Method of Immunization Against the 4 Dengue Serotypes

Barban; Veronique ;   et al.

Patent Application Summary

U.S. patent application number 12/718091 was filed with the patent office on 2010-09-02 for method of immunization against the 4 dengue serotypes. This patent application is currently assigned to SANOFI PASTEUR SA. Invention is credited to Veronique Barban, Remi Forrat, Bruno Guy, Jean Lang.

Application Number20100221285 12/718091
Document ID /
Family ID37866217
Filed Date2010-09-02

United States Patent Application 20100221285
Kind Code A1
Barban; Veronique ;   et al. September 2, 2010

Method of Immunization Against the 4 Dengue Serotypes

Abstract

The invention relates to a method for inducing a homologous protection against the 4 dengue serotypes in a patient, comprising the sequential administration, to said patient, (i) of a dose of a vaccinal dengue virus of a first serotype and of a dose of a vaccinal dengue virus of a second serotype, and (ii) of a dose of a vaccinal dengue virus of a third serotype and of a dose of a vaccinal dengue virus of a fourth serotype, in which the vaccinal dengue viruses (ii) are administered at least 30 days and at most 1 year after administration of the vaccinal viruses (i).


Inventors: Barban; Veronique; (Craponne, FR) ; Forrat; Remi; (Serezin du Rhone, FR) ; Guy; Bruno; (Lyon, FR) ; Lang; Jean; (Moins, FR)
Correspondence Address:
    MCDONNELL BOEHNEN HULBERT & BERGHOFF LLP
    300 S. WACKER DRIVE, 32ND FLOOR
    CHICAGO
    IL
    60606
    US
Assignee: SANOFI PASTEUR SA
Lyon cedex
FR

Family ID: 37866217
Appl. No.: 12/718091
Filed: March 5, 2010

Related U.S. Patent Documents

Application Number Filing Date Patent Number
11776816 Jul 12, 2007 7718357
12718091
60829361 Oct 13, 2006

Current U.S. Class: 424/218.1
Current CPC Class: A61K 39/12 20130101; A61P 31/14 20180101; Y02A 50/30 20180101; A61K 2039/5252 20130101; A61K 2039/70 20130101; A61P 31/12 20180101; A61K 2039/545 20130101; A61P 37/04 20180101; Y02A 50/386 20180101; C12N 2770/24134 20130101; A61K 2039/5254 20130101; A61K 39/00 20130101
Class at Publication: 424/218.1
International Class: A61K 39/12 20060101 A61K039/12

Foreign Application Data

Date Code Application Number
Jul 12, 2006 FR 06 06324

Claims



1. A vaccinal dengue virus kit comprising four different vaccinal dengue virus serotypes, wherein a) each vaccinal dengue virus serotype is in a separate dosage form; b) two of the four vaccinal dengue virus serotypes are combined in a single dosage form; or c) two of the four vaccinal dengue virus serotypes are combined in a first dosage form and the other two of the four dengue virus serotypes are combined in a second dosage form.

2. The vaccinal dengue virus kit according to claim 1 wherein the vaccinal dengue viruses serotypes are each present in the dosage forms in a range of from 10.sup.3 to 10.sup.5 CCID.sub.50.

3. The vaccinal dengue virus kit as claimed in claim 1 comprising two dosage forms, wherein two of the four serotypes are combined in a first dosage form and the other two of the four serotypes are combined in a second dosage form.

4. The vaccinal dengue virus kit according to claim 1, wherein one of the vaccinal dengue virus serotypes is selected from the group consisting of the VDV1 strain and of a CYD DEN-1.

5. The vaccinal dengue virus kit according to claim 1 wherein one of the vaccinal dengue virus serotypes is selected from the group consisting of the VDV2 strain and of a CYD DEN-2.

6. The vaccinal dengue virus kit according to claim 1 wherein one of the vaccinal dengue virus serotypes is the VDV1 strain and another vaccinal dengue virus serotype is the VDV2 strain.

7. The vaccinal dengue virus kit according to claim 1 wherein one of the vaccinal dengue virus serotypes is CYD DEN-1 and another vaccinal dengue virus serotype is CYD DEN-2 strain.

8. The dengue virus kit according to claim 1 wherein one of the vaccinal dengue virus serotypes is a CYD DEN-3.

9. The dengue virus kit according to claim 1 wherein one of the vaccinal dengue virus serotypes is a CYD DEN-4.

10. The dengue virus kit according to claim 1 comprising the vaccinal dengue viruses CYD DEN1, CYD DEN2, CYD DEN3, and CYD DEN4, wherein each of the CYD DEN1 and CYD DEN2 serotypes are in a dosage form where each is the only dengue virus serotype in the dosage form or the two are combined together in a single dosage form, and wherein each of the CYD DEN3 and CYD DEN4 serotypes are in a dosage form where each is the only dengue virus serotype in the dosage form or the two are combined together in a single dosage form.

11. A kit comprising two different vaccinal dengue virus serotypes, wherein a) each vaccinal dengue virus serotype is in a separate dosage form; or b) both vaccinal dengue virus serotypes are combined in a single dosage form.

12. The vaccinal dengue virus kit according to claim 11 wherein the vaccinal dengue viruses serotypes are each present in the dosage forms in a range of from 10.sup.3 to 10.sup.5 CCID.sub.50.

13. The vaccinal dengue virus kit as claimed in claim 11 comprising two dosage forms, wherein the two serotypes are combined in a single dosage form.

14. The vaccinal dengue virus kit according to claim 11, wherein one of the vaccinal dengue virus serotypes is selected from the group consisting of the VDV1 strain and of a CYD DEN-1.

15. The vaccinal dengue virus kit according to claim 11 wherein one of the vaccinal dengue virus serotypes is selected from the group consisting of the VDV2 strain and of a CYD DEN-2.

16. The vaccinal dengue virus kit according to claim 11 wherein one of the vaccinal dengue virus serotypes is the VDV1 strain and the other vaccinal dengue virus serotype is the VDV2 strain.

17. The vaccinal dengue virus kit according to claim 11 wherein one of the vaccinal dengue virus serotypes is CYD DEN-1 and the other vaccinal dengue virus serotype is CYD DEN-2 strain.

18. The vaccinal dengue virus kit according to claim 11 wherein one of the vaccinal dengue virus serotypes is a CYD DEN-3.

19. The vaccinal dengue virus kit according to claim 11 wherein one of the vaccinal dengue virus serotypes is a CYD DEN-4.

21-33. (canceled)
Description



BACKGROUND OF THE INVENTION

[0001] 1. Field of the Invention

[0002] The invention relates to a method for inducing a homologous protection against the 4 dengue serotypes in a patient, comprising the sequential administration, to said patient, (i) of a dose of a vaccinal dengue virus of a first serotype and of a dose of a vaccinal dengue virus of a second serotype, and (ii) of a dose of a vaccinal dengue virus of a third serotype and of a dose of a vaccinal dengue virus of a fourth serotype, in which the vaccinal dengue viruses (ii) are administered at least 30 days and at most 1 year after administration of the vaccinal dengue viruses (i).

[0003] 2. Summary of the Related Art

[0004] Dengue diseases are caused by four viruses of the flavivirus genus, of the serological type, which are similar but distinct from an antigenic point of view (Gubler et al., 1988 In: Epidemiology of arthropod-borne viral disease. Monath TPM, editor, Boca Raton (FL): CRC Press: 223-60; Kautner et al., 1997, J. of Pediatrics, 131:516-524; Rigau-Perez et al., 1998, Lancet; 352: 971-977; Vaughn et al., 1997, J Infect Dis; 176: 322-30). Infection with a dengue serotype can produce a clinical disease spectrum ranging from a nonspecific viral syndrome to a severe hemorrhagic disease which is fatal. The incubation period of dengue fever after a mosquito bite is approximately 4 days (ranging from 3 to 14 days). Dengue fever is characterized by a biphasic fever, headaches, pain in various parts of the body, prostration, eruptions, lymphadenopathy and leukopenia (Kautner et al., 1997, J. of Pediatrics, 131:516-524; Rigau-Perez et al., 1998, Lancet; 352: 971-977). The viremia period is the same as for febrile diseases (Vaughn et al., 1997, J. Infect. Dis.; 176: 322-30). Recovery from dengue fever occurs after 7 to 10 days, but there is usually a prolonged asthenia. Decreases in leukocyte and platelet count are common.

[0005] Hemorrhagic dengue is a severe febrile disease characterized by anomalies in homeostasis and an increase in vascular permeability which can result in hypovolemia and in hypotension (dengue with shock syndrome) often complicated by severe internal hemorrhaging. The mortality rate of hemorrhagic dengue can be up to 10% without treatment, but is 1% in most centers with experience in treatment (WHO technical Guide, 1986. Dengue haemorrhagic fever: diagnosis, treatment and control, p1-2. World Health Organization, Geneva, Switzerland).

[0006] The routine laboratory diagnosis of dengue is based on isolation of the virus and/or detection of antibodies specific for the dengue virus.

[0007] Dengue is the second most common tropical infectious disease after malaria, more than half the world's population (2.5 billion) living in regions where there is a risk of epidemic transmission. Each year, cases of dengue are estimated at 50-100 million, cases of patients hospitalized for hemorrhagic dengue at 500 000, and the number of deaths at 25 000. Dengue is endemic in Asia, in the Pacific region, in Africa, in Latin America and in the Caribbean. More than 100 tropical countries are endemic for dengue virus infections and hemorrhagic dengue has been documented in 60 of these countries (Gubler, 2002, TRENDS in Microbiology. 10:100-103; Monath, 1994, Proc. Natl. Acad. Sci.; 91: 2395-2400). A certain number of well-described factors appear to be involved in dengue: population growth; unplanned and uncontrolled urbanization, in particular in combination with poverty; an increase in air travel; the lack of effective control of mosquitoes and the deterioration of hygiene infrastructures and of public health (Gubler, 2002, TRENDS in Microbiology. 10:100-103). Individuals who travel and expatriates are increasingly warned about dengue (Shirtcliffe et al., 1998, J. Roy. Coll. Phys. Lond.; 32: 235-237). Dengue has constituted one of the main causes of febrile diseases in American troops during deployments in tropical zones endemic for dengue (DeFraites et al., 1994, MMWR 1994; 43: 845-848).

[0008] The viruses are maintained in a cycle which involves humans and Aedes aegypti, a domestic mosquito which bites during the day, and which prefers to feed off humans. The infection in humans is initiated by injection of the virus while an infected Aedes aegypti mosquito feeds on the blood. The virus in the saliva is deposited mainly in the extravascular tissues. The first category of cells infected after inoculation are dendritic cells, which then migrate to the lymph nodes (Wu et al., 2000, Nature Med.; 7:816-820). After an initial replication in the skin and in the lymph nodes, the virus appears in the blood during the acute febrile phase, generally for 3 to 5 days.

[0009] Monocytes and macrophages are, with dendritic cells, among the first targets of the dengue virus. Protection against a homotypic reinfection is complete and probably lasts for a lifetime, but crossprotection between the various dengue types lasts less than a few weeks to a few months (Sabin, 1952, Am. J. Trop. Med. Hyg.; 1: 30-50). Consequently, an individual can experience an infection with a different serotype. A second infection with dengue is in theory a risk factor for developing a severe dengue disease. However, hemorrhagic dengue is multifactorial: these factors include the strain of the virus involved, and also the age, the immune status and the genetic predisposition of the patient. Two factors play a major role in the occurrence of hemorrhagic dengue: rapid viral replication with a high viremia (the severity of the disease being associated with the level of viremia; Vaughn et al., 2000, J. Inf. Dis.; 181: 2-9) and a substantially inflammatory response with the release of high levels of inflammatory mediators (Rothman and Ennis, 1999, Virology; 257: 1-6). There is no specific treatment against dengue. The treatment for dengue fever is symptomatic with confinement to bed, control of the fever and of the pain with antipyretics and analgesics, and adequate fluid intake. The treatment for hemorrhagic dengue requires equilibration of fluid losses, replacement of clotting factors and heparin infusion.

[0010] Preventive measures are currently based on controlling the vector and taking personal protection steps which are difficult to implement and expensive. No vaccine against dengue has been approved at this time. Given that the four dengue serotypes are in circulation in the world and since they have been reported as being involved in cases of dengue hemorrhagic fever, immunization should ideally confer protection against the four serotypes of the dengue virus.

[0011] Sequential immunization strategies have previously been implemented with the aim of inducing a heterologous protection among the various dengue serotypes.

[0012] Thus, Price (1968, Am. J. Epid., 88:392-397) has described a method of sequential immunization against dengue comprising a series of two infections with dengue serotype 1 and then with dengue serotype 2, which conferred protection in a challenge test with dengue serotype 3 or 4.

[0013] Whitehead et al. (1970, Am. J. Trop. Med. Hyg., 19:94-102) sought to determine the influence of a sequential monovalent infection with two or three of the four dengue serotypes, on the conferred heterologous immunity. Gibbons were thus initially infected with a dengue virus serotype 1, 2, 3 or 4. Following a second infection with a heterologous serotype, a variable viremia was detected which was dependent on the sequence of infection and in particular on the serotype used for the first infection. More specifically, a second viremia appeared in gibbons initially infected with serotype 2, 3 or 4 and then challenged with serotype 1, 2 or 4.

[0014] Scherer et al. (1972, Am. J. Epid., 95:67-79) described a sequential monovalent infection comprising a first infection with one of the four dengue serotypes, followed by a second infection, or even a third infection, with a homologous or heterologous serotype. The proposed schemes did not make it possible to obtain a satisfactory protection against a challenge with a heterologous serotype.

[0015] Halstead et al. (1973, Am. J. Trop. Med. Hyg., 22:365-374) evaluated, in monkeys, a method of sequential immunization against dengue comprising a series of two, three or four monovalent infections with heterologous dengue serotypes 1 to 4. The authors concluded that a protection against a subsequent infection could be obtained with the immunization sequence consisting of serotypes 1, 2 then 4, followed by a challenge with serotype 3. Bivalent immunization is neither described nor suggested. Furthermore, the authors advise against sequential immunizations due to their laborious nature and to the random nature of the results generated.

[0016] Halstead et al. (1973, Am. J. Trop. Med. Hyg., 22:375-381) also found that a bivalent immunization with two heterologous dengue serotypes did not protect, or only partially protected, against an infection with a third dengue serotype.

SUMMARY OF THE INVENTION

[0017] In the context of the present invention, the objective is to induce a homologous protection against the 4 dengue serotypes. The inventors demonstrated that it is possible to generate an immune response comprising antibodies which neutralize the 4 serotypes when the latter are administered sequentially in pairs.

[0018] The inventors have in particular shown that a DEN-1,2 bivalent immunization followed two months later by a DEN-3,4 bivalent immunization induces high responses against the four serotypes in all the monkeys immunized. The immune response thus generated is quantitatively and qualitatively greater (covers all the serotypes).

DETAILED DESCRIPTION OF THE INVENTION

[0019] According to a first subject, the present invention therefore relates to vaccinal compositions comprising (i) a dose of a vaccinal dengue virus of a first serotype and a dose of a vaccinal dengue virus of a second serotype, and (ii) a dose of a vaccinal dengue virus of a third serotype and a dose of a vaccinal dengue virus of a fourth serotype, as a combination vaccinal composition against dengue for sequential administration, in which the vaccinal dengue viruses (ii) are administered at least 30 days and at most 1 year after the administration of the vaccinal dengue viruses (i).

[0020] According to one embodiment of the vaccinal compositions according to the invention, the vaccinal viruses (ii) are administered 30 days to 3 months after the administration of the vaccinal viruses (i).

[0021] According to another specific embodiment of the vaccinal compositions according to the invention, the vaccinal viruses (ii) are administered 30 days after the administration of the vaccinal viruses (i).

[0022] According to another embodiment of the vaccinal compositions according to the invention, the vaccinal dengue viruses (i) are administered in the form of a bivalent vaccinal composition.

[0023] According to another embodiment of the vaccinal compositions according to the invention, the vaccinal dengue viruses (ii) are administered in the form of a bivalent vaccinal composition.

[0024] According to one specific embodiment of the vaccinal compositions according to the invention, said vaccinal dengue virus serotype 1 is selected from the group consisting of the VDV1 strain and of a Chimerivax.TM. DEN-1.

[0025] According to another specific embodiment of the vaccinal compositions according to the invention, said vaccinal dengue virus serotype 2 is selected from the group consisting of the VDV2 strain and of a Chimerivax.TM. DEN-2.

[0026] According to another specific embodiment of the vaccinal compositions according to the invention, said vaccinal dengue virus serotype 1 is the VDV1 strain and said vaccinal dengue virus serotype 2 is the VDV2 strain.

[0027] According to another specific embodiment of the vaccinal compositions according to the invention, said vaccinal dengue virus serotype 1 is a Chimerivax.TM. DEN-1 and said vaccinal dengue virus serotype 2 is a Chimerivax.TM. DEN-2.

[0028] According to another specific embodiment of the vaccinal compositions according to the invention, said vaccinal dengue virus serotype 3 is a Chimerivax.TM. DEN-3.

[0029] According to another specific embodiment of the vaccinal compositions according to the invention, said vaccinal dengue virus serotype 4 is a Chimerivax.TM. DEN-4.

[0030] According to another specific embodiment of the vaccinal compositions according to the invention, the first and second serotypes are, respectively, CYD DENT and CYD DEN2 and the third and fourth serotypes are, respectively, CYD DEN3 and CYD DEN 4.

[0031] According to another specific embodiment of the vaccinal compositions according to the invention, the doses of vaccinal dengue viruses serotypes 1, 2, 3 and 4 are each within a range of from 10.sup.3 to 10.sup.5 CCID.sub.50.

[0032] A subject of the invention is also the use of a vaccinal dengue virus of a third serotype and of a vaccinal dengue virus of a fourth serotype, for the manufacture of a dengue vaccine intended to be administered to a patient who has received, at least 30 days and at most 1 year beforehand, a dose of a vaccinal dengue virus of a first serotype and a dose of a vaccinal dengue virus of a second serotype.

[0033] According to another specific embodiment of the use according to the invention, the third and fourth serotypes are administered in the form of a bivalent vaccinal composition.

[0034] According to another specific embodiment of the use according to the invention, the first and second serotypes are administered in the form of a bivalent vaccinal composition.

[0035] According to another specific embodiment of the use according to the invention, said vaccinal dengue virus serotype 1 is selected from the group consisting of the VDV1 strain and a Chimerivax.TM. DEN-1.

[0036] According to another specific embodiment of the use according to the invention, said vaccinal dengue virus serotype 2 is selected from the group consisting of the VDV2 strain and a Chimerivax.TM. DEN-2.

[0037] According to another specific embodiment of the use according to the invention, said vaccinal dengue virus serotype 1 is the VDV1 strain and said vaccinal dengue virus serotype 2 is the VDV2 strain.

[0038] According to another specific embodiment of the use according to the invention, said vaccinal dengue virus serotype 1 is a Chimerivax.TM. DEN-1 and said vaccinal dengue virus serotype 2 is a Chimerivax.TM. DEN-2.

[0039] According to another specific embodiment of the use according to the invention, said vaccinal dengue virus serotype 3 is a Chimerivax.TM. DEN-3.

[0040] According to another specific embodiment of the use according to the invention, said vaccinal dengue virus serotype 4 is a Chimerivax.TM. DEN-4.

[0041] According to another specific embodiment of the use according to the invention, the first and second serotypes are, respectively, CYD DENT and CYD DEN2 and the third and fourth serotypes are, respectively, CYD DEN3 and CYD DEN4.

[0042] According to another specific embodiment of the use according to the invention, the third and fourth serotypes are administered 30 days to 3 months after the administration of the first and second serotypes.

[0043] According to another specific embodiment of the use according to the invention, the third and fourth serotypes are administered 30 days after the administration of the first and second serotypes.

[0044] According to another specific embodiment of the use according to the invention, the doses of vaccinal dengue viruses serotypes 1, 2, 3 and 4 are each within a range of from 10.sup.3 to 10.sup.5 CCID.sub.50.

[0045] According to another aspect, the invention comprises a vaccinal dengue virus kit comprising four different vaccinal dengue virus serotypes, wherein [0046] a) each vaccinal dengue virus serotype is in a separate dosage form; [0047] b) two of the four vaccinal dengue virus serotypes are combined in a single dosage form; or [0048] c) two of the four vaccinal dengue virus serotypes are combined in a first dosage form and the other two of the four dengue virus serotypes are combined in a second dosage form.

[0049] Preferably, the vaccinal dengue viruses serotypes are each present in the dosage forms in a range of from 10.sup.3 to 10.sup.5 CCID.sub.50.

[0050] Also preferably, the vaccinal dengue virus kit comprises two dosage forms, wherein two of the four serotypes are combined in a first dosage form and the other two of the four serotypes are combined in a second dosage form.

[0051] In some embodiments of this aspect of the invention, one of the vaccinal dengue virus serotypes is selected from the group consisting of the VDV1 strain and of a CYD DEN-1.

[0052] In some embodiments of this aspect of the invention, one of the vaccinal dengue virus serotypes is selected from the group consisting of the VDV2 strain and of a CYD DEN-2.

[0053] In some embodiments of this aspect of the invention, one of the vaccinal dengue virus serotypes is the VDV1 strain and another vaccinal dengue virus serotype is the VDV2 strain.

[0054] In some embodiments of this aspect of the invention, one of the vaccinal dengue virus serotypes is CYD DEN-1 and another vaccinal dengue virus serotype is CYD DEN-2 strain.

[0055] In some embodiments of this aspect of the invention, one of the vaccinal dengue virus serotypes is a CYD DEN-3.

[0056] In some embodiments of this aspect of the invention, one of the vaccinal dengue virus serotypes is a CYD DEN-4.

[0057] In one embodiment of this aspect of the invention, the dengue virus kit comprises the vaccinal dengue viruses CYD DEN.TM., CYD DEN2, CYD DEN3, and CYD DEN4, wherein each of the CYD DEN.TM. and CYD DEN2 serotypes are in a dosage form where each is the only dengue virus serotype in the dosage form or the two are combined together in a single dosage form, and wherein each of the CYD DEN3 and CYD DEN4 serotypes are in a dosage form where each is the only dengue virus serotype in the dosage form or the two are combined together in a single dosage form.

[0058] According to another aspect, the invention comprises a kit comprising two different vaccinal dengue virus serotypes, wherein [0059] a) each vaccinal dengue virus serotype is in a separate dosage form; or [0060] b) both vaccinal dengue virus serotypes are combined in a single dosage form.

[0061] Preferably in this aspect of the invention, the vaccinal dengue viruses serotypes are each present in the dosage forms in a range of from 10.sup.3 to 10.sup.5 CCID.sub.50.

[0062] Also preferably in this aspect of the invention, the two serotypes are combined in a single dosage form.

[0063] In some embodiments of this aspect of the invention, one of the vaccinal dengue virus serotypes is selected from the group consisting of the VDV1 strain and of a CYD DEN-1.

[0064] In some embodiments of this aspect of the invention, one of the vaccinal dengue virus serotypes is selected from the group consisting of the VDV2 strain and of a CYD DEN-2.

[0065] In some embodiments of this aspect of the invention, one of the vaccinal dengue virus serotypes is the VDV1 strain and the other vaccinal dengue virus serotype is the VDV2 strain.

[0066] In some embodiments of this aspect of the invention, one of the vaccinal dengue virus serotypes is CYD DEN-1 and the other vaccinal dengue virus serotype is CYD DEN-2 strain.

[0067] In some embodiments of this aspect of the invention, one of the vaccinal dengue virus serotypes is a CYD DEN-3.

[0068] In some embodiments of this aspect of the invention, one of the vaccinal dengue virus serotypes is a CYD DEN-4.

[0069] In another aspect, the invention comprises a method of preventing or inhibiting a dengue virus infection comprising: [0070] a) in a first administration administering to a subject an effective amount of a first and second vaccinal dengue virus serotype; and [0071] b) in a second administration administering to the subject an effective amount of a third and fourth vaccinal dengue virus serotype

[0072] wherein [0073] i) the first, second, third, and fourth vaccinal dengue virus serotypes are each different one from another; [0074] ii) the second administration occurs from about 30 days to about 1 year after the first administration; [0075] iii) each vaccinal dengue virus serotypes is administered in an amount that is sufficient to induce a homologous immune response; [0076] iv) the first and second serotypes are administered in separate dosages forms or together in a single dosage form; and [0077] v) the third and fourth serotypes are administered in separate dosages forms or together in a single dosage form.

[0078] In some embodiments of this aspect of the invention, the third and fourth serotypes are administered in a single dosage form.

[0079] In some embodiments of this aspect of the invention, the first and second serotypes are administered in a single dosage form.

[0080] In some embodiments of this aspect of the invention, the first or second vaccinal dengue virus serotype is selected from the group consisting of the VDV1 strain and of a CYD DEN-1.

[0081] In some embodiments of this aspect of the invention, the first or second vaccinal dengue virus serotype is selected from the group consisting of the VDV2 strain and of a CYD DEN-2.

[0082] In some embodiments of this aspect of the invention, the first vaccinal dengue virus serotype is the VDV1 strain and the second vaccinal dengue virus serotype is the VDV2 strain.

[0083] In some embodiments of this aspect of the invention, the first vaccinal dengue virus serotype is a CYD DEN-1 and the second vaccinal dengue virus serotype 2 is a CYD DEN-2.

[0084] In some embodiments of this aspect of the invention, the third vaccinal dengue virus serotype is a CYD DEN-3.

[0085] In some embodiments of this aspect of the invention, the fourth vaccinal dengue virus serotype 4 is a CYD DEN-4.

[0086] In some embodiments of this aspect of the invention, first and second serotypes are CYD DENT and CYD DEN2 and the third and fourth serotypes are CYD DEN3 and CYD DEN4.

[0087] In some embodiments of this aspect of the invention, the third and fourth serotypes are administered 30 days to 3 months after the administration of the first and second serotypes.

[0088] In some embodiments of this aspect of the invention, the third and fourth serotypes are administered 30 days after the administration of the first and second serotypes.

[0089] In some embodiments of this aspect of the invention, the dosage forms comprise the vaccinal dengue viruses serotypes in a range of from 10.sup.3 to 10.sup.5 CCID.sub.50.

[0090] The invention will be described in further detail in the description which follows.

DEFINITIONS

[0091] "Dengue viruses" or "DENs" are positive, single-stranded RNA viruses belonging to the Flavivirus genus of the flaviviridae family. The genomic RNA contains a type I cap at the 5' end but lacks a poly-A tail at the 3' end. The genomic organization consists of the following elements: 5' noncoding region (NCR), structural proteins (capsid (C), premembrane/membrane (prM/M), envelope (E)) and nonstructural proteins (NS1-NS2A-NS2B-NS3-NS4A-NS4B-NS5), and 3' NCR. The genomic viral RNA is associated with the capsid proteins so as to form a nucleocapsid. As for the other flaviviruses, the DEN viral genome encodes an uninterrupted coding region which is translated into a single polyprotein.

[0092] "VDV" or "Vero dengue vaccine" denotes a live attenuated dengue viral strain adapted on Vero cells and capable of inducing a specific humoral response, including the induction of neutralizing antibodies, in primates and in particular in humans.

[0093] "VDV-1" is a strain obtained from a wild-type strain DEN-1 16007 which was subjected to 11 passages on PDK cells (DEN-1 16007/PDK11), which was then amplified on Vero cells at 32.degree. C., and the RNA of which was purified and transfected into Vero cells. The VDV-1 strain has 14 additional mutations compared to the vaccinal strain DEN-1 16007/PDK13 (13 passages on PDK--Primary Dog Kidney--cells). The DEN-1 16007/PDK13 strain, also called "LAV1", was described in patent application EP1159968 in the name of Mahidol University and was deposited with the Collection Nationale de Cultures de Microorganismes (CNCM) [National Collection of Microorganism Cultures] under the number 1-2480. The complete sequence of the VDV-1 strain is given in the sequence SEQ ID NO:1. Said strain can be readily reproduced from said sequence. A method of preparation and the characterization of the VDV-1 strain have been described in the International patent application filed under the names of Sanofi-Pasteur and of the Center for Disease Control and Prevention under the number PCT/IB 2006/001313.

[0094] "VDV-2" is a strain obtained from a wild-type strain DEN-2 16681 which was subjected to 50 passages on PDK cells (DEN-2 16681/PDK50), and plaque-purified, and the RNA of which was extracted and purified before being transfected into Vero cells. The VDV-2 strain was then obtained by plaque-purification and amplification on Vero cells. The VDV-2 strain has 10 additional mutations compared with the vaccinal strain DEN-2 16681/PDK53 (53 passages on PDK cells), 4 mutations of which are silent. The DEN-2 16681/PDK53 strain, also called "LAV2", was described in patent application EP1159968 in the name of Mahidol University and was deposited with the Collection Nationale de Cultures de Microorganismes (CNCM) under the number 1-2481. The complete sequence of the VDV-2 strain is shown in the sequence SEQ ID NO:2. The VDV-2 strain can be readily reproduced from said sequence. A method of preparation and of characterization of the VDV-2 strain has been described in the International patent application filed in the names of Sanofi-Pasteur and of the Center for Disease Control and Prevention under the number PCT/IB 2006/001513.

[0095] As used herein the terms "ChimeriVax.TM. dengue" and "CYD" are equivalent and denote a chimeric yellow fever (YF) virus which comprises the backbone of a YF virus in which the sequences encoding the premembrane and envelope proteins have been replaced with those of a DEN virus. The term "CYD-1 or CYD DEN1" is thus used to describe a chimeric YF virus containing the prM and E sequences of a dengue serotype 1 strain (DEN-1). The term "CYD-2 or CYD DEN2" is used to describe a chimeric YF virus containing the prM and E sequences of a DEN-2 strain. The term "CYD-3 or CYD DEN3" is used to describe a chimeric YF virus containing the prM and E sequences of a DEN-3 strain. The term "CYD-4 or CYD DEN4" is used to describe a chimeric YF virus containing the prM and E sequences of a DEN-4 strain. The preparation of these ChimeriVax.TM. or CYD dengues has been described in detail in International patent applications WO 98/37911 and WO 03/101397, to which reference may be made for a precise description of the method for preparing them. The chimeras described in the examples were generated using the prM and E sequences derived from the DENT PUO359, DEN2 PR 159, DEN3 PaH881 and DEN4 TVP 980 strains. Any strain of the dengue virus could be used in the context of the present invention for the construction of the chimeras.

[0096] Preferably, the chimeric YF virus comprises the backbone of an attenuated yellow fever strain YF17D (Theiler M, and Smith HH (1937) J Exp. Med 65, p 767-786.) (YF17D/DEN-1, YF17D/DEN-2, YF17D/DEN-3, YF17D/DEN-4 virus). Examples of YF17D strains which can be used include YF17D204 (YF-Vax.RTM., Sanofi-Pasteur, Swifwater, Pa., USA; Stamaril.RTM., Sanofi-Pasteur, Marcy l'Etoile, France; ARILVAX.TM., Chiron, Speke, Liverpool, UK; FLAVIMUN.RTM., Berna Biotech, Bern, Switzerland); YF17D-204 France (X15067, X15062); YF17D-204,234 US (Rice et al., 1985, Science, 229:726-733), or else related strains YF17DD (Genbank accession number U17066), YF17D-213 (Genbank accession number U17067) and the YF17DD strains described by Galler et al. (1998, Vaccines 16(9/10):1024-1028). Any other yellow fever virus strain sufficiently attenuated for use in humans can be used.

[0097] A "monovalent" vaccine contains a single dengue virus serotype. A "bivalent" vaccine contains two different dengue virus serotypes. A "trivalent" vaccine contains three different dengue virus serotypes. A "tetravalent" vaccine contains four different dengue virus serotypes.

[0098] The term "patient" denotes an individual (child or adult) who may be infected with dengue, in particular an individual at risk of infection, such as, for example, an individual who travels in regions where dengue is present or an inhabitant of these regions.

Sequential Immunization

[0099] The inventors have shown that the administration of the 4 serotypes in the form of two sequential bivalent administrations makes it possible to obtain an effective homologous protection against the 4 serotypes. The method according to the present invention is therefore most particularly valuable in the context of an immunization strategy against dengue.

[0100] The inventors therefore propose a method for inducing a neutralizing antibody response against the 4 dengue serotypes in a patient, comprising the sequential administration, to said patient, (i) of a dose of a vaccinal dengue virus of a first serotype and of a dose of a vaccinal dengue virus of a second serotype, and (ii) of a dose of a vaccinal dengue virus of a third serotype and of a dose of a vaccinal dengue virus of a fourth serotype, in which the vaccinal dengue viruses (ii) are administered at least 30 days and at most 3 months after administration of the vaccinal dengue viruses (i). The administration of the first and second serotypes can be in separate dosages forms or a single, combined dosage form. Similarly, the administration of the third and fourth serotypes can be in separate dosages forms or a single, combined dosage forms. As used herein a "dosage form" is a composition comprising a dengue serotype together with a pharmaceutically acceptable carrier, diluent, or excipient. The pharmaceutically acceptable carrier, diluent, or excipient can be any known in the art that is suitable for combination with a vaccinal dengue virus.

[0101] The vaccinal dengue virus is intended to mean any viral form of dengue virus that is able to induce a specific homologous immune response. Preferably such vaccinal dengue virus can be used in the context of an immunization program in humans against an infection with a dengue virus.

[0102] By vaccinal dengue virus we mean an inactivated virus, an attenuated virus, as well as recombinant proteins such as the envelope proteins of the dengue virus. A vaccinal virus is "inactivated" if it is no longer able to replicate on permissive cells.

[0103] A vaccinal virus is "attenuated" if after growth at 37.degree. C. or 39.degree. C. on Huh-7, VERO and/or C6/C36. Such a vaccinal virus shows a maximal titer that is at least 10 times less than the maximal titer of the wild type in the same culture condition, using the same titration method.

[0104] A vaccinal virus showing a decreased growth on at least one of the 3 cell types identified above is deemed to be attenuated within the framework of the present invention.

[0105] A vaccinal virus usable in humans shows a positive benefit to risk ratio, which will generally satisfy regulatory requirements for obtaining market authorization.

[0106] A vaccinal dengue virus for use in the invention is preferably attenuated to such an extent that it does not induce the disease in humans. Advantageously, such a vaccinal virus results only in side effects that are at most of moderate intensity (i.e., medium to low, or even zero) in the majority of individuals vaccinated, while at the same time maintaining its ability to induce a homologous neutralizing antibody response.

[0107] Non-limiting example of vaccinal dengue virus to be used in the present invention include, but are not limited to, inactivated dengue virus, attenuated dengue virus such as attenuated strains VDV1, VDV2, strains described in, for example, WO 02/66621, WO 00/57904, WO 00/57908, WO 00/57909, WO00/57910, WO 02/0950075, and WO 02/102828 and chimeras.

[0108] Chimeric viruses show the attenuated features of the attenuated virus as defined above.

[0109] Any chimera virus expressing the envelope protein of a dengue virus and inducing an immune response comprising antibody neutralizing the serotype from which the protein comes from can be used in the present invention. Non-limiting examples include, for example, chimeras Chimerivax' dengues as described, for example, in patent application WO 98/37911, and the dengue/dengue chimeras as described, for example, in patent applications WO 96/40933 and WO 01/60847.

[0110] The vaccinal dengue virus serotype 1 can, for example, be the vaccinal strain VDV1 or a Chimerivax.TM. DEN-1, in particular a YF17D/DEN-1 virus, or else a DEN-1 16007/PDK13 strain. The vaccinal dengue virus serotype 2 can, for example, be the vaccinal strain VDV2 or a Chimerivax.TM. DEN-2, in particular a YF17D/DEN-2 virus, or else a DEN-2 16681/PDK53 virus. The vaccinal dengue virus serotype 3 can be a Chimerivax.TM. DEN-3, in particular a YF17D/DEN-3 virus. The vaccinal dengue virus serotype 4 can be a Chimerivax.TM. DEN-4, in particular a YF17D/DEN-4 virus. It can also be a "LAV4" or "DEN-4 1036/PDK48" strain, i.e. a DEN-4 1036 strain attenuated by 48 passages on PDK cells. This strain was described in patent application EP1159968 in the name of Mahidol University and was deposited with the Collection Nationale de Cultures de Microorganismes (CNCM) under the number 1-2483.

[0111] Each Chimerivax.TM. monovalent vaccinal dengue virus (serotypes 1, 2, 3 and 4) was prepared by amplification of each serotype on Vero cells. More specifically, the four viruses are produced separately on adherent Vero cells in serum-free medium. The viral harvest, clarified to remove the cell debris by filtration, is then concentrated and purified by ultrafiltration and chromatography in order to remove the DNA of the host cells. After the addition of a stabilizer, the vaccinal strains are stored in frozen or lyophilized form before use, and then reconstituted extemporaneously. The same method is applied for the four chimeras.

[0112] The VDV1 and 2 strains are prepared by amplification on Vero cells. The viruses produced are harvested and clarified to remove the cell debris by filtration. The DNA is digested by enzymatic treatment. The impurities are eliminated by ultrafiltration. The infectious titers can be increased by means of a method of concentration. After the addition of a stabilizer, the strains are stored in a lyophilized or frozen form before use, and then reconstituted extemporaneously.

[0113] The multivalent compositions are obtained by simple mixing of the monovalent compositions.

[0114] According to the present invention, the 4 dengue serotypes can be administered in any order provided that they are administered in pairs sequentially, within a period of 30 days to 1 year, such as 30 days, 45 days, 60 days, 3 months, 6 months, 9 months and 1 year, being observed, advantageously a period of 30 days to 3 months, in particular a period of 1 to 2 months, being observed between the two series of administrations.

[0115] The method according to the present invention can therefore be implemented with the embodiments described below: [0116] (i) serotypes 1 and 2; (ii) serotypes 3 and 4; or [0117] (i) serotypes 1 and 3; (ii) serotypes 2 and 4; or [0118] (i) serotypes 1 and 4; (ii) serotypes 2 and 3; or [0119] (i) serotypes 2 and 3; (ii) serotypes 1 and 4; or [0120] (i) serotypes 2 and 4; (ii) serotypes 1 and 3; or [0121] (i) serotypes 3 and 4; (ii) serotypes 1 and 2.

[0122] According to specific embodiments the present invention therefore covers the following schemes: [0123] (i) CYD DEN-1 and CYD DEN-2; (ii) CYD DEN-3 and CYD DEN-4 [0124] (i) CYD DEN-1 and CYD DEN-3; (ii) CYD DEN-2 and CYD DEN-4 [0125] (i) CYD DEN-1 and CYD DEN-4; (ii) CYD DEN-2 and CYD DEN-3 [0126] (i) CYD DEN-2 and CYD DEN-3; (ii) CYD DEN-1 and CYD DEN-4 [0127] (i) CYD DEN-2 and CYD DEN-4; (ii) CYD DEN-1 and CYD DEN-3 [0128] (i) CYD DEN-3 and CYD DEN-4; (ii) CYD DEN-1 and CYD DEN-2 [0129] (i) VDV-1 and CYD DEN-2; (ii) CYD DEN-3 and CYD DEN-4 [0130] (i) VDV-1 and CYD DEN-3; (ii) CYD DEN-2 and CYD DEN-4 [0131] (i) VDV-1 and CYD DEN-4; (ii) CYD DEN-2 and CYD DEN-3 [0132] (i) CYD DEN-2 and CYD DEN-3; (ii) VDV-1 and CYD DEN-4 [0133] (i) CYD DEN-2 and CYD DEN-4; (ii) VDV-1 and CYD DEN-3 [0134] (i) CYD DEN-3 and CYD DEN-4; (ii) VDV-1 and CYD DEN-2 [0135] (i) CYD DEN-1 and VDV-2; (ii) CYD DEN-3 and CYD DEN-4 [0136] (i) CYD DEN-1 and CYD DEN-3; (ii) VDV-2 and CYD DEN-4 [0137] (i) CYD DEN-1 and CYD DEN-4; (ii) VDV-2 and CYD DEN-3 [0138] (i) VDV-2 and CYD DEN-3; (ii) CYD DEN-1 and CYD DEN-4 [0139] (i) VDV-2 and CYD DEN-4; (ii) CYD DEN-1 and CYD DEN-3 [0140] (i) CYD DEN-3 and CYD DEN-4; (ii) CYD DEN-1 and VDV-2 [0141] (i) VDV-1 and VDV-2; (ii) CYD DEN-3 and CYD DEN-4 [0142] (i) VDV-1 and CYD DEN-3; (ii) VDV-2 and CYD DEN-4 [0143] (i) VDV-1 and CYD DEN-4; (ii) VDV-2 and CYD DEN-3 [0144] (i) VDV-2 and CYD DEN-3; (ii) VDV-1 and CYD DEN-4 [0145] (i) VDV-2 and CYD DEN-4; (ii) VDV-1 and CYD DEN-3 [0146] (i) CYD DEN-3 and CYD DEN-4; (ii) VDV-1 and VDV-2.

[0147] In the context of the present invention, the term "dose of vaccinal virus" is intended to mean a composition comprising an "immunoeffective amount" of the vaccinal virus, i.e. an amount of virus sufficient to induce a homologous neutralizing antibody response, which can be demonstrated, for example, by means of the seroneutralization test as described below in example 1. A serum is considered to be positive for the presence of neutralizing antibodies when the neutralizing antibody titer thus determined is greater than or equal to 1:10.

[0148] Vaccinal strain amounts are commonly expressed in terms of viral plaque-forming units (PFU) or of 50% tissue culture infectious dose (TCID.sub.50), or else of 50% cell culture infectious dose (CCID.sub.50). For example, the compositions according to the invention can contain from 10 to 10.sup.6 CCID.sub.50, in particular from 10.sup.3 to 10.sup.5 CCID.sub.50 of vaccinal dengue virus serotype 1, 2, 3 or 4 for a monovalent or bivalent composition. Thus, in the compositions or use according to the invention, the doses of vaccinal dengue viruses serotypes 1, 2, 3 and 4 are preferably each within a range of from 10 to 10.sup.6 CCID.sub.50, such as 10, 10.sup.1, 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5 or 10.sup.6 CCID.sub.50, in particular in a range from 10.sup.3 to 10.sup.5 CCID.sub.50. The vaccinal viruses can be used at identical or different doses, which can be adjusted according to the nature of the vaccinal virus used and to the strength of the immune response obtained.

[0149] Preferably, the homologous neutralizing antibody response is long-lasting, i.e. it can be detected in the serum at least 6 months, after administration of the dengue serotypes (ii).

[0150] In the sequential administration according to the invention, the vaccinal dengue viruses of the third and fourth serotypes are administered at least 30 days and at most 12 months after the administration of the vaccinal dengue viruses of the first and second serotypes.

[0151] In the context of the present invention, the vaccinal dengue viruses of the third and fourth serotypes can, for example, be administered 30 days to 1 year, for example 30 days, 45 days, 60 days, 3 months, 6 months, 9 months or 1 year, advantageously 30 days to 3 months, in particular 1 to 2 months, after the administration of the vaccinal dengue viruses of the first and second serotypes.

[0152] The dose of a vaccinal dengue virus of a first serotype and the dose of a vaccinal dengue virus of a second serotype are administered simultaneously in the form of two monovalent compositions, or in the form of a single bivalent composition.

[0153] Similarly, the dose of a vaccinal dengue virus of a third serotype and the dose of a vaccinal dengue virus of a fourth serotype are administered simultaneously. For example, the third and fourth serotypes can be administered simultaneously in the form of two monovalent vaccinal compositions, or in the form of a single bivalent vaccinal composition.

[0154] The vaccinal viruses are administered in the form of vaccinal compositions which can be prepared according to any method known to those skilled in the art. Usually, the viruses, generally in lyophilized form, are mixed with a pharmaceutically acceptable excipient, such as water or a phosphate buffered saline solution, wetting agents or stabilizers. The term "pharmaceutically acceptable excipient" is intended to mean any solvent, dispersing medium, filler, etc., which does not produce a side reaction, for example an allergic reaction, in humans or animals. The excipient is selected according to the pharmaceutical form chosen, and to the method and route of administration. Appropriate excipients and also the requirements in terms of pharmaceutical formulation are described in "Remington: The Science & Practice of Pharmacy", which represents a reference work in the field.

[0155] Preferably, the vaccinal compositions are prepared in an injectable form, and can correspond to liquid solutions, suspensions or emulsions. The compositions can in particular include an aqueous solution buffered so as to maintain a pH of between approximately 6 and 9 (as determined with a pH meter at ambient temperature).

[0156] Although it is not necessary to add an adjuvant, the compositions can nevertheless include such a compound, i.e. a substance which increases, stimulates or strengthens the cellular or humoral immune response induced by the vaccinal strain administered simultaneously. Those skilled in the art are in a position to select, from the adjuvants conventionally used in the field of vaccines, an adjuvant which may be suitable in the context of the present invention.

[0157] The vaccinal compositions according to the invention can be administered according to any route normally used in immunization, for example parenterally (in particular intradermally, subcutaneously or intramuscularly). Preferably, the vaccinal compositions are injectable compositions administered subcutaneously in the deltoid region.

[0158] The volume of composition administered depends on the route of administration. For subcutaneous injections, the volume is generally between 0.1 and 1.0 ml, preferably approximately 0.5 ml.

[0159] The optimal period for the administration of the first and second serotypes, or preferably of all the serotypes 1 to 4, is approximately 1 to 3 months before exposure to the dengue virus. The vaccines can be administered as a prophylactic treatment for infection with a dengue virus in adults and children. Target populations therefore include individuals who may be naive (i.e. not previously immunized) or non-naive with respect to the dengue virus.

[0160] Vaccinal dengue virus serotypes 1 to 4 booster administrations can also be carried out, for example, between 6 months and 10 years, for example 6 months, 1 year, 3 years, 5 years or 10 years, after administration of the third and fourth serotypes.

[0161] The invention is illustrated by means of the following examples. All publications referred to herein are hereby incorporated by reference in their entirety.

EXAMPLES

Example 1

Sequential Immunization in Monkeys

[0162] The viremia and the immunogenicity were therefore tested in a monkey model. The viremia, in particular, was identified as one of the factors associated with the virulence and the severity of the disease in man and therefore constitutes an important parameter to be taken into consideration. The immunogenicity is, for its part, a key parameter in the context of the evaluation of the protection conferred.

[0163] 1.1 Materials and Methods:

[0164] The experiments in monkeys were carried out according to the European Directives relating to animal experimentation. The immunizations were carried out in cynomolgus monkeys (Macaca fascicularis) originating from Mauritania. The monkeys were placed in quarantine for six weeks before immunization.

[0165] The monkeys were immunized subcutaneously in the arm(s) with 0.5 ml of vaccinal composition. After a light anesthesia with ketamine (Imalgene, Merial), blood was collected by puncture from the inguinal or saphenous veins. At day 0 and 28, 5 ml of blood were sampled in order to evaluate the antibody responses, while, between days 2 and 10, 1 ml of blood was sampled in order to evaluate the viremia. The blood was collected on ice and stored on ice until serum separation. To do this, the blood was centrifuged for 20 minutes at 4.degree. C. and the serum collected was stored at -80.degree. C. until the time of the tests.

Measurement of Viremia

[0166] The post-vaccinal viremias were monitored by quantitative real-time RP-PCR (qRT-PCR). Two sets of primers and of probes located in the NS5 gene of the DENT and DEN2 strains were used to quantify the VDV-1 RNA and VDV-2 RNA, respectively. A third set of primers and of probes located in the NS5 gene of the YF virus was used to quantify the CYD RNA. Finally, 4 sets of primers and of probes specific for the various serotypes, located at the junction of the E (DEN)/NS1 (YF) genes were used to identify the serotype in the samples positive for the YF NS5 RNA (see also table I). 7 plasmids containing, under the control of the T7 promoter, the region targeted by each PCR were transcribed in vitro so as to generate a series of synthetic RNAs which were included as an internal reference in each RT-PCR assay. These synthetic RNAs were assayed by spectrophotometry, and the amount of RNA obtained was converted to number of RNA copies and expressed as GEQ (genomic equivalents).

[0167] 0.140 ml of monkey serum was extracted using the Macherey Nagel "Nucleospin 96 Virus.TM." RNA extraction kit, according to the manufacturer's instructions, and then the purified RNA was eluted with 0.140 ml (0.090 ml, then 0.05 ml) of RNase-free water. In order to avoid repeated freezing/thawing cycles, a first quantification was carried out immediately after the extraction, on 5 .mu.l of said RNA preparation. The remaining volume was frozen at 70.degree. C.

[0168] The reaction mixtures contained, in addition to the components of the "Qiagen Qauntitect.TM. probes" RT-PCR quantification kit (Qiagen), 10 picomol of each primers, 4 picomol of each probe and 5 .mu.l of RNA, in the total volume of 25 .mu.l. In the case of the RNAs to be tested, 5 .mu.l of the purified preparation were directly introduced into the reaction mixture, without any prior dilution step. The synthetic RNAs were diluted to 1/10 in RNAse-free water, and 7 dilutions containing approximately 10 to 10.sup.6 GEQ in 5 .mu.l were quantified in parallel in order to generate the standard curve.

[0169] The quantification reactions were carried out on the Applied Biosystem ABIPrism 700.TM. device, using the following program: 50.degree. C./30 min, 95.degree. C./15 min, then 40 cycles of 95.degree. C./15 sec-60.degree. C./60 sec.

[0170] The limit of quantification of the viral RNA in this test is from 2.9 to 3.3 log.sub.10GEQ/ml (800 to 2000 GEQ/ml; 4 to 10 GEQ/reaction), according to the PCR targets (standard deviation: +/-0.3 log.sub.10).

[0171] The correlation between the infectious titer and the viral RNA quantification was established in parallel to the assays, by analysis of 0.140 ml of negative monkey serum samples (DO) to which a known amount of infectious particles of the viruses which were used for the immunization (CYD or VDV) were added. Said control sera were prepared at two dilutions containing approximately 1 PFU and approximately 100 PFU in 5 .mu.l (2.3 and 4.3 log.sub.10PFU/ml, respectively).

[0172] The primers and probes used are given in table 1 below, in which are listed, in order, for each assay, the sense and antisense primers and the probe.

TABLE-US-00001 TABLE 1 sequence Y YF-NS5 sense 5' GCACGGATGTAACAGACTGAAGA (23 bases) F YF NS5 anti 5' CCAGGCCGAACCTGTCAT (18 bases) YF-NS5 5' Fam- CGACTGTGTGGTCCGGCCCATC-Tamra (22 bases) CYD1 CYD1- sense 5' CAT TGC AGT TGG CCT GGT AA (20 b) spe CYD1- anti 5' CTT TGG CAA GAG AGA GCT CAA GT (23 b) CYD1- 5' Fam-CCG ATC AAG GAT GCG CCA TCA-Tamra (21 b) CYD2 CYD2- sense 5' GTG GGA GTC GTG ACG CTG TA (20 b) spe CYD2- anti 5' GTT GAT GGC GCA TCC TTG ATC (21 b) CYD2 5' Fam-TGG GAG TTA TGG TGG GCG CCG-Tamra (21 b) CYD3 CYD3- sense 5' AAA ACA CTT CCA TGT CAT TTT CAT G (25b) spe CYD3- anti 5' GTT GAT GGC GCA TCC TTG ATC (21 b) CYD3- 5'Fam-TGCGATAGGAATTATCACACTCTATCTGGGAGC-Tamra (33b) CYD4 CYD4- sense 5' CTT AGT ATT GTG GAT TGG CAC GAA (24 b) spe CYD4- anti 5' GCG CCA ACT GTG AAA CCT AGA (21 b) CYD4- 5'-Fam-AGAAACACTTCAATGGCAATGACGTGCAT-Tamra (29 b) VDV1 VDV1-NS5 sense 5' TCG CAA CAG CCT TAA CAG C (19 b) spe VDV1-NS5 anti 5' ACT ATC TCC CTC CCA TCC TTC (21 b) VDV1-NS5 5' Fam-TTC ACA CCA CTT CCA C-M GB/NFQ (16 b) VDV2 VDV2-NS5 sense 5' AAT GAC AGA CAC GAC TCC (18 b) spec VDV2-NS5 anti 5' CCC AAA ACC TAC TAT CTT CAA C (22 b) VDV2-NS5 5' Fam-TGG AAG TCG GCA CGT GA-MGB/NFQ (17 b)

Measurement of Neutralizing Antibodies (Seroneutralization Test) (SN50)

[0173] Conventionally, the dengue antibody measurement is established using the PRNT50 (50% PFU number reduction neutralization test). Since this test is laborious and uses up a lot of material, we developed the SN50 test, based on 50% reduction in the number of units measured in a CCID50 test.

[0174] In a 96-well plate, 0.120 ml of each decomplemented serum is added to 0.480 ml of diluent (ISCOVE 4% FCS) per well. 6-fold serial dilutions are prepared by transfer of 0.150 ml of serum into 0.450 ml of diluent. 450 .mu.l of virual dilution at 2.7 log.sub.10 CCID50/ml are added to each well so as to obtain 25 CCID50/well. The plate is incubated at 37.degree. C. for 1 hour. 100 .mu.l of each dilution are then distributed into 6 wells of a 96-well plate into which VERO cells had been seeded 3 days before the beginning of the experiment at a density of 8000 cells/well, in 100 .mu.l of ISCOVE medium containing 4% FCS. After incubation at 37.degree. C. for 6 days, in the presence of 5% CO.sub.2, the cells are fixed with an ethanol/acetone (70/30) mixture at 4.degree. C. for 15 minutes, and then washed 3 times in PBS and incubated for 1 h at 37.degree. C. in the presence of 50 .mu.l of a 1/2000 dilution of an anti-flavivirus monoclonal antibody (mAb 4G2). The plates are then washed twice and incubated for 1 h at 37.degree. C. in the presence of 50 .mu.l of a 1/1000 dilution of an alkaline phosphatase-conjugated anti-mouse IgG. The lysis plaques are visualized by adding 50 .mu.l of a colored substrate: BCIP/NBT. The neutralizing antibody titers are calculated using the Karber formula as defined below:

log.sub.10SN50=d+f/N(X+N/2),

[0175] in which: [0176] d represents the dilution resulting in 100% neutralization (i.e. 6 negative replicates, i.e. replicates exhibiting no sign of infection) [0177] f: represents the dilution factor in log 10 (e.g. dilution factor of 1:4, f=0.6) [0178] N: represents the number of replicates/dilution (N=6) [0179] X: total number of wells exhibiting no sign of infection, with the exception of the dilution d.

[0180] The limit of viral detection is 10 SN50 (i.e. 1.0 log.sub.10SN50).

[0181] The viral strains which were used for the neutralization are the DEN1 16007, DEN2 16681, DEN3 16562 or DEN4 1036 strains.

[0182] For the controls, the initial viral dilutions were re-titrated.

[0183] The correlation between the neutralizing titer measured in the SN50 test and the neutralizing titer measured conventionally in the PRNT50 test is: log.sub.10PRNT50=log.sub.10SN50+0.2

[0184] The mean titer (GMT) is established by calculating the geometric mean of the titers expressed as linear value; samples for which the titer is below the detection threshold are, by convention, given a value equal to half this threshold.

[0185] 1.2 Evaluation of the sequential immunizations

[0186] 3 groups of 4 monkeys of equivalent age and weight were immunized (see table 2).

[0187] The immunization was carried out subcutaneously in the arm, with a 23G1 needle, at a dose of 10.sup.5 CCID.sub.50 for each serotype for the CYD DEN 1 to 4 vaccines. VDV-1 and VDV-2 were injected at a dose of 3.96 log.sub.10 and 4.84 log.sub.10, respectively.

TABLE-US-00002 TABLE 2 Composition of the groups and immunization protocol No of the Immunizations Group monkeys D0 D56 1 AM633 VDV-1,2 CYD-3,4 AM634 (bivalent (bivalent AM941 composition) composition) AN045 2 AM637 CYD-1,2 CYD-3,4 AN002 (bivalent (bivalent AN013 composition) composition) AN073 3 AM496 CYD-1,2,3,4 CYD-1,2,3,4 AM645 (tetravalent (tetravalent composition) AM766 composition) AM813

[0188] The immunogenicity results obtained after one immunization (D28) and two immunizations (D84) are given in table 3.

[0189] The viremia results are given in table 4.

TABLE-US-00003 TABLE 3 SN50 neutralizing titer Monkeys Immunizations D + 28 D + 84 Group ID D0 D56 DEN-1 DEN-2 DEN-3 DEN-4 DEN-1 DEN-2 DEN-3 DEN-4 1 AM633 VDV 12 CYD 34 16 10 -- -- 20 126 20 126 AM634 126 200 -- -- 319 802 100 637 AM941 32 200 -- -- 252 802 40 252 AN045 25 200 -- -- 63 400 50 252 geometric 35 94 -- -- 100 425 45 268 mean 2 AM637 CYD 12 CYD 34 32 10 -- -- 637 31 40 159 AN002 40 31 -- -- 1277 634 100 159 AN013 20 316 -- -- 20 400 20 16 AN073 -- -- -- -- 63 126 40 504 geometric 19 27 -- -- 179 178 42 119 mean 3 AM496 CYD CYD 50 -- 16 32 100 40 80 252 AM645 1234 1234 -- -- 13 31 16 -- -- 63 AM766 -- -- -- 32 20 -- -- 80 AM813 25 -- -- 13 63 13 20 63 geometric 13 -- 8 25 38 11 14 95 mean --= <10 SN.sub.50 corresponding to the limit of sensitivity of the test (titer = 5 for the calculation of the geometric mean)*

TABLE-US-00004 TABLE 4 Viremia titers Monitoring of post-vaccinal viremias of the F IM DENO11 Mk monkey study 1st immunization (D0) Group Monkey type D2 D3 D4 D5 D6 D7 D8 D9 D10 1 AM633 VDV1 -- -- -- -- -- -- -- -- -- VDV2 -- -- -- -- 3.928 -- 3.54 -- -- (i)VDV 1.2 AM634 VDV1 -- -- -- -- -- -- -- -- -- (ii)CYD3.4 VDV2 -- 4.08 4.75 5.14 5.38 2.93 4.42 3.42 -- AM941 VDV1 -- -- -- -- -- -- -- -- -- VDV2 4.191 -- 4.015 4.341 4.897 4.894 4.276 -- 2.754 AN045 VDV1 -- -- -- -- -- -- -- -- -- VDV2 3.446 -- 4.108 4.905 4.968 4.749 3.175 2.908 -- 2 AM637 CYD1 3.32 -- -- -- -- -- -- -- -- CYD2 -- -- -- -- -- -- -- -- -- (i)CYD1.2 AN002 CYD1 -- -- -- -- -- -- -- -- -- (ii)CYD3.4 CYD2 -- -- -- -- -- -- -- -- -- AN013 CYD1 -- -- -- -- -- -- -- -- -- CYD2 -- -- -- -- -- -- -- -- -- AN073 CYD1 -- -- -- -- -- -- -- -- -- CYD2 -- -- -- -- -- -- -- -- -- 6 AM496 CYD1 -- -- -- -- -- -- -- -- -- CYD2 -- -- -- -- -- -- -- -- -- (i)CYD1-4 CYD3 -- -- -- -- -- -- -- -- -- (ii)CYD1-4 CYD4 4.221 3.363 3.711 4.154 3.145 -- 3.579 -- -- AM645 CYD1 3.27 -- -- -- -- -- -- -- -- CYD2 -- -- -- -- -- -- -- -- -- CYD3 3.55 -- -- -- -- -- -- -- -- CYD4 3.66 3.607 2.82 3.514 3.654 3.238 -- 3.475 3.443 AM766 CYD1 -- -- -- -- -- -- -- -- -- CYD2 -- -- -- -- -- -- -- -- -- CYD3 -- -- -- -- -- -- -- -- -- CYD4 3.966 3.06 3.378 4.193 3.80 3.729 -- -- -- AM813 CYD1 -- -- -- -- -- -- -- -- -- CYD2 -- -- -- -- -- -- -- -- -- CYD3 -- -- -- -- -- -- -- -- -- CYD4 4.813 4.603 3.173 2.85 -- -- -- -- -- 2nd immunization (D56) Group Monkey type D58 D59 D60 D61 D62 D63 D64 D65 D66 1 AM633 CYD3 -- -- -- -- -- -- -- -- -- CYD4 3.613 -- -- -- -- 3.075 -- -- -- (i)VDV 1.2 AM634 CYD3 -- -- -- -- -- -- -- -- -- (ii)CYD3.4 CYD4 -- -- -- -- -- 2.986 -- -- -- AM941 CYD3 -- -- -- -- -- -- -- -- -- CYD4 -- -- -- -- -- 3.444 -- -- -- AN045 CYD3 -- -- -- -- -- -- -- -- -- CYD4 2.97 -- -- 2.95 -- 3.344 3.509 3.40 -- 2 AM637 CYD3 -- -- -- -- -- -- -- -- -- CYD4 5.209 4.629 3.664 2.985 -- -- -- -- -- (i)CYD1.2 AN002 CYD3 -- -- -- -- -- -- -- -- -- (ii)CYD3.4 CYD4 3.559 -- -- -- 3.674 3.835 3.573 3.587 3.30 AN013 CYD3 -- -- -- -- -- -- -- -- -- CYD4 -- -- -- -- -- -- -- -- -- AN073 CYD3 -- -- -- -- -- -- -- -- -- CYD4 3.73 3.50 3.111 2.8 3.337 -- 3.068 3.284 -- 6 AM496 CYD1 -- -- -- -- -- -- -- -- -- CYD2 -- -- -- -- -- -- -- -- -- (i)CYD1-4 CYD3 -- -- -- -- -- -- -- -- -- (ii)CYD1-4 CYD4 -- -- -- -- -- -- -- -- -- AM645 CYD1 -- -- -- -- -- -- -- -- -- CYD2 -- -- -- -- -- -- -- -- -- CYD3 -- -- -- -- -- -- -- -- -- CYD4 -- -- -- -- -- -- -- -- -- AM766 CYD1 -- -- -- -- -- -- -- -- -- CYD2 -- -- -- -- -- -- -- -- -- CYD3 -- -- -- -- -- -- -- -- -- CYD4 -- -- -- -- -- -- -- -- -- AM813 CYD1 -- -- -- -- -- -- -- -- -- CYD2 -- -- -- -- -- -- -- -- -- CYD3 -- -- -- -- -- -- -- -- -- CYD4 -- -- -- -- -- -- -- -- --

Correlation Between GEQ and PFU

[0190] GEQ/PFU ratio of 2.7 log.sub.10 (i.e.: 1 PFU=500 GEQ) for the sera positive with respect to YF or CYDs

[0191] GEQ/PFU ratio of 2.5 log.sub.10 (i.e.: 1 PFU=320 GEQ) for the sera positive with respect to VDV1 or VDV2

[0192] Quantification Limits:

[0193] <3.3 log.sub.10 GEQ/ml (i.e.: <4 PFU/ml) for the qRT-PCRs with respect to YF and CYDs

[0194] <2.9 log.sub.10 GEQ/ml (i.e.: <2.5 PFU/ml) for the qRT-PCRs with respect to VDV1 and VDV2

[0195] Briefly, the results can be summarized as follows: [0196] The administration scheme according to the present invention makes it possible to qualitatively and quantitatively increase the homologous neutralizing antibody response which is obtained with the tetravalent immunization. [0197] The bivalent immunization CYD-1,2 followed two months later by an immunization CYD-3,4 induces high homologous responses against the four serotypes in all the monkeys. Similarly, the same good responses are observed after an administration of VDV-1,2 followed by CYD-3,4. [0198] A notable result is the strong stimulatory effect of the CYD-3,4 serotypes on the responses induced by CYD-1,2 after primary immunization. An increase in the homologous, but also heterologous, neutralizing antibody responses can be noted. This phenomenon could be explained by a positive helper effect of the anti-NS-yellow fever response on the anti-E responses, without immunodominance. E epitopes with cross reactivity may also play a role. Paradoxically, this stimulating effect is not observed after a tetravalent booster, insofar as only the dominant E responses induced after primary immunization (here, 3) are boosted. [0199] The viremia (table 4) is predominantly caused by CYD-4 in the case of the CYD vaccines and no difference is observed between two sequential bivalent administrations and one tetravalent administration (group 2 versus group 3). Thus, no difference in terms of safety after two bivalent immunizations or one tetravalent immunization is expected. A tendency toward a lower viremia is even rather observed with the vaccinal scheme according to the invention; see, for example, group 2 compared with group 3.

Example 2

Sequential Immunization in Monkeys Carried Out with a 1 Month Interval. Comparison of Schemes CYD-1,2 Followed by CYD-3,4 Versus CYD-2,3 Followed by CYD-1,4

[0200] The viremia and the immunogenicity were tested in a monkey model as in the previous example. In the present example, a one-month interval was used between the two immunizations, against two months in the previous example. The primary immunization carried out with the two vaccinal viruses that are the least immunogenic in monkeys (CYD-2,3) is followed by an administration with the two immunodominant vaccinal viruses (CYD-1,4).

[0201] 2.1 Materials and Methods: Identical to Example 1

[0202] 2.2 Evaluation of Sequential Immunizations with a One-Month Interval

[0203] 3 groups of 4 monkeys of equivalent age and weight were immunized. (see table 5).

[0204] The immunization was carried out subcutaneously in the arm with a 23G1 needle, at a dose of 10.sup.5 CCID.sub.50 for each serotype for the vaccinal viruses CYD DEN1 to 4 as previously.

TABLE-US-00005 TABLE 5 Group composition and immunization protocol Immunizations Group D0 D28 1 CYD CYD Tetrav Tetrav (5555) (5555) 2 CYD CYD Biv 1-2 Biv 3-4 (55) (55) 3 CYD CYD Biv 2-3 Biv 1-4 (55) (55)

[0205] The immunogenicity results obtained after one immunization (D28) and two immunizations (D56) are given in table 6.

[0206] The viremia results are similar to those given in example 1, showing a weak viremia induced by CYD4 and no significant difference between the various groups.

TABLE-US-00006 TABLE 6 SN 50 Monkeys Immunizations D0 + 24 D0 + 56 Group ID D0 D28 DEN-1 DEN-2 DEN-3 DEN-4 DEN-1 DEN-2 DEN-3 DEN-4 1 AR193 CYD CYD 160 80 32 638 638 63 40 401 AR197 Tetrav Tetrav 50 -- -- 318 32 16 10 401 AR209 (5555) (5555) 100 -- -- 159 160 16 32 317 AR335 40 -- -- 505 126 25 -- 100 Geometric 75 -- -- 357 142 25 23 267 mean 2 AR162 CYD Biv CYD Biv 1604 63 ND ND 1274 50 63 318 AR230 1-2 3-4 32 -- ND ND 100 63 12 160 AR264 (55) (55) 1274 63 ND ND 635 25 40 401 AR336 4048 -- ND ND 2019 13 126 401 Geometric 715 21 ND ND 636 32 44 301 mean 3 AR156 CYD Biv CYD Biv ND -- 318 ND 32 25 126 126 AR173 2-3 1-4 ND 25 80 ND 63 50 80 253 AR337 (55) (55) ND 32 -- ND 40 63 160 401 AR367 ND 50 100 ND 32 80 126 126 Geometric ND 18 50 ND 40 50 119 200 mean ND: not determined --: =<10 SN.sub.50 corresponding to the limit of sensitivity of the test

[0207] Briefly, the results complete those obtained in example 1 and can be summarized as follows: [0208] The administration scheme according to the present invention makes it possible to qualitatively and quantitatively increase the homologous neutralizing antibody response that is obtained with the tetravalent vaccination when the two immunizations are carried out with a 1 month interval. [0209] The CYD-1,2 bivalent immunization followed, one month later, by a CYD-3,4 immunization (group 2) induces high homologous responses against the four serotypes in all the monkeys, with serotypes 1 and 4 being dominant. [0210] In this group, the booster effect on serotypes 1 and 2 is less marked when the second administration is carried out after one month, than when it is carried out after 2 months as in example 1. [0211] When the immunizations begin with the less immunogenic serotypes (CYD-2,3) and the booster is carried out with the strongest serotypes (CYD-1,4), the response obtained is better balanced, with less dominance of serotypes 1 and 4 (group 3). [0212] These results confirm those obtained in example 1, which show that an immunization carried out sequentially with two bivalents is effective in inducing a response against all the serotypes in all the animals, even when the booster is carried out only 1 month after the primary immunization.

Sequence CWU 1

1

2110735DNADengue virus 1agttgttagt ctacgtggac cgacaagaac agtttcgaat cggaagcttg cttaacgtag 60ttctaacagt tttttattag agagcagatc tctgatgatc aaccaacgaa aaaagacggg 120tcgaccgtct ttcaatatgc tgaaacgcgc gagaaaccgc gtgtcaactg tttcacagtt 180ggcgaagaga ttctcaaaag gattgctctc aggccaagga cccatgaaat tggtgatggc 240tttcatagca ttcttaagat ttctagccat acccccaaca gcaggaattt tggctagatg 300gggctcattc aagaagaatg gagcgattaa agtgttacgg ggtttcaaga gagaaatctc 360aaacatgcta aacataatga acaggaggaa aagatccgtg accatgctcc ttatgctgct 420gcccacagcc ctggcgttcc atctgacgac acgaggggga gagccgcata tgatagttag 480caagcaggaa agaggaaagt cacttttgtt caagacctct gcaggtgtca acatgtgcac 540cctcattgcg atggatttgg gagagttgtg tgaggacacg atgacctaca aatgcccccg 600gatcactgag gcggaaccag atgacgttga ctgttggtgc aatgccacgg acacatgggt 660gacctatgga acgtgctctc aaactggcga acaccgacga gacaaacgtt ccgtcgcatt 720ggccccacac gtggggcttg gcctagaaac aagagccgaa acgtggatgt cctctgaagg 780tgcttggaaa cagatacaaa aagtagagac ttgggctctg agacatccag gattcacggt 840gatagccctt tttctagcac atgccatagg aacatccatc acccagaaag ggatcatttt 900cattttgctg atgctggtaa caccatctat ggccatgcga tgcgtgggaa taggcaacag 960agacttcgtg gaaggactgt caggagcaac atgggtggat gtggtactgg agcatggaag 1020ttgcgtcacc accatggcaa aaaacaaacc aacactggac attgaactct tgaagacgga 1080ggtcacaaac cctgcagttc tgcgtaaatt gtgcattgaa gctaaaatat caaacaccac 1140caccgattcg agatgtccaa cacaaggaga agccacactg gtggaagaac aagacgcgaa 1200ctttgtgtgc cgacgaacgt tcgtggacag aggctggggc aatggctgtg ggctattcgg 1260aaaaggtagt ctaataacgt gtgccaagtt taagtgtgtg acaaaactag aaggaaagat 1320agctcaatat gaaaacctaa aatattcagt gatagtcacc gtccacactg gagatcagca 1380ccaggtggga aatgagacta cagaacatgg aacaactgca accataacac ctcaagctcc 1440tacgtcggaa atacagctga ccgactacgg aacccttaca ttagattgtt cacctaggac 1500agggctagat tttaacgaga tggtgttgct gacaatgaaa aagaaatcat ggcttgtcca 1560caaacagtgg tttctagact taccactgcc ttggacctct ggggctttaa catcccaaga 1620gacttggaac agacaagatt tactggtcac atttaagaca gctcatgcaa agaagcagga 1680agtagtcgta ctaggatcac aagaaggagc aatgcacact gcgctgactg gagcgacaga 1740aatccaaacg tcaggaacga caacaatttt cgcaggacac ctaaaatgca gactaaaaat 1800ggacaaacta actttaaaag ggatgtcata tgtgatgtgc acaggctcat tcaagttaga 1860gaaagaagtg gctgagaccc agcatggaac tgttctggtg caggttaaat atgaaggaac 1920agacgcacca tgcaagattc ccttttcgac ccaagatgag aaaggagcaa cccagaatgg 1980gagattaata acagccaacc ccatagtcac tgacaaagaa aaaccagtca atattgaggc 2040agaaccaccc tttggtgaga gctacatcgt ggtaggagca ggtgaaaaag ctttgaaact 2100aagctggttc aagaaaggaa gcagcatagg gaaaatgttt gaagcaactg cccgaggagc 2160acgaaggatg gccattctgg gagacaccgc atgggacttc ggttctatag gaggagtgtt 2220cacgtctatg ggaaaactgg tacaccaggt ttttggaact gcatatggag ttttgtttag 2280cggagtttct tggaccatga aaataggaat agggattctg ctgacatggc taggattaaa 2340ttcaaggaac acgtcccttt cggtgatgtg catcgcagtt ggcatggtca cactgtacct 2400aggagtcatg gttcaggcag attcgggatg tgtaatcaac tggaaaggca gagaacttaa 2460atgtggaagc ggcatttttg tcactaatga agttcacact tggacagagc aatacaaatt 2520ccaggctgac tcccccaaga gactatcagc agccattggg aaggcatggg aggagggtgt 2580gtgtggaatc cgatcagcca ctcgtctcga gaacatcatg tggaaacaaa tatcaaatga 2640attgaaccac atcctacttg aaaatgacat gaaatttaca gtggtcgtgg gagacgttag 2700tggaatcttg gcccaaggaa aaaaaatgat taggccacaa cccatggaac acaaatactc 2760gtggaaaagc tggggaaaag ctaaaatcat aggagcggat gtacagaaca ccaccttcat 2820catcgacggc ccaaacaccc cagaatgccc tgacaatcaa agagcatgga atatttggga 2880agtagaggac tatggatttg ggattttcac gacaaacata tggttgaaat tgcgtgactc 2940ctacacccaa gtatgtgacc accggctgat gtcagctgcc attaaggaca gcaaggcagt 3000ccatgctgac atggggtact ggatagaaag tgaaaagaac gagacatgga agttggcgag 3060agcctccttt atagaagtta agacatgcat ctggccaaaa tcccacactc tatggagcaa 3120tggagttctg gaaagtgaaa tgataattcc aaagatatat ggaggaccaa tatctcagca 3180caactacaga ccaggatatt tcacacaaac agcagggccg tggcacctag gcaagttgga 3240actagatttc gatttttgtg aaggtaccac agttgttgtg gatgaacatt gtggaaatcg 3300aggaccatct ctcagaacca caacagtcac aggaaagata atccatgaat ggtgctgcag 3360atcttgtacg ctaccccccc tacgtttcaa aggggaagac gggtgttggt acggcatgga 3420aatcagacca gtgaaggaca aggaagagaa cctggtcaag tcaatggtct ctgcagggtc 3480aggagaagtg gacagctttt cactaggact gctatgcata tcaataatga ttgaagaagt 3540gatgagatcc agatggagca aaaaaatgct gatgactgga acactggctg tgttcctcct 3600tcttataatg ggacaattga catggagtga tctgatcagg ttatgtatta tggttggagc 3660caacgcttca gacaagatgg ggatgggaac aacgtaccta gctttaatgg ccactttcaa 3720aatgagacca atgttcgccg tcgggctatt atttcgcaga ctaacatcta gagaagttct 3780tcttcttaca attggcttga gcctggtggc atccgtggag ctaccaagtt ccctagagga 3840gctgggggat ggacttgcaa taggcatcat gatgttgaaa ttattgactg attttcagtc 3900acaccagcta tgggctactc tgctatcctt gacatttatt aaaacaactt tttcattgca 3960ctatgcatgg aagacaatgg ctatggtact gtcaattgta tctctcttcc ctttatgcct 4020gtccacgacc tctcaaaaaa caacatggct tccggtgctg ttgggatctc ttggatgcaa 4080accactaccc atgtttctta taacagaaaa caaaatctgg ggaaggaaga gttggcccct 4140caatgaagga attatggctg ttggaatagt tagtattcta ctaagttcac ttttaaaaaa 4200tgatgtgccg ctagccggcc cattaatagc tggaggcatg ctaatagcat gttatgtcat 4260atccggaagc tcagctgatt tatcactgga gaaagcggct gaggtctcct gggaggaaga 4320agcagaacac tcaggcgcct cacacaacat actagtagag gttcaagatg atggaaccat 4380gaagataaaa gatgaagaga gagatgacac gctcaccatt ctccttaaag caactctgct 4440ggcagtctca ggggtgtacc caatgtcaat accagcgacc ctttttgtgt ggtatttttg 4500gcagaaaaag aaacagagat caggagtgct atgggacaca cccagccccc cagaagtgga 4560aagagcagtt cttgatgatg gcatctatag aattttgcaa agaggactgt tgggcaggtc 4620ccaagtagga gtaggagttt tccaagaagg cgtgttccac acaatgtggc acgtcactag 4680gggagctgtc ctcatgtatc aaggaaaaag gctggaacca agctgggcca gtgtcaaaaa 4740agacttgatc tcatatggag gaggttggag gtttcaagga tcctggaaca cgggagaaga 4800agtacaggtg attgctgttg aaccgggaaa aaaccccaaa aatgtacaaa caacgccggg 4860taccttcaag acccctgaag gcgaagttgg agccatagcc ttagacttta aacctggcac 4920atctggatct cccatcgtaa acagagaggg aaaaatagta ggtctttatg gaaatggagt 4980ggtgacaaca agcggaactt acgttagtgc catagctcaa gctaaggcat cacaagaagg 5040gcctctacca gagattgagg acaaggtgtt taggaaaaga aacttaacaa taatggacct 5100acatccagga tcgggaaaaa caagaagata ccttccagcc atagtccgtg aggccataaa 5160aaggaagctg cgcacgctaa tcctagctcc cacaagagtt gtcgcttctg aaatggcaga 5220ggcactcaag ggagtgccaa taaggtatca gacaacagca gtgaagagtg aacacacagg 5280aaaggagata gttgacctta tgtgccacgc cactttcacc atgcgcctcc tgtctcccgt 5340gagagttccc aattataaca tgattatcat ggatgaagca cacttcaccg atccagccag 5400catagcagcc agagggtaca tctcaacccg agtgggtatg ggtgaagcag ctgcgatctt 5460tatgacagcc actcccccag gatcggtgga ggcctttcca cagagcaatg caattatcca 5520agatgaggaa agagacattc ctgagagatc atggaactca ggctatgact ggatcactga 5580ttttccaggt aaaacagtct ggtttgttcc aagcatcaaa tcaggaaatg acattgccaa 5640ctgtttaaga aaaaacggga aacgggtgat ccaattgagc agaaaaacct ttgacactga 5700gtaccagaaa acaaaaaaca acgactggga ctatgtcgtc acaacagaca tttccgaaat 5760gggagcaaat ttccgggccg acagggtaat agacccaagg cggtgtctga aaccggtaat 5820actaaaagat ggtccagagc gcgtcattct agccggaccg atgccagtga ctgtggccag 5880tgccgcccag aggagaggaa gaattggaag gaaccaaaac aaggaaggtg atcagtatat 5940ttacatggga cagcctttaa aaaatgatga ggaccacgct cattggacag aagcaaagat 6000gctccttgac aatataaaca caccagaagg gattatccca gccctctttg agccggagag 6060agaaaagagt gcagctatag acggggaata cagactgcgg ggtgaagcaa ggaaaacgtt 6120cgtggagctc atgagaagag gggatctacc agtctggcta tcctacaaag ttgcctcaga 6180aggcttccag tactccgaca gaaggtggtg cttcgatggg gaaaggaaca accaggtgtt 6240ggaggagaac atggacgtgg agatctggac aaaagaagga gaaagaaaga aactacgacc 6300tcgctggttg gacgccagaa catactctga cccactggct ctgcgcgagt ttaaagagtt 6360tgcagcagga agaagaagcg tctcaggtga cctaatatta gaaataggga aacttccaca 6420acatttgacg caaagggccc agaatgcttt ggacaacttg gtcatgttgc acaattccga 6480acaaggagga aaagcctata gacatgctat ggaagaactg ccagacacaa tagaaacgtt 6540gatgctccta gccttgatag ctgtgttgac tggtggagtg acgctgttct tcctatcagg 6600aagaggtcta ggaaaaacat ctatcggctt actctgcgtg atggcctcaa gcgcactgtt 6660atggatggcc agtgtggagc cccattggat agcggcctcc atcatactgg agttctttct 6720gatggtactg cttattccag agccagacag acagcgcact ccacaggaca accagctagc 6780atatgtggtg ataggtctgt tattcgtgat attgacagtg gcagccaatg agatgggatt 6840attggaaacc acaaagaaag acctggggat tggccatgta gctgctgaaa accaccacca 6900tgctacaatg ctggacgtag acctacatcc agcttcagcc tggaccctct atgcagtggc 6960cacaacaatc atcactccta tgatgagaca cacaattgaa aacacaacgg caaatatttc 7020cctgacagcc atcgcaaacc aagcagctat attgatggga cttgacaagg gatggccaat 7080atcgaagatg gacataggag ttccacttct cgccttgggg tgctattccc aagtgaatcc 7140gctgacactg atagcggcag tattgatgct agtagctcat tacgccataa ttggacctgg 7200actgcaagca aaagctacta gagaagctca aaaaagaaca gcggctggaa taatgaaaaa 7260tccaactgtc gacgggattg ttgcaataga cttagatccc gtggtttacg atgcaaaatt 7320tgaaaaacag ctaggccaaa taatgttgtt gatactttgc acatcacaga ttcttttgat 7380gcggactaca tgggccttgt gtgaatccat cacattggct actggacctc tgaccactct 7440ttgggaggga tctccaggaa aattctggaa caccacaata gcggtatcca tggcaaacat 7500tttcaggggg agttatctag caggagcagg tctggccttc tcattaatga aatctctagg 7560aggaggtagg agaggcacgg gagcccaagg ggaaacactg ggagaaaaat ggaaaagaca 7620actaaaccaa ctgagcaagt cagaattcaa tacttacaag aggagtggga ttatggaggt 7680ggatagatcc gaagccaaag agggactgaa aagaggagaa acaaccaaac acgcagtatc 7740gagaggaacg gccaaactga ggtggttcgt ggagaggaac cttgtgaaac cagaagggaa 7800agtcatagac ctcggttgtg gaagaggtgg ctggtcatat tattgcgctg ggctgaagaa 7860agtcacagaa gtgaaaggat acacaaaagg aggacctgga catgaggaac caatcccaat 7920ggcgacctat ggatggaacc tagtaaggct gcactccgga aaagatgtat tttttatacc 7980acctgagaaa tgtgacaccc ttttgtgtga tattggtgag tcctctccga acccaactat 8040agaggaagga agaacgttac gtgttctgaa aatggtggaa ccatggctca gaggaaacca 8100attttgcata aaaattctaa atccctatat gccgagcgtg gtagaaactc tggaacaaat 8160gcaaagaaaa catggaggaa tgctagtgcg aaacccactc tcaagaaatt ccacccatga 8220aatgtactgg gtttcatgtg gaacaggaaa cattgtgtca gcagtaaaca tgacatctag 8280aatgttgcta aatcggttca caatggctca caggaagcca acatatgaaa gagacgtgga 8340cttaggcgct ggaacaagac atgtggcagt agaaccagag gtagccaacc tagatatcat 8400tggccagagg atagagaata taaaaaatga acataagtca acatggcatt atgatgagga 8460caatccatac aaaacatggg cctatcatgg atcatatgag gttaagccat caggatcggc 8520ctcatccatg gtcaatggcg tggtgagatt gctcaccaaa ccatgggatg ttatccccat 8580ggtcacacaa atagccatga ctgataccac accctttgga caacagaggg tgtttaaaga 8640gaaagttgac acgcgcacac caaaagcaaa acgtggcaca gcacaaatta tggaagtgac 8700agccaggtgg ttatggggtt tcctttctag aaacaaaaaa cccagaattt gcacaagaga 8760ggagtttaca agaaaagtta ggtcaaacgc agctattgga gcagtgttcg ttgatgaaaa 8820tcaatggaac tcggcaaaag aagcagtgga agacgaacgg ttctgggaac ttgtccacag 8880agagagggag cttcataaac aggggaaatg tgccacgtgt gtctacaata tgatggggaa 8940gagagagaaa aaattaggag agttcggaaa ggcaaaagga agtcgtgcaa tatggtacat 9000gtggttggga gcacgcttcc tagagtttga agcccttggt ttcatgaatg aagatcactg 9060gttcagtaga gagaattcac tcagtggagt ggaaggagaa ggactccaca aacttggata 9120catactcaga gacatatcaa ggattccagg ggggaacatg tatgcagatg acacagccgg 9180atgggacaca agaataacag aggatgatct ccagaatgag gctaaaatca ctgacatcat 9240ggagcccgaa catgccctgc tggctacgtc aatctttaag ctgacctacc aaaataaggt 9300ggtaagggtg cagagaccag caaaaaatgg aaccgtgatg gatgttatat ccagacgtga 9360ccagagaggc agtggacagg ttggaactta tggcttaaac actttcacca acatggaggc 9420ccaactgata agacaaatgg agtctgaggg aatcttttta cccagcgaat tggaaacccc 9480aaatctagcc ggaagagttc tcgactggtt ggaaaaatat ggtgtcgaaa ggctgaaaag 9540aatggcaatc agcggagatg actgtgtggt gaaaccaatt gatgacaggt tcgcaacagc 9600cttaacagct ttgaatgaca tgggaaaagt aagaaaagac ataccacaat gggaaccttc 9660aaaaggatgg aatgattggc aacaagtgcc tttctgttca caccacttcc accagctaat 9720tatgaaggat gggagggaga tagtggtgcc atgccgcaac caagatgaac ttgtggggag 9780ggccagagta tcacaaggcg ccggatggag cctgagagaa accgcatgcc taggcaagtc 9840atatgcacaa atgtggcagc tgatgtattt ccacaggaga gacctgagac tggcggctaa 9900cgctatttgt tcagccgttc cagttgattg ggtcccaacc agccgcacca cctggtcgat 9960ccatgcccat caccaatgga tgacaacaga agacatgtta tcagtatgga atagggtctg 10020gatagaggaa aacccatgga tggaggataa gactcatgtg tccagttggg aagaagttcc 10080atacctagga aagagggaag atcagtggtg tggatccctg ataggcttaa cagcaagggc 10140cacctgggcc actaatatac aagtggccat aaaccaagtg agaaggctca ttgggaatga 10200gaattatcta gattacatga catcaatgaa gagattcaag aatgagagtg atcccgaagg 10260ggcactctgg taagtcaaca cattcacaaa ataaaggaaa ataaaaaatc aaatgaggca 10320agaagtcagg ccagattaag ccatagtacg gtaagagcta tgctgcctgt gagccccgtc 10380caaggacgta aaatgaagtc aggccgaaag ccacggtttg agcaagccgt gctgcctgtg 10440gctccatcgt ggggatgtaa aaacccggga ggctgcaacc catggaagct gtacgcatgg 10500ggtagcagac tagtggttag aggagacccc tcccaagaca caacgcagca gcggggccca 10560acaccagggg aagctgtacc ctggtggtaa ggactagagg ttagaggaga ccccccgcgt 10620aacaataaac agcatattga cgctgggaga gaccagagat cctgctgtct ctacagcatc 10680attccaggca cagaacgcca gaaaatggaa tggtgctgtt gaatcaacag gttct 10735210723DNADengue virus 2agttgttagt ctacgtggac cgacaaagac agattctttg agggagctaa gctcaatgta 60gttctaacag ttttttaatt agagagcaga tctctgatga ataaccaacg gaaaaaggcg 120aaaaacacgc ctttcaatat gctgaaacgc gagagaaacc gcgtgtcgac tgtgcaacag 180ctgacaaaga gattctcact tggaatgctg cagggacgag gaccattaaa actgttcatg 240gccctggtgg cgttccttcg tttcctaaca atcccaccaa cagcagggat attgaagaga 300tggggaacaa ttaaaaaatc aaaagctatt aatgttttga gagggttcag gaaagagatt 360ggaaggatgc tgaacatctt gaataggaga cgcagatctg caggcatgat cattatgctg 420attccaacag tgatggcgtt ccatttaacc acacgtaacg gagaaccaca catgatcgtc 480agcagacaag agaaagggaa aagtcttctg tttaaaacag aggttggcgt gaacatgtgt 540accctcatgg ccatggacct tggtgaattg tgtgaagaca caatcacgta caagtgtccc 600cttctcaggc agaatgagcc agaagacata gactgttggt gcaactctac gtccacgtgg 660gtaacttatg ggacgtgtac caccatggga gaacatagaa gagaaaaaag atcagtggca 720ctcgttccac atgtgcgaat gggactggag acacgaactg aaacatggat gtcatcagaa 780ggggcctgga aacatgtcca gagaattgaa acttggatct tgagacatcc aggcttcacc 840atgatggcag caatcctggc atacaccata ggaacgacac atttccaaag agccctgatt 900ttcatcttac tgacagctgt cactccttca atgacaatgc gttgcatagg aatgtcaaat 960agagactttg tggaaggggt ttcaggagga agctgggttg acatagtctt agaacatgga 1020agctgtgtga cgacgatggc aaaaaacaaa ccaacattgg attttgaact gataaaaaca 1080gaagccaaac agcctgccac cctaaggaag tactgtatag aggcaaagct aaccaacaca 1140acaacagaat ctcgctgccc aacacaaggg gaacccagcc taaatgaaga gcaggacaaa 1200aggttcgtct gcaaacactc catggtagac agaggatggg gaaatggatg tggactattt 1260ggaaagggag gcattgtgac ctgtgctatg ttcagatgca aaaagaacat ggaaggaaaa 1320gttgtgcaac cagaaaactt ggaatacacc attgtgataa cacctcactc aggggaagag 1380catgcagtcg gaaatgacac aggaaaacat ggcaaggaaa tcaaaataac accacagagt 1440tccatcacag aagcagaatt gacaggttat ggcactgtca caatggagtg ctctccaaga 1500acgggcctcg acttcaatga gatggtgttg ctgcagatgg aaaataaagc ttggctggtg 1560cacaggcaat ggttcctaga cctgccgtta ccatggttgc ccggagcgga cacacaagag 1620tcaaattgga tacagaagga gacattggtc actttcaaaa atccccatgc gaagaaacag 1680gatgttgttg ttttaggatc ccaagaaggg gccatgcaca cagcacttac aggggccaca 1740gaaatccaaa tgtcatcagg aaacttactc ttcacaggac atctcaagtg caggctgaga 1800atggacaagc tacagctcaa aggaatgtca tactctatgt gcacaggaaa gtttaaagtt 1860gtgaaggaaa tagcagaaac acaacatgga acaatagtta tcagagtgca atatgaaggg 1920gacggctctc catgcaagat cccttttgag ataatggatt tggaaaaaag acatgtctta 1980ggtcgcctga ttacagtcaa cccaattgtg acagaaaaag atagcccagt caacatagaa 2040gcagaacctc catttggaga cagctacatc atcataggag tagagccggg acaactgaag 2100ctcaactggt ttaagaaagg aagttctatc ggccaaatgt ttgagacaac aatgaggggg 2160gcgaagagaa tggccatttt aggtgacaca gcctgggatt ttggatcctt gggaggagtg 2220tttacatcta taggaaaggc tctccaccaa gtctttggag caatctatgg agctgccttc 2280agtggggttt catggactat gaaaatcctc ataggagtca ttatcacatg gataggaatg 2340aattcacgca gcacctcact gtctgtgaca ctagtattgg tgggaattgt gacactgtat 2400ttgggagtca tggtgcaggc cgatagtggt tgcgttgtga gctggaaaaa caaagaactg 2460aaatgtggca gtgggatttt catcacagac aacgtgcaca catggacaga acaatacaaa 2520ttccaaccag aatccccttc aaaactagct tcagctatcc agaaagccca tgaagaggac 2580atttgtggaa tccgctcagt aacaagactg gagaatctga tgtggaaaca aataacacca 2640gaattgaatc acattctatc agaaaatgag gtgaagttaa ctattatgac aggagacatc 2700aaaggaatca tgcaggcagg aaaacgatct ctgcggcctc agcccactga gctgaagtat 2760tcatggaaaa catggggcaa agcaaaaatg ctctctacag agtctcataa ccagaccttt 2820ctcattgatg gccccgaaac agcagaatgc cccaacacaa atagagcttg gaattcgttg 2880gaagttgaag actatggctt tggagtattc accaccaata tatggctaaa attgaaagaa 2940aaacaggatg tattctgcga ctcaaaactc atgtcagcgg ccataaaaga caacagagcc 3000gtccatgccg atatgggtta ttggatagaa agtgcactca atgacacatg gaagatagag 3060aaagcctctt tcattgaagt taaaaactgc cactggccaa aatcacacac cctctggagc 3120aatggagtgc tagaaagtga gatgataatt ccaaagaatc tcgctggacc agtgtctcaa 3180cacaactata gaccaggcta ccatacacaa ataacaggac catggcatct aggtaagctt 3240gagatggact ttgatttctg tgatggaaca acagtggtag tgactgagga ctgcggaaat 3300agaggaccct ctttgagaac aaccactgcc tctggaaaac tcataacaga atggtgctgc 3360cgatcttgca cattaccacc gctaagatac agaggtgagg atgggtgctg gtacgggatg 3420gaaatcagac cattgaagga gaaagaagag aatttggtca actccttggt cacagctgga 3480catgggcagg tcgacaactt ttcactagga gtcttgggaa tggcattgtt cctggaggaa 3540atgcttagga cccgagtagg aacgaaacat gcaatactac tagttgcagt ttcttttgtg 3600acattgatca cagggaacat gtcctttaga gacctgggaa gagtgatggt tatggtaggc 3660gccactatga cggatgacat aggtatgggc gtgacttatc ttgccctact agcagccttc 3720aaagtcagac caacttttgc agctggacta ctcttgagaa agctgacctc caaggaattg 3780atgatgacta ctataggaat tgtactcctc tcccagagca ccataccaga gaccattctt 3840gagttgactg atgcgttagc cttaggcatg atggtcctca aaatggtgag aaatatggaa 3900aagtatcaat tggcagtgac tatcatggct atcttgtgcg tcccaaacgc agtgatatta 3960caaaacgcat ggaaagtgag ttgcacaata ttggcagtgg tgtccgtttc cccactgttc 4020ttaacatcct cacagcaaaa aacagattgg ataccattag cattgacgat caaaggtctc 4080aatccaacag ctatttttct aacaaccctc tcaagaacca gcaagaaaag gagctggcca 4140ttaaatgagg ctatcatggc agtcgggatg gtgagcattt tagccagttc tctcctaaaa 4200aatgatattc ccatgacagg accattagtg gctggagggc tcctcactgt gtgctacgtg 4260ctcactggac gatcggccga

tttggaactg gagagagcag ccgatgtcaa atgggaagac 4320caggcagaga tatcaggaag cagtccaatc ctgtcaataa caatatcaga agatggtagc 4380atgtcgataa aaaatgaaga ggaagaacaa acactgacca tactcattag aacaggattg 4440ctggtgatct caggactttt tcctgtatca ataccaatca cggcagcagc atggtacctg 4500tgggaagtga agaaacaacg ggccggagta ttgtgggatg ttccttcacc cccacccatg 4560ggaaaggctg aactggaaga tggagcctat agaattaagc aaaaagggat tcttggatat 4620tcccagatcg gagccggagt ttacaaagaa ggaacattcc atacaatgtg gcatgtcaca 4680cgtggcgctg ttctaatgca taaaggaaag aggattgaac caacatgggc ggacgtcaag 4740aaagacctaa tatcatatgg aggaggctgg aagttagaag gagaatggaa ggaaggagaa 4800gaagtccagg tattggcact ggagcctgga aaaaatccaa gagccgtcca aacgaaacct 4860ggtcttttca aaaccaacgc cggaacaata ggtgctgtat ctctggactt ttctcctgga 4920acgtcaggat ctccaattat cgacaaaaaa ggaaaagttg tgggtcttta tggtaatggt 4980gttgttacaa ggagtggagc atatgtgagt gctatagccc agactgaaaa aagcattgaa 5040gacaacccag agatcgaaga tcacattttc cgaaagagaa gactgaccat catggacctc 5100cacccaggag cgggaaagac gaagagatac cttccggcca tagtcagaga agctataaaa 5160cggggtttga gaacattaat cttggccccc actagagttg tggcagctga aatggaggaa 5220gcccttagag gacttccaat aagataccag accccagcca tcagagctga gcacaccggg 5280cgggagattg tggacctaat gtgtcatgcc acatttacca tgaggctgct atcaccagtt 5340agagtgccaa actacaacct gattatcatg gacgaagccc atttcacaga cccagcaagt 5400atagcagcta gaggatacat ctcaactcga gtggagatgg gtgaggcagc tgggattttt 5460atgacagcca ctcccccggg aagcagagac ccatttcctc agagcaatgc accaatcata 5520gatgaagaaa gagaaatccc tgaacgctcg tggaattccg gacatgaatg ggtcacggat 5580tttaaaggga agactgtttg gttcgttcca agtataaaag caggaaatga tatagcagct 5640tgcctgagga aaaatggaaa gaaagtgata caactcagta ggaagacctt tgattctgag 5700tatgtcaaga ctagaaccaa tgattgggac ttcgtggtta caactgacat ttcagaaatg 5760ggtgccaatt tcaaggctga gagggttata gaccccagac gctgcatgaa accagtcata 5820ctaacagatg gtgaagagcg ggtgattctg gcaggaccta tgccagtgac ccactctagt 5880gcagcacaaa gaagagggag aataggaaga aatccaaaaa atgagaatga ccagtacata 5940tacatggggg aacctctgga aaatgatgaa gactgtgcac actggaaaga agctaaaatg 6000ctcctagata acatcaacac gccagaagga atcattccta gcatgttcga accagagcgt 6060gaaaaggtgg atgccattga tggcgaatac cgcttgagag gagaagcaag gaaaaccttt 6120gtagacttaa tgagaagagg agacctacca gtctggttgg cctacagagt ggcagctgaa 6180ggcatcaact acgcagacag aaggtggtgt tttgatggag tcaagaacaa ccaaatccta 6240gaagaaaacg tggaagttga aatctggaca aaagaagggg aaaggaagaa attgaaaccc 6300agatggttgg atgctaggat ctattctgac ccactggcgc taaaagaatt taaggaattt 6360gcagccggaa gaaagtctct gaccctgaac ctaatcacag aaatgggtag gctcccaacc 6420ttcatgactc agaaggcaag agacgcactg gacaacttag cagtgctgca cacggctgag 6480gcaggtggaa gggcgtacaa ccatgctctc agtgaactgc cggagaccct ggagacattg 6540cttttactga cacttctggc tacagtcacg ggagggatct ttttattctt gatgagcgca 6600aggggcatag ggaagatgac cctgggaatg tgctgcataa tcacggctag catcctccta 6660tggtacgcac aaatacagcc acactggata gcagcttcaa taatactgga gttttttctc 6720atagttttgc ttattccaga acctgaaaaa cagagaacac cccaagacaa ccaactgacc 6780tacgttgtca tagccatcct cacagtggtg gccgcaacca tggcaaacga gatgggtttc 6840ctagaaaaaa cgaagaaaga tctcggattg ggaagcattg caacccagca acccgagagc 6900aacatcctgg acatagatct acgtcctgca tcagcatgga cgctgtatgc cgtggccaca 6960acatttgtta caccaatgtt gagacatagc attgaaaatt cctcagtgaa tgtgtcccta 7020acagctatag ccaaccaagc cacagtgtta atgggtctcg ggaaaggatg gccattgtca 7080aagatggaca tcggagttcc ccttctcgcc attggatgct actcacaagt caaccccata 7140actctcacag cagctctttt cttattggta gcacattatg ccatcatagg gccaggactc 7200caagcaaaag caaccagaga agctcagaaa agagcagcgg cgggcatcat gaaaaaccca 7260actgtcgatg gaataacagt gattgaccta gatccaatac cttatgatcc aaagtttgaa 7320aagcagttgg gacaagtaat gctcctagtc ctctgcgtga ctcaagtatt gatgatgagg 7380actacatggg ctctgtgtga ggctttaacc ttagctaccg ggcccatctc cacattgtgg 7440gaaggaaatc cagggaggtt ttggaacact accattgcgg tgtcaatggc taacattttt 7500agagggagtt acttggccgg agctggactt ctcttttcta ttatgaagaa cacaaccaac 7560acaagaaggg gaactggcaa cataggagag acgcttggag agaaatggaa aagccgattg 7620aacgcattgg gaaaaagtga attccagatc tacaagaaaa gtggaatcca ggaagtggat 7680agaaccttag caaaagaagg cattaaaaga ggagaaacgg accatcacgc tgtgtcgcga 7740ggctcagcaa aactgagatg gttcgttgag agaaacatgg tcacaccaga agggaaagta 7800gtggacctcg gttgtggcag aggaggctgg tcatactatt gtggaggact aaagaatgta 7860agagaagtca aaggcctaac aaaaggagga ccaggacacg aagaacccat ccccatgtca 7920acatatgggt ggaatctagt gcgtcttcaa agtggagttg acgttttctt catcccgcca 7980gaaaagtgtg acacattatt gtgtgacata ggggagtcat caccaaatcc cacagtggaa 8040gcaggacgaa cactcagagt ccttaactta gtagaaaatt ggttgaacaa caacactcaa 8100ttttgcataa aggttctcaa cccatatatg ccctcagtca tagaaaaaat ggaagcacta 8160caaaggaaat atggaggagc cttagtgagg aatccactct cacgaaactc cacacatgag 8220atgtactggg tatccaatgc ttccgggaac atagtgtcat cagtgaacat gatttcaagg 8280atgttgatca acagatttac aatgagatac aagaaagcca cttacgagcc ggatgttgac 8340ctcggaagcg gaacccgtaa catcgggatt gaaagtgaga taccaaacct agatataatt 8400gggaaaagaa tagaaaaaat aaagcaagag catgaaacat catggcacta tgaccaagac 8460cacccataca aaacgtgggc ataccatggt agctatgaaa caaaacagac tggatcagca 8520tcatccatgg tcaacggagt ggtcaggctg ctgacaaaac cttgggacgt tgtccccatg 8580gtgacacaga tggcaatgac agacacgact ccatttggac aacagcgcgt ttttaaagag 8640aaagtggaca cgagaaccca agaaccgaaa gaaggcacga agaaactaat gaaaataaca 8700gcagagtggc tttggaaaga attagggaag aaaaagacac ccaggatgtg caccagagaa 8760gaattcacaa gaaaggtgag aagcaatgca gccttggggg ccatattcac tgatgagaac 8820aagtggaagt cggcacgtga ggctgttgaa gatagtaggt tttgggagct ggttgacaag 8880gaaaggaatc tccatcttga aggaaagtgt gaaacatgtg tgtacaacat gatgggaaaa 8940agagagaaga agctagggga attcggcaag gcaaaaggca gcagagccat atggtacatg 9000tggcttggag cacgcttctt agagtttgaa gccctaggat tcttaaatga agatcactgg 9060ttctccagag agaactccct gagtggagtg gaaggagaag ggctgcacaa gctaggttac 9120attctaagag acgtgagcaa gaaagaggga ggagcaatgt atgccgatga caccgcagga 9180tgggatacaa aaatcacact agaagaccta aaaaatgaag agatggtaac aaaccacatg 9240gaaggagaac acaagaaact agccgaggcc attttcaaac taacgtacca aaacaaggtg 9300gtgcgtgtgc aaagaccaac accaagaggc acagtaatgg acatcatatc gagaagagac 9360caaagaggta gtggacaagt tggcacctat ggactcaata ctttcaccaa tatggaagcc 9420caactaatca gacagatgga gggagaagga gtctttaaaa gcattcagca cctaacaatc 9480acagaagaaa tcgctgtgca aaactggtta gcaagagtgg ggcgcgaaag gttatcaaga 9540atggccatca gtggagatga ttgtgttgtg aaacctttag atgacaggtt cgcaagcgct 9600ttaacagctc taaatgacat gggaaagatt aggaaagaca tacaacaatg ggaaccttca 9660agaggatgga atgattggac acaagtgccc ttctgttcac accatttcca tgagttaatc 9720atgaaagacg gtcgcgtact cgttgttcca tgtagaaacc aagatgaact gattggcaga 9780gcccgaatct cccaaggagc agggtggtct ttgcgggaga cggcctgttt ggggaagtct 9840tacgcccaaa tgtggagctt gatgtacttc cacagacgcg acctcaggct ggcggcaaat 9900gctatttgct cggcagtacc atcacattgg gttccaacaa gtcgaacaac ctggtccata 9960catgctaaac atgaatggat gacaacggaa gacatgctga cagtctggaa cagggtgtgg 10020attcaagaaa acccatggat ggaagacaaa actccagtgg aaacatggga ggaaatccca 10080tacttgggga aaagagaaga ccaatggtgc ggctcattga ttgggttaac aagcagggcc 10140acctgggcaa agaacatcca agcagcaata aatcaagtta gatcccttat aggcaatgaa 10200gaatacacag attacatgcc atccatgaaa agattcagaa gagaagagga agaagcagga 10260gttctgtggt agaaagcaaa actaacatga aacaaggcta gaagtcaggt cggattaagc 10320catagtacgg aaaaaactat gctacctgtg agccccgtcc aaggacgtta aaagaagtca 10380ggccatcata aatgccatag cttgagtaaa ctatgcagcc tgtagctcca cctgagaagg 10440tgtaaaaaat ccgggaggcc acaaaccatg gaagctgtac gcatggcgta gtggactagc 10500ggttagggga gacccctccc ttacaaatcg cagcaacaat gggggcccaa ggcgagatga 10560agctgtagtc tcgctggaag gactagaggt tagaggagac ccccccgaaa caaaaaacag 10620catattgacg ctgggaaaga ccagagatcc tgctgtctcc tcagcatcat tccaggcaca 10680gaacgccaga aaatggaatg gtgctgttga atcaacaggt tct 10723

* * * * *


uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed