U.S. patent application number 12/634556 was filed with the patent office on 2010-07-29 for biologically active proteins having increased in vivo and/or in vitro stability.
Invention is credited to Andreas Crameri, Nathaniel C. Gordon, Mikhail Popkov, Volker Schellenberger, Michael D. Scholle, Willem P. Stemmer, Chia-wei Wang.
Application Number | 20100189682 12/634556 |
Document ID | / |
Family ID | 46328572 |
Filed Date | 2010-07-29 |
United States Patent
Application |
20100189682 |
Kind Code |
A1 |
Schellenberger; Volker ; et
al. |
July 29, 2010 |
Biologically active proteins having increased In Vivo and/or In
Vitro stability
Abstract
The present invention provides unstructured recombinant polymers
(URPs) and proteins containing one or more of the URPs. The present
invention also provides microproteins, toxins and other related
proteinaceous entities, as well as genetic packages displaying
these entities. The present invention also provides recombinant
polypeptides including vectors encoding the subject proteinaceous
entities, as well as host cells comprising the vectors. The subject
compositions have a variety of utilities including a range of
pharmaceutical applications.
Inventors: |
Schellenberger; Volker;
(Palo Alto, CA) ; Stemmer; Willem P.; (Los Gatos,
CA) ; Wang; Chia-wei; (Santa Clara, CA) ;
Scholle; Michael D.; (Mountain View, CA) ; Popkov;
Mikhail; (San Diego, CA) ; Gordon; Nathaniel C.;
(Campbell, CA) ; Crameri; Andreas; (Los Altos
Hills, CA) |
Correspondence
Address: |
WILSON, SONSINI, GOODRICH & ROSATI
650 PAGE MILL ROAD
PALO ALTO
CA
94304-1050
US
|
Family ID: |
46328572 |
Appl. No.: |
12/634556 |
Filed: |
December 9, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11715276 |
Mar 6, 2007 |
|
|
|
12634556 |
|
|
|
|
11528927 |
Sep 27, 2006 |
|
|
|
11715276 |
|
|
|
|
11528950 |
Sep 27, 2006 |
|
|
|
11528927 |
|
|
|
|
60743410 |
Mar 6, 2006 |
|
|
|
60721270 |
Sep 27, 2005 |
|
|
|
60721188 |
Sep 27, 2005 |
|
|
|
60743622 |
Mar 21, 2006 |
|
|
|
Current U.S.
Class: |
424/85.2 ;
424/130.1; 424/85.5; 424/85.6; 424/85.7; 435/183; 435/320.1;
435/325; 435/69.1; 514/1.1; 530/350; 530/351; 530/387.1; 530/399;
536/23.1; 536/23.2; 536/23.5; 536/23.51; 536/23.52; 536/23.53 |
Current CPC
Class: |
C07K 14/53 20130101;
A61P 3/10 20180101; A61P 35/00 20180101; C07K 14/415 20130101; A61P
31/00 20180101; C07K 7/06 20130101; A61P 9/10 20180101; A61P 37/06
20180101; C07K 2319/31 20130101; A61P 29/00 20180101; A61P 5/00
20180101; C07K 2319/35 20130101; A61P 9/00 20180101; C07K 14/001
20130101; A61K 38/00 20130101; C12N 15/1044 20130101; C07K 7/08
20130101; A61P 37/00 20180101; C07K 14/56 20130101; G01N 33/6845
20130101; A61P 7/06 20180101; A61P 13/12 20180101; C07K 14/47
20130101; C07K 14/61 20130101; C07K 14/535 20130101; A61P 7/02
20180101 |
Class at
Publication: |
424/85.2 ;
530/350; 514/12; 530/387.1; 424/130.1; 530/399; 536/23.1;
536/23.51; 536/23.5; 536/23.53; 536/23.2; 424/85.7; 424/85.6;
424/85.5; 536/23.52; 530/351; 435/183; 435/320.1; 435/325;
435/69.1 |
International
Class: |
A61K 38/20 20060101
A61K038/20; C07K 14/00 20060101 C07K014/00; A61K 38/16 20060101
A61K038/16; C07K 16/00 20060101 C07K016/00; A61K 39/395 20060101
A61K039/395; C07K 14/52 20060101 C07K014/52; C07K 14/475 20060101
C07K014/475; C07H 21/04 20060101 C07H021/04; A61P 37/00 20060101
A61P037/00; A61P 35/00 20060101 A61P035/00; A61P 3/10 20060101
A61P003/10; A61P 9/10 20060101 A61P009/10; A61P 13/12 20060101
A61P013/12; A61P 7/02 20060101 A61P007/02; A61P 29/00 20060101
A61P029/00; A61K 38/21 20060101 A61K038/21; C12N 9/00 20060101
C12N009/00; C12N 15/63 20060101 C12N015/63; C12N 5/10 20060101
C12N005/10; C12P 21/02 20060101 C12P021/02 |
Claims
1-49. (canceled)
50. A biologically active protein comprising at least two domains
wherein (a) a first domain of said at least two domains comprises
an amino acid sequence having and/or mediating said biological
activity; and (b) a second domain of said at least two domains
comprises an amino acid sequence consisting preferably of at least
about 100 amino acid residues forming random coil conformation
whereby said random coil conformation mediates an increased in vivo
and/or in vitro stability of said biologically active protein.
51. The biologically active protein according to claim 50, wherein
said second domain forming random coil conformation consists of
alanine, serine and proline residues.
52. The biologically active protein according to claim 50 or 51,
wherein said second domain forming random coil conformation
comprises a plurality of amino acid repeats, wherein said repeat
consist of Ala, Ser, and Pro residues and wherein no more than 6
consecutive amino acid residues are identical.
53. The biologically active protein according to any one of claims
50-52, wherein said proline residues constitute more than 4% and
less than 40% of the amino acids of said second domain forming
random coil conformation.
54. The biologically active protein according to any one of claims
50-53, wherein said second domain of said at least two domains
comprises an amino acid sequence consisting of about 100 to 3000
amino acid residues forming random coil conformation.
55. The biologically active protein according to any one of claims
50-54, wherein said polypeptide with biological activity is
selected from the group consisting of binding molecules, antibody
fragments, cytokines, growth factors, hormones or enzymes.
56. The biologically active protein according to claim 55 wherein
said binding molecule is selected from the group consisting of
antibodies, antibody fragments, domain antibodies and
lipocalins.
57. The biologically active protein according to any one of claims
50-56, wherein said polypeptide with biological activity is
selected from the group consisting of granulocyte colony
stimulating factor, human growth hormone, alphainterferon,
betainterferon, gammainterferon, tumor necrosis factor,
erythropoietin, coagulation factor VIII, soluble tumor necrosis
factor I and II receptor, interleukin 2 and neutrophil gelatinase
associated lipocalin.
58. The biologically active protein according to any one of claims
50-57, wherein said increased in vivo stability of said
biologically active protein is a prolonged plasma half life of said
biologically active protein comprising said random coil forming
second domain when compared to said biologically active protein
lacking said random coil forming second domain.
59. A composition comprising the biologically active protein
according to any one of claims 50-58.
60. The composition according to claim 59 which is a pharmaceutical
composition, optionally further comprising a pharmaceutical
acceptable carrier.
61. A nucleic acid molecule encoding the biologically active
protein of any one of claims 50-58.
62. A vector comprising the nucleic acid of claim 61.
63. A cell comprising the nucleic acid according to claim 61 or the
vector according to claim 62.
64. A method for preparing a biologically active protein comprising
culturing the cell according to claim 63 and isolating said
biologically active protein from the culture.
65. A method of treating a disease condition selected from the
group consisting of hormone deficiency related disorders,
autoimmune disease, cancer, anaemia, neovascular diseases,
infectious/inflammatory diseases, thrombosis, myocardial
infarction, diabetes, reperfusion injury, and a kidney disease,
comprising administering to a subject in need thereof a composition
according to claim 60.
Description
CROSS-REFERENCE
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/743,410 filed Mar. 6, 2006, which application is
incorporated herein by reference. This application is a
continuation-in-part application of Ser. Nos. 11/528,927 and
11/528,950, filed on Sep. 27, 2006, which in turn claim priority to
provisional applications Ser. Nos. 60/721,270, 60/721,188, filed on
Sep. 27, 2005 and 60/743,622 filed on Mar. 21, 2006, all of which
are herein incorporated by reference in their entirety.
BACKGROUND OF THE INVENTION
[0002] It has been well documented that properties of proteins, in
particular plasma clearance and immunogenicity, can be improved by
attaching hydrophilic polymers to these proteins (Kochendoerfer, G.
(2003) Expert Opin Biol Ther, 3: 1253-61), (Greenwald, R. B., et
al. (2003) Adv Drug Deliv Rev, 55: 217-50), (Harris, J. M., et al.
(2003) Nat Rev Drug Discov, 2: 214-21). Examples of
polymer-modified proteins that have been approved by the FDA for
treatment of patients are Adagen, Oncaspar, PEG-Intron, Pegasys,
Somavert, and Neulasta. Many more polymer-modified proteins are in
clinical trials. These polymers exert their effect by increasing
the hydrodynamic radius (also called Stokes' radius) of the
modified protein relative to the unmodified protein, which reduces
the rate of clearance by kidney filtration (Yang, K., et al. (2003)
Protein Eng, 16: 761-70). In addition, polymer attachment can
reduce interaction of the modified protein with other proteins,
cells, or surfaces. In particular, polymer attachment can reduce
interactions between the modified protein and antibodies and other
components of the immune system thus reducing the formation of a
host immune response to the modified protein. Of particular
interest is protein modification by PEGylation, i.e. by attaching
linear or branched polymers of polyethylene glycol. Reduced
immunogenicity upon PEGylation was shown for example for
phenylalanine ammonia lyase (Gamez, A., et al. (2005) Mol Ther, 11:
986-9), antibodies (Deckert, P. M., et al. (2000) Int J Cancer, 87:
382-90.), Staphylokinase (Collen, D., et al. (2000) Circulation,
102: 1766-72), and hemoglobin (Jin, C., et al. (2004) Protein Pept
Lett, 11: 353-60). Typically, such polymers are conjugated with the
protein of interest via a chemical modification step after the
unmodified protein has been purified.
[0003] Various polymers can be attached to proteins. Of particular
interest are hydrophilic polymers that have flexible conformations
and are well hydrated in aqueous solutions. A frequently used
polymer is polyethylene glycol (PEG). These polymers tend to have
large hydrodynamic radi relative to their molecular weight
(Kubetzko, S., et al. (2005) Mol Pharmacol, 68: 1439-54). The
attached polymers tend to have limited interactions with the
protein they have been attached to and thus the polymer-modified
protein retains its relevant functions.
[0004] The chemical conjugation of polymers to proteins requires
complex multi-step processes. Typically, the protein component
needs to be produced and purified prior to the chemical conjugation
step. The conjugation step can result in the formation of product
mixtures that need to be separated leading to significant product
loss. Alternatively, such mixtures can be used as the final
pharmaceutical product. Some examples are currently marketed
PEGylated Interferon-alpha products that are used as mixtures
(Wang, B. L., et al. (1998) J Submicrosc Cytol Pathol, 30: 503-9;
Dhalluin, C., et al. (2005) Bioconjug Chem, 16: 504-17). Such
mixtures are difficult to manufacture and characterize and they
contain isomers with reduced or no therapeutic activity.
[0005] Methods have been described that allow the site-specific
addition of polymers like PEG. Examples are the selective
PEGylation at a unique glycosylation site of the target protein or
the selective PEGylation of a non-natural amino acid that has been
engineered into the target proteins. In some cases it has been
possible to selectively PEGylate the N-terminus of a protein while
avoiding PEGylation of lysine side chains in the target protein by
carefully controlling the reaction conditions. Yet another approach
for the site-specific PEGylation of target proteins is the
introduction of cysteine residues that allow selective conjugation.
All these methods have significant limitations. The selective
PEGylation of the N-terminus requires careful process control and
side reactions are difficult to eliminate. The introduction of
cysteines for PEGylation can interfere with protein production
and/or purification. The specific introduction of non-natural amino
acids requires specific host organisms for protein production. A
further limitation of PEGylation is that PEG is typically
manufactured as a mixture of polymers with similar but not uniform
length. The same limitations are inherent in many other chemical
polymers.
[0006] Chemical conjugation using multifunctional polymers which
would allow the synthesis of products with multiple protein modules
is even more complex then the polymer conjugation of a single
protein domain.
[0007] Recently, it has been observed that some proteins of
pathogenic organisms contain repetitive peptide sequences that seem
to lead to a relatively long serum halflife of the proteins
containing these sequences (Alvarez, P., et al. (2004) J Biol Chem,
279: 3375-81). It has also been demonstrated that oligomeric
sequences that are based on such pathogen-derived repetitive
sequences can be fused to other proteins resulting in increased
serum halflife. However, these pathogen-derived oligomers have a
number of deficiencies. The pathogen-derived sequences tend to be
immunogenic. It has been described that the sequences can be
modified to reduce their immunogenicity. However, no attempts have
been reported to remove T cell epitopes from the sequences
contributing to the formation of immune reactions. Furthermore, the
pathogen-derived sequences have not been optimized for
pharmacological applications which require sequences with good
solubility and a very low affinity for other target proteins.
[0008] Thus there is a significant need for compositions and
methods that would allow one to combine multiple polymer modules
and multiple protein modules into defined multidomain products.
SUMMARY OF THE INVENTION
[0009] The present invention provides an unstructured recombinant
polymer (URP) comprising at least 40 contiguous amino acids,
wherein said URP is substantially incapable of non-specific binding
to a serum protein, and wherein (a) the sum of glycine (G),
aspartate (D), alanine (A), serine (S), threonine (T), glutamate
(E) and proline (P) residues contained in the URP, constitutes more
than about 80% of the total amino acids of the URP; and/or (b) at
least 50% of the amino acids are devoid of secondary structure as
determined by Chou-Fasman algorithm. In a related embodiment, the
present invention provides an unstructured recombinant polymer
(URP) comprising at least 40 contiguous amino acids, wherein said
URP has an in vitro serum degradation half-life greater than about
24 hours, and wherein (a) the sum of glycine (G), aspartate (D),
alanine (A), serine (S), threonine (T), glutamate (E) and proline
(P) residues contained in the URP, constitutes more than about 80%
of the total amino acids of the URP; and/or (b) at least 50% of the
amino acids are devoid of secondary structure as determined by
Chou-Fasman algorithm. The subject URP can comprises a non-natural
amino acid sequence. Where desired, the URP is selected for
incorporation into a heterologous protein, and wherein upon
incorporation the URP into a heterologous protein, said
heterologous protein exhibits a longer serum secretion half-life
and/or higher solubility as compared to the corresponding protein
that is deficient in said URP. The half-life can be extended by two
folds, three folds, five folds, ten folds or more. In some aspects,
incorporation of the URP into a heterologous protein results in at
least a 2-fold, 3-fold, 4-fold, 5-fold or more increase in apparent
molecular weight of the protein as approximated by size exclusion
chromatography. In some aspects, the URPs has a Tepitope score less
than -3.5 (e.g., -4 or less, -5 or less). In some aspects, the URPs
can contain predominantly hydrophilic residues. Where desired, at
least 50% of the amino acids of the URP are devoid of secondary
structure as determined by Chou-Fasman algorithm. The glycine
residues contained in the URP may constitute at least about 50% of
the total amino acids of the URP. In some aspect, any one type of
the amino acids alone selected from the group consisting of glycine
(G), aspartate (D), alanine (A), serine (S), threonine (T),
glutamate (E) and proline (P) contained in the URP constitutes more
than about 20%, 30%, 40%, 50%, 60% or more of the total amino acids
of the URP. In some aspects, the URP comprises more than about 100,
150, 200 or more contiguous amino acids.
[0010] The present invention also provides a protein comprising one
or more of the subject URPs, wherein the subject URPs are
heterologous with respect to the protein. The total length of URPs
in aggregation can exceed about 40, 50, 60, 100, 150, 200, or more
amino acids. The protein can comprise one or more functional
modules selected from the group consisting of effector module,
binding module, N-terminal module, C-terminal module, and any
combinations thereof. Where desired, the subject protein comprises
a plurality of binding modules, wherein the individual binding
modules exhibit binding specificities to the same or different
targets. The binding module may comprise a disulfide-containing
scaffold formed by intra-scaffold pairing of cysteines. The binding
module may bind to a target molecule target is selected from the
group consisting of cell surface protein, secreted protein,
cytosolic protein, and nuclear protein. The target can be an ion
channel and/or GPCR. Where desired, the effector module can be a
toxin. The subject URP-containing protein typically an extended
serum secretion half-life by at least 2, 3, 4, 5, 10 or more folds
as compared to a corresponding protein that is deficient in said
URP.
[0011] In a seperate embodiment, the present invention provides a
non-naturally occurring protein comprising at least 3 repeating
units of amino acid sequences, each of the repeating unit
comprising at least 6 amino acids, wherein the majority of segments
comprising about 6 to about 15 contiguous amino acids of the at
least 3 repeating units are present in one or more native human
proteins. In one aspect, the majority of the segments, or each
segment comprising about 9 to about 15 contiguous amino acids
within the repeating units are present in one or more native human
proteins. The segments can comprise about 9 to about 15 amino
acids. The three repeating units may share substantial sequence
homology, e.g., share sequence identify of greater than about 50%,
60%, 70%, 80%, 90% or 100% when aligned. Such non-natural protein
may also comprise one or more modules selected from the group
consisting of binding modules, effector modules, multimerization
modules, C-terminal modules, and N-terminal modules. Where desired,
the non-natural protein may comprise individual repeating unit
having the subject unstructured recombinant polymer (URP).
[0012] The present invention also provides recombinant
polynucleotides comprising coding sequences that encode the subject
URPs, URP-containing proteins, microproteins and toxins. Also
provided in the present invention are vectors containing the
subject polynucleotides, host cells harboring the vectors, genetic
packages displaying the subject URPs, URP-containing proteins,
toxins and any other proteinaceous entities disclosed herein.
Further provided are selectable library of expression vectors of
the present invention.
[0013] The present invention also provides method of producing a
protein comprising an unstructured recombinant polymer (URP). The
method involves (i) providing a host cell comprising a recombinant
polynucleotide encoding the protein, said protein comprising one or
more URP, said URP comprising at least 40 contiguous amino acids,
wherein said URP is substantially incapable of non-specific binding
to a serum protein, and wherein (a) the sum of glycine (G),
aspartate (D), alanine (A), serine (S), threonine (T), glutamate
(E) and proline (P) residues contained in the URP, constitutes more
than about 80% of the total amino acids of the URP; and/or (b) at
least 50% of the amino acids are devoid of secondary structure as
determined by Chou-Fasman algorithm; and (ii) culturing said host
cell in a suitable culture medium under conditions to effect
expression of said protein from said polynucleotide. Suitable host
cells are eukaryotic (e.g., CHO cells) and prokaryotic cells.
[0014] The present invention also provides a method of
increasing-serum secretion half-life of a protein, comprising:
fusing said protein with one or more unstructured recombinant
polymers (URPs), wherein the URP comprises at least about 40
contiguous amino acids, and wherein (a) the sum of glycine (G),
aspartate (D), alanine (A), serine (S), threonine (T), glutamate
(E) and proline (P) residues contained in the URP, constitutes more
than about 80% of the total amino acids of the URP; and/or (b) at
least 50% of the amino acids are devoid of secondary structure as
determined by Chou-Fasman algorithm; and wherein said URP is
substantially incapable of non-specific binding to a serum
protein.
[0015] Also provided in the present invention is a method of
detecting the presence or absence of a specific interaction between
a target and an exogenous protein that is displayed on a genetic
package, wherein said protein comprises one or more unstructured
recombinant polymer (URP), the method comprising: (a) providing a
genetic package displaying a protein that comprises one or more
unstructured recombinant polymers (URPs); (b) contacting the
genetic package with the target under conditions suitable to
produce a stable protein-target complex; and (c) detecting the
formation of the stable protein-target complex on the genetic
package, thereby detecting the presence of a specific interaction.
The method may further comprises obtaining a nucleotide sequence
from the genetic package that encodes the exogenous protein. In
some aspects, the presence or absence of a specific interaction is
between the URP and a target comprising a serum protein. In some
aspects, the presence or absence of a specific interaction is
between the URP and a target comprising a serum protease.
[0016] Further included in the present invention is a genetic
package displaying a microprotein, wherein said microprotein
retains binding capability to its native target. In some aspects,
the microprotein exhibits binding capability towards at least one
family of ion channel selected from the group consisting of a
sodium, a potassium, a calcium, an acetylcholine, and a chlorine
channel. Where desired, the microprotein is an ion-channel-binding
microprotein, and is modified such that (a) the microprotein binds
to a different family of channel as compared to the corresponding
unmodified microprotein; (b) the microprotein binds to a different
subfamily of the same channel family as compared to the
corresponding unmodified microprotein; (c) the microprotein binds
to a different species of the same subfamily of channel as compared
to the corresponding unmodified microprotein; (d) the microprotein
binds to a different site on the same channel as compared to the
corresponding unmodified microprotein; and/or (e) the microprotein
binds to the same site of the same channel but yield a different
biological effect as compared to the corresponding unmodified
microprotein. In some aspect, the microprotein is a toxin. The
present invention also provides a library of genetic packages
displaying the subject microproteins and/or toxins. Where desired,
the genetic package displays a proteinaceous toxin that retains in
part or in whole its toxicity spectrum. The toxin can be derived
from a single toxin protein, or derived from a family of toxins.
The present invention also provides a library of genetic packages
wherein the library displays a family of toxins, wherein the family
retains in part or in whole its native toxicity spectrum.
[0017] The present invention further provides a protein comprising
a plurality of ion-channel binding domains, wherein individual
domains are microprotein domains that have been modified such that
(a) the microprotein domains bind to a different family of channel
as compared to the corresponding unmodified microprotein domains;
(b) the microprotein domains bind to a different subfamily of the
same channel family as compared to the corresponding unmodified
microprotein domains; (c) the microprotein domains bind to a
different species of the same subfamily as compared to the
corresponding unmodified microprotein domains; (d) the microprotein
domains bind to a different site on the same channel as compared to
the corresponding unmodified microprotein domains; (e) the
microprotein domains bind to the same site of the same channel but
yield a different biological effect as compared to the
corresponding unmodified microprotein domains; and/or (f) the
microprotein domains bind to the same site of the same channel and
yield the same biological effect as compared to the corresponding
unmodified microprotein domains.
[0018] Also embodied in the invention is a method of obtaining a
microprotein with desired property, comprising: (a) providing a
subject library; and (b) screening the selectable library to obtain
at least one phage displaying a microprotein with the desired
property. Polynucleotides, vectors, genetic packages, host cells
for use in any one of the disclosed methods are also provided.
INCORPORATION BY REFERENCE
[0019] All publications and patent applications mentioned in this
specification are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] The novel features of the invention are set forth with
particularity in the appended claims. A better understanding of the
features and advantages of the present invention will be obtained
by reference to the following detailed description that sets forth
illustrative embodiments, in which the principles of the invention
are utilized, and the accompanying drawings of which:
[0021] FIG. 1 shows the modular components of an MURP. Binding
modules, effector modules, and multimerization modules are depicted
as circles. URP modules, N-terminal, and C-terminal modules are
shown as rectangles.
[0022] FIG. 2 shows examples of modular architectures of MURPs.
Binding modules (BM) in one MURP can have identical or differing
target specificities.
[0023] FIG. 3 shows that a repeat protein that is based on a human
sequence can contain novel amino acid sequences, which can contain
T cell epitopes. These novel sequences are formed at the junction
between neighboring repeat units.
[0024] FIG. 4 illustrates the design of a URP sequence that is a
repeat protein based on three human donor sequences D1, D2, and D3.
The repeating unit of this URP was chosen such that even 9-mer
sequences that span the junction between neighboring units can be
found in at least one of the human donor sequences.
[0025] FIG. 5 Example of a URP sequences that is a repeat protein
based on the sequences of three human proteins. The lower portion
of the figure illustrates that all 9-mer subsequences in the URP
occur in at least one of the human donor proteins.
[0026] FIG. 6 Example based URP sequence based on the human POU
domain residues 146-182.
[0027] FIG. 7 shows the advantage of separating modules with
information rich sequences by inserting URP modules between such
sequences. The left side of the figure shows that the direct fusion
of modules A and B leads to novel sequences in the junction region.
These junction sequences can be epitopes. The right half of the
figure shows that the insertion of a URP module between module A
and B prevents the formation of such junction sequences that
contain partial sequences from modules A and B. Instead, the
termini of modules A and B yield junction sequences that contain
URP sequences and thus are predicted to have low
immunogenicity.
[0028] FIG. 8 shows drug delivery constructs that are based on
URPs. The drug molecules depicted as hexagons are chemically
conjugated to the MURP.
[0029] FIG. 9 shows and MURP containing a protease-sensitive site.
The URP module is designed such that it blocks the effector module
from its function. Protease cleavage removes a portion of the URP
module and results in increased activity of the effector
function.
[0030] FIG. 10 shows how an URP module can act as a linker between
a binding module and an effector module. The binding module can
bind to a target and as a consequence it increases the local
concentration of the effector module in the proximity of the
target.
[0031] FIG. 11 Shows a process to construct genes encoding URP
sequences from libraries of short URP modules. The URP module
library can be inserted into a stuffer vector that contains green
fluorescent protein (GFP) as a reporter to facilitate the
identification of URP sequences with high expression. The figure
illustrates that genes encoding long URP sequences can be build by
iterative dimerization.
[0032] FIG. 12 shows MURPs that contain multiple binding modules
for death receptors. Death receptors are triggered by trimerization
and thus MURPs containing at least three binding elements for one
death receptor particularly potent in inducing cell death. The
lower portion of the figure illustrates that one can increase the
specificity of the MURP for diseased tissue by adding one or more
binding modules with specificity for tumor tissue.
[0033] FIG. 13 shows a MURP that comprises four binding modules
(rectangles) with specificity for a tumor antigen with an effector
module like interleukin 2.
[0034] FIG. 14 shows the flow chart for the construction of URP
modules with 288 residues. The URP modules were constructed as
fusion proteins with GFP. Libraries of URP modules with 36 amino
acids were constructed first followed by iterative dimerization to
yield URP modules with 288 amino acids (rPEG_H288 and
rPEG_J288).
[0035] FIG. 15 Amino acid and nucleotide sequence of a URP module
with 288 amino acids (rPEG_J288).
[0036] FIG. 16 Amino acid and nucleotide sequence of a URP module
with 288 amino acids (rPEG_H288).
[0037] FIG. 17 Amino acid sequence of a serine-rich sequence region
of the human protein dentin sialophosphoprotein.
[0038] FIG. 18 shows a depot derivative of a MURP. The protein
contains two cysteine residues that can form a weak SS bridge. The
protein can be manufactured with the SS bridge intact. It can be
formulated and injected into patients in reduced form. After
injection it will be oxidized in proximity to the injection site
and as a result in can form a high molecular weight polymer with
very limited diffusivity. The active MURP can slowly leach from the
injection site by limited proteolysis or limited reduction of the
cross linking SS bond.
[0039] FIG. 19 shows a depot form of a MURP. The MURP has very
limited diffusivity at the injection site and can be liberated from
the injection site by limited proteolysis.
[0040] FIG. 20 shows a depot form of a MURP that contains a
histidine-rich sequence. The MURP can be formulated and injected in
combination with insoluble beads that contain immobilized nickel.
The MURP binds to the nickel beads at the injection site and is
released slowly into the circulation.
[0041] FIG. 21 shows MURPs that contain multimerization modules.
The upper part of the figure shows an MURP that contains one
dimerization sequence. As a result it forms a dimer which
effectively doubles its molecular weight. The center of the figure
shows three MURP designs that comprise two multimerization
sequences. Such MURPs can form multimers with very high effective
molecular weight. The lower part of the figure illustrated an MURP
that contains multiple RGD sequences that are known to bind to cell
surface receptors and thus confer half-life.
[0042] FIG. 22 Shows a variety of MURPs that are designed to block
or modulate ion channel function. Circles indicate binding modules
with specificity for ion channels. These binding modules can be
derived or identical to natural toxins with affinity for ion
channel receptors. The figure illustrates that other binding
domains can be added on either side of the ion channel-specific
binding modules thus conferring the MURPs increased efficacy or
specificity for a particular cell type.
[0043] FIG. 23 shows several MURP designs for increased half-life.
Increased effective molecular weight can be achieved by increasing
chain length (A), chemical multimerization (B), adding multiple
copies of binding modules into a molecule separated by non-binding
sites (C), construction of chemical multimers similar to C (D, E),
including multimerization sequences (F).
[0044] FIG. 24 shows MURPs that can be formed by chemical
conjugation of binding modules to a recombinant URP sequence. The
URP sequence is designed to contain multiple lysine residues (K) as
conjugation sites.
[0045] FIG. 25 shows the design of a library of 2SS binding
modules. The sequences contain a constant 1SS sequence in the
center which is flanked by random sequences that contain cysteine
residues in varying distance from the 1SS core.
[0046] FIG. 26 shows the design of a library of 2SS binding
modules. The sequences contain a constant 1SS sequence in the
center which is flanked by random sequences that contain cysteine
residues in varying distance from the 1SS core.
[0047] FIG. 27 shows the design of a library of dimers of 1SS
binding modules. Initially, a collection of 1SS binding modules is
amplified by two PCR reactions. The resulting PCR products are
combined and dimers are generated in a subsequent PCR step.
[0048] FIG. 28 show the Western analysis of a fusion protein
containing the 288 amino acid URP sequence rPEG_J288 after
incubation of up to 3 days in 50% mouse serum.
[0049] FIG. 29 shows results of a binding assay testing for
pre-existing antibodies against a URP sequence of 288 amino
acids.
[0050] FIG. 30 shows the binding of MURPs containing one (Monomer),
two (Dimer), four (Tetramer), or zero (rPEG36) binding modules with
specificity for VEGF which was coated to microtiter plates.
[0051] FIG. 31 shows the amino acid sequence of an MURP with
specificity for EpCAM. The sequence contains four binding modules
with affinity for EpCAM (underlined). The sequence contains an
N-terminal Flag sequence which contains the only two lysine
residues of the entire sequence.
[0052] FIG. 32 shows the design of 1SS addition libraries. Random
1SS modules can be added to the N- or C-terminus of a pre-selected
binding module or simultaneously to both sides.
[0053] FIG. 33 shows the alignment of three finger toxin-related
sequences. The figure also shows a 3D structure that was solved by
NMR.
[0054] FIG. 34 shows the design of a three-finger toxin-based
library. Residues designated X were randomized. The codon choice
for each random position is indicated.
[0055] FIG. 35 shows the alignment of plexin-related sequences.
[0056] FIG. 36 shows the design of a plexin-based library. Residues
designated X were randomized. The codon choice for each random
position is indicated.
[0057] FIG. 37 Sequences of plexin-related binding modules with
specificity for DR4, ErbB2, and HGFR.
[0058] FIG. 38 shows a binding assay for microprotein-based binding
domains with specificity for VEGF.
[0059] FIG. 39 shows sequences of 2SS and 3SS binding modules that
were isolated from buildup libraries with specificity for VEGF. The
upper part of the protein shows PAGE gel analysis of the proteins
purified by heat-lysis.
[0060] FIG. 40 shows cloning steps to construct the URP sequence
rPEG_J72.
[0061] FIG. 41 shows the construction of a library of URP modules
with 36 amino acids called rPEG_J36. The region encoding rPEG_J36
was assembled by ligating three shorter segments encoding rPEG_J12
and a stopper module.
[0062] FIG. 42 shows the nucleotide sequence and translation of the
stuffer vector pCW0051. The stuffer region is flanked by BsaI and
BbsI sites and contains multiple stop codons.
[0063] FIG. 43 shows a PAGE gel of the purification of the URP
rPEG_J288 fused to GFP. Lane 2 shows the cell lysate; lane 3:
product purified by IMAC; lane 4: product purified by
anti-Flag.
[0064] FIG. 44 Amino acid sequence of fusion proteins between
rPEG_J288 and human effector domains interferon alpha, G-CSF, and
human growth hormone.
[0065] FIG. 45 shows the Western analysis of expression of fusion
proteins between rPEG_J288 and human growth hormone (lanes 1 and
2), interferon alpha (lanes 3 and 4), and GFP (lanes 5 and 6). Both
soluble and insoluble material was analyzed for each protein.
[0066] FIG. 46 shows the design of MURPs based on the toxin OSK1.
The figure shows that URP sequences and/or binding modules can be
added to either side of OSK1
[0067] FIG. 47 depicts exemplary product formats comprising the
subject URPs.
DETAILED DESCRIPTION OF THE INVENTION
[0068] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. Numerous variations, changes, and substitutions will
now occur to those skilled in the art without departing from the
invention. It should be understood that various alternatives to the
embodiments of the invention described herein may be employed in
practicing the invention. It is intended that the following claims
define the scope of the invention and that methods and structures
within the scope of these claims and their equivalents be covered
thereby.
General Techniques:
[0069] The practice of the present invention employs, unless
otherwise indicated, conventional techniques of immunology,
biochemistry, chemistry, molecular biology, microbiology, cell
biology, genomics and recombinant DNA, which are within the skill
of the art. See Sambrook, Fritsch and Maniatis, MOLECULAR CLONING:
A LABORATORY MANUAL, 2.sup.nd edition (1989); CURRENT PROTOCOLS IN
MOLECULAR BIOLOGY (F. M. Ausubel, et al. eds., (1987)); the series
METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL
APPROACH (M. J. MacPherson, B. D. Hames and G. R. Taylor eds.
(1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY
MANUAL, and ANIMAL CELL CULTURE (R. I. Freshney, ed. (1987)).
DEFINITIONS
[0070] As used in the specification and claims, the singular form
"a", "an" and "the" include plural references unless the context
clearly dictates otherwise. For example, the term "a cell" includes
a plurality of cells, including mixtures thereof.
[0071] The terms "polypeptide", "peptide", "amino acid sequence"
and "protein" are used interchangeably herein to refer to polymers
of amino acids of any length. The polymer may be linear or
branched, it may comprise modified amino acids, and it may be
interrupted by non-amino acids. The terms also encompass an amino
acid polymer that has been modified, for example, disulfide bond
formation, glycosylation, lipidation, acetylation, phosphorylation,
or any other manipulation, such as conjugation with a labeling
component. As used herein the term "amino acid" refers to either
natural and/or unnatural or synthetic amino acids, including but
not limited to glycine and both the D or L optical isomers, and
amino acid analogs and peptidomimetics. Standard single or three
letter codes are used to designate amino acids.
[0072] A "repetitive sequence" refers to an amino acid sequence
that can be described as an oligomer of repeating peptide
sequences, forming direct repeats, or inverted repeats or
alternating repeats of multiple sequence motifs. These repeating
oligomer sequences can be identical or homologous to each other,
but there can also be multiple repeated motifs. Repetitive
sequences are characterized by a very low information content. A
repetitive sequence is not a required feature of a URP and in some
cases a non-repetitive sequence will in fact be preferred.
[0073] Amino acids can be characterized based on their
hydrophobicity. A number of scales have been developed. An example
is a scale developed by Levitt, M et al. (see Levitt, M (1976) J
Mol Biol 104, 59, #3233, which is listed in Hopp, T P, et al.
(1981) Proc Natl Acad Sci USA 78, 3824, #3232). Examples of
"hydrophilic amino acids" are arginine, lysine, threonine, alanine,
asparagine, and glutamine. Of particular interest are the
hydrophilic amino acids aspartate, glutamate, and serine, and
glycine. Examples of "hydrophobic amino acids" are tryptophan,
tyrosine, phenylalanine, methionine, leucine, isoleucine, and
valine.
[0074] The term "denatured conformation" describes the state of a
peptide in solution that is characterized by a large conformational
freedom of the peptide backbone. Most peptides and proteins adopt a
denatured conformation in the presence of high concentrations of
denaturants or at elevated temperatures. Peptides in denatured
conformation have characteristic CD spectra and they are generally
characterized by a lack of long range interactions as determined by
e.g., NMR. Denatured conformation and unfolded conformation will be
used synonymously.
[0075] The terms "unstructured protein (UNP) sequences" and
"unstructured recombinant polymer" (URP) are used herein
interchanageably. The terms refer to amino acid sequences that
share commonality with denatured peptide sequences, e.g.,
exhibiting a typical behavior like denatured peptide sequences,
under physiological conditions, as detailed herein. URP sequences
lack a defined tertiary structure and they have limited or no
secondary structure as detected by, e.g., Chou-Fasman
algorithm.
[0076] As used herein, the term "cell surface proteins" refers to
the plasma membrane components of a cell. It encompasses integral
and peripheral membrane proteins, glycoproteins, polysaccharides
and lipids that constitute the plasma membrane. An integral
membrane protein is a transmembrane protein that extends across the
lipid bilayer of the plasma membrane of a cell. A typical integral
membrane protein consists of at least one membrane spanning segment
that generally comprises hydrophobic amino acid residues.
Peripheral membrane proteins do not extend into the hydrophobic
interior of the lipid bilayer and they are bound to the membrane
surface via covalent or noncovalent interaction directly or
indirectly with other membrane components.
[0077] The terms "membrane", "cytosolic", "nuclear" and "secreted"
as applied to cellular proteins specify the extracellular and/or
subcellular location in which the cellular protein is mostly,
predominantly, or preferentially localized.
[0078] "Cell surface receptors" represent a subset of membrane
proteins, capable of binding to their respective ligands. Cell
surface receptors are molecules anchored on or inserted into the
cell plasma membrane. They constitute a large family of proteins,
glycoproteins, polysaccharides and lipids, which serve not only as
structural constituents of the plasma membrane, but also as
regulatory elements governing a variety of biological
functions.
[0079] The term "module" refers to a portion of a protein that is
physically or functionally distinguished from other portions of the
protein or peptide. A module can comprise one or more domains. In
general, a module or domain can be a single, stable
three-dimensional structure, regardless of size. The tertiary
structure of a typical domain is stable in solution and remains the
same whether such a member is isolated or covalently fused to other
domains. A domain generally has a particular tertiary structure
formed by the spatial relationships of secondary structure
elements, such as beta-sheets, alpha helices, and unstructured
loops. In domains of the microprotein family, disulfide bridges are
generally the primary elements that determine tertiary structure.
In some instances, domains are modules that can confer a specific
functional activity, such as avidity (multiple binding sites to the
same target), multi-specificity (binding sites for different
targets), halflife (using a domain, cyclic peptide or linear
peptide) which binds to a serum protein like human serum albumin
(HSA) or to IgG (hIgG1, 2, 3 or 4) or to red blood cells.
Functionally-defined domains have a distinct biological
function(s). The ligand-binding domain of a receptor, for example,
is that domain that binds ligand. An antigen-binding domain refers
to the part of an antigen-binding unit or an antibody that binds to
the antigen. Functionally-defined domains need not be encoded by
contiguous amino acid sequences. Functionally-defined domains may
contain one or more physically-defined domain. Receptors, for
example, are generally divided into the extracellular
ligand-binding domain, a transmembrane domain, and an intracellular
effector domain. A "membrane anchorage domain" refers to the
portion of a protein that mediates membrane association. Generally,
the membrane anchorage domain is composed of hydrophobic amino acid
residues. Alternatively, the membrane anchorage domain may contain
modified amino acids, e.g. amino acids that are attached to a fatty
acid chain, which in turn anchors the protein to a membrane.
[0080] "Non-naturally occurring" as applied to a protein means that
the protein contains at least one amino acid that is different from
the corresponding wildtype or native protein. Non-natural sequences
can be determined by performing BLAST search using, e.g., the
lowest smallest sum probability where the comparison window is the
length of the sequence of interest (the queried) and when compared
to the non-redundant ("nr") database of Genbank using BLAST 2.0.
The BLAST 2.0 algorithm, which is described in Altschul et al.
(1990) J. Mol. Biol. 215:403-410, respectively. Software for
performing BLAST analyses is publicly available through the
National Center for Biotechnology Information.
[0081] A "host cell" includes an individual cell or cell culture
which can be or has been a recipient for the subject vectors. Host
cells include progeny of a single host cell. The progeny may not
necessarily be completely identical (in morphology or in genomic of
total DNA complement) to the original parent cell due to natural,
accidental, or deliberate mutation. A host cell includes cells
transfected in vivo with a vector of this invention.
[0082] As used herein, the term "isolated" means separated from
constituents, cellular and otherwise, in which the polynucleotide,
peptide, polypeptide, protein, antibody, or fragments thereof, are
normally associated with in nature. As is apparent to those of
skill in the art, a non-naturally occurring the polynucleotide,
peptide, polypeptide, protein, antibody, or fragments thereof, does
not require "isolation" to distinguish it from its naturally
occurring counterpart. In addition, a "concentrated", "separated"
or "diluted" polynucleotide, peptide, polypeptide, protein,
antibody, or fragments thereof, is distinguishable from its
naturally occurring counterpart in that the concentration or number
of molecules per volume is greater than "concentrated" or less than
"separated" than that of its naturally occurring counterpart.
[0083] "Linked" and "fused" or "fusion" are used interchangeably
herein. These terms refer to the joining together of two more
chemical elements or components, by whatever means including
chemical conjugation or recombinant means. An "in-frame fusion"
refers to the joining of two or more open reading frames (OFRs) to
form a continuous longer OFR, in a manner that maintains the
correct reading frame of the original OFRs. Thus, the resulting
recombinant fusion protein is a single protein containing two ore
more segments that correspond to polypeptides encoded by the
original OFRs (which segments are not normally so joined in
nature.)
[0084] In the context of polypeptides, a "linear sequence" or a
"sequence" is an order of amino acids in a polypeptide in an amino
to carboxyl terminus direction in which residues that neighbor each
other in the sequence are contiguous in the primary structure of
the polypeptide. A "partial sequence" is a linear sequence of part
of a polypeptide which is known to comprise additional residues in
one or both directions.
[0085] "Heterologous" means derived from a genotypically distinct
entity from the rest of the entity to which it is being compared.
For example, a glycine rich sequence removed from its native coding
sequence and operatively linked to a coding sequence other than the
native sequence is a heterologous glycine rich sequence. The term
"heterologous" as applied to a polynucleotide, a polypeptide, means
that the polynucleotide or polypeptide is derived from a
genotypically distinct entity from that of the rest of the entity
to which it is being compared.
[0086] The terms "polynucleotides", "nucleic acids", "nucleotides"
and "oligonucleotides" are used interchangeably. They refer to a
polymeric form of nucleotides of any length, either
deoxyribonucleotides or ribonucleotides, or analogs thereof.
Polynucleotides may have any three-dimensional structure, and may
perform any function, known or unknown. The following are
non-limiting examples of polynucleotides: coding or non-coding
regions of a gene or gene fragment, loci (locus) defined from
linkage analysis, exons, introns, messenger RNA (mRNA), transfer
RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides,
branched polynucleotides, plasmids, vectors, isolated DNA of any
sequence, isolated RNA of any sequence, nucleic acid probes, and
primers. A polynucleotide may comprise modified nucleotides, such
as methylated nucleotides and nucleotide analogs. If present,
modifications to the nucleotide structure may be imparted before or
after assembly of the polymer. The sequence of nucleotides may be
interrupted by non-nucleotide components. A polynucleotide may be
further modified after polymerization, such as by conjugation with
a labeling component.
[0087] "Recombinant" as applied to a polynucleotide means that the
polynucleotide is the product of various combinations of cloning,
restriction and/or ligation steps, and other procedures that result
in a construct that is distinct from a polynucleotide found in
nature.
[0088] The terms "gene" or "gene fragment" are used interchangeably
herein. They refer to a polynucleotide containing at least one open
reading frame that is capable of encoding a particular protein
after being transcribed and translated. A gene or gene fragment may
be genomic or cDNA, as long as the polynucleotide contains at least
one open reading frame, which may cover the entire coding region or
a segment thereof. A "fusion gene" is a gene composed of at least
two heterologous polynucleotides that are linked together.
[0089] A "vector" is a nucleic acid molecule, preferably
self-replicating, which transfers an inserted nucleic acid molecule
into and/or between host cells. The term includes vectors that
function primarily for insertion of DNA or RNA into a cell,
replication of vectors that function primarily for the replication
of DNA or RNA, and expression vectors that function for
transcription and/or translation of the DNA or RNA. Also included
are vectors that provide more than one of the above functions. An
"expression vector" is a polynucleotide which, when introduced into
an appropriate host cell, can be transcribed and translated into a
polypeptide(s). An "expression system" usually connotes a suitable
host cell comprised of an expression vector that can function to
yield a desired expression product.
[0090] The "target" as used in the context of MURPs is a
biochemical molecule or structure to which the Binding Module or
the URP-linked Binding Module can bind and where the binding event
results in a desired biological activity. The target can be a
protein ligand or receptor that is inhibited, activated or
otherwise acted upon by the t protein. Examples of targets are
hormones, cytokines, antibodies or antibody fragments, cell surface
receptors, kinases, growth factors and other biochemical structures
with biological activity.
[0091] A "functional module" can be any non-URP in a protein
product. Thus a functional module can be a binding module (BM), an
effector module (EM), a multimerization module (MM), a C-terminal
module (CM), or an N-terminal module (NM). In general, functional
modules are characterized by a high information content of their
amino acid sequence, i.e they contain many different amino acids
and many of these amino acids are important for the function of a
functional module. A functional module typically has secondary and
tertiary structure, may be a folded protein domain and may contain
1, 2, 3, 4, 5 or more disulfide bonds.
[0092] The term `microproteins` refers to a classification in the
SCOP database. Microproteins are usually the smallest proteins with
a fixed structure and typically but not exclusively have as few as
15 amino acids with two disulfides or up to 200 amino acids with
more than ten disulfides. A microprotein may contain one or more
microprotein domains. Some microprotein domains or domain families
can have multiple more-or-less stable and multiple more or less
similar structures which are conferred by different disulfide
bonding patterns, so the term stable is used in a relative way to
differentiate microproteins from peptides and non-microprotein
domains. Most microprotein toxins are composed of a single domain,
but the cell-surface receptor microproteins often have multiple
domains. Microproteins can be so small because their folding is
stabilized either by disulfide bonds and/or by ions such as
Calcium, Magnesium, Manganese, Copper, Zinc, Iron or a variety of
other multivalent ions, instead of being stabilized by the typical
hydrophobic core.
[0093] The term "scaffold" refers to the minimal polypeptide
`framework` or `sequence motif` that is used as the conserved,
common sequence in the construction of protein libraries. In
between the fixed or conserved residues/positions of the scaffold
lie variable and hypervariable positions. A large diversity of
amino acids is provided in the variable regions between the fixed
scaffold residues to provide specific binding to a target molecule.
A scaffold is typically defined by the conserved residues that are
observed in an alignment of a family of sequence-related proteins.
Fixed residues may be required for folding or structure, especially
if the functions of the aligned proteins are different. A full
description of a microprotein scaffold may include the number,
position or spacing and bonding pattern of the cysteines, as well
as position and identity of any fixed residues in the loops,
including binding sites for ions such as Calcium.
[0094] The "fold" of a microprotein is largely defined by the
linkage pattern of the disulfide bonds (i.e., 1-4, 2-6, 3-5). This
pattern is a topological constant and is generally not amenable to
conversion into another pattern without unlinking and relinking the
disulfides such as by reduction and oxidation (redox agents). In
general, natural proteins with related sequences adopt the same
disulfide bonding patterns. The major determinants are the cysteine
distance pattern (CDP) and some fixed non-cys residues, as well as
a metal-binding site, if present. In few cases the folding of
proteins is also influenced by the surrounding sequences (ie
pro-peptides) and in some cases by chemical derivatization (ie
gamma-carboxylation) of residues that allow the protein to bind
divalent metal ions (ie Ca++) which assists their folding. For the
vast majority of microproteins such folding help is not
required.
[0095] However, proteins with the same bonding pattern may still
comprise multiple folds, based on differences in the length and
composition of the loops that are large enough to give the protein
a rather different structure. An example are the conotoxin,
cyclotoxin and anato domain families, which have the same DBP but a
very different CDP and are considered to be different folds.
Determinants of a protein fold are any attributes that greatly
alter structure relative to a different fold, such as the number
and bonding pattern of the cysteines, the spacing of the cysteines,
differences in the sequence motifs of the inter-cysteine loops
(especially fixed loop residues which are likely to be needed for
folding, or in the location or composition of the calcium (or other
metal or co-factor) binding site.
[0096] The term "disulfide bonding pattern" or "DBP" refers to the
linking pattern of the cysteines, which are numbered 1-n from the
N-terminus to the C-terminus of the protein. Disulfide bonding
patterns are topologically constant, meaning they can only be
changed by unlinking one or more disulfides such as using redox
conditions. The possible 2-, 3-, and 4-disulfide bonding patterns
are listed below in paragraphs 0048-0075.
[0097] The term "cysteine distance pattern" or "CDP" refers to the
number of non-cysteine amino acids that separate the cysteines on a
linear protein chain. Several notations are used: C5C0C3C equals
C5CC3C equals CxxxxxCCxxxC.
[0098] The term `Position n6` or `n7=4` refers to the intercysteine
loops and `n6` is defined as the loop between C6 and C7; `n7=4`
means the loop between C7 and C8 is 4 amino acids long, not
counting the cysteines.
[0099] Serum degradation resistance--Proteins can be eliminated by
degradation in the blood, which typically involves proteases in the
serum or plasma. The serum degradation resistance is measured by
combining the protein with human (or mouse, rat, monkey, as
appropriate) serum or plasma, typically for a range of days (ie
0.25, 0.5, 1, 2, 4, 8, 16 days) at 37 C. The samples for these
timepoints are then run on a western assay and the protein is
detected with an antibody. The antibody can be to a tag in the
protein. If the protein shows a single band on the western, where
the protein's size is identical to that of the injected protein,
then no degradation has occurred. The timepoint where 50% of the
protein is degraded, as judged by western, is the serum degradation
halflife of the protein.
[0100] Serum protein binding--While the MURP typically has a number
of modules that bind to cell-surface targets and/or serum proteins,
it is desirable that the URP substantially lack unintended
activities. The URP should be designed to minimize avoid
interaction with (binding to) serum proteins, including antibodies.
Different URP designs can be screened for serum protein binding by
ELISA, immobilizing the serum proteins and then adding the URP,
incubating, washing and then detecting the amount of bound URP. One
approach is to detect the URP using an antibody that recognizes a
tag that has been added to the URP. A different approach is to
immobilize the URP (such as via a fusion to GFP) and come in with
human serum, incubating, washing, and then detecting the amount of
human antibodies that remain bound to the URP using secondary
antibodies like goat anti-human IgG. Using these approaches we have
designed our URPs to show very low levels of binding to serum
proteins. However, in some applications binding to serum proteins
or serum-exposed proteins is desired, for example because it can
further extend the secretion halflife. In such cases one can use
these same assays to design URPs that bind to serum proteins or
serum-exposed proteins such as HSA or IgG. In other cases the MURP
can be given binding modules that contain peptides that have been
designed to bind to serum proteins or serum-exposed proteins such
as HAS or IgG.
Unstructured Recombinant Polymers (URPs):
[0101] One aspect of the present invention is the design of
unstructured recombinant polymers (URPs). The subject URPs are
particularly useful for generating recombinant proteins of
therapeutic and/or diagnostic value. The subject URPs exhibit one
or more following features.
[0102] The subject URPs comprise amino acid sequences that
typically share commonality with denatured peptide sequences under
physiological conditions. URP sequences typically behave like
denatured peptide sequences under physiological conditions. URP
sequences lack well defined secondary and tertiary structures under
physiological conditions. A variety of methods have been
established in the art to ascertain the second and tertiary
structures of a given polypeptide. For example, the secondary
structure of a polypeptide can be determined by CD spectroscopy in
the "far-UV" spectral region (190-250 nm). Alpha-helix, beta-sheet,
and random coil structures each give rise to a characteristic shape
and magnitude of CD spectra. Secondary structure can also be
ascertained via certain computer programs or algorithms such as the
Chou-Fasman algorithm (Chou, P. Y., et al. (1974) Biochemistry, 13:
222-45). For a given URP sequence, the algorithm can predict
whether there exists some or no secondary structure at all. In
general, URP sequences will have spectra that resemble denatured
sequences due to their low degree of secondary and tertiary
structure. Where desired, URP sequences can be designed to have
predominantly denatured conformations under physiological
conditions. URP sequences typically have a high degree of
conformational flexibility under physiological conditions and they
tend to have large hydrodynamic radii (Stokes' radius) compared to
globularproteins of similar molecular weight. As used herein,
physiological conditions refer to a set of conditions including
temperature, salt concentration, pH that mimic those conditions of
a living subject. A host of physiologically relevant conditions for
use in in vitro assays have been established. Generally, a
physiological buffer contains a physiological concentration of salt
and at adjusted to a neutral pH ranging from about 6.5 to about
7.8, and preferably from about 7.0 to about 7.5. A variety of
physiological buffers is listed in Sambrook et al. (1989) supra and
hence is not detailed herein. Physiologically relevant temperature
ranges from about 25.degree. C. to about 38.degree. C., and
preferably from about 30.degree. C. to about 37.degree. C.
[0103] The subject URPs can be sequences with low immunogenicity.
Low immunogenicity can be a direct result of the conformational
flexibility of URP sequences. Many antibodies recognize so-called
conformational epitopes in protein antigens. Conformational
epitopes are formed by regions of the protein surface that are
composed of multiple discontinuous amino acid sequences of the
protein antigen. The precise folding of the protein brings these
sequences into a well-defined special configuration that can be
recognized by antibodies. Preferred URPs are designed to avoid
formation of conformational epitopes. For example, of particular
interest are URP sequences having a low tendency to adapt compactly
folded conformations in aqueous solution. In particular, low
immunogenicity can be achieved by choosing sequences that resist
antigen processing in antigen presenting cells, choosing sequences
that do not bind MHC well and/or by choosing sequences that are
derived from human sequences.
[0104] The subject URPs can be sequences with a high degree of
protease resistance. Protease resistance can also be a result of
the conformational flexibility of URP sequences. Protease
resistance can be designed by avoiding known protease recognition
sites. Alternatively, protease resistant sequences can be selected
by phage display or related techniques from random or semi-random
sequence libraries. Where desired for special applications, such as
slow release from a depot protein, serum protease cleavage sites
can be built into an URP. Of particular interest are URP sequences
with high stability (e.g., long serum half-life, less prone to
cleavage by proteases present in bodily fluid) in blood.
[0105] The subject URP can also be characterized by the effect in
that wherein upon incorporation of it into a protein, the protein
exhibits a longer serum half-life and/or higher solubility as
compared to the corresponding protein that is deficient in the URP.
[Methods of ascertaining serum half-life are known in the art (see
e.g., Alvarez, P., et al. (2004) J Biol Chem, 279: 3375-81). One
can readily determine whether the resulting protein has a longer
serum half-life as compared to the unmodified protein by praciting
any methods available in the art or exemplified herein.
[0106] The subject URP can be of any length necessary to effect (a)
extension of serum half-life of a protein comprising the URP; (b)
an increase in solubility of the resulting protein; (c) an
increased resistance to protease; and/or (d) a reduced
immunogenicity of the resulting protein that comprises the URP.
Typically, the subject URP has about 30, 40, 50, 60, 70, 80, 90,
100, 150, 200, 300, 400 or more contiguous amino acids. When
incorporated into a protein, the URP can be fragmented such that
the resulting protein contains multiple URPs, or multiple fragments
of URPs. Some or all of these individual URP sequences may be
shorter that 40 amino acids as long as the combined length of all
URP sequences in the resulting protein is at least 40 amino acids.
Preferably, the resulting protein has a combined length of URP
sequences exceeding 40, 50, 60, 70, 80, 90, 100, 150, 200 or more
amino acids.
[0107] URPs may have an isoelectric point (pI) of 1.0, 1.5, 2.0,
2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5,
9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5 or even 13.0.
[0108] In general, URP sequences are rich in hydrophilic amino
acids and contain a low percentage of hydrophobic or aromatic amino
acids. Suitable hydrophilic residues include but are not limited to
glycine, serine, aspartate, glutamate, lysine, arginine, and
threonine. Hydrophobic residues that are less favored in
construction of URPs include tryptophan, phenylalanine, tyrosine,
leucine, isoleucine, valine, and methionine. URP sequences can be
rich in glycine but URP sequences can also be rich in the amino
acids glutamate, aspartate, serine, threonine, alanine or proline.
Thus the predominant amino acid may be G, E, D, S, T, A or P. The
inclusion of proline residues tends to reduce sensitivity to
proteolytic degradation.
[0109] The inclusion of hydrophilic residues typically increases
URPs' solubility in water and aqueous media under physiological
conditions. As a result of their amino acid composition, URP
sequences have a low tendency to form aggregates in aqueous
formulations and the fusion of URP sequences to other proteins or
peptides tends to enhance their solubility and reduce their
tendency to form aggregates, which is a separate mechanism to
reduce immunogenicity.
[0110] URP sequences can be designed to avoid certain amino acids
that confer undesirable properties to the protein. For instance,
one can design URP sequences to contain few or none of the
following amino acids: cysteine (to avoid disulfide formation and
oxidation), methionine (to avoid oxidation), asparagine and
glutamine (to avoid desamidation).
[0111] Glycine-Rich URPs:
[0112] In one embodiment, the subject URP comprises a glycine rich
sequence (GRS). For example, glycine can be present predominantly
such that it is the most prevalent residues present in the sequence
of interest. In another example, URP sequences can be designed such
that glycine residues constitute at least about 30%, 35%, 40%, 45%,
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% of the total
amino acids. URPs can also contain 100% glycines. In yet another
example, the URPs contain at least 30% glycine and the total
concentration of tryptophan, phenylalanine, tyrosine, valine,
leucine, and isoleucine is less then 20%. In still another example,
the URPs contain at least 40% glycine and the total concentration
of tryptophan, phenylalanine, tyrosine, valine, leucine, and
isoleucine is less then 10%. In still yet another example, the URPs
contain at least about 50% glycine and the total concentration of
tryptophan, phenylalanine, tyrosine, valine, leucine, and
isoleucine is less then 5%.
[0113] The length of GRS can vary between about 5 amino acids and
200 amino acids or more. For example, the length of a single,
contiguous GRS can contain 5, 10, 15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 240, 280, 320 or
400 or more amino acids. GRS may comprise glycine residues at both
ends.
[0114] GRS can also have a significant content of other amino
acids, for example Ser, Thr, Ala, or Pro. GRS can contain a
significant fraction of negatively charged amino acids including
but not limited to Asp and Glu. GRS can contain a significant
fraction of positively charged amino acids including but not
limited to Arg or Lys. Where desired, URPs can be designed to
contain only a single type of amino acid (i.e., Gly or Glu),
sometimes only a few types of amino acid, e.g., two to five types
of amino acids (e.g., selected from G, E, D, S, T, A and P), in
contrast to typical proteins and typical linkers which generally
are composed of most of the twenty types of amino acids. URPs may
contain negatively charged residue's (Asp, Glu) in 30, 25, 20, 15,
12, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 percent of the amino acids
positions.
[0115] Typically, the subject GRS-containing URP has about 30, 40,
50, 60, 70, 80, 90, 100, or more contiguous amino acids. When
incorporated into a protein, the URP can be fragmented such that
the resulting protein contains multiple URPs, or multiple fragments
of URPs. Some or all of these individual URP sequences may be
shorter that 40 amino acids as long as the combined length of all
URP sequences in the resulting protein is at least 30 amino acids.
Preferably, the resulting protein has a combined length of URP
sequences exceeding 40, 50, 60, 70, 80, 90, 100, or more amino
acids.
[0116] The GRS-containing URPs are of particular interest due to,
in part, the increased conformational freedom of glycine-containing
peptides. Denatured peptides in solution have a high degree of
conformational freedom. Most of that conformational freedom is lost
upon binding of said peptides to a target like a receptor, an
antibody, or a protease. This loss of entropy needs to be offset by
the energy of interaction between the peptide and its target. The
degree of conformational freedom of a denatured peptide is
dependent on its amino acid sequences. Peptides containing many
amino acids with small side chains tend to have more conformational
freedom than peptides that are composed of amino acids with larger
side chains. Peptides containing the amino acid glycine have
particularly large degrees of freedom. It has been estimated that
glycine-containing peptide bonds have about 3.4 times more entropy
in solution as compared to corresponding alanine-containing
sequences (D'Aquino, J. A., et al. (1996) Proteins, 25: 143-56).
This factor increases with the number of glycine residues in a
sequence. As a result, such peptides tend to lose more entropy upon
binding to targets, which reduces their overall ability to interact
with other proteins as well as their ability to adopt defined
three-dimensional structures. The large conformational flexibility
of glycine-peptide bonds is also evident when analyzing
Ramachandran plots of protein structures where glycine peptide
bonds occupy areas that are rarely occupied by other peptide bonds
(Venkatachalam, C. M., et al. (1969) Annu Rev Biochem, 38: 45-82).
Stites et al. studied a database of 12,320 residues from 61
nonhomologous, high resolution crystal structures to determine the
phi, psi conformational preferences of each of the 20 amino acids.
The observed distributions in the native state of proteins are
assumed to also reflect the distributions found in the denatured
state. The distributions were used to approximate the energy
surface for each residue, allowing the calculation of relative
conformational entropies for each residue relative to glycine. In
the most extreme case, replacement of glycine by proline,
conformational entropy changes will stabilize the native state
relative to the denatured state by -0.82+/-0.08 kcal/mol at
20.degree. C. (Stites, W. E., et al. (1995) Proteins, 22: 132).
These observations confirm the special role of glycine among the 20
natural amino acids.
[0117] In designing the subject URPs, natural or non-natural
sequences can be used. For example, a host of natural sequences
containing high glycine content is provided in Table 1, Table 2,
Table 3, and Table 4. One skilled in the art may adopt any one of
the sequences as an URP, or modify the sequences to achieve the
intended properties. Where immunogenicity to the host subject is of
concern, it is preferable to design GRS-containing URPs based on
glycine rich sequences derived from the host. Preferred
GRS-containing URPs are sequences from human proteins or sequences
that share substantial homology to the corresponding glycine rich
sequences in the reference human proteins.
TABLE-US-00001 TABLE 1 Structural analysis of proteins that contain
glycine rich sequences PDB sequences file Protein function Glycine
rich 1K3V Porcine Parvovirus capsid sgggggggggrgagg 1FPV Feline
Panleukopenia Virus tgsgngsgggggggsgg 1IJS CpV strain D, mutant
A300d tgsgngsgggggggsgg 1MVM Mvm (strain I) virus ggsggggsgggg
TABLE-US-00002 TABLE 2 Open reading frames encoding GRS with 300 or
more glycine residues Gly GRS Gene Accession Organism (%) length
length Predicted Function NP_974499 Arabidopsis thaliana 64 509 579
unknown ZP_00458077 Burkholderia cenocopacia 66 373 518 putative
lipoprotein XP_477841 Oryza sativa 74 371 422 unknown NP_910409
Oryza sativa 75 368 400 putative cell-wall precursor NP_610660
Drosophila melanogaster 66 322 610 transposable element
TABLE-US-00003 TABLE 3 Examples of human GRS Gly GRS Gene Hydro-
Accession (%) length length phobics Predicted Function NP_000217 62
135 622 yes keratin 9 NP_631961 61 73 592 yes TBP-associated factor
15 isoform 1 NP_476429 65 70 629 yes keratin 3 NP_000418 70 66 316
yes loricrin, cell envelope NP_056932 60 66 638 yes cytokeratin
2
TABLE-US-00004 TABLE 4 Additional examples of human GRS Number of
Accession Sequences amino acids NP_006228.
GPGGGGGPGGGGGPGGGGPGGGGGGGP 37 GGGGGGPGGG NP_787059
GAGGGGGGGGGGGGGSGGGGGGGGAGA 33 GGAGAG NP_009060
GGGSGSGGAGGGSGGGSGSGGGGGGAG 32 GGGGG NP_031393
GDGGGAGGGGGGGGSGGGGSGGGGGGG 27 NP_005850 GSGSGSGGGGGGGGGGGGSGGGGGG
25 NP_061856 GGGRGGRGGGRGGGGRGGGRGGG 22 NP_787059
GAGGGGGGGGGGGGGSGGGGGGGGAGA 33 GGAGAG NP_009060
GGGSGSGGAGGGSGGGSGSGGGGGGAG 32 GGGGG NP_031393
GDGGGAGGGGGGGGSGGGGSGGGGGGG 27 NP_115818 GSGGSGGSGGGPGPGPGGGGG 21
XP_376532 GEGGGGGGEGGGAGGGSG 18 NP_065104 GGGGGGGGDGGG 12
GGGSGSGGAGGGSGGGSGSGGGGGGAGGGGGGSSGGGSGTAGGHSG POU domain, class 4,
transcription factor 1 [Homo sapiens]
GPGGGGGPGGGGGPGGGGPGGGGGGGPGGGGGGPGGG YEATS domain containing 2
[Homo sapiens] GGSGAGGGGGGGGGGGSGSGGGGSTGGGGGTAGGG AT rich
interactive domain 1B (SWI1-like) isoform 3; BRG1-binding protein
ELD/OSA1; Eld (eyelid)/Osa protein [Homo sapiens]
GAGGGGGGGGGGGGGSGGGGGGGGAGAGGAGAG AT rich interactive domain 1B
(SWI1-like) isoform 2; BRG1-binding protein ELD/OSA1; Eld
(eyelid)/Osa protein [Homo sapiens]
GAGGGGGGGGGGGGGSGGGGGGGGAGAGGAGAG AT rich interactive domain 1B
(SWI1-like) isoform 1; BRG1-binding protein ELD/OSA1; Eld
(eyelid)/Osa protein [Homo sapiens]
GAGGGGGGGGGGGGGSGGGGGGGGAGAGGAGAG purine-rich element binding
protein A; purine-rich single-stranded DNA-binding protein alpha;
transcriptional activator protein PUR-alpha [Homo sapiens]
GHPGSGSGSGGGGGGGGGGGGSGGGGGGAPGG regulatory factor X1; trans-acting
regulatory factor 1; enhancer factor C; MHC class II regulatory
factor RFX [Homo sapiens] GGGGSGGGGGGGGGGGGGGSGSTGGGGSGAG bromo
domain-containing protein disrupted in leukemia [Homo sapiens
GGRGRGGRGRGSRGRGGGGTRGRGRGRGGRG unknown protein [Homo sapiens]
GSGGSGGSGGGPGPGPGGGGGPSGSGSGPG PREDICTED: hypothetical protein
XP_059256 [Homo sapiens] GGGGGGGGGGGRGGGGRGGGRGGGGEGGG zinc finger
protein 281; ZNP-99 transcription factor [Homo sapiens]
GGGGTGSSGGSGSGGGGSGGGGGGGSSG RNA binding protein (autoantigenic,
hnRNP- associated with lethal yellow) short isoform; RNA- binding
protein (autoantigenic); RNA-binding protein (autoantigenic,
hnRNP-associated with lethal yellow) [Homo sapiens]
GDGGGAGGGGGGGGSGGGGSGGGGGGG signal recognition particle 68kDa [Homo
sapiens] GGGGGGGSGGGGGSGGGGSGGGRGAGG KIAA0265 protein [Homo
sapiens] GGGAAGAGGGGSGAGGGSGGSGGRGTG engrailed homolog 2;
Engrailed-2 [Homo sapiens GAGGGRGGGAGGEGGASGAEGGGGAGG RNA binding
protein (autoantigenic, hnRNP- associated with lethal yellow) long
isoform; RNA- binding protein (autoantigenic); RNA-binding protein
(autoantigenic, hnRNP-associated with lethal yellow) [Homo sapiens]
GDGGGAGGGGGGGGSGGGGSGGGGGGG androgen receptor; dihydrotestosterone
receptor [Homo sapiens] GGGGGGGGGGGGGGGGGGGGGGGEAG homeo box D11;
homeo box 4F; Hox-4.6, mouse, homolog of; homeobox protein Hox-D11
[Homo sapiens] GGGGGGSAGGGSSGGGPGGGGGGAGG frizzled 8; frizzled
(Drosophila) homolog 8 [Homo sapiens] GGGGGPGGGGGGGPGGGGGPGGGGG
ocular development-associated gene [Homo sapiens]
GRGGAGSGGAGSGAAGGTGSSGGGG homeo box B3; homeo box 2G; homeobox
protein Hox-B3 [Homo sapiens] GGGGGGGGGGGSGGSGGGGGGGGGG chromosome
2 open reading frame 29 [Homo sapiens] GGSGGGRGGASGPGSGSGGPGGPAG
DKFZP564F0522 protein [Homo sapiens] GGHHGDRGGGRGGRGGRGGRGGRAG
PREDICTED: similar to Homeobox even-skipped homolog protein 2
(EVX-2) [Homo sapiens GSRGGGGGGGGGGGGGGGGAGAGGG ras homolog gene
family, member U; Ryu GTPase; Wnt-1 responsive Cdc42 homolog;
2310026M05Rik; GTP-binding protein like 1; CDC42-like GTPase [Homo
sapiens] GGRGGRGPGEPGGRGRAGGAEGRG scratch 2 protein;
transcriptional repressor scratch 2; scratch (drosophila homolog)
2, zinc finger protein [Homo sapiens] GGGGGDAGGSGDAGGAGGRAGRAG
nucleolar protein family A, member 1; GAR1 protein [Homo sapiens]
GGGRGGRGGGRGGGGRGGGRGGG keratin 1; Keratin-1; cytokeratin 1; hair
alpha protein [Homo sapiens] GGSGGGGGGSSGGRGSGGGSSGG hypothetical
protein FLJ31413 [Homo sapiens] GSGPGTGGGGSGSGGGGGGSGGG one cut
domain, family member 2; onecut 2 [Homo sapiens]
GARGGGSGGGGGGGGGGGGGGPG POU domain, class 3, transcription factor 2
[Homo sapiens] GGGGGGGGGGGGGGGGGGGGGDG PREDICTED: similar to THO
complex subunit 4 (Tho4) (RNA and export factor binding protein 1)
(REF 1-I) (Ally of AML-1 and LEF-1) (Aly/REF) [Homo sapiens]
GGTRGGTRGGTRGGDRGRGRGAG PREDICTED: similar to THO complex subunit 4
(Tho4) (RNA and export factor binding protein 1) (REF 1-I) (Ally of
AML-1 and LEF-1) (Aly/REF) [Homo sapiens] GGTRGGTRGGTRGGDRGRGRGAG
POU domain, class 3, transcription factor 3 [Homo sapiens]
GAGGGGGGGGGGGGGGAGGGGGG nucleolar protein family A, member 1; GAR1
protein [Homo sapiens] GGGRGGRGGGRGGGGRGGGRGGG fibrillarin; 34-kD
nucleolar scleroderma antigen; RNA, U3 small nucleolar interacting
protein 1 [Homo sapiens] GRGRGGGGGGGGGGGGGRGGGG zinc finger protein
579 [Homo sapiens] GRGRGRGRGRGRGRGRGRGGAG calpain, small subunit 1;
calcium-activated neutral proteinase; calpain, small polypeptide;
calpain 4, small subunit (30K); calcium-dependent protease, small
subunit [Homo sapiens] GAGGGGGGGGGGGGGGGGGGGG keratin 9 [Homo
sapiens] GGGSGGGHSGGSGGGHSGGSGG forkhead box D1; forkhead-related
activator 4; Forkhead, drosophila, homolog-like 8; forkhead
(Drosophila)-like 8 [Homo sapiens] GAGAGGGGGGGGAGGGGSAGSG
PREDICTED: similar to RIKEN cDNA C230094B15 [Homo sapiens]
GGPGTGSGGGGAGTGGGAGGPG GGGGGGGGGAGGAGGAGSAGGG cadherin 22
precursor; ortholog of rat PB-cadherin [Homo sapiens]
GGDGGGSAGGGAGGGSGGGAG AT-binding transcription factor 1; AT motif-
binding factor 1 [Homo sapiens] GGGGGGSGGGGGGGGGGGGGG eomesodermin;
t box, brain, 2; eomesodermin (Xenopus laevis) homolog [Homo
sapiens] GPGAGAGSGAGGSSGGGGGPG phosphatidylinositol transfer
protein, membrane- associated 2; PYK2 N-terminal domain-interacting
receptor 3; retinal degeneration B alpha 2 (Drosophila) [Homo
sapiens] GGGGGGGGGGGSSGGGGSSGG sperm associated antigen 8 isoform
2; sperm membrane protein 1 [Homo sapiens] GSGSGPGPGSGPGSGPGHGSG
PREDICTED: RNA binding motif protein 27 [Homo sapiens]
GPGPGPGPGPGPGPGPGPGPG AP1 gamma subunit binding protein 1 isoform
1; gamma-synergin; adaptor-related protein complex 1 gamma
subunit-binding protein 1 [Homo sapiens] GAGSGGGGAAGAGAGSAGGGG AP1
gamma subunit binding protein 1 isoform 2; gamma-synergin;
adaptor-related protein complex 1 gamma subunit-binding protein 1
[Homo sapiens] GAGSGGGGAAGAGAGSAGGGG
ankyrin repeat and sterile alpha motif domain containing 1; ankyrin
repeat and SAM domain containing 1 [Homo sapiens]
GGGGGGGSGGGGGGSGGGGGG methyl-CpG binding domain protein 2 isoform 1
[Homo sapiens] GRGRGRGRGRGRGRGRGRGRG triple functional domain
(PTPRF interacting) [Homo sapiens] GGGGGGGSGGSGGGGGSGGGG forkhead
box D3 [Homo sapiens GGEEGGASGGGPGAGSGSAGG sperm associated antigen
8 isoform 1; sperm membrane protein 1 [Homo sapiens]
GSGSGPGPGSGPGSGPGHGSG methyl-CpG binding domain protein 2 testis-
specific isoform [Homo sapiens] GRGRGRGRGRGRGRGRGRGRG cell death
regulator aven; programmed cell death 12 [Homo sapiens]
GGGGGGGGDGGGRRGRGRGRG regulator of nonsense transcripts 1; delta
helicase; up-frameshift mutation 1 homolog (S. cerevisiae);
nonsense mRNA reducing factor 1; yeast Upflp homolog [Homo sapiens]
GGPGGPGGGGAGGPGGAGAG small conductance calcium-activated potassium
channel protein 2 isoform a; apamin-sensitive small-conductance
Ca2+-activated potassium channel [Homo sapiens]
GTGGGGSTGGGGGGGGSGHG SRY (sex determining region Y)-box 1;
SRY-related HMG-box gene 1 [Homo sapiens] GPAGAGGGGGGGGGGGGGGG
transcription factor 20 isoform 2; stromelysin-1 platelet-derived
growth factor-responsive element binding protein; stromelysin 1
PDGF-responsive element-binding protein; SPRE-binding protein;
nuclear factor SPBP [Homo sapiens] GGTGGSSGSSGSGSGGGRRG
transcription factor 20 isoform 1; stromelysin-1 platelet-derived
growth factor-responsive element binding protein; stromelysin 1
PDGF-responsive element-binding protein; SPRE-binding protein;
nuclear factor SPBP [Homo sapiens] GGTGGSSGSSGSGSGGGRRG
Ras-interacting protein 1 [Homo sapiens] GSGTGTTGSSGAGGPGTPGG BMP-2
inducible kinase isoform b [Homo sapiens] GGSGGGAAGGGAGGAGAGAG
BMP-2 inducible kinase isoform a [Homo sapiens]
GGSGGGAAGGGAGGAGAGAG forkhead box C1; forkhead-related activator 3;
Forkhead, drosophila, homolog-like 7; forkhead (Drosophila)-like 7;
iridogoniodysgenesis type 1 [Homo sapiens] GSSGGGGGGAGAAGGAGGAG
splicing factor p54; arginine-rich 54 kDa nuclear protein [Homo
sapiens] GPGPSGGPGGGGGGGGGGGG v-maf musculoaponeurotic fibrosarcoma
oncogene homolog; Avian musculoaponeurotic fibrosarcoma (MAF)
protooncogene; v-maf musculoaponeurotic fibrosarcoma (avian)
oncogene homolog [Homo sapiens] GGGGGGGGGGGGGGAAGAGG small nuclear
ribonucleoprotein D1 polypeptide 16kDa; snRNP core protein D1; Sm-D
autoantigen; small nuclear ribonucleoprotein D1 polypeptide (16kD)
[Homo sapiens] GRGRGRGRGRGRGRGRGRGG hypothetical protein H41 [Homo
sapiens] GSAGGSSGAAGAAGGGAGAG
URPs Containing Non-Glycine Residues (NGR):
[0118] The sequences of non-glycine residues in these GRS can be
selected to optimize the properties of URPs and hence the proteins
that contain the desired URPs. For instance, one can optimize the
sequences of URPs to enhance the selectivity of the resulting
protein for a particular tissue, specific cell type or cell
lineage. For example, one can incorporate protein sequences that
are not ubiquitously expressed, but rather are differentially
expressed in one or more of the body tissues including heart,
liver, prostate, lung, kidney, bone marrow, blood, skin, bladder,
brain, muscles, nerves, and selected tissues that are affected by
diseases such as infectious diseases, autoimmune disease, renal,
neronal, cardiac disorders and cancers. One can employ sequences
representative of a specific developmental origin, such as those
expressed in an embryo or an adult, during ectoderm, endoderm or
mesoderm formation in a multi-cellular organism. One can also
utilize sequence involved in a specific biological process,
including but not limited to cell cycle regulation, cell
differentiation, apoptosis, chemotaxsis, cell motility and
cytoskeletal rearrangement. One can also utilize other
non-ubiquitously expressed protein sequences to direct the
resulting protein to a specific subcellular locations:
extracellular matrix, nucleus, cytoplasm, cytoskeleton, plasma
and/or intracellular membranous structures which include but are
not limited to coated pits, Golgi apparatus, endoplasmic reticulum,
endosome, lysosome, and mitochondria.
[0119] A variety of these tissue-specific, cell-type specific,
subcellular location specific sequences are known and available
from numerous protein databases. Such selective URP sequences can
be obtained by generating libraries of random or semi-random URP
sequences, injecting them into animals or patients, and determining
sequences with the desired tissue selectivity in tissue samples.
Sequence determination can be performed by mass spectrometry. Using
similar methods one can select URP sequences that facilitate oral,
buccal, intestinal, nasal, thecal, peritoneal, pulmonary, rectal,
or dermal uptake.
[0120] Of particular interest are URP sequences that contain
regions that are relatively rich in the positively charged amino
acids arginine or lysine which favor cellular uptake or transport
through membranes. URP sequences can be designed to contain one or
several protease-sensitive sequences. Such URP sequences can be
cleaved once the product of the invention has reached its target
location. This cleavage may trigger an increase in potency of the
pharmaceutically active domain (pro-drug activation) or it may
enhance binding of the cleavage product to a receptor. URP
sequences can be designed to carry excess negative charges by
introducing aspartic acid or glutamic acid residues. Of particular
interest are URP that contain great than 5%, greater than 6%, 7%,
8%, 9%, 10%, 15%, 30% or more glutamic acid and less than 2% lysine
or arginine. Such URPs carry an excess negative charge and as a
result they have a tendency to adopt open conformations due to
electrostatic repulsion between individual negative charges of the
peptide. Such an excess negative charge leads to an effective
increase in their hydrodynamic radius and as a result it can lead
to reduced kidney clearance of such molecules. Thus, one can
modulate the effective net charge and hydrodynamic radius of a URP
sequence by controlling the frequency and distribution of
negatively charged amino acids in the URP sequences. Most tissues
and surfaces in a human or animal carry excess negative charges. By
designing URP sequences to carry excess negative charges one can
minimize non-specific interactions between the resulting protein
comprising the URP and various surfaces such as blood vessels,
healthy tissues, or various receptors.
[0121] URPs may have a repetitive amino acid sequence of the format
(Motif).sub.x in which a sequence motif forms a direct repeat (ie
ABCABCABCABC) or an inverted repeat (ABCCBAABCCBA) and the number
of these repeats can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18,
20, 22, 24, 26, 28, 30, 35, 40, 50 or more. URPs or the repeats
inside URPs often contain only 1, 2, 3, 4, 5 or 6 different types
of amino acids. URPs typically consist of repeats of human amino
acid sequences that are 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36 or more amino
acids long, but URPs may also consist of non-human amino acid
sequences that are 20, 22, 24, 26, 28, 30, 32, 34 36, 38 40, 42,
44, 46, 48, 50 amino acids long.
[0122] URPs Derived from Human Sequences:
[0123] URPs can be derived from human sequences. The human genome
contains many subsequences that are rich in one particular amino
acid. Of particular interest are such amino acid sequences that are
rich in a hydrophilic amino acid like serine, threonine, glutamate,
aspartate, or glycine. Of particular interest are such subsequences
that contain few hydrophobic amino acids. Such subsequences are
predicted to be unstructured and highly soluable in aqeuous
solution. Such human subsequences can be modified to further
improve their utility. FIG. 17 shows an exemplary human sequence
that is rich in serine and that can be isolated as the subject URP.
The exemplified dentin sialophosphoprotein contains a 670-amino
acid subsequence in which 64% of the residues are serine and most
other positions are hydrophilic amino acids such as aspartate,
asparagines, and glutamate. The sequence is extremely repetitive
and as a result it has a low information content. One can directly
use subsequences of such a human protein. Where desired, one can
modify the sequence in a way that preserves its overall character
but which makes it more suitable for pharmaceutical applications.
Examples of sequences that are related to dentin
sialophosphoprotein are (SSD).sub.n, (SSDSSN).sub.n, (SSE).sub.n,
where n is between about 4 and 200.
[0124] The use of sequences from human proteins is particularly
desirable in design of URPs with reduced immunogenicity in a human
subject. A key step for eliciting an immune response to a foreign
protein is the presentation of peptide fragments of said protein by
MHC class II receptors. These MHCII-bound fragments can then be
detected by T cell receptors, which triggers the proliferation of T
helper cells and initiates an immune response. The elimination of T
cell epitopes from pharmaceutical proteins has been recognized as a
means to reduce the risk of eliciting an immune reaction (Stickler,
M., et al. (2003) J Immunol Methods, 281: 95-108). MHCII receptors
typically interact with an epitope having e.g., a 9-amino acid long
region of the displayed peptides. Thus, one can reduce the risk of
eliciting an immune response to a protein in patients if all or
most of the possible 9mer subsequences of the protein can be found
in human proteins and if so, these sequences and repeats of these
sequences will not be recognized by the patient as foreign
sequences. One can incorporate human sequences into the design of
URP sequences by oligomerizing or concatenating human sequences
that have suitable amino acid compositions. These can be direct
repeats or inverted repeats or mixtures of different repeats. For
instance one can oligomerize the sequences shown in table 2. Such
oligomers have reduced risk of being immunogenic. However, the
junction sequences between the monomer units can still contain T
cell epitopes that can trigger an immune reaction, which is
illustrated in FIG. 3. One can further reduce the risk of eliciting
an immune response by designing URP sequences based on multiple
overlapping human sequences. This approach is illustrated in FIG.
4. The URP sequence in FIG. 2 designed as an oligomer based on
multiple human sequences such that each 9mer subsequences of the
oligomer can be found in a human protein. In these designs, every
9-mer subsequence is a human sequence. An example of a URP sequence
based on three human sequences is shown in FIG. 5. It is also
possible to design URP sequences based on a single human sequences
such that all possible 9mer subsequences in the oligomeric URP
sequences occur in the same human protein. An example is shown in
FIG. 6 based on the POU domain that is rich in glycine and proline.
The repeating monomer in the URP sequence is only a fragment of the
human protein and its flanking sequences is identical to the
repeating unit as illustrated in FIG. 6. Non-oligomeric URP
sequences can be designed based on human proteins as well. The
primary conditions are that all 9mer sub-sequences can be found in
human sequences. The amino acid composition of the sequences
preferably contains few hydrophobic residues. Of particular
interest are URP sequences that are designed based on human
sequences and that contain a large fraction of glycine
residues.
[0125] Utilizing this or similar scheme, one can design a class of
URPs that comprise repeat sequences with low immunogenicity to the
host of interest. Host of interest can be any animals, including
vertebrates and invertebrates. Preferred hosts are mammals such as
primates (e.g. chimpanzees and humans), cetaceans (e.g. whales and
dolphins), chiropterans (e.g. bats), perrisodactyls (e.g. horses
and rhinoceroses), rodents (e.g. rats), and certain kinds of
insectivores such as shrews, moles and hedgehogs. Where human is
selected as the host, the URPs typically contain multiple copies of
the repeat sequences or units, wherein the majority of segments
comprising about 6 to about 15 contiguous amino acids are present
in one or more native human proteins. One can also design URPs in
which the majority of segments comprising between about 9 to about
15 contiguous amino acids are found in one or more native human
proteins. As used herein, majority of the segments refers to more
than about 50%, preferably 60%, preferably 70%, preferably 80%,
preferably 90%, preferably 100%. Where desired, each of the
possible segments between about 6 to 15 amino acids, preferably
between about 9 to 15 amino acids within the repeating units are
present in one or more native human proteins. The URPs can comprise
multiple repeating units or sequences, for example having 2, 3, 4,
5, 6, 7, 8, 9, 10, or more repeating units.
[0126] Design of URPs that are Substantially Free of Human T-Cell
Epitopes:
[0127] URP sequences can be designed to be substantially free of
epitopes recognized by human T cells. For instance, one can
synthesize a series of semi-random sequences with amino acid
compositions that favor denatured, unstructured conformations and
evaluate these sequences for the presence of human T cell epitopes
and whether they are human sequences. Assays for human T cell
epitopes have been described (Stickler, M., et al. (2003) J Immunol
Methods, 281: 95-108). Of particular interest are peptide sequences
that can be oligomerized without generating T cell epitopes or
non-human sequences. This can be achieved by testing direct repeats
of these sequences for the presence of T-cell epitopes and for the
occurrence of 6 to 15-mer and in particular 9-mer subsequences that
are not human. An alternative is to evaluate multiple peptide
sequences that can be assembled into repeating units as described
in the previous section for the assembly of human sequences.
Another alternative is to design URP sequences that result in low
scores using epitope prediction algorithms like TEPITOPE
(Sturniolo, T., et al. (1999) Nat Biotechnol, 17: 555-61). Another
approach to avoiding T-cell epitopes is to avoid amino acids that
can serve as anchor residues during peptide display on MHC, such as
M, I, L, V, F. Hydrophobic amino acids and positively charged amino
acids can frequently serve as such anchor residues and minimizing
their frequency in a URP sequences reduces the chance of generating
T-cell epitopes and thus eliciting an immune reaction. The selected
URPs generally contain subsequences that are found in at least one
human protein, and have a lower content of hydrophobic amino
acids.
[0128] URP sequences can be designed to optimize protein
production. This can be achieved by avoiding or minimizing
repetitiveness of the encoding DNA. URP sequences such as
poly-glycine may have very desirable pharmaceutical properties but
their manufacturing can be difficult due to the high GC-content of
DNA sequences encoding for GRS and due to the presence of repeating
DNA sequences that can lead to recombination.
[0129] As noted above, URP sequences can be designed to be highly
repetitive at the amino acid level. As a result the URP sequences
have very low information content and the risk of eliciting an
immune reaction can be reduced.
[0130] Non-limiting examples of URPs containing repeating amino
acids are: poly-glycine, poly-glutamic acid, poly-aspartic acid,
poly-serine, poly-threonine, (GX).sub.n where G is glycine and X is
serine, aspartic acid, glutamic acid, threonine, or proline and n
is at least 20, (GGX).sub.n where X is serine, aspartic acid,
glutamic acid, threonine, or proline and n is at least 13,
(GGGX).sub.n where X is serine, aspartic acid, glutamic acid,
threonine, or proline and n is at least 10, (GGGGX).sub.n where X
is serine, aspartic acid, glutamic acid, threonine, or proline and
n is at least 8, (G.sub.2X).sub.n where X is serine, aspartic acid,
glutamic acid, threonine, or proline, n is at least 15, and z is
between 1 and 20.
[0131] The number of these repeats can be any number between 10 and
100. Products of the invention may contain URP sequences that are
semi-random sequences. Examples are semi-random sequences
containing at least 30, 40, 50, 60 or 70% glycine in which the
glycines are well dispersed and in which the total concentration of
tryptophan, phenylalanine, tyrosine, valine, leucine, and
isoleucine is less then 70, 60, 50, 40, 30, 20, or 10% when
combined. A preferred semi-random URP sequence contains at least
40% glycine and the total concentration of tryptophan,
phenylalanine, tyrosine, valine, leucine, and isoleucine is less
then 10%. A more preferred random URP sequence contains at least
50% glycine and the total concentration of tryptophan,
phenylalanine, tyrosine, valine, leucine, and isoleucine is less
then 5%. URP sequences can be designed by combining the sequences
of two or more shorter URP sequences or fragments of URP sequences.
Such a combination allows one to better modulate the pharmaceutical
properties of the product containing the URP sequences and it
allows one to reduce the repetitiveness of the DNA sequences
encoding the URP sequences, which can improve expression and reduce
recombination of the URP encoding sequences.
[0132] URP sequences can be designed and selected to possess
several of the following desired properties: a) high genetic
stability of the coding sequences in the production host, b) high
level of expression, c) low (predicted/calculated) immunogenicity,
d) high stability in presence of serum proteases and/or other
tissue proteases, e) large hydrodynamic radius under physiological
conditions. One exemplary approach to obtain URP sequences that
meet multiple criteria is to construct a library of candidate
sequences and to identify from the library the suitable
subsequences. Libraries can comprise random and/or semi-random
sequences. Of particular utility are codon libraries, which is a
library of DNA molecules that contains multiple codons for the
identical amino acid residue. Codon randomization can be applied to
selected amino acid positions of a certain type or to most or all
positions. True codon libraries encode only a single amino acid
sequence, but they can easily be combined with amino acid
libraries, which is a population of DNA molecules encoding a
mixture of (related or unrelated) amino acids at the same residue
position. Codon libraries allow the identification of genes that
have relatively low repetitiveness at the DNA level but that encode
highly repetitive amino acid sequences. This is useful because
repetitive DNA sequences tend to recombine, leading to instability.
One can also construct codon libraries that encode limited amino
acid diversity. Such libraries allow introduction of a limited
number of amino acids in some positions of the sequence while other
positions allow for codon variation but all codons encode the same
amino acid. One can synthesize partially random oligonucleotides by
incorporating mixtures of nucleotides at the same position during
oligonucleotide synthesis. Such partially random oligonucleotides
can be fused by overlap PCR or ligation-based approaches. In
particular, one can multimerize semi-random oligonucleotides that
encode glycine-rich sequences. These oligonucleotides can differ in
length and sequences and codon usage. As a result, one obtains a
library of candidate URP sequences. Another method to generate
libraries is to synthesize a starting sequence and subsequently
subject said sequence to partial randomization. This can be done by
cultivation of the gene encoding the URP sequences in a mutator
strain or by amplification of the encoding gene under mutagenic
conditions (Leung, D., et al. (1989) Technique, 1: 11-15). URP
sequences with desirable properties can be identified from
libraries using a variety of methods. Sequences that have a high
degree of genetic stability can be enriched by cultivating the
library in a production host. Sequences that are unstable will
accumulate mutations, which can be identified by DNA sequencing.
Variants of URP sequences that can be expressed at high level can
be identified by screening or selection using multiple protocols
known to someone skilled in the art. For instance one can cultivate
multiple isolates from a library and compare expression levels.
Expression levels can be measured by gel analysis, analytical
chromatography, or various ELISA-based methods. The determination
of expression levels of individual sequence variants can be
facilitated by fusing the library of candidate URP sequences to
sequence tags like myc-tag, His-tag, HA-tag. Another approach is to
fuse the library to an enzyme or other reporter protein like green
fluorescent protein. Of particular interest is the fusion of the
library to a selectable marker like beta-lactamase or
kanamycin-acyl transferase. One can use antibiotic selection to
enrich for variants with high level of expression and good genetic
stability. Variants with good protease resistance can be identified
by screening for intact sequences after incubation with proteases.
An effective way to identify protease-resistant URP sequences is
bacterial phage display or related display methods. Multiple
systems have been described where sequences that undergo rapid
proteolysis can be enriched by phage display. These methods can be
easily adopted to enrich for protease resistant sequences. For
example, one can clone a library of candidate URP sequences between
an affinity tag and the pIII protein of M13 phage. The library can
then be exposed to proteases or protease-containing biological
samples like blood or lysosomal preparations. Phage that contain
protease-resistant sequences can be captured after protease
treatment by binding to the affinity tag. Sequences that resist
degradation by lysosomal preparations are of particular interest
because lysosomal degradation is a key step during antigen
presentation in dendritic and other antigen presenting cells. Phage
display can be utilized to identify candidate URP sequences that do
not bind to a particular immune serum in order to identify URP
sequences with low immunogenicity. One can immunize animals with a
candidate URP sequence or with a library of URP sequences to raise
antibodies against the URP sequences in the library. The resulting
serum can then be used for phage panning to remove or identify
sequences that are recognized by antibodies in the resulting immune
serum. Other methods like bacterial display, yeast display,
ribosomal display can be utilized to identify variants of URP
sequences with desirable properties. Another approach is the
identification of URP sequences of interest by mass spectrometry.
For instance, one can incubate a library of candidate URP sequences
with a protease or biological sample of interest and identify
sequences that resist degradation by mass spectrometry. In a
similar approach one can identify URP sequences that facilitate
oral uptake. One can feed a mixture of candidate URP sequences to
animals or humans and identify variants with the highest transfer
or uptake efficiency across some tissue barrier (ie dermal, etc) by
mass spectrometry. In a similar way, one can identify URP sequences
that favor other uptake mechanisms like pulmonary, intranasal,
rectal, transdermal delivery. One can also identify URP sequences
that favor cellular uptake or URP sequences that resist cellular
uptake.
[0133] URP sequences can be designed by combining URP sequences or
fragments of URP sequences that were designed by any of the methods
described above. In addition, one can apply semi-random approaches
to optimize sequences that were designed based on the rules
described above. Of particular interest is codon optimization with
the goal of improving expression of the enhanced proteins and to
improve the genetic stability of the encoding gene in the
production hosts. Codon optimization is of particular importance
for URP sequences that are rich in glycine or that have very
repetitive amino acid sequences. Codon optimization can be
performed using computer programs (Gustafsson, C., et al. (2004)
Trends Biotechnol, 22: 346-53), some of which minimize ribosomal
pausing (Coda Genomics Inc.). When designing URP sequences one can
consider a number of properties. One can minimize the
repetitiveness in the encoding DNA sequences. In addition, one can
avoid or minimize the use of codons that are rarely used by the
production host (ie the AGG and AGA arginine codons and one Leucine
codon in E. coli) DNA sequences that have a high level of glycine
tend to have a high GC content that can lead to instability or low
expression levels. Thus, when possible it is preferred to choose
codons such that the GC-content of URP-encoding sequence is
suitable for the production organism that will be used to
manufacture the URP.
[0134] URP encoding genes can be made in one or more steps, either
fully synthetically or by synthesis combined with enzymatic
processes, such as restriction enzyme-mediated cloning, PCR and
overlap extension. URP modules can be constructed such that the URP
module-encoding gene has low repetitiveness while the encoded amino
acid sequence has a high degree of repetitiveness. The approach is
illustrated in FIG. 11. As a first step, one constructs a library
of relatively short URP sequences. This can be a pure codon library
such that each library member has the same amino acid sequence but
many different coding sequences are possible. To facilitate the
identification of well-expressing library members one can construct
the library as fusion to a reporter protein. Examples of suitable
reporter genes are green fluorescent protein, luciferace, alkaline
phosphatase; beta-galactosidase. By screening one can identify
short URP sequences that can be expressed in high concentration in
the host organism of choice. Subsequently, one can generate a
library of random URP dimers and repeat the screen for high level
of expression. Dimerization can be performed by ligation, overlap
extension or similar cloning techniques. This process of
dimerization and subsequent screening can be repeated multiple
times until the resulting URP sequence has reached the desired
length. Optionally, one can sequence clones in the library to
eliminate isolates that contain undesirable sequences. The initial
library of short URP sequences can allow some variation in amino
acid sequence. For instance one can randomize some codons such that
a number of hydrophilic amino acids can occur in said position.
During the process of iterative multimerization one can screen
library members for other characteristics like solubility or
protease resistance in addition to a screen for high-level
expression. Instead of dimerizing URP sequences one can also
generate longer multimers. This allows one to faster increase the
length of URP modules.
[0135] Many URP sequences contain particular amino acids at high
fraction. Such sequences can be difficult to produce by recombinant
techniques as their coding genes can contain repetitive sequences
that are subject to recombination. Furthermore, genes that contain
particular codons at very high frequencies can limit expression as
the respective loaded tRNAs in the production host become limiting.
An example is the recombinant production of GRS. Glycine residues
are encoded by 4 triplets, GGG, GGC, GGA, and GGT. As a result,
genes encoding GRS tend to have high GC-content and tend to be
particularly repetitive. An additional challenge can result from
codon bias of the production host. In the case of E. coli, two
glycine codons, GGA and GGG, are rarely used in highly expressed
proteins. Thus codon optimization of the gene encoding URP
sequences can be very desirable. One can optimize codon usage by
employing computer programs that consider codon bias of the
production host (Gustafsson, C., et al. (2004) Trends Biotechnol,
22: 346-53). As an alternative, one can construct codon libraries
where all members of the library encode the same amino acid
sequence but where codon usage is varied. Such libraries can be
screened for highly expressing and genetically stable members which
are particularly suitable for the large-scale production of
URP-containing products.
Multivalent Unstructured Recombinant Proteins (MURPs):
[0136] As noted above, the subject URPs are particularly useful as
modules for design of proteins of therapeutic value. Accordingly,
the present invention provides proteins comprising one or more
subject URPs. Such proteins are termed herein Multivalent
Unstructured Recombinant Proteins (MURPs).
[0137] To construct MURPs, one or more URP sequences can be fused
to the N-terminus or C-terminus of a protein or inserted in the
middle of the protein, e.g., into loops of a protein or in between
modules of the protein of interest, to give the resulting modified
protein improved properties relative to the unmodified protein. The
combined length of URP sequences that are attached to a protein can
be 40, 50, 60, 70, 80, 90, 100, 150, 200 or more amino acids.
[0138] The subject MURPs exhibit one or more improved properties as
detailed below.
[0139] Improved Half-Life:
[0140] Adding a URP sequences to a pharmaceutically active protein
can improve many properties of that protein. In particular, adding
a long URP sequence can significantly increase the serum half-life
of the protein. Such URPs typically contain amino acid sequences of
at least about 40, 50, 60, 70, 80, 90, 100, 150, 200 or more amino
acids.
[0141] The URPs can be fragmented such that the resulting protein
contains multiple URPs, or multiple fragments of URPs. Some or all
of these individual URP sequences may be shorter that 40 amino
acids as long as the combined length of all URP sequences in the
resulting protein is at least 30 amino acids. Preferably, the
resulting protein has a combined length of URP sequences exceeding
40, 50, 60, 70, 80, 90, 100, 150, 200 or more amino acids. In one
aspect, the fused URPS can increase the hydrodynamic radius of a
protein and thus reduces its clearance from the blood by the
kidney. The increase in the hydrodynamic radius of the resulting
fusion protein relative to the unmodified protein can be detected
by ultracentrifugation, size exclusion chromatography, or light
scattering.
[0142] Improved Tissue Selectivity:
[0143] Increasing the hydrodynamic radius can also lead to reduced
penetration into tissues, which can be exploited to minimize side
effects of a pharmaceutically active protein. It is well documented
that hydrophilic polymers have a tendency to accumulate selectively
in tumor tissue which is caused by the enhanced permeability and
retention (EPR) effect. The underlying cause of the EPR effect is
the leaky nature of tumor vasculature (McDonald, D. M., et al.
(2002) Cancer Res, 62: 5381-5) and the lack of lymphatic drainage
in tumor tissues. Therefore, the selectivity of pharmaceutically
active proteins for tumor tissues can be enhanced by adding
hydrophilic polymers. As such, the therapeutic index of a given
pharmaceutically active protein can be increased via incorporating
the subject URPS.
[0144] Protection from Degradation and Reduced Immunogenicity:
[0145] Adding URP sequences can significantly improve the protease
resistance of a protein. URP sequences themselves can be designed
to be protease resistant and by attaching them to a protein one can
shield that protein from the access of degrading enzymes. URP
sequences can be added to pharmaceutically active proteins with the
goal of reducing undesirable interactions of the protein with other
receptors or surfaces. To achieve this, it can be beneficial to add
the URP sequences to the pharmaceutically active protein in
proximity to the site of the protein that makes such undesirable
contacts. In particular, one can add URP sequences to
pharmaceutically active proteins with the goal of reducing their
interactions with any component of the immune system to prevent an
immune response against the product of the invention. Adding a URP
sequence to a pharmaceutically active protein can reduce
interaction with pre-existing antibodies or B-cell receptors.
Furthermore, the addition of URP sequences can reduce the uptake
and processing of the product of the invention by antigen
presenting cells. Adding one or more URP sequence to a protein is a
preferred way of reducing its immunogenicity as it will suppress an
immune response in many species allowing one to predict the
expected immunogenicity of a product in patients based on animal
data. Such species independent testing of immunogenicity is not
possible for approaches that are based on the identification and
removal of human T cell epitopes or sequences comparison with human
sequences.
[0146] Interruption of T Cell Epitopes:
[0147] URP sequences can be introduced into proteins in order to
interrupt T cell epitopes. This is particularly useful for proteins
that combine multiple separate functional modules. The formation of
T cell epitopes requires that peptide fragments of a protein
antigen bind to MHC. MHC molecules interact with a short segment of
amino acids typically 9 contiguous residues of the presented
peptides. The direct fusion of different binding modules in a
protein molecule can lead to T cell epitopes that span two
neighboring domains. By separating the functional modules by URP
modules prevents the generation of such module-spanning T cell
epitopes as illustrated in FIG. 7. The insertion of URP sequences
between functional modules can also interfere with proteolytic
processing in antigen presenting cells, which will lead to an
additional reduction of immunogenicity. Another approach to reduce
the risk of immunogenicity is to disrupt T cell epitopes within
functional modules of a product. In the case of microproteins, one
approach is to have some of the intercysteine loops (those that are
not involved in target binding) be glycine-rich. In microproteins,
whose structure is due to a small number of cysteines, one could in
fact replace most or all of the residues that are not involved in
target binding with glycine, serine, glutamate, threonine, thus
reducing the potential for immunogenicity while not affecting the
affinity for the target. For instance, this can be carried out by
performing a `glycine-scan` of all residues, in which each residue
is replaced by a glycine, then selecting the clones which retain
target binding using phage display or screening, and then combining
all of the glycine substitutions that are permitted. In general,
functional modules have a much higher probability to contain T cell
epitopes than URP modules. One can reduce the frequency of T cell
epitopes in functional modules by replacing all or many
non-critical amino acid residues with small hydrophilic residues
like gly, ser, ala, glu, asp, asn, gln, thr. Positions in a
functional module that allow replacement can be identified using a
variety of random or structure based protein engineering
approaches.
[0148] Improved Solubility:
[0149] Functional modules of a protein can have limited solubility.
In particular, binding modules tend to carry hydrophobic residues
on their surface, which can limit their solubility and can lead to
aggregation. By spacing or flanking such functional modules with
URP modules one can improve the overall solubility of the resulting
product. This is in particular true for URP modules that carry a
significant percentage of hydrophilic or charged residues. By
separating functional modules with soluble URP modules one can
reduce intramolecular interactions between these functional
modules
[0150] Improved pH Profile and Homogeneity of Product Charge:
[0151] URP sequences can be designed to carry an excess of negative
or positive charges. As a result they confer an electrostatic field
to any fusion partner which can be utilized to shift the pH profile
of an enzyme or a binding interaction. Furthermore, the
electrostatic field of a charged URP sequence can increase the
homogeneity of pKa values of surface charges of a protein product,
which leads to sharpened pH profiles of ligand interactions and to
sharpened separations by isoelectric focusing or
chromatofocusing.
[0152] Improved Purification Properties Due to Sharper Product
pKa:
[0153] Each amino acid in solution by itself has a single, fixed
pKa, which is the pH at which its functional groups are half
protonated. In a typical protein you have many types of residues
and due to proximity and protein breathing effects, they also
change each other's effective pKa in variable ways. Because of
this, at a wide range of pH conditions, typical proteins can adopt
hundreds of differently ionized species, each with a different
molecular weight and net charge, due to large numbers of
combinations of charged and neutral amino acid residues. This is
referred to as a broad ionization spectrum and makes the analysis
(ie Mass Spec) and purification of such proteins more
difficult.
[0154] PEG is uncharged and does not affect the ionization spectrum
of the protein it is attached to, leaving it with a broad
ionization spectrum. However, a URP with a high content of Gly and
Glu in principle exist in only two states: neutral (--COOH) when
the pH is below the pKa of Glutamate and negatively charged
(--COO.sup.-) when the pH is above the pKa of Glutamate. URP
modules can form a single, homogeneously ionizated type of molecule
and can yield a single mass in mass spectrometry.
[0155] Where desired, MURPs can be expressed as a fusion with an
URP having a single type of charge (Glu) distributed at constant
spacing through the URP module. One may choose to incorporate 25-50
Glu residues per 20 kD of URP and all of these 25-50 residues would
have very similar pKa.
[0156] In addition, adding 25-50 negative charges to a small
protein like IFN, hGH or GCSF (with only 20 charged residues) will
increase the charge homogeneity of the product and sharpen its
isoelectric point, which will be very close to the pKa of free
glutamate.
[0157] The increase in the homogeneity of the charge of the protein
population has favorable processing properties, such as in ion
exchange, isoelectric focusing, mass spec, etc. compared to
traditional PEGylation.
[0158] Improved Formulation and/or Delivery:
[0159] Addition of URP sequences to pharmaceutically active
proteins can significantly simplify the formulation and or the
delivery of the resulting products. URP sequences can be designed
to be very hydrophilic and as a result they improve the solubility
of (for example) human proteins, which often contain hydrophobic
patches that they use to bind to other human proteins. The
formulation of such human proteins, like antibodies, can be quite
challenging and often limits their concentration and delivery
options. URPs can reduce product precipitation and aggregation and
it allows one to use simpler formulations containing fewer
ingredients, that are typically needed to stabilize a product in
solution. The improved solubility of URP sequences-containing
products allows to formulate these products at higher concentration
and as a result one can reduce the injection volume for injectable
products, which may enable home injection, which is limited to a
very low injected volume. Addition of a URP sequence can also
simplify the storage of the resulting formulated products. URP
sequences can be added to pharmaceutically active proteins to
facilitate their oral, pulmonary, rectal, or intranasal uptake. URP
sequences can facilitate various modes of delivery because they
allow higher product concentrations and improved product stability.
Additional improvements can be achieved by designing URP sequences
that facilitate membrane penetration.
[0160] Improved Production:
[0161] Adding URP sequences can have significant benefits for the
production of the resulting product. Many recombinant products,
especially native human proteins, have a tendency to form
aggregates during production that can be difficult or impossible to
dissolve and even when removed from the final product they may
re-occur. These are usually due to hydrophobic patches by which
these (native human) proteins contacted other (native human)
proteins and mutating these residues is considered risky because of
immunogenicity. However, URPs can increase the hydrophilicity of
such proteins and enable their formulation without mutating the
sequence of the human protein. URP sequences can facilitate the
folding of a protein to reach its native state. Many
pharmaceutically active proteins are produced by recombinant
methods in a non-native aggregated state. These products need to be
denatured and subsequently they are incubated under conditions that
allow the proteins to fold into their native active state. A
frequent side reaction during renaturation is the formation of
aggregates. The fusion of URP sequences to a protein significantly
reduces its tendency to form aggregates and thus it facilitates the
folding of the pharmaceutically active component of the product.
URP-containing products are much easier to prepare as compared to
polymer-modified proteins. Chemical polymer-modification requires
extra modification and purification steps after the active protein
has been purified. In contrast, URP sequences can be manufactured
using recombinant DNA methods together with the pharmaceutically
active protein. The products of the invention are also
significantly easier to characterize compared to polymer-modified
products. Due to the recombinant production process one can obtain
more homogeneous products with defined molecular characteristics.
URP sequences can also facilitate the purification of a product.
For instance URP sequences can include subsequences that can be
captured by affinity chromatography. An example are sequences rich
in histidine, which can be captured on resins with immobilized
metals like nickel. URP sequences can also be designed to have an
excess of negatively or positively charged amino acids. As a result
they can significantly impact the net charge of a product, which
can facilitate product purification by ion-exchange chromatography
or preparative electrophoresis.
[0162] The subject MURPs can contain a variety of modules,
including but not limited to binding modules, effector modules,
multimerization modules, C-terminal modules, and N-terminal
modules. FIG. 1 depicts an exemplary MURP having multiple modules.
However, MURPs can also have relatively simple architectures that
are illustrated in FIG. 2. MURPs can also contain fragmentation
sites. These can be protease-sensitive sequences or chemically
sensitive sequences that can be preferentially cleaved when the
MURPs reach their target site.
[0163] Binding Module (BM):
[0164] The MURPs of the present invention may comprise one or more
binding modules. Binding module (BM) refers to a peptide or protein
sequence that can bind specifically to one or several targets,
which may be one or more therapeutic targets or accessory targets,
such as for cell-, tissue- or organ targeting. BMs can be linear or
cyclic peptides, cysteine-constrained peptides, microproteins,
scaffold proteins (e.g., fibronectin, ankyrins, crystalline,
streptavidin, antibody fragments, domain antibodies), peptidic
hormones, growth factors, cytokines, or any type of protein domain,
human or non-human, natural or non-natural, and they may be based
on a natural scaffold or not based on a natural scaffold, or based
on combinations or they may be fragments of any of the above.
Optionally, these BMs can be engineered by adding, removing or
replacing one or multiple amino acids in order to enhance their
binding properties, their stability, or other properties. Binding
modules can be obtained from natural proteins, by design or by
genetic package display, including phage display, cellular display,
ribosomal display or other display methods. Binding modules may
bind to the same copy of the same target, which results in avidity,
or they may bind to different copies of the same target (which can
result in avidity if these copies are somehow connected or linked,
such as by a cell membrane), or they may bind to two unrelated
targets (which yields avidity if these targets are somehow linked,
such as by a membrane). Binding modules can be identified by
screening or otherwise analyzing random libraries of peptides or
proteins.
[0165] Particularly desirable binding modules are those that upon
incorporation into a MURP, the MURP yield a desirable Tepitope
score. The Tepitope score of a protein is the log of the Kd
(dissociation constant, affinity, off-rate) of the binding of that
protein to multiple of the most common human MHC alleles, as
disclosed in Sturniolo, T. et al. (1999) Nature Biotechnology
17:555). The score ranges over at least 15 logs, from about 10, 9,
8, 7, 6, 5, 4, 3, 2, 1, 0, -1, -2, -3, -4, -5 (10e.sup.10 Kd) to
about -5. Preferred MURPs yield a score less than about -3.5 [KKW:
On absolute scale?]
[0166] Of particular interest are also binding modules comprising
disulfide bonds formed by pairing two cysteine residues. In certain
embodiments, the binding modules comprise polypeptides having high
cysteine content or high disulfide density (HDD). Binding modules
of the HDD family typically have 5-50% (5, 6, 7, 8, 9, 10, 12, 14,
16, 18, 20, 25, 30, 35, 40, 45 or 50%) cysteine residues and each
domain typically contains at least two disulfides and optionally a
co-factor such as calcium or another ion.
[0167] The presence of HDD scaffold allows these modules to be
small but still adopt a relatively rigid structure. Rigidity is
important to obtain high binding affinities, resistance to
proteases and heat, including the proteases involved in antigen
processing, and thus contributes to the low or non-immunogenicity
of these modules. The disulfide framework folds the modules without
the need for a large number of hydrophobic side chain interactions
in the interior of most modules. The small size is also
advantageous for fast tissue penetration and for alternative
delivery such as oral, nasal, intestinal, pulmonary,
blood-brain-barrier, etc. In addition, the small size also helps to
reduce immunogenicity. A higher disulfide density is obtainable,
either by increasing the number of disulfides or by using domains
with the same number of disulfides but fewer amino acids. It is
also desirable to decrease the number of non-cysteine fixed
residues, so that a higher percentage of amino acids is available
for target binding.
[0168] The cysteine-containing binding modules can adopt a wide
range of disulfide bonding patterns (DBPs). For example,
two-disulfide modules can have three different disulfide bonding
patterns (DBPs), three-disulfide modules can have 15 different DBPs
and four-disulfide modules have up to 105 different DBPs. Natural
examples exist for all of the 2SS DBPs, the majority of the 3SS
DBPs and less than half of the 4SS DBPs. In one aspect, the total
number of disulfide bonding patterns can be calculated according to
the formula:
i = 1 n 2 i - 1 , ##EQU00001##
wherein n=the predicted number of disulfide bonds formed by the
cysteine residues, and wherein .PI. represents the product of
(2i-1), where i is a positive integer ranging from 1 up to n.
[0169] Accordingly, in one embodiment, the modules used in MURPs
are natural or non-naturally occurring cysteine (C)-containing
scaffold exhibiting a binding specificity towards a target
molecule, wherein the non-naturally occurring cysteine
(C)-containing scaffold comprise intra-scaffold cysteines according
to a pattern selected from the group of permutations represented by
the formula
i = 1 n 2 i - 1 , ##EQU00002##
wherein n equals to the predicted number of disulfide bonds formed
by the cysteine residues, and wherein .PI. represents the product
of (2i-1), where i is a positive integer ranging from 1 up to n. In
one aspect, the natural or non-naturally occurring cysteine
(C)-containing module comprises a polypeptide having two disulfide
bonds formed by pairing cysteines contained in the polypeptide
according to a pattern selected from the group consisting of
C.sup.1-2, 3-4, C.sup.1-3, 2-4, and C.sup.1-4, 2-3, wherein the two
numerical numbers linked by a hyphen indicate which two cysteines
counting from N-terminus of the polypeptide are paired to form a
disulfide bond. In another aspect, the natural or non-naturally
occurring cysteine (C)-containing module comprises a polypeptide
having three disulfide bonds formed by pairing intra-scaffold
cysteines according to a pattern selected from the group consisting
of C.sup.1-2, 3-4, 5-6, C.sup.1-2, 3-5, 4-6, C.sup.1-2, 3-6, 4-5,
C.sup.1-3, 2-4, 5-6, C.sup.1-3, 2-5, 4-6, C.sup.1-3, 2-6, 4-5,
C.sup.1-4, 2-3, 5-6, C.sup.1-4, 2-6, 3-5, C.sup.1-5, 2-3, 4-6,
C.sup.1-5, 2-4, 3-6, C.sup.1-5, 2-6, 3-4, C.sup.1-6, 2-3, 4-5, and
C.sup.1-6, 2-5, 3-4, wherein the two numerical numbers linked by a
hyphen indicate which two cysteines counting from N-terminus of the
polypeptide are paired to form a disulfide bond. In yet another
aspect, the natural or non-naturally occurring cysteine
(C)-containing module comprises a polypeptide having at least four
disulfide bonds formed by pairing cysteines contained in the
polypeptide according to a pattern selected from the group of
permutations defined by the formula above. In yet another aspect,
the natural or non-naturally occurring cysteine (C)-containing
module comprises a polypeptide having at least five, six, or more
disulfide bonds formed by pairing intra-protein cysteines according
to a pattern selected from the group of permutations represented by
the formula above. Any of the cysteine-containing proteins or
scaffolds disclosed in the co-pending application Ser. Nos.
11/528,927 and 11/528,950, which are incorporated herein by
reference in their entiety] are candidate binding modules.
[0170] Binding modules can also be selected from libraries of
cysteine-constrained cyclic peptides with 4, 5, 6, 7, 8, 9, 10, 11
and 12 randomized or partially randomized amino acids between the
disulfide-bonded cystines (e.g., in a build-up manner), and in some
cases additional randomized amino acids on the outside of the
cystine pair can be constructed using a variety of methods. Library
members with specificity for a target of interest can be identified
using various methods including phage display, ribosomal display,
yeast display and other methods known in the art. Such cyclic
peptides can be utilized as binding modules in MURPs. In a
preferred embodiment one can further engineer cysteine-constrained
peptides to increase there binding affinity, proteolytic stability,
and/or specificity using buildup approaches that lead to binding
modules containing more than one disulfide bond. One particular
buildup approach is illustrated in FIG. 25. It is based on the
addition of a single cysteine plus multiple randomized residues on
the N-terminal side of the previously selected cyclic peptide, as
well as on the C-terminal side. One can generate libraries that
have been designed as illustrated in FIG. 25. Binding modules with
improved properties can be identified by phage display or similar
methods. Such buildup libraries can contain between 1 and 12 random
positions on the N-terminal as well as on the C-terminal side of a
cyclic peptide. The distance between the cysteine residues in the
newly added random flanks and the cysteine residues in the cyclic
peptide can be varied between 1 and 12 residues. Such libraries
will contain four cysteine residues per library member, with two
cysteines resulting from the original cyclic peptide and two
cysteine residues in the newly added flanks. This approach favors a
1-4 2-3 DBP or a change in DBP, breaking up the preexisting 1-2
disulfide (=2-3 in the 4-cysteine construct) to form a 1-2 3-4 or a
1-3 2-4 DBP. Such buildup approaches can be performed with
clone-specific primers so that it leaves no fixed sequence between
the library areas as shown in FIG. 25, or it can be performed with
primers that use (and thus leave) a fixed sequence on both sides of
the previously selected peptide and therefore these same primers
can be used for any previously selected clone as illustrated in
FIG. 26. The method illustrated in FIG. 26 can be applied to a
collection of cyclic peptides with specificity for a target of
interest. Both buildup approaches were shown to work for anti-VEGF
affinity maturation by build-up. This approach can be repeated to
generate binding modules with six or more cysteine residues.
[0171] Another buildup of a one-disulfide into a 2-disulfide
sequence is illustrated in FIG. 27. It involves the dimerization of
a previously selected pool of 1-disulfide peptides with itself so
that the preselected peptide pool ends up in the N-terminal as well
as in the C-terminal position. This approach favors the build up of
2-disulfide sequences that recognize two separate epitopes on a
target.
[0172] Another buildup approach involves the addition of a
(partially) randomized sequence of 6-15 residues containing two
cysteines that are spaced 4, 5, 6, 7, 8, 9, or 10 amino acids
apart, with optionally additional randomized positions outside the
linked cysteines. This 2-cysteine random sequence is added on the
N-terminal side of the previously selected peptide, or on the
C-terminal side. This approach favors a 1-2 3-4 DBP, although other
DBPs may be formed. This approach can be repeated to generate
binding modules with six or more cysteine residues.
[0173] Binding modules can be constructed based on natural protein
scaffolds. Such scaffolds can be identified by data base searching.
Libraries that are based on natural scaffolds can be subjected to
phage display panning followed by screening to identify sequences
that specifically bind to a target of interest.
[0174] A wide selection of natural scaffolds is available for
constructing the binding modules. The choice of a particular
scaffold will depend on the intended target. Non-limiting examples
of natural scaffolds include snake-toxin-like proteins such as
snake venom toxins and extracellular domain of human cell surface
receptors. Non-limiting examples of snake venom toxins are
Erabutoxin B, gamma-Cardiotoxin, Faciculin, Muscarininc toxin,
Erabutoxin A, Neurotoxin I, Cardiotoxin V4II (Toxin III),
Cardiotoxin V, alpha-Cobratoxin, long Neurotoxin 1, FS2 toxin,
Bungarotoxin, Bucandin, Cardiotoxin CTXI, Cardiotoxin CTX IIB,
Cardiotoxin II, Cardiotoxin III, Cardiotoxin IV, Cobrotoxin 2,
alpha-toxins, Neurotoxin II (cobrotoxin B), Toxin B (long
neurotoxin), Candotoxin, Bucain. Non-limiting examples of
extracellular domain of (human) cell surface receptors include
CD59, Type II activin receptor, BMP receptor Ia ectodomain,
TGF-beta type II receptor extracellular domain. Other natural
scaffolds include but are not limited to A-domains, EGF, Ca-EGF,
TNF-R, Notch, DSL, Trefoil, PD, TSP1, TSP2, TSP3, Anato, Integrin
Beta, Thyroglobulin, Defensin 1, Defensin 2, Cyclotide, SHKT,
Disintegrins, Myotoxins, Gamma-Thioneins, Conotoxin, Mu-Conotoxin,
Omega-Atracotoxins, Delta-Atracotoxins, as well as additional
families disclosed in co-pending application Ser. Nos. 11/528,927
and 11/528,950, which are incorporated herein in their
entirety.
[0175] A large variety of methods has been described that allow one
to identify binding molecules in a large library of variants. One
method is chemical synthesis. Library members can be synthesized on
beads such that each bead carries a different peptide sequence.
Beads that carry ligands with a desirable specificity can be
identified using labeled binding partners. Another approach is the
generation of sub-libraries of peptides which allows one to
identify specific binding sequences in an iterative procedure
(Pinilla, C., et al. (1992) BioTechniques, 13: 901-905). More
commonly used are display methods where a library of variants is
expressed on the surface of a phage, protein, or cell. These
methods have in common, that that DNA or RNA coding for each
variant in the library is physically linked to the ligand. This
enables one to detect or retrieve the ligand of interest and then
determine its peptide sequence by sequencing the attached DNA or
RNA. Display methods allow one skilled in the art to enrich library
members with desirable binding properties from large libraries of
random variants. Frequently, variants with desirable binding
properties can be identified from enriched libraries by screening
individual isolates from an enriched library for desirable
properties. Examples of display methods are fusion to lac repressor
(Cull, M., et al. (1992) Proc. Natl. Acad. Sci. USA, 89:
1865-1869), cell surface display (Wittrup, K. D. (2001) Curr Opin
Biotechnol, 12: 395-9). Of particular interest are methods were
random peptides or proteins are linked to phage particles. Commonly
used are M13 phage (Smith, G. P., et al. (1997) Chem Rev, 97:
391-410) and T7 phage (Danner, S., et al. (2001) Proc Natl Acad Sci
USA, 98: 12954-9). There are multiple methods available to display
peptides or proteins on M13 phage. In many cases, the library
sequence is fused to the N-terminus of peptide pIII of the M13
phage. Phage typically carry 3-5 copies of this protein and thus
phage in such a library will in most cases carry between 3-5 copies
of a library member. This approach is referred to as multivalent
display. An alternative is phagemid display where the library is
encoded on a phagemid. Phage particles can be formed by infection
of cells carrying a phagemid with a helper phage. (Lowman, H. B.,
et al. (1991) Biochemistry, 30: 10832-10838). This process
typically leads to monovalent display. In some cases, monovalent
display is preferred to obtain high affinity binders. In other
cases multivalent display is preferred (O'Connell, D., et al.
(2002) J Mol Biol, 321: 49-56).
[0176] A variety of methods have been described to enrich sequences
with desirable characteristics by phage display. One can immobilize
a target of interest by binding to immunotubes, microtiter plates,
magnetic beads, or other surfaces. Subsequently, a phage library is
contacted with the immobilized target, phage that lack a binding
ligand are washed away, and phage carrying a target specific ligand
can be eluted by a variety of conditions. Elution can be performed
by low pH, high pH, urea or other conditions that tend to break
protein-protein contacts. Bound phage can also be eluted by adding
E. coli cells such that eluting phage can directly infect the added
E. coli host. An interesting protocol is the elution with protease
which can degrade the phage-bound ligand or the immobilized target.
Proteases can also be utilized as tools to enrich protease
resistant phage-bound ligands. For instance, one can incubate a
library of phage-bound ligands with one or more (human or mouse)
proteases prior to panning on the target of interest. This process
degrades and removes protease-labile ligands from the library
(Kristensen, P., et al. (1998) Fold Des, 3: 321-8). Phage display
libraries of ligands can also be enriched for binding to complex
biological samples. Examples are the panning on immobilized cell
membrane fractions (Tur, M. K., et al. (2003) Int J Mol Med, 11:
523-7), or entire cells (Rasmussen, U. B., et al. (2002) Cancer
Gene Ther, 9: 606-12; Kelly, K. A., et al. (2003) Neoplasia, 5:
437-44). In some cases one has to optimize the panning conditions
to improve the enrichment of cell specific binders from phage
libraries (Watters, J. M., et al. (1997) Immunotechnology, 3:
21-9). Phage panning can also be performed in live patients or
animals. This approach is of particular interest for the
identification of ligands that bind to vascular targets (Arap, W.,
et al. (2002) Nat Med, 8: 121-7).
[0177] A variety of cloning methods are available that allow one
skilled in the art to generate libraries of DNA sequences that
encode libraries of peptides. Random mixtures of nucleotides can be
utilized to synthesize oligonucleotides that contain one or
multiple random positions. This process allows one to control the
number of random positions as well as the degree of randomization.
In addition, one can obtain random or semi-random DNA sequences by
partial digestion of DNA from biological samples. Random
oligonucleotides can be used to construct libraries of plasmids or
phage that are randomized in pre-defined locations. This can be
done by PCR fusion as described in (de Kruif, J., et al. (1995) J
Mol Biol, 248: 97-105). Other protocols are based on DNA ligation
(Felici, F., et al. (1991) J Mol Biol, 222: 301-10; Kay, B. K., et
al. (1993) Gene, 128: 59-65). Another commonly used approach is
Kunkel mutagenesis where a mutagenized strand of a plasmid or
phagemid is synthesized using single stranded cyclic DNA as
template. See, Sidhu, S. S., et al. (2000) Methods Enzymol, 328:
333-63; Kunkel, T. A., et al. (1987) Methods Enzymol, 154:
367-82.
[0178] Kunkel mutagenesis uses templates containing randomly
incorporated uracil bases which can be obtained from E. coli
strains like CJ236. The uracil-containing template strand is
preferentially degraded upon transformation into E. coli while the
in vitro synthesized mutagenized strand is retained. As a result
most transformed cells carry the mutagenized version of the
phagemid or phage. A valuable approach to increase diversity in a
library is to combine multiple sub-libraries. These sub-libraries
can be generated by any of the methods described above and they can
be based on the same or on different scaffolds.
[0179] A useful method to generate large phage libraries of short
peptides has been recently described (Scholle, M. D., et al. (2005)
Comb Chem High Throughput Screen, 8: 545-51). This method is
related to the Kunkel approach but it does not require the
generation of single stranded template DNA that contains random
uracil bases. Instead, the method starts with a template phage that
carries one or more mutations close to the area to be mutagenized
and said mutation renders the phage non-infective. The method uses
a mutagenic oligonucleotide that carries randomized codons in some
positions and that correct the phage-inactivating mutation in the
template. As a result, only mutagenized phage particles are
infective after transformation and very few parent phage are
contained in such libraries. This method can be further modified in
several ways. For instance, one can utilize multiple mutagenic
oligonucleotides to simultaneously mutagenize multiple
discontiguous regions of a phage. We have taken this approach one
step further by applying it to whole microproteins of >25, 30,
35, 40, 45, 50, 55 and 60 amino acids, instead of short peptides of
<10, 15 or 20 amino acids, which poses an additional challenge.
This approach now yields libraries of more than 10e10 transformants
(up to 10e11) with a single transformation, so that a single
library with a diversity of 10e12 is expected from 10
transformations.
[0180] Another variation of the Scholle method is to design the
mutagenic oligonucleotide such that an amber stop codon in the
template is converted into an ochre stop codon, and an ochre into
an amber in the next cycle of mutagenesis. In this case the
template phage and the mutagenized library members must be cultured
in different suppressor strains of E. coli, alternating an ochre
suppressor with amber suppressor strains. This allows one to
perform successive rounds of mutagenesis of a phage by alternating
between these two types of stop codons and two suppressor
strains.
[0181] Yet another variation of the Scholle approach involves the
use of megaprimers with a single stranded phage DNA template. The
megaprimer is a long ssDNA that was generated from the library
inserts of the selected pool of phage from the previous round of
panning. The goal is to capture the full diversity of library
inserts from the previous pool, which was mutagenized in one or
more areas, and transfer it to a new library in such a way that an
additional area can be mutagenized. The megaprimer process can be
repeated for multiple cycles using the same template which contains
a stop-codon in the gene of interest. The megaprimer is a ssDNA
(optionally generated by PCR) which contains 1) 5' and 3' overlap
areas of at least 15 bases for complementarity to the ssDNA
template, and 2) one or more previously selected library areas (1,
2, 3, 4 or more) which were copied (optionally by PCR) from the
pool of previously selected clones, and 3) a newly mutagenized
library area that is to be selected in the next round of panning.
The megaprimer is optionally prepared by 1) synthesizing one or
more oligonucleotides encoding the newly synthesized library area
and 2) by fusing this, optionally using overlap PCR, to a DNA
fragment (optionally obtained by PCR) which contains any other
library areas which were previously optimized. Run-off or single
stranded PCR of the combined (overlap) PCR product is used to
generate the single stranded megaprimer that contains all of the
previously optimized areas as well as the new library for an
additional area that is to be optimized in the next panning
experiment. This approach is expected to allow affinity maturation
of proteins using multiple rapid cycles of library creation
generating 10e11 to 10e12 diversity per cycle, each followed by
panning.
[0182] A variety of methods can be applied to introduce sequence
diversity into (previously selected or naive) libraries of
microproteins or to mutate individual microprotein clones with the
goal of enhancing their binding or other properties like
manufacturing, stability or immunogenicity. In principle, all the
methods that can be used to generate libraries can also be used to
introduce diversity into enriched (previously selected) libraries
of microproteins. In particular, one can synthesize variants with
desirable binding or other properties and design partially
randomized oligonucleotides based on these sequences. This process
allows one to control the positions and degree of randomization.
One can deduce the utility of individual mutations in a protein
from sequence data of multiple variants using a variety of computer
algorithms (Jonsson, J., et al. (1993) Nucleic Acids Res, 21:
733-9; Amin, N., et al. (2004) Protein Eng Des Sel, 17: 787-93). Of
particular interest for the re-mutagenesis of enriched libraries is
DNA shuffling (Stemmer, W. P. C. (1994) Nature, 370: 389-391),
which generates recombinants of individual sequences in an enriched
library. Shuffling can be performed using a variety modified PCR
conditions and templates may be partially degraded to enhance
recombination. An alternative is the recombination at pre-defined
positions using restriction enzyme-based cloning. Of particular
interest are methods utilizing type IIS restriction enzymes that
cleave DNA outside of their sequence recognition site (Collins, J.,
et al. (2001) J Biotechnol, 74: 317-38. Restriction enzymes that
generate non-palindromic overhangs can be utilized to cleave
plasmids or other DNA encoding variant mixtures in multiple
locations and complete plasmids can be re-assembled by ligation
(Berger, S. L., et al. (1993) Anal Biochem, 214: 571-9). Another
method to introduce diversity is PCR-mutagenesis where DNA
sequences encoding library members are subjected to PCR under
mutagenic conditions. PCR conditions have been described that lead
to mutations at relatively high mutation frequencies (Leung, D., et
al. (1989) Technique, 1: 11-15). In addition, a polymerase with
reduced fidelity can be employed (Vanhercke, T., et al. (2005) Anal
Biochem, 339: 9-14). A method of particular interest is based on
mutator strains (Irving, R. A., et al. (1996) Immunotechnology, 2:
127-43; Coia, G., et al. (1997) Gene, 201: 203-9). These are
strains that carry defects in one or more DNA repair genes.
Plasmids or phage or other DNA in these strains accumulate
mutations during normal replication. One can propagate individual
clones or enriched populations in mutator strains to introduce
genetic diversity. Many of the methods described above can be
utilized in an iterative process. One can apply multiple rounds of
mutagenesis and screening or panning to entire genes, or to
portions of a gene, or one can mutagenize different portions of a
protein during each subsequent round (Yang, W. P., et al. (1995) J
Mol Biol, 254: 392-403).
[0183] The libraries can be further treated to reduce artifacts.
Known artifacts of phage panning include 1) no-specific binding
based on hydrophobicity, and 2) multivalent binding to the target,
either due to a) the pentavalency of the pIII phage protein, or b)
due to the formation of disulfides between different microproteins,
resulting in multimers, or c) due to high density coating of the
target on a solid support and 3) context-dependent target binding,
in which the context of the target or the context of the
microproteins becomes critical to the binding or inhibition
activity. Different treatment steps can be taken to minimize the
magnitude of these problems. For example, such treatments are
applied to the whole library, but some useful treatments that
remove bad clones can only be applied to pools of soluble proteins
or only to individual soluble proteins.
[0184] Libraries of cysteine-containing scaffolds are likely to
contain free thiols, which can complicate directed evolution by
cross-linking to other proteins. One approach is to remove the
worst clones from the library by passing it over a free-thiol
column, thus removing all clones that have one or more free
sulfhydryls. Clones with free SH groups can also be reacted with
biotin-SH reagents, enabling efficient removal of clones with
reactive SH groups using Streptavidin columns. Another approach is
to not remove the free thiols, but to inactivate them by capping
them with sulfhydryl-reactive chemicals such as iodoacetic acid. Of
particular interest are bulky or hydrophilic sulfhydryl reagents
that reduce the non-specific target binding or modified
variants.
[0185] Examples of context dependence are all of the constant
sequences, including pIII protein, linkers, peptide tags,
biotin-streptavidin, Fc and other fusion proteins that contribute
to the interaction. The typical approach for avoiding
context-dependence involves switching the context as frequently as
practical in order to avoid buildup. This may involve alternating
between different display systems (ie M13 versus T7, or M13 versus
Yeast), alternating the tags and linkers that are used, alternating
the (solid) support used for immobilization (ie immobilization
chemistry) and alternating the target proteins itself (different
vendors, different fusion versions).
[0186] Library treatments can also be used to select for proteins
with preferred qualities. One option is the treatment of libraries
with proteases in order to remove unstable variants from the
library. The proteases used are typically those that would be
encountered in the application. For pulmonary delivery, one would
use lung proteases, for example obtained by a pulmonary lavage.
Similarly, one would obtain mixtures of proteases from serum,
saliva, stomach, intestine, skin, nose, etc. However, it is also
possible to use mixtures of single purified proteases. An extensive
list of proteases is shown in [Appendix E]. The phage themselves
are exceptionally resistant to most proteases and other harsh
treatments.
[0187] For example, it is possible to select the library for the
most stable structures, ie those with the strongest disulfide
bonds, by exposing it to increasing concentrations of reducing
agents (ie DTT or betamercaptoethanol), thus eliminating the least
stable structures first. One would typically use reducing agent (ie
DTT, BME, other) concentrations from 2.5 mM, to 5 mM, 10 mM, 20 mM,
30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM or even 100 mM,
depending on the desired stability.
[0188] It is also possible to select for clones that can be
efficiently refolded in vitro, by reducing the entire display
library with a high level of reducing agent, followed by gradually
re-oxidizing the protein library to reform the disulfides, followed
by the removal of clones with free SH groups, as described above.
This process can be applied once or multiple times to eliminate
clones that have low refolding efficiency in vitro.
[0189] One approach is to apply a genetic selection for protein
expression level, folding and solubility as described by A. C.
Fisher et al. (2006) Genetic selection for protein solubility
enabled by the folding quality control feature of the twin-arginine
translocation pathway. Protein Science (online). After panning of
display libraries (optional), one would like to avoid screening
thousands of clones at the protein level for target binding,
expression level and folding. An alternative is to clone the whole
pool of selected inserts into a betalactamase fusion vector, which,
when plated on betalactam, the authors demonstrated to be selective
for well-expressed, fully disulfide bonded and soluble
proteins.
[0190] Following M13 Phage display of protein libraries and panning
on targets for one or more cycles, there are a variety of ways to
proceed, including (1) screening of individual phage clones by
phage ELISA, which measures the number of phage particles (using
anti-M13 antibodies) that bind to an immobilized target; (2)
transferring from M13 into T7 phage display libraries. The second
approach is particularly useful in reducing the occurrence of false
positives based on valency. Any single library format tends to
favor clones that can form high-avidity contacts with the target.
This is the reason that screening of soluble proteins is important,
although this is a tedious solution. The multivalency achieved in
T7 phage display is likely very different from that achieved in M13
display, and cycling between T7 and M13 can be an excellent
approach to reducing the occurrence of false positives based on
valency.
[0191] Filter lift is another methodology that can be with
bacterial colonies grown at high density on large agar plates
(10e2-10e5). Small amounts of some proteins are secreted into the
media and end up bound to the filter membrane (nitrocellulose or
nylon). The filters are then blocked in non-fat milk, 1% Casein
hydrolysate or a 1% BSA solution and incubated with the target
protein that has been labeled with a fluorescent dye or an
indicator enzyme (directly or indirectly via antibodies or via
biotin-streptavidin). The location of the colony is determined by
overlaying the filter on the back of the plate and all of the
positive colonies are selected and used for additional
characterization. The advantage of filter lifts is that it can be
made to be affinity-selective by reading the signal after washing
for different periods of time. The signal of high affinity clones
`fades` slowly, whereas the signal of low affinity clones fades
rapidly. Such affinity characterization typically requires a
3-point assay with a well-based assay and may provide better
clone-to-clone comparability than well-based assays. Gridding of
colonies into an array is useful since it minimizes differences due
to colony size or location.
[0192] N-Terminal Modules:
[0193] The subject MURPs can contain N-terminal modules (NM), which
are particularly useful e.g., in facilitating production of the
MURPs. The NM can be a single methionine residue when the products
is expressed in the E. coli cytoplasm. A typical product format is
an URP fused to a therapeutic protein, which is expressed in the
bacterial cytoplasm so that the N-terminus is formyl-methionine.
The formyl-methionine can either be permanent or temporary, if it
is removed by biological or chemical processing.
[0194] The NM can also be a peptide sequence that has been
engineered for proteolytic processing, which can be used to remove
tags or to remove fusion proteins. The N-terminal module can be
engineered to facilitate the purification of the MURP by including
an affinity tag such as the Flag-, Myc-, HA- or His-tag. The
N-terminal module can also include an affinity tag that can be used
for the detection of the MURP. An NM can be engineered or selected
for high-level expression of the MURP. It can also be engineered or
selected to enhance the protease resistance of the resulting MURP.
MURPs can be produced with an N-terminal module that facilitates
expression and/or purification. This N-terminal module can be
cleaved off during the production process with a protease, such
that the final product does not contain an N-terminal module.
[0195] By optimizing the amino acid and codon choice of the
N-terminal module one can increase recombinant production. The
N-terminal module can also contain a processing site that can be
cleaved by a specific protease like factor Xa, thrombin, or
enterokinase, Tomato Etch Virus (TEV) protease. Processing sites
can also be designed to be cleavable by chemical hydrolysis. An
example is the amino acid sequence asp-pro that can be cleaved
under acidic conditions. An N-terminal module can also be designed
to facilitate the purification of a MURP. For example, N-terminal
modules can be designed to contain multiple his residues which
allow product capture by immobilized metal chromatography.
N-terminal modules can contain peptide sequences that can be
specifically captured or detected by antibodies. Examples are FLAG,
HA, c-myc.
[0196] C-Terminal Modules:
[0197] MURPs can contain a C-terminal module, which are
particularly useful e.g., in facilitating production of the MURPs.
For example, C-terminal module can comprise a cleavage site to
effect proteolytic processing to remove sequences that are fused
and hence increasing protein expression or facilitating
purification. In particular, the C-terminal module can also contain
a processing site that can be cleaved by a specific protease like
factor Xa, thrombin, TEV protease or enterokinase. Processing sites
can also be designed to be cleavable by chemical hydrolysis. An
example is the amino acid sequence asp-pro that can be cleaved
under acidic conditions. The C-terminal module can be an affinity
tag aimed at facilitating the purification of the MURP. For
example, C-terminal modules can be designed to contain multiple his
residues which allow product capture by immobilized metal
chromatography. C-terminal modules can contain peptide sequences
that can be specifically captured or detected by antibodies.
Non-limiting examples of the tags include FLAG-, HA-, c-myc, or
His-tag. C-terminal module can also be engineered or selected to
enhance the protease resistance of the resulting MURP.
[0198] Where desired, the N-terminus of the protein can be linked
to its own C-terminus. For example, linking these two modules can
be carried out by creating an amino acid-like natural linkage
(peptide bond) or by using an exogenous linking entity. Of
particular interest are cyclotides, a family of small proteins in
which this occurs naturally. Adopting a structural format like
cyclotides is expected to provide additional stability against
exo-proteases. Such intramolecular linkage typically works better
at lower protein concentrations.
[0199] Effector Modules:
[0200] MURPs can comprise one or multiple effector modules (EMs),
or none at all. Effector modules typically do not provide the
targeting, but they provide an activity required for therapeutic
effect, like cell-killing. EMs can be pharmaceutically active small
molecules (ie toxic drugs), peptides or proteins. Non-limiting
examples are cytokines, antibodies enzymes, growth factors,
hormones, receptors, receptor agonists or antagonists, whether
whole or a fragment or domain thereof. Effector modules can also
comprise peptide sequences that carry chemically linked small
molecule drugs, whether synthetic or natural. Optionally, these
effector molecules can be linked to the effector module via
chemical linkers, which may or may not be cleaved under selected
conditions leading to a release of the toxic activity. EMs can also
include radioisotopes and their chelates, as well as various labels
for PET and MRI. Effector modules can also be toxic to a cell or a
tissue. Of particular interest are MURPs that contain toxic
effector modules and binding modules with specificity for a
diseased tissue or disease cell type. Such MURPs can specifically
accumulate in a diseased tissue or in diseased cells and the can
exert their toxic action preferentially in the diseased cells or
tissues. Listed below are exemplary effector modules.
[0201] Enzymes--Effector modules can be enzymes. Of particular
interest are enzymes that degrade metabolites that are critical for
cellular growth like carbohydrates or amino acids or lipids or
co-factors. Other examples for effector modules with enzymatic
activity are RNase, DNase, and phosphatase, asparaginase,
histidinase, arginase, betalactamase. Effector modules with
enzymatic activity can be toxic when delivered to a tissue or cell.
Of particular interest are MURPs that combine effector modules that
are toxic and binding modules that bind specifically to a diseased
tissue. Enzymes that convert an inactive prodrug into an active
drug at the tumor site are also potential effector modules.
[0202] Drug--The subject MURP can contain an effector that is a
drug. Where desired, sequences can be designed for the
organ-selective delivery of drug molecules. An example is
illustrated in FIG. 8. An URP sequence can be fused to a protein
that preferentially binds to diseased tissue. The same URP sequence
can contain one or more amino acid residues that can be modified
for the attachment of drug molecules. Such a conjugate can bind to
diseased tissue with high specificity and the attached drug
molecules can result in local action while minimizing systemic drug
exposure. The MURP can be designed to facilitate the release of
drug molecules at the target size by introducing protease-sensitive
sites that can be cleaved by native proteases at the site of
desired action. A significant advantage of using URP sequences for
the design of drug delivery constructs is that one can avoid
undesirable interactions between the drug molecule and the
targeting domain of the construct. Many drug molecules that can be
conjugated to targeting domains have significant hydrophobicity and
the resulting conjugates tend to aggregate. By adding hydrophilic
URP sequences to such constructs one can improve the solubility of
the resulting delivery constructs and as a consequence reduce the
aggregation tendency. Furthermore, one can increase the number of
drug molecules that can be fused to a targeting domain by adding
long URP sequences. In addition, the use of URP sequences allows
one to optimize the distance between the drug conjugation sites to
facilitate complete conjugation. The list of suitable drugs
includes but are not limited to chemotherapeutic agents such as
thiotepa and cyclosphosphamide (CYTOXAN.TM.); alkyl sulfonates such
as busulfan, improsulfan and piposulfan; aziridines such as
benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and
methylamelamines including altretamine, triethylenemelamine,
trietylenephosphoramide, triethylenethiophosphaoramide and
trimethylolomelamine; nitrogen mustards such as chlorambucil,
chlornaphazine, cholophosphamide, estramustine, ifosfamide,
mechlorethamine, mechlorethamine oxide hydrochloride, melphalan,
novembichin, phenesterine, prednimustine, trofosfamide, uracil
mustard; nitrosureas such as carmustine, chlorozotocin,
fotemustine, lomustine, nimustine, ranimustine; antibiotics such as
aclacinomysins, actinomycin, authramycin, azaserine, bleomycins,
cactinomycin, calicheamicin, carabicin, caminomycin, carzinophilin,
chromomycins, dactinomycin, daunorubicin, detorubicin,
6-diazo-5-oxo-L-norleucine, doxorubicin, epirubicin, esorubicin,
idarubicin, marcellomycin, mitomycins, mycophenolic acid,
nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin,
quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin,
ubenimex, zinostatin, zorubicin; anti-metabolites such as
methotrexate and 5-fluorouracil (5-FU); folic acid analogues such
as denopterin, methotrexate, pteropterin, trimetrexate; purine
analogs such as fludarabine, 6-mercaptopurine, thiamiprine,
thioguanine; pyrimidine analogs such as ancitabine, azacitidine,
6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine,
enocitabine, floxuridine, androgens such as calusterone,
dromostanolone propionate, epitiostanol, mepitiostane,
testolactone; anti-adrenals such as aminoglutethimide, mitotane,
trilostane; folic acid replenisher such as frolinic acid;
aceglatone; aldophosphamide glycoside; aminolevulinic acid;
amsacrine; bestrabucil; bisantrene; edatraxate; defofamine;
demecolcine; diaziquone; duocarmycin, maytansin, auristatin,
elfomithine; elliptinium acetate; etoglucid; gallium nitrate;
hydroxyurea; lentinan; lonidamine; mitoguazone; mitoxantrone;
mopidamol; nitracrine; pentostatin; phenamet; pirarubicin;
podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK.R.TM.;
razoxane; sizofiran; spirogermanium; tenuazonic acid; triaziquone;
2,2',2''-trichlorotriethyla-mine; urethan; vindesine; dacarbazine;
mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine;
arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxanes, e.g.
paclitaxel (TAXOL.TM., Bristol-Myers Squibb Oncology, Princeton,
N.J.) and docetaxel (TAXOTERE.TM., Rhone-Poulenc Rorer, Antony,
France); chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine;
methotrexate; platinum analogs such as cisplatin and carboplatin;
vinblastine; platinum; etoposide (VP-16); ifosfamide; mitomycin C;
mitoxantrone; vincristine; vinorelbine; navelbine; novantrone;
teniposide; daunomycin; aminopterin; xeloda; ibandronate;
camptothecin-11 (CPT-1); topoisomerase inhibitor RFS 2000;
difluoromethylornithine (DMFO); retinoic acid; esperamicins;
capecitabine; and pharmaceutically acceptable salts, acids or
derivatives of any of the above. Also included as suitable
chemotherapeutic cell conditioners are anti-hormonal agents that
act to regulate or inhibit hormone action on tumors such as
anti-estrogens including for example tamoxifen, raloxifene,
aromatase inhibiting 4(5)-imidazoles, 4-hydroxytamoxifen,
trioxifene, keoxifene, LY 117018, onapristone, and toremifene
(Fareston); and anti-androgens such as flutamide, nilutamide,
bicalutamide, leuprolide, goserelin, doxorubicin, daunomycin,
duocarmycin, vincristin, and vinblastin.
[0203] Other drugs that can be used as the effector modules include
those that are useful for treating inflammatory conditions, cardiac
diseases, infectious diseases, respiratory diseases, autoimmune
diseases, neronal and muscular disorders, metabolic disorders, and
cancers.
[0204] Additional drugs that can be used as the effectors in MURPs
include agents for pain and inflammation such as histamine and
histamine antagonists, bradykinin and bradykinin antagonists,
5-hydroxytryptamine (serotonin), lipid substances that are
generated by biotransformation of the products of the selective
hydrolysis of membrane phospholipids, eicosanoids, prostaglandins,
thromboxanes, leukotrienes, aspirin, nonsteroidal anti-inflammatory
agents, analgesic-antipyretic agents, agents that inhibit the
synthesis of prostaglandins and thromboxanes, selective inhibitors
of the inducible cyclooxygenase, selective inhibitors of the
inducible cyclooxygenase-2, autacoids, paracrine hormones,
somatostatin, gastrin, cytokines that mediate interactions involved
in humoral and cellular immune responses, lipid-derived autacoids,
eicosanoids, .beta.-adrenergic agonists, ipratropium,
glucocorticoids, methylxanthines, sodium channel blockers, opioid
receptor agonists, calcium channel blockers, membrane stabilizers
and leukotriene inhibitors.
[0205] Other drugs that can be used as effector include agents for
the treatment of peptic ulcers, agents for the treatment of
gastroesophageal reflux disease, prokinetic agents, antiemetics,
agents used in irritable bowel syndrome, agents used for diarrhea,
agents used for constipation, agents used for inflammatory bowel
disease, agents used for biliary disease, agents used for
pancreatic disease.
[0206] Radionuclides--MURPs can be designed for the tissue-targeted
delivery of radionuclides as well as for imagin with radionuclides.
URPs are ideal for imaging because the halflife can be optimized by
changing the length of the URP. For most imaging applications a
moderately long URP is likely to be preferred, providing a halflife
of 5 minutes to a few hours, not days or weeks MURPs can be
designed such that they only contain a single or a small defined
number of amino groups that can be modified with chelating agents
(such as DOTA) for radio isotopes such as technetium, indium,
yttrium, (EXPAND). Alternative methods of conjugation are through
reserved cysteine side chains. Such radionuclide-carrying MURPs can
be employed for the treatment of tumors or other diseased tissues,
as well as for imaging.
[0207] Many pharmaceutically active proteins or protein domains can
used as effector models in MURPs. Examples are the following
proteins as well as fragments of these proteins: cytokines, growth
factors, enzymes, -receptors, microproteins, hormones,
erythopoetin, adenosine deiminase, asparaginase, arginase,
interferon, growth hormone, growth hormone releasing hormone,
G-CSF, GM-CSM, insulin, hirudin, TNF-receptor, uricase,
rasburicase, axokine, RNAse, DNAse, phosphatase, pseudomonas
exotoxin, ricin, gelonin, desmoteplase, laronidase, thrombin, blood
clotting enzyme, VEGF, protropin, somatropin, alteplase,
interleukin, factor IIV, factor VIII, factor X, factor IX, dornase,
glucocerebrosidase, follitropin, glucagon, thyrotropin, nesiritide,
alteplase, teriparatide, agalsidase, laronidase, methioninase.
[0208] Protease-activated MURPs: To enhance the therapeutic index
of an effector module, one can insert protease-labile sequences
into URP sequences that are sensitive to proteases that are
preferentially found in serum or in the target tissue to be treated
by the MURP. This approach is illustrated in FIG. 9. Some designs
allows one to construct proteins that are selectively activated
when reaching a target tissue. Of particular interest are MURPs
that are activated at a disease site. To facilitate such
target-specific activation one can attach URP sequences in close
proximity to the active site or receptor binding site of the
effector module such that the resulting fusion protein has limited
biological activity. Of particular interest is the activation of an
effector module at a tumor site. Many tumor tissues express
proteases in relatively high concentrations and sequences that are
specifically cleaved by these tumor proteases can be inserted into
URP sequences. For example, most prostate tumor tissues contain
high concentrations of prostate specific antigen (PSA) which is a
serine protease. Prodrugs consisting of a PSA-labile peptide
conjugated to the cancer drug doxorubicin have shown selective
activation in prostate tissue [DeFeo-Jones, D., et al. (2000) Nat
Med, 6: 1248]. Of particular interest for disease-specific
activation are proteins with cytostatic or cytotoxic activity like
TNFalpha, and many cytokines and interleukins. Another application
is the selective activation of proteins at the site of inflammation
or at site of virus or bacterial infection.
[0209] Methods of production--MURPs containing URP sequences can be
produced using molecular biology approaches that are well know in
the art. A variety of cloning vectors are available for various
expression systems like mammalian cells, yeast, and microbes. Of
particular interest as expression hosts are E. coli, S. cerevisiae,
P. pastoris, and chinese hamster ovary cells. Of particular
interest are hosts that have been optimized to widen their codon
usage. Of particular interest is a host that has been modified to
enhance expression of GRS. That can be done by providing DNA that
encodes glycine-specific tRNAs. In addition, one can engineer the
host such that loading of glycine-specific tRNAs is enhanced. The
DNA encoding the enhanced protein can be operationally linked to a
promoter sequences. The DNA encoding the enhanced protein as well
as the operationally linked promoter can be part of a plasmid
vector, viral vector or it can be inserted into the chromosome of
the host.
[0210] For production on can culture the host under conditions that
facilitate the production of the enhanced protein. Of particular
interest are conditions that improve the production of GRS.
[0211] The subject MURPs can adopt a variety of formats. For
instance, the MURPs can contain URPs that are fused to
pharmaceutically active proteins to produce slow-release products.
Such products can be injected or implanted locally for instance
into or under the skin of a patient. Due to its large hydrodynamic
radius the URP sequences-containing product is slowly released from
the injection or implantation site which leads to a reduction of
the frequency of injection or implantation. The URP sequences can
be designed to contain regions that bind to cell surfaces or tissue
in order to prolong the local retention of the drug at the
injection site. Of particular interest are URP-containing products
that can be formulated as soluble compounds but form aggregates or
precipitates upon injection. This aggregation or precipitation can
be triggered by a change in pH between the formulated product and
the pH at the injection site. Alternatives are URP-containing
products that precipitate or form aggregates as a result of a
change in redox conditions. Yet another approach is a
URP-containing product that is stabilized in solution by addition
of non-active solutes, but that precipitates or aggregates upon
injection as a result of diffusion of the solubilizing solutes.
Another approach is to design URP-containing products that contain
one or multiple Lysine or Cysteine residues in their URP sequence
and that can be cross-linked prior to injection.
[0212] Where desired, the MURP is monomeric (here meaning
not-crosslinked) when manufactured and formulated and when
injected, but after subcutaneous injection the protein starts to
crosslink with itself or with native human proteins, forming a
polymer under the skin from which active drug molecules are freed
only very gradually. Such release can be by disulfide bond
reduction or disulfide shuffling as illustrated in FIG. 18, or it
can be mediated by proteolysis as shown in FIG. 19, releasing
active fragments into the circulation. It is important that these
active fragments are large enough to have a long halflife, because
the longer their secretion halflife, the lower the dose of the
released protein can be, allowing the use of a lower dose of
product to be injected or a longer time between injections.
[0213] One approach that offers these advantages is
disulfide-mediated crosslinking of proteins. For example, a protein
drug would be manufactured with a cyclic peptide in it (one or
more). This cyclic peptide may or may not be involved in binding to
the target. This protein is manufactured with the cyclic peptide
formed, ie in oxidized form, to simplify purification. However, the
product is then reduced and formulated to keep the protein in
reduced form. It is important that the cyclic peptide reduces at a
low concentration of reducing agent, such as 0.25, 0.5, 1.0, 2.0,
4.0 or 8.0 mM Dithiothreitol or Betamercaptoethanol or cysteine or
equivalent reducing agent, so that the cyclic peptide can be
reduced without reducing other disulfide containing protein modules
in the product. The use of FDA approved reducing agents is
preferred, such as cysteine or glutathione. After subcutaneous
injection, the low molecular weight reducing agent diffuses away
rapidly or is neutralized by human proteins, exposing the drug to
an oxidizing environment while it is still at a high molar
concentration, which causes crosslinking of cysteines located on
different protein chains, which leads to polymerization of the drug
at the injection site. The longer the distance between the
cysteines in the cyclic peptide, and the higher the concentration
of the drug, the higher the degree of polymerization of the drug
will be, since polymerization competes with cyclic peptide
reformation. Over time, disulfide reduction and oxidation will
cause disulfide reshuffling, which will lead to cyclic peptide
reformation and monomerization and resolubilization of the drug.
The release of the drug from the polymer can also occur via
proteolysis which could be targeted and controlled or increased by
building in cleavage sites for serum proteases. The crosslinking to
the proteins could also be performed with a chemical
protein-protein crosslinking agent, such as the ones listed in
[table x]. Ideally, this is an already FDA-approved agent, such as
those used for vaccine conjugation or conjugation of chemicals to
proteins.
[0214] Instead of using disulfides, one can also stabilize proteins
against proteolytic degradation using a wide variety of
crosslinking agents. Most of the agents below are sold by Pierce
Chemicals under that same name and instructions for their use are
available online (www.piercenet.com). The agents that result in the
same chain-to-chain distance as obtained with disulfides are the
most likely to be useful for this application. The short-linker
agents such as DFDNB are the most promising. The interchain
distance can be readily determined from the structures of the
chemicals as shown in www.piercenet.com.
[0215] There are a large number of specific chemical products that
work based on the following small number of basic reaction schemes,
all of which are described in detail at www.piercenet.com. Examples
of useful crosslinking agents are Imidoesters, active halogens,
maleimide, pyridyl disulfide, NHS-ester. Homobifunctional
crosslinking agents have two identical reactive groups and are
often used in a onestep chemical crosslinking procedure. Examples
are BS3 (a non-cleavable water-soluble DSS analog), BSOCOES
(base-reversible), DMA (Dimethyl adipimidate-2HCl), DMP (Dimethyl
pimelimidate-2HCl), DMS (Dimethyl suberimidate-2HCl), DSG (5-carbon
analog of DSS), DSP (Lomant's reagent), DSS (non-cleavable), DST
(cleavable by oxidizing agents), DTBP (Dimethyl
3,3'-dithiobispropionimidate-2HCl), DTSSP, EGS, Sulfo-EGS, THPP,
TSAT, DFDNB (1,5-Difluoro-2,4-dinitrobenzene) is especially useful
for crosslinking between small spacial distances (Kornblatt, J. A.
and Lake, D. F. (1980). Cross-linking of cytochrome oxidase
subunits with difluorodinitrobenzene. Can J. Biochem. 58,
219-224).
[0216] Sulfhydryl-reactive homobifunctional crosslinking agents are
homobifunctional protein crosslinkers that react with sulfhydryls
are often based on maleimides, which react with --SH groups at pH
6.5-7.5, forming stable thioether linkages. BM[PEO]3 is an 8-atom
polyether spacer that reduces potential for conjugate precipitation
in sulfhydryl-to-sulfhydryl cross-linking applications. BM[PEO]4 is
similar but with an 11-atom spacer. BMB is a non-cleavable
crosslinker with a four-carbon spacer. BMDB makes a linkage that
can be cleaved with periodate. BMH is a widely used
homobifunctional sulfhydryl-reactive crosslinker. BMOE has an
especially short linker. DPDPB and DTME are cleavable crosslinkers.
HVBS does not have the hydrolysis potential of meleimides. TMEA is
another option. Hetero-bifunctional crosslinking agents have two
different reactive groups. Examples are NHS-esters and
amines/hydrazines via EDC activation, AEDP, ASBA (photoreactive,
iodinatable), EDC (water-soluble carbodiimide). Amine-Sulflhydryl
reactive bifunctional crosslinkers are AMAS, APDP, BMPS, EMCA,
EMCS, GMBS, KMUA, LC-SMCC, LC-SPDP, MBS, SBAP, SIA (extra short),
SIAB, SMCC, SMPB, SMPH, SMPT, SPDP, Sulfo-EMCS, Sulfo-GMBS,
Sulfo-KMUS, Sulfo-LC-SMPT, Sulfo-LC-SPDP, Sulfo-MBS, Sulfo-SIAB,
Sulfo-SMCC, Sulfo-SMPB. Amino-group reactive heterobifunctional
crosslinking agents are ANB-NOS, MSA, NHS-ASA, SADP, SAED, SAND,
SANPAH, SASD, SFAD, Sulfo-HSAB, Sulfo-NHS-LC-ASA, Sulfo-SADP,
Sulfo-SANPAH, TFCS.
[0217] A different slow release format has the drug labeled with a
His6 tag, which is mixed and co-injected with
Nickel-Nitrilotriacetic acid-conjugated beads (Ni-NTA beads), a GMO
version of the ones that are available from Qiagen. The drug would
slowly teach off the beads, providing depot and slow release as
illustrated in FIG. 20. The beads are optional and can be replaced
by a crosslinked, polymeric Nickel-nitrilotriacetic acid that leads
to assembly of an even larger polymer.
[0218] URP sequences can contain sequences that are known to form
multimers like alpha2D [Hill, R., et al. (1998) J Am Chem Soc, 120:
1138-1145] that was utilized to dimerize an antibody fragment
[Kubetzko, S., et al. (2005) Mol Pharmacol, 68: 1439-54]. Examples
of a useful homo dimerization peptide is the sequence SKVILFE. An
example of useful heterodimerization sequences are the peptide
ARARAR that can form dimers with the sequence DADADA and related
sequences. Multimerization can improve the biological function of a
molecule by increasing its avidity and it can influence
pharmacokinetic properties and tissue distribution of the resulting
MURPs.
[0219] "Multimerization modules" are amino acid sequences that
facilitate dimer or multimer formation of MURPs. Multimerization
modules may bind to themselves to form dimers or multimers.
Alternatively, multimerization modules can bind to other modules of
the MURP. These can be leucine zippers or small peptides like Hydra
head activator derivatives (SKVILF-like) which forms antiparallel
homopolymers, or peptides like RARARA and DADADA, which form high
affinity antiparallel heteropolymers. Using one, two or more copies
of these peptides one can force the formation of protein dimers,
linear multimers or branched multimers.
[0220] The affinity of the association can be tailored by changing
the type, length and composition of the peptides. Some applications
require peptides that form homodimers as illustrated in FIG. 21.
Other applications require heterodimers. In some cases, once
associated, the peptides can be locked into place by forming
disulfide bonds between the two protein chains, typically on either
side of the peptides. Multimerization modules are useful for
linking two MURP molecules together (head to tail, head to head, or
tail to tail) as illustrated in FIG. 21. The multimerization
modules can be located on either the N- or C-terminus in order to
form dimers. If the multimerization modules are present at both
termini, long, linear multimers will be formed. If more than two
multimerization modules are present per protein, branched polymeric
networks can be formed. The concepts of multimerization and
chemical conjugation can be combined leading to useful for halflife
extension and depot formation, leading to slow release of active
drug from the depot or injection site as illustrated in FIG.
23.
[0221] The subject MURPs can incorporate a genetic or universal
URP. One approach is to express a URP containing a long URP module,
which provides halflife and contains multiple (typically 4-10)
lysines (or other sites) that allows site-specific conjugation of
peptides (ie linear, cyclic, 2SS, 3 SS, etc) that bind to a
specific target. The advantage of this approach is that the URP
module is generic and can be conjugated with any target-specific
peptide. Ideally the linkage of the target-specific peptide to the
URP is a directed linkage, so that residues on the URP can only
react with a residue on the target-specific peptide and exhaustive
coupling can only produce a single species, which is a URP that is
linked to a peptide at every lysine, for example. This complex
behaves like a high-avidity multimer in it's binding properties but
is simple to manufacture. This approach is illustrated in FIG.
24.
[0222] The subject MURPs can also incorporate URPs to effect
delivery across tissue barriers. URPs can be engineered to enhance
delivery across the dermal, oral, buccal, intestinal, nasal,
blood-brain, pulmonary, thecal, peritoneal, rectal, vaginal or many
other tissue barriers.
[0223] One of the key obstacles to oral protein delivery is the
sensitivity of most proteins to proteases in the digestive system.
Conjugation to URP sequences can improve protease resistance of
pharmaceutically active proteins and thus facilitate their uptake.
It has been shown that protein uptake in the digestive system can
be improved by adding molecular carriers. The main role of these
carriers is an improvement of membrane permeability [Stoll, B. R.,
et al. (2000) J Control Release, 64: 217-28]. Thus one can include
sequences into URP sequences that improve membrane permeability.
Many sequences that improve membrane permeability are know and
examples are sequences rich in arginine [Takenobu, T., et al.
(2002) Mol Cancer Ther, 1: 1043-9]. Thus one can design URP
sequences that improve cellular or oral uptake of proteins by
combining two functions, a reduction in proteolytic degradation of
the protein of interest as well as an increase in membrane
permeability of the fusion product. Optional, on can add a sequence
to the URP sequence that is sensitive to a protease that is
preferentially located at in the target tissue for the drug of
interest but is stable to proteases in the digestive tract.
Examples of such URP sequences are sequences that contain long
regions of GRS as well as sequences that are rich in basic amino
acids in particular arginine and facilitate membrane transfer. URP
can be utilized in a similar way to improve protein uptake via
intranasal, intrapulmonary, or other routes of delivery.
SPECIFIC PRODUCT EXAMPLES
[0224] DR4/DR5 agonist--DR4 and DR5 are death receptors that are
expressed on many tumor cells. These receptors can be triggered by
trimerization which leads to cell death and tumor regression.
Binding domains with specificity for DR4 or DR5 can be obtained by
phage panning or other display methods. These DR4 or DR5-specific
binding domains can be multimerized using URP modules as linkers as
illustrated in FIG. 12. Of particular interest are MURPs that
contain three or more binding modules with specificity for DR4 or
DR5 or both. As illustrated in FIG. 12, MURPs can contain
additional binding modules with specificity for tumor antigens that
are overexpressed in tumor tissues. This allows one to construct
MURPs that specifically accumulate in tumor tissue and trigger cell
death. MURPs can contain modules that bind either DR4 or DR5. Of
particular interest are MURPs that contain binding modules that
bind both DR4 and DR5.
[0225] Tumor-targeted Interleukin 2--Interleukin 2 (IL2) is a
cytokine that can enhance the immune response to tumor tissue.
However, systemic IL2 therapy is characterized by significant side
effects. MURPs can be constructed that combine binding domains with
specificity for tumor antigens and IL2 as effector module as
illustrated in FIG. 13. Such MURP can selectively accumulate in
tumor tissue and thus elicit a tumor-selective immune response
while minimizing the systemic side effects of cytokine therapy.
Such MURPs can target a variety of tumor antigens like EpCAM, Her2,
CEA, EGFR, Thomsen Friedenreich antigen. Of particular utility are
MURPs that bind to tumor antigens that show slow internalization.
Similar MURPs can be designed using other cytokines or tumor
necrosis factor-alfa as effector modules.
[0226] Tumor-selective asparaginase--Asparaginase is used to treat
patients with acute leukemia. Both asparaginase from E. coli and
asparaginase from Erwinia are used for treatment. Both enzymes can
lead to immunogenicity and hypersensitive reactions. Oncaspar is
PEGylated version of asparaginase that has reduced immunogenicity.
However, the protein is difficult to manufacture and administered
as a mixture of isomers. Adding URP sequences to termini and/or to
internal loops allows the direct recombinant manufacture of an
asparaginase variant that is homogeneous and has low
immunogenicity. Various URP sequences and attachment sites can be
compared to determine the optimum position for URP sequence
attachment. Several other enzymes can degrade amino acids have
reported antitumor activity. Examples are arginase, methioninase,
phenylalanine ammonia lyase, and tryptophanase. Of particular
interest is the phenylalanine ammonia lyase of streptomyces
maritimus, which has a high specific activity and does not require
a co-factor [Calabrese, J. C., et al. (2004) Biochemistry, 43:
11403-16]. Most of these enzymes are of bacterial or other
non-human origin and are likely to elicit immune reactions. The
immunogenicity of these enzymes can be reduced by adding one or
more URP sequences. In addition, the therapeutic index and PK
properties of these enzymes can be improved by increasing their
hydrodynamic radius as a result of URP sequences attachment.
[0227] The subject MURPs can be designed to target any cellular
proteins. A non-limiting list is provided below.
[0228] VEGF, VEGF-R1, VEGF-R2, VEGF-R3, Her-1, Her-2, Her-3, EGF-1,
EGF-2, EGF-3, Alpha3, cMet, ICOS, CD40L, LFA-1, c-Met, ICOS, LFA-1,
IL-6, B7.1, B7.2, OX40, IL-1b, TACI, IgE, BAFF or BLys, TPO-R,
CD19, CD20, CD22, CD33, CD28, IL-1-R1, TNF.alpha., TRAIL-R1,
Complement Receptor 1, FGFa, Osteopontin, Vitronectin, Ephrin
A1-A5, Ephrin B1-B3, alpha-2-macroglobulin, CCL1, CCL2, CCL3, CCL4,
CCL5, CCL6, CCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CCL13,
CCL14, CCL15, CXCL16, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21,
CCL22, PDGF, TGFb, GMCSF, SCF, p40 (IL12/IL23), IL1b, IL1a, IL1ra,
IL2, IL3, IL4, IL5, IL6, IL8, IL10, IL12, IL15, IL23, Fas, FasL,
Flt3 ligand, 41BB, ACE, ACE-2, KGF, FGF-7, SCF, Netrin1,2,
IFNa,b,g, Caspase2,3,7,8,10, ADAM S1,S5,8,9,15,TS1,TS5;
Adiponectin, ALCAM, ALK-1, APRIL, Annexin V, Angiogenin,
Amphiregulin, Angiopoietin1,2,4, B7-1/CD80, B7-2/CD86, B7-H1,
B7-H2, B7-H3, Bcl-2, BACE-1, BAK, BCAM, BDNF, bNGF, bECGF,
BMP2,3,4,5,6,7,8; CRP, Cadherin6,8,11; Cathepsin A,B,C,D,E,L,S,V,X;
CD11a/LFA-1, LFA-3, GP2b3a, GH receptor, RSV F protein, IL-23 (p40,
p19), IL-12, CD80, CD86, CD28, CTLA-4, .alpha.4.beta.1,
.alpha.4.beta.7, TNF/Lymphotoxin, IgE, CD3, CD20, IL-6, IL-6R,
BLYS/BAFF, IL-2R, HER2, EGFR, CD33, CD52, Digoxin, Rho (D),
Varicella, Hepatitis, CMV, Tetanus, Vaccinia, Antivenom, Botulinum,
Trail-R1, Trail-R2, cMet, TNF-R family, such as LA NGF-R, CD27,
CD30, CD40, CD95, Lymphotoxin a/b receptor, Wsl-1, TL1A/TNFSF15,
BAFF, BAFF-R/TNFRSF13C, TRAIL R2/TNFRSF10B, TRAIL R2/TNFRSF10B,
Fas/TNFRSF6 CD27/TNFRSF7, DR3/TNFRSF25, HVEM/TNFRSF14,
TROY/TNFRSF19, CD40 Ligand/TNFSF5, BCMA/TNFRSF17, CD30/TNFRSF8,
LIGHT/TNFSF14, 4-1BB/TNFRSF9, CD40/TNFRSF5, GITR/TNFRSF18,
Osteoprotegerin/TNFRSF11B, RANK/TNFRSF11A, TRAIL R3/TNFRSF10C,
TRAIL/TNFSF10, TRANCE/RANK L/TNFSF11, 4-1BB Ligand/TNFSF9,
TWEAK/TNFSF12, CD40 Ligand/TNFSF5, Fas Ligand/TNFSF6,
RELT/TNFRSF19L, APRIL/TNFSF13, DcR3/TNFRSF6B, TNF RI/TNFRSF1A,
TRAIL R1/TNFRSF10A, TRAIL R4/TNFRSF10D, CD30 Ligand/TNFSF8, GITR
Ligand/TNFSF18, TNFSF18, TACI/TNFRSF13B, NGF R/TNFRSF16, OX40
Ligand/TNFSF4, TRAIL R2/TNFRSF10B, TRAIL R3/TNFRSF10C, TWEAK
R/TNFRSF12, BAFF/BLyS/TNFSF13, DR6/TNFRSF21, TNF-alpha/TNFSF1A,
Pro-TNF-alpha/TNFSF1A, Lymphotoxin beta R/TNFRSF3, Lymphotoxin beta
R (LTbR)/Fc Chimera, TNF RI/TNFRSF1A, TNF-beta/TNFSF1B, PGRP-S, TNF
RI/TNFRSF1A, TNF RII/TNFRSF1B, EDA-A2, TNF-alpha/TNFSF1A, EDAR,
XEDAR, TNF RI/TNFRSF1A.
[0229] Of particular interest are human target proteins that are
commercially available in purified form. Examples are: 4EBP1,
14-3-3 zeta, 53BP1, 2B4/SLAMF4, CCL21/6Ckine, 4-1BB/TNFRSF9, 8D6A,
4-1BB Ligand/TNFSF9, 8-oxo-dG, 4-Amino-1,8-naphthalimide, A2B5,
Aminopeptidase LRAP/ERAP2, A33, Aminopeptidase N/ANPEP, Aag,
Aminopeptidase P2/XPNPEP2, ABCG2, Aminopeptidase P1/XPNPEP1, ACE,
Aminopeptidase PILS/ARTS1, ACE-2, Amnionless, Actin, Amphiregulin,
beta-Actin, AMPK alpha 1/2, Activin A, AMPK alpha 1, Activin AB,
AMPK alpha 2, Activin B, AMPK beta 1, Activin C, AMPK beta 2,
Activin RIA/ALK-2, Androgen R/NR3C4, Activin RIB/ALK-4, Angiogenin,
Activin RIIA, Angiopoietin-1, Activin RIIB, Angiopoietin-2, ADAM8,
Angiopoietin-3, ADAM9, Angiopoietin-4, ADAM10, Angiopoietin-like 1,
ADAM12, Angiopoietin-like 2, ADAM15, Angiopoietin-like 3,
TACE/ADAM17, Angiopoietin-like 4, ADAM19, Angiopoietin-like 7/CDT6,
ADAM33, Angiostatin, ADAMTS4, Annexin A1/Annexin I, ADAMTS5,
Annexin A7, ADAMTS1, Annexin A10, ADAMTSL-1/Punctin, Annexin V,
Adiponectin/Acrp30, ANP, AEBSF, AP Site, Aggrecan, APAF-1, Agrin,
APC, AgRP, APE, AGTR-2, APJ, AIF, APLP-1, Akt, APLP-2, Akt1,
Apolipoprotein AI, Akt2, Apolipoprotein B, Akt3, APP, Serum
Albumin, APRIL/TNFSF13, ALCAM, ARC, ALK-1, Artemin, ALK-7,
Arylsulfatase A/ARSA, Alkaline Phosphatase, ASAH2/N-acylsphingosine
Amidohydrolase-2, alpha 2u-Globulin, ASC, alpha-1-Acid
Glycoprotein, ASGR1, alpha-Fetoprotein, ASK1, ALS, ATM,
Ameloblastin, ATRIP, AMICA/JAML, Aurora A, AMIGO, Aurora B, AMIGO2,
Axin-1, AMIGO3, Ax1, Aminoacylase/ACY1, Azurocidin/CAP37/HBP,
Aminopeptidase A/ENPEP, B4GALT1, BIM, B7-1/CD80, 6-Biotin-17-NAD,
B7-2/CD86, BLAME/SLAMF8, B7-H1/PD-L1, CXCL13/BLC/BCA-1, B7-H2,
BLIMP1, B7-H3, Blk, B7-H4, BMI-1, BACE-1, BMP-1/PCP, BACE-2, BMP-2,
Bad, BMP-3, BAFF/TNFSF13B, BMP-3b/GDF-10, BAFF R/TNFRSF13C, BMP-4,
Bag-1, BMP-5, BAK, BMP-6, BAMBI/NMA, BMP-7, BARD1, BMP-8, Bax,
BMP-9, BCAM, BMP-10, Bcl-10, BMP-15/GDF-9B, Bcl-2, BMPR-IA/ALK-3,
Bcl-2 related protein A1, BMPR-IB/ALK-6, Bcl-w, BMPR-II, Bcl-x,
BNIP3L, Bcl-xL, BOC, BCMA/TNFRSF17, BOK, BDNF, BPDE, Benzamide,
Brachyury, Common beta Chain, B-Raf, beta IG-H3, CXCL14/BRAK,
Betacellulin, BRCA1, beta-Defensin 2, BRCA2, BID, BTLA, Biglycan,
Bub-1, Bik-like Killer Protein, c-jun, CD90/Thy1, c-Rel, CD94,
CCL6/C10, CD97, C1q R1/CD93, CD151, C1qTNF1, CD160, C1qTNF4, CD163,
C1qTNF5, CD164, Complement Component C1r, CD200, Complement
Component C1s, CD200 R1, Complement Component C2, CD229/SLAMF3,
Complement Component C3a, CD23/Fc epsilon RII, Complement Component
C3d, CD2F-10/SLAMF9, Complement Component C5a, CD5L,
Cadherin-4/R-Cadherin, CD69, Cadherin-6, CDC2, Cadherin-8, CDC25A,
Cadherin-11, CDC25B, Cadherin-12, CDCP1, Cadherin-13, CDO,
Cadherin-17, CDX4, E-Cadherin, CEACAM-1/CD66a, N-Cadherin,
CEACAM-6, P-Cadherin, Cerberus 1, VE-Cadherin, CFTR, Calbindin D,
cGMP, Calcineurin A, Chem R23, Calcineurin B, Chemerin,
Calreticulin-2, Chemokine Sampler Packs, CaM Kinase II, Chitinase
3-like 1, cAMP, Chitotriosidase/CHIT1, Cannabinoid R1, Chk1,
Cannabinoid R2/CB2/CNR2, Chk2, CAR/NR1I3, CHL-1/L1CAM-2, Carbonic
Anhydrase J, Choline Acetyltransferase/ChAT, Carbonic Anhydrase II,
Chondrolectin, Carbonic Anhydrase III, Chordin, Carbonic Anhydrase
IV, Chordin-Like 1, Carbonic Anhydrase VA, Chordin-Like 2, Carbonic
Anhydrase VB, CINC-1, Carbonic Anhydrase VI, CINC-2, Carbonic
Anhydrase VII, CINC-3, Carbonic Anhydrase VIII, Claspin, Carbonic
Anhydrase IX, Claudin-6, Carbonic Anhydrase X, CLC, Carbonic
Anhydrase XII, CLEC-1, Carbonic Anhydrase XIII, CLEC-2, Carbonic
Anhydrase XIV, CLECSF13/CLEC4F, Carboxymethyl Lysine, CLECSF8,
Carboxypeptidase A1/CPA1, CLF-1, Carboxypeptidase A2,
CL-P1/COLEC12, Carboxypeptidase A4, Clusterin, Carboxypeptidase B1,
Clusterin-like 1, Carboxypeptidase E/CPE, CMG-2, Carboxypeptidase
XI, CMV UL146, Cardiotrophin-1, CMV UL147, Carnosine Dipeptidase 1,
CNP, Caronte, CNTF, CART, CNTF R alpha, Caspase, Coagulation Factor
II/Thrombin, Caspase-1, Coagulation Factor III/Tissue Factor,
Caspase-2, Coagulation Factor VII, Caspase-3, Coagulation Factor X,
Caspase-4, Coagulation Factor XI, Caspase-6, Coagulation Factor
XIV/Protein C, Caspase-7, COCO, Caspase-8, Cohesin, Caspase-9,
Collagen I, Caspase-10, Collagen II, Caspase-12, Collagen IV,
Caspase-13, Common gamma Chain/IL-2 R gamma, Caspase Peptide
Inhibitors, COMP/Thrombospondin-5, Catalase, Complement Component
C1rLP, beta-Catenin, Complement Component C1qA, Cathepsin 1,
Complement Component C1qC, Cathepsin 3, Complement Factor D,
Cathepsin 6, Complement Factor I, Cathepsin A, Complement MASP3,
Cathepsin B, Connexin 43, Cathepsin C/DPPI, Contactin-1, Cathepsin
D, Contactin-2/TAG1, Cathepsin E, Contactin-4, Cathepsin F,
Contactin-5, Cathepsin H, Corin, Cathepsin L, Cornulin, Cathepsin
O, CORS26/C1qTNF, 3, Cathepsin S, Rat Cortical Stem Cells,
Cathepsin V, Cortisol, Cathepsin X/Z/P, COUP-TF I/NR2F1, CBP,
COUP-TF II/NR2F2, CCI, COX-1, CCK-A R, COX-2, CCL28, CRACC/SLAMF7,
CCR1, C-Reactive Protein, CCR2, Creatine Kinase, Muscle/CKMM, CCR3,
Creatinine, CCR4, CREB, CCR5, CREG, CCR6, CRELD1, CCR7, CRELD2,
CCR8, CRHBP, CCR9, CRHR-1, CCR10, CRIM1, CD155/PVR, Cripto, CD2,
CRISP-2, CD3, CRISP-3, CD4, Crossveinless-2, CD4+/45RA-, CRTAM,
CD4+/45RO-, CRTH-2, CD4+/CD62L-/CD44, CRY1, CD4+/CD62L+/CD44,
Cryptic, CD5, CSB/ERCC6, CD6, CCL27/CTACK, CD8, CTGF/CCN2,
CD8+/45RA-, CTLA-4, CD8+/45RO-, Cubilin, CD9, CX3CR1, CD14, CXADR,
CD27/TNFRSF7, CXCL16, CD27 Ligand/TNFSF7, CXCR3, CD28, CXCR4,
CD30/TNFRSF8, CXCR5, CD30 Ligand/TNFSF8, CXCR6, CD31/PECAM-1,
Cyclophilin A, CD34, Cyr61/CCN1, CD36/SR-B3, Cystatin A, CD38,
Cystatin B, CD40/TNFRSF5, Cystatin C, CD40 Ligand/TNFSF5, Cystatin
D, CD43, Cystatin E/M, CD44, Cystatin F, CD45, Cystatin H, CD46,
Cystatin H2, CD47, Cystatin S, CD48/SLAMF2, Cystatin SA, CD55/DAF,
Cystatin SN, CD58/LFA-3, Cytochrome c, CD59, Apocytochrome c, CD68,
Holocytochrome c, CD72, Cytokeratin 8, CD74, Cytokeratin 14, CD83,
Cytokeratin 19, CD84/SLAMF5, Cytonin, D6, DISP1, DAN, Dkk-1, DANCE,
Dkk-2, DARPP-32, Dkk-3, DAX1/NR0B1, Dkk-4, DCC, DLEC, DCIR/CLEC4A,
DLL1, DCAR, DLL4, DcR3/TNFRSF6B, d-Luciferin, DC-SIGN, DNA Ligase
IV, DC-SIGNR/CD299, DNA Polymerase beta, DcTRAIL R1/TNFRSF23,
DNAM-1, DcTRAIL R2/TNFRSF22, DNA-PKcs, DDR1, DNER, DDR2, Dopa
Decarboxylase/DDC, DEC-205, DPCR-1, Decapentaplegic, DPP6, Decorin,
DPPA4, Dectin-1/CLEC7A, DPPA5/ESG1, Dectin-2/CLEC6A,
DPPII/QPP/DPP7, DEP-1/CD148, DPPIV/CD26, Desert Hedgehog,
DR3/TNFRSF25, Desmin, DR6/TNFRSF21, Desmoglein-1, DSCAM,
Desmoglein-2, DSCAM-L1, Desmoglein-3, DSPG3, Dishevelled-1, Dtk,
Dishevelled-3, Dynamin, EAR2/NR2F6, EphA5, ECE-1, EphA6, ECE-2,
EphA7, ECF-L/CHI3L3, EphA8, ECM-1, EphB1, Ecotin, EphB2, EDA,
EphB3, EDA-A2, EphB4, EDAR, EphB6, EDG-1, Ephrin, EDG-5, Ephrin-A1,
EDG-8, Ephrin-A2, eEF-2, Ephrin-A3, EGF, Ephrin-A4, EGF R,
Ephrin-A5, EGR1, Ephrin-B, EG-VEGF/PK1, Ephrin-B1, eIF2 alpha,
Ephrin-B2, eIF4E, Ephrin-B3, Elk-1, Epigen, EMAP-II,
Epimorphin/Syntaxin 2, EMMPRIN/CD147, Epiregulin, CXCL5/ENA,
EPR-1/Xa Receptor, Endocan, ErbB2, Endoglin/CD105, ErbB3,
Endoglycan, ErbB4, Endonuclease III, ERCC1, Endonuclease IV, ERCC3,
Endonuclease V, ERK1/ERK2, Endonuclease VIII, ERK1,
Endorepellin/Perlecan, ERK2, Endostatin, ERK3, Endothelin-1,
ERK5/BMK1, Engrailed-2, ERR alpha/NR3B1, EN-RAGE, ERR beta/NR3B2,
Enteropeptidase/Enterokinase, ERR gamma/NR3B3, CCL11/Eotaxin,
Erythropoietin, CCL24/Eotaxin-2, Erythropoietin R, CCL26/Eotaxin-3,
ESAM, EpCAM/TROP-1, ER alpha/NR3A1, EPCR, ER beta/NR3A2, Eph,
Exonuclease III, EphA1, Exostosin-like 2/EXTL2, EphA2,
Exostosin-like 3/EXTL3, EphA3, FABP1, FGF-BP, FABP2, FGF R1-4,
FABP3, FGF R1, FABP4, FGF R2, FABP5, FGF R3, FABP7, FGF R4, FABP9,
FGF R5, Complement Factor B, Fgr, FADD, FHR5, FAM3A, Fibronectin,
FAM3B, Ficolin-2, FAM3C, Ficolin-3, FAM3D, FITC, Fibroblast
Activation Protein alpha/FAP, FKBP38, Fas/TNFRSF6, Flap, Fas
Ligand/TNFSF6, FLIP, FATP1, FLRG, FATP4, FLRT1, FATP5, FLRT2, Fc
gamma RI/CD64, FLRT3, Fc gamma RIIB/CD32b, Flt-3, Fc gamma
RIIC/CD32c, Flt-3 Ligand, Fc gamma RIIA/CD32a, Follistatin, Fc
gamma RIII/CD16, Follistatin-like 1, FcRH1/IRTA5, FosB/GOS3,
FcRH2/IRTA4, FoxD3, FcRH4/IRTA1, FoxJ1, FcRH5/IRTA2, FoxP3, Fc
Receptor-like 3/CD16-2, Fpg, FEN-1, FPR1, Fetuin A, FPRL1, Fetuin
B, FPRL2, FGF acidic, CX3CL1/Fractalkine, FGF basic, Frizzled-1,
FGF-3, Frizzled-2, FGF-4, Frizzled-3, FGF-5, Frizzled-4, FGF-6,
Frizzled-5, FGF-8, Frizzled-6, FGF-9, Frizzled-7, FGF-10,
Frizzled-8, FGF-11, Frizzled-9, FGF-12, Frk, FGF-13, sFRP-1,
FGF-16, sFRP-2, FGF-17, sFRP-3, FGF-19, sFRP-4, FGF-20, Furin,
FGF-21, FXR/NR1H4, FGF-22, Fyn, FGF-23, G9a/EHMT2, GFR alpha-3/GDNF
R alpha-3, GABA-A-R alpha 1, GFR alpha-4/GDNF R alpha-4, GABA-A-R
alpha 2, GITR/TNFRSF18, GABA-A-R alpha 4, GITR Ligand/TNFSF18,
GABA-A-R alpha 5, GLI-1, GABA-A-R alpha 6, GLI-2, GABA-A-R beta 1,
GLP/EHMT1, GABA-A-R beta 2, GLP-1 R, GABA-A-R beta 3, Glucagon,
GABA-A-R gamma 2, Glucosamine (N-acetyl)-6-Sulfatase/GNS,
GABA-B-R2, GluR1, GAD1/GAD67, GluR2/3, GAD2/GAD65, GluR2, GADD45
alpha, GluR3, GADD45 beta, Glut1, GADD45 gamma, Glut2, Galectin-1,
Glut3, Galectin-2, Glut4, Galectin-3, Glut5, Galectin-3 BP,
Glutaredoxin 1, Galectin-4, Glycine R, Galectin-7, Glycophorin A,
Galectin-8, Glypican 2, Galectin-9, Glypican 3, GalNAc4S-6ST,
Glypican 5, GAP-43, Glypican 6, GAPDH, GM-CSF, Gas1, GM-CSF R
alpha, Gas6, GMF-beta, GASP-1/WFIKKNRP, gp130, GASP-2/WFIKKN;
Glycogen Phosphorylase BB/GPBB, GATA-1, GPR15, GATA-2, GPR39,
GATA-3, GPVI, GATA-4, GR/NR3C1, GATA-5, Gr-1/Ly-6G, GATA-6,
Granulysin, GBL, Granzyme A, GCNF/NR6A1, Granzyme B, CXCL6/GCP-2,
Granzyme D, G-CSF, Granzyme G, G-CSF R, Granzyme H, GDF-1, GRASP,
GDF-3 GRB2, GDF-5, Gremlin, GDF-6, GRO, GDF-7, CXCL1/GRO alpha,
GDF-8, CXCL2/GRO beta, GDF-9, CXCL3/GRO gamma, GDF-11, Growth
Hormone, GDF-15, Growth Hormone R, GDNF, GRP75/HSPA9B, GFAP, GSK-3
alpha/beta, GFI-1, GSK-3 alpha, GFR alpha-1/GDNF R alpha-1, GSK-3
beta, GFR alpha-2/GDNF R alpha-2, EZF1T, H2AX, Histidine, H60,
HM74A, HAI-1, HMGA2, HAI-2, HMGB1, HAI-2A, TCF-2/HNF-1 beta,
HAI-2B, HNF-3 beta/FoxA2, HAND1, HNF-4 alpha/NR2A1, HAPLN1, HNF-4
gamma/NR2A2, Airway Trypsin-like Protease/HAT, HO-1/HMOX1/HSP32,
HB-EGF, HO-2/HMOX2, CCL14a/HCC-1, HPRG, CCL14b/HCC-3, Hrk,
CCL16/HCC-4, HRP-1, alpha HCG, HS6ST2, Hck, HSD-1, HCR/CRAM-A/B,
HSD-2, HDGF, HSP10/EPF, Hemoglobin, HSP27, Hepassocin, HSP60,
HES-1, HSP70, HES-4, HSP90, HGF, HTRA/Protease Do, HGF Activator,
HTRA1/PRSS11, HGF R, HTRA2/Omi, HIF-1 alpha, HVEM/TNFRSF14, HIF-2
alpha, Hyaluronan, HIN-1/Secretoglobulin 3A1, 4-Hydroxynonenal,
Hip, CCL1/I-309/TCA-3, IL-10, cIAP (pan), IL-10 R alpha,
cIAP-1/HIAP-2, IL-10 R beta, cIAP-2/HIAP-1, IL-1, IBSP/Sialoprotein
II, IL-11 R alpha, ICAM-1/CD54, IL-12, ICAM-2/CD102, IL-12/IL-23
p40, ICAM-3/CD50, IL-12 R beta 1, ICAM-5, IL-12 R beta 2, ICAT,
IL-13, ICOS, IL-13 R alpha 1, Iduronate 2-Sulfatase/IDS, IL-13 R
alpha 2, IFN, IL-15, IFN-alpha, IL-15 R alpha, IFN-alpha 1, IL-16,
IFN-alpha 2, IL-17, IFN-alpha 4b, IL-17 R, IFN-alpha A, IL-17 RC,
IFN-alpha B2, IL-17 RD, IFN-alpha C, IL-17B, IFN-alpha D, IL-17B R,
IFN-alpha F, IL-17C, IFN-alpha G, IL-17D, IFN-alpha H2, IL-17E,
IFN-alpha I, IL-17F, IFN-alpha J1, IL-18/IL-1F4, IFN-alpha K, IL-18
BPa, IFN-alpha WA, IL-18 BPc, IFN-alpha/beta R1, IL-18 BPd,
IFN-alpha/beta R2, IL-18 R alpha/IL-1 R5, IFN-beta, IL-18 R
beta/IL-1 R7, IFN-gamma, IL-19, IFN-gamma R1, IL-20, IFN-gamma R2,
IL-20 R alpha, IFN-omega, IL-20 R beta, IgE, IL-21, IGFBP-1, IL-21
R, IGFBP-2, IL-22, IGFBP-3, IL-22 R, IGFBP-4, IL-22BP, IGFBP-5,
IL-23, IGFBP-6, IL-23 R, IGFBP-L1, IL-24, IGFBP-rp1/IGFBP-7,
IL-26/AK155, IGFBP-rP10, IL-27, IGF-I, IL-28A, IGF-I R, IL-28B,
IGF-II, IL-29/IFN-lambda 1, IGF-II R, IL-31, IgG, IL-31 RA, IgM,
IL-32 alpha, IGSF2, IL-33, IGSF4A/SynCAM, ILT2/CD85j, IGSF4B,
ILT3/CD85k, IGSF8, ILT4/CD85d, IgY, ILT5/CD85a, IkB-beta,
ILT6/CD85e, IKK alpha, Indian Hedgehog, IKK epsilon, INSRR, IKK
gamma, Insulin, IL-1 alpha/IL-1F1, Insulin R/CD220, IL-1
beta/IL-1F2, Proinsulin, IL-1ra/IL-1F3, Insulysin/IDE, IL-1F5/FIL1
delta, Integrin alpha 2/CD49b, IL-1F6/FIL1 epsilon, Integrin alpha
3/CD49c, IL-1F7/FIL1 zeta, Integrin alpha 3 beta 1/VLA-3,
IL-1F8/FIL1 eta, Integrin alpha 4/CD49d, IL-1F9/IL-1H1, Integrin
alpha 5/CD49e, IL-1F10/IL-1HY2, Integrin alpha 5 beta 1, IL-1 RI,
Integrin alpha 6/CD49f, IL-1 RII, Integrin alpha 7, IL-1 R3/IL-1 R
AcP, Integrin alpha 9, IL-1 R4/ST2, Integrin alpha E/CD103, IL-1
R6/IL-1 R rp2, Integrin alpha L/CD11a, IL-1 R8, Integrin alpha L
beta 2, IL-1 R9, Integrin alpha M/CD11b, IL-2, Integrin alpha M
beta 2, IL-2 R alpha, Integrin alpha V/CD51, IL-2 R beta, Integrin
alpha V beta 5, IL-3, Integrin alpha V beta 3, IL-3 R alpha,
Integrin alpha V beta 6, IL-3 R beta, Integrin alpha X/CD11c, IL-4,
Integrin beta 1/CD29, IL-4 R, Integrin beta 2/CD18, IL-5, Integrin
beta 3/CD61, IL-5 R alpha, Integrin beta 5, IL-6, Integrin beta 6,
IL-6 R, Integrin beta 7, IL-7, CXCL10/IP-10/CRG-2, IL-7 R
alpha/CD127, IRAK1, CXCR1/IL-8 RA, IRAK4, CXCR2/IL-8 RB, IRS-1,
CXCL8/IL-8, Islet-1, IL-9, CXCL11/I-TAC, IL-9 R, Jagged 1,
JAM-4/IGSF5, Jagged 2, JNK, JAM-A, JNK1/JNK2, JAM-B/VE-JAM, JNK1,
JAM-C, JNK2, Kininogen, Kallikrein 3/PSA, Kininostatin, Kallikrein
4, KIR/CD158, Kallikrein 5, KIR2DL1, Kallikrein 6/Neurosin,
KIR2DL3, Kallikrein 7, KIR2DL4/CD158d, Kallikrein 8/Neuropsin,
KIR2DS4, Kallikrein 9, KIR3DL1, Plasma Kallikrein/KLKB1, KIR3DL2,
Kallikrein 10, Kirrel2, Kallikrein 11, KLF4, Kallikrein 12, KLF5,
Kallikrein 13, KLF6, Kallikrein 14, Klotho, Kallikrein 15, Klotho
beta, KC, KOR, Keap1, Kremen-1, Kell, Kremen-2, KGF/FGF-7, LAG-3,
LINGO-2, LAIR1, Lipin 2, LAIR2, Lipocalin-1, Laminin alpha 4,
Lipocalin-2/NGAL, Laminin gamma 1, 5-Lipoxygenase, Laminin I, LXR
alpha/NR1H3, Laminin S, LXR beta/NR1H2, Laminin-1, Livin,
Laminin-5, LIX, LAMP, LMIR1/CD300A, Langerin, LMIR2/CD300c, LAR,
LMIR3/CD300LF, Latexin, LMIR5/CD300LB, Layilin, LMIR6/CD300LE, LBP,
LMO2, LDL R, LOX-1/SR-E1, LECT2, LRH-1/NR5A2, LEDGF, LRIG1, Lefty,
LRIG3, Lefty-1, LRP-1, Lefty-A, LRP-6, Legumain, LSECtin/CLEC4G,
Leptin, Lumican, Leptin R, CXCL15/Lungkine, Leukotriene B4,
XCL1/Lymphotactin, Leukotriene B4 R1, Lymphotoxin, LIF, Lymphotoxin
beta/TNFSF3, LIF R alpha, Lymphotoxin beta R/TNFRSF3,
LIGHT/TNFSF14, Lyn, Limitin, Lyp, LIMPII/SR-B2, Lysyl Oxidase
Homolog 2, LIN-28, LYVE-1, LINGO-1, alpha 2-Macroglobulin,
CXCL9/MIG, MAD2L1, Mimecan, MAdCAM-1, Mindin, MafB,
Mineralocorticoid R/NR3C2, MafF, CCL3L1/MIP-1 alpha Isoform LD78
beta, MafG, CCL3/MIP-1 alpha, MafK, CCL4L1/LAG-1, MAG/Siglec-4a,
CCL4/MIP-1 beta, MANF, CCL15/MIP-1 delta, MAP2, CCL9/10/MIP-1
gamma, MAPK, MIP-2, Marapsin/Pancreasin, CCL19/MIP-3 beta, MARCKS,
CCL20/MIP-3 alpha, MARCO, MIP-I, Mash1, MIP-II, Matrilin-2,
MIP-III, Matrilin-3, MIS/AMH, Matrilin-4, MIS RII, Matriptase/ST14,
MIXL1, MBL, MKK3/MKK6, MBL-2, MKK3, Melanocortin 3R/MC3R, MKK4,
MCAM/CD146, MKK6, MCK-2, MKK7, Mcl-1, MKP-3, MCP-6, MLH-1,
CCL2/MCP-1, MLK4 alpha, MCP-11, MMP, CCL8/MCP-2, MMP-1,
CCL7/MCP-3/MARC, MMP-2, CCL13/MCP-4, MMP-3, CCL12/MCP-5, MMP-7,
M-CSF, MMP-8, M-CSF R, MMP-9, MCV-type 11, MMP-10, MD-1, MMP-11,
MD-2; MMP-12, CCL22/MDC, MMP-13, MDL-1/CLEC5A, MMP-14, MDM2,
MMP-15, MEA-1, MMP-16/MT3-MMP, MEK1/MEK2, MMP-24/MT5-MMP, MEK1,
MMP-25/MT6-MMP, MEK2, MMP-26, Melusin, MMR, MEPE, MOG, Meprin
alpha, CCL23/MPIF-1, Meprin beta, M-Ras/R-Ras3, Mer, Mre11,
Mesothelin, MRP1 Meteorin, MSK1/MSK2, Methionine Aminopeptidase 1,
MSK1, Methionine Aminopeptidase, MSK2, Methionine Aminopeptidase 2,
MSP, MFG-E8, MSP R/Ron, MFRP, Mug, MgcRacGAP, MULT-1, MGL2,
Musashi-1, MGMT, Musashi-2, MIA, MuSK, MICA, MutY DNA Glycosylase,
MICB, MyD88, MICL/CLEC12A, Myeloperoxidase, beta 2 Microglobulin,
Myocardin, Midkine, Myocilin, MIF, Myoglobin, NAIP NGFI-B
gamma/NR4A3, Nanog, NgR2/NgRH1, CXCL7/NAP-2, NgR3/NgRH2, Nbs1,
Nidogen-1/Entactin, NCAM-1/CD56, Nidogen-2, NCAM-L1, Nitric Oxide,
Nectin-1, Nitrotyrosine, Nectin-2/CD112, NKG2A, Nectin-3, NKG2C,
Nectin-4, NKG2D, Neogenin, NKp30, Neprilysin/CD10, NKp44,
Neprilysin-2/MMEL1/MMEL2, NKp46/NCR1, Nestin, NKp80/KLRF1, NETO2,
NKX2.5, Netrin-1, NMDA R, NR1 Subunit, Netrin-2, NMDA R, NR2A
Subunit, Netrin-4, NMDA R, NR2B Subunit, Netrin-G1a, NMDA R, NR2C
Subunit, Netrin-G2a, N-Me-6,7-diOH-TIQ, Neuregulin-1/NRG1, Nodal,
Neuregulin-3/NRG3, Noggin, Neuritin, Nogo Receptor, NeuroD1,
Nogo-A, Neurofascin, NOMO, Neurogenin-1, Nope, Neurogenin-2,
Norrin, Neurogenin-3, eNOS, Neurolysin, iNOS, Neurophysin II, nNOS,
Neuropilin-1, Notch-1, Neuropilin-2, Notch-2, Neuropoietin,
Notch-3, Neurotrimin, Notch-4, Neurturin, NOV/CCN3, NFAM1, NRAGE,
NF-H, NrCAM, NFkB1, NRL, NFkB2, NT-3, NF-L, NT-4, NF-M,
NTB-A/SLAMF6, NG2/MCSP, NTH1, NGF R/TNFRSF16, Nucleostemin,
beta-NGF, Nurr-1/NR4A2, NGFI-B alpha/NR4A1, OAS2, Orexin B, OBCAM,
OSCAR, OCAM, OSF-2/Periostin, OCIL/CLEC2d, Oncostatin M/OSM,
OCILRP2/CLEC21, OSM R beta, Oct-3/4, Osteoactivin/GPNMB, OGG1,
Osteoadherin, Olig 1, 2, 3, Osteocalcin, Olig1, Osteocrin, Olig2,
Osteopontin, Olig3, Osteoprotegerin/TNFRSF11B, Oligodendrocyte
Marker O1, Otx2, Oligodendrocyte Marker O4, OV-6, OMgp,
OX40/TNFRSF4, Opticin, OX40 Ligand/TNFSF4, Orexin A, OAS2, Orexin
B, OBCAM, OSCAR, OCAM, OSF-2/Periostin, OCIL/CLEC2d, Oncostatin
M/OSM, OCILRP2/CLEC2i, OSM R beta, Oct-3/4, Osteoactivin/GPNMB,
OGG1, Osteoadherin, Olig 1, 2, 3, Osteocalcin, Olig1, Osteocrin,
Olig2, Osteopontin, Olig3, Osteoprotegerin/TNFRSF11B,
Oligodendrocyte Marker O1, Otx2,
Oligodendrocyte Marker O4, OV-6, OMgp, OX40/TNFRSF4, Opticin, OX40
Ligand/TNFSF4, Orexin A, RACK1, Ret, Rad1, REV-ERB alpha/NR1D1,
Rad17, REV-ERB beta/NR1D2, Rad51, Rex-1, Rae-1, RGM-A, Rae-1 alpha,
RGM-B, Rae-1 beta, RGM-C, Rae-1 delta, Rheb, Rae-1 epsilon,
Ribosomal Protein S6, Rae-1 gamma, RIP1, Raf-1, ROBO1, RAGE, ROBO2,
Ra1A/Ra1B, ROBO3, Ra1A, ROBO4, Ra1B, ROR/NR1F1-3 (pan),
RANK/TNFRSF11A, ROR alpha/NR1F1, CCL5/RANTES, ROR gamma/NR1F3,
Rap1A/B, RTK-like Orphan Receptor 1/ROR1, RAR alpha/NR1B1, RTK-like
Orphan Receptor 2/ROR2, RAR beta/NR1B2, RP105, RAR gamma/NR1B3,
RPA2, Ras, RSK (pan), RBP4, RSK1/RSK2, RECK, RSK1, Reg 2/PAP, RSK2,
Reg I, RSK3, Reg II, RSK4, Reg III, R-Spondin 1, Reg IIIa,
R-Spondin 2, Reg IV, R-Spondin 3, Relaxin-1, RUNX1/CBFA2,
Relaxin-2, RUNX2/CBFA1, Relaxin-3, RUNX3/CBFA3, RELM alpha, RXR
alpha/NR2B1, RELM beta, RXR beta/NR2B2, RELT/TNFRSF19L, RXR
gamma/NR2B3, Resistin, S100A10, SLITRK5, S100A8, SLP1, S100A9,
SMAC/Diablo, S100B, Smad1, S100P, Smad2, SALL1, Smad3,
delta-Sarcoglycan, Smad4, Sca-1/Ly6, Smad5, SCD-1, Smad7, SCF,
Smad8, SCF R/c-kit, SMC1, SCGF, alpha-Smooth Muscle Actin,
SCL/Tal1, SMUG1, SCP3/SYCP3, Snail, CXCL12/SDF-1, Sodium Calcium
Exchanger 1, SDNSF/MCFD2, Soggy-1, alpha-Secretase, Sonic Hedgehog,
gamma-Secretase, S or CSI, beta-Secretase, S or CS3, E-Selectin,
Sortilin, L-Selectin, SOST, P-Selectin, SOX1, Semaphorin 3A, SOX2,
Semaphorin 3C, SOX3, Semaphorin 3E, SOX7, Semaphorin 3F, SOX9,
Semaphorin 6A, SOX10, Semaphorin 6B, SOX17, Semaphorin 6C, SOX21
Semaphorin 6D, SPARC, Semaphorin 7A, SPARC-like 1, Separase, SP-D,
Serine/Threonine Phosphatase Substrate I, Spinesin, Serpin A1,
F-Spondin, Serpin A3, SR-AI/MSR, Serpin A4/Kallistatin, Src, Serpin
A5/Protein C Inhibitor, SREC-1/SR-F1, Serpin A8/Angiotensinogen,
SREC-II, Serpin B5, SSEA-1, Serpin C1/Antithrombin-III, SSEA-3,
Serpin D1/Heparin Cofactor II, SSEA-4, Serpin E1/PAI-1, ST7/LRP12,
Serpin E2, Stabilin-1, Serpin F1, Stabilin-2, Serpin F2,
Stanniocalcin 1, Serpin G1/C1 Inhibitor, Stanniocalcin 2, Serpin
12, STAT1, Serum Amyloid A1, STAT2, SF-1/NR5A1, STAT3, SGK, STAT4,
SHBG, STAT5a/b, SHIP, STAT5a, SHP/NROB2, STAT5b, SHP-1, STAT6,
SHP-2, VE-Statin, SIGIRR, Stella/Dppa3, Siglec-2/CD22, STRO-1,
Siglec-3/CD33, Substance P, Siglec-5, Sulfamidase/SGSH, Siglec-6,
Sulfatase Modifying Factor 1/SUMF1, Siglec-7, Sulfatase Modifying
Factor 2/SUMF2, Siglec-9, SUMO1, Siglec-10, SUMO2/3/4, Siglec-11,
SUMO3, Siglec-F, Superoxide Dismutase, SIGNR1/CD209, Superoxide
Dismutase-1/Cu--Zn SOD, SIGNR4, Superoxide Dismutase-2/Mn-SOD, SIRP
beta 1, Superoxide Dismutase-3/EC-SOD, SKI, Survivin, SLAM/CD150,
Synapsin I, Sleeping Beauty Transposase, Syndecan-1/CD138, Slit3,
Syndecan-2, SLITRK1, Syndecan-3, SLITRK2, Syndecan-4, SLITRK4,
TACI/TNFRSF13B, TMEFF1/Tomoregulin-1, TAO2, TMEFF2, TAPP1,
TNF-alpha/TNFSF1A, CCL17/TARC, TNF-beta/TNFSF1B, Tau, TNF
RI/TNFRSF1A, TC21/R-Ras2, TNF RII/TNFRSF1B, TCAM-1, TOR,
TCCR/WSX-1, TP-1, TC-PTP, TP63/TP73L, TDG, TR, CCL25/TECK, TR
alpha/NR1A1, Tenascin C, TR beta 1/NR1A2, Tenascin R, TR2/NR2C1,
TER-119, TR4NR2C2, TERT, TRA-1-85, Testican 1/SPOCK1, TRADD,
Testican 2/SPOCK2, TRAF-1, Testican 3/SPOCK3, TRAF-2, TFPI, TRAF-3,
TFPI-2, TRAF-4, TGF-alpha, TRAF-6, TGF-beta, TRAIL/TNFSF10,
TGF-beta 1, TRAIL R1/TNFRSF10A, LAP (TGF-beta 1), TRAIL
R2/TNFRSF10B, Latent TGF-beta 1, TRAIL R3/TNFRSF10C, TGF-beta 1.2,
TRAIL R4/TNFRSF10D, TGF-beta 2, TRANCE/TNFSF11, TGF-beta 3, TfR
(Transferrin R), TGF-beta 5, Apo-Transferrin, Latent TGF-beta bp1,
Holo-Transferrin, Latent TGF-beta bp2, Trappin-2/Elafin, Latent
TGF-beta bp4, TREM-1, TGF-beta R/ALK-5, TREM-2, TGF-beta RII,
TREM-3, TGF-beta RIIb, TREML1/TLT-1, TGF-beta RIII, TRF-1,
Thermolysin, TRF-2, Thioredoxin-1, TRH-degrading Ectoenzyme/TRHDE,
Thioredoxin-2, TRIM5, Thioredoxin-80, Tripeptidyl-Peptidase I,
Thioredoxin-like 5/TRP14, TrkA, THOP1, TrkB, Thrombomodulin/CD141,
TrkC, Thrombopoietin, TROP-2, Thrombopoietin R, Troponin I Peptide
3, Thrombospondin-1, Troponin T, Thrombospondin-2, TROY/TNFRSF19,
Thrombospondin-4, Trypsin 1, Thymopoietin, Trypsin 2/PRSS2, Thymus
Chemokine-1, Trypsin 3/PRSS3, Tie-1, Tryptase-5/Prss32, Tie-2,
Tryptase alpha/TPS1, TIM-1/KIM-1/HAVCR, Tryptasebeta-1/MCPT-7,
TIM-2, Tryptasebeta-2/TPSB2, TIM-3, Tryptase epsilon/BSSP-4, TIM-4,
Tryptase gamma-1/TPSG1, TIM-5, Tryptophan Hydroxylase, TIM-6,
TSC22, TIMP-1, TSG, TIMP-2, TSG-6, TIMP-3, TSK, TIMP-4, TSLP,
TL1A/TNFSF15, TSLP R, TLR1, TSP50, TLR2, beta-III Tubulin, TLR3,
TWEAK/TNFSF12, TLR4, TWEAK R/TNFRSF12, TLR5, Tyk2, TLR6,
Phospho-Tyrosine, TLR9, Tyrosine Hydroxylase, TLX/NR2E1, Tyrosine
Phosphatase Substrate I, Ubiquitin, UNC5H3, Ugi, UNC5H4, UGRP1,
UNG, ULBP-1, uPA, ULBP-2, uPAR, ULBP-3, URB, UNC5H1, UVDE, UNC5H2,
Vanilloid R1, VEGF R, VASA, VEGF R1/Flt-1, Vasohibin, VEGF
R2/KDR/Flk-1, Vasorin, VEGF R3/Flt-4, Vasostatin, Versican, Vav-1,
VG5Q, VCAM-1, VHR, VDR/NRIII, Vimentin, VEGF, Vitronectin, VEGF-B,
VLDLR, VEGF-C, vWF-A2, VEGF-D, Synuclein-alpha, Ku70, WASP, Wnt-7b,
WIF-1, Wnt-8a WISP-1/CCN4, Wnt-8b, WNK1, Wnt-9a, Wnt-1, Wnt-9b,
Wnt-3a, Wnt-10a, Wnt-4, Wnt-10b, Wnt-5a, Wnt-11, Wnt-5b, wnvNS3,
Wnt7a, XCR1, XPE/DDBI, XEDAR, XPE/DDB2, Xg, XPF, XIAP, XPG, XPA,
XPV, XPD, XRCC1, Yes, YY1, EphA4.
Numerous human ion channels are targets of particular interest.
Non-limiting examples include 5-hydroxytryptamine 3 receptor B
subunit, 5-hydroxytryptamine 3 receptor precursor,
5-hydroxytryptamine receptor 3 subunit C, AAD14 protein,
Acetylcholine receptor protein, alpha subunit precursor,
Acetylcholine receptor protein, beta subunit precursor,
Acetylcholine receptor protein, delta subunit precursor,
Acetylcholine receptor protein, epsilon subunit precursor,
Acetylcholine receptor protein, gamma subunit precursor, Acid
sensing ion channel 3 splice variant b, Acid sensing ion channel 3
splice variant c, Acid sensing ion channel 4, ADP-ribose
pyrophosphatase, mitochondrial precursor, Alpha1A-voltage-dependent
calcium channel, Amiloride-sensitive cation channel 1, neuronal,
Amiloride-sensitive cation channel 2, neuronal Amiloride-sensitive
cation channel 4, isoform 2, Amiloride-sensitive sodium channel,
Amiloride-sensitive sodium channel alpha-subunit,
Amiloride-sensitive sodium channel beta-subunit,
Amiloride-sensitive sodium channel delta-subunit,
Amiloride-sensitive sodium channel gamma-subunit, Annexin A7,
Apical-like protein, ATP-sensitive inward rectifier potassium
channel 1, ATP-sensitive inward rectifier potassium channel 10,
ATP-sensitive inward rectifier potassium channel 11, ATP-sensitive
inward rectifier potassium channel 14, ATP-sensitive inward
rectifier potassium channel 15, ATP-sensitive inward rectifier
potassium channel 8, Calcium channel alpha12.2 subunit, Calcium
channel alpha12.2 subunit, Calcium channel alpha1E subunit, delta19
delta40 delta46 splice variant, Calcium-activated potassium channel
alpha subunit 1, Calcium-activated potassium channel beta subunit
1, Calcium-activated potassium channel beta subunit 2,
Calcium-activated potassium channel beta subunit 3,
Calcium-dependent chloride channel-1, Cation channel TRPM4B, CDNA
FLJ90453 fis, clone NT2RP3001542, highly similar to Potassium
channel tetramerisation domain containing 6, CDNA FLJ90663 fis,
clone PLACE1005031, highly similar to Chloride intracellular
channel protein 5, CGMP-gated cation channel beta subunit, Chloride
channel protein, Chloride channel protein 2, Chloride channel
protein 3, Chloride channel protein 4, Chloride channel protein 5,
Chloride channel protein 6, Chloride channel protein ClC-Ka,
Chloride channel protein ClC-Kb, Chloride channel protein, skeletal
muscle, Chloride intracellular channel 6, Chloride intracellular
channel protein 3, Chloride intracellular channel protein 4,
Chloride intracellular channel protein 5, CHRNA3 protein, Clcn3e
protein, CLCNKB protein, CNGA4 protein, Cullin-5, Cyclic GMP gated
potassium channel, Cyclic-nucleotide-gated cation channel 4,
Cyclic-nucleotide-gated cation channel alpha 3,
Cyclic-nucleotide-gated cation channel beta 3,
Cyclic-nucleotide-gated olfactory channel, Cystic fibrosis
transmembrane conductance regulator, Cytochrome B-245 heavy chain,
Dihydropyridine-sensitive L-type, calcium channel alpha-2/delta
subunits precursor, FXYD domain-containing ion transport regulator
3 precursor, FXYD domain-containing ion transport regulator 5
precursor, FXYD domain-containing ion transport regulator 6
precursor, FXYD domain-containing ion transport regulator 7, FXYD
domain-containing ion transport regulator 8 precursor, G
protein-activated inward rectifier potassium channel 1, G
protein-activated inward rectifier potassium channel 2, G
protein-activated inward rectifier potassium channel 3, G
protein-activated inward rectifier potassium channel 4,
Gamma-aminobutyric-acid receptor alpha-1 subunit precursor,
Gamma-aminobutyric-acid receptor alpha-2 subunit precursor,
Gamma-aminobutyric-acid receptor alpha-3 subunit precursor,
Gamma-aminobutyric-acid receptor alpha-4 subunit precursor,
Gamma-aminobutyric-acid receptor alpha-5 subunit precursor,
Gamma-aminobutyric-acid receptor alpha-6 subunit precursor,
Gamma-aminobutyric-acid receptor beta-1 subunit precursor,
Gamma-aminobutyric-acid receptor beta-2 subunit precursor,
Gamma-aminobutyric-acid receptor beta-3 subunit precursor,
Gamma-aminobutyric-acid receptor delta subunit precursor,
Gamma-aminobutyric-acid receptor epsilon subunit precursor,
Gamma-aminobutyric-acid receptor gamma-1 subunit precursor,
Gamma-aminobutyric-acid receptor gamma-3 subunit precursor,
Gamma-aminobutyric-acid receptor pi subunit precursor,
Gamma-aminobutyric-acid receptor rho-1 subunit precursor,
Gamma-aminobutyric-acid receptor rho-2 subunit precursor,
Gamma-aminobutyric-acid receptor theta subunit precursor, GluR6
kainate receptor, Glutamate receptor 1 precursor, Glutamate
receptor 2 precursor, Glutamate receptor 3 precursor, Glutamate
receptor 4 precursor, Glutamate receptor 7, Glutamate receptor B,
Glutamate receptor delta-1 subunit precursor, Glutamate receptor,
ionotropic kainate 1 precursor, Glutamate receptor, ionotropic
kainate 2 precursor, Glutamate receptor, ionotropic kainate 3
precursor, Glutamate receptor, ionotropic kainate 4 precursor,
Glutamate receptor, ionotropic kainate 5 precursor, Glutamate
[NMDA] receptor subunit 3A precursor, Glutamate [NMDA] receptor
subunit 3B precursor, Glutamate [NMDA] receptor subunit epsilon 1
precursor, Glutamate [NMDA] receptor subunit epsilon 2 precursor,
Glutamate [NMDA] receptor subunit epsilon 4 precursor, Glutamate
[NMDA] receptor subunit zeta 1 precursor, Glycine receptor alpha-1
chain precursor, Glycine receptor alpha-2 chain precursor, Glycine
receptor alpha-3 chain precursor, Glycine receptor beta chain
precursor, H/ACA ribonucleoprotein complex subunit 1, High affinity
immunoglobulin epsilon receptor beta-subunit, Hypothetical protein
DKFZp31310334, Hypothetical protein DKFZp761M1724, Hypothetical
protein FLJ12242, Hypothetical protein FLJ14389, Hypothetical
protein FLJ14798, Hypothetical protein FLJ14995, Hypothetical
protein FLJ16180, Hypothetical protein FLJ16802, Hypothetical
protein FLJ32069, Hypothetical protein FLJ37401, Hypothetical
protein FLJ38750, Hypothetical protein FLJ40162, Hypothetical
protein FLJ41415, Hypothetical protein FLJ90576, Hypothetical
protein FLJ90590, Hypothetical protein FLJ90622, Hypothetical
protein KCTD15, Hypothetical protein MGC15619, Inositol
1,4,5-trisphosphate receptor type 1, Inositol 1,4,5-trisphosphate
receptor type 2, Inositol 1,4,5-trisphosphate receptor type 3,
Intermediate conductance calcium-activated potassium channel
protein 4, Inward rectifier potassium channel 13, Inward rectifier
potassium channel 16, Inward rectifier potassium channel 4, Inward
rectifying K(+) channel negative regulator Kir2.2v, Kainate
receptor subunit KA2a, KCNH5 protein, KCTD17 protein, KCTD2
protein, Keratinocytes associated transmembrane protein 1, Kv
channel-interacting protein 4, Melastatin 1, Membrane protein MLC1,
MGC15619 protein, Mucolipin-1, Mucolipin-2, Mucolipin-3, Multidrug
resistance-associated protein 4, N-methyl-D-aspartate receptor 2C
subunit precursor, NADPH oxidase homolog 1, Nav1.5, Neuronal
acetylcholine receptor protein, alpha-10 subunit precursor,
Neuronal acetylcholine receptor protein, alpha-2 subunit precursor,
Neuronal acetylcholine receptor protein, alpha-3 subunit precursor,
Neuronal acetylcholine receptor protein, alpha-4 subunit precursor,
Neuronal acetylcholine receptor protein, alpha-5 subunit precursor,
Neuronal acetylcholine receptor protein, alpha-6 subunit precursor,
Neuronal acetylcholine receptor protein, alpha-7 subunit precursor,
Neuronal acetylcholine receptor protein, alpha-9 subunit precursor,
Neuronal acetylcholine receptor protein, beta-2 subunit precursor,
Neuronal acetylcholine receptor protein, beta-3 subunit precursor,
Neuronal acetylcholine receptor protein, beta-4 subunit precursor,
Neuronal voltage-dependent calcium channel alpha 2D subunit, P2X
purinoceptor 1, P2X purinoceptor 2, P2X purinoceptor 3, P2X
purinoceptor 4, P2X purinoceptor 5, P2X purinoceptor 6, P2X
purinoceptor 7, Pancreatic potassium channel TALK-1b, Pancreatic
potassium channel TALK-1c, Pancreatic potassium channel TALK-1d,
Phospholemman precursor, Plasmolipin, Polycystic kidney disease 2
related protein, Polycystic kidney disease 2-like 1 protein,
Polycystic kidney disease 2-like 2 protein, Polycystic kidney
disease and receptor for egg jelly related protein precursor,
Polycystin-2, Potassium channel regulator, Potassium channel
subfamily K member 1, Potassium channel subfamily K member 10,
Potassium channel subfamily K member 12, Potassium channel
subfamily K member 13, Potassium channel subfamily K member 15,
Potassium channel subfamily K member 16, Potassium channel
subfamily K member 17, Potassium channel subfamily K member 2,
Potassium channel subfamily K member 3, Potassium channel subfamily
K member 4, Potassium channel subfamily K member 5, Potassium
channel subfamily K member 6, Potassium channel subfamily K member
7, Potassium channel subfamily K member 9, Potassium channel
tetramerisation domain containing 3, Potassium channel
tetramerisation domain containing protein 12, Potassium channel
tetramerisation domain containing protein 14, Potassium channel
tetramerisation domain containing protein 2, Potassium channel
tetramerisation domain containing protein 4, Potassium channel
tetramerisation domain containing protein 5, Potassium channel
tetramerization domain containing 10, Potassium channel
tetramerization domain containing protein 13, Potassium channel
tetramerization domain-containing 1, Potassium voltage-gated
channel subfamily A member 1, Potassium voltage-gated channel
subfamily A member 2, Potassium voltage-gated channel subfamily A
member 4, Potassium voltage-gated channel subfamily A member 5,
Potassium voltage-gated channel subfamily A member 6, Potassium
voltage-gated channel subfamily B member 1, Potassium voltage-gated
channel subfamily B member 2, Potassium voltage-gated channel
subfamily C member 1, Potassium voltage-gated channel subfamily C
member 3, Potassium voltage-gated channel subfamily C member 4,
Potassium voltage-gated channel subfamily D member 1, Potassium
voltage-gated channel subfamily D member 2, Potassium voltage-gated
channel subfamily D member 3, Potassium voltage-gated channel
subfamily E member 1, Potassium voltage-gated channel subfamily E
member 2, Potassium voltage-gated channel subfamily E member 3,
Potassium voltage-gated channel subfamily E member 4, Potassium
voltage-gated channel subfamily F member 1, Potassium voltage-gated
channel subfamily E member 1, Potassium voltage-gated channel
subfamily G member 2, Potassium voltage-gated channel subfamily G
member 3, Potassium voltage-gated channel subfamily G member 4,
Potassium voltage-gated channel subfamily H member 1, Potassium
voltage-gated channel subfamily H member 2, Potassium voltage-gated
channel subfamily H member 3, Potassium voltage-gated channel
subfamily H member 4, Potassium voltage-gated channel subfamily H
member 5, Potassium voltage-gated channel subfamily H member 6,
Potassium voltage-gated channel subfamily H member 7, Potassium
voltage-gated channel subfamily H member 8, Potassium voltage-gated
channel subfamily KQT member 1, Potassium voltage-gated channel
subfamily KQT member 2, Potassium voltage-gated channel subfamily
KQT member 3, Potassium voltage-gated channel subfamily KQT member
4, Potassium voltage-gated channel subfamily KQT member 5,
Potassium voltage-gated channel subfamily S member 1, Potassium
voltage-gated channel subfamily S member 2, Potassium voltage-gated
channel subfamily S member 3, Potassium voltage-gated channel
subfamily V member 2, Potassium voltage-gated channel, subfamily H,
member 7, isoform 2, Potassium/sodium hyperpolarization-activated
cyclic nucleotide-gated channel 1, Potassium/sodium
hyperpolarization-activated cyclic nucleotide-gated channel 2,
Potassium/sodium hyperpolarization-activated cyclic
nucleotide-gated channel 3, Potassium/sodium
hyperpolarization-activated cyclic nucleotide-gated channel 4,
Probable mitochondrial import receptor subunit TOM40 homolog,
Purinergic receptor P2X5, isoform A, Putative 4 repeat
voltage-gated ion channel, Putative chloride channel protein 7,
Putative GluR6 kainate receptor, Putative ion channel protein
CATSPER2 variant 1, Putative ion channel protein CATSPER2 variant
2, Putative ion channel protein CATSPER2 variant 3, Putative
regulator of potassium channels protein variant 1, Putative
tyrosine-protein phosphatase TPTE, Ryanodine receptor 1, Ryanodine
receptor 2, Ryanodine receptor 3, SH3 KBP1 binding protein 1, Short
transient receptor potential channel 1, Short transient receptor
potential channel 4, Short transient receptor potential channel 5,
Short transient receptor potential channel 6, Short transient
receptor potential channel 7, Small conductance calcium-activated
potassium channel protein 1, Small conductance calcium-activated
potassium channel protein 2, isoform b, Small conductance
calcium-activated potassium channel protein 3, isoform b,
Small-conductance calcium-activated potassium channel SK2,
Small-conductance calcium-activated potassium channel SK3, Sodium
channel, Sodium channel beta-1 subunit precursor, Sodium channel
protein type II alpha subunit, Sodium channel protein type III
alpha subunit, Sodium channel protein type IV alpha subunit, Sodium
channel protein type IX alpha subunit, Sodium channel protein type
V alpha subunit, Sodium channel protein type VII alpha subunit,
Sodium channel protein type VIII alpha subunit, Sodium channel
protein type X alpha subunit, Sodium channel protein type XI alpha
subunit, Sodium- and chloride-activated ATP-sensitive potassium
channel, Sodium/potassium-transporting ATPase gamma chain,
Sperm-associated cation channel 1, Sperm-associated cation channel
2, isoform 4, Syntaxin-1B1, Transient receptor potential cation
channel subfamily A member 1, Transient receptor potential cation
channel subfamily M member 2, Transient receptor potential cation
channel subfamily M member 3, Transient receptor potential cation
channel subfamily M member 6, Transient receptor potential cation
channel subfamily M member 7, Transient receptor potential cation
channel subfamily V member 1, Transient receptor potential cation
channel subfamily V member 2, Transient receptor potential cation
channel subfamily V member 3, Transient receptor potential cation
channel subfamily V member 4, Transient receptor potential cation
channel subfamily V member 5, Transient receptor potential cation
channel subfamily V member 6, Transient receptor potential channel
4 epsilon splice variant, Transient receptor potential channel 4
zeta splice variant, Transient receptor potential channel 7 gamma
splice variant, Tumor necrosis factor, alpha-induced protein 1,
endothelial, Two-pore calcium channel protein 2, VDAC4 protein,
Voltage gated potassium channel Kv3.2b, Voltage gated sodium
channel beta 1B subunit, Voltage-dependent anion channel,
Voltage-dependent anion channel 2, Voltage-dependent
anion-selective channel protein 1, Voltage-dependent
anion-selective channel protein 2, Voltage-dependent
anion-selective channel protein 3, Voltage-dependent calcium
channel gamma-1 subunit, Voltage-dependent calcium channel gamma-2
subunit, Voltage-dependent calcium channel gamma-3 subunit,
Voltage-dependent calcium channel gamma-4 subunit,
Voltage-dependent calcium channel gamma-5 subunit,
Voltage-dependent calcium channel gamma-6 subunit,
Voltage-dependent calcium channel gamma-7 subunit,
Voltage-dependent calcium channel gamma-8 subunit,
Voltage-dependent L-type calcium channel alpha-1C subunit,
Voltage-dependent L-type calcium channel alpha-1D subunit,
Voltage-dependent L-type calcium channel alpha-1S subunit,
Voltage-dependent L-type calcium channel beta-1 subunit,
Voltage-dependent L-type calcium channel beta-2 subunit,
Voltage-dependent L-type calcium channel beta-3 subunit,
Voltage-dependent L-type calcium channel beta-4 subunit,
Voltage-dependent N-type calcium channel alpha-1B subunit,
Voltage-dependent P/Q-type calcium channel alpha-1A subunit,
Voltage-dependent R-type calcium channel alpha-1E subunit,
Voltage-dependent T-type calcium channel alpha-1G subunit,
Voltage-dependent T-type calcium channel alpha-1H subunit,
Voltage-dependent T-type calcium channel alpha-1I subunit,
Voltage-gated L-type calcium channel alpha-1 subunit, Voltage-gated
potassium channel beta-1 subunit, Voltage-gated potassium channel
beta-2 subunit, Voltage-gated potassium channel beta-3 subunit,
Voltage-gated potassium channel KCNA7.
[0231] Exemplary GPCRs include but are not limited to Class A
Rhodopsin like receptors such as Musc. acetylcholine Vertebrate
type 1, Musc. acetylcholine Vertebrate type 2, Musc. acetylcholine
Vertebrate type 3, Musc. acetylcholine Vertebrate type 4;
Adrenoceptors (Alpha Adrenoceptors type 1, Alpha Adrenoceptors type
2, Beta Adrenoceptors type 1, Beta Adrenoceptors type 2, Beta
Adrenoceptors type 3, Dopamine Vertebrate type 1, Dopamine
Vertebrate type 2, Dopamine Vertebrate type 3, Dopamine Vertebrate
type 4, Histamine type 1, Histamine type 2, Histamine type 3,
Histamine type 4, Serotonin type 1, Serotonin type 2, Serotonin
type 3, Serotonin type 4, Serotonin type 5, Serotonin type 6,
Serotonin type 7, Serotonin type 8, other Serotonin types, Trace
amine, Angiotensin type 1, Angiotensin type 2, Bombesin,
Bradykinin, C5a anaphylatoxin, Finet-leu-phe, APJ like,
Interleukin-8 type A, Interleukin-8 type B, Interleukin-8 type
others, C--C Chemokine type 1 through type 11 and other types,
C--X--C Chemokine (types 2 through 6 and others), C--X3-C
Chemokine, Cholecystokinin CCK, CCK type A, CCK type B, CCK others,
Endothelin, Melanocortin (Melanocyte stimulating hormone,
Adrenocorticotropic hormone, Melanocortin hormone), Duffy antigen,
Prolactin-releasing peptide (GPR10), Neuropeptide Y (type 1 through
7), Neuropeptide Y, Neuropeptide Y other, Neurotensin, Opioid (type
D, K, M, X), Somatostatin (type 1 through 5), Tachykinin (Substance
P (NK1), Substance K (NK2), Neuromedin K (NK3), Tachykinin like 1,
Tachykinin like 2, Vasopressin/vasotocin (type 1 through 2),
Vasotocin, Oxytocin/mesotocin, Conopressin, Galanin like,
Proteinase-activated like, Orexin & neuropeptides FF, QRFP,
Chemokine receptor-like, Neuromedin U like (Neuromedin U,
PRXamide), hormone protein (Follicle stimulating hormone,
Lutropin-choriogonadotropic hormone, Thyrotropin, Gonadotropin type
I, Gonadotropin type II), (Rhod)opsin, Rhodopsin Vertebrate (types
1-5), Rhodopsin Vertebrate type 5, Rhodopsin Arthropod, Rhodopsin
Arthropod type 1, Rhodopsin Arthropod type 2, Rhodopsin Arthropod
type 3, Rhodopsin Mollusc, Rhodopsin, Olfactory (Olfactory II fam 1
through 13), Prostaglandin (prostaglandin E2 subtype EP1,
Prostaglandin E2/D2 subtype EP2, prostaglandin E2 subtype EP3,
Prostaglandin E2 subtype EP4, Prostaglandin F2-alpha, Prostacyclin,
Thromboxane, Adenosine type 1 through 3, Purinoceptors,
Purinoceptor P2RY1-4,6,11 GPR91, Purinoceptor P2RY5,8,9,10
GPR35,92,174, Purinoceptor P2RY12-14 GPR87 (UDP-Glucose),
Cannabinoid, Platelet activating factor, Gonadotropin-releasing
hormone, Gonadotropin-releasing hormone type I,
Gonadotropin-releasing hormone type II, Adipokinetic hormone like,
Corazonin, Thyrotropin-releasing hormone & Secretagogue,
Thyrotropin-releasing hormone, Growth hormone secretagogue, Growth
hormone secretagogue like, Ecdysis-triggering hormone (ETHR),
Melatonin, Lysosphingolipid & LPA (EDG), Sphingosine
1-phosphate Edg-1, Lysophosphatidic acid Edg-2, Sphingosine
1-phosphate Edg-3, Lysophosphatidic acid Edg-4, Sphingosine
1-phosphate Edg-5, Sphingosine 1-phosphate Edg-6, Lysophosphatidic
acid Edg-7, Sphingosine 1-phosphate Edg-8, Edg Other Leukotriene B4
receptor, Leukotriene B4 receptor BLT1, Leukotriene B4 receptor
BLT2, Class A Orphan/other, Putative neurotransmitters, SREB, Mas
proto-oncogene & Mas-related (MRGs), GPR45 like, Cysteinyl
leukotriene, G-protein coupled bile acid receptor, Free fatty acid
receptor (GP40, GP41, GP43), Class B Secretin like, Calcitonin,
Corticotropin releasing factor, Gastric inhibitory peptide,
Glucagon, Growth hormone-releasing hormone, Parathyroid hormone,
PACAP, Secretin, Vasoactive intestinal polypeptide, Latrophilin,
Latrophilin type 1, Latrophilin type 2, Latrophilin type 3, ETL
receptors, Brain-specific angiogenesis inhibitor (BAI),
Methuselah-like proteins (MTH), Cadherin EGF LAG (CELSR), Very
large G-protein coupled receptor, Class C Metabotropic
glutamate/pheromone, Metabotropic glutamate group I through III,
Calcium-sensing like, Extracellular calcium-sensing, Pheromone,
calcium-sensing like other, Putative pheromone receptors, GABA-B,
GABA-B subtype 1, GABA-B subtype 2, GABA-B like, Orphan GPRC5,
Orphan GPCR6, Bride of sevenless proteins (BOSS), Taste receptors
(TIR), Class D Fungal pheromone, Fungal pheromone A-Factor like
(STE2,STE3), Fungal pheromone B like (BAR,BBR,RCB,PRA), Class E
cAMP receptors, Ocular albinism proteins, Frizzled/Smoothened
family, frizzled Group A (Fz 1&2&4&5&7-9), frizzled
Group B (Fz 3 & 6), frizzled Group C (other), Vomeronasal
receptors, Nematode chemoreceptors, Insect odorant receptors, and
Class Z Archaeal/bacterial/fungal opsins.
[0232] The subject MURPs can be designed to target any cellular
proteins including but not limited to cell surface protein,
secreted protein, cytosolic protein, and nuclear protein. A target
of particular interest is an ion channel.
[0233] Ion channels constitute a superfamily of proteins, including
the family of potassium channels (K-channels), the family of sodium
channels (Na-channels), the family of calcium channels
(Ca-channels), the family of Chlorine channels (Cl-channels) and
the family of acetylcholine channels. Each of these families
contains subfamilies and each subfamily typically contains specific
channels derived from single genes. For example, the K-channel
family contains subfamilies of voltage-gated K-channels called
Kv1.x and Kv3.x. The subfamily Kv1.x contains the channels Kv1.1,
Kv1.2 and Kv1.3, which correspond to the products of single genes
and are thus called `species`. The classification applies to the
Na-, Ca-, Cl- and other families of channels as well.
[0234] Ion channels can also be classified according to the
mechanisms by which the channels are operated. Specifically, the
main types of ion channel proteins are characterized by the method
employed to open or close the channel protein to either permit or
prevent specific ions from permeating the channel protein and
crossing a lipid bilayer cellular membrane. One important type of
channel protein is the voltage-gated channel protein, which is
opened or closed (gated) in response to changes in electrical
potential across the cell membrane. The voltage-gated sodium
channel 1.6 (Nav1.6) is of particular interest as a therapeutic
target. Another type of ion channel protein is the mechanically
gated channel, for which a mechanical stress on the protein opens
or closes the channel. Still another type is called a ligand-gated
channel, which opens or closes depending on whether a particular
ligand is bound to the protein. The ligand can be either an
extracellular moiety, such as a neurotransmitter, or an
intracellular moiety, such as an ion or nucleotide.
[0235] Ion channels generally permit passive flow of ions down an
electrochemical gradient, whereas ion pumps use ATP to transport
against a gradient. Coupled transporters, both antiporters and
symporters, allow movement of one ion species against its gradient,
powered by the downhill movement of another ion species.
[0236] One of the most common types of channel proteins, found in
the membrane of almost all animal cells, permits the specific
permeation of potassium ions across a cell membrane. In particular,
potassium ions permeate rapidly across cell membranes through
K.sup.+ channel proteins (up to 10.sup.-8 ions per second).
Moreover, potassium channel proteins have the ability to
distinguish among potassium ions, and other small alkali metal
ions, such as Li.sup.+ or Na.sup.+ with great fidelity. In
particular, potassium ions are at least ten thousand times more
permanent than sodium ions. Potassium channel proteins typically
comprise four (usually identical) subunits, so their cell surface
targets are present as tetramers, allowing tetravalent binding of
MURPs. One type of subunit contains six long hydrophobic segments
(which can be membrane-spanning), while the other types contains
two hydrophobic segments.
[0237] Another significant family of channels is calcium channel.
Calcium channels are generally classified according to their
electrophysiological properties as Low-voltage-activated (LVA) or
High-voltage-activated (HVA) channels. HVA channels comprises at
least three groups of channels, known as L-, N- and P/Q-type
channels. These channels have been distinguished one from another
electrophysiologically as well as bio-chemically on the basis of
their pharmacology and ligand binding properties. For instance,
dihydropyridines, diphenyl-alkylamines and piperidines bind to the
.alpha..sub.1 subunit of the L-type calcium channel and block a
proportion of HVA calcium currents in neuronal tissue, which are
termed L-type calcium currents. N-type calcium channels are
sensitive to omega conopeptides, but are relatively insensitive to
dihydropyridine compounds, such as nimodipine and nifedipine.
P/Q-type channels, on the other hand, are insensitive to
dihydropyridines, but are sensitive to the funnel web spider toxin
Aga IIIA. R-type calcium channels, like L-, N-, P- and Q-type
channels, are activated by large membrane depolarizations, and are
thus classified as high voltage-activated (HVA) channels. R-type
channels are generally insensitive to dihydropyridines and omega
conopeptides, but, like P/Q, L and N channels, are sensitive to the
funnel web spider toxin AgaIVA. Immunocytochemical staining studies
indicate that these channels are located throughout the brain,
particularly in deep midline structures (caudate-putamen, thalamus,
hypothalamus, amygdala, cerebellum) and in the nuclei of the
ventral midbrain and brainstem. Neuronal voltage-sensitive calcium
channels typically consists of a central .alpha..sub.1. subunit, an
.alpha..sub.2/.delta. subunit, a .beta. subunit and a 95 kD
subunit.
[0238] Additional non-limiting examples include Kir (an inwardly
rectified potassium channel), Kv (a voltage-gated potassium
channel), Nav (a voltage-gated sodium channel), Cav (a
voltage-gated calcium channel), CNG (cyclic nucleotide-gated
channel), HCN (hyperpolarization-activated channel), TRP (a
transient receptor potential channel), ClC (a chloride channel),
CFTR (a cystic fibrosis transmembrane conductance regulator, a
chloride channel), IP3R (a inositol trisphosphate receptor), RYR (a
ryanodine receptor). Other channel types are 2-pore channels,
glutamate-receptors (AMPA, NMDA, KA), M2, Connexins and Cys-loop
receptors.
[0239] A common layout for ion channel proteins, such as Kv1.2,
Kv3.1, Shaker; TRPC1 and TRPC5 is to have six membrane-spanning
segments, arranged as follows: [0240]
N-terminus---S1---E1---S2---X1---S3---E2---S4---X2---S5---E3---S6---C-ter-
minus
[0241] Wherein S1-6 are membrane-spanning sequences, E1-3 are
extracellular surface loops and X1-2 are intracellular surface
loops. The E3 loop is generally the longest of the three
extracellular loops and is hydrophilic so it is a good target for
drugs and MURPs to bind. The pore-forming part of most channels is
a multimeric (e.g. tetrameric or rarely pentameric) complex of
membrane-spanning alpha-helices. There is generally a pore loop,
which is a region of the protein that loops back into the membrane
to form the selectivity filter that determines which ion species
can permeate. Such channels are called `pore-loop` channels.
[0242] The ion channels are valuable targets for drug design
because they are involved in a broad range of physiological
processes. In human, there exist approximately over three hundreds
of ion channel proteins, many of which have been implicated in
genetic diseases. For example, abbrebrant expression or function of
ion channels has been shown to cause a wide arrange of diseases
including cardiac, neuronal, muscular, respiratory metabolic
diseases. This section focuses on ion channels, but the same
concepts and approaches are equally applicable to all membrane
proteins, including 7TMs, 1TMs, G-proteins and G-Protein Coupled
receptors (GPCRs), etc. Some of the ion channels are GPCRs.
[0243] Ion channels typically form large macromolecular complexes
that include tightly bound accessory protein subunits and
combinatorial use of such subunits contributes to the diversity of
ion channels. These accessory proteins can also be the binding
targets of the subject MURPs, microproteins and toxins.
[0244] The subject MURPs can be designed to bind any of the
channels known in the art and to those specifically exemplified
herein. MURPs exhibiting a desired ion channel binding capability
(encompassing specificity and avidity) can be selected by any
recombinant and biochemical (e.g. expression and display)
techniques known in the art. For instance, MURPs can be displayed
by a genetic package including but not limited to phages and
spores, and be subjected to panning against intact cell membranes,
or preferably intact cells such as whole mammalian cells. To remove
the phage that bind to the other, non-target cell surface
molecules, the standard approach was to perform subtraction panning
against similar cell lines that had a low or non-detectable level
of the target receptor. However, Popkov et al. (J. Immunol. Methods
291:137-151 (2004)) showed that related cell types are not ideal
for subtraction because they generally have a reduced but still
significant level of the target on their surface, which reduces the
number of desired phage clones. This problem occurs even when
panning on cells that have been transfected with the gene encoding
the target, followed by negative selection/subtraction on the same
cell-line which was not transfected, especially when the native
target gene was not knocked out. Instead, Popkov et al. showed that
the negative selection or subtraction panning works much better if
performed with an excess of the same cells that are used for normal
panning (positive selection), except that the target has now been
blocked with a high-affinity, target-specific inhibitor, such as a
small molecule, peptide or an antibody to the target, which makes
the active site unavailable. This process is called "negative
selection with epitope-masked cells", which is particularly useful
in selecting the subject MURPs with a desired ion-channel binding
capability.
[0245] In a separate embodiment, the present invention provides
microproteins, and particularly microproteins exhibiting binding
capability towards at least one family of ion channels. The present
invention also provides a genetic package displaying such
microproteins. Non-limiting ion-channel examples to which the
subject microproteins bind are sodium, potassium, calcium,
acetylcholine, and chlorine channels. Of particular interest are
those microproteins and the genetic packages displaying such
microproteins, which exhibit binding capability towards native
targets. Native targets are generally natural molecules or
fragments, derivatives thereof that the microprotein is known to
bind, typically including those known binding targets that have
been reported in the literature.
[0246] The subject invention also provides a genetic package
displaying an ion-channel-binding microprotein which has been
modified. The modified microprotein may (a) binds to a different
family of channel as compared to the corresponding unmodified
microprotein; (b) binds to a different subfamily of the same
channel family as compared to the corresponding unmodified
microprotein; (c) binds to a different species of the same
subfamily of channel as compared to the corresponding unmodified
microprotein; (d) the microprotein binds to a different site on the
same channel as compared to the corresponding unmodified
microprotein; and/or (e) binds to the same site of the same channel
but yield a different biological effect as compared to the
corresponding unmodified microprotein.
[0247] FIGS. 22 and 46 show how microprotein domains or toxins that
each bind at different sites of the same ion channel can be
combined into a single protein. The two binding sites that these
two microproteins bind to can be on two channels from different
families, two channels from the same family but a different
subfamily, two channels from the same subfamily but a different
species (gene product), or two different binding sites on the same
channel (species) or they can (simultaneously or not) bind the same
binding site on the same channel (species) since the channels are
multimeric. The binding modules and domains that bind to sites on
the channels can be microprotein domains (natural or non-natural,
2- to 8-disulfide containing), one-disulfide peptides, or linear
peptides. These modules can be selected independently and combined,
or one can be selected from a library to bind in the presence of
one fixed, active binding module. In the latter case, the display
library would display multiple modules of which one would contain a
library of variants. A typical goal is to select a dimer from this
library that has a higher affinity than the active monomer that was
the starting point.
[0248] In another embodiment, the present invention provides a
protein comprising a plurality of ion-channel binding domains,
wherein individual domains are microprotein domains that have been
modified such that (a) the microprotein domains bind to a different
family of channel as compared to the corresponding unmodified
microprotein domains; (b) the microprotein domains bind to a
different subfamily of the same channel family as compared to the
corresponding unmodified microprotein domains; (c) the microprotein
domains bind to a different species of the same subfamily as
compared to the corresponding unmodified microprotein domains; (d)
the microprotein domains bind to a different site on the same
channel as compared to the corresponding unmodified microprotein
domains; (e) the microprotein domains bind to the same site of the
same channel but yield a different biological effect as compared to
the corresponding unmodified microprotein domains; and/or (f) the
microprotein domains bind to the same site of the same channel and
yield the same biological effect as compared to the corresponding
unmodified microprotein domains. Where desired, the microprotein
domains may comprise natural or non-natural sequences. The
individual domains can be linked together via a heterologous
linker. The individual microprotein domains can bind to the same or
different channel family, same or different channel subfamily, same
or different species of the same subfamily, same or different site
on the same channel.
[0249] The subject microproteins can be a toxin. Preferably, the
toxin retains in part or in whole its toxicity spectrum. In
particular, venomous animals, such as snakes, encounter a range of
prey and intruder species and the venom toxins differ in activity
for the different receptors of the different species. The venom
consists of a large number of related and unrelated toxins, with
each toxin having a "spectrum of activity", which can be defined as
all of the receptors from all of the species on which that toxin
has measurable activity. All of the targets in the `spectrum of
activity` are considered "native targets" and this includes any
human targets that the toxin is active against. The native
target(s) of a microprotein or toxin include all of the targets
that the toxin is reported to inhibit in the literature. The higher
the affinity or activity on a target, the more likely that target
is the natural, native target, but it is not uncommon for toxins to
act on multiple targets within the same species. Native target(s)
can be human or non-human receptors that the toxin is active
against.
[0250] For the toxin to retain the ability to bind to cells after
fusion to the display vector, it may be desirable to test both the
N-terminus and C-terminus for fusion and to test a variety of
fusion sites (i.e., 0, 1, 2, 3, 4, 5, 6 amino acids before the
first cysteine or after the last cysteine of the toxin domain, if
the toxin domain is a cysteine-containing domain) using a synthetic
DNA library approach, preferably encoding a library of glycine-rich
linkers, which form the smallest amino acid chain, are uncharged
and are most likely to be compatible with binding of the toxin to
the target. Since the N-terminal amino group and the C-terminal
carboxyl groups may be involved in target binding, the library
should contain a lysine or a arginine to mimic the positively
charged amino group (or fusions to the N-terminus of the toxin) and
a glutamate or an aspartate to mimic the negatively charged
carboxyl group (for fusions to the C-terminus of the toxin).
[0251] The inhibitor(s) that are used to block the target during
negative selection can be small molecules, peptides or proteins,
and natural or non-natural. In addition to simple subtraction, the
choice of the mixture of inhibitors is a valuable tool to control
the specificity of the ion channel inhibitors that are being
designed. Because there are over three hundreds ion channels in
total, with partially overlapping specificities and sequence
similarities, and multiple modulatory sites per channel, each
having a different effect, the specificity requirement can be
complex.
[0252] When modifying the activity of a toxin, or when combining
two different toxins into a single protein, the two toxins can bind
the same channel at the same site and have the same physiologic
effect, or the two toxins can bind the same channel at the same
site and have a different physiologic effect, or the two toxins can
bind to the same channel at a different site, or the two toxins can
bind to different channels that belong to the same subfamily (i.e.
Kv1.3 and Kv1.2; meaning product of a different gene or `species`),
or the two toxins can bind to different channels that belong to the
same family (i.e. both are K-channels), or the two toxins can bind
to channels that belong to different families (i.e. K-channels
versus Na-channels).
[0253] Ion channels typically have many transmembrane segments (24
for sodium channels) and thus offer a number of different,
non-competing and non-overlapping binding sites for modulators to
alter the activity of the channel in different ways. One approach
is to create binders for one site on the same ion channel from
existing binders for a different site, even if these sites are
unrelated. To achieve this, the existing toxin can be used as a
targeting agent for a library of 1-, 2-, 3-, or 4-disulfide
proteins that is separated from the targeting toxin by a flexible
linker of 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40 or
50 amino acids. It is useful if the affinity of the targeting agent
is not too high, so that the affinity of the new library can have a
significant contribution to the overall affinity. Another approach
is to create new modulators for channels from existing modulators
for other channels that are related in sequence or in structure.
The conotoxin family, for example, contains sequence-related and
structure-related modulators for Ca-, K, Na-channels and nicotinic
acetylcholine receptors. It appears feasible to convert a K-channel
modulator into a Na-channel modulator using a library of
conotoxin-derivatives, or vice versa. For example, Kappa-conotoxins
inhibit K-channels, Mu-conotoxins and Delta-conotoxins inhibit
Na-channels, Omega-conotoxins inhibit Ca-channels and
Alpha-conotoxins inhibit acetylcholine receptors.
[0254] The proximity of different binding sites, each with a
different effect on channel activity, from the same ion channel
makes it attractive to link the inhibitors using flexible linkers,
creating a single inhibitor with two domains, each binding at a
different site. Or a single protein with two domains that bind at
different copies of the same site, yielding a bivalent, high
affinity interaction (avidity). This approach has not been taken by
natural toxins, presumably because they must act fast and thus stay
small in order to have maximal tissue penetration, but for
pharmaceuticals the speed of action is less important, making this
is an attractive approach.
[0255] One can thus create combinatorial libraries of dimeric,
trimeric, tetrameric or multimeric toxins/modulators, each native
or modified, and directly screen these libraries at the protein
level or pan these libraries using genetic packages for improved
affinity (avidity, if binding occurs simultaneously at multiple
sites) and then characterize the specificity and activity of such
multimeric clones by protein expression and purification followed
by cell-based activity assays, including patch-clamp assays. The
individual modules can be panned and selected separately, in
isolation of each other, or they can be designed in each other's
presence, such that the new domain is added to a display system as
a library that also contain a fixed, active copy that serves as a
targeting element for the library and only clones that are
significantly better than the fixed, active monomer are selected
and characterized.
[0256] FIGS. 46 and 47 show some of the monomeric derivatives that
can be made from native (natural) toxins, and some of the multimers
that can be made to bind at multiple different binding sites of the
target. The linkers are shown as glycine-rich rPEG, but the linkers
could be any sequence and could also be optimized using molecular
libraries followed by panning. One can create libraries inside the
active, native toxin itself, using a variety of mutagenesis
strategies as describes above, or one can expand the existing area
of contact with the target by creating libraries on the N-terminal
or C-terminal side of the active toxin, hoping to create additional
contacts with the target. Such libraries can be based on existing
toxins with known activity for that site, or they can be or naive
1-, 2-, 3-, 4-disulfide libraries based on unrelated microprotein
scaffolds. These additional contact elements can be added on one or
both sides of the active domains, and can be directly adjacent to
the existing modulatory domain or they can be separated from it by
flexible linkers. The initial multimer or the final, improved
multimer can be a homomultimer or a heteromultimer, based on
sequence similarity of the domains or based on target specificity
of the domains of the multimer. Thus, the monomers that comprise
the multimer may bind to the same target sites but have the same or
different sequences. With 10-100 different native toxins that are
known to bind to each family of channels, and with 2, 3, 4, 5 or 6
domains per clone, display libraries with a huge combinatorial
diversity can be created even if one only uses native toxin
sequences. Low level synthetic mutagenesis based on amino acid
similarity or on phylogenetic substitution rates within the family
can be used to create high quality libraries of mutants, of which a
very high fraction is expected to retain function, with a high
probability of enhanced function in some of the properties of
interest.
[0257] The binding capability of the subject MURPs, microproteins,
or toxins to a given ion channel can be measured in terms of Hill
Coefficient. Hill Coefficient indicates the stoichiometry of the
binding interaction. A Hill coefficient of 2 indicates that 2
inhibitors bind to each channel. One can also assess the allosteric
modulation, which is modulation of activity at one site caused by
binding at a distant site.
[0258] The biological activity or effect of an ion channel and the
ability of the subject MURPs, microproteins or toxins to regulate
an ion channel activity can be assessed using a variety of in vitro
and in vivo assays. For instance, methods are available in the art
for measuring voltage, measuring current, measuring membrane
potential, measuring ion flux, e.g., potassium or rubidium,
measuring ion concentration, measuring gating, measuring second
messengers and transcription levels, and using e.g.,
voltage-sensitive dyes, radioactive tracers, and patch-clamp
electrophysiology. In particular such assays can be used to test
for microproteins and toxins that can inhibit or activate an ion
channel of interest.
[0259] Specifically, potential channel inhibitors or activators can
be tested in comparison to a suitable control to examine the extent
of modulation. Control samples can also be samples untreated with
the candidate activators or inhibitors. Inhibition is present when
a given ion channel activity value relative to the control is about
90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or even less. IC50 is
a commonly used unit (the concentration of inhibitor that reduces
the ion channel's activity by 50%) for determining the inhibitory
effect. Similar for IC90. Activation of channels is achieved when
the select a given ion channel activity value relative to the
control is increased by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 100%, 200%, 500%, or more.
[0260] Changes in ion flux may be assessed by determining changes
in polarization (i.e., electrical potential) of the cell or
membrane expressing the channel of interest. For instance, one
method is to determine changes in cellular polarization is by
measuring changes in current (thereby measuring changes in
polarization) with voltage-clamp and patch-clamp techniques, e.g.,
the "cell-attached" mode, the "inside-out" mode, and the "whole
cell" mode (see, e.g., Ackerman et al., New Engl. J. Med.
336:1575-1595 (1997)). Whole cell currents are conveniently
determined using the standard methodology (see, e.g., Hamil et al.,
Pflugers. Archiv. 391:85 (1981). Other known assays include:
radiolabeled rubidium flux assays and fluorescence assays using
voltage-sensitive dyes (see, e.g., Vestergarrd-Bogind et al., J.
Membrane Biol. 88:67-75 (1988); Daniel et al., J. Pharmacol. Meth.
25:185-193 (1991); Holevinsky et al., J. Membrane Biology 137:59-70
(1994)).
[0261] The effects of the candidate MURPs, microproteins, or toxins
upon the function of a channel of interest can be measured by
changes in the electrical currents or ionic flux or by the
consequences of changes in currents and flux. The downstream effect
of the candidate proteins on ion flux can be varied. Accordingly,
any suitable physiological change can be used to assess the
influence of a candidate protein on the test channels. The effects
of candidate protein can be measured by a toxin binding assay. When
the functional consequences are determined using intact cells or
animals, one can also measure a variety of effects such as
transmitter release (e.g., dopamine), hormone release (e.g.,
insulin), transcriptional changes to both known and uncharacterized
genetic markers (e.g., northern blots), cell volume changes (e.g.,
in red blood cells), immunoresponses (e.g., T cell activation),
changes in cell metabolism such as cell growth or pH changes, and
changes in intracellular second messengers such as Ca2.sup.+.
[0262] Other key biological activities of ion channels are ion
selectivity and gating. Selectivity is the ability of some channels
to discriminate between ion species, allowing some to pass through
the pore while excluding others. Gating is the transition between
open and closed states. They can be assessed by any of the methods
known in the art or disclosed herein
[0263] Yet another biological property that the subject MURP,
microprotein, or toxin can be selected for is the frequency of
opening and closing of the target channels, called Gating
Frequency. Gating Frequency is influenced by voltage (in voltage
gated channels, which are opened or closed by changes in membrane
voltage) and ligand-binding. The transition rate between open and
closed states is typically <10 microseconds but can be increased
or decreased by other molecules. The flux rate (current) through
the pore when it is open is on the order of 10e7 ions per second
for ion channels and much less for coupled exchangers. Following
opening, some voltage-gated channels enter an inactivated,
non-conducting state in which they are refractory to
depolarization.
EXAMPLES
Example
Design of a Glycine-Serine Oligomer Based on Human Sequences
[0264] The human genome data base was searched for sequences that
are rich in glycine. Three sequences were identified as suitable
donor sequences as shown in Table X.
TABLE-US-00005 TABLE X Donor sequences for GRS design A. Amino
Accession Sequences acid Protein NP_009060 GGGSGGGSGSGGGG 486-499
zinc finger protein Q9Y2X9 GSGSGGGGSGG 19-31 zinc finger protein
CAG38801 SGGGGSGGGSGSG 7-19 MAP2K4
[0265] Based on the sequences in Table X we designed a glycine rich
sequence that contains multiple repeats of the peptide A with
sequence GGGSGSGGGGS. Peptide A can be oligomerized to form
structures with the formula (GGGSGSGGGGS).sub.n where n is between
2 and 40. FIG. 5 shows that all possible 9mer subsequences in
oligomers of peptide A are contained in at least one of the
proteins listed in table 3. Thus oligomers of peptide A do not
contain human T cell epitopes. Inspection of FIG. 5 reveals that
GRS based on oligomers of peptide A can begin and end at any of the
positions of peptide A.
Example
Design of Glycine-Proline Oligomer Based on Human Sequences
[0266] Glycine rich sequences were designed based on sequence
GPGGGGGPGGGGGPGGGGPGGGGGGGPGGGGGGPGGG, which represents amino acids
146-182 of the human class 4 POU domain with accession number
NP.sub.--006228. FIG. 6 illustrates that oligomers of peptide B
with sequence GGGGGPGGGGP can be utilized as GRS. All 9mer
subsequences that are contained in peptides with the sequence
(GGGGGPGGGGP).sub.n are also contained in the sequence of the POU
domain. Thus, such oligomeric sequences do not contain T cell
epitopes.
Example
Design of Glycine-Glutamic Acid Oligomer
[0267] Glycine rich sequences can be designed based on the
subsequence GAGGEGGGGEGGGPGG that is part of the ribosomal protein
S6 kinase (accession number BAD92170). For instance, oligomers of
peptide C with the sequence GGGGE will form sequences where most
9mer subsequences will be contained in the sequence of ribosomal
protein S6 kinase. Thus, oligomeric GRS of the general structure
(GGGGE).sub.n bear a very low risk of containing T cell
epitopes.
Example
Identification of Human Hydrophilic Glycine-Rich Sequences
[0268] A data base of human proteins was searched for subsequences
that are rich in glycine residues. These subsequences contained at
least 50% glycine. Only the following non-glycine residues were
allowed to occur in the GRS: ADEHKPRST. 70 subsequences were
identified that had a minimum length of 20 amino acids. These
subsequences are listed in appendix A. They can be utilized to
construct GRS with low immunogenic potential in humans.
Example
Construction of rPEG_J288
[0269] The following example describes the construction of a codon
optimized gene encoding a URP sequence with 288 amino acids and the
sequence (GSGGEG).sub.48. First we constructed a stuffer vector
pCW0051 as illustrated in FIG. 40. The sequence of the expression
cassette in pCW0051 is shown in FIG. 42. The stuffer vector was
based on a pET vector and includes a T7 promoter. The vector
encodes a Flag sequence followed by a stuffer sequence that is
flanked by BsaI, BbsI, and KpnI sites. The BsaI and BbsI sites were
inserted such that they generate compatible overhangs after
digestion as illustrated in FIG. 42. The stuffer sequence was
followed by a His.sub.6 tag and the gene of green fluorescent
protein (GFP). The stuffer sequence contains stop codons and thus
E. coli cells carrying the stuffer plasmid pCW0051 formed
non-fluorescent colonies. The stuffer vector pCW0051 was digested
with BsaI and KpnI. A codon library encoding URP sequences of 36
amino acid length was constructed as shown in FIG. 41. The URP
sequence was designated rPEG_J36 and had the amino acid sequence
(GSGGEG).sub.6. The insert was obtained by annealing synthetic
oligonucleotide pairs encoding the amino acid sequence GSGGEGGSGGEG
as well as a pair of oligonucleotides that encode an adaptor to the
KpnI site. The following oligonucleotides were used: pr_LCW0057
for: AGGTAGTGGWGGWGARGGWGGWTCYGGWGGAGAAGG, pr_LCW0057rev:
[0270] ACCTCCTTCTCCWCCRGAWCCWCCYTCWCCWCCACT, pr.sub.--3
KpnIstopperFor: AGGTTCGTCTTCACTCGAGGGTAC, pr.sub.--3
KpnIstopperRev: CCTCGAGTGAAGACGA. The annealed oligonucleotide
pairs were ligated, which resulted in a mixture of products with
varying length that represents the varying number of rPEG_J12
repeats. The product corresponding to the length of rPEG_J36 was
isolated from the mixture by agarose gel electrophoresis and
ligated into the BsaI/KpnI digested stuffer vector pCW0051. Most of
the clones in the resulting library designated LCW0057 showed green
fluorescence after induction which shows that the sequence of
rPEG_J36 had been ligated in frame with the GFP gene. The process
of screening and iterative multimerization of rPEG_J36 sequences is
illustrated in FIG. 14. We screened 288 isolates from library
LCW0057 for high level of fluorescence. 48 isolates with strong
fluorescence were analyzed by PCR to verify the length of the
rPEG_J segment and 16 clones were identified that had the expected
length of rPEG_J36. This process resulted in a collection of 16
isolates of rPEG_J36, which show high expression and which differ
in their codon usage. The isolates were pooled and dimerized using
a process outlined in FIG. 40. A plasmid mixture was digested with
BsaI/NcoI and a fragment comprising the rPEG_J36 sequence and a
part of GFP was isolated. The same plasmid mixture was also
digested with BbsI/NcoI and the vector fragment comprising
rPEG_J36, most of the plasmid vector, and the remainder of the GFP
gene was isolated. Both fragments were mixed, ligated, and
transformed into BL21 and isolates were screened for fluorescence.
This process of dimerization was repeated two more rounds as
outlined in FIG. 14. During each round, we doubled the length of
the rPEG_J gene and ultimately obtained a collection of genes that
encode rPEG_J288. The amino acid and nucleotide sequence of
rPEG_J288 is shown in FIG. 15. It can be seen that the rPEG_J288
module contains segments of rPEG_J36 that differ in their
nucleotide sequence despite of having identical amino acid
sequence. Thus we minimized internal homology in the gene and as a
result we reduced the risk of spontaneous recombination. We
cultured E. coli BL21 harboring plasmids encoding rPEG_J288 for at
least 20 doublings and no spontaneous recombination was
observed.
Example
Construction of rPEG_H288
[0271] A library of genes encoding a 288 amino acid URP termed
rPEG_H288 was constructed using the same procedure that was used to
construct rPEG_J288. rPEG_H288 has the amino acid sequence
(GSGGEGGSGGSG).sub.24. The flow chart of the construction process
in shown in FIG. 14. The complete amino acid sequence as well as
the nucleotide sequence of one isolate of rPEG_H288 as given in
FIG. 16.
Example
Serum Stability of rPEG_J288
[0272] A fusion protein containing the an N-terminal Flag tag and
the URP sequence rPEG_J288 fused to the N-terminus of green
fluorescent protein was incubated in 50% mouse serum at 37 C for 3
days. Samples were withdrawn at various time points and analyzed by
SDS PAGE followed by detection using Western analysis. An antibody
against the N-terminal flag tag was used for Western detection.
Results are shown in FIG. 28, which indicate that a URP sequence of
288 amino acids can be completely stable in serum for at least
three days.
Example
Absence of Pre-Existing Antibodies to rPEG_J288 in Serum
[0273] Existence of antibodies against URP would be an indication
of a potential immunogenic response to this glycine rich sequence.
To test for the presence of existing antibodies in serum, an
URP-GFP fusion was subjected to an ELISA by immobilizing URP-GFP on
a support and subsequently incubating with 30% serum. The presence
of antibodies bound to URP-GFP were detected using an
anti-IgG-horse radish peroxidase antibody and substrate. The data
are shown in FIG. 29. The data show, that the fusion protein can be
detected by antibodies against GFP or Flag but not by murine serum.
This indicates that murine serum does not contain antibodies that
contain the URP sequence.
Example
Purification of a Fusion Protein Containing rPEG_J288
[0274] We purified a protein with the architecture
Flag-rPEG_J288-H6-GFP. The protein was expressed in E. coli BL21 in
SB medium. Cultures were induced with 0.5 mM IPTG overnight at 18
C. Cells were harvested by centrifugation. The pellet was
re-suspended in TBS buffer containing benzonase and a commercial
protease inhibitor cocktail. The suspension was heated for 10 min
at 75 C in a water bath to lyze the cells. Insoluble material was
removed by centrifugation. The supernatant was purified using
immobilized metal ion specificity (IMAC) followed by a column with
immobilized anti-Flag antibody. FIG. 43 shows PAGE analysis of the
purification process. The process yielded protein with at least 90%
purity.
Example
Construction of Fusion Protein Between rPEG_J288 and
Interferon-Alpha
[0275] A gene encoding human interferon alpha was designed using
codon optimization for E. coli expression. The synthetic gene was
fused with a gene encoding rPEG_J288. A His6 tag was placed at the
N-terminus to facilitate detection and purification, of the fusion
protein. The amino acid sequence of the fusion protein is given in
FIG. 44.
Example
Construction of rPEG_J288-G-CSF Fusion
[0276] A gene encoding human G-CSF was designed using codon
optimization for E. coli expression. The synthetic gene was fused
with a gene encoding rPEG_J288. A His6 tag was placed at the
N-terminus to facilitate detection and purification of the fusion
protein. The amino acid sequence of the fusion protein is given in
FIG. 44.
Example
Construction of rPEG_J288-hGH Fusion
[0277] A gene encoding human growth hormone was designed using
codon optimization for E. coli expression. The synthetic gene was
fused with a gene encoding rPEG_J288. A His6 tag was placed at the
N-terminus to facilitate detection and purification of the fusion
protein. The amino acid sequence of the fusion protein is given in
FIG. 44.
Example
Expression of Fusion Proteins Between rPEG_J288 and Human
Proteins
[0278] The fusion proteins between rPEG_J288 and two human
proteins, interferon-alpha and human growth hormone were cloned
into a T7 expression vector and transformed into E. coli BL21. The
cells were grown at 37 C to an optical density of 0.5 OD.
Subsequently, the cells were cultured at 18 C for 30 min. Then 0.5
mM IPTG was added and the cultures were incubated in a shaking
incubator at 18 C overnight. Cells were harvested by centrifugation
and soluble protein was released using BugBuster (Novagen). Both,
insoluble and soluble protein fractions were separated by SDS-PAGE
and the fusion proteins were detected by Western using and antibody
against the N-terminal His6 tag for detection. FIG. 45 shows the
Western analysis of the two fusion proteins as well as
rPEG_J288-GFP as control. All fusion proteins were expressed and
the majority of the protein was in the soluble fraction. This is
evidence of the high solubility of rPEG_J288 because most attempts
at expression of the interferon-alpha and human growth hormone in
the cytosol of E. coli, that have been reported in the literature,
resulted in the formation of insoluble inclusion bodies. FIG. 45
shows that the majority of fusion proteins are expressed as full
length proteins, i.e. no fragments that would suggest incomplete
synthesis or partial protein degradation were detected.
Example
Construction and Binding of aVEGF Multimer
[0279] Libraries of cysteine-constrained peptides were constructed
as published [Scholle, M. D., et al. (2005) Comb Chem High
Throughput Screen, 8: 545-51]. These libraries were panned against
human VEGF and two binding modules were indentified consisting of
amino acid sequences FTCTNHWCPS or FQCTRHWCPI. Oligonucleotides
encoding the amino acid sequence FTCTNHWCPS were ligated to a
nucleotide sequence encoding the URP sequence rPEG_A36 with the
sequence (GGS)12. Subsequently, the fusion sequence was dimerized
using restriction enzymes and ligation steps to construct a
molecule that contains 4 copies of the VEGF binding module
separated by rPEG_A36 fused to GFP. The VEGF binding affinity of
fusion proteins containing between zero and four VEGF-binding units
were compared in FIG. 30. A fusion protein containing only rPEG_A36
fused to GFP shows no affinity for VEGF. Adding increasing numbers
of VEGF binding modules increases affinity of the resulting fusion
proteins.
Example
Discovery of 1SS Binding Modules Against Therapeutic Targets
[0280] Random peptide libraries were generated according to
Scholle, et al. [Scholle, M. D., et al. (2005) Comb Chem High
Throughput Screen, 8: 545-51]. The naive peptide libraries
displayed cysteine-constrained peptides with cysteines spaced by 4
to 10 random residues. The library design is illustrated in the
table:
TABLE-US-00006 TABLE X Naive 1SS libraries: LNG0001 XXXCXXCXXX
X.sub.3CX.sub.2CX.sub.3 NNS NNS NNS TGC NNS NNS TGT NNS NNS NNS
LNG0002 XXCXXXCXXX X.sub.2CX.sub.3CX.sub.3 NNS NNS TGC NNS NNS NNS
TGT NNS NNS NNS LNG0003 XXCXXXXCXX X.sub.2CX.sub.4CX.sub.2 NNS NNS
TGC NNS NNS NNS NNS TGT NNS NNS LNG0004 XCXXXXXCXX
X.sub.1CX.sub.5CX.sub.2 NNS TGC NNS NNS NNS NNS NNS TGT NNS NNS
LNG0005 XCXXXXXXCX X.sub.1CX.sub.6CX.sub.1 NNS TGC NNS NNS NNS NNS
NNS NNS TGT NNS LNG0006 CXXXXXXXCX CX.sub.7CX.sub.1 TGC NNS NNS NNS
NNS NNS NNS NNS TGT NNS LNG0007 CXXXXXXXXC CX.sub.8C TGC NNS NNS
NNS NNS NNS NNS NNS NNS TGT LNG0008 CXXXXXXXXXC CX.sub.9C TGC NNS
NNS NNS NNS NNS NNS NNS NNS NNS TGT LNG0009 CXXXXXXXXXXC CX.sub.10C
TGC NNS NNS NNS NNS NNS NNS NNS NNS NNS NNS TGT LNG0010
XXXXXXCXXCXXXXXX X.sub.6CX.sub.2CX.sub.6 NNS NNS NNS NNS NNS NNS
TGC NNS NNS TGT NNS NNS KNS NNS NNS NNS LNG0011 XXXXXCXXXCXXXXXX
X.sub.5CX.sub.3CX.sub.6 NNS NNS NNS NNS NNS TGC NNS NNS NNS TGT NNS
NNS KNS NNS NNS NNS LNG0012 XXXXXCXXXXCXXXXX
X.sub.5CX.sub.4CX.sub.5 NNS NNS NNS NNS NNS TGC NNS NNS NNS NNS TGT
NNS KNS NNS NNS NNS LNG0013 XXXXCXXXXXCXXXXX
x.sub.4CX.sub.5CX.sub.5 NNS NNS NNS NNS TGC NNS NNS NNS NNS NNS TGT
NNS KNS NNS NNS NNS LNG0014 XXXXCXXXXXXCXXXX
X.sub.4CX.sub.6Cx.sub.4 NNS NNS NNS NNS TGC NNS NNS NNS NNS NNS NNS
TGT NNS NNS NNS NNS LNG0015 XXXCXXXXXXXCXXXX
X.sub.3CX.sub.7Cx.sub.4 NNS NNS NNS TGC NNS NNS NNS NNS NNS NNS NNS
TGT NNS NNS NNS NNS LNG0016 XXXCXXXXXXXXCXXX
X.sub.3CX.sub.8CX.sub.3 NNS NNS NNS TGC NNS NNS NNS NNS NNS NNS NNS
NNS TGT NNS NNS NNS LNG0017 XXCXXXXXXXXXCXXX
X.sub.2CX.sub.9CX.sub.3 NNS NNS TGC NNS NNS NNS NNS NNS NNS NNS NNS
NNS TGT NNS NNS NNS LNG0018 XXCXXXXXXXXXXCXX
X.sub.2CX.sub.10CX.sub.2 NNS NNS TGC NNS NNS NNS NNS NNS NNS NNS
NNS NNS NNS TGT NNS NNS
[0281] The libraries were panned agains a series of therapeutically
relevant targets using the following protocol: Wells on
immunosorbent ELISA plates were coated with 5 .mu.g/ml of the
target antigen in PBS overnight at 4.degree. C. Coated plates were
washed with PBS, and non-specific sites were blocked with Blocking
Buffer (PBS containing either 0.5% BSA or 0.5% Ovalbumin) for 2 h
at room temperature. The plates were then washed with PBST (PBS
containing 0.05% Tween 20), and phage particles at
1-5.times.10.sup.12/ml in Binding Buffer (Blocking Buffer
containing 0.05% Tween 20) were added to the wells and incubated
with shaking for 2 h at room temperature. Wells were then emptied
and washed with PBST. Bound phage particles were eluted from the
wells by incubation with 100 mM HCl for 10 min at room temperature,
transferred to sterile tubes, and neutralized with 1M TRIS base.
For infection, log phase E. Coli SS320 growing in Super Broth
supplemented with 5 .mu.g/ml Tetracycline were added to the
neutralized phage eluate, and the culture was incubated with
shaking for 30 min at 37.degree. C. Infected cultures were then
transferred to larger tubes containing Super Broth with 5 .mu.g/ml
Tetracycline and the cultures were incubated with shaking overnight
at 37.degree. C. The overnight cultures were cleared of E. Coli by
centrifugation, and phage were precipitated from the supernatant
following the addition of a solution of 20% PEG and 2.5MNaCl to a
final PEG concentration of 4%. Precipitated phage were harvested by
centrifugation, and the phage pellet was resuspended in 1 ml PBS,
cleared of residual E. Coli by centrifugation, and transferred to a
fresh tube. Phage concentrations were estimated
spectrophotometrically and phage was utilized for the next round of
selection. Individual clones were screened for target binding
affinity after 3 or 4 rounds of phage panning. Individual plaques
from phage clones selected during the panning were picked into
Super Broth containing 5 .mu.g/ml Tetracycline and grown overnight
with shaking at 37.degree. C. ELISA plates were prepared by coating
antigen and control proteins (BSA, Ovalbumin, IgG) at 3 .mu.g/ml in
PBS overnight at 4.degree. C. The plates were washed with PBS, and
blocked with Blocking Buffer (PBS containing 0.5% BSA) for 2 h at
room temperature. Overnight cultures were cleared of E. coli by
centrifugation and the supernatant was diluted 1:10 in Binding
Buffer (Blocking Buffer containing 0.05% Tween 20) and transferred
to the ELISA plates after washing with PBST (PBS containing 0.05%
Tween 20). The plates were incubated with shaking for 2 h at room
temperature. Following washing with PBST, anti-M13-HRP (Pharmacia),
1:5000 dilution in PBS, was added to wells. The plates were
incubated with shaking for 30 min at room temperature and washed
with PBST, followed by PBS. A substrate solution containing 0.4
mg/ml ABTS and 0.001% H.sub.2O.sub.2 in 50 mM phosphate-citrate
buffer was added to the wells, and allowed to develop for 40 min
after which the plates were read in a plate reader at 405 nm. These
ELISA readings allowed the determination of clone specificity, and
antigen-specific clones were sequenced commercially via established
methods.
TABLE-US-00007 TABLE X Sequences of EpCAM-specific binding modules
S Y I C H N C L L S sNG0017S3.021 L R C W G M L C Y A sNG0017S3.017
L R C I G Q I C W R sNG0017S3.022 L K C L Y N I C W V sNG0017S3.024
R P G M A C S G Q L C W L N S P sNG001SS3.015 P H A L Q C Y G S L C
W P S H L sNG001SS3.O18 R A G I T C H G H L C W P I T D
sNG001SS3.019 R P A L K C I G T L C S L A N P sNG001SS3.014 P H G L
W C H G S L C H Y P L A sNG001SS3.012 P H G L I C A G S I C F W P P
P sNG001SS3.007 P R N L T C Y G Q I C F Q S Q H sNG001SS3.011 P H N
L A C Q N S I C V R L P R sNG001SS3.021 P H G L T C T N Q I C F Y G
N T sNG001SS3.006 L F C W G N V C H F sNG0017S3.006 L T C W G Q V C
F R sNG0017S3.009 R C P S R V P W C V sNG0017S3.O11 Q L V C G F S D
S S R L C Y M R sNG001SS3.009 L L C Y I T S P G N R L C S P Y
sNG001SS3.022
TABLE-US-00008 TABLE X Sequences of VEGF-specific binding modules W
E C T Q H W C P S sNG0025S3.021 A P F F S C S F G F C R D L Q T
sNG0026S3.035 T P Y F R C Q F G F C F D S F S sNG0026S3.045 N P F F
Y C V A G K C V D A P L sNG0026S3.029 D M R F L C R H G K C H D L P
L sNG0026S3.034 P P F F V C S L G K C R D A H L sNG0026S3.043 P P Q
F Q C V R G K C F D L T F sNG0026S3.053 I S T F F C S N G S C V D V
P A sNG0026S3.006 P P H F R C F N G S C V D L S R sNG0026S3.051 N V
H F W C H N H K C H D L V S sNG0026S3.040 L F F K C D V G H G C Y D
I K H sNG0026S3.038 L Y F Q C F P N R G C S T L Q P sNG0026S3.002 P
S F F C S P L L G C R D S L S sNG0026S3.052 G T P R C N P F R Q F C
A I P S sNG0026S3.032 L C L P L G R W C P sNG0025S3.016 T S P A C N
P F R H F C T L P T sNG0026S3.058 Q P P I C N P F R Q L C G I P L
sNG0026S3.046 V H T F C N P F R Q M C S L P M sNG0026S3.027 R M V N
C N P F N S W C S L P S sNG0026S3.001 S K H M C N P F H S W C G V P
L sNG0026S3.047 R W P V C N P F L G Y C G I P N sNG0026S3.056 S K P
T C N V F N S W C S V P L sNG0026S3.059 R P P A C N L F L S W C S Y
D S sNG0026S3.004 G R S V C N P Y K S W C P V R Q sNG0026S3.O11 A S
S C K D S P H F R C L F P L sNG0026S3.055 L A N C P N S P G F L C L
H A V sNG0026S3.024 P F A C P H S S G F R C L Y N I sNG0026S3.005 S
F T C S L F P S P H C T T L R sNG0026S3.054 L R L C T Y G G G K Y D
C S S T sNG0026S3.050 G S Y C Q Y R P F S S F C N R S sNG0026S3.048
C S Y N Q V L G R A C sNG0025S3.001 P H C R Q H P L D R W M C S P S
sNG0026S3.057 S L C S M F G D T P H W N C V P sNG0026S3.007 S S C S
L F N N T R H W S C T D sNG0026S3.008
TABLE-US-00009 TABLE X Sequences of CD28-specific binding modules T
T A Y P D C F W C S L F G P P sNG0028S3.085 M L D T T I C P W C S L
F G P V sNG0028S3.081 M L X T T I C P W C S L F G P V sNG0028S3.018
E L L L E R C S W C S L F G P P sNG0028S3.086 S L S Q Q S C D W C W
L F G P P sNG0028S3.060 K R L L E C G A L C A L F G P P
sNG0028S3.008 H T I L T C D S G F C T L F G P sNG0028S3.012 N L W H
V C H T S L C H S R L A sNG0028S3.092 N S F Y L C H S S V C G Q L P
S sNG0028S3.082 A G F S C E N Y F F C P P K N L sNG0028S3.016 S W C
T V F G N H D P S C N S R sNG0028S3.004 C S S N G R W K A H C
sNG0028S3.076 L P N M W R V V V P D V Y D R R sNG0028S3.068
TABLE-US-00010 TABLE X Sequences of CD28-specific binding modules K
H Y C F G P K S W T T C A R G sNG0030S3.096 P W C H L C P G S P S R
C C Q P sNG0030S3.091 P E S K L I S E E D L N G D V S
sNG0030S3.042
TABLE-US-00011 TABLE X Sequences of Tiel-specific binding modules I
W D R V C R M N T C H Q H S H sNG0032S3.096 P Y T I F C L H S S C R
S S S S sNG0032S3.087 D W C L T G P N T L S F C P R R
sNG0032S3.031
TABLE-US-00012 TABLE X Sequences of DR4-specific binding modules L
S T W R C L H D V C W P P L K sNG0033S3.072
TABLE-US-00013 TABLE X Sequences of DR5-specific binding modules V
Y L T Q C G A Q L C L K R T N sNG0034S3.039 P Y L T S C G D R V C L
K R P P sNG0034S3.001 P Y L S R C G G R I C M H D R L sNG0034S3.026
L K L T P C S H G V C M H R L R sNG0034S3.087 Y Y L T N C P K G H C
L R R V D sNG0034S3.080 L Y L H S C S R G I C L S P R V
sNG0034S3.082 F S C Q S S F P G R R M C E L R sNG0034S3.040 H R C S
A H G S S S S F C P G S sNG0034S3.029
TABLE-US-00014 TABLE X Sequences of TrkA-specific binding modules K
T W D C R N S G H C V I T F K sNG0035S3.074 A T W D C R D H N F S C
V R L S sNG0035S3.089
Example
aEpCAM Drug Conjugates
[0282] Anti-EpCAM peptides were isolated from random peptide
libraries that were generated according to Scholle, et al.
[Scholle, M. D., et al. (2005) Comb Chem High Throughput Screen, 8:
545-51] The naive peptide libraries displayed cysteine-constrained
peptides with cysteines spaced by 4 to 10 random residues. After
three rounds of affinity selection with the above libraries,
several EpCAM specific peptide ligands (EpCam1) were isolated
(Table X). The EpCam1 isolates have a conserved cysteine spacing of
four amino acids (CXXXXC). EpCam1 peptide ligands were then softly
randomized (except cysteine positions) with codons encoding 3-9
residues and moved into a phagemid vector. Phagemid libraries were
subsequently affinity selected against EpCAM to isolate peptide
ligands optimized for binding (Table X, EpCam2). EpCam2 ligands
contain the conserved CXXXXC cysteine spacing. In addition, the
majority of anti-EpCam sequences do not contain a lysine residue,
which allows for conjugation to free amine groups outside of the
binding sequences. Furthermore, anti-EpCam peptide ligands can be
genetically fused to URP sequences (of any length) and multimerized
using iterative dimerization. The resulting anti-EpCAM MURPs can be
used to specifically target EpCAM with increased affinity over
monomer sequences. An example of a tetramer EpCAM-URP amino acid
sequence is shown in FIG. 31. This sequence contains only two
lysine residues that are located in the N-terminal Flag-tag. The
side chains of these lysine residues are particularly suitable for
drug conjugation.
TABLE-US-00015 TABLE X Anti-EpCam sequences Name Sequence EpCam 1
LRCWGMLCYA LRCIGQICWR LKCLYNICWV LFCWGNVCHF LTCWGQVCFR
RPGMACSGQLCWLNSP PHALQCYGSLCWPSHL RAGITCHGHLCWPITD RPALKCIGTLCSLANP
PHGLWCHGSLCHYPLA PHGLICAGSICFWPPP PRNLTCYGQICFQSQH PHNLACQNSICVRLPR
PHGLTCTNQICFYGNT EpCam 2 HSLTCYGQICWVSNI PTLTCYNQVCWVNRT
PALRCLGQLCWVTPT PGLRCLGTLCWVPNR RNLTCWNTVCYAYPN RGLKCLGQLCWVSSN
PTLKCSGQICWVPPP RNLECLGNVCSLLNQ PTLTCLNNLCWVPPQ RGLKCSGHLCWVTPQ
HGLTCHNTVCWVHHP HTLECLGNICWVINQ HGLTCYNQICWAPRP HGLACYNQLCWVNPH
RGLACQGNICWRLNP RAITCLGTLCWPTSP LTLECIGNICYVPHH
Example
Random Sequence Addition
[0283] Binding modules can be affinity matured, or lengthened, by
the addition of URP-like linkers and random sequence to the
N-terminus, C-terminus, or both N- and C-terminus of the binding
sequence. FIG. 32 shows the addition of naive cysteine-constrained
sequences to an anti-EpCAM binding module. Libraries of random
sequence additions can be generated using a single-stranded or
double-stranded DNA cloning approaches. Once generated, libraries
can be affinity selected against the initial target protein or a
second protein. For example, an addition library that contains an
anti-EpCAM binding module can be used to select sequences that
contain 2 or more binding sites to the target protein.
Example
Construction of a 2SS Buildup Library
[0284] A series of oligonucleotides was designed to construct a
library based on the VEGF-binding 1SS peptide FTCTNHWCPS. The
oligonucleotides incorporate variations in cysteine distance
patterns of the flanking sequences while the VEGF-binding peptide
sequence was kept fixed.
TABLE-US-00016 Forward oligos: LMS70-1
CAGGCAGCGGGCCCGTCTGGCCCGTGYTTTACTTGTACGAATCATTGGTG TCCT LMS70-2
CAGGCAGCGGGCCCGTCTGGCCCGTGYNNKTTTACTTGTACGAATCATTG GTGTCCT LMS70-3
CAGGCAGCGGGCCCGTCTGGCCCGTGYNNKNNKTTTACTTGTACGAATCA TTGGTGTCCT
LMS70-4 CAGGCAGCGGGCCCGTCTGGCCCGTGYNHTNHTNHTTTTACTTGTACGAA
TCATTGGTGTCCT LMS70-5
CAGGCAGCGGGCCCGTCTGGCCCGTGYNHTNHTNHTNHTTTTACTTGTAC GAATCATTGGTGTCCT
LMS70-6 CAGGCAGCGGGCCCGTCTGGCCCGTGYKMTKMTKMTKMTKMTTTTACTTG
TACGAATCATTGGTGTCC Reverse oligos (reverse complemented): LMS70-1R
ACCGGAACCACCAGACTGGCCRCACGAAGGACACCAATGATTCGTACAA LMS70-2R
ACCGGAACCACCAGACTGGCCRCAMNNCGAAGGACACCAATGATTCGTAC AA LMS70-3R
ACCGGAACCACCAGACTGGCCRCAMNNMNNCGAAGGACACCAATGATTCG TACAA LMS70-4R
ACCGGAACCACCAGACTGGCCRCAADNADNADNCGAAGGACACCAATGAT TCGTACAA
LMS70-5R ACCGGAACCACCAGACTGGCCRCAADNADNADNADNCGAAGGACACCAAT
GATTCGTACAA LMS70-6R
ACCGGAACCACCAGACTGGCCRCAAKMAKMAKMAKMAKMCGAAGGACACC
AATGATTCGTACAA
Oligo Dilutions
[0285] Mixture 1 (from 100 .mu.M stocks): 100 .mu.l 70-6, 33 .mu.l
70-5, 11 .mu.l 70-4, 3.66 .mu.l 70-3, 1.2 .mu.l 70-2, 0.4 .mu.l
70-1. Mixture 2 (from 100 .mu.M stocks): 100 .mu.l 70-6R, 33 .mu.l
70-5R, 11 .mu.l 70-4R, 3.66 .mu.l 70-3R, 1.2 .mu.l 70-2R, 0.4 .mu.l
70-1R
PCR Assembly
[0286] 10.0 .mu.l Template Oligo (5 .mu.M), 10.0 .mu.l 10.times.
Buffer, 2.0 dNTPs (10 mM), 1.0 .mu.l cDNA Polymerase (Clonetech),
77 .mu.l DS H.sub.20. PCR program: 95.degree. C. 1 min, (95.degree.
C. 15 sec, 54.degree. C. 30 sec, 68.degree. C. 15 sec).times.5,
68.degree. C. 1 min
PCR Amplification
[0287] Primers, 10.0 .mu.l Assembled mixture, 10.0 .mu.l 10.times.
buffer, 2.0 dNTPs (10 mM), 10.0 .mu.l LIBPTF (5 .mu.M), 10.0 .mu.l
LIBPTR (5 .mu.M), 1.0 .mu.l cDNA polymerase (Clonetech), 57 .mu.l
DS H.sub.20. PCR program: 95.degree. C. 1 min, (95.degree. C. 15
sec, 54.degree. C. 30 sec, 68.degree. C. 15 sec).times.25,
68.degree. C. 1 min. The product was purified by Amicon column Y10.
The assembled product was digested with SfiI and BstXI and ligated
into the phagemid vector pMP003. Ligation was performed over night
at 16.degree. C. in a MJ PCR machine. Ligation then was purified by
EtOH precipitation. Transformation into fresh competent ER2738
cells by Electroporation.
[0288] The resulting library was panned against VEGF as described
below. Several isolates were identified that showed improved
binding to VEGF relative to the 1SS starting sequence. Binding and
expression data are shown in FIG. 38. Sequences and results of
Western analysis of buildup clones is shown in FIG. 39.
Example
Phage Panning of Buildup Libraries
[0289] First Round Panning:
[0290] 1) First round, coat 4 wells per library to be screened.
Coat the well of a Costar 96-well ELISA plate with 0.25 .mu.g of
VEGF.sub.121 antigen in 25 .mu.l of PBS. Cover the plate with a
plate sealer. Coating can be performed overnight at 4.degree. C. or
for 1 h at 37.degree. C.
[0291] 2) After shaking out the coating solution, block the well by
adding 150 .mu.l of PBS/BSA 1%. Seal and incubate for 1 h at
37.degree. C.
[0292] 3) After shaking out the blocking solution, add 50 .mu.l of
freshly prepared phage (see library reamplification protocol) to
the well. For the first round only, also add 5 .mu.l of Tween 5%.
Seal the plate and incubate for 2 h at 37.degree. C.
[0293] In the meantime, inoculate 2 ml SB medium plus 2 .mu.l of 5
mg/ml Tetracycline with 2 .mu.l of an ER 2738 cell preparation and
allow growth at 250 rpm and 37.degree. C. for 2.5 h. Grow 1 culture
for each library that is screened including negative selections.
Take all precautions to avoid a contamination of the culture with
phage.
[0294] 4) Shake out the phage solution, add 150 .mu.l of PBS/Tween
0.5% to the well and pipette 5 times vigorously up and down. Wait 5
min, shake out, and repeat this washing step. In the first round,
wash in this fashion 5 times, in the second round 10 times, and in
the third, fourth and fifth round 15 times.
[0295] 5) After shaking out the final washing solution, add 50
.mu.l of freshly prepared 10 mg/ml trypsin in PBS, seal, and
incubate for 30 min at 37.degree. C. Pipette 10 times vigorously up
and down and transfer the eluate (4.times.50 .mu.l in the first
round, 2.times.50 ml in the second round, 1.times.50 .mu.l in the
subsequent rounds) to the prepared 2-ml E. coli culture and
incubate at room temperature for 15 min.
[0296] 6) Add 6 ml of pre-warmed SB medium, 1.6 .mu.l of
carbenicillin and 6 .mu.l of 5 mg/ml Tetracycline. Transfer the
culture into a 50-ml polypropylene tube.
[0297] 7) Shake the 8-ml culture at 250 rpm and 37.degree. C. for 1
h, add 2.4 .mu.l 100 mg/ml carbenicillin, and shake for an
additional hour at 250 rpm and 37.degree. C.
[0298] 8) Add 1 ml of VCSM13 helper phage and transfer to a 500-ml
polypropylene centrifuge bottle. Add 91 ml of pre-warmed
(37.degree. C.) SB medium and 46 .mu.L of 100 mg/ml carbenicillin
and 92 .mu.l of 5 mg/ml Tetracycline. Shake the 100-ml culture at
300 rpm and 37.degree. C. for 11/2 to 2 h.
[0299] 9) Add 140 .mu.l of 50 mg/ml kanamycin and continue shaking
at 300 rpm and 37.degree. C. overnight.
[0300] 10) Spin at 4000 rpm for 15 min at 4.degree. C. Transfer the
supernatant to a clean 500-ml centrifuge bottle and add add 25 ml
of 20% PEG-8000/NaCl 2.5M. Store on ice for 30 min.
[0301] 11) Spin at 9000 rpm for 15 min at 4.degree. C. Discard the
supernatant, drain inverted on a paper towel for at least 10 min,
and wipe off remaining liquid from the upper part of the centrifuge
bottle with a paper towel.
[0302] 12) Resuspend the phage pellet in 2 ml of PBS/BSA 0.5%/Tween
0.5% buffer by pipetting up and down along the side of the
centrifuge bottle and transfer to a 2-ml microcentrifuge tube.
Resuspend further by pipetting up and down using a 1-ml pipette
tip, spin at full speed in a microcentrifuge for 1 min at 4.degree.
C., and pass the supernatant through a 0.2-.mu.m filter into a
sterile 2-ml microcentrifuge tube.
[0303] 13) Continue from step 3) for the next round or store the
phage preparation at 4.degree. C. Sodium azide may be added to
0.02% (w/v) for long-term storage. Only freshly prepared phage
should be used for each round.
[0304] Second Round Panning
[0305] Second round, coat 2 wells per library to be screened. Coat
the well of a Costar 96-well ELISA plate with 0.25 .mu.g of
VEGF.sub.121 antigen in 25 .mu.l of PBS. Cover the plate with a
plate sealer. Coating can be performed overnight at 4.degree. C. or
for 1 h at 37.degree. C.
[0306] Also block 2 uncoated wells for each library to be used as
negative control for the enrichment ratio calculation.
[0307] Third Round Panning
[0308] Third round, coat 1 well per library to be screened. Coat
the well of a Costar 96-well ELISA plate with 0.25 .mu.g of
VEGF.sub.12, antigen in 25 .mu.l of PBS. Cover the plate with a
plate sealer. Coating can be performed overnight at 4.degree. C. or
for 1 h at 37.degree. C.
[0309] Also block 1 uncoated well for each library to be used as
negative control for the enrichment ratio calculation.
Example
Solution-Based Panning
[0310] 1. Biotinylate the target protein according to
manufacturer.
[0311] 2. Coat a total of 8 wells (per selection) with 1.0 .mu.g of
neutravidin (Pierce) in PBS and incubate overnight at 4.degree.
C.
[0312] 3. Block the wells with SuperBlock (Pierce) for 1 h at room
temp. Store plate with blocking buffer until needed (in Step
6).
[0313] 4. Use 100 nM of biotinylated target protein and add 1012
phage/ml (in PBST) for a total volume of 100-200 .mu.l using
SuperBlock plus Tween 20 0.05%.
[0314] 5. Tumble phage-target mixture at room temp for at least 1
h.
[0315] 6. Dilute 100 .mu.l phage-target mix with 700 .mu.l
SuperBlock, mix, and add 100 .mu.l to each of 8 neutravidin-coated
wells (from Step 3).
[0316] 7. Incubate for 5 min at room temp.
[0317] 8. Wash 8.times. with PBST.
[0318] 9. Elute phage with 100 .mu.l of 100 mM HCl for 10 min.
[0319] 10. Neutralize by adding 10 .mu.l of 1M TRIS pH=8.0.
[0320] 11. Infect cells for plating or amplify phage for a
subsequent round of solution panning.
Example
Screening by Phage Elisa for VEGF Positive Clones
[0321] 1) Add 0.5 ml SB containing 50 .mu.g/ml carbenicillin to 96
deep well plate. Pick one colony and inoculate wells.
[0322] 2) Shake the plate containing the bacterial cultures at 300
rpm o/n at 37.degree. C.
[0323] 3) Prepare 4 ng/.mu.l target protein solution in PBS. Add 25
.mu.l (100 ng) of protein to each well and incubate overnight at
4.degree. C.
[0324] 4) Shake out coated ELISA plates and wash 2.times. with PBS.
Add 150 .mu.l/well PBS+0.5% BSA (blocking buffer). Block for 1 at
RT.
[0325] 5) Spin down microtube racks (3000 rpm; 20 min).
[0326] 6) Prepare binding buffer (blocking buffer+0.5% Tween 20).
Aliquot 135 .mu.l binding buffer per well in low protein-binding 96
well plate.
[0327] 7) Shake out wells on ELISA plates and wash 2 times with
PBST (PBS+0.5% Tween 20).
[0328] 8) Dilute 15 .mu.l phage from o/n cultures 1:10 in PBST, mix
by pipetting, and transfer 30 .mu.l to each protein-coated well.
Incubate 2 h at RT with gentle shaking.
[0329] 9) Wash plates 6 times with PBST.
[0330] 10) Add 50 .mu.l antiM13-HRP 1:5000 in binding buffer to the
wells. Incubate 30 min with gentle shaking at RT.
[0331] 11) Wash the plates 4 times with PBST, followed by 2 times
with H2O.
[0332] 12) Prepare 6 ml of ABTS solution (5.88 ml of citrate buffer
plus 120 .mu.l ABTS and 2 .mu.l H2O2). Aliquot 50 .mu.l per well on
each ELISA plate
[0333] 13) Incubate at RT and read O.D. at 405 nm using an ELISA
plate reader at appropriate time points depending on the signal (up
to 1 h)
Example
Dimerization of Binding Modules
[0334] Phage displayed libraries of 10e9 to 10e11 cyclic peptides
with 4, 5, 6, 7, 8, 9, 10, 11 and 12 randomized or partially
randomized amino acids between the disulfide-bonded cystines, and
in some cases additional randomized amino acids on the outside of
the cystine pair, were created by standard methods. Panning of
these cyclic peptide libraries against a number of targets,
including human VEGF, reliably yielded peptides that bound
specifically to hVEGF and not to BSA, Ovalbumin or IgG.
Example
Construction and Panning of a Plexin-Based Library
[0335] Two libraries were designed based on the Plexin scaffold.
The Pfam protein database was used for phylogenetic alignment of
naturally occurring plexin domains as shown in FIG. 35. The middle
part of plexin scaffold (Cys24-Gly25-Trp26-Cys27) is conserved in
both library designs and served as a crossover region for N- and
C-library generation. The randomization schemes of both plexin
libraries are shown in FIG. 36. The two libraries were generated by
overlapping two library-encoding oligos at the crossover region and
using pull-thru PCR followed by restriction cloning (SfiI/BstXI)
and cloning into phagemid vector pMP003. The resulting plexin
libraries were designated LMP031 (N terminal library) and LMP032 (C
terminal library) and each was represented by a complexity of
approximately 5.times.10.sup.8 independent transformants. For
validation, approximately 24 Carb-resistant clones from each
unselected library were analyzed by PCR. Clones that gave a correct
size fragment (375 bp) were further analyzed by DNA sequencing.
Correct full-length plexin sequences were obtained for 50% and 67%
of clones derived from LMP031 and LMP032 libraries,
respectively.
[0336] The two libraries were mixed together at 50/50 ratio and
panned in parallel against VEGF, death receptor Dr4, ErbB2, and
HGFR immobilized on 96-well ELISA plates. Four rounds of panning
were carried out using 1000 ng of protein target in the first
round, 500 ng in the second round, 250 ng in the third round, and
100 ng in the fourth round. After the final round of panning, 192
Carb-resistant clones from each selection were analyzed for binding
to 100 ng immobilized protein target, human IgG, Ovalbumin, and BSA
by phage ELISA using polyclonal anti-M13 Ab conjugated to
horseradish peroxidase for detection. The highest percentage of
positive clones was obtained for target DR4 (69%), followed by
target ErbB2 (53%), HGFR (13%), and BoNT target (1%). Positive
clones were further analyzed by PCR and by DNA sequencing. All
clones revealed unique sequences and all but one (against DR4) were
derived from LMP032 (C terminal library). Sequences of some of the
identified target-selective isolates are shown in FIG. 37.
[0337] For further analysis, an assortment of selected
target-specific binders are first subcloned into protein expression
vector pVS001, then produced as soluble microproteins, and finally
purified by heat lysis. The purified target-specific microproteins
are analysed by protein ELISA to confirm the target recognition, by
SDS-PAGE to confirm monomer formation, and by surface plasmon
resonance to measure their affinities to target. The best clones
are used in the next round of library generation to further improve
their properties.
Example
Construction of a Snake Toxin-Based Library
[0338] Phage displayed libraries of 10e8 to 10e10 of 3 finger toxin
(3FT) scaffolds with partially randomized amino acids of fingertip
1 and descending part of finger 2 or fingertip 3 and ascending part
of finger 2 were created by standard methods.
[0339] Two 3FT scaffolds were used as a template for 3FT library
generation (fingers 1 and 2 configuration). The structure of a 3FT
scaffold and a multiple sequence alignment of related sequences is
shown in FIG. 33. A library was designed such that two surface
loops of the toxin are randomized as illustrated in FIG. 34. The
library of partially randomized 3FT scaffold was generated by
overlapping four library-encoding oligos at the annealing regions
and using pull-thru PCR followed by restriction cloning
(SfiI/BstXI) into phagemid vector pMP003. The resulting 3FT library
was designated LMP041.
Example
Grafting of Binding Peptides into Microprotein
Scaffolds--Target-specific Peptides-Assisted Randomization
[0340] The aim here is to use the peptides that have been
identified to be specific for target of interest in order to
generate 3SSplus target-specific binders. This strategy is
illustrated by using VEGF-specific peptide transfer into fingertip
1 of 3FT scaffold and by modifying the AA residues of finger 2,
which are in close proximity from target specific sequence to
generate high affinity VEGF binders. Phage displayed libraries of
10e8 to 10e10 of 3 finger toxin (3FT) scaffolds with VEGF specific
sequence of fingertip 1 and partially randomized descending part of
finger 2 was created by standard methods as described in example
above except 2 random finger 1 forward primers were replaced by
F1-VEGF-specific forward primer encoding the following sequence: P
S G P S C H T T N H W P I S A V T C P P.
[0341] The focused (VEGF-specific) 3FT scaffold library with
partially randomized finger 2 was generated by overlapping four
library-encoding oligos at the annealing regions and using
pull-thru PCR followed by restriction cloning (SfiI/BstXI) into
phagemid vector pMP003. The resulting 3FT library was designated
LMP042.
Example
Plasma Half-Life of an MURP
[0342] The plasma half-life of MURPs can be measured after i.v. or
i.p. injection of the MURP into catheterized rats essentially as
described by [Pepinsky, R. B., et al. (2001) J Pharmacol Exp Ther,
297: 1059-66]. Blood samples can be withdrawn at various time
points (5 min, 15 min, 30 min, 1 h, 3 h, 5 h, 1 d, 2 d, 3 d) and
the plasma concentration of the MURP can be measured using ELISA.
Pharmacokinetic parameters can be calculated using WinNonlin
version 2.0 (Scientific Consulting Inc., Apex, N.C.). To analyze
the effect of the URP module one can compare on plasma half-life of
a protein containing the URP module with the plasma half-life of
the same protein lacking the URP module.
Example
Solubility Testing of an MURP
[0343] Solubility of MURPs can be determined by concentrating
purified samples of MURPs in physiological buffers like phosphate
buffered saline to various concentrations in the range of 0.01
mg/ml to 10 mg/ml. Samples can be incubated for up to several
weeks. Samples where the concentration exceeds the solubility of
the MURP show precipitation as indicated by turbidity, which can be
measured in an absorbance reader. On can remove precipitated
material by centrifugation or filtration and measure the
concentration of remaining protein in the supernatant using a
protein assay like the Bradford assay of by measuring the
absorbance at 280 nm. Solubility studies can be accelerated by
freezing the samples at -20 C and subsequent thawing. This process
frequently leads to the precipitation of poorly soluble
proteins.
Example
Serum Binding Activity of MURPs
[0344] One can coat MURPs of interest into microtiter plates and
control proteins in other wells of the plate. Subsequently, one can
add serum samples of interest to the wells for 1 hour.
Subsequently, the wells can be washed with a plate washer. Bound
serum proteins can be detected by adding antibodies against serum
proteins that have been conjugated with enzymes like horse radish
peroxidase or alkaline phosphatase for detection. Another way to
detec serum binding to MURPs to add the MURP of interest to serum
for about 1 hour to allow binding. Subsequently, one can
immunoprecipitate the MURP using an antibody against an epitope in
the MURP sequence. The precipitated samples can be analyzed by PAGE
and optionally by Western to detect any proteins that
co-precipitated with the MURP. One can identify the serum proteins
that show co-precipitation by mass spectrometry.
Sequence CWU 1
1
366112PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 1Cys Xaa Xaa Xaa Xaa Xaa Cys Cys Xaa Xaa Xaa Cys1
5 10215PRTPorcine Parvovirus 2Ser Gly Gly Gly Gly Gly Gly Gly Gly
Gly Arg Gly Ala Gly Gly1 5 10 15317PRTFeline Panleukopenia Virus
3Thr Gly Ser Gly Asn Gly Ser Gly Gly Gly Gly Gly Gly Gly Ser Gly1 5
10 15Gly417PRTCanine Parvovirus 4Thr Gly Ser Gly Asn Gly Ser Gly
Gly Gly Gly Gly Gly Gly Ser Gly1 5 10 15Gly512PRTMurine Minute
Virus 5Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly1 5
10637PRTHomo sapiens 6Gly Pro Gly Gly Gly Gly Gly Pro Gly Gly Gly
Gly Gly Pro Gly Gly1 5 10 15Gly Gly Pro Gly Gly Gly Gly Gly Gly Gly
Pro Gly Gly Gly Gly Gly 20 25 30Gly Pro Gly Gly Gly 35733PRTHomo
sapiens 7Gly Ala Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly
Gly Ser1 5 10 15Gly Gly Gly Gly Gly Gly Gly Gly Ala Gly Ala Gly Gly
Ala Gly Ala 20 25 30Gly 832PRTHomo sapiens 8Gly Gly Gly Ser Gly Ser
Gly Gly Ala Gly Gly Gly Ser Gly Gly Gly1 5 10 15Ser Gly Ser Gly Gly
Gly Gly Gly Gly Ala Gly Gly Gly Gly Gly Gly 20 25 30927PRTHomo
sapiens 9Gly Asp Gly Gly Gly Ala Gly Gly Gly Gly Gly Gly Gly Gly
Ser Gly1 5 10 15Gly Gly Gly Ser Gly Gly Gly Gly Gly Gly Gly 20
251025PRTHomo sapiens 10Gly Ser Gly Ser Gly Ser Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly1 5 10 15Gly Gly Ser Gly Gly Gly Gly Gly Gly 20
251123PRTHomo sapiens 11Gly Gly Gly Arg Gly Gly Arg Gly Gly Gly Arg
Gly Gly Gly Gly Arg1 5 10 15Gly Gly Gly Arg Gly Gly Gly
201233PRTHomo sapiens 12Gly Ala Gly Gly Gly Gly Gly Gly Gly Gly Gly
Gly Gly Gly Gly Ser1 5 10 15Gly Gly Gly Gly Gly Gly Gly Gly Ala Gly
Ala Gly Gly Ala Gly Ala 20 25 30Gly1332PRTHomo sapiens 13Gly Gly
Gly Ser Gly Ser Gly Gly Ala Gly Gly Gly Ser Gly Gly Gly1 5 10 15Ser
Gly Ser Gly Gly Gly Gly Gly Gly Ala Gly Gly Gly Gly Gly Gly 20 25
301427PRTHomo sapiens 14Gly Asp Gly Gly Gly Ala Gly Gly Gly Gly Gly
Gly Gly Gly Ser Gly1 5 10 15Gly Gly Gly Ser Gly Gly Gly Gly Gly Gly
Gly 20 251521PRTHomo sapiens 15Gly Ser Gly Gly Ser Gly Gly Ser Gly
Gly Gly Pro Gly Pro Gly Pro1 5 10 15Gly Gly Gly Gly Gly
201618PRTHomo sapiens 16Gly Glu Gly Gly Gly Gly Gly Gly Glu Gly Gly
Gly Ala Gly Gly Gly1 5 10 15Ser Gly1712PRTHomo sapiens 17Gly Gly
Gly Gly Gly Gly Gly Gly Asp Gly Gly Gly1 5 101846PRTHomo sapiens
18Gly Gly Gly Ser Gly Ser Gly Gly Ala Gly Gly Gly Ser Gly Gly Gly1
5 10 15Ser Gly Ser Gly Gly Gly Gly Gly Gly Ala Gly Gly Gly Gly Gly
Gly 20 25 30Ser Ser Gly Gly Gly Ser Gly Thr Ala Gly Gly His Ser Gly
35 40 451937PRTHomo sapiens 19Gly Pro Gly Gly Gly Gly Gly Pro Gly
Gly Gly Gly Gly Pro Gly Gly1 5 10 15Gly Gly Pro Gly Gly Gly Gly Gly
Gly Gly Pro Gly Gly Gly Gly Gly 20 25 30Gly Pro Gly Gly Gly
352035PRTHomo sapiens 20Gly Gly Ser Gly Ala Gly Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly1 5 10 15Ser Gly Ser Gly Gly Gly Gly Ser Thr Gly
Gly Gly Gly Gly Thr Ala 20 25 30Gly Gly Gly 352133PRTHomo sapiens
21Gly Ala Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Ser1
5 10 15Gly Gly Gly Gly Gly Gly Gly Gly Ala Gly Ala Gly Gly Ala Gly
Ala 20 25 30Gly2233PRTHomo sapiens 22Gly Ala Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly Gly Gly Gly Ser1 5 10 15Gly Gly Gly Gly Gly Gly
Gly Gly Ala Gly Ala Gly Gly Ala Gly Ala 20 25 30Gly2333PRTHomo
sapiens 23Gly Ala Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly
Gly Ser1 5 10 15Gly Gly Gly Gly Gly Gly Gly Gly Ala Gly Ala Gly Gly
Ala Gly Ala 20 25 30Gly2432PRTHomo sapiens 24Gly His Pro Gly Ser
Gly Ser Gly Ser Gly Gly Gly Gly Gly Gly Gly1 5 10 15Gly Gly Gly Gly
Gly Ser Gly Gly Gly Gly Gly Gly Ala Pro Gly Gly 20 25 302531PRTHomo
sapiens 25Gly Gly Gly Gly Ser Gly Gly Gly Gly Gly Gly Gly Gly Gly
Gly Gly1 5 10 15Gly Gly Gly Ser Gly Ser Thr Gly Gly Gly Gly Ser Gly
Ala Gly 20 25 302631PRTHomo sapiens 26Gly Gly Arg Gly Arg Gly Gly
Arg Gly Arg Gly Ser Arg Gly Arg Gly1 5 10 15Gly Gly Gly Thr Arg Gly
Arg Gly Arg Gly Arg Gly Gly Arg Gly 20 25 302730PRTHomo sapiens
27Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Gly Pro Gly Pro Gly Pro1
5 10 15Gly Gly Gly Gly Gly Pro Ser Gly Ser Gly Ser Gly Pro Gly 20
25 302829PRTHomo sapiens 28Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly
Gly Arg Gly Gly Gly Gly1 5 10 15Arg Gly Gly Gly Arg Gly Gly Gly Gly
Glu Gly Gly Gly 20 252928PRTHomo sapiens 29Gly Gly Gly Gly Thr Gly
Ser Ser Gly Gly Ser Gly Ser Gly Gly Gly1 5 10 15Gly Ser Gly Gly Gly
Gly Gly Gly Gly Ser Ser Gly 20 253027PRTHomo sapiens 30Gly Asp Gly
Gly Gly Ala Gly Gly Gly Gly Gly Gly Gly Gly Ser Gly1 5 10 15Gly Gly
Gly Ser Gly Gly Gly Gly Gly Gly Gly 20 253127PRTHomo sapiens 31Gly
Gly Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Gly Ser Gly Gly1 5 10
15Gly Gly Ser Gly Gly Gly Arg Gly Ala Gly Gly 20 253227PRTHomo
sapiens 32Gly Gly Gly Ala Ala Gly Ala Gly Gly Gly Gly Ser Gly Ala
Gly Gly1 5 10 15Gly Ser Gly Gly Ser Gly Gly Arg Gly Thr Gly 20
253327PRTHomo sapiens 33Gly Ala Gly Gly Gly Arg Gly Gly Gly Ala Gly
Gly Glu Gly Gly Ala1 5 10 15Ser Gly Ala Glu Gly Gly Gly Gly Ala Gly
Gly 20 253427PRTHomo sapiens 34Gly Asp Gly Gly Gly Ala Gly Gly Gly
Gly Gly Gly Gly Gly Ser Gly1 5 10 15Gly Gly Gly Ser Gly Gly Gly Gly
Gly Gly Gly 20 253526PRTHomo sapiens 35Gly Gly Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly Gly Gly Gly Gly1 5 10 15Gly Gly Gly Gly Gly Gly
Gly Glu Ala Gly 20 253626PRTHomo sapiens 36Gly Gly Gly Gly Gly Gly
Ser Ala Gly Gly Gly Ser Ser Gly Gly Gly1 5 10 15Pro Gly Gly Gly Gly
Gly Gly Ala Gly Gly 20 253725PRTHomo sapiens 37Gly Gly Gly Gly Gly
Pro Gly Gly Gly Gly Gly Gly Gly Pro Gly Gly1 5 10 15Gly Gly Gly Pro
Gly Gly Gly Gly Gly 20 253825PRTHomo sapiens 38Gly Arg Gly Gly Ala
Gly Ser Gly Gly Ala Gly Ser Gly Ala Ala Gly1 5 10 15Gly Thr Gly Ser
Ser Gly Gly Gly Gly 20 253925PRTHomo sapiens 39Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly Gly Ser Gly Gly Ser Gly1 5 10 15Gly Gly Gly Gly
Gly Gly Gly Gly Gly 20 254025PRTHomo sapiens 40Gly Gly Ser Gly Gly
Gly Arg Gly Gly Ala Ser Gly Pro Gly Ser Gly1 5 10 15Ser Gly Gly Pro
Gly Gly Pro Ala Gly 20 254125PRTHomo sapiens 41Gly Gly His His Gly
Asp Arg Gly Gly Gly Arg Gly Gly Arg Gly Gly1 5 10 15Arg Gly Gly Arg
Gly Gly Arg Ala Gly 20 254225PRTHomo sapiens 42Gly Ser Arg Gly Gly
Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly1 5 10 15Gly Gly Gly Ala
Gly Ala Gly Gly Gly 20 254324PRTHomo sapiens 43Gly Gly Arg Gly Gly
Arg Gly Pro Gly Glu Pro Gly Gly Arg Gly Arg1 5 10 15Ala Gly Gly Ala
Glu Gly Arg Gly 204424PRTHomo sapiens 44Gly Gly Gly Gly Gly Asp Ala
Gly Gly Ser Gly Asp Ala Gly Gly Ala1 5 10 15Gly Gly Arg Ala Gly Arg
Ala Gly 204523PRTHomo sapiens 45Gly Gly Gly Arg Gly Gly Arg Gly Gly
Gly Arg Gly Gly Gly Gly Arg1 5 10 15Gly Gly Gly Arg Gly Gly Gly
204623PRTHomo sapiens 46Gly Gly Ser Gly Gly Gly Gly Gly Gly Ser Ser
Gly Gly Arg Gly Ser1 5 10 15Gly Gly Gly Ser Ser Gly Gly
204723PRTHomo sapiens 47Gly Ser Gly Pro Gly Thr Gly Gly Gly Gly Ser
Gly Ser Gly Gly Gly1 5 10 15Gly Gly Gly Ser Gly Gly Gly
204823PRTHomo sapiens 48Gly Ala Arg Gly Gly Gly Ser Gly Gly Gly Gly
Gly Gly Gly Gly Gly1 5 10 15Gly Gly Gly Gly Gly Pro Gly
204923PRTHomo sapiens 49Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly1 5 10 15Gly Gly Gly Gly Gly Asp Gly
205023PRTHomo sapiens 50Gly Gly Thr Arg Gly Gly Thr Arg Gly Gly Thr
Arg Gly Gly Asp Arg1 5 10 15Gly Arg Gly Arg Gly Ala Gly
205123PRTHomo sapiens 51Gly Gly Thr Arg Gly Gly Thr Arg Gly Gly Thr
Arg Gly Gly Asp Arg1 5 10 15Gly Arg Gly Arg Gly Ala Gly
205223PRTHomo sapiens 52Gly Ala Gly Gly Gly Gly Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly1 5 10 15Ala Gly Gly Gly Gly Gly Gly
205323PRTHomo sapiens 53Gly Gly Gly Arg Gly Gly Arg Gly Gly Gly Arg
Gly Gly Gly Gly Arg1 5 10 15Gly Gly Gly Arg Gly Gly Gly
205422PRTHomo sapiens 54Gly Arg Gly Arg Gly Gly Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly1 5 10 15Gly Arg Gly Gly Gly Gly 205522PRTHomo
sapiens 55Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg Gly Arg
Gly Arg1 5 10 15Gly Arg Gly Gly Ala Gly 205622PRTHomo sapiens 56Gly
Ala Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly1 5 10
15Gly Gly Gly Gly Gly Gly 205722PRTHomo sapiens 57Gly Gly Gly Ser
Gly Gly Gly His Ser Gly Gly Ser Gly Gly Gly His1 5 10 15Ser Gly Gly
Ser Gly Gly 205822PRTHomo sapiens 58Gly Ala Gly Ala Gly Gly Gly Gly
Gly Gly Gly Gly Ala Gly Gly Gly1 5 10 15Gly Ser Ala Gly Ser Gly
205922PRTHomo sapiens 59Gly Gly Pro Gly Thr Gly Ser Gly Gly Gly Gly
Ala Gly Thr Gly Gly1 5 10 15Gly Ala Gly Gly Pro Gly 206022PRTHomo
sapiens 60Gly Gly Gly Gly Gly Gly Gly Gly Gly Ala Gly Gly Ala Gly
Gly Ala1 5 10 15Gly Ser Ala Gly Gly Gly 206121PRTHomo sapiens 61Gly
Gly Asp Gly Gly Gly Ser Ala Gly Gly Gly Ala Gly Gly Gly Ser1 5 10
15Gly Gly Gly Ala Gly 206221PRTHomo sapiens 62Gly Gly Gly Gly Gly
Gly Ser Gly Gly Gly Gly Gly Gly Gly Gly Gly1 5 10 15Gly Gly Gly Gly
Gly 206321PRTHomo sapiens 63Gly Pro Gly Ala Gly Ala Gly Ser Gly Ala
Gly Gly Ser Ser Gly Gly1 5 10 15Gly Gly Gly Pro Gly 206421PRTHomo
sapiens 64Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Ser Ser Gly
Gly Gly1 5 10 15Gly Ser Ser Gly Gly 206521PRTHomo sapiens 65Gly Ser
Gly Ser Gly Pro Gly Pro Gly Ser Gly Pro Gly Ser Gly Pro1 5 10 15Gly
His Gly Ser Gly 206621PRTHomo sapiens 66Gly Pro Gly Pro Gly Pro Gly
Pro Gly Pro Gly Pro Gly Pro Gly Pro1 5 10 15Gly Pro Gly Pro Gly
206721PRTHomo sapiens 67Gly Ala Gly Ser Gly Gly Gly Gly Ala Ala Gly
Ala Gly Ala Gly Ser1 5 10 15Ala Gly Gly Gly Gly 206821PRTHomo
sapiens 68Gly Ala Gly Ser Gly Gly Gly Gly Ala Ala Gly Ala Gly Ala
Gly Ser1 5 10 15Ala Gly Gly Gly Gly 206921PRTHomo sapiens 69Gly Gly
Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Gly Gly Ser Gly1 5 10 15Gly
Gly Gly Gly Gly 207021PRTHomo sapiens 70Gly Arg Gly Arg Gly Arg Gly
Arg Gly Arg Gly Arg Gly Arg Gly Arg1 5 10 15Gly Arg Gly Arg Gly
207121PRTHomo sapiens 71Gly Gly Gly Gly Gly Gly Gly Ser Gly Gly Ser
Gly Gly Gly Gly Gly1 5 10 15Ser Gly Gly Gly Gly 207221PRTHomo
sapiens 72Gly Gly Glu Glu Gly Gly Ala Ser Gly Gly Gly Pro Gly Ala
Gly Ser1 5 10 15Gly Ser Ala Gly Gly 207321PRTHomo sapiens 73Gly Ser
Gly Ser Gly Pro Gly Pro Gly Ser Gly Pro Gly Ser Gly Pro1 5 10 15Gly
His Gly Ser Gly 207421PRTHomo sapiens 74Gly Arg Gly Arg Gly Arg Gly
Arg Gly Arg Gly Arg Gly Arg Gly Arg1 5 10 15Gly Arg Gly Arg Gly
207521PRTHomo sapiens 75Gly Gly Gly Gly Gly Gly Gly Gly Asp Gly Gly
Gly Arg Arg Gly Arg1 5 10 15Gly Arg Gly Arg Gly 207620PRTHomo
sapiens 76Gly Gly Pro Gly Gly Pro Gly Gly Gly Gly Ala Gly Gly Pro
Gly Gly1 5 10 15Ala Gly Ala Gly 207720PRTHomo sapiens 77Gly Thr Gly
Gly Gly Gly Ser Thr Gly Gly Gly Gly Gly Gly Gly Gly1 5 10 15Ser Gly
His Gly 207820PRTHomo sapiens 78Gly Pro Ala Gly Ala Gly Gly Gly Gly
Gly Gly Gly Gly Gly Gly Gly1 5 10 15Gly Gly Gly Gly 207920PRTHomo
sapiens 79Gly Gly Thr Gly Gly Ser Ser Gly Ser Ser Gly Ser Gly Ser
Gly Gly1 5 10 15Gly Arg Arg Gly 208020PRTHomo sapiens 80Gly Gly Thr
Gly Gly Ser Ser Gly Ser Ser Gly Ser Gly Ser Gly Gly1 5 10 15Gly Arg
Arg Gly 208120PRTHomo sapiens 81Gly Ser Gly Thr Gly Thr Thr Gly Ser
Ser Gly Ala Gly Gly Pro Gly1 5 10 15Thr Pro Gly Gly 208220PRTHomo
sapiens 82Gly Gly Ser Gly Gly Gly Ala Ala Gly Gly Gly Ala Gly Gly
Ala Gly1 5 10 15Ala Gly Ala Gly 208320PRTHomo sapiens 83Gly Gly Ser
Gly Gly Gly Ala Ala Gly Gly Gly Ala Gly Gly Ala Gly1 5 10 15Ala Gly
Ala Gly 208420PRTHomo sapiens 84Gly Ser Ser Gly Gly Gly Gly Gly Gly
Ala Gly Ala Ala Gly Gly Ala1 5 10 15Gly Gly Ala Gly 208520PRTHomo
sapiens 85Gly Pro Gly Pro Ser Gly Gly Pro Gly Gly Gly Gly Gly Gly
Gly Gly1 5 10 15Gly Gly Gly Gly 208620PRTHomo sapiens 86Gly Gly Gly
Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Ala Ala1 5 10 15Gly Ala
Gly Gly 208720PRTHomo sapiens 87Gly Arg Gly Arg Gly Arg Gly Arg Gly
Arg Gly Arg Gly Arg Gly Arg1 5 10 15Gly Arg Gly Gly 208820PRTHomo
sapiens 88Gly Ser Ala Gly Gly Ser Ser Gly Ala Ala Gly Ala Ala Gly
Gly Gly1 5 10 15Ala Gly Ala Gly 2089600PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
89Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser1
5 10 15Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser
Ser 20 25 30Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser
Ser Asp 35 40 45Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser
Ser Asp Ser 50 55 60Ser Asp Ser
Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser65 70 75 80Asp
Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp 85 90
95Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser
100 105 110Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp
Ser Ser 115 120 125Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser
Asp Ser Ser Asp 130 135 140Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser
Ser Asp Ser Ser Asp Ser145 150 155 160Ser Asp Ser Ser Asp Ser Ser
Asp Ser Ser Asp Ser Ser Asp Ser Ser 165 170 175Asp Ser Ser Asp Ser
Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp 180 185 190Ser Ser Asp
Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser 195 200 205Ser
Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser 210 215
220Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser
Asp225 230 235 240Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp
Ser Ser Asp Ser 245 250 255Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser
Asp Ser Ser Asp Ser Ser 260 265 270Asp Ser Ser Asp Ser Ser Asp Ser
Ser Asp Ser Ser Asp Ser Ser Asp 275 280 285Ser Ser Asp Ser Ser Asp
Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser 290 295 300Ser Asp Ser Ser
Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser305 310 315 320Asp
Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp 325 330
335Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser
340 345 350Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp
Ser Ser 355 360 365Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser
Asp Ser Ser Asp 370 375 380Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser
Ser Asp Ser Ser Asp Ser385 390 395 400Ser Asp Ser Ser Asp Ser Ser
Asp Ser Ser Asp Ser Ser Asp Ser Ser 405 410 415Asp Ser Ser Asp Ser
Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp 420 425 430Ser Ser Asp
Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser 435 440 445Ser
Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser 450 455
460Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser
Asp465 470 475 480Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp
Ser Ser Asp Ser 485 490 495Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser
Asp Ser Ser Asp Ser Ser 500 505 510Asp Ser Ser Asp Ser Ser Asp Ser
Ser Asp Ser Ser Asp Ser Ser Asp 515 520 525Ser Ser Asp Ser Ser Asp
Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser 530 535 540Ser Asp Ser Ser
Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser545 550 555 560Asp
Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp 565 570
575Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser
580 585 590Ser Asp Ser Ser Asp Ser Ser Asp 595
600901200PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 90Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser
Asn Ser Ser Asp Ser1 5 10 15Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser
Asp Ser Ser Asn Ser Ser 20 25 30Asp Ser Ser Asn Ser Ser Asp Ser Ser
Asn Ser Ser Asp Ser Ser Asn 35 40 45Ser Ser Asp Ser Ser Asn Ser Ser
Asp Ser Ser Asn Ser Ser Asp Ser 50 55 60Ser Asn Ser Ser Asp Ser Ser
Asn Ser Ser Asp Ser Ser Asn Ser Ser65 70 75 80Asp Ser Ser Asn Ser
Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn 85 90 95Ser Ser Asp Ser
Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser 100 105 110Ser Asn
Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser 115 120
125Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn
130 135 140Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser
Asp Ser145 150 155 160Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp
Ser Ser Asn Ser Ser 165 170 175Asp Ser Ser Asn Ser Ser Asp Ser Ser
Asn Ser Ser Asp Ser Ser Asn 180 185 190Ser Ser Asp Ser Ser Asn Ser
Ser Asp Ser Ser Asn Ser Ser Asp Ser 195 200 205Ser Asn Ser Ser Asp
Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser 210 215 220Asp Ser Ser
Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn225 230 235
240Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser
245 250 255Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn
Ser Ser 260 265 270Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser
Asp Ser Ser Asn 275 280 285Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser
Ser Asn Ser Ser Asp Ser 290 295 300Ser Asn Ser Ser Asp Ser Ser Asn
Ser Ser Asp Ser Ser Asn Ser Ser305 310 315 320Asp Ser Ser Asn Ser
Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn 325 330 335Ser Ser Asp
Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser 340 345 350Ser
Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser 355 360
365Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn
370 375 380Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser
Asp Ser385 390 395 400Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp
Ser Ser Asn Ser Ser 405 410 415Asp Ser Ser Asn Ser Ser Asp Ser Ser
Asn Ser Ser Asp Ser Ser Asn 420 425 430Ser Ser Asp Ser Ser Asn Ser
Ser Asp Ser Ser Asn Ser Ser Asp Ser 435 440 445Ser Asn Ser Ser Asp
Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser 450 455 460Asp Ser Ser
Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn465 470 475
480Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser
485 490 495Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn
Ser Ser 500 505 510Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser
Asp Ser Ser Asn 515 520 525Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser
Ser Asn Ser Ser Asp Ser 530 535 540Ser Asn Ser Ser Asp Ser Ser Asn
Ser Ser Asp Ser Ser Asn Ser Ser545 550 555 560Asp Ser Ser Asn Ser
Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn 565 570 575Ser Ser Asp
Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser 580 585 590Ser
Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser 595 600
605Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn
610 615 620Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser
Asp Ser625 630 635 640Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp
Ser Ser Asn Ser Ser 645 650 655Asp Ser Ser Asn Ser Ser Asp Ser Ser
Asn Ser Ser Asp Ser Ser Asn 660 665 670Ser Ser Asp Ser Ser Asn Ser
Ser Asp Ser Ser Asn Ser Ser Asp Ser 675 680 685Ser Asn Ser Ser Asp
Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser 690 695 700Asp Ser Ser
Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn705 710 715
720Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser
725 730 735Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn
Ser Ser 740 745 750Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser
Asp Ser Ser Asn 755 760 765Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser
Ser Asn Ser Ser Asp Ser 770 775 780Ser Asn Ser Ser Asp Ser Ser Asn
Ser Ser Asp Ser Ser Asn Ser Ser785 790 795 800Asp Ser Ser Asn Ser
Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn 805 810 815Ser Ser Asp
Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser 820 825 830Ser
Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser 835 840
845Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn
850 855 860Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser
Asp Ser865 870 875 880Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp
Ser Ser Asn Ser Ser 885 890 895Asp Ser Ser Asn Ser Ser Asp Ser Ser
Asn Ser Ser Asp Ser Ser Asn 900 905 910Ser Ser Asp Ser Ser Asn Ser
Ser Asp Ser Ser Asn Ser Ser Asp Ser 915 920 925Ser Asn Ser Ser Asp
Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser 930 935 940Asp Ser Ser
Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn945 950 955
960Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser
965 970 975Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn
Ser Ser 980 985 990Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser
Asp Ser Ser Asn 995 1000 1005Ser Ser Asp Ser Ser Asn Ser Ser Asp
Ser Ser Asn Ser Ser Asp 1010 1015 1020Ser Ser Asn Ser Ser Asp Ser
Ser Asn Ser Ser Asp Ser Ser Asn 1025 1030 1035Ser Ser Asp Ser Ser
Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp 1040 1045 1050Ser Ser Asn
Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn 1055 1060 1065Ser
Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp 1070 1075
1080Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn
1085 1090 1095Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser
Ser Asp 1100 1105 1110Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser Ser
Asp Ser Ser Asn 1115 1120 1125Ser Ser Asp Ser Ser Asn Ser Ser Asp
Ser Ser Asn Ser Ser Asp 1130 1135 1140Ser Ser Asn Ser Ser Asp Ser
Ser Asn Ser Ser Asp Ser Ser Asn 1145 1150 1155Ser Ser Asp Ser Ser
Asn Ser Ser Asp Ser Ser Asn Ser Ser Asp 1160 1165 1170Ser Ser Asn
Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn 1175 1180 1185Ser
Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn 1190 1195
120091600PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 91Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser
Glu Ser Ser Glu Ser1 5 10 15Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser
Glu Ser Ser Glu Ser Ser 20 25 30Glu Ser Ser Glu Ser Ser Glu Ser Ser
Glu Ser Ser Glu Ser Ser Glu 35 40 45Ser Ser Glu Ser Ser Glu Ser Ser
Glu Ser Ser Glu Ser Ser Glu Ser 50 55 60Ser Glu Ser Ser Glu Ser Ser
Glu Ser Ser Glu Ser Ser Glu Ser Ser65 70 75 80Glu Ser Ser Glu Ser
Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu 85 90 95Ser Ser Glu Ser
Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser 100 105 110Ser Glu
Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser 115 120
125Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu
130 135 140Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser
Glu Ser145 150 155 160Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu
Ser Ser Glu Ser Ser 165 170 175Glu Ser Ser Glu Ser Ser Glu Ser Ser
Glu Ser Ser Glu Ser Ser Glu 180 185 190Ser Ser Glu Ser Ser Glu Ser
Ser Glu Ser Ser Glu Ser Ser Glu Ser 195 200 205Ser Glu Ser Ser Glu
Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser 210 215 220Glu Ser Ser
Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu225 230 235
240Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser
245 250 255Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu
Ser Ser 260 265 270Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser
Glu Ser Ser Glu 275 280 285Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser
Ser Glu Ser Ser Glu Ser 290 295 300Ser Glu Ser Ser Glu Ser Ser Glu
Ser Ser Glu Ser Ser Glu Ser Ser305 310 315 320Glu Ser Ser Glu Ser
Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu 325 330 335Ser Ser Glu
Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser 340 345 350Ser
Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser 355 360
365Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu
370 375 380Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser
Glu Ser385 390 395 400Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu
Ser Ser Glu Ser Ser 405 410 415Glu Ser Ser Glu Ser Ser Glu Ser Ser
Glu Ser Ser Glu Ser Ser Glu 420 425 430Ser Ser Glu Ser Ser Glu Ser
Ser Glu Ser Ser Glu Ser Ser Glu Ser 435 440 445Ser Glu Ser Ser Glu
Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser 450 455 460Glu Ser Ser
Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu465 470 475
480Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser
485 490 495Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu
Ser Ser 500 505 510Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser
Glu Ser Ser Glu 515 520 525Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser
Ser Glu Ser Ser Glu Ser 530 535 540Ser Glu Ser Ser Glu Ser Ser Glu
Ser Ser Glu Ser Ser Glu Ser Ser545 550 555 560Glu Ser Ser Glu Ser
Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu 565 570 575Ser Ser Glu
Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser Ser Glu Ser 580 585 590Ser
Glu Ser Ser Glu Ser Ser Glu 595 6009240PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 92Gly
Xaa Gly Xaa Gly Xaa Gly Xaa Gly Xaa Gly Xaa Gly Xaa Gly Xaa1 5 10
15Gly Xaa Gly Xaa Gly Xaa Gly Xaa Gly Xaa Gly Xaa Gly Xaa Gly Xaa
20 25 30Gly Xaa Gly Xaa Gly Xaa Gly Xaa 35 409339PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 93Gly
Gly Xaa Gly Gly Xaa Gly Gly Xaa Gly Gly Xaa Gly Gly Xaa Gly1 5 10
15Gly Xaa Gly Gly Xaa Gly Gly Xaa Gly Gly Xaa Gly Gly Xaa Gly Gly
20 25 30Xaa Gly Gly Xaa Gly Gly Xaa 359440PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 94Gly
Gly Gly Xaa Gly Gly Gly Xaa Gly Gly Gly Xaa Gly Gly Gly Xaa1 5 10
15Gly Gly Gly Xaa Gly Gly Gly Xaa Gly Gly Gly Xaa Gly Gly Gly Xaa
20 25 30Gly Gly Gly Xaa Gly Gly Gly Xaa 35 409540PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 95Gly
Gly Gly Gly Xaa Gly Gly Gly Gly Xaa Gly Gly Gly Gly Xaa Gly1 5 10
15Gly Gly Gly Xaa Gly Gly Gly Gly Xaa Gly Gly Gly Gly Xaa Gly Gly
20 25 30Gly Gly Xaa Gly Gly Gly Gly Xaa 35 4096315PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
96Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly1
5 10 15Gly Gly Gly Gly Xaa Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly
Gly 20 25 30Gly Gly Gly Gly Gly Gly Gly Gly Gly Xaa Gly Gly Gly Gly
Gly Gly 35 40 45Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly
Gly Xaa Gly 50 55 60Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly
Gly Gly Gly Gly65 70 75 80Gly Gly Gly Xaa Gly Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly Gly 85 90 95Gly Gly Gly Gly Gly Gly Gly Gly Xaa
Gly Gly Gly Gly Gly Gly Gly 100 105 110Gly Gly Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly Gly Xaa Gly Gly 115 120 125Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 130 135 140Gly Gly Xaa
Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly145 150 155
160Gly Gly Gly Gly Gly Gly Gly Xaa Gly Gly Gly Gly Gly Gly Gly Gly
165 170 175Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Xaa Gly
Gly Gly 180 185 190Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly
Gly Gly Gly Gly 195 200 205Gly Xaa Gly Gly Gly Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly Gly 210 215 220Gly Gly Gly Gly Gly Gly Xaa Gly
Gly Gly Gly Gly Gly Gly Gly Gly225 230 235 240Gly Gly Gly Gly Gly
Gly Gly Gly Gly Gly Gly Xaa Gly Gly Gly Gly 245 250 255Gly Gly Gly
Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 260 265 270Xaa
Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 275 280
285Gly Gly Gly Gly Gly Xaa Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly
290 295 300Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Xaa305 310
315976PRTArtificial SequenceDescription of Artificial Sequence
Synthetic 6xHis tag 97His His His His His His1 5987PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 98Ser
Lys Val Ile Leu Phe Glu1 5996PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 99Ala Arg Ala Arg Ala Arg1
51006PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 100Asp Ala Asp Ala Asp Ala1 51016PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 101Ser
Lys Val Ile Leu Phe1 51026PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 102Arg Ala Arg Ala Arg Ala1
510314PRTHomo sapiens 103Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser
Gly Gly Gly Gly1 5 1010411PRTHomo sapiens 104Gly Ser Gly Ser Gly
Gly Gly Gly Ser Gly Gly1 5 1010513PRTHomo sapiens 105Ser Gly Gly
Gly Gly Ser Gly Gly Gly Ser Gly Ser Gly1 5 1010611PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 106Gly
Gly Gly Ser Gly Ser Gly Gly Gly Gly Ser1 5 10107440PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
107Gly Gly Gly Ser Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly1
5 10 15Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser Gly Gly Gly
Gly 20 25 30Ser Gly Gly Gly Ser Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly Ser 35 40 45Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser
Gly Gly Gly 50 55 60Gly Ser Gly Gly Gly Ser Gly Ser Gly Gly Gly Gly
Ser Gly Gly Gly65 70 75 80Ser Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly Ser Gly Ser Gly Gly 85 90 95Gly Gly Ser Gly Gly Gly Ser Gly Ser
Gly Gly Gly Gly Ser Gly Gly 100 105 110Gly Ser Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Ser Gly Ser Gly 115 120 125Gly Gly Gly Ser Gly
Gly Gly Ser Gly Ser Gly Gly Gly Gly Ser Gly 130 135 140Gly Gly Ser
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser145 150 155
160Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser Gly Gly Gly Gly Ser
165 170 175Gly Gly Gly Ser Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly
Ser Gly 180 185 190Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser
Gly Gly Gly Gly 195 200 205Ser Gly Gly Gly Ser Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Ser 210 215 220Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Ser Gly Ser Gly Gly Gly225 230 235 240Gly Ser Gly Gly Gly
Ser Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly 245 250 255Ser Gly Ser
Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser Gly Gly 260 265 270Gly
Gly Ser Gly Gly Gly Ser Gly Ser Gly Gly Gly Gly Ser Gly Gly 275 280
285Gly Ser Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser Gly
290 295 300Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser Gly Gly Gly Gly
Ser Gly305 310 315 320Gly Gly Ser Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly Ser Gly Ser 325 330 335Gly Gly Gly Gly Ser Gly Gly Gly Ser
Gly Ser Gly Gly Gly Gly Ser 340 345 350Gly Gly Gly Ser Gly Ser Gly
Gly Gly Gly Ser Gly Gly Gly Ser Gly 355 360 365Ser Gly Gly Gly Gly
Ser Gly Gly Gly Ser Gly Ser Gly Gly Gly Gly 370 375 380Ser Gly Gly
Gly Ser Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser385 390 395
400Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser Gly Gly Gly
405 410 415Gly Ser Gly Gly Gly Ser Gly Ser Gly Gly Gly Gly Ser Gly
Gly Gly 420 425 430Ser Gly Ser Gly Gly Gly Gly Ser 435
44010837PRTHomo sapiens 108Gly Pro Gly Gly Gly Gly Gly Pro Gly Gly
Gly Gly Gly Pro Gly Gly1 5 10 15Gly Gly Pro Gly Gly Gly Gly Gly Gly
Gly Pro Gly Gly Gly Gly Gly 20 25 30Gly Pro Gly Gly Gly
3510911PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 109Gly Gly Gly Gly Gly Pro Gly Gly Gly Gly Pro1 5
1011016PRTHomo sapiens 110Gly Ala Gly Gly Glu Gly Gly Gly Gly Glu
Gly Gly Gly Pro Gly Gly1 5 10 151115PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 111Gly
Gly Gly Gly Glu1 511262PRTLaticauda semifasciata 112Arg Ile Cys Phe
Asn His Gln Ser Ser Gln Pro Gln Thr Thr Lys Thr1 5 10 15Cys Ser Pro
Gly Glu Ser Ser Cys Tyr Asn Lys Gln Trp Ser Asp Phe 20 25 30Arg Gly
Thr Ile Ile Glu Arg Gly Cys Gly Cys Pro Thr Val Lys Pro 35 40 45Gly
Ile Lys Leu Ser Cys Cys Glu Ser Glu Val Cys Asn Asn 50 55
60113288PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 113Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Glu Gly Gly Ser Gly Gly1 5 10 15Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly Glu Gly Gly Ser 20 25 30Gly Gly Glu Gly Gly Ser Gly Gly
Glu Gly Gly Ser Gly Gly Glu Gly 35 40 45Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly Glu Gly Gly Ser Gly Gly 50 55 60Glu Gly Gly Ser Gly Gly
Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser65 70 75 80Gly Gly Glu Gly
Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly 85 90 95Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly 100 105 110Glu
Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser 115 120
125Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly
130 135 140Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser
Gly Gly145 150 155 160Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly
Gly Glu Gly Gly Ser 165 170 175Gly Gly Glu Gly Gly Ser Gly Gly Glu
Gly Gly Ser Gly Gly Glu Gly 180 185 190Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly Glu Gly Gly Ser Gly Gly 195 200 205Glu Gly Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser 210 215 220Gly Gly Glu
Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly225 230 235
240Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
245 250 255Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly
Gly Ser 260 265 270Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser
Gly Gly Glu Gly 275 280 28511436PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 114Gly Ser Gly Gly Glu Gly
Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly1 5 10 15Glu Gly Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser 20 25 30Gly Gly Glu Gly
3511512PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 115Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu
Gly1 5 1011636DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 116aggtagtggw ggwgarggwg
gwtcyggwgg agaagg 3611736DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 117acctccttct
ccwccrgawc cwccytcwcc wccact 3611824DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 118aggttcgtct tcactcgagg gtac 2411916DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 119cctcgagtga agacga 16120288PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
120Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly1
5 10 15Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly
Ser 20 25 30Gly Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Ser Gly 35 40 45Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly Gly
Ser Gly Gly 50 55 60Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly
Glu Gly Gly Ser65 70 75 80Gly Gly Ser Gly Gly Ser Gly Gly Glu Gly
Gly Ser Gly Gly Ser Gly 85 90 95Gly Ser Gly Gly Glu Gly Gly Ser Gly
Gly Ser Gly Gly Ser Gly Gly 100 105 110Glu Gly Gly Ser Gly Gly Ser
Gly Gly Ser Gly Gly Glu Gly Gly Ser 115 120 125Gly Gly Ser Gly Gly
Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly 130 135 140Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly145 150 155
160Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly Ser
165 170 175Gly Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Ser Gly 180 185 190Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly
Gly Ser Gly Gly 195 200 205Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser
Gly Gly Glu Gly Gly Ser 210 215 220Gly Gly Ser Gly Gly Ser Gly Gly
Glu Gly Gly Ser Gly Gly Ser Gly225 230 235 240Gly Ser Gly Gly Glu
Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly 245 250 255Glu Gly Gly
Ser Gly Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly Ser 260 265 270Gly
Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly 275 280
28512110PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 121Phe Thr Cys Thr Asn His Trp Cys Pro Ser1 5
1012210PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 122Phe Gln Cys Thr Arg His Trp Cys Pro Ile1 5
1012336PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 123Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly
Ser Gly Gly Ser Gly1 5 10 15Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly
Ser Gly Gly Ser Gly Gly 20 25 30Ser Gly Gly Ser
3512430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 124nnsnnsnnst gcnnsnnstg tnnsnnsnns
3012530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 125nnsnnstgcn nsnnsnnstg tnnsnnsnns
3012630DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 126nnsnnstgcn nsnnsnnsnn stgtnnsnns
3012730DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 127nnstgcnnsn nsnnsnnsnn stgtnnsnns
3012830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 128nnstgcnnsn nsnnsnnsnn snnstgtnns
3012930DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 129tgcnnsnnsn nsnnsnnsnn snnstgtnns
3013030DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 130tgcnnsnnsn nsnnsnnsnn snnsnnstgt
3013133DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 131tgcnnsnnsn nsnnsnnsnn snnsnnsnns tgt
3313236DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 132tgcnnsnnsn nsnnsnnsnn snnsnnsnns
nnstgt 3613348DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 133nnsnnsnnsn nsnnsnnstg
cnnsnnstgt nnsnnsnnsn nsnnsnns 4813448DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 134nnsnnsnnsn nsnnstgcnn snnsnnstgt nnsnnsnnsn
nsnnsnns 4813548DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 135nnsnnsnnsn nsnnstgcnn
snnsnnsnns tgtnnsnnsn nsnnsnns 4813648DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 136nnsnnsnnsn nstgcnnsnn snnsnnsnns tgtnnsnnsn
nsnnsnns 4813748DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 137nnsnnsnnsn nstgcnnsnn
snnsnnsnns nnstgtnnsn nsnnsnns 4813848DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 138nnsnnsnnst gcnnsnnsnn snnsnnsnns nnstgtnnsn
nsnnsnns 4813948DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 139nnsnnsnnst gcnnsnnsnn
snnsnnsnns nnsnnstgtn
nsnnsnns 4814048DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 140nnsnnstgcn nsnnsnnsnn
snnsnnsnns nnsnnstgtn nsnnsnns 4814148DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 141nnsnnstgcn nsnnsnnsnn snnsnnsnns nnsnnsnnst
gtnnsnns 4814210PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 142Ser Tyr Ile Cys His Asn Cys Leu Leu
Ser1 5 1014310PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 143Leu Arg Cys Trp Gly Met Leu Cys Tyr
Ala1 5 1014410PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 144Leu Arg Cys Ile Gly Gln Ile Cys Trp
Arg1 5 1014510PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 145Leu Lys Cys Leu Tyr Asn Ile Cys Trp
Val1 5 1014616PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 146Arg Pro Gly Met Ala Cys Ser Gly Gln
Leu Cys Trp Leu Asn Ser Pro1 5 10 1514716PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 147Pro
His Ala Leu Gln Cys Tyr Gly Ser Leu Cys Trp Pro Ser His Leu1 5 10
1514816PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 148Arg Ala Gly Ile Thr Cys His Gly His Leu Cys
Trp Pro Ile Thr Asp1 5 10 1514916PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 149Arg Pro Ala Leu Lys Cys
Ile Gly Thr Leu Cys Ser Leu Ala Asn Pro1 5 10 1515016PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 150Pro
His Gly Leu Trp Cys His Gly Ser Leu Cys His Tyr Pro Leu Ala1 5 10
1515116PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 151Pro His Gly Leu Ile Cys Ala Gly Ser Ile Cys
Phe Trp Pro Pro Pro1 5 10 1515216PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 152Pro Arg Asn Leu Thr Cys
Tyr Gly Gln Ile Cys Phe Gln Ser Gln His1 5 10 1515316PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 153Pro
His Asn Leu Ala Cys Gln Asn Ser Ile Cys Val Arg Leu Pro Arg1 5 10
1515416PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 154Pro His Gly Leu Thr Cys Thr Asn Gln Ile Cys
Phe Tyr Gly Asn Thr1 5 10 1515510PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 155Leu Phe Cys Trp Gly Asn
Val Cys His Phe1 5 1015610PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 156Leu Thr Cys Trp Gly Gln
Val Cys Phe Arg1 5 1015710PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 157Arg Cys Pro Ser Arg Val
Pro Trp Cys Val1 5 1015816PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 158Gln Leu Val Cys Gly Phe
Ser Asp Ser Ser Arg Leu Cys Tyr Met Arg1 5 10 1515916PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 159Leu
Leu Cys Tyr Ile Thr Ser Pro Gly Asn Arg Leu Cys Ser Pro Tyr1 5 10
1516010PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 160Trp Glu Cys Thr Gln His Trp Cys Pro Ser1 5
1016116PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 161Ala Pro Phe Phe Ser Cys Ser Phe Gly Phe Cys
Arg Asp Leu Gln Thr1 5 10 1516216PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 162Thr Pro Tyr Phe Arg Cys
Gln Phe Gly Phe Cys Phe Asp Ser Phe Ser1 5 10 1516316PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 163Asn
Pro Phe Phe Tyr Cys Val Ala Gly Lys Cys Val Asp Ala Pro Leu1 5 10
1516416PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 164Asp Met Arg Phe Leu Cys Arg His Gly Lys Cys
His Asp Leu Pro Leu1 5 10 1516516PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 165Pro Pro Phe Phe Val Cys
Ser Leu Gly Lys Cys Arg Asp Ala His Leu1 5 10 1516616PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 166Pro
Pro Gln Phe Gln Cys Val Arg Gly Lys Cys Phe Asp Leu Thr Phe1 5 10
1516716PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 167Ile Ser Thr Phe Phe Cys Ser Asn Gly Ser Cys
Val Asp Val Pro Ala1 5 10 1516816PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 168Pro Pro His Phe Arg Cys
Phe Asn Gly Ser Cys Val Asp Leu Ser Arg1 5 10 1516916PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 169Asn
Val His Phe Trp Cys His Asn His Lys Cys His Asp Leu Val Ser1 5 10
1517016PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 170Leu Phe Phe Lys Cys Asp Val Gly His Gly Cys
Tyr Asp Ile Lys His1 5 10 1517116PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 171Leu Tyr Phe Gln Cys Phe
Pro Asn Arg Gly Cys Ser Thr Leu Gln Pro1 5 10 1517216PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 172Pro
Ser Phe Phe Cys Ser Pro Leu Leu Gly Cys Arg Asp Ser Leu Ser1 5 10
1517316PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 173Gly Thr Pro Arg Cys Asn Pro Phe Arg Gln Phe
Cys Ala Ile Pro Ser1 5 10 1517410PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 174Leu Cys Leu Pro Leu Gly
Arg Trp Cys Pro1 5 1017516PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 175Thr Ser Pro Ala Cys Asn
Pro Phe Arg His Phe Cys Thr Leu Pro Thr1 5 10 1517616PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 176Gln
Pro Pro Ile Cys Asn Pro Phe Arg Gln Leu Cys Gly Ile Pro Leu1 5 10
1517716PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 177Val His Thr Phe Cys Asn Pro Phe Arg Gln Met
Cys Ser Leu Pro Met1 5 10 1517816PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 178Arg Met Val Asn Cys Asn
Pro Phe Asn Ser Trp Cys Ser Leu Pro Ser1 5 10 1517916PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 179Ser
Lys His Met Cys Asn Pro Phe His Ser Trp Cys Gly Val Pro Leu1 5 10
1518016PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 180Arg Trp Pro Val Cys Asn Pro Phe Leu Gly Tyr
Cys Gly Ile Pro Asn1 5 10 1518116PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 181Ser Lys Pro Thr Cys Asn
Val Phe Asn Ser Trp Cys Ser Val Pro Leu1 5 10 1518216PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 182Arg
Pro Pro Ala Cys Asn Leu Phe Leu Ser Trp Cys Ser Tyr Asp Ser1 5 10
1518316PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 183Gly Arg Ser Val Cys Asn Pro Tyr Lys Ser Trp
Cys Pro Val Arg Gln1 5 10 1518416PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 184Ala Ser Ser Cys Lys Asp
Ser Pro His Phe Arg Cys Leu Phe Pro Leu1 5 10 1518516PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 185Leu
Ala Asn Cys Pro Asn Ser Pro Gly Phe Leu Cys Leu His Ala Val1 5 10
1518616PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 186Pro Phe Ala Cys Pro His Ser Ser Gly Phe Arg
Cys Leu Tyr Asn Ile1 5 10 1518716PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 187Ser Phe Thr Cys Ser Leu
Phe Pro Ser Pro His Cys Thr Thr Leu Arg1 5 10 1518816PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 188Leu
Arg Leu Cys Thr Tyr Gly Gly Gly Lys Tyr Asp Cys Ser Ser Thr1 5 10
1518916PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 189Gly Ser Tyr Cys Gln Tyr Arg Pro Phe Ser Ser
Phe Cys Asn Arg Ser1 5 10 1519011PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 190Cys Ser Tyr Asn Gln Val
Leu Gly Arg Ala Cys1 5 1019116PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 191Pro His Cys Arg Gln His
Pro Leu Asp Arg Trp Met Cys Ser Pro Ser1 5 10 1519216PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 192Ser
Leu Cys Ser Met Phe Gly Asp Thr Pro His Trp Asn Cys Val Pro1 5 10
1519316PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 193Ser Ser Cys Ser Leu Phe Asn Asn Thr Arg His
Trp Ser Cys Thr Asp1 5 10 1519416PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 194Thr Thr Ala Tyr Pro Asp
Cys Phe Trp Cys Ser Leu Phe Gly Pro Pro1 5 10 1519516PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 195Met
Leu Asp Thr Thr Ile Cys Pro Trp Cys Ser Leu Phe Gly Pro Val1 5 10
1519616PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 196Met Leu Xaa Thr Thr Ile Cys Pro Trp Cys Ser
Leu Phe Gly Pro Val1 5 10 1519716PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 197Glu Leu Leu Leu Glu Arg
Cys Ser Trp Cys Ser Leu Phe Gly Pro Pro1 5 10 1519816PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 198Ser
Leu Ser Gln Gln Ser Cys Asp Trp Cys Trp Leu Phe Gly Pro Pro1 5 10
1519916PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 199Lys Arg Leu Leu Glu Cys Gly Ala Leu Cys Ala
Leu Phe Gly Pro Pro1 5 10 1520016PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 200His Thr Ile Leu Thr Cys
Asp Ser Gly Phe Cys Thr Leu Phe Gly Pro1 5 10 1520116PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 201Asn
Leu Trp His Val Cys His Thr Ser Leu Cys His Ser Arg Leu Ala1 5 10
1520216PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 202Asn Ser Phe Tyr Leu Cys His Ser Ser Val Cys
Gly Gln Leu Pro Ser1 5 10 1520316PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 203Ala Gly Phe Ser Cys Glu
Asn Tyr Phe Phe Cys Pro Pro Lys Asn Leu1 5 10 1520416PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 204Ser
Trp Cys Thr Val Phe Gly Asn His Asp Pro Ser Cys Asn Ser Arg1 5 10
1520511PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 205Cys Ser Ser Asn Gly Arg Trp Lys Ala His Cys1 5
1020616PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 206Leu Pro Asn Met Trp Arg Val Val Val Pro Asp
Val Tyr Asp Arg Arg1 5 10 1520716PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 207Lys His Tyr Cys Phe Gly
Pro Lys Ser Trp Thr Thr Cys Ala Arg Gly1 5 10 1520816PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 208Pro
Trp Cys His Leu Cys Pro Gly Ser Pro Ser Arg Cys Cys Gln Pro1 5 10
1520916PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 209Pro Glu Ser Lys Leu Ile Ser Glu Glu Asp Leu
Asn Gly Asp Val Ser1 5 10 1521016PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 210Ile Trp Asp Arg Val Cys
Arg Met Asn Thr Cys His Gln His Ser His1 5 10 1521116PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 211Pro
Tyr Thr Ile Phe Cys Leu His Ser Ser Cys Arg Ser Ser Ser Ser1 5 10
1521216PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 212Asp Trp Cys Leu Thr Gly Pro Asn Thr Leu Ser
Phe Cys Pro Arg Arg1 5 10 1521316PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 213Leu Ser Thr Trp Arg Cys
Leu His Asp Val Cys Trp Pro Pro Leu Lys1 5 10 1521416PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 214Val
Tyr Leu Thr Gln Cys Gly Ala Gln Leu Cys Leu Lys Arg Thr Asn1 5 10
1521516PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 215Pro Tyr Leu Thr Ser Cys Gly Asp Arg Val Cys
Leu Lys Arg Pro Pro1 5 10 1521616PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 216Pro Tyr Leu Ser Arg Cys
Gly Gly Arg Ile Cys Met His Asp Arg Leu1 5 10 1521716PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 217Leu
Lys Leu Thr Pro Cys Ser His Gly Val Cys Met His Arg Leu Arg1 5 10
1521816PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 218Tyr Tyr Leu Thr Asn Cys Pro Lys Gly His Cys
Leu Arg Arg Val Asp1 5 10 1521916PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 219Leu Tyr Leu His Ser Cys
Ser Arg Gly Ile Cys Leu Ser Pro Arg Val1 5 10 1522016PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 220Phe
Ser Cys Gln Ser Ser Phe Pro Gly Arg Arg Met Cys Glu Leu Arg1 5 10
1522116PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 221His Arg Cys Ser Ala His Gly Ser Ser Ser Ser
Phe Cys Pro Gly Ser1 5 10 1522216PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 222Lys Thr Trp Asp Cys Arg
Asn Ser Gly His Cys Val Ile Thr Phe Lys1 5 10 1522316PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 223Ala
Thr Trp Asp Cys Arg Asp His Asn Phe Ser Cys Val Arg Leu Ser1 5 10
1522410PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 224Leu Arg Cys Trp Gly Met Leu Cys Tyr Ala1 5
1022510PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 225Leu Arg Cys Ile Gly Gln Ile Cys Trp Arg1 5
1022610PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 226Leu Lys Cys Leu Tyr Asn Ile Cys Trp Val1 5
1022710PRTArtificial SequenceDescription of Artificial Sequence
Synthetic
peptide 227Leu Phe Cys Trp Gly Asn Val Cys His Phe1 5
1022810PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 228Leu Thr Cys Trp Gly Gln Val Cys Phe Arg1 5
1022916PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 229Arg Pro Gly Met Ala Cys Ser Gly Gln Leu Cys
Trp Leu Asn Ser Pro1 5 10 1523016PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 230Pro His Ala Leu Gln Cys
Tyr Gly Ser Leu Cys Trp Pro Ser His Leu1 5 10 1523116PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 231Arg
Ala Gly Ile Thr Cys His Gly His Leu Cys Trp Pro Ile Thr Asp1 5 10
1523216PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 232Arg Pro Ala Leu Lys Cys Ile Gly Thr Leu Cys
Ser Leu Ala Asn Pro1 5 10 1523316PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 233Pro His Gly Leu Trp Cys
His Gly Ser Leu Cys His Tyr Pro Leu Ala1 5 10 1523416PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 234Pro
His Gly Leu Ile Cys Ala Gly Ser Ile Cys Phe Trp Pro Pro Pro1 5 10
1523516PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 235Pro Arg Asn Leu Thr Cys Tyr Gly Gln Ile Cys
Phe Gln Ser Gln His1 5 10 1523616PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 236Pro His Asn Leu Ala Cys
Gln Asn Ser Ile Cys Val Arg Leu Pro Arg1 5 10 1523716PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 237Pro
His Gly Leu Thr Cys Thr Asn Gln Ile Cys Phe Tyr Gly Asn Thr1 5 10
1523815PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 238His Ser Leu Thr Cys Tyr Gly Gln Ile Cys Trp
Val Ser Asn Ile1 5 10 1523915PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 239Pro Thr Leu Thr Cys Tyr
Asn Gln Val Cys Trp Val Asn Arg Thr1 5 10 1524015PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 240Pro
Ala Leu Arg Cys Leu Gly Gln Leu Cys Trp Val Thr Pro Thr1 5 10
1524115PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 241Pro Gly Leu Arg Cys Leu Gly Thr Leu Cys Trp
Val Pro Asn Arg1 5 10 1524215PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 242Arg Asn Leu Thr Cys Trp
Asn Thr Val Cys Tyr Ala Tyr Pro Asn1 5 10 1524315PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 243Arg
Gly Leu Lys Cys Leu Gly Gln Leu Cys Trp Val Ser Ser Asn1 5 10
1524415PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 244Pro Thr Leu Lys Cys Ser Gly Gln Ile Cys Trp
Val Pro Pro Pro1 5 10 1524515PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 245Arg Asn Leu Glu Cys Leu
Gly Asn Val Cys Ser Leu Leu Asn Gln1 5 10 1524615PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 246Pro
Thr Leu Thr Cys Leu Asn Asn Leu Cys Trp Val Pro Pro Gln1 5 10
1524715PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 247Arg Gly Leu Lys Cys Ser Gly His Leu Cys Trp
Val Thr Pro Gln1 5 10 1524815PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 248His Gly Leu Thr Cys His
Asn Thr Val Cys Trp Val His His Pro1 5 10 1524915PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 249His
Thr Leu Glu Cys Leu Gly Asn Ile Cys Trp Val Ile Asn Gln1 5 10
1525015PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 250His Gly Leu Thr Cys Tyr Asn Gln Ile Cys Trp
Ala Pro Arg Pro1 5 10 1525115PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 251His Gly Leu Ala Cys Tyr
Asn Gln Leu Cys Trp Val Asn Pro His1 5 10 1525215PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 252Arg
Gly Leu Ala Cys Gln Gly Asn Ile Cys Trp Arg Leu Asn Pro1 5 10
1525315PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 253Arg Ala Ile Thr Cys Leu Gly Thr Leu Cys Trp
Pro Thr Ser Pro1 5 10 1525415PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 254Leu Thr Leu Glu Cys Ile
Gly Asn Ile Cys Tyr Val Pro His His1 5 10 1525554DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 255caggcagcgg gcccgtctgg cccgtgyttt acttgtacga
atcattggtg tcct 5425657DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 256caggcagcgg
gcccgtctgg cccgtgynnk tttacttgta cgaatcattg gtgtcct
5725760DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 257caggcagcgg gcccgtctgg cccgtgynnk
nnktttactt gtacgaatca ttggtgtcct 6025863DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 258caggcagcgg gcccgtctgg cccgtgynht nhtnhtttta
cttgtacgaa tcattggtgt 60cct 6325966DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 259caggcagcgg gcccgtctgg cccgtgynht nhtnhtnhtt
ttacttgtac gaatcattgg 60tgtcct 6626068DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 260caggcagcgg gcccgtctgg cccgtgykmt kmtkmtkmtk
mttttacttg tacgaatcat 60tggtgtcc 6826149DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 261accggaacca ccagactggc crcacgaagg acaccaatga
ttcgtacaa 4926252DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 262accggaacca ccagactggc
crcamnncga aggacaccaa tgattcgtac aa 5226355DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 263accggaacca ccagactggc crcamnnmnn cgaaggacac
caatgattcg tacaa 5526458DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 264accggaacca
ccagactggc crcaadnadn adncgaagga caccaatgat tcgtacaa
5826561DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 265accggaacca ccagactggc crcaadnadn
adnadncgaa ggacaccaat gattcgtaca 60a 6126664DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 266accggaacca ccagactggc crcaakmakm akmakmakmc
gaaggacacc aatgattcgt 60acaa 642674PRTHomo sapiens 267Cys Gly Trp
Cys126821PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 268Pro Ser Gly Pro Ser Cys His Thr Thr Asn His
Trp Pro Ile Ser Ala1 5 10 15Val Thr Cys Pro Pro
2026932PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 269Gly Gly Gly Ser Gly Ser Gly Gly Gly Gly Ser
Gly Gly Gly Ser Gly1 5 10 15Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser
Gly Ser Gly Gly Gly Gly 20 25 3027013PRTHomo sapiens 270Gly Gly Ser
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly1 5 1027133PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 271Gly
Gly Gly Gly Gly Pro Gly Gly Gly Gly Pro Gly Gly Gly Gly Gly1 5 10
15Pro Gly Gly Gly Gly Pro Gly Gly Gly Gly Gly Pro Gly Gly Gly Gly
20 25 30Pro272864DNAArtificial SequenceDescription of Artificial
Sequence Synthetic construct 272ggt agt ggt ggt gaa gga ggt tct ggt
gga gaa gga ggt agt gga ggt 48Gly Ser Gly Gly Glu Gly Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly1 5 10 15gaa ggt gga tcc gga gga gaa gga
ggt agt gga ggt gaa gga gga tcc 96Glu Gly Gly Ser Gly Gly Glu Gly
Gly Ser Gly Gly Glu Gly Gly Ser 20 25 30gga gga gaa gga ggt agt ggt
ggt gaa gga ggt tct ggt gga gaa gga 144Gly Gly Glu Gly Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly Glu Gly 35 40 45ggt agt gga ggt gaa ggt
gga tcc gga gga gaa gga ggt agt gga ggt 192Gly Ser Gly Gly Glu Gly
Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly 50 55 60gaa gga gga tcc gga
gga gaa gga ggt agt gga ggt gaa ggt gga tcc 240Glu Gly Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser65 70 75 80ggt gga gaa
gga ggt agt gga ggt gaa gga ggt tcc ggt gga gaa gga 288Gly Gly Glu
Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly 85 90 95ggt agt
gga gga gag ggt gga tct gga gga gaa gga ggt agt gga gga 336Gly Ser
Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly 100 105
110gag ggt ggt tct gga gga gaa gga ggt agt ggt gga gag ggt gga tct
384Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser
115 120 125ggt gga gaa gga ggt agt gga gga gaa ggt ggt tct gga gga
gaa gga 432Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Glu Gly 130 135 140ggt agt ggt ggt gaa gga ggt tct ggt gga gaa gga
ggt agt gga ggt 480Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly
Gly Ser Gly Gly145 150 155 160gaa ggt gga tcc gga gga gaa gga ggt
agt gga ggt gaa gga gga tcc 528Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly Glu Gly Gly Ser 165 170 175gga gga gaa gga ggt agt ggt
ggt gaa gga ggt tct ggt gga gaa gga 576Gly Gly Glu Gly Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly Glu Gly 180 185 190ggt agt gga ggt gaa
ggt gga tcc gga gga gaa gga ggt agt gga ggt 624Gly Ser Gly Gly Glu
Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly 195 200 205gaa gga gga
tcc gga gga gaa gga ggt agt gga ggt gaa ggt gga tcc 672Glu Gly Gly
Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser 210 215 220ggt
gga gaa gga ggt agt gga ggt gaa gga ggt tcc ggt gga gaa gga 720Gly
Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly225 230
235 240ggt agt gga gga gag ggt gga tct gga gga gaa gga ggt agt gga
gga 768Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly
Gly 245 250 255gag ggt ggt tct gga gga gaa gga ggt agt ggt gga gag
ggt gga tct 816Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu
Gly Gly Ser 260 265 270ggt gga gaa gga ggt agt gga gga gaa ggt ggt
tct gga gga gaa gga 864Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly Glu Gly 275 280 285273288PRTArtificial
SequenceDescription of Artificial Sequence Synthetic construct
273Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly1
5 10 15Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser 20 25 30Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Glu Gly 35 40 45Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly 50 55 60Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Glu Gly Gly Ser65 70 75 80Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly
Gly Ser Gly Gly Glu Gly 85 90 95Gly Ser Gly Gly Glu Gly Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly 100 105 110Glu Gly Gly Ser Gly Gly Glu
Gly Gly Ser Gly Gly Glu Gly Gly Ser 115 120 125Gly Gly Glu Gly Gly
Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly 130 135 140Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly145 150 155
160Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser
165 170 175Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Glu Gly 180 185 190Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly
Gly Ser Gly Gly 195 200 205Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser
Gly Gly Glu Gly Gly Ser 210 215 220Gly Gly Glu Gly Gly Ser Gly Gly
Glu Gly Gly Ser Gly Gly Glu Gly225 230 235 240Gly Ser Gly Gly Glu
Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly 245 250 255Glu Gly Gly
Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser 260 265 270Gly
Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly 275 280
285274864DNAArtificial SequenceDescription of Artificial Sequence
Synthetic construct 274ggt agt ggt ggt gag ggt gga tcc gga gga agt
gga ggt agt ggt gga 48Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser
Gly Gly Ser Gly Gly1 5 10 15gaa gga gga tct ggt gga agt gga ggt agt
gga ggt gag gga gga tct 96Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser
Gly Gly Glu Gly Gly Ser 20 25 30ggt gga agt gga ggt agt ggt ggt gag
ggt ggt tcc gga gga agt gga 144Gly Gly Ser Gly Gly Ser Gly Gly Glu
Gly Gly Ser Gly Gly Ser Gly 35 40 45ggt agt gga gga gaa ggt ggt tcc
ggt gga agt gga ggt agt ggt gga 192Gly Ser Gly Gly Glu Gly Gly Ser
Gly Gly Ser Gly Gly Ser Gly Gly 50 55 60gag ggt gga tct gga gga agt
gga ggt agt ggt ggt gag ggt ggt tcc 240Glu Gly Gly Ser Gly Gly Ser
Gly Gly Ser Gly Gly Glu Gly Gly Ser65 70 75 80gga gga agt gga ggt
agt gga gga gaa ggt ggt tcc ggt gga agt gga 288Gly Gly Ser Gly Gly
Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly 85 90 95ggt agt ggt gga
gag ggt gga tct gga gga agt gga ggt agt gga gga 336Gly Ser Gly Gly
Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly 100 105 110gaa gga
gga tct gga gga agt gga ggt agt ggt ggt gaa gga ggt tcc 384Glu Gly
Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly Ser 115 120
125ggt gga agt gga ggt agt ggt gga gaa gga ggt tcc gga gga agt gga
432Gly Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly
130 135 140ggt agt ggt ggt gag gga gga tct ggt gga agt gga ggt agt
gga gga 480Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser
Gly Gly145 150 155 160gag gga ggt tct ggt gga agt gga ggt agt ggt
ggt gag ggt ggt tcc 528Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly
Gly Glu Gly Gly Ser 165 170 175ggt gga agt gga ggt agt ggt ggt gaa
gga ggt tct gga gga agt gga 576Gly Gly Ser Gly Gly Ser Gly Gly Glu
Gly Gly Ser Gly Gly Ser Gly 180 185 190ggt agt ggt gga gaa ggt ggt
tcc ggt gga agt gga ggt agt gga gga 624Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly Ser Gly Gly Ser Gly Gly 195 200 205gaa gga gga tct gga
gga agt gga ggt agt ggt ggt gag ggt ggt tcc 672Glu Gly Gly Ser Gly
Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly Ser 210 215 220gga gga agt
gga ggt agt gga gga gaa ggt ggt tcc ggt gga agt gga 720Gly Gly Ser
Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly225 230 235
240ggt agt ggt gga gag ggt gga tct gga gga
agt gga ggt agt ggt ggt 768Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Ser Gly Gly Ser Gly Gly 245 250 255gaa gga ggt tcc ggt gga agt gga
ggt agt gga ggt gaa ggt gga tct 816Glu Gly Gly Ser Gly Gly Ser Gly
Gly Ser Gly Gly Glu Gly Gly Ser 260 265 270ggt gga agt gga ggt agt
gga ggt gag ggt ggt tcc gga gga agt gga 864Gly Gly Ser Gly Gly Ser
Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly 275 280
285275288PRTArtificial SequenceDescription of Artificial Sequence
Synthetic construct 275Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser
Gly Gly Ser Gly Gly1 5 10 15Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser
Gly Gly Glu Gly Gly Ser 20 25 30Gly Gly Ser Gly Gly Ser Gly Gly Glu
Gly Gly Ser Gly Gly Ser Gly 35 40 45Gly Ser Gly Gly Glu Gly Gly Ser
Gly Gly Ser Gly Gly Ser Gly Gly 50 55 60Glu Gly Gly Ser Gly Gly Ser
Gly Gly Ser Gly Gly Glu Gly Gly Ser65 70 75 80Gly Gly Ser Gly Gly
Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly 85 90 95Gly Ser Gly Gly
Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly 100 105 110Glu Gly
Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly Ser 115 120
125Gly Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly
130 135 140Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser
Gly Gly145 150 155 160Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly
Gly Glu Gly Gly Ser 165 170 175Gly Gly Ser Gly Gly Ser Gly Gly Glu
Gly Gly Ser Gly Gly Ser Gly 180 185 190Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly Ser Gly Gly Ser Gly Gly 195 200 205Glu Gly Gly Ser Gly
Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly Ser 210 215 220Gly Gly Ser
Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly225 230 235
240Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly
245 250 255Glu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Glu Gly
Gly Ser 260 265 270Gly Gly Ser Gly Gly Ser Gly Gly Glu Gly Gly Ser
Gly Gly Ser Gly 275 280 285276671PRTHomo sapiens 276Ser Asp Ser Ser
Asp Ser Asp Ser Ser Asp Ser Ser Asn Ser Ser Asp1 5 10 15Ser Ser Asp
Ser Ser Asp Ser Asp Ser Ser Asp Ser Asn Ser Ser Ser 20 25 30Asp Ser
Asp Ser Ser Asp Ser Asp Ser Ser Asp Ser Ser Asp Ser Asp 35 40 45Ser
Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser 50 55
60Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Lys Ser Asp Ser65
70 75 80Ser Lys Ser Glu Ser Asp Ser Ser Asp Ser Asp Ser Lys Ser Asp
Ser 85 90 95Ser Asp Ser Asn Ser Ser Asp Ser Ser Asp Asn Ser Asp Ser
Ser Asp 100 105 110Ser Ser Asn Ser Ser Asn Ser Ser Asp Ser Ser Asp
Ser Ser Asp Ser 115 120 125Ser Asp Ser Ser Ser Ser Ser Asp Ser Ser
Ser Ser Ser Asp Ser Ser 130 135 140Asn Ser Ser Asp Ser Ser Asp Ser
Ser Asp Ser Ser Asn Ser Ser Glu145 150 155 160Ser Ser Asp Ser Ser
Asp Ser Ser Asp Ser Asp Ser Ser Asp Ser Ser 165 170 175Asp Ser Ser
Asn Ser Asn Ser Ser Asp Ser Asp Ser Ser Asn Ser Ser 180 185 190Asp
Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asn Ser Ser Asp 195 200
205Ser Ser Asp Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asp Ser
210 215 220Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asn Ser Ser Asp
Ser Asn225 230 235 240Asp Ser Ser Asn Ser Ser Asp Ser Ser Asp Ser
Ser Asn Ser Ser Asp 245 250 255Ser Ser Asn Ser Ser Asp Ser Ser Asp
Ser Ser Asp Ser Ser Asp Ser 260 265 270Asp Ser Ser Asn Ser Ser Asp
Ser Ser Asn Ser Ser Asp Ser Ser Asp 275 280 285Ser Ser Asn Ser Ser
Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser 290 295 300Ser Asp Ser
Asp Ser Ser Asn Arg Ser Asp Ser Ser Asn Ser Ser Asp305 310 315
320Ser Ser Asp Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asp Ser
325 330 335Ser Asp Ser Ser Asp Ser Asn Glu Ser Ser Asn Ser Ser Asp
Ser Ser 340 345 350Asp Ser Ser Asn Ser Ser Asp Ser Asp Ser Ser Asp
Ser Ser Asn Ser 355 360 365Ser Asp Ser Ser Asp Ser Ser Asn Ser Ser
Asp Ser Ser Glu Ser Ser 370 375 380Asn Ser Ser Asp Asn Ser Asn Ser
Ser Asp Ser Ser Asn Ser Ser Asp385 390 395 400Ser Ser Asp Ser Ser
Asp Ser Ser Asn Ser Ser Asp Ser Ser Asn Ser 405 410 415Gly Asp Ser
Ser Asn Ser Ser Asp Ser Ser Asp Ser Asn Ser Ser Asp 420 425 430Ser
Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser 435 440
445Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser
450 455 460Asp Ser Ser Asp Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser
Ser Asn465 470 475 480Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser
Asp Ser Ser Asp Ser 485 490 495Ser Asp Ser Ser Asn Ser Ser Asp Ser
Ser Asp Ser Ser Asp Ser Ser 500 505 510Asp Ser Ser Asp Ser Ser Gly
Ser Ser Asp Ser Ser Asp Ser Ser Asp 515 520 525Ser Ser Asp Ser Ser
Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser 530 535 540Ser Asp Ser
Ser Glu Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser545 550 555
560Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp
565 570 575Ser Ser Asp Ser Ser Asp Ser Ser Asn Ser Ser Asp Ser Ser
Asp Ser 580 585 590Ser Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp Ser
Ser Asp Ser Ser 595 600 605Asp Ser Ser Asp Ser Ser Asp Ser Ser Asp
Ser Ser Asp Ser Ser Asp 610 615 620Ser Ser Asp Ser Ser Asp Ser Ser
Asp Ser Ser Asp Ser Asn Glu Ser625 630 635 640Ser Asp Ser Ser Asp
Ser Ser Asp Ser Ser Asp Ser Ser Asn Ser Ser 645 650 655Asp Ser Ser
Asp Ser Ser Asp Ser Ser Asp Ser Thr Ser Asp Ser 660 665
6702776PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 277Ser Ser Asp Ser Ser Asn1 52788PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 278Arg
Ala Asp Ala Arg Ala Asp Ala1 52798PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 279Arg Ala Arg Ala Arg Ala
Arg Ala1 52808PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 280Asp Ala Asp Ala Asp Ala Asp Ala1
52818PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 281His Ala His Ala His Ala His Ala1
528213PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 282Cys Cys Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa
Xaa Cys1 5 1028313PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 283Cys Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa
Xaa Xaa Cys Cys1 5 1028412PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 284Cys Xaa Cys Xaa Xaa Xaa
Xaa Xaa Xaa Cys Xaa Cys1 5 1028514PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 285Cys Xaa Xaa Cys Xaa Xaa
Xaa Xaa Xaa Xaa Cys Xaa Xaa Cys1 5 1028616PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 286Cys
Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa Xaa Cys1 5 10
1528718PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 287Cys Xaa Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa
Xaa Cys Xaa Xaa Xaa1 5 10 15Xaa Cys28820PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 288Cys
Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa1 5 10
15Xaa Xaa Xaa Cys 2028922PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 289Cys Xaa Xaa Xaa Xaa Xaa
Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa1 5 10 15Xaa Xaa Xaa Xaa Xaa
Cys 2029024PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 290Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa
Xaa Xaa Xaa Xaa Cys1 5 10 15Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys
2029126PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 291Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa
Xaa Xaa Xaa Xaa Xaa1 5 10 15Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys
20 2529232DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 292gaaagtggcg gcgaaagccg gtctgcccgg cc
32293102DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 293gaaagcggcg gtgaaagcnn nnnnnnnnnn
tgcnnnnnnn nnnnnnnnnn ntgtnnnnnn 60nnnnnnagct ccggatctgg tggttccagc
ggcggtgaaa gc 10229434PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 294Glu Ser Gly Gly Glu Ser
Xaa Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa1 5 10 15Xaa Cys Xaa Xaa Xaa
Xaa Ser Ser Gly Ser Gly Gly Ser Ser Gly Gly 20 25 30Glu
Ser29527DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 295agaccaccaa ggtcgccgcc tctttcg
2729620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 296gaaagtggcg gcgaccttgg
2029792DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 297tgcggcggtg aaagcnnnnn nnnnnnntgc
nnnnnnnnnn nnnnnnnntg tnnnnnnnnn 60nnngctccgg atctgggtcc agtctggtgg
tg 9229828PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 298Gly Ser Ser Gly Gly Glu Ser Xaa Xaa Xaa Xaa
Cys Xaa Xaa Xaa Xaa1 5 10 15Xaa Xaa Cys Xaa Xaa Xaa Xaa Ser Ser Gly
Ser Gly 20 2529984DNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 299acccagatcc ggagcnnnnn
nnnnnnnaca nnnnnnnnnn nnnnnnnngc annnnnnnnn 60nnngctttca ccgccgctgg
aacc 8430029DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 300cgaggcctag acccaggtca
gaccacctg 29301112DNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 301ggcccgtctg gccgaaagcg
gcggtgaaag cnnntgcnnn tgtnnnagct ccggatctgg 60tggttccggt agcggcggta
gcnnntgcnn ntgtnnngct ccggatctgg gt 11230233PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 302Glu
Ser Gly Gly Glu Ser Xaa Cys Xaa Cys Xaa Ser Ser Gly Ser Gly1 5 10
15Gly Ser Ser Gly Gly Glu Ser Xaa Cys Xaa Cys Xaa Ser Ser Gly Ser
20 25 30Gly303124DNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 303ccaccagact ggacccagat
ccggagcnnn acannngcan nngctaccgc cgctaccgga 60accaccagat ccggagctnn
nacannngca nnngctttca ccgccgcttt cggccagacg 120ggcc
124304230PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 304Met Asp Tyr Lys Asp Asp Asp Asp Lys Gly
Ser Pro Gly Ser Gly Gly1 5 10 15Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly Glu Gly Gly Ser 20 25 30Gly Gly Glu Gly Gly Ser Gly Gly
Glu Gly Gly Ser Gly Gly Glu Gly 35 40 45Gly Ser His Thr Leu Glu Cys
Leu Gly Asn Ile Cys Trp Val Ile Asn 50 55 60Gln Gly Gly Glu Gly Gly
Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu65 70 75 80Gly Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly 85 90 95Gly Glu Gly
Gly Ser His Thr Leu Glu Cys Leu Gly Asn Ile Cys Trp 100 105 110Val
Ile Asn Gln Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser 115 120
125Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly
130 135 140Gly Ser Gly Gly Glu Gly Gly Ser His Thr Leu Glu Cys Leu
Gly Asn145 150 155 160Ile Cys Trp Val Ile Asn Gln Gly Gly Glu Gly
Gly Ser Gly Gly Glu 165 170 175Gly Gly Ser Gly Gly Glu Gly Gly Ser
Gly Gly Glu Gly Gly Ser Gly 180 185 190Gly Glu Gly Gly Ser Gly Gly
Glu Gly Gly Ser His Thr Leu Glu Cys 195 200 205Leu Gly Asn Ile Cys
Trp Val Ile Asn Gln Ser Ser Leu Glu Gly Thr 210 215 220His His His
His His His225 23030531PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 305Gly Gly Glu Ser Gly Gly
Glu Ser His Thr Leu Glu Cys Leu Gly Asn1 5 10 15Ile Cys Trp Val Ile
Asn Gln Ser Ser Gly Ser Gly Gly Ser Gly 20 25 3030648PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 306Ser
Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa Xaa Gly1 5 10
15Ser Gly Gly Glu Ser Gly Gly Glu Ser His Thr Leu Glu Cys Leu Gly
20 25 30Asn Ile Cys Trp Val Ile Asn Gln Ser Ser Gly Ser Gly Gly Ser
Gly 35 40 4530751PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 307Gly Gly Glu Ser Gly Gly Glu Ser His
Thr Leu Glu Cys Leu Gly Asn1 5 10 15Ile Cys Trp Val Ile Asn Gln Ser
Ser Gly Ser Gly Gly Ser Gly Gly 20 25 30Ser Xaa Xaa Xaa Cys Xaa Xaa
Xaa Xaa Xaa Xaa Cys Xaa Xaa Xaa Gly 35 40 45Ser Gly Ser
5030844PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 308Ser Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa
Cys Xaa Xaa Xaa Gly1 5 10 15Ser Gly Gly Glu Ser Gly Gly Glu Ser His
Thr Leu Glu Cys Leu Gly 20 25 30Asn Ile Cys Trp Val Ile Asn Gln Ser
Ser Gly Ser 35 4030924PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 309Gly Gly Ser Gly Gly Ser
Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa1 5 10 15Cys Xaa Xaa Xaa Gly
Ser Gly Ser 2031057PRTLaticauda semifasciata 310Cys Phe Asn His Gln
Ser Gln Pro Gln Thr Thr Lys Thr Cys Ser Pro1 5 10 15Gly Glu Ser Ser
Cys Tyr Asn Lys Gln Trp Ser Asp Phe Arg Gly Thr 20 25 30Ile Ile Glu
Arg Gly Cys Gly Cys Pro Thr Val Lys Pro Gly Ile Lys 35 40 45Leu Ser
Cys Cys Glu Ser Glu Val Cys 50 5531155PRTMicrurus nigrocinctus
311Cys His Asn Gln Gln Ser Gln Pro Pro Thr Ile Lys Thr Cys Ser Glu1
5 10 15Gly Gln Cys Tyr Lys Lys Thr Trp Arg Asp His Arg Gly Thr Ile
Ser 20 25 30Glu Arg Gly Cys Gly Cys Pro Thr Val Lys Pro Gly Ile His
Ile Ser 35 40
45Cys Cys Ala Ser Asp Lys Cys 50 5531256PRTNaja haje 312Cys Tyr Lys
Gln Arg Ser Gln Phe Pro Ile Thr Thr Val Cys Pro Gly1 5 10 15Glu Lys
Asn Cys Tyr Lys Lys Gln Trp Ser Gly His Arg Gly Thr Ile 20 25 30Ile
Glu Arg Gly Cys Gly Cys Pro Ser Val Lys Lys Gly Ile Glu Ile 35 40
45Asn Cys Cys Thr Thr Asp Lys Cys 50 5531356PRTHemachatus
haemachatus 313Cys His Asn Gln Gln Ser Gln Pro Pro Thr Thr Lys Ser
Cys Pro Gly1 5 10 15Asp Thr Asn Cys Tyr Asn Lys Arg Trp Arg Asp His
Arg Gly Thr Ile 20 25 30Ile Glu Arg Gly Cys Gly Cys Pro Thr Val Lys
Pro Gly Ile Asn Leu 35 40 45Lys Cys Cys Thr Thr Asp Arg Cys 50
5531456PRTBoulengerina annulata 314Cys Tyr Asn Gln Pro Ser Gln His
Pro Thr Thr Lys Ala Cys Pro Gly1 5 10 15Glu Lys Asn Cys Tyr Arg Lys
Gln Trp Ser Asp His Arg Gly Thr Ile 20 25 30Ile Glu Arg Gly Cys Gly
Cys Pro Thr Val Lys Pro Gly Val Lys Leu 35 40 45His Cys Cys Thr Thr
Glu Lys Cys 50 5531557PRTNaja atra 315Cys His Asn Gln Gln Ser Gln
Thr Pro Thr Thr Thr Gly Cys Ser Gly1 5 10 15Gly Glu Thr Asn Cys Tyr
Lys Lys Arg Trp Arg Asp His Arg Gly Tyr 20 25 30Arg Thr Glu Arg Gly
Cys Gly Cys Pro Ile Val Lys Asn Gly Ile Glu 35 40 45Ser Asn Cys Cys
Thr Thr Asp Arg Cys 50 5531657PRTNaja mossambica 316Cys His Asn Gln
Met Ser Gln Pro Pro Thr Thr Thr Arg Cys Ser Arg1 5 10 15Trp Glu Thr
Asn Cys Tyr Lys Lys Arg Trp Arg Asp His Arg Gly Tyr 20 25 30Lys Thr
Glu Arg Gly Cys Gly Cys Pro Thr Val Lys Lys Gly Ile Gln 35 40 45Leu
His Cys Cys Thr Ser Asp Asn Cys 50 5531757PRTLaticauda colubrina
317Cys Phe Asn Gln Gln Ser Gln Pro Lys Thr Thr Lys Ser Cys Pro Pro1
5 10 15Gly Glu Asn Ser Cys Tyr Asn Lys Gln Trp Arg Asp His Arg Gly
Ser 20 25 30Ile Thr Glu Arg Gly Cys Gly Cys Pro Lys Val Lys Pro Gly
Ile Lys 35 40 45Leu Arg Cys Cys Glu Ser Glu Asp Cys 50
5531855PRTDendroaspis polylepis 318Cys Tyr Asn His Gln Ser Thr Arg
Ala Thr Thr Lys Ser Cys Glu Glu1 5 10 15Asn Ser Cys Tyr Lys Lys Tyr
Trp Arg Asp His Arg Gly Thr Ile Ile 20 25 30Glu Arg Gly Cys Gly Cys
Pro Lys Val Lys Pro Gly Val Gly Ile His 35 40 45Cys Cys Gln Ser Asp
Lys Cys 50 5531953PRTDendroaspis jamesoni 319Cys Tyr Asn His Gln
Ser Thr Pro Ala Thr Thr Lys Ser Cys Val Glu1 5 10 15Asn Ser Cys Tyr
Lys Ser Ile Trp Ala Asp His Arg Gly Thr Ile Ile 20 25 30Lys Arg Gly
Cys Gly Cys Pro Arg Val Lys Ser Lys Ile Lys Cys Cys 35 40 45Lys Ser
Asp Asn Cys 5032057PRTOxyuranus scutellatus 320Cys Tyr Asn Gln Gln
Ser Glu Ala Lys Thr Thr Thr Thr Cys Ser Gly1 5 10 15Gly Val Ser Ser
Cys Tyr Lys Lys Thr Trp Ser Asp Gly Arg Gly Thr 20 25 30Ile Ile Glu
Arg Gly Cys Gly Cys Pro Ser Val Lys Lys Gly Ile Glu 35 40 45Arg Ile
Cys Cys Arg Thr Asp Lys Cys 50 5532157PRTOphiophagus hannah 321Cys
Leu Lys Gln Glu Pro Gln Pro Glu Thr Thr Thr Thr Cys Pro Glu1 5 10
15Gly Glu Asp Ala Cys Tyr Asn Leu Phe Trp Ser Asp His Ser Glu Ile
20 25 30Lys Ile Glu Met Gly Cys Gly Cys Pro Lys Thr Glu Pro Tyr Thr
Asn 35 40 45Leu Tyr Cys Cys Lys Ile Asp Ser Cys 50
5532255PRTDendroaspis angusticeps 322Cys Tyr Ser His Lys Leu Gln
Ala Lys Thr Thr Lys Thr Cys Glu Glu1 5 10 15Asn Ser Cys Tyr Lys Arg
Ser Leu Pro Lys Ile Pro Leu Ile Ile Ile 20 25 30Gly Arg Gly Cys Gly
Cys Pro Leu Thr Leu Pro Phe Leu Arg Ile Lys 35 40 45Cys Cys Thr Ser
Asp Lys Cys 50 5532355PRTDendroaspis angusticeps 323Cys Tyr Ser His
Lys Thr Gln Pro Ser Ala Thr Ile Thr Cys Glu Glu1 5 10 15Lys Thr Cys
Tyr Lys Lys Ser Val Arg Lys Leu Pro Ala Ile Val Ala 20 25 30Gly Arg
Gly Cys Gly Cys Pro Ser Lys Glu Met Leu Val Ala Ile His 35 40 45Cys
Cys Arg Ser Asp Lys Cys 50 5532455PRTDendroaspis polylepis 324Cys
Tyr Ile His Lys Ala Leu Pro Arg Ala Thr Lys Thr Cys Val Glu1 5 10
15Asn Thr Cys Tyr Lys Met Phe Ile Arg Thr Gln Arg Glu Tyr Ile Ser
20 25 30Glu Arg Gly Cys Gly Cys Pro Thr Ala Met Trp Pro Tyr Gln Thr
Glu 35 40 45Cys Cys Lys Gly Asp Arg Cys 50 5532555PRTDendroaspis
jamesoni 325Cys Tyr Thr His Lys Ser Gln Ala Lys Thr Thr Lys Ser Cys
Glu Gly1 5 10 15Asn Thr Cys Tyr Lys Met Phe Ile Arg Thr Ser Arg Glu
Tyr Ile Ser 20 25 30Glu Arg Gly Cys Gly Cys Pro Thr Ala Met Trp Pro
Tyr Gln Thr Glu 35 40 45Cys Cys Lys Gly Asp Arg Cys 50
5532662PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 326Ser Cys His Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Ala Val Thr Cys Pro1 5 10 15Pro Gly Glu Asn Leu Cys Tyr Arg Lys
Met Trp Xaa Xaa Xaa Xaa Xaa 20 25 30Xaa Xaa Xaa Xaa Xaa Xaa Gly Cys
Ala Ala Thr Cys Pro Ser Val Lys 35 40 45Pro Tyr Glu Glu Val Thr Cys
Cys Ser Thr Asp Lys Cys Gly 50 55 6032742PRTHomo sapiens 327Cys Arg
His Phe Gln Ser Cys Ser Gln Cys Leu Ser Ala Pro Pro Phe1 5 10 15Val
Gln Cys Gly Trp Cys His Asp Lys Cys Val Arg Ser Glu Glu Cys 20 25
30Leu Ser Gly Thr Trp Thr Gln Gln Ile Cys 35 4032842PRTRhinolophus
ferrumequinum 328Cys Glu His Phe Gln Ser Cys Ser Gln Cys Leu Ser
Ala Pro Pro Phe1 5 10 15Val Gln Cys Gly Trp Cys His Asn Lys Cys Val
Arg Ser Glu Glu Cys 20 25 30Pro Ser Gly Val Trp Thr Gln Asp Val Cys
35 4032942PRTCarollia perspicillata 329Cys Glu His Phe Gln Ser Cys
Ser Gln Cys Leu Ser Ala Pro Pro Phe1 5 10 15Val Gln Cys Gly Trp Cys
His Asp Lys Cys Val Arg Leu Glu Thr Cys 20 25 30Pro Ser Gly Ala Trp
Thr Gln Glu Ile Cys 35 4033042PRTOtolemur garnettii 330Cys Glu His
Phe Gln Ser Cys Ser Gln Cys Leu Ser Ala Pro Pro Phe1 5 10 15Val Gln
Cys Gly Trp Cys His Asp Lys Cys Val Arg Ser Glu Glu Cys 20 25 30Pro
Ser Gly Ser Trp Thr Gln Glu Thr Cys 35 4033142PRTSus scrofa 331Cys
Glu His Phe Gln Ser Cys Ser Gln Cys Leu Ser Ala Pro Pro Phe1 5 10
15Val Gln Cys Gly Trp Cys Gln Asp Lys Cys Val Gln Leu Glu Glu Cys
20 25 30Pro Ser Gly Thr Trp Thr Gln Glu Ile Cys 35 4033242PRTCanis
familiaris 332Cys Glu His Phe Gln Ser Cys Ser Gln Cys Leu Ser Ala
Pro Pro Phe1 5 10 15Val Gln Cys Gly Trp Cys His Asp Arg Cys Val His
Leu Glu Glu Cys 20 25 30Pro Thr Gly Ala Trp Thr Gln Glu Val Cys 35
4033342PRTRattus norvegicus 333Cys Gly His Phe Gln Ser Cys Ser Gln
Cys Leu Ser Pro Pro Tyr Phe1 5 10 15Ile Gln Cys Gly Trp Cys His Asn
Arg Cys Val His Ser Asn Glu Cys 20 25 30Pro Ser Gly Thr Trp Thr Gln
Glu Ile Cys 35 4033442PRTGallus gallus 334Cys His His Phe Gln Ser
Cys Ser Gln Cys Leu Leu Ala Pro Ala Phe1 5 10 15Met Arg Cys Gly Trp
Cys Gly Gln Gln Cys Leu Arg Ala Pro Glu Cys 20 25 30Asn Gly Gly Thr
Trp Thr Gln Glu Thr Cys 35 4033542PRTTakifugu rubripes 335Cys Asp
His Leu Thr Thr Cys Thr Ser Cys Leu Val Ser Ser Arg Val1 5 10 15Thr
Glu Cys Gly Trp Cys Glu Gly Arg Cys Thr Arg Ala Asn Gln Cys 20 25
30Pro Pro Ser Val Trp Thr Gln Glu Tyr Cys 35 4033641PRTTakifugu
rubripes 336Cys Gln His Phe Leu Thr Cys Ala Val Cys Leu Thr Ala Pro
Lys Phe1 5 10 15Val Gly Cys Gly Trp Cys Ser Gly Val Cys Ser Trp Glu
Ser Asp Cys 20 25 30Asp His His Trp Arg Asn Asp Ser Cys 35
4033741PRTTetraodon nigroviridis 337Cys Gln His Phe Leu Thr Cys Ala
Met Cys Leu Met Ala Pro Gln Phe1 5 10 15Met Gly Cys Gly Trp Cys Ser
Gly Val Cys Ser Trp Glu Asn Gln Cys 20 25 30Asp Asp Arg Trp Arg Asn
Glu Ser Cys 35 4033841PRTTetraodon nigroviridis 338Cys Ala His Phe
Arg Thr Cys Ser Met Cys Leu Met Ala Pro Arg Phe1 5 10 15Met Asn Cys
Gly Trp Cys Ser Gly Val Cys Ser Arg Gln His Glu Cys 20 25 30Thr Ser
Trp Gln Thr Ser Ala Ser Cys 35 4033941PRTTakifugu rubripes 339Cys
Ala His Phe Arg Thr Cys Ser Met Cys Leu Met Ala Pro Arg Phe1 5 10
15Met Asn Cys Gly Trp Cys Ser Gly Val Cys Ser Arg Gln His Gln Cys
20 25 30Asp Met Gln Trp Glu Lys Asp Ser Cys 35 4034041PRTHomo
sapiens 340Cys Arg His Phe Leu Thr Cys Gly Arg Cys Leu Arg Ala Trp
His Phe1 5 10 15Met Gly Cys Gly Trp Cys Gly Asn Met Cys Gly Gln Gln
Lys Glu Cys 20 25 30Pro Gly Ser Trp Gln Gln Asp His Cys 35
4034141PRTCanis familiaris 341Cys His His Phe Leu Thr Cys Gly Ser
Cys Leu Arg Ala Gln Arg Phe1 5 10 15Met Gly Cys Gly Trp Cys Gly Gly
Met Cys Gly Arg Gln Lys Glu Cys 20 25 30Pro Gly Ser Trp Gln Gln Asp
His Cys 35 4034241PRTMus musculus 342Cys Arg His Phe Leu Thr Cys
Trp Arg Cys Leu Arg Ala Gln Arg Phe1 5 10 15Met Gly Cys Gly Trp Cys
Gly Asp Arg Cys Asp Arg Gln Lys Glu Cys 20 25 30Pro Gly Ser Trp Gln
Gln Asp His Cys 35 4034341PRTGallus gallus 343Cys Arg His Phe Ser
Thr Cys Asp Arg Cys Leu Arg Ala Glu Arg Phe1 5 10 15Met Gly Cys Gly
Trp Cys Gly Asn Gly Cys Thr Arg His His Glu Cys 20 25 30Ala Gly Pro
Trp Val Gln Asp Ser Cys 35 4034444PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 344Ser Cys Xaa His Xaa Xaa
Xaa Cys Xaa Xaa Cys Leu Xaa Xaa Xaa Xaa1 5 10 15Xaa Xaa Xaa Cys Gly
Trp Cys His Asp Lys Cys Val Arg Ser Glu Glu 20 25 30Cys Leu Ser Gly
Thr Trp Thr Gln Gln Ile Cys Gly 35 4034544PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 345Ser
Cys Arg His Phe Gln Ser Cys Ser Gln Cys Leu Ser Ala Pro Pro1 5 10
15Phe Val Gln Cys Gly Trp Cys Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa
20 25 30Cys Xaa Xaa Xaa Xaa Trp Xaa Xaa Xaa Xaa Cys Gly 35
4034644PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 346Ser Cys Xaa His Xaa Xaa Xaa Cys Xaa Xaa Cys
Leu Xaa Xaa Xaa Xaa1 5 10 15Xaa Xaa Xaa Cys Gly Trp Cys His Asp Lys
Cys Val Arg Ser Glu Glu 20 25 30Cys Leu Ser Gly Thr Trp Thr Gln Gln
Ile Cys Gly 35 4034744PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 347Ser Cys Arg His Phe Gln
Ser Cys Ser Gln Cys Leu Ser Ala Pro Pro1 5 10 15Phe Val Gln Cys Gly
Trp Cys Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa 20 25 30Cys Xaa Xaa Xaa
Xaa Trp Xaa Xaa Xaa Xaa Cys Gly 35 4034844PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 348Ser
Cys His His Phe Ile Ser Cys Gly Arg Cys Leu Arg Ser Trp His1 5 10
15Val Val Asp Cys Gly Trp Cys His Asp Lys Cys Val Arg Ser Glu Glu
20 25 30Cys Leu Ser Gly Thr Trp Thr Gln Gln Ile Cys Gly 35
4034943PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 349Ser Cys Arg His Phe Gln Ser Cys Ser Gln Cys
Leu Ser Ala Pro Pro1 5 10 15Phe Val Gln Cys Gly Trp Cys Gly Asp Met
Cys Ala Arg Val Gln Gln 20 25 30Cys His Asp Arg Trp Thr His His Ala
Cys Gly 35 4035043PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 350Ser Cys Arg His Phe Gln Ser Cys Ser
Gln Cys Leu Ser Ala Pro Pro1 5 10 15Phe Val Gln Cys Gly Trp Cys His
Asp Lys Cys Gly His Gln Asp Glu 20 25 30Cys Thr Ala Ser Trp Arg Lys
Glu Ala Cys Gly 35 4035144PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 351Ser Cys Arg His Phe Gln
Ser Cys Ser Gln Cys Leu Ser Ala Pro Pro1 5 10 15Phe Val Gln Cys Gly
Trp Cys Arg Asn Met Cys Val Gln Glu Lys Gln 20 25 30Cys Asp Asp Ser
Ile Trp Lys Asn Gln His Cys Gly 35 4035244PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 352Ser
Cys Arg His Phe Gln Ser Cys Ser Gln Cys Leu Ser Ala Pro Pro1 5 10
15Phe Val Gln Cys Gly Trp Cys Arg Asp Arg Cys Ser Arg Glu Asp His
20 25 30Cys Pro Thr Lys Thr Trp Arg Asn His Pro Cys Gly 35
4035343PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 353Ser Cys Arg His Phe Gln Ser Cys Ser Gln Cys
Leu Ser Ala Pro Pro1 5 10 15Phe Val Gln Cys Gly Trp Cys Asn Asn Val
Cys Ser Arg His Asn Asp 20 25 30Cys Asp Asn Asn Trp Gln His Gln Asn
Cys Gly 35 4035443PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 354Ser Cys Arg His Phe Gln Ser Cys Ser
Gln Cys Leu Ser Ala Pro Pro1 5 10 15Phe Val Gln Cys Gly Trp Cys Asn
Ser Met Cys Gly Arg Ala His Asp 20 25 30Cys Thr Asp His Trp Gln Lys
Gln His Cys Gly 35 4035543PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 355Ser Cys Arg His Phe Gln
Ser Cys Ser Gln Cys Leu Ser Ala Pro Pro1 5 10 15Phe Val Gln Cys Gly
Trp Cys Gly Asn Met Cys Val Arg Ser Glu Glu 20 25 30Cys His Thr Asp
Trp Arg His Asp Thr Cys Gly 35 4035644PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 356Ser
Cys Arg His Phe Gln Ser Cys Ser Gln Cys Leu Ser Ala Pro Pro1 5 10
15Phe Val Gln Cys Gly Trp Cys Asn Ser Met Cys Gly Arg Ala Gln Asp
20 25 30Cys Asn Asp Arg Thr Trp Lys Gln His Thr Cys Gly 35
4035751PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 357Gln Ala Ala Gly Pro Ser Gly Pro Cys Ser Tyr
Tyr Ala Tyr Phe Thr1 5 10 15Cys Thr Asn His Trp Cys Pro Ser Pro Pro
Phe Ala Phe Thr Cys Thr 20 25 30Asn His Trp Cys Pro Ser Tyr Tyr Asp
Ser Ala Tyr Cys Gly Gln Ser 35 40 45Gly Gly Ser
5035837PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 358Gln Ala Ala Gly Pro Ser Gly Pro Cys
Ala Ala Tyr Ala Tyr Phe Thr1 5 10 15Cys Thr Asn His Trp Cys Pro Ser
Tyr Tyr Ser Ala Ala Cys Gly Gln 20 25 30Ser Gly Gly Ser Gly
3535937PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 359Gln Ala Ala Gly Pro Ser Gly Pro Cys Ala Tyr
Ala Tyr Tyr Phe Thr1 5 10 15Cys Thr Asn His Trp Cys Pro Ser Tyr Tyr
Ala Tyr Tyr Cys Gly Gln 20 25 30Ser Gly Gly Ser Gly
3536037PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 360Gln Ala Ala Gly Pro Ser Gly Pro Cys Ala Tyr
Tyr Ser Tyr Phe Thr1 5 10 15Cys Thr Asn His Trp Cys Pro Ser Tyr Tyr
Ser Ser Tyr Cys Gly Gln 20 25 30Ser Gly Gly Ser Gly
35361126DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 361atg gat tat aaa gac gat gac gat aaa ggg
tct cca ggt tagtaaccta 49Met Asp Tyr Lys Asp Asp Asp Asp Lys Gly
Ser Pro Gly1 5 10ggtgatag gga ggt tcg tct tca ctc gag ggt acc cat
cac cat cac cat 99 Gly Gly Ser Ser Ser Leu Glu Gly Thr His His His
His His 15 20 25cac gag ctc gta ccg gta gaa aaa atg 126His Glu Leu
Val Pro Val Glu Lys Met 30 3536213PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 362Met Asp Tyr Lys Asp Asp
Asp Asp Lys Gly Ser Pro Gly1 5 1036323PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 363Gly
Gly Ser Ser Ser Leu Glu Gly Thr His His His His His His Glu1 5 10
15Leu Val Pro Val Glu Lys Met 20364463PRTArtificial
SequenceDescription of Artificial Sequence Synthetic construct
364Met Gly His His His His His His Gly Gly Ser Gly Gly Glu Gly Gly1
5 10 15Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Glu 20 25 30Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly 35 40 45Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Glu Gly Gly 50 55 60Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly Glu65 70 75 80Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly
Gly Glu Gly Gly Ser Gly 85 90 95Gly Glu Gly Gly Ser Gly Gly Glu Gly
Gly Ser Gly Gly Glu Gly Gly 100 105 110Ser Gly Gly Glu Gly Gly Ser
Gly Gly Glu Gly Gly Ser Gly Gly Glu 115 120 125Gly Gly Ser Gly Gly
Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly 130 135 140Gly Glu Gly
Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly145 150 155
160Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu
165 170 175Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly 180 185 190Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly
Gly Glu Gly Gly 195 200 205Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu
Gly Gly Ser Gly Gly Glu 210 215 220Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly Glu Gly Gly Ser Gly225 230 235 240Gly Glu Gly Gly Ser
Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly 245 250 255Ser Gly Gly
Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu 260 265 270Gly
Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly 275 280
285Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Cys Asp Leu Pro Gln Thr
290 295 300His Ser Leu Gly Ser Arg Arg Thr Leu Met Leu Leu Ala Gln
Met Arg305 310 315 320Lys Ile Ser Leu Phe Ser Cys Leu Lys Asp Arg
His Asp Phe Gly Phe 325 330 335Pro Gln Glu Glu Phe Gly Asn Gln Phe
Gln Lys Ala Glu Thr Ile Pro 340 345 350Val Leu His Glu Met Ile Gln
Gln Ile Phe Asn Leu Phe Ser Thr Lys 355 360 365Asp Ser Ser Ala Ala
Trp Asp Glu Thr Leu Leu Asp Lys Phe Tyr Thr 370 375 380Glu Leu Tyr
Gln Gln Leu Asn Asp Leu Glu Ala Cys Val Ile Gln Gly385 390 395
400Val Gly Val Thr Glu Thr Pro Leu Met Lys Glu Asp Ser Ile Leu Ala
405 410 415Val Arg Lys Tyr Phe Gln Arg Ile Thr Leu Tyr Leu Lys Glu
Lys Lys 420 425 430Tyr Ser Pro Cys Ala Trp Glu Val Val Arg Ala Glu
Ile Met Arg Ser 435 440 445Phe Ser Leu Ser Thr Asn Leu Gln Glu Ser
Leu Arg Ser Lys Glu 450 455 460365472PRTArtificial
SequenceDescription of Artificial Sequence Synthetic construct
365Met Gly His His His His His His Gly Gly Ser Gly Gly Glu Gly Gly1
5 10 15Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Glu 20 25 30Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly 35 40 45Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Glu Gly Gly 50 55 60Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly Glu65 70 75 80Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly
Gly Glu Gly Gly Ser Gly 85 90 95Gly Glu Gly Gly Ser Gly Gly Glu Gly
Gly Ser Gly Gly Glu Gly Gly 100 105 110Ser Gly Gly Glu Gly Gly Ser
Gly Gly Glu Gly Gly Ser Gly Gly Glu 115 120 125Gly Gly Ser Gly Gly
Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly 130 135 140Gly Glu Gly
Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly145 150 155
160Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu
165 170 175Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly 180 185 190Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly
Gly Glu Gly Gly 195 200 205Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu
Gly Gly Ser Gly Gly Glu 210 215 220Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly Gly Glu Gly Gly Ser Gly225 230 235 240Gly Glu Gly Gly Ser
Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly 245 250 255Ser Gly Gly
Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu 260 265 270Gly
Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly 275 280
285Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Thr Pro Leu Gly Pro Ala
290 295 300Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Glu Gln
Val Arg305 310 315 320Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu
Lys Leu Cys Ala Thr 325 330 335Tyr Lys Leu Cys His Pro Glu Glu Leu
Val Leu Leu Gly His Ser Leu 340 345 350Gly Ile Pro Trp Ala Pro Leu
Ser Ser Cys Pro Ser Gln Ala Leu Gln 355 360 365Leu Ala Gly Cys Leu
Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln 370 375 380Gly Leu Leu
Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr385 390 395
400Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp
405 410 415Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro
Thr Gln 420 425 430Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg
Arg Ala Gly Gly 435 440 445Val Leu Val Ala Ser His Leu Gln Ser Phe
Leu Glu Val Ser Tyr Arg 450 455 460Val Leu Arg His Leu Ala Gln
Pro465 470366489PRTArtificial SequenceDescription of Artificial
Sequence Synthetic construct 366Met Gly His His His His His His Gly
Gly Ser Gly Gly Glu Gly Gly1 5 10 15Ser Gly Gly Glu Gly Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly Glu 20 25 30Gly Gly Ser Gly Gly Glu Gly
Gly Ser Gly Gly Glu Gly Gly Ser Gly 35 40 45Gly Glu Gly Gly Ser Gly
Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly 50 55 60Ser Gly Gly Glu Gly
Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu65 70 75 80Gly Gly Ser
Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly 85 90 95Gly Glu
Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly 100 105
110Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu
115 120 125Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly
Ser Gly 130 135 140Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly
Gly Glu Gly Gly145 150 155 160Ser Gly Gly Glu Gly Gly Ser Gly Gly
Glu Gly Gly Ser Gly Gly Glu 165 170 175Gly Gly Ser Gly Gly Glu Gly
Gly Ser Gly Gly Glu Gly Gly Ser Gly 180 185 190Gly Glu Gly Gly Ser
Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly 195 200 205Ser Gly Gly
Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu 210 215 220Gly
Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly225 230
235 240Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly
Gly 245 250 255Ser Gly Gly Glu Gly Gly Ser Gly Gly Glu Gly Gly Ser
Gly Gly Glu 260 265 270Gly Gly Ser Gly Gly Glu Gly Gly Ser Gly Gly
Glu Gly Gly Ser Gly 275 280 285Gly Glu Gly Gly Ser Gly Gly Glu Gly
Gly Phe Pro Thr Ile Pro Leu 290 295 300Ser Arg Leu Phe Asp Asn Ala
Met Leu Arg Ala His Arg Leu His Gln305 310 315 320Leu Ala Phe Asp
Thr Tyr Gln Glu Phe Glu Glu Ala Tyr Ile Pro Lys 325 330 335Glu Gln
Lys Tyr Ser Phe Leu Gln Asn Pro Gln Thr Ser Leu Cys Phe 340 345
350Ser Glu Ser Ile Pro Thr Pro Ser Asn Arg Glu Glu Thr Gln Gln Lys
355 360 365Ser Asn Leu Glu Leu Leu Arg Ile Ser Leu Leu Leu Ile Gln
Ser Trp 370 375 380Leu Glu Pro Val Gln Phe Leu Arg Ser Val Phe Ala
Asn Ser Leu Val385 390 395 400Tyr Gly Ala Ser Asp Ser Asn Val Tyr
Asp Leu Leu Lys Asp Leu Glu 405 410 415Glu Gly Ile Gln Thr Leu Met
Gly Arg Leu Glu Asp Gly Ser Pro Arg 420 425 430Thr Gly Gln Ile Phe
Lys Gln Thr Tyr Ser Lys Phe Asp Thr Asn Ser 435 440 445His Asn Asp
Asp Ala Leu Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe 450 455 460Arg
Lys Asp Met Asp Lys Val Glu Thr Phe Leu Arg Ile Val Gln Cys465 470
475 480Arg Ser Val Glu Gly Ser Cys Gly Phe 485
* * * * *
References