U.S. patent application number 12/601651 was filed with the patent office on 2010-08-12 for mutated structural protein of a parvovirus.
This patent application is currently assigned to MediGene AG. Invention is credited to Jorge Boucas, Hildegard Buening, Michael Hallek, Markus Hoerer, Kerstin Lux, John Nieland, Luca Perabo, Mirko Ritter.
Application Number | 20100203083 12/601651 |
Document ID | / |
Family ID | 39871952 |
Filed Date | 2010-08-12 |
United States Patent
Application |
20100203083 |
Kind Code |
A1 |
Lux; Kerstin ; et
al. |
August 12, 2010 |
MUTATED STRUCTURAL PROTEIN OF A PARVOVIRUS
Abstract
The present invention is related to a structural protein of a
parvovirus with an amino acid insertion at the insertion site
I-453, a library comprising the protein, a multimeric structure
comprising the protein, a nucleic acid encoding the protein, a
vector, virus or cell comprising the nucleic acid, a process for
the preparation of the protein, a medicament comprising the
protein, nucleic acid or multimeric structure as well as methods
and uses involving the protein, nucleic acid or multimeric
structure.
Inventors: |
Lux; Kerstin; (Munich,
DE) ; Buening; Hildegard; (Koeln, DE) ;
Perabo; Luca; (Koeln, DE) ; Nieland; John;
(Aarhus, DK) ; Boucas; Jorge; (Koeln, DE) ;
Hallek; Michael; (Koeln, DE) ; Ritter; Mirko;
(Planegg, DE) ; Hoerer; Markus; (Planegg,
DE) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Assignee: |
MediGene AG
Ludwig-Maximilians-Universitaet
Klinikum der Universitaet Zu Koeln
|
Family ID: |
39871952 |
Appl. No.: |
12/601651 |
Filed: |
June 2, 2008 |
PCT Filed: |
June 2, 2008 |
PCT NO: |
PCT/EP2008/004365 |
371 Date: |
March 5, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60932410 |
May 31, 2007 |
|
|
|
Current U.S.
Class: |
424/233.1 ;
435/236; 435/320.1; 514/1.1; 514/2.3; 514/21.3; 514/44R; 530/350;
536/23.72 |
Current CPC
Class: |
A61K 2039/5256 20130101;
C12N 2750/14145 20130101; C12N 7/00 20130101; C12N 2750/14121
20130101; A61P 37/00 20180101; A61P 35/04 20180101; C12N 2810/405
20130101; A61P 25/28 20180101; C07K 14/005 20130101; C07K 2319/40
20130101; C12N 2750/14122 20130101; C12N 15/86 20130101; C12N
2750/14143 20130101; A61K 2039/5258 20130101; A61P 31/00 20180101;
C07K 14/015 20130101 |
Class at
Publication: |
424/233.1 ;
530/350; 536/23.72; 435/320.1; 435/236; 514/12; 514/44.R |
International
Class: |
A61K 39/23 20060101
A61K039/23; C07K 14/015 20060101 C07K014/015; C07H 21/04 20060101
C07H021/04; C12N 15/63 20060101 C12N015/63; C12N 7/04 20060101
C12N007/04; A61K 38/16 20060101 A61K038/16; A61K 31/7088 20060101
A61K031/7088; A61P 37/00 20060101 A61P037/00; A61P 35/04 20060101
A61P035/04; A61P 25/28 20060101 A61P025/28; A61P 31/00 20060101
A61P031/00 |
Claims
1-51. (canceled)
52. A structural protein of a parvovirus which comprises an amino
acid insertion of one or more amino acids into I-453.
53. The structural protein of claim 52, wherein the amino acid
insertion is directly C-terminally of amino acid G.sub.453 in the
sequence of AAV-2 or the corresponding amino acid of any other
parvovirus.
54. The structural protein of claim 52, wherein the insertion is
located on the surface of the capsid formed by the structural
proteins.
55. The structural protein of claim 52, wherein the structural
protein with the insertion is capable of particle formation.
56. The structural protein of claim 52, wherein the parvovirus is
an adeno-associated virus.
57. The structural protein of claim 56, wherein the parvovirus is
selected from the group consisting of AAV-1, AAV-2, AAV-3b, AAV-4,
AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, b-AAV,
feline panleukopenia virus (FPV), canine parvovirus (CPV), B19,
goose parvovirus (GPV) and minute virus of mice (MVM), especially
FPV, CPV and B19.
58. The structural protein of claim 52, wherein the amino acid
insertion has a length of about 4 to about 30 amino acids.
59. The structural protein of claim 52, wherein the amino acid
insertion is selected from the group consisting of an epitope, a
B-cell epitope and a tolerogen-derived epitope.
60. The structural protein of claim 52, wherein the insertion is a
part of a protein selected from the group consisting of a tumor
antigen, a misfolded protein, a serum protein, a membrane protein,
a viral receptor, a TNF-family member and an interleukin.
61. The structural protein of claim 59, wherein the
tolerogen-derived epitope is derived from a protein from the group
consisting of CETP, CD20, acetylcholine receptors, IL13R, EGFR,
IgE, Melan A, HMW MAA, CA125, Her2/NEU, CCR5, L1 cell adhesion
molecule, VEGF, EGFR, CD20, TNF-.alpha., IL-6, IL9, IL-13, IL-17,
and .beta.-amyloid.
62. The structural protein of claim 61, wherein the
tolerogen-derived epitope is selected from the group consisting of
VNLTWSRASG, EFCINHRGYWVCGD, EDGQVMDVDLS, EKQRNGTLT,
TYQCRVTHPHLPRALMR, RHSTTQPRKTKGSG, DSNPRGVSAYLSR, TITCLVVDLAPSK,
KTKGSGFFVF, THPHLPRALMRS, GETYQCRVTHPHLPRALMRSTTK, LPRALMRS,
INHRGYWV, CDAGSVRTNAPD AKAVSNLTESRSESLQS, SLTGDEFKKVLET,
REAVAYRFEED, INPEIITLDG, DISVTGAPVITATYL, DISVTGAPVITA,
PKTVSNLTESSSESVQS, SLMGDEFKAVLET, QHSVAYTFEED, INPEIITRDG,
DISLTGDPVITASYL, DISLTGDPVITA, DQSIDFEIDSA, KNVSEDLPLPTFSPTLLGDS,
KNVSEDLPLPT, CDSGRVRTDAPD, FPEHLLVDFLQSLS, DAEFRHDSG,
HYAAAQWDFGNTMCQL, YAAQWDFGNTMCQ, RSQKEGLHYT, SSRTPSDKPVAHVVANPQAE,
SRTPSDKPVAHVVANP, SSRTPSDKP, NADGNVDYHMNSVP, DGNVDYHMNSV,
RSFKEFLQSSLRALRQ; FKEFLQSSLRA, and QMWAPQWGPD.
63. The structural protein of claim 52, wherein the amino acid
insertion brings about an increase in the transducing activity of
the parvovirus.
64. The structural protein of claim 63, wherein the amino acid
insertion mediates binding of the structural protein to a cell
membrane receptor.
65. The structural protein of claim 52, wherein the amino acid
insertion brings about an alteration in a chromatographic property
of the structural protein.
66. The structural protein of claim 52, wherein the parvovirus
structural protein comprises one or more further mutation(s) at a
site different to I-453 independently selected from a point
mutation, an internal deletion, an N-terminal deletion, an
insertion and a substitution.
67. The structural protein of claim 66, wherein the further
mutation is an insertion of a B-cell epitope or a cytotoxic T-cell
epitope.
68. The structural protein of claim 66, wherein the further
mutation reduces the transducing activity of the particle for a
given target cell by at least 50%.
69. The structural protein of claim 68, wherein the further
mutation is a mutation inactivating the HSPG binding site located
in the proximity of I-587.
70. The structural protein of claim 66, wherein the further
mutation reduces the ability to induce a B-cell response against a
parvovirus-specific epitope and/or mimotope.
71. A nucleic acid encoding a structural protein of claim 52.
72. A vector comprising a nucleic acid of claim 71.
73. A method for altering the tropism of a parvovirus, the method
comprising the steps of: a) co-expressing parvoviral helper and
vector functions, wherein the helper function expresses a
parvoviral structural protein according to claim 52 under
conditions that enable parvovirus formation, and b) isolating the
parvovirus.
74. A method for vaccinating a mammal, the method comprising the
vaccination of a mammal, with a structural protein according to
claim 52.
75. A method for breaking immune tolerance or treating an
infectious disease, the method comprising the vaccination of a
mammal with a structural protein according to claim 52.
76. Medicament comprising at least one parvovirus structural
protein according to claim 52 or a nucleic acid according to claim
71.
77. Method of treating and/or preventing a disease, the method
comprising the step of administering to a subject need thereof a
therapeutically effective amount of the medicament of claim 76,
wherein the disease is selected from the group consisting of an
allergic disease or asthma whereas at insertion site I-453 the
structural protein of a parvovirus comprises an anti-idiotypic
epi-/mimotope of an anti-IgE antibody or an IgE epi-/mimotope;
Alzheimer's disease whereas at insertion site I-453 the structural
protein of a parvovirus comprises a .beta.-amyloid epitope or
mimotope; atherosclerosis whereas at insertion site I-453 the
structural protein of a parvovirus comprises a CETP epitope or
mimotope; a tumor disease whereas at insertion site I-453 the
structural protein of a parvovirus comprises a tumor antigen; an
autoimmune disease or a chronic inflammatory disease, whereas at
insertion site I-453 the structural protein of a parvovirus
comprises an epitope or mimotope of a cytokine; and an infectious
disease whereas at insertion site I-453 the structural protein of a
parvovirus comprises an epitope or mimotope of a viral receptor.
Description
[0001] The present invention is related to a structural protein of
a parvovirus with an amino acid insertion at the insertion site
I-453, a library comprising the protein, a multimeric structure
comprising the protein, a nucleic acid encoding the protein, a
vector, virus or cell comprising the nucleic acid, a process for
the preparation of the protein, a medicament comprising the
protein, nucleic acid or multimeric structure as well as methods
and uses involving the protein, nucleic acid or multimeric
structure.
[0002] Monoclonal antibody therapies have been one of the most
successful therapy forms of new drug developments over the last
couple of years in therapeutic fields such as oncology, autoimmune
and inflammatory diseases. In monoclonal antibody therapies
patients are injected with a specific monoclonal antibody that
recognizes the antigen involved in the disease. Antibodies
recognize their antigen with the variable domain of the antibody
which is also referred to as the idiotype of the antibody.
[0003] However, monoclonal antibody therapies also have certain
drawbacks. It can be observed that, if the concentration of a
specific antibody with one particular idiotype is too high, the
patient's immune system develops an antibody response against the
idiotype of the therapeutic monoclonal antibody and thereby limits
its efficacy. This kind of antibody that recognizes an antibody's
idiotype is referred to as an anti-idiotypic antibody. In addition,
antibodies to monoclonal therapeutic antibodies directed against
other parts of the monoclonals often limit efficacy of a passive
antibody therapy. Therefore, many of the monoclonal antibody drugs
need to be used in combination with the traditional
immunosuppression regiments, increasing the overall treatment
costs. Furthermore, active suppression of the patient's immune
system is detrimental especially; if an intact immune system is
required to control the stage of disease such as for oncological
indications.
[0004] As being a passive vaccination against the target antigen
the monoclonal antibody has to be injected frequently depending on
the half life of the antibody within the serum of the patient.
Therefore, such treatments are expensive and inconvenient for the
patients.
[0005] An alternative for such monoclonal antibody therapies
already exists exemplified by a number of clinical developments
using anti-idiotypic antibodies as drugs. Such anti-idiotypic
antibody therapies are based on the fact (see above) that the
patient's immune system can induce an antibody response against the
idiotype of an antibody. If one uses a monoclonal antibody
expressing a functional imitation of a target epitope (paratope or
mimotope) as an idiotype, the patient's immune system will generate
a polyclonal antibody response wherein a subset of these antibodies
is able to cross-react with the target epitope in the patient. Such
antibody expressing a paratope is referred to as an anti-idiotypic
antibody (based on Jerne's network model of idiotypic relationships
(Jerne, 1974, Jerne et al., 1982). Thus, selective immunization
with an anti-idiotypic antibody can induce a specific immune
response directed against the original antigen (Varela and
Coutinho, 1991, Jefferis, 1993, Chatterjee et al., 1994).
[0006] Therefore, a vaccination with such an anti-idiotypic
antibody actively induces a polyclonal antibody response. As a
consequence such anti-idiotypic antibody vaccines have a number of
advantages over a passive immunization by a standard monoclonal
antibody. There is no antibody response towards the anti-idiotypic
antibody that limits its efficacy as exactly this immune response
is used as the therapeutic principle. Therefore, it is also not
necessary to combine the antibody treatment with an
immunosuppression regimen. And further, due to the fact that the
anti-idiotypic treatment is an active immunization, the drug only
has to be injected from time to time to boost the antibody response
generated by the patient himself maintaining a continuous titer of
specific antibodies. Additionally, anti-idiotypic antibodies induce
a polyclonal antibody response against the target antigen that
hampers the potential mechanism for resistance to the treatment of
e.g. in tumor cells.
[0007] However, anti-idiotypic antibody therapies face major
disadvantages. The titers of the induced polyclonal antibody
response obtained by the vaccination with anti-idiotypic antibodies
are often not high enough to establish a beneficial treatment. This
is due to the lack of a strong antigen as a vaccine, since
antibodies per definition are not very immunogenic. Furthermore, it
is difficult to generate specific anti-idiotypic vaccines because
of this lack of immunogenicity and technical difficulties to
identify anti-idiotypic antibodies.
[0008] A series of publications describes that an antigen placed in
the context of an ordered surface of a viral particle--here a
papilloma virus particle--can induce a B cell response that even
can abrogate B cell tolerance to such antigen by direct
crosslinking the respective B-cell receptor. Bovine papilloma
virus-like particles (VLPs) conjugated to an A.beta. peptide
through biotin were used to generate an immune response against the
self antigen A.beta. (Li et al., 2004). Further, this group used
bovine papilloma virus-like particles having the murine chemokine
receptor mCCR5 inserted into an immunodominant site of the viral L1
protein to immunize mice leading to sera with high anti-CCR5
antibody titers despite the fact that CCR5 is a self-antigen.
Further, a macaque L1-CCR5 fusion protein was used to immunize pig
tail macaques. 4 of the 5 test animals produced CCR5 specific
antibodies. In a further approach TNF-.alpha. was joined to VLPs by
way of a biotin-streptavidin interaction (Chackerian et al., 2001).
These VLPs were successful in generating an auto-antibody response
in mice, whereas these antibodies bound native TNF-.alpha.. (U.S.
Pat. No. 6,719,978).
[0009] Therefore, papilloma VLPs have been shown to be a suitable
backbone for the presentation of antigens to the immune system in
order to generate strong B cell responses, probably because of
their dense, ordered and closely packed array of vaccination
epitopes. Due do their exceptionally strong B cell induction
papilloma VLPs can be especially useful to overcome B cell
tolerance to self antigens.
[0010] However, linkage of epitopes via biotin is a complicated
process step that is difficult to perform under exactly controlled
conditions as required by regulatory authorities for an approved
drug. Further, the use of a bovine papilloma virus-backbone in
humans may generate a dominant immune response against the viral
backbone that the generated B-cell response against the inserted
epitope is to weak to generate a sufficient priming of B-cells,
which is especially important if tolerance has to be broken.
Additionally, papilloma viruses are very difficult to manufacture
in tissue culture and usually have to get isolated from warts.
Therefore, for applications were viruses are necessary that encode
a viral genome, papilloma viruses are unsuitable. One such
application is the generation of viral libraries of capsid variants
that can be used to screen a capsid mutant with certain properties
like displaying an epitope matching to a monoclonal antibody of
choice or an insert capable of binding to a cellular receptor of
choice.
[0011] For Adeno-associated virus of type 2 (AAV-2) it was
described in the past that the insertion of ligand peptides into
structural proteins results in capsids that are able to display the
ligand on the surface of the capsid and mediate transduction
through the interaction of the ligand with its receptor thereby
redirecting viral tropism by genetic capsid modifications (Girod et
al., 1999, Grifman et al., 2001, Nicklin et al., 2001, Shi et al.,
2001, Wu et al., 2000), which is referred to as hereinafter
retargeting. In particular, it has been demonstrated that the
insertion of an integrin binding Arg-Gly-Asp (RGD) motif at the
insertion site I-587 of the AAV capsid proteins VP-1 enabled AAV
particles to transduce cells via .alpha..sub.V.beta..sub.1
integrins (Aumailley et al., 1990, Girod et al., 1999). Successful
targeting of gene vectors such as AAV-2 is important to increase
the efficiency and safety of gene therapy, since it would allow to
restrict the gene transfer into the desired tissue, minimize the
risk associated with the transfer of potentially dangerous genes
into other cell types and increase the concentration of the
therapeutic gene product delivered to the ill tissue (Kay et al.,
2001, Pfeifer and Verma, 2001). Although other potential insertion
sites have been described for AAV-2, I-587 has by far been used
most successfully and can be regarded as the best site for capsid
modifications. Further, AAV-2 libraries displaying random peptide
inserts at the position I-587 have been reported that were
successfully screened for targeting mutants (Perabo et al., 2003,
Perabo, 2003, Waterkamp et al., 2006).
[0012] A further advantage of parvoviruses in this context is that
due to the high structural conservation of parvoviruses knowledge
obtained for e.g. AAV-2 can easily be transferred to other
parvoviruses. Whenever repeated administration of the product is
necessary the switch between different parvovirus backbones
displaying the same peptide/epitope can circumvent (neutralizing)
antibodies that have been raised in an earlier application.
[0013] However, an insertion within I-587--depending on its
use--may have certain disadvantages. The insertion of ligand
peptides into this site has been reported to ablate binding of
heparin sulphate proteoglycan (HSPG), which is AAV-2's primary
receptor, in some but not in all mutants (Perabo et al., 2006b).
This phenomenon is likely due to the fact that an insertion
interferes with at least two of the five positively charged amino
acids of the recently identified HSPG binding motif (Kern et al.,
2003, Opie et al., 2003), namely R.sub.585 and R.sub.588. Inserted
peptides containing a net negative charge are prone to confer an
HSPG nonbinding phenotype, while positive charges facilitate the
interaction with HSPG (Perabo et al., 2006b). Conclusively, the
interference of the HSPG binding site with the insertion site I-587
limits its universal applicability.
[0014] Generally speaking one can expect a certain interference of
an inserted peptide/ligand with its surrounding amino acids of the
capsid backbone. Such interference determines which kind of insert
is acceptable for the viral capsid at a specific site. If another
site is used for insertions, one can expect that the backbone
context is different and different peptides can successfully be
integrated. Therefore, the "ideal" peptide (e.g. for targeting the
virus) may interfere at one site but may perfectly fit at another
site.
[0015] In case of vaccination purposes HSPG binding might be
necessary or at least useful for the capsids to enter predendritic
cells, whose activation is needed to exert a T.sub.H1-response.
Consequently, the insertion of a B-cell epitope into I-587 may
ablate HSPG binding and therefore would not trigger a
T.sub.H1-response. Additionally, viruses with an intact HSPG
binding motif can still be efficiently purified using common
heparin affinity chromatography.
[0016] Further, the combination of I-587 with a further insertion
site would be ideal to increase the density of B-cell epitopes on
the surface of the capsid or to display two different epitopes
expressed from a single cap gene--in contrast to mosaic capsids
generated by co-expressing more than one different cap gene, which
is disadvantageous from a regulatory stand point.
[0017] Taken together these facts and considerations suggest that
AAV and other parvoviruses are suitable backbones for vaccination
purposes and/or retargeting approaches in the gene therapy context,
but an additional insertion site with equal or improved properties
is needed. Therefore, the underlying problem of the present
invention is the identification of a further insertion site being
an alternative or even superior to I-587, in which peptides can be
inserted alone or in combination with insertions into e.g. I-587,
which peptides are displayed on the surface of a capsid and which
peptides are at least bound by a respective antibody and for the
use of retargeting viral vectors can mediate transduction of target
cells.
[0018] It has now been surprisingly found that the position after
amino acid G.sub.453 of AAV-2 is especially suitable for such
insertions.
[0019] Accordingly, the major object of the present invention is a
structural protein of AAV which comprises an amino acid insertion
of one or more amino acids located directly adjacent to amino acid
G.sub.453 in the sequence of AAV-2 or to the corresponding amino
acid of an AAV-2 variant or of any other parvovirus. Preferably,
the amino acid insertion is directly C-terminal of amino acid
G.sub.453 in the sequence of AAV-2 or the corresponding amino acid
of any other parvovirus.
[0020] Insertions near, but not exactly at this site have
previously been suggested but were only of no or limited success.
The insertion of the 14-amino-acid peptide L14 after amino acid
R.sub.447 (I-447) (Girod et al., 1999) led to intact capsids as the
conformation-sensitive antibody A20 still reacted with it. Further,
an L14-specific antibody specifically recognized the insert in an
ELISA. The mutant capsid was further able to specifically bind to
cells expressing the L14-specific integrin receptor. However,
successful transduction did not occur for the insertion in I-447 in
such cells--in contrast to a mutant capsid with the same insertion
at I-587. These data show that in principle it is possible to
insert peptides at I-447 as capsids are still formed and the
inserted peptide is displayed on the surface of the protein, but at
least for the L14 peptide such insertion does not lead to a
successful transduction suggesting that I-447 is not an ideal
candidate for insertions in general.
[0021] Also Wu et al. (Wu et al., 2000) report the insertion of a
hemagglutinin (HA) peptide at the position I-447. Indeed, the
mutated structural protein shows intermediate capsid formation and
transduction (table 5, page 8643) but clearly this insertion site
is inferior to I-587.
[0022] Further, Grifman et al. inserted a Myc epitope between
T.sub.448 and N.sub.449 (referred to as by the authors 449Myc, see
FIG. 3B; and herein I-448) (Grifman et al., 2001). The Myc epitope
was accessible to an anti-Myc antibody and was therefore present on
the surface of the capsid. Whereas successful retargeting was again
reported for the insertion after N.sub.587 (here the insertion of
an NGR motif that mediates binding to CD13), no data on the
retargeting using the I-449 site was presented indicating that
retargeting was again not successful despite the fact that this
site can be used to display inserts on the surface of a capsid.
[0023] In another study the insertion of an RGD4C peptide inserted
after amino acid R.sub.459 severely diminished transducing titers,
whereas the insertion of the same peptide at positions A.sub.139,
Q.sub.584 and R.sub.588 were well tolerated (Shi and Bartlett,
2003).
[0024] Due to the near .beta.-barrel structures that might get
affected by insertions at I-453, one would not have expected that
I-453 actually is a superior insertion site or at least an
alternative insertion site compared to I-587.
[0025] Surprisingly, in the context of the present invention
insertions directly C-terminally of G.sub.453 of AAV-2 were found
to be superior or at least a valid alternative to I-587.
[0026] As further detailed below peptide sequences that have been
successfully inserted after G.sub.453 and that were displayed on
the capsid surface, were recognized by peptide-specific antibodies
and--in case of a targeting mutant--mediated viral transduction.
When aligning amino acid sequences of various parvoviruses it has
surprisingly been found that G.sub.453 of AAV-2 is conserved among
all adeno-associated viruses included in the alignment and some
more distantly related parvoviruses such as FPV, CPV and B19 (see
FIG. 2). Previously published alignments of this region do not
reveal this conserved amino acid (Grifman et al., 2001) FIG. 1, A
and B, Loop III, (Girod et al., 1999) FIG. 1c). Accordingly, the
invention is not limited to AAV-2 but is also applicable to other
parvoviruses as defined below. Additional parvovirus sequences can
easily be aligned to the provided alignment (FIG. 2).
[0027] Therefore, insertions can be made at the herein defined
insertion site I-453, being an insertion located directly N- or
C-terminally, preferably C-terminally of one amino acid in the
sequence of 5 amino acids N- or C-terminal of the corresponding
amino acid to AAV-2's G.sub.453, preferably 3, more preferably 1,
especially directly N- or C-terminal, in particular C-terminal, of
the corresponding amino acid to AAV-2's G.sub.453. This means that
the insertion site I-453 corresponds to the amino acids listed in
Table 1.
TABLE-US-00001 TABLE 1 I-453 Parvovirus Amino acid no. Amino acid
seq. SEQ ID NO: AAV-2 G.sub.453 N T P S G T T T Q S SEQ ID NO: 1
AAV-5 G.sub.446 N N T G G G V Q F N K SEQ ID NO: 2 AAV-1 G.sub.454
Q N Q S G S A Q N K SEQ ID NO: 3 AAV-6 G.sub.454 Q N Q S G S A Q N
K SEQ ID NO: 4 AAV-8 G.sub.456 Q T T G G T A N T Q SEQ ID NO: 5
AAV-10 G.sub.456 Q S T G G T Q G T Q SEQ ID NO: 6 AAV-3b G.sub.454
G T T S G T T N Q S SEQ ID NO: 7 AAV-7 G.sub.456 S N P G G T A G N
R SEQ ID NO: 8 AAV-4 G.sub.445 S T T T G T T L N A SEQ ID NO: 9
AAV-11 G.sub.444 S T T S G E T L N Q SEQ ID NO: 10 b-AAV G.sub.447
S T T S G G T L N Q SEQ ID NO: 11 FPV G.sub.307 F G D I G V Q Q D K
SEQ ID NO: 12 CPV G.sub.271 F G D I G V Q Q D K SEQ ID NO: 13 B19
G.sub.268 P D T L G G D P K F SEQ ID NO: 14 GPV Y.sub.323 V S A T Y
T E G E A SEQ ID NO: 15 MVM T.sub.309 A G T L T A Q G S R SEQ ID
NO: 16 indicates the most preferred insertion site within I-453 for
each structural protein listed.
[0028] As the previously known insertion site I-587, I-453 lies
within the C-terminal region of the CAP proteins that is present in
VP-1, VP-2 and VP-3. Consequently, an insertion of a coding DNA
sequence in frame into the cap gene at the corresponding site of
I-453 leads to a respective amino acid insertion into VP-1, VP-2
and VP-3 (see FIG. 1).
[0029] The following definitions explain how the defined terms are
to be interpreted in the context of the products, methods and uses
of the present invention:
[0030] A "structural protein" means a protein that is part of the
capsid of the virus. For parvoviruses the structural proteins are
generally referred to as VP-1, VP-2 and/or VP-3, encoded by the cap
gene. The amino acid sequences of structural proteins of
parvoviruses are well known in the art. They are conserved within
the parvoviruses. Amino acid positions provided herein that are not
further specified refer to the AAV-2 sequence of the major coat
protein VP-1 as published by Ruffing et al. (Ruffing et al., 1994);
Genpept Accession No. 2906023).
[0031] A "mutated structural protein" means a structural protein
that has at least one mutation in comparison to the respective
structural protein of the wild-type virus.
[0032] A "parvovirus" means a member of the family of Parvoviridae
containing several genera divided between two subfamilies
Parvovirinae (Parvovirus, Erythrovirus, Dependovirus, Amdovirus and
Bocavirus) and Densovirinae (Densovirus, Iteravirus,
Brevidensovirus, Pefudensovirus and Contravirus) (Fields: Virology,
fourth edition 2001, Volume 2, chapters 69 (especially Table 1) and
70, Lippincott Williams Wilkins, Philadelphia;
http://virus.stanford.edu/parvo/parvovirus.html,
http://www.ncbi.nlm.nih.gov/ICTVdb/Ictv/fs_parvo.htm#SubFamily1).
Preferred parvoviruses are members of the genus Parvovirus such as
AAV-1, AAV-2, AAV-3b, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9,
AAV-10, AAV-11, AAV-12, bovine AAV (b-AAV), canine AAV (CAAV),
canine parvovirus (CPV), mouse parvovirus, minute virus of mice
(MVM), B19, H1, avian AAV (AAAV), feline panleukopenia virus (FPV)
and goose parvovirus (GPV). More preferred parvoviruses are those
that have a conserved G aligning to G.sub.453 of AAV-2, which are
AAV-1, AAV-2, AAV-3b, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-10,
AAV-11, FPV, CPV and B19 (see FIG. 2). Most preferred are AAV-2,
AAV-1 and AAV-6.
[0033] An "epitope" is the part of a macromolecule that is
recognized by the immune system, specifically by antibodies, B
cells, or cytotoxic T cells. Although epitopes are usually thought
to be derived from nonself proteins, sequences derived from the
host that can be recognized are also classified as epitopes.
Epitopes have a length of at least 4 amino acids, preferably 4 to
30 amino acids, more preferably 5 to 20 amino acids, especially 5
to 15 amino acids. Epitopes can be linear or three-dimensional
formed typically by amino acids that are distant from each other in
the primary protein structure but become closely related in a
secondary and/or tertiary structure. Epitopes that are specifically
recognized by B cells are referred to as B-cell epitopes.
[0034] A "tolerogen" is a self-antigen that is--in its natural
environment--accessible to the humoral immune system. It may be
either secreted or otherwise released from a living cell or
associated to the outer surface of or integrated into the cellular
membrane. Generally speaking tolerogens do--under normal
circumstances in contrast to e.g. autoimmune diseases--not evoke a
specific immune response due to tolerance against the antigen which
results from a previous exposure to the same antigen. Tolerance can
occur due to central tolerance or peripheral tolerance. Central
tolerance refers to tolerogens which corresponding antigens have
been exposed to T cells in the thymus leading to elimination of the
specific T cells. Peripheral tolerance occurs when
antigens/epitopes/mimotopes/paratopes are presented to T cells
without appropriate additional stimuli, commonly provided by
inflammation leading to anergy. Still, it has been observed that
tolerogens can induce to some extent regulatory B-cell responses
(Vogel et al., 2004).
[0035] In one preferred embodiment this invention relates to
tolerogens due to peripheral tolerance, preferably tolerogens
derived from tumor antigens/epitopes/mimotopes/paratopes.
Tolerogens encompassed by this invention include peptides, nucleic
acids, carbohydrates, and lipids, preferably peptides.
[0036] Preferred tolerogens are antigens on the surface of a cell,
especially tumor cells, e.g. receptors, especially growth factor
receptors (preferably EGFR), tumor antigens (preferably Her2/NEU,
Melan A, high molecular weight melanoma associated antigen (HMW
MAA), CA125), viral receptors (CCR5), CD20, acetylcholine
receptors, interleukin receptors (IL-13 receptor). Further
preferred tolerogens can be blood proteins (preferably CETP),
interleukins (preferably IL-6, IL-9, IL-13, IL-17), cytokines,
TNF-family members (preferably TNF-.alpha.), immunoglobulins
(preferably IgE), complement factors, misfolded proteins
(preferably .beta.-ayloid) and growth factors (preferably
VEGF).
[0037] A "tolerogen-derived epitope" of a specific tolerogen in the
context of the products, methods and uses of the present invention
refers to a B-cell epitope that [0038] i) is identical to a B-cell
epitope of the tolerogen, [0039] ii) a derivative (e.g. a mutant)
of a B-cell epitope of the tolerogen that crossreacts with an
antibody that binds the B-cell epitope of the tolerogen, [0040]
iii) a mimotope of a B-cell epitope of the tolerogen, and/or [0041]
iv) a paratope of a B-cell epitope of the tolerogen. [0042] The
length of a tolerogen-derived epitope is typically 4-30, preferably
5-20 and most preferably 5-15 amino acids.
[0043] The derivative of a B-cell epitope of a tolerogen may be
generated by one or more amino acid substitutions, preferably one
or more conservative amino acid substitutions, i.e. substitutions
that take place within a family of amino acids that are related in
their side chains and chemical properties. Examples of such
families are amino acids with basic side chains, with acidic side
chains, with non-polar aliphatic side chains, with non-polar
aromatic side chains, with uncharged polar side chains, with small
side chains, with large side chains etc. Further, derivatives may
be obtained by one or more single amino acid deletion(s) and/or
insertion(s).
[0044] "Crossreaction" or "crossreact" of B-cell epitopes with a
specific monoclonal antibody means according to this invention that
the its affinity (K.sub.D; see below) of the epitopes with the
antibody are within two magnitudes, preferably within one magnitude
when comparing the B-cell epitope to its derivative.
[0045] Tolerogen-derived epitopes within the multimeric structure
comprising parvovirus mutated structural proteins according to this
invention are identical, resemble or mimic antigen stretches of a
tolerogen that are--in their natural environment--accessible to the
immune system, e.g. epitopes of membrane protein located in the
extracellular part, serum proteins, immunoglobulins, plaque
proteins. Such antigen stretches are preferably located on the
surface of such protein within the body of a mammal, preferably a
human.
[0046] A "mimotope" is a non-linear structural epitope composed of
several amino acids derived from different regions of the linear
sequence of the structural protein located in close neighborhood
due to the overall tertiary structure of the capsid that is
specifically bound by an antibody, or a linear epitope mimicking a
discontinuous epitope of the structural protein.
[0047] A "paratope" is the antigen binding site that is
specifically bound by an antibody.
[0048] The mimotope or paratope in the context of the present
invention might consist of (parts of) the inserted peptide sequence
alone or might be composed of inserted peptide and parvovirus core
particle amino acid residues.
[0049] An "insertion" of (an) amino acid(s) is generally speaking
an insertion of at least one heterologous amino acid into the
sequence of--for this invention--a parvovirus structural protein.
`Heterologous` in this context means heterologous as compared to
the virus, from which the parvovirus structural protein is derived
from. The inserted amino acids can simply be inserted between two
given amino acids of the parvovirus structural protein. An
insertion of amino acids can also go along with a deletion of given
amino acids of the parvovirus sturctural protein at the site of
insertion, leading to a complete substitution (e.g. 10 given amino
acids are substituted by 10 or more inserted amino acids) or
partial substitution (e.g. 10 given amino acids are substituted by
8 inserted amino acids) of amino acids of the parvovirus structural
protein.
[0050] The term "binder" refers to a molecule that specifically
binds to its respective binding partner. Commonly used binders are
antibodies, especially monoclonal antibodies, antibody derivatives
such as single chain antibodies or antibody fragments. In principle
all classes of antibodies can be used, preferred are IgG
antibodies. Fragments or multimers of antibodies can equally be
used. Commonly used fragments are single chain antibodies, Fab- or
(Fab).sub.2-fragments. Examples of other suitable binders are
protein scaffolds such as anticalins or lipocalins (Nygren and
Skerra, 2004), receptors or parts thereof (e.g. soluble T-cell
receptors), ankyrine, microbodies or aptamers.
[0051] The term "specifically binds" means that two molecules A and
B, preferably proteins, bind to each other thereby generating
complex AB with an affinity (K.sub.D=k.sub.off/K.sub.on) of at
least K.sub.D=1.times.10.sup.-5 mol/l, preferably 1.times.10.sup.-7
mol/l, more preferably 1.times.10.sup.-8 mol/l, especially
1.times.10.sup.-9 mol/l.
[0052] "Heterologous" in the context of the present invention means
a peptide sequence, e.g. an epitope that is not present on the
parvovirus wild-type viral capsid and/or structural protein.
[0053] The term "antigen" in the context of the products, methods
and uses of the present invention refers to any target antigen
against which an immune reaction should be induced. Such target
antigens are usually antigens that are susceptible to the humoral
immune response. They are usually proteins that may be
posttranslationally modified, as for example glycosylated proteins.
Preferred antigens are serum proteins, proteins that can be found
at least under certain conditions (e.g. in a disease state) in the
blood (e.g. CETP, IL-6, IL-17, TNF-.alpha.), and membrane proteins,
especially receptor proteins (e.g. CD20, acetylcholine receptors,
IL13R, EGFR). Especially preferred antigens are IgE, tumor-antigens
(e.g. Melan A, high molecular weight melanoma associated antigen
(HMW MAA), CA125, IL13R, Her2/NEU, L1 cell adhesion molecule),
VEGF, EGFR, CD20, CETP (cholesterol ester transfer protein),
TNF-family members (e.g. TNF-.alpha.), interleukins (IL-9, IL-6,
IL-13, IL-17), or misfolded proteins leading to a protein
aggregation and, therefore, causing conformational diseases (for an
overview see Uversky et al., 2006, e.g. .beta.-amyloid). Excluded
from the above definition of "antigen" are parvovirus antigens,
i.e. antigens inherent the unmutated parvovirus itself, e.g.
derived from B19 (Klenerman et al., 2002).
[0054] By inserting amino acids at I-453 the inserted amino acids
are located on the surface of the capsid formed by the structural
proteins. The display of the amino acids on the surface enables the
insertion to exert their vaccination or targeting function.
[0055] Insertions at position I-453 did not interfere with particle
formation of the capsid proteins. The structural protein of the
present invention shows advantageous characteristics, in particular
if the claimed structural proteins are to be used for vaccination
purposes, as it is believed that ordered/virus-like particles are
superior to exert a strong and insertion-specific immune response.
However, as was shown for human papilloma virus-like particles also
capsid subunits like capsomeres were able to be used for
vaccination purposes. As a vaccination with a particle containing a
genome is a gene therapy it is preferred to use inactivated (e.g.
by gamma or UV-irradiation) genome-containing AAV particles, or
virus-like particles of the respective parvovirus. Such virus-like
particles (or in brief particles) are capsid-like structures that
are composed of the structural proteins of the respective
parvovirus, e.g. VP-1, VP-2 and/or VP-3, or parts thereof such as
N- or C-terminal truncated structural proteins but do essentially
not contain a viral genome. VP-2 alone has been shown to assemble
into virus-like particles and can be expressed in various
expression systems such as bacteria e.g. E. coli, yeasts, e.g.
Saccharomyces cerevisiae, hansenula polymorpha, Pichia pastoris, in
insect cells, e.g. the baculovirus expression system (SF9, SF+ or
High Five cells), or in mammalian cells (such as CHO, HeLa, 293,
BHK, or PerC6).
[0056] As far as the context of gene therapy is concerned, where
viral vectors are constructed, the capability of forming particles
such as capsids is an highly preferred feature, as intact particles
are in general needed to package a viral genome carrying the
transgene.
[0057] In a preferred embodiment the parvovirus is an
adeno-associated virus, preferably selected from the group
consisting of AAV-1, AAV-2, AAV-3b, AAV-4, AAV-5, AAV-6, AAV-7,
AAV-8, AAV-9, AAV-10, AAV-11, AAV-12 and b-AAV, especially selected
from the group consisting of AAV-1, AAV-2, AAV-5 and AAV-8. In a
further preferred embodiment the parvovirus is selected from the
group consisting of bovine AAV (b-AAV), canine AAV (CAAV), canine
parvovirus (CPV), mouse parvovirus, minute virus of mice (MVM),
B19, H1, avian AAV (AAAV), feline panleukopenia virus (FPV) and
goose parvovirus (GPV), more preferably FPV, CPP, B19, GPV and MVM,
especially FPV, CPV and B19.
[0058] The claimed structural protein contains an amino acid
insertion that has a length of about 4 to about 30 amino acids,
preferably about 5 to about 20, most preferably about 5 to about 15
amino acids. Typically, the size of a B-cell epitope is at least 5
amino acids (US 2004/0228798A1). Same is true for a number of known
amino acid sequences suitable as targeting sequences. Larger
inserts are likely to interfere with each other. It is also
encompassed by this invention that one insert comprises more than
one functional amino acid sequence (e.g. epitopes and/or targeting
sequences) in a row. For example the insert can comprise 2, 3, 4, 5
or 6 identical inserts in a row or 2, 3, 4, 5 or 6 different
functional amino acid sequences such as different epitopes.
[0059] The nature of the amino acid insertion is preferably an
epitope, especially a B-cell epitope. Epitopes are generally
preferred if the structural proteins are modified to be suitable
for vaccination purposes. The epitopes can be known B-cell epitopes
that have been identified as linear epitopes, paratopes or sequence
that form mimotopes. Therefore, B-cell epitopes can be both linear
and structural. However, it is especially preferred to use linear
epitopes that are no mimotopes.
[0060] Further, the epitopes can be sequences that have been
identified by phage display or by AAV display, where a library of
amino acid sequences is displayed on the surface of phages or AAV
and such phages/AAVs are identified that specifically bind to a
specific binder, especially an antibody of choice. The inserted
amino acid sequence can be sequenced and transferred into I-453. In
a preferred embodiment the amino acid sequence is directly
identified from an AAV-library, where the library of amino acid
sequences had been inserted into I-453, for example in analogy to
the AAV-2 libraries described in (Perabo et al., 2003, Lieber,
2003, Muller et al., 2003) (WO 03/054197). In this context the
advantage is used that the amino acid insert is identified in the
same surface context as it is used for vaccination later on.
Therefore, the conformation is not changed compared to settings
where an epitope is transferred from an original context (e.g. from
an antigen or from a phage) to the site I-453.
[0061] In a preferred embodiment the B-cell epitope is heterologous
to the parvovirus.
[0062] In an especially preferred embodiment the inserted B-cell
epitope is a tolerogen-derived epitope. As described above it is
especially difficult to break tolerance and structural proteins
according to this invention are especially suitable for this
purpose. Preferred tolerogen-derived epitopes are derived from IgE,
CETP, CCR5, HER2/Neu, TNF-.alpha., IL-17, IL-6 or .beta.-amyloid,
preferably human IgE and human .beta.-amyloid, exemplified by the
following preferred epitopes:
TABLE-US-00002 IgE epitopes: (SEQ ID NO: 50) VNLTWSRASG ("Kricek")
(SEQ ID NO: 55) EFCINHRGYWVCGD ("Rudolf") (SEQ ID NO: 85)
EDGQVMDVDLS ("Flex") (SEQ ID NO: 86) EKQRNGTLT ("Bind-2") (SEQ ID
NO: 87) TYQCRVTHPHLPRALMR ("3DEpi1") (SEQ ID NO: 88) RHSTTQPRKTKGSG
("3DEpi2") (SEQ ID NO: 89) DSNPRGVSAYLSR (3DEpi3) (SEQ ID NO: 90)
TITCLVVDLAPSK ("3DEpi4") (SEQ ID NO: 91) KTKGSGFFVF ("C4E") (SEQ ID
NO: 92) THPHLPRALMRS ("Wang-CS") (SEQ ID NO: 93)
GETYQCRVTHPHLPRALMRSTTK ("Wang") (SEQ ID NO: 94) LPRALMRS ("C21")
(SEQ ID NO. 95) INHRGYWV ("C4M") CETP epitopes: (SEQ ID NO: 60)
CDAGSVRTNAPD (SEQ ID NO: 96) AKAVSNLTESRSESLQS ("CETP TP10") (SEQ
ID NO: 97) SLTGDEFKKVLET ("CETP TP11") (SEQ ID NO: 98) REAVAYRFEED
("CETP TP12") (SEQ ID NO: 99) INPEIITLDG ("CETP TP13") (SEQ ID NO:
100) DISVTGAPVITATYL ("CETP TP18") (SEQ ID NO: 101) DISVTGAPVITA
("CETP TP20A") (SEQ ID NO: 102) PKTVSNLTESSSESVQS ("hTP10") (SEQ ID
NO: 103) SLMGDEFKAVLET ("hTP11") (SEQ ID NO: 104) QHSVAYTFEED
("hTP12") (SEQ ID NO: 105) INPEIITRDG ("hTP13") (SEQ ID NO: 106)
DISLTGDPVITASYL ("hTP18") (SEQ ID NO: 107) DISLTGDPVITA ("hTP20")
(SEQ ID NO: 108) DQSIDFEIDSA ("hRitsch-1") (SEQ ID NO: 109)
KNVSEDLPLPTFSPTLLGDS ("hRitsch-2") (SEQ ID NO: 110) KNVSEDLPLPT
("hRitsch-3") (SEQ ID NO: 111) CDSGRVRTDAPD ("hCETP-intern") (SEQ
ID NO: 112) FPEHLLVDFLQSLS ("hCETP C-Term") .beta.-amyloid epitope:
(SEQ ID NO: 65) DAEFRHDSG CCR5 epitopes: (SEQ ID NO: 113)
HYAAAQWDFGNTMCQL (Chackerian, 1999) (SEQ ID NO: 114) YAAQWDFGNTMCQ
(Barassi et al., 2005) (SEQ ID NO: 115) RSQKEGLHYT (Misumi et al.,
2006) TNF-.alpha. epitopes: (SEQ ID NO: 116) SSRTPSDKPVAHVVANPQAE
("TNF-.alpha.V1") (SEQ ID NO: 117) SRTPSDKPVAHVVANP
("TNF-.alpha.V2") (SEQ ID NO: 118) SSRTPSDKP ("TNF-.alpha.V3")
IL-17 epitopes: (SEQ ID NO: 119) NADGNVDYHMNSVP ("IL-17 V1") (SEQ
ID NO: 120) DGNVDYHMNSV ("IL-17 V2") IL-6 epitopes: (SEQ ID NO:
121) RSFKEFLQSSLRALRQ ("IL-6 V1") (SEQ ID NO: 122) FKEFLQSSLRA
("IL-6 V2") HER2/Neu epitope: (SEQ ID NO: 123) QMWAPQWGPD (Riemer
et al. 2007).
[0063] As described earlier it is one embodiment to modify
structural proteins in order to retarget the parvovirus to a
different cell or tissue. Therefore, in another preferred
embodiment of the present invention the amino acid insertion is a
sequence that brings about an increase in the transducing activity
of the mutated parvovirus. Increase in the transducing activity
according to this invention means preferably that the ratio of
genomic particles divided by transducing particles (GenP/tP) as
determined in Example 6.1 is lowered for a cell line of choice
compared to the respective unmutated parvovirus. An increase in
this context preferably refers to a decrease of GenP/tP of at least
about 25%, more preferably at least about 100%, still more
preferably at least about 300%, most preferably at least about
1000%.
[0064] Such increase in the transducing activity is usually
accomplished by an amino acid insertion that mediates binding of
the structural protein in the form of a particle to a cell membrane
receptor. These inserted targeting sequences can be known ligands
or parts thereof for a given receptor. Further, the targeting
sequences can be sequences that have been identified by phage
display or by AAV display, where a library of amino acid sequences
is displayed on the surface of phages or AAV and such phages/AAVs
are identified that specifically bind to a receptor of choice. The
inserted amino acid sequence can be sequenced and transferred into
I-453. In a preferred embodiment the amino acid sequence is
directly identified from an AAV-library, where the library of amino
acid sequences had been inserted into I-453, for example in analogy
to the AAV-2 libraries described in (Perabo et al., 2003, Lieber,
2003, Muller et al., 2003), (WO 03/054197). In this context the
advantage is used that the amino acid insert is identified in the
same surface context as it is used later on. Therefore, the
conformation is not changed compared to settings where a targeting
sequence is transferred from an original context (e.g. as part of
ligand or from a phage) to the site I-453.
[0065] In an especially preferred embodiment the inserted targeting
sequence does contain an RGD motif, especially it is the sequence
ACDCRGDCFCA (SEQ ID NO: 84), herein referred to as RGD-4C peptide.
The RGD motif in general and especially the RGD-4C peptide mediate
the binding to the integrins, especially .alpha..sub.V.beta..sub.3
and .alpha..sub.V.beta..sub.5. Consequently, these structural
proteins can be used to target cells expressing these
integrins.
[0066] In a further preferred embodiment the insertion brings about
an alteration in a chromatographic property of the structural
protein. It is preferred to insert a known tag that can be used for
binding the structural protein or a particle composed of the
structural protein to a ligand. Such tags are well known in the
art. Examples are given in Table 2.
TABLE-US-00003 TABLE 2 Tags and corresponding ligands Tag Ligand
HIS Nickel GST Glutathione Protein A IgG Biotin or Strep
Streptavidin Calmodulin-binding peptide Calmodulin Fc-Peptide of
IgG Protein A Flag FLAG- or 3xFLAG peptide HA (hemagglutinin) HA
peptide
[0067] Depending on their use the particles of this invention may
have to be purified to high purity. Otherwise unmodified structural
proteins can be modified by insertion to alter their
chromatographic properties as it has been described in WO 01/05991.
In case of AAV-2 the HSPG binding capabilities due to the loop
structure around I-587 remain unchanged if a tag is inserted into
I-453. Furthermore, modified structural proteins that comprise for
example a targeting insert and/or an epitope at a site different to
I-453 can be further modified to display a tag that enables simple
and scalable purification to high purity.
[0068] The insertion according to this invention may have an N-
and/or C-terminal linker. A linker according to this invention is a
further stretch of at least one amino acid N- and/or C-terminal of
the inserted epitope, targeting sequence or tag, preferably of 2-12
amino acids. Preferred amino acids for the linker are amino acids
selected from the group consisting of Ala, Gly, Ser, Pro, and Cys,
especially 3 Ala upstream and 2 downstream of the B-cell epitope, 5
Ala upstream and 5 downstream of the B-cell epitope, or 3-5 Gly
upstream and 3-5 Gly downstream of the B-cell epitope.
[0069] In a further preferred embodiment the insertion comprises
linker sequences which enable a circularization of the inserted
peptide sequences in order to better display the insertion.
Accordingly spacer sequences are selected to form Zinc-fingers
(Zn-finger), well known in the art. Preferred Zn-finger motifs are
CXXC or C.sub.2H.sub.2:. Preferred Zn-finger motifs are
C.sub.2H.sub.2, C.sub.4, and C.sub.2HC including but not limited to
motifs CX.sub.2CX.sub.nC.sub.2, CX.sub.2CX.sub.10-30CX.sub.2C,
CX.sub.5HX.sub.10-30CX.sub.2C, CX.sub.2CX.sub.10-30CX.sub.4H (Laity
et al., 2001, Gamsjaeger et al., 2007).
[0070] An example of a preferred Zn-finger linker is:
X.sub.(3-5)CXXCX.sub.(0-5)(NNK).sub.nX.sub.(0-5)CXXCX.sub.(3-5)
[0071] (X=Gly or Ala, C=Cys; with each N being any nucleotide and K
standing for G or T). Thus the random NNK sequence protrudes from
the capsid surface.
[0072] In an especially preferred embodiment the linker comprises
at least one Cys N-terminal and at least one Cys C-terminal of the
insertion. Such cysteins are capable of forming a disulfide bond to
generate a loop that stabilizes the insertion and thereby
facilitates its binding to its antibody, receptor or ligand.
[0073] It is a further embodiment of the present invention that the
parvovirus structural protein comprises one or more further
mutation(s) at a site different from I-453. This/These further
mutation(s) is/are independently selected from the group consisting
of a point mutation, an internal deletion, a terminal deletion, an
insertion and a substitution. In general, the purpose of such
further mutation may be selected from the same group of purposes as
explained above for the insertion into I-453, namely to generate a
vaccine, to target a vector to a different cell/tissue and/or
change the chromatographic properties in order to purify the
particles to high purity. Accordingly, an additional insertion may
again be an epitope, preferably a B-cell epitope or CTL epitope (as
further specified below), especially a tolerogen-derived epitope, a
targeting sequence that enhances the transduction activity,
preferably a ligand to a receptor of choice, or a tag. For further
characterization of these further insertions reference is made to
the above sections that described the features for the I-453
insertion that equally apply for a second insertion.
[0074] This further peptide can be identical to the insertion in
I-453. This is preferred if it is key to have a large number of
identical peptides being optimally presented on the surface of a
particle, especially in cases where direct B-cell receptor (BCR)
crosslinking is required for T-cell independent priming of B-cells
and breaking of tolerance against self-antigens. A higher density
of B-cell epitopes increases the likelihood of optimal
peptide-specific BCR crosslinking which requires a defined distance
between BCRs (e.g. about 5-10 nm), and therefore, respective B-cell
epitopes being presented on a parvovirus capsid. Furthermore, as
shown in this invention (FIG. 5), modifications of parvovirus
capsids at two or more different sites at a time can lead to a
conformational cross-talk within the capsid structure leading to an
improved presentation of the inserted peptide sequence. Moreover, a
larger number of inserted B-cell epitopes decreases the probability
for undesired immune reactions against the parvovirus backbone due
to i) masking of natural parvovirus B-cell epi-/mimotopes and/or
ii) slight structural capsid changes rendering these natural B-cell
epi-/mimotopes less immunogenic.
[0075] Consequently, in this case it is especially preferred that
the inserted peptide is a .alpha.-cell epitope, even more preferred
a tolerogen-derived epitope. Parvovirus structural proteins
displaying a high number of epitopes on the surface of a virus-like
particle/capsid can efficiently be used to generate T-cell
independent B-cell responses and even break tolerance. As shown in
examples 5.4 and 6.2, identical epitopes, respectively B-cell
epitopes can be inserted in two different insertion sites, here
I-453 and I-587, and are accessible to soluble ligand, in this case
.alpha..sub.V.beta..sub.3, or .beta.-amyloid, respectively.
Therefore, it is an especially preferred embodiment of this
invention that an identical peptide is inserted at I-453 and I-587
and that this peptide is a B-cell epitope, most preferred a
tolerogen-derived epitope. Another preferred double insertion
variant is a variant with insertions at I-453 and I-261.
[0076] However, the further peptide can be a different one compared
to the peptide inserted into I-453.
[0077] Therefore, it is a further embodiment of the present
invention that an insertion at position I-453 is combined with at
least one further amino acid insertion at one or more additional
site. Additional suitable insertion sites identified by using AAV-2
are well known in the art and are exemplarily listed in Table 3.
However, it should be understood that the further amino acid
insertion at one or more additional site(s) is/are not limited to
those listed in the following.
TABLE-US-00004 TABLE 3 Further insertion sites corresp. Insertion
amino acid/ site sequence of AAV-2 SEQ ID NO: References I-1
M.sub.1 M.sub.1 AADGY SEQ ID NO: 17 (Wu et al., 2000) I-34 P.sub.34
PPPKP.sub.34 AERHK SEQ ID NO: 18 (Wu et al., 2000) I-138 T.sub.138
EPVKT.sub.138 APGKK SEQ ID NO: 19 (Wu et al., 2000, Warrington et
al., 2004, Lux et al., 2005) I-139 A.sub.139 PVKTA.sub.139 PGKKR
SEQ ID NO: 20 (Shi et al., 2001, Shi and Bartlett, 2003, Arnold et
al., 2006) I-161 K.sub.161 SGTGK.sub.161 AGQQP SEQ ID NO: 21 (Shi
et al., 2001, Arnold et al., 2006) I-261 S.sub.261 YKQIS.sub.261
SQSGA SEQ ID NO: 22 (Girod et al., 1999) I-266 A.sub.266
SQSGA.sub.266 SNDNH SEQ ID NO: 23 (Wu et al., 2000) I-381 N.sub.381
YLTLN.sub.381 NGSQA SEQ ID NO: 24 (Girod et al., 1999) I-447
R.sub.447 YYLSR.sub.447 TNTPS SEQ ID NO: 25 (Girod et al., 1999, Wu
et al., 2000) I-448 T.sub.448 YLSRT.sub.448 NTPSG SEQ ID NO: 26
(Grifman et al., 2001) I-459 R.sub.459 TTQSR.sub.459 LQFSQ SEQ ID
NO: 27 (Shi et al., 2001, Arnold et al., 2006) I-471 R.sub.471
ASDIR.sub.471 DQSRN SEQ ID NO: 28 (Asokan and Samulski, 2006,
Moskalenko et al., 2000) I-520 G.sub.520 LVNPG.sub.520 PAMAS SEQ ID
NO: 29 (Shi et al., 2006) I-534 F.sub.534 EEKFF.sub.534 PQSGV SEQ
ID NO: 30 (Girod et al., 1999) I-570 P.sub.570 RTTNP.sub.570 VATEQ
SEQ ID NO: 124 own data I-573 T.sub.573 NPVAT.sub.573 EQYGS SEQ ID
NO: 31 (Girod et al., 1999) I-584 Q.sub.584 STNLQ.sub.584 RGNRQ SEQ
ID NO: 32 (Shi et al., 2001, Shi and Bartlett, 2003, Shi et al.,
2006) I-587 N.sub.587 LQRGN.sub.587 RQAAT SEQ ID NO: 33 (Girod et
al., 1999, Shi et al., 2001, Grifman et al., 2001, Ried et al.,
2002, Nicklin et al., 2001, Work et al., 2004, White et al., 2004,
Arnold et al., 2006, Maheshri et al., 2006, Work et al., 2006)
I-588 R.sub.588 QRGNR.sub.588 QAATA SEQ ID NO: 34 (Shi and
Bartlett, 2003, Muller et al., 2003, Waterkamp et al., 2006) I-591
A.sub.591 NRQAA.sub.591 TADVN SEQ ID NO: 35 (Wu et al., 2000) I-657
P.sub.657 VPANP.sub.657 STTFS SEQ ID NO: 36 I-664 A.sub.664
TFSAA.sub.664 KFASF SEQ ID NO: 37 (Wu et al., 2000) I-713 T.sub.713
NVDFT.sub.713 VDTNG SEQ ID NO: 38 I-716 T.sub.716 FTVDT.sub.716
NGVYS SEQ ID NO: 39 (Maheshri et al., 2006)
[0078] I-570 is especially suitable as an insertion site that goes
along with a deletion of given amino acids of the parvovirus
structural protein at the site of insertion, leading to a complete
substitution. In this case the amino acids RTTNPVATEQ can be
substituted by a targeting peptide or epi- or mimotope.
[0079] Insertions have successfully also been made into
AAV-serotypes other than AAV-2 (Table 4).
TABLE-US-00005 TABLE 4 Insertions into AAV-serotypes other than
AAV2 Ins. site/ amino acid AAV relative to serotype Sequence SEQ ID
NO: AAV2 References AAV1 FQSSS.sub.588 TDPAT SEQ ID NO: 125 I-587
N.sub.587 own data AAV1 SSSTD.sub.590 PATGD SEQ ID NO: 40 I-589
Q.sub.589 (Arnold et al., 2006, Stachler and Bartlett, 2006) AAV3
NNLQS.sub.586-SNTAP SEQ ID NO: 41 I-585 R.sub.585 (Arnold et al.,
2006) AAV4 GGDQS.sub.584-NSNLP SEQ ID NO: 42 I-585 (Arnold et al.,
2006) AAV5 TNNQS.sub.575-STTAP SEQ ID NO: 43 I-585 (Arnold et al.,
2006)
[0080] The used nomenclature 1-### within this invention refers to
the insertion site with ### naming the amino acid number relative
to the VP-1 protein of AAV2, however meaning that the insertion may
be located directly N- or C-terminal, preferably C-terminal of one
amino acid in the sequence of 5 amino acids N- or C-terminal of the
given amino acid, preferably 3, more preferably 2, especially 1
amino acid(s) N- or C-terminal of the given amino acid. For
parvoviruses other than AAV2 the corresponding further insertion
sites can be identified by performing an amino acid alignment or by
comparison of the capsid structures, if available. Such alignment
has been performed for the parvoviruses AAV1, AAV6, AAV2, AAV3b,
AAV7, AAV8, AAV10, AAV4, AAV11, b-AAV, AAV5, GPV, B19, MVM, FPV and
CPV (see FIG. 3).
[0081] Most of the work on targeting parvoviruses was done using
AAV2. However, due to the high conservation of at least large
stretches and the large member of closely related family members it
is easy to identify corresponding sites of AAV2 within other
parvoviruses, e.g. by using alignments as shown in FIG. 3.
[0082] An insertion into the corresponding position of the coding
nucleic acid of one of these sites of the cap gene leads to an
insertion into VP-1, VP-2 and/or VP-3, as the cap proteins are
encoded by overlapping reading frames of the same gene with
staggered start codons. Therefore for AAV2, according to this
nomenclature insertions between amino acids 1 and 138 are only
inserted into VP-1, insertions between 138 and 203 are inserted
into VP-1 and VP-2, and insertions between 203 and the C-terminus
are inserted into VP-1, VP-2 and VP-3, which is of course also the
case for the insertion site I-453. A schematic organization of the
cap gene of AAV2 is provided in FIG. 1. Therefore, the present
invention encompasses structural genes of parvoviruses with
corresponding insertions in the VP-1, VP-2 and/or VP-3
proteins.
[0083] More preferred additional insertion sites are I-138, I-261,
I-570, I-575, I-584, I-587, I-588 and I-590.
[0084] The most preferred further insertion site is I-587, as
various insertions have been made in the amino acid stretch around
N.sub.587 (LQRGN.sub.587 RQAAT) of AAV2. Within this stretch
insertions of various peptides were made C-terminal of amino acids
Q.sub.584, N.sub.587, R.sub.588 and A.sub.591 in AAV2 (Table 3) and
C-terminal of amino acids of other AAV-serotypes corresponding to
R.sub.585 and Q.sub.589 of AAV2 (Table 4).
[0085] Amino acid 138 is the N-terminus of VP-2. Preferred
embodiments are VP-2 structural proteins with an additional
N-terminal fusion to one of the amino acids within the stretch
T.sub.138 APGKKR. In order to achieve an N-terminal fusion to VP-2
only, one could use an expression construct with the coding
sequence for VP-2 with the respective insert comprising its own
start codon. This construct would be co-transfected with a vector
construct where the start codon for VP-2 was eliminated.
[0086] Further, preferably the further inserted nucleic acid
sequence may be inserted at any site corresponding to the first
amino-terminal amino acids 1 to 50 of VP-1.
[0087] Within this invention an AAV2 structural protein was
generated that contained an insertion of an .beta.-amyloid
tolerogen-derived epitope both at I-453 and I-587. Surprisingly, it
was shown that compared to a structural protein containing the same
insert only at I-587 the respective particles were much better
recognized by a .beta.-amyloid-specific antibody (see example
5).
[0088] Additionally encompassed by this invention are point
mutations such as substitutions or internal deletions, where at
least one amino acid is deleted or replaced by a different amino
acid that decreases binding of the structural protein and/or
respective particles composed of the structural proteins to primary
or secondary cellular receptors for the respective virus. This
detargeting of the virus from its natural host cell is important
especially if systemic versus local or loco-regional administration
of the particles is intended, as uptake of the particles by the
natural host cells limits the effective dose of the particles. In
case of AAV2 and AAV6 HSPG is reported to be the primary receptor
for viral uptake in a large number of cells, especially liver
cells. For AAV2 HSPG-binding activity is dependent on a group of 5
basic amino acids, R.sub.484, R.sub.487, R.sub.585, R.sub.588 and
K.sub.532 (Kern et al., 2003). Recently it was reported that the
lysine-to-glutamate amino acid substitution K.sub.531E leads to the
suppression of AAV6's ability to bind heparin or HSPG ((Wu et al.,
2006)).
[0089] Accordingly, preferred point mutations are those that reduce
the transducing activity of the particle for a given target cell
mediated by the natural receptor by at least 50%, preferably at
least 80%, especially at least 95%, in case of HSPG as primary
receptor the binding of the particles to HSPG. Transducing ability
can be determined as described in example 6.1 as the GenP/tP ratio
(see also above).
[0090] Consequently, further mutations preferred for HSPG-binding
particles are those mutations that deplete or replace a basic amino
acid such as R, K or H, preferably R or K which is involved in HSPG
binding of the respective virus, by a non-basic amino acid such as
A, D, G, Q, S and T, preferably A or an amino acid that is present
at the corresponding position of a different but highly conserved
AAV serotype lacking such basic amino acid at this position.
Consequently preferred amino acid substitutions are R.sub.484A,
R.sub.487A, R.sub.487G, K.sub.532A, K.sub.532D, R.sub.585A,
R.sub.585S, R.sub.585Q, R.sub.588A or R.sub.588T, especially
R.sub.585A and/or R.sub.588A for AAV2, and K.sub.531A or K.sub.531
E for AAV6.
[0091] One especially preferred embodiment of the invention are
such structural protein mutants of AAV2 that additionally contain
the two point mutations R.sub.585A and R.sub.588A as these two
point mutations are sufficient to ablate HSPG binding activity to a
large extent. These point mutations enable an efficient detargeting
from HSPG-expressing cells which--for targeting purposes--increases
specificity of the respective mutant virus for its new target cell.
Furthermore, these point mutations seem to lead to a structural
change rendering the RGD4C 453 A2 capsid mutant transducing (FIG.
7).
[0092] It is also an embodiment of the present invention that the
parvovirus mutated structural protein comprises at least one
further mutation that reduces the ability to induce a B-cell
response against a parvovirus-specific epitope and/or mimotope,
thereby reducing the natural antigenicity of the respective
particle. Administration of particles, either as vaccines or as
vectors, is usually hampered by existing antibodies directed
against certain epitopes of the particle/capsid. In case of AAV2,
the majority of the human population has an AAV2 positive serum
status. In case of non-human parvoviruses the patient will generate
a strong humoral immune response against the particle backbone that
may neutralize the vector or may dominate an intended immune
response against an inserted epitope. Point mutations as well as
insertions have been described to modify the natural antigenicity
of particles to evade a preexisting immune response (e.g. (Huttner
et al., 2003); WO 01/05990). Perabo et al. were able to identify
point mutations that increased AAV2's immune-escaping ability by up
to 5.5-fold higher N50 values (amount of human serum needed to
halve the number of transduced cells) in comparison to AAV2 with
wild-type structural proteins (Perabo et al., 2006a), namely a
point mutation at positions R.sub.459 and N.sub.551. Therefore, a
further preferred embodiment is a mutated structural protein that
further comprises a point mutation that reduces the ability to
induce a B-cell response against an AAV-specific epitope and/or
mimotope, preferably for AAV2 a point mutation at position
R.sub.459 and/or N.sub.551.
[0093] A further mutation can be also used to compose more complex
mimotopes or to enhancing the correct display of an inserted amino
acid sequence. Such further mutations can either be identified by
using structure prediction software or by inserting random point
mutations into the respective cap gene e.g. by error prone PCR and
then selecting for matured display of the inserted amino acid
sequence.
[0094] In a further preferred embodiment the further mutation might
be adequate to introduce at least one cytotoxic T-cell epitope (CTL
epitope). For both infectious diseases and cancer it is most useful
to combine both humoral and cellular immune responses to fight
these diseases. The multimeric structures according to this
invention are in principle capable of pseudo-infecting cells.
Accordingly these structures--like viruses--are able to enter
cells, are processed to peptides, the peptides are loaded onto MHC
class I and II molecules and finally presented to CD8- or
CD4-positive T cells. The T-cells become stimulated after specific
recognition of such processed peptide presented by MHC class I or
II molecules. As a consequence of such stimulation CD8 cells may
differentiate into cytotoxic T cells and then cause a cellular
immune response. CD4 cells may develop into T helper cells which
stimulate B cells to provide a humoral immune response or
CD8-positive T cells to provide a cytotoxic immune response, which
may themselves induce lysis of infected cells and other cells
carrying and presenting the same peptide. Suitable CTL epitopes are
known in the art for various cancer antigens or viral antigens, or
they can be predicted from given antigen sequences using for
example the peptide prediction program by Parker under
http://www-bimas.cit.nih.gov/molbio/hla_bind/ (Parker et al.,
1994). Proposed CTL epitopes can be validated according to the
methods as exemplified for HPV-epitopes in U.S. Pat. No. 6,838,084,
examples 2-8 (herein incorporated by reference). As processing of
CTL epitopes occurs within the cell it is not necessary that such
CTL epitopes are located on the surface or are present in a
specific conformation.
[0095] A further embodiment of the present invention is a library
of structural proteins, wherein the library comprises a set of
different parvoviral structural proteins inserted at I-453 as
described above. AAV2 libraries have been previously described for
the insertion site I-587 (Perabo et al., 2003, Lieber, 2003, Muller
et al., 2003). The same technology can equally be applied to the
newly identified insertion site I-453. The advantages described for
the insertion site I-453 for insertions versus I-587 and other
sites in general equally apply to a library generated for the
insertion site I-453. E.g. using I-453 based libraries may result
in the selection of other peptides (as for example with I-587 based
libraries) since neighboring residues may have an influence on the
exposure and functionality of the peptides inserted into the
structural protein. In addition, the sites (I-587 and I-453) are
located on different loops of the AAV capsid. Thus a different
mechanism of cell interaction can be assumed. Furthermore, AAV
particles derived from I-453 libraries can be purified with heparin
affinity chromatography, as the heparin binding site overlapping
with I-587 is still intact. Further, a library with inserted sets
of amino acid insertions in both I-453 and a further insertion site
can be used to enhance the multiplicity of the library and select
structural proteins with higher binding affinities.
[0096] In a preferred embodiment genotype and phenotype of virion
particles of the library are coupled. This means that the genomic
mutant of the virion is identical to the phenotypic mutant of the
same virion or, in other words, that each structurally modified
virus codes for its structural protein mutant.
[0097] In contrast to a bacterial transformation, where only one
bacteriophage is taken up by one bacterial cell, using transfection
methods for eukaryotic cells many DNA copies (up to
1.times.10.sup.6) can be taken up per cell (Dean et al., 2005).
Therefore, in the case of an AAV library one cell can replicate
thousands of AAV genomes at the same time where each may express a
different mutated structural protein with a different peptide
sequence inserted into VP1, VP2, and/or VP3 of AAV. At least some
of these structural proteins can assemble a complete viral capsid
(consisting of 5 VP1, 5 VP2 and 50 VP3 proteins) encapsidating
essentially only one of the thousands of AAV genomes present in the
cell. In case of a geno-/phenotypically coupled library at least
10%, preferably more than 25%, especially more than 50% of the
resulting AAV particles have an encapsulated genome which codes for
at least 25%, preferably more than 50%, especially more than 80% of
the 60 VP proteins of which its capsid is composed. As a
consequence, if an uncoupled library was used for a first screening
against a target antibody or target receptor, the chance that
screened particles contained the genome coding for this specific
amino acid sequence might be very low.
[0098] In general, geno-/phenotypically coupled virion
particles/libraries are obtained when introducing essentially one
single copy of the virus genome into each virion production cell
entering the cell nucleus. This cell will only produce capsid
protein variants encoded of exactly the introduced genome which is
replicated and afterwards packaged into the mutant virion particle.
Different experimental settings can ensure this:
[0099] To obtain a geno-/phenotypically coupled library of
parvovirus virions a library of parvovirus virions is produced by
transfecting a plasmid library into production cells under suitable
conditions whereas a low copy number of viral genomes equal to or
less than 100 genomes per cell is used, preferably equal to or less
than 10 genomes, more preferably equal to or less than one genome
per cell, resulting in geno-/phenotypically coupled
virions/library. The overall transfection efficacy will be finally
decisive for the ideal number of virus genomes per cell to be
transfected.
[0100] The required amount of virus plasmid can be quantified, if
e.g. autonomous replicating plasmids with similar size as the virus
genome encoding a reporter gene such as GFP are used as a model
system. Autonomous replicating plasmids are e.g. systems comprising
SV40 origin of replication and large T antigen or the EBV (ebstein
barr virus) P1 origin and EBNA. Increasing amounts of the
self-replicating reporter gene plasmid are cotransfected with
carrier DNA such as empty plasmid DNA (e.g. pUC derivates) keeping
the amount of total DNA constant. In theory, each cell transfected
with the reporter gene plasmid will, due to its self-replication,
express sufficient amounts of reporter protein to be detected. At
some ratio of reporter gene vector to carrier DNA, a further
increase of reporter gene plasmid will lead to a corresponding
increase in the number of transfected cells. By this means, the
ideal amount of self-replicating reporter gene plasmid can be
determined, reflecting the ideal amount of vector genomes.
[0101] Similarly, another read-out system for detection of
successfully transfected cells are methods such as in-situ PCR to
detect the transfected plasmid genome on a single cell level.
[0102] Alternatively, the geno-/phenotypically coupled library of
parvovirus virions can be produced by transducing a (non- or
partially coupled) virion library into production cells under
suitable conditions at a ratio of genomes per cell of 5 to 5,000,
preferably 10 to 1,000, more preferably 50 to 300, especially
approximately 100, and selecting transduction conditions to be
independent from infection pathways, particularly through
unspecific uptake through pinocytosis and/or phagocytosis,
resulting in geno-/phenotypically coupled virions/library.
[0103] Especially relevant for the screening of structural proteins
having epitope inserts is the method used for infecting cells after
binding virions have been separated from non-binding virions. It is
known that a peptide insertion into the I-587 site of AAV2
frequently destroys (depending on the sequence of the inserted
peptide) the heparin binding motif required for efficient infection
of HSPG-receptor containing cells such as HeLa or 293 cells. It has
now been found that an insertion in I-453 optionally in combination
with I-587 can alter the transducing activity of respective
virions. Therefore, simple infection methods could bias the
screening method and lead only to mutants that still can enter HeLa
cells specifically through the respective receptor, in case of AAV2
through heparan sulfate proteoglycan (HSPG). Therefore, an
unspecific uptake of the virus particle by the production cell may
be advantageous. Such unspecific uptake can be achieved by seeding
production cells on immobilized parvovirus virions. For this
method, the virions are directly coated to a support such as a
tissue culture plate. Alternatively, first a capsid-specific
antibody (in case of AAV2 for example A20) is coated to the support
and second the capsids are bound to the coated antibodies. The
advantage in the latter case is that the antibody/virus particle
complex, respectively the virus particle itself is more efficiently
detached from the support and thereby internalized by the cell.
Importantly, introduction of foreign peptide sequences into I-453
of AAV2 does not destroy the affinity of A20 to the respective
mutant particle as the epitopes of A20 are hardly if at all
affected by the peptide insertion. The cells, e.g. HeLa cells, are
finally seeded on the bound capsids. It is expected that this
procedure leads to an uptake of the virus, e.g. AAV, by the cell
independent of the natural infectious pathway, presumably by
pinocytosis and/or phagocytosis.
[0104] Alternatively or additionally, the selection step can be
carried out on cells expressing a specific receptor for a binder of
choice which is used for selecting the wanted parvoviral variant.
E.g. cells can be used which express the Fc.gamma.RI which is
specific for any binder comprising an Fc-part of an antibody. For
this example, such Fc.gamma.RI expressing cells can be transduced
with a library pool of parvoviruses. First, a negative selection
can be performed to avoid unspecific selection of parvoviral
candidates which by themselves are able to transduce cells
independently from an interaction of a binder with the Fc.gamma.RI.
Therefore, Fc.gamma.RI-expressing cells are incubated with the
library pool. The supernatant (pool of parvoviruses which is not
able to transduce the cells) is collected and subsequently
incubated with the binder of choice (e.g. selection antibody) to
perform the positive selection. In the positive selection
parvoviruses decorated with the binder will be able to transduce
Fc.gamma.RI expressing cells through the coupling of the binder to
the Fc.gamma.RI on the surface of the cells. The transduced cells
can subsequently be used to amplify the particles in the presence
of the binder, assuming that the intracellular trafficking is not
impaired within the cells.
[0105] In a further preferred embodiment a geno-/phenotypically
coupled library of parvovirus virions can be obtained by a method
where selected virions are specifically taken up by production
cells. In this case the library of parvovirus virions is produced
by transducing the library into production cells under suitable
conditions at a ratio of genomes per cell of 10 to 10,000,
preferably 50 to 5,000, more preferably 100 to 3,000, especially
approximately 1,000, wherein transduction conditions are selected
to be dependent on infection pathways, particularly through
specific receptor binding, resulting in geno-/phenotypically
coupled virions/library. In order to achieve such receptor-specific
uptake the virions of the library are preferably not immobilized
but added to the cells in suspension, whereas both cells and
virions can be in suspension or cells are immobilized and virions
are added in suspension. Therefore, the transfection of the cells
is basically dependent on the virus's infection pathway.
[0106] Dependence on infection pathways means that virions are
taken up by the cells e.g. through receptor-specific uptake, e.g.
for AAV2 heparin sulfate proteoglycan (HSPG)-specific uptake (e.g.
for virion libraries where natural infection pathways are not
blocked or destroyed by the inserted random peptide sequences). To
keep biodiversity of the library during the coupling step (either
by transfection of virus genomes or by cell transduction with
virion particles by either means, uptake or infection), always a at
least 10-fold, preferably 100-fold, especially 500-fold excess of
genomic particles compared to the multiplicity of parvoviral
mutants should be transduced in order to ensure that each virus
variant is amplified. To further ensure that each virus is coupled
in the resulting library an at least 2-fold, preferably at least
5-fold excess of cells is to be used compared to total number of
genomic particles.
[0107] Geno-/phenotype coupling is desired as the genetic
information of the packed DNA can easily be used to obtain the
sequence of those particles having high affinity or avidity to the
respective antigen binder. It is an object of the invention to use
for the identification of a parvovirus mutated structural protein
such geno-/phenotypically coupled libraries with a coupling of at
least 5%, preferably of at least 25% and more preferably of at
least 50%, especially at least 90%.
[0108] In a preferred embodiment the library of the present
invention has a multiplicity of parvoviral mutants of greater than
10.sup.3, preferably greater than 10.sup.5, more preferably greater
than 10.sup.6, especially greater than 10.sup.7. Multiplicity means
according to this invention the number of different virions or
viral genomes within the library. In principal it is advantageous
to use a library of high multiplicity as the likelihood to identify
an optimal clone increases with the multiplicity of the library.
The multiplicity of the library is generated by insertion of a
nucleic acid insert into the coding region of the gene encoding a
parvoviral structural protein leading to an amino acids insertion
into a position within the parvoviral structural protein.
[0109] One embodiment of the present invention is a multimeric
structure comprising a parvovirus structural protein of the present
invention. A multimeric structure according to this invention is a
structure of at least 5, preferably at least 10, more preferably at
least 30, most preferably at least 60 structural proteins. They can
form regular particles such as capsomeres, virus-like particles
(empty viral shells) or capsids. Alternatively, they also can form
non-regular aggregates. As explained above the formation of
particles capable of packaging a viral genome is a highly preferred
feature, particularly if the structural proteins of this invention
shall be used as viral vectors. In case the structural proteins are
intended for use as vaccines such particle formation may not be
necessary to exert a sufficient immune response and capsomeres or
aggregates may be sufficient. Still, it is believed that particle
formation is also beneficial for the display of the inserted
epitopes, especially if direct cross linking of B-cell epitopes is
necessary for breaking tolerance.
[0110] One embodiment of the present invention is a nucleic acid
encoding a structural protein as described above. The nucleic acid
is preferably a vector comprising the claimed nucleic. Nucleic
acids, especially vectors are necessary to recombinantly express
the structural proteins of this invention.
[0111] A further embodiment is a library of vectors, wherein the
library comprises a set of different vectors described above. In a
preferred embodiment the library has a multiplicity of parvoviral
mutants of greater than 10.sup.3, preferably greater than 10.sup.5,
more preferably greater than 10.sup.6, especially greater than
10.sup.7. Multiplicity means according to this invention the number
of different virions or viral genomes within the library. In
principal it is advantageous to use a library of high multiplicity
as the likelihood to identify a suitable or even ideal clone
increases with the multiplicity of the library.
[0112] Another embodiment of the present invention is a virus,
preferably a parvovirus as further characterized above, comprising
a nucleic acid as characterized above or a vector as characterized
above.
[0113] Another embodiment of the present invention is an isolated
cell comprising a nucleic acid as characterized above or a vector
as characterized above.
[0114] A further embodiment of the mutated structural proteins
according to this invention is their use for gene therapy. The gene
therapy vector is formulated to contain common salts, buffer and
excipients. The gene therapy vector according to this invention can
be administered by common routes of administration such as
intra-venously or local or loco-regional.
[0115] A further embodiment of the present invention is a process
for the preparation of a structural protein of a parvovirus, the
method comprising the steps of:
a) expressing a nucleic acid according to this invention under
suitable conditions, and b) isolating the expressed structural
protein of step a).
[0116] A further embodiments of the present invention is a method
for altering the tropism of a parvovirus, the method comprising the
steps of: a) co-expressing parvoviral helper and vector functions,
wherein the helper function expresses a parvoviral structural
protein according to this invention under conditions that enable
parvovirus formation, and b) isolating the parvovirus
[0117] A further embodiment of the present invention is a method
for displaying an epitope on the surface of a parvovirus, the
method comprising the steps of: a) expressing the nucleic acid
according to this invention under suitable conditions, and b)
isolating the expressed structural protein of step a).
[0118] A further embodiment of the present invention is method for
vaccinating a mammal, the method comprising the vaccination of a
mammal, preferably a human, with a structural protein, preferably a
particle according to this invention. As disclosed above the
structural protein is formulated to contain common salts, buffer,
excipients and/or adjuvants. Preferred adjuvants are listed below.
The vaccines according to this invention can be administered by
common routes of administration as described below. Such
vaccination is preferably used for breaking immune tolerance, but
also for treating infectious diseases, the method comprising the
vaccination of a mammal, preferably a human, with a structural
protein according to the invention.
[0119] A further embodiment of the present invention is a method
for transducing cells in vitro or in vivo, the method comprising
the steps of: a) co-expressing parvoviral helper and vector
functions, wherein the helper function expresses a parvoviral
structural protein according to this invention under conditions
that enable parvovirus formation, b) isolating the parvovirus, and
c) transducing cells with said parvovirus.
[0120] A further embodiment of the present invention is a method
for producing a library of nucleic acids comprising a multiplicity
of expressible nucleic acids according to this invention,
comprising the steps of: a) providing a set of nucleic acids
encoding each a parvoviral structural protein, b) inserting a
library of inserts in frame into a plurality of nucleic acids at a
position corresponding to that defined herein.
[0121] A further embodiment of the present invention is a
medicament comprising at least one parvovirus structural protein
according to this invention and/or a nucleic acid according to this
invention, preferably at least one multimeric structure according
to this invention. Preferably such medicament is used as a vaccine
or as a gene transfer vector. The parvovirus structural protein
according to this invention, the nucleic acid according to this
invention, and the multimeric structure according to this invention
may be defined as detailed above.
[0122] A further embodiment of the present invention is the use of
at least one parvovirus structural protein according to this
invention and/or a nucleic acid according to this invention,
preferably at least one multimeric structure according to this
invention for the manufacture of a vaccine or for use as a gene
transfer vector.
[0123] As described earlier one preferred utility of the mutated
structural proteins according to this invention is their use as a
vaccine. Vaccine in the context of this invention means that an
immune response, preferably a humoral immune response is generated
after administration of the mutated structural protein. The vaccine
is formulated to contain common salts, buffer, excipients and/or
adjuvants.
[0124] The medicament of the present invention may further
encompass pharmaceutically acceptable carriers and/or excipients.
The pharmaceutically acceptable carriers and/or excipients useful
in this invention are conventional and may include buffers,
stabilizers, diluents, preservatives, and solubilizers. Remington's
Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co.,
Easton, Pa., 15th Edition (1975), describes compositions and
formulations suitable for pharmaceutical delivery of the
(poly)peptides herein disclosed. In general, the nature of the
carrier or excipients will depend on the particular mode of
administration being employed. For instance, parenteral
formulations usually comprise injectable fluids that include
pharmaceutically and physiologically acceptable fluids such as
water, physiological saline, balanced salt solutions, aqueous
dextrose, glycerol or the like as a vehicle. For solid compositions
(e.g. powder, pill, tablet, or capsule forms), conventional
non-toxic solid carriers can include, for example, pharmaceutical
grades of mannitol, lactose, starch, or magnesium stearate. In
addition to biologically neutral carriers, pharmaceutical
compositions to be administered can contain minor amounts of
non-toxic auxiliary substances, such as wetting or emulsifying
agents, preservatives, and pH buffering agents and the like, for
example sodium acetate or sorbitan monolaurate.
[0125] In a preferred embodiment the medicament further comprises
an immunostimulatory substance such as an adjuvant. The adjuvant
can be selected based on the method of administration and may
include mineral oil-based adjuvants such as Freund's complete and
incomplete adjuvant, Montanide incomplete Seppic adjuvant such as
ISA, oil in water emulsion adjuvants such as the Ribi adjuvant
system, syntax adjuvant formulation containing muramyl dipeptide,
or aluminum salt adjuvants. Preferably, the adjuvant is a mineral
oil-based adjuvant, especially ISA206 (SEPPIC, Paris, France), most
preferably ISA51 (SEPPIC, Paris, France). In another preferred
embodiment the parvovirus mutated structural protein is
co-formulated with at least one suitable adjuvant such as CpG,
Imidazoquinolines, MPL, MDP, MALP; flagellin, LPS, LTA, or cholera
toxin or derivative thereof, HSP60, HSP70, HSP90, saponins, QS21,
ISCOMs, CFA, SAF, MF59, adamantanes, aluminum hydroxide, aluminum
phosphate or a cytokine.
[0126] In a more preferred embodiment the immunostimulatory
substance is selected from the group comprising polycationic
polymers, especially polycationic peptides such as polyarginine,
immunostimulatory deoxynucleotides (ODNs), peptides containing at
least two LysLeuLys motifs, especially KLKLLLLLKLK (SEQ ID NO:
126), neuroactive compounds, especially human growth hormone,
alumn, adjuvants or combinations thereof. Preferably, the
combination is either a polycationic polymer and immunostimulatory
deoxynucleotides or of a peptide containing at least two LysLeuLys
motifs and immunostimulatory deoxynucleotides. In a still more
preferred embodiment the polycationic polymer is a polycationic
peptide.
[0127] In an even more preferred embodiment of the invention the
immunostimulatory substance is at least one immunostimulatory
nucleic acid. Immunostimulatory nucleic acids are e.g. neutral or
artificial CpG containing nucleic acids, short stretches of nucleic
acids derived from non-vertebrates or in form of short
oligonucleotides (ODNs) containing non-methylated cytosine-guanine
dinucleotides (CpG) in a defined base context (e.g. as described in
WO 96/02555). Alternatively, also nucleic acids based on inosine
and cytidine as e.g. described in WO 01/93903, or deoxynucleic
acids containing deoxy-inosine and/or deoxyuridine residues
(described in WO 01/93905 and WO 02/095027) may preferably be used
as immunostimulatory nucleic acids in the present invention.
Preferably, mixtures of different immunostimulatory nucleic acids
are used in the present invention. Additionally, the aforementioned
polycationic compounds may be combined with any of the
immunostimulatory nucleic acids as aforementioned. Preferably, such
combinations are according to the ones described in WO 01/93905, WO
02/32451, WO 01/54720, WO 01/93903, WO 02/13857 and WO 02/095027
and the Australian patent application A 1924/2001.
[0128] In a further embodiment the parvovirus mutated structural
protein of this invention is used for the manufacture of a vaccine
for preventing or treating an autoimmune disease (e.g. diabetes
type 1), a tumor disease (examples are: melanoma: e.g. HMW MAA,
glioblastome multiforme: e.g. CA125, anti-IL13R, colon cancer: e.g.
CA125 or anti-EGF(R), breast cancer: e.g. HER2/NEU, ovarian cancer:
e.g. L1 adhesion molecule, B-cell lymphoma: e.g. CD20), an allergic
disease (asthma, allergies such as allergic rhinitis, e.g. IgE), a
metabolic disease (e.g. high cholesterol, intervention into the
cholesterol metabolism, obesity, hypertension, e.g. CETP), an
inflammatory disease (rheumatoid arthritis, Crohn's disease,
psoriasis, e.g. IL-6, IL-17, TNF-.alpha.), a neurological disease
(e.g. Alzheimer, e.g. .beta.-amyloid) or to be used in
opthalmology.
[0129] Examples for autoimmune disease that are especially suitable
for this invention are listed in Table 5.
TABLE-US-00006 TABLE 5 Autoimmune diseases and suitable antibody
targets/antigens Disease antibody target/antigen Myasthenia gravis
Acetylcholine receptors Graves's disease Thyroid-stimulating
hormone receptor Thyroiditis Thyroid Insulin-resistant diabetes
Insulin receptor Asthma Beta-2 adrenergic receptors Juvenile
insulin-dependent diabetes Pancreatic islet cells Pernicious anemia
Gastric parietal cells Addison's disease Adrenal cells Idiopathic
hypoparathyroidism Parathyroid cells Spontaneous infertility Sperm
Premature ovarian failure Interstitial cells, corpus luteum cells
Pemphigus Intercellular substance of skin Primary biliary cirrhosis
Mitochondria Autoimmune hemolytic anemia Erythrocytes Idiopathic
thrombocytopenic purpura Platelets Idiopathic neutropenia
Neutrophils Vitiligo Melanocytes Osteosclerosis and Meniere's
disease Type-II collagen Chronic active hepatitis Nuclei of
hepatocytes Goodpasture's syndrome Basement membranes Rheumatoid
arthritis Gamma globulin, virus-related antigens, IL-6, IL-17,
TNF-.alpha. Sjogren's syndrome Nuclei and centromeres Systemic
lupus erythematosus Nuclei, DNA, RNA, erythrocytes, etc.
Scleroderma Nuclei and centromeres Polymyositis Nuclei, RNA
[0130] Preferred autoimmune diseases are asthma, Juvenile
insulin-dependent diabetes (diabetes type 1) and rheumatoid
arthritis. Therefore, preferred antigens are the corresponding
antigens of Beta-2 adrenergic receptors, pancreatic islet cells,
Gamma globulin E, virus-related antigens, IL-6, IL-17 and
TNF-.alpha..
[0131] Examples for tumor diseases disease that are especially
suitable for this invention are listed in Table 6.
TABLE-US-00007 TABLE 6 Tumor diseases and suitable antibody
targets/antigens Disease antibody target/antigen Melanoma HMW MAA
(=high molecular weight melanoma associated antigen), BAGE, GAGE,
MAGE-3, Melan A, MART-1, NY ESO, gp 100, tyrosinase Colon cancer
CA125, EGFR Gliobastome multiforme CA125, IL13R (GBM) Breast cancer
Her2/NEU Ovarian cancer L1 cell adhesion molecule various cancers
(e.g. for VEGF colon cancer, small lung cell carcinoma) B-cell
lymphoma, e.g. Non- CD20 Hodgkin Lymphoma
[0132] Examples for allergic diseases are asthma, especially atopic
asthma, and all types of allergies. The preferred target antigens
for vaccination against allergic diseases are IgE, IL-9, and IL-13,
especially IgE.
[0133] An example for a metabolic disease is a disorder in the
cholesterol metabolism (e.g. atherosclerosis), a preferred target
antigen is CETP.
[0134] Examples for inflammatory diseases that are especially
suitable for this invention are listed in Table 7.
TABLE-US-00008 TABLE 7 Inflammatory diseases and suitable antibody
targets/antigens Disease COPD (chronic obstructive pulmonary
disease) OA (osteoarthritis) Rheumatoid arthritis Polymyalgia
rheumatica Gouty arthritis, Gout, Pseudogout Atherosclerosis
Crohn's disease (inflammatory bowel disease) Shoulder tendinitis,
Bursitis Colitis Multiple Sclerosis Systemic Lupus Erythematosus
Psoriasis Juvenile diabetes Type I diabetes mellitus
(insulin-resistant diabetes) Hypothyroidism Chronic fatigue
syndrome Kawasaki's disease Cardiavascular disease Pericarditis
Lymph adenopathy Raynaud's phenomenon Sarcoidosis Sjogren's
syndrome Spondyloarthropathies Vasculitides Scleroderma
Goodpasture's syndrome Wegener's granulomatosis temporal = Giant
cell arteritis Celiac disease Addison's disease Autoimmune
hepatitis Grave's disease Graft-vs-host disease
[0135] Preferred target antigens are TNF-.alpha., CD20, IL-6 and
IL-17.
[0136] Examples for diseases in opthalmology are age-related
macular degeneration (AMD) and diabetic retinopathy, a preferred
target in these indications is VEGF.
[0137] Other preferred diseases are Alzheimer disease with the
target antigen .beta.-amyloid.
[0138] The parvovirus mutated structural protein according to this
invention can be especially useful for manufacture of a medicament
for breaking immune tolerance.
[0139] In the context of the uses of the invention, the features of
the parvovirus mutated structural protein are as defined above.
[0140] In a preferred embodiment the disease is not an infectious
disease, meaning a disease caused by a virus, a bacterium, a fungus
or a eukaryotic parasite.
[0141] In a further embodiment parvovirus mutated structural
protein is not used to make a vector that is used in gene
therapy.
[0142] A preferred embodiment of the instant invention is a
structural protein of a parvovirus as further defined above
comprising an anti-idiotypic epi-/mimotope of an anti-IgE antibody,
and/or an IgE epi-/mimotope. Preferred vaccines are the
following:
Vaccines for the Treatment of Asthma and Allergic Diseases
[0143] Atopic asthma and allergic rhinitis are caused by adverse
immune responses, typified by IgE, against otherwise harmless
environmental proteins, allergens. In sensitized individuals,
allergen-specific IgE becomes localized in tissues by binding to
the high-affinity receptor for IgE, FI.epsilon.RI, expressed by
mast cells in various tissues and basophils as well as eosinophils
in the blood. Subsequent encounters with the allergen result in
cross-linking of IgE/Fc.epsilon.RI, which triggers effector cell
degranulation and the release of both preformed mediators
(histamine, proteolytic enzymes, and proteoglycans) and de novo
synthesized mediators (prostaglandin D.sub.2, leukotrienes, and
cytokines). Together, these mediators are responsible for the
clinical manifestations of allergic reactions, including hay fever,
asthma, and eczema, as well as life-threatening anaphylactic
reactions. Standard therapy includes inhaled corticosteroids (ICS),
Beclomethasone Dipropionate (BDP), long-acting .beta.-agonists
(LABA) and leukotriene receptor antagonists (LTRAs).
[0144] The receptor-binding region of human IgE was previously
mapped to the N-terminal region of the CH3 domain (Helm et al.,
1988, Helm et al., 1989). Site-directed mutagenesis studies to
identify the amino acid residues directly involved in the
interaction have been conducted on both IgE (Presta et al., 1994)
and Fc.epsilon.RI (Cook et al., 1997). In addition, the crystal
structure of the human IgE-Fc.epsilon.RI.alpha. complex was
recently solved by Garman and colleagues (Garman et al., 2000). The
amino acid regions that are involved in receptor binding are
localized in three loops and spread over most of the C.epsilon.3
domain (Pro-364, Arg-365, Arg-408, Ser-411, Lys-415, Glu-452,
Arg-465, and Met-469). Binding is mediated primarily by
electrostatic interaction.
[0145] Anti-IgE therapy is based on antibodies which bind the
receptor-binding target domain C.epsilon.3 region of IgE, thereby
preventing the binding of IgE to the Fc.epsilon.RI receptor and,
therefore, preventing sensitization of mast cells and basophils.
However, even if 99% of free IgE was neutralized by the anti-IgE
antibody, the therapy still would fail because the few remaining
IgE molecules would be sufficient to sensitize the respective
cells. Therapeutic efficacy is provided through additional actions:
Fc.epsilon.RI expression is regulated by the level of free IgE, in
a way that reduced levels of free IgE lead to lowered densities of
Fc.epsilon.RI on basophils and mast cells and lowered
sensitivities. And, anti-IgE may lead to down-regulation of IgE
production by eliminating or down-regulating IgE-expressing B
cells, perhaps by cross-linking membrane-bound IgE and causing
apoptosis, anergy or most likely also by complement-mediated and
cell-mediated cytolysis. The latter mechanism was, however, not
found in clinical trials performed with Omalizumab. For this
monoclonal antibody, reduction of IgE production from B-cells
(plasma cells) mediated by lowered IgE levels was only observed in
animal and in-vitro experiments.
[0146] Most of the therapeutic monoclonal antibodies in development
can only bind and neutralize free IgE or IgE associated with
B-cells. In contrast, Fc.epsilon.RI-bound IgE is not accessible for
these anti-IgE antibodies. Anti-IgE antibodies directed against
regions of the IgE molecule outside of the receptor binding region
(such as the variable, antigen-binding domain of IgE referred to as
the IgE idiotype), can bind to an IgE molecule while it is bound to
its receptor. This results in cross-linking of receptor-bound IgE,
causing an anaphylactic shock in animals treated systemically with
such antibodies. Importantly, except for defense mechanisms against
parasite infections, IgE seems to play no role in normal physiology
and IgE-deficient people are healthy with no apparent sign of
pathology (Levy and Chen, 1970).
[0147] Omalizumab (XOLAIR.RTM.) is a humanized monoclonal anti-IgE
antibody for passive immunization, and the first available/approved
anti-IgE therapy on the market. A total of 7 phase III clinical
trials were performed with this monoclonal anti-IgE antibody, which
bind to the C.epsilon.3 region of IgE (for a review refer to
(Bousquet et al., 2005)) without cross linking the Fc.epsilon.RI
receptor. Omalizumab significantly reduced the rate of asthma
exacerbations by 38% and the rate of total emergency visits by 47%.
The efficacy of Omalizumab was unaffected by patient age, gender,
baseline serum IgE or by 2- or 4-weekly dosing schedule, although
benefit in absolute terms appeared to be greatest in patients with
more severe asthma, defined by a lower value of percentage
predicted forced expiratory volume in 1 s (FEV.sub.1) at
baseline.
[0148] As outlined before, one disadvantage of passive immunization
with a monoclonal antibody is the requirement of infusions every
2-4 weeks with relatively high antibody doses making such therapies
expensive. Therefore, alternative approaches are needed for the
treatment of allergic diseases such as atopic allergies or
asthma.
[0149] According to the present invention this problem is solved by
a structural protein of a parvovirus comprising an anti-idiotypic
epi-/mimotope of an anti-IgE antibody, and/or an IgE epi-/mimotope
inserted at the insertion site I-453. Such structural proteins are
preferably capable of forming virus-like particles. They harbor
anti-idiotypic epi-/mimotopes of an anti-IgE antibody and/or IgE
epi-/mimotopes on the surface of the capsid shell. Therefore the
anti-idiotypic epi-/mimotopes of an anti-IgE antibody, respectively
the IgE epi-/mimotopes are accessible to the humoral immune system.
Such structural protein can be used as vaccines in patients in
order to induce specifically an immune response against IgE,
meaning antibodies that cross-react with IgE (anti-IgE antibodies),
thereby preventing binding of IgE to its high affinity receptor
Fc.epsilon.RI.
[0150] Especially preferred embodiments of the invention are
structural proteins of parvoviruses, especially AAV, that contain
IgE epitopes or mimotopes, preferably previously known epitopes or
mimotopes inserted at insertion site I-453 that can be used as
vaccines. In a preferred embodiment the B-cell epitope is a human
epitope. Preferably it is inserted into I-453 and at least one
further insertion site, preferably I-261, I-534, I-570, I-573 or
I-587, especially into I-453 and I-587, preferably of AAV1, AAV2 or
AAV-6.
[0151] For a lot of the publicly available therapeutic antibodies
which can be used as target antibody for AAV selection, the
epitopes are not known. To be able to compare the epitopes of the
target antibodies and the antibodies induced in e.g. mice after
vaccination, epitope mapping can be performed. For example,
epitopes recognized by anti mouse or anti human IgE antibodies can
be identified from arrays using overlapping peptide scans from the
respective IgE spotted on nylon membranes. Preferred antibodies are
those with a binding pattern similar to that of Omalizumab, which
can be used for selection of mimotopes from the AAV capsid library.
Epitopes recognized by antibodies induced in e.g. mice after
vaccination can be identified from arrays spotted on glass slides.
Cross-reactivity of anti human IgE antibodies or antibodies induced
in mice after vaccination with the constant chain regions of other
Ig's can be monitored in Westernblot experiments.
[0152] Especially preferred embodiments of the invention are
structural proteins of parvoviruses, especially AAV, that contain
IgE epitopes or mimotopes, preferably previously known epitopes or
mimotopes.
[0153] Preferred IgE epitopes or mimotopes can first be identified
as described by Rudolf, Stadler, Vogel and colleagues (Rudolf et
al., 1998, Rudolf et al., 2000, Stadler et al., 1999, Vogel et al.,
2000): one can develop so-called mimotope immunization vaccines
based on peptide phage display libraries screened for particles
recognizing BSW17, a mouse monoclonal anti-human IgE antibody.
Peptide sequences best recognized by BSW17 are the preferred
epitopes/mimotopes
[0154] EFCINHRGYWVCGD ("Rudolf" (Rudolf et al., 2000), (SEQ ID NO:
55) with G, W and V (underlined) being conserved among all
sequences identified (the cysteine residues (in bold) mediate a
circular form of the peptide via disulfide bridging), C4M' (Rudolf
et al., 2000), and Kricek (Kricek et al., 1999).
[0155] Second, in the course of this invention previously unknown
epitopes that are especially suitable for vaccination purposes
against allergic diseases like asthma have been identified which
are preferred IgE epitopes which are preferred IgE epitopes: Bind2,
Flex, 3DEpi1, 3DEpi2, 3DEpi3, 3DEpi4, C4E, Wang-CS, Wang and
C21.
[0156] The present invention further relates to novel IgE B-cell
epitopes Bind2, Flex, 3DEpi1, 3DEpi2, 3DEpi3, 3DEpi4, C4E, Wang-CS,
Wang, and C21 and/or to a functionally active variant thereof. A
functionally active variant of these epitopes means a B-cell
epitope which generates in a rabbit vaccination experiment
according to example 8.6 a B-cell response in this case measurable
as titer of specific antibodies binding to human IgE.
[0157] Such functionally active variants can either be single
peptides or mixtures of single peptides consisting of peptide
sequences of up to 40 amino acids, preferably up to 25 amino acids,
more preferably 15 amino acids, especially 9 amino acids of the
given sequence, or a fusion of such functionally active variant to
a carrier. Such carrier is meant to be any molecule except for the
naturally occurring IgE protein or part thereof (larger than the
functionally active variant), preferably a parvoviral particle, but
also a different virus- or bacteriophage particle, a polymer (e.g.
LPH) or a fusion protein, capable of generating a B cell response
(as defined above) against such functionally active variant. Such
fusion to a carrier can i.e. be obtained by chemically linking the
variant to the carrier or by genetically making fusion proteins or
insertion variants.
[0158] These and similar sequences or parts therefore including or
excluding the cysteine residues and flanking sequences can be
introduced into positions I-453 and others of AAV VP. The
corresponding AAV particles can be manufactured (initially as
genome-containing infectious AAV), purified and characterized.
Although AAV capsids have a different conformational structure than
phages, the chance that a similar structure of the mimotope
sequence EFCINHRGYWVCGD (SEQ ID NO: 55) is present on both, phages
and AAV, is high due to the cysteine residues building up a loop
structure of the peptide sequence. For linear epitopes such as
Kricek (VNLTVVSRASG, SEQ ID NO: 50), interchangeability should also
be possible. If these AAV particles bind BSW17 (the anti-IgE
antibody used for phage display), they can be used as an anti-IgE
vaccine that can be used with and without co-formulation in a
suitable adjuvant (as described herein).
[0159] Especially preferred embodiments of the invention are
structural proteins of parvoviruses that contain IgE epi-/mimotopes
that, once injected into an immuno-competent mammal, induce
anti-IgE specific antibodies with therapeutic efficacy without
cross-linking properties. Cross-linking properties means that in an
immunocompetent mammal the generated anti-IgE antibodies are
binding IgE molecules in a way that IgE/Fc.epsilon.RI binding is
still possible. By such way, and if one antibody binds several IgE
molecules at a time, the high-affinity Fc.epsilon.RI receptor is
cross linked on effector cells leading to its degranulation. This
would induce a systemic anaphylactic shock. On the other hand, the
structural proteins of parvoviruses should be able to directly
crosslink the respective B-cell receptor (binding the IgE
epi-/mimotopes or the anti-idiotype epi-/mimotope of an anti-IgE
antibody) to activate the corresponding B-cells and to induce
anti-IgE antibody production independent of a T-cell response.
Vaccines for the Treatment of Alzheimer's Disease
[0160] In general, misfolded proteins leading to a protein
aggregation and, therefore, causing conformational diseases, are
good candidate targets for an active immunization approach with AAV
vaccines. Ideally, B-cell epitopes represented by misfolded
proteins or protein aggregates only are chosen for presentation on
AAV particles (for an overview, please refer to Uversky et al.,
2006, especially table 1-1).
[0161] Especially preferred embodiments of the invention are
structural proteins of parvoviruses, especially AAV, that contain
.beta.-amyloid epitopes or mimotopes at insertion site I-453,
preferably known epitopes or mimotopes, that can be used for the
treatment of Alzheimer disease. In the context of the present
invention a B-cell epitope of .beta.-amyloid was inserted into a
parvovirus capsid and displayed on the surface of the capsid. In a
preferred embodiment the B-cell epitope is a human epitope.
Preferably it is inserted into I-453 and at least one further
insertion site, preferably I-261, I-534, I-570, I-573 or I-587,
especially into I-453 and I-587 of preferably AAV1, AAV2 or AAV6.
In an especially preferred embodiment the B-cell epitope has the
sequence DAEFRHDSG (SEQ ID NO: 65).
Vaccines for the Treatment of Atherosclerosis
[0162] Atherosclerosis is a disease affecting arterial blood
vessels. It is a chronic inflammatory response in the walls of
arteries, in large part due to the accumulation of macrophage white
blood cells and promoted by low density (especially small particle)
lipoproteins (plasma proteins that carry cholesterol and
triglycerides) without adequate removal of fats and cholesterol
from the macrophages by functional high density lipoproteins (HDL).
It is commonly referred to as a "hardening" or "furring" of the
arteries. It is caused by the formation of multiple plaques within
the arteries. There is a strong inverse relationship between the
plasma concentration of cholesterol in HDLs (HDL-C) and the
development of coronary heart disease (CHD). Plasma concentration
of HDL-C is a powerful predictor of CHD. Although 33% of patients
with CHD have low plasma levels of HDL-C as their primary lipid
abnormality, there is currently no effective therapy for increasing
the plasma concentration of HDL-C. Diet and moderate exercise are
ineffective, statins afford only a modest 5% to 7% increase in
HDL-C, and niacin has side effects and compliance profiles that
limit its use.
[0163] One therapeutic approach that has been suggested for
increasing plasma HDL-C concentrations is the inhibition of
cholesteryl ester transfer protein (CETP) activity. CETP is a
74-kDa plasma glycoprotein that facilitates transfer of neutral
lipids and phospholipids between lipoproteins and contributes to
the regulation of plasma concentration of HDL-C. CETP functions in
the plasma to lower the concentration of HDL-C by moving
cholesteryl esters from HDLs to VLDLs and LDLs (Rittershaus et al.,
2000).
[0164] Accordingly it is a further embodiment of the invention to
provide structural proteins of parvoviruses, especially AAV, that
contain CETP epitopes or mimotopes at insertion site I-453 that can
be used as a vaccine for the treatment of atherosclerosis.
Preferably the epitope or mimotope is inserted into I-453 and at
least one further insertion site, preferably I-261, I-534, I-570,
I-573 or I-587, especially into I-453 and I-587, preferably of
AAV1, AAV2 or AAV-6. Suitable epitopes or mimotopes are the human
CETP derived peptides hTP10, hTP11, hTP12, hTP13, hTP18 and hTP20,
hRitsch-1, hRitsch-2, hRitsch-3, hCETP-intern and hCETP C-Term.
[0165] The present invention further relates to novel CETP B-cell
epitopes hTP10, hTP11, hTP12, hTP13, hTP18, hTP20, hRitsch-1,
hRitsch-2, hRitsch-3, hCETP-intern and hCETP C-Term and/or to a
functionally active variant thereof.
Vaccines for the Treatment of Tumor Diseases
[0166] Antibody therapies such as HERCEPTIN.RTM., AVASTIN.RTM.,
ERBITUX.RTM., OMNITARG.RTM., RITUXAN.RTM., CAMPATH.RTM.,
ZEVALIN.RTM., MYLOTARG.RTM., BEXXAR.RTM. or Panitumumab play an
increasing role in fighting various types of tumor diseases. These
antibodies specifically bind epitopes of factors causing
uncontrolled cellular growth, such as growth factor receptors or
growth factors. Accordingly, it is a further embodiment of this
invention to provide structural proteins of parvoviruses,
especially AAV, that contain epitopes of such factors causing
uncontrolled cellular growth.
[0167] HER2/neu (also known as ErbB-2, ERBB2) is a protein giving
higher aggressiveness in breast cancers. It is a member of the ErbB
protein family, more commonly known as the epidermal growth factor
receptor family. HER2/neu has also been designated as CD340.
HER2/neu is notable for its role in the pathogenesis of breast
cancer and as a target of treatment. It is a cell membrane
surface-bound receptor tyrosine kinase and is normally involved in
the signal transduction pathways leading to cell growth and
differentiation. Approximately 25-35 percent of breast cancers have
amplification of the HER2/neu gene or over expression of its
protein product. Overexpression also occurs in other cancer such as
ovarian cancer and stomach cancer. Clinically, HER2/neu is
important as the target of the monoclonal antibody trastuzumab
(marketed as HERCEPTIN.RTM.).
[0168] As for an active vaccination approach, the epitope sequence
QMWAPQWGPD (SEQ ID NO: 123) presented in a circular way has been
shown to induce polyclonal antibodies with therapeutic
effectiveness. Therefore, a Her2/NEU-AAV vaccine can be generated
by insertion of this peptide into AAV using suitable adaptor
sequences (Riemer et al., 2007).
[0169] Accordingly, especially preferred embodiments of the
invention are structural proteins of parvoviruses, especially AAV,
that contain epitopes or mimotopes of tumor antigens, preferably
HER2/neu, especially the epitope described by Riemer, at I-453,
preferably known epitopes or mimotopes. In the context of the
present invention a B-cell epitope of HER2/neu can be inserted into
a parvovirus capsid and displayed on the surface of the capsid. In
a preferred embodiment the B-cell epitope is a human epitope.
Preferably it is inserted into I-453 and at least one further
insertion site, preferably I-261, I-534, I-570, I-573 or I-587,
especially into I-453 and I-587, preferably of AAV1, AAV2 or
AAV-6.
Vaccines for the Treatment of Autoimmune Diseases and Chronic
Inflammatory Diseases
[0170] Autoimmune diseases as well as inflammatory diseases arise
from an overactive immune response of the body against substances
and tissues normally present in the body. In other words, the body
attacks its own cells.
[0171] Rheumatoid arthritis (RA) is an autoimmune disease which
causes chronic inflammation of the joints, the tissue around the
joints, as well as other organs in the body affecting 0.5-1.0% of
the population in the industrialized world. It commonly leads to
significant disability and consequently to a significant reduction
of quality of life. If not treated appropriately, RA leads to a
reduction of life expectancy (Smolen and Steiner, 2003).
[0172] Psoriasis is a chronic inflammatory disease of the skin
characterized by overgrowth of epidermal cells, angiogenesis,
infiltration of immune cells, and increased production of
cytokines. Similar activation of immune cells and increased
production of cytokines is associated with autoimmune diseases and
(chronic) inflammatory diseases as further listed below.
[0173] In order to limit or control such disease causing/related
immune responses it has become an established therapeutic modality
to neutralize cytokines involved in the pathogenesis of autoimmune
and inflammatory diseases. Antibodies (infliximab, adalimumab) and
a soluble receptor construct neutralizing the action of TNF-.alpha.
(etanercept) have been established in the treatment of RA and other
disease. Now there is evidence implicating several novel cytokines,
including IL-32 and IL-17, in the pathogenesis of RA. In addition
we assess the development of existing targets as they move towards
clinical evaluation, particularly IL-1, IL-6, IL-15, IL-18 and the
IL-12 superfamily (Asquith et al., 2007).
[0174] Accordingly, preferred embodiments of the invention are
structural proteins of parvoviruses, especially AAV, that contain
epitopes or mimotopes of cytokines, preferably of TNF-.alpha., IL-6
and/or IL-17, preferably known epitopes or mimotopes, inserted at
insertion site I-453 that can be used as vaccines for the treatment
of autoimmune diseases and/or chronic inflammatory diseases,
preferably rheumatoid arthritis and/or Crohn's disease. In a
preferred embodiment the B-cell epitope is a human epitope. In a
preferred embodiment the B-cell epitope is a human epitope or
mimotope. Preferably it is inserted into I-453 and at least one
further insertion site, preferably I-261, I-534, I-570, I-573 or
I-587, especially into I-453 and I-587, preferably of AAV1, AAV2 or
AAV-6.
[0175] Preferred B-cell epitopes are the human epitopes:
TNF-.alpha. V1, TNF-.alpha. V2, TNF-.alpha. V3, IL-17 V1, IL-17 V2,
IL-6 V1, IL-6 V2
[0176] The present invention further relates to novel cytokine
B-cell epitopes TNF-.alpha. V1, TNF-.alpha. V2, TNF-.alpha. V3,
IL-17 V1, IL-17 V2, IL-6 V1 and IL-6 V2 and/or to a functionally
active variant thereof.
Vaccines for the Treatment of Infectious Diseases
[0177] Blocking of viral infection by induction of auto-antibodies
against the cellular receptor of the virus is a suggested mechanism
of a preventive or therapeutic vaccination against viruses,
preferably for viruses where classical vaccination attemps have
failed like HIV using CCR5 as the target receptor (Chackerian,
1999).
[0178] Accordingly, preferred embodiments of the invention are
structural proteins of parvoviruses, especially AAV, that contain
epitopes or mimotopes of viral receptors, preferably of CCR5,
preferably known epitopes or mimotopes, inserted at insertion site
I-453 that can be used as vaccines for the treatment of such viral
infection and associated diseases, preferably HIV infection/AIDS.
In a preferred embodiment the B-cell epitope is a human epitope. In
a preferred embodiment the B-cell epitope is a human epitope or
mimotope. Preferably it is inserted into I-453 and at least one
further insertion site, preferably I-261, I-534, I-570, I-573 or
I-587, especially into I-453 and I-587, preferably of AAV1, AAV2 or
AAV-6.
[0179] Preferred B-cell epitopes are HYAAAQWDFGNTMCQL (SEQ ID NO:
113), YAAQWDFGNTMCQ (SEQ ID NO: 114), RSQKEGLHYT (SEQ ID NO: 115)
or a functionally active variant thereof
[0180] Accordingly, a further aspect of the present invention
relates to a medicament of the invention for the treatment and/or
prevention of [0181] a) an allergic disease and/or asthma whereas
at insertion site I-453, and preferably at least one further
insertion site, more preferably at insertion site I-261, I-534,
I-570, I-573 or I-587, especially I-453 and I-587, preferably of
AAV1, AAV2 or AAV-6, the structural protein of a parvovirus
comprises an anti-idiotypic epi-/mimotope of an anti-IgE antibody,
and/or an IgE epi-/mimotope, particularly a mimotope of sequence of
EFCINHRGYWVCGD (SEQ ID NO: 55), with the first G, W and V being
conserved and cysteine residues C mediating a circular form of the
peptide via disulfide bridging, VNLTWSRASG (SEQ ID NO: 50) or
INHRGYWV (SEQ ID NO: 95) or particularly an epitope selected from
the group consisting of EKQRNGTLT (SEQ ID NO: 86), EDGQVMDVDLS (SEQ
ID NO: 85), TYQCRVTHPHLPRALMR (SEQ ID NO: 87), RHSTTQPRKTKGSG (SEQ
ID NO: 88), DSNPRGVSAYLSR (SEQ ID NO: 89), TITCLVVDLAPSK (SEQ ID
NO: 90), KTKGSGFFVF (SEQ ID NO: 91), THPHLPRALMRS (SEQ ID NO: 92),
GETYQCRVTHPHLPRALMRSTTK (SEQ ID NO: 93, LPRALMRS (SEQ ID NO: 94)
and a functionally active variant thereof; [0182] b) Alzheimer's
disease whereas at insertion site I-453, and preferably at least
one further insertion site, more preferably at insertion site
I-261, I-534, I-570, I-573 or I-587, especially I-453 and I-587,
preferably of AAV1, AAV2 or AAV-6, the structural protein of a
parvovirus comprises a .beta.-amyloid epitope or mimotope,
particularly comprising or having the sequence DAEFRHDSG (SEQ ID
NO: 65) or a functionally active variant thereof; [0183] c)
atherosclerosis whereas at insertion site I-453, and preferably at
least one further insertion site, more preferably at insertion site
I-261, I-534, I-570, I-573 or I-587, especially I-453 and I-587,
preferably of AAV1, AAV2 or AAV-6, the structural protein of a
parvovirus comprises a CETP epitope or mimotope, particularly an
epitope selected from the group consisting of PKTVSNLTESSSESVQS
(SEQ ID NO: 102), SLMGDEFKAVLET (SEQ ID NO:103), QHSVAYTFEED (SEQ
ID NO: 104), INPEIITRDG (SEQ ID NO: 105), DISLTGDPVITASYL (SEQ ID
NO: 106), DISLTGDPVITA (SEQ ID NO: 107), DQSIDFEIDSA (SEQ ID NO:
108), KNVSEDLPLPTFSPTLLGDS (SEQ ID NO: 109), KNVSEDLPLPT (SEQ ID
NO: 110), CDSGRVRTDAPD (SEQ ID NO: 111), FPEHLLVDFLQSLS (SEQ ID NO:
112) and a functionally active variant thereof; [0184] d) a tumor
disease whereas at insertion site I-453, and preferably at least
one further insertion site, more preferably at insertion site
I-261, I-534, I-570, I-573 or I-587, especially I-453 and I-587,
preferably of AAV1, AAV2 or AAV-6, the structural protein of a
parvovirus comprises a tumor antigen, particularly a HER2/neu
epitope or mimotope, especially the epitope QMWAPQWGPD (SEQ ID NO:
123) or a functionally active variant thereof; or [0185] e) an
autoimmune disease and/or a chronic inflammatory disease,
preferably rheumatoid arthritis and/or Crohn's disease, whereas at
insertion site I-453, and preferably at least one further insertion
site, more preferably at insertion site I-261, I-534, I-570, I-573
or I-587, especially I-453 and I-587, preferably of AAV1, AAV2 or
AAV-6, the structural protein of a parvovirus comprises an epitope
or mimotope of a cytokine, preferably of TNF-.alpha., IL-6 and/or
IL-17, especially an epitope selected from the group consisting of
SSRTPSDKPVAHVVANPQAE (SEQ ID NO: 116), SRTPSDKPVAHVVANP (SEQ ID NO:
117), SSRTPSDKP (SEQ ID NO: 118), NADGNVDYHMNSVP (SEQ ID NO: 119),
DGNVDYHMNSV (SEQ ID NO: 120), RSFKEFLQSSLRALRQ (SEQ ID NO: 121),
FKEFLQSSLRA (SEQ ID NO: 122) or or a functionally active variant
thereof. [0186] f) an infectious disease, preferably HIV infection,
whereas at insertion site I-453, and preferably at least one
further insertion site, more preferably at insertion site I-261,
I-534, I-570, I-573 or I-587, especially I-453 and I-587,
preferably of AAV1, AAV2 or AAV-6, the structural protein of a
parvovirus comprises an epitope or mimotope of a viral receptor,
preferably of CCR5, especially an epitope selected from the group
consisting of HYAAAQWDFGNTMCQL (SEQ ID NO: 113), YAAQWDFGNTMCQ (SEQ
ID NO: 114), RSQKEGLHYT (SEQ ID NO: 115) or a functionally active
variant thereof.
FIGURES
[0187] FIG. 1: Schematic organization of the cap gene of AAV2
[0188] FIG. 2: Amino acid sequence alignment of various
parvoviruses with a boxed insertion site I-453.
[0189] For references for the aligned parvoviruses see FIG. 3.
Further parvoviruses can be found at
http://www.ncbi.nlm.nih.gov/ICTVdb/lctv/fs_parvo.htm#SubFamily1.
The corresponding amino acids to G.sub.453 are boxed.
[0190] FIG. 3: Amino acid sequence alignment of parvoviruses (AAV1,
AAV6, AAV2, AAV3b, AAV7, AAV8, AAV10, AAV4, AAV11, b-AAV, AAV5,
GPV, B19, MVM, FPV and CPV)
[0191] Alignment was made using Multalin version 5.4.1, (Corpet,
1988). Symbol comparison table: blosum62, Gap weight: 12, Gap
length weight: 2, Consensus levels: high=90% low=50%. Consensus
symbols: ! is anyone of IV; $ is anyone of LM; % is anyone of FY; #
is anyone of NDQEBZ. The amino acids corresponding to N.sub.587 of
AAV2 and the preferred insertion range for I-587 are boxed.
TABLE-US-00009 Name Length Check Weight Seq. GP-No. AAV1 799 4900
0.26 9632548 AAV6 799 5176 0.26 2766607 AAV2 799 2359 0.50 2906023
AAV3b 799 3639 0.50 2766610 AAV7 799 132 0.50 22652859 AAV8 799
3007 0.37 22652862 AAV10 799 4671 0.37 48728343 AAV4 799 7292 0.74
2337940 AAV11 799 2546 0.74 48728346 b-AAV 799 5299 0.79 48696559
AAV5 799 5950 1.34 91134730 GPV 799 3208 1.92 9628653 B19 799 1920
2.45 4092542 MVM 799 332 2.05 2982110 FPV 799 7156 1.61 494031 CPV
799 7674 1.61 494746 consensus 799 6436 0.00
[0192] FIG. 4: Interaction of an anti-CETP antibody with the
respective CETP epitope inserted into the AAV2 capsid at position
I-453 and I-587
[0193] 5.0.times.10.sup.10 and 1.0.times.10.sup.10 capsids of the
variants AAV-CETP-453-short and AAV-CETP-453-long (for further
details see example 1.2) were spotted onto a nitrocellulose
membrane. In addition, 5.0.times.10.sup.10 capsids of the variants
AAV-CETP-587-short and AAV-CETP-587-long were spotted onto the same
membrane. As negative control wtAAV was spotted ranging from
5.0.times.10.sup.10 to 6.3.times.10.sup.9 capsids per dot. The
membrane was incubated with a polyclonal anti-CETP antibody
directed against the CETP epitope inserted into the AAV capsid.
Binding of the anti-CETP antibody to the spotted AAV variants was
detected with an anti-rabbit IgG HRP (horse radish peroxidase)
conjugate.
[0194] FIG. 5: Detection of a .beta.-amyloid epitope displayed by
AAV2 at I-587 or I-453/I-587 by .beta.-amyloid-specific
antibody
[0195] Serial dilutions (2.times.10.sup.11-2.times.10.sup.8
capsids) of purified AAV particles displaying a .beta.-amyloid
epitope at I-587, I-453 and I-587, a CETP epitope at I-587 (as
negative control) and 1 .mu.g to 1 ng of the .beta.-amyloid peptide
(aa 1-42, BIOSOURCE, as positive control) were dotted on a
membrane. The .beta.-amyloid epitope was detected using an
anti-.beta.-amyloid mAb 6.times.10.sup.10 (CHEMICON) and as
secondary antibody a peroxidase-labeled anti-mouse IgG antibody
(CALTAG). Signals were detected by chemiluminescence.
[0196] FIG. 6: Normalization of AAV2 particles detected by
monoclonal antibody A20
[0197] ELISA plate was coated with A20 (75 ng/well, PROGEN). After
blocking (PBS, 1% Milk Powder, 1% Tween) 1.00.times.10.sup.10
particles were given per well. For detection of a functional RGD
purified .alpha..sub.V.beta..sub.3 integrin (100 ng/well, CHEMICON)
was added to the plate and detected with anti-integrin
.alpha..sub.V antibody (C-terminus/intracellular, Dil. 1:1000,
CHEMICON). For quantification of viral particles in each well
biotinylated A20 (250 ng/well, PROGEN) was used. The ratio
"anti-integrin .alpha..sub.V":"A20-biot" was used for normalization
of the amount of .alpha..sub.V.beta..sub.3-binding to total
particles.
[0198] FIG. 7: HSPG independent transduction
[0199] Chinese Hamster Ovarian cells with HSPG KO phenotype were
transduced with 1,000 genomic particles per cell of the indicated
mutant. Percentage of transduced cells was measured using flow
cytometry.
[0200] FIG. 8: Competition of transduction with soluble peptide
[0201] Transduction of CHO(HSPG KO) cells was performed with
indicated virions 24 h after seeding the cells. Medium was removed.
1/2 vol. of medium was given to the well containing competition
peptide (600 .mu.M) or, as in the case of the controls, just
medium. After 15 min of incubation at RT 1/2 medium containing
virus was given to the cells. MOI=1.000 genomic particles per cell.
48 h after transduction GFP expression was measured by flow
cytometry.
[0202] FIG. 9: Induction of auto-antibodies by AAV-based vaccines
vs. peptide based vaccines
[0203] Rabbits (n=2) were immunized with the AAV-based CETP
vaccines AAV-TP11, AAV-TP12, AAV-TP13 or AAV-TP18 s.c. in the
presence of an adjuvant. AAV-based CETP vaccines were compared with
the corresponding peptide vaccines containing the same epitope
coupled to LPH (Limulus polyphemus hemocyanine). The titer of CETP
auto-antibodies in the immune sera was measured after the 2.sup.nd
(gray) and 3.sup.rd (black) boost immunization.
[0204] FIG. 10: Induction of auto-antibodies by AAV-based vaccines
vs. peptide based vaccines
[0205] Rabbits (n=2) were immunized with the AAV-based CETP
vaccines AAV-TP11, AAV-TP12, AAV-TP13, or AAV-TP18 s.c. in the
presence of an adjuvant. AAV-based CETP vaccines were compared with
the corresponding peptide vaccines containing the same epitope
coupled to LPH (Limulus polyphemus hemocyanine). The titer of
auto-antibodies directed against the epitope (linear peptide) in
the immune sera was measured after the 2.sup.nd (gray) and 3.sup.rd
(black) boost immunization.
[0206] FIG. 11: Induction of auto-antibodies by native and
heat-denatured AAV-based vaccines
[0207] Rabbits (n=4) were immunized with native (gray) or
heat-denatured (black) AAV-based CETP vaccines AAV-TP11 2x or
AAV-TP18 2x s.c. in the presence of an adjuvant. The titer of CETP
auto-antibodies in the immune sera was measured after the 1.sup.st
boost immunization.
[0208] FIG. 12: Evaluation of the impact of anti-AAV2 antibodies on
immunization with AAV2-based vaccines
[0209] (A) To evaluate the impact of anti-AAV2 antibodies on the
immunization success of AAV2-based vaccines, rabbits (n=3) were
pre-immunized by two applications of 4.5 .mu.g wtAA2 (s.c. or
i.m.). Serum was analyzed two weeks after 2.sup.nd application for
the level of anti-AAV2 antibodies. A control group (n=2) was not
pre-immunized with wtAAV2.
[0210] (B) Following pre-immunization with wtAAV2 rabbits were
vaccinated with the AAV2-based vaccine AAV-TP18 (7.2 .mu.g per
application). The vaccine was administered s.c. or i.m. in the
presence of an adjuvant. Sera were analyzed two weeks after the
1.sup.st boost vaccination for the level of CETP auto-antibodies.
Results were compared to vaccination (s.c.) of animals without
wtAAV2 pre-immunization.
[0211] FIG. 13: Evaluation of different prime/boost regimens for
AAV-based vaccines
[0212] Three different prime/boost regimens were evaluated. Group A
received one prime and three boost applications of AAV2-CETin-2x
(AAV2-based vaccination). Group B received one prime and one boost
immunization with AAV2-CETin-2x followed by two boost immunizations
with the LPH-coupled CETP-intern peptide (LPH-peptide boost). Group
C received one prime and one boost immunization with AAV2-CETIn-2x
followed by two boost immunizations with AAV1-CETin (switch
AAV2-/AAV1-based vaccine). Immune sera were analyzed for
anti-CETP-reactivity (CETP auto-antibody titer) two weeks after the
2.sup.nd (gray) and 3.sup.rd boost (black) immunization.
[0213] FIG. 14: Vaccination against human IgE
[0214] Rabbits (n=2) were immunized with AAV2 particles carrying a
human IgE epitope ("Kricek") at position I-587. In a control group
rabbits were immunized with the same IgE epitope coupled to LPH
(LPH-Kricek). Immune sera were analyzed for anti-IgE reactivity two
weeks after the 1.sup.st (white), 2.sup.nd (gray) and 3.sup.rd
(black) boost immunization. n. d.: not determined.
EXAMPLES
[0215] The following examples exemplify the invention for AAV,
especially for AAV2. Due to the general similarities within the
structures of the adeno-associated viruses and other parvoviruses
the invention can be easily transferred to other parvoviruses.
1. Generation of Modified AAV Variants by Insertion of Epi- or
Mimotope Sequences at Position I-453 of the AAV Capsid by Genetic
Manipulation
[0216] The approach described below is used for the insertion of
epi- or mimotopes into the AAV capsid at position I-453 using a
defined cloning strategy. This strategy includes the generation of
a NotI and AscI restriction site within the cap gene by
site-directed mutagenesis that allows the insertion of DNA
fragments encoding epi- or mimotope at position I-453 of AAV cap
flanked by a short or long alanine adaptor sequence.
1.1. Creation of Singular NotI and AscI Restriction Sites in Vector
pCI-VP2
[0217] The vector pCI-VP2 was created by PCR amplification of the
AAV2 VP-2 gene mutating the minor ACG start codon into an ATG and
cloning of the respective PCR product into the polylinker sequence
of pCI (PROMEGA). The NotI site at nucleotide 18 of pCI-VP2
(nucleotide 1099 of pCI) was destroyed by site directed mutagenesis
using the primers
TABLE-US-00010 mutashe-3 (SEQ ID NO: 44) 5'-GAG TCG ACC CGG GCA GCC
GCT TCG AGC-3' and mutashe-4 (SEQ ID NO: 45) 5'-GCT CGA AGC GGC TGC
CCG GGT CGA CTC-3'
together with the QUICKCHANGE II SITE-DIRECTED MUTAGENESIS KIT
(STRATAGENE) according to the instructions of the manufacturer. The
resulting vector was referred to as pCI-VP2-.DELTA.Not18. To
introduce a NotI and AscI restriction site that allows for the
cloning of epitope or mimotope sequences at position I-453 of the
AAV capsid, the vector pCI-VP2-.DELTA.Not18 was modified by site
directed mutagenesis using the primers
TABLE-US-00011 mutashe-5 (SEQ ID NO: 46) 5'-CA AAC ACT CCA AGT GGA
GGG CGC GCC GCT ACC ACC ACG CAG TC-3' and mutashe-6 (SEQ ID NO: 47)
5'-GA CTG CGT GGT GGT AGC GGC GCG CCC TCC ACT TGG AGT GTT TG-3'
to introduce the AscI site first as well as the primers
TABLE-US-00012 mutashe-7 (SEQ ID NO: 48) 5'-CA AAC ACT CCA AGT GGA
GCG GCC GCA GGG CGC GCC GCT AC-3' and mutashe-8 (SEQ ID NO: 49)
5'-GT AGC GGC GCG CCC TGC GGC CGC TCC ACT TGG AGT GTT TG-3'
to introduce the NotI site subsequently.
[0218] Site specific mutagenesis was performed using the QUIKCHANGE
II SITE-DIRECTED MUTAGENESIS KIT (STRATAGENE) according to the
instructions of the manufacturer. The resulting vector is referred
to as pCIVP2-I453-NotI-AscI.
1.2. Cloning of Epitope or Mimotope Sequences into
PCIVP2-I453-NotI-AscI
[0219] For cloning of epi- or mimotope sequences into
pCIVP2-I453-NotI-AscI, forward and reverse oligonucleotides were
designed that encode the respective epi- or mimotope sequences with
a short or long alanine adaptor sequence and contain a 5'-site
extension. The 5'-site extension of the oligonucleotides was
designed so that annealing of the forward and reverse
oligonucleotides results in a dsDNA with 5'-site and 3'-site
overhangs compatible with overhangs generated by NotI and AscI
restriction of the plasmid pCIVP2-I453-NotI-AscI. The sequences of
the oligonucleotides and the respective epi- or mimotope sequences
including the alanine adaptors are summarized in Table 8. Each of
the inserted epi- or mimotope sequences is flanked by a short or
long adaptor according to the following scheme (X.sub.n represents
the mimotope or epitope sequence): [0220] short Ala adaptor:
(A).sub.3-X.sub.n--R-(A).sub.2 (A short) [0221] long Ala adaptor:
(A).sub.5-X.sub.n-(A).sub.2-R-(A).sub.2 (A long) [0222] long Gly
adaptor: (A).sub.2-(G).sub.5-X.sub.n-(G).sub.5-R-(A).sub.2 (G
long)
TABLE-US-00013 [0222] TABLE 8 Oligonucleotides used for cloning of
epi- or mimotope sequences at position I-453 Name/ Forward Reverse
Peptide Seq. Type Oligonucleotide Oligonucleotide Adaptor Kricek
Epitope 5'-ggccgcagtgaacctgac 5'-cgcggccggaggctctgct A short
VNLTWSRASG ctggagcagagcctccggc-3' ccaggtcaggttcactgc-3' SEQ ID NO:
50 SEQ ID NO: 51 SEQ ID NO: 52 5'-ggccgcagccgcagtgaa
5'-cgcgtgccgcgccggag A long cctgacctggagcagagcctcc
gctctgctccaggtcaggttcact ggcgcggca-3' gcggctgc-3' SEQ ID NO: 53 SEQ
ID NO: 54 Rudolf Mimotope 5'-ggccgcagaattctgcata
5'-cgcggtctccgcacaccc A short EFCINHRGYW aaccacaggggatactgggtgt
agtatcccctgtggtttatgcaga VCGD gcggagac-3' attctgc-3' SEQ ID NO: 55
SEQ ID NO: 56 SEQ ID NO: 57 5'-ggccgcagccgcagaattc
5'-cgcgtgccgcgtctccgca A long tgcataaaccacaggggatact
cacccagtatcccctgtggtttat gggtgtgcggagacgcggca-
gcagaattctgcggctgc-3' 3' SEQ ID NO: 59 SEQ ID NO: 58 CETP-intern
Epitope 5'-ggccgcatgcgacgctgg 5'-cgcggtctggtgcattggtg A short
CDAGSVRTNA cagtgtgcgcaccaatgcacca cgcacactgccagcgtcgca PD gac-3'
tgc-3' SEQ ID NO: 60 SEQ ID NO: 61 SEQ ID NO: 62
5'-ggccgcagccgcatgcga 5'-cgcgtgccgcgtctggtgc A long
cgctggcagtgtgcgcaccaat attggtgcgcacactgccagc gcaccagacgcggca-3'
gtcgcatgcggctgc-3' SEQ ID NO: 63 SEQ ID NO: 64 .beta.-amyloid
Epitope 5'-ggccggcggaggcggtgg 5'-cgcgccctccaccgcctcc G long
DAEFRHDSG ggacgccgaattcagacacga gccgctgtcgtgtctgaattcgg SEQ ID NO:
65 cagcggcggaggcggtggag cgtccccaccgcctccgcc-3' gg-3' SEQ ID NO: 67
SEQ ID NO: 66
[0223] To anneal the oligonucleotides 50.0 .mu.g of the forward
oligonucleotide and 50.0 .mu.g of the reverse oligonucleotide were
mixed in a total volume of 200 .mu.l 1.times.PCR-Buffer (QIAGEN)
and incubated for 3 min at 95.degree. C. in a thermomixer. After 3
min at 95.degree. C. the thermomixer was switched off and the tubes
were left in the incubator for an additional 2 h to allow annealing
of the oligonucleotides during the cooling down of the incubator.
To clone the annealed oligonucleotides into pCIVP2-I453-NotI-AscI
the vector was linearized by restriction with NotI and AscI and the
cloning reaction was performed using the Rapid DNA Ligation Kit
(Roche). Briefly, the annealed oligonucleotides were diluted
10-fold in 1.times.DNA Dilution Buffer and incubated for 5 min at
50.degree. C. 100 ng of these annealed oligonucleotides and 50 ng
of the linearized vector pCIVP2-I453-NotI-AscI were used in the
ligation reaction, to which was performed according to the
instructions of the manufacturer of the Rapid DNA Ligation Kit
(Roche). E. coli XL1 blue were transformed with an aliquot of the
ligation reaction and plated on LB-Amp agar plates. Plasmids were
prepared according to standard procedures and were analyzed by
sequencing.
1.3. Subcloning of Epitope or Mimotope Sequences from pCIVP2 into
pUCAV2
[0224] For production of recombinant AAV particles carrying a mimo-
or epitope insertion at position I-453 the BsiWI/XmaI fragment of
pCI-VP2-453-NotI-AscI encoding a VP-2 fragment containing the
epitope or mimotope at position I-453 was sub-cloned into pUCAV2,
which was modified as described below.
[0225] Cloning of vector pUCAV2 is described in detail in U.S. Pat.
No. 6,846,665. Basically, this vector contains the complete AAV
genome (BgI II fragment) derived from pAV2 (Laughlin et al., 1983)
cloned into BamHI of pUC19.
[0226] pUCAV2 is used for production of the modified AAV particles.
Since there are three XmaI sites in pUCAV2 it is not possible to
use the XmaI site of pUCAV2 for subcloning of the BsiWI/XmaI
fragment of pCI-VP2-453-NotI-AscI. Therefore, a new AgeI site was
introduced into pUCAV2 that is compatible with XmaI and is not
present in pUCAV2. To introduce the AgeI site pUCAV2 was linearized
by SnaBI, dephosphorylated and subsequently blunt-end ligated with
a short ds oligonucleotide adaptor containing an internal AgeI
site. The ds oligonucleotide adaptor was generated by annealing of
a
TABLE-US-00014 sense (SEQ ID NO: 68) 5'-GTA GCC CTG GAA ACT AGA ACC
GGT GCC TGC GCC-3' and anti-sense (SEQ ID NO: 69) 5'-GGC GCA GGC
ACC GGT TCT AGT TTC CAG GGC TAC-3'
oligonucleotide containing an AgeI restriction site as described
above. The annealed oligonucleotides were ligated with the SnaBI
linearized, dephosphorylated pUCAV2 using the Rapid DNA Ligation
Kit (Roche) as described above. The resulting vector is referred to
as pUCAV2-AgeI. pUCAV2-AgeI was linearized with BsiWI and AgeI and
ligated with the BsiWI/XmaI fragment of pCI-VP2-453-NotI-AscI
encoding the VP-2 fragment containing the respective epitope or
mimotope at position I-453.
2. Generation of Modified AAV Variants by Insertion of Epitope
Sequences at Position I-587 of the AAV Capsid by Genetic
Manipulation
[0227] The approach described below is used for the insertion of
epi- or mimotopes into the AAV capsid at position I-587 using a
defined cloning strategy. This strategy includes the generation of
a NotI and AscI restriction site within the cap gene by
site-directed mutagenesis that allows the insertion of DNA
fragments encoding epi- or mimotope at position I-587 of AAV cap
flanked by a short or long alanine adaptor sequence.
2.1. Creation of Singular NotI and AscI Restriction Sites in Vector
pCI-VP2 at Insertion Site I-587
[0228] The vector pCI-VP2 was created by PCR amplification of the
AAV2 VP-2 gene mutating the minor ACG start codon into an ATG and
cloning of the respective PCR product into the polylinker sequence
of pCI (PROMEGA). The NotI site at nucleotide 18 of pCI-VP2
(nucleotide 1099 of pCI) was destroyed by site-directed mutagenesis
as described above. The resulting vector was referred to as
pCI-VP2-.DELTA.Not18. To introduce a NotI and AscI restriction site
that allows for the cloning of epitope or mimotope sequences at
position I-587 of the AAV capsid, the vector pCI-VP2-.DELTA.Not18
was modified by site-directed mutagenesis using the primers
TABLE-US-00015 pCI-VP2-.DELTA.Not-I587-for (SEQ ID NO: 70) 5'-CC
AAC CTC CAG AGA GGC AAC GCG GCC GCA AGG CGC GCC AAG CAG CTA CCG
CAG-3' and pCI-VP2-.DELTA.Not-I587-rev (SEQ ID NO: 71) 5'-CTG CGG
TAG CTG CTT GGC GCG CC TT GCG GCC GCG TTG CCT CTC TGG AGG TTG
G-3'.
[0229] Site-specific mutagenesis was performed using the QUIKCHANGE
II SITE-DIRECTED MUTAGENESIS KIT (STRATAGENE) according to the
instructions of the manufacturer. The resulting vector is referred
to as pCIVP2-I587-NotI-AscI
2.2. Cloning of Epitope Sequences into pCIVP2-I587-NotI-AscI
[0230] For cloning of a CETP epitope sequence into
pCIVP2-I587-NotI-AscI sense and anti-sense oligonucleotides were
designed that encode the CETP epitope with a short or long alanine
adaptor sequence and contain 5'-site extensions. The 5'-site
extension of the oligonucleotides was designed so that annealing of
the sense and anti-sense oligonucleotides results in a dsDNA with
5'-site and 3'-site overhangs compatible with overhangs generated
by NotI and AscI restriction of the plasmid pCIVP2-I587-NotI-AscI.
The sequences of the oligonucleotides and the encoded CETP epitope
sequence including the alanine adaptors are summarized in Table 9.
The inserted CETP epitope sequence is flanked by a short or long
alanine adaptor according to the following scheme (X.sub.n
represents the CETP epitope sequence): [0231] short Ala adaptor:
(A).sub.3-X.sub.n-(A).sub.2 (A short) [0232] long Ala adaptor:
(A).sub.5-X.sub.n-(A).sub.5 (A long) [0233] long Gly adaptor:
(A).sub.3-(G).sub.5-X.sub.n-(G).sub.5-(A).sub.2(G long)
TABLE-US-00016 [0233] TABLE 9 Oligonucleotides used for cloning of
epitope sequences at position I-587 Name/ sense anti-sense Peptide
Seq. Type Oligonucleotide Oligonucleotide Adaptor CETP-intern
Epitope 5' GGCCGCATGCGACG 5' CGCGCCGCGTCTGGT A short CDAGSVRTNAPD
CTGGCAGTGTGCGCACC GCATTGGTGCGCACACTG SEQ ID NO: 60 AATGCACCAGACGCGG
CCAGCGTCGCATGC 3' 3' SEQ ID NO: 73 SEQ ID NO: 72 5' GGCCGCAGCGGCGT
5' CGCGCCGCCGCCGCC A long GCGACGCTGGCAGTGTG GCGTCTGGTGCATTGGTG
CGCACCAATGCACCAGA CGCACACTGCCAGCGTCG CGCGGCGGCGGCGG 3' CACGCCGCTGC
3' SEQ ID NO: 74 SEQ ID NO: 75 .beta.-amyloid Epitope 5'
GGCCGCAGGCGGAG 5' CGCGCCGCGCCTCCC G long DAEFRHDSG
GGGGAGGCGACGCCGAG CCTCCGCCGCCGCTGTCG SEQ ID NO: 65 TTCAGACACGACAG
TGTCTGAACTCGGCGTCG CGGCGGCGGAGGGGGAG CCTCCCCCTCCGCCTGC GCGCGG 3' 3'
SEQ ID NO: 76 SEQ ID NO: 77
[0234] The sense and anti-sense oligonucleotides were annealed as
described above (1.2). To clone the annealed oligonucleotides into
pCIVP2-I587-NotI-AscI the vector was linearized by restriction with
NotI and AscI and the cloning reaction was performed using the
Rapid DNA Ligation Kit (Roche). Briefly, the annealed
oligonucleotides were diluted 10-fold in 1.times.DNA Dilution
Buffer and incubated for 5 min at 50.degree. C. 100 ng of these
annealed oligonucleotides and 50 ng of the linearized vector
pCIVP2-I587-NotI-AscI were used in the ligation reaction, which was
performed according to the instructions of the manufacturer of the
Rapid DNA Ligation Kit (Roche). E. coli XL1 blue were transformed
with an aliquot of the ligation reaction and plated on LB-Amp agar
plates. Plasmids were prepared according to standard procedures and
were analyzed by sequencing.
2.3. Subcloning of Epitopes from pCIVP2 into pUCAV2 at Position
I-587
[0235] For production of recombinant AAV particles carrying the
CETP epitope insertion at position I-587 the BsiWI/XmaI fragment of
pCI-VP2-587-NotI-AscI encoding a VP-2 fragment containing the
epitope or mimotope at position I-587 was sub-cloned into pUCAV2,
which was modified as described above (1.3). The modified pUCAV2 is
referred to as pUCAV2-AgeI. pUCAV2-AgeI was linearized with BsiWI
and AgeI and ligated with the BsiWI/XmaI fragment of
pCI-VP2-587-NotI-AscI encoding the VP-2 fragment containing the
CETP epitope at position I-587.
3. Production and Purification of AAV Variants
3.1. AdV Helper Plasmid
[0236] An AdV helper plasmid encoding AdV E2, E4 and VAI-VAII was
used for AAV manufacturing in HEK 293-T cells. The helper plasmid
pUCAdvE2/E4-VAI-VAII was constructed by subcloning of the BamHI
restriction fragment encoding the adenovirus E2 and E4-ORF6 from
pAdEasy-1 into the site BamHI site of pUC19. The resulting plasmid
is referred to as pUCAdVE2/E4. The VAI-VAII fragment from
pAdvantage was amplified by PCR using the primers
TABLE-US-00017 XbaI-VAI-780-3': SEQ ID NO: 78 5'-TCT AGA GGG CAC
TCT TCC GTG GTC TGG TGG-3' and XbaI-VAII-1200-5' SEQ ID NO: 79
5'-TCT AGA GCA AAA AAG GGG CTC GTC CCT GTT TCC-3',
cloned into pTOPO and then subcloned into the XbaI site of
pUCAdvE2/E4. The resulting plasmid pUCAdvE2/E4-VAI-VAII was
evaluated in co-transfection experiments for production of AAV as
described below. AAV particle formation was analyzed using the A20
ELISA.
3.2. Production of AAV Variants by Co-Transfection of HEK
293-T-Cells
[0237] For production of AAV particles HEK 293-T cells were
co-transfected with the vector plasmid pUCAV2 containing the
subcloned epitope (in I-453 and/or I-587) and the helper plasmid
pUCAdV (described above).
[0238] For co-transfection 7.5.times.10.sup.6 293-T cells were
seeded into each O15 cm cell culture plate in a total volume of
17.5 ml medium (DMEM containing 10% FCS, 5 mM L-Gln and ABAM) 24 h
before transfection and cultivated at 37.degree. C., 5% CO, in a
humidified atmosphere. For co-transfection of the vector plasmid
pUCAV2 containing the epitope (in I-453 or I-587) and pUCAdV a
molar ratio of the plasmids of 1:1 was chosen. For Calcium
phosphate transfection of one culture plate with 293-T cells using
the Calcium phosphate transfection protocol as disclosed in US
2004/0053410, 12.0 .mu.g pUCAV2 (containing the epitope in I-453 or
I-587) and 24.0 .mu.g pUCAdV were mixed in 875 .mu.l 270 mM
CaCl.sub.2. In brief, 875 .mu.l 2.times.BBS (50 mM BES (pH 6.95),
280 mM NaCl and 1.5 mM Na.sub.2HPO.sub.4) was added to the mixture
and the resulting solution was carefully mixed by pipetting. The
solution was incubated for 20 min at room temperature and then
added drop-wise to the cell culture plate. Cells were incubated at
35.degree. C., 3% CO.sub.2 in a humidified atmosphere for 18 h.
After 18 h at 35.degree. C. and 3% CO.sub.2 cells were cultivated
for an additional 3d at 37.degree. C., 5% CO.sub.2 in a humidified
atmosphere.
[0239] 293-T cells were harvested with a cell lifter, transferred
into 50 ml plastic tubes (Falcon) and centrifuged at 3000 g at
4.degree. C. for 10 min. The cell pellet was resuspended in 1.0 ml
lysis buffer (150 mM NaCl, 50 mM Tris, pH 8.5) and objected to
three rounds of freeze and thaw cycles. The lysate was treated with
100 U/ml benzonase (MERCK) at 37.degree. C. for 30 min. The cell
lysate was cleared by two centrifugation steps (3700 g, 4.degree.
C., 20 min) and the AAV-containing supernatant was used for further
purification.
[0240] The AAV capsid titer of the lysate was determined using a
commercially available ELISA (AAV Titration ELISA, PROGEN).
3.3. Purification of AAV Particles by Density Gradient
Centrifugation Using Iodixanol
[0241] AAV particles were purified by iodixanol gradient
centrifugation. The virus-containing cell lysate was cleared by
centrifugation (3700 g, 4.degree. C., 20 min) and the cleared
lysate was transferred to QICKSEAL ultracentrifugation tubes
(26.times.77 mm, BECKMAN). Iodixanol solutions (SIGMA) of different
concentrations were layered beneath the virus containing lysate. By
this an Iodixanol gradient was created composed of 6.0 ml 60% on
the bottom, 5.0 ml 40%, 6.0 ml 25% and 9.0 ml 15% Iodixanol with
the virus solution on top. The gradient was spinned in an
ultracentrifuge at 416.000 g for 1 h at 18.degree. C. The 40% phase
containing the AAV particles was then extracted with a cannula by
puncturing the tube underneath the 40% phase and allowing the
solution to drip into a collecting tube until the 25% phase was
reached. The AAV capsid titer of the 40% phase was determined using
a commercially available ELISA (AAV Titration ELISA, PROGEN).
4. AAV Variants Carrying a CETP Epitope at Position I-453 or I-587
of the AAV2 Capsid
[0242] An epitope (CDAGSVRTNAPD; SEQ ID NO: 60) of rabbit CETP
(cholesteryl ester transfer protein) was introduced at position
I-453 or I-587 of AAV2 by the cloning approaches described above.
In both insertion sites the epitope is flanked by a short or long
alanine adaptor. For production of AAV variants HEK 293-T cells
were co-transfected with the vector plasmid pUCAV2 containing the
subcloned CETP epitope sequence at position I-453 or I-587, and the
helper plasmid pUCAdV as described above. AAV variants were
purified by Iodixanol gradient centrifugation as described
above.
[0243] The AAV capsid variants AAV-CETP-453-short,
AAV-CETP-453-long, AAV-CETP-587-short and AAV-CETP-587-long were
analyzed by dot blot experiments (FIG. 4). 5.times.10.sup.10 or
1.times.10.sup.10 purified AAV particles AAV-CETP-453-short and
AAV-CETP-453-long were spotted onto a nitrocellulose membrane using
a vacuum device. Likewise, 5.times.10.sup.10 purified AAV particles
AAV-CETP-587-short and AAV-CETP-587-long were spotted onto the same
membrane. As negative control wtAAV was spotted ranging from
5.0.times.10.sup.10 to 6.3.times.10.sup.9 capsids per dot. After
blocking of the membrane with blocking buffer (5% milk powder in
PBS containing 0.05% Tween-20), the membrane was incubated with a
polyclonal anti-CETP serum generated by immunizing rabbits with the
CETP epitope coupled to KLH. After washing of the membrane with
PBS/0.05% Tween-20, binding of the anti-CETP antibodies to the
spotted AAV variants was detected with an anti-rabbit IgG HRP
conjugate (CALTAG). After washing, signals were detected by
chemiluminescence using the ECL system (AMERSHAM BIOSCIENCE).
[0244] The result demonstrate that there is a specific detection of
the CETP epitope inserted into the AAV capsid at position I-453 or
I-587 by the respective CETP antibody demonstrating that the
epitope is displayed on the surface of the AAV particle.
5. Double Insertion of a .beta.-Amyloid Epitope at Position I-453
and I-587 of the AAV Capsid
[0245] The cloning approach described below is used for the double
insertion of an epi- or mimotope sequence into the AAV capsid at
position I-453 and I-587 using a defined cloning strategy.
5.1. Insertion of an FseI Restriction Site into pCIVP2
[0246] An FseI restriction site was inserted into the vectors
pCIVP2-I587-Not-AscI and pCIVP2-I453-NotI-AscI located between
I-453 and I-587 by site-directed mutagenesis using the QUIKCHANGE
II SITE-DIRECTED MUTAGENESIS KIT (STRATAGENE) and the
oligonucleotides
TABLE-US-00018 mutashe-9 (SEQ ID NO: 80) 5'-GGT GAA TCC GGG GCC GGC
CAT GGC AAG C-3' and mutashe-10 (SEQ ID NO: 81) 5'-GCT TGC CAT GGC
CGG CCC CGG ATT CAC C-3'.
5.2. Cloning of a .beta.-Amyloid Epitope at Position I-587 of
pUCAV2
[0247] The .beta.-amyloid epitope DAEFRHDSG (SEQ ID NO: 65) (aa 1-9
of human .beta.-amyloid) was cloned into the NotI/AscI restriction
site of the vector pCIVP2-I587-NotI-AscI (modified as described in
5.1) using the sense and anti-sense oligonucleotides
TABLE-US-00019 .beta.-amyloid-for (SEQ ID NO: 76) 5'-GGC CGC AGG
CGG AGG GGG AGG CGA CGC CGA GTT CAG ACA CGA CAG CGG CGG CGG AGG GGG
AGG CGC GG-3' and .beta.-amyloid-rev (SEQ ID NO: 77) 5'-CGC GCC GCG
CCT CCC CCT CCG CCG CCG CTG TCG TGT CTG AAC TCG GCG TCG CCT CCC CCT
CCG CCT GC-3'
[0248] The oligonucleotides encode the .beta.-amyloid epitope with
a glycine adaptor sequence:
TABLE-US-00020 (A).sub.3-(G).sub.5-DAEFRHDSG-(G).sub.5-(A).sub.2
(SEQ ID NO: 82)
[0249] Cloning was performed as described above (2.2).
[0250] The BsiWI/XmaI fragment of pCI-VP2-587-NotI-AscI encoding a
VP-2 fragment containing the .beta.-amyloid epitope at position
I-587 was sub-cloned into pUCAV2-AgeI as described above (2.3). The
resulting vector was referred to as pUCAV2-amyloid-587
5.3. Cloning of a .beta.-Amyloid Epitope at Position I-453 of
pCIVP2
[0251] The .beta.-amyloid epitope (DAEFRHDSG, SEQ ID NO: 65) was
cloned into the NotI/AscI restriction site at the insertion site
I-453 of the vector pCIVP2-I453-NotI-AscI (modified as described in
5.1) using the sense and anti-sense oligonucleotides
TABLE-US-00021 Amyloid 453for (SEQ ID NO: 66) 5'-G GCC GGC GGA GGC
GGT GGG GAC GCC GAA TTC AGA CAC GAC AGC GGC GGA GGC GGT GGA GGG-3'
Amyloid 453rev (SEQ ID NO: 67) 5'-C GCG CCC TCC ACC GCC TCC GCC GCT
GTC GTG TCT GAA TTC GGC GTC CCC ACC GCC TCC GCC-3'
[0252] The oligonucleotides encode the .beta.-amyloid epitope with
a glycine adaptor sequence:
TABLE-US-00022 (A).sub.2-(G).sub.5-DAEFRHDSG-(G).sub.5-R-(A).sub.2
(SEQ ID NO: 83)
[0253] Cloning was performed as described above (1.2).
5.4. Cloning of a .beta.-Amyloid Epitope at Position I-453 and
I-587 of pUCAV2
[0254] For production of recombinant AAV particles carrying the
.beta.-amyloid epitope at position I-587 and I-453, the vector
pUCAV2-amyloid-587 was cut with BsiW/FseI and ligated with the 0.6
kb BsiW/FseI fragment of pCI-VP2-453-NotI-AscI. The BsiW/FseI
fragment of pCI-VP2-453-NotI-AscI encodes the VP-2 fragment
containing the .beta.-amyloid epitope at position I-453. The
resulting vector was referred to as pUCAV2-amyloid-453-587.
5.5. Production, Purification and Evaluation of AAV Particles
Carrying a .beta.-Amyloid Epitope at I-453 and I-587
[0255] For production of recombinant AAV particles carrying the
.beta.-amyloid epitope at position I-587 and I-453, 293 cells were
transfected with the vector pUCAV2-amyloid-453-587 and the helper
plasmid pUCAdV as described above (3.2 and 3.3). The corresponding
AAV particles were referred to as AAV-amyloid-453-587.
[0256] For production of recombinant AAV particles carrying the
.beta.-amyloid epitope at position I-587, 293 cells were
transfected with the vector pUCAV2-amyloid-587 and the helper
plasmid pUCAdV as described above. The corresponding AAV particles
were referred to as AAV-amyloid-587. All AAV particles were
purified as described above
[0257] To evaluate the expression of the .beta.-amyloid epitope at
the surface of the AAV capsid, serial dilutions of purified AAV
particles AAV-amyloid-453-587 and AAV-amyloid-587 were dotted on a
membrane (FIG. 5). As a negative control AAV particles carrying a
CETP epitope at position I-587 were dotted. As a positive control a
.beta.-amyloid peptide (aa 1-42) (BIOSOURCE) was dotted. After
blocking of the membrane with blocking buffer (5% milk powder in
PBS containing 0.05% Tween-20), the .beta.-amyloid epitope was
detected using an anti-.beta.-amyloid mAb 6E10 (CHEMICON) (FIG. 5).
The anti-.beta.-amyloid mAb was used at a concentration of 1.0
.mu.g/ml in PBS/1% milk powder/0.05% Tween-20. Binding of the
anti-.beta.-amyloid mAb was detected using a peroxidase labeled
anti-mouse IgG antibody (CALTAG). After washing, signals were
detected by chemiluminescence using the SUPERSIGNAL WEST PICO
CHEMILUMINESCENT SUBSTRATE (PIERCE).
[0258] These data demonstrate that the double insertion of the
epitope into the insertion sites I-453 and I-587 resulting in
higher epitope density at the capsid surface than the singular
insertion of the epitope at position I-587 leads to an at least
2fold higher affinity of the double insertion mutant to the
.beta.-amyloid antibody as compared to the I-587-insertion mutant
alone.
6. Generation of Modified AAV2 Variants by Insertion of a
.alpha..sub.V.beta..sub.3 Integrin Targeting Sequence at Position
I-453 of the AAV Capsid by Genetic Manipulation
6.1. Determination of Titers
[0259] In order to generate a number of insertion mutants that
target the .alpha..sub.V.beta..sub.3 and .alpha..sub.V.beta..sub.5
integrins, the targeting peptide RGD-4C with its sequence [0260]
ACDCRGDCFCA (SEQ ID NO: 84) was inserted between G.sub.453 and
T.sub.454 of AAV2 structural proteins VP-1, VP-2 and VP-3 of AAV2
(mutant named RGD4C 453). This targeting insertion was further
combined with the two point mutations R.sub.585A and R.sub.588A in
order to diminish binding to AAV2's natural receptor HSPG (named
RGD4C 453 A2). The identical targeting peptide was inserted into
the previously described insertion site I-587 (named RGD4C 587) and
the corresponding R.sub.585A/R.sub.588A mutant (named RGD4C 587
A2). Further, the identical targeting peptide was inserted into
both insertion sites I-453 and I-587 (named RGD4C 453 & 587)
and the corresponding R.sub.585A/R.sub.588A mutant (named RGD4C 453
& 587 A2).
[0261] All mutants were generated by site-direct mutagenesis used
to package scGFP and titrated as follows: 293 cells were seeded at
80% confluence and co-transfected by calcium phosphate with a total
of 37.5 .mu.g vector plasmid pAAV/EGFP, packaging helper plasmid
(coding for Rep and Cap), and adenoviral plasmid pXX6 (Xiao et al.,
1998) at a 1:1:1 ratio. 48 h after transfection, cells were
harvested and pelleted by low-speed centrifugation. Cells were
resuspended in 150 mM NaCl, 50 mM Tris-HCl (pH 8.5), freeze-thawed
several times, and treated with Benzonase for 30 min at 37.degree.
C. Cell debris was spun down at 3.700 g for 20 min at 4.degree. C.
Supernatant was loaded onto a discontinuous iodixanol gradient. 40%
phase containing the vector was harvested and titered.
[0262] Genomic titers of vector stocks were determined by
quantitative PCR (Theiss et al., 2003). For this, viral DNA was
isolated from vector stocks according to the DNeasy kit protocol
(QIAGEN).
[0263] The capsid titers of vector stocks were determined by A20
ELISA as previously described (Girod et al., 1999).
[0264] Transducing titers were determined transducing HeLa cells
with the respective AAV mutant or wild-type expressing scGFP.
Transduced cells were then counted by standard FACS analysis. In
brief, 7.times.10.sup.4 HeLa cells were seeded into each well of a
12-well-plate and incubated for 24 h. Serial dilutions of the
respective virus were added to the cells and incubated for 48 h at
37.degree. C. and 5% CO.sub.2. Cells were trypsinized, transferred
into FACS tubes and analyzed by standard conditions by flow
cytometry (FACS Becton-Dickinson) in order to calculate the amount
of transducing particles per ml.
[0265] The amount of capsid per genomic particles in each viral
preparation showed, by comparison with wild-type, that all mutants
assembled capsids and packaged efficiently viral genomes (Table 10,
columns Cap/ml and GenP/ml). Determination of transducing particles
(tP) is dependent on all steps of viral transduction including
binding, uptake, lysosomal escape and activation of gene
expression. All tested mutants except the two double insertions
mutants AAV2 RGD4C 453 & 587 and AAV2 RGD4C 453 & 587 A2
had considerably high transducing titers of at least 10.sup.7
transducing particles per ml. Transducing titers of both double
insertion mutants were below the detection limit although a
successful cell binding could be determined.
[0266] The ratio of capsids per genomic particles provides
information about packaging efficiencies and thus allows
determining whether a capsid modification interferes with packaging
of vector genomes into the preformed AAV capsids. All tested
mutants were able to efficiently package viral genomes (Cap/GenP).
Consequently, the peptide RGD4C can be successfully inserted into
I-453. The tested mutants show capsid formation and efficient
packaging of viral genomes.
[0267] The ratio of genomic particles per transducing particles
(GenP/tP) is an indicator for the ability of a mutant containing a
viral genome to successfully transduce a cell and express its
reporter gene. Consequently the higher the ratio the lower is the
transducing activity of the mutant for the specific cell line.
[0268] The insertion of the RGD-4C peptide in either I-453 or I-587
led, compared to wild-type, to a higher GenP/tP ratio. Therefore,
the inserted targeting peptide somehow interfered with the
transducing activity of HeLa cells. The two double insertion
mutants AAV2 RGD4C 453 & 587 and AAV2 RGD4C 453 & 587 A2
were completely unable to transduce HeLa cells. This is surprising
as .alpha..sub.V.beta..sub.5, another reported target molecule of
the RGD-4C, is known to be present on HeLa cells and further is
known to be an AAV2 secondary receptor (Summerford et al.,
1999).
[0269] As expected, the two point mutations R.sub.585A and
R.sub.588A (AAV A2 mutant) led to a 3 log reduction of transducing
activity of the mutant capsids on HeLa cells. The insertion of one
targeting peptide in I-453 or I-587 restored to some extent the A2
mutants' ability to transduce HeLa cells, which can be explained by
the fact that .alpha..sub.V.beta..sub.5 is expressed on HeLa cells
and that therefore .alpha..sub.V.beta..sub.5 can compensate for the
diminished HSPG binding.
TABLE-US-00023 TABLE 10 Titers of a.nu..beta..sub.3 integrin
targeting Virus Cap/ml GenP/ml tP/ml Cap/GenP GenP/tP wtAAV2
1.09E+13 7.07E+11 6.84E+10 15 10 wtAAV2 9.50E+12 1.25E+12 4.34E+10
8 29 AAV2 A2 1.00E+13 1.11E+12 2.75E+07 9 40364 AAV2 RGD4C 1.12E+12
4.97E+11 1.63E+08 2 3049 453 AAV2 RGD4C 1.54E+12 6.12E+11 2.55E+08
3 2400 453 A2 AAV2 RGD4C 1.17E+12 4.73E+11 1.22E+08 3 3877 587 AAV2
RGD4C 2.83E+12 2.42E+11 6.45E+08 12 375 587 A2 AAV2 RGD4C 1.34E+12
1.55E+11 -- 9 -- 453 & 587 AAV2 RGD4C 5.02E+11 2.25E+11 -- 2 --
453 & 587 A2 (Cap = capsids; GenP = genomic particles; tP =
transducing particles)
6.2. Binding of Capsids to .alpha..sub.V.beta..sub.3 Integrin
[0270] The binding of AAV2 RGD-4C insertion mutants to their
receptor molecule .alpha..sub.V.beta..sub.3 integrin was analyzed
as previously described (Shi and Bartlett, 2003) and normalized to
the amount of AAV2 particles detected by A20. In brief an ELISA
plate was coated with A20 (75 ng/well, PROGEN). After blocking
(PBS, 1% milk powder, 1% Tween) 1.00.times.10.sup.10 particles were
given per well. For detection of a functional RGD purified
.alpha..sub.V.beta..sub.3 integrin (100 ng/well, CHEMICON) was
added to the plate and detected with anti-integrin .alpha.V
antibody (C-terminus/intracellular, Dil. 1:1.000, CHEMICON). For
quantification of viral particles in each well biotinylated A20
(250 ng/well) was used. The ratio "anti-integrin
.alpha..sub.V":"A20-biot" was used for normalization of the amount
of .alpha..sub.V.beta..sub.3 binding to total particles.
[0271] Both wild-type and the A2 mutant did not show any binding of
.alpha..sub.V.beta..sub.3 (FIG. 6). The mutants with a single
inserted targeting peptide either at I-453 or I-587 (RGD4C 453 and
RGD4C 587) showed clearly detectable binding of
.alpha..sub.V.beta..sub.3. Once the two arginines R.sub.585 and
R.sub.588 were replaced by alanine, these A2 mutants showed much
better binding of .alpha..sub.V.beta..sub.3 in the ELISA, whereas
RGD4C 453 was even superior to RGD4C 587. The double insertion
mutation RGD4C 453 & 587 also showed very good binding activity
for .alpha..sub.V.beta..sub.3. The double insertion double
replacement mutant RGD4C 453 & 587 A2 did not show a further
increase in binding compared to RGD4C A2. However, if compared to
the RGD4C 587 A2 mutant the additional insertion in I-453 clearly
increased its binding activity.
[0272] Consequently, the insertion site I-453 is well suited for
the insertion of peptides, as the RGD4C peptide is displayed on the
surface of the capsid and is accessible to antibodies and therefore
most likely to the corresponding cellular receptors. Its
combination with the R.sub.585A and R.sub.588A mutations increased
its binding activities approximately 50fold suggesting that
R.sub.585A and/or R.sub.588A mutants enhance the accessibility of
the insert to an antibody and/or receptor.
[0273] Considering the data from example 6.1, namely that the
double insert mutants AAV2 RGD4C 453 & 587 and AAV2 RGD4C 453
& 587 A2 did not show any transducing activity on HeLa cells,
whereas these double insert mutants very efficiently display the
peptide on the surface and strongly bind .alpha..sub.V.beta..sub.3,
can be explained by the following hypothesis: (i) there might be a
difference whether or not membrane bound receptor as in example 6.1
or the soluble receptor .alpha..sub.V.beta..sub.3 in this ELISA is
used. Whereas the inserted peptides are perfectly accessible to
small, soluble receptors the high number of modifications on the
surface of the capsid may sterically hinder the binding of a
larger, membrane fixed receptor; (ii) although the double insert
mutant binds to the membrane bound receptor, the uptake of the
virus or the intracellular processing is hindered so that no
transduction takes place. For example it is reasonable to believe
that the known mechanism of endosomal acidification triggering
conformational changes of the viral capsid might be impaired if
epitopes are presented in a too dense fashion.
6.3. HSPG Independent Transduction
[0274] HSPG independent transduction was tested using a Chinese
Hamster Ovarian (CHO) cell line with an HSPG knock-out phenotype
(ATCC No.: CRL-2242) that likely expresses
.alpha..sub.V.beta..sub.3 integrin as can be concluded from FIG. 8,
where the addition of soluble RGD peptide inhibits transduction.
Indeed, wild-type AAV2 had a very low transduction efficiency that
was even reduced in the A2 mutant (FIG. 7). The insertion of the
RGD-4C peptide into I-453 alone does not lead to significant
transduction rates, however, if combined with the A2 point
mutations (RGD4C 453 A2 in FIG. 7) transduction is even superior to
I-587 insertion mutants, suggesting a conformational dependency for
cell transduction.
[0275] This transduction could be inhibited by the addition of the
soluble RGD peptide but only weakly by the unspecific RGE peptide
(FIG. 8), demonstrating that the transduction by this mutant became
RGD-4C dependent. Transduction efficiency of these CHO HSPG KO
cells was increased by a factor of about four in relation to
wild-type (FIG. 7).
[0276] The single insertion mutants at position I-587 (RGD4C 587
and RGD4C 587 A2) also showed an increased transduction rate
compared to wild-type, but not as strong as for RGD4C 453 A2 (FIG.
7). Transduction of RGD4C 587 was also inhibited by soluble RGD
peptide indicating its dependence on the RGD-4C interaction with
the .alpha..sub.V.beta..sub.3 integrin.
[0277] The double insertion mutant (RGD4C 453 & 587 and RGD4C
453 & 587 A2) again were not able to efficiently transduce
cells (FIG. 7) as already shown for HeLa cells (Table 10) despite
efficient binding to soluble .alpha..sub.V.beta..sub.3 (FIG. 6).
Again this could be explained by either steric hindrance of the too
dense targeting sequences or by an inefficient uptake and/or the
intracellular processing of the virus.
7. Generation of Further AAV Variants
[0278] 7.1. Insertion of CETP Epitopes into the AAV2 Capsid at
Position I-453
[0279] The following rabbit CETP derived epitopes were cloned into
position I-453 of the AAV2 capsid using annealed oligonucleotides
as described above. Each of the inserted epitope sequences in the
AAV2 backbone at I-453 is flanked by the following alanine/glycine
adaptors according to the following scheme (Xn represents the
epitope sequence): [0280] Type I Ala/Gly adaptor:
(Ala).sub.2-(Gly).sub.3-Xn-(Gly).sub.4-Arg-(Ala).sub.2 [0281] Type
II Ala/Gly adaptor:
(Ala).sub.3-(Gly).sub.3--X.sub.n-(Gly).sub.4-Arg-(Ala).sub.2
TABLE-US-00024 [0281] TABLE 11 rabbit CETP derived epitopes in
I-453 Name/ sense anti-sense Peptide Seq. Type Oligonucleotide
Oligonucleotide Adaptor CETP TP10 Epitope 5'GGCCGGCGGTGGAGCCA
5'CGCGTCCACCGCCACC Type I AKAVSNLTESRS AGGCCGTGAGCAACCTGAC
GCTCTGCAGGCTCTCGCT Ala/Gly ESLQS CGAGAGCAGAAGCGAGAGC
TCTGCTCTCGGTCAGGTT SEQ ID NO: 96 CTGCAGAGCGGTGGCGGTG
GCTCACGGCCTTGGCTCC GA 3' ACCGCC 3' SEQ ID NO: 128 SEQ ID NO: 129
CETP TP11 Epitope 5'GGCCGGCGGTGGAAGCC 5'CGCGTCCACCGCCACC Type I
SLTGDEFKKVLET TGACCGGCGACGAATTCAA GGTCTCCAGCACCTTCTT Ala/Gly SEQ ID
NO: 97 GAAGGTGCTGGAGACCGGT GAATTCGTCGCCGGTCAG GGCGGTGGA 3'
GCTTCCACCGCC 3' SEQ ID NO: 130 SEQ ID NO: 131 CETP TP12 Epitope
5'GGCCGGCGGTGGAAGAG 5'CGCGTCCACCGCCACC Type I REAVAYRFEED
AGGCCGTGGCCTACAGATT GTCCTCTTCGAATCTGTA Ala/Gly SEQ ID NO: 98
CGAAGAGGACGGTGGCGGT GGCCACGGCCTCTCTTCC GGA 3' ACCGCC 3' SEQ ID NO:
132 SEQ ID NO: 133 CETP TP13 Epitope 5'GGCCGGCGGTGGAATCA
5'CGCGTCCACCGCCACC Type I INPEIITLDG ACCCCGAGATCATCACCCT
GCCGTCCAGGGTGATGAT Ala/Gly SEQ ID NO: 99 GGACGGCGGTGGCGGTGGA
CTCGGGGTTGATTCCACC 3' GCC 3' SEQ ID NO: 134 SEQ ID NO: 135 CETP
TP18 Epitope 5'GGCCGGCGGTGGAGACA 5'CGCGTCCACCGCCACC Type I
DISVTGAPVITAT TCAGCGTGACCGGTGCACC CAGGTAGGTGGCGGTGAT Ala/Gly YL
CGTGATCACCGCCACCTAC CACGGGTGCACCGGTCAC SEQ ID NO: 100
CTGGGTGGCGGTGGA 3' GCTGATGTCTCCACCGCC SEQ ID NO: 136 3' SEQ ID NO:
137 CETP TP20 Epitope 5'GGCCGGCGGTGGAGACA 5'CGCGTCCACCGCCACC Type I
DISVTGAPVITA TCAGCGTGACCGGTGCACC GGCGGTGATCACGGGTGC Ala/Gly SEQ ID
NO: 101 CGTGATCACCGCCGGTGGC ACCGGTCACGCTGATGTC GGTGGA 3' TCCACCGCC
3' SEQ ID NO: 138 SEQ ID NO: 139 Ritsch-1 Epitope
5'GGCCGGCGGTGGAGACC 5'CGCGTCCACCGCCACC Type I DQSVDFEIDSA
AGAGCGTGGACTTCGAGAT GGCGCTGTCGATCTCGAA Ala/Gly SEQ ID NO: 127
CGACAGCGCCGGTGGCGGT GTCCACGCTCTGGTCTCC GGA 3' ACCGCC 3' SEQ ID NO:
140 SEQ ID NO: 141
7.2. Insertion of CETP Epitopes into the AAV2 Capsid at Position
I-453 and I-587
[0282] Using the cloning strategy described above, the following
AAV2 capsid variants carrying rabbit CETP epitopes at position
I-453 and I-587 were produced:
TABLE-US-00025 TABLE 12 CETP double insertion mutants Name Epitope
at I-453 Epitope at I-587 AAV-TP10-2x AKAVSNLTESRSESLQS
AKAVSNLTESRSESLQS SEQ ID NO: 96 SEQ ID NO: 96 AAV-TP11-2x
SLTGDEFKKVLET SLTGDEFKKVLET SEQ ID NO: 97 SEQ ID NO: 97 AAV-TP12/13
REAVAYRFEED INPEIITLDG SEQ ID NO: 98 SEQ ID NO: 99 AAV-TP12-2x
REAVAYRFEED REAVAYRFEED SEQ ID NO: 98 SEQ ID NO: 98 AAV-TP13-2x
INPEIITLDG INPEIITLDG SEQ ID NO: 99 SEQ ID NO: 99 AAV-TP18-2x
DISVTGAPVITATYL DISVTGAPVITATYL SEQ ID NO: 100 SEQ ID NO: 100
AAV-TP20-2x DISVTGAPVITA DISVTGAPVITA SEQ ID NO: 101 SEQ ID NO: 101
AAV-Ritsch1-2x DQSVDFEIDSA DQSVDFEIDSA SEQ ID NO: 127 SEQ ID NO:
127 AAV2-CETin-2x CDAGSVRTNAPD CDAGSVRTNAPD SEQ ID NO: 60 SEQ ID
NO: 60
7.3. Insertion of Cytokine Epitopes into the AAV2 Capsid at
Position I-453
[0283] The following murine cytokine derived epitopes were cloned
into position I-453 of the AAV2 capsid using annealed
oligonucleotides as described above. Each of the inserted epitope
sequences in the AAV2 backbone at I-453 is flanked by the
alanine/glycine adaptors according this section 7 for I-453
above.
TABLE-US-00026 TABLE 13 murine cytokine derived epitopes in I-453
Name/ sense anti-sense Peptide Seq. Type Oligonucleotide
Oligonucleotide Adaptor mTNF.alpha.-V1 Epitope 5'GGCCGCCGGTGGAGGCA
5'CGCGCCCTCCACCGCC Type II SSQNSSDKPVAH GCAGCCAGAACAGCAGCGA
CTCCACCTGGTGGTTAGC Ala/Gly VVANHQVE CAAGCCCGTGGCCCACGTG
CACCACGTGGGCCACGGG SEQ ID NO: 142 GTGGCTAACCACCAGGTGG
CTTGTCGCTGCTGTTCTG AGGGCGGTGGAGGG 3' GCTGCTGCCTCCACCGGC SEQ ID NO:
145 3' SEQ ID NO: 148 mIL-17-V1 Epitope 5'GGCCGCCGGTGGAGGCA
5'CGCGCCCTCCACCGCC Type II NAEGKLDHHMN ACGCCGAGGGCAAGCTTGA
CAGCACGCTGTTCATGTG Ala/Gly SVL CCACCACATGAACAGCGTG
GTGGTCAAGCTTGCCCTC SEQ ID NO: 143 CTGGGCGGTGGAGGG 3'
GGCGTTGCCTCCACCGGC SEQ ID NO: 146 3' SEQ ID NO: 149 mIL-6-V2
Epitope 5'GGCCGCCGGTGGAGGCC 5'CGCGCCCTCCACCGCC Type II LEEFLKVTLRS
TGGAGGAATTCCTGAAGGT GCTTCTCAGGGTCACCTT Ala/Gly SEQ ID NO: 144
GACCCTGAGAAGCGGCGGT CAGGAATTCCTCCAGGCC GGAGGG 3' TCCACCGGC 3' SEQ
ID NO: 147 SEQ ID NO: 150
[0284] The following sequences, which are homologues to the
corresponding murine cytokine sequences, can be integrated into the
AAV2 capsid at position I-453 according to the methods described
above:
TABLE-US-00027 TABLE 14 human cytokine derived epitopes in I-453
Cytokine murine epitope human epitope TNF-.alpha. V1
SSQNSSDKPVAHVVANHQVE SSRTPSDKPVAHVVANPQAE SEQ ID NO: 142 SEQ ID NO:
116 TNF-.alpha. V2 SQNSSDKPVAHVVANH SRTPSDKPVAHVVANP SEQ ID NO: 151
SEQ ID NO: 117 TNF-.alpha. V3 SSQNSSDKP SSRTPSDKP SEQ ID NO: 152
SEQ ID NO: 118 IL-17 V1 NAEGKLDHHMNSVL NADGNVDYHMNSVP SEQ ID NO:
143 SEQ ID NO: 119 IL-17 V2 EGKLDHHMNSV DGNVDYHMNSV SEQ ID NO: 153
SEQ ID NO: 120 IL-6 V1 KSLEEFLKVTLRSTRQ RSFKEFLQSSLRALRQ SEQ ID NO:
154 SEQ ID NO: 121 IL-6 V2 LEEFLKVTLRS FKEFLQSSLRA SEQ ID NO: 144
SEQ ID NO: 122
7.4. Insertion of Cytokine Epitopes into the AAV2 Capsid at
Position I-453 and I-587
[0285] Using the cloning strategy described above, the following
AAV variants carrying different cytokine epitopes at position I-453
and I-587 can be generated (bivalent vaccines):
TABLE-US-00028 TABLE 15 double insertion variants for cytokine
derived epitopes com- bination Epitope at I-453 Epitope at I-587
TNF-.alpha./ mTNF.alpha.-V1 mIL-17-V1 IL-17 SSQNSSDKPVAHVVANHQVE
NAEGKLDHHMNSVL SEQ ID NO: 142 SEQ ID NO: 143 TNF-.alpha./
mTNF.alpha.-V1 mIL-6-V2 IL-6 SSQNSSDKPVAHVVANHQVE LEEFLKVTLRS SEQ
ID NO: 142 SEQ ID NO: 144 IL-17/ mIL-17-V1 mTNF.alpha.-V1
TNF-.alpha. NAEGKLDHHMNSVL SSQNSSDKPVAHVVANHQVE SEQ ID NO: 143 SEQ
ID NO: 142 IL-6/ mIL-6-V2 mTNF.alpha.-V1 TNF-.alpha. LEEFLKVTLRS
SSQNSSDKPVAHVVANHQVE SEQ ID NO: 144 SEQ ID NO: 142 IL-17/ mIL-17-V1
mIL-6-V2 IL-6 NAEGKLDHHMNSVL LEEFLKVTLRS SEQ ID NO: 143 SEQ ID NO:
144 IL-6/ mIL-6-V2 mIL-17-V1 IL-17 LEEFLKVTLRS NAEGKLDHHMNSVL SEQ
ID NO: 144 SEQ ID NO: 143
8. Immunization of Rabbits with AAV-Based Vaccines
8.1. Production and Purification of AAV2-Based Vaccines for
Immunization Experiments
[0286] For production of AAV particles HEK 293-T cells were
co-transfected with the vector plasmid pUCAV2 containing the
subcloned epitope (in I-453 and/or I-587) and the helper plasmid
pUCAdV as described above. For large scale production 30-60 O15 cm
cell culture plates with 7.5.times.10.sup.6 293-T cells were seeded
and cultivated at 37.degree. C., 5% CO.sub.2 in a humidified
atmosphere. Co-transfection of the cells with the vector plasmid
pUCAV2 containing the epitope (in I-453 or I-587) and pUCAdV was
performed as described above. 72 h after transfection 293-T cells
and medium were harvested and centrifuged at 3000 g at 4.degree. C.
for 15 min. The cell pellet was resuspended in 15-30 ml lysis
buffer (50 mM HEPES, 200 mM NaCl, 2.5 mM MgCl.sub.2; pH 6.8) and
objected to three rounds of freeze and thaw cycles. The cleared
cell culture supernatant was concentrated by TFF (tangential flow
filtration) using the SARTOFLOW.RTM. Slice 200 Benchtop Cross-flow
system using a SARTOCON.RTM. Slice 200 cassette (Hdyrosart
membrane). The TFF concentrate of the cell culture supernatant
(about 35 ml) was pooled with the cleared crude lysate and
subsequently treated with 1667 U/ml benzonase (MERCK) at 37.degree.
C. for 2 h-4 h. After benzonase treatment the pool of crude lysate
and TFF concentrate was centrifuged at 3600 g for 5 min at
4.degree. C. The AAV-containing supernatant was separated through a
size exclusion chromatography (SEC) column. SEC was performed using
a XK50/20 column packed with SUPERDEX 200.RTM. resin beads and SEC
running buffer (50 mM HEPES, 400 mM NaCl, 2.5 mM MgCl.sub.2; pH
6.8). SEC fractions were analyzed by AAV2 ELISA. AAV-containing
fractions were pooled and objected to iodixanol gradient
centrifugation. Iodixanol solutions of different concentrations
were layered beneath the pool of virus containing SEC fraction in
QUICKSEAL.RTM. centrifugation tubes (25.times.89 mm; BECKMAN). By
this an Iodixanol gradient was created composed of 4.0 ml 60% on
the bottom, 5.0 ml 40%, 4.0 ml 25% and 5.5 ml 15% Iodixanol with
the virus solution on top. The gradient was centrifuged using a
fixed angel rotor (Ti 70.1 rotor, BECKMAN) at 65000 rpm for 1 h at
18.degree. C. The 40% phase containing the AAV particles was then
extracted with a cannula by puncturing the tube underneath the 40%
phase and allowing the solution to drip into collecting tubes.
Fractions of about 0.5 ml were collected until the 25% phase was
reached. The AAV capsid titer of the fractions was determined using
a commercially available ELISA (AAV Titration ELISA, PROGEN).
Purity of the AAV-containing fractions was determined by SDS-PAGE
and subsequent colloidal Coomassie staining. Fractions with high
purity of AAV particles were pooled and the capsid titer of the
final pool was determined by AAV2 titration ELISA.
8.2. Breaking of Self-Tolerance by AAV-Based Vaccines
[0287] A panel of AAV-based vaccines carrying epitopes derived from
rabbit CETP was generated as described above. AAV-based CETP
vaccines were compared with the corresponding peptide vaccines
containing the same epitope coupled to LPH (Limulus polyphemus
hemocyanine) as a carrier protein. The peptides were chemically
synthesized with a C- or N-terminal cysteine residue that was used
for coupling of the peptides to LPH. Synthesis and coupling of the
peptides was performed by BIOGENES (Berlin, Germany).
[0288] The vaccines described in table Table 16 were used for
immunization of rabbits:
TABLE-US-00029 TABLE 16 Vaccines used for immunization of rabbits
Name of Vaccine Insertion Dose vaccine carrier Site Epitope (.mu.g)
AAV-TP11 AAV2 I-587 SLTGDEFKKVLET 10.9 SEQ ID NO: 97 AAV-TP12 AAV2
I-587 REAVAYRFEED 14.1 SEQ ID NO: 98 AAV-TP13 AAV2 I-587 INPEIITLDG
13.3 SEQ ID NO: 99 AAV-TP18 AAV2 I-587 DISVTGAPVITATYL 7.2 SEQ ID
NO: 100 LPH-TP11 LPH N/A CSLTGDEFKKVLET see text SEQ ID NO: 155
LPH-TP12 LPH N/A CREAVAYRFEED see text SEQ ID NO: 156 LPH-TP13 LPH
N/A CINPEIITLDG see text SEQ ID NO: 157 LPH-TP18 LPH N/A
CDISVTGAPVITATYL see text SEQ ID NO: 158
[0289] For each vaccination approach two rabbits were immunized
s.c. with the vaccines shown in the table above four times (one
prime and three boost immunizations). The first boost immunization
was performed 2 weeks after an initial prime immunization. Rabbits
were boosted another two times with the vaccines at intervals of 3
weeks. Serum of the immunized animals was prepared two weeks after
each boost immunization.
[0290] The purified AAV-based vaccines were mixed an equal volume
of formulation buffer (PBS with 1% sorbitol, 0.2% Tween-20, 25%
propylenglycol, 200 mM NaCl and 2.5 mM MgCl.sub.2) for
stabilization of the particles and stored at -80.degree. C. until
administration. If necessary, the volume of the AAV-based vaccines
was adjusted to 0.3 ml with formulation buffer directly before
application. The vaccines were administered s.c. in the presence of
0.7 ml adjuvant (total volume 1 ml). The adjuvant was provided by
BIOGENES and contained amongst others 0.01% lipopolysaccharide
derived from Phormidium, 95% paraffin oil, 2.4% Tween-40 and 0.1%
cholesterol.
[0291] The LPH-coupled peptides (in 0.3 ml TBS) were administered
s.c. in the presence of 0.7 ml of the adjuvant provided by
BIOGENES. 1 mg of the LPH-peptide conjugate was administered for
the prime immunization. 0.5 mg of the conjugate was used for the
1.sup.st boost immunization and 0.25 mg of the conjugate were used
for the 2.sup.nd and 3.sup.rd boost immunization.
[0292] Induction of anti-CETP auto-antibodies in the vaccinated
animals was determined by ELISA using recombinant rabbit CETP as
antigen. For production of rabbit CETP, the CETP cDNA was amplified
by RT-PCR using the primers
TABLE-US-00030 rCETP-uni (SEQ ID NO: 159) 5'-GGG GAA TTC ATG TCC
CAA AGG CGC CTC CTA CG-3' and rCETP-rev (SEQ ID NO: 160) 5'-GGG GGA
TCC CTA GCT CAG GCT CTG GAG GAA ATC C-3'
and rabbit liver PolyA.sup.+ RNA (CLONTECH) as template. The CETP
cDNA was cloned into the EcoRI/BamHI site of the vector
p3XFLAG-CMV-8 (SIGMA). The resulting vector encodes the mature CETP
sequence with a C-terminal FLAG.RTM.-tag and an N-terminal
preprotrypsin leader sequence for secretion of the recombinant
protein. For expression of recombinant rabbit CETP 293T cells were
transfected with the vector by calcium phosphate transfection as
described above. CETP was purified from the cell culture
supernatant by affinity chromatography using anti-FLAG.RTM. M2
agarose beads (SIGMA). Purity of the recombinant rabbit CETP was
analyzed by SDS-PAGE and subsequent colloidal Coomassie staining.
CETP activity was determined using a commercially available CETP
activity assay (ROAR).
[0293] For titration of rabbit CETP auto-antibodies in the immune
sera, a 96-well MAXISORP plate (NUNC) was coated with purified
recombinant rabbit CETP (100 ng/well) for 1 h at 37.degree. C.
After coating wells were washed with wash buffer (PBS/0.1%
Tween-20) and subsequently incubated with blocking buffer (5% skim
milk in wash buffer) for 1 h at 37.degree. C. After blocking of the
wells, immobilized CETP was incubated with serial dilutions of the
immune sera in dilution buffer (wash buffer with 1% skim milk and
1% BSA) for 1 h at 37.degree. C. Rabbit pre-immune sera or rabbit
sera of unrelated vaccinations served as negative controls. After
washing binding of rabbit IgG to the immobilized CETP was detected
using a HRP-labelled anti-rabbit IgG antibody (H+L) (DAKO; 1:2500
in dilution buffer). Signals (OD) were detected using TMB
(KEMENTEC) as substrate.
[0294] CETP auto-antibody titers were determined by end point
dilution. The titer of the immune serum corresponds to the
intersection point of the titration curve of the immune sera with
the limit of detection of the assay.
[0295] The limit of detection (LOD) of the assay was calculated as
follows:
Mean OD (unspecific sera)+3.3.times. standard deviation OD
(unspecific sera)
[0296] In addition to the CETP auto-antibody titers, the
anti-peptide titers of the immune sera were analyzed. The free
peptides (corresponding to the epitopes integrated in the AAV
capsid or coupled to LPH) were covalently immobilized in a 96-well
plate (REACTI-BIND.TM. Amine-binding, Maleic Anhydride Activated
Plates; PIERCE). For immobilization of the peptide, the 96-well
plate was incubated with 1 .mu.g peptide per well in a total volume
of 50 .mu.l PBS for at least 1 h at 37.degree. C. After coating
with the peptides wells were blocked with 200 .mu.l/well blocking
buffer (PBS/5% skim milk/0.1% Tween-20) for 1 h at 37.degree. C.
After blocking of the wells, immobilized peptides were incubated
with serial dilutions of the immune sera in dilution buffer (PBS
with 1% skim milk, 1% BSA, 0.1% Tween-20) for 1 h at 37.degree. C.
Rabbit pre-immune sera or rabbit sera of unrelated vaccinations
served as negative controls. After washing binding of rabbit IgG to
the immobilized CETP was detected using a HRP-labelled anti-rabbit
IgG antibody (DAKO; 1:2500 in dilution buffer). Signals (OD) were
detected using TMB (KEMENTEC) as substrate. Antibody titers were
determined as described above.
[0297] Except for one animal vaccinated with AAV-TP13 the data
demonstrate that vaccination with AAV-based vaccines induces high
titers of target-specific auto-antibodies that are not obtained
using peptide-based vaccines. Accordingly AAV-based vaccines are
able to break self-tolerance and induce high levels of
auto-antibodies (FIG. 9). The immunogenic properties of the peptide
based vaccines are reflected by the high titers of peptide specific
antibodies induced by the peptide vaccines (FIG. 10). However,
these antibodies show only weak reaction with native rabbit CETP
(FIG. 9) suggesting that peptide based vaccines--although
immunogenic--have only a limited potential to break self-tolerance
and induce low levels of auto-antibodies.
8.3. The AAV Capsid Structure is Essential for Breaking of
Self-Tolerance and Induction of Auto-Antibodies
[0298] To demonstrate that the capsid structure and the structured,
repetitive presentation of epitopes within the AAV-capsid are
essential for breaking of self-tolerance of the immune system and
induction of auto-antibodies, rabbits were immunized with
heat-denatured AAV-TP11-2x or AAV-TP18-2x particles. Results were
compared with vaccinations using the corresponding native
particles. The AAV-variant AAV-TP11-2x carries the CETP TP11
epitope (SLTGDEFKKVLET, SEQ ID NO: 97) at positions I-453 and
I-587. The AAV-variant AAV-TP18-2x carries the CETP TP18 epitope
(DISVTGAPVITATYL, SEQ ID NO: 100) at positions I-453 and I-587. For
heat denaturation the particles were mixed with an equal volume of
formulation buffer (PBS with 1% sorbitol, 0.2% Tween-20, 25%
propylenglycol, 200 mM NaCl and 2.5 mM MgCl.sub.2) and incubated at
90.degree. C. for 15 min. Destruction of the particle conformation
was analyzed by AAV2 titration ELISA recognizing a conformational
epitope within the native capsid. Protein concentration of the
heat-denatured particles was determined by Micro BCA assay (Pierce)
and analyzed by Western blotting using a polyclonal anti-AAV2
antibody generated by immunization of rabbits with purified VP3
protein of AAV2 (data not shown).
[0299] Rabbits were immunized with heat-denatured AAV-TP11-2x
particles (5.7 .mu.g per application) or AAV-TP18-2x particles (1.8
.mu.g per application) s.c. in the presence of an adjuvant provided
by BIOGENES as described above. 2 weeks after an initial prime
immunization rabbits were boosted with the heat-denatured
particles. Serum of the animals was analyzed 2 weeks after the
boost immunization for levels of CETP auto-antibodies as described
above. In a control group rabbits were vaccinated with native
AAV-TP11-2x or AAV-TP18-2x particles using the same regimen as for
the heat-denatured particles.
[0300] Analysis of the CETP auto-antibody titer in the sera of the
immunized animals demonstrates that destruction of the native
capsid conformation results in a strongly impaired induction of
CETP antibodies compared with the native vaccine (FIG. 11) showing
that the native capsid structure and the structured presentation of
the epitopes within the capsid are essential for breaking of
self-tolerance.
8.4. Evaluation of the Impact of Anti-AAV2 Antibodies on
Immunization with AAV2-Based Vaccines
[0301] The immunization experiments demonstrated that AAV-based
vaccines induce high titers of anti-AAV capsid antibodies in
addition to the target specific antibodies (data not shown).
However, most humans are AAV2 positive meaning that these persons
have anti-AAV2 antibody titers that potentially might affect
vaccination results using AAV2-based particles. To evaluate the
impact of anti-AAV2 antibodies on the immunization success of
AAV2-based vaccines, rabbits were pre-immunized by two applications
of wtAAV2 (4.5 .mu.g per application), before immunization (prime
and two boost immunizations) with an AAV2-based CETP vaccine
(AAV-TP18) was started. wtAAV2 particles were administered s.c. or
i.m. in the presence of an adjuvant provided by BIOGENES as
described above. 2 weeks after an initial prime immunization with
wtAAV2, rabbits were boosted once again with wtAAV2. Serum was
analyzed two weeks after the prime and 1.sup.st boost immunization
for the level of anti-AAV2 antibodies. The anti-AAV2 antibody titer
was determined by ELISA using immobilized wtAAV2 particles as
described below. The data demonstrate that high levels of
anti-wtAAV2 antibodies are detectable after two applications of
wtAAV2 for both s.c. and i.m. administration (FIG. 12A).
[0302] 3 weeks after boost immunization with wtAAV2, rabbits
received the first prime immunization with the AAV2-based vaccine
AAV-TP18 (7.2 .mu.g per application). The vaccine was administered
s.c. or i.m. in the presence of adjuvant provided by BIOGENES as
described above. Rabbits were boosted with the vaccines 2 weeks
after the prime vaccination. Sera were analyzed 2 weeks after the
boost vaccination for the level of CETP auto-antibodies (FIG. 12B).
CETP auto-antibody titers were determined as described above.
Results were compared to vaccination (s.c.) of animals not
pre-immunized with wtAAV2.
[0303] The data demonstrate that wtAAV2 pre-immunization results in
high titers of anti-AAV2 capsid antibodies. However, these high
anti-AAV2 capsid antibodies do not impair the immunization success
of an AAV2-based vaccine, in this case regarding the induction of
anti-CETP auto-antibodies. Accordingly, it is concluded that AAV2
sero-positive humans are equally eligible for vaccination with
AAV2-particles as sero-negative humans and that sero-conversion of
a vaccinated human during a vaccination protocol does not impair
vaccination success.
[0304] Determination of anti-wtAAV2 antibody titers: The anti-AAV2
antibody titer was determined by ELISA using immobilized wtAAV2
particles. Briefly, 5.times.10.sup.09 wtAAV2 particles were
immobilized in each well of a 96-well MAXISORP plate (NUNC) in a
total volume of 50 .mu.l PBS per well. The plate was incubated at
37.degree. C. for 1 h. After blocking of the wells with PBS/5% skim
milk/0.1% Tween-20, immobilized wtAAV2 particles were incubated
with serial dilutions of the immune sera in dilution buffer (PBS
with 1% skim milk, 1% BSA, 0.1% Tween-20) for 1 h at 37.degree. C.
Rabbit pre-immune sera or rabbit sera of unrelated vaccinations
served as negative controls. After washing binding of rabbit IgG to
the immobilized AAV2 was detected using a HRP-labelled anti-rabbit
IgG antibody and TMB as substrate. Antibody titers were determined
as described above.
8.5. Prime/Boost Regimen for AAV-Based Vaccines
[0305] 16.4 .mu.g AAV2 particles carrying the CETP-intern epitope
(CDAGSVRTNAPD, SEQ ID NO: 60) at position I-453 and I-587
(AAV2-CETin-2x) were administered i.m. at each prime or boost
immunization together with the adjuvant provided by BIOGENES as
described above.
[0306] Three different regimens were evaluated. Group A received
one prime and three boost applications of AAV2-CETin-2x (AAV2-based
vaccination). Group B received one prime and one boost immunization
with AAV2-CETin-2x followed by two boost immunizations with the
LPH-coupled CETP-intern peptide (LPH-peptide boost). Group C
received one prime and one boost immunization with AAV2-CETIn-2x
followed by two boost immunizations with AAV1-CETin (AAV1 particle
carrying the CETP-intern epitope at position I-588; 11.7
.mu.g/application). In each group the first boost immunization was
performed two weeks after the prime immunization. The 2.sup.nd and
3.sup.rd boost immunization was performed three weeks after the
preceding boost vaccination.
[0307] Immune sera were analyzed for anti-CETP-reactivity (CETP
auto-antibody titer) two weeks after the 1st, 2nd and 3rd boost
immunization as described above (FIG. 13).
[0308] Resulting data demonstrate that high levels of CETP
auto-antibodies are detectable in animals vaccinated with
AAV2-CETin-2x only (group A). There is no increase of CETP
auto-antibodies observed in the group of animals boosted with
LPH-coupled CETP peptide (group B). Furthermore, data demonstrate
that switching of the serotype of the AAV-backbone (group C) has
the potential to increase the immune response to a self-antigen
compared to boost vaccinations with an individual AAV serotype.
8.6. Immunization Against Human IgE Using AAV-Based Vaccines
[0309] A panel of AAV-based vaccines carrying epitopes derived from
human IgE was generated as described above. AAV-based IgE vaccines
were compared to the corresponding peptide vaccines containing the
same epitope coupled to LPH as carrier protein. The peptides were
chemically synthesized with a C- or N-terminal cysteine residue
that was used for coupling of the peptides to LPH. The following
vaccines were used for immunization of rabbits:
TABLE-US-00031 TABLE 17 AAV- and LPH-based vaccines used for
immunization against human IgE Vaccine Insertion Dose Name of
vaccine carrier Site Epitope (.mu.g) Appl. AAV-Kricek AAV2 I-587
Kricek 3.1 s.c. AAV-3DEpi3 AAV2 I-587 3DEpi3 4.4 s.c. AAV-Flex AAV2
I-587 Flex 16.3 i.m. AAV-Bind2 AAV2 I-587 Bind2 5.1 i.m. LPH-Kricek
LPH N/A VNLTWSRASGC see text i.m. SEQ ID NO: 161 LPH-3DEpi3 LPH N/A
CDSNPRGVSAYLSR see text i.m. SEQ ID NO: 162 LPH-Flex LPH N/A
CEDGQVMDVDLS see text i.m. SEQ ID NO: 163 LPH-Bind2 LPH N/A
CEKQRNGTLT see text i.m. SEQ ID NO: 164
[0310] For each vaccination approach two rabbits were immunized
with the vaccines shown in the table above four times (one prime
and three boost immunizations). The first boost immunization was
performed 2 weeks after an initial prime immunization. Rabbits were
boosted another two times with the vaccines at intervals of 3
weeks.
[0311] The purified AAV-based vaccines were mixed with an equal
volume of formulation buffer (PBS with 1% sorbitol, 0.2% Tween-20,
25% propylenglycol, 200 mM NaCl and 2.5 mM MgCl.sub.2) for
stabilization of the particles and stored at -80.degree. C. until
administration. If necessary, the volume of the vaccine was
adjusted to 0.3 ml-0.5 ml with formulation buffer directly before
application. The AAV-based vaccines were administered s.c. or i.m.
together with the BIOGENES adjuvant (total volume 1 ml).
[0312] The LPH-coupled peptides (in 0.3 ml TBS) were administered
i.m. in the presence of 0.7 ml of the adjuvant provided by
BIOGENES. 1 mg of the LPH-peptide conjugate was administered for
the prime immunization. 0.5 mg of the conjugate was used for the
1.sup.st boost immunization and 0.25 mg of the conjugate were used
for the 2.sup.nd and 3.sup.rd boost immunization.
[0313] Induction of anti-human IgE antibodies in the vaccinated
animals was determined by ELISA using human IgE (DIATEC, Oslo,
Norway) as antigen. A 96-well MAXISORP plate (NUNC) was coated with
human IgE (1 .mu.g/well) for 1 h at 37.degree. C. After coating
wells were washed with wash buffer (PBS/0.1% Tween-20) and
subsequently incubated with blocking buffer (5% skim milk in wash
buffer) for 1 h at 37.degree. C. After blocking of the wells,
immobilized human IgE was incubated with serial dilutions of the
immune sera in dilution buffer (wash buffer with 1% skim milk and
1% BSA) for 1 h at 37.degree. C. Rabbit pre-immune sera or rabbit
sera of unrelated vaccinations served as negative controls. After
washing binding of rabbit IgG to the immobilized IgE was detected
using a HRP-labelled anti-rabbit IgG antibody (DAKO; 1:2500 in
dilution buffer). Signals (OD) were detected using TMB (KEMENTEC)
as substrate.
[0314] In addition to the IgE titers, the anti-peptide titers of
the immune sera were analyzed. The free peptides (corresponding to
the epitopes integrated in the AAV capsid or coupled to LPH) were
covalently immobilized in a 96-well plate (REACTI-BIND.TM.
Amine-binding, Maleic Anhydride Activated Plates; PIERCE) as
described above. After blocking of the wells, immobilized peptides
were incubated with serial dilutions of the immune sera in dilution
buffer (PBS with 1% skim milk, 1% BSA, 0.1% Tween-20) for 1 h at
37.degree. C. Rabbit pre-immune sera or rabbit sera of unrelated
vaccinations served as negative controls. After washing binding of
rabbit IgG to the immobilized CETP was detected using a
HRP-labelled anti-rabbit IgG antibody (DAKO; 1:2500 in dilution
buffer). Signals (OD) were detected using TMB (KEMENTEC) as
substrate. Antibody titers were determined as described above
[0315] The anti-IgE titers of the immune sera are summarized in
Table 18 below:
TABLE-US-00032 TABLE 18 Mean anti-IgE titer of immunizations with
AAV- vs. LPH-based IgE vaccines anti-IgE Titer anti-IgE Titer
anti-IgE Titer Vaccine 1.sup.st Boost 2.sup.nd Boost 3.sup.rd Boost
AAV-Kricek 4750 20150 25460 AAV-Kricek* n.d. 7950 27000 AAV-3DEpi3*
5000 18200 30140 AAV-Bind2 575 3075 7750 AAV-Flex 17200 40300 38100
LPH-Kricek n.d. 1300 400 LPH-3DEpi3 705 1400 1600 LPH-Flex 15000
14000 23250 LPH-Bind2 0 0 0 *AAV-based vaccines were used for the
prime and 1.sup.st boost immunization; 2.sup.nd and 3.sup.rd boost
immunization were performed with the corresponding LPH-coupled
peptide
[0316] Interestingly, vaccination of rabbits with LPH-Kricek,
LPH-3DEpi3 or LPH-Bind2 failed to induce significant levels of
antibodies against human IgE. The immunogenic properties of the
peptide based vaccines are reflected by the high titers of peptide
specific antibodies induced by the peptide vaccines (data not
shown). However, these antibodies show no or only weak reaction
with native human IgE. Only LPH-Flex induced reasonably high titers
of antibodies specific for native human IgE. This is in clear
contrast to the results obtained with the corresponding AAV-based
vaccines like AAV-Kricek (FIG. 14) which generate considerably
higher human IgE specific antibody titers compared to the
corresponding LPH-fusion constructs. This indicates that the fixed
conformation of the corresponding IgE epitopes in the AAV2 capsid
resembles the structure of the sequence within the IgE molecule in
a better way than the LPH-coupled peptides. It should be noted that
the generation of anti-human IgE antibodies in this animal model
with rabbits does not overcome tolerance of the immune system to
self-antigens.
LITERATURE (HEREBY INCORPORATED BY REFERENCE)
[0317] Arnold, G. S., Sasser, A. K., Stachler, M. D. and Bartlett,
J. S. (2006) Mol Ther, 14, 97-106. [0318] Asokan, A. and Samulski,
R. J. (2006) Nat Biotechnol, 24, 158-60. [0319] Asquith, D. L. and
I. B. McInnes (2007). "Emerging cytokine targets in rheumatoid
arthritis." Curr Opin Rheumatol 19(3): 246-51. [0320] Aumailley,
M., Gerl, M., Sonnenberg, A., Deutzmann, R. and Timpl, R. (1990)
FEBS Lett, 262, 82-6. [0321] Barassi, C., E. Soprana, et al.
(2005). J Virol 79(11): 6848-58. [0322] Bousquet, J., Cabrera, P.,
Berkman, N., Buhl, R., Holgate, S., Wenzel, S., Fox, H., Hedgecock,
S., Blogg, M. and Cioppa, G. D. (2005) Allergy, 60, 302-8. [0323]
Chackerian, B., Lowy, D. R. et al. (1999). Proc Natl Acad Sci USA
96(5): 2373-8. [0324] Chackerian, B., Lowy, D. R. and Schiller, J.
T. (2001) J Clin Invest, 108, 415-23. [0325] Chatterjee, M. B.,
Foon, K. A. and Kohler, H. (1994) Cancer Immunology Immunotherapy,
38, 75-82. [0326] Cook, J. P., Henry, A. J., McDonnell, J. M.,
Owens, R. J., Sutton, B. J. and Gould, H. J. (1997) Biochemistry,
36, 15579-88. [0327] Corpet, F. (1988) Nucleic Acids Res, 16,
10881-90. [0328] Dean, D. A., Strong, D. D. and Zimmer, W. E.
(2005) Gene Ther, 12, 881-90. [0329] Gamsjaeger, R., C. K. Liew, et
al. (2007). Trends Biochem Sci 32(2): 63-70. [0330] Garman, S. C.,
Wurzburg, B. A., Tarchevskaya, S. S., Kinet, J. P. and Jardetzky,
T. S. (2000) Nature, 406, 259-66. [0331] Girod, A., Ried, M.,
Wobus, C., Lahm, H., Leike, K., Kleinschmidt, J., Deleage, G. and
Hallek, M. (1999) Nat Med, 5, 1438. [0332] Grifman, M., Trepel, M.,
Speece, P., Gilbert, L. B., Arap, W., Pasqualini, R. and Weitzman,
M. D. (2001) Mol Ther, 3, 964-75. [0333] Helm, B., Kebo, D.,
Vercelli, D., Glovsky, M. M., Gould, H., Ishizaka, K., Geha, R. and
Ishizaka, T. (1989) Proc Natl Acad Sci USA, 86, 9465-9. [0334]
Helm, B., Marsh, P., Vercelli, D., Padlan, E., Gould, H. and Geha,
R. (1988) Nature, 331, 180-3. [0335] Huttner, N. A., Girod, A.,
Perabo, L., Edbauer, D., Kleinschmidt, J. A., Buning, H. and
Hallek, M. (2003) Gene Ther, 10, 2139-47. [0336] Jefferis, R.
(1993) Immunol Today, 14, 119-21. [0337] Jerne, N. K. (1974) Ann
Immunol (Paris), 125C, 373-89. [0338] Jerne, N. K., Roland, J. and
Cazenave, P. A. (1982) Embo J, 1, 243-7. [0339] Kay, M. A.,
Glorioso, J. C. and Naldini, L. (2001) Nat Med, 7, 33-40. [0340]
Kern, A., Schmidt, K., Leder, C., Muller, O. J., Wobus, C. E.,
Bettinger, K., Von der Lieth, C. W., King, J. A. and Kleinschmidt,
J. A. (2003) J Virol, 77, 11072-81. [0341] Klenerman, P.,
Tolfvenstam, T., Price, D. A., Nixon, D. F., Broliden, K. and
Oxenius, A. (2002) Pathol Biol (Paris), 50, 317-25. [0342] Kricek,
F., Ruf, C., Rudolf, M. P., Effenberger, F., Mayer, P. and Stadler,
B. M. (1999) Int Arch Allergy Immunol, 118, 222-3. [0343] Laity, J.
H., B. M. Lee, et al. (2001). Curr Opin Struct Biol 11(1): 39-46.
[0344] Laughlin, C. A., Tratschin, J. D., Coon, H. and Carter, B.
J. (1983) Gene, 23, 65-73. [0345] Levy, D. A. and Chen, J. (1970) N
Engl J Med, 283, 541-2. [0346] Li, Q., Cao, C., Chackerian, B.,
Schiller, J., Gordon, M., Ugen, K. E. and Morgan, D. (2004) BMC
Neurosci, 5, 21. [0347] Lieber, A. (2003) Nat Biotechnol, 21,
1011-3. [0348] Lux, K., Goerlitz, N., Schlemminger, S., Perabo, L.,
Goldnau, D., Endell, J., Leike, K., Kofler, D. M., Finke, S.,
Hallek, M. and Buning, H. (2005) J Virol, 79, 11776-87. [0349]
Maheshri, N., Koerber, J. T., Kaspar, B. K. and Schaffer, D. V.
(2006) Nat Biotechnol, 24, 198-204. [0350] Misumi, S., D. Nakayama,
et al. (2006). J Immunol 176(1): 463-71. [0351] Moskalenko, M.,
Chen, L., van Roey, M., Donahue, B. A., Snyder, R. O., McArthur, J.
G. and Patel, S. D. (2000) J Virol, 74, 1761-6. [0352] Muller, O.
J., Kaul, F., Weitzman, M. D., Pasqualini, R., Arap, W.,
Kleinschmidt, J. A. and Trepel, M. (2003) Nat Biotechnol, 21,
1040-6. [0353] Nicklin, S. A., Buening, H., Dishart, K. L., de
Alwis, M., Girod, A., Hacker, U., Thrasher, A. J., Ali, R. R.,
Hallek, M. and Baker, A. H. (2001) Mol Ther, 4, 174-81. [0354]
Nygren, P. A. and Skerra, A. (2004) J Immunol Methods, 290, 3-28.
[0355] Opie, S. R., Warrington, K. H., Jr., Agbandje-McKenna, M.,
Zolotukhin, S, and Muzyczka, N. (2003) J Virol, 77, 6995-7006.
[0356] Parker, K. C., M. A. Bednarek, et al. (1994). J Immunol
152(1): 163-75. [0357] Perabo, L. (2003) In Institut fur
BiochemieLMU, Munchen, pp. 1-121. [0358] Perabo, L., Buning, H.,
Kofler, D. M., Ried, M. U., Girod, A., Wendtner, C. M., Enssle, J.
and Hallek, M. (2003) Mol Ther, 8, 151-7. [0359] Perabo, L.,
Endell, J., King, S., Lux, K., Goldnau, D., Hallek, M. and Buning,
H. (2006a) J Gene Med, 8, 155-62. [0360] Perabo, L., Goldnau, D.,
White, K., Endell, J., Boucas, J., Humme, S., Work, L. M., Janicki,
H., Hallek, M., Baker, A. H. and Buning, H. (2006b) J Virol, 80,
7265-9. [0361] Pfeifer, A. and Verma, I. M. (2001) Annu Rev
Genomics Hum Genet, 2, 177-211. [0362] Presta, L., Shields, R.,
O'Connell, L., Lahr, S., Porter, J., Gorman, C. and Jardieu, P.
(1994) J Biol Chem, 269, 26368-73. [0363] Ried, M. U., Girod, A.,
Leike, K., Buning, H. and Hallek, M. (2002) J Virol, 76, 4559-66.
[0364] Riemer, A. B., Untersmayr, E., Knittelfelder, R., Duschl,
A., Pehamberger, H., Zielinski, C. C., Scheiner, O. and
Jensen-Jarolim, E. (2007) Cancer Res, 67, 3406-11. [0365]
Rittershaus, C. W., Miller, D. P., Thomas, L. J., Picard, M. D.,
Honan, C. M., Emmett, C. D., Pettey, C. L., Adari, H., Hammond, R.
A., Beattie, D. T., Callow, A. D., Marsh, H. C. and Ryan, U.S.
(2000) Arterioscler Thromb Vasc Biol, 20, 2106-12. [0366] Rudolf,
M. P., Vogel, M., Kricek, F., Ruf, C., Zurcher, A. W., Reuschel,
R., Auer, M., Miescher, S, and Stadler, B. M. (1998) J Immunol,
160, 3315-21. [0367] Rudolf, M. P., Zuercher, A. W., Nechansky, A.,
Ruf, C., Vogel, M., Miescher, S. M., Stadler, B. M. and Kricek, F.
(2000) J Immunol, 165, 813-9. [0368] Ruffing, M., Heid, H. and
Kleinschmidt, J. A. (1994) J Gen Virol, 75 (Pt 12), 3385-92. [0369]
Shi, W., Arnold, G. S, and Bartlett, J. S. (2001) Hum Gene Ther,
12, 1697-711. [0370] Shi, W. and Bartlett, J. S. (2003) Mol Ther,
7, 515-25. [0371] Shi, X., Fang, G., Shi, W. and Bartlett, J. S.
(2006) Hum Gene Ther, 17, 353-61. [0372] Smolen, J. S, and Steiner,
G. (2003) Nat Rev Drug Discov, 2, 473-88. [0373] Stachler, M. D.
and Bartlett, J. S. (2006) Gene Ther, 13, 926-31. [0374] Stadler,
B. M., Zurcher, A. W., Miescher, S., Kricek, F. and Vogel, M.
(1999) Int Arch Allergy Immunol, 118, 119-21. [0375] Summerford,
C., Bartlett, J. S, and Samulski, R. J. (1999) Nat Med, 5, 78-82.
[0376] Theiss, H. D., Kofler, D. M., Buning, H., Aldenhoff, A. L.,
Kaess, B., Decker, T., Baumert, J., Hallek, M. and Wendtner, C. M.
(2003) Exp Hematol, 31, 1223-9. [0377] Uversky V. N., Fernandez A.
and Fink A. L. (2006) chapter 1, 1-20 in: Protein Reviews Volume 4,
editor: M. Zouhair Atassi: Protein Misfolding, Aggregation, and
Conformational Disease, Part A: Protein Aggregation and
Conformational Disease; Springer. [0378] Varela, F. J. and
Coutinho, A. (1991) Immunol Today, 12, 159-66. [0379] Vogel, M.,
Miescher, S., Kuhn, S., Zurcher, A. W., Stadler, M. B., Ruf, C.,
Effenberger, F., Kricek, F. and Stadler, B. M. (2000) J Mol Biol,
298, 729-35. [0380] Vogel, M., Tschopp, C., Bobrzynski, T., Fux,
M., Stadler, M. B., Miescher, S. M. and Stadler, B. M. (2004) J Mol
Biol, 341, 477-89. [0381] Warrington, K. H., Jr., Gorbatyuk, O, S.,
Harrison, J. K., Opie, S. R., Zolotukhin, S, and Muzyczka, N.
(2004) J Virol, 78, 6595-609. [0382] Waterkamp, D. A., Muller, O.
J., Ying, Y., Trepel, M. and Kleinschmidt, J. A. (2006) J Gene Med,
8, 1307-19. [0383] White, S. J., Nicklin, S. A., Buning, H.,
Brosnan, M. J., Leike, K., Papadakis, E. D., Hallek, M. and Baker,
A. H. (2004) Circulation, 109, 513-9. [0384] Work, L. M., Buning,
H., Hunt, E., Nicklin, S. A., Denby, L., Britton, N., Leike, K.,
Odenthal, M., Drebber, U., Hallek, M. and Baker, A. H. (2006) Mol
Ther, 13, 683-93. [0385] Work, L. M., Nicklin, S. A., Brain, N. J.,
Dishart, K. L., Von Seggern, D. J., Hallek, M., Buning, H. and
Baker, A. H. (2004) Mol Ther, 9, 198-208. [0386] Wu, P., Xiao, W.,
Conlon, T., Hughes, J., Agbandje-McKenna, M., Ferkol, T., Flotte,
T. and Muzyczka, N. (2000) J Virol, 74, 8635-47. [0387] Wu, Z.,
Asokan, A., Grieger, J. C., Govindasamy, L., Agbandje-McKenna, M.
and Samulski, R. J. (2006) J Virol, 80, 11393-7. [0388] Xiao, X.,
Li, J. and Samulski, R. J. (1998) J Virol, 72, 2224-32.
Sequence CWU 1
1
164110PRTArtificial SequenceSynthetic Construct 1Asn Thr Pro Ser
Gly Thr Thr Thr Gln Ser1 5 10210PRTArtificial SequenceSynthetic
Construct 2Asn Asn Thr Gly Gly Val Gln Phe Asn Lys1 5
10310PRTArtificial SequenceSynthetic Construct 3Gln Asn Gln Ser Gly
Ser Ala Gln Asn Lys1 5 10410PRTArtificial SequenceSynthetic
Construct 4Gln Asn Gln Ser Gly Ser Ala Gln Asn Lys1 5
10510PRTArtificial SequenceSynthetic Construct 5Gln Thr Thr Gly Gly
Thr Ala Asn Thr Gln1 5 10610PRTArtificial SequenceSynthetic
Construct 6Gln Ser Thr Gly Gly Thr Gln Gly Thr Gln1 5
10710PRTArtificial SequenceSynthetic Construct 7Gly Thr Thr Ser Gly
Thr Thr Asn Gln Ser1 5 10810PRTArtificial SequenceSynthetic
Construct 8Ser Asn Pro Gly Gly Thr Ala Gly Asn Arg1 5
10910PRTArtificial SequenceSynthetic Construct 9Ser Thr Thr Thr Gly
Thr Thr Leu Asn Ala1 5 101010PRTArtificial SequenceSynthetic
Construct 10Ser Thr Thr Ser Gly Glu Thr Leu Asn Gln1 5
101110PRTArtificial SequenceSynthetic Construct 11Ser Thr Thr Ser
Gly Gly Thr Leu Asn Gln1 5 101210PRTArtificial SequenceSynthetic
Construct 12Phe Gly Asp Ile Gly Val Gln Gln Asp Lys1 5
101310PRTArtificial SequenceSynthetic Construct 13Phe Gly Asp Ile
Gly Val Gln Gln Asp Lys1 5 101410PRTArtificial SequenceSynthetic
Construct 14Pro Asp Thr Leu Gly Gly Asp Pro Lys Phe1 5
101510PRTArtificial SequenceSynthetic Construct 15Val Ser Ala Thr
Tyr Thr Glu Gly Glu Ala1 5 101610PRTArtificial SequenceSynthetic
Construct 16Ala Gly Thr Leu Thr Ala Gln Gly Ser Arg1 5
10176PRTArtificial SequenceSynthetic Construct 17Met Ala Ala Asp
Gly Tyr1 51810PRTArtificial SequenceSynthetic Construct 18Pro Pro
Pro Lys Pro Ala Glu Arg His Lys1 5 101910PRTArtificial
SequenceSynthetic Construct 19Glu Pro Val Lys Thr Ala Pro Gly Lys
Lys1 5 102010PRTArtificial SequenceSynthetic Construct 20Pro Val
Lys Thr Ala Pro Gly Lys Lys Arg1 5 102110PRTArtificial
SequenceSynthetic Construct 21Ser Gly Thr Gly Lys Ala Gly Gln Gln
Pro1 5 102210PRTArtificial SequenceSynthetic Construct 22Tyr Lys
Gln Ile Ser Ser Gln Ser Gly Ala1 5 102310PRTArtificial
SequenceSynthetic Construct 23Ser Gln Ser Gly Ala Ser Asn Asp Asn
His1 5 102410PRTArtificial SequenceSynthetic Construct 24Tyr Leu
Thr Leu Asn Asn Gly Ser Gln Ala1 5 102510PRTArtificial
SequenceSynthetic Construct 25Tyr Tyr Leu Ser Arg Thr Asn Thr Pro
Ser1 5 102610PRTArtificial SequenceSynthetic Construct 26Tyr Leu
Ser Arg Thr Asn Thr Pro Ser Gly1 5 102710PRTArtificial
SequenceSynthetic Construct 27Thr Thr Gln Ser Arg Leu Gln Phe Ser
Gln1 5 102810PRTArtificial SequenceSynthetic Construct 28Ala Ser
Asp Ile Arg Asp Gln Ser Arg Asn1 5 102910PRTArtificial
SequenceSynthetic Construct 29Leu Val Asn Pro Gly Pro Ala Met Ala
Ser1 5 103010PRTArtificial SequenceSynthetic Construct 30Glu Glu
Lys Phe Phe Pro Gln Ser Gly Val1 5 103110PRTArtificial
SequenceSynthetic Construct 31Asn Pro Val Ala Thr Glu Gln Tyr Gly
Ser1 5 103210PRTArtificial SequenceSynthetic Construct 32Ser Thr
Asn Leu Gln Arg Gly Asn Arg Gln1 5 103310PRTArtificial
SequenceSynthetic Construct 33Leu Gln Arg Gly Asn Arg Gln Ala Ala
Thr1 5 103410PRTArtificial SequenceSynthetic Construct 34Gln Arg
Gly Asn Arg Gln Ala Ala Thr Ala1 5 103510PRTArtificial
SequenceSynthetic Construct 35Asn Arg Gln Ala Ala Thr Ala Asp Val
Asn1 5 103610PRTArtificial SequenceSynthetic Construct 36Val Pro
Ala Asn Pro Ser Thr Thr Phe Ser1 5 103710PRTArtificial
SequenceSynthetic Construct 37Thr Phe Ser Ala Ala Lys Phe Ala Ser
Phe1 5 103810PRTArtificial SequenceSynthetic Construct 38Asn Val
Asp Phe Thr Val Asp Thr Asn Gly1 5 103910PRTArtificial
SequenceSynthetic Construct 39Phe Thr Val Asp Thr Asn Gly Val Tyr
Ser1 5 104010PRTArtificial SequenceSynthetic Construct 40Ser Ser
Ser Thr Asp Pro Ala Thr Gly Asp1 5 104110PRTArtificial
SequenceSynthetic Construct 41Asn Asn Leu Gln Ser Ser Asn Thr Ala
Pro1 5 104210PRTArtificial SequenceSynthetic Construct 42Gly Gly
Asp Gln Ser Asn Ser Asn Leu Pro1 5 104310PRTArtificial
SequenceSynthetic Construct 43Thr Asn Asn Gln Ser Ser Thr Thr Ala
Pro1 5 104427DNAArtificial SequenceSynthetic Construct 44gagtcgaccc
gggcagccgc ttcgagc 274527DNAArtificial SequenceSynthetic Construct
45gctcgaagcg gctgcccggg tcgactc 274643DNAArtificial
SequenceSynthetic Construct 46caaacactcc aagtggaggg cgcgccgcta
ccaccacgca gtc 434743DNAArtificial SequenceSynthetic Construct
47gactgcgtgg tggtagcggc gcgccctcca cttggagtgt ttg
434840DNAArtificial SequenceSynthetic Construct 48caaacactcc
aagtggagcg gccgcagggc gcgccgctac 404940DNAArtificial
SequenceSynthetic Construct 49gtagcggcgc gccctgcggc cgctccactt
ggagtgtttg 405010PRTArtificial SequenceSynthetic Construct 50Val
Asn Leu Thr Trp Ser Arg Ala Ser Gly1 5 105137DNAArtificial
SequenceSynthetic Construct 51ggccgcagtg aacctgacct ggagcagagc
ctccggc 375237DNAArtificial SequenceSynthetic Construct
52cgcggccgga ggctctgctc caggtcaggt tcactgc 375349DNAArtificial
SequenceSynthetic Construct 53ggccgcagcc gcagtgaacc tgacctggag
cagagcctcc ggcgcggca 495449DNAArtificial SequenceSynthetic
Construct 54cgcgtgccgc gccggaggct ctgctccagg tcaggttcac tgcggctgc
495514PRTArtificial SequenceSynthetic Construct 55Glu Phe Cys Ile
Asn His Arg Gly Tyr Trp Val Cys Gly Asp1 5 105649DNAArtificial
SequenceSynthetic Construct 56ggccgcagaa ttctgcataa accacagggg
atactgggtg tgcggagac 495749DNAArtificial SequenceSynthetic
Construct 57cgcggtctcc gcacacccag tatcccctgt ggtttatgca gaattctgc
495861DNAArtificial SequenceSynthetic Construct 58ggccgcagcc
gcagaattct gcataaacca caggggatac tgggtgtgcg gagacgcggc 60a
615961DNAArtificial SequenceSynthetic Construct 59cgcgtgccgc
gtctccgcac acccagtatc ccctgtggtt tatgcagaat tctgcggctg 60c
616012PRTArtificial SequenceSynthetic Construct 60Cys Asp Ala Gly
Ser Val Arg Thr Asn Ala Pro Asp1 5 106143DNAArtificial
SequenceSynthetic Construct 61ggccgcatgc gacgctggca gtgtgcgcac
caatgcacca gac 436243DNAArtificial SequenceSynthetic Construct
62cgcggtctgg tgcattggtg cgcacactgc cagcgtcgca tgc
436355DNAArtificial SequenceSynthetic Construct 63ggccgcagcc
gcatgcgacg ctggcagtgt gcgcaccaat gcaccagacg cggca
556455DNAArtificial SequenceSynthetic Construct 64cgcgtgccgc
gtctggtgca ttggtgcgca cactgccagc gtcgcatgcg gctgc
55659PRTArtificial SequenceSynthetic Construct 65Asp Ala Glu Phe
Arg His Asp Ser Gly1 56661DNAArtificial SequenceSynthetic Construct
66ggccggcgga ggcggtgggg acgccgaatt cagacacgac agcggcggag gcggtggagg
60g 616761DNAArtificial SequenceSynthetic Construct 67cgcgccctcc
accgcctccg ccgctgtcgt gtctgaattc ggcgtcccca ccgcctccgc 60c
616833DNAArtificial SequenceSynthetic Construct 68gtagccctgg
aaactagaac cggtgcctgc gcc 336933DNAArtificial SequenceSynthetic
Construct 69ggcgcaggca ccggttctag tttccagggc tac
337053DNAArtificial SequenceSynthetic Construct 70ccaacctcca
gagaggcaac gcggccgcaa ggcgcgccaa gcagctaccg cag 537153DNAArtificial
SequenceSynthetic Construct 71ctgcggtagc tgcttggcgc gccttgcggc
cgcgttgcct ctctggaggt tgg 537247DNAArtificial SequenceSynthetic
Construct 72ggccgcatgc gacgctggca gtgtgcgcac caatgcacca gacgcgg
477347DNAArtificial SequenceSynthetic Construct 73cgcgccgcgt
ctggtgcatt ggtgcgcaca ctgccagcgt cgcatgc 477462DNAArtificial
SequenceSynthetic Construct 74ggccgcagcg gcgtgcgacg ctggcagtgt
gcgcaccaat gcaccagacg cggcggcggc 60gg 627562DNAArtificial
SequenceSynthetic Construct 75cgcgccgccg ccgccgcgtc tggtgcattg
gtgcgcacac tgccagcgtc gcacgccgct 60gc 627668DNAArtificial
SequenceSynthetic Construct 76ggccgcaggc ggagggggag gcgacgccga
gttcagacac gacagcggcg gcggaggggg 60aggcgcgg 687768DNAArtificial
SequenceSynthetic Construct 77cgcgccgcgc ctccccctcc gccgccgctg
tcgtgtctga actcggcgtc gcctccccct 60ccgcctgc 687830DNAArtificial
SequenceSynthetic Construct 78tctagagggc actcttccgt ggtctggtgg
307933DNAArtificial SequenceSynthetic Construct 79tctagagcaa
aaaaggggct cgtccctgtt tcc 338028DNAArtificial SequenceSynthetic
Construct 80ggtgaatccg gggccggcca tggcaagc 288128DNAArtificial
SequenceSynthetic Construct 81gcttgccatg gccggccccg gattcacc
288224PRTArtificial SequenceSynthetic Construct 82Ala Ala Ala Gly
Gly Gly Gly Gly Asp Ala Glu Phe Arg His Asp Ser1 5 10 15Gly Gly Gly
Gly Gly Gly Ala Ala 208324PRTArtificial SequenceSynthetic Construct
83Ala Ala Gly Gly Gly Gly Gly Asp Ala Glu Phe Arg His Asp Ser Gly1
5 10 15Gly Gly Gly Gly Gly Arg Ala Ala 208411PRTArtificial
SequenceSynthetic Construct 84Ala Cys Asp Cys Arg Gly Asp Cys Phe
Cys Ala1 5 108511PRTArtificial SequenceSynthetic Construct 85Glu
Asp Gly Gln Val Met Asp Val Asp Leu Ser1 5 10869PRTArtificial
SequenceSynthetic Construct 86Glu Lys Gln Arg Asn Gly Thr Leu Thr1
58717PRTArtificial SequenceSynthetic Construct 87Thr Tyr Gln Cys
Arg Val Thr His Pro His Leu Pro Arg Ala Leu Met1 5 10
15Arg8814PRTArtificial SequenceSynthetic Construct 88Arg His Ser
Thr Thr Gln Pro Arg Lys Thr Lys Gly Ser Gly1 5 108913PRTArtificial
SequenceSynthetic Construct 89Asp Ser Asn Pro Arg Gly Val Ser Ala
Tyr Leu Ser Arg1 5 109013PRTArtificial SequenceSynthetic Construct
90Thr Ile Thr Cys Leu Val Val Asp Leu Ala Pro Ser Lys1 5
109110PRTArtificial SequenceSynthetic Construct 91Lys Thr Lys Gly
Ser Gly Phe Phe Val Phe1 5 109212PRTArtificial SequenceSynthetic
Construct 92Thr His Pro His Leu Pro Arg Ala Leu Met Arg Ser1 5
109323PRTArtificial SequenceSynthetic Construct 93Gly Glu Thr Tyr
Gln Cys Arg Val Thr His Pro His Leu Pro Arg Ala1 5 10 15Leu Met Arg
Ser Thr Thr Lys 20948PRTArtificial SequenceSynthetic Construct
94Leu Pro Arg Ala Leu Met Arg Ser1 5958PRTArtificial
SequenceSynthetic Construct 95Ile Asn His Arg Gly Tyr Trp Val1
59617PRTArtificial SequenceSynthetic Construct 96Ala Lys Ala Val
Ser Asn Leu Thr Glu Ser Arg Ser Glu Ser Leu Gln1 5 10
15Ser9713PRTArtificial SequenceSynthetic Construct 97Ser Leu Thr
Gly Asp Glu Phe Lys Lys Val Leu Glu Thr1 5 109811PRTArtificial
SequenceSynthetic Construct 98Arg Glu Ala Val Ala Tyr Arg Phe Glu
Glu Asp1 5 109910PRTArtificial SequenceSynthetic Construct 99Ile
Asn Pro Glu Ile Ile Thr Leu Asp Gly1 5 1010015PRTArtificial
SequenceSynthetic Construct 100Asp Ile Ser Val Thr Gly Ala Pro Val
Ile Thr Ala Thr Tyr Leu1 5 10 1510112PRTArtificial
SequenceSynthetic Construct 101Asp Ile Ser Val Thr Gly Ala Pro Val
Ile Thr Ala1 5 1010217PRTArtificial SequenceSynthetic Construct
102Pro Lys Thr Val Ser Asn Leu Thr Glu Ser Ser Ser Glu Ser Val Gln1
5 10 15Ser10313PRTArtificial SequenceSynthetic Construct 103Ser Leu
Met Gly Asp Glu Phe Lys Ala Val Leu Glu Thr1 5 1010411PRTArtificial
SequenceSynthetic Construct 104Gln His Ser Val Ala Tyr Thr Phe Glu
Glu Asp1 5 1010510PRTArtificial SequenceSynthetic Construct 105Ile
Asn Pro Glu Ile Ile Thr Arg Asp Gly1 5 1010615PRTArtificial
SequenceSynthetic Construct 106Asp Ile Ser Leu Thr Gly Asp Pro Val
Ile Thr Ala Ser Tyr Leu1 5 10 1510712PRTArtificial
SequenceSynthetic Construct 107Asp Ile Ser Leu Thr Gly Asp Pro Val
Ile Thr Ala1 5 1010811PRTArtificial SequenceSynthetic Construct
108Asp Gln Ser Ile Asp Phe Glu Ile Asp Ser Ala1 5
1010920PRTArtificial SequenceSynthetic Construct 109Lys Asn Val Ser
Glu Asp Leu Pro Leu Pro Thr Phe Ser Pro Thr Leu1 5 10 15Leu Gly Asp
Ser 2011011PRTArtificial SequenceSynthetic Construct 110Lys Asn Val
Ser Glu Asp Leu Pro Leu Pro Thr1 5 1011112PRTArtificial
SequenceSynthetic Construct 111Cys Asp Ser Gly Arg Val Arg Thr Asp
Ala Pro Asp1 5 1011214PRTArtificial SequenceSynthetic Construct
112Phe Pro Glu His Leu Leu Val Asp Phe Leu Gln Ser Leu Ser1 5
1011316PRTArtificial SequenceSynthetic Construct 113His Tyr Ala Ala
Ala Gln Trp Asp Phe Gly Asn Thr Met Cys Gln Leu1 5 10
1511413PRTArtificial SequenceSynthetic Construct 114Tyr Ala Ala Gln
Trp Asp Phe Gly Asn Thr Met Cys Gln1 5 1011510PRTArtificial
SequenceSynthetic Construct 115Arg Ser Gln Lys Glu Gly Leu His Tyr
Thr1 5 1011620PRTArtificial SequenceSynthetic Construct 116Ser Ser
Arg Thr Pro Ser Asp Lys Pro Val Ala His Val Val Ala Asn1 5 10 15Pro
Gln Ala Glu 2011716PRTArtificial SequenceSynthetic Construct 117Ser
Arg Thr Pro Ser Asp Lys Pro Val Ala His Val Val Ala Asn Pro1 5 10
151189PRTArtificial SequenceSynthetic Construct 118Ser Ser Arg Thr
Pro Ser Asp Lys Pro1 511914PRTArtificial SequenceSynthetic
Construct 119Asn Ala Asp Gly Asn Val Asp Tyr His Met Asn Ser Val
Pro1 5 1012011PRTArtificial SequenceSynthetic Construct 120Asp Gly
Asn Val Asp Tyr His Met Asn Ser Val1 5 1012116PRTArtificial
SequenceSynthetic Construct 121Arg Ser Phe Lys Glu Phe Leu Gln Ser
Ser Leu Arg Ala Leu Arg Gln1 5 10 1512211PRTArtificial
SequenceSynthetic Construct 122Phe Lys Glu Phe Leu Gln Ser Ser Leu
Arg Ala1 5 1012310PRTArtificial SequenceSynthetic Construct 123Gln
Met Trp Ala Pro Gln Trp Gly Pro Asp1 5 1012410PRTArtificial
SequenceSynthetic Construct 124Arg Thr Thr Asn Pro Val Ala Thr Glu
Gln1 5 1012510PRTArtificial SequenceSynthetic Construct 125Phe Gln
Ser Ser Ser Thr Asp Pro Ala Thr1 5 1012611PRTArtificial
SequenceSynthetic Construct 126Lys Leu Lys Leu Leu Leu Leu Leu Lys
Leu Lys1 5 1012711PRTArtificial SequenceSynthetic Construct 127Asp
Gln Ser Val Asp Phe Glu Ile Asp Ser Ala1 5 1012876DNAArtificial
SequenceSynthetic Construct 128ggccggcggt ggagccaagg ccgtgagcaa
cctgaccgag agcagaagcg agagcctgca 60gagcggtggc ggtgga
7612976DNAArtificial SequenceSynthetic Construct 129cgcgtccacc
gccaccgctc tgcaggctct cgcttctgct ctcggtcagg ttgctcacgg 60ccttggctcc
accgcc 7613064DNAArtificial SequenceSynthetic Construct
130ggccggcggt ggaagcctga ccggcgacga attcaagaag gtgctggaga
ccggtggcgg 60tgga 6413164DNAArtificial SequenceSynthetic
Construct
131cgcgtccacc gccaccggtc tccagcacct tcttgaattc gtcgccggtc
aggcttccac 60cgcc 6413258DNAArtificial SequenceSynthetic Construct
132ggccggcggt ggaagagagg ccgtggccta cagattcgaa gaggacggtg gcggtgga
5813358DNAArtificial SequenceSynthetic Construct 133cgcgtccacc
gccaccgtcc tcttcgaatc tgtaggccac ggcctctctt ccaccgcc
5813455DNAArtificial SequenceSynthetic Construct 134ggccggcggt
ggaatcaacc ccgagatcat caccctggac ggcggtggcg gtgga
5513555DNAArtificial SequenceSynthetic Construct 135cgcgtccacc
gccaccgccg tccagggtga tgatctcggg gttgattcca ccgcc
5513670DNAArtificial SequenceSynthetic Construct 136ggccggcggt
ggagacatca gcgtgaccgg tgcacccgtg atcaccgcca cctacctggg 60tggcggtgga
7013770DNAArtificial SequenceSynthetic Construct 137cgcgtccacc
gccacccagg taggtggcgg tgatcacggg tgcaccggtc acgctgatgt 60ctccaccgcc
7013861DNAArtificial SequenceSynthetic Construct 138ggccggcggt
ggagacatca gcgtgaccgg tgcacccgtg atcaccgccg gtggcggtgg 60a
6113961DNAArtificial SequenceSynthetic Construct 139cgcgtccacc
gccaccggcg gtgatcacgg gtgcaccggt cacgctgatg tctccaccgc 60c
6114058DNAArtificial SequenceSynthetic Construct 140ggccggcggt
ggagaccaga gcgtggactt cgagatcgac agcgccggtg gcggtgga
5814158DNAArtificial SequenceSynthetic Construct 141cgcgtccacc
gccaccggcg ctgtcgatct cgaagtccac gctctggtct ccaccgcc
5814220PRTArtificial SequenceSynthetic Construct 142Ser Ser Gln Asn
Ser Ser Asp Lys Pro Val Ala His Val Val Ala Asn1 5 10 15His Gln Val
Glu 2014314PRTArtificial SequenceSynthetic Construct 143Asn Ala Glu
Gly Lys Leu Asp His His Met Asn Ser Val Leu1 5 1014411PRTArtificial
SequenceSynthetic Construct 144Leu Glu Glu Phe Leu Lys Val Thr Leu
Arg Ser1 5 1014588DNAArtificial SequenceSynthetic Construct
145ggccgccggt ggaggcagca gccagaacag cagcgacaag cccgtggccc
acgtggtggc 60taaccaccag gtggagggcg gtggaggg 8814670DNAArtificial
SequenceSynthetic Construct 146ggccgccggt ggaggcaacg ccgagggcaa
gcttgaccac cacatgaaca gcgtgctggg 60cggtggaggg 7014761DNAArtificial
SequenceSynthetic Construct 147ggccgccggt ggaggcctgg aggaattcct
gaaggtgacc ctgagaagcg gcggtggagg 60g 6114888DNAArtificial
SequenceSynthetic Construct 148cgcgccctcc accgccctcc acctggtggt
tagccaccac gtgggccacg ggcttgtcgc 60tgctgttctg gctgctgcct ccaccggc
8814970DNAArtificial SequenceSynthetic Construct 149cgcgccctcc
accgcccagc acgctgttca tgtggtggtc aagcttgccc tcggcgttgc 60ctccaccggc
7015061DNAArtificial SequenceSynthetic Construct 150cgcgccctcc
accgccgctt ctcagggtca ccttcaggaa ttcctccagg cctccaccgg 60c
6115116PRTArtificial SequenceSynthetic Construct 151Ser Gln Asn Ser
Ser Asp Lys Pro Val Ala His Val Val Ala Asn His1 5 10
151529PRTArtificial SequenceSynthetic Construct 152Ser Ser Gln Asn
Ser Ser Asp Lys Pro1 515311PRTArtificial SequenceSynthetic
Construct 153Glu Gly Lys Leu Asp His His Met Asn Ser Val1 5
1015416PRTArtificial SequenceSynthetic Construct 154Lys Ser Leu Glu
Glu Phe Leu Lys Val Thr Leu Arg Ser Thr Arg Gln1 5 10
1515514PRTArtificial SequenceSynthetic Construct 155Cys Ser Leu Thr
Gly Asp Glu Phe Lys Lys Val Leu Glu Thr1 5 1015612PRTArtificial
SequenceSynthetic Construct 156Cys Arg Glu Ala Val Ala Tyr Arg Phe
Glu Glu Asp1 5 1015711PRTArtificial SequenceSynthetic Construct
157Cys Ile Asn Pro Glu Ile Ile Thr Leu Asp Gly1 5
1015816PRTArtificial SequenceSynthetic Construct 158Cys Asp Ile Ser
Val Thr Gly Ala Pro Val Ile Thr Ala Thr Tyr Leu1 5 10
1515932DNAArtificial SequenceSynthetic Construct 159ggggaattca
tgtcccaaag gcgcctccta cg 3216034DNAArtificial SequenceSynthetic
Construct 160gggggatccc tagctcaggc tctggaggaa atcc
3416111PRTArtificial SequenceSynthetic Construct 161Val Asn Leu Thr
Trp Ser Arg Ala Ser Gly Cys1 5 1016214PRTArtificial
SequenceSynthetic Construct 162Cys Asp Ser Asn Pro Arg Gly Val Ser
Ala Tyr Leu Ser Arg1 5 1016312PRTArtificial SequenceSynthetic
Construct 163Cys Glu Asp Gly Gln Val Met Asp Val Asp Leu Ser1 5
1016410PRTArtificial SequenceSynthetic Construct 164Cys Glu Lys Gln
Arg Asn Gly Thr Leu Thr1 5 10
* * * * *
References