U.S. patent application number 12/601386 was filed with the patent office on 2010-08-19 for polynucleotide markers.
This patent application is currently assigned to SYNGENTA PARTICIPATIONS AG. Invention is credited to Johannes Jacobus Ludgerus Gielen, Thomas Kraft, Pierre Pin.
Application Number | 20100209919 12/601386 |
Document ID | / |
Family ID | 39529427 |
Filed Date | 2010-08-19 |
United States Patent
Application |
20100209919 |
Kind Code |
A1 |
Gielen; Johannes Jacobus Ludgerus ;
et al. |
August 19, 2010 |
POLYNUCLEOTIDE MARKERS
Abstract
The invention relates to polynucleotides that are closely linked
to the bolting gene or B gene within the sugar beet genome and can
be used for the development of molecular markers. The invention
further relates to molecular markers and kits comprising said
markers that can be used for mapping, identification and isolation
of the bolting gene or S gene in the sugar beet genome and to
discriminate between the annual and bienniai genotype or between
different haplotypes within plant groupings of sugar beet plants
exhibiting a biennial genotype. The invention also relates to
assays and methods of breeding sugar beet plants involving said
markers.
Inventors: |
Gielen; Johannes Jacobus
Ludgerus; (Bouloc, FR) ; Kraft; Thomas; (Lund,
SE) ; Pin; Pierre; (Malmo, SE) |
Correspondence
Address: |
SYNGENTA BIOTECHNOLOGY, INC.;PATENT DEPARTMENT
3054 CORNWALLIS ROAD, P.O. BOX 12257
RESEARCH TRIANGLE PARK
NC
27709-2257
US
|
Assignee: |
SYNGENTA PARTICIPATIONS AG
Basel
CH
|
Family ID: |
39529427 |
Appl. No.: |
12/601386 |
Filed: |
May 23, 2008 |
PCT Filed: |
May 23, 2008 |
PCT NO: |
PCT/EP08/56390 |
371 Date: |
February 26, 2010 |
Current U.S.
Class: |
435/5 ;
435/320.1; 435/6.12; 536/23.6; 536/24.33 |
Current CPC
Class: |
C07K 14/415
20130101 |
Class at
Publication: |
435/6 ; 536/23.6;
435/320.1; 536/24.33 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/04 20060101 C07H021/04; C12N 15/74 20060101
C12N015/74 |
Foreign Application Data
Date |
Code |
Application Number |
May 23, 2007 |
EP |
07108777.9 |
Claims
1-63. (canceled)
64. An isolated nucleic acid molecule having at least 95%, 90%,
85%, 80% or 75% sequence identity to SEQ ID NO: 52, wherein the
nucleic acid encodes a polypeptide associated with bolting in sugar
beet.
65. The isolated nucleic acid molecule of claim 64, wherein the
nucleic acid comprises SEQ ID NO: 52.
66. An isolated nucleic acid molecule encoding a polypeptide having
at least 95%, 90%, 85%, 80% or 75% sequence identity to SEQ ID NO:
6, wherein the polypeptide is associated with bolting in sugar
beet.
67. The isolated nucleic acid molecule of claim 66, wherein the
nucleic acid molecule encodes a polypeptide comprising the amino
acid sequence of SEQ ID NO: 6.
68. An expression vector comprising a nucleic acid molecule
comprising the nucleic acid sequence of claim 64.
69. An amplicon or informative fragment thereof comprising the
nucleic acid sequence selected from the group consisting of SEQ ID
NO: 5, SEQ ID NO: 51, SEQ ID NO: 52 or any allelic variations
thereof, wherein the amplicon or informative fragment can be used
to identify the absence or presence of an allele associated with
annuality in a sugar beet plant.
70. A polynucleotide including an informative fragment thereof,
comprising a nucleotide sequence that has the nucleotide sequence
depicted in SEQ ID NO: 5 or variants thereof, wherein said variants
comprise a nucleotide sequence selected from the group of
nucleotide sequences consisting of: a) a sequence having a G at
position 3695, a C at position 3827, a T at position 3954, a T at
position 5284, a G at position 5714, a G at position 10954, a T at
position 11043, a C at position 11143, a C at position 11150, an A
at position 11220, a C at position 11238, an A at position 11299,
an A at position 11391, a G at position 12053, a G at position
12086, a T at position 12127, an A at position 12193, a G at
position 12337, and a G at position 12837, representing annual
allele 1; or b) a sequence having a G at position 3695, an A at
position 3827, an A at position 3954, a C at position 5284, a T at
position 5714, an A at position 10954, a G at position 11043, a C
at position 11143, a C at position 11150, a C at position 11220, a
C at position 11238, a T at position 11299, a G at position 11391,
an A at position 12053, a G at position 12086, a C at position
12127, a G at position 12193, a G at position 12337, and an A at
position 12837, representing biennial allele 7.
71. A method of identifying the absence or presence of an allele
associated with annuality in a sugar beet plant, the method
comprising: a) obtaining a genomic sample from a sugar beet plant;
b) contacting the genomic sample comprising DNA with a pair of
primers that, when used in a nucleic-acid amplification reaction
with genomic DNA from sugar beet; produces an amplicon that can be
used to identify the absence or presence of an allele associated
with annuality. c) amplifying a fragment from said genomic sample
using the primer pair of b) wherein the primer pair is
complementary and binds to the nucleotide sequence of b) d)
detecting the amplicon that can be used to identify the absence or
presence of an allele associated with annuality in a sugar beet
plant.
72. The method of claim 71, wherein the genomic region from which
the fragment is amplified comprises SEQ ID NO: 5 or any allelic
variations thereof.
73. The method of claim 71, wherein said amplicon comprises a
polymorphism that is diagnostic for the B allele at the B locus and
allows to discriminate between the annual and biennial genotype or
between different haplotypes within plant groupings of sugar beet
plants exhibiting a biennial or annual genotype.
74. The method of claim 73, wherein the polymorphism is located at
position 3827, 3954, 5284, 5714, 10954, 11220, 11391, 12053, 12127,
or 12837 in the B locus of the sugar beet genome.
75. The method of claim 73, wherein the primer pair amplifies an
informative fragment from a coding region of the BVPRR7 gene
comprising a single nucleotide polymorphism comprising a A/C. SNP
at position 3827, a A/T SNP at position 3954, a T/G SNP at position
5714, a C/A SNP at position 11220, a G/A SNP at position 11391, a
A/G SNP at position 12053, or a C/T SNP at position 12127
76. The method of claim 71, wherein the amplified fragment from
said genomic sample comprises the nucleic acid sequence or
informative fragments selected from the group consisting of SEQ ID
NO: 5, SEQ ID NO: 51, SEQ ID NO: 52.
77. The method of claim 71, wherein the primer pair is
complementary and binds to a nucleotide sequence present in the
promoter region of the BvPRRR7 gene as depicted in SEQ ID NO:
51.
78. The method of claim 71, wherein the method is used to identify
annual seed contaminations in commercial biennial sugar beet
seed.
79. The method of claim 71, wherein the primer pair comprises the
nucleic acid sequence selected from the group consisting of SEQ ID
NO: 7, SEQ ID NO: 8, SEQ ID NO: 27, or SEQ ID NO: 28.
80. A method of identifying the absence or presence of an allele
associated with annuality in a sugar beet plant the method
comprising: a) obtaining a genomic sample from a sugar beet plant;
e) contacting the genomic sample comprising DNA with a probe,
wherein the probe hybridizes under high stringency conditions with
genomic DNA from sugar beet and can identify the absence or
presence of an allele associated with annuality. b) Subjecting the
sample and probe to high stringency hybridization conditions; and
c) Detecting the hybridization of the probe to the DNA wherein the
presence or absence of hybridization can be used to identify the
absence or presence of an allele associated with annuality in a
sugar beet plant.
81. The method of claim 80, wherein the genomic region for which
the probe hybridizes under high stringency conditions comprises SEQ
ID NO: 5 or allelic variations thereof.
82. An allelic discrimination assay for detecting a polymorphism in
a genomic region of the sugar beet genome co-segregating with the
annuality phenotype, wherein the polymorphism is diagnostic for the
B allele at the B locus and allows to discriminate between the
annual and biennial genotype comprising a molecular marker, the
assay comprising: a) obtaining a genomic sample from a sugar beet
plant; b) contacting the genomic sample comprising DNA with a pair
of primers that, when used in a nucleic-acid amplification reaction
with genomic DNA from sugar beet; produces an amplicon that can be
used to identify the absence or presence of an allele associated
with annuality. c) amplifying a fragment from said genomic sample
using the primer pair of b) wherein the primer pair is
complementary and binds to the nucleotide sequence of b) d)
detecting the amplicon that can be used to identify the absence or
presence of an allele associated with annuality in a sugar beet
plant.
83. The assay of claim 82, wherein the primer pair comprises the
nucleic acid sequence selected from the group consisting of SEQ ID
NO: 7, SEQ ID NO: 8, SEQ ID NO: 27, or SEQ ID NO: 28.
84. A pair of primers which anneals to a nucleotide sequence within
the coding region of the BvPRR7 gene as depicted in SEQ ID NO: 5
and amplifies an informative fragment from said coding sequence
comprising a polymorphism, wherein the polymorphism comprises at
least one of the SNPs selected from the group consisting of a A/C
SNP at position #3827, an A/T SNP at position #3954, a T/G SNP at
position #5714, a C/A SNP at position #11220, a G/A SNP at position
#11391, a A/G SNP at position #12053, or a C/T SNP at position
#12127.
85. The pair of primers of claim 84 comprising a forward primer
F3806 as depicted in SEQ ID NO 27 and a reverse primer R3807 as
depicted in SEQ ID NO 28 for amplifying a fragment comprising SNP
#3827.
86. The pair of primers of claim 84 comprising a forward primer
PRR7-F as depicted in SEQ ID NO: 7 and a reverse primer PRR7-R as
depicted in SEQ ID NO: 8 for amplifying a fragment comprising SNP
#160.
Description
[0001] The present invention is in the area of marker-assisted
breeding and quality control of sugar beet seed. In particular, the
invention relates to polynucleotides that are closely linked to or
residing within the bolting gene or B gene within the sugar beet
genome and can be used for the development of molecular markers.
The invention further relates to molecular markers and kits
comprising said markers that can be used for mapping,
identification and isolation of the bolting gene or B gene in the
sugar beet genome and to discriminate between the annual and
biennial genotype or between different haplotypes within plant
groupings of sugar beet plants exhibiting a biennial genotype. The
invention further relates to transgenic approaches, wherein
transgenic plants are provided with the B gene either being
overexpressed or down-regulated.
[0002] The cultivated sugar beet (Beta vulgaris ssp. vulgaris L.)
is a biennial plant which forms a storage root and a leaf rosette
in the first year. Shoot elongation (bolting) and flower formation
starts after a period of low temperature. In contrast, many wild
beets of the genus B. vulgaris ssp. maritime show an annual growing
habit due to the presence of the bolting gene B at the B locus,
which was mapped to the central region of chromosome II. The
dominant allele of locus B. is abundant in wild beets and causes
bolting under long days without the cold requirement usually
essential for biennial cultivars (Abe et al., 1997) carrying the
recessive allele.
[0003] Bolting (stem elongation) is the first step clearly visible
in the transition from vegetative to reproductive growth.
[0004] In cultivated sugar beet, bolting is an undesirable
phenomenon, as it results in reduction of yield and gives rise to
problems during harvesting and sugar extraction. Owing to the
incomplete penetrance of the B allele and its environmental
dependence, closely linked molecular markers are needed to screen
its presence in breeding lines.
[0005] Commercial seed productions for sugar beet are often done in
regions, where annual weed beets are growing, which can cause
pollen contamination in the seed productions, resulting in annuals
in the commercial seed. This is not acceptable to the customers. To
identify contaminations with annuals, commercial seed lots are
grown in regions where no wild annual beets are growing directly
after harvesting the seed. The plants are not vernalized and
contaminations are identified by the presence of bolters. Replacing
this test with a marker-based screening assay would be highly
desirable, as results could be obtained earlier, which would lead
to cost savings in seed processing.
[0006] A marker-based approach could also be advantageously used in
sugar beet breeding, e.g., to speed up the breeding process, or to
introduce new variation from wild sea beets. In these cases, it is
important to have a marker tightly linked to the B gene to be able
to select annuals or biennials accurately.
[0007] The present invention now provides the means to develop such
markers.
[0008] In particular, the present invention relates to a
polynucleotide, particularly an isolated polynucleotide, identified
in the sugar beet genome including variants and derivatives
thereof, which polynucleotide is genetically closely linked to, or,
preferably, located within the bolting gene or B gene. The
invention further relates to the use of said polynucleotide for the
development of markers that can be used for mapping, identification
and isolation of the bolting gene or B gene in the sugar beet
genome.
[0009] In one aspect of the invention, the polynucleotide according
to the invention shows perfect co-segregation with the bolting gene
(B gene) associated phenotype in sugar beet.
[0010] In one embodiment, the invention relates to a polynucleotide
including informative fragments thereof according to the invention
and as described herein before, which polynucleotide is obtainable
from a genomic DNA region that maps at a distance of 1 cM upstream
of markers MP0176 and GJQI and co-segregates with marker GJ131,
shows perfect co-segregation with the bolting gene (B gene)
associated phenotype in sugar beet.
[0011] In another embodiment, the invention relates to a
polynucleotide including informative fragments thereof,
particularly an isolated polynucleotide, according to the invention
and as described herein before which is obtainable from a genomic
DNA located in the interval delimited by markers a GJ131 and
GJ01.
[0012] In one embodiment of the invention, a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, is provided which polynucleotide is obtainable from
a genomic sugar beet DNA genetically linked to the bolting gene or
B gene in the sugar beet genome and comprises one or more of the
following elements: [0013] a) an intronic region that yields an
amplification product of approximately 0.5 kb in a PCR reaction
with forward primer PRR7-F and reverse primer PRR7-R as given in
SEQ ID NO: 7 and SEQ ID NO: 8, respectively, or a primer pair
having at least 90%, particularly at least 95%, more particularly
at least 98% and up to 99% sequence identity with a sequence as
given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, when using
genomic sugar beet DNA as a template, particularly a polynucleotide
fragment exhibiting a nucleotide sequence as depicted in SEQ ID NO:
2, 3 or 4, or a sequence that has at least 70%, particularly at
least 75%, more particularly at least 80%, even more particularly
at least 85%, but especially at least 90% and up to at least
95%-99% sequence identity therein; [0014] b) a polynucleotide
fragment comprising a nucleotide sequence which has 70%,
particularly 75%, more particularly 80%, even more particularly
85%, but especially 90% and up to 95%-99% sequence identity with a
nucleotide sequence as depicted in SEQ ID NO:1 or SEQ ID NO: 52;
[0015] c) a polynucleotide fragment comprising a nucleotide
sequence as depicted in SEQ ID NO: 5 or a sequence which has 70%,
particularly 75%, more particularly 80%, even more particularly
85%, but especially 90% and up to 95%-99% sequence identity with a
nucleotide sequence as depicted in SEQ ID NO: 5 or SEQ ID NO: 51;
[0016] d) a polynucleotide fragment which, after splicing, encodes
a polypeptide which has at least 80%, particularly at least 85%,
more particularly at least 90%, even more particularly at least
95%, but especially at least 98% and up to 100% sequence identity
with a nucleotide sequence shown in SEQ ID NO: 6 and, optionally,
in addition [0017] e) a highly conserved portion encoding a Pseudo
Response Regulator Receiver Domain motif (PRR) near the
NH.sub.2-terminus and a CCT motif at the COOH-terminus.
[0018] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, comprising an intronic region that yields an
amplification product of approximately 0.5 kb in a PCR reaction
with forward primer PRR7-F and reverse primer PRR7-R as given in
SEQ ID NO: 7 and SEQ ID NO: 8, respectively, or a primer pair
having at least 90%, particularly at least 95%, more particularly
at least 98% and up to 99% sequence identity with a sequence as
given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, when using
genomic sugar beet DNA as a template.
[0019] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, comprising a polynucleotide fragment exhibiting a
nucleotide sequence as depicted in SEQ ID NO: 1, or a sequence that
has at least 70%, particularly at least 75%, more particularly at
least 80%, even more particularly at least 85% but especially at
least 90% and up to at least 95%-99% sequence identity therein.
[0020] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, comprising a polynucleotide fragment exhibiting a
nucleotide sequence as depicted in SEQ ID NO: 2, 3 or 4, or a
sequence that has at least 70%, particularly at least 75%, more
particularly at least 80%, even more particularly at least 85%, but
especially at least 90% and up to at least 95%-99% sequence
identity therein.
[0021] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, which, after splicing, encodes a polypeptide which
has at least 80%, particularly at least 85%, more particularly at
least 90%, even more particularly at least 95%, but especially at
least 98% and up to 100% sequence identity with a nucleotide
sequence shown in SEQ ID NO: 6
[0022] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, comprising a polynucleotide fragment comprising a
nucleotide sequence as depicted in SEQ ID NO: 5 or a sequence which
has at least 70%, particularly at least 75%, more particularly at
least 80%, even more particularly at least 85%, but especially at
least 90% and up to at least 95%-99% sequence identity with a
nucleotide sequence as depicted in SEQ ID NO: 5.
[0023] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, comprising a polynucleotide fragment comprising a
nucleotide sequence as depicted in SEQ ID NO: 51 or a sequence
which has at least 70%, particularly at least 75%, more
particularly at least 80%, even more particularly at least 85%, but
especially at least 90% and up to at least 95%-99% sequence
identity with a nucleotide sequence as depicted in SEQ ID NO
51.
[0024] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, comprising a polynucleotide fragment comprising a
nucleotide sequence as depicted in SEQ ID NO: 52 or a sequence
which has at least 70%, particularly at least 75%, more
particularly at least 80%, even more particularly at least 85%, but
especially at least 90% and up to at least 95%-99% sequence
identity with a nucleotide sequence as depicted in SEQ ID NO:
52.
[0025] All individual numerical values, which fall into the range
from between 70%-99% as mentioned herein before, i.e., 71%, 72%,
73%, 74%, 75%, . . . 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99% should likewise be covered by the present invention.
[0026] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, comprising a polynucleotide fragment wherein the
complementary strand of said polynucleotide fragment is capable of
hybridizing with a nucleotide sequence depicted in SEQ ID NO: 1,
particularly under moderate hybridization conditions, more
particularly under stringent hybridization conditions.
[0027] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, comprising a polynucleotide fragment wherein the
complementary strand of said polynucleotide fragment is capable of
hybridizing with a nucleotide sequence depicted in SEQ ID NO: 2, 3
or 4 particularly under moderate hybridization conditions, more
particularly under stringent hybridization conditions.
[0028] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, comprising a polynucleotide fragment wherein the
complementary strand of said polynucleotide fragment is capable of
hybridizing with a nucleotide sequence depicted in SEQ ID NO: 5,
particularly under moderate hybridization conditions, more
particularly under stringent hybridization conditions.
[0029] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, comprising a polynucleotide fragment wherein the
complementary strand of said polynucleotide fragment is capable of
hybridizing with a nucleotide sequence depicted in SEQ ID NO: 51,
particularly under moderate hybridization conditions, more
particularly under stringent hybridization conditions.
[0030] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, comprising a polynucleotide fragment wherein the
complementary strand of said polynucleotide fragment is capable of
hybridizing with a nucleotide sequence which encodes a polypeptide
having an amino acid sequence as depicted in SEQ ID NO: 6,
particularly under moderate hybridization conditions, more
particularly under stringent hybridization conditions.
[0031] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof, particularly an isolated
polynucleotide, comprising a polynucleotide fragment wherein the
complementary strand of said polynucleotide fragment is capable of
hybridizing with a nucleotide sequence depicted in SEQ ID NO: 52,
particularly under moderate hybridization conditions, more
particularly under stringent hybridization conditions.
[0032] In one embodiment of the invention, a polynucleotide is
provided including an informative fragment thereof, particularly an
isolated polynucleotide, which polynucleotide is obtainable from a
genomic sugar beet DNA genetically linked to the bolting gene or B
gene in the sugar beet genome [0033] a) by screening a BAC library
developed from the biennial commercial cultivar H20 using forward
primer PRR7-F and reverse primer PRR7-R as given in SEQ ID NO: 7
and SEQ ID NO: 8, respectively, or a primer pair having at least
90%, particularly at least 95%, more particularly at least 98% and
up to 99% sequence identity with a sequence as given in SEQ ID NO 7
and SEQ ID NO 8, respectively, in a PCR reaction, particularly
under the following conditions: [0034] primary denaturation at
95.degree. C. for 5 min; followed by [0035] 35 amplification cycles
of 30 seconds at 95.degree. C., [0036] 30 seconds at 60.degree. C.;
[0037] 30 seconds at 72.degree. C.; and followed by [0038] 5 min at
72.degree. C. [0039] b) selecting BAC SBA079-L24 comprising two
non-overlapping contigs both sharing sequence homology with EST
CV301305 as given in SEQ ID NO: 1 and combining them into one
single sequence; [0040] c) obtaining the gene structure of the beet
BvPRR7 gene comprising introns and exons based on the alignment of
the BAC sequence contigs to EST CV301305 as given in SEQ ID NO:1
and on sequence homology to the PRR7 gene from Arabidopsis.
[0041] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO: 1.
[0042] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO: 2.
[0043] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO: 3.
[0044] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO 4.
[0045] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO: 5.
[0046] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO: 51.
[0047] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO: 52.
[0048] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence
has a G at position 3695, a C at position 3827, a T at position
3954, a T at position 5284, a G at position 5714, a G at position
10954, a T at position 11043, a C at position 11143, a C at
position 11150, an A at position 11220, a C at position 11238, an A
at position 11299, an A at position 11391, a G at position 12053, a
G at position 12086, a T at position 12127, an A at position 12193,
a G at position 12337, and a G at position 12837, representing
annual allele 1.
[0049] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence
has a T at position 3695, a C at position 3827, a T at position
3954, a T at position 5284, a G at position 5714, a G at position
10954, a T at position 11043, a C at position 11143, a C at
position 11150, an A at position 11220, an A at position 11238, an
T at position 11299, an A at position 11391, a G at position 12053,
a G at position 12086, a T at position 12127, a G at position
12193, a G at position 12337, and a G at position 12837,
representing annual allele 2.
[0050] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence
has a G at position 3695, a C at position 3827, a T at position
3954, a T at position 5284, a G at position 5714, a G at position
10954, a G at position 11043, a T at position 11143, a C at
position 11150, an A at position 11220, a C at position 11238, a T
at position 11299, an A at, position 11391, a G at position 12053,
a G at position 12086, a T at position 12127, a G at position
12193, a G at position 12337, and a G at position 12837,
representing annual allele 3.
[0051] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO 5, wherein said sequence
has a G at position 3695, a C at position 3827, a T at position
3954, a T at position 5284, a G at position 5714, a G at position
10954, a T at position 11043, a C at position 11143, a T at
position 11150, an A at position 11220, a C at position 11238, a T
at position 11299, an A at position 11391, a G at position 12053, a
G at position 12086, a T at position 12127, an A at position 12193,
a G at position 12337, and a G at position 12837, representing
annual allele 4.
[0052] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence
has a G at position 3695, a C at position 3827, a T at position
3954, a T at position 5284, a G at position 5714, a G at position
10954, a T at position 11043, a C at position 11143, a C at
position 11150, an A at position 11220, a C at position 11238, a T
at position 11299, an A at position 11391, a G at position 12053,
an A at position 12086, a T at position 12127, an A at position
12193, an A at position 12337, and a G at position 12837,
representing annual allele 5.
[0053] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence
has a G at position 3695, a C at position 3827, a T at position
3954, a T at position 5284, a G at position 5714, a G at position
10954, a T at position 11043, a C at position 11143, a C at
position 11150, an A at position 11220, a C at position 11238, a T
at position 11299, an A at position 11391, a G at position 12053, a
G at position 12086, a T at position 12127, an A at position 12193,
an A at position 12337, and a G at position 12837, representing
annual allele 6.
[0054] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence
has a G at position 3695, an A at position 3827, an A at position
3954, a C at position 5284, a T at position 5714, an A at position
10954, a G at position 11043, a C at position 11143, a C at
position 11150, a C at position 11220, a C at position 11238, a T
at position 11299, a G at position 11391, an A at position 12053, a
G at position 12086, a C at position 12127, a G at position 12193,
a G at position 12337, and an A at position 12837, representing
biennial allele 7.
[0055] In a specific embodiment, the polynucleotide according to
the invention comprises a nucleotide sequence that has the
nucleotide sequence which encodes a polypeptide having an amino
acid sequence as depicted in SEQ ID NO: 6.
[0056] In one embodiment, the invention relates to an amplification
product of approximately 0.5 kb including an informative fragment,
which is obtainable in a PCR reaction with forward primer PRR7-F
and reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NO:
8, respectively, when using genomic sugar beet DNA as a
template.
[0057] In a specific embodiment of the invention, a set of
polynucleotide markers is provided comprising a plurality of
individual markers which markers are developed based on a
polynucleotide as depicted in SEQ ID NO: 5 including any of its
allelic variants 1 to 7 as disclosed herein before and are capable
of detecting the various SNPs at the nucleotide positions given in
Table 5, wherein said set of markers is capable of identifying the
different alleles and thus of differentiating between annual and
biennial sugar beet lines.
[0058] In one embodiment, the invention relates to one or a
plurality of probe molecules and/or to one or a plurality of
primers, particularly one or a plurality of primer pairs, but
especially one or a plurality of primer pairs consisting of a
forward primer and a reverse primer, which primers are capable of
annealing to a nucleotide sequence within a genomic region of the
sugar beet genome that is genetically closely linked to the B gene,
but particularly to a region within the B gene, and which comprises
a polynucleotide according to the invention and as described herein
before including an informative fragment thereof, wherein said
fragment comprises a polymorphism, particularly a polymorphism that
is based on an SNP, an SSR, a deletion or an insertion of at least
one nucleotide, but especially a polymorphism based on an SNP,
which polymorphism is diagnostic for the B allele at the B locus
and allows to discriminate between the annual and biennial genotype
or between different haplotypes within plant groupings of sugar
beet plants exhibiting a biennial or annual genotype.
[0059] In one embodiment of the invention, a polynucleotide marker
is provided which can be developed from a polynucleotide molecule
or an informative fragment thereof selected from the group of
polynucleotides as depicted in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:
3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 51, SEQ ID NO: 52 and a
polynucleotide encoding a polypeptide comprising a amino acid
sequence as depicted in SEQ ID NO: 6, wherein said polynucleotide
comprises one or more polymorphisms, particularly a polymorphism
that is based on an SNP, an SSR, a deletion or an insertion of at
least one nucleotide, but especially a polymorphism based on an
SNP, which polymorphism is diagnostic for the B allele at the B
locus and allows to discriminate between the annual and biennial
genotype or between different haplotypes within a plant grouping of
sugar beet plants exhibiting a biennial or annual genotype.
[0060] In a specific embodiment of the invention, a polynucleotide
marker is provided which is developed based on a polynucleotide as
depicted in SEQ ID NO: 2, which marker is capable of detecting at
least one of the following SNPs in the 3.sup.rd intron of the
BvPRR7 gene: [0061] a) a cytosine or a thymine at position 87
[0062] b) a cytosine or thymine at position 160 [0063] c) an
adenine or a guanine at position 406 and thus of differentiating
between annual and biennial haplotypes.
[0064] In one embodiment, said polynucleotide marker is represented
by one or a plurality of probe molecules and/or to one or a
plurality of primers, particularly one or a plurality of primer
pairs, but especially a pair of primers consisting of a forward
primer and a reverse primer which primers are capable of annealing
to a nucleotide sequence within a genomic region of the sugar beet
genome that is genetically closely linked to the B gene and
exhibits the nucleotide sequences as shown in SEQ ID NO:2 and of
amplifying an informative fragment thereof, wherein said fragment
comprises one or more polymorphisms, particularly a polymorphism
that is based on an SNP, an SSR, a deletion or an insertion of at
least one nucleotide, but especially a polymorphism based on an SNP
as shown, for example, in Table 1, which polymorphism is diagnostic
for the B allele at the B locus and allows to discriminate between
plants having an annual and a biennial genotype or between
different haplotypes within a plant grouping of sugar beet plants
exhibiting a biennial or annual genotype.
[0065] In a specific embodiment, a pair of primers is provided
according to the invention and as described herein before, which
anneals to a nucleotide sequence within the 3.sup.rd intron as
depicted in SEQ ID NO: 2 and amplifies an informative fragment from
said region comprising a polymorphism, particularly a polymorphism
comprising a C/T SNP at position #87 and/or a UT SNP at position
#160 and/or an A/G SNP at position #406.
[0066] In particular, a pair of primers comprises a forward primer
PRR7-F as depicted in SEQ ID NO: 7 and a reverse primer PRR7-R as
depicted in SEQ ID NO: 8 for amplifying a fragment comprising the
SNP #160, SNP #87 and SNP #406.
[0067] In one embodiment, the polynucleotide marker according to
the invention is represented by one or a plurality of probe
molecules and/or to one or a plurality of primers, particularly one
or a plurality of primer pairs, but especially a pair of primers
consisting of a forward primer and a reverse primer which primers
are capable of annealing to a nucleotide sequence within a genomic
region of the sugar beet genome that is genetically closely linked
to the B gene, particularly to a nucleotide sequence within the B
gene, particularly to a nucleotide sequence as shown in SEQ ID NO 5
and of amplifying an informative fragment thereof, wherein said
fragment comprises one or more polymorphisms, particularly a
polymorphism that is based on an SNP, an SSR, a deletion or an
insertion of at least one nucleotide, but especially a polymorphism
based on an SNP as shown, for example, in Table 5, which
polymorphism is diagnostic for the B allele at the B locus and
allows to discriminate between plants having an annual and a
biennial genotype or between different haplotypes within a plant
grouping of sugar beet plants exhibiting a biennial or annual
genotype.
[0068] In a specific embodiment, a pair of primers is provided
according to the invention and as described herein before, which
anneals to a nucleotide sequence within the coding region of the
BvPRR7 gene as depicted in SEQ ID NO: 5 and amplifies an
informative fragment from said coding sequence comprising a
polymorphism, particularly a polymorphism comprising an A/C SNP at
position #3827 and/or an A/T SNP at position #3954 and/or a T/G SNP
at position #5714 and/or a C/A SNP at position #11220, and/or a G/A
SNP at position #11391, and/or an A/G SNP at position #12053,
and/or a C/T SNP at position #12127.
[0069] In particular, a first pair of primers comprises a forward
primer F3806 as depicted in [0070] SEQ ID NO 27 and a reverse
primer R3807 as depicted in SEQ ID NO 28 for amplifying a fragment
comprising the SNP #3827 and SNP #3954.
[0071] A second pair of primers comprises a forward primer F3768 as
depicted in SEQ ID NO 21 and a reverse primer R3769 as depicted in
SEQ ID NO 22 for amplifying a fragment comprising the SNP
#5714.
[0072] A third pair of primers comprises a forward primer F3857 as
depicted in SEQ ID NO 37 and a reverse primer R3858 as depicted in
SEQ ID NO 38 for amplifying a fragment comprising the SNP
#11220.
[0073] A fourth pair of primers comprises a forward primer F3859 as
depicted in SEQ ID NO 39 and a reverse primer R3860 as depicted in
SEQ ID NO 40 for amplifying a fragment comprising the SNP
#11391.
[0074] A fifth pair of primers comprises a forward primer F3861 as
depicted in SEQ ID NO 41 and a reverse primer R3862 as depicted in
SEQ ID NO 42 for amplifying a fragment comprising the SNP #12053
and SNP #12127.
[0075] In one embodiment, the polynucleotide marker according to
the invention is represented by one or a plurality of probe
molecules and/or to one or a plurality of primers, particularly one
or a plurality of primer pairs, but especially a pair of primers
consisting of a forward primer and a reverse primer which primers
are capable of annealing to a nucleotide sequence within a genomic
region of the sugar beet genome that is genetically closely linked
to the B gene, particularly to a nucleotide sequence within the B
gene, particularly to a nucleotide sequence within the promoter
region of the PRR7 gene, particularly to a nucleotide sequence
within the promoter region of the PRR7 gene as shown in SEQ ID NO:
5 and SEQ ID NO: 51, respectively, and of amplifying an informative
fragment thereof, which is diagnostic for the B allele at the B
locus and allows to discriminate between plants having an annual
and a biennial genotype or between different haplotypes within a
plant grouping of sugar beet plants exhibiting a biennial or annual
genotype.
[0076] In a specific embodiment of the invention, a polynucleotide
marker is provided which is represented by a primer pair selected
from the group of primer pair F3808 (SEQ ID NO 29) and R3809 (SEQ
ID NO 30) yielding an amplification product of 0.6 Kb; primer pair
F3855 (SEQ ID NO 35) and R3809 (SEQ ID NO 30) yielding an
amplification product of 1.0 Kb; and primer pair F3855 (SEQ ID NO
35) and R3856 (SEQ ID NO 36) (Table 4) yielding an amplifications
product of 0.8, provided that a genomic DNA from biennial lines is
used as template, but does not provide amplification for the annual
lines.
[0077] Said informative fragment may further comprise one or more
polymorphisms, particularly a polymorphism that is based on an SNP,
an SSR, a deletion or an insertion of at least one nucleotide, but
especially a polymorphism based on an SNP, which is diagnostic for
the B allele at the B locus and allows to discriminate between
plants having an annual and a biennial genotype or between
different haplotypes within a plant grouping of sugar beet plants
exhibiting a biennial or annual genotype.
[0078] The invention further relates to one or a plurality of probe
molecules and/or to one or a plurality of primers, particularly one
or a plurality of primer pairs, but especially a pair of primers
consisting of a forward primer and a reverse primer which primers
are capable of annealing to a nucleotide sequence within a genomic
region of the sugar beet genome that is genetically closely linked
to the B gene, particularly to a nucleotide sequence within the B
gene, particularly to a nucleotide sequence within the promoter
region of the PRR7 gene, particularly to a nucleotide sequence
within the promoter region of the PRR7 gene as shown in SEQ ID NO:
5 and SEQ ID NO: 51, respectively, and of amplifying an informative
fragment thereof, which is diagnostic for the B allele at the B
locus and allows to discriminate between plants having an annual
and a biennial genotype or between different haplotypes within a
plant grouping of sugar beet plants exhibiting a biennial or annual
genotype.
[0079] In another specific embodiment of the invention, a primer
pair is provided selected from the group of primer pair F3808 (SEQ
ID NO 29) and R3809 (SEQ ID NO 30) yielding an amplification
product of 0.6 Kb; primer pair F3855 (SEQ ID NO 35) and R3809 (SEQ
ID NO 30) yielding an amplification product of 1.0 Kb; and primer
pair F3855 (SEQ ID NO 35) and R3856 (SEQ ID NO 36) (Table 4)
yielding an amplifications product of 0.8, provided that a genomic
DNA from biennial lines is used as template, but does not provide
amplification for the annual lines.
[0080] The above probe molecules and/or primers can be used in a
method of identifying annual contaminations in commercial sugar
beet seed.
[0081] In one embodiment, the invention relates to a set of probe
polynucleotides comprising at least two separate probe molecules
that are complementary to a sub-region within an informative
polynucleotide fragment according to the invention and as described
herein before comprising a polymorphic site and amplify partially
overlapping fragments which differ only by one or two base
mismatches in the area of overlap, wherein a first probe,
particularly a probe labelled with a first fluorescent dye, more
particularly with a first fluorescent dye and a quencher represents
one allele and a second probe, particularly a probe labelled with a
second fluorescent dye, which is not identical with the first dye,
more particularly with a second fluorescent dye and a quencher,
represents the other allele.
[0082] In a specific embodiment of the invention, said informative
polynucleotide fragment comprises a polymorphism, wherein said
polymorphism is based on SNP #3827, within the Pseudo-receiver
domain of the PRR7 gene depicted in SEQ ID NO: 5 and the first
probe molecule labelled with a first fluorescent dye, has a
nucleotide sequence as shown in SEQ ID NO: 47 and the second probe
molecule labelled with a second fluorescent dye, has a nucleotide
sequence as shown in SEQ ID NO: 48.
[0083] In one embodiment, the invention relates to the use of a
polynucleotide according to the invention and as described herein
before, or any informative fragment thereof, for developing a
marker that may be used in an allelic discrimination assay for
detecting a polymorphism in the sugar beet genome, which
polymorphism is diagnostic for the B allele at the B locus and
allows to discriminate between the annual and biennial genotype or
between different haplotypes within plant groupings of sugar beet
plants exhibiting a biennial genotype or for mapping the B gene to
the sugar beet genome.
[0084] In a specific embodiment, the invention relates to the use
of one or a plurality of primers, particularly one or a plurality
of primer pairs, according to the invention and as described herein
before in an allelic discrimination assay for detecting a
polymorphism in the sugar beet genome, particularly a polymorphism
that is based on an SNP, an SSR, a deletion or an insertion of at
least one nucleotide, but especially a polymorphism based on an
SNP, which polymorphism is diagnostic for the B allele at the B
locus and allows to discriminate between the annual and biennial
genotype or between different haplotypes within plant groupings of
sugar beet plants exhibiting a biennial genotype.
[0085] In another specific embodiment of the invention, a set of
probe molecules according to the invention and as described herein
before may in addition be employed in said allelic discrimination
assay.
[0086] In one embodiment, the invention relates to a method of
identifying the absence or presence of an allele associated with
annuality in a sugar beet plant, comprising [0087] a) obtaining a
genomic sample from a sugar beet plant to be analyzed, [0088] b)
analyzing the nucleotide sequence of the genomic region of the
sugar beet genome that is genetically closely linked to the B gene
and complementary to or comprises the sequence of a polynucleotide
according to the invention and as described herein before, and
[0089] c) comparing said sequence with an allelic sequence known to
be associated with the biennial phenotype and the annual phenotype,
respectively.
[0090] In one embodiment, the invention relates to a method of
identifying the absence or presence of an allele associated with
annuality in a sugar beet plant, comprising [0091] a) obtaining a
genomic sample from a sugar beet plant to be analyzed, [0092] b)
amplifying a fragment from said sample DNA using a primer,
particularly a primer pair, that is complementary and binds to a
nucleotide sequence present in the promoter region of the BvPRR7
gene, particularly the BvPRR7 as disclosed in SEQ ID NO: 51, and
[0093] c) comparing said sequence with an allelic sequence known to
be associated with the biennial phenotype but not with the annual
phenotype.
[0094] In one embodiment, the invention relates to a method of
identifying the absence or presence of an allele associated with
annuality in a sugar beet plant, comprising [0095] a) obtaining a
genomic sample from a sugar beet plant to be analyzed, [0096] b)
probing said sample DNA with a probe molecule comprising an
allele-specific sequence, particularly an allele-specific sequence
form the promoter region of the BvPRR7 gene, particularly the
BvPRR7 as disclosed in SEQ ID NO: 51, known to be present in the
biennial allele but not in the annual allele.
[0097] In a specific embodiment of the invention, a primer pair is
used in said method selected from the group of primer pair F3808
(SEQ ID NO 29) and R3809 (SEQ ID NO 30) yielding an amplification
product of 0.6 Kb; primer pair F3855 (SEQ ID NO 35) and R3809 (SEQ
ID NO 30) yielding an amplification product of 1.0 Kb; and primer
pair F3855 (SEQ ID NO 35) and R3856 (SEQ ID NO 36) (Table 4)
yielding an amplifications product of 0.8, provided that a genomic
DNA from biennial lines is used as template, but does not provide
amplification for the annual lines.
[0098] In one embodiment, the invention relates to a method of
identifying a specific haplotype within a plant grouping of sugar
beet plants exhibiting a biennial genotype comprising [0099] a)
obtaining a genomic sample from a sugar beet plant to be analyzed,
[0100] b) analyzing the nucleotide sequence of the genomic region
of the sugar beet genome that is genetically closely linked to the
B gene and complementary to or comprises the sequence of a
polynucleotide according to the invention and as described herein
before, and [0101] c) comparing said sequence with an allelic
sequence known to be associated with a specific haplotype.
[0102] In a specific embodiment, the sequence analysis is carried
out using a molecular marker based on a polynucleotide or an
informative fragment thereof or on one or a plurality of primers,
particularly on one or a plurality of primer pairs, but especially
on one or a plurality of primer pairs consisting of a forward
primer and a reverse primer according to the invention and as
described herein before.
[0103] In another specific embodiment, a method of identifying the
absence or presence of an allele associated with annuality in a
sugar beet plant is provided comprising [0104] a) obtaining a
genomic sample from a sugar beet plant to be analyzed, [0105] b)
analyzing the nucleotide sequence of an intronic region obtainable
from the sugar beet genome by PCR amplification based on forward
primer PRR7-F as depicted in SEQ ID NO: 7 and a reverse primer
PRR7-R as depicted in SEQ ID NO: 8, and [0106] c) comparing said
sequence with an allelic sequence known to be associated with the
biennial phenotype and the annual phenotype, respectively.
[0107] In one embodiment, the intronic region has at least 70%,
particularly at least 75%, more particularly at least 80%, even
more particularly at least 85%, but especially at least 90% and up
to at least 95%-99% sequence identity with the nucleotide sequence
depicted in SEQ ID NO: 2.
[0108] In still another specific embodiment the intronic region has
a nucleotide sequence as shown in SEQ ID NO: 2.
[0109] In another specific embodiment, a method of identifying the
absence or presence of an allele associated with annuality in a
sugar beet plant is provided, comprising [0110] a) obtaining a
genomic sample from a sugar beet plant to be analyzed, [0111] b)
analyzing the nucleotide sequence of a genomic region comprising a
nucleotide sequence as given in SEQ ID NO: 5, and [0112] c)
comparing said sequence with an allelic sequence known to be
associated with the biennial phenotype and the annual phenotype,
respectively, and [0113] d) determining whether said genomic sample
is from a genome representing an annual or a biennial
phenotype.
[0114] In still another specific embodiment, a method is provided
wherein within a genomic sample from a sugar beet plant the
intronic region of a polynucleotide according to the invention and
as described herein before is analyzed using a forward and a
reverse primer flanking a sub-region within said intronic region
known to comprise a polymorphic site, amplifying said sub-region
and comparing the amplified fragment with an allelic sequence known
to be associated with the biennial phenotype and the annual
phenotype, respectively.
[0115] In another specific embodiment, a method is provided as
described herein before, wherein a set of probe polynucleotides is
designed based on said SNP comprising two separate probe molecules
which differ by at least one mismatch, particularly by two or more
mismatches located at adjacent sites, but especially by one single
mismatch, wherein a first probe molecule, particularly a labelled
probe molecule, more particularly a probe molecule labelled with a
first fluorescent dye and a quencher, represents one allele and a
second probe molecule, particularly a labelled probe molecule, more
particularly a probe molecule labelled with a second fluorescent
dye and a quencher, which is not identical with the first dye,
represents the other allele, and wherein said set of probe
polynucleotides is used for discriminating between the two allelic
variants.
[0116] In particular, the markers according to the present
invention can be used in an allelic discrimination assay,
particularly in an assay for discriminating between different
haplotypes within plant groupings of sugar beet plants exhibiting a
biennial genotype. Said assay is based on a set of probe
polynucleotides comprising two separate probe molecules that are
complementary, for example, to a subregion of the BvPRR7 gene
obtainable by PCR amplification based on forward primer PRR7-F and
reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NO: 8,
respectively, which probe molecules differ only by one base
mismatch, particularly a base mismatch at position #631.
[0117] A first probe molecule, particularly a probe molecule which
has a sequence as depicted in SEQ ID NO: 9 and is labelled with a
first fluorescent dye such as, for example, FAM, more particularly
with a first fluorescent dye and a quencher, represents one allele
and a second probe molecule, particularly a probe molecule which
has a sequence as depicted in SEQ ID NO: 10 and is labelled with a
second fluorescent dye, which is not identical with the first dye,
such as, for example VIC, more particularly with a second
fluorescent dye and a quencher, represents the other allele.
[0118] In one embodiment, an allelic discrimination assay is
provided for detecting a polymorphism in a genomic region of the
sugar beet genome co-segregating with the annuality phenotype,
particularly a polymorphism that is based on an SNP, an SSR, a
deletion or an insertion of at least one nucleotide, but especially
a polymorphism based on an SNP, which polymorphism is diagnostic
for the B allele at the B locus and allows to discriminate between
the annual and biennial genotype, comprising a molecular marker
developed based on a polynucleotide according to the invention and
as described herein before or any informative fragment thereof.
[0119] In a specific embodiment, said molecular marker comprises a
pair of primers according to the invention and as described herein
before.
[0120] In another specific embodiment, an allelic discrimination
assay is provided for detecting a single-base polymorphism in an
intronic region obtainable from the sugar beet genome by PCR
amplification based on forward primer PRR7-F as depicted in SEQ ID
NO: 7 and a reverse primer PRR7-R as depicted in SEQ ID NO: 8,
comprising a set of primers and/or probe polynucleotides according
to the invention and as described herein before.
[0121] In one embodiment, the intronic region has at least 70%,
particularly at least 75%, more particularly at least 80%, even
more particularly at least 85%, but especially at least 90% and up
to at least 95%-99% sequence identity with the nucleotide sequence
depicted in SEQ ID NO: 2.
[0122] In still another specific embodiment the intronic region has
a nucleotide sequence as shown in SEQ ID NO: 2.
[0123] In one embodiment, the invention relates to the use of a
polynucleotide according to the invention and as described herein
before for the development of a molecular marker to be used for
identifying the absence or presence of an allele associated with
annuality in a sugar beet genome, comprising [0124] a) identifying
in said polynucleotide polymorphic sites [0125] b) associating said
polymorphisms with the absence or presence of an allele associated
with annuality in sugar beet by [0126] c) designing a probe
molecule or a plurality of probe molecules, particularly a primer
or a plurality of primers, particularly a pair of primers or a
plurality of primer pairs, but especially a forward and reverse
primer recognizing a nucleotide sequence flanking this polymorphic
site for amplification of a polynucleotide comprising said
polymorphic site that can be used in an allelic discrimination
assay.
[0127] In one embodiment, the invention relates to a method of
identifying annual contaminations in commercial seed using a
polynucleotide according to the invention and as described herein
before or an informative fragment thereof as a marker for
determining the presence or absence of the annuality allele in a
plant sample.
[0128] In particular, the invention relates to a method of
identifying annual contaminations in commercial seed using a
polynucleotide according to the invention and as described herein
before or an informative fragment thereof as a marker for
identifying annual contaminations in commercial seed.
[0129] In one embodiment, the invention relates to a method of
identifying annual contaminations in commercial seed using a
marker-based allelic discrimination assay according to the
invention and as described herein before.
[0130] The invention further relates to the use of the B gene,
particularly the BvPRR7 gene, in a transgenic approach for
producing plants exhibiting an annual or an non-bolting
phenotype.
[0131] In particular, the invention relates to chimeric constructs
comprising an expression cassette comprising the coding sequence of
the B gene, particularly the BvPRR7 coding sequence as depicted in
SEQ ID NO:1, but particularly in SEQ ID NO: 52 or a sequence that
has at least 70%, particularly at least 75%, more particularly at
least 80%, even more particularly at least 85%, but especially at
least 90% and up to at least 95%-99% sequence identity therein
under the control of regulatory elements, particularly under the
control of regulatory elements functional in plants.
[0132] In one embodiment, the invention provides chimeric
constructs comprising an expression cassette comprising the coding
sequence of the B gene, particularly the BvPRR7 coding sequence as
depicted in SEQ ID NO:1, but particularly in SEQ ID NO 52 or a
sequence that has at least 70%, particularly at least 75%, more
particularly at least 80%, even more particularly at least 85%, but
especially at least 90% and up to at least 95%-99% sequence
identity therein under the control of annual promoter and
terminator sequences such as those provided in the PRR7 gene,
particularly the PRR7 gene of Beta vulgaris.
[0133] In one embodiment of the invention, the chimeric construct
as described hereinbefore may further contain a selection marker
gene which allows discriminating between transformed and
non-transformed plant material in a selection procedure.
[0134] In one embodiment, the chimeric construct of the invention
comprises a negative selection marker, particularly a selection
marker encoding a resistance to plant toxic compounds such as
antibiotics or herbicides.
[0135] In one embodiment, the chimeric construct of the invention
comprises a positive selection marker, particularly a selection
marker encoding an enzyme that provides the transformed plant with
a selective advantage over the non-transformed plants, particularly
a nutritional advantage such as, for example, a phosphomannose
isomerase gene, a xylose isomerase gene.
[0136] In one embodiment of the invention, a transformation vector
and/or an expression vector is provided, particularly a plant
transformation vector and/or an expression vector, comprising the
chimeric construct of the invention as described herein before.
[0137] In one embodiment of the invention a plant cell is provided,
particularly a plant cell of a sugar beet plant, comprising a
chimeric polynucleotide construct or a vector molecule according to
the invention and as described herein before.
[0138] In one embodiment of the invention a plant is provided,
particularly a sugar beet plant, comprising a plant cell of the
invention and expressing the B gene protein, particularly the
BvPRR7 protein such that the plant exhibits an annual
phenotype.
[0139] In one embodiment of the invention, a polynucleotide
construct is provided for transgenic suppression of BvPRR7 gene
expression, particularly through an antisense or an RNAi
approach.
[0140] In one embodiment of the invention, a polynucleotide
construct is provided comprising a nucleotide sequence encoding a
dsRNA which is capable of targetting mRNAs produced by
transcription of the DNA sequence encoding the B gene protein,
particularly the BvPRR7 protein, for degradation.
[0141] In one embodiment, a polynucleotide construct is provided
comprising a nucleotide sequence encoding a dsRNA which is
substantially identical with at least a region of the coding
sequence of the B gene, particularly the coding region of the
BvPRR7 gene as depicted in SEQ ID NO:1, but particularly in SEQ ID
NO: 52 or a sequence that has at least 70%, particularly at least
75%, more particularly at least 80%, even more particularly at
least 85%, but especially at least 90% and up to at least 95%-99%
sequence identity therein.
[0142] In one embodiment of the invention, a polynucleotide
construct is provided comprising a fragment of the coding region of
the B gene, particularly a fragment of the coding region of the
BvPRR7 gene as depicted in SEQ ID NO:1, but particularly in SEQ ID
NO: 52 or a sequence that has at least 70%, particularly at least
75%, more particularly at least 80%, even more particularly at
least 85%, but especially at least 90% and up to at least 96%-99%
sequence identity therein, assembled into an RNAi cassette under
the control of the constitutive promoter such as, for example, the
Ubi3 promoter from Arabidopsis.
[0143] In one embodiment of the invention, a transformation vector
and/or an RNAi expression vector is provided, particularly a plant
transformation vector and/or an expression vector, comprising the
polynucleotide construct of the invention as described herein
before.
[0144] In one embodiment of the invention, a plant cell is
provided, comprising a polynucleotide construct or a vector
molecule according to the invention and as described herein
before.
[0145] In one embodiment of the invention, a plant is provided,
particularly a sugar beet plant, comprising a plant cell of the
invention and expressing the dsRNA such that bolting is suppressed
and the plant exhibits a non-bolting phenotype.
BRIEF DESCRIPTION OF THE FIGURES AND SEQUENCES
[0146] FIGURES
[0147] FIG. 1 shows an amino acid sequence comparison of the REC
domains between different species and the putative REC domain of
sugar beet EST CV301305. Identical amino acids are in black;
conserved in grey; weakly similar in light grey and non-similar in
white. Bb, Bordetella bronchiseptica; Bs, Bacillus subtilis; Bv,
Beta vulgaris; Ec, Escherichia coil; Kp, Klebsiella pneumoniae; Pa,
Pseudomonas aeruginosa; Rc, Rhodobacter capsulatus; Sc,
Streptomyces coelicolor; Sf, Shigella flexneri; St, Salmonella
typhimurium.
[0148] FIG. 2: Amino acid sequence comparison of the Arabidopsis
PRR7 protein and the predicted partial protein from sugar beet EST
CV301305. Identical amino acids are in black; similar in grey and
non-similar in white.
[0149] FIG. 3: Sequence alignment between the genomic and mRNA
sequences of the Arabidopsis PRR7 gene and sugar beet EST CV301305.
Conserved nucleotides between Arabidopsis and Beta vulgaris L. are
in grey. Introns are represented by strings of dashes.
[0150] FIG. 4: Genetic map of sugar beet chromosome II. Marker
names are given at the right of the chromosome, at the left the
cumulative genetic distance is indicated.
[0151] FIG. 5: Schematic representation of the gene structure of
the BvPRR7 gene showing putative exons and introns. The region
covered by EST CV301305 is shown by the block arrow.
[0152] FIG. 6: Amino acid sequence comparison of the Arabidopsis
PRR gene family members and the BvPRR7 protein. Identical amino
acids are in black; conserved in grey; weakly similar in light grey
and non-similar in white. The REC and CCT motifs are boxed.
[0153] FIG. 7: Phylogenetic relationship between BvPRR7 and related
proteins from other flowering plants. The predicted amino acid
sequence of BvPRR7 was aligned to the proteins listed below using
ClustaiW and an unrooted phylogenetic tree was constructed. The
evolutionary history was inferred using the Neighbor-Joining method
(Saitou and Nei, 1987). The bootstrap consensus tree inferred from
1000 replicates is taken to represent the evolutionary history of
the taxa analyzed (Felsenstein, 1985). Branches corresponding to
partitions reproduced in less than 50% bootstrap replicates are
collapsed. The percentage of replicate trees in which the
associated taxa clustered together in the bootstrap test (1000
replicates) are shown next to the branches. The tree is drawn to
scale, with branch lengths in the same units as those of the
evolutionary distances used to infer the phylogenetic tree. The
evolutionary distances were computed using the Poisson correction
method (Zuckerkandl and Pauling, 1965) and are in the units of the
number of amino acid substitutions per site. All positions
containing gaps and missing data were eliminated from the dataset
(Complete deletion option). There were a total of 352 positions in
the final dataset. Phylogenetic analyses were conducted in MEGA4
software (Tamura et al., 2007). At PRR3, Arabidopsis Mariana PRR3
(NP.sub.--568919); At PRR5, Arabidopsis thaliana PRR5
(NP.sub.--568446); At PRR7, Arabidopsis thaliana PRR7
(NP.sub.--568107); At PRR9, Arabidopsis thaliana PRR9
(NP.sub.--566085); At TOC1, Arabidopsis thaliana TOC1/PRR1
(NP.sub.--200946); Hv PPD-H1, Hordeum vulgare PPD-H1 (AAY17586); Os
PRR37, Oryza sativa PRR37 (Q0D3B6); Ta PPD-D1, Triticum aestivum
PPD-D1 (ABL09477).
[0154] FIG. 8: Gene expression profile of BvPRR7 in biennial sugar
beet plant grown in long days (16 h light, 8 h dark) and at
constant temperature 18.degree. C. Values are expressed as relative
expression levels normalized against the BvBTU and BvICDH reference
genes by geometric averaging analysis (Vandesompele et al.,
2002).
[0155] FIG. 9. Plasmid map of the binary vector for the
transformation of the BvPRR7 cDNA under the control of the annual
BvPRR7 promoter fragment. The selectable marker consists of the PMI
gene under the control of the HSP80 promoter (Brunke and Wilson,
1993).
[0156] FIG. 10. Plasmid map of the binary vector for the transgenic
suppression of BvPRR7 by means of RNAi. The inverted repeat for
BvPRR7 consists of a 0.6 Kb cDNA fragment that was cloned between
the Ubi3 promoter (Norris at al, 1993) and Nos terminator in both
the antisense and sense orientation, separated by the second intron
of the StLS1 gene from potato (Eckes et al, 1986, Vancanneyt at al,
1990). The selectable marker consists of the PMI gene under the
control of the HSP80 promoter (Brunke and Wilson, 1993).
SEQUENCES
[0157] SEQ ID NO 1 depicts the nucleotide sequence of EST CV301305
[0158] SEQ ID NO: 2 depicts the nucleotide sequence of Intron 3 of
BvPRR7 and its allelic variability for mapping [0159] SEQ ID NO: 3
depicts the nucleotide sequence of Intron 3 of allelic variant 1 of
BvPRR7 (haplotype #1) [0160] SEQ ID NO: 4 depicts the nucleotide
sequence of Intron 3 of allelic variant 2 of BvPRR7 (haplotype #2)
[0161] SEQ ID NO: 5 depicts the genomic nucleotide sequence of
BvPRR7 [0162] SEQ ID NO: 6 depicts the putative amino acid sequence
of BvPRR7 [0163] SEQ ID NO: 7 depicts the nucleotide sequence of
primer PRR7-F [0164] SEQ ID NO: 8 depicts the nucleotide sequence
of primer PRR7-R [0165] SEQ ID NO: 9 depicts the nucleotide
sequence of probe PRR7(T1)-FAM [0166] SEQ ID NO: 10 depicts the
nucleotide sequence of probe PRR7(T1)-VIC [0167] SEQ ID NO: 11
depicts the nucleotide sequence of forward primer BvPRR7 [0168] SEQ
ID NO: 12 depicts the nucleotide sequence of reverse primer BvPRR7
[0169] SEQ ID NO: 13 depicts the nucleotide sequence of forward
primer BvBTU [0170] SEQ ID NO: 14 depicts the nucleotide sequence
of reverse primer BvBTU [0171] SEQ ID NO 15 depicts the nucleotide
sequence of forward primer BvICDH [0172] SEQ ID NO: 16 depicts the
nucleotide sequence of reverse primer BvICDH [0173] SEQ ID NO 17
depicts the nucleotide sequence of primer F3766 [0174] SEQ ID NO:
18 depicts the nucleotide sequence of primer R3767 [0175] SEQ ID
NO: 19 depicts the nucleotide sequence of primer F3354 [0176] SEQ
ID NO: 20 depicts the nucleotide sequence of primer R3355 [0177]
SEQ ID NO: 21 depicts the nucleotide sequence of primer F3768
[0178] SEQ ID NO: 22 depicts the nucleotide sequence of primer
R3769 [0179] SEQ ID NO: 23 depicts the nucleotide sequence of
primer F3782 [0180] SEQ ID NO: 24 depicts the nucleotide sequence
of primer R3783 [0181] SEQ ID NO: 25 depicts the nucleotide
sequence of primer F3784 [0182] SEQ ID NO: 26 depicts the
nucleotide sequence of primer R3785 [0183] SEQ ID NO: 27 depicts
the nucleotide sequence of primer F3806 [0184] SEQ ID NO: 28
depicts the nucleotide sequence of primer R3807 [0185] SEQ ID NO:
29 depicts the nucleotide sequence of primer F3808 [0186] SEQ ID
NO: 30 depicts the nucleotide sequence of primer R3809 [0187] SEQ
ID NO: 31 depicts the nucleotide sequence of primer F3810 [0188]
SEQ ID NO: 32 depicts the nucleotide sequence of primer R3811
[0189] SEQ ID NO: 33 depicts the nucleotide sequence of primer
F3853 [0190] SEQ ID NO 34 depicts the nucleotide sequence of primer
F3854 [0191] SEQ ID NO: 35 depicts the nucleotide sequence of
primer F3855 [0192] SEQ ID NO: 36 depicts the nucleotide sequence
of primer R3856 [0193] SEQ ID NO: 37 depicts the nucleotide
sequence of primer F3857 [0194] SEQ ID NO: 38 depicts the
nucleotide sequence of primer R3858 [0195] SEQ ID NO: 39 depicts
the nucleotide sequence of primer F3859 [0196] SEQ ID NO 40 depicts
the nucleotide sequence of primer R3860 [0197] SEQ ID NO: 41
depicts the nucleotide sequence of primer F3861 [0198] SEQ ID NO:
42 depicts the nucleotide sequence of primer R3862 [0199] SEQ ID NO
43 depicts the nucleotide sequence of primer F3863 [0200] SEQ ID
NO: 44 depicts the nucleotide sequence of primer R3864 [0201] SEQ
ID NO: 45 depicts the nucleotide sequence of primer F3865 [0202]
SEQ ID NO: 46 depicts the nucleotide sequence of primer R3866
[0203] SEQ ID NO: 47: depicts the nucleotide sequence of probe
PRR7(#3827)-FAM [0204] SEQ ID NO: 48: depicts the nucleotide
sequence of probe PRR7(#3827)-VIC [0205] SEQ ID NO: 49: depicts the
nucleotide sequence of forward primer BvPRR7 used for gene
expression analysis [0206] SEQ ID NO: 50: depicts the nucleotide
sequence of reverse primer BvPRR7 used for gene expression analysis
[0207] SEQ ID NO: 51: depicts the nucleotide sequence of genomic
nucleotide sequence of BvPRR7 including about 13 kb of the promoter
region. [0208] SEQ ID NO 52: depicts the nucleotide sequence of the
coding region of BvPRR7.
DEFINITIONS
[0209] The technical terms and expressions used within the scope of
this application are generally to be given the meaning commonly
applied to them in the pertinent art of plant molecular biology if
not otherwise indicated herein below.
[0210] As used in this specification and the appended claims, the
singular forms "a", "an", and "the" include plural referents unless
the context clearly dictates otherwise. Thus, for example,
reference to "a plant" includes one or more plants, and reference
to "a cell" includes mixtures of cells, tissues, and the like.
[0211] "Sugar beet" refers to all species and subspecies within,
the genus Beta as well as all kinds of cultivated beets of Beta
vulgar/s. Cultivated beets have been separated into four groups:
leaf beet, garden beet, fodder beet and sugar beet. "Sugar beet"
refers also to all cultivated beets including those grown for other
purposes than the production of sugar, such as ethanol, plastics or
industrial products. In particular, "Sugar beet" refers to fodder
beet and sugar beet, but especially to sugar beet.
[0212] An "annual sugar beet line" refers to a sugar beet plant
containing the dominant allele b at the B locus in a heterozygous
or homozygous state.
[0213] A "biennial sugar beet line" refers to a sugar beet plant
containing the recessive allele b at the B locus in a homozygous
state
[0214] "Bolting" refers to the transition from the vegetative
rosette stage to the inflorescence or reproductive growth
stage.
[0215] "B gene" as used herein refers to a gene that is responsible
for early bolting in sugarbeet. Plants carrying the dominant allele
make shoot elongation followed by flowering without prior exposure
to cold temperatures.
[0216] "Vernalization" refers to the process by which floral
induction in some plants is promoted by exposing the plants to
chilling for certain duration.
[0217] An "allele" is understood within the scope of the invention
to refer to alternative forms of various genetic units associated
with different forms of a gene or of any kind of identifiable
genetic element, which are alternative in inheritance because they
are situated at the same locus in homologous chromosomes. In a
diploid cell or organism, the two alleles of a given gene (or
marker) typically occupy corresponding loci on a pair of homologous
chromosomes.
[0218] As used herein, the term "breeding", and grammatical
variants thereof, refer to any process that generates a progeny
individual. Breedings can be sexual or asexual, or any combination
thereof. Exemplary non-limiting types of breedings include
crossings, selfings, doubled haploid derivative generation, and
combinations thereof.
[0219] "Locus" is understood within the scope of the invention to
refer to a region on a chromosome, which comprises a gene or any
other genetic element or factor contributing to a trait.
[0220] As used herein, the phrase "genetic marker" refers to a
feature of an individual's genome (e.g., a nucleotide or a
polynucleotide sequence that is present in an individual's genome)
that is associated with one or more loci of interest. In some
embodiments, a genetic marker is polymorphic in a population of
interest, or the locus occupied by the polymorphism, depending on
context. Genetic markers include, for example, single nucleotide
polymorphisms (SNIPs), indels (i.e., insertions/deletions), simple
sequence repeats (SSRs), restriction fragment length polymorphisms
(RFLPs), random amplified polymorphic DNAs (RAPDs), cleaved
amplified polymorphic sequence (CAPS) markers, Diversity Arrays
Technology (DArT) markers, and amplified fragment length
polymorphisms (AFLPs), among many other examples, Genetic markers
can, for example, be used to locate genetic loci containing alleles
that contribute to variability in expression of phenotypic traits
on a chromosome. The phrase "genetic marker" can also refer to a
polynucleotide sequence complementary to a genomic sequence, such
as a sequence of a nucleic acid used as probes.
[0221] A genetic marker can be physically located in a position on
a chromosome that is within or outside of to the genetic locus with
which it is associated (i.e., is intragenic or extragenic,
respectively). Stated another way, whereas genetic markers are
typically employed when the location on a chromosome of the gene
that corresponds to the locus of interest has not been identified
and there is a non-zero rate of recombination between the genetic
marker and the locus of interest, the presently disclosed subject
matter can also employ genetic markers that are physically within
the boundaries of a genetic locus (e.g., inside a genomic sequence
that corresponds to a gene such as, but not limited to a
polymorphism within an intron or an exon of a gene). In some
embodiments of the presently disclosed subject matter, the one or
more genetic markers comprise between one and ten markers, and in
some embodiments the one or more genetic markers comprise more than
ten genetic markers.
[0222] As used herein, the phrase "informative fragment" refers to
a polynucleotide fragment with an information content that is a
retrievable and can assist in the determination and/or
characterization of a genetic locus of interest. This information
content may be represented by a polymorphism which is associated
with said locus of interest such as, for example, a single
nucleotide polymorphisms (SNPs), indels (i.e.,
insertions/deletions), simple sequence repeats (SSRs), restriction
fragment length polymorphisms (RFLPs), random amplified polymorphic
DNAs (RAPDs), cleaved amplified polymorphic sequence (CAPS)
markers, Diversity Arrays Technology (DArT) markers, and amplified
fragment length polymorphisms (AFLPs), among many other examples
and may be used for the development of a genetic marker. The
information content of such an "informative fragment" may also be
represented by a specific sequence that can be detected by a
corresponding probe molecule.
[0223] As used herein, the phrase "phenotypic trait" refers to the
appearance or other detectable characteristic of an individual,
resulting from the interaction of its genome with the
environment.
[0224] "Marker-based selection" is understood within the scope of
the invention to refer to the use of genetic markers to detect one
or more nucleic acids from the plant, where the nucleic acid is
associated with a desired trait to identify plants that carry genes
for desirable (or undesirable) traits, so that those plants can be
used (or avoided) in a selective breeding program.
[0225] "Microsatellite or SSRs (Simple sequence repeats) (Marker)"
is understood within the scope of the invention to refer to a type
of genetic marker that consists of numerous repeats of short
sequences of DNA bases, which are found at loci throughout the
plant's DNA and have a likelihood of being highly polymorphic.
[0226] "PCR (Polymerase chain reaction)" is understood within the
scope of the invention to refer to a method of producing relatively
large amounts of specific regions of DNA, thereby making possible
various analyses that are based on those regions.
[0227] "PCR primer" is understood within the scope of the invention
to refer to rrelatively short fragments of single-stranded DNA used
in the PCR amplification of specific regions of DNA.
[0228] "Phenotype" is understood within the scope of the invention
to refer to a distinguishable characteristic(s) of a genetically
controlled trait.
[0229] "Polymorphism" is understood within the scope of the
invention to refer to the presence in a population of two or more
different forms of a gene, genetic marker, or inherited trait.
[0230] "Selective breeding" is understood within the scope of the
invention to refer to a program of breeding that uses plants that
possess or display desirable traits as parents.
[0231] The term "polynucleotide" is understood herein to refer to
polymeric molecule of high molecular weight which can be
single-stranded or double-stranded, composed of monomers
(nucleotides) containing a sugar, phosphate and a base which is
either a purine or pyrimidine. A "polynucleotide fragment" is a
fraction of a given polynucleotide molecule. In higher plants,
deoxyribonucleic acid (DNA) is the genetic material while
ribonucleic acid (RNA) is involved in the transfer of information
contained within DNA into proteins. A "genome" is the entire body
of genetic material contained in each cell of an organism. The term
"polynucleatide" thus refers to a polymer of DNA or RNA which can
be single- or double-stranded, optionally containing synthetic,
non-natural or altered nucleotide bases capable of incorporation
into DNA or RNA polymers. Unless otherwise indicated, a particular
nucleic acid sequence of this invention also implicitly encompasses
conservatively modified variants thereof (e.g. degenerate codon
substitutions) and complementary sequences and as well as the
sequence explicitly indicated. Specifically, degenerate codon
substitutions may be achieved by generating sequences in which the
third position of one or more selected (or all) codons is
substituted with mixed-base and/or deoxyinosine residues (Batzer et
al., 1991; Ohtsuka et 1985; Rossolini et al., 1994). The term
polynucleotide is used interchangeably with nucleic acid,
nucleotide sequence and may include genes, cDNAs, and mRNAs encoded
by a gene, etc.
[0232] The polynucleotide of the invention is understood to be
provided in isolated form. The term "isolated" means that the
polynucleotide disclosed and claimed herein is not a polynucleotide
as it occurs in its natural context, if it indeed has a naturally
occurring counterpart. Accordingly, the other compounds of the
invention described further below are understood to be isolated. If
claimed in the context of a plant genome, the polynucleotide of the
invention is distinguished over naturally occurring counterparts by
the insertion side in the genome and the flanking sequences at the
insertion side.
[0233] As used herein, the phrase "nucleic acid" refers to any
physical string of monomer units that can be corresponded to a
string of nucleotides, including a polymer of nucleotides (e.g., a
typical DNA or RNA polymer), modified oligonucleotides (e.g.,
oligonucleotides comprising bases that are not typical to
biological RNA or DNA, such as 2'-O-methylated oligonucleotides),
and the like. In some embodiments, a nucleic acid can be
single-stranded, double-stranded, multi-stranded, or combinations
thereof. Unless otherwise indicated, a particular nucleic acid
sequence of the presently disclosed subject matter optionally
comprises or encodes complementary sequences, in addition to any
sequence explicitly indicated.
[0234] The term "gene" is used broadly to refer to any segment of
nucleic acid associated with a biological function. Thus, genes
include coding sequences and/or the regulatory sequences required
for their expression. For example, gene refers to a nucleic acid
fragment that expresses mRNA or functional RNA, or encodes a
specific protein, and which includes regulatory sequences. Genes
also include nonexpressed DNA segments that, for example, form
recognition sequences for other proteins. Genes can be obtained
from a variety of sources, including cloning from a source of
interest or synthesizing from known or predicted sequence
information, and may include sequences designed to have desired
parameters.
[0235] A "marker gene" encodes a selectable or screenable
trait.
[0236] The term "chimeric gene" refers to any gene that contains 1)
DNA sequences, including regulatory and coding sequences that are
not found together in nature or 2) sequences encoding parts of
proteins not naturally adjoined, or 3) parts of promoters that are
not naturally adjoined. Accordingly, a chimeric gene may comprise
regulatory sequences and coding sequences that are derived from
different sources, or comprise regulatory sequences and coding
sequences derived from the same source, but arranged in a manner
different from that found in nature.
[0237] A "transgene" refers to a gene that has been introduced into
the genome by transformation and is stably maintained. Transgenes
may include, for example, genes that are either heterologous or
homologous to the genes of a particular plant to be transformed.
Additionally, transgenes may comprise native genes inserted into a
non-native organism, or chimeric genes.
[0238] The terms "protein," "peptide" and "polypeptide" are used
interchangeably herein.
[0239] "Coding sequence" refers to a DNA or RNA sequence that codes
for a specific amino acid sequence and excludes the non-coding
sequences. It may constitute an "uninterrupted coding sequence",
i.e., lacking an intron, such as in a cDNA or it may include one or
more introns bounded by appropriate splice junctions. An "intron"
is a sequence of RNA which is contained in the primary transcript
but which is removed through cleavage and re-ligation of the RNA
within the cell to create the mature mRNA that can be translated
into a protein.
[0240] "Promoter" refers to a nucleotide sequence, usually upstream
(5') to its coding sequence, which controls the expression of the
coding sequence by providing the recognition for RNA polymerase and
other factors required for proper transcription. "Promoter"
includes a minimal promoter that is a short DNA sequence comprised
of a TATA box and other sequences that serve to specify the site of
transcription initiation, to which regulatory elements are added
for control of expression. "Promoter" also refers to a nucleotide
sequence that includes a minimal promoter plus regulatory elements
that is capable of controlling the expression of a coding sequence
or functional RNA. This type of promoter sequence consists of
proximal and more distal upstream elements, the latter elements
often referred to as enhancers. Accordingly, an "enhancer" is a DNA
sequence which can stimulate promoter activity and may be an innate
element of the promoter or a heterologous element inserted to
enhance the level or tissue specificity of a promoter. It is
capable of operating in both orientations (normal or flipped), and
is capable of functioning even when moved either upstream or
downstream from the promoter. Both enhancers and other upstream
promoter elements bind sequence-specific DNA-binding proteins that
mediate their effects. Promoters may be derived in their entirety
from a native gene, or be composed of different elements derived
from different promoters found in nature, or even be comprised of
synthetic DNA segments. A promoter may also contain DNA sequences
that are involved in the binding of protein factors which control
the effectiveness of transcription initiation in response to
physiological or developmental conditions.
[0241] The "initiation site" is the position surrounding the first
nucleotide that is part of the transcribed sequence, which is also
defined as position +1. With respect to this site all other
sequences of the gene and its controlling regions are numbered.
Downstream sequences (i.e., further protein encoding sequences in
the 3.degree. direction) are denominated positive, while upstream
sequences (mostly of the controlling regions in the 5' direction)
are denominated negative.
[0242] Promoter elements, particularly a TATA element, that are
inactive or that have greatly reduced promoter activity in the
absence of upstream activation are referred to as "minimal or core
promoters." In the presence of a suitable transcription factor, the
minimal promoter functions to permit transcription. A "minimal or
core promoter" thus consists only of all basal elements needed for
transcription initiation, e.g., a TATA box and/or an initiator.
[0243] "Constitutive expression" refers to expression using a
constitutive or regulated promoter. "Conditional" and "regulated
expression" refer to expression controlled by a regulated
promoter.
[0244] "Constitutive promoter" refers to a promoter that is able to
express the open reading frame (ORF) that it controls in all or
nearly all of the plant tissues during all or nearly all
developmental stages of the plant. Each of the
transcription-activating elements do not exhibit an absolute
tissue-specificity, but mediate transcriptional activation in most
plant parts at a level of .ltoreq.1% of the level reached in the
part of the plant in which transcription is most active.
[0245] "Regulated promoter" refers to promoters that direct gene
expression not constitutively, but in a temporally- and/or
spatially-regulated manner, and includes both tissue-specific and
inducible promoters. It includes natural and synthetic sequences as
well as sequences which may be a combination of synthetic and
natural sequences. Different promoters may direct the expression of
a gene in different tissues or cell types, or at different stages
of development, or in response to different environmental
conditions. New promoters of various types useful in plant cells
are constantly being discovered, numerous examples may be found in
the compilation by Okamuro et at (1989). Typical regulated
promoters useful in plants include but are not limited to
safener-inducible promoters, promoters derived from the
tetracycline-inducible system, promoters derived from
salicylate-inducible systems, promoters derived from
alcohol-inducible systems, promoters derived from
glucocorticoid-inducible system, promoters derived from
pathogen-inducible systems, and promoters derived from
ecdysome-inducible systems.
[0246] "Tissue-specific promoter" refers to regulated promoters
that are not expressed in all plant cells but only in one or more
cell types in specific organs (such as leaves or seeds), specific
tissues (such as embryo or cotyledon), or specific cell types (such
as leaf parenchyma or seed storage cells). These also include
promoters that are temporally regulated, such as in early or late
embryogenesis, during fruit ripening in developing seeds or fruit,
in fully differentiated leaf, or at the onset of senescence.
[0247] "Inducible promoter" refers to those regulated promoters
that can be turned on in one or more cell types by an external
stimulus, such as a chemical, light, hormone, stress, or a
pathogen.
[0248] "Operably-linked" refers to the association of nucleic acid
sequences on single nucleic acid fragment so that the function of
one is affected by the other. For example, a regulatory DNA
sequence is said to be "operably linked to" or "associated with" a
DNA sequence that codes for an RNA or a polypeptide if the two
sequences are situated such that the regulatory DNA sequence
affects expression of the coding DNA sequence (i.e., that the
coding sequence or functional RNA is under the transcriptional
control of the promoter). Coding sequences can be operably-linked
to regulatory sequences in sense or antisense orientation.
[0249] "Expression" refers to the transcription and/or translation
of an endogenous gene, ORF or portion thereof, or a transgene in
plants. For example, in the case of antisense constructs,
expression may refer to the transcription of the antisense DNA
only. In addition, expression refers to the transcription and
stable accumulation of sense (mRNA) or functional RNA. Expression
may also refer to the production of protein
[0250] "Overexpression" refers to the level of expression in
transgenic cells or organisms that exceeds levels of expression in
normal or untransformed (nontransgenic) cells or organisms.
[0251] "Antisense inhibition" refers to the production of antisense
RNA transcripts capable of suppressing the expression of protein
from an endogenous gene or a transgene.
[0252] "Gene silencing" refers to homology-dependent suppression of
viral genes, transgenes, or endogenous nuclear genes. Gene
silencing may be transcriptional, when the suppression is due to
decreased transcription of the affected genes, or
post-transcriptional, when the suppression is due to increased
turnover (degradation) of RNA species homologous to the affected
genes (English et al., 1996). Gene silencing includes virus-induced
gene silencing (Ruiz et al, 1998).
[0253] The term "hybridize" as used herein refers to conventional
hybridization conditions, preferably to hybridization conditions at
which 5.times.SSPE, 1% SDS, 1.times.Denhardts solution is used as a
solution and/or hybridization temperatures are between 35.degree.
C. and 70.degree. C., preferably 65.degree. C. After hybridization,
washing is preferably carried out first with 2.times.SSC, 1% SDS
and subsequently with 0.2.times.SSC at temperatures between
35.degree. C. and 75.degree. C., particularly between 45.degree. C.
and 65.degree. C., but especially at 59.degree. C. (regarding the
definition of SSPE, SSC and Denhardts solution see Sambrook et al.
loc. cit.). High stringency hybridization conditions as for
instance described in Sambrook at al, supra, are particularly
preferred. Particularly preferred stringent hybridization
conditions are for instance present if hybridization and washing
occur at 65.degree. C. as indicated above. Non-stringent
hybridization conditions for instance with hybridization and
washing carried out at 45.degree. C. are less preferred and at
35.degree. C. even less.
[0254] "Sequence Homology or Sequence Identity" is used herein
interchangeably. The terms "identical" or percent "identity" in the
context of two or more nucleic acid or protein sequences, refer to
two or more sequences or subsequences that are the same or have a
specified percentage of amino acid residues or nucleotides that are
the same, when compared and aligned for maximum correspondence, as
measured using one of the following sequence comparison algorithms
or by visual inspection. If two sequences which are to be compared
with each other differ in length, sequence identity preferably
relates to the percentage of the nucleotide residues of the shorter
sequence which are identical with the nucleotide residues of the
longer sequence. Sequence identity can be determined conventionally
with the use of computer programs such as the Bestfit program
(Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics
Computer Group, University Research Park, 575 Science Drive
Madison, Wis. 53711). Bestfit utilizes the local homology algorithm
of Smith and Waterman, Advances in Applied Mathematics 2 (1981),
482-489, in order to find the segment having the highest sequence
identity between two sequences. When using Bestfit or another
sequence alignment program to determine whether a particular
sequence has for instance 95% identity with a reference sequence of
the present invention, the parameters are preferably so adjusted
that the percentage of identity is calculated over the entire
length of the reference sequence and that homology gaps of up to 5%
of the total number of the nucleotides in the reference sequence
are permitted. When using Bestfit, the so-called optional
parameters are preferably left at their preset ("default") values.
The deviations appearing in the comparison between a given sequence
and the above-described sequences of the invention may be caused
for instance by addition, deletion, substitution, insertion or
recombination. Such a sequence comparison can preferably also be
carried out with the program "fasta20u66" (version 2.0u66,
September 1998 by William R. Pearson and the University of
Virginia; see also Pearson, 1990, appended examples and
http://workbench.sdsc.edu/). For this purpose, the "default"
parameter settings may be used.
[0255] Another indication that two nucleic acid sequences are
substantially identical is that the two molecules hybridize to each
other under stringent conditions. The phrase: "hybridizing
specifically to" refers to the binding, duplexing, or hybridizing
of a molecule only to a particular nucleotide sequence under
stringent conditions when that sequence is present in a complex
mixture (e.g., total cellular) DNA or RNA. "Bind(s) substantially"
refers to complementary hybridization between a probe nucleic acid
and a target nucleic acid and embraces minor mismatches that can be
accommodated by reducing the stringency of the hybridization media
to achieve the desired detection of the target nucleic acid
sequence.
[0256] "Stringent hybridization conditions" and "stringent
hybridization wash conditions" in the context of nucleic acid
hybridization experiments such as Southern and Northern
hybridizations are sequence dependent, and are different under
different environmental parameters. Longer sequences hybridize
specifically at higher temperatures. An extensive guide to the
hybridization of nucleic acids is found in Tijssen P., 1993
Laboratory Techniques in Biochemistry and Molecular
Biology-Hybridization with Nucleic Acid Probes part I chapter 2
"Overview of principles of hybridization and the strategy of
nucleic acid probe assays" Elsevier, N.Y. Generally, highly
stringent hybridization and wash conditions are selected to be
about 5.degree. C. lower than the thermal melting point (T.sub.m)
for the specific sequence at a defined ionic strength and pH.
Typically, under "stringent conditions" a probe will hybridize to
its target subsequence, but to no other sequences.
[0257] The T.sub.m is the temperature (under defined ionic strength
and pH) at which 50% of the target sequence hybridizes to a
perfectly matched probe. Very stringent conditions are selected to
be equal to the T.sub.m for a particular probe. An example of
stringent hybridization conditions for hybridization of
complementary nucleic acids which have more than 100 complementary
residues on a filter in a Southern or northern blot is 50%
formamide with 1 mg of heparin at 42.degree C., with the
hybridization being carried out overnight. An example of highly
stringent wash conditions is 0.15M NaCl at 72.degree C. for about
15 minutes. An example of stringent wash conditions is a
0.2.times.SSC wash at 65.degree C. for 15 minutes (see, Sambrook,
infra, for a description of SSC buffer). Often, a high stringency
wash is preceded by a low stringency wash to remove background
probe signal. An example medium stringency wash for a duplex of,
e.g., more than 100 nucleotides, is 1 time.SSC at 45 degree C. for
15 minutes. An example low stringency wash for a duplex of, e.g.,
more than 100 nucleotides, is 4-6.times.SSC at 40.degree C. for 15
minutes. For short probes (e.g., about 10 to 50 nucleotides),
stringent conditions typically involve salt concentrations of less
than about 1.0M Na ion, typically about 0.01 to 1.0 M Na ion
concentration (or other salts) at pH 7.0 to 8.3, and the
temperature is typically at least about 30.degree C. Stringent
conditions can also be achieved with the addition of destabilizing
agents such as formamide. In general, a signal to noise ratio of
2.times. (or higher) than that observed for an unrelated probe in
the particular hybridization assay indicates detection of a
specific hybridization. Nucleic acids that do not hybridize to each
other under stringent conditions are still substantially identical
if the proteins that they encode are substantially identical. This
occurs, e.g., when a copy of a nucleic acid is created using the
maximum codon degeneracy permitted by the genetic code.
[0258] A "plant" is any plant at any stage of development,
particularly a seed plant.
[0259] A "plant cell" is a structural and physiological unit of a
plant, comprising a protoplast and a cell wall. The plant cell may
be in form of an isolated single cell or a cultured cell, or as a
part of higher organized unit such as, for example, plant tissue, a
plant organ, or a whole plant.
[0260] "Plant cell culture" means cultures of plant units such as,
for example, protoplasts, cell culture cells, cells in plant
tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes and
embryos at various stages of development.
[0261] "Plant material" refers to leaves, sterns, roots, flowers or
flower parts, fruits, pollen, egg cells, zygotes, seeds, cuttings,
cell or tissue cultures, or any other part or product of a
plant.
[0262] A "plant organ" is a distinct and visibly structured and
differentiated part of a plant such as a root, stem, leaf, flower
bud, or embryo.
[0263] "Plant tissue" as used herein means a group of plant cells
organized into a structural and functional unit. Any tissue of a
plant in plants or in culture is included. This term includes, but
is not limited to, whole plants, plant organs, plant seeds, tissue
culture and any groups of plant cells organized into structural
and/or functional units. The use of this term in conjunction with,
or in the absence of, any specific type of plant tissue as listed
above or otherwise embraced by this definition is not intended to
be exclusive of any other type of plant tissue.
[0264] The present invention discloses polynucleotides identified
in the sugar beet genome including variants and derivatives
thereof, which polynucleotides were demonstrated to show perfect
co-segregation with the bolting gene (B gene) associated phenotype
in sugar beet, and the use of said polynucleotides for the
development of markers that can be used for mapping and
identification of the bolting gene or B gene. The polynucleotide
markers according to the invention may also be used for quality
control of commercial seed lots by screening of commercial biennial
sugar beet seed for annual contaminants and for identifying
annuals/biennials in breeding programs, which use the annual trait
to speed up the breeding process, or when the annual trait is
introduced together with new sources of genetic variation.
[0265] The polynucleotides according to the invention and described
herein before, can further be used in a transgenic approach for
producing transgenic sugar beet plants comprising said
polynucleotides stably integrated into the sugar beet genome. In
particular, upon expression from the genome, the expression product
can be used to modulate the vernalization response of the sugar
beet plant.
[0266] In one aspect of the invention the vernalization response
will be delayed by suppressing or down-regulating expression of the
B gene.
[0267] In another aspect of the invention, early bolting without
cold treatment will be induced upon overexpression of the B
gene.
[0268] The present invention provides a polynucleotide which maps
at or in close vicinity to the B locus, particularly at a distance
of 1 cM upstream of markers MP0176 and GJO1 and co-segregates with
marker GJ131 (Mohring S. et al, 2004; Gaafar R. M. et al, 2005)
(FIG. 5).
[0269] In one embodiment, the invention relates to a polynucleotide
including an informative fragment thereof according to the
invention and as described herein before, which is obtainable from
a genomic DNA region that maps at a distance of less than 1 cM,
particularly of less than 0.75 cM, more particularly of less than
0.5 cM, even more particularly of less than 0.3 cM, but especially
of less than 0.25 cM relative to the B gene.
[0270] The polynucleotide according to the invention can further be
used to fully characterize the region around the B locus including
the B gene and to identify further putative flowering time control
candidate genes.
[0271] A BAC library has been established with DNA from the
biennial commercial sugar beet cultivar H20. Partially (HindIII)
digested HMW DNA of fragments in the size of 100-400 kb were size
selected two times. The DNA fragments were ligated into the vector
pBeloBAC-Kan. The library contains 57,600 clones with an average
insert size of approximately 120 kb, corresponding to an 8.times.
coverage of the beet genome. The redundancy has been tested by
screening with single-copy probes and the frequency of clones from
mitochondrial or plastid DNA was estimated to be lower than 1
[0272] This BAC library was used to recover the full-length genomic
sequence of the sugar beet PRR7 gene.
[0273] In particular, primers PRR7-F and PRR7-R were used to screen
the sugar beet BAC library using standard PCR techniques well known
to those skilled in the art. The PCR conditions for the screening
of the DNA pools were as follows: primary denaturation was
accomplished at a temperature of between 90.degree. C. and
98.degree. C., particularly at about 95.degree. C. for 2 to 10 min,
particularly for about 5 min followed by between 30 and 40
amplification cycles of between 25 and 35 seconds, particularly
about 35 amplification cycles of about 30 seconds at a temperature
of between 90.degree. C. and 98.degree. C., particularly at about
95.degree. C., between 25 and 35 seconds, particularly 30 seconds
at a temperature of between 55.degree. C. and 65.degree. C.,
particularly at about 60.degree. C. and between 25 and 35 seconds,
particularly 30 seconds at a temperature of between 68.degree. C.
and 75.degree. C., particularly at about 72.degree. C. and followed
by between 2 and 8 min, particularly about 5 min, at a temperature
of between 68.degree. C. and 75.degree. C., particularly at about
72.degree. C. PCR experiments are carried out using an appropriate
reaction mix including a suitable polymerase, particularly a Tag
polymerase. Subsequent screenings of the DNA pools for fragment
BvPRR7 resulted in the positive identification of a BAC clone
carrying the respective fragment.
[0274] In order to obtain the full-length sequence of the BvPRR7
gene, the previously identified BAC clone is sequenced using
standard sequencing technology such as, for example, the
pyrosequencing technology developed by 454 Life Sciences. Two
non-overlapping contigs that both share sequence homology with EST
CV301305 can then be combined into one single sequence (SEQ ID NO
5). Based on the alignment of the BAC sequence contigs to EST
CV301305 and on sequence homology to the PRR7 gene from
Arabidopsis, the putative gene structure of the beet BvPRR7 gene
comprising introns and exons can be predicted as shown in FIG. 5.
Based on this prediction the genomic sequence can be shown to span
the entire BvPRR7 gene with 3.6 Kb of sequence upstream of the ATO
stop codon and 2.2 Kb downstream of the coding region. The
corresponding amino acid sequence of BvPRR7 is shown under SEQ ID
NO 6. Alignment of the amino acid sequence of BvPRR7 to all members
of the PRR gene family from Arabidopsis including TOC1 (PRR1),
PRR3, PRR5, PRR7 and PRR9 illustrates the strong conservation of
the Pseudo Response Regulator receiver domain (PRR) motif
(pfam00072) near the NH2-terminus and the CCT motif (pfam06203) at
the COOH-terminus (FIG. 6). In addition to the PRR gene family from
Arabidopsis, BvPRR7 also shares strong homology to the PRR7
homologue in cereals as illustrated by the phylogenetic tree shown
in FIG. 7. The PRR7 homologue in cereals, better known as Ppd, was
shown to represent the major determinant of the photoperiod
response (Turner et al, 2005; Beales at al, 2007). A function in
the vernalization response as in sugar beet could not yet be
demonstrated.
[0275] Based on their homology to known flowering-time control
genes or their putative regulatory function as suggested by the
presence of conserved domains representative of regulatory
proteins, few genes can be identified as potential candidates for
the B gene. These genes need further validation by allelic
variability and/or gene expression studies between annual and
biennial genotypes, or by means of complementation or knockout
experiments using transgenic approaches. The B gene may be used in
a transgenic approach for producing transgenic sugar beet plants
comprising said polynucleotides stably integrated into the sugar
beet genome. In particular, upon expression from the genome, the
expression product can be used to modulate the vernalization
response of the sugar beet plant.
[0276] In one aspect of the invention the vernalization response
may be delayed by suppressing or down-regulating expression of the
B gene.
[0277] In another aspect of the invention, early bolting without
cold treatment may be induced upon overexpression of the B
gene.
[0278] In the past molecular marker techniques have been developed
which can be used for genetic mapping, gene cloning, marker
assisted plant breeding and for genome fingerprinting and
investigating genetic relationships. Genetic markers are based on
DNA polymorphisms in the nucleotide sequences of genomic regions
and can either be detected by restriction enzymes, or by means of
two priming sites.
[0279] There are several types of molecular markers that may be
used in marker-based selection including restriction fragment
length polymorphism (RFLP), random amplification of polymorphic DNA
(RAPD), amplified restriction fragment length polymorphism (AFLP),
single sequence repeats (SSR) and single nucleotide polymorphisms
SNPs.
[0280] The information content of the different types of markers
may be different depending on the method that was used to obtain
the marker data and the population in which the markers were
scored. For example, it is not always possible to distinguish
genome fragments that are present in homozygous condition from
heterozygous fragments. In a heterogeneous population like an F2,
co-dominant markers like restriction fragment length polymorphisms
(RFLPs, Botstein et al., 1980) and co-dominantly scored amplified
fragment length polymorphisms (AFLPs, Vos et al., 1995) yield more
information than dominant markers like random amplified polymorphic
DNAs (RAPDs, Welsh and McCleland, 1990) and dominantly scored
AFLPs. RFLPs are co-dominant and are able to identify a unique
locus. RFLP involves the use of restriction enzymes to cut
chromosomal DNA at specific short restriction sites, polymorphisms
result from duplications or deletions between the sites or
mutations at the restriction sites.
[0281] AFLP requires digestion of cellular DNA with a restriction
enzyme before using PCR and selective nucleotides in the primers to
amplify specific fragments. With this method up to 100 polymorphic
loci can be measured and only relatively small DNA sample are
required for each test.
[0282] The most preferred method of achieving such amplification of
nucleotide fragments that span a polymorphic region of the plant
genome employs the polymerase chain reaction ("PCR") (Mullis et al.
1986), using primer pairs involving a backward primer and a forward
primer that are capable of hybridizing to the proximal sequences
that define a polymorphism in its double-stranded form.
[0283] In contrast to RFLPs, PCR-based techniques require only a
small percentage (approximately 10%) of the DNA amount as template
to produce large quantities of the target sequence by PCR
amplification.
[0284] One such PCR based technique is RAPD, which utilizes low
stringency polymerase chain reaction (PCR) amplification with
single primers of arbitrary sequence to generate strain-specific
arrays of anonymous DNA fragments. The method requires only tiny
DNA samples and analyses a large number of polymorphic loci.
However, the unpredictable behaviour of short primers which is
affected by numerous reaction conditions, inheritance in a dominant
manner, and population specificity are the main disadvantages of
RAPDs.
[0285] Microsatellites, or simple sequence repeats (SSRs), simple
sequence length polymorphisms (SSLPs), short tandem repeats (STRs),
simple sequence motifs (SSMs), and sequence target microsatellites
(STMs) represent a class of repetitive sequences which are widely
dispersed throughout the genome of eukaryotes. The variation in
number and length of the repeats is a source of polymorphism even
between closely related individuals, SSR analysis is based on these
(short-repeat) sequences which are selectively amplified to detect
variations in simple sequence repeats. Such microsatellite
sequences can be easily amplified by PCR using a pair of flanking
locus-specific oligonucleotides as primers and detect DNA length
polymorphisms (Litt and Luty, 1989; Weber and May, 1989).
[0286] Mutations at a single nucleotide position resulting in
substitutions, deletions or insertions give rise to single
nucleotide polymorphisms or SNPs, which occur approximately every
1.3 kb in human (Cooper et al., 1985; Kwok et al., 1996). Most
polymorphisms of this type have only two alleles and are also
called biallelic loci.
[0287] Positional cloning based on SNPs may accelerate the
identification of disease traits and a range of biologically
informative mutations (Wang et al., 1998).
[0288] PCR extension assays that efficiently pick up point
mutations may be used to detect SNPs. The procedure requires little
DNA per sample. Three widely used types of SNP detection assays
using PCR method are cleaved amplified polymorphic sequences (CAPS)
(Konieczny and Ausubel, 1993; Thiel et al., 2004), derived CAPS
(dCAPS) (Michaels and Amasino, 1998; Neff at al, 1998), and single
strand conformation polymorphism (SSCP) (Orita et al., 1989).
[0289] CAPS polymorphisms are differences in restriction fragment
lengths caused by SNPs or INDELs that create or abolish restriction
endonuclease recognition sites in PCR amplicons produced by
locus-specific oligonucleotide primers. CAPS assays are performed
by digesting locus-specific PCR amplicons with one or more
restriction enzymes and then separating the digested DNA on agarose
or polyacrylamide gels.
[0290] dCAPS is a modification of the CAPS technique that allows
detection of most single-nucleotide changes by utilizing mismatched
PCR primers. Using the method, a restriction enzyme recognition
site that includes the SNP is introduced into the PCR product by a
primer containing one or more mismatches to template DNA. The PCR
product modified in this manner is then subjected to restriction
enzyme digestion, and the presence or absence of the SNP is
determined by the resulting restriction pattern.
[0291] The SSCP technique separates denatured double stranded DNA
on a non-denaturing gel, and thus allows the secondary structure,
as well as the molecular weight, of single stranded DNA to
determine gel mobility.
[0292] The ARMS (amplification refractory mutation system)-PCR
procedure (Ye et al., 2001) involves the use of a single PCR for
SNP genotyping (Fan et al., 2003; Chiapparino et al., 2004). A
tetra-primer, employing two primer pairs, is used to amplify two
different alleles of a SNP in a single PCR reaction.
[0293] Alternative methods may be employed to amplify such
fragments, such as the "Ligase Chain Reaction" ("LCR") (Barony, F.,
1991)), which uses two pairs of oligonucleotide probes to
exponentially amplify a specific target. The sequences of each pair
of oligonucleotides are selected to permit the pair to hybridize to
abutting sequences of the same strand of the target. Such
hybridization forms a substrate for a template-dependent ligase. As
with POR, the resulting products thus serve as a template in
subsequent cycles and an exponential amplification of the desired
sequence is obtained.
[0294] LCR can be performed with oliganucleotides having the
proximal and distal sequences of the same strand of a polymorphic
site. In one embodiment, either oligonucleotide will be designed to
include the actual polymorphic site of the polymorphism. In such an
embodiment, the reaction conditions are selected such that the
oligonucleotides can be ligated together only if the target
molecule either contains or lacks the specific nucleotide that is
complementary to the polymorphic site present on the
oligonucleotide. Alternatively, the oligonucleotides may be
selected such that they do not include the polymorphic site (see,
Segev, POT Application WO 90/01069).
[0295] A further method that may alternatively be employed is the
"Oligonucleotide Ligation Assay" ("OLA") (Landegren et al, 1988).
The OLA protocol uses two oligonucleotides that are designed to be
capable of hybridizing to abutting sequences of a single strand of
a target. OLA, like LCR, is particularly suited for the detection
of point mutations. Unlike LCR, however, OLA results in "linear"
rather than exponential amplification of the target sequence.
[0296] Nickerson et al., 1990 have described a nucleic acid
detection assay that combines attributes of PCR and OLA (Nickerson
et al., 1990). In this method, POR is used to achieve the
exponential amplification of target DNA, which is then detected
using OLA. In addition to requiring multiple, and separate,
processing steps, one problem associated with such combinations is
that they inherit all of the problems associated with PCR and
OLA.
[0297] Schemes based on ligation of two for more) oligonucleotides
in the presence of a nucleic acid having the sequence of the
resulting "di-oligonucleotide," thereby amplifying the
di-oligonucleotide, are also known (Wu and Wallace, 1989), and may
be readily adapted to the purposes of the present invention.
[0298] Different assays based on the gene sequence according to the
invention and as described herein above can thus be developed and
used to screen plant material for the presence or absence of the
annuality allele.
[0299] Molecular markers, preferentially End point TaqMan.RTM., can
be developed based on SNPs characterized from sequenced PCR
products that are amplified from annual and biennial plants. Here,
several PCR amplifications will be performed in order to cover the
whole sequence of the gene.
[0300] New molecular markers will then be tested within different
annual and biennial genetic backgrounds to evaluate the robustness
of the molecular test.
[0301] In one embodiment, a molecular marker is a DNA fragment
amplified by PCR, a SSR marker or a RAPD marker. In one embodiment,
the presence or absence of an amplified DNA fragment is indicative
of the presence or absence of the trait itself or of a particular
allele of the trait. In one embodiment, a difference in the length
of an amplified DNA fragment is indicative of the presence of a
particular allele of a trait, and thus enables to distinguish
between different alleles of a trait.
[0302] In a specific embodiment of the invention simple sequence
repeat (SSR) markers are used to identify invention-relevant
alleles in the parent plants and/or the ancestors thereof, as well
as in the progeny plants resulting from a cross of said parent
plants.
[0303] In another specific embodiment of the invention a marker
based on a single nucleotide polymorphism is used to identify
invention-relevant alleles in the parent plants and/or the
ancestors thereof, as well as in the progeny plants resulting from
a cross of said parent plants.
[0304] In still another embodiment of the invention a marker based
on a deletion or an insertion ("INDEL") of at least one nucleotide
is used to identify invention-relevant alleles in the parent plants
and/or the ancestors thereof, as well as in the progeny plants
resulting from a cross of said parent plants.
[0305] These markers can be developed based on the sequence of the
polynucleotides according to the invention and as described herein
before.
[0306] In one aspect of the invention, markers may be developed and
used which are not explicitly disclosed herein or markers even yet
to be identified. Based on the information provided in this
application it will be possible, for a skilled person, to identify
or develop markers not explicitly disclosed herein but genetically
closely linked to, or, preferably, located within the bolting gene
or B gene or linked to the markers disclosed herein. The skilled
person knows that other markers may provide at least equal utility
in screening assays and marker assisted selection.
[0307] There are several methods or approaches available, known to
those skilled in the art, which can be used to identify and/or
develop markers in linkage disequilibrium and/or linked to and/or
located in the B gene region, as well as markers that represent the
actual causal mutations responsible for the biennial genotype.
Without being fully exhaustive some approaches, known by those
skilled in the art, include: [0308] use of disclosed
sequences/markers in hybridization approaches to identify other
sequence in the region of interest: primer sequences as disclosed
herein and/or marker/gene sequences (or part thereof) that can be
determined using the primer sequences as disclosed herein may be
used as (hybridization) probes in isolating nucleic acid
sequences/genes flanking the markers and/or linked and/or
associated and/or specific for the B gene region from a genomic
nucleic acid sample and/or RNA or cDNA sample or pool of samples
(for example screening of genomic resources like BAC libraries or
gDNA or cDNA library screening). [0309] use of disclosed
sequences/markers in PCR approaches to identify other sequence in
the region of interest: primer sequences as disclosed herein and/or
marker/(candidate)gene sequences (or part thereof) that can be
determined using the primer sequences as disclosed may be used as
(PCR) amplification primers to amplify a nucleic acid sequence/gene
flanking and/or linked to and/or associated with and/or specific
for the QTL region from a genomic nucleic acid sample and/or RNA or
cDNA sample or pool of samples either or not isolated from a
specific plant tissue and/or after specific treatment of the plant
and from sugar beet or in principal any other organism with
sufficient homology. [0310] use of disclosed sequences/markers in
PCR approaches to identify other sequence in the region of
interest: the nucleotide sequences/genes of one or more markers can
be determined after internal primers for said marker sequences may
be designed and used to further determine additional flanking
sequence/genes within the B gene region and/or genetically linked
and/or associated with the trait. [0311] use of disclosed
sequences/markers in mapping and/or comparative mapping approaches
to identify markers in the same region(s) (positioning of the
B-gene on other maps): based on positional information and/or
marker information as disclosed herein, markers, of any type, may
be identified by genetic mapping approaches, eventually (if already
needed) by positioning of the disclosed markers (by genetic mapping
or extrapolation based on common markers across maps) on a (high
density) genetic map(s), and/or integrated genetic or consensus
map(s). Markers already known and/or new markers genetically linked
and/or positioned in the vicinity of the disclosed markers and/or B
gene region may be identified and/or obtained and eventually used
in B gene (fine-) mapping and/or B gene cloning and/or MAS breeding
applications. [0312] use of disclosed sequences/markers in
`in-siloco` approaches to identify additional
sequences/markers/(candidate)genes in Bene region(s): primer
sequences as disclosed herein and/or marker/(candidate)gene
sequences (or part thereof) that can be determined using the primer
sequences as disclosed herein or based on linked markers may be
used in `in-silico` methods to search sequence or protein databases
(e.g., BLAST) for (additional) flanking and/or homolog
sequences/genes and/or allelic diversity (both genomic and/or cDNA
sequences or even proteins and both originating from capsicum
and/or any other organism) genetically linked and/or associated
with the traits as described herein and/or located in the B gene
region. [0313] use of disclosed sequences/markers in physical
mapping approaches (positioning of B-gene on physical map or genome
sequence): primer sequences as disclosed herein and/or marker/gene
sequences (or part thereof) that can be determined using the primer
sequences as disclosed herein or using other markers genetically
linked to the markers disclosed herein and/or located in the B gene
region may be positioned on a physical map and/or (whole) genome
sequence in principal of any organism with sufficient homology to
identify (candidate) sequences/markers/-genes applicable in B gene
(fine-mapping) and/or B gene cloning and/or MAS breeding
applications. [0314] use of disclosed sequences/markers to position
B-gene on other (physical) maps or genomes (across species for
pepper other Solanaceae as tomato and potato are of first interest
of course but model species like Arabidopsis may be used): primer
sequences as disclosed herein and/or marker/gene sequences (or part
thereof) that can be determined using the primer sequences as
disclosed herein may be used in comparative genome or syntheny
mapping approaches to identify homolog region and homolog and/or
ortholog sequences/(candidate genes genetically linked and/or
positioned in the B gene region and applicable in B gene
(fine-mapping) and/or B gene cloning and/or MAS breeding
applications. [0315] use of disclosed sequences/markers to select
the appropriate individuals allowing the identification of markers
in region of interest by genetic approaches: primer sequences
and/or markers as disclosed herein may be used to select
individuals with different/contrasting B gene alleles. Genetic
association approaches and/or bulk segregant analysis (BSA,
Michelmore et al. 1991) can be used to identify markers/genes in
the specific region (B gene region) of interest and/or associated
or genetically linked to the described traits. [0316] use of
disclosed information to search for (positional) candidate genes:
the disclosed information may be used to identify positional and/or
functional candidate genes which may be associated with the
described traits and/or genetically linked.
[0317] In particular, the markers according to the present
invention can be used in an allelic discrimination assay,
particularly in an assay for discriminating between different
haplotypes within plant groupings of sugar beet plants exhibiting a
biennial genotype. Said assay is based on a set of probe
polynucleotides comprising two separate probe molecules that are
complementary, for example, to a subregion of the BvPRR7 gene
obtainable by PCR amplification based on forward primer PRR7-F and
reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NO: 8,
respectively, which probe molecules differ only by one base
mismatch, particularly a base mismatch at position #631.
[0318] In another aspect of the invention, an assay is provided
involving markers that can discriminate specifically between annual
plants and biennial plants and can thus be used, for example, for
quality control of seed lots.
[0319] In particular, the invention relates to an assay, which is
based on a set of probe polynucleotides comprising two separate
probe molecules that are complementary, for example, to a to a
subregion of the BvPRR7 gene obtainable by PCR amplification based
on forward primer PRR7-F and reverse primer PRR7-R as given in SEQ
ID NO: 7 and SEQ ID NO 8, respectively, which probe molecules
differ only by one base mismatch, particularly a base mismatch at
position #631.
[0320] The majority of commercial seed productions for sugar beet
are done in southern France and northern Italy. In both regions,
the presence of annual weed beets can cause pollen contamination in
the seed productions, resulting in annuals in the commercial seed.
This is not acceptable to a customer, and therefore all commercial
seed lots are grown in regions, such as Argentina where no wild
beets are growing directly after harvesting the seed. The plants
are not vernalized and the presence of bolters is used to identify
seed lots contaminated with annuals.
[0321] The annual plant habit conferred by the B gene behaves as a
single dominant trait; the requirement for vernalization in
biennial plants accordingly is recessive. The transformation of an
annual allele of BvPRR7 into a biennial genotype thus is predicted
to bestow the annual flowering behavior onto the biennial acceptor
genotype. To verify this hypothesis, the coding sequence of an
annual allele of BvPRR7 under the control of an annual promoter and
terminator fragment is transformed into biennial genotype such as,
for example G018. Transformation can be accomplished by methods
known in art such as that disclosed by Chang et al, 2002 using
sugar beet meristems as explant material and the phosphomannose
isomerase (PMI) gene as selectable marker . . . . Transgenic shoots
are checked for expression of the selection marker such as, for
example, PMI activity (Joersbo et al, 1998) and subsequently
rooted, potted in soil and transferred to the greenhouse. Negative
controls consist of non-transgenic shoots that are subjected to the
same in vitro regeneration procedure, but without Agrobacterium
infection and selection. Plants are grown in growth chambers at a
constant temperature of 18.degree. C. and a photoperiod of 17 hours
light and 7 hours dark. Under these conditions none of the
non-transgenic controls are supposed to show any signs of bolting
during the observation period, whereas annual control plants are
supposed to bolt normally within 8 weeks. Contrary to the
non-transgenic biennial control plants, a substantial number of
transgenic events should start bolting within four to ten weeks and
basically behave as annual plants despite their biennial genetic
background. Transgenic plants that bolted and flowered are
cross-pollinated with a biennial maintainer line to produce
offspring. Progeny plants are tested for selection marker activity
and subsequently monitored for bolting and flowering without
vernalization. Most progenies should show a one to one segregation
ratio and a perfect correlation between PMI activity and the annual
habit. These data will equivocally confirm the causal relationship
between BvPRR7 and vernalization-independent flowering in sugar
beet.
[0322] BvPRR7 plays a key role in the vernalization response in
sugar beet and can thus be used for engineering bolting resistance
into sugar beet plants by suppressing the vernalization response.
To this purpose a BvPRR7 cDNA fragment such as, for example the 0.6
Kb fragment depicted in SEC) ID NO. 1, is assembled into an RNAi
cassette under the control of a constitutive promoter. Suitable
constitutive promoters are, for example, the Ubi3 promoter from
Arabidopsis (Norris et al, 1993), the CaMV 355 promoter, or any
other promoter known to promote constitutive expression in sugar
beet. The expression cassette further contains a selectable marker
gene under the control of a suitable promoter. Particularly, the
marker gene encodes a positive selection marker such as
phosphomannose isomerase or a xylose isomerase. The inverted repeat
of the BvPRR7 fragment may be separated by the second intron from
the potato StLS1 gene (Eckes et al, 1986; Vancanneyt at al, 1990)
to stabilize the RNAi cassette, but also to improve the efficiency
of the RNAi phenomenon (Wang and Waterhouse, 2001; Smith et al,
2000).
[0323] The RNAi cassette can then be transformed into a biennial
sugar beet genotype such as, for example, G018 as described herein
previously. Transgenic shoots are checked for expression of the
selection marker such as, for example, PMI activity (Joersbo at al,
1998). Positive shoots and non-transgenic controls are rooted and
transferred to the greenhouse for an acclimatization period of two
weeks minimum at 18.degree. C. prior to the vernalization
treatment. Once well-established, the transgenic plants are exposed
to the vernalization treatment consisting of a period of 14 weeks
at a constant temperature of 6.degree. C. and 12 hours low
artificial light. Prior to applying bolting-inductive conditions,
vernalized plants are slowly acclimatized for two weeks in climate
chambers by stepwise increasing the temperature from 10 to
18.degree. C. Plants are subsequently repotted into to larger pots
(2 liter), and monitored for bolting while exposed to a constant
temperature of 18.degree. C. and a long-day photoperiod of 17 hours
light/7 hours dark. Non-transgenic control plants routinely start
bolting between four to six weeks post vernalization. Transgenic
plants suppressed for BvPRR7 frequently show a delay in bolting
ranging from only two weeks to more than two months. A few events
never bolted under the conditions applied in the greenhouse. Apart
from the delay in bolting and flowering, transgenic plants develop
normally and show no phenotypic aberrations. In general, plants
delayed in bolting show a higher leaf number at the time of bolting
as a result of the prolonged vegetative stage.
[0324] Obtaining sufficient levels of transgene expression in the
appropriate plant tissues is an important aspect in the production
of genetically engineered crops. Expression of heterologous DNA
sequences in a plant host is dependent upon the presence of an
operably linked promoter that is functional within the plant host.
Choice of the promoter sequence will determine when and where
within the organism the heterologous DNA sequence is expressed.
[0325] For example, if overexpression is desired, a plant promoter
fragment may be employed which will direct expression of the gene
in all tissue; of a regenerated plant. Such promoters are referred
to herein as "constitutive" promoters and are active under most
environmental conditions and states of development or cell
differentiation. Examples of constitutive promoters include the
cauliflower mosaic virus (CaMV) 35S transcription initiation
region, the 1'- or 2'-promoter derived from T-DNA of Agrobacterium
tumefaciens, and other transcription initiation regions from
various plant genes known to those of skill. Such genes include for
example, the AP2 gene, ACTI1 from Arabidopsis (Huang et al. Plant
Mol. Biol. 33:125-139 (1996)), Cat3 from Arabidopsis (GenBank No.
U43147, Zhong et al., Mol. Gen. Genet. 251:196-203 (1996)), the
gene encoding stearoyl-acyl carrier protein desaturase from
Brassica napus (Genbank No. X74782, Solocornbe et al. Plant
Physiol. 104:1167-1176 (1994)), GPc1 from maize (GenBank No X15596,
Martinez et al. J. Mol. Biol 208:551-565 (1989)), and Gpc2 from
maize (GenBank No. U45855, Manjunath et al., Plant Mol. Biol.
33:97-112 (1997)).
[0326] Alternatively, the plant promoter may direct expression of
the nucleic acid molecules of the invention in a specific tissue or
may be otherwise under more precise environmental or developmental
control. Examples of environmental conditions that may effect
transcription by inducible promoters include anaerobic conditions,
elevated temperature, or the presence of light. Such promoters are
referred to here as "inducible" or "tissue-specific" promoters. One
of skill will recognize that a tissue-specific promoter may drive
expression of operably linked sequences in tissues other than the
target tissue. Thus, as used herein a tissue-specific promoter is
one that drives expression preferentially in the target tissue, but
may also lead to some expression in other tissues as well.
[0327] Examples of promoters under developmental control include
promoters that initiate transcription only (or primarily only) in
certain tissues, such as fruit, seeds, or flowers. Promoters that
direct expression of nucleic acids in ovules, flowers or seeds are
particularly useful in the present invention. As used herein a
seed-specific or preferential promoter is one which directs
expression specifically or preferentially in seed tissues, such
promoters may be, for example, ovule-specific, embryo-specific,
endosperm-specific, integument-specific, seed coat-specific, or
some combination thereof. Examples include a promoter from the
ovule-specific BEL1 gene described in Reiser et al. Cell 83:735-742
(1995) (GenBank No. U39944). Other suitable seed specific promoters
are derived from the following genes: MAC1 from maize (Sheridan et
al. Genetics 142:1009-1020 (1996), Cat3 from maize (GenBank No.
L05934, Abler et al. Plant Mol. Biol. 22:10131-1038 (1993), the
gene encoding oleosin 18 kD from maize (GenBank No, J05212, Lee et
al. Plant Mol. Biol. 26:1981-1987 (1994)), vivparous-1 from
Arabidopsis (Genbank No. U93215), the gene encoding oleosin from
Arabidopsis (Genbank No. Z17657), Atmycl from Arabidopsis (Urao et
al. Plant Mol. Biol, 32:571-576 (1996), the 2s seed storage protein
gene family from Arabidopsis (Conceicao et al. Plant 5:493-505
(1994)) the gene encoding oleosin 20 kD from Brassica napus
(GenBank No. M63985), napA from Brassica napus (GenBank No. J02798,
Josefsson et al. JBL 26:12196-1301 (1987), the napin gene family
from Brassica napus (Sjodahl et al. Planta 197:264-271 (1995), the
gene encoding the 25 storage protein from Brassica napus (Dasgupta
et al. Gene 133:301-302 (1993)), the genes encoding oleosin A
(Genbank No. U09118) and oleosin B (Genbank No. U09119) from
soybean and the gene encoding low molecular weight sulphur rich
protein from soybean (Choi et al. Mot Gen, Genet. 246:266-268
(1995)).
[0328] Alternatively, particular sequences which provide the
promoter with desirable expression characteristics, or the promoter
with expression enhancement activity, could be identified and these
or similar sequences introduced into the sequences via mutation. It
is further contemplated that one could mutagenize these sequences
in order to enhance their expression of transgenes in a particular
species.
[0329] Furthermore, it is contemplated that promoters combining
elements from more than one promoter may be useful. For example,
U.S. Pat. No. 6,491,288 discloses combining a Cauliflower Mosaic
Virus promoter with a histone promoter. Thus, the elements from the
promoters disclosed herein may be combined with elements from other
promoters.
[0330] A variety of 5' and 3' transcriptional regulatory sequences
are available for use in the present invention. Transcriptional
terminators are responsible for the termination of transcription
and correct mRNA polyadenylation. The 3' nontranslated regulatory
DNA sequence preferably includes from about 50 to about 1,000, more
preferably about 100 to about 1,000, nucleotide base pairs and
contains plant transcriptional and translational termination
sequences. Appropriate transcriptional terminators and those which
are known to function in plants include the CaMV 35S terminator,
the tml terminator, the nopaline synthase terminator, the pea rbcS
E9 terminator, the terminator for the 17 transcript from the
octopine synthase gene of Agrobacterium tumefaciens, and the 3' end
of the protease inhibitor I or II genes from potato or tomato,
although other 3' elements known to those of skill in the art can
also be employed. Alternatively, one also could use a gamma coixin,
oleosin 3 or other terminator from the genus Coix.
[0331] Preferred 3' elements include those from the nopaline
synthase gene of Agrobacterium tumefaciens (Bevan et al., 1983),
the terminator for the T7 transcript from the octopine synthase
gene of Agrobacterium tumefaciens, and the 3' end of the protease
inhibitor I or II genes from potato or tomato.
[0332] As the DNA sequence between the transcription initiation
site and the start of the coding sequence, i.e., the untranslated
leader sequence, can influence gene expression, one may also wish
to employ a particular leader sequence. Preferred leader sequences
are contemplated to include those which include sequences predicted
to direct optimum expression of the attached gene, i.e., to include
a preferred consensus leader sequence which may increase or
maintain mRNA stability and prevent inappropriate initiation of
translation. The choice of such sequences will be known to those of
skill in the art in light of the present disclosure. Sequences that
are derived from genes that are highly expressed in plants will be
most preferred.
[0333] Other sequences that have been found to enhance gene
expression in transgenic plants include intron sequences (e.g.,
from Adh1, bronze 1, actin1, actin 2 (WO 00/760067), or the sucrose
synthase intron) and viral leader sequences (e.g., from TMV MCMV
and AMV). For example, a number of non-translated leader sequences
derived from viruses are known to enhance expression. Specifically,
leader sequences from Tobacco Mosaic Virus (TMV), Maize Chlorotic
Mottle Virus (MCMV), and Alfalfa Mosaic Virus (AMV) have been shown
to be effective in enhancing expression (e.g., Gallie at 1987;
Skuzeski et al., 1990). Other leaders known in the art include but
are not limited to: Picornavirus leaders, for example, EMCV leader
(Encephalomyocarditis 5 noncoding region) (Elroy-Stein at al.,
1989); Potyvirus leaders, for example, TEV leader (Tobacco Etch
Virus); MDMV leader (Maize Dwarf Mosaic Virus); Human
immunoglobulin heavy-chain binding protein (BiP) leader, (Macejak
et al., 1991); Untranslated leader from the coat protein mRNA of
alfalfa mosaic virus (AMV RNA 4), (Jobling et al., 1987; Tobacco
mosaic virus leader (TMV), (Gallie et al., 1989; and Maize
Chlorotic Mottle Virus leader (MCMV) (Lommel et al., 1991. See
also, Della-Ciappa et al., 1987.
[0334] Regulatory elements such as Adh intron 1 (CaIlls et al.,
1987), sucrose synthase intron (Vasil at al., 1989) or TMV omega
element (Gallie, et al., 1989), may further be included where
desired.
[0335] Examples of enhancers include elements from the CaMV 35S
promoter, octopine synthase genes (Ellis el al., 1987), the rice
actin I gene, the maize alcohol dehydrogenase gene (Callis et al.,
1987), the maize shrunken I gene (Vasil et al., 1989), TMV Omega
element (Gallie et al., 1989) and promoters from non-plant
eukaryotes (e.g., yeast; Ma et al., 1988).
[0336] Two principal methods for the control of expression are
known, viz.: overexpression and underexpression. Overexpression can
be achieved by insertion of one or more than one extra copy of the
selected gene. It is, however, not unknown for plants or their
progeny, originally transformed with one or more than one extra
copy of a nucleotide sequence, to exhibit the effects of
underexpression as well as overexpression. For underexpression
there are two principle methods which are commonly referred to in
the art as "antisense downregulation" and "sense downregulation"
(sense downregulation is also referred to as "cosuppression").
Generically these processes are referred to as "gene silencing".
Both of these methods lead to an inhibition of expression of the
target gene.
[0337] Within the scope of the present invention, the alteration in
expression of the nucleic acid molecule of the present invention
may be achieved in one of the following ways:
"Sense" Suppression
[0338] Alteration of the expression of a nucleotide sequence of the
present invention, preferably reduction of its expression, is
obtained by "sense" suppression (referenced in e.g., Jorgensen et
al. (1996) Plant Mol. Biol. 31, 957-973). In this case, the
entirety or a portion of a nucleotide sequence of the present
invention is comprised in a DNA molecule. The DNA molecule is
preferably operatively linked to a promoter functional in a cell
comprising the target gene, preferably a plant cell, and introduced
into the cell, in which the nucleotide sequence is expressible. The
nucleotide sequence is inserted in the DNA molecule in the "sense
orientation", meaning that the coding strand of the nucleotide
sequence can be transcribed. In a preferred embodiment, the
nucleotide sequence is fully translatable and all the genetic
information comprised in the nucleotide sequence, or portion
thereof, is translated into a polypeptide. In another preferred
embodiment, the nucleotide sequence is partially translatable and a
short peptide is translated. In a preferred embodiment, this is
achieved by inserting at least one premature stop codon in the
nucleotide sequence, which brings translation to a halt. In another
more preferred embodiment, the nucleotide sequence is transcribed
but no translation product is being made. This is usually achieved
by removing the start codon, e.g., the "ATG", of the polypeptide
encoded by the nucleotide sequence. In a further preferred
embodiment, the DNA molecule comprising the nucleotide sequence, or
a portion thereof, is stably integrated in the genome of the plant
cell. In another preferred embodiment, the DNA molecule comprising
the nucleotide sequence, or a portion thereof, is comprised in an
extrachromosomally replicating molecule.
[0339] In transgenic plants containing one of the DNA molecules
described immediately above, the expression of the nucleotide
sequence corresponding to the nucleotide sequence comprised in the
DNA molecule is preferably reduced. Preferably, the nucleotide
sequence in the DNA molecule is at least 70% identical to the
nucleotide sequence the expression of which is reduced, more
preferably it is at least 80% identical, yet more preferably at
least 90% identical, yet more preferably at least 95% identical,
yet more preferably at least 99% identical.
"Anti-Sense" Suppression
[0340] In another preferred embodiment, the alteration of the
expression of a nucleotide sequence of the present invention,
preferably the reduction of its expression is obtained by
"anti-sense" suppression. The entirety or a portion of a nucleotide
sequence of the present invention is comprised in a DNA molecule.
The DNA molecule is preferably operatively linked to a promoter
functional in a plant cell, and introduced in a plant cell, in
which the nucleotide sequence is expressible. The nucleotide
sequence is inserted in the DNA molecule in the "anti-sense
orientation", meaning that the reverse complement (also called
sometimes non-coding strand) of the nucleotide sequence can be
transcribed. In a preferred embodiment, the DNA molecule comprising
the nucleotide sequence, or a portion thereof, is stably integrated
in the genome of the plant cell. In another preferred embodiment
the DNA molecule comprising the nucleotide sequence, or a portion
thereof, is comprised in an extrachromosomally replicating
molecule. Several publications describing this approach are cited
for further illustration (Green, P. J. et al., Ann. Rev. Biochem.
55:569-597 (1986); van der Krol, A. R. et al, Antisense Nuc. Acids
& Proteins, pp. 125-141 (1991); Abel, P. P. et al., Proc. Natl.
Acad. Sci. USA 86:6949-6952 (1989); Ecker, J. R. et al., Proc.
Natl. Acad. Sci. USA 83:5372-5376 (August 1986)).
[0341] In transgenic plants containing one of the DNA molecules
described immediately above, the expression of the nucleotide
sequence corresponding to the nucleotide sequence comprised in the
DNA molecule is preferably reduced. Preferably, the nucleotide
sequence in the DNA molecule is at least 70% identical to the
nucleotide sequence the expression of which is reduced, more
preferably it is at least 80% identical, yet more preferably at
least 90% identical, yet more preferably at least 95% identical,
yet more preferably at least 99% identical.
Homologous Recombination
[0342] In another preferred embodiment, at least one genomic copy
corresponding to a nucleotide sequence of the present invention is
modified in the genome of the plant by homologous recombination as
further illustrated in Paszkowski et al., EMBO Journal 7:4021-26
(1988). This technique uses the property of homologous sequences to
recognize each other and to exchange nucleotide sequences between
each by a process known in the art as homologous recombination.
Homologous recombination can occur between the chromosomal copy of
a nucleotide sequence in a cell and an incoming copy of the
nucleotide sequence introduced in the cell by transformation.
Specific modifications are thus accurately introduced in the
chromosomal copy of the nucleotide sequence. In one embodiment, the
regulatory elements of the nucleotide sequence of the present
invention are modified. Such regulatory elements are easily
obtainable by screening a genomic library using the nucleotide
sequence of the present invention, or a portion thereof, as a
probe. The existing regulatory elements are replaced by different
regulatory elements, thus altering expression of the nucleotide
sequence, or they are mutated or deleted, thus abolishing the
expression of the nucleotide sequence. In another embodiment, the
nucleotide sequence is modified by deletion of a part of the
nucleotide sequence or the entire nucleotide sequence, or by
mutation. Expression of a mutated polypeptide in a plant cell is
also contemplated in the present invention. More recent refinements
of this technique to disrupt endogenous plant genes have been
described (Kempin et al., Nature 389:802-803 (1997) and Miao and
Lam, Plant J., 7:359-365 (1995).
[0343] In another preferred embodiment, a mutation in the
chromosomal copy of a nucleotide sequence is introduced by
transforming a cell with a chimeric oligonucleotide composed of a
contiguous stretch of RNA and DNA residues in a duplex conformation
with double hairpin caps on the ends. An additional feature of the
oligonucleotide is for example the presence of 2'-O-methylation at
the RNA residues. The RNA/DNA sequence is designed to align with
the sequence of a chromosomal copy of a nucleotide sequence of the
present invention and to contain the desired nucleotide change. For
example, this technique is further illustrated in U.S. Pat. No.
5,501,967 and Zhu et al. (1999) Proc. Natl. Acad. Sci. USA 96:
8768-773.
Ribozymes
[0344] In a further embodiment, the RNA coding for a polypeptide of
the present invention is cleaved by a catalytic RNA, or ribozyme,
specific for such RNA. The ribozyme is expressed in transgenic
plants and results in reduced amounts of RNA coding for the
polypeptide of the present invention in plant cells, thus leading
to reduced amounts of polypeptide accumulated in the cells. This
method is further illustrated in U.S. Pat. No. 4,987,071.
Dominant-Negative Mutants
[0345] In another preferred embodiment, the activity of the
polypeptide encoded by the nucleotide sequences of this invention
is changed. This is achieved by expression of dominant negative
mutants of the proteins in transgenic plants, leading to the loss
of activity of the endogenous protein.
Aptamers
[0346] In a further embodiment, the activity of polypeptide of the
present invention is inhibited by expressing in transgenic plants
nucleic acid ligands, so-called aptamers, which specifically bind
to the protein. Aptamers are preferentially obtained by the SELEX
(Systematic Evolution of Ligands by EXponential Enrichment) method.
In the SELEX method, a candidate mixture of single stranded nucleic
acids having regions of randomized sequence is contacted with the
protein and those nucleic acids having an increased affinity to the
target are partitioned from the remainder of the candidate mixture.
The partitioned nucleic acids are amplified to yield a ligand
enriched mixture. After several iterations a nucleic acid with
optimal affinity to the polypeptide is obtained and is used for
expression in transgenic plants. This method is further illustrated
in U.S. Pat. No. 5,270,163.
Zinc Finger Proteins
[0347] A zinc finger protein that binds a nucleotide sequence of
the present invention or to its regulatory region is also used to
alter expression of the nucleotide sequence. Preferably,
transcription of the nucleotide sequence is reduced or increased.
Zinc finger proteins are for example described in Beerli et al.
(1998) PNAS 95:14628-14633, or in WO 95/19431, WO 98/54311, or WO
96/06166, all incorporated herein by reference in their
entirety.
[0348] dsRNA
[0349] Alteration of the expression of a nucleotide sequence of the
present invention is also obtained by dsRNA interference as
described for example in WO 99/32619, WO 99/53050 or WO 99/61631,
all incorporated herein by reference in their entirety.
Insertion of a DNA Molecule (Insertional Mutagenesis)
[0350] In another preferred embodiment, a DNA molecule is inserted
into a chromosomal copy of a nucleotide sequence of the present
invention, or into a regulatory region thereof. Preferably, such
DNA molecule comprises a transposable element capable of
transposition in a plant cell, such as e.g, Ac/Ds, Em/Spm, mutator.
Alternatively, the DNA molecule comprises a T-DNA border of an
Agrobacterium T-DNA. The DNA molecule may also comprise a
recombinase or integrase recognition site which can be used to
remove part of the DNA molecule from the chromosome of the plant
cell. An example of this method is set forth in Example 2. Methods
of insertional mutagenesis using T-DNA, transposons,
oligonucleotides or other methods known to those skilled in the art
are also encompassed. Methods of using T-DNA and transposon for
insertional mutagenesis are described in Winkler et al. (1989)
Methods Mol. Biol. 82:129-136 and Martienssen (1998) PNAS
95:2021-2026, incorporated herein by reference in their
entireties.
Deletion Mutagenesis
[0351] In yet another embodiment, a mutation of a nucleic acid
molecule of the present invention is created in the genomic copy of
the sequence in the cell or plant by deletion of a portion of the
nucleotide sequence or regulator sequence. Methods of deletion
mutagenesis are known to those skilled in the art. See, for
example, Miao et al, (1995) Plant J. 7:359.
[0352] In yet another embodiment, this deletion is created at
random in a large population of plants by chemical mutagenesis or
irradiation and a plant with a deletion in a gene of the present
invention is isolated by forward or reverse genetics. Irradiation
with fast neutrons or gamma rays is known to cause deletion
mutations in plants (Silverstone et al, (1998) Plant Cell,
10:155-169; Bruggemann et al., (1996) Plant J., 10:755-760; Redei
and Koncz in Methods in Arabidopsis Research, World Scientific
Press (1992), pp. 16-82). Deletion mutations in a gene of the
present invention can be recovered in a reverse genetics strategy
using PCR with pooled sets of genomic DNAs as has been shown in C.
elegans (Liu et al., (1999), Genome Research, 9:859-867.). A
forward genetics strategy would involve mutagenesis of a line
displaying PTGS followed by screening the M2 progeny for the
absence of PTGS. Among these mutants would be expected to be some
that disrupt a gene of the present invention. This could be
assessed by Southern blot or PCR for a gene of the present
invention with genomic DNA from these mutants.
Overexpression in a Plant Cell
[0353] In yet another preferred embodiment, a nucleotide sequence
of the present invention encoding the B gene, particularly the
BvPRR7 gene, in a plant cell is overexpressed. Examples of nucleic
acid molecules and expression cassettes for overexpression of a
nucleic acid molecule of the present invention are described above.
Methods known to those skilled in the art of over-expression of
nucleic acid molecules are also encompassed by the present
invention.
[0354] In still another embodiment, the expression of the
nucleotide sequence of the present invention is altered in every
cell of a plant. This is for example obtained though homologous
recombination or by insertion in the chromosome. This is also for
example obtained by expressing a sense or antisense RNA, zinc
finger protein or ribozyme under the control of a promoter capable
of expressing the sense or antisense RNA, zinc finger protein or
ribozyme in every cell of a plant. Constitutive expression,
inducible, tissue-specific or developmentally-regulated expression
are also within the scope of the present invention and result in a
constitutive, inducible, tissue-specific or
developmentally-regulated alteration of the expression of a
nucleotide sequence of the present invention in the plant cell.
Constructs for expression of the sense or antisense RNA, zinc
finger protein or ribozyme, or for overexpression of a nucleotide
sequence of the present invention, are prepared and transformed
into a plant cell according to the teachings of the present
invention, e.g., as described infra.
[0355] The invention hence also provides sense and anti-sense
nucleic acid molecules corresponding to the open reading frames
identified in the SEQ ID NO: 1 of the Sequence Listing as well as
their orthologs.
[0356] The genes and open reading frames according to the present
invention which are substantially similar to a nucleotide sequence
encoding a polypeptide as given in SEQ ID NO: 6 including any
corresponding anti-sense constructs can be operably linked to any
promoter that is functional within the plant host including the
promoter sequences according to the invention or mutants
thereof.
[0357] Once completed, the polynucleotide construct of the
invention comprising an expression cassette or an RNAi cassette may
be mobilized into a suitable vector for plant transformation, such
as, for example, a binary vector, which may then be mobilized to
sugar beet using one of the well known transformation techniques
such as, for example, Agrobacterium-mediated transformation.
[0358] Transgenic plants (or plant cells, or plant explants, or
plant tissues) incorporating and expressing the polynucleotide or
dsRNA of the invention can be produced by a variety of well
established techniques. Following construction of the
polynucleotide construct of the invention comprising an expression
cassette or an RNAI cassette incorporating a polynucleotide
sequence according to the invention and as described herein before,
standard techniques can be used to introduce the polynucleotide
into a plant, a plant cell, a plant explant or a plant tissue of
interest. Optionally, the plant cell, explant or tissue can be
regenerated to produce a transgenic plant. The plant can be any
higher plant, including gymnosperms, monocotyledonous and
dicotyledonous plants. Suitable protocols are available for
Leguminosae (alfalfa, soybean, clover, etc.), Umbelliferae (carrot,
celery, parsnip), Cruciferae (cabbage, radish, rapeseed, broccoli,
etc.), Curcurbitaceae (melons and cucumber), Gramineae (wheat,
corn, rice, barley, millet, etc.), Solanaceae (potato, tomato,
tobacco, peppers, etc.), and various other crops. See protocols
described in Ammirato et eds., (1984) Handbook of Plant Cell
Culture--Crop Species, Macmillan Publ. Co., New York, N.Y.;
Shimamoto et al. (1989) Nature 338: 274 276; Fromm et al. (1990)
Bio/Technol. 8: 833 839; and Vasil et al. (1990) Bio/Technol. 8:
429 434. Transformation and regeneration of both monocotyledonous
and dicotyledonous plant cells is now routine, and the selection of
the most appropriate transformation technique will be determined by
the practitioner. The choice of method will vary with the type of
plant to be transformed; those skilled in the art will recognize
the suitability of particular methods for given plant types.
Suitable methods can include, but are not limited to:
electroporation of plant protoplasts; liposome-mediated
transformation; polyethylene glycol (PEG) mediated transformation;
transformation using viruses; micro-injection of plant cells;
micro-projectile bombardment of plant cells; vacuum infiltration;
and Agrobacterium tumefaciens mediated transformation.
[0359] Transformation of plants can be undertaken with a single DNA
molecule or multiple DNA molecules (i.e., co-transformation), and
both these techniques are suitable for use with the polynucleotide
constructs of the present invention. Numerous transformation
vectors are available for plant transformation, and the expression
cassettes of this invention can be used in conjunction with any
such vectors. The selection of vector will depend upon the
preferred transformation technique and the target species for
transformation.
[0360] A variety of techniques are available and known to those
skilled in the art for introduction of constructs into a plant cell
host. These techniques generally include transformation with DNA
employing A. tumefaciens or A. rhizogenes as the transforming
agent, liposomes, PEG precipitation, electroporation, DNA
injection, direct DNA uptake, microprojectile bombardment, particle
acceleration, and the like (See, for example, EP 295959 and EP
138341) (see below). However, cells other than plant cells may be
transformed with the polynucleotide construct of the invention. The
general descriptions of plant expression vectors and reporter
genes, and Agrobacterium and Agrobacterium-mediated gene transfer,
can be found in Gruber et al. (1993).
[0361] Expression vectors containing a polynucleotide sequence
according to the invention can be introduced into protoplasts or
into intact tissues or isolated cells. Preferably expression
vectors are introduced into intact tissue. General methods of
culturing plant tissues are provided for example by Maki et al.,
(1993), and by Phillips et al. (1988). Preferably, expression
vectors are introduced into maize or other plant tissues using a
direct gene transfer method such as microprojectile-mediated
delivery, DNA injection, electroporation and the like. More
preferably expression vectors are introduced into plant tissues
using the microprojectile media delivery with the biolistic device.
See, for example, Tomes et al. (1995). The vectors of the invention
can not only be used for expression of structural genes but may
also be used in exon-trap cloning, or promoter trap procedures to
detect differential gene expression in varieties of tissues,
(Lindsey et al., 1993; Auch & Reth et al.).
[0362] It is particularly preferred to use the binary type vectors
of Ti and Ri plasmids of Agrobacterium spp. Ti-derived vectors
transform a wide variety of higher plants, including
monocotyledonous and dicotyledonous plants, such as soybean,
cotton, rape, tobacco, and rice (Pacciotti at, 1985: Byrne et al.,
1987; Sukhapinda et al., 1987; Lorz et al., 1985; Potrykus, 1985;
Park et al., 1985: Hiei et al., 1994). The use of T-DNA to
transform plant cells has received extensive study and is amply
described (EP 120516; Hoekema, 1985; Knauf, et al., 1983; and An et
al., 1985). For introduction into plants, the chimeric genes of the
invention can be inserted into binary vectors as described in the
examples.
[0363] Those skilled in the art will appreciate that the choice of
method might depend on the type of plant, i.e., monocotyledonous or
dicotyledonous, targeted for transformation. Suitable methods of
transforming plant cells include, but are not limited to,
microinjection (Crossway et al., 1986), electroporation (Riggs et
al., 1986), Agrobacterium-mediated transformation (Hinchee et al.,
1988), direct gene transfer (Paszkowski et al., 1984), and
ballistic particle acceleration using devices available from
Agracetus, Inc., Madison, Wis. And BioRad, Hercules, Calif. (see,
for example, Sanford et al., U.S. Pat. No. 4,945,050; and McCabe et
al., 1988). Also see, Weissinger et al., 1988; Sanford et a/, 1987
(onion); Christou at al., 1988 (soybean); McCabe et al., 1988
(soybean); Datta et al., 1990 (rice); Klein et al., 1988 (maize);
Klein et al., 1988 (maize); Klein et al., 1988 (maize); Fromm et
al. 1990 (maize); and Gordon-Kamm at al., 1990 (maize); Svab et
al., 1990 (tobacco chloroplast); Koziel et al., 1993 (maize);
Shimamoto et al., 1989 (rice); Christou at al., 1991 (rice);
European Patent Application EP 0 332 581 (orchardgrass and other
Pooideae); Vasil et al., 1993 (wheat); Weeks et al., 1993 (wheat).
In one embodiment, the protoplast transformation method for maize
is employed (European Patent Application EP 0 292 435, U.S. Pat.
No. 5,350,689).
[0364] The main focus of the present invention is on transformation
of sugar beet. The experimental procedures for the transformation
of sugar beet are well known to those skilled in the art such as
that disclosed by Chang at al, 2002 using sugar beet meristems as
explant material.
[0365] After transformed plant cells or plants are selected and
grown to maturity, those plants showing the trait of interest are
identified. The trait can be any of those traits described above.
Additionally, to confirm that the trait of interest is due to the
expression of the introduced polynucleotide of interest under
control of the regulatory nucleotide according to the invention,
expression levels or activity of the polypeptide or polynucleotide
of interest can be determined by analyzing mRNA expression using
Northern blots, RT-PCR or microarrays, or protein expression using
immunoblots or Western blots or gel shift assays.
[0366] The invention thus relates to plant cells and tissues, to
plants derived from such cells and tissues, respectively, to plant
material, to the progeny and to seeds derived from such plants, and
to agricultural products including processed plant products with
improved properties obtainable by, for example, any one of the
transformation methods described below.
[0367] Once an expression cassette according the present invention
and as described herein before comprising a polynucleotide sequence
according to the invention in association with a polynucleotide of
interest has been transformed into a particular plant species, it
may be propagated in that species or moved into other varieties of
the same species, particularly including commercial varieties,
using traditional breeding techniques. Preferred plants of the
invention include gymnosperms, monocots, and dicots, especially
agronomically important crop plants, such as rice, wheat, barley,
rye, rape, corn, potato, carrot, sweet potato, sugar beet, bean,
pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip,
radish, spinach, asparagus, onion, garlic, eggplant, pepper,
celery, carrot, squash, pumpkin, zucchini, cucumber, apple, pear,
quince, melon, plum, cherry, peach, nectarine, apricot, strawberry,
grape, raspberry, blackberry, pineapple, avocado, papaya, mango,
banana, soybean, tobacco, tomato, sorghum and sugarcane.
[0368] The genetic properties engineered into the transgenic plants
described above are passed on by sexual reproduction or vegetative
growth and can thus be maintained and propagated in progeny plants.
Generally said maintenance and propagation make use of known
agricultural methods developed to fit specific purposes such as
tilling, sowing or harvesting. Specialized processes such as
hydroponics or greenhouse technologies can also be applied. Use of
the advantageous genetic properties of the transgenic plants
according to the invention can further be made in plant breeding
that aims at the development of plants with improved properties
such as tolerance of pests, herbicides, or stress, improved
nutritional value, increased yield, or improved structure causing
less loss from lodging or shattering. The various breeding steps
are characterized by well-defined human intervention such as
selecting the lines to be crossed, directing pollination of the
parental lines, or selecting appropriate progeny plants. Depending
on the desired properties different breeding measures are taken.
The relevant techniques are well known in the art and include but
are not limited to hybridization, inbreeding, backcross breeding,
multiline breeding, variety blend, interspecific hybridization,
aneuploid techniques, etc. Hybridization techniques also include
the sterilization of plants to yield male or female sterile plants
by mechanical, chemical or biochemical means. Cross pollination of
a male sterile plant with pollen of a different line assures that
the genome of the male sterile but female fertile plant will
uniformly obtain properties of both parental lines. Thus, the
transgenic plants according to the invention can be used for the
breeding of improved plant lines that for example increase the
effectiveness of conventional methods such as herbicide or
pesticide treatment or allow to dispense with said methods due to
their modified genetic properties. Alternatively new crops with
improved stress tolerance can be obtained that, due to their
optimized genetic "equipment", yield harvested product of better
quality than products that were not able to tolerate comparable
adverse developmental conditions.
[0369] In one embodiment, a polynucleotide sequence is provided as
given in SEQ ID NO: 5, SEQ ID NO: 51 and SEQ ID NO: 52, which
encodes a protein which is functionally equivalent to the B
gene.
EXAMPLES
[0370] The following Examples provide illustrative embodiments. In
light of the present disclosure and the general level of skill in
the art, those of skill will appreciate that the following Examples
are intended to be exemplary only and that numerous changes,
modifications, and alterations can be employed without departing
from the scope of the presently claimed subject matter.
Example 1
Characterization of the Sugar Beet PRR7 Gene
Example 1.1
Characterization of the Putative PRR7 Homologue from Sugar Beet
[0371] Based on a candidate gene approach for the identification
and characterization of putative bolting control genes in sugar
beet, the EST sequence with accession number CV301305 was
identified as the putative beet homologue of PRR7 by means of
homology searches using BLAST. SEQ ID 1 shows the nucleotide
sequence of EST CV301305. The corresponding amino acid sequence
shows the partial presence of a Pseudo Response Regulator receiver
(PRR, pfam00072) or Signal Receiver (REC, cd00156) domain (FIG. 1),
a hallmark of the PRR gene family that appear to be crucial for
certain circadian-associated events (Nakamichi et al, 2005). FIG. 2
shows the alignment of the amino acid sequence of CV301305 with
PRR7, its closest Arabidopsis homologue, which has been described
as a component of the temperature-sensitive circadian system
(Nakamichi et al, 2007; Salome and McClung 2005). The circadian
clock is known to control several developmental processes in plants
including flowering time (i.e; bolting) control (Imaizumi and Kay,
2006; Zhou et al, 2007).
[0372] Based on the above observations, the putative gene structure
of the partial beet PRR7 fragment was deduced using the alignment
between the genomic sequence and the mRNA of the Arabidopsis PRR7
gene (AT5G02810 and NM.sub.-- 120359 respectively) to the BvPRR7
sugar beet EST (CV301305), which revealed the presence of several
putative intronic regions (FIG. 3). Primers PRR7-F and -R (SEQ ID
NO 2 and 3) encompassing the third putative intronic region
delivered an amplification product of approximately 0.5 Kb when
using genomic beet DNA as template. The PCR conditions for the
amplification reaction were as follows: primary denaturation at
95.degree. C. for 5 min followed by 35 amplification cycles of 30
seconds at 95.degree. C., 30 seconds at 60.degree. C. and 30
seconds at 72.degree. C. and followed by 5 min at 72.degree. C. PCR
experiments were run at a GeneAMP PCR System 9600 instrument from
Applied Biosystems Inc. using Platinum Tag DNA polymerase and the
corresponding reaction mix from Invitrogen Corporation as
recommended by the supplier. Sequence analysis of the PCR product
enabled the reconstruction of the genomic sequence around intron 3
of the BvPRR7 gene fragment, and confirmed the presence of an
intron of 296 base pairs in length (SEQ ID NO 4).
Example 12
Mapping of the BvPRR7 Gene
[0373] Using the PRR7-F and PRR7-R primers described above, the
genomic fragment of the BvPRR7 gene was amplified and sequenced
across a panel of sugar beet parental lines consisting of 15
biennial and one annual line. All biennial lines revealed
monomorphic for BvPRR7 as only two different haplotypes were
observed: one biennial allele and one annual allele (Table 1). In
order to map BvPRR7 in a population segregating for the annual
habit, an assay was developed targeting the SNP at position #160
(SEQ ID NO 4) using the EndPoint TagMan.RTM. technology. Table 2
summarizes the nucleotide sequences of the primers and probes
designed for the PRR7(T1) TagMan.RTM. assay targeting SNP at
position #160; the reactions further consisted of the TaoMan.RTM.
Universal PCR Master Mix, No AmpErase.RTM. UNG (2.times.) from
Applied Biosystems Inc. according to the manufacturers
recommendations. The PCR amplification was performed as follows:
95.degree. C. for 10 min followed by 40 cycles of 95.degree. C. for
15 sec and 60.degree. C. for 1 min, using an ABI PRISM 7700
Sequence Detector instrument. Endpoint measurement was performed
using the Sequence Detection System 2.0 software.
[0374] Using the above PRR7(T1) assay, the BvPRR7 gene was mapped
in a F2 population of 198 individuals derived from a cross between
the annual line and a biennial line polymorphic for the SNP at
position #160. BvPRR7 maps at chromosome H at an approximate
distance of 1 cM downstream of the GJ131 marker (FIG. 4), a region
known to contain the B gene for vernalization-independent flowering
(Mohring et al, 2004; Gaafar et al, 2005). The results of the
PRR7(T1) assay show a perfect match between the predicted genotype
of the B gene and the genotype of the BvPRR7 gene. The genotype of
the B gene was predicted based on phenotypic evaluation of the F3
populations derived from the individual F2 plants for
vernalization-independent flowering. Table 3 summarizes the
graphical representation of the fine-map of the B gene region for 9
individual progeny plants comprising the closest recombination
events. The combination of its map position and its biological
function relating to the temperature-sensitive circadian rhythm
(Salome and McClung, 2005) obviously make BvPRR7 a strong candidate
for the B gene.
Example 1.3
Recovery of the Full-Length Genomic Sequence of BvPRR7
[0375] Using the primers PRR7-F and PRR7-R, a sugar beet BAC
library was screened by means of PER. The library was developed
from the biennial commercial cultivar H20 and calculated to
represent 6 genome equivalents with an average insert size of 120
Kb (McGrath et al, 2004). DNA pools for this library are
distributed by Amplicon Express, Pullman W A. The PCR conditions
for the screening of the DNA pools were as follows: primary
denaturation at 95.degree. C. for 5 min followed by 35
amplification cycles of 30 seconds at 95.degree. C., 30 seconds at
60.degree. C. and 30 seconds at 72.degree. C. and followed by 5 min
at 72.degree. C. PCR experiments were run at a GeneAMP PCR System
9700 instrument from Applied Biosystems Inc, using Platinum Taq DNA
polymerase and the corresponding reaction mix from Invitrogen
Corporation as recommended by the supplier. Subsequent screenings
of the DNA pools for the presence of the BvPRR7 fragment according
to the supplier's instructions resulted in the positive
identification of BAC SBA079-L24.
[0376] In order to obtain the full-length sequence of the BvPRR7
gene, BAC SBA079-L24 was sent to MWG Biotech AG, Germany for
sequence analysis by means of the 454 sequencing technology. Where
necessary, gaps between the obtained contigs were filled by regular
Sanger sequencing to yield one single genomic sequence for the
BvPRR7 gene (SEQ ID NO 5). Based on the alignment of the genomic
sequence to EST CV301305 and on sequence homology to the PRR7 gene
from Arabidopsis, the putative gene structure of the beet BvPRR7
gene comprising introns and exons was predicted as shown in FIG. 5.
Based on this prediction, the genomic sequence spans the entire
BvPRR7 gene with 3.6 Kb of sequence upstream of the ATG start codon
and 2.2 Kb downstream of the coding region. The corresponding amino
acid sequence of BvPRR7 is shown under SEQ ID NO 6. Alignment of
the amino acid sequence of BvPRR7 to all members of the PRR gene
family from Arabidopsis including TOC1 (PRR1), PRR3, PRR5, PRR7 and
PRR9 illustrates the strong conservation of the Pseudo Response
Regulator receiver domain (PRR) motif (pfam00072) near the
NH2-terminus and the CCT motif (pfam06203) at the COOH-terminus
(FIG. 6). In addition to the PRR gene family from Arabidopsis,
BvPRR7 also shares strong homology to the PRR7 homologue in cereals
as illustrated by the phylogenetic tree shown in FIG. 7.
Surprisingly, the PRR7 homologue in cereals, better known as Ppd,
is known to represent a major determinant of the photoperiod
response (Turner et al, 2005; Beales at al, 2007) rather than the
vernalization response as suggested here for sugar beet.
Example 1.4
Gene Expression Analysis of BvPRR7
[0377] For gene expression analysis, seedlings from biennial
vernalized plants were grown in controlled environment chambers at
a constant temperature of 18.degree. C. and a photoperiod of 16 h
day and 8 h night. Leaf samples were harvested every two hours over
a period of 24 hours and total RNA was isolated using the
RNAqueous.RTM.-4PCR Kit commercialized by Ambion, basically
following the supplier's instructions. Plant RNA Isolation Aid
(Ambion) was added to the RNA isolation steps to remove
contaminants such as polysaccharides and polyphenolics and the RNA
samples were treated with DNase I (Ambion) for removal of DNA
residues. The RNA samples were converted to cDNA using the
RETROscript.RTM. Kit (Ambion) starting from 1 .mu.g of total RNA as
template. The expression of the BvPRR7 gene was measured by means
of quantitative PCR (qPCR) using the Power SYBR.RTM. Green FOR
Master Mix (Applied Biosystems Inc.) on an ABI PRISM 7700 Sequence
Detector instrument. The PCR conditions were as follows: primary
denaturation at 95.degree. C. for 10 min followed by 40
amplification cycles of 15 seconds at 95.degree. C. and 1 min at
60.degree. C. The nucleotide sequences of the forward and reverse
primer for BvPRR7 are as follows: 5'-TTGGAGGAGGTGTCACAGTTCTAG-3''
(SEQ ID NO: 49) and 5'-TGTCATTGTCCGACTCTTCAGC-3' (SEQ ID NO: 50),
respectively. The beta tubulin (BvBTU) and isocitrate dehydrogenase
(BvICDH) genes were used as reference genes for normalizing the
expression of BvPRR7. The primer sequences designed for these two
reference genes consisted of 5'-TTGTTGAAAATGCAGACGAGTGT-3' (SEQ ID
NO: 13) and 5-AAGATCGCCAAAGCTTGGTG-3' for 8vBTU (AWO63029) (SEQ ID
NO: 14) and 5'-CACACCAGATGAAGGCCGT-3' (SEQ ID NO 15) and
5'-CCCTGAAGACCGTGCCAT-3' (SEQ ID NO: 16) for BvICDH (AF173666). All
time points were run on biological triplicates and each qPCR
experiment was repeated twice. Data were analysed using the
Sequence Detection System 2.0 software (Applied Biosystems Inc.)
and the GenEx software (MuIUD Analyses). As illustrated in FIG. 8,
the expression profile of BvPRR7 gene shows a circadian oscillation
with a peak of expression 7 h after dawn. This experiment confirms
the rhythmic and circadian expression of BvPRR7 as described for
most of the clock-associated genes identified thus far (McClung,
2006).
Example 1.5
Allelic Variability and Association to the Vernalization
Requirement
[0378] Using several primer pairs (Table 4) the entire coding
region of the BvPRR7 gene was amplified and sequenced across a
panel of 16 biennial and 14 annual plants. The PCR conditions for
the amplifications were as follows: primary denaturation at
95.degree. C. for 5 min followed by 35 amplification cycles of 30
seconds at 95.degree. C., 30 seconds at 60.degree. C. and 30
seconds at 72.degree. C. and followed by 5 min at 72.degree. C. PCR
experiments were run at a GeneAMP PCR System 9600 instrument from
Applied Biosystems Inc. using Platinum Taq DNA polymerase and the
corresponding reaction mix from Invitrogen Corporation as
recommended by the supplier. The graphical representation of the
observed genotypes shows 7 distinct alleles; 6 annual and 1
biennial allele (Table 5). The biennial allele is unique for the
biennial lines and is never found in the annual entries, which
suggest a strong correlation between the allelic variation observed
for BvPRR7 and the annual or biennial plant habit. This observation
further strengthens the causal relationship between BvPRR7 and the
B locus for vernalization independent flowering in sugar beet.
Amongst the 19 SNPs characterized in the coding regions, 7 of them
lead to amino acid changes in the predicted protein sequence
between the annual and the biennial alleles. According to the
haplotypes illustrated in Table 5, any of the SNPs at positions
#3827, #3954, #5284, #5714, #10954, #11220, #11391, #12053, #12127,
and #12837 can be used to distinguish all annual alleles from the
biennial allele by means of molecular markers targeting one or more
of these SNPs.
[0379] Besides the coding region of the PRR7 gene, the promoter
region also revealed polymorphic between annual and biennial lines.
Using primers F3808 (SEQ ID NO 29) and R3809 (SEQ ID NO 30), an
amplification product of 0.6 Kb is obtained when using genomic DNA
from biennial lines as template, but no amplification for the
annual lines. The PCR conditions for the amplification reaction
were as follows: primary denaturation at 95.degree. C. for 5 min
followed by 35 amplification cycles of 30 seconds at 95.degree. C.,
30 seconds at 60.degree. C. and 30 seconds at 72.degree. C. and
followed by 5 min at 72.degree. C. PCR experiments were run at a
GeneAMP PCR System 9600 instrument from Applied Biosystems Inc.
using Platinum Taq DNA polymerase and the corresponding reaction
mix from Invitrogen Corporation as recommended by the supplier.
This primer pair thus specifically amplifies the biennial alleles,
but not the annual alleles. Similar results were obtained for
primer pairs F3855 (SEQ ID NO 35) and R3809 (SEQ ID NO 30) or F3855
(SEQ ID NO 35) and R3856 (SEQ ID NO 36) (Table 4) yielding
amplifications products of 1.0 Kb and 0.8 Kb respectively in
biennial lines, but no amplification in annuals. The person skilled
in the art would know that the choice of discriminative
polymorphisms is not limited to those listed herein above, but can
also be identified in other parts of the non-coding or flanking
regions such as the terminator and the introns.
Tables
TABLE-US-00001 [0380] TABLE 1 Polymorphisms observed between 1
annual and 15 biennial sugar beet lines for the BvPRR7 gene
fragment spanning intron 3. SEQ ID NO 4 pos. 87 160 406 haplotype#1
T T G annual haplotype#2 C C A biennial
[0381] The header row indicates the nucleotide position at the
genomic sequence of the BvPRR7 gene fragment (SEC) ID NO 5). The
remaining rows represent the 2 haplotypes observed across the panel
of 16 lines.
TABLE-US-00002 TABLE 2 Nucleotide sequences of primers and probes
cor- responding to the TaqMan assay PRR7(T1) for the genotyping of
SNP #160 precursor names sequence (5' to 3') PRR7(T1)-F
GAGGTGTCACAGTGTAAGTGTCT PRR7(T1)-R AAAGACTGCTACACGAACCACTAAG
PRR7(T1)-FAM FAM-CTGATGAAAAGCTG-MGB-NFQ PRR7(T1)-VIC
VIC-CTGATGGAAAGCTG-MGB-NFQ
TABLE-US-00003 TABLE 3 Genotypes for a number of markers including
PRR7(T1) mapping around the B gene across nine F2 plants showing
recombination events at either side of the B gene. PRR7(T1), as
well as 9_27(T2) marker, show a perfect match to the predicted
genotype of the B gene. The genotype of the B gene is based on
phenotypic evaluation of the F3 populations derived from the
individual F2 plants. No. of recombinations 98775103 98775161
98775167 98775176 98775206 98775214 98775153 98775237 98775245
E8M4:193 -5 B A H H A H H A H E05M16:24 -3 B A H H A B A A H
E15M4:162 -2 B A H H A B A H H E15M4:159 -2 B A H H A B A H H GJ131
-2 B A H H A B A H H 9_27 0 B H B H A B A H H PRR7 0 B H B H A B A
H H B gene 0 B H B H A B A H H GJ01 3 H H B A H B A H H MP0176 3 H
H B A H B A H H E13M4-196 3 H H B A H B A H H E09M08-113 3 H H B A
H B A H H E09M08-124 3 H H B A H B A H H E09M08:03 3 H H B A H B A
H H E13M04:36 3 H H B A H B A H H MS0278 3 H H B A H B A H H
E09M08-588 3 H H B A H B A H H E8M4:174 3 H H B A H B A H H
E13M04:50 3 H H B A H B A H H E16M16:19 4 H H B A H B A H B
E16M16:17 4 H H B A H B A H B E16M16:20 4 H H B A H B A H B
TABLE-US-00004 TABLE 4 Nucleotide sequences of the PCR primers used
to amplify and sequence all exons of BvPRR7 and part of the introns
and promoter or terminator regions. precursor names sequence (5' to
3') location SEQ ID NO F3766 TTTGATGCTTTTTTCAGGCCA intron 1 SEQ ID
NO: 17 R3767 TTTTCTTATAGGCTTCACCAGAAAGTC exon 3 SEQ ID NO: 18 F3354
ATGTCATCTCATGATTCGATGGG exon 3 SEQ ID NO: 19 R3355
TCAGCCCTCTTGCTTCCTATG exon 4 SEQ ID NO: 20 F3768
TTTCCTCATTCTTTTTTTAGTCTAGTGGT intron SEQ ID NO: 21 3/exon 4 R3769
AATATGTGTGAGAAAATGGTGGCA intron 4 SEQ ID NO: 22 F3782
TCYGAATGGGAAAGGATTTG exon 6 SEQ ID NO: 23 R3783
AATTTCGGGTGGTGCATCAG exon 6 SEQ ID NO: 24 F3784
GCCCCCAACCACAGTCTACA exon 5 SEQ ID NO: 25 R3785
GGTCCATTTAGCCGTGAATCTG exon 6 SEQ ID NO: 26 F3806
TTTTTGCATACCGAAGGCGT promoter SEQ ID NO: 27 R3807
CATTTGTTGAAGTAGGTGATAAGGACAA intron 1 SEQ ID NO: 28 F3808
TTAGATCCTCTCCCTTAGACTCTTCTGT promoter SEQ ID NO: 29 R3809
TCACCAATTCTTTATATCATATCATGACA promoter SEQ ID NO: 30 F3810
GAGAAAAGGGTTTTAGATGGTAAGTTTT promoter SEQ ID NO: 31 R3811
AACTTTAACGGATCATGTGTTTTCAAC promoter SEQ ID NO: 32 F3853
AACTGGACACTTGGATTTCAAGTCA promoter SEQ ID NO: 33 R3854
TTATGGGAAAAAACTCTCGGTATTCT promoter SEQ ID NO: 34 F3855
GAACCCCATTTTAGTATTGACATTTCT promoter SEQ ID NO: 35 R3856
AATTAGATGAATAAAAAGACAAATGAGGAA promoter SEQ ID NO: 36 F3857
TCCATTTGAGGAGTAGGTATGATGAG intron 4 SEQ ID NO: 37 R3858
CTTCGACGATCATTTTCCTGGT exon 6 SEQ ID NO: 38 F3859
GGAAAACCAATATTCACAGTTAGACCT exon 6 SEQ ID NO: 39 R3860
TCTTGAGCTGCTGATCCACGT exon 7 SEQ ID NO: 40 F3861
CTGCATCTGGTAAGCCTGGTG exon 7 SEQ ID NO: 41 R3862 CGTACCTGGCGCACGAAT
exon 8 SEQ ID NO: 42 F3863 AATTTGGCCATTTCTTGCTTGTAT intron 7 SEQ ID
NO: 43 R3864 AATGTGACGCGTAAACGCCT terminator SEQ ID NO: 44 F3865
GGTGTGATGCATATAATCTTGTTTGG terminator SEQ ID NO: 45 R3866
AGCAAGCCTGCGCTGG terminator SEQ ID NO: 46
TABLE-US-00005 TABLE 5 Haplotypes and polymorphisms observed in the
coding region of BvPRR7 amongst 16 biennial and 14 annual lines
##STR00001##
[0382] The Table shows the 19 polymorphisms identified in the
coding regions when comparing the annual and biennial alleles.
Polymorphisms in the Pseudo-receiver and CCT domains are indicated
by bolded lines. Amino acid substitutions are indicated by small
stars. Amino acid changes specific for the biennial allele are
indicated by big stars. The SNP position indicated in the header
row are numbered according to SEQ ID NO 5.
Example 2
Transgenic Validation of BvPRR7 by Means of a Complementation
Study
[0383] The annual plant habit conferred by the B gene behaves as a
single dominant trait; the requirement for vernalization in
biennial plants accordingly is recessive. The transformation of an
annual allele of BvPRR7 into a biennial genotype thus is predicted
to bestow the annual flowering behavior onto the biennial acceptor
genotype. To verify this hypothesis, the coding sequence of an
annual allele of BvPRR7 under the control of an annual promoter and
terminator fragment is transformed into biennial genotype G018. The
experimental procedure for the transformation of sugar beet is
essentially as disclosed by Chang et al, 2002 using sugar beet
meristems as explant material and the phosphomannose isomerase
(PMI) gene as selectable marker. The plasmid map of the binary
vector carrying the gene cassettes for both the PMI selectable
marker gene and the annual BvPRR7 allele is shown in FIG. 9.
Transgenic shoots are checked for PMI activity (Joersbo et al,
1998) and subsequently rooted, potted in soil and transferred to
the greenhouse. Negative controls consist of non-transgenic shoots
that underwent the same in vitro regeneration procedure, but
without Agrobacterium infection and mannose selection. Plants are
grown in growth chambers at a constant temperature of 18.degree. C.
and a photoperiod of 17 hours light and 7 hours dark. Under these
conditions none of the non-transgenic controls are supposed to show
any signs of bolting during the observation period, whereas annual
control plants are supposed to bolt normally within 8 weeks.
Contrary to the non-transgenic biennial control plants, a
substantial number of transgenic events should start bolting within
four to ten weeks and basically behaved as annual plants despite
their biennial genetic background. Transgenic plants that bolted
and flowered are cross-pollinated with a biennial maintainer line
to produce offspring. Progeny plants are tested for PMI activity
and subsequently monitored for bolting and flowering without
vernalization. Most progenies should show a one to one segregation
ratio and a perfect correlation between PMI activity and the annual
habit. These data will equivocally confirm the causal relationship
between E3vPRR7 and vernalization-independent flowering in sugar
beet.
Example 3
Transgenic Suppression of BvPRR7 Confers Bolting Resistance
[0384] Since BvPRR7 plays a key role in the vernalization response
in sugar beet, BvPRR7 represents an obvious candidate for
engineering bolting resistance by suppressing the vernalization
response. To this purpose a BvPRR7 cDNA fragment of 0.6 Kb (SEQ ID
NO. 1) is assembled into an RNAi cassette under the control of the
constitutive Ubi3 promoter from Arabidopsis (Norris et 1993). The
inverted repeat of the BvPRR7 fragment is separated by the second
intron from the potato StLS1 gene (Eckes et al, 1986; Vancanneyt et
al, 1990) to stabilize the RNAi cassette, but also to improve the
efficiency of the RNAi phenomenon (Wang and Waterhouse, 2001; Smith
et al, 2000). The plasmid map of the binary vector carrying the
RNAi gene cassette for BvPRR7 and the PMI selectable marker gene is
shown in FIG. 10. The RNAi cassette is transformed into the
biennial genotype G018 as described in the previous example.
PMI-positive shoots and non-transgenic controls are rooted and
transferred to the greenhouse for an acclimatization period of two
weeks minimum at 18.degree. C. prior to the vernalization
treatment. Once well-established, the transgenic plants are exposed
to the vernalization treatment consisting of a period of 14 weeks
at a constant temperature of 6.degree. C. and 12 hours low
artificial light. Prior to applying bolting-inductive conditions,
vernalized plants are slowly acclimatized for two weeks in climate
chambers by stepwise increasing the temperature from 10 to
18.degree. C. Plants are subsequently repotted into to larger pots
(2 liter), and monitored for bolting while exposed to a constant
temperature of 18.degree. C. and a long-day photoperiod of 17 hours
light 7 hours dark. Non-transgenic control plants routinely start
bolting between four to six weeks post vernalization. Transgenic
plants suppressed for BvPRR7 frequently show a delay in bolting
ranging from only two weeks to more than two months. A few events
may never bolt under the conditions applied in the greenhouse.
Apart from the delay in bolting and flowering, transgenic plants
develop normally and show no phenotypic aberrations. In general,
plants delayed in bolting show a higher leaf number at the time of
bolting as a result of the prolonged vegetative stage.
REFERENCES
[0385] Abe J., Guan G.-P. and Shimamoto Y., 1997. A gene complex
for annual habit in sugar beet (Beta vulgaris L.). Euphytica 94:
129-135. [0386] Barany F., 1991. Genetic Disease Detection and DNA
Amplification Using Cloned Thermostable Ligase. Proc. Natl. Acad.
Sci. USA, 88:189-93. [0387] Batzer M A, Carlton J. E. and Deininger
P. L., 1991. Enhanced evolutionary PCR using oligonucleotides with
inosine at the 3'-terminus. Nucleic Acids Res. 19:5081. [0388]
Beales J., Turner A., Griffiths S., Snape J. W. and Laurie D. A.,
2007. A Pseudo-Response Regulator is misexpressed in the
photoperiod insensitive Ppd-Dle mutant of wheat (Triticum aestivum
L.). Theor. Appl. Genet. 115: 721-733. [0389] Botstein D., White R.
L., Skolnick M. and Davis R. W., 1980. Construction of genetic
linkage map in man using restriction length polymorphisms. Am. J.
Hum. Genet., 32: 314-331. [0390] Brunke K. J. and Wilson S. L.,
1993. Brassica hsp80 promoter. EP0559603 [0391] Chang Y.-F., Zhou
H., Dunder E. M., Rouse S. N., Gu W. and Boutreau E., 2002. Methods
for stable transformation of plants. WO 02/14523 [0392] Chiapparino
E, Lee D. and Donini P., 2004. Genotyping single nucleotide
polymorphisms in barley by tetra-primer ARMS-PCR. Genome 47414-420.
[0393] Cooper D. N., Smith B. A., Cooke H. J. et al, 1985. An
estimate of unique DNA sequence heterozygosity in the human genome.
Hum. Genet. 69:201-205. [0394] Eckes P., Rosahl S., Schell J. and
Willmitzer L., 1986, Isolation and characterization of a
light-inducible, organ-specific gene from potato and analysis of
its expression after tagging and transfer into tobacco and potato
shoots. Mol Gen Genet 205, 14-22. [0395] English J. J., Mueller E.
and Baulcombe D. C., 1996. Suppression of virus accumulation in
transgenic plants exhibiting silencing of nuclear genes. Plant Cell
8:179-188. [0396] Fan J. B., Oliphant A., Shen R., Kermani B. G.,
Garcia F., Gunderson K. L., Hansen M., et al., 2003, Highly
parallel SNP genotyping. Cold Spring Herb Symp Quant Bid 68:69-78.
[0397] Felsenstein J., 1985. Confidence limits on phylogenies: An
approach using the bootstrap. Evolution 39:783-791. [0398] Gaafar
R. M., Hohmann U. and Jung C., 2005. Bacterial artificial
chromosome-derived molecular markers for early bolting in sugar
beet. Theor. Appl. Genet, 110, Number 6: 1027-1037. [0399] Imaizumi
T. and Kay S. A., 2006. Photoperiodic control of flowering: not
only by coincidence. Trends Plant Science 11: 550-557. [0400]
Joersbo M, Donaldson I., Kreiberg K., Petersen S. G., Brunstedt J.
and Okkels F. T., 1998. Analysis of mannose selection used for
transformation of sugar beet. Mol Breeding 4:111-117. [0401]
Konieczny A. and Ausubel F. M., 1993. A procedure for mapping
Arabidopsis mutations using co-dominant ecotype-specific PCR-based
markers, Plant J. 4, pp. 403-410. [0402] Kwok P. Y., Deng Q.,
Zakeri H., Taylor S. L. and Nickerson D. A., 1996. Increasing the
information content of STS-based genome maps: Identifying
polymorphisms in mapped STSs. Genomics 31: 123-126. [0403]
Landegren U., Kaiser R., Sanders J. and Hood L, 1988. A
ligase-mediated gene detection technique. Science 241 4869, pp.
1077-1080. [0404] Litt M. and Luty J. A., 1989. Hypervariable
microsatellite revealed by in-vitro amplification of a dinucleotide
repeat in the cardiac muscle actin gene. Am J Hum Genet 44:
397-401. [0405] McClung C. R., 2006. Plant circadian rhythms. Plant
Cell 18: 792-803. [0406] McGrath J. M., Shaw R. S., de los Reyes B.
G. and Weiland J. J., 2004. Construction of a Sugar Beet BAC
Library from a Hybrid with diverse Traits. Plant Mol Biol Rep 22:
23-28. [0407] Michaels S. D. and Amasino R. M., 1998. A robust
method for detecting single-nucleotide changes as polymorphic
markers by PCR. The Plant Journal 14(3): 381-385. [0408] Mohring
S., Salamini F. and Schneider K., 2005. Multiplexed, linkage
group-specific SNP marker sets for rapid genetic mapping and
fingerprinting of sugar beet (Beta vulgaris L.). Molecular
Breeding, Volume 14, Number 4: 475-488. [0409] Mullis K B., Faloona
F. A., Scharf S., Saiki R., Horn G. and Erlich H., 1986. Specific
enzymatic amplification of DNA in vitro: the polymerase chain
reaction. Cold Spring Harbor Symp Quant Biol 51:263-273. [0410]
Nakamichi N., Kita M., Ito S., Sato E., Yamashino T. and Mizuno T.,
2005. PSEUDO-RESPONSE REGULATORS, PRR9, PRR7 and PRR5, together
play essential roles close to the circadian dock of Arabidopsis
thaliana. Plant Cell Physiol., 46: 686-698. [0411] Neff M. M., Neff
J. D., Chory J. and Pepper A. E., 1998. dCAPS, a simple technique
for the genetic analysis of single nucleotide polymorphisms:
experimental applications in Arabidopsis thaliana genetics. Plant J
14: 387-392. [0412] Nickerson D. A., Kaiser R., Lappin S., Stewart
J., Hood L. and Landegren U., 1990. Automated DNA diagnostics using
an ELISA-based oligonucleotide ligation assay. Proc. Natl. Acad.
Sci. USA. 1990 November; 87(22):8923-7. [0413] Norris S. R., Meyer
S. E and Cailis J., 1993. The intron of Arabidopsis thaliana
polyubiquitin genes is conserved in location and is a quantitative
determinant of chimeric gene expression. Plant Mol Bid 21: 895-906.
[0414] Ohtsuka E., Matsuki S., Ikehara M. Takahashi Y. and
Matsubara K., 1985. An alternative approach to
deoxyoligonucleotides as hybridization probes by insertion of
deoxyinosine at ambiguous codon positions, J. Biol., Chem.
260(5):2605-2608. [0415] Okamuro J. K. and Goldberg R. B., 1989.
Regulation of Plant Gene Expression: General Principles.
Biochemistry of Plants, vol. 15:1-82. [0416] Orita M., Suzuki Y.,
Sekiya T. and Hayashi K., 1989. Rapid and sensitive detection of
point mutations and DNA polymorphism using the polymerase chain
reaction. Genomics 5:874-879. [0417] Pearson W. R., 1990. Rapid and
Sensitive Sequence Comparison with FASTP and FASTA. Methods in
Enzymology 183, 63-98 [0418] Rossolini G. M., Cresti S., Ingianni
A., Cattani P., Riccio M. L. and Satta G., 1994. Use of
deoxyinosine-containing primers vs degenerate primers for
polymerase chain reaction based on ambiguous sequence information,
Mol. Cell Probes 8 (1994), pp. 91-98 [0419] Ruiz M. T., Voinnet O.
and Baulcombe D. C., 1998. Initiation and maintenance of
virus-induced gene silencing. Plant Cell 10, 937-946. [0420] Salome
RA. and McClung C. R., 2005. PSEUDO-RESPONSE REGULATOR 7 and 9 are
partially redundant genes essential for the temperature
responsiveness of the Arabidopsis circadian clock, Plant Cell 17:
791-803. [0421] Saitou N. and Nei M., 1987. The neighbor-joining
method: A new method for reconstructing phylogenetic trees.
Molecular Biology and Evolution 4:406-425. [0422] Segev D., 1990.
PCT Pub. No. WO 90/01069. [0423] Smith N. A., Singh S. P., Wang M.
B., Stoutjesdijk P. A. Green A. G. and Waterhouse P. M, 2000. Total
silencing by intron-spliced hairpin RNAs. Nature 407: 319-320.
[0424] Smith T. F. and Waterman M. S., 1981. Advances in Applied
Mathematics, 2, 482-489. [0425] Tamura K., Dudley J., Nei M. and
Kumar S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis
(MEGA) software version 4.0. Molecular Biology and Evolution
24:1596-1599. [0426] Thiel T, Kota R., Grosse I., Stein N. and
Graner A., 2004. SNP2CAPS: a SNP and INDEL analysis tool for CAPS
marker development. Nucleic Acids Res 32(1): e5. [0427] Tijssen P.,
1993. Laboratory Techniques in Biochemistry and Molecular
Biology-Hybridization with Nucleic Acid Probes part I chapter 2
"Overview of principles of hybridization and the strategy of
nucleic acid probe assays" Elsevier, N.Y. [0428] Turner A., Beales
J., Faure S., Dunford R. P. and Laurie D. A., 2005. The
Pseudo-Response Regulator Ppd-H1 provides adaptation to photoperiod
in barley. Science 310: 1031-1034. [0429] Vancanneyt G., Schmidt
R., O'Connor-Sanchez A., Willmitzer L. and Rocha-Sosa M., 1990.
Construction of an intron-containing marker gene: Splicing of the
intron in transgenic plants and its use in monitoring early events
in Agrobacterium-mediated plant transformation. Mol. Gen. Genet.
220: 245-250. [0430] Vandesompele J., De Preter K., Pattyn F.,
Poppe B, Van Roy N., De Paepe A. and Speleman F., 2002. Accurate
normalization of real-time quantitative RT-PCR data by geometric
averaging of multiple internal control genes. Genome Biology 3:
1-11. [0431] Vos P., Hogers R., Bleeker M., et al. 1995. AFLP: a
new technique for DNA fingerprinting. Nucleic Acids Research
23(21):4407-4414. [0432] Wang D. G., Fan J. B., Siao C. J. et al.,
1998. Large-scale identification, mapping, and genotyping of
single-nucleotide polymorphisms in the human genome. Science 15,
1077-82. [0433] Wang M. B. and Waterhouse P. M., 2001. Application
of gene silencing in plants. Curr. Opin. Plant Biol 5:124-150.
[0434] Weber J. L. and May P. E., 1989. Abundant class of human DNA
polymorhisms which can be typed using the polymerare chain
reaction. Am. J. Hum. Genet. 44, 388-396. [0435] Welsh J. and
McCleland M., 1990. Fingerprinting genomes using PCR with arbitrary
primers. Nucleic Acids Research 18 (24):7213-7218. [0436] Wu D. Y.
and Wallace R. B., 1989. Genomics 4560-569. [0437] Ye S., Dhillon
S., Ke X., Collins A. R. and Day I.N., 2001. An efficient procedure
for genotyping single nucleotide polymorphisms. Nucleic Acids Res.,
29, E88-E88. [0438] Zhou Y., Sun X.-D. and Ni M., 2007. Timing of
photoperiodic flowering: light perception and circadian clock. J.
Integrative Plant Biol. 49: 28-34. [0439] Zuckerkandl E and Pauling
L, 1965. Evolutionary divergence and convergence in proteins, pp.
97-166 in Evolving Genes and Proteins, edited by V. Bryson and H.
J. Vogel. Academic Press, New York.
Sequence CWU 1
1
521840DNABeta vulgaris 1gctcctgtca ttatgatgtc atctcatgat tcgatgggtt
tagtcttaaa gtgcttatcc 60aagggcgctg ttgactttct ggtgaagcct ataagaaaaa
acgaacttaa aaacctttgg 120cagcatgttt ggaggaggtg tcacagttct
agtggtagtg gaagtgaaag ctgtgtaagg 180aatggaaaat ccataggaag
caagagggct gaagagtcgg acaatgacac tgacatcaat 240gaggaagatg
ataacagaag cattggttta caagctcggg atggaagtga caatggaagt
300gggacccaga gttcatggac aaaaagggct gcagaagttg agagccccca
accacagtct 360acatgggagc aagcaactga tccacctgat agcacttgtg
ctcaggtcat ttatccaatg 420tctgaggcat ttgccagcag ctggatgcct
ggatccatgc aggaacttga tggacaggat 480catcaatatg acaatgtccc
aatgggaaag gatttggaga ttggagtacc tagaatttca 540gattcacggc
taaatggacc aaacaaaacg gttaagttag caactactgc tgaggaaaac
600caatattcac agttagacct caaccaggaa aatgatggtc gaagttttga
tgaagagaac 660ctggagatga ataatgataa acctaaaagt gagtggatta
aacaggctat gaactcacca 720ggaaaagttg aagaacatcg tagaggaaat
aaagtatctg atgcaccacc cgaaatttca 780aaataaagga caaaggcatg
caacatgtcg aggatatgcc ttctcttgtg ctcagtctga 8402493DNABeta vulgaris
2atgtcatctc atgattcgat gggtttagtc ttaaagtgct tatccaaggg cgctgttgac
60tttctggtga agcctataag aaaaaaygaa cttaaaaacc tttggcagca tgtttggagg
120aggtgtcaca gtgtaagtgt ctttacattt tccagcttty catcagctta
gtggttcgtg 180tagcagtctt tcarattttc gaactttcta gcacatatga
caaattaaac ctgcatgcta 240attcccgatt agataatgga ataagctctt
tcagctggtc ttttacttct ttctcttctc 300ctcttatgaa aaactggtat
gccactatgc atcttgttcc aggtgtttgt ttagtgtttc 360tttcctttat
tcgttttttt gtttttattt ttaattttaa ttttartttt tcctcattct
420ttttttagtc tagtggtagt ggaagtgaaa gctgtgtaag gaatggaaaa
tccataggaa 480gcaagagggc tga 4933493DNABeta vulgaris 3atgtcatctc
atgattcgat gggtttagtc ttaaagtgct tatccaaggg cgctgttgac 60tttctggtga
agcctataag aaaaaatgaa cttaaaaacc tttggcagca tgtttggagg
120aggtgtcaca gtgtaagtgt ctttacattt tccagctttt catcagctta
gtggttcgtg 180tagcagtctt tcaaattttc gaactttcta gcacatatga
caaattaaac ctgcatgcta 240attcccgatt agataatgga ataagctctt
tcagctggtc ttttacttct ttctcttctc 300ctcttatgaa aaactggtat
gccactatgc atcttgttcc aggtgtttgt ttagtgtttc 360tttcctttat
tcgttttttt gtttttattt ttaattttaa ttttagtttt tcctcattct
420ttttttagtc tagtggtagt ggaagtgaaa gctgtgtaag gaatggaaaa
tccataggaa 480gcaagagggc tga 4934493DNABeta vulgaris 4atgtcatctc
atgattcgat gggtttagtc ttaaagtgct tatccaaggg cgctgttgac 60tttctggtga
agcctataag aaaaaatgaa cttaaaaacc tttggcagca tgtttggagg
120aggtgtcaca gtgtaagtgt ctttacattt tccagctttt catcagctta
gtggttcgtg 180tagcagtctt tcagattttc gaactttcta gcacatatga
caaattaaac ctgcatgcta 240attcccgatt agataatgga ataagctctt
tcagctggtc ttttacttct ttctcttctc 300ctcttatgaa aaactggtat
gccactatgc atcttgttcc aggtgtttgt ttagtgtttc 360tttcctttat
tcgttttttt gtttttattt ttaattttaa ttttaatttt tcctcattct
420ttttttagtc tagtggtagt ggaagtgaaa gctgtgtaag gaatggaaaa
tccataggaa 480gcaagagggc tga 493515037DNABeta vulgaris 5attattgtac
atayawgacy atttacgtaa ctaaattaaa aaaagtttta aaaatgcaaa 60acagaaaata
aaatcaaata tcgacatttg gaaatttata atagaaatga ataaaaataa
120gggagaaata aatgaagaac aaaataaatg agaaagagaa ttaaaatggt
tcttgaaaaa 180taaatgagag agaaaaggag ggaatgagtg agtgatgaga
gagaaagagc tggcccactt 240tcaaaaattc tgccaaaagc ctgccaaatt
ttggccctcc taaaagcatc aaaactacgt 300agttttggcc aaggtgtagg
atgctcatcc tacacctccg tgcaggatct aaattgcgct 360tagaaatagg
gtctcctaat atttctctac tagcattttt tgcacgcgat gcgtgcttga
420atttttttca agatagaaac tcgatttttt tcgacgtatg taaaagtcaa
aatttaaaca 480ttagacatac aaagtataat tgtttttagt tacaaaattt
aattggttta gtctctgtaa 540cttgagtttc tcaccagtct tttttttttt
tttttttttt tttactttca aagttaaatt 600ctatgaacaa aatagaaatt
ttattgaatt tatctatgat ttctaatatt actccctccg 660acccaaaata
tagttcccat ttcccttttt tcacggtaat ttatgcaaat agaatataag
720agggatagta aagatttttt gtttatttaa ataaatgttg tatgggaaaa
gatgatttta 780ggagagaaag tagagaataa ttggtgaaag agtattaatt
gtaacatttt ggttgaataa 840acaaaggaaa aaacaaaatt caagaagcaa
ataaatgaga attgtttcct tgaataatgc 900aaaagtgggt tttaattccc
aaaatatgcc caaaaataaa aaaattccct gtgtaccgtc 960cacgtaagac
ggcacgcgag attttttttt cctacttcaa tacaaccgct acttaaagta
1020gcggtttact gatttttttt tttatctact taggtaaaac cttggcgctg
agtgatataa 1080ctcgctactt caagtagcga tttactgaaa tccccaactc
catagtttga tatgtgcttg 1140caacattttg cccaggtaaa ccgctactca
gggtagcggt ttatgtgtat aaaccgctac 1200ttaaagtagc ggtttatttt
aatataaacc actattgtga gtagcggttt acgtgggcaa 1260aaacaaaaaa
aaaaatagtt tctcgcgtgt cgtcctacgt ggacggtacg cagggaattt
1320tttaattttt gggcatattt tgggaactaa aacccacttt tgcattattc
aaggaaaaaa 1380ttcaaataaa tgatgggaca cggtttttct agacaaatta
cgaaaaaatg tggaactaaa 1440tatgaaaatg gaaactatat tttgggacac
ccaaaatgga aatgggaatt atattttggg 1500acggagggag tataattttt
tagttgattt ttgaattaag tatactactt catatattgt 1560taagaaactg
gacacttgga tttcaagtca aatttttgtg agtatgtatt gacgttgtag
1620tgtattggtt gtagtttgta agttaatttt tgtttttgta aagtttactc
atttgagtga 1680tttgtataat gtaaattatg caattctatg attttagttg
acttgtgagt gattgttata 1740attttatttc cattattttt atttgaatct
ccctttggtt tgtatgtgaa tttgtaattt 1800agaaaggcaa aggggtaaaa
tagtctcttc attcgggaac accatagttc ccctccttcc 1860cttatataat
aaagatgatg atgatttttg ataataatga tttgtaagtg aattatgtga
1920atgtttttgt atgtattgac gtcctagtat attagtttta gtttgtaagt
taattttttt 1980gtttttgtaa agtttcccga tcatttgagt gattttcgtg
attttttgtg attttctcaa 2040ttctatgagt gatttgtaaa gtttcttgat
ataagtgatt tctgagtggt gttgaattaa 2100tttccggtgg ctttgttaga
accccatttt agtattgaca tttcttttgt aatttagaaa 2160gggaaagggg
ggtaaaatag gcatttcaaa aaaggacacc attgctcccc ccttccctta
2220tgtaattgag atatcttaaa agaataccga gagttttttc ccataaagga
gtattttttt 2280taaaattttt tccataaagg agtatttatt agtaccaagt
tgatttccca aatcattatc 2340cttgcgcaaa ttgcataatg gagatatttg
gtgttgacgt gtgaatatgg ggccataata 2400ataggaggtc aaaaacaaaa
ctacaagggt taaaatcgtc acaatattaa acaagcatct 2460cacattctca
ctggtcactt ttttttaacc tattaaaaga acaaaccttt aactctcctc
2520acaatctgac acgtgtcgaa tattgattta ctgagatcaa tttagatcct
ctcccttaga 2580ctcttctgtc ttctcagtac agctttagat ctcaacctcc
atgtcagcaa agttacctta 2640cgtgtcatcc tacgtggcct ctccttctac
ccctcactcc tccacgtcaa cattttcctc 2700caaaattaaa aaatcatttt
tttattatat ttacttgaat gtatataata atgtctactg 2760atcttcttct
ttagaactat ctccttctct cattggaacc tcaaaatcat tcttatttta
2820tttcgagaaa aggaaaaaaa agcacatctt ttttgaagat taatttgtgg
attattattg 2880agcttcatcg tattaaaaaa catagtaaaa gttctttcct
catttgtctt tttattcatc 2940taattttttt tagtgaagaa ccctaatttt
gtttgtgaat tctcaagttc aagttttgat 3000ttgggtattt tttttgatga
aatttgtgca gctgtaggat gttatcgtgc tgagaaaagg 3060gttttagatg
gtaagttttt ttttctttga tttctctctc ctactttttt ttttgttttg
3120ctttagataa tactgtcatg atatgatata aagaattggt gatttgggta
gtttatttaa 3180cctatgatta tgtgttattt gttttgatct ttcaatttat
ctggtgctgt gtgtatatat 3240gttttgtttt tcttcaagta tttggttatt
attgaagtgg gtaattagga atttgctact 3300aatctatgga tttgggttct
gttgtgatta atttactata gatttgaggt ttaatttatg 3360ttttataggt
tagaaaagga aatcaatgat ttgtttgtgg atttgagtag attgtttgtt
3420agtgtgtgta tgatgatatt aacttccatt attcttcccc aaattagggg
taattgatgg 3480ttttttgcat accgaaggcg tattctcttt gatgatggag
tgattgttga aaagacatga 3540tgggttaaag ttgcaggatt atttcatttc
aataaacata attgatcaat ttggatctgt 3600tgaatgaggt tgattcacaa
aaatgaagat gggcccggtg ttgccaagtc ggtggcagag 3660cttaatcaac
atatagttgc tgtgaaaaaa gaaggtaggg gtagggttgc aggtgaaggg
3720caggggcttt ccgaggagga cgaactgaga attattgagg atggtgaaga
tgcaaacagc 3780aggcgttctt tgagttctgt tcagcttcca gttcatactc
acaggcatca gccacaagta 3840caaccccagg ggagagtctg ttgggagagg
tttctccctg ttggatctcc taaggttttg 3900ctcgtagaaa gtgatgactc
aactcgtcat attgttagtg ctttgctacg gaaatgtagc 3960tatgaaggtg
atttgatctg ttttaatccc atatatgcaa tgtcttgtcc ttatcaccta
4020cttcaacaaa tgattaagag aattgtactc cctcgttcca aaataatagc
aacacttagc 4080cttcccgtag actttaggga gcgtttggtt catattatgg
tatgggtttg gaattaggaa 4140tgaaaccaag gtggtatggg gttggaactt
gatacttaat accttgtatt tggtttcatt 4200taggaatgaa aaaatttctt
ttatttgata cctagaggta aggtatgagc catacccacc 4260tccccccatg
ggtttctaaa ccccatacct tatgggtttg aggtatgggt ttaaaattta
4320aaaataagtt aaacaaacac taggtatgtg ttttgttcat tccaaaccca
tacctcatac 4380ctaaaactag tgaaccaaac acccccttaa ggatcttggg
acaaagggaa tccattacta 4440gatctggtga cattaatacc taagtttaca
tcagtttcac ttaaatcctt cgttttaaaa 4500aaagtaaaaa aacctgttag
tctgagtaag tttactaatt tttgttctaa aattcaacac 4560attatctaca
tgcaagcact tactagtaca atacaactca aacaatatat gcatcctatc
4620tgttcacaat gaaccgaaaa ctaatctttt catacccttg tttgatgctt
ttttcaggcc 4680atacaaattt ctttaaccta aattgcctcc tcagtcactg
ttcaaaattg cagttttaac 4740atcctcaaga ccatgtgatg tactgttaga
ttatattaag accctattgt aaataaagca 4800tgtatagtgg aataaaatgc
atgtcttcct actttttttt gggggtcatg aactcattgt 4860ttgatatttt
gcagttgtag gggtgccaaa tggcatagaa gcatggaaaa tcttagaaga
4920tttgagcaat cagattgacc tagttttaac tgaggtagtc acatcaggac
tctctggtat 4980aggtcttctg tccaagataa tgagtcacaa aagctgccag
aatactcctg tcattagtga 5040gctttcgttc cttgttgtat tagtgtatgt
tctgtatttg attttctttc tttgtgcata 5100tcttgccttg ttttttacaa
ttatttagat tttagatgaa aatgtatact cattttatgg 5160tctttagctg
caacatttga ttattttgtg tgcagtgatg tcatctcatg attcgatggg
5220tttagtctta aagtgcttat ccaagggcgc tgttgacttt ctggtgaagc
ctataagaaa 5280aaacgaactt aaaaaccttt ggcagcatgt ttggaggagg
tgtcacagtg taagtgtctt 5340tacattttcc agctttccat cagcttagtg
gttcgtgtag cagtctttca aattttcgaa 5400ctttctagca catatgacaa
attaaacctg catgctaatt cccgattaga taatggaata 5460agctctttca
gctggtcttt tacttctttc tcttctcctc ttatgaaaaa ctggtatgcc
5520actatgcatc ttgttccagg tgtttgttta gtgtttcttt cctttattcg
tttttttgtt 5580tttattttta attttaattt taatttttcc tcattctttt
tttagtctag tggtagtgga 5640agtgaaagct gtgtaaggaa tggaaaatcc
ataggaagca agagggctga agagtcggac 5700aatgacactg acatcaatga
ggaagatgat aacagaagca ttggtttaca agctcgggat 5760ggaagtgaca
atggaagtgg gacccaggta gtgctaaccc ctgtaatatt aaacttccta
5820tagtaggtgt ggttaatgtg acgctgttaa ggccttttgg gtggttgctt
ctagttcact 5880aaggataata agaaatagct cgctattgat agttagggca
cctcaatatc acctcctctt 5940gtatgtttgt tgaactacat ttttagccag
acttgagtat tttatcctga aggatagaac 6000aggtgcattt ttggttgcgg
ttgttagttg ttactgttat gcaaagacta ttgccaccat 6060tttctcacac
atatttaaca tggaagtgtc ctaaccaccc cccaacccaa aaaatgggag
6120ggagaaatta ctggagatgg gaaagaagtt acataaaaag ttagtcgttt
gggtcatgat 6180tgtttgttgt atttgcaaag ttagcgcgtt ctcttcctgg
atgcttcaaa ataagctgat 6240gcaccataaa gtaccactct tggcttcacc
tgttggtgtg gacccaacca atgtaccctt 6300gttgatctcg agatagacaa
agaggaagtt taatttctct ttatatgtta tctctcttca 6360atttgttagc
agctatgtct ctttcgtgga catttagaac ccatgttagg ttcatattta
6420tagttaggtg attgtatcaa aattgccatc acaataaaca gaacattaat
ttctattggg 6480aaggattcaa ggatcaaata tacaggaaag agcagtgtag
gagatatcat cttgttgaac 6540aacaaaagaa acattaacat caactggtga
taatctttgc aagattggat gacaaaatga 6600ggagtcgatc taatataaaa
caaattggga actgtcagct atatcctgca tatcaagaat 6660ggagaccttt
aagaaaagta agaccatttt ttgttgggaa gtcaagccat tgtcccagtt
6720tccttgtgaa atttagttca tcttagcttt cttctaccaa catgaattct
ctttcctttc 6780agcccttgca aacttggttt tatgctaatt atcagtgttt
ccttcattta gtacgctgag 6840agggtttatt tggttgatca aagaatactt
gatgaccttg aggtagatgc tctacatgga 6900gaagttcctc taagtgtaca
aagaatctag ttcgaccaac tttgatttag gaagagataa 6960cacgatcacc
tcgtggtcta gactctggag aggtcaaagt gtgcaaaagg gtatttttga
7020aagacaatgg cttgttgatt catgactgaa attggatggt cgtgactgag
catatactat 7080tagtggttct cttctaaggt gatataagta tgtgataacc
caatcctgta tatttcttcg 7140aggacatcaa ttgtgctact attctagggt
gctggagacc catacatata gagccattga 7200caattaacac aaacttcaac
cacttatttt tatttcattt aagctatcaa tccctaagaa 7260agagcccatc
caagctcctg ctttaggtgc atcccctccc ttttcagcta gtgcacaaaa
7320aatgaacttt cgagatagac tgctaaattt gctttgtcaa gaagacaaaa
ttttgataca 7380caactgtaat tgcattttat gacacttacg ctgatatatc
tgcaagtgaa gttgatatgc 7440aaaaactatg tagcctcctt cgtctacggt
aatagatctc cgtcaatgtg atgcttgtgt 7500gccatcataa aatgatattg
ggtctttaga ctctgttact ctacagctga aggatcttag 7560ccttggcatt
tatatccttt ttatccaaaa gttaaaaaaa gcggaccgtt tgacccatgt
7620aaggaaaaag gaaaggaatc gagaaagaca aaggagggga aagaagttaa
atctcctaaa 7680aagcttgttt tgtgcggtga gagagggagc gacttgaaat
tgccattgat gatgattggt 7740tcacaattgt aatcgaaatc aaactcactc
tctctctctc tctctctctt atcacccccc 7800tcaaactata acatcacagt
cctttaaacg tgactgtttc gggggatagt gactggtagg 7860gatgggcaag
ggtcgggtct ggctggaccc tagacccgga ccctaatttt tttttgtaga
7920cccaaacccg gaccctaagg gtctgaaaaa attggacctt gacccagacc
cttagggtct 7980gaagggtcta gagggtcagg agggtccagg cttaaatttt
ttattttgcc aaatttttag 8040cattattaat atcaataatc atttgaaatt
cgcatgaaac aaacacaaaa aaaaatcgca 8100tgaatcaaac acaaaaattc
gcatgaaaca aacactaaca tataaattga aaaaaacgaa 8160acaaacacaa
acttataaac gaaaaaaatt gaaacaaaca caattccaaa catataaact
8220gaaaaaaaaa acgaaacaaa cacaaatata caaactgaaa aaaagaagaa
acaaacacaa 8280cttacataag agttcagaat gggtgttata gtttatgttt
tagtcattta gaaaatcaat 8340ttgttttttt tttaaagtta aaatgtatat
attaaataag tttagggtct aaggtgttgg 8400aacatttata gggtaatggg
tttgaaactc atatgggtat gtactagaag aggaggaggt 8460ctagtatgca
aaaggttaga gtgcatcaag tggtaacaac gcgcattgtt ataccaatgt
8520cgcgagtcgc gacaggcgtc gcgggtcgcg accagcgcct cgcgagcttc
ttcgcatgtc 8580gcgacgcgtc ttctgccttg gaatgcgaaa aaatgcctcg
gcggttttat atccgttgtg 8640atgctttgtt gatcatttta atgactttta
aggtctttta atcagtagat taaaggcctt 8700tgatgagtga ttaagatggg
ggttatgtga ttaacctctc tagtcaatga aatgttgatt 8760atgcttatat
aacctttgga ttcctatgag tgaggagtta gaagaaaatc agaattttct
8820atactctctc aaaagtcttc ttgcttagct taagagaaac cttgcaatct
tctcttgagt 8880gttcttcaca aacacaaaac acaagttctt gttgattcac
ttagaagatc atctaagtgg 8940attgtttctc tccattgtat ctcattagtt
atttcgtgtt aacccggtga tcctagaggg 9000gcgaaattaa actaattgga
aagcgtagtt tccgtgcctt ggagtgggat atccggttct 9060ctcattgatc
acaagcctaa cataagggtc gggtctgggt ccaaatttta agacccggac
9120ccggacccta aaaaattcac ttggacccag acccggaccc ggactcttag
ggtctgaaaa 9180agttggaccc aaacccttaa attagggtcg ggtccaacag
ggtccgggta gggtcttgga 9240cccatgccca tccctagtga ttgggtagcc
cattgcagaa tattgagaac gcaatataaa 9300ggggtgttga gaaagagggt
tttgagtgta ttgtttaaga aagttgggaa aggaatgaga 9360gatgaagtac
agaagaaaac gtctagaaag tgaagcatgg gagtctgttt cttttctttt
9420tcctaaagtt tcccaccaaa tgtcccttaa gtggttcagc cacgcctttg
gacaagctta 9480ccaccaagct ccccatccca gatcatattt gaatcaaaca
tctttctttt tttagaatat 9540tctttttttg tgcatgaaag ccaattccat
gagatatgta ccttatattt ctctaaaata 9600tataaataat tgatgaagca
attttcagat cattagataa gcgttctaca aaagaaccat 9660ctttttttgc
ttccttgtgt acttggaaaa tgtagttccc atatataatt ttaccatggc
9720agtacttcta tagaccacta agttcttcgc ttgtgcaacc tatagtgcat
ttaagagggt 9780ttaggtatag acagccttca ctttcaattg gttagagtct
acctccagta tcactgacag 9840aattttcaat aggaacttct gtcataactt
aattcgcaga aagcactaac taaacaaccc 9900cttagttctt tagttaagcg
cttgattggt cacatccagc ttttagtttt tagtatggag 9960atttataaag
tagtatgact tgagttgaat agtgaacgta agattagaca tatttatata
10020gtcgtgttaa ttttggaaac tgacaggagt gactagaaac cacttttttt
gtgtccaaaa 10080tttccatata ttgtttttta aaaaaactgc taaatcacga
tgataacaaa caaaccttac 10140acaggtaccg gaatgatatt gaaacaaatt
gaggttagtg ataagccata atcccttacc 10200ttgaaattca gaggctgtct
gctgcagtct ctatcatctt cttatttcac taaatcaatt 10260attacctgct
tcaacctcaa cggtccgagg cttagacatt gtgtctttga tagtatcatc
10320acagctgaaa attaatgtgt actttcttct atttaaatac catttgagag
tgcctttggt 10380agtcattatg aatgtcgtga gatcacaatc cgtgaaatat
agttttcatc acattcttac 10440ctgcatgtgt aaggaaaagt atagcgttag
tgttcaatct tttgctactt ctggtgactg 10500gtcaatggtc aaagtatgca
gcatgatttt gtgtttgtca gtttcttctt taaataagtg 10560tgaactgctc
tagtctaagt tgctcgaact cttaaaaagt gttggacttg ttagttgtta
10620catgtataca atgttgattg ggtgggcttt tccatatatt attatatttg
ttgaatcaca 10680atgaagtacc tatttccatt tgaggagtag gtatgatgag
gttagtaggg agtttgagtg 10740ttaaaggtta tgtgaagatg taaaaattca
ctgacaatga gaccttagta tccgacggtc 10800ggaattttac caattttatt
gccttgttac ctttctattt ttacttagta tttccttttc 10860ataaattttt
gtgatctaga gttcatggac aaaaagggct gcagaagttg agagccccca
10920accacagtct acatgggagc aagcaactga tccacctgat agcacttgtg
ctcaggtcat 10980ttatccaatg tctgaggcat ttgccagcag ctggatgcct
ggatccatgc aggaacttga 11040tggacaggat catcaatatg gtatgtggta
ctgtatttga tagaagttac aataatgtgt 11100aaactgaaac cacttaatga
cctagtatcc atctgtatca gacaatgtcc caatgggaaa 11160ggatttggag
attggagtac ctagaatttc agattcacgg ctaaatggac caaacaaaac
11220ggttaagtta gcaactactg ctgaggaaaa ccaatattca cagttagacc
tcaaccagga 11280aaatgatggt cgaagttttg atgaagagaa cctggagatg
aataatgata aacctaaaag 11340tgagtggatt aaacaggcta tgaactcacc
aggaaaagtt gaagaacatc gtagaggaaa 11400taaagtatct gatgcaccac
ccgaaatttc caaaataaag gacaaaggca tgcaacatgt 11460cgaggatatg
ccttctcttg tgctcagtct gaagaggttg ggtgatattg cagacacgag
11520cactaatgtc tcagaccaga atattgttgg gcgttcagag ctttcagcct
tcaccaggta 11580tgctagagaa ggtgaaactt gaatttatat aatggacaag
tggacaatat ctcattttta 11640aattgttgca ggtacaattc aggcacaact
ggtaaccagg gtcaaacagg taatgttggc 11700agttgctctc caccaaataa
tagttcagaa gcagcaaagc agtcccattt tgatgctcca 11760catcaaattt
cgaatagcag tagtaacaat aacaatatgg gctctactac taataagttc
11820ttcaaaaagc ctgctatgga cattgataag acacctgcaa aatcaacagt
caactgttct 11880catcattcac atgtgtttga gccagtgcaa agttcccata
tgtctaataa taaccttact 11940gcatctggta agcctggtgt tggctccgta
aatggtatgc tgcaagaaaa cgtaccagta 12000aatgctgttc tgccgcaaga
aaataacgtg gatcagcagc tcaagattca gcaccaccat 12060cactaccatc
attacgatgt ccatagtgta cagcagctac caaaggtttc tgttcaacat
12120aatatgccca aaagcaagga tgtgacagca cccccacagt gtgggtcttc
aaacacttgt 12180agatcgccaa ttgaagcaaa tgttgccaat tgcagtttga
atggaagtgg tagtggaagc 12240aatcatggga gcaatttcct taatggaagt
agtgctgctg tgaatgttga aggaacaaac 12300atggtcaatg atagtgggat
agctgcaaaa gatggtgctg aaaatggaag tggtagtgga 12360agtggaagtg
gtagtggtag tggtgttggt gtggatcaaa gtcgatcagc tcaacgagaa
12420gctgccttga ataaattccg tctcaagcgt aaagaaagat gctttgacaa
aaaggtaata 12480ctccaaattc tctccagaat
gtttatactt ggacatctag tatgtacatc cttgaatcta 12540aactgtaaaa
gctgaatttc agaataaaaa acacaaatta tatcaagtat gaaggcagag
12600tattgtagta attatagttt ttctggtatg gaattagtac ttacatttac
cagaagcctg 12660ctgtcacaag ccataatttg atcatcaagc aacaataatt
tggccatttc ttgcttgtat 12720tgaaagtgag atgacttcaa acttatttgt
gtatcatcac atcaggtgcg atatcaaagc 12780agaaagaagt tagcagatca
aagacctcgt gttcgtgggc aattcgtgcg ccaggtacga 12840gaaaacaaag
gaaggaatac cgatagctaa caccaattct ttccacaagt tgctgccaag
12900atcatttatg ccactctgat gtcagctgtc ttcatatgta caaatttcga
attttatgtg 12960tgcatgaggt gctaaatact gtcaaacctc agtgattctg
tttggtttag gctgtagaaa 13020gacatctttt cctttgtgtt ttcatggttc
ttattttgag ctgtgttcac tactttttat 13080aacatggtag cccctggttg
cctttggaaa taagcttttc cttaaaggtg tgatgcatat 13140aatcttgttt
ggtgttagat tatatgatca tttcttcagg cgtttacggg tcacattttc
13200cggaatcctt tcaaacgcga ttccggaaac aatggctcat attttctttt
ggtttcaagg 13260agaaggctat ttaaaacaga aaagatttag gttacagaaa
tcagtgatga agcaatgagt 13320ttcattatag aataggtaga agtagggggt
gttttttccg tactcttgag atagaaagtg 13380gggatagatt ctttggactc
gtcagaaagg aataatatag ttgtctacct ttttcatttt 13440tagttcttgt
aggagtttta ttccacttcc atttttgtaa aatttaggag ttgtaaggac
13500gtgtaaagag aatctgccat ccagatttta accgacggta aatttgttct
tttcatgttt 13560tctcaagtaa ctataatgtt ttcatcgaat ctatagggat
tttctaatgt gtacctgata 13620gaggcacaca gtaacaataa tataagtaca
tatattcttt aagaataatg acatagtaat 13680tatattttta atacaaataa
aagatgtcct tatgtaatga aacaaataac ttttccttga 13740aggtatgcca
taattaatta ctttattttg aagatatttt atatttagtt tgggtagtgg
13800aactactaaa taaaaatatg gttatagtaa catgtactca tgtgcgaacc
gaaaaaaacc 13860ctatgctttc tctaaaagtt cccaaaccct tgagcttata
gccccgacgg cccagcgcag 13920gcttgctgga gcgccgcgtc gctcaccctg
tcgccgacga gcctgcatgt cgtatcgttc 13980ggtcttctga aggtttagtt
ttccctgttc ctctttgtgt tattcatcgt tcccatcccc 14040catgtctccc
cttcccctgt cagtggttgt cggcctcccc ttcccctatt aatggttgtc
14100ggcctcccct tccctttccc ctaatagtgg ttgttggtct ccccttcccc
tttcatgttg 14160tcaagttgtt cctttccccg ttctcccttt tcctagtcct
cttttggtgt tcttgttgtt 14220gttagtttag tggctttggt tggttagttc
ggctgagtgc ttcgtcgtcg tatgcccttc 14280cttgttcccc tatttggttt
tggttatgtt ggggtttcgg ttaaccccgt tcccatgctt 14340aaacgtggga
gggcctcagg atttagatat aaaggtcatc attctcgcgc ttagacgtga
14400gagggattaa gtgttcaggg ataagggctc cgttcctgcg cttaaacgtg
ggagaactta 14460aaggttctag gttttacagg agttttggga ttggaaagta
tatgaactct gtttggcaga 14520agatgacagt gcaatgtggg gattaatcat
ttcgttttct tcctttttaa taagttagtc 14580tcttattatg agagttttct
attagttcta atccccttaa tttcttgtag gggttgtaag 14640tctagtttgt
cgttgtttag tatatctagt tcgagaagct cgaaagtttg aggttgtgga
14700aaaatgtact tactggttgc agatcaagaa tattaagacg aatgtttgac
ttcaatttac 14760tattgcatca ggtaggaaat atggtgagtc atcgaatatc
cattatggtt ggaatagtac 14820catatcatgg aagcggtttc gaagcgtgta
tattagtaaa atagatgaag atattcaaat 14880cgatgtttta gattatcttt
tatgtacgta agggtcatta ttgttgtaga tgttgtatgg 14940ttttttaatt
taatgataat ttttccttat tcccacttaa aagtaaacaa tgcattcatg
15000tgcacatatt agtacatata tttgtatata catctcg 150376788PRTBeta
vulgaris 6Met Arg Leu Ile His Lys Asn Glu Asp Gly Pro Gly Val Ala
Lys Ser1 5 10 15Val Ala Glu Leu Asn Gln His Ile Val Ala Val Lys Lys
Glu Gly Arg 20 25 30Gly Arg Val Ala Gly Glu Gly Gln Gly Leu Ser Glu
Glu Asp Glu Leu 35 40 45Arg Ile Ile Glu Asp Gly Glu Asp Ala Asn Ser
Arg Arg Ser Leu Ser 50 55 60Ser Val Gln Leu Pro Val His Thr His Arg
His Gln Pro Gln Val Gln65 70 75 80Pro Gln Gly Arg Val Cys Trp Glu
Arg Phe Leu Pro Val Gly Ser Pro 85 90 95Lys Val Leu Leu Val Glu Ser
Asp Asp Ser Thr Arg His Ile Val Ser 100 105 110Ala Leu Leu Arg Lys
Cys Ser Tyr Glu Val Val Gly Val Pro Asn Gly 115 120 125Ile Glu Ala
Trp Lys Ile Leu Glu Asp Leu Ser Asn Gln Ile Asp Leu 130 135 140Val
Leu Thr Glu Val Val Thr Ser Gly Leu Ser Gly Ile Gly Leu Leu145 150
155 160Ser Lys Ile Met Ser His Lys Ser Cys Gln Asn Thr Pro Val Ile
Met 165 170 175Met Ser Ser His Asp Ser Met Gly Leu Val Leu Lys Cys
Leu Ser Lys 180 185 190Gly Ala Val Asp Phe Leu Val Lys Pro Ile Arg
Lys Asn Glu Leu Lys 195 200 205Asn Leu Trp Gln His Val Trp Arg Arg
Cys His Ser Ser Ser Gly Ser 210 215 220Gly Ser Glu Ser Cys Val Arg
Asn Gly Lys Ser Ile Gly Ser Lys Arg225 230 235 240Ala Glu Glu Ser
Asp Asn Asp Thr Asp Ile Asn Glu Glu Asp Asp Asn 245 250 255Arg Ser
Ile Gly Leu Gln Ala Arg Asp Gly Ser Asp Asn Gly Ser Gly 260 265
270Thr Gln Ser Ser Trp Thr Lys Arg Ala Ala Glu Val Glu Ser Pro Gln
275 280 285Pro Gln Ser Thr Trp Glu Gln Ala Thr Asp Pro Pro Asp Ser
Thr Cys 290 295 300Ala Gln Val Ile Tyr Pro Met Ser Glu Ala Phe Ala
Ser Ser Trp Met305 310 315 320Pro Gly Ser Met Gln Glu Leu Asp Gly
Gln Asp His Gln Tyr Asp Asn 325 330 335Val Pro Met Gly Lys Asp Leu
Glu Ile Gly Val Pro Arg Ile Ser Asp 340 345 350Ser Arg Leu Asn Gly
Pro Asn Lys Thr Val Lys Leu Ala Thr Thr Ala 355 360 365Glu Glu Asn
Gln Tyr Ser Gln Leu Asp Leu Asn Gln Glu Asn Asp Gly 370 375 380Arg
Ser Phe Asp Glu Glu Asn Leu Glu Met Asn Asn Asp Lys Pro Lys385 390
395 400Ser Glu Trp Ile Lys Gln Ala Met Asn Ser Pro Gly Lys Val Glu
Glu 405 410 415His Arg Arg Gly Asn Lys Val Ser Asp Ala Pro Pro Glu
Ile Ser Lys 420 425 430Ile Lys Asp Lys Gly Met Gln His Val Glu Asp
Met Pro Ser Leu Val 435 440 445Leu Ser Leu Lys Arg Leu Gly Asp Ile
Ala Asp Thr Ser Thr Asn Val 450 455 460Ser Asp Gln Asn Ile Val Gly
Arg Ser Glu Leu Ser Ala Phe Thr Arg465 470 475 480Tyr Asn Ser Gly
Thr Thr Gly Asn Gln Gly Gln Thr Gly Asn Val Gly 485 490 495Ser Cys
Ser Pro Pro Asn Asn Ser Ser Glu Ala Ala Lys Gln Ser His 500 505
510Phe Asp Ala Pro His Gln Ile Ser Asn Ser Ser Ser Asn Asn Asn Asn
515 520 525Met Gly Ser Thr Thr Asn Lys Phe Phe Lys Lys Pro Ala Met
Asp Ile 530 535 540Asp Lys Thr Pro Ala Lys Ser Thr Val Asn Cys Ser
His His Ser His545 550 555 560Val Phe Glu Pro Val Gln Ser Ser His
Met Ser Asn Asn Asn Leu Thr 565 570 575Ala Ser Gly Lys Pro Gly Val
Gly Ser Val Asn Gly Met Leu Gln Glu 580 585 590Asn Val Pro Val Asn
Ala Val Leu Pro Gln Glu Asn Asn Val Asp Gln 595 600 605Gln Leu Lys
Ile Gln His His His His Tyr His His Tyr Asp Val His 610 615 620Ser
Val Gln Gln Leu Pro Lys Val Ser Val Gln His Asn Met Pro Lys625 630
635 640Ser Lys Asp Val Thr Ala Pro Pro Gln Cys Gly Ser Ser Asn Thr
Cys 645 650 655Arg Ser Pro Ile Glu Ala Asn Val Ala Asn Cys Ser Leu
Asn Gly Ser 660 665 670Gly Ser Gly Ser Asn His Gly Ser Asn Phe Leu
Asn Gly Ser Ser Ala 675 680 685Ala Val Asn Val Glu Gly Thr Asn Met
Val Asn Asp Ser Gly Ile Ala 690 695 700Ala Lys Asp Gly Ala Glu Asn
Gly Ser Gly Ser Gly Ser Gly Ser Gly705 710 715 720Ser Gly Ser Gly
Val Gly Val Asp Gln Ser Arg Ser Ala Gln Arg Glu 725 730 735Ala Ala
Leu Asn Lys Phe Arg Leu Lys Arg Lys Glu Arg Cys Phe Asp 740 745
750Lys Lys Val Arg Tyr Gln Ser Arg Lys Lys Leu Ala Asp Gln Arg Pro
755 760 765Arg Val Arg Gly Gln Phe Val Arg Gln Val Arg Glu Asn Lys
Gly Arg 770 775 780Asn Thr Asp Ser785723DNAArtificialprimer
PRR7(T1)-F 7gaggtgtcac agtgtaagtg tct 23825DNAArtificialprimer
PRR7(T1)-R 8aaagactgct acacgaacca ctaag 25914DNAArtificialprobe
PRR7(T1)-FAM 9ctgatgaaaa gctg 141014DNAArtificialprobe PRR7(T1)-VIC
10ctgatggaaa gctg 141123DNAArtificialprimer BvPRR7 11atgtcatctc
atgattcgat ggg 231221DNAArtificialprimer BvPRR7 12tcagccctct
tgcttcctat g 211323DNAArtificialprimer BvBTU 13ttgttgaaaa
tgcagacgag tgt 231420DNAArtificialprimer BvBTU 14aagatcgcca
aagcttggtg 201519DNAArtificialprimer BvlCDH 15cacaccagat gaaggccgt
191618DNAArtificialprimer BvICDH 16ccctgaagac cgtgccat
181721DNAArtificialprimer F3766 17tttgatgctt ttttcaggcc a
211827DNAArtificialprimer R3767 18ttttcttata ggcttcacca gaaagtc
271923DNAArtificialprimer F3354 19atgtcatctc atgattcgat ggg
232021DNAArtificialprimer R3355 20tcagccctct tgcttcctat g
212129DNAArtificialprimer F3768 21tttcctcatt ctttttttag tctagtggt
292224DNAArtificialprimer R3769 22aatatgtgtg agaaaatggt ggca
242320DNAArtificialprimer F3782 23tcycaatggg aaaggatttg
202420DNAArtificialprimer R3783 24aatttcgggt ggtgcatcag
202520DNAArtificialprimer F3784 25gcccccaacc acagtctaca
202622DNAArtificialprimer R3785 26ggtccattta gccgtgaatc tg
222720DNAArtificialprimer F3806 27tttttgcata ccgaaggcgt
202828DNAArtificialprimer vR3807 28catttgttga agtaggtgat aaggacaa
282928DNAArtificialprimer F3808 29ttagatcctc tcccttagac tcttctgt
283029DNAArtificialprimer R3809 30tcaccaattc tttatatcat atcatgaca
293128DNAArtificialprimer F3810 31gagaaaaggg ttttagatgg taagtttt
283227DNAArtificialprimer R3811 32aactttaacc catcatgtct tttcaac
273325DNAArtificialprimer F3853 33aactggacac ttggatttca agtca
253426DNAArtificialprimer R3854 34ttatgggaaa aaactctcgg tattct
263527DNAArtificialprimer F3855 35gaaccccatt ttagtattga catttct
273630DNAArtificialprimer R3856 36aattagatga ataaaaagac aaatgaggaa
303726DNAArtificialprimer F3857 37tccatttgag gagtaggtat gatgag
263822DNAArtificialprimer R3858 38cttcgaccat cattttcctg gt
223927DNAArtificialprimer F3859 39ggaaaaccaa tattcacagt tagacct
274021DNAArtificialprimer R3860 40tcttgagctg ctgatccacg t
214121DNAArtificialprimer F3861 41ctgcatctgg taagcctggt g
214218DNAArtificialprimer R3862 42cgtacctggc gcacgaat
184324DNAArtificialprimer F3863 43aatttggcca tttcttgctt gtat
244420DNAArtificialprimer R3864 44aatgtgaccc gtaaacgcct
204526DNAArtificialprimer F3865 45ggtgtgatgc atataatctt gtttgg
264616DNAArtificialprimer R3866 46agcaagcctg cgctgg
164713DNAArtificialprobe PRR7(#3827)-FAM 47acaggcatca gcc
134815DNAArtificialprobe PRR7(#3827)-VIC 48tcacaggcct cagcc
154924DNAArtificialforward primer BvPRR7 used for gene expression
analysis 49ttggaggagg tgtcacagtt ctag 245022DNAArtificialreverse
primer BvPRR7 used for gene expression analysis 50tgtcattgtc
cgactcttca gc 225124128DNABeta vulgaris 51maaacgttgt gatcatctaa
tattattgaa tatattatct ccataactta tcctaatatt 60atttagttta ttacacttga
tcgaggacaa aatccttcaa tctcccactt gtctaagaac 120aagtgtgtaa
ccttcaaact ccttaagtcg cttaatgtct aacttgatga catgataaca
180tcatatgttc atcataacaa tattcaagtc gttccttgaa atctgagttt
gaactgtcga 240aacaaatgat taacttctta atccatttga gcacggccat
gcattttcag ttctcactct 300tcaagaggcc aagacaccaa tcctaactct
taggaggact tatccaatct tgtatgacca 360aagctcccac tcaattcata
gcagttccaa tcgctgcttt tataacctcc ttttacggca 420cggcgttttg
cagcgtcaag aacatactaa tccttaagta agaacagttt catactcatg
480tcaaaggaat ccactaaata tattaataag agtctcataa accttttaga
gaactcccac 540taggtctgcc cagcgtgtat caactataca agcctatgca
aatgactaga catctccatg 600tccctatagc ccatgaaact gcgctatcaa
tcaacttgca atctagtcca tgaaattgaa 660tcatttacgt tcaacttaat
gattcgaact agggactaag gtatattata actcctgttc 720actggataga
gttccattcg tcaaatcacg tatttgacaa ttctatcaaa cgttataaaa
780tactttgaac gttttattta atactaaacc aagattaaat aagaacaaaa
cttttattga 840taaacataaa cataacatat caaagcgagt aattataact
gtgaactaat taaaagtaaa 900tagtacacaa ttaaacccac tctcctatat
gcttaagccc tatagcccta gtatgactct 960catgcttggg ctgtggcaaa
ggtttagtca aaggatcagc gacattacta tccgtatgaa 1020ccttgcaaac
tattacatcc tttctctcaa cgatttctcg aatgagatga aactttctaa
1080gtacatgttt acatctttga tgtgatcttg gttccttaga ctgagctatg
gcaccattgt 1140tatcacaatg taaaacaata ccatctccaa cactaggcac
tactcctagc tccagaatga 1200acttcttcat ccaaacggct tcctttgctg
catctgctgc agcaatatac tcagcttctg 1260tcgtagaatc agcgacagtg
ctttgctttg aacttttcca gctcactgcc cctccattta 1320gacaaaagat
gaaaccagat tgggatcgga aatcatcttt gtcagtttgg aaacttgcat
1380ctgtgtaacc ctcaacaatt aacttacttt tacctccata cactaagaaa
ttatccttag 1440tccttctcaa gtactttagg atattcttag ctgcactcca
gtgtgcgtca cctggatttg 1500attggaatct gctacacatg ctcaaggcat
atgaaacatc tgggcgagta caaatcatgg 1560agtacataat ggagcctata
gctgacgcat aaggaacatt actcattcgc ttaatctcat 1620caggcccaga
aggacactga gtcttgctaa gcgacactcc atgttgcatg ggtaggaagc
1680ctctcttaga gttttccatg ttgaacttag tgacgatctt atctatataa
gttcgttggc 1740taagtccgat catcctctta gacctatccc tatagatctt
gatccccaaa atatactcgg 1800cgttttcgag gtctttcata gaaaaacaac
tttttaacca ttccttgact gactcaagca 1860tgggaatgtt gtttcctatg
agaagtatgt catctacata caagaccaag aagactatgt 1920tactcccact
ttccttcttg taaacacaag actcttctcc atttttaaga aaaccaaact
1980ctttgattgc ctcatcaaaa cgaagattcc aactccgtga tgcttgcttc
aatccataaa 2040tggatttttg aagcttacat accctcctag gattttctgg
atccacaaaa ccctccggct 2100gtgtcatata cacatcctct ttcaagaacc
cattcaagaa agcggttttg acatccattt 2160gccaaatctc gtaatcatag
aaggcggcga tcgctaggag tatccgaacg gatttaagca 2220tggctaccgg
tgaaaaggtt tcgtcatagt ctataccatg aacttgcttg aacccttttg
2280caaccaacct tgctttgtaa acctgaatat taccatcctt gtctgttttc
actttgaaaa 2340cccatttgca accaataggt gtgatcccat cgggcaaatc
taccaagtcc catacttgat 2400tttcagacat ggatgccatt tcggacctca
tggcttcgag ccatttttcg gagtcttcac 2460tcatcaaagc ttgcttgtaa
gtagtaggtt cctcaaattc taaaatcatt atctcagaat 2520tttcagttaa
caagaaatca acaaacctct tggttggtat tcttgttcta ctagacttac
2580gaggggctgc aacaggagaa attttcttct caacaatatg agaattttcg
cacgaattag 2640attcgagtgg gacaatagga ggttcgtgta cgggatgcac
gtcctccaac acttggtcag 2700ttatgggaga agattcctcc aaaggaggaa
ctacttcaag cccaacatct ggctcttgtg 2760tcgttgtctc taacatagga
tgaactatgt ccatttgttg atcttctcga acttcttcga 2820gaaatacatt
actcccactt gcctttttgg aaataaaatc tttttccaaa aagacaccac
2880gacgagcaac aaacactttg ccctcagtgc gattgtagaa gtaatagccc
ttggtttcct 2940ttggataacc cacaaagaaa cacttatctg atttaggggc
gagtttatct gaaagtaaac 3000gctttacata aacctcacat ccccaaatac
gtagaaaaga caagtttgga acttttccac 3060tccatatctc atatggtgtc
ttatctactg cctttgatgg agttctatta agtgtgaaag 3120tagcagtttc
gagagcatat ccccagaagg atattggaag atcagcaaaa ctcatcatag
3180accgaaccat atcaagtaga gttcgattcc tcctttccga aacaccattc
aactgaggtg 3240ttccaggcgg agtgagttgt gaaagaattc cacaactctt
caagtgatca ttaaactctt 3300ggctcaaata ttcaccacca cgatcggatc
gcagtgcttt gattgttttg ccaagctggt 3360tttggacttc attttggaat
tctttgaatt tttcaaatga ttccgactta tgcttcatta 3420aatagacata
tccatatcta cttaaatcgt ccgtaaaagt aatgaagtat ccaaaccctc
3480ccctagcttt tgtgctcatt ggtccacata catcagtatg tattaggccc
aatagatcac 3540tgaccttttc accctttcca gtaaaaggtg actttgtcat
tttacccatt aaacatgatt 3600cacacacatc aaatggctca aagtcaaaag
atgttagaag tccatcttta tgcaacttct 3660gaatgcgttt cgcgtttatg
tgtcctaaac gacaatgcca taagtaagta ggattagtat 3720cgcttgttct
atgttttttg ttgtctatgt taaggacatc tttgtctaag tctaggtaat
3780atagaccatt agacctctta gcagtggcat aaaacattga attcaaataa
acagagaaac 3840aacctttctc aattgtaaat gaaaaccctt cattatccaa
aacaggaata gaaataatgt 3900ttttggtaat agcaggaacg taataacaat
tattaagctc taatattaat ccagaaggca 3960aaggtagact ataagtccca
actgcaacgg cggcaactct tgcaccattt ccaactcgca 4020gttccacctc
tcctttagcc aaggttctac tccttcttag tccctgcaca ttcgaagtaa
4080tgtgagaaac acaaccggta tcaaataccc aagaagtaga tgttgctaaa
ttaatgtcaa 4140tgacatagat acctgaagaa gaagccccag acttcttatc
cttcaagtac tttgggcagt 4200tacgcttcca atgacctatt tgatcacaat
agaagcactt ggcatttgcg gccacctttg 4260gctttgcctt tgcctgtggc
ttaatagcag tcttagtggc aacttgcttg cccttatctt 4320gctttttctt
gccagcccat tccttcttaa aacccttttc cttttgaacc ataagaactt
4380ccttcttagg tgcaatagtg atgttttgct cggcagtcat gagcatccca
tgcaactcag 4440caagggtttt cgacacccca ttcatattga aattcaatcg
aaacgtattg aaccccttat 4500gaagtgagtg cagaatgatg tcagtagcca
actcttggct ataaggaaag cccaacctct 4560ccatggcttc aaaataacca
atcatttcga agacatgagt ggcgaccggc ttgccttcaa 4620ctaacgaaca
ctcaagaata gccttgtgag tttcatacct ctctatccga gcttgttgtt
4680gaaacatggt tttcaactgt cggataatgc tataggcatc caagcttgca
aacctctttt 4740gaaggcttgg ttccatagcc gctagcataa ggcaagtaac
aattactgac ctttctgcaa 4800cggccttatg ggcctctttc tcagcatcag
tagaggtagt agttaaaact gggatcggtg 4860tttcaagaac atcctctcga
ccttcggacc taagaacaat tcttagattc ctttcccaat 4920caaggaagtt
gttcccgttc aatttatcct tctcaaggat tgaacgtaag ttaaaaggtg
4980aattattgtt gttaccagac atgatatcta catagaagat gcaaaaagta
taagtatgtt 5040tatcataata gcttttaaca aattttaaac actttaaaat
aaaagctatg cacttgacca 5100attttaatgt gtcccttttg aatcaagtgg
ttctaagatc ctatcaaaca tgatttataa 5160gtggactttg gcctcaactt
aaaaccaagt ttaaaaggta agtaaactcc tttactaatt 5220acaacaattg
taactcttag ttaatgggtg attgctaagg tgattacgct cccaggtaag
5280gaagttaccc acaacgttgg ggagagcctt cctaatccta gacagagcat
gtcacccaaa 5340cacaaaaacc cataaacttt gctacaaaat ccaaaaccgt
tttgatgatt ttgttgggcc 5400aaaccaaact aaacttgcaa atttcggaaa
tttactctac ttagcccaag attgaaagta 5460atactctgct ttggcagaac
ctattactaa cgatcaagtt ttagtaggtg tttatttgga 5520atagcaaaaa
cccaatattt tatttaaggg acctaagtaa attattatgt tgatttaatt
5580gctagtgaac atttaaataa ttaaatcaca agcataataa acttagaaag
catttaaaag 5640caatatttaa atgcataaaa ttaaatatga tcctagtatg
gcccctaaac ctaaagacta 5700ctctttaaga ctcccttgtt gaatcaccat
ggatctccat ccttgtgctt cataggataa 5760gattgaatca ccattcttct
tattaatact tgaataaata ttttttgaaa ttataaacta 5820aaaaattaca
aaaaatacca acgatgcgta gatcgtattt agattacaaa aatacattaa
5880cgatacgcat atcgtatttt ctatccaagt tttgggccat actagtcacc
gcatgcattc 5940ataatatcat atatacaaaa acatgcattt taatcaacta
ttaaaataaa ttatcatgtt 6000ttaacaactt taaaacataa taacaccatg
aagatttaat cacacattaa atcctatggt 6060tggtacctta agacaaaatt
taatcatatt agaatttcgt ctcacaaagg ctttaaaata 6120ttaatctaac
aaatttaatc atattaaact taaagaaaaa ttaaagcaat tgtaggcacc
6180acatataatt taatcatatt aaaaacaaaa acttaacatg atgactaacc
acataaaaag 6240ggcatgaaag aattaatcaa ctattaatac taacaaccta
acatgtaatt aacatcataa 6300aaaaataata atagttacta actccttagt
aacccccttt aaaattaact agtcaattat 6360cacatataat taactaataa
aattaaagct cattatttaa ttcaattatg acttaaatat 6420aaaattaatc
accattaatt aatttatttg caaattggaa tatactcaaa aacaagaaaa
6480agaaagaaaa aaaaaaaaaa agcaggctgc caaggcagca gtgtacactg
ccacctcagt 6540gccggccacc tgcgcgacca ccagaaacga ccagaacctg
ccaccgcgtc gctggccacg 6600gcgaccagca ccggcagcac tgcagcgcag
gcagcaggcc gcgccaacag cagcgcccag 6660cgcaggaagc tcgcgccgcg
cgagccacca cgacgccggc cacagtccgg cggcacgcca 6720gccaccatgt
cggtcgaatt ccggtggacc ttcccccttt ccctttcaat tatcatcaac
6780ccttgtgcat aattgaatga aagttacaac aaattgattt ggggaaaaaa
ttagggttca 6840tatcaatttt gttttaaaaa aaamcatgaa ctaacacaaa
aaatctgata ttttgtgatg 6900tgagatttca attttgagta taatatatat
ttatatatat acatwaaaat ccaattttta 6960tgtttccaat caattaatat
cataatatca attatgcaaa taaattcata tataaagccc 7020tcccttaatt
gaattaaaaa atgaaataaa acatgcatca acatgatcat attaatctat
7080gcaataggct aactgatacc actgtaggaa cttagatgca taatgcggaa
aatcaagtat 7140caaatacttg tacatctatc ccaagatcat tgcataaatt
agtatgaatc aaacaatagt 7200atagaattat acctttgatg cgtatgttcc
tcttgtcacc aaacttctag tggagatcac 7260cttagaacgt caagcgccgt
tcctctaatg ttggtccacg aacaacactt ggatcaccac 7320gtatgctagt
acggaagaga gaaaaacact ctcttacttt tgtggtgagg gccgaaaatg
7380agtgtgaaaa gactaaggga aaaatcagat ttttcactct agaagttgta
aaagtgtata 7440tccacctttg taaccccata tcaatatata aggtggttac
aaaagaggtg tttcatgagg 7500ctttatttts cctcataatg tcatacatta
tgagtctaat aaactcatga gttacaactc 7560ttcccatcca tcatcaaacc
gcgcaaccca tttcacaaat ggatttggat aaatatccaa 7620gtgtcattac
ttgtgtgacc tcataggact caatgatatt agtagttggc cctaatcata
7680ttagtccaac aaaccacaat tagcttctag caaaacgttg tgatcatcta
atattattga 7740atatattatc tccataactt atcctaatat tatttagttt
attacacttg atcgaggaca 7800aaatccttca caaatgcata tggtttgatg
tacaataata tacgagtgta catttgggta 7860ttttcaatga tcaaagtaat
gaccatcagt gtacattgtg atttatcctt atttacgttg 7920gttgcggtac
ctttttatta ttattattag ctccacctac agttgcatgt acatgcacgt
7980acctagcatg tacactttgt tgacattcat gtacattaac cgggttaacg
ttacaattat 8040gttgttatgt gttgaccttt tgttttaata ctcgtattga
gttttttttg ttttgtttgt 8100gtctatatca caaggattgt actttggatg
tctattattg ttcattgtgt gttattgacg 8160attttatggg gggatgtcat
tgtgcatttt gattttgtta atgaacaacc acgaagccaa 8220gaatgtacaa
agaaacataa tagaataaaa gtaacccaat tcctaaagct gatgtcaagt
8280gagtaatttg caatctttgt acactggtgt gttgatgttt gttcgcttat
gaaattcaat 8340atgtacaatt atagtcatat acctcatagt gctccaggtg
ccacaaaaaa aactcaatat 8400gggtattaaa acaaaaggtc aatacataac
aacatgattg caacccagtt aatgtacatg 8460aatgtcaaca aagtgtacat
gcaaggtacg tgcatgtaca tgcaactgta tgtggagcta 8520ataataaaaa
aaggtaccgc aaccaacgta aataaggata aatcacaatg tacactgatg
8580gtcattactt tgatcactga aaataaggat acattattgt ttgattgaat
gttcactgga 8640tatgactcaa tgtacaaata ttctagcaag attgttcaat
tattaagcct gaatgtacaa 8700tgttgttatg actgaatgtt caagttattt
tatagagctg actttgttct gtgtacatta 8760aagttgcgtt aatgatcatt
gtgtatgact aaatatacat tagcttcact aacatgcgtg 8820cataacatat
tctatagaca caaacaaaac aaaaaaaaac tcaatatggg tactagatta
8880aaaggtcaac acataacaac ctgattgtaa cccagttaat gtacatgaat
gtcaacaaag 8940tgtacatgca aggtacgtgc atgtacatgc aactgtagat
ggagctaata ataaaaaaaa 9000ggttccacaa ccaacgtaaa taaggataaa
tcacaatgta cactgatggt cattactttg 9060atcactgaaa atacccaaat
gtacactcgt atattattgt acatcaaacc atatgcattt 9120gttacattaa
aaaaagtttt aaaaatgcaa aacagaaaat aaaatcaaat atcgacattt
9180ggaaatttat aatagaaatg aataaaaata agggagaaat aaatgaagaa
caaaataaat 9240gagaaagaga attaaaatgg ttcttgaaaa ataaatgaga
gagaaaagga gggaatgagt 9300gagtgatgag agagaaagag ctggcccact
ttcaaaaatt ctgccaaaag cctgccaaat 9360tttggccctc ctaaaagcat
caaaactacg tagttttggc caaggtgtag gatgctcatc 9420ctacacctcc
gtgcaggatc taaattgcgc ttagaaatag ggtctcctaa tatttctcta
9480ctagcatttt ttgcacgcga tgcgtgcttg aatttttttc aagatagaaa
ctcgattttt 9540ttcgacgtat gtaaaagtca aaatttaaac attagacata
caaagtataa ttgtttttag 9600ttacaaaatt taattggttt agtctctgta
acttgagttt ctcaccagtc tttttttttt 9660tttttttttt ttttactttc
aaagttaaat tctatgaaca aaatagaaat tttattgaat 9720ttatctatga
tttctaatat tactccctcc gacccaaaat atagttccca tttccctttt
9780ttcacggtaa tttatgcaaa tagaatataa gagggatagt aaagattttt
tgtttattta 9840aataaatgtt gtatgggaaa agatgatttt aggagagaaa
gtagagaata attggtgaaa 9900gagtattaat tgtaacattt tggttgaata
aacaaaggaa aaaacaaaat tcaagaagca 9960aataaatgag aattgtttcc
ttgaataatg caaaagtggg ttttaattcc caaaatatgc 10020ccaaaaataa
aaaaattccc tgtgtaccgt ccacgtaaga cggcacgcga gatttttttt
10080tcctacttca atacaaccgc tacttaaagt agcggtttac tgattttttt
ttttatctac 10140ttaggtaaaa ccttggcgct gagtgatata actcgctact
tcaagtagcg atttactgaa 10200atccccaact ccatagtttg atatgtgctt
gcaacatttt gcccaggtaa accgctactc 10260agggtagcgg tttatgtgta
taaaccgcta cttaaagtag cggtttattt taatataaac 10320cactattgtg
agtagcggtt tacgtgggca aaaacaaaaa aaaaaatagt ttctcgcgtg
10380tcgtcctacg tggacggtac gcagggaatt ttttaatttt tgggcatatt
ttgggaacta 10440aaacccactt ttgcattatt caaggaaaaa attcaaataa
atgatgggac acggtttttc 10500tagacaaatt acgaaaaaat gtggaactaa
atatgaaaat ggaaactata ttttgggaca 10560cccaaaatgg aaatgggaat
tatattttgg gacggaggga gtataatttt ttagttgatt 10620tttgaattaa
gtatactact tcatatattg ttaagaaact ggacacttgg atttcaagtc
10680aaatttttgt gagtatgtat tgacgttgta gtgtattggt tgtagtttgt
aagttaattt 10740ttgtttttgt aaagtttact catttgagtg atttgtataa
tgtaaattat gcaattctat 10800gattttagtt gacttgtgag tgattgttat
aattttattt ccattatttt tatttgaatc 10860tccctttggt ttgtatgtga
atttgtaatt tagaaaggca aaggggtaaa atagtctctt 10920cattcgggaa
caccatagtt cccctccttc ccttatataa taaagatgat gatgattttt
10980gataataatg atttgtaagt gaattatgtg aatgtttttg tatgtattga
cgtcctagta 11040tattagtttt agtttgtaag ttaatttttt tgtttttgta
aagtttcccg atcatttgag 11100tgattttcgt gattttttgt gattttctca
attctatgag tgatttgtaa agtttcttga 11160tataagtgat ttctgagtgg
tgttgaatta atttccggtg gctttgttag aaccccattt 11220tagtattgac
atttcttttg taatttagaa agggaaaggg gggtaaaata ggcatttcaa
11280aaaaggacac cattgctccc cccttccctt atgtaattga gatatcttaa
aagaataccg 11340agagtttttt cccataaagg agtatttttt ttaaaatttt
ttccataaag gagtatttat 11400tagtaccaag ttgatttccc aaatcattat
ccttgcgcaa attgcataat ggagatattt 11460ggtgttgacg tgtgaatatg
gggccataat aataggaggt caaaaacaaa actacaaggg 11520ttaaaatcgt
cacaatatta aacaagcatc tcacattctc actggtcact tttttttaac
11580ctattaaaag aacaaacctt taactctcct cacaatctga cacgtgtcga
atattgattt 11640actgagatca atttagatcc tctcccttag actcttctgt
cttctcagta cagctttaga 11700tctcaacctc catgtcagca aagttacctt
acgtgtcatc ctacgtggcc tctccttcta 11760cccctcactc ctccacgtca
acattttcct ccaaaattaa aaaatcattt ttttattata 11820tttacttgaa
tgtatataat aatgtctact gatcttcttc tttagaacta tctccttctc
11880tcattggaac ctcaaaatca ttcttatttt atttcgagaa aaggaaaaaa
aagcacatct 11940tttttgaaga ttaatttgtg gattattatt gagcttcatc
gtattaaaaa acatagtaaa 12000agttctttcc tcatttgtct ttttattcat
ctaatttttt ttagtgaaga accctaattt 12060tgtttgtgaa ttctcaagtt
caagttttga tttgggtatt ttttttgatg aaatttgtgc 12120agctgtagga
tgttatcgtg ctgagaaaag ggttttagat ggtaagtttt tttttctttg
12180atttctctct cctacttttt tttttgtttt gctttagata atactgtcat
gatatgatat 12240aaagaattgg tgatttgggt agtttattta acctatgatt
atgtgttatt tgttttgatc 12300tttcaattta tctggtgctg tgtgtatata
tgttttgttt ttcttcaagt atttggttat 12360tattgaagtg ggtaattagg
aatttgctac taatctatgg atttgggttc tgttgtgatt 12420aatttactat
agatttgagg tttaatttat gttttatagg ttagaaaagg aaatcaatga
12480tttgtttgtg gatttgagta gattgtttgt tagtgtgtgt atgatgatat
taacttccat 12540tattcttccc caaattaggg gtaattgatg gttttttgca
taccgaaggc gtattctctt 12600tgatgatgga gtgattgttg aaaagacatg
atgggttaaa gttgcaggat tatttcattt 12660caataaacat aattgatcaa
tttggatctg ttgaatgagg ttgattcaca aaaatgaaga 12720tgggcccggt
gttgccaagt cggtggcaga gcttaatcaa catatagttg ctgtgaaaaa
12780agaaggtagg ggtagggttg caggtgaagg gcaggggctt tccgaggagg
acgaactgag 12840aattattgag gatggtgaag atgcaaacag caggcgttct
ttgagttctg ttcagcttcc 12900agttcatact cacaggcatc agccacaagt
acaaccccag gggagagtct gttgggagag 12960gtttctccct gttggatctc
ctaaggtttt gctcgtagaa agtgatgact caactcgtca 13020tattgttagt
gctttgctac ggaaatgtag ctatgaaggt gatttgatct gttttaatcc
13080catatatgca atgtcttgtc cttatcacct acttcaacaa atgattaaga
gaattgtact 13140ccctcgttcc aaaataatag caacacttag ccttcccgta
gactttaggg agcgtttggt 13200tcatattatg gtatgggttt ggaattagga
atgaaaccaa ggtggtatgg ggttggaact 13260tgatacttaa taccttgtat
ttggtttcat ttaggaatga aaaaatttct tttatttgat 13320acctagaggt
aaggtatgag ccatacccac ctccccccat gggtttctaa accccatacc
13380ttatgggttt gaggtatggg tttaaaattt aaaaataagt taaacaaaca
ctaggtatgt 13440gttttgttca ttccaaaccc atacctcata cctaaaacta
gtgaaccaaa caccccctta 13500aggatcttgg gacaaaggga atccattact
agatctggtg acattaatac ctaagtttac 13560atcagtttca cttaaatcct
tcgttttaaa aaaagtaaaa aaacctgtta gtctgagtaa 13620gtttactaat
ttttgttcta aaattcaaca cattatctac atgcaagcac ttactagtac
13680aatacaactc aaacaatata tgcatcctat ctgttcacaa tgaaccgaaa
actaatcttt 13740tcataccctt gtttgatgct tttttcaggc catacaaatt
tctttaacct aaattgcctc 13800ctcagtcact gttcaaaatt gcagttttaa
catcctcaag accatgtgat gtactgttag 13860attatattaa gaccctattg
taaataaagc atgtatagtg gaataaaatg catgtcttcc 13920tacttttttt
tgggggtcat gaactcattg tttgatattt tgcagttgta ggggtgccaa
13980atggcataga agcatggaaa atcttagaag atttgagcaa tcagattgac
ctagttttaa 14040ctgaggtagt cacatcagga ctctctggta taggtcttct
gtccaagata atgagtcaca 14100aaagctgcca gaatactcct gtcattagtg
agctttcgtt ccttgttgta ttagtgtatg 14160ttctgtattt gattttcttt
ctttgtgcat atcttgcctt gttttttaca attatttaga 14220ttttagatga
aaatgtatac tcattttatg gtctttagct gcaacatttg attattttgt
14280gtgcagtgat gtcatctcat gattcgatgg gtttagtctt aaagtgctta
tccaagggcg 14340ctgttgactt tctggtgaag cctataagaa aaaacgaact
taaaaacctt tggcagcatg 14400tttggaggag gtgtcacagt gtaagtgtct
ttacattttc cagctttcca tcagcttagt 14460ggttcgtgta gcagtctttc
aaattttcga actttctagc acatatgaca aattaaacct 14520gcatgctaat
tcccgattag ataatggaat aagctctttc agctggtctt ttacttcttt
14580ctcttctcct cttatgaaaa actggtatgc cactatgcat cttgttccag
gtgtttgttt 14640agtgtttctt tcctttattc gtttttttgt ttttattttt
aattttaatt ttaatttttc 14700ctcattcttt ttttagtcta gtggtagtgg
aagtgaaagc tgtgtaagga atggaaaatc 14760cataggaagc aagagggctg
aagagtcgga caatgacact gacatcaatg aggaagatga 14820taacagaagc
attggtttac aagctcggga tggaagtgac aatggaagtg ggacccaggt
14880agtgctaacc cctgtaatat taaacttcct atagtaggtg tggttaatgt
gacgctgtta 14940aggccttttg ggtggttgct tctagttcac taaggataat
aagaaatagc tcgctattga 15000tagttagggc acctcaatat cacctcctct
tgtatgtttg ttgaactaca tttttagcca 15060gacttgagta ttttatcctg
aaggatagaa caggtgcatt tttggttgcg gttgttagtt 15120gttactgtta
tgcaaagact attgccacca ttttctcaca catatttaac atggaagtgt
15180cctaaccacc ccccaaccca aaaaatggga gggagaaatt actggagatg
ggaaagaagt 15240tacataaaaa gttagtcgtt tgggtcatga ttgtttgttg
tatttgcaaa gttagcgcgt 15300tctcttcctg gatgcttcaa aataagctga
tgcaccataa agtaccactc ttggcttcac 15360ctgttggtgt ggacccaacc
aatgtaccct tgttgatctc gagatagaca aagaggaagt 15420ttaatttctc
tttatatgtt atctctcttc aatttgttag cagctatgtc tctttcgtgg
15480acatttagaa cccatgttag gttcatattt atagttaggt gattgtatca
aaattgccat 15540cacaataaac agaacattaa tttctattgg gaaggattca
aggatcaaat atacaggaaa 15600gagcagtgta ggagatatca tcttgttgaa
caacaaaaga aacattaaca tcaactggtg 15660ataatctttg caagattgga
tgacaaaatg aggagtcgat ctaatataaa acaaattggg 15720aactgtcagc
tatatcctgc atatcaagaa tggagacctt taagaaaagt aagaccattt
15780tttgttggga agtcaagcca ttgtcccagt ttccttgtga aatttagttc
atcttagctt 15840tcttctacca acatgaattc tctttccttt cagcccttgc
aaacttggtt ttatgctaat 15900tatcagtgtt tccttcattt agtacgctga
gagggtttat ttggttgatc aaagaatact 15960tgatgacctt gaggtagatg
ctctacatgg agaagttcct ctaagtgtac aaagaatcta 16020gttcgaccaa
ctttgattta ggaagagata acacgatcac ctcgtggtct agactctgga
16080gaggtcaaag tgtgcaaaag ggtatttttg aaagacaatg gcttgttgat
tcatgactga 16140aattggatgg tcgtgactga gcatatacta ttagtggttc
tcttctaagg tgatataagt 16200atgtgataac ccaatcctgt atatttcttc
gaggacatca attgtgctac tattctaggg 16260tgctggagac ccatacatat
agagccattg acaattaaca caaacttcaa ccacttattt 16320ttatttcatt
taagctatca atccctaaga aagagcccat ccaagctcct gctttaggtg
16380catcccctcc cttttcagct agtgcacaaa aaatgaactt tcgagataga
ctgctaaatt 16440tgctttgtca agaagacaaa attttgatac acaactgtaa
ttgcatttta tgacacttac 16500gctgatatat ctgcaagtga agttgatatg
caaaaactat gtagcctcct tcgtctacgg 16560taatagatct ccgtcaatgt
gatgcttgtg tgccatcata aaatgatatt gggtctttag 16620actctgttac
tctacagctg aaggatctta gccttggcat ttatatcctt tttatccaaa
16680agttaaaaaa agcggaccgt ttgacccatg taaggaaaaa ggaaaggaat
cgagaaagac 16740aaaggagggg aaagaagtta aatctcctaa aaagcttgtt
ttgtgcggtg agagagggag 16800cgacttgaaa ttgccattga tgatgattgg
ttcacaattg taatcgaaat caaactcact 16860ctctctctct ctctctctct
tatcaccccc ctcaaactat aacatcacag tcctttaaac 16920gtgactgttt
cgggggatag tgactggtag ggatgggcaa gggtcgggtc tggctggacc
16980ctagacccgg accctaattt ttttttgtag acccaaaccc ggaccctaag
ggtctgaaaa 17040aattggacct tgacccagac ccttagggtc tgaagggtct
agagggtcag gagggtccag 17100gcttaaattt tttattttgc caaattttta
gcattattaa tatcaataat catttgaaat 17160tcgcatgaaa caaacacaaa
aaaaaatcgc atgaatcaaa cacaaaaatt cgcatgaaac 17220aaacactaac
atataaattg aaaaaaacga aacaaacaca aacttataaa cgaaaaaaat
17280tgaaacaaac acaattccaa acatataaac tgaaaaaaaa aacgaaacaa
acacaaatat 17340acaaactgaa aaaaagaaga aacaaacaca acttacataa
gagttcagaa tgggtgttat 17400agtttatgtt ttagtcattt agaaaatcaa
tttgtttttt ttttaaagtt aaaatgtata 17460tattaaataa gtttagggtc
taaggtgttg gaacatttat agggtaatgg gtttgaaact 17520catatgggta
tgtactagaa gaggaggagg tctagtatgc aaaaggttag agtgcatcaa
17580gtggtaacaa cgcgcattgt tataccaatg tcgcgagtcg cgacaggcgt
cgcgggtcgc 17640gaccagcgcc tcgcgagctt cttcgcatgt cgcgacgcgt
cttctgcctt ggaatgcgaa 17700aaaatgcctc ggcggtttta tatccgttgt
gatgctttgt tgatcatttt aatgactttt 17760aaggtctttt aatcagtaga
ttaaaggcct ttgatgagtg attaagatgg gggttatgtg 17820attaacctct
ctagtcaatg aaatgttgat tatgcttata taacctttgg attcctatga
17880gtgaggagtt agaagaaaat cagaattttc tatactctct caaaagtctt
cttgcttagc 17940ttaagagaaa ccttgcaatc ttctcttgag tgttcttcac
aaacacaaaa cacaagttct 18000tgttgattca cttagaagat catctaagtg
gattgtttct ctccattgta tctcattagt 18060tatttcgtgt taacccggtg
atcctagagg ggcgaaatta aactaattgg aaagcgtagt 18120ttccgtgcct
tggagtggga tatccggttc tctcattgat cacaagccta acataagggt
18180cgggtctggg tccaaatttt aagacccgga cccggaccct aaaaaattca
cttggaccca 18240gacccggacc cggactctta gggtctgaaa aagttggacc
caaaccctta aattagggtc 18300gggtccaaca gggtccgggt agggtcttgg
acccatgccc atccctagtg attgggtagc 18360ccattgcaga atattgagaa
cgcaatataa aggggtgttg agaaagaggg ttttgagtgt 18420attgtttaag
aaagttggga aaggaatgag agatgaagta cagaagaaaa cgtctagaaa
18480gtgaagcatg ggagtctgtt tcttttcttt ttcctaaagt ttcccaccaa
atgtccctta 18540agtggttcag ccacgccttt ggacaagctt accaccaagc
tccccatccc agatcatatt 18600tgaatcaaac atctttcttt ttttagaata
ttcttttttt gtgcatgaaa gccaattcca 18660tgagatatgt accttatatt
tctctaaaat
atataaataa ttgatgaagc aattttcaga 18720tcattagata agcgttctac
aaaagaacca tctttttttg cttccttgtg tacttggaaa 18780atgtagttcc
catatataat tttaccatgg cagtacttct atagaccact aagttcttcg
18840cttgtgcaac ctatagtgca tttaagaggg tttaggtata gacagccttc
actttcaatt 18900ggttagagtc tacctccagt atcactgaca gaattttcaa
taggaacttc tgtcataact 18960taattcgcag aaagcactaa ctaaacaacc
ccttagttct ttagttaagc gcttgattgg 19020tcacatccag cttttagttt
ttagtatgga gatttataaa gtagtatgac ttgagttgaa 19080tagtgaacgt
aagattagac atatttatat agtcgtgtta attttggaaa ctgacaggag
19140tgactagaaa ccactttttt tgtgtccaaa atttccatat attgtttttt
aaaaaaactg 19200ctaaatcacg atgataacaa acaaacctta cacaggtacc
ggaatgatat tgaaacaaat 19260tgaggttagt gataagccat aatcccttac
cttgaaattc agaggctgtc tgctgcagtc 19320tctatcatct tcttatttca
ctaaatcaat tattacctgc ttcaacctca acggtccgag 19380gcttagacat
tgtgtctttg atagtatcat cacagctgaa aattaatgtg tactttcttc
19440tatttaaata ccatttgaga gtgcctttgg tagtcattat gaatgtcgtg
agatcacaat 19500ccgtgaaata tagttttcat cacattctta cctgcatgtg
taaggaaaag tatagcgtta 19560gtgttcaatc ttttgctact tctggtgact
ggtcaatggt caaagtatgc agcatgattt 19620tgtgtttgtc agtttcttct
ttaaataagt gtgaactgct ctagtctaag ttgctcgaac 19680tcttaaaaag
tgttggactt gttagttgtt acatgtatac aatgttgatt gggtgggctt
19740ttccatatat tattatattt gttgaatcac aatgaagtac ctatttccat
ttgaggagta 19800ggtatgatga ggttagtagg gagtttgagt gttaaaggtt
atgtgaagat gtaaaaattc 19860actgacaatg agaccttagt atccgacggt
cggaatttta ccaattttat tgccttgtta 19920cctttctatt tttacttagt
atttcctttt cataaatttt tgtgatctag agttcatgga 19980caaaaagggc
tgcagaagtt gagagccccc aaccacagtc tacatgggag caagcaactg
20040atccacctga tagcacttgt gctcaggtca tttatccaat gtctgaggca
tttgccagca 20100gctggatgcc tggatccatg caggaacttg atggacagga
tcatcaatat ggtatgtggt 20160actgtatttg atagaagtta caataatgtg
taaactgaaa ccacttaatg acctagtatc 20220catctgtatc agacaatgtc
ccaatgggaa aggatttgga gattggagta cctagaattt 20280cagattcacg
gctaaatgga ccaaacaaaa cggttaagtt agcaactact gctgaggaaa
20340accaatattc acagttagac ctcaaccagg aaaatgatgg tcgaagtttt
gatgaagaga 20400acctggagat gaataatgat aaacctaaaa gtgagtggat
taaacaggct atgaactcac 20460caggaaaagt tgaagaacat cgtagaggaa
ataaagtatc tgatgcacca cccgaaattt 20520ccaaaataaa ggacaaaggc
atgcaacatg tcgaggatat gccttctctt gtgctcagtc 20580tgaagaggtt
gggtgatatt gcagacacga gcactaatgt ctcagaccag aatattgttg
20640ggcgttcaga gctttcagcc ttcaccaggt atgctagaga aggtgaaact
tgaatttata 20700taatggacaa gtggacaata tctcattttt aaattgttgc
aggtacaatt caggcacaac 20760tggtaaccag ggtcaaacag gtaatgttgg
cagttgctct ccaccaaata atagttcaga 20820agcagcaaag cagtcccatt
ttgatgctcc acatcaaatt tcgaatagca gtagtaacaa 20880taacaatatg
ggctctacta ctaataagtt cttcaaaaag cctgctatgg acattgataa
20940gacacctgca aaatcaacag tcaactgttc tcatcattca catgtgtttg
agccagtgca 21000aagttcccat atgtctaata ataaccttac tgcatctggt
aagcctggtg ttggctccgt 21060aaatggtatg ctgcaagaaa acgtaccagt
aaatgctgtt ctgccgcaag aaaataacgt 21120ggatcagcag ctcaagattc
agcaccacca tcactaccat cattacgatg tccatagtgt 21180acagcagcta
ccaaaggttt ctgttcaaca taatatgccc aaaagcaagg atgtgacagc
21240acccccacag tgtgggtctt caaacacttg tagatcgcca attgaagcaa
atgttgccaa 21300ttgcagtttg aatggaagtg gtagtggaag caatcatggg
agcaatttcc ttaatggaag 21360tagtgctgct gtgaatgttg aaggaacaaa
catggtcaat gatagtggga tagctgcaaa 21420agatggtgct gaaaatggaa
gtggtagtgg aagtggaagt ggtagtggta gtggtgttgg 21480tgtggatcaa
agtcgatcag ctcaacgaga agctgccttg aataaattcc gtctcaagcg
21540taaagaaaga tgctttgaca aaaaggtaat actccaaatt ctctccagaa
tgtttatact 21600tggacatcta gtatgtacat ccttgaatct aaactgtaaa
agctgaattt cagaataaaa 21660aacacaaatt atatcaagta tgaaggcaga
gtattgtagt aattatagtt tttctggtat 21720ggaattagta cttacattta
ccagaagcct gctgtcacaa gccataattt gatcatcaag 21780caacaataat
ttggccattt cttgcttgta ttgaaagtga gatgacttca aacttatttg
21840tgtatcatca catcaggtgc gatatcaaag cagaaagaag ttagcagatc
aaagacctcg 21900tgttcgtggg caattcgtgc gccaggtacg agaaaacaaa
ggaaggaata ccgatagcta 21960acaccaattc tttccacaag ttgctgccaa
gatcatttat gccactctga tgtcagctgt 22020cttcatatgt acaaatttcg
aattttatgt gtgcatgagg tgctaaatac tgtcaaacct 22080cagtgattct
gtttggttta ggctgtagaa agacatcttt tcctttgtgt tttcatggtt
22140cttattttga gctgtgttca ctacttttta taacatggta gcccctggtt
gcctttggaa 22200ataagctttt ccttaaaggt gtgatgcata taatcttgtt
tggtgttaga ttatatgatc 22260atttcttcag gcgtttacgg gtcacatttt
ccggaatcct ttcaaacgcg attccggaaa 22320caatggctca tattttcttt
tggtttcaag gagaaggcta tttaaaacag aaaagattta 22380ggttacagaa
atcagtgatg aagcaatgag tttcattata gaataggtag aagtaggggg
22440tgttttttcc gtactcttga gatagaaagt ggggatagat tctttggact
cgtcagaaag 22500gaataatata gttgtctacc tttttcattt ttagttcttg
taggagtttt attccacttc 22560catttttgta aaatttagga gttgtaagga
cgtgtaaaga gaatctgcca tccagatttt 22620aaccgacggt aaatttgttc
ttttcatgtt ttctcaagta actataatgt tttcatcgaa 22680tctataggga
ttttctaatg tgtacctgat agaggcacac agtaacaata atataagtac
22740atatattctt taagaataat gacatagtaa ttatattttt aatacaaata
aaagatgtcc 22800ttatgtaatg aaacaaataa cttttccttg aaggtatgcc
ataattaatt actttatttt 22860gaagatattt tatatttagt ttgggtagtg
gaactactaa ataaaaatat ggttatagta 22920acatgtactc atgtgcgaac
cgaaaaaaac cctatgcttt ctctaaaagt tcccaaaccc 22980ttgagcttat
agccccgacg gcccagcgca ggcttgctgg agcgccgcgt cgctcaccct
23040gtcgccgacg agcctgcatg tcgtatcgtt cggtcttctg aaggtttagt
tttccctgtt 23100cctctttgtg ttattcatcg ttcccatccc ccatgtctcc
ccttcccctg tcagtggttg 23160tcggcctccc cttcccctat taatggttgt
cggcctcccc ttccctttcc cctaatagtg 23220gttgttggtc tccccttccc
ctttcatgtt gtcaagttgt tcctttcccc gttctccctt 23280ttcctagtcc
tcttttggtg ttcttgttgt tgttagttta gtggctttgg ttggttagtt
23340cggctgagtg cttcgtcgtc gtatgccctt ccttgttccc ctatttggtt
ttggttatgt 23400tggggtttcg gttaaccccg ttcccatgct taaacgtggg
agggcctcag gatttagata 23460taaaggtcat cattctcgcg cttagacgtg
agagggatta agtgttcagg gataagggct 23520ccgttcctgc gcttaaacgt
gggagaactt aaaggttcta ggttttacag gagttttggg 23580attggaaagt
atatgaactc tgtttggcag aagatgacag tgcaatgtgg ggattaatca
23640tttcgttttc ttccttttta ataagttagt ctcttattat gagagttttc
tattagttct 23700aatcccctta atttcttgta ggggttgtaa gtctagtttg
tcgttgttta gtatatctag 23760ttcgagaagc tcgaaagttt gaggttgtgg
aaaaatgtac ttactggttg cagatcaaga 23820atattaagac gaatgtttga
cttcaattta ctattgcatc aggtaggaaa tatggtgagt 23880catcgaatat
ccattatggt tggaatagta ccatatcatg gaagcggttt cgaagcgtgt
23940atattagtaa aatagatgaa gatattcaaa tcgatgtttt agattatctt
ttatgtacgt 24000aagggtcatt attgttgtag atgttgtatg gttttttaat
ttaatgataa tttttcctta 24060ttcccactta aaagtaaaca atgcattcat
gtgcacatat tagtacatat atttgtatat 24120acatctcg 24128522367DNABeta
vulgaris 52atgaggttga ttcacaaaaa tgaagatggg cccggtgttg ccaagtcggt
ggcagagctt 60aatcaacata tagttgctgt gaaaaaagaa ggtaggggta gggttgcagg
tgaagggcag 120gggctttccg aggaggacga actgagaatt attgaggatg
gtgaagatgc aaacagcagg 180cgttctttga gttctgttca gcttccagtt
catactcaca ggcatcagcc acaagtacaa 240ccccagggga gagtctgttg
ggagaggttt ctccctgttg gatctcctaa ggttttgctc 300gtagaaagtg
atgactcaac tcgtcatatt gttagtgctt tgctacggaa atgtagctat
360gaagttgtag gggtgccaaa tggcatagaa gcatggaaaa tcttagaaga
tttgagcaat 420cagattgacc tagttttaac tgaggtagtc acatcaggac
tctctggtat aggtcttctg 480tccaagataa tgagtcacaa aagctgccag
aatactcctg tcattatgat gtcatctcat 540gattcgatgg gtttagtctt
aaagtgctta tccaagggcg ctgttgactt tctggtgaag 600cctataagaa
aaaacgaact taaaaacctt tggcagcatg tttggaggag gtgtcacagt
660tctagtggta gtggaagtga aagctgtgta aggaatggaa aatccatagg
aagcaagagg 720gctgaagagt cggacaatga cactgacatc aatgaggaag
atgataacag aagcattggt 780ttacaagctc gggatggaag tgacaatgga
agtgggaccc agagttcatg gacaaaaagg 840gctgcagaag ttgagagccc
ccaaccacag tctacatggg agcaagcaac tgatccacct 900gatagcactt
gtgctcaggt catttatcca atgtctgagg catttgccag cagctggatg
960cctggatcca tgcaggaact tgatggacag gatcatcaat atgacaatgt
cccaatggga 1020aaggatttgg agattggagt acctagaatt tcagattcac
ggctaaatgg accaaacaaa 1080acggttaagt tagcaactac tgctgaggaa
aaccaatatt cacagttaga cctcaaccag 1140gaaaatgatg gtcgaagttt
tgatgaagag aacctggaga tgaataatga taaacctaaa 1200agtgagtgga
ttaaacaggc tatgaactca ccaggaaaag ttgaagaaca tcgtagagga
1260aataaagtat ctgatgcacc acccgaaatt tccaaaataa aggacaaagg
catgcaacat 1320gtcgaggata tgccttctct tgtgctcagt ctgaagaggt
tgggtgatat tgcagacacg 1380agcactaatg tctcagacca gaatattgtt
gggcgttcag agctttcagc cttcaccagg 1440tacaattcag gcacaactgg
taaccagggt caaacaggta atgttggcag ttgctctcca 1500ccaaataata
gttcagaagc agcaaagcag tcccattttg atgctccaca tcaaatttcg
1560aatagcagta gtaacaataa caatatgggc tctactacta ataagttctt
caaaaagcct 1620gctatggaca ttgataagac acctgcaaaa tcaacagtca
actgttctca tcattcacat 1680gtgtttgagc cagtgcaaag ttcccatatg
tctaataata accttactgc atctggtaag 1740cctggtgttg gctccgtaaa
tggtatgctg caagaaaacg taccagtaaa tgctgttctg 1800ccgcaagaaa
ataacgtgga tcagcagctc aagattcagc accaccatca ctaccatcat
1860tacgatgtcc atagtgtaca gcagctacca aaggtttctg ttcaacataa
tatgcccaaa 1920agcaaggatg tgacagcacc cccacagtgt gggtcttcaa
acacttgtag atcgccaatt 1980gaagcaaatg ttgccaattg cagtttgaat
ggaagtggta gtggaagcaa tcatgggagc 2040aatttcctta atggaagtag
tgctgctgtg aatgttgaag gaacaaacat ggtcaatgat 2100agtgggatag
ctgcaaaaga tggtgctgaa aatggaagtg gtagtggaag tggaagtggt
2160agtggtagtg gtgttggtgt ggatcaaagt cgatcagctc aacgagaagc
tgccttgaat 2220aaattccgtc tcaagcgtaa agaaagatgc tttgacaaaa
aggtgcgata tcaaagcaga 2280aagaagttag cagatcaaag acctcgtgtt
cgtgggcaat tcgtgcgcca ggtacgagaa 2340aacaaaggaa ggaataccga tagctaa
2367
* * * * *
References