U.S. patent application number 12/767279 was filed with the patent office on 2010-09-16 for diagnosis and treatment of cancers with microrna located in or near cancer-associated chromosomal features.
This patent application is currently assigned to Thomas Jefferson University. Invention is credited to George A. Calin, Carlo M. Croce, Chang-Gong Liu, Cinzia Sevignani.
Application Number | 20100234241 12/767279 |
Document ID | / |
Family ID | 34865553 |
Filed Date | 2010-09-16 |
United States Patent
Application |
20100234241 |
Kind Code |
A1 |
Croce; Carlo M. ; et
al. |
September 16, 2010 |
DIAGNOSIS AND TREATMENT OF CANCERS WITH MicroRNA LOCATED IN OR NEAR
CANCER-ASSOCIATED CHROMOSOMAL FEATURES
Abstract
MicroRNA genes are highly associated with chromosomal features
involved in the etiology of different cancers. The perturbations in
the genomic structure or chromosomal architecture of a cell caused
by these cancer-associated chromosomal features can affect the
expression of the miR gene(s) located in close proximity to that
chromosomal feature. Evaluation of miR gene expression can
therefore be used to indicate the presence of a cancer-causing
chromosomal lesion in a subject. As the change in miR gene
expression level caused by a cancer-associated chromosomal feature
may also contribute to cancerigenesis, a given cancer can be
treated by restoring the level of miR gene expression to normal.
microRNA expression profiling can be used to diagnose cancer and
predict whether a particular cancer is associated with an adverse
prognosis. The identification of specific mutations associated with
genomic regions that harbor miR genes in CLL patients provides a
means for diagnosing CLL and possibly other cancers.
Inventors: |
Croce; Carlo M.; (Columbus,
OH) ; Liu; Chang-Gong; (Powell, OH) ; Calin;
George A.; (Columbus, OH) ; Sevignani; Cinzia;
(Philadelphia, PA) |
Correspondence
Address: |
HAMILTON, BROOK, SMITH & REYNOLDS, P.C.
530 VIRGINIA ROAD, P.O. BOX 9133
CONCORD
MA
01742-9133
US
|
Assignee: |
Thomas Jefferson University
Philadelphia
PA
|
Family ID: |
34865553 |
Appl. No.: |
12/767279 |
Filed: |
April 26, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11194055 |
Jul 29, 2005 |
7723030 |
|
|
12767279 |
|
|
|
|
PCT/US05/04865 |
Feb 9, 2005 |
|
|
|
11194055 |
|
|
|
|
60543119 |
Feb 9, 2004 |
|
|
|
60542929 |
Feb 9, 2004 |
|
|
|
60542963 |
Feb 9, 2004 |
|
|
|
60542940 |
Feb 9, 2004 |
|
|
|
60580959 |
Jun 18, 2004 |
|
|
|
60580797 |
Jun 18, 2004 |
|
|
|
Current U.S.
Class: |
506/9 ;
435/6.18 |
Current CPC
Class: |
C12N 2310/31 20130101;
C12Q 2600/158 20130101; C12N 2710/16143 20130101; C12Q 1/6886
20130101; C12N 2310/33 20130101; C12Q 2600/178 20130101; A61P 35/00
20180101; C12N 7/00 20130101; A61K 31/713 20130101; A61K 31/7088
20130101; C12N 2310/141 20130101; C12N 15/113 20130101; C12N
2310/32 20130101; C12N 15/1135 20130101; C12Q 2600/106 20130101;
C12N 2310/11 20130101; A61K 45/06 20130101 |
Class at
Publication: |
506/9 ;
435/6 |
International
Class: |
C40B 30/04 20060101
C40B030/04; C12Q 1/68 20060101 C12Q001/68 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] The invention described herein was supported in part by
grant nos. P01CA76259, P01CA81534, and P30CA56036 from the National
Cancer Institute. The U.S. government has certain rights in this
invention
Claims
1. A method of determining increased risk of a human subject
developing a cancer, or increased likelihood of the presence of a
cancer in a human subject, comprising the steps of: (i) measuring
in a sample from the subject the level of at least one miR-155(BIC)
gene product; and (ii) comparing the level of the at least one
miR-155(BIC) gene product in the sample to a control level of the
miR-155(BIC) gene product, wherein an increase in the level of the
miR-155(BIC) gene product in the sample relative to the control
level of miR-155(BIC) gene product is indicative of the subject
either having increased risk of developing the cancer or increased
likelihood of the presence of the cancer.
2. The method of claim 1, wherein the at least one miR-155(BIC)
gene product comprises SEQ ID NO:183.
3. The method of claim 1, wherein the at least one miR-155(BIC)
gene product comprises nucleotides 4-25 of SEQ ID NO:183.
4. The method of claim 1, wherein the cancer is selected from the
group consisting of: bladder cancer; esophageal cancer; lung
cancer; stomach cancer; kidney cancer; cervical cancer; ovarian
cancer; breast cancer; lymphoma; Ewing sarcoma; hematopoietic
tumors; solid tumors; gastric cancer; colorectal cancer; brain
cancer; epithelial cancer; nasopharyngeal cancer; uterine cancer;
hepatic cancer; head-and-neck cancer; renal cancer; male germ cell
tumors; malignant mesothelioma; myelodysplastic syndrome;
pancreatic or biliary cancer; prostate cancer; thyroid cancer;
urothelial cancer; renal cancer; Wilm's tumor; small cell lung
cancer; melanoma; skin cancer; osteosarcoma; neuroblastoma;
leukemia (acute lymphocytic leukemia, acute myeloid leukemia,
chronic lymphocytic leukemia); glioblastoma multiforme;
medulloblastoma; lymphoplasmacytoid lymphoma; and
rhabdomyosarcoma.
5. The method of claim 4, wherein the cancer is breast cancer.
6. The method of claim 4, wherein the cancer is lung cancer.
7. The method of claim 6, wherein the lung cancer is small cell
lung cancer.
8. The method of claim 4, wherein the cancer is colorectal
cancer.
9. The method of claim 1, wherein the level of the at least one
miR-155(BIC) gene product in the sample is measured using an assay
selected from the group consisting of northern blot analysis, in
situ hybridization and quantitative reverse transcriptase
polymerase chain reaction.
10. The method of claim 1, wherein the sample is a tissue
sample.
11. The method of claim 10, wherein the tissue sample is a
biopsy.
12. The method of claim 1, wherein the sample is a blood
sample.
13. A method of determining increased risk of a human subject
developing a cancer, or increased likelihood of the presence of a
cancer in a human subject, comprising the steps of: (1) reverse
transcribing at least one miR-155(BIC) RNA from a sample from the
subject to provide at least one miR-155(BIC) target
oligodeoxynucleotide; (2) hybridizing the at least one miR-155(BIC)
target oligodeoxynucleotide to a microarray comprising
miRNA-specific probe oligonucleotides that include at least one
miR-155(BIC) RNA-specific probe oligonucleotide to provide a
hybridization profile for the sample, wherein the hybridization
profile includes a hybridization signal for the at least one
miR-155(BIC) RNA; and (3) comparing the sample hybridization
profile to a control hybridization profile, wherein the control
hybridization profile includes a control hybridization signal for
the at least one miR-155(BIC) RNA, wherein a hybridization signal
for the at least one miR-155(BIC) RNA in the sample hybridization
profile that is greater than the control hybridization signal for
the at least one miR-155(BIC) RNA indicates the subject has
increased risk of developing the cancer or increased likelihood of
the presence of the cancer.
14. The method of claim 13, wherein the at least one miR-155(BIC)
gene product comprises SEQ ID NO:183.
15. The method of claim 13, wherein the at least one miR-155(BIC)
gene product comprises nucleotides 4-25 of SEQ ID NO:183.
16. The method of claim 13, wherein the cancer is selected from the
group consisting of: bladder cancer; esophageal cancer; lung
cancer; stomach cancer; kidney cancer; cervical cancer; ovarian
cancer; breast cancer; lymphoma; Ewing sarcoma; hematopoietic
tumors; solid tumors; gastric cancer; colorectal cancer; brain
cancer; epithelial cancer; nasopharyngeal cancer; uterine cancer;
hepatic cancer; head-and-neck cancer; renal cancer; male germ cell
tumors; malignant mesothelioma; myelodysplastic syndrome;
pancreatic or biliary cancer; prostate cancer; thyroid cancer;
urothelial cancer; renal cancer; Wilm's tumor; small cell lung
cancer; melanoma; skin cancer; osteosarcoma; neuroblastoma;
leukemia (acute lymphocytic leukemia, acute myeloid leukemia,
chronic lymphocytic leukemia); glioblastoma multiforme;
medulloblastoma; lymphoplasmacytoid lymphoma; and
rhabdomyosarcoma.
17. The method of claim 16, wherein the cancer is selected from the
group consisting of: breast cancer; lung cancer; and colorectal
cancer.
18. The method of claim 13, wherein the sample is a tissue
sample.
19. The method of claim 13, wherein the sample is a blood
sample.
20. The method of claim 13, wherein the microarray comprises
miRNA-specific probes oligonucleotides for a substantial portion of
the human miRNome.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 11/194,055, filed Jul. 29, 2005, which is a
continuation-in-part of International Application No.
PCT/US2005/004865, filed Feb. 9, 2005, which claims the benefit of
U.S. Provisional Application No. 60/543,119, filed Feb. 9, 2004,
U.S. Provisional Application No. 60/542,929, filed Feb. 9, 2004,
U.S. Provisional Application No. 60/542,963, filed Feb. 9, 2004,
U.S. Provisional Application No. 60/542,940, filed Feb. 9, 2004,
U.S. Provisional Application No. 60/580,959, filed Jun. 18, 2004,
and U.S. Provisional Application No. 60/580,797, filed Jun. 18,
2004. The entire teachings of the above applications are
incorporated herein by reference.
FIELD OF THE INVENTION
[0003] The invention relates to the diagnosis of cancers, or the
screening of individuals for the predisposition to cancer, by
evaluating the status of at least one miR gene located in close
proximity to chromosomal features, such as cancer-associated
genomic regions, fragile sites, human papilloma virus integration
sites, and homeobox genes and gene clusters. The invention also
relates to the treatment of cancers by altering the amount of gene
product produced from miR genes located in close proximity to these
chromosomal features. The invention further provides methods of
diagnosing CLL and other cancers by screening for mutations in miR
genes.
BACKGROUND OF THE INVENTION
[0004] Taken as a whole, cancers are a significant source of
mortality and morbidity in the U.S. and throughout the world.
However, cancers are a large and varied class of diseases with
diverse etiologies. Researchers therefore have been unable to
develop treatments or diagnostic tests which cover more than a few
types of cancer.
[0005] For example, cancers are associated with many different
classes of chromosomal features. One such class of chromosomal
features are perturbations in the genomic structure of certain
genes, such as the deletion or mutation of tumor suppressor genes.
The activation of proto-oncogenes by gene amplification or promoter
activation (e.g., by viral integration), epigenetic modifications
(e.g., a change in DNA methylation) and chromosomal translocations
can also cause cancerigenesis. Such perturbations in the genomic
structure which are involved in the etiology of cancers are called
"cancer-associated genomic regions" or "CAGRs."
[0006] Chromosomal fragile sites are another class of chromosomal
feature implicated in the etiology of cancers. Chromosomal fragile
sites are regions of genomic DNA which show an abnormally high
occurrence of gaps or breaks when DNA synthesis is perturbed during
metaphase. These fragile sites are categorized as "rare" or
"common." As their name suggests, rare fragile sites are uncommon.
Such sites are associated with di- or tri-nucleotide repeats, can
be induced in metaphase chromosomes by folic acid deficiency, and
segregate in a Mendelian manner. An exemplary rare fragile site is
the Fragile X site.
[0007] Common fragile sites are revealed when cells are grown in
the presence of aphidocolin or 5-azacytidine, which inhibit DNA
polymerase. At least eighty-nine common fragile sites have been
identified, and at least one such site is found on every human
chromosome. Thus, while their function is poorly understood, common
fragile sites represent a basic component of the human chromosome
structure.
[0008] Induction of fragile sites in vitro leads to increased
sister-chromatid exchange and a high rate of chromosomal deletions,
amplifications and translocations, while fragile sites have been
colocalized with chromosome breakpoints in vivo. Also, most common
fragile sites studied in tumor cells contain large, intra-locus
deletions or translocations, and a number of tumors have been
identified with deletions in multiple fragile sites. Chromosomal
fragile sites are therefore mechanistically involved in producing
many of the chromosomal lesions commonly seen in cancer cells.
[0009] Cervical cancer, which is the second leading cause of female
cancer mortality worldwide, is highly associated with human
papillomavirus (HPV) infection. Indeed, sequences from the HPV 16
or HPV 18 viruses are found in cells from nearly every cervical
tumor cell examined. In malignant forms of cervical cancer, the HPV
genome is found integrated into the genome of the cancer cells. HPV
preferentially integrates in or near common chromosomal fragile
sites. HPV integration into a host cell genome can cause large
amplification, deletions or rearrangements near the integration
site. Expression of cellular genes near the HPV integration site
can therefore be affected, which may contribute to the oncogenesis
of the infected cell. These sites of HPV integration into a host
cell genome are therefore considered another class of chromosomal
feature that is associated with a cancer.
[0010] Homeobox genes are a conserved family of regulatory genes
that contain the same 183-nucleotide sequence, called the
"homeobox." The homeobox genes encode nuclear transcription factors
called "homeoproteins," which regulate the expression of numerous
downstream genes important in development. The homeobox sequence
itself encodes a 61 amino acid "homeodomain" that recognizes and
binds to a specific DNA binding motif in the target developmental
genes. Homeobox genes are categorized as "class I" or "clustered"
homeobox genes, which regulate antero-posterior patterning during
embryogenesis, or "class II" homeobox genes, which are dispersed
throughout the genome. Altogether, the homeobox genes account for
more than 0.1% of the vertebrate genome.
[0011] The homeobox genes are believed to "decode" external
inductive stimuli that signal a given cell to proceed down a
particular developmental lineage. For example, specific homeobox
genes might be activated in response to various growth factors or
other external stimuli that activate signal transduction pathways
in a cell. The homeobox genes then activate and/or repress specific
programs of effector or developmental genes (e.g., morphogenetic
molecules, cell-cycle regulators, pro- or anti-apoptotic proteins,
etc.) to induce the phenotype "ordered" by the external stimuli.
The homeobox system is clearly highly coordinated during
embryogenesis and morphogenesis, but appears to be dysregulated
during oncogenesis. Such dysregulation likely occurs because of
disruptions in the genomic structure or chromosomal architecture
surrounding the homeobox genes or gene clusters. The homeobox genes
or gene clusters are therefore considered yet another chromosomal
feature which are associated with cancers.
[0012] Micro RNAs (miRs) are naturally-occurring 19 to 25
nucleotide transcripts found in over one hundred distinct
organisms, including fruit flies, nematodes and humans. The miRs
are typically processed from 60- to 70-nucleotide foldback RNA
precursor structures, which are transcribed from the miR gene. The
miR precursor processing reaction requires Dicer RNase III and
Argonaute family members (Sasaki et al. (2003), Genomics 82,
323-330). The miR precursor or processed miR products are easily
detected, and an alteration in the levels of these molecules within
a cell can indicate a perturbation in the chromosomal region
containing the miR gene.
[0013] To date, at least 222 separate miR genes have been
identified in the human genome. Two miR genes (miR15a and miR16a)
have been localized to a homozygously deleted region on chromosome
13 that is correlated with chronic lymphocytic leukemia (Calin et
al. (2002), Proc. Natl. Acad. Sci. USA 99:15524-29), and the
miR-143/miR145 gene cluster is downregulated in colon cancer
(Michael et al. (2003), Mol. Cancer. Res. 1:882-91). However, the
distribution of miR genes throughout the genome, and the
relationship of the miR genes to the diverse chromosomal features
discussed herein, has not been systematically studied.
[0014] A method for reliably and accurately diagnosing, or for
screening individuals for a predisposition to, cancers associated
with such diverse chromosomal features as CAGRs, fragile sites, HPV
integration sites and homeobox genes is needed. A method of
treating cancers associated with these diverse chromosomal features
is also highly desired.
SUMMARY OF THE INVENTION
[0015] It has now been discovered that miR genes are commonly
associated with chromosomal features involved in the etiology of
different cancers. The perturbations in the genomic structure or
chromosomal architecture of a cell caused by a cancer-associated
chromosomal feature can affect the expression of the miR gene(s)
located in close proximity to that chromosomal feature. Evaluation
of miR gene expression can therefore be used to indicate the
presence of a cancer-causing chromosomal lesion in a subject. As
the change in miR gene expression level caused by a
cancer-associated chromosomal feature may also contribute to
cancerigenesis, a given cancer can be treated by restoring the
level of miR gene expression to normal.
[0016] The invention therefore provides a method of diagnosing
cancer in a subject. The cancer can be any cancer associated with a
cancer-associated chromosomal feature. As used herein, a
cancer-associated chromosomal feature includes, but is not limited
to, a cancer-associated genomic region, a chromosomal fragile site,
a human papillomavirus integration site on a chromosome of the
subject, and a homeobox gene or gene cluster on a chromosome of the
subject. The cancer can also be any cancer associated with one or
more adverse prognostic markers, including cancers associated with
positive ZAP-70 expression, an unmutated IgV.sub.H gene, positive
CD38 expression, deletion at chromosome 11q23, and loss or mutation
of TP53. In one embodiment, the diagnostic method comprises the
following steps. In a sample obtained from a subject suspected of
having a cancer associated with a cancer-associated chromosomal
feature, the status of at least one miR gene located in close
proximity to the cancer-associated chromosomal feature is evaluated
by measuring the level of at least one miR gene product from the
miR gene in the sample, provided the miR genes are not miR-15,
miR-16, miR-143 or miR-145. An alteration in the level of miR gene
product in the sample relative to the level of miR gene product in
a control sample is indicative of the presence of the cancer in the
subject. In a related embodiment, the diagnostic method comprises
evaluating in a sample obtained from a subject suspected of having
a cancer associated with a cancer-associated chromosomal feature,
the status of at least one miR gene located in close proximity to
the cancer-associated chromosomal feature, provided the miR gene is
not miR-15 or miR-16, by measuring the level of at least one miR
gene product from the miR gene in the sample. An alteration in the
level of miR gene product in the sample relative to the level of
miR gene product in a control sample is indicative of the presence
of the cancer in the subject.
[0017] The status of the at least one miR gene in the subject's
sample can also be evaluated by analyzing the at least one miR gene
for a deletion, mutation and/or amplification. The detection of a
deletion, mutation and/or amplification in the miR gene relative to
the miR gene in a control sample is indicative of the presence of
the cancer in the subject. The status of the at least one miR gene
in the subject's sample can also be evaluated by measuring the copy
number of the at least one miR gene in the sample, wherein a copy
number other than two for miR genes located on any chromosome other
than a Y chromosome, and other than one for miR genes located on a
Y chromosome, is indicative of the subject either having or being
at risk for having a cancer. In one embodiment, the diagnostic
method comprises analyzing at least one miR gene in the sample for
a deletion, mutation and/or amplification, wherein detection of a
deletion, mutation and/or amplification in the miR gene relative to
the miR gene in a control sample is indicative of the presence of
the cancer in the subject. In a related embodiment, the diagnostic
method comprises analyzing at least one miR gene in the sample for
a deletion, mutation or amplification, provided the miR gene is not
miR-15 or miR-16, wherein detection of a deletion, mutation and/or
amplification in the miR gene relative to the miR gene in a control
sample is indicative of the presence of the cancer in the subject.
In a further embodiment, the diagnostic method comprises analyzing
the miR-16 gene in the sample for a specific mutation, depicted in
SEQ ID NO. 642, wherein detection of the mutation in the miR-16
gene relative to a miR-16 gene in a control sample is indicative of
the presence of the cancer in the subject.
[0018] The invention also provides a method of screening subjects
for a predisposition to develop a cancer associated with a
cancer-associated chromosomal feature, by evaluating the status of
at least one miR gene located in close proximity to the
cancer-associated chromosomal feature in the same manner described
herein for the diagnostic method. The cancer can be any cancer
associated with a cancer-associated chromosomal feature.
[0019] In one embodiment, the level of the at least one miR gene
product from the sample is measured by quantitatively reverse
transcribing the miR gene product to form a complementary target
oligodeoxynucleotide, and hybridizing the target
oligodeoxynucleotide to a microarray comprising a probe
oligonucleotide specific for the miR gene product. In another
embodiment, the levels of multiple miR gene products in a sample
are measured in this fashion, by quantitatively reverse
transcribing the miR gene products to form complementary target
oligodeoxynucleotides, and hybridizing the target
oligodeoxynucleotides to a microarray comprising probe
oligonucleotides specific for the miR gene products. In another
embodiment, the multiple miR gene products are simultaneously
reverse transcribed, and the resulting set of target
oligodeoxynucleotides are simultaneously exposed to the
microarray.
[0020] In a related embodiment, the invention provides a method of
diagnosing cancer in a subject, comprising reverse transcribing
total RNA from a sample from the subject to provide a set of
labeled target oligodeoxynucleotides; hybridizing the target
oligodeoxynucleotides to a microarray comprising miRNA-specific
probe oligonucleotides to provide a hybridization profile for the
sample; and comparing the sample hybridization profile to the
hybridization profile generated from a control sample, an
alteration in the profile being indicative of the subject either
having, or being at risk for developing, a cancer. The microarray
of miRNA-specific probe oligonucleotides preferably comprises
miRNA-specific probe oligonucleotides for a substantial portion of
the human miRNome, the full complement of microRNA genes in a cell.
The microarray more preferably comprises at least about 60%, 70%,
80%, 90%, or 95% of the human miRNome. In one embodiment, the
cancer is associated with a cancer-associated chromosomal feature,
such as a cancer-associated genomic region or a chromosomal fragile
site. In another embodiment, the cancer is associated with one or
more adverse prognostic markers. In a particular embodiment, the
cancer is B-cell chronic lymphocytic leukemia. In a further
embodiment, the cancer is a subset of B-cell chronic lymphocytic
leukemia that is associated with one or more adverse prognostic
markers. As used herein, an adverse prognostic marker is any
indicator, such as a specific genetic alteration or a level of
expression of a gene, whose presence suggests an unfavorable
prognosis concerning disease progression, the severity of the
cancer, and/or the likelihood of developing the cancer.
[0021] The invention further provides a method of treating a cancer
associated with a cancer-associated chromosomal feature in a
subject. The cancer can be any cancer associated with a
cancer-associated chromosomal feature, for example, cancers
associated with a cancer-associated genomic region, a chromosomal
fragile site, a human papillomavirus integration site on a
chromosome of the subject, or a homeobox gene or gene cluster on a
chromosome of the subject. Furthermore, the cancer is a cancer
associated with a cancer-associated chromosomal feature in which at
least one isolated miR gene product from a miR gene located in
close proximity to the cancer-associated chromosomal feature is
down-regulated or up-regulated in cancer cells of the subject, as
compared to control cells. When the at least one isolated miR gene
product is down regulated in the subject's cancer cells, the method
comprises administering to the subject, an effective amount of at
least one isolated miR gene product from the at least one miR gene,
such that proliferation of cancer cells in the subject is
inhibited. When the at least one isolated miR gene product is
up-regulated in the cancer cells, an effective amount of at least
one compound for inhibiting expression of the at least one miR gene
is administered to the subject, such that proliferation of cancer
cells in the subject is inhibited.
[0022] The invention further provides a method of treating cancer
associated with a cancer-associated chromosomal feature in a
subject, comprising the following steps. The amount of miR gene
product expressed from at least one miR gene located in close
proximity to the cancer-associated chromosomal region in cancer
cells from the subject is determined relative to control cells. If
the amount of the miR gene product expressed in the cancer cells is
less than the amount of the miR gene product expressed in control
cells, the amount of miR gene product expressed in the cancer cells
is altered by administering to the subject an effective amount of
at least one isolated miR gene product from the miR gene, such that
proliferation of cancer cells in the subject is inhibited. If the
amount of the miR gene product expressed in the cancer cells is
greater than the amount of the miR gene product expressed in
control cells, the amount of miR gene product expressed in the
cancer cells is altered by administering to the subject an
effective amount of at least one compound for inhibiting expression
of the at least one miR gene, such that proliferation of cancer
cells in the subject is inhibited.
[0023] The invention further provides pharmaceutical compositions
comprising a pharmaceutically acceptable carrier and at least one
miR gene product, or a nucleic acid expressing at least one miR
gene product, from an miR gene located in close proximity to a
cancer-associated chromosomal feature, provided the miR gene
product is not miR-15 or miR-16.
[0024] The invention still further provides for the use of at least
one miR gene product, or a nucleic acid expressing at least one miR
gene product, from an miR gene located in close proximity to a
cancer-associated chromosomal feature for the manufacture of a
medicament for the treatment of a cancer associated with a
cancer-associated chromosomal region.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 is an image of a Northern blot analysis of the
expression of miR-16a (upper panel), miR-26a (middle panel), and
miR-99a (lower panel) in normal human lung (lane 1) and human lung
cancer cells (lanes 2-8). Below the three blots is an image of an
ethidium bromide-stained gel indicating the 55 RNA lane loading
control. The genomic location and the type of alteration are
indicated.
[0026] FIG. 2 is a schematic representation demonstrating the
position of various miR genes on human chromosomes in relation to
HOX gene clusters.
[0027] FIG. 3 shows an miRNome expression analysis of 38 individual
CLL samples. The main miR-associated CLL clusters are presented.
The control samples are: MNC, mononuclear cells; Ly, Diffuse large
B cell lymphoma; CD5, selected CD5+ B lymphocytes.
[0028] FIG. 4 is an image of a Northern blot analysis of the
expression of miR-16a (upper panel), miR-26a (middle panel), and
miR-99a (lower panel) in 12 B-CLL samples. Below the three blots is
an image of an ethidium bromide-stained gel indicating the 5S RNA
lane loading control. miR-16a expression levels varied in these
B-CLL cases, and were either low or absent in several of the
samples tested. However, the expression levels of miR-26a and
miR-99a, both regions not involved in B-CLL, were relatively
constant in the tested samples.
[0029] FIG. 5 shows Kaplan-Meier curves depicting the relationship
between miRNA expression levels and the time from diagnosis to
either the time of initial therapy or the present, if therapy had
not commenced. The proportion of untreated patients with CLL is
plotted against time since diagnosis. The patients are grouped
according to the expression profile generated by 11 microRNA
genes.
[0030] FIG. 6 shows the expression levels of miR-16-1 and miR-15a
miRNAs in samples from two patients with a miR-16-1 mutation (see
SEQ ID NO. 642) and in CD5+ cell samples from normal patients, both
by Northern blot analysis (upper panels) and by miRNACHIP
(expression level indicated by numbers below panels).
[0031] FIG. 7A is a schematic depicting the locations of mutations
affecting various miRNAs. The mutated (below chromosome) and normal
(above chromosome) nucleotide base is presented for each
mutation/polymorphism. The figure is not drawn to scale.
[0032] FIG. 7B depicts the RT-PCR amplification products of primary
transcripts corresponding to various mutant miR gene products for
which mutations have been identified in B-CLL cells, as well as the
length of the amplified genomic DNA (G). GAPDH levels were used for
normalization; RT+=reverse transcription, RT-=control without
reverse transcription, G=genomic control.
[0033] FIG. 7C presents the chromatograms for the genomic regions
of samples having either normal miR-16-1/15a (top) or mutated
miR-16-1/15a (CtoT)+7 (bottom). The precise position of the
precursor (line with period at end) and the location of the
mutation (arrowheads) are indicated.
[0034] FIG. 7D shows the expression levels by miRNACHIP (MAr) and
Northern blot (NB) analysis for miR-16-1 and miR-15a in samples
from two normal CD5 pools (CD5+) and from both of the patients
carrying the germline (CtoT)+7 mutation (CLL). The Northern blot
band intensities were quantified using ImageQuantTL (Nonlinear
Dynamics Ltd.). Data are presented as arbitrary units.
[0035] FIG. 7E is a Northern blot showing that the germline
mutation in the pri-miR-16-1 is associated with abnormal expression
of the active, mature miR-16-1 molecule. Levels of expression were
assessed in 293 cells transfected with miR-16-1-WT, miR-16-1-MUT or
Empty vector (Empty V), as indicated. Untransfected 293 cells were
tested as a control. Normalization for loading was performed with a
U6 probe (miR-15a; left panel) and the transfection levels were
normalized with anti-GFP signal on cell lysates from the same
pellet as that used for Northern blotting (miR-16-1; right
panel).
DETAILED DESCRIPTION OF THE INVENTION
[0036] All nucleic acid sequences herein are given in the 5' to 3'
direction. In addition, genes are represented by italics, and gene
products are represented by normal type; e.g., mir-17 is the gene
and miR-17 is the gene product.
[0037] It has now been discovered that the genes that comprise the
miR gene complement of the human genome (or "miRNome") are
non-randomly distributed throughout the genome in relation to each
other. For example, of 222 human miR genes, at least ninety are
located in thirty-six gene clusters, typically with two or three
miR genes per cluster (median=2.5). The largest cluster is composed
of six genes located on chromosome 13 at 13q31; the miR genes in
this cluster are
miR-17/miR-18/miR-19a/miR-20/miR-19b1/miR-92-1.
[0038] The human miR genes are also non-randomly distributed across
the human chromosomal complement. For example, chromosome 4 has a
less-than-expected rate of miRs, and chromosomes 17 and 19 contain
significantly more miR genes than expected based on chromosome
size. Indeed, six of the thirty-six miR gene clusters (17%),
containing 16 of 90 clustered genes (18%), are located on
chromosomes 17 and 19, which account for only 5% of the entire
human genome.
[0039] The sequences of the gene products of 187 miR genes are
provided in Table 1. The location and distribution of these 187 miR
genes in the human genome is given in Tables 2 and 3; see also
Example 1. All Tables are located in the Examples section below. As
used herein, an "miR gene product" or "miRNA" means the unprocessed
or processed RNA transcript from an miR gene. As the miR gene
products are not translated into a protein, the term "miR gene
products" does not include proteins.
[0040] A used herein, "probe oligonucleotide" refers to an
oligonucleotide that is capable of hybridizing to a target
oligonucleotide. "Target oligonucleotide" or "target
oligodeoxynucleotide" refers to a molecule to be detected (e.g., in
a hybridization). By "miR-specific probe oligonucleotide" or "probe
oligonucleotide specific for an miR" is meant a probe
oligonucleotide that has a sequence selected to hybridize to a
specific miR gene product, or to a reverse transcript of the
specific miR gene product.
[0041] The unprocessed miR gene transcript is also called an "miR
precursor," and typically comprises an RNA transcript of about 70
nucleotides in length. The miR precursor can be processed by
digestion with an RNAse (such as, Dicer, Argonaut, or RNAse III,
e.g., E. coli RNAse III)) into an active 19-25 nucleotide RNA
molecule. This active 19-25 nucleotide RNA molecule is also called
the "processed miR gene transcript."
[0042] The active 19-25 nucleotide RNA molecule can be obtained
from the miR precursor through natural processing routes (e.g.,
using intact cells or cell lysates) or by synthetic processing
routes (e.g., using isolated processing enzymes, such as isolated
Dicer, Argonaut, or RNAase III). It is understood that the active
19-25 nucleotide RNA molecule can also be produced directly by
biological or chemical syntheses, without having been processed
from the miR precursor. For ease of discussion, such a directly
produced active 19-25 nucleotide RNA molecule is also referred to
as a "processed miR gene product."
[0043] As used herein, "miR gene expression" refers to the
production of miR gene products from an miR gene, including
processing of the miR precursor into a processed miR gene
product.
[0044] The human miR genes are closely associated with different
classes of chromosomal features that are themselves associated with
cancer. As used herein, a "cancer-associated chromosomal feature"
refers to a region of a given chromosome, which, when perturbed, is
correlated with the occurrence of at least one human cancer. As
used herein, a chromosomal feature is "correlated" with a cancer
when the feature and the cancer occur together in individuals of a
study population in a manner not expected on the basis of chance
alone.
[0045] A region of a chromosome is "perturbed" when the chromosomal
architecture or genomic DNA sequence in that region is disturbed or
differs from the normal architecture or sequence in that region.
Exemplary perturbations of chromosomal regions include, e.g.,
chromosomal breakage and translocation, mutations, deletions or
amplifications of genomic DNA, a change in the methylation pattern
of genomic DNA, the presence of fragile sites, and the presence of
viral integration sites. One skilled in the art would recognize
that other chromosomal perturbations associated with a cancer are
possible.
[0046] It is understood that a cancer-associated chromosomal
feature can be a chromosomal region where perturbations are known
to occur at a higher rate than at other regions in the genome, but
where the perturbation has not yet occurred. For example, a common
chromosomal breakpoint or fragile site is considered a
cancer-associated chromosomal feature, even if a break has not yet
occurred. Likewise, a region in the genomic DNA known as a
mutational "hotspot" can be a cancer-associated chromosomal
feature, even if no mutations have yet occurred in the region.
[0047] One class of cancer-associated chromosomal feature which is
closely associated with miR genes in the human genome is a
"cancer-associated genomic region" or "CAGR" (see Table 4). As used
herein, a "CAGR" includes any region of the genomic DNA that
comprises a genetic or epigenetic change (or the potential for a
genetic or epigenetic change) that differs from normal DNA, and
which is correlated with a cancer. Exemplary genetic changes
include single- and double-stranded breaks (including common
breakpoint regions in or near possible oncogenes or
tumor-suppressor genes); chromosomal translocations; mutations,
deletions, insertions (including viral, plasmid or transposon
integrations) and amplifications (including gene duplications) in
the DNA; minimal regions of loss-of-heterozygosity (LOH) suggestive
of the presence of tumor-suppressor genes; and minimal regions of
amplification suggestive of the presence of oncogenes. Exemplary
epigenetic changes include any changes in DNA methylation patterns
(e.g., DNA hyper- or hypo-methylation, especially in promoter
regions). As used herein, "cancer-associated genomic region" or
"CAGR" specifically excludes chromosomal fragile sites or human
papillomavirus insertion sites.
[0048] Many of the known miR genes in the human genome are in or
near CAGRs, including 80 miR genes that are located exactly in
minimal regions of LOH or minimal regions of amplification
correlated to a variety of cancers. Other miR genes are located in
or near breakpoint regions, deleted areas, or regions of
amplification. The distribution of miR genes in the human genome
relative to CAGRs is given in Tables 6 and 7 and in Example 4A
below.
[0049] As used herein, an miR gene is "associated" with a given
CAGR when the miR gene is located in close proximity to the CAGR;
i.e., when the miR is located within the same chromosomal band or
within 3 megabases (3 Mb) of the CAGR. See Tables 6 and 7 and
Example 4A below for a description of cancers which are correlated
with CAGRs, and a description of miRs associated with those
CAGRs.
[0050] For example, cancers associated with CAGRs include leukemia
(e.g., AML, CLL, pro-lymphocytic leukemia), lung cancer (e.g.,
small cell and non-small cell lung carcinoma), esophageal cancer,
gastric cancer, colorectal cancer, brain cancer (e.g., astrocytoma,
glioma, glioblastoma, medulloblastoma, meningioma, neuroblastoma),
bladder cancer, breast cancer, cervical cancer, epithelial cancer,
nasopharyngeal cancer (e.g., oral or laryngeal squamous cell
carcinoma), lymphoma (e.g., follicular lymphoma), uterine cancer
(e.g., malignant fibrous histiocytoma), hepatic cancer (e.g.,
hepatocellular carcinoma), head-and-neck cancer (e.g.,
head-and-neck squamous cell carcinoma), renal cancer, male germ
cell tumors, malignant mesothelioma, myelodysplastic syndrome,
ovarian cancer, pancreatic or biliary cancer, prostate cancer,
thyroid cancer (e.g., sporadic follicular thyroid tumors), and
urothelial cancer.
[0051] Examples of miR genes associated with CAGRs include
miR-153-2, let-71, miR-33a, miR-34a-2, miR34a-1, let-7a-1, let-7d;
let-7f-1, miR-24-1, miR-27b, miR-23b, miR-181a; miR-199b,
miR-218-1, miR-31, let-7a-2, let-7g, miR-21, miR-32a-1, miR-33b,
miR-100, miR-101-1, miR-125b-1, miR-135-1, miR-142 as, miR-142s;
miR-144, miR-301, miR-297-3, miR-155(BIC), miR-26a, miR-17, miR-18,
miR-19a, miR-19b1, miR-20, miR-92-1, miR-128a, miR-7-3, miR-22,
miR-123, miR-132, miR-149, miR-161; miR-177, miR-195, miR-212,
let-7c, miR-99a, miR-125b-2, miR-210, miR-135-2, miR-124a-1,
miR-208, miR-211, miR-180, miR-145, miR-143, miR-127, miR-136,
miR-138-1, miR-154, miR-134, miR-299, miR-203, miR-34, miR-92-2,
miR-19b-2, miR-108-1, miR-193, miR-106a, miR-29a, miR-29b,
miR-129-1, miR-182s, miR-182 as, miR-96, miR-183, miR-32,
miR-159-1, miR-192 and combinations thereof.
[0052] Specific groupings of miR gene(s) that are associated with a
particular cancer are evident from Tables 6 and 7, and are
preferred. For example, acute myeloid leukemia (AML) is associated
with miR-153-2, and adenocarcinoma of the lung or esophagus is
associated with let-71. Where more than one miR gene is listed in
Tables 6 and 7, it is understood that the cancer associated with
those genes can be diagnosed by evaluating any one of the listed
miR genes, or by evaluating any combination of the listed miR
genes. Subgenera of CAGRs or associated with miR gene(s) would also
be evident to one of ordinary skill in the art from Tables 6 and
7.
[0053] Another class of cancer-associated chromosomal feature which
is closely associated with miR genes in the human genome is a
"chromosomal fragile site" or "FRAs" (see Table 4 and Example 2).
As used herein, a "FRA" includes any rare or common fragile site in
a chromosome; e.g., one that can be induced by subjecting a cell to
stress during DNA replication. For example, a rare FRA can be
induced by subjecting the cell to folic acid deficiency during DNA
replication. A common FRA can be induced by treating the cell with
aphidocolin or 5-azacytidine during DNA replication. The
identification or induction of chromosomal fragile sites is within
the skill in the art; see, e.g., Arlt et al. (2003), Cytogenet.
Genome Res. 100:92-100 and Arlt et al. (2002), Genes, Chromosomes
and Cancer 33:82-92, the entire disclosures of which are herein
incorporated by reference.
[0054] Approximately 20% of the known human miR genes are located
in (13 miRs) or within 3 Mb (22 miRs) of cloned FRAs. Indeed, the
relative incidence of miR genes inside fragile sites occurs at a
rate 9.12 times higher than in non-fragile sites. Moreover, after
studying 113 fragile sites in a human karyotype, it was found that
61 miR genes are located in the same chromosomal band as a FRA. The
distribution of miR genes in the human genome relative to FRAs is
given in Table 5 and in Example 2.
[0055] As used herein, an miR gene is "associated" with a given FRA
when the miR gene is located in close proximity to the FRA; i.e.,
when the miR is located within the same chromosomal band or within
3 megabases (3 Mb) of the FRA. See Table 5 and Example 2 for a
description of cancers which are correlated with FRAs, and a
description of miRs associated with those FRAs.
[0056] For example, cancers associated with FRAs include bladder
cancer, esophageal cancer, lung cancer, stomach cancer, kidney
cancer, cervical cancer, ovarian cancer, breast cancer, lymphoma,
Ewing sarcoma, hematopoietic tumors, solid tumors and leukemia.
[0057] Examples of miR genes associated with FRAs include miR-186,
miR-101-1, miR-194, miR-215, miR-106b, miR-25, miR-93, miR-29b,
miR-29a, miR-96, miR-182s, miR-182 as, miR-183, miR-129-1, let7a-1,
let-7d, let-7f-1, miR-23b, miR-24-1, miR-27b, miR-32, miR-159-1,
miR-192, miR-125b-1, let-7a-2, miR-100, miR-196-2, miR-148b,
miR-190, miR-21, miR-301, miR-142s, miR-142 as, miR-105-1, miR-175
and combinations thereof.
[0058] Specific groupings of miR gene(s) that are associated with a
particular cancer and FRA are evident from Table 5, and are
preferred. For example, FRA7H is correlated with esophageal cancer,
and is associated with miR-29b, miR-29a, miR-96, miR-182s, miR-182
as, miR-183, and miR-129-1. FRA9D is correlated with bladder
cancer, and is associated with let7a-1, let-7d, let-7f-1, miR-23b,
miR-24-1, and miR-27b. Where more than one miR gene is listed in
Table 5 in association with a FRA, it is understood that the cancer
associated with those miR genes can be diagnosed by evaluating any
one of the listed miR genes, or by evaluating any combination of
the listed miR genes. Subgenera of CAGRs and/or associated with miR
gene(s) would also be evident to one of ordinary skill in the art
from Table 5.
[0059] Another class of cancer-associated chromosomal feature which
is closely associated with miR genes in the human genome is a
"human papillomavirus (HPV) integration site" (see Table 4 and
Example 3). As used herein, an "HPV integration site" includes any
site in a chromosome of a subject where some or all of an HPV
genome can insert into the genomic DNA, or any site where some or
all of an HPV genome has inserted into the genomic DNA. HPV
integration sites are often associated with common FRAs, but are
distinct from FRAs for purposes of the present invention. Any
species or strain of HPV can insert some or all of its genome into
an HPV integration site. However, the most common strains of HPV
which insert some or all of their genomes into an HPV integration
site are HPV 16 and HPV 18. The identification of HPV integration
sites in the human genome is within the skill in the art; see,
e.g., Thorland et al. (2000), Cancer Res. 60:5916-21, the entire
disclosure of which is herein incorporated by reference.
[0060] Thirteen miR genes (7%) are located within 2.5 Mb of seven
of the seventeen (45%) cloned integration sites in the human
genome. The relative incidence of miRs at HPV16 integration sites
occurred at a rate 3.22 times higher than in the rest of the
genome. Indeed, four miR genes (miR-21, miR-301, miR-142s and
miR-142 as) were located within one cluster of integration sites at
chromosome 17q23, in which there are three HPV16 integration events
spread over roughly 4 Mb of genomic sequence.
[0061] As used herein, an miR gene is "associated" with a given HPV
integration site when the miR gene is located in close proximity to
the HPV integration site; i.e., when the miR is located within the
same chromosomal band or within 3 megabases (3 Mb), preferably
within 2.5 Mb, of the HPV integration site. See Table 5 and Example
3 for a description of miRs associated with HPV integration
sites.
[0062] Insertion of HPV sequences into the genome of subject is
correlated with the occurrence of cervical cancer. Examples of miR
genes associated with HPV integration sites on human chromosomes
include miR-21, miR-301, miR-142 as, miR-142s, miR-194, miR-215,
miR-32 and combinations thereof.
[0063] Specific groupings of miR gene(s) that are associated with a
particular HPV integration site are evident from Table 5, and are
preferred. For example, the HPV integration site located in or near
FRA9E is associated with miR-32. The HPV integration site located
in or near FRA1H is associated with miR-194 and miR-215. The HPV
integration site located in or near FRA17B is associated with
miR-21, miR-301, miR-142s, and miR-142 as. Where more than one miR
gene is listed in Table 5 in relation to an HPV integration site,
it is understood that the cancer associated with those miR genes
can be diagnosed by evaluating any one of the listed miR genes, or
by evaluating any combination of the listed miR genes.
[0064] Another class of cancer-associated chromosomal feature which
is closely associated with miR genes in the human genome is a
"homeobox gene or gene cluster" (see Table 4 and Example 5). As
used herein, a "homeobox gene or gene cluster" is a single gene or
a grouping of genes, characterized in that the gene or genes have
been classified by sequence or function as a class I or class II
homeobox gene or contain the 183-nucleotide "homeobox" sequence.
Identification and characterization of homeobox genes or gene
clusters are within the skill in the art; see, e.g., Cillo et al.
(1999), Exp. Cell Res. 248:1-9 and Pollard et al. (2000), Current
Biology 10:1059-62, the entire disclosures of which are herein
incorporated by reference.
[0065] Of the four known class I homeobox gene clusters in the
human genome, three contain miR genes: miR-10a and miR-196-1 are in
the HOX B cluster on 17q21; miR-196-2 is in the HOX C cluster at
12q13; and miR-10b is in the HOX D cluster at 2q31. Three other
miRs (miR-148, miR-152 and miR-148b) are located within 1 Mb of a
HOX gene cluster. miR genes are also found within class II homeobox
gene clusters; for example, seven microRNAs (miR-129-1, miR-153-2,
let-7a-1, let-7f-1, let-7d, miR-202 and miR-139) are located within
0.5 Mb of class II homeotic genes. See Example 5 and FIG. 2 for a
description of miRs associated with homeobox genes or gene clusters
in the human genome.
[0066] Examples of homeobox genes associated with miR genes in the
human genome include genes in the HOXA cluster, genes in the HOXB
cluster, genes in the HOXC cluster, genes in the HOXD cluster, NK1,
NK3, NK4, Lbx, Tlx, Emx, Vax, Hmx, NK6, Msx, Cdx, Xlox, Gsx, En,
HB9, Gbx, Msx-1, Msx-2, GBX2, HLX, HEX, PMX1, DLX, LHX2 and CDX2.
Examples of homeobox gene clusters associated with miR genes in the
human genome include HOXA, HOXB, HOXC, HOXD, extended Hox, NKL,
ParaHox, and EHGbox, PAX, PBX, MEIS, REIG and PREP/KNOX1.
[0067] Examples of cancers associated with homeobox genes or gene
clusters include renal cancer, Wilm's tumor, colorectal cancer,
small cell lung cancer, melanoma, breast cancer, prostate cancer,
skin cancer, osteosarcoma, neuroblastoma, leukemia (acute
lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic
leukemia), glioblastoma multiform, medulloblastoma,
lymphoplasmacytoid lymphoma, thyroid cancer, rhabdomyosarcoma and
solid tumors.
[0068] Examples of miR genes associated with homeobox genes or gene
clusters include miR-148, miR-10a, miR-196-1, miR-152, miR-196-2,
miR-148b, miR-10b, miR-129-1, miR-153-2, miR-202, miR-139, let-7a,
let-7f, let-7d and combinations thereof.
[0069] Specific groupings of miR gene(s) that are associated with
particular homeobox genes or gene cluster are evident from Example
5 and FIG. 2, and are preferred. For example, homeobox gene cluster
HOXA is associated with miR-148. Homeobox gene cluster HOXB is
associated with miR-148, miR-10a, miR-196-1, miR-152 and
combinations thereof. Homeobox gene cluster HOXC is associated with
miR-196-2, miR-148b or a combination thereof. Homeobox gene cluster
HOXD, is associated with miR-10b. Where more than one miR gene is
associated with a homeobox gene or gene cluster, it is understood
that the cancer associated with those genes can be diagnosed by
evaluating any one of the miR genes, or by evaluating any
combination of the miR genes. In one embodiment, the miR gene or
gene product that is measured or analyzed is not miR-15, miR-16,
miR-143 and/or miR-145.
[0070] Without wishing to be bound by any theory, it is believed
that perturbations in the genomic structure or chromosomal
architecture of a cell which comprise the cancer-associated
chromosomal feature can affect the expression of the miR gene(s)
associated with the feature in that cell. For example, a CAGR can
comprise an amplification of the region containing an miR gene(s),
causing an up-regulation of miR gene expression. Likewise, the CAGR
can comprise a chromosomal breakpoint or a deletion that disrupts
gene expression, and results in a down-regulation of miR gene
expression. HPV integrations and FRAs can cause deletions,
amplifications or rearrangement of the surrounding DNA, which can
also affect the structure or expression of any associated miR
genes. The factors which cause the collected dysregulation of
homeobox genes or gene clusters would cause similar disruptions to
any associated miR genes. A change in the status of at least one of
the miR genes associated with a cancer-associated chromosomal
feature in a tissue or cell sample from a subject, relative to the
status of that miR gene in a control sample, therefore is
indicative of the presence of a cancer, or a susceptability to
cancer, in a subject.
[0071] Without wishing to be bound by any theory, it is also
believed that a change in status of miR genes associated with a
cancer-associated chromosomal feature can be detected prior to, or
in the early stages of, the development of transformed or
neoplastic phenotypes in cells of a subject. The invention
therefore also provides a method of screening subjects for a
predisposition to developing a cancer associated with a
cancer-associated chromosomal feature, by evaluating the status of
at least one miR gene associated with a cancer-associated
chromosomal feature in a tissue or cell sample from a subject,
relative to the status of that miR gene in a control sample.
Subjects with a change in the status of one or more miR genes
associated with a cancer-associated chromosomal feature are
candidates for further testing to determine or confirm that the
subjects have cancer. Such further testing can comprise
histological examination of blood or tissue samples, or other
techniques within the skill in the art.
[0072] As used herein, the "status of an miR gene" refers to the
condition of the miR gene in terms of its physical sequence or
structure, or its ability to express a gene product. Thus, the
status of an miR gene in cells of a subject can be evaluated by any
technique suitable for detecting genetic or epigenetic changes in
the miR gene, or by any technique suitable for detecting the level
of miR gene product produced from the miR gene.
[0073] For example, the level of at least one miR gene product
produced from an miR gene can be measured in cells of a biological
sample obtained from the subject. An alteration in the level (i.e.,
an up- or down-regulation) of miR gene product in the sample
obtained from the subject relative to the level of miR gene product
in a control sample is indicative of the presence of the cancer in
the subject. As used herein, a "subject" is any mammal suspected of
having a cancer associated with a cancer-associated chromosomal
feature. In one embodiment, the subject is a human suspected of
having a cancer associated with a cancer-associated chromosomal
feature. As used herein, expression of an miR gene is
"up-regulated" when the amount of miR gene product produced from
that gene in a cell or tissue sample from a subject is greater than
the amount produced from the same gene in a control cell or tissue
sample. Likewise, expression of an miR gene is "down-regulated"
when the amount of miR gene product produced from that gene in a
cell or tissue sample from a subject is less than the amount
produced from the same gene in a control cell or tissue sample.
[0074] Methods for determining RNA expression levels in cells from
a biological sample are within the level of skill in the art. For
example, tissue sample can be removed from a subject suspected of
having cancer associated with a cancer-associated chromosomal
feature by conventional biopsy techniques. In another example, a
blood sample can be removed from the subject, and white blood cells
isolated for DNA extraction by standard techniques. The blood or
tissue sample is preferably obtained from the subject prior to
initiation of radiotherapy, chemotherapy or other therapeutic
treatment. A corresponding control tissue or blood sample can be
obtained from unaffected tissues of the subject, from a normal
human individual or population of normal individuals, or from
cultured cells corresponding to the majority of cells in the
subject's sample. The control tissue or blood sample is then
processed along with the sample from the subject, so that the
levels of miR gene product produced from a given miR gene in cells
from the subject's sample can be compared to the corresponding miR
gene product levels from cells of the control sample.
[0075] For example, the relative miR gene expression in the control
and normal samples can be conveniently determined with respect to
one or more RNA expression standards. The standards can comprise,
for example, a zero miR gene expression level, the miR gene
expression level in a standard cell line, or the average level of
miR gene expression previously obtained for a population of normal
human controls.
[0076] Suitable techniques for determining the level of RNA
transcripts of a particular gene in cells are within the skill in
the art. According to one such method, total cellular RNA can be
purified from cells by homogenization in the presence of nucleic
acid extraction buffer, followed by centrifugation. Nucleic acids
are precipitated, and DNA is removed by treatment with DNase and
precipitation. The RNA molecules are then separated by gel
electrophoresis on agarose gels according to standard techniques,
and transferred to nitrocellulose filters by, e.g., the so-called
"Northern" blotting technique. The RNA is then immobilized on the
filters by heating. Detection and quantification of specific RNA is
accomplished using appropriately labeled DNA or RNA probes
complementary to the RNA in question. See, for example, Molecular
Cloning: A Laboratory Manual, J. Sambrook et al., eds., 2nd
edition, Cold Spring Harbor Laboratory Press, 1989, Chapter 7, the
entire disclosure of which is incorporated by reference.
[0077] Suitable probes for Northern blot hybridization of a given
miR gene product can be produced from the nucleic acid sequences
provided in Table 1. Methods for preparation of labeled DNA and RNA
probes, and the conditions for hybridization thereof to target
nucleotide sequences, are described in Molecular Cloning: A
Laboratory Manual, J. Sambrook et al., eds., 2nd edition, Cold
Spring Harbor Laboratory Press, 1989, Chapters 10 and 11, the
disclosures of which are herein incorporated by reference.
[0078] For example, the nucleic acid probe can be labeled with,
e.g., a radionuclide such as .sup.3H, .sup.32P, .sup.33P, .sup.14C,
or .sup.35S; a heavy metal; or a ligand capable of functioning as a
specific binding pair member for a labeled ligand (e.g., biotin,
avidin or an antibody), a fluorescent molecule, a chemiluminescent
molecule, an enzyme or the like.
[0079] Probes can be labeled to high specific activity by either
the nick translation method of Rigby et al. (1977), J. Mol. Biol.
113:237-251 or by the random priming method of Fienberg et al.
(1983), Anal. Biochem. 132:6-13, the entire disclosures of which
are herein incorporated by reference. The latter is the method of
choice for synthesizing .sup.32P-labeled probes of high specific
activity from single-stranded DNA or from RNA templates. For
example, by replacing preexisting nucleotides with highly
radioactive nucleotides according to the nick translation method,
it is possible to prepare .sup.32P-labeled nucleic acid probes with
a specific activity well in excess of 10.sup.8 cpm/microgram.
Autoradiographic detection of hybridization can then be performed
by exposing hybridized filters to photographic film. Densitometric
scanning of the photographic films exposed by the hybridized
filters provides an accurate measurement of miR gene transcript
levels. Using another approach, miR gene transcript levels can be
quantified by computerized imaging systems, such the Molecular
Dynamics 400-B 2D Phosphorimager available from Amersham
Biosciences, Piscataway, N.J.
[0080] Where radionuclide labeling of DNA or RNA probes is not
practical, the random-primer method can be used to incorporate an
analogue, for example, the dTTP analogue
5-(N--(N-biotinyl-epsilon-aminocaproyl)-3-aminoallyl)deoxyuridine
triphosphate, into the probe molecule. The biotinylated probe
oligonucleotide can be detected by reaction with biotin-binding
proteins, such as avidin, streptavidin, and antibodies (e.g.,
anti-biotin antibodies) coupled to fluorescent dyes or enzymes that
produce color reactions.
[0081] In addition to Northern and other RNA blotting hybridization
techniques, determining the levels of RNA transcripts can be
accomplished using the technique of in situ hybridization. This
technique requires fewer cells than the Northern blotting
technique, and involves depositing whole cells onto a microscope
cover slip and probing the nucleic acid content of the cell with a
solution containing radioactive or otherwise labeled nucleic acid
(e.g., cDNA or RNA) probes. This technique is particularly
well-suited for analyzing tissue biopsy samples from subjects. The
practice of the in situ hybridization technique is described in
more detail in U.S. Pat. No. 5,427,916, the entire disclosure of
which is incorporated herein by reference. Suitable probes for in
situ hybridization of a given miR gene product can be produced from
the nucleic acid sequences provided in Table 1, as described
above.
[0082] The relative number of miR gene transcripts in cells can
also be determined by reverse transcription of miR gene
transcripts, followed by amplification of the reverse-transcribed
transcripts by polymerase chain reaction (RT-PCR). The levels of
miR gene transcripts can be quantified in comparison with an
internal standard, for example, the level of mRNA from a
"housekeeping" gene present in the same sample. A suitable
"housekeeping" gene for use as an internal standard includes, e.g.,
myosin or glyceraldehyde-3-phosphate dehydrogenase (G3PDH). The
methods for quantitative RT-PCR and variations thereof are within
the skill in the art.
[0083] In some instances, it may be desirable to simultaneously
determine the expression level of a plurality of different of miR
genes in a sample. In certain instances, it may be desirable to
determine the expression level of the transcripts of all known miR
genes correlated with cancer. Assessing cancer-specific expression
levels for hundreds of miR genes is time consuming and requires a
large amount of total RNA (at least 20 .mu.g for each Northern
blot) and autoradiographic techniques that require radioactive
isotopes. To overcome these limitations, an oligo library in
microchip format may be constructed containing a set of probe
oligonucleotides specific for a set of miR genes. In one
embodiment, the oligo library contains probes corresponding to all
known miRs from the human genome. The microchip oligolibrary may be
expanded to include additional miRNAs as they are discovered.
[0084] The microchip is prepared from gene-specific oligonucleotide
probes generated from known miRNAs. According to one embodiment,
the array contains two different oligonucleotide probes for each
miRNA, one containing the active sequence and the other being
specific for the precursor of the miRNA. The array may also contain
controls such as one or more mouse sequences differing from human
orthologs by only a few bases, which can serve as controls for
hybridization stringency conditions. tRNAs from both species may
also be printed on the microchip, providing an internal, relatively
stable positive control for specific hybridization. One or more
appropriate controls for non-specific hybridization may also be
included on the microchip. For this purpose, sequences are selected
based upon the absence of any homology with any known miRNAs.
[0085] The microchip may be fabricated by techniques known in the
art. For example, probe oligonucleotides of an appropriate length,
e.g., 40 nucleotides, are 5'-amine modified at position C6 and
printed using commercially available microarray systems, e.g., the
GeneMachine OmniGrid.TM. 100 Microarrayer and Amersham CodeLink.TM.
activated slides. Labeled cDNA oligomer corresponding to the target
RNAs is prepared by reverse transcribing the target RNA with
labeled primer. Following first strand synthesis, the RNA/DNA
hybrids are denatured to degrade the RNA templates. The labeled
target cDNAs thus prepared are then hybridized to the microarray
chip under hybridizing conditions, e.g. 6.times.SSPE/30% formamide
at 25.degree. C. for 18 hours, followed by washing in
0.75.times.TNT at 37.degree. C. for 40 minutes. At positions on the
array where the immobilized probe DNA recognizes a complementary
target cDNA in the sample, hybridization occurs. The labeled target
cDNA marks the exact position on the array where binding occurs,
allowing automatic detection and quantification. The output
consists of a list of hybridization events, indicating the relative
abundance of specific cDNA sequences, and therefore the relative
abundance of the corresponding complementary miRs, in the patient
sample. According to one embodiment, the labeled cDNA oligomer is a
biotin-labeled cDNA, prepared from a biotin-labeled primer. The
microarray is then processed by direct detection of the
biotin-containing transcripts using, e.g., Streptavidin-Alexa647
conjugate, and scanned utilizing conventional scanning methods.
Images intensities of each spot on the array are proportional to
the abundance of the corresponding miR in the patient sample.
[0086] The use of the array has several advantages for miRNA
expression detection. First, the global expression of several
hundred genes can be identified in a same sample at one time point.
Second, through careful design of the oligonucleotide probes,
expression of both mature and precursor molecules can be
identified. Third, in comparison with Northern blot analysis, the
chip requires a small amount of RNA, and provides reproducible
results using 2.5 .mu.g of total RNA. The relatively limited number
of miRNAs (a few hundred per species) allows the construction of a
common microarray for several species, with distinct
oligonucleotide probes for each. Such a tool would allow for
analysis of trans-species expression for each known miR under
various conditions.
[0087] In addition to use for quantitative expression level assays
of specific miRs, a microchip containing miRNA-specific probe
oligonucleotides corresponding to a substantial portion of the
miRNome, preferably the entire miRNome, may be employed to carry
out miR gene expression profiling, for analysis of miR expression
patterns. Distinct miR signatures may be associated with
established disease markers, or directly with a disease state. As
described hereinafter in Example 11, two distinct clusters of human
B-cell chronic lymphocytic leukemia (CLL) samples are associated
with the presence or the absence of Zap-70 expression, a predictor
of early disease progression. As described in Examples 11 and 12,
two miRNA signatures were associated with the presence of absence
of prognostic markers of disease progression, including Zap-70
expression, mutations in the expressed immunoglobulin
variable-region gene IgV.sub.H and deletions at 13q14. Therefore,
miR gene expression profiles can be used for diagnosing the disease
state of a cancer, such as whether a cancer is malignant or benign,
based on whether or not a given profile is representative of a
cancer that is associated with one or more established adverse
prognostic markers. Prognostic markers that are suitable for this
method include ZAP-70 expression, unmutated IgV.sub.H gene, CD38
expression, deletion at chromosome11q23, loss or mutation of TP53,
and any combination thereof.
[0088] According to the expression profiling method in one
embodiment, total RNA from a sample from a subject suspected of
having a cancer is quantitatively reverse transcribed to provide a
set of labeled target oligodeoxynucleotides complementary to the
RNA in the sample. The target oligodeoxynucleotides are then
hybridized to a microarray comprising miRNA-specific probe
oligonucleotides to provide a hybridization profile for the sample.
The result is a hybridization profile for the sample representing
the expression pattern of miRNA in the sample. The hybridization
profile comprises the signal from the binding of the target
oligodeoxynucleotides from the sample to the miRNA-specific probe
oligonucleotides in the microarray. The profile may be recorded as
the presence or absence of binding (signal vs. zero signal). More
preferably, the profile recorded includes the intensity of the
signal from each hybridization. The profile is compared to the
hybridization profile generated from a normal, i.e., noncancerous,
control sample. An alteration in the signal is indicative of the
presence of the cancer in the subject.
[0089] Other techniques for measuring miR gene expression are also
within the skill in the art, and include various techniques for
measuring rates of RNA transcription and degradation.
[0090] The status of an miR gene in a cell of a subject can also be
evaluated by analyzing at least one miR gene or gene product in the
sample for a deletion, mutation or amplification, wherein detection
of a deletion, mutation or amplification in the miR gene or gene
product relative to the miR gene or gene product in a control
sample is indicative of the presence of the cancer in the subject.
As used herein, a mutation is any alteration in the sequence of a
gene of interest that results from one or more nucleotide changes.
Such changes include, but are not limited to, allelic
polymorphisms, and may affect gene expression and/or function of
the gene product.
[0091] A deletion, mutation or amplification in an miR gene or gene
product can be detected by determining the structure or sequence of
an miR gene or gene product in cells from a biological sample from
a subject suspected of having cancer associated with a
cancer-associated chromosomal feature, and comparing this with the
structure or sequence of a corresponding gene or gene product in
cells from a control sample. Subject and control samples can be
obtained as described herein. Especially suitable candidate miR
genes for this type of analysis include, but are not limited to,
miR-16-1, miR-27b, miR-206, miR-29b-2 and miR-187. As described in
Examples 13 and 14 herein, specific mutations in these five miR
genes have been identified in samples from CLL patients.
[0092] In certain embodiments, the present invention provides
methods for diagnosing whether a subject has, or is at risk for
developing, a cancer, comprising analyzing a miR gene or gene
product in a test sample from the subject, wherein the detection of
a mutation in the miR gene or gene product in the test sample,
relative to a control sample, is indicative of the subject having,
or being at risk for developing, cancer. In one embodiment, the
method comprises analyzing the status of a miR-16-1 gene or gene
product. In a particular embodiment, the method comprises analyzing
the status of a miR-16-1 gene for the presence of a mutation,
wherein the mutation is a C to T nucleotide substitution at +7 base
pairs 3' of the miR-16-1 precursor coding region (see, e.g., SEQ ID
NOS:641 and 642). Suitable cancers to be diagnosed by this method
include CLL, among others. In another embodiment, the method
comprises analyzing the status of a miR-27b gene or gene product.
In a particular embodiment, the method comprises analyzing the
status of a miR-27b gene for the presence of a mutation, wherein
the mutation is a G to A nucleotide substitution at +50 base pairs
3' of the miR-27b precursor coding region (see, e.g., SEQ ID
NOS:645 and 646). Suitable cancers to be diagnosed by this method
include, but are not limited to, CLL, throat cancer, and lung
cancer. In an additional embodiment, the method comprises analyzing
the status of a miR-206 gene or gene product. In a particular
embodiment, the method comprises analyzing the status of a miR-206
gene for the presence of a mutation, wherein the mutation is a G to
T nucleotide substitution at position 49 of the miR-206 precursor
coding region (see, e.g., SEQ ID NOS:657 and 658). In a related
embodiment, the method comprises analyzing the status of a miR-206
gene for the presence of a mutation, wherein the mutation is an A
to T substitution at -116 base pairs 5' of the miR-206 precursor
coding region (see, e.g., SEQ ID NOS:657 and 659). Suitable cancers
to be diagnosed by this method include, but are not limited to, CLL
and other leukemias, esophogeal cancer, prostate cancer and breast
cancer. In yet another embodiment the method comprises analyzing
the status of a miR-29b-2 gene or gene product. In a particular
embodiment, the method comprises analyzing the status of a
miR-29b-2 gene for the presence of a mutation, wherein the mutation
is a G to A nucleotide substitution at +212 base pairs 3' of the
miR-29b-2 precursor coding region (see, e.g., SEQ ID NOS:651 and
652). In a related embodiment, the method comprises analyzing the
status of a miR-206 gene for the presence of a mutation, wherein
the mutation is an A nucleotide insertion at +107 base pairs 3' of
the miR-29b-2 precursor coding region (see, e.g., SEQ ID NOS:651
and 653). Suitable cancers to be diagnosed by this method include,
but are not limited to, CLL and other leukemias, as well as breast
cancer. In a further embodiment, the method comprises analyzing the
status of a miR-187 gene or gene product. In a particular
embodiment, the method comprises analyzing the status of a miR-187
gene for the presence of a mutation, wherein the mutation is a T to
C nucleotide substitution at +73 base pairs 3' of the miR-187
precursor coding region (see, e.g., SEQ ID NOS:654 and 655).
Suitable cancers to be diagnosed by this method include, CLL, among
others.
[0093] Any technique suitable for detecting alterations in the
structure or sequence of genes can be used in the practice of the
present method. For example, the presence of miR gene deletions,
mutations or amplifications can be detected by Southern blot
hybridization of the genomic DNA from a subject, using nucleic acid
probes specific for miR gene sequences.
[0094] Southern blot hybridization techniques are within the skill
in the art. For example, genomic DNA isolated from a subject's
sample can be digested with restriction endonucleases. This
digestion generates restriction fragments of the genomic DNA that
can be separated by electrophoresis, for example, on an agarose
gel. The restriction fragments are then blotted onto a
hybridization membrane (e.g., nitrocellulose or nylon), and
hybridized with labeled probes specific for a given miR gene or
genes. A deletion or mutation of these genes is indicated by an
alteration of the restriction fragment patterns on the
hybridization membrane, as compared to DNA from a control sample
that has been treated identically to the DNA from the subject's
sample. Probe labeling and hybridization conditions suitable for
detecting alterations in gene structure or sequence can be readily
determined by one of ordinary skill in the art. The miR gene
nucleic acid probes for Southern blot hybridization can be designed
based upon the nucleic acid sequences provided in Table 1, as
described herein. Nucleic acid probe hybridization can then be
detected by exposing hybridized filters to photographic film, or by
employing computerized imaging systems, such the Molecular Dynamics
400-B 2D Phosphorimager available from Amersham Biosciences,
Piscataway, N.J.
[0095] Deletions, mutations and/or amplifications of an miR gene
can also be detected by amplifying a fragment of these genes by
polymerase chain reaction (PCR), and analyzing the amplified
fragment by sequencing or by electrophoresis to determine if the
sequence and/or length of the amplified fragment from the subject's
DNA sample is different from that of a control DNA sample. Suitable
reaction and cycling conditions for PCR amplification of DNA
fragments can be readily determined by one of ordinary skill in the
art.
[0096] Deletions of an miR gene can also be identified by detecting
deletions of chromosomal markers that are closely linked to the miR
gene. Mutations in an miR gene can also be detected by the
technique of single strand conformational polymorphism (SSCP), for
example, as described in Orita et al. (1989), Genomics 5:874-879
and Hayashi (1991), PCR Methods and Applic. 1:34-38, the entire
disclosures of which are herein incorporated by reference. The SSCP
technique consists of amplifying a fragment of the gene of interest
by PCR; denaturing the fragment and electrophoresing the two
denatured single strands under non-denaturing conditions. The
single strands assume a complex sequence-dependent intrastrand
secondary structure that affects the strands electrophoretic
mobility.
[0097] The status of an miR gene in cells of a subject can also be
evaluated by measuring the copy number of the at least one miR gene
in the sample, wherein a gene copy number other than two for miR
genes on somatic chromosomes and sex chromosomes in a female, or
other than one for miR genes on sex chromosomes in a male, is
indicative of the presence of the cancer in the subject.
[0098] Any technique suitable for detecting gene copy number can be
used in the practice of the present method, including the Southern
blot and PCR amplification techniques described above. An
alternative method of determining the miR gene copy number in a
sample of tissue relies on the fact that many miR genes or gene
clusters are closely linked to chromosomal markers or other genes.
The loss of a copy of an miR gene in an individual who is
heterozygous at a marker or gene closely linked to the miR gene can
be inferred from the loss of heterozygosity in the closely linked
marker or gene. Methods for determining loss of heterozygosity of
chromosomal markers are within the skill in the art.
[0099] As discussed above, the human miR genes are closely
associated with different classes of chromosomal features that are
themselves associated with cancer. These cancers are likely caused,
in part, by the perturbation in the chromosome or genomic DNA
caused by the cancer-associated chromosomal feature, which can
affect expression of oncogenes or tumor-suppressor genes located
near the site of perturbation. Without wishing to be bound by any
theory, it is believed that the perturbations caused by the
cancer-associated chromosomal features also affect the expression
level of miR genes associated with the feature, and that this also
may also contribute to cancerigenesis. Therefore, a given cancer
can be treated by restoring the level of miR gene expression
associated with that cancer to normal. For example, if the level of
miR gene expression is down-regulated in cancer cells of a subject,
then the cancer can be treated by raising the miR expression level.
Likewise, if the level of miR gene expression is up-regulated in
cancer cells of a subject, then the cancer can be treated by
reducing the miR expression level.
[0100] The cancers associated with different cancer-associated
chromosomal features, and the miR genes associated with these
features, are described above and in Tables 5, 6 and 7 and FIG. 2.
In the practice of the present method, expression the appropriate
miR gene or genes associated with a particular cancer and/or
cancer-associated chromosomal features is altered by the
compositions and methods described herein. As before, specific
groupings of miR gene(s) that are associated with a particular
cancer-associated chromosomal feature and/or cancer are evident
from Tables 5, 6 and 7 and in FIG. 2, and are preferred. In one
embodiment, the method of treatment comprising administering an miR
gene product. In another embodiment, the method of treatment
comprises administering an miR gene product, provided the miR gene
product is not miR-15, miR-16, miR-143 and/or miR-145.
[0101] In one embodiment of the present method, the level of at
least one miR gene product in cancer cells of a subject is first
determined relative to control cells.
[0102] Techniques suitable for determining the relative level of
miR gene product in cells are described above. If miR gene
expression is down-regulated in the cancer cell relative to control
cells, then the cancer cells are treated with an effective amount
of a compound comprising the isolated miR gene product from the miR
gene which is down-regulated. If miR gene expression is
up-regulated in cancer cells relative to control cells, then the
cancer cells are treated with an effective amount of a compound
that inhibits miR gene expression. In one embodiment, the level of
miR gene product in a cancer cell is not determined beforehand, for
example, in those cancers where miR gene expression is known to be
up- or down-regulated.
[0103] Thus, in the practice of the present treatment methods, an
effective amount of at least one isolated miR gene product can be
administered to a subject. As used herein, an "effective amount" of
an isolated miR gene product is an amount sufficient to inhibit
proliferation of a cancer cell in a subject suffering from a cancer
associated with a cancer-associated chromosomal feature. One
skilled in the art can readily determine an effective amount of an
miR gene product to be administered to a given subject, by taking
into account factors such as the size and weight of the subject;
the extent of disease penetration; the age, health and sex of the
subject; the route of administration; and whether the
administration is regional or systemic.
[0104] For example, an effective amount of isolated miR gene
product can be based on the approximate weight of a tumor mass to
be treated. The approximate weight of a tumor mass can be
determined by calculating the approximate volume of the mass,
wherein one cubic centimeter of volume is roughly equivalent to one
gram. An effective amount of the isolated miR gene product based on
the weight of a tumor mass can be at least about 10 micrograms/gram
of tumor mass, and is preferably between about 10-500
micrograms/gram of tumor mass. More preferably, the effective
amount is at least about 60 micrograms/gram of tumor mass.
Particularly preferably, the effective amount is at least about 100
micrograms/gram of tumor mass. It is preferred that an effective
amount based on the weight of the tumor mass be injected directly
into the tumor.
[0105] An effective amount of an isolated miR gene product can also
be based on the approximate or estimated body weight of a subject
to be treated. Preferably, such effective amounts are administered
parenterally or enterally, as described herein. For example, an
effective amount of the isolated miR gene product is administered
to a subject can range from about 5-3000 micrograms/kg of body
weight, and is preferably between about 700-1000 micrograms/kg of
body weight, and is more preferably greater than about 1000
micrograms/kg of body weight.
[0106] One skilled in the art can also readily determine an
appropriate dosage regimen for the administration of an isolated
miR gene product to a given subject. For example, an miR gene
product can be administered to the subject once (e.g., as a single
injection or deposition). Alternatively, an miR gene product can be
administered once or twice daily to a subject for a period of from
about three to about twenty-eight days, more preferably from about
seven to about ten days. In a preferred dosage regimen, an miR gene
product is administered once a day for seven days. Where a dosage
regimen comprises multiple administrations, it is understood that
the effective amount of the miR gene product administered to the
subject can comprise the total amount of gene product administered
over the entire dosage regimen.
[0107] As used herein, an "isolated" miR gene product is one which
is synthesized, or altered or removed from the natural state
through human intervention. For example, an miR gene product
naturally present in a living animal is not "isolated." A synthetic
miR gene product, or an miR gene product partially or completely
separated from the coexisting materials of its natural state, is
"isolated." An isolated miR gene product can exist in substantially
purified form, or can exist in a cell into which the miR gene
product has been delivered. Thus, an miR gene product which is
deliberately delivered to, or expressed in, a cell is considered an
"isolated" miR gene product. An miR gene product produced inside a
cell by from an miR precursor molecule is also considered to be
"isolated" molecule.
[0108] Isolated miR gene products can be obtained using a number of
standard techniques. For example, the miR gene products can be
chemically synthesized or recombinantly produced using methods
known in the art. Preferably, miR gene products are chemically
synthesized using appropriately protected ribonucleoside
phosphoramidites and a conventional DNA/RNA synthesizer. Commercial
suppliers of synthetic RNA molecules or synthesis reagents include,
e.g., Proligo (Hamburg, Germany), Dharmacon Research (Lafayette,
Colo., USA), Pierce Chemical (part of Perbio Science, Rockford,
Ill., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland,
Mass., USA) and Cruachem (Glasgow, UK).
[0109] Alternatively, the miR gene products can be expressed from
recombinant circular or linear DNA plasmids using any suitable
promoter. Suitable promoters for expressing RNA from a plasmid
include, e.g., the U6 or H1 RNA pol III promoter sequences, or the
cytomegalovirus promoters. Selection of other suitable promoters is
within the skill in the art. The recombinant plasmids of the
invention can also comprise inducible or regulatable promoters for
expression of the miR gene products in cancer cells.
[0110] The miR gene products that are expressed from recombinant
plasmids can be isolated from cultured cell expression systems by
standard techniques. The miR gene products which are expressed from
recombinant plasmids can also be delivered to, and expressed
directly in, the cancer cells. The use of recombinant plasmids to
deliver the miR gene products to cancer cells is discussed in more
detail below.
[0111] The miR gene products can be expressed from a separate
recombinant plasmid, or can be expressed from the same recombinant
plasmid. Preferably, the miR gene products are expressed as the RNA
precursor molecules from a single plasmid, and the precursor
molecules are processed into the functional miR gene product by a
suitable processing system, including processing systems extant
within a cancer cell. Other suitable processing systems include,
e.g., the in vitro Drosophila cell lysate system as described in
U.S. published application 2002/0086356 to Tuschl et al. and the E.
coli RNAse III system described in U.S. published patent
application 2004/0014113 to Yang et al., the entire disclosures of
which are herein incorporated by reference.
[0112] Selection of plasmids suitable for expressing the miR gene
products, methods for inserting nucleic acid sequences into the
plasmid to express the gene products, and methods of delivering the
recombinant plasmid to the cells of interest are within the skill
in the art. See, for example, Zeng et al. (2002), Molecular Cell
9:1327-1333; Tuschl (2002), Nat. Biotechnol, 20:446-448;
Brummelkamp et al. (2002), Science 296:550-553; Miyagishi et al.
(2002), Nat. Biotechnol. 20:497-500; Paddison et al. (2002), Genes
Dev. 16:948-958; Lee et al. (2002), Nat. Biotechnol. 20:500-505;
and Paul et al. (2002), Nat. Biotechnol. 20:505-508, the entire
disclosures of which are herein incorporated by reference.
[0113] In one embodiment, a plasmid expressing the miR gene
products comprises a sequence encoding a miR precursor RNA under
the control of the CMV intermediate-early promoter. As used herein,
"under the control" of a promoter means that the nucleic acid
sequences encoding the miR gene product are located 3' of the
promoter, so that the promoter can initiate transcription of the
miR gene product coding sequences.
[0114] The miR gene products can also be expressed from recombinant
viral vectors. It is contemplated that the miR gene products can be
expressed from two separate recombinant viral vectors, or from the
same viral vector. The RNA expressed from the recombinant viral
vectors can either be isolated from cultured cell expression
systems by standard techniques, or can be expressed directly in
cancer cells. The use of recombinant viral vectors to deliver the
miR gene products to cancer cells is discussed in more detail
below.
[0115] The recombinant viral vectors of the invention comprise
sequences encoding the miR gene products and any suitable promoter
for expressing the RNA sequences. Suitable promoters include, for
example, the U6 or H1 RNA pol III promoter sequences, or the
cytomegalovirus promoters. Selection of other suitable promoters is
within the skill in the art. The recombinant viral vectors of the
invention can also comprise inducible or regulatable promoters for
expression of the miR gene products in a cancer cell.
[0116] Any viral vector capable of accepting the coding sequences
for the miR gene products can be used; for example, vectors derived
from adenovirus (AV); adeno-associated virus (AAV); retroviruses
(e.g., lentiviruses (LV), Rhabdoviruses, murine leukemia virus);
herpes virus, and the like. The tropism of the viral vectors can be
modified by pseudotyping the vectors with envelope proteins or
other surface antigens from other viruses, or by substituting
different viral capsid proteins, as appropriate.
[0117] For example, lentiviral vectors of the invention can be
pseudotyped with surface proteins from vesicular stomatitis virus
(VSV), rabies, Ebola, Mokola, and the like. AAV vectors of the
invention can be made to target different cells by engineering the
vectors to express different capsid protein serotypes. For example,
an AAV vector expressing a serotype 2 capsid on a serotype 2 genome
is called AAV 2/2. This serotype 2 capsid gene in the AAV 2/2
vector can be replaced by a serotype 5 capsid gene to produce an
AAV 2/5 vector. Techniques for constructing AAV vectors which
express different capsid protein serotypes are within the skill in
the art; see, e.g., Rabinowitz J. E. et al. (2002), J Virol
76:791-801, the entire disclosure of which is herein incorporated
by reference.
[0118] Selection of recombinant viral vectors suitable for use in
the invention, methods for inserting nucleic acid sequences for
expressing RNA into the vector, methods of delivering the viral
vector to the cells of interest, and recovery of the expressed RNA
products are within the skill in the art. See, for example,
Dornburg (1995), Gene Therap. 2:301-310; Eglitis (1988),
Biotechniques 6:608-614; Miller (1990), Hum. Gene Therap. 1:5-14;
and Anderson (1998), Nature 392:25-30, the entire disclosures of
which are herein incorporated by reference.
[0119] Preferred viral vectors are those derived from AV and AAV. A
suitable AV vector for expressing the miR gene products, a method
for constructing the recombinant AV vector, and a method for
delivering the vector into target cells, are described in Xia et
al. (2002), Nat. Biotech. 20:1006-1010, the entire disclosure of
which is herein incorporated by reference. Suitable AAV vectors for
expressing the miR gene products, methods for constructing the
recombinant AAV vector, and methods for delivering the vectors into
target cells are described in Samulski et al. (1987), J. Virol.
61:3096-3101; Fisher et al. (1996), J. Virol., 70:520-532; Samulski
et al. (1989), J. Virol. 63:3822-3826; U.S. Pat. No. 5,252,479;
U.S. Pat. No. 5,139,941; International Patent Application No. WO
94/13788; and International Patent Application No. WO 93/24641, the
entire disclosures of which are herein incorporated by reference.
Preferably, the miR gene products are expressed from a single
recombinant AAV vector comprising the CMV intermediate early
promoter.
[0120] In one embodiment, a recombinant AAV viral vector of the
invention comprises a nucleic acid sequence encoding an miR
precursor RNA in operable connection with a polyT termination
sequence under the control of a human U6 RNA promoter. As used
herein, "in operable connection with a polyT termination sequence"
means that the nucleic acid sequences encoding the sense or
antisense strands are immediately adjacent to the polyT termination
signal in the 5' direction. During transcription of the miR
sequences from the vector, the polyT termination signals act to
terminate transcription.
[0121] In the practice of the present treatment methods, an
effective amount of at least one compound which inhibits miR gene
expression can also be administered to the subject. As used herein,
"inhibiting miR gene expression" means that the production of miR
gene product from the miR gene in the cancer cell after treatment
is less than the amount produced prior to treatment. One skilled in
the art can readily determine whether miR gene expression has been
inhibited in a cancer cell, using for example the techniques for
determining miR transcript level discussed above for the diagnostic
method.
[0122] As used herein, an "effective amount" of a compound that
inhibits miR gene expression is an amount sufficient to inhibit
proliferation of a cancer cell in a subject suffering from a cancer
associated with a cancer-associated chromosomal feature. One
skilled in the art can readily determine an effective amount of an
miR gene expression-inhibiting compound to be administered to a
given subject, by taking into account factors such as the size and
weight of the subject; the extent of disease penetration; the age,
health and sex of the subject; the route of administration; and
whether the administration is regional or systemic.
[0123] For example, an effective amount of the
expression-inhibiting compound can be based on the approximate
weight of a tumor mass to be treated. The approximate weight of a
tumor mass can be determined by calculating the approximate volume
of the mass, wherein one cubic centimeter of volume is roughly
equivalent to one gram. An effective amount based on the weight of
a tumor mass can be at least about 10 micrograms/gram of tumor
mass, and is preferably between about 10-500 micrograms/gram of
tumor mass. More preferably, the effective amount is at least about
60 micrograms/gram of tumor mass. Particularly preferably, the
effective amount is at least about 100 micrograms/gram of tumor
mass. It is preferred that an effective amount based on the weight
of the tumor mass be injected directly into the tumor.
[0124] An effective amount of a compound that inhibits miR gene
expression can also be based on the approximate or estimated body
weight of a subject to be treated. Preferably, such effective
amounts are administered parenterally or enterally, as described
herein. For example, an effective amount of the
expression-inhibiting compound administered to a subject can range
from about {tilde over (5)}-3000 micrograms/kg of body weight, and
is preferably between about 700-1000 micrograms/kg of body weight,
and is more preferably greater than about 1000 micrograms/kg of
body weight.
[0125] One skilled in the art can also readily determine an
appropriate dosage regimen for administering a compound that
inhibits miR gene expression to a given subject. For example, an
expression-inhibiting compound can be administered to the subject
once (e.g., as a single injection or deposition). Alternatively, an
expression-inhibiting compound can be administered once or twice
daily to a subject for a period of from about three to about
twenty-eight days, more preferably from about seven to about ten
days. In a preferred dosage regimen, an expression-inhibiting
compound is administered once a day for seven days. Where a dosage
regimen comprises multiple administrations, it is understood that
the effective amount of the expression-inhibiting compound
administered to the subject can comprise the total amount of
compound administered over the entire dosage regimen.
[0126] Suitable compounds for inhibiting miR gene expression
include double-stranded RNA (such as short- or small-interfering
RNA or "siRNA"), antisense nucleic acids, and enzymatic RNA
molecules such as ribozymes. Each of these compounds can be
targeted to a given miR gene product and destroy or induce the
destruction of the target miR gene product.
[0127] For example, expression of a given miR gene can be inhibited
by inducing RNA interference of the miR gene with an isolated
double-stranded RNA ("dsRNA") molecule which has at least 90%, for
example 95%, 98%, 99% or 100%, sequence homology with at least a
portion of the miR gene product. In a preferred embodiment, the
dsRNA molecule is a "short or small interfering RNA" or
"siRNA."
[0128] siRNA useful in the present methods comprise short
double-stranded RNA from about 17 nucleotides to about 29
nucleotides in length, preferably from about 19 to about 25
nucleotides in length. The siRNA comprise a sense RNA strand and a
complementary antisense RNA strand annealed together by standard
Watson-Crick base-pairing interactions (hereinafter "base-paired").
The sense strand comprises a nucleic acid sequence which is
substantially identical to a nucleic acid sequence contained within
the target miR gene product.
[0129] As used herein, a nucleic acid sequence in an siRNA which is
"substantially identical" to a target sequence contained within the
target mRNA is a nucleic acid sequence that is identical to the
target sequence, or that differs from the target sequence by one or
two nucleotides. The sense and antisense strands of the siRNA can
comprise two complementary, single-stranded RNA molecules, or can
comprise a single molecule in which two complementary portions are
base-paired and are covalently linked by a single-stranded
"hairpin" area.
[0130] The siRNA can also be altered RNA that differs from
naturally-occurring RNA by the addition, deletion, substitution
and/or alteration of one or more nucleotides. Such alterations can
include addition of non-nucleotide material, such as to the end(s)
of the siRNA or to one or more internal nucleotides of the siRNA,
or modifications that make the siRNA resistant to nuclease
digestion, or the substitution of one or more nucleotides in the
siRNA with deoxyribonucleotides.
[0131] One or both strands of the siRNA can also comprise a 3'
overhang. As used herein, a "3' overhang" refers to at least one
unpaired nucleotide extending from the 3'-end of a duplexed RNA
strand. Thus, in one embodiment, the siRNA comprises at least one
3' overhang of from 1 to about 6 nucleotides (which includes
ribonucleotides or deoxyribonucleotides) in length, preferably from
1 to about 5 nucleotides in length, more preferably from 1 to about
4 nucleotides in length, and particularly preferably from about 2
to about 4 nucleotides in length. In a preferred embodiment, the 3'
overhang is present on both strands of the siRNA, and is 2
nucleotides in length. For example, each strand of the siRNA can
comprise 3' overhangs of dithymidylic acid ("TT") or diuridylic
acid ("uu").
[0132] The siRNA can be produced chemically or biologically, or can
be expressed from a recombinant plasmid or viral vector, as
described above for the isolated miR gene products. Exemplary
methods for producing and testing dsRNA or siRNA molecules are
described in U.S. published patent application 2002/0173478 to
Gewirtz and in U.S. published patent application 2004/0018176 to
Reich et al., the entire disclosures of which are herein
incorporated by reference.
[0133] Expression of a given miR gene can also be inhibited by an
antisense nucleic acid. As used herein, an "antisense nucleic acid"
refers to a nucleic acid molecule that binds to target RNA by means
of RNA-RNA or RNA-DNA or RNA-peptide nucleic acid interactions,
which alters the activity of the target RNA. Antisense nucleic
acids suitable for use in the present methods are single-stranded
nucleic acids (e.g., RNA, DNA, RNA-DNA chimeras, PNA) that
generally comprise a nucleic acid sequence complementary to a
contiguous nucleic acid sequence in an miR gene product.
Preferably, the antisense nucleic acid comprises a nucleic acid
sequence that is 50-100% complementary, more preferably 75-100%
complementary, and most preferably 95-100% complementary to a
contiguous nucleic acid sequence in an miR gene product. Nucleic
acid sequences for the miR gene products are provided in Table 1.
Without wishing to be bound by any theory, it is believed that the
antisense nucleic acids activate RNase H or some other cellular
nuclease that digests the miR gene product/antisense nucleic acid
duplex.
[0134] Antisense nucleic acids can also contain modifications to
the nucleic acid backbone or to the sugar and base moieties (or
their equivalent) to enhance target specificity, nuclease
resistance, delivery or other properties related to efficacy of the
molecule. Such modifications include cholesterol moieties, duplex
intercalators such as acridine or the inclusion of one or more
nuclease-resistant groups.
[0135] Antisense nucleic acids can be produced chemically or
biologically, or can be expressed from a recombinant plasmid or
viral vector, as described above for the isolated miR gene
products. Exemplary methods for producing and testing are within
the skill in the art; see, e.g., Stein and Cheng (1993), Science
261:1004 and U.S. Pat. No. 5,849,902 to Woolf et al., the entire
disclosures of which are herein incorporated by reference.
[0136] Expression of a given miR gene can also be inhibited by an
enzymatic nucleic acid. As used herein, an "enzymatic nucleic acid"
refers to a nucleic acid comprising a substrate binding region that
has complementarity to a contiguous nucleic acid sequence of an miR
gene product, and which is able to specifically cleave the miR gene
product. Preferably, the enzymatic nucleic acid substrate binding
region is 50-100% complementary, more preferably 75-100%
complementary, and most preferably 95-100% complementary to a
contiguous nucleic acid sequence in an miR gene product. The
enzymatic nucleic acids can also comprise modifications at the
base, sugar, and/or phosphate groups. An exemplary enzymatic
nucleic acid for use in the present methods is a ribozyme.
[0137] The enzymatic nucleic acids can be produced chemically or
biologically, or can be expressed from a recombinant plasmid or
viral vector, as described above for the isolated miR gene
products. Exemplary methods for producing and testing dsRNA or
siRNA molecules are described in Werner and Uhlenbeck (1995), Nucl.
Acids Res. 23:2092-96; Hammann et al. (1999), Antisense and Nucleic
Acid Drug Dev. 9:25-31; and U.S. Pat. No. 4,987,071 to Cech et al,
the entire disclosures of which are herein incorporated by
reference.
[0138] Administration of at least one miR gene product, or at least
one compound for inhibiting miR gene expression, will inhibit the
proliferation of cancer cells in a subject who has a cancer
associated with a cancer-associated chromosomal feature. As used
herein, to "inhibit the proliferation of a cancer cell" means to
kill the cell, or permanently or temporarily arrest or slow the
growth of the cell Inhibition of cancer cell proliferation can be
inferred if the number of such cells in the subject remains
constant or decreases after administration of the miR gene products
or miR gene expression-inhibiting compounds. An inhibition of
cancer cell proliferation can also be inferred if the absolute
number of such cells increases, but the rate of tumor growth
decreases.
[0139] The number of cancer cells in a subject's body can be
determined by direct measurement, or by estimation from the size of
primary or metastatic tumor masses. For example, the number of
cancer cells in a subject can be measured by immunohistological
methods, flow cytometry, or other techniques designed to detect
characteristic surface markers of cancer cells.
[0140] The size of a tumor mass can be ascertained by direct visual
observation, or by diagnostic imaging methods, such as X-ray,
magnetic resonance imaging, ultrasound, and scintigraphy.
Diagnostic imaging methods used to ascertain size of the tumor mass
can be employed with or without contrast agents, as is known in the
art. The size of a tumor mass can also be ascertained by physical
means, such as palpation of the tissue mass or measurement of the
tissue mass with a measuring instrument, such as a caliper.
[0141] The miR gene products or miR gene expression-inhibiting
compounds can be administered to a subject by any means suitable
for delivering these compounds to cancer cells of the subject. For
example, the miR gene products or miR expression inhibiting
compounds can be administered by methods suitable to transfect
cells of the subject with these compounds, or with nucleic acids
comprising sequences encoding these compounds. Preferably, the
cells are transfected with a plasmid or viral vector comprising
sequences encoding at least one miR gene product or miR gene
expression inhibiting compound.
[0142] Transfection methods for eukaryotic cells are well known in
the art, and include, e.g., direct injection of the nucleic acid
into the nucleus or pronucleus of a cell; electroporation; liposome
transfer or transfer mediated by lipophilic materials; receptor
mediated nucleic acid delivery, bioballistic or particle
acceleration; calcium phosphate precipitation, and transfection
mediated by viral vectors.
[0143] For example, cells can be transfected with a liposomal
transfer compound, e.g., DOTAP
(N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium
methylsulfate, Boehringer-Mannheim) or an equivalent, such as
LIPOFECTIN. The amount of nucleic acid used is not critical to the
practice of the invention; acceptable results may be achieved with
0.1-100 micrograms of nucleic acid/10.sup.5 cells. For example, a
ratio of about 0.5 micrograms of plasmid vector in 3 micrograms of
DOTAP per 10.sup.5 cells can be used.
[0144] An miR gene product or miR gene expression inhibiting
compound can also be administered to a subject by any suitable
enteral or parenteral administration route. Suitable enteral
administration routes for the present methods include, e.g., oral,
rectal, or intranasal delivery. Suitable parenteral administration
routes include, e.g., intravascular administration (e.g.,
intravenous bolus injection, intravenous infusion, intra-arterial
bolus injection, intra-arterial infusion and catheter instillation
into the vasculature); peri- and intra-tissue injection (e.g.,
peri-tumoral and intra-tumoral injection, intra-retinal injection,
or subretinal injection); subcutaneous injection or deposition,
including subcutaneous infusion (such as by osmotic pumps); direct
application to the tissue of interest, for example by a catheter or
other placement device (e.g., a retinal pellet or a suppository or
an implant comprising a porous, non-porous, or gelatinous
material); and inhalation. Preferred administration routes are
injection, infusion and direct injection into the tumor.
[0145] In the present methods, an miR gene product or miR gene
expression inhibiting compound can be administered to the subject
either as naked RNA, in combination with a delivery reagent, or as
a nucleic acid (e.g., a recombinant plasmid or viral vector)
comprising sequences that express the miR gene product or
expression inhibiting compound. Suitable delivery reagents include,
e.g, the Minis Transit TKO lipophilic reagent; lipofectin;
lipofectamine; cellfectin; polycations (e.g., polylysine), and
liposomes.
[0146] Recombinant plasmids and viral vectors comprising sequences
that express the miR gene products or miR gene expression
inhibiting compounds, and techniques for delivering such plasmids
and vectors to cancer cells, are discussed above.
[0147] In a preferred embodiment, liposomes are used to deliver an
miR gene product or miR gene expression-inhibiting compound (or
nucleic acids comprising sequences encoding them) to a subject.
Liposomes can also increase the blood half-life of the gene
products or nucleic acids.
[0148] Liposomes suitable for use in the invention can be formed
from standard vesicle-forming lipids, which generally include
neutral or negatively charged phospholipids and a sterol, such as
cholesterol. The selection of lipids is generally guided by
consideration of factors such as the desired liposome size and
half-life of the liposomes in the blood stream. A variety of
methods are known for preparing liposomes, for example, as
described in Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9:467;
and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369,
the entire disclosures of which are herein incorporated by
reference.
[0149] The liposomes for use in the present methods can comprise a
ligand molecule that targets the liposome to cancer cells. Ligands
which bind to receptors prevalent in cancer cells, such as
monoclonal antibodies that bind to tumor cell antigens, are
preferred.
[0150] The liposomes for use in the present methods can also be
modified so as to avoid clearance by the mononuclear macrophage
system ("MMS") and reticuloendothelial system ("RES"). Such
modified liposomes have opsonization-inhibition moieties on the
surface or incorporated into the liposome structure. In a
particularly preferred embodiment, a liposome of the invention can
comprise both opsonization-inhibition moieties and a ligand.
[0151] Opsonization-inhibiting moieties for use in preparing the
liposomes of the invention are typically large hydrophilic polymers
that are bound to the liposome membrane. As used herein, an
opsonization inhibiting moiety is "bound" to a liposome membrane
when it is chemically or physically attached to the membrane, e.g.,
by the intercalation of a lipid-soluble anchor into the membrane
itself, or by binding directly to active groups of membrane lipids.
These opsonization-inhibiting hydrophilic polymers form a
protective surface layer that significantly decreases the uptake of
the liposomes by the MMS and RES; e.g., as described in U.S. Pat.
No. 4,920,016, the entire disclosure of which is herein
incorporated by reference.
[0152] Opsonization inhibiting moieties suitable for modifying
liposomes are preferably water-soluble polymers with a
number-average molecular weight from about 500 to about 40,000
daltons, and more preferably from about 2,000 to about 20,000
daltons. Such polymers include polyethylene glycol (PEG) or
polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG,
and PEG or PPG stearate; synthetic polymers such as polyacrylamide
or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric
polyamidoamines; polyacrylic acids; polyalcohols, e.g.,
polyvinylalcohol and polyxylitol to which carboxylic or amino
groups are chemically linked, as well as gangliosides, such as
ganglioside GM1. Copolymers of PEG, methoxy PEG, or methoxy PPG, or
derivatives thereof, are also suitable. In addition, the
opsonization inhibiting polymer can be a block copolymer of PEG and
either a polyamino acid, polysaccharide, polyamidoamine,
polyethyleneamine, or polynucleotide. The opsonization inhibiting
polymers can also be natural polysaccharides containing amino acids
or carboxylic acids, e.g., galacturonic acid, glucuronic acid,
mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid,
alginic acid, carrageenan; aminated polysaccharides or
oligosaccharides (linear or branched); or carboxylated
polysaccharides or oligosaccharides, e.g., reacted with derivatives
of carbonic acids with resultant linking of carboxylic groups.
Preferably, the opsonization-inhibiting moiety is a PEG, PPG, or
derivatives thereof. Liposomes modified with PEG or PEG-derivatives
are sometimes called "PEGylated liposomes."
[0153] The opsonization inhibiting moiety can be bound to the
liposome membrane by any one of numerous well-known techniques. For
example, an N-hydroxysuccinimide ester of PEG can be bound to a
phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a
membrane. Similarly, a dextran polymer can be derivatized with a
stearylamine lipid-soluble anchor via reductive amination using
Na(CN)BH.sub.3 and a solvent mixture, such as tetrahydrofuran and
water in a 30:12 ratio at 60.degree. C.
[0154] Liposomes modified with opsonization-inhibition moieties
remain in the circulation much longer than unmodified liposomes.
For this reason, such liposomes are sometimes called "stealth"
liposomes. Stealth liposomes are known to accumulate in tissues fed
by porous or "leaky" microvasculature. Thus, tissue characterized
by such microvasculature defects, for example solid tumors, will
efficiently accumulate these liposomes; see Gabizon, et al. (1988),
Proc. Natl. Acad. Sci., USA, 18:6949-53. In addition, the reduced
uptake by the RES lowers the toxicity of stealth liposomes by
preventing significant accumulation of the liposomes in the liver
and spleen. Thus, liposomes that are modified with
opsonization-inhibition moieties are particularly suited to deliver
the miR gene products or miR gene expression inhibition compounds
(or nucleic acids comprising sequences encoding them) to tumor
cells.
[0155] The miR gene products or miR gene expression inhibition
compounds are preferably formulated as pharmaceutical compositions,
sometimes called "medicaments," prior to administering to a
subject, according to techniques known in the art. Pharmaceutical
compositions of the present invention are characterized as being at
least sterile and pyrogen-free. As used herein, "pharmaceutical
formulations" include formulations for human and veterinary use.
Methods for preparing pharmaceutical compositions of the invention
are within the skill in the art, for example as described in
Remington's Pharmaceutical Science, 17th ed., Mack Publishing
Company, Easton, Pa. (1985), the entire disclosure of which is
herein incorporated by reference.
[0156] The present pharmaceutical formulations comprise at least
one miR gene product or miR gene expression inhibition compound (or
at least one nucleic acid comprising sequences encoding them)
(e.g., 0.1 to 90% by weight), or a physiologically acceptable salt
thereof, mixed with a pharmaceutically-acceptable carrier. The
pharmaceutical formulations of the invention can also comprise at
least one miR gene product or miR gene expression inhibition
compound (or at least one nucleic acid comprising sequences
encoding them) which are encapsulated by liposomes and a
pharmaceutically-acceptable carrier. In one embodiment, the
pharmaceutical compositions comprise an miR gene or gene product
that is not miR-15, miR-16, miR-143 and/or miR-145.
[0157] Preferred pharmaceutically-acceptable carriers are water,
buffered water, normal saline, 0.4% saline, 0.3% glycine,
hyaluronic acid and the like.
[0158] In a preferred embodiment, the pharmaceutical compositions
of the invention comprise at least one miR gene product or miR gene
expression inhibition compound (or at least one nucleic acid
comprising sequences encoding them) which is resistant to
degradation by nucleases. One skilled in the art can readily
synthesize nucleic acids which are nuclease resistant, for example
by incorporating one or more ribonucleotides that are modified at
the 2'-position into the miR gene products. Suitable 2'-modified
ribonucleotides include those modified at the 2'-position with
fluoro, amino, alkyl, alkoxy, and O-allyl.
[0159] Pharmaceutical compositions of the invention can also
comprise conventional pharmaceutical excipients and/or additives.
Suitable pharmaceutical excipients include stabilizers,
antioxidants, osmolality adjusting agents, buffers, and pH
adjusting agents. Suitable additives include, e.g., physiologically
bio compatible buffers (e.g., tromethamine hydrochloride),
additions of chelants (such as, for example, DTPA or DTPA-bisamide)
or calcium chelate complexes (such as, for example, calcium DTPA,
CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium
salts (for example, calcium chloride, calcium ascorbate, calcium
gluconate or calcium lactate). Pharmaceutical compositions of the
invention can be packaged for use in liquid form, or can be
lyophilized.
[0160] For solid pharmaceutical compositions of the invention,
conventional nontoxic solid pharmaceutically-acceptable carriers
can be used; for example, pharmaceutical grades of mannitol,
lactose, starch, magnesium stearate, sodium saccharin, talcum,
cellulose, glucose, sucrose, magnesium carbonate, and the like.
[0161] For example, a solid pharmaceutical composition for oral
administration can comprise any of the carriers and excipients
listed above and 10-95%, preferably 25%-75%, of the at least one
miR gene product or miR gene expression inhibition compound (or at
least one nucleic acid comprising sequences encoding them). A
pharmaceutical composition for aerosol (inhalational)
administration can comprise 0.01-20% by weight, preferably 1%-10%
by weight, of the at least one miR gene product or miR gene
expression inhibition compound (or at least one nucleic acid
comprising sequences encoding them) encapsulated in a liposome as
described above, and a propellant. A carrier can also be included
as desired; e.g., lecithin for intranasal delivery.
[0162] The invention will now be illustrated by the following
non-limiting examples.
EXAMPLES
[0163] The following techniques were used in the Examples.
[0164] General Methods:
[0165] The miR gene database
[0166] A set of 187 human miR genes was compiled (see Table 1). The
set comprises 153 miRs identified in the miR Registry (maintained
by the Wellcome Trust Sanger Institute, Cambridge, UK), and 36
other miRs manually curated from published papers (Lim et al.,
2003, Science 299:1540; Lagos-Quintana et al., 2001, Science
294:853-858; Lau et al., 2001, Science 294:858-862; Lee et al.,
2001, Science 294:862-864; Mourelatos et al., 2002, Genes Dev.
16:720-728; Lagos-Quintana et al., 2002, Curr. Biol. 12:735-739;
Dostie et al., 2003, RNA 9:180-186; Houbaviy et al., 2003, Dev.
Cell. 5:351-8) or found in the GenBank database accessed through
the National Center for Biotechnology Information (NCBI) website,
maintained by the National Institutes of Health and the National
Library of Medicine Nineteen new human miRs (approximately 10% of
the miR set) were found based on their homology with cloned miRs
from other species (mainly mouse). For all miRs, the sequence of
the precursor was identified using the M Zucker RNA folding program
and selecting the precursor sequence that gave the best score for
the hairpin structure. The program is available and is maintained
by Michael Zucker of Rensselaer Polytechnic Institute.
TABLE-US-00001 TABLE 1 Human miR Gene Product Sequences SEQ ID Name
Precursor Sequence (5' to 3')* NO. has-let-7a-l-prec
CACTGTGGGATGAGGTAGTAGGTTGTATAGTTTTAGG 1
GTCACACCCACCACTGGGAGATAACTATACAATCTAC TGTCTTTCCTAACGTG
hsa-let-7a-2-prec AGGTTGAGGTAGTAGGTTGTATAGTTTAGAATTACAT 2
CAAGGGAGATAACTGTACAGCCTCCTAGCTTTCCT hsa-let-7a-3-prec
GGGTGAGGTAGTAGGTTGTATAGTTTGGGGCTCTGCC 3
CTGCTATGGGATAACTATACAATCTACTGTCTTTCCT hsa-let-7a-4-prec
GTGACTGCATGCTCCCAGGTTGAGGTAGTAGGTTGTA 4
TAGTTTAGAATTACACAAGGGAGATAACTGTACAGCC
TCCTAGCTTTCCTTGGGTCTTGCACTAAACAAC hsa-let-7b-prec
GGCGGGGTGAGGTAGTAGGTTGTGTGGTTTCAGGGCA 5
GTGATGTTGCCCCTCGGAAGATAACTATACAACCTAC TGCCTTCCCTG hsa-let-7c-prec
GCATCCGGGTTGAGGTAGTAGGTTGTATGGTTTAGAG 6
TTACACCCTGGGAGTTAACTGTACAACCTTCTAGCTTT CCTTGGAGC hsa-let-7d-prec
CCTAGGAAGAGGTAGTAGGTTGCATAGTTTTAGGGCA 7
GGGATTTTGCCCACAAGGAGGTAACTATACGACCTGC TGCCTTTCTTAGG
hsa-let-7d-v1-prec CTAGGAAGAGGTAGTAGTTTGCATAGTTTTAGGGCAA 8
AGATTTTGCCCACAAGTAGTTAGCTATACGACCTGCA GCCTTTTGTAG
hsa-let-7d-v2-prec CTGGCTGAGGTAGTAGTTTGTGCTGTTGGTCGGGTTGT 9
GACATTGCCCGCTGTGGAGATAACTGCGCAAGCTACT GCCTTGCTAG hsa-let-7e-prec
CCCGGGCTGAGGTAGGAGGTTGTATAGTTGAGGAGGA 10
CACCCAAGGAGATCACTATACGGCCTCCTAGCTTTCCC CAGG hsa-let-7f-1-prec
TCAGAGTGAGGTAGTAGATTGTATAGTTGTGGGGTAG 11
TGATTTTACCCTGTTCAGGAGATAACTATACAATCTAT TGCCTTCCCTGA
hsa-let-7f-2-prec CTGTGGGATGAGGTAGTAGATTGTATAGTTGTGGGGT 12
AGTGATTTTACCCTGTTCAGGAGATAACTATACAATCT ATTGCCTTCCCTGA
hsa-let-7f-2-prec CTGTGGGATGAGGTAGTAGATTGTATAGTTTTAGGGT 13
CATACCCCATCTTGGAGATAACTATACAGTCTACTGTC TTTCCCACGG hsa-let-7g-prec
TTGCCTGATTCCAGGCTGAGGTAGTAGTTTGTACAGTT 14
TGAGGGTCTATGATACCACCCGGTACAGGAGATAACT
GTACAGGCCACTGCCTTGCCAGGAACAGCGCGC hsa-let-7i-prec
CTGGCTGAGGTAGTAGTTTGTGCTGTTGGTCGGGTTGT 15
GACATTGCCCGCTGTGGAGATAACTGCGCAAGCTACT GCCTTGCTAG hsa-mir-001b-1-
ACCTACTCAGAGTACATACTTCTTTATGTACCCATATG 16 prec
AACATACAATGCTATGGAATGTAAAGAAGTATGTATT TTTGGTAGGC hsa-mir-001b-1-
CAGCTAACAACTTAGTAATACCTACTCAGAGTACATA 17 prec
CTTCTTTATGTACCCATATGAACATACAATGCTATGGA
ATGTAAAGAAGTATGTATTTTTGGTAGGCAATA hsa-mir-001b-2-
GCCTGCTTGGGAAACATACTTCTTTATATGCCCATATG 18 prec
GACCTGCTAAGCTATGGAATGTAAAGAAGTATGTATC TCAGGCCGGG hsa-mir-001b-
TGGGAAACATACTTCTTTATATGCCCATATGGACCTGC 19 prec
TAAGCTATGGAATGTAAAGAAGTATGTATCTCA hsa-mir-001d-
ACCTACTCAGAGTACATACTTCTTTATGTACCCATATG 20 prec
AACATACAATGCTATGGAATGTAAAGAAGTATGTATT TTTGGTAGGC hsa-mir-007-1
TGGATGTTGGCCTAGTTCTGTGTGGAAGACTAGTGATT 21
TTGTTGTTTTTAGATAACTAAATCGACAACAAATCACA
GTCTGCCATATGGCACAGGCCATGCCTCTACA hsa-mir-007-1-
TTGGATGTTGGCCTAGTTCTGTGTGGAAGACTAGTGAT 22 prec
TTTGTTGTTTTTAGATAACTAAATCGACAACAAATCAC
AGTCTGCCATATGGCACAGGCCATGCCTCTACAG hsa-mir-007-2
CTGGATACAGAGTGGACCGGCTGGCCCCATCTGGAAG 23
ACTAGTGATTTTGTTGTTGTCTTACTGCGCTCAACAAC
AAATCCCAGTCTACCTAATGGTGCCAGCCATCGCA hsa-mir-007-2-
CTGGATACAGAGTGGACCGGCTGGCCCCATCTGGAAG 24 prec
ACTAGTGATTTTGTTGTTGTCTTACTGCGCTCAACAAC
AAATCCCAGTCTACCTAATGGTGCCAGCCATCGCA hsa-mir-007-3
AGATTAGAGTGGCTGTGGTCTAGTGCTGTGTGGAAGA 25
CTAGTGATTTTGTTGTTCTGATGTACTACGACAACAAG
TCACAGCCGGCCTCATAGCGCAGACTCCCTTCGAC hsa-mir-007-3-
AGATTAGAGTGGCTGTGGTCTAGTGCTGTGTGGAAGA 26 prec
CTAGTGATTTTGTTGTTCTGATGTACTACGACAACAAG
TCACAGCCGGCCTCATAGCGCAGACTCCCTTCGAC hsa-mir-009-1
CGGGGTTGGTTGTTATCTTTGGTTATCTAGCTGTATGA 27
GTGGTGTGGAGTCTTCATAAAGCTAGATAACCGAAAG TAAAAATAACCCCA hsa-mir-009-2
GGAAGCGAGTTGTTATCTTTGGTTATCTAGCTGTATGA 28
GTGTATTGGTCTTCATAAAGCTAGATAACCGAAAGTA AAAACTCCTTCA hsa-mir-009-3
GGAGGCCCGTTTCTCTCTTTGGTTATCTAGCTGTATGA 29
GTGCCACAGAGCCGTCATAAAGCTAGATAACCGAAAG TAGAAATGATTCTCA
hsa-mir-010a-prec GATCTGTCTGTCTTCTGTATATACCCTGTAGATCCGAA 30
TTTGTGTAAGGAATTTTGTGGTCACAAATTCGTATCTA
GGGGAATATGTAGTTGACATAAACACTCCGCTCT hsa-mir-010b-
CCAGAGGTTGTAACGTTGTCTATATATACCCTGTAGAA 31 prec
CCGAATTTGTGTGGTATCCGTATAGTCACAGATTCGAT
TCTAGGGGAATATATGGTCGATGCAAAAACTTCA hsa-mir-015a-2-
GCGCGAATGTGTGTTTAAAAAAAATAAAACCTTGGAG 32 prec
TAAAGTAGCAGCACATAATGGTTTGTGGATTTTGAAA
AGGTGCAGGCCATATTGTGCTGCCTCAAAAATAC hsa-mir-015a-prec
CCTTGGAGTAAAGTAGCAGCACATAATGGTTTGTGGA 33
TTTTGAAAAGGTGCAGGCCATATTGTGCTGCCTCAAA AATACAAGG hsa-mir-015b-
CTGTAGCAGCACATCATGGTTTACATGCTACAGTCAA 34 prec
GATGCGAATCATTATTTGCTGCTCTAG hsa-mir-015b-
TTGAGGCCTTAAAGTACTGTAGCAGCACATCATGGTTT 35 prec
ACATGCTACAGTCAAGATGCGAATCATTATTTGCTGCT CTAGAAATTTAAGGAAATTCAT
hsa-mir-016a- GTCAGCAGTGCCTTAGCAGCACGTAAATATTGGCGTT 36 chr13
AAGATTCTAAAATTATCTCCAGTATTAACTGTGCTGCT GAAGTAAGGTTGAC hsa-mir-016b-
GTTCCACTCTAGCAGCACGTAAATATTGGCGTAGTGA 37 chr3
AATATATATTAAACACCAATATTACTGTGCTGCTTTAG TGTGAC hsa-mir-016-prec-
GCAGTGCCTTAGCAGCACGTAAATATTGGCGTTAAGA 38 13
TTCTAAAATTATCTCCAGTATTAACTGTGCTGCTGAAG TAAGGT hsa-mir-017-prec
GTCAGAATAATGTCAAAGTGCTTACAGTGCAGGTAGT 39
GATATGTGCATCTACTGCAGTGAAGGCACTTGTAGCA TTATGGTGAC hsa-mir-018-prec
TGTTCTAAGGTGCATCTAGTGCAGATAGTGAAGTAGA 40
TTAGCATCTACTGCCCTAAGTGCTCCTTCTGGCA hsa-mir-018-prec-
TTTTTGTTCTAAGGTGCATCTAGTGCAGATAGTGAAGT 41 13
AGATTAGCATCTACTGCCCTAAGTGCTCCTTCTGGCAT AAGAA hsa-mir-019a-prec
GCAGTCCTCTGTTAGTTTTGCATAGTTGCACTACAAGA 42
AGAATGTAGTTGTGCAAATCTATGCAAAACTGATGGT GGCCTGC hsa-mir-019a-
CAGTCCTCTGTTAGTTTTGCATAGTTGCACTACAAGAA 43 prec-13
GAATGTAGTTGTGCAAATCTATGCAAAACTGATGGTG GCCTG hsa-mir-019b-1-
CACTGTTCTATGGTTAGTTTTGCAGGTTTGCATCCAGC 44 prec
TGTGTGATATTCTGCTGTGCAAATCCATGCAAAACTGA CTGTGGTAGTG hsa-mir-019b-2-
ACATTGCTACTTACAATTAGTTTTGCAGGTTTGCATTT 45 prec
CAGCGTATATATGTATATGTGGCTGTGCAAATCCATGC AAAACTGATTGTGATAATGT
hsa-mir-019b- TTCTATGGTTAGTTTTGCAGGTTTGCATCCAGCTGTGT 46 prec-13
GATATTCTGCTGTGCAAATCCATGCAAAACTGACTGT GGTAG hsa-mir-019b-
TTACAATTAGTTTTGCAGGTTTGCATTTCAGCGTATAT 47 prec-X
ATGTATATGTGGCTGTGCAAATCCATGCAAAACTGAT TGTGAT hsa-mir-020-prec
GTAGCACTAAAGTGCTTATAGTGCAGGTAGTGTTTAG 48
TTATCTACTGCATTATGAGCACTTAAAGTACTGC hsa-mir-021-prec
TGTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAAT 49
CTCATGGCAACACCAGTCGATGGGCTGTCTGACA hsa-mir-021-prec-
ACCTTGTCGGGTAGCTTATCAGACTGATGTTGACTGTT 50 17
GAATCTCATGGCAACACCAGTCGATGGGCTGTCTGAC ATTTTG hsa-mir-022-prec
GGCTGAGCCGCAGTAGTTCTTCAGTGGCAAGCTTTAT 51
GTCCTGACCCAGCTAAAGCTGCCAGTTGAAGAACTGT TGCCCTCTGCC hsa-mir-023a-prec
GGCCGGCTGGGGTTCCTGGGGATGGGATTTGCTTCCT 52
GTCACAAATCACATTGCCAGGGATTTCCAACCGACC hsa-mir-023b-
CTCAGGTGCTCTGGCTGCTTGGGTTCCTGGCATGCTGA 53 prec
TTTGTGACTTAAGATTAAAATCACATTGCCAGGGATTA CCACGCAACCACGACCTTGGC
hsa-mir-023-prec- CCACGGCCGGCTGGGGTTCCTGGGGATGGGATTTGCT 54 19
TCCTGTCACAAATCACATTGCCAGGGATTTCCAACCG ACCCTGA hsa-mir-024-1-
CTCCGGTGCCTACTGAGCTGATATCAGTTCTCATTTTA 55 prec
CACACTGGCTCAGTTCAGCAGGAACAGGAG hsa-mir-024-2-
CTCTGCCTCCCGTGCCTACTGAGCTGAAACACAGTTGG 56 prec
TTTGTGTACACTGGCTCAGTTCAGCAGGAACAGGG hsa-mir-024-prec-
CCCTGGGCTCTGCCTCCCGTGCCTACTGAGCTGAAACA 57 19
CAGTTGGTTTGTGTACACTGGCTCAGTTCAGCAGGAA CAGGGG hsa-mir-024-prec-
CCCTCCGGTGCCTACTGAGCTGATATCAGTTCTCATTT 58 9
TACACACTGGCTCAGTTCAGCAGGAACAGCATC hsa-mir-025-prec
GGCCAGTGTTGAGAGGCGGAGACTTGGGCAATTGCTG 59
GACGCTGCCCTGGGCATTGCACTTGTCTCGGTCTGACA GTGCCGGCC hsa-mir-026a-prec
AGGCCGTGGCCTCGTTCAAGTAATCCAGGATAGGCTG 60
TGCAGGTCCCAATGGCCTATCTTGGTTACTTGCACGGG GACGCGGGCCT hsa-mir-026b-
CCGGGACCCAGTTCAAGTAATTCAGGATAGGTTGTGT 61 prec
GCTGTCCAGCCTGTTCTCCATTACTTGGCTCGGGGACC GG hsa-mir-027a-prec
CTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAGGGTCC 62
ACACCAAGTCGTGTTCACAGTGGCTAAGTTCCGCCCC CCAG hsa-mir-027b-
AGGTGCAGAGCTTAGCTGATTGGTGAACAGTGATTGG 63 prec
TTTCCGCTTTGTTCACAGTGGCTAAGTTCTGCACCT hsa-mir-027b-
ACCTCTCTAACAAGGTGCAGAGCTTAGCTGATTGGTG 64 prec
AACAGTGATTGGTTTCCGCTTTGTTCACAGTGGCTAAG TTCTGCACCTGAAGAGAAGGTG
hsa-mir-027-prec- CCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAGGGTC 65 19
CACACCAAGTCGTGTTCACAGTGGCTAAGTTCCGCCC CCCAGG hsa-mir-028-prec
GGTCCTTGCCCTCAAGGAGCTCACAGTCTATTGAGTTA 66
CCTTTCTGACTTTCCCACTAGATTGTGAGCTCCTGGAG GGCAGGCACT hsa-mir-029a-2
CCTTCTGTGACCCCTTAGAGGATGACTGATTTCTTTTG 67
GTGTTCAGAGTCAATATAATTTTCTAGCACCATCTGAA
ATCGGTTATAATGATTGGGGAAGAGCACCATG hsa-mir-029a-prec
ATGACTGATTTCTTTTGGTGTTCAGAGTCAATATAATT 68
TTCTAGCACCATCTGAAATCGGTTAT hsa-mir-029c-prec
ACCACTGGCCCATCTCTTACACAGGCTGACCGATTTCT 69
CCTGGTGTTCAGAGTCTGTTTTTGTCTAGCACCATTTG
AAATCGGTTATGATGTAGGGGGAAAAGCAGCAGC hsa-mir-030a-prec
GCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCC 70
ACAGATGGGCTTTCAGTCGGATGTTTGCAGCTGC hsa-mir-030b-
ATGTAAACATCCTACACTCAGCTGTAATACATGGATT 71 prec
GGCTGGGAGGTGGATGTTTACGT hsa-mir-030b-
ACCAAGTTTCAGTTCATGTAAACATCCTACACTCAGCT 72 prec
GTAATACATGGATTGGCTGGGAGGTGGATGTTTACTT CAGCTGACTTGGA
hsa-mir-030c-prec AGATACTGTAAACATCCTACACTCTCAGCTGTGGAAA 73
GTAAGAAAGCTGGGAGAAGGCTGTTTACTCTTTCT hsa-mir-030d-
GTTGTTGTAAACATCCCCGACTGGAAGCTGTAAGACA 74 prec
CAGCTAAGCTTTCAGTCAGATGTTTGCTGCTAC hsa-mir-031-prec
GGAGAGGAGGCAAGATGCTGGCATAGCTGTTGAACTG 75
GGAACCTGCTATGCCAACATATTGCCATCTTTCC hsa-mir-032-prec
GGAGATATTGCACATTACTAAGTTGCATGTTGTCACG 76
GCCTCAATGCAATTTAGTGTGTGTGATATTTTC hsa-mir-033b-
GGGGGCCGAGAGAGGCGGGCGGCCCCGCGGTGCATT 77 prec
GCTGTTGCATTGCACGTGTGTGAGGCGGGTGCAGTGC
CTCGGCAGTGCAGCCCGGAGCCGGCCCCTGGCACCAC hsa-mir-033-prec
CTGTGGTGCATTGTAGTTGCATTGCATGTTCTGGTGGT 78
ACCCATGCAATGTTTCCACAGTGCATCACAG hsa-mir-034-prec
GGCCAGCTGTGAGTGTTTCTTTGGCAGTGTCTTAGCTG 79
GTTGTTGTGAGCAATAGTAAGGAAGCAATCAGCAAGT
ATACTGCCCTAGAAGTGCTGCACGTTGTGGGGCCC hsa-mir-091-prec-
TCAGAATAATGTCAAAGTGCTTACAGTGCAGGTAGTG 80 13
ATATGTGCATCTACTGCAGTGAAGGCACTTGTAGCATT ATGGTGA hsa-mir-092-prec-
CTTTCTACACAGGTTGGGATCGGTTGCAATGCTGTGTT 81 13 = 092-1
TCTGTATGGTATTGCACTTGTCCCGGCCTGTTGAGTTT GG hsa-mir-092-prec-
TCATCCCTGGGTGGGGATTTGTTGCATTACTTGTGTTC 82 X = 092-2
TATATAAAGTATTGCACTTGTCCCGGCCTGTGGAAGA hsa-mir-093-prec-
CTGGGGGCTCCAAAGTGCTGTTCGTGCAGGTAGTGTG 83 7.1 = 093-1
ATTACCCAACCTACTGCTGAGCTAGCACTTCCCGAGCC CCCGG hsa-mir-093-prec-
CTGGGGGCTCCAAAGTGCTGTTCGTGCAGGTAGTGTG 84 7.2 = 093-2
ATTACCCAACCTACTGCTGAGCTAGCACTTCCCGAGCC CCCGG hsa-mir-095-prec-
AACACAGTGGGCACTCAATAAATGTCTGTTGAATTGA 85 4
AATGCGTTACATTCAACGGGTATTTATTGAGCACCCAC TCTGTG hsa-mir-096-prec-
TGGCCGATTTTGGCACTAGCACATTTTTGCTTGTGTCT 86 7
CTCCGCTCTGAGCAATCATGTGCAGTGCCAATATGGG AAA hsa-mir-098-prec-
GTGAGGTAGTAAGTTGTATTGTTGTGGGGTAGGGATA 87 X
TTAGGCCCCAATTAGAAGATAACTATACAACTTACTA CTTTCC hsa-mir-099b-
GGCACCCACCCGTAGAACCGACCTTGCGGGGCCTTCG 88 prec-19
CCGCACACAAGCTCGTGTCTGTGGGTCCGTGTC hsa-mir-099-prec-
CCCATTGGCATAAACCCGTAGATCCGATCTTGTGGTG 89 21
AAGTGGACCGCACAAGCTCGCTTCTATGGGTCTGTGT CAGTGTG hsa-mir-100-1/2-
AAGAGAGAAGATATTGAGGCCTGTTGCCACAAACCCG 90 prec
TAGATCCGAACTTGTGGTATTAGTCCGCACAAGCTTGT
ATCTATAGGTATGTGTCTGTTAGGCAATCTCAC hsa-mir-100-prec-
CCTGTTGCCACAAACCCGTAGATCCGAACTTGTGGTAT 91 11
TAGTCCGCACAAGCTTGTATCTATAGGTATGTGTCTGT TAGG hsa-mir-101-1/2-
AGGCTGCCCTGGCTCAGTTATCACAGTGCTGATGCTGT 92 prec
CTATTCTAAAGGTACAGTACTGTGATAACTGAAGGAT
GGCAGCCATCTTACCTTCCATCAGAGGAGCCTCAC hsa-mir-101-prec
TCAGTTATCACAGTGCTGATGCTGTCCATTCTAAAGGT 93 ACAGTACTGTGATAACTGA
hsa-mir-101-prec- TGCCCTGGCTCAGTTATCACAGTGCTGATGCTGTCTAT 94 1
TCTAAAGGTACAGTACTGTGATAACTGAAGGATGGCA hsa-mir-101-prec-
TGTCCTTTTTCGGTTATCATGGTACCGATGCTGTATAT 95 9
CTGAAAGGTACAGTACTGTGATAACTGAAGAATGGTG hsa-mir-102-prec-
CTTCTGGAAGCTGGTTTCACATGGTGGCTTAGATTTTT 96 1
CCATCTTTGTATCTAGCACCATTTGAAATCAGTGTTTT AGGAG hsa-mir-102-prec-
CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAA 97 7.1
ATAGTGATTGTCTAGCACCATTTGAAATCAGTGTTCTT GGGGG hsa-mir-102-prec-
CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAA 98 7.2
ATAGTGATTGTCTAGCACCATTTGAAATCAGTGTTCTT GGGGG hsa-mir-103-2-
TTGTGCTTTCAGCTTCTTTACAGTGCTGCCTTGTAGCA 99 prec
TTCAGGTCAAGCAACATTGTACAGGGCTATGAAAGAA CCA hsa-mir-103-prec-
TTGTGCTTTCAGCTTCTTTACAGTGCTGCCTTGTAGCA 100 20
TTCAGGTCAAGCAACATTGTACAGGGCTATGAAAGAA CCA hsa-mir-103-prec-
TACTGCCCTCGGCTTCTTTACAGTGCTGCCTTGTTGCA 101 5 = 103-1
TATGGATCAAGCAGCATTGTACAGGGCTATGAAGGCA TTG hsa-mir-104-prec-
AAATGTCAGACAGCCCATCGACTGGTGTTGCCATGAG 102 17
ATTCAACAGTCAACATCAGTCTGATAAGCTACCCGAC AAGG hsa-mir-105-prec-
TGTGCATCGTGGTCAAATGCTCAGACTCCTGTGGTGGC 103 X.1 = 105-1
TGCTCATGCACCACGGATGTTTGAGCATGTGCTACGGT GTCTA hsa-mir-105-prec-
TGTGCATCGTGGTCAAATGCTCAGACTCCTGTGGTGGC 104 X.2 = 105-2
TGCTCATGCACCACGGATGTTTGAGCATGTGCTACGGT GTCTA hsa-mir-106-prec-
CCTTGGCCATGTAAAAGTGCTTACAGTGCAGGTAGCT 105 X
TTTTGAGATCTACTGCAATGTAAGCACTTCTTACATTA CCATGG hsa-mir-107-prec-
CTCTCTGCTTTCAGCTTCTTTACAGTGTTGCCTTGTGGC 106 10
ATGGAGTTCAAGCAGCATTGTACAGGGCTATCAAAGC ACAGA hsa-mir-122a-prec
CCTTAGCAGAGCTGTGGAGTGTGACAATGGTGTTTGT 107
GTCTAAACTATCAAACGCCATTATCACACTAAATAGC TACTGCTAGGC hsa-mir-122a-prec
AGCTGTGGAGTGTGACAATGGTGTTTGTGTCCAAACT 108
ATCAAACGCCATTATCACACTAAATAGCT hsa-mir-123-prec
ACATTATTACTTTTGGTACGCGCTGTGACACTTCAAAC 109 TCGTACCGTGAGTAATAATGCGC
hsa-mir-124a-1- tccttcctCAGGAGAAAGGCCTCTCTCTCCGTGTTCACAGC 110 prec
GGACCTTGATTTAAATGTCCATACAATTAAGGCACGC GGTGAATGCCAAGAATGGGGCT
hsa-mir-124a-1- AGGCCTCTCTCTCCGTGTTCACAGCGGACCTTGATTTA 111 prec
AATGTCCATACAATTAAGGCACGCGGTGAATGCCAAG AATGGGGCTG hsa-mir-124a-2-
ATCAAGATTAGAGGCTCTGCTCTCCGTGTTCACAGCG 112 prec
GACCTTGATTTAATGTCATACAATTAAGGCACGCGGT
GAATGCCAAGAGCGGAGCCTACGGCTGCACTTGAAG hsa-mir-124a-3-
CCCGCCCCAGCCCTGAGGGCCCCTCTGCGTGTTCACA 113 prec
GCGGACCTTGATTTAATGTCTATACAATTAAGGCACG
CGGTGAATGCCAAGAGAGGCGCCTCCGCCGCTCCTT hsa-mir-124a-3-
TGAGGGCCCCTCTGCGTGTTCACAGCGGACCTTGATTT 114 prec
AATGTCTATACAATTAAGGCACGCGGTGAATGCCAAG AGAGGCGCCTCC
hsa-mir-124a-prec CTCTGCGTGTTCACAGCGGACCTTGATTTAATGTCTAT 115
ACAATTAAGGCACGCGGTGAATGCCAAGAG hsa-mir-124b-
CTCTCCGTGTTCACAGCGGACCTTGATTTAATGTCATA 116 prec
CAATTAAGGCACGCGGTGAATGCCAAGAG hsa-mir-125a-prec
TGCCAGTCTCTAGGTCCCTGAGACCCTTTAACCTGTGA 117
GGACATCCAGGGTCACAGGTGAGGTTCTTGGGAGCCT GGCGTCTGGCC hsa-mir-125a-prec
GGTCCCTGAGACCCTTTAACCTGTGAGGACATCCAGG 118
GTCACAGGTGAGGTTCTTGGGAGCCTGG hsa-mir-125b-1
ACATTGTTGCGCTCCTCTCAGTCCCTGAGACCCTAACT 119
TGTGATGTTTACCGTTTAAATCCACGGGTTAGGCTCTT
GGGAGCTGCGAGTCGTGCTTTTGCATCCTGGA hsa-mir-125b-1
TGCGCTCCTCTCAGTCCCTGAGACCCTAACTTGTGATG 120
TTTACCGTTTAAATCCACGGGTTAGGCTCTTGGGAGCT GCGAGTCGTGCT hsa-mir-125b-2-
ACCAGACTTTTCCTAGTCCCTGAGACCCTAACTTGTGA 121 prec
GGTATTTTAGTAACATCACAAGTCAGGCTCTTGGGAC CTAGGCGGAGGGGA
hsa-mir-125b-2- CCTAGTCCCTGAGACCCTAACTTGTGAGGTATTTTAGT 122 prec
AACATCACAAGTCAGGCTCTTGGGACCTAGGC hsa-mir-126-prec
CGCTGGCGACGGGACATTATTACTTTTGGTACGCGCTG 123
TGACACTTCAAACTCGTACCGTGAGTAATAATGCGCC GTCCACGGCA hsa-mir-126-prec
ACATTATTACTTTTGGTACGCGCTGTGACACTTCAAAC 124 TCGTACCGTGAGTAATAATGCGC
hsa-mir-127-prec TGTGATCACTGTCTCCAGCCTGCTGAAGCTCAGAGGG 125
CTCTGATTCAGAAAGATCATCGGATCCGTCTGAGCTTG GCTGGTCGGAAGTCTCATCATC
hsa-mir-127-prec CCAGCCTGCTGAAGCTCAGAGGGCTCTGATTCAGAAA 126
GATCATCGGATCCGTCTGAGCTTGGCTGGTCGG hsa-mir-128a-prec
TGAGCTGTTGGATTCGGGGCCGTAGCACTGTCTGAGA 127
GGTTTACATTTCTCACAGTGAACCGGTCTCTTTTTCAG CTGCTTC hsa-mir-128b-
GCCCGGCAGCCACTGTGCAGTGGGAAGGGGGGCCGAT 128 prec
ACACTGTACGAGAGTGAGTAGCAGGTCTCACAGTGAA
CCGGTCTCTTTCCCTACTGTGTCACACTCCTAATGG hsa-mir-128-prec
GTTGGATTCGGGGCCGTAGCACTGTCTGAGAGGTTTA 129
CATTTCTCACAGTGAACCGGTCTCTTTTTCAGC hsa-mir-129-prec
TGGATCTTTTTGCGGTCTGGGCTTGCTGTTCCTCTCAA 130
CAGTAGTCAGGAAGCCCTTACCCCAAAAAGTATCTA hsa-mir-130a-prec
TGCTGCTGGCCAGAGCTCTTTTCACATTGTGCTACTGT 131
CTGCACCTGTCACTAGCAGTGCAATGTTAAAAGGGCA TTGGCCGTGTAGTG hsa-mir-131-1-
gccaggaggcggGGTTGGTTGTTATCTTTGGTTATCTAGCTG 132 prec
TATGAGTGGTGTGGAGTCTTCATAAAGCTAGATAACC
GAAAGTAAAAATAACCCCATACACTGCGCAG hsa-mir-131-3-
CACGGCGCGGCAGCGGCACTGGCTAAGGGAGGCCCGT 133 prec
TTCTCTCTTTGGTTATCTAGCTGTATGAGTGCCACAGA
GCCGTCATAAAGCTAgataaccgaaagtagaaatg hsa-mir-131-prec
GTTGTTATCTTTGGTTATCTAGCTGTATGAGTGTATTG 134
GTCTTCATAAAGCTAGATAACCGAAAGTAAAAAC hsa-mir-132-prec
CCGCCCCCGCGTCTCCAGGGCAACCGTGGCTTTCGATT 135
GTTACTGTGGGAACTGGAGGTAACAGTCTACAGCCAT GGTCGCCCCGCAGCACGCCCACGCGC
hsa-mir-132-prec GGGCAACCGTGGCTTTCGATTGTTACTGTGGGAACTG 136
GAGGTAACAGTCTACAGCCATGGTCGCCC hsa-mir-133a-1
ACAATGCTTTGCTAGAGCTGGTAAAATGGAACCAAAT 137
CGCCTCTTCAATGGATTTGGTCCCCTTCAACCAGCTGT AGCTATGCATTGA hsa-mir-133a-2
GGGAGCCAAATGCTTTGCTAGAGCTGGTAAAATGGAA 138
CCAAATCGACTGTCCAATGGATTTGGTCCCCTTCAACC AGCTGTAGCTGTGCATTGATGGCGCCG
hsa-mir-133-prec GCTAGAGCTGGTAAAATGGAACCAAATCGCCTCTTCA 139
ATGGATTTGGTCCCCTTCAACCAGCTGTAGC hsa-mir-134-prec
CAGGGTGTGTGACTGGTTGACCAGAGGGGCATGCACT 140
GTGTTCACCCTGTGGGCCACCTAGTCACCAACCCTC hsa-mir-134-prec
AGGGTGTGTGACTGGTTGACCAGAGGGGCATGCACTG 141
TGTTCACCCTGTGGGCCACCTAGTCACCAACCCT hsa-mir-135-1-
AGGCCTCGCTGTTCTCTATGGCTTTTTATTCCTATGTG 142 prec
ATTCTACTGCTCACTCATATAGGGATTGGAGCCGTGGC GCACGGCGGGGACA
hsa-mir-135-2- AGATAAATTCACTCTAGTGCTTTATGGCTTTTTATTCC 143 prec
TATGTGATAGTAATAAAGTCTCATGTAGGGATGGAAG CCATGAAATACATTGTGAAAAATCA
hsa-mir-135-prec CTATGGCTTTTTATTCCTATGTGATTCTACTGCTCACTC 144
ATATAGGGATTGGAGCCGTGG hsa-mir-136-prec
TGAGCCCTCGGAGGACTCCATTTGTTTTGATGATGGAT 145
TCTTATGCTCCATCATCGTCTCAAATGAGTCTTCAGAG GGTTCT hsa-mir-136-prec
GAGGACTCCATTTGTTTTGATGATGGATTCTTATGCTC 146 CATCATCGTCTCAAATGAGTCTTC
hsa-mir-137-prec CTTCGGTGACGGGTATTCTTGGGTGGATAATACGGATT 147
ACGTTGTTATTGCTTAAGAATACGCGTAGTCGAGG hsa-mir-138-1-
CCCTGGCATGGTGTGGTGGGGCAGCTGGTGTTGTGAA 148 prec
TCAGGCCGTTGCCAATCAGAGAACGGCTACTTCACAA CACCAGGGCCACACCACACTACAGG
hsa-mir-138-2- CGTTGCTGCAGCTGGTGTTGTGAATCAGGCCGACGAG 149 prec
CAGCGCATCCTCTTACCCGGCTATTTCACGACACCAGG GTTGCATCA hsa-mir-138-prec
CAGCTGGTGTTGTGAATCAGGCCGACGAGCAGCGCAT 150
CCTCTTACCCGGCTATTTCACGACACCAGGGTTG hsa-mir-139-prec
GTGTATTCTACAGTGCACGTGTCTCCAGTGTGGCTCGG 151
AGGCTGGAGACGCGGCCCTGTTGGAGTAAC hsa-mir-140
TGTGTCTCTCTCTGTGTCCTGCCAGTGGTTTTACCCTAT 152
GGTAGGTTACGTCATGCTGTTCTACCACAGGGTAGAA CCACGGACAGGATACCGGGGCACC
hsa-mir-140as- TCCTGCCAGTGGTTTTACCCTATGGTAGGTTACGTCAT 153 prec
GCTGTTCTACCACAGGGTAGAACCACGGACAGGA hsa-mir-140s-prec
CCTGCCAGTGGTTTTACCCTATGGTAGGTTACGTCATG 154
CTGTTCTACCACAGGGTAGAACCACGGACAGG hsa-mir-141-prec
CGGCCGGCCCTGGGTCCATCTTCCAGTACAGTGTTGG 155
ATGGTCTAATTGTGAAGCTCCTAACACTGTCTGGTAAA GATGGCTCCCGGGTGGGTTC
hsa-mir-141-prec GGGTCCATCTTCCAGTACAGTGTTGGATGGTCTAATTG 156
TGAAGCTCCTAACACTGTCTGGTAAAGATGGCCC hsa-mir-142as-
ACCCATAAAGTAGAAAGCACTACTAACAGCACTGGAG 157 prec
GGTGTAGTGTTTCCTACTTTATGGATG hsa-mir-142-prec
GACAGTGCAGTCACCCATAAAGTAGAAAGCACTACTA 158
ACAGCACTGGAGGGTGTAGTGTTTCCTACTTTATGGAT GAGTGTACTGTG
hsa-mir-142s-pres ACCCATAAAGTAGAAAGCACTACTAACAGCACTGGAG 159
GGTGTAGTGTTTCCTACTTTATGGATG hsa-mir-143-prec
GCGCAGCGCCCTGTCTCCCAGCCTGAGGTGCAGTGCT 160
GCATCTCTGGTCAGTTGGGAGTCTGAGATGAAGCACT
GTAGCTCAGGAAGAGAGAAGTTGTTCTGCAGC hsa-mir-143-prec
CCTGAGGTGCAGTGCTGCATCTCTGGTCAGTTGGGAG 161
TCTGAGATGAAGCACTGTAGCTCAGG hsa-mir-144-prec
TGGGGCCCTGGCTGGGATATCATCATATACTGTAAGTT 162
TGCGATGAGACACTACAGTATAGATGATGTACTAGTC CGGGCACCCCC hsa-mir-144-prec
GGCTGGGATATCATCATATACTGTAAGTTTGCGATGA 163
GACACTACAGTATAGATGATGTACTAGTC hsa-mir-145-prec
CACCTTGTCCTCACGGTCCAGTTTTCCCAGGAATCCCT 164
TAGATGCTAAGATGGGGATTCCTGGAAATACTGTTCTT GAGGTCATGGTT
hsa-mir-145-prec CTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTA 165
AGATGGGGATTCCTGGAAATACTGTTCTTGAG hsa-mir-146-prec
CCGATGTGTATCCTCAGCTTTGAGAACTGAATTCCATG 166
GGTTGTGTCAGTGTCAGACCTCTGAAATTCAGTTCTTC AGCTGGGATATCTCTGTCATCGT
hsa-mir-146-prec AGCTTTGAGAACTGAATTCCATGGGTTGTGTCAGTGTC 167
AGACCTGTGAAATTCAGTTCTTCAGCT hsa-mir-147-prec
AATCTAAAGACAACATTTCTGCACACACACCAGACTA 168
TGGAAGCCAGTGTGTGGAAATGCTTCTGCTAGATT hsa-mir-148-prec
GAGGCAAAGTTCTGAGACACTCCGACTCTGAGTATGA 169
TAGAAGTCAGTGCACTACAGAACTTTGTCTC hsa-mir-149-prec
GCCGGCGCCCGAGCTCTGGCTCCGTGTCTTCACTCCCG 170
TGCTTGTCCGAGGAGGGAGGGAGGGACGGGGGCTGT GCTGGGGCAGCTGGA
hsa-mir-149-prec GCTCTGGCTCCGTGTCTTCACTCCCGTGCTTGTCCGAG 171
GAGGGAGGGAGGGAC hsa-mir-150-prec
CTCCCCATGGCCCTGTCTCCCAACCCTTGTACCAGTGC 172
TGGGCTCAGACCCTGGTACAGGCCTGGGGGACAGGGA CCTGGGGAC hsa-mir-150-prec
CCCTGTCTCCCAACCCTTGTACCAGTGCTGGGCTCAGA 173
CCCTGGTACAGGCCTGGGGGACAGGG hsa-mir-151-prec
CCTGCCCTCGAGGAGCTCACAGTCTAGTATGTCTCATC 174
CCCTACTAGACTGAAGCTCCTTGAGGACAGG hsa-mir-152-prec
TGTCCCCCCCGGCCCAGGTTCTGTGATACACTCCGACT 175
CGGGCTCTGGAGCAGTCAGTGCATGACAGAACTTGGG CCCGGAAGGACC hsa-mir-152-prec
GGCCCAGGTTCTGTGATACACTCCGACTCGGGCTCTG 176
GAGCAGTCAGTGCATGACAGAACTTGGGCCCCGG hsa-mir-153-1-
CTCACAGCTGCCAGTGTCATTTTTGTGATCTGCAGCTA 177 prec
GTATTCTCACTCCAGTTGCATAGTCACAAAAGTGATCA TTGGCAGGTGTGGC
hsa-mir-153-1- tctctctctccctcACAGCTGCCAGTGTCA 178 prec
TTGTCACAAAAGTGA TCATTGGCAGGTGTGGCTGCTGCATG hsa-mir-153-2-
AGCGGTGGCCAGTGTCATTTTTGTGATGTTGCAGCTAG 179 prec
TAATATGAGCCCAGTTGCATAGTCACAAAAGTGATCA TTGGAAACTGTG hsa-mir-153-2-
CAGTGTCATTTTTGTGATGTTGCAGCTAGTAATATGAG 180 prec
CCCAGTTGCATAGTCACAAAAGTGATCATTG hsa-mir-154-prec
GTGGTACTTGAAGATAGGTTATCCGTGTTGCCTTCGCT 181
TTATTTGTGACGAATCATACACGGTTGACCTATTTTTC AGTACCAA hsa-mir-154-prec
GAAGATAGGTTATCCGTGTTGCCTTCGCTTTATTTGTG 182
ACGAATCATACACGGTTGACCTATTTTT hsa-mir-155-prec
CTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAA 183
CTGACTCCTACATATTAGCATTAACAG hsa-mir-16-2-prec
CAATGTCAGCAGTGCCTTAGCAGCACGTAAATATTGG 184
CGTTAAGATTCTAAAATTATCTCCAGTATTAACTGTGC
TGCTGAAGTAAGGTTGACCATACTCTACAGTTG hsa-mir-181a-prec
AGAAGGGCTATCAGGCCAGCCTTCAGAGGACTCCAAG 185
GAACATTCAACGCTGTCGGTGAGTTTGGGATTTGAAA
AAACCACTGACCGTTGACTGTACCTTGGGGTCCTTA hsa-mir-181b-
TGAGTTTTGAGGTTGCTTCAGTGAACATTCAACGCTGT 186 prec
CGGTGAGTTTGGAATTAAAATCAAAACCATCGACCGT
TGATTGTACCCTATGGCTAACCATCATCTACTCCA hsa-mir-181c-prec
CGGAAAATTTGCCAAGGGTTTGGGGGAACATTCAACC 187
TGTCGGTGAGTTTGGGCAGCTCAGGCAAACCATCGAC
CGTTGAGTGGACCCTGAGGCCTGGAATTGCCATCCT hsa-mir-182-as-
GAGCTGCTTGCCTCCCCCCGTTTTTGGCAATGGTAGAA 188 prec
CTCACACTGGTGAGGTAACAGGATCCGGTGGTTCTAG
ACTTGCCAACTATGGGGCGAGGACTCAGCCGGCAC hsa-mir-182-prec
TTTTTGGCAATGGTAGAACTCACACTGGTGAGGTAAC 189
AGGATCCGGTGGTTCTAGACTTGCCAACTATGG hsa-mir-183-prec
CCGCAGAGTGTGACTCCTGTTCTGTGTATGGCACTGGT 190
AGAATTCACTGTGAACAGTCTCAGTCAGTGAATTACC
GAAGGGCCATAAACAGAGCAGAGACAGATCCACGA hsa-mir-184-prec
CCAGTCACGTCCCCTTATCACTTTTCCAGCCCAGCTTT 191
GTGACTGTAAGTGTTGGACGGAGAACTGATAAGGGTA GGTGATTGA hsa-mir-184-prec
CCTTATCACTTTTCCAGCCCAGCTTTGTGACTGTAAGT 192
GTTGGACGGAGAACTGATAAGGGTAGG hsa-mir-185-prec
AGGGGGCGAGGGATTGGAGAGAAAGGCAGTTCCTGA 193
TGGTCCCCTCCCCAGGGGCTGGCTTTCCTCTGGTCCTT CCCTCCCA hsa-mir-185-prec
AGGGATTGGAGAGAAAGGCAGTTCCTGATGGTCCCCT 194
CCCCAGGGGCTGGCTTTCCTCTGGTCCTT hsa-mir-186-prec
TGCTTGTAACTTTCCAAAGAATTCTCCTTTTGGGCTTT 195
CTGGTTTTATTTTAAGCCCAAAGGTGAATTTTTTGGGA AGTTTGAGCT hsa-mir-186-prec
ACTTTCCAAAGAATTCTCCTTTTGGGCTTTCTGGTTTTA 196
TTTTAAGCCCAAAGGTGAATTTTTTGGGAAGT hsa-mir-187-prec
GGTCGGGCTCACCATGACACAGTGTGAGACTCGGGCT 197
ACAACACAGGACCCGGGGCGCTGCTCTGACCCCTCGT
GTCTTGTGTTGCAGCCGGAGGGACGCAGGTCCGCA hsa-mir-188-prec
TGCTCCCTCTCTCACATCCCTTGCATGGTGGAGGGTGA 198
GCTTTCTGAAAACCCCTCCCACATGCAGGGTTTGCAG GATGGCGAGCC hsa-mir-188-prec
TCTCACATCCCTTGCATGGTGGAGGGTGAGCTTTCTGA 199
AAACCCCTCCCACATGCAGGGTTTGCAGGA hsa-mir-189-prec
CTGTCGATTGGACCCGCCCTCCGGTGCCTACTGAGCTG 200
ATATCAGTTCTCATTTTACACACTGGCTCAGTTCAGCA GGAACAGGAGTCGAGCCCTTGAGCAA
hsa-mir-189-prec CTCCGGTGCCTACTGAGCTGATATCAGTTCTCATTTTA 201
CACACTGGCTCAGTTCAGCAGGAACAGGAG hsa-mir-190-prec
TGCAGGCCTCTGTGTGATATGTTTGATATATTAGGTTG 202
TTATTTAATCCAACTATATATCAAACATATTCCTACAG TGTCTTGCC hsa-mir-190-prec
CTGTGTGATATGTTTGATATATTAGGTTGTTATTTAAT 203
CCAACTATATATCAAACATATTCCTACAG hsa-mir-191-prec
CGGCTGGACAGCGGGCAACGGAATCCCAAAAGCAGC 204
TGTTGTCTCCAGAGCATTCCAGCTGCGCTTGGATTTCG TCCCCTGCTCTCCTGCCT
hsa-mir-191-prec AGCGGGCAACGGAATCCCAAAAGCAGCTGTTGTCTCC 205
AGAGCATTCCAGCTGCGCTTGGATTTCGTCCCCTGCT hsa-mir-192-2/3
CCGAGACCGAGTGCACAGGGCTCTGACCTATGAATTG 206
ACAGCCAGTGCTCTCGTCTCCCCTCTGGCTGCCAATTC
CATAGGTCACAGGTATGTTCGCCTCAATGCCAG hsa-mir-192-prec
GCCGAGACCGAGTGCACAGGGCTCTGACCTATGAATT 207
GACAGCCAGTGCTCTCGTCTCCCCTCTGGCTGCCAATT
CCATAGGTCACAGGTATGTTCGCCTCAATGCCAGC hsa-mir-193-prec
CGAGGATGGGAGCTGAGGGCTGGGTCTTTGCGGGCGA 208
GATGAGGGTGTCGGATCAACTGGCCTACAAAGTCCCA GTTCTCGGCCCCCG
hsa-mir-193-prec GCTGGGTCTTTGCGGGCGAGATGAGGGTGTCGGATCA 209
ACTGGCCTACAAAGTCCCAGT hsa-mir-194-prec
ATGGTGTTATCAAGTGTAACAGCAACTCCATGTGGAC 210
TGTGTACCAATTTCCAGTGGAGATGCTGTTACTTTTGA TGGTTACCAA hsa-mir-194-prec
GTGTAACAGCAACTCCATGTGGACTGTGTACCAATTTC 211
CAGTGGAGATGCTGTTACTTTTGAT hsa-mir-195-prec
AGCTTCCCTGGCTCTAGCAGCACAGAAATATTGGCAC 212
AGGGAAGCGAGTCTGCCAATATTGGCTGTGCTGCTCC AGGCAGGGTGGTG
hsa-mir-195-prec TAGCAGCACAGAAATATTGGCACAGGGAAGCG 213
AGTCTGCCAATATTGGCTGTGCTGCT hsa-mir-196-1-
CTAGAGCTTGAATTGGAACTGCTGAGTGAATTAGGTA 214 prec
GTTTCATGTTGTTGGGCCTGGGTTTCTGAACACAACAA
CATTAAACCACCCGATTCACGGCAGTTACTGCTCC hsa-mir-196-1-
GTGAATTAGGTAGTTTCATGTTGTTGGGCCTGGGTTTC 215 prec
TGAACACAACAACATTAAACCACCCGATTCAC hsa-mir-196-2-
TGCTCGCTCAGCTGATCTGTGGCTTAGGTAGTTTCATG 216 prec
TTGTTGGGATTGAGTTTTGAACTCGGCAACAAGAAAC
TGCCTGAGTTACATCAGTCGGTTTTCGTCGAGGGC hsa-mir-196-prec
GTGAATTAGGTAGTTTCATGTTGTTGGGCCTGGGTTTC 217
TGAACACAACAACATTAAACCACCCGATTCAC hsa-mir-197-prec
GGCTGTGCCGGGTAGAGAGGGCAGTGGGAGGTAAGA 218
GCTCTTCACCCTTCACCACCTTCTCCACCCAGCATGGC C hsa-mir-198-prec
TCATTGGTCCAGAGGGGAGATAGGTTCCTGTGATTTTT 219 CCTTCTTCTCTATAGAATAAATGA
hsa-mir-199a-1- GCCAACCCAGTGTTCAGACTACCTGTTCAGGAGGCTC 220 prec
TCAATGTGTACAGTAGTCTGCACATTGGTTAGGC hsa-mir-199a-2-
AGGAAGCTTCTGGAGATCCTGCTCCGTCGCCCCAGTG 221 prec
TTCAGACTACCTGTTCAGGACAATGCCGTTGTACAGTA
GTCTGCACATTGGTTAGACTGGGCAAGGGAGAGCA hsa-mir-199b-
CCAGAGGACACCTCCACTCCGTCTACCCAGTGTTTAG 222 prec
ACTATCTGTTCAGGACTCCCAAATTGTACAGTAGTCTG
CACATTGGTTAGGCTGGGCTGGGTTAGACCCTCGG hsa-mir-199s-prec
GCCAACCCAGTGTTCAGACTACCTGTTCAGGAGGCTC 223
TCAATGTGTACAGTAGTCTGCACATTGGTTAGGC hsa-mir-200a-prec
GCCGTGGCCATCTTACTGGGCAGCATTGGATGGAGTC 224
AGGTCTCTAATACTGCCTGGTAATGATGACGGC hsa-mir-200b-
CCAGCTCGGGCAGCCGTGGCCATCTTACTGGGCAGCA 225 prec
TTGGATGGAGTCAGGTCTCTAATACTGCCTGGTAATG ATGACGGCGGAGCCCTGCACG
hsa-mir-202-prec GTTCCTTTTTCCTATGCATATACTTCTTTGAGGATCTGG 226
CCTAAAGAGGTATAGGGCATGGGAAGATGGAGC hsa-mir-203-prec
GTGTTGGGGACTCGCGCGCTGGGTCCAGTGGTTCTTA 227
ACAGTTCAACAGTTCTGTAGCGCAATTGTGAAATGTTT
AGGACCACTAGACCCGGCGGGCGCGGCGACAGCGA hsa-mir-204-prec
GGCTACAGTCTTTCTTCATGTGACTCGTGGACTTCCCT 228
TTGTCATCCTATGCCTGAGAATATATGAAGGAGGCTG
GGAAGGCAAAGGGACGTTCAATTGTCATCACTGGC hsa-mir-205-prec
AAAGATCCTCAGACAATCCATGTGCTTCTCTTGTCCTT 229
CATTCCACCGGAGTCTGTCTCATACCCAACCAGATTTC
AGTGGAGTGAAGTTCAGGAGGCATGGAGCTGACA hsa-mir-206-prec
TGCTTCCCGAGGCCACATGCTTCTTTATATCCCCATAT 230
GGATTACTTTGCTATGGAATGTAAGGAAGTGTGTGGT TTCGGCAAGTG hsa-mir-206-prec
AGGCCACATGCTTCTTTATATCCCCATATGGATTACTT 231
TGCTATGGAATGTAAGGAAGTGTGTGGTTTT hsa-mir-208-prec
TGACGGGCGAGCTTTTGGCCCGGGTTATACCTGATGCT 232
CACGTATAAGACGAGCAAAAAGCTTGTTGGTCA hsa-mir-210-prec
ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCC 233
CACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTG
TGACAGCGGCTGATCTGTGCCTGGGCAGCGCGACCC hsa-mir-211-prec
TCACCTGGCCATGTGACTTGTGGGCTTCCCTTTGTCAT 234
CCTTCGCCTAGGGCTCTGAGCAGGGCAGGGACAGCAA
AGGGGTGCTCAGTTGTCACTTCCCACAGCACGGAG hsa-mir-212-prec
CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCTTGG 235
CTCTAGACTGCTTACTGCCCGGGCCGCCCTCAGTAACA
GTCTCCAGTCACGGCCACCGACGCCTGGCCCCGCC hsa-mir-213-prec
CCTGTGCAGAGATTATTTTTTAAAAGGTCACAATCAAC 236
ATTCATTGCTGTCGGTGGGTTGAACTGTGTGGACAAG
CTCACTGAACAATGAATGCAACTGTGGCCCCGCTT hsa-mir-213-prec-
GAGTTTTGAGGTTGCTTCAGTGAACATTCAACGCTGTC 237 LIM
GGTGAGTTTGGAATTAAAATCAAAACCATCGACCGTT
GATTGTACCCTATGGCTAACCATCATCTACTCC hsa-mir-214-prec
GGCCTGGCTGGACAGAGTTGTCATGTGTCTGCCTGTCT 238
ACACTTGCTGTGCAGAACATCCGCTCACCTGTACAGC
AGGCACAGACAGGCAGTCACATGACAACCCAGCCT hsa-mir-215-prec
ATCATTCAGAAATGGTATACAGGAAAATGACCTATGA 239
ATTGACAGACAATATAGCTGAGTTTGTCTGTCATTTCT
TTAGGCCAATATTCTGTATGACTGTGCTACTTCAA hsa-mir-216-prec
GATGGCTGTGAGTTGGCTTAATCTCAGCTGGCAACTGT 240
GAGATGTTCATACAATCCCTCACAGTGGTCTCTGGGAT
TATGCTAAACAGAGCAATTTCCTAGCCCTCACGA hsa-mir-217-prec
AGTATAATTATTACATAGTTTTTGATGTCGCAGATACT 241
GCATCAGGAACTGATTGGATAAGAATCAGTCACCATC
AGTTCCTAATGCATTGCCTTCAGCATCTAAACAAG hsa-mir-218-1-
GTGATAATGTAGCGAGATTTTCTGTTGTGCTTGATCTA 242 prec
ACCATGTGGTTGCGAGGTATGAGTAAAACATGGTTCC
GTCAAGCACCATGGAACGTCACGCAGCTTTCTACA hsa-mir-218-2-
GACCAGTCGCTGCGGGGCTTTCCTTTGTGCTTGATCTA 243 prec
ACCATGTGGTGGAACGATGGAAACGGAACATGGTTCT
GTCAAGCACCGCGGAAAGCACCGTGCTCTCCTGCA hsa-mir-219-prec
CCGCCCCGGGCCGCGGCTCCTGATTGTCCAAACGCAA 244
TTCTCGAGTCTATGGCTCCGGCCGAGAGTTGAGTCTGG
ACGTCCCGAGCCGCCGCCCCCAAACCTCGAGCGGG hsa-mir-220-prec
GACAGTGTGGCATTGTAGGGCTCCACACCGTATCTGA 245
CACTTTGGGCGAGGGCACCATGCTGAAGGTGTTCATG
ATGCGGTCTGGGAACTCCTCACGGATCTTACTGATG hsa-mir-221-prec
TGAACATCCAGGTCTGGGGCATGAACCTGGCATACAA 246
TGTAGATTTCTGTGTTCGTTAGGCAACAGCTACATTGT
CTGCTGGGTTTCAGGCTACCTGGAAACATGTTCTC hsa-mir-222-prec
GCTGCTGGAAGGTGTAGGTACCCTCAATGGCTCAGTA 247
GCCAGTGTAGATCCTGTCTTTCGTAATCAGCAGCTACA
TCTGGCTACTGGGTCTCTGATGGCATCTTCTAGCT hsa-mir-223-prec
CCTGGCCTCCTGCAGTGCCACGCTCCGTGTATTTGACA 248
AGCTGAGTTGGACACTCCATGTGGTAGAGTGTCAGTT
TGTCAAATACCCCAAGTGCGGCACATGCTTACCAG hsa-mir-224-prec
GGGCTTTCAAGTCACTAGTGGTTCCGTTTAGTAGATGA 249
TTGTGCATTGTTTCAAAATGGTGCCCTAGTGACTACAA AGCCC hsA-mir-29b-
CTTCTGGAAGCTGGTTTCACATGGTGGCTTAGATTTTT 250 1 = 102-prec1
CCATCTTTGTATCTAGCACCATTTGAAATCAGTGTTTT AGGAG hsA-mir-29b-
CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAA 251 2 = 102prec7.1 =
ATAGTGATTGTCTAGCACCATTTGAAATCAGTGTTCTT 7.2 GGGGG hsA-mir-29b-
CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAA 252 3 = 102prec7.1 =
ATAGTGATTGTCTAGCACCATTTGAAATCAGTGTTCTT 7.2 GGGGG hsa-mir-30* =
GTGAGCGACTGTAAACATCCTCGACTGGAAGCTGTGA 253 mir-097-prec-6
AGCCACAGATGGGCTTTCAGTCGGATGTTTGCAGCTG CCTACT mir-033b
ACCAAGTTTCAGTTCATGTAAACATCCTACACTCAGCT 254
GTAATACATGGATTGGCTGGGAGGTGGATGTTTACTT CAGCTGACTTGGA mir-101-
TGCCCTGGCTCAGTTATCACAGTGCTGATGCTGTCTAT 255 precursor-9 =
TCTAAAGGTACAGTACTGTGATAACTGAAGGATGGCA mir-101-3 mir-108-1-small
ACACTGCAAGAACAATAAGGATTTTTAGGGGCATTAT 256
GACTGAGTCAGAAAACACAGCTGCCCCTGAAAGTCCC TCATTTTTCTTGCTGT
mir-108-2-small ACTGCAAGAGCAATAAGGATTTTTAGGGGCATTATGA 257
TAGTGGAATGGAAACACATCTGCCCCCAAAAGTCCCT CATTTT mir-123-prec =
CGCTGGCGACGGGACATTATTACTTTTGGTACGCGCTG 258 mir-126-prec
TGACACTTCAAAC TCGTACCGTGAGTAATAATGCGCCGTCCACGGCA mir-123-prec =
ACATTATTACTTTTGGTACGCGCTGTGACACTTCAAAC 259 mir-126-prec
TCGTACCGTGAGTAATAATGCGC mir-129-1-prec
TGGATCTTTTTGCGGTCTGGGCTTGCTGTTCCTCTCAA 260
CAGTAGTCAGGAAGCCCTTACCCCAAAAAGTATCTA mir-129-small-
TGCCCTTCGCGAATCTTTTTGCGGTCTGGGCTTGCTGT 261 2 = 129b?
ACATAACTCAATAGCCGGAAGCCCTTACCCCAAAAAG CATTTGCGGAGGGCG
mir-133b-small GCCCCCTGCTCTGGCTGGTCAAACGGAACCAAGTCCG 262
TCTTCCTGAGAGGTTTGGTCCCCTTCAACCAGCTACAG CAGGG mir-135-small-
AGATAAATTCACTCTAGTGCTTTATGGCTTTTTATTCC 263
TATGTGATAGTAATAAAGTCTCATGTAGGGATGGAAG CCATGAAATACATTGTGAAAAATCA
mir-148b-small AAGCACGATTAGCATTTGAGGTGAAGTTCTGTTATAC 264
ACTCAGGCTGTGGCTCTCTGAAAGTCAGTGCAT mir-151-prec
CCTGTCCTCAAGGAGCTTCAGTCTAGTAGGGGATGAG 265
ACATACTAGACTGTGAGCTCCTCGAGGGCAGG mir-155-
CTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAA 266 prec(BIC)
CTGACTCCTACATATTAGCATTAACAG mir-156 = mir-
CCTAACACTGTCTGGTAAAGATGGCTCCCGGGTGGGT 267 157 = overlap mir-
TCTCTCGGCAGTAACCTTCAGGGAGCCCTGAAGACCA 141 TGGAGGAC mir-158-small =
GCCGAGACCGAGTGCACAGGGCTCTGACCTATGAATT 268 mir-192
GACAGCCAGTGCTCTCGTCTCCCCTCTGGCTGCCAATT
CCATAGGTCACAGGTATGTTCGCCTCAATGCCAGC mir-159-1-small
TCCCGCCCCCTGTAACAGCAACTCCATGTGGAAGTGC 269
CCACTGGTTCCAGTGGGGCTGCTGTTATCTGGGGCGA GGGCCA mir-161-small
AAAGCTGGGTTGAGAGGGCGAAAAAGGATGAGGTGA 270
CTGGTCTGGGCTACGCTATGCTGCGGCGCTCGGG mir-163-1b-small
CATTGGCCTCCTAAGCCAGGGATTGTGGGTTCGAGTC 271
CCACCCGGGGTAAAGAAAGGCCGAATT mir-163-3-small
CCTAAGCCAGGGATTGTGGGTTCGAGTCCCACCTGGG 272
GTAGAGGTGAAAGTTCCTTTTACGGAATTTTTT
mir-175- GGGCTTTCAAGTCACTAGTGGTTCCGTTTAGTAGATGA 273 small = mir-224
TTGTGCATTGTTTCAAAATGGTGCCCTAGTGACTACAA AGCCC mir-177-small
ACGCAAGTGTCCTAAGGTGAGCTCAGGGAGCACAGAA 274
ACCTCCAGTGGAACAGAAGGGCAAAAGCTCATT mir-180-small
CATGTGTCACTTTCAGGTGGAGTTTCAAGAGTCCCTTC 275
CTGGTTCACCGTCTCCTTTGCTCTTCCACAAC mir-187-prec
GGTCGGGCTCACCATGACACAGTGTGAGACTCGGGCT 276
ACAACACAGGACCCGGGGCGCTGCTCTGACCCCTCGT
GTCTTGTGTTGCAGCCGGAGGGACGCAGGTCCGCA mir-188-prec
TGCTCCCTCTCTCACATCCCTTGCATGGTGGAGGGTGA 277
GCTTTCTGAAAACCCCTCCCACATGCAGGGTTTGCAG GATGGCGAGCC mir-190-prec
TGCAGGCCTCTGTGTGATATGTTTGATATATTAGGTTG 278
TTATTTAATCCAACTATATATCAAACATATTCCTACAG TGTCTTGCC mir-197-2
GTGCATGTGTATGTATGTGTGCATGTGCATGTGTATGT 279 GTATGAGTGCATGCGTGTGTGC
mir-197-prec GGCTGTGCCGGGTAGAGAGGGCAGTGGGAGGTAAGA 280
GCTCTTCACCCTTCACCACCTTCTCCACCCAGCATGGC C mir-202-prec
GTTCCTTTTTCCTATGCATATACTTCTTTGAGGATCTGG 281
CCTAAAGAGGTATAGGGCATGGGAAGATGGAGC mir-294-1 (chr16)
CAATCTTCCTTTATCATGGTATTGATTTTTCAGTGCTTC 282 CCTTTTGTGTGAGAGAAGATA
mir-hes1 ATGGAGCTGCTCACCCTGTGGGCCTCAAATGTGGAGG 283
AACTATTCTGATGTCCAAGTGGAAAGTGCTGCGACAT TTGAGCGTCACCGGTGACGCCCATATCA
mir-hes2 GCATCCCCTCAGCCTGTGGCACTCAAACTGTGGGGGC 284
ACTTTCTGCTCTCTGGTGAAAGTGCCGCCATCTTTTGA GTGTTACCGCTTGAGAAGACTCAACC
mir-hes3 CGAGGAGCTCATACTGGGATACTCAAAATGGGGGCGC 285
TTTCCTTTTTGTCTGTTACTGGGAAGTGCTTCGATTTTG GGGTGTCCCTGTTTGAGTAGGGCATC
hsa-mir-29b-1 CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAA 664
ATAGTGATTGTCTAGCACCATTTGAAATCAGTGTTCTT GGGGG *An underlined
sequence within a precursor sequence represents a processed miR
transcript. All sequences are human.
Genome Analysis
[0167] The BUILD 33 and BUILD 34 Version 1 of the Homo sapiens
genome, available at the NCBI website (see above), was used for
genome analysis. For each human miR present in the miR database, a
BLAST search was performed using the default parameters against the
human genome to find the precise location, followed by mapping
using the maps available at the Human Genome Resources at the NCBI
website. See also Altschul et al. (1990), J. Mol. Biol. 215:403-10
and Altschul et al. (1997), Nucleic Acids Res. 25:3389-3402, the
entire disclosures of which are herein incorporated by reference,
for a discussion of the BLAST search algorithm. Also, as a
confirmation of the data, the human clone corresponding to each miR
was identified and mapped to the human genome (see Table 2). Perl
scripts for the automatic submission of BLAST jobs and for the
retrieval of the search results were based on the LPW, HTML, and
HTPP Perl modules and BioPerl modules.
Fragile Site Database
[0168] This database was constructed using the Virtual Gene
Nomenclature Workshop, maintained by the HUGO Gene Nomenclature
Committee at University College, London. For each FRA locus, the
literature was screened for publications reporting the cloning of
the locus. In ten cases, genomic positions for both centromeric and
telomeric ends were found. The total genomic length of these FRA
loci is 26.9 Mb. In twenty-nine cases, only one anchoring marker
was identified. It was determined, based on the published data,
that 3 Mb can be used as the median length for each FRA locus.
Therefore, 3 Mb was used as a guideline or window length for
considering whether miR were in close proximity to the FRA
sites.
[0169] The human clones for seventeen HPV16 integration sites (IS)
were also precisely mapped on the human genome. By analogy with the
length of a FRA, in the case of HPV16 integration sites, "close"
vicinity was defined to be a distance of less than 2 Mb.
PubMed Database
[0170] The PubMed database was screened on-line for publications
describing cancer-related abnormalities such as minimal regions of
loss-of-heterozygosity (minimal LOH) and minimal regions of
amplification (minimal amplicons) using the words "LOH and
genome-wide," "amplification and genome-wide" and "amplicon and
cancer." The PubMed database is maintained by the NCBI and was
accessed via its website. The data obtained from thirty-two papers
were used to screen for putative CAGRs, based on markers with high
frequency of LOH/amplification. As a second step, a literature
search was performed to determine the presence or absence of the
above three types of alterations and to determine the precise
location of miRs with respect to CAGRs (see above). Search phrases
included the combinations "minimal regions of LOH AND cancer", and
"minimal region amplification AND cancer." A total of 296
publications were found and manually curated to find regions
defined by both telomeric and centromeric markers. One hundred
fifty-four minimally deleted regions (median length-4.14 Mb) and 37
minimally amplified regions (median length-2.45 Mb) were identified
with precise genomic mapping for both telomeric and centromeric
ends involving all human chromosomes except Y. To identify common
breakpoint regions, PubMed was searched with the combination
"translocation AND cloning AND breakpoint AND cancer." The search
yielded 308 papers, which were then manually curated. Among these
papers, 45 translocations with at least one breakpoint precisely
mapped were reported.
Statistical Analyses
[0171] The incidence of miR genes and their association with
specific chromosomes and chromosome regions, such as FRAs and
amplified or deleted regions in cancer, was analyzed with random
effect Poisson regression models. Under these models, "events" are
defined as the number of miR genes, and non-overlapping lengths of
the region of interest defined exposure "time" (i.e., fragile site
versus non-fragile site, etc.). The "length" of a region was
exactly .+-.1 Mb, if known, or estimated as .+-.1 Mb if unknown.
The random effect used was chromosomal location, in that data
within a chromosome were assumed to be correlated. The fixed effect
in each model consisted of an indicator variable(s) for the type of
region. This model provided the incidence rate ratio (IRR), 2-sided
95% confidence interval of the IRR, and 2-sided p-values for
testing the hypothesis that the IRR is 1.0. An IRR significantly
greater than 1 indicates an increase in the number of miR genes
within a region.
[0172] Each model was repeated considering the distribution of miR
genes only in the transcriptionally active portion of the genome
(about 43% of the genome using the published data), rather than the
entire chromosome length, and similar results were obtained.
Considering the distribution of miRs only in the transcriptionally
active portion of the genome is more conservative, and takes into
account the phenomenon of clustering that was observed for the miR
genes' genomic location. All computations were completed using
STATA v7.0.
Patient Samples and Cell Lines
[0173] Patient samples were obtained from twelve chronic
lymphocytic leukemia (CLL) patients, and mononuclear cells were
isolated through Ficoll-Hypaque gradient centrifugation (Amersham
Pharmacia Biotech, Piscataway, N.J.), as previously described
(Calin et al., Proc. Natl. Acad. Sci. USA 2002, 99:15524-15529).
Samples were then processed for RNA and DNA extraction according to
standard protocols as described in Sambrook J et al. (1989),
Molecular cloning: A Laboratory Manual (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.), the entire disclosure
of which is herein incorporated by reference.
[0174] Seven human lung cancer cell lines were obtained from the
American Type Culture Collection (ATCC; Manassas, Va.) and
maintained according to ATCC instructions. These cell lines were:
Calu-3, H1299, H522, H460, H23, H1650 and H1573.
Northern Blotting
[0175] Total RNA isolation from patient samples and cell lines
described above was performed using the Tri-Reagent protocol
(Molecular Research Center, Inc). RNA samples (30 .mu.g each) were
run on 15% acryl amide denaturing (urea) Criterion recast gels
(Bio-Red Laboratories, Hercules, Calif.) and then transferred onto
Hyoid-N+membrane (Amersham Pharmacia Biotech), as previously
described (Calin et al., Proc. Natl. Acad. Sci. USA 2002,
99:15524-15529). Hybridization with gamma-.sup.32P ATP labeled
probes was performed at 42.degree. C. in 7% SDS, 0.2 M
Na.sub.2PO.sub.4, pH 7.0 overnight. Membranes were washed at
42.degree. C., twice in 2.times.SSPE, 0.1% SDS and twice with
0.5.times.SSPE, 0.1% SDS. Blots were stripped by boiling in 0.1%
aqueous SDS/0.1.times.SSC for 10 minutes, and were reprobed several
times. As a gel loading control, 5S rRNA was also loaded and was
stained with ethidium bromide. Lung tissue RNA was utilized as the
normal control; normal lung total RNA was purchased from Clontech
(Palo Alto, Calif.).
Example 1
miR Genes are Non-Randomly Distributed in the Human Genome
[0176] One hundred eighty-six human genes representing known or
predicted miR genes were mapped, based on mouse homology or
computational methods, as described above in the General Methods.
The results are presented in Table 2. The names were as in the
miRNA Registry; for new miR genes, sequential names were assigned.
miR 213 from Sanger database is different from miR 213 described in
Lim et al. (2003, Science 299:1540). MiR genes in clusters are
separated by a forward slash "/". The approximate location in Mb of
each clone is presented in the last column.
TABLE-US-00002 TABLE 2 miR Database: Chromosome Location and
Clustering Chromosome Loc (Mb) Name location Genes in Cluster
(built 33) let-7a-1 09q22.2 let-7a-1/let-7f-1/let-7d 90.2-.3
let-7a-2 11q24.1 miR-125b-1/let-7a-2/miR-100 121.9-122.15 let-7a-3
22q13.3 let-7a-3/let-7b 44.7-.8 let-7b 22q13.3 let-7a-3/let-7b
44.7-.8 let-7c 21q11.2 miR-99a/let-7c/miR-125b-2 16.7-.9 let-7d
09q22.2 let-7a-1/let-7f-1/let7d 90.2-.3 let-7e 19q13.4
miR-99b/let-7e/miR-125a 56.75-57 let-7f-1 09q22.2
let-7a-1/let-7f-1/let7d 90.2-.3 let-7f-2 Xp11.2 miR-98/let-7f-2
52.2-.3 let-7g 03p21.3 let-7g/miR-135-1 52.1-.3 let-7i 12q14.1
62.7-.9 miR- 20q13.3 miR-133a-2/miR-1b-2 61.75-.8 001b-2 miR-001d
18q11.1 miR-133a-1/miR-1d 19.25-.4 miR-007-1 09q21.33 80-80.1
miR-007-2 15q25 86.7-.8 miR-007-3 19p13.3 4.7-.75 miR-009- 01q22
153.1-.2 1 (= miR- 131-1) miR-009- 05q14 87.85-88 2 (= miR- 131-2)
miR-009- 15q25.3 87.5 3 (= miR- 131-3) miR-010a 17q21.3
miR-196-1/miR-10a 46.95-47.05 miR-010b 02q31 176.85-177 miR-015a
13q14 miR-16a/miR-15a 49.5-.8 miR-015b 03q26.1 miR-15b/miR-16b
161.35-.5 miR-016a 13q14 miR-16a/miR-15a 49.5-.8 miR-016b 03q26.1
miR-15b/miR-16b 161.35-.5 miR-017 13q31
miR-17/miR-18/miR-19a/miR-20/miR- 90.82 (= miR- 19b-1/miR-92-1 91)
miR-018 13q31 miR-17/miR-18/miR-19a/miR-20/miR- 90.82
19b-1/miR-92-1 miR-019a 13q31 miR-17/miR-18/miR-19a/miR-20/miR-
90.82 19b-1/miR-92-1 miR- 13q31 miR-17/miR-18/miR-19a/miR-20/miR-
90.82 019b-1 19b-1/miR-92-1 miR- Xq26.2 miR-92-2/miR-19b-2/miR-106a
131.2-.3 019b-2 miR-020 13q31 miR-17/miR-18/miR-19a/miR-20/miR-
90.82 19b-1/miR-92-1 miR-021 17q23.2 58.25-.35 (= miR104- as)
miR-022 17p13.3 1.4-.6 miR-023a 19p13.2
miR-24-2/miR-27a/miR-23a/miR- 13.75-.95 181c miR-023b 09q22.1
miR-24-1/miR27b/miR-23b 90.8-91 miR-024- 09q22.1
miR-24-1/miR27b/miR-23b 90.8-91 1 (= miR- 189) miR-024-2 19p13.2
miR-24-2/miR-27a/miR-23a/miR- 13.75-.95 181c miR-025 07q22
miR-106b/miR-25/miR-93-1 99.25-.4 miR-026a 03p21 37.8-.9 miR-026b
02q35 219.1-.3 miR-027a 19p13.2 miR-24-2/miR-27a/miR-23a/miR-
13.75-.95 181c miR-027b 09q22.1 miR-24-1/miR27b/miR-23b 90.8-91
miR-028 03q28 189.65-.85 miR-029a 07q32 miR-29a/miR29b 129.9-130.1
miR-029b 07q32 miR-29a/miR29b 129.9-130.1 (= miR- 102-7.1) miR-029c
01q32.2-32.3 miR-29c/miR-102 204.6-.7 miR-030a- 06q12-13 72.05-.2
as miR-030a- 06q12-13 72.05-.2 s (= miR- 097) miR-030b 08q24.2
miR-30d/miR-30b 135.5 miR-030c 06q13 71.95-72.1 miR-030d 08q24.2
miR-30d/miR-30b 135.5 miR-031 09p21 21.3-.5 miR-032 09q31.2
105.1-.3 miR-033a 22q13.2 40.5-.8 miR-033b 17p11.2 17.6-.7 miR-034
01p36.22 8.8 (= miR- 170) miR-034a-1 11q23 miR-34a-2/miR 34a-1
111.3-.5 miR-034a-2 11q23 miR-34a-2/miR 34a-1 111.3-.5 miR-092-1
13q31 miR-17/miR-18/miR-19a/miR-20/miR- 90.82 19b-1/miR-92-1
miR-092-2 Xq26.2 miR-92-2/miR-19b-2/miR-106a 131.2-.3 miR-093-1
07q22 miR-106b/miR-25/miR-93-1 99.25-.4 miR-095 04p16 8-.2 miR-096
07q32 miR-182s/miR-182as/miR-96/miR- 128.9-129 183 miR-098 Xp11.2
miR-98/let-7f-2 52.2-.3 miR-099a 21q11.2 miR-99a/let-7c/miR-125b-2
16.7-.9 miR-099b 19q13.4 miR-99b/let-7e/miR-125a 56.75-57 miR-100
11q24.1 miR-125b-1/let-7a-2/miR-100 121.9-122.15 miR-101-1 01p31.3
64.85-95 miR-101-2 09p24 4.8-5 miR-102 01q32.2-32.3 miR-29c/miR-102
204.5-.7 miR-103-1 05q35.1 167.8-.95 miR-103-2 20p13 3.82-.90
miR-105-1 Xq28 149.3-.4 miR-106b 07q22 miR-106b/miR-25/miR-93-1
99.25-.4 (= miR- 94) miR-106a Xq26.2 miR-92-2/miR-19b-2/miR-106a
131.2-.3 miR-107 10q23.31 91.45-.6 miR-108-1 17q11.1
miR-108-1/miR-193 29.6-.8 miR-108-2 16q13.1 14.3-.5 miR-122a 18q21
55.85-56 miR-123 09q34 132.9-133.05 (= miR- 126) miR-124a-1 08p23
9.5-.65 miR-124a-2 08q12.2 64.9-65.1 miR-124a-3 20q13.33 62.4-.55
miR-125a 19q13.4 miR-99b/let-7e/miR-125a 56.75-57 miR-125b-1
11q24.1 miR-125b1/let-7a-2/miR-100 121.9-122.1 miR-125b-2 21q11.2
miR-99a/let-7c/miR-125b-2 16.7-.9 miR-127 14q32 miR-127/miR-136
99.2-.4 miR-128a 02q21 136.3-.5 miR-128b 03p22 35.45-.6 miR-129-1
07q32 127.25-.4 miR-129-2 11p11.2 43.65-.75 miR-130a 11q12 57.6-.7
miR-130b 22q11.1 20.2-.4 miR-132 17p13.3 miR-212/miR-132 1.85-2
miR-133a-1 18q11.1 miR-133a-1/miR-1d 19.25-.4 miR-133a-2 20q13.3
miR-133a-2/miR-1b-2 61.75-.8 miR-133b 06p12 miR-206/miR-133b
51.9-52 miR-134 14q32 miR-154/miR-134/miR-299 99.4-.6 miR-135-1
03p21.3 let-7g/miR-135-1 52.1-.3 miR-135-2 12q23 97.85-98 miR-136
14q32 miR-127/miR-136 99.2-.4 miR-137 01p21-22 97.75 miR-138-1
03p21 43.85-.95 miR-138-2 16q12-13 56.55-.7 miR-139 11q13 72.55-.7
miR-140as 16q22.1 69.6-.8 miR-140s 16q22.1 69.6-.8 miR-141 12p13
overlap miR-156 - cluster 6.9-7.05 (= overlap miR-156) miR-142-
17q23 56.75-.9 as miR-142-s 17q23 56.75-.9 miR-143 05q32-33
miR-145/miR-143 148.65-.8 miR-144 17q11.2 27.05 miR-145 05q32-33
miR-145/miR-143 148.65-.8 miR-146 05q34 159.8-.9 miR-147 09q33
116.35-.55 miR-148 07p15 25.6-.8 miR-148b 12q13 54.35-.45 miR-149
02q37.3 241.3-.4 miR-150 19q13 54.6-.8 miR-151 08q24.3 141.4-.5
miR-152 17q21 46.4-.5 miR-153-1 02q36 220.1-.2 miR-153-2 07q36
156.5-.7 miR-154 14q32 miR-154/miR-134/miR-299 99.4-.6 miR-155
21q21 25.85 (BIC) miR-156 12p13 overlap miR-141 - cluster 6.9-7.05
(= miR- 157) miR-159-1 11q13 miR-159-1/miR-192 64.9-65 miR-161
08p21 21.8-.9 miR-175 Xq28 148.8-.9 (= miR- 224) miR-177 08p21
21.25-.35 miR-180 22q11.21-12.2 26.45 miR-181a 09q33.1-34.13
120.85-.95 (= miR- 178-2) miR-181b 01q31.2-q32.1 miR-213 S/miR-181b
195.2-.35 (= miR- 178 = miR-213- LIM) miR-181c 19p13.3
miR-24-2/miR-27a/miR-23a/miR- 13.75-.95 181c miR-182- 07q32
miR-182s/miR-182as/miR-96/miR- 128.9-129 as 183 miR-182-s 07q32
miR-182s/miR-182as/miR-96/miR- 128.9-129 183 miR-183 07q32
miR-182s/miR-182as/miR-96/miR- 128.9-129 (= miR- 183 174) miR-184
15q24 76.9-77.1 miR-185 22q11.2 18.35-.45 miR-186 01p31 70.9-71
miR-187 18q12.1 33.25-.4 miR-188 Xp11.23-p11.2 48.35-.5 miR-190
15q21 60.6-.8 miR-191 03p21 48.85-.95 miR-192 11q13
miR-159-1/miR-192 64.9-65 (= miR- 158) miR-193 17q11.2
miR-108-1/miR-193 29.6-.8 miR-194 01q41 miR-215/miR-194 216.7-.8 (=
miR- 159-2) miR-195 17p13 6.75-.85 miR-196-1 17q21
miR-196-1/miR-10a 46.9-47.1 miR-196-2 12q13 54-54.15 miR-197 01p13
109.2-.3 miR-198 03q13.3 121.3-.4 miR-199a- 19p13.2 10.75-.8 1 (=
miR- 199s) miR-199a-2 01q23.3 miR-214/miR-199a-2 168.7-.8 miR-199as
19p13.2 10.75-.8 (= antisense miR-199a- 1) miR-199b 09q34 124.3-.5
(= miR- 164) miR-200 01p36.3 0.9-1 miR-202 10q26.3 135 miR-203
14q32.33 102.4-.6 miR-204 09q21.1 66.9-67 miR-205 01q32.2 206.2-.3
miR-206 06p12 miR-206/miR-133b 51.9-52 miR-208 14q11.2 21.8-22
miR-210 11p15 0.55-0.75 miR-211 15q11.2-q12 28.9-29.1 miR-212
17p13.3 miR-212/miR-132 1.9-2.1 miR-213- 01q31.3-q32.1 miR-213
S/miR-181b 195.2-.35 SANGER miR-214 01q23.3 miR-214/miR-199a-2
168.7-.8 miR-215 01q41 miR-215/miR-194 216.7-.8 miR-216 02p16
miR-217/miR-216 56.2-.4 miR-217 02p16 miR-217/miR-216 56.2-.4
miR-218-1 04p15.32 20.15-.35 miR-218-2 05q35.1 168-.15 miR-219
06p21.2-21.31 33.1-.25 miR-220 Xq25 120.6-.8 miR-221 Xp11.3
miR-222/miR-221 44.35-.45 miR-222 Xp11.3 miR-222/miR-221
44.35-.45
miR-223 Xq12-13.3 63.4-.5 miR-294-1 16q22 65.1-.3 miR-297-3 20q13.2
52.25-.35 miR-299 14q32 miR-154/miR-134/miR-299 99.4-.6 miR-301
17q23 57.5-.7 miR-302 04q25 113.9-114 miR-hes1 19q13.4
miR-hes1/miR-hes2/miR-hes3 58.9-59.05 miR-hes2 19q13.4
miR-hes1/miR-hes2/miR-hes3 58.9-59.05 miR-hes3 19q13.4
miR-hes1/miR-hes2/miR-hes3 58.9-59.05
[0177] The distribution of the 186 human miR genes was found to be
non-random. Ninety miR genes were located in 36 clusters, usually
with two or three genes per cluster (median=2.5). The largest
cluster found comprises six genes
(miR-17/miR-18/miR-19a/miR-20/miR-19b1/miR-92-1) and is located at
13q31 (Table 2). A significant association of the incidence of miR
genes with specific chromosomes was found. Chromosome 4 was found
to have a lower than expected rate of miR genes (IRR=0.27;
p=0.035). Chromosomes 17 and 19 were found to have significantly
more miR genes than expected, based on chromosome size (IRR=2.97,
p=0.002 and IRR=3.39, p=0.001, respectively). Six of the 36 miR
gene clusters (17%), which contain 16 of 90 clustered genes (18%),
are located on these two small chromosomes, which account for only
5% of the entire genome.
[0178] Similar results were obtained using a model considering the
distribution of miR genes only in the transcriptionally active
portion of the genome (see Table 3).
[0179] Chromosome 1 is used as the baseline in the model with a
rate of miR gene incidence of .about.0.057, which is approximately
equal to the overall rate of miR gene incidence across the
genome.
TABLE-US-00003 TABLE 3 Location of miRs by chromosome and results
of mixed effects Poisson regression model. Chromosome Length # of
miRs IRR p 1 279 16 -- -- 2 251 7 0.49 0.112 3 221 10 0.79 0.557 4
197 3 0.27 0.035 5 198 6 0.53 0.183 6 176 6 0.59 0.277 7 163 13
1.39 0.377 8 148 6 0.71 0.469 9 140 15 1.87 0.082 10 143 2 0.24
0.060 11 148 11 1.29 0.508 12 142 6 0.74 0.523 13 118 8 0 1.000 14
107 7 1.14 0.771 15 100 5 0.87 0.789 16 104 5 0.84 0.731 17 88 15
2.97 0.002 18 86 4 0.81 0.708 19 72 14 3.39 0.001 20 66 5 1.32
0.587 21 45 4 1.55 0.433 22 48 6 2.09 0.123 X 163 12 1.28 0.513 Y
51 0 0 1.000
Example 2
miR Genes are Located in or Near Fragile Sites
[0180] Thirty-five of 186 miRs (19%) were found in (13 miR genes),
or within 3 Mb (22 miR genes) of cloned fragile sites (FRA). A set
of 39 fragile sites with available cloning information was used in
the analysis. Data were available for the exact dimension (mean
2.69 Mb) and position of ten of these cloned fragile sites (see
General Methods above). The relative incidence of miR genes inside
fragile sites occurred at a rate 9.12 times higher than in
non-fragile sites (p<0.001, using mixed effect Poisson
regression models; see Tables 3 and 4). The same very high
statistical significance was also found when only the 13 miRs
located exactly inside a FRA or exactly in the vicinity of the
"anchoring" marker mapped for a FRA were considered (IRR=3.21,
p<0.001). Among the four most active common fragile sites
(FRA3B, FRA16D, FRA6E, and FRA7H), the data demonstrate seven miRs
in (miR-29a and miR-29b) or close (miR-96, miR-182s, miR-182 as,
miR-183, and miR-129-1) to FRA7H, the only fragile site where no
candidate tumor suppressor (TS) gene has been found. The other
three of the four most active sites contain known or candidate TS
genes; i.e., FHIT, WWOX and PARK2, respectively (Ohta et al., 1996,
Cell 84:587-597; Paige et al., 2001, Proc. Natl. Acad. Sci. USA
98:11417-11422; Cesari et al., 2003, Proc. Natl. Acad. Sci. USA
100:5956-5961).
[0181] Analysis of 113 fragile sites scattered in the human
karyotype showed that 61 miR genes are located in the same
cytogenetic positions with FRAs. Thirty-five miR genes were located
inside twelve cloned FRAs. These data indicate that more miRs are
located in or near FRAs, and that the results described herein
represent an underestimation of miR gene/FRA association, likely
because the mapping of these unstable regions is not complete.
TABLE-US-00004 TABLE 4 Mixed Effect Poisson Regression Results for
the Association Between microRNAs and Several Types of Regions of
Interest Incidence Rate 95% CI Region of interest Ratio (IRR) IRR p
Cloned Fragile sites vs. non- 9.12 6.22, 13.38 <0.001 fragile
sites HPV16 insertion vs. all other 3.22 1.55, 6.68 <0.002
Deleted region vs. all other 4.08 2.99, 5.56 <0.001 Amplified
region vs. all other 3.97 2.31, 6.83 <0.001 HOX Clusters vs. all
other 15.77 7.39, 33.62 <0.001 Homeobox genes vs. all other 2.95
1.63, 5.34 <0.001 Note: "all other" means all the genome except
the regions of interest.
Example 3
miR Genes are Located in or Near Human Papilloma Virus (HPV)
Integration Sites
[0182] Because common fragile sites are preferential targets for
HPV 16 integration in cervical tumors, and infection with HPV16 or
HPV18 is the major risk factor for developing cervical cancer, the
association between miR gene locations and HPV16 integration sites
in cervical tumors was analyzed. The data indicate that thirteen
miR genes (7%) are located within 2.5 Mb of seven of seventeen
(45%) cloned integration sites. The relative incidence of miRs at
HPV16 integration sites occurred at a rate 3.22 times higher than
in the rest of the genome (p<0.002) (Tables 4 and 5). In one
cluster of integration sites at chromosome 17q23, where three HPV16
integration sites are spread over roughly 4 Mb of genomic sequence,
four miR genes (miR-21, miR-301, miR-142s and miR-142 as) were
found.
TABLE-US-00005 TABLE 5 Analyzed FRA Sites, Cancer Correlation and
HPV Integration Sites Distance Location miR- HPV16 Symbol
Chromosome Cancer correlation Type (Mb) Closest miR(s) FRA(Mb)
integration* FRA1A 1p36 FRA1C 1p31 aphidicolin type, 67.87 miR-186;
miR- 3; 3 common 101-1 FRA1F 1q21 bladder FRA1H 1q42.1 cervical
5-azacytidine, 216.5 miR-194; miR- exact YES common 215 FRA2G 2q31
RCC FRA2I 2q33 chronic myelogenous leukemia FRA3B 3p14.2 esophageal
carcinoma, lung, stomach, kidney, cervical cancer FRA4B 4q12 FRA4C
4q31.1 FRA5C 5q31.1 FRA5E 5p14 FRA6E 6q26 ovarian FRA6F 6q21
leukemias and solid tumors FRA7E 7q21.2 or 21.11 FRA7F 7q22
aphidicolin type, 100.2-107 miR-106b; miR- less than 1 common 25;
miR-93 FRA7G 7q31.2 ovarian FRA7H 7q32.3 esophageal aphidicolin
type, 129.8-130.4 miR-29b; miR- exact; 1 common 29a; and 2.5
miR-96; miR- 182s; miR-182as; miR-183; miR- 129-1 FRA7I 7q35 breast
FRA8B 8q22.1 FRA8E 8q24.1 FRA9D 9q22.1 bladder aphidicolin type,
89.5-92 let7a-1; let-7d; exact common let-7f-1 miR-23b; miR-24-1;
miR- 27b FRA9E 9q32-33.1 ovarian, bladder, aphidicolin type,
101.3-111.9 miR-32 exact YES cervical common FRA10B 10q25.2 FRA10C
10q21 FRA10D 10q22.1 FRA11A 11q13.3 hematopoietic and solid folic
acid type, 66.18-66.9 miR-159-1; miR- 1.2 tumors rare 192 FRA11B
11q23.3 folic acid type, 119.1-.2 miR-125b-1; let- 2 rare 7a-2;
miR-100 FRA12A 12q13.1 folic acid type, 53.55 miR-196-2; miR- 1
rare 148b FRA13C 13q21.2 FRA15A 15q22 aphidicolin type, 60.93
miR-190 exact common FRA16D 16q23.2 gastric adenocarcinoma,
adenocarcinomas of stomach, colon, lung and ovary FRA16E 16p12.1
FRA17B 17q23.1 aphidicolin type, 58.25-58.35 miR-21 exact YES
common miR-301 0.5 miR-142s; miR- 1.5 142as FRA18A 18q12.2
esophageal carcinoma FRA22A 22q13 FRAXA Xq27.31 FRAXB Xp22.3 FRAXE
Xq28 FRAXF Xq28 146.58 miR-105-1; miR- 2.2 175 Note: *other
microRNAs located close to HPV16 integration sites were found in
relation to FRA5C, FRA11C, FRA12B and FRA12E. Positions are
indicated according to Build 33 of the Human Genome.
Example 4
miR Genes are Located in or Near Cancer Associated Genomic
Regions
[0183] Because the miR-FRA-HPV16 association has significance for
cancer pathogenesis, miR genes might be involved in malignancies
through other mechanisms, such as deletion, amplification, or
epigenetic modifications. Thus, a search was performed for reported
genomic alterations in human cancers, located in regions containing
miR genes. PubMed was searched for reports of CAGR such as minimal
regions of loss-of-heterozygosity (LOH) suggestive of the presence
of tumor-suppressor genes (TSs), minimal regions of amplification
suggestive of the presence of oncogenes (OGs), and common
breakpoint regions in or near possible OGs or TSs (see General
Methods above). Overall, 98 of 187 (52.5%) miR genes were found to
be located in CAGRs (see Tables 6 and 7). Eighty of the miR genes
(43%) were found to be located exactly within minimal regions of
LOH or minimal regions of amplification described in a variety of
tumors, such as lung, breast, ovarian, colon, gastric and
hepatocellular carcinoma, as well as leukemias and lymphomas (see
Tables 6 and 7).
[0184] The analysis showed that on chromosome 9, eight of fifteen
mapped miR genes (including six located in clusters), were located
inside two regions of deletion on 9q (Simoneau et al., 1999,
Oncogene 7:157-163): the clusters let-7a-1/let-7f-1/let-7d and
miR-23b/miR-27b/miR-24-1 inside region B at 9q22.3 and miR-181a and
miR-199b inside region D at 9q33-34.1 (Table 6). Furthermore, five
other miR genes were located less than 2 Mb from the markers with
the highest rate of LOH: miR-31 near IFNA, miR-204 near D9S15,
miR-181 and miR-147 near GSN, and miR-123 near D9S67.
[0185] In breast carcinomas, two different regions of loss at
11q23, independent from the ATM locus, have been studied
extensively: the first spans about 2 Mb between loci D11S1347 and
D11S927; the second is located between loci D11S1345 and D11S1316
and is estimated at about 1 Mb (di Iasio et al., 1999, Oncogene
25:1635-1638). Despite extensive effort, the only candidate TS gene
found was the PPP2R1B gene, involved in less than 10% of reported
cases (Calin et al., 2002, Proc. Natl. Acad. Sci. USA
99:15524-15529; Wang et al., 1998, Science 282:284-7). Both of
these minimal LOH regions contained numerous microRNAs: the cluster
miR-34-a1/miR-34-a2 in the first and the cluster
miR-125b1/let-7a-2/miR-100 in the second.
[0186] High frequency LOH at 17p13.3 and relatively low TP53
mutation frequency in cases of hepatocellular carcinomas (HCC),
lung cancers and astrocytomas indicate the presence of other TSs
involved in the development of these tumors. One minimal LOH region
correlated with HCC, and located telomeric to TP53 between markers
D17S1866 and D17S1574 on chromosome 17, contained three miR genes:
miR-22, miR-132, and miR-212. miR-195 is located between ENO3 and
TP53 on chromosome 17.
[0187] Homozygous deletions (HD) in cancer can indicate the
presence of TSs (Huebner et al., 1998, Annu Rev. Genet. 32:7-31),
and several miR genes are located in homozygously deleted regions
without known TSs. In addition to miR-15a and miR-16a located at
13q14 HD region in B-CLL, the cluster miR-99a/let-7c/miR-125b-2
mapped in a 21p11.1 region of HD in lung cancers and miR-32 at
9q31.2 in a region of HD in various types of cancer. Among the
seven regions of LOH and HD on the short arm of chromosome 3, three
of the regions harbor miRs: miR-26a in region AP20, miR-138-1 in
region 5 at 3p21.3 and the cluster let-7g/miR-135-1 in region 3 at
3p21.1-p21.2. The locations of the miR genes/gene clusters are not
likely to be random, because it was found that overall, the
relative incidence of miRs in both deleted and amplified regions is
highly significant (IRR=4.08, p<0.001 and IRR=3.97, p=0.001,
respectively) (Table 4). Thus, these miRs expand the spectrum of
candidate TSs.
TABLE-US-00006 TABLE 6 Examples of microRNAs Located in Minimal
Deleted Regions, Minimal Amplified Regions, and Breakpoint Regions
Involved in Human Cancers* Location (defining Size Known Chromosome
markers) Mb MiR Gene Histotype OG/TS 3p21.1-21.2-D ARP- 7
let-7g/miR-135-1 lung, breast -- DRR1 cancer 3p21.3(AP20)-D GOLGA4-
0.75 miR-26a epithelial cancer -- VILL 3p23-21.31 D3S1768- 12.32
miR-26a; miR-138-1 nasopharyngeal -- (MDR2)-D D3S1767 cancer 5q32-D
ADRB2- 2.92 miR-145/miR-143 myelodysplastic -- ATX1 syndrome
9q22.3-D D9S280- 1.46 miR-24-1/mir-27b/miR- urothelial cancer PTC,
D9S1809 23b; FANCC let-7a-1/let-7f-1/let-7d 9q33-D D9S1826- 0.4
miR-123 NSCLC -- D9S158 11q23-q24-D D11S927- 1.994
miR-34a-1/miR-34a-2 breast, lung PPP2R1B D11S1347 cancer
11q23-q24-D D11S1345- 1.725 miR-125b-1/let-7a- breast, lung, --
D11S1328 2/miR-100 ovary, cervix cancer 13q14.3-D D13S272- 0.54
miR-15a/miR-16a B-CLL -- D13S25 13q32-33-A stSG15303- 7.15
miR-17/miR-18/miR- follicular -- stSG31624 19a/miR-20/miR-19b-
lymphoma 1/miR-92-1 17p13.3-D D17S1866- 1.899 miR-22; miR-132; miR-
HCC -- D17S1574 212 17p13.3-D ENO3- 2.275 miR-195 lung cancer TP53
TP53 17q22-t(8; 17) miR-142s/ miR-142s; miR-142as prolymphocytic
c-MYC c-MYC leukemia 17q23-A CLTC- 0.97 miR-21 neuroblastoma --
PPM1D 20q13-A FLJ33887- 0.55 miR-297-3 colon cancer -- ZNF217
21q11.1-D D21S1911- 2.84 miR-99a/let-7c/miR- lung cancer -- ANA
125b Note: *OG--oncogene; TS--tumor suppressor gene; D--deleted
region; A--amplified region; NSCLC--Non-Small Cell Lung Cancer;
HCC--Hepatocellular carcinoma; B-CLL--B-Chronic Lymphocytic
Leukemia; PTC--patched homolog (Drosophila); FANCC--Fanconi anemia,
complementation group C; PPP2R1B--protein phosphatase 2, regulatory
subunit A (PR 65), .beta. isoform. miR genes in a cluster are
separated by a slash.
TABLE-US-00007 TABLE 7 MicroRNAs Located in Minimal Deleted
Regions, Minimal Amplified Regions and Breakpoint Regions Involved
in Human Cancers Size/ miR Type of region Position Position
Distance Location Chromosome (name) Marker 1 (Mb) Marker 2 (Mb)
(Mb) Histotype Closest miR (Mb) 01p31 D D1S2638 62.92 ARHI 67.885
4.96 ovarian and miR-101-1 64.9 breast cancer 01p36.3 D D1S468 3.36
D1s2697 15.23 0 Non Small Cell miR-34 8.8 Lung Ca. 02q21 D D2S1334
136.66 0.1 gastric ca. miR-128a 136.55 02q37 D D2S125 241.5 0.2
hepatocellular miR-149 241.65 carcinoma (HCC) 03p21.1-21.2 D ARP
51.5 DRR1 58.5 7 lung, breast ca. let-7g/miR-135-1 52.3 03p21.3 D
(AP20) GOLGA4 37.25 VILL 38 0.75 epithelial miR-26a 38 malignancies
03p23-21.31 D (MDR2) D3S1768 34.59 D3S1767 46.91 12.32
nasopharyngeal miR-26a; miR- 38; 44 carcinoma 138-1 03q27 t(3;
11)(q27; q23.1) LAZ3/BCL6 188.75 BOB1/ 110.78 B cell leukemia
miR-34a-2/miR 110.9 OBF1 line (Karpas 231) 34a-1 04p15.3 D D4S1608
18.83 D4S404 23.98 5.15 primary bladder miR-218-1 20.25 ca.
05q31-33 D D5S1480 144.17 D5S820 156.1 11.93 prostate ca.
miR-145/miR- 148.7 aggressiveness 143 05q32 D ADRB2 148.23 ATX1
151.15 2.92 myelodysplastic miR-145/miR- 148.7 syndrome 143 07q32 D
D7S3061 122.84 D7S1804 131.25 8.41 prostate ca. miR-129-1; miR-
127.3; (aggressiveness) 182s/miR- 129; 130 182as/miR- 96/miR-183;
miR29a/miR-29b 07q32-q33 D D7S2531 130.35 D7S1804 131.69 1.34
prostate ca. miR-29a/miR- 130 (aggressiveness) 29b 08p21 D (MRL1)
D8S560 21.61 D8S1820 28.02 6.41 HCC miR-161; miR- 22; 21.5 177
08p21 D D8S282 21.42 0.1 HCC miR-177 21.5 08p22 D D8S254 16.62
SFTP2 22.05 5.43 oral and miR-161; miR- 22; 21.5 laryngeal 177
squamous carcinoma. 08p23.1 A D8S1819 6.737 D8S550 10.919 4.18
malignant miR-124a-1 9.75 fibrous histiocytomas (MFHs) 09p21 D
(LOH) IFNA 21.2 D9S171/ 22.07 0.87 primary bladder miR-31 21.4
S1814 tumor 09p21 D IFNA 21.5 0 lung miR-31 21.4 adenocarcinoma
09p21 D IFNA 21.5 0 gastric ca. miR-31 21.4 09p21 D CDKN2A, 21.9
0.5 breast ca. miR-31 21.4 CDKN2B 09q22 D D9S280 92.47 D9S1809
93.93 1.46 urothelial ca. miR-24-1/miR- 92.9; 92.3 27b/miR-23b;
let-7a-1/let- 7f1/let-7d 09q22.3 D (reg B) D9S12 91.21 D9S180 R
96.03 4.82 bladder ca. let-7a-1/let- 92.3; 92.9 7f1/let-7d; miR-
24-1/miR- 27b/miR-23b 09q32 D D9S1677 107.35 0.2 Small Cell Lung
miR-32 107.15 Ca., Non-Small Cell Lung Ca. 09q33 D D9S1826 133.88
D9S158 134.53 0.4 NSCLC miR-123 134.95 09q33-34.1 D (reg D) GSN
119.45 D9S260 127.09 7.64 bladder ca. miR-181a; miR- 122.85; 199b
126.3 09q34 D D9S158 134.54 0.4 HCC miR-123 134.95 11p15 D D11S2071
0.23 0.4 ovarian ca. miR-210 0.6 11p15.5 D (LOH11B) HRAS 0.52
D11S1363 1.05 0.53 lung ca. miR-210 0.6 11q13 D D11S4946 64.35
D11S4939 64.54 0.19 sporadic miR-159-1/miR- 64.45 follicular
thyroid 192 tumor 11q22 D D11S940/ 100.65 CD3D/ 118.7 18.05 lung
miR-34a-1/miR- 111 S1782 D11S4104 adenocarcinoma 34a-2 11q22.1-23.2
D (MDR3) D11S2017 107.05 D11S965 111.3 4.25 nasopharyngeal
miR-34a-1/miR- 111 carcinoma 34a-2 11q22.3-q25 D D11S1340 116.12
D11S912 128.16 12.04 ovarian ca. miR125b-1/let- 121.5 7a-2/miR-100
11q22-q23 D D11S2106/ 108.76 D11S1356 117.454 8.7 chronic
miR-34a-1/miR- 111 S2220 lymphocytic 34a-2 leukemia 11q23 D
D11S1647 110.34 NCAM2/ 112.5 2.16 lung ca. miR-34a-1/miR- 111 NCAM1
34a-2 11q23 D D11S1345 121.83 D11S1328 123.56 1.73 lung
miR125b-1/let- 121.5 adenocarcinoma 7a-2/miR-100 11q23 D D11S1345
121.83 D11S1328 123.56 1.73 lung miR125b-1/let- 121.5
adenocarcinoma 7a-2/miR-100 11q23.1-23.2 D (LOH) D11S4167 121.68
D11S4144 122.96 1.28 cervical ca. miR125b-1/let- 121.5 7a-2/miR-100
11q23-q24 D D11S927 109.676 D11S1347 111.67 1.994 breast, lung ca.
miR-34a-1/miR- 111 (LOH11CR1) 34a-2 11q23-q24 D D11S1345 121.835
D11S1328 123.56 1.725 breast, lung, miR125b-1/let- 121.5 (LOH11CR2)
ovary, cervix ca. 7a-2/miR-100 12p13 t(7; 12)(q36; p13) TEL(ETV6)
11.83 near HLXB9 156.21 acute myeloid miR-153-2 156.6 leukemia
(AML) 12q13-q14 A DGKA 54.6 BLOV1 67.4 12.8 adenocarcinomas let-7i
61.35 of lung and esophagus 12q13-q15 A GLI 56.15 MDM2 67.5 11.35
bladder ca. let-7i 61.3-.45 12q22 D D12S1716 95.45 P382A8AG/ 97.47
2.02 male germ cell miR-135-2 96.5 D12S296 tumors 12q22 D D12S377/
94.1 D12S296 97.47 3.37 male germ cell miR-135-2 96.5 D12S101
tumors. 13q14.3 D D13S319/ 48.5 D13S25 49.04 0.54 B-Chronic
miR-15a/miR- 48.5 D13S272 Lymphocytic 16a Leuk (B-CLL) 13q14 D
D13S260 30.23 AFMa301wb5 48.62 18.39 adult miR-15a/miR- 48.5
Lymphoblastic 16a leukemia 13q14 D Rb1 46.77 BCMS 48.46 1.69 lipoma
miR-15a/miR16a 48.5 (DLEU-1) 13q14.3 D (RMD) D13S272 48.5 AF077401
48.765 0.265 CLL miR-15a/miR- 48.5 16a 13q14.3 D (Reg II) D13S153
46.68 D13S1289 62.43 15.75 head-and-neck miR-15a/miR- 48.5
squamous-cell 16a carcinoma 13q14.3 D D13S273 48.11 D13S176 58.31
10.2 oral ca. miR-15a/miR- 48.5 16a 13q14.3 D D13S1168 48.28 D13S25
49.04 0.76 B-CLL miR-15a/miR- 48.5 16a 13q32-33 A stSG15303 89.7
stSG31624 96.85 7.15 follicular miR-17/miR- 89.7 Lymphoma
18/miR-19a/miR- 20/miR-19b- 1/miR-92-1 14q11.1-q12 D D14S283 20.67
D14S64 22.55 1.88 malignant miR-208 21.8 mesothelioma 14q32 D
D14S51 95.56 telomere 105.2 9.64 nasopharyngeal miR-127/miR- 99.3;
99.5; carcinoma 136; miR- 102.5 154/miR- 134/miR-299; miR-203
15q11.1-15 D D15S128 22.67 D15S1012 36.72 14.05 malignant miR-211
29 mesothelioma. 17p11.2 A PNMT 17.351 0.5 breast ca miR-33b 17.8
17p11.2 D D17S1857 16.61 D17S805/ 20.79 4.18 kidney ca (Birt-
miR-33b 17.9 S959 Hogg-Dube sy) 17p11.2 D D117S1857 16.61 D17S805/
20.79 4.18 medulloblastoma miR-33b 17.9 S959 (Smith-Magenis
syndrome) 17p13 D D17S578 7.025 0 HCC miR-195 7 17p13.3 D D17S1866
0.121 D17S1574 2.02 1.9 HCC miR-22; miR- 1.75; 2.2 132; miR-212
17p13.3 D ENO3 5.5 TP53 7.775 2.275 lung ca. miR-195 7 17p13.3 D
D17S1574 2.02 D17S379 2.46 0.44 lung ca. miR-132; miR- 2.2 212
17q11.1 D NF1 29.7 0.3 ovarian ca. miR-108-1 30 17q11.1 D NF1 29.7
0.3 ovarian ca. miR-193 30 17q11.2 A MLN 62 27.22 0.1 primary
breast miR-144 27.35 (TRAF4) ca. 17q11.2 D (NF1 locus) CYTOR4 29.25
WI-12393 30.52 1.27 NF1 miR-108-1/miR- 30; 30 microdeletion 193
17q22 t(8; 17) "BCL3" 56.95 c-MYC 128.7 prolymphocytic
miR-142s/miR- 56.95 leukemia 142as 17q23 A RAD51C 57.116 0.25
breast ca. miR-142s/miR- 56.95 142as 17q23 A RAD51C 57.116 0.5
breast ca. miR-301 57.7 17q23 A CLTC 58.21 PPM1D 59.18 0.97
neuroblastoma miR-21 58.45 17q25 A (SRO2) D17S1306 53.76 D17S1604
58.45 4.69 breast ca. miR-142s; miR- 56.95; 142as; miR-301; 57.7;
miR-21 58.45 19p13.3 D D19S886 0.95 D19S216 4.9 3.95 lung miR-7-3
4.75 adenocarcinoma 19p13.3 D (LOH) D19S216 4.9 D19S549 5.44 0.54
gynecological miR-7-3 4.75 tumor in Peutz- Jegher's sy 19p13.3 D
(HZYG) D19S894 4.34 D19S395 7.32 2.98 gynecological miR-7-3 4.75
tumor in Peutz- Jegher's sy 19p13.3 D (LOH) D19S886 0.95 D19S216
4.9 3.95 pancreatic and miR-7-3 4.75 biliary ca 20q13 A FLJ33887
52.2 ZNF217 52.75 0.55 colon ca miR-297-3 52.35 20q13.1 A ZNF217
52.285 0 ovarian miR-297-3 52.35 20q13.2 A D20S854 52.68 D20S120
53.69 1.01 gastric miR-297-3 52.35 adenocarcinoma 20q13.2 A ZNF217
52.85 0.5 head/neck miR-297-3 52.35 squamous carcinoma 21q11.1 D
D21S120/ 15.06 ANA 17.9 2.84 lung ca. (cell line miR-99a/let- 16.8
S1911 MA17) 7c/miR-125b-2 21q21 A BIC 25.8 BIC 25.9 0.1 colon ca.
miR-155(BIC) 25.85 22q12.2-q13.33 D D22S280 31.53 D22S274 43.54
12.01 colorectal ca. miR-33a 40.6 22q12.3-q13.33 D D22S280 31.53
D22S282 42.1 10.57 astrocytomas miR-33a 40.6 22q12.1 t(4; 22) MN1
26.5 meningioma miR-180 26.45 Xq25-26.1 D DXS1206 125.08 HPRT
132.31 7.23 advanced miR-92-2/miR- 132 ovarian ca. 19b-2/miR-106a
Note: D--deletion; A--amplification; ca.--cancer; sy--syndrome. The
distance (in Mb) from the markers used in genome-wide analysis is
shown. miRs in clusters are separated by a slash. Positions are
according to BUILD 34, version 1, of the Human Genome
Example 4B
Effect of Genomic Location on miR Gene Expression
[0188] In order to investigate whether the genomic location in
deleted regions influences miR gene expression, a set of lung
cancer cell lines was analyzed. miR-26a and miR-99a, located at
3p21 and 21q1.2, respectively, are not expressed or are expressed
at low levels in lung cancer cell lines. The locations of miR-26a
and miR-99a correlate with regions of LOH/HD in lung tumors.
However, the expression of miR-16a (located at 13q14) was unchanged
in the majority of lung tumor cell lines as compared to normal lung
(see FIG. 1).
[0189] Several miR genes are located near breakpoint regions,
including miR-142s at 50 nt from the t(8;17) translocation
involving chromosome 17 and MYC, and miR-180 at 1 kb from the MN1
gene involved in a t(4;22) translocation in meningioma (Table 6).
The t(8;17) translocation brings the MYC gene near the miR gene
promoter, with consequent MYC over-expression, while the t(4;22)
translocation inactivates the MN1 gene, and possibly inactivates
the miR gene located in the same position. Other miR genes are
located relatively close to chromosomal breakpoints, such as the
cluster miR 34a-1/34a-2 and miR-153-2 (see Table 7). Further
supporting a role for miR-122a in cancer, it was found herein that
human miR-122a is located in the minimal amplicon around MALT1 in
aggressive marginal zone lymphoma (MZL), and was found to be about
160 kb from the breakpoint region of translocation t(11;18) in
mucosa-associated lymphoid tissue (MALT) lymphoma
(Sanchez-Izquierdo et al., 2003, Blood 101:4539-4546). Apart from
miR-122a, several other miR genes were located in regions
particularly prone to cancer-specific abnormalities, such as
miR-142s and miR-142 as, located at 17q23 close to a t(8;17)
breakpoint in B cell acute leukemia, and also located within the
minimal amplicon in breast cancer and near the FRA17B site, which
is also a target for HPV16 integration in cervical tumors (see
Tables 5 and 7).
Example 5
MicroRNAs are Located in or Near HOX Gene Clusters
[0190] Homeobox-containing genes are a family of transcription
factor genes that play crucial roles during normal development and
in oncogenesis. HOXB4, HOXB5, HOXC9, HOXC10, HOXD4 and HOXD8, all
with miR gene neighbors, are deregulated in a variety of solid and
hematopoietic cancers (Cillo et al., 1999, Exp. Cell Res. 248:1-9;
Owebs et al., 2002, Stem Cells 20:364-379). A strong correlation
was found between the location of specific miR genes and homeobox
(HOX) genes. The miR-10a and miR-196-1 genes are located within the
HOX B cluster on 17q21, while miR-196-2 is within the HOX C cluster
at 12q13, and miR-10b maps to the HOX D cluster at 2q31 (see FIG.
2). Moreover, three other miRs (miR-148, miR-152 and miR-148b) are
close to HOX clusters (less than 1 Mb; see FIG. 2). The 1 Mb
distance was selected because some form of long-range coordinated
regulation of gene expression was shown to expand up to one
megabase to HOX clusters (Kamath et al., 2003, Nature 421:231-7).
Such proximity of miR genes to HOX gene clusters is unlikely to
have occurred by chance (IRR=15.77; p<0.001) (Table 4). Because
collinear expression of, and cooperation between, HOX genes is well
demonstrated, these data indicated that miRs are altered along with
the HOX genes in human cancers.
[0191] Next, it was determined whether miR genes were located
within class II HOX gene clusters as well. Fourteen additional
human HOX gene clusters (Pollard et al., 2000, Current Biology
10:1059-1062) were analyzed, and seven miR genes (miR-129-1,
miR-153-2, let-7a-1, let-7f-1, let-7d, miR-202 and miR-139) were
located within 0.5 Mb of class II homeotic genes, a result which
was highly unlikely to occur by chance (IRR=2.95, p<0.001)
(Table 4).
Example 6
Expression of miR Gene Products in Human Cells
[0192] The cDNA sequence encoding the entire miR precursor
transcript of an miR gene is separately cloned into the context of
an irrelevant mRNA expressed under the control of the
cytomegalovirus immediate early (CMV-IE) promoter, according to the
procedure of Zeng et al., 2002, Mol. Cell. 9:1327-1333, the entire
disclosure of which is herein incorporated by reference.
[0193] Briefly, Xho I linkers are placed on the end of
double-stranded cDNA sequences encoding an miR precursor, and this
construct is separately cloned into the Xho I site present in the
pBC12/CMV plasmid. The pBC12/CMV plasmid is described in Cullen,
1986, Cell 46:973-982, the entire disclosure of which is herein
incorporated by reference.
[0194] pCMV plasmid containing the miR precursor coding sequence is
transfected into cultured human 293T cells by standard techniques
using the FuGene 6 reagent (Roche). Total RNA is extracted as
described above, and the presence of the processed miR transcript
is detected by Northern blot analysis with an miR probe specific
for the miR transcript.
[0195] pCMV-miR is also transfected into cultured human normal
cells or cells with proliferative disorders, such as cancer cells.
For example, the proliferative disease or cancer cell types include
ovarian cancer, breast cancer, small cell lung cancer, sporadic
follicular thyroid tumor, chronic lymphocytic leukemia, cervical
cancer, acute myeloid leukemia, adenocarcinomas, male germ cell
tumor, non-small cell lung cancer, gastric cancer, hepatocellular
carcinoma, lung cancer, nasopharyngeal cancer, B-chronic
lymphocytic leukemia, lipoma, mesothelioma, kidney cancer, NF1
microdeletion, neuroblastoma, medulloblastoma, pancreatic cancer,
biliary cancer, colon cancer, gastric adenocarcinoma, head/neck
squamous carcinoma, astrocytoma, meningioma, B cell leukemia,
primary bladder cancer, prostate cancer, myelodysplastic syndrome,
oral cavity carcinoma, laryngeal squamous carcinoma, and urothelial
cancer. Total RNA is extracted as described above, and the presence
of processed miR transcripts in the cancer cells is detected by
Northern blot analysis with miR specific probes. The transfected
cells are also evaluated for changes in morphology, the ability to
overcome contact inhibition, and other markers indicative of a
transformed phenotype.
Example 7
Preparation of Liposomes Encapsulating MiR Gene Products
[0196] Liposome Preparation 1--Liposomes composed of lactosyl
cerebroside, phosphatidylglycerol, phosphatidylcholine, and
cholesterol in molar ratios of 1:1:4:5 are prepared by the reverse
phase evaporation method described in U.S. Pat. No. 4,235,871, the
entire disclosure of which is herein incorporated by reference. The
liposomes are prepared in an aqueous solution of 100 .mu.g/ml
processed miR transcripts or 500 .mu.g/ml pCMV-microRNA. The
liposomes thus prepared encapsulate either the processed microRNA,
or the pCMV-microRNA plasmids.
[0197] The liposomes are then passed through a 0.4 polycarbonate
membrane and suspended in saline, and are separated from
non-encapsulated material by column chromatography in 135 mM sodium
chloride, 10 mM sodium phosphate (pH 7.4). The liposomes are used
without further modification, or are modified as described
herein.
[0198] A quantity of the liposomes prepared above are charged to an
appropriate reaction vessel to which is added, with stirring, a
solution of 20 mM sodium metaperiodate, 135 mM sodium chloride and
10 mM sodium phosphate (pH 7.4). The resulting mixture is allowed
to stand in darkness for 90 minutes at a temperature of about
20.degree. C. Excess periodate is removed by dialysis of the
reaction mixture against 250 ml of buffered saline (135 mM sodium
chloride, 10 mM sodium phosphate, pH 7.4) for 2 hours. The product
is a liposome having a surface modified by oxidation of
carbohydrate hydroxyl groups to aldehyde groups. Targeting groups
or opsonization inhibiting moieties are conjugated to the liposome
surface via these aldehyde groups.
[0199] Liposome Preparation 2--A second liposome preparation
composed of maleimidobenzoyl-phosphatidylethanolamine (MBPE),
phosphatidylcholine and cholesterol is obtained as follows. MBPE is
an activated phospholipid for coupling sulfhydryl-containing
compounds, including proteins, to the liposomes.
[0200] Dimyristoylphosphatidylethanolamine (DMPE) (100 mmoles) is
dissolved in 5 ml of anhydrous methanol containing 2 equivalents of
triethylamine and 50 mg of m-maleimidobenzoyl N-hydroxysuccinimide
ester, as described in Kitagawa et al. (1976), J. Biochem.
79:233-236, the entire disclosure of which is herein incorporated
by reference. The resulting reaction is allowed to proceed under a
nitrogen gas atmosphere overnight at room temperature, and is
subjected to thin layer chromatography on Silica gel H in
chloroform/methanol/water (65/25/4), which reveals quantitative
conversion of the DMPE to a faster migrating product. Methanol is
removed under reduced pressure and the products re-dissolved in
chloroform. The chloroform phase is extracted twice with 1% sodium
chloride and the maleimidobenzoyl-phosphatidylethanolamine (MBPE)
purified by silicic acid chromatography with chloroform/methanol
(4/1) as the solvent. Following purification, thin-layer
chromatography indicates a single phosphate containing spot that is
ninhydrin negative.
[0201] Liposomes are prepared with MBPE, phosphatidylcholine and
cholesterol in molar ratios of 1:9:8 by the reverse phase
evaporation method of U.S. Pat. No. 4,235,871, supra, in an aqueous
solution of 100 .mu.g/ml processed microRNA or a solution of 500
.mu.g/ml pCMV-miR (see above). Liposomes are separated from
non-encapsulated material by column chromatography in 100 mM sodium
chloride-2 mM sodium phosphate (pH 6.0).
Example 8
Attachment of Anti-Tumor Antibodies to Liposomes
[0202] An appropriate vessel is charged with 1.1 ml (containing
about 10 mmoles) of Liposome Preparation 1 (see above) carrying
reactive aldehyde groups, or Liposome Preparation 2 (see above).
0.2 ml of a 200 mM sodium cyanoborohydride solution and 1.0 ml of a
3 mg/ml solution of a monoclonal antibody directed against a tumor
cell antigen is added to the preparation, with stirring. The
resulting reaction mixture is allowed to stand overnight while
maintained at a temperature of 4.degree. C. The reaction mixture is
separated on a Biogel A5M agarose column (Biorad, Richmond, Calif.;
1.5.times.37 cm).
Example 9
Inhibition of Human Tumor Growth In Vivo with miR Gene Products
[0203] A cancer cell line, such as one of the lung cancer cell
lines described above or a tumor-derived cell, is inoculated into
nude mice, and the mice are divided into treatment and control
groups. When tumors in the mice reach 100 to 250 cubic millimeters,
processed miR transcripts encapsulated in liposomes are injected
directly into the tumors of the test group. The tumors of the
control group are injected with liposomes encapsulating carrier
solution only. Tumor volume is measured throughout the study.
Example 10
Oligonucleotide Microchip for Genome-wide miRNA Profiling
Introduction
[0204] A micro-chip microarray was prepared as follows, containing
368 gene-specific oligonucleotide probes generated from 248 miRNAs
(161 human, 84 mouse, and 3 arabidopsis) and 15 tRNAs (8 human and
7 mouse). These sequences correspond to human and mouse miRNAs
found in the miRNA Registry (June 2003) (Griffiths-Jones, S. (2004)
Nucleic Acids Res. 32, D109-D111) or collected from published
literature (Lagos-Quintana, M., Rauhut, R., Lendeckel, W. &
Tuschl, T. (2001) Science 294, 853-858; Lim, L. P., Glasner, M. E.,
Yekta, S., Burge, C. B. & Bartel, D. P. (2003) Science 299,
1540; Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A.,
Charroux, B., Abel, L., Rappsilber, J., Mann, M. & Dreyfuss, G.
(2002) Genes Dev 16, 720-728). For 76 miRNAs, two different
oligonucleotide probes were designed, one containing the active
sequence and the other specific for the precursor. Using these
distinct sequences, we were able to separately analyze the
expression of miRNA and pre-miRNA transcripts for the same
gene.
[0205] Various specificity controls were used to validate data. For
intra-assay validation, individual oligonucleotide-probes were
printed in triplicate. Fourteen oligonucleotides had a total of six
replicates because of identical mouse and human sequences and
therefore were spotted on both human and mouse sections of the
array.
[0206] Several mouse and human orthologs differ only in few bases,
serving as controls for the hybridization stringency conditions.
tRNAs from both species were also printed on the microchip,
providing an internal, relatively stable positive, control for
specific hybridization, while Arabidopsis sequences were selected,
based on the absence of any homology with known miRNAs from other
species, and used as controls for non-specific hybridization.
[0207] Materials and Methods
[0208] The following materials and methods were employed in
designing and testing the microchip.
[0209] miRNA Oligonucleotide Probe Design. A total of 281 miRNA
precursor sequences (190 Homo sapiens, 88 Mus musculus, and 3
Arabidopsis thaliana) with annotated active sites were selected for
oligonucleotide design. These correspond to human and mouse miRNAs
found in the miRNA Registry or collected from published literature.
All of the sequences were confirmed by BLAST alignment with the
corresponding genome and the hairpin structures were analyzed. When
two precursors with different length or slightly different base
composition for the same miRNAs were found, both sequences were
included in the database and the one that satisfied the highest
number of design criteria was used. The sequences were clustered by
organism using the LEADS platform (Sorek, R., Ast, G. & Graur,
D. (2002) Genome Research 12, 1060-1067), resulting in 248 clusters
(84 mouse, 161 human, and 3 arabidopsis). For each cluster, all
40-mer oligonucleotides were evaluated for their cross-homology to
all genes of the relevant organism, number of bases in alignment to
a repetitive element, amount of low-complexity sequence, maximum
homopolymeric stretch, global and local G+C content, and potential
hairpins (self 5-mers). The best oligonucleotide was selected that
contained each active site of each miRNA. This produced a total of
259 oligonucleotides; there were 11 clusters with multiple
annotated active sites. Next, we attempted to design an
oligonucleotide that did not contain the active site for each
cluster, when it was possible to choose such an oligonucleotide
that did not overlap the selected oligonucleotide(s) by more than
10 nt. To design each of these additional oligonucleotides, we
required <75% global cross-homology and <20 bases in any 100%
alignment to the relevant organism, <16 bases in alignments to
repetitive elements, <16 bases of low-complexity, homopolymeric
stretches of no more than 6 bases, G+C content between 30-70% and
no more than 11 windows of size 10 with G+C content outside 30-70%,
and no self 5-mers. A total of 76 additional oligonucleotides were
designed. In addition, we designed oligonucleotides for 7 mouse
tRNAs and 8 human tRNAs, using similar design criteria. We selected
a single oligonucleotide for each, with the exception of the human
and mouse initiators, Met-tRNA-i, for which we selected two
oligonucleotides each (Table 8).
TABLE-US-00008 TABLE 8 Oligonucleotides used for the miRNA
microarray chip and correspondence with specific human and mouse
microRNAs. Covers SEQ Corresponding active ID Oligonucleotide_name
miRNA Oligonucleotide sequence site? Notes NO. ath-miR156a-#1
ath-miR156a TGACAGAAGAGAGTGAGCACACAAAGGCAATTTGCATATC yes 286
ath-miR156a-#2 ath-miR156a CATTGCACTTGCTTCTCTTGCGTGCTCACTGCTCTTTCTG
no 287 ath-miR157a-#1 ath-miR157a
GTGTTGACAGAAGATAGAGAGCACAGATGATGAGATACAA yes 288 ath-miR157a-#2
ath-miR157a CATCTTACTCCTTTGTGCTCTCTAGCCTTCTGTCATCACC no 289
ath-miR180a-#1 ath-miR180 GATGGACGGTGGTGATTCACTCTCCACAAAGTTCTCTATG
no 290 ath-miR180a-#2 ath-miR180
TGAGAATCTTGATGATGCTGCATCGGCAATCAACGACTAT yes 291 hsa-let-7a-1-prec
let-7a-1 TGAGGTAGTAGGTTGTATAGTTTTAGGGTCACACCCACCA yes 292
hsa-let-7a-2-prec-#1 let-7a-2
TACAGCCTCCTAGCTTTCCTTGGGTCTTGCACTAAACAAC no 293
hsa-let-7a-2-prec-#2 let-7a-2
ACTGCATGCTCCCAGGTTGAGGTAGTAGGTTGTATAGTTT yes 294 hsa-let-7a-3-prec
let-7a-3 GGGTGAGGTAGTAGGTTGTATAGTTTGGGGCTCTGCCCTG yes 295
hsa-let-7b-prec let-7b TGAGGTAGTAGGTTGTGTGGTTTCAGGGCAGTGATGTTGC yes
296 hsa-let-7c-prec let-7c GCATCCGGGTTGAGGTAGTAGGTTGTATGGTTTAGAGTTA
yes 297 hsa-let-7d-prec let-7d
CCTAGGAAGAGGTAGTAGGTTGCATAGTTTTAGGGCAGGG yes 298 hsa-let-7d-v1-prec
let-7d CTAGGAAGAGGTAGTAGTTTGCATAGTTTTAGGGCAAAGA yes 299 (= 7d-v1)
hsa-let-7d-v2-prec-#1 let-7i
TTGGTCGGGTTGTGACATTGCCCGCTGTGGAGATAACTGC no 300 (= let-7d-v2)
hsa-let-7d-v2-prec-#2 let-7i
GCTGAGGTAGTAGTTTGTGCTGTTGGTCGGGTTGTGACAT yes idem mmu- 301 (=
let-7d-v2) let-7i-prec hsa-let-7e-prec let-7e
GGCTGAGGTAGGAGGTTGTATAGTTGAGGAGGACACCCAA yes 302
hsa-let-7f-1-prec-#1 let-7f-1
GGTAGTGATTTTACCCTGTTCAGGAGATAACTATACAATC no 303
hsa-let-7f-1-prec-#2 let-7f-1
GGGATGAGGTAGTAGATTGTATAGTTGTGGGGTAGTGATT yes 304 hsa-let-7f-2-prec2
let-7f-2 TGAGGTAGTAGATTGTATAGTTTTAGGGTCATACCCCATC yes 305
hsa-let-7g-prec-#1 let-7g CTGATTCCAGGCTGAGGTAGTAGTTTGTACAGTTTGAGGG
yes 306 hsa-let-7g-prec-#2 let-7g
TTGAGGGTCTATGATACCACCCGGTACAGGAGATAACTGT no 307
hsa-miR-001b-1-prec1 miR-001
AATGCTATGGAATGTAAAGAAGTATGTATTTTTGGTAGGC yes 308
hsa-miR-001b-2-prec miR-001
TAAGCTATGGAATGTAAAGAAGTATGTATCTCAGGCCGGG yes 309 hsa-miR-007-1-prec
miR-007-1 TGTTGGCCTAGTTCTGTGTGGAAGACTAGTGATTTTGTTG yes 310
hsa-miR-007-2-prec-#1 miR-007-2
TACTGCGCTCAACAACAAATCCCAGTCTACCTAATGGTGC no 311
hsa-miR-007-2-prec-#2 miR-007-2
GGACCGGCTGGCCCCATCTGGAAGACTAGTGATTTTGTTG yes 312
hsa-miR-007-3-prec-#1 miR-007-3
AGATTAGAGTGGCTGTGGTCTAGTGCTGTGTGGAAGACTA no 313
hsa-miR-007-3-prec-#2 miR-007-3
TGGAAGACTAGTGATTTTGTTGTTCTGATGTACTACGACA yes 314 hsa-miR-009-1-#1
miR-009-1 TCTTTGGTTATCTAGCTGTATGAGTGGTGTGGAGTCTTCA yes 315
(miR-131-1) hsa-miR-009-1-#2 miR-009-1
TAAAGCTAGATAACCGAAAGTAAAAATAACCCCATACACT yes 316 (miR-131-1)
hsa-miR-009-2-#1 miR-009-2 GAAGCGAGTTGTTATCTTTGGTTATCTAGCTGTATGAGTG
yes 317 (miR-131-2) hsa-miR-009-2-#2 miR-009-2
GAGTGTATTGGTCTTCATAAAGCTAGATAACCGAAAGTAA yes idem mmu- 318
(miR-131-2) miR-009- prec-#2 hsa-miR-009-3-#1 miR-009-3
GGGAGGCCCGTTTCTCTCTTTGGTTATCTAGCTGTATGAG yes 319 (miR-131-3)
hsa-miR-009-3-#2 miR-009-3 GTGCCACAGAGCCGTCATAAAGCTAGATAACCGAAAGTAG
yes 320 (miR-131-3) hsa-miR-010a-prec-#1 miR-010a
GTCTGTCTTCTGTATATACCCTGTAGATCCGAATTTGTGT yes 321
hsa-miR-010a-prec-#2 miR-010a
GTGGTCACAAATTCGTATCTAGGGGAATATGTAGTTGACA no 322
hsa-miR-010b-prec-#1 miR-010b
TACCCTGTAGAACCGAATTTGTGTGGTATCCGTATAGTCA yes 323
hsa-miR-010b-prec-#2 miR-010b
GTCACAGATTCGATTCTAGGGGAATATATGGTCGATGCAA no 324
hsa-miR-015a-2-prec-#1 miR-15-a
CCTTGGAGTAAAGTAGCAGCACATAATGGTTTGTGGATTT yes 325
hsa-miR-015a-2-prec-#2 miR-15-a
TTTGTGGATTTTGAAAAGGTGCAGGCCATATTGTGCTGCC no 326
hsa-miR-015b-prec-#1 miR-015-b
GGCCTTAAAGTACTGTAGCAGCACATCATGGTTTACATGC yes 327
hsa-miR-015b-prec-#2 miR-015-b
TGCTACAGTCAAGATGCGAATCATTATTTGCTGCTCTAGA no 328 hsa-miR-016a-chr13
miR-016-1 CAATGTCAGCAGTGCCTTAGCAGCACGTAAATATTGGCGT yes 329
hsa-miR-016b-chr3 miR-016-2
GTTCCACTCTAGCAGCACGTAAATATTGGCGTAGTGAAAT yes 330
hsa-miR-017-prec-#1 miR-017
GCATCTACTGCAGTGAAGGCACTTGTAGCATTATGGTGAC yes 331 (miR-091)
hsa-miR-017-prec-#2 miR-017
GTCAGAATAATGTCAAAGTGCTTACAGTGCAGGTAGTGAT yes 332 (miR-091)
hsa-miR-018-prec miR-018 TAAGGTGCATCTAGTGCAGATAGTGAAGTAGATTAGCATC
yes 333 hsa-miR-019a-prec miR-019a
TGTAGTTGTGCAAATCTATGCAAAACTGATGGTGGCCTGC yes 334
hsa-miR-019b-1-prec miR-019b-1
TTCTGCTGTGCAAATCCATGCAAAACTGACTGTGGTAGTG yes 335
hsa-miR-019b-2-prec miR-019b-2
GTGGCTGTGCAAATCCATGCAAAACTGATTGTGATAATGT yes 336 hsa-miR-020-prec
miR-020 TAAAGTGCTTATAGTGCAGGTAGTGTTTAGTTATCTACTG yes 337
hsa-miR-021-prec-17-#1 miR-021
GTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAATCTC yes 338
hsa-miR-021-prec-17-#2 miR-021
TTCAACAGTCAACATCAGTCTGATAAGCTACCCGACAAGG yes 339 hsa-miR-022-prec
miR-022 TGTCCTGACCCAGCTAAAGCTGCCAGTTGAAGAACTGTTG yes 340
hsa-miR-023a-prec miR-023a TCCTGTCACAAATCACATTGCCAGGGATTTCCAACCGACC
yes 341 hsa-miR-023b-prec miR-023b
AATCACATTGCCAGGGATTACCACGCAACCACGACCTTGG yes 342
hsa-miR-024-1-prec-#1 miR-024-1
TTTTACACACTGGCTCAGTTCAGCAGGAACAGGAGTCGAG yes 343
hsa-miR-024-1-prec-#2 miR-024-1
TCCGGTGCCTACTGAGCTGATATCAGTTCTCATTTTACAC yes 344 hsa-miR-024-2-prec
miR-024-2 AGTTGGTTTGTGTACACTGGCTCAGTTCAGCAGGAACAGG yes 345
hsa-miR-025-prec miR-025 ACGCTGCCCTGGGCATTGCACTTGTCTCGGTCTGACAGTG
yes 346 hsa-miR-026a-prec-#1 miR-026a
TTCAAGTAATCCAGGATAGGCTGTGCAGGTCCCAATGGCC yes 347
hsa-miR-026a-prec-#2 miR-026a
TCCCAATGGCCTATCTTGGTTACTTGCACGGGGACGCGGG no 348 hsa-miR-026b-prec
miR-026b TTCAAGTAATTCAGGATAGGTTGTGTGCTGTCCAGCCTGT yes 349
hsa-miR-027a-prec miR-027a GTCCACACCAAGTCGTGTTCACAGTGGCTAAGTTCCGCCC
yes 350 hsa-miR-027b-prec miR-027b
CCGCTTTGTTCACAGTGGCTAAGTTCTGCACCTGAAGAGA yes 351 hsa-miR-028-prec
miR-028 AAGGAGCTCACAGTCTATTGAGTTACCTTTCTGACTTTCC yes 352
hsa-miR-029a-2-#1 miR-029a CTAGCACCATCTGAAATCGGTTATAATGATTGGGGAAGAG
yes 353 hsa-miR-029a-2-#2 miR-029a
CCCCTTAGAGGATGACTGATTTCTTTTGGTGTTCAGAGTC no 354 hsa-miR-029b-2 =
miR-029b AGTGATTGTCTAGCACCATTTGAAATCAGTGTTCTTGGGG yes 355
102prec7.1 = 7.2 (= miR-102- 7.1 = 7.2) hsa-miR-029c-prec miR-029c
TTTTGTCTAGCACCATTTGAAATCGGTTATGATGTAGGGG yes 356
hsa-miR-030a-prec-#1 miR-030a-as
GCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACA yes 357
hsa-miR-030a-prec-#2 miR-030a-s
CACAGATGGGCTTTCAGTCGGATGTTTGCAGCTGCCTACT yes 358
hsa-miR-030b-prec-#1 miR-030b
TGTAAACATCCTACACTCAGCTGTAATACATGGATTGGCT yes 359
hsa-miR-030b-prec-#2 miR-030b
ATGGATTGGCTGGGAGGTGGATGTTTACTTCAGCTGACTT no 360 hsa-miR-030c-prec
miR-030c TACTGTAAACATCCTACACTCTCAGCTGTGGAAAGTAAGA yes 361
hsa-miR-030d-prec-#1 miR-030d
TAAGACACAGCTAAGCTTTCAGTCAGATGTTTGCTGCTAC no 362
hsa-miR-030d-prec-#2 miR-030d
TTGTAAACATCCCCGACTGGAAGCTGTAAGACACAGCTAA yes
363 hsa-miR-031-prec miR-031
GGCAAGATGCTGGCATAGCTGTTGAACTGGGAACCTGCTA yes 364
hsa-miR-032-prec-#1 miR-032
TGTCACGGCCTCAATGCAATTTAGTGTGTGTGATATTTTC no 365 hsa-miR-032-prec-#2
miR-032 GGAGATATTGCACATTACTAAGTTGCATGTTGTCACGGCC yes 366
hsa-miR-033b-prec miR-033b GTGCATTGCTGTTGCATTGCACGTGTGTGAGGCGGGTGCA
yes 367 hsa-miR-033-prec miR-33
GTGGTGCATTGTAGTTGCATTGCATGTTCTGGTGGTACCC yes 368
hsa-miR-034-prec-#1 miR-034
GAGTGTTTCTTTGGCAGTGTCTTAGCTGGTTGTTGTGAGC yes 369 (= miR-170)
hsa-miR-034-prec-#2 miR-034
AGTAAGGAAGCAATCAGCAAGTATACTGCCCTAGAAGTGC no 370 (= miR-170)
hsa-miR-092-prec- miR-092-1
ACAGGTTGGGATCGGTTGCAATGCTGTGTTTCTGTATGGT no 371 13 = 092-1-#1
hsa-miR-092-prec- miR-092-1
TCTGTATGGTATTGCACTTGTCCCGGCCTGTTGAGTTTGG yes 372 13 = 092-1-#2
hsa-miR-092-prec- miR-092-2
GTTCTATATAAAGTATTGCACTTGTCCCGGCCTGTGGAAG yes 373 X = 092-2
hsa-miR-093-prec- miR-093-1
CCAAAGTGCTGTTCGTGCAGGTAGTGTGATTACCCAACCT yes 374 7.1 = 093-1
hsa-miR-095-prec-4 miR-095 CGTTACATTCAACGGGTATTTATTGAGCACCCACTCTGTG
yes 375 hsa-miR-096-prec-7-#1 miR-096
CTCCGCTCTGAGCAATCATGTGCAGTGCCAATATGGGAAA no 376
hsa-miR-096-prec-7-#2 miR-096
TGGCCGATTTTGGCACTAGCACATTTTTGCTTGTGTCTCT yes 377 hsa-miR-098-prec-X
miR-098 TGAGGTAGTAAGTTGTATTGTTGTGGGGTAGGGATATTAG yes 378
hsa-miR-099b-prec-19- miR-099b
GCCTTCGCCGCACACAAGCTCGTGTCTGTGGGTCCGTGTC no idem mmu- 379 #1
miR-099b- prec-#1 hsa-miR-099b-prec-19- miR-099b
CACCCGTAGAACCGACCTTGCGGGGCCTTCGCCGCACACA yes idem mmu- 380 #2
miR-099b- prec-#2 hsa-miR-099-prec-21 miR-099a
ATAAACCCGTAGATCCGATCTTGTGGTGAAGTGGACCGCA yes 381 (= miR-099-
prec21) hsa-miR-100-1/2-prec miR-100
TGAGGCCTGTTGCCACAAACCCGTAGATCCGAACTTGTGG yes 382
hsa-miR-101-1/2-prec-#1 miR-101-1
CCCTGGCTCAGTTATCACAGTGCTGATGCTGTCTATTCTA no 383
hsa-miR-101-1/2-prec-#2 miR-101-1
TACAGTACTGTGATAACTGAAGGATGGCAGCCATCTTACC yes 384 hsa-miR-101-prec-9
miR-101-2 GCTGTATATCTGAAAGGTACAGTACTGTGATAACTGAAGA yes 385
hsa-miR-102-prec-1 miR-102 TCTTTGTATCTAGCACCATTTGAAATCAGTGTTTTAGGAG
yes 386 hsa-miR-103-2-prec miR-103-2
GTAGCATTCAGGTCAAGCAACATTGTACAGGGCTATGAAA yes 387 hsa-miR-103-prec-
miR-103-1 TATGGATCAAGCAGCATTGTACAGGGCTATGAAGGCATTG yes 388 5 =
103-1 (= miR-103-5) hsa-miR-105-prec- miR-105-1
ATCGTGGTCAAATGCTCAGACTCCTGTGGTGGCTGCTCAT yes 389 X.1 = 105-1 (=
miR-105- prec-X) hsa-miR-106-prec-X miR-106a
CCTTGGCCATGTAAAAGTGCTTACAGTGCAGGTAGCTTTT yes 390
hsa-miR-107-prec-10 miR-107
GGCATGGAGTTCAAGCAGCATTGTACAGGGCTATCAAAGC yes 391 hsa-miR-122a-prec
miR-122a CCTTAGCAGAGCTGTGGAGTGTGACAATGGTGTTTGTGTC yes 392
hsa-miR-123-prec-#1 miR-123 =
GACGGGACATTATTACTTTTGGTACGCGCTGTGACACTTC yes 393 miR-126
hsa-miR-123-prec-#2 miR-123 =
TGTGACACTTCAAACTCGTACCGTGAGTAATAATGCGCCG yes 394 miR-126
hsa-miR-124a-1-prec1 miR-124a-1
ATACAATTAAGGCACGCGGTGAATGCCAAGAATGGGGCTG yes 395
hsa-miR-124a-2-prec miR-124a-2
TTAAGGCACGCGGTGAATGCCAAGAGCGGAGCCTACGGCT yes 396
hsa-miR-124a-3-prec miR-124a-3
TTAAGGCACGCGGTGAATGCCAAGAGAGGCGCCTCCGCCG yes 397
hsa-miR-125a-prec-#1 miR-125a
TCTAGGTCCCTGAGACCCTTTAACCTGTGAGGACATCCAG yes 398
hsa-miR-125a-prec-#2 miR-125a
CAGGGTCACAGGTGAGGTTCTTGGGAGCCTGGCGTCTGGC no 399 hsa-miR-125b-1
miR-125b-1 TCCCTGAGACCCTAACTTGTGATGTTTACCGTTTAAATCC yes 400
hsa-miR-125b-2-prec-#1 miR-125b-2
TAGTAACATCACAAGTCAGGCTCTTGGGACCTAGGCGGAG no 401
hsa-miR-125b-2-prec-#2 miR-125b-2
ACCAGACTTTTCCTAGTCCCTGAGACCCTAACTTGTGAGG yes 402 hsa-miR-127-prec
miR-127 TCGGATCCGTCTGAGCTTGGCTGGTCGGAAGTCTCATCAT yes 403
hsa-miR-128a-prec-#1 miR-128a
TTGGATTCGGGGCCGTAGCACTGTCTGAGAGGTTTACATT no idem mmu- 404 miR-128-
prec-#2 hsa-miR-128a-prec-#2 miR-128a
ACATTTCTCACAGTGAACCGGTCTCTTTTTCAGCTGCTTC yes 405
hsa-miR-128b-prec-#1 miR-128b
TCACAGTGAACCGGTCTCTTTCCCTACTGTGTCACACTCC yes 406
hsa-miR-128b-prec-#2 miR-128b
GGGGGCCGATACACTGTACGAGAGTGAGTAGCAGGTCTCA no 407 hsa-miR-129-prec-#1
miR-129-1/2 TGGATCTTTTTGCGGTCTGGGCTTGCTGTTCCTCTCAACA yes 408
hsa-miR-129-prec-#2 miR-129-1/2
CCTCTCAACAGTAGTCAGGAAGCCCTTACCCCAAAAAGTA no 409
hsa-miR-130a-prec-#1 miR-130a
CCAGAGCTCTTTTCACATTGTGCTACTGTCTGCACCTGTC no 410
hsa-miR-130a-prec-#2 miR-130a
TGTCTGCACCTGTCACTAGCAGTGCAATGTTAAAAGGGCA yes 411
hsa-miR-132-prec-#1 miR-132
TGTGGGAACTGGAGGTAACAGTCTACAGCCATGGTCGCCC yes 412
hsa-miR-132-prec-#2 miR-132
TCCAGGGCAACCGTGGCTTTCGATTGTTACTGTGGGAACT no 413 hsa-miR-133a-1
miR-133a-1 CCTCTTCAATGGATTTGGTCCCCTTCAACCAGCTGTAGCT yes 414 (=
miR-133c) hsa-miR-133a-2 miR-133a-2
TTGGTCCCCTTCAACCAGCTGTAGCTGTGCATTGATGGCG yes 415 (= miR-133d)
hsa-miR-134-prec-#1 miR-134
ATGCACTGTGTTCACCCTGTGGGCCACCTAGTCACCAACC no 416 hsa-miR-134-prec-#2
miR-134 GTGTGTGACTGGTTGACCAGAGGGGCATGCACTGTGTTCA yes 417
hsa-miR-135-1-prec miR-135-1
GCCTCGCTGTTCTCTATGGCTTTTTATTCCTATGTGATTC yes 418 (= miR-135)
hsa-miR-135-2-prec miR-135-2
CACTCTAGTGCTTTATGGCTTTTTATTCCTATGTGATAGT yes 419
hsa-miR-136-prec-#1 miR-136
ATGCTCCATCATCGTCTCAAATGAGTCTTCAGAGGGTTCT no 420 hsa-miR-136-prec-#2
miR-136 TGAGCCCTCGGAGGACTCCATTTGTTTTGATGATGGATTC yes 421
hsa-miR-137-prec miR-137 GGATTACGTTGTTATTGCTTAAGAATACGCGTAGTCGAGG
yes idem mmu- 422 miR- 137-prec hsa-miR-138-1-prec miR-138-1
AGCTGGTGTTGTGAATCAGGCCGTTGCCAATCAGAGAACG yes 423 hsa-miR-138-2-prec
miR-138-2 AGCTGGTGTTGTGAATCAGGCCGACGAGCAGCGCATCCTC yes idem mmu-
424 miR- 138-prec hsa-miR-139-prec miR-139
GTGTATTCTACAGTGCACGTGTCTCCAGTGTGGCTCGGAG yes 425 hsa-miR-140-#1
miR-140-as GCCAGTGGTTTTACCCTATGGTAGGTTACGTCATGCTGTT no 426
hsa-miR-140-#2 miR-140-as TTCTACCACAGGGTAGAACCACGGACAGGATACCGGGGCA
yes 427 hsa-miR-141-prec-#1 miR-141
TTGTGAAGCTCCTAACACTGTCTGGTAAAGATGGCTCCCG yes 428
hsa-miR-141-prec-#2 miR-141
ATCTTCCAGTACAGTGTTGGATGGTCTAATTGTGAAGCTC no 429 hsa-miR-142-prec
miR-142-as CCCATAAAGTAGAAAGCACTACTAACAGCACTGGAGGGTG yes idem mmu-
430 miR- 142-prec hsa-miR-143-prec miR-143
CTGGTCAGTTGGGAGTCTGAGATGAAGCACTGTAGCTCAG yes 431
hsa-miR-144-prec-#1 miR-144
CGATGAGACACTACAGTATAGATGATGTACTAGTCCGGGC yes 432
hsa-miR-144-prec-#2 miR-144
CCCTGGCTGGGATATCATCATATACTGTAAGTTTGCGATG no 433 hsa-miR-145-prec
miR-145 CCTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTAA yes 434
hsa-miR-146-prec miR-146 TGAGAACTGAATTCCATGGGTTGTGTCAGTGTCAGACCTC
yes 435 hsa-miR-147-prec miR-147
GACTATGGAAGCCAGTGTGTGGAAATGCTTCTGCTAGATT yes 436 hsa-miR-148-prec
miR-148 TGAGTATGATAGAAGTCAGTGCACTACAGAACTTTGTCTC yes 437
hsa-miR-149-prec miR-149 CGAGCTCTGGCTCCGTGTCTTCACTCCCGTGCTTGTCCGA
yes 438
hsa-miR-150-prec miR-150 CTCCCCATGGCCCTGTCTCCCAACCCTTGTACCAGTGCTG
yes 439 hsa-miR-151-prec miR-151
GTATGTCTCATCCCCTACTAGACTGAAGCTCCTTGAGGAC yes 440
hsa-miR-152-prec-#1 miR-152
ACTCGGGCTCTGGAGCAGTCAGTGCATGACAGAACTTGGG yes idem mmu- 441 miR-
152-prec hsa-miR-152-prec-#2 miR-152
CCCCGGCCCAGGTTCTGTGATACACTCCGACTCGGGCTCT no 442 hsa-miR-153-1-prec1
miR-153-1 CAGTTGCATAGTCACAAAAGTGATCATTGGCAGGTGTGGC yes 443
hsa-miR-153-1-prec2 miR-153-1
CACAGCTGCCAGTGTCATTGTCACAAAAGTGATCATTGGC yes 444 hsa-miR-153-2-prec
miR-153-2 GCCCAGTTGCATAGTCACAAAAGTGATCATTGGAAACTGT yes 445
hsa-miR-154-prec1-#1 miR-154
GTGGTACTTGAAGATAGGTTATCCGTGTTGCCTTCGCTTT yes 446
hsa-miR-154-prec1-#2 miR-154
GCCTTCGCTTTATTTGTGACGAATCATACACGGTTGACCT no 447 hsa-miR-155-prec
miR-155(BIC) TTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAACTGAC yes 448
hsa-miR-181a-prec-#1 miR-181a
TCAGAGGACTCCAAGGAACATTCAACGCTGTCGGTGAGTT yes 449 (= miR-178-2)
hsa-miR-181a-prec-#2 miR-181a
GAAAAAACCACTGACCGTTGACTGTACCTTGGGGTCCTTA no 450 (= miR-178-2)
hsa-miR-181b-prec-#1 miR-181b
TGAGGTTGCTTCAGTGAACATTCAACGCTGTCGGTGAGTT yes 451 (= miR-178)
hsa-miR-181b-prec-#2 miR-181b
ACCATCGACCGTTGATTGTACCCTATGGCTAACCATCATC yes 452 (= miR-178)
hsa-miR-181c-prec-#1 miR-181c
TGCCAAGGGTTTGGGGGAACATTCAACCTGTCGGTGAGTT yes 453
hsa-miR-181c-prec-#2 miR-181c
ATCGACCGTTGAGTGGACCCTGAGGCCTGGAATTGCCATC no 454 hsa-miR-182-prec-#1
miR-182-s AGGTAACAGGATCCGGTGGTTCTAGACTTGCCAACTATGG no 455
hsa-miR-182-prec-#2 miR-182-s
TTGGCAATGGTAGAACTCACACTGGTGAGGTAACAGGATC yes 456
hsa-miR-183-prec-#1 miR-183
GACTCCTGTTCTGTGTATGGCACTGGTAGAATTCACTGTG yes 457 (= miR-174)
hsa-miR-183-prec-#2 miR-183
GTCTCAGTCAGTGAATTACCGAAGGGCCATAAACAGAGCA no 458 (= miR-174)
hsa-miR-184-prec-#1 miR-184
GACTGTAAGTGTTGGACGGAGAACTGATAAGGGTAGGTGA yes 459
hsa-miR-184-prec-#2 miR-184
CGTCCCCTTATCACTTTTCCAGCCCAGCTTTGTGACTGTA no 460 hsa-miR-185-prec-#1
miR-185 GCGAGGGATTGGAGAGAAAGGCAGTTCCTGATGGTCCCCT yes 461
hsa-miR-185-prec-#2 miR-185
CCTCCCCAGGGGCTGGCTTTCCTCTGGTCCTTCCCTCCCA no 462 hsa-miR-186-prec
miR-186 CTTGTAACTTTCCAAAGAATTCTCCTTTTGGGCTTTCTGG yes 463
hsa-miR-187-prec-#1 miR-187
CTCGTGTCTTGTGTTGCAGCCGGAGGGACGCAGGTCCGCA yes 464
hsa-miR-187-prec-#2 miR-187
TCACCATGACACAGTGTGAGACTCGGGCTACAACACAGGA no 465 hsa-miR-188-prec
miR-188 TCACATCCCTTGCATGGTGGAGGGTGAGCTTTCTGAAAAC yes 466
hsa-miR-190-prec miR-190 GCAGGCCTCTGTGTGATATGTTTGATATATTAGGTTGTTA
yes 467 hsa-miR-191-prec miR-191
CAACGGAATCCCAAAAGCAGCTGTTGTCTCCAGAGCATTC yes idem mmu- 468 miR-
191-prec hsa-miR-192-2/3-#1 miR-192
TCTGACCTATGAATTGACAGCCAGTGCTCTCGTCTCCCCT yes 469 hsa-miR-192-2/3-#2
miR-192 CCAATTCCATAGGTCACAGGTATGTTCGCCTCAATGCCAG no 470
hsa-miR-193-prec-#1 miR-193
AGATGAGGGTGTCGGATCAACTGGCCTACAAAGTCCCAGT yes 471
hsa-miR-193-prec-#2 miR-193
AGGATGGGAGCTGAGGGCTGGGTCTTTGCGGGCGAGATGA no 472 hsa-miR-194-prec-#1
miR-194 TGTAACAGCAACTCCATGTGGACTGTGTACCAATTTCCAG yes 473
hsa-miR-194-prec-#2 miR-194
CCAATTTCCAGTGGAGATGCTGTTACTTTTGATGGTTACC no 474 hsa-miR-195-prec
miR-195 TCTAGCAGCACAGAAATATTGGCACAGGGAAGCGAGTCTG yes 475
hsa-miR-196-1-prec-#1 miR-196-1
CTGCTGAGTGAATTAGGTAGTTTCATGTTGTTGGGCCTGG yes 476
hsa-miR-196-1-prec-#2 miR-196-1
ACACAACAACATTAAACCACCCGATTCACGGCAGTTACTG no 477
hsa-miR-196-2-prec-#1 miR-196-2
AGAAACTGCCTGAGTTACATCAGTCGGTTTTCGTCGAGGG no 478
hsa-miR-196-2-prec-#2 miR-196-2
GCTGATCTGTGGCTTAGGTAGTTTCATGTTGTTGGGATTG yes 479 hsa-miR-197-prec
miR-197 TAAGAGCTCTTCACCCTTCACCACCTTCTCCACCCAGCAT yes 480
hsa-miR-198-prec miR-198 TCATTGGTCCAGAGGGGAGATAGGTTCCTGTGATTTTTCC
yes 481 hsa-miR-199a-1-prec miR-199a-1
GCCAACCCAGTGTTCAGACTACCTGTTCAGGAGGCTCTCA yes 482 (= 199s)
hsa-miR-199a-2-prec miR-199a-2
TCGCCCCAGTGTTCAGACTACCTGTTCAGGACAATGCCGT yes 483
hsa-miR-199b-prec-#1 miR-199b
GTCTGCACATTGGTTAGGCTGGGCTGGGTTAGACCCTCGG no 484
hsa-miR-199b-prec-#2 miR-199b
ACCTCCACTCCGTCTACCCAGTGTTTAGACTATCTGTTCA yes 485 hsa-miR-200a-prec
miR-200a GTCTCTAATACTGCCTGGTAATGATGACGGCGGAGCCCTG yes 486
hsa-miR-202-prec miR-202 GATCTGGCCTAAAGAGGTATAGGGCATGGGAAGATGGAGC
yes 487 hsa-miR-203-prec-#1 miR-203
GTTCTGTAGCGCAATTGTGAAATGTTTAGGACCACTAGAC yes 488
hsa-miR-203-prec-#2 miR-203
TGGGTCCAGTGGTTCTTAACAGTTCAACAGTTCTGTAGCG no 489 hsa-miR-204-prec-#1
miR-204 CGTGGACTTCCCTTTGTCATCCTATGCCTGAGAATATATG yes 490
hsa-miR-204-prec-#2 miR-204
AGGCTGGGAAGGCAAAGGGACGTTCAATTGTCATCACTGG no 491 hsa-miR-205-prec
miR-205 TCCTTCATTCCACCGGAGTCTGTCTCATACCCAACCAGAT yes 492
hsa-miR-206-prec-#1 miR-206
TTGCTATGGAATGTAAGGAAGTGTGTGGTTTCGGCAAGTG yes 493
hsa-miR-206-prec-#2 miR-206
TGCTTCCCGAGGCCACATGCTTCTTTATATCCCCATATGG no 494 hsa-miR-208-prec
miR-208 ACCTGATGCTCACGTATAAGACGAGCAAAAAGCTTGTTGG yes 495
hsa-miR-210-prec miR-210 AGACCCACTGTGCGTGTGACAGCGGCTGATCTGTGCCTGG
yes 496 hsa-miR-211-prec-#1 miR-211
TTCCCTTTGTCATCCTTCGCCTAGGGCTCTGAGCAGGGCA yes 497
hsa-miR-211-prec-#2 miR-211
GCAGGGACAGCAAAGGGGTGCTCAGTTGTCACTTCCCACA no 498 hsa-miR-212-prec-#1
miR-212 CCTCAGTAACAGTCTCCAGTCACGGCCACCGACGCCTGGC yes 499
hsa-miR-212-prec-#2 miR-212
CGGACAGCGCGCCGGCACCTTGGCTCTAGACTGCTTACTG no 500 hsa-miR-213-prec-#1
miR-213 AACATTCATTGCTGTCGGTGGGTTGAACTGTGTGGACAAG yes idem mmu- 501
miR- 213-prec hsa-miR-213-prec-#2 miR-213
TGTGGACAAGCTCACTGAACAATGAATGCAACTGTGGCCC no 502 hsa-miR-214-prec
miR-214 TGTACAGCAGGCACAGACAGGCAGTCACATGACAACCCAG yes idem mmu- 503
miR- 214-prec hsa-miR-215-prec-#1 miR-215
CAGGAAAATGACCTATGAATTGACAGACAATATAGCTGAG yes 504
hsa-miR-215-prec-#2 miR-215
CATTTCTTTAGGCCAATATTCTGTATGACTGTGCTACTTC no 505 hsa-miR-216-prec-#1
miR-216 CTGGGATTATGCTAAACAGAGCAATTTCCTAGCCCTCACG no 506
hsa-miR-216-prec-#2 miR-216
GATGGCTGTGAGTTGGCTTAATCTCAGCTGGCAACTGTGA yes 507
hsa-miR-217-prec-#1 miR-217
GAATCAGTCACCATCAGTTCCTAATGCATTGCCTTCAGCA no 508 hsa-miR-217-prec-#2
miR-217 TGTCGCAGATACTGCATCAGGAACTGATTGGATAAGAATC yes 509
hsa-miR-218-1-prec miR-218-1
GTTGTGCTTGATCTAACCATGTGGTTGCGAGGTATGAGTA yes 510
hsa-miR-218-2-prec-#1 miR-218-2
TGGTGGAACGATGGAAACGGAACATGGTTCTGTCAAGCAC no 511
hsa-miR-218-2-prec-#2 miR-218-2
TCGCTGCGGGGCTTTCCTTTGTGCTTGATCTAACCATGTG yes 512 hsa-miR-219-prec
miR-219 ATTGTCCAAACGCAATTCTCGAGTCTATGGCTCCGGCCGA yes 513
hsa-miR-220-prec miR-220 TGTGGCATTGTAGGGCTCCACACCGTATCTGACACTTTGG
yes 514 hsa-miR-221-prec miR-221
CAACAGCTACATTGTCTGCTGGGTTTCAGGCTACCTGGAA yes idem mmu- 515 miR-221-
prec-#1 hsa-miR-222-prec-#1 miR-222
CTTTCGTAATCAGCAGCTACATCTGGCTACTGGGTCTCTG yes
516 hsa-miR-222-prec-#2 miR-222
GCTGCTGGAAGGTGTAGGTACCCTCAATGGCTCAGTAGCC no 517 hsa-miR-223-prec
miR-223 GAGTGTCAGTTTGTCAAATACCCCAAGTGCGGCACATGCT yes 518
hsa-miR-224-prec miR-224 GGCTTTCAAGTCACTAGTGGTTCCGTTTAGTAGATGATTG
yes 519 HSHELA01 -- GGCCGCAGCAACCTCGGTTCGTATCCGAGTCACGGCACCA -- 520
HSTRNL -- TCCGGATGGAGCGTGGGTTCGAATCCCACTTCTGACACCA -- 521 HUMTRAB
-- ATGGTAGAGCGCTCGCTTTGCTTGCGAGAGGTAGCGGGAT -- 522 HUMTRF --
GATCTAAAGGTCCCTGGTTCGATCCCGGGTTTCGGCACCA -- 523 HUMTRMI-#1 --
AGCAGAGTGGCGCAGCGGAAGCGTGCTGGGCCCATAACCC -- idem 524 MUSTRMI-#1
HUMTRMI-#2 -- AACCCAGAGGTCGATGGATCGAAACCATCCTCTGCTACCA -- 525
HUMTRN -- CAATCGGTTAGCGCGTTCGGCTGTTAACCGAAAGGTTGGT -- 526 HUMTRS --
TCTAGCGACAGAGTGGTTCAATTCCACCTTTCGGGCGCCA -- 527 HUMTRV1A --
ACGCGAAAGGTCCCCGGTTCGAAACCGGGCGGAAACACCA -- 528 mmu-let-7g-prec
mmu-let-7g CTGAGGTAGTAGTTTGTACAGTTTGAGGGTCTATGATACC yes 529
mmu-let-7i-prec mmu-let-7i GCTGAGGTAGTAGTTTGTGCTGTTGGTCGGGTTGTGACAT
yes idem hsa- 530 let-7d-v2- prec-#2 mmu-miR-001b-prec mmu-miR-001b
ATTCAGTGCTATGGAATGTAAAGAAGTATGTATTTTGGGT yes 531 mmu-miR-001d-prec
mmu-miR-001d CTGCTAAGCTATGGAATGTAAAGAAGTATGTATTTCAGGC yes 532
mmu-miR-009-prec-#1 mmu-miR-009
ATCTTTGGTTATCTAGCTGTATGAGTGTATTGGTCTTCAT yes 533
mmu-miR-009-prec-#2 mmu-miR-009-
GAGTGTATTGGTCTTCATAAAGCTAGATAACCGAAAGTAA yes idem hsa- 534 miR-
009-2-#2 mmu-miR-010b-prec mmu-miR-010b
TACCCTGTAGAACCGAATTTGTGTGGTACCCACATAGTCA yes 535 mmu-miR-023b-prec
mmu-miR-023b TTGAGATTAAAATCACATTGCCAGGGATTACCACGCAACC yes 536
mmu-miR-027b-prec mmu-miR-027b
TTGGTTTCCGCTTTGTTCACAGTGGCTAAGTTCTGCACCT yes 537 mmu-miR-029b-prec
mmu-miR-029b TAAATAGTGATTGTCTAGCACCATTTGAAATCAGTGTTCT yes 538
mmu-miR-030b-prec mmu-miR-030b
TGTAAACATCCTACACTCAGCTGTCATACATGCGTTGGCT yes 539 mmu-miR-030e-prec
mmu-miR-030e TGTAAACATCCTTGACTGGAAGCTGTAAGGTGTTGAGAGG yes 540
mmu-miR-099a-prec mmu-miR-099a
CATAAACCCGTAGATCCGATCTTGTGGTGAAGTGGACCGC yes 541
mmu-miR-099b-prec-#1 mmu-miR-099b
GCCTTCGCCGCACACAAGCTCGTGTCTGTGGGTCCGTGTC no idem hsa- 542 miR-099b-
prec-19-#1 mmu-miR-099b-prec-#2 mmu-miR-099b
CACCCGTAGAACCGACCTTGCGGGGCCTTCGCCGCACACA yes idem hsa- 543
miR-099b- prec-19-#2 mmu-miR-100-prec mmu-miR-100
TGCCACAAACCCGTAGATCCGAACTTGTGCTGATTCTGCA yes 544 mmu-miR-101-prec
mmu-miR-101 GCTGTCCATTCTAAAGGTACAGTACTGTGATAACTGAAGG yes 545
mmu-miR-122a-prec-#1 mmu-miR-122a
GTGTCCAAACCATCAAACGCCATTATCACACTAAATAGCT no 546
mmu-miR-122a-prec-#2 mmu-miR-122a
GCTGTGGAGTGTGACAATGGTGTTTGTGTCCAAACCATCA yes 547
mmu-miR-123-prec-#1 mmu-miR-123
CATTATTACTTTTGGTACGCGCTGTGACACTTCAAACTCG yes 548
mmu-miR-123-prec-#2 mmu-miR-123
GACACTTCAAACTCGTACCGTGAGTAATAATGCGCGGTCA yes 549 mmu-miR-124a-prec
mmu-miR-124a TAATGTCTATACAATTAAGGCACGCGGTGAATGCCAAGAG yes 550
mmu-miR-125a-prec mmu-miR-125a
TCCCTGAGACCCTTTAACCTGTGAGGACGTCCAGGGTCAC yes 551
mmu-miR-125b-prec-#1 mmu-miR-125b
GCCTAGTCCCTGAGACCCTAACTTGTGAGGTATTTTAGTA yes 552
mmu-miR-125b-prec-#2 mmu-miR-125b
ATTTTAGTAACATCACAAGTCAGGTTCTTGGGACCTAGGC no 553 mmu-miR-127-prec
mmu-miR-127 TTCAGAAAGATCATCGGATCCGTCTGAGCTTGGCTGGTCG yes 554
mmu-miR-128-prec-#1 mmu-miR-128
AGGTTTACATTTCTCACAGTGAACCGGTCTCTTTTTCAGC yes 555
mmu-miR-128-prec-#2 mmu-miR-128
TTGGATTCGGGGCCGTAGCACTGTCTGAGAGGTTTACATT no idem hsa- 556 miR-128a-
prec-#1 mmu-miR-129b-prec mmu-miR-129b
CTTTTTGCGGTCTGGGCTTGCTGTACATAACTCAATAGCC yes 557 mmu-miR-129-prec
mmu-miR-129 CTTTTTGCGGTCTGGGCTTGCTGTTTTCTCGACAGTAGTC yes 558
mmu-miR-130-prec mmu-miR-130
GTCTAACGTGTACCGAGCAGTGCAATGTTAAAAGGGCATC yes 559 mmu-miR-131-3-prec
mmu-miR-131-3 AGTGGTGTGGAGTCTTCATAAAGCTAGATAACCGAAAGTA yes 560
mmu-miR-132-prec mmu-miR-132
TGTGGGAACCGGAGGTAACAGTCTACAGCCATGGTCGCCC yes 561 mmu-miR-133-prec
mmu-miR-133 ATCGCCTCTTCAATGGATTTGGTCCCCTTCAACCAGCTGT yes 562
mmu-miR-134-prec-#1 mmu-miR-134
GCACTCTGTTCACCCTGTGGGCCACCTAGTCACCAACCCT no 563 mmu-miR-134-prec-#2
mmu-miR-134 TGTGTGACTGGTTGACCAGAGGGGCGTGCACTCTGTTCAC yes 564
mmu-miR-135-prec mmu-miR-135
CTATGGCTTTTTATTCCTATGTGATTCTATTGCTCGCTCA yes 565 mmu-miR-136-prec
mmu-miR-136 GAGGACTCCATTTGTTTTGATGATGGATTCTTAAGCTCCA yes 566
mmu-miR-137-prec mmu-miR-137
GGATTACGTTGTTATTGCTTAAGAATACGCGTAGTCGAGG yes idem hsa- 567 miR-
137-prec mmu-miR-138-prec mmu-miR-138
AGCTGGTGTTGTGAATCAGGCCGACGAGCAGCGCATCCTC yes idem hsa- 568 miR-138-
2-prec mmu-miR-140s-prec mmu-miR-140s
TTACGTCATGCTGTTCTACCACAGGGTAGAACCACGGACA yes 569 mmu-miR-141-prec
mmu-miR-141 GAAGTATGAAGCTCCTAACACTGTCTGGTAAAGATGGCCC yes 570
mmu-miR-142-prec mmu-miR-142
CCCATAAAGTAGAAAGCACTACTAACAGCACTGGAGGGTG yes idem hsa- 571 miR-
142-prec mmu-miR-143-prec mmu-miR-143
TGGTCAGTTGGGAGTCTGAGATGAAGCACTGTAGCTCAGG yes 572 mmu-miR-144-prec
mmu-miR-144 GTTTGTGATGAGACACTACAGTATAGATGATGTACTAGTC yes 573
mmu-miR-145-prec mmu-miR-145
ACGGTCCAGTTTTCCCAGGAATCCCTTGGATGCTAAGATG yes 574 mmu-miR-146-prec
mmu-miR-146 TGAGAACTGAATTCCATGGGTTATATCAATGTCAGACCTG yes 575
mmu-miR-149-prec mmu-miR-149
GCTCTGGCTCCGTGTCTTCACTCCCGTGTTTGTCCGAGGA yes 576 mmu-miR-150-prec
mmu-miR-150 TGTCTCCCAACCCTTGTACCAGTGCTGTGCCTCAGACCCT yes 577
mmu-miR-151-prec mmu-miR-151
TATGTCTCCTCCCTACTAGACTGAGGCTCCTTGAGGGACA yes 578 mmu-miR-152-prec
mmu-miR-152 ACTCGGGCTCTGGAGCAGTCAGTGCATGACAGAACTTGGG yes idem hsa-
579 miR-152- prec-#1 mmu-miR-153-prec mmu-miR-153
TAATATGAGCCCAGTTGCATAGTGACAAAAGTGATCATTG yes 580 mmu-miR-154-prec
mmu-miR-154 AGATAGGTTATCCGTGTTGCCTTCGCTTTATTCGTGACGA yes 581
mmu-miR-155-prec mmu-miR-155
TTAATGCTAATTGTGATAGGGGTTTTGGCCTCTGACTGAC yes 582 mmu-miR-181-prec
mmu-miR-181 CCATGGAACATTCAACGCTGTCGGTGAGTTTGGGATTCAA yes 583
mmu-miR-182-prec mmu-miR-182
TTTGGCAATGGTAGAACTCACACCGGTAAGGTAATGGGAC yes 584
mmu-miR-183-prec-#1 mmu-miR-183
AACAGTCTCAGTCAGTGAATTACCGAAGGGCCATAAACAG no 585 mmu-miR-183-prec-#2
mmu-miR-183 TATGGCACTGGTAGAATTCACTGTGAACAGTCTCAGTCAG yes 586
mmu-miR-184-prec mmu-miR-184
TGTGACTCTAAGTGTTGGACGGAGAACTGATAAGGGTAGG yes 587 mmu-miR-185-prec
mmu-miR-185 GGGATTGGAGAGAAAGGCAGTTCCTGATGGTCCCCTCCCA yes 588
mmu-miR-186-prec mmu-miR-186
CAAAGAATTCTCCTTTTGGGCTTTCTCATTTTATTTTAAG yes 589 mmu-miR-187-prec
mmu-miR-187 GGGCGCTGCTCTGACCCCTCGTGTCTTGTGTTGCAGCCGG yes 590
mmu-miR-188-prec mmu-miR-188
TCACATCCCTTGCATGGTGGAGGGTGAGCTCTCTGAAAAC yes 591 mmu-miR-189-prec
mmu-miR-189 CGGTGCCTACTGAGCTGATATCAGTTCTCATTTCACACAC yes 592
mmu-miR-190-prec mmu-miR-190
CTGTGTGATATGTTTGATATATTAGGTTGTTATTTAATCC yes 593 mmu-miR-191-prec
mmu-miR-191 CAACGGAATCCCAAAAGCAGCTGTTGTCTCCAGAGCATTC yes idem hsa-
594 miR- 191-prec mmu-miR-192-2/3-prec mmu-miR-192-2/3
CTGACCTATGAATTGACAGCCAGTGCTCTCGTCTCCCCTC yes 595
mmu-miR-193-prec mmu-miR-193
TGAGAGTGTCAGTTCAACTGGCCTACAAAGTCCCAGTCCT yes 596 mmu-miR-194-prec
mmu-miR-194 ATCGGGTGTAACAGCAACTCCATGTGGACTGTGCTCGGAT yes 597
mmu-miR-195-prec mmu-miR-195
TAGCAGCACAGAAATATTGGCATGGGGAAGTGAGTCTGCC yes 598 mmu-miR-196-prec
mmu-miR-196 GTAGGTAGTTTCATGTTGTTGGGCCTGGCTTTCTGAACAC yes 599
mmu-miR-199as-prec mmu-miR-199as
GAGGCTGGGACATGTACAGTAGTCTGCACATTGGTTAGGC yes 600
mmu-miR-200a-prec-#1 mmu-miR-200a
TAGTGTCTGATCTCTAATACTGCCTGGTAATGATGACGGC yes 601
mmu-miR-200a-prec-#2 mmu-miR-200a
CCGTGGCCATCTTACTGGGCAGCATTGGATAGTGTCTGAT no 602 mmu-miR-201-prec
mmu-miR-201 TACCTTACTCAGTAAGGCATTGTTCTTCTATATTAATAAA yes 603
mmu-miR-202-prec mmu-miR-202
GATCTGGTCTAAAGAGGTATAGCGCATGGGAAGATGGAGC yes 604
mmu-miR-203-prec-#1 mmu-miR-203
GGTCCAGTGGTTCTTGACAGTTCAACAGTTCTGTAGCACA no 605 mmu-miR-203-prec-#2
mmu-miR-203 GTAGCACAATTGTGAAATGTTTAGGACCACTAGACCCGGC yes 606
mmu-miR-204-prec mmu-miR-204
TTCCCTTTGTCATCCTATGCCTGAGAATATATGAAGGAGG yes 607 mmu-miR-205-prec
mmu-miR-205 GTCCTTCATTCCACCGGAGTCTGTCTTATGCCAACCAGAT yes 608
mmu-miR-206-prec mmu-miR-206
TAGATATCTCAGCACTATGGAATGTAAGGAAGTGTGTGGT yes 609 mmu-miR-207-prec
mmu-miR-207 GCTGCGGCTTGCGCTTCTCCTGGCTCTCCTCCCTCTCCTT yes 610
mmu-miR-212-prec-#1 mmu-miR-212
CTTCAGTAACAGTCTCCAGTCACGGCCACCGACGCCTGGC yes 611
mmu-miR-212-prec-#2 mmu-miR-212
AGCGCGCCGGCACCTTGGCTCTAGACTGCTTACTGCCCGG no 612 mmu-miR-213-prec
mmu-miR-213 AACATTCATTGCTGTCGGTGGGTTGAACTGTGTGGACAAG yes idem hsa-
613 miR-213- prec-#1 mmu-miR-214-prec mmu-miR-214
TGTACAGCAGGCACAGACAGGCAGTCACATGACAACCCAG yes idem hsa- 614 miR-
214-prec mmu-miR-215-prec mmu-miR-215
CAGGAGAATGACCTATGATTTGACAGACCGTGCAGCTGTG yes 615
mmu-miR-216-prec-#1 mmu-miR-216
GAGATGTCCCTATCATTCCTCACAGTGGTCTCTGGGATTA no 616 mmu-miR-216-prec-#2
mmu-miR-216 ATGGCTATGAGTTGGTTTAATCTCAGCTGGCAACTGTGAG yes 617
mmu-miR-217-prec-#1 mmu-miR-217
GCAGATACTGCATCAGGAACTGACTGGATAAGACTTAATC yes 618
mmu-miR-217-prec-#2 mmu-miR-217
CCCCATCAGTTCCTAATGCATTGCCTTCAGCATCTAAACA no 619
mmu-miR-218-2-prec-#1 mmu-miR-218-2
GGGCTTTCCTTTGTGCTTGATCTAACCATGTGGTGGAACG yes 620
mmu-miR-218-2-prec-#2 mmu-miR-218-2
GTGGTGGAACGATGGAAACGGAACATGGTTCTGTCAAGCA no 621 mmu-miR-219-prec-#1
mmu-miR-219 TCCTGATTGTCCAAACGCAATTCTCGAGTCTCTGGCTCCG yes 622
mmu-miR-219-prec-#2 mmu-miR-219
CTCTGGCTCCGGCCGAGAGTTGCGTCTGGACGTCCCGAGC no 623 mmu-miR-221-prec-#1
mmu-miR-221 CAACAGCTACATTGTCTGCTGGGTTTCAGGCTACCTGGAA yes idem hsa-
624 miR- 221-prec mmu-miR-221-prec-#2 mmu-miR-221
GGCATACAATGTAGATTTCTGTGTTTGTTAGGCAACAGCT no 625 mmu-miR-222-prec
mmu-miR-222 TTGGTAATCAGCAGCTACATCTGGCTACTGGGTCTCTGGT yes 626
mmu-miR-223-prec mmu-miR-223
AGAGTGTCAGTTTGTCAAATACCCCAAGTGTGGCTCATGC yes 627 mmu-miR-224-
mmu-miR-224- TAAGTCACTAGTGGTTCCGTTTAGTAGATGGTCTGTGCAT yes 628
precformer175-#1 (miR-175) mmu-miR-224- mmu-miR-224-
TGCATTGTTTCAAAATGGTGCCCTAGTGACTACAAAGCCC no 629 precformer175-#2
(miR-175) MUSTRF -- TAGACTGAAGATCTAAAGGTCCCTGGTTCGATCCCGGGTT -- 630
MUSTRM4 -- AATCTGAAGGTCGTGAGTTCGATCCTCACACGGGGCACCA -- 631
MUSTRMI-#1 -- AGCAGAGTGGCGCAGCGGAAGCGTGCTGGGCCCATAACCC -- idem 632
HUMTRMI-#1 MUSTRMI-#2 -- CCCATAACCCAGAGGTCGATGGATCGAAACCATCCTCTGC
-- 633 MUSTRNAH -- TGCGTTGTGGCCGCAGCAACCTCGGTTCGAATCCGAGTCA -- 634
MUSTRP2 -- GCTCGTTGGTCTAGGGGTATGATTCTCGCTTTGGGTGCGA -- 635 MUSTRS
-- AGCTGTTTAGCGACAGAGTGGTTCAATTCCACCTTTCGGG -- 636 MUSTRV1MN --
TTCCGTAGTGTAGTGGTTATCACGCTCGCCTGACACGCGA -- 637 Oligonucleotide
primer -- 5' biotin-AAA-AAA-AAA-AAA-(biotin)AAA-AAA- -- 638 #1
AAA-AAA-NNN-NNN-NN 3' Oligonucleotide primer -- 5'
biotin-(biotin)-AAA-NNN-NNN-NN 3' -- 639 #2 Oligonucleotide primer
-- 5' GCC-AGT-GAA-TTG-TAA-TAC-GAC-TCA-CTA-TAG- -- 640 #3
GGA-GGC-GGN-NNN-NNN-N 3'
[0210] miRNA Microarray Fabrication. 40-mer 5' amine modified C6
oligonucleotides were resuspended in 50 mM phosphate buffer pH 8.0
at 20 mM concentration. The individual oligonucleotide-probe was
printed in triplicate on Amersham CodeLink.TM. activated slides
under 45% humidity by GeneMachine OmniGrid.TM. 100 Microarrayer in
2.times.2 pin configuration and 20.times.20 spot configuration of
each subarray. The spot diameter was 100 .mu.m and distance from
center to center was 200 .mu.m. The printed miRNA microarrays were
further chemically covalently-coupled under 70% humidity overnight.
The miRNA microarrays were ready for sample hybridization after
additional blocking and washing steps.
[0211] Target Preparation. Five .mu.g of total RNA were separately
added to a reaction mix in a final volume of 12 .mu.A, containing 1
.mu.g of [3'(N)8-(A)12-biotin-(A)12-biotin 5'] oligonucleotide
primer. The mixture was incubated for 10 min at 70.degree. C. and
chilled on ice. With the mixture remaining on ice, 4 .mu.l of
5.times. first-strand buffer, 2 .mu.l 0.1 M DTT, 1 .mu.l of 10 mM
dNTP mix and 1 .mu.l Superscript.TM. II RNaseH.sup.- reverse
transcriptase (200 U/.mu.l) was added to a final volume of 20
.mu.A, and the mixture incubated for 90 min in a 37.degree. C.
water bath. After incubation for first strand cDNA synthesis, 3.5
.mu.l of 0.5 M NaOH/50 mM EDTA was added into 20 .mu.l of first
strand reaction mix and incubated at 65.degree. C. for 15 min to
denature the RNA/DNA hybrids and degrade RNA templates. Then 5
.mu.l of 1 M Tris-HCl, pH 7.6 (Sigma) was added to neutralize the
reaction mix and labeled targets were stored in 28.5 .mu.l at
-80.degree. C. until chip hybridization.
[0212] Array Hybridization. Labeled targets from 5 .mu.g of total
RNA were used for hybridization on each KCC/TJU miRNA microarray
containing 368 probes in triplicate, corresponding to 245 human and
mouse miRNA genes. All probes on these microarrays were 40-mer
oligonucleotides spotted by contacting technologies and covalently
attached to a polymeric matrix. The microarrays were hybridized in
6.times.SSPE/30% formamide at 25.degree. C. for 18 hours, washed in
0.75.times.TNT at 37.degree. C. for 40 min, and processed using
direct detection of the biotin-containing transcripts by
Streptavidin-Alexa647 conjugate. Processed slides were scanned
using a Perkin Elmer ScanArray.RTM. XL5K Scanner with the laser set
to 635 nm, at Power 80 and PMT 70 setting, and a scan resolution of
10 microns.
[0213] Data Analysis. Images were quantified by QuantArray.RTM.
Software (PerkinElmer). Signal intensities for each spot were
calculated by subtracting local background (based on the median
intensity of the area surrounding each spot) from total
intensities. Raw data were normalized and analyzed using the
GeneSpring.RTM. software version 6.1.1 (Silicon Genetics, Redwood
City, Calif.). GeneSpring generates an average value of the three
spot replicates of each miRNA. Following data transformation (to
convert any negative value to 0.01), normalization was performed by
using a per-chip 50th percentile method that normalizes each chip
on its median allowing comparison among chips. Hierarchical
clustering for both genes and conditions were then generated by
using standard correlation as a measure of similarity. To highlight
genes that characterize each tissue, a per-gene on median
normalization was performed, which normalizes the expression of
every miRNA on its median among samples.
[0214] Samples. HeLa cells were purchased from ATCC and grown as
recommended. Mouse macrophage cell line RAW264.7 (established from
BALB/c mice) was also used (Dumitru, C. D., Ceci, J. D., Tsatsanis,
C., Kontoyiannis, D., Stamatakis, K., Lin, J. H., Patriotis, C.,
Jenkins, N. A., Copeland, N. G., Kollias, G. & Tsichlis, P. N.
(2000) Cell 103, 1071-83). RNA from 20 normal human tissues,
including 18 of adult origin (7 hematopoietic: bone marrow,
lymphocytes B, T, and CD5+ cells from 2 individuals, peripheral
blood leukocytes derived from three healthy donors, spleen, and
thymus; and 11 solid tissues, including brain, breast, ovary,
testis, prostate, lung, heart, kidney, liver, skeletal muscle, and
placenta) and 2 of fetal origin (fetal liver and fetal brain) were
assessed for miRNA expression. Each RNA was labeled and hybridized
in duplicate and the average expression was calculated. For all the
normal tissues, except lymphocytes B, T and CD5+ cells, total RNA
was purchased from Ambion (Austin, Tex.).
[0215] Cell Preparation. Mononuclear cells (MNC) from peripheral
blood of normal donors were separated by Ficoll-Hypaque density
gradients. T cells were purified from these MNC by rosetting with
neuraminidase treated SRBC and depletion of contaminant monocytes
(Cd11b+), natural killer cells (CD16+) and B lymphocytes (CD19+)
were purified using magnetic beads (Dynabeads, Unipath, Milano,
Italy) and specific monoclonal antibodies (Becton Dickinson, San
Jose, Calif.). Total B cells and CD5+ B cells were prepared from
tonsils as described (Dono, M., Zupo, S., Leanza, N., Melioli, G.,
Fogli, M., Melagrana, A., Chiorazzi, N. & Ferrarini, M. (2000)
J. Immunol. 164, 5596-604). Briefly, tonsils were obtained from
patients in the pediatric age group undergoing routine
tonsillectomies, after informed consent. Purified B cells were
prepared by rosetting T cells from MNC cells with neuraminidase
treated SRBC. In order to obtain CD5+ B cells, purified B cells
were incubated with anti CD5 monoclonal antibody followed by goat
anti mouse Ig conjugated with magnetic microbeads. CD5+ B cells
were positively selected by collecting the cells retained on the
magnetic column MS by Mini MACS system (Miltenyi Biotec, Auburn,
Calif.). The degree of purification of the cell preparations was
higher than 95%, as assessed by flow cytometry.
[0216] RNA Extraction and Northern Blots. Total RNA isolation and
blots were performed as described (Calin, et al., (2002) Proc Natl
Acad Sc USA. 99, 15524-15529). After RNA isolation, the washing
step with ethanol was not performed, or if performed, the tube
walls were rinsed with 75% ethanol without perturbing the RNA
pellet (Lagos-Quintana, et al., (2001) Science 294, 853-858). For
reuse, blots were stripped by boiling in 0.1% aqueous
SDS/0.1.times.SSC for 10 min, and were reprobed. 5S rRNA stained
with ethidium bromide served as a loading control.
[0217] Quantitative RT-PCR for miRNA Precursors. Quantitative
RT-PCR was performed as described (Schmittgen, T. D., Jiang, J.,
Liu, Q. & Yang, L. (2004) Nucleic Acid Research 32, 43-53).
Briefly, RNA was reverse transcribed to cDNA with gene-specific
primers and Thermoscript, and the relative amount of each miRNA to
both U6 RNA and tRNA for initiator methionine was described using
the equation 2.sup.-dcT, where dC.sub.T=(C.sub.TmiRNA-C.sub.TU6 or
HUMTMI RNA). The miRNAs analyzed included miR-15a, miR-16-1,
miR-18, miR-20, miR-21, miR-28-2, miR-30d, miR-93-1, miR-105,
miR-124a-2, miR-147, miR-216, miR-219, and miR-224. The primers
used were as published (Schmittgen, T. D., Jiang, J., Liu, Q. &
Yang, L. (2004) Nucleic Acid Research 32, 43-53).
[0218] Microarray Data Submission. All data were submitted using
MIAMExpress to Array Express database and each of the 44 samples
described here received an ID number ranging from
SAMPLE169150SUB621 to SAMPLE 169193SIUB621.
[0219] Results
[0220] Hybridization Sensitivity. The hybridization sensitivity of
the miRNA microarray was tested using various quantities of total
RNA from HeLa cells, starting from 2.5 .mu.g up to 20 .mu.g. The
coefficients of correlation between the 5 .mu.g experiment versus
the 2.5, 10 and 20 .mu.g experiments, were 0.98, 0.99 and 0.97
respectively. These results clearly show high inter-assay
reproducibility, even in the presence of large differences in RNA
quantities. In addition, standard deviation calculated for miRNA
triplicates was below 10% for the vast majority (>95%) of
oligonucleotides. All other experiments described here were
performed with 5 .mu.g of total RNA.
[0221] Microarray specificity. To test the specificity of the
microchip, miRNA expression in human blood leukocytes from three
healthy donors and 2 samples of mouse macrophages was analyzed.
Samples derived from the same type of tissue presented homogenous
patterns of miRNA expression. Furthermore, the pattern of
hybridization is different for the two species. To confirm
microarray results, the same RNA samples from mouse macrophages and
HeLa cells were also analyzed by quantitative RT-PCR for a randomly
selected set of 14 miRNAs (Schmittgen, T. D., Jiang, J., Liu, Q.
& Yang, L. (2004) Nucleic Acid Research 32, 43-53). When we
were able to amplify a miRNA precursor for which a correspondent
oligonucleotide was present on the chip (hsa-miR-15a, hsa-mir-30d,
mmu-miR-219 and mmu-miR-224) the concordance between the two
techniques was 100%. Furthermore, it has been reported that
expression levels of the active miRNA and the precursor pre-miRNA
are different in the same sample (Calin, et al. (2002) Proc Natl
Acad Sc USA. 99, 15524-15529; Mourelatos, et al. (2002) Genes Dev
16, 720-728; Lagos-Quintana, et al. (2002) Curr Biol 12, 735-739);
in fact, for another 10 miRNAs for which only the oligonucleotide
corresponding to the active version was present on the chip, no
concordance with quantitative real-time PCR results was observed
for the precursor.
[0222] The stringency of hybridization was, in several instances,
sufficient to distinguish nucleotide mismatches for members of
closely related miRNA families and very similar sequences gave
distinct expression profiles (for example let-7a-1 and let-7f-2
which are 89% similar in an 88 nucleotide sequence). Therefore,
each quantified result represents the specific expression of a
single miRNA member and not the combined expression of the entire
family. In other cases, when a portion of oligonucleotide was 100%
identical for two probes (for example, the 23 mer of active
molecule present in the 40-mer oligonucleotides for both mir-16
sequences from chromosome 13 and chromosome 3), very similar
profiles were observed. Therefore, both sequence similarity and
secondary structure influence the cross-hybridization between
different molecules on this type of microarray.
[0223] miRNA Expression in Normal Human Tissues. To further
validate reliability of the microarray, we analyzed a panel of 20
RNAs from human normal tissues, including 18 of adult origin (7
hematopoietic and 11 solid tissues) and 2 of fetal origin (fetal
liver and brain). For 15 of them, at least two different RNA
samples or two replicates from the same preparation were used (for
a detailed list of samples see the above Methods). The results
demonstrated that different tissues have distinctive patterns of
miRNome expression (defined as the full complement of miRNAs in a
cell) with each tissue presenting a specific signature. Using
unsupervised hierarchical clustering, the same types of tissue from
different individuals clustered together. The hematopoietic tissues
presented two distinct clusters, the first one containing CD5+
cells, T lymphocytes, and leukocytes and the second cluster
containing bone marrow, fetal liver and B lymphocytes. Of note, RNA
of fetal or adult type from the same tissue origin (brain) present
different miRNA expression pattern. The results demonstrated that
some miRNAs are highly expressed in only one or few tissues, such
as miR-1b-2 or miR-99b in brain, and the closely related members
miR-133a and miR-133b in skeletal muscle, heart and prostate. The
types of normalization of the GeneSpring software (on 50% with or
without a per-gene on median normalization) did not influence these
results.
[0224] To verify these data, Northern blot analysis was performed
on total RNA used in the microarray experiments, using four miRNA
probes: miR-16-1, miR-26a, miR-99a and miR-223. In each case, the
concordance between the two techniques was high: in all instances
the highest and the lowest expression levels were concordant. For
example high levels of miR-223 expression were found by both
techniques in spleen, for miR-16-1 in CD5+ cells, while very low
levels were found in brain for both miRNAs. Moreover, in several
instances (for example miR-15a), we were able to identify the same
pattern of expression for the precursor and the active miR with
both microchip and Northern blots.
[0225] We also compared the published expression data for cloned
human and mouse miRNAs by Northern blot analyses against the
microarray results. We found that the concordance with the chip
data is high for both pattern and intensity of expression. For
example, miR-133 was reported to be strongly expressed only in the
skeletal muscle and heart (Sempere, et al. (2003) Genome Biol. 5,
R13), precisely as was found with the microarray, while miR-125 and
mir-128 were reported to be highly expressed in brain (Sempere, et
al. (2003) Genome Biol. 5, R13), a finding confirmed on the
microchip.
Example 11
miRNA Profiling of B-Cell Chronic Lymphocytic Leukemia Samples
Introduction
[0226] The miRNome expression in 38 individual human B-cell chronic
lymphocytic leukemia (CLL) cell samples was determined utilizing
the microchip of Example 10. One normal lymph node sample and 5
samples from healthy donors, including two tonsillar CD5+ B
lymphocyte samples and three blood mononuclear cell (MNC) samples,
were included for comparison. As hereinafter demonstrated, two
distinct clusters of CLL samples associated with the presence or
the absence of Zap-70 expression, a predictor of early disease
progression. Two miRNA signatures were associated with presence or
absence of mutations in the expressed immunoglobulin
variable-region genes or with deletions at 13q14 respectively.
[0227] Materials and Methods
[0228] The following methods were employed in the miRNome
expression study.
[0229] Tissue Samples and CLL Samples. 47 samples were used for
this study, including 41 samples from 38 patients with CLL, and 6
normal samples, including one lymph node, tonsillar CD5+ B cells
from two normal donors and blood mononuclear cells from three
normal donors. For three cases, two independent samples were
collected and processed. CLL samples were obtained after informed
consent from patients diagnosed with CLL at the CLL Research
Consortium institutions. Briefly, blood was obtained from CLL
patients, mononuclear cells were isolated through Ficoll/Hypaque
gradient centrifugation (Amersham Pharmacia Biotech) and processed
for RNA extraction according to described protocols (M.
Lagos-Quintana, R. Rauhut, W. Lendeckel, T. Tuschl, Science 294,
853-858 (2001)). For the majority of samples clinical and
biological information, such as age at diagnosis, sex, Rai stage,
presence/absence of treatment, ZAP-70 expression, IgV.sub.H gene
mutation status were available, as provided in Table 9:
TABLE-US-00009 TABLE 9 Clinical and biological data for the
patients in the two CLL clusters* Semnification Dx Age Sex % Zap VH
gene Mut CLL cluster 1 50.68 F 30.4 VH4-04 Neg CLL cluster 1 57.4 F
50.6 VH3-33 Pos CLL cluster 1 67.49 M 0.5 VH3-23 Pos CLL cluster 1
59.74 M 31.5 VH3-09 Pos CLL cluster 1 77.49 F 0.3 VH5-51 Pos CLL
cluster 1 58.19 F 3.6 VH3-30/3-30.5 Pos CLL cluster 1 43 M 41.9
VH4-30.1/4-31 Neg CLL cluster 1 61.82 M 83.2 VH1-03 Neg CLL cluster
1 48.44 F 69.3 VH1-69 Neg CLL cluster 2 72.59 M 2.2 VH3-72 Pos CLL
cluster 2 45.19 M 7.3 VH1-69 Pos CLL cluster 2 56.39 F 0.6 VH3-15
Pos CLL cluster 2 61.85 F 0.1 VH3-30 Neg CLL cluster 2 60.89 F 0.1
VH2-05 Pos CLL cluster 2 62.66 M 1 VH3-07 Pos CLL cluster 2 49.85 M
3.6 VH3-74 Pos CLL cluster 2 70.62 M 0.2 VH3-13 Pos CLL cluster 2
68.02 F 0.9 VH3-30.3 Pos CLL cluster 2 46.84 M 62.2 VH3-30/3-30.5
Neg CLL cluster 2 51.31 F 91.9 VH4-59 Neg CLL cluster 2 52.6 F 10.6
VH3-07 Pos CLL cluster 2 56.04 F 0.4 VH3-72 Pos CLL cluster 2 61.67
M 77.9 VH3-74 Neg CLL cluster 2 62.14 F 46 VH1-02 Pos CLL cluster 2
39.29 F 10.1 VH3-07 Neg *data for ZAP-70 expression were available
for 25 patients (25/38, 66%).
[0230] Cell Preparation. Mononuclear cells (MNC) from peripheral
blood of normal donors were separated by Ficoll-Hypaque density
gradients. T cells were purified from these MNC by rosetting with
neuraminidase-treated sheep red blood cells (SRBC) and depletion of
contaminant monocytes (Cd11b+), natural killer cells (CD16+) and B
lymphocytes (CD19+) were purified using magnetic beads (Dynabeads,
Unipath, Milano, Italy) and specific monoclonal antibodies (Becton
Dickinson, San Jose, Calif.). Total B cells and CD5+ B cells were
prepared from tonsillar lymphocytes as described (M. Dono et al.,
J. Immunol. 164, 5596-604. (2000)). Briefly, tonsils were obtained
from patients in the pediatric age group undergoing routine
tonsillectomies, after informed consent. Purified B cells were
prepared by rosetting T cells from MNC cells with neuraminidase
treated SRBC. In order to obtain CD5+ B cells, purified B cells
were incubated with anti CD5 monoclonal antibody followed by goat
anti mouse Ig conjugated with magnetic microbeads. CD5+ B cells
were positively selected by collecting the cells retained on the
magnetic column MS by Mini MACS system (Miltenyi Biotec, Auburn,
Calif.). The degree of purification of the cell preparations was
higher than 95%, as assessed by flow cytometry.
[0231] RNA Extraction and Northern Blots. Total RNA isolation and
blots were performed as described (G. A. Calin et al., Proc Natl
Acad Sc USA. 99, 15524-15529 (2002)). After RNA isolation, the
washing step with ethanol was not performed, or if performed, the
tube walls were rinsed with 75% ethanol without perturbing the RNA
pellet (M. Lagos-Quintana, R. Rauhut, W. Lendeckel, T. Tuschl,
Science 294, 853-858 (2001)). For reuse, blots were stripped by
boiling in 0.1% aqueous SDS/0.1.times.SSC for 10 minutes, and were
reprobed. 5S rRNA stained with ethidium bromide served as a sample
loading control.
[0232] Microarray Experiments. RNA blot analysis was performed as
described in Example 10, utilizing the microchip of Example 10.
Briefly, labeled targets from 5 .mu.g of total RNA was used for
hybridization on each miRNA microarray chip containing 368 probes
in triplicate, corresponding to 245 human and mouse miRNA genes.
The microarrays were hybridized in 6.times.SSPE/30% formamide at
25.degree. C. for 18 hrs, washed in 0.75.times.TNT at 37.degree. C.
for 40 min, and processed using a method of direct detection of the
biotin-containing transcripts by Streptavidin-Alexa647 conjugate.
Processed slides were scanned using a Perkin Elmer ScanArray.RTM.
XL5K Scanner, with the laser set to 635 nm, at Power 80 and PMT 70
setting, and a scan resolution of 10 microns.
[0233] Data Analysis. Expression profiles were analyzed in
duplicate independent experiments starting from the same cell
sample. Raw data were normalized and analyzed in GeneSpring.RTM.
software version 6.1.1 (Silicon Genetics, Redwood City, Calif.).
GeneSpring generated an average value of the three spot replicates
of each miRNA. Following data transformation (to convert any
negative value to 0.01), normalization was performed by using a
per-chip on median normalization method and a normalization to
specific samples, expressly to the two CD5+ B cell samples, used as
common reference for miRNA expression. Hierarchical clustering for
both genes and conditions were generated by using standard
correlation as a measure of similarity. To identify genes with
statistically significant differences between sample groups (i.e.
CLL cells and CD5+ B cells, CLL and MNC, CLL samples with or
without IgV.sub.H mutations or CLL cases with or without 13q14.3
deletion), a Welch's approximate t-test for two groups (variances
not assumed equal) with a p-value cutoff of 0.05 and Benjamini and
Hochberg False Discovery Rate as multiple testing correction were
performed.
[0234] Real Time PCR. Quantitative real-time PCR was performed as
described by T. D. Schmittgen, J. Jiang, Q. Liu, L. Yang, Nucleic
Acid Research 32, 43-53 (2004). Briefly, RNA was reverse
transcribed to cDNA with gene-specific primers and Thermoscript and
the relative amount of each miRNA to tRNA for initiator methionine
was described, using the equation 2.sup.-dcT, where
dC.sub.T=(C.sub.TmiRNA-C.sub.TU6 or HUMTMI RNA). The set of
analyzed miRNAs included miR-15a, miR-16-1, miR-18, miR-20, and
miR-21. The primers used were as published (Id.).
[0235] Western Blotting. Protein lysates were prepared from the
leukemia cells of 7 CLL patients and from isolated tonsillar
CD5.sup.+ B cells. Western blot analysis was performed with a
polyclonal Pten antibody (Cell Signaling Technology, Beverly,
Mass.) and was normalized using an anti-actin antibody (Sigma, St.
Louis, Mo.).
[0236] Microarray Data Submission. All data were submitted using
MIAMExpress to the Array Express database and each of the 39 CLL
samples described here received an ID number ranging from SAMPLE
169194SUB621 to SAMPLE 169234SIUB621.
[0237] Results
[0238] Comparison of miRNA expression in CLL cells vs. normal CD5+
B cells and normal blood mononuclear cells. Normal CD5+ B cells
utilized in this study are considered as normal cell counterparts
to CLL B cells. As described in Table 10, two groups of
differentially expressed miRNAs, the first composed of 55 genes and
the second of 29 genes, had statistically significant differences
in expression levels between the various groups (p<0.05 using
Welch t-test as described in Materials and Methods, above). Only 6
miRNA are shared between the two lists, confirming the results of
Example 10 showing distinct miRNome signatures in CD5.sup.+ B cells
and leukocytes. When both pre-miRNA and mature miRNA were observed
to be dysregulated (such as for miR-123, miR-132 or miR-136), the
same type of variation in CLL samples with respect to CD5 or MNC
was noted in every case. Also, for some miRNA genomic clusters all
members were aberrantly regulated (such as the up-regulated 7q32
group encompassing miR-96-miR182-miR183), while for others only
some members were abnormally expressed (such as the 13q31 genomic
cluster where two out of six members, miR-19 and miR-92-1, were
strongly up-regulated and two, miR-17 and miR-20, were moderately
down-regulated). Without wishing to be bound by any theory, the
results illustrate the complexity of the patterns of miRNA
expression in CLL and indicate the existence of mechanisms
regulating individual miRNA genes that map in the same chromosome
region. In confirmation of the accuracy of the data, miR-223,
reported to be expressed at high levels in granulocytes (M.
Lagos-Quintana et al., Curr Biol 12, 735-739 (2002)), was expressed
at significantly lower levels in the CLL samples than in the MNC,
but at about the same level as that noted for CD5.sup.+ B cells
(which generally constitute less than a few percent of blood
MNC).
TABLE-US-00010 TABLE 10 Differentially expressed miRNAs in CLLs
versus CD5+ cells or CLLs versus MNC (bold)* Oligonucleotide probe
microRNA Chr location FRA associated P-value Type
hsa-let-7a-2-precNo1 let-7a-2 11q24.1 0.014 Down
hsa-let-7d-v2-precNo2 let-7d-v2-prec 12q14.1 4.29E-04 Down
hsa-let-7f-1-precNo1 let-7f-1 09q22.2 FRA9D 3.09E-29 Down
hsa-mir-009-2No1 miR-9-2 5q14 0.013 up hsa-mir-010a-precNo2
miR-10a-prec 17q21.3 0.007 up hsa-mir-010b-precNo1 mir-10b 02q31
1.10E-15 up hsa-mir-015b-precNo2 mir-15b-prec 03q26.1 5.79E-14 up
hsa-mir-017-precNo2 mir-17-prec 13q31 0.042 Down
hsa-mir-017-precNo2 mir-17-prec 13q31 0.049 Down hsa-mir-019a-prec
mir-19a 13q31 5.16E-17 up hsa-mir-020-prec mir-20a 13q31 0.038 Down
hsa-mir-021-prec-17No2 mir-21-prec 17q23.2 FRA17B 0.044 up
hsa-mir-022-prec mir-22 17p13.3 7.16E-04 up hsa-mir-023a-prec
mir-23a 19p13.2 0.011 Down hsa-mir-024-1-precNo1 mir-24-1 09q22.1
FRA9D 0.002 Down hsa-mir-024-1-precNo2 mir-24-1-prec 09q22.1 FRA9D
7.35E-20 up hsa-mir-024-2-prec mir-24-2 19p13.2 5.69E-17 Down
hsa-mir-025-prec mir-25 07q22 FRA7F 9.52E-04 Down hsa-mir-027b-prec
mir-27b 09q22.1 FRA9D 0.046 Down hsa-mir-029a-2No1 mir-29a-2 07q32
FRA7H 0.013 up hsa-mir-029a-2No2 mir-29a-2-prec 07q32 FRA7H 0.001
up hsa-mir-029c-prec mir-29c 01q32.2-32.3 0.002 up
hsa-mir-030a-precNo1 mir-30a 06q12-13 0.004 Down
hsa-mir-030a-precNo2 mir-30a-prec 06q12-13 0.034 Down
hsa-mir-030d-precNo2 mir-30d-prec 08q24.2 0.008 Down
hsa-mir-033-prec mir-33 22q13.2 1.56E-18 up hsa-mir-034precNo1
mir-34 01p36.22 6.00E-06 up hsa-mir-092-prec-13=092-1No1 mir-92-1
13q31 1.70E-12 up hsa-mir-092-prec-13=092-1No2 mir-92-prec 13q31
0.021 Down hsa-mir-092-prec-X=092-2 mir-92-2 Xq26.2 3.38E-04 Down
hsa-mir-092-prec-X=092-2 mir-92-2 Xq26.2 0.042 Down
hsa-mir-096-prec-7No1 mir-96 07q32 FRA7H 1.79E-04 up
hsa-mir-099-prec-21 mir-99 21q11.2 0.001 Down
hsa-mir-101-1/2-precNo1 mir-101 01p31.3 FRA1C 1.26E-08 up
hsa-mir-101-1/2-precNo2 mir-101-prec 01p31.3 0.017 up
hsa-mir-103-prec-5=103-1 mir-103-1 05q35.1 0.002 Down
hsa-mir-103-prec-5=103-1 mir-103-1 05q35.1 0.007 Down
hsa-mir-105-prec-X.1=105-1 mir-105-1 Xq28 FRAXF 1.55E-05 up
hsa-mir-107-prec-10 mir-107 10q23.31 0.002 Down hsa-mir-123-precNo1
mir-123 09q34 2.80E-16 up hsa-mir-123-precNo1 mir-123 09q34 0.021
Down hsa-mir-123-precNo2 mir-123-prec 09q34 0.021 Down
hsa-mir-124a-2-prec mir-124a-2 08q12.2 4.33E-06 up
hsa-mir-128b-precNo1 mir-128b 03p22 5.05E-07 Down
hsa-mir-128b-precNo2 mir-128-prec 03p22 0.007 up
hsa-mir-130a-precNo2 mir-130a-prec 11q12 0.010 Down
hsa-mir-130a-precNo2 mir-130a-prec 11q12 0.050 up
hsa-mir-132-precNo1 mir-132 11q12 1.68E-07 up hsa-mir-132-precNo2
mir-132-prec 17p13.3 8.62E-04 up hsa-mir-134-precNo1 mir-134 14q32
6.01E-08 up hsa-mir-136-precNo1 mir-136 14q32 0.003 up
hsa-mir-136-precNo2 mir-136-prec 14q32 7.44E-04 up hsa-mir-137-prec
mir-137 01p21-22 0.013 up hsa-mir-138-1-prec mir-138-1 03p21
2.53E-04 up hsa-mir-140No1 mir-140 16q22.1 2.41E-16 up
hsa-mir-141-precNo1 mir-141 12p13 7.91E-08 up hsa-mir-141-precNo2
mir-141-prec 12p13 1.39E-08 up hsa-mir-142-prec mir-142 17q23
FRA17B 0.004 Down hsa-mir-145-prec mir-145 05q32-33 0.021 Down
hsa-mir-146-prec mir-146 05q34 1.03E-08 Down hsa-mir-148-prec
mir-148 07p15 3.48E-05 up hsa-mir-152-precNo1 mir-152 17q21 0.003
up hsa-mir-152-precNo2 mir-152-prec 17q21 3.35E-05 up
hsa-mir-153-1-prec1 mir-153 02q36 0.005 up hsa-mir-153-1-prec2
mir-153-prec 02q36 1.48E-08 up hsa-mir-154-prec1No1 mir-154 14q32
1.14E-10 up hsa-mir-155-prec mir-155 21q21 0.029 up
hsa-mir-181b-precNo2 mir-181b-prec 01q31.2-q32.1 3.26E-06 up
hsa-mir-181c-precNo2 mir-181c-prec 19p13.3 0.003 up
hsa-mir-182-precNo2 mir-182-prec 07q32 FRA7H 0.001 up
hsa-mir-183-precNo2 mir-183-prec 07q32 FRA7H 1.26E-23 up
hsa-mir-184-precNo1 mir-184 15q24 0.007 up hsa-mir-188-prec mir-188
Xp11.23-p11.2 6.08E-11 up hsa-mir-190-prec mir-190 15q21 FRA15A
1.48E-20 up hsa-mir-191-prec mir-191 03p21 9.14E-05 Down
hsa-mir-192-2/3No1 mir-192 11q13 2.00E-07 Down hsa-mir-193-precNo2
mir-193-prec 17q11.2 9.14E-05 up hsa-mir-194-precNo1 mir-194 01q41
FRA1H 0.002 up hsa-mir-196-2-precNo1 mir-196-2 12q13 FRA12A
4.94E-08 up hsa-mir-196-2-precNo2 mir-196-2-prec 12q13 FRA12A 0.040
up hsa-mir-197-prec mir-197 01p13 0.003 Down hsa-mir-200a-prec
mir-200a 01p36.3 9.14E-05 up hsa-mir-204-precNo2 mir-204-prec
09q21.1 8.55E-04 up hsa-mir-206-precNo1 mir-206 06p12 0.003 Down
hsa-mir-210-prec mir-210 11p15 0.009 Down hsa-mir-212-precNo1
mir-212 17p13.3 0.045 Down hsa-mir-213-precNo1 mir-213
01q31.3-q32.1 1.47E-33 Down hsa-mir-217-precNo2 mir-217 02p16
3.85E-09 up hsa-mir-220-prec mir-220 Xq25 2.14E-09 Down
hsa-mir-220-prec mir-220 Xq25 3.16E-05 Down hsa-mir-221-prec
mir-221 Xp11.3 1.39E-05 Down hsa-mir-223-prec mir-223 Xq12-13.3
9.04E-04 Down *The correlation with fragile sites (FRA) location is
as published in Calin et al., Proc Natl Acad Sci USA. 101,
2999-3004 (2004).
[0239] As indicated in the CLL vs. CD5+ B cell list of Table 10,
several miRNAs located exactly inside fragile sites (miR-183 at
FRA7H, miR-190 at FRA15A and miR-24-1 at FRA9D) and miR-213. The
mature miR-213 molecule is expressed at lower levels in all the CLL
samples, and the precursor miR-213 is reduced in expression in
62.5% of the samples. miR-16-1, at 13q14.3, which we previously
reported to be down-regulated in the majority of CLL cases by
microarray analysis (G. A. Calin et al., Proc Natl Acad Sc USA. 99,
15524-15529 (2002), was expressed at low levels in 45% of CLL
samples. An identical mature miR-16 exists on chromosome 3; because
the 40-mer oligonucleotide for both miR-16 sequences from
chromosome 13 (miR-16-1) and chromosome 3 (miR-16-2) exhibit the
same 23-mer mature sequence, very similar profiles were observed.
However, since we observed very low levels of miR-16-2 expression
in CLL samples by Northern blot, the expression observed is mainly
contributed by miR-16-1. The other miRNA of 13q14.3, miR-15a, was
expressed at low levels in .about.25% of CLL cases. Overall, these
data demonstrate that CLL is a malignancy with extensive
alterations of miRNA expression.
[0240] Validation of the microarray data was supplied for four
miRNAs by Northern blot analyses: miR-16-1, located within the
region of deletion at 13q14.3, miR-26a, on chromosome 3 in a region
not involved in the pathogeneses of CLL, and miR-206 and miR-223
that are down-regulated (see above) in the majority of samples. For
all four miRNAs, the Northern blot analyses confirmed the data
obtained using the microarray. We also performed real-time PCR to
measure expression levels of precursor molecules for five genes
(miR-15a, miR-16-1, miR-18, miR-21, and miR-30d) and we found
results concordant with the chip data.
[0241] Unsupervised hierarchical clustering generated two clearly
distinguishable miRNA signatures within the set of CLL samples, one
closer to the miRNA expression profile observed in human leukocytes
and the other clearly different (FIG. 3). A list of the microRNAs
differentially expressed between the two main CLL clusters is given
in Table 11. The name of each miRNA is as in the miRNA Registry.
The disregulation of either active molecule or precursor is
specified in the name. The location in minimally deleted or
minimally amplified or breakpoint regions or in fragile sites is
presented. The top 25 differentially expressed miRNA in these two
signatures (at p<0.001) include genes known or suggested to be
involved in cancer. The precursor of miR-155 is over-expressed in
the majority of childhood Burkitt's lymphoma (M. Metzler, M. Wilda,
K. Busch, S. Viehmann, A. Borkhardt, Genes Chromosomes Cancer. 39,
167-9. (2004)), miR-21 is located at the fragile site FRA17B (G. A.
Calin et al., Proc Natl Acad Sci US A. 101, 2999-3004. (2004)),
miR-26a is at 3p21.3, a region frequently deleted region in
epithelial cancers, while miR-92-1 and miR-17 are at 13q32, a
region amplified in follicular lymphoma (Id.).
TABLE-US-00011 TABLE 11 microRNAs differentially expressed between
the two main CLL clusters*. Oligonucleotide miRNA Chr location
P-value Cancer-associated genomic regions hsa-miR-017-precNo2
miR-17-prec 13q31 0.00000000 Amp - Folicular Ly/Del - HCC
hsa-miR-020-prec miR-20 13q31 0.00000000 Amp - Folicular Ly/Del -
HCC hsa-miR-103-2-prec miR-103-2 20p13 0.00000001
hsa-miR-030d-precNo2 miR-30d-prec 08q24.2 0.00000002
hsa-miR-106-prec-X miR-106 Xq26.2 0.00000006 Del - advanced ovarian
ca. hsa-miR-026b-prec miR-26b 02q35 0.00000006 hsa-miR-103-prec-5 =
103-1 miR-103-1 05q35.1 0.00000006 hsa-miR-025-prec miR-25 07q22
0.00000007 FRA7F hsa-miR-030a-precNo1 miR-30a 06q12-13 0.00000008
hsa-miR-021-prec-17No1 miR-21 17q23.2 0.00000008 Amp -
Neuroblastoma; FRA17B hsa-miR-107-prec-10 miR-107 10q23.31
0.00000008 hsa-miR-092-prec-13 = 092-1No2 miR-92-1-prec 13q31
0.00000024 Amp - Follicular Ly. hsa-miR-027a-prec miR-27a 19p13.2
0.00000024 hsa-miR-023a-prec miR-23a 19p13.2 0.00000032
hsa-miR-092-prec-X = 092-2 miR-92-2 Xq26.2 0.00000040 Del -
Advanced Ovarian ca. hsa-miR-030b-precNo1 miR-30b 08q24.2 0.000004
hsa-miR-026a-precNo1 miR-26a 03p21 0.000009 Del - Epithelial
malignancies hsa-miR-093-prec-7.1 = 093-1 miR-93-1 07q22 0.000009
Amp - Folicular Ly/Del - HCC; FRA7F hsa-miR-194-precNo1 miR-194
01q41 0.000015 FRA1H hsa-miR-155-prec miR-155 21q21 0.000028 Amp -
Colon ca; Childhood Burkit Ly hsa-miR-153-2-prec miR-153-2 07q36
0.000028 t(7; 12)(q36; p13) - Acute Myeloid Leukemia
hsa-miR-193-precNo2 miR-193-prec 17q11.2 0.000044 Del - Ovarian ca.
hsa-miR-130a-precNo1 miR-130a 11q12 0.0001 hsa-miR-023b-prec
miR-23b 09q22.1 0.0001 Del - Urothelial Ca.; FRA9D
hsa-miR-030c-prec miR-30c 06q13 0.0001 hsa-miR-139-prec miR-139
11q13 0.0001 hsa-miR-144-precNo2 miR-144-prec 17q11.2 0.0001 Amp -
Primary Breast ca. hsa-miR-29b-2 = 102prec7.1 = 7.2 miR-29b-2 07q32
0.0002 Del - Prostate ca agressiveness; FRA7H hsa-miR-125a-precNo2
miR-125a-prec 19q13.4 0.0002 hsa-miR-224-prec miR-224 Xq28 0.0002
hsa-miR-211-precNo1 miR-211 Xp11.3 0.0002 Del - Malignant
Mesothelioma. hsa-miR-221-prec miR-221 Xp11.3 0.0002
hsa-miR-191-prec miR-191 03p21 0.0002 hsa-miR-018-prec miR-18 13q31
0.0003 Amp - Follicular Lymphoma hsa-miR-203-precNo2 miR-203-prec
14q32.33 0.0004 Del - Nasopharyngeal ca. hsa-miR-217-precNo2
miR-217-prec 02p16 0.0004 hsa-miR-204-precNo2 miR-204-prec 09q21.1
0.0004 hsa-miR-199a-1-prec miR-199a-1 19p13.2 0.0005
hsa-miR-128b-precNo1 miR-128b 03p22 0.0005 hsa-miR-102-prec-1
miR-102 01q32.2-32.3 0.0005 Del - Prostate ca agressiveness
hsa-miR-140No2 miR-140-prec 16q22.1 0.0006 hsa-miR-199a-2-prec
miR-199a-2 01q23.3 0.0007 hsa-miR-010b-precNo2 miR-10b-prec 02q31
0.0008 hsa-miR-029a-2No1 miR-29a-2 07q32 0.0008 Del - Prostate ca
agressiveness; FRA7H hsa-miR-125a-precNo1 miR-125a 19q13.4 0.0010
hsa-miR-204-precNo1 miR-204 09q21.1 0.0011 hsa-miR-181a-precNo1
miR-181a 09q33.1-34.13 0.0014 Del - Bladder ca hsa-miR-188-prec
miR-188 Xp11.23-p11.2 0.0014 hsa-miR-200a-prec miR-200a 01p36.3
0.0014 hsa-miR-024-2-prec miR-24-2 19p13.2 0.0014
hsa-miR-134-precNo2 miR-134-prec 14q32 0.0016 Del - Nasopharyngeal
ca. hsa-miR-010a-precNo2 miR-10a-prec 17q21.3 0.0018
hsa-miR-029c-prec miR-29c 01q32.2-32.3 0.0021 hsa-miR-010a-precNo1
miR-10a 17q21.3 0.0022 hsa-let-7d-v2-precNo1 let-7d-v2 12q14.1
0.0022 Del - Urothelial carc; FRA9D hsa-miR-205-prec miR-205
01q32.2 0.0023 hsa-miR-129-precNo1 miR-129 07q32 0.0023 Del -
Prostate ca agressiveness hsa-miR-032-precNo2 miR-32-prec 09q31.2
0.0026 Del - Lung ca.; FRA9E hsa-miR-187-precNo2 miR-187-prec
18q12.1 0.0035 hsa-miR-125b-2-precNo1 miR-125b-2 21q11.2 0.0036 Del
- Lung ca.(MA17) hsa-miR-181c-precNo1 miR-181c 19p13.3 0.0036
hsa-miR-132-precNo2 miR-132-prec 17p13.3 0.0036 Del - HCC
hsa-miR-215-precNo1 miR-215 01q41 0.0036 FRA1H hsa-miR-136-precNo1
miR-136 14q32 0.0036 Del - Nasopharyngeal ca. hsa-miR-030a-precNo2
miR-30a-prec 06q12-13 0.0040 hsa-miR-100-1/2-prec miR-100 11q24.1
0.0040 Del - 0varian Ca.; FRA11B hsa-miR-218-2-precNo1 miR-218-2
05q35.1 0.0040 hsa-miR-193-precNo1 miR-193 17q11.2 0.0052 Del -
Ovarian ca. hsa-miR-027b-prec miR-27b 09q22.1 0.0058 Del - Bladder
ca; FRA9D hsa-miR-220-prec miR-220 Xq25 0.0065
hsa-miR-024-1-precNo1 miR-24-1 09q22.1 0.0065 Del - Urothelial ca.
hsa-miR-019a-prec miR-19a 13q31 0.0071 Amp - Follicular Ly
hsa-miR-196-2-precNo1 miR-196-2 12q13 0.0082 FRA12A
hsa-miR-022-prec miR-22 17p13.3 0.0086 Del - HCC
hsa-miR-183-precNo2 miR-183-prec 07q32 0.0086 Del - Prostate ca
agressiveness; FRA7H hsa-miR-128a-precNo2 miR-128a-prec 02q21
0.0105 Del - Gastric Ca hsa-miR-203-precNo1 miR-203 14q32.33 0.0109
Del - Nasopharyngeal ca. hsa-miR-033b-prec miR-33b 17p11.2 0.0109
Amp - Breast ca. hsa-miR-030d-precNo1 miR-30d 08q24.2 0.0111
hsa-miR-133a-1 miR-133a-1 18q11.1 0.0119 hsa-miR-007-3-precNo2
miR-7-3-prec 22q13.3 0.0128 hsa-miR-021-prec-17No2 miR-21-prec
17q23.2 0.0131 Amp - Neuroblastoma hsa-miR-208-prec miR-208 14q11.2
0.0134 Del - Malignant Mesothelioma hsa-miR-154-prec1No2
miR-154-prec 14q32 0.0146 Del - Nasopharyngeal ca.
hsa-miR-141-precNo2 miR-141-prec 12p13 0.0154 hsa-miR-024-1-precNo2
miR-024-1-prec 09q22.1 0.0169 Del - Urothelial carc; FRA9D
hsa-miR-128a-precNo1 miR-128a 02q21 0.0170 Del - Gastric Ca
hsa-miR-184-precNo2 miR-184-prec 15q24 0.0219 hsa-miR-019b-2-prec
miR-19b-2 13q31 0.0302 hsa-miR-132-precNo1 miR-132 17p13.3 0.0303
Del - Hepatocellular ca. (HCC) hsa-miR-127-prec miR-127 14q32
0.0326 Del - Nasopharyngeal ca. hsa-miR-202-prec miR-202 10q26.3
0.0333 hsa-let-7g-precNo2 let-7g-prec 03p21.3 0.0350 Del - Lung
Ca., Breast Ca. hsa-miR-222-precNo1 miR-222 Xp11.3 0.0351
hsa-miR-009-1No2 miR-009-1-prec 05q14 0.0382 hsa-miR-136-precNo2
miR-136-prec 14q32 0.0391 Del - Nasopharyngeal ca.
hsa-miR-010b-precNo1 miR-10b 02q31 0.0403 hsa-miR-223-prec miR-223
Xq12-13.3 0.0407 *The location in minimally deleted or minimally
amplified or breakpoint regions or in fragile sites is presented.
HCC--Hepatocellular ca.; AML--acute myeloid leukemia.
[0242] The two clusters may be distinguished by at least one
clinico-biological factor. A high difference in the levels of
ZAP-70 characterized the two groups: 66% (6/9) patients from the
first cluster vs. 25% (4/16) patients from the second one have low
levels of ZAP-70 (<20%) (P=0.04 at chi test) (Table 9). The mean
value of ZAP-70 was 19% (.+-.31% S.D.) vs. 35% (.+-.30% S.D.),
respectively or otherwise the two clusters can discriminate between
patients who express and who do not express this protein (at levels
<20% ZAP-70 is considered as non-expressed) (Table 9). ZAP-70 is
a tyrosine kinase, which is a strong predictor of early disease
progression, and low levels of expression are proved to be a
finding associated with good prognosis (J. A. Orchard et al.,
Lancet 363, 105-11 (2004)).
[0243] The microarray data revealed specific molecular signatures
predictive for subsets of CLL that differ in clinical behavior. CLL
cases harbor deletions at chromosome 13q14.3 in approximately 50%
of cases (F. Bullrich, C. M. Croce, Chronic Lymphoid leukemia. B.
D. Chenson, Ed. (Dekker, New York, 2001)). As a single cytogenetic
defect, these CLL patients have a relatively good prognosis,
compared with patients with leukemia cells harboring complex
cytogenetic changes (H. Dohner et al., N Engl J Med. 343, 1910-6.
(2000)). It was also shown that deletion at 13q14.3 was associated
with the presence of mutated immunoglobulin V.sub.H (IgV.sub.H)
genes (D. G. Oscier et al., Blood. 100, 1177-84 (2002)), another
good prognostic factor. By comparing expression data of CLL samples
with or without deletions at 13q14, we found that miR-16-1 was
expressed at low levels in leukemias harboring deletions at 13q14
(p=0.03, ANOVA test). We also found that miR-24-2, miR-195,
miR-203, miR-220 and miR-221 are expressed at significantly reduced
levels, while miR-7-1, miR-19a, miR-136, miR-154, miR-217 and the
precursor of miR-218-2 are expressed at significantly higher levels
in the samples with 13q14.3 deletions, respectively (Table 12). All
these genes are located in different regions of the genome and
differ in their nucleotide sequences, excluding the possibility of
cross-hybridization. Without wishing to be bound by any theory,
these results suggest the existence of functional miRNA networks in
which hierarchical regulation may be present, with some miRNA (such
as miR-16-1) controlling or influencing the expression of other
miRNA
TABLE-US-00012 TABLE 12 microRNAs signatures associated with
prognosis in B-CLL.sup.1. Chr. miRNA location P-value Association
Observation miR-7-1 9q21.33 0.030 13q14 normal miR-16-1 13q14.3
0.030 IGVH mutations negative 0.023 13q14 deleted miR-19a 13q31
0.024 13q14 normal miR-24-2 19p13.2 0.033 13q14 deleted miR-29c
1q32.2-32.3 0.018 IGVH mutations cluster miR- positive 29c-miR 102
miR-102 1q32.2-32.3 0.023 IGVH mutations cluster miR- positive
29c-miR 102 miR-132 17p13.3 0.033 IGVH mutations negative miR-136
14q32 0.045 13q14 normal miR-154 14q32 0.020 13q14 normal miR-186
1p31 0.038 IGVH mutations negative mir-195 17p13 0.036 13q14
deleted miR-203 14q32.33 0.026 13q14 deleted miR-217-prec 2p16
0.005 13q14 normal miR-218-2 5q35.1 0.019 13q14 normal miR-220 Xq25
0.026 13q14 deleted miR-221 Xp11.3 0.021 13q14 deleted .sup.1The
name of each miRNA is as in miRNA Registry and the disregulation of
either active molecule or precursor is specified in the name.
[0244] The expression of mutated IgV.sub.H is a favorable
prognostic marker (D. G. Oscier et al., Blood. 100, 1177-84
(2002)). We found a distinct miRNA signature composed of 5
differentially expressed genes (miR-186, miR-132, miR-16-1, miR-102
and miR-29c) that distinguished CLL samples that expressed mutated
IgV.sub.H gene from those that expressed unmutated IgV.sub.H genes,
indicating that miRNA expression profiles have prognostic
significance in CLL. As a confirmation of our results is the
observation that the common element between the del 13q14.3-related
and the IgV.sub.H-related signatures is miR-16-1. This gene is
located in the common deleted region 13q14.3 and the presence of
this particular deletion is associated with good prognosis.
Therefore, miRNAs expand the spectrum of adverse prognostic markers
in CLL, such as expression of ZAP-70, unmutated IgV.sub.H, CD38,
deletion at chromosome 11q23, or loss or mutation of TP53.
Example 12
Identification of miRNA Signature Profiles Associated with
Prognostic Factors and Disease Survival in B-Cell Chronic Leukemia
Samples
[0245] Introduction
[0246] Knowing that the expression profile of miRNome, the full
complement of microRNAs in a cell, is different between malignant
CLL cells and normal corresponding cells, we asked whether
microarray analysis using the miRNACHIP could reveal specific
molecular signatures predictive for subsets of CLL that differ in
clinical behavior. The miRNome expression in 94 CLL samples was
determined utilizing the microchip of Example 10. miRNA expression
profiles were analyzed to determine if distinct molecular
signatures are associated with the presence or absence of two
prognostic markers, ZAP-70 expression and mutation of the IgV.sub.H
gene. The microarray data revealed that two specific molecular
signatures were associated with the presence or absence of each of
these markers. An analysis of expression profiles from Zap-70
positive/IgV.sub.H unmutated (Umut) vs. Zap-70 negative/IgV.sub.H
mutated (Mut) CLL samples revealed a unique signature of 17 genes
that can distinguish these two subsets. Our results indicate that
miRNA expression profiles have prognostic significance in CLL.
[0247] Materials and Methods
[0248] Patient Samples and Clinical Database. 94 CLL samples were
used for this study, which were obtained after informed consent
from patients diagnosed with CLL at the CLL Research Consortium
institutions (L. Z. Rassenti et al. N. Engl. J. Med. 351(9):893-901
(2004)). Briefly, blood was obtained from CLL patients and
mononuclear cells were isolated through Ficoll/Hypaque gradient
centrifugation (Amersham Pharmacia Biotech) and processed for RNA
extraction according to described protocols (G. A. Calin et al.,
Proc. Natl. Acad. Sc. U.S.A. 99, 15524-15529 (2002)). For each
sample, clinical and biological information, such as sex, age at
diagnosis, Rai stage, presence/absence of treatment, time between
diagnosis and therapy, ZAP-70 expression, and IgV.sub.H gene
mutation status, were available and are described in Table 13.
TABLE-US-00013 TABLE 13 Characteristics of patients analyzed with
the miRNACHIP. Characteristic Value Male sex - no. of patients (%)
58 (61.7) Age at diagnosis - years median 57.3 range 38.2 Therapy
begun No No. of patients 53 Time since diagnosis - months 87.07 Yes
No. of patients 41 Time between diagnosis & therapy - months
40.27 ZAP-70 level .ltoreq.20% 48 >20% 46 IgV.sub.H Unmutated
(.gtoreq.98% homology) 57 Mutated (<98% homology) 37
[0249] RNA Extraction and Northern Blots. Total RNA isolation and
RNA blotting were performed as described (G. A. Calin et al., Proc
Proc. Natl. Acad. Sc. U.S.A. 99, 15524-15529 (2002)).
[0250] Microarray Experiments. Microarray experiments were
performed as described in Example 11. Of note, for 76 microRNAs on
the miRNACHIP, two specific oligonucleotides were synthesized--one
identifying the active 22 nucleotide part of the molecule and the
other identifying the 60-110 nucleotide precursor. All probes on
these microarrays are 40-mer oligonucleotides spotted by contacting
technologies and covalently attached to a polymeric matrix.
[0251] Data Analysis. After construction of the expression table
with Genespring, data normalization was performed by using
Bioconductor package. Analyses were carried out using the PAM
package (Prediction Analysis of Microarrays) and SAM (Significance
Analysis of Microarrays) software. The data were confirmed by
Northern blotting for 4 microRNAs in 20 CLL samples, each. All data
were submitted using MIAMExpress to the Array Express database.
[0252] Analysis of ZAP-70 and Sequence analysis of expressed
IgV.sub.H. Analyses were performed as described previously (L. Z.
Rassenti et al. N. Engl. J. Med. 351(9):893-901 (2004)). Briefly,
ZAP-70 expression was assessed by immunoblot analysis and flow
cytometry, while the analysis of expressed IgV.sub.H was performed
by direct sequencing.
[0253] Results
[0254] Comparison of miRNA expression in ZAP-70 positive vs. ZAP-70
negative CLL cells. Using 20% as a cutoff for defining ZAP-70
positivity, we constructed two classes that were constituted of 48
ZAP-70-negative and 46 ZAP-70-positive CLL samples, respectively.
The analyses carried out using the PAM package identified an
expression signature composed of 14 microRNAs (14/190 miRNAs on
chip, 7.35%) with a PAM score >.+-.0.02 (Table 14). Using the
expression of these microRNAs, it is possible to predict with a low
misclassification error (about 0.2 at cross-validation) the type of
ZAP-70 expression in a patient's malignant B cells.
[0255] Comparison of miRNA expression in IgV.sub.H positive vs.
IgV.sub.H negative CLL cells. The expression of a mutated IgV.sub.H
gene is a favorable prognostic marker (D. G. Oscier et al., Blood.
100, 1177-84 (2002)). ZAP-70 expression is well correlated with the
status of the IgV.sub.H gene. Therefore, we asked whether a
specific microRNA signature can predict the mutated (Mut) vs.
unmutated (Umut) status of this gene. Using the 98% cutoff for
homology with germ-line IgV.sub.H, we identified two groups of
patients composed of 37 Umut(.gtoreq.98% homology) and 57 Mut
(<98% homology). Based on this analysis, 12 microRNAs can be
used to correctly predict the Umut vs. Mut status of the gene with
a low error (0.02) (Table 14). All of these genes are included in
the previous signature.
[0256] Comparison of miRNA expression in Zap-70 positive/IgV.sub.H
Umut vs. Zap-70 negative/IgV.sub.H Mut CLL cells. We divided the 94
CLL cases into 4 groups (Zap-70 positive/IgV.sub.H Umut, Zap-70
positive/IgV.sub.H Mut, Zap-70 negative/IgV.sub.H Umut and Zap-70
negative/IgV.sub.H Mut), and have found, using the PAM package,
that the same unique signature composed of 17 genes can
discriminate between the two main groups of patients, Zap70
positive/IgV.sub.H Umut and Zap-70 negative/IgV.sub.H Mut. In this
case, we observed the lowest classification error (0.015 at cross
validation). Only one patient was Zap-70 negative and IgV.sub.H
Umut, and therefore was not used in the classification. When the
remaining three classes were analyzed, the 10 patients belonging to
the Zap-70 positive/IgV.sub.H Mut class were always misclassified,
which indicates that there are no microRNAs on the miRNACHIP that
can compose a different signature. The same unique signature was
identified using another algorithm of microarray analysis, SAM,
thereby confirming the reproducibility of our results. These
results indicate that miRNA expression profiles have prognostic
significance in CLL and can be used for diagnosing the disease
state of a particular cancer by determining whether or not a given
profile is characteristic of a cancer associated with one or more
adverse prognostic markers.
TABLE-US-00014 TABLE 14 A miRNA signature associated with
prediction factors and disease survival in CLL patients. Short vs.
IgV.sub.H Mut Zap70+/IgV.sub.H Long ZAP-70+ vs. Umut vs. time to
Signature vs. IgV.sub.H Zap70-/IgV.sub.H initial component Zap-70-
Umut Mut therapy Observation mir-015a -0.0728 NA -0.0372 vs. NA
cluster 15a/16-1 vs. 0.076 0.0485 del CLL, prostate ca. 13q13.4 (G.
A. Calin et al., Proc. Natl. Acad. Sic. USA. 99, 15524-15529
(2002)) mir-016-1 -0.1396 -0.0852 -0.1444 vs. NA del CLL, prostate
vs. vs. 0.1312 0.1886 ca. 13q13.4 (G. A. Calin 0.1457 et al., Proc.
Natl. Acad. Sci. USA. 99, 15524-15529 (2002)) mir-016-2 -0.1615
-0.0969 -0.1619 vs. NA identical 16-1/16-2 vs. vs. 0.1493 0.2113
0.1685 mir-023a -0.0235 0.0647 vs. -0.0748 vs. 0.0587 cluster
23a/24-2 vs. 0.0997 0.0977 vs. -0.019 0.0245 mir-023b -0.0658
-0.0663 -0.0909 vs. 0.0643 cluster 24-1/23b vs. vs. 0.1021 0.1187
vs. -0.0208 FRA 9D; del 0.0686 Urothelial ca. 9q22. (G. A Calin et
al. Proc. Natl. Acad. Sci. U.S.A. 101(32): 11755-60 (2004))
mir-024-1 NA -0.042 vs. -0.0427 vs. NA FRA 9D; del 0.0648 0.0558
Urothelial ca. 9q22 (ref (G. A. Calin et al. Proc. Natl. Acad. Sci.
U.S.A. 101(32): 11755-60 (2004)) mir-024-2 NA NA -0.0272 vs. 0.0696
0.0355 vs. -0.0225 mir-029a 0.0806 0.0887 vs. 0.1139 vs. -0.1487 NA
cluster 29a/29b-1 vs. -00842 -0.1367 FRA7H; del Prostate ca. 7q32
(G. A. Calin et al. Proc. Natl. Acad. Sci. U.S.A. 101(32): 11755-60
(2004)) mir-29b-2 0.1284 0.1869 vs. 0.2065 vs. -0.2696 NA
1q32.2-32.3 vs. -0.134 -0.2879 mir-029c 0.1579 0.1846 0.2174 vs.
-0.2839 -0.0221 vs. -0.1648 vs. -0.2844 vs. 0.0072 mir-146 -0.1518
-0.1167 -0.1803 vs. 0.07 vs. vs. 0.1798 0.2354 vs. -0.0227 0.1584
mir-155 -.0.1015 -0.0743 -0.1155 vs. 0.1409 amp child Burkitt's vs.
vs. 0.1145 0.1508 vs. -0.0456 lymphoma, colon 0.1059 ca. (M.
Metzler et al. Genes Chromosomes Cancer. Feb; 39(2): 167-9 (2004))
and (M. Z. Michael et al. Mol Cancer Res. 1(12): 882-91 (2003)).
mir-181a -0.0473 NA -0.0279 vs. 0.1862 Up-regulated in vs. 0.0364
vs. -0.0603 differentiated B ly 0.0494 (C. Z. Chen et al. Science.
303(5654): 83-6 (2004)). mir-195 -0.0679 NA -0.053 vs. NA vs.
0.0692 0.0708 mir-221 -0.0812 -0.0839 -0.1157 vs. 0.0343 cluster
221/222 vs. vs. 0.1292 0.1511 vs. -0.0111 0.0848 mir-222 NA NA
-0.022 vs. 0.0458 0.0288 vs. -0.0148 mir-223 0.0522 0.1036 vs.
0.1056 vs. -0.1379 NA Normally vs. -0.0544 -0.1596 expression
restricted to myeloid lineage (C. Z. Chen et al. Science.
303(5654): 83-6 (2004)). Note: ZAP-70 negative = ZAP-70 expression
.ltoreq.20%; ZAP-70 positive = ZAP-70 expression >20%; IgV.sub.H
unmutated = homology .gtoreq.98%; IgV.sub.H mutated = homology
<98%. The numbers indicate the PAM scores in the two classes (n
score and y score). mir-29b-2 was previously named mir-102.
[0257] Association between miRNA expression and time to initial
therapy. Treatment of patients according to the National Cancer
Institute Working Group criteria (B. D. Cheson et al. Blood.
87(12):4990-7 (1996)) was performed when symptomatic or progressive
disease developed. Of the 94 patients studied, 41 had initiated
therapy (Table 13). We examined the relationship between the
expression of 190 microRNA genes and either the time from diagnosis
to initial therapy (for patients that have begun treatment) or from
the time of diagnosis to the present (for those patients who
haven't begun treatment), collectively representing the total group
of 94 patients in the study. We found that the expression profile
generated by a spectrum of 9 microRNAs, all components of the
unique signature, can differentiate between two subsets of patients
in the group of 94 tested--one subset with a short interval from
diagnosis to initial therapy and the second subset with a
significantly longer interval (see Table 14 and FIG. 5). The
significance of Kaplan-Meier curves improves if we restrict the
analyses to the two main groups of 83 patients (the Zap-70
positive/IgV.sub.H Umut and Zap-70 negative/IgV.sub.H Mut groups)
or if we use only the 17 microRNAs from the signature (P decreases
from <0.01 to P<0.005 and P<0.001, respectively). All of
the microRNAs which can predict the time to initial therapy, with
the exception of mir-29c, are overexpressed in the group
characterized by a short interval from diagnosis to initial
therapy.
Example 13
Identification of sequence alterations in miR genes associated with
CLL
[0258] Introduction
[0259] Using tumor DNA from CLL samples, we screened more than 700
kb of tumor DNAs (mean 39 patients/miRNA for mean 500 bp/miRNA) for
sequence alterations in each of 35 different miR genes. Very rare
polymorphisms or tumor specific mutations were identified in 4 of
the 39 CLL cases, affecting one of three different miR genes:
miR-16-1, miR-27b and miR-206. In two other miR genes, miR-34b and
miR-100, polymorphisms were identified in both CLL and normal
samples with similar frequencies.
[0260] Materials and Methods
[0261] Detection of microRNA mutations. Thirty-five miR genes were
analyzed for the presence of a mutation, including 16 members of
the miR expression signature identified in Example 12 (mir-15a,
mir-16-1, mir-23a, mir-23b, mir-24-1, mir-24-2, mir-27a, mir-27b,
mir-29b-2, mir-29c, mir-146, mir-155, mir-181a, mir-221, mir-222,
mir-223) and 19 other miR genes selected randomly (let-7a2, let-7b,
mir-21, mir-30a, mir-30b, mir-30c, mir-30d, mir-30e, mir-32,
mir-100, mir-108, mir-125b1, mir-142-5p, mir-142-3p, mir-193,
mir-181a, mir-206, mir-213 and mir-224).
[0262] The algorithm for screening for miR gene mutations in CLL
samples was performed as follows: the genomic region corresponding
to each precursor miRNA from either 39 CLL samples or 3 normal
mononuclear cell samples from healthy individuals was amplified,
including at least 50 base pairs in the 5' and 3' extremities. For
the miRNAs located in clusters covering less than one kilobase, the
entire corresponding genomic region was amplified and sequenced
using the Applied Biosystems Model 377 DNA sequencing system (PE,
Applied Biosystems, Foster City, Calif.). When a deviation from the
normal sequence was found, a panel of blood DNAs from 95 normal
individuals was screened to confirm that the deviation represented
a polymorphism. If the sequencing data were normal, an additional
panel of 37 CLL cases was screened to determine the frequency of
mutations in a total of 76 cancer patients. If additional mutations
were found, another set of 65 normal DNAs was screened, to assess
the frequency of the specific alteration in a total of 160 normal
samples.
[0263] In vivo studies of mir-16-1 mutant effects. We constructed
two mir-16-1/mir-15a expression vectors--one containing an 832 base
pair genomic sequence that included both mir-16-1 and mir-15a, and
another nearly identical construct containing the C to T mir-16-1
substitution, as shown in SEQ ID NO. 642--by ligating the relevant
open reading frame in a sense orientation into the mammalian
expression vector, pSR-GFP-Neo (OligoEngine, Seattle, Wash.). These
vectors are referred to as mir-16-1-WT and mir-16-1-MUT,
respectively. All sequenced constructs were transfected into 293
cells using Lipofectamine 2000 according to the manufacturer's
protocol (Invitrogen, Carlsbad, Calif.). The expression of both
mir-16-1-WT and mir-16-1-MUT constructs was assessed by Northern
blotting as previously described (G. A. Calin et al., Proc. Natl.
Acad. Sc. U.S.A. 99, 15524-15529 (2002)).
[0264] Results
[0265] Very rare polymorphisms or tumor specific mutations were
identified in 4 of the 39 CLL cases, affecting one of three
different miR genes: miR-16-1, miR-27b and miR-206 (Tables 15 and
16). In two other miR genes, miR-34b and miR-100, polymorphisms
were identified in both CLL and normal samples with similar
frequencies (see Tables 15, 16 and Results section below).
TABLE-US-00015 TABLE 15 Genetic variations in the genomic sequences
of miR genes in CLL patients. Other miRNA miRNA Mutation CLL (%)
allele Normals CHIP Observation mir-16-1 C to T 2/76 (2.6) Deleted
0/160 (0) Reduced Heterozygous in (see SEQ ID (FISH, expression
normal cells NO. 642) LOH) from both patients; Previous breast
cancer; Mother died with CLL; sister died with breast cancer.
mir-27b G to A 1/39 (2.6) Normal 0/98 (0) Normal (see SEQ ID
expression NO. 646) mir-206 G to A 1/39 (2.6) Normal NA NA (see SEQ
ID NO. 647) mir-100 G to A 17/39 (43.5) Normal 2/3 NA (see SEQ ID
NO. 644)
TABLE-US-00016 TABLE 16 Sequences showing genetic variations in the
miR genes of CLL patients. SEQ Precursor Sequence ID Name (5' to
3') NO. hsa-mir-16- GTCAGCAGTGCCTTAGCAGCACGTAAATATTGGCG 641
1-normal TTAAGATTCTAAAATTATCTCCAGTATTAACTGTG
CTGCTGAAGTAAGGTTGACCATACTCTAC hsa-mir-16-
GTCAGCAGTGCCTTAGCAGCACGTAAATATTGGCG 642 1-MUT
TTAAGATTCTAAAATTATCTCCAGTATTAACTGTG CTGCTGAAGTAAGGTTGACCATACTTTAC
hsa-mir-100 CCTGTTGCCACAAACCCGTAGATCCGAACTTGTGG 643
TATTAGTCCGCACAAGCTTGTATCTATAGGTATGT GTCTGTTAGGCAATCTCACGGACC
hsa-mir- CCTGTTGCCACAAACCCGTAGATCCGAACTTGTGG 644 100-MUT
TATTAGTCCGCACAAGCTTGTATCTATAGGTATGT GTCTGTTAGGCAATCTCACAGACC
hsa-mir- ACCTCTCTAACAAGGTGCAGAGCTTAGCTGATTGG 645 27b-normal
TGAACAGTGATTGGTTTCCGCTTTGTTCACAGTGG
CTAAGTTCTGCACCTGAAGAGAAGGTGAGATGGGG
ACAGTTAAGTTGGAGCCGCTGGGGCAGAGGCCGTT GCTGACGGGC hsa-mir-
ACCTCTCTAACAAGGTGCAGAGCTTAGCTGATTGG 646 27b-MUT
TGAACAGTGATTGGTTTCCGCTTTGTTCACAGTGG
CTAAGTTCTGCACCTGAAGAGAAGGTGAGATGGGG
ACAGTTAAGTTGGAGCCGCTGGGGCAGAGGCCGTT GCTGACAGGC has-mir-206
TGCTTCCCGAGGCCACATGCTTCTTTATATCCCCA 230
TATGGATTACTTTGCTATGGAATGTAAGGAAGTGT GTGGTTTCGGCAAGTG has-mir-
TGCTTCCCGAGGCCACATGCTTCTTTATATCCCCA 647 206-MUT
TATGGATTACTTTACTATGGAATGTAAGGAAGTGT GTGGTTTCGGCAAGTG hsa-mir-
GTGCTCGGTTTGTAGGCAGTGTCATTAGCTGATTG 648 34b-normal
TACTGTGGTGGTTACAATCACTAACTCCACTGCCA TCAAAACAAGGCACAGCATCACCGCCG
hsa-mir- GTGCTCGGTTTGTAGGCAGTGTCATTAGCTGATTG 650 34b-MUT
TACTGTGGTGGTTACAATCACTAACTCCACTGCCA TCAAAACAAGGCACAGCATCACCACCG
Note: Each mutation/polymorphism is underlined and indicated in
bold in the sequences marked "MUT".
[0266] The miR-16-1 gene is located at 13q13.4. In 2 CLL patients
out of 76 screened (2.6%), we found a homozygous C to T
polymorphism (compare SEQ ID NO: 641 to SEQ ID NO: 642; Table 16),
which is located in a 3' region of the miR-16-1 precursor (FIG. 7C)
with strong conservation in all of the primates analyzed (E.
Berezikov et al., Cell 120(1):21-4 (2005)), suggesting that this
polymorphism has functional implications. By RT-PCR and Northern
blotting we have shown that the precursor miRNA includes the 3'
region harboring the base substitution. Both patients have a
significant reduction in mir-16-1 expression in comparison with
normal CD5+ cells by miRNACHIP and Northern blotting (FIG. 6, FIG.
7D). Further suggesting a pathogenic role, by FISH and LOH, we
found a monoallelic deletion at 13q14.3 in the majority of examined
cells. This substitution was not found in any of 160 normal control
samples (p<0.05 using chi square analysis). In both patients,
the normal cells from mucal mucosa were heterozygous for this
abnormality. Therefore, this change is a very rare polymorphism or
a germ-line mutation. In support of the latter is the fact that one
of the patients has two relatives (mother and sister) who have been
diagnosed with CLL and breast cancer, respectively. Therefore, this
family fulfills the minimal criteria for "familial" CLL, i.e., two
or more cases of B-CLL in first-degree living relatives (N. Ishibe
et al., Leuk Lymphoma 42(1-2):99-108 (2001)).
[0267] To identify a possible pathogenic effect for this
substitution, we inserted both the wild-type sequence of the
mir-15a/mir-16-1 cluster, as well as the mutated sequence, into
separate expression vectors. We transfected 293 cells, which have a
low endogenous expression of this cluster. As a control, 293 cells
transfected with an empty vector were tested. The expression levels
of both mir-15a and mir-16-1 were significantly reduced in
transfectants expressing the mutant construct in comparison to
transfectants expressing the wild-type construct (FIG. 7E). The
level of expression in transfectants expressing the mutant
construct was comparable with the level of endogenous expression in
293 cells (FIG. 7E). Therefore, we conclude that the C to T change
in miR-16-1 affects the processing of the pre-miRNA in mature
miRNA.
[0268] The miR-27b gene is located on chromosome 9. A heterozygous
mutation caused by a G to A change in the 3' region of the miR-27b
precursor (compare SEQ ID NO: 645 to SEQ ID NO: 646; Table 16), but
within the transcript of the 23b-27b-24-1 cluster, was identified
in one out of 39 CLL samples. miRCHIP analysis indicated that
miR-27b expression was reduced in this sample. This change has not
been found in any of the 98 normal individuals screened to
date.
[0269] The miR-34b gene is located at 11q23. Four CLL patients out
of 39 carried two associated polymorphisms, a G to A polymorphism,
as shown in SEQ. ID NO. 650, and a T to G polymorphism located in
the 3' region of the miR-34b precursor. Both polymorphisms were
within the transcript of the mir-34b-mir-34c cluster. One patient
was found to be homozygous (presenting by FISH heterozygous
abnormal chromosome 11q23), while the other three were heterozygous
for the polymorphisms. The same frequency of mutation was found in
35 normal individuals tested.
Example 14
Identification of Abnormalities in the Genomic Sequences of MiR
Genes Associated with CLL
[0270] Introduction
[0271] Abnormally expressed cancer genes are frequently targets for
genetic abnormalities, e.g., mutations that can either activate or
inactivate their function. Therefore, we screened 42 microRNAs for
germline or somatic mutations.
[0272] Materials and Methods
[0273] Detection of microRNA gene mutations.
[0274] The genomic region corresponding to each precursor miRNA,
including at least 50 additional base pairs (bp) in the 5' and 3'
extremities (i.e., flanking sequences), was amplified from 40 CLL
samples and normal mononuclear cell samples from 3 healthy
individuals. For the miRNAs located in clusters that were less than
one kilobase (kb) in length, the entire corresponding genomic
region was amplified and sequenced using the Applied Biosystems
Model 377 DNA sequencing system (PE, Applied Biosystems, Foster
City, Calif.). When a deviation from the normal sequence was found,
a panel of blood DNAs from 160 normal individuals, as well as an
additional panel of 35 CLL cases (total of 75 leukemia patients),
were screened to confirm polymorphisms. All subjects were
Caucasian, as indicated by medical records of CLL patients and
information obtained during an interview for control patients. For
46 CLL patients, personal and/or familial cancer history was known.
Forty-two miR genes were screened for germline or somatic
mutations, including 15 members of the specific signature
identified in Example 12, or members of the same cluster: miR-15a,
miR-16-1, miR-23a, miR-23b, miR-24-1, miR-24-2, miR-27a, miR-27b,
miR-29b-2, miR-29c, miR-146, miR-155, miR-221, miR-222, miR-223, as
well as 27 other microRNAs that were selected randomly: let-7a2,
let-7b, miR-17-3p, miR-17-5p, miR-18, miR-19a, miR-19b-1, miR-20,
miR-21, miR-30b, miR-30c-1, miR-30d, miR-30e, miR-32, miR-100,
miR-105-1, miR-108, miR-122, miR-125b-1, miR-142-5p, miR-142-3p,
miR-193, miR-181a, miR-187, miR-206, miR-224, miR-346.
[0275] Results
[0276] Germline or somatic mutations were identified in miRNA
genomic regions in 11 out of 75 (15%) CLL samples. Five different
miRNAs were affected by mutations (5/42 miR genes analyzed, 12%):
miR-16-1, miR-27b, miR-206, miR-29b-2 and miR-187. None of these
mutations were found in a set of 160 individuals without cancer
(p<0.0001) (see Table 17). The positions of the various
mutations are shown relative to the position of the miR gene in
FIG. 7A. All the abnormalities are localized in regions that are
transcribed, as shown by RT-PCR (FIG. 7B). Eight of the 11 (73%)
patients with abnormal miRNA sequences have a known personal or
familial history of CLL or other hematopoietic or solid tumors
(Table 17). Sequences containing the identified miR gene mutations,
as well as their corresponding wild-type sequences, are shown in
Table 16 for miR-16-1 and miR-27b and in Table 18 for miR-29b-2,
miR-187 and miR-206. Two mutations were identified in miR-29b-2 and
miR-206 (labeled MUT1 and MUT2, respectively, in Table 18). In
addition, a polymorphism was detected in both CLL and normal
samples with similar frequencies for three other miR genes:
miR-29c, miR-122a and miR-187 (labeled MUT2) (see Tables 17 and
18).
TABLE-US-00017 TABLE 17 Genetic variations in the genomic sequences
of miR genes in CLL patients. miRNACHIP miRNA Location** CLL
Normals expression Observations miR- Germline; 2/75 0/160 Reduced
to Normal allele deleted in 16-1 pri- 15% and 40% CLL cells in both
miRNA: of normal, patients (FISH, LOH). CtoT respectively For one
patient: History substitution of previous breast at +7 bp in
cancer; mother with CLL the 3' (deceased); sister with flanking
breast cancer (deceased). miR- Germline; 1/75 0/160 Normal Mother
with throat and 27b pri- lung cancer at age 58. miRNA: G Father
with lung cancer toA at age 57. substitution at +50bp in 3'
flanking sequence miR- pri- 1/75 0/160 Reduced to 75% Sister with
breast cancer 29b-2 miRNA: G at age 88 (still living). to A Brother
with "some type substitution of blood cancer" at age at +212 in 70.
3' flanking sequence miR- pri- 3/75 0/160 Reduced to 80% Both
patients have a 29b-2 miRNA: A family history of insertion at
unspecified cancer. +107 in 3' flanking sequence miR- pri- 1/75
0/160 NA Unknown 187 miRNA: T to C substitution at +73 in 3'
flanking sequence miR- pre- 2/75 0/160 Reduced to 25% Prostate
cancer; mother 206 miRNA: G with esophogeal cancer. to T Brother
with prostate substitution cancer; sister with breast at position
cancer 49 of precursor miR- Somatic; 1/75 0/160 Reduced to 25% Aunt
with leukemia 206 pri- (data only for one (deceased) miRNA: pt) A
to T substitution at -116 in 5' flanking sequence miR- pri- 2/75
1/160 NA Paternal grandmother 29c miRNA: G with CLL; sister with to
A breast cancer. substitution at -31 in 5' flanking sequence miR-
pre- 1/75 2/160 Reduced to 33% Paternal uncle with 122a miRNA: C
colon cancer. to T substitution at position 53 of precursor miR-
pre- 1/75 1/160 NA Grandfather with 187 miRNA: G polycythemia vera.
to A Father has a history of substitution cancer but not at
position lymphoma. 34 of precursor For each CLL patient/normal
control, more than 12 kb of genomic DNA was sequenced. In total,
~627 kb of tumor DNA and about 700 kb of normal DNA was screened by
direct sequencing. The positions of the mutations are reported with
respect to the precursor miRNA molecule. **When normal
corresponding DNA from bucal mucosa was available, the alteration
was identified as germline when present or somatic when absent,
respectively. FISH = fluorescence in situ hybridization; LOH = loss
of heterozygosity; NA = not available.
TABLE-US-00018 TABLE 18 Sequences showing genetic variations in the
miR genes of CLL patients. Precursor Sequence SEQ (5' to 3') +/- 5'
or 3' ID Name flanking genomic sequence NO. hsa-mir-29b-
CTTCTGGAAGCTGGTTTCACATGGTGGCTT 651 2-normal
AGATTTTTCCATCTTTGTATCTAGCACCAT TTGAAATCAGTGTTTTAGGAGTAAGAATTG
CAGCACAGCCAAGGGTGGACTGCAGAGGAA CTGCTGCTCATGGAACTGGCTCCTCTCCTC
TTGCCACTTGAGTCTGTTCGAGAAGTCCAG GGAAGAACTTGAAGAGCAAAATACACTCTT
GAGTTTGTTGGGTTTTGGGAGAGGTGACAG TAGAGAAGGGGGTTGTGTTTAAAATAAACA
CAGTGGCTTGAGCAGGGGCAGAGG hsa-mir-29b-
CTTCTGGAAGCTGGTTTCACATGGTGGCTT 652 2-MUT1 (G to A
AGATTTTTCCATCTTTGTATCTAGCACCAT substitution
TTGAAATCAGTGTTTTAGGAGTAAGAATTG at +212 in 3'
CAGCACAGCCAAGGGTGGACTGCAGAGGAA flanking
CTGCTGCTCATGGAACTGGCTCCTCTCCTC sequence)
TTGCCACTTGAGTCTGTTCGAGAAGTCCAG GGAAGAACTTGAAGAGCAAAATACACTCTT
GAGTTTGTTGGGTTTTGGGAGAGGTGACAG TAGAGAAGGGGGTTGTGTTTAAAATAAACA
CAGTGGCTTGAGCAGGGGCAGAAG hsa-mir-29b-2-
CTTCTGGAAGCTGGTTTCACATGGTGGCTT 653 MUT2 (A
AGATTTTTCCATCTTTGTATCTAGCACCAT insertion at
TTGAAATCAGTGTTTTAGGAGTAAGAATTG +107 in
CAGCACAGCCAAGGGTGGACTGCAGAGGAA 3' flanking
CTGCTGCTCATGGAACTGGCTCCTCTCCTC sequence)
TTGCCACTTGAGTCTGTTCGAGAAGTCCAG GGAAGAAACTTGAAGAGCAAAATACACTCT
TGAGTTTGTTGGGTTTTGGGAGAGGTGACA GTAGAGAAGGGGGTTGTGTTTAAAATAAAC
ACAGTGGCTTGAGCAGGGGCAGAGG hsa-mir-187-
GGTCGGGCTCACCATGACACAGTGTGAGAC 654 normal
CTCGGGCTACAACACAGGACCCGGGCGCTG CTCTGACCCCTCGTGTCTTGTGTTGCAGCC
GGAGGGACGCAGGTCCGCAGCAGAGCCTGC TCCGCTTGTCCTGAGGGACTCGACACAGGG
GACTGCACAGAGACCATGGGAAAGTCCAGG CTC hsa-mir-187-
GGTCGGGCTCACCATGACACAGTGTGAGAC 655 MUT1 (T to C
CTCGGGCTACAACACAGGACCCGGGCGCTG substitution
CTCTGACCCCTCGTGTCTTGTGTTGCAGCC at +73 in 3'
GGAGGGACGCAGGTCCGCAGCAGAGCCTGC flanking
TCCGCTTGTCCTGAGGGACTCGACACAGGG sequence)
GACTGCACAGAGACCATGGGAAAGTCCAGG CCC hsa-mir-187-
GGTCGGGCTCACCATGACACAGTGTGAGAC 656 MUT2 (G to A
TCGAGCTACAACACAGGACCCGGGGCGCTG substitution
CTCTGACCCCTCGTGTCTTGTGTTGCAGCC at position 34
GGAGGGACGCAGGTCCGCAGCAGAGCCTGC of precursor)
TCCGCTTGTCCTGAGGGACTCGACACAGGG GACTGCACAGAGACCATGGGAAAGTCCAGG CTC
has-mir-206 GATTTAGGATGAGTTGAGATCCCAGTGATC 657
TTCTCGCTAAGAGTTTCCTGCCTGGGCAAG GAGGAAAGATGCTACAAGTGGCCCACTTCT
GAGATGCGGGCTGCTTCTGGATGACACTGC TTCCCGAGGCCACATGCTTCTTTATATCCC
CATATGGATTACTTTGCTATGGAATGTAAG GAAGTGTGTGGTTTCGGCAAGTG has-mir-206-
GATTTAGGATGAGTTGAGATCCCAGTGATC 658 MUT1 (G to T
TTCTCGCTAAGAGTTTCCTGCCTGGGCAAG substitution
GAGGAAAGATGCTACAAGTGGCCCACTTCT at position 49
GAGATGCGGGCTGCTTCTGGATGACACTGC of precursor)
TTCCCGAGGCCACATGCTTCTTTATATCCC CATATGGATTACTTTTCTATGGAATGTAAG
GAAGTGTGTGGTTTCGGCAAGTG has-mir-206- GTTTTAGGATGAGTTGAGATCCCAGTGATC
659 MUT2 (A to T TTCTCGCTAAGAGTTTCCTGCCTGGGCAAG substitution
GAGGAAAGATGCTACAAGTGGCCCACTTCT at -116 in 5'
GAGATGCGGGCTGCTTCTGGATGACACTGC flanking
TTCCCGAGGCCACATGCTTCTTTATATCCC sequence)
CATATGGATTACTTTTCTATGGAATGTAAG GAAGTGTGTGGTTTCGGCAAGTG hsa-mir-29c-
CGAGGTGCAGACCCTGGGAGCACCACTGGC 660 normal
CCATCTCTTACACAGGCTGACCGATTTCTC CTGGTGTTCAGAGTCTGTTTTTGTCTAGCA
CCATTTGAAATCGGTTATGATGTAGGGGGA hsa-mir-29c- C+*B
AAGGTGCAGACCCTGGGAGCACCACTGGC 661 MUT (G to A
CCATCTCTTACACAGGCTGACCGATTTCTC substitution
CTGGTGTTCAGAGTCTGTTTTTGTCTAGCA at -31 in 5'
CCATTTGAAATCGGTTATGATGTAGGGGGA flanking sequence) hsa-mir-122a-
CCTTAGCAGAGCTGTGGAGTGTGACAATGG 662 normal
TGTTTGTGTCTAAACTATCAAACGCCATTA TCACACTAAATAGCTACTGCTAGGC
hsa-mir-122a- CCTTAGCAGAGCTGTGGAGTGTGACAATGG 663 MUT (C to T
TGTTTGTGTCTAAACTATCAAATGCCATTA substitution
TCACACTAAATAGCTACTGCTAGGC at position 53 of precursor) Note: The
position of each mutation/polymorphism is underlined and indicated
in bold in the sequences marked "MUT".
Example 15
A Unique MicroRNA Signature Associated with Prognostic Factors and
Disease Progression in Chronic Lymphocytic Leukemia
[0277] Introduction: In spite of extensive effort, little is known
regarding the pathogenic events leading to the initiation and
progression of B cell CLL, the most frequent adult leukemia in the
Western world. On the contrary, several factors predicting the
clinical course have been defined. CLL cells with few or no
mutations in the immunoglobulin heavy-chain variable-region gene
(IgV.sub.H) or with high expression of the 70-kD zeta-associated
protein positive (ZAP-70+) have an aggressive course, whereas
patients with mutated clones or few ZAP-70+B cells have an indolent
course (Chiorazzi, N., et al., N. Engl. J. Med. 352:804-815
(2005)). It was also found that genomic aberrations in CLL are
important independent predictors of disease progression and
survival (Dohner, H., et al., N. Engl. J. Med. 343(26):1910-1916
(2000)). However, the molecular basis of these associations is
largely unknown. Here, we performed genome wide expression
profiling with the miRNACHIP in a large series of CLL samples with
extensive clinical data to examine whether expression of these
noncoding genes is associated with factors predicting the clinical
course.
Materials and Methods
[0278] Patient samples and clinical database. Samples used for this
study are described in detail in Example 12.
[0279] RNA extraction, Northern blots and miRNACHIP experiments.
Procedures were performed as described (Calin, G. A., et al., Proc.
Natl. Acad. Sci. USA 101(32):1175-1160 (2004); Liu, C.-G., et al.,
Proc. Natl. Acad. Sci. USA 101(26): 9740-9744 (2004)). Briefly,
labeled targets from 5 .mu.g of total RNA was used for
hybridization on each miRNACHIP microarray chip containing 368
probes in triplicate, corresponding to 245 human and mouse miRNA
genes. Of note, for 76 microRNAs on the miRNACHIP two specific
oligos were synthesized one identifying the active 22 nt part of
the molecule and the other for the 60-110 nt precursor (Liu, C.-G.,
et al., Proc. Natl. Acad. Sci. USA 101(26): 9740-9744 (2004)).
[0280] Data analysis. Raw data were normalized and analyzed in
GeneSpring.RTM. software version 7.2 (Silicon Genetics, Redwood
City, Calif.). Expression data were median centered using both
GeneSpring normalization option or Global Median normalization of
the Bioconductor package, without any substantial difference.
Statistical comparisons were done both using the GeneSpring ANOVA
tool and the SAM software (Significance Analysis of Microarray).
mRNA predictors were calculated by using PAM software (Prediction
Analysis of Microarrays); the Support Vector Machine tool of
GeneSpring was used for the Cross-validation and Test-set
prediction. The Kaplan-Meier plot ("survival analysis" of the PAM
software) was used to identify an association between miRNA
expression and the time elapsing from CLL diagnosis and the
beginning of therapy. miRNAs able to best separate the two groups
were identified at the same time. All data were submitted using
MIAMExpress to the Array Express database (accession numbers to be
received upon revision). We validated the microarray data for 4
miRNAs (miR-16-1, miR-26a, miR-206 and miR-223) in 11 CLL samples
and normal CD5 cells by solution hybridization detection as
presented elsewhere (Calin, G. A., et al., Proc. Natl. Acad. Sci.
USA 101(32):11755-11760 (2004)). Furthermore, miR-15a and miR-16-1
expression in the patients with germline mutation was confirmed by
Northern blot.
[0281] Analysis of ZAP-70 and Sequence analysis of expressed
IgV.sub.H. These experiments were performed as described in Example
12.
[0282] Results
[0283] Comparison of miRNA expression in Zap-70 positive/IgV.sub.H
Umut vs. Zap-70 negative/IgV.sub.H Mut CLL cells. In Example 12, a
unique signature that can discriminate between the two main groups
of CLL patients (i.e., Zap70 positive/IgV.sub.H Umut and Zap-70
negative/IgV.sub.H Mut), composed of 17 genes, was identified using
the PAM package. Using additional algorithms for statistical and
prediction analysis (i.e., SAM and GeneSpring) to validate the PAM
signature, we found that a signature composed of 13 mature
microRNAs could discriminate (at P<0.01) between Zap70
positive/IgV.sub.H Umut and Zap-70 negative/IgV.sub.H Mut patients
(Tables 19 and 20). Furthermore, the prediction made using Support
Vector Machine correctly classified all patients (Table 20). The
majority of miRNAs (9 out of 13) were significantly overexpressed
in the group with poor prognosis. The 10 patients belonging to the
Zap-70 positive and VhMut group were equally assigned to groups
good or poor prognosis, suggesting either that there are no
microRNAs on the miRNACHIP whose expression can distinguish these
two groups, that these two groups are not different with regard to
microRNA expression profiles or that the groups are too small to be
correctly classified.
[0284] We used the Support Vector Machine algorithm also to predict
an additional independent set of 50 CLL samples with known ZAP-70
status (Table 21). When the 13 miRNAs of the identified signature
were used, the prediction was made correctly in all cases,
confirming, thereby confirming our results. Also confirming the
microarray specificity, as reported in Liu, C.-G., et al., Proc.
Natl. Acad. Sci. USA 101(26): 9740-9744 (2004), the signature did
not include very similar members of the same families, such as
miR-23a (1 base difference from miR-23b) and miR-15b (four bases
difference from miR-15a), while the identical mature miRNAs
miR-16-1 and miR-16-2 were both identified, indicating that the
chip is able to discriminate between highly similar iso forms.
TABLE-US-00019 TABLE 19 miRNA signature associated with prognostic
factors (ZAP70 and IgVH mutations) and disease progression in CLL
patients*. Group 4 Nr. Crt. Component Map P value expression**
Putative targets*** Observation**** 1 miR-15a 13q14.3 0.018 high NA
cluster 15a/16-1 del CLL & Prostate ca. 2 miR-195 17p13 0.017
high NA del HCC 3 miR-221 Xp11.3 0.010 high HECTD2, CDKN1B, NOVA1,
cluster 221/222 ZFPM2, PHF2 4 miR-23b 9q22.1 0.009 high FNBP1L,
WTAP, cluster 24-1/23b PDE4B, SATB1, SEMA6D FRA 9D; del Urothelial
ca. 5 miR-155 21q21 0.009 high ZNF537, PICALM, RREB1, amp child
Burkitt's lymphoma BDNF, QKI 6 miR-223 Xq12-13.3 0.007 low PTBP2,
SYNCRIP, WTAP, normally expression restricted FBXW7, QKI to myeloid
lineage 7 miR-29a-2 7q32 0.004 low NA cluster 29a-2/29b-1 FRA7H;
del Prostate ca. 8 miR-24-1 9q22.1 0.003 high TOP1, FLJ45187,
RSBN1L, cluster 24-1/23b RAP2C, PRPF4B FRA 9D; del Urothelial ca. 9
miR-29b-2 (miR-102) 1q32.2-32.3 0.0007 low NA 10 miR-146 5q34
0.0007 high NOVA1, NFE2L1, C1orf16, ABL2, ZFYVE1 11 miR-16-1
13q14.3 0.0004 high BCL2, CNOT6L, USP15, cluster 15a/16-1 PAFAH1B1,
ESRRG del CLL, prostate ca. 12 miR-16-2 3q26.1 0.0003 high see
miR-16-1 identical miR-16-1 13 miR-29c 1q32.2-32.3 0.0002 low NA
Note: *All the members of the signature are mature miRNAs; **Group
4 includes patients with IgVh mutated and Zap-70 negative, both
predictors of poor prognosis. ***top five predictions using
TargetScan (Lewis, B. P., et al., Cell 120: 15-20 (2005)) were
included. NA--not available; for specific gene names - see the NCBI
site. ****FRA = fragile site; del = deletion; HCC = hepatocellular
carcinoma; ca. = carcinoma.
TABLE-US-00020 TABLE 20 List of miRNAs associated with prognostic
factors and disease progression in CLL patients selected by
Prediction Analysis of Microarrays (PAM) and ANOVA analysis
(GeneSpring)*. Nr. PAM n- y+ GeneSpring Anova crt. signature score
score map signature p-value map 1 mir-222 -0.022 0.0288 Xp11.2
mir-34-prec 0.048 1p36.22 2 mir-24-2 -0.0272 0.0355 19p13.12
mir-192-2/3-prec 0.0457 11q13 3 mir-181a -0.0279 0.0364 1q32.1
mir-15a-prec 0.0353 13q14.3 4 mir-15a -0.0372 0.0485 13q14.3 mir-17
0.0257 13q31 5 mir-24-1 -0.0427 0.0558 9q22.1 mir-15a 0.018 13q14.3
6 mir-195 -0.053 0.0692 17p13 mir-195 0.0175 17p13 7 mir-23a
-0.0748 0.0977 19p13.12 mir-213-prec 0.0153 1q31.3-q32.1 8 mir-23b
-0.0909 0.1187 9q22.1 mir-221 0.0105 Xp11.3 9 mir-223 0.1056
-0.1379 Xq12-13.3 mir-023b 0.00964 9q22.1 10 mir-29a-2 0.1139
-0.1487 7q32 mir-155 0.00959 21q21 11 mir-155 -0.1155 0.1508 21q21
mir-223 0.00774 Xq12-13.3 12 mir-221 -0.1157 0.1511 Xp11.3 mir-132
0.00461 17p13.3 13 mir-16-1 -0.1444 0.1886 13q14.3 mir-029a-2
0.00446 7q32 14 mir-16-2 -0.1619 0.2113 3q26.1 mir-024-1 0.00311
9q22.1 15 mir-146 -0.1803 0.2354 5q34 mir-29b-2 (102) 0.000778
1q32.2-32.3 16 mir-29b-2 0.2065 -0.2696 1q32.2-32.3 mir-146
0.000753 5q34 (102) 17 mir-029c 0.2174 -0.2839 1q32.2-32.3
mir-016-1 0.00042 13q14.3 18 mir-016-2 0.000327 3q26.1 19 mir-029c
0.000216 1q32.2-32.3 *the list of genes is in ascending order of
significance, as represented by score or p value, respectively.
TABLE-US-00021 TABLE 21 Predictions of ZAP-70 status and
Immunoglobulin heavy chain variable gene status according to miRNA
expression in CLL patients*. CLL True Value Prediction n margin y
margin PANEL 1 - CLL01 Zap70 < 20 VhM Zap70 < 20 VhM 1.278
-1.327 83 correct predictions, CLL02 Zap70 < 20 VhM Zap70 <
20 VhM 1 -1 0 incorrect predictions. CLL03 Zap70 < 20 VhM Zap70
< 20 VhM 1.247 -1.348 CLL04 Zap70 < 20 VhM Zap70 < 20 VhM
1.16 -1.388 CLL05 Zap70 < 20 VhM Zap70 < 20 VhM 1 -1 CLL06
Zap70 < 20 VhM Zap70 < 20 VhM 1 -1 CLL07 Zap70 < 20 VhM
Zap70 < 20 VhM 1 -1.122 CLL08 Zap70 < 20 VhM Zap70 < 20
VhM 1.391 -1.595 CLL09 Zap70 < 20 VhM Zap70 < 20 VhM 0.953
-1.048 CLL10 Zap70 < 20 VhM Zap70 < 20 VhM 1.059 -1.333 CLL11
Zap70 < 20 VhM Zap70 < 20 VhM 1 -1 CLL12 Zap70 < 20 VhM
Zap70 < 20 VhM 0.997 -1.261 CLL13 Zap70 < 20 VhM Zap70 <
20 VhM 1.488 -1.841 CLL14 Zap70 < 20 VhM Zap70 < 20 VhM 2.171
-2.582 CLL15 Zap70 < 20 VhM Zap70 < 20 VhM 1.252 -1.352 CLL16
Zap70 < 20 VhM Zap70 < 20 VhM 1 -1.188 CLL17 Zap70 < 20
VhM Zap70 < 20 VhM 1.19 -1.284 CLL18 Zap70 < 20 VhM Zap70
< 20 VhM 1.747 -2.062 CLL19 Zap70 < 20 VhM Zap70 < 20 VhM
1.503 -1.833 CLL20 Zap70 < 20 VhM Zap70 < 20 VhM 1 -1 CLL21
Zap70 < 20 VhM Zap70 < 20 VhM 1 -1 CLL22 Zap70 < 20 VhM
Zap70 < 20 VhM 1 -1 CLL23 Zap70 < 20 VhM Zap70 < 20 VhM
2.047 -2.27 CLL24 Zap70 < 20 VhM Zap70 < 20 VhM 1.464 -1.527
CLL25 Zap70 < 20 VhM Zap70 < 20 VhM 1 -1 CLL26 Zap70 < 20
VhM Zap70 < 20 VhM 1.034 -1.034 CLL27 Zap70 < 20 VhM Zap70
< 20 VhM 1.479 -1.617 CLL28 Zap70 < 20 VhM Zap70 < 20 VhM
2.355 -2.57 CLL29 Zap70 < 20 VhM Zap70 < 20 VhM 1 -1 CLL30
Zap70 < 20 VhM Zap70 < 20 VhM 1 -1 CLL31 Zap70 < 20 VhM
Zap70 < 20 VhM 1 -1 CLL32 Zap70 < 20 VhM Zap70 < 20 VhM 1
-1 CLL33 Zap70 < 20 VhM Zap70 < 20 VhM 2.229 -2.496 CLL34
Zap70 < 20 VhM Zap70 < 20 VhM 2.683 -2.931 CLL35 Zap70 <
20 VhM Zap70 < 20 VhM 1 -1 CLL36 Zap70 < 20 VhM Zap70 < 20
VhM 2.578 -2.768 CLL37 Zap70 < 20 VhM Zap70 < 20 VhM 2.079
-2.34 CLL38 Zap70 < 20 VhM Zap70 < 20 VhM 1.745 -1.814 CLL39
Zap70 < 20 VhM Zap70 < 20 VhM 1.559 -1.699 CLL40 Zap70 <
20 VhM Zap70 < 20 VhM 2.608 -3.005 CLL41 Zap70 < 20 VhM Zap70
< 20 VhM 2.357 -2.676 CLL42 Zap70 < 20 VhM Zap70 < 20 VhM
1.102 -1.303 CLL43 Zap70 < 20 VhM Zap70 < 20 VhM 1 -1 CLL44
Zap70 < 20 VhM Zap70 < 20 VhM 2.464 -2.629 CLL45 Zap70 <
20 VhM Zap70 < 20 VhM 1 -1 CLL46 Zap70 < 20 VhM Zap70 < 20
VhM 1 -1 CLL47 Zap70 < 20 VhM Zap70 < 20 VhM 2.074 -2.271
CLL48 Zap70 > 20 VhUM Zap70 > 20 VhUM -1 1 CLL49 Zap70 >
20 VhUM Zap70 > 20 VhUM -1.179 1.487 CLL50 Zap70 > 20 VhUM
Zap70 > 20 VhUM -1 0.88 CLL51 Zap70 > 20 VhUM Zap70 > 20
VhUM -1 1 CLL52 Zap70 > 20 VhUM Zap70 > 20 VhUM -1.836 2.405
CLL53 Zap70 > 20 VhUM Zap70 > 20 VhUM -1 1 CLL54 Zap70 >
20 VhUM Zap70 > 20 VhUM -1.334 1.649 CLL55 Zap70 > 20 VhUM
Zap70 > 20 VhUM -1 1.229 CLL56 Zap70 > 20 VhUM Zap70 > 20
VhUM -1 1 CLL57 Zap70 > 20 VhUM Zap70 > 20 VhUM -1 1 CLL58
Zap70 > 20 VhUM Zap70 > 20 VhUM -1.171 1.566 CLL59 Zap70 >
20 VhUM Zap70 > 20 VhUM -1 1 CLL60 Zap70 > 20 VhUM Zap70 >
20 VhUM -1 1 CLL61 Zap70 > 20 VhUM Zap70 > 20 VhUM -1.505
1.976 CLL62 Zap70 > 20 VhUM Zap70 > 20 VhUM -1.095 1.46 CLL63
Zap70 > 20 VhUM Zap70 > 20 VhUM -2.297 2.717 CLL64 Zap70 >
20 VhUM Zap70 > 20 VhUM -1.187 1.381 CLL65 Zap70 > 20 VhUM
Zap70 > 20 VhUM -1 1 CLL66 Zap70 > 20 VhUM Zap70 > 20 VhUM
-1.344 1.479 CLL67 Zap70 > 20 VhUM Zap70 > 20 VhUM -1.876
2.049 CLL68 Zap70 > 20 VhUM Zap70 > 20 VhUM -1 1 CLL69 Zap70
> 20 VhUM Zap70 > 20 VhUM -1.89 1.987 CLL70 Zap70 > 20
VhUM Zap70 > 20 VhUM -2.658 2.938 CLL71 Zap70 > 20 VhUM Zap70
> 20 VhUM -1.556 1.967 CLL72 Zap70 > 20 VhUM Zap70 > 20
VhUM -2.574 2.81 CLL73 Zap70 > 20 VhUM Zap70 > 20 VhUM -1 1
CLL74 Zap70 > 20 VhUM Zap70 > 20 VhUM -1 1 CLL75 Zap70 >
20 VhUM Zap70 > 20 VhUM -1 1 CLL76 Zap70 > 20 VhUM Zap70 >
20 VhUM -2.671 3.041 CLL77 Zap70 > 20 VhUM Zap70 > 20 VhUM -1
1.376 CLL78 Zap70 > 20 VhUM Zap70 > 20 VhUM -1 1 CLL79 Zap70
> 20 VhUM Zap70 > 20 VhUM -1.678 1.914 CLL80 Zap70 > 20
VhUM Zap70 > 20 VhUM -2.416 2.953 CLL81 Zap70 > 20 VhUM Zap70
> 20 VhUM -1 1 CLL82 Zap70 > 20 VhUM Zap70 > 20 VhUM
-1.782 1.846 CLL83 Zap70 > 20 VhUM Zap70 > 20 VhUM -2.307
2.716 PANEL 2 - CLL95 Zap70 < 20 Zap70 < 20 8.494 -8.494 50
correct predictions, CLL96 Zap70 < 20 Zap70 < 20 1 -1 0
incorrect predictions CLL97 Zap70 < 20 Zap70 < 20 0.763
-0.763 CLL98 Zap70 < 20 Zap70 < 20 11.19 -11.19 CLL99 Zap70
< 20 Zap70 < 20 7.561 -7.561 CLL100 Zap70 < 20 Zap70 <
20 14.51 -14.51 CLL101 Zap70 < 20 Zap70 < 20 5.585 -5.585
CLL102 Zap70 < 20 Zap70 < 20 1 -1 CLL103 Zap70 < 20 Zap70
< 20 10.09 -10.09 CLL104 Zap70 < 20 Zap70 < 20 5.521
-5.521 CLL105 Zap70 < 20 Zap70 < 20 7.33 -7.33 CLL106 Zap70
< 20 Zap70 < 20 3.264 -3.264 CLL107 Zap70 < 20 Zap70 <
20 7.774 -7.774 CLL108 Zap70 < 20 Zap70 < 20 5.3 -5.3 CLL109
Zap70 < 20 Zap70 < 20 4.34 -4.34 CLL110 Zap70 < 20 Zap70
< 20 1.822 -1.822 CLL111 Zap70 < 20 Zap70 < 20 3.879
-3.879 CLL112 Zap70 < 20 Zap70 < 20 8.514 -8.514 CLL113 Zap70
< 20 Zap70 < 20 5.866 -5.866 CLL114 Zap70 < 20 Zap70 <
20 10.69 -10.69 CLL115 Zap70 < 20 Zap70 < 20 4.141 -4.141
CLL116 Zap70 < 20 Zap70 < 20 1 -1 CLL117 Zap70 < 20 Zap70
< 20 1 -1 CLL118 Zap70 < 20 Zap70 < 20 1 -1 CLL119 Zap70
< 20 Zap70 < 20 10.11 -10.11 CLL120 Zap70 > 20 Zap70 >
20 -3.109 3.109 CLL121 Zap70 > 20 Zap70 > 20 -4.722 4.722
CLL122 Zap70 > 20 Zap70 > 20 -5.166 5.166 CLL123 Zap70 >
20 Zap70 > 20 -7.828 7.828 CLL124 Zap70 > 20 Zap70 > 20
-7.468 7.468 CLL125 Zap70 > 20 Zap70 > 20 -11.44 11.44 CLL126
Zap70 > 20 Zap70 > 20 -1 1 CLL127 Zap70 > 20 Zap70 > 20
-6.617 6.617 CLL128 Zap70 > 20 Zap70 > 20 -7.011 7.011 CLL129
Zap70 > 20 Zap70 > 20 -7.479 7.479 CLL130 Zap70 > 20 Zap70
> 20 -9.568 9.568 CLL131 Zap70 > 20 Zap70 > 20 -5.286
5.286 CLL132 Zap70 > 20 Zap70 > 20 -5.045 5.045 CLL133 Zap70
> 20 Zap70 > 20 -1 1 CLL134 Zap70 > 20 Zap70 > 20 -1 1
CLL135 Zap70 > 20 Zap70 > 20 -1.324 1.324 CLL136 Zap70 >
20 Zap70 > 20 -1 1 CLL137 Zap70 > 20 Zap70 > 20 -1 1
CLL138 Zap70 > 20 Zap70 > 20 -9.649 9.649 CLL139 Zap70 >
20 Zap70 > 20 -9.264 9.264 CLL140 Zap70 > 20 Zap70 > 20
-7.13 7.13 CLL141 Zap70 > 20 Zap70 > 20 -11.77 11.77 CLL142
Zap70 > 20 Zap70 > 20 -2.986 2.986 CLL143 Zap70 > 20 Zap70
> 20 -1 1 CLL144 Zap70 > 20 Zap70 > 20 -1 1 *Prediction
for 83 CLLs, from groups 1 and 4 (see text). Classification was
generated by the `Support Vector Machines` algorithm (Kernel
Function used: Polynomial Dot Product (Order 2). Diagonal Scaling
Factor: 0). The miRNA signature associated with prognostic factors
was generated using panel 1 samples and then tested to cross
validate the panel 1 and to predict the status of samples from
panel 2.
Association Between miRNA Expression and Time to Initial
Therapy.
[0285] This analysis was performed as described in Example 12. All
of the microRNAs which can predict the time to initial therapy,
with the exception of mir-29c, are overexpressed in the group
characterized by a short interval from diagnosis to initial therapy
(Table 22). The PAM score for each of the components of microRNA
signature associated with the time from diagnosis to initial
therapy is presented in Table 23.
TABLE-US-00022 TABLE 22 Relative expression levels of microRNAs
predictive of the time interval from diagnosis to initial therapy.
Short Long interval interval microarray expression hsa-mir-181a
High Low hsa-mir-155 High Low hsa-mir-146 High Low hsa-mir-024-2
High Low hsa-mir-023b High Low hsa-mir-023a High Low hsa-mir-222
High Low hsa-mir-221 High Low hsa-mir-029c Low High
TABLE-US-00023 TABLE 23 PAM score for each of the components of
microRNA signature associated with the time from diagnosis to
initial therapy. 1 score 2 score hsa-mir-181a 0.1862 -0.0603
hsa-mir-155 0.1409 -0.0456 hsa-mir-146 0.07 -0.0227 hsa-mir-024-2
0.0696 -0.0225 hsa-mir-023b 0.0643 -0.0208 hsa-mir-023a 0.0587
-0.019 hsa-mir-222 0.0458 -0.0148 hsa-mir-221 0.0343 -0.0111
hsa-mir-029c -0.0221 0.0072 Note: Score 1 characterize the short
time; score 2 the long time from diagnosis to initial therapy in a
panel of 94 CLL patients.
[0286] The relevant teachings of all publications cited herein that
have not explicitly been incorporated by reference, are
incorporated herein by reference in their entirety. One skilled in
the art will readily appreciate that the present invention is well
adapted to carry out the objects and obtain the ends and advantages
mentioned, as well as those inherent therein. The present invention
may be embodied in other specific forms without departing from the
spirit or essential attributes thereof and, accordingly, reference
should be made to the appended claims, rather than to the foregoing
specification, as indicating the scope of the invention.
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 664 <210> SEQ ID NO 1 <211> LENGTH: 90 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
1 cactgtggga tgaggtagta ggttgtatag ttttagggtc acacccacca ctgggagata
60 actatacaat ctactgtctt tcctaacgtg 90 <210> SEQ ID NO 2
<211> LENGTH: 72 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 2 aggttgaggt agtaggttgt
atagtttaga attacatcaa gggagataac tgtacagcct 60 cctagctttc ct 72
<210> SEQ ID NO 3 <211> LENGTH: 74 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 3
gggtgaggta gtaggttgta tagtttgggg ctctgccctg ctatgggata actatacaat
60 ctactgtctt tcct 74 <210> SEQ ID NO 4 <211> LENGTH:
107 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 4 gtgactgcat gctcccaggt tgaggtagta ggttgtatag
tttagaatta cacaagggag 60 ataactgtac agcctcctag ctttccttgg
gtcttgcact aaacaac 107 <210> SEQ ID NO 5 <211> LENGTH:
85 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 5 ggcggggtga ggtagtaggt tgtgtggttt cagggcagtg
atgttgcccc tcggaagata 60 actatacaac ctactgcctt ccctg 85 <210>
SEQ ID NO 6 <211> LENGTH: 84 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 6
gcatccgggt tgaggtagta ggttgtatgg tttagagtta caccctggga gttaactgta
60 caaccttcta gctttccttg gagc 84 <210> SEQ ID NO 7
<211> LENGTH: 87 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 7 cctaggaaga ggtagtaggt
tgcatagttt tagggcaggg attttgccca caaggaggta 60 actatacgac
ctgctgcctt tcttagg 87 <210> SEQ ID NO 8 <211> LENGTH:
85 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 8 ctaggaagag gtagtagttt gcatagtttt agggcaaaga
ttttgcccac aagtagttag 60 ctatacgacc tgcagccttt tgtag 85 <210>
SEQ ID NO 9 <211> LENGTH: 85 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 9
ctggctgagg tagtagtttg tgctgttggt cgggttgtga cattgcccgc tgtggagata
60 actgcgcaag ctactgcctt gctag 85 <210> SEQ ID NO 10
<211> LENGTH: 79 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 10 cccgggctga ggtaggaggt
tgtatagttg aggaggacac ccaaggagat cactatacgg 60 cctcctagct ttccccagg
79 <210> SEQ ID NO 11 <211> LENGTH: 87 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
11 tcagagtgag gtagtagatt gtatagttgt ggggtagtga ttttaccctg
ttcaggagat 60 aactatacaa tctattgcct tccctga 87 <210> SEQ ID
NO 12 <211> LENGTH: 89 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 12 ctgtgggatg
aggtagtaga ttgtatagtt gtggggtagt gattttaccc tgttcaggag 60
ataactatac aatctattgc cttccctga 89 <210> SEQ ID NO 13
<211> LENGTH: 85 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 13 ctgtgggatg aggtagtaga
ttgtatagtt ttagggtcat accccatctt ggagataact 60 atacagtcta
ctgtctttcc cacgg 85 <210> SEQ ID NO 14 <211> LENGTH:
108 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 14 ttgcctgatt ccaggctgag gtagtagttt
gtacagtttg agggtctatg ataccacccg 60 gtacaggaga taactgtaca
ggccactgcc ttgccaggaa cagcgcgc 108 <210> SEQ ID NO 15
<211> LENGTH: 85 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 15 ctggctgagg tagtagtttg
tgctgttggt cgggttgtga cattgcccgc tgtggagata 60 actgcgcaag
ctactgcctt gctag 85 <210> SEQ ID NO 16 <211> LENGTH: 85
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 16 acctactcag agtacatact tctttatgta
cccatatgaa catacaatgc tatggaatgt 60 aaagaagtat gtatttttgg taggc 85
<210> SEQ ID NO 17 <211> LENGTH: 108 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 17
cagctaacaa cttagtaata cctactcaga gtacatactt ctttatgtac ccatatgaac
60 atacaatgct atggaatgta aagaagtatg tatttttggt aggcaata 108
<210> SEQ ID NO 18 <211> LENGTH: 85 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 18
gcctgcttgg gaaacatact tctttatatg cccatatgga cctgctaagc tatggaatgt
60 aaagaagtat gtatctcagg ccggg 85 <210> SEQ ID NO 19
<211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 19 tgggaaacat acttctttat
atgcccatat ggacctgcta agctatggaa tgtaaagaag 60 tatgtatctc a 71
<210> SEQ ID NO 20 <211> LENGTH: 85 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 20
acctactcag agtacatact tctttatgta cccatatgaa catacaatgc tatggaatgt
60 aaagaagtat gtatttttgg taggc 85 <210> SEQ ID NO 21
<211> LENGTH: 108 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 21 tggatgttgg cctagttctg
tgtggaagac tagtgatttt gttgttttta gataactaaa 60 tcgacaacaa
atcacagtct gccatatggc acaggccatg cctctaca 108 <210> SEQ ID NO
22 <211> LENGTH: 110 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 22 ttggatgttg
gcctagttct gtgtggaaga ctagtgattt tgttgttttt agataactaa 60
atcgacaaca aatcacagtc tgccatatgg cacaggccat gcctctacag 110
<210> SEQ ID NO 23 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 23
ctggatacag agtggaccgg ctggccccat ctggaagact agtgattttg ttgttgtctt
60 actgcgctca acaacaaatc ccagtctacc taatggtgcc agccatcgca 110
<210> SEQ ID NO 24 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 24
ctggatacag agtggaccgg ctggccccat ctggaagact agtgattttg ttgttgtctt
60 actgcgctca acaacaaatc ccagtctacc taatggtgcc agccatcgca 110
<210> SEQ ID NO 25 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 25
agattagagt ggctgtggtc tagtgctgtg tggaagacta gtgattttgt tgttctgatg
60 tactacgaca acaagtcaca gccggcctca tagcgcagac tcccttcgac 110
<210> SEQ ID NO 26 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 26
agattagagt ggctgtggtc tagtgctgtg tggaagacta gtgattttgt tgttctgatg
60 tactacgaca acaagtcaca gccggcctca tagcgcagac tcccttcgac 110
<210> SEQ ID NO 27 <211> LENGTH: 89 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 27
cggggttggt tgttatcttt ggttatctag ctgtatgagt ggtgtggagt cttcataaag
60 ctagataacc gaaagtaaaa ataacccca 89 <210> SEQ ID NO 28
<211> LENGTH: 87 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 28 ggaagcgagt tgttatcttt
ggttatctag ctgtatgagt gtattggtct tcataaagct 60 agataaccga
aagtaaaaac tccttca 87 <210> SEQ ID NO 29 <211> LENGTH:
90 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 29 ggaggcccgt ttctctcttt ggttatctag
ctgtatgagt gccacagagc cgtcataaag 60 ctagataacc gaaagtagaa
atgattctca 90 <210> SEQ ID NO 30 <211> LENGTH: 110
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 30 gatctgtctg tcttctgtat ataccctgta
gatccgaatt tgtgtaagga attttgtggt 60 cacaaattcg tatctagggg
aatatgtagt tgacataaac actccgctct 110 <210> SEQ ID NO 31
<211> LENGTH: 110 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 31 ccagaggttg taacgttgtc
tatatatacc ctgtagaacc gaatttgtgt ggtatccgta 60 tagtcacaga
ttcgattcta ggggaatata tggtcgatgc aaaaacttca 110 <210> SEQ ID
NO 32 <211> LENGTH: 108 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 32 gcgcgaatgt
gtgtttaaaa aaaataaaac cttggagtaa agtagcagca cataatggtt 60
tgtggatttt gaaaaggtgc aggccatatt gtgctgcctc aaaaatac 108
<210> SEQ ID NO 33 <211> LENGTH: 83 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 33
ccttggagta aagtagcagc acataatggt ttgtggattt tgaaaaggtg caggccatat
60 tgtgctgcct caaaaataca agg 83 <210> SEQ ID NO 34
<211> LENGTH: 64 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 34 ctgtagcagc acatcatggt
ttacatgcta cagtcaagat gcgaatcatt atttgctgct 60 ctag 64 <210>
SEQ ID NO 35 <211> LENGTH: 98 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 35
ttgaggcctt aaagtactgt agcagcacat catggtttac atgctacagt caagatgcga
60 atcattattt gctgctctag aaatttaagg aaattcat 98 <210> SEQ ID
NO 36 <211> LENGTH: 89 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 36 gtcagcagtg
ccttagcagc acgtaaatat tggcgttaag attctaaaat tatctccagt 60
attaactgtg ctgctgaagt aaggttgac 89 <210> SEQ ID NO 37
<211> LENGTH: 81 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 37 gttccactct agcagcacgt
aaatattggc gtagtgaaat atatattaaa caccaatatt 60 actgtgctgc
tttagtgtga c 81 <210> SEQ ID NO 38 <211> LENGTH: 81
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 38 gcagtgcctt agcagcacgt aaatattggc
gttaagattc taaaattatc tccagtatta 60 actgtgctgc tgaagtaagg t 81
<210> SEQ ID NO 39 <211> LENGTH: 84 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 39
gtcagaataa tgtcaaagtg cttacagtgc aggtagtgat atgtgcatct actgcagtga
60 aggcacttgt agcattatgg tgac 84 <210> SEQ ID NO 40
<211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 40 tgttctaagg tgcatctagt
gcagatagtg aagtagatta gcatctactg ccctaagtgc 60 tccttctggc a 71
<210> SEQ ID NO 41 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 41
tttttgttct aaggtgcatc tagtgcagat agtgaagtag attagcatct actgccctaa
60 gtgctccttc tggcataaga a 81 <210> SEQ ID NO 42 <211>
LENGTH: 82 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 42 gcagtcctct gttagttttg catagttgca
ctacaagaag aatgtagttg tgcaaatcta 60 tgcaaaactg atggtggcct gc 82
<210> SEQ ID NO 43 <211> LENGTH: 80 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 43
cagtcctctg ttagttttgc atagttgcac tacaagaaga atgtagttgt gcaaatctat
60 gcaaaactga tggtggcctg 80 <210> SEQ ID NO 44 <211>
LENGTH: 87 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 44 cactgttcta tggttagttt tgcaggtttg
catccagctg tgtgatattc tgctgtgcaa 60 atccatgcaa aactgactgt ggtagtg
87 <210> SEQ ID NO 45 <211> LENGTH: 96 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
45 acattgctac ttacaattag ttttgcaggt ttgcatttca gcgtatatat
gtatatgtgg 60 ctgtgcaaat ccatgcaaaa ctgattgtga taatgt 96
<210> SEQ ID NO 46 <211> LENGTH: 80 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 46
ttctatggtt agttttgcag gtttgcatcc agctgtgtga tattctgctg tgcaaatcca
60 tgcaaaactg actgtggtag 80 <210> SEQ ID NO 47 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 47 ttacaattag ttttgcaggt ttgcatttca
gcgtatatat gtatatgtgg ctgtgcaaat 60 ccatgcaaaa ctgattgtga t 81
<210> SEQ ID NO 48 <211> LENGTH: 71 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 48
gtagcactaa agtgcttata gtgcaggtag tgtttagtta tctactgcat tatgagcact
60 taaagtactg c 71 <210> SEQ ID NO 49 <211> LENGTH: 72
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 49 tgtcgggtag cttatcagac tgatgttgac
tgttgaatct catggcaaca ccagtcgatg 60 ggctgtctga ca 72 <210>
SEQ ID NO 50 <211> LENGTH: 81 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 50
accttgtcgg gtagcttatc agactgatgt tgactgttga atctcatggc aacaccagtc
60 gatgggctgt ctgacatttt g 81 <210> SEQ ID NO 51 <211>
LENGTH: 85 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 51 ggctgagccg cagtagttct tcagtggcaa
gctttatgtc ctgacccagc taaagctgcc 60 agttgaagaa ctgttgccct ctgcc 85
<210> SEQ ID NO 52 <211> LENGTH: 73 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 52
ggccggctgg ggttcctggg gatgggattt gcttcctgtc acaaatcaca ttgccaggga
60 tttccaaccg acc 73 <210> SEQ ID NO 53 <211> LENGTH:
97 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 53 ctcaggtgct ctggctgctt gggttcctgg
catgctgatt tgtgacttaa gattaaaatc 60 acattgccag ggattaccac
gcaaccacga ccttggc 97 <210> SEQ ID NO 54 <211> LENGTH:
81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 54 ccacggccgg ctggggttcc tggggatggg
atttgcttcc tgtcacaaat cacattgcca 60 gggatttcca accgaccctg a 81
<210> SEQ ID NO 55 <211> LENGTH: 68 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 55
ctccggtgcc tactgagctg atatcagttc tcattttaca cactggctca gttcagcagg
60 aacaggag 68 <210> SEQ ID NO 56 <211> LENGTH: 73
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 56 ctctgcctcc cgtgcctact gagctgaaac
acagttggtt tgtgtacact ggctcagttc 60 agcaggaaca ggg 73 <210>
SEQ ID NO 57 <211> LENGTH: 81 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 57
ccctgggctc tgcctcccgt gcctactgag ctgaaacaca gttggtttgt gtacactggc
60 tcagttcagc aggaacaggg g 81 <210> SEQ ID NO 58 <211>
LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 58 ccctccggtg cctactgagc tgatatcagt
tctcatttta cacactggct cagttcagca 60 ggaacagcat c 71 <210> SEQ
ID NO 59 <211> LENGTH: 84 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 59 ggccagtgtt
gagaggcgga gacttgggca attgctggac gctgccctgg gcattgcact 60
tgtctcggtc tgacagtgcc ggcc 84 <210> SEQ ID NO 60 <211>
LENGTH: 86 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 60 aggccgtggc ctcgttcaag taatccagga
taggctgtgc aggtcccaat ggcctatctt 60 ggttacttgc acggggacgc gggcct 86
<210> SEQ ID NO 61 <211> LENGTH: 77 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 61
ccgggaccca gttcaagtaa ttcaggatag gttgtgtgct gtccagcctg ttctccatta
60 cttggctcgg ggaccgg 77 <210> SEQ ID NO 62 <211>
LENGTH: 78 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 62 ctgaggagca gggcttagct gcttgtgagc
agggtccaca ccaagtcgtg ttcacagtgg 60 ctaagttccg ccccccag 78
<210> SEQ ID NO 63 <211> LENGTH: 73 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 63
aggtgcagag cttagctgat tggtgaacag tgattggttt ccgctttgtt cacagtggct
60 aagttctgca cct 73 <210> SEQ ID NO 64 <211> LENGTH:
97 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 64 acctctctaa caaggtgcag agcttagctg
attggtgaac agtgattggt ttccgctttg 60 ttcacagtgg ctaagttctg
cacctgaaga gaaggtg 97 <210> SEQ ID NO 65 <211> LENGTH:
80 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 65 cctgaggagc agggcttagc tgcttgtgag
cagggtccac accaagtcgt gttcacagtg 60 gctaagttcc gccccccagg 80
<210> SEQ ID NO 66 <211> LENGTH: 86 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 66
ggtccttgcc ctcaaggagc tcacagtcta ttgagttacc tttctgactt tcccactaga
60 ttgtgagctc ctggagggca ggcact 86 <210> SEQ ID NO 67
<211> LENGTH: 108 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 67 ccttctgtga ccccttagag
gatgactgat ttcttttggt gttcagagtc aatataattt 60 tctagcacca
tctgaaatcg gttataatga ttggggaaga gcaccatg 108 <210> SEQ ID NO
68 <211> LENGTH: 64 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 68 atgactgatt
tcttttggtg ttcagagtca atataatttt ctagcaccat ctgaaatcgg 60 ttat 64
<210> SEQ ID NO 69 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 69
accactggcc catctcttac acaggctgac cgatttctcc tggtgttcag agtctgtttt
60 tgtctagcac catttgaaat cggttatgat gtagggggaa aagcagcagc 110
<210> SEQ ID NO 70 <211> LENGTH: 71 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 70
gcgactgtaa acatcctcga ctggaagctg tgaagccaca gatgggcttt cagtcggatg
60 tttgcagctg c 71 <210> SEQ ID NO 71 <211> LENGTH: 60
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 71 atgtaaacat cctacactca gctgtaatac
atggattggc tgggaggtgg atgtttacgt 60 <210> SEQ ID NO 72
<211> LENGTH: 88 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 72 accaagtttc agttcatgta
aacatcctac actcagctgt aatacatgga ttggctggga 60 ggtggatgtt
tacttcagct gacttgga 88 <210> SEQ ID NO 73 <211> LENGTH:
72 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 73 agatactgta aacatcctac actctcagct
gtggaaagta agaaagctgg gagaaggctg 60 tttactcttt ct 72 <210>
SEQ ID NO 74 <211> LENGTH: 70 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 74
gttgttgtaa acatccccga ctggaagctg taagacacag ctaagctttc agtcagatgt
60 ttgctgctac 70 <210> SEQ ID NO 75 <211> LENGTH: 71
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 75 ggagaggagg caagatgctg gcatagctgt
tgaactggga acctgctatg ccaacatatt 60 gccatctttc c 71 <210> SEQ
ID NO 76 <211> LENGTH: 70 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 76 ggagatattg
cacattacta agttgcatgt tgtcacggcc tcaatgcaat ttagtgtgtg 60
tgatattttc 70 <210> SEQ ID NO 77 <211> LENGTH: 110
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 77 gggggccgag agaggcgggc ggccccgcgg
tgcattgctg ttgcattgca cgtgtgtgag 60 gcgggtgcag tgcctcggca
gtgcagcccg gagccggccc ctggcaccac 110 <210> SEQ ID NO 78
<211> LENGTH: 69 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 78 ctgtggtgca ttgtagttgc
attgcatgtt ctggtggtac ccatgcaatg tttccacagt 60 gcatcacag 69
<210> SEQ ID NO 79 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 79
ggccagctgt gagtgtttct ttggcagtgt cttagctggt tgttgtgagc aatagtaagg
60 aagcaatcag caagtatact gccctagaag tgctgcacgt tgtggggccc 110
<210> SEQ ID NO 80 <211> LENGTH: 82 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 80
tcagaataat gtcaaagtgc ttacagtgca ggtagtgata tgtgcatcta ctgcagtgaa
60 ggcacttgta gcattatggt ga 82 <210> SEQ ID NO 81 <211>
LENGTH: 78 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 81 ctttctacac aggttgggat cggttgcaat
gctgtgtttc tgtatggtat tgcacttgtc 60 ccggcctgtt gagtttgg 78
<210> SEQ ID NO 82 <211> LENGTH: 75 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 82
tcatccctgg gtggggattt gttgcattac ttgtgttcta tataaagtat tgcacttgtc
60 ccggcctgtg gaaga 75 <210> SEQ ID NO 83 <211> LENGTH:
80 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 83 ctgggggctc caaagtgctg ttcgtgcagg
tagtgtgatt acccaaccta ctgctgagct 60 agcacttccc gagcccccgg 80
<210> SEQ ID NO 84 <211> LENGTH: 80 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 84
ctgggggctc caaagtgctg ttcgtgcagg tagtgtgatt acccaaccta ctgctgagct
60 agcacttccc gagcccccgg 80 <210> SEQ ID NO 85 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 85 aacacagtgg gcactcaata aatgtctgtt
gaattgaaat gcgttacatt caacgggtat 60 ttattgagca cccactctgt g 81
<210> SEQ ID NO 86 <211> LENGTH: 78 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 86
tggccgattt tggcactagc acatttttgc ttgtgtctct ccgctctgag caatcatgtg
60 cagtgccaat atgggaaa 78 <210> SEQ ID NO 87 <211>
LENGTH: 80 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 87 gtgaggtagt aagttgtatt gttgtggggt
agggatatta ggccccaatt agaagataac 60 tatacaactt actactttcc 80
<210> SEQ ID NO 88 <211> LENGTH: 70 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 88
ggcacccacc cgtagaaccg accttgcggg gccttcgccg cacacaagct cgtgtctgtg
60 ggtccgtgtc 70 <210> SEQ ID NO 89 <211> LENGTH: 81
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 89 cccattggca taaacccgta gatccgatct
tgtggtgaag tggaccgcac aagctcgctt 60 ctatgggtct gtgtcagtgt g 81
<210> SEQ ID NO 90 <211> LENGTH: 108 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 90
aagagagaag atattgaggc ctgttgccac aaacccgtag atccgaactt gtggtattag
60 tccgcacaag cttgtatcta taggtatgtg tctgttaggc aatctcac 108
<210> SEQ ID NO 91 <211> LENGTH: 80 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 91
cctgttgcca caaacccgta gatccgaact tgtggtatta gtccgcacaa gcttgtatct
60 ataggtatgt gtctgttagg 80 <210> SEQ ID NO 92 <211>
LENGTH: 110 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 92 aggctgccct ggctcagtta tcacagtgct
gatgctgtct attctaaagg tacagtactg 60 tgataactga aggatggcag
ccatcttacc ttccatcaga ggagcctcac 110 <210> SEQ ID NO 93
<211> LENGTH: 57 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 93 tcagttatca cagtgctgat
gctgtccatt ctaaaggtac agtactgtga taactga 57 <210> SEQ ID NO
94 <211> LENGTH: 75 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 94 tgccctggct
cagttatcac agtgctgatg ctgtctattc taaaggtaca gtactgtgat 60
aactgaagga tggca 75 <210> SEQ ID NO 95 <211> LENGTH: 75
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 95 tgtccttttt cggttatcat ggtaccgatg
ctgtatatct gaaaggtaca gtactgtgat 60 aactgaagaa tggtg 75 <210>
SEQ ID NO 96 <211> LENGTH: 81 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 96
cttctggaag ctggtttcac atggtggctt agatttttcc atctttgtat ctagcaccat
60 ttgaaatcag tgttttagga g 81 <210> SEQ ID NO 97 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 97 cttcaggaag ctggtttcat atggtggttt
agatttaaat agtgattgtc tagcaccatt 60 tgaaatcagt gttcttgggg g 81
<210> SEQ ID NO 98 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 98
cttcaggaag ctggtttcat atggtggttt agatttaaat agtgattgtc tagcaccatt
60 tgaaatcagt gttcttgggg g 81 <210> SEQ ID NO 99 <211>
LENGTH: 78 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 99 ttgtgctttc agcttcttta cagtgctgcc
ttgtagcatt caggtcaagc aacattgtac 60 agggctatga aagaacca 78
<210> SEQ ID NO 100 <211> LENGTH: 78 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 100
ttgtgctttc agcttcttta cagtgctgcc ttgtagcatt caggtcaagc aacattgtac
60 agggctatga aagaacca 78 <210> SEQ ID NO 101 <211>
LENGTH: 78 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 101 tactgccctc ggcttcttta cagtgctgcc
ttgttgcata tggatcaagc agcattgtac 60 agggctatga aggcattg 78
<210> SEQ ID NO 102 <211> LENGTH: 78 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 102
aaatgtcaga cagcccatcg actggtgttg ccatgagatt caacagtcaa catcagtctg
60 ataagctacc cgacaagg 78 <210> SEQ ID NO 103 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 103 tgtgcatcgt ggtcaaatgc tcagactcct
gtggtggctg ctcatgcacc acggatgttt 60 gagcatgtgc tacggtgtct a 81
<210> SEQ ID NO 104 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 104
tgtgcatcgt ggtcaaatgc tcagactcct gtggtggctg ctcatgcacc acggatgttt
60 gagcatgtgc tacggtgtct a 81 <210> SEQ ID NO 105 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 105 ccttggccat gtaaaagtgc ttacagtgca
ggtagctttt tgagatctac tgcaatgtaa 60 gcacttctta cattaccatg g 81
<210> SEQ ID NO 106 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 106
ctctctgctt tcagcttctt tacagtgttg ccttgtggca tggagttcaa gcagcattgt
60 acagggctat caaagcacag a 81 <210> SEQ ID NO 107 <211>
LENGTH: 85 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 107 ccttagcaga gctgtggagt gtgacaatgg
tgtttgtgtc taaactatca aacgccatta 60 tcacactaaa tagctactgc taggc 85
<210> SEQ ID NO 108 <211> LENGTH: 66 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 108
agctgtggag tgtgacaatg gtgtttgtgt ccaaactatc aaacgccatt atcacactaa
60 atagct 66 <210> SEQ ID NO 109 <211> LENGTH: 61
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 109 acattattac ttttggtacg cgctgtgaca
cttcaaactc gtaccgtgag taataatgcg 60 c 61 <210> SEQ ID NO 110
<211> LENGTH: 100 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 110 tccttcctca ggagaaaggc
ctctctctcc gtgttcacag cggaccttga tttaaatgtc 60 catacaatta
aggcacgcgg tgaatgccaa gaatggggct 100 <210> SEQ ID NO 111
<211> LENGTH: 85 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 111 aggcctctct ctccgtgttc
acagcggacc ttgatttaaa tgtccataca attaaggcac 60 gcggtgaatg
ccaagaatgg ggctg 85 <210> SEQ ID NO 112 <211> LENGTH:
110 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 112 atcaagatta gaggctctgc tctccgtgtt
cacagcggac cttgatttaa tgtcatacaa 60 ttaaggcacg cggtgaatgc
caagagcgga gcctacggct gcacttgaag 110 <210> SEQ ID NO 113
<211> LENGTH: 110 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 113 cccgccccag ccctgagggc
ccctctgcgt gttcacagcg gaccttgatt taatgtctat 60 acaattaagg
cacgcggtga atgccaagag aggcgcctcc gccgctcctt 110 <210> SEQ ID
NO 114 <211> LENGTH: 87 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 114 tgagggcccc
tctgcgtgtt cacagcggac cttgatttaa tgtctataca attaaggcac 60
gcggtgaatg ccaagagagg cgcctcc 87 <210> SEQ ID NO 115
<211> LENGTH: 68 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 115 ctctgcgtgt tcacagcgga
ccttgattta atgtctatac aattaaggca cgcggtgaat 60 gccaagag 68
<210> SEQ ID NO 116 <211> LENGTH: 67 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 116
ctctccgtgt tcacagcgga ccttgattta atgtcataca attaaggcac gcggtgaatg
60 ccaagag 67 <210> SEQ ID NO 117 <211> LENGTH: 86
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 117 tgccagtctc taggtccctg agacccttta
acctgtgagg acatccaggg tcacaggtga 60 ggttcttggg agcctggcgt ctggcc 86
<210> SEQ ID NO 118 <211> LENGTH: 65 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 118
ggtccctgag accctttaac ctgtgaggac atccagggtc acaggtgagg ttcttgggag
60 cctgg 65 <210> SEQ ID NO 119 <211> LENGTH: 108
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 119 acattgttgc gctcctctca gtccctgaga
ccctaacttg tgatgtttac cgtttaaatc 60 cacgggttag gctcttggga
gctgcgagtc gtgcttttgc atcctgga 108 <210> SEQ ID NO 120
<211> LENGTH: 88 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 120 tgcgctcctc tcagtccctg
agaccctaac ttgtgatgtt taccgtttaa atccacgggt 60 taggctcttg
ggagctgcga gtcgtgct 88 <210> SEQ ID NO 121 <211>
LENGTH: 89 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 121 accagacttt tcctagtccc tgagacccta
acttgtgagg tattttagta acatcacaag 60 tcaggctctt gggacctagg cggagggga
89 <210> SEQ ID NO 122 <211> LENGTH: 70 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
122 cctagtccct gagaccctaa cttgtgaggt attttagtaa catcacaagt
caggctcttg 60 ggacctaggc 70 <210> SEQ ID NO 123 <211>
LENGTH: 85 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 123 cgctggcgac gggacattat tacttttggt
acgcgctgtg acacttcaaa ctcgtaccgt 60 gagtaataat gcgccgtcca cggca 85
<210> SEQ ID NO 124 <211> LENGTH: 61 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 124
acattattac ttttggtacg cgctgtgaca cttcaaactc gtaccgtgag taataatgcg
60 c 61 <210> SEQ ID NO 125 <211> LENGTH: 97
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 125 tgtgatcact gtctccagcc tgctgaagct
cagagggctc tgattcagaa agatcatcgg 60 atccgtctga gcttggctgg
tcggaagtct catcatc 97 <210> SEQ ID NO 126 <211> LENGTH:
70 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 126 ccagcctgct gaagctcaga gggctctgat
tcagaaagat catcggatcc gtctgagctt 60 ggctggtcgg 70 <210> SEQ
ID NO 127 <211> LENGTH: 82 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 127 tgagctgttg
gattcggggc cgtagcactg tctgagaggt ttacatttct cacagtgaac 60
cggtctcttt ttcagctgct tc 82 <210> SEQ ID NO 128 <211>
LENGTH: 110 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 128 gcccggcagc cactgtgcag tgggaagggg
ggccgataca ctgtacgaga gtgagtagca 60 ggtctcacag tgaaccggtc
tctttcccta ctgtgtcaca ctcctaatgg 110 <210> SEQ ID NO 129
<211> LENGTH: 70 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 129 gttggattcg gggccgtagc
actgtctgag aggtttacat ttctcacagt gaaccggtct 60 ctttttcagc 70
<210> SEQ ID NO 130 <211> LENGTH: 74 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 130
tggatctttt tgcggtctgg gcttgctgtt cctctcaaca gtagtcagga agcccttacc
60 ccaaaaagta tcta 74 <210> SEQ ID NO 131 <211> LENGTH:
89 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 131 tgctgctggc cagagctctt ttcacattgt
gctactgtct gcacctgtca ctagcagtgc 60 aatgttaaaa gggcattggc cgtgtagtg
89 <210> SEQ ID NO 132 <211> LENGTH: 110 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
132 gccaggaggc ggggttggtt gttatctttg gttatctagc tgtatgagtg
gtgtggagtc 60 ttcataaagc tagataaccg aaagtaaaaa taaccccata
cactgcgcag 110 <210> SEQ ID NO 133 <211> LENGTH: 110
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 133 cacggcgcgg cagcggcact ggctaaggga
ggcccgtttc tctctttggt tatctagctg 60 tatgagtgcc acagagccgt
cataaagcta gataaccgaa agtagaaatg 110 <210> SEQ ID NO 134
<211> LENGTH: 72 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 134 gttgttatct ttggttatct
agctgtatga gtgtattggt cttcataaag ctagataacc 60 gaaagtaaaa ac 72
<210> SEQ ID NO 135 <211> LENGTH: 101 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 135
ccgcccccgc gtctccaggg caaccgtggc tttcgattgt tactgtggga actggaggta
60 acagtctaca gccatggtcg ccccgcagca cgcccacgcg c 101 <210>
SEQ ID NO 136 <211> LENGTH: 66 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 136
gggcaaccgt ggctttcgat tgttactgtg ggaactggag gtaacagtct acagccatgg
60 tcgccc 66 <210> SEQ ID NO 137 <211> LENGTH: 88
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 137 acaatgcttt gctagagctg gtaaaatgga
accaaatcgc ctcttcaatg gatttggtcc 60 ccttcaacca gctgtagcta tgcattga
88 <210> SEQ ID NO 138 <211> LENGTH: 102 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
138 gggagccaaa tgctttgcta gagctggtaa aatggaacca aatcgactgt
ccaatggatt 60 tggtcccctt caaccagctg tagctgtgca ttgatggcgc cg 102
<210> SEQ ID NO 139 <211> LENGTH: 68 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 139
gctagagctg gtaaaatgga accaaatcgc ctcttcaatg gatttggtcc ccttcaacca
60 gctgtagc 68 <210> SEQ ID NO 140 <211> LENGTH: 73
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 140 cagggtgtgt gactggttga ccagaggggc
atgcactgtg ttcaccctgt gggccaccta 60 gtcaccaacc ctc 73 <210>
SEQ ID NO 141 <211> LENGTH: 71 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 141
agggtgtgtg actggttgac cagaggggca tgcactgtgt tcaccctgtg ggccacctag
60 tcaccaaccc t 71 <210> SEQ ID NO 142 <211> LENGTH: 90
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 142 aggcctcgct gttctctatg gctttttatt
cctatgtgat tctactgctc actcatatag 60 ggattggagc cgtggcgcac
ggcggggaca 90 <210> SEQ ID NO 143 <211> LENGTH: 100
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 143 agataaattc actctagtgc tttatggctt
tttattccta tgtgatagta ataaagtctc 60 atgtagggat ggaagccatg
aaatacattg tgaaaaatca 100 <210> SEQ ID NO 144 <211>
LENGTH: 60 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 144 ctatggcttt ttattcctat gtgattctac
tgctcactca tatagggatt ggagccgtgg 60 <210> SEQ ID NO 145
<211> LENGTH: 82 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 145 tgagccctcg gaggactcca
tttgttttga tgatggattc ttatgctcca tcatcgtctc 60 aaatgagtct
tcagagggtt ct 82 <210> SEQ ID NO 146 <211> LENGTH: 62
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 146 gaggactcca tttgttttga tgatggattc
ttatgctcca tcatcgtctc aaatgagtct 60 tc 62 <210> SEQ ID NO 147
<211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 147 cttcggtgac gggtattctt
gggtggataa tacggattac gttgttattg cttaagaata 60 cgcgtagtcg agg 73
<210> SEQ ID NO 148 <211> LENGTH: 99 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 148
ccctggcatg gtgtggtggg gcagctggtg ttgtgaatca ggccgttgcc aatcagagaa
60 cggctacttc acaacaccag ggccacacca cactacagg 99 <210> SEQ ID
NO 149 <211> LENGTH: 84 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 149 cgttgctgca
gctggtgttg tgaatcaggc cgacgagcag cgcatcctct tacccggcta 60
tttcacgaca ccagggttgc atca 84 <210> SEQ ID NO 150 <211>
LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 150 cagctggtgt tgtgaatcag gccgacgagc
agcgcatcct cttacccggc tatttcacga 60 caccagggtt g 71 <210> SEQ
ID NO 151 <211> LENGTH: 68 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 151 gtgtattcta
cagtgcacgt gtctccagtg tggctcggag gctggagacg cggccctgtt 60 ggagtaac
68 <210> SEQ ID NO 152 <211> LENGTH: 100 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
152 tgtgtctctc tctgtgtcct gccagtggtt ttaccctatg gtaggttacg
tcatgctgtt 60 ctaccacagg gtagaaccac ggacaggata ccggggcacc 100
<210> SEQ ID NO 153 <211> LENGTH: 72 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 153
tcctgccagt ggttttaccc tatggtaggt tacgtcatgc tgttctacca cagggtagaa
60 ccacggacag ga 72 <210> SEQ ID NO 154 <211> LENGTH:
70 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 154 cctgccagtg gttttaccct atggtaggtt
acgtcatgct gttctaccac agggtagaac 60 cacggacagg 70 <210> SEQ
ID NO 155 <211> LENGTH: 95 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 155 cggccggccc
tgggtccatc ttccagtaca gtgttggatg gtctaattgt gaagctccta 60
acactgtctg gtaaagatgg ctcccgggtg ggttc 95 <210> SEQ ID NO 156
<211> LENGTH: 72 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 156 gggtccatct tccagtacag
tgttggatgg tctaattgtg aagctcctaa cactgtctgg 60 taaagatggc cc 72
<210> SEQ ID NO 157 <211> LENGTH: 64 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 157
acccataaag tagaaagcac tactaacagc actggagggt gtagtgtttc ctactttatg
60 gatg 64 <210> SEQ ID NO 158 <211> LENGTH: 87
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 158 gacagtgcag tcacccataa agtagaaagc
actactaaca gcactggagg gtgtagtgtt 60 tcctacttta tggatgagtg tactgtg
87 <210> SEQ ID NO 159 <211> LENGTH: 64 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
159 acccataaag tagaaagcac tactaacagc actggagggt gtagtgtttc
ctactttatg 60 gatg 64 <210> SEQ ID NO 160 <211> LENGTH:
106 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 160 gcgcagcgcc ctgtctccca gcctgaggtg
cagtgctgca tctctggtca gttgggagtc 60 tgagatgaag cactgtagct
caggaagaga gaagttgttc tgcagc 106 <210> SEQ ID NO 161
<211> LENGTH: 63 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 161 cctgaggtgc agtgctgcat
ctctggtcag ttgggagtct gagatgaagc actgtagctc 60 agg 63 <210>
SEQ ID NO 162 <211> LENGTH: 86 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 162
tggggccctg gctgggatat catcatatac tgtaagtttg cgatgagaca ctacagtata
60 gatgatgtac tagtccgggc accccc 86 <210> SEQ ID NO 163
<211> LENGTH: 66 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 163 ggctgggata tcatcatata
ctgtaagttt gcgatgagac actacagtat agatgatgta 60 ctagtc 66
<210> SEQ ID NO 164 <211> LENGTH: 88 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 164
caccttgtcc tcacggtcca gttttcccag gaatccctta gatgctaaga tggggattcc
60 tggaaatact gttcttgagg tcatggtt 88 <210> SEQ ID NO 165
<211> LENGTH: 70 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 165 ctcacggtcc agttttccca
ggaatccctt agatgctaag atggggattc ctggaaatac 60 tgttcttgag 70
<210> SEQ ID NO 166 <211> LENGTH: 99 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 166
ccgatgtgta tcctcagctt tgagaactga attccatggg ttgtgtcagt gtcagacctc
60 tgaaattcag ttcttcagct gggatatctc tgtcatcgt 99 <210> SEQ ID
NO 167 <211> LENGTH: 65 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 167 agctttgaga
actgaattcc atgggttgtg tcagtgtcag acctgtgaaa ttcagttctt 60 cagct 65
<210> SEQ ID NO 168 <211> LENGTH: 72 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 168
aatctaaaga caacatttct gcacacacac cagactatgg aagccagtgt gtggaaatgc
60 ttctgctaga tt 72 <210> SEQ ID NO 169 <211> LENGTH:
68 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 169 gaggcaaagt tctgagacac tccgactctg
agtatgatag aagtcagtgc actacagaac 60 tttgtctc 68 <210> SEQ ID
NO 170 <211> LENGTH: 89 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 170 gccggcgccc
gagctctggc tccgtgtctt cactcccgtg cttgtccgag gagggaggga 60
gggacggggg ctgtgctggg gcagctgga 89 <210> SEQ ID NO 171
<211> LENGTH: 53 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 171 gctctggctc cgtgtcttca
ctcccgtgct tgtccgagga gggagggagg gac 53 <210> SEQ ID NO 172
<211> LENGTH: 84 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 172 ctccccatgg ccctgtctcc
caacccttgt accagtgctg ggctcagacc ctggtacagg 60 cctgggggac
agggacctgg ggac 84 <210> SEQ ID NO 173 <211> LENGTH: 64
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 173 ccctgtctcc caacccttgt accagtgctg
ggctcagacc ctggtacagg cctgggggac 60 aggg 64 <210> SEQ ID NO
174 <211> LENGTH: 69 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 174 cctgccctcg
aggagctcac agtctagtat gtctcatccc ctactagact gaagctcctt 60 gaggacagg
69 <210> SEQ ID NO 175 <211> LENGTH: 87 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
175 tgtccccccc ggcccaggtt ctgtgataca ctccgactcg ggctctggag
cagtcagtgc 60 atgacagaac ttgggcccgg aaggacc 87 <210> SEQ ID
NO 176 <211> LENGTH: 71 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 176 ggcccaggtt
ctgtgataca ctccgactcg ggctctggag cagtcagtgc atgacagaac 60
ttgggccccg g 71 <210> SEQ ID NO 177 <211> LENGTH: 90
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 177 ctcacagctg ccagtgtcat ttttgtgatc
tgcagctagt attctcactc cagttgcata 60 gtcacaaaag tgatcattgg
caggtgtggc 90 <210> SEQ ID NO 178 <211> LENGTH: 71
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 178 tctctctctc cctcacagct gccagtgtca
ttgtcacaaa agtgatcatt ggcaggtgtg 60 gctgctgcat g 71 <210> SEQ
ID NO 179 <211> LENGTH: 87 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 179 agcggtggcc
agtgtcattt ttgtgatgtt gcagctagta atatgagccc agttgcatag 60
tcacaaaagt gatcattgga aactgtg 87 <210> SEQ ID NO 180
<211> LENGTH: 69 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 180 cagtgtcatt tttgtgatgt
tgcagctagt aatatgagcc cagttgcata gtcacaaaag 60 tgatcattg 69
<210> SEQ ID NO 181 <211> LENGTH: 84 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 181
gtggtacttg aagataggtt atccgtgttg ccttcgcttt atttgtgacg aatcatacac
60 ggttgaccta tttttcagta ccaa 84 <210> SEQ ID NO 182
<211> LENGTH: 66 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 182 gaagataggt tatccgtgtt
gccttcgctt tatttgtgac gaatcataca cggttgacct 60 attttt 66
<210> SEQ ID NO 183 <211> LENGTH: 65 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 183
ctgttaatgc taatcgtgat aggggttttt gcctccaact gactcctaca tattagcatt
60 aacag 65 <210> SEQ ID NO 184 <211> LENGTH: 108
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 184 caatgtcagc agtgccttag cagcacgtaa
atattggcgt taagattcta aaattatctc 60 cagtattaac tgtgctgctg
aagtaaggtt gaccatactc tacagttg 108 <210> SEQ ID NO 185
<211> LENGTH: 110 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 185 agaagggcta tcaggccagc
cttcagagga ctccaaggaa cattcaacgc tgtcggtgag 60 tttgggattt
gaaaaaacca ctgaccgttg actgtacctt ggggtcctta 110 <210> SEQ ID
NO 186 <211> LENGTH: 110 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 186 tgagttttga
ggttgcttca gtgaacattc aacgctgtcg gtgagtttgg aattaaaatc 60
aaaaccatcg accgttgatt gtaccctatg gctaaccatc atctactcca 110
<210> SEQ ID NO 187 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 187
cggaaaattt gccaagggtt tgggggaaca ttcaacctgt cggtgagttt gggcagctca
60 ggcaaaccat cgaccgttga gtggaccctg aggcctggaa ttgccatcct 110
<210> SEQ ID NO 188 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 188
gagctgcttg cctccccccg tttttggcaa tggtagaact cacactggtg aggtaacagg
60 atccggtggt tctagacttg ccaactatgg ggcgaggact cagccggcac 110
<210> SEQ ID NO 189 <211> LENGTH: 70 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 189
tttttggcaa tggtagaact cacactggtg aggtaacagg atccggtggt tctagacttg
60 ccaactatgg 70 <210> SEQ ID NO 190 <211> LENGTH: 110
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 190 ccgcagagtg tgactcctgt tctgtgtatg
gcactggtag aattcactgt gaacagtctc 60 agtcagtgaa ttaccgaagg
gccataaaca gagcagagac agatccacga 110 <210> SEQ ID NO 191
<211> LENGTH: 84 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 191 ccagtcacgt ccccttatca
cttttccagc ccagctttgt gactgtaagt gttggacgga 60 gaactgataa
gggtaggtga ttga 84 <210> SEQ ID NO 192 <211> LENGTH: 65
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 192 ccttatcact tttccagccc agctttgtga
ctgtaagtgt tggacggaga actgataagg 60 gtagg 65 <210> SEQ ID NO
193 <211> LENGTH: 82 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 193 agggggcgag
ggattggaga gaaaggcagt tcctgatggt cccctcccca ggggctggct 60
ttcctctggt ccttccctcc ca 82 <210> SEQ ID NO 194 <211>
LENGTH: 66 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 194 agggattgga gagaaaggca gttcctgatg
gtcccctccc caggggctgg ctttcctctg 60 gtcctt 66 <210> SEQ ID NO
195 <211> LENGTH: 86 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 195 tgcttgtaac
tttccaaaga attctccttt tgggctttct ggttttattt taagcccaaa 60
ggtgaatttt ttgggaagtt tgagct 86 <210> SEQ ID NO 196
<211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 196 actttccaaa gaattctcct
tttgggcttt ctggttttat tttaagccca aaggtgaatt 60 ttttgggaag t 71
<210> SEQ ID NO 197 <211> LENGTH: 109 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 197
ggtcgggctc accatgacac agtgtgagac tcgggctaca acacaggacc cggggcgctg
60 ctctgacccc tcgtgtcttg tgttgcagcc ggagggacgc aggtccgca 109
<210> SEQ ID NO 198 <211> LENGTH: 86 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 198
tgctccctct ctcacatccc ttgcatggtg gagggtgagc tttctgaaaa cccctcccac
60 atgcagggtt tgcaggatgg cgagcc 86 <210> SEQ ID NO 199
<211> LENGTH: 68 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 199 tctcacatcc cttgcatggt
ggagggtgag ctttctgaaa acccctccca catgcagggt 60 ttgcagga 68
<210> SEQ ID NO 200 <211> LENGTH: 102 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 200
ctgtcgattg gacccgccct ccggtgccta ctgagctgat atcagttctc attttacaca
60 ctggctcagt tcagcaggaa caggagtcga gcccttgagc aa 102 <210>
SEQ ID NO 201 <211> LENGTH: 68 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 201
ctccggtgcc tactgagctg atatcagttc tcattttaca cactggctca gttcagcagg
60 aacaggag 68 <210> SEQ ID NO 202 <211> LENGTH: 85
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 202 tgcaggcctc tgtgtgatat gtttgatata
ttaggttgtt atttaatcca actatatatc 60 aaacatattc ctacagtgtc ttgcc 85
<210> SEQ ID NO 203 <211> LENGTH: 67 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 203
ctgtgtgata tgtttgatat attaggttgt tatttaatcc aactatatat caaacatatt
60 cctacag 67 <210> SEQ ID NO 204 <211> LENGTH: 92
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 204 cggctggaca gcgggcaacg gaatcccaaa
agcagctgtt gtctccagag cattccagct 60 gcgcttggat ttcgtcccct
gctctcctgc ct 92 <210> SEQ ID NO 205 <211> LENGTH: 74
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 205 agcgggcaac ggaatcccaa aagcagctgt
tgtctccaga gcattccagc tgcgcttgga 60 tttcgtcccc tgct 74 <210>
SEQ ID NO 206 <211> LENGTH: 108 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 206
ccgagaccga gtgcacaggg ctctgaccta tgaattgaca gccagtgctc tcgtctcccc
60 tctggctgcc aattccatag gtcacaggta tgttcgcctc aatgccag 108
<210> SEQ ID NO 207 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 207
gccgagaccg agtgcacagg gctctgacct atgaattgac agccagtgct ctcgtctccc
60 ctctggctgc caattccata ggtcacaggt atgttcgcct caatgccagc 110
<210> SEQ ID NO 208 <211> LENGTH: 88 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 208
cgaggatggg agctgagggc tgggtctttg cgggcgagat gagggtgtcg gatcaactgg
60 cctacaaagt cccagttctc ggcccccg 88 <210> SEQ ID NO 209
<211> LENGTH: 58 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 209 gctgggtctt tgcgggcgag
atgagggtgt cggatcaact ggcctacaaa gtcccagt 58 <210> SEQ ID NO
210 <211> LENGTH: 85 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 210 atggtgttat
caagtgtaac agcaactcca tgtggactgt gtaccaattt ccagtggaga 60
tgctgttact tttgatggtt accaa 85 <210> SEQ ID NO 211
<211> LENGTH: 63 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 211 gtgtaacagc aactccatgt
ggactgtgta ccaatttcca gtggagatgc tgttactttt 60 gat 63 <210>
SEQ ID NO 212 <211> LENGTH: 87 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 212
agcttccctg gctctagcag cacagaaata ttggcacagg gaagcgagtc tgccaatatt
60 ggctgtgctg ctccaggcag ggtggtg 87 <210> SEQ ID NO 213
<211> LENGTH: 58 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 213 tagcagcaca gaaatattgg
cacagggaag cgagtctgcc aatattggct gtgctgct 58 <210> SEQ ID NO
214 <211> LENGTH: 110 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 214 ctagagcttg
aattggaact gctgagtgaa ttaggtagtt tcatgttgtt gggcctgggt 60
ttctgaacac aacaacatta aaccacccga ttcacggcag ttactgctcc 110
<210> SEQ ID NO 215 <211> LENGTH: 70 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 215
gtgaattagg tagtttcatg ttgttgggcc tgggtttctg aacacaacaa cattaaacca
60 cccgattcac 70 <210> SEQ ID NO 216 <211> LENGTH: 110
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 216 tgctcgctca gctgatctgt ggcttaggta
gtttcatgtt gttgggattg agttttgaac 60 tcggcaacaa gaaactgcct
gagttacatc agtcggtttt cgtcgagggc 110 <210> SEQ ID NO 217
<211> LENGTH: 70 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 217 gtgaattagg tagtttcatg
ttgttgggcc tgggtttctg aacacaacaa cattaaacca 60 cccgattcac 70
<210> SEQ ID NO 218 <211> LENGTH: 75 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 218
ggctgtgccg ggtagagagg gcagtgggag gtaagagctc ttcacccttc accaccttct
60 ccacccagca tggcc 75 <210> SEQ ID NO 219 <211>
LENGTH: 62 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 219 tcattggtcc agaggggaga taggttcctg
tgatttttcc ttcttctcta tagaataaat 60 ga 62 <210> SEQ ID NO 220
<211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 220 gccaacccag tgttcagact
acctgttcag gaggctctca atgtgtacag tagtctgcac 60 attggttagg c 71
<210> SEQ ID NO 221 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 221
aggaagcttc tggagatcct gctccgtcgc cccagtgttc agactacctg ttcaggacaa
60 tgccgttgta cagtagtctg cacattggtt agactgggca agggagagca 110
<210> SEQ ID NO 222 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 222
ccagaggaca cctccactcc gtctacccag tgtttagact atctgttcag gactcccaaa
60 ttgtacagta gtctgcacat tggttaggct gggctgggtt agaccctcgg 110
<210> SEQ ID NO 223 <211> LENGTH: 71 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 223
gccaacccag tgttcagact acctgttcag gaggctctca atgtgtacag tagtctgcac
60 attggttagg c 71 <210> SEQ ID NO 224 <211> LENGTH: 70
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 224 gccgtggcca tcttactggg cagcattgga
tggagtcagg tctctaatac tgcctggtaa 60 tgatgacggc 70 <210> SEQ
ID NO 225 <211> LENGTH: 95 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 225 ccagctcggg
cagccgtggc catcttactg ggcagcattg gatggagtca ggtctctaat 60
actgcctggt aatgatgacg gcggagccct gcacg 95 <210> SEQ ID NO 226
<211> LENGTH: 72 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 226 gttccttttt cctatgcata
tacttctttg aggatctggc ctaaagaggt atagggcatg 60 ggaagatgga gc 72
<210> SEQ ID NO 227 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 227
gtgttgggga ctcgcgcgct gggtccagtg gttcttaaca gttcaacagt tctgtagcgc
60 aattgtgaaa tgtttaggac cactagaccc ggcgggcgcg gcgacagcga 110
<210> SEQ ID NO 228 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 228
ggctacagtc tttcttcatg tgactcgtgg acttcccttt gtcatcctat gcctgagaat
60 atatgaagga ggctgggaag gcaaagggac gttcaattgt catcactggc 110
<210> SEQ ID NO 229 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 229
aaagatcctc agacaatcca tgtgcttctc ttgtccttca ttccaccgga gtctgtctca
60 tacccaacca gatttcagtg gagtgaagtt caggaggcat ggagctgaca 110
<210> SEQ ID NO 230 <211> LENGTH: 86 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 230
tgcttcccga ggccacatgc ttctttatat ccccatatgg attactttgc tatggaatgt
60 aaggaagtgt gtggtttcgg caagtg 86 <210> SEQ ID NO 231
<211> LENGTH: 69 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 231 aggccacatg cttctttata
tccccatatg gattactttg ctatggaatg taaggaagtg 60 tgtggtttt 69
<210> SEQ ID NO 232 <211> LENGTH: 71 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 232
tgacgggcga gcttttggcc cgggttatac ctgatgctca cgtataagac gagcaaaaag
60 cttgttggtc a 71 <210> SEQ ID NO 233 <211> LENGTH:
110 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 233 acccggcagt gcctccaggc gcagggcagc
ccctgcccac cgcacactgc gctgccccag 60 acccactgtg cgtgtgacag
cggctgatct gtgcctgggc agcgcgaccc 110 <210> SEQ ID NO 234
<211> LENGTH: 110 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 234 tcacctggcc atgtgacttg
tgggcttccc tttgtcatcc ttcgcctagg gctctgagca 60 gggcagggac
agcaaagggg tgctcagttg tcacttccca cagcacggag 110 <210> SEQ ID
NO 235 <211> LENGTH: 110 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 235 cggggcaccc
cgcccggaca gcgcgccggc accttggctc tagactgctt actgcccggg 60
ccgccctcag taacagtctc cagtcacggc caccgacgcc tggccccgcc 110
<210> SEQ ID NO 236 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 236
cctgtgcaga gattattttt taaaaggtca caatcaacat tcattgctgt cggtgggttg
60 aactgtgtgg acaagctcac tgaacaatga atgcaactgt ggccccgctt 110
<210> SEQ ID NO 237 <211> LENGTH: 108 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 237
gagttttgag gttgcttcag tgaacattca acgctgtcgg tgagtttgga attaaaatca
60 aaaccatcga ccgttgattg taccctatgg ctaaccatca tctactcc 108
<210> SEQ ID NO 238 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 238
ggcctggctg gacagagttg tcatgtgtct gcctgtctac acttgctgtg cagaacatcc
60 gctcacctgt acagcaggca cagacaggca gtcacatgac aacccagcct 110
<210> SEQ ID NO 239 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 239
atcattcaga aatggtatac aggaaaatga cctatgaatt gacagacaat atagctgagt
60 ttgtctgtca tttctttagg ccaatattct gtatgactgt gctacttcaa 110
<210> SEQ ID NO 240 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 240
gatggctgtg agttggctta atctcagctg gcaactgtga gatgttcata caatccctca
60 cagtggtctc tgggattatg ctaaacagag caatttccta gccctcacga 110
<210> SEQ ID NO 241 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 241
agtataatta ttacatagtt tttgatgtcg cagatactgc atcaggaact gattggataa
60 gaatcagtca ccatcagttc ctaatgcatt gccttcagca tctaaacaag 110
<210> SEQ ID NO 242 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 242
gtgataatgt agcgagattt tctgttgtgc ttgatctaac catgtggttg cgaggtatga
60 gtaaaacatg gttccgtcaa gcaccatgga acgtcacgca gctttctaca 110
<210> SEQ ID NO 243 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 243
gaccagtcgc tgcggggctt tcctttgtgc ttgatctaac catgtggtgg aacgatggaa
60 acggaacatg gttctgtcaa gcaccgcgga aagcaccgtg ctctcctgca 110
<210> SEQ ID NO 244 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 244
ccgccccggg ccgcggctcc tgattgtcca aacgcaattc tcgagtctat ggctccggcc
60 gagagttgag tctggacgtc ccgagccgcc gcccccaaac ctcgagcggg 110
<210> SEQ ID NO 245 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 245
gacagtgtgg cattgtaggg ctccacaccg tatctgacac tttgggcgag ggcaccatgc
60 tgaaggtgtt catgatgcgg tctgggaact cctcacggat cttactgatg 110
<210> SEQ ID NO 246 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 246
tgaacatcca ggtctggggc atgaacctgg catacaatgt agatttctgt gttcgttagg
60 caacagctac attgtctgct gggtttcagg ctacctggaa acatgttctc 110
<210> SEQ ID NO 247 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 247
gctgctggaa ggtgtaggta ccctcaatgg ctcagtagcc agtgtagatc ctgtctttcg
60 taatcagcag ctacatctgg ctactgggtc tctgatggca tcttctagct 110
<210> SEQ ID NO 248 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 248
cctggcctcc tgcagtgcca cgctccgtgt atttgacaag ctgagttgga cactccatgt
60 ggtagagtgt cagtttgtca aataccccaa gtgcggcaca tgcttaccag 110
<210> SEQ ID NO 249 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 249
gggctttcaa gtcactagtg gttccgttta gtagatgatt gtgcattgtt tcaaaatggt
60 gccctagtga ctacaaagcc c 81 <210> SEQ ID NO 250 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 250 cttctggaag ctggtttcac atggtggctt
agatttttcc atctttgtat ctagcaccat 60 ttgaaatcag tgttttagga g 81
<210> SEQ ID NO 251 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 251
cttcaggaag ctggtttcat atggtggttt agatttaaat agtgattgtc tagcaccatt
60 tgaaatcagt gttcttgggg g 81 <210> SEQ ID NO 252 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 252 cttcaggaag ctggtttcat atggtggttt
agatttaaat agtgattgtc tagcaccatt 60 tgaaatcagt gttcttgggg g 81
<210> SEQ ID NO 253 <211> LENGTH: 80 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 253
gtgagcgact gtaaacatcc tcgactggaa gctgtgaagc cacagatggg ctttcagtcg
60 gatgtttgca gctgcctact 80 <210> SEQ ID NO 254 <211>
LENGTH: 88 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 254 accaagtttc agttcatgta aacatcctac
actcagctgt aatacatgga ttggctggga 60 ggtggatgtt tacttcagct gacttgga
88 <210> SEQ ID NO 255 <211> LENGTH: 75 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
255 tgccctggct cagttatcac agtgctgatg ctgtctattc taaaggtaca
gtactgtgat 60 aactgaagga tggca 75 <210> SEQ ID NO 256
<211> LENGTH: 90 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 256 acactgcaag aacaataagg
atttttaggg gcattatgac tgagtcagaa aacacagctg 60 cccctgaaag
tccctcattt ttcttgctgt 90 <210> SEQ ID NO 257 <211>
LENGTH: 80 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 257 actgcaagag caataaggat ttttaggggc
attatgatag tggaatggaa acacatctgc 60 ccccaaaagt ccctcatttt 80
<210> SEQ ID NO 258 <211> LENGTH: 85 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 258
cgctggcgac gggacattat tacttttggt acgcgctgtg acacttcaaa ctcgtaccgt
60 gagtaataat gcgccgtcca cggca 85 <210> SEQ ID NO 259
<211> LENGTH: 61 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 259 acattattac ttttggtacg
cgctgtgaca cttcaaactc gtaccgtgag taataatgcg 60 c 61 <210> SEQ
ID NO 260 <211> LENGTH: 74 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 260 tggatctttt
tgcggtctgg gcttgctgtt cctctcaaca gtagtcagga agcccttacc 60
ccaaaaagta tcta 74 <210> SEQ ID NO 261 <211> LENGTH: 90
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 261 tgcccttcgc gaatcttttt gcggtctggg
cttgctgtac ataactcaat agccggaagc 60 ccttacccca aaaagcattt
gcggagggcg 90 <210> SEQ ID NO 262 <211> LENGTH: 80
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 262 gccccctgct ctggctggtc aaacggaacc
aagtccgtct tcctgagagg tttggtcccc 60 ttcaaccagc tacagcaggg 80
<210> SEQ ID NO 263 <211> LENGTH: 100 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 263
agataaattc actctagtgc tttatggctt tttattccta tgtgatagta ataaagtctc
60 atgtagggat ggaagccatg aaatacattg tgaaaaatca 100 <210> SEQ
ID NO 264 <211> LENGTH: 70 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 264 aagcacgatt
agcatttgag gtgaagttct gttatacact caggctgtgg ctctctgaaa 60
gtcagtgcat 70 <210> SEQ ID NO 265 <211> LENGTH: 69
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 265 cctgtcctca aggagcttca gtctagtagg
ggatgagaca tactagactg tgagctcctc 60 gagggcagg 69 <210> SEQ ID
NO 266 <211> LENGTH: 65 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 266 ctgttaatgc
taatcgtgat aggggttttt gcctccaact gactcctaca tattagcatt 60 aacag 65
<210> SEQ ID NO 267 <211> LENGTH: 82 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 267
cctaacactg tctggtaaag atggctcccg ggtgggttct ctcggcagta accttcaggg
60 agccctgaag accatggagg ac 82 <210> SEQ ID NO 268
<211> LENGTH: 110 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 268 gccgagaccg agtgcacagg
gctctgacct atgaattgac agccagtgct ctcgtctccc 60 ctctggctgc
caattccata ggtcacaggt atgttcgcct caatgccagc 110 <210> SEQ ID
NO 269 <211> LENGTH: 80 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 269 tcccgccccc
tgtaacagca actccatgtg gaagtgccca ctggttccag tggggctgct 60
gttatctggg gcgagggcca 80 <210> SEQ ID NO 270 <211>
LENGTH: 70 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 270 aaagctgggt tgagagggcg aaaaaggatg
aggtgactgg tctgggctac gctatgctgc 60 ggcgctcggg 70 <210> SEQ
ID NO 271 <211> LENGTH: 64 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 271 cattggcctc
ctaagccagg gattgtgggt tcgagtccca cccggggtaa agaaaggccg 60 aatt 64
<210> SEQ ID NO 272 <211> LENGTH: 70 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 272
cctaagccag ggattgtggg ttcgagtccc acctggggta gaggtgaaag ttccttttac
60 ggaatttttt 70 <210> SEQ ID NO 273 <211> LENGTH: 81
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 273 gggctttcaa gtcactagtg gttccgttta
gtagatgatt gtgcattgtt tcaaaatggt 60 gccctagtga ctacaaagcc c 81
<210> SEQ ID NO 274 <211> LENGTH: 70 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 274
acgcaagtgt cctaaggtga gctcagggag cacagaaacc tccagtggaa cagaagggca
60 aaagctcatt 70 <210> SEQ ID NO 275 <211> LENGTH: 70
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 275 catgtgtcac tttcaggtgg agtttcaaga
gtcccttcct ggttcaccgt ctcctttgct 60 cttccacaac 70 <210> SEQ
ID NO 276 <211> LENGTH: 109 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 276 ggtcgggctc
accatgacac agtgtgagac tcgggctaca acacaggacc cggggcgctg 60
ctctgacccc tcgtgtcttg tgttgcagcc ggagggacgc aggtccgca 109
<210> SEQ ID NO 277 <211> LENGTH: 86 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 277
tgctccctct ctcacatccc ttgcatggtg gagggtgagc tttctgaaaa cccctcccac
60 atgcagggtt tgcaggatgg cgagcc 86 <210> SEQ ID NO 278
<211> LENGTH: 85 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 278 tgcaggcctc tgtgtgatat
gtttgatata ttaggttgtt atttaatcca actatatatc 60 aaacatattc
ctacagtgtc ttgcc 85 <210> SEQ ID NO 279 <211> LENGTH:
60 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 279 gtgcatgtgt atgtatgtgt gcatgtgcat
gtgtatgtgt atgagtgcat gcgtgtgtgc 60 <210> SEQ ID NO 280
<211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 280 ggctgtgccg ggtagagagg
gcagtgggag gtaagagctc ttcacccttc accaccttct 60 ccacccagca tggcc 75
<210> SEQ ID NO 281 <211> LENGTH: 72 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 281
gttccttttt cctatgcata tacttctttg aggatctggc ctaaagaggt atagggcatg
60 ggaagatgga gc 72 <210> SEQ ID NO 282 <211> LENGTH:
60 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 282 caatcttcct ttatcatggt attgattttt
cagtgcttcc cttttgtgtg agagaagata 60 <210> SEQ ID NO 283
<211> LENGTH: 102 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 283 atggagctgc tcaccctgtg
ggcctcaaat gtggaggaac tattctgatg tccaagtgga 60 aagtgctgcg
acatttgagc gtcaccggtg acgcccatat ca 102 <210> SEQ ID NO 284
<211> LENGTH: 101 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 284 gcatcccctc agcctgtggc
actcaaactg tgggggcact ttctgctctc tggtgaaagt 60 gccgccatct
tttgagtgtt accgcttgag aagactcaac c 101 <210> SEQ ID NO 285
<211> LENGTH: 102 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 285 cgaggagctc atactgggat
actcaaaatg ggggcgcttt cctttttgtc tgttactggg 60 aagtgcttcg
attttggggt gtccctgttt gagtagggca tc 102 <210> SEQ ID NO 286
<211> LENGTH: 40 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: oligonucleotide probe <400> SEQUENCE: 286
tgacagaaga gagtgagcac acaaaggcaa tttgcatatc 40 <210> SEQ ID
NO 287 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 287
cattgcactt gcttctcttg cgtgctcact gctctttctg 40 <210> SEQ ID
NO 288 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 288
gtgttgacag aagatagaga gcacagatga tgagatacaa 40 <210> SEQ ID
NO 289 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 289
catcttactc ctttgtgctc tctagccttc tgtcatcacc 40 <210> SEQ ID
NO 290 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 290
gatggacggt ggtgattcac tctccacaaa gttctctatg 40 <210> SEQ ID
NO 291 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 291
tgagaatctt gatgatgctg catcggcaat caacgactat 40 <210> SEQ ID
NO 292 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 292
tgaggtagta ggttgtatag ttttagggtc acacccacca 40 <210> SEQ ID
NO 293 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 293
tacagcctcc tagctttcct tgggtcttgc actaaacaac 40 <210> SEQ ID
NO 294 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 294
actgcatgct cccaggttga ggtagtaggt tgtatagttt 40 <210> SEQ ID
NO 295 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 295
gggtgaggta gtaggttgta tagtttgggg ctctgccctg 40 <210> SEQ ID
NO 296 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 296
tgaggtagta ggttgtgtgg tttcagggca gtgatgttgc 40 <210> SEQ ID
NO 297 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 297
gcatccgggt tgaggtagta ggttgtatgg tttagagtta 40 <210> SEQ ID
NO 298 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 298
cctaggaaga ggtagtaggt tgcatagttt tagggcaggg 40 <210> SEQ ID
NO 299 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 299
ctaggaagag gtagtagttt gcatagtttt agggcaaaga 40 <210> SEQ ID
NO 300 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 300
ttggtcgggt tgtgacattg cccgctgtgg agataactgc 40 <210> SEQ ID
NO 301 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 301
gctgaggtag tagtttgtgc tgttggtcgg gttgtgacat 40 <210> SEQ ID
NO 302 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 302
ggctgaggta ggaggttgta tagttgagga ggacacccaa 40 <210> SEQ ID
NO 303 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 303
ggtagtgatt ttaccctgtt caggagataa ctatacaatc 40 <210> SEQ ID
NO 304 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 304
gggatgaggt agtagattgt atagttgtgg ggtagtgatt 40 <210> SEQ ID
NO 305 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 305
tgaggtagta gattgtatag ttttagggtc ataccccatc 40 <210> SEQ ID
NO 306 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 306
ctgattccag gctgaggtag tagtttgtac agtttgaggg 40 <210> SEQ ID
NO 307 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 307
ttgagggtct atgataccac ccggtacagg agataactgt 40 <210> SEQ ID
NO 308 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 308
aatgctatgg aatgtaaaga agtatgtatt tttggtaggc 40 <210> SEQ ID
NO 309 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 309
taagctatgg aatgtaaaga agtatgtatc tcaggccggg 40 <210> SEQ ID
NO 310 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 310
tgttggccta gttctgtgtg gaagactagt gattttgttg 40 <210> SEQ ID
NO 311 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 311
tactgcgctc aacaacaaat cccagtctac ctaatggtgc 40 <210> SEQ ID
NO 312 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 312
ggaccggctg gccccatctg gaagactagt gattttgttg 40 <210> SEQ ID
NO 313 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 313
agattagagt ggctgtggtc tagtgctgtg tggaagacta 40 <210> SEQ ID
NO 314 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 314
tggaagacta gtgattttgt tgttctgatg tactacgaca 40 <210> SEQ ID
NO 315 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 315
tctttggtta tctagctgta tgagtggtgt ggagtcttca 40 <210> SEQ ID
NO 316 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 316
taaagctaga taaccgaaag taaaaataac cccatacact 40 <210> SEQ ID
NO 317 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 317
gaagcgagtt gttatctttg gttatctagc tgtatgagtg 40 <210> SEQ ID
NO 318 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 318
gagtgtattg gtcttcataa agctagataa ccgaaagtaa 40 <210> SEQ ID
NO 319 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 319
gggaggcccg tttctctctt tggttatcta gctgtatgag 40 <210> SEQ ID
NO 320 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 320
gtgccacaga gccgtcataa agctagataa ccgaaagtag 40 <210> SEQ ID
NO 321 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 321
gtctgtcttc tgtatatacc ctgtagatcc gaatttgtgt 40 <210> SEQ ID
NO 322 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 322
gtggtcacaa attcgtatct aggggaatat gtagttgaca 40 <210> SEQ ID
NO 323 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 323
taccctgtag aaccgaattt gtgtggtatc cgtatagtca 40 <210> SEQ ID
NO 324 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 324
gtcacagatt cgattctagg ggaatatatg gtcgatgcaa 40 <210> SEQ ID
NO 325 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 325
ccttggagta aagtagcagc acataatggt ttgtggattt 40 <210> SEQ ID
NO 326 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 326
tttgtggatt ttgaaaaggt gcaggccata ttgtgctgcc 40 <210> SEQ ID
NO 327 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 327
ggccttaaag tactgtagca gcacatcatg gtttacatgc 40 <210> SEQ ID
NO 328 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 328
tgctacagtc aagatgcgaa tcattatttg ctgctctaga 40 <210> SEQ ID
NO 329 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 329
caatgtcagc agtgccttag cagcacgtaa atattggcgt 40 <210> SEQ ID
NO 330 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 330
gttccactct agcagcacgt aaatattggc gtagtgaaat 40 <210> SEQ ID
NO 331 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 331
gcatctactg cagtgaaggc acttgtagca ttatggtgac 40 <210> SEQ ID
NO 332 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 332
gtcagaataa tgtcaaagtg cttacagtgc aggtagtgat 40 <210> SEQ ID
NO 333 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 333
taaggtgcat ctagtgcaga tagtgaagta gattagcatc 40 <210> SEQ ID
NO 334 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 334
tgtagttgtg caaatctatg caaaactgat ggtggcctgc 40 <210> SEQ ID
NO 335 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 335
ttctgctgtg caaatccatg caaaactgac tgtggtagtg 40 <210> SEQ ID
NO 336 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 336
gtggctgtgc aaatccatgc aaaactgatt gtgataatgt 40 <210> SEQ ID
NO 337 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 337
taaagtgctt atagtgcagg tagtgtttag ttatctactg 40 <210> SEQ ID
NO 338 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 338
gtcgggtagc ttatcagact gatgttgact gttgaatctc 40 <210> SEQ ID
NO 339 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 339
ttcaacagtc aacatcagtc tgataagcta cccgacaagg 40 <210> SEQ ID
NO 340 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 340
tgtcctgacc cagctaaagc tgccagttga agaactgttg 40 <210> SEQ ID
NO 341 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 341
tcctgtcaca aatcacattg ccagggattt ccaaccgacc 40 <210> SEQ ID
NO 342 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 342
aatcacattg ccagggatta ccacgcaacc acgaccttgg 40 <210> SEQ ID
NO 343 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 343
ttttacacac tggctcagtt cagcaggaac aggagtcgag 40 <210> SEQ ID
NO 344 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 344
tccggtgcct actgagctga tatcagttct cattttacac 40 <210> SEQ ID
NO 345 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 345
agttggtttg tgtacactgg ctcagttcag caggaacagg 40 <210> SEQ ID
NO 346 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 346
acgctgccct gggcattgca cttgtctcgg tctgacagtg 40 <210> SEQ ID
NO 347 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 347
ttcaagtaat ccaggatagg ctgtgcaggt cccaatggcc 40 <210> SEQ ID
NO 348 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 348
tcccaatggc ctatcttggt tacttgcacg gggacgcggg 40 <210> SEQ ID
NO 349 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 349
ttcaagtaat tcaggatagg ttgtgtgctg tccagcctgt 40 <210> SEQ ID
NO 350 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 350
gtccacacca agtcgtgttc acagtggcta agttccgccc 40 <210> SEQ ID
NO 351 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 351
ccgctttgtt cacagtggct aagttctgca cctgaagaga 40 <210> SEQ ID
NO 352 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 352
aaggagctca cagtctattg agttaccttt ctgactttcc 40 <210> SEQ ID
NO 353 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 353
ctagcaccat ctgaaatcgg ttataatgat tggggaagag 40 <210> SEQ ID
NO 354 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 354
ccccttagag gatgactgat ttcttttggt gttcagagtc 40 <210> SEQ ID
NO 355 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 355
agtgattgtc tagcaccatt tgaaatcagt gttcttgggg 40 <210> SEQ ID
NO 356 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 356
ttttgtctag caccatttga aatcggttat gatgtagggg 40 <210> SEQ ID
NO 357 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 357
gcgactgtaa acatcctcga ctggaagctg tgaagccaca 40 <210> SEQ ID
NO 358 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 358
cacagatggg ctttcagtcg gatgtttgca gctgcctact 40 <210> SEQ ID
NO 359 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 359
tgtaaacatc ctacactcag ctgtaataca tggattggct 40 <210> SEQ ID
NO 360 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 360
atggattggc tgggaggtgg atgtttactt cagctgactt 40 <210> SEQ ID
NO 361 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 361
tactgtaaac atcctacact ctcagctgtg gaaagtaaga 40 <210> SEQ ID
NO 362 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 362
taagacacag ctaagctttc agtcagatgt ttgctgctac 40 <210> SEQ ID
NO 363 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 363
ttgtaaacat ccccgactgg aagctgtaag acacagctaa 40 <210> SEQ ID
NO 364 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 364
ggcaagatgc tggcatagct gttgaactgg gaacctgcta 40 <210> SEQ ID
NO 365 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 365
tgtcacggcc tcaatgcaat ttagtgtgtg tgatattttc 40 <210> SEQ ID
NO 366 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 366
ggagatattg cacattacta agttgcatgt tgtcacggcc 40 <210> SEQ ID
NO 367 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 367
gtgcattgct gttgcattgc acgtgtgtga ggcgggtgca 40 <210> SEQ ID
NO 368 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 368
gtggtgcatt gtagttgcat tgcatgttct ggtggtaccc 40 <210> SEQ ID
NO 369 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 369
gagtgtttct ttggcagtgt cttagctggt tgttgtgagc 40 <210> SEQ ID
NO 370 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 370
agtaaggaag caatcagcaa gtatactgcc ctagaagtgc 40 <210> SEQ ID
NO 371 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 371
acaggttggg atcggttgca atgctgtgtt tctgtatggt 40 <210> SEQ ID
NO 372 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 372
tctgtatggt attgcacttg tcccggcctg ttgagtttgg 40 <210> SEQ ID
NO 373 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 373
gttctatata aagtattgca cttgtcccgg cctgtggaag 40 <210> SEQ ID
NO 374 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 374
ccaaagtgct gttcgtgcag gtagtgtgat tacccaacct 40 <210> SEQ ID
NO 375 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 375
cgttacattc aacgggtatt tattgagcac ccactctgtg 40 <210> SEQ ID
NO 376 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 376
ctccgctctg agcaatcatg tgcagtgcca atatgggaaa 40 <210> SEQ ID
NO 377 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 377
tggccgattt tggcactagc acatttttgc ttgtgtctct 40 <210> SEQ ID
NO 378 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 378
tgaggtagta agttgtattg ttgtggggta gggatattag 40 <210> SEQ ID
NO 379 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 379
gccttcgccg cacacaagct cgtgtctgtg ggtccgtgtc 40 <210> SEQ ID
NO 380 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 380
cacccgtaga accgaccttg cggggccttc gccgcacaca 40 <210> SEQ ID
NO 381 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 381
ataaacccgt agatccgatc ttgtggtgaa gtggaccgca 40 <210> SEQ ID
NO 382 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 382
tgaggcctgt tgccacaaac ccgtagatcc gaacttgtgg 40 <210> SEQ ID
NO 383 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 383
ccctggctca gttatcacag tgctgatgct gtctattcta 40 <210> SEQ ID
NO 384 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 384
tacagtactg tgataactga aggatggcag ccatcttacc 40 <210> SEQ ID
NO 385 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 385
gctgtatatc tgaaaggtac agtactgtga taactgaaga 40 <210> SEQ ID
NO 386 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 386
tctttgtatc tagcaccatt tgaaatcagt gttttaggag 40 <210> SEQ ID
NO 387 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 387
gtagcattca ggtcaagcaa cattgtacag ggctatgaaa 40 <210> SEQ ID
NO 388 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 388
tatggatcaa gcagcattgt acagggctat gaaggcattg 40 <210> SEQ ID
NO 389 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 389
atcgtggtca aatgctcaga ctcctgtggt ggctgctcat 40 <210> SEQ ID
NO 390 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 390
ccttggccat gtaaaagtgc ttacagtgca ggtagctttt 40 <210> SEQ ID
NO 391 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 391
ggcatggagt tcaagcagca ttgtacaggg ctatcaaagc 40 <210> SEQ ID
NO 392 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 392
ccttagcaga gctgtggagt gtgacaatgg tgtttgtgtc 40 <210> SEQ ID
NO 393 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 393
gacgggacat tattactttt ggtacgcgct gtgacacttc 40 <210> SEQ ID
NO 394 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 394
tgtgacactt caaactcgta ccgtgagtaa taatgcgccg 40 <210> SEQ ID
NO 395 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 395
atacaattaa ggcacgcggt gaatgccaag aatggggctg 40 <210> SEQ ID
NO 396 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 396
ttaaggcacg cggtgaatgc caagagcgga gcctacggct 40 <210> SEQ ID
NO 397 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 397
ttaaggcacg cggtgaatgc caagagaggc gcctccgccg 40 <210> SEQ ID
NO 398 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 398
tctaggtccc tgagaccctt taacctgtga ggacatccag 40 <210> SEQ ID
NO 399 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 399
cagggtcaca ggtgaggttc ttgggagcct ggcgtctggc 40 <210> SEQ ID
NO 400 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 400
tccctgagac cctaacttgt gatgtttacc gtttaaatcc 40 <210> SEQ ID
NO 401 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 401
tagtaacatc acaagtcagg ctcttgggac ctaggcggag 40 <210> SEQ ID
NO 402 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 402
accagacttt tcctagtccc tgagacccta acttgtgagg 40 <210> SEQ ID
NO 403 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 403
tcggatccgt ctgagcttgg ctggtcggaa gtctcatcat 40 <210> SEQ ID
NO 404 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 404
ttggattcgg ggccgtagca ctgtctgaga ggtttacatt 40 <210> SEQ ID
NO 405 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 405
acatttctca cagtgaaccg gtctcttttt cagctgcttc 40 <210> SEQ ID
NO 406 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 406
tcacagtgaa ccggtctctt tccctactgt gtcacactcc 40 <210> SEQ ID
NO 407 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 407
gggggccgat acactgtacg agagtgagta gcaggtctca 40 <210> SEQ ID
NO 408 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 408
tggatctttt tgcggtctgg gcttgctgtt cctctcaaca 40 <210> SEQ ID
NO 409 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 409
cctctcaaca gtagtcagga agcccttacc ccaaaaagta 40 <210> SEQ ID
NO 410 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 410
ccagagctct tttcacattg tgctactgtc tgcacctgtc 40 <210> SEQ ID
NO 411 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 411
tgtctgcacc tgtcactagc agtgcaatgt taaaagggca 40 <210> SEQ ID
NO 412 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 412
tgtgggaact ggaggtaaca gtctacagcc atggtcgccc 40 <210> SEQ ID
NO 413 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 413
tccagggcaa ccgtggcttt cgattgttac tgtgggaact 40 <210> SEQ ID
NO 414 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 414
cctcttcaat ggatttggtc cccttcaacc agctgtagct 40 <210> SEQ ID
NO 415 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 415
ttggtcccct tcaaccagct gtagctgtgc attgatggcg 40 <210> SEQ ID
NO 416 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 416
atgcactgtg ttcaccctgt gggccaccta gtcaccaacc 40 <210> SEQ ID
NO 417 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 417
gtgtgtgact ggttgaccag aggggcatgc actgtgttca 40 <210> SEQ ID
NO 418 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 418
gcctcgctgt tctctatggc tttttattcc tatgtgattc 40 <210> SEQ ID
NO 419 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 419
cactctagtg ctttatggct ttttattcct atgtgatagt 40 <210> SEQ ID
NO 420 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 420
atgctccatc atcgtctcaa atgagtcttc agagggttct 40 <210> SEQ ID
NO 421 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 421
tgagccctcg gaggactcca tttgttttga tgatggattc 40 <210> SEQ ID
NO 422 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 422
ggattacgtt gttattgctt aagaatacgc gtagtcgagg 40 <210> SEQ ID
NO 423 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 423
agctggtgtt gtgaatcagg ccgttgccaa tcagagaacg 40 <210> SEQ ID
NO 424 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 424
agctggtgtt gtgaatcagg ccgacgagca gcgcatcctc 40 <210> SEQ ID
NO 425 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 425
gtgtattcta cagtgcacgt gtctccagtg tggctcggag 40 <210> SEQ ID
NO 426 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 426
gccagtggtt ttaccctatg gtaggttacg tcatgctgtt 40 <210> SEQ ID
NO 427 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 427
ttctaccaca gggtagaacc acggacagga taccggggca 40 <210> SEQ ID
NO 428 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 428
ttgtgaagct cctaacactg tctggtaaag atggctcccg 40 <210> SEQ ID
NO 429 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 429
atcttccagt acagtgttgg atggtctaat tgtgaagctc 40 <210> SEQ ID
NO 430 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 430
cccataaagt agaaagcact actaacagca ctggagggtg 40 <210> SEQ ID
NO 431 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 431
ctggtcagtt gggagtctga gatgaagcac tgtagctcag 40 <210> SEQ ID
NO 432 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 432
cgatgagaca ctacagtata gatgatgtac tagtccgggc 40 <210> SEQ ID
NO 433 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 433
ccctggctgg gatatcatca tatactgtaa gtttgcgatg 40 <210> SEQ ID
NO 434 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 434
cctcacggtc cagttttccc aggaatccct tagatgctaa 40 <210> SEQ ID
NO 435 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 435
tgagaactga attccatggg ttgtgtcagt gtcagacctc 40 <210> SEQ ID
NO 436 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 436
gactatggaa gccagtgtgt ggaaatgctt ctgctagatt 40 <210> SEQ ID
NO 437 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 437
tgagtatgat agaagtcagt gcactacaga actttgtctc 40 <210> SEQ ID
NO 438 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 438
cgagctctgg ctccgtgtct tcactcccgt gcttgtccga 40 <210> SEQ ID
NO 439 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 439
ctccccatgg ccctgtctcc caacccttgt accagtgctg 40 <210> SEQ ID
NO 440 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 440
gtatgtctca tcccctacta gactgaagct ccttgaggac 40 <210> SEQ ID
NO 441 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 441
actcgggctc tggagcagtc agtgcatgac agaacttggg 40 <210> SEQ ID
NO 442 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 442
ccccggccca ggttctgtga tacactccga ctcgggctct 40 <210> SEQ ID
NO 443 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 443
cagttgcata gtcacaaaag tgatcattgg caggtgtggc 40 <210> SEQ ID
NO 444 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 444
cacagctgcc agtgtcattg tcacaaaagt gatcattggc 40 <210> SEQ ID
NO 445 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 445
gcccagttgc atagtcacaa aagtgatcat tggaaactgt 40 <210> SEQ ID
NO 446 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 446
gtggtacttg aagataggtt atccgtgttg ccttcgcttt 40 <210> SEQ ID
NO 447 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 447
gccttcgctt tatttgtgac gaatcataca cggttgacct 40 <210> SEQ ID
NO 448 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 448
ttaatgctaa tcgtgatagg ggtttttgcc tccaactgac 40 <210> SEQ ID
NO 449 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 449
tcagaggact ccaaggaaca ttcaacgctg tcggtgagtt 40 <210> SEQ ID
NO 450 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 450
gaaaaaacca ctgaccgttg actgtacctt ggggtcctta 40 <210> SEQ ID
NO 451 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 451
tgaggttgct tcagtgaaca ttcaacgctg tcggtgagtt 40 <210> SEQ ID
NO 452 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 452
accatcgacc gttgattgta ccctatggct aaccatcatc 40 <210> SEQ ID
NO 453 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 453
tgccaagggt ttgggggaac attcaacctg tcggtgagtt 40 <210> SEQ ID
NO 454 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 454
atcgaccgtt gagtggaccc tgaggcctgg aattgccatc 40 <210> SEQ ID
NO 455 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 455
aggtaacagg atccggtggt tctagacttg ccaactatgg 40 <210> SEQ ID
NO 456 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 456
ttggcaatgg tagaactcac actggtgagg taacaggatc 40 <210> SEQ ID
NO 457 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 457
gactcctgtt ctgtgtatgg cactggtaga attcactgtg 40 <210> SEQ ID
NO 458 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 458
gtctcagtca gtgaattacc gaagggccat aaacagagca 40 <210> SEQ ID
NO 459 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 459
gactgtaagt gttggacgga gaactgataa gggtaggtga 40 <210> SEQ ID
NO 460 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 460
cgtcccctta tcacttttcc agcccagctt tgtgactgta 40 <210> SEQ ID
NO 461 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 461
gcgagggatt ggagagaaag gcagttcctg atggtcccct 40 <210> SEQ ID
NO 462 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 462
cctccccagg ggctggcttt cctctggtcc ttccctccca 40 <210> SEQ ID
NO 463 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 463
cttgtaactt tccaaagaat tctccttttg ggctttctgg 40 <210> SEQ ID
NO 464 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 464
ctcgtgtctt gtgttgcagc cggagggacg caggtccgca 40 <210> SEQ ID
NO 465 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 465
tcaccatgac acagtgtgag actcgggcta caacacagga 40 <210> SEQ ID
NO 466 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 466
tcacatccct tgcatggtgg agggtgagct ttctgaaaac 40 <210> SEQ ID
NO 467 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 467
gcaggcctct gtgtgatatg tttgatatat taggttgtta 40 <210> SEQ ID
NO 468 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 468
caacggaatc ccaaaagcag ctgttgtctc cagagcattc 40 <210> SEQ ID
NO 469 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 469
tctgacctat gaattgacag ccagtgctct cgtctcccct 40 <210> SEQ ID
NO 470 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 470
ccaattccat aggtcacagg tatgttcgcc tcaatgccag 40 <210> SEQ ID
NO 471 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 471
agatgagggt gtcggatcaa ctggcctaca aagtcccagt 40 <210> SEQ ID
NO 472 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 472
aggatgggag ctgagggctg ggtctttgcg ggcgagatga 40 <210> SEQ ID
NO 473 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 473
tgtaacagca actccatgtg gactgtgtac caatttccag 40 <210> SEQ ID
NO 474 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 474
ccaatttcca gtggagatgc tgttactttt gatggttacc 40 <210> SEQ ID
NO 475 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 475
tctagcagca cagaaatatt ggcacaggga agcgagtctg 40 <210> SEQ ID
NO 476 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 476
ctgctgagtg aattaggtag tttcatgttg ttgggcctgg 40 <210> SEQ ID
NO 477 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 477
acacaacaac attaaaccac ccgattcacg gcagttactg 40 <210> SEQ ID
NO 478 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 478
agaaactgcc tgagttacat cagtcggttt tcgtcgaggg 40 <210> SEQ ID
NO 479 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 479
gctgatctgt ggcttaggta gtttcatgtt gttgggattg 40 <210> SEQ ID
NO 480 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 480
taagagctct tcacccttca ccaccttctc cacccagcat 40 <210> SEQ ID
NO 481 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 481
tcattggtcc agaggggaga taggttcctg tgatttttcc 40 <210> SEQ ID
NO 482 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 482
gccaacccag tgttcagact acctgttcag gaggctctca 40 <210> SEQ ID
NO 483 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 483
tcgccccagt gttcagacta cctgttcagg acaatgccgt 40 <210> SEQ ID
NO 484 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 484
gtctgcacat tggttaggct gggctgggtt agaccctcgg 40 <210> SEQ ID
NO 485 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 485
acctccactc cgtctaccca gtgtttagac tatctgttca 40 <210> SEQ ID
NO 486 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 486
gtctctaata ctgcctggta atgatgacgg cggagccctg 40 <210> SEQ ID
NO 487 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 487
gatctggcct aaagaggtat agggcatggg aagatggagc 40 <210> SEQ ID
NO 488 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 488
gttctgtagc gcaattgtga aatgtttagg accactagac 40 <210> SEQ ID
NO 489 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 489
tgggtccagt ggttcttaac agttcaacag ttctgtagcg 40 <210> SEQ ID
NO 490 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 490
cgtggacttc cctttgtcat cctatgcctg agaatatatg 40 <210> SEQ ID
NO 491 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 491
aggctgggaa ggcaaaggga cgttcaattg tcatcactgg 40 <210> SEQ ID
NO 492 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 492
tccttcattc caccggagtc tgtctcatac ccaaccagat 40 <210> SEQ ID
NO 493 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 493
ttgctatgga atgtaaggaa gtgtgtggtt tcggcaagtg 40 <210> SEQ ID
NO 494 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 494
tgcttcccga ggccacatgc ttctttatat ccccatatgg 40 <210> SEQ ID
NO 495 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 495
acctgatgct cacgtataag acgagcaaaa agcttgttgg 40 <210> SEQ ID
NO 496 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 496
agacccactg tgcgtgtgac agcggctgat ctgtgcctgg 40 <210> SEQ ID
NO 497 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 497
ttccctttgt catccttcgc ctagggctct gagcagggca 40 <210> SEQ ID
NO 498 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 498
gcagggacag caaaggggtg ctcagttgtc acttcccaca 40 <210> SEQ ID
NO 499 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 499
cctcagtaac agtctccagt cacggccacc gacgcctggc 40 <210> SEQ ID
NO 500 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 500
cggacagcgc gccggcacct tggctctaga ctgcttactg 40 <210> SEQ ID
NO 501 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 501
aacattcatt gctgtcggtg ggttgaactg tgtggacaag 40 <210> SEQ ID
NO 502 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 502
tgtggacaag ctcactgaac aatgaatgca actgtggccc 40 <210> SEQ ID
NO 503 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 503
tgtacagcag gcacagacag gcagtcacat gacaacccag 40 <210> SEQ ID
NO 504 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 504
caggaaaatg acctatgaat tgacagacaa tatagctgag 40 <210> SEQ ID
NO 505 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 505
catttcttta ggccaatatt ctgtatgact gtgctacttc 40 <210> SEQ ID
NO 506 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 506
ctgggattat gctaaacaga gcaatttcct agccctcacg 40 <210> SEQ ID
NO 507 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 507
gatggctgtg agttggctta atctcagctg gcaactgtga 40 <210> SEQ ID
NO 508 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 508
gaatcagtca ccatcagttc ctaatgcatt gccttcagca 40 <210> SEQ ID
NO 509 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 509
tgtcgcagat actgcatcag gaactgattg gataagaatc 40 <210> SEQ ID
NO 510 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 510
gttgtgcttg atctaaccat gtggttgcga ggtatgagta 40 <210> SEQ ID
NO 511 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 511
tggtggaacg atggaaacgg aacatggttc tgtcaagcac 40 <210> SEQ ID
NO 512 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 512
tcgctgcggg gctttccttt gtgcttgatc taaccatgtg 40 <210> SEQ ID
NO 513 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 513
attgtccaaa cgcaattctc gagtctatgg ctccggccga 40 <210> SEQ ID
NO 514 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 514
tgtggcattg tagggctcca caccgtatct gacactttgg 40 <210> SEQ ID
NO 515 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 515
caacagctac attgtctgct gggtttcagg ctacctggaa 40 <210> SEQ ID
NO 516 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 516
ctttcgtaat cagcagctac atctggctac tgggtctctg 40 <210> SEQ ID
NO 517 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 517
gctgctggaa ggtgtaggta ccctcaatgg ctcagtagcc 40 <210> SEQ ID
NO 518 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 518
gagtgtcagt ttgtcaaata ccccaagtgc ggcacatgct 40 <210> SEQ ID
NO 519 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 519
ggctttcaag tcactagtgg ttccgtttag tagatgattg 40 <210> SEQ ID
NO 520 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 520
ggccgcagca acctcggttc gtatccgagt cacggcacca 40 <210> SEQ ID
NO 521 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 521
tccggatgga gcgtgggttc gaatcccact tctgacacca 40 <210> SEQ ID
NO 522 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 522
atggtagagc gctcgctttg cttgcgagag gtagcgggat 40 <210> SEQ ID
NO 523 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 523
gatctaaagg tccctggttc gatcccgggt ttcggcacca 40 <210> SEQ ID
NO 524 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 524
agcagagtgg cgcagcggaa gcgtgctggg cccataaccc 40 <210> SEQ ID
NO 525 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 525
aacccagagg tcgatggatc gaaaccatcc tctgctacca 40 <210> SEQ ID
NO 526 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 526
caatcggtta gcgcgttcgg ctgttaaccg aaaggttggt 40 <210> SEQ ID
NO 527 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 527
tctagcgaca gagtggttca attccacctt tcgggcgcca 40 <210> SEQ ID
NO 528 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 528
acgcgaaagg tccccggttc gaaaccgggc ggaaacacca 40 <210> SEQ ID
NO 529 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 529
ctgaggtagt agtttgtaca gtttgagggt ctatgatacc 40 <210> SEQ ID
NO 530 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 530
gctgaggtag tagtttgtgc tgttggtcgg gttgtgacat 40 <210> SEQ ID
NO 531 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 531
attcagtgct atggaatgta aagaagtatg tattttgggt 40 <210> SEQ ID
NO 532 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 532
ctgctaagct atggaatgta aagaagtatg tatttcaggc 40 <210> SEQ ID
NO 533 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 533
atctttggtt atctagctgt atgagtgtat tggtcttcat 40 <210> SEQ ID
NO 534 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 534
gagtgtattg gtcttcataa agctagataa ccgaaagtaa 40 <210> SEQ ID
NO 535 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 535
taccctgtag aaccgaattt gtgtggtacc cacatagtca 40 <210> SEQ ID
NO 536 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 536
ttgagattaa aatcacattg ccagggatta ccacgcaacc 40 <210> SEQ ID
NO 537 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 537
ttggtttccg ctttgttcac agtggctaag ttctgcacct 40 <210> SEQ ID
NO 538 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 538
taaatagtga ttgtctagca ccatttgaaa tcagtgttct 40 <210> SEQ ID
NO 539 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 539
tgtaaacatc ctacactcag ctgtcataca tgcgttggct 40 <210> SEQ ID
NO 540 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 540
tgtaaacatc cttgactgga agctgtaagg tgttgagagg 40 <210> SEQ ID
NO 541 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 541
cataaacccg tagatccgat cttgtggtga agtggaccgc 40 <210> SEQ ID
NO 542 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 542
gccttcgccg cacacaagct cgtgtctgtg ggtccgtgtc 40 <210> SEQ ID
NO 543 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 543
cacccgtaga accgaccttg cggggccttc gccgcacaca 40 <210> SEQ ID
NO 544 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 544
tgccacaaac ccgtagatcc gaacttgtgc tgattctgca 40 <210> SEQ ID
NO 545 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 545
gctgtccatt ctaaaggtac agtactgtga taactgaagg 40 <210> SEQ ID
NO 546 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 546
gtgtccaaac catcaaacgc cattatcaca ctaaatagct 40 <210> SEQ ID
NO 547 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 547
gctgtggagt gtgacaatgg tgtttgtgtc caaaccatca 40 <210> SEQ ID
NO 548 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 548
cattattact tttggtacgc gctgtgacac ttcaaactcg 40 <210> SEQ ID
NO 549 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 549
gacacttcaa actcgtaccg tgagtaataa tgcgcggtca 40 <210> SEQ ID
NO 550 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 550
taatgtctat acaattaagg cacgcggtga atgccaagag 40 <210> SEQ ID
NO 551 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 551
tccctgagac cctttaacct gtgaggacgt ccagggtcac 40 <210> SEQ ID
NO 552 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 552
gcctagtccc tgagacccta acttgtgagg tattttagta 40 <210> SEQ ID
NO 553 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 553
attttagtaa catcacaagt caggttcttg ggacctaggc 40 <210> SEQ ID
NO 554 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 554
ttcagaaaga tcatcggatc cgtctgagct tggctggtcg 40 <210> SEQ ID
NO 555 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 555
aggtttacat ttctcacagt gaaccggtct ctttttcagc 40 <210> SEQ ID
NO 556 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 556
ttggattcgg ggccgtagca ctgtctgaga ggtttacatt 40 <210> SEQ ID
NO 557 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 557
ctttttgcgg tctgggcttg ctgtacataa ctcaatagcc 40 <210> SEQ ID
NO 558 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 558
ctttttgcgg tctgggcttg ctgttttctc gacagtagtc 40 <210> SEQ ID
NO 559 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 559
gtctaacgtg taccgagcag tgcaatgtta aaagggcatc 40 <210> SEQ ID
NO 560 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 560
agtggtgtgg agtcttcata aagctagata accgaaagta 40 <210> SEQ ID
NO 561 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 561
tgtgggaacc ggaggtaaca gtctacagcc atggtcgccc 40 <210> SEQ ID
NO 562 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 562
atcgcctctt caatggattt ggtccccttc aaccagctgt 40 <210> SEQ ID
NO 563 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 563
gcactctgtt caccctgtgg gccacctagt caccaaccct 40 <210> SEQ ID
NO 564 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 564
tgtgtgactg gttgaccaga ggggcgtgca ctctgttcac 40 <210> SEQ ID
NO 565 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 565
ctatggcttt ttattcctat gtgattctat tgctcgctca 40 <210> SEQ ID
NO 566 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 566
gaggactcca tttgttttga tgatggattc ttaagctcca 40 <210> SEQ ID
NO 567 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 567
ggattacgtt gttattgctt aagaatacgc gtagtcgagg 40 <210> SEQ ID
NO 568 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 568
agctggtgtt gtgaatcagg ccgacgagca gcgcatcctc 40 <210> SEQ ID
NO 569 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 569
ttacgtcatg ctgttctacc acagggtaga accacggaca 40 <210> SEQ ID
NO 570 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 570
gaagtatgaa gctcctaaca ctgtctggta aagatggccc 40 <210> SEQ ID
NO 571 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 571
cccataaagt agaaagcact actaacagca ctggagggtg 40 <210> SEQ ID
NO 572 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 572
tggtcagttg ggagtctgag atgaagcact gtagctcagg 40 <210> SEQ ID
NO 573 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 573
gtttgtgatg agacactaca gtatagatga tgtactagtc 40 <210> SEQ ID
NO 574 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 574
acggtccagt tttcccagga atcccttgga tgctaagatg 40 <210> SEQ ID
NO 575 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 575
tgagaactga attccatggg ttatatcaat gtcagacctg 40 <210> SEQ ID
NO 576 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 576
gctctggctc cgtgtcttca ctcccgtgtt tgtccgagga 40 <210> SEQ ID
NO 577 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 577
tgtctcccaa cccttgtacc agtgctgtgc ctcagaccct 40 <210> SEQ ID
NO 578 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 578
tatgtctcct ccctactaga ctgaggctcc ttgagggaca 40 <210> SEQ ID
NO 579 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 579
actcgggctc tggagcagtc agtgcatgac agaacttggg 40 <210> SEQ ID
NO 580 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 580
taatatgagc ccagttgcat agtgacaaaa gtgatcattg 40 <210> SEQ ID
NO 581 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 581
agataggtta tccgtgttgc cttcgcttta ttcgtgacga 40 <210> SEQ ID
NO 582 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 582
ttaatgctaa ttgtgatagg ggttttggcc tctgactgac 40 <210> SEQ ID
NO 583 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 583
ccatggaaca ttcaacgctg tcggtgagtt tgggattcaa 40 <210> SEQ ID
NO 584 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 584
tttggcaatg gtagaactca caccggtaag gtaatgggac 40 <210> SEQ ID
NO 585 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 585
aacagtctca gtcagtgaat taccgaaggg ccataaacag 40 <210> SEQ ID
NO 586 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 586
tatggcactg gtagaattca ctgtgaacag tctcagtcag 40 <210> SEQ ID
NO 587 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 587
tgtgactcta agtgttggac ggagaactga taagggtagg 40 <210> SEQ ID
NO 588 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 588
gggattggag agaaaggcag ttcctgatgg tcccctccca 40 <210> SEQ ID
NO 589 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 589
caaagaattc tccttttggg ctttctcatt ttattttaag 40 <210> SEQ ID
NO 590 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 590
gggcgctgct ctgacccctc gtgtcttgtg ttgcagccgg 40 <210> SEQ ID
NO 591 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 591
tcacatccct tgcatggtgg agggtgagct ctctgaaaac 40 <210> SEQ ID
NO 592 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 592
cggtgcctac tgagctgata tcagttctca tttcacacac 40 <210> SEQ ID
NO 593 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 593
ctgtgtgata tgtttgatat attaggttgt tatttaatcc 40 <210> SEQ ID
NO 594 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 594
caacggaatc ccaaaagcag ctgttgtctc cagagcattc 40 <210> SEQ ID
NO 595 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 595
ctgacctatg aattgacagc cagtgctctc gtctcccctc 40 <210> SEQ ID
NO 596 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 596
tgagagtgtc agttcaactg gcctacaaag tcccagtcct 40 <210> SEQ ID
NO 597 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 597
atcgggtgta acagcaactc catgtggact gtgctcggat 40 <210> SEQ ID
NO 598 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 598
tagcagcaca gaaatattgg catggggaag tgagtctgcc 40 <210> SEQ ID
NO 599 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 599
gtaggtagtt tcatgttgtt gggcctggct ttctgaacac 40 <210> SEQ ID
NO 600 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 600
gaggctggga catgtacagt agtctgcaca ttggttaggc 40 <210> SEQ ID
NO 601 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 601
tagtgtctga tctctaatac tgcctggtaa tgatgacggc 40 <210> SEQ ID
NO 602 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 602
ccgtggccat cttactgggc agcattggat agtgtctgat 40 <210> SEQ ID
NO 603 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 603
taccttactc agtaaggcat tgttcttcta tattaataaa 40 <210> SEQ ID
NO 604 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 604
gatctggtct aaagaggtat agcgcatggg aagatggagc 40 <210> SEQ ID
NO 605 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 605
ggtccagtgg ttcttgacag ttcaacagtt ctgtagcaca 40 <210> SEQ ID
NO 606 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 606
gtagcacaat tgtgaaatgt ttaggaccac tagacccggc 40 <210> SEQ ID
NO 607 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 607
ttccctttgt catcctatgc ctgagaatat atgaaggagg 40 <210> SEQ ID
NO 608 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 608
gtccttcatt ccaccggagt ctgtcttatg ccaaccagat 40 <210> SEQ ID
NO 609 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 609
tagatatctc agcactatgg aatgtaagga agtgtgtggt 40 <210> SEQ ID
NO 610 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 610
gctgcggctt gcgcttctcc tggctctcct ccctctcctt 40 <210> SEQ ID
NO 611 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 611
cttcagtaac agtctccagt cacggccacc gacgcctggc 40 <210> SEQ ID
NO 612 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 612
agcgcgccgg caccttggct ctagactgct tactgcccgg 40 <210> SEQ ID
NO 613 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 613
aacattcatt gctgtcggtg ggttgaactg tgtggacaag 40 <210> SEQ ID
NO 614 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 614
tgtacagcag gcacagacag gcagtcacat gacaacccag 40 <210> SEQ ID
NO 615 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 615
caggagaatg acctatgatt tgacagaccg tgcagctgtg 40 <210> SEQ ID
NO 616 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 616
gagatgtccc tatcattcct cacagtggtc tctgggatta 40 <210> SEQ ID
NO 617 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 617
atggctatga gttggtttaa tctcagctgg caactgtgag 40 <210> SEQ ID
NO 618 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 618
gcagatactg catcaggaac tgactggata agacttaatc 40 <210> SEQ ID
NO 619 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 619
ccccatcagt tcctaatgca ttgccttcag catctaaaca 40 <210> SEQ ID
NO 620 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 620
gggctttcct ttgtgcttga tctaaccatg tggtggaacg 40 <210> SEQ ID
NO 621 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 621
gtggtggaac gatggaaacg gaacatggtt ctgtcaagca 40 <210> SEQ ID
NO 622 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 622
tcctgattgt ccaaacgcaa ttctcgagtc tctggctccg 40 <210> SEQ ID
NO 623 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 623
ctctggctcc ggccgagagt tgcgtctgga cgtcccgagc 40 <210> SEQ ID
NO 624 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 624
caacagctac attgtctgct gggtttcagg ctacctggaa 40 <210> SEQ ID
NO 625 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 625
ggcatacaat gtagatttct gtgtttgtta ggcaacagct 40 <210> SEQ ID
NO 626 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 626
ttggtaatca gcagctacat ctggctactg ggtctctggt 40 <210> SEQ ID
NO 627 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 627
agagtgtcag tttgtcaaat accccaagtg tggctcatgc 40 <210> SEQ ID
NO 628 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 628
taagtcacta gtggttccgt ttagtagatg gtctgtgcat 40 <210> SEQ ID
NO 629 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 629
tgcattgttt caaaatggtg ccctagtgac tacaaagccc 40 <210> SEQ ID
NO 630 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 630
tagactgaag atctaaaggt ccctggttcg atcccgggtt 40 <210> SEQ ID
NO 631 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 631
aatctgaagg tcgtgagttc gatcctcaca cggggcacca 40 <210> SEQ ID
NO 632 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 632
agcagagtgg cgcagcggaa gcgtgctggg cccataaccc 40 <210> SEQ ID
NO 633 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 633
cccataaccc agaggtcgat ggatcgaaac catcctctgc 40 <210> SEQ ID
NO 634 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 634
tgcgttgtgg ccgcagcaac ctcggttcga atccgagtca 40 <210> SEQ ID
NO 635 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 635
gctcgttggt ctaggggtat gattctcgct ttgggtgcga 40 <210> SEQ ID
NO 636 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 636
agctgtttag cgacagagtg gttcaattcc acctttcggg 40 <210> SEQ ID
NO 637 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 637
ttccgtagtg tagtggttat cacgctcgcc tgacacgcga 40 <210> SEQ ID
NO 638 <211> LENGTH: 32 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: 25, 26, 27, 28, 29,
30, 31, 32 <223> OTHER INFORMATION: n = A,T,C or G
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 638 aaaaaaaaaa aaaaaaaaaa aaaannnnnn nn
32 <210> SEQ ID NO 639 <211> LENGTH: 11 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
4, 5, 6, 7, 8, 9, 10, 11 <223> OTHER INFORMATION: n = A,T,C
or G <220> FEATURE: <223> OTHER INFORMATION:
oligonucleotide probe <400> SEQUENCE: 639 aaannnnnnn n 11
<210> SEQ ID NO 640 <211> LENGTH: 46 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: 39, 40,
41, 42, 43, 44, 45, 46 <223> OTHER INFORMATION: n = A,T,C or
G <220> FEATURE: <223> OTHER INFORMATION:
oligonucleotide probe <400> SEQUENCE: 640 gccagtgaat
tgtaatacga ctcactatag ggaggcggnn nnnnnn 46 <210> SEQ ID NO
641 <211> LENGTH: 99 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 641 gtcagcagtg
ccttagcagc acgtaaatat tggcgttaag attctaaaat tatctccagt 60
attaactgtg ctgctgaagt aaggttgacc atactctac 99 <210> SEQ ID NO
642 <211> LENGTH: 99 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 642 gtcagcagtg
ccttagcagc acgtaaatat tggcgttaag attctaaaat tatctccagt 60
attaactgtg ctgctgaagt aaggttgacc atactttac 99 <210> SEQ ID NO
643 <211> LENGTH: 94 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 643 cctgttgcca
caaacccgta gatccgaact tgtggtatta gtccgcacaa gcttgtatct 60
ataggtatgt gtctgttagg caatctcacg gacc 94 <210> SEQ ID NO 644
<211> LENGTH: 94 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 644 cctgttgcca caaacccgta
gatccgaact tgtggtatta gtccgcacaa gcttgtatct 60 ataggtatgt
gtctgttagg caatctcaca gacc 94 <210> SEQ ID NO 645 <211>
LENGTH: 150 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 645 acctctctaa caaggtgcag agcttagctg
attggtgaac agtgattggt ttccgctttg 60 ttcacagtgg ctaagttctg
cacctgaaga gaaggtgaga tggggacagt taagttggag 120 ccgctggggc
agaggccgtt gctgacgggc 150 <210> SEQ ID NO 646 <211>
LENGTH: 150 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 646 acctctctaa caaggtgcag agcttagctg
attggtgaac agtgattggt ttccgctttg 60 ttcacagtgg ctaagttctg
cacctgaaga gaaggtgaga tggggacagt taagttggag 120 ccgctggggc
agaggccgtt gctgacaggc 150 <210> SEQ ID NO 647 <211>
LENGTH: 86 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 647 tgcttcccga ggccacatgc ttctttatat
ccccatatgg attactttgc tatggaatgt 60 aaggaagtgt gtggtttcgg caagtg 86
<210> SEQ ID NO 648 <211> LENGTH: 97 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 648
gtgctcggtt tgtaggcagt gtcattagct gattgtactg tggtggttac aatcactaac
60 tccactgcca tcaaaacaag gcacagcatc accgccg 97 <210> SEQ ID
NO 649 <400> SEQUENCE: 649 000 <210> SEQ ID NO 650
<211> LENGTH: 97 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 650 gtgctcggtt tgtaggcagt
gtcattagct gattgtactg tggtggttac aatcactaac 60 tccactgcca
tcaaaacaag gcacagcatc accaccg 97 <210> SEQ ID NO 651
<211> LENGTH: 294 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 651 cttctggaag ctggtttcac
atggtggctt agatttttcc atctttgtat ctagcaccat 60 ttgaaatcag
tgttttagga gtaagaattg cagcacagcc aagggtggac tgcagaggaa 120
ctgctgctca tggaactggc tcctctcctc ttgccacttg agtctgttcg agaagtccag
180 ggaagaactt gaagagcaaa atacactctt gagtttgttg ggttttggga
gaggtgacag 240 tagagaaggg ggttgtgttt aaaataaaca cagtggcttg
agcaggggca gagg 294 <210> SEQ ID NO 652 <211> LENGTH:
294 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 652 cttctggaag ctggtttcac atggtggctt
agatttttcc atctttgtat ctagcaccat 60 ttgaaatcag tgttttagga
gtaagaattg cagcacagcc aagggtggac tgcagaggaa 120 ctgctgctca
tggaactggc tcctctcctc ttgccacttg agtctgttcg agaagtccag 180
ggaagaactt gaagagcaaa atacactctt gagtttgttg ggttttggga gaggtgacag
240 tagagaaggg ggttgtgttt aaaataaaca cagtggcttg agcaggggca gaag 294
<210> SEQ ID NO 653 <211> LENGTH: 295 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 653
cttctggaag ctggtttcac atggtggctt agatttttcc atctttgtat ctagcaccat
60 ttgaaatcag tgttttagga gtaagaattg cagcacagcc aagggtggac
tgcagaggaa 120 ctgctgctca tggaactggc tcctctcctc ttgccacttg
agtctgttcg agaagtccag 180 ggaagaaact tgaagagcaa aatacactct
tgagtttgtt gggttttggg agaggtgaca 240 gtagagaagg gggttgtgtt
taaaataaac acagtggctt gagcaggggc agagg 295 <210> SEQ ID NO
654 <211> LENGTH: 183 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 654 ggtcgggctc
accatgacac agtgtgagac ctcgggctac aacacaggac ccgggcgctg 60
ctctgacccc tcgtgtcttg tgttgcagcc ggagggacgc aggtccgcag cagagcctgc
120 tccgcttgtc ctgagggact cgacacaggg gactgcacag agaccatggg
aaagtccagg 180 ctc 183 <210> SEQ ID NO 655 <211>
LENGTH: 183 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 655 ggtcgggctc accatgacac agtgtgagac
ctcgggctac aacacaggac ccgggcgctg 60 ctctgacccc tcgtgtcttg
tgttgcagcc ggagggacgc aggtccgcag cagagcctgc 120 tccgcttgtc
ctgagggact cgacacaggg gactgcacag agaccatggg aaagtccagg 180 ccc 183
<210> SEQ ID NO 656 <211> LENGTH: 183 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 656
ggtcgggctc accatgacac agtgtgagac tcgagctaca acacaggacc cggggcgctg
60 ctctgacccc tcgtgtcttg tgttgcagcc ggagggacgc aggtccgcag
cagagcctgc 120 tccgcttgtc ctgagggact cgacacaggg gactgcacag
agaccatggg aaagtccagg 180 ctc 183 <210> SEQ ID NO 657
<211> LENGTH: 203 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 657 gatttaggat gagttgagat
cccagtgatc ttctcgctaa gagtttcctg cctgggcaag 60 gaggaaagat
gctacaagtg gcccacttct gagatgcggg ctgcttctgg atgacactgc 120
ttcccgaggc cacatgcttc tttatatccc catatggatt actttgctat ggaatgtaag
180 gaagtgtgtg gtttcggcaa gtg 203 <210> SEQ ID NO 658
<211> LENGTH: 203 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 658 gatttaggat gagttgagat
cccagtgatc ttctcgctaa gagtttcctg cctgggcaag 60 gaggaaagat
gctacaagtg gcccacttct gagatgcggg ctgcttctgg atgacactgc 120
ttcccgaggc cacatgcttc tttatatccc catatggatt acttttctat ggaatgtaag
180 gaagtgtgtg gtttcggcaa gtg 203 <210> SEQ ID NO 659
<211> LENGTH: 203 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 659 gttttaggat gagttgagat
cccagtgatc ttctcgctaa gagtttcctg cctgggcaag 60 gaggaaagat
gctacaagtg gcccacttct gagatgcggg ctgcttctgg atgacactgc 120
ttcccgaggc cacatgcttc tttatatccc catatggatt acttttctat ggaatgtaag
180 gaagtgtgtg gtttcggcaa gtg 203 <210> SEQ ID NO 660
<211> LENGTH: 120 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 660 cgaggtgcag accctgggag
caccactggc ccatctctta cacaggctga ccgatttctc 60 ctggtgttca
gagtctgttt ttgtctagca ccatttgaaa tcggttatga tgtaggggga 120
<210> SEQ ID NO 661 <211> LENGTH: 120 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 661
caaggtgcag accctgggag caccactggc ccatctctta cacaggctga ccgatttctc
60 ctggtgttca gagtctgttt ttgtctagca ccatttgaaa tcggttatga
tgtaggggga 120 <210> SEQ ID NO 662 <211> LENGTH: 85
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 662 ccttagcaga gctgtggagt gtgacaatgg
tgtttgtgtc taaactatca aacgccatta 60 tcacactaaa tagctactgc taggc 85
<210> SEQ ID NO 663 <211> LENGTH: 85 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 663
ccttagcaga gctgtggagt gtgacaatgg tgtttgtgtc taaactatca aatgccatta
60 tcacactaaa tagctactgc taggc 85 <210> SEQ ID NO 664
<211> LENGTH: 81 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 664 cttcaggaag ctggtttcat
atggtggttt agatttaaat agtgattgtc tagcaccatt 60 tgaaatcagt
gttcttgggg g 81
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 664
<210> SEQ ID NO 1 <211> LENGTH: 90 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 1
cactgtggga tgaggtagta ggttgtatag ttttagggtc acacccacca ctgggagata
60 actatacaat ctactgtctt tcctaacgtg 90 <210> SEQ ID NO 2
<211> LENGTH: 72 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 2 aggttgaggt agtaggttgt
atagtttaga attacatcaa gggagataac tgtacagcct 60 cctagctttc ct 72
<210> SEQ ID NO 3 <211> LENGTH: 74 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 3
gggtgaggta gtaggttgta tagtttgggg ctctgccctg ctatgggata actatacaat
60 ctactgtctt tcct 74 <210> SEQ ID NO 4 <211> LENGTH:
107 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 4 gtgactgcat gctcccaggt tgaggtagta ggttgtatag
tttagaatta cacaagggag 60 ataactgtac agcctcctag ctttccttgg
gtcttgcact aaacaac 107 <210> SEQ ID NO 5 <211> LENGTH:
85 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 5 ggcggggtga ggtagtaggt tgtgtggttt cagggcagtg
atgttgcccc tcggaagata 60 actatacaac ctactgcctt ccctg 85 <210>
SEQ ID NO 6 <211> LENGTH: 84 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 6
gcatccgggt tgaggtagta ggttgtatgg tttagagtta caccctggga gttaactgta
60 caaccttcta gctttccttg gagc 84 <210> SEQ ID NO 7
<211> LENGTH: 87 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 7 cctaggaaga ggtagtaggt
tgcatagttt tagggcaggg attttgccca caaggaggta 60 actatacgac
ctgctgcctt tcttagg 87 <210> SEQ ID NO 8 <211> LENGTH:
85 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 8 ctaggaagag gtagtagttt gcatagtttt agggcaaaga
ttttgcccac aagtagttag 60 ctatacgacc tgcagccttt tgtag 85 <210>
SEQ ID NO 9 <211> LENGTH: 85 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 9
ctggctgagg tagtagtttg tgctgttggt cgggttgtga cattgcccgc tgtggagata
60 actgcgcaag ctactgcctt gctag 85 <210> SEQ ID NO 10
<211> LENGTH: 79 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 10 cccgggctga ggtaggaggt
tgtatagttg aggaggacac ccaaggagat cactatacgg 60 cctcctagct ttccccagg
79 <210> SEQ ID NO 11 <211> LENGTH: 87 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
11 tcagagtgag gtagtagatt gtatagttgt ggggtagtga ttttaccctg
ttcaggagat 60 aactatacaa tctattgcct tccctga 87 <210> SEQ ID
NO 12 <211> LENGTH: 89 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 12 ctgtgggatg
aggtagtaga ttgtatagtt gtggggtagt gattttaccc tgttcaggag 60
ataactatac aatctattgc cttccctga 89 <210> SEQ ID NO 13
<211> LENGTH: 85 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 13 ctgtgggatg aggtagtaga
ttgtatagtt ttagggtcat accccatctt ggagataact 60 atacagtcta
ctgtctttcc cacgg 85 <210> SEQ ID NO 14 <211> LENGTH:
108 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 14 ttgcctgatt ccaggctgag gtagtagttt
gtacagtttg agggtctatg ataccacccg 60 gtacaggaga taactgtaca
ggccactgcc ttgccaggaa cagcgcgc 108 <210> SEQ ID NO 15
<211> LENGTH: 85 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 15 ctggctgagg tagtagtttg
tgctgttggt cgggttgtga cattgcccgc tgtggagata 60 actgcgcaag
ctactgcctt gctag 85 <210> SEQ ID NO 16 <211> LENGTH: 85
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 16 acctactcag agtacatact tctttatgta
cccatatgaa catacaatgc tatggaatgt 60 aaagaagtat gtatttttgg taggc 85
<210> SEQ ID NO 17 <211> LENGTH: 108 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 17
cagctaacaa cttagtaata cctactcaga gtacatactt ctttatgtac ccatatgaac
60 atacaatgct atggaatgta aagaagtatg tatttttggt aggcaata 108
<210> SEQ ID NO 18 <211> LENGTH: 85 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 18
gcctgcttgg gaaacatact tctttatatg cccatatgga cctgctaagc tatggaatgt
60 aaagaagtat gtatctcagg ccggg 85 <210> SEQ ID NO 19
<211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 19 tgggaaacat acttctttat
atgcccatat ggacctgcta agctatggaa tgtaaagaag 60 tatgtatctc a 71
<210> SEQ ID NO 20 <211> LENGTH: 85 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 20
acctactcag agtacatact tctttatgta cccatatgaa catacaatgc tatggaatgt
60 aaagaagtat gtatttttgg taggc 85 <210> SEQ ID NO 21
<211> LENGTH: 108 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens
<400> SEQUENCE: 21 tggatgttgg cctagttctg tgtggaagac
tagtgatttt gttgttttta gataactaaa 60 tcgacaacaa atcacagtct
gccatatggc acaggccatg cctctaca 108 <210> SEQ ID NO 22
<211> LENGTH: 110 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 22 ttggatgttg gcctagttct
gtgtggaaga ctagtgattt tgttgttttt agataactaa 60 atcgacaaca
aatcacagtc tgccatatgg cacaggccat gcctctacag 110 <210> SEQ ID
NO 23 <211> LENGTH: 110 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 23 ctggatacag
agtggaccgg ctggccccat ctggaagact agtgattttg ttgttgtctt 60
actgcgctca acaacaaatc ccagtctacc taatggtgcc agccatcgca 110
<210> SEQ ID NO 24 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 24
ctggatacag agtggaccgg ctggccccat ctggaagact agtgattttg ttgttgtctt
60 actgcgctca acaacaaatc ccagtctacc taatggtgcc agccatcgca 110
<210> SEQ ID NO 25 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 25
agattagagt ggctgtggtc tagtgctgtg tggaagacta gtgattttgt tgttctgatg
60 tactacgaca acaagtcaca gccggcctca tagcgcagac tcccttcgac 110
<210> SEQ ID NO 26 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 26
agattagagt ggctgtggtc tagtgctgtg tggaagacta gtgattttgt tgttctgatg
60 tactacgaca acaagtcaca gccggcctca tagcgcagac tcccttcgac 110
<210> SEQ ID NO 27 <211> LENGTH: 89 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 27
cggggttggt tgttatcttt ggttatctag ctgtatgagt ggtgtggagt cttcataaag
60 ctagataacc gaaagtaaaa ataacccca 89 <210> SEQ ID NO 28
<211> LENGTH: 87 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 28 ggaagcgagt tgttatcttt
ggttatctag ctgtatgagt gtattggtct tcataaagct 60 agataaccga
aagtaaaaac tccttca 87 <210> SEQ ID NO 29 <211> LENGTH:
90 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 29 ggaggcccgt ttctctcttt ggttatctag
ctgtatgagt gccacagagc cgtcataaag 60 ctagataacc gaaagtagaa
atgattctca 90 <210> SEQ ID NO 30 <211> LENGTH: 110
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 30 gatctgtctg tcttctgtat ataccctgta
gatccgaatt tgtgtaagga attttgtggt 60 cacaaattcg tatctagggg
aatatgtagt tgacataaac actccgctct 110 <210> SEQ ID NO 31
<211> LENGTH: 110 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 31 ccagaggttg taacgttgtc
tatatatacc ctgtagaacc gaatttgtgt ggtatccgta 60 tagtcacaga
ttcgattcta ggggaatata tggtcgatgc aaaaacttca 110 <210> SEQ ID
NO 32 <211> LENGTH: 108 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 32 gcgcgaatgt
gtgtttaaaa aaaataaaac cttggagtaa agtagcagca cataatggtt 60
tgtggatttt gaaaaggtgc aggccatatt gtgctgcctc aaaaatac 108
<210> SEQ ID NO 33 <211> LENGTH: 83 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 33
ccttggagta aagtagcagc acataatggt ttgtggattt tgaaaaggtg caggccatat
60 tgtgctgcct caaaaataca agg 83 <210> SEQ ID NO 34
<211> LENGTH: 64 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 34 ctgtagcagc acatcatggt
ttacatgcta cagtcaagat gcgaatcatt atttgctgct 60 ctag 64 <210>
SEQ ID NO 35 <211> LENGTH: 98 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 35
ttgaggcctt aaagtactgt agcagcacat catggtttac atgctacagt caagatgcga
60 atcattattt gctgctctag aaatttaagg aaattcat 98 <210> SEQ ID
NO 36 <211> LENGTH: 89 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 36 gtcagcagtg
ccttagcagc acgtaaatat tggcgttaag attctaaaat tatctccagt 60
attaactgtg ctgctgaagt aaggttgac 89 <210> SEQ ID NO 37
<211> LENGTH: 81 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 37 gttccactct agcagcacgt
aaatattggc gtagtgaaat atatattaaa caccaatatt 60 actgtgctgc
tttagtgtga c 81 <210> SEQ ID NO 38 <211> LENGTH: 81
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 38 gcagtgcctt agcagcacgt aaatattggc
gttaagattc taaaattatc tccagtatta 60 actgtgctgc tgaagtaagg t 81
<210> SEQ ID NO 39 <211> LENGTH: 84 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 39
gtcagaataa tgtcaaagtg cttacagtgc aggtagtgat atgtgcatct actgcagtga
60 aggcacttgt agcattatgg tgac 84 <210> SEQ ID NO 40
<211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 40 tgttctaagg tgcatctagt
gcagatagtg aagtagatta gcatctactg ccctaagtgc 60 tccttctggc a 71
<210> SEQ ID NO 41 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 41
tttttgttct aaggtgcatc tagtgcagat agtgaagtag attagcatct actgccctaa
60 gtgctccttc tggcataaga a 81 <210> SEQ ID NO 42 <211>
LENGTH: 82 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 42
gcagtcctct gttagttttg catagttgca ctacaagaag aatgtagttg tgcaaatcta
60 tgcaaaactg atggtggcct gc 82 <210> SEQ ID NO 43 <211>
LENGTH: 80 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 43 cagtcctctg ttagttttgc atagttgcac
tacaagaaga atgtagttgt gcaaatctat 60 gcaaaactga tggtggcctg 80
<210> SEQ ID NO 44 <211> LENGTH: 87 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 44
cactgttcta tggttagttt tgcaggtttg catccagctg tgtgatattc tgctgtgcaa
60 atccatgcaa aactgactgt ggtagtg 87 <210> SEQ ID NO 45
<211> LENGTH: 96 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 45 acattgctac ttacaattag
ttttgcaggt ttgcatttca gcgtatatat gtatatgtgg 60 ctgtgcaaat
ccatgcaaaa ctgattgtga taatgt 96 <210> SEQ ID NO 46
<211> LENGTH: 80 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 46 ttctatggtt agttttgcag
gtttgcatcc agctgtgtga tattctgctg tgcaaatcca 60 tgcaaaactg
actgtggtag 80 <210> SEQ ID NO 47 <211> LENGTH: 81
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 47 ttacaattag ttttgcaggt ttgcatttca
gcgtatatat gtatatgtgg ctgtgcaaat 60 ccatgcaaaa ctgattgtga t 81
<210> SEQ ID NO 48 <211> LENGTH: 71 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 48
gtagcactaa agtgcttata gtgcaggtag tgtttagtta tctactgcat tatgagcact
60 taaagtactg c 71 <210> SEQ ID NO 49 <211> LENGTH: 72
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 49 tgtcgggtag cttatcagac tgatgttgac
tgttgaatct catggcaaca ccagtcgatg 60 ggctgtctga ca 72 <210>
SEQ ID NO 50 <211> LENGTH: 81 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 50
accttgtcgg gtagcttatc agactgatgt tgactgttga atctcatggc aacaccagtc
60 gatgggctgt ctgacatttt g 81 <210> SEQ ID NO 51 <211>
LENGTH: 85 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 51 ggctgagccg cagtagttct tcagtggcaa
gctttatgtc ctgacccagc taaagctgcc 60 agttgaagaa ctgttgccct ctgcc 85
<210> SEQ ID NO 52 <211> LENGTH: 73 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 52
ggccggctgg ggttcctggg gatgggattt gcttcctgtc acaaatcaca ttgccaggga
60 tttccaaccg acc 73 <210> SEQ ID NO 53 <211> LENGTH:
97 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 53 ctcaggtgct ctggctgctt gggttcctgg
catgctgatt tgtgacttaa gattaaaatc 60 acattgccag ggattaccac
gcaaccacga ccttggc 97 <210> SEQ ID NO 54 <211> LENGTH:
81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 54 ccacggccgg ctggggttcc tggggatggg
atttgcttcc tgtcacaaat cacattgcca 60 gggatttcca accgaccctg a 81
<210> SEQ ID NO 55 <211> LENGTH: 68 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 55
ctccggtgcc tactgagctg atatcagttc tcattttaca cactggctca gttcagcagg
60 aacaggag 68 <210> SEQ ID NO 56 <211> LENGTH: 73
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 56 ctctgcctcc cgtgcctact gagctgaaac
acagttggtt tgtgtacact ggctcagttc 60 agcaggaaca ggg 73 <210>
SEQ ID NO 57 <211> LENGTH: 81 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 57
ccctgggctc tgcctcccgt gcctactgag ctgaaacaca gttggtttgt gtacactggc
60 tcagttcagc aggaacaggg g 81 <210> SEQ ID NO 58 <211>
LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 58 ccctccggtg cctactgagc tgatatcagt
tctcatttta cacactggct cagttcagca 60 ggaacagcat c 71 <210> SEQ
ID NO 59 <211> LENGTH: 84 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 59 ggccagtgtt
gagaggcgga gacttgggca attgctggac gctgccctgg gcattgcact 60
tgtctcggtc tgacagtgcc ggcc 84 <210> SEQ ID NO 60 <211>
LENGTH: 86 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 60 aggccgtggc ctcgttcaag taatccagga
taggctgtgc aggtcccaat ggcctatctt 60 ggttacttgc acggggacgc gggcct 86
<210> SEQ ID NO 61 <211> LENGTH: 77 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 61
ccgggaccca gttcaagtaa ttcaggatag gttgtgtgct gtccagcctg ttctccatta
60 cttggctcgg ggaccgg 77 <210> SEQ ID NO 62 <211>
LENGTH: 78 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 62 ctgaggagca gggcttagct gcttgtgagc
agggtccaca ccaagtcgtg ttcacagtgg 60 ctaagttccg ccccccag 78
<210> SEQ ID NO 63 <211> LENGTH: 73
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 63 aggtgcagag cttagctgat tggtgaacag
tgattggttt ccgctttgtt cacagtggct 60 aagttctgca cct 73 <210>
SEQ ID NO 64 <211> LENGTH: 97 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 64
acctctctaa caaggtgcag agcttagctg attggtgaac agtgattggt ttccgctttg
60 ttcacagtgg ctaagttctg cacctgaaga gaaggtg 97 <210> SEQ ID
NO 65 <211> LENGTH: 80 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 65 cctgaggagc
agggcttagc tgcttgtgag cagggtccac accaagtcgt gttcacagtg 60
gctaagttcc gccccccagg 80 <210> SEQ ID NO 66 <211>
LENGTH: 86 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 66 ggtccttgcc ctcaaggagc tcacagtcta
ttgagttacc tttctgactt tcccactaga 60 ttgtgagctc ctggagggca ggcact 86
<210> SEQ ID NO 67 <211> LENGTH: 108 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 67
ccttctgtga ccccttagag gatgactgat ttcttttggt gttcagagtc aatataattt
60 tctagcacca tctgaaatcg gttataatga ttggggaaga gcaccatg 108
<210> SEQ ID NO 68 <211> LENGTH: 64 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 68
atgactgatt tcttttggtg ttcagagtca atataatttt ctagcaccat ctgaaatcgg
60 ttat 64 <210> SEQ ID NO 69 <211> LENGTH: 110
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 69 accactggcc catctcttac acaggctgac
cgatttctcc tggtgttcag agtctgtttt 60 tgtctagcac catttgaaat
cggttatgat gtagggggaa aagcagcagc 110 <210> SEQ ID NO 70
<211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 70 gcgactgtaa acatcctcga
ctggaagctg tgaagccaca gatgggcttt cagtcggatg 60 tttgcagctg c 71
<210> SEQ ID NO 71 <211> LENGTH: 60 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 71
atgtaaacat cctacactca gctgtaatac atggattggc tgggaggtgg atgtttacgt
60 <210> SEQ ID NO 72 <211> LENGTH: 88 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
72 accaagtttc agttcatgta aacatcctac actcagctgt aatacatgga
ttggctggga 60 ggtggatgtt tacttcagct gacttgga 88 <210> SEQ ID
NO 73 <211> LENGTH: 72 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 73 agatactgta
aacatcctac actctcagct gtggaaagta agaaagctgg gagaaggctg 60
tttactcttt ct 72 <210> SEQ ID NO 74 <211> LENGTH: 70
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 74 gttgttgtaa acatccccga ctggaagctg
taagacacag ctaagctttc agtcagatgt 60 ttgctgctac 70 <210> SEQ
ID NO 75 <211> LENGTH: 71 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 75 ggagaggagg
caagatgctg gcatagctgt tgaactggga acctgctatg ccaacatatt 60
gccatctttc c 71 <210> SEQ ID NO 76 <211> LENGTH: 70
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 76 ggagatattg cacattacta agttgcatgt
tgtcacggcc tcaatgcaat ttagtgtgtg 60 tgatattttc 70 <210> SEQ
ID NO 77 <211> LENGTH: 110 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 77 gggggccgag
agaggcgggc ggccccgcgg tgcattgctg ttgcattgca cgtgtgtgag 60
gcgggtgcag tgcctcggca gtgcagcccg gagccggccc ctggcaccac 110
<210> SEQ ID NO 78 <211> LENGTH: 69 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 78
ctgtggtgca ttgtagttgc attgcatgtt ctggtggtac ccatgcaatg tttccacagt
60 gcatcacag 69 <210> SEQ ID NO 79 <211> LENGTH: 110
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 79 ggccagctgt gagtgtttct ttggcagtgt
cttagctggt tgttgtgagc aatagtaagg 60 aagcaatcag caagtatact
gccctagaag tgctgcacgt tgtggggccc 110 <210> SEQ ID NO 80
<211> LENGTH: 82 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 80 tcagaataat gtcaaagtgc
ttacagtgca ggtagtgata tgtgcatcta ctgcagtgaa 60 ggcacttgta
gcattatggt ga 82 <210> SEQ ID NO 81 <211> LENGTH: 78
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 81 ctttctacac aggttgggat cggttgcaat
gctgtgtttc tgtatggtat tgcacttgtc 60 ccggcctgtt gagtttgg 78
<210> SEQ ID NO 82 <211> LENGTH: 75 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 82
tcatccctgg gtggggattt gttgcattac ttgtgttcta tataaagtat tgcacttgtc
60 ccggcctgtg gaaga 75 <210> SEQ ID NO 83 <211> LENGTH:
80 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 83 ctgggggctc caaagtgctg ttcgtgcagg
tagtgtgatt acccaaccta ctgctgagct 60 agcacttccc gagcccccgg 80
<210> SEQ ID NO 84 <211> LENGTH: 80 <212> TYPE:
DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 84
ctgggggctc caaagtgctg ttcgtgcagg tagtgtgatt acccaaccta ctgctgagct
60 agcacttccc gagcccccgg 80 <210> SEQ ID NO 85 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 85 aacacagtgg gcactcaata aatgtctgtt
gaattgaaat gcgttacatt caacgggtat 60 ttattgagca cccactctgt g 81
<210> SEQ ID NO 86 <211> LENGTH: 78 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 86
tggccgattt tggcactagc acatttttgc ttgtgtctct ccgctctgag caatcatgtg
60 cagtgccaat atgggaaa 78 <210> SEQ ID NO 87 <211>
LENGTH: 80 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 87 gtgaggtagt aagttgtatt gttgtggggt
agggatatta ggccccaatt agaagataac 60 tatacaactt actactttcc 80
<210> SEQ ID NO 88 <211> LENGTH: 70 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 88
ggcacccacc cgtagaaccg accttgcggg gccttcgccg cacacaagct cgtgtctgtg
60 ggtccgtgtc 70 <210> SEQ ID NO 89 <211> LENGTH: 81
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 89 cccattggca taaacccgta gatccgatct
tgtggtgaag tggaccgcac aagctcgctt 60 ctatgggtct gtgtcagtgt g 81
<210> SEQ ID NO 90 <211> LENGTH: 108 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 90
aagagagaag atattgaggc ctgttgccac aaacccgtag atccgaactt gtggtattag
60 tccgcacaag cttgtatcta taggtatgtg tctgttaggc aatctcac 108
<210> SEQ ID NO 91 <211> LENGTH: 80 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 91
cctgttgcca caaacccgta gatccgaact tgtggtatta gtccgcacaa gcttgtatct
60 ataggtatgt gtctgttagg 80 <210> SEQ ID NO 92 <211>
LENGTH: 110 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 92 aggctgccct ggctcagtta tcacagtgct
gatgctgtct attctaaagg tacagtactg 60 tgataactga aggatggcag
ccatcttacc ttccatcaga ggagcctcac 110 <210> SEQ ID NO 93
<211> LENGTH: 57 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 93 tcagttatca cagtgctgat
gctgtccatt ctaaaggtac agtactgtga taactga 57 <210> SEQ ID NO
94 <211> LENGTH: 75 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 94 tgccctggct
cagttatcac agtgctgatg ctgtctattc taaaggtaca gtactgtgat 60
aactgaagga tggca 75 <210> SEQ ID NO 95 <211> LENGTH: 75
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 95 tgtccttttt cggttatcat ggtaccgatg
ctgtatatct gaaaggtaca gtactgtgat 60 aactgaagaa tggtg 75 <210>
SEQ ID NO 96 <211> LENGTH: 81 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 96
cttctggaag ctggtttcac atggtggctt agatttttcc atctttgtat ctagcaccat
60 ttgaaatcag tgttttagga g 81 <210> SEQ ID NO 97 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 97 cttcaggaag ctggtttcat atggtggttt
agatttaaat agtgattgtc tagcaccatt 60 tgaaatcagt gttcttgggg g 81
<210> SEQ ID NO 98 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 98
cttcaggaag ctggtttcat atggtggttt agatttaaat agtgattgtc tagcaccatt
60 tgaaatcagt gttcttgggg g 81 <210> SEQ ID NO 99 <211>
LENGTH: 78 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 99 ttgtgctttc agcttcttta cagtgctgcc
ttgtagcatt caggtcaagc aacattgtac 60 agggctatga aagaacca 78
<210> SEQ ID NO 100 <211> LENGTH: 78 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 100
ttgtgctttc agcttcttta cagtgctgcc ttgtagcatt caggtcaagc aacattgtac
60 agggctatga aagaacca 78 <210> SEQ ID NO 101 <211>
LENGTH: 78 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 101 tactgccctc ggcttcttta cagtgctgcc
ttgttgcata tggatcaagc agcattgtac 60 agggctatga aggcattg 78
<210> SEQ ID NO 102 <211> LENGTH: 78 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 102
aaatgtcaga cagcccatcg actggtgttg ccatgagatt caacagtcaa catcagtctg
60 ataagctacc cgacaagg 78 <210> SEQ ID NO 103 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 103 tgtgcatcgt ggtcaaatgc tcagactcct
gtggtggctg ctcatgcacc acggatgttt 60 gagcatgtgc tacggtgtct a 81
<210> SEQ ID NO 104 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 104
tgtgcatcgt ggtcaaatgc tcagactcct gtggtggctg ctcatgcacc acggatgttt
60 gagcatgtgc tacggtgtct a 81 <210> SEQ ID NO 105 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens
<400> SEQUENCE: 105 ccttggccat gtaaaagtgc ttacagtgca
ggtagctttt tgagatctac tgcaatgtaa 60 gcacttctta cattaccatg g 81
<210> SEQ ID NO 106 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 106
ctctctgctt tcagcttctt tacagtgttg ccttgtggca tggagttcaa gcagcattgt
60 acagggctat caaagcacag a 81 <210> SEQ ID NO 107 <211>
LENGTH: 85 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 107 ccttagcaga gctgtggagt gtgacaatgg
tgtttgtgtc taaactatca aacgccatta 60 tcacactaaa tagctactgc taggc 85
<210> SEQ ID NO 108 <211> LENGTH: 66 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 108
agctgtggag tgtgacaatg gtgtttgtgt ccaaactatc aaacgccatt atcacactaa
60 atagct 66 <210> SEQ ID NO 109 <211> LENGTH: 61
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 109 acattattac ttttggtacg cgctgtgaca
cttcaaactc gtaccgtgag taataatgcg 60 c 61 <210> SEQ ID NO 110
<211> LENGTH: 100 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 110 tccttcctca ggagaaaggc
ctctctctcc gtgttcacag cggaccttga tttaaatgtc 60 catacaatta
aggcacgcgg tgaatgccaa gaatggggct 100 <210> SEQ ID NO 111
<211> LENGTH: 85 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 111 aggcctctct ctccgtgttc
acagcggacc ttgatttaaa tgtccataca attaaggcac 60 gcggtgaatg
ccaagaatgg ggctg 85 <210> SEQ ID NO 112 <211> LENGTH:
110 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 112 atcaagatta gaggctctgc tctccgtgtt
cacagcggac cttgatttaa tgtcatacaa 60 ttaaggcacg cggtgaatgc
caagagcgga gcctacggct gcacttgaag 110 <210> SEQ ID NO 113
<211> LENGTH: 110 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 113 cccgccccag ccctgagggc
ccctctgcgt gttcacagcg gaccttgatt taatgtctat 60 acaattaagg
cacgcggtga atgccaagag aggcgcctcc gccgctcctt 110 <210> SEQ ID
NO 114 <211> LENGTH: 87 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 114 tgagggcccc
tctgcgtgtt cacagcggac cttgatttaa tgtctataca attaaggcac 60
gcggtgaatg ccaagagagg cgcctcc 87 <210> SEQ ID NO 115
<211> LENGTH: 68 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 115 ctctgcgtgt tcacagcgga
ccttgattta atgtctatac aattaaggca cgcggtgaat 60 gccaagag 68
<210> SEQ ID NO 116 <211> LENGTH: 67 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 116
ctctccgtgt tcacagcgga ccttgattta atgtcataca attaaggcac gcggtgaatg
60 ccaagag 67 <210> SEQ ID NO 117 <211> LENGTH: 86
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 117 tgccagtctc taggtccctg agacccttta
acctgtgagg acatccaggg tcacaggtga 60 ggttcttggg agcctggcgt ctggcc 86
<210> SEQ ID NO 118 <211> LENGTH: 65 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 118
ggtccctgag accctttaac ctgtgaggac atccagggtc acaggtgagg ttcttgggag
60 cctgg 65 <210> SEQ ID NO 119 <211> LENGTH: 108
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 119 acattgttgc gctcctctca gtccctgaga
ccctaacttg tgatgtttac cgtttaaatc 60 cacgggttag gctcttggga
gctgcgagtc gtgcttttgc atcctgga 108 <210> SEQ ID NO 120
<211> LENGTH: 88 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 120 tgcgctcctc tcagtccctg
agaccctaac ttgtgatgtt taccgtttaa atccacgggt 60 taggctcttg
ggagctgcga gtcgtgct 88 <210> SEQ ID NO 121 <211>
LENGTH: 89 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 121 accagacttt tcctagtccc tgagacccta
acttgtgagg tattttagta acatcacaag 60 tcaggctctt gggacctagg cggagggga
89 <210> SEQ ID NO 122 <211> LENGTH: 70 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
122 cctagtccct gagaccctaa cttgtgaggt attttagtaa catcacaagt
caggctcttg 60 ggacctaggc 70 <210> SEQ ID NO 123 <211>
LENGTH: 85 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 123 cgctggcgac gggacattat tacttttggt
acgcgctgtg acacttcaaa ctcgtaccgt 60 gagtaataat gcgccgtcca cggca 85
<210> SEQ ID NO 124 <211> LENGTH: 61 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 124
acattattac ttttggtacg cgctgtgaca cttcaaactc gtaccgtgag taataatgcg
60 c 61 <210> SEQ ID NO 125 <211> LENGTH: 97
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 125 tgtgatcact gtctccagcc tgctgaagct
cagagggctc tgattcagaa agatcatcgg 60 atccgtctga gcttggctgg
tcggaagtct catcatc 97 <210> SEQ ID NO 126 <211> LENGTH:
70 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 126
ccagcctgct gaagctcaga gggctctgat tcagaaagat catcggatcc gtctgagctt
60 ggctggtcgg 70 <210> SEQ ID NO 127 <211> LENGTH: 82
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 127 tgagctgttg gattcggggc cgtagcactg
tctgagaggt ttacatttct cacagtgaac 60 cggtctcttt ttcagctgct tc 82
<210> SEQ ID NO 128 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 128
gcccggcagc cactgtgcag tgggaagggg ggccgataca ctgtacgaga gtgagtagca
60 ggtctcacag tgaaccggtc tctttcccta ctgtgtcaca ctcctaatgg 110
<210> SEQ ID NO 129 <211> LENGTH: 70 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 129
gttggattcg gggccgtagc actgtctgag aggtttacat ttctcacagt gaaccggtct
60 ctttttcagc 70 <210> SEQ ID NO 130 <211> LENGTH: 74
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 130 tggatctttt tgcggtctgg gcttgctgtt
cctctcaaca gtagtcagga agcccttacc 60 ccaaaaagta tcta 74 <210>
SEQ ID NO 131 <211> LENGTH: 89 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 131
tgctgctggc cagagctctt ttcacattgt gctactgtct gcacctgtca ctagcagtgc
60 aatgttaaaa gggcattggc cgtgtagtg 89 <210> SEQ ID NO 132
<211> LENGTH: 110 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 132 gccaggaggc ggggttggtt
gttatctttg gttatctagc tgtatgagtg gtgtggagtc 60 ttcataaagc
tagataaccg aaagtaaaaa taaccccata cactgcgcag 110 <210> SEQ ID
NO 133 <211> LENGTH: 110 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 133 cacggcgcgg
cagcggcact ggctaaggga ggcccgtttc tctctttggt tatctagctg 60
tatgagtgcc acagagccgt cataaagcta gataaccgaa agtagaaatg 110
<210> SEQ ID NO 134 <211> LENGTH: 72 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 134
gttgttatct ttggttatct agctgtatga gtgtattggt cttcataaag ctagataacc
60 gaaagtaaaa ac 72 <210> SEQ ID NO 135 <211> LENGTH:
101 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 135 ccgcccccgc gtctccaggg caaccgtggc
tttcgattgt tactgtggga actggaggta 60 acagtctaca gccatggtcg
ccccgcagca cgcccacgcg c 101 <210> SEQ ID NO 136 <211>
LENGTH: 66 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 136 gggcaaccgt ggctttcgat tgttactgtg
ggaactggag gtaacagtct acagccatgg 60 tcgccc 66 <210> SEQ ID NO
137 <211> LENGTH: 88 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 137 acaatgcttt
gctagagctg gtaaaatgga accaaatcgc ctcttcaatg gatttggtcc 60
ccttcaacca gctgtagcta tgcattga 88 <210> SEQ ID NO 138
<211> LENGTH: 102 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 138 gggagccaaa tgctttgcta
gagctggtaa aatggaacca aatcgactgt ccaatggatt 60 tggtcccctt
caaccagctg tagctgtgca ttgatggcgc cg 102 <210> SEQ ID NO 139
<211> LENGTH: 68 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 139 gctagagctg gtaaaatgga
accaaatcgc ctcttcaatg gatttggtcc ccttcaacca 60 gctgtagc 68
<210> SEQ ID NO 140 <211> LENGTH: 73 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 140
cagggtgtgt gactggttga ccagaggggc atgcactgtg ttcaccctgt gggccaccta
60 gtcaccaacc ctc 73 <210> SEQ ID NO 141 <211> LENGTH:
71 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 141 agggtgtgtg actggttgac cagaggggca
tgcactgtgt tcaccctgtg ggccacctag 60 tcaccaaccc t 71 <210> SEQ
ID NO 142 <211> LENGTH: 90 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 142 aggcctcgct
gttctctatg gctttttatt cctatgtgat tctactgctc actcatatag 60
ggattggagc cgtggcgcac ggcggggaca 90 <210> SEQ ID NO 143
<211> LENGTH: 100 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 143 agataaattc actctagtgc
tttatggctt tttattccta tgtgatagta ataaagtctc 60 atgtagggat
ggaagccatg aaatacattg tgaaaaatca 100 <210> SEQ ID NO 144
<211> LENGTH: 60 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 144 ctatggcttt ttattcctat
gtgattctac tgctcactca tatagggatt ggagccgtgg 60 <210> SEQ ID
NO 145 <211> LENGTH: 82 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 145 tgagccctcg
gaggactcca tttgttttga tgatggattc ttatgctcca tcatcgtctc 60
aaatgagtct tcagagggtt ct 82 <210> SEQ ID NO 146 <211>
LENGTH: 62 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 146 gaggactcca tttgttttga tgatggattc
ttatgctcca tcatcgtctc aaatgagtct 60 tc 62 <210> SEQ ID NO 147
<211> LENGTH: 73 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens
<400> SEQUENCE: 147 cttcggtgac gggtattctt gggtggataa
tacggattac gttgttattg cttaagaata 60 cgcgtagtcg agg 73 <210>
SEQ ID NO 148 <211> LENGTH: 99 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 148
ccctggcatg gtgtggtggg gcagctggtg ttgtgaatca ggccgttgcc aatcagagaa
60 cggctacttc acaacaccag ggccacacca cactacagg 99 <210> SEQ ID
NO 149 <211> LENGTH: 84 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 149 cgttgctgca
gctggtgttg tgaatcaggc cgacgagcag cgcatcctct tacccggcta 60
tttcacgaca ccagggttgc atca 84 <210> SEQ ID NO 150 <211>
LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 150 cagctggtgt tgtgaatcag gccgacgagc
agcgcatcct cttacccggc tatttcacga 60 caccagggtt g 71 <210> SEQ
ID NO 151 <211> LENGTH: 68 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 151 gtgtattcta
cagtgcacgt gtctccagtg tggctcggag gctggagacg cggccctgtt 60 ggagtaac
68 <210> SEQ ID NO 152 <211> LENGTH: 100 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
152 tgtgtctctc tctgtgtcct gccagtggtt ttaccctatg gtaggttacg
tcatgctgtt 60 ctaccacagg gtagaaccac ggacaggata ccggggcacc 100
<210> SEQ ID NO 153 <211> LENGTH: 72 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 153
tcctgccagt ggttttaccc tatggtaggt tacgtcatgc tgttctacca cagggtagaa
60 ccacggacag ga 72 <210> SEQ ID NO 154 <211> LENGTH:
70 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 154 cctgccagtg gttttaccct atggtaggtt
acgtcatgct gttctaccac agggtagaac 60 cacggacagg 70 <210> SEQ
ID NO 155 <211> LENGTH: 95 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 155 cggccggccc
tgggtccatc ttccagtaca gtgttggatg gtctaattgt gaagctccta 60
acactgtctg gtaaagatgg ctcccgggtg ggttc 95 <210> SEQ ID NO 156
<211> LENGTH: 72 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 156 gggtccatct tccagtacag
tgttggatgg tctaattgtg aagctcctaa cactgtctgg 60 taaagatggc cc 72
<210> SEQ ID NO 157 <211> LENGTH: 64 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 157
acccataaag tagaaagcac tactaacagc actggagggt gtagtgtttc ctactttatg
60 gatg 64 <210> SEQ ID NO 158 <211> LENGTH: 87
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 158 gacagtgcag tcacccataa agtagaaagc
actactaaca gcactggagg gtgtagtgtt 60 tcctacttta tggatgagtg tactgtg
87 <210> SEQ ID NO 159 <211> LENGTH: 64 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
159 acccataaag tagaaagcac tactaacagc actggagggt gtagtgtttc
ctactttatg 60 gatg 64 <210> SEQ ID NO 160 <211> LENGTH:
106 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 160 gcgcagcgcc ctgtctccca gcctgaggtg
cagtgctgca tctctggtca gttgggagtc 60 tgagatgaag cactgtagct
caggaagaga gaagttgttc tgcagc 106 <210> SEQ ID NO 161
<211> LENGTH: 63 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 161 cctgaggtgc agtgctgcat
ctctggtcag ttgggagtct gagatgaagc actgtagctc 60 agg 63 <210>
SEQ ID NO 162 <211> LENGTH: 86 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 162
tggggccctg gctgggatat catcatatac tgtaagtttg cgatgagaca ctacagtata
60 gatgatgtac tagtccgggc accccc 86 <210> SEQ ID NO 163
<211> LENGTH: 66 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 163 ggctgggata tcatcatata
ctgtaagttt gcgatgagac actacagtat agatgatgta 60 ctagtc 66
<210> SEQ ID NO 164 <211> LENGTH: 88 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 164
caccttgtcc tcacggtcca gttttcccag gaatccctta gatgctaaga tggggattcc
60 tggaaatact gttcttgagg tcatggtt 88 <210> SEQ ID NO 165
<211> LENGTH: 70 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 165 ctcacggtcc agttttccca
ggaatccctt agatgctaag atggggattc ctggaaatac 60 tgttcttgag 70
<210> SEQ ID NO 166 <211> LENGTH: 99 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 166
ccgatgtgta tcctcagctt tgagaactga attccatggg ttgtgtcagt gtcagacctc
60 tgaaattcag ttcttcagct gggatatctc tgtcatcgt 99 <210> SEQ ID
NO 167 <211> LENGTH: 65 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 167 agctttgaga
actgaattcc atgggttgtg tcagtgtcag acctgtgaaa ttcagttctt 60 cagct 65
<210> SEQ ID NO 168 <211> LENGTH: 72 <212> TYPE:
DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 168
aatctaaaga caacatttct gcacacacac cagactatgg aagccagtgt gtggaaatgc
60 ttctgctaga tt 72 <210> SEQ ID NO 169 <211> LENGTH:
68 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 169 gaggcaaagt tctgagacac tccgactctg
agtatgatag aagtcagtgc actacagaac 60 tttgtctc 68 <210> SEQ ID
NO 170 <211> LENGTH: 89 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 170 gccggcgccc
gagctctggc tccgtgtctt cactcccgtg cttgtccgag gagggaggga 60
gggacggggg ctgtgctggg gcagctgga 89 <210> SEQ ID NO 171
<211> LENGTH: 53 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 171 gctctggctc cgtgtcttca
ctcccgtgct tgtccgagga gggagggagg gac 53 <210> SEQ ID NO 172
<211> LENGTH: 84 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 172 ctccccatgg ccctgtctcc
caacccttgt accagtgctg ggctcagacc ctggtacagg 60 cctgggggac
agggacctgg ggac 84 <210> SEQ ID NO 173 <211> LENGTH: 64
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 173 ccctgtctcc caacccttgt accagtgctg
ggctcagacc ctggtacagg cctgggggac 60 aggg 64 <210> SEQ ID NO
174 <211> LENGTH: 69 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 174 cctgccctcg
aggagctcac agtctagtat gtctcatccc ctactagact gaagctcctt 60 gaggacagg
69 <210> SEQ ID NO 175 <211> LENGTH: 87 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
175 tgtccccccc ggcccaggtt ctgtgataca ctccgactcg ggctctggag
cagtcagtgc 60 atgacagaac ttgggcccgg aaggacc 87 <210> SEQ ID
NO 176 <211> LENGTH: 71 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 176 ggcccaggtt
ctgtgataca ctccgactcg ggctctggag cagtcagtgc atgacagaac 60
ttgggccccg g 71 <210> SEQ ID NO 177 <211> LENGTH: 90
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 177 ctcacagctg ccagtgtcat ttttgtgatc
tgcagctagt attctcactc cagttgcata 60 gtcacaaaag tgatcattgg
caggtgtggc 90 <210> SEQ ID NO 178 <211> LENGTH: 71
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 178 tctctctctc cctcacagct gccagtgtca
ttgtcacaaa agtgatcatt ggcaggtgtg 60 gctgctgcat g 71 <210> SEQ
ID NO 179 <211> LENGTH: 87 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 179 agcggtggcc
agtgtcattt ttgtgatgtt gcagctagta atatgagccc agttgcatag 60
tcacaaaagt gatcattgga aactgtg 87 <210> SEQ ID NO 180
<211> LENGTH: 69 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 180 cagtgtcatt tttgtgatgt
tgcagctagt aatatgagcc cagttgcata gtcacaaaag 60 tgatcattg 69
<210> SEQ ID NO 181 <211> LENGTH: 84 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 181
gtggtacttg aagataggtt atccgtgttg ccttcgcttt atttgtgacg aatcatacac
60 ggttgaccta tttttcagta ccaa 84 <210> SEQ ID NO 182
<211> LENGTH: 66 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 182 gaagataggt tatccgtgtt
gccttcgctt tatttgtgac gaatcataca cggttgacct 60 attttt 66
<210> SEQ ID NO 183 <211> LENGTH: 65 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 183
ctgttaatgc taatcgtgat aggggttttt gcctccaact gactcctaca tattagcatt
60 aacag 65 <210> SEQ ID NO 184 <211> LENGTH: 108
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 184 caatgtcagc agtgccttag cagcacgtaa
atattggcgt taagattcta aaattatctc 60 cagtattaac tgtgctgctg
aagtaaggtt gaccatactc tacagttg 108 <210> SEQ ID NO 185
<211> LENGTH: 110 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 185 agaagggcta tcaggccagc
cttcagagga ctccaaggaa cattcaacgc tgtcggtgag 60 tttgggattt
gaaaaaacca ctgaccgttg actgtacctt ggggtcctta 110 <210> SEQ ID
NO 186 <211> LENGTH: 110 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 186 tgagttttga
ggttgcttca gtgaacattc aacgctgtcg gtgagtttgg aattaaaatc 60
aaaaccatcg accgttgatt gtaccctatg gctaaccatc atctactcca 110
<210> SEQ ID NO 187 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 187
cggaaaattt gccaagggtt tgggggaaca ttcaacctgt cggtgagttt gggcagctca
60 ggcaaaccat cgaccgttga gtggaccctg aggcctggaa ttgccatcct 110
<210> SEQ ID NO 188 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 188
gagctgcttg cctccccccg tttttggcaa tggtagaact cacactggtg aggtaacagg
60 atccggtggt tctagacttg ccaactatgg ggcgaggact cagccggcac 110
<210> SEQ ID NO 189 <211> LENGTH: 70 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 189 tttttggcaa tggtagaact cacactggtg
aggtaacagg atccggtggt tctagacttg 60 ccaactatgg 70 <210> SEQ
ID NO 190 <211> LENGTH: 110 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 190 ccgcagagtg
tgactcctgt tctgtgtatg gcactggtag aattcactgt gaacagtctc 60
agtcagtgaa ttaccgaagg gccataaaca gagcagagac agatccacga 110
<210> SEQ ID NO 191 <211> LENGTH: 84 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 191
ccagtcacgt ccccttatca cttttccagc ccagctttgt gactgtaagt gttggacgga
60 gaactgataa gggtaggtga ttga 84 <210> SEQ ID NO 192
<211> LENGTH: 65 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 192 ccttatcact tttccagccc
agctttgtga ctgtaagtgt tggacggaga actgataagg 60 gtagg 65 <210>
SEQ ID NO 193 <211> LENGTH: 82 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 193
agggggcgag ggattggaga gaaaggcagt tcctgatggt cccctcccca ggggctggct
60 ttcctctggt ccttccctcc ca 82 <210> SEQ ID NO 194
<211> LENGTH: 66 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 194 agggattgga gagaaaggca
gttcctgatg gtcccctccc caggggctgg ctttcctctg 60 gtcctt 66
<210> SEQ ID NO 195 <211> LENGTH: 86 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 195
tgcttgtaac tttccaaaga attctccttt tgggctttct ggttttattt taagcccaaa
60 ggtgaatttt ttgggaagtt tgagct 86 <210> SEQ ID NO 196
<211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 196 actttccaaa gaattctcct
tttgggcttt ctggttttat tttaagccca aaggtgaatt 60 ttttgggaag t 71
<210> SEQ ID NO 197 <211> LENGTH: 109 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 197
ggtcgggctc accatgacac agtgtgagac tcgggctaca acacaggacc cggggcgctg
60 ctctgacccc tcgtgtcttg tgttgcagcc ggagggacgc aggtccgca 109
<210> SEQ ID NO 198 <211> LENGTH: 86 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 198
tgctccctct ctcacatccc ttgcatggtg gagggtgagc tttctgaaaa cccctcccac
60 atgcagggtt tgcaggatgg cgagcc 86 <210> SEQ ID NO 199
<211> LENGTH: 68 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 199 tctcacatcc cttgcatggt
ggagggtgag ctttctgaaa acccctccca catgcagggt 60 ttgcagga 68
<210> SEQ ID NO 200 <211> LENGTH: 102 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 200
ctgtcgattg gacccgccct ccggtgccta ctgagctgat atcagttctc attttacaca
60 ctggctcagt tcagcaggaa caggagtcga gcccttgagc aa 102 <210>
SEQ ID NO 201 <211> LENGTH: 68 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 201
ctccggtgcc tactgagctg atatcagttc tcattttaca cactggctca gttcagcagg
60 aacaggag 68 <210> SEQ ID NO 202 <211> LENGTH: 85
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 202 tgcaggcctc tgtgtgatat gtttgatata
ttaggttgtt atttaatcca actatatatc 60 aaacatattc ctacagtgtc ttgcc 85
<210> SEQ ID NO 203 <211> LENGTH: 67 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 203
ctgtgtgata tgtttgatat attaggttgt tatttaatcc aactatatat caaacatatt
60 cctacag 67 <210> SEQ ID NO 204 <211> LENGTH: 92
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 204 cggctggaca gcgggcaacg gaatcccaaa
agcagctgtt gtctccagag cattccagct 60 gcgcttggat ttcgtcccct
gctctcctgc ct 92 <210> SEQ ID NO 205 <211> LENGTH: 74
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 205 agcgggcaac ggaatcccaa aagcagctgt
tgtctccaga gcattccagc tgcgcttgga 60 tttcgtcccc tgct 74 <210>
SEQ ID NO 206 <211> LENGTH: 108 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 206
ccgagaccga gtgcacaggg ctctgaccta tgaattgaca gccagtgctc tcgtctcccc
60 tctggctgcc aattccatag gtcacaggta tgttcgcctc aatgccag 108
<210> SEQ ID NO 207 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 207
gccgagaccg agtgcacagg gctctgacct atgaattgac agccagtgct ctcgtctccc
60 ctctggctgc caattccata ggtcacaggt atgttcgcct caatgccagc 110
<210> SEQ ID NO 208 <211> LENGTH: 88 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 208
cgaggatggg agctgagggc tgggtctttg cgggcgagat gagggtgtcg gatcaactgg
60 cctacaaagt cccagttctc ggcccccg 88 <210> SEQ ID NO 209
<211> LENGTH: 58 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 209 gctgggtctt tgcgggcgag
atgagggtgt cggatcaact ggcctacaaa gtcccagt 58 <210> SEQ ID NO
210 <211> LENGTH: 85 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens
<400> SEQUENCE: 210 atggtgttat caagtgtaac agcaactcca
tgtggactgt gtaccaattt ccagtggaga 60 tgctgttact tttgatggtt accaa 85
<210> SEQ ID NO 211 <211> LENGTH: 63 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 211
gtgtaacagc aactccatgt ggactgtgta ccaatttcca gtggagatgc tgttactttt
60 gat 63 <210> SEQ ID NO 212 <211> LENGTH: 87
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 212 agcttccctg gctctagcag cacagaaata
ttggcacagg gaagcgagtc tgccaatatt 60 ggctgtgctg ctccaggcag ggtggtg
87 <210> SEQ ID NO 213 <211> LENGTH: 58 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
213 tagcagcaca gaaatattgg cacagggaag cgagtctgcc aatattggct gtgctgct
58 <210> SEQ ID NO 214 <211> LENGTH: 110 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
214 ctagagcttg aattggaact gctgagtgaa ttaggtagtt tcatgttgtt
gggcctgggt 60 ttctgaacac aacaacatta aaccacccga ttcacggcag
ttactgctcc 110 <210> SEQ ID NO 215 <211> LENGTH: 70
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 215 gtgaattagg tagtttcatg ttgttgggcc
tgggtttctg aacacaacaa cattaaacca 60 cccgattcac 70 <210> SEQ
ID NO 216 <211> LENGTH: 110 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 216 tgctcgctca
gctgatctgt ggcttaggta gtttcatgtt gttgggattg agttttgaac 60
tcggcaacaa gaaactgcct gagttacatc agtcggtttt cgtcgagggc 110
<210> SEQ ID NO 217 <211> LENGTH: 70 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 217
gtgaattagg tagtttcatg ttgttgggcc tgggtttctg aacacaacaa cattaaacca
60 cccgattcac 70 <210> SEQ ID NO 218 <211> LENGTH: 75
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 218 ggctgtgccg ggtagagagg gcagtgggag
gtaagagctc ttcacccttc accaccttct 60 ccacccagca tggcc 75 <210>
SEQ ID NO 219 <211> LENGTH: 62 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 219
tcattggtcc agaggggaga taggttcctg tgatttttcc ttcttctcta tagaataaat
60 ga 62 <210> SEQ ID NO 220 <211> LENGTH: 71
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 220 gccaacccag tgttcagact acctgttcag
gaggctctca atgtgtacag tagtctgcac 60 attggttagg c 71 <210> SEQ
ID NO 221 <211> LENGTH: 110 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 221 aggaagcttc
tggagatcct gctccgtcgc cccagtgttc agactacctg ttcaggacaa 60
tgccgttgta cagtagtctg cacattggtt agactgggca agggagagca 110
<210> SEQ ID NO 222 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 222
ccagaggaca cctccactcc gtctacccag tgtttagact atctgttcag gactcccaaa
60 ttgtacagta gtctgcacat tggttaggct gggctgggtt agaccctcgg 110
<210> SEQ ID NO 223 <211> LENGTH: 71 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 223
gccaacccag tgttcagact acctgttcag gaggctctca atgtgtacag tagtctgcac
60 attggttagg c 71 <210> SEQ ID NO 224 <211> LENGTH: 70
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 224 gccgtggcca tcttactggg cagcattgga
tggagtcagg tctctaatac tgcctggtaa 60 tgatgacggc 70 <210> SEQ
ID NO 225 <211> LENGTH: 95 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 225 ccagctcggg
cagccgtggc catcttactg ggcagcattg gatggagtca ggtctctaat 60
actgcctggt aatgatgacg gcggagccct gcacg 95 <210> SEQ ID NO 226
<211> LENGTH: 72 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 226 gttccttttt cctatgcata
tacttctttg aggatctggc ctaaagaggt atagggcatg 60 ggaagatgga gc 72
<210> SEQ ID NO 227 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 227
gtgttgggga ctcgcgcgct gggtccagtg gttcttaaca gttcaacagt tctgtagcgc
60 aattgtgaaa tgtttaggac cactagaccc ggcgggcgcg gcgacagcga 110
<210> SEQ ID NO 228 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 228
ggctacagtc tttcttcatg tgactcgtgg acttcccttt gtcatcctat gcctgagaat
60 atatgaagga ggctgggaag gcaaagggac gttcaattgt catcactggc 110
<210> SEQ ID NO 229 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 229
aaagatcctc agacaatcca tgtgcttctc ttgtccttca ttccaccgga gtctgtctca
60 tacccaacca gatttcagtg gagtgaagtt caggaggcat ggagctgaca 110
<210> SEQ ID NO 230 <211> LENGTH: 86 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 230
tgcttcccga ggccacatgc ttctttatat ccccatatgg attactttgc tatggaatgt
60 aaggaagtgt gtggtttcgg caagtg 86 <210> SEQ ID NO 231
<211> LENGTH: 69 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 231
aggccacatg cttctttata tccccatatg gattactttg ctatggaatg taaggaagtg
60 tgtggtttt 69 <210> SEQ ID NO 232 <211> LENGTH: 71
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 232 tgacgggcga gcttttggcc cgggttatac
ctgatgctca cgtataagac gagcaaaaag 60 cttgttggtc a 71 <210> SEQ
ID NO 233 <211> LENGTH: 110 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 233 acccggcagt
gcctccaggc gcagggcagc ccctgcccac cgcacactgc gctgccccag 60
acccactgtg cgtgtgacag cggctgatct gtgcctgggc agcgcgaccc 110
<210> SEQ ID NO 234 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 234
tcacctggcc atgtgacttg tgggcttccc tttgtcatcc ttcgcctagg gctctgagca
60 gggcagggac agcaaagggg tgctcagttg tcacttccca cagcacggag 110
<210> SEQ ID NO 235 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 235
cggggcaccc cgcccggaca gcgcgccggc accttggctc tagactgctt actgcccggg
60 ccgccctcag taacagtctc cagtcacggc caccgacgcc tggccccgcc 110
<210> SEQ ID NO 236 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 236
cctgtgcaga gattattttt taaaaggtca caatcaacat tcattgctgt cggtgggttg
60 aactgtgtgg acaagctcac tgaacaatga atgcaactgt ggccccgctt 110
<210> SEQ ID NO 237 <211> LENGTH: 108 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 237
gagttttgag gttgcttcag tgaacattca acgctgtcgg tgagtttgga attaaaatca
60 aaaccatcga ccgttgattg taccctatgg ctaaccatca tctactcc 108
<210> SEQ ID NO 238 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 238
ggcctggctg gacagagttg tcatgtgtct gcctgtctac acttgctgtg cagaacatcc
60 gctcacctgt acagcaggca cagacaggca gtcacatgac aacccagcct 110
<210> SEQ ID NO 239 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 239
atcattcaga aatggtatac aggaaaatga cctatgaatt gacagacaat atagctgagt
60 ttgtctgtca tttctttagg ccaatattct gtatgactgt gctacttcaa 110
<210> SEQ ID NO 240 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 240
gatggctgtg agttggctta atctcagctg gcaactgtga gatgttcata caatccctca
60 cagtggtctc tgggattatg ctaaacagag caatttccta gccctcacga 110
<210> SEQ ID NO 241 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 241
agtataatta ttacatagtt tttgatgtcg cagatactgc atcaggaact gattggataa
60 gaatcagtca ccatcagttc ctaatgcatt gccttcagca tctaaacaag 110
<210> SEQ ID NO 242 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 242
gtgataatgt agcgagattt tctgttgtgc ttgatctaac catgtggttg cgaggtatga
60 gtaaaacatg gttccgtcaa gcaccatgga acgtcacgca gctttctaca 110
<210> SEQ ID NO 243 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 243
gaccagtcgc tgcggggctt tcctttgtgc ttgatctaac catgtggtgg aacgatggaa
60 acggaacatg gttctgtcaa gcaccgcgga aagcaccgtg ctctcctgca 110
<210> SEQ ID NO 244 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 244
ccgccccggg ccgcggctcc tgattgtcca aacgcaattc tcgagtctat ggctccggcc
60 gagagttgag tctggacgtc ccgagccgcc gcccccaaac ctcgagcggg 110
<210> SEQ ID NO 245 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 245
gacagtgtgg cattgtaggg ctccacaccg tatctgacac tttgggcgag ggcaccatgc
60 tgaaggtgtt catgatgcgg tctgggaact cctcacggat cttactgatg 110
<210> SEQ ID NO 246 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 246
tgaacatcca ggtctggggc atgaacctgg catacaatgt agatttctgt gttcgttagg
60 caacagctac attgtctgct gggtttcagg ctacctggaa acatgttctc 110
<210> SEQ ID NO 247 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 247
gctgctggaa ggtgtaggta ccctcaatgg ctcagtagcc agtgtagatc ctgtctttcg
60 taatcagcag ctacatctgg ctactgggtc tctgatggca tcttctagct 110
<210> SEQ ID NO 248 <211> LENGTH: 110 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 248
cctggcctcc tgcagtgcca cgctccgtgt atttgacaag ctgagttgga cactccatgt
60 ggtagagtgt cagtttgtca aataccccaa gtgcggcaca tgcttaccag 110
<210> SEQ ID NO 249 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 249
gggctttcaa gtcactagtg gttccgttta gtagatgatt gtgcattgtt tcaaaatggt
60 gccctagtga ctacaaagcc c 81 <210> SEQ ID NO 250 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 250 cttctggaag ctggtttcac atggtggctt
agatttttcc atctttgtat ctagcaccat 60 ttgaaatcag tgttttagga g 81
<210> SEQ ID NO 251 <211> LENGTH: 81 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 251
cttcaggaag ctggtttcat atggtggttt agatttaaat agtgattgtc tagcaccatt
60 tgaaatcagt gttcttgggg g 81 <210> SEQ ID NO 252 <211>
LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens
<400> SEQUENCE: 252 cttcaggaag ctggtttcat atggtggttt
agatttaaat agtgattgtc tagcaccatt 60 tgaaatcagt gttcttgggg g 81
<210> SEQ ID NO 253 <211> LENGTH: 80 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 253
gtgagcgact gtaaacatcc tcgactggaa gctgtgaagc cacagatggg ctttcagtcg
60 gatgtttgca gctgcctact 80 <210> SEQ ID NO 254 <211>
LENGTH: 88 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 254 accaagtttc agttcatgta aacatcctac
actcagctgt aatacatgga ttggctggga 60 ggtggatgtt tacttcagct gacttgga
88 <210> SEQ ID NO 255 <211> LENGTH: 75 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
255 tgccctggct cagttatcac agtgctgatg ctgtctattc taaaggtaca
gtactgtgat 60 aactgaagga tggca 75 <210> SEQ ID NO 256
<211> LENGTH: 90 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 256 acactgcaag aacaataagg
atttttaggg gcattatgac tgagtcagaa aacacagctg 60 cccctgaaag
tccctcattt ttcttgctgt 90 <210> SEQ ID NO 257 <211>
LENGTH: 80 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 257 actgcaagag caataaggat ttttaggggc
attatgatag tggaatggaa acacatctgc 60 ccccaaaagt ccctcatttt 80
<210> SEQ ID NO 258 <211> LENGTH: 85 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 258
cgctggcgac gggacattat tacttttggt acgcgctgtg acacttcaaa ctcgtaccgt
60 gagtaataat gcgccgtcca cggca 85 <210> SEQ ID NO 259
<211> LENGTH: 61 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 259 acattattac ttttggtacg
cgctgtgaca cttcaaactc gtaccgtgag taataatgcg 60 c 61 <210> SEQ
ID NO 260 <211> LENGTH: 74 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 260 tggatctttt
tgcggtctgg gcttgctgtt cctctcaaca gtagtcagga agcccttacc 60
ccaaaaagta tcta 74 <210> SEQ ID NO 261 <211> LENGTH: 90
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 261 tgcccttcgc gaatcttttt gcggtctggg
cttgctgtac ataactcaat agccggaagc 60 ccttacccca aaaagcattt
gcggagggcg 90 <210> SEQ ID NO 262 <211> LENGTH: 80
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 262 gccccctgct ctggctggtc aaacggaacc
aagtccgtct tcctgagagg tttggtcccc 60 ttcaaccagc tacagcaggg 80
<210> SEQ ID NO 263 <211> LENGTH: 100 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 263
agataaattc actctagtgc tttatggctt tttattccta tgtgatagta ataaagtctc
60 atgtagggat ggaagccatg aaatacattg tgaaaaatca 100 <210> SEQ
ID NO 264 <211> LENGTH: 70 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 264 aagcacgatt
agcatttgag gtgaagttct gttatacact caggctgtgg ctctctgaaa 60
gtcagtgcat 70 <210> SEQ ID NO 265 <211> LENGTH: 69
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 265 cctgtcctca aggagcttca gtctagtagg
ggatgagaca tactagactg tgagctcctc 60 gagggcagg 69 <210> SEQ ID
NO 266 <211> LENGTH: 65 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 266 ctgttaatgc
taatcgtgat aggggttttt gcctccaact gactcctaca tattagcatt 60 aacag 65
<210> SEQ ID NO 267 <211> LENGTH: 82 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 267
cctaacactg tctggtaaag atggctcccg ggtgggttct ctcggcagta accttcaggg
60 agccctgaag accatggagg ac 82 <210> SEQ ID NO 268
<211> LENGTH: 110 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 268 gccgagaccg agtgcacagg
gctctgacct atgaattgac agccagtgct ctcgtctccc 60 ctctggctgc
caattccata ggtcacaggt atgttcgcct caatgccagc 110 <210> SEQ ID
NO 269 <211> LENGTH: 80 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 269 tcccgccccc
tgtaacagca actccatgtg gaagtgccca ctggttccag tggggctgct 60
gttatctggg gcgagggcca 80 <210> SEQ ID NO 270 <211>
LENGTH: 70 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 270 aaagctgggt tgagagggcg aaaaaggatg
aggtgactgg tctgggctac gctatgctgc 60 ggcgctcggg 70 <210> SEQ
ID NO 271 <211> LENGTH: 64 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 271 cattggcctc
ctaagccagg gattgtgggt tcgagtccca cccggggtaa agaaaggccg 60 aatt 64
<210> SEQ ID NO 272 <211> LENGTH: 70 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 272
cctaagccag ggattgtggg ttcgagtccc acctggggta gaggtgaaag ttccttttac
60 ggaatttttt 70 <210> SEQ ID NO 273 <211> LENGTH: 81
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 273 gggctttcaa gtcactagtg gttccgttta
gtagatgatt gtgcattgtt tcaaaatggt 60 gccctagtga ctacaaagcc c 81
<210> SEQ ID NO 274 <211> LENGTH: 70 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 274
acgcaagtgt cctaaggtga gctcagggag cacagaaacc tccagtggaa cagaagggca
60 aaagctcatt 70 <210> SEQ ID NO 275 <211> LENGTH: 70
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 275 catgtgtcac tttcaggtgg agtttcaaga
gtcccttcct ggttcaccgt ctcctttgct 60 cttccacaac 70 <210> SEQ
ID NO 276 <211> LENGTH: 109 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 276 ggtcgggctc
accatgacac agtgtgagac tcgggctaca acacaggacc cggggcgctg 60
ctctgacccc tcgtgtcttg tgttgcagcc ggagggacgc aggtccgca 109
<210> SEQ ID NO 277 <211> LENGTH: 86 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 277
tgctccctct ctcacatccc ttgcatggtg gagggtgagc tttctgaaaa cccctcccac
60 atgcagggtt tgcaggatgg cgagcc 86 <210> SEQ ID NO 278
<211> LENGTH: 85 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 278 tgcaggcctc tgtgtgatat
gtttgatata ttaggttgtt atttaatcca actatatatc 60 aaacatattc
ctacagtgtc ttgcc 85 <210> SEQ ID NO 279 <211> LENGTH:
60 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 279 gtgcatgtgt atgtatgtgt gcatgtgcat
gtgtatgtgt atgagtgcat gcgtgtgtgc 60 <210> SEQ ID NO 280
<211> LENGTH: 75 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 280 ggctgtgccg ggtagagagg
gcagtgggag gtaagagctc ttcacccttc accaccttct 60 ccacccagca tggcc 75
<210> SEQ ID NO 281 <211> LENGTH: 72 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 281
gttccttttt cctatgcata tacttctttg aggatctggc ctaaagaggt atagggcatg
60 ggaagatgga gc 72 <210> SEQ ID NO 282 <211> LENGTH:
60 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 282 caatcttcct ttatcatggt attgattttt
cagtgcttcc cttttgtgtg agagaagata 60 <210> SEQ ID NO 283
<211> LENGTH: 102 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 283 atggagctgc tcaccctgtg
ggcctcaaat gtggaggaac tattctgatg tccaagtgga 60 aagtgctgcg
acatttgagc gtcaccggtg acgcccatat ca 102 <210> SEQ ID NO 284
<211> LENGTH: 101 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 284 gcatcccctc agcctgtggc
actcaaactg tgggggcact ttctgctctc tggtgaaagt 60 gccgccatct
tttgagtgtt accgcttgag aagactcaac c 101 <210> SEQ ID NO 285
<211> LENGTH: 102 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 285 cgaggagctc atactgggat
actcaaaatg ggggcgcttt cctttttgtc tgttactggg 60 aagtgcttcg
attttggggt gtccctgttt gagtagggca tc 102 <210> SEQ ID NO 286
<211> LENGTH: 40 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: oligonucleotide probe <400> SEQUENCE: 286
tgacagaaga gagtgagcac acaaaggcaa tttgcatatc 40 <210> SEQ ID
NO 287 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 287
cattgcactt gcttctcttg cgtgctcact gctctttctg 40 <210> SEQ ID
NO 288 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 288
gtgttgacag aagatagaga gcacagatga tgagatacaa 40 <210> SEQ ID
NO 289 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 289
catcttactc ctttgtgctc tctagccttc tgtcatcacc 40 <210> SEQ ID
NO 290 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 290
gatggacggt ggtgattcac tctccacaaa gttctctatg 40 <210> SEQ ID
NO 291 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 291
tgagaatctt gatgatgctg catcggcaat caacgactat 40 <210> SEQ ID
NO 292 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 292
tgaggtagta ggttgtatag ttttagggtc acacccacca 40 <210> SEQ ID
NO 293 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 293
tacagcctcc tagctttcct tgggtcttgc actaaacaac 40 <210> SEQ ID
NO 294 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe
<400> SEQUENCE: 294 actgcatgct cccaggttga ggtagtaggt
tgtatagttt 40 <210> SEQ ID NO 295 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 295 gggtgaggta gtaggttgta tagtttgggg
ctctgccctg 40 <210> SEQ ID NO 296 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 296 tgaggtagta ggttgtgtgg tttcagggca
gtgatgttgc 40 <210> SEQ ID NO 297 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 297 gcatccgggt tgaggtagta ggttgtatgg
tttagagtta 40 <210> SEQ ID NO 298 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 298 cctaggaaga ggtagtaggt tgcatagttt
tagggcaggg 40 <210> SEQ ID NO 299 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 299 ctaggaagag gtagtagttt gcatagtttt
agggcaaaga 40 <210> SEQ ID NO 300 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 300 ttggtcgggt tgtgacattg cccgctgtgg
agataactgc 40 <210> SEQ ID NO 301 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 301 gctgaggtag tagtttgtgc tgttggtcgg
gttgtgacat 40 <210> SEQ ID NO 302 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 302 ggctgaggta ggaggttgta tagttgagga
ggacacccaa 40 <210> SEQ ID NO 303 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 303 ggtagtgatt ttaccctgtt caggagataa
ctatacaatc 40 <210> SEQ ID NO 304 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 304 gggatgaggt agtagattgt atagttgtgg
ggtagtgatt 40 <210> SEQ ID NO 305 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 305 tgaggtagta gattgtatag ttttagggtc
ataccccatc 40 <210> SEQ ID NO 306 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 306 ctgattccag gctgaggtag tagtttgtac
agtttgaggg 40 <210> SEQ ID NO 307 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 307 ttgagggtct atgataccac ccggtacagg
agataactgt 40 <210> SEQ ID NO 308 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 308 aatgctatgg aatgtaaaga agtatgtatt
tttggtaggc 40 <210> SEQ ID NO 309 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 309 taagctatgg aatgtaaaga agtatgtatc
tcaggccggg 40 <210> SEQ ID NO 310 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 310 tgttggccta gttctgtgtg gaagactagt
gattttgttg 40 <210> SEQ ID NO 311 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 311 tactgcgctc aacaacaaat cccagtctac
ctaatggtgc 40 <210> SEQ ID NO 312 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 312 ggaccggctg gccccatctg gaagactagt
gattttgttg 40 <210> SEQ ID NO 313 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 313 agattagagt ggctgtggtc tagtgctgtg
tggaagacta 40 <210> SEQ ID NO 314 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 314 tggaagacta gtgattttgt tgttctgatg
tactacgaca 40 <210> SEQ ID NO 315 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe
<400> SEQUENCE: 315 tctttggtta tctagctgta tgagtggtgt
ggagtcttca 40 <210> SEQ ID NO 316 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 316 taaagctaga taaccgaaag taaaaataac
cccatacact 40 <210> SEQ ID NO 317 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 317 gaagcgagtt gttatctttg gttatctagc
tgtatgagtg 40 <210> SEQ ID NO 318 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 318 gagtgtattg gtcttcataa agctagataa
ccgaaagtaa 40 <210> SEQ ID NO 319 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 319 gggaggcccg tttctctctt tggttatcta
gctgtatgag 40 <210> SEQ ID NO 320 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 320 gtgccacaga gccgtcataa agctagataa
ccgaaagtag 40 <210> SEQ ID NO 321 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 321 gtctgtcttc tgtatatacc ctgtagatcc
gaatttgtgt 40 <210> SEQ ID NO 322 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 322 gtggtcacaa attcgtatct aggggaatat
gtagttgaca 40 <210> SEQ ID NO 323 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 323 taccctgtag aaccgaattt gtgtggtatc
cgtatagtca 40 <210> SEQ ID NO 324 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 324 gtcacagatt cgattctagg ggaatatatg
gtcgatgcaa 40 <210> SEQ ID NO 325 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 325 ccttggagta aagtagcagc acataatggt
ttgtggattt 40 <210> SEQ ID NO 326 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 326 tttgtggatt ttgaaaaggt gcaggccata
ttgtgctgcc 40 <210> SEQ ID NO 327 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 327 ggccttaaag tactgtagca gcacatcatg
gtttacatgc 40 <210> SEQ ID NO 328 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 328 tgctacagtc aagatgcgaa tcattatttg
ctgctctaga 40 <210> SEQ ID NO 329 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 329 caatgtcagc agtgccttag cagcacgtaa
atattggcgt 40 <210> SEQ ID NO 330 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 330 gttccactct agcagcacgt aaatattggc
gtagtgaaat 40 <210> SEQ ID NO 331 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 331 gcatctactg cagtgaaggc acttgtagca
ttatggtgac 40 <210> SEQ ID NO 332 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 332 gtcagaataa tgtcaaagtg cttacagtgc
aggtagtgat 40 <210> SEQ ID NO 333 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 333 taaggtgcat ctagtgcaga tagtgaagta
gattagcatc 40 <210> SEQ ID NO 334 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 334 tgtagttgtg caaatctatg caaaactgat
ggtggcctgc 40 <210> SEQ ID NO 335 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 335 ttctgctgtg caaatccatg caaaactgac
tgtggtagtg 40 <210> SEQ ID NO 336 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 336 gtggctgtgc aaatccatgc aaaactgatt gtgataatgt 40
<210> SEQ ID NO 337 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 337 taaagtgctt atagtgcagg tagtgtttag ttatctactg 40
<210> SEQ ID NO 338 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 338 gtcgggtagc ttatcagact gatgttgact gttgaatctc 40
<210> SEQ ID NO 339 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 339 ttcaacagtc aacatcagtc tgataagcta cccgacaagg 40
<210> SEQ ID NO 340 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 340 tgtcctgacc cagctaaagc tgccagttga agaactgttg 40
<210> SEQ ID NO 341 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 341 tcctgtcaca aatcacattg ccagggattt ccaaccgacc 40
<210> SEQ ID NO 342 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 342 aatcacattg ccagggatta ccacgcaacc acgaccttgg 40
<210> SEQ ID NO 343 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 343 ttttacacac tggctcagtt cagcaggaac aggagtcgag 40
<210> SEQ ID NO 344 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 344 tccggtgcct actgagctga tatcagttct cattttacac 40
<210> SEQ ID NO 345 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 345 agttggtttg tgtacactgg ctcagttcag caggaacagg 40
<210> SEQ ID NO 346 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 346 acgctgccct gggcattgca cttgtctcgg tctgacagtg 40
<210> SEQ ID NO 347 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 347 ttcaagtaat ccaggatagg ctgtgcaggt cccaatggcc 40
<210> SEQ ID NO 348 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 348 tcccaatggc ctatcttggt tacttgcacg gggacgcggg 40
<210> SEQ ID NO 349 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 349 ttcaagtaat tcaggatagg ttgtgtgctg tccagcctgt 40
<210> SEQ ID NO 350 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 350 gtccacacca agtcgtgttc acagtggcta agttccgccc 40
<210> SEQ ID NO 351 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 351 ccgctttgtt cacagtggct aagttctgca cctgaagaga 40
<210> SEQ ID NO 352 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 352 aaggagctca cagtctattg agttaccttt ctgactttcc 40
<210> SEQ ID NO 353 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 353 ctagcaccat ctgaaatcgg ttataatgat tggggaagag 40
<210> SEQ ID NO 354 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 354 ccccttagag gatgactgat ttcttttggt gttcagagtc 40
<210> SEQ ID NO 355 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 355 agtgattgtc tagcaccatt tgaaatcagt gttcttgggg 40
<210> SEQ ID NO 356 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 356 ttttgtctag caccatttga aatcggttat gatgtagggg 40
<210> SEQ ID NO 357 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 357 gcgactgtaa acatcctcga ctggaagctg
tgaagccaca 40 <210> SEQ ID NO 358 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 358 cacagatggg ctttcagtcg gatgtttgca
gctgcctact 40 <210> SEQ ID NO 359 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 359 tgtaaacatc ctacactcag ctgtaataca
tggattggct 40 <210> SEQ ID NO 360 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 360 atggattggc tgggaggtgg atgtttactt
cagctgactt 40 <210> SEQ ID NO 361 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 361 tactgtaaac atcctacact ctcagctgtg
gaaagtaaga 40 <210> SEQ ID NO 362 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 362 taagacacag ctaagctttc agtcagatgt
ttgctgctac 40 <210> SEQ ID NO 363 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 363 ttgtaaacat ccccgactgg aagctgtaag
acacagctaa 40 <210> SEQ ID NO 364 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 364 ggcaagatgc tggcatagct gttgaactgg
gaacctgcta 40 <210> SEQ ID NO 365 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 365 tgtcacggcc tcaatgcaat ttagtgtgtg
tgatattttc 40 <210> SEQ ID NO 366 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 366 ggagatattg cacattacta agttgcatgt
tgtcacggcc 40 <210> SEQ ID NO 367 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 367 gtgcattgct gttgcattgc acgtgtgtga
ggcgggtgca 40 <210> SEQ ID NO 368 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 368 gtggtgcatt gtagttgcat tgcatgttct
ggtggtaccc 40 <210> SEQ ID NO 369 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 369 gagtgtttct ttggcagtgt cttagctggt
tgttgtgagc 40 <210> SEQ ID NO 370 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 370 agtaaggaag caatcagcaa gtatactgcc
ctagaagtgc 40 <210> SEQ ID NO 371 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 371 acaggttggg atcggttgca atgctgtgtt
tctgtatggt 40 <210> SEQ ID NO 372 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 372 tctgtatggt attgcacttg tcccggcctg
ttgagtttgg 40 <210> SEQ ID NO 373 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 373 gttctatata aagtattgca cttgtcccgg
cctgtggaag 40 <210> SEQ ID NO 374 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 374 ccaaagtgct gttcgtgcag gtagtgtgat
tacccaacct 40 <210> SEQ ID NO 375 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 375 cgttacattc aacgggtatt tattgagcac
ccactctgtg 40 <210> SEQ ID NO 376 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 376 ctccgctctg agcaatcatg tgcagtgcca
atatgggaaa 40 <210> SEQ ID NO 377 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 377 tggccgattt tggcactagc acatttttgc
ttgtgtctct 40 <210> SEQ ID NO 378 <211> LENGTH: 40
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 378 tgaggtagta agttgtattg ttgtggggta gggatattag 40
<210> SEQ ID NO 379 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 379 gccttcgccg cacacaagct cgtgtctgtg ggtccgtgtc 40
<210> SEQ ID NO 380 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 380 cacccgtaga accgaccttg cggggccttc gccgcacaca 40
<210> SEQ ID NO 381 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 381 ataaacccgt agatccgatc ttgtggtgaa gtggaccgca 40
<210> SEQ ID NO 382 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 382 tgaggcctgt tgccacaaac ccgtagatcc gaacttgtgg 40
<210> SEQ ID NO 383 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 383 ccctggctca gttatcacag tgctgatgct gtctattcta 40
<210> SEQ ID NO 384 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 384 tacagtactg tgataactga aggatggcag ccatcttacc 40
<210> SEQ ID NO 385 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 385 gctgtatatc tgaaaggtac agtactgtga taactgaaga 40
<210> SEQ ID NO 386 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 386 tctttgtatc tagcaccatt tgaaatcagt gttttaggag 40
<210> SEQ ID NO 387 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 387 gtagcattca ggtcaagcaa cattgtacag ggctatgaaa 40
<210> SEQ ID NO 388 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 388 tatggatcaa gcagcattgt acagggctat gaaggcattg 40
<210> SEQ ID NO 389 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 389 atcgtggtca aatgctcaga ctcctgtggt ggctgctcat 40
<210> SEQ ID NO 390 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 390 ccttggccat gtaaaagtgc ttacagtgca ggtagctttt 40
<210> SEQ ID NO 391 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 391 ggcatggagt tcaagcagca ttgtacaggg ctatcaaagc 40
<210> SEQ ID NO 392 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 392 ccttagcaga gctgtggagt gtgacaatgg tgtttgtgtc 40
<210> SEQ ID NO 393 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 393 gacgggacat tattactttt ggtacgcgct gtgacacttc 40
<210> SEQ ID NO 394 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 394 tgtgacactt caaactcgta ccgtgagtaa taatgcgccg 40
<210> SEQ ID NO 395 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 395 atacaattaa ggcacgcggt gaatgccaag aatggggctg 40
<210> SEQ ID NO 396 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 396 ttaaggcacg cggtgaatgc caagagcgga gcctacggct 40
<210> SEQ ID NO 397 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 397 ttaaggcacg cggtgaatgc caagagaggc gcctccgccg 40
<210> SEQ ID NO 398 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 398 tctaggtccc tgagaccctt taacctgtga ggacatccag 40
<210> SEQ ID NO 399 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 399 cagggtcaca ggtgaggttc ttgggagcct
ggcgtctggc 40 <210> SEQ ID NO 400 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 400 tccctgagac cctaacttgt gatgtttacc
gtttaaatcc 40 <210> SEQ ID NO 401 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 401 tagtaacatc acaagtcagg ctcttgggac
ctaggcggag 40 <210> SEQ ID NO 402 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 402 accagacttt tcctagtccc tgagacccta
acttgtgagg 40 <210> SEQ ID NO 403 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 403 tcggatccgt ctgagcttgg ctggtcggaa
gtctcatcat 40 <210> SEQ ID NO 404 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 404 ttggattcgg ggccgtagca ctgtctgaga
ggtttacatt 40 <210> SEQ ID NO 405 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 405 acatttctca cagtgaaccg gtctcttttt
cagctgcttc 40 <210> SEQ ID NO 406 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 406 tcacagtgaa ccggtctctt tccctactgt
gtcacactcc 40 <210> SEQ ID NO 407 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 407 gggggccgat acactgtacg agagtgagta
gcaggtctca 40 <210> SEQ ID NO 408 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 408 tggatctttt tgcggtctgg gcttgctgtt
cctctcaaca 40 <210> SEQ ID NO 409 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 409 cctctcaaca gtagtcagga agcccttacc
ccaaaaagta 40 <210> SEQ ID NO 410 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 410 ccagagctct tttcacattg tgctactgtc
tgcacctgtc 40 <210> SEQ ID NO 411 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 411 tgtctgcacc tgtcactagc agtgcaatgt
taaaagggca 40 <210> SEQ ID NO 412 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 412 tgtgggaact ggaggtaaca gtctacagcc
atggtcgccc 40 <210> SEQ ID NO 413 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 413 tccagggcaa ccgtggcttt cgattgttac
tgtgggaact 40 <210> SEQ ID NO 414 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 414 cctcttcaat ggatttggtc cccttcaacc
agctgtagct 40 <210> SEQ ID NO 415 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 415 ttggtcccct tcaaccagct gtagctgtgc
attgatggcg 40 <210> SEQ ID NO 416 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 416 atgcactgtg ttcaccctgt gggccaccta
gtcaccaacc 40 <210> SEQ ID NO 417 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 417 gtgtgtgact ggttgaccag aggggcatgc
actgtgttca 40 <210> SEQ ID NO 418 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 418 gcctcgctgt tctctatggc tttttattcc
tatgtgattc 40 <210> SEQ ID NO 419 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 419 cactctagtg ctttatggct ttttattcct
atgtgatagt 40 <210> SEQ ID NO 420
<211> LENGTH: 40 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: oligonucleotide probe <400> SEQUENCE: 420
atgctccatc atcgtctcaa atgagtcttc agagggttct 40 <210> SEQ ID
NO 421 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 421
tgagccctcg gaggactcca tttgttttga tgatggattc 40 <210> SEQ ID
NO 422 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 422
ggattacgtt gttattgctt aagaatacgc gtagtcgagg 40 <210> SEQ ID
NO 423 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 423
agctggtgtt gtgaatcagg ccgttgccaa tcagagaacg 40 <210> SEQ ID
NO 424 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 424
agctggtgtt gtgaatcagg ccgacgagca gcgcatcctc 40 <210> SEQ ID
NO 425 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 425
gtgtattcta cagtgcacgt gtctccagtg tggctcggag 40 <210> SEQ ID
NO 426 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 426
gccagtggtt ttaccctatg gtaggttacg tcatgctgtt 40 <210> SEQ ID
NO 427 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 427
ttctaccaca gggtagaacc acggacagga taccggggca 40 <210> SEQ ID
NO 428 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 428
ttgtgaagct cctaacactg tctggtaaag atggctcccg 40 <210> SEQ ID
NO 429 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 429
atcttccagt acagtgttgg atggtctaat tgtgaagctc 40 <210> SEQ ID
NO 430 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 430
cccataaagt agaaagcact actaacagca ctggagggtg 40 <210> SEQ ID
NO 431 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 431
ctggtcagtt gggagtctga gatgaagcac tgtagctcag 40 <210> SEQ ID
NO 432 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 432
cgatgagaca ctacagtata gatgatgtac tagtccgggc 40 <210> SEQ ID
NO 433 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 433
ccctggctgg gatatcatca tatactgtaa gtttgcgatg 40 <210> SEQ ID
NO 434 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 434
cctcacggtc cagttttccc aggaatccct tagatgctaa 40 <210> SEQ ID
NO 435 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 435
tgagaactga attccatggg ttgtgtcagt gtcagacctc 40 <210> SEQ ID
NO 436 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 436
gactatggaa gccagtgtgt ggaaatgctt ctgctagatt 40 <210> SEQ ID
NO 437 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 437
tgagtatgat agaagtcagt gcactacaga actttgtctc 40 <210> SEQ ID
NO 438 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 438
cgagctctgg ctccgtgtct tcactcccgt gcttgtccga 40 <210> SEQ ID
NO 439 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 439
ctccccatgg ccctgtctcc caacccttgt accagtgctg 40 <210> SEQ ID
NO 440 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 440
gtatgtctca tcccctacta gactgaagct ccttgaggac 40
<210> SEQ ID NO 441 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 441 actcgggctc tggagcagtc agtgcatgac agaacttggg 40
<210> SEQ ID NO 442 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 442 ccccggccca ggttctgtga tacactccga ctcgggctct 40
<210> SEQ ID NO 443 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 443 cagttgcata gtcacaaaag tgatcattgg caggtgtggc 40
<210> SEQ ID NO 444 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 444 cacagctgcc agtgtcattg tcacaaaagt gatcattggc 40
<210> SEQ ID NO 445 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 445 gcccagttgc atagtcacaa aagtgatcat tggaaactgt 40
<210> SEQ ID NO 446 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 446 gtggtacttg aagataggtt atccgtgttg ccttcgcttt 40
<210> SEQ ID NO 447 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 447 gccttcgctt tatttgtgac gaatcataca cggttgacct 40
<210> SEQ ID NO 448 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 448 ttaatgctaa tcgtgatagg ggtttttgcc tccaactgac 40
<210> SEQ ID NO 449 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 449 tcagaggact ccaaggaaca ttcaacgctg tcggtgagtt 40
<210> SEQ ID NO 450 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 450 gaaaaaacca ctgaccgttg actgtacctt ggggtcctta 40
<210> SEQ ID NO 451 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 451 tgaggttgct tcagtgaaca ttcaacgctg tcggtgagtt 40
<210> SEQ ID NO 452 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 452 accatcgacc gttgattgta ccctatggct aaccatcatc 40
<210> SEQ ID NO 453 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 453 tgccaagggt ttgggggaac attcaacctg tcggtgagtt 40
<210> SEQ ID NO 454 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 454 atcgaccgtt gagtggaccc tgaggcctgg aattgccatc 40
<210> SEQ ID NO 455 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 455 aggtaacagg atccggtggt tctagacttg ccaactatgg 40
<210> SEQ ID NO 456 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 456 ttggcaatgg tagaactcac actggtgagg taacaggatc 40
<210> SEQ ID NO 457 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 457 gactcctgtt ctgtgtatgg cactggtaga attcactgtg 40
<210> SEQ ID NO 458 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 458 gtctcagtca gtgaattacc gaagggccat aaacagagca 40
<210> SEQ ID NO 459 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 459 gactgtaagt gttggacgga gaactgataa gggtaggtga 40
<210> SEQ ID NO 460 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 460 cgtcccctta tcacttttcc agcccagctt tgtgactgta 40
<210> SEQ ID NO 461 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 461 gcgagggatt ggagagaaag gcagttcctg atggtcccct 40
<210> SEQ ID NO 462 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 462 cctccccagg ggctggcttt cctctggtcc ttccctccca 40
<210> SEQ ID NO 463 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 463 cttgtaactt tccaaagaat tctccttttg ggctttctgg 40
<210> SEQ ID NO 464 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 464 ctcgtgtctt gtgttgcagc cggagggacg caggtccgca 40
<210> SEQ ID NO 465 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 465 tcaccatgac acagtgtgag actcgggcta caacacagga 40
<210> SEQ ID NO 466 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 466 tcacatccct tgcatggtgg agggtgagct ttctgaaaac 40
<210> SEQ ID NO 467 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 467 gcaggcctct gtgtgatatg tttgatatat taggttgtta 40
<210> SEQ ID NO 468 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 468 caacggaatc ccaaaagcag ctgttgtctc cagagcattc 40
<210> SEQ ID NO 469 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 469 tctgacctat gaattgacag ccagtgctct cgtctcccct 40
<210> SEQ ID NO 470 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 470 ccaattccat aggtcacagg tatgttcgcc tcaatgccag 40
<210> SEQ ID NO 471 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 471 agatgagggt gtcggatcaa ctggcctaca aagtcccagt 40
<210> SEQ ID NO 472 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 472 aggatgggag ctgagggctg ggtctttgcg ggcgagatga 40
<210> SEQ ID NO 473 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 473 tgtaacagca actccatgtg gactgtgtac caatttccag 40
<210> SEQ ID NO 474 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 474 ccaatttcca gtggagatgc tgttactttt gatggttacc 40
<210> SEQ ID NO 475 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 475 tctagcagca cagaaatatt ggcacaggga agcgagtctg 40
<210> SEQ ID NO 476 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 476 ctgctgagtg aattaggtag tttcatgttg ttgggcctgg 40
<210> SEQ ID NO 477 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 477 acacaacaac attaaaccac ccgattcacg gcagttactg 40
<210> SEQ ID NO 478 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 478 agaaactgcc tgagttacat cagtcggttt tcgtcgaggg 40
<210> SEQ ID NO 479 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 479 gctgatctgt ggcttaggta gtttcatgtt gttgggattg 40
<210> SEQ ID NO 480 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 480 taagagctct tcacccttca ccaccttctc cacccagcat 40
<210> SEQ ID NO 481 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 481 tcattggtcc agaggggaga taggttcctg tgatttttcc 40
<210> SEQ ID NO 482 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 482 gccaacccag tgttcagact acctgttcag gaggctctca 40
<210> SEQ ID NO 483 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 483 tcgccccagt gttcagacta cctgttcagg acaatgccgt 40
<210> SEQ ID NO 484 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 484 gtctgcacat tggttaggct gggctgggtt agaccctcgg 40
<210> SEQ ID NO 485 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 485 acctccactc cgtctaccca gtgtttagac tatctgttca 40
<210> SEQ ID NO 486 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 486 gtctctaata ctgcctggta atgatgacgg cggagccctg 40
<210> SEQ ID NO 487 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 487 gatctggcct aaagaggtat agggcatggg aagatggagc 40
<210> SEQ ID NO 488 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 488 gttctgtagc gcaattgtga aatgtttagg accactagac 40
<210> SEQ ID NO 489 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 489 tgggtccagt ggttcttaac agttcaacag ttctgtagcg 40
<210> SEQ ID NO 490 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 490 cgtggacttc cctttgtcat cctatgcctg agaatatatg 40
<210> SEQ ID NO 491 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 491 aggctgggaa ggcaaaggga cgttcaattg tcatcactgg 40
<210> SEQ ID NO 492 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 492 tccttcattc caccggagtc tgtctcatac ccaaccagat 40
<210> SEQ ID NO 493 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 493 ttgctatgga atgtaaggaa gtgtgtggtt tcggcaagtg 40
<210> SEQ ID NO 494 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 494 tgcttcccga ggccacatgc ttctttatat ccccatatgg 40
<210> SEQ ID NO 495 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 495 acctgatgct cacgtataag acgagcaaaa agcttgttgg 40
<210> SEQ ID NO 496 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 496 agacccactg tgcgtgtgac agcggctgat ctgtgcctgg 40
<210> SEQ ID NO 497 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 497 ttccctttgt catccttcgc ctagggctct gagcagggca 40
<210> SEQ ID NO 498 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 498 gcagggacag caaaggggtg ctcagttgtc acttcccaca 40
<210> SEQ ID NO 499 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 499 cctcagtaac agtctccagt cacggccacc gacgcctggc 40
<210> SEQ ID NO 500 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 500 cggacagcgc gccggcacct tggctctaga ctgcttactg 40
<210> SEQ ID NO 501 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 501 aacattcatt gctgtcggtg ggttgaactg tgtggacaag 40
<210> SEQ ID NO 502 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 502 tgtggacaag ctcactgaac aatgaatgca actgtggccc 40
<210> SEQ ID NO 503 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 503
tgtacagcag gcacagacag gcagtcacat gacaacccag 40 <210> SEQ ID
NO 504 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 504
caggaaaatg acctatgaat tgacagacaa tatagctgag 40 <210> SEQ ID
NO 505 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 505
catttcttta ggccaatatt ctgtatgact gtgctacttc 40 <210> SEQ ID
NO 506 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 506
ctgggattat gctaaacaga gcaatttcct agccctcacg 40 <210> SEQ ID
NO 507 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 507
gatggctgtg agttggctta atctcagctg gcaactgtga 40 <210> SEQ ID
NO 508 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 508
gaatcagtca ccatcagttc ctaatgcatt gccttcagca 40 <210> SEQ ID
NO 509 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 509
tgtcgcagat actgcatcag gaactgattg gataagaatc 40 <210> SEQ ID
NO 510 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 510
gttgtgcttg atctaaccat gtggttgcga ggtatgagta 40 <210> SEQ ID
NO 511 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 511
tggtggaacg atggaaacgg aacatggttc tgtcaagcac 40 <210> SEQ ID
NO 512 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 512
tcgctgcggg gctttccttt gtgcttgatc taaccatgtg 40 <210> SEQ ID
NO 513 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 513
attgtccaaa cgcaattctc gagtctatgg ctccggccga 40 <210> SEQ ID
NO 514 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 514
tgtggcattg tagggctcca caccgtatct gacactttgg 40 <210> SEQ ID
NO 515 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 515
caacagctac attgtctgct gggtttcagg ctacctggaa 40 <210> SEQ ID
NO 516 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 516
ctttcgtaat cagcagctac atctggctac tgggtctctg 40 <210> SEQ ID
NO 517 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 517
gctgctggaa ggtgtaggta ccctcaatgg ctcagtagcc 40 <210> SEQ ID
NO 518 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 518
gagtgtcagt ttgtcaaata ccccaagtgc ggcacatgct 40 <210> SEQ ID
NO 519 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 519
ggctttcaag tcactagtgg ttccgtttag tagatgattg 40 <210> SEQ ID
NO 520 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 520
ggccgcagca acctcggttc gtatccgagt cacggcacca 40 <210> SEQ ID
NO 521 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 521
tccggatgga gcgtgggttc gaatcccact tctgacacca 40 <210> SEQ ID
NO 522 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 522
atggtagagc gctcgctttg cttgcgagag gtagcgggat 40 <210> SEQ ID
NO 523 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 523
gatctaaagg tccctggttc gatcccgggt ttcggcacca 40 <210> SEQ ID
NO 524 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE:
524
agcagagtgg cgcagcggaa gcgtgctggg cccataaccc 40 <210> SEQ ID
NO 525 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 525
aacccagagg tcgatggatc gaaaccatcc tctgctacca 40 <210> SEQ ID
NO 526 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 526
caatcggtta gcgcgttcgg ctgttaaccg aaaggttggt 40 <210> SEQ ID
NO 527 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 527
tctagcgaca gagtggttca attccacctt tcgggcgcca 40 <210> SEQ ID
NO 528 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 528
acgcgaaagg tccccggttc gaaaccgggc ggaaacacca 40 <210> SEQ ID
NO 529 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 529
ctgaggtagt agtttgtaca gtttgagggt ctatgatacc 40 <210> SEQ ID
NO 530 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 530
gctgaggtag tagtttgtgc tgttggtcgg gttgtgacat 40 <210> SEQ ID
NO 531 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 531
attcagtgct atggaatgta aagaagtatg tattttgggt 40 <210> SEQ ID
NO 532 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 532
ctgctaagct atggaatgta aagaagtatg tatttcaggc 40 <210> SEQ ID
NO 533 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 533
atctttggtt atctagctgt atgagtgtat tggtcttcat 40 <210> SEQ ID
NO 534 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 534
gagtgtattg gtcttcataa agctagataa ccgaaagtaa 40 <210> SEQ ID
NO 535 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 535
taccctgtag aaccgaattt gtgtggtacc cacatagtca 40 <210> SEQ ID
NO 536 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 536
ttgagattaa aatcacattg ccagggatta ccacgcaacc 40 <210> SEQ ID
NO 537 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 537
ttggtttccg ctttgttcac agtggctaag ttctgcacct 40 <210> SEQ ID
NO 538 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 538
taaatagtga ttgtctagca ccatttgaaa tcagtgttct 40 <210> SEQ ID
NO 539 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 539
tgtaaacatc ctacactcag ctgtcataca tgcgttggct 40 <210> SEQ ID
NO 540 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 540
tgtaaacatc cttgactgga agctgtaagg tgttgagagg 40 <210> SEQ ID
NO 541 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 541
cataaacccg tagatccgat cttgtggtga agtggaccgc 40 <210> SEQ ID
NO 542 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 542
gccttcgccg cacacaagct cgtgtctgtg ggtccgtgtc 40 <210> SEQ ID
NO 543 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 543
cacccgtaga accgaccttg cggggccttc gccgcacaca 40 <210> SEQ ID
NO 544 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe <400> SEQUENCE: 544
tgccacaaac ccgtagatcc gaacttgtgc tgattctgca 40 <210> SEQ ID
NO 545 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: oligonucleotide probe
<400> SEQUENCE: 545 gctgtccatt ctaaaggtac agtactgtga
taactgaagg 40 <210> SEQ ID NO 546 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 546 gtgtccaaac catcaaacgc cattatcaca
ctaaatagct 40 <210> SEQ ID NO 547 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 547 gctgtggagt gtgacaatgg tgtttgtgtc
caaaccatca 40 <210> SEQ ID NO 548 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 548 cattattact tttggtacgc gctgtgacac
ttcaaactcg 40 <210> SEQ ID NO 549 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 549 gacacttcaa actcgtaccg tgagtaataa
tgcgcggtca 40 <210> SEQ ID NO 550 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 550 taatgtctat acaattaagg cacgcggtga
atgccaagag 40 <210> SEQ ID NO 551 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 551 tccctgagac cctttaacct gtgaggacgt
ccagggtcac 40 <210> SEQ ID NO 552 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 552 gcctagtccc tgagacccta acttgtgagg
tattttagta 40 <210> SEQ ID NO 553 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 553 attttagtaa catcacaagt caggttcttg
ggacctaggc 40 <210> SEQ ID NO 554 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 554 ttcagaaaga tcatcggatc cgtctgagct
tggctggtcg 40 <210> SEQ ID NO 555 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 555 aggtttacat ttctcacagt gaaccggtct
ctttttcagc 40 <210> SEQ ID NO 556 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 556 ttggattcgg ggccgtagca ctgtctgaga
ggtttacatt 40 <210> SEQ ID NO 557 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 557 ctttttgcgg tctgggcttg ctgtacataa
ctcaatagcc 40 <210> SEQ ID NO 558 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 558 ctttttgcgg tctgggcttg ctgttttctc
gacagtagtc 40 <210> SEQ ID NO 559 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 559 gtctaacgtg taccgagcag tgcaatgtta
aaagggcatc 40 <210> SEQ ID NO 560 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 560 agtggtgtgg agtcttcata aagctagata
accgaaagta 40 <210> SEQ ID NO 561 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 561 tgtgggaacc ggaggtaaca gtctacagcc
atggtcgccc 40 <210> SEQ ID NO 562 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 562 atcgcctctt caatggattt ggtccccttc
aaccagctgt 40 <210> SEQ ID NO 563 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 563 gcactctgtt caccctgtgg gccacctagt
caccaaccct 40 <210> SEQ ID NO 564 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 564 tgtgtgactg gttgaccaga ggggcgtgca
ctctgttcac 40 <210> SEQ ID NO 565 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 565 ctatggcttt ttattcctat gtgattctat
tgctcgctca 40 <210> SEQ ID NO 566 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe
<400> SEQUENCE: 566 gaggactcca tttgttttga tgatggattc
ttaagctcca 40 <210> SEQ ID NO 567 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 567 ggattacgtt gttattgctt aagaatacgc
gtagtcgagg 40 <210> SEQ ID NO 568 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 568 agctggtgtt gtgaatcagg ccgacgagca
gcgcatcctc 40 <210> SEQ ID NO 569 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 569 ttacgtcatg ctgttctacc acagggtaga
accacggaca 40 <210> SEQ ID NO 570 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 570 gaagtatgaa gctcctaaca ctgtctggta
aagatggccc 40 <210> SEQ ID NO 571 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 571 cccataaagt agaaagcact actaacagca
ctggagggtg 40 <210> SEQ ID NO 572 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 572 tggtcagttg ggagtctgag atgaagcact
gtagctcagg 40 <210> SEQ ID NO 573 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 573 gtttgtgatg agacactaca gtatagatga
tgtactagtc 40 <210> SEQ ID NO 574 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 574 acggtccagt tttcccagga atcccttgga
tgctaagatg 40 <210> SEQ ID NO 575 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 575 tgagaactga attccatggg ttatatcaat
gtcagacctg 40 <210> SEQ ID NO 576 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 576 gctctggctc cgtgtcttca ctcccgtgtt
tgtccgagga 40 <210> SEQ ID NO 577 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 577 tgtctcccaa cccttgtacc agtgctgtgc
ctcagaccct 40 <210> SEQ ID NO 578 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 578 tatgtctcct ccctactaga ctgaggctcc
ttgagggaca 40 <210> SEQ ID NO 579 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 579 actcgggctc tggagcagtc agtgcatgac
agaacttggg 40 <210> SEQ ID NO 580 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 580 taatatgagc ccagttgcat agtgacaaaa
gtgatcattg 40 <210> SEQ ID NO 581 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 581 agataggtta tccgtgttgc cttcgcttta
ttcgtgacga 40 <210> SEQ ID NO 582 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 582 ttaatgctaa ttgtgatagg ggttttggcc
tctgactgac 40 <210> SEQ ID NO 583 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 583 ccatggaaca ttcaacgctg tcggtgagtt
tgggattcaa 40 <210> SEQ ID NO 584 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 584 tttggcaatg gtagaactca caccggtaag
gtaatgggac 40 <210> SEQ ID NO 585 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 585 aacagtctca gtcagtgaat taccgaaggg
ccataaacag 40 <210> SEQ ID NO 586 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 586 tatggcactg gtagaattca ctgtgaacag
tctcagtcag 40 <210> SEQ ID NO 587 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 587 tgtgactcta agtgttggac ggagaactga taagggtagg 40
<210> SEQ ID NO 588 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 588 gggattggag agaaaggcag ttcctgatgg tcccctccca 40
<210> SEQ ID NO 589 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 589 caaagaattc tccttttggg ctttctcatt ttattttaag 40
<210> SEQ ID NO 590 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 590 gggcgctgct ctgacccctc gtgtcttgtg ttgcagccgg 40
<210> SEQ ID NO 591 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 591 tcacatccct tgcatggtgg agggtgagct ctctgaaaac 40
<210> SEQ ID NO 592 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 592 cggtgcctac tgagctgata tcagttctca tttcacacac 40
<210> SEQ ID NO 593 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 593 ctgtgtgata tgtttgatat attaggttgt tatttaatcc 40
<210> SEQ ID NO 594 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 594 caacggaatc ccaaaagcag ctgttgtctc cagagcattc 40
<210> SEQ ID NO 595 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 595 ctgacctatg aattgacagc cagtgctctc gtctcccctc 40
<210> SEQ ID NO 596 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 596 tgagagtgtc agttcaactg gcctacaaag tcccagtcct 40
<210> SEQ ID NO 597 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 597 atcgggtgta acagcaactc catgtggact gtgctcggat 40
<210> SEQ ID NO 598 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 598 tagcagcaca gaaatattgg catggggaag tgagtctgcc 40
<210> SEQ ID NO 599 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 599 gtaggtagtt tcatgttgtt gggcctggct ttctgaacac 40
<210> SEQ ID NO 600 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 600 gaggctggga catgtacagt agtctgcaca ttggttaggc 40
<210> SEQ ID NO 601 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 601 tagtgtctga tctctaatac tgcctggtaa tgatgacggc 40
<210> SEQ ID NO 602 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 602 ccgtggccat cttactgggc agcattggat agtgtctgat 40
<210> SEQ ID NO 603 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 603 taccttactc agtaaggcat tgttcttcta tattaataaa 40
<210> SEQ ID NO 604 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 604 gatctggtct aaagaggtat agcgcatggg aagatggagc 40
<210> SEQ ID NO 605 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 605 ggtccagtgg ttcttgacag ttcaacagtt ctgtagcaca 40
<210> SEQ ID NO 606 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 606 gtagcacaat tgtgaaatgt ttaggaccac tagacccggc 40
<210> SEQ ID NO 607 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 607 ttccctttgt catcctatgc ctgagaatat atgaaggagg 40
<210> SEQ ID NO 608 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 608 gtccttcatt ccaccggagt ctgtcttatg
ccaaccagat 40 <210> SEQ ID NO 609 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 609 tagatatctc agcactatgg aatgtaagga
agtgtgtggt 40 <210> SEQ ID NO 610 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 610 gctgcggctt gcgcttctcc tggctctcct
ccctctcctt 40 <210> SEQ ID NO 611 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 611 cttcagtaac agtctccagt cacggccacc
gacgcctggc 40 <210> SEQ ID NO 612 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 612 agcgcgccgg caccttggct ctagactgct
tactgcccgg 40 <210> SEQ ID NO 613 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 613 aacattcatt gctgtcggtg ggttgaactg
tgtggacaag 40 <210> SEQ ID NO 614 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 614 tgtacagcag gcacagacag gcagtcacat
gacaacccag 40 <210> SEQ ID NO 615 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 615 caggagaatg acctatgatt tgacagaccg
tgcagctgtg 40 <210> SEQ ID NO 616 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 616 gagatgtccc tatcattcct cacagtggtc
tctgggatta 40 <210> SEQ ID NO 617 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 617 atggctatga gttggtttaa tctcagctgg
caactgtgag 40 <210> SEQ ID NO 618 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 618 gcagatactg catcaggaac tgactggata
agacttaatc 40 <210> SEQ ID NO 619 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 619 ccccatcagt tcctaatgca ttgccttcag
catctaaaca 40 <210> SEQ ID NO 620 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 620 gggctttcct ttgtgcttga tctaaccatg
tggtggaacg 40 <210> SEQ ID NO 621 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 621 gtggtggaac gatggaaacg gaacatggtt
ctgtcaagca 40 <210> SEQ ID NO 622 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 622 tcctgattgt ccaaacgcaa ttctcgagtc
tctggctccg 40 <210> SEQ ID NO 623 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 623 ctctggctcc ggccgagagt tgcgtctgga
cgtcccgagc 40 <210> SEQ ID NO 624 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 624 caacagctac attgtctgct gggtttcagg
ctacctggaa 40 <210> SEQ ID NO 625 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 625 ggcatacaat gtagatttct gtgtttgtta
ggcaacagct 40 <210> SEQ ID NO 626 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 626 ttggtaatca gcagctacat ctggctactg
ggtctctggt 40 <210> SEQ ID NO 627 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 627 agagtgtcag tttgtcaaat accccaagtg
tggctcatgc 40 <210> SEQ ID NO 628 <211> LENGTH: 40
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: oligonucleotide
probe <400> SEQUENCE: 628 taagtcacta gtggttccgt ttagtagatg
gtctgtgcat 40 <210> SEQ ID NO 629 <211> LENGTH: 40
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 629 tgcattgttt caaaatggtg ccctagtgac tacaaagccc 40
<210> SEQ ID NO 630 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 630 tagactgaag atctaaaggt ccctggttcg atcccgggtt 40
<210> SEQ ID NO 631 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 631 aatctgaagg tcgtgagttc gatcctcaca cggggcacca 40
<210> SEQ ID NO 632 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 632 agcagagtgg cgcagcggaa gcgtgctggg cccataaccc 40
<210> SEQ ID NO 633 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 633 cccataaccc agaggtcgat ggatcgaaac catcctctgc 40
<210> SEQ ID NO 634 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 634 tgcgttgtgg ccgcagcaac ctcggttcga atccgagtca 40
<210> SEQ ID NO 635 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 635 gctcgttggt ctaggggtat gattctcgct ttgggtgcga 40
<210> SEQ ID NO 636 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 636 agctgtttag cgacagagtg gttcaattcc acctttcggg 40
<210> SEQ ID NO 637 <211> LENGTH: 40 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: oligonucleotide probe <400>
SEQUENCE: 637 ttccgtagtg tagtggttat cacgctcgcc tgacacgcga 40
<210> SEQ ID NO 638 <211> LENGTH: 32 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: 25, 26,
27, 28, 29, 30, 31, 32 <223> OTHER INFORMATION: n = A,T,C or
G <220> FEATURE: <223> OTHER INFORMATION:
oligonucleotide probe <400> SEQUENCE: 638 aaaaaaaaaa
aaaaaaaaaa aaaannnnnn nn 32 <210> SEQ ID NO 639 <211>
LENGTH: 11 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: 4, 5, 6, 7, 8, 9, 10, 11 <223> OTHER
INFORMATION: n = A,T,C or G <220> FEATURE: <223> OTHER
INFORMATION: oligonucleotide probe <400> SEQUENCE: 639
aaannnnnnn n 11 <210> SEQ ID NO 640 <211> LENGTH: 46
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: 39, 40, 41, 42, 43, 44, 45, 46 <223> OTHER
INFORMATION: n = A,T,C or G <220> FEATURE: <223> OTHER
INFORMATION: oligonucleotide probe <400> SEQUENCE: 640
gccagtgaat tgtaatacga ctcactatag ggaggcggnn nnnnnn 46 <210>
SEQ ID NO 641 <211> LENGTH: 99 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 641
gtcagcagtg ccttagcagc acgtaaatat tggcgttaag attctaaaat tatctccagt
60 attaactgtg ctgctgaagt aaggttgacc atactctac 99 <210> SEQ ID
NO 642 <211> LENGTH: 99 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 642 gtcagcagtg
ccttagcagc acgtaaatat tggcgttaag attctaaaat tatctccagt 60
attaactgtg ctgctgaagt aaggttgacc atactttac 99 <210> SEQ ID NO
643 <211> LENGTH: 94 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 643 cctgttgcca
caaacccgta gatccgaact tgtggtatta gtccgcacaa gcttgtatct 60
ataggtatgt gtctgttagg caatctcacg gacc 94 <210> SEQ ID NO 644
<211> LENGTH: 94 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 644 cctgttgcca caaacccgta
gatccgaact tgtggtatta gtccgcacaa gcttgtatct 60 ataggtatgt
gtctgttagg caatctcaca gacc 94 <210> SEQ ID NO 645 <211>
LENGTH: 150 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 645 acctctctaa caaggtgcag agcttagctg
attggtgaac agtgattggt ttccgctttg 60 ttcacagtgg ctaagttctg
cacctgaaga gaaggtgaga tggggacagt taagttggag 120 ccgctggggc
agaggccgtt gctgacgggc 150 <210> SEQ ID NO 646 <211>
LENGTH: 150 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 646 acctctctaa caaggtgcag agcttagctg
attggtgaac agtgattggt ttccgctttg 60 ttcacagtgg ctaagttctg
cacctgaaga gaaggtgaga tggggacagt taagttggag 120 ccgctggggc
agaggccgtt gctgacaggc 150 <210> SEQ ID NO 647 <211>
LENGTH: 86 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 647 tgcttcccga ggccacatgc ttctttatat
ccccatatgg attactttgc tatggaatgt 60 aaggaagtgt gtggtttcgg caagtg 86
<210> SEQ ID NO 648 <211> LENGTH: 97 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 648
gtgctcggtt tgtaggcagt gtcattagct gattgtactg tggtggttac aatcactaac
60 tccactgcca tcaaaacaag gcacagcatc accgccg 97
<210> SEQ ID NO 649 <400> SEQUENCE: 649 000 <210>
SEQ ID NO 650 <211> LENGTH: 97 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 650
gtgctcggtt tgtaggcagt gtcattagct gattgtactg tggtggttac aatcactaac
60 tccactgcca tcaaaacaag gcacagcatc accaccg 97 <210> SEQ ID
NO 651 <211> LENGTH: 294 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 651 cttctggaag
ctggtttcac atggtggctt agatttttcc atctttgtat ctagcaccat 60
ttgaaatcag tgttttagga gtaagaattg cagcacagcc aagggtggac tgcagaggaa
120 ctgctgctca tggaactggc tcctctcctc ttgccacttg agtctgttcg
agaagtccag 180 ggaagaactt gaagagcaaa atacactctt gagtttgttg
ggttttggga gaggtgacag 240 tagagaaggg ggttgtgttt aaaataaaca
cagtggcttg agcaggggca gagg 294 <210> SEQ ID NO 652
<211> LENGTH: 294 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 652 cttctggaag ctggtttcac
atggtggctt agatttttcc atctttgtat ctagcaccat 60 ttgaaatcag
tgttttagga gtaagaattg cagcacagcc aagggtggac tgcagaggaa 120
ctgctgctca tggaactggc tcctctcctc ttgccacttg agtctgttcg agaagtccag
180 ggaagaactt gaagagcaaa atacactctt gagtttgttg ggttttggga
gaggtgacag 240 tagagaaggg ggttgtgttt aaaataaaca cagtggcttg
agcaggggca gaag 294 <210> SEQ ID NO 653 <211> LENGTH:
295 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 653 cttctggaag ctggtttcac atggtggctt
agatttttcc atctttgtat ctagcaccat 60 ttgaaatcag tgttttagga
gtaagaattg cagcacagcc aagggtggac tgcagaggaa 120 ctgctgctca
tggaactggc tcctctcctc ttgccacttg agtctgttcg agaagtccag 180
ggaagaaact tgaagagcaa aatacactct tgagtttgtt gggttttggg agaggtgaca
240 gtagagaagg gggttgtgtt taaaataaac acagtggctt gagcaggggc agagg
295 <210> SEQ ID NO 654 <211> LENGTH: 183 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
654 ggtcgggctc accatgacac agtgtgagac ctcgggctac aacacaggac
ccgggcgctg 60 ctctgacccc tcgtgtcttg tgttgcagcc ggagggacgc
aggtccgcag cagagcctgc 120 tccgcttgtc ctgagggact cgacacaggg
gactgcacag agaccatggg aaagtccagg 180 ctc 183 <210> SEQ ID NO
655 <211> LENGTH: 183 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 655 ggtcgggctc
accatgacac agtgtgagac ctcgggctac aacacaggac ccgggcgctg 60
ctctgacccc tcgtgtcttg tgttgcagcc ggagggacgc aggtccgcag cagagcctgc
120 tccgcttgtc ctgagggact cgacacaggg gactgcacag agaccatggg
aaagtccagg 180 ccc 183 <210> SEQ ID NO 656 <211>
LENGTH: 183 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 656 ggtcgggctc accatgacac agtgtgagac
tcgagctaca acacaggacc cggggcgctg 60 ctctgacccc tcgtgtcttg
tgttgcagcc ggagggacgc aggtccgcag cagagcctgc 120 tccgcttgtc
ctgagggact cgacacaggg gactgcacag agaccatggg aaagtccagg 180 ctc 183
<210> SEQ ID NO 657 <211> LENGTH: 203 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 657
gatttaggat gagttgagat cccagtgatc ttctcgctaa gagtttcctg cctgggcaag
60 gaggaaagat gctacaagtg gcccacttct gagatgcggg ctgcttctgg
atgacactgc 120 ttcccgaggc cacatgcttc tttatatccc catatggatt
actttgctat ggaatgtaag 180 gaagtgtgtg gtttcggcaa gtg 203 <210>
SEQ ID NO 658 <211> LENGTH: 203 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 658
gatttaggat gagttgagat cccagtgatc ttctcgctaa gagtttcctg cctgggcaag
60 gaggaaagat gctacaagtg gcccacttct gagatgcggg ctgcttctgg
atgacactgc 120 ttcccgaggc cacatgcttc tttatatccc catatggatt
acttttctat ggaatgtaag 180 gaagtgtgtg gtttcggcaa gtg 203 <210>
SEQ ID NO 659 <211> LENGTH: 203 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 659
gttttaggat gagttgagat cccagtgatc ttctcgctaa gagtttcctg cctgggcaag
60 gaggaaagat gctacaagtg gcccacttct gagatgcggg ctgcttctgg
atgacactgc 120 ttcccgaggc cacatgcttc tttatatccc catatggatt
acttttctat ggaatgtaag 180 gaagtgtgtg gtttcggcaa gtg 203 <210>
SEQ ID NO 660 <211> LENGTH: 120 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 660
cgaggtgcag accctgggag caccactggc ccatctctta cacaggctga ccgatttctc
60 ctggtgttca gagtctgttt ttgtctagca ccatttgaaa tcggttatga
tgtaggggga 120 <210> SEQ ID NO 661 <211> LENGTH: 120
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 661 caaggtgcag accctgggag caccactggc
ccatctctta cacaggctga ccgatttctc 60 ctggtgttca gagtctgttt
ttgtctagca ccatttgaaa tcggttatga tgtaggggga 120 <210> SEQ ID
NO 662 <211> LENGTH: 85 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 662 ccttagcaga
gctgtggagt gtgacaatgg tgtttgtgtc taaactatca aacgccatta 60
tcacactaaa tagctactgc taggc 85 <210> SEQ ID NO 663
<211> LENGTH: 85 <212> TYPE: DNA <213> ORGANISM:
Homo sapiens <400> SEQUENCE: 663 ccttagcaga gctgtggagt
gtgacaatgg tgtttgtgtc taaactatca aatgccatta 60 tcacactaaa
tagctactgc taggc 85 <210> SEQ ID NO 664 <211> LENGTH:
81 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 664 cttcaggaag ctggtttcat atggtggttt
agatttaaat agtgattgtc tagcaccatt 60 tgaaatcagt gttcttgggg g 81
* * * * *