
gaccgagcgt 1380 agcgagtcag tgagcgagga agcggaatat atcctgtatc
acatattctg ctgacgcacc 1440 ggtgcagcct tttttctcct gccacatgaa
gcacttcact gacaccctca tcagtgccaa 1500 catagtaagc cagtatacac
tccgctagcg ctgaggtctg cctcgtgaag aaggtgttgc 1560 tgactcatac
caggcctgaa tcgccccatc atccagccag aaagtgaggg agccacggtt 1620
gatgagagct ttgttgtagg tggaccagtt ggtgattttg aacttttgct ttgccacgga
1680 acggtctgcg ttgtcgggaa gatgcgtgat ctgatccttc aactcagcaa
aagttcgatt 1740 tattcaacaa agccacgttg tgtctcaaaa tctctgatgt
tacattgcac aagataaaaa 1800 tatatcatca tgaacaataa aactgtctgc
ttacataaac agtaatacaa ggggtgttat 1860 gagccatatt caacgggaaa
cgtcttgctc gaggccgcga ttaaattcca acatggatgc 1920 tgatttatat
gggtataaat gggctcgcga taatgtcggg caatcaggtg cgacaatcta 1980
tcgattgtat gggaagcccg atgcgccaga gttgtttctg aaacatggca aaggtagcgt
2040 tgccaatgat gttacagatg agatggtcag actaaactgg ctgacggaat
ttatgcctct 2100 tccgaccatc aagcatttta tccgtactcc tgatgatgca
tggttactca ccactgcgat 2160 ccccgggaaa acagcattcc aggtattaga
agaatatcct gattcaggtg aaaatattgt 2220 tgatgcgctg gcagtgttcc
tgcgccggtt gcattcgatt cctgtttgta attgtccttt 2280 taacagcgat
cgcgtatttc gtctcgctca ggcgcaatca cgaatgaata acggtttggt 2340
tgatgcgagt gattttgatg acgagcgtaa tggctggcct gttgaacaag tctggaaaga
2400 aatgcataag cttttgccat tctcaccgga ttcagtcgtc actcatggtg
atttctcact 2460 tgataacctt atttttgacg aggggaaatt aataggttgt
attgatgttg gacgagtcgg 2520 aatcgcagac cgataccagg atcttgccat
cctatggaac tgcctcggtg agttttctcc 2580 ttcattacag aaacggcttt
ttcaaaaata tggtattgat aatcctgata tgaataaatt 2640 gcagtttcat
ttgatgctcg atgagttttt ctaatcagaa ttggttaatt ggttgtaaca 2700
ctggcagagc attacgctga cttgacggga cggcggcttt gttgaataaa tcgaactttt
2760 gctgagttga aggatcagat cacgcatctt cccgacaacg cagaccgttc
cgtggcaaag 2820 caaaagttca aaatcaccaa ctggtccacc tacaacaaag
ctctcatcaa ccgtggctcc 2880 ctcactttct ggctggatga tggggcgatt
caggcctggt atgagtcagc aacaccttct 2940 tcacgaggca gacctcagcg
ctcaaagatg caggggtaaa agctaaccgc atctttaccg 3000 acaaggcatc
cggcagttca acagatcggg aagggctgga tttgctgagg atgaaggtgg 3060
aggaaggtga tgtcattctg gtgaagaagc tcgaccgtct tggccgcgac accgccgaca
3120 tgatccaact gataaaagag tttgatgctc agggtgtagc ggttcggttt
attgacgacg 3180 ggatcagtac cgacggtgat atggggcaaa tggtggtcac
catcctgtcg gctgtggcac 3240 aggctgaacg ccggaggatc ctagagcgca
cgaatgaggg ccgacaggaa gcaaagctga 3300 aaggaatcaa atttggccgc
aggcgtaccg tggacaggaa cgtcgtgctg acgcttcatc 3360 agaagggcac
tggtgcaacg gaaattgctc atcagctcag tattgcccgc tccacggttt 3420
ataaaattct tgaagacgaa agggcctcgt gatacgccta tttttatagg ttaatgtcat
3480 gataataatg gtttcttaga cgtcttaatt aatcaggaga gcgttcaccg
acaaacaaca 3540 gataaaacga aaggcccagt ctttcgactg agcctttcgt
tttatttgat gcctggcagt 3600 tccctactct cgcatgggga gaccccacac
taccatcggc gctacggcgt ttcacttctg 3660 agttcggcat ggggtcaggt
gggaccaccg cgctactgcc gccaggcaaa ttctgtttta 3720 tcagaccgct
tctgcgttct gatttaatct gtatcaggct gaaaatcttc tctcatccgc 3780
caaaacagcc aagctggaga ccgtttaaac tcaatgatga tgatgatgat ggtcgacggc
3840 gctattcaga tcctcttctg agatgagttt ttgttcgggc ccaagcttcg
aattcccata 3900 tggtaccagc tgcagatctc gagctcggat ccatggttta
ttcctcctta tttaatcgat 3960 acattaatat atacctcttt aatttttaat
aataaagtta atcgataatt ccggtcgagt 4020 gcccacacag attgtctgat
aaattgttaa agagcagtgc cgcttcgctt tttctcagcg 4080 gcgctgtttc
ctgtgtgaaa ttgttatccg ctcacaattc cacacattat acgagccgga 4140
tgattaattg tcaacagctc atttcagaat atttgccaga accgttatga tgtcggcgca
4200 aaaaacatta tccagaacgg gagtgcgcct tgagcgacac gaattatgca
gtgatttacg 4260 acctgcacag ccataccaca gcttccgatg gctgcctgac
gccagaagca ttggtgcacc 4320 gtgcagtcga tgataagctg tcaaaccaga
tcaattcgcg ctaactcaca ttaattgcgt 4380 tgcgctcact gcccgctttc
cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg 4440 gccaacgcgc
ggggagaggc ggtttgcgta ttgggcgcca gggtggtttt tcttttcacc 4500
agtgagacgg gcaacagctg attgcccttc accgcctggc cctgagagag ttgcagcaag
4560 cggtccacgc tggtttgccc cagcaggcga aaatcctgtt tgatggtggt
tgacggcggg 4620 atataacatg agctgtcttc ggtatcgtcg tatcccacta
ccgagatatc cgcaccaacg 4680 cgcagcccgg actcggtaat ggcgcgcatt
gcgcccagcg ccatctgatc gttggcaacc 4740 agcatcgcag tgggaacgat
gccctcattc agcatttgca tggtttgttg aaaaccggac 4800 atggcactcc
agtcgccttc ccgttccgct atcggctgaa tttgattgcg agtgagatat 4860
ttatgccagc cagccagacg cagacgcgcc gagacagaac ttaatgggcc cgctaacagc
4920 gcgatttgct ggtgacccaa tgcgaccaga tgctccacgc ccagtcgcgt
accgtcttca 4980 tgggagaaaa taatactgtt gatgggtgtc tggtcagaga
catcaagaaa taacgccgga 5040 acattagtgc aggcagcttc cacagcaatg
gcatcctggt catccagcgg atagttaatg 5100 atcagcccac tgacgcgttg
cgcgagaaga ttgtgcaccg ccgctttaca ggcttcgacg 5160 ccgcttcgtt
ctaccatcga caccaccacg ctggcaccca gttgatcggc gcgagattta 5220
atcgccgcga caatttgcga cggcgcgtgc agggccagac tggaggtggc aacgccaatc
5280 agcaacgact gtttgcccgc cagttgttgt gccacgcggt tgggaatgta
attcagctcc 5340 gccatcgccg cttccacttt ttcccgcgtt ttcgcagaaa
cgtggctggc ctggttcacc 5400 acgcgggaaa cggtctgata agagacaccg
gcatactctg cgacatcgta taacgttact 5460 ggtttcacat tcaccaccct
gaattgactc tcttccgggc gctatcatgc cataccgcga 5520 aaggttttgc
accattcgat ggtgtcaacg taaatgcatg ccgcttcgcc ttcgcgcgcg 5580
aattgatctg ctgcctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc
5640 tcccggagac ggtcacagct tgtctgtaag cggatgccgg gagcagacaa
gcccgtcagg 5700 gcgcgtcagc gggtgttggc ggggccggcc tcg 5733
<210> SEQ ID NO 12 <211> LENGTH: 60 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 12 ctctagaaat aatttaactt taagtaggag auaggtaccc atggcggaca
cgttattgat 60 <210> SEQ ID NO 13 <211> LENGTH: 58
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 13 cttcgaattc catttaaatt atttctagag
tcattatgag tcatgattta ctaaaggc 58 <210> SEQ ID NO 14
<211> LENGTH: 65 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer
<400> SEQUENCE: 14 ctctagaaat aattttagtt aagtataaga
aggagatata ccatggtgaa gaaggtttgg 60 cttaa 65 <210> SEQ ID NO
15 <211> LENGTH: 51 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic primer <400> SEQUENCE: 15
cttcgaattc catttaaatt atttctagag ttatcaggct ttattgtcca c 51
<210> SEQ ID NO 16 <211> LENGTH: 42 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 16 ctctagaaat aatttagtta agtataagaa ggagatatac at 42
<210> SEQ ID NO 17 <211> LENGTH: 58 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 17 cttcgaattc catttaaatt atttctagag ttactattta attcctgcac
cgatttcc 58 <210> SEQ ID NO 18 <211> LENGTH: 28
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 18 atatgacgtc ggcatccgct tacagaca 28
<210> SEQ ID NO 19 <211> LENGTH: 32 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 19 aattcttaag tcaggagagc gttcaccgac aa 32 <210> SEQ
ID NO 20 <211> LENGTH: 36 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic primer <400> SEQUENCE: 20
caaccagcgg ccgcgcagac gatggtgcag gatatc 36 <210> SEQ ID NO 21
<211> LENGTH: 36 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 21 ccacacacta
gtcagatctg cagaattcag gctgtc 36 <210> SEQ ID NO 22
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic primer <400> SEQUENCE: 22 ggctggctgg
cataaatatc tc 22 <210> SEQ ID NO 23 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 23 catcgcgtgg gcgtattcg 19 <210>
SEQ ID NO 24 <400> SEQUENCE: 24 000 <210> SEQ ID NO 25
<400> SEQUENCE: 25 000 <210> SEQ ID NO 26 <400>
SEQUENCE: 26 000 <210> SEQ ID NO 27 <400> SEQUENCE: 27
000 <210> SEQ ID NO 28 <211> LENGTH: 4311 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: pLacZ plasmid <400>
SEQUENCE: 28 ctagtaacgg ccgccagtgt gctggaattc aggcagttca acctgttgat
agtacgtact 60 aagctctcat gtttcacgta ctaagctctc atgtttaacg
tactaagctc tcatgtttaa 120 cgaactaaac cctcatggct aacgtactaa
gctctcatgg ctaacgtact aagctctcat 180 gtttcacgta ctaagctctc
atgtttgaac aataaaatta atataaatca gcaacttaaa 240 tagcctctaa
ggttttaagt tttataagaa aaaaaagaat atataaggct tttaaagctt 300
ttaaggttta acggttgtgg acaacaagcc agggatgtaa cgcactgaga agcccttaga
360 gcctctcaaa gcaattttca gtgacacagg aacacttaac ggctgacagc
ctgaattctg 420 cagatctggc gtaatagcga agaggcccgc accgatcgcc
cttcccaaca gttgcgcagc 480 ctgaatggcg aatggcgctt tgcctggttt
ccggtaccag aagcggtgcc ggaaagctgg 540 ctggagtgcg atcttcctga
ggccgatact gtcgtcgtcc cctcaaactg gcagatgcac 600 ggttacgatg
cgcccatcta caccaacgta acctatccca ttacggtcaa tccgccgttt 660
gttcccacgg agaatccgac gggttgttac tcgctcacat ttaatgttga tgaaagctgg
720 ctacaggaag gccagacgcg aattattttt gatggcgtta actcggcgtt
tcatctgtgg 780 tgcaacgggc gctgggtcgg ttacggccag gacagtcgtt
tgccgtctga atttgacctg 840 agcgcatttt tacgcgccgg agaaaaccgc
ctcgcggtga tggtgctgcg ttggagtgac 900 ggcagttatc tggaagatca
ggatatgtgg cggatgagcg gcattttccg tgacgtctcg 960 ttgctgcata
aaccgactac acaaatcagc gatttccatg ttgccactcg ctttaatgat 1020
gatttcagcc gcgctgtact ggaggctgaa gttcagatgt gcggcgagtt gcgtgactac
1080 ctacgggtaa cagtttcttt atggcagggt gaaacgcagg tcgccagcgg
caccgcgcct 1140 ttcggcggtg aaattatcga tgagcgtggt ggttatgccg
atcgcgtcac actacgtctg 1200 aacgtcgaaa acccgaaact gtggagcgcc
gaaatcccga atctctatcg tgcggtggtt 1260 gaactgcaca ccgccgacgg
cacgctgatt gaagcagaag cctgcgatgt cggtttccgc 1320 gaggtgcgga
ttgaaaatgg tctgctgctg ctgaacggca agccgttgct gattcgaggc 1380
gttaaccgtc acgagcatca tcctctgcat ggtcaggtca tggatgagca gacgatggtg
1440 caggatatcc tgctgatgaa gcagaacaac tttaacgccg tgcgctgttc
gcattatccg 1500 aaccatccgc tgtggtacac gctgtgcgac cgctacggcc
tgtatgtggt ggatgaagcc 1560 aatattgaaa cccacggcat ggtgccaatg
aatcgtctga ccgatgatcc gcgctggcta 1620 ccggcgatga gcgaacgcgt
aacgcgaatg gtgcagcgcg atcgtaatca cccgagtgtg 1680 atcatctggt
cgctggggaa tgaatcaggc cacggcgcta atcacgacgc gctgtatcgc 1740
tggatcaaat ctgtcgatcc ttcccgcccg gtgcagtatg aaggcggcgg agccgacacc
1800 acggccaccg atattatttg cccgatgtac gcgcgcgtgg atgaagacca
gcccttcccg 1860 gctgtgccga aatggtccat caaaaaatgg ctttcgctac
ctggagagac gcgcccgctg 1920 atcctttgcg aatacgccca cgcgatgggt
aacagtcttg gcggtttcgc taaatactgg 1980 caggcgtttc gtcagtatcc
ccgtttacag ggcggcttcg tctgggactg ggtggatcag 2040 tcgctgatta
aatatgatga aaacggcaac ccgtggtcgg cttacggcgg tgattttggc 2100
gatacgccga acgatcgcca gttctgtatg aacggtctgg tctttgccga ccgcacgccg
2160 catccagcgc tgacggaagc aaaacaccag cagcagtttt tccagttccg
tttatccggg 2220 caaaccatcg aagtgaccag cgaatacctg ttccgtcata
gcgataacga gctcctgcac 2280 tggatggtgg cgctggatgg taagccgctg
gcaagcggtg aagtgcctct ggatgtcgct 2340 ccacaaggta aacagttgat
tgaactgcct gaactaccgc agccggagag cgccgggcaa 2400 ctctggctca
cagtacgcgt agtgcaaccg aacgcgaccg catggtcaga agccgggcac 2460
atcagcgcct ggcagcagtg gcgtctggcg gaaaacctca gtgtgacgct ccccgccgcg
2520 tcccacgcca tcccgcatct gaccaccagc gaaatggatt tttgcatcga
gctgggtaat 2580 aagcgttggc aatttaaccg ccagtcaggc tttctttcac
agatgtggat tggcgataaa 2640 aaacaactgc tgacgccgct gcgcgatcag
ttcacccgtg cacgtctgct gtcagataaa 2700 gtctcccgtg aactttaccc
ggtggtgcat atcggggatg aaagctggcg catgatgacc 2760 accgatatgg
ccagtgtgcc ggtctccgtt atcggggaag aagtggctga tctcagccac 2820
cgcgaaaatg acatcaaaaa cgccattaac ctgatgttct ggggaatata aatgtcaggc
2880 atgagattat caaaaaggat cttcacctag atccttttca cgtagaaagc
cagtccgcag 2940
aaacggtgct gaccccggat gaatgtcagc tactgggcta tctggacaag ggaaaacgca
3000 agcgcaaaga gaaagcaggt agcttgcagt gggcttacat ggcgatagct
agactgggcg 3060 gttttatgga cagcaagcga accggaattg ccagctgggg
cgccctctgg taaggttggg 3120 aagccctgca aagtaaactg gatggctttc
tcgccgccaa ggatctgatg gcgcagggga 3180 tcaagctctg atcaagagac
aggatgagga tcgtttcgca tgattgaaca agatggattg 3240 cacgcaggtt
ctccggccgc ttgggtggag aggctattcg gctatgactg ggcacaacag 3300
acaatcggct gctctgatgc cgccgtgttc cggctgtcag cgcaggggcg cccggttctt
3360 tttgtcaaga ccgacctgtc cggtgccctg aatgaactgc aagacgaggc
agcgcggcta 3420 tcgtggctgg ccacgacggg cgttccttgc gcagctgtgc
tcgacgttgt cactgaagcg 3480 ggaagggact ggctgctatt gggcgaagtg
ccggggcagg atctcctgtc atctcacctt 3540 gctcctgccg agaaagtatc
catcatggct gatgcaatgc ggcggctgca tacgcttgat 3600 ccggctacct
gcccattcga ccaccaagcg aaacatcgca tcgagcgagc acgtactcgg 3660
atggaagccg gtcttgtcga tcaggatgat ctggacgaag agcatcaggg gctcgcgcca
3720 gccgaactgt tcgccaggct caaggcgagc atgcccgacg gcgaggatct
cgtcgtgacc 3780 catggcgatg cctgcttgcc gaatatcatg gtggaaaatg
gccgcttttc tggattcatc 3840 gactgtggcc ggctgggtgt ggcggaccgc
tatcaggaca tagcgttggc tacccgtgat 3900 attgctgaag agcttggcgg
cgaatgggct gaccgcttcc tcgtgcttta cggtatcgcc 3960 gctcccgatt
cgcagcgcat cgccttctat cgccttcttg acgagttctt ctgaattatt 4020
aacgcttaca atttcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac
4080 cgcatacagg tggcactttt cggggaaatg tgcgcggaac ccctatttgt
ttatttttct 4140 aaatacattc aaatatgtat ccgctcatga gacaataacc
ctgataaatg cttcaataat 4200 agcacgtgag gagggccacc atggccaagt
tgaccagtgc cgttccggtg ctcaccgcgc 4260 gcgacgtcgc cggagcggtc
gagttctgga ccgaccggct cgggttctcc c 4311
* * * * *
References