Bacteriophage or lytic protein derived from the bacteriophage which effective for the treatment of staphylococcus aureus biofilm

Abstract

The present invention relates to compositions for removing a biofilm formed by Staphylococcus aureus, comprising a bacteriophage, such as Myoviridae family T4-like phage genus bacteriophage (Accession No: KCTC 11153BP, SAP-I) or Podoviridae family .phi.29-like virus genus bacteriophage (Accession No: KCTC11154BP, SAP-2), and lytic protein derived therefrom, that destroys the biofilm. Also disclosed are pharmaceutical compositions for the treatment of diseases caused by Staphylococcus aureus capable of forming biofilm.

Description

TECHNICAL FIELD

[0001] The present invention relates to a use of bacteriophage or lytic protein derived from the bacteriophage for the removal (destroy) of biofilm formed by Staphylococcus aureus. The present invention also relates to a use of bacteriophage or lytic protein derived therefrom which is effective in eliminating biofilm formed by Staphylococcus aureus for the treatment of disease caused by biofilm-forming Staphylococcus aureus. Therefore, the present invention provides a composition for the removal of biofilm formed by Staphylococcus aureus containing bacteriophage or lytic protein derived therefrom as an active ingredient and a pharmaceutical composition containing bacteriophage or lytic protein derived therefrom as well as conventional antibiotics to improve the antibacterial activity of the conventional antibiotics. The present invention provides a disinfectant, a medical cleaner and an environmental purifier for the purpose of removing biofilm formed by Staphylococcus aureus and also provides a therapeutic agent and antibacterial agent for treating diseases caused by biofilm-associated Staphylococcus aureus infection.

BACKGROUND ART

[0002] In a region infected with bacteria, a mucose structured community of bacterial cells enclosed in polymer matrix is found. This complex aggregation of bacterial cells is called biofilm or biological film (J Bacteriol 176: 2137-2142, 1994). In the biofilm, a bacterial colony is enveloped by extracellular matrix (mucosal surface) comprising polymer matrix (composed of polysaccharides and polypeptides). That is, biofilm is a complex composed of a solid biological surface. the bacterial colony, and a non-biological surface, the extracellular matrix. Therefore, in this invention, biofilm indicates the entire structure composed of such extracellular matrix and bacterial colony therein. Biofilm is the concept first proposed in the late 1970 by Professor Costerton, Chief of The Center for Biofilm Engineering, Montana State University, USA, which indicates the environment where many bacteria survive covered by extracellular matrix made of viscous materials secreted by bacteria (the bacteria adhered on a solid surface secrete viscous materials such as polysaccharides, etc). Biofilm is found everywhere in nature. Mucous slime found in rock or pond is one example. Biofilm is a small city of bacteria where bacteria communicate and defense themselves from outside world. So, biofilm provides an environment for bacteria to survive under diverse environmental stress including antibiotics.

[0003] Biofilm is frequently observed not only in nature but also in relation to infectious disease. It can be formed in organs of human and generated as plaques on teeth and can be generated on medical devices for transplantation or industrial equipments. Therefore, biofilm has been a major concern of researchers who study earache in middle ear and pneumonia accompanied with periodontal disease or cystic fibrosis. According to the report made by NIH, USA in 2002, maximum 80% of total bacterial infection was spread through biofilm.

[0004] Even antibiotics effective on planktonic bacteria lose their effect once bacteria form biofilm (Trends Microbiol 9: 34-39, 2001). Once bacteria form biofilm, an antibody cannot invade through the extracellular matrix of biofilm, resulting in disablement of host immune system. One of the best-known of the biofilm-specific properties is the development of antibiotics resistance that can be up to 1.000-fold greater than planktonic cells (Antimicrob Agents Chemother 47: 3407-3414, 2003). The mechanism of increase of resistance against antibiotics by biofilm has not been disclosed but can be outlined by the following three reasons. The first reason is "ecological change of microorganisms". Once biofilm is formed, adhesion among bacteria becomes strong, so that bacterial colony is not apt to be spread, resulting in the decrease of proliferation. Then, bacteria begin to lose dependence on interaction with environment and accordingly metabolism of bacteria becomes slow and sensitivity against antibiotics decreases.

[0005] The second reason is physical properties of "extracellular matrix composed of viscous polysaccharides". Viscous polysaccharides forming the extracellular matrix have electric property being apt to bind antibiotics. The binding of viscous polysaccharides to antibiotics interrupts the spread of antibiotics. That is, antibiotics cannot be delivered to target bacteria, so that the antibiotics cannot take an effect. The third reason is the "production of an inhibitor", which is presumably involved in the general antibiotic-resistance acquirement mechanism. The most representative inhibitor inhibiting the effect of antibiotics is .beta.-lactamases produced by Pseudomonas. Once biofilm is formed, bacteria residing therein but not having resistance start acquiring the resistance related genes by horizontal gene transfer and as a result these bacteria turn into resistant bacteria. Once biofilm is generated on infected area, it can be judged the area has become antibiotic-resistant condition. Therefore, once biofilm is generated, it is very difficult to treat infectious disease by using general antibiotics.

[0006] Thus, formation of biofilm indicates chronic bacterial infection. As described hereinbefore, sensitivity of bacteria to antibiotics becomes weak, suggesting that normal doses of antibiotics are not effective. To overcome such low sensitivity, antibiotics are over-used, only resulting in production of antibiotic resistant bacteria. That is, bacteria infection, particularly when biofilm is already generated, treatment with antibiotics is not effective any more.

[0007] To prevent antibiotics from being disabled by biofilm, a novel antibiotic capable of destroying biofilm is required or a method for co-treatment of a conventional antibiotic and a specific component capable of destroying the extracellular matrix of biofilm has to be developed in order for the conventional antibiotics to be effectively functioning.

[0008] Staphylococcus aureus is Gram-positive bacteria, which is a pathogenic microorganism causing purulence, abscess, various pyogenic infection, and sepsis. This is a very dangerous pathogen demonstrating the highest resistance against methicillin (73% at average, which is the top level of resistance world widely), according to the investigation in Korea. That means Staphylococcus aureus that is not killed by methicillin takes 73% by its total population, indicating that Staphylococcus aureus is a very dangerous pathogen. Many strains of Staphylococcus aureus are able to form biofilm. Once biofilm is generated, drug delivery is impossible, resulting in chronic infection. That is, biofilm formation causes chronic infection (FEMS Microbiology Letters 252: 89-96, 2005). The treatment of biofilm-associated disease caused by Staphylococcus aureus is especially difficult, compared with other bacteria infection treatments dealing with biofilms generated by other pathogens. Even if a drug is administered for treating disease, delivery of the drug is difficult because of biofilm. Even if the drug is delivered, the treatment effect on highly resistant Staphylococcus aureus is not so great by the conventional antibiotics based treatment. Therefore, to treat biofilm of Staphylococcus aureus, a novel approach with a novel material is necessary.

[0009] Various attempts have been made so far to treat biofilm generated by Staphylococcus aureus. However, the results were not successful. The only effective attempt was using lysostaphin, precisely it was reported that lysostaphin could be useful for removing biofilm generated by Staphylococcus aureus (Antimicrob Agents Chemother 47: 3407-3414, 2003). Lysostaphin is an antibacterial enzyme produced by staphyolococcus that is able to destroy cell wall of staphyolococcus. This enzyme is glycylglycine endopeptidase that specifically digests pentaglycine cross bridges found in peptidoglycanstructure of staphyolococcus. So, lysostaphin is expected as an extremely potent anti-staphylococcal agent. Even if lysostaphin has an excellent anti-bacterial effect, it is not perfect. There are still many staphyolococcuses which are not sensitive to lysostaphin (lysostaphin-resistant strains) (J Clin Microbiol 11: 724-727, 1980; Antimicrob Agents Chemother 47: 3407-3414, 2003). Since lysostaphin sensitivity is different among staphyolococcuses, it cannot be effective in every staphyolococcus. Moreover, lysostaphin resistant strains are being generated. Such lysostaphin-resistant strains are called lysostaphin-resistant Staphylococcus aureus variants (Antimicrob Agents Chemother 51: 475-482, 2007). The mechanism of acquiring resistance against lysostaphin has not been explained, yet. But, there was a report concerning the mechanism saying as follows. When femA gene is mutated and thus nonfunctional FemA protein is expressed, monoglycine cross bridges are generated in peptidoglycan structure, which makes lysostaphin powerless (J Bacteriol 188: 6288-6297, 2006). To overcome the above problem of using lysostaphin, studies have been actively undergoing to establish a method to use lysostaphin together with another enzyme such as lysozyme or antibiotics such as methicillin, oxacillin and vancomycin for better effect (Antimicrob Agents Chemother 21: 631-535, 1982; J Antimicrob Chemother 59: 759-762, 2007; Folia Microbiol (Praha) 51: 381-386, 2006). In spite of co-treatment, if Staphylococcus aureus has a low sensitivity against lysostaphin or resistance, removal of biofilm is still impossible. Therefore, a novel substance is required to overcome the disadvantages of lysostaphin treatment. The novel substance might be administered independently or co-administered with the conventional antibiotics. It will be more preferred if the novel substance can be functioning by different mechanism from lysostaphin or the conventional antibiotics.

[0010] The new approach drawing our attention these clays to be able to complement the conventional art is to use bacteriophage. Bacteriophage is a kind of virus-like agent that infects bacteria and is generally called `phage` in short. Bacteriophage is a simple structured organism in which a genetic material composed of nucleic acid is covered with a protein envelope. The nucleic acid is single-stranded or double-stranded DNA or RNA. Bacteriophage was first found by Twort, an English bacteriologist, in 1915 during his study on the phenomenon of melting down of micrococcus colonies as being transparent. In 1917, d'Herelle, a French bacteriologist, discovered that there was something decomposing Shigella disentriae in a filtrate of a dysentery patient's feces and later through his further research he isolated bacteriophage independently and named it as bacteriophage. The term bacteriophage means `eating bacteria`. Bacteriophage needs a host for its survival and every bacterium has its specific bacteriophage. Bacteriophage invades into a host and is multiplicated therein. Then, bacteriophage expresses a group of enzymes necessary for decomposing cell wall of a host bacterium. These enzymes destroy cell wall of a host bacterium by attacking peptidoglycan layer involved in rigidity and mechanical strength of cell wall. Such bacteriolytic protein of bacteriophage plays a role in destroying cell wall of a host bacterium to pave the way for bacteriophage to get out of the host. Such bacteriolytic protein of bacteriophage is generally called lysin.

[0011] Antibiotics (antibacterial agents) are still major part of the treatment of infectious disease by bacteria. However, since 1980s, excessive use of antibiotics has generated many antibiotic resistant strains and since year 2000, multidrug-resistant strains have been frequently reported. With the recognition of problems of using the conventional antibiotics, studies have been focused on bacteriophage as a highly potent alternative for the conventional antibiotics in many advanced countries. Bacteriophage is not only effective in treatment of antibiotic-resistant strain but also effective in treatment of patients with allergy to antibiotics. It was once reported that lysin was used to kill Bacillus anthracis usable as a biochemical weapon for bioterror (Nature 418: 884-889, 2002). Since then, studies have been actively undergoing to understand lysin having a specific bactericidal activity and its functions.

[0012] As an alternative for the conventional antibiotics, bacteriophage and lytic protein derived therefrom also draw our attention as a biofilm remover. There is a description on the use of bacteriophage itself in relation to biofilm (International Publication Number WO 2006/063176 A2; WO 2004/062677 A1). However, bacteriophage has a narrow window of effect, suggesting that one bacteriophage cannot be effective in whole bacteria of one species. So, to secure the effective treatment, diverse bacteriophages are necessary. And if necessary, combination of different bacteriophages might be required. The bacteriophage mixture containing different kinds of bacteriophages is called bacteriophage cocktail. Even among different bacteriophages showing equal effect on the same bacteria, there is a difference in the cleavage site of cell wall peptidoglycan and actual functional mechanisms, producing different results. Therefore, co-use of two different bacteriophages might be more effective than single, separate use of each bacteriophage.

[0013] It has been recently attempted to use lytic protein derived from bacteriophage to remove biofilm. In general, lytic protein derived from bacteriophage exhibits wider spectrum of antibacterial activity than its mother bacteriophage. Therefore, it is expected that lytic protein can be more effective in eliminating biofilm than bacteriophage. However, it seems too early to judge with such a few reports made so far. And, there is no report disclosing the sufficient biofilm removal activity of lytic protein. In relation to the lytic protein derived from bacteriophage, it was once reported that recombinant .phi.11 endolysin could remove biofilm generated by Staphylococcus aureus (Applied and Environmental Microbiology 73: 347-352, 2007). However, the effect of .phi.11 endolysin was not sufficient because the antibacterial spectrum was still too narrow. To treat biofilm generated by different Staphylococcus aureus strains, diverse lytic proteins derived from different bacteriophages are required. What we have to keep in our mind herein is that every lytic protein derived from bacteriophage is not capable of removing biofilm. According to the previous reports. .phi.11 endolysin has biofilm removal activity but .phi.12 endolysin has not. Therefore, biofilm removal activity is not a common property of lytic protein derived from bacteriophage. So, it is necessary to obtain diverse lytic proteins derived from bacteriophage having biofilm removal activity as well as diverse bacteriophages.

DISCLOSURE

Technical Problem

[0014] The present inventors provide a composition for eliminating biofilm formed by Staphylococcus aureus using bacteriophage or lytic protein derived from the bacteriophage, and further tried to use the composition for the treatment of disease caused by Staphylococcus aureus and then become chronic by biofilm formed thereby.

[0015] Particularly, the present inventors tried to develop a composition effective in elimination and treatment of biofilm generated by Staphylococcus aureus which is the cause of various biofilm-associated infectious diseases. As a result, the present inventors completed this invention by developing an effective composition for the elimination and treatment of biofilm generated by Staphylococcus aureus using the bacteriophage first identified by the inventors or lytic protein derived from the bacteriophage.

[0016] It is an object of the present invention to provide a composition for eliminating biofilm generated by Staphylococcus aureus containing bacteriophage or lytic protein derived from the bacteriophage of the present invention as an active ingredient. The composition of the present invention can additionally include a component confirmed to have antibacterial activity against Staphylococcus aureus.

[0017] It is another object of the present invention to provide a medical cleaner and an environmental purifier against biofilm-forming Staphylococcus aureus which contain bacteriophage or lytic protein derived from the bacteriophage of the present invention as an active ingredient. The medical cleaner and the environmental purifier herein can additionally include a component confirmed to have antibacterial activity against Staphylococcus aureus.

[0018] It is further an object of the present invention to provide a therapeutic agent or antibacterial agent capable of improving the treatment effect on biofilm-associated disease caused by biofilm-forming Staphylococcus aureus which contains bacteriophage or lytic protein derived from the bacteriophage of the present invention as an active ingredient. The therapeutic agent or antibacterial agent of the present invention can additionally include a component confirmed to have antibacterial activity against Staphylococcus aureus.

Technical Solution

[0019] To achieve the above objects, the present inventors completed this invention by confirming that the bacteriophage isolated by the inventors and lytic protein prepared using a gene derived from the bacteriophage could eliminate biofilm formed by Staphylococcus aureus.

[0020] The present invention provides a composition for eliminating biofilm generated by Staphylococcus aureus containing bacteriophage or lytic protein derived from the bacteriophage of the present invention as an active ingredient.

[0021] The present invention also provides a pharmaceutical composition for the treatment of biofilm-associated disease caused by bifilm forming Staphylococcus aureus containing bacteriophage or lytic protein derived from the bacteriophage of the present invention as an active ingredient. The composition can additionally include a component confirmed to have antibacterial activity against Staphylococcus aureus. This additional component does not necessarily have power to destroy extracellular matrix of biofilm.

[0022] The present invention further provides a pharmaceutical composition for destroying extracellular matrix of biofilm along with the conventional antibiotics to increase the treatment effect of the conventional antibiotics on biofilm-associated disease caused by biofilm-forming Staphylococcus aureus containing bacteriophage or lytic protein derived from the bacteriophage of the present invention as an active ingredient. The conventional antibiotic included in this composition does not necessarily have power to destroy extracellular matrix of biofilm.

[0023] The composition of the present invention is formulated as a disinfectant, a medical cleaner, an environmental purifier, a therapeutic agent and an antibacterial agent for the elimination of biofilm generated by Staphylococcus aureus or for the treatment of disease caused by Staphylococcus aureus and become chronic by biofilm formed by biofilm-forming Staphylococcus aureus. The composition can additionally include a component confirmed to have antibacterial activity against Staphylococcus aureus.

[0024] Hereinafter, the present invention is described in detail.

[0025] The present inventors isolated novel bacteriophage capable of killing specifically Staphylococcus aureus, and deposited the bacteriophage at Korean Agricultural Culture Collection, National Institute of Agricultural Biotechnology on Jun. 14, 2006 (Accession No: KACC 97001P) and at Biological Resource Center, Korea Research Institute of Bioscience and Biotechnology on Jul. 18, 2007 (Accession No: KCTC 11153BP). The related matters have been applied for a patent (Korean Patent Application No. 2006-55461). The present inventors continued the study and as a result isolated another effective bacteriophage, and then deposited the isolated bacteriophage at Biological Resource Center, Korea Research Institute of Bioscience and Biotechnology on Jul. 18, 2007 (Accession No: KCTC 11154BP), and also applied for a patent for the related matters (Korean Patent Application No. 2007-82358).

[0026] In addition, the present inventors applied for a patent describing a novel antibacterial protein originated from the bacteriophage capable of killing specifically Staphylococcus aureus based on the genetic information thereon (Korean Patent Application No. 2006-73562 and No. 2007-82357).

[0027] As described hereinbefore, lytic protein (antibacterial protein) derived from bacteriophage is a protein that destroys cell wall of a host bacterium when the bacteriophage comes out of the host bacterium. Such lytic protein derived from bacteriophage is generally called lysin. The lytic protein, lysin, is composed of N-terminal catalytic domain and C-terminal binding domain and these two domains are linked by a short linker. Lysin can have two different catalytic domains, which is a rare case, though. C-terminal binding domain is conjugated with matrix on cell wall of target bacteria. The difference between the catalytic domain and the binding domain makes the difference in antibacterial spectrum of lytic protein. Therefore, it is also important to secure diverse lytic proteins derived from different bacteriophages. Diversity of lytic proteins facilitates establishing a method to cope with more bacteria and combination therapy of at least two different lytic proteins can increase the antibacterial effect, compared with single treatment of one kind of lytic protein.

[0028] The present invention provides bacteriophage SAP-1 (Accession No. KCTC 11153BP) having a genome represented by the nucleotide sequence selected from the group consisting of sequences represented by SEQ. ID. NO: 1 NO: 26. and bacteriophage SAP-2 (Accession No. KCTC 11154BP) having the nucleotide sequence represented by SEQ. ID. NO: 29 which are capable of killing specifically Staphylococcus aureus and effective in destroying biofilm formed by Staphylococcus aureus.

[0029] The present invention also provides lytic protein derived from bacteriophage SAP-1 having the amino acid sequence represented by SEQ. ID. NO: 28 and a gene encoding the nucleotide sequence represented by SEQ. ID. NO: 27 and lytic protein derived from bacteriophage SAP-2 having the amino acid sequence represented by SEQ. ID. NO: 31 and a gene encoding the nucleotide sequence represented by SEQ. ID. NO: 30 which are capable of killing specifically Staphylococcus aureus and effective in destroying biofilm formed by Staphylococcus aureus. Herein, the antibacterial activity by lytic activity is not distinguished from the general antibacterial activity resulted from other mechanisms.

[0030] The present inventors provide a composition for elimination of biofilm formed by Staphylococcus aureus using bacteriophage or lytic protein derived from the bacteriophage capable of killing specifically Staphylococcus aureus and effective in destroying biofilm formed by Staphylococcus aureus.

[0031] Once biofilm is formed by Staphylococcus aureus, as described hereinbefore, it results in chronic infection and the treatment of such chronic infection is very difficult. All the conventional treatment methods based on the conventional antibiotics are not so effective. Particularly, recent rise of antibiotic resistant strains requests a novel method to treat biofilm formed by such antibiotic resistant strains. The present inventors provide an appropriate method to treat such biofilm using bacteriophage or lytic protein derived therefrom.

[0032] It is another object of the present invention to provide a composition for a medical cleaner and an environmental purifier containing the bacteriophage or lytic protein derived from the bacteriophage as an active ingredient.

[0033] The medical cleaner is used to prevent biofilm from being formed on the surface of artificial organs transplanted or wound. Biofilm formed by Staphylococcus aureus is largely found on implanted artificial surfaces such as catheters, heart valves, shunts and prosthetic devices (New Microbiol 22: 337-341, 1999; J Med Microbiol 50: 582-587, 2001; Infections Associated with Indwelling Medical Devices, pp. 55-88, 2000, ASM, Washington, D.C.). Therefore, implantable medical devices are preferably coated with an antibacterial agent.

[0034] Once biofilm is formed on artificial implants, surgical operation is the only way to eliminate the biofilm. Therefore, it is more important to prevent biofilm from being formed. The prevention of the formation of biofilm has advantages of less frequent replacement of implanted medical devices and thereby decreases of medical cost.

[0035] The medical cleaner can be sprayed on the surface of a target area which needs to be protected from the formation of biofilm, for example artificial joint, catheter, endoscope or wound. Washing can be performed by hand wash, ultrasonic cleaner or automatic washer. Medical devices can be soaked in a medical cleaner. As antibiotic-resistant strains are generated, a novel method to treat biofilms generated by such antibiotic-resistant strains is necessary. Therefore, the present inventors developed an appropriate method using bacteriophage or lytic protein derived from the bacteriophage.

[0036] The use of the composition of the present invention as an environmental purifier indicates the use as a general disinfectant. The composition of the present invention can be effectively used as a disinfectant for cooking area and facilities.

[0037] The effective content of bacteriophage or lytic protein derived from the bacteriophage in the composition of the present invention for a medical cleaner and an environmental purifier can be determined by those in the art after simple preliminary investigation. The dose can be regulated considering a field targeted and a method of application. The content of the bacteriophage in the composition of the present invention is preferably 1.times.10.sup.3-1.times.10.sup.12 pfu/ml and more preferably 1.times.10.sup.8-1.times.10.sup.10 pfu/ml. The content of the lytic protein in the composition of the present invention is preferably 0.001% (w/v)-0.1% (w/v), more preferably 0.002% (w/v)-0.01% (w/v) and most preferably 0.005% (w/v). The bacteriophage and the lytic protein derived therefrom of the present invention are complementary to each other.

[0038] It is further an object of the present invention to provide a therapeutic agent and antibacterial agent containing the bacteriophage or lytic protein derived from the bacteriophage as an active ingredient.

[0039] The bacteriophage or lytic protein derived from the bacteriophage included in the composition of the present invention, as described hereinbefore, is capable of killing specifically Staphylococcus aureus and effective in destroying biofilm formed by Staphylococcus aureus, so that it has treatment effect on diverse chronic infectious diseases caused by Staphylococcus aureus and become chronic by the formation of biofilm such as mastitis, dermatitis, sepsis, suppurative disorder, food poisoning, pneumonia, osteomyelitis, impetigo, bacteremia, endocarditis, and enteritis, etc. The composition herein can additionally include a component confirmed to have antibacterial activity against Staphylococcus aureus to increase treatment effect.

[0040] The component confirmed to have antibacterial activity against Staphylococcus aureus that can be additionally included in the composition of the present invention is exemplified by methicillin, oxacillin and vancomycin, but not always limited thereto, and diverse antibiotics can be used.

[0041] When the bacteriophage or lytic protein derived from the same can be co-administered with the conventional antibiotics or other effective substances, it helps them to be as fully functioning as aimed by destroying extracellular matrix of biofilm. The bacteriophage or lytic protein derived therefrom of the present invention can digest a specific bond in peptidoglycan structure, unlike lysostaphin, so that it can be effective in treating disease caused by Staphylococcus aureus which is not sensitive to lysostaphin or lysostaphin-resistant variants.

[0042] The effective dosage of the composition of the present invention as a therapeutic agent or an antibacterial agent can be determined and prescribed by an experienced doctor. In this invention, `antibacterial agent` is the generalized term for antiseptics, bactericides and antibiotics. The effective dose can be specifically determined by considering age and weight of an animal including human, clinical symptoms and administration methods.

[0043] The effective dosage of the pharmaceutical composition of the present invention formulated for application, spray, injection and general administration can be determined by considering formulation method, administration method, age, weight and gender of a patient, severity of a disease, diet, administration time and pathway, excretion rate and reactivity, etc. An experienced doctor can determine and prescribe the effective dosage considering the purpose of treatment. In general, the content of the bacteriophage in the pharmaceutical composition of the present invention is preferably 1.times.10.sup.3-1.times.10.sup.12 pfu/ml, and more preferably 1.times.10.sup.8-1.times.10.sup.10 pfu/ml. And the content of the lytic protein in the pharmaceutical composition of the present invention is preferably 0.001% (w/v)-0.1% (w/v), more preferably 0.002% (w/v)-0.01% (w/v) and most preferably 0.005% (w/v). The bacteriophage and lytic protein derived from the same of the present invention are complementary to each other.

[0044] The composition of the present invention can be applied, sprayed or injected on a target area. In addition, the composition of the present invention can be orally or parenterally administered. The parenteral administration is exemplified by intravenous administration, intraperitoneal administration, intramuscular administration, hypodermic administration or local administration.

[0045] The pharmaceutically acceptable carrier included in the composition of the present invention is exemplified by lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, but not always limited thereto. The pharmaceutical composition of the present invention can additionally include lubricants, wetting agents, sweetening agents, flavors, emulsifying agents, suspending agents and adjuvants, in addition to the above ingredients.

[0046] The pharmaceutical composition of the present invention can be formulated by using a pharmaceutically acceptable carrier and/or excipient according to a method generally performed by those in the art as a unit dose or in a multi-close container. At this time, the formulation can be oil or solution in aqueous media, suspension or emulsion, extract, powder, granule, tablet or capsule and a dispersing agent or a stabilizer can be additionally included therein.

[0047] The treatment of disease caused by Staphylococcus aureus using the bacteriophage capable of destroying biofilm or lytic protein derived from the bacteriophage is advantageous over the conventional antibiotics based treatment. That is, biofilm removal and target bacteria destruction can be achieved at the same time by the treatment method using the bacteriophage or lytic protein derived from the same. So, even if Staphylococcus aureus survives in biofilm, it can be effectively destroyed.

[0048] The term `treatment` in this invention indicates (i) prevention of infectious disease caused by Staphylococcus aureus; (ii) inhibition of infectious disease caused by Staphylococcus aureus and (iii) alleviation of infectious disease caused by Staphylococcus aureus.

ADVANTAGEOUS EFFECTS

[0049] As explained hereinbefore, bacteriophage SAP-1, bacteriophage SAP-2 and lytic proteins derived from those bacteriophages of the present invention are capable of killing Staphylococcus aureus specifically and further destroying biofilm formed by Staphylococcus aureus, so that they can be effectively used for the elimination of biofilm by Staphylococcus aureus. They can be also used as a medical cleaner and an environmental purifier for removing biofilm formed by Staphylococcus aureus and further as a therapeutic agent and an antibacterial agent with improved treatment effect by removing biofilm of Staphylococcus aureus for the treatment of infection caused by biofilm-forming Staphylococcus aureus.

[0050] And, bacteriophage SAP-1, bacteriophage SAP-2 and lytic proteins derived from those bacteriophages of the present invention not only have Staphylococcus aureus specific killing activity but also have biofilm removal activity. Therefore, when they are administered with the conventional antibiotics or medicines, they can increase treatment effect of the conventional antibiotics or medicines having antibacterial activity against Staphylococcus aureus which have been not so effective in treatment because of being blocked by extracellular matrix of biofilm formed by Staphylococcus aureus.

DESCRIPTION OF DRAWINGS

[0051] The application of the preferred embodiments of the present invention is best understood with reference to the accompanying drawings, wherein:

[0052] FIG. 1 is a set of electron microscope photographs showing the Staphylococcus aureus specific bacteriophage isolated by plaque assay. (A): Myoviridae family T4-like phage genus bacteriophage, (B): Podoviridae family .phi.29-like virus genus bacteriophage.

[0053] FIG. 2 is a schematic diagram illustrating the method for construction of bacteriophage genome library stepwise.

[0054] FIG. 3 is a set of photographs illustrating the result of electrophoresis with the expressed lytic protein. (A) lane M: size marker (198, 115, 90.5, 61.5, 46.2, and 37.8 kDa), lane 1: cell lysate containing expressed lytic protein SAL-1 (B) lane M: size marker (198, 115, 90.5, 61.5, 46.2, 37.8, 26, 18.5, and 9 kDa), lane 1: cell lysate containing expressed lytic protein SAL-2. *: over-expressed lytic protein.

[0055] FIG. 4 is a set of photographs illustrating the lytic activity of the lytic protein against Staphylococcus aureus isolated clinically, in which clear zones are generated by lytic activity of the lytic protein.

[0056] FIG. 5 is a photograph illustrating the result of PCR with ica C gene for the isolation of Staphylococcus aureus capable of forming biofilm.

[0057] FIG. 6 is a photograph illustrating the formation of biofilm by the isolated SA1 Staphylococcus aureus. (A): control Staphylococcus aureus which is not able to form biofilm. (B): SA1 Staphylococcus aureus forming biofilm.

[0058] FIG. 7 is a set of photographs illustrating the elimination of biofilm formed by SA1 Staphylococcus aureus by the bacteriophage and lytic protein derived therefrom of the present invention. #1: sample treated with the lytic protein SAL-1 and then stained. #2: negative control sample stained without the treatment, #3: sample treated with the bacteriophage SAP-2 ant then stained, #4: sample treated with the lytic protein SAL-2 and then stained, #5: positive control sample treated with lysostaphin and then stained, and #6: sample treated with PBS alone and then stained. The quantity of each treatment component was not significantly considered. The upper photograph illustrates the whole 96-well plate and the lower photograph illustrates each well of the plate in detail.

BEST MODE

[0059] Practical and presently preferred embodiments of the present invention are illustrative as shown in the following Examples.

[0060] However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.

Example 1

Isolation of Staphylococcus aureus from Pathogen and Isolation of Bacteriophage Having Staphylococcus aureus Specific Killing Ability

[0061] <1-1> Isolation of Staphylococcus aureus

[0062] Bacteriophage is distributed widely in nature and particularly lives together with bacteria. To isolate bacteriophage infecting Staphylococcus aureus specifically, the present inventors collected samples from expected places where Staphylococcus aureus seems to proliferate, followed by confirmation if Staphylococcus aureus was growing therein by using Baird-Packer agar medium, the Staphylococcus aureus selection medium.

[0063] Particularly, bovine mastitis was selected as a target disease to isolate the target bacteria Staphylococcus aureus from pathogen. Mastitis is one of the most representative diseases caused by Staphylococcus aureus. Staphylococcus aureus was isolated from the samples extracted from milk of milk-cow with mastitis by using Baird-Parker agar medium, the Staphylococcus aureus selection medium. Then, the isolated bacteria were identified as Staphylococcus aureus by Gram staining method. catalase test and biochemical test using Vitek (bioMerieux). The results are shown in Table 1.

TABLE-US-00001 TABLE 1 Vitek ID 200000-0 (A1-18) catalase + Coagulase + Type Gram positive identification card (GPI) Condition Final Time 5 hours Organism Staphylococcus aureus PB+ BAC- OPT+ HCS+ 6NC+ 10B+ 40B- ESC- ARG- URE- TZR+ NOV- DEX+ LAC+ MAN+ RAF- SAL- SOR- SUC+ TRE+ ARA- PYR+ PUL- INU- MEL- MLZ- CEL- RIB- XYL- CAT+ BH/CO+

<1-2> Isolation of Staphylococcus aureus Specific Bacteriophage

[0064] Next, to isolate a Staphylococcus aureus specific bacteriophage, the samples expected to contain bacteriophage were cultured with Staphylococcus aureus. The culture broth was centrifuged to obtain supernatant. The obtained supernatant was filtered. The filtered solution was cultured again with the cultured Staphylococcus aureus as bait for isolating bacteriophage, followed by investigation of lysis of Staphylococcus aureus. The lysis of Staphylococcus aureus was finally confirmed by plaque assay.

[0065] Particularly, to isolate bacteriophage having Staphylococcus aureus specific killing activity, samples were collected from soil, straws, earth and sewage in cowshed where bacteriophage possibly survives. The samples were shaking-cultured at 37.degree. C. for 3-4 hours with the Staphylococcus aureus obtained in Example <1-1>. After cultivaton, the culture broth was centrifuged at 8,000 rpm for 20 minutes to obtain supernatant. The supernatant was filtered with 0.45 .mu.m filter. Two kinds of Staphylococcus aureus specific bacteriophages were isolated by plaque assay with the filtrate.

[0066] To observe morphology of the obtained bacteriophage, the bacteriophage was purified by CsCl density gradient (density: 1.15 g/ml, 1.45 g/ml, 1.50 g/ml and 1.70 g/ml) centrifugation (38,000 rpm, 22 hours, 4.degree. C.). The purified bacteriophage was placed on cupper grid, followed by negative staining with 2% uranyl acetate and drying. Morphology of the bacteriophage was photographed under electron microscope. As a result, the isolated bacteriophages were confirmed according to morphological classification to belong to Myoviridae family T4-like phage genus and Podoviridae family .phi.29-like virus genus (FIG. 1). The isolated bacteriophage belonging to Myoviridae family T4-like phage genus was named bacteriophage SAP-1, which was deposited at Korean Agricultural Culture Collection, National Institute of Agricultural Biotechnology on Jun. 14, 2006 (Accession No: KACC 97001P) and at Biological Resource Center, Korea Research Institute of Bioscience and Biotechnology on Jul. 18, 2007 (Accession No: KCTC 11153BP). Another bacteriophage isolated above belonging to Podoviridae family .phi.29-like virus genus was named bacteriophage SAP-2, which was deposited at Biological Resource Center, Korea Research Institute of Bioscience and Biotechnology on Jul. 18, 2007 (Accession No: KCTC 11154BP).

Example 2

Genetic Characteristics of the Staphylococcus Aureus Specific Bacteriophages SAP-1 and SAP-2

<2-1> Genetic Characteristics of Bacteriophage SAP-1

[0067] Genetic characteristics of the isolated bacteriophage SAP-1 were analyzed. First, bacteriophage genome was extracted by the conventional method, followed by genetic analysis. Particularly, 50 ml of Staphylococcus aureus suspension [OD.sub.600: 1] and 1 ml of bacteriophage suspension filtered at the concentration of 1.times.10.sup.8 pfu/ml were inoculated to 200 ml of TSB (Tryptic Soy Broth) medium (casein digest, 17 g/l soybean digest, 3 g/l dextrose, 2.5 g/l NaCl, 5 g/l dipotassium phosphate, 2.5 g/) in 1 l flask, followed by shaking-culture at 37.degree. C. for 3-4 hours. Upon completion of the culture, lysis of the Staphylococcus aureus was investigated. When lysis of the Staphylococcus aureus was confirmed, the culture broth was filtered with 0.45 .mu.m filter. Then, 20% polyethylene glycol 8000/2.5 M NaCl solution was added to the filtrate by 1/6 of the filtrate volume, which stood at 4.degree. C. for overnight. The solution was centrifuged at 8,000 rpm for 20 minutes to obtain bacteriophage from the precipitate. The obtained bacteriophage precipitate was suspended in 1 ml PBS (phosphate buffer saline), to which 20% polyethylene glycol 8000/2.5 M NaCl solution was added by 1/6 the total volume, which stood at 4.degree. C. for one hour. One hour later, the solution was centrifuged at 14,000 for 10 minutes to obtain purified bacteriophage precipitate. The precipitate was mixed with 200 ml of iodide buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 4 M NaI) gently, which stood at room temperature for 15 minutes. Bacteriophage genome was extracted by using DNeasy Tissue kit (QIAGEN) and PCR purification kit (Labopass).

[0068] The extracted bacteriophage genome was genomic DNA (gDNA). The total gDNA size was too big to analyze its sequence directly. So, gDNA library was first constructed, followed by sequencing. The gDNA library was constructed by using the restriction enzyme Msp I according to the conventional method presented in FIG. 2.

[0069] Particularly, to obtain various gene fragments, the extracted gDNA was treated with the restriction enzyme Msp I at 30.degree. C. for one minute, leading to partial fragmentation of the gDNA. After the fragmentation, the gene fragments were introduced into pBluescript II SK(+) phagemid vector (Stratagene) using T4 ligase. The constructed recombinant plasmid containing bacteriophage gene fragments was introduced into E. coli Top10F' (Invitrogen) by electroporation, one of electro-transformation methods. The transformant having the recombinant plasmid was selected on ampicillin containing agar plate supplemented with X-Gal (5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside) and IPTG (isopropyl-D-1-thiogalactopyranoside) by Blue-White colony selection. The selected single colony was inoculated in the culture medium containing ampicillin, followed by shaking-culture for overnight. Plasmid was extracted from the cultured cells by using plasmid purification kit (iNtRON Biotechnology). The extracted plasmid was electrophoresed on 0.8% agarose gel to examine the size. Based on the confirmed size, the recombinant plasmid was selected.

[0070] The selected plasmids were 51 in all and whose corresponding clones were also 51. These clones were cultured again, from which plasmids were extracted again. Nucleotide sequences of the extracted plasmids were analyzed. Sequencing was performed with M13 forward primer and M13 reverse primer which are general primers widely used for sequencing. Each primer sequence is shown in Table 2.

TABLE-US-00002 TABLE 2 Primer Sequence M13 forward primer GTCGTGACTGGGAAAACCCTGGCG M13 reverse primer TCCTGTGTGAAATTGTTATCCGCT

[0071] The gene sequences obtained thereby are partial sequences forming the whole genome of bacteriophage SAP-1, which are represented by SEQ. ID. NO: 1 NO: 26.

[0072] Homology of the nucleotide sequences of bacteriophage SAP-1 with the known bacteriophage genes was analyzed by using BLAST on Web (http://www.ncbi.nlm.nih.gov/BLAST/). As a result, the nucleotide sequence of the bacteriophage SAP-1 was confirmed to have the highest homology with the bacteriophage G1. To understand genetic functions of each part of the genome, ORF (Open Reading Frame) analysis was performed based on bacteriophage G1 gene sequence using NCBI ORF finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and Vector NTI ContigExpress (INFORMAX) program. As a result, gene sequence of the lytic protein of bacteriophage SAP-1 was obtained. The whole nucleotide sequence of the lytic protein derived from bacteriophage SAP-1 is represented by SEQ. ID. NO: 27. And the amino acid sequence of the lytic protein derived from bacteriophage SAP-1 is represented by SEQ. ID. NO: 28. The lytic protein derived from bacteriophage SAP-1 was named as SAL-1.

<2-2> Genetic Characteristics of Bacteriophage SAP-2

[0073] Genetic characteristics of the isolated bacteriophage SAP-2 were analyzed. First, the genome of bacteriophage SAP-2 was extracted by the conventional method, followed by genetic analysis. Particularly, 50 ml of Staphylococcus aureus suspension (OD.sub.600: 1) and 1 ml of bacteriophage suspension filtered at the concentration of 1.times.10.sup.8 pfu/ml were added to 200 ml of TSB medium in 1 l flask, followed by shaking-culture at 37.degree. C. for 3-4 hours. Upon completion of the culture, lysis of the Staphylococcus aureus was investigated. When lysis of the Staphylococcus aureus was confirmed, the culture broth was filtered with 0.45 .mu.m filter. To eliminate DNA and RNA of Staphylococcus aureus remaining in the filtered culture broth, 200 U of each DNase I and RNase A were added to 10 ml of the filtered culture broth, which stood at 37.degree. C. for 30 minutes. To inactivate DNase I and RNase A, 500 .mu.l of 0.5 M EDTA (ethylenediaminetetraacetic acid) was added, which stood for 10 minutes. Next, to destroy the outer protein envelope of bacteriophage, 100 .mu.l of proteinase K (20 mg/ml) and 500 .mu.l of 10% SDS (Sodium Dodecyl Sulfate) were added thereto, followed by incubation at 65.degree. C. for 1 hour. After one hour incubation, 10 ml of the mixed solution comprising phenol, chloroform and isoamylalcohol (25:24:1) was added thereto and mixed well. The mixture was centrifuged at 18,000 rpm to separate layers. The upper layer was recovered, to which 100% alcohol was added double the volume of the recovered upper layer, followed by extraction of pure genome.

[0074] The extracted bacteriophage genome was gDNA. The gDNA of bacteriophage SAP-2 was sequenced directly since the gDNA was not too big.

[0075] Primers used for the direct sequencing of bacteriophage SAP-2 gDNA are shown in Table 3.

TABLE-US-00003 TABLE 3 Primer Sequence T7 TAATACGACTCACTATAGGGCGA pro- moter SP6 GTATTCTATAGTGTCACCTAAAT pro- moter 1 CGTAATGCTTCAAAATGTTC 2 GAGCAATGTTAGTTGATTACTCATT 3 CCATTTAAAAAATAATCATCACGTT 4 TGCAATTCATATATTAGATGATAA 5 TATGCTTTATATGGAGGTTGATAAC 6 AATTAGTGTACCGTCACCTAAAGA 7 TGCAACACCATCGTGATGTA 8 GTTGTTGAACATCGCAACAG 9 CAAAATCTGATAAAAACGTCAT 10 GACGTGATGAGGATTATTAT 11 ATAAATTCTCTTTCTTTTTCCTCAAATTCAAATCTCGCTAATGT 12 CATACGTGGATAATTACGTTTCAACATTAATTCCTCATTT 13 ATCAAATTCATTTAAAATTTTCTTTCT 14 AATGTCACCTATGTTTAATGCAGA 15 AGTTCATCATTTAAGAATTGAACAACAGAACT 16 TTTGTTGCTCTAATGATGTAATACGTTGTTCTAATATAACAG 17 TCACTTGCAATAATACCACTTTCTAAT 18 GTCAAGTATCATTTTAATACAATTT 19 TCATTATACATTACGTGACGCTTA 20 AGCTTCTCTTTCTTTTTTCCATCTA 21 GAACTTCATTGTATTTAGCGCTGTTG 22 TGAATCTTCATATGGTCGACCTGCAG 23 ATTTAATAGTTTTGCACAAGTACCAA 24 CAAACTAACCCATCTGATAAACAAAC 25 AACCTAATGGCTATTGGTTCCAACCA 26 GGTAACAGTTCAGTTAATTCACAT 27 GGTGCCATAATTTATTATTCCTCC 28 TTAATCGTACCTAATTTAATATCAC 29 AACGTAAATCGTTATTACTTGCAATG 30 CGTTACAACACCCGGAGAATATTA 31 CCAAATGTCCAAGATTTTGAATAA 32 TTTAAAATGTACAGGTACGTATAC 33 TTGAATTTAACGAATATAATTTGGC 34 ATATTATCATGATTGCACATAACTG 35 GTAAAAGGTTATGGACGTTTTAAT 36 AATTTTTATGACTATATAAAATCATT 37 ACAAAAAACATTTAACAACACGTAT 38 AAATAAAATACAAAACATAATCAAT

[0076] Nucleotide sequence of the whole genome of bacteriophage SAP-2 is represented by SEQ. ID. NO: 29. Total number of nucleotides forming the genome of bacteriophage SAP-2 is 17938.

[0077] Homology of the nucleotide sequence of bacteriophage SAP-2 with the known bacteriophage genes was analyzed by using BLAST on Web. As a result, homology of the analyzed nucleotide sequence of the bacteriophage SAP-2 was 86.0% with Staphylococcus aureus phage phi P68, 81.1% with 44AHJD and 49.2% homology with bacteriophage 66. To understand genetic functions of each part of the genome, ORF analysis was performed based on Staphylococcus aureus phage phi P68 gene sequence exhibiting the highest homology by using NCBI ORF finder and Vector NTI ContigExpress program. Comparing with the paper `Complete nucleotide sequence and molecular characterization of two lytic Staphylococcus aureus phages: 44AHJD and P68, FEMS Microbiology Letters, 2003, 219: 275-283`, ORF homology was investigated. As a result, gene sequence of the lytic protein of bacteriophage SAP-2 was obtained. The gene encoding the lytic protein of bacteriophage SAP-2 was composed of 750 bp and the lytic protein expressed therefrom was composed of 250 amino acids. The sequence of the gene encoding the lytic protein of bacteriophage SAP-2 is represented by SEQ. ID. NO: 30 and the amino acid sequence of the lytic protein of bacteriophage SAP-2 is represented by SEQ. ID. NO: 31. The lytic protein derived from bacteriophage SAP-2 was named as SAL-2.

Example 3

Cloning of Lytic Protein Gene and Construction of Expression Plasmid

<3-1> Construction of the Lytic Protein SAL-1 Expression Plasmid

[0078] From the gene sequencing and ORF analysis performed in Example <2-1>, gene sequence of the lytic protein SAL-1 was identified. To express the target lytic protein from the lytic protein gene, a large-scale expression system of lytic protein was constructed using pBAD-TOPO vector (Invitrogen). The gene of lytic protein was subcloned into the Nco I and Not I restriction enzyme sites of vector according to the conventional method. Before the cloning, enterokinase cleavage site in pBAD-TOPO vector was eliminated and instead Not I restriction enzyme site was inserted. The constructed lytic protein expression plasmid was named pBAD-TOPO-SAL1. E. coli BL21 (DE3) (Novagen) was transformed with the lytic protein expression plasmid, resulting in the preparation of a producing strain of the lytic protein. The producing strain of the lytic protein prepared thereby was deposited at Biological Resource Center, Korea Research Institute of Bioscience and Biotechnology on Jul. 18, 2007 (Accession No: KCTC 11151BP).

<3-2> Construction of the Lytic Protein SAL-2 Expression Plasmid

[0079] From the gene sequencing and ORF analysis performed in Example <2-2>, gene sequence of the lytic protein SAL-2 was identified. To express the target lytic protein from the lytic protein gene, a large-scale expression system of lytic protein was constructed using pBAD-TOPO vector (Invitrogen). The gene of lytic protein was subcloned into the Nco I and Not I restriction enzyme sites of vector according to the conventional method. Before the cloning, enterokinase cleavage site in pBAD-TOPO vector was eliminated and instead Not I restriction enzyme site was inserted. The constructed lytic protein expression plasmid was named pBAD::lysinM. E. coli. Origami (DE3) (Novagen) was transformed with the lytic protein expression plasmid, resulting in the preparation of a producing strain of the lytic protein. The producing strain of the lytic protein prepared thereby was deposited at Biological Resource Center, Korea Research Institute of Bioscience and Biotechnology on Jul. 18, 2007 (Accession No: KCTC 11152BP).

Example 4

Over-Expression of Lytic Protein

[0080] Lytic protein was over-expressed in E. coli transformed with the recombinant plasmid constructed in Example 3. Methods for over-expression of both SAL-1 and SAL-2 are similar. The pBAD-TOPO vector based expression system is the method inducing over-expression using L-arabinose, which is a suitable expression system of toxic protein to host bacteria (according to the manufacturer's instruction titled `pBAD expression system` and protocol #25-0257 publicized in 2004).

[0081] Over-expression of lytic proteins is described in detail hereinafter. The constructed plasmids contained ampicillin resistant gene, so every culture medium was supplemented with ampicillin. To express the lytic protein SAL-2. Origami (DE3) was used as a producing strain. This producing strain itself contained tetracycline resistant gene. So, to express the lytic protein SAL-2, every culture medium was supplemented with both of ampicillin and tetracycline. LB medium (trypton, 10 g/L; yeast extract, 5 g/L; NaCl, 10 g/L) was used as a culture medium. Each producing strain of the lytic protein was inoculated in 5 ml of LB medium supplemented with proper antibiotics, followed by shaking-culture at 37.degree. C. for overnight. 100 .mu.l of each overnight culture broth was re-inoculated in 10 ml of fresh LB medium supplemented with proper antibiotics, followed by shaking-culture again at 37.degree. C. Induction was carried out with 0.2% L-arabinose, at which point the cell density (OD.sub.600) was 0.8-1 (for lytic protein SAL-1) or 0.5 (for lytic protein SAL-2). To induce the expression of the lytic protein SAL-1, temperature for culture was maintained at 37.degree. C. and to induce the lytic protein SAL-2, temperature for culture was changed to 23.degree. C. right after the induction started. The additional culture time for inducing the expression of SAL-1 was 4 hours and 12 hours for the expression of SAL-2. Upon completion of the culture, 1 ml of the cell culture broth was centrifuged at 8,000 rpm for 5 minutes, and then cell precipitate was recovered. The cells were lysed by adding 100 .mu.l of 1% SDS solution to the cell precipitate. 12 .mu.l of the cell lysate was used as a sample for electrophoresis. Precisely, 3 .mu.l of 5.times. sample loading buffer used for electrophoresis was added to the cell lysate, which was well mixed and boiled in water bath for 5 minutes. Electrophoresis was performed according to the conventional method. Then, the over-expressed lytic protein was confirmed. The results are shown in FIG. 3.

Example 5

Separation and Purification of Expressed Lytic Protein

<5-1> Separation and Purification of SAL-1

[0082] 500 ml of the culture broth of the transformant cultivated in LB medium was centrifuged at 8,000 rpm for 5 minutes to obtain cell precipitate. The precipitate was suspended in 6 ml of 20 mM sodium phosphate buffer (pH 6.0) containing 1 mM phenylmethylsulfonyl fluoride. To precipitate the ribosomal proteins, 2 mg of streptomycin sulfate was added thereto. Cells of the prepared cell suspension were disrupted by sonication. Sonication was performed by repeating 20 second sonication-5 second rest for 20 minutes. The resultant whole cell lysate was centrifuged at 8,000 for 5 minutes to remove the cell debris. The supernatant obtained by the centrifugation proceeded to 35% (w.v) ammonium sulfate precipitation, leading to the concentration of expressed lytic protein. Precisely, ammonium sulfate was added at the final concentration of 35% (w/v), and the mixed solution stood in ice for 15 minutes to precipitate the protein. Then, the mixed solution was centrifuged at 10,000.times.g for 15 minutes to obtain precipitate. The precipitate was dissolved in 2 ml of adsorption buffer (50 mM sodium phosphate, 0.25 M sodium chloride, pH 6.5) to be used for chromatography. To remove the excessive ammonium sulfate, the prepared protein solution was dialyzed against adsorption buffer at 4.degree. C. for overnight by replacing the adsorption buffer with a fresh buffer from time to time. Upon completion of dialysis, the protein solution was centrifuged at 10,000.times.g for 25 minutes to eliminate insoluble materials. The protein solution was filtered with 0.2 .mu.m filter, followed by cation-exchange chromatography. CM-Sephadex C-50 (Pharmacia) was used as a cation-exchange resin, which was a weak cation-exchange resin. The column was packed with CM-Sephadex C-50 by 27 cm and the total packed bedvolume was approximately 14 ml. After equilibrium of the column with adsorption buffer, chromatography was performed. The protein solution was loaded on the column, which was washed with 100 ml of adsorption buffer. Other proteins derived from E. coli except the lytic protein were hardly adhered on the resin filled in the column. At last, the lytic protein was eluted by using 50 mM sodium phosphate solution (pH 6.5) containing NaCl with increasing the concentration from 0.2 M to 0.8 M. To remove NaCl used for the elution of the lytic protein, the eluent fraction containing the lytic protein was dialyzed against 50 mM of sodium phosphate solution (pH 6.5) at 4.degree. C. for overnight by replacing the sodium phosphate solution with fresh sodium phosphate solution from time to time. The dialysate was concentrated by dialyzing to dried ethylene glycol 20,000.

<5-2> Separation and Purification of SAL-2

[0083] 500 ml of the culture broth of the transformant cultivated in LB medium was centrifuged at 8,000 rpm for 5 minutes to obtain cell precipitate. The precipitate was suspended in 6 ml of 80 mM Tris-HCl buffer (pH 4.0). Cells of the prepared cell suspension were lysed by freezing/thawing. Precisely, for the freezing/thawing, the cell suspension was frozen by using liquid nitrogen, which was thawed at 30.degree. C. for 5 minutes. This freezing/thawing was repeated 8 times. And the resultant cell lysate was centrifuged at 8,000 rpm for 5 minutes to remove the cell debris. The supernatant obtained by the centrifugation proceeded to 30% (w.v) ammonium sulfate precipitation, leading to the concentration of expressed lytic protein. Precisely, ammonium sulfate was added at the final concentration of 30% (w/v), and the mixed solution stood in ice for 15 minutes to precipitate the protein. Then, the mixed solution was centrifuged at 10,000.times.g for 15 minutes to obtain precipitate. The precipitate was dissolved in 2 ml of adsorption buffer (25 mM sodium phosphate, pH 5.8) to be used for chromatography. To remove the excessive ammonium sulfate, the prepared protein solution was dialyzed against adsorption buffer at 4.degree. C. for overnight by replacing the adsorption buffer with a fresh buffer from time to time. Upon completion of dialysis, the protein solution was centrifuged at 10,000.times.g for 25 minutes to eliminate insoluble materials. The protein solution was filtered with 0.2 .mu.m filter, followed by cation-exchange chromatography. HiTrap SPFF (GE Healthcare) was used as a cation-exchange resin, which was a strong cation-exchange resin. After equilibrium of the column with adsorption buffer, chromatography was performed. The protein solution was loaded on the column, which was washed with 100 ml of adsorption buffer. Other proteins derived from E. coli except the lytic protein were hardly adhered on the resin filled in the column. At last, the lytic protein was eluted by using 25 mM sodium phosphate solution (pH 5.8) containing KCl with increasing the concentration from 0.2 M to 0.8 M. To remove KCl used for the elution of the lytic protein, the eluent fraction containing the lytic protein was dialyzed against 25 mM of sodium phosphate solution (pH 5.8) at 4.degree. C. for overnight by replacing the sodium phosphate solution with fresh sodium phosphate solution from time to time. The dialysate was concentrated by dialyzing to dried ethylene glycol 20,000.

Example 6

Antibacterial Activity of the Lytic Proteins

[0084] Antibacterial activity of the lytic proteins separated/purified in Example 5 was investigated. Staphylococcus aureus isolated and identified by the present inventors by the same manner as described in Example 1 was used for this experiment.

[0085] 1 ml culture broth of Staphylococcus aureus cultivated in TSB medium (OD.sub.600: 1) was spread on each plate medium, followed by drying. 5 .mu.l of protein solution containing the lytic protein prepared above was dropped thereto, followed by incubation in a 37.degree. C. incubator for overnight. Then, lysis of Staphylococcus aureus isolated was examined. As a result, as shown in FIG. 4, it was confirmed that clear zones were formed by the lytic activity of the lytic proteins.

Example 7

Biofilm Removal Activity

[0086] <7-1>: Selection of Biofilm-Forming Staphylococcus aureus To investigate whether the composition containing bacteriophage or lytic protein derived from the bacteriophage was capable of destroying biofilm, Staphylococcus aureus capable of forming biofilm was selected at first. To select Staphylococcus aureus capable of forming biofilm, the existence of genes involved in the formation of biofilm were analyzed first. Precisely, PIA (polysaccharide intercellular adhesion) is important for the formation of biofilm (Science 284: 1523-1527, 1999). And ica C (1054 bp) gene is involved in PIA biosynthesis (J Clin Microbiol 39: 2151-2156, 2001; Infect Immun 67: 5427-5433, 1999). So, to select biofilm-forming Staphylococcus aureus, PCR amplification of the ica C gene was performed with the genomic DNA prepared from three kinds of Staphylococcus aureus strains. Primers for PCR were prepared as follows.

TABLE-US-00004 TABLE 4 Primer Sequence Ica C F ATGAAAAAGATTAGACTTGAACTC Ica C R TTAATAAGCATTAATGTTCAATT

[0087] From the PCR, one of Staphylococcus aureus strain was confirmed to have ica C gene (named this Staphylococcus aureus as SA1) (FIG. 5). That is, this SA1 Staphylococcus aureus presumably has the ability to form biofilm. Then, biofilm formation by SA1 Staphylococcus aureus was examined. Precisely, SA1 Staphylococcus aureus was cultured in 5 ml. TSB medium containing 0.25% D-(+)-glucose for overnight. The culture broth of SA1 Staphylococcus aureus was diluted (1:50) with TSB medium containing D-(+)-glucose, which was disturbed in a 96-well plate (polystyrene, Corning) by 200 .mu.l. The plate was shaking-cultured at 100 rpm for 24 hours in a 37.degree. C. incubator. After 24 hours of the culture, 50 .mu.l of TSB medium containing 0.25% D-(+)-glucose was added in each well of plate to supplement evaporated medium, followed by culture at 37.degree. C. for 24 hours. Upon completion of the additional culture, each well was washed with 200 .mu.l of PBS, followed by examination of the biofilm formation. As shown in FIG. 6, the selected SA1 Staphylococcus aureus formed biofilm.

<7-2> Biofilm Removal Activity

[0088] The present inventors investigated if the bacteriophage or lytic protein derived from the bacteriophage of the present invention could destroy biofilm formed by SA1 Staphylococcus aureus, according to the method of Wu et al (biofilm plate assay. Antimicrob Agents Chemother 47: 3407-3414, 2003). Particularly, SA1 Staphylococcus aureus was cultured in 5 id TSB medium containing 0.25% D-(+)-glucose for overnight. The culture broth of SA1 Staphylococcus aureus was diluted (1:50) with TSB medium containing D-(+)-glucose, which was disturbed in a 96-well plate (polystyrene, Corning) by 200 .mu.l. The plate was shaking-cultured at 100 rpm for 24 hours in a 37.degree. C. incubator. After 24 hours of the culture, 50 .mu.l of TSB medium containing 0.25% D-(+)-glucose was added in each well of plate to supplement evaporated medium, followed by culture at 37.degree. C. for 24 hours. After the additional culture, the wells were washed with 200 .mu.l of PBS. The bacteriophage suspension and the lytic protein solution were independently added to each well, which stood for 24 hours. 24 hours later, the medium was eliminated and each well was washed with PBS. After drying the plate, safranin staining was performed with 200 .mu.l of 0.1% safranin for one hour, followed by examination of removal of biofilm. The results are shown in FIG. 7. In this example, it was confirmed that biofilm formed by SA1 Staphylococcus aureus was destroyed by bacteriophage SAP-1, bacteriophage SAP-2 and those lytic proteins derived from the two bacteriophages. The lytic protein solution was more effective in destroying biofilm than the bacteriophage suspension. That is, the lytic protein derived from bacteriophage is more effective in destroying biofilm than bacteriophage itself. Destruction of biofilm starts with breaking the extracellular matrix, suggesting that bacteriophage SAP-1, bacteriophage SAP-2 and those lytic proteins derived from the two bacteriophages are also effective in destroying extracellular matrix of biofilm.

Example 8

Biofilm Formation Inhibiting Activity

[0089] Biofilm formation inhibiting activity of the composition containing bacteriophage or lytic protein derived from the bacteriophage was investigated by using medical catheter. The general medical catheter (silicone elastomer coated foley balloon catheter: Sewoonmedica Co. Ltd.) was cut into 1 cm pieces, resulting in 15 catheter pieces. 3 of them were treated with nothing and 12 of them were grouped again into four group 1 was treated with PBS containing bacteriophage SAP-1, group 2 was treated with PBS containing bacteriophage SAP-2, group 3 was treated with PBS containing SAL-1, the lytic protein derived from bacteriophage SAP-1 and group 4 was treated with PBS containing SAL-2, the lytic protein derived from bacteriophage SAP-2, on their surfaces. The concentration of bacteriophage in the composition containing bacteriophage was 1.times.10.sup.10 pfu/ml and the concentration of lytic protein in the composition containing lytic protein was 0.005% (w/v). Surface treatment was performed by soaking those catheter pieces completely in the composition containing bacteriophage or the composition containing lytic protein (one hour). After the surface treatment, SA1 Staphylococcus aureus culture broth cultured by the method of Example <7-2> was diluted (1:50) with TSB medium containing D-(+)-glucose and this diluted solution was sprayed on the surface of the catheter pieces. At this time, lumen of the catheter was also sprayed. The catheter pieces were then incubated in clean bench at 37.degree. C. for 24 hours using hybridization device. 24 hours later, to supplement evaporated medium, TSB medium containing 0.25% D-(+)-glucose was sprayed additionally, followed by incubation at 37.degree. C. for 24 hours again. Upon completion of the additional incubation, the catheter pieces were cut to the direction of length, followed by washing with PBS. After washing, biofilm formation was investigated. The results are shown in table 5.

TABLE-US-00005 TABLE 5 Surface treatment method (soaking for 1 hour) Treated Treated with with bacteriophage bacteriophage Treated Treated SAP-1 SAP-2 with SAL-1 with SAL-2 containing containing containing containing Non-treated composition composition composition composition Result +++ --- --- --- --- "+" indicates biofilm formed, and "-" indicates biofilm not formed. Three of these signs are maximum that can represent each experiment. That is, "+++" indicates biofilm was formed on all of three catheter pieces and "---" indicates biofilm was not formed on any of these three catheter pieces.

[0090] For the surface-treatment, PBS containing bacteriophage or PBS containing lytic protein was used. Additional experiment was performed by the same manner as described above, except that the surface treatment was distinguished. That is, to treat surface in this additional experiment, synovial jelly widely used for the catheter injection containing the same concentration of bacteriophage or lytic protein derived from the bacteriophage was used instead of PBS. Unlike the above one-hour soaking, it was just smeared well this time. But, the result was consistent with that of previous experiment.

TABLE-US-00006 TABLE 6 Surface treatment method (smeared with synovial jelly) Treated Treated with with bacteriophage bacteriophage Treated Treated SAP-1 SAP-2 with SAL-1 with SAL-2 containing containing containing containing Non-treated composition composition composition composition Result +++ --- --- --- --- "+" indicates biofilm formed, and "-" indicates biofilm not formed. Three of these signs are maximum that can represent each experiment. That is, "+++" indicates biofilm was formed on all of three catheter pieces and "---" indicates biofilm was not formed on any of these three catheter pieces.

[0091] From the above results, it was confirmed that the biofilm formation by SA1 Staphylococcus aureus can be effectively inhibited by the compositions containing bacteriophage SAP-1, bacteriophage SAP-2 or the lytic proteins derived from the two bacteriophages. Therefore, the composition of the present invention can be effectively used as a medical cleaner and an environmental purifier including a disinfectant.

Example 9

Application of the Composition of the Present Invention in the Treatment of Disease Caused by Staphylococcus aureus Infection

[0092] 24 milk-cows with bovine mastitis caused by Staphylococcus aureus infection were selected as targets of the experiment examining the treatment effect on mastitis of bacteriophage SAP-1, bacteriophage SAP-2 or lytic proteins derived therefrom. The milk-cows were grouped into 8 groups (three cows per group), and group 1 was treated with PBS containing bacteriophage SAP-1 at the concentration of 1.times.10.sup.8 pfu/ml. group 2 was treated with PBS containing bacteriophage SAP-2 at the concentration of 1.times.10.sup.8 pfu/ml, group 3 was treated with PBS containing SAL-1 at the concentration of 0.005% (w/v), group 4 was treated with PBS containing SAL-2 at the concentration of 0.005% (w/v). group 5 was treated with PBS containing both of bacteriophage SAP-1 at the concentration of 1.times.10.sup.8 pfu/ml and bacteriophage SAP-2 at the concentration of 1.times.10.sup.8 pfu/ml, group 6 was treated with PBS containing both of SAL-1 at the concentration of 0.005% (w/v) and SAL-2 at the concentration of 0.005% (w/v), and group 7 was treated with PBS containing bacteriophage SAP-1 at the concentration of 1.times.10.sup.8 pfu/ml, bacteriophage SAP-2 at the concentration of 1.times.10.sup.8 pfu/ml, SAL-1 at the concentration of 0.005% (w/v) and SAL-2 at the concentration of 0.005% (w/v). Treatment was performed by every day injection through papilla, and the dose was 5 ml per injection. The control group (3 milk-cows) was treated with 5 ml of PBS alone by the same manner everyday. The treatment continued for 10 days, during which somatic cells included in milk taken from the cow was counted by the conventional method. Once mastitis is developed, leucocytes are increased to prevent the pathogen and dead leucocytes by the fight with the pathogen are called somatic cells herein. The somatic cells are composed of mammary epithelial cells, immune cells (lymphocytes), neutrophils, and monocytes. Direct microscope assay, the most common method, is used for somatic cell counting. Briefly, milk sample was smeared on 1 cm.sup.2 of slide glassan dried, followed by staining. Then, somatic cells were directly counted under microscope. The number of somatic cells was multiplied by microscope coefficient to calculate somatic cell number in 1 ml of milk. The results are shown in below. In Table 7, mean value of three milk-cows in each group is presented and standard error is not provided because each value is not much different from the mean value.

TABLE-US-00007 TABLE 7 Treatment effect on disease caused by Staphylococcus aureus infection (somatic cell number/1 ml of milk) A B C D E F G H Before 4.6 .times. 10.sup.5 5.1 .times. 10.sup.5 4.8 .times. 10.sup.5 4.7 .times. 10.sup.5 5.0 .times. 10.sup.5 5.1 .times. 10.sup.5 4.9 .times. 10.sup.5 5.1 .times. 10.sup.5 treatment After 6.7 .times. 10.sup.5 1.6 .times. 10.sup.5 1.9 .times. 10.sup.5 2.2 .times. 10.sup.5 1.9 .times. 10.sup.5 1.7 .times. 10.sup.5 1.8 .times. 10.sup.5 1.7 .times. 10.sup.5 treatment

[0093] In the above table, A) indicates the result of the injection with PBS; B) indicates the result of the injection with PBS containing bacteriophage SAP-1; C) indicates the result of the injection with PBS containing bacteriophage SAP-2; D) indicates the result of the injection with PBS containing SAL-1, the lytic protein derived from bacteriophage SAP-1; E) indicates the result of the injection of PBS containing SAL-2, the lytic protein derived from bacteriophage SAP-2; F) indicates the result of the injection with PBS containing bacteriophage SAP-1 and bacteriophage SAP-2; G) indicates the result of the injection with PBS containing SAL-1, the lytic protein derived from bacteriophage SAP-1 and SAL-2, the lytic protein derived from bacteriophage SAP-2 and H) indicates the result of the injection with PBS containing bacteriophage SAP-1, bacteriophage SAP-2, SAL-1, the lytic protein derived from bacteriophage SAP-1 and SAL-2, the lytic protein derived from bacteriophage SAP-2.

[0094] As shown in the above results, only injection with the composition containing bacteriophage or lytic protein derived from the bacteriophage of the present invention was significantly effective in the treatment of mastitis. Therefore, it was suggested that the composition containing bacteriophage or lytic protein derived from the bacteriophage of the present invention could be effective as well in the treatment of other infectious disease caused by Staphylococcus aureus. It was also confirmed that single treatment of each bacteriophage and lytic protein thereof was as effective as combined treatment of the bacteriophage and the lytic protein derived therefrom, but time for full effect was shorten by the combined treatment. The results of B)-E) of Table 7 were obtained on the 9th-10th day from the treatment and the results of F)-H) were obtained on the 7th-8th day from the treatment. Effective close used for F)-H) was greater than for B)-F). The concentration of bacteriophage used for F) was reduced to half to make the total amount of bacteriophage equal to that used for B) or C), followed by experiment by the same manner as described above. As a result, time for full effect was similar to that before reducing the concentration of bacteriophage but shorter than that of case B) or C). Therefore, the combined treatment might be more effective.

[0095] It was investigated whether Staphylococcus aureus isolated from the milk-cows with bovine mastitis could form biofilm by the same manner as described in Example <7-1>. Then, 6 milk-cows infected with the Staphylococcus aureus capable of forming biofilm were selected. The selected 6 milk-cows were grouped into three (2 per group). Group 1 was injected with the conventional antibiotics alone, and group 2 was injected with 5 ml of PBS containing bacteriophage SAP-1 at the concentration of 1.times.10.sup.8 pfu/ml, bacteriophage SAP-2 at the concentration of 1.times.10.sup.8 pfu/ml, SAL-1 at the concentration of 0.005% (w/v) and SAL-2 at the concentration of 0.005% (w/v) every day through papilla. Group 3 was injected with 5 ml of PBS containing bacteriophage SAP-1 at the concentration of 1.times.10.sup.8 pfu/ml, bacteriophage SAP-2 at the concentration of 1.times.10.sup.8 pfu/ml, SAL-1 at the concentration of 0.005% (w/v) and SAL-2 at the concentration of 0.005% (w/v) together with the conventional antibiotics every day through papilla. At that time, the composition of the present invention was first injected and then the conventional antibiotic was injected right after. The conventional antibiotic used herein was gentamycin cream widely used for the treatment of bovine mastitis. The antibiotic comprises 70 mg of gentamycin and 2.5 mg of dexametasone in each syringe. The results are as follows.

TABLE-US-00008 TABLE 8 Treatment effect on disease caused by biofilm-forming Staphylococcus aureus infection (somatic cell number/1 ml of milk) A B C Before 4.7 .times. 10.sup.5 5.0 .times. 10.sup.5 4.8 .times. 10.sup.5 treatment After 4.3 .times. 10.sup.5 1.8 .times. 10.sup.5 1.7 .times. 10.sup.5 treatment

[0096] In the above table, A) indicates the result of the injection with the conventional antibiotic alone; B) indicates the result of the injection with PBS containing two kinds of bacteriophages and two lytic proteins derived therefrom; and C) indicates the result of the injection with PBS containing two kinds of bacteriophages and two lytic proteins derived therefrom together with the conventional antibiotic.

[0097] As shown in the above results, the conventional antibiotic was not effective in the treatment of infectious disease caused by biofilm-forming Staphylococcus aureus, while the composition of the present invention demonstrated the treatment effect on biofilm-associated infectious disease caused by biofilm-forming Staphylococcus aureus. Therefore, the composition of the present invention is presumably effective in other biofilm-associated infectious diseases caused by biofilm-forming Staphylococcus aureus as well. The result of B) was obtained about 7 days after the treatment, but the result of C) was obtained about 6 days after the treatment. The time gap was not so significant but suggested that the combined treatment of the composition of the present invention and the conventional antibiotic might be more effective.

[0098] Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended claims.

Sequence CWU 1

1

311776DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 1tatgggtata cacaaattat atcaacaatc tgaccaatgg tattatggtc atagatgtca 60acattgtgat tatttaaatg aaatgagtta taatgattac aaccctgata atcttgaaga 120aagtgggaat atgttatgtg ttaaccctga aggtgtagat gaacaggcta aaacagtaca 180gaatggtagt taccaatttg tttgtcaaaa atgcggtaaa ccactagata gatggtataa 240tggtgagtgg cattgtaagt atcctgagcg tacaaaaggt aataaagggg tacgaggata 300cctaataaca caaatgaacg ctgtatggat ttctgctgat gaattaaaag aaaaagaaat 360gaatacagaa tctaagcaag cgttttacaa ttatattttg ggttatccat ttgaagatgt 420ttaactgaga gttaatgaag aagacgtttt atggtaacaa atcacctatt gcagaaacac 480aattaatgaa acgagataga tattctcata tagctaatgg tatagattgg ggaaatactc 540attggataac tgttcatggt atgttaccta atggtaaggt agacttaata cgattattct 600ctgttaaaag atgaccagac ctgatttagt gaagcagatt tagaaaaatc atttggggaa 660atatctagta cgacctgata tataatgcga tacggagatc agaaacatgg tctaaactca 720tatcatttga aagataaagt atttgatgta cgtataatct tcctcttagt ctacag 77621424DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 2gaagctaaca aggcaattca aaaaagatgt agattcaggt aaggcaattg aactaggtga 60tgtagctatt atagatacag cattaagtat tattctttca ggtaacgagt tccaaggaag 120tattcgttta tgctaaaaaa agacttgaag aaaaagaaag aattagaaaa gaagaagaag 180agaaacttaa taacttataa aagggaagaa ttatgagact atataaaatg aggtatcata 240attgaaaaag aaaccacaag gcaatgagat aatcataacc ataataacgg ttatgatagc 300aatatttgta gtcattatga ccatattttt taataaatac caagatgcta aagaagataa 360agatagatat cagagattag ttgagattta taaaaaagca gatgataatg atggagagac 420taaaaagaaa tacgtaaaaa gattaaataa agctgaagaa gaacttaaaa aagtaaagaa 480agaaacaaat tataaagact ataataagaa gtcaaataaa gaaagacaaa aggaagataa 540agaaactaga gagaaaatat atgatgtaac tggtgatgat gacttaatat tagtaaaaaa 600taatattgag tttagtgata aggtagataa acctgaaata cttattagtg aagatggaat 660tggtacgata actgtcccta caaacagtgg ttatgaaaaa caaacagtag gttctattat 720tactagtgta ttaggttccc cgttcttatc aactgattca ccggtataga tagttaggta 780tcatatagtt atgttatccc aaatacagta gatagtatag tagagataca aatacttcta 840ctgataatgt actaaaggat aatccctatt ataacaaatc ccagttgaac ccaaccacac 900cttcagatat attacctcct attgataatc ccgtcagttc ctatattacc tgaaaaccct 960gtagacaata attcaggaaa tatagataat acggataatc caaaccctcc cacctccagg 1020atataccaga tgaagatgga ggtagaggcc caggtggtgg aggtaatgtt gaaccccccc 1080caacggaaga accttcagat aacggtaata caggaggagg agattgggaa gaaaaacctg 1140acccaggaga agagccatca gataatggta atacaggaga caatgaagga gaggtaactc 1200ctgaacctga ccctacacct tctgagcctg aacaacctaa tgaaaaacct aatgagggta 1260atggtaatga agaaaaacca tccgaaccat cagataatcc tgatgaaaat ggaggatggg 1320aaactgagcc ttccgaacct gaaacacctt ctgagccgga cgataaggtg gacgaagagg 1380ataaaaacga agatacaaca gaggataaac aacctacaga acaa 14243702DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 3ctaaagaacc tgaaaaggtt actgaggaag atgctaaaga agcacaagag caaggtgaaa 60aagttgaatc tgaagaggta acagaggaca ctgaagatga ggaagttgaa aaatcagcta 120aagaatcaaa agaccctgta gaccaaaaag atactaaaac agaaaataaa gacaacgaga 180aacgtaaaaa taaaaaagat aaaaaagaag attctgaatc tgatgatgaa gacaaagata 240ctgacgatga taaagataag aaagaagata agaaggaaaa aacttctaaa tcaatttctg 300atgaggatat cacaacagta tttaaatcta tcctaacatc ttttgaaaac ttaaataagg 360gagaaagaaa actttgctac taaagacgat ttaagtgaag ttagtaaatc tattaatgaa 420gttatcagca aaaatttctg aaatccaatc tgaaagatgt ttctaaatca gtagacactg 480atgaagaaga agctgtagaa aaatcagtaa catctacaaa tggggagcaa gaaaaagtag 540aaagttatgt ttctaaatca gtagacactg aagagcaagc tgaaactggt gaagcaaatc 600agagatgctg agagtacaga gatacacatt aagatagtca gagaagacta gtcatgatct 660ataagcacag ctaagaccta gagcttctaa acatgactta ca 7024772DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 4caacagccaa aaaagatgaa aataagtaaa gggtgaatta aatggttaac tcaatgtttg 60aggggactta gacctttgaa aaatcataaa ctatgaatat cttatcatcc tagtggtaat 120cctaaacata tagacgtaag tgagatagat aacttaacat tagctgatta tggatggtca 180cctgatgcag ttaaagctta tatgtttggt attgtagtac aaaaccctga tacaggacag 240cccatgggtg atgagtttta taaccatata ttagaaagag cagtaggtaa agctgagaga 300gcgctagata tttctatact acctgatact caacatgaga tgagagatta tcatgagaca 360gagtttaata gttatatgtt tgtacatgct tacagaaaac ctatattaca ggtagagaac 420ttacagctac aatttaatgg tagacctata tataaatacc ctgctaactg gtggaaagta 480gagcatttag caggtcatgt tcaattgttc cctacagcac ttatgcaaac aggacaatca 540atgtcatatg atgctgtatt caatggatac cctcaattag caggtgtata cccaccatca 600ggagcaacct ttgcacctca aatgatacga ctagaatacg tatcaggtat gcttccacgt 660aaaaaagcag gtagaaataa accttgggag atgcctcctg agttagaaca gctagttata 720aaatatgcat tgaaagaaat ataccaagta tggggtaact taatcattgg tg 7725784DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 5aagaaataga taaattaaaa tatcaagata agcaagaaaa agaacaagta attaacaaag 60ttattaaagg tgttaatgat acttgggaaa aagaatataa ctttgaagaa ttagatttaa 120gatttaaagt taaaattaaa ttacctaatg cacgagaaca aggtaacata tttgcgttac 180gttctgctta cttaggtggt atggatatgt atcaaacaga ccaagtaatt agagcatacc 240aaatgttagc tacattacaa gaagtaggta ttgaagttcc taaggaattc caagaccctg 300atgatatcta taacttatat cctttaactg ttatgtatga agattggtta ggatttttaa 360actcctttcg ttactaatag tatagaaaca ttagataaag atatagaacg attgggtggt 420atggaatcaa ttgttaaaca acctttatct agaaatctat gggctattat gaaagagttt 480aatgttttgc ctactgagca aagatttaag gatttagacg attatcaaat agagtttatt 540attggtaata tgaataggga tgtttatgaa cataataaac aacttaaaca agctcaaaaa 600ggtggaaaat tcgacagtca atttgaagat gatgatagta gttggtggaa tgaatctcat 660gaagactttg acccggtacc tgatttctta gatgccgatg acttagcaca acagatggaa 720gctaaattat ctgatagaga taaggaagaa agagctaaga gaaatgatgc ggagttaaat 780gatg 7846761DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 6gaaggactca ctacacaaca tcttgctatg atggaataca ttagaagaaa acaagaagaa 60ttagatgatg aagtaggaaa tggtaaaact agtgaagatg atgctactat atcacaagag 120agcgttaata aagcactaga agacctagat gatgactggt atatgtaaag ggtggtaggt 180gatactacca tccttatttt tttaaaatgg atggtgaata atgatggcaa tgaatgacga 240ttatagattg gtcttatccg gtgatagttc ggatttagag aatagtctga aggcaataga 300actttatatg gattccctag aatctaaaaa tattgatgcc cctttagaca atttcttaaa 360gaaattaaaa gtaattgcta aagaagttaa aaatgtacag aactcaatgg ataaacaaga 420aggtaaatct gtcatatctt ctaaagatat ggatgaatct attaaatcca ctcaatctgc 480tacaaagaat ataaatgaat taaagaaagc cttagatgac cttcaaaaag aaaatatatc 540taaaggtatt gcacctgacc ctgaagttga aaaagcatat gctaagatgg gtaaagttgt 600agatgaaact caagaaaaac ttgagaaaat gtcttcacaa aaaataggct cagacgctag 660tatacaaaat agaattaagg aaatgaaaac cttaaatcaa gtaacagaag atataataag 720ataagtaaag attctagtgc tactaaagac tatactaaac g 76171472DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 7taaatagtac tgacatgttg aaaatggcta cttcatatga agcatctgta ggacataaaa 60gtgatgagga tacaatggca ggaactaaac aacttgctat tggaggacgt tctttaggta 120ttaaagacca agaagcttat caagagtcta tgggtcagat aatgcatact ggtggagtaa 180attccgataa catgaaggag atgcaagatg cattcctagg cgggattaaa caatcaggta 240tggttggtcg tcaagatgaa caacttaaag cattaggttc tatagctgaa caatcaggag 300aaggaagaac tttaactaaa gaccaaatga gtaatcttac tgctatgcaa tctacttttg 360cagagtcagg aagtaaagga ttacaaggtg aacaaggtgc caatgctatt aatagtatag 420accaaggact taaaaatggt atgaatagtt cttatgctcg tatagcaatg ggatggggaa 480cacagtacca aggtcttgaa ggtggatatg atttacaaaa acgtatggat gaaggtatat 540ctaaccctga aaacttgaca gacatggctg atatggctac tcaaatgggt ggtagtgaaa 600aagaacaaaa atacctattc aatagaagta tgaaagaaat aggtgctaac gattaactat 660ggagcgaatc tgatgagata ctttaaagat gctcgaatcc ggaaaattat ctaaagaaga 720gttagctaaa aaagctaaga aaatggaaaa agaaggtaaa aaagaaggag aagataacgc 780cactgattat aaagaatcta aatcaggaaa aaatgaccaa aataaatcta agactgatga 840taaggcagaa gatacttatg atatggctca accattaaga gatgctcata gtgctttagc 900agggctacct gctcctatat atttagcaat aggagctatt ggagcattta cagcatcact 960aattgcatct gcaagtcaat ttggggcagg tcatttaata ggtaaaggag ctaaaggact 1020tagaaataaa tttggcagaa ataagggtgg tagctccgga ggtaacccta tggcaggagg 1080aatgcctact ggaggaggtt cacctaaagg cggaggctct cctaaaggtg gcggtactcg 1140ttctactgga ggtaaaatac ttgatagtgc taaaggatta ggaggattcc tagtcggtgg 1200agcaggatgg aaaggtatgt ttggtggaga atctaaaggt aaaggattta aacaaacatc 1260taaagaagcc tggtcaggta ctagaaaagt atttaacaga gacaatggta gaaaagccat 1320ggataaatct aaagatatag ctaaaggtac tggtagcggt cttaaagata tttataatga 1380tagtatattt ggaaaagaaa gaagacaaat ctaggagata aagctaaagg ttttggtgga 1440aagctaaagg tctctatggt aaatttgctg at 14728763DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 8taaccgacat tacaagtatc aatgtacttg gtatgcttat aatagaagag gtcaattagg 60cattcctgtg cctttatggg gggatgccgc cgactggatt ggcggtgcta aaagtgcagg 120ttatggtgta ggtagaacac ctaaacaagg agcttgtgtc atatggcaaa gaggagttca 180aggcggtagt gctcaatatg gtcacgtagc ttttgttgag aaagttttag atggaggtaa 240aaaaatattt atctctgaac ataactacgc tactcctaat ggatatggta ctagaacaat 300agatatgagt tcagctatag gtaagaatgc tcaattcatt tacgataaga aataaaggag 360gatagtctat ggcaacagat aaagaagcta aagatgttat tgataaattt atagataatg 420tatttaattt tgatgtactt acaaaagaaa gaataaaaga aaaagatgaa gaaattaaaa 480aaataactac agatgatatg tatgaaaaag ttgtttatat acgaccttat gttggagtga 540tacaaagcct taaccctcaa catgtacaat atgaatcatt ttctaataat ggttacgata 600tagaagcaga attaagtttt aggaaagtaa gttatttagt tgataaaggg tctataccta 660cagattcttt atccacttta acagttcatt tagtagaaag aaaccaggag ttattaatag 720attactttga tgagatacaa gatgtgttgt atggggaata tat 7639696DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 9gatgaagagg tgtatattta atggtagtaa gatttccaat cttccatggg gagaagtcta 60aaaagagtag attcagatga cttaaatgta aaagggttag ttttagctac agttagtaaa 120attaattata agtatcaatc agtagaagtt aaagttaata acttgacttt aggaagccgt 180ataggtgatg atggtagctt agctgtacct tatcctaaat ctttcatagg tagaacacct 240gagggaagtg tatttggtac aaaaccactt attactgaag gttctgtagt attaataggg 300ttcctaaatg atgatataaa tagtcctata atcttgagtg tttacggtga taatgaacaa 360aataaaatga ttaatacgaa tcctttagat ggaggtaagt ttgatacaga aagtgtttac 420aaatacagta gttcactata tgaaatttta ccatctttaa attataaata tgatgatgga 480gaaggaacaa gtattagaac ttataatggt aaatcattct tctctatgac atcaggtgaa 540gaagagaaac cacaggcaac agatttttat actggaactg agtatcaaga tttatttact 600tcctattacg gtaataaaac attgattgaa cctagaatac aaaaggctcc taatatgtta 660ttcaaacatc aaggagtttt ttatgatgat ggtacg 69610754DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 10agaggtcatc gagaataaaa actatgtacc acctaaaatc aataatggtg atgaggattc 60ccaacaaaat actgtaccta aagaacaata tgatagttta aaagaagagc tagaacttat 120gagacagcaa caagaagcta tgatgaaaat gcttcagcaa ctcttaggtc aaaaggggta 180ataataaatg gcattaaatt ttactacaat aacagaaaac aatgttatta gagacctgac 240tgttcaggtc aataacattg gagaagagtt aacaaaagaa agaaatatat ttgacattac 300ggatgattta gtttataatt ttaataagtc acaaaaagtt aaattaacag atgataaagg 360tttatctaaa tcttatggta atataactgt aattagggat ataaaagaac caggttacta 420ttatataaat gcaagaacat tagctacact attagataaa cctgatatag aatccataga 480tgttttactt catgtattac ctttagattc atctagtaga gtaatacagc atttatatac 540gttgtctact aacaataatc aaattaagac attatataga tttgtttcag gtagctctag 600ttcagaatgg cagtttataa ctggattacc tagtaataaa aatgctgtta tttcaggaac 660taatatttta gatatagctt caccaggtgt ttactttgtt atgggaatga caggaggaat 720gcctagtggt gtagattcag gttttctaga tttg 75411665DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 11gttaaactta aaaaaacata atgcacattt ccaaaaagtt gttagagaaa agaatgaaaa 60gaaatatgat aaatatcaag atatgagaga ctttttagat tcagtgactg ttatgatagt 120tgatgaagca catcactcta aatcagattc gtggtataat aatctaatga catgtgaaaa 180agctttgtat aggattgcat taacgggttc tatagataaa aaagatgaat tactatggat 240gagattgcag gctctatttg gtaatgttat tgcacgaact actaataagt ttttaattga 300tgaaggtcat tctgctagac caacaataaa tattataccc gtagctaatc ctaatgacat 360agatagaatt gatgattaca gggaagctta tgataaaggt ataacaaata atgattttag 420aaataaactt attgcaaaac taacagaaaa gtggtataat caagataaag ggacattgat 480tattgtaaac ttcatcgaac atggagatac aatatcagaa atgttaaatg atttagatgt 540agagcactac ttcttacatg gagaaataga ctctgaaacc cgtagagaaa aattaaatga 600tatgagaagt ggtaagctta aagtaatgat agctacatca cttattgatg agggtgtaga 660tatat 66512789DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 12attcaaatcc ttttaatgac tttgatgtaa acagtgttga tgattcacaa gtaccttttg 60agacacaacc tcaaaacaca caacaagcac ctgaaccaca acaaactact caggagcctc 120caaaacaaaa acaaacacaa agtattgacg atgtattagg tggtctagac ttagataacc 180tataagatat agagtgcctt agagcactct tttatttgag atataattac taggaggata 240ttaaatggca agagcaaaaa aaggtaaaga agtagattta acagatttaa atacaattga 300tttaggtaaa gaattaggat taacattatt atcagataca aatagagcag atattaagaa 360tgttatacct acaatggtac ctcagtatga ctatatttta ggtggaggta taccgttagg 420tagattaaca gaggtttatg gtttaactgg tagtggtaaa tcaacatttg cagttcattt 480gtctaggatt gcaacacaat taggtgttat taccatttgg attgatattg aaggaacagc 540agacaataat cgtatggaac aacttggagt agatgtttca aaattattct ctattcaatc 600aggagaaggt agacttaaaa atacagtaga attatctgta gaggctgtag gtaaagaatt 660agagtactgg attgacacat ttaatgaaaa gatacctgga gtacctattg tgtttatttg 720ggactcacta gagctacacg aactcagaaa gagattgacg gcggtattga tgagaaacaa 780atgggtctt 78913685DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 13tcctaaggaa gacggagcag acgtatcagc agaataatat agataaagga tggtaaattt 60ggctaagtta aatttataca aaggtaatga gttactaaac agcgtagaga aaacagaagg 120aaaatcaaca atcacgattg agaatttaga tgctaacaca gattacccta aaggtacttt 180taaagtatca ttctcaaatg attcaggaga atcagagaag gtcgatgtcc ctcagtttaa 240gacaaaagca attaaagtta tttcagttac ccttgacgtt gatagtttag accttacagt 300tggagatact caccaactat caacaactat cacgcctagt gaagcatcta acaaaaatgt 360gtcatttgaa tcagacaaat caggtgttgc tagtgtaaca tcagaaggat taattgaagc 420agttagtgca ggaacagcta atattactgt aactactgag gatggtagtc atactgatat 480tgttgcggta acagttaagg aacctattcc tgaagcacct acagatgtaa cagttgaacc 540tggtgaaaat agcgcagata ttactgcata ggaggacaat aaagaatgga aaagacatta 600aaagtttata gtaatggtga agttgtaggc tctcaagtag ctaataacga tggagctact 660acagtatcta ttacaggctt agaag 68514700DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 14tctcacccat ctacatctac aaaagtattc cattccatat ctatacaaga acgttcacta 60ctttctataa aggcatttaa atcggcatat aattgaacaa aaaaagacat atcatagttc 120caatacttag gttcatttct tcctaatttt ttattcattt ttttatactt tctatttctc 180tttaacccaa aaacttcttt ttcaaaatca tttaatttta aacctttaaa atattttttc 240ttcatatcta atcctccaat ttaataagtg gtaaatctat atctctaaat acagaaccta 300cgtcacatag cagtatatca ttatgttctt ctacttcacc actactagta ggtgtatgac 360cacatacata tataaatcca tcttttctag gttggaagtc tctagaccat attaactggt 420ctactgtttg ctcttctata ggtttccaac taactccccc tgaatgggaa aatatatact 480taccttcttt ataatacctt ctacaattaa ccataaatat tttaaatttt ctataatctt 540cagattcttt aagtttcttt agttcacttt taataaaatc ataatgattt cttaaattat 600cttctacact tttatatttt aaagttacag tactaacacc gtaagagtta agtgtttcta 660tacaatacct tgataaccat tcaatatcat agatacttaa 70015789DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 15gaatggtacc cgatgaacca gctgttggcg ttgcacaaat aatacccatc gcagcattga 60cttcatttgt tgcaatggca cctttgactg catcaatcat ttcatatcca gacaaagcat 120gatgtgtttc attataatca cgtagtttag cagcgtcatg accagtgtag cccgttacac 180tttcaacgcc atcacctgtc gtccctttga ttactgcgtc tcgcatgaca tctaaatttt 240gtttcatttg cgctcgcact tcatcacgtg atttaccgct taattccatt tcttctttaa 300ccatgatatc cgcaaatgac atattatttt ctacggcata atctatagtc tctctaattg 360aatcaaacat gtttattccc cctctaattt atataggaaa cgtttacgtc actgtatttc 420tctttaattg tatttaatat cgattctgag attgctttat ttaatggtat tacaaccaag 480catttatctt catctatctt aataaattca tctttacagt ctaatttcat atcgttgata 540tcattaatga aatgatttac ttgtgcttta gtcatatttc cgtcaacaac taaaattggt 600aatccatgat ttaaatctac ttctagtcca tttatatgaa tacctttaat tttaattgta 660ccaccaccga ttgaataccg atatttcata tagcaccatc atacgagatg attatatagc 720acagtttgga tgttgacata ctatcgcttc tcttcgatga tatctatttt aataccatca 780tcagctgca 78916710DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 16gctaaatgtc acgatacatg cgtgacgacc ccaatcagtg catttgtacc atatagtgta 60ctggatatgc gctataaatc aatttgcgtc aatggctcaa tacaaactgc aaatgctttg 120acggtccacc aatgtttaat tttcggaata aaataaggtt aacaaatgag ctacctgtac 180atgttagtgc tccaatagcc ataggaacac ctgtcagtcc taataaactt gttaatacca 240ttgaacttag cggtgtcata cctgtaacag gaatcactag tcctaaaatg accgctaatg 300catatggatt gttatcacct accgcagtaa cagcactacc tatttgtttt aatgttgcta 360gcacaccagg tgtaatgatt gatgcaagtc cgaaagcaat tgctggtgca aataagatca 420ccacaattaa gtccaagcct tctggaactt tcttttcaat ccatttaatt aaaaaagcta 480cgccataagc tgcaatgaat gctggtaata atttaaagtc atgtaatact aaaccaacaa 540tgaccgcaaa tactggtgca acgcctaagt ttaagcacgt tagaatacct actgcgatac 600cgcttaaact tcctgctaaa tccccaatat cttgtagaaa tttaatatca aatacgccac 660caatggcata

acttaagaat gcttgtggta gaaatgtcgc acaagctgca 71017762DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 17gagacaaagc taaagaatta aatatcgaac cattggcagt gcttgatggc tttggaagtc 60atggtgtaga tcctttctat tatgggtatc gcaccagttg gcgctgttga aaaggctttg 120aaacgtagta aaaaagaatt aagcgatatt gatgtatttg aattaaatga agcatttgca 180gcacaatcat tagctgtaga tcgcgaatta aaattacctc ctgaaaaggt gaatgttaaa 240ggtggcgcta ttgcattagg acaccctatt ggtgcatctg gtgctagagt tttagtgaca 300ttattgcatc aactgaatga tgaagtcgaa actggtttaa catcattgtg tattggtggc 360ggtcaagcta tcgctgcagt tgtatcaaag tataaataat aagaaaacag gttatcacaa 420cagtattaat tacatgttgg cataacctgt ttttatttgt ttatggattt attgggtaat 480attagtcatt tgatggttta attgcaaatg ctctaacagg gaacccaggt gcatcttttg 540gtttagggct gatagcgtaa atgatggcgc cacgagttgg taattgatct aaattagtta 600ataactcgac ttggtattta tcctgaccaa gaatataacg ttcgccaact aaatcaccat 660tttttacaac gtccacagat gcatcggtat cgaatgtttc atgaccaaca gcttcaacac 720ggcgttcttc aattaagtac ttcaaagcat ctaatcccca ac 76218673DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 18acgttctact aaatgcatca tattaacagg tgataataca agatgtttct gaaatggaat 60aagccctgtc gctgcaatga atacgcctaa aaatccaggg atgtaatgga tactttgcgg 120tagtactaat gatagaaatg ataaaaatga aatcacaaag gctacggtcg caaaagcttg 180acatgtacgc ttatcgccat aatctaatcc tgtacgtata tgtaataaat actgtaatcc 240gatacttaag tacataattg ccacgcataa gaagaatggg aagaatgtct tttcaaagtc 300cggatatagg ctgttagata ggaagaccat gataaacata ttaaacatca taaacgaaac 360gtctttgaat gtaacttgac caaatcgatt tgtaaaaaat gtttgatgag accacattaa 420ccataagaac aaactcatga cgatgtattt gaaaaacaaa tcagctgaaa tggaaccatt 480ttgtgttgtt aaaatcacat gtgcaatttt ttgaatggca tagacgaaaa ttaaatcaaa 540gaacaactca tggaatcctg cacgcttttc agctaaatgt tttggtgtta atgcattaac 600cataaaattt taactccttt aagatgtgta attaatttac taagtatact atttattttt 660tctagtgaat agg 67319766DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 19cacatttagt acaaaataac gacattatcg ttattacatg caattatcgt ttaggcgcac 60taggatattt agactggtca tattttaata aagattttca ttccaataac ggactttcag 120atcaaatcaa tgtcataaaa tgggtgcatc aatttattga atccttcggt ggcgacgcta 180ataacattac tttaatgggt cagtctgcag gcagtatgag cattttgact ttacttaaaa 240tacctgacat tgagccatac ttccataaag tcgttctgct aagtggcgca ctacgattag 300acacccttga gagtgcacgc aataaagcac aacatttcca aaaaatgatg ctcgattatt 360tagatacaga tgatgttaca tcattatcga cagatgatat tcttatgctg atggcgaagc 420taaaacaatc tcgaggacct tctaaagggc ttgatttaat atatgcgcct attaaaacag 480attatataca aaataattat ccaacaacga aaccaatttt tgcatgtaat acaaaagatg 540aaggcgatat ttatattact agtgaacaga aaaaattatc gccgcaacgc tttatcgaca 600ttatggaatt aaatgatatt cctttaaaat acgaagatgt tcagacggcg aagcaacaat 660ctttagcgat tacacattgt tatttcaaac agccgatgaa gcaattttta caacaactca 720atatacaaga ttcaaacgca aaactatggc ttgctgaatt tgcatg 76620654DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 20aaaacaacga ttaatcctaa tgcgccaatg atggcactcg tatacgtgat agcttgaaca 60gaaacatgtg tcatgaccaa gcctccaata atgccaccaa caccaatacc agcgtttaaa 120ctagacatgt tccaactcat tacttggctt gtgtcgcctt caacatgttg aatcacaccg 180ctttgcactg ctggattagt actccattgc atgatattcc aaataaatag tcctgctaac 240aatagacctg aaccaggtaa gattaaattc ataagtaaca tcatgacgat aaaaatagaa 300accgaaatca ttaaccaacg cttacttgta attttatcgg agaatatacc acctaatgat 360gttccaataa cgccagcgat tccatttact agaagtgcta atgaaacgaa tgacatatca 420tgaccattag ataaaataag tggatttata aagacgaatg tcactgagtt tgcaatcaat 480actaaaaacg taataattaa atattttgct acttcagcag gtcttaatat tttcgaagta 540acatgatttt catgagatgg tgcctcatga ttcacagggc ctcgttgtat ttcctgatcc 600ttcggtaaat agatcaccat caagaagcca acaataatac tcacaataat taag 65421764DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 21tctaaactta tagacatctt gtttaacctc tttgttagta atccattgac tttgtccatt 60atcattcgct tgtttaccat ctaaacttgc agatactttc actgtaattt gtggcagttg 120ctttgctttt gctttaaaaa agtcttggta taattgtgat gcacgttcat catcaacgca 180ttcaacctca ataccgtgat cccgtaacgt atcatcacca tgtgtatcta acgaattgtc 240ttttgttgcg taaactactt tagctatctt acaatcaatt attttgttaa cacagggtgg 300tgttgaacca aaatgactac atggctctaa cgtaatataa atcgtcgcac cttcagcatt 360ttgttgtgcc atatcaagtg cttgaacctc cgcatgcttg tcaccttttc tcaagtgtgc 420accaataccg acaatcctac cttctttaac tacaactgcg ccaacgggtg gattaacacc 480tgtttgacct tgtaccatat ttgcaagttg aatcgcataa tccataaatt gactcaaatg 540atcacctcta taaacaaaaa tcctcacatc atgaattaag atgcaaggag aaaaatttat 600cgttaaataa gcctatttgt acacattttt acaaatacgc tacattatct ttgtcgataa 660ttaacattct ttctcccatc cagactttaa ctgtcggctc tagaatctca ctagatcagc 720cactaatatg aaacatatta gcaggtcgca ggctttattt actg 76422367DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 22ctgatactgt gaaatttttg gatctttgta cggtgaaaaa ttgtggcgcc ctcgggtgga 60agtaggaatc tttggtcgga gacgtcggcc acagtaggaa ttcgttggtg agtgcggtcg 120aatgtcaagt ttacagacta caatcatgac tatagggaat agaaaaaatt aaaaaatttg 180ttcatttaat acttcgatgc ctgatgagcg ctaattcatt ggaaacttac aatgctgata 240atgatcgaaa aataagaccg atgaatcaat gtattgtgtt tagtttcctg aagattgagg 300ggaaggtgca aaagatactt tgattcgaca tgatgttaat gaagacaata ttgatgtagc 360atttgtt 36723767DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 23ttttactcat gcatgcctat tttcaagtga gtctgagaca taaatcaatg ttctacgctt 60tacaaagtta tattggcagt ggggccccaa tacagagaaa ttggaatccc aatttcaaca 120aacaatgcga gttggggcgg tacaacgaaa tgaattttgt gaaaatatca tttctgtccc 180attccctgat gaatatgtgt atttaaaaag gacgttacct acattaaagt aagtcacgtc 240cgtatgctta tgatttactg tcactgtttt caattcgatt gatagtaaca tttagtccaa 300aatatttttc taaaaaatgt ttatagttat ctttagtgac agctaacttt tctgagatgc 360catcctttgc ttttgtcaaa gttaaatgat tttcagacat tgtagcacgg ccaaacgatt 420gtggcattgt aattaataaa tgctgtacaa atattgaatc tggatgcgtt tgattatatt 480caatattttt atcaaaatct gcaatacatt tagctttaaa ttcagcttca tattttgtat 540gccaatgatc attttcgaat ttttgaacat agaaaatatc cttgtcttcg ttgttaaaga 600tagcacgaaa cgtaccactg atgtcagtaa tcggttgtgt atgctctgac gaagtaatag 660gaatggcgtg tagaggtaag tctccaaagc caacatcagt tacatagaat acatcattta 720tagaaacaac aagtgaagca tgtgaaccgt tcagactgcg accgcca 76724698DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 24catgaaggaa atattaccca tcaatttcat aaatgctatt gcggcgaata ctgcatgtaa 60tatagcaatc aataatggta aaccgaagtt gaaagtaatt tttaataata atcccttaag 120catatctgta tgcgtaaagc ctatgcgttt taatattctg aagttactta gttcatcctc 180agtttcatcc atttgtttaa tataaataat acatccagct gctactaaaa atgctaatcc 240taaaaatgat gtaacaaata ttagaatacc gttagtagca tcgacctctt ttttcatgtc 300atcatacgtg attactttgt ctccaaactg ttttgcaatt gcttgagctt tttccttttg 360tgatgtttgt ttaatatcat acccataaaa agtatgaaca ttattttgtg ttttcaactg 420ctgatacttt tcaggactta cttcgacgac aggtgagttg aagcttagat ttaaaggata 480aaccttacct ttgtcttctt gtgtaacacg gaaagtttca ttcttagttc cttttactac 540taaatctttg tttaaaagga tattaatcac gttaggcagc gactttgtat ttgtaatgat 600ggcattgtta ccagttaact ttgtatttgc acttaaaata gaattcgtgc gacctgaatc 660actaccattt tccaaagtaa taacctgatc tttaacat 69825774DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 25agggttatac gatatcacac agcaagcgaa tgctaaggca gctggtattc gtattgctgt 60tgccgaaaag gcgggaaagt tgtcggcatg tatttattag aaaacagagg gagttcacat 120tccacctcgt tacaaaatgt ttttgctctc gtgcgagaat caaaactgtc tatgaaaatc 180gaattcgatt gattgagtgc atactctttt taattattaa catatttccg ttttcccaat 240ggaggagacc tttactgaga tacatctttt gctaattctg tcaaaaccaa tagattatgg 300tatgcaagtg gcttacctgc gagcgatcag tattgaaaac cactggaaaa catctatctc 360atccttcgat ttctgttttc gaccctatta cagttgtaga tacacaggtg tgctatggat 420caaagatgaa ggcttgattg ttattttaaa tatgggccag cacgacagtt ccatcttttc 480tatatcgaac gaactctaat gttcccattt attgttacaa tgcctcgtaa tccccctcta 540ttaagagctg aagattctta ttactaacaa ggcctaaata gatagatgct acggaacact 600tctccaaaca acaaaattat tatctttttt tcttcccgga aatgttttcc atgctgactt 660caccccggaa cgactgtcag ctacaccgat tagtgcgacc atacgggtca tcttgcttct 720tgctacatga aaaaagaaca atcctacaaa taaagattat gtctaggtgc acgt 77426703DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 26gatttcccta atgcagcaaa agatgaacat ggtcgtctac ttgtagccgc agcaatcggt 60atttcaaaag acactgatat tcgtgctcaa aaattagtcg aagcaggtgt ggatgtctta 120gttatcgata cagcacatgg tcactctaaa ggtgttatcg atcaagtgaa acatattaag 180aagacttacc cagaaatcac attagttgca ggtaacgtag caactgcaga agcaacaaag 240gatttatttg aagcgggtgc agatattgtt aaagttggta ttggcccagg ttcaatttgt 300acgacacgtg ttgtagcagg tgttggtgta ccacaaatta cagcaattta tgattgtgca 360actgaagcgc gcaaacatgg taaagctatc attgctgatg gtggtattaa attctcagga 420gatatcatta aagcattagc tgctggtgga catgcggtta tgttaggtag cttattagca 480ggtactgaag aaagtccagg cgcaacagaa attttccaag gtagacaata taaagtatac 540cgcggtatgg gctctttagg tgcgatggaa aaaggttcaa acgaccgtta cttccaagaa 600gacaaagcgc ctaagaaatt tgtacctgaa ggtatcgaag gacgtacagc atataaaggt 660gctttacaag atacaattta ccaattaatg ggcggagtgc gtg 703271488DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 27atggctaaga ctcaagcaga aataaataaa cgtttagacg cttatgcaaa aggtacagta 60gacagtcctt atagaattaa aaaagctaca agctatgacc catcgtttgg tgtaatggaa 120gcaggagcaa ttgacgcaga tggttactat catgcacagt gccaagactt aattactgat 180tatgtattat ggttaacaga taataaagtt agaacttggg gtaatgctaa agaccaaatc 240aaacaaagtt atggtactgg atttaaaata catgaaaata aaccttctac agtacctaaa 300aaaggatgga ttgctgtatt tacatccggt agttatcagc aatggggtca cataggtatt 360gtatatgatg gaggtaatac ttctacattt actattttag agcaaaactg gaacggttac 420gctaataaaa aacctacaaa acgtgtagat aattattacg gattaactca ttttattgag 480atacctgtaa aagcaggaac tactgttaaa aaagaaacag ctaagaaaag tgcaagtaaa 540acacctgcac ctaaaaagaa agcaacacta aaagtttcta agaaccatat taactataca 600atggataaac gtggtaagaa acctgaagga atggtaatac acaacgatgc aggtcgttct 660tcagggcaac aatacgagaa ttcattagct aacgcaggtt atgctagata tgctaatggt 720attgctcatt actatggctc tgaaggttat gtatgggaag caatagatgc taagaatcaa 780attgcttggc acacaggaga tggaacagga gcaaactcag gtaactttag atttgcaggt 840attgaagtct gtcaatcaat gagtgctagt gatgctcaat tccttaaaaa cgaacaagca 900gtattccaat ttactgcaga gaaatttaaa gaatggggtc ttactcctaa tcgtaaaact 960gtaagattgc atatggaatt tgttccaaca gcttgtcctc atcgttctat ggttcttcat 1020acaggattta atccagtaac acaaggaaga ccatctcaag caataatgaa taaactaaaa 1080gattatttca ttaaacaaat taaaaactac atggataaag gaacttcaag ttctacagta 1140gttaaagacg gtaaaacaag tagcgcaagt acaccggcaa ctagaccagt aacaggctct 1200tggaaaaaga accagtacgg aacttggtac aaaccggaaa atgcaacatt tgttaatggt 1260aaccaaccta tagtaactag aataggttct ccattcttaa atgctccagt aggaggtaac 1320ttaccggcag gagctacaat tgtatatgac gaagtttgta tccaagcagg tcacatttgg 1380ataggttaca atgcttacaa tggtaacaga gtatattgcc ctgttagaac ttgtcaagga 1440gttccaccta atcatatacc tggggttgcc tggggagtat tcaaatag 148828495PRTArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 28Met Ala Lys Thr Gln Ala Glu Ile Asn Lys Arg Leu Asp Ala Tyr Ala1 5 10 15Lys Gly Thr Val Asp Ser Pro Tyr Arg Ile Lys Lys Ala Thr Ser Tyr 20 25 30Asp Pro Ser Phe Gly Val Met Glu Ala Gly Ala Ile Asp Ala Asp Gly 35 40 45Tyr Tyr His Ala Gln Cys Gln Asp Leu Ile Thr Asp Tyr Val Leu Trp 50 55 60Leu Thr Asp Asn Lys Val Arg Thr Trp Gly Asn Ala Lys Asp Gln Ile65 70 75 80Lys Gln Ser Tyr Gly Thr Gly Phe Lys Ile His Glu Asn Lys Pro Ser 85 90 95Thr Val Pro Lys Lys Gly Trp Ile Ala Val Phe Thr Ser Gly Ser Tyr 100 105 110Gln Gln Trp Gly His Ile Gly Ile Val Tyr Asp Gly Gly Asn Thr Ser 115 120 125Thr Phe Thr Ile Leu Glu Gln Asn Trp Asn Gly Tyr Ala Asn Lys Lys 130 135 140Pro Thr Lys Arg Val Asp Asn Tyr Tyr Gly Leu Thr His Phe Ile Glu145 150 155 160Ile Pro Val Lys Ala Gly Thr Thr Val Lys Lys Glu Thr Ala Lys Lys 165 170 175Ser Ala Ser Lys Thr Pro Ala Pro Lys Lys Lys Ala Thr Leu Lys Val 180 185 190Ser Lys Asn His Ile Asn Tyr Thr Met Asp Lys Arg Gly Lys Lys Pro 195 200 205Glu Gly Met Val Ile His Asn Asp Ala Gly Arg Ser Ser Gly Gln Gln 210 215 220Tyr Glu Asn Ser Leu Ala Asn Ala Gly Tyr Ala Arg Tyr Ala Asn Gly225 230 235 240Ile Ala His Tyr Tyr Gly Ser Glu Gly Tyr Val Trp Glu Ala Ile Asp 245 250 255Ala Lys Asn Gln Ile Ala Trp His Thr Gly Asp Gly Thr Gly Ala Asn 260 265 270Ser Gly Asn Phe Arg Phe Ala Gly Ile Glu Val Cys Gln Ser Met Ser 275 280 285Ala Ser Asp Ala Gln Phe Leu Lys Asn Glu Gln Ala Val Phe Gln Phe 290 295 300Thr Ala Glu Lys Phe Lys Glu Trp Gly Leu Thr Pro Asn Arg Lys Thr305 310 315 320Val Arg Leu His Met Glu Phe Val Pro Thr Ala Cys Pro His Arg Ser 325 330 335Met Val Leu His Thr Gly Phe Asn Pro Val Thr Gln Gly Arg Pro Ser 340 345 350Gln Ala Ile Met Asn Lys Leu Lys Asp Tyr Phe Ile Lys Gln Ile Lys 355 360 365Asn Tyr Met Asp Lys Gly Thr Ser Ser Ser Thr Val Val Lys Asp Gly 370 375 380Lys Thr Ser Ser Ala Ser Thr Pro Ala Thr Arg Pro Val Thr Gly Ser385 390 395 400Trp Lys Lys Asn Gln Tyr Gly Thr Trp Tyr Lys Pro Glu Asn Ala Thr 405 410 415Phe Val Asn Gly Asn Gln Pro Ile Val Thr Arg Ile Gly Ser Pro Phe 420 425 430Leu Asn Ala Pro Val Gly Gly Asn Leu Pro Ala Gly Ala Thr Ile Val 435 440 445Tyr Asp Glu Val Cys Ile Gln Ala Gly His Ile Trp Ile Gly Tyr Asn 450 455 460Ala Tyr Asn Gly Asn Arg Val Tyr Cys Pro Val Arg Thr Cys Gln Gly465 470 475 480Val Pro Pro Asn His Ile Pro Gly Val Ala Trp Gly Val Phe Lys 485 490 4952917938DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 29taaatataat cggaaaaagt ttttgtaaat ttacacctcc ccaccgttta aaataaacga 60ttatacaaat caaaacttat aaattaactt atcatttcta aactaaactt ataaaaaatg 120ttcacctact ttcccaactt atctaaccta ttacatattc attaattaca aaatatatac 180atctattgac ttttatccaa aattatgatt tgaaattaaa atctagtttc ttctattaaa 240tagtagtttt aaattattta aactttttta cgatatttta ttgacaaaac atttaaacat 300ttgctatact aagtatgtaa tcaaaacaag gaggtaacaa aaatgattaa tgttgataat 360gcaccatcag aaaaaggtca agcatatact gaaatgttgc aattattcaa taaactgatt 420caatggaatc cagcatatac gtttgataac gcaattaact tagtatctgc ttgtcaacaa 480ctattattaa actataacag ttctgttgtt caattcttaa atgatgaact caacaacgaa 540actaagccag aatctatttt agcttatatt gctggtgacg atgcaatcga acagtggaat 600atgcacaaag gtttttatga aacgtataat gtttacgtat tttagaaagg aatgatataa 660tgaaagctga tgacattata actttacgtg ttaaaggtta tatattccat tacttagatg 720aatcaaatga atacattgaa gaatttatac cacttcacga gtatcattta actaaaacac 780aagcaataga attattacct aacacatgta cactattatc aactacacgc aaaacgaaaa 840aaatccaagt atattacaat gatttactac aaatttcaat taaagaggag aaataaaaaa 900tgacaaacgt aaaagaaatt ttatcaagac accaaaatac aacagcgaga tttgaatttg 960aggaaaaaga aagagaattt ataaaactat cagaattagt tgaaaaatac ggtattaaaa 1020aagagtatat cgttagagca ttattcacaa acaaagaatc aaaattcggt gtacagggtg 1080ttatcgtcac tgacgactat aatgtaaact taccgaacca cttaacagag ttaattaaag 1140aaatgagatc agacgaggac gttgttaaca ttatcaatgc tggtgaagtg caatttacaa 1200tttatgaata tgaaaacaaa aaaggtcaaa aaggttactc aatcaacttt ggtcaagtat 1260cattttaata caatttcata ggggatattt atcccctatt ttatgaggtg ctaaacaatg 1320gaaaaaatat acactgccgt attattatac aatgtatcaa ttaatgaaac atatgaacat 1380gaaattgaac aattcgaaaa aataaataaa gttaaggtaa tatatagtta ttttgacgca 1440aacttttaca aaaaaggtgc atataatttt ggtgtaaaat acattaagga gatataaaaa 1500tgaatattac aacaacatta aacacaaaaa aattaattaa ttatatttta gataatagag 1560attgttttat gaataaaata acaaaattta catcactaag tggaaaatgt gttgtttttg 1620ttagatacgg tgaaatttct attgaatact atgatagtga tacaaaaaac aataatgatt 1680tatttacttt agacattgac gttgatatta ataaacatgt ctttaattgt cttaaagttt 1740attatataga acatacagaa gatataaaca taatatataa aaaaggtgta tacatggggt 1800gtactattga tgatgtatta tcatattttg aaaaaccatt agaaagtgat attactatta 1860tttaccaagg caaagttatt tatgaatacg ggaaagtaat agaccatgaa taacctacta 1920gatattatta ttgttttcct tttagcattt ttaattacac ttgtaatact tatgacaatg 1980tatatacgtg tgtcatttgg tgttttattt actacattta ttatattcta cattatcttt 2040ttattggttg tatatgcttt atatggaggt tgataacatt ggtttagaca tacgtctgaa 2100atggatagat ggaaaaaaga aagagaagct agaaaagaaa gagaagaaaa aaaatataaa 2160aatgatttta gcggtatcaa ttttaaattt gacgataaag

atttacaaga ggcttatatt 2220gacgcatgga aacatttttc acatttacca catttaccaa aagaaaaaaa tgtatctcat 2280gcaaacgctg tttcattagt tcgtggtaaa cgacataaaa aattaaatca tatactagaa 2340atatataacc gtaatgataa taataacaaa aatgcaaaaa tgcataaata tgcattatat 2400aatttacacg ccgaaaaaaa taaatcttca cttacaaaat atattaaaga aattgataac 2460ttattttttg aaataggaaa atcagataga ccaaaaacaa caatagatga tatcaatgtt 2520aggtataact ttttatatta tgcaacattt gaagaataac tttaatactg taaatgacat 2580tataaactat tacaaggagc aaaaacatgg tgaaacaaaa tcgtttagac atggtaagag 2640attatcaaaa tgcggtcaat catgtaagga aaaaaatacc agaaaactat aatcaaatag 2700aattagttga tgaactcatg aatgatgata tagactatta tatatctatt tcaaaccgtt 2760ctgacggaaa atcgttcaac tatgtttcat tttttattta tttagctatt aaacttgata 2820taaaatttac tttattatca cgtcattata cattacgtga cgcttaccgt gattttattg 2880aggaaatcat agataaaaac ccactattca aatctaagcg tgtcactttc agaagcgcta 2940gagattattt agctattatc tatcaagata aagaaattgg cgtgattaca gatttgaata 3000gcgctactga tttaaaatat cattctaact ttttaaaaca ctaccctatt attatatatg 3060atgaattctt agcgcttgaa gatgactatt taattgatga gtgggacaag ttaaaaacaa 3120tttatgaatc aatcgaccgt aaccatggta atgttgatta tattggtttt cctaaaatgt 3180ttttactagg taatgctgtc aacttttcaa gtcctatatt atccaattta aatatttata 3240atttattaca aaaacataaa atgaatacat caagacttta caaaaacatt tttttagaaa 3300tgcgtcgaaa cgattacgtc aatgagaggc gtaatacacg tgcgtttaat tcaaatgatg 3360acgctatgac aactggcgag tttgaattta acgaatataa tttggcagat gataatttaa 3420gaaatcatat caaccaaaac ggtgattttt tctatattaa aactgacgat aaatatataa 3480aaattatgta taatgttgat acatttaatg ctaacatcat tgtaatacct tatacaaaac 3540aatatgagtt ttgcactaaa atcaaagata tcgatgacaa tgttatttat ctaagagaag 3600atatgtttta taaagaaaac atggaacgat attactacaa tccaagtaat ttacattttg 3660acaatgctta ttcaaaaaat tacgtggttg ataatgatag atatttatat ttagatatga 3720ataaaattat aaaatttcat ataaaaaatg aaatgaagaa aaatattaac gaatttgaaa 3780gaaaagaaaa gatatacgaa gataactata tagaaaatac aaagaagtat ttaatgaaac 3840aatacggctt ataaaaggtg tgtaagatta tgggattact tgagtgtatg caatatcata 3900aaaatcaacg taaaatgata ttgtactggg atattgaaac attatcgtac aataaaataa 3960acggacgcaa taaaccaaca ttatataaaa acgtaacgta ttctgttgcg attggttggt 4020ataatggtta cgaaattgat gttgaagtat tccccagttt tgaagccttt tatgatgatt 4080ttttcaagta tgtttatcgc cgggatacaa tcacaaaatc aaaaacaaat attatcatga 4140ttgcacataa ctgtaataaa tacgataatc attttttact taaagacacc atgcgttatt 4200ttgataatat tacacgcgaa aatgtatatt taaaatctgc agaagaaaat gaacatacaa 4260taaaaattca agaggctact attttagcca aaaatcaaaa tgtgatttta gaaaaacgtg 4320ttaaatcttc aatcaattta gatttaacga tgtttttaaa tggttttaaa tttaatatca 4380ttgataactt tatgaaaacc aatacatcaa tagcaacatt aggaaaaaag ctacttgacg 4440ggggttattt aacagaaaac caacttaaaa cagattttaa ttatacaatt tttgataaag 4500ataacgatat gtcagatagt gaagcttatg actatgctgt taagtgtttt gataatctta 4560catctgaaca attaacctac attcataatg acgtgattat attaggtatg tgccatattc 4620attatagtga catttttcca aattttgact ataacaaatt aacattctca ctaaatatca 4680tggaatctta tttgaataat gaaatgactc gttttcagtt actcaatcaa tatcaagata 4740ttaaaatatc ttatacacat tatcattttc atgatatgaa tttttatgac tatataaaat 4800cattttatcg tggtggttta aatatgtata ataccaaata tatcaataaa cttattgatg 4860aaccttgttt ttctatagac atcaattcga gttatcctta cgtgatgtat catgagaaaa 4920ttccaacatg gttatacttt tatgagcatt actcaaaacc aacattaatc cctacttttt 4980tagatgatga taattatttt tcattatata agattgataa agaggtattt aacgatgagg 5040tattaattaa aatcaaatca cgcgtactac gtcagatgat tgttaaatac tacaataatg 5100ataacgatta cgttaatatc aatacaaaca cattaagaat gatacaagac attacgggta 5160ttgattgcac gcatatacgt gttaattcgt ttgttgtata tgaatgtgaa tactttcacg 5220cacgagatat tatatttcaa aactatttta ttaaaacaca aggtaaatta aagaataaaa 5280tcaatatgac aacaccttac gactatcaca ttacagatga aattaacgaa cacccctact 5340caaatgaaga agttatgtta tcaaaagtcg ttttaaatgg tttatatggt atacctgctt 5400tacgttcaca ctttaattta tttcgtttag atgaaaacaa cgaattgtat aacatcatta 5460acggatacaa aaacacggaa cgtaatattt tattctctac atttgtcaca tcacgttcat 5520tgtataactt attagtacct ttccaatact taacggaaag tgaaattgac gacaatttta 5580tttattgcga cactgatagt ttgtatatga aatcagttgt aaagccctta ttgaacccca 5640gtttattcga ccctatatca ttaggcaaat gggatattga aaacgaacag atagataaga 5700tgtttgtact gaatcataaa aaatatgctt atgaagtgaa tggaaagatt aaaattgcgt 5760ctgctggtat accgaaaaac gccaaaaata caagcgtcga ttttgaaacc tttgtacgtg 5820aacaattttt tgacggtgca attatagaaa acaataaaag tatctataat aatcaaggta 5880cgatatcaat ttatccgtca aaaacagaaa ttgtttgtgg taatgtatat gatgaatatt 5940ttactgatga acttaattta aaacgtgaat ttatcttaaa agacgctaga gaaaattttg 6000accatagtca atttgatgat attctttata ttgaaagtga tattggttca ttttcactca 6060atgacttatt tccatttgaa cgttcagtac ataacaaatc tgatttgcat atattaaaac 6120aacaacatga tgacatcaaa aaaggcaact gttaaaataa cagtcgcctt ttctttgaga 6180taacatgaaa aatgtgtacg aaaattgatt atgttttgta ttttatttac tagcattact 6240agcatgtgtt cattatagca taaatcttta tgcaatacca ctaaagaata caatattatc 6300acctgcgttt tctggtacac cgttaatgag tgtatacaat aatacacgtg acggtgcaac 6360gtatggtggt acattatagt ttgcgactaa gaatgaacca tcgtcaaaca cagcaacaac 6420tacacccgtg tgaccgatac catatatgct tgcttgtaag tatggcggtt tactagagaa 6480gccgtaacca acggtaggaa tatgtgttgt tttagcccct aattttttat aaacatacca 6540cacacgttga ccgtttgtta cttgtccatc atcagttggt tgtctttttc catgtaattg 6600tgacatatac gcccatgtta attctgtaca ctgaccagca ttaccagttt gagggaatat 6660gttacccggt ttgtataaat attctttttt gaataaaggt acaccaattg cttttttata 6720tttttctggt aattggtcat acgtccagtt accacctatc acacgaccac tttttccgtt 6780tggtttcaca gatttacctc taatcgcatt atgctcacca tcgtcatcag tagggtttga 6840acttccaccg tcatctattt gcacactatc aatgagcttt tttaatgagt cgagtagtcc 6900aatcgtcatt ttaatatgat acgtgttgtt aaatgttttt tgtagtgtaa aataatcatt 6960actaaaaaat ttatcactac caatactatg cacgtcccat tgtaatgcgt cttgaacttt 7020ttttaataat tcttgcatgg cttgttttgc taaagcgagc agtgaactac cactgtcacc 7080actactacca ctgtcagacg aatcactagg tgaaccacct ttaccgtcta atttaccacc 7140ccatgctaaa atagtatttg caccgtctaa aaaaggatta ccatagtttt gtactttatt 7200atatgacgct ttcaaaccta ggggataata tgccgcccaa gtagctgcag ccgttaatgg 7260gatataagca cgtccaaccg taccagcttt catgttttta gcaaaatctg cattaccttt 7320tctttgtacg ttttgaggta caaagtgaac gatgttacct gcgtcatacc aagacggttg 7380tcctgcttgt tttgattgtg atacaagctt tctagctaca aatttagcgt ctgttaaata 7440atcgccttgt gcagaagtat gatttaacca acctaaacct gcactgtatc cttcgttttt 7500ttcatataca gcaattagcg taggtgaaac tcctatcgat ttaactgcat ttagaacttg 7560tctgatttta ctttcattac cacctaacca aacattaaaa cgtccataac cttttacttt 7620aggcactaac tggtctatcg ttaatccaaa gtcatcatta atataagaat gtgtaaattt 7680atctatcttc tcttggtcgt tcatctttat cactcttttc agaatcgttt ttaattactc 7740ttaatttatc tttaatttgt tctggcacta atacatccat ctctgcacaa ttttctacaa 7800tagataaacc ctcattagca atataataga aaatcgtaat cataagtaga ccacctttta 7860attgtaaaat ttggtcaatg atatttgcta gaataataat acagaatatg agtaattttt 7920tagcgaaacc tctcattgat ttttttgacc atagattatt atttttaatg gcttttgaaa 7980tacctgtaat aatatcaaca aacattaata taaataaaaa atatagtaat tttaaatctc 8040ctgcatatat aaacatgtga aacacttctg tatctgtaaa cctgaatttt acttcattca 8100tttttatacc ccctctctaa atttattatt taatggattt tgtaacatag ggttacctga 8160accatcatta tgccaaaatc tcacaccaga ttccaaaata gcttttaatt gttccattaa 8220catagggtca atgtcacgta ttgtatacgt acctgtacat tttaaatagt tgcatatagt 8280catactgtta attggttcaa taaatgtatt atagtcattt acttcaaaac caaacaacat 8340ataatatttt tgtaaaaatg taatttcttt aggtgacggt acactaattt tcattgttaa 8400accgttaatg ctatttgcga tttggaaagc gttccccatt tctgactctg tcactgatgg 8460tggttgtaag gctaaatctt tatattctgc ttgttgttgt ttgtagaaat tatattcttc 8520attaaactta ccaaataaag cagttggact taaattactt gctacactta cagcgtcata 8580aaaacgtgat tttgggtcac tgccatttaa tacattatct atacgacttg tgattaattg 8640actttctgca ttacgctgtc tattggcttg ttgtgattgc cctaaaatac cgttattgat 8700taaaattggt acttgtgcaa aactattaaa tgttatattt gtatttaaga atgaacctgt 8760atcaattaat atatctttat tttttgcaag tatcggtcta tcattttcag cactgttata 8820atctactgga taaactcgca cttcattatg ataaccaatg atggattttg tacgtaactt 8880aacacctgtt ttttgtgaaa tcttaccagc gtctagtaac atagtattac cattccagtc 8940ataaaaatca atcgtcatgt actcattacg tatcatatgg tcgcactcgt cttttttaga 9000caacatcatc tcttgaagct ttgtgaaact taatgataaa tcgtttaaac tccattcttt 9060tgattttcca ccttgtttta acgtctttaa tccagtaatt ttttcacttg tcttaacgtc 9120ctctaaatct tttgtattaa tagaatcttt aggtaacatt tgaacctttt gaaagttttg 9180tgtaatccat ggataggcac tcattttatc cataaagtta ataaagtcac catattccat 9240aacgtataag ttgactggtg atgtgatatt gtcatatatt gtacctttag acgtatctaa 9300gtttggctct tttttagtac caaatttctt tgataaatca gcacttgact ggaataacac 9360taaattttcc aaaaactgtt gcatttggtt atacacatag tttttatttg atacttttaa 9420cacatcatca ttgttacgta acattggtaa catatagtta tacgtgcgtt ttgataagtg 9480ttgacgttca atattaacgt ttgagagttg ttctaataca ttaccttgtg tatacgtcat 9540aatagtatca atcacaaaat atattttaac cacaacatca ttcacatatt cgatttgatt 9600cacaaacgca taataacgtc tgtcctcaaa atctgataaa aacgtcatgt agttaatccc 9660ttgtgcgtca tgccactgca tatcaacatt gatttccatt ctatcacgta taaaattata 9720cggttgtttg gaatagtcta atgatttaaa atgacgtcca tttaaaaaat aatcatcacg 9780ttcttgatta ctattaaaat gaatcgtatt ttgataatca gtaaacggtg tgttatagaa 9840aaatttaaaa tttgttaatt ttctcatttt tacctccata aaaaatagtc gtataaatta 9900tttatacgac tattataaca tttttattca atgatttgtg tatctattgc aaaactttta 9960ttaccatttg aaagctcact atcactataa tttgatgtaa caaaatgtaa ttcattatta 10020aagtttaaat ataatcttgt attaatcatt ttcgaatcaa tcgcacattg tgtgtagtga 10080tgtgtagatt ttaagtttgc gttaatcgta cctaatttaa tatcaccgtt tttcttaatg 10140ccttttaata ccccttttaa ttgtatggtt ttaacaccat taattgttaa aatacgatat 10200tgcggtgcag gatatccaac gttgctatca cttgcaataa taccactttc taatgtaata 10260tcttgccacc ctgtatcatt cacagttgtt ttattttcat taattgtatt taaaatttct 10320attttatcat tagttattat agcagttaaa ttgttaatac tttgtgtatt attacctaca 10380ctttcttttg tagctataat atcttgttta tttttttcaa tatcttcttc attttttgtg 10440tttttatcat ctaatatatg aattgcagat tcatgattac ttagtttatt tgtatgttct 10500gattgaacat ctgataaatt ttttattttt ttatcttgtt gcacattatc ttctttaata 10560ttaataatgt ctgtagcgtt ttgagaaata ttatttttat ttgtagcgat atcattttta 10620tttttattaa tgtcttttgt gttcgtatta attttactta ataattcatc tttaaaggtt 10680aacttataat aatcctcatc acgtcttata taaatgttac cgtcctttgt agtaattaag 10740tcatttgctt ctactaaatt atcatttaat ttatctacag agtcaatgtt gcgcaaactt 10800ccttaaaatc caacaaccat tggttaaacc ttttatttta atgttttcca actaattcaa 10860agaaaaattc tattttatca ttagttttta tagcagttaa attgttaata ctttgtgtat 10920tattacctac actttctttt gtagctataa tatcttgttt atttttttca atatcttctt 10980cattttttgt gtttttatca tctaatatat gaattgcaga ttcatgatta cttagtttat 11040ttgtatgttc tgattgaaca tctgataaat tttttatttt tttatcttgt tgcacattat 11100cttctttaat attaataatg tctgtagcgt tttgagaaat attattttta tttgtagcga 11160tatcattttt atttttattt atgtcttttg tgttcgtatt aattttactt aataattcat 11220ctttaaaggt taacttataa taatcctcat cacgtcttat ataaatgtta ccgtcctttg 11280tagtaattaa gtcatttgct tctactaaat tatcatttaa tttatctaca gagtcaatgt 11340tgcgcaaact tcttacaatt ctatcagcca ttgtttacac ctcttattta tatcgtttcc 11400aactaaattc aaagaaaaat cctaaaatac ccattatgag aacacccccc aaggtacacc 11460aatactatat gcattacctg tttttccgtt ccattgtcta actggtaaat aataacgagt 11520tccttgccag ttataaccaa tccaaactaa cccatctgat aaacaaactt cgtcatatgg 11580tgtatagccg tttggttgga accaatagcc attaggttca cttaatttag gactacagac 11640acgtgcaaat attggtaaaa aaccacatgt aaatgttgcc ttttcgtttc tataatatgt 11700gccgtattgg ttttgtttcc aattattagt tagttgaata ttttgttcta atactttact 11760ttcactgttt gagaattttg ggcgaataaa atgtgtcaca ccgtcataat aatgtgttct 11820aattgttgct ttttcccaac catcatatcc accattcaac cagttttgtt ctaaacatgt 11880ataataatca agatttccac ttgttacaca ttggatatgt ccatattgag aatttgtgta 11940tactgcaaca tcacctaatt gaggtttaaa gctcgatgta ttttcataca ccgttgctaa 12000acctttaaag tcattattaa ttgcgtcttt agcattaccc cacatacgca ctttaccgtc 12060agtaatataa tagatataag caacagctaa gtccatacat tgaaaaccat atgcaccatc 12120aaagtcaaca ccaacacctt catgtttata tatccaatct ttagcttgtt gttgtgattt 12180catttataac actcctattt tttatgtttt gctacccatt catattcacg atgttttgta 12240tcagcgttca cattactgaa aaactcttta tattctgata tgttagcttc taatgtttgt 12300ctcacttctc caactgcgtt accacttgac acacgtaacc atgcaccaac acgttttatt 12360tcttccggtg cgtctttgaa taattccatt tggttgcctg taatataata ttctccgggt 12420gttgtaacgt aagctatcca attattatat ttacttgctt ctaaatattc ttgatatggt 12480gcgtctgttt tgattgttgt ccataaacca taatcccatt ttaacgtgaa tacatctagc 12540gtcataccac gcataacttt taccatttta cgaccagttg aaaaacgtgt taattcttga 12600acagtaccta atgtttgtgt tgtagggtat acattaatga aacaaccagc gtcaataatt 12660tttttacttc catttgtagg catgttttta agcttttctg ccgtactacc gtcaatataa 12720taaaatccag cttgcgttaa gtcatttaag tcgtcgatat ggtcaggtat agataatgca 12780cgaccgtcat cttttgttaa tttataattt tgagaacctc ttgcacgtaa tgcttcaaaa 12840tgttcatatt ctccaagttg gaagaaaccg tataagttat ggaatcgttt accaccaccg 12900ccattagtca ttgcaagtaa taacgattta cgttttgttt ttgggtttgt ataaatacaa 12960ataccctcag gctctttaaa attatcacgt gggaagttaa ttccgtcttg gtaagataac 13020ttaaacgggt aatcgtataa cttttgacca gttgttaatg aatctttgcc aatttgcaca 13080tgtgaattaa ctgaactgtt accacttaac cagtacaaat catcaccatc aacagcaata 13140ccttgcatcc aacgtgcatc gttattttct gaattatcaa ttgtcatttc tttttctaca 13200ttatcaatat gatttttaac atcagctctt gaacgtacct gtatcgtacc atcaccgaaa 13260cgtaatacga gtttgtcatt tgcttcatca attaacggtg taaaagaatg tttgtttaaa 13320agtgactgtg gtgtataatc tgttaaccct ttggcttctt ctaaatctaa tacatagtta 13380tctttatatg ctacttgcaa cagttttgca acaccatcgt gatgtaacca tattttcatt 13440tccccgtttg attgtctttc taatccgatt gttgtaccgt gaccaccttg tacaatacgc 13500atactagaaa ttaaatcacc actaggcgtt aatttattaa tccaaaatcc ctcaggtgtt 13560tgtgagtcgg attgtgttga gtacatttga ttcgtttctt tatcaatatt aatagattgg 13620ttcacagcgt tacgaatacc cccaaagccc attacaaact taggttcaag ctcatttaat 13680tcgaacccat taacaaaacg gttaatgtct ttaattaagt ctttaacttc tgctttaaaa 13740tcattcattt gtttcatttc agcaacttta aataatgcaa atgcagatgt aagaccggca 13800ctatatttag taaattcatc atgaataatg ttatctatcg taccatcatt taaccaacct 13860ctaaataatt ctttagcttg gtctgggaat gctttcatta agtcgtccca atttttgaaa 13920cgttttttta actcatcgtc atagtcccaa atacgatgtg ctaatacttc aatgagcttt 13980gataatcttg aaatataatc ataatatgat tttgaattgg tattataatc tgctctatca 14040tcgtaaaacg gtgtataacg ttctctcgtt ttatatattt cgtctaaaaa tggacgaatg 14100tcgtcaaaat atttaaaatc gttttcatta tatgccataa ttttccacct ttaccaaatt 14160tgtaaaaaac atttttttat caaattcatt taaaattttc tttcttaaat cgtatacttt 14220atcaatatta tcaattaaat actgttttga aaattgtgtg cctttcgcat tacctttttg 14280attttgatta cgttttacgt tttgattact ttcgttactt gatttattca cagttttacc 14340gttatcaatc gtgttattgt ctgcaaattt taacgttgtt ttatctacat caatgttaac 14400ctcgctttgt ggtaatgaca cataagcatt tctgttcgct gtcataccag ttgaattgtc 14460taaagatgta gcattttgat ttgatgtttc atctgtgttg tttgttgtat cttcattatg 14520ttctgtaaaa ccttgtgatt gtagatattt ttcaacttca cttgatgaat aaacaacatt 14580caaataatcc tcatgtgtga tacatacagt aatcacttgc ataccaaatg cctcaactgt 14640ttgtctgtta atctctctat ctaaaaaatg aatcgtaaat gattttttaa aaagtaagtc 14700tgataaatct tctttcaatg aaaaaccttt aaatactttt tcattaacga tagctaaaac 14760atctttatcg aatttcaaca ttttttgcat aaattgaaaa tcatcatcat aaaacgttaa 14820tttattatca tttacaaatt cattgaaacc ttttttaata agctcagatt taataaaatc 14880gtataaagtc attgtatatc tagccattta aatcactact ttcatctttt aaaagtgtgt 14940caaccattga tattttagac gttgtttcat catcgtaata cggtttaata tctaaaccat 15000agcgtttaga taaaaacgtg attggttcac gaccttttaa ataaatatta ctatttgatg 15060ttgtaaaacc acgattactt ttagcttctt catctgatac accactttct ttatcaacag 15120ctaaagagtt aatacctaaa tagttactta attcactaat cttattttga tactctcttt 15180tcatctcagt taaagcagga atcacactat tacttgttaa atcaataatg tcatcttctg 15240cattaaacat aggtgacatt ttaacaaatg gtgcaccgtt atatatttct gatacaagtt 15300gattaattga ctcgtcatta atttctgatt taaatacctt gctaaatttc gcttgcataa 15360tcaatgaaaa tcgagataaa acaacttcag ctaattcatc ggtatagtgt tcaatgattt 15420caatatcact attatactgt ataggtttat tttgcataac aacaaagtta ccactcatac 15480aattatcgta tagcttatga atttgtagac actcatcagg aattaaatag tcaggtacaa 15540taaaataaat atcttctttt gttaatcgtt tttgaaattg gaaattaaag tttgatgaaa 15600aatttggtgc ttgattaaaa taggtattat ttacataacc aagtatcata atttgtttat 15660ttctagcttc accaaccact acattaatat tttgccttaa tgcagactct aactgtataa 15720aatctatacc aaccgtatca cgattggtat agtttataag taggggtaaa aattccaaat 15780aacgattaaa cataagacgt ttaaatctgt tgcgatgttc aacaactctt ttgttgattt 15840cttttgataa ttcaacgttt aaacctcttt tatcgttgtt catatttacg ctccttttat 15900tctgttgctt cttcctctag ttttggtgtt acatcttggt cagtaattaa tattttatta 15960aagaatggac taatagcctt gaatgaataa taatgaatcc agtgtgtgac ctcatcaaat 16020tcaccattat agaatggttg ttttaacata cctttggtat aacgtttgta tttaattgca 16080ttaatatcta aaataaatgc gtataaatct gattttggtt taatttcttc aatgttacca 16140gtaaactctt taagtttaga aacatcataa gtaaatactg caccaactgg aattgtgtca 16200ccaatttgcg actgataatc accgtaagca cgtaagaaat caattgtctc ttgattttgt 16260aatttaaatt cttttgttac tttaaacaca ccacctaaat catcaaaact tataacatgg 16320tctgtaaaat caataccagc gatttggaat gtgttagcaa tttttgtatc taataggtaa 16380gattttaaag aatctgttgt taaaataaca atatctttta acttagatac agttgtatat 16440tgaccaattg caccaccaga agcacggtga acttcattgt atttagcgct gttgttttgt 16500aagtttaaaa ttgcttcaaa tactttgctt gctaaatctt cttttgatgt tgttttacgt 16560acgtttgact ctgataattg atttaatgag taatcaacta acattgctcg catttctttt 16620tcttctaata cattaatatc agaaattttc tttttatata cacctaatgc gtaatttgtt 16680gcgtctgcta atgtttggaa attgaaacgt gtatcattat tgtttaatgt gaatttttgt 16740ttcttcacaa taccactacc atataactta gtagccatac gtggataatt acgtttcaac 16800attaattcct cattttttga taaatccata ttaattggta ctgtatccat aatgacatat 16860tcttcactat attgaccaat aaagtcttgt tctttagcta accaattaaa acggttacct 16920aaagcaatat caattaataa tgtctcgtta atcttaggga ataaatattt atttacaaat 16980gtttcaaaca ttgtattatt gttatcccat ttatcaccaa atgtccaaga ttttgaataa 17040tcatggttaa aatcttgtaa tgccgacttt gcagattttg ctactaaaag agctgtttcg 17100ttttttgtac ttgctggtgc cataatttat tattcctcct ctacgtctcc gctaaaagtt 17160tgttttgaaa gtgaatggat ttgtacaccg tactcatctt cacttttgtt tacatctatt 17220gacatatttt catttaattc agtacgttta tttaaacgtg

aatcttcata tgatgtcccc 17280atcatagaac gcatgttatt gccttcatac atattatttt cctcctaatc taaatctaac 17340ttgtcaacta attcttcatc tgaatagtct ttatcttctt tgtcagcatt tgttacatct 17400ggttgtgttt gttgtggttg ttgaatttgt gatgataaaa aagtagtcat ttgttgctct 17460aatgatgtaa tacgttgttc taatataaca gggtcgaatt ttgaactatc ttcatctgtt 17520atagtaggtt ctaatttatt cttattttct tcttcaattg tttctactgt tttatcttca 17580gtaggttctt cagttggttc ttcagttggt tcttcagttg gttctttgtc gtctggtttt 17640acgatttcct caaattctgt cattgtgaca cctccaaaat attttataac taattatatc 17700atagaatatt taaataagta aattaaattt attaaaaagc gtgaacatag ttttcaataa 17760aagtaaatag atgtatatat tttgtaatta atgaatatgt aataggttag ataagttgga 17820aaagtaggtg aacatttttt ataagtttag tttagaaatg ataagttaat ttataagttt 17880tgatttgtat aatcgtttat tttaaacggt ggggaggtgt aaatttacaa aaactttt 1793830750DNAArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 30atgaaatcac aacaacaagc taaagattgg atatataaac atgaaggtgt tggtgttgac 60tttgatggtg catatggttt tcaatgtatg gacttagctg ttgcttatat ctattatatt 120actgacggta aagtgcgtat gtggggtaat gctaaagacg caattaataa tgactttaaa 180ggtttagcaa cggtgtatga aaatacatcg agctttaaac ctcaattagg tgatgttgca 240gtatacacaa attctcaata tggacatatc caatgtgtaa caagtggaaa tcttgattat 300tatacatgtt tagaacaaaa ctggttgaat ggtggatatg atggttggga aaaagcaaca 360attagaacac attattatga cggtgtgaca cattttattc gcccaaaatt ctcaaacagt 420gaaagtaaag tattagaaca aaatattcaa ctaactaata attggaaaca aaaccaatac 480ggcacatatt atagaaacga aaaggcaaca tttacatgtg gttttttacc aatatttgca 540cgtgtctgta gtcctaaatt aagtgaacct aatggctatt ggttccaacc aaacggctat 600acaccatatg acgaagtttg tttatcagat gggttagttt ggattggtta taactggcaa 660ggaactcgtt attatttacc agttagacaa tggaacggaa aaacaggtaa tgcatatagt 720attggtgtac cttggggggt gttctcataa 75031249PRTArtificial SequenceDescription of Artificial Sequence Note = Synthetic Construct 31Met Lys Ser Gln Gln Gln Ala Lys Asp Trp Ile Tyr Lys His Glu Gly1 5 10 15Val Gly Val Asp Phe Asp Gly Ala Tyr Gly Phe Gln Cys Met Asp Leu 20 25 30Ala Val Ala Tyr Ile Tyr Tyr Ile Thr Asp Gly Lys Val Arg Met Trp 35 40 45Gly Asn Ala Lys Asp Ala Ile Asn Asn Asp Phe Lys Gly Leu Ala Thr 50 55 60Val Tyr Glu Asn Thr Ser Ser Phe Lys Pro Gln Leu Gly Asp Val Ala65 70 75 80Val Tyr Thr Asn Ser Gln Tyr Gly His Ile Gln Cys Val Thr Ser Gly 85 90 95Asn Leu Asp Tyr Tyr Thr Cys Leu Glu Gln Asn Trp Leu Asn Gly Gly 100 105 110Tyr Asp Gly Trp Glu Lys Ala Thr Ile Arg Thr His Tyr Tyr Asp Gly 115 120 125Val Thr His Phe Ile Arg Pro Lys Phe Ser Asn Ser Glu Ser Lys Val 130 135 140Leu Glu Gln Asn Ile Gln Leu Thr Asn Asn Trp Lys Gln Asn Gln Tyr145 150 155 160Gly Thr Tyr Tyr Arg Asn Glu Lys Ala Thr Phe Thr Cys Gly Phe Leu 165 170 175Pro Ile Phe Ala Arg Val Cys Ser Pro Lys Leu Ser Glu Pro Asn Gly 180 185 190Tyr Trp Phe Gln Pro Asn Gly Tyr Thr Pro Tyr Asp Glu Val Cys Leu 195 200 205Ser Asp Gly Leu Val Trp Ile Gly Tyr Asn Trp Gln Gly Thr Arg Tyr 210 215 220Tyr Leu Pro Val Arg Gln Trp Asn Gly Lys Thr Gly Asn Ala Tyr Ser225 230 235 240Ile Gly Val Pro Trp Gly Val Phe Ser 245

Claims

1. A composition for removing a biofilm formed by Staphylococcus aureus, comprising, bacteriophage, wherein the bacteriophage kills Staphylococcus aureus and destroys the biofilm.

2. The composition of claim 1, wherein the bacteriophage is Myoviridae family T4-like phage genus bacteriophage (Accession No: KCTC 11153BP, SAP-1) or Podoviridae family .phi.29-like virus genus bacteriophage (Accession No: KCTC11154BP, SAP-2).

3. The composition of claim 1, wherein the nucleotide sequence of the bacteriophage comprises SEQ. ID. NO: 1, SEQ. ID. NO: 2, SEQ. ID. NO: 3, SEQ. ID. NO: 4, SEQ. ID. NO: 5, SEQ. ID. NO: 6, SEQ. ID. NO: 7, SEQ. ID. NO: 8, SEQ. ID. NO: 9, SEQ. ID. NO: 10, SEQ. ID. NO: 11, SEQ. ID. NO: 12, SEQ. ID. NO: 13, SEQ. ID. NO: 14, SEQ. ID. NO: 15, SEQ. ID. NO: 16, SEQ. ID. NO: 17, SEQ. ID. NO: 18, SEQ. ID. NO: 19, SEQ. ID. NO: 20, SEQ. ID. NO: 21, SEQ. ID. NO: 22, SEQ. ID. NO: 23, SEQ. ID. NO: 24, SEQ. ID. NO: 25, SEQ. ID. NO: 26, or SEQ. ID. NO: 29.

4. A composition for removing a biofilm generated by Staphylococcus aureus, comprising, a lytic protein derived from a bacteriophage wherein the lytic protein kills Staphylococcus aureus and destroys the biofilm.

5. The composition of claim 4, wherein the lytic protein derived from the bacteriophage comprises SEQ. ID. NO: 28 or SEQ. ID. NO: 31.

6. The composition of claim 1, wherein the composition is a disinfectant, a medical cleaner, or an environmental purifier.

7. A pharmaceutical composition for the treatment of disease caused by Staphylococcus aureus capable of forming biofilm, comprising, bacteriophage, wherein the bacteriophage kills Staphylococcus aureus and destroys the biofilm.

8. The pharmaceutical composition of claim 7, further comprising an antibiotic.

9. The pharmaceutical composition of claim 8, wherein the antibiotic is lysozyme, lysostaphin, methicillin, oxacillin, or vancomycin.

10. The pharmaceutical composition of claim 7, wherein the bacteriophage is Myoviridae family T4-like phage genus bacteriophage (Accession No: KCTC 11153BP, SAP-1) or Podoviridae family .phi.29-like virus genus bacteriophage (Accession No: KCTC 11154BP, SAP-2).

11. The pharmaceutical composition of claim 7, wherein the nucleotide sequence of the bacteriophage comprises SEQ. ID. NO: 1, SEQ. ID. NO: 2, SEQ. ID. NO: 3, SEQ. ID. NO: 4, SEQ. ID. NO: 5, SEQ. ID. NO: 6, SEQ. ID. NO: 7, SEQ. ID. NO: 8, SEQ. ID. NO: 9, SEQ. ID. NO: 10, SEQ. ID. NO: 11, SEQ. ID. NO: 12, SEQ. ID. NO: 13, SEQ. ID. NO: 14, SEQ. ID. NO: 15, SEQ. ID. NO: 16, SEQ. ID. NO: 17, SEQ. ID. NO: 18, SEQ. ID. NO: 19, SEQ. ID. NO: 20, SEQ. ID. NO: 21, SEQ. ID. NO: 22, SEQ. ID. NO: 23, SEQ. ID. NO: 24, SEQ. ID. NO: 25, SEQ. ID. NO: 26, or SEQ. ID. NO: 29.

12. A pharmaceutical composition for the treatment of disease caused by Staphylococcus aureus capable of forming biofilm, comprising a lytic protein derived from a bacteriophage, wherein the lytic protein kills Staphylococcus aureus and destroys the biofilm.

13. The pharmaceutical composition of claim 12, further comprising an antibiotic.

14. The pharmaceutical composition of claim 13, wherein the antibiotic is lysozyme, lysostaphin, methicillin, oxacillin, or vancomycin.

15. The pharmaceutical composition of claim 12, wherein the lytic protein comprises SEQ. ID. NO: 28 or SEQ. ID. NO: 31.

16. The pharmaceutical composition of claim 7, wherein the disease is mastitis, dermatitis, sepsis, suppurative disorder, food poisoning, pneumonia, osteomyelitis, impetigo, bacteremia, endocarditis, or enteritis.

17. The pharmaceutical composition of claim 7, wherein the pharmaceutical composition is a medicinal therapeutic agent or an antibacterial agent.

18. The composition of claim 4, wherein the composition is a disinfectant, a medical cleaner, or an environmental purifier.

19. The pharmaceutical composition of claim 12, wherein the disease is mastitis, dermatitis, sepsis, suppurative disorder, food poisoning, pneumonia, osteomyelitis, impetigo, bacteremia, endocarditis, or enteritis.

20. The pharmaceutical composition of claim 12, wherein the pharmaceutical composition is a medicinal therapeutic agent or an antibacterial agent.