U.S. patent application number 11/648679 was filed with the patent office on 2010-10-07 for fluorescent substrates for detecting organophosphatase enzyme activity.
This patent application is currently assigned to The American National Red Cross. Invention is credited to David Hammond, Serguei Soukharev.
Application Number | 20100255521 11/648679 |
Document ID | / |
Family ID | 33313437 |
Filed Date | 2010-10-07 |
United States Patent
Application |
20100255521 |
Kind Code |
A1 |
Soukharev; Serguei ; et
al. |
October 7, 2010 |
Fluorescent substrates for Detecting organophosphatase enzyme
activity
Abstract
Disclosed are compounds of the formula (I): wherein R.sup.3,
R.sup.4, R.sup.5, R.sup.9, and R.sup.10 are selected from the group
consisting of H and groups or atoms other than H, and R.sup.6 and
R.sup.8 are halo or hydrogen; X.sup.1, X.sup.2, and X.sup.3 are
independently O or S; provided that R.sup.9 and R.sup.10 are not
simultaneously H, when all of X.sup.1, X.sup.2, and X.sup.3 are O;
and of the formula (II) wherein R.sup.11-R.sup.14 are selected from
the group consisting of H and groups or atoms other than H;
X.sup.4-X.sup.9 are independently O or S; n and m are 0 or 1 but m
and n cannot be 0 simultaneously; R.sup.15-R.sup.24 can be H or any
substituent so long as the compound of formula II upon hydrolysis
provides a fluorescent compound. These compounds are useful as
substrates with high specificity for organophosphatase particularly
human paraoxonase and bacterial organophosphorus hydrolase. Also
disclosed is a method for detecting and/or measuring the
paraoxonase activity in a fluid comprising contacting the fluid
with a fluorescent substrate and measuring the fluorescence of the
fluorescent product formed. ##STR00001##
Inventors: |
Soukharev; Serguei;
(Derwood, MD) ; Hammond; David; (Laytonsville,
MD) |
Correspondence
Address: |
FOLEY AND LARDNER LLP;SUITE 500
3000 K STREET NW
WASHINGTON
DC
20007
US
|
Assignee: |
The American National Red
Cross
|
Family ID: |
33313437 |
Appl. No.: |
11/648679 |
Filed: |
January 3, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10553650 |
Oct 14, 2005 |
7374900 |
|
|
PCT/US04/07897 |
Mar 16, 2004 |
|
|
|
11648679 |
|
|
|
|
60463317 |
Apr 17, 2003 |
|
|
|
60487935 |
Jul 18, 2003 |
|
|
|
Current U.S.
Class: |
435/21 ;
549/220 |
Current CPC
Class: |
C07F 9/65522 20130101;
C07F 9/6561 20130101; C12Q 1/42 20130101 |
Class at
Publication: |
435/21 ;
549/220 |
International
Class: |
C12Q 1/42 20060101
C12Q001/42; C07F 9/12 20060101 C07F009/12 |
Claims
1-56. (canceled)
57. A compound of the formula II: ##STR00006## wherein
R.sup.11-R.sup.14 are selected from the group consisting of
C.sub.1-C.sub.8 alkyl, C.sub.5-C.sub.8 cycloalkyl, C.sub.1-C.sub.6
haloalkyl, C.sub.1-C.sub.6 perfluoroalkyl, C.sub.2-C.sub.6 alkenyl,
and C.sub.2-C.sub.6 alkynyl, and aryl, arylcarbonyl, and
heteroaryl, which may be optionally substituted with a substituent
selected from the group consisting of hydroxyl, cyano, nitro, halo,
amino, amido, azido, acetal, ketal, imido, sulfo, sulfonyl,
sulfinyl, thiocyanato, aldehydro, keto, carbamoyl, urethane,
ureido, and guanidino; X.sup.4-X.sup.9 are independently O or S; n
and m are 0 or 1 but m and n cannot be 0 simultaneously; and
R.sup.15-R.sup.24 can be H or any substituent so long as the
compound of formula II upon hydrolysis provides a fluorescent
compound.
58. The compound of claim 57, wherein the hydrolysis takes place at
the P--X.sup.6 and/or P--X.sup.9 bonds.
59. The compound of claim 57, wherein m and n are 1.
60. The compound of claim 57, wherein R.sup.15-R.sup.24 are
independently selected from the group consisting of H, hydroxyl,
cyano, nitro, halo, amino, amido, azido, acetal, ketal, imido,
sulfo, sulfonyl, sulfinyl, sulfomethyl, a salt of sulfomethyl,
thiocyanato, aldehydro, keto, carbamoyl, urethane, ureido,
guanidino, C.sub.1-C.sub.6 alkylamino, C.sub.1-C.sub.6 acylamino,
C.sub.1-C.sub.6 alkylamido, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6
alkoxy, C.sub.1-C.sub.6 alkylthio, C.sub.5-C.sub.8 cycloalkyl,
C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 perfluoroalkyl, formyl,
carboxamide of the formula --(C.dbd.O)NR.sup.1R.sup.2 where R.sup.1
and R.sup.2 are independently H, alkyl having 1-6 carbon atoms, an
aryl, or R.sup.1 and R.sup.2 taken together form a saturated 5- or
6-membered ring having the formula
--(CH.sub.2).sub.2-M-(CH.sub.2).sub.2-- where the ring moiety M is
a single bond, an oxygen atom, a methylene group, or the secondary
amine --NR.sup.7-- where R.sup.7 is H or alkyl having 1-6 carbon
atoms, an aryl, or R.sup.1 and R.sup.2 taken together form a
saturated 5- or 6-membered ring having the formula
--(CH.sub.2).sub.2-M-(CH.sub.2).sub.2-- where the ring moiety M is
a single bond, an oxygen atom, a methylene group, or the secondary
amine --NR.sup.7-- where R.sup.7 is H or alkyl having 1-6 carbon
atoms, C.sub.5-C.sub.8 halocycloalkyl, C.sub.1-C.sub.6
hydroxyalkyl, C.sub.5-C.sub.8 hydroxycycloalkyl, C.sub.1-C.sub.6
alkoxy C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkoxycarbonyl,
C.sub.2-C.sub.6 alkoxycarbonyl C.sub.1-C.sub.6 alkyl, carboxy
C.sub.1-C.sub.6 alkyl, carboxy C.sub.1-C.sub.6 alkoxy, dicarboxy
C.sub.1-C.sub.6 alkyl, dicarboxy C.sub.1-C.sub.6 alkoxy,
C.sub.2-C.sub.6 cyanoalkyl, phosphono C.sub.1-C.sub.6 alkyl,
phosphoryl C.sub.1-C.sub.6 alkyl, mono-, di-, and trisaccharides,
nucleic acids, oligonucleotides, amino acids, peptides, and
proteins, and C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl,
aryl, arylcarbonyl, and heteroaryl, which may be optionally
substituted with a substituent selected from the group consisting
of hydroxyl, cyano, nitro, halo, amino, amido, azido, acetal,
ketal, imido, sulfo, sulfonyl, sulfinyl, thiocyanato, aldehydro,
keto, carbamoyl, urethane, ureido, and guanidino.
61. The compound of claim 57, wherein R.sup.11-R.sup.14 are
independently selected from the group consisting of C.sub.1-C.sub.6
alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, aryl, and
heteroaryl.
62. The compound of claim 57, wherein R.sup.11-R.sup.14 are
independently selected from the group consisting of C.sub.1-C.sub.6
alkyl, C.sub.2-C.sub.6 alkenyl, and C.sub.2-C.sub.6 alkynyl.
63. The compound of claim 57, wherein R.sup.11-R.sup.14 groups are
independently selected from the group consisting of C.sub.1-C.sub.6
alkyl.
64. The compound of claim 57, wherein R.sup.11-R.sup.14 is
ethyl.
65. A compound of formula II ##STR00007## wherein X.sup.4-X.sup.9
are O, R.sup.15-R.sup.24 are H, R.sup.11-R.sup.14 are ethyl; and m
and n are 1.
66. A compound of formula II: ##STR00008## wherein X.sup.4,
X.sup.5, X.sup.7, and X.sup.8 are O; X.sup.6 and X.sup.9 are S;
R.sup.15-R.sup.24 are H; R.sup.11-R.sup.14 are ethyl; and m and n
are 1.
67. A method for specifically and selectively detecting and/or
measuring the activity of an organophosphatase enzyme in a fluid,
which contains at least organophosphatases and phosphatases, said
method comprising: ##STR00009## (a) contacting the fluid with a
compound of the formula II: wherein R.sup.11-R.sup.14 are selected
from the group consisting of H and groups or atoms other than H,
X.sup.4-X.sup.9 are independently O or S, n and m are 0 or 1 but m
and n cannot be 0 simultaneously, and R.sup.15-R.sup.24 can be H or
any substituent so long as the compound of formula II upon
hydrolysis provides a fluorescent product; (b) collecting the
fluorescent product; (c) measuring the fluorescence of a
fluorescent product formed during the contacting; and (d)
correlating the measured fluorescence with the activity of the
organophosphatase enzyme.
68. A method for selectively detecting an organophosphatase enzyme
in a sample suspected to contain an organophosphatase and a
phosphatase comprising (a) contacting the sample with a compound of
the formula II: ##STR00010## wherein R.sup.11-R.sup.14 are selected
from the group consisting of H and groups or atoms other than H,
X.sup.4-X.sup.9 are independently O or S, n and m are 0 or 1 but m
and n cannot be 0 simultaneously, and R.sup.15-R.sup.24 can be H or
any substituent so long as the compound of formula II upon
hydrolysis provides a fluorescent product; (b) collecting the
fluorescent product; (c) measuring the fluorescence of a
fluorescent product formed during the contacting; and (d)
correlating the measured fluorescence with the activity of the
organophosphatase enzyme.
69. A method for specifically and selectively detecting and/or
measuring the activity of an organophosphatase enzyme immobilized
on a support comprising: (a) contacting the support with a compound
of the formula II: ##STR00011## wherein R.sup.11-R.sup.14 are
selected from the group consisting of H and groups or atoms other
than H, X.sup.4-X.sup.9 are independently O or S, n and m are 0 or
1 but m and n cannot be 0 simultaneously, and R.sup.15-R.sup.24 can
be H or any substituent so long as the compound of formula II upon
provides a fluorescent product; (b) collecting the fluorescent
product; (c) measuring the fluorescence of a fluorescent product
formed during the contacting; and (d) correlating the measured
fluorescence with the activity of the organophosphatase enzyme.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. provisional
patent application Nos. 60/463,317, filed Apr. 17, 2003 and
60/487,935, filed Jul. 18, 2003, the disclosures of which are
incorporated by reference.
FIELD OF THE INVENTION
[0002] This invention relates to certain fluorescent substrates and
a method for detecting organophosphatase activity in general, and
paraoxonase activity specifically and in particular in biological
fluids such as blood and serum, through the use of such fluorescent
substrates.
BACKGROUND OF THE INVENTION
[0003] Enzymatic degradation of organophosphates (OPs) is performed
by specialized enzymes including bacterial organophosphorus
hydrolase (OPH) and mammalian paraoxonase. Paraoxonase also
referred to as, arylesterase (EC 3.1.1.2) is a 43 kDa molecular
weight calcium dependent ester hydrolase that catalyses the
hydrolysis of a broad range of esters such as OPs, and unsaturated
aliphatic and aromatic carboxylic esters. Its name derives from the
ability of this protein to hydrolyze paraoxon, the toxic metabolite
of the insecticide parathion. In addition to paraoxon, paraoxonase
is able to detoxify a number of other insecticides, e.g. diazonin,
as well as the potent nerve gases sarin and soman that target
acetylcholinesterase (AChE). The paraoxonase gene (PON) family
consists of at least three members: PON1, PON2 and PON3, which are
located on the human 7q21.3-22.1 chromosome. No significant
endogenous expression of PON2 and PON3 genes has been detected.
Most PON1 expression takes place in the human liver; from there the
protein is secreted into blood where it circulates associated with
high density lipoprotein (HDL) particles. Paraoxonase has the
unusual property that the mature protein retains its hydrophobic
N-terminal signal peptide, which is used as an anchor for
association with HDL. The enzyme has three potential N-linked sites
and carbohydrate accounts for approximately 16% of its molecular
mass.
[0004] There is a significant variation in paraoxonase activity in
the human population, which is a result of polymorphism in the PON1
promoter that leads to different levels of expression, as well as
polymorphism in gene sequence that leads to allele forms of protein
with different specific activity. Both types of polymorphisms are
quite common among the human population generating a range of
paraoxonase serum activity in the population. The apparent
molecular mass of serum paraoxonase varies as the result of
heterogeneous glycosylation.
[0005] Neither the function nor natural substrate(s) for
paraoxonase have yet been identified. One possible substrate is
oxidized low density lipoprotein (LDL) [1-3]. Paraoxonase has been
shown both to prevent formation of oxidized LDL and to hydrolyze
LDL-derived oxidized phospholipids. Since accumulation of oxidized
LDL is one of the key factors in development of atherosclerosis,
paraoxonase activity may correlate with development of this
disease. For example, Shih et al demonstrated that PON1-/- mice
were extremely sensitive to diet-induced atherosclerosis in
comparison with wild type mice. Since there is a significant
variation in paraoxonase activity among the population, evaluation
of paraoxonase levels of individuals may have a significant
diagnostic value, predicting the chances, development and prognosis
of atherosclerosis.
[0006] Another possible natural substrate is lipopolysaccharide
(LPS) or mediators of septic shock. It has been shown that high
density lipoprotein (HDL) can inactivate LPS [4]. Moreover,
intraperitoneal injection of mice before and up to 2 hours after
LPS administration afforded protection against septic shock [5]. In
addition, PON-1 knockout mice are extremely sensitive to LPS
[6].
[0007] Paraoxonase is able to hydrolyze a number of OP toxins in
vitro, and the ability of paraoxonase to protect animals in acute
OP poisoning has been extensively studied. Injection of purified
paraoxonase protected animals against OP toxicity [7, 8]. Further
proof of the ability of paraoxonase to protect animals has been
obtained from studies on PON1 "knock-out" mice. Destruction of the
PON1 gene by knock-out technology creates mice that lack
paraoxonase. Compared to wild type littermates, PON1 deficient mice
were extremely sensitive to the toxic effects of chlorpyrifos, an
OP. Thus, monitoring of paraoxonase activity may help to evaluate a
person's ability to withstand OP poisoning associated with
deployment of chemical weapons.
[0008] Consequently, monitoring blood levels of paraoxonase may be
used to identify, a predisposition to atherosclerosis, sepsis and
OP poisoning. However, the absence of a robust test for detection
of paraoxonase levels in blood has significantly delayed progress
in studying the diagnostic value of paraoxonase. There are two
major options for detection of this enzyme activity. The first is a
change in optical density and the second the generation of a
fluorescent product.
[0009] Currently, the most common substrates for paraoxonase used
in research are paraoxon and phenylacetate. Paraoxonase catalyzed
hydrolyses of paraoxon leads to release of nitrophenol, which can
be detected by monitoring adsorption at 405 nm. This reaction is
used to measure paraoxonase activity in fundamental and clinical
research. The main disadvantages of this substrate are the low Vmax
of hydrolysis, which results in relatively low sensitivity and, due
to its toxicity, paraoxon requires special handling conditions. The
arylesterase activity of paraoxonase is usually measured through
hydrolysis of phenylacetate. This reaction has a much higher Vmax,
than the Vmax of paraoxon hydrolysis; however, phenylacetate is
also hydrolyzed by a number of other esterases in cell extracts and
serum samples, which significantly decreases the specificity of
detection. In addition, the detection of phenylacetate hydrolysis
is based on monitoring adsorption at 270 nm making paraoxonase
detection difficult, or impossible, in protein rich solutions or in
extracts containing detergents like Triton X-100.
[0010] The OPH gene was originally found in two soil
microorganisms, Pseudomonas diminuta and Flavobacterium sp. It has
been suggested that this enzyme evolved recently in these bacteria
in response to industrial soil contamination with organophosphate
compounds. Like paraoxonase, OPH catalyzes a broad range of
organophosphate esters including sarin and VX. Due to this activity
these organisms may have additional utility in decontamination of
OPs in the environment. In this context a sensitive and robust
assay would be necessary to confirm expression of OPH in the
presence of a large excess of phosphatase activity. Thus, it is
essential that the substrate has very little or no affinity for
phosphatases.
[0011] The foregoing shows that there exists a need for detecting
organophosphatase activity including paraoxonase with high
specificity and sensitivity. There exists a need for substrates
with high specificity for OPH and paraoxonase. The advantages of
the present invention as well as inventive features will be
apparent from the detailed description of the embodiments of the
invention provided herein.
BRIEF SUMMARY OF THE INVENTION
[0012] The foregoing needs have been fulfilled to a great extent.
The present invention provides highly sensitive and specific
fluorescent substrates. In accordance with an embodiment, the
present invention provides compounds of the formula (I):
##STR00002##
wherein R.sup.3, R.sup.4, R.sup.5, R.sup.9, and R.sup.10 are
selected from the group consisting of H and groups or atoms other
than H, and R.sup.6 and R.sup.8 are halo or hydrogen; X.sup.1,
X.sup.2, and X.sup.3 are independently O or S; provided that
R.sup.9 and R.sup.10 are not simultaneously H, when all of X.sup.1,
X.sup.2, and X.sup.3 are O.
[0013] In accordance with another embodiment, the present invention
provide compound of the formula II:
##STR00003##
wherein R.sup.11-R.sup.14 are selected from the group consisting of
H and groups or atoms other than H; X.sup.4-X.sup.9 are
independently O or S. n and m are 0 or 1 but m and n cannot be 0
simultaneously. R.sup.15-R.sup.24 can be H or any substituent so
long as the compound of formula II upon hydrolysis provides a
fluorescent compound.
[0014] The present invention also provides a method for detecting
and/or measuring the organophosphatases and particularly
paraoxonase activity in a fluid comprising contacting the fluid
with a fluorescent substrate and measuring the fluorescence of the
fluorescent product formed.
[0015] The fluorescent substrates of this invention are specific
for organophosphatases including paraoxonase and, when hydrolyzed,
release highly fluorescent products which can be measured at, for
example, an emission wavelength of 460 nm following excitation at a
wavelength of 355 nm for structures based on the coumarin structure
and emission of 520 nm following excitation at 488 nm for
fluorescein-based structures. In comparison with the other
substrates used for the detection of paraoxonase, these have
significantly higher sensitivity and specificity. The substrates of
the present invention facilitate large throughput methods for the
detection and quantitation of this enzyme's activity. Such methods
may be used for detection of paraoxonase as a diagnostic marker for
prediction of atherosclerosis development, sepsis and sensitivity
to OPs.
[0016] The substrates are useful for detecting and quantifying
paraoxonase activity in samples of biological fluids such as blood.
Measurement of blood paraoxonase activity may be useful as an
indicator of cardiovascular disease and sensitivity to OP
poisoning. Also provided is a method for detecting the activity of
paraoxonase in an environmental sample. Such samples may include
those which have been treated with paraoxonase to decontaminate
OPs. Also provided is a method for studying the basic properties of
paraoxonase by using these substrates as research reagents. Also
provided is a method of assaying for the presence of OPs through
the specific inhibition of substrate induced fluorescence. The
substrates of the present invention have one or more than one
advantage; e.g., high specificity for paraoxonase; high sensitivity
fluorescent detection and a significant Vmax of reaction makes it
at least 10-20 times more sensitive than any other known substrate
for paraoxonase detection. Consequently, the substrates may have a
significant practical use in different areas of medicine and
detection of nerve gas poisons.
[0017] The substrates are useful for detecting and quantifying OPH
activity in environmental samples such as soil extracts or swabs.
Such samples may include those which have been treated with OPH to
decontaminate OPs. Also provided is a method for studying the basic
properties of OPH by using these substrates as research reagents.
Also provided is a method of assaying for the presence of OPs
through the specific inhibition of substrate induced fluorescence.
The substrates of the present invention have one or more than one
advantage; e.g., high specificity for OPH; high sensitivity
fluorescent detection and a significant Vmax of reaction makes it
at least 10-20 times more sensitive than any other known substrate
for OPH detection. Consequently, the substrates may have a
significant practical use in different areas of medicine and
detection of nerve gas poisons.
[0018] The proposed substrates can be used for broad screening of
paraoxonase activity in human blood. Paraoxonase levels in the
blood correlates with resistance to organophosphate poisoning,
development of atherosclerosis, ability to detoxify LPS and general
liver malfunctions. The present invention provides an assay kit for
paraoxonase detection and quantitation. Such a kit may be used for
detection of paraoxonase as a diagnostic marker for prediction of
atherosclerosis development. The diagnostic prognosis of
paraoxonase detection is comparable to, or better than, such blood
markers as blood cholesterol level. Such a kit may also be used for
detection of paraoxonase as a diagnostic marker for prediction of
sepsis development. Another potential use of a kit for detection of
paraoxonase is predicting the resistance to OP challenges which can
have a significant value in a war against chemical terrorism or
during combat where chemical weapons are utilized. It is also
envisaged that the kit may be used to confirm that protective
levels of paraoxonase have been achieved in war fighters following
administration of prophylactic levels of recombinant paraoxonase.
Moreover, a rapid and sensitive method for detection of
organophosphatase activity may be useful for the detection of
alternative substrates, e.g., nerve poisons, OP toxins and
insecticides, present in environment samples. Such alternative
substrates for organophosphatase may be identified by their ability
to compete for binding and hydrolysis of the substrates of the
present invention.
[0019] The present invention further provides a method for
selectively detecting organophosphatase in a sample suspected to
contain organophosphatase and a phosphatase comprising contacting
the sample with a substrate of the invention, measuring the
fluorescence of a fluorescent product formed during the contacting;
and correlating the measured fluorescence with the activity of the
organophosphatase enzyme. The spectrum of structures provides a
method to discover different organophosphatases with different
spectra of substrate specificities.
[0020] The present invention further provides a method for
detecting and/or measuring the activity of organophosphatase enzyme
immobilized on a support comprising contacting the support with a
substrate of the invention, measuring the fluorescence of a
fluorescent product formed during the contacting; and correlating
the measured fluorescence with the activity of the
organophosphatase enzyme.
[0021] While the invention has been described and disclosed below
in connection with certain embodiments and procedures, it is not
intended to limit the invention to those specific embodiments.
Rather it is intended to cover all such alternative embodiments and
modifications as fall within the spirit and scope of the
invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1 depicts the detection of paraoxonase activity in
serum samples using
7[diethyl-phosphor]-6,8-difluoro-4-methylumbelliferyl (DEPFMU) as a
substrate. In this assay 10 .mu.l of rabbit and, separately 10
.mu.l of mouse serum both previously diluted 10 fold with assay
buffer, 20 mM Tris.HCl, pH 8.0, 150 mM NaCl and 2 mM CaCl.sub.2,
were incubated with 100 .mu.l of assay buffer containing 100 .mu.M
of DEPFMU. The rates of change of fluorescence at 37.degree. C.
were monitored at 355/460.
[0023] FIG. 2 depicts a cell membrane associated production of
fluorescence in PON1 transfected and non-transfected CHO cells
using DEPFMU as the substrate. In this experiment Chinese hamster
ovary (CHO) cells were transfected using Fugene 6 reagent (Roche)
with the expression vector pHLSS122 containing human PON1 cDNA.
Transfection was performed in 96 well microliter plates. 48 hours
after transfection, the cells were washed twice with PBS and 100
.mu.l of assay buffer containing 100 .mu.m of DEPFMU were added.
Immediately after addition, the rates of change of fluorescence at
37.degree. C. were monitored at 355/460.
[0024] FIG. 3 depicts the measurement of the Km of DEPFMU for
rabbit recombinant paraoxonase. The rabbit recombinant paraoxonase
was expressed in CHO cells and partially purified. v-A, v-B and v-C
are the velocities at 1/5, 1/10 and 1/20 dilutions of recombinant
paraoxonase, respectively. Partially purified recombinant
paraoxonase was mixed with solutions containing different
concentrations of DEPFMU as substrate. The time-course of DEPFMU
hydrolysis 37.degree. C. was monitored using fluorescence reading
at 355/460. The reciprocal of the Km of DEPFMU was obtained from
the intercept on the abscissa using a Lineweaver-Burk Plot (1/v)
where v is the velocity of the reaction against 1/[S] where [S] is
the substrate concentration.
[0025] FIG. 4 depicts a comparison of the sensitivity of
paraoxonase detection using paraoxon and DEPFMU based assays. An
evaluation of the relative sensitivity of DEPFMU (A) and paraoxon
(B) based assays for paraoxonase assay was performed using 10 .mu.l
serial dilution of rabbit serum samples incubated with 100 .mu.l of
assay buffer comprising 4 mM paraoxon or 100 .mu.M DEPFMU in the
assay buffer. After incubation, the optical density at 405 was
measured to detect paraoxon and fluorescence (355/460) was read for
DEPFMU. The two standard deviations above background readings is
assigned as the limits of reliable detection. As can be seen from
the figure, paraoxonase activity can be reliably detected with more
that 1:10,000 dilution in the DEPFMU based assay, while less than
1:1,000 is required for detection with paraoxon based assay.
[0026] FIG. 5 depicts the hydrolysis of the DEPFMU by PON1
mutants.
[0027] FIG. 6A depicts the hydrolysis data for a substrate of the
present invention, DEPFMU. FIG. 6B depicts the hydrolysis data for
6,8-difluoro-4-methylumbelliferyl phosphate (DiFMUP). See Example
8.
[0028] FIG. 7 depicts the hydrolysis of the fluorescein diphosphate
tetra ethyl ester (FDPTEE) by bacterial OPH.
[0029] FIG. 8 depicts the hydrolysis of FDPTEE by normal mice
contrasted with PON1 knock out mice.
DETAILED DESCRIPTION OF EMBODIMENTS
[0030] The present invention provides a compound of the formula
I:
##STR00004##
wherein R.sup.3, R.sup.4, R.sup.5, R.sup.9, and R.sup.10 are
selected from the group consisting of H and groups or atoms other
than H, and R.sup.6 and R.sup.8 are halo or hydrogen; X.sup.1,
X.sup.2, and X.sup.3 are independently O or S; provided that
R.sup.9 and R.sup.10 are not simultaneously H, when all of X.sup.1,
X.sup.2, and X.sup.3 are O.
[0031] In accordance with an embodiment of the invention in formula
I, R.sup.3, R.sup.4, and R.sup.5 are selected from the group
consisting of H, hydroxyl, cyano, nitro, halo, amino, amido, azido,
acetal, ketal, imido, sulfo, sulfonyl, sulfinyl, sulfomethyl, a
salt of sulfomethyl, thiocyanato, aldehydro, keto, carbamoyl,
urethane, ureido, guanidino, C.sub.1-C.sub.6 alkylamino,
C.sub.1-C.sub.6 acylamino, C.sub.1-C.sub.6 alkylamido,
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6
alkylthio, C.sub.5-C.sub.8 cycloalkyl, C.sub.1-C.sub.6 haloalkyl,
C.sub.1-C.sub.6 perfluoroalkyl, formyl, carboxamide of the formula
--(C.dbd.O)NR.sup.1R.sup.2 where R.sup.1 and R.sup.2 are
independently H, alkyl having 1-6 carbon atoms, an aryl, or R.sup.1
and R.sup.2 taken together form a saturated 5- or 6-membered ring
having the formula --(CH.sub.2).sub.2-M-(CH.sub.2).sub.2-- where
the ring moiety M is a single bond, an oxygen atom, a methylene
group, or the secondary amine --NR.sup.7-- where R.sup.7 is H or
alkyl having 1-6 carbon atoms, C.sub.5-C.sub.8 halocycloalkyl,
C.sub.1-C.sub.6 hydroxyalkyl, C.sub.5-C.sub.8 hydroxycycloalkyl,
C.sub.1-C.sub.6 alkoxy C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6
alkoxycarbonyl, C.sub.2-C.sub.6 alkoxycarbonyl C.sub.1-C.sub.6
alkyl, carboxy C.sub.1-C.sub.6 alkyl, carboxy C.sub.1-C.sub.6
alkoxy, dicarboxy C.sub.1-C.sub.6 alkyl, dicarboxy C.sub.1-C.sub.6
alkoxy, C.sub.2-C.sub.6 cyanoalkyl, phosphono C.sub.1-C.sub.6
alkyl, phosphoryl C.sub.1-C.sub.6 alkyl, mono-, di-, and
trisaccharides, nucleic acids, oligonucleotides, amino acids,
peptides, and proteins, and C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, aryl, arylcarbonyl, and heteroaryl, which
may be optionally substituted with a substituent selected from the
group consisting of hydroxyl, cyano, nitro, halo, amino, amido,
azido, acetal, ketal, imido, sulfo, sulfonyl, sulfinyl,
thiocyanato, aldehydro, keto, carbamoyl, urethane, ureido, and
guanidino; R.sup.9 and R.sup.10 are selected from the group
consisting of H, C.sub.1-C.sub.6 alkyl, C.sub.5-C.sub.8 cycloalkyl,
C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 perfluoroalkyl,
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, aryl,
arylcarbonyl, heteroaryl, C.sub.1-C.sub.6 aminoalkyl,
C.sub.5-C.sub.8 cycloalkyl, C.sub.1-C.sub.6 haloalkyl,
C.sub.5-C.sub.8 halocycloalkyl, C.sub.1-C.sub.6 hydroxyalkyl,
C.sub.5-C.sub.8 hydroxycycloalkyl, C.sub.1-C.sub.6 alkoxy
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkoxycarbonyl,
C.sub.2-C.sub.6 alkoxycarbonyl C.sub.1-C.sub.6 alkyl, carboxy
C.sub.1-C.sub.6 alkyl, carboxy C.sub.1-C.sub.6 alkoxy, dicarboxy
C.sub.1-C.sub.6 alkyl, dicarboxy C.sub.1-C.sub.6 alkoxy,
C.sub.2-C.sub.6 cyanoalkyl, phosphono C.sub.1-C.sub.6 alkyl,
phosphoryl C.sub.1-C.sub.6 alkyl, mono-, di-, and trisaccharides,
nucleic acids, oligonucleotides, amino acids, peptides, and
proteins, and C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl,
aryl, and heteroaryl, which may be optionally substituted with a
substituent selected from the group consisting of hydroxyl, cyano,
nitro, halo, amino, amido, azido, acetal, ketal, imido, sulfo,
sulfonyl, sulfinyl, thiocyanato, aldehydro, keto, carbamoyl,
urethane, ureido, and guanidino; and R.sup.6 and R.sup.8 are halo,
particularly fluoro.
[0032] In accordance with an embodiment of the invention in formula
I, R.sup.4 is selected from the group consisting of H, hydroxyl,
cyano, nitro, halo, amino, amido, azido, acetal, ketal, imido,
sulfo, sulfonyl, sulfinyl, sulfomethyl, salt of sulfomethyl,
thiocyanato, aldehydro, keto, carbamoyl, urethane, ureido,
guanidino, C.sub.1-C.sub.6 alkylamino, C.sub.1-C.sub.6 acylamino,
C.sub.1-C.sub.6 alkylamido, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6
alkoxy, C.sub.1-C.sub.6 perfluoroalkyl, halomethyl, C.sub.1-C.sub.6
alkylthio, C.sub.5-C.sub.8 cycloalkyl, C.sub.1-C.sub.6 haloalkyl,
C.sub.5-C.sub.8 halocycloalkyl, C.sub.1-C.sub.6 hydroxyalkyl,
C.sub.5-C.sub.8 hydroxycycloalkyl, C.sub.1-C.sub.6 alkoxy
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkoxycarbonyl,
C.sub.2-C.sub.6 alkoxycarbonyl C.sub.1-C.sub.6 alkyl, carboxy
C.sub.1-C.sub.6 alkyl, carboxy C.sub.1-C.sub.6 alkoxy, dicarboxy
C.sub.1-C.sub.6 alkyl, dicarboxy C.sub.1-C.sub.6 alkoxy,
C.sub.2-C.sub.6 cyanoalkyl, phosphono C.sub.1-C.sub.6 alkyl,
phosphoryl C.sub.1-C.sub.6 alkyl, mono-, di-, and trisaccharides,
nucleic acids, oligonucleotides, amino acids, peptides, and
proteins, and C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl,
aryl, arylcarbonyl, and heteroaryl, which may be optionally
substituted with a substituent selected from the group consisting
of hydroxyl, cyano, nitro, halo, amino, amido, azido, acetal,
ketal, imido, sulfo, sulfonyl, sulfinyl, thiocyanato, aldehydro,
keto, carbamoyl, urethane, ureido, and guanidino. In a preferred
embodiment, R.sup.4 is selected from the group consisting of H,
cyano, sulfomethyl, salt of sulfomethyl, aryl, C.sub.1-C.sub.6
alkyl, C.sub.1-C.sub.6 alkoxy, and C.sub.1-C.sub.6 perfluoroalkyl,
more preferably C.sub.1-C.sub.6 alkyl, for example, methyl.
[0033] In accordance with an embodiment of the invention in formula
I, R.sup.9 and R.sup.10 are selected from the group consisting of
H, C.sub.1-C.sub.6 alkyl, C.sub.5-C.sub.8 cycloalkyl,
C.sub.1-C.sub.6 haloalkyl, C.sub.1-C.sub.6 perfluoroalkyl,
C.sub.2-C.sub.6 alkenyl, and C.sub.2-C.sub.6 alkynyl, and aryl,
arylcarbonyl, and heteroaryl, which may be optionally substituted
with a substituent selected from the group consisting of hydroxyl,
cyano, nitro, halo, amino, amido, azido, acetal, ketal, imido,
sulfo, sulfonyl, sulfinyl, thiocyanato, aldehydro, keto, carbamoyl,
urethane, ureido, and guanidino; and X.sup.1, X.sup.2, and X.sup.3
are O or S, preferably O.
[0034] In a preferred embodiment of formula I, R.sup.9 and R.sup.10
are selected from the group consisting of H, C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, aryl, and
heteroaryl, more preferably from the group consisting of H,
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, and C.sub.2-C.sub.6
alkynyl. In a further preferred embodiment, R.sup.9 and R.sup.10
are selected from the group consisting of C.sub.1-C.sub.6 alkyl,
for example, R.sup.9 and R.sup.10 are ethyl.
[0035] In accordance with another embodiment of formula I, R.sup.3
is selected from the group consisting of H, cyano, C.sub.1-C.sub.6
alkyl, C.sub.1-C.sub.6 perfluoroalkyl, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, aryl, and heteroaryl, formyl, carboxamide
of the formula --(C.dbd.O)NR.sup.1R.sup.2 where R.sup.1 and R.sup.2
are independently H, alkyl having 1-6 carbon atoms, an aryl, or
R.sup.1 and R.sup.2 taken together form a saturated 5- or
6-membered ring having the formula
--(CH.sub.2).sub.2-M-(CH.sub.2).sub.2-- where the ring moiety M is
a single bond, an oxygen atom, a methylene group, or the secondary
amine --NR.sup.7-- where R.sup.7 is H or alkyl having 1-6 carbon
atoms.
[0036] In accordance with an embodiment of formula I, R.sup.5 is H
or C.sub.1-C.sub.6 alkoxy, preferably H. In accordance with a
preferred embodiment of formula I, R.sup.6 and R.sup.8 are fluoro.
Examples of preferred compounds include those wherein X.sup.1,
X.sup.2, and X.sup.3 are O or S, more preferably O, R.sup.9 and
R.sup.10 are ethyl, R.sup.4 is methyl, R.sup.6 and R.sup.8 are
fluoro, and R.sup.3 and R.sup.5 are H. Specific examples of the
compound of formula I are those wherein R.sup.9 and R.sup.10 are
ethyl, R.sup.4 is methyl, R.sup.6 and R.sup.8 are fluoro, and
X.sup.1, X.sup.2, and X.sup.3 are O; and those wherein X.sup.1 and
X.sup.2 are O, X.sup.3 is S, R.sup.6 and R.sup.8 are H; R.sup.9 and
R.sup.10 are ethyl, and R.sup.4 is methyl.
[0037] The compounds of the present invention can be prepared by
any suitable method, for example, by following methods generally
known in the art; see, e.g., U.S. Pat. Nos. 4,659,657; 5,428,059;
5,830,912; and 6,416,970; and U.S. patent application publication
No. US 2003/0032080 A1; the disclosures of which are incorporated
by reference. For example, the appropriate 7-hydroxycoumarin can be
reacted with a suitable phosphate (or thiophosphate) ester compound
to obtain the desired ester or thioester. For the preparation of
dye conjugates, see G. T. Hermanson, Bioconjugate Techniques
(Academic Press 1996).
[0038] The present invention provides a compound of the formula
II:
##STR00005##
wherein R.sup.11-R.sup.14 are selected from the group consisting of
H and groups or atoms other than H; X.sup.4-X.sup.9 are
independently O or S. m and n are 0 or 1 but m and n cannot be 0
simultaneously. R.sup.15-R.sup.24 can be H or any substituent so
long as the compound of formula II upon hydrolysis, e.g., of the
P--X.sup.6 and/or P--X.sup.9 bonds, provides a fluorescent
compound. When m or n is 0, the substituent at that position is
H.
[0039] In an embodiment of the formula II, R.sup.11-R.sup.14 are
independently selected from the group consisting of H,
C.sub.1-C.sub.6 alkyl, C.sub.5-C.sub.8 cycloalkyl, C.sub.1-C.sub.6
haloalkyl, C.sub.1-C.sub.6 perfluoroalkyl, C.sub.2-C.sub.6 alkenyl,
and C.sub.2-C.sub.6 alkynyl, and aryl, arylcarbonyl, and
heteroaryl, which may be optionally substituted with a substituent
selected from the group consisting of hydroxyl, cyano, nitro, halo,
amino, amido, azido, acetal, ketal, imido, sulfo, sulfonyl,
sulfinyl, thiocyanato, aldehydro, keto, carbamoyl, urethane,
ureido, and guanidino; and X.sup.4-X.sup.9 are independently O or
S, preferably O. In a preferred embodiment, m and n are 1.
[0040] In accordance with an embodiment of the invention in formula
II, R.sup.15-R.sup.24 are independently selected from the group
consisting of H, hydroxyl, cyano, nitro, halo, amino, amido, azido,
acetal, ketal, imido, sulfo, sulfonyl, sulfinyl, sulfomethyl, a
salt of sulfomethyl, thiocyanato, aldehydro, keto, carbamoyl,
urethane, ureido, guanidino, C.sub.1-C.sub.6alkylamino,
C.sub.1-C.sub.6 acylamino, C.sub.1-C.sub.6 alkylamido,
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6
alkylthio, C.sub.5-C.sub.8 cycloalkyl, C.sub.1-C.sub.6 haloalkyl,
C.sub.1-C.sub.6 perfluoroalkyl, formyl, carboxamide of the formula
--(C.dbd.O)NR.sup.1R.sup.2 where R.sup.1 and R.sup.2 are
independently H, alkyl having 1-6 carbon atoms, an aryl, or R.sup.1
and R.sup.2 taken together form a saturated 5- or 6-membered ring
having the formula --(CH.sub.2).sub.2-M-(CH.sub.2).sub.2-- where
the ring moiety M is a single bond, an oxygen atom, a methylene
group, or the secondary amine --NR.sup.7-- where R.sup.7 is H or
alkyl having 1-6 carbon atoms, C.sub.5-C.sub.8 halocycloalkyl,
C.sub.1-C.sub.6 hydroxyalkyl, C.sub.5-C.sub.8 hydroxycycloalkyl,
C.sub.1-C.sub.6 alkoxy C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6
alkoxycarbonyl, C.sub.2-C.sub.6 alkoxycarbonyl C.sub.1-C.sub.6
alkyl, carboxy C.sub.1-C.sub.6 alkyl, carboxy C.sub.1-C.sub.6
alkoxy, dicarboxy C.sub.1-C.sub.6 alkyl, dicarboxy C.sub.1-C.sub.6
alkoxy, C.sub.2-C.sub.6 cyanoalkyl, phosphono C.sub.1-C.sub.6
alkyl, phosphoryl C.sub.1-C.sub.6 alkyl, mono-, di-, and
trisaccharides, nucleic acids, oligonucleotides, amino acids,
peptides, and proteins, and C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, aryl, arylcarbonyl, and heteroaryl, which
may be optionally substituted with a substituent selected from the
group consisting of hydroxyl, cyano, nitro, halo, amino, amido,
azido, acetal, ketal, imido, sulfo, sulfonyl, sulfinyl,
thiocyanato, aldehydro, keto, carbamoyl, urethane, ureido, and
guanidino.
[0041] In a preferred embodiment of the compound of formula II,
R.sup.11-R.sup.14 are independently selected from the group
consisting of H, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, aryl, and heteroaryl, more preferably from
the group consisting of H, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6
alkenyl, and C.sub.2-C.sub.6 alkynyl. In a further preferred
embodiment, R.sup.11-R.sup.14 are independently selected from the
group consisting of C.sub.1-C.sub.6 alkyl, for example,
R.sup.11-R.sup.14 are ethyl, and m and n are 1. Specific examples
are a compound wherein X.sup.4-X.sup.9 are O, R.sup.15-R.sup.24 are
H, R.sup.11-R.sup.14 are ethyl; and m and n are 1 and a compound
wherein X.sup.4, X.sup.5, X.sup.7, and X.sup.8 are O; X.sup.6 and
X.sup.9 are S; R.sup.15-R.sup.24 are H; R.sup.11-R.sup.14 are
ethyl; and m and n are 1.
[0042] In the compounds of formula I and II, aryl is a 1-3 aromatic
ring containing group, preferably phenyl; heteroaryl is a 5- or
6-membered aromatic heterocycle that is optionally fused to an
additional 6-membered aromatic ring or to one or more
heteroaromatic ring containing 1-3 heteroatoms selected from the
group consisting of O, N, and S. Examples of heteroaryl include
pyrrole, thiophene, furan, oxazole, isooxazole, or imidazole,
benzoxazole, benzothiazole, benzimidazole, benzofuran, and
indole.
[0043] The compounds of formula II can be prepared by any suitable
method. For example, fluorescein diphosphate tetraethyl ester can
be prepared as shown in Example 10.
[0044] In an embodiment, the compounds of the present invention can
be linked or conjugated to other molecules, groups, or substance,
e.g., a dye, a reactive group, an antibody, or a solid support.
[0045] "Assay Buffer" is the buffer used in the detection of
paraoxonase activity and is composed of 20 mM Tris.HCl, 150 mM NaCl
and 2 mM CaCl.sub.2 at pH 8.0 at 25.degree. C.
[0046] "Biological fluid" is a sample of a fluid originating from a
biological source. Examples of biological fluids include, but are
not limited to blood, blood-derived compositions, serum,
cerebrospinal fluid, urine, saliva, milk, ductal fluid, tears,
semen, cell or tissue extracts, culture medium from the expression
of paraoxonase or mutations of paraoxonase, samples arising from
the fractionation of paraoxonase or HDL from biological
samples.
[0047] "DEPFMU" is the abbreviation for
7-diethyl-phospho-6,8-difluoro-4-methylumbelliferyl, a chemical
compound that is one of the newly invented fluorogenic substrates
for detection of paraoxonase activity
[0048] "Environmental sample" is a sample obtained from the
environment for purposes of detection of paraoxonase or OPs. It may
be soil, water, air or any other material obtained natural
environment.
[0049] "FDPTEE" is the abbreviation for fluorescein diphosphate
tetraethyl ester.
[0050] "OP" is the abbreviation for organophosphate, which includes
a variety of organic compounds that contain phosphorus and often
have intense neurotoxic activities. This includes such compounds as
sarin and soman, which were originally developed as nerve gases, as
well as others widely used as insecticides and fire retardants.
[0051] OPH refers to the protein encoded by organophosphorus
hydrolase which is expressed by two soil dwelling bacteria,
Pseudomonas diminuta and Flavobacterium sp. It hydrolyses a number
of organic esters including paraoxon.
[0052] "Paraoxonase" refers to the protein encoded by PON1 gene.
Paraoxonase is a serum protein that possesses enzymatic activity.
It hydrolyzes a number of organic and phospho-organic esters
including paraoxon. The physiological function of paraoxonase is
not known with certainty.
[0053] "PON1" refers to the gene encoding the protein known as
paraoxonase, or arylesterase (EC 3.1.1.2). Paraoxonase is present
in normal human plasma and the cDNA, and genes encoding the human
protein have been sequenced and characterized.
[0054] "Substrate for organophosphatase" refers to one of a number
of chemical compounds that are hydrolyzed by OPH and/or
paraoxonase. These include DEPFMU, phenyl acetate, oxidized lipids
and paraoxon.
[0055] "355/460" refers to an excitation wavelength of 355 nm and
an emission wavelength of 460 nm.
[0056] The present invention further provides a method for
detecting and/or measuring the activity of organosphosphatase in a
fluid comprising contacting the fluid with a compound of formula I,
wherein R.sup.3-R.sup.6 and R.sup.8-R.sup.10 can be any atom or
group and X.sup.1, X.sup.2, and X.sup.3 are independently O or S;
or of the formula II, wherein R.sup.11-R.sup.14 are selected from
the group consisting of H and groups or atoms other than H;
X.sup.4-X.sup.9 are independently O or S. n and m are 0 or 1 but m
and n cannot be 0 simultaneously. R.sup.15-R.sup.24 can be H or any
substituent so long as the compound of formula II upon hydrolysis
provides a fluorescent compound; measuring the fluorescence of a
fluorescent product formed during the contacting; and correlating
the measured fluorescence with the activity of the paraoxonase
enzyme. Any of the compounds described above in paragraphs
[0029]-[0036] and [0038]-[0042] may be employed in the method of
the present invention.
[0057] In an embodiment of the method of detecting and/or measuring
the activity of paraoxonase, the compound of formula I can be one
wherein R.sup.3, R.sup.4, R.sup.5, R.sup.9, and R.sup.10 are
selected from the group consisting of H and groups or atoms other
than H, and R.sup.6 and R.sup.8 are halo. In an embodiment of the
method of detecting and/or measuring the activity of paraoxonase,
the compound of formula II can be one wherein X.sup.4-X.sup.9 are
O, m and n are 1, R.sup.11-R.sup.24 are H.
[0058] In accordance with an embodiment, the compounds described
above can be used for detection of organophosphatase activity and
specifically paraoxonase activity in a biological fluid. Examples
of biological fluids include, but are not limited to, blood,
blood-derived compositions or serum, cerebrospinal fluid, urine,
saliva, milk, ductal fluid, tears, semen, brain, artery, vein and
gland extracts. Other fluids may contain culture medium from the
expression of paraoxonase or mutations of paraoxonase. Still
further fluids may be taken from methods and processes resulting in
the fractionation of paraoxonase or HDL from biological samples. In
an embodiment, the fluid is an environmental fluid, for example, an
extract of soil, water, or swab.
[0059] In accordance with an embodiment, the compounds described
above can be used for detection of organophosphatase activity and
specifically OPH activity in a biological fluid or environmental
extract. Examples of biological fluids include, but are not limited
to, blood, blood-derived compositions or serum, cerebrospinal
fluid, urine, saliva, milk, ductal fluid, tears, semen, brain,
artery, vein and gland extracts. Other fluids may contain culture
medium from the expression of OPH or mutations of OPH. Still
further fluids may be taken from methods and processes resulting in
the fractionation of OPH from biological samples. In an embodiment,
the fluid is an environmental fluid, for example, an extract of
soil, water, or swab.
[0060] In a further embodiment, the present invention provides a
method for predicting the existence of cardiovascular diseases. The
present invention further provides a method for predicting a
person's sensitivity to OPs. The activity of paraoxonase as
measured using the compounds of the present invention can be used
as a predictor of cardiovascular disease and sensitivity to
OPs.
[0061] In a further embodiment, the present invention provides a
method for predicting the potential for septic shock. The present
invention further provides a method for predicting a person's
sensitivity to LPS. The activity of paraoxonase as measured using
the compounds of the present invention can be used as a predictor
of sensitivity to LPS.
[0062] In another embodiment, the present invention provides a
method for evaluating and/or predicting the functional activity of
preparations of HDL. The paraoxonase activity measured by the
fluorescence in accordance with the present invention may be used
for evaluation/prediction of functional activity of preparations of
high density lipoproteins.
[0063] In a further embodiment, detection of fluorescence is
achieved using an excitation wavelength and an emission wavelength.
In a further embodiment, OPH and paraoxonase activity can be
monitored using a fluorimeter with an excitation wavelength at 355
nm and an emission wavelength at 460 nm. Other assay formats
include analysis of OPH activity in gels after protein separation
by electrophoresis or analysis of paraoxonase expression/secretion
in live or dead cells embedded in low melting point agarose,
immunoblotting, western blot analysis, and fluorescent detection in
situ with detection by microscopy, visual inspection, via film.
Alternatively OPH or paraoxonase may be immobilized on supports
such as membranes, resins or dipsticks.
[0064] In a further embodiment, organophosphatase activity may be
detected on the surface of cells expressing paraoxonase activity
using a cell sorter (e.g., fluorescence assisted cell sorter or
FACS).
[0065] In a further embodiment the compounds of the present
invention can be used to quantify the activity of OPases such as
those associated with paraoxonase or variants of paraoxonase
including natural variants or artificially created mutant forms of
paraoxonase.
[0066] In a further embodiment the compounds of the present
invention can be used to quantify the activity of
organophosphatases such as those associated with OPH or variants of
OPH including natural variants or artificially created mutant forms
of OPH.
[0067] In a further embodiment the presence of competing substrates
(or compounds) for organophosphatase can be identified by
inhibition of fluorescence in the presence of a substrate for OPH
or paraoxonase. In a preferred embodiment, the substrate is DEPFMU
and the competing substrate is an OP such as sarin or soman. In a
further embodiment, paraoxonase is immobilized on a support and its
activity is measured by the production of a fluorescent signal.
Environmental extracts including water and air, extracts of swabs
are added to paraoxonase and alternative substrates identified by a
decrease in fluorescence. Environmental extracts may be extracted
with aqueous or organic solvents, supercritical fluids, subcritical
fluids, and the like.
[0068] In a further embodiment, OPH is immobilized on a support and
its activity is measured by the production of a fluorescent signal.
Environmental extracts including water and air, extracts of swabs
are added to OPH and alternative substrates identified by a
decrease in fluorescence. Environmental extracts may be extracted
with aqueous or organic solvents, supercritical fluids, subcritical
fluids, and the like.
[0069] A wide variety of organic and inorganic polymers, both
natural and synthetic, may be employed as the material for
immobilizing organophosphatases such as OPH or paraoxonase.
Illustrative polymers include polyethylene, polypropylene,
polymethacrylate, polyacrylate, rayon, nylon, cellulose,
nitrocellulose, and polyvinylidene fluoride. The immobilized
organophosphatase can be quantified by contacting with a compound
of the present invention.
[0070] In a further embodiment, the present invention provides a
method for monitoring decontamination of the environment of OPs.
The extract of the soil treated with paraoxonase (for
decontamination) can be contacted with a compound of the present
invention, and the fluorescence produced can be an indication of
the completeness of decontamination. In a still further embodiment,
the compound of the present invention can be employed to identify
soil-dwelling micro-organisms or plants which express either OPH
and/or paraoxonase.
[0071] In a further embodiment the organophosphatase is coupled to
a secondary structure such as an antibody with specificity for an
alternative target such that the secondary structure binds to its
target to form a organophosphatase-secondary structure: target
complex. The organophosphatase may then be used as a reporter
protein and the presence of the organophosphatase-secondary
structure: target complex identified using the substrates or
compounds of the present invention.
[0072] In a further embodiment, the PON1 gene is co-transfected
with another protein of interest and used as a reporter gene for
expression of the target protein. In a still further embodiment,
the PON1 gene is under the control of different promoters and the
fluorescent substrate used to determine the activity of different
promoters.
[0073] In a further embodiment, the OPH gene is co-transfected with
another protein of interest and used as a reporter gene for
expression of the target protein. In a still further embodiment,
the OPH gene is under the control of different promoters and the
fluorescent substrate used to determine the activity of different
promoters.
[0074] In a further embodiment the substrate is added to cells
incubated with different molecules that may up-regulate the PON1
promoter and hence the expression of paraoxonase. Up-regulators of
paraoxonase expression are identified by the increase in
fluorescent signal in the presence of paraoxonase substrate. These
regulators may affect signal transduction pathways that ultimately
result in up-regulation of the gene promoter.
[0075] Unexpectedly, the replacement of two protons on the
phosphate group of 6,8-difluoro-4-methylumbelliferyl phosphate by
ethyl groups (and other low molecular weight groups, e.g.,
hydrocarbon groups) generates a poor substrate for serum or
cell-derived phosphatases but a good substrate that is selectively
hydrolyzed by serum and recombinant paraoxonases and OPH. This is
in marked contrast to phosphatase specific substrates, such as
6,8-difluoro-4-methylumbelliferyl phosphate which is readily
hydrolyzed by phosphatases, but not by paraoxonase. Thus, DEPFMU
may be used as a paraoxonase specific substrate which can
accurately detect serum paraoxonase activity even in the presence
endogenous phosphatase. Consequently, a major advantage of DEPFMU
over prior art, is the unexpectedly low specificity of this
substrate to phosphatase and its high specificity for
organophosphatases such as OPH and paraoxonase.
[0076] The present invention further provides a method for
detecting and/or measuring the activity of organophosphatase
including paraoxonase immobilized on a support comprising
contacting the support with any of the compounds of formula I or
II; measuring the fluorescence of a fluorescent product formed
during the contacting; and correlating the measured fluorescence
with the activity of the paraoxonase enzyme. In an embodiment, the
support is a membrane, resin, biosensor, microtiter plate, nanotube
or dipstick, fiber, silicon chip, magnetic beads, and different
gels.
[0077] The present invention further provides a method for
selectively detecting organophosphatase in a sample suspected to
contain organophosphatase and a phosphatase comprising contacting
the sample with any of the compounds of formula I or II, e.g., the
compound of formula I, wherein R.sup.3, R.sup.4, R.sup.5, R.sup.9,
and R.sup.10 are selected from the group consisting of H and groups
or atoms other than H, and R.sup.6 and R.sup.8 are halo or H; and
the compound of formula II, wherein X.sup.4-X.sup.9 are O, m and n
are 1, R.sup.11-R.sup.24 are H; measuring the fluorescence of a
fluorescent product formed during the contacting; and correlating
the measured fluorescence with the activity of the
organophosphatase enzyme.
[0078] The present invention further provides a method for
detecting and/or measuring the activity of organophosphatase enzyme
immobilized on a support comprising contacting the support with any
of the compounds of formula I or II; e.g., the compound of formula
I, wherein R.sup.3, R.sup.4, R.sup.5, R.sup.9, and R.sup.10 are
selected from the group consisting of H and groups or atoms other
than H, and R.sup.6 and R.sup.8 are halo or H; and the compound of
formula wherein X.sup.4-X.sup.9 are O, m and n are 1,
R.sup.11-R.sup.24 are H; measuring the fluorescence of a
fluorescent product formed during the contacting; and correlating
the measured fluorescence with the activity of the
organophosphatase enzyme.
[0079] The substrates of the present invention provide unexpected
specificity and sensitivity for detection of OPases even in the
presence of the high acid and alkaline phosphatase activities found
in cellular extracts, plasma and sera. The fact that the substrates
of the present invention are even recognized by organophosphatases
is surprising in view of the large size of the fluorogenic groups
used relative to the known substrates for these proteins. Thus,
there is no data available a priori to suggest that such a bulky
substrate would be accessible to the active site of
organophosphatases such as paraoxonase let alone selectively
hydrolyzed by the protein.
[0080] The following examples further illustrate the invention but,
of course, should not be construed as in any way limiting its
scope.
Example 1
[0081] This example demonstrates the specificity of
7-[diethyl-phospho]-,8-difluor-4-methylumbelliferyl towards
paraoxonase.
[0082] The tested compounds included: 4-methylumbelliferyl acetate,
4-methylumbelliferyl oleate, 4-methylumbelliferyl heptanoate,
4-methylumbelliferyl palmitate,
6,8-difluoro-4-methylumbelliferyl-octanoate,
7-[diethyl-phospho]-6,8-difluoro-4-methylumbelliferyl [DEPFMU], and
ELF-97 palmitate (Molecular Probes, OR), fluorescein diphosphate
tetraethyl ester, (3-carboxypropyl)-trimethylammonium chloride
4-methylumbelliferyl ester, and
7-benzyloxy-6,8-difluoro-4-methylumbelliferyl. All compounds were
evaluated for possible detection of paraoxonase activity using
recombinant human paraoxonase, expressed in CHO cells. For
expression of recombinant paraoxonase, human liver cDNA was
obtained from Ambion Inc, (Austin, Tex.). Human PON1 cDNA was
amplified by PCR with gene specific primers, TRSSP 216
[AAGAATTCCACCATGGCGAAGCTGATTGCGCTC] [SEQ ID NO:1] and TRSSP 217
[AATCTAGATTAGAGCTCACAGTAAAGAGCTTTGTG] [SEQ ID NO:2] containing Xba
I and EcoRI restriction sites. Hassett C, Richter R J, Humbert R,
Chapline C, Crabb J W, Omiecinski C J, Furlong C E.
Characterization of cDNA clones encoding rabbit and human serum
paraoxonase: the mature protein retains its signal sequence.
Biochemistry, October 22; 30(42):10141-9 (1991). Amplified PCR
product containing PON1 cDNA was cloned into pBlueScript KS II
vector (Stratagene, CA) as XbaI/EcoRI fragment, sequenced from T3
and T7 primers to confirm identity of DNA and then subcloned into
an expression vector containing EF-1a promoter and GC-MSF poly (A)
signal, forming expression vector pHLSS131. The expression vector
DNA was propagated in E. coli, DH5a strain, and purified using
Quagen Maxiprep kit for plasmid purification (Quagen, CA). CHO
cells were obtained from ATCC and cultivated according to the
recommended conditions. CHO cells were transfected with the
expression vector using Fugene 6 reagent (Roche Diagnostic,
Indianapolis, Ind.) according the manufacturer's manual. 48 hours
after transfection, the level of PON1 expression was easily
detectable by using standard substrates like paraoxon and
phenylacetate. The test compounds were screened for paraoxonase
mediated hydrolysis by incubation with transfected CHO cells.
Fluorescent monitoring of the reaction was performed using
SpectraMax GenimiXS fluorimeter, Molecular Devises Inc. (Sunnyvale,
Calif.).
[0083] DEPFMU was specifically hydrolyzed by paraoxonase. After
hydrolysis, highly fluorescent 6,8-difluoro-4-methylumbelliferyl is
released. Since the DEPFMU itself does not possess any significant
fluorescence, hydrolysis can be easily and safely monitored using
any commercial fluorimeter with excitation at 355 nm and emission
at 460 nm.
Example 2
[0084] This example illustrates an assay for detection of
paraoxonase activity. DEPFMU may be used as a substrate for
detection of serum derived as well as recombinant paraoxonase
expressed in cell cultures. The following conditions have been used
for the detection of paraoxonase in plasma. Samples of serum or
plasma may be diluted 1 to 100 times in an assay buffer. This assay
was performed in a 96 well "Nunc-immuno" plate. For example, 10
.mu.l of diluted rabbit serum was added to each well of a 96 well
plate containing 100 .mu.l of assay buffer plus 100 .mu.M of DEPFMU
(stock DEPFMU was prepared as a 50 mM concentrate in
dimethylformamide and stored at -20.degree. C.). After thorough
mixing the assay solution containing plasma was incubated for 20
min. at 37.degree. C. Hydrolysis of DEPFMU was quantified by
measuring the fluorescence level at 355/460 using a commercial
fluorimeter. The level of fluorescence correlates with the level of
6,8-difluoro-4-methylumbelliferyl released from DEPFMU as result of
paraoxonase mediated hydrolysis. The actual amount of
6,8-difluoro-4-methylumbelliferyl released in the assay may be
calibrated with a known amount of
6,8-difluoro-4-methylumbelliferyl. An example of paraoxonase
detection in different serum samples is presented in FIG. 1.
Similar methods can be used for detection of recombinant
paraoxonase expressed in cell culture.
[0085] Since a significant percentage of recombinant paraoxonase
stays associated with the cell membrane, methods were developed for
evaluating the cell membrane associated paraoxonase. One such
method harvests cells expressing paraoxonase, washes them twice
with PBS (Dulbecco's Phosphate Buffer System) to remove endogenous
paraoxonase which originates from either paraoxonase present in the
growth medium or is synthesized and secreted by the cells. Washed
cells are pelleted by centrifugation and resuspended in PBS at a
density of up to 10.sup.7 cells/ml. 10 .mu.l of the cell suspension
is mixed with 100 .mu.l of substrate solution per well of a 96 well
microtiter plate, incubated for 20 min. and the fluorescence level
measured as described above. As an option for this assay, adhesive
cells may be plated into a microtiter plate a day or more before
evaluation. The medium is then removed and the cells washed two
times with PBS. 100 .mu.L of substrate solution is added and
fluorescence monitored after 20 or more minutes of incubation at
37.degree. C. An example of the detection of membrane-associated
paraoxonase is shown in FIG. 2. This shows the detection of
paraoxonase activity with DEPFMU for CHO cells transfected with
PON1 versus background fluorescence using non-transfected
cells.
Example 3
[0086] This example illustrates a method of detecting recombinant
paraoxonase activity in CHO cells transfected with paraoxonase.
[0087] Human PON1 cDNA was recovered, cloned into pBlueScript KS
II, and sequenced to confirm identity. For studies on the
expression of paraoxonase PON1, cDNA was subcloned in expression
vector under the control of the EF-1a promoter. CHO cells were
transfected using Fugene 6 reagent with expression vector pHLSS122,
containing human PON1 cDNA under EF-1a promoter in pBlueScript KS
II cloning vector. Transfection with pBlueScript KS II vector DNA
was performed for control CHO cells. Transfected cells were plated
into 96 well tissue culture plates. 48 hours after transfection,
the wells were washed twice with PBS and 100 .mu.l of assay buffer
containing 100 .mu.M DEPFMU was added. Immediately after addition,
the fluorescence of the wells was monitored using a 96 well
SpectraMax Gemini XS fluorescence reader at 355/460.
[0088] Data from this experiment is presented on FIG. 2.
Mock-transfected CHO cells do not hydrolyze DEPFMU, whereas cells
transfected with the vector expressing paraoxonase catalyses
significant hydrolysis of the substrate. Since the only difference
between the two cell populations is that transfected cells express
human paraoxonase activity whereas the control cells do not. This
further demonstrates that the substrates of the present invention
are highly specific for paraoxonase and there are no significant
levels of enzyme in normal cells which are able to hydrolyze
DEPFMU.
Example 4
[0089] This example illustrates a method for measuring the Km of
recombinant rabbit paraoxonase for DEPFMU.
[0090] CHO cells were transfected with the plasmid pHLSS131
expressing rabbit PON1 cDNA. See example 1 and 2 for additional
details of transfection and expression. After transfection the
cells were propagated in growth medium, harvested and paraoxonase
was partially purified from the cell membrane by extraction with
0.03% Tergitol (Sigma) in PBS. Extracted paraoxonase was separated
from cells by centrifugation at 10000 g for 10 min. The supernatant
was considered as partially purified paraoxonase. 10 .mu.l of three
different dilutions 1/5, 1/10 and 1/20 of recombinant paraoxonase
(1/v-A, 1/v-B and 1/v-C) were incubated with 100 .mu.l of serially
diluted DEPFMU as the substrate at 37.degree. C. in a 96 well
micro-titer plate. The time-course of DEFPMU hydrolysis was
measured by monitoring fluorescence every 5 min at 355/460 as
described above. Data on this experiment is presented in FIG. 3.
Velocity of reaction was calculated as the change in the level of
fluorescence over time. Stable velocity of reaction was observed up
to 30 min of reaction. Actual Km of paraoxonase for DEPFMU was
calculated as 666 .mu.M. For comparison the Km of human paraoxonase
for paraoxon is around 500 .mu.M [9].
Example 5
[0091] This example provides a comparison of the sensitivity of
paraoxon and a compound of the present invention as a substrate for
paraoxonase detection.
[0092] This experiment demonstrates the relative sensitivity of
DEPFMU-based assay compared with paraoxon based assays. 10 .mu.l of
serially diluted samples of rabbit serum were incubated for 30 min
at 37.degree. C. in the presence of 100 .mu.l of 4 mM paraoxon or
100 .mu.l of 100 .mu.M DEPFMU in the assay buffer described above.
After incubation, the optical density change of paraoxon was
measured at a wavelength of 405 nm and the fluorescence of DEPFMU
hydrolysis was measured at 355/460. The data is presented in FIG.
4. Reliable detection of paraoxonase activity was considered to be
greater than two standard deviation units above background. This
experiment demonstrates that the limit of detection of enzyme
activity for paraoxon-based assay was less than 1/1,000 dilution of
serum whereas that for DEPFMU was greater than a 1/10,000 fold
dilution. Thus, DEPFMU-based assays a significantly higher
sensitivity. The sensitivity and velocity of fluorescent detection
of DEPFMU was sub-optimal due to using a substrate concentration
(100 .mu.M), well below the Km of [.about.666 .mu.M], whereas the
assay using paraoxon was well above the Km.
Example 6
[0093] This example illustrates the hydrolysis of DEPFMU and
detection of PON1 activity in CHO cells transfected with different
PON1 mutants.
[0094] 2.times.10.sup.5 CHO cells in a 96 well plate were
transfected by 1 .mu.g of DNA with Fugene 6 reagent. DNA vector
contained PON1 cDNA driven by EF-1 promoter. Since different
natural variants of PON1 have different substrate specificity, four
different variant/mutants of PON were used (145-6, 142-2, 131-10,
and 122-7). 48 hours after transfection, cells were washed with PBS
and 100 .mu.L of the DEPFMU substrate were added. Final
concentration of the substrate was 40 .mu.g/mL in 50 mM Tris buffer
pH 8.0, 100 mM NaCl, and 1 mM CaCl.sub.2. After 10 min. of
incubation at 37 C, fluorescence was measured at 355 nm excitation
and 460 nm emission. The results are shown in FIG. 5. All four
mutants hydrolyzed the DEPFMU with very high efficiency.
Spontaneous hydrolysis of substrate by CHO non-transfected cells
was about 3%. The control CHO cell did not hydrolyze the
substrate.
Example 7
[0095] This example illustrates the sensitivity of detection
provided by an embodiment of the present invention. We compared the
sensitivity of detection of a serial dilution of OPH from 10
.mu.g/ml to 0.5 ng/ml using different substrates including paraoxon
and DEPFMU. 10 .mu.l of OPH solution was mixed with 100 .mu.l of
buffer containing 100 .mu.M of DEPFMU, or 1.2 mM of paraoxon.
Samples were incubated for 30 min at 37.degree. C. with changes in
optical properties monitored every 5 min. Assuming a molecular
weight of 39,000 kDa and 100% purity and activity of the protein as
low as 1 femtomole (fmol) of OPH per well was reliably detected.
For paraoxon the level of reliable detection was around 100 fmole
of OPH per well. The catalytic rate (k.sub.cat) of OPH mediated
hydrolysis was 1.5.times.10.sup.3 min.sup.-1 for DEPFMU and
4.times.10.sup.4 min.sup.-1 for paraoxon. Though the k.sub.cat for
paraoxon was more than 10 times higher than the k.sub.cat for
DEPFMU, the superior signal to noise ratio for the coumarin
fluorophore over the optical change in nitrophenol, which was
released after paraoxon hydrolysis, makes the DEPFMU based assay
system approximately 100 times more sensitive for OPH detection
than paraoxon. The Km of DEPFMU for OPH was analyzed. For this
experiment 10 .mu.l of OPH solution containing 25 fmoles of enzyme
were mixed with 100 .mu.l of 100 .mu.M DEPFMU. The velocity of
hydrolysis was constant only during the first 10 min of reaction
and decreases after 10-15 min. A decline in hydrolysis was detected
only after 25-30 min (data not shown) following OPH mediated
hydrolysis of paraoxon. The Km of DEPFMU for OPH, was evaluated
using concentrations of DEPFMU ranging from 290 .mu.M to 2 .mu.M.
10 .mu.l of solution containing 25 fmoles of OPH were mixed with
100 .mu.l of substrate solution. The reciprocal of the Km of DEPFMU
was obtained from the intercept on the abscissa using a
Lineweaver-Burk Plot (1/v) where v is the velocity of the reaction
against 1/[S] where [S] is the substrate concentration. The
apparent Km was calculated as 29 .mu.M.
Example 8
[0096] This example illustrates a superior property of a substrate
of the present invention, DEPFMU, relative to that of
6,8-difluoro-4-methylumbelliferyl phosphate (DiFMUP) as substrate
for detection of paraoxonase. CHO cells were transfected using
Fugene 6 reagent with the expression vector pHLSS122, containing
human PON1 cDNA under EF-1a promoter in pBlueScript KS II cloning
vector. Transfection with pBlueScript KS II vector DNA was
performed for control CHO cells. Different plasmids 182, 178, 190,
184 188 and 186 containing different mutants and natural variants
of PON1 were used for expression. Transfected cells were plated
into 96 well tissue culture plates. 48 hours after transfection,
the wells were washed twice with PBS and 100 .mu.l of assay buffer
containing 100 .mu.M DEPFMU or 100 .mu.M DiFMUP was added.
Immediately after addition, the fluorescence of the wells was
monitored using a 96 well SpectraMax Gemini XS fluorescence reader
at an excitation wavelength of 355 nm and an emission wavelength of
460 nm. The data from this experiment is presented on FIGS. 6a and
6b. On FIG. 6a, DEPFMU hydrolysis by control and transfected cells
was demonstrated. As it is seen from the figure, mock-transfected
CHO cells do not hydrolyze DEPFMU, whereas cells transfected with
the vector expressing paraoxonase catalyses significant hydrolysis
of the substrate. FIG. 6b demonstrates data on DiFMUP hydrolysis by
control and transfected CHO cells. The control cells as well as
experimentally transfected cells do hydrolyze significant amount of
DiFMUP, indicating there is significant PON1 independent hydrolysis
of DiFMUP. Most probably this high level of hydrolysis is mediated
by cell phosphatases, which are abundant in the majority of cell
lines. The significant paraoxonase independent hydrolysis of DiFMUP
precludes this substrate being useful for the detection of
paraoxonase.
Example 9
[0097] This example illustrates a method for the detection of
organophosphatase. Fluorescein diphosphate tetraethyl ester
(FDPTEE) was used as a substrate for detection of organophosphatase
activity. The experiment was performed as described above in
example 7. Briefly, serial dilution of OPH from 10 .mu.g/ml to 0.5
ng/ml was prepared. 10 .mu.l of the various dilution of OPH were
mixed with 100 .mu.l of buffer containing 100 .mu.M of FDPTEE.
Samples were incubated for 30 min at 37.degree. C. and fluorescence
(Ex 488 nm/Em 520 nm) was monitored every 5 min. The results
obtained are shown in FIG. 7. Assuming that the enzyme has a
molecular weight of 39,000 kDa and is 100% pure and fully active as
low as 100 femtomole (fmol) of OPH per well was reliably detected,
showing it to be applicable as a substrate for OPase.
[0098] The specificity of FDPTEE for paraoxonase was demonstrated
using sera samples obtained from mice than had their PON1 gene
destroyed through embryonic stem cell technology (PON1 KO) (10). In
these experiments, 10 .mu.l of sera samples from normal C57B1/6
mice and PON1 KO C57 Black/6 mice were diluted 1/10 with 150 mM
NaCl and 20 mM Tris pH 8.0. 10 .mu.l of diluted sera were mixed
with 100 .mu.l of 100 .mu.M FDPTEE and incubated for 30 min at
37.degree. C. After incubation the level of fluorescence was
measured (Ex 488 nm/Em 520 nm). The results obtained are shown in
FIG. 8. No fluorescence was detected in samples of sera obtained
from PON1 KO mice, whereas significant fluorescence was detected in
sera samples obtained from normal C57Black mice. These data confirm
that serum paraoxonase is the enzyme responsible for FDPTEE
hydrolysis and generation of fluorescence signal in normal
samples.
Example 10
[0099] This example illustrates a method of preparing an embodiment
of the compound of formula II, namely, fluorescein diphosphate
tetraethyl ester. 2.5 g of fluorescein (7.5 mmol) is suspended in
THF (60 mL) and anhydrous CH.sub.2Cl.sub.2 (mL). 3.1 g of
1H-tetrazole 3.1 g. (44 mmol) is added and stirred at room
temperature for .about.1.5 hours or until the reaction mixture
becomes a transparent dark yellowish solution. The resulting
solution is cooled to 0.degree. C. and 5.0 g of diethyl
N,N-diisopropylphosphoramidite (23 mmol) is added dropwise over a
period of 3-4 minutes to yield a very light yellow solution. The
cooling bath is removed and the reaction stirred at room
temperature until TLC shows no starting material remains (.about.5
minutes). The reaction is cooled back to 0.degree. C. R.sub.f
(fluorescein diphosphite, tetraethyl ester)=0.7-0.75, a quenching
spot that becomes fluorescent yellow upon heating; hexanes/EtOAc
(3:2) A solution of 3-chloroperoxybenzoic acid (MCPBA) (5.5 g, 32
mmol) in CH.sub.2Cl.sub.2/CHCl.sub.3 (9:1, 50 mL) is prepared, and
washed with saturated NaCl (1.times.50 mL), followed by drying over
Na.sub.2SO.sub.4. The dried solution is added to the 0.degree. C.
reaction mixture to yield a cloudy yellowish solution. The cooling
bath is removed and the reaction stirred at room temperature until
TLC indicates completion (.about.10 minutes). The solvent is
removed from the reaction mixture in vacuo and the resulting yellow
gum is dissolved in EtOAc (.about.100 mL). The solution is washed
with 10-20% sodium thiosulfate/H.sub.2O (1.times.100 mL), saturated
NaHCO.sub.3 (1.times.100 mL), and saturated NaCl (1.times.100 mL),
and dried over Na.sub.2SO.sub.2. The solvent is removed in vacuo.
At this point, TLC in hexanes/EtOAc (3:2) shows two spots:
R.sub.f-0.65-0.7, a quenching spot that becomes fluorescent upon
heating; and R.sub.f-0.95-1.0, a quenching spot that does not
fluoresce upon heating. 50 mL of methanol are added to the gum to
precipitate the high-R.sub.f material. The solid is removed by
filtration, and methanol is removed from the filtrate in vacuo. The
resulting product is purified by column chromatography under the
following conditions:
TABLE-US-00001 Stationary Phase medium SiO.sub.2 Mobile Phase
CHC1.sub.3 .fwdarw. 50% MeOH/CHC1.sub.3
About 50 mL of hexane is added to the resulting oily material to
form a solid. The solid is collected with filtration and dried to
constant weight in vacuo to yield FDP tetraethyl ester (fluorescein
diphosphate tetraethyl ester) as a white sold. Actual yield 1.61 g
(36%). R.sub.f(VI)=0.25, a quenching spot that becomes fluorescent
yellow upon heating; EtOAc/hexanes (2:1)
REFERENCES
[0100] 1. Aviram, M., Billecke, S., Sorenson, R., Bisgaier, C.,
Newton, R., Rosenblat, M., Erogul, J., Hsu, C., Dunlop, C., and La
Du, B. (1998). Paraoxonase active site required for protection
against LDL oxidation involves its free sulfhydryl group and is
different from that required for its arylesterase/paraoxonase
activities: selective action of human paraoxonase allozymes Q and
R. Arterioscler Thromb Vasc Biol 18, 1617-24. [0101] 2. Mackness,
B., Mackness, M. I., Arrol, S., Turkie, W., and Durrington, P. N.
(1998). Effect of the human serum paraoxonase 55 and 192 genetic
polymorphisms on the protection by high density lipoprotein against
low density lipoprotein oxidative modification. FEBS Lett 423,
57-60. [0102] 3. Costa, L. G., Cole, T. B., Jarvik, G. P., and
Furlong, C. E. (2003). Functional genomic of the paraoxonase (PON1)
polymorphisms: effects on pesticide sensitivity, cardiovascular
disease, and drug metabolism. Annu Rev Med 54, 371-92. [0103] 4.
Johnson, K. J., Ward, P. A., Goralnick, S., and Osborn, M. J.
(1977), Isolation from human serum of an inactivator of bacterial
lipopolysaccharide. Am J Pathol 88, 559-74. [0104] 5. La Du, B. N.,
Aviram, M., Billecke, S., Navab, M., Primo-Parmo, S., Sorenson, R.
C., and Standiford, T. J. (1999). On the physiological role(s) of
the paraoxonases. Chem Biol Interact 119-120, 379-88. [0105] 6. La
Du, B., Draganov, D. I., Stetson, P. L., and Watson, C. E. (2000).
PON3 and uses thereof U.S. Pat. No. 6,573,370. [0106] 7. Costa, L.
G., McDonald, B. E., Murphy, S. D., Omenn, G. S., Richter, it J.,
Motulsky, A. G., and Furlong, C. E. (1990). Serum paraoxonase and
its influence on paraoxon and chlorpyrifos-oxon toxicity in rats.
Toxicol Appl Pharmacol 103, 66-76. [0107] 8. Li, W. F., Furlong, C.
E., and Costa, L. G. (1995). Paraoxonase protects against
chlorpyrifos toxicity in mice. Toxicol Lett 76, 219-26. [0108] 9.
Josse, D., Xie, W., Renault, F., Rochu, D., Schopfer, L. M.,
Masson, P., and Lockridge, O. (1999), Identification of residues
essential for human paraoxonase (PON1)
arylesterase/organophosphatase activities. Biochemistry 38,
2816-25. [0109] 10. Shih D M, Gu L, Xia Y R, Navab M, Li W F, Hama
S, Castellani L W, Furlong C E, Costa L G, Fogelman A M, Lusis A J.
Mice lacking serum paraoxonase are susceptible to organophosphate
toxicity and atherosclerosis. Nature. 1998 Jul. 16; 394
(6690):284-7.
[0110] All references, including publications, patent applications,
and patents, cited herein are hereby incorporated by reference to
the same extent as if each reference were individually and
specifically indicated to be incorporated by reference and were set
forth in its entirety herein.
[0111] The use of the terms "a" and "an" and "the" and similar
referents in the context of describing the invention (especially in
the context of the following claims) are to be construed to cover
both the singular and the plural, unless otherwise indicated herein
or clearly contradicted by context. The terms "comprising,"
"having," "including," and "containing" are to be construed as
open-ended terms (i.e., meaning "including, but not limited to,")
unless otherwise noted. Recitation of ranges of values herein are
merely intended to serve as a shorthand method of referring
individually to each separate value falling within the range,
unless otherwise indicated herein, and each separate value is
incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention unless otherwise
claimed. No language in the specification should be construed as
indicating any non-claimed element as essential to the practice of
the invention.
[0112] Preferred embodiments of this invention are described
herein, including the best mode known to the inventors for carrying
out the invention. Variations of those preferred embodiments may
become apparent to those of ordinary skill in the art upon reading
the foregoing description. The inventors expect skilled artisans to
employ such variations as appropriate, and the inventors intend for
the invention to be practiced otherwise than as specifically
described herein. Accordingly, this invention includes all
modifications and equivalents of the subject matter recited in the
claims appended hereto as permitted by applicable law. Moreover,
any combination of the above-described elements in all possible
variations thereof is encompassed by the invention unless otherwise
indicated herein or otherwise clearly contradicted by context.
Sequence CWU 1
1
2133DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1aagaattcca ccatggcgaa gctgattgcg ctc
33235DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 2aatctagatt agagctcaca gtaaagagct ttgtg 35
* * * * *