U.S. patent application number 12/676670 was filed with the patent office on 2010-09-30 for microrna signatures in human ovarian cancer.
This patent application is currently assigned to THE OHIO STATE UNIVERSITY RESEARCH FOUNDATION. Invention is credited to Carlo M. Croce.
Application Number | 20100249213 12/676670 |
Document ID | / |
Family ID | 40429408 |
Filed Date | 2010-09-30 |
United States Patent
Application |
20100249213 |
Kind Code |
A1 |
Croce; Carlo M. |
September 30, 2010 |
MicroRNA Signatures in Human Ovarian Cancer
Abstract
The present invention provides novel methods and compositions
for the diagnosis, prognosis and treatment of ovarian cancer. The
invention also provides methods of identifying anti-cancer
agents.
Inventors: |
Croce; Carlo M.; (Columbus,
OH) |
Correspondence
Address: |
MACMILLAN SOBANSKI & TODD, LLC
ONE MARITIME PLAZA FIFTH FLOOR, 720 WATER STREET
TOLEDO
OH
43604-1619
US
|
Assignee: |
THE OHIO STATE UNIVERSITY RESEARCH
FOUNDATION
Columbus
OH
|
Family ID: |
40429408 |
Appl. No.: |
12/676670 |
Filed: |
September 8, 2008 |
PCT Filed: |
September 8, 2008 |
PCT NO: |
PCT/US08/75565 |
371 Date: |
March 31, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60967663 |
Sep 6, 2007 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/366; 435/375; 435/6.14; 436/64; 506/7; 514/44R; 536/23.1 |
Current CPC
Class: |
C12Q 2600/16 20130101;
C12Q 1/6886 20130101; C12Q 2600/154 20130101; C12Q 2600/106
20130101; C12Q 2600/136 20130101; C12Q 2600/112 20130101; A61K
31/7088 20130101; C12Q 2600/178 20130101; A61P 35/00 20180101; A61P
15/00 20180101 |
Class at
Publication: |
514/44.A ;
436/64; 506/7; 435/6; 435/375; 435/366; 536/23.1; 514/44.R |
International
Class: |
A61K 31/713 20060101
A61K031/713; G01N 33/574 20060101 G01N033/574; C40B 30/00 20060101
C40B030/00; C12Q 1/68 20060101 C12Q001/68; C12N 5/09 20100101
C12N005/09; C07H 21/04 20060101 C07H021/04; A61P 35/00 20060101
A61P035/00 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] This invention was supported, in whole or in part, by grants
from National Cancer Institute Grant No. ______. The Government has
certain rights in this invention.
Claims
1. A method of diagnosing whether a subject has, or is at risk for
developing, ovarian cancer, comprising: measuring the level of at
least one miR in a test sample from the subject, wherein at least
one miR is selected from a miR profile comprising: miR-200a,
miR-200b, miR-200c, miR-141, miR-199a, miR-140, miR-145 and
miR-125b1, and wherein an alteration in the level of the miR in the
test sample, relative to the level of a corresponding miR in a
control sample, is indicative of the subject either having, or
being at risk for developing, ovarian cancer .
2. The method of claim 1, including identifying a correlation
between miR expression and ovarian cancer or a predisposition for
ovarian cancer, comprising: (a) labeling the miR isolated from a
sample from a subject having or suspected of having a disease or
condition; (b) hybridizing the miR to an miR array; (c) determining
miR hybridization to the array; and (d) identifying miR
differentially expressed in a sample representative of the disease
or condition compared to a reference.
3. (canceled)
4. (canceled)
5. (canceled)
6. The method of claim 1, wherein the ovarian cancer is one or more
of clear cell, serous or endometrioid ovarian cancer.
7. (canceled)
8. The method of claim 1, wherein the test sample comprises ovarian
cancer cells, whereby ovarian cancer cells are distinguished by
histotype among: serous, non-serous endometrioid, non-endometrioid,
clear cell, non-clear cell, poorly differentiated and non-poorly
differentiated.
9. (canceled)
10. (canceled)
11. The method of claim 1, wherein an increase in expression of at
least one of miR-200a, miR-200b, miR-200c or miR-141, and/or a
decrease in expression of at least one of miR-199a, miR-140,
miR-145 or miR-125b1, as compared to a normal sample, is indicative
of ovarian cancer.
12. (canceled)
13. A method of diagnosing whether a subject has, or is at risk for
developing, ovarian cancer, comprising: measuring the level of at
least one miR in a test sample from the subject, wherein at least
one miRNA is selected from the group consisting of miR-205, miR-21
and miR-182, wherein a difference in expression of one or more of
the miRNA compared to a normal sample is indicative of endometrioid
ovarian cancer.
14. (canceled)
15. (canceled)
16. (canceled)
17. (canceled)
18. The method of claim 1, wherein the miR profile further includes
one or more of the miRs shown in FIG. 3A or FIG. 3B, where the miR
profile is indicative of serous ovarian cancer.
19. The method of claim 1, wherein the miR profile further includes
one or more of the miRs shown in FIG. 3A or FIG. 3B, where the miR
profile is indicative of endometriod ovarian cancer.
20. The method of claim 1, wherein the miR profile further includes
one or more of the miRs shown in FIG. 3A or FIG. 3B, where the miR
profile is indicative of clear cell ovarian cancer.
21. A method of inhibiting proliferation of an ovarian cancer cell
comprising: i) introducing into the cell one or more agents which
inhibit expression or activity of one or more miRs selected from a
miR profile comprising: miR-200a, miR-200b, miR-200c, miR-141, ii)
introducing into the cell one or more agents which enhances
expression of one or more target genes of the miRs, or introducing
into the cell a combination of the one or more agents of i) and
ii), and maintaining the cells under conditions in which the one or
more agents inhibits expression or activity of the miR, enhances
expression or activity of one or more target genes of the miR, or
results in a combination thereof, thereby inhibiting proliferation
of the ovarian cancer cell.
22. The method of claim 21, wherein the cell is a human cell.
23. The method of claim 21, wherein the expression of miR-200a,
miR-200b, miR-200c and miR-141 are up-regulated, and have as common
putative target the oncosuppressor BAP1, BRCA1-associated protein,
that is down-modulated in ovarian cancer.
24. A method for modulating levels of one or more of miR-21,
miR-203, miR-146, miR-205, miR-30-5p and miR-30c in an ovarian
cancer cell compared with normal tissues, comprising administering
an effective amount of a demethylation agent.
25. The method of claim 24, wherein the levels one or more of the
miRs are increased after 5-aza-2'-deoxycytidine demethylating
treatment.
26. A method for altering expression of one or more of miRs in a
miR profile comprising: miR-21, miR-203, miR-146, miR-205,
miR-30-5p and miR-30c in a subject diagnoses with ovarian cancer,
comprising controlling the DNA hypomethylation mechanism
responsible for overexpression thereof.
27. The method of claim 1, wherein the subject is a human.
28. (canceled)
29. The method of claim 1, comprising: (1) reverse transcribing RNA
from the test sample obtained from the subject to provide a set of
target oligodeoxynucleotides; (2) hybridizing the target
oligodeoxynucleotides to a microarray comprising miRNA-specific
probe oligonucleotides to provide a hybridization profile for the
test sample; and, (3) comparing the test sample hybridization
profile to a hybridization profile generated from a control sample,
wherein an alteration in the signal of at least one miR is
indicative of the subject either having, or being at risk for
developing, ovarian cancer.
30. (canceled)
31. (canceled)
32. (canceled)
33. (canceled)
34. A method of treating ovarian cancer in a subject who has a
ovarian cancer in which at least one miR is down-regulated or
up-regulated in the cancer cells of the subject relative to control
cells, comprising: (1) when the at least one miR is down-regulated
in the cancer cells, administering to the subject an effective
amount of at least one isolated miR, such that proliferation of
cancer cells in the subject is inhibited; or (2) when the at least
one miR is up-regulated in the cancer cells, administering to the
subject an effective amount of at least one compound for inhibiting
expression of the at least one miR, such that proliferation of
cancer cells in the subject is inhibited; wherein the at least one
isolated miR in step (1) is selected miR-199a, miR-140, miR-145 and
miR-125b1, and combinations thereof; and/or wherein the at least
one miR in step (2) is selected from the group consisting of
miR-200a, miR-200b, miR-200c and miR-141, and combinations
thereof.
35. (canceled)
36. (canceled)
37. A method of treating ovarian cancer in a subject, comprising:
(1) determining the amount of at least one miR in ovarian cancer
cells, relative to control cells; and (2) altering the amount of
the at least one miR expressed in the ovarian cancer cells by: i)
administering to the subject an effective amount of at least one
isolated miR, if the amount of the miR expressed in the cancer
cells is less than the amount of the miR expressed in control
cells; or ii) administering to the subject an effective amount of
at least one compound for inhibiting expression of the at least one
miR, if the amount of the miR expressed in the cancer cells is
greater than the amount of the miR expressed in control cells, such
that proliferation of cancer cells in the subject is inhibited;
wherein the at least one isolated miR in steps (i) and/or (ii) is
selected from the group consisting of miR-200a, miR-200b, miR-200c,
miR-141, miR-199a, miR-140, miR-145 and miR-125b1, and combinations
thereof.
38. (canceled)
39. A pharmaceutical composition for treating ovarian cancer,
comprising at least one isolated miR and a
pharmaceutically-acceptable carrier, wherein the isolated miR is
selected from the group consisting of miR-200a, miR-200b, miR-200c,
miR-141, miR-199a, miR-140, miR-145 and miR-125b1, and combinations
thereof.
40. (canceled)
41. (canceled)
42. The pharmaceutical composition of claim 39, comprising at least
one miR expression inhibitor compound and a
pharmaceutically-acceptable carrier.
43. (canceled)
44. The pharmaceutical composition of claim 42, wherein the at
least one miR expression inhibitor compound is specific for a miR
selected from the group consisting of miR-200a, miR-200b, miR-200c,
miR-141, and combinations thereof.
45. A method of identifying an anti-ovarian cancer agent,
comprising providing a test agent to a cell and measuring the level
of at least one miR associated with decreased expression levels in
ovarian cancer cells, wherein an increase in the level of the miR
in the cell, relative to a suitable control cell, is indicative of
the test agent being an anti-ovarian cancer agent, wherein the miR
is selected from the group consisting of miR-199a, miR-140,
miR-145, miR-125b1, and combinations thereof.
46. (canceled)
47. A method of identifying an anti-ovarian cancer agent,
comprising providing a test agent to a cell and measuring the level
of at least one miR associated with increased expression levels in
ovarian cancer cells, wherein an decrease in the level of the miR
in the cell, relative to a suitable control cell, is indicative of
the test agent being an anti-ovarian cancer agent, wherein the miR
is selected from the group consisting of miR-200a, miR-200b,
miR-200c, miR-141, and combinations thereof.
48. (canceled)
49. A kit for detecting ovarian cancer in an individual comprising
one or more reagents for detecting one or more miRs selected from
the group consisting of: miR-200a, miR-200b, miR-200c, miR-141,
miR-199a, miR-140, miR-145 and miR-125b1, and combinations thereof,
one or more target genes of one or more miRs selected from the
group consisting of: miR-200a, miR-200b, miR-200c, miR-141,
miR-199a, miR-140, miR-145 and miR-125b1, and combinations thereof
shown in Table 3, in the individual compared to a control, or a
combination thereof.
50. (canceled)
51. The method of claim 1, further combining the expression levels
of two or more of the miRs.
52. The method of claim 13, further combining the expression levels
of two or more of the miRs.
53. The method of claim 21, further combining the expression levels
of two or more of the miRs.
54. The method of claim 24, further combining the expression levels
of two or more of the miRs.
55. The method of claim 26, further combining the expression levels
of two or more of the miRs.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/967,663, filed Sep. 6, 2007, the disclosure of
which is expressly incorporated herein by reference.
FIELD OF INVENTION
[0003] The present invention relates generally to the field of
molecular biology. More particularly, it concerns methods and
compositions involving microRNA (miRNAs or miRs) molecules. Methods
and compositions for isolating, labeling, preparing miRNAs for
analysis or as a tool for analysis are described, such as miRNA
arrays. In addition, there are applications for miRNAs in
diagnostics, therapeutics, and prognostics.
BACKGROUND OF THE INVENTION
[0004] Epithelial ovarian cancer is the most common gynecological
malignancy and the sixth most common cancer in women worldwide,
with highly aggressive natural history causing almost 125,000
deaths yearly (1). Despite advances in detection and cytotoxic
therapies, only 30% of patients with advanced-stage ovarian cancer
survive 5 years after initial diagnosis (2). The high mortality of
this disease is mainly due to late stage diagnosis for more than
70% of ovarian cancers. In fact, when ovarian cancer is diagnosed
in its early stage, that is still organ-confined, the five year
survival rate exceeds 90%. Unfortunately, only 19% of all ovarian
cancers are diagnosed at this early stage. Indeed, this rather poor
prognosis is due to (i) the insidious asymptomatic nature of this
disease in its early onset, (ii) the lack of robust and minimally
invasive methods for early detection, and (iii) tumor resistance to
chemotherapy. The vast majority of human ovarian carcinomas are
represented by ovarian epithelial cancers (OECs), deriving from the
ovarian surface epithelium (OSE) (3).
[0005] Ovarian adenocarcinomas occur as four major histological
subtypes, serous, mucinous, endometrioid and clear cell, with
serous being the most common. Current data indicate that each of
these histological types is associated with distinct morphologic
and molecular genetic alterations (4), but further investigations
of the molecular mechanisms promoting ovarian cancer are necessary
to determine how each of the subtypes emerges.
[0006] Over the last five years expression profiling technologies
greatly improved, thus expanding the knowledge on cancer etiology
and biomarkers with clinical applications (5, 6). However, although
these technologies have provided most of the new biomarkers with
potential use for diagnosis, drug development, and tailored
therapy, they have so far shed little insight into the detailed
mechanisms at the origin of this neoplasia, thus suggesting that
ovarian tumorigenesis may occur through novel or poorly
characterized pathways.
[0007] A new class of small non-coding RNAs, named microRNAs, was
recently discovered and shown to regulate gene expression at
post-transcriptional level, for the most part by binding through
partial sequence homology to the 3' untranslated region (3' UTR) of
target mRNAs, and causing block of translation and/or mRNA
degradation (7). MicroRNAs are 19-25 nt long molecules cleaved from
70-100 nt hairpin pre-miRNA precursors. The precursor is cleaved by
cytoplasmic RNase III Dicer into .about.22-nt miRNA duplex: one
strand (miRNA*) of the short-lived duplex is degraded, while the
other strand, that serves as mature miRNA, is incorporated into the
RNA-induced silencing complex (RISC) and drives the selection of
target mRNAs containing antisense sequences.
[0008] Several studies have demonstrated that miRNAs play important
roles in essential processes, such as differentiation, cell growth
and cell death (8, 9).
[0009] Moreover, it has been shown that miRNAs are aberrantly
expressed or mutated in cancers, suggesting that they may play a
role as a novel class of oncogenes or tumor suppressor genes,
depending on the targets they regulate: let-7, downregulated in
lung cancer, suppresses RAS (10) and HMGA2 (11, 12) mir-15 and
mir-16, deleted or down-regulated in leukemia, suppress BCL2 (13);
mir-17-5p and mir-20a control the balance of cell death and
proliferation driven by the proto-oncogene c-Myc (14).
[0010] Clear evidences indicate that miRNA polycistron mir-17-92
acts as an oncogene in lymphoma and lung cancer (15); mir-372 and
mir-373 are novel oncogenes in testicular germ cell tumors by
numbing p53 pathway (16), miR-155, overexpressed in B cell
lymphomas and solid tumors, leads to the development of B cell
malignancies in an in vivo model of transgenic mice (17).
[0011] The use of microRNA microarray technologies has been used as
a powerful tool to recognize microRNAs differentially expressed
between normal and tumor samples (18-20), and also to identify
miRNA expression signatures associated with well-defined
clinico-pathological features and disease outcome (21, 22). Several
studies have also investigated the molecular mechanisms leading to
an aberrant microRNAs expression, identifying the presence of
genomic abnormalities in microRNA genes (21, 23, 24). More
recently, few evidences have shown that microRNAs genes may be
regulated also by epigenetic mechanisms, as changes in genomic DNA
methylation pattern: miR-127 (25) and miR-124a (26) are
transcriptionally inactivated by CpG island hypermethylation, while
in lung cancer the overexpression of let-7a-3 seems to be due to
DNA hypomethylation (27).
[0012] In spite of considerable research into therapies for ovarian
cancer, ovarian cancer remains difficult to diagnose and treat
effectively, and the mortality observed in patients indicates that
improvements are needed in the diagnosis, treatment and prevention
of the disease.
SUMMARY OF THE INVENTION
[0013] The present invention is based, in part, on the
identification of an ovarian cancer-specific signature of miRNAs
that are differentially-expressed in ovarian cancer cells, relative
to normal control cells.
[0014] Accordingly, the invention encompasses methods of diagnosing
whether a subject has, or is at risk for developing, ovarian
cancer, comprising measuring the level of at least one miR in a
test sample from the subject, wherein an alteration in the level of
the miR in the test sample, relative to the level of a
corresponding miR in a control sample, is indicative of the subject
either having, or being at risk for developing, ovarian cancer.
[0015] In a particular aspect, there is provided herein a method of
diagnosing whether a subject has, or is at risk for developing,
ovarian cancer, comprising measuring the level of at least one miR
in a test sample from the subject. An alteration in the level of
the miR in the test sample, relative to the level of a
corresponding miR in a control sample, is indicative of the subject
either having, or being at risk for developing, ovarian cancer.
[0016] In another particular aspect, there is provided herein a
method that includes identifying a correlation between miR
expression and ovarian cancer or a predisposition for ovarian
cancer, comprising: (a) labeling the miR isolated from a sample
from a subject having or suspected of having a disease or
condition; (b) hybridizing the miR to an miR array; (c) determining
miR hybridization to the array; and (d) identifying miR
differentially expressed in a sample representative of the disease
or condition compared to a reference.
[0017] In a particular aspect, there is provided herein a method
where identifying miR differentially expressed comprises generating
an miR profile for the sample and evaluating the miR profile to
determine whether miR in the sample are differentially expressed
compared to a normal sample. In certain embodiments, the miR
profile is selected from one or more of the miRs shown in Table 1.
Also, in certain embodiments, the miR profile is selected from one
or more of the miRs shown in FIG. 3A or FIG. 3B.
[0018] In a particular aspect, the ovarian cancer is one or more of
clear cell, serous or endometrioid ovarian cancer. In a particular
aspect, the miR profile is selected from one or more of the miRs
shown in Table 3, whereby ovarian cancer cells are distinguished
from normal cells. Also, in certain embodiments, the miR profile is
selected from one or more of the miRs shown in Table 4, whereby
ovarian cancer cells are distinguished by histotype among: serous,
non-serous endometrioid, non-endometrioid, clear cell, non-clear
cell, poorly differentiated and non-poorly differentiated.
[0019] In a particular embodiment, the miR profile involves at
least one miR selected from the group consisting of miR-200a,
miR-200b, miR-200c, miR-141, miR-199a, miR-140, miR-145 and
miR-125b1, wherein a difference in expression of one or more of the
miRNA compared to a normal sample is indicative of ovarian cancer.
Also, in certain embodiments, the miR profile involves at least
miR-200a, miR-200b, miR-200c, miR-141, miR-199a, miR-140, miR-145
and miR-125b1, wherein a difference in expression of one or more of
the miR compared to a normal sample is indicative of ovarian
cancer.
[0020] In a particular aspect, there is provided herein a method
wherein an increase in expression of miR-200a, miR-200b, miR-200c
or miR-141, and/or a decrease in expression of miR-199a, miR-140,
miR-145 or miR-125b1, as compared to a normal sample, is indicative
of ovarian cancer.
[0021] In a particular aspect, there is provided herein a method
where the miR profile involves at least one miRNA selected from the
group consisting of miR-200a, miR-200b, miR-200c and miR-141,
wherein a difference in expression of one or more of the miRNA
compared to a normal sample is indicative of serous ovarian
cancer.
[0022] In a particular aspect, there is provided herein a method
where the miR profile involves at least one miRNA selected from the
group consisting of miR-205, miR-21, miR-182, miR-200b and miR-141,
wherein a difference in expression of one or more of the miRNA
compared to a normal sample is indicative of endometrioid ovarian
cancer.
[0023] In a particular aspect, there is provided herein a method of
distinguishing among ovarian cancer histotypes of serous,
endometriod, clear cell and/or poorly differentiated ovarian
cancer. In certain embodiments, the miR profile is selected from
one or more of the miRs shown in FIG. 3A or FIG. 3B, and is
indicative of serous ovarian cancer. In certain other embodiments,
the miR profile is selected from one or more of the miRs shown in
FIG. 3A or FIG. 3B, and is indicative of endometriod ovarian
cancer. In certain other embodiments, the miR profile is selected
from one or more of the miRs shown in FIG. 3A or FIG. 3B, and is
indicative of clear cell ovarian cancer.
[0024] In a particular aspect, there is provided herein a method of
inhibiting proliferation of an ovarian cancer cell comprising: i)
introducing into the cell one or more agents which inhibit
expression or activity of one or more miRs selected from the group
shown in Table 3; ii) introducing into the cell one or more agents
which enhances expression of one or more target genes of the miRs,
or introducing into the cell a combination of the one or more
agents of i) and ii), and maintaining the cells under conditions in
which the one or more agents inhibits expression or activity of the
miR, enhances expression or activity of one or more target genes of
the miR, or results in a combination thereof, thereby inhibiting
proliferation of the ovarian cancer cell. In a particular
embodiment, the cell is a human cell.
[0025] In a particular aspect, there is provided herein a method
where the expression of miR-200a, miR-200b, miR-200c and miR-141
are up-regulated, and have as common putative target the
oncosuppressor BAP1, BRCA1-associated protein, that is
down-modulated in ovarian cancer.
[0026] In a particular aspect, there is provided herein a method
for modulating levels of one or more of miR-21, miR-203, miR-146,
miR-205, miR-30-5p and miR-30c in an ovarian caner cell compared
with normal tissues, comprising administering an effective amount
of a demethylation agent. In a particular embodiment, the levels
are increased after 5-aza-2'-deoxycytidine demethylating
treatment.
[0027] In a particular aspect, there is provided herein a method
for altering expression of one or more of miR-21, miR-203, miR-146,
miR-205, miR-30-5p and miR-30c, comprising controlling the DNA
hypomethylation mechanism responsible for their overexpression.
[0028] The level of the at least one miR can be measured using a
variety of techniques that are well known to those of skill in the
art. In one embodiment, the level of the at least one miR is
measured using Northern blot analysis. In another embodiment, the
level of the at least one miR in the test sample is less than the
level of the corresponding miR in the control sample. Also, in
another embodiment, the level of the at least one miR in the test
sample can be greater than the level of the corresponding miR in
the control sample.
[0029] The invention also provides methods of diagnosing a cancer
associated with one or more prognostic markers in a subject,
comprising measuring the level of at least one miR in a cancer
sample from the subject, wherein an alteration in the level of the
at least one miR in the test sample, relative to the level of a
corresponding miR in a control sample, is indicative of the subject
having a cancer associated with the one or more prognostic markers.
In one embodiment, the level of the at least one miR is measured by
reverse transcribing RNA from a test sample obtained from the
subject to provide a set of target oligodeoxynucleotides;
hybridizing the target oligodeoxynucleotides to a microarray
comprising miR-specific probe oligonucleotides to provide a
hybridization profile for the test sample; and, comparing the test
sample hybridization profile to a hybridization profile generated
from a control sample. An alteration in the signal of at least one
miR is indicative of the subject either having, or being at risk
for developing, such cancer.
[0030] The invention also encompasses methods of treating cancer in
a subject, wherein the signal of at least one miR, relative to the
signal generated from the control sample, is de-regulated (e.g.,
down-regulated, up-regulated).
[0031] The invention also encompasses methods of diagnosing whether
a subject has, or is at risk for developing, a cancer associated
with one or more adverse prognostic markers in a subject, by
reverse transcribing RNA from a test sample obtained from the
subject to provide a set of target oligodeoxynucleotides;
hybridizing the target oligodeoxynucleotides to a microarray
comprising miR-specific probe oligonucleotides to provide a
hybridization profile for the test sample; and, comparing the test
sample hybridization profile to a hybridization profile generated
from a control sample. An alteration in the signal is indicative of
the subject either having, or being at risk for developing, the
cancer.
[0032] The invention also encompasses methods of treating cancer in
a subject who has a cancer in which at least one miR is
down-regulated or up-regulated in the cancer cells of the subject
relative to control cells. When the at least one miR is
down-regulated in the cancer cells, the method comprises
administering to the subject an effective amount of at least one
isolated miR, such that proliferation of cancer cells in the
subject is inhibited. When the at least one miR is up-regulated in
the cancer cells, the method comprises administering to the subject
an effective amount of at least one compound for inhibiting
expression of the at least one miR, such that proliferation of
cancer cells in the subject is inhibited.
[0033] In related embodiments, the invention provides methods of
treating cancer in a subject, comprising: determining the amount of
at least one miR in cancer cells, relative to control cells; and
altering the amount of miR expressed in the cancer cells by:
administering to the subject an effective amount of at least one
isolated miR, if the amount of the miR expressed in the cancer
cells is less than the amount of the miR expressed in control
cells; or administering to the subject an effective amount of at
least one compound for inhibiting expression of the at least one
miR, if the amount of the miR expressed in the cancer cells is
greater than the amount of the miR expressed in control cells, such
that proliferation of cancer cells in the subject is inhibited.
[0034] The invention further provides pharmaceutical compositions
for treating cancer, comprising at least one isolated miR and a
pharmaceutically-acceptable carrier. In a particular embodiment,
the pharmaceutical compositions the at least one isolated miR
corresponds to a miR that is down-regulated in cancer cells
relative to suitable control cells.
[0035] In another particular embodiment, the pharmaceutical
composition comprises at least one miR expression inhibitor
compound and a pharmaceutically-acceptable carrier. Also, in a
particular embodiment, the pharmaceutical composition comprises at
least one miR expression inhibitor compound is specific for a miR
that is down regulated and/or up-regulated in cancer cells relative
to suitable control cells.
[0036] In other embodiments, the present invention provides methods
of identifying an anti-cancer agent, comprising providing a test
agent to a cell and measuring the level of at least one miR
associated with decreased expression levels in cancer cells,
wherein an increase in the level of the miR in the cell, relative
to a suitable control cell, is indicative of the test agent being
an anti-cancer agent.
[0037] The present invention also provides methods of identifying
an anti-cancer agent, comprising providing a test agent to a cell
and measuring the level of at least one miR associated with
increased expression levels in cancer cells, wherein an decrease in
the level of the miR in the cell, relative to a suitable control
cell, is indicative of the test agent being an anti-cancer.
[0038] In a specific aspect, as disclosed herein, at least one miR
is selected the group shown in Table 3. In a particular embodiment
the miR is selected from the group consisting of miR-200a, miR-141,
miR-200c, and miR-200b, miR-199a, miR-140, miR-145, and
miR-125b1.
[0039] In a specific aspect, there is also provided herein the
identification of miRNAs whose expression is correlated with
specific ovarian cancer biopathologic features, such as histotype,
lymphovascular and organ invasion, and involvement of ovarian
surface.
[0040] In another specific aspect, it is disclosed herein that the
levels of miR-21, miR-203, and miR-205, up-modulated in ovarian
carcinomas compared with normal tissues, were significantly
increased after 5-aza-2'-deoxycytidine demethylating treatment of
OVCAR3 cells.
[0041] In another particular aspect, there is also disclosed herein
a method for altering the expression of these miRs by controlling
the DNA hypomethylation mechanism responsible for their
overexpression.
[0042] Various objects and advantages of this invention will become
apparent to those skilled in the art from the following detailed
description of the preferred embodiment, when read in light of the
accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0043] The patent or application file may contain one or more
drawings executed in color and/or one or more photographs. Copies
of this patent or patent application publication with color
drawing(s) and/or photograph(s) will be provided by the United
States Patent and Trademark Office upon request and payment of the
necessary fee.
[0044] FIGS. 1A-1C: Cluster analysis of ovarian carcinomas and
normal ovarian tissues:
[0045] FIG. 1A: Tree generated by the hierarchical cluster analysis
showing the separation of normal tissues from ovarian cancers on
the basis of all human miRNAs spotted on the chip.
[0046] FIG. 1B: Some of the microRNAs most significantly
down-modulated in tumors versus normal ovary.
[0047] FIG. 1C: The 4 microRNAs most significantly up-modulated in
tumors versus normal ovary.
[0048] FIG. 2A: Northern blot analysis of human ovarian carcinomas
with probes of miR-200a, miR-141, miR-199a, miF-125b1, miR-145.
Evaluation of miR-199a, miR-125b1 and miR-145 on human ovarian cell
lines. The 5S probe was used for normalization of expression levels
in the different lanes.
[0049] FIG. 2B: Real Time PCR to verify the miR-140 down-modulation
in tumors compared to normal samples.
[0050] FIGS. 3A and 3B: Venn diagram showing the microRNA
signatures characterizing different ovarian carcinoma histotypes
(serous, endometrioid and clear cell) compared to the normal tissue
(FIG. 3A, miRs up-modulated; FIG. 3B, down-modulated).
[0051] FIG. 4A: T-test graphic representation of miR-222 microarray
data expression in serous and endometrioid tumors.
[0052] FIG. 4B: Verification by Northern Blot on a smallest set of
samples.
[0053] FIGS. 5A-5D: Expression pattern of microRNAs in OVCAR3 cell
line before and after treatment with the demethylating agent
5'-AZA.
[0054] FIG. 5A: Table reporting the most significant miRs
differentially expressed resulting from the Microarray
profiling.
[0055] FIG. 5B: Hierarchical cluster tree representation.
[0056] FIG. 5C: Real-Time PCR to verify the up-modulation of the 5
most significantly induced miRs, reported as graphical
representation of miRs expression levels (each bar is an
independent experiment resulting from the average of 3 technical
replicates).
[0057] FIG. 5D: Northern Blot showing the up-modulation of miR-21
after treatment, normalized with EtBr gel staining.
[0058] FIGS. 6A and 6B: The PAM analysis displaying the graphical
representation of the probabilities (0.0 to 1.0) of each sample for
being a cancer or a normal tissue according to the miR signature
reported in FIG. 8--Table 1, which describes a smaller set of 29
miRs, 4 up-modulated (miR-200a, miR -200b, miR -200c and miR-141)
and 25 down-modulated (being miR-199a,miR-140, miR-145 and
miR-125b1 among the most significant) differentiating normal versus
tumor with a classification rate of 89%.
[0059] FIGS. 7A and 7B: Northern Blotting (FIG. 7A) on a panel of
human ovarian carcinomas and two normal tissues; miR-21 and miR-203
are associated with CpG islands, being the miR-203 embedded in a
CpG island 875 by long, and the miR-21 characterized by a CpG
island -2 kb upstream the mature sequence (FIG. 7B), while miR-205
does not show any CpG island in a region spanning 2 Kb upstream its
mature form.
[0060] FIG. 8: Table 1. PAM analysis of microRNAs differentially
expressed between tumors and normals. Out of the 39 miRs found by
SAM analysis, 29 miRs, 4 up-modulated and 25 down-modulated, were
able to classify normal and tumor samples with a classification
rate of 89%. The four miRs up-modulated were found amplified in the
genomic study performed by Zhang et al., 2005; among the miRs
down-modulated, 10 out of 25 were found deleted, 4 are discordant
and 11 do not show any copy loss or gain in Zhang study.
[0061] FIG. 9--Table 2: miRs differentially expressed in tumors
samples versus normal ovarian tissues. SAM analysis of microRNAs
differentially expressed between tumors and normal tissues shows 10
microRNAs up-modulated and 29 down-modulated (q-value<1% and
fold change>3). Out of 10 miRs up-modulated, 6 were found
amplified in the genomic study performed by Zhang et al., 2005, and
4 did not show any copy loss or gain; among the miRs
down-modulated, 12 out of 29 were found deleted, 6 are discordant
and 11 do not show any copy loss or gain in Zhang study.
[0062] FIG. 10--Table 3: SAM analyses of different histological
subtypes compared to the normal tissues.
[0063] FIG. 11--Table 4: SAM analyses of miRNA expression of
different histotypes of tumors compared in pairs.
[0064] FIG. 12--Table 5: SAM analyses identifying microRNAs
associated with EOC clinico-pathological features.
[0065] FIG. 13--Table 6: Table summarizing validated and the
important predicted targets of the most significant microRNAs
resulting from our analyses.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
[0066] The present invention is directed to compositions and
methods relating to preparation and characterization of miRNAs, as
well as use of miRNAs for therapeutic, prognostic, and diagnostic
applications.
[0067] As used herein interchangeably, a "miR," "microRNA," "miR,"
or "miRNA" refers to the unprocessed or processed RNA transcript
from an miR gene. As the miRs are not translated into protein, the
term "miRs" does not include proteins. The unprocessed miR gene
transcript is also called an "miR precursor," and typically
comprises an RNA transcript of about 70-100 nucleotides in length.
The miR precursor can be processed by digestion with an RNAse (for
example, Dicer, Argonaut, or RNAse III, e.g., E. coli RNAse III))
into an active 19-25 nucleotide RNA molecule. This active 19-25
nucleotide RNA molecule is also called the "processed" miR gene
transcript or "mature" miRNA. It is to be understood that the term
"miR" as used herein can include one or more of
miR-oligonucleotides, including mature miRs, pre-miRs, pri-miRs, or
a miR seed sequence. In certain embodiments, a mixture of various
miR nucleic acids can also be used. Also, in certain embodiments,
the miRs may be modified to enhance delivery.
[0068] The miRNA (miR) information is available from the Sanger
Institute, which maintains a registry of miRNA at
http:/microrna.sanger.ac.uk/sequences/. The miRBase Sequence
database includes the nucleotide sequences and annotations of
published miRNA from a variety of sources. The miRBase Registry
provides unique names for novel miRNA genes that comply with
conventional naming nomenclature for new miRNA prior to
publication. Also, the miRBase Targets is a resource for predicated
miRNA targets in animals.
[0069] The active 19-25 nucleotide RNA molecule can be obtained
from the miR precursor through natural processing routes (e.g.,
using intact cells or cell lysates) or by synthetic processing
routes (e.g., using isolated processing enzymes, such as isolated
Dicer, Argonaut, or RNAase III). It is understood that the active
19-25 nucleotide RNA molecule can also be produced directly by
biological or chemical synthesis, without having been processed
from the miR precursor.
[0070] The present invention encompasses methods of diagnosing
whether a subject has, or is at risk for developing, cancer,
comprising measuring the level of at least one miR in a test sample
from the subject and comparing the level of the miR in the test
sample to the level of a corresponding miR in a control sample. As
used herein, a "subject" can be any mammal that has, or is
suspected of having, breast cancer. In a particular embodiment, the
subject is a human who has, or is suspected of having, cancer.
[0071] The level of at least one miR can be measured in cells of a
biological sample obtained from the subject. For example, a tissue
sample can be removed from a subject suspected of having ovarian
cancer associated with by conventional biopsy techniques. In
another example, a blood sample can be removed from the subject,
and white blood cells can be isolated for DNA extraction by
standard techniques. The blood or tissue sample is preferably
obtained from the subject prior to initiation of radiotherapy,
chemotherapy or other therapeutic treatment. A corresponding
control tissue or blood sample can be obtained from unaffected
tissues of the subject, from a normal human individual or
population of normal individuals, or from cultured cells
corresponding to the majority of cells in the subject's sample. The
control tissue or blood sample is then processed along with the
sample from the subject, so that the levels of miR produced from a
given miR gene in cells from the subject's sample can be compared
to the corresponding miR levels from cells of the control
sample.
[0072] An alteration (i.e., an increase or decrease) in the level
of a miR in the sample obtained from the subject, relative to the
level of a corresponding miR in a control sample, is indicative of
the presence of cancer in the subject. In one embodiment, the level
of the at least one miR in the test sample is greater than the
level of the corresponding miR in the control sample (i.e.,
expression of the miR is "up-regulated"). As used herein,
expression of a miR is "up-regulated" when the amount of miR in a
cell or tissue sample from a subject is greater than the amount the
same in a control cell or tissue sample. In another embodiment, the
level of the at least one miR in the test sample is less than the
level of the corresponding miR in the control sample (i.e.,
expression of the miR is "down-regulated"). As used herein,
expression of an miR gene is "down-regulated" when the amount of
miR produced from that gene in a cell or tissue sample from a
subject is less than the amount produced from the same gene in a
control cell or tissue sample. The relative miR gene expression in
the control and normal samples can be determined with respect to
one or more RNA expression standards. The standards can comprise,
for example, a zero miR gene expression level, the miR gene
expression level in a standard cell line, or the average level of
miR gene expression previously obtained for a population of normal
human controls.
[0073] The level of a miR in a sample can be measured using any
technique that is suitable for detecting RNA expression levels in a
biological sample. Suitable techniques for determining RNA
expression levels in cells from a biological sample (e.g., Northern
blot analysis, RT-PCR, in situ hybridization) are well known to
those of skill in the art. In a particular embodiment, the level of
at least one miR is detected using Northern blot analysis. For
example, total cellular RNA can be purified from cells by
homogenization in the presence of nucleic acid extraction buffer,
followed by centrifugation. Nucleic acids are precipitated, and DNA
is removed by treatment with DNase and precipitation. The RNA
molecules are then separated by gel electrophoresis on agarose gels
according to standard techniques, and transferred to nitrocellulose
filters. The RNA is then immobilized on the filters by heating.
Detection and quantification of specific RNA is accomplished using
appropriately labeled DNA or RNA probes complementary to the RNA in
question. See, for example, Molecular Cloning: A Laboratory Manual,
J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor
Laboratory Press, 1989, Chapter 7, the entire disclosure of which
is incorporated by reference.
[0074] Suitable probes for Northern blot hybridization of a given
miR can be produced from the nucleic acid sequences of the given
miR. Methods for preparation of labeled DNA and RNA probes, and the
conditions for hybridization thereof to target nucleotide
sequences, are described in Molecular Cloning: A Laboratory Manual,
J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor
Laboratory Press, 1989, Chapters 10 and 11, the disclosures of
which are incorporated herein by reference.
[0075] For example, the nucleic acid probe can be labeled with,
e.g., a radionuclide, such as .sup.3H, .sup.32P, .sup.33P,
.sup.14C, or .sup.35S; a heavy metal; or a ligand capable of
functioning as a specific binding pair member for a labeled ligand
(e.g., biotin, avidin or an antibody), a fluorescent molecule, a
chemiluminescent molecule, an enzyme or the like.
[0076] Probes can be labeled to high specific activity by either
the nick translation method of Rigby et al. (1977), J. Mol. Biol.
113:237-251 or by the random priming method of Fienberg et al.
(1983), Anal. Biochem. 132:6-13, the entire disclosures of which
are incorporated herein by reference. The latter is the method of
choice for synthesizing .sup.32P-labeled probes of high specific
activity from single-stranded DNA or from RNA templates. For
example, by replacing preexisting nucleotides with highly
radioactive nucleotides according to the nick translation method,
it is possible to prepare .sup.32P-labeled nucleic acid probes with
a specific activity well in excess of 10.sup.8 cpm/microgram.
Autoradiographic detection of hybridization can then be performed
by exposing hybridized filters to photographic film. Densitometric
scanning of the photographic films exposed by the hybridized
filters provides an accurate measurement of miR gene transcript
levels. Using another approach, miR gene transcript levels can be
quantified by computerized imaging systems, such the Molecular
Dynamics 400-B 2D Phosphorimager available from Amersham
Biosciences, Piscataway, N.J.
[0077] Where radionuclide labeling of DNA or RNA probes is not
practical, the random-primer method can be used to incorporate an
analogue, for example, the dTTP analogue
5-(N-(N-biotinyl-epsilon-aminocaproyl)-3-aminoallyl)deoxyuridine
triphosphate, into the probe molecule. The biotinylated probe
oligonucleotide can be detected by reaction with biotin-binding
proteins, such as avidin, streptavidin, and antibodies (e.g.,
anti-biotin antibodies) coupled to fluorescent dyes or enzymes that
produce color reactions.
[0078] In addition to Northern and other RNA hybridization
techniques, determining the levels of RNA transcripts can be
accomplished using the technique of in situ hybridization. This
technique requires fewer cells than the Northern blotting
technique, and involves depositing whole cells onto a microscope
cover slip and probing the nucleic acid content of the cell with a
solution containing radioactive or otherwise labeled nucleic acid
(e.g., cDNA or RNA) probes. This technique is particularly
well-suited for analyzing tissue biopsy samples from subjects. The
practice of the in situ hybridization technique is described in
more detail in U.S. Pat. No. 5,427,916, the entire disclosure of
which is incorporated herein by reference. Suitable probes for in
situ hybridization of a given miR can be produced from the nucleic
acid sequences.
[0079] The relative number of miR gene transcripts in cells can
also be determined by reverse transcription of miR gene
transcripts, followed by amplification of the reverse-transcribed
transcripts by polymerase chain reaction (RT-PCR). The levels of
miR gene transcripts can be quantified in comparison with an
internal standard, for example, the level of mRNA from a
"housekeeping" gene present in the same sample. A suitable
"housekeeping" gene for use as an internal standard includes, e.g.,
myosin or glyceraldehyde-3-phosphate dehydrogenase (G3PDH). The
methods for quantitative RT-PCR and variations thereof are within
the skill in the art.
[0080] In some instances, it may be desirable to simultaneously
determine the expression level of a plurality of different miRs in
a sample. In other instances, it may be desirable to determine the
expression level of the transcripts of all known miR genes
correlated with a cancer. Assessing cancer-specific expression
levels for hundreds of miR genes is time consuming and requires a
large amount of total RNA (at least 20 .mu.g for each Northern
blot) and autoradiographic techniques that require radioactive
isotopes.
[0081] To overcome these limitations, an oligolibrary, in microchip
format (i.e., a microarray), may be constructed containing a set of
probe oligodeoxynucleotides that are specific for a set of miR
genes. Using such a microarray, the expression level of multiple
microRNAs in a biological sample can be determined by reverse
transcribing the RNAs to generate a set of target
oligodeoxynucleotides, and hybridizing them to probe
oligodeoxynucleotides on the microarray to generate a
hybridization, or expression, profile. The hybridization profile of
the test sample can then be compared to that of a control sample to
determine which microRNAs have an altered expression level in
cancer.
[0082] As used herein, "probe oligonucleotide" or "probe
oligodeoxynucleotide" refers to an oligonucleotide that is capable
of hybridizing to a target oligonucleotide.
[0083] "Target oligonucleotide" or "target oligodeoxynucleotide"
refers to a molecule to be detected (e.g., via hybridization).
[0084] By "miR-specific probe oligonucleotide" or "probe
oligonucleotide specific for an miR" is meant a probe
oligonucleotide that has a sequence selected to hybridize to a
specific miR, or to a reverse transcript of the specific miR.
[0085] An "expression profile" or "hybridization profile" of a
particular sample is essentially a fingerprint of the state of the
sample; while two states may have any particular gene similarly
expressed, the evaluation of a number of genes simultaneously
allows the generation of a gene expression profile that is unique
to the state of the cell. That is, normal cells may be
distinguished from cancer cells, and within cancer cells, different
prognosis states (good or poor long term survival prospects, for
example) may be determined. By comparing expression profiles of
cancer cells in different states, information regarding which genes
are important (including both up- and down-regulation of genes) in
each of these states is obtained.
[0086] The identification of sequences that are differentially
expressed in cancer cells or normal cells, as well as differential
expression resulting in different prognostic outcomes, allows the
use of this information in a number of ways. For example, a
particular treatment regime may be evaluated (e.g., to determine
whether a chemotherapeutic drug act to improve the long-term
prognosis in a particular patient). Similarly, diagnosis may be
done or confirmed by comparing patient samples with the known
expression profiles. Furthermore, these gene expression profiles
(or individual genes) allow screening of drug candidates that
suppress the cancer expression profile or convert a poor prognosis
profile to a better prognosis profile.
[0087] Accordingly, the invention provides methods of diagnosing
whether a subject has, or is at risk for developing, cancer,
comprising reverse transcribing RNA from a test sample obtained
from the subject to provide a set of target oligo-deoxynucleotides,
hybridizing the target oligo-deoxynucleotides to a microarray
comprising miRNA-specific probe oligonucleotides to provide a
hybridization profile for the test sample, and comparing the test
sample hybridization profile to a hybridization profile generated
from a control sample, wherein an alteration in the signal of at
least one miRNA is indicative of the subject either having, or
being at risk for developing, cancer.
[0088] In one embodiment, the microarray comprises miRNA-specific
probe oligonucleotides for a substantial portion of the human
miRNome.
[0089] The microarray can be prepared from gene-specific
oligonucleotide probes generated from known miRNA sequences. The
array may contain two different oligonucleotide probes for each
miRNA, one containing the active, mature sequence and the other
being specific for the precursor of the miRNA. The array may also
contain controls, such as one or more mouse sequences differing
from human orthologs by only a few bases, which can serve as
controls for hybridization stringency conditions. tRNAs from both
species may also be printed on the microchip, providing an
internal, relatively stable, positive control for specific
hybridization. One or more appropriate controls for non-specific
hybridization may also be included on the microchip. For this
purpose, sequences are selected based upon the absence of any
homology with any known miRNAs.
[0090] The microarray may be fabricated using techniques known in
the art. For example, probe oligonucleotides of an appropriate
length, e.g., 40 nucleotides, are 5'-amine modified at position C6
and printed using commercially available microarray systems, e.g.,
the GeneMachine OmniGrid.TM. 100 Microarrayer and Amersham
CodeLink.TM. activated slides. Labeled cDNA oligomer corresponding
to the target RNAs is prepared by reverse transcribing the target
RNA with labeled primer. Following first strand synthesis, the
RNA/DNA hybrids are denatured to degrade the RNA templates. The
labeled target cDNAs thus prepared are then hybridized to the
microarray chip under hybridizing conditions, e.g.,
6.times.SSPE/30% formamide at 25.degree. C. for 18 hours, followed
by washing in 0.75.times. TNT at 37.degree. C. for 40 minutes. At
positions on the array where the immobilized probe DNA recognizes a
complementary target cDNA in the sample, hybridization occurs. The
labeled target cDNA marks the exact position on the array where
binding occurs, allowing automatic detection and quantification.
The output consists of a list of hybridization events, indicating
the relative abundance of specific cDNA sequences, and therefore
the relative abundance of the corresponding complementary miRs, in
the patient sample. According to one embodiment, the labeled cDNA
oligomer is a biotin-labeled cDNA, prepared from a biotin-labeled
primer. The microarray is then processed by direct detection of the
biotin-containing transcripts using, e.g., Streptavidin-Alexa647
conjugate, and scanned utilizing conventional scanning methods.
Image intensities of each spot on the array are proportional to the
abundance of the corresponding miR in the patient sample.
[0091] The use of the array has several advantages for miRNA
expression detection. First, the global expression of several
hundred genes can be identified in the same sample at one time
point. Second, through careful design of the oligonucleotide
probes, expression of both mature and precursor molecules can be
identified. Third, in comparison with Northern blot analysis, the
chip requires a small amount of RNA, and provides reproducible
results using 2.5 .mu.g of total RNA. The relatively limited number
of miRNAs (a few hundred per species) allows the construction of a
common microarray for several species, with distinct
oligonucleotide probes for each. Such a tool would allow for
analysis of trans-species expression for each known miR under
various conditions.
[0092] In addition to use for quantitative expression level assays
of specific miRs, a microchip containing miRNA-specific probe
oligonucleotides corresponding to a substantial portion of the
miRNome, preferably the entire miRNome, may be employed to carry
out miR gene expression profiling, for analysis of miR expression
patterns. Distinct miR signatures can be associated with
established disease markers, or directly with a disease state.
[0093] According to the expression profiling methods described
herein, total RNA from a sample from a subject suspected of having
cancer is quantitatively reverse transcribed to provide a set of
labeled target oligodeoxynucleotides complementary to the RNA in
the sample. The target oligodeoxynucleotides are then hybridized to
a microarray comprising miRNA-specific probe oligonucleotides to
provide a hybridization profile for the sample. The result is a
hybridization profile for the sample representing the expression
pattern of miRNA in the sample. The hybridization profile comprises
the signal from the binding of the target oligodeoxynucleotides
from the sample to the miRNA-specific probe oligonucleotides in the
microarray. The profile may be recorded as the presence or absence
of binding (signal vs. zero signal). More preferably, the profile
recorded includes the intensity of the signal from each
hybridization. The profile is compared to the hybridization profile
generated from a normal, i.e., noncancerous, control sample. An
alteration in the signal is indicative of the presence of the
cancer in the subject.
[0094] Other techniques for measuring miR gene expression are also
within the skill in the art, and include various techniques for
measuring rates of RNA transcription and degradation.
[0095] The invention also provides methods of diagnosing a cancer
associated with one or more prognostic markers, comprising
measuring the level of at least one miR in a cancer test sample
from a subject and comparing the level of the at least one miR in
the cancer test sample to the level of a corresponding miR in a
control sample. An alteration (e.g., an increase, a decrease) in
the signal of at least one miRNA in the test sample relative to the
control sample is indicative of the subject either having, or being
at risk for developing, cancer associated with the one or more
prognostic markers.
[0096] The cancer can be associated with one or more prognostic
markers or features, including, a marker associated with an adverse
(i.e., negative) prognosis, or a marker associated with a good
(i.e., positive) prognosis. In certain embodiments, the cancer that
is diagnosed using the methods described herein is associated with
one or more adverse prognostic features.
[0097] Particular microRNAs whose expression is altered in cancer
cells associated with each of these prognostic markers are
described herein. In one embodiment, the level of the at least one
miR is measured by reverse transcribing RNA from a test sample
obtained from the subject to provide a set of target
oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides
to a microarray that comprises miRNA-specific probe
oligonucleotides to provide a hybridization profile for the test
sample, and comparing the test sample hybridization profile to a
hybridization profile generated from a control sample.
[0098] Without wishing to be bound by any one theory, it is
believed that alterations in the level of one or more miRs in cells
can result in the deregulation of one or more intended targets for
these miRs, which can lead to the formation of cancer.
[0099] Therefore, altering the level of the miR (e.g., by
decreasing the level of a miR that is up-regulated in CLL cells, by
increasing the level of a miR that is down-regulated in cancer
cells) may successfully treat the cancer. Examples of putative gene
targets for miRNAs that are deregulated in cancer cells are
described herein.
[0100] Accordingly, the present invention encompasses methods of
treating cancer in a subject, wherein at least one miR is
de-regulated (e.g., down-regulated, up-regulated) in the cancer
cells of the subject. When the at least one isolated miR is
down-regulated in the cancer cells, the method comprises
administering an effective amount of the at least one isolated miR
such that proliferation of cancer cells in the subject is
inhibited. When the at least one isolated miR is up-regulated in
the cancer cells, the method comprises administering to the subject
an effective amount of at least one compound for inhibiting
expression of the at least one miR gene, referred to herein as miR
gene expression inhibition compounds, such that proliferation of
cancer cells is inhibited.
[0101] The terms "treat", "treating" and "treatment", as used
herein, refer to ameliorating symptoms associated with a disease or
condition, for example, cancer, including preventing or delaying
the onset of the disease symptoms, and/or lessening the severity or
frequency of symptoms of the disease or condition. The terms
"subject" and "individual" are defined herein to include animals,
such as mammals, including but not limited to, primates, cows,
sheep, goats, horses, dogs, cats, rabbits, guinea pigs, rats, mice
or other bovine, ovine, equine, canine, feline, rodent, or murine
species. In a preferred embodiment, the animal is a human.
[0102] As used herein, an "effective amount" of an isolated miR is
an amount sufficient to inhibit proliferation of a cancer cell in a
subject suffering from cancer. One skilled in the art can readily
determine an effective amount of an miR to be administered to a
given subject, by taking into account factors, such as the size and
weight of the subject; the extent of disease penetration; the age,
health and sex of the subject; the route of administration; and
whether the administration is regional or systemic.
[0103] For example, an effective amount of an isolated miR can be
based on the approximate or estimated body weight of a subject to
be treated. Preferably, such effective amounts are administered
parenterally or enterally, as described herein. For example, an
effective amount of the isolated miR is administered to a subject
can range from about 5-3000 micrograms/kg of body weight, from
about 700-1000 micrograms/kg of body weight, or greater than about
1000 micrograms/kg of body weight.
[0104] One skilled in the art can also readily determine an
appropriate dosage regimen for the administration of an isolated
miR to a given subject. For example, an miR can be administered to
the subject once (e.g., as a single injection or deposition).
Alternatively, an miR can be administered once or twice daily to a
subject for a period of from about three to about twenty-eight
days, more particularly from about seven to about ten days. In a
particular dosage regimen, an miR is administered once a day for
seven days. Where a dosage regimen comprises multiple
administrations, it is understood that the effective amount of the
miR administered to the subject can comprise the total amount of
miR administered over the entire dosage regimen.
[0105] As used herein, an "isolated" miR is one which is
synthesized, or altered or removed from the natural state through
human intervention. For example, a synthetic miR, or an miR
partially or completely separated from the coexisting materials of
its natural state, is considered to be "isolated." An isolated miR
can exist in substantially-purified form, or can exist in a cell
into which the miR has been delivered. Thus, an miR which is
deliberately delivered to, or expressed in, a cell is considered an
"isolated" miR. An miR produced inside a cell from an miR precursor
molecule is also considered to be "isolated" molecule.
[0106] Isolated miRs can be obtained using a number of standard
techniques. For example, the miRs can be chemically synthesized or
recombinantly produced using methods known in the art. In one
embodiment, miRs are chemically synthesized using appropriately
protected ribonucleoside phosphoramidites and a conventional
DNA/RNA synthesizer. Commercial suppliers of synthetic RNA
molecules or synthesis reagents include, e.g., Proligo (Hamburg,
Germany), Dharmacon Research (Lafayette, Colo., U.S.A.), Pierce
Chemical (part of Perbio Science, Rockford, Ill., U.S.A.), Glen
Research (Sterling, Va., U.S.A.), ChemGenes (Ashland, Mass.,
U.S.A.) and Cruachem (Glasgow, UK).
[0107] Alternatively, the miRs can be expressed from recombinant
circular or linear DNA plasmids using any suitable promoter.
Suitable promoters for expressing RNA from a plasmid include, e.g.,
the U6 or H1 RNA pol III promoter sequences, or the cytomegalovirus
promoters. Selection of other suitable promoters is within the
skill in the art. The recombinant plasmids of the invention can
also comprise inducible or regulatable promoters for expression of
the miRs in cancer cells.
[0108] The miRs that are expressed from recombinant plasmids can be
isolated from cultured cell expression systems by standard
techniques. The miRs which are expressed from recombinant plasmids
can also be delivered to, and expressed directly in, the cancer
cells. The use of recombinant plasmids to deliver the miRs to
cancer cells is discussed in more detail below.
[0109] The miRs can be expressed from a separate recombinant
plasmid, or they can be expressed from the same recombinant
plasmid. In one embodiment, the miRs are expressed as RNA precursor
molecules from a single plasmid, and the precursor molecules are
processed into the functional miR by a suitable processing system,
including, but not limited to, processing systems extant within a
cancer cell. Other suitable processing systems include, e.g., the
in vitro Drosophila cell lysate system (e.g., as described in U.S.
Published Patent Application No. 2002/0086356 to Tuschl et al., the
entire disclosure of which are incorporated herein by reference)
and the E. coli RNAse III system (e.g., as described in U.S.
Published Patent Application No. 2004/0014113 to Yang et al., the
entire disclosure of which are incorporated herein by
reference).
[0110] Selection of plasmids suitable for expressing the miRs,
methods for inserting nucleic acid sequences into the plasmid to
express the s, and methods of delivering the recombinant plasmid to
the cells of interest are within the skill in the art. See, for
example, Zeng et al. (2002), Molecular Cell 9:1327-1333; Tuschl
(2002), Nat. Biotechnol, 20:446-448; Brummelkamp et al. (2002),
Science 296:550-553; Miyagishi et al. (2002), Nat. Biotechnol.
20:497-500; Paddison et al. (2002), Genes Dev. 16:948-958; Lee et
al. (2002), Nat. Biotechnol. 20:500-505; and Paul et al. (2002),
Nat. Biotechnol. 20:505-508, the entire disclosures of which are
incorporated herein by reference.
[0111] In one embodiment, a plasmid expressing the miRs comprises a
sequence encoding a miR precursor RNA under the control of the CMV
intermediate-early promoter. As used herein, "under the control" of
a promoter means that the nucleic acid sequences encoding the miR
are located 3' of the promoter, so that the promoter can initiate
transcription of the miR coding sequences.
[0112] The miRs can also be expressed from recombinant viral
vectors. It is contemplated that the miRs can be expressed from two
separate recombinant viral vectors, or from the same viral vector.
The RNA expressed from the recombinant viral vectors can either be
isolated from cultured cell expression systems by standard
techniques, or can be expressed directly in cancer cells. The use
of recombinant viral vectors to deliver the miRs to cancer cells is
discussed in more detail below.
[0113] The recombinant viral vectors of the invention comprise
sequences encoding the miRs and any suitable promoter for
expressing the RNA sequences. Suitable promoters include, for
example, the U6 or H1 RNA pol III promoter sequences, or the
cytomegalovirus promoters. Selection of other suitable promoters is
within the skill in the art. The recombinant viral vectors of the
invention can also comprise inducible or regulatable promoters for
expression of the miRs in a cancer cell.
[0114] Any viral vector capable of accepting the coding sequences
for the miRs can be used; for example, vectors derived from
adenovirus (AV); adeno-associated virus (AAV); retroviruses (e.g.,
lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes
virus, and the like. The tropism of the viral vectors can be
modified by pseudotyping the vectors with envelope proteins or
other surface antigens from other viruses, or by substituting
different viral capsid proteins, as appropriate.
[0115] For example, lentiviral vectors of the invention can be
pseudotyped with surface proteins from vesicular stomatitis virus
(VSV), rabies, Ebola, Mokola, and the like. AAV vectors of the
invention can be made to target different cells by engineering the
vectors to express different capsid protein serotypes. For example,
an AAV vector expressing a serotype 2 capsid on a serotype 2 genome
is called AAV 2/2. This serotype 2 capsid gene in the AAV 2/2
vector can be replaced by a serotype 5 capsid gene to produce an
AAV 2/5 vector. Techniques for constructing AAV vectors that
express different capsid protein serotypes are within the skill in
the art; see, e.g., Rabinowitz, J. E., et al. (2002), J. Virol.
76:791-801, the entire disclosure of which is incorporated herein
by reference.
[0116] Selection of recombinant viral vectors suitable for use in
the invention, methods for inserting nucleic acid sequences for
expressing RNA into the vector, methods of delivering the viral
vector to the cells of interest, and recovery of the expressed RNA
products are within the skill in the art. See, for example,
Dornburg (1995), Gene Therap. 2:301-310; Eglitis (1988),
Biotechniques 6:608-614; Miller (1990), Hum. Gene Therap. 1:5-14;
and Anderson (1998), Nature 392:25-30, the entire disclosures of
which are incorporated herein by reference.
[0117] Particularly suitable viral vectors are those derived from
AV and AAV. A suitable AV vector for expressing the miRs, a method
for constructing the recombinant AV vector, and a method for
delivering the vector into target cells, are described in Xia et
al. (2002), Nat. Biotech. 20:1006-1010, the entire disclosure of
which is incorporated herein by reference. Suitable AAV vectors for
expressing the miRs, methods for constructing the recombinant AAV
vector, and methods for delivering the vectors into target cells
are described in Samulski et al. (1987), J. Virol. 61:3096-3101;
Fisher et al. (1996), J. Virol., 70:520-532; Samulski et al.
(1989), J. Virol. 63:3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat.
No. 5,139,941; International Patent Application No. WO 94/13788;
and International Patent Application No. WO 93/24641, the entire
disclosures of which are incorporated herein by reference. In one
embodiment, the miRs are expressed from a single recombinant AAV
vector comprising the CMV intermediate early promoter.
[0118] In a certain embodiment, a recombinant AAV viral vector of
the invention comprises a nucleic acid sequence encoding an miR
precursor RNA in operable connection with a polyT termination
sequence under the control of a human U6 RNA promoter. As used
herein, "in operable connection with a polyT termination sequence"
means that the nucleic acid sequences encoding the sense or
antisense strands are immediately adjacent to the polyT termination
signal in the 5' direction. During transcription of the miR
sequences from the vector, the polyT termination signals act to
terminate transcription.
[0119] In other embodiments of the treatment methods of the
invention, an effective amount of at least one compound which
inhibits miR expression can also be administered to the subject. As
used herein, "inhibiting miR expression" means that the production
of the active, mature form of miR after treatment is less than the
amount produced prior to treatment. One skilled in the art can
readily determine whether miR expression has been inhibited in a
cancer cell, using for example the techniques for determining miR
transcript level discussed above for the diagnostic method.
Inhibition can occur at the level of gene expression (i.e., by
inhibiting transcription of a miR gene encoding the miR) or at the
level of processing (e.g., by inhibiting processing of a miR
precursor into a mature, active miR).
[0120] As used herein, an "effective amount" of a compound that
inhibits miR expression is an amount sufficient to inhibit
proliferation of a cancer cell in a subject suffering from a cancer
associated with a cancer-associated chromosomal feature. One
skilled in the art can readily determine an effective amount of an
miR expression-inhibiting compound to be administered to a given
subject, by taking into account factors, such as the size and
weight of the subject; the extent of disease penetration; the age,
health and sex of the subject; the route of administration; and
whether the administration is regional or systemic.
[0121] For example, an effective amount of the
expression-inhibiting compound can be based on the approximate or
estimated body weight of a subject to be treated. Such effective
amounts are administered parenterally or enterally, among others,
as described herein. For example, an effective amount of the
expression-inhibiting compound administered to a subject can range
from about 5-3000 micrograms/kg of body weight, from about 700-1000
micrograms/kg of body weight, or it can be greater than about 1000
micrograms/kg of body weight.
[0122] One skilled in the art can also readily determine an
appropriate dosage regimen for administering a compound that
inhibits miR expression to a given subject. For example, an
expression-inhibiting compound can be administered to the subject
once (e.g., as a single injection or deposition). Alternatively, an
expression-inhibiting compound can be administered once or twice
daily to a subject for a period of from about three to about
twenty-eight days, more preferably from about seven to about ten
days. In a particular dosage regimen, an expression-inhibiting
compound is administered once a day for seven days. Where a dosage
regimen comprises multiple administrations, it is understood that
the effective amount of the expression-inhibiting compound
administered to the subject can comprise the total amount of
compound administered over the entire dosage regimen.
[0123] Suitable compounds for inhibiting miR gene expression
include double-stranded RNA (such as short- or small-interfering
RNA or "siRNA"), antisense nucleic acids, and enzymatic RNA
molecules, such as ribozymes. Each of these compounds can be
targeted to a given miR and destroy or induce the destruction of
the target miR.
[0124] For example, expression of a given miR gene can be inhibited
by inducing RNA interference of the miR gene with an isolated
double-stranded RNA ("dsRNA") molecule which has at least 90%, for
example at least 95%, at least 98%, at least 99% or 100%, sequence
homology with at least a portion of the miR . In a particular
embodiment, the dsRNA molecule is a "short or small interfering
RNA" or "siRNA."
[0125] siRNA useful in the present methods comprise short
double-stranded RNA from about 17 nucleotides to about 29
nucleotides in length, preferably from about 19 to about 25
nucleotides in length. The siRNA comprise a sense RNA strand and a
complementary antisense RNA strand annealed together by standard
Watson-Crick base-pairing interactions (hereinafter "base-paired").
The sense strand comprises a nucleic acid sequence which is
substantially identical to a nucleic acid sequence contained within
the target miR.
[0126] As used herein, a nucleic acid sequence in an siRNA which is
"substantially identical" to a target sequence contained within the
target mRNA is a nucleic acid sequence that is identical to the
target sequence, or that differs from the target sequence by one or
two nucleotides. The sense and antisense strands of the siRNA can
comprise two complementary, single-stranded RNA molecules, or can
comprise a single molecule in which two complementary portions are
base-paired and are covalently linked by a single-stranded
"hairpin" area.
[0127] The siRNA can also be altered RNA that differs from
naturally-occurring RNA by the addition, deletion, substitution
and/or alteration of one or more nucleotides. Such alterations can
include addition of non-nucleotide material, such as to the end(s)
of the siRNA or to one or more internal nucleotides of the siRNA,
or modifications that make the siRNA resistant to nuclease
digestion, or the substitution of one or more nucleotides in the
siRNA with deoxyribonucleotides.
[0128] One or both strands of the siRNA can also comprise a 3'
overhang. As used herein, a "3' overhang" refers to at least one
unpaired nucleotide extending from the 3'-end of a duplexed RNA
strand. Thus, in certain embodiments, the siRNA comprises at least
one 3' overhang of from 1 to about 6 nucleotides (which includes
ribonucleotides or deoxyribonucleotides) in length, from 1 to about
5 nucleotides in length, from 1 to about 4 nucleotides in length,
or from about 2 to about 4 nucleotides in length. In a particular
embodiment, the 3' overhang is present on both strands of the
siRNA, and is 2 nucleotides in length. For example, each strand of
the siRNA can comprise 3' overhangs of dithymidylic acid ("TT") or
diuridylic acid ("uu").
[0129] The siRNA can be produced chemically or biologically, or can
be expressed from a recombinant plasmid or viral vector, as
described above for the isolated miRs. Exemplary methods for
producing and testing dsRNA or siRNA molecules are described in
U.S. Published Patent Application No. 2002/0173478 to Gewirtz and
in U.S. Published Patent Application No. 2004/0018176 to Reich et
al., the entire disclosures of which are incorporated herein by
reference.
[0130] Expression of a given miR gene can also be inhibited by an
antisense nucleic acid. As used herein, an "antisense nucleic acid"
refers to a nucleic acid molecule that binds to target RNA by means
of RNA-RNA or RNA-DNA or RNA-peptide nucleic acid interactions,
which alters the activity of the target RNA. Antisense nucleic
acids suitable for use in the present methods are single-stranded
nucleic acids (e.g., RNA, DNA, RNA-DNA chimeras, PNA) that
generally comprise a nucleic acid sequence complementary to a
contiguous nucleic acid sequence in an miR. The antisense nucleic
acid can comprise a nucleic acid sequence that is 50-100%
complementary, 75-100% complementary, or 95-100% complementary to a
contiguous nucleic acid sequence in an miR. Nucleic acid sequences
for the miRs are provided herein. Without wishing to be bound by
any theory, it is believed that the antisense nucleic acids
activate RNase H or another cellular nuclease that digests the
miR/antisense nucleic acid duplex.
[0131] Antisense nucleic acids can also contain modifications to
the nucleic acid backbone or to the sugar and base moieties (or
their equivalent) to enhance target specificity, nuclease
resistance, delivery or other properties related to efficacy of the
molecule. Such modifications include cholesterol moieties, duplex
intercalators, such as acridine, or one or more nuclease-resistant
groups.
[0132] Antisense nucleic acids can be produced chemically or
biologically, or can be expressed from a recombinant plasmid or
viral vector, as described above for the isolated miRs. Exemplary
methods for producing and testing are within the skill in the art;
see, e.g., Stein and Cheng (1993), Science 261:1004 and U.S. Pat.
No. 5,849,902 to Woolf et al., the entire disclosures of which are
incorporated herein by reference.
[0133] Expression of a given miR gene can also be inhibited by an
enzymatic nucleic acid. As used herein, an "enzymatic nucleic acid"
refers to a nucleic acid comprising a substrate binding region that
has complementarity to a contiguous nucleic acid sequence of an
miR, and which is able to specifically cleave the miR. The
enzymatic nucleic acid substrate binding region can be, for
example, 50-100% complementary, 75-100% complementary, or 95-100%
complementary to a contiguous nucleic acid sequence in an miR. The
enzymatic nucleic acids can also comprise modifications at the
base, sugar, and/or phosphate groups. An exemplary enzymatic
nucleic acid for use in the present methods is a ribozyme.
[0134] The enzymatic nucleic acids can be produced chemically or
biologically, or can be expressed from a recombinant plasmid or
viral vector, as described above for the isolated miRs. Exemplary
methods for producing and testing dsRNA or siRNA molecules are
described in Werner and Uhlenbeck (1995), Nucl. Acids Res.
23:2092-96; Hammann et al. (1999), Antisense and Nucleic Acid Drug
Dev. 9:25-31; and U.S. Pat. No. 4,987,071 to Cech et al, the entire
disclosures of which are incorporated herein by reference.
[0135] Administration of at least one miR, or at least one compound
for inhibiting miR expression, will inhibit the proliferation of
cancer cells in a subject who has a cancer associated with a
cancer-associated chromosomal feature. As used herein, to "inhibit
the proliferation of a cancer cell" means to kill the cell, or
permanently or temporarily arrest or slow the growth of the cell.
Inhibition of cancer cell proliferation can be inferred if the
number of such cells in the subject remains constant or decreases
after administration of the miRs or miR gene expression-inhibiting
compounds. An inhibition of cancer cell proliferation can also be
inferred if the absolute number of such cells increases, but the
rate of tumor growth decreases.
[0136] The number of cancer cells in a subject's body can be
determined by direct measurement, or by estimation from the size of
primary or metastatic tumor masses. For example, the number of
cancer cells in a subject can be measured by immunohistological
methods, flow cytometry, or other techniques designed to detect
characteristic surface markers of cancer cells.
[0137] The miRs or miR gene expression-inhibiting compounds can be
administered to a subject by any means suitable for delivering
these compounds to cancer cells of the subject. For example, the
miRs or miR expression inhibiting compounds can be administered by
methods suitable to transfect cells of the subject with these
compounds, or with nucleic acids comprising sequences encoding
these compounds. In one embodiment, the cells are transfected with
a plasmid or viral vector comprising sequences encoding at least
one miR or miR gene expression inhibiting compound.
[0138] Transfection methods for eukaryotic cells are well known in
the art, and include, e.g., direct injection of the nucleic acid
into the nucleus or pronucleus of a cell; electroporation; liposome
transfer or transfer mediated by lipophilic materials;
receptor-mediated nucleic acid delivery, bioballistic or particle
acceleration; calcium phosphate precipitation, and transfection
mediated by viral vectors.
[0139] For example, cells can be transfected with a liposomal
transfer compound, e.g., DOTAP
(N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium
methylsulfate, Boehringer-Mannheim) or an equivalent, such as
LIPOFECTIN. The amount of nucleic acid used is not critical to the
practice of the invention; acceptable results may be achieved with
0.1-100 micrograms of nucleic acid/10.sup.5 cells. For example, a
ratio of about 0.5 micrograms of plasmid vector in 3 micrograms of
DOTAP per 10.sup.5 cells can be used.
[0140] An miR or miR gene expression inhibiting compound can also
be administered to a subject by any suitable enteral or parenteral
administration route. Suitable enteral administration routes for
the present methods include, e.g., oral, rectal, or intranasal
delivery. Suitable parenteral administration routes include, e.g.,
intravascular administration (e.g., intravenous bolus injection,
intravenous infusion, intra-arterial bolus injection,
intra-arterial infusion and catheter instillation into the
vasculature); peri- and intra-tissue injection (e.g., peri-tumoral
and intra-tumoral injection, intra-retinal injection, or subretinal
injection); subcutaneous injection or deposition, including
subcutaneous infusion (such as by osmotic pumps); direct
application to the tissue of interest, for example by a catheter or
other placement device (e.g., a retinal pellet or a suppository or
an implant comprising a porous, non-porous, or gelatinous
material); and inhalation. Particularly suitable administration
routes are injection, infusion and intravenous administration into
the patient.
[0141] In the present methods, an miR or miR expression inhibiting
compound can be administered to the subject either as naked RNA, in
combination with a delivery reagent, or as a nucleic acid (e.g., a
recombinant plasmid or viral vector) comprising sequences that
express the miR or expression inhibiting compound. Suitable
delivery reagents include, e.g., the Mirus Transit TKO lipophilic
reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g.,
polylysine), and liposomes.
[0142] Recombinant plasmids and viral vectors comprising sequences
that express the miRs or miR gene expression inhibiting compounds,
and techniques for delivering such plasmids and vectors to cancer
cells, are discussed herein.
[0143] In a particular embodiment, liposomes are used to deliver an
miR or miR gene expression-inhibiting compound (or nucleic acids
comprising sequences encoding them) to a subject. Liposomes can
also increase the blood half-life of the s or nucleic acids.
Suitable liposomes for use in the invention can be formed from
standard vesicle-forming lipids, which generally include neutral or
negatively charged phospholipids and a sterol, such as cholesterol.
The selection of lipids is generally guided by consideration of
factors, such as the desired liposome size and half-life of the
liposomes in the blood stream. A variety of methods are known for
preparing liposomes, for example, as described in Szoka et al.
(1980), Ann. Rev. Biophys. Bioeng. 9:467; and U.S. Pat. Nos.
4,235,871, 4,501,728, 4,837,028, and 5,019,369, the entire
disclosures of which are incorporated herein by reference.
[0144] The liposomes for use in the present methods can comprise a
ligand molecule that targets the liposome to cancer cells. Ligands
which bind to receptors prevalent in cancer cells, such as
monoclonal antibodies that bind to tumor cell antigens, are
preferred.
[0145] The liposomes for use in the present methods can also be
modified so as to avoid clearance by the mononuclear macrophage
system ("MMS") and reticuloendothelial system ("RES"). Such
modified liposomes have opsonization-inhibition moieties on the
surface or incorporated into the liposome structure. In a
particularly preferred embodiment, a liposome of the invention can
comprise both opsonization-inhibition moieties and a ligand.
[0146] Opsonization-inhibiting moieties for use in preparing the
liposomes of the invention are typically large hydrophilic polymers
that are bound to the liposome membrane. As used herein, an
opsonization inhibiting moiety is "bound" to a liposome membrane
when it is chemically or physically attached to the membrane, e.g.,
by the intercalation of a lipid-soluble anchor into the membrane
itself, or by binding directly to active groups of membrane lipids.
These opsonization-inhibiting hydrophilic polymers form a
protective surface layer that significantly decreases the uptake of
the liposomes by the MMS and RES; e.g., as described in U.S. Pat.
No. 4,920,016, the entire disclosure of which is incorporated
herein by reference.
[0147] Opsonization inhibiting moieties suitable for modifying
liposomes are preferably water-soluble polymers with a
number-average molecular weight from about 500 to about 40,000
daltons, and more preferably from about 2,000 to about 20,000
daltons. Such polymers include polyethylene glycol (PEG) or
polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG,
and PEG or PPG stearate; synthetic polymers, such as polyacrylamide
or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric
polyamidoamines; polyacrylic acids; polyalcohols, e.g.,
polyvinylalcohol and polyxylitol to which carboxylic or amino
groups are chemically linked, as well as gangliosides, such as
ganglioside GM1. Copolymers of PEG, methoxy PEG, or methoxy PPG, or
derivatives thereof, are also suitable. In addition, the
opsonization inhibiting polymer can be a block copolymer of PEG and
either a polyamino acid, polysaccharide, polyamidoamine,
polyethyleneamine, or polynucleotide. The opsonization inhibiting
polymers can also be natural polysaccharides containing amino acids
or carboxylic acids, e.g., galacturonic acid, glucuronic acid,
mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid,
alginic acid, carrageenan; aminated polysaccharides or
oligosaccharides (linear or branched); or carboxylated
polysaccharides or oligosaccharides, e.g., reacted with derivatives
of carbonic acids with resultant linking of carboxylic groups.
Preferably, the opsonization-inhibiting moiety is a PEG, PPG, or
derivatives thereof. Liposomes modified with PEG or PEG-derivatives
are sometimes called "PEGylated liposomes."
[0148] The opsonization inhibiting moiety can be bound to the
liposome membrane by any one of numerous well-known techniques. For
example, an N-hydroxysuccinimide ester of PEG can be bound to a
phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a
membrane. Similarly, a dextran polymer can be derivatized with a
stearylamine lipid-soluble anchor via reductive amination using
Na(CN)BH.sub.3 and a solvent mixture, such as tetrahydrofuran and
water in a 30:12 ratio at 60.degree. C.
[0149] Liposomes modified with opsonization-inhibition moieties
remain in the circulation much longer than unmodified liposomes.
For this reason, such liposomes are sometimes called "stealth"
liposomes. Stealth liposomes are known to accumulate in tissues fed
by porous or "leaky" microvasculature. Thus, tissue characterized
by such microvasculature defects, for example solid tumors, will
efficiently accumulate these liposomes; see Gabizon, et al. (1988),
Proc. Natl. Acad. Sci., U.S.A., 18:6949-53. In addition, the
reduced uptake by the RES lowers the toxicity of stealth liposomes
by preventing significant accumulation of the liposomes in the
liver and spleen. Thus, liposomes that are modified with
opsonization-inhibition moieties are particularly suited to deliver
the miRs or miR gene expression inhibition compounds (or nucleic
acids comprising sequences encoding them) to tumor cells.
[0150] The miRs or miR gene expression inhibition compounds can be
formulated as pharmaceutical compositions, sometimes called
"medicaments," prior to administering them to a subject, according
to techniques known in the art. Accordingly, the invention
encompasses pharmaceutical compositions for treating cancer. In one
embodiment, the pharmaceutical compositions comprise at least one
isolated miR and a pharmaceutically-acceptable carrier. In a
particular embodiment, the at least one miR corresponds to a miR
that has a decreased level of expression in cancer cells relative
to suitable control cells.
[0151] In other embodiments, the pharmaceutical compositions of the
invention comprise at least one miR expression inhibition compound.
In a particular embodiment, the at least one miR gene expression
inhibition compound is specific for a miR gene whose expression is
greater in cancer cells than control cells.
[0152] Pharmaceutical compositions of the present invention are
characterized as being at least sterile and pyrogen-free. As used
herein, "pharmaceutical formulations" include formulations for
human and veterinary use. Methods for preparing pharmaceutical
compositions of the invention are within the skill in the art, for
example as described in Remington's Pharmaceutical Science, 17th
ed., Mack Publishing Company, Easton, Pa. (1985), the entire
disclosure of which is incorporated herein by reference.
[0153] The present pharmaceutical formulations comprise at least
one miR or miR gene expression inhibition compound (or at least one
nucleic acid comprising sequences encoding them) (e.g., 0.1 to 90%
by weight), or a physiologically acceptable salt thereof, mixed
with a pharmaceutically-acceptable carrier. The pharmaceutical
formulations of the invention can also comprise at least one miR or
miR gene expression inhibition compound (or at least one nucleic
acid comprising sequences encoding them) which are encapsulated by
liposomes and a pharmaceutically-acceptable carrier.
[0154] Especially suitable pharmaceutically-acceptable carriers are
water, buffered water, normal saline, 0.4% saline, 0.3% glycine,
hyaluronic acid and the like.
[0155] In a particular embodiment, the pharmaceutical compositions
of the invention comprise at least one miR or miR gene expression
inhibition compound (or at least one nucleic acid comprising
sequences encoding them) which is resistant to degradation by
nucleases. One skilled in the art can readily synthesize nucleic
acids which are nuclease resistant, for example by incorporating
one or more ribonucleotides that are modified at the 2'-position
into the miRs. Suitable 2'-modified ribonucleotides include those
modified at the 2'-position with fluoro, amino, alkyl, alkoxy, and
O-allyl.
[0156] Pharmaceutical compositions of the invention can also
comprise conventional pharmaceutical excipients and/or additives.
Suitable pharmaceutical excipients include stabilizers,
antioxidants, osmolality adjusting agents, buffers, and pH
adjusting agents. Suitable additives include, e.g., physiologically
biocompatible buffers (e.g., tromethamine hydrochloride), additions
of chelants (such as, for example, DTPA or DTPA-bisamide) or
calcium chelate complexes (such as, for example, calcium DTPA,
CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium
salts (for example, calcium chloride, calcium ascorbate, calcium
gluconate or calcium lactate). Pharmaceutical compositions of the
invention can be packaged for use in liquid form, or can be
lyophilized.
[0157] For solid pharmaceutical compositions of the invention,
conventional nontoxic solid pharmaceutically-acceptable carriers
can be used; for example, pharmaceutical grades of mannitol,
lactose, starch, magnesium stearate, sodium saccharin, talcum,
cellulose, glucose, sucrose, magnesium carbonate, and the like.
[0158] For example, a solid pharmaceutical composition for oral
administration can comprise any of the carriers and excipients
listed above and 10-95%, preferably 25%-75%, of the at least one
miR or miR gene expression inhibition compound (or at least one
nucleic acid comprising sequences encoding them). A pharmaceutical
composition for aerosol (inhalational) administration can comprise
0.01-20% by weight, preferably 1%-10% by weight, of the at least
one miR or miR gene expression inhibition compound (or at least one
nucleic acid comprising sequences encoding them) encapsulated in a
liposome as described above, and a propellant. A carrier can also
be included as desired; e.g., lecithin for intranasal delivery.
[0159] The invention also encompasses methods of identifying an
anti-cancer agent, comprising providing a test agent to a cell and
measuring the level of at least one miR in the cell. In one
embodiment, the method comprises providing a test agent to a cell
and measuring the level of at least one miR associated with
decreased expression levels in cancer cells. An increase in the
level of the miR in the cell, relative to a suitable control cell,
is indicative of the test agent being an anti-cancer agent.
[0160] In other embodiments the method comprises providing a test
agent to a cell and measuring the level of at least one miR
associated with increased expression levels in cancer cells. A
decrease in the level of the miR in the cell, relative to a
suitable control cell, is indicative of the test agent being an
anti-cancer agent.
[0161] Suitable agents include, but are not limited to drugs (e.g.,
small molecules, peptides), and biological macromolecules (e.g.,
proteins, nucleic acids). The agent can be produced recombinantly,
synthetically, or it may be isolated (i.e., purified) from a
natural source. Various methods for providing such agents to a cell
(e.g., transfection) are well known in the art, and several of such
methods are described hereinabove. Methods for detecting the
expression of at least one miR (e.g., Northern blotting, in situ
hybridization, RT-PCR, expression profiling) are also well known in
the art.
[0162] The invention will now be illustrated by the following
non-limiting examples. e following examples are intended to
illustrate preferred embodiments of the invention and should not be
interpreted to limit the scope of the invention as defined in the
claims, unless so specified.
Examples
[0163] Presented herein are the results of a genome-wide miRNA
expression profiling in a large set of normal and tumor ovarian
tissues. It is now demonstrated here the existence of an ovarian
cancer specific miRNA signature. Also, the altered methylation of
microRNA genes is identified as a possible epigenetic mechanism
responsible for their aberrant expression.
[0164] Materials and Methods
[0165] Ovarian Cancer Samples and Cell Lines.
[0166] A total of 84 snap-frozen normal and malignant ovarian
tissues were collected at the GOG Tissues Bank, Columbus Children's
Hospital, Columbus (Ohio, USA). The tissue collection used for
microarray analysis included 15 normal ovarian tissue sections, and
69 malignant tissues, all ovarian epithelial carcinomas, including
31 serous (29 out of them showed a papillary pattern), 8
endometrioid, 4 clear cell, 9 poorly differentiated and 1 mucinous
carcinomas. The ovarian cancer cell line IGROV1 was originally
derived by Dr. Bernard (Institute Gustave Roussy, Villejuf,
France), from a moderately differentiated ovarian carcinoma of an
untreated patient, OAW-42 from Dr. Ulrich U. (Department of
Obstetrics and Gynecology, University of Ulm, Germany), while
OVCAR3, OVCAR8 and SK-OV3 were purchased from the American Type
Culture Collection. All the cell lines were maintained in RPMI
medium (Life Technologies, Rockville, Md.), supplemented with 10%
(v/v) fetal bovine serum (FCS), 3mM L-Glutamine and 100 U/ml
penicillin/streptomycin.
[0167] miRNA Microarray Hybridization and Quantification
[0168] Total RNA isolation was performed with Trizol (Invitrogen,
Carlsbad, Calif.) according to the manufacturer's instructions. RNA
labeling and hybridization on microRNA microarray chips were
performed as previously described (28) using 5 .mu.g of total RNA
from each sample. Hybridization was carried out on our microRNA
microarray (Ohio State Comprehensive Cancer Center, version 2.0),
which contains probes for 460 mature microRNAs spotted in
quadruplicate (235 homo sapiens, 222 mus musculus, and three
Arabidopsis thaliana) with annotated active sites. Often, more than
one probe set exists for a given mature microRNA. Additionally,
there are quadruplicate probes corresponding to most precursor
microRNAs. Hybridization signals were detected with
Streptavidin-Alexa647 conjugate and scanned images (Axon 4000B)
were quantified using the Genepix 6.0 software (Axon Instruments,
Sunnyvale, Calif.).
[0169] Computational Analysis of MicroRNA Microarray Data.
[0170] Microarray images were analyzed by using GENEPIX PRO.
Average values of the replicate spots of each miRNA were background
subtracted, normalized, and subjected to further analysis. We
performed a global median normalization of Ovary microarray data by
using BRB ArrayTools developed by Richard Simon & Amy Peng Lam
(29). Absent calls were thresholded to 4.5 before subsequent
statistical analysis. This level is the average minimum intensity
level detected in the experiments. miRNA nomenclature was according
to the Genome Browser (genome.ucsc.edu) and the miRNA database at
Sanger Center (microrna.sanger.ac.uk/); in case of discrepancies
the miRNA database was followed. Differentially expressed miRNAs
were identified by using the t test procedure within significance
analysis of microarrays (SAM), a method developed at Stanford
University Labs based on recent paper of Tusher, Tibshirani and Chu
(30).
[0171] To identify miRNA signatures we also applied PAM, which
performs sample classification from gene expression data, via the
"nearest shrunken centroid method" of Tibshirani, Hastie,
Narasimhan and Chu (31).
[0172] Northern Blotting.
[0173] Northern blot analysis was performed as previously
described. RNA samples (10 .mu.g each) were run on 15%
Polyacrylamide, 7M Urea Criterion pre-casted gels (Bio-Rad,
Hercules, Calif.) and transferred onto Hybond-N+ membranes
(Amersham, Piscataway, N.J.). The hybridization was performed at
370C in ULTRAhyb-Oligo hybrization buffer (Ambion, Austin, Tex.)
for 16 hours. Membranes were washed at 370 C, twice with
2.times.SSPE and 0.5% SDS.
[0174] The oligonucleotides used as probes were antisense to the
sequence of the mature microRNAs (miR Registry at
sanger.ac.uk/Software/Rfam/mirna/, which is fully incorporated
herein by reference):
TABLE-US-00001 [SEQ ID NO: 92] miR-200a: 5'-ACA TCG TTA CCA GAC AGT
GTT A-3'; [SEQ ID NO: 93] miR-141: 5'-CCA TCT TTA CCA GAC AGT GTT
A-3'; [SEQ ID NO: 94] miR-199a: 5'-GAA CAG GTA GTC TGA ACA CTG
GG-3'; [SEQ ID NO: 95] miR-125b1: 5'TCA CAA GTT AGG GTC TCA GGG
A-3'; [SEQ ID NO: 96] miR-145: 5'-AAG GGA TTC CTG GGA AAA CTG
GAC-3'; [SEQ ID NO: 97] miR-222: 5'-GAG ACC CAG TAG CCA GAT GTA
GCT-3'; [SEQ ID NO: 98] miR-21: 5'-TCA ACA TCA GTC TGA TAA GCT
A-3'.
[0175] 5S RNA or EtBr gel staining were used to normalize. 200 ng
of each probe was end labeled with 100 .mu.Ci [gamma-32P]-ATP using
the polynucleotide kinase (Roche). Blots were stripped in boiling
0.1% SDS for 10 minutes before re-hybridization.
[0176] Real-Time PCR
[0177] The single tube TaqMan MicroRNA Assays were used to detect
and quantify mature microRNAs on Applied Biosystems Real-Time PCR
instruments in accordance with manufacturer's instructions (Applied
Biosystems, Foster City, Calif.). Normalization was performed with
18S rRNA. All RT reactions, including no-template controls and RT
minus controls, were run in a GeneAmp PCR 9700 Thermocycler
(Applied Biosystems). Gene expression levels were quantified using
the ABI Prism 7900HT Sequence detection system (Applied
Biosystems). Comparative real-time PCR was performed in triplicate,
including no-template controls. Relative expression was calculated
using the comparative Ct method.
[0178] Demethylating Experiment
[0179] OVCAR3 cells were seeded at low density 48h before treatment
with 10 .mu.M 5'aza-2'deoxycytidine (5'-AZA, Sigma). After 24 h of
treatment, cells were collected and total RNA was isolated using
Trizol reagent (Invitrogen). 3 replicates for both untreated cells
and AZA-treated cells were used to evaluate the miR expression by
Microarray profiling. Differentially expressed microRNAs were
identified by using univariate two-classes T-test with random
variance model.
[0180] Results
[0181] A MicroRNA Expression Signature Discriminates Ovarian Cancer
Tissues from Normal Ovary
[0182] A custom microarray platform already validated by numerous
studies (19) was used to evaluate microRNA expression profiles on a
heterogeneous set of ovarian tissues from different patients. This
set included 15 normal ovarian samples, 69 ovarian malignant
tumors, and 5 ovarian cancer cell lines, for a total of 89
biologically independent samples. Each tumor sample derived from a
single specimen (data not shown).
[0183] The unsupervised hierarchical clustering, based on all the
human microRNAs spotted on the chip, generated a tree with a clear
distinction of samples in two main groups, represented by normal
tissues and malignant tissues (FIG. 1).
[0184] To identify microRNAs differentiating normal versus cancer
tissue, we used SAM and PAM tools, and the results obtained from
the two types of class prediction analysis were largely
overlapping. The SAM comparison between normal and cancer tissues
identified 39 miRNAs (with q-values<1% and fold changes>3)
differentially expressed, 10 up-modulated in tumors and the
remaining down-modulated (the list is reported in FIG. 9--Table
2).
[0185] The PAM analysis in FIGS. 6A and 6B displays the graphical
representation of the probabilities (0.0 to 1.0) of each sample for
being a cancer or a normal tissue according to the miR signature
reported in FIG. 8--Table 1, which describes a smaller set of 29
miRs, 4 up-modulated (miR-200a, -200b, -200c and -141) and 25
down-modulated (being miR-199a,miR-140, miR-145 and miR-125b1 among
the most significant) differentiating normal versus tumor with a
classification rate of 89%.
[0186] To confirm the results obtained by microarray analysis, we
carried out Northern blots (FIG. 2A) or Real-Time PCR (FIG. 2B) on
some of the differentially expressed microRNAs. We analyzed the
expression of miR-200a and miR-141, the most significantly
up-modulated in ovarian carcinoma, and the microRNAs most
significantly down-modulated: miR-199a, miR-140, miR-145 and
miR-125b1. All the experiments confirmed the results obtained by
microarray analysis.
[0187] Bio-Pathological Features and microRNA Expression.
[0188] Considering that ovarian epithelial carcinomas occur as
different histological subtypes characterized by distinct
morphologic and molecular genetic alterations, we decided to
compare the microRNA profile of each of them to the normal tissue
to evaluate if microRNA expression profiles are different in
distinct histotypes of ovarian carcinomas. Complete lists resulting
from SAM analyses are reported in FIG. 10--Table 3, while a summary
is shown in the Venn diagrams in FIGS. 3A and 3B:
[0189] Two (2) out of 4 microRNAs most significantly up-modulated
(FIG. 3A) in tumors versus normal tissue, miR-200a and miR-200c,
are up-modulated in all the three histotypes considered (serous,
endometrioid and clear cell), while miR-200b and miR-141
up-modulation is shared by endometrioid and serous histotypes.
[0190] Moreover, the endometrioid histotype shows the up-modulation
of 3 additional microRNAs, miR-21, miR-203 and miR-205. 19 miRs,
including miR-125b1, miR-199a and miR-140, are down-modulated (FIG.
3B) in all the three histotypes examined in comparison with normal
tissue, while 4 are shared in each paired analysis of the different
signatures: miR-145, for example, is down-modulated in both serous
and clear cell carcinomas; miR-222 in both endometrioid and clear
cell carcinomas.
[0191] Considering the tumors classified as "mixed" and "poorly
differentiated", we found that the first group revealed a signature
with characteristics of different histotypes, sharing for example
the overexpression of miR-200c and miR-181 with the endometrioid
carcinomas, and the down-modulation of miR-214 with the serous,
while the "poorly differentiated" tumors have a quite different
pattern of microRNAs expression (FIG. 10--Table 3).
[0192] We then compared miRNA expression of different groups of
tumors paired as reported in FIG. 11--Table 4, and in particular we
compared the 2 most numerous histotypes, serous and endometriod.
When considering the microRNAs differentially expressed in
endometrioid carcinomas compared to serous, we found miR-212
up-modulated, and miR-302b* and miR-222 (T-test analysis of
microarray data in FIG. 4A, p<0.05), among the microRNAs most
significantly down-modulated.
[0193] In FIG. 4B a Northern Blot on a small set of samples
verifies miR-222 overexpression in serous tumors compared to
endometrioid. We then focused our attention on other
clinico-pathological features associated with tumor specimens:
while no miRs were found significantly differentially expressed in
relation to the age of patients, other tumor characteristics seemed
to affect miRs expression, such as lympho-vascular invasion,
ovarian surface, tubal, uterus and pelvic peritoneum involvement
(FIG. 12--Table 5).
[0194] To investigate if there were miRs associated with different
Grade or Stage of the disease, we performed comparative analyses
considering all the tumors or only the serous histotype, which was
the most numerous, but we did not obtain any significant microRNA
differentially expressed.
[0195] Confirmed and Potential Targets for miRNAs Members of
Various Signatures.
[0196] Using the DianaTarbase at "diana.pcbi.upenn.edu/tarbase", we
looked for confirmed targets of some of the most significant miRNAs
resulting from our analyses, finding some interesting data: ERBB2
and ERBB3 receptors, for example, are targeted by miR-125 (32);
miR-101, down-modulated in ovarian carcinoma, has been demonstrated
targeting the oncogene MYCN (33). We then analyzed their potential
targets using the "diana.pcbi.upenn.edu/miRGen" database, and
evaluated for some of these molecules the expression levels in
ovarian carcinoma. All the four most significantly up-modulated
microRNAs, miR-200a, miR-200b, miR-200c and miR-141, for example,
have as common putative target the oncosuppressor BAP1,
BRCA1-associated protein, down-modulated in ovarian cancer. The
information obtained is summarized in FIG. 13--Table 6.
[0197] Epigenetic Regulation of miRs Expression
[0198] To evaluate if an aberrant DNA methylation pattern could
also contribute to the altered microRNA expression characterizing
the human ovarian carcinoma, we analyzed the miR profiling of the
ovarian cell line OVCAR3, before and after treatment with the
demethylating agent 5-Aza-2'-deoxycitidine. The analysis of
Microarray data showed 11 human microRNAs differentially expressed,
9 up-modulated and 2 down-modulated (significance threshold of each
univariate test: p<0.001), being miR-21, miR-203, miR-146b,
miR-205, miR-30-5p and miR-30c the most significant induced upon
treatment (the miRs differentially expressed are listed in FIG. 5A,
while the resulting hierarchical cluster tree is reported in FIG.
5B).
[0199] Real-Time PCRs to verify the up-modulation of the 5 most
significantly induced miRs are described in FIGS. 5C and 5D as
graphical representation of miR expression levels (FIG. 5C), and
miR-21 was also validated by Northern Blot (FIG. 5D).
[0200] Interestingly, miR-21, miR-203 and miR-205 are overexpressed
in ovarian carcinomas compared to normal tissues (see SAM analysis
in FIG. 9--Table 2 and Venn Diagram in FIGS. 3A and 3B): the
reactivation of these miR genes after demethylating treatment
suggests that the hypomethylation could be the mechanism
responsible for their overexpression in vivo. We confirmed the
overexpression of miR-21, the most significant miR induced upon
treatment, performing a Northern Blotting (FIG. 7A) on a panel of
human ovarian carcinomas and two normal tissues. Moreover, using
the CpG Island Searcher Program (34), we verified that miR-21 and
miR-203 are associated with CpG islands, being the miR-203 embedded
in a CpG island 875 by long, and the miR-21 characterized by a CpG
island -2 kb upstream the mature sequence (FIG. 7B), while miR-205
does not show any CpG island in a region spanning 2 Kb upstream its
mature form.
[0201] Discussion
[0202] In the Examples herein, it is now shown that microRNAs are
aberrantly expressed in human ovarian cancer. The overall microRNA
expression can clearly separate normal versus cancer tissues,
identifying a number of microRNAs altered in human ovarian cancer
and probably involved in the development of this neoplasia.
[0203] The expression of all the four microRNAs we found most
significantly up-modulated, miR-200a and miR-141, belonging to the
same family; miR-200b (localized in the same region of miR-200a, at
chr.1p36.33); and miR-200c, (localized in the same region of
miR-141, at chr.12p13.31), is concordant with the results obtained
at genomic level by Zhang et al. (24), suggesting that the
mechanism driving their up-modulation could be the amplification of
the microRNA genes.
[0204] Interestingly, all these miRs have a common putative target:
the oncosuppressor BAP1, BRCA1-associated protein (24). The altered
expression of GATA factors, found and proposed as the underlying
mechanism for dedifferentiation in ovarian carcinogenesis (35), may
also be driven by microRNAs deregulation. In particular GATA6, lost
or excluded from the nucleus in 85% of ovarian tumors, may be
regulated by miR-200a, and GATA4, absent in the majority of ovarian
cancer cell lines, may be targeted by miR-200b (FIG. 12--Table
5).
[0205] Among the down-modulated genes, notably we found miR-125b1,
altered also in breast cancer, as well as miR-145 (18); mir-199a,
recently shown down-modulated in other tumors, as hepatocellular
carcinoma (36); miR-140, deleted in ovarian carcinoma (24).
[0206] Interestingly, miR-140 is indeed located at chr.6q22, a
fragile region often deleted in ovarian tumor, and it is predicted
to target important molecules as c-SRK, MMP13 and FGF2.
[0207] Even if the normal control available in these examples is
represented by whole normal ovary, our data can identify a number
of microRNAs altered in human ovarian carcinoma and probably
involved in the biology of this malignancy. In fact, the miRNA
signatures obtained comparing different histotypes of ovarian
carcinomas (serous, endometrioid, clear cell and mixed) to the
normal tissue are overlapping in most cases, but they also reveal a
number of microRNAs that seem to be "histotype-specific": the
endometrioid tumors, for example, share with the others the 4 most
significantly up-modulated miRs (miR-200a, miR200b, miR-200c and
miR-141), but also present overexpression of miR-21, known to be
mis-regulated in numerous solid tumors (18, 37, 38) and to exert an
anti-apoptotic role in different cellular systems (39, 40), miR-205
and miR-182.
[0208] Endometrioid tumors also present down-modulation of several
microRNAs in comparison with the other classes of tumors, for
example miR-222, already demonstrated targeting c-Kit (41), being
involved in cancer (42-44) and down-modulated under
folate-deficient conditions (45).
[0209] These differences enforce the fact that different histotypes
represent biologically and pathogenetically distinct entities of
EOCs, even though they are currently treated with identical
therapeutic strategies. Microarray analysis has recently confirmed
that different histotypes (serous, mucinous, endometrioid and clear
cell) show the alteration of different pathways, probably
reflecting the gene expression pattern of the organ of origin
(respectively fallopian tubes, colonic mucosa and endometrium)
(46).
[0210] Notably, many of the microRNAs differentially expressed are
predicted to target molecules involved in pathways differentially
activated depending on the histotype. miR-212, for example,
down-modulated in serous carcinoma, has as putative target WT1,
overexpressed in this subgroup of ovarian carcinomas (47). Another
putative target of miR-212 is BRCA1: mutated in hereditary ovarian
cancer, this molecule has been recently found involved also in the
pathoetiology of sporadic ovarian epithelial cancer (OEC), where a
loss of gene function due to epigenetic alterations has been
observed more commonly (48). he decreased BRCA1 expression could be
determined by overexpression of one or more microRNAs.
[0211] miR-299-5p and miR-135b, up-modulated in serous histotype
compared to endometrioid, are supposed to target, respectively,
DLK1 (Delta-like 1) and MSX2 (msh homeobox 2), overexpressed in
endometrioid carcinomas (47). Compared to the other tumors, clear
cell carcinomas show expression levels of miR-30-5p and of miR-20a
opposite (46) to two putative targets, RBP4 (retinol binding
protein 4) and SLC40A1 (solute carrier 40-iron-regulated
transporter, member 1), respectively. Compared to the normal
tissue, clear cell carcinoma also show lower expression of miR-18a,
miR-19a and miR-19b, suggesting a possible down-modulation of the
cluster 17-92 (already validated as deleted by Zhang et al.). This
cluster, involved in the intricate regulation mediated by E2F1 and
c-Myc, seems to have a duplex nature of putative oncogene, as
recently suggested in B-cell Lymphoma (15), or tumor-suppressor: in
hepatocellular carcinoma, for example, LOH at the locus coding the
miR-17-92 cluster (13q31) has been reported (49). In Ovarian
Carcinoma, at least in clear cell histotype, it could also exert a
role of oncosuppressor. The data shown herein now suggest indeed
that microRNAs may have a regulatory role in the process of
differentiation leading to the development of a specific subtype of
EOC.
[0212] Interestingly, poorly differentiated carcinomas have a quite
different pattern of microRNAs expression, showing up-modulation of
several microRNAs in comparison to normal ovary. More intriguingly,
one of them, miR-373, has been recently described as putative
oncogene in testicular germ cell tumors (16).
[0213] The absence of microRNAs significantly differentially
expressed in relation to tumor Stage or Grade might be explained by
the fact that our set of samples is mostly represented by advanced
stage tumors, as expected considering the late diagnosis of this
kind of neoplasia; however, the difference in size among the
different groups of samples could have represented a limit for the
statistical analysis. Alternatively, microRNAs might be important
for the development of human ovarian carcinoma but not for the
progression of the disease.
[0214] Resulting from our analyses a number of miRs overexpressed
but not reported as amplified in Zhang study, as well as
down-modulated but not deleted, the involvement of an epigenetic
regulatory mechanism could actually exert a role on microRNA
expression in human EOC.
[0215] Indeed, among the most significant microRNAs induced after
demethylating treatment of an ovarian cell line, we found miR-21,
miR-203 and miR-205, up-modulated in ovarian cancer. Moreover,
miR-203 and miR-21 are associated with a CpG island (miR-203 is
embedded in a CpG island, while miR-21 has a CpG island -2 kb
upstream its mature sequence), supporting the idea that the
demethylation leads to the reactivation of these microRNA genes.
Notably, miR-21 has already been described up-modulated in several
human tumors and having an anti-apoptotic role in different
cellular models. These data now show that the DNA hypomethylation
could be an epigenetic mechanism responsible for the in vivo
overexpression of potentially oncogenic miRs.
[0216] To the best of the inventor's knowledge, this is the first
report describing a complete miRs expression profiling in human
EOCs, focused on the identification of miRs differentially
expressed in carcinomas versus normal ovary, and in different
subgroups of tumors. The data now show the important role that
microRNAs can exert on the pathogenesis and on the development of
different histotypes of ovarian carcinoma, and identify altered DNA
methylation as a possible epigenetic mechanism responsible for the
aberrant expression of microRNAs not affected by genomic
changes.
[0217] In accordance with the provisions of the patent statutes,
the principle and mode of operation of this invention have been
explained and illustrated in its preferred embodiment. However, it
must be understood that this invention may be practiced otherwise
than as specifically explained and illustrated without departing
from its spirit or scope.
[0218] The miR Gene Database
[0219] The miRNAs of interest are listed in public databases. In
certain preferred embodiments, the public database can be a central
repository provided by the Sanger Institute
http://microrna.sanger.ac.uk/sequences/ to which miRNA sequences
are submitted for naming and nomenclature assignment, as well as
placement of the sequences in a database for archiving and for
online retrieval via the world wide web. Generally, the data
collected on the sequences of miRNAs by the Sanger Institute
include species, source, corresponding genomic sequences and
genomic location (chromosomal coordinates), as well as full length
transcription products and sequences for the mature fully processed
miRNA (miRNA with a 5' terminal phosphate group). Another database
can be the GenBank database accessed through the National Center
for Biotechnology Information (NCBI) website, maintained by the
National Institutes of Health and the National Library of Medicine.
These databases are fully incorporated herein by reference.
TABLE-US-00002 ACCESSION NUMBER ID SEQUENCE SEQ ID NO MIMAT0000682
hsa-miR-200a UAACACUGUCUGGUAACGAUGU 1 MIMAT0000318 hsa-miR-200b
UAAUACUGCCUGGUAAUGAUGA 2 MIMAT0000617 hsa-miR-200c
UAAUACUGCCGGGUAAUGAUGGA 3 MIMAT0000432 hsa-miR-141
UAACACUGUCUGGUAAAGAUGG 4 MIMAT0000714 hsa-miR-302b*
ACUUUAACAUGGAAGUGCUUUC 5 MIMAT0000259 hsa-mir-182
UUUGGCAAUGGUAGAACUCACACU 6 MIMAT0000771 hsa-miR-325
CCUAGUAGGUGUCCAGUAAGUGU 7 MIMAT0000726 hsa-miR-373
GAAGUGCUUCGAUUUUGGGGUGU 8 MIMAT0000264 hsa-miR-203
GUGAAAUGUUUAGGACCACUAG 9 MIMAT0000266 hsa-miR-205
UCCUUCAUUCCACCGGAGUCUG 10 MIMAT0000231 hsa-miR-199a
CCCAGUGUUCAGACUACCUGUUC 11 MIMAT0000263 hsa-miR-199b
CCCAGUGUUUAGACUAUCUGUUC 12 MIMAT0000435 hsa-miR-143
UGAGAUGAAGCACUGUAGCUC 13 MIMAT0004604 hsa-miR-127
CUGAAGCUCAGAGGGCUCUGAU 14 MIMAT0000431 hsa-miR-140
CAGUGGUUUUACCCUAUGGUAG 15 MIMAT0000441 hsa-miR-9
UCUUUGGUUAUCUAGCUGUAUGA 16 MIMAT0000427 hsa-miR-133a
UUUGGUCCCCUUCAACCAGCUG 17 MIMAT0000102 hsa-miR-105
UCAAAUGCUCAGACUCCUGUGGU 18 MIMAT0000099 hsa-miR-101
UACAGUACUGUGAUAACUGAA 19 MIMAT0000281 hsa-miR-224
CAAGUCACUAGUGGUUCCGUU 20 MIMAT0000445 hsa-miR-126
UCGUACCGUGAGUAAUAAUGCG 21 MIMAT0000098 hsa-miR-100
AACCCGUAGAUCCGAACUUGUG 22 MIMAT0000251 hsa-miR-147
GUGUGUGGAAAUGCUUCUGC 23 MIMAT0000265 hsa-miR-204
UUCCCUUUGUCAUCCUAUGCCU 24 MIMAT0000271 hsa-miR-214
ACAGCAGGCACAGACAGGCAGU 25 MIMAT0000097 hsa-miR-99a
AACCCGUAGAUCCGAUCUUGUG 26 MIMAT0000268 hsa-miR-211
UUCCCUUUGUCAUCCUUCGCCU 27 MIMAT0000437 hsa-miR-145
GUCCAGUUUUCCCAGGAAUCCCU 28 MIMAT0000065 hsa-let-7d
AGAGGUAGUAGGUUGCAUAGUU 29 MIMAT0000422 hsa-miR-124
UAAGGCACGCGGUGAAUGCC 30 MIMAT0000443 hsa-miR-125a
UCCCUGAGACCCUUUAACCUGUGA 31 MIMAT0000064 hsa-let-7c
UGAGGUAGUAGGUUGUAUGGUU 32 MIMAT0000062 hsa-let-7a
UGAGGUAGUAGGUUGUAUAGUU 33 MIMAT0000681 hsa-miR-29c
UAGCACCAUUUGAAAUCGGUUA 34 MIMAT0000461 hsa-miR-195
UAGCAGCACAGAAAUAUUGGC 35 MIMAT0000423 hsa-miR-125b
UCCCUGAGACCCUAACUUGUGA 36 MIMAT0000727 hsa-miR-374
UUAUAAUACAACCUGAUAAGUG 37 MIMAT0000715 hsa-miR-302b
UAAGUGCUUCCAUGUUUUAGUAG 38 MIMAT0000086 hsa-miR-29a
UAGCACCAUCUGAAAUCGGUUA 39 MIMAT0000076 hsa-miR-21
UAGCUUAUCAGACUGAUGUUGA 40 MIMAT0000259 hsa-miR-182
UUUGGCAAUGGUAGAACUCACACU 41 MIMAT0000270 hsa-miR-181a*
ACCAUCGACCGUUGAUUGUACC 42 MIMAT0000273 hsa-miR-216
UAAUCUCAGCUGGCAACUGUGA 43 MIMAT0000717 hsa-miR-302c
UAAGUGCUUCCAUGUUUCAGUGG 44 MIMAT0000688 hsa-miR-301a
CAGUGCAAUAGUAUUGUCAAAGC 45 MIMAT0000096 hsa-miR-98
UGAGGUAGUAAGUUGUAUUGUU 46 MIMAT0000074 hsa-miR-19b
UGUGCAAAUCCAUGCAAAACUGA 47 MIMAT0000100 hsa-miR-29b
UAGCACCAUUUGAAAUCAGUGUU 48 MIMAT0000072 hsa-miR-18a
UAAGGUGCAUCUAGUGCAGAUAG 49 MIMAT0000452 hsa-miR-154
UAGGUUAUCCGUGUUGCCUUCG 50 MIMAT0000073 hsa-miR-19a
UGUGCAAAUCUAUGCAAAACUGA 51 MIMAT0000439 hsa-miR-153
UUGCAUAGUCACAAAAGUGAUC 52 MIMAT0000436 hsa-miR-144
UACAGUAUAGAUGAUGUACU 53 MIMAT0000279 hsa-miR-222
AGCUACAUCUGGCUACUGGGU 54 MIMAT0000416 hsa-miR-1
UGGAAUGUAAAGAAGUAUGUAU 55 MIMAT0000684 hsa-miR-302a
UAAGUGCUUCCAUGUUUUGGUGA 56 MIMAT0000686 hsa-miR-34c-5p
AGGCAGUGUAGUUAGCUGAUUGC 57 MIMAT0000272 hsa-miR-215
AUGACCUAUGAAUUGACAGAC 58 MIMAT0000085 hsa-miR-28-5p
AAGGAGCUCACAGUCUAUUGAG 59 MIMAT0000770 hsa-miR-133b
UUUGGUCCCCUUCAACCAGCUA 60 MIMAT0002890 hsa-miR-299-5p
UGGUUUACCGUCCCACAUACAU 61 MIMAT0000252 hsa-miR-7
UGGAAGACUAGUGAUUUUGUUGU 62 MIMAT0000250 hsa-miR-139-5p
UCUACAGUGCACGUGUCUCCAG 63 MIMAT0000722 hsa-miR-370
GCCUGCUGGGGUGGAACCUGGU 64 MIMAT0000429 hsa-miR-137
UUAUUGCUUAAGAAUACGCGUAG 65 MIMAT0000442 hsa-miR-9*
AUAAAGCUAGAUAACCGAAAGU 66 MIMAT0002809 hsa-miR-146b-5p
UGAGAACUGAAUUCCAUAGGCU 67 MIMAT0000087 hsa-miR-30
UGUAAACAUCCUCGACUGGAAG 68 MIMAT0000095 hsa-miR-96
UUUGGCACUAGCACAUUUUUGCU 69 MIMAT0000646 hsa-miR-155
UUAAUGCUAAUCGUGAUAGGGGU 70 MIMAT0000738 hsa-miR-383
AGAUCAGAAGGUGAUUGUGGCU 71 MIMAT0000244 hsa-miR-30c
UGUAAACAUCCUACACUCUCAGC 72 MIMAT0002819 hsa-miR-193b
AACUGGCCCUCAAAGUCCCGCU 73 MIMAT0002811 hsa-miR-202
AGAGGUAUAGGGCAUGGGAA 74 MIMAT0000447 hsa-miR-134
UGUGACUGGUUGACCAGAGGGG 75 MIMAT0004696 hsa-miR-323-5p
AGGUGGUCCGUGGCGCGUUCGC 76 MIMAT0004695 hsa-miR-337-5p
GAACGGCUUCAUACAGGAGUU 77 MIMAT0000254 hsa-miR-10b
UACCCUGUAGAACCGAAUUUGUG 78 MIMAT0000077 hsa-miR-22
AAGCUGCCAGUUGAAGAACUGU 79 MIMAT0001080 hsa-miR-196b
UAGGUAGUUUCCUGUUGUUGGG 80 MIMAT0000460 hsa-miR-194
UGUAACAGCAACUCCAUGUGGA 81 MIMAT0000761 hsa-miR-324-5p
CGCAUCCCCUAGGGCAUUGGUGU 82 MIMAT0000758 hsa-miR-135b
UAUGGCUUUUCAUUCCUAUGUGA 83 MIMAT0000269 hsa-miR-212
UAACAGUCUCCAGUCACGGCC 84 MIMAT0000451 hsa-miR-150
UCUCCCAACCCUUGUACCAGUG 85 MIMAT0000759 hsa-miR-148b
UCAGUGCAUCACAGAACUUUGU 86 MIMAT0000692 hsa-miR-30e
UGUAAACAUCCUUGACUGGAAG 87 MIMAT0000075 hsa-miR-20a
UAAAGUGCUUAUAGUGCAGGUAG 88 MIMAT0000256 hsa-miR-181a
AACAUUCAACGCUGUCGGUGAGU 89 MIMAT0000449 hsa-miR-146a
UGAGAACUGAAUUCCAUGGGUU 90 MIMAT0004614 hsa-miR-193a-5p
UGGGUCUUUGCGGGCGAGAUGA 91
REFERENCES
[0220] The references discussed above and the following references,
to the extent that they provide exemplary procedural or other
details supplementary to those set forth herein, are specifically
incorporated herein by reference. [0221] 1. Cannistra S A. Cancer
of the ovary. N Engl J Med 2004; 351:2519-29. [0222] 2. Greenlee R
T, Hill-Harmon M B, Murray T and Thun M. Cancer statistics, 2001.
CA Cancer J. Clin. 2001; 51:15-36. [0223] 3. Feeley K M and Wells
M. Precursor lesions of ovarian epithelial malignancy.
Histopathology 2001; 38:87-95. [0224] 4. Bell D A. Origins and
molecular pathology of ovarian cancer. Mod Pathol 2005; 18 Suppl
2:S19-32. [0225] 5. Schwartz D R, Kardia S L, Shedden K A et al.
Gene expression in ovarian cancer reflects both morphology and
biological behavior, distinguishing clear cell from other
poor-prognosis ovarian carcinomas. Cancer Res 2002; 62:4722-9.
[0226] 6. De Cecco L, Marchionni L, Gariboldi M et al. Gene
expression profiling of advanced ovarian cancer: characterization
of a molecular signature involving Fibroblast Growth Factor 2.
Oncogene 2004; 23:8171-83. [0227] 7. He L, Hannon G J. MicroRNAs:
small RNAs with a big role in gene regulation. Nature Rev Genet
2004; 5:522-31. [0228] 8. Miska E A. How microRNAs control cell
division, differentiation and death. Curr Opin Genet Dev 2005;
5:563-8. [0229] 9. Zamore P D, Haley B. Ribo-gnome: the big world
of small RNAs. Science 2005; 309:1519-24. [0230] 10. Johnson S M,
Grosshans H, Shingara J, et al. RAS is regulated by the let-7
microRNA family. Cell 2005; 120:635-47. [0231] 11. Mayr C, Hemann M
T, Bartel D. Disrupting the pairing between let-7 and HMGA2
enhances oncogenic transformation. Science 2007; 315:1576-9. [0232]
12. Lee Y S, Dutta A. The tumor suppressor microRNA let-7 represses
the HMGA2 oncogene. Genes Dev. 2007; 21:1025-30. [0233] 13. Cimmino
A, Calin GA, Fabbri M et al. miR-15 and miR-16 induce apoptosis by
targeting BCL2. Proc Natl Acad Sci USA 2005; 102:13944-9. [0234]
14. O'Donnell K A, Wentzel E A, Zeller K I, Dang C V, Mendell J T.
c-Myc-regulated microRNAs modulate E2F1 expression. Nature 2005;
435:839-43. [0235] 15. He L, Thomson J M, Hemann M T et al. A
microRNA polycistron as a potential human oncogene. Nature 2005;
435:828-33. [0236] 16. Voorhoeve P M, le Sage C, Schrier M et al. A
genetic screen implicates miRNA-372 and miRNA-373 as Oncogenes in
Testicular Germ Cell Tumors. Cell 2006; 124:1169-81. [0237] 17.
Costinean S, Zanesi N, Pekarsky Y et al. Pre-B cell proliferation
and lymphoblastic leukemia/high-grade lymphoma in E(mu)-miR155
transgenic mice. Proc Natl Acad Sci USA. 2006; 103:7024-9. [0238]
18. Iorio M V, Ferracin M, Liu C G et al. Cancer Res. 2005;
65:7065-70. [0239] 19. Calin GA, Croce CM. MicroRNA signatures in
human cancers. Nat Rev Cancer 2006; 6:857-66. [0240] 20.
Esquela-Kerscher A, Slack F J. Oncomirs-microRNAs with a role in
cancer. Nat Rev Cancer 2006; 6:259-69. [0241] 21. Calin G A,
Ferracin M, Cimmino A et al. MicroRNA signature associated with
prognosis and progression in chronic lymphocytic leukemia. N Engl J
Med 2005; 353:1793-801. [0242] 22. Yanaihara N, Caplen N, Bowman E
et al. Unique microRNA molecular profiles in lung cancer diagnosis
and prognosis. Cancer Cell 2006; 9:189-98. [0243] 23. Calin G A,
Croce C M. MicroRNAs and chromosomal abnormalities in cancer cells.
Oncogene 2006; 25:6202-10. [0244] 24. Zhang L, Huang J, Yang N et
al. MicroRNAs exhibit high frequency genomic alterations in human
cancer. Proc Natl Acad Sci USA. 2006; 103:9136-41. [0245] 25. Saito
Y, Liang G, Egger G et al. Specific activation of microRNA-127 with
downregulation of the proto-oncogene BCL6 by chromatin-modifying
drugs in human cancer cells. Cancer Cell 2006; 9:435-43. [0246] 26.
Lujambio A, Ropero S, Ballestar E et al. Genetic unmasking of an
epigenetically silenced microRNA in human cancer cells. Cancer Res
2007; 67:1424-9. [0247] 27. Brueckner B, Stresemann C, Kuner R et
al. The human let-7a-3 locus contains an epigenetically regulated
microRNA gene with oncogenic function. Cancer Res 2007; 67:1419-23.
[0248] 28. Liu C G, Calin G A, Meloon B, et al. An oligonucleotide
microchip for genome-wide microRNA profiling in human and mouse
tissues. Proc Natl Acad Sci USA 2004; 101:9740-4. [0249] 29. Wright
G W, Simon R M. A random variance model for detection of
differential gene expression in small microarray experiments.
Bioinformatics. 2003; 19:2448-55. [0250] 30. Tusher V G, Tibshirani
R and Chu G. Significance analysis of microarrays applied to the
ionizing radiation response. Proc Natl Acad Sci USA. 2001;
98:5116-21. [0251] 31. Tibshirani R, Hastie T, Narasimhan B, Chu G.
Diagnosis of multiple cancer types by shrunken centroids of gene
expression. Proc Natl Acad Sci USA 2002; 99:6567-6572. [0252] 32.
Scott G K, Goga A, Bhaumik D et al. Coordinate suppression of ERBB2
and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b.
J Biol Chem 2007; 282:1479-86. [0253] 33. Lewis B P, Shih I H,
Jones-Rhoades M W, Bartel D P, Burge C B. Prediction of mammalian
microRNA targets. Cell 2003; 115:787-98. [0254] 34. Takai D, Jones
P A. The CpG island searcher: a new WWW resource. In Silico Biol
2003; 3:325-40. [0255] 35. Capo-chichi C D, Roland I H, Vanderveer
L et al. Anomalous expression of epithelial
differentiation-determining GATA factors in ovarian tumorigenesis.
Cancer Res 2003; 63:4967-77. [0256] 36. Murakami Y, Yasuda T, Saigo
K et al. Comprehensive analysis of microRNA expression patterns in
hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006;
25:2537-45. [0257] 37. Roldo C, Missaglia E, Hagan J P et al.
MicroRNA expression abnormalities in pancreatic endocrine and
acinar tumors are associated with distinctive pathologic features
and clinical behavior. J Clin Oncol 2006; 24:4677-84. [0258] 38.
Volinia S, Calin G A, Liu C G et al. A microRNA expression
signature of human solid tumors defines cancer gene targets. Proc
Natl Acad Sci USA. 2006; 103:2257-61. [0259] 39. Chan J A,
Krichevsky A M, Kosik K S. MicroRNA-21 is an antiapoptotic factor
in human glioblastoma cells. Cancer Res 2005; 65:6029-33. [0260]
40. Zhu S, Si M L, Wu H, Mo Y Y. MicroRNA-21 targets the tumor
suppressor gene tropomyosin 1 (TPM1). J Biol Chem 2007;
282:14328-36. [0261] 41. Felli N, Fontana L, Pelosi E et al.
MicroRNAs 221 and 222 inhibit normal erythropoiesis and
erythroleukemic cell growth via kit receptor down-modulation. Proc
Natl Acad Sci USA. 2005; 102:18081-6. [0262] 42. He H, Jazdzewski
K, Li W et al. The role of microRNA genes in papillary thyroid
carcinoma. Proc Natl Acad Sci USA 2005; 102:19075-80. [0263] 43.
Pallante P, Visone R, Ferracin M et al. MicroRNA deregulation in
human thyroid papillary carcinomas. Endocr Relat Cancer 2006;
13:497-508. [0264] 44. Lee E J, Gusev Y, Jiang J et al. Expression
profiling identifies microRNA signature in pancreatic cancer. Int J
Cancer 2007; 120:1046-54. [0265] 45. Marsit C J, Eddy K, Kelsey K
T. MicroRNA responses to cellular stress. Cancer Res 2006;
66:10843-8. [0266] 46. Marquez R T, Baggerly K A, Patterson A P et
al. Patterns of gene expression in different histotypes of
epithelial ovarian cancer correlate with those in normal fallopian
tube, endometrium and colon. Clin Cancer Res 2005; 11:6116-26.
[0267] 47. Shedden K A, Kshirsagar M P, Schwartz D R et al.
Histologic type, organ of origin, and Wnt pathway status: effect on
gene expression in ovarian and uterine carcinomas. Clin Cancer Res
2005; 11:2123-31. [0268] 48. Thrall M, Gallion H H, Kryshio R et
al. BRCA1 expression in a large series of sporadic ovarian
carcinomas: a Gynecologic Oncology Group study. Int J Gynecol
Cancer 2006; 16 Suppl 1:166-71. [0269] 49. Lin Y W, Sheu J C, Liu L
Y et al. Loss of heterozygosity at chromosome 13q in hepatocellular
carcinoma: identification of three independent regions. Eur J
Cancer 1999; 35:1730-4.
Sequence CWU 1
1
98122RNAHomo sapiens 1uaacacuguc ugguaacgau gu 22222RNAHomo sapiens
2uaauacugcc ugguaaugau ga 22323RNAHomo sapiens 3uaauacugcc
ggguaaugau gga 23422RNAHomo sapiens 4uaacacuguc ugguaaagau gg
22522RNAHomo sapiens 5acuuuaacau ggaagugcuu uc 22624RNAHomo sapiens
6uuuggcaaug guagaacuca cacu 24723RNAHomo sapiens 7ccuaguaggu
guccaguaag ugu 23823RNAHomo sapiens 8gaagugcuuc gauuuugggg ugu
23922RNAHomo sapiens 9gugaaauguu uaggaccacu ag 221022RNAHomo
sapiens 10uccuucauuc caccggaguc ug 221123RNAHomo sapiens
11cccaguguuc agacuaccug uuc 231223RNAHomo sapiens 12cccaguguuu
agacuaucug uuc 231321RNAHomo sapiens 13ugagaugaag cacuguagcu c
211422RNAHomo sapiens 14cugaagcuca gagggcucug au 221522RNAHomo
sapiens 15cagugguuuu acccuauggu ag 221623RNAHomo sapiens
16ucuuugguua ucuagcugua uga 231722RNAHomo sapiens 17uuuggucccc
uucaaccagc ug 221823RNAHomo sapiens 18ucaaaugcuc agacuccugu ggu
231921RNAHomo sapiens 19uacaguacug ugauaacuga a 212021RNAHomo
sapiens 20caagucacua gugguuccgu u 212122RNAHomo sapiens
21ucguaccgug aguaauaaug cg 222222RNAHomo sapiens 22aacccguaga
uccgaacuug ug 222320RNAHomo sapiens 23guguguggaa augcuucugc
202422RNAHomo sapiens 24uucccuuugu cauccuaugc cu 222522RNAHomo
sapiens 25acagcaggca cagacaggca gu 222622RNAHomo sapiens
26aacccguaga uccgaucuug ug 222722RNAHomo sapiens 27uucccuuugu
cauccuucgc cu 222823RNAHomo sapiens 28guccaguuuu cccaggaauc ccu
232922RNAHomo sapiens 29agagguagua gguugcauag uu 223020RNAHomo
sapiens 30uaaggcacgc ggugaaugcc 203124RNAHomo sapiens 31ucccugagac
ccuuuaaccu guga 243222RNAHomo sapiens 32ugagguagua gguuguaugg uu
223322RNAHomo sapiens 33ugagguagua gguuguauag uu 223422RNAHomo
sapiens 34uagcaccauu ugaaaucggu ua 223521RNAHomo sapiens
35uagcagcaca gaaauauugg c 213622RNAHomo sapiens 36ucccugagac
ccuaacuugu ga 223722RNAHomo sapiens 37uuauaauaca accugauaag ug
223823RNAHomo sapiens 38uaagugcuuc cauguuuuag uag 233922RNAHomo
sapiens 39uagcaccauc ugaaaucggu ua 224022RNAHomo sapiens
40uagcuuauca gacugauguu ga 224124RNAHomo sapiens 41uuuggcaaug
guagaacuca cacu 244222RNAHomo sapiens 42accaucgacc guugauugua cc
224322RNAHomo sapiens 43uaaucucagc uggcaacugu ga 224423RNAHomo
sapiens 44uaagugcuuc cauguuucag ugg 234523RNAHomo sapiens
45cagugcaaua guauugucaa agc 234622RNAHomo sapiens 46ugagguagua
aguuguauug uu 224723RNAHomo sapiens 47ugugcaaauc caugcaaaac uga
234823RNAHomo sapiens 48uagcaccauu ugaaaucagu guu 234923RNAHomo
sapiens 49uaaggugcau cuagugcaga uag 235022RNAHomo sapiens
50uagguuaucc guguugccuu cg 225123RNAHomo sapiens 51ugugcaaauc
uaugcaaaac uga 235222RNAHomo sapiens 52uugcauaguc acaaaaguga uc
225320RNAHomo sapiens 53uacaguauag augauguacu 205421RNAHomo sapiens
54agcuacaucu ggcuacuggg u 215522RNAHomo sapiens 55uggaauguaa
agaaguaugu au 225623RNAHomo sapiens 56uaagugcuuc cauguuuugg uga
235723RNAHomo sapiens 57aggcagugua guuagcugau ugc 235821RNAHomo
sapiens 58augaccuaug aauugacaga c 215922RNAHomo sapiens
59aaggagcuca cagucuauug ag 226022RNAHomo sapiens 60uuuggucccc
uucaaccagc ua 226122RNAHomo sapiens 61ugguuuaccg ucccacauac au
226223RNAHomo sapiens 62uggaagacua gugauuuugu ugu 236322RNAHomo
sapiens 63ucuacagugc acgugucucc ag 226422RNAHomo sapiens
64gccugcuggg guggaaccug gu 226523RNAHomo sapiens 65uuauugcuua
agaauacgcg uag 236622RNAHomo sapiens 66auaaagcuag auaaccgaaa gu
226722RNAHomo sapiens 67ugagaacuga auuccauagg cu 226822RNAHomo
sapiens 68uguaaacauc cucgacugga ag 226923RNAHomo sapiens
69uuuggcacua gcacauuuuu gcu 237023RNAHomo sapiens 70uuaaugcuaa
ucgugauagg ggu 237122RNAHomo sapiens 71agaucagaag gugauugugg cu
227223RNAHomo sapiens 72uguaaacauc cuacacucuc agc 237322RNAHomo
sapiens 73aacuggcccu caaagucccg cu 227420RNAHomo sapiens
74agagguauag ggcaugggaa 207522RNAHomo sapiens 75ugugacuggu
ugaccagagg gg 227622RNAHomo sapiens 76aggugguccg uggcgcguuc gc
227721RNAHomo sapiens 77gaacggcuuc auacaggagu u 217823RNAHomo
sapiens 78uacccuguag aaccgaauuu gug 237922RNAHomo sapiens
79aagcugccag uugaagaacu gu 228022RNAHomo sapiens 80uagguaguuu
ccuguuguug gg 228122RNAHomo sapiens 81uguaacagca acuccaugug ga
228223RNAHomo sapiens 82cgcauccccu agggcauugg ugu 238323RNAHomo
sapiens 83uauggcuuuu cauuccuaug uga 238421RNAHomo sapiens
84uaacagucuc cagucacggc c 218522RNAHomo sapiens 85ucucccaacc
cuuguaccag ug 228622RNAHomo sapiens 86ucagugcauc acagaacuuu gu
228722RNAHomo sapiens 87uguaaacauc cuugacugga ag 228823RNAHomo
sapiens 88uaaagugcuu auagugcagg uag 238923RNAHomo sapiens
89aacauucaac gcugucggug agu 239022RNAHomo sapiens 90ugagaacuga
auuccauggg uu 229122RNAHomo sapiens 91ugggucuuug cgggcgagau ga
229222DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 92acatcgttac cagacagtgt ta 229322DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
93ccatctttac cagacagtgt ta 229423DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 94gaacaggtag tctgaacact ggg
239522DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 95tcacaagtta gggtctcagg ga 229624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
96aagggattcc tgggaaaact ggac 249724DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
97gagacccagt agccagatgt agct 249822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
98tcaacatcag tctgataagc ta 22
* * * * *
References