U.S. patent application number 12/461948 was filed with the patent office on 2010-08-19 for method for measuring resistance of a patient hiv-2 to protease inhibitors.
This patent application is currently assigned to BIOMERIEUX. Invention is credited to Francoise Brun-Vezinet, Diane Descamps, Jean-Noel Telles.
Application Number | 20100209903 12/461948 |
Document ID | / |
Family ID | 9547071 |
Filed Date | 2010-08-19 |
United States Patent
Application |
20100209903 |
Kind Code |
A1 |
Telles; Jean-Noel ; et
al. |
August 19, 2010 |
Method for measuring resistance of a patient HIV-2 to protease
inhibitors
Abstract
A search method in a biological sample containing an HIV-2 viral
strain for possible resistance of said strain to treatment by an
anti-protease agent, and nucleotide probes for the implementation
thereof. According to methods known per se, the presence of at
least one mutation at certain, specified, particular positions of
the proteinic sequence of the protease of said viral strain from a
biological sample taken from a patient contaminated by HIV-2 is
searched. If said mutation is observed, the existence of a
resistance to said anti-protease agent is assumed in the
patient.
Inventors: |
Telles; Jean-Noel; (Paris,
FR) ; Brun-Vezinet; Francoise; (Paris, FR) ;
Descamps; Diane; (Paris, FR) |
Correspondence
Address: |
OLIFF & BERRIDGE, PLC
P.O. BOX 320850
ALEXANDRIA
VA
22320-4850
US
|
Assignee: |
BIOMERIEUX
Marcy-L'Etoile
FR
ASSISTANCE PUBLIQUE-HOPITAUX DE PARIS
Paris
FR
|
Family ID: |
9547071 |
Appl. No.: |
12/461948 |
Filed: |
August 28, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10865889 |
Jun 14, 2004 |
7632635 |
|
|
12461948 |
|
|
|
|
09980777 |
Feb 20, 2002 |
6794129 |
|
|
PCT/FR00/01728 |
Jun 21, 2000 |
|
|
|
10865889 |
|
|
|
|
Current U.S.
Class: |
435/5 ;
536/24.32 |
Current CPC
Class: |
C12Q 1/703 20130101 |
Class at
Publication: |
435/5 ;
536/24.32 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70; C07H 21/04 20060101 C07H021/04 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 21, 1999 |
FR |
99 07855 |
Claims
1. A method for testing, in a biological sample from a patient
infected by HIV-2 containing at least one HIV-2 viral strain, the
resistance of said HIV-2 viral strain to treatment with an
antiprotease agent, comprising investigating the presence of a
mutation at position 46 of the protein sequence of the protease of
said viral strain, said mutation having previously been found to
elicit said resistance, and if such a mutation is found, concluding
that a viral strain resistant to said antiprotease agent is present
in the patient in question.
2. The method according to claim 1, wherein: a) the presence of a
mutation at position 46 of the protein sequence of the protease of
said viral strain in a biological sample taken from a patient
infected with HIV-2 is investigated, b) a mutation found in a)
which, after cloning in an HIV-2 virus, does not prevent the virus
clone obtained from multiplying in culture in the presence of said
antiprotease drug is selected, and c) if the mutation is selected
at step b), it is concluded that resistance exists to the
antiprotease drug referred to in b).
3. The method according to claim 1, wherein the presence of the
mutation I46V, in the protein sequence of the protease to said
viral strain is investigated and in which said resistance is
concluded to exist if said mutation is present.
4. The method according to claim 1, wherein, to detect a mutation
of the protein sequence of the protease, a corresponding mutation
is sought in the nucleotide sequence of the gene of said
protease.
5. The method according to claim 4, wherein said test is carried
out using hybridization techniques.
6. The method according to claim 4, wherein said test is carried
out using sequencing techniques.
7. The method of claim 4, wherein said mutation in the sequence of
the gene corresponds to I46V.
8. The method of claim 7, wherein said mutation corresponds to a
codon for position 46, which is GTA, instead of ATA.
9. The method of claim 1, said method further comprising
investigating the presence of at least one additional mutation at
one or more of positions 10, 45, 54, 64, 82, 84 and 90 of the
protein sequence of the protease of said viral strain.
10. The method of claim 9, wherein the at least one additional
mutation is selected from the following mutations: V10I, K45R,
154M, I64V, I82M, I84L, and L90M.
11. The method of claim 9, wherein, to detect the at least one
additional mutation of the protein sequence of the protease, at
least one corresponding mutation is sought in the nucleotide
sequence of the gene of said protease.
12. The method of claim 9, wherein said additional mutation is at
said position 10.
13. The method of claim 9, wherein said additional mutation is at
said position 45.
14. The method of claim 9, wherein said additional mutation is at
said position 82.
15. The method of claim 9, wherein said additional mutation is at
said position 54.
16. The method of claim 9, wherein said additional mutation is at
said position 64.
17. The method of claim 9, wherein said additional mutation is at
said position 84.
18. The method of claim 11, wherein said additional mutation
corresponds to a condon for position 45, which is AGA, instead of
AAA.
19. The method of claim 11, wherein said additional mutation
corresponds to a condon for position 54, which is ATG, instead of
ATA.
20. The method of claim 11, wherein said additional mutation
corresponds to a condon for position 64, which is GTA, instead of
ATA.
21. A nucleotide probe usable in the method according to claim 1,
comprising, as a minimum sequence, a sequence selected from the
group consisting of: a) AAA GTA GTA possibly supplemented by the
nucleotide sequence of an adjacent region of the gene of said
protease, on either side of the minimum sequence, b) a nucleotide
sequence equivalent to a sequence defined in (a), and c) a sequence
complementary to a sequence defined in (a) or in (b).
Description
[0001] This is a Divisional of application Ser. No. 10/865,889,
filed Jun. 14, 2004, which in turn is a Divisional of application
Ser. No. 09/980,777, filed Feb. 20, 2002, and which issued as U.S.
Pat. No. 6,794,129 B1, which is a National Stage of Application No.
PCT/FR00/01728, filed Jun. 21, 2000. The disclosure of the prior
applications is hereby incorporated by reference herein in its
entirety.
BACKGROUND
[0002] The invention relates to a method for testing the resistance
of the HIV-2 virus to antiprotease treatment in a patient infected
with HIV-2 as well as nucleotide probes usable for such
testing.
[0003] Acquired immunodeficiency syndrome (AIDS) is caused by two
viruses: HIV-1 and HIV-2. HIV-1 is present throughout the world
while HIV-2 is present mainly in western Africa.
[0004] Effective antiviral treatments have been in widespread use
since 1996 in developed countries where the virus present is HIV-1.
Because of their cost, these treatments cannot be used in
developing countries where HIV-2 is present.
[0005] There are three types of antiretroviral treatments:
antiprotease (Indinavir, Ritonavir, Saquinavir, Nelfinavir, and
Amprenavir), nucleoside reverse transcriptase (RT) inhibitors
(Zidovudine, Didanosine, Zalcitabine, Lamivudine, Stavudine,
Abacavir, FTC, and Adefovir), and nonnucleoside RT inhibitors
(Nevirapine, Delavirdine, and Efavirenz). These treatments are
often given in combination; this is known as multiple-drug
therapy.
[0006] Antiproteases elicit primary mutations which confer a high
degree of resistance but alter the ability of the virus to
replicate. Thus, the virus needs to select secondary mutations if
it is to be both resistant and able to replicate actively. Also,
reverse transcriptase mutations have been described where
nucleoside RT inhibitors have been used in combination.
[0007] During treatment with HIV-1 infection, particularly if the
levels of drug in the bloodstream are inadequate, viral replication
is insufficiently inhibited, or rises above the detection threshold
of available viral load techniques (the "viral load" measures the
quantity of virus genomes in the bloodstream). Because of the high
error rate of reverse transcription, mutations take place in the
genes targeted by protease and reverse transcriptase treatment.
Certain mutations bring about various degrees of resistance to
antivirals. Virologic failure occurs in 20 to 40% of patients
treated with current multiple drug regimens.
[0008] If viruses resistant to one or more substances can be shown
for a patient before treatment or if the viral load increases
again, the best drug combination for treating HIV-1 can be
chosen.
[0009] There are currently no published data on mutations in the
HIV-2 genome due to the use of antiproteases.
[0010] Antiprotease agents that are active against HIV-1 are also
active against HIV-2. However, there are no methods available to
assist the clinician in determining resistance to antiprotease
drugs in patients infected with HIV-2.
SUMMARY
[0011] The amino acid sequence of the HIV-2 protease is known. In
the present application, the numbering system for this amino acid
sequence can be deduced from that described in Human Retroviruses
and Aids, 1997, Los Alamos National Laboratory, Los Alamos, N.
Mex., Chapter II, pp. B10 and B11. The first amino acid in the
protease sequence, considered to be position 1 in the present
application, is the proline in position 86 of the polyprotein PoL
in the ROD strain.
[0012] It has now been discovered that antiprotease drugs can bring
about mutations in positions 45, 54, 64, 84, and 90 and in
positions 10, 46 of the HIV-2 protease and that the mutated viral
strains thus appearing are usually resistant to at least one of the
antiprotease drugs used.
[0013] Hence, the subject of the present invention is a method for
testing resistance of an HIV-2 viral strain to antiprotease
treatment.
[0014] In a preliminary testing phase, this is a method
wherein:
[0015] a) using known methods, the presence of at least one
mutation at one of positions 45, 54, 64, 84, and 90 or one of
positions 10, 46 of the protein sequence of the protease of said
viral strain in a biological sample taken from a patient infected
with HIV-2 is investigated,
[0016] b) of the mutations founds in a), those which, after cloning
in an HIV-2 virus, do not prevent the virus clone obtained from
multiplying in culture in the presence of said antiprotease drug
are selected, and
[0017] c) if at least one mutation is selected at step b), it is
concluded that resistance exists to the antiprotease drug referred
to in b).
[0018] Of the mutations found in a), those which, when present in a
gene cloned in an HIV-2 virus, cause the viral clone not to be
significantly prevented from multiplying in the presence of said
antiprotease drug are selected. The following procedure may be used
to implement step b). The mutations tested are inserted
individually into a viral clone by mutagenesis directed by the
method described in the article by Kemp et al., J. Virol., 72(6),
pp. 5093-5098, 1998. The clones thus obtained are cultured with a
"wild-type" (i.e. non-mutated) virus clone as a reference in the
presence of the various antiprotease drugs able to act against the
HIV-2 virus. By measuring the IC.sub.50 with a colorimetric test
for example (see above Kemp article), the size of the mutation
(minor or major) with the various drugs tested can be determined.
Thus, one can select the mutations that allow the virus to multiply
in the presence of an antiprotease agent as these mutations give
rise to strains resistant to this antiprotease.
[0019] Of course, in the case outlined in c), the future treatment
planned for the patient would be a different antiprotease agent
from the agent shown to elicit resistance in this patient.
[0020] If step b) did not select a mutation found in step a), it
may be concluded that the mutation in question did not elicit
resistance by the HIV-2 virus to the antiprotease drug tested for
the patient in question.
[0021] Obviously, when step b) identifies a mutation that generates
resistance to a given antiprotease drug, step b) of the method
described above need not be carried out in the future. In this
case, step a) would suffice because the link between the mutation
and resistance to the antiprotease drug would be established once
and for all; one can go on directly to step c) and conclude that
there is resistance to the antiprotease agent studied.
[0022] The invention relates in particular to a method for
detecting any resistance of an HIV-2 viral strain to treatment by
an antiprotease drug in which the presence of at least one mutation
chosen from the following mutations:
[0023] K45R, I54M, I64V, I84L, and L90M, or V10I, I46V, and I82M,
in the protein sequence of the protease of said viral strain is
investigated and in which said resistance is concluded to exist if
said mutation or said mutations is or are present.
[0024] The conventional notation in the present application for
describing a mutation is as follows: The number indicates the
position in the amino acid sequence of the HIV-2 protease. The
letter to the left of the number is the amino acid of the wild-type
strain in the international classification, with the one-letter
code. The letter to the right of the number is the amino acid, in
the same classification, resulting from a mutation.
[0025] "Wild-type strain" is understood to be a viral strain that
has not mutated after treatment with an antiprotease.
[0026] To identify a mutation in the protein sequence of the
protease of the viral strain in question, it is preferable to look
for a corresponding mutation in the nucleotide sequence of the gene
of said protease. These mutations can be tested on the DNA or the
RNA. Of course, in looking for a mutation in the protein sequence
by seeking a mutation in the nucleotide sequence, degeneration of
the genetic code would be taken into account, namely a given amino
acid can be coded by different codons. This mutation assay can be
done in the nucleotide sequence by known methods, particularly by
hybridization or sequencing techniques.
DETAILED DESCRIPTION OF EMBODIMENT
[0027] In a first embodiment of the invention, a hybridization
method using specific probes is implemented to test for the
mutation or mutations.
[0028] A particular embodiment using a hybridization method
consists of obtaining a polynucleotide containing all or part of
the protease gene, and including the sequence of interest
corresponding to the region containing the mutation to be assayed.
Such a polynucleotide can be obtained in particular by enzymatic
amplification. The method used in this case comprises the steps
consisting of placing said polynucleotide in contact with a
nucleotide probe that is attached or attachable to a solid
substrate and is able to hybridize specifically with such a
polynucleotide only if the polynucleotide has the mutation studied;
then revealing the presence of the polynucleotide attached to the
solid substrate by the capture probe, using known methods. For this
purpose, the solid substrate can be washed, after which the
presence of the polynucleotide, attached to the substrate, is
revealed either by a physical method or with an appropriate
marker.
[0029] The probe can be attached directly by adsorption or by
covalence. It can also be attached indirectly by a
ligand/antiligand-type reaction such as the biotin/streptavidin or
haptene/antibody pair, with the antiligand attaching to the solid
substrate and the ligand to the probe, for example.
[0030] The polynucleotide can also be labeled during the enzymatic
amplification stage, for example using a triphosphate nucleoside
labeled for the amplification reaction. The labeled nucleotide will
be a deoxyribonucleotide in amplification systems generating a DNA,
such as PCR, or a ribonucleotide in amplification techniques
generating an RNA, such as the TMA or NASBA techniques.
[0031] The polynucleotide can also be labeled after the
amplification stage, for example by hybridizing a probe labeled by
the sandwich hybridizing technique described in document WO
91/19812.
[0032] A particular method of labeling polynucleotides is described
in application FR 98 07870 by the applicant.
[0033] Alternatively, the polynucleotide including all or part of
the protease gene can be prepared by enzymatic amplification,
elongating primers that have a ligand. The polynucleotide obtained,
which will thus contain the ligand, can be attached to the solid
substrate by interaction with a corresponding antiligand. The solid
substrate to which the polynucleotide is attached is then placed in
contact with at least one probe able to attach specifically to the
polynucleotide only if it contains the sought-after mutation. If
this mutation is present, the probe will be attached to the solid
substrate by the hybrid it forms with the polynucleotide, which
itself is attached. One need then only reveal the presence of the
hybrid so formed by known methods.
[0034] In another embodiment, a hybridization method is used that
comprises the steps of enzymatically amplifying all or part of the
protease gene using primers carrying a ligand to generate a
polynucleotide having at least one ligand, attaching the
polynucleotide to a solid substrate by interaction with an
antiligand as described above, placing said attached polynucleotide
in contact with at least one probe capable of hybridizing
specifically therewith, and revealing the hybrid formed, if any.
The probe must hybridize only if the polynucleotide contains the
sought-after mutation.
[0035] Other detection methods by hybridization may be considered
such as that described in Kricka et al., Clinical Chemistry, 45(4),
pp. 453-458, 1999 or Keller G. H. et al., DNA Probes, 2nd Ed.,
Stockton Press, 1993, sections 5 and 6, pp. 173-249.
[0036] The "solid substrate" as used here includes all the
materials on which a polynucleotide can be immobilized. Synthetic
materials or natural materials, that may be chemically modified,
can be used for the solid substrate, particularly polysaccharides
such as cellulose-based materials, for example paper, cellulose
derivatives such as cellulose acetate and nitrocellulose, or
dextran; polymers, copolymers, particularly those based on
styrene-type monomers, natural fibers such as cotton, and synthetic
fibers such as nylon; minerals such as silica, quartz, glasses, and
ceramics; latexes; magnetic particles; metal derivatives; gels;
etc. The solid substrate may be in the form of a microtitration
plate, a membrane as described in application WO 9412670, a
particle, or a biochip.
[0037] "Biochip" is understood to be a solid substrate of small
size to which a plurality of polynucleotides are attached at
predetermined positions.
[0038] Examples of these biochips are given for example in the
publications of G. Ramsay, Nature Biotechnology, 16, pp. 40-44,
1998; F. Ginot, Human Mutation, 10, pp. 1-10, 1997; J. Cheng et
al., Molecular Diagnosis, 1(3), pp. 183-200, 1996; T. Livache et
al., Nucleic Acids Research, 22(15), pp. 2915-2921, 1994; J. Cheng
et al., Nature Biotechnology, 16, pp. 541-546, 1998. The main
property of the solid substrate must be to preserve the
hybridization properties of the probes on the target and allow a
minimum background noise for the detection method. One advantage of
biochips is that they simplify the use of numerous probes, taking
into account the polymorphism of the virus in areas abutting the
sought-after mutation. A biochip for verifying the presence or
absence of mutations can be made by the procedure described by
Kozal M. et al., Nature Medicine, 2, pp. 753-759, 1996, as a
function of alignments of sequences known for different HIV-2
strains.
[0039] A "marker" is understood to be a tracer able to generate a
signal. A nonexhaustive list of these tracers includes enzymes
producing a detectable signal, for example by colorimetry,
fluorescence, or luminescence, such as horseradish peroxidase,
alkaline phosphatase, beta-galactosidase,
glucose-6-phosphate-dehydrogenase; chromophores such as
fluorescent, luminescent, or dye compounds; electron density groups
detectable by electron microscopy, or by their electrical
properties such as conductivity, by amperometry or voltametry
methods, or by impedance measurement; groups detectable by optical
methods such as diffraction, surface plasmon resonance, or
variation in contact angle, or by physical methods such as atomic
force spectroscopy, tunnel effect, etc.; radioactive molecules such
as .sup.32P, .sup.35S, or .sup.125I.
[0040] Signal amplification systems can be used as described in
document WO/95 08000 and in this case, the preliminary enzymatic
amplification reaction may be unnecessary.
[0041] The term "primer" designates an oligonucleotide sequence
able to hybridize to a useful nucleic sequence and to serve as a
starting point for an enzymatic elongation reaction to produce a
nucleic acid fragment complementing a target of interest such as
the gene of the protease or part of this gene. The primer has a
size of between 5 and 50 nucleotides, particularly between 10 and
30 nucleotides. Preferably, the primers are chosen in the preserved
regions of the HIV-2 virus to enable all the viral strains that
could be encountered in a patient to be amplified in order to deal
with the polymorphism inherent in the HIV-2 virus.
[0042] The probes for demonstrating mutations at positions 45
and/or 54 and/or 64 and/or 84 and/or 90, as well as those showing
mutations at positions 10 and/or 46 by hybridizing on all or part
of the protease gene of the HIV-2 virus present in a biological
sample, are also a subject of the present invention.
[0043] The term "probe" refers to an oligonucleotide sequence able
to hybridize specifically with a nucleic acid sequence of interest.
Here, since the goal of the present invention is to detect a point
mutation on the gene of the HIV-2 protease, the probe must be able
to distinguish a point mutation under predetermined hybridization
or washing conditions. The size of these probes is between 5 and 40
nucleotides, particularly between 9 and 25 nucleotides. Methods for
determining these probes have been described for example in the
patent application WO 97/27332. The probe is, for example,
constructed such that the position of the mutation to be detected
is substantially in the center of the probe.
[0044] The oligonucleotides used as primers or probes can include
natural or modified nucleotides such as phosphorothioates,
H-phosphonates, alkylphosphorothioates, or analogs of nucleotides
containing bases such as inosine or nebularin in the place of the
purine or pyrimidine bases present in the A, T, C, G, and U
nucleotides.
[0045] These primers or probes can be composed totally or partially
of alpha or beta anomerism nucleosides or isomers in the D or L
series, or PNA (Nielsen et al., Nucleic Acid Research, 21(2), pp.
197-200, 1993).
[0046] In another embodiment of the invention, the mutation or
mutations is/are detected by sequencing all or part of the protease
gene.
[0047] The various sequencing methods are well known: In
particular, the sequencing methods of Sanger, the sequencing
methods using four wells to react the sequences studied with
sequencing primers labeled by four different fluorophores
(Perkin-Elmer "ABI Prism Dye Primer" procedure), or the method
described in U.S. Pat. No. 5,795,722 (Visible Genetics), or the
method using labeled nucleotides (Perkin-Elmer "ABI Prism Dye
Terminator" procedure) instead of labeled primers can be used. The
sequencing methods are described, for example, in Molecular
Cloning, A Laboratory Manual, Sambrook, Fritsch, and Maniatis, Cold
Spring Harbor Laboratory Press, 1989, Chapter 13.
[0048] In a particular embodiment of the invention, the presence of
only one or more given mutations is tested. In another embodiment
of the invention, both the mutated nucleotide sequence and the
wild-type (non-mutated) nucleotide sequence are tested. If a
hybridization method is used, at least two types of probes are
defined for each position able to mutate: a probe type specific to
the mutated sequence and a probe type specific to the wild-type
sequence. Using both these types of probes enables the method to be
controlled, since at least one of the two probe types has to react.
Another advantage is to reveal the presence of mutated strains and
wild-type strains in a given patient, where present.
[0049] Preferably, the target nucleic acid is subjected to a
preliminary enzymatic amplification reaction to increase the
sensitivity of the test, but it is possible to detect the target
nucleic acid directly. The articles by Lewis (1992, Genetic
Engineering News, 12, 1-9), and Abramson and Myers (1993, Curr.
Opin. Biotechnol., 4, 41-47) give examples of target amplification.
The enzymatic amplification technique is, for example, chosen from
the NASBA (Nucleic Acid Sequence Based Amplification), TMA
(Transcription Mediated Amplification), RT-PCR (Reverse
Transcriptase-Polymerase Chain Reaction), SDA (Strand Displacement
Amplification), or LCR (Ligase Chain Reaction) techniques.
[0050] Mutant viral strains are detected from a possibly pretreated
biologic sample. "Pretreatment" means the various steps by which
the sample is treated to make the target nucleic acid, namely the
protease gene, accessible, for example lysis, fluidization,
concentration, or capture (see for example U.S. Pat. Nos. 5,750,388
and 5,766,849) using methods known of themselves.
[0051] To extract the viral RNA, one may, for example, use the
reagent sold by the Boeringher Mannheim Company (High Pure Viral
RNA reference 1858882) or the Quiagen kit (Viral RNA reference
29504). Other procedures are described in Maniatis et al.,
Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring
Harbor Laboratory Press, 1989. The biologic sample can be any
sample from the human body or possibly a sample enriched by
culturing, such as blood, sperm, skin tissue, bronchoalveolar
lavage fluid, biopsy, urine, colonies, liquid culture, etc.
[0052] The following examples illustrate the invention.
EXAMPLES
Example 1
[0053] A study was conducted on three patients infected with HIV-2.
Patients 1 and 2 had never received antiproteases. Patient 3 had
already received Ritonavir for 8 months, and this treatment had
been withdrawn 5 months before the study started. The first sample
studied was taken before the beginning of treatment in patients 1
and 2, and 6 weeks after the start of Ritonavir treatment for
patient 3. In patients 1 and 2, samples taken 2 and 5 months
respectively after the start of treatment were studied. For patient
3, two samples (8 months and 11 months) were analyzed. Treatment
consisted of Ritonavir for patient 2 and Ritonavir/Saquinavir for
patients 1 and 3, at the recommended doses.
Methods:
[0054] The plasmas were obtained by centrifuging whole blood at 800
g for 10 minutes and clarified by a second centrifugation at 3000 g
for 15 minutes.
[0055] 500 microliters of pure plasma were added to 1.5 milliliters
of fresh lymphocyte culture stimulated by PHA (10.sup.6
cells/dish). Viral replication in the supernatant was monitored
twice a week by measuring the level of HIV P-24 antigen (ELAVIA Ag
I, Sanofi Diagnostics Pasteur). The positive supernatants were
stored at -80.degree. C. After ultracentrifugation of 1 milliliter
of supernatant (23,500 g for 1 hour), the HIV-2 RNA was extracted
by means of the Amplicor HCV Specimen Preparation kit (Roche).
[0056] The protease gene was retrotranscribed from 10 microliters
of viral RNA solution and amplified with the Titan One Tube RT-PCR
kit (Roche Molecular Diagnostics). Reverse transcription and the
first amplification were done with the 3' Prot and 5' RT 3 primers
(see below). The reaction at 50.degree. C. for 30 minutes was
followed by a denaturing step at 94.degree. C. for 5 minutes then
40 cycles (30 seconds at 94.degree. C., 30 seconds at 55.degree.
C., 90 seconds at 68.degree. C.), and finally at 68.degree. C. for
7 minutes. The step PCR stage was done with 5 microliters of the
product of the first stage with primers 3' RTD and 5' Prot 2.1,
with 5 minutes denaturing at 94.degree. C., followed by 30 cycles
(30 seconds at 94.degree. C., followed by 30 cycles at 55.degree.
C., and 30 seconds at 72.degree. C.) and finally 10 minutes at
72.degree. C. The primer sequence is the following:
TABLE-US-00001 3' Prot: CAGGGGCTGACACCAACAGCACCCCC (SEQ ID NO: 1)
5' RT 3: CCATTTTTTCACAGATCTCTTTTAATGCCTC (SEQ ID NO: 2) 3' RTD:
ATGTGGGGGTATTATAAGGATTT (SEQ ID NO: 3) 5' Prot 2.1:
GAAAGAAGCCCCGCAACTTC (SEQ ID NO: 4)
[0057] The amplification products were purified with the QUIACQUICK
PCR purification kit (Quiagen) and sequenced directly with the 3'
RTD and 5' Prot 2.1 primers using the ABI Prism Dye Terminator
Cycle Sequencing kit (Applied Biosystem). They were analyzed with
the Applied Biosystem 377 automatic sequencer and the sequences
were aligned with the HIV-2 consensus sequences (subtypes A and
B).
Results:
[0058] Before treatment, no mutation was detected relative to the
HIV-2 A and B consensus sequences.
[0059] After treatment, the following mutations were observed:
[0060] position 45: In patients 1 and 2, coexistence of a
non-mutated population (lysine; codon AAA) and a mutated population
(arginine; codon AGA) were observed, namely the K 45 K/R mutation
was observed;
[0061] position 54: In patients 1 and 2, replacement of isoleucine
(codon ATA) by methionine (codon ATG), namely the I 54 M mutation,
was observed;
[0062] position 64: A non-mutated population was observed, and a
population in which isoleucine (codon ATA) was replaced by a valine
(codon GTA), namely mutation I 64 I/V;
[0063] position 84: In patient 3, a non-mutated population
(isoleucine (codon ATC) and a mutated population with replacement
of isoleucine by a leucine (codon CTC) were observed, namely the I
84 I/L mutation;
[0064] position 90: In all 3 patients, replacement of leucine
(codon CTG) by a methionine (codon ATG) was observed, namely the L
90 M mutation.
[0065] Similarly, the following mutations were observed:
[0066] position 10: Replacement of valine (codon GTA) by an
isoleucine (codon ATA): i.e. mutation V 10 I when a patient was
treated with Ritonavir;
[0067] position 46: Replacement of isoleucine (codon ATA) by a
valine (codon GTA): i.e. mutation I 46 V when a patient was treated
with Ritonavir; and
[0068] position 82: Replacement of isoleucine (codon ATA) by a
methionine (codon ATG): i.e. mutation I 82 M when a patient was
treated with Indinavir.
Example 2
Example of Probes that can be Used for Detecting Mutations on the
HIV-2 Protease Gene
[0069] The probes usable for revealing any mutations according to
the invention, using hybridization techniques, can be defined from
alignments published by Myers G. et al., 1997, Human Retroviruses
and AIDS: A compilation and analysis of nucleic acid and amino acid
sequences, Los Alamos National Laboratory, Los Alamos, N. Mex.
[0070] Of course, in addition to the probes expressly defined
below, the invention also includes equivalent nucleotide probes,
namely probes able to detect the same mutations on the protein
sequence of the protease as those detected by the probes defined
below, taking into account degeneration in the genetic code, namely
the fact that a given amino acid can be coded by different
codons.
[0071] Thus, the expression "equivalent nucleotide sequences" means
any nucleotide sequences that differ from each other by at least
one nucleotide but whose translation leads to the same protein
sequence, in other words all nucleotide sequences coding for the
same protein sequence.
[0072] Of course, this comment applies to each codon in each probe.
Thus, for example, the amino acid in position 53 of HIV-2 protease
is a phenylalanine which can be coded either by codon TTT or by
codon TTC. The probes corresponding to each of these possibilities
are of course part of the invention.
[0073] Depending on the particular hybridization conditions,
particularly the temperature and composition of the hybridization
and washing buffers, it is possible to define probes that must
include at least one of the minimum sequences below, or their
complementary sequences. Probes containing these sequences enable
mutations to be distinguished in a hybridization process. Of
course, analogous probes, obtained in particular by introducing
base analogs such as inosine or nebularin in positions where
polymorphism due to intrinsic variability of the virus is present
lead to a similar result and are also part of the invention.
[0074] These sequences are given in the 5' to 3' direction:
[0075] CCA AAA ATA for a wild-type form of position 45.
[0076] CCA AAA GTA for a wild-type form of position 45.
[0077] CCT AAA ATA for a wild-type form of position 45.
[0078] CCA AGA ATA for a mutated form of position 45.
[0079] CCA AGA GTA for a mutated form of position 45.
[0080] CCT AGA ATA for a mutated form of position 45.
[0081] TTT ATA AAC for a wild-type form of position 54.
[0082] TTT ATA AAT for a wild-type form of position 54.
[0083] TTT ATG AAC for a mutated form of position 54.
[0084] TTT ATG AAT for a mutated form of position 54.
[0085] GAA ATA AAA for a wild-type form of position 64.
[0086] GAA ATA GAA for a wild-type form of position 64.
[0087] GAA GTA AAA for a mutated form of position 64.
[0088] GAA GTA GAA for a mutated form of position 64.
[0089] AAC ATC TTT for a wild-type form of position 84.
[0090] AAC ATT TTT for a wild-type form of position 84.
[0091] AAC CTC TTT for a mutated form of position 84.
[0092] ATT CTG ACA for a wild-type form of position 90.
[0093] ATC CTG ACA for a wild-type form of position 90.
[0094] ATT CTA ACA for a wild-type form of position 90.
[0095] ATC CTA ACA for a wild-type form of position 90.
[0096] ATT ATG ACA for a mutated form of position 90.
[0097] ATC ATG ACA for a mutated form of position 90.
[0098] or:
[0099] CCA GTA GTC for a wild-type form of position 10.
[0100] CCA ATA GTC for a mutated form of position 10.
[0101] AAA ATA GTA for a wild-type form of position 46.
[0102] AAA GTA GTA for a mutated form of position 46.
[0103] CCA ATC AAC for a wild-type form of position 82.
[0104] CCA ATA AAC for a wild-type form of position 82.
[0105] CCA ATG AAC for a mutated form of position 82.
[0106] To obtain probes longer than those with the minimum
sequences of 9 nucleotides shown above, it is of course necessary
to choose additional nucleotides in order to respect the sequence
of the adjacent regions on either side of the minimum sequence in
the gene of the protease of an HIV-2 strain. These sequences can be
obtained from databases.
[0107] For example, the probes indicated below, or their
complementary probes, can be used.
[0108] (a) Position 45:
[0109] A probe having for example 9 to 25 nucleotides (preferably
distributed symmetrically about the mutated codon AGA) whose
sequence is included in one of the following sequences:
TABLE-US-00002 ATTACACTCCAAGAATAGTAGGGGG (SEQ ID NO: 5)
ATTATAGCCCAAGAATAGTAGGGGG (SEQ ID NO: 6) ATTATAGTCCAAGAATAGTAGGGGG
(SEQ ID NO: 7) ATTATACCCCAAGAATAGTAGGGGG (SEQ ID NO: 8)
ATTATAGTCCAAGAATAGTAGGAGG (SEQ ID NO: 9) ATTATACCCCAAGAATAGTAGGAGG
(SEQ ID NO: 10)
[0110] can be used.
[0111] (b) Position 54:
[0112] A probe having for example 9 to 25 nucleotides (preferably
distributed symmetrically about the mutated codon ATG) whose
sequence is included in one of the following sequences:
TABLE-US-00003 TAGGGGGATTTATGAACACCAAAGA (SEQ ID NO: 11)
TAGGGGGATTCATGAACACCAAAGA (SEQ ID NO: 12) TAGGAGGATTCATGAACACCAAAGA
(SEQ ID NO: 13) TAGGAGGGTTCATGAACACCAAAGA (SEQ ID NO: 14)
[0113] can be used.
[0114] (c) Position 64:
[0115] A probe having for example 9 to 25 nucleotides (preferably
distributed symmetrically about the mutated codon GTA) whose
sequence is included in one of the following sequences:
TABLE-US-00004 AAAATGTAGAAGTAAAAGTACTAAA (SEQ ID NO: 15)
AAAATATAGAAGTAAAAGTACTAAA (SEQ ID NO: 16) AAGATGTAGAAGTAAAGGTACTAAA
(SEQ ID NO: 17) AAAATGTAGAAGTAGAAGTTCTAAA (SEQ ID NO: 18)
AAAATGTAGAAGTAGAAGTCCTGGA (SEQ ID NO: 19) AAAGTGTAGAAGTAAGAGTGCTAAA
(SEQ ID NO: 20)
[0116] can be used.
[0117] (d) Position 84:
[0118] A probe having for example 9 to 25 nucleotides (preferably
distributed symmetrically about the mutated codon CTC) whose
sequence is included in the following sequence:
TABLE-US-00005 CCCCAATCAACCTCTTTGGCAGAAA (SEQ ID NO: 21)
[0119] can be used.
[0120] (e) position 90:
[0121] A probe having for example 9 to 25 nucleotides (preferably
distributed symmetrically about the mutated codon ATG) whose
sequence is included in one of the following sequences:
TABLE-US-00006 GCAGAAATATTATGACAGCCTTAGG (SEQ ID NO: 22)
GCAGAAATATTATGGCAACCTTAGG (SEQ ID NO: 23) GCAGAAATGTTATGACAGCTTTAGG
(SEQ ID NO: 24) GCAGAAATATCATGACAGCCTTGGG (SEQ ID NO: 25)
GCAGAAACATTATGACAGCCTTA (SEQ ID NO: 26)
[0122] can be used.
Sequence CWU 1
1
26126DNAArtificial Sequence3' Prot primer 1caggggctga caccaacagc
accccc 26231DNAArtificial Sequence5' RT primer 2ccattttttc
acagatctct tttaatgcct c 31323DNAArtificial Sequence3' RTD primer
3atgtgggggt attataagga ttt 23420DNAArtificial Sequence5' Prot 2.1
primer 4gaaagaagcc ccgcaacttc 20525DNAArtificial SequenceProbe
(position 45) 5attacactcc aagaatagta ggggg 25625DNAArtificial
SequenceProbe (position 45) 6attatagccc aagaatagta ggggg
25725DNAArtificial SequenceProbe (position 45) 7attatagtcc
aagaatagta ggggg 25825DNAArtificial SequenceProbe (position 45)
8attatacccc aagaatagta ggggg 25925DNAArtificial SequenceProbe
(position 45) 9attatagtcc aagaatagta ggagg 251025DNAArtificial
SequenceProbe (position 45) 10attatacccc aagaatagta ggagg
251125DNAArtificial SequenceProbe (position 54) 11tagggggatt
tatgaacacc aaaga 251225DNAArtificial SequenceProbe (position 54)
12tagggggatt catgaacacc aaaga 251325DNAArtificial SequenceProbe
(position 54) 13taggaggatt catgaacacc aaaga 251425DNAArtificial
SequenceProbe (position 54) 14taggagggtt catgaacacc aaaga
251525DNAArtificial SequenceProbe (position 64) 15aaaatgtaga
agtaaaagta ctaaa 251625DNAArtificial SequenceProbe (position 64)
16aaaatataga agtaaaagta ctaaa 251725DNAArtificial SequenceProbe
(position 64) 17aagatgtaga agtaaaggta ctaaa 251825DNAArtificial
SequenceProbe (position 64) 18aaaatgtaga agtagaagtt ctaaa
251925DNAArtificial SequenceProbe (position 64) 19aaaatgtaga
agtagaagtc ctgga 252025DNAArtificial SequenceProbe (position 64)
20aaagtgtaga agtaagagtg ctaaa 252125DNAArtificial SequenceProbe
(position 84) 21ccccaatcaa cctctttggc agaaa 252225DNAArtificial
SequenceProbe (position 90) 22gcagaaatat tatgacagcc ttagg
252325DNAArtificial SequenceProbe (position 90) 23gcagaaatat
tatggcaacc ttagg 252425DNAArtificial SequenceProbe (position 90)
24gcagaaatgt tatgacagct ttagg 252525DNAArtificial SequenceProbe
(position 90) 25gcagaaatat catgacagcc ttggg 252623DNAArtificial
SequenceProbe (position 90) 26gcagaaacat tatgacagcc tta 23
* * * * *