U.S. patent application number 12/708128 was filed with the patent office on 2010-09-09 for detection system.
This patent application is currently assigned to The Secretary of State for Defence. Invention is credited to Martin Alan Lee.
Application Number | 20100227326 12/708128 |
Document ID | / |
Family ID | 9915364 |
Filed Date | 2010-09-09 |
United States Patent
Application |
20100227326 |
Kind Code |
A1 |
Lee; Martin Alan |
September 9, 2010 |
Detection System
Abstract
A method for detecting the presence of a target nucleic acid
sequence in a sample, said method comprising: performing nucleic
acid amplification on the sample in the presence of (a) a DNA
duplex binding agent, (b) a nucleic acid polymerase and (c) a
reagent comprising an amplification primer which can hybridise to
said target sequence when in single stranded form and which is
connected at its 5' end to a probe which carries a label by way of
a chemical linking group, said labelled probe being of a sequence
which is similar to that of the said target nucleic acid sequence,
such that it can hybridise to a complementary region in an
amplification product, and wherein the label is able to absorb
fluorescence from or donate fluorescent energy to the DNA duplex
binding agent; and monitoring fluorescence of said sample.
Inventors: |
Lee; Martin Alan;
(Salisbury, GB) |
Correspondence
Address: |
JOHN S. PRATT, ESQ;KILPATRICK STOCKTON, LLP
1100 PEACHTREE STREET, SUITE 2800
ATLANTA
GA
30309
US
|
Assignee: |
The Secretary of State for
Defence
Salisbury
GB
|
Family ID: |
9915364 |
Appl. No.: |
12/708128 |
Filed: |
February 18, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10478788 |
Jun 8, 2004 |
7700275 |
|
|
PCT/GB02/02443 |
May 24, 2002 |
|
|
|
12708128 |
|
|
|
|
Current U.S.
Class: |
435/6.1 |
Current CPC
Class: |
C12Q 1/6851 20130101;
C12Q 1/6851 20130101; C12Q 2561/113 20130101; C12Q 2565/101
20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
May 25, 2001 |
GB |
0112868.5 |
Claims
1. A method for detecting the presence of a target nucleic acid
sequence in a sample, said method comprising: performing nucleic
acid amplification on the sample in the presence of (a) a DNA
duplex binding agent, (b) a nucleic acid polymerase and (c) a
reagent comprising an amplification primer which can hybridise to
said target sequence when in single stranded form and which is
connected at its 5' end to a probe which carries a label by way of
a chemical linking group, said labelled probe being of a sequence
which is similar to that of the said target nucleic acid sequence,
such that it can hybridise to a complementary region in an
amplification product, and wherein the label is able to absorb
fluorescence from or donate fluorescent energy to the DNA duplex
binding agent; and monitoring fluorescence of said sample.
2. A method according to claim 1, said method comprising: (a)
adding to a sample suspected of containing the target nucleic acid
sequence, the DNA duplex binding agent, the nucleic acid polymerase
and the reagent; (b) subjecting said sample to conditions under
which the primer hybridises to the target nucleic acid sequence and
an amplification product comprising the probe is formed; (c)
subjecting said sample to conditions under which the labelled probe
hybridises to a complementary region in the amplification product;
and (d) monitoring fluorescence of said sample during at least one
of steps (b) and (c).
3. A method according to claim 1 wherein the amplification product
comprises the probe.
4. A method according to any one of claims 1 to 3 wherein the DNA
duplex binding agent is an intercalating dye.
5. A method according to any one preceding claim wherein the DNA
duplex binding agent comprises a donor label and the probe
comprises the acceptor label.
6. A method according to any one of claims 1 to 4 wherein the DNA
duplex binding agent comprises an acceptor label and the probe
comprises the donor label.
7. A method according to any one preceding claim wherein the
acceptor label is a fluorescent molecule which emits energy at a
characteristic wavelength.
8. A method according to claim 7 wherein the acceptor label is a
rhodamine dye or Cy5.
9. A method according to any one of claims 1 to 6 wherein the
acceptor label is a dark acceptor.
10. A method according to claim 9 wherein the dark acceptor is
selected from any one of DABCYL, Methyl Red, a QSY-7
diarylrhodamine dye and
6-(dimethylamino)-2-[4-[4-(dimethylamino)phenyl]-1,3-butadienyl]-1-ethyl
quinolinium perchlorate (CAS number 181885-68-7).
11. A method according to any one of the preceding claims wherein
the amplification reaction comprises the polymerase chain reaction
(PCR).
12. A method according to any one of claims 1 to 8 and 11 wherein
the acceptor molecule is a fluorescent molecule and wherein
fluorescence of both the donor and the acceptor molecules are
monitored and the relationship between the emissions
calculated.
13. A method according to any one of the preceding claims wherein
the fluorescent signal from the sample is monitored throughout the
amplification reaction and the results used to quantitate the
amount of target sequence present in the sample.
14. A method according to any one of the preceding claims wherein
the amplification reaction is performed in the presence of an
additional corresponding amplification primer which is not attached
to a labelled probe.
15. A method for detecting nucleic acid amplification comprising:
performing nucleic acid amplification on a target polynucleotide in
the presence of (a) a nucleic acid polymerase, (b) a DNA duplex
binding agent and (c) a reagent comprising an amplification primer
which can hybridise to said target sequence when in single stranded
form and which is connected at its 5' end to a probe which carries
a second label, by way of a chemical linking group, said labelled
probe being of a sequence which is similar to that of the said
target sequence, such that it can hybridise to a complementary
region in an amplification product, and wherein one of the DNA
duplex binding agent or second label comprises a donor label which
is able to donate fluorescent energy to the other of the DNA duplex
binding agent or second label which comprises an acceptor label
able to absorb fluorescent energy from said donor molecule, said
primer being capable of hybridising to said target polynucleotide;
and monitoring changes in fluorescence during the amplification
reaction.
16. A method according to claim 15 wherein the amplification is
carried out using a pair of primers which are designed such that
only the target nucleotide sequence within a DNA strand is
amplified.
17. A method according to any one of the preceding claims wherein
the probe is specific either for a splice region of RNA or an
intron in DNA, so that only one of amplified RNA or amplified DNA
is detected and/or quantitated.
18. A method for determining a characteristic of a target nucleic
acid sequence, said method comprising (a) amplifying said sequence
in the presence of a DNA duplex binding agent and a reagent
comprising an amplification primer linked by way of a chemical link
at its 5' end to a probe which comprises a sequence which is
similar to that of a region of the target sequence and which
further comprises a label, where one of said DNA duplex binding
agent and the label is a donor label and the other is an acceptor
label, the donor label being able to donate fluorescent energy to
the acceptor label; so as to form an amplification product
incorporating a probe region, (b) subjecting amplification product
to conditions under which the probe region thereof will hybridise
to the complementary region of the amplification product, and (c)
monitoring fluorescence of said sample and determining a particular
reaction condition, characteristic of said sequence, at which
fluorescence changes as a result of the hybridisation of the probe
region to the sample or destabilisation of the duplex formed
between the probe region and the target nucleic acid sequence.
19. A method for detecting a polymorphism and/or allelic variation,
said method comprising amplifying a sequence suspected of
containing said polymorphism or variation using a method as defined
in any one of claims 1 to 16, measuring the temperature at which
the probe region melts from its complementary sequence within the
amplification product using the fluorescent signal generated, and
relating this to the presence of a polymorphism or allelic
variation.
20. A kit for use in the method of any one of the preceding claims
which kit comprises a reagent comprising an amplification primer
linked at its 5' end by way of a chemical link, to a probe specific
for a target nucleotide sequence, wherein the probe comprises a
first label which may act as one of either a donor and acceptor
label; and a DNA intercalating agent comprising a second label,
which second label may act as one of either a donor and acceptor
label, wherein the first and second labels form a donor-acceptor
pair.
Description
[0001] The present invention provides a method for detecting a
target polynucleotide in a sample, for example by monitoring an
amplification reaction, preferably in a quantitative manner, as
well as to kits for use in these methods. The method is also
suitable for the detection of sequence characteristics such as
polymorphisms or allelic variation and so may be used in diagnostic
methods.
[0002] Known fluorescence polymerase chain reaction (PCR)
monitoring techniques include both strand specific and generic DNA
intercalator techniques that can be used on a few second-generation
PCR thermal cycling devices.
[0003] Generic fluorescence PCR methods utilise DNA intercalating
dyes that exhibit increased fluorescence when bound to double
stranded DNA species. An increase in fluorescence due to a rise in
the bulk concentration of DNA during amplifications can be used to
measure reaction progress and to determine the initial target
molecule copy number. Furthermore, by monitoring fluorescence with
a controlled change of temperature, DNA melting curves can be
generated, for example, at the end of PCR thermal cycling.
[0004] These generic fluorescence PCR methods monitor the rise in
bulk concentration of nucleic acids without any time penalty. A
single fluorescent reading can be taken at the same point in every
reaction. End point melting curve analysis can be used to
discriminate artefacts from amplicon, and to discriminate
amplicons. Peaks of products can be seen at concentrations that
cannot be visualised by agarose gel electrophoresis.
[0005] It has been found that DNA melting curve analysis in general
is a powerful tool in optimising PCR thermal cycling. By
determining the melting temperatures of the amplicons, it is
possible to lower the denaturing temperatures in later PCR cycles
to this temperature. Optimisation for amplification from first
generation reaction products rather than the genomic DNA, reduces
artefact formation occurring in later cycles. Melting temperatures
of primer oligonucleotides and their complements can be used to
determine their annealing temperatures, reducing the need for
empirical optimisation.
[0006] The generic intercalator methods however are only
quasi-strand-specific and are therefore not very useful where
strand specific detection is required.
[0007] Fluorescence PCR strand specific methods utilise additional
nucleic acid reaction components to monitor the progress of
amplification reactions. These methods may use fluorescence energy
transfer (FET) as the basis of detection. One or more nucleic acid
probes are labelled with fluorescent molecules, one of which is
able to act as an energy donor and the other of which is an energy
acceptor molecule. These are sometimes known as a reporter molecule
and a quencher molecule respectively. The donor molecule is excited
with a specific wavelength of light for which it will normally
exhibit a fluorescence emission wavelength. The acceptor molecule
is excited at this emission wavelength such that it can accept the
emission energy of the donor molecule by a variety of
distance-dependent energy transfer mechanisms. A specific example
of fluorescence energy transfer which can occur is Fluorescence
Resonance Energy Transfer or "FRET". Generally the acceptor
molecule accepts the emission energy of the donor molecule when
they are in close proximity (e.g. on the same, or a neighbouring
molecule). The basis of FET or FRET detection is to monitor the
changes at donor emission wavelength. Where the acceptor is also a
fluorescent molecule, the acceptor emission wavelengths may also be
monitored.
[0008] There are two commonly used types of FET or FRET probes,
those using hydrolysis of nucleic acid probes to separate'donor
from acceptor, and those using hybridisation to alter the spatial
relationship of donor and acceptor molecules.
[0009] Hydrolysis probes are commercially available as TaqMan.TM.
probes. These consist of DNA oligonucleotides which are labelled
with donor and acceptor molecules. The probes are designed to bind
to a specific region on one strand of a PCR product. Following
annealing of the PCR primer to this strand, Tag enzyme extends the
DNA with 5' to 3' polymerase activity. Tag enzyme also exhibits 5'
to 3' exonuclease activity. TaqMan.TM. probes are protected at the
3' end by phosphorylation to prevent them from priming Tag
extension. If the TaqMan.TM. probe is hybridised to the product
strand than an extending Tag molecule may also hydrolyse the probe,
liberating the donor from acceptor as the basis of detection. The
signal in this instance is cumulative, the concentration of free
donor and acceptor molecules increasing with each cycle of the
amplification reaction.
[0010] The fact that signal generation is dependent upon the
occurrence of probe hydrolysis reactions means that there is a time
penalty associated with this method. Furthermore, the presence of
the probe may interrupt the smooth operation of the PCR
process.
[0011] In addition, it has been found that hydrolysis can become
non-specific, particularly where large numbers of amplification
cycles, for instance more than 50 cycles, are required. In these
cases, non-specific hydrolysis of the probe will result in an
unduly elevated signal.
[0012] This means that such techniques are not very compatible with
rapid PCR methods which are becoming more prominent with the
development of rapid hot air thermal cyclers such as the
RapidCycler.TM. and LightCycler.TM. from Idaho Technologies Inc.
Other rapid PCR devices are described for example in co-pending
British Patent No. 2334904. The merits of rapid cycling over
conventional thermal cycling have been reported elsewhere. Such
techniques are particularly useful for example in detection systems
for biological warfare where speed of result is important if loss
of life or serious injury is to be avoided.
[0013] Furthermore, hydrolysis probes do not provide significant
information with regard to hysteresis of melting since signal
generation is, by and large, dependent upon hydrolysis of the probe
rather than the melt temperature of the amplicon or probe.
[0014] Hybridisation probes are available in a number of guises.
Molecular beacons are oligonucleotides that have complementary 5'
and 3' sequences such that they form hairpin loops. Terminal
fluorescent labels are in close proximity for FRET to occur when
the hairpin structure is formed. Following hybridisation of
molecular beacons to a complementary sequence the fluorescent
labels are separated, so FRET does not occur, and this forms the
basis of detection.
[0015] Pairs of labelled oligonucleotides may also be used. These
hybridise in close proximity on a PCR product strand bringing donor
and acceptor molecules together so that FRET can occur. Enhanced
FRET is the basis of detection. Variants of this type include using
a labelled amplification primer with a single adjacent probe.
[0016] The use of two probes, or a molecular beacon type of probe
which includes two labelling molecules increases the cost involved
in the process. In addition, this method requires the presence of a
reasonably long known sequence so that two probes which are long
enough to bind specifically in close proximity to each other are
known. This can be a problem in some diagnostic applications, where
the length of conserved sequences in an organism which can be used
to design an effective probe may be relatively short such as the
HIV virus.
[0017] Furthermore, the use of pairs of probes involves more
complex experimental design. For example, a signal provided by the
melt of a probe is a function of the melting off of both probes.
The study of small mismatches or where one of the probes is
required to bind across a splice region (for example to detect RNA
as compared to DNA in a sample where the sequence on either side of
an intron can be utilised as the probe site) can yield incorrect
results if the other probe melts first.
[0018] Co-pending international application WO99/28500 describes a
method for detecting the presence of a particular target nucleic
acid sequence, the method comprising a) adding to the sample a
probe specific for said sequence, the probe bearing a moiety able
to either donate fluorescence to, or absorb fluorescent energy
from, a DNA duplex binding agent, b) subjecting the mixture to a
amplification reaction, c) hybridising the probe to the target
sequence and monitoring the fluorescence from the sample. The
reaction can then be monitored by measuring the fluorescence of
said sample as this will alter during the course of the reaction as
more product is formed which hybridises to the probe and gives rise
to a FET or FRET interaction between the DNA duplex binding agent
and the fluorescent moiety on the probe.
[0019] Co-pending International Patent application No.
PCT/GB99/00504 describes a similar assay for detecting the presence
of particular nucleic acid sequences which may be adapted to
quantify the amount of the target sequence in the sample. In this
assay, an amplification reaction is effected using a set of
nucleotides, at least one of which is fluorescently labelled. Thus
the amplification product has fluorescent label incorporated in it.
The reaction is effected in the presence of a probe which can
hybridise to the amplification product and which includes a
reactive molecule which is able to absorb fluorescence from or
donate fluorescent energy to said fluorescent labelled nucleotide.
The reaction can then be monitored by measuring the fluorescence of
said sample as this will alter during the course of the reaction as
more product is formed which hybridises to the probe and gives rise
to a FET or FRET interaction between them.
[0020] International Patent Application WO01/11078 describes a
further related method for detecting the presence of a target
nucleic acid sequence in a sample. In this assay, in a first stage,
the target sequence is made single stranded so that the primer
region of the reagent can hybridise to it. This can thus initiate
extension of the strand to generate a complementary strand which
will include labelled nucleotides and will also have a labelled
probe region upstream of its 5' end which is complementary to a
downstream region of the product. Once the extension phase is
complete, the product is separated from its template strand during
a melt phase and so becomes single stranded. In this form, the
labelled probe region is able to twist over and hybridise to the
complementary region of the product strand whereupon the label
which is able to donate fluorescent energy (donor) to the other
label by means of FET or FRET does so, thus changing the
fluorescent signal from the sample. This change in signal can be
monitored throughout the reaction in order to monitor the progress
of the amplification reaction.
[0021] Assays comprising the use of Scorpion probe systems are
disclosed in GB2338301 and Nucleic Acids Research, 2000, vol. 28,
no. 19, 3752-3761. The Scorpion probe systems comprise a primer
portion attached to a probe portion by a linking moiety. The probe
systems comprise both donor and acceptor moieties. In this assay,
in a first stage, the target sequence is made single stranded so
that the primer portion can hybridise to the target sequence. This
can thus initiate extension of the strand to generate a
complementary strand which will have the probe portion upstream of
its 5' end which is complementary to a downstream region of the
product. Once the extension phase is complete, the product is
separated from its template strand during a melt phase and so
becomes single stranded. In this form, the labelled probe region is
able to twist over and hybridise to the complementary region of the
product strand. The hybridisation of the probe portion to the
complementary region of the product strand alters the spatial
relationship between the donor and acceptor moieties and thus the
fluorescent signal from the sample is changed.
[0022] The applicants have now found an alternative improved
assay.
[0023] The present invention provides a method for detecting the
presence of a target nucleic acid sequence in a sample, said method
comprising:
performing nucleic acid amplification on the sample in the presence
of (a) a DNA duplex binding agent, (b) a nucleic acid polymerase
and (c) a reagent comprising an amplification primer which can
hybridise to said target sequence when in single stranded form and
which is connected at its 5' end to a probe which carries a label
by way of a chemical linking group, said labelled probe being of a
sequence which is similar to that of the said target nucleic acid
sequence, such that it can hybridise to a complementary region in
an amplification product, and wherein the label is able to absorb
fluorescence from or donate fluorescent energy to the DNA duplex
binding agent; and monitoring fluorescence of said sample.
[0024] The present invention is cheaper and simpler than the prior
art assay of WO01/11078 and is surprisingly effective. In the
present invention, the DNA duplex binding agent is added to the
reaction mixture in an unbound state, dispensing with the need to
attach the agent either to a nucleotide, as in WO01/11078, or to
the probe system as in GB2338301.
[0025] In the assay of the present invention, in a first stage, the
target sequence is made single stranded so that the primer region
of the reagent can hybridise to it. This can thus initiate
extension of the strand to generate a complementary strand. The
primer strand will also have a labelled probe region upstream of
its 5' end which is complementary to a downstream region of the
product. DNA duplex binding material (preferably an intercalating
dye) will become entrapped within the duplex so formed. Once the
extension phase is complete, the product is separated from its
template strand during a melt phase and so becomes single stranded.
In this form, the labelled probe region is able to twist over and
hybridise to the complementary region of the product strand, thus
entrapping DNA duplex binding agent between probe region and
complementary region of the product strand. Due to the mutual
proximity of the DNA duplex binding agent and the probe label, the
fluorescent moiety which is able to donate fluorescent energy
(donor) to the acceptor moiety by means of FET or FRET does so,
thus changing the fluorescent signal from the sample. This change
in signal can be monitored, throughout the reaction in order to
monitor the progress of the amplification reaction.
[0026] In the second and subsequent stages of the amplification,
the product strand may itself act as a template strand for
extension. However, the chemical link between probe and primer will
halt the extension reaction before a sequence complementary to said
probe is produced. Thus the probe region remains single
stranded.
[0027] It is preferred that the method of the present invention
comprises:
(a) adding to a sample suspected of containing the target nucleic
acid sequence, the DNA duplex binding agent, the nucleic acid
polymerase and the reagent; (b) subjecting said sample to
conditions under which the primer hybridises to the target nucleic
acid sequence and an amplification product comprising the probe is
formed; (c) subjecting said sample to conditions under which the
labelled probe hybridises to a complementary region in the
amplification product; and (d) monitoring fluorescence of said
sample during at least one of steps (b) and (c).
[0028] If required, a corresponding amplification primer which is
not attached to a labelled probe region may also be present during
the amplification reaction. This primer would result in the
production of a conventional unlabelled amplification product which
may serve to mediate the signal into the dynamic range of the
detector device being used. It may also improve reaction efficiency
which may be adversely affected by the presence of a complex
probe/primer structure.
[0029] When the acceptor label which is able to absorb fluorescence
from the donor label performs this function, fluorescence from the
donor is reduced. This reduction may be detected and this indicates
binding of the probe region.
[0030] Most preferably, the label which is able to absorb
fluorescence (acceptor) is itself a fluorescent molecule which
emits fluorescence at a characteristic wavelength. Such probes
include a rhodamine dye or Cy5. In this case, increase in
fluorescence from the acceptor molecule, which is of a different
wavelength to that of the donor label, will also indicate binding
of the probe. Alternatively, the acceptor does not fluoresce (dark
acceptor). Such acceptors include DABCYL, methyl red, QSY-7
diarylrhodamine dyes and
6-(dimethylamino)-2-[4-[4-(dimethylamino)phenyl]-1,3-butadienyl]-1-ethyl
quinolinium perchlorate (CAS number 181885-68-7).
[0031] Suitably, the DNA duplex binding agent comprises a donor
label and the acceptor label is provided on the probe. In this
case, and if the acceptor fluoresces, then the presence of the thus
labelled amplification product can be detected by monitoring
fluorescence from the acceptor molecule on the probe, which
predominantly binds to a downstream region of the same product
strand. In this case, signal from the amplification product can be
distinguished from background signal of the fluorescent label and
also from any non-specific amplification product. Alternatively,
the DNA duplex binding agent may comprise an acceptor label and the
probe comprises the donor label.
[0032] In the system of the present invention there is
discrimination between the rise in the generic intercalator signal
(as the DNA is amplified) and the sequence specific signal which is
only generated when the two fluorescent moieties are in close
proximity (i.e. when probe hybridises to amplification product).
The fact that the sequence specific signal is produced only by
labelled amplification product means that the system is highly
specific in terms of detecting specific target sequences in
reaction mixtures that contain large amounts of background DNA.
This is because non-specific amplification product will not
hybridise to the probe region and so does not contribute to the
measured signal. The measurement of the generic intercalator signal
in addition to the sequence specific signal may be beneficial. The
generic intercalator signal is proportional to the degree of
amplification in the reaction mixture and thus may be used to
indicate the efficiency or blockage of amplification.
[0033] An assay of this nature can be carried out using inexpensive
reagents. Single labelled probes are more economical than those
which include both acceptor and donor molecules.
[0034] Amplification is suitably effected using known amplification
reactions such as the polymerase chain reaction (PCR) or the ligase
chain reaction (LCR), strand displacement assay (SDA) or NASBA, but
preferably PCR.
[0035] Preferably, the fluorescence of both the donor and the
acceptor moieties are monitored and the relationship between the
emissions calculated.
[0036] The position of the label along the probe is immaterial
although it general, they will be positioned at an end region of
the probe. More than one label may be used in the reagent, but one
is preferred since it is cheaper.
[0037] In order for FET, such as FRET, to the fluorescent emission
of the donor moiety must be of a shorter wavelength than the
acceptor moiety.
[0038] Suitable combinations are therefore set out in the following
Table:
TABLE-US-00001 Donor Acceptor SYBRGold Rhodamine SYBRGreen I
Rhodamine Fluorescein Rhodamine SYBRGold Cy5 SYBRGreen I Cy5
Fluorescein Cy5 Fluorescein Ethidium bromide Fluorescein Dabcyl
Fluorescein Methyl Red Fluorescein QSY-7 diaryl rhodamine dyes*
SYBRGold Cy5.5 *Available from Molecular Probes, UK.
[0039] Those skilled in the art will realise that many other such
combinations are possible.
[0040] Preferably, the molecules used as donor and/or acceptor
produce sharp emission peaks, and there is little or no overlap in
the wavelengths of the emission. Under these circumstances, it may
not be necessary to resolve the "strand specific peak" from the
signal produced by amplification product. A simple measurement of
the strand specific signal alone (i.e. that provided by the
acceptor moiety) will provide information regarding the extent of
the FET or FRET caused by the target reaction.
[0041] However, where there is a spectral overlap in the
fluorescent signals from the donor and acceptor moieties, this can
be accounted for in the results, for example by determining
empirically the relationship between the spectra and using this
relationship to normalise the signals from the two signals.
[0042] The chemical link separating the labelled probe from the
primer is suitably any molecule that can link nucleotide sequences
but which is not recognised by a DNA polymerase. A wide range of
chemical linkers which would fulfil this requirement are
available.
[0043] Examples of the types of chemical and reactions which may be
used in the formation of linkers are described for example in WO
95/08642. In particular, the chemical linker comprises a group of
atoms joining the two polynucleotide sequences, primer and probe,
together. The linker can be joined to the respective polynucleotide
sequences by any of the conventional methods.
[0044] Generally speaking, the linker will be derived from an
organic chemical having a first and a second functional group by
means of which it can be attached to the probe and the primer
sequences respectively or to individual nucleotides from which the
probe or primer sequence is then generated subsequently. The linker
is generally designed not to bind to nucleotides.
[0045] The synthesis of linkers is discussed in detail in, for
example, S. Agrawal et al, Nucleic Acids Research, 1986, 14, 6227
and WO-88/02004 (Applied Biosystems); J. L. Ruth and D. E.
Bergstrom, J. Org. Chem., 1978, 43, 2870; D. E. Bergstrom and M. K.
Ogawa, J. Amer. Chem. Soc., 1978, 10, 8106; and C. F. Bigge, P.
Kalaritis, J. R. Deck and M. P. Mertes, J. Amer. Chem. Soc., 1980,
102, 2033; and European Patent Application No. 063,879. The reader
is also directed to International Patent Application WO01/11078 for
a more detailed discussion of the structure and synthesis of
reagents having chemical linking groups that join a probe and
primer.
[0046] In particular, the linkers will comprise a multiple form of
ethylene glycol, for example hexaethylene glycol (HEG). Such
linkers may be of structure --(CHOH--CHOH).sub.n-- where n is an
integer in excess of 1, for example from 1-10 and suitably 6.
[0047] Such reagents comprising linker groups that link a probe and
primer can be obtained from Oswel Research Products Ltd, UK.
[0048] The method of the present invention is extremely versatile
in its applications. The method can be used to generate both
quantitative and qualitative data regarding the target nucleic acid
sequence in the sample, as discussed in more detail hereinafter. In
particular, not only does the invention provide for quantitative
amplification, but also it can be used, additionally or
alternatively, to obtain characterising data such as duplex
destabilisation temperatures or melting points.
[0049] In the method of the invention, the labelled probe is
integral with an amplification primer and so is present throughout
the course of the amplification reaction. The process allows the
detection to be effected in a homogenous manner, in that the
amplification and monitoring can be carried out in a single
container with all reagents added initially. No subsequent reagent
addition steps are required. It may be possible to use the method
of the present invention in some heterogeneous systems. Note that
there is no need to effect the method in the presence of solid
supports (although this is an option as discussed further
hereinafter).
[0050] Since the probe is present throughout the amplification
reaction, the fluorescent signal may allow the progress of the
amplification reaction to be monitored. This may provide a means
for quantitating the amount of target sequence present in the
sample.
[0051] If a fluorescent acceptor moiety is used, then during each
cycle of the amplification reaction, amplicon strands containing
the target sequence and a probe region generate an acceptor signal.
As the amount of such amplicons in the sample increases, so the
acceptor signal will increase. By plotting the rate of increase
over cycles, the start point of the increase can be determined.
[0052] The labelled probe may comprise a nucleic acid molecule such
as DNA or RNA, which will hybridise to the target nucleic acid
sequence when the latter is in single stranded form. In this
instance, conditions will be used which render the target nucleic
acid single stranded. Alternatively, the probe may comprise a
molecule such as a peptide nucleic acid or another nucleic acid
analogue which also binds the target sequence in double stranded
form.
[0053] In particular, the amplification reaction used will involve
a step of subjecting the sample to conditions under which any of
the target nucleic acid sequence present in the sample becomes
single stranded, such as PCR or LCR. It is possible then for the
probe region to hybridise to the downstream region of the amplicon
strand containing it during the course of the amplification
reaction provided appropriate hybridisation conditions are
encountered.
[0054] In a preferred embodiment, the probe may be designed such
that these conditions are met during each cycle of the
amplification reaction. Thus at some point during each cycle of the
amplification reaction, the probe will hybridise to the target
sequence, and generate a signal as a result of the FET or FRET. As
the amplification proceeds, the probe region will be separated or
melted from the downstream sequence and so the signal generated by
the acceptor label will either reduce or increase depending upon
whether it comprises the donor or acceptor molecule. For instance,
where it is an acceptor, in each cycle of the amplification, a
fluorescence peak from the acceptor label is generated. The
intensity of the peak will increase as the amplification proceeds
because more amplicon strands including probes becomes
available.
[0055] By monitoring the fluorescence of the acceptor label from
the sample during each cycle, the progress of the amplification
reaction can be monitored in various ways. For example, the data
provided by melting peaks can be analysed, for example by
calculating the area under the melting peaks and this data plotted
against the number of cycles.
[0056] Fluorescence is suitably monitored using a known
fluorimeter. The signals from these, for instance in the form of
photo-multiplier voltages, are sent to a data processor board and
converted into a spectrum associated with each sample tube.
Multiple tubes, for example 96 tubes, can be assessed at the same
time. Data may be collected in this way at frequent intervals, for
example once every 10 ms, throughout the reaction.
[0057] The spectra generated in this way can be resolved, for
example, using "fits" of pre-selected fluorescent moieties such as
dyes, to form peaks representative of each signalling moiety (i.e.
DNA duplex binding agent and/or probe label). The areas under the
peaks can be determined which represents the intensity value for
each signal, and if required, expressed as quotients of each other.
The differential of signal intensities and/or ratios will allow
changes in FET or FRET to be recorded through the reaction or at
different reaction conditions, such as temperatures. The changes,
as outlined above, are related to the binding phenomenon between
the probe and the target sequence. The integral of the area under
the differential peaks will allow intensity values for the FET or
FRET effects to be calculated.
[0058] These data provide one means to quantitate the amount of
target nucleic acid present in the sample.
[0059] The primer/labelled probe reagent may either be free in
solution or immobilised on a solid support, for example on the
surface of a bead such as a magnetic bead, useful in separating
products, or the surface of a detector device, such as the
waveguide of a surface plasmon resonance detector and, for example,
a DNA array. The selection will depend upon the nature of the
particular assay being examined and the particular detection means
being employed.
[0060] The probe may be designed such that it is hydrolysed by the
DNA polymerase used in the amplification reaction thereby releasing
the acceptor molecule. This provides a cumulative signal, with the
amount of free probe label present in the system increasing with
each cycle. However, it is not necessary in this assay for the
probe to be consumed in this way as the signal does not depend upon
the hydrolysis of the probe.
[0061] Suitably, the probe is designed such that it is released
intact from the target sequence and so is able to bind again when
suitable hybridisation conditions are met during the amplification
reaction. This may be, for example, during the extension phase of
the amplification reaction. However, since the signal is not
dependent upon probe hydrolysis, the probe may be designed to
hybridise and melt from the target sequence at any stage during the
amplification cycle. In particular, the probe may preferably be
designed to hybridise at temperatures below the extension
temperature of the reaction as this will ensure that interference
with the amplification reaction is minimised.
[0062] This provides a fully reversible signal which is directly
related to the amount of amplification product present at each
stage of the reaction. Furthermore, it is advantageous where speed
of reaction is of the greatest importance, for example in rapid
PCR, since a probe which is integral with the amplicon strand being
detected will be able to hybridise rapidly to it.
[0063] The data generated in this way can be interpreted in various
ways. In its simplest form, an increase in fluorescence of the
acceptor molecule in the course of or at the end of the
amplification reaction is indicative of an increase in the amount
of the target sequence present, suggestive of the fact that the
amplification reaction has proceeded and therefore the target
sequence was in fact present in the sample. However, as outlined
above, quantification is also possible by monitoring the
amplification reaction throughout. Finally, it is possible to
obtain characterisation data and in particular melting point
analysis, either as an end point measure or throughout, in order to
obtain information about the sequence as will be discussed further
below.
[0064] Thus, a preferred embodiment of the invention comprises a
method for detecting nucleic acid amplification comprising:
performing nucleic acid amplification on a target polynucleotide in
the presence of (a) a nucleic acid polymerase, (b) a DNA duplex
binding agent and (c) a reagent comprising an amplification primer
which can hybridise to said target sequence when in single stranded
form and which is connected at its 5' end to a probe which carries
a second label, by way of a chemical linking group, said labelled
probe being of a sequence which is similar to that of the said
target sequence, such that it can hybridise to a complementary
region in an amplification product, and wherein one of the DNA
duplex binding agent or second label comprises a donor label which
is able to donate fluorescent energy to the other of the DNA duplex
binding agent or second label which comprises an acceptor label
able to absorb fluorescent energy from said donor molecule, said
primer being capable of hybridising to said target polynucleotide;
and monitoring changes in fluorescence during the amplification
reaction.
[0065] Suitably, the acceptor label is itself fluorescent and emits
fluorescent energy at a characteristic wavelength.
[0066] The amplification is suitably carried out using a pair of
primers which are designed such that only the target nucleotide
sequence within a DNA strand is amplified as is well understood in
the art. The nucleic acid polymerase is suitably a thermostable
polymerase such as Tag polymerase.
[0067] Suitable conditions under which the amplification reaction
can be carried out are well known in the art. The optimum
conditions may be variable in each case depending upon the
particular amplicon involved, the nature of the primers used and
the enzymes employed. The optimum conditions may be determined in
each case by the skilled person. Typical denaturation temperatures
are of the order of 95.degree. C., typical annealing temperatures
are of the order of 55.degree. C. and extension temperatures are of
the order of 72.degree. C.
[0068] In a particular embodiment of the invention the labelled
probe may be used to quantitate RNA transcripts, for example in
expression experiments, that may be used in drug discovery. In
particular this embodiment is suitable for expression studies in
tissues from eukaryotic organisms. DNA encoding proteins in
eukaryotic cells may contain introns, non-coding regions of DNA
sequence, and exons that encode for protein sequence. Non-coding
intron sequences are removed from RNA sequences that are derived
from the DNA sequences during cellular "splicing" processes. PCR
primers are normally targeted at coding regions and when reverse
transcriptase PCR is used on total nucleic acid extracts, products
will result from both DNA dependent amplification and RNA dependent
amplification. Thus PCR alone, when used for expression studies,
will contain amplification resulting from genomic DNA and expressed
RNA.
[0069] A labelled probe that is designed to bind across introns, on
adjacent terminal regions of coding exons, will have limited
interaction because of the intron region. Spliced RNA has these
regions removed and therefore the adjacent terminal regions of
coding exons form one continuous sequence allowing efficient
binding of the probe region.
[0070] Conversely, the probe region may detect only an
amplification product of genomic DNA if it is designed such that it
binds an intron region. Signal generated from such a probe would
relate only to the DNA concentration and not the RNA concentration
of the sample. It is also possible to use two reagents, each having
different probes and primers, one reagent suitable for use with the
splice region of the RNA and one reagent suitable for the intron in
the DNA.
[0071] Thus in a further embodiment, the probe region is specific
either for a splice region of RNA or an intron in DNA, so that only
one of amplified RNA or amplified DNA is detected and/or
quantitated.
[0072] Alternatively or additionally, the method of the invention
can be used in hybridisation assays for determining characteristics
of a sequence. Thus in a further aspect, the invention provides a
method for determining a characteristic of a nucleic acid sequence,
said method comprising (a) amplifying said sequence in the presence
of a DNA duplex binding agent and a reagent comprising an
amplification primer linked by way of a chemical link at its 5' end
to a probe which comprises a sequence which is similar to that of a
region of the target sequence and which further comprises a label,
where one of said DNA duplex binding agent and the label is a donor
label and the other is an acceptor label, the donor label being
able to donate fluorescent energy to the acceptor label; so as to
form an amplification product incorporating a probe region, (b)
subjecting amplification product to conditions under which the
probe region thereof will hybridise to the complementary region of
the amplification product, and (c) monitoring fluorescence of said
sample and determining a particular reaction condition,
characteristic of said sequence, at which fluorescence changes as a
result of the hybridisation of the probe region to the sample or
destabilisation of the duplex formed between the probe region and
the target nucleic acid sequence.
[0073] Suitable reaction conditions include temperature,
electrochemical, or the response to the presence of particular
enzymes or chemicals. By monitoring changes in fluorescence as
these properties are varied, information characteristic of the
precise nature of the sequence can be achieved. For example, in the
case of temperature, the temperature at which the probe separates
from the sequences in the sample as a result of heating can be
determined. This can be extremely useful in for example, to detect
and if desired also to quantitate, polymorphisms and/or allelic
variation in genetic diagnosis. By "polymorphism" is included
transitions, transversions, insertions, deletions of inversions
which may occur in sequences, particularly in nature.
[0074] The hysteresis of melting will be different if the target
sequence varies by only one base pair. Thus for example, where a
sample contains only a single allelic variant, the temperature of
melting of the probe region will be a particular value which will
be different from that found in a sample which contains only
another allelic variant. A sample containing both allelic variants
which show two melting points corresponding to each of the allelic
variants.
[0075] Thus, in a further embodiment of the present invention a
method for detecting a polymorphism and/or allelic variation, said
method comprising amplifying a sequence suspected of containing
said polymorphism or variation using a method of the present
invention, measuring the temperature at which the probe region
melts from its complementary sequence within the amplification
product using the fluorescent signal generated, and relating this
to the presence of a polymorphism or allelic variation.
[0076] Similar considerations apply with respect to electrochemical
properties, or in the presence of certain enzymes or chemicals. The
labelled probe may be immobilised on a solid surface across which
an electrochemical potential may be applied. Downstream target
sequence will bind to or be repulsed from the probe at particular
electrochemical values depending upon the precise nature of the
sequence.
[0077] In addition, the kinetics of probe hybridisation will allow
the determination, in absolute terms, of the target sequence
concentration. Changes in fluorescence from the sample can allow
the rate of hybridisation of the probe region to the sample to be
calculated. An increase in the rate of hybridisation will relate to
the amount of target sequence present in the sample. As the
concentration of the target sequence increases as the amplification
reaction proceeds, hybridisation of the probe region will occur
more rapidly. Thus this parameter may also be used as a basis for
quantification. This mode of data processing useful in that it is
not reliant directly on signal intensity to provide the
information.
[0078] In a further embodiment of the invention, a kit for use in
the method of the present invention which kit comprises a reagent
comprising an amplification primer linked at its 5' end by way of a
chemical link, to a probe specific for a target nucleotide
sequence, wherein the probe comprises a first label which may act
as one of either a donor and acceptor label; and a DNA
intercalating agent comprising a second label, which second label
may act as one of either a donor and acceptor label, wherein the
first and second labels form a donor-acceptor pair.
[0079] If desired, the probe can be immobilised on a support such
as a bead, for example a magnetic bead, or a support used in a
detector, such as the waveguide of an evanescent wave detector
device. Other potential components of the kit include reagents used
in amplification reactions such as a DNA polymerase.
[0080] The use of a non-fluorescent acceptor molecule may also be
used in the assay described in co-pending International Patent
Application No PCT/GB99/0504.
[0081] The present invention will now be particularly described by
way of example with reference to the accompanying diagrammatic
drawings in which:
[0082] FIG. 1 shows diagrammatically the molecular interactions
which take place in the method of the invention.
[0083] FIG. 2 shows fluorescence as measured in accordance with a
method of the present invention by the F3 detector as a function of
cycle number for the beta-actin system for various concentrations
of human DNA
[0084] FIG. 3 shows fluorescence as measured by the F3 detector in
accordance with a comparative prior art method as a function of
cycle number for the beta-actin system for various concentrations
of human DNA
[0085] FIG. 4 shows fluorescence as measured by the F1 detector
using a Taqman.TM. method of the prior art as a function of cycle
number for the beta-actin system for various concentrations of
human DNA
[0086] FIG. 5 shows fluorescence as measured in accordance with a
method of the present invention by the F3 detector as a function of
cycle number for a meningitis system for various concentrations of
meningitis gene
[0087] FIG. 6 shows fluorescence as measured by the F3 detector in
accordance with a comparative prior art method as a function of
cycle number for the meningitis system for various concentrations
of meningitis gene
[0088] FIG. 7 shows fluorescence as measured by the F1 detector
using a Taqman.TM. method of the prior art as a function of cycle
number for the meningitis system for various concentrations of
meningitis gene
[0089] FIG. 8 shows fluorescence as measured in accordance with a
method of the present invention by the F3 detector as a function of
cycle number for a chlamydia system for various concentrations of
chlamydia gene
[0090] FIG. 9 shows fluorescence as measured by the F1 detector
using a Taqman.TM. method of the prior art as a function of cycle
number for the chlamydia system for various concentrations of
chlamydia gene
[0091] FIG. 10 shows fluorescence as measured in accordance with a
method of the present invention by the F3 detector as a function of
cycle number for a genetically modified soybean system for various
concentrations of modified gene; and
[0092] FIG. 11 shows fluorescence as measured by the F1 detector
using a Taqman.TM. method of the prior art as a function of cycle
number for the GM soybean system for various concentrations of
modified gene.
[0093] FIG. 1 shows diagrammatically the molecular interactions
which take place in the method of the invention. In the illustrated
amplification reaction, a DNA molecule (1) prepared for
amplification by contacting it with pair of amplification primers
(2), (3). One of the primers (2) is linked to a probe (6) which
includes an acceptor label (7) by way of a chemical link (8). A
fluorescent donor moiety (10) is provided in the reaction
mixture.
[0094] The DNA molecule (1) is rendered single stranded (FIG. 1B)
whereupon the primers (2,3) bind as forward and reverse primers
respectively in an amplification reaction as is well known.
[0095] During the course of the subsequent amplification reaction,
an amplicon product (9) is built up (FIG. 1C).
[0096] When this product is melted during the subsequent phase of
the amplification, the probe region (6) comprising an acceptor
label (7) binds the complementary region within the amplicon strand
(FIG. 1D). Intercalator moieties (10) are entrapped between the
probe and the product. The FRET interaction between the fluorescent
intercalator moieties (10) and the acceptor label (7) generates a
signal at the wavelength characteristic of the acceptor.
[0097] The signal from the acceptor molecule (7) can then be
monitored using conventional fluorescence detection devices.
[0098] The person skilled in the art will realise that the use of
the second primer (3) is not essential to the present invention.
Furthermore, those skilled in the art will realise that the label
on the probe may be a donor label and the intercalator moiety may
be an acceptor label.
PCR Amplification Reaction
[0099] PCR reaction mixtures contained the following reagents with
working concentrations being prepared.
[0100] The composition was:
50 mM Trizma pH 8.8 at 25.degree. C., 3 mM Magnesium Chloride, 8%
w/Vol. Glycerol, 250 ng/.mu.l non-acetylated bovine serum albumin,
200 .mu.M dNTP's PCR nucleotides, 0.01 units/.mu.l
uracil-n-glycosylase, 0.04 units/.mu.l Taq (exo 5'-3' deficient)
DNA polymerase and 0.03 .mu.M TaqStart anti-Taq antibody.
[0101] The Taq DNA polymerase and the TaqStart anti-Taq antibody
were incubated together for 10 minutes before addition to the
mixture.
[0102] SYBRGold was included as the fluorescent donor label in the
reactions to a final concentration of 1:20,000 to 1:200,000
dilution of the reference solution.
[0103] The Taq DNA polymerase was used to ensure that the reagent
was not hydrolysed during the course of the reaction. The use of
this polymerase was not found to be necessary because of the very
short hold times used in the method of the present invention.
Target Template
[0104] Several target templates and associated genes were
investigated. These are listed below.
TABLE-US-00002 Target template Gene Human placental DNA ABI human
beta-actin amplicon Soybean Lel lectin Genetically modified soybean
CP4 EPSPS Neisseria meningitidis porA Chlamydia trachomatis Ct
plasmid
[0105] Custom novel oligonucleotide reagents comprising probes and
primers were made for each target gene. Each reagent has the
generic structure: FL-PROBE-HEG-PRIMER, where FL is the fluorescent
moiety, PROBE is the probe sequence, HEG is HEG (hexaethylene
glycol) and PRIMER is the primer sequence which hybridises to the
appropriate target sequence. The reagents are available from Oswel
Research Products Ltd., UK. Reagents with the same generic
structure suitable for use in the method of the present invention
may be made in accordance with the teaching of WO01/11078.
[0106] The structure of the reagent corresponding to each gene is
listed below:
TABLE-US-00003 Gene Reagent structure Actin
$atgccctcccccatgccatcctgcgt*cagcggaaccgctcattgccaatgg (Seq No. 1)
Lectin $tgccttctttctcgcaccaattgaca*cctgcatgtgtttgtggctt (Seq. No.
2) CP4 $ccttcatgttcggcggtctcgc*atgcgcgtttcaccgct (Seq. No. 3) PorA
$tcagcggcagcgtccaattcg*acttgctgttttgggccg (Seq. No. 4) PorA
$ccaaacgcacttccgccatcg*tcagccaagcgccagac (Seq. No. 5) Ct
$tatgcttacacatttatcgactgggtgattacagc*ttttcgtctctttttcgcagc (Seq.
No. 6) $-5' CyS label *-HEG linking group
[0107] The concentration of the gene sequence to be detected was
varied as desired. The final concentration of the reagent was 0.2
.mu.M.
[0108] The performance of the method of the present invention was
compared to methods of the prior art by repeating the experiments
using analogous Taqman.TM. assays and those of WO99/28500.
[0109] The ThermalCycler real-time PCR instrument and consumables
were obtained from Roche. The instrument was calibrated using
conventional techniques. It was found to be extremely beneficial to
run the colour calibration program with specific product and
SYBRGold. It was also found to be beneficial to run the colour
calibration program with Cy5.
[0110] The thermal cycling protocols were:
For the method of the present invention and that of WO99/28500:
50.degree. C. hold for 1 minute for carry-over prevention
95.degree. C. hold for 1 minute for initial denaturation 50 cycles
of (95.degree. C., 5 seconds; 60.degree. C. 5 seconds; 74.degree.
C. 5 seconds, 5 seconds extension, collect fluorescence)
[0111] For the Taqman.TM. assays:
50.degree. C. hold for 1 minute for carry-over prevention
95.degree. C. hold for 1 minute for initial denaturation 50 cycles
of (95.degree. C., 5 secs.; 60.degree. C. 20-120 secs.; collect
fluorescence at end of step)
[0112] This shows that the method of the present invention is
considerably faster than that using the prior art Taqman.TM.
assays.
[0113] The ThermalCycler PCR instrument uses three detectors,
denoted F1, F2 and F3. F1 operates at 520 nm, optimised to detect
the emissions of SYBRGold and Fluorescein. F2 operates at 640 nm
optimised to detect the signal generated by LC640. F3 operates at
705 nm, optimised to work with LC705.
[0114] The F1 (520 nm/Fluorescein) optical detector was used for
detecting the non-strand specific amplification signal generated by
the SYBRGold intercalating dye. The F3 (705 nm/LC705 dye) optical
detector was used for detecting the amplification of specific
product using the signal generated by the Cy5 moiety of the probe.
The probe system used Cy5 instead of LC705 because of the better
yield of incorporated dye during oligonucleotide synthesis.
EXAMPLE 1
Detection and Quantification of Beta-Actin Gene
[0115] FIG. 2 shows fluorescence as measured by the F3 detector as
a function of cycle number for the beta-actin system for various
concentrations of human DNA using the method of the present
invention. Each set of data shows a low-level background response
for a given number of cycles, dependent on the concentration of DNA
within the sample. Within each set of data, the observed
fluorescence increases dramatically at a certain cycle number
dependent on the concentration of human DNA in the sample. The
fluorescence is generated by the probe section of the reagent
binding to the amplification product downstream of the primer. This
binding process brings the Cy5 moiety into proximity of the
SYBRGold species. The SYBRGold species undergoes fluorescence, with
the emitted light being adsorbed by the Cy5 moiety. The Cy5 itself
then emits light which is detected by the F3 detector. As the cycle
number further increases, the fluorescence reaches a maximum and
then decreases slowly. It is believed that this is due to the probe
section being displaced by amplification product (often referred to
as the "hook effect" that is also observed in dual-hybe probe
reporting chemistries).
[0116] Analysis of the data sets of FIG. 2A produces a
quantification curve as shown in FIG. 2B. The correlation
co-efficient for the curve is near to 1.0, showing that the method
of the present invention is excellent for quantification and
identification of a nucleic acid sequence.
[0117] FIG. 3 shows comparative data obtained using assays of
WO99/28500 for the beta-actin gene. FIG. 3A shows the measured
fluorescence as a function of cycle number for the beta-actin
system as a function of concentration of DNA. The data obtained
from the prior art system are noisier than those obtained from the
method of the present invention. Furthermore, the gradient of
response is sharper using the method of the present invention and
the cycle threshold value is also slightly lower using the method
of the present invention. A comparison of FIGS. 2B and 3B confirms
this observation.
[0118] FIG. 4 shows comparative data obtained using the Taqman.TM.
assays in accordance with a prior art method. The response curves
are relatively shallow compared to those of the present invention.
Furthermore, the Taqman.TM. methodology is very slow compared to
that of the present invention.
EXAMPLE 2
Identification and Quantification of porA Gene
[0119] FIG. 5 shows fluorescence as measured by the F3 detector as
a function of cycle number for the meningitis system for various
concentrations of human DNA using the method of the present
invention. The data shown use the reagent of structure Seq. No. 5.
Each set of data shows a low-level background response for a given
number of cycles, dependent on the concentration of DNA within the
sample. Within each set of data, the observed fluorescence
increases dramatically at a certain cycle number dependent on the
concentration of human DNA in the sample.
[0120] FIG. 6 shows comparative data obtained using assays of
WO99/28500 for the porA gene.
[0121] FIG. 7 shows comparative data obtained using the Taqman.TM.
methodology of the prior art. Again, the response curves are
relatively shallow compared to those of the present invention.
Furthermore, the Taqman.TM. methodology is very slow compared to
that of the present invention. The Taqman.TM. response curves are
noisier and the quantification curve generated from such data
produces a lower correlation co-efficient than the present
method.
EXAMPLE 3
Identification and Quantification of Ct Plasmid Gene
[0122] FIG. 8 shows fluorescence as measured by the F3 detector as
a function of cycle number for the chlamydia system for various
concentrations of human DNA using the method of the present
invention. Each set of data shows a low-level background response
for a given number of cycles, dependent on the concentration of DNA
within the sample. Within each set of data, the observed
fluorescence increases dramatically at a certain cycle number
dependent on the concentration of human DNA in the sample.
[0123] FIG. 9 shows comparative data obtained using the Taqman.TM.
methodology of the prior art. Again, the response curves are
relatively shallow compared to those of the present invention.
Furthermore, the Taqman.TM. methodology is very slow compared to
that of the present invention.
EXAMPLE 4
Identification and Quantification of CP4 EPSPS Gene
[0124] FIG. 10 shows fluorescence as measured by the F3 detector as
a function of cycle number for the genetically modified soybean
system for various concentrations of the modified gene using the
method of the present invention. The figure also shows the
fluorescence generated by the lect system as a function of cycle
number for various concentrations of the modified gene. Within each
set of data the observed fluorescence increases dramatically at a
certain cycle number dependent on the concentration of the relevant
gene in the sample. The lect system is effectively acting as a
control, the fluorescence versus cycle number response curve as
expected being virtually independent of the concentration of the
modified gene. In the case of the modified gene system, it can be
seen that an increase in concentration of the modified gene causes
a decrease in the cycle number at which the fluorescence
dramatically increases.
[0125] FIG. 11 shows comparative data obtained using the Taqman.TM.
methodology of the prior art. Again, the response curves are
relatively shallow compared to those of the present invention.
Furthermore, the Taqman.TM. methodology is very slow compared to
that of the present invention.
[0126] It should be noted that in virtually all circumstances the
data obtained using the Taqman.TM. methodology of the prior art is
noisier than those obtained using the method of the present
invention. Furthermore, the response curves are shallower than
those of the present invention and the quantification curves
generated from the data obtained using the method of the present
invention have higher correlation co-efficients than those obtained
from the Taqman.TM. methodology.
[0127] The present invention also provides a method which is
potentially very fast. The data presented herein for the method of
the present invention were obtained using the instrumentation at
the fastest possible mode of operation. It is believed that the
relatively short probe length helps to produce a fast response. It
is thus anticipated that the speed of the present method is limited
by the current specification of the instrument on which the method
is performed.
Sequence CWU 1
1
6151DNAArtificial SequenceSynthetic 1atgccctccc ccatgccatc
ctgcgtcagc ggaaccgctc attgccaatg g 51246DNAArtificial
SequenceSynthetic 2tgccttcttt ctcgcaccaa ttgacacctg catgtgtttg
tggctt 46339DNAArtificial SequenceSynthetic 3ccttcatgtt cggcggtctc
gcatgcgcgt ttcaccgct 39439DNAArtificial SequenceSynthetic
4tcagcggcag cgtccaattc gacttgctgt tttgggccg 39538DNAArtificial
SequenceSynthetic 5ccaaacgcac ttccgccatc gtcagccaag cgccagac
38656DNAArtificial SequenceSynthetic 6tatgcttaca catttatcga
ctgggtgatt acagcttttc gtctcttttt cgcagc 56
* * * * *