U.S. patent application number 12/314893 was filed with the patent office on 2010-08-12 for retinoid metabolizing protein.
This patent application is currently assigned to Queen's University at Kingston. Invention is credited to Barbara R. Beckett, Glenville Jones, P. Martin Petkovich, Jay A. White.
Application Number | 20100203511 12/314893 |
Document ID | / |
Family ID | 34199015 |
Filed Date | 2010-08-12 |
United States Patent
Application |
20100203511 |
Kind Code |
A1 |
Petkovich; P. Martin ; et
al. |
August 12, 2010 |
Retinoid metabolizing protein
Abstract
Amino acid sequences and corresponding nucleic acid sequence of
retinoid metabolizing protein found in human, mouse and zebrafish
are described, as well as methods of using same.
Inventors: |
Petkovich; P. Martin;
(Kingston, CA) ; White; Jay A.; (Kingston, CA)
; Beckett; Barbara R.; (Kingston, CA) ; Jones;
Glenville; (Kingston, CA) |
Correspondence
Address: |
DOWELL & DOWELL P.C.
103 Oronoco St., Suite 220
Alexandria
VA
22314
US
|
Assignee: |
Queen's University at
Kingston
Kingston
CA
|
Family ID: |
34199015 |
Appl. No.: |
12/314893 |
Filed: |
December 18, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10855595 |
May 28, 2004 |
7473422 |
|
|
12314893 |
|
|
|
|
09668482 |
Sep 25, 2000 |
6861238 |
|
|
10855595 |
|
|
|
|
08882164 |
Jun 25, 1997 |
6306624 |
|
|
09668482 |
|
|
|
|
PCT/CA97/00440 |
Jun 23, 1997 |
|
|
|
08882164 |
|
|
|
|
08724466 |
Oct 1, 1996 |
6063606 |
|
|
10855595 |
|
|
|
|
08667546 |
Jun 21, 1996 |
|
|
|
08724466 |
|
|
|
|
Current U.S.
Class: |
435/455 |
Current CPC
Class: |
C07K 2319/00 20130101;
Y10S 435/975 20130101; A61K 38/00 20130101; C12N 9/0077
20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method of screening drugs for their effect on expression of a
gene wherein the gene is inducible by a retinoid, comprising: (A)
exposing a recombinant DNA to a said drug, and (B) determining the
effect on gene expression, wherein the recombinant DNA comprises:
(i) a nucleotide sequence selected from the group consisting of:
(a) SEQ ID NO:33; (b) SEQ ID NO:34; (c) SEQ ID NO:35; and (d) a
fragment of (a), (b) or (c), wherein said DNA fragment possesses
promoter activity; and (ii) at least one structural gene.
2. The method of claim 1 including exposing the recombinant DNA in
the presence of a said retinoid.
3. The method of claim 1 wherein the at least one structural gene
comprises a reporter gene that does not metabolize retinoic
acid.
4. The method of claim 1 wherein the at least one structural gene
comprises at least one cytochrome P450.
5. The method of claim 1 wherein determining the effect on gene
expression includes ascertaining the effect on transcription of the
gene.
6. The method of claim 2 wherein the retinoid is a retinoic
acid.
7. The method of claim 6 wherein the retinoic acid is
all-trans-retinoic acid.
8. The method of claim 1 wherein said recombinant DNA includes the
sequence TGAACTNNNNNTGAACT, where "N" can be any nucleotide and
there can be 0 to 5 N (SEQ ID NO:39).
9. The method of claim 8 wherein there are 5 N.
10. The method of claim 8 wherein said recombinant DNA further
includes the sequence TCTGASSAAGKTAAC (SEQ ID NO:40) downstream
from the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39).
11. The method of claim 10 wherein said recombinant DNA further
includes the sequence AATT between the sequence TGAACTNNNNNTGAACT
(SEQ ID NO:39) and the sequence TCTGASSAAGKTAAC (SEQ ID NO:40).
12. The method of claim 10 wherein there are up to six nucleotides
between the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39) and the
sequence TCTGASSAAGKTAAC (SEQ ID NO:40).
13. The method of claim 8 wherein said recombinant DNA further
includes the sequence CAATTAAAGA (SEQ ID NO:41) upstream of the
sequence TGAACTNNNNNTGAACT (SEQ ID NO:39).
14. The method of claim 1 wherein said recombinant DNA includes the
sequence CAATTAAAGATGAACTTTGGGTGAACTAATT (SEQ ID NO:42).
15. The method of any of claims 1 to 14 wherein said recombinant
DNA includes the sequence TATAA.
16. The method of claim 8, 9 or 13 wherein said recombinant DNA
includes the sequence TATAA downstream of the sequence
TGAACTNNNNNTGAACT (SEQ ID NO:39).
17. The method of claim 10 or 11 wherein said recombinant DNA
includes the sequence TATAA downstream of the sequence
TCTGASSAAGKTAAC (SEQ ID NO:40).
18. The method of claim 8 wherein said recombinant DNA includes the
sequence TATAA located downstream of the sequence TGAACTNNNNNTGAACT
(SEQ ID NO:39) and spaced up to about 55 nucleotides therefrom.
Description
[0001] This application is a division application of U.S. patent
application Ser. No. 10/855,595, filed May 25, 2004, now U.S. Pat.
No. ______ issued ______, which application is a division
application of U.S. patent application Ser. No. 09/668,482 filed
Sep. 25, 2000, now U.S. Pat. No. 6,861,238 issued Mar. 1, 2005,
which application is a division application of U.S. patent
application Ser. No. 08/882,164 filed Jun. 25, 1997, now U.S. Pat.
No. 6,306,624 issued Oct. 23, 2001, which application is a
continuation-in-part application of PCT/CA97/00440 filed Jun. 23,
1997, and U.S. patent application Ser. No. 10/855,595 is a
continuation-in-part application of U.S. patent application Ser.
No. 08/724,466 filed Oct. 1, 1996, now U.S. Pat. No. 6,063,606
issued May 16, 2000, which application is a continuation-in-part
application of U.S. patent application Ser. No. 08/667,546, filed
Jun. 21, 1996, abandoned, the specifications of which applications
are incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] Vitamin A metabolism gives rise to several active forms of
retinoic acid (RA) which are involved in regulating gene expression
during development, regeneration, and in the growth and
differentiation of epithelial tissues [Maden, 1992; Chambon, 1995;
Mangelsdorf, 1995; Gudas, 1994; Lotan, 1995; Morriss-Kay, 1996];
has been linked apoptosis, or programmed cell death in a number of
cell types; and to have anticarcinogenic and antitumoral properties
[Lotan, 1996].
[0003] Early studies of retinol deficiency indicated a correlation
between vitamin A depletion and a higher incidence of cancer and
increased susceptability to chemical carcinogenesis [Chytil, 1984].
Several animal models have been used to demonstrate the
effectiveness of retinoids in supressing carcinogenesis in a
variety of tissues including skin, mammary epithelia, oral cavity,
aerodigestive tract, liver, bladder and prostate [Moon, 1994].
These studies have led to the preventative use of retinoids to
treat premalignant lesions including actinic keratosis and oral
leukoplakia, as well as in the prevention of secondary tumours of
the head and neck and the recurrence of non-small cell lung
carcinomas, and basal cell carcinomas [Hong, 1994; Lippman, 1995].
RA itself has been found to be useful therapeutically, notably in
the treatment of cancers, including acute promyelocytic leukemia
(APL), tumors of the head and neck, and skin cancer, as well as in
the treatment of skin disorders such as the premalignancy
associated actinic keratoses, acne, psoriasis and ichthyosis. There
is evidence that the effectiveness of RA as an anti-tumour agent is
at least partially due to induction of cellular differentiation
and/or inhibition of proliferation [Lotan, 1996]. Studies over the
past several years indicate that a high proportion of patients with
acute promyelocytic leukemia (APL) achieve complete remission after
a short period of treatment with all-trans RA. Unfortunately, this
high rate of remission is in most cases brief. Following relapse,
patients are clinically resistant to further treatment with RA
[Warrell, 1994; Warrell, et al., 1994; Chomienne, 1996; Muindi,
1992]. The nature of this resistance is unknown. Interestingly,
leukemic cells taken from patients exhibiting clinical resistance
to RA have been shown to be sensitive to the differentiating action
of RA when grown in vitro (Muindi, 1992; Muindi, 1994). This
suggests that pharmacokinetic mechanisms may account for the
acquired resistance to RA. This possibility is supported by studies
showing that peak plasma concentrations of RA were much higher in
patients after initial administration than in patients treated
following relapse. This decrease in peak plasma RA concentration
was accompanied by a 10-fold increase in urinary 4-oxo-retinoic
acid concentration. In addition, ketoconazole, a broad spectrum
inhibitor of cytochrome P450 function was shown to modulate RA
pharmacokinetics in vivo [Muindi, 1992; Muindi, 1994]. It is
therefore likely that RA increases the rate of its own metabolism
which in turn results in the inability to sustain effective
therapeutic doses of RA. Therapeutic administration of RA can
result in a variety of undesirable side effects and it is therefore
important to establish and maintain the minimal requisite doses of
RA in treatment. For example, RA treatments during pregnancy can
lead to severe teratogenic effects on the fetus. Adverse reactions
to RA treatment also include headache, nausea, chelitis, facial
dermatitis, conjunctivitis, and dryness of nasal mucosa. Prolonged
exposure to RA can cause major elevations in serum triglycerides
and can lead to severe abnormalities of liver function, including
hepatomegaly, cirrhosis and portal hypertension.
[0004] RA metabolism may also account for the lack of response of
certain tumors to RA treatment. For example, recent studies have
shown that cytochrome P450 inhibitors that block RA metabolism,
resulting in increased tissue levels of RA, may be useful
therapeutic agents in the treatment of prostate cancer [Wouters,
1992; De Coster, 1996]. Thus RA metabolizing cytochrome P450s may
be useful targets for the treatment of a number of different types
of cancer.
[0005] The classical view of vitamin A metabolism holds that all
trans-RA, the most active metabolite is derived from conversion of
retinol to retinaldehyde to RA through two oxidation steps and that
RA is further metabolized to the polar derivatives 4-OH RA and
4-oxo RA [Blaner, 1994; Napoli, 1995; Formelli, 1996; Napoli,
1996]. It is unknown whether the 4-oxo- and 4-OH-metabolites are
simply intermediates in the RA catabolic pathway or whether they
can also have specific activities which differ from those of
all-trans RA and 9-cis RA. Pijnappel et al. [Pijnappel, 1993] have
shown that, in Xenopus, 4-oxo-RA can efficiently modulate
positional specification in early embryos and exhibits a more
potent ability to regulate Hoxb-9 and Hoxb-4 gene expression than
all-trans RA. 4-oxo-RA has been found to bind to retinoic acid
receptor-.beta. (RAR-.beta.) with affinity comparable to all-trans
RA [Pijnappel, 1993] but poorly to RAR-.gamma. [Reddy, 1992],
suggesting that this metabolite exhibits some receptor selectivity.
4-oxo-RA also binds to cellular retinoic acid binding protein
(CRABP) but with an affinity slightly lower than that of all-trans
RA [Fiorella, 1993]. Takatsuka et al. [Takatsuka, 1996] have shown
that growth inhibitory effects of RA correlate with RA metabolic
activity but it is unknown whether there is a causal relationship
between production of RA metabolites and growth inhibition. The
asymmetric distribution of these metabolites in developing embryos
suggests that they may be preferentially sequestered or generated
by tissue specific isomerases [Creech Kraft, 1994]. The normal
balance of these metabolites is dependent upon rate of formation
from metabolic precursors, retinol and retinaldehyde [Leo, 1989],
and rate of catabolism. Little is presently known about the enzymes
involved in this metabolic scheme, in particular the catabolism of
RA.
[0006] The catabolism of RA is thought to be initiated by
hydroxylation either at the C4-, or C18-position of the
.beta.-ionone ring of RA [Napoli, 1996]. The C4-hydroxylation step
is mediated by cytochrome P450 activity, as judged by the ability
of broad spectrum P450 inhibitors such as ketocoazole and liarazole
to block 4-hydroxylation [Williams, 1987, Van Wauwe, 1988; Van
Wauwe, 1990, Van Wauwe, 1992, Wouters, 1992]. In certain tissues,
including testis, skin and lung and in numerous cell lines, such as
NIH3T3 fibroblasts, HL 60 myelomonocytic leukemic cells, F9 and P19
murine embryonal carcinoma cell lines and MCF7, RA metabolism can
be induced by RA pretreatment [Frolik, 1979, Roberts, 1979a and b;
Duell, 1992; Wouters, 1992]. Studies involving targetted disruption
of RAR genes in F9 cells suggest that RAR-.alpha. and RAR-.gamma.
isoforms may play a role in regulating the enzymes responsible for
this increased metabolism [Boylan, 1995].
[0007] The glucuronidation of RA is a significant metabolic step in
the inactivation of RA [Blaner, 1994; Formelli, 1996]. The
elimination of RA may require oxidation to 4-oxo, followed by
conjugation to form the 4-oxo all-trans RA glucuronide. This is
supported by studies in both primates and humans showing that the
4-oxo RA glucuronide is the only retinoid conjugate found in urine
[Muindi, 1992; Muindi, 1994]. The fact that following RA therapy,
4-oxo RA is not present or barely detectable in serum, suggests
that oxidation may be the rate limiting step in this process.
[0008] It has recently been shown that 4-oxoretinol (4-oxo-ROL) can
have greater biological activity than retinol. The 4-oxo-ROL is
inducible by RA in F9 and P19 mouse teratocarcinoma cells [Blumberg
et al., 1995; Achkar et al., 1996].
[0009] It is known that zebrafish fins regenerate through an RA
sensitive process which utilizes many gene regulatory pathways
involved in early vertebrate development [White, 1994; Akimenko,
1995a & b].
[0010] As far as the inventors are aware, cytochrome P450s involved
in the metabolism of RA in extrahepatic tissues remain
uncharacterized at the molecular level.
SUMMARY OF THE INVENTION
[0011] The present inventors are the first to identify, clone and
sequence a gene (cDNA) encoding a retinoic acid-inducible, retinoic
acid-metabolizing protein, including a cDNA which is RA-inducible
in humans. The protein has been found to be expressed in
epithelia.
[0012] A cDNA has been isolated from zebra fish and sequenced. A
protein encoded by the cDNA has been expressed and shown to have
the ability to hydroxylate retinoic acid at the 4 position of the
.beta.-ionone ring of retinoic acid. The protein has been found to
be inducible in epithelial cells exposed to retinoic acid.
[0013] A human cDNA encoding a protein with similar functionality
has also been isolated and sequenced.
[0014] A cDNA has also been isolated from mouse and sequenced.
[0015] Homology between sequences from the three species, be they
nucleic acids encoding the protein, or the amino acid sequences of
the proteins, has been found to be relatively high and all three
proteins contain a heme-binding motif characteristic of the group
of proteins known as cytochrome P450s. The overall homology between
the amino acid sequences of these newly obtained proteins and known
cytochrome P450s is less than 30%. Notwithstanding this relatively
low overall homology, a higher degree of homology has been observed
in the heme binding region for certain other P450s. For example,
homology between the approximately 20 amino acids defining
respective heme binding regions of the new zebrafish protein and
CYP4503A12 is about 50% and between the new zebrafish protein and
hCYTFAOH is 65%. The homology between the heme binding region
itself of a protein of the present invention and another P450 could
well be 70%, 75%, 80%, 85%, 90%, 95% or even 100%.
[0016] A first aspect of the present invention is thus a purified
protein having the ability to oxidize a retinoid, and having an
amino acid sequence which is at least about 30% conserved in
relation to the amino acid sequence identified as SEQ ID NO:2 or
identified as SEQ ID NO:4 or identified as SEQ ID NO:32, or a
functionally equivalent homolog thereof. The amino acid sequence
identified as SEQ ID NO:2 is of the protein, termed here
"zP450RAI", obtained from zebrafish. The amino acid sequence of the
human protein is identified as SEQ ID NO:4 and the protein is
referred to herein as "hP450RAI". The sequence of the mouse protein
is identified as SEQ ID NO:32 and the protein is referred to herein
as mP450RAI.
[0017] Such a protein which is at least about 35% conserved in
relation to the amino acid sequence identified as SEQ ID NO:2
(zebrafish) or identified as SEQ ID NO:4 (human) or identified as
SEQ ID NO:32 (mouse), or a functionally equivalent homolog thereof,
also forms part of the invention disclosed herein. Likewise, the
degree of sequence conservation of a protein could be 40%, 45%,
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or of course 100%
of either SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:32 or a
functionally equivalent homolog thereof, variants being possible so
long as the ability of the native protein to oxidize a retinoid is
retained. Also within the scope of the invention is any such
protein which has the ability to hydroxylate retinoic acid at the 4
position of the .beta.-ionone ring. Of course, conservatively
substituted variants of proteins disclosed are within the scope of
the present invention.
[0018] A retinoid oxidized by a protein of the present invention
may be a retinoic acid or a retinol and the protein may have the
ability to oxidize the carbon occupying the 4-position of the
.beta.-ionone ring of the retinoid. In particular, all-trans
retinoids may be metabolized by proteins of the present
invention.
[0019] In the context of this specification, the term "conserved"
describes similarity between sequences. The degree of conservation
between two sequences can be determined by optimally aligning the
sequences for comparison, as is commonly known in the art, and
comparing a position in the first sequence with a corresponding
position in the second sequence. When the compared positions are
occupied by the same nucleotide or amino acid, as the case may be,
the two sequences are conserved at that position. The degree of
conservation between two sequences is often expressed, as it is
here, as a percentage representing the ratio of the number of
matching positions in the two sequences to the total number of
positions compared.
[0020] The generic term "retinoids" means a group of compounds
which includes retinoic acid, vitamin A (retinol) and a series of
natural and synthetic derivatives that can exert profound effects
on development and differentiation in a wide variety of systems.
For purposes of this disclosure "retinoid" is also intended to
encompass an equivalent thereof having the same functional
characteristics which may be produced, for example, by
computational chemistry.
[0021] In another aspect, the present invention is an isolated
nucleic acid molecule encoding a protein of the present
invention.
[0022] The present invention thus includes an isolated nucleic acid
molecule encoding a protein having an amino acid sequence which is
at least about 30% conserved in relation to the amino acid sequence
identified as SEQ ID NO:2 or identified as SEQ ID NO:4 or
identified as SEQ ID NO:32, or a functionally equivalent homolog
thereof, for example, or a nucleic acid strand capable of
hybridizing with the nucleic acid molecule under stringent
hybridization conditions. Of course, the degree of conservation of
the protein which the nucleic acid encodes can be higher, that is,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or
more.
[0023] Particularly, the invention is an isolated nucleic acid
molecule encoding a protein having the ability to oxidize a
retinoid at the carbon occupying the 4-position of the
.beta.-ionone ring of the retinoid ring, and more particularly,
having all-trans retinoic acid 4-hydroxylase activity. For the
purposes of this invention, the term "isolated" refers to a nucleic
acid that is substantially free of other cellular material or
culture medium when produced by recombinant DNA techniques, or
chemical precursors or other chemicals when produced by chemical
synthesis.
[0024] Cellular expression of preferred proteins of the present
invention, preferred embodiments being described in more detail
below, can for certain types of cells be induced by exposure of the
cells to a retinoid, particularly, retinoic acid. A protein of the
present invention, when described as being a "retinoic acid
inducible protein", is a protein normally encoded by DNA of a cell
and whose expression by that cell can be induced by exposure of the
cell to retinoic acid. It will be appreciated that not every cell,
even if it contains DNA encoding such a protein, possesses all the
attributes necessary to express the protein on exposure to RA.
[0025] Nucleotide sequences possessing promoter activity associated
with the proteins have also been isolated and identified by the
inventors. The human nucleotide sequence having promoter activity
is identified as SEQ ID NO:33. The murine nucleotide sequence
having promoter activity is identified as SEQ ID NO:34. The
zebrafish nucleotide sequence having promoter activity is
identified as SEQ ID NO:35.
[0026] In fact, the invention includes genomic sequences for the
human (SEQ ID Nos:36 and 37) and mouse (SEQ ID NO:38).
[0027] In another respect, the present invention is thus a
microbial cell containing and expressing heterologous DNA encoding
a retinoic acid inducible protein having all-trans retinoic acid
4-hydroxylase activity.
[0028] The sequence of a nucleic acid molecule of the present
invention can correspond to a part of a human genome or of a fish
genome or of a mouse genome, or vary therefrom due to the
degeneracy of the genetic code. More particularly, a nucleic acid
molecule of the present invention can be a DNA molecule having the
sequence identified as SEQ ID NO:3 (zP450RAI) or SEQ ID NO:5
(hP450RAI), or SEQ ID NO:31 (mP450RAI), or the sequence can be one
which varies from one of these sequences due to the degeneracy of
the genetic code, or it can be a nucleic acid strand capable of
hybridizing with at least one of these nucleic acid molecules under
high or low stringency hybridization conditions.
[0029] "Stringent hybridization conditions" takes on its common
meaning to a person skilled in the art here. Appropriate stringency
conditions which promote nucleic acid hybridization, for example,
6.times. sodium chloride/sodium citrate (SSC) at about 45.degree.
C. are known to those skilled in the art. The following examples
are found in Current Protocols in Molecular Biology, John Wiley
& Sons, NY (1989), 6.3.1-6.3.6: For 50 ml of a first suitable
hybridization solution, mix together 24 ml formamide, 12 ml
20.times.SSC, 0.5 ml 2 M Tris-HCl pH 7.6, 0.5 ml
100.times.Denhardt's solution, 2.5 ml deionized H.sub.2O, 10 ml 50%
dextran sulfate, and 0.5 ml 10% SDS. A second suitable
hybridization solution can be 1% crystalline BSA (fraction V), 1 mM
EDTA, 0.5 M Na.sub.2HPO.sub.4 pH 7.2, 7% SDS. The salt
concentration in the wash step can be selected from a low
stringency of about 2.times.SSC at 50.degree. C. to a high
stringency of about 0.2.times.SSC at 50.degree. C. Both of these
wash solutions may contain 0.1% SDS. In addition, the temperature
in the wash step can be increased from low stringency conditions at
room temperature, about 22.degree. C., to high stringency
conditions, at about 65.degree. C. The cited reference gives more
detail, but appropriate wash stringency depends on degree of
homology and length of probe. If homology is 100%, a high
temperature (65.degree. C. to 75.degree. C.) may be used. If
homology is low, lower wash temperatures must be used. However, if
the probe is very short (<100 bp), lower temperatures must be
used even with 100% homology. In general, one starts washing at low
temperatures (37.degree. C. to 40.degree. C.), and raises the
temperature by 3-5.degree. C. intervals until background is low
enough not to be a major factor in autoradiography.
[0030] Another aspect of this invention is isolated mRNA
transcribed from DNA having a sequence encoding a protein of the
present invention.
[0031] In another aspect, the present invention is isolated DNA
having a sequence according to a nucleotide sequence described
above operatively linked in a recombinant cloning vector. In the
context of this invention, the two-part term "operatively linked"
means both that the regulatory sequence contains sufficient
element(s) to allow expression of the nucleic acid in question and
that the nucleic acid is linked to the regulatory sequence
appropriately. For example, the nucleic acid of the invention is in
the appropriate orientation and in phase with an initiation codon.
The present invention thus includes a stably transfected cell line
which expresses a protein having the ability to hydroxylate
retinoic acid at the 4 position of the .beta.-ionone ring of
retinoic acid. The invention includes a culture of cells
transformed with a recombinant DNA molecule having a nucleic acid
sequence which encodes a protein having the ability to hydroxylate
retinoic acid at the 4 position of the .beta.-ionone ring of
retinoic acid.
[0032] Another aspect of the present invention is a host cell that
has been engineered genetically to produce a protein of the
invention described above, the cell having incorporated expressibly
therein heterologous DNA encoding said protein. The cell may be
selected such that production of the protein is inducible by
exposing the cell to a retinoid, preferably, retinoic acid. The
cell can be eukaryotic.
[0033] The present invention also includes a process for producing
an above-described protein of the invention. Such a process
includes: [0034] preparing a DNA fragment containing a nucleotide
sequence which encodes the protein; [0035] incorporating the DNA
fragment into an expression vector to obtain a recombinant DNA
molecule which contains the DNA fragment and is capable of
undergoing replication; [0036] transforming a host cell with the
recombinant DNA molecule to produce a transformant which can
express the protein; [0037] culturing the transformant to produce
the protein; and [0038] recovering the protein from resulting
cultured mixture.
[0039] The present invention includes an antibody to a protein of
the invention. Here, the term "antibody" is intended to include a
Fab fragment and it can be a monoclonal antibody. The antibody can
be specifically raised to the amino acid sequence identified as SEQ
ID NO:4, i.e., hP450RAI.
[0040] The present invention includes a purified protein for use in
metabolizing retinoic acid in an organism or cell in need of such
metabolizing. Likewise, the invention includes a method for
metabolizing retinoic acid in an organism or cell in need of
retinoic acid metabolizing wherein the method includes
administering a protein of the invention as described above.
[0041] The invention includes a method for inhibiting retinoic acid
hydroxylation in an organism in need of such inhibition, comprising
introducing into cells of the organism an effective amount of an
antisense RNA or oligonucleotide substantially complementary to at
least a portion of the sequence identified as SEQ ID NO:5. The
organism can be human and/or the organism can be in need of
treatment against a cancerous disease or a disease selected from
the group consisting of cancer, actinic keratosis, oral
leukoplakia, a secondary tumor of the head and/or neck, a non-small
cell lung carcinoma, a basal cell carcinoma, acute promyelocytic
leukemia, skin cancer, and a premalignancy associated actinic
keratosis, acne, psoriasis and/or ichthyosis. Such a method can
include use of at least one delivery vehicle or technique selected
from the set of viral vectors, microinjection, electroporation,
coprecipitation, liposomes, aerosol delivery and lavage. The
portion of the sequence may be 5 bases in length, between 5 and 50
bases in length, 5 and 30 bases in length between 10 and 20 bases
in length, or another suitable length may be found. The organism
may be a human patient and the method can include treating the
patient against a cancerous disease.
[0042] The invention also includes a method of inhibiting retinoic
acid hydroxylation in an organism in need of such inhibition by
administering to the organism an effective amount of an antibody,
such antibodies being described above. A particularly useful
antibody for the treatment of a human would be an antibody to the
protein having the amino acid sequence identified as SEQ ID NO:4,
or a portion thereof. It would be advantageous to adapt such an
antibody for administration to a human by "humanizing" the
antibody, as is understood by those skilled in the art [Hozumi,
1993].
[0043] The invention includes a method for producing a desired
protein, comprising providing a cell which can produce an
endogenous protein in response to exposure to a retinoid;
incorporating into DNA of the cell a DNA sequence encoding the
desired protein at or near a site which is normally occupied by a
DNA sequence encoding the endogenous protein; and exposing the cell
to the retinoid so as to induce production of the desired
protein.
[0044] In another embodiment, the present invention is a kit for
determining the presence of a protein having the ability to oxidize
a retinoid, and having an amino acid sequence which is at least
about 30% conserved in relation to the amino acid sequence
identified as SEQ ID NO:2 or identified as SEQ ID NO:32, or more
likely for determining the presence of a protein (or peptide
fragment thereof) having an amino acid sequence identified as SEQ
ID NO:4, the human protein. The kit includes an antibody to the
protein linked to a reporter system wherein the reporter system
produces a detectable response when a predetermined amount of the
protein and the antibody are bound together.
[0045] In another aspect, the present invention is a kit for
determining the presence of a nucleic acid encoding a protein of
invention, or having the sequence identified as SEQ ID NO:3 or SEQ
ID NO:5 or SEQ ID NO:31, or which varies from the sequence due to
the degeneracy of the genetic code, or a nucleic acid strand
capable of hybridizing with at least one said nucleic acid under
stringent hybridization conditions. The kit includes a nucleic acid
molecule capable of hybridizing with at least a portion of a said
nucleic acid or nucleic acid strand under stringent conditions in
which the nucleic acid molecule is linked to a reporter system
wherein the reporter system produces a detectable response when a
predetermined amount of the nucleic acid or nucleic acid strand and
nucleic acid molecule are hybridized with each other. The molecule
can be 5 bases in length or longer; between 5 and 50 bases in
length, between 5 and 30 or 40 bases in length, or between 10 and
20 bases in length. Of course it might be possible to find a more
suitable base length.
[0046] The present invention includes an isolated DNA molecule
having a nucleotide sequence selected from the group consisting
of:
[0047] (a) SEQ ID NO:33;
[0048] (b) SEQ ID NO:34;
[0049] (c) SEQ ID NO:35; and
[0050] (d) a fragment of (a), (b) or (c),
wherein the DNA molecule possesses promoter activity.
[0051] In a more particular aspect, the invention includes a DNA
molecule of one of the indicated sequences in which the DNA
molecule includes the sequence TGAACTNNNNNTGAACT, where "N" can be
any nucleotide and there can be 0 to 5 N (SEQ ID NO:39), wherein x
has a value of up to 5. This sequence is conserved in all three of
the nucleotide sequences identified as having promoter activity,
particularly where x is 5. Even more particularly, the invention
includes such a DNA molecule in which the sequence TCTGASSAAGKTAAC
SEQ ID NO:40 occurs downstream from the sequence TGAACTNNNNNTGAACT,
where "N" can be any nucleotide and there can be 0 to 5 N (SEQ ID
NO:39). Even more particularly, the sequence includes the sequence
AATT between the sequence TGAACTNNNNNTGAACT, where "N" can be any
nucleotide and there can be 0 to 5 N (SEQ ID NO:39) and the
sequence TCTGASSAAGKTAAC, the AATT having been found immediately
downstream of the sequence TGAACTNNNNNTGAACT, where "N" can be any
nucleotide and there can be 0 to 5 N (SEQ ID NO:39). It has been
observed that there can be up to six nucleotides between the
sequence TGAACTNNNNNTGAACT, where "N" can be any nucleotide and
there can be 0 to 5 N (SEQ ID NO:39) and the sequence
TCTGASSAAGKTAAC (SEQ ID NO:40). There can also be the sequence
CAATTAAAGA (SEQ ID NO:41) upstream of the sequence
TGAACTNNNNNTGAACT, where "N" can be any nucleotide and there can be
0 to 5 N (SEQ ID NO:39). In a particular aspect, the nucleotide
sequence having promoter activity includes the sequence
CAATTAAAGATGAACTTTGGGTGAACTAATT (SEQ ID NO:42) and the sequence
TATAA. Particularly, the sequence TATAA is downstream of the
sequence TGAACTNNNNNTGAACT, where "N" can be any nucleotide and
there can be 0 to 5 N (SEQ ID NO:39), and more particularly, the
sequence TATAA is downstream of the sequence. TCTGASSAAGKTAAC (SEQ
ID NO:40) and it can be spaced up to about 55 nucleotides
downstream from the sequence TGAACTNNNNNTGAACT, where "N" can be
any nucleotide and there can be 0 to 5 N (SEQ ID NO:39).
[0052] The invention includes a recombinant DNA having such a DNA
sequence having promoter activity. The recombinant DNA can also
include one or more structural genes. The structural gene(s) can
encode cytochrome P450 protein(s). The invention includes an
expression plasmid including such recombinant DNA and an isolated
cell containing the recombinant DNA. The cell is usually
eukaryotic.
[0053] The invention includes a process for the production of
recombinant protein(s), including steps of culturing a cell
according to the invention containing recombinant DNA and
recovering the protein(s) produced. The protein(s) can be a
cytochrome P450, but is not necessarily so. The protein(s) can be a
fusion protein.
[0054] The invention further includes a method of screening drugs
for their effect on activity of a retinoic acid inducible protein,
comprising exposing a purified said protein to a said drug and
determining the effect on the activity. The activity can be
hydroxylation of a retinoic acid, particularly all-trans retinoic
acid. In particular, the activity can be hydroxylation of a
retinoic acid, particularly all trans-retinoic acid, at the 4
position of the .beta.-ionone ring thereof.
[0055] The invention provides a method of screening drugs for their
effect on activity of any protein having P450RAI activity of the
present invention, particularly ascertaining the effect a potential
drug has on the oxidation of retinoic acid, specifically all-trans
retinoic acid.
[0056] In yet another aspect, the invention includes a method of
screening drugs for their effect on expression of a gene wherein
the gene is inducible by a retinoid, including the step of exposing
a recombinant DNA described above to a potential drug and
determining the effect on gene expression. This can include
exposing the recombinant DNA in the presence of a said retinoid.
The gene can be a reporter gene which does not metabolize retinoic
acid. The method can include ascertaining the effect on
transcription of the gene.
[0057] The invention includes a method of screening a drug for its
effect on the metabolism of a retinoid by a cytochrome P450 encoded
by a nucleotide sequence of the invention which is incorporated
into an expression system so as to be under control of a nucleotide
sequence having native promoter activity for a said cytochrome
P450, comprising: [0058] exposing the system to the drug in the
presence of the retinoid so as to determine the effect of the drug
on metabolism of the retinoid.
[0059] The retinoid can be retinoic acid and it can be all
trans-retinoic acid.
[0060] The invention includes any drug identified according to such
a method as having the effect of modulating, and preferably
reducing, the activity of a said protein or as having the effect of
modulating, and preferably reducing, gene expression.
[0061] The invention includes a method for inhibiting retinoic acid
metabolism in an organism in need of such inhibition, comprising
administering to the organism an effective amount of a drug
identified according to a method of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0062] FIG. 1 is a schematic representation of the steps involved
in the isolation of retinoid-regulated genes using the differential
display technique. The cloned products isolated in step 6 can then
be used for sequencing, Northern blotting or screening of cDNA
libraries. P1, P2 and P3 correspond to fragments from RA induced
mRNAs. P4 represents a PCR product from an mRNA which is
down-regulated.
[0063] FIG. 2(a) shows a polyacrylamide gel of PCR amplified mRNA
in duplicate obtained using retinoic acid-treated fish (lanes 1 and
2) and dimethyl sulfoxide (DMSO-) treated control fish (lanes 3 and
4). The arrow indicates a PCR amplified band present in the
RA-treated samples and not observed in the controls.
[0064] FIG. 2(b) shows the nucleotide sequence (SEQ ID NO:1) of the
337 base pair PCR product isolated from the band (arrow) of FIG.
2(a). The arrows indicate the nucleotide sequences where the
upstream and downstream priming sites for differential display PCR
amplification were located in the 3'-untranslated portion of
zP450RAI.
[0065] FIGS. 2c(i) and 2c(ii) show an amino acid sequence (SEQ ID
NO:2) corresponding to cDNA (492 amino acid open reading frame).
The boxed residues indicate the heme-binding motif characteristic
of cytochrome P450s.
[0066] FIG. 2(d) shows amino acid sequence comparisons between
zP450RAI and several other cytochrome P450s (SEQ ID Nos:
6,7,8,9,10) in the area of the conserved heme-binding motif found
in the superfamily. The cysteine, designated 0 in the figure, which
has been shown to be directly involved in heme-binding [Gotoh,
1989] is surrounded by several highly conserved amino acids.
[0067] FIG. 3(a) shows Northern blot analysis of mRNAs obtained
from regenerate tissue of RA-treated fish in lane 5, and controls
(DMSO-treated fish) in lane 4, using a zP450RAI cDNA probe.
Comparison to an RNA ladder (lane 1) shows the major zP450RAI
transcript to be in the 1.4-2.4 kb range.
[0068] FIG. 3(b) shows localization of zP450RAI transcripts in
regenerating caudal fin tissue 72 hours post-amputation by whole
mount in situ hybridization. (i) zP450RAI transcripts were found to
be undetectable in DMSO-treated regenerates. The original plane of
amputation is indicated by the white line with arrowhead; m (soft
mesenchyme) and r (bony rays) are labelled. (ii) In a sample
obtained from an RA-treated fish, zP450RAI transcripts, indicated
by the black arrowhead, were found to be localized to a band of
cells extending across the distal tip of the regenerate. Lower
levels of expression of zP450RAI were also evident in
non-regenerate tissue at the proximal base of the isolated fin, as
indicated by the black line with arrowhead. The plane of amputation
is indicated by the white line with arrowhead as in FIG. 3(b)(i).
(iii) A histological section taken through the plane is indicated
by the line. (iv) A histological section of RA-treated fins
post-hybridization is shown. Localized expression of zP450RAI was
detected in a subset of epithelial cells (black arrowhead) which
lie at the distal tip of the regenerate. Basement membrane
separating the dense blastemae and the wound epithelium is
indicated by the grey arrowhead.
[0069] FIG. 4 shows elution profiles of lipid soluble extracts
obtained from treated media of pSG5-zP450RAI transfected COS-1
cells and pSG5 transfected control cells. FIGS. 4(a) and 4(b) are
plots of cpm vs fraction number for cells incubated with 575 .mu.M
[11,12-.sup.3H]RA for 4 hours and 24 hours, respectively,
pSG5-zP450RAI COS-1 cells (-) and control cells (---). Metabolism
of [11,12-.sup.3H]-RA to total aqueous soluble metabolites (% of
total cpm) was measured using aliquots of the aqueous soluble
extract subjected to .beta.-scintillation counting. See insets of
FIGS. 4(a) and (b). FIGS. 4(c) and 4(d) are plots of absorbance vs
retention time for cells incubated with 1 .mu.M RA for 4 and 24
hours, respectively. Peaks observed in zP450RAI transfected cell
are shaded black. The region of the chromatogram from 4 to 6 min
has been expanded (see lower boxes of FIGS. 4(c) and (d)). In cells
transfected with zP450RAI cDNA, the generation of peaks
corresponding to 4-oxo RA and 4-OH RA was observed.
[0070] FIG. 5 shows results obtained with human cell lines probed
with a .alpha.-[.sup.32P]-dATP labeled probe having the sequence
identified as SEQ ID NO:11: HEK293; EL-E; HL-60; MCF10A; LC-T;
SK-LC6; and MCF7. (+) indicates pretreatment with 1 .mu.M RA and
(-) indicates no RA pretreatment. The blot was also probed with
hGAPDH to control for RNA loading of the gel, shown in the bottom
panel.
[0071] FIG. 6 is similar to FIG. 5 for the cell lines U937 and
HepG2.
[0072] FIG. 7 is similar to FIG. 5 for the NT2 cell line.
[0073] FIG. 8 is similar to FIG. 5 for a normal NB4 cell line
(first two lanes) and three individually derived retinoic acid
resistant NB4 derivative cell lines.
[0074] FIGS. 9a and 9b show the murine cDNA amino acid sequence
(top row, SEQ ID NO:32) aligned with the human P450RAI amino acid
sequence (middle row; SEQ ID NO:4) and the zebrafish cDNA amino
acid sequence (bottom row: SEQ ID NO:2).
[0075] FIG. 10(a) shows elution profiles of lipid soluble extracts
obtained from treated media of pSG5-hP450RAI transfected COS-1
cells and pSG5 transfected control cells. Plots of cpm vs fraction
number for cells incubated with [11,12-.sup.3H]RA for 24 hours of
pSG5-hP450RAI COS-1 cells (---) and control cells (-) are
shown.
[0076] FIG. 10(b) shows measurement of aliquots of the aqueous
soluble extract subjected to .beta.-scintillation counting taken to
determine metabolism of [11,12-.sup.3H]RA to total aqueous soluble
metabolites.
[0077] FIG. 10(c) shows plots of absorbance vs retention time for
hP450RAI transfected cell (---) and control cells (-) cells
incubated with 1 .mu.M RA for 24 hours. The inset is the region
around 10 minutes, expanded for clarity.
[0078] FIG. 11(a) shows 4-oxo-RA production of pSG5-hP450RAI
transfected COS-1 cells and pSG5 transfected control cells.
[0079] FIG. 11(b) shows 4-OH-RA production of pSG5-hP450RAI
transfected COS-1 cells and pSG5 transfected control cells.
[0080] FIG. 11(c) shows formation of aqueous soluble metabolites of
pSG5-hP450RAI transfected COS-1 cells and pSG5 transfected control
cells.
[0081] FIG. 11(d) shows unmetabolized RA of pSG5-hP450RAI
transfected COS-1 cells and pSG5 transfected control cells.
[0082] FIG. 12(a) shows elution profiles of lipid soluble extracts
obtained from media of MCF10A cells exposed to IRA and unexposed
MCF10A control cells. Plots of cpm vs fraction number for cells
incubated with [11,12-.sup.3H]RA for 24 hours of RA-induced MCF10A
cells (---) and control (-) are shown.
[0083] FIG. 12(b) shows elution profiles of lipid soluble extracts
obtained from treated media of MCF7 cells exposed to IRA and
unexposed MCF7 control cells. Plots of cpm vs fraction number for
cells incubated with [11,12-.sup.3h]RA for 24 hours of RA-induced
MCF7 cells (---) and control (-) are shown.
[0084] FIG. 12(c) shows the total aqueous soluble metabolites
measured using aliquots of the aqueous soluble extracts of the cell
lines described in FIGS. 12(a) and (b) subjected to
.beta.-scintillation counting. The first two bars are for unexposed
MCF7 cells and MCF7 cells exposed to RA, respectively. The third
and fourth bars are for unexposed MCF10A cells and MCF10A cells
exposed to RA, respectively.
[0085] FIG. 13(a) shows elution profiles of lipid soluble extracts
obtained from microsomal preparations after incubation with
radiolabelled RA for ninety minutes, as described in Example 7.
Plots of dpm vs fraction number for HeLa P microsomes
(.box-solid.,.DELTA.) and HeLa RAI microsomes
(.gradient.,.diamond-solid.).
[0086] FIG. 13(b) shows fractions 5 to 15 of FIG. 13(a) on a larger
scale.
[0087] FIG. 14(a) shows SDS-PAGE of the GST-hP450RAI fusion
protein. Lane 1 shows the whole cell lysate of E. coli expressing
the plasmid containing the fusion protein, without induction. Lane
2 shows the whole cell lysate of E. coli expressing the plasmid
containing the fusion protein after induction with 0.1 mM IPTG.
[0088] FIG. 14(b) shows SDS-PAGE of the purified GST-hP450RAI
fusion protein after induction with 0.1 mM IPTG, with molecular
weight markers at the right hand side indicating the fusion protein
to have a molecular weight of about 75 kDa.
[0089] FIG. 15 shows promoter sequences of human, mouse and
zebrafish P450RAI (SEQ ID NOs:33, 34 and 35, respectively). The
boxed regions show highly conserved regions while the arrows
indicate spaced apart consensus sequences of RAREs.
[0090] FIG. 16 shows relative luciferase activity induced in cells
containing a luciferase vector into which was cloned a portion of
the putative promoter for mP450RAI. Luciferase activity was
measured in cell extract supernatants from cells transfected with 3
concentrations of expression vectors comprising cDNAs encoding
RXR.alpha. and RAR.gamma. (100 ng, 500 ng, and 1 .mu.g) along with
a luciferase-based reporter gene including either the sense or
antisence promoter sequence, or no promoter sequence, grown in
presence and absence of RA.
[0091] FIG. 17 shows inhibition of P450RAI mRNA in MCF7 cells by
4-hydroxy-phenylretinamide (4-HPR). Cells were treated for twelve
hours with the indicated concentrations of all-trans retinoic acid
(atRA) and 4-HPR. Total RNA was extracted using TRIzol, and,
following electrophoresis, Northern blotting was performed as
described. The nitrocellulose was probed with radiolabelled P450RAI
then GAPDH.
[0092] FIG. 18 shows expression of cytochrome P450RAI in MCF7 cells
by northern blot analysis, over time, after administration of
all-trans retinoic acid.
[0093] FIG. 19 shows expression of cytochrome P450RAI in MCF7 cells
by northern blot analysis, over time, after administration of
all-trans retinoic acid alone, and in the presence of all-trans
retinoic acid and ketoconazole.
[0094] FIG. 20 shows expression of cytochrome P450RAI in MCF7 cells
by northern blot analysis, over time, after administration of
all-trans retinoic acid and after administration of Am580.
DESCRIPTION OF PREFERRED EMBODIMENTS
[0095] FIG. 1 outlines the steps used to isolate retinoid-regulated
genes using differential display of mRNA. The cloned products
isolated in step 6 of FIG. 1 were used for sequencing and screening
of Danio rerio (D. rerio) cDNA libraries. P1, P2 and P3 correspond
to fragments from RA induced mRNAs. P4 is a PCR product from a
down-regulated mRNA. Details of procedures followed in
determination of gene sequences described herein follow.
Danio rerio Stocks
[0096] D. rerio were kept at 28.5.degree. C. in 40 L tanks with
25-30 fish per tank on a 14 hour light-10 hour dark cycle. Tap
water was conditioned by the addition of 10 ml of Water Conditioner
(Sera Aqutan) and 10 ml of 250 g/L Aquarium Salt (Nutra Fin) per 20
L. 2-3 L of water was changed daily. Amputation of fins was carried
out following anaesthetization of the fish in a solution of 0.2%
ethyl-m-aminobenzoate methanesulfonic acid (ICN) in conditioned
water. Retinoic acid treatment was performed by adding all-trans
RA, to a final concentration of 10.sup.-6 M, directly into the tank
water two days following amputation. Both control- and RA-treated
fish were kept in the dark during the experiments.
Differential Display of mRNAs
[0097] Differential mRNA display was performed essentially as
described by Liang and Pardee (1992) with appropriate modifications
as described herein. Regenerating tissues were collected 3 days
post-amputation (24 hours post-RA addition) and quick frozen in
liquid nitrogen. Poly (A).sup.+ RNA was isolated using the Micro
Fast-Track kit. Duplicate independent reverse transcription
reactions were performed on the isolated poly(A).sup.+ RNA from
both the treated and untreated samples for each specific 3' poly-T
primer used (5'-T.sub.12VN-3'). The symbol "V" represents A or C or
G and not T or U. Several combinations of the 3' poly-T primers
given in the first column of Table 1 and the upstream primers given
in the second column were utilized for PCR amplification. For each
reaction 0.1 .mu.g poly(A).sup.+RNA was reverse transcribed in a 20
.mu.l reaction volume containing 300 U Superscript Reverse
Transcriptase (Gibco/BRL), 1.times. Buffer, 20 .mu.M each dGTP,
dATP, dCTP and dTTP, 10 .mu.M dithiothreitol (DTT) and 5 .mu.mol of
5'-T.sub.12VN-3' primer. The reactions were mixed and incubated at
35.degree. C. for 60 minutes, followed by 5 minutes at 95.degree.
C. PCR amplification was performed in a Perkin Elmer Cetus PCR
machine as follows: 1 .mu.l cDNA synthesis reaction, 5 U Taq DNA
polymerase (Gibco/BRL), 1.times.PCR Buffer, 2 .mu.M each dGTP,
dATP, dCTP and dTTP, 10 .mu.Ci .alpha.-[.sup.35S]dATP (redivue,
Amersham) 1.2 mM MgCl.sub.2, 0.5 .mu.M upstream primer and 0.5
.mu.M of the corresponding 5'-T.sub.12VN-3' primer. PCR conditions
were as follows: 1 cycle, 94.degree. C. for 5 minutes; 40 cycles,
94.degree. C. for 30 seconds, 42.degree. C. for 1 minute,
72.degree. C. for 30 seconds; followed by a final extension of 5
minutes at 72.degree. C. 4 .mu.l of the PCR reactions were loaded
onto a 6% non-denaturing polyacrylamide gel and electrophoresed at
60 watts, 45.degree. C. The gel was dried and exposed for 12 to 24
hours on Kodak XAR film at room temperature.
TABLE-US-00001 TABLE 1 Sequences of the downstream Poly (T)
oligonu- cleotides for the differential display procedure. 3'-
Poly(T) primers: 5'-degenerate primers: 5'-TTT TTT TTT TTT GG-3'
5'-AAG CGA CCG A-3' 5'-TTT TTT TTT TTT GA-3' 5'-TGT TCG CCA G-3'
5'-TTT TTT TTT TTT GT-3' 5'-TGC CAG TGG A-3' 5'-TTT TTT TTT TTT
GC-3' 5'-GGC TGC AAA C-3' 5'-TTT TTT TTT TTT AG-3' 5'-CCT AGC GTT
G-3' 5'-TTT TTT TTT TTT AA-3' 5'-TTT TTT TTT TTT AT-3' 5'-TTT TTT
TTT TTT AC-3' 5'-TTT TTT TTT TTT CG-3' 5'-TTT TTT TTT TTT CA-3'
5'-TTT TTT TTT TTT CT-3' 5'-TTT TTT TTT TTT CC-3'
[0098] In Table 1, the sequences in the first column are identified
as SEQ ID NOs: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 and 23,
respectively. The sequences in the second column are identified as
SEQ ID NOs: 24, 25, 26, 27 and 28, respectively.
Gel Purification and Reamplification
[0099] Bands demonstrating reproducible differential amplifications
(see FIG. 2a) were found for the upstream-downstream primer
combination of 5'-TGCCAGTGGA-3'-poly-T primer, 5'-TTT TTT TTT TTT
AG-3' (SEQ ID NOs: 26 and 16, respectively). These bands were
excised from the gel by overlaying the X-ray film and cutting out
the corresponding piece of dried gel and filter paper. The PCR
product corresponding to a fragment of the protein described herein
was isolated from the band in FIG. 2(a). Samples were placed in 100
.mu.l of nuclease free water, incubated for 10 minutes at room
temperature, then boiled for 15 minutes. The supernatant was
recovered following a 15 minute centrifugation at
12,000.times.g.
[0100] In order to facilitate cloning of the PCR products, several
changes were made to the reactions. Primers which included EagI
restriction endonuclease sites were used in the reamplification.
Based on results obtained in the differential display analysis, the
upstream 5'-TGCCAGTGGA-3' primer was replaced by
5'-GTAGCGGCCGCTGCCAGTGGA-3' (SEQ ID NO: 29) and the downstream
poly-T primer, 5'-TTT TTT TTT TTT AG-3', was replaced by
5'-GTAGCGGCCGCT.sub.12-3' (SEQ ID NO:30). In addition, the reaction
volume was increased to 40 .mu.l, isotope was omitted and 20 as
opposed to 40 cycles were performed. 5 .mu.l aliquots of the PCR
reactions were removed and the products were visualized by
electrophoresis in a 1% agarose gel followed by ethidium bromide
staining and UV illumination.
Cloning PCR Products
[0101] The reamplified products were purified by phenol/chloroform
extraction followed by ethanol precipitation. The resulting DNA
pellet was resuspended in 17 .mu.l of sterile water and digested at
37.degree. C. for 1 hour by the inclusion of 10 U EagI (New England
Biolabs), and 1.times.NEB 3 buffer. EagI restriction endonuclease
was heat inactivated by incubation at 65.degree. C. for 20 minutes.
pBluescript SK.sup.+ vector was prepared by digestion with EagI,
followed by dephosphorylation using calf intestinal alkaline
phosphatase (CAP, Promega). Restriction digests were purified using
the GeneClean II Kit (Bio 101) following electrophoresis in a 1%
agarose gel. In a total ligation volume of 10 .mu.l, 2 .mu.l of
digested PCR product, 1 .mu.l digested SK.sup.+, 1 U T4 DNA ligase
(Gibco/BRL) and 1.times. buffer were incubated at 16.degree. C.
overnight. E. coli bacterial strain JM109 was transformed with 1
.mu.l of the ligation product using a BioRad Gene Pulser, then
plated on LB+ampicillin plates and incubated overnight at
37.degree. C.
Colony Selection
[0102] Individual colonies were transferred in duplicate to fresh
LB plates and grown overnight at 37.degree. C. Colonies were
transferred to nitrocellulose membrane and denatured in a solution
of 1.5M NaCl, 0.5M NaOH for 5 minutes, neutralized in 1.5M NaCl,
0.5M Tris-HCl, pH 8.0 for 5 minutes, followed by two 5 minute
washes in 2.times.SSC. Membranes were then UV cross-linked
(Stratalinker UV Crosslinker, Stratagene). Prehybridization and
hybridization were performed using Quickhyb (Stratagene) following
the manufacturer's directions. Each colony lift was probed with the
corresponding PCR product isolated during the gel reamplification
and purification step. .alpha.-[.sup.32P]-dATP labelled probes were
generated using the Prime-It Kit II (Stratagene). Subsequent to
hybridization, filters were washed twice for 20 minutes in
2.times.SSC, 0.1% SDS solution at room temperature and exposed to
Kodak X-omat autoradiography film overnight at -70.degree. C.
Positive colonies were selected from the duplicate plates, grown
overnight in LB+ampicillin (100 .mu.g/ml) and plasmid DNA isolated
using the Qiaprep Spin Plasmid Kit (Qiagen).
[0103] Clones were sequenced using the T7 Sequencing Kit (Pharmacia
Biotech). Sequence comparisons were generated using the GeneWorks
software package (Intelligenetics).
Screening of a D. rerio cDNA Library
[0104] A random primed D. rerio 6-18 hour embryo cDNA library
constructed in Uni-ZAP II (Stratagene) was produced.
4.5.times.10.sup.5 independent pfu were screened using the random
primed, .alpha.-[.sup.32P]-dATP labelled 337 by PCR fragment
isolated by mRNA differential display as a probe. Filters were
prehybridized for 1-4 hours at 42.degree. C. in 50% formamide,
5.times.SSPE, 1.times.Denhardt's solution, 0.2 mg/ml denatured
salmon sperm DNA. Hybridization was performed at 42.degree. C. by
adding denatured probe to the prehybridization solution. Filters
were washed two times for 20 minutes in 2.times.SSC, 0.05% SDS at
room temperature and exposed to Kodak XAR film overnight at
-70.degree. C. Positive plaques were picked into 500 .mu.l SM
buffer and subjected to additional rounds of rescreening until
purified. Positive plaques were exposed to the in vivo excision
protocol following the manufacturer's directions (Stratagene).
pBluescript containing colonies were plated onto LB+amp plates and
grown overnight at 37.degree. C. Sequence data were generated using
the T7 Sequencing Kit (Pharmacia) and analysed using the GeneWorks
software package (Intelligenetics).
Whole Mount In Situ Hybridization
[0105] RA- and DMSO-treated regenerates were isolated 72 hours
post-amputation (24 hours post RA/DMSO addition), washed in PBS and
prepared for whole mount in situ hybridization. In situ
hybridizations were undertaken as previously described [White,
1994].
Northern Blot Analysis
[0106] Fish were allowed to regenerate their caudal fins for 72
hours. At 48 hours 10.sup.-6M all-trans RA in DMSO vehicle or DMSO
alone was added directly to the tank water. mRNA was prepared using
the Micro Fast-Track mRNA isolation kit (Invitrogen, CA) according
to the manufacturer's directions. 3.0-5.0 .mu.g poly A.sup.+ RNA
was electrophoresed, blotted and probed using a previously
described method [White, 1994] with the full length zP450RAI cDNA
obtained as described below. Ethidium bromide stained agarose gel
showed that equivalent amounts of mRNA were used in the blotting
experiments. See lanes 2 and 3 of FIG. 3(a).
HPLC Analysis
[0107] Media from transfected cells incubated with 575 pM
[11,12-.sup.3H]RA (FIGS. 4(a) and 4(b)) or 1 .mu.M RA (FIGS. 4(c)
and 4(d)) for either 4 hrs (FIGS. 4(a) and 4(c)) or 24 hrs (FIGS.
4(b) and 4(d)) were acidified with 0.1% acetic acid. Lipid soluble
metabolites were separated from aqueous soluble metabolites using a
total lipid extraction of the medium [Bligh, 1957]. Metabolism of
[11,12-.sup.3H]RA to total aqueous soluble metabolites was measured
using aliquots of the aqueous soluble extract subjected to
.beta.-scintillation counting (See the insets of FIGS. 4(a) and
4(b)). Lipid soluble extracts were evaporated to dryness under a
stream of nitrogen and resuspended in 93.5/5/1/0.5
hexane/isopropanol/methanol/acetic acid (H/I/M/AA). Metabolites
were separated by HPLC using a Zorbax-SIL (3.mu., 8.times.0.62 cm)
column eluted with a solvent system of 93.5/5/1/0.5H/I/M/AA at a
flow rate of 1 ml/min.
Example 1
Characterization of a Novel Cytochrome P450
[0108] Transcripts present in fin tissue regenerating in the
presence or absence of RA were compared using the differential
display PCR technique developed by Liang and Pardee [Liang, 1992]
(FIG. 2(a). One of the differential display products which
exhibited a dependence on the presence of RA for its expression,
indicated by the arrow in FIG. 2(a), was isolated and sequenced.
The sequence is identified as SEQ ID NO:1 and is also shown in FIG.
2(b). The amino acid sequence corresponding to the cDNA, termed
here, "zP450RAI", is shown in FIG. 2(c) and identified as SEQ ID
NO:2. BLAST search analyses revealed sequence homology between
zP450RAI and multiple members of the cytochrome P450 superfamily.
Alignments between zP450RAI cDNA deduced amino acid sequence and
those of other cytochrome P450s indicated that zP450RAI exhibited
less than 30% overall amino acid identity with members of
previously defined subfamilies [Nelson, 1993]. zP450RAI contains
many of the structural motifs which are common to cytochrome P450
family members, including the heme-binding domain located in the
C-terminal portion of the protein. See FIG. 2(d). The P450RAI
family has been designated "CYP26".
Example 2
Cell Specific Induction of zP450RAI by All-Trans RA
[0109] Northern blot analysis of mRNAs expressed in regenerate
tissue isolated from control (dimethyl sulfoxide-treated) and
RA-treated fish was performed with a full-length zP450RAI cDNA
probe. zP450RAI transcripts were not detectable in regenerate
tissue from control fish (FIG. 3(a), lane 4) but were very
noticeably present in tissues isolated from fish exposed to RA for
24 hours (FIG. 3(a), lane 5).
[0110] Whole mount in situ hybridization was used to determine the
cellular localization of zP450RAI expression in regenerating fin
tissue. FIG. 3(b) shows regenerating fins from control and
RA-treated fish. zP450RAI transcripts are not detectable in control
fin tissue (FIG. 3(b)(i)). In regenerating tissue from RA-treated
fish, zP450RAI transcripts were found to be abundant in a layer of
epithelial cells extending across the distal edge of the wound
epithelium as indicated by the black arrowhead in FIG. 3(b)(ii).
Some low level staining was also observed in inter-ray tissue as
indicated by the black line with arrowhead in FIG. 3(b)(ii). A
histological section of an RA-treated fin, taken along the line
shown in FIG. 3(b)(iii), is shown in FIG. 3(b)(iv). The section
indicates that cells expressing zP450RAI are located deep within
the epithelial layer at the distal tip of the blastemal mesenchyme.
Whole mount in situ hybridization thus illustrates the usefulness
of nucleic acid probes of the invention for the localization of
cytochrome P450RAI mRNA in whole tissue.
Example 3
Metabolism of All-Trans RA by zP450RAI Transfected Cells
[0111] Retinoic acid as a substrate of zP450RAI was studied. The
full-length zebrafish zP450RAI cDNA was cloned into the eukaryotic
expression vector pSG5 [Green, 1988]. COS-1 cells were transiently
transfected with either pSG5 or pSG5-zP450RAI and then incubated
with either picomolar concentrations of [11,12-.sup.3H]all-trans-RA
or micromolar concentrations of non-radioactive all-trans-RA. COS-1
cells are an African green monkey kidney "fibroblast-like" cell
line. zP450RAI expression in COS-1 cells promoted the rapid
conversion of RA into both lipid- and aqueous-soluble metabolites.
See FIGS. 4(a) and 4(b). Fractions of total lipid extracts of
transfected cells were initially separated by normal-phase HPLC on
Zorbax-SIL. Comparison between extracts from pSG5 and
pSG5-zP450RAI-transfected cells indicated that zP450RAI
significantly increased RA metabolism. Incubation of
zP450RAI-transfected cells with 575 .mu.M
[11,12-.sup.3H]all-trans-RA for either 4 or 24 hours resulted in
accumulation of RA metabolites, one of which co-migrated on a
column with synthetic standards 4-OH-RA and 18-OH-RA, and a second
slightly less polar metabolite which co-migrated with 4-oxo-RA
standard (FIGS. 4(a) and 4(b)). Rechromatography of RA metabolites
using other HPLC systems confirmed the identity of these two
metabolites as 4-OH-RA and 4-oxo-RA (Table 2). It is possible that
the aqueous-soluble radioactivity represents glucuronides of RA
metabolites or glucuronides of RA itself. Rapid glucuronidation of
4- and 18-hydroxy-RA in mammalian cell extracts has been reported
by others [Wouters, 1992; Takatsuka, 1996].
TABLE-US-00002 TABLE 2 Chromatographic properties of RA
metabolites. Retention Time (min) Metabolite Z-Sil.sup.a Z-CN.sup.b
Z-ODS.sup.c RA (std) 2.57 4.47 19.92 4-oxo-RA (std) 4.79 11.33
11.73 4-OH-RA (std) 5.17 9.65 12.65 18-OH-RA (std) 5.06 9.53 14.03
Peak 1 (RA) 2.57 4.48 19.73 Peak 2 (4-oxo-RA) 4.87 11.38 11.57 Peak
3 (4-OH-RA) 5.16 9.68 12.68 .sup.aHPLC conditions: Zorbax-SIL
column eluted with 93.5/5/1/0.5 H/I/M/A.A. (1 ml/min) .sup.bHPLC
conditions: Zorbax-CN column eluted with 93.5/5/1/0.5 H/I/M/A.A (1
ml/min) .sup.cHPLC conditions: Zorbax-ODS column eluted with a 20
min linear gradient with solvent containing 10 mM ammonium acetate
which ranged from 55.45 to 5.95 H.sub.2O/MeOH (2 ml/min).
[0112] A similar pattern of zP450RAI-dependent metabolism was also
observed using a much higher RA concentration (1 .mu.M).
zP450RAI-transfected COS-1 cells incubated for 4 or 24 hours with 1
.mu.M RA generated two closely-running peaks which were discernible
in a 350 nm HPLC trace shown in FIGS. 4(c) and 4(d), but which were
essentially undetectable in control pSG5-transfected cells (See the
insets of FIGS. 4(c) and 4(d)). These peaks co-migrated with those
of 4-oxo-RA and 4-OH-RA standards, respectively. Diode array
spectrophotometric detection of the zP450RAI-generated peaks showed
that the spectral properties of the two metabolite peaks matched
the standard retinoids [In hexane-based solvents: 4-OH-RA,
.lamda..sub.max=350 nm; 4-oxo-RA, .lamda..sub.max=355 nm; in
methanol-based solvents: 4-OH-RA, .lamda..sub.nax=340 nm; 4-oxo-RA,
.lamda..sub.max=360 nm].
[0113] The invention thus includes a retinoic acid metabolizing
protein belonging to the family of cytochrome P450s, designated
CYP26, and generation of the protein in zebrafish caudal fin wound
epithelium being induced in response to RA treatment. While RA
metabolizing activity has previously been detected in epithelial
tissues of several species [Frolik, 1979; Roberts, 1979; Wouters,
1992; Duell, 1992], an actual enzyme responsible for such activity
has heretofore been unknown.
[0114] zP450RAI is up-regulated by RA treatment and apparently this
up-regulation occurs in a specific set of cells in the wound
epithelium of regenerating zebrafish caudal fins.
[0115] It might be of relevance to the regulation of the generation
of this enzyme in vivo that experiments with F9 cells where RARs
have been selectively ablated indicate that RAR-.alpha. and
RAR-.gamma. might have a role in the regulation of RA metabolism
[Boylan, 1995]. The expression of both RAR-.alpha. and RAR-.gamma.
in the regenerating caudal fin is consistent with the suggestion
that they may be involved in the regulation of P450RAI expression
by RA [White, 1994].
Example 4
Cloning of Human P450RAI
[0116] The amino acid sequence corresponding to the DNA of
zebrafish P450RAI (zP450RAI) (SEQ ID NO:2) was used to search an
express sequence tag (EST) database. A commercially available EST
clone (SEQ ID NO:11) having a high degree of homology with a
C-terminal portion of the zP450RAI (from Glu 292 to Phe 410 of SEQ
ID NO:2) was purchased (Research Genetics, Huntsville, Ala.). The
clone is reportedly from a human infant brain cDNA library (Bento
Soares and M. Fatima Bonaldo) and is apparently otherwise
unpublished. The purchased clone was sequenced using the T7
sequencing kit (Pharmacia) and sequence data was generated using
the Geneworks Software Package (Intelligenetics).
[0117] A cDNA library generated from an NT2 cell line treated with
retinoic acid is commercially available (Stratagene, cat#939231)
and this product was used for further studies. The cDNA library was
probed with a nucleic acid having a sequence identified as SEQ ID
NO:11. Eleven positively hybridizing clones were isolated and
purified according to the manufacturer's directions. Sequence data
for these clones were generated using the 17 Sequencing Kit
(Pharmacia) and analyzed using the Geneworks package
(Intelligenetics). The human DNA sequence is identified as SEQ ID
NO:5 and the corresponding polypeptide as SEQ ID NO:4.
Example 5
Isolating Mouse P450RAI
[0118] It has been found by the present inventors (results not
shown) that RA can induce mRNA transcripts which cross hybridize
with a hP450RAI cDNA probe in either of the F9 and P19 mouse cell
lines having 4-hydroxylase activity, as described by Blumberg et
al. [Blumberg et al., 1995; Achkar et al., 1996].
[0119] A retinoic acid-treated P19 teratocarcinoma cDNA library in
lambda Unizap XR (Stratagene) was screened using .sup.32P-labelled
full length human P450RAI as a probe. Nitrocellulose filters were
hybridized overnight at 37.degree. C. in a buffer containing 50%
formamide, Denhardt's, 5.times.SSPE, 0.1% SDS, and 100 .mu.g/ml
boiled salmon sperm DNA, and washed in 2.times.SSC, 0.1% SDS for
2.times.15 minutes at room temperature followed by 20 minutes at
37.degree. C. From a total of 600,000 plaque forming units of
phage, 72 positives were isolated. Of these, 18 were purified, as
described above, and one was found to have a full-length cDNA
insert 1.7 kb in length homologous to the full-length human clone
previously isolated. The murine DNA sequence is identified as SEQ
ID NO:31 and the corresponding polypeptide as SEQ ID NO:32. FIG. 9
shows aligned portions of the amino acid sequence of the mouse
protein (SEQ ID NO:32) with those of the human protein (SEQ ID
NO:4) and the zebrafish protein (SEQ ID NO:2).
Example 6
Transient Transfection Analysis
[0120] COS-1 cells were subcultured 20 hours prior to transfection
which was carried out according to the standard DEAE-dextran method
[Sambrook, 1989; Maniatis, 1982]. Cells were transfected with pE-AR
(adrenodoxin expression vector, 1 .mu.g/P100 plate) and pE-ADX
(adrenodoxin reductase expression vector, 1 .mu.g/P100 plate)
together with 3 .mu.g per plate of either pSG5 (control) or
hP450RAI-pSG5 (experimental). [11,12-.sup.3H]all-trans retinoic
acid (60,000 cpm per plate) was added 24 hours after transfection.
Analyses were carried out as described in Example 3 and results
obtained are shown in FIGS. 10 and 11(a) to 11(d). As indicated in
the Figures, hP450RAI expression in COS-1 cells promoted conversion
of RA into 4-OH-RA and 4-oxo-RA. Total amounts of 4-oxo-RA and
4-OH-RA produced in the transfected cells in comparison to amounts
produced in the control cells are shown in FIGS. 11(a) and (b),
respectively. Overall, greater amounts of aqueous soluble
metabolites were produced in the transfected cells (FIG. 11(c)) and
greater amounts of unmetabolized RA were found in control cells
(FIG. 11(d)).
[0121] The clone sequence (SEQ ID NO:11) was prepared as a
.sup.32[P]-dATP labeled probe to study the inducibility of hP450RAI
by RA in several cell lines: HEK293; EL-E; HL-60; MCF10A; LC-T;
SK-LC6; MCF7; U937; HepG2; NT2 (See FIGS. 5 to 7). As can be seen,
a variety of expression patterns were observed. The SK-LC6 human
lung (epithelial) line appeared to constitutively express
corresponding mRNA. There was apparently some increase in
expression in the HEK293 (human embryonic kidney), LC-T (human lung
epithelial), HepG2 (human liver, epithelial in morphology), NT2
(pluripotent human embryonic carcinoma) and U937 (human
monomyelocytes) cell lines in response to addition of RA. There was
a large dependence on exposure to RA in the MCF7 (human breast
carcinoma (epithelial)) cell line. Some cell lines showed no
expression in the absence or presence of RA: EL-E; HL-60 and
MCF10A.
[0122] The .sup.32[P]-dATP labeled probe was also used to study
hP450RAI mRNA expression in a human acute promyelocytic leukemia
cell line. Experiments were carried out using the NB4 cell line,
isolated from a human acute promyelocytic leukemia patient, and
three retinoic acid resistant cell lines were independently derived
from NB4. Results are shown in FIG. 8. As can be seen, the normal
cells expressed hP450RAI mRNA after treatment with 10.sup.-6M RA,
while such expression appeared to be absent for the other cell
lines both in the absence and presence of RA.
[0123] Analysis of metabolites of MCF10A and MCF7 cell lines
exposed to RA was carried out, MCF10A cells having displayed no
expression of mRNA and latter having displayed a large dependence
of mRNA expression on exposure to RA. The results are shown in
FIGS. 12(a) to 12(c). Consistent with the results shown in FIG. 5,
the results shown in FIG. 12(a) indicate there was little
difference in the lipid soluble activity profiles of the MCF10A
cell line exposed to RA and the control. The last two bars of FIG.
12(c) indicate that total aqueous soluble metabolites were about
the same for both the induced and control MCF10A cells. As
indicated in FIG. 12(b), the MCF7 cell line exposed to RA had an
elution profile which indicated significantly greater
concentrations of 4-OH-RA and 4-oxo-RA than the same cell line not
exposed to RA. FIG. 12(c) indicates that the amount of total
aqueous soluble metabolites of the MCF7 cells exposed to RA was
much greater than that for the control cells. Again, these results
are consistent with those obtained in the Northern blot analysis
shown in FIG. 5 for the MCF7 cell line.
Example 7
Generation of a Stable Cell Line Using Human P450RAI
Hela Cells Expressing Sense Construct
[0124] For expression in HeLa cells, the human cytochrome P450RAI
cDNA (SEQ ID NO:5) was inserted into the XhoI-NotI sites of the
multiple cloning site of the Epstein-Barr virus-based vector pCEBV7
[Wilson, 1995]. Stable transfection was performed via the calcium
phosphate method [Sambrook, 1989]. Prior to the day of
transfection, HeLa cells were seeded at 3.0.times.10.sup.6 cells
per 100 mm plate. Approximately 12 .mu.g of DNA were transfected
per plate and triplicate plates were employed for the transfection.
Selection using hygromycin B began three days after the
transfection and continued for approximately three weeks until the
development of foci on the plates. The concentration of hygromycin
B (100 .mu.g/ml) was chosen for selection of cells with high
expression of the construct. A killing curve was determined prior
to selection which showed that 50 .mu.g/ml of hygromycin was
sufficient to kill 50% of the cells in 4 days. Confirmation of the
selected HeLa cells expressing the sense construct was determined
by Northern blot analysis and probing with full length hP450RAI
cDNA (data not shown).
[0125] Microsomes were prepared from HeLa cells transfected with
the pCEBV7 alone (HeLa P) or from the HeLa cells expressing the
P450RAI (HeLa RAI) and exposed to radiolabelled RA for ninety
minutes. The results are shown in FIGS. 13(a) and 13(b), in which
it can be seen that when microsomes prepared from these cells are
incubated with RA, only those from HeLa RAI showed any conversion
of retinoic acid to 4-hydroxy-retinoic acid or 4-oxo-retinoic
acid.
Example 8
Expressing a Fusion Protein Containing Human P450RAI
[0126] The cDNA of hP450RAI was inserted into the GST gene fusion
vector, pGEX3X using the Sma1 site. The construct generated lacked
177 by of the N-terminal portion of the hP450RAI cDNA, which
encodes a hydrophobic region characteristic of a signal sequence.
E. coli (JM109) cells were used for expression of vectors and
construct. After screening for positive colonies expressing the
construct in the proper orientation, expression of the fusion
protein was carried out according to the manual provided by
Pharmacia.
[0127] GST-hP450RAI fusion protein was generated via
electroporation of E. coli (JM109) cells with the construct,
followed by induction of gene expression. Expression of the fusion
protein is under the control of the tac promoter which is inducible
by the lactose analog, isopropylbeta-thiogalactoside (IPTG).
[0128] Cultures were grown overnight in LB-ampicillin broth. The
following day, approximately 1:100 dilution factor of the overnight
culture was transferred to a fresh tube containing LB-ampicillin
broth. The culture was allowed to grow for three hours and induced
with IPTG to a final concentration of 0.1 mM for an additional 2.5
hours. After induction, the culture was centrifuged at
7,700.times.g for 10 minutes at 4.degree. C. to sediment the cells.
The pellet was resuspended in a ratio of 50 .mu.l of culture/ml of
ice-cold 1.times.PBS. The cells were lysed with a sonicator at 30
second intervals while submerged in ice-water. Triton X-100 was
added to the lysed cells to a final concentration of 1% and the
mixture was incubated for 30 minutes at 4.degree. C. to allow
solubilization. The suspension was subjected to centrifugation at
12,000.times.g for 10 minutes at 4.degree. C.
[0129] Binding of the GST portion of the fusion protein to
glutathione beads was used to purify the protein. 2 ml of a 50%
slurry of reduced glutathione beads equilibrated with 1.times.PBS
were used per 100 ml of sonicate mixture from above. After the
addition of the beads, the material was gently agitated for 30
minutes at room temperature to allow binding of the fusion protein
to the beads. The suspension was centrifuged at 500.times.g for 5
minutes to separate glutathione beads with bound fusion protein
from other cellular components. The glutathione beads were washed
three times with cold PBS to remove non-specifically bound
material.
[0130] The fusion protein was eluted from the glutathione beads
using an elution buffer containing reduced glutathione.
Approximately 1.0 ml of glutathione elution buffer per 100 ml of
sonicate suspension was used. The bound glutathione beads were
allowed to mix at room temperature for 10 minutes to elute the
fusion protein. Centrifugation of the eluted beads was performed at
500.times.g for 5 minutes. Both the elution and centrifugation were
performed three times. FIGS. 14(a) and (b) show the results of
SDS-PAGE of the GST-hP450RAI fusion protein.
[0131] It is generally possible to carry out some functional tests
with the GST protein covalently attached to the protein of
interest, but removal is preferred for the production of
antibodies. The GST-hP450RAI fusion protein contains a site
recognized by factor Xa. Treatment of the eluted fusion protein
with factor Xa yields both the GST protein and hP450RAI protein.
Alternatively, it is possible to cleave the fusion protein prior to
its elution from the beads, but inadequate cleavage many occur.
Approximately 10 .mu.g of factor Xa/mg of fusion protein is used.
The material is mixed gently and incubated for approximately 2-16
hours at room temperature. Completion of digestion is checked by
gel eletrophoresis at various time points. To purify the protein of
interest from the GST protein, binding of cleaved fusion protein
suspension with glutathione beads is carried out, followed by
centrifugation. The protein of interest remains in the
supernatant.
[0132] The GST fusion protein can be assayed immunologically or
biochemically. Biochemically, treatment of the GST fusion protein
with the GST substrate, 1-chloro-2,4-dinitrobenzene (CDNB),
indicates the amount of the fusion protein. The GST protein
catalyzes the conjugation of CDNB with glutathione, resulting in a
CDNB-glutathione product with a strong molar absorptivity at 340
nm. Immunologically, a Western blot of the fusion protein can be
probed with an anti-GST antibody which can be readily detected
using a secondary antibody such as an anti-goat IgG alkaline
phosphatase conjugate, and the standard colorimetric reaction.
Example 9
Mapping of Human P450RAI
[0133] A 1.3 kb cDNA of hP450RAI was mapped using a P-1 derived
artificial chromosome (PAC) library. Mapping of the cDNA and
genomic PAC clone was performed by fluorescence in situ
hybridization [Lichter, 1990] to normal human lymphocyte
chromosomes counterstained with propidium iodide and DAPI.
Biotinylated probe was detected with avidin-fluorescein
isothiocyanate (FITC). Images of metaphase preparations were
captured by a thermoelectrically cooled charge coupled camera
(Photometrics, Tucson, Ariz.). Separate images of DAPI banded
chromosomes [Heng, 1993] and FITC targeted chromosomes were
obtained. Hybridization signals were acquired and merged using
image analysis software and pseudo colored blue (DAPI) and yellow
(FTIC) [Boyle, 1992] and overlaid electronically.
[0134] Positive hybridization signals were found to be localized to
10q23-24. The band assignment was determined by measuring the
fractional chromosome length and by analyzing the banding pattern
generated by the DAPI counterstained image.
Example 10
Regulation of P450RAI transcription--Cloning of P450RAI
Promoters
[0135] Cloning of Zebrafish P450RAI promoter. An adult zebrafish
genomic library (1.0.times.10.sup.6 pfu) was screened with the full
length cDNA corresponding to zP450RAI and positive plaques purified
through secondary and tertiary screening. Lambda DNA corresponding
to positive plaques was prepared, and the inserts from these clones
were excised by restriction enzyme digestion with NotI and
subcloned into the plasmid SK+ (Stratagene). Genomic clones were
analyzed by restriction enzyme digestion using enzymes from the
polylinker of SK+, followed by Southern blotting using an
oligonucleotide (5'-GTAGCACGGATGGTG-3') (SEQ ID NO:43) which
hybridizes to the nucleotide sequence encoding the N-terminus of
the zP450RAI cDNA to identify fragments of the genomic clones which
encode the N-terminal region. A 772 base pair PstI fragment which
hybridized with the oligonucleotide probe was purified, ligated
into the vector SK+ and sequenced using the Core Facility for
Protein/DNA Chemistry at Queen's University, Kingston, Canada.
Sequence analysis identified this clone as containing the putative
initial methionine followed by 129 base pairs of coding sequence,
plus 651 nucleotides upstream (5'). Within this 772 base pair
fragment, a 402 base pair HindIII fragment was found to contain the
putative retinoic acid response element (RARE). This fragment was
subcloned into the pGL3B luciferase vector, in both the forward and
reverse orientations, (Promega) for transient transfection
analyses.
[0136] Cloning Human P450RAI promoter. The full length hP450RAI
cDNA was used as a probe to identify PAC (P1 artificial chromosome)
clones which contain the hP450RAI gene. cDNA from hP450RAI was sent
to Canadian Genome Analysis and Technology Program at the Hospital
for Sick Children in Toronto, Ontario, Canada for screening of PAC
libraries. 5 PAC clones were obtained from this screening, which
were verified to contain the hP450RAI gene by restriction enzyme
digestion and Southern blotting using the full length hP450RAI cDNA
as a probe. One of these clones, 245C7, was found to hybridize to
an N-terminal probe from hP450RAI. The probe used was an
approximately 130 by NotI fragment generated from the hP450RAI
cDNA. Digestion and Southern blotting of clone 245C7 identified an
approximately 3.5 Kb BamHI fragment which hybridized with the NotI
fragment. This fragment was subcloned into the plasmid SK+ and
sequence data generated at the Core Facility for Protein/DNA
Chemistry at Queen's University, Kingston, Canada. Comparison of
the sequence data generated with the hP450RAI cDNA identified this
3.5 Kb clone as containing the potential initial methionine and
approximately 675 by upstream (5').
[0137] Cloning of mouse P450RAI promoter. A clone of mouse P450RAI
genomic DNA approximately 17 kb long was isolated from an SV129
.lamda.DASH library and subcloned into SK. DNA prepared from this
plasmid was digested with various restriction endonucleases,
electrophoresed on an agarose gel, and Southern blotted onto
nitrocellulose. The resulting blot was hybridized with a
.sup.32P-labelled 230 base pair probe from the N-terminal region of
a mouse P450RAI cDNA clone. A SacI fragment approximately 520 base
pairs in length was found to hybridize strongly to the probe. This
fragment was subcloned into SK cleaved with SacI. Sequence analysis
revealed the presence of a DR5-type RARE in the proximal promoter.
Flanking this RARE were two BssHII sites 193 base pairs apart. This
193 base pair BssHII fragment was subcloned into the MluI site of
pGL3B. Diagnostic restriction digests with XhoI were done to
isolate clones with the BssHII fragments in both forward and
reverse orientations. Within the 193 base pair fragment is also
found the TATA box, 45 base pairs downstream of the RARE. Also
included in the 193 base pair BssHII fragment is 83 base pairs of
DNA upstream of the DR5RARE.
[0138] The existence of retinoic acid response elements (RAREs),
which bind retinoic acid receptors (RARs) and retinoid-x-receptors
RXRs is known. The three promoters of P450RAIs from different
species described above were thus examined for the presence of
RAREs, which might indicate that the regulation of expression of
P450RAI is at the transcriptional level. RAREs bind RARs in the
form of a heterodimer and typically include a direct repeat of the
consensus motif 5'-(A/G)G(T/G)TCA-3'. The repeated sequences can be
separated by 1, 2 or 5 nucleotides. FIG. 15 shows the promoter
sequences for the zebrafish, human and mouse P450RAI genes. There
is a highly conserved motif, indicated by the arrows, which
corresponds to a consensus retinoic acid response element known as
a DR5, consisting of a direct repeat of a motif AGTTCA separated by
5 nucleotides. This motif in the P450RAI promoters extends over the
sequence TGAACT (the complement of AGTTCA). There is also a highly
conserved region extending on either side of the DR5, the entire
region being boxed. The degree of conservation of this region of
the promoter between all three species suggests that this region is
important to the control of RA response and that RAR/RXRs are
acting in conjunction or competition with other factors binding to
this region whose identities are currently unknown. A portion of
the conserved region corresponds to the sequence 5'-CAATTAAA-3'
which corresponds very closely to a homeodomain binding motif,
suggesting that homeobox proteins may facilitate or compete with
RAR/RXR heterodimers in the regulation of P450RAI expression.
Example 11
Transfection with Mouse P450RAI Promoter
[0139] A 195 basepair fragment of genomic DNA containing a portion
of the putative promoter for mP450RAI was cloned into the
luciferase vector, pGL3B (Promega). For analyses of promoter
activity, HepG2 cells were transfected in 6-well dishes with 2
.mu.g BssHI-pGL3B sense or antisense constructs, described in
Example 10, using 5 .mu.l lipofectAMINE reagent (Gibco, BRL).
[0140] On the first day, 48 hours prior to transfection, cells were
replated into 6-well plates, with 2.5-3 mls Minimal Essential
Medium (MEM) (Gibco, BRL)+10% Fetal Calf Serum (Gibco, BRL). On the
third day, cells are generally about 50% confluent (HepG2). Before
beginning transfection, the medium was replaced with fresh medium
and the cells were allowed to grow while preparing
DNA/lipofectamine mix. In individual wells of a 48 well plate were
mixed 1-5 .mu.g DNA in 100 .mu.l optiMEM (Gibco, BRL) and 5 .mu.l
lipofectAMINE reagent in 100 .mu.l optiMEM, by addition of the
DNA/optiMEM to the lipofectAMINE/optiMEM with gentle mixing. This
was left to sit 15 min to 1 hour at room temperature. To each well
were added 800 .mu.l optiMEM to obtain a final volume of 1 ml. The
cells were washed 2 times in 1.times.PBS and once in optiMEM. The 1
ml DNA/lipofectamine/optiMEM mixture was added to the cells and
incubated for 20 hours at 37.degree. C.
[0141] The effects of retinoic acid on promoter activity were
analyzed by cotransfecting with varying amounts (100 ng to 1 .mu.g)
of expression vectors including cDNA sequences encoding zebrafish
retinoic acid receptor gamma (RAR-.gamma.) and zebrafish retinoid x
receptor alpha (RXR-.alpha.). Comparisons were made between cells
transfected with the control pGL3B vector, those with the sense
construct and those with the antisense construct by incubating one
set of the transfected cells with DMSO and the other set with
10.sup.-6 M RA in DMSO.
[0142] On the fourth day, the medium was removed and replaced with
fresh medium (+10% FBS). The RA or vehicle was added as required to
the wells and mixed gently by swirling the plate. For a 6 well
plate 3 .mu.l of 10.sup.-3M RA in DMSO were added. Control wells
received 3 .mu.l DMSO. The plates were covered in foil and
incubated for 24 hours at 37.degree. C.
[0143] On the fifth day, cells were harvested by removing the
medium and washing twice in 1.times.PBS. Then, on ice, 100 .mu.l
lysis buffer (1% Triton X-100, 25 mM glycylglycine, pH 7.8, 15 mM
MgSO.sub.4, 4 mM EGTA, 1 mM DTT (added fresh just before use)) were
added, and the cells were scraped off the bottom of the dish and
transferred to a 1.5 ml microcentrifuge tube, spun for minutes at
12000.times.g, and the supernatant recovered.
[0144] To assay for luciferase activity, 20 .mu.l supernatant from
lysed, pelleted cells were transferred to a fresh tube. 80 .mu.l
luciferase assay buffer were added and a reading in millivolts in a
luminometer was taken immediately. The luciferase assay buffer was
20 mM Tricine, 1.07 mM (MgCO.sub.3).sub.4Mg(OH).sub.2*5H.sub.2O,
2.67 mM MgSO.sub.4, 0.1 mM EDTA, 33.3 mM DTT, 0.27 mM Coenzyme A,
0.47 mM Luciferin, 0.53 mM ATP. The results are shown in FIG. 16,
in which it can be seen that enhanced luciferase activity was
observed in the presence of RA, RXR.alpha. and RAR.gamma., for both
orientations of the promoter sequence, although enhancement appears
to be greater for the sense construct.
Example 12
Inhibition of P450RAI Induction by 4-Hydroxyphenylretinamide
[0145] It has recently been reported that 4-hydroxyphenylretinamide
(4-HPR) inhibits RA-induced RA catabolism by NB4 cells [Taimi,
1997]. It was suggested that 4-HPR may inhibit the cytochrome P450
enzyme(s) responsible for RA oxidation to competitively inhibit RA
catabolism. However, any such enzymes were not identified, no
explanation of the nature of 4-HPR inhibition of RA catabolism was
provided, and no evidence of 4-HPR metabolism was observed.
[0146] Experiments to determine the effect of 4-HPR on the
induction of P450RAI were thus carried out. FIG. 17 illustrates the
ability of the synthetic retinoid, 4-HPR to inhibit the induction
of P450RAI by RA. MCF7 cells were grown in culture in minimal
essential medium (MEM) (Gibco) supplemented with 10% fetal calf
serum, insulin (0.01 mg/mL), MEM non-essential amino acids (as
directed by the manufacturer--Gibco), sodium pyruvate (500 nM),
L-glutamine (2 mM) gentamycin (10 .mu.g/mL), penicillin (5
.mu.g/mL), streptomycin (5 .mu.g/mL), and fungizone (200 ng/mL).
MCF7 cells cultured in parallel were treated for 12 hours with: 10
.mu.M 4HPR; 1 .mu.M 4HPR; 1 .mu.M RA; 1 .mu.M RA and 10 .mu.M
4-HPR; or 1 .mu.M RA and 1 .mu.M 4-HPR. At the end of the 12 hour
treatment, total RNA was extracted from the cells using TRIzol
reagent (as outlined by the manufacturer--Gibco). P450RAI message
in the total RNA preparations was analyzed by northern blot
hybridization. The blot was reprobed with a probe corresponding to
the GAPDH cDNA to control for equivalent loading of RNA in each
lane of the blot. The results indicate that 4-HPR treatment alone
does not induce the P450RAI message. As expected, RA treatment of
MCF7 cells results in a marked induction of P450RAI message
following 12 hours of incubation. However, when cells are treated
with RA in the presence of 10 .mu.M 4-HPR, there is a noticeable
suppression of P450RAI induction.
Example 13
P450RAI Expression in the Presence of Retinoic Acid
[0147] FIG. 18 shows a time course of expression of cytochrome p450
RAI following treatment of MCF7 breast epithelium adenocarcinoma
cells with 1 .mu.M all-trans retinoic acid. In this northern blot
analysis, total RNA was extracted at the indicated time points and
transferred to nitrocellulose following electrophoresis in a 1%
agarose, 0.66 M formaldehyde gel. The nitrocellulose was then
probed with radioactively labelled human cytochrome p450RAI cDNA or
GAPDH cDNA to control for equivalence of mRNA loading. This shows
that after 3 hours of incubation with retinoic acid, the MCF7 cells
express high levels of P450RAI message and following 12 hours of
exposure, the message declines sharply, possibly indicating that
the metabolic activity of induced P450RAI protein is reducing the
concentration of active retinoic acid in the surrounding medium.
This strongly suggests that the induction of P450RAI in MCF7 cells
forms an autoregulatory negative feedback loop.
Example 14
P450RAI Expression in the Presence of Retinoic Acid and
Ketoconazole
[0148] FIG. 19 shows a time course of P450RAI mRNA expression in
MCF7 cells similar to that described in FIG. 18, except that the
effect of the broad spectrum cytochrome p450 inhibitor ketoconazole
on P450RAI expression was examined. In the absence of ketoconazole,
lanes 1 to 5 in FIG. 19 a time course similar to that shown in FIG.
18 is shown. In cells which were exposed to 1 .mu.M ketoconazole
(replenished every 12 hours following initial treatment),
cytochrome P450RAI message was detectable at high levels at 24 and
48 hour time points indicating that the breakdown of retinoic acid
can be inhibited by a cytochrome P450 inhibitor and that P450RAI
metabolism may be responsible for the sharp drop in P450RAI message
in the absence of ketoconazole. The example illustrates a method of
identifying P450RAI inhibitors.
Example 15
P450RAI Expression in the Presence of Am580
[0149] FIG. 20 shows a time course of P450RAI mRNA expression in
MCF7 cells similar to that described in FIG. 18, except that a
comparison was made between the retinobenzoic acid derivative Am580
and all-trans retinoic acid. Retinoic acid shows a typical time
course of induction of P450RAI message, lanes 1 to 4, FIG. 20.
Am580 induces P450RAI message to levels comparable to those
observed following treatment with retinoic acid. Notably, whereas
P450RAI message has declined sharply between 24 and 48 hours, for
retinoic acid treated cells, the levels of P450RAI in Am580 treated
cells remains high at this time point. This indicates that the
synthetic retinoid Am580 is resilient to metabolism in these cells
and illustrates the utility of identifying such compounds for
therapeutic use. For example, the resistance to retinoic acid
treatment observed in acute promyelocytic leukemia due to increased
retinoic acid metabolism [Warrell, 1994] might be circumvented by
treatment with a metabolism-resistant retinoid. P450RAI protein may
be a useful agent for screening for these types of compounds.
Example 16
Monoclonal Antibodies to P450RAI
[0150] Monoclonal antibodies (Mab's) specific for P450RAI are
useful, for example, for diagnostic purposes such as for
determining P450RAI protein levels in the identification of normal
and tumor tissues which metabolize RA. To produce these antibodies,
purified P450RAI protein is prepared. The human P450RAI protein is
produced in bacterial cells as a fusion protein with
glutathione-S-transferase using the vector pGEX2 (Pharmacia). This
permits purification of the fusion protein by GSH affinity
chromatography. In another approach, P450RAI is expressed as a
fusion protein with the bacterial maltose binding domain. The
fusion protein is thus recovered from bacterial extracts by passing
the extract over an amylose resin column followed by elution of the
fusion protein with maltose. For this fusion construct, the vector
pMalC2, commercially available from New England Biolabs, is used.
This vector has been used in the past, for example, to overexpress
nuclear receptor proteins which were recovered in high yields for
functional studies and the production of receptor specific antisera
[Ohno, 1993]. The preparation of a second fusion protein is also
useful in the preliminary screening of MAb's.
[0151] The generation of hybridomas expressing monoclonal
antibodies recognizing P450RAI protein is carried out as follows:
BALB/c mice are injected intraperitoneally with protein/adjuvant
three times at one-month intervals, followed by a final injection
into the tail vein shortly prior to cell fusion. Spleen cells are
harvested and fused with NS-1 myeloma cells (American Type Culture
Collection, Rockville, Md.) using polyethylene glycol 4000
according to standard protocols [Kennett, 1979; Mirski, 1989]. The
cell fusion process is carried out as described in more detail
below.
[0152] The fused cells are plated into 96-well plates with
peritoneal exudate cells and irradiated spleen cells from
BALB/Ccmice as feeder layers and selection with hypoxanthine,
aminopterin, and thymidine (HAT medium) is performed.
[0153] An ELISA assay is used as an initial screening procedure.
1-10 .mu.g of purified P450RAI (cleaved from the fusion protein) in
PBS is used to coat individual wells, and 50-100 .mu.l per well of
hybridoma supernatants is incubated. Horseradish
peroxidase-conjugated anti-mouse antibodies are used for the
colorimetric assay.
[0154] As a secondary screening, breast epithelial carcinoma MCF-7
cells are used as a source of P450RAI determinant. As indicated
above, untreated MCF-7 cells exhibit no detectable expression of
P450RAI message and no detectable RA metabolizing activity, whereas
there is a rapid and striking induction of both in cells treated
with RA. Untreated MCF-7 cells thus serve as a negative control for
background. MCF-7 cells are aliquotted into 96 well plates one day
prior to assay. Cells are fixed and permeabilized with methanol.
Hybridoma supernatants are added and fluorescein isothiocyanate
(FITC)-conjugated anti-mouse antibodies are used for screening
using a standard fluorescence microscope.
[0155] Positive hybridomas are cloned by limiting-dilution and
grown to large-scale for freezing and antibody production. Various
positive hybridomas are selected for usefulness in western blotting
and immunohistochemistry, as well as for cross reactivity with
P450RAI proteins from different species.
[0156] The selected MAb's are useful for monitoring the levels of
expression of P450RAI protein following RA treatment in cell
culture and in tissues. P450RAI protein expression may be a
prognostic indicator for determining whether a particular tumor
will respond to RA treatment. There is also a wide intersubject
variability in baseline RA metabolism and there is evidence
suggesting that subjects with a high rate of RA metabolism have a
higher incidence of squamous or large cell cancers of the lung
[Rigas, 1996]. Once useful antibodies are characterized, these
antibodies are used to survey tumor tissue samples for P450RAI
expression.
Protocol for Production of Mouse Hybridomas
[0157] Fusion. Feeder cells (spleen and peritoneal exudate cells)
are plated. 24 to 48 hours before fusion, mouse myeloma cells are
taken off drug (8-azaguanine 20 .mu.g/ml) and counted to ensure
that there are at least 50.times.10.sup.6 cells. 2 g of PEG 4000
are autoclaved in a glass tube for 15 minutes and maintained at
60.degree. C. for use or alternatively stored at room temperature
and remelted in a 60.degree. C. water bath when needed.
[0158] BALB/c mice are immunized as per desired schedule. The final
injection is given intravenously in the tail vein. Fusion of
immunized spleen cells is carried out 3 or 4 days after the
intravenous injection. Spleen from each animal is collected
separately; eye sera for ELISA if desired.
[0159] A single cell suspension is prepared using a Teflon pestle
and decanting connective tissue. The suspension is washed 1.times.
in serum-free medium. Each spleen has about 10.times.10.sup.6
cells. The myeloma cells are collected, counted and washed in
serum-free medium.
[0160] The cells are then fused. A small beaker of water, and
serum-free medium (37.degree. C.) are prepared and the PEG melted
at 50-60.degree. C. The immunized spleen cells and myeloma cells
are mixed in a 50 ml TC tube (recommended ratios vary from 1:1 to
2:1) and the cells are washed once with serum-free medium. The
supernatant is carefully discarded. 2.4 ml pre-warmed serum-free
medium is added immediately with pipette to the melted PEG and
mixed, maintaining the temperature at 37.degree. C. in beaker of
warm water. The PEG should be light pink. If it is yellow, another
aliquot should be used. 0.5-1.0 ml of PEG is added dropwise to the
cell pellet over 1 minute with gentle rotation of the tube or
gentle stirring to ensure mixing. The tip of the addition pipette
is placed directly over the cell pellet. The tube is swirled gently
in 37.degree. C. water bath for 90 seconds with the blunt end of a
3 ml pipette tip and 10 ml warm serum-free medium added slowly over
6-10 minutes while rotating tube gently to bring the volume up to
20-50 ml. The tube is maintained at 37.degree. C. for at least 20
minutes to obtain cell fusion and then the cells are washed
2.times. with serum-free medium. The cells are centrifuged and
gently resuspended in 100 ml of pre-warmed medium+10-20% FBS. 100
aliquotted in 96-well plates. Assuming one spleen fused with
100.times.10.sup.6 cells myeloma fusion partner, about 10 plates
are needed. On the following day, 100 .mu.l medium is removed and
100 ul 2.times.HAT added. Feed with 1.times.HAT medium for 1 to 3
weeks, then feed with HT medium (i.e., remove 1/2 HAT medium and
replace with equal volume HT medium).
[0161] Preparation of Peritoneal Exudates and Spleen Feeder Cells.
A sacrificed mouse is sprayed with 70% alcohol, skin is nicked and
torn apart, with care being taken not to cut the peritoneum. The
peritoneum is lifted with forceps and a needle is introduced; 5 ml
of serum-free medium is slowly injected. The abdomen is massaged
and the fluid is slowly sucked up, collected in a sterile tube and
kept on ice. The volume is brought up to 5 ml. The spleen is
obtained and placed in a sterile tube containing serum-free medium.
The spleen is gently mashed with a sterile Teflon pestle. Clumps
are allowed to settle and the cells are decanted into a clean tube,
care being taken to avoid including connective tissue, in order to
minimize fibroblast growth. The sample is irradiated at 4500 R.
Cells are washed once with serum-free medium, placed into 96-well
plates [one spleen/10 plates (approximately 2-5.times.10.sup.5
cells/well) and peritoneal exudate cell suspension (PECS)
(<3.times.10.sup.3 cells/well) in a total volume of 100
.mu.l/well] and incubated at 37.degree. C. until ready to be used.
They can also be stored in sterile tube overnight at 4.degree.
C.
Discussion
[0162] It is possible to compare the zP450RAI, mP450RAI and
hP450RAI sequences described above. Of the 492 amino acids of
zP450RAI (SEQ ID NO:2), it is possible to align 334 amino acids
with the 497 amino acids of hP450RAI (SEQ ID NO:4). See FIG. 9. On
this basis, there is about 68% homology between the human and fish
proteins. The degree of homology between the two amino acid
sequences is slightly greater towards the C-terminus than in the
N-terminal region. It also appears as though nucleic acid sequences
encoding the conserved sequence Met-Lys-Arg-Gln-Lys (amino acid
numbers 70 to 74 of zP450RAI) can be used as a probe to obtain
corresponding proteins from cDNA libraries of other species. The
amino acid identity between the human and mouse P450RAI sequences
is greater than 93%.
[0163] As shown above, RA-induced expression of a protein by the
cells described herein involves a regulatory sequence which is
located upstream of the coding sequence of DNA that it controls. As
it occurs in nature, the protein is P450RAI, whether in cells of
the zebrafish, human, mouse or other organism. Such a cell can be
modified by incorporating DNA encoding a different protein into the
region of the gene which encodes P450RAI, as exemplified above with
DNA encoding luciferase. An aspect of the present invention is thus
a regulatory DNA sequence, responsive to the presence of RA,
operably linked to a protein-encoding sequence and incorporated
into a conventional genetically engineered protein-producing cell.
Production of the desired protein can be induced by exposure of the
cell to RA.
[0164] Antisense nucleic acids or oligonucleotides (RNA or
preferably DNA) that inhibit cellular RA-induced P450RAI production
can be used to inhibit metabolism of RA by P450RAI [Monia, 1996].
Antisense oligonucleotides, typically 15 to 20 bases long, bind to
the sense mRNA or pre mRNA region coding for the protein of
interest, which can inhibit translation of the bound mRNA to
protein. The cDNA sequence encoding hP450RAI can thus be used to
design a series of oligonucleotides which together span a large
portion, or even the entire cDNA sequence. These oligonucleotides
can be tested to determine which provides the greatest inhibitory
effect on the expression of the protein [Stewart, 1996]. This can
be done by exposing cells to the various oligonucleotides and
measuring subsequent changes in hP450RAI activity or by using
antibodies to screen for inhibition of P450RAI synthesis. The most
suitable mRNA target sites include 5'- and 3'-untranslated regions
as well as the initiation codon. Other regions might be found to be
more or less effective. Alternatively, an antisense nucleic acid or
oligonucleotide may bind to P450RAI DNA coding or regulatory
sequences.
[0165] Rather than reducing RA metabolism by inhibiting P450RAI
gene expression at the nucleic acid level, activity of the P450RAI
protein may be directly inhibited by binding to an agent, such as,
for example, a suitable small molecule or a monoclonal
antibody.
[0166] The present invention thus includes a method of screening
drugs for their effect on activity of a retinoic acid inducible
protein. The method includes exposing the protein to a prospective
inhibitor drug and determining the effect on protein activity. The
measured activity might be hydroxylation of a retinoid,
particularly all-trans retinoic acid, or hydroxylation of a
retinoic acid, particularly all-trans retinoic acid, at the 4
position of the .beta.-ionone ring thereof. For screening drugs for
use in humans, hP450RAI itself is particularly useful for testing
the effectiveness of such drugs. Prospective drugs could also be
tested for inhibition of the activity of other P450 cytochromes,
which are desired not to be inhibited. In this way, drugs which
selectively inhibit hP450RAI over other P450s could be
identified.
[0167] Another system for screening for potential inhibitors of a
P450RAI protein includes a stably transfected cell line having
incorporated therein DNA of a reporter gene (e.g.,
.beta.-galactosidase, firefly luciferase, or the like) and of the
P450RAI, in which expression of both genes is inducible by exposure
of the cells to RA. Expression of the reporter gene provides a
measure of the induction of the expression system and therefore
provides an indication of the amount of RA present. Exposure of the
cells to RA leads to RA metabolism and, with time, such metabolism
leads to a decrease in the degree of induction which is indicated
by the reporter protein. Exposure of the cells to RA in the
presence of an agent that inhibits P450RAI metabolism of RA results
in decreased RA metabolism, whereas exposure of the cells to RA in
the presence of an agent that does not inhibit P450RAI metabolism
of RA has no effect on RA metabolism. A comparison of expression of
the reporter gene in the presence of RA alone and in the presence
of both RA and a potential inhibitory drug thus gives a measure of
the effectiveness of the drug in inhibiting metabolism of RA by the
P450RAI protein.
[0168] One system for screening for potential inhibitors of a
P450RAI protein includes a cell line in which the endogenous
P450RAI gene is not present or not functional or not expressed. In
this cell line, a cytochrome P450RAI expression vector and an
RA-inducible reporter gene are incorporated such that exposure of
the cell line to RA results in metabolism of RA by the expressed
P450RAI protein and a degree of induction of the reporter gene
based on remaining active RA. The addition of an inhibitor of
P450RAI will decrease the rate of metabolism/degradation of RA and
therefore increase the activation/induction of the RA sensitive
reporter gene.
[0169] Given the high degree of conservation of the promoter
regions of the mouse, human and zebrafish P450RAI promoter regions,
it is likely that RA regulates P450RAI expression through a
transcriptional mechanism involving the RARE conserved in the
promoters of all three species. This is supported by studies which
show the rapid and RA-dependent expression of P450RAI in a number
of cell lines. Since P450RAI message is induced so strongly a
reporter gene may be a useful indicator of RA activity in vivo as
well as in vitro. Thus, the P450RAI promoter linked to a reporter
gene provides a tool for screening retinoids or other compounds
which have the ability to block or inhibit P450RAI induction. For
example, the P450RAI reporter gene could be stably or transiently
introduced into a cell line such that when the cells are exposed to
a certain level of retinoid or other agent, the concentration will
be reflected in reporter gene activity. Such transfection assays
can be carried out in a manner similar to those described by
Petkovich et al., for example [Petkovich, 1987; Ohno, 1994].
[0170] The invention thus provides a system for screening potential
inhibitors of RA catabolism by a P450RAI protein. The system
includes a transfected cell line having incorporated therein DNA of
a reporter gene, for example the luciferase gene exemplified above,
in which expression of the reporter gene is inducible by exposure
of the cells to RA. In this system, the P450RAI gene is omitted,
that is the reporter gene is under the control of the native
promoter for the P450RAI gene. Expression of the reporter gene
provides a measure of the induction of the expression system and
therefore provides an indication of the amount of mRNA produced in
response to exposure of the cells to RA. Exposure of the cells to
RA in the presence of an agent that inhibits induction of the
expression system indicates that the agent is a potential inhibitor
of RA catabolism, i.e., provides a measure of the effectiveness of
the agent as a drug in inhibiting the expression of P450RAI gene
and thus metabolism of RA.
[0171] There is the possibility that cellular retinoic acid-binding
protein (CRABP) [Adamson, 1993] is involved in binding of a
retinoid substrate to a P450RAI protein of the present invention.
The effect of the presence of CRABP, derivatives, synthetic
fragments or analogs thereof could thus be determined according to
screening methods of the present invention; effectiveness of such
agents in enhancing RA metabolism can also be determined.
[0172] It will of course be understood, without the intention of
being limited thereby, that a variety of substitutions of amino
acids is possible while preserving the structure responsible for
retinoid metabolizing acitivity of the proteins disclosed herein.
Conservative substitutions are described in the patent literature,
as for example, in U.S. Pat. No. 5,264,558. It is thus expected,
for example, that interchange among non-polar aliphatic neutral
amino acids, glycine, alanine, proline, valine and isoleucine,
would be possible. Likewise, substitutions among the polar
aliphatic neutral amino acids, serine, threonine, methionine,
asparagine and glutamine could possibly be made. Substitutions
among the charged acidic amino acids, aspartic acid and glutamic
acid, could probably be made, as could substitutions among the
charged basic amino acids, lysine and arginine. Substitutions among
the aromatic amino acids, including phenylalanine, histidine,
tryptophan and tyrosine would also likely be possible. These sorts
of substitutions and interchanges are well known to those skilled
in the art. Other substitutions might well be possible. Of course,
it would also be expected that the greater the percentage of
homology, i.e., sequence similarity, of a variant protein with a
naturally occurring protein, the greater the retention of metabolic
activity. Of course, as protein variants having the activity of
P450RAI as described herein are intended to be within the scope of
this invention, so are nucleic acids encoding such variants.
[0173] A further advantage may be obtained through chimeric forms
of the protein, as known in the art. A DNA sequence encoding the
entire protein, or a portion of the protein, could thus be linked,
for example, with a sequence coding for the C-terminal portion of
E. coil .beta.-galactosidase to produce a fusion protein.
GST-CYPRAI fusion proteins are described in the above examples. An
expression system for human respiratory syncytial virus
glycoproteins F and G is described in U.S. Pat. No. 5,288,630
issued Feb. 22, 1994 and references cited therein, for example.
[0174] A recombinant expression vector of the invention can be a
plasmid, as described above. The recombinant expression vector of
the invention further can be a virus, or portion thereof, which
allows for expression of a nucleic acid introduced into the viral
nucleic acid. For example, replication defective retroviruses,
adenoviruses and adeno-associated viruses can be used.
[0175] The invention provides a recombinant expression vector
comprising a DNA molecule of the invention cloned into the
expression vector in an antisense orientation. That is, the DNA
molecule is operatively linked to a regulatory sequence in a manner
which allows for expression, by transcription of the DNA molecule,
of an RNA molecule which is antisense to the nucleotide sequence of
SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:31. Regulatory sequences
operatively linked to the antisense nucleic acid can be chosen
which direct the continuous expression of the antisense RNA
molecule in a variety of cell types, for instance a viral promoter
and/or enhancer, or other regulatory sequences can be chosen which
direct tissue or cell type specific expression of antisense
RNA.
[0176] The recombinant expression vectors of the invention can be
used to make a transformant host cell including the recombinant
expression vector. The term "transformant host cell" is intended to
include prokaryotic and eukaryotic cells which have been
transformed or transfected with a recombinant expression vector of
the invention. The terms "transformed with", "transfected with",
"transformation" and "transfection" are intended to encompass
introduction of nucleic acid (e.g. a vector) into a cell by one of
many possible techniques known in the art. Prokaryotic cells can be
transformed with nucleic acid by, for example, electroporation or
calcium-chloride mediated transformation. Nucleic acid can be
introduced into mammalian cells via conventional techniques such as
calcium phosphate or calcium chloride coprecipitation,
DEAE-dextran-mediated transfection, lipofection, electroporation or
microinjection. Suitable methods for transforming and transfecting
host cells are known [Sambrook, 1989].
[0177] The number of host cells transformed with a recombinant
expression vector of the invention by techniques such as those
described above will depend upon the type of recombinant expression
vector used and the type of transformation technique used. Plasmid
vectors introduced into mammalian cells are integrated into host
cell DNA at only a low frequency. In order to identify these
integrants, a gene that contains a selectable marker (e.g.
resistance to antibiotics) is generally introduced into the host
cells along with the gene of interest. Preferred selectable markers
include those which confer resistance to certain drugs, such as
G418 and hygromycin. Selectable markers can be introduced on a
separate plasmid from the nucleic acid of interest or, preferably,
are introduced on the same plasmid. Host cells transformed with one
or more recombinant expression vectors containing a nucleic acid of
the invention and a gene for a selectable marker can be identified
by selecting for cells using the selectable marker. For example, if
the selectable marker encodes a gene conferring neomycin resistance
(such as pRc/CMV), transformant cells can be selected with G418.
Cells that have incorporated the selectable marker gene will
survive, while the other cells die.
[0178] Certain nucleic acids of the invention encode proteins which
"have biological activity of a cytochrome P450RAI". The biological
activity of a cytochrome P450RAI is the ability to oxidize a
retinoid. Such activity can be tested for as described above.
[0179] The invention provides purified proteins having biological
activity of P450RAI. The terms "isolated" and "purified" each refer
to a protein substantially free of cellular material or culture
medium when produced by recombinant DNA techniques, or chemical
precursors or other chemicals when chemically synthesized. In
certain preferred embodiments, the protein having biological
activity of P450RAI comprises an amino acid sequence identified as
SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:32. Alternatively,
preferred proteins encoded by a nucleic acid comprising the
nucleotide sequence identified as SEQ ID NO:3 or SEQ ID NO:5 or SEQ
ID NO:31, as defined above, are encompassed by the invention.
Furthermore, proteins having biological activity of P450RAI that
are encoded by nucleic acids which hybridize under stringent
conditions, as discussed above, to a nucleic acid comprising a
nucleotide sequence identified as SEQ ID NO:3 or SEQ ID NO:5 or SEQ
ID NO:31 are encompassed by the invention. P450RAIs of the
invention can be obtained by expression in a suitable host cell
using techniques known in the art. Suitable host cells include
prokaryotic or eukaryotic organisms or cell lines, for example,
yeast, E. coli, insect cells and COS 1 cells. The recombinant
expression vectors of the invention, described above, can be used
to express a protein having P450RAI activity in a host cell in
order to isolate the protein. The invention provides a method of
preparing an purified protein of the invention comprising
introducing into a host cell a recombinant nucleic acid encoding
the protein, allowing the protein to be expressed in the host cell
and isolating and purifying the protein. Preferably, the
recombinant nucleic acid is a recombinant expression vector.
Proteins can be isolated from a host cell expressing the protein
and purified according to standard procedures of the art, including
ammonium sulfate precipitation, column chromatography (e.g. ion
exchange, gel filtration, affinity chromatography, etc.),
electrophoresis, and ultimately, crystallization [see generally,
"Enzyme Purification and Related Techniques", Methods in
Enzymology, 22, 233-577 (1971)].
[0180] Alternatively, the protein or parts thereof can be prepared
by chemical synthesis using techniques well known in the chemistry
of proteins such as solid phase synthesis [Merrifield, 1964], or
synthesis in homogeneous solution [Houbenwcyl, 1987].
[0181] The protein of the invention, or portions thereof, can be
used to prepare antibodies specific for the proteins. Antibodies
can be prepared which bind to a distinct epitope in an unconserved
region of a particular protein. An unconserved region of the
protein is one which does not have substantial sequence homology to
other proteins, for example other members of the P450 family of
cytochromes. Conventional methods can be used to prepare the
antibodies. For example, by using a peptide of a P450RAI protein,
polyclonal antisera or monoclonal antibodies can be made using
standard methods. As demonstrated in Example 16, a mammal, (e.g. a
mouse, hamster, or rabbit) can be immunized with an immunogenic
form of the peptide which elicits an antibody response in the
mammal. Techniques for conferring immunogenicity on a peptide
include conjugation to carriers or other techniques well known in
the art. For example, the peptide can be administered in the
presence of adjuvant. The progress of immunization can be monitored
by detection of antibody titers in plasma or serum. Standard ELISA
or other immunoassay can be used to assess the levels of
antibodies. Following immunization, antisera can be obtained and,
if desired, polyclonal antibodies isolated from the sera.
[0182] To produce monoclonal antibodies, antibody producing cells
(lymphocytes) can be harvested from an immunized animal and fused
with myeloma cells by standard somatic cell fusion procedures, thus
immortalizing these cells and yielding hybridoma cells. Such
techniques are well known in the art. For example, the hybridoma
technique originally developed by Kohler and Milstein [Kohler,
1975] as well as other techniques such as the human B-cell
hybridoma technique [Kozbor, 1983], the EBV-hybridoma technique to
produce human monoclonal antibodies [Cole, 1985], and screening of
combinatorial antibody libraries [Huse, 1989]. Hybridoma cells can
be screened immunochemically for production of antibodies
specifically reactive with the peptide, and monoclonal antibodies
isolated.
[0183] The term antibody as used herein is intended to include
fragments thereof which are also specifically reactive with a
protein having the biological activity of P450RAI, or a peptide
fragment thereof. Antibodies can be fragmented using conventional
techniques and the fragments screened for utility in the same
manner as described above for whole antibodies. For example,
F(ab').sub.2 fragments can be generated by treating antibody with
pepsin. The resulting F(ab').sub.2 fragment can be treated to
reduce disulfide bridges to produce Fab' fragments.
[0184] It is also known in the art to make chimeric antibody
molecules with human constant regions. See, for example, Morrison
et al., Takeda et al., Cabilly et al., Boss at al., Tanaguchi et
al., Teng et al. [Morrison, 1985; Takeda, 1985; Cabilly; Boss;
Tanaguchi; Teng, 1982], European Patent Publication 0173494, United
Kingdom Patent GB 2177096B, PCT Publication WO92/06193 and EP
0239400. It is expected that such chimeric antibodies would be less
immunogenic in a human subject than the corresponding non-chimeric
antibody.
[0185] Another method of generating specific antibodies, or
antibody fragments, reactive against protein having the biological
activity of a P450RAI, or a peptide fragment thereof, is to screen
expression libraries encoding immunoglobulin genes, or portions
thereof, expressed in bacteria, with peptides produced from the
nucleic acid molecules of the present invention. For example,
complete Fab fragments, VH regions and FV regions can be expressed
in bacteria using phage expression libraries. See for example Ward
et al., Huse at al., and McCafferty at al. [Ward, 1989; Huse, 1989;
McCafferty, 1990]. Screening such libraries with, for example, a
P450RAI peptide can identify immunoglobulin fragments reactive with
P450RAI. Alternatively, the SCID-hu mouse developed by Genpharm can
be used to produce antibodies, or fragments thereof.
[0186] The polyclonal, monoclonal or chimeric monoclonal antibodies
can be used to detect the proteins of the invention, portions
thereof or closely related isoforms in various biological
materials, for example they can be used in an ELISA,
radioimmunoassay or histochemical tests. Thus, the antibodies can
be used to quantify the amount of a P450RAI protein of the
invention, portions thereof or closely related isoforms in a sample
in order to determine the role of P450RAI proteins in particular
cellular events or pathological states. Using methods described
hereinbefore, polyclonal, monoclonal antibodies, or chimeric
monoclonal antibodies can be raised to nonconserved regions of
P450RAI and used to distinguish a particular P450RAI from other
proteins.
[0187] The polyclonal or monoclonal antibodies can be coupled to a
detectable substance or reporter system. The term "coupled" is used
to mean that the detectable substance is physically linked to the
antibody. Suitable detectable substances include various enzymes,
prosthetic groups, fluorescent materials, luminescent materials and
radioactive materials. Examples of suitable enzymes include
horseradish peroxidase, alkaline phosphatase, .beta.-galactosidase,
and acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride and
phycoerythrin; an example of a luminescent material includes
luminol; and examples of suitable radioactive material include
.sup.125I; .sup.131I, .sup.35S and .sup.3H. In a preferred
embodiment, the reporter system allows quantitation of the amount
of protein (antigen) present.
[0188] Such an antibody-linked reporter system could be used in a
method for determining whether a fluid or tissue sample of a
subject contains a deficient amount or an excessive amount of the
protein. Given a normal threshold concentration of such a protein
for a given type of subject, test kits could thus be developed.
[0189] The present invention allows the skilled artisan to prepare
bispecific antibodies and tetrameric antibody complexes. Bispecific
antibodies can be prepared by forming hybrid hybridomas [Staerz,
1986a &b].
[0190] The present invention includes three types of compounds
related to retinoids: those that inhibit enzymatic activity of
P450RAI, thereby inhibiting metabolism of RA; those retinoids that
evade metabolism by P450RAI, for example Am580, shown above; and
those compounds that repress induction of P450RAI gene expression,
for example 4-HPR, as shown above.
[0191] Compositions of the invention are administered to subjects
in a biologically compatible form suitable for pharmaceutical
administration in vivo. By "biologically compatible from suitable
for administration in vivo" is meant a form of the composition to
be administered in which any toxic effects are outweighed by the
therapeutic effects of the composition. The term "subject" is
intended to include living organisms in which a desired therapeutic
response can be elicited, e.g. mammals. Examples of subjects
include human, dogs, cats, mice, rats and transgenic species
thereof. Administration of a therapeutically active amount of the
therapeutic compositions of the present invention is defined as an
amount effective, at dosages and for periods of time necessary to
achieve the desired result. For example, a therapeutically active
amount of a compound that inhibits catabolism of RA by a P450RAI
protein may vary according to factors such as the disease state,
age, sex, and weight of the individual, as well as target tissue
and mode of delivery. Dosage regimes may be adjusted to provide the
optimum therapeutic response. For example, several divided doses
may be administered daily or the dose may be proportionally reduced
as indicated by the exigencies of the therapeutic situation.
[0192] Compounds of the present invention, such as those that are
found to inhibit metabolism of RA by P450RAI enzymes and that are
useful as anticancer agents and in the treatment, amelioration, or
prevention of skin disorders for which retinoic acid is useful, for
example, may be used topically. In this regard they may be included
in compositions for therapy in animals, including humans, for
premalignant epithelial cell lesions, as a prophylaxis against
tumor promotion in epithelial cells and treatment for dermatoses
such as ichthyoses, follicular disorders, benign epithelial
disorders, and other proliferative skin diseases, such as acne,
psoriasis, eczema, atopic dermatitis, nonspecific dermatitis and
the like.
[0193] Topical compositions are usually formulated with a
pharmaceutically acceptable carrier in liquid, semi-solid or solid
form. A pharmaceutically acceptable carrier is a material that is
nontoxic and generally inert and does not affect the functionality
of the active ingredients adversely. Such materials are well known
and include those materials sometimes referred to as diluents or
vehicles (excipients) in the pharmaceutical formulation art. The
carrier may be organic or inorganic in nature. Examples of
pharmaceutically acceptable carriers are water, gelatin, lactose,
starch, mineral oil, cocoa butter, dextrose, sucrose, sorbitol,
mannitol, gum, acacia, alginates, cellulose, talc, magnesium
stearate, polyoxyethylene sorbitan monolaurate, and other commonly
used pharmaceutical carriers. In addition to an active ingredient
and carrier, the formulation may contain minor amounts of additives
such as flavoring agents, coloring agents, thickening or gelling
agents, emulsifiers, wetting agents, buffers, stabilizers, and
preservatives such as antioxidants.
[0194] Certain compositions may be administered enterally. For oral
administration, suitable forms are, for example, tablets, pills,
syrups, suspensions, emulsions, solutions, powders and
granules.
[0195] As anti-tumor agents or as part of an anti-tumor
formulation, for example, compounds of the present invention can be
used in a similar manner to retinoids used for treating various
tumours, such as all-trans retinoic acid. The dose to be
administered, whether a single dose, multiple does or daily dose,
will of course vary with the particular compound employed because
of the varying potency of the active ingredient, the chosen route
of administration, the size of the recipient, the type of tumor,
and the nature of the patient's condition. The dosage to be
administered is not subject to definite bounds, but it will usually
be an effective amount, or the equivalent on a molar basis of the
pharmacologically active free form produced from a dosage
formulation upon the metabolic release of the active drug to
achieve its desired pharmacological and physiological effects. An
oncologist skilled in the art of cancer treatment will be able to
ascertain without undue experimentation, appropriate protocols for
the effective administration of the compounds of this present
invention.
[0196] Nucleic acids which encode proteins having biological
activity of a P450RAI protein can be used to generate either
transgenic animals or "knock out" animals which, in turn, are
useful in the development and screening of therapeutically useful
reagents. A transgenic animal (e.g., a mouse) is an animal having
cells that contain a transgene, which transgene was introduced into
the animal or an ancestor of the animal at a prenatal, e.g., an
embryonic stage. A transgene is a DNA which is integrated into the
genome of a cell from which a transgenic animal develops. In one
embodiment, a human P450RAI cDNA, comprising the nucleotide
sequence shown in SEQ ID NO:5, or an appropriate variant or
subsequence thereof, can be used to generate transgenic animals
that contain cells which express human P450RAI protein. Methods for
generating transgenic animals, particularly animals such as mice,
have become conventional in the art are described, for example, in
U.S. Pat. Nos. 4,736,866 and 4,870,009. In a preferred embodiment,
plasmids containing recombinant molecules of the invention are
microinjected into mouse embryos. In particular, the plasmids are
microinjected into the male pronuclei of fertilized one-cell mouse
eggs; the injected eggs are transferred to pseudo-pregnant foster
females; and, the eggs in the foster females are allowed to develop
to term. [Hogan, 1986]. Alternatively, an embryonal stem cell line
can be transfected with an expression vector comprising nucleic
acid encoding a protein having P450RAI activity, and cells
containing the nucleic acid can be used to form aggregation
chimeras with embryos from a suitable recipient mouse strain. The
chimeric embryos can then be implanted into a suitable
pseudopregnant female mouse of the appropriate strain and the
embryo brought to term. Progeny harboring the transfected DNA in
their germ cells can be used to breed uniformly transgenic
mice.
[0197] Typically, particular cells would be targeted for P450RAI
transgene incorporation by use of tissue specific enhancers
operatively linked to the P450RAI encoding gene. For example,
promoters and/or enhancers which direct expression of a gene to
which they are operatively linked preferentially in cardiac muscle
cells can be used to create a transgenic animal which expresses a
P450RAI protein preferentially in cardiac muscle tissue. Examples
of suitable promoters and enhancers include those which regulate
the expression of the genes for cardiac myosin and cardiac actin.
Transgenic animals that include a copy of an P450RAI transgene
introduced into the germ line of the animal at an embryonic stage
can also be used to examine the effect of increased P450RAI
expression in various tissues.
[0198] The pattern and extent of expression of a recombinant
molecule of the invention in a transgenic mouse is facilitated by
fusing a reporter gene to the recombinant molecule such that both
genes are co-transcribed to form a polycistronic mRNA. The reporter
gene can be introduced into the recombinant molecule using
conventional methods such as those described in Sambrook et al.,
[Sambrook, 1989]. Efficient expression of both cistrons of the
polycistronic mRNA encoding the protein of the invention and the
reporter protein can be achieved by inclusion of a known internal
translational initiation sequence such as that present in
poliovirus mRNA. The reporter gene should be under the control of
the regulatory sequence of the recombinant molecule of the
invention and the pattern and extent of expression of the gene
encoding a protein of the invention can accordingly be determined
by assaying for the phenotype of the reporter gene. Preferably the
reporter gene codes for a phenotype not displayed by the host cell
and the phenotype can be assayed quantitatively. Examples of
suitable reporter genes include lacZ (.beta.-galactosidase), neo
(neomycin phosphotransferase), CAT (chloramphenicol
acetyltransferase) dhfr (dihydrofolate reductase), aphIV
(hygromycin phosphotransferase), lux (luciferase), uidA
(.beta.-glucuronidase). Preferably, the reporter gene is lacZ which
codes for .beta.-galactosidase. .beta.-galactosidase can be assayed
using the lactose analogue X-gal
(5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside) which is broken
down by .beta.-galactosidase to a product that is blue in color
[Old].
[0199] Although experimental animals used in the preferred
embodiment disclosed are mice, the invention should not be limited
thereto. It can be desirable to use other species such as, for
example, rats, hamsters, rabbits and sheep.
[0200] The transgenic animals of the invention can be used to
investigate the molecular basis of RA metabolism. The transgenic
animals of the invention can also be used to test substances for
the ability to prevent, slow or enhance RA metabolism. A transgenic
animal can be treated with the substance in parallel with an
untreated control transgenic animal.
[0201] Cells from the transgenic animals of the invention can be
cultured using standard tissue culture techniques. In particular,
cells carrying the recombinant molecule of the invention can be
cultured and used to test substances for the ability to prevent,
slow or enhance RA metabolism.
[0202] Additionally, the non-human homologues of genes encoding
proteins having P450RAI activity can be used to construct a "knock
out" animal which has a defective or altered P450RAI gene. For
example, with established techniques, a portion of murine genomic
P450RAI DNA (e.g., an exon), can be deleted or replaced with
another gene, such as a gene encoding a selectable marker which can
be used to monitor integration. The altered P450RAI DNA can then be
transfected into an embryonal stem cell line. The altered P450RAI
DNA will homologously recombine with the endogenous P450RAI gene in
certain cells and clones containing the altered gene can be
selected. Cells containing the altered gene are injected into a
blastocyst of an animal, such as a mouse, to form aggregation
chimeras as described for transgenic animals. Chimeric embryos are
implanted as described above. Transmission of the altered gene into
the germline of a resultant animal can be confirmed using standard
techniques and the animal can be used to breed animals having an
altered P450RAI gene in every cell [Lemoine, 1996]. Accordingly, a
knockout animal can be made which cannot express a functional
P450RAI protein. Such a knockout animal can be used, for example,
to test the effectiveness of an agent in the absence of a P450RAI
protein.
[0203] The antisense nucleic acids and oligonucleotides of the
invention are useful for inhibiting expression of nucleic acids
(e.g. mRNAs) encoding proteins having P450RAI activity. Since
proteins having P450RAI activity are associated with metabolism of
agents which can act on the cell, e.g., RA, decreasing expression
of such proteins can increase sensitivity of the cell to such
agents. Antisense nucleic acids can be introduced into a drug
resistant cell in culture to inhibit P450RAI expression. One or
more antisense nucleic acids, such as oligonucleotides, can be
added to cells in culture media, typically, for example, at 200
[0204] The antisense nucleic acids of the invention, or
oligonucleotides thereof, can thus be used in gene therapy to
correct or prevent retinoic acid or other retinoid resistance in a
subject. For example, antisense sequences can be used to render
retinoic acid or other retinoid resistant malignant cells sensitive
to chemotherapeutic agents. Administration of antisense nucleic
acids to a subject may be most effective when the antisense nucleic
acid is contained in a recombinant expression vector which allows
for continuous production of antisense RNA. Recombinant molecules
comprising an antisense nucleic acid or oligonucleotide thereof,
can be directly introduced into tissues, including lung tissue in
vivo, using delivery vehicles such as liposomes, retroviral
vectors, adenoviral vectors and DNA virus vectors. A delivery
vehicle can be chosen which can be targeted to a cell of interest
in the subject (e.g. a retinoid resistant tumor cell). Antisense
nucleic acids can also be introduced into isolated cells, such as
those of the haematopoietic system, ex vivo using viral vectors or
physical techniques such as microinjection and electroporation or
chemical methods such as coprecipitation and incorporation of DNA
into liposomes, and such cells can be returned to the donor.
Recombinant molecules can be delivered in the form of an aerosol or
by lavage.
[0205] Accordingly, the invention provides a method for inhibiting
retinoic acid or other retinoid resistance of a resistant cell by
introducing into the resistant cell a nucleic acid which is
antisense to a nucleic acid which encodes the protein identified as
SEQ ID NO:2, SEQ ID NO:32, or particularly, the in case of human
cells SEQ ID NO:4.
[0206] The nucleic acids of the invention can further be used to
design ribozymes which are capable of cleaving a single-stranded
nucleic acid encoding a protein having P450RAI activity, such as an
mRNA. A catalytic RNA (ribozyme) having ribonuclease activity can
be designed which has specificity for a P450RAI-encoding mRNA based
upon the sequence of a nucleic acid of the invention. For example,
a derivative of a Tetrahymena L-191VS RNA can be constructed in
which the base sequence of the active site is complementary to the
base sequence to be cleaved in a P450RAI-encoding mRNA. [Cech a and
b]. Alternatively, a nucleic acid of the invention could be used to
select a catalytic RNA having a specific ribonuclease activity from
a pool of RNA molecules [Bartel, 1993].
[0207] The isolated nucleic acids and antisense nucleic acids of
the invention can be used to construct recombinant expression
vectors as described previously. These recombinant expression
vectors are then useful for making transformant host cells
containing the recombinant expression vectors, for expressing
protein encoded by the nucleic acids of the invention, and for
isolating proteins of the invention as described previously. The
isolated nucleic acids and antisense nucleic acids of the invention
can also be used to construct transgenic and knockout animals as
described previously.
[0208] The isolated proteins of the invention are useful for making
antibodies reactive against proteins having P450RAI activity, as
described previously. Alternatively, the antibodies of the
invention can be used to isolate a protein of the invention by
standard immunoaffinity techniques. Furthermore, the antibodies of
the invention, including bispecific antibodies are useful for
diagnostic purposes.
[0209] Molecules which bind to a protein comprising an amino acid
sequence shown in SEQ ID NO:4 can also be used in a method for
killing a cell which expresses the protein, wherein the cell takes
up the molecule. Preferably, the cell is a tumor cell. Destruction
of such cells can be accomplished by labeling the molecule with a
substance having toxic or therapeutic activity. The term "substance
having toxic or therapeutic activity" as used herein is intended to
include molecules whose action can destroy a cell, such as a
radioactive isotope, a toxin (e.g. diphtheria toxin or ricin), or a
chemotherapeutic drug, as well as cells whose action can destroy a
cell, such as a cytotoxic cell. The molecule binding to the P450RAI
can be directly coupled to a substance having a toxic or
therapeutic activity or may be indirectly linked to the substance.
In one example, the toxicity of the molecule taken up by the cell
is activated by P450RAI protein.
[0210] The invention also provides a diagnostic kit for identifying
tumor cells comprising a molecule which binds to a protein
comprising an amino acid sequence shown in SEQ ID NO:4, for
example, for incubation with a sample of tumor cells; means for
detecting the molecule bound to the protein, unreacted protein or
unbound molecule; means for determining the amount of protein in
the sample; and means for comparing the amount of protein in the
sample with a standard. Preferably, the molecule is a monoclonal
antibody. In some embodiments of the invention, the detectability
of the molecule which binds to P450RAI is activated by said binding
(e.g., change in fluorescence spectrum, loss of radioisotopic
label). The diagnostic kit can also contain an instruction manual
for use of the kit.
[0211] The invention further provides a diagnostic kit for
identifying tumor cells comprising a nucleotide probe complementary
to the sequence, or an oligonucleotide fragment thereof, shown in
SEQ ID NO:3, for example, for hybridization with mRNA from a sample
of tumor cells; means for detecting the nucleotide probe bound to
mRNA in the sample with a standard. The diagnostic kit can also
contain an instruction manual for use of the kit.
[0212] Those skilled in the art will know, or be able to ascertain
using no more than routine experimentation, many equivalents to the
specific embodiments of the invention described herein. Such
equivalents are intended to be encompassed by the following
claims.
REFERENCES
[0213] Particulars of references cited above are given below. All
of the listed references are incorporated herein by reference.
[0214] Adamson, P. C., Boylan, J. F., Balis, F. M., Murphy, R. F.,
Godwin, K. A., Gudas, L. J. and Poplack, D. G. (1993). Time course
of induction of metabolism of all-trans retinoic acid and the
up-regulation of cellular retinoic acid-binding protein. Cancer
Research 53, 472-476. [0215] Achkar, C. C., Derguini, F., Blumberg,
B., Langston, A., Arthur, A. L., Speck, J., Evans, R. M., Bolado,
Jr., J. Nakanishi, K. and Buck, J. (1996) 4-Oxoreinol, a new
natural ligand and transactivator of the retinoic acid receptors.
Proc. Natl. Acad. Sci. USA 93, 4879-84. [0216] Akimenko, M. A. and
Ekker, M. (1995a). Anterior duplication of the Sonic hedgehog
expression pattern in the pectoral fin buds of zebrafish treated
with retinoic acid. Developmental Biology 170, 243-7. [0217]
Akimenko, M. A., Johnson, S. L., Westerfield, M. and Ekker, M.
(1995b). Differential induction of four msx homeobox genes during
fin development and regeneration in zebrafish. Development 121,
347-57. [0218] Akiyoshi-Shibata, M., Sakaki, T., Ohyama, Y.,
Noshiro, M., Okuda, K. and Yabusaki, Y. (1994). Further oxidation
of hydroxycalcidiol by calcidiol 24-hydroxylase. A study with the
mature enzyme expressed in Escherichia coli. European Journal of
Biochemistry 224, 335-43. [0219] Bartel, D. and Szostak, J. W.
(1993). Science 261, 1411-1418. [0220] Blaner, W. (1994). Retinol
and retinoic acid metabolism. In: The Retinoids. (M. Sporn,
Roberts, A. and Goodman, D. S., Editors) Raven Press, Inc.: New
York. [0221] Bligh, E. G. and Dyer, W. J. (1957). A rapid method of
total lipid extraction and purification. Canadian Journal of
Biochemistry 37, 911-917. [0222] Blumberg, B., Bolado, Jr., J.,
Derguini, F., Craig, A. G., Moreno, T. A., Chakravarti, D., Heyman,
R. A., Buck, J. and Evans, R. M. (1996) Novel retinoic acid
receptor ligands in Xenopus embryos. Proc. Natl. Acad. Sci. USA 93,
4873-78. [0223] Boss et al., U.S. Pat. No. 4,816,397. [0224]
Boylan, J. F., Lufkin, T., Achkar, C. C., Taneha, R., Chambon, P.
and Gudas, L. J. (1995). Targeted Disruption of Retinoic Acid
Receptor a (RARa) and RARg Results in Receptor-Specific Alterations
in Retinoic Acid-Mediated Differentiation and Retinoic Acid
Metabolism. Mol. Cell. Biol. 15, 843-851. [0225] Boyle, A. L. et
al. (1992). Genomics 12, 106-15. [0226] Cabilly et al. U.S. Pat.
No. 4,816,567. [0227] Cech et al., (a) U.S. Pat. No. 4,987,071.
[0228] Cech et al., (b) U.S. Pat. No. 5,116,742. [0229] Chambon, P.
(1995). The molecular and genetic dissection of the retinoid
signaling pathway. [Review]. Recent Progress in Hormone Research
50, 317-32. [0230] Chen, K. S, and DeLuca, H. F. (1995). Cloning of
the human 1 alpha,25-dihydroxyvitamin D-3 24-hydroxylase gene
promoter and identification of two vitamin D-responsive elements.
Biochimica et Biophysica Acta 1263, 1-9. [0231] Chomienne, C.,
Fenaux and Degos, L. (1996). Retinoid differentiation therapy in
promyelocytic leukemia. FASEB J. 1025-1030. [0232] Chytil, F.
(1984). Retinoic acid: Biochemistry, toxicology, pharmacology, and
therapeutic use. Pharmacol. Rev. 36, 93-99. [0233] Cole et al.
(1985). Monoclonal Antibodies in Cancer Therapy. Allen R. Bliss,
Inc. [0234] Costaridis, P., Horton, C., Zeitlinger, J., Holder, N.
and Maden, M. (1996). Endogenous Retinoids in the Zebrafish Embryo
and Adult. Developmental Dynamics 205, 41-51. [0235] Creech Kraft,
J., Schuh, T., Juchau, M. R. and Kimelman, D. (1994). Temporal
distribution, localization and metabolism of all-trans retinol,
didehydroretinol and all-trans retinal during Xenopus development.
Biochem. J. 301, 111-119. [0236] De Coster, R., Wouters, W. and
Bruynseels, J. (1996). P450-dependent enzymes as targets for
prostate cancer therapy. J. Ster. Biochem. Mol. Biol. 56, 133-43.
[0237] Duell, E. A., Astrom, A., Griffiths, C. E., Chambon, P. and
Voorhees, J. J. (1992). Human skin levels of retinoic acid and
cytochrome p-450-derived 4-hydroxyretinoic acid after topical
application of retinoic acid in vivo compared to concentrations
required to stimulate retinoic acid receptor-mediated transcription
in vitro. Journal of Clinical Investigation 90, 1269-74. [0238]
Duell, E. A., Astrom, A., Kang, S., Griffiths, C. E. M. and
Voorhees, J. (1994). All-trans, 9-cis and 13-cis retinoic acid each
induce a cytochrome P450 4-retinoic acid hydroxylase which causes
all-trans but not 9-cis or 13-cis retinoic acid to self-metabolize.
Society for Investigative Dermatology Abstracts 102, 641. [0239]
Fiorella, P. D., Giguere, V. and Napoli, J. L. (1993). Expression
of Cellular Retinoic Acid-binding Protein (Type II) in Escherichia
coli. The Journal of Biological Chemistry 268, 21545-21552. [0240]
Formelli, F., Barua, A. and Olson, J. (1996). Bioactivities of
N-(4-hydroxyphenyl) retinimide and retinoyl B-glucuronide. FASEB J.
10, 1014-1024. [0241] Frolik, C. A., Roberts, A. B., Tavela, T. E.,
Roller, P. P., Newton, D. L. and Sporn, M. B. (1979). Isolation and
identification of 4-hydroxy- and 4-oxoretinoic acid. In vitro
metabolites of all-trans retinoic acid in hamster trachea and
liver. Biochemistry 18, 2092-7. [0242] Gotoh, O. and
Fujii-Kuriyama, Y. (1989). Evolution, structure, and gene
regulation of cytochrome P-450. [0243] Green, S., Issemann, I. and
Sheer, E. (1988). A versatile in vivo and in vitro eukaryotic
expression vector for protein engineering. Nucleic Acids Research
16, 369-370. [0244] Gudas, L., Sporn, M. and Roberts, A. (1994).
Cellular biology and biochemistry of the retinoids. In: The
Retinoids. (M. Sporn, Roberts, A. and Goodman, D. S., Editors)
Raven Press, Inc.: New York. [0245] Heng, H. and Tsui, L-C. (1993).
Chromosome 102, 325-32. [0246] Hogan, B. et al., (1986). A
Laboratory Manual, Cold Spring Harbor, N.Y., Cold Spring Harbor
Laboratory. [0247] Hong, W. (1994). Retinoids and human cancer. In:
The Retinoids. (M. Sporn, Roberts, A. and Goodman, D. S., Editors)
Raven Press, Inc.: New York. [0248] Houbenwcyl, (1987). Methods of
Organic Chemistry, ed. E. Wansch. Vol. 151 and II. Thieme,
Stuttgart. [0249] Hozumi, N and Sandhu, J. S. (1993). Recombinant
antibody technology, its advent and advances. Cancer Invest. 11,
714-723. [0250] Huse et al., (1989). Science 246, 1275-1281. [0251]
Jones, B. B., Ohno, C. K., Allenby, G., Boffa, M., Levin, A. A.,
Grippo, J. F. and Petkovich, M. (1995). New Retinoid X Receptor
Subtypes in Zebra Fish (Danio rerio) Differentially Modulate
Transcription and Do Not Bind 9-cis Retinoic Acid. Mol. Cell. Biol.
15, 5226-5234. [0252] Kennett, R. (1979). Cell fusion. Methods
Enzymol. 58, 345-359. [0253] Kohler and Milstein. (1975). Nature
256, 495-497. [0254] Kozbor et al. (1983). Immunol. Today 4, 72.
[0255] Lammer, E. J., Chen, D. T., Hoar, R. M., Agnish, N. D.,
Benke, P. J., Braun, J. T., Curry, C. J., Fernhoff, P. M., Grix, A.
J., Lott, I. T. et al. (1985). Retinoic acid embryopathy. New
England Journal of Medicine 313, 837-41. [0256] Lansdorp, U.S. Pat.
No. 4,868,109. [0257] Lemoine, N. R. and Cooper, D. N. (1996). Gene
Therapy, Human Molecular Genetics Series, BIOS Scientific
Publishers, Oxford, U.K. [0258] Leo et al. (1989). Metabolism of
retinol and retinoic acid by human liver cytochrome P450I IC.sub.8.
Arch. Biochem. Biophys. 269, 305-312. [0259] Liang, P. and Pardee,
A. B. (1992). Differential display of eukaryotic messenger RNA by
means of the polymerase chain reaction. Science 257, 967-71. [0260]
Lichter, P. et al. (1990). High Resolution Mapping of Chromosome 11
by in situ hybridization by cosmid clones. Science 247, 64-9.
[0261] Lippman, S. M., Heyman, R. A., Kurie, J. M., Benner, S. E.
and Hong, W. K. (1995). Retinoids and chemoprevention: clinical and
basic studies. J. Cellular Biochem. Supplement 22, 1-10. [0262]
Lotan, R. M. (1995). Squamous differentiation and retinoids. Cancer
Treat. Res. 74, 43-72. [0263] Lotan, R. (1996). Retinoids in Cancer
Chemoprevention. Faseb J. 10, 1031-1039. [0264] Maden, M. and
Holder, N. (1992). Retinoic acid and development of the central
nervous system. [Review]. Bioessays 14, 431-8. [0265] Makin, G.,
Lohnes, D., Byford, V., Ray, R. and Jones, G. (1989). Target cell
metabolism of 1,25-dihydroxyvitamin D3 to calcitroic acid. Evidence
for a pathway in kidney and bone involving 24-oxidation.
Biochemical Journal 262, 173-80. [0266] Maniatis et al. (1982)
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. [0267] Mangelsdorf, D.
J. and Evans, R. M. (1995). The RXR Heterodimers and Orphan
Receptors. Cell 83, 841-850. [0268] Merrifield, (1964). J. Am.
Chem. Assoc. 85, 2149-2154. [0269] McCafferty et al., (1990).
Nature 348, 552-554. [0270] Mirski, S, and Cole, S. P. C. (1989).
Antigens associated with multidrug resistance in H69AR, a small
cell lung cancer cell line. Cancer Res. 49, 5719-5724. [0271]
Monia, B. P., Johnston, J. F., Geiger, T., Muller, M. and Fabbro,
D. (1996). Antitumor activity of a phosphorothioate antisense
oligodeoxynucleotide targeted against C-raf kinase. Nature Medicine
2, 668-75. [0272] Moon, R. C., Mehta, R. G. and Rao, K. V. N.
(1994). Retinoids and cancer in experimental animals. In: The
Retinoids. (M. Sporn, Roberts, A. and Goodman, D. S., Editors)
Raven Press, Inc.: New York. [0273] Morriss-Kay, G. (1993).
Retinoic acid and craniofacial development: molecules and
morphogenesis. [Review]. Bioessays 15, 9-15. [0274] Morriss-Kay, G.
M. (1996). Embryonic development and pattern formation. FASEB J.
10, 961-968. [0275] Morrison et al., (1985). Proc. Natl. Acad. Sci.
USA 81, 6851. [0276] Muindi, J. R. F., Frankel, S. R., Huselton,
C., DeGrazia, F., Garland, W., Young, C. W. and Warrell, R. P., Jr.
(1992). Clinical pharmacology of oral all-trans retinoic acid in
patients with acute promyelocytic leukemia. Cancer Research 52,
2138-2142. [0277] Muindi, J. R., Young, C. W. and Warrell, R. J.
(1994a). Clinical pharmacology of all-trans retinoic acid. Leukemia
8, 1807-1812. [0278] Muindi, J. R., Young, C. W. and Warrell, R. J.
(1994b). Clinical pharmacology of all-trans retinoic acid. Leukemia
8, s16-s21. [0279] Napoli, J. L., Boerman, M. H., Chai, X., Zhai,
Y. and Fiorella, P. D. (1995). Enzymes and binding proteins
affecting retinoic acid concentrations. J. Ster. Biochem. Mol.
Biol. 53, 497-502. [0280] Napoli, J. (1996). Retinoic acid
biosynthesis and metabolism. FASEB J. 10, 993-1001. [0281] Nelson,
D. R., Kamataki, T., Waxman, D. J., Guengerich, F. P., Estabrook,
R. W., Feyereisen, R., Gonzalez, F. J., Coon, M. J., Gunsalus, I.
C., Gotoh, O., Okuda, K. and Nebert, D. W. (1993). The P450
superfamily: update on new sequences, gene mapping, accession
numbers, early trivial names of enzymes, and nomenclature. DNA
& Cell Biology 12, 1-51. [0282] Old, R. W. and Primrose, S. B.,
In: Principles of Gene Manipulation. An Introduction to Genetic
Engineering, 4th ed. Oxford University Press. 63-66. [0283] Ohno,
C. K. and Petkovich, M. (1993). FTZ-F1 beta, a novel member of the
Drosophila nuclear receptor family. Mechanisms of Development 40,
13-24. [0284] Ohno, C. K., Ueda, H. and Petkovich, M. (1994). The
Drosophila nuclear receptors FTZ-F1 alpha and FTZ-F1 beta compete
as monomers for binding to a site in the fushi tarazu gene. Mol.
Cell Biol. 14, 3166-75. [0285] Ohyama, Y., Ozono, K., Uchida, M.,
Shinki, T., Kato, S., Suda, T., Yamamoto, O., Noshiro, M. and Kato,
Y. (1994). Identification of a vitamin D-responsive element in the
5'-flanking region of the rat 25-hydroxyvitamin D3 24-hydroxylase
gene. Journal of Biological Chemistry 269, 10545-50. [0286]
Petkovich, M., Brand, N. J., Krust, A. and Chambon, P. (1987). A
human retinoic acid receptor which belongs to the family of nuclear
receptors. Nature 330, 444-50. [0287] Pijnappel, W. W., Hendriks,
H. F., Folkers, G. E., van den Brink, C., Dekker, E. J.,
Edelenbosch, C., van der Saag, P. and Durston, A. J. (1993). The
retinoid ligand 4-oxo-retinoic acid is a highly active modulator of
positional specification. Nature 366, 340-4. [0288] Reddy, A. P.,
Chen, J., Zacharewski, T., Gronemeyer, H., Voorhees, J. J. and
Fisher, G. J. (1992). Characterization and purification of human
retinoic acid receptor-g1 overexpressed in the baculovirus-insect
cell system. Biochem. J. 287, 833-840. [0289] Rigas, J., Miller,
V., Zhang, Z. F., Klimstra, D., Tong, W., Kris, M. and Warrell, R.
(1996). Metabolic phenotypes of retinoic acid and the risk of lung
cancer. Cancer Res. 56, 2692-2696. [0290] Roberts, A. B., Nichols,
M. D., Newton, D. L. and Sporn, M. B. (1979a). In vitro metabolism
of retinoic acid in hamster intestine and liver. Journal of
Biological Chemistry 254, 6296-302. [0291] Roberts, A. B., Frolik,
C. A., Nichols, M. D. and Sporn, M. B. (1979b). Retinoid-dependent
induction of the in vivo and in vitro metabolism of retinoic acid
in tissues of the vitamin A-deficient hamster. Journal of
Biological Chemistry 254, 6303-9. [0292] Sambrook, J., Fritsch E.
F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual.
Cold Spring Harbor Lab Press, Cold Spring Harbor, N.Y. [0293]
Staerz & Bevan (1986a). Proc. Natl. Acad. Sci. (USA) 83, 1453.
[0294] Staerz & Bevan (1986b). Immunology Today 7, 241. [0295]
Stewart, A. J., Canitrot, Y., Baracchini, E., Dean, N. M., Deeley,
R. G., and Cole, S. P. C. (1996). Reduction of Expression of the
multidrug resistance protein (MRP) in human tumor cells by
antisense phosphorothioate oligonucleotides. Biochem. Pharamcol.
51, 461-469. [0296] Taimi, M. and Breitman, T. R. (1997).
N-4-hydroxyphenylretinamide enhances retinoic acid-induced
differentiation and retinoylation of proteins in the human acute
promyelocytic leukemia cell line, NB4, by a mechanism that may
involve inhibition of retinoic acid catabolism. Biochemical and
Biophysical Research Communications 232, 432-435. [0297] Takatsuka,
J., Takahashi, N. and De Luca, L. M. (1996). Retinoic Acid
Metabolism and Inhibition of Cell Proliferation: An Unexpected
Liaison. Cancer Research 56, 675-678. [0298] Takeda et al., (1985).
Nature 314, 452. [0299] Tanaguchi et al., European Patent
Publication EP171496. [0300] Teng, et al. (1982) Meth. Enzymol. 92.
3-16. [0301] Thaller, C. and Eichele, G. (1990). Isolation of
3,4-didehydroretinoic acid, a novel morphogenetic signal in the
chick wing bud. Nature 345, 815-9. [0302] Van Wauwe, J. P., Coene,
M.-C., Goossens, J., Van Nijen, G., Cools, W. and Lauwers, W.
(1988). Ketoconazole inhibits the in vitro and in vivo metabolism
of all-trans retinoic acid. The Journal of Pharmacology and
Experimental Therapeutics 245, 718-722. [0303] Van Wauwe, J. P.,
Coene, M.-C., Goossens, J., Cools, W. and Monbaliu, J. (1990).
Effects of cytochrome P450 inhibitors on the in vivo metabolism of
all-trans-retinoic acid in rats. The Journal of Pharmacology and
Experimental Therapeutics 252, 365-369. [0304] Van Wauwe, J., Van
Nyen, G., Coene, M., Stoppie, P., Cools, W., Goossens, J.,
Borghgraef, P. and Janssen, P. A. J. (1992). Liarazole, an
Inhibitor of Retinoic Acid Metabolism, Exerts Retinoid-Mimetic
Effects in Vivo. The Journal of Pharmacology and Experimental
Therapeutics 261, 773-779.
[0305] Ward et al., (1989). Nature 341.544-546. [0306] Warrell, R.
J. (1994). Applications for retinoids in cancer therapy. Seminars
in Hematol. 31, 1-13. [0307] Warrell, R. J., Maslak, P., Eardley,
A., Heller, G., Miller, W. J. and Frankel, S. R. (1994). Treatment
of acute promyelocytic leukemia with all-trans retinoic acid: an
update of the New York experience. Leukemia 8, 929-933. [0308]
White, J. A., Boffa, M. B., Jones, B. and Petkovich, M. (1994). A
zebrafish retinoic acid receptor expressed in the regenerating
caudal fin. Development 120, 1861-72. [0309] Williams, J. B. and
Napoli, J. L. (1987). Inhibition of retinoic acid metabolism by
imidazole antimycotics in F9 embryonal carcinoma cells. Biochemical
Pharmacology 36, 1386-1388. [0310] Wilson, G. M. and Deeley, R. G.
(1995). An episomal expression vector system for monitoring
sequence-specific effects on mRNA stability in human cell lines.
Plasmid 33, 198-207. [0311] Windhorst, D. B. (1982). The use of
isotretinoin in disorders of keratinization. Journal of the
American Academy of Dermatology 6, 708-9. [0312] Wouters, W., van,
D. J., Dillen, A., Coene, M. C., Cools, W. and De, C. R. (1992).
Effects of liarazole, a new antitumoral compound, on retinoic
acid-induced inhibition of cell growth and on retinoic acid
metabolism in MCF-7 human breast cancer cells. Cancer Research 52,
2841-6. [0313] Zierold, C., Darwish, H. M. and DeLuca, H. F.
(1995). Two vitamin D response elements function in the rat
1,25-dihydroxyvitamin D 24-hydroxylase promoter. Journal of
Biological Chemistry 270, 1675-8.
Sequence CWU 1
1
* * * * *