U.S. patent application number 11/501466 was filed with the patent office on 2010-09-09 for nanoscale sensors.
This patent application is currently assigned to President and Fellows of Harvard College. Invention is credited to Charles M. Lieber, Fernando Patolsky, Gengfeng Zheng.
Application Number | 20100227382 11/501466 |
Document ID | / |
Family ID | 42678606 |
Filed Date | 2010-09-09 |
United States Patent
Application |
20100227382 |
Kind Code |
A1 |
Lieber; Charles M. ; et
al. |
September 9, 2010 |
Nanoscale sensors
Abstract
Various aspects of the present invention generally relate to
nanoscale wire devices and methods for use in determining analytes
suspected to be present in a sample, and systems and methods of
immobilizing entities such as reaction entities relative to
nanoscale wires. In one aspect, a nucleic acid, such as DNA, may be
immobilized relative to a nanoscale wire, and in some cases, grown
from the nanoscale wire. In certain embodiments, the nucleic acid
may interact with entities such as other nucleic acids, proteins,
etc., and in some cases, such interactions may be reversible. As an
example, an enzyme such as telomerase may be allowed to bind to DNA
immobilized relative to a nanoscale wire. The telomerase may extend
the length of the DNA, for instance, by reaction with free
deoxynucleotide triphosphates in solution; additionally, various
properties of the nucleic acid may be determined, for example,
using electric field interactions between the nucleic acid and the
nanoscale wire. In another aspect, the invention provides systems
and methods for attaching entities such as nucleic acids, receptors
such as gangliosides, or surfactants to a nanoscale wire, for
example, using aldehyde-producing reactions or hydrophobic
interactions. In some aspects, certain systems and methods of the
present invention may be used to determine an analyte suspected to
be present in a sample, for example, a toxin, a virus, or a small
molecule. Systems and methods of using such nanoscale wires are
disclosed in other aspects of the invention, for example, within a
microarray. Still other aspects of the invention include assays,
sensors, kits, and/or other devices that include such nanoscale
wires, methods of making and/or using functionalized nanoscale
wires (for example, in drug screening or high-throughput
screening), and the like.
Inventors: |
Lieber; Charles M.;
(Lexington, MA) ; Patolsky; Fernando; (Rehovot,
IL) ; Zheng; Gengfeng; (Dorchester, MA) |
Correspondence
Address: |
Harvard University & Medical School;c/o Wolf, Greenfield & Sacks, P.C.
600 Atlantic Avenue
Boston
MA
02210-2206
US
|
Assignee: |
President and Fellows of Harvard
College
Cambridge
MA
|
Family ID: |
42678606 |
Appl. No.: |
11/501466 |
Filed: |
August 9, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11137784 |
May 25, 2005 |
|
|
|
11501466 |
|
|
|
|
60707136 |
Aug 9, 2005 |
|
|
|
Current U.S.
Class: |
435/287.1 ;
422/69; 977/762 |
Current CPC
Class: |
C12Q 1/6834 20130101;
G01N 33/6854 20130101; A61B 5/418 20130101; A61B 2562/0285
20130101; C12Q 1/6834 20130101; A61B 5/415 20130101; A61B
2018/00875 20130101; C12Q 1/6825 20130101; G01N 2333/96455
20130101; A61B 5/14546 20130101; C12Q 1/6825 20130101; C12Q
2563/155 20130101; C12Q 2563/155 20130101; C12Q 2565/607 20130101;
C12Q 2565/607 20130101; C12Q 2563/125 20130101; C12Q 2563/125
20130101; G01N 33/54353 20130101 |
Class at
Publication: |
435/287.1 ;
422/69; 977/762 |
International
Class: |
C12M 1/34 20060101
C12M001/34; G01N 30/00 20060101 G01N030/00 |
Goverment Interests
FEDERALLY SPONSORED RESEARCH
[0002] Research leading to various aspects of the present invention
were sponsored, at least in part, by the Defense Advanced Research
Projects Agency and the National Cancer Institute. The United
States Government may have certain rights in the invention.
Claims
1-26. (canceled)
27. An article, comprising: a silicon nanoscale wire having a
surface, at least a portion of which is aldehyde-functionalized;
and an entity covalently bonded to the aldehyde-functionalized
surface via an imine bond, wherein the entity comprises an
antibody.
28-125. (canceled)
126. The article of claim 27, wherein the portion of the silicon
nanoscale wire which is aldehyde-functionalized is functionalized
with aldehyde propyltrimethoxysilane.
127. The article of claim 27, wherein the antibody is an antibody
to prostate specific antigen.
128. The article of claim 27, wherein the silicon nanoscale wire
has a cross-sectional dimension of less than about 20 nm.
129. An article comprising: a nanoscale wire having a surface, at
least a portion of which is aldehyde-functionalized; and an entity
covalently bonded to the aldehyde-functionalized surface via an
imine bond, wherein the entity comprises a telomerase.
130. The article of claim 129, wherein the portion of the silicon
nanoscale wire which is aldehyde-functionalized is functionalized
with aldehyde propyltrimethoxysilane.
131. The article of claim 129, wherein the silicon nanoscale wire
has a cross-sectional dimension of less than about 20 nm.
Description
RELATED APPLICATIONS
[0001] This application claims priority to all of the following
according to the following recitation of priority relationships.
This application claims the benefit of U.S. Provisional Patent
Application Ser. No. 60/707,136, filed Aug. 9, 2005, entitled
"Nanoscale Sensors," by Lieber, et al. This application is also a
continuation-in-part of U.S. patent application Ser. No.
11/137,784, filed May 25, 2005, entitled "Nanoscale Sensors," by
Lieber, et al. Each of these is incorporated herein by
reference.
FIELD OF INVENTION
[0003] Various aspects of the present invention generally relate to
nanoscale wire devices and methods for use in determining analytes
suspected to be present in a sample, and systems and methods of
immobilizing entities such as reaction entities relative to
nanoscale wires.
BACKGROUND
[0004] Interest in nanotechnology, in particular
sub-microelectronic technologies such as semiconductor quantum dots
and nanowires, has been motivated by the challenges of chemistry
and physics at the nanoscale, and by the prospect of utilizing
these structures in electronic and related devices. Nanoscopic
articles might be well-suited for transport of charge carriers and
excitons (e.g. electrons, electron pairs, etc.) and thus may be
useful as building blocks in nanoscale electronics applications.
Nanowires are well-suited for efficient transport of charge
carriers and excitons, and thus are expected to be important
building blocks for nanoscale electronics and optoelectronics.
[0005] Nanoscale wires having selectively functionalized surfaces
have been described in U.S. patent application Ser. No. 10/020,004,
entitled "Nanosensors," filed Dec. 11, 2001, published as
Publication No. 2002/0117659 on Aug. 29, 2002, and as corresponding
International Patent Application Serial No. PCT/US01/48230, filed
Dec. 11, 2001, published as International Patent Application
Publication WO 02/48701 on Jun. 20, 2002 (each incorporated herein
by reference). As described, functionalization of the nanoscale
wire may permit interaction of the functionalized nanoscale wire
with various entities, such as molecular entities, and the
interaction induces a change in a property of the functionalized
nanowire, which provides a mechanism for a nanoscale sensor device
for detecting the presence or absence of an analyte suspected to be
present in a sample.
SUMMARY OF THE INVENTION
[0006] Various aspects of the present invention generally relate to
nanoscale wire devices and methods for use in determining analytes
suspected to be present in a sample, and systems and methods of
immobilizing entities such as reaction entities relative to
nanoscale wires. The subject matter of the present invention
involves, in some cases, interrelated products, alternative
solutions to a particular problem, and/or a plurality of different
uses of one or more systems and/or articles.
[0007] In one aspect, the invention is a method. In one set of
embodiments, the method is a method of virus detection. The method,
in one embodiment, includes an act of determining a single virus by
causing the virus to bind an antibody. In some cases, the antibody
is immobilized relative to a surface of a nanoscale wire via a
nitrogen-containing bond.
[0008] In another set of embodiments, the method is a method of
cancer diagnosis. In one embodiment, the method includes acts of
exposing a sample suspected of containing a telomerase to a nucleic
acid immobilized relative to a nanoscale wire, determining binding
of the telomerase to the nucleic acid, and diagnosing cancer based
on the binding of the telomerase to the nucleic acid.
[0009] The method, in yet another set of embodiments, is a method
of determining a toxin. In one embodiment, the method includes acts
of exposing a sample suspected of containing a toxin to a
ganglioside immobilized relative to a nanoscale wire, and
determining binding of the toxin to the ganglioside.
[0010] In still another set of embodiments, the method includes
acts of adding one or more nucleotides, using a telomerase, to a
nucleic acid immobilized relative to a nanoscale wire.
[0011] In one set of embodiments, the method includes acts of
exposing a sample suspected of containing a nucleic acid synthesis
enzyme to a nucleic acid immobilized relative to a nanoscale wire,
and determining binding of the enzyme to the nucleic acid. The
method, in another set of embodiments, includes an act of adding
one or more nucleotides to a nucleic acid immobilized relative to a
nanoscale wire. In still another set of embodiments, the method
includes acts of immobilizing a first nucleic acid relative to a
nanoscale wire, and immobilizing a second nucleic acid relative to
the first nucleic acid.
[0012] The method, in yet another set of embodiments, includes an
act of replacing a first nucleic acid immobilized relative to a
nanoscale wire with a second nucleic acid without breaking a
covalent bond between the first nucleic acid and the nanoscale
wire. In another set of embodiments, the method includes an act of
replacing a first protein immobilized relative to a nanoscale wire
with a second protein without breaking a covalent bond between the
first protein and the nanoscale wire. The method includes, in still
another set of embodiments, acts of providing a nucleic acid
immobilized relative to a nanoscale wire, immobilizing an entity
relative to the nucleic acid, determining an electrical property of
the nanoscale wire, and determining a property of the nucleic acid
using the electrical property.
[0013] Another set of embodiments of the invention provides a
method of detecting an uncharged analyte. In one embodiment, the
method includes acts of providing a liquid comprising an analyte
that is uncharged, immobilizing the species relative to the nucleic
acid, altering pH of the liquid such that the entity becomes
charged, and determining an electrical property of the nanoscale
wire to detect the analyte.
[0014] The method, according to another set of embodiments,
includes an act of covalently bonding an entity to a surface of a
nanoscale wire by forming an imine bond between the nanoscale wire
and the entity. In still another set of embodiments, the method
includes an act of covalently bonding an entity to a surface of a
nanoscale wire by forming an amide bond between the nanoscale wire
and the entity. In yet another set of embodiments, the method
includes an act of reacting a surface of a nanoscale wire with an
aldehyde to produce an aldehyde-functionalized surface. The method,
in another set of embodiments, includes an act of reacting a
surface of a nanoscale wire with an amine to produce an
amine-functionalized surface. In yet another set of embodiments,
the method includes an act of reacting a surface of a nanoscale
wire with a thiol to produce a thiol-functionalized surface.
[0015] In another set of embodiments, the method includes an act of
reacting a molecule comprising a halogenated silane with a
nanoscale wire such that at least a portion of the silane becomes
covalently bonded to the nanoscale wire.
[0016] The method, according to still another set of embodiments,
includes acts of providing a nanoscale wire having a surface, at
least a portion of the surface comprising a monolayer covalently
bonded thereon, and immobilizing an entity relative to the
monolayer via a hydrophobic interaction between at least a portion
of the entity and the monolayer. In another set of embodiments, the
method includes acts of providing a nanoscale wire having a
surface, at least a portion of the surface comprising one or more
layers of molecules covalently immobilized relative to the
nanoscale wire, and immobilizing an entity relative to the one or
more layers via a hydrophobic interaction between at least a
portion of the entity and the one or more layers.
[0017] In one set of embodiments, the method includes acts of
providing a solution containing a concentration of an analyte of
interest and a total solute concentration at least about 1000 times
greater than the concentration of the analyte of interest, and
determining the analyte of interest in solution using a nanoscale
wire comprising an entity able to bind the analyte.
[0018] The method, in yet another set of embodiments, includes an
act of annealing a nickel electrode to a nanoscale wire.
[0019] In one set of embodiments, the method includes acts of
attaching, to the surface of a nanoscale wire, a layer of
molecules, determining the thickness of the layer on the nanoscale
wire, and thereafter, attaching an entity to at least a portion of
the layer of the nanoscale wire. In another set of embodiments, the
method includes acts of forming a precursor of a linker on a
nanoscale wire, under conditions preselected to apply a controlled
thickness of the precursor to the nanoscale wire, and covalently
attaching an entity to the precursor to form an entity covalently
linked via the linker to the nanoscale wire.
[0020] In another aspect, the invention is an article. The article,
according to one set of embodiments, includes a nanoscale wire, a
first nucleic acid immobilized relative to a nanoscale wire, and a
second nucleic acid immobilized relative to the first nucleic
acid.
[0021] The article includes a nanoscale wire having a surface, in
one set of embodiments. In one embodiment, at least a portion of
the surface is aldehyde-functionalized, amine-functionalized,
and/or thiol-functionalized. In another embodiment, at least a
portion of the surface comprises a monolayer covalently bonded
thereon. In still another embodiment, at least a portion of the
surface comprises one or more layers of molecules covalently
immobilized relative to the nanoscale wire. In yet another
embodiment, at least a portion of the surface comprises more than
one layer covalently immobilized relative thereto. The article
includes, in another set of embodiments, a ganglioside immobilized
relative to a nanoscale wire.
[0022] In yet another set of embodiments, the article includes a
microarray comprising a plurality of sensing regions. In some
cases, at least some of the sensing regions comprise a plurality of
nanoscale wires that are individually addressable. In certain
instances, at least some of the nanoscale wires comprise reaction
entities. In one embodiment, the microarray contains the
individually addressable nanoscale wires at a density of at least
about 120 nanoscale wires/cm.sup.2.
[0023] The article, in still another set of embodiments, includes a
first electrode, a first electrical contact in electronic
communication with the first electrode, a plurality of second
electrodes, each of which is in electrical communication with a
second electrical contact, and a plurality of nanoscale wires, at
least some of which comprise reaction entities, at least some of
which are disposed between the first electrode and one of the
second electrodes.
[0024] In yet another set of embodiments, the article includes a
nanoscale wire having a core, and optionally a shell, and a linker
covalently attaching an entity to the nanoscale wire. In some
cases, the distance between the entity and the outermost border of
the core is no more than about 20 nm.
[0025] Yet another aspect of the present invention provides a
nanoscale electrical sensor array device. In some embodiments, the
device comprises a first electrode, a first nanoscale wire in
electrical communication with the first electrode and in electrical
communication with a first-counter electrode, a second nanoscale
wire in electrical communication with the first electrode and in
electrical communication with a second counter electrode, a first
reaction entity immobilized relative to the first nanoscale wire
such that a binding event involving the first reaction entity is
detectable by the nanoscale electrical sensor array device, and a
second reaction entity immobilized relative to the second nanoscale
wire such that a binding event involving the second reaction entity
is detectable by the nanoscale electrical sensor array device
independently of detection of a binding event involving the first
reaction entity.
[0026] In another set of embodiments, the nanoscale electrical
sensor array device includes a first nanoscale wire, a second
nanoscale wire differing in composition from the first nanoscale
wire, a first reaction entity immobilized relative to the first
nanoscale wire such that a binding event involving the first
reaction entity is detectable by the nanoscale electrical sensor
array device, and a second reaction entity immobilized relative to
the second nanoscale wire such that a binding event involving the
second reaction entity is detectable by the nanoscale electrical
sensor array device independently of detection of a binding event
involving the first reaction entity.
[0027] Still another aspect of the invention provides a
densely-packed nanoscale electrical sensor array. In certain
embodiments, the array comprises a first, generally elongate
electrode, a first electrical lead in electronic communication with
the first electrode, and a plurality of second electrodes, each
spaced essentially equidistantly from the first electrode, and each
in electrical communication with one of a plurality of separate,
second electrical leads. The plurality of second electrodes may be
disposed in a generally linear array essentially parallel to the
first electrode. The array may also comprise a plurality of
nanoscale wires, at least some of which span and are in electrical
communication with the first electrode and one of the second
electrodes, and a plurality of reaction entities positioned
proximate the nanowires. In certain cases, the first and the
plurality of second electrical leads define portions of an
electrical circuit having the ability to sense a binding event
involving a reaction entity, where each of the plurality of second
electrical leads includes a portion nearest a second electrode that
is both parallel to an adjacent second electrical lead and not
perpendicular to the first electrode and the generally linear array
of second electrodes.
[0028] The article, in another set of embodiments, includes a
nanoscale wire, a nickel electrode annealed to the nanoscale wire,
and a reaction entity immobilized relative to the nanoscale
wire.
[0029] In another aspect, the present invention is directed to a
method of making one or more of the embodiments described herein,
for example, a sensing device comprising a nanoscale wire. In yet
another aspect, the present invention is directed to a method of
using one or more of the embodiments described herein, for example,
a sensing device comprising a nanoscale wire. In still another
aspect, the present invention is directed to a method of promoting
one or more of the embodiments described herein, for example, a
sensing device comprising a nanoscale wire.
[0030] Other advantages and novel features of the present invention
will become apparent from the following detailed description of
various non-limiting embodiments of the invention when considered
in conjunction with the accompanying figures. In cases where the
present specification and a document incorporated by reference
include conflicting and/or inconsistent disclosure, the present
specification shall control. If two or more documents incorporated
by reference include conflicting and/or inconsistent disclosure
with respect to each other, then the document having the later
effective date shall control.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Non-limiting embodiments of the present invention will be
described by way of example with reference to the accompanying
figures, which are schematic and are not intended to be drawn to
scale. In the figures, each identical or nearly identical component
illustrated is typically represented by a single numeral. For
purposes of clarity, not every component is labeled in every
figure, nor is every component of each embodiment of the invention
shown where illustration is not necessary to allow those of
ordinary skill in the art to understand the invention. In the
figures:
[0032] FIGS. 1A-1C are schematic diagrams illustrating telomerase
binding, in one embodiment of the invention;
[0033] FIGS. 2A-2C are schematic diagrams illustrating the
determination of an enzyme using another embodiment of the
invention;
[0034] FIGS. 3A-3D illustrate certain gangliosides, as used in
certain embodiments of the invention;
[0035] FIGS. 4A-4E illustrate sensors according to various
embodiments of the invention;
[0036] FIGS. 5A-5F illustrate various devices of the invention;
[0037] FIGS. 6A-6B schematically illustrate a nanoscale detector
device having a reaction entity, according to one embodiment of the
invention;
[0038] FIGS. 7A-7B schematically illustrate certain nanoscale
detector devices that can be used in connection with the
invention;
[0039] FIGS. 8A-8D illustrate various field effect transistors
including nanoscale detectors that can be used in connection with
certain embodiments of the invention;
[0040] FIGS. 9A-9E illustrate various nanoscale wire sensors and
some of their properties, according to certain embodiments of the
invention;
[0041] FIGS. 10A-10B illustrate a nanoscale wire sensor, according
to another embodiment of the invention;
[0042] FIGS. 11A-11B illustrate the concentration-dependent
detection of various marker proteins, in another embodiment of the
invention;
[0043] FIGS. 12A-12B illustrate multiplexed detection using various
nanoscale wire sensors, according to other embodiments of the
invention;
[0044] FIG. 13 illustrates the multiplexed detection of certain
marker proteins, according to one embodiment of the invention;
[0045] FIGS. 14A-14B illustrate the detection of certain cancer
marker proteins, according to still another embodiment of the
invention;
[0046] FIGS. 15A-15C illustrate data showing the binding of
telomerase, in another embodiment of the invention;
[0047] FIGS. 16A-16B illustrate telomerase binding in yet another
embodiment of the invention;
[0048] FIGS. 17A-17B illustrate the detection of certain viruses,
according to another embodiment of the invention;
[0049] FIGS. 18A-18D illustrate the detection of certain viruses,
according to another embodiment of the invention;
[0050] FIGS. 19A-19D illustrate the binding of certain viruses to a
nanoscale wire, in yet another embodiment of the invention; and
[0051] FIGS. 20A-20D illustrate single virus binding, in another
embodiment of the invention;
[0052] FIGS. 21A-21D illustrate the detection of certain viruses,
according to yet another embodiment of the invention;
[0053] FIGS. 22A-22C illustrate the detection of viruses, according
to still another embodiment of the invention;
[0054] FIGS. 23A-23F illustrate the placement of antibodies on a
nanoscale wire, in another embodiment of the invention;
[0055] FIGS. 24A-24I illustrate multiplexed detection of various
analytes, according to other embodiments of the invention;
[0056] FIGS. 25A-25H illustrate the passivation of a metal
electrode, according to still another embodiment of the
invention;
[0057] FIGS. 26A-26C are schematic diagrams illustrating processes
useful in making certain embodiments of the invention;
[0058] FIGS. 27A-27D illustrate current vs. voltage characteristics
for certain embodiments of the invention;
[0059] FIGS. 28A-28C illustrate the measurement of a nanowire FET,
in yet another embodiment of the invention; and
[0060] FIG. 29 is a schematic diagram indicating antibody
modification of a nanowire, in one embodiment of the invention.
BRIEF DESCRIPTION OF THE SEQUENCES
[0061] SEQ ID NO: 1 is TTAGGG, a telomeric repeat sequence;
[0062] SEQ ID NO: 2 is TTGGGG, a telomeric repeat sequence;
[0063] SEQ ID NO: 3 is TTGGGT, a telomeric repeat sequence;
[0064] SEQ ID NO: 4 is TTTTGGGG, a telomeric repeat sequence;
[0065] SEQ ID NO: 5 is TTAGGGT, a telomeric repeat sequence;
[0066] SEQ ID NO: 6 is TTAGGGC, a telomeric repeat sequence;
[0067] SEQ ID NO: 7 is TTTAGGG, a telomeric repeat sequence;
[0068] SEQ ID NO: 8 is TTTTAGGG, a telomeric repeat sequence;
[0069] SEQ ID NO: 9 is TTAGG, a telomeric repeat sequence;
[0070] SEQ ID NO: 10 is TTAGGC, a telomeric repeat sequence;
[0071] SEQ ID NO: 11 is AG, a telomeric repeat sequence;
[0072] SEQ ID NO: 12 is AGG, a telomeric repeat sequence;
[0073] SEQ ID NO: 13 is AGGG, a telomeric repeat sequence;
[0074] SEQ ID NO: 14 is AGGGG, a telomeric repeat sequence;
[0075] SEQ ID NO: 15 is AGGGGG, a telomeric repeat sequence;
[0076] SEQ ID NO: 16 is AGGGGGG, a telomeric repeat sequence;
[0077] SEQ ID NO: 17 is AGGGGGGG, a telomeric repeat sequence;
[0078] SEQ ID NO: 18 is AGGGGGGGG, a telomeric repeat sequence;
[0079] SEQ ID NO: 19 is TTACG, a telomeric repeat sequence;
[0080] SEQ ID NO: 20 is TTACGG, a telomeric repeat sequence;
[0081] SEQ ID NO: 21 is TTACGGG, a telomeric repeat sequence;
[0082] SEQ ID NO: 22 is TTACGGGG, a telomeric repeat sequence;
[0083] SEQ ID NO: 23 is TTACGGGGG, a telomeric repeat sequence;
[0084] SEQ ID NO: 24 is TTACGGGGGG, a telomeric repeat
sequence;
[0085] SEQ ID NO: 25 is TTACGGGGGGG, a telomeric repeat
sequence;
[0086] SEQ ID NO: 26 is TTACGGGGGGGG, a telomeric repeat
sequence;
[0087] SEQ ID NO: 27 is TTACAG, a telomeric repeat sequence;
[0088] SEQ ID NO: 28 is TTACAGG, a telomeric repeat sequence;
[0089] SEQ ID NO: 29 is TTACAGGG, a telomeric repeat sequence;
[0090] SEQ ID NO: 30 is TTACAGGGG, a telomeric repeat sequence;
[0091] SEQ ID NO: 31 is TTACAGGGGG, a telomeric repeat
sequence;
[0092] SEQ ID NO: 32 is TTACAGGGGGG, a telomeric repeat
sequence;
[0093] SEQ ID NO: 33 is TTACAGGGGGGG, a telomeric repeat
sequence;
[0094] SEQ ID NO: 34 is TTACAGGGGGGGG, a telomeric repeat
sequence;
[0095] SEQ ID NO: 35 is TTACCG, a telomeric repeat sequence;
[0096] SEQ ID NO: 36 is TTACCGG, a telomeric repeat sequence;
[0097] SEQ ID NO: 37 is TTACCGGG, a telomeric repeat sequence;
[0098] SEQ ID NO: 38 is TTACCGGGG, a telomeric repeat sequence;
[0099] SEQ ID NO: 39 is TTACCGGGGG, a telomeric repeat
sequence;
[0100] SEQ ID NO: 40 is TTACCGGGGGG, a telomeric repeat
sequence;
[0101] SEQ ID NO: 41 is TTACCGGGGGGG, a telomeric repeat
sequence;
[0102] SEQ ID NO: 42 is TTACCGGGGGGGG, a telomeric repeat
sequence;
[0103] SEQ ID NO: 43 is TTACACG, a telomeric repeat sequence;
[0104] SEQ ID NO: 44 is TTACACGG, a telomeric repeat sequence;
[0105] SEQ ID NO: 45 is TTACACGGG, a telomeric repeat sequence;
[0106] SEQ ID NO: 46 is TTACACGGGG, a telomeric repeat
sequence;
[0107] SEQ ID NO: 47 is TTACACGGGGG, a telomeric repeat
sequence;
[0108] SEQ ID NO: 48 is TTACACGGGGGG, a telomeric repeat
sequence;
[0109] SEQ ID NO: 49 is TTACACGGGGGGG, a telomeric repeat
sequence;
[0110] SEQ ID NO: 50 is TTACACGGGGGGGG, a telomeric repeat
sequence;
[0111] SEQ ID NO: 51 is TGTGGGTGTGGTG, a telomeric repeat
sequence;
[0112] SEQ ID NO: 52 is GGGGTCTGGGTGCTG, a telomeric repeat
sequence;
[0113] SEQ ID NO: 53 is GGTGTACGGATGTCTAACTTCTT, a telomeric repeat
sequence;
[0114] SEQ ID NO: 54 is GGTGTACGGATGTCACGATCATT, a telomeric repeat
sequence;
[0115] SEQ ID NO: 55 is GGTGTAAGGATGTCACGATCATT, a telomeric repeat
sequence;
[0116] SEQ ID NO: 56 is GGTGTACGGATGCAGACTCGCTT, a telomeric repeat
sequence;
[0117] SEQ ID NO: 57 is GGTGTAC, a telomeric repeat sequence;
[0118] SEQ ID NO: 58 is GGTGTACGGATTTGATTAGTTATGT, a telomeric
repeat sequence;
[0119] SEQ ID NO: 59 is GGTGTACGGATTTGATTAGGTATGT, a telomeric
repeat sequence; and SEQ ID NO: 60 is
H.sub.2N--(CH.sub.2).sub.6-TTTTTTAATCCGTCGAGCAGAGTT, an
amino-modified oligonucleotide.
DETAILED DESCRIPTION
[0120] Various aspects of the present invention generally relate to
nanoscale wire devices and methods for use in determining analytes
suspected to be present in a sample, and systems and methods of
immobilizing entities such as reaction entities relative to
nanoscale wires. In one aspect, a nucleic acid, such as DNA, may be
immobilized relative to a nanoscale wire, and in some cases, grown
from the nanoscale wire. In certain embodiments, the nucleic acid
may interact with entities such as other nucleic acids, proteins,
etc., and in some cases, such interactions may be reversible. As an
example, an enzyme such as a telomerase may be allowed to bind to
DNA immobilized relative to a nanoscale wire. The telomerase may
extend the length of the DNA, for instance, by reaction with free
deoxynucleotide triphosphates in solution; additionally, various
properties of the nucleic acid may be determined, for example,
using electric field interactions between the nucleic acid and the
nanoscale wire. In another aspect, the invention provides systems
and methods for attaching entities such as nucleic acids, receptors
such as gangliosides, or surfactants to a nanoscale wire, for
example, using aldehyde-producing reactions or hydrophobic
interactions. In some aspects, certain systems and methods of the
present invention may be used to determine an analyte suspected to
be present in a sample, for example, a toxin, a virus, or a small
molecule. Systems and methods of using such nanoscale wires are
disclosed in other aspects of the invention, for example, within a
microarray. Still other aspects of the invention include assays,
sensors, kits, and/or other devices that include such nanoscale
wires, methods of making and/or using functionalized nanoscale
wires (for example, in drug screening or high-throughput
screening), and the like.
[0121] One embodiment of the present invention allows for the
detection and/or quantification (i.e., determination) of a
telomerase enzyme, for example, in a cancer test or a drug screen.
In this embodiment, a nanoscale wire can have one or more nucleic
acids covalently bonded thereon (or otherwise immobilized relative
to the nanoscale wire), where the nucleic acid is chosen such that
the telomerase will bind to the nucleic acid. For example, the
nucleic acid may be substantially complementary to the nucleic acid
component of the telomerase enzyme (or a portion thereof). Binding
of the telomerase to the nucleic acid may alter the conductivity of
the nanoscale wire. For instance, if the telomerase is charged, the
immobilization of a charged entity relative to the nanoscale wire
may alter the conductivity (or other electronic property) of the
nanoscale wire, which can then be detected and recorded. Thus, by
determining the conductivity of the nanoscale wire, the presence
and/or concentration of the telomerase within a sample can be
determined.
[0122] In another embodiment of the present invention, a toxin,
such as cholera toxin or botulinum toxin, may be determined, for
example, in an environmental study or a food test. In this
embodiment, a nanoscale wire may have one or more gangliosides
immobilized relative thereto. For instance, a hydrophobic
interaction between the hydrophobic portion of the ganglioside and
a hydrophobic monolayer present on the surface of the nanoscale
wire can be used to immobilize the ganglioside relative to the
nanoscale wire. The ganglioside is chosen to specifically bind the
toxin. If the toxin is charged, upon binding, the toxin may alter
the conductivity (or other electronic property) of the nanoscale
wire, which can then be detected and recorded. Thus, by determining
the conductivity of the nanoscale wire, the presence and/or
concentration of the toxin in a sample can be determined.
[0123] However, it should be noted that the present invention is
not limited to the above-described embodiments. In general, various
aspects of the present invention provide a sensing element
comprising a nanoscale wire able to interact with one or more
analytes. For example, the nanoscale wire may be used to determine
an analyte as part of an assay for determining or diagnosing cancer
or other medical conditions (e.g., by determining a suitable
marker, for example, a hormone, an enzyme, a peptide, a virus,
etc., and diagnosing the cancer or other medical condition based on
the determination of the marker), for determining drugs (e.g., as
part of a drug assay or a drug screen, for instance, to identify a
drug able to treat a medical condition such as cancer or aging),
for determining toxins or other environmental agents (e.g., by
determining binding of the toxin to a receptor), or the like.
[0124] The nanoscale wire may have a reaction entity able to
interact with an analyte of interest. Nanoscale sensing elements of
the invention may be used, for example, to determine pH or metal
ions, viruses, proteins or enzymes (e.g., a telomerase or other
enzymes able to bind a nucleic acid, as further described below),
nucleic acids (e.g. DNA, RNA, PNA, etc.), drugs, sugars,
carbohydrates, a toxin (e.g., a harmful chemical, such as a
chemical produced by a living organism that is harmful to other
organisms), small molecules (e.g., having molecular weights of less
than about 2000 Da, less than about 1500 Da, or less than about
1000 Da), or other analytes of interest, as further described
herein. The analyte may be charged, or uncharged in some
embodiments. In certain embodiments, single entities may be
determined, for example, a single virus, a single protein, a single
enzyme, a single nucleic acid molecule, a single drug molecule, a
single carbohydrate molecule, etc. In some cases, the sensing
element includes a detector constructed and arranged to determine a
change in a property of the nanoscale wire, for example, a change
in light emission, a change in stress or shape, or a change in an
electrical property of the nanoscale wire, such as voltage,
current, conductivity, resistivity, inductance, impedance,
electrical change, an electromagnetic change, etc. In one set of
embodiments, at least a portion of the nanoscale wire is
addressable by a sample (e.g., a gas or liquid sample) containing,
or at least suspected of containing, the analyte. The term
"addressable," e.g., by a fluid, is defined as the ability of the
fluid to be positioned relative to the nanoscale wire so that the
analytes suspected of being in the fluid are able to interact with
the nanoscale wire. The fluid may be proximate to or in contact
with the nanoscale wire. In some embodiments, the fluid may be
directed to the nanoscale wire through the use of a microfluidic
channel, as further described below.
[0125] As used herein, the term "reaction entity" refers to any
entity that can interact with an analyte in such a manner as to
cause a detectable change in a property of a nanoscale wire. The
reaction entity may comprise a binding partner to which the analyte
binds. The reaction entity, when a binding partner, can comprise a
specific binding partner of the analyte. In some cases, the
reaction entity can form a coating on the nanoscale wire.
Non-limiting examples of reaction entities include a nucleic acid
(e.g., DNA or RNA), an antibody, a sugar or a carbohydrate, a
protein or an enzyme, a ganglioside or a surfactant, etc., e.g., as
discussed herein.
[0126] In one set of embodiments, a reaction entity associated with
the nanoscale wire is able to interact with an analyte. The
reaction entity, as "associated" with or "immobilized" relative to
the nanoscale wire, may be positioned in relation to the nanoscale
wire (e.g., in close proximity or in contact) such that the analyte
can be determined by determining a change in a characteristic or
property of the nanoscale wire. Interaction of the analyte with the
reaction entity may cause a detectable change or modulation in a
property of the nanoscale wire, for example, through electrical
coupling with the reaction entity. The term "electrically coupled"
or "electrocoupling," when used with reference to a nanoscale wire
and an analyte, or other moiety such as a reaction entity, refers
to an association between any of the analyte, other moiety, and the
nanoscale wire such that electrons can move from one to the other,
or in which a change in an electrical characteristic of one can be
determined by the other. This can include electron flow between
these entities, or a change in a state of charge, oxidation, or the
like, that can be determined by the nanoscale wire. As examples,
electrical coupling or immobilization can include direct covalent
linkage between the analyte or other moiety and the nanoscale wire,
indirect covalent coupling (for instance, via a linker, and/or a
plurality of linkers, e.g., serially), direct or indirect ionic
bonding between the analyte (or other moiety) and the nanoscale
wire, direct or indirect bonding of both the analyte and the
nanoscale wire to a particle (i.e., the particle acts as a linker
between the analyte and the nanoscale wire), direct or indirect
bonding of both the analyte and the nanoscale wire to a common
surface (i.e., the surface acts as a linker), or other types of
bonding or interactions (e.g. hydrophobic interactions or hydrogen
bonding). In some cases, no actual covalent bonding is required;
for example, the analyte or other moiety may simply be contacted
with the nanoscale wire surface. There also need not necessarily be
any contact between the nanoscale wire and the analyte or other
moiety where the nanoscale wire is sufficiently close to the
analyte to permit electron tunneling between the analyte and the
nanoscale wire.
[0127] Thus, the reaction entity may be positioned relative to the
nanoscale wire to cause a detectable change in the nanoscale wire.
In some cases, the reaction entity may be positioned within about
100 nm of the nanoscale wire, within about 75 nm of the nanoscale
wire, within about 50 nm of the nanoscale wire, within about 20 nm
of the nanoscale wire, within about 15 nm of the nanoscale wire, or
within about 10 nm of the nanoscale wire. The actual proximity can
be determined by those of ordinary skill in the art. In some cases,
the reaction entity is positioned less than about 5 nm from the
nanoscale wire. In other cases, the reaction entity is positioned
within about 4 nm, within about 3 nm, within about 2 nm, or within
about 1 nm of the nanoscale wire.
[0128] In some embodiments, the reaction entity is fastened to or
directly bonded (e.g., covalently) to the nanoscale wire, e.g., as
further described herein. However, in other embodiments, the
reaction entity is not directly bonded to the nanoscale wire, but
is otherwise immobilized relative to the nanoscale wire, i.e., the
reaction entity is indirectly immobilized relative to the nanoscale
wire. For instance, the reaction entity may be attached to the
nanoscale wire through a linker, i.e., a species (or plurality of
species) to which the reaction entity and the nanoscale wire are
each immobilized relative thereto, e.g., covalently or
non-covalently bound to. As an example, a linker may be directly
bonded to the nanoscale wire, and the reaction entity may be
directly bonded to the linker, or the reaction entity may not be
directly bonded to the linker, but immobilized relative to the
linker, e.g., through the use of non-covalent bonds such as
hydrogen bonding (e.g., as in complementary nucleic acid-nucleic
acid interactions), hydrophobic interactions (e.g., between
hydrocarbon chains), entropic interactions, or the like. The linker
may or may not be directly bonded (e.g., covalently) to the
nanoscale wire.
[0129] As used herein, a first portion of a nucleic acid is
"complementary" to a second portion of a nucleic acid if the
nucleotides of the first portion and the nucleotides of the second
portion are complementary (i.e., A to T or U, C to G, etc.) and/or
the portions are at least 75% complementary (i.e., at least 75% of
the nucleotides of the first and second portions of the nucleic
acids are complementary). In some cases, the nucleic acid portions
are at least 80%, at least 85%, at least 90%, at least 95%, at
least 96%, at least 97%, at least 98%, or at least 99%
complementary. In some embodiments, the first and second portions
have a maximum of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide
mismatches. The complementary portions of the nucleotides may be at
least 5 nucleotides long, and in some cases, at least 7 nucleotides
long, at least about 10 nucleotides long, at least about 12
nucleotides long, at least about 15 nucleotides long, at least
about 20 nucleotides long, at least about 25 nucleotides long, or
at least about 50 nucleotides long.
[0130] As one particular, non-limiting example, an enzyme able to
bind a nucleic acid can be bound to a nucleic acid covalently bound
to a nanoscale wire, or the enzyme may be bound to a first nucleic
acid that is not covalently bound to the nanoscale wire, but is
otherwise immobilized relative to the nanoscale wire, e.g., by
complementary binding to a second nucleic acid that is covalently
bound to the nanoscale wire, etc. In certain embodiments, the
nucleic acid covalently bound to the nanoscale wire can be
relatively short and/or have a relatively specific sequence that
allows only a certain kind of interaction. For instance, the
nucleic acid that is covalently bound to the nanoscale wire may
have less than 5, less than 10, less than 15, or less than 20
nucleotides.
[0131] As another particular, non-limiting example, a reaction
entity having a hydrophobic moiety, such as a ganglioside or a
surfactant, may be not directly bound to a nanoscale wire, but may
be immobilized relative to the nanoscale wire via a hydrophobic
interaction between the hydrophobic portion of the reaction entity
and a portion of a nanoscale wire that is hydrophobic. For
instance, the hydrophobic portion of the nanoscale wire may be
created due to the presence of a hydrophobic layer (e.g., of
hydrocarbon chains) on the surface of the nanoscale wire, e.g., as
described in more detail below.
[0132] Indirectly immobilizing a reaction entity relative to a
nanoscale wire is useful in certain embodiments of the invention.
For example, if a reaction entity is immobilized relative to a
nanoscale wire without the use of covalent bonds, the reaction
entity may be replaced with a second reaction entity (which may be
of the same type or different), without breaking a covalent bond
between the reaction entity and the nanoscale wire. This allows,
for instance, simpler chemical reactions, less energetic costs in
replacing the reaction entity, or reusability of the nanoscale
wire. As a non-limiting example, a reaction entity, such as a
nucleic acid or a protein, immobilized relative to a nanoscale
wire, e.g., through complementary nucleic acid-nucleic acid
interactions, can be replaced with a second nucleic acid through
the use of a melting solution that dissociates the nucleic
acid-nucleic acid interactions (e.g., a urea solution, a formamide
solution, etc.) and/or by heating the nucleic acids to induce
dissociation. Such dissociation can be followed by, or
simultaneously performed with, exposure of the nanoscale wire to
the second reaction entity.
[0133] A high degree of specificity is also possible in some
embodiments of the invention, for example, in embodiments where the
reaction entity specifically binds to one or more particular
analytes of interest, but does not bind to other molecules, e.g.,
molecules similar to the analytes of interest (such as other
proteins or enzymes if the analyte of interest is a protein or an
enzyme). For example, a reaction entity may specifically bind a
first analyte, such as a toxin, a virus, or an enzyme, but is not
able to specifically bind to other toxins or enzymes. The binding
(or other interaction) of the reaction entity to a single molecule
of the analyte of interest may be determinable in some cases,
regardless of the concentrations or amounts of other molecules that
are similar to the analytes of interest that are present in the
sample, e.g., due to specificity between the reaction entity and
the analyte of interest. Thus, in certain embodiments of the
invention, an analyte of interest may be determined in a sample,
such as in solution, even though the total concentration of other
molecules (e.g., other solutes or solvents, molecules similar to
the analyte of interest, carrier fluids, impurities, etc.) is much
higher than the concentration of the analyte of interest. For
example, an analyte of interest may be determined from a sample,
although the total concentration of other molecules may be at least
about 1000 times higher, at least about 3000 times higher, at least
about 10.sup.5 times higher, at least about 3.times.10.sup.5 times
higher, at least about 10.sup.6 times higher, etc. than the analyte
of interest.
[0134] In one set of embodiments, the reaction entity is able to
bind a nucleic acid synthesis enzyme, i.e., an enzyme able to
synthesize a nucleic acid such as DNA or RNA. The nucleic acid
synthesis enzyme, after binding, may be allowed to synthesize
(e.g., de novo) and/or extend a nucleic acid, for example, a
nucleic acid immobilized relative to a nanoscale wire as part of a
reaction entity. The reaction entity may be, for instance, an
antibody able to specifically bind at least a portion of the
nucleic acid synthesis enzyme, a nucleic acid that includes a
sequence that is recognized by the enzyme (e.g., the nucleic acid
may be recognized by an active site of the enzyme, the enzyme may
contain a nucleic acid that is at least partially complementary to
the nucleic acid of the reaction entity, or the like), etc. The
nucleic acid synthesis enzyme that the reaction entity is able to
bind may be, for example, a reverse transcriptase, a DNA
polymerase, an RNA polymerase, or a telomerase, and the reaction
entity immobilized relative to the nanoscale wire may be a nucleic
acid that the nucleic acid synthesis enzyme is able to bind to.
Non-limiting examples of DNA polymerases include Pol I, Pol II, Pol
III, Pol alpha, Pol beta, Pol gamma, Pol delta, Pol epsilon, Pol
zeta, or the like. Non-limiting examples of RNA polymerase include
RNA polymerase I, RNA polymerase. II, RNA polymerase III, etc.
[0135] In some cases, the reaction entity is able to bind a
telomerase, i.e., the reaction entity is a telomerase-recognition
entity, that is, an entity able to specifically bind a telomerase
enzyme, or at least a portion thereof. A telomerase is an enzyme
able to synthesize a telomeric repeat sequence. A telomere is
generally a region of highly repetitive DNA located at or near the
end of a DNA strand that is involved in DNA replication, and the
repeated DNA is the telomeric repeat sequence. For example, in
humans and in many other vertebrates, as well as certain fungi,
molds, or protazoas, the telomere repeat sequence is a repeating
sequence of TTAGGG (SEQ ID NO: 1), which may be, for example,
between 3 and 20 kilobases in length in normal human chromosomes.
Telomere sequences can vary from species to species, but are
generally GC-rich. Telomeres have also been linked to aging and to
cancer. Thus, according to some embodiments of the invention,
determination of a telomere and/or a telomerase may be used to
diagnose cancer and/or aging processes within a subject.
[0136] In one embodiment, the telomerase-recognition entity is a
nucleic acid that includes a sequence that is at least partially
complementary to a nucleic acid that is part of a telomerase
enzyme. For example, the nucleic acid may include sequence may be
at least about 80% complementary, at least about 85% complementary,
at least about 90% complementary, at least about 95% complementary,
or 100% complementary to the telomeric repeat sequence to be
determined.
[0137] Additional examples of telomeric repeat sequences include,
but are not limited to, TTGGGG (SEQ ID NO: 2), TTGGGT (SEQ ID NO:
3), TTTTGGGG (SEQ ID NO: 4) (e.g., in certain ciliated protozoa);
TTAGGGT (SEQ ID NO: 5), TTAGGGC (SEQ ID NO: 6) (e.g., in certain
apicomplexan protazoa); TTTAGGG (SEQ ID NO: 7) (e.g., in certain
plants); TTTTAGGG (SEQ ID NO: 8) (e.g., in green algae); TTAGG (SEQ
ID NO: 9) (e.g., in certain insects); TTAGGC (SEQ ID NO: 10) (e.g.,
in certain roundworms); AG (SEQ ID NO: 11), AGG (SEQ ID NO: 12),
AGGG (SEQ ID NO: 13), AGGGG (SEQ ID NO: 14), AGGGGG (SEQ ID NO:
15), AGGGGGG (SEQ ID NO: 16), AGGGGGGG (SEQ ID NO: 17), AGGGGGGGG
(SEQ ID NO: 18) (e.g., in certain slime molds); TTACG (SEQ ID NO:
19); TTACGG (SEQ ID NO: 20); TTACGGG (SEQ ID NO: 21); TTACGGGG (SEQ
ID NO: 22); TTACGGGGG (SEQ ID NO: 23); TTACGGGGGG (SEQ ID NO: 24);
TTACGGGGGGG (SEQ ID NO: 25); TTACGGGGGGGG (SEQ ID NO: 26); TTACAG
(SEQ ID NO: 27); TTACAGG (SEQ ID NO: 28); TTACAGGG (SEQ ID NO: 29);
TTACAGGGG (SEQ ID NO: 30); TTACAGGGGG (SEQ ID NO: 31); TTACAGGGGGG
(SEQ ID NO: 32); TTACAGGGGGGG (SEQ ID NO: 33); TTACAGGGGGGGG (SEQ
ID NO: 34); TTACCG (SEQ ID NO: 35); TTACCGG (SEQ ID NO: 36);
TTACCGGG (SEQ ID NO: 37); TTACCGGGG (SEQ ID NO: 38); TTACCGGGGG
(SEQ ID NO: 39); TTACCGGGGGG (SEQ ID NO: 40); TTACCGGGGGGG (SEQ ID
NO: 41); TTACCGGGGGGGG (SEQ ID NO: 42); TTACACG (SEQ ID NO: 43);
TTACACGG (SEQ ID NO: 44); TTACACGGG (SEQ ID NO: 45); TTACACGGGG
(SEQ ID NO: 46); TTACACGGGGG (SEQ ID NO: 47); TTACACGGGGGG (SEQ ID
NO: 48); TTACACGGGGGGG (SEQ ID NO: 49); TTACACGGGGGGGG (SEQ ID NO:
50) (e.g., in certain yeasts); or TGTGGGTGTGGTG (SEQ ID NO: 51),
GGGGTCTGGGTGCTG (SEQ ID NO: 52), GGTGTACGGATGTCTAACTTCTT (SEQ ID
NO: 53), GGTGTACGGATGTCACGATCATT (SEQ ID NO: 54),
GGTGTAAGGATGTCACGATCATT (SEQ ID NO: 55), GGTGTACGGATGCAGACTCGCTT
(SEQ ID NO: 56), GGTGTAC (SEQ ID NO: 57), GGTGTACGGATTTGATTAGTTATGT
(SEQ ID NO: 58), or GGTGTACGGATTTGATTAGGTATGT (SEQ ID NO: 59)
(e.g., in certain yeasts). Those of ordinary skill in the art will
know of other telomeric repeat sequences, depending on the specific
organism being studied.
[0138] In some embodiments, binding of a nucleic acid synthesis
enzyme alters a property of the nanoscale wire, for example, the
conductivity of the nanoscale wire, e.g., if the enzyme is charged.
A determination of the conductivity or other property of the
nanoscale wire and/or a change in such conductivity or other
property may thus allow determination of the immobilization of the
enzyme relative to the nanoscale wire. If the enzyme binds a
nucleic acid immobilized relative to the nanoscale wire, in certain
cases, additional properties of the enzyme and/or the nucleic acid
may be determined. For example, the enzyme may be immobilized at a
certain distance away from the nanoscale wire, which is at least
partially dependent on the length of the nucleic acid. Thus,
determination of the conductivity or other property of the
nanoscale wire may allow a determination of the length of the
nucleic acid and/or the number of nucleotides within the nucleic
acid. In some embodiments, the enzyme is allowed to synthesize
(e.g., de novo) and/or extend the nucleic acid, and such nucleic
acid synthesis may be monitored by determining the conductivity or
other property of the nanoscale wire.
[0139] As an example, as is shown in FIG. 1A, a nanoscale wire 230,
disposed between electrodes 231, 232, has several nucleic acids 233
directly bonded thereto. In FIG. 1B, the nanoscale wire is exposed
to a sample containing a nucleic acid synthesis enzyme 235 (e.g., a
telomerase), and at least some of the nucleic acids are
complementary to nucleic acids found within enzyme 235, allowing
binding of the enzyme to those nucleic acids. The conductivity or
other properties of the nanoscale wire in FIG. 1B may be altered by
immobilization of the enzyme relative to the nanoscale wire, and
such alterations may be determined, e.g., by electrical
measurements between electrodes 231 and 232. In FIG. 1C, the
enzymes are induced to perform nucleic acid synthesis on the
nucleic acid covalently bound to the nanoscale wire, and
deoxynucleotide triphosphates ("dNTPs") 236 are provided and are
incorporated into the growing nucleic acid strand. Such nucleic
acid synthesis may be monitored, for example, by determining
changes in conductivity or other properties of the nanoscale wires.
The enzymes may also be removed from the nanoscale wire.
[0140] It should be noted that direct covalent bonding of the
nucleic acid reaction entity to the nanoscale wire is not
necessarily a requirement. An example of indirect immobilization of
the nucleic acid reaction entity is shown in FIG. 2. In FIG. 2A, a
nanoscale wire 240, disposed between electrodes 241, 242, has
several first nucleic acid 243 directly bonded thereto (which may
all be identical, or some may be different). These nucleic acids
are hybridized in FIG. 2B to a second nucleic acid 244. The second
nucleic acid contains a first portion having a sequence
substantially complementary to a first nucleic acid, and a second
portion having a sequence substantially complementary to a portion
of an enzyme of interest (e.g., a telomerase). In FIG. 2C, the
nanoscale wire is exposed to a sample comprising an enzyme 245
(e.g., a telomerase), and at least some of the nucleic acids are
complementary to nucleic acids found within enzyme 235, allowing
binding of the enzyme to those nucleic acids. Optionally, the
nanoscale wire may also be exposed to deoxynucleotide triphosphates
("dNTPs") 246, and enzyme 235 may be induced to perform nucleic
acid synthesis. By dehybridizing the second nucleic acid from the
first nucleic acid (e.g., using a "melting solution" such as a urea
solution), the second nucleic acids (and any enzymes that may be
bound thereto) may be removed (e.g., to be discarded, or for
further analyses), and the nanoscale wire with the first nucleic
acid may also be reused in some cases.
[0141] Such reactions may also be modified or altered using
techniques known to those of ordinary skill in the art. For
example, additional species may be introduced, which can compete
with binding of the enzyme to the nucleic acids, e.g.,
competitively, uncompetitively, or noncompetitively. As an example,
an inhibitor of nucleic acid synthesis, e.g., a nucleotide analog
such as azido deoxythymidine triphosphate may be used to partially
or totally inhibit nucleic acid synthesis. Such techniques may be
used, for example, to identify or screen for agents able to treat
cancer or aging (e.g., agents able to inhibit telomerase activity
within cells), to study nucleic acid synthesis (e.g., by promoting
or inhibiting various chemical reactions within the nucleic acid
synthesis pathway), etc.
[0142] In another set of embodiments, the reaction entity is able
to bind a toxin or a small molecule (e.g., a molecule having
molecular weights of less than about 2000 Da, less than about 1500
Da, or less than about 1000 Da). Binding of the toxin or small
molecule may alter a property of the nanoscale wire, for example,
the conductivity of the nanoscale wire, e.g., if the toxin or other
small molecule is charged. A determination of the conductivity or
other property of the nanoscale wire and/or a change in such
conductivity or other property may allow determination of the toxin
or other small molecule, e.g., detection and/or quantification.
[0143] The reaction entity may be, for example, an antibody, an
aptamer, or a receptor for the toxin or other small molecule, e.g.,
a ganglioside. The reaction entity may be directly covalently bound
to the nanoscale wire, or the reaction entity may be indirectly
immobilized relative to the nanoscale wire, e.g., through the use
of non-covalent bonds such as hydrogen bonding, hydrophobic
interactions, etc. For example, if the reaction entity includes a
hydrophobic region, and at least a portion of the surface of a
nanoscale wire includes one or more layers of molecules covalently
bonded thereto, at least some of which are hydrophobic, the
hydrophobic interactions between the hydrophobic portion of the
entity and the one or more layers may cause the entity to be
immobilized relative to the nanoscale wire, as discussed in more
detail herein.
[0144] In some embodiments, the reaction entity is a ganglioside, a
glycosphingolipid, a phospholipid, a surfactant, etc., i.e., a
molecule having both a lipid region and a charged region, for
example, a carbohydrate or a sugar region. Such molecules can be
found in the plasma (outer) membrane of a cell. Non-limiting
examples of gangliosides include GM1, GD1b, and asialo-GM1 (FIG.
3A). Other examples include GM1a, GM1b, GM2, GM3, GD1a, GD1b, GD2,
GD3, GT1a, GT1b, GT2, GT3, GT4, GA1, GA2, GA3, GA4, GQ1a, GQ1b,
GQ1c, GQ3, GP1b, GP1c, GP2, GP3, GP4, GP5, GP6, sulfatide, SPG,
SGPG, etc.
[0145] The lipid region of such reaction entities may include one
or more relatively long hydrocarbon chains (e.g., containing carbon
and hydrogen atoms), which may confer hydrophobic properties to the
reaction entities. In some cases, the hydrocarbon chains are
straight-chain saturated alkyls, e.g., as is shown in FIG. 3A.
However, in other cases, one or more hydrocarbon chains may be
unsaturated (e.g., containing one or more double and/or triple
carbon-carbon bonds), and/or include one or more heteroatoms (e.g.,
oxygen or nitrogen atoms). In some embodiments, one or more
hydrocarbon chains may be branched.
[0146] In some cases, the reaction entity is able to interact with
a toxin or a small molecule, and in some instances, the interaction
is a specific interaction. Thus, for example, the toxin may be a
toxin that has a specific interaction with a ganglioside or
glycosphingolipid, i.e., the toxin has a higher affinity to the
particular ganglioside or glycosphingolipid than to any other
ganglioside or glycosphingolipid. For example, cholera toxin (CT)
may specifically interact with GM1, botulinum toxin (BT) may
specifically interact with GT1b, etc. Those of ordinary skill in
the art will know of other toxins that interact with various
gangliosides or glycosphingolipids.
[0147] Thus, another set of embodiments of the present invention
generally relates to nanoscale wires having one or more layers of
molecules immobilized relative to the nanoscale wire, for example,
covalently. For instance, all, or a portion, of the surface of the
nanoscale wire may comprise a monolayer of molecules covalently
bonded thereon (for example, a portion of the nanoscale wire may be
blocked or shielded, prior to attachment of the monolayer of the
surface). Such a monolayer may be formed, for instance, of
molecules each having a functional group that selectively attaches
to the surface, and in some cases, the remainder of each molecule
can interact with neighboring molecules in the monolayer (e.g.,
through hydrophobic interactions, charged interactions, or the
like). In some cases, the monolayer is a self-assembled
monolayer.
[0148] In other embodiments, however, more than one layer of
molecules may be covalently immobilized relative to the nanoscale
wire. For instance, all, or a portion of, a nanoscale wire may
comprise a first layer of molecules covalently bonded to the
nanoscale wire, a second layer of molecules covalently bonded to at
least a portion of the first layer of molecules. Optionally,
additional layers may be present, for example, a third layer of
molecules covalently bonded to at least a portion of the second
layer of molecules, a fourth layer of molecules covalently bonded
to at least a portion of the third layer of molecules, etc. The
compositions of each layer of molecules may be the same or
different (for example, having different molecule(s) and/or
different ratios of molecules, etc.), and each layer may have
properties that are the same or different. For instance, one layer
may be relatively hydrophilic while another layer may be relatively
hydrophobic, etc. In some cases, one or more of the layers may be
cross-linked.
[0149] In certain embodiments, the thickness and/or number of
layers on the surface of the nanoscale wire may be controlled, for
example, by controlling the reaction time between the molecules
forming the layer(s) and the surface of the nanoscale wire. Thus,
as a specific non-limiting example, a thicker monolayer of an
aldehyde silane (e.g., aldehyde propyltrimethoxysilane) may be
formed on the surface of a nanoscale wire by exposing the nanoscale
wire to a solution comprising an aldehyde, for example, aldehyde
propyltrimethoxysilane, for a longer period of time, e.g., as
further discussed below. For example, the reaction may be
controlled such that the thickness is only a few atomic layers
thick, and/or a few molecules or layers thick, or the thickness of
the layer may be controlled such that the thickness of the layer is
less than about 20 nm, less than about 15 nm, less than about 10
nm, less than about 9 nm, less than about 8 nm, less than about 7
nm, less than about 6 nm, less than about 5 nm, less than about 4
nm, less than about 3 nm, less than about 2 nm, or less than about
1 nm.
[0150] In some cases, the reaction and/or the thickness of the
layer may be monitored. The thicknesses may be controlled in some
embodiments by controlling parameters such as the exposure time of
the precursor to the nanoscale wire, the reaction rate, the
concentration of precursor in solution, etc. In some cases,
nanoscale wires subjected to such control may be removed and
examined (during and/or after an experiment), using techniques such
as atomic force microscopy or the like, to determine the thickness
of the layer formed on the nanoscale wire. By using such
monitoring, preselected reaction conditions may be determined
wherein a nanoscale wire, exposed to a precursor under such
conditions, will form a layer of the precursor on the surface of
the nanoscale wire of a certain known thickness. Thus, the
preselected conditions are one or a set of conditions specifically
developed in conjunction with a measurement of the thickness of a
layer of precursor on the nanoscale wire.
[0151] In another aspect, the present invention generally relates
to the attachment of reaction entities, such as biological
entities, to the surfaces of nanoscale wires, in some cases by
using covalent bonding. The entity is thus immobilized with respect
to the surface of the nanoscale wire. In some embodiments, a linker
is used to covalently immobilize the entity with respect to the
nanoscale wire. For example, a nanoscale wire may have a core, and
optionally a shell, and a linker may covalently immobilize the
entity with respect to the nanoscale wire. In some cases, the
entity may be covalently immobilized with respect to the surface of
the nanoscale wire at relatively short distances, depending on the
size of the linker and/or the precursors thereof. For instance, the
entity may be immobilized at a distance of less than about 20 nm,
less than about 15 nm, less than about 10 nm, less than about 9 nm,
less than about 8 nm, less than about 7 nm, less than about 6 nm,
less than about 5 nm, less than about 4 nm, less than about 3 nm,
less than about 2 nm, or less than about 1 nm from the surface of
the nanoscale wire and/or a border of the nanoscale wire, for
example, a border of the core of a nanoscale wire. In certain
instances, the border is an outermost border of the core of the
nanoscale wire. In some cases, the proximity of the entity may
control or otherwise affect electronic and/or other properties of
the nanoscale wire, for example, the conductivity of the nanoscale
wire.
[0152] In some cases, the linker and/or precursor thereof may form
a layer, such as a monolayer or other layer of a controlled
thickness, that is attached to the surface of the nanoscale wire
and/or immobilized relative to the nanoscale wire, for example,
covalently. For example, precursor linker molecules may be attached
to the surface of the nanoscale, e.g., as described herein, and an
entity then attached to the precursor molecules, thereby forming an
entity covalently attached to the surface of the nanoscale wire via
a linker. In one embodiment, the precursor itself is called a
linker once the entity is attached covalently to it. In another
embodiment, the precursor of a linker may undergo chemical
modification or reaction, prior to attachment of the entity. In
some cases, the linker includes at least a first region that is
bound to the surface of the nanoscale wire and/or another molecule
that is immobilized relative to the surface of the nanoscale wire,
and a second region that is bound to an entity such as a biological
entity.
[0153] Non-limiting examples of techniques for preparing a layer of
linkers and/or precursors thereof include those described herein.
For example, the thicknesses may be controlled in some embodiments
by controlling parameters such as the exposure time of the
precursor to the nanoscale wire, and the thickness may be monitored
using techniques such as atomic force microscopy or the like, prior
to or after attachment of the entity to the precursor on the
nanoscale wire. Thus, one embodiment provides for the attaching, to
the surface of a nanoscale wire, of a precursor of a molecule such
as a linker in a layer, and the determination of the thickness of
the precursor on the nanoscale wire. Optionally, an entity may be
attached to at least a portion of the layer of the nanoscale wire.
By using such techniques, the distance between the entity and the
nanoscale wire may be controlled. For example, the layer may be
controlled to have a thickness of less than about 20 nm, less than
about 15 nm, less than about 10 nm, less than about 5 nm, etc., as
previously described, such that attachment of the entity to the
layer results in the distance between the entity and the outermost
border of the core of the nanoscale wire is less than about 20 nm,
less than about 15 nm, less than about 10 nm, less than about 5 nm,
etc.
[0154] In some cases, the remaining precursor molecules on the
surface of the nanoscale wire, which are not covalently bound to an
entity, may be passivated, for example, using techniques such as
those described herein. For instance, the remaining precursor
molecules may be passivated by exposure of the nanoscale wire to a
passivating agent such as ethanolamine.
[0155] Non-limiting examples of chemistries suitable for attaching
entities to surfaces of nanoscale wires, optionally via one or more
linkers, include the following. In one set of embodiments of the
present invention, the surface of the nanoscale wire may be
functionalized, for example, the surface may be functionalized with
aldehydes, amines, thiols, or the like, which may form
nitrogen-containing or sulfur-containing covalent bonds. For
instance, in some embodiments, the reaction entity may be
covalently bound to the nanoscale wire through the use of a moiety
such as an aldehyde moiety, an amine moiety, and/or a thiol
moiety.
[0156] In certain embodiments, a nanoscale wire may be reacted with
an aldehyde, amine, or a thiol in solution to functionalize the
nanoscale wire with the appropriate moiety, e.g., such that the
surface of the nanoscale wire includes terminal aldehyde, amine,
and/or thiol groups. For example, the solution may contain an
aldehyde such as aldehyde propyltrimethoxysilane
((CH.sub.3O).sub.3SiCH.sub.2CH.sub.2CHO), or other aldehydes, for
example, having a formula
(OCHR.sup.1)(R.sup.2O)(R.sup.3O)(R.sup.4O)Si, where each R is
independently an alkyl or other carbon-containing moiety. All, or
only a portion of, the surface of the nanoscale wire may be
functionalized with aldehyde moieties (for example, a portion of
the nanoscale wire may be blocked or shielded, prior to
aldehydization of the surface). While others have investigated the
functionalization of surfaces, aldehyde-functionalized nanoscale
wires and similar functionalized nanoscale wires of a controlled
thickness have not been previously reported, due to problems in
controlling the coupling chemistry at nanometer length scales, for
instance, between the nanoscale wire and the aldehyde.
[0157] Examples of suitable amines or thiols include amino- and
thiol-functionalized silane derivatives, for instance, trimethoxy
propylamine silane
((CH.sub.3O).sub.3SiCH.sub.2CH.sub.2CH.sub.2NH.sub.2) or
propylthiol trimethoxy silane
((CH.sub.3O).sub.3SiCH.sub.2CH.sub.2CH.sub.2SH), which may react
with all, or only a portion of, the surface of the nanoscale wire
to form, surfaces functionalized with, respectively, amines or
thiols. Other potentially suitable amines may have a formula
(Z.sup.1Z.sup.2NR.sup.1)(R.sup.2O)(R.sup.3O)(R.sup.4O)Si, where
each R is independently an alkyl or other carbon-containing moiety
and each Z independently is --H or an alkyl or other
carbon-containing) moiety; other potentially suitable thiols may
have a formula (R.sup.2O)(R.sup.3O)(R.sup.4O)Si. In some cases, the
derivative may have more than one functional group, for example,
the derivative may have an amine and a thiol group, an amine and an
aldehyde group, a thiol and an aldehyde group, etc.
[0158] One or more entities, e.g., reaction entities such as
proteins, enzymes, nucleic acids, antibodies, receptors, ligands,
etc., may then be reacted with the aldehyde, amine, and/or thiol
moieties to covalently bind the entity to the nanoscale wire. In
some cases, after the entity has been fastened to the nanoscale
wire, the surface of the nanoscale wire, including any unreacted
moieties, is then passivated, e.g., blocked with one or more
compounds that causes the moieties to become unreactive.
Non-limiting examples of such passivating agents include
ethanolamine. For example, a solution may be added to the nanowires
that includes one or more passivating agents.
[0159] In some cases, the entity covalently binds to an aldehyde
group via a reaction between a functional group of the entity and
the aldehyde. For instance, if the entity contains a primary amine
(RNH.sub.2), the primary amine can react with the aldehyde to
produce an imine bond (R.sup.1CH.dbd.NR.sup.2), e.g. as in a
reaction:
##STR00001##
where R.sup.1 represents the surface of the nanoscale wire and/or a
species immobilized relative to the surface of the nanoscale wire,
and R.sup.2 is an alkyl or other carbon-containing moiety. Thus, as
a particular, non-limiting example, a entity containing an amine,
such as a protein, an antibody, or an enzyme, may be reacted with
an aldehyde on the surface of the nanoscale wire, thereby
covalently binding the entity to the surface of the nanoscale wire.
As another non-limiting example, an entity that does not contain a
primary amine, such as a nucleic acid molecule, may be modified to
include a primary amine, and then the primary amine reacted with an
aldehyde on the surface of the nanoscale wire, thereby binding the
entity to the surface of the nanoscale wire. Similarly, the entity
may covalently bind to an amine or a thiol group via reaction
between a functional group of the entity and an amine or thiol.
[0160] In one set of embodiments, a nitrogen-containing covalent
bond may be formed between an entity and a functional group present
on the surface of a nanoscale wire, thereby immobilizing the entity
with respect to the surface of the nanoscale wire. In one
embodiment, the covalent bond is a nitrogen-containing covalent
bond, such as an imine bond, an amide bond, a carbamate bond, etc.
As an example, an entity containing an amine may react with an
aldehyde present on the surface of a nanoscale wire to form an
imine bond, e.g., as previously described. As another example, an
entity containing an aldehyde may react with an amine via the
following reaction:
R.sup.1NH.sub.2+R.sup.2CHO.fwdarw.R.sup.1N.dbd.CHR.sup.2+H.sub.2O,
where R.sup.1 represents the surface of the nanoscale wire and/or a
species immobilized relative to the surface of the nanoscale wire,
and R.sup.2 is an alkyl or other carbon-containing moiety. In this
reaction, an imine bond is produced, immobilizing R.sup.2 with
respect to R.sup.1. As yet another example, an amine may react with
a carboxylic acid, producing an amide bond immobilizing an entity
with respect to a surface, e.g., as follows:
##STR00002##
where R.sup.1 represents the surface of the nanoscale wire and/or a
species immobilized relative to the surface of the nanoscale wire,
R.sup.2 is an alkyl or other carbon-containing moiety, and Z is --H
or an alkyl or other carbon-containing moiety. Other examples of
reactions include reactions forming carbamate
(R.sup.1R.sup.2N--C(.dbd.O) --O--R.sup.3) bonds. For instance, an
entity comprising an N-hydroxysuccinimide group or other similar
leaving group may react with an amine to form a carbamate bond,
e.g., as in a reaction:
R.sup.1NH.sub.2+R.sup.2COO--(NHS).fwdarw.R.sup.1NHCOOR.sup.2.
where R.sup.1 represents the surface of the nanoscale wire and/or a
species immobilized relative to the surface of the nanoscale wire,
R.sup.2 is an alkyl or other carbon-containing moiety, and (NHS) is
an N-hydroxysuccinimide group.
[0161] In another example, a sulfur-containing covalent bond may be
formed between an entity and a functional group present on the
surface of a nanoscale wire, thereby immobilizing the entity with
respect to the surface of the nanoscale wire. An example is a
reaction involving a thiol. For instance, in one embodiment, an
entity may be covalently immobilized to a thiol group via the
following reaction:
R.sup.1SH+R.sup.2-Maleimide.fwdarw.R.sup.1S-Maleimide-R.sup.2,
where R.sup.1 represents the surface of the nanoscale wire and/or a
species immobilized relative to the surface of the nanoscale wire,
and R.sup.2 is an alkyl or other carbon-containing moiety. Thus,
R.sup.2 is immobilized with respect to R.sup.1 via a
sulfur-containing covalent bond.
[0162] In some embodiments, the molecules covalently bound to the
surface of the nanoscale wire may comprise a lipid region, e.g.,
including one or more hydrocarbon chains (e.g., containing carbon
and hydrogen atoms). In some cases, the hydrocarbon chains are
straight-chain saturated alkyls, e.g., as is shown in FIG. 3A.
However, in other cases, one or more hydrocarbon chains may be
unsaturated, and/or include one or more heteroatoms. In some
embodiments, one or more hydrocarbon chains may be branched.
[0163] In one embodiment, a series of molecules is covalently
bonded to an aldehyde-functionalized surface of a nanoscale wire to
form a layer on the surface of the nanoscale wire, e.g., as
previously described. However, in another embodiment, a layer may
be formed on the surface of a nanoscale wire through the reaction
of a halogenated silane (or other silane with a suitable leaving
group) with a hydroxide moiety on the nanoscale wire, e.g. as in
the reaction:
##STR00003##
with a hydrohalic acid (HX) as a by-product. In the above
structures, R.sup.1 represents the surface of the nanoscale wire
and/or a species immobilized relative to the surface of the
nanoscale wire, X is a halogen or other leaving group, R is an
alkyl (for example, an unsubstituted straight-chain saturated
alkyl, such as --C.sub.10H.sub.21, --C.sub.11H.sub.23,
--C.sub.12H.sub.25, --C.sub.13H.sub.27, --C.sub.14H.sub.29,
--C.sub.15H.sub.31, --C.sub.16H.sub.33, --C.sub.17H.sub.35,
--C.sub.18H.sub.37, etc.), and each of Z.sup.1 and Z.sup.2 is
independently --H, a halogen, or an alkyl or other
carbon-containing moiety. The halogenated silane may be reacted, in
some cases, with the nanoscale wire in a non-aqueous environment,
e.g., using an organic solvent such as anhydrous toluene.
Non-limiting examples of halogenated silanes include:
##STR00004##
[0164] In some cases, e.g., as illustrated above, more than one
halogen may be present in the halogenated silane, and some or all
of the halogens may participate in reactions between the
halogenated silane and one or more hydroxide groups on the
nanoscale wire. Thus, as an example, one or more halogens in the
above structure may react such that the silane becomes covalently
bound to the surface of the nanoscale wire via --O--Si-- bonds,
e.g., as in the following structures:
##STR00005##
where represents the surface of the nanoscale wire, R is an alkyl
(for example, an unsubstituted straight-chain saturated alkyl), and
each of Z.sup.1 and Z.sup.2 is independently --H, a halogen, or an
alkyl or other carbon-containing moiety.
[0165] As used herein, the term "halogen," or equivalently,
"halogen atom," is given its ordinary meaning as used in the field
of chemistry. The halogens include fluorine, chlorine, bromine,
iodine, and astatine, and may have any charge state and/or
electronic configuration. In some cases, the halogen atoms include
one or more of fluorine, chlorine, bromine, or iodine. In certain
embodiments, the halogen atoms found within the halogenated silane
are fluorine, chlorine, and bromine; fluorine and chlorine;
chlorine and bromine, or a single type of halogen atom.
[0166] Also, as used herein, the term "alkyl" is given its ordinary
meaning as used in the is field of organic chemistry. Alkyl (i.e.,
aliphatic) moieties useful for practicing the invention can contain
any of a wide number of carbon atoms, for example, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more carbon
atoms. In some embodiments, the alkyl moiety will contain at least
8 carbon atoms, at least 10 carbon atoms, at least 12 carbon atoms,
at least 14 carbon atoms, at least 16 carbon atoms, or at least 18
carbon atoms; in some embodiments, the alkyl moiety will have at
most 25 carbon atoms, or at most 20 carbon atoms. Alkyls of the
present invention may be lower alkyls or higher alkyls in some
cases. As used herein, a "lower alkyl" is an alkyl that has less
than 5 carbon atoms, while a "higher alkyl" is an alkyl that
contains at least 5 carbon atoms.
[0167] The carbon atoms within the alkyl moiety may be arranged in
any configuration within the alkyl moiety, for example, as a
straight chain (i.e., a n-alkyl such as methyl, ethyl, propyl,
butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, etc.) or a
branched chain, i.e., a chain where there is at least one carbon
atom that is covalently bonded to at least three carbon atoms
(e.g., a t-butyl moiety or a sec-butyl moiety, an isoalkyl moiety
such as isopropyl, isobutyl, isopentyl, isohexyl, isoheptyl,
isooctyl, isononyl, etc.). In some cases, the alkyl may contain one
or more rings (e.g., cycloalkyls). The alkyl moiety may contain
only single bonds (i.e., the alkyl is a "saturated alkyl," or the
alkyl may contain one or more double and/or triple bonds within its
structure (i.e., the alkyl is an "unsaturated alkyl"), for example,
as in an alkenyl, an alkynyl, an alkenynyl, etc. As known to those
of ordinary skill in the art, an alkenyl comprises at least one
double bond, an alkynyl comprises at least one triple bond, and an
alkenynyl comprises at least one double bond and at least one
triple bond (i.e., the alkenynyl is both an alkenyl and an
alkynyl). Terms such as "lower alkenyl," "higher alkenyl," "lower
alkynyl," "higher alkynyl," etc., are defined analogously to the
terms "lower alkyl" and "higher alkyl," discussed above.
[0168] In some embodiments, the alkyl moiety contains only carbon
and hydrogen atoms; however, in other embodiments, the alkyl moiety
may also contain one or more heteroatoms, i.e., non-carbon and/or
non-hydrogen moieties may be present within an alkyl moiety, for
example, halogen atoms, oxygen atoms, nitrogen atoms, etc.
[0169] In some cases, a layer of molecules present on the surface
of a nanoscale wire may be used to immobilize other entities
relative to the nanoscale wire, for example, entities having a
hydrophobic moiety, e.g., a ganglioside, a glycosphingolipid, etc.,
as described herein. For instance, if the layer of molecules is
hydrophobic (e.g., contains hydrocarbon chains, for example, higher
alkyls, or unsubstituted straight-chain alkyls, which may be
saturated or unsaturated), hydrophobic interactions between the
hydrophobic layer and the hydrophobic moiety of the entity may be
used to immobilize the entity relative to the nanoscale wire. As a
non-limiting example, in FIG. 3B, a nanoscale wire 130, disposed
between electrodes 131, 132, has several hydroxide moieties (--OH)
on its surface. The nanowire is then exposed to anhydrous toluene
and (chloro)(dimethyl)(tetradecyl)silane, which react to produce
HCl and the attachment of a hydrocarbon monolayer on the surface of
the nanoscale wire (FIG. 3C). Optionally, the hydrophobic moieties
of other entities, such as gangliosides or surfactants, may
interact with the monolayer, resulting in the immobilization of
those entities relative to the nanoscale wire (FIG. 3D). In this
figure, the hydrophobic portion of the moiety is represented by a
straight-chain saturated alkyl and the hydrophilic portion of the
moiety is represented by the symbol
##STR00006##
[0170] Also provided, according to another set of embodiments of
the present invention, is a sensing element comprising a nanoscale
wire and a detector constructed and arranged to determine a
property and/or a change in a property of the nanoscale wire. In
some cases, alteration of a property of the nanoscale wire may be
indicative of an interaction between a reaction entity and an
analyte (e.g., association or dissociation of the reaction entity
and the analyte). Where a detector is present, any detector capable
of determining a property associated with the nanoscale wire can be
used. The property can be electronic, electromagnetic, optical,
mechanical, or the like. Examples of electrical or magnetic
properties that can be determined include, but are not limited to,
voltage, current, conductivity, resistance, impedance, inductance,
charge, etc. Examples of optical properties associated with the
nanoscale wire include its emission intensity and/or emission
wavelength, e.g. where the nanoscale wire is emissive. In some
cases, the detector will include a power source and a metering
device, for example a voltmeter or an ammeter.
[0171] In one embodiment, a conductance (or a change in
conductance) less than about 1 nS in a nanoscale wire sensor of the
invention can be detected. In another embodiment, a conductance in
the range of thousandths of a nS can be detected. In other
embodiments, conductances of less than about 10 microsiemens, less
than about 1 microsiemen, less than about 100 nS, or less than
about 10 nS can be detected. The concentration of a species, or
analyte, may be detected from femtomolar concentrations, to
nanomolar, micromolar, millimolar, and to molar concentrations and
above. By using nanoscale wires with known detectors, sensitivity
can be extended to a single molecules in some cases.
[0172] As a non-limiting example, a charged analyte may be
determined by determining a change in an electrical property of the
nanoscale wire, for example, conductivity. Immobilizing a charged
analyte relative to the nanoscale wire may cause a change in the
conductivity of the nanoscale wire, and in some cases, the distance
between the charged analyte and the nanoscale wire may determine
the magnitude of the change in conductivity of the nanoscale wire.
Uncharged analytes can be similarly determined, for instance, by
causing the analyte to become charged, e.g., by altering
environmental conditions such as pH (by raising or lowering pH),
temperature, reactants, or the like, by reacting the analyte with a
charged moiety, or the like.
[0173] The analyte to be determined by the nanoscale sensor may be
present within a sample. The term "sample" refers to any cell,
lysate, tissue, or fluid from a biological source (a "biological
sample"), or any other medium, biological or non-biological, that
can be evaluated in accordance with the invention. The sample may
be, for instance, a liquid (e.g., a solution or a suspension) or a
gas. A sample includes, but is not limited to, a biological sample
drawn from an organism (e.g. a human, a non-human mammal, an to
invertebrate, a plant, a fungus, an algae, a bacteria, a virus,
etc.), a sample drawn from food designed for human consumption, a
sample including food designed for animal consumption such as
livestock feed, milk, an organ donation sample, a sample of blood
destined for a blood supply, a sample from a water supply, a soil
sample, or the like.
[0174] In some cases, the sample may be a sample suspected of
containing an analyte. A "sample suspected of containing" a
particular component means a sample with respect to which the
content of the component is unknown. For example, a fluid sample
from a human suspected of having a disease, but not known to have
the disease, defines a sample suspected of containing the disease.
"Sample" in this context includes naturally-occurring samples, such
as physiological samples from humans or other animals, samples from
food, livestock feed, water, soil, etc. Typical samples include
tissue biopsies, cells, cell lysates, whole blood, serum or other
blood fractions, urine, ocular fluid, saliva, fluid or other
samples from tonsils, lymph nodes, needle biopsies, etc.
[0175] A variety of sample sizes, for exposure of a sample to a
nanoscale sensor of the invention, can be used in various
embodiments. As examples, the sample size used in nanoscale sensors
may be less than or equal to about 10 microliters, less than or
equal to about 1 microliter, or less than or equal to about 0.1
microliter. The sample size may be as small as about 10 nanoliters,
1 nanoliter, or less, in certain instances. The nanoscale sensor
also allows for unique accessibility to biological species and may
be used for in vivo and/or in vitro applications. When used in
vivo, in some case, the nanoscale sensor and corresponding method
result in a minimally invasive procedure.
[0176] The invention, in some embodiments, involves a sensing
element comprising a sample exposure region and a nanoscale wire
able to detect the presence or absence of an analyte, and/or the
concentration of the analyte. The "sample exposure region" may be
any region in close proximity to the nanoscale wire where a sample
in the sample exposure region addresses at least a portion of the
nanoscale wire. Examples of sample exposure regions include, but
are not limited to, a well, a channel, a microfluidic channel, or a
gel. In certain embodiments, the sample exposure region is able to
hold a sample proximate the nanoscale wire, and/or may direct a
sample toward the nanoscale wire for determination of an analyte in
the sample. The nanoscale wire may be positioned adjacent or within
the sample exposure region. Alternatively, the nanoscale wire may
be a probe that is inserted into a fluid or fluid flow path. The
nanoscale wire probe may also comprise, in some instances, a
microneedle that supports and/or is integral with the nanoscale
wire, and the sample exposure region may be addressable by the
microneedle. In this arrangement, a device that is constructed and
arranged for insertion of a microneedle probe into a sample can
include a region surrounding or otherwise in contact with the
microneedle that defines the sample exposure region, and a sample
in the sample exposure region is addressable by the nanoscale wire,
and vice versa. Fluid flow channels can be created at a size and
scale advantageous for use in the invention (microchannels) using a
variety of techniques such as those described in International
Patent Application Serial No. PCT/US97/04005, entitled "Method of
Forming Articles and Patterning Surfaces via Capillary
Micromolding," filed Mar. 14, 1997, published as Publication No. WO
97/33737 on Sep. 18, 1997, and incorporated herein by
reference.
[0177] As an example, a sample, such as a fluid suspected of
containing an analyte that is to be determined, may be presented to
a sample exposure region of a sensing element comprising a
nanoscale wire. An analyte present in the fluid that is able to
bind to the nanoscale wire and/or a reaction entity immobilized
relative to the nanoscale wire may cause a change in a property of
the nanoscale wire that is determinable upon binding, e.g. using
conventional electronics. If the analyte is not present in the
fluid, the relevant property of the nanoscale wire will remain
unchanged, and the detector will measure no significant change.
Thus, according to this particular example, the presence or absence
of an analyte can be determined by monitoring changes, or lack
thereof, in the property of the nanoscale wire. In some cases, if
the detector measures a change, the magnitude of the change may be
a function of the concentration of the analyte, and/or a function
of some other relevant property of the analyte (e.g., charge or
size, etc.). Thus, by determining the change in the property of the
nanoscale wire, the concentration or other property of the analyte
in the sample may be determined.
[0178] In some embodiments, one or more nanoscale wires may be
positioned in a channel or in a microfluidic channel, which may
define the sample exposure region in some cases. As used herein, a
"channel" is a conduit that is able to transport one or more fluids
specifically from one location to another. Materials may flow
through the channels, continuously, randomly, intermittently, etc.
The channel may be a closed channel, or a channel that is open, for
example, open to the external environment. The channel can include
characteristics that facilitate control over fluid transport, e.g.,
structural characteristics, physical/chemical characteristics
(e.g., hydrophobicity vs. hydrophilicity) and/or other
characteristics that can exert a force (e.g., a containing force)
on a fluid when within the channel. The fluid within the channel
may partially or completely fill the channel. In some cases the
fluid may be held or confined within the channel or a portion of
the channel in some fashion, for example, using surface tension
(i.e., such that the fluid is held within the channel within a
meniscus, such as a concave or convex meniscus). The channel may
have any suitable cross-sectional shape that allows for fluid
transport, for example, a square channel, a circular channel, a
rounded channel, a rectangular channel (e.g., having any aspect
ratio), a triangular channel, an irregular channel, etc. The
channel may be of any size. For example, the channel may have a
largest dimension perpendicular to a direction of fluid flow within
the channel of less than about 1000 micrometers in some cases
(i.e., a microfluidic channel), less than about 500 micrometers in
other cases, less than about 400 micrometers in other cases, less
than about 300 micrometers in other cases, less than about 200
micrometers in still other cases, less than about 100 micrometers
in still other cases, or less than about 50 or 25 micrometers in
still other cases. In some embodiments, the dimensions of the
channel may be chosen such that fluid is able to freely flow
through the channel. The dimensions of the channel may also be
chosen in certain cases, for example, to allow a certain volumetric
or linear flowrate of fluid within the channel. Of course, the
number of channels, the shape or geometry of the channels, and the
placement of channels can be determined by those of ordinary skill
in the art.
[0179] One or more different nanoscale wires may cross the same
microfluidic channel (e.g., at different positions) to detect the
same or different analytes, to measure a flowrate of an analyte(s),
etc. In another embodiment, one or more nanoscale wires may be
positioned in a microfluidic channel to form one of a plurality of
analytic elements, for instance, in a microneedle probe, a dip and
read probe, etc. The analytic elements probe may be implantable and
capable of detecting several analytes simultaneously in real time,
according to certain embodiments. In another embodiment, one or
more nanoscale wires may be positioned in a microfluidic channel to
form an analytic element in a microarray for a cassette or a
lab-on-a-chip device. Those of ordinary skill in the art would know
of examples of cassette or lab-on-a-chip devices that are suitable
for high-throughout chemical analysis and screening, combinational
drug discovery, etc. The ability to include multiple nanoscale
wires in one nanoscale sensor also allows, in some cases, for the
simultaneous detection of different analytes suspected of being
present in a single sample, i.e., the nanoscale sensor allows
"multiplexed" detection of different analytes. For example, a
nanoscale sensor may include a plurality of nanoscale wires that
each detect different pH levels, proteins, enzymes, toxins, small
molecules, and/or nucleic acids, etc.
[0180] In one set of embodiments, the use of multiple nanoscale
wires may prevent or at least decrease the frequency of "false
positive" events, i.e., where it appears that a binding event or
other interaction between a reaction entity and an analyte has
occurred, based on a determination of a property of the nanoscale
wire (e.g., a change in conductance) when, in fact, no such event
or interaction has occurred. By comparing the properties of
different nanoscale wires (e.g., having the same or different
compositions, and/or the same or different reaction entities),
false positive events can be identified. As a non-limiting example,
two nanoscale wires, each having the same reaction entity, or
different reaction entities able to bind the same analyte, can be
compared to determine whether an analyte is actually present in a
sample that both nanoscale wires are exposed to, e.g., by
determining if both nanoscale wires are able to bind or otherwise
interact with the reaction entity, e.g., simultaneously. As another
non-limiting example, the first nanoscale wire may be p-doped, and
the second nanoscale wire may be n-doped, such that binding of
analytes to each of the reaction entities may cause different
changes in the properties of the nanoscale wires (e.g., the
conductivity of one wire may increase, while the conductivity of
the other wire decreases). Thus, in one set of embodiments, two or
more nanoscale wires, each having a reaction entity able to bind an
analyte, are compared such that two or more binding events with
respect to two or more of the nanoscale wires are required for the
binding event to be considered genuine, whereas a binding event
involving only one nanoscale wire (or less than a predetermined
number of nanoscale wires) is treated as a "false positive." Other
nanoscale wires of different composition, analogous to the n-doped
and p-doped nanowires described above, can be used, and the
different nanoscale wires may cause different changes to occur
based upon binding of an identical analyte to each nanoscale wire.
Different analytes can be detected by these different nanoscale
wires as well.
[0181] Of course, in a in a situation where binding occurs at one
possible site but not at another possible site, additional
experiments may be required in some cases to determine whether a
binding event occurred or whether a "false positive" signal was
detected. In some cases (e.g., a very dilute sample or other
situation involving very little analyte present), two nanoscale
wires may be present, each having a reaction entity immobilized
thereon (or other entity with which the analyte is able to interact
with), and an analyte that binds to one nanoscale wire only is a
positive binding event rather than a false positive. Those of
ordinary skill in the art will be able to establish experimental
protocols to determine, positively, whether a binding event has
occurred in these and similar situations.
[0182] In some cases, the sensing element may comprise a plurality
of nanoscale wires able to determine (i.e., detect the presence,
absence, and/or amount or concentration) one or more analytes
within a sample, for example, from a liquid or solution, blood
serum, etc., as previously described. Various nanoscale wires
within the sensing element may be differentially doped as described
herein, and/or contain different reaction entities, and/or the same
reaction entities at different concentrations, thereby varying the
sensitivity of the nanoscale wires to the analytes, as needed. For
example, different reaction entities may be "printed" on the
nanoscale wires, e.g., using microarray printing techniques or the
like, thereby producing an array of nanoscale wires comprising
different reaction entities. In some cases, individual nanoscale
wires may be selected based on their ability to interact with
specific analytes, thereby allowing the detection of a variety of
analytes. The plurality of nanoscale wires may be randomly oriented
or parallel to one another, according to another set of
embodiments. The plurality of nanoscale wires may also be oriented
in an array on a substrate, in specific instances.
[0183] A sensing element of the present invention can collect real
time data and/or near-real time data, in some embodiments. The data
may be used, for example, to monitor the reaction rate of a
specific chemical or biological reaction. Physiological conditions
or drug concentrations present in vivo may also produce a real time
(or near-real time) signal that may be used to control a drug
delivery system, in another embodiment of the invention. An example
of near-real time data is a system in which multiple nanoscale
wires are individually addressed, e.g., using a switching matrix.
The switching matrix can address each wire on any suitable basis,
for example, once per second, once every 100 milliseconds, once
every 10 milliseconds, once every millisecond, once every 100
microseconds, once every 10 microseconds, once every microsecond,
etc.
[0184] In addition, electrical determination of one or more
properties of the nanoscale wire may allow for the determination of
one or more analytes as a function of time. For example, the
conductance of a nanoscale wire may be determined as a function of
time, which may give additional information regarding the analyte.
In some cases, a microarray of the invention may be exposed to a
series of samples, and the properties of the nanoscale wire, as
determined as a function of time, may be related to the
concentration of analyte within each of the samples. This feature
may also, in some cases, be combined with the use of multiple
nanoscale wires to detect different analytes. Thus, in some
embodiments, a sensing element of the invention may be used to
detect multiple analytes in one or more samples.
[0185] In some cases, the nanoscale wires, or at least a portion of
the nanoscale wires, may be individually addressable, i.e., the
status of the nanoscale wire may be determined without determining
the status of nearby nanoscale wires. Thus, for example, a
nanoscale wire within a sensing element, or a number of nanoscale
wires within the sensing element, may be in electrical
communication with an electrode that is able to address the
nanoscale wire(s), and such a wire may be addressed using the
electrode without addressing other nanoscale wires not in
electrical communication with the electrode. For example, a first
reaction entity immobilized relative to a first nanoscale wire may
bind an analyte, and such a binding event may be detectable
independently of the detection of a binding event involving a
second reaction entity immobilized relative to a second nanoscale
wire. The electrodes may be in electronic communication with one or
more electrical contacts.
[0186] In some embodiments, the invention includes a microarray
including a plurality of sensing regions, at least some of which
comprise one or more nanoscale wires. The microarray, including
some or all of the sensing regions, may define a sensing element in
a sensor device. At least some of the nanoscale wires are able to
determine an analyte suspected to be present in a sample that the
sensing region of the microarray is exposed to, for example, the
nanoscale wire may comprise a reaction entity able to interact with
an analyte. If more than one nanoscale wire is present within the
sensing region, the nanoscale wires may be able to detect the same
analyte and/or different analytes, depending on the application.
For example, the nanoscale wires within the sensing region of the
microarray may be able to determine 1, 2, 3, 4, 5, 6, 8, 10, 12,
14, 16, 18, 20, 22, 24, 26, 28, 30, 40, 50, or more analytes or
types of analytes. As an example, a microarray may have one or more
sensing regions, at least some of which comprise nanoscale wires
having nucleic acids immobilized with respect to the nanoscale
wires, e.g., as described herein. The microarray may be used to
determine analytes in one, or a number of samples. For example, the
microarray may include at least 2, at least 3, at least 5, at least
10, at least 15, at least 20, at least 25, at least 30, at least
50, at least 70, at least 100, at least 200, at least 300, at least
500, at least 1,000, at least 3,000, at least 5,000, or at least
10,000 or more sensing regions, at least some of which may be used
to determine the analyte of a sample placed on the sensing region.
In certain cases, the microarray may have a high density of
nanoscale wires, at least some of which may be individually
addressable, and at least some of which can be used to determine an
analyte suspected to be present in a sample. For instance, the
density of nanoscale wires may be at least about 100 nanoscale
wires/cm.sup.2, and in some cases, at least about 110 nanoscale
wires/cm.sup.2, at least about 120 nanoscale wires/cm.sup.2, at
least about 130 nanoscale wires/cm.sup.2, at least about 150
nanoscale wires/cm.sup.2, at least about 200 nanoscale
wires/cm.sup.2, at least about 250 nanoscale wires/cm.sup.2, or at
least about 500 nanoscale wires/cm.sup.2.
[0187] An example of a sensing region is shown in FIG. 4A. In this
figure, the sensing region 220 includes a first electrode 221 and a
second or counter electrode 222. The first electrode is generally
elongated (i.e., one-dimension of the electrode is significantly
longer in one dimension than another). One or more nanoscale wires
227 are in electrical communication with first electrode 221 and
second electrode 222, and at least some of the nanoscale wires may
comprise a reaction entity able to interact with an analyte. First
electrode 221 is in electronic communication with an electrical
contact or lead 225 through electronic connection 223 (e.g., a wire
or an etched electronic pathway), while second electrode 222 is in
electronic communication with an electrical contact 225 through
electronic connection 224. Analyte 229 is present in a sample that
is placed within sensing region 220, and is able to interact with a
reaction entity present on a nanoscale wire 227 (e.g., by binding,
for example, covalently). Upon such an interaction, an electrical
property of the nanoscale wire, e.g., conductivity, is altered
(e.g., through a charge interaction between the analyte and the
nanoscale wire), which can be determined by determining a change in
conductivity of the nanoscale wire, for instance, by measuring a
change in conductivity between electrical contact 225 and
electrical contact 226.
[0188] Additional nanoscale wires may be added to the sensing
region. For example, in FIG. 4B, sensing region 220 has five second
or counter electrodes 222. At least some of nanoscale wires 211,
212, 213, 214 connect at least some of the second electrodes 222
with first electrode 221, and at least some of the nanoscale wires
may comprise a reaction entity able to interact with an analyte.
For instance, nanoscale wires 211 may interact with a first
analyte, but not with a second analyte or a third analyte, while
nanoscale wires 212 may interact with only the second analyte and
nanoscale wires 213 may interact with only the third analyte. Upon
a binding event of an analyte with a corresponding reaction entity,
a property of the nanoscale wire, such as conductance, may change,
and may be determined, as previously described.
[0189] In FIG. 4C, a relatively large number of second or counter
electrodes are positioned in parallel about the first electrode
(i.e., the second electrodes are disposed in a generally linear
array that is essentially parallel to the first electrode), and the
electrical pathways or leads between the second electrodes and the
electrical contacts are positioned such that at least some of the
pathways are angled, i.e., non-perpendicular. (The nanoscale wires
are not illustrated in FIG. 4C for clarity, but may span between
the first and second electrodes.) In this figure, the second
electrodes are spaced essentially equidistantly from the first
electrode. The pathways or leads may be positioned to be in
parallel to each other, and in some cases, the leads may be
positioned at an angle with respect to the first and/or second
electrodes, i.e., the leads are not perpendicular to the first
and/or second electrodes. Such pathways or leads may allow closer
or more dense packing of the pathways and/or electrical contacts
226, for example, to allow interfacing of the electrical contacts
with detectors able to determine changes in properties of the
nanoscale wires. Additional examples of such a system are shown in
FIGS. 4D-4E, where the dotted lines indicate optional features.
Such as system may include certain ornamental features, as shown in
these figures. In some cases, if the second electrodes are
positioned on either side of the first electrode, the second
electrodes may be aligned with each other, e.g., as is shown in
FIG. 5B, or not aligned (e.g., "staggered"), e.g., as is shown in
FIG. 4C
[0190] In another set of embodiments, an article of the invention
may comprise a cassette comprising a sensing element having a
sample exposure region and a nanoscale wire. The detection of an
analyte in a sample within the sample exposure region may occur, in
some cases, while the cassette is disconnected to a detector
apparatus, allowing samples to be gathered at one site, and
determined at another. The cassette may then be operatively
connectable to a detector apparatus able to determine a property
associated with the nanoscale wire. As used herein, a device is
"operatively connectable" when it has the ability to attach and
interact with another apparatus. In other cases, the cassette may
be constructed and arranged such that samples may be gathered and
determination at one site.
[0191] As an example, the present invention includes, in some
embodiments, an integrated system comprising a nanoscale wire
detector, a reader, and a computer controlled response system. In
this example, the nanoscale wire detects a change in the
equilibrium or concentration of an analyte in the sample, feeding a
signal to the computer controlled response system, causing it to
withhold or release a chemical or drug. This is useful as an
implantable drug or chemical delivery system because of its small
size and low energy requirements. Those of ordinary skill in the
art are well aware of the parameters and requirements for
constructing implantable devices, readers, and computer-controlled
response systems suitable for use in connection with the present
invention. That is, the knowledge of those of ordinary skill in the
art, coupled with the disclosure herein of nanoscale wires as
sensors, enables implantable devices, real-time measurement
devices, integrated systems, and the like. Such systems can be made
capable of monitoring one, or a plurality of, physiological
characteristics individually or simultaneously. Such physiological
characteristics can include, for example, oxygen concentration,
carbon dioxide concentration, glucose level, concentration of a
particular drug or molecule, concentration of a particular drug
by-product, concentration of an enzyme or protein, concentration of
a toxin, or the like. Integrated physiological devices can be
constructed to carry out a function depending upon a condition
sensed by a sensor of the invention.
[0192] The present invention finds use in a wide range of
applications. For instance, in one set of embodiments, any of the
techniques described herein may be used in the determination of
proteins, enzymes, toxins, viruses, small molecules, or the like,
e.g., as in an assay, for example, to detect or diagnose cancer or
other medical conditions, toxins or other environmental agents,
viruses, or the like. A property of an analyte may be determined by
allowing the analyte to interact with a nanoscale wire and/or a
reaction entity, and the interaction may be analyzed or determined
in some fashion, e.g., quantified. In some cases, the degree or
amount of interaction (e.g., a binding constant) may be determined,
for example, by measuring a property of the nanoscale wire (e.g.,
an electronic property, such as the conductance) after exposing the
nanoscale wire and/or the reaction entity to the analyte.
[0193] In certain instances, such assays are useful in drug
screening techniques. In one example, a protein, enzyme, or other
target molecule may be immobilized relative to a nanoscale wire as
a reaction entity, and exposed to one or more drug candidates, for
example, serially or simultaneously. Interaction of the drug
candidate(s) with the reaction entity may be determined by
determining a property of the nanoscale wire, e.g., as previously
described. As a non-limiting example, a nanoscale wire, having an
associated reaction entity, may be exposed to one or more species
able to interact with the reaction entity, for instance, the
nanoscale wire may be exposed to a sample containing a first
species able to interact with the reaction entity, where the sample
contains or is suspected of containing a second species able to
interact with the reaction entity, and optionally other, different
species, where one of the species is a drug candidate. As one
example, if the reaction entity is an enzyme, the sample may
contain a substrate and a drug candidate suspected of interacting
with the enzyme in a way that inhibits enzyme/substrate
interaction; if the reaction entity is a substrate, the sample may
contain an enzyme and a drug candidate suspected of interacting
with the substrate in an inhibitory manner; if the reaction entity
is a nucleic acid, the sample may contain an enzyme able to bind
the nucleic acid (e.g., a nucleic acid synthesis enzyme), or a
complementary nucleic acid, and a drug candidate suspected of
interacting with the nucleic acid reaction entity in an inhibitory
manner; if the reaction entity is a receptor, the sample may
contain a ligand for the receptor and a drug candidate suspected of
interacting with the receptor in an inhibitory manner; etc. In each
of these cases, the drug candidate may also act in a way that
enhances, rather than inhibits, interaction.
[0194] In some cases, assays of the invention may be used in
high-throughput screening applications, e.g., where at least 100,
at least 1,000, at least 10,000, or at least 100,000 or more
analytes may be rapidly screened, for example, by exposing one or
more analytes to a nanoscale wire (e.g., in solution), and/or
exposing a plurality of analytes to a plurality of nanoscale wires
and/or reaction entities.
[0195] As non-limiting examples, referring now to the figures, FIG.
6A schematically shows a portion of a nanoscale detector device in
which nanoscale wire 38 has been modified with a reaction entity
that is a binding partner 42 for detecting analyte 44. FIG. 6B
schematically shows a portion of the nanoscale detector device of
FIG. 6A, in which the analyte 44 is attached to the specific
binding partner 42. Selectively functionalizing the surface of
nanoscale wires can be done, for example, by functionalizing the
nanoscale wire with a siloxane derivative. For example, a nanoscale
wire may be modified after construction of the nanoscale detector
device by immersing the device in a solution containing the
modifying chemicals to be coated. Alternatively, a microfluidic
channel may be used to deliver the chemicals to the nanoscale
wires. For example, amine groups may be attached by first making
the nanoscale detector device hydrophilic by oxygen plasma, or an
acid and/or oxidizing agent, and then immersing the nanoscale
detector device in a solution containing an amino silane. By way of
example, a nucleic acid may be attached by first attaching amine
groups as described above, and immersing the modified nanoscale
detector device in a solution containing bifunctional crosslinkers,
if necessary, and immersing the modified nanoscale detector device
in a solution containing the nucleic acid. The process may be
accelerated and promoted in some cases by applying a bias voltage
to the nanoscale wire. The bias voltage can be either positive or
negative depending on the nature of the reaction entity. For
example, a positive bias voltage will promote bringing a negatively
charged nucleic acid close to the nanoscale wire surface and
increasing its reaction rate with surface amino groups.
[0196] FIG. 7A shows one example of an article of the present
invention where one or more nanoscale wires are positioned within a
microfluidic channel. In FIG. 7A, nanoscale detector device 10
comprises a nanoscale wire 38 positioned above upper surface 18 of
substrate 16. Chip carrier 12 has an upper surface 14 for
supporting substrate 16 and electrical connections 22. Chip carrier
12 may be made of any insulating material that allows connection of
electrical connections 22 to electrodes 36. In one embodiment, the
chip carrier is an epoxy. Upper surface 14 of the chip carrier may
be of any shape including, for example, planar, convex, and
concave. In one embodiment, upper surface 14 of the chip carrier is
planar.
[0197] As shown in FIG. 7A, lower surface 20 of substrate 16 is
positioned adjacent to upper surface 14 of the chip carrier and
supports electrical connection 22. Substrate 16 may be made of a
polymer, silicon, quartz, or glass, for example. In one embodiment,
the substrate 16 is made of silicon coated with 600 nm of silicon
oxide. Upper surface 18 and lower surface 20 of substrate 16 may be
of any shape, such as planar, convex, and concave. In some cases,
lower surface 20 of substrate 16 contours to upper surface 14 of
chip carrier 12. Similarly, mold 24 has an upper surface 26 and a
lower surface 28, either of which may be of any shape. In certain
embodiments, lower surface 26 of mold 24 contours to upper surface
18 of substrate 16.
[0198] Mold 24 has a sample exposure region 30, shown here as a
microchannel, having a fluid inlet 32 and fluid outlet 34, shown in
FIG. 7A on the upper surface 26 of mold 24. Nanoscale wire 38 is
positioned such that at least a portion of the nanoscale wire is
positioned within sample exposure region 30. Electrodes 36 connect
nanoscale wire 38 to electrical connection 22. Electrical
connections 22 are, optionally, connected to a detector (not shown)
that measures a change in an electrical or other property of the
nanoscale wire. The distance between electrodes 36 may range from
50 nm to about 20 microns, in some cases from about 100 nm to about
10 microns, or from about 500 nm to about 5 microns.
[0199] FIG. 7B shows another embodiment of the present invention
wherein the nanoscale detector device 10 of FIG. 7A further
includes multiple nanoscale wires (not shown). In FIG. 7B, wire
interconnects 40a-h connect to corresponding nanoscale wires to
electrical connections, respectively (not shown). In some cases,
each nanoscale wire has a unique reaction entity selected to detect
a different analytes in the fluid. In this way, the determination
(presence, absence, and/or amount) of several analytes may be
determined using one sample while performing one test.
[0200] FIG. 8A depicts one example of an embodiment of a nanoscale
wire sensor of the invention. In the embodiment shown in FIG. 8A,
the nanoscale wire sensor invention comprises a nanoscale wire 50.
The nanoscale wire may have one or more reaction entities
immobilized relative to the surface. The surface of the nanoscale
wire can act as the gate 52 of an FET device and the electrical
contacts at either end of the nanoscale wire may allow the ends to
act as the drain 56 and the source 58. In the depicted embodiment,
the device is symmetric and either end of the nanoscale wire may be
considered the drain or the source. For purpose of illustration,
the nanoscale wire of FIG. 8A defines the left-hand side as the
source and the right hand side as the drain. FIG. 8A also shows
that the nanoscale wire device of this embodiment is disposed upon
and electrically connected to two conductor elements 54.
[0201] FIGS. 8A and 8B illustrate an example of a chemical and/or
ligand-gated field effect transistor ("FET") that can define a
sensor of the invention. FETs are well know in the art of
electronics, and are described in more detail in, e.g., The Art of
Electronics, Second Edition by Paul Horowitz and Winfield Hill,
Cambridge University Press, 1989, pp. 113-174. In the FET, the
availability of charge carriers is controlled by a voltage applied
to a third "control electrode," also known as the gate electrode.
The conduction in the channel is controlled by a voltage applied to
the gate electrode which produces an electric field across the
channel. The device of FIGS. 8A and 8B may be considered a chemical
or ligand-FET because the chemical or ligand provides the voltage
at the gate which produced the electric field which changes the
conductivity of the channel. This change in conductivity in the
channel effects the flow of current through the channel.
[0202] For this reason, a FET is often referred to as a
transconductant device in which a voltage on the gate controls the
current through the channel through the source and the drain. The
gate of a FET is insulated from the conduction channel, for
example, using a semiconductor junction such in a junction FET
(JFET) or using an oxide insulator such as in a metal oxide
semiconductor FET (MOSFET). Thus, as an example, in FIGS. 8A and
8B, an SiO.sub.2 exterior surface of the nanoscale wire sensor may
serve as the gate insulation for the gate.
[0203] In application, the nanoscale wire device illustrated in the
example of FIG. 8 provides an FET device that may be contacted with
a sample or disposed within the path of a sample flow. Analytes of
interest within the sample can contact the surface of the nanoscale
wire device and, under certain conditions, bind or otherwise become
immobilized relative to the surface and/or affect the binding
and/or adherence of other species. The exterior surface of the
device may, in some cases, have reaction entities, e.g., as
described above. The reaction entities may attract the analyte
and/or bind the analyte. A non-limiting example is shown in FIG.
8C, where there is depicted an analyte 60 (not drawn to scale)
bound to the surface of the nanoscale wire. Also shown, with
reference to FIG. 8D, an analyte bound to the nanoscale wire may
create a depletion region 62 within the nanoscale wire. In some
cases, the depletion region may limit current passing through the
wire. The depletion region can be depleted of holes or electrons,
depending upon the type of channel.
[0204] Certain aspects of the present invention include a
nanoscopic wire or other nanostructured material comprising one or
more semiconductor and/or metal compounds, for example, for use in
any of the above-described embodiments. In some cases, the
semiconductors and/or metals may be chemically and/or physically
combined, for example, as in a doped nanoscopic wire. The
nanoscopic wire may be, for example, a nanorod, a nanowire, a
nanowhisker, or a nanotube. The nanoscopic wire may be used in a
device, for example, as a semiconductor component, a pathway, etc.
The criteria for selection of nanoscale wires and other conductors
or semiconductors for use in the invention are based, in some
instances, upon whether the nanoscale wire is able to interact with
an analyte, or whether the appropriate reaction entity, e.g. a
binding partner, can be easily attached to the surface of the
nanoscale wire, or the appropriate reaction entity, e.g. a binding
partner, is near the surface of the nanoscale wire. Selection of
suitable conductors or semiconductors, including nanoscale wires,
will be apparent and readily reproducible by those of ordinary
skill in the art with the benefit of the present disclosure.
[0205] Many nanoscopic wires as used in accordance with the present
invention are individual nanoscopic wires. As used herein,
"individual nanoscopic wire" means a nanoscopic wire free of
contact with another nanoscopic wire (but not excluding contact of
a type that may be desired between individual nanoscopic wires,
e.g., as in a crossbar array). For example, an "individual" or a
"free-standing" article may, at some point in its life, not be
attached to another article, for example, with another nanoscopic
wire, or the free-standing article may be in solution. This is in
contrast to nanotubes produced primarily by laser vaporization
techniques that produce materials formed as ropes having diameters
of about 2 nm to about 50 nm or more and containing many individual
nanotubes. This is also in contrast to conductive portions of
articles which differ from surrounding material only by having been
altered chemically or physically, in situ, i.e., where a portion of
a uniform article is made different from its surroundings by
selective doping, etching, etc. An "individual" or a
"free-standing" article is one that can be (but need not be)
removed from the location where it is made, as an individual
article, and transported to a different location and combined with
different components to make a functional device such as those
described herein and those that would be contemplated by those of
ordinary skill in the art upon reading this disclosure.
[0206] In another set of embodiments, the nanoscopic wire (or other
nanostructured material) may include additional materials, such as
semiconductor materials, dopants, organic compounds, inorganic
compounds, etc. The following are non-limiting examples of
materials that may be used as dopants within the nanoscopic wire.
The dopant may be an elemental semiconductor, for example, silicon,
germanium, tin, selenium, tellurium, boron, diamond, or
phosphorous. The dopant may also be a solid solution of various
elemental semiconductors. Examples include a mixture of boron and
carbon, a mixture of boron and P(BP.sub.6), a mixture of boron and
silicon, a mixture of silicon and carbon, a mixture of silicon and
germanium, a mixture of silicon and tin, a mixture of germanium and
tin, etc. In some embodiments, the dopant may include mixtures of
Group IV elements, for example, a mixture of silicon and carbon, or
a mixture of silicon and germanium. In other embodiments, the
dopant may include mixtures of Group III and Group V elements, for
example, BN, BP, BAs, AlN, AlP, AlAs, AlSb, GaN, GaP, GaAs, GaSb,
InN, InP, InAs, or InSb. Mixtures of these combinations may also be
used, for example, a mixture of BN/BP/BAs, or BN/AlP. In other
embodiments, the dopants may include mixtures of Group III and
Group V elements. For example, the mixtures may include AlGaN,
GaPAs, InPAs, GaInN, AlGaInN, GaInAsP, or the like. In other
embodiments, the dopants may also include mixtures of Group II and
Group VI elements. For example, the dopant may include mixtures of
ZnO, ZnS, ZnSe, ZnTe, CdS, CdSe, CdTe, HgS, HgSe, HgTe, BeS, BeSe,
BeTe, MgS, MgSe, or the like. Alloys or mixtures of these dopants
are also be possible, for example, ZnCd Se, or ZnSSe or the like.
Additionally, mixtures of different groups of semiconductors may
also be possible; for example, combinations of Group II-Group VI
and Group III-Group V elements, such as (GaAs).sub.x(ZnS).sub.1-x.
Other non-limiting examples of dopants may include mixtures of
Group IV and Group VI elements, for example GeS, GeSe, GeTe, SnS,
SnSe, SnTe, PbO, PbS, PbSe, PbTe, etc. Other dopant mixtures may
include mixtures of Group I elements and Group VII elements, such
as CuF, CuCl, CuBr, CuI, AgF, AgCl, AgBr, AgI, or the like. Other
dopant mixtures may include different mixtures of these elements,
such as BeSiN.sub.2, CaCN.sub.2, ZnGeP.sub.2, CdSnAs.sub.2,
ZnSnSb.sub.2, CuGeP.sub.3, CuSi.sub.2P.sub.3, Si.sub.3N.sub.4,
Ge.sub.3N.sub.4, Al.sub.2O.sub.3, (Al, Ga, In).sub.2(S, Se,
Te).sub.3, Al.sub.2CO, (Cu, Ag)(Al, Ga, In, Tl, Fe)(S, Se,
Te).sub.2 or the like.
[0207] As a non-limiting example, a p-type dopant may be selected
from Group III, and an n-type dopant may be selected from Group V.
For instance, a p-type dopant may include at least one of B, Al and
In, and an n-type dopant may include at least one of P, As and Sb.
For Group III-Group V mixtures, a p-type dopant may be selected
from Group II, including one or more of Mg, Zn, Cd and Hg, or Group
IV, including one or more of C and Si. An n-type dopant may be
selected from at least one of Si, Ge, Sn, S, Se and Te. It will be
understood that the invention is not limited to these dopants, but
may include other elements, alloys, or mixtures as well.
[0208] As used herein, the term "Group," with reference to the
Periodic Table, is given its usual definition as understood by one
of ordinary skill in the art. For instance, the Group II elements
include Mg and Ca, as well as the Group II transition elements,
such as Zn, Cd, and Hg. Similarly, the Group III elements include
B, Al, Ga, In and Tl; the Group IV elements include C, Si, Ge, Sn,
and Pb; the Group V elements include N, P, As, Sb and Bi; and the
Group VI elements include O, S, Se, Te and Po. Combinations
involving more than one element from each Group are also possible.
For example, a Group II-VI material may include at least one
element from Group II and at least one element from Group VI, e.g.,
ZnS, ZnSe, ZnSSe, ZnCdS, CdS, or CdSe. Similarly, a Group III-V
material may include at least one element from Group III and at
least one element from Group V, for example GaAs, GaP, GaAsP, InAs,
InP, AlGaAs, or InAsP. Other dopants may also be included with
these materials and combinations thereof, for example, transition
metals such as Fe, Co, Te, Au, and the like. The nanoscale wire of
the present invention may further include, in some cases, any
organic or inorganic molecules. In some cases, the organic or
inorganic molecules are polarizable and/or have multiple charge
states.
[0209] In some embodiments, at least a portion of a nanoscopic wire
may be a bulk-doped semiconductor. As used herein, a "bulk-doped"
article (e.g. an article, or a section or region of an article) is
an article for which a dopant is incorporated substantially
throughout the crystalline lattice of the article, as opposed to an
article in which a dopant is only incorporated in particular
regions of the crystal lattice at the atomic scale, for example,
only on the surface or exterior. For example, some articles such as
carbon nanotubes are typically doped after the base material is
grown, and thus the dopant only extends a finite distance from the
surface or exterior into the interior of the crystalline lattice.
It should be understood that "bulk-doped" does not define or
reflect a concentration or amount of doping in a semiconductor, nor
does it necessarily indicate that the doping is uniform. In
particular, in some embodiments, a bulk-doped semiconductor may
comprise two or more bulk-doped regions. Thus, as used herein to
describe nanoscopic wires, "doped" refers to bulk-doped nanoscopic
wires, and, accordingly, a "doped nanoscopic (or nanoscale) wire"
is a bulk-doped nanoscopic wire. "Heavily doped" and "lightly
doped" are terms the meanings of which are understood by those of
ordinary skill in the art.
[0210] In one set of embodiments, the invention includes a
nanoscale wire (or other nanostructured material) that is a single
crystal. As used herein, a "single crystal" item (e.g., a
semiconductor) is an item that has covalent bonding, ionic bonding,
or a combination thereof throughout the item. Such a single-crystal
item may include defects in the crystal, but is to be distinguished
from an item that includes one or more crystals, not ionically or
covalently bonded, but merely in close proximity to one
another.
[0211] In yet another set of embodiments, the nanoscale wire (or
other nanostructured material) may comprise two or more regions
having different compositions. Each region of the nanoscale wire
may have any shape or dimension, and these can be the same or
different between regions. For example, a region may have a
smallest dimension of less than 1 micron, less than 100 nm, less
than 10 nm, or less than 1 nm. In some cases, one or more regions
may be a single monolayer of atoms (i.e., "delta-doping"). In
certain cases, the region may be less than a single monolayer thick
(for example, if some of the atoms within the monolayer are
absent).
[0212] The two or more regions may be longitudinally arranged
relative to each other, and/or radially arranged (e.g., as in a
core/shell arrangement) within the nanoscale wire. As one example,
the nanoscale wire may have multiple regions of semiconductor
materials arranged longitudinally. In another example, a nanoscale
wire may have two regions having different compositions arranged
longitudinally, surrounded by a third region or several regions,
each having a composition different from that of the other regions.
As a specific example, the regions may be arranged in a layered
structure within the nanoscale wire, and one or more of the regions
may be delta-doped or at least partially delta-doped. As another
example, the nanoscale wire may have a series of regions positioned
both longitudinally and radially relative to each other. The
arrangement can include a core that differs in composition along
its length (changes in composition or concentration
longitudinally), while the lateral (radial) dimensions of the core
do, or do not, change over the portion of the length differing in
composition. The shell portions can be adjacent each other
(contacting each other, or defining a change in composition or
concentration of a unitary shell structure longitudinally), or can
be separated from each other by, for example, air, an insulator, a
fluid, or an auxiliary, non-nanoscale wire component. The shell
portions can be positioned directly on the core, or can be
separated from the core by one or more intermediate shells portions
that can themselves be constant in composition longitudinally, or
varying in composition longitudinally, i.e., the invention allows
the provision of any combination of a nanowire core and any number
of radially-positioned shells (e.g., concentric shells), where the
core and/or any shells can vary in composition and/or concentration
longitudinally, any shell sections can be spaced from any other
shell sections longitudinally, and different numbers of shells can
be provided at different locations longitudinally along the
structure.
[0213] In still another set of embodiments, a nanoscale wire may be
positioned proximate the surface of a substrate, i.e., the
nanoscale wire may be positioned within about 50 nm, about 25 nm,
about 10 nm, or about 5 nm of the substrate. In some cases, the
proximate nanoscale wire may contact at least a portion of the
substrate. In one embodiment, the substrate comprises a
semiconductor and/or a metal. Non-limiting examples include Si, Ge,
GaAs, etc. Other suitable semiconductors and/or metals are
described above with reference to nanoscale wires. In certain
embodiments, the substrate may comprise a nonmetal/nonsemiconductor
material, for example, a glass, a plastic or a polymer, a gel, a
thin film, etc. Non-limiting examples of suitable polymers that may
form or be included in the substrate include polyethylene,
polypropylene, poly(ethylene terephthalate), polydimethylsiloxane,
or the like.
[0214] In certain aspects, the present invention provides a method
of preparing a nanostructure. In one set of embodiments, the method
involves allowing a first material to diffuse into at least part of
a second material, optionally creating a new compound. For example,
the first and second materials may each be metals or
semiconductors, one material may be a metal and the other material
may be a semiconductor, etc. In one set of embodiments, a
semiconductor may be annealed to a metal. For example, a portion of
the semiconductor and/or a portion of the metal may be heated such
that at least some metal atoms are able to diffuse into the
semiconductor, or vice versa. In one embodiment, a metal electrode
(e.g., a nickel, gold, copper, silver, chromium electrode, etc.),
may be positioned in physical contact with a semiconductor
nanoscopic wire, and then annealed such that at least a portion of
the semiconductor diffuses into at least a portion of the metal,
optionally forming a metal-semiconductor compound, e.g., as
disclosed in International Patent Application No.
PCT/US2005/004459, filed Feb. 14, 2005, entitled "Nanostructures
Containing Metal-Semiconductor Compounds," by Lieber, et al.,
incorporated herein by reference. For example, the semiconductor
may be annealed with the metal at a temperature of about
300.degree. C., about 350.degree. C., about 400.degree. C., about
450.degree. C., about 500.degree. C., about 550.degree. C., or
about 600.degree. C. for a period of time of at least about 30
minutes, at least about 1 hour, at least about 2 hours, at least
about 4 hours, at least about 6 hours etc. Such annealing may
allow, for example, lower contact resistances or impedances between
the metal and the semiconductor.
[0215] In some cases, the metal may be passivated, e.g., as
described herein. For example, the metal, or at least a portion of
the metal, may be exposed to one or more passivating agents, for
example, Si.sub.3N.sub.4. Insulation of the metal by the
passivating agent may be used to form a layer covering the surface
of the metal, for example, to prevent reaction or nonspecific
binding between an analyte and the metal. For instance, a metal
electrode may be in electrical communication with a semiconductor
comprising one or more immobilized reaction entities, and the metal
electrode may be passivated to prevent a reaction or nonspecific
binding between the metal and the reaction entity, and/or to reduce
or prevent leakage current from the metal. In some cases, the
passivation may be conducted at a relatively high temperature, for
example, within a plasma CVD chamber.
[0216] In certain embodiments, the present invention involves
controlling and altering the doping of semiconductors in a
nanoscale wire. In some cases, the nanoscale wires (or other
nanostructure) may be produced using techniques that allow for
direct and controlled growth of the nanoscale wires. In some cases,
the nanoscale wire may be doped during growth of the nanoscale
wire. Doping the nanoscale wire during growth may result in the
property that the doped nanoscale wire is bulk-doped. Furthermore,
such doped nanoscale wires may be controllably doped, such that a
concentration of a dopant within the doped nanoscale wire can be
controlled and therefore reproduced consistently.
[0217] Certain arrangements may utilize metal-catalyzed CVD
techniques ("chemical vapor deposition") to synthesize individual
nanoscale wires. CVD synthetic procedures useful for preparing
individual wires directly on surfaces and in bulk form are
generally known, and can readily be carried out by those of
ordinary skill in the art. Nanoscopic wires may also be grown
through laser catalytic growth. With the same basic principles as
LCG, if uniform diameter nanoclusters (less than 10% to 20%
variation depending on how uniform the nanoclusters are) are used
as the catalytic cluster, nanoscale wires with uniform size
(diameter) distribution can be produced, where the diameter of the
wires is determined by the size of the catalytic clusters. By
controlling growth time, nanoscale wires with different lengths can
be grown.
[0218] One technique that may be used to grow nanoscale wires is
catalytic chemical vapor deposition ("C-CVD"). In C-CVD, reactant
molecules are formed from the vapor phase. Nanoscale wires may be
doped by introducing the doping element into the vapor phase
reactant (e.g. diborane and phosphane). The doping concentration
may be controlled by controlling the relative amount of the doping
compound introduced in the composite target. The final doping
concentration or ratios are not necessarily the same as the
vapor-phase concentration or ratios. By controlling growth
conditions, such as temperature, pressure or the like, nanoscale
wires having the same doping concentration may be produced.
[0219] Another technique for direct fabrication of nanoscale wire
junctions during synthesis is referred to as laser catalytic growth
("LCG"). In LCG, dopants are controllably introduced during vapor
phase growth of nanoscale wires. Laser vaporization of a composite
target composed of a desired material (e.g. silicon or indium
phosphide) and a catalytic material (e.g. a nanoparticle catalyst)
may create a hot, dense vapor. The vapor may condense into liquid
nanoclusters through collision with a buffer gas. Growth may begin
when the liquid nanoclusters become supersaturated with the desired
phase and can continue as long as reactant is available. Growth may
terminate when the nanoscale wire passes out of the hot reaction
zone and/or when the temperature is decreased. The nanoscale wire
may be further subjected to different semiconductor reagents during
growth.
[0220] Other techniques to produce nanoscale semiconductors such as
nanoscale wires are also contemplated. For example, nanoscale wires
of any of a variety of materials may be grown directly from vapor
phase through a vapor-solid process. Also, nanoscale wires may also
be produced by deposition on the edge of surface steps, or other
types of patterned surfaces. Further, nanoscale wires may be grown
by vapor deposition in or on any generally elongated template. The
porous membrane may be porous silicon, anodic alumina, a diblock
copolymer, or any other similar structure. The natural fiber may be
DNA molecules, protein molecules carbon nanotubes, any other
elongated structures. For all the above described techniques, the
source materials may be a solution or a vapor. In some cases, while
in solution phase, the template may also include be column micelles
formed by surfactant.
[0221] In some cases, the nanoscale wire may be doped after
formation. In one technique, a nanoscale wire having a
substantially homogeneous composition is first synthesized, then is
doped post-synthetically with various dopants. Such doping may
occur throughout the entire nanoscale wire, or in one or more
portions of the nanoscale wire, for example, in a wire having
multiple regions differing in composition.
[0222] One aspect of the invention provides for the assembly, or
controlled placement, of nanoscale wires on a surface. Any
substrate may be used for nanoscale wire placement, for example, a
substrate comprising a semiconductor, a substrate comprising a
metal, a substrate comprising a glass, a substrate comprising a
polymer, a substrate comprising a gel, a substrate that is a thin
film, a substantially transparent substrate, a non-planar
substrate, a flexible substrate, a curved substrate, etc. In some
cases, assembly can be carried out by aligning nanoscale wires
using an electrical field. In other cases, assembly can be
performed using an arrangement involving positioning a fluid flow
directing apparatus to direct fluid containing suspended nanoscale
wires toward and in the direction of alignment with locations at
which nanoscale wires are desirably positioned.
[0223] In certain cases, a nanoscale wire (or other nanostructure)
is formed on the surface of a substrate, and/or is defined by a
feature on a substrate. In one example, a nanostructure, such as a
nanoscale wire, is formed as follows. A substrate is imprinted
using a stamp or other applicator to define a pattern, such as a
nanoscale wire or other nanoscale structure. After removal of the
stamp or other applicator, at least a portion of the imprintable
layer is removed, for example, through etching processes such as
reactive ion etching (RIE), or other known techniques. In some
cases, enough imprintable material may be removed from the
substrate so as to expose portions of the substrate free of the
imprintable material. A metal or other materials may then be
deposited onto at least a portion of the substrate, for example,
gold, copper, silver, chromium, etc. In some cases, a "lift-off"
step may then be performed, where at least a portion of the
imprintable material is removed from the substrate. Metal or other
material deposited onto the imprintable material may be removed
along with the removal of the imprintable material, for example, to
form one or more nanoscale wires. Structures deposited on the
surface may be connected to one or more electrodes in some cases.
The substrate may be any suitable substrate that can support an
imprintable layer, for example, comprising a semiconductor, a
metal, a glass, a polymer, a gel, etc. In some cases, the substrate
may be a thin film, substantially transparent, non-planar,
flexible, and/or curved, etc.
[0224] In certain cases, an array of nanoscale wires may be
produced by providing a surface having a plurality of substantially
aligned nanoscale wires, and removing, from the surface, a portion
of one or more of the plurality of nanoscale wires. The remaining
nanoscale wires on the surface may then be connected to one or more
electrodes. In certain cases, the nanoscopic wires are arranged
such that they are in contact with each other; in other instances,
however, the aligned nanoscopic wires may be at a pitch such that
they are substantially not in physical contact.
[0225] In certain cases, nanoscale wires are positioned proximate a
surface using flow techniques, i.e., techniques where one or more
nanoscale wires may be carried by a fluid to a substrate. Nanoscale
wires (or any other elongated structures) can be aligned by
inducing a flow of a nanoscale wire solution on surface, where the
flow can include channel flow or flow by any other suitable
technique. Nanoscale wire arrays with controlled position and
periodicity can be produced by patterning a surface of a substrate
and/or conditioning the surface of the nanoscale wires with
different functionalities, where the position and periodicity
control may be achieved by designing specific complementary forces
between the patterned surface and the nanoscale wires. Nanoscale
wires can also be assembled using a Langmuir-Blodgett (LB) trough.
Nanoscale wires may first be surface-conditioned and dispersed to
the surface of a liquid phase to form a Langmuir-Blodgett film. In
some cases, the liquid may include a surfactant, which can, in some
cases, reduce aggregation of the nanoscale wires and/or reduce the
ability of the nanoscale wires to interact with each other. The
nanoscale wires can be aligned into different patterns (such as
parallel arrays or fibers) by compressing the surface or reducing
the surface area of the surface.
[0226] Another arrangement involves forming surfaces on a substrate
including regions that selectively attract nanoscale wires
surrounded by regions that do not selectively attract them.
Surfaces can be patterned using known techniques such as
electron-beam patterning, "soft-lithography" such as that described
in International Patent Application Serial No. PCT/US96/03073,
entitled "Microcontact Printing on Surfaces and Derivative
Articles," filed Mar. 1, 1996, published as Publication No. WO
96/29629 on Jul. 26, 1996; or U.S. Pat. No. 5,512,131, entitled
"Formation of Microstamped Patterns on Surfaces and Derivative
Articles," issued Apr. 30, 1996, each of which is incorporated
herein by reference. Additional techniques are described in U.S.
Patent Application Ser. No. 60/142,216, entitled "Molecular
Wire-Based Devices and Methods of Their Manufacture," filed Jul. 2,
1999, incorporated herein by reference. Fluid flow channels can be
created at a size scale advantageous for placement of nanoscale
wires on surfaces using a variety of techniques such as those
described in International Patent Application Serial No.
PCT/US97/04005, entitled "Method of Forming Articles and Patterning
Surfaces via Capillary Micromolding," filed Mar. 14, 1997,
published as Publication No. WO 97/33737 on Sep. 18, 1997, and
incorporated herein by reference. Other techniques include those
described in U.S. Pat. No. 6,645,432, entitled "Microfluidic
Systems Including Three-dimensionally Arrayed Channel Networks,"
issued Nov. 11, 2003, incorporated herein by reference.
[0227] Chemically patterned surfaces other than SAM-derivatized
surfaces can be used, and many techniques for chemically patterning
surfaces are known. Another example of a chemically patterned
surface may be a micro-phase separated block copolymer structure.
These structures may provide a stack of dense lamellar phases,
where a cut through these phases reveals a series of "lanes"
wherein each lane represents a single layer. The assembly of
nanoscale wires onto substrate and electrodes can also be assisted
using bimolecular recognition in some cases. For example, one
biological binding partner may be immobilized onto the nanoscale
wire surface and the other one onto a substrate or an electrode
using physical adsorption or covalently linking. An example
technique which may be used to direct the assembly of a nanoscopic
wires on a substrate is by using "SAMs," or self-assembled
monolayers. Any of a variety of substrates and SAM-forming material
can be used along with microcontact printing techniques, such as
those described in International Patent Application Serial No.
PCT/US96/03073, entitled "Microcontact Printing on Surfaces and
Derivative Articles," filed Mar. 1, 1996, published as Publication
No. WO 96/29629 on Jul. 26, 1996, incorporated herein by reference
in its entirety.
[0228] In some cases, the nanoscale wire arrays may also be
transferred to another substrate, e.g., by using stamping
techniques. In certain instances, nanoscale wires may be assembled
using complementary interaction, i.e., where one or more
complementary chemical, biological, electrostatic, magnetic or
optical interactions are used to position one or more nanoscale
wires on a substrate. In certain cases, physical patterns may be
used to position nanoscale wires proximate a surface. For example,
nanoscale wires may be positioned on a substrate using physical
patterns, for instance, aligning the nanoscale wires using corner
of the surface steps or along trenches on the substrate.
[0229] In one aspect, the present invention provides any of the
above-mentioned devices packaged in kits, optionally including
instructions for use of the devices. As used herein, "instructions"
can define a component of instructional utility (e.g., directions,
guides, warnings, labels, notes, FAQs ("frequently asked
questions"), etc., and typically involve written instructions on or
associated with packaging of the invention. Instructions can also
include instructional communications in any form (e.g., oral,
electronic, digital, optical, visual, etc.), provided in any manner
such that a user will clearly recognize that the instructions are
to be associated with the device, e.g., as discussed herein.
Additionally, the kit may include other components depending on the
specific application, for example, containers, adapters, syringes,
needles, replacement parts, etc. As used herein, "promoted"
includes all methods of doing business including, but not limited
to, methods of selling, advertising, assigning, licensing,
contracting, instructing, educating, researching, importing,
exporting, negotiating, financing, loaning, trading, vending,
reselling, distributing, replacing, or the like that can be
associated with the methods and compositions of the invention,
e.g., as discussed herein. Promoting may also include, in some
cases, seeking approval from a government agency to sell a
composition of the invention for medicinal purposes. Methods of
promotion can be performed by any party including, but not limited
to, businesses (public or private), contractual or sub-contractual
agencies, educational institutions such as colleges and
universities, research institutions, hospitals or other clinical
institutions, governmental agencies, etc. Promotional activities
may include instructions or communications of any form (e.g.,
written, oral, and/or electronic communications, such as, but not
limited to, e-mail, telephonic, facsimile, Internet, Web-based,
etc.) that are clearly associated with the invention.
DEFINITIONS
[0230] The following definitions will aid in the understanding of
the invention. Certain devices of the invention may include wires
or other components of scale commensurate with nanometer-scale
wires, which includes nanotubes and nanowires. In some embodiments,
however, the invention comprises articles that may be greater than
nanometer size (e.g., micrometer-sized). As used herein,
"nanoscopic-scale," "nanoscopic," "nanometer-scale," "nanoscale,"
the "nano-" prefix (for example, as in "nanostructured"), and the
like generally refers to elements or articles having widths or
diameters of less than about 1 micron, and less than about 100 nm
in some cases. In all embodiments, specified widths can be a
smallest width (i.e. a width as specified where, at that location,
the article can have a larger width in a different dimension), or a
largest width (i.e. where, at that location, the article has a
width that is no wider than as specified, but can have a length
that is greater).
[0231] As used herein, a "wire" generally refers to any material
having a conductivity of or of similar magnitude to any
semiconductor or any metal, and in some embodiments may be used to
connect two electronic components such that they are in electronic
communication with each other. For example, the terms "electrically
conductive" or a "conductor" or an "electrical conductor" when used
with reference to a "conducting" wire or a nanoscale wire, refers
to the ability of that wire to pass charge. Typically, an
electrically conductive nanoscale wire will have a resistivity
comparable to that of metal or semiconductor materials, and in some
cases, the electrically conductive nanoscale wire may have lower
resistivities, for example, resistivities of less than about 100
microOhm cm (.mu..OMEGA.cm). In some cases, the electrically
conductive nanoscale wire will have a resistivity lower than about
10.sup.-3 ohm meters, lower than about 10.sup.-4 ohm meters, or
lower than about 10.sup.-6 ohm meters or 10.sup.-7 ohm meters.
[0232] A "semiconductor," as used herein, is given its ordinary
meaning in the art, i.e., an element having semiconductive or
semi-metallic properties (i.e., between metallic and non-metallic
properties). An example of a semiconductor is silicon. Other
non-limiting examples include gallium, germanium, diamond (carbon),
tin, selenium, tellurium, boron, or phosphorous.
[0233] A "nanoscopic wire" (also known herein as a
"nanoscopic-scale wire" or "nanoscale wire") generally is a wire,
that at any point along its length, has at least one
cross-sectional dimension and, in some embodiments, two orthogonal
cross-sectional dimensions less than 1 micron, less than about 500
nm, less than about 200 nm, less than about 150 nm, less than about
100 nm, less than about 70, less than about 50 nm, less than about
20 nm, less than about 10 nm, or less than about 5 nm. In other
embodiments, the cross-sectional dimension can be less than 2 nm or
1 nm. In one set of embodiments, the nanoscale wire has at least
one cross-sectional dimension ranging from 0.5 nm to 100 nm or 200
nm. In some cases, the nanoscale wire is electrically conductive.
Where nanoscale wires are described having, for example, a core and
an outer region, the above dimensions generally relate to those of
the core. The cross-section of a nanoscopic wire may be of any
arbitrary shape, including, but not limited to, circular, square,
rectangular, annular, polygonal, or elliptical, and may be a
regular or an irregular shape. The nanoscale wire may be solid or
hollow. A non-limiting list of examples of materials from which
nanoscale wires of the invention can be made appears below. Any
nanoscale wire can be used in any of the embodiments described
herein, including carbon nanotubes, molecular wires (i.e., wires
formed of a single molecule), nanorods, nanowires, nanowhiskers,
organic or inorganic conductive or semiconducting polymers, and the
like, unless otherwise specified. Other conductive or
semiconducting elements that may not be molecular wires, but are of
various small nanoscopic-scale dimensions, can also be used in some
instances, e.g. inorganic structures such as main group and metal
atom-based wire-like silicon, transition metal-containing wires,
gallium arsenide, gallium nitride, indium phosphide, germanium,
cadmium selenide, etc. A wide variety of these and other nanoscale
wires can be grown on and/or applied to surfaces in patterns useful
for electronic devices in a manner similar to techniques described
herein involving the specific nanoscale wires used as examples,
without undue experimentation. The nanoscale wires, in some cases,
may be formed having dimensions of at least about 1 micron, at
least about 3 microns, at least about 5 microns, or at least about
10 microns or about 20 microns in length, and can be less than
about 100 nm, less than about 80 nm, less than about 60 nm, less
than about 40 nm, less than about 20 nm, less than about 10 nm, or
less than about 5 nm in thickness (height and width). The nanoscale
wires may have an aspect ratio (length to thickness) of greater
than about 2:1, greater than about 3:1, greater than about 4:1,
greater than about 5:1, greater than about 10:1, greater than about
25:1, greater than about 50:1, greater than about 75:1, greater
than about 100:1, greater than about 150:1, greater than about
250:1, greater than about 500:1, greater than about 750:1, or
greater than about 1000:1 or more in some cases.
[0234] A "nanowire" (e.g. comprising silicon and/or another
semiconductor material) is a nanoscopic wire that is typically a
solid wire, and may be elongated in some cases. Preferably, a
nanowire (which is abbreviated herein as "NW") is an elongated
semiconductor, i.e., a nanoscale semiconductor. A "non-nanotube
nanowire" is any nanowire that is not a nanotube. In one set of
embodiments of the invention, a non-nanotube nanowire having an
unmodified surface (not including an auxiliary reaction entity not
inherent in the nanotube in the environment in which it is
positioned) is used in any arrangement of the invention described
herein in which a nanowire or nanotube can be used.
[0235] As used herein, a "nanotube" (e.g. a carbon nanotube) is a
nanoscopic wire that is hollow, or that has a hollowed-out core,
including those nanotubes known to those of ordinary skill in the
art. "Nanotube" is abbreviated herein as "NT." Nanotubes are used
as one example of small wires for use in the invention and, in
certain embodiments, devices of the invention include wires of
scale commensurate with nanotubes. Examples of nanotubes that may
be used in the present invention include, but are not limited to,
single-walled nanotubes (SWNTs). Structurally, SWNTs are formed of
a single graphene sheet rolled into a seamless tube. Depending on
the diameter and helicity, SWNTs can behave as one-dimensional
metals and/or semiconductors. SWNTs. Methods of manufacture of
nanotubes, including SWNTs, and characterization are known. Methods
of selective functionalization on the ends and/or sides of
nanotubes also are known, and the present invention makes use of
these capabilities for molecular electronics in certain
embodiments. Multi-walled nanotubes are well known, and can be used
as well.
[0236] As used herein, an "elongated" article (e.g. a semiconductor
or a section thereof) is an article for which, at any point along
the longitudinal axis of the article, the ratio of the length of
the article to the largest width at that point is greater than
2:1.
[0237] A "width" of an article, as used herein, is the distance of
a straight line from a point on a perimeter of the article, through
the center of the article, to another point on the perimeter of the
article. As used herein, a "width" or a "cross-sectional dimension"
at a point along a longitudinal axis of an article is the distance
along a straight line that passes through the center of a
cross-section of the article at that point and connects two points
on the perimeter of the cross-section. The "cross-section" at a
point along the longitudinal axis of an article is a plane at that
point that crosses the article and is orthogonal to the
longitudinal axis of the article. The "longitudinal axis" of an
article is the axis along the largest dimension of the article.
Similarly, a "longitudinal section" of an article is a portion of
the article along the longitudinal axis of the article that can
have any length greater than zero and less than or equal to the
length of the article. Additionally, the "length" of an elongated
article is a distance along the longitudinal axis from end to end
of the article.
[0238] As used herein, a "cylindrical" article is an article having
an exterior shaped like a cylinder, but does not define or reflect
any properties regarding the interior of the article. In other
words, a cylindrical article may have a solid interior, may have a
hollowed-out interior, etc. Generally, a cross-section of a
cylindrical article appears to be circular or approximately
circular, but other cross-sectional shapes are also possible, such
as a hexagonal shape. The cross-section may have any arbitrary
shape, including, but not limited to, square, rectangular, or
elliptical. Regular and irregular shapes are also included.
[0239] As used herein, an "array" of articles (e.g., nanoscopic
wires) comprises a plurality of the articles, for example, a series
of aligned nanoscale wires, which may or may not be in contact with
each other. As used herein, a "crossed array" or a "crossbar array"
is an array where at least one of the articles contacts either
another of the articles or a signal node (e.g., an electrode).
[0240] The invention provides, in certain embodiments, a nanoscale
wire or wires forming part of a system constructed and arranged to
determine an analyte in a sample to which the nanoscale wire(s) is
exposed. "Determine," in this context, generally refers to the
analysis of a species, for example, quantitatively or
qualitatively, and/or the detection of the presence or absence of
the species. "Determining" may also refer to the analysis of an
interaction between two or more species, for example,
quantitatively or qualitatively, and/or by detecting the presence
or absence of the interaction, e.g. determination of the binding
between two species. As an example, an analyte may cause a
determinable change in an electrical property of a nanoscale wire
(e.g., electrical conductivity, resistivity, impedance, etc.), a
change in an optical property of the nanoscale wire, etc. Examples
of determination techniques include, but are not limited to,
piezoelectric measurement, electrochemical measurement,
electromagnetic measurement, photodetection, mechanical
measurement, acoustic measurement, gravimetric measurement, and the
like. "Determining" also means detecting or quantifying interaction
between species.
[0241] A "fluid," as used herein, generally refers to a substance
that tends to flow and to conform to the outline of its container.
Typically, fluids are materials that are unable to withstand a
static shear stress. When a shear stress is applied to a fluid, it
experiences a continuing and permanent distortion. Typical fluids
include liquids and gases, but may also include free-flowing solid
particles, viscoelastic fluids, and the like.
[0242] As used herein, a component that is "immobilized relative
to" another component either is fastened to the other component or
is indirectly fastened to the other component, e.g., by being
fastened to a third component to which the other component also is
fastened. For example, a first entity is immobilized relative to a
second entity if a species fastened to the surface of the first
entity attaches to an entity, and a species on the surface of the
second entity attaches to the same entity, where the entity can be
a single entity, a complex entity of multiple species, another
particle, etc. In certain embodiments, a component that is
immobilized relative to another component is immobilized using
bonds that are stable, for example, in solution or suspension. In
some embodiments, non-specific binding of a component to another
component, where the components may easily separate due to solvent
or thermal effects, is not preferred.
[0243] As used herein, "fastened to or adapted to be fastened to,"
as used in the context of a species relative to another species or
a species relative to a surface of an article (such as a nanoscale
wire), or to a surface of an article relative to another surface,
means that the species and/or surfaces are chemically or
biochemically linked to or adapted to be linked to, respectively,
each other via covalent attachment, attachment via specific
biological binding (e.g., biotin/streptavidin), coordinative
bonding such as chelate/metal binding, or the like. For example,
"fastened" in this context includes multiple chemical linkages,
multiple chemical/biological linkages, etc., including, but not
limited to, a binding species such as a peptide synthesized on a
nanoscale wire, a binding species specifically biologically coupled
to an antibody which is bound to a protein such as protein A, which
is attached to a nanoscale wire, a binding species that forms a
part of a molecule, which in turn is specifically biologically
bound to a binding partner covalently fastened to a surface of a
nanoscale wire, etc. A species also is adapted to be fastened to a
surface if a surface carries a particular nucleotide sequence, and
the species includes a complementary nucleotide sequence.
[0244] "Specifically fastened" or "adapted to be specifically
fastened" means a species is chemically or biochemically linked to
or adapted to be linked to, respectively, another specimen or to a
surface as described above with respect to the definition of
"fastened to or adapted to be fastened," but excluding essentially
all non-specific binding. "Covalently fastened" means fastened via
essentially nothing other than one or more covalent bonds.
[0245] The term "binding" refers to the interaction between a
corresponding pair of molecules or surfaces that exhibit mutual
affinity or binding capacity, typically due to specific or
non-specific binding or interaction, including, but not limited to,
biochemical, physiological, and/or chemical interactions.
"Biological binding" defines a type of interaction that occurs
between pairs of molecules including proteins, nucleic acids,
glycoproteins, carbohydrates, hormones and the like. Specific
non-limiting examples include antibody/antigen, antibody/hapten,
enzyme/substrate, enzyme/inhibitor, enzyme/cofactor, binding
protein/substrate, carrier protein/substrate, lectin/carbohydrate,
receptor/hormone, receptor/effector, complementary strands of
nucleic acid, protein/nucleic acid repressor/inducer, ligand/cell
surface receptor, virus/ligand, virus/cell surface receptor,
etc.
[0246] The term "binding partner" refers to a molecule that can
undergo binding with a particular molecule. Biological binding
partners are examples. For example, Protein A is a binding partner
of the biological molecule IgG, and vice versa. Other non-limiting
examples include nucleic acid-nucleic acid binding, nucleic
acid-protein binding, protein-protein binding, enzyme-substrate
binding, receptor-ligand binding, receptor-hormone binding,
antibody-antigen binding, etc. Binding partners include specific,
semi-specific, and non-specific binding partners as known to those
of ordinary skill in the art. For example, Protein A is usually
regarded as a "non-specific" or semi-specific binder. The term
"specifically binds," when referring to a binding partner (e.g.,
protein, nucleic acid, antibody, etc.), refers to a reaction that
is determinative of the presence and/or identity of one or other
member of the binding pair in a mixture of heterogeneous molecules
(e.g., proteins and other biologics). Thus, for example, in the
case of a receptor/ligand binding pair the ligand would
specifically and/or preferentially select its receptor from a
complex mixture of molecules, or vice versa. An enzyme would
specifically bind to its substrate, a nucleic acid would
specifically bind to its complement, an antibody would specifically
bind to its antigen. Other examples include nucleic acids that
specifically bind (hybridize) to their complement, antibodies
specifically bind to their antigen, binding pairs such as those
described above, and the like. The binding may be by one or more of
a variety of mechanisms including, but not limited to ionic
interactions, and/or covalent interactions, and/or hydrophobic
interactions, and/or van der Waals interactions, etc.
[0247] The terms "polypeptide," "peptide," and "protein" are used
interchangeably herein to refer to a polymer of amino acid
residues. The terms apply to amino acid polymers in which one or
more amino acid residue is an artificial chemical analogue of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers. The term also includes
variants on the traditional peptide linkage joining the amino acids
making up the polypeptide.
[0248] As used herein, terms such as "polynucleotide" or
"oligonucleotide" or grammatical equivalents generally refer to a
polymer of at least two nucleotide bases covalently linked
together, which may include, for example, but not limited to,
natural nucleosides (e.g., adenosine, thymidine, guanosine,
cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine
and deoxycytidine), nucleoside analogs (e.g., 2-aminoadenosine,
2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine,
C5-bromouridine, C5-fluorouridine, C5-iodouridine,
C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine,
7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine,
06-methylguanosine, 2-thiocytidine, 2-aminopurine,
2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine),
chemically or biologically modified bases (e.g., methylated bases),
intercalated bases, modified sugars (2'-fluororibose, arabinose, or
hexose), modified phosphate moieties (e.g., phosphorothioates or
5'-N-phosphoramidite linkages), and/or other naturally and
non-naturally occurring bases substitutable into the polymer,
including substituted and unsubstituted aromatic moieties. Other
suitable base and/or polymer modifications are well-known to those
of skill in the art. Typically, an "oligonucleotide" is a polymer
having 20 bases or less, and a "polynucleotide" is a polymer having
at least 20 bases. Those of ordinary skill in the art will
recognize that these terms are not precisely defined in terms of
the number of bases present within the polymer strand.
[0249] A "nucleic acid," as used herein, is given its ordinary
meaning as used in the art. Nucleic acids can be single-stranded or
double stranded, and will generally contain phosphodiester bonds,
although in some cases, as outlined below, nucleic acid analogs are
included that may have alternate backbones, comprising, for
example, phosphoramide (Beaucage et al. (1993) Tetrahedron
49(10):1925) and references therein; Letsinger (1970) J. Org. Chem.
35:3800; Sprinzl et al. (1977) Eur. J. Biochem. 81: 579; Letsinger
et al. (1986) Nucl. Acids Res. 14: 3487; Sawai et al. (1984) Chem.
Lett. 805, Letsinger et al. (1988) J. Am. Chem. Soc. 110: 4470; and
Pauwels et al. (1986) Chemica Scripta 26: 1419), phosphorothioate
(Mag et al. (1991) Nucleic Acids Res. 19:1437; and U.S. Pat. No.
5,644,048), phosphorodithioate (Briu et al. (1989) J. Am. Chem.
Soc. 111:2321, O-methylphosphoroamidite linkages (see Eckstein,
Oligonucleotides and Analogues: A Practical Approach, Oxford
University Press), and peptide nucleic acid backbones and linkages
(see Egholm (1992) J. Am. Chem. Soc. 114:1895; Meier et al. (1992)
Chem. Int. Ed. Engl. 31: 1008; Nielsen (1993) Nature, 365: 566;
Carlsson et al. (1996) Nature 380: 207). Other analog nucleic acids
include those with positive backbones (Denpcy et al. (1995) Proc.
Natl. Acad. Sci. USA 92: 6097; non-ionic backbones (U.S. Pat. Nos.
5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863; Angew.
(1991) Chem. Intl. Ed. English 30: 423; Letsinger et al. (1988) J.
Am. Chem. Soc. 110:4470; Letsinger et al. (1994) Nucleoside &
Nucleotide 13:1597; Chapters 2 and 3, ASC Symposium Series 580,
"Carbohydrate Modifications in Antisense Research", Ed. Y. S.
Sanghui and P. Dan Cook; Mesmaeker et al. (1994), Bioorganic &
Medicinal Chem. Lett. 4: 395; Jeffs et al. (1994) J. Biomolecular
NMR 34:17; Tetrahedron Lett. 37:743 (1996)) and non-ribose
backbones, including those described in U.S. Pat. Nos. 5,235,033
and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580,
Carbohydrate Modifications in Antisense Research, Ed. Y. S. Sanghui
and P. Dan Cook. Nucleic acids containing one or more carbocyclic
sugars are also included within the definition of nucleic acids
(see Jenkins et al. (1995), Chem. Soc. Rev. pp. 169-176). Several
nucleic acid analogs are described in Rawls, Chemical &
Engineering News, Jun. 2, 1997 page 35. These modifications of the
ribose-phosphate backbone may be done to facilitate the addition of
additional moieties such as labels, or to increase the stability
and half-life of such molecules in physiological environments.
[0250] As used herein, an "antibody" refers to a protein or
glycoprotein including one or more polypeptides substantially
encoded by immunoglobulin genes or fragments of immunoglobulin
genes. The recognized immunoglobulin genes include the kappa,
lambda, alpha, gamma, delta, epsilon and mu constant region genes,
as well as myriad immunoglobulin variable region genes. Light
chains are classified as either kappa or lambda. Heavy chains are
classified as gamma, mu, alpha, delta, or epsilon, which in turn
define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE,
respectively. A typical immunoglobulin (antibody) structural unit
is known to comprise a tetramer. Each tetramer is composed of two
identical pairs of polypeptide chains, each pair having one "light"
(about 25 kD) and one "heavy" chain (about 50-70 kD). The
N-terminus of each chain defines a variable region of about 100 to
110 or more amino acids primarily responsible for antigen
recognition. The terms variable light chain (VL) and variable heavy
chain (VH) refer to these light and heavy chains respectively.
Antibodies exist as intact immunoglobulins or as a number of well
characterized fragments produced by digestion with various
peptidases. Thus, for example, pepsin digests an antibody below
(i.e. toward the Fc domain) the disulfide linkages in the hinge
region to produce F(ab)'2, a dimer of Fab which itself is a light
chain joined to V.sub.H-C.sub.H1 by a disulfide bond. The F(ab)'2
may be reduced under mild conditions to break the disulfide linkage
in the hinge region thereby converting the (Fab').sub.2 dimer into
an Fab' monomer. The Fab' monomer is essentially a Fab with part of
the hinge region (see, Paul (1993) Fundamental Immunology, Raven
Press, N.Y. for a more detailed description of other antibody
fragments). While various antibody fragments are defined in terms
of the digestion of an intact antibody, one of skill will
appreciate that such fragments may be synthesized de novo either
chemically, by utilizing recombinant DNA methodology, or by "phage
display" methods (see, e.g., Vaughan et al. (1996) Nature
Biotechnology, 14(3): 309-314, and PCT/US96/10287). Preferred
antibodies include single chain antibodies, e.g., single chain Fv
(scFv) antibodies in which a variable heavy and a variable light
chain are joined together (directly or through a peptide linker) to
form a continuous polypeptide.
[0251] The term "quantum dot" is known to those of ordinary skill
in the art, and generally refers to semiconductor or metal
nanoparticles that absorb light and quickly re-emit light in a
different color depending on the size of the dot. For example, a 2
nanometer quantum dot emits green light, while a 5 nanometer
quantum dot emits red light. Cadmium selenide quantum dot
nanocrystals are available from Quantum Dot Corporation of Hayward,
Calif.
[0252] The following documents are incorporated herein by reference
in their entirety for all purposes, and include additional
description of teachings usable with the present invention: U.S.
Provisional Patent Application Ser. No. 60/142,216, filed Jul. 2,
1999, entitled "Molecular Wire-Based Devices and Methods of Their
Manufacture," by Lieber, et al.; International Patent Application
No. PCT/US00/18138, filed Jun. 30, 2000, entitled "Nanoscopic
Wire-Based Devices, Arrays, and Methods of Their Manufacture," by
Lieber, et al., published as WO 01/03208 on Jan. 11, 2001; U.S.
Provisional Patent Application Ser. No. 60/226,835, filed Aug. 22,
2000, entitled "Semiconductor Nanowires," by Lieber, et al.; U.S.
Provisional Patent Application Ser. No. 60/254,745, filed Dec. 11,
2000, entitled "Nanowire and Nanotube Nanosensors," by Lieber, et
al.; U.S. Provisional Patent Application Ser. No. 60/291,896, filed
May 18, 2001, entitled "Nanowire Devices Including Emissive
Elements and Sensors," by Lieber, et al.; U.S. Provisional Patent
Application Ser. No. 60/292,035, filed May 18, 2001, entitled
"Nanowire and Nanotube Sensors," by Lieber, et al.; U.S.
Provisional Patent Application Ser. No. 60/292,045, filed May 18,
2001, entitled "Nanowire Electronic Devices Including Memory and
Switching Devices," by Lieber, et al.; U.S. Provisional Patent
Application Ser. No. 60/292,121, filed May 18, 2001, entitled
"Semiconductor Nanowires," by Lieber, et al.; U.S. patent
application Ser. No. 09/935,776, filed Aug. 22, 2001, entitled
"Doped Elongated Semiconductors, Growing Such Semiconductors,
Devices Including Such Semiconductors, and Fabricating Such
Devices," by Lieber, et al., published as U.S. Patent Application
Publication No. 2002/0130311 on Sep. 19, 2002; International Patent
Application No. PCT/US01/26298, filed Aug. 22, 2001, entitled
"Doped Elongated Semiconductors, Growing Such Semiconductors,
Devices Including Such Semiconductors, and Fabricating Such
Devices," by Lieber, et al., published as WO 02/17362 on Feb. 28,
2002; U.S. patent application Ser. No. 10/033,369, filed Oct. 24,
2001, entitled "Nanoscopic Wire-Based Devices and Arrays," by
Lieber, et al., published as U.S. Patent Application Publication
No. 2002/0130353 on Sep. 19, 2002, now U.S. Pat. No. 6,781,166,
issued Aug. 24, 2004; U.S. Provisional Patent Application Ser. No.
60/348,313, filed Nov. 9, 2001, entitled "Transistors, Diodes,
Logic Gates and Other Devices Assembled from Nanowire Building
Blocks," by Lieber, et al.; U.S. patent application Ser. No.
10/020,004, filed Dec. 11, 2001, entitled "Nanosensors," by Lieber,
et al., published as U.S. Patent Application Publication No.
2002/0117659 on Aug. 29, 2002; International Patent Application No.
PCT/US01/48230, filed Dec. 11, 2001, entitled "Nanosensors," by
Lieber, et al., published as WO 02/48701 on Jun. 20, 2002; U.S.
Provisional Patent Application Ser. No. 60/354,642, filed Feb. 6,
2002, entitled "Nanowire Devices Including Emissive Elements and
Sensors," by Lieber, et al.; U.S. patent application Ser. No.
10/152,490, filed May 20, 2002, entitled "Nanoscale Wires and
Related Devices," by Lieber, et al.; International Patent
Application No. PCT/US02/16133, filed May 20, 2002, entitled
"Nanoscale Wires and Related Devices," by Lieber, et al., published
as WO 03/005450 on Jan. 16, 2003; U.S. patent application Ser. No.
10/196,337, filed Jul. 16, 2002, entitled "Nanoscale Wires and
Related Devices," by Lieber, et al., published as U.S. Patent
Application Publication No. 2003/0089899 on May 15, 2003; U.S.
Provisional Patent Application Ser. No. 60/397,121, filed Jul. 19,
2002, entitled "Nanowire Coherent Optical Components," by Lieber,
et al.; International Patent Application No. PCT/US03/22061, filed
Jul. 16, 2003, entitled "Nanoscale Wires and Related Devices," by
Lieber, et al.; U.S. patent application Ser. No. 10/624,135, filed
Jul. 21, 2003, entitled "Nanowire Coherent Optical Components," by
Lieber, et al.; International Patent Application No.
PCT/US03/11078, filed Jul. 21, 2003, entitled "Nanowire Coherent
Optical Components," by Lieber, et al., published as WO 2004/010552
on Jan. 29, 2004; U.S. Provisional Patent Application Ser. No.
60/524,301, filed Nov. 20, 2003, entitled "Nanoscale Arrays and
Related Devices," by Whang, et al.; U.S. patent application Ser.
No. 10/720,020, filed Nov. 21, 2003, entitled "Nanoscale Wires and
Related Devices," by Lieber, et al., published as U.S. Patent
Application Publication No. 2003/0089899 on May 15, 2003; U.S.
patent application Ser. No. 10/734,086, filed Dec. 11, 2003,
entitled "Nanowire Coherent Optical Components," by Lieber, et al.,
published as U.S. Patent Application Publication No. 2004/0213307
on Oct. 28, 2004; U.S. Provisional Patent Application Ser. No.
60/544,800, filed Feb. 13, 2004, entitled "Nanostructures
Containing Metal-Semiconductor Compounds," by Lieber, et al.; U.S.
Provisional Patent Application Ser. No. 60/551,634, filed Mar. 8,
2004, entitled "Robust Nanostructures," by McAlpine, et al.; U.S.
patent application Ser. No. 10/812,653, filed Mar. 29, 2004,
entitled "Nanoscopic Wire-Based Devices and Arrays," by Lieber, et
al., published as U.S. Patent Application Publication No.
2004/0188721 on Sep. 30, 2004; U.S. Provisional Patent Application
Ser. No. 60/579,996, filed Jun. 15, 2004, entitled "Nanosensors,"
by Wang, et al.; U.S. patent application Ser. No. 10/973,665, filed
Oct. 26, 2004, entitled "Nanoscopic Wire-Based Devices and Arrays,"
by Lieber, et al., published as U.S. Patent Application Publication
No. 2005/0117441 on Jun. 2, 2005; U.S. patent application Ser. No.
10/995,075, filed Nov. 22, 2004, entitled "Nanoscale Arrays and
Related Devices," by Whang, et al., published as U.S. Patent
Application Publication No. 2005/0253137 on Nov. 17, 2005; U.S.
Provisional Patent Application Ser. No. 60/633,733, filed Dec. 6,
2004, entitled "Nanoscale Wire Based Data Storage," by Lieber, et
al.; U.S. patent application Ser. No. 11/058,443, filed Feb. 14,
2005, entitled "Nanoscale Wires and Related Devices," by Lieber, et
al.; International Patent Application No. PCT/US2005/004459, filed
Feb. 14, 2005, entitled "Nanostructures Containing
Metal-Semiconductor Compounds," by Lieber, et al., published as WO
2005/093831 on Oct. 6, 2005; U.S. patent application Ser. No.
11/082,372, filed Mar. 17, 2005, entitled "Doped Elongated
Semiconductors, Growing Such Semiconductors, Devices Including Such
Semiconductors, and Fabricating Such Devices," by Lieber, et al.,
published as U.S. Patent Application Publication No. 2005/0164432
on Jul. 28, 2005; U.S. patent application Ser. No. 11/137,784,
filed May 25, 2005, entitled "Nanoscale Sensors," by Lieber, et
al.; U.S. Provisional Patent Application Ser. No. 60/707,136, filed
Aug. 9, 2005, entitled "Nanoscale Sensors," by Lieber, et al.; U.S.
Provisional Patent Application Ser. No. 60/790,322, filed Apr. 7,
2006, entitled "Nanoscale Wire Methods and Devices," by Lieber, et
al.; and U.S. Provisional Patent Application Ser. No. 60/812,884,
filed Jun. 12, 2006, entitled "Nanosensors and Related
Technologies," by Lieber, et al.
[0253] The following examples are intended to illustrate certain
embodiments of the present invention, but do not exemplify the full
scope of the invention.
Example 1
[0254] This example illustrates the design and characteristics of
an array, according to one embodiment of the invention. The
conversion of silicon nanowire field-effect transistors into
sensors for cancer protein marker detection was carried out by
attaching monoclonal antibodies to the nanowire surfaces following
device fabrication. The basic linkage chemistry is as follows.
First, aldehyde propyltrimethoxysilane (APTMS) was coupled to
oxygen plasma-cleaned silicon nanowire surfaces in order to present
terminal aldehyde groups at the nanowire surface. Second, aldehyde
groups were coupled to the monoclonal antibodies, and third,
unreacted free aldehyde groups were blocked by reaction with
ethanolamine. These studies thus show that the surface chemistry
may affect the nanowire device sensitivity and selectivity.
[0255] The basic sensor chip (FIGS. 9A and 10) included integrated
electrically addressable silicon nanowires with the potential for
about 200 individually addressable devices. This particular chip
allowed the incorporation of different types of addressable
nanowires, for example p-type and/or n-type doped silicon
nanowires, during fabrication steps to form the addressable
electrical contacts; that is, solutions of different nanowires can
be sequentially assembled in different regions of the device, and
electrical contacts formed in parallel by photolithography and
metal deposition steps. The nanowire arrays were fabricated as
follows. The silicon nanowires were synthesized by chemical vapor
deposition using 20 nm gold nanoclusters as catalysts, silane as
reactant. For p-type silicon nanowires, diborane was used as
dopant, with a B:Si ratio of 1:4000; for n-type silicon nanowires,
phosphine was used as dopant, with a P:Si ratio of 1:4000. Arrays
of silicon nanowire devices were defined using photolithography
with Ni metal contacts on silicon substrates with 600 nm thick
oxide layer. The metal contacts were passivated by subsequent
deposition of a roughly 50 nm thick Si.sub.3N.sub.4 coating. The
spacing between source-drain electrodes (active sensor area) was 2
microns in all experiments. The protein samples were delivered to
the nanowire device arrays using fluidic channels formed by a
flexible PDMS polymer channel sealed to the device chip, and
samples were delivered through inlet/outlet connection in the
polymer.
[0256] FIG. 9A is an optical image (top) of the device. The white
line features in the image correspond to the silicon nitride
passivated metal electrodes that connect to individual nanowire
devices. The rectangle highlights one of the repeated (vertical)
regions where the nanowire devices are formed (see FIGS. 10A-10B
for higher resolution images of devices). The position of the
microfluidic channel used to deliver sample is highlighted by the
dashed white rectangle and has a total size of 6 mm.times.500
microns, length.times.width. The image field is 8 mm.times.1.2 mm.
The schematic diagram (bottom) shows details of metal electrodes
(gold) connecting nanowires (white lines) in this region with
orientation rotated 90.degree. relative to red rectangle. FIG. 10A
is an optical image of one row of addressable device elements from
the region highlighted by the dashed box in FIG. 9B. The white
arrow highlights the position of a single device. The image field
is 350 microns.times.400 microns. FIG. 10B is a scanning electron
microscopy image of one silicon nanowire device. The two parallel
electrode contacts are visible at the upper and lower regions of
the image; the nanowire, which is oriented approximately
horizontally, is highlighted by the white arrow. The scale bar is 2
microns.
[0257] In addition, different receptors can be printed on the
nanowire device array to allow selective multiplexed detection
(FIG. 9B). This figure is a schematic showing two nanowire devices,
1 and 2, within an array, where the nanowires are modified with
different antibody receptors, i.e., a first antibody receptor 5 on
nanowire 1, and a second antibody receptor 6 on nanowire 2. A
cancer marker protein 4 that binds specifically to its antibody
receptor 5 (on nanowire 1) will produce a conductance change
characteristic of the surface charge of the protein only on
nanowire 1. However, cancer marker protein 4 does not bind to
second antibody receptor 6.
[0258] Selective binding of cancer marker proteins to a
surface-linked monoclonal antibodies would produce a conductance
change in the corresponding receptor-modified silicon nanowire
device, but not in devices without the specific antibody receptor.
For a p-type doped silicon nanowire the conductance may increase
(decrease) when a protein with negative (positive) surface charge
bound to the antibody, while the opposite response may be observed
for an n-type doped nanowire.
[0259] The sensitivity limits of these silicon nanowire devices for
cancer marker protein detection were determined by measuring
conductance changes as the solution concentration of prostate
specific antigen (PSA) was varied, where the devices were modified
with monoclonal antibodies for PSA (Ab1). Representative
time-dependent data (inset, FIG. 9C) showed a well-defined
conductance increase and subsequent return to baseline when PSA
solution and pure buffer, respectively, were alternately delivered
through a microfluidic channel to the devices. The data were
recorded following alternate delivery of PSA and pure buffer,
solutions; the PSA concentrations were 5 ng/ml, 0.9 ng/ml, 9 pg/ml,
0.9 pg/ml and 90 fg/ml, respectively. The buffer solutions used in
all measurements were 1 micromolar phosphate (potassium salt)
containing 2 micromolar KCl, pH=7.4. A plot of these data (FIG. 9C)
showed that the conductance change is directly proportional to the
solution PSA concentration for values from about 5 ng/mL down to
about 90 fg/mL. This figure shows a change in conductance vs.
concentration of PSA for a p-type silicon nanowire modified with
PSA-Ab1 receptor.
[0260] There were several important features observed. First, the
reversibility of the conductance changes demonstrated that
non-specific irreversible protein binding did not occur to a
measurable extent on the devices. Second, the increases in
conductance with PSA binding to the Ab1-linked p-type nanowire
devices were consistent with binding of a protein with negative
overall charge as expected from the pI of PSA, 6.8, and the pH,
7.4, of these experiments. Third, these data showed that direct
label-free detection of PSA was routinely achieved with signal to
noise >3 for concentrations down to about 75 fg/ml or about 2
fM. Similar ultrasensitive detection was achieved in studies of
carcinoembryonic antigen (CEA), about 100 fg/ml or about 0.55 fM,
and mucin-1, about 75 fg/ml or about 0.49 fM, (FIG. 11) using
silicon nanowire devices modified with monoclonal antibodies for
CEA and mucin-1, respectively. In these figures, FIG. 11A
illustrates the change in conductance of a silicon nanowire device
element modified with monoclonal antibody receptor for CEA vs.
concentration of CEA, and FIG. 11B illustrates the change in
conductance of a silicon nanowire device element modified with
monoclonal antibody receptor for mucin-1 vs. concentration of
mucin-1. The error bars correspond to .+-.1 standard deviation.
[0261] The surfaces of the nanowires were modified using the
following procedure to covalently link antibody receptors and
oligonucleotides to the surfaces of the silicon nanowire devices.
First, the devices were reacted with a 1% ethanol solution of
3-(trimethoxysilyl)propyl aldehyde (United Chemical Technologies,
Inc.) for about 30 min, washed with ethanol and heated at
120.degree. C. for 15 min. Monoclonal antibody receptors, anti-PSA
(AbI, NeoMarkers Inc. clone ER-PR8), anti-ACT-PSA (AbII, clone PSA1
with 59% cross-reactivity to ACT-PSA, abcam Inc.), anti-CEA
antibody (clone COL-1, Neomarkers) and anti-mucin-1 (clone B413,
abcam Inc.) were coupled to the aldehyde-terminated nanowire
surfaces by reaction of 10-100 microgram/ml antibody in a pH=8.4,
10 mM phosphate buffer solution containing 4 mM sodium
cyanoborohydride for a period of 2-3 hrs. Unreacted aldehyde
surface groups were subsequently passivated by reaction with
ethanolamine, in the presence of 4 mM cyanoborohydride, under
similar conditions for a period of 1-2 hours. The device arrays for
multiplexed experiments were made in generally the same way, except
that distinct antibody solutions (1% v/v glycerol) were spotted on
different regions of the array. The antibody surface density vs.
reaction time was quantified by reacting Au-labeled IgG antibodies
(Ted Pella laboratories, 5 nm Au-nanoparticles) with
aldehyde-terminated nanowires, and then imaging the modified
nanowire by transmission electron microscopy.
[0262] PSA, PSA-ACT, CEA and mucin-1 were purchased from Calbiochem
Inc. All protein samples were used as received without further
purification and diluted in the assay buffer (1 micromolar
phosphate buffer solution containing 2 micromolar KCl with pH 7.1)
prior to the sensing measurements.
[0263] The electrical measurements were performed as follows.
Electrical measurements were made using lock-in detection with a
modulation frequency of 79 Hz, inclusive. The modulation amplitude
was 30 mV and the dc source-drain potential was set at zero to
avoid electrochemical reactions. Conductance vs. time data was
recorded while buffer solutions, or different protein solutions,
were flowed through the microfluidic channel. Protein sensing
experiments were performed in the microfluidic channel under a flow
rate of 0.15 ml/h in 1 micromolar phosphate buffer solution
containing 2 micromolar KCl with pH 7.1. The multiplexing
experiments were carried out by interfacing up to three independent
lock-in amplifiers to different nanowire elements within the sensor
arrays; the output was recorded simultaneous as a function of time
by computer through analog-to-digital converter.
[0264] It was also noted that frequency dependent measurements
showed that for a 12.6-times increase in detection frequency (from
value used in these studies) the binding time increased by
approximately 5 times. This behavior suggested that electrokinetic
effects may contribute to and enhance the observed binding kinetics
in some of these measurements.
[0265] The reproducibility and selectivity of the nanowire devices
was further investigated in competitive binding experiments with
bovine serum albumin (BSA) as shown in FIG. 9D. Conductance versus
time measurements recorded on a silicon nanowire device modified
with Ab1 (i.e., a PSA-Ab1 modified p-type silicon nanowire)
exhibited similar conductance changes as above when 9 pg/ml and 0.9
pg/ml solutions of PSA were delivered to the device. In FIG. 9D,
the data were recorded following alternate delivery of the
following protein and pure buffer solutions: (1) 9 pg/ml PSA, (2)
0.9 pg/ml PSA, (3) 0.9 pg/ml PSA and 10 microgram/ml BSA, (4) 10
microgram/ml BSA, and (5) 9 pg/ml PSA. These results showed that
reproducible device to device sensitivity was achieved with these
particular silicon nanowire sensors. Moreover, delivery of a
solution containing 0.9 pg/ml PSA and 10 microgram/ml BSA showed
the same conductance increase as a solution containing only PSA at
this concentration, while no conductance change was observed in the
device when the BSA solution alone was delivered. These latter data
demonstrated selectivity using the antibody receptors and also that
sensitivity was not lost even with a 10-million fold higher
concentration of other proteins in solution.
[0266] In addition, the details of the modification chemistry were
investigated to define limits for high sensitivity detection of
cancer marker proteins using these silicon nanowire field-effect
devices. Specifically, atomic force microscopy measurements of the
initial aldehyde-silane layer thickness on single nanowires (FIG.
9E) demonstrated a systematic increase with modification time. FIG.
9E shows the thickness dependence (curve 9) of aldehyde silane
layer on the SiNW surfaces extracted from AFM measurements after
different modification time of the aldehyde propyltrimethoxysilane,
and the sensitivity dependence (curve 8) of the detection of 1
ng/ml of PSA, after different modification times, using a p-type
SiNW device. Significantly, measurements of the nanowire device
sensitivity showed that the sensor response decreases rapidly for
initial reaction times >30 minutes.
[0267] In the AFM measurements, the increase in the thickness of
silicon nanowires as a function of silane modification times was
measured by atomic force microscopy (AFM, Digital Instruments Inc.,
Nanoscope Ma) on a lithographically marked-Au surface, in order to
localize and measure the same nanowires each time.
Example 2
[0268] In this example, multiplexed detection with nanowire arrays
is illustrated. Initially, the effectiveness of the nanowire device
arrays for multiplexed detection was characterized using an array
containing both p-type and n-type silicon nanowire devices that
were modified with Ab1 as the marker protein receptor. The
incorporation of p- and n-type nanowires in a single sensor chip
allowed possible electrical cross-talk and/or false positive
signals to be discriminated by correlating the response versus time
from the two distinct types of device elements. Notably,
simultaneous conductance versus time data recorded from p-type
nanowire (NW1, FIG. 12A) and n-type nanowire (NW2, FIG. 12A)
devices showed that introduction of 0.9 ng/ml of PSA resulted in a
conductance increase in NW1 and a conductance decrease in NW2,
while the conductance returned to the baseline value of each device
following introduction of buffer solution without PSA. The
magnitude of the conductance changes in the two devices were nearly
the same and consistent with the concentration dependent
conductance measurements show in FIG. 9. Similar behavior was
observed froth the two devices as the solution was alternated
between different concentrations of PSA and pure buffer solution
(FIG. 12A); that is, the p- and n-type devices showed concentration
dependent increases and decreases, respectively, in conductance
when the PSA solutions were added. In FIG. 12A, the complementary
sensing of PSA using p-type (NW1) and n-type (NW2) silicon nanowire
devices in the same array can be seen. The vertical solid lines
correspond to times at which PSA solutions of (1) 0.9 ng/ml, (2)
0.9 ng/ml, (3) 9 pg/ml, (4) 0.9 pg/ml, and (5) 5 ng/ml were
connected to the microfluidic channel. Arrows correspond to the
points where the solution flow was switched from protein to pure
buffer solutions.
[0269] These experiments demonstrated several points about
multiplexed electrical detection with nanowire devices. First, the
complementary conductance changes observed for the p-type and
n-type elements were consistent with specific binding of PSA to
field-effect devices, since the negatively-charged protein caused
accumulation and depletion in the p- and n-type nanowire elements,
respectively. Second, the complementary electrical signals from p-
and n-type devices provided simple yet robust means for detecting
false positive signals from either electrical noise or nonspecific
binding of protein to one device; that is, real and selective
binding events must show complementary responses in the p- and
n-type devices. The presence of correlated conductance signals in
both devices (FIG. 12A), which occurred at points when buffer and
PSA/buffer solutions were changed, illustrate how this multiplexing
capability can be used to distinguish noise from protein binding
signals.
[0270] A second test of multiplexing capabilities was carried out
using a device array consisting of p-type silicon nanowire elements
with either PSA Ab 1 receptors (NW1, FIG. 12B) or surfaces
passivated with ethanolamine (NW2, FIG. 12B). Simultaneous
measurements of the conductance of NW1 and NW2 showed that
well-defined concentration-dependent conductance increases were
only observed in NW1 upon delivery of PSA solutions (9 pg/ml and 1
pg/ml), although small conductance spikes were observed in both
devices at the points where PSA and buffer solutions are changed.
Delivery of BSA at 10 micrograms/ml showed no response in either
NW1 or NW2, and subsequent delivery of a solution of PSA (1 ng/ml)
and Ab1 (10 micrograms/ml), which complexes the free PSA, did not
exhibit measurable conductance changes in either device. Together,
these multiplexing experiments demonstrated that the electronic
signals measured in the nanowire arrays can be readily attributed
to selective marker protein binding, showing that the surface
passivation chemistry effectively prevented non-specific protein
binding, and also provided a robust means for discriminating
against false positive signals arising from either electronic noise
or nonspecific binding.
[0271] In FIG. 12B, the conductance vs. time data was recorded
simultaneously from two p-type silicon nanowire devices in the
array, where NW1 was functionalized with PSA Ab1, and NW2 was
modified with ethanolamine. The vertical lines correspond to times
when solutions of (1) 9 pg/ml PSA, (2) 1 pg/ml PSA, (3) 10
microgram/ml BSA, (4) a mixture of 1 ng/ml PSA and 10 .mu.g/ml PSA
Ab1 were connected to the microfluidic channel. The arrows
correspond to the points where the solution flow was switched from
protein to pure buffer solutions.
Example 3
[0272] This example illustrates the multiplexed detection of cancer
markers. To test the capabilities of the nanowire arrays for
multiplexed detection of marker proteins relevant to cancer
diagnosis, the initial experiments focused on prostate cancer where
concentrations of both free PSA (f-PSA) and
PSA-alpha-1-antichymotrypsin (PSA-ACT) complex are generally
measured. In these experiments, a device array was fabricated from
p-type silicon nanowire elements that were then modified either
with monoclonal antibody receptors for f-PSA, Ab1, or monoclonal
antibody receptors that show cross-binding reactivity for f-PSA and
the PSA-ACT complex, Ab2. Simultaneous conductance measurements of
NW1, which was modified with Ab1, and NW2, which was modified with
Ab2, were carried out for a wide-range of conditions (FIG. 13) and
are summarized in Table 1.
[0273] FIG. 13 shows representative conductance vs. time data
recorded simultaneously from two p-type silicon nanowire devices in
an array, where NW1 was modified with Ab1, which is selective to
f-PSA, and NW2 was modified with Ab2, which is cross reactive to
f-PSA and PSA-ACT. The protein solutions were added at the numbered
points as follows: (1) 850 pg/ml f-PSA; (2) 8.5 pg/ml f-PSA; (3)
3200 pg/ml PSA-ACT; (4) 320 pg/ml PSA-ACT; (5) 850 pg/ml f-PSA,
3200 pg/ml PSA-ACT, and 1.times.10.sup.7 pg/ml Ab1; (6) 8.5 pg/ml
f-PSA, 320 pg/ml PSA-ACT, and 1.times.10.sup.7 pg/ml Ab1; (7) 850
pg/ml f-PSA and 1.times.10.sup.7 pg/ml Ab1. Arrows correspond to
the points where the fluid delivery was switched from protein to
pure buffer solutions.
TABLE-US-00001 TABLE 1 Protein Conductance Change, nS Sample
[Protein] pg/ml NW1-Ab1 NW2-Ab2 f-PSA 1700 192 154 f-PSA 850 185
132 f-PSA 8.5 98 81 f-PSA 0.85 45 50 f-PSA 0.085 15 10 PSA-ACT 3200
ND 143 PSA-ACT 320 ND 124 PSA-ACT 3.2 ND 67 PSA-ACT 0.32 ND 19
f-PSA, PSA- 850, 3200, 1 .times. 10.sup.7 ND 140 ACT, Ab1 f-PSA,
PSA- 8.5, 320, 1 .times. 10.sup.7 ND 118 ACT, Ab1 f-PSA, PSA- 0.85,
3200, 1 .times. 10.sup.7 ND 138 ACT, Ab1 f-PSA, PSA- 850, 0.32, 1
.times. 10.sup.7 ND 15 ACT, Ab1 f-PSA, Ab1 .sup. 850, 1 .times.
10.sup.7 ND ND
[0274] ND corresponds to no detected conductance change. Sensor
data used to obtain conductance changes are shown in FIG. 13.
[0275] The data show that delivery of f-PSA resulted in
concentration-dependent conductance changes in both NW1 and NW2,
while the introduction of PSA-ACT yielded concentration-dependent
conductance changes only in NW2. In addition, control experiments
in which solutions of f-PSA, PSA-ACT, and Ab 1 were delivered to
the device array showed concentration conductance changes in NW2
but not NW1, since f-PSA was blocked by Ab1 present in the
solution. These multiplexing results thus demonstrate selective,
high-sensitivity detection of both markers, and showed that
nanowire sensor arrays could be used to measure the f-PSA and
PSA-ACT concentrations in a single real-time assay.
[0276] Multiplexed detection of distinct marker proteins, which may
facilitate pattern analysis of existing and emerging markers for
robust cancer diagnosis, can also be carried out with high
sensitivity and selectivity using nanowire arrays modified with
distinct antibody receptors as shown in FIG. 14A, where three
silicon nanowire devices in an array are used for multiplexed
protein detection. The devices were fabricated from the similar
nanowires, and then differentiated with distinct monoclonal
antibody receptors specific to three different cancer markers,
f-PSA (NW1), CEA (NW2), and mucin-1 (NW3). Conductance vs. time
measurements were recorded simultaneously from NW1, NW2 and NW3 as
different protein solutions were sequentially delivered to the
device array as shown in FIG. 14B. The solutions were delivered to
the nanowire array sequentially as follows: (1) 0.9 ng/ml PSA, (2)
1.4 pg/ml PSA, (3) 0.2 ng/ml CEA, (4) 2 pg/ml CEA, (5) 0.5 ng/ml
mucin-1, (6) 5 pg/ml mucin-1. Buffer solutions were injected
following each protein solution at points indicated by black
arrows.
[0277] The introduction of f-PSA and buffer solutions led to
concentration-dependent conductance increases only when NW1 was
exposed to PSA solution; no conductance changes were observed in
NW2 or NW3. Similarly, introduction of CEA solutions to the device
array yielded concentration dependent conductance changes only in
NW2, while subsequent delivery of mucin-1 solutions to the array
resulted in concentration dependent conductance changes only in
NW3. These results demonstrate capability for multiplexed
real-time, label-free marker protein detection with sensitivity at
the femtomolar level and a high degree of selectivity.
Example 4
[0278] The multiplexed examples described above demonstrate a
unique level of sensitivity and selectivity. To impact cancer
diagnosis and treatment in the most significant way will require
rapid analysis of clinically relevant samples, such as blood serum.
This example demonstrates the detection of PSA in undiluted donkey
and human serum samples that were desalted by a rapid and simple
purification step. The measurements were made using p-type silicon
nanowire elements with either PSA Ab1 receptors (NW1, FIGS.
14C-14E) or surfaces passivated with ethanolamine (NW2, FIGS.
14C-14E) in the same sensor array.
[0279] Donkey serum (pooled preparation obtained from normal donor
herd, total protein 59 mg/ml), and human serum (from clotted human
male whole blood, 40-90 mg/ml total protein) were purchased from
Sigma, desalted using a microcentrifuge filter (Centricon YM-3,
3,000 MWCO, Millipore Corp.) and diluted back to the original
protein concentration with the assay buffer solution (1 micromolar
phosphate buffer+2 micromolar KCl, pH 7.1) prior to injection into
the detection system. PSA was added to donkey serum prior to the
desalting step for data presented in the paper; however, similar
results were also obtained from samples in which PSA was added
after desalting.
[0280] Conductance vs. time measurements recorded simultaneously
from NW1 and NW2 as different donkey serum solutions were
sequentially delivered to the devices are shown in FIGS. 14C and
14D. FIG. 14C shows conductance vs. time data recorded for the
detection of PSA-containing donkey serum samples on a p-type
silicon nanowire array in which NW1 was functionalized with Ab1 and
NW2 was passivated with ethanolamine. The solutions were delivered
to the nanowire array sequentially as follows: (1) 1 micromolar
phosphate buffer+2 micromolar KCl, pH=7.1, (2) donkey serum, (3) a
mixture of donkey serum and 90 pg/ml of PSA, (4) a mixture of
donkey serum and 0.9 ng/ml of PSA. The donkey serum was injected at
points indicated by the black arrows. FIG. 14D shows conductance
vs. time data recorded for the same two p-type silicon nanowire
devices as FIG. 14C following addition of (1) donkey serum, (2) a
mixture of donkey serum and 0.9 pg/ml of PSA.
[0281] The introduction of donkey serum containing 59 mg/ml total
protein did not lead to appreciable conductance change relative to
the standard assay buffer. Also, introduction of donkey serum
solutions containing f-PSA led to concentration-dependent
conductance increases only for NW1; no conductance changes were
observed in NW2 (FIGS. 14C and 14D). Well-defined conductance
changes were observed for PSA concentrations as low as 0.9 pg/ml,
which corresponded to .about.100 billion times lower concentration
than that of the background serum proteins.
[0282] Similar results were also obtained in conductance vs. time
data recorded simultaneously from NW1 and NW2 for different human
serum samples (FIG. 14E). FIG. 14E shows conductance vs. time data
recorded for the detection of PSA-containing human serum samples on
a p-type silicon nanowire array in which NW1 was functionalized
with Ab1 and NW2 was passivated with ethanolamine. The solutions
were delivered to the nanowire array sequentially as follows: (1) 1
micromolar phosphate buffer+2 micromolar KCl, pH=7.1, (2) a mixture
of human serum preblocked with 10 micrograms/ml Ab1, (3) human
serum, and (4) same as (2). Specifically, addition of undiluted
human serum, which contained f-PSA, blocked with an excess of Ab1
showed little change in baseline for either NW1 or NW2, although
subsequent addition of undiluted human serum showed well-defined
conductance increase in NW1. These results thus demonstrate the
ability to detect cancer markers with high sensitivity and
selectivity in human serum.
Example 5
[0283] This example illustrates telomerase detection and activity.
To define further the potential of the silicon nanowire arrays
described herein as broad-based cancer diagnostic tools, in this
example, an orthogonal nucleic acid based marker assay involving
detection of telomerase was investigated. Telomerase is a
eukaryotic ribonucleoprotein (RNP) complex that catalyzes the
addition of the telomeric repeat sequence TTAGGG (SEQ ID NO: 1) to
the ends of chromosomes using its intrinsic RNA as a template for
reverse transcription. Telomerase is inactive in most normal
somatic cells but has been found to be active in at least 80% of
known human cancers, and thus been proposed as both a marker and
therapeutic target for cancer detection and treatment,
respectively.
[0284] The underlying concept of the telomerase assay is
illustrated in the schematic shown in FIG. 1. First, silicon
nanowire device elements within an array are functionalized with
oligonucleotide primers complementary to the telomerase binding
site (FIG. 1A). Second, a solution containing telomerase 235 is
delivered to the device, and the presence/absence of telomerase is
then detected by monitoring the nanowire conductance following
delivery of a sample cell extract to the device array (FIG. 1B). In
some cases, telomerase binds in a concentration dependent manner.
In the case of p-type nanowire device elements, binding may produce
a reduced conductance since telomerase (pI.about.10) is positively
charged at physiological pH. Third, the addition of deoxynucleotide
triphosphates (dNTPs) 236 leads, in the presence of active
telomerase, to telomerase catalyzed primer extension/elongation
that may produce an increase in conductance due to the
incorporation of negatively-charged nucleotides near the nanowire
surface (FIG. 1C).
[0285] Representative conductance versus time data recorded from an
oligonucleotide primer modified p-type silicon nanowire element
(FIG. 15A) shows a well-defined conductance decrease following
delivery of the extract from 100 HeLa cells to the device array.
This conductance decrease may be attributed to selective binding of
positively charged telomerase at the surface of p-type nanowires in
the array. The conductance decrease was directly proportional to
number of HeLa cells (and hence telomerase concentration) used to
prepare the extract (FIG. 16) as expected for an equilibrium
binding process. In FIG. 15A, the conductance vs. time data was
recorded following the introduction of (1) a solution containing
extract from 100 HeLa cells and 0.4 mM dCTP, (2) a mixture all four
dNTPs (dATP, dGTP, dUTP and dCTP) each at 0.1 mM, (3) a solution
containing extract from 100 HeLa cells and 0.4 mM dCTP, and (4) 0.4
mM dCTP only. Points (3) and (4) were recorded using a second
device.
[0286] These data also showed that binding was readily detectable
at the 10 cell level without amplification. In FIG. 16A, the
steady-state conductance change was associated with telomerase
binding to oligonucleotide primer-modified p-type silicon nanowires
as a function of the number of HeLa cells used to prepare extract
solution. Each solution contained dCTP at 0.4 mM. FIG. 16B shows
the steady state conductance when a mixture of all four dNTPs each
at 0.1 mM was delivered to the nanowire devices following initial
telomerase binding step using extract from different numbers of
HeLa cells.
[0287] Additionally, delivery of a solution extract prepared from
100,000 normal human fibroblasts cells to nanowire device (FIG.
15B, point 1) showed no conductance change. Moreover, delivery of
HeLa cell extracts that were pre-incubated with a solution of
oligonucleotide, which blocks binding to the much lower
concentration of surface-bound primers, did not result in an
observable conductance change (FIG. 15B, point 3). Also,
experiments carried out using heat denatured HeLa cell extracts
exhibited essentially no conductance decrease above background
(FIG. 15B, point 5). In FIG. 15B, the data are presented as
conductance vs. time data, recorded following delivery of (1) a
solution containing extract from 100,000 normal human fibroblast
cells and 0.4 mM dCTP, (2) a mixture of all four dNTPs each at 0.1
mM, (3) a solution containing extract from 10,000 HeLa cells, 0.4
mM dCTP, and 5 micromolar oligonucleotide (amino-modified
oligonucleotide
5'-H.sub.2N--(CH.sub.2).sub.6-TTTTTTAATCCGTCGAGCAGAGTT-3' (SEQ ID
NO. 65)), (4) a mixture of all four dNTPs each at 0.1 mM, (5) a
solution containing extract from 10,000 heat-deactivated HeLa cells
(90.degree. C., 10 min) and 0.4 mM dCTP, and (6) a mixture of all
four dNTPs each at 0.1 mM.
[0288] All cell extracts from frozen cell pellets were prepared
using CHAPS lysis buffer (Centricon International Inc., 100
microliter 1.times.CHAPS buffer, 10 mM Tris-HCl pH 7.5, 1 mM
MgCl.sub.2, 1 mM EGTA, 0.1 mM benzamidine, 0.5% CHAPS
(3-[(3-cholamidopropyl)dimethylammonio]propanesulfonic acid), 5
micromolar alpha-mercaptoethanol and 10% Glycerol) fractionated and
stored at -80.degree. C. until used and diluted in telomerase assay
buffer (10 micromolar Hepes buffer, 1.5 mM KCl, 100 micromolar
MgCl.sub.2 and 10 micromolar EGTA, pH 7.4). Normal human fibroblast
cells (ATCC), HeLa cells (Chemicon International), AZTTP (azido
deoxythymidine triphosphate, Sigma-Aldrich), and dATP, dGTP, dUTP
and dCTP (Sigma) were used as received. Aldehyde functionalized
SiNWs were modified with the amino-modified oligonucleotide
5'-H.sub.2N--(CH.sub.2).sub.6-TTTTTTAATCCGTCGAGCAGAGTT-3' (SEQ ID
NO: 60) (Sigma-Genosys Inc.) in 100 mM phosphate buffer pH 8.4 and
5 mM NaCNBH.sub.3 for 2 h. The sensor array was washed using the
microfluidic channel with 100 mM phosphate buffer pH 8.4, and then
the telomerase assay buffer (10 micromolar Hepes buffer, 1.5 mM
KCl, 100 micromolar MgCl.sub.2 and 10 micromolar EGTA, pH 7.4).
[0289] The primer-modified nanowire arrays were used to monitor
directly telomerase activity. FIG. 15A showed that adding a
solution of dNTPs following initial telomerase binding lead to an
increase in the device conductance. This increase is consistent
with the incorporation of negatively charged nucleotide units on
the nanowire surface during the elongation catalyzed by telomerase.
In the absence of a mixture of dNTPs, no significant conductance
increase was observed after the telomerase binding step (FIG. 15A),
which may show that the observed increases did not correspond to
unbinding of telomerase on the time scale of the experiment. In
addition, the conductance increase at fixed concentration of dNTPs
was proportional to number of HeLa cells used for initial binding
step (FIG. 16), which showed that the overall nucleotide addition
depended on the telomerase concentration bound-initially to
primers. These data also demonstrated that telomerase activity
could be monitored at least to the 10 cell level without
amplification. Further experiments showed that the delivery of dNTP
solutions following an initial addition of (1) extract from normal
human fibroblasts cells (FIG. 15B, point 2), (2) HeLa cell extracts
pre-incubated with a primer-oligonucleotides (FIG. 15B, point 4),
or (3) heat denatured HeLa cell extracts (FIG. 15B, point 6) to the
nanowire devices did not result in conductance increases. These
control experiments showed that conductance increases observed in
the presence of dNTPs is indeed due to telomerase catalyzed
nucleotide addition. Significantly, the telomerase activity
measurements were distinct from current approaches based upon
variations of telomeric repeat amplification protocol (TRAP), since
PCR amplification was not required to achieve high sensitivity.
[0290] Lastly, the nanowire detectors, which allow direct
monitoring of telomerase binding and/or activity, could be used to
screen for inhibitors that might serve as therapeutic agents. This
was shown by investigating the inhibition of telomerase elongation
activity in the presence of azido deoxythymidine triphosphate
(AZTTP), which is a known reverse transcriptase inhibitor.
Significantly, FIG. 15C shows that the conductance increase
associated with elongation was reduced when a solution of dNTPs and
AZTTP is delivered to a nanowire device following initial
telomerase binding. Studies of AZTTP concentration-dependent
inhibition (inset, FIG. 15C) showed up to a 80% reduction of
elongation as the AZTTP concentration is increased to 20
micromolar, and thus demonstrated the capability to evaluate
directly inhibition of telomerase activity. In FIG. 15C,
conductance vs. time data are shown as recorded on a p-type silicon
nanowire device following the introduction of (1) a solution
containing extract from 100 HeLa cells and 0.4 mM dCTP, and (2) a
mixture of all four dNTPs each at 0.1 mM and 20 micromolar AZTTP.
The inset is a plot of the inhibition of elongation vs. AZTTP
concentration, where 100% corresponds to conductance change
associated with elongation in absence of AZTTP.
[0291] Thus, these examples demonstrate the development and
validation of nanowire sensor arrays for label-free, real-time,
multiplexed electrical detection of cancer markers with ultrahigh
sensitivity and excellent selectivity. The nanowire arrays have
been used to elucidate the surface modification details needed for
ultrahigh device sensitivity, to demonstrate very good device to
device absolute detection reproducibility, and also to show two
distinct approaches for simultaneous discrimination against false
positives. Using the nanowire sensor arrays modified with antibody
receptors these examples demonstrate real-time multiplexed
detection of f-PSA, PSA-ACT complex, CEA and mucin-1 with good
signal-to-noise ratios down to a 50-100 fg/ml level, and showed
that high selectivity with sensitivity to concentrations at least
as low as 0.9 pg/ml could be achieved in undiluted serum samples
containing as much as 100 billion times more protein than the
cancer marker being detected. In addition, using the same chemistry
to prepare nucleic acid primer modified devices it was shown that
telomerase binding and activity could be measured down to a 10 cell
level without amplification.
[0292] These examples also demonstrate a sensitive telomerase
binding and activity assay, which exploits the same basic sensor
array and modification chemistry used for protein marker detection,
thus showing the power of the nanowire sensor arrays for cancer
detection. The direct nanowire-based assay achieves at least a
level of sensitivity in about 10 cells but can do so without the
need for PCR cycling and labeling, unlike TRAP-based protocols,
where PCR-cycling is used for amplification and fluorescence or
radiolabeling is used in detection. The direct measurement of
telomerase binding and activity also makes possible straightforward
studies of inhibition of both steps using added small
molecules.
[0293] In conclusion, these examples demonstrate highly sensitive
and selective multiplexed electrical detection of protein cancer
markers and telomerase using arrays of silicon nanowire
field-effect devices in both idealized solutions and clinically
relevant blood serum and cell extract samples. The present example
limited simultaneous real-time measurements to three distinct
sensor devices, although it should be noted that this limit was
only related to available measurement electronics, and could easily
be improved with additional measurement electronics. At least 100
independently addressable sensor elements are available in the
arrays described in this example and could be ultilized with more
sophisticated multiplexing electronics. Considering the
capabilities demonstrated in this work and the potential to expand
significantly this real-time multiplexing, it is believed that the
nanowire sensor arrays will move beyond current technologies and
take advantage of information emerging from genomics and proteomics
to improve diagnosis and treatment of cancer and other complex
diseases.
Example 6
[0294] This example describes direct, real-time electrical
detection of single virus particles with high selectivity by using
nanowire field effect transistors. Measurements made with nanowire
arrays modified with antibodies for influenza A showed discrete
conductance changes characteristic of binding and unbinding in the
presence of influenza A but not paramyxovirus or adenovirus.
Simultaneous electrical and optical measurements using
fluorescently labeled influenza A were used to demonstrate
conclusively that the conductance changes correspond to
binding/unbinding of single viruses at the surface of nanowire
devices. Also, pH-dependent studies further show that the detection
mechanism is caused by a field effect, and that the nanowire
devices can be used to determine rapidly isoelectric points and
variations in receptor-virus binding kinetics for different
conditions. Lastly, studies of nanowire devices modified with
antibodies specific for either influenza or adenovirus show that
multiple viruses can be selectively detected in parallel. The
possibility of large-scale integration of these nanowire devices
suggests potential for simultaneous detection of a large number of
distinct viral threats at the single virus level.
[0295] The underlying concept of these experiments is illustrated
schematically in FIG. 17. When a virus particle binds to the
antibody receptor on a nanowire device, the conductance of that
device may change from a baseline value, and when the virus
unbinds, the conductance should return to the baseline value. For a
p-type nanowire, the conductance should decrease (increase) when
the surface charge of the virus is positive (negative). The
conductance of a second nanowire device at which binding does not
occur during this same time period should show no change and can
serve as an internal control. Modification of different nanowires
within the array with receptors specific for different viruses
provides a means for simultaneous detection of multiple viruses.
More specifically, FIG. 17A is a schematic showing two nanoscale
wire devices, numbered 1 and 2, where the nanoscale wires are
modified with different antibody receptors. In FIG. 17B, the
specific binding of a single virus to the receptors on nanowire 2
produces a conductance change characteristic of the surface charge
of the virus only in nanoscale wire 2. When the virus unbinds from
the surface, the conductance returns to the baseline value.
[0296] This example uses arrays of individually addressable silicon
nanowire field-effect transistors, which exhibit reproducible
high-performance properties, for these experiments. Representative
microscopy images of a silicon nanowire device array are shown in
FIG. 5. The nanowire elements were confined to a central region
that was coupled to a microfluidic channel for sample delivery; the
larger-scale metal electrodes, which are used for electrical
connections to measurement instrumentation, were passivated with
silicon nitride in all areas exposed to solution. Nanowire elements
within the arrays were functionalized with the same or different
virus-specific antibodies as receptors for selective binding.
[0297] In this figure, FIG. 5A is an optical image of the upper
portion of a device array (the entire device is shown in FIG. 5F).
White lines correspond to metal electrodes that connect to
individual nanowire devices. The position of the microfluidic
channel used to deliver sample is highlighted (center portion) and
has a total size of 6 mm.times.500 micrometers, length.times.width.
The image field is 4.4.times.3.5 mm. FIG. 58 is an optical image of
one row of addressable device elements from the region highlighted
by the dashed box in FIG. 5A. The arrow highlights the position of
a device. The image field is 500.times.400 micrometers. FIG. 5C is
a scanning electron microscopy image of one sensing element. The
electrode contacts are visible at the upper right and lower left
regions of the image. The scale bar is 500 nm. The inset is a
cross-sectional schematic of a single silicon nanowire device. The
nanowire 151 is connected at its ends by source (S) and drain (D)
metal electrodes, and the metal is insulated with a layer of
silicon nitride 152. The microfluidic channel is 153. FIGS. 5D-5E
illustrates the device after a series of fluidic droplets have been
placed on each of the sensing elements, optically (FIG. 5D) and
fluorescently (FIG. 5E).
[0298] Time-dependent conductance data recorded simultaneously from
two nanowires in the same device array modified with antibodies
specific for influenza A virus (FIG. 18A) showed discrete changes
in conductance when a solution containing about 100 virus particles
per microliter was delivered to the sensor elements. There are
several noteworthy features of these experiments. First, the
magnitude and duration of the conductance drops are nearly the same
for a given nanowire: for nanowires 1 and 2 the magnitude and
duration were 24.+-.1 nS and 20.+-.4 s, and 20.+-.3 nS and 15.+-.7
s, respectively. The similarity in responses was consistent with
good reproducibility in the nanowires electronic properties and a
uniform density of antibody receptors on their surfaces, which
determine the response to and duration of binding of a single
virus, respectively. Second, an excess of free antibody added to
the viral solution (monoclonal antihemagglutinin for influenza A
was added to a standard solution containing 100 virons per
microliter to yield an antibody concentration of 10 .mu.g/ml)
eliminated the well defined conductance changes, consistent with
blocking sites on the viruses that are recognized by the same
antibodies attached to the nanowire surfaces. Lower antibody
concentrations produced partial reduction of the nanowire response.
Third, the discrete conductance changes were uncorrelated for the
two nanowire devices in the microfluidic channel and were thus
consistent with stochastic binding events at or near the surfaces
of the respective nanowires. Fourth, concentration-dependent
measurements showed that the frequency of the discrete conductance
drops was directly proportional to the number of virus particles in
solution (FIG. 18A inset and FIG. 19). The observed frequencies
also agreed with estimates for a diffusion limited process. Lastly,
little or no purification of virus samples was required in these
measurements; that is, similar results were obtained on samples
purified by simple gel filtration or diluted directly from
allantoic fluid.
[0299] FIG. 18A is a plot of conductance vs. time data recorded
simultaneously from two silicon nanowires elements, within a single
device array after introduction of an influenza A solution. The
inset is a plot of the frequency of single virus events as a
function of virus solution concentration. FIG. 18B shows
conductance changes associated with single influenza A virus
binding/unbinding as a function of solution pH. FIG. 18C shows
conductance and FIG. 18D shows optical data, each recorded
simultaneously vs. time for a single silicon nanowire device after
introduction of influenza A solution. Combined bright-field and
fluorescence images correspond to time points 1-6 indicated in the
conductance data; virus appears as a dot in the images. The solid
white arrow in image 1 of FIG. 18D highlights the position of the
nanowire device, and the dashed arrow indicates the position of a
single virus. Images are 8.times.8 micrometers. All measurements
were performed with solutions containing 100 viral particles per
microliters. FIG. 19 shows additional conductance vs. time data,
recorded as a function of influenza A concentration. FIG. 19A is
virus-free buffer solution, FIG. 19B is 30 viral particles per
microliter, FIG. 19C is 100 viral particles per microliter, and
FIG. 19D is 1,000 viral particles per microliter.
[0300] Measurements were also made as a function of pH at constant
ionic strength to probe viral surface charge. These data (FIG. 18B
and FIG. 20) show that the discrete conductance changes decreased
and then increased in magnitude but with opposite sign as the pH
increased from 5.5 to 8 with a point of zero conductance change
(that is, the isoelectric point) occurring between pH 6.5 and 7.0.
The results and estimated isoelectric point were consistent with
electrophoretic mobility measurements made by using much higher
concentrations and larger quantities of virus. The fact that the
p-type nanowire devices show a reduced (increased) conductivity
upon binding of single influenza A viruses at pH<7 (.gtoreq.7)
also demonstrated that detection with the nanowire devices may be
caused by a field effect and not a change in capacitance as
reported for carbon nanotube sensors. More generally, these results
suggest that these nanowire devices could be used to determine
rapidly isoelectric points for small quantities of viruses and
other biomolecules. In addition, the time scale of the discrete
changes in conductance associated with binding/unbinding depended
on pH (FIG. 20), which suggests that nanowire detectors could be
used to assess directly variations in receptor-virus binding
kinetics (for different conditions) from the single particle
binding/unbinding data. In FIG. 20, the conductance data were
recorded as a function of time for a nanowire modified with
anti-influenza type A antibody at constant ionic strength for
solution pH values of 5.5 (FIG. 20A), 6.5 (FIG. 20B), 7.0 (FIG.
20C), and 8.0 (FIG. 20D). The measurements were carried out with
solutions containing 100 virus particles per microliter.
[0301] To characterize the discrete conductance changes further,
additional simultaneous electrical and optical measurements were
performed. Parallel collection of conductance, fluorescence, and
bright-field data from a single nanowire device (FIG. 18C) with
fluorescently labeled viruses demonstrated that each discrete
conductance change corresponded to a single virus binding to and
unbinding from the nanowire. The data showed that as a virus
particle diffuses near a nanowire device the conductance remains at
the baseline value, and only after binding at the nanowire surface
does the conductance drop, where the conductance change, 18.+-.1
nS, was similar to that observed with unlabeled viruses; as the
virus unbinds and diffuses from the nanowire surface the
conductance returns rapidly to the baseline value. Additional
experiments showed that a bound virus can sample several nearby
positions on the nanowire surface before unbinding, which may
explain the smaller variations in conductance in the on state. The
two events in FIG. 18C also exhibited similar conductance changes
when virus particles bound to distinct sites on the nanowire, and
thus demonstrated that the detection sensitivity is relatively
uniform along the length of the nanowire. Lastly, these parallel
measurements suggest that a virus particle should be in contact
with the nanowire device to yield an electrical response, thus
suggesting the potential for relatively dense integration without
crosstalk.
[0302] The selectivity was first investigated by characterizing how
variations in the density of the influenza A antibody receptors
affect the binding/unbinding properties. Simultaneous conductance
and optical data recorded on devices with average antibody coverage
about 10 times higher than above (FIGS. 21A-21B) showed sequential
binding of virus particles without unbinding on a 5- to 10-min time
scale (vs. unbinding on a 20-s time scale in FIG. 18). Sequential
unbinding of the viruses was observed after introducing pure buffer
solution. These data showed that the unbinding kinetics can be
substantially slowed through increases in the density of specific
antibodies and provide strong evidence for selective binding of
influenza A; that is, the unbinding kinetics may be slowed as the
number of specific antibody-virus contact points increases.
[0303] Thus, in FIG. 21, FIGS. 21A-21B show simultaneous
conductance (FIG. 21A) and optical (FIG. 21B) vs. time data
recorded from a single nanowire device with a high density of
anti-influenza type A antibody. Influenza A solution was added
before point 1, and the solution was switched to pure buffer
between points 4 and 5 on the plot. The bright-field and
fluorescence images corresponding to time points 1-8 are indicated
in the conductance data; the viruses appear as dots in the images.
Each image is 6.5.times.6.5 micrometers. FIGS. 21C-21D show
simultaneous conductance (FIG. 18C) and optical (FIG. 21D) vs. time
data recorded from a single nanowire device with a low density of
anti-influenza type A antibody. Bright-field and fluorescence
images corresponding to time points 1-3 are shown. Each image is
7.times.7 micrometers. Measurements were made by using solutions
containing 100 viral particles per microliters. The solid white
arrows highlight the positions of the nanowires in both
devices.
[0304] In addition, parallel electrical and optical experiments
carried out on devices with a low density of specific antibodies
(FIGS. 21C-21D) showed discrete conductance changes caused by the
interaction of single viruses with an average duration, 1.1.+-.0.3
s. This average on time was about 20 times shorter than observed in
FIG. 18, where an intermediate antibody density was used. Analysis
showed that some of the conductance changes (e.g., event 2) had a
time scale of 1-1.5 s, although other events had a time scale of
0.4.+-.0.1 s that was characteristic of diffusion of the virus past
and/or rapid touching of the nanowire surface (see below).
Interestingly, further analysis of event 2 showed that the virus
rapidly samples two nearby positions on the nanowire surface before
unbinding. Overall, these coverage-dependent detection data were
consistent with selective detection and the ability to vary
unbinding kinetics with the density of specific antibodies. These
experiments further suggest that it may be possible to determine
the unbinding kinetics from a single antibody or other receptor,
and how the interactions are perturbed, for example, by the
addition of small molecules.
[0305] The delivery of a solution containing influenza A (100
virons per microliter) to a nanowire device functionalized with a
high density of anti-adenovirus group III antibodies, which should
have no specificity against influenza A, only exhibited discrete
conductance changes of short duration, 0.4.+-.0.1 s (FIG. 22A).
These short events were consistent with diffusion of the virus past
and/or rapid touching of the nanowire surface and can be
distinguished on the basis of temporal behavior from selective
binding exhibited by devices with a comparable density of specific
antibody (FIG. 21A). A more stringent test of selectivity was also
carried out by characterizing the response of a device to two
different, but structurally similar, viruses, paramyxovirus and
influenza A, by using nanowire devices modified with antibodies
specific for influenza A (FIG. 22B). Delivery of a solution
containing paramyxovirus exhibited only short-duration conductance
changes characteristic of diffusion of the virus past and/or rapid
touching of the nanowire surface and not specific binding; however,
when the solution was changed to one containing influenza A,
conductance changes consistent with well defined binding/unbinding
behavior similar to that in FIG. 18 were observed. Importantly,
these experiments demonstrated that the antibody-modified nanowire
devices exhibited good binding selectivity, which is an important
characteristic for detection of one or more viruses. These data
also showed that the devices were sensitive to single charged virus
particles (including the sign of the charge) as they diffuse by and
sample the nanowire surface, and this capability finds uses, for
example, for charge detection in microfluidic devices.
[0306] Lastly, multiplexed detection of different viruses at the
single particle level by modifying nanowire device surfaces in an
array with antibody receptors specific either for influenza A
(nanowire 1) or adenovirus (nanowire 2) was investigated.
Simultaneous conductance measurements obtained when adenovirus,
influenza A, and a mixture of both viruses are delivered to the
devices (FIG. 22C) showed several noteworthy points. Introduction
of adenovirus, which, as negatively charged at the pH of the
experiment, to the device array yielded positive conductance
changes for nanowire 2 with an on time of 16.+-.6 s, similar to the
selective binding/unbinding in FIG. 18 for a comparable density of
surface receptors. The magnitude of the conductance change for
binding of single adenovirus particles differed from that of
influenza A viruses, possibly because of differences in the surface
charge densities for the two viruses. Shorter, roughly 0.4-s
duration positive conductance changes were also observed for
nanowire 1. These changes were characteristic of a charged virus
diffusing past and rapidly sampling the nanowire element (see
above) and may be distinguished from specific binding to the
antibody receptors. On the other hand, addition of influenza A
yielded negative conductance changes for nanowire 1, with a
binding/unbinding behavior similar to that in FIG. 18 under
comparable conditions. Nanowire 2 also exhibited short duration
negative conductance changes, which may correspond to diffusion of
influenza A viral particles past the nanowire device, although
these were also distinguished from specific binding events by the
temporal response. Significantly, delivery of a mixture of both
viruses demonstrates unambiguously that selective binding/unbinding
responses for influenza A and adenovirus may be detected in
parallel by nanowire 1 and nanowire 2, respectively, at the single
virus level.
[0307] FIG. 22A shows the conductance vs. time curve recorded from
a silicon nanowire device after introduction of influenza A virus
solution; the device had a high surface coverage of anti-adenovirus
group III antibody. FIG. 22B shows conductance vs. time data
recorded from a silicon nanowire device modified with an
intermediate density of anti-influenza type A antibody. Initially,
a solution of paramyxovirus (50 virons per microliter) was
delivered to the device, and at the point indicated by the arrow
the solution was changed to one containing influenza A (50 virons
per microliter). FIG. 22C shows conductance vs. time data recorded
simultaneously from two silicon nanowires elements; one nanowire
(nanowire 1) was modified with anti-influenza type A antibody
(upper curve), and the other (nanowire 2) was modified with
anti-adenovirus group III antibody (lower curve). Arrows 1-4
correspond to the introduction of adenovirus, influenza A, pure
buffer, and a 1:1 mixture of adenovirus and influenza A, where the
virus concentrations were 50 viral particles per microliter in
phosphate buffer (10 micromolar, pH 6.0). Small arrows in B and C
highlight conductance changes corresponding to diffusion of viral
particles past the nanowire and not specific binding.
[0308] These experiments thus show that single viruses may be
detected directly with high selectivity, including parallel
detection of different viruses, in electrical measurements using
antibody functionalized nanowire field-effect transistors. This
demonstrated potential, which was achieved with virtually
unpurified samples, could impact virus detection for medical and
biothreat applications and may exceed the capabilities of existing
methods such as PCR and micromechanical devices.
[0309] The simplicity, single viral particle sensitivity, and
capability of selective multiplexed detection of this approach
suggest that this work may lead to useful viral sensing devices.
Although parallel detection has been demonstrated for only two
distinct viruses in this work, assembly methods have demonstrated
much larger arrays of reproducible nanowire devices that can
simultaneously screen for the presence of 100 or more different
viruses. The potential to carry out multiplexing in large nanowire
arrays could be exploited by including nanowires modified with
general viral cell-surface receptors and/or antibody libraries.
This enables rapid identification of viral families and provide an
indication of mutations in samples, e.g., as required for robust
medical and bioterrorism detection. Lastly, these capabilities and
the potential to characterize a range of virus--receptor
interactions provide unique opportunities for fundamental virology
and drug discovery.
[0310] Additional details about these experiments follow. Silicon
nanowires were synthesized by chemical vapor deposition with 20-nm
gold nanoclusters as catalysts, silane as reactant, and diborane as
p-type dopant with a B/Si ratio of 1:4,000. Arrays of silicon
nanowire devices were defined by using photolithography with Ni
metal contacts on silicon substrates with a 600-nm-thick oxide
layer. The metal contacts to the nanowires were isolated by
subsequent deposition of about 50-nm-thick Si.sub.3N.sub.4 coating.
The spacing between source-drain electrodes (active sensor area)
was 2 micrometers in all experiments.
[0311] Virus samples were delivered to the nanowire device arrays
by using fluidic channels formed by either a flexible polymer
channel or a 0.1-mm-thick glass coverslip sealed to the device
chip. Virus samples were delivered through inlet/outlet connection
in the polymer or holes made through the back of device chip in the
case of the coverslip. Similar electrical results were obtained
with both approaches, although the latter was used for all combined
electrical/optical measurements.
[0312] A two-step procedure was used to covalently link antibody
receptors to the surfaces of the silicon nanowire devices. First,
the devices were reacted with a 1% ethanol solution of
3-(trimethoxysilyl)propyl aldehyde (United Chemical Technologies,
Bristol, Pa.) for 30 min, washed with ethanol, and heated at
120.degree. C. for 15 min (FIG. 23F, left). Second, mAb receptors,
anti-hemagglutinin for influenza A (AbCam, Cambridge, U.K.) and
anti-adenovirus group III (Charles River Breeding Laboratories),
were coupled to the aldehyde-terminated nanowire surfaces by
reaction of 10-100 microgram/ml antibody in a pH 8, 10 mM phosphate
buffer solution containing 4 mM sodium cyanoborohydride (FIG. 23F,
right). The surface density of antibody was controlled by varying
the reaction time from 10 min (low density) to 3 h (high density).
Unreacted aldehyde surface groups were subsequently passivated by
reaction with ethanolamine under similar conditions. Device arrays
for multiplexed experiments were made in the same way except that
distinct antibody solutions were spotted on different regions of
the array. The antibody surface density vs. reaction time was
quantified by reacting Au-labeled IgG antibodies (Ted Pella, Inc.,
Redding, Calif.; 5 nm Au nanoparticles) with aldehyde-terminated
nanowires on a transmission electron microscopy grid, and then
imaging the modified nanowire by transmission electron microscopy,
which enabled the number of antibodies per unit length of nanowire
to be counted (FIG. 23).
[0313] FIG. 23 shows transmission electron microscopy images of
nanowires modified with antibodies. The antibodies were labeled
with 5-nm gold nanoparticles (Au-NP). Different densities were
obtained by varying the nanowire modification time. FIG. 23A shows
low antibody coverage. FIG. 23B shows medium antibody coverage.
FIG. 23C shows high antibody coverage. FIG. 23D is a summary of
data from analysis of at least 10 images per coverage. These values
represent a lower limit for true antibody densities since the
reactivity of the free antibody may be higher than that of the
antibody-NP conjugate. (Scale bars: FIG. 23A, 20 nm; FIG. 23B, 10
nm; FIG. 23C, 20 nm). In FIG. 23E, passivating the surface with
ethanolamine prior to exposure to the nanoparticles did not result
in any binding of the nanoparticles to the nanoscale wire. FIG. 23F
is a schematic diagram of the process used to attach the
antibody-gold nanoparticle conjugates to the nanoscale wires.
[0314] Different concentration virus solutions were prepared from
stocks by dilution in phosphate buffer (10 micromolar, pH 6.0)
containing 10 micromolar KCl (assay buffer); influenza type A,
10.sup.9 to 10.sup.10 particles per ml (Charles River Breeding
Laboratories; purified virus supplied in 0.1 M Hepes buffer (pH
7.4), caprolactane inactivated), and unpurified avian adenovirus
group III, influenza A, and avian paramyxovirus virus in allantoic
fluid, 10.sup.10 to 10.sup.11 particles per ml (Charles River
Breeding Laboratories), were used as received after dilution in
assay buffer or purified by using a microfiltration device (5,000
rpm, Centricon 30, Millipore). Similar results (sensitivity and
selectivity) were obtained with purified and unpurified samples.
Viral concentrations were measured by transmission electron
microscopy after staining samples with uranyl acetate and by
fluorescence microscopy using
1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine-labeled
viruses.
[0315] Electrical measurements were made by using lock-in detection
with a modulation frequency chosen as a prime number between 17 and
79 Hz, inclusive. Measurements were independent of frequency within
this range. The modulation amplitude was 30 mV and the dc
source-drain potential was zero to avoid electrochemical reactions.
Conductance vs. time data were recorded while buffer solutions, or
different virus solutions, flowed through the microfluidic channel.
Viral sensing experiments were performed in the microfluidic
channel under a flow rate of 0.15 ml/hr in 10 micromolar phosphate
buffer solution containing 10 micromolar KCl at pH 6.0.
[0316] Influenza virus solutions containing 10.sup.8 virus
particles per ml were labeled with DiIC.sub.18 (Molecular Probes)
in a manner similar to previous studies. Optical data were acquired
by using a Zeiss LSM 510 laser scanning confocal microscope with
PMT detectors and water immersion objective (.times.60, numerical
aperture 1.2). The DiIC.sub.18 dye was excited at 532 nm.
Bright-field and fluorescence images together with conductance data
were recorded simultaneously. The bright-field data, which
highlight the positions of the nanowire and passivated metal
contact electrodes, and fluorescence data were recorded
simultaneously with two detectors and combined to show the relative
positions of the nanowire and moving virus particles.
Example 7
[0317] This example illustrates multiplex detection of various
toxins, using another embodiment of the invention. A microfluidic
channel in fluidic communication with a microarray of nanowires was
used in these experiments. The microarray contained a series of 11
nanoscale wires, some of which were able to bind PSA
(prostate-specific antigen) using PSA antibodies (nanowires 1-3),
some of which were able to bind cholera toxin (CT) using CT
antibodies (nanowires 4 and 5), some of which were able to bind
botulinum toxin (BT) using BT antibodies (nanowires 6 and 7), and
some of which were passivated using ethanolamine and thus were not
sensitive to any analytes (nanowires 8-11).
[0318] Liquid was urged through the microfluidic channels,
containing varying amounts of analytes, and the conductance of each
nanoscale wire was measured as a function of time. These results
are shown in FIG. 24A (conductance scale is arbitrary). At time
(a), 5 ng/ml PSA (an inert protein) was directed into the
microfluidic channels. At (b), 5 ng/ml CT subunit-B was directed
into the microfluidic channels; at (c), 5 ng/ml BT; at (d), 10
micrograms/ml HAS (human serum albumin, an inert protein) at (e), 5
ng/ml PSA, 5 ng/ml CT, and 5 ng/ml BT, and (f) the solution
included a pre-mixed solution of (e) along with free antibodies to
PSA, CT, and BT at 10 microgram/ml.
[0319] At (a), only nanoscale wires 1-3 (which contained PSA
antibodies) showed a response to the PSA injection. Similarly, at
(b), only nanowires 4 and 5 (which contained CT antibodies) showed
a response to the CT injection, and at (c), only nanowires 6 and 7
(which contained BT antibodies) showed a response to the BT
injection. No response was observed in any of the nanowires during
the HAS injection (d). At (e), nanowires 1-7 each showed a response
to the simultaneous injection of PSA, CT, and BT. However, at (f),
no response was observed in any of the nanoscale wires.
[0320] FIGS. 24B and 24C show the sensitivity of the device for CT
antibodies (FIG. 24B) and BT antibodies (FIG. 24C). Both figures
show that the change in conductance of the nanoscale wire detectors
is a function of the concentration of CT or BT.
[0321] A similar experiment using gangliosides instead of
antibodies, is illustrated in FIG. 24D. In these experiments, 8
nanoscale wires were simultaneously used. Nanoscale wires 1-3
included GT1b (sensitive to BT), nanoscale wires 4 and 5 included
GM1 (sensitive to CT), and nanoscale wires 6-8 included asialo-GM1
which is not sensitive to either CT or BT. The experimental
apparatus was similar to the one described above.
[0322] At time (a), 5 ng/ml of BT was directed into the
microfluidic channels.; at (b), 100 ng/ml PSA; at (c), 5 ng/ml CT
and 5 ng/ml BT; at (d), 5 ng/ml CT; and at (e) 10 microgram/ml of
BSA (bovine serum albumin, an inert protein). At certain times, as
shown by the arrows at the bottom of FIG. 24B, injections of buffer
(phosphate buffer, 10 micromolar, pH of 6.7) were also added to the
microfluidic channel. BT is negatively charged and CT is positively
charged at this pH.
[0323] At (a), only nanoscale wires 1-3 (containing GT1b) showed a
response to the BT injection. At (b), no response was observed in
any of the nanowires for the PSA injection. At (c), nanoscale wires
1-3 (containing GT1b) and nanoscale wires 4 and 5 (containing GM1)
both showed a response to the combined CT/BT injection. At (d),
nanoscale wires 4 and 5 showed a response to the injection of CT
only. At (e), no response was observed in any of the nanowires for
the BSA injection.
[0324] FIGS. 24E and 24F show the sensitivity of the device for CT
with GM1 (FIG. 24E) and BT with GD1 (FIG. 24C). Similar to the
previous graphs, both figures show that the change in conductance
of the nanoscale wire detectors is a function of the concentration
of CT or BT.
[0325] In FIG. 24G, 3 nanoscale wires including GM1 (sensitive to
CT), were exposed to various injections, as follows (the buffer was
10 micromolar phosphate buffer at a pH of 6.7): (a) 5 ng/ml CT; (b)
20 microgram/ml BSA; (c) 5 ng/ml CT and 20 microgram/ml of BSA; (d)
5 ng/ml CT and 10 microgram/ml BSA; (e) 5 ng/ml CT and 1
microgram/ml BSA. The nanoscale wires in FIG. 24G each show large
responses in conductivity for CT only, and somewhat smaller
responses for CT and BSA solutions. However, it should be noted
that detection of a change in conductivity was still evident even
when the BSA was at a concentration of 4,000 times greater than CT
(c). Additional experiments (data not shown) illustrate this
sensitivity in FIG. 24H, as a plot of change in conductance verses
the concentration of BSA for the detection of 5 ng/ml CT. Detection
of 5 ng/ml CT was still possible even in concentrations of 1 mg/ml
BSA (i.e., at a concentration of 200,000 times greater than CT.
[0326] Yet another experiment, showing multiplexed cancer marker
detection, is shown in FIG. 24I. In this figure, three nanoscale
wires were prepared, having antibodies to PSA, carcinoembryonic
antigen ("CEA"), and mucin-1 ("MUC"). The three nanoscale wires
were exposed to various injections, as follows: (a) 0.9 ng/ml PSA;
(b) 1.4 pg/ml PSA; (c) 0.2 ng/ml CEA; (d) 2 pg/ml CEA; (e) 0.5
ng/ml mucin-1; and (f) 5 pg/ml mucin-1. FIG. 24I shows that each
nanoscale wire responded to its corresponding marker, but did not
respond to any of the other markers.
[0327] Thus, this example illustrates that various analytes can be
independently and specifically determined, even when the analytes
are all present in a given sample.
Example 8
[0328] This example illustrates the preparation of a passivated
nickel electrode, in accordance with an embodiment of the
invention. In FIG. 25A, a substrate 250 is shown.
[0329] On top of substrate 250 is a liftoff resist 252, a
photoresist 254, and a nickel layer 256. In some locations of the
substrate, where no liftoff resist (or photoresist) is present, the
nickel layer 257 directly contacts the substrate. Thus, using
suitable liftoff resist patterns, various nickel electrodes, other
metal electrodes, and/or other connects may be patterned on the
surface of the substrate. The nickel layer (or other metal layer)
can be used, for example, as an electrode that may be in contact
with a semiconductor nanoscale wire.
[0330] On top of the nickel layer, SiN.sub.x 259 is directly
deposited onto the nickel layer using PE-CVD deposition, forming
layer 258 as shown in FIG. 25B. Layer 258 is deposited onto the
nickel layer 256 that is positioned on top of the photoresist
layer, as well as on the nickel layer 257 that is directly
deposited on the substrate. In FIG. 25C, liftoff resist 252 is
removed, thereby also removing photoresist layer 254 and nickel
layer 256. Remaining on the substrate 250 is the nickel layer 257,
forming an electrode, which is passivated by a layer of SiN.sub.x
258. A photomicrograph, determined optically, of such a passivated
nickel electrode is shown in FIG. 25D. FIG. 25E is cross-section of
the height profile of FIG. 25D at the line 251, as determined by
AFM.
[0331] FIGS. 25F and 25G illustrate the leakage current for a
nickel electrode passivated with SiN.sub.x as described above. In
each case, the leakage current increased upon exposure of the
nickel electrode to 100 mM KCl.
[0332] FIG. 25H is a table illustrating that the amount of leakage
current observed in buffer solution decreases with the degree of
passivation of the nickel electrode with SiN.sub.x. The leakage
current of the passivated electrodes generally decreased by
approximately at least in order of magnitude relative to no
passivation.
Example 9
[0333] This example illustrates a detailed protocol for realizing
nanowire electronic sensors. First, the growth of uniform, single
crystal silicon nanowires, and subsequent isolation of the
nanowires as stable suspensions, are outlined. Second, the
fabrication of addressable nanowire device arrays is discussed.
Third, covalent modification of the nanowire device surface with
specific receptors is described. Last, measurements of the
electrical response from devices and sensors are detailed. The
silicon nanowire devices have demonstrated applications for
label-free, sensitive, and highly-selective real-time detection of
a wide range of biological and chemical species, including
proteins, nucleic acids, small molecules, and viruses.
[0334] In this example, semiconductor nanowires are configured
within field-effect transistors (FETs), where the FETs exhibit a
conductivity change in response to variations in the electric field
or potential at the surface. In a typical FET, a semiconductor such
as p-type silicon (p-Si) is connected to metal source and drain
electrodes through which a current is injected and collected, and
the conductance of the semiconductor device is controlled by a
third gate electrode capacitively coupled through a dielectric
layer. In the case of p-Si, applying a positive gate voltage can
deplete carriers and reduce the conductance, while applying a
negative gate voltage can lead to an accumulation of carriers and
an increase in conductance. The dependence of the FET conductance
on gate voltage also allows direct, electrically-based sensing,
since the electric field resulting from binding of a charged
species to the surface may be analogous to applying a voltage using
a gate electrode.
[0335] Silicon nanowires have a one-dimensional morphology and a
nanometer scale cross-section that allows depletion or accumulation
of carriers in the "bulk" of the device when a species binds to the
surface. Silicon nanowires are used in this example since this
material represents one of the best characterized examples of
semiconductor nanowires with the structure, size and electronic
properties reproducibly controlled, although other materials will
also work, as previously described. Specifically, silicon nanowires
can be prepared as single-crystal structures with controllable
diameters as small as 2-3 nm, and moreover, as both p-type and
n-type material with well-defined and reproducible high-performance
FET device properties.
[0336] The sensor was prepared using a silicon nanowire device by
linking recognition receptor groups to the surface of the nanowire.
The native silicon oxide coating on silicon nanowires makes this
receptor linkage relatively straightforward since extensive data
exists for the chemical modification of silicon oxide or glass
surfaces. When the sensor device with surface receptors was exposed
to a solution containing a macromolecule like a protein, which may
have a net negative (or positive) charge in aqueous solution,
specific binding will lead to an increase (decrease) in the surface
negative charge and an increase (decrease) in conductance for the
nanowire device.
[0337] These nanowires can be used in for real-time, label-free and
highly-sensitive detection of a wide-range of species, including
proteins, nucleic acids, small molecules and viruses, in either
single element or multiplexed formats, as discussed herein. In some
cases, detection may involve a change in charge at the nanowire
surface associated with binding and/or unbinding.
TABLE-US-00002 TABLE 2 Reagents Silicon wafer substrate for growth
and electrical measurement (3' N<100>, <0.005 ohm-cm,
356-406 micrometers thick with 600 nm thermal oxide, SSP prime
grade, Nova Electronic Materials Ltd.) Poly-L-lysine (0.1% w/v
aqueous, Ted-Pella Inc.) Gold nanoparticles, 20 nm diameter
(Ted-Pella Inc.) Gases for growth: silane (99.9+%, Voltaix Inc.),
diborane (97 ppm in hydrogen, Voltaix Inc.), phosphine (1000 ppm in
hydrogen, Voltaix Inc.), argon (99%, Matheson Tri-gas Inc.),
hydrogen (99.9995%, Matheson Tri-gas Inc.) S1805 photoresist
(Shipley, Inc.) LOR3A lift-off resist (MicroChem Corporation) MF319
developer (Shipley Inc.) Remover PG (MicroChem Corporation)
Buffered hydrofluoric acid (Fluoride-bifluoride-hydrofluoric acid
buffer, Transene Inc.) Gold slug (99.995%, 3.175 mm dia .times.
3.175 mm length, Alfa Aesar Inc.) Nickel slug (99.995%, 3.175 mm
dia .times. 3.175 mm length, Alfa Aesar Inc.) Chromium coated
tungsten wire (Cr 99.888%, W 96.5+%, 1.8 mm dia .times. 10 cm
length, Alfa Aesar Inc.) 3-(trimethoxysilyl) propyl aldehyde (90%,
United Chemical Technologies Inc.) Carbon conductive tape (double
coated, 8 mm wide, Ted Pella Inc.) 0.2 micrometer cut-off acrodisc
syringe filter (0.2 micron HT tuffryn membrane, non-pyrogenic,
#4192, Pall Corporation). Polydimethylsiloxane (SYLGARD 184
silicone elastomer kit, BROWNELL Inc.) Polyethylene tubing (ID/OD =
0.38/1.09 mm, Becton Dickinson Inc.) Ethanolamine (99.5%,
Sigma-Aldrich Inc.) Buffer for antibody binding (10 mM phosphate
buffer, pH 8.4) Buffer for ethanolamine blocking (100 mM
ethanolamine in 10 mM phosphate buffer, pH 8.4) Buffer for protein
sensing (10 micromolar phosphate buffer, containing 2 micromolar
KCl, pH 7.4) Prostate Specific Antigen Antibody (mouse monoclonal
PSA antibody, without bovine serum albumin (BSA) and azides,
NeoMarkers Inc.) Prostate Specific Antigen (EMD Bioscience Inc.)
Bovine Serum Albumin (New England BioLabs Inc.) Equipment Nanowire
chemical vapor deposition synthesis apparatus Optical microscope
(BX51, Olympus, Inc.) Scanning electron microscope (SEM) for
microscopic characterization of nanowires and devices (LEO982 field
emission SEM, Zeiss Inc.) Transmission electron microscope (TEM)
for microscopic characterization of nanowires (JEOL2010, JEOL Inc.)
Sonicator (2510, Branson Inc.) Hotplate (PMC720, Fisher Scientific
Inc.) Spin-coater (PWM32, Headway Research Inc.) Photolithography
mask aligner (2130-C2, AB-M Inc.) Metal evaporator (thermal
evaporator, Sharon Vacuum Inc.) Rapid thermal annealer (RTA) (610,
Metron Technology Inc.) Oxygen plasma cleaner (PJ Benchtop, AST
Products Inc.) Plasma-enhanced chemical vapor deposition (PECVD)
for silicon nitride deposition (Cirrus-150, Nexx Inc.) Probe
station (TTP-4, Dessert Cryogenics Inc.) Semiconductor property
analyzer (4156C, Agilent Inc.) Wire-bonder (8850, West Bond Inc.)
Electrical measuring set-up, hardware and software Syringe pump for
sample delivery (PhD2000, Harvard Apparatus Inc.) Centrifuge
(epp5804r, VWR International Inc.) Lock-in amplifier (SR830, DSP
dual-phase, Stanford Research Systems Inc.) Current pre-amplifer
(1211, DL Instrument Inc.) Multifunction I/O adaptor panel
(BNC-2090, National Instrument Inc.) DAC card (PCI-6030E, National
Instrument Inc.)
[0338] The overall steps involved in the synthesis and isolation of
silicon nanowires (SiNWs) are shown in FIG. 26A. The synthesis in
this particular example involved nanoparticle-catalyzed
vapor-liquid-solid (VLS) growth on an oxidized silicon substrate
using gold nanoparticles and silane as the catalyst and
silicon-reactant, respectively. The diameter of gold nanoparticle
catalyst defined the diameter of the resulting silicon SiNWs. The
isolation process involves removal of the SiNWs from the substrate
into a solution suspension. The specific steps for SiNW synthesis
and isolation are as follows.
[0339] 1. The silicon dioxide (SiO.sub.2) surface of a 1.times.2
cm.sup.2 piece of silicon wafer (the growth chip) was cleaned with
oxygen plasma: 100 W and 50 sccm O.sub.2 for 200 sec. This plasma
treatment removed organic residues and rendered the surface
hydrophilic.
[0340] 2. The clean surface of the growth chip was covered with a
0.1% poly-L-lysine (about 200 microliters), and the solution was
allowed to stand for 2 min.
[0341] 3. The poly-L-lysine was then removed by rinsing with a
stream of DI water from a squeeze bottle for 5 sec (about 10 ml),
and then surface was dried using a gentle stream of nitrogen gas
for 10 sec.
[0342] 4. The growth chip surface was covered with a solution of 20
nm Au nanoparticles (diluted 1:4, v/v with DI water; final
concentration about 2.times.10.sup.11 particles/ml). The solution
was allowed to stand for 10 sec, and then surface was rinsed with a
stream of DI water from a squeeze bottle for 5 sec (about 10 ml),
and then surface was dried using a gentle stream of nitrogen gas
for 10 sec. The negatively charged Au nanoparticles were
electrostatically bound to the positively charged poly-L-lysine
covered growth chip surface.
[0343] 5. The growth chip with Au nanoparticles was cleaned in an
oxygen plasma: 100 W and 50 sccm O.sub.2 for 5 min. The cleaning
step allowed uniform nucleation and nanowire growth.
[0344] 6. The clean growth chip was then placed in the middle of
the quartz reactor tube inside the CVD growth furnace.
[0345] 7. The reactor was evacuated to less than 3 mtorr and the
temperature was raised to 460.degree. C. in a 10 sccm Ar flow and
total pressure of 10 mtorr.
[0346] 8. When the growth temperature was stable, silane
(SiH.sub.4), which was the silicon reactant source, and dopant
(e.g., diborane (B.sub.2H.sub.6) for p-type or phosphine (PH.sub.3)
for n-type nanowires) were introduced into the reactor. The typical
growth conditions for p-type SiNWs were 10 sccm Ar, 6 sccm
SiH.sub.4, 7.5 sccm B.sub.2H.sub.6 (97 ppm in H.sub.2), total
chamber pressure 25 ton, temperature of 460.degree. C., and growth
time of about 10 min, where typical growth rates were 1.2-1.5
micrometers/min. The typical growth conditions for n-type SiNWs
were 30 sccm H.sub.2, 8 sccm SiH.sub.4, 2 sccm PH.sub.3 (1000 ppm
in H.sub.2), total chamber pressure 40 torr, temperature of
460.degree. C., and growth time of about 15 min, where typical
growth rates were 0.8-1.0 micrometers/min. At the end of the
growth, the reactant flow was terminated, the reactor tube was
evacuated (3 mtorr), and the furnace was shut-down and opened for
cooling (about 30 min).
[0347] 9. The nanowires were removed from the growth chip and
suspended in 1-2 ml of ethanol by sonication for 5-10 seconds. The
ethanol suspension of SiNWs was a transparent yellow-brown color.
The nanowire solution was checked for uniformity by placing a drop
onto a silicon chip, and imaging by SEM.
[0348] The steps involved in fabrication of nanowire electronic
devices are shown in FIG. 26B. The fabrication of SiNW FET devices
is relatively straightforward, and combines bottom-up assembly of
the nanowires on a device chip together with a single step of
photolithography to make contacts. Following FIG. 26B, the specific
steps for SiNW synthesis and isolation were as follows.
[0349] 10. The silicon dioxide (SiO.sub.2) surface of a 2.times.2
cm.sup.2 piece of silicon wafer (the sensor chip) was cleaned with
oxygen plasma: 100 W and 50 sccm O.sub.2 for 200 sec.
[0350] 11. A two-layer photoresist of LOR3A and S1805 was deposited
onto the sensor chip by spin coating. First, 0.5 ml of LOR3A was
deposited by spinning at 500 rpm/5 sec, then 4000 rpm/40 sec,
followed by baking on a hotplate at 185.degree. C. for 5 min; the
LOR3A layer thickness was about 300 nm. Second, 0.5 ml of S1805 was
deposited by spinning at 500 rpm/5 sec, then 4000 rpm/40 sec,
followed by baking on a hotplate at 115.degree. C. for 90 sec; the
S1805 layer thickness was about 500 nm.
[0351] 12. Photolithography (ABM photoaligner, wavelength 350-430
nm, exposure time 0.8 sec) was used to define the outer contact
pads and interconnects using the photomask shown in FIG. 5F.
[0352] 13. The photopatterned chip was immersed in MF319 developer
for 1 min, and then rinsed by immersing in DI water (30-50 ml) with
gentle agitation for 1 min. The chip was dried in a stream of
nitrogen gas for 30 sec.
[0353] 14. The sensor chip was cleaned using an oxygen plasma: 30 W
and 50 sccm O.sub.2 for 60 sec, and then placed in a thermal
evaporator.
[0354] 15. The contact pads were metallized by sequentially
depositing Cr and Au after the chamber pressure was reduced to the
10.sup.4 torr range. 5 nm of Cr was deposited at 0.1 nm/sec
followed immediately by 60 nm of Au at 0.1 nm/sec within the
multi-source thermal evaporator.
[0355] 16. The remaining resist was lifted off with PG Remover
(immersion in 20-30 ml, 70.degree. C., 30 min), washed with (i)
acetone and (ii) ethanol for 5-10 sec/each using squeeze bottles,
and then dried for 10 sec in a stream of nitrogen gas.
[0356] 17. The sensor chip with outer metal contact pads was
cleaned using an oxygen plasma: 100 W and 50 sccm O.sub.2 for 200
sec.
[0357] 18. The nanowire-containing ethanol solution was deposited
drop-wise on the clean oxide surface of the sensor chip using 1
microliter aliquots, where typically on the order of 20 drops were
used. The drops were deposited in the central region of the chip
where the devices were made, and each drop was allowed to evaporate
before the next drop was deposited. The nanowire density for device
design used in the sensor chips was 1-2 nanowires per 100
micrometer.sup.2, where the nanowire density was estimated using
dark-field optical microscopy. Alternatively, the SiNWs could be
aligned on the growth chip by using solvent flow-induced alignment
or Langmuir-Blodgett methods.
[0358] 19. A two-layer photoresist of LOR3A and S1805 was deposited
onto the sensor chip by spin coating. First, 0.5 ml of LOR3A was
deposited by spinning at 500 rpm/5 sec, then 4000 rpm/40 sec,
followed by heating at 185.degree. C. for 5 min; the LOR3A layer
thickness was about 300 nm. Second, 0.5 ml of S1805 was deposited
by spinning at 500 rpm/5 sec, then 4000 rpm/40 sec, followed by
heating at 115.degree. C. for 90 sec; the S1805 layer thickness was
about 500 nm.
[0359] 20. Photolithography (ABM photoaligner, wavelength 350-430
nm, exposure time 0.8 sec) was used to define the source/drain
electrodes and inner interconnects using the photomask shown in
FIG. 5F. The photomask was aligned using an optical microscope to
the pattern previously defined above using common alignment
markers.
[0360] 21. The photopatterned chip was immersed in MF319 developer
for 1 min, and then rinsed by immersing in DI water (30-50 ml) with
gentle agitation for 1 min. The chip was dried in a stream of
nitrogen gas for 30 sec.
[0361] 22. The sensor chip was cleaned using an oxygen plasma: 30 W
and 50 sccm O.sub.2 for 60 sec, and then placed in a thermal
evaporator.
[0362] 23. Prior to placing the sensor chip in the metal
evaporator, the contact regions were etched in buffered HF solution
to remove oxide on the SiNW surface. The chip was immersed
completely in HF solution for 5-8 sec, immersed in 30 ml of DI
water for 10 sec, dried for <10 sec in a stream of nitrogen gas,
and then immediately placed in the metal evaporator.
[0363] 24. The source/drain contacts and inner interconnects were
metallized by depositing 60 nm Ni at 0.1 nm/sec; the chamber
pressure prior to the start of evaporation was in the 10.sup.4 ton
range.
[0364] 25. After Ni deposition, the sensor chip was removed from
the evaporator and transferred to the PE-CVD chamber for silicon
nitride deposition. The Si.sub.3N.sub.4 passivation layer was 20-30
nm thick and deposited with the following conditions: Ar (20 sccm),
SiH.sub.4 (40 sccm, 3% in Ar), N.sub.2 (6 sccm), total chamber
pressure of 5 mtorr, microwave power of 375 W, and a deposition
time of 600 sec.
[0365] 26. The remaining resist was lifted off with PG Remover
(immersion in 20-30 ml, 70.degree. C., 30 min), washed with (i)
acetone and (ii) ethanol for 5-10 sec/each using squeeze bottles,
and then dried for 10 sec in a stream of nitrogen gas.
[0366] 27. The metallized sensor chip was annealed using a rapid
thermal annealer at 380.degree. C. for 2 min in forming gas (10%
H2/90% N2) to form low-resistance NiSi contacts at the interfaces
between the SiNWs and source/drain Ni electrodes.
[0367] 28. The sensor chips were examined at completion of
annealing by optical microscopy. Metal contact pads,
interconnection lines, and source drain contacts appeared
well-formed, continuous, and sharp with a good yield of single
SiNWs spanning source/drain electrodes. Sensor chips with a
low-yield of nanowire devices, considerable nanowire aggregation
and/or poorly defined/broken metal lines were discarded.
[0368] The basic electrical properties of the SiNW devices on the
sensor chip were measured, as these provide a means for quality
control prior to completion of the sensor device for use. Device
measurements in air were used to identify good devices and any
unsuitable devices. Subsequent measurements in aqueous solution
were useful for testing integrity of good devices identified in
air. The specific steps for SiNW device characterization were as
follows.
[0369] 29. For air characterization, individual SiNW devices on the
sensor chip were connected to measurement electronics
(semiconductor property analyzer) using a probe station. The probes
were brought into contact with the outer metal contact pads on the
sensor chip, while viewing optically.
[0370] 30. The individual SiNW devices on the chip were tested to
identify suitable and unsuitable devices. The current (I.sub.ds)
versus drain-source voltage (V.sub.ds) for several gate voltages
(V.sub.gs) and Ids versus V.sub.gs for V.sub.ds=1V were measured.
Data representative of suitable p-type and n-type SiNW devices are
shown in FIGS. 27A-27B and FIGS. 27C-27D, respectively. In FIGS.
27A and 27C, the curves (as followed the direction of the arrow)
correspond to gate voltage (V.sub.g) values of -5, -4, -3, -2, -1,
0, 1, 2, and 3 V, respectively for a typical p-type SiNW FET (FIG.
27A) and a typical n-type SiNW FET (FIG. 27C). FIGS. 27B and 27D
illustrate I.sub.ds V. V.sub.g data recorded for the nanowires
shown in FIGS. 27A and 27C, respectively, plotted on linear (left)
and logarithmic (right) scales at a V.sub.ds of 1V.
[0371] In some cases, the electrical properties of SiNW devices
were also measured in aqueous solution. This process allows testing
of the integrity of the Si.sub.3N.sub.4 passivation, and testing of
the electronics and microfluidics that will be used in sensor
experiments. The overall set-up for solution measurements and
sensing are detailed with reference to FIG. 28A.
[0372] 31. The sensor chip was mounted on a chip-carrier using
double-sided conductive carbon tape, and then wire-bonding was used
to connect contact pads of good devices to the 24 output pads of
the chip carrier. This allowed about 11 devices and a
reference/gate electrode to be connected, although a larger number
of devices is also possible with shared source electrodes.
[0373] 32. A single channel microfluidic device was clamped on the
chip carrier such that the channel overlaps the central region of
the sensor chip, which contains the SiNW devices. The channel (0.5
mm width.times.0.05 mm height.times.10 mm length) was made from
polydimethylsiloxane (PDMS) using published procedures. Solution
was drawn into the channel through 0.38 mm ID polyethylene tubing
attached to the inlet using a syringe pump attached to the channel
outlet using the same size tubing. Typical flows used in the
experiments were 0.3-0.4 ml/hour.
[0374] 33. The individual SiNW devices were characterized in
aqueous buffer solution (10 micromolar phosphate buffer, containing
2 micromolar KCl, pH 7.4) by measuring the conductance, G
(=dI.sub.ds/dV.sub.ds) as a function of the water gate potential,
V.sub.g. G is measured in these and sensor experiments using a
lock-in technique (FIG. 28), where V.sub.as was modulated at 79 Hz
with a 30 mV amplitude and V.sub.ds(dc)=0 V, and the water gate
electrode was located centrally within the sensor chip device
array. Data representative of suitable p-type and n-type SiNW
devices are shown in FIGS. 28B and 28C, respectively, which show
electrical properties of SiNW FETs in aqueous solution. FIG. 28B
shows a typical water-gate transconductance of a p-type SiNW. The
inset shows a histogram of transconductance values of more than 50
p-type SiNW devices. FIG. 28C shows a typical water-gate
transconductance of an n-type SiNW, with the inset showing a
histogram of transconductance values of more than 50 n-type SiNW
devices.
[0375] The overall steps involved in linking receptors for specific
recognition and selective sensing to the SiNW device surfaces are
shown in FIGS. 26C and 29. Specific steps for surface modification
were as follows.
[0376] 34. A sensor device chip was cleaned using an oxygen plasma:
30 W and 50 sccm O.sub.2 for 60 sec. The plasma cleaned chip was
used promptly.
[0377] 35. The plasma-cleaned sensor chip was immersed in a
filtered 1% volume/volume 3-(trimethoxysilyl)propyl aldehyde in
ethanol/water (95%/5%) solution for 30 min (FIG. 29). The
silane/ethanol solution was prepared and allowed to stand for 20
min before being filtered with a 0.2 micrometer cut-off syringe
filter.
[0378] 36. The sensor chip was washed with ethanol flow for 50 sec,
dried in a stream of nitrogen gas, and heated at 110.degree. C. for
10 min. The silanized surfaces were used relatively quickly after
preparation, and kept under a dry nitrogen atmosphere until use if
stored.
[0379] 37. The aldehyde-silane-modified SiNW sensor chip was
mounted on the chip carrier using double-sided conductive carbon
tape, and then wire-bonding was used to connect contact pads of
good devices to the 24 output pads of the chip carrier.
[0380] 38. A single channel microfluidic device was clamped on the
chip carrier such that the channel overlapped the central region of
the sensor chip, which contained the SiNW devices. The channel (0.5
mm width.times.0.05 mm height.times.10 mm length) was made from
polydimethylsiloxane (PDMS) using published procedures. The general
strategy of covalent linkage of specific receptors to the SiNW
device surface involved drawing a solution of receptor into the
PDMS channel until the channel was full, allowing the solution to
react, and then quenching the reaction. The aldehyde groups can be
used to couple proteins (through lysine residues), and other
receptors that have free amine groups. As discussed below,
monoclonal antibodies were coupled to the SiNW devices and used in
sensing experiments.
[0381] 39. A solution of monoclonal anti-PSA antibody receptor
.about.10-100 microgram/ml antibody in a pH=8.4, 10 mM phosphate
buffer solution containing 4 mM sodium cyanoborohydride was drawn
into to the PDMS channel and allowed to react for 2-3 h at room
temperature.
[0382] 40. The surface was washed using a continuous flow of 10 mM
phosphate buffer (pH=8.4) through the channel for 10 min.
[0383] Alternatively, the device arrays for these experiments were
made in the same way as described above, except that distinct
antibody solutions were spotted on different regions of device
array/sensor chip. A 5% v/v glycerol/antibody solution was spotted
using a microarrayer (Affymetrix GMS417) with droplet size of about
100 micrometers.
[0384] 41. Passivate unreacted aldehyde surface groups by drawing a
solution of ethanolamine (100 mM ethanolamine in 10 mM phosphate
buffer, pH 8.4) in the presence of 4 mM cyanoborohydride into the
channel and allow to stand for 1-2 hours.
[0385] 42. Lastly, the surface was washed using a continuous flow
of 10 mM phosphate buffer (pH=8.4) through the channel for 10
min.
[0386] While several embodiments of the present invention have been
described and illustrated herein, those of ordinary skill in the
art will readily envision a variety of other means and/or
structures for performing the functions and/or obtaining the
results and/or one or more of the advantages described herein, and
each of such variations and/or modifications is deemed to be within
the scope of the present invention. More generally, those skilled
in the art will readily appreciate that all parameters, dimensions,
materials, and configurations described herein are meant to be
exemplary and that the actual parameters, dimensions, materials,
and/or configurations will depend upon the specific application or
applications for which the teachings of the present invention
is/are used. Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. It is, therefore, to be understood that the foregoing
embodiments are presented by way of example only and that, within
the scope of the appended claims and equivalents thereto, the
invention may be practiced otherwise than as specifically described
and claimed. The present invention is directed to each individual
feature, system, article, material, kit, and/or method described
herein. In addition, any combination of two or more such features,
systems, articles, materials, kits, and/or methods, if such
features, systems, articles, materials, kits, and/or methods are
not mutually inconsistent, is included within the scope of the
present invention.
[0387] All definitions, as defined and used herein, should be
understood to control over dictionary definitions, definitions in
documents incorporated by reference, and/or ordinary meanings of
the defined terms.
[0388] The indefinite articles "a" and "an," as used herein in the
specification and in the claims, unless clearly indicated to the
contrary, should be understood to mean "at least one."
[0389] The phrase "and/or," as used herein in the specification and
in the claims, should be understood to mean "either or both" of the
elements so conjoined, i.e., elements that are conjunctively
present in some cases and disjunctively present in other cases.
Multiple elements listed with "and/or" should be construed in the
same fashion, i.e., "one or more" of the elements so conjoined.
Other elements may optionally be present other than the elements
specifically identified by the "and/or" clause, whether related or
unrelated to those elements specifically identified. Thus, as a
non-limiting example, a reference to "A and/or B", when used in
conjunction with open-ended language such as "comprising" can
refer, in one embodiment, to A only (optionally including elements
other than B); in another embodiment, to B only (optionally
including elements other than A); in yet another embodiment, to
both A and B (optionally including other elements); etc.
[0390] As used herein in the specification and in the claims, "or"
should be understood to have the same meaning as "and/or" as
defined above. For example, when separating items in a list, "or"
or "and/or" shall be interpreted as being inclusive, i.e., the
inclusion of at least one, but also including more than one, of a
number or list of elements, and, optionally, additional unlisted
items. Only terms clearly indicated to the contrary, such as "only
one of" or "exactly one of," or, when used in the claims,
"consisting of," will refer to the inclusion of exactly one element
of a number or list of elements. In general, the term "or" as used
herein shall only be interpreted as indicating exclusive
alternatives (i.e. "one or the other but not both") when preceded
by terms of exclusivity, such as "either," "one of," "only one of,"
or "exactly one of." "Consisting essentially of," when used in the
claims, shall have its ordinary meaning as used in the field of
patent law.
[0391] As used herein in the specification and in the claims, the
phrase "at least one," in reference to a list of one or more
elements, should be understood to mean at least one element
selected from any one or more of the elements in the list of
elements, but not necessarily including at least one of each and
every element specifically listed within the list of elements and
not excluding any combinations of elements in the list of elements.
This definition also allows that elements may optionally be present
other than the elements specifically identified within the list of
elements to which the phrase "at least one" refers, whether related
or unrelated to those elements specifically identified. Thus, as a
non-limiting example, "at least one of A and B" (or, equivalently,
"at least one of A or B," or, equivalently "at least one of A
and/or B") can refer, in one embodiment, to at least one,
optionally including more than one, A, with no B present (and
optionally including elements other than B); in another embodiment,
to at least one, optionally including more than one, B, with no A
present (and optionally including elements other than A); in yet
another embodiment, to at least one, optionally including more than
one, A, and at least one, optionally including more than one, B
(and optionally including other elements); etc.
[0392] It should also be understood that, unless clearly indicated
to the contrary, in any methods claimed herein that include more
than one step or act, the order of the steps or acts of the method
is not necessarily limited to the order in which the steps or acts
of the method are recited.
[0393] In the claims, as well as in the specification above, all
transitional phrases such as "comprising," "including," "carrying,"
"having," "containing," "involving," "holding," "composed of," and
the like are to be understood to be open-ended, i.e., to mean
including but not limited to. Only the transitional phrases
"consisting of" and "consisting essentially of" shall be closed or
semi-closed transitional phrases, respectively, as set forth in the
United States Patent Office Manual of Patent Examining Procedures,
Section 2111.03.
Sequence CWU 1
1
6016DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1ttaggg 626DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 2ttgggg 636DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 3ttgggt
648DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 4ttttgggg 857DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 5ttagggt 767DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 6ttagggc
777DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 7tttaggg 788DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 8ttttaggg 895DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 9ttagg
5106DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 10ttaggc 6112DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 11ag 2123DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 12agg
3134DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 13aggg 4145DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 14agggg 5156DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 15aggggg
6167DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 16agggggg 7178DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 17aggggggg 8189DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 18agggggggg
9195DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 19ttacg 5206DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 20ttacgg 6217DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 21ttacggg
7228DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 22ttacgggg 8239DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 23ttacggggg 92410DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 24ttacgggggg
102511DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 25ttacgggggg g 112612DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 26ttacgggggg gg 12276DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 27ttacag 6287DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 28ttacagg
7298DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 29ttacaggg 8309DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 30ttacagggg 93110DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 31ttacaggggg
103211DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 32ttacaggggg g 113312DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 33ttacaggggg gg 123413DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 34ttacaggggg ggg 13356DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 35ttaccg 6367DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 36ttaccgg
7378DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 37ttaccggg 8389DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 38ttaccgggg 93910DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 39ttaccggggg
104011DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 40ttaccggggg g 114112DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 41ttaccggggg gg 124213DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 42ttaccggggg ggg 13437DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 43ttacacg 7448DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 44ttacacgg
8459DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 45ttacacggg 94610DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 46ttacacgggg 104711DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 47ttacacgggg g 114812DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 48ttacacgggg gg 124913DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 49ttacacgggg ggg 135014DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 50ttacacgggg gggg 145113DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 51tgtgggtgtg gtg 135215DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 52ggggtctggg tgctg 155323DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 53ggtgtacgga tgtctaactt ctt 235423DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 54ggtgtacgga tgtcacgatc att 235523DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 55ggtgtaagga tgtcacgatc att 235623DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 56ggtgtacgga tgcagactcg ctt 23577DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 57ggtgtac 75825DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 58ggtgtacgga
tttgattagt tatgt 255925DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 59ggtgtacgga
tttgattagg tatgt 256024DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 60ttttttaatc
cgtcgagcag agtt 24
* * * * *