U.S. patent application number 12/377160 was filed with the patent office on 2010-07-22 for methods and means for treating dna repeat instability associated genetic disorders.
This patent application is currently assigned to PROSENTA TECHNOLOGIES B.V.. Invention is credited to Josephus Johannes De Kimpe, Gerard Johannes Platenburg, Derick Gert Wansink.
Application Number | 20100184833 12/377160 |
Document ID | / |
Family ID | 38668759 |
Filed Date | 2010-07-22 |
United States Patent
Application |
20100184833 |
Kind Code |
A1 |
De Kimpe; Josephus Johannes ;
et al. |
July 22, 2010 |
METHODS AND MEANS FOR TREATING DNA REPEAT INSTABILITY ASSOCIATED
GENETIC DISORDERS
Abstract
The current invention provides for methods and medicaments that
apply oligonucleotide molecules complementary only to a repetitive
sequence in a human gene transcript, for the manufacture of a
medicament for the diagnosis, treatment or prevention of a
cis-element repeat instability associated genetic disorders in
humans. The invention hence provides a method of treatment for
cis-element repeat instability associated genetic disorders. The
invention also pertains to modified oligonucleotides which can be
applied in method of the invention to prevent the accumulation
and/or translation of repeat expanded transcripts in cells.
Inventors: |
De Kimpe; Josephus Johannes;
(Utrecht, NL) ; Platenburg; Gerard Johannes;
(Voorschoten, NL) ; Wansink; Derick Gert; (Arnhem,
NL) |
Correspondence
Address: |
BROWDY AND NEIMARK, P.L.L.C.;624 NINTH STREET, NW
SUITE 300
WASHINGTON
DC
20001-5303
US
|
Assignee: |
PROSENTA TECHNOLOGIES B.V.
Leiden
NL
|
Family ID: |
38668759 |
Appl. No.: |
12/377160 |
Filed: |
August 10, 2007 |
PCT Filed: |
August 10, 2007 |
PCT NO: |
PCT/NL07/50399 |
371 Date: |
February 24, 2010 |
Current U.S.
Class: |
514/44R ;
435/320.1; 435/440; 435/6.16; 536/23.1 |
Current CPC
Class: |
C12N 15/11 20130101;
A61P 21/00 20180101; C12N 2310/11 20130101; C12N 2310/346 20130101;
C12Q 2600/156 20130101; C12N 15/113 20130101; A61K 48/00 20130101;
C12Q 1/6883 20130101; A61P 25/00 20180101; A61P 43/00 20180101;
C12N 2310/321 20130101; A61P 25/14 20180101; C12N 2310/315
20130101; C12N 2310/321 20130101; C12N 2310/3521 20130101 |
Class at
Publication: |
514/44.R ;
536/23.1; 435/320.1; 435/440; 435/6 |
International
Class: |
A61K 31/7052 20060101
A61K031/7052; A61K 48/00 20060101 A61K048/00; C07H 21/00 20060101
C07H021/00; C12N 15/63 20060101 C12N015/63; C12N 15/00 20060101
C12N015/00; C12Q 1/68 20060101 C12Q001/68; A61P 43/00 20060101
A61P043/00 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 11, 2006 |
EP |
06118809.0 |
Aug 21, 2006 |
EP |
06119247.2 |
Claims
1. A method for preventing or treating a genetic disorder in a
subject, comprising administering to a subject with a genetic
disorder that is associated with human cis-element repeat
instability a single stranded oligonucleotide comprising or
consisting of a sequence that is complementary only to a repetitive
element sequence in a gene transcript of a gene with said repeat
instability.
2. The method according to claim 1 wherein the repetitive element
is present in a coding sequence of the gene transcript.
3. The method according to claim 1 wherein the repetitive element
is present in a non-coding sequence of the gene transcript.
4. The method according to claim 1 wherein the sequence of the
repetitive element is selected from the group consisting of CAG;
GCG; CUG; CGG; CCG; GAA; GCC; and CCUG.
5. The method according to claim 2, wherein the oligonucleotide
comprises or consists of a sequence that is complementary to a CAG
repeat and wherein the disorder is Huntington's disease,
spino-cerebellar ataxias, Haw River syndrome, X-linked spinal and
bulbar muscular atrophy or dentatorubral-pallidoluysian
atrophy.
6. The method according to claim 2, wherein the oligonucleotide
comprises or consists of a sequence that is complementary to a GCG
repeat and wherein the disorder is infantile spasm syndrome,
deidocranial dysplasia, blepharophimosis, hand-foot-genital
disease, synpolydactyl, oculopharyngeal muscular dystrophy or
holoprosencephaly.
7. The method according to claim 3, wherein the oligonucleotide
comprises or consists of a sequence that is complementary to a CUG
repeat and wherein the disorder is myotonic dystrophy type 1,
spino-cerebellar ataxia 8 or Huntington's disease-like 2.
8. The method according to claim 3 wherein the oligonucleotide
comprises or consists of a sequence that is complementary to a CCUG
repeat and wherein the disorder is myotonic dystrophy type 2.
9. The method according to claim 3, wherein the oligonucleotide
comprises or consists of a sequence that is complementary to a CGG
repeat and wherein the disorder is fragile X syndrome.
10. The method according to claim 3, wherein the oligonucleotide
comprises or consists of a sequence that is complementary to a GAA
repeat and wherein the disorder is Friedreich's ataxia.
11. The method according to claim 1 wherein the oligonucleotide has
a length of about 10 to about 50 nucleotides.
12. The method according to claim 1 wherein the single stranded
oligonucleotide comprises ribonucleotides, deoxyribonucleotides,
nucleotides of a locked nucleic acid (LNA), nucleotides of a
peptide nucleic acid (PNA), morpholino phosphorodiamidates,
nucleotides of an ethylene-bridged nucleic acid or a mixture
thereof.
13. The method according to claim 12, wherein the oligonucleotide
comprises 2'-O-substituted RNA phosphorothioate nucleotides.
14. The method according to claim 1 wherein the administered
oligonucleotide is in the form of an expressible nucleic acid
vector.
15. The method according to claim 1, wherein the oligonucleotide is
in a pharmaceutical composition which further comprises an
excipient and/or targeting ligand that delivers the oligonucleotide
to cells and/or enhances intracellular delivery of the
oligonucleotide.
16. A single stranded oligonucleotide comprising or consisting of a
sequence of about 10 to about 50 nucleotides that is complementary
to a repetitive sequence of a tri- or tetranucleotide selected from
the group consisting of (a) CAG; (b) GCG; (c) CUG; (c) CGG; (d)
GAA; (e) GCC; (f) CCUG.
17. The oligonucleotide according to claim 16, comprising
2'-O-substituted phosphorothioate ribonucleotides, phosphorothioate
deoxyribonucleotides, LNA nucleotides, morpholino nucleotides,
and/or combinations thereof.
18. The oligonucleotide according to claim 26 wherein the label is
a radioactive label or a fluorescent label.
19. A pharmaceutical composition comprising an oligonucleotide
according to claim 16, and a pharmaceutically acceptable
excipient.
20. The pharmaceutical composition of claim 19, further comprising
a targeting ligand that delivers the oligonucleotide to a cell
and/or enhances intracellular delivery of the oligonucleotide.
21. A nucleic acid vector, that expresses the oligonucleotide
according to claim 16 in human cells.
22. A method for reducing the number of repeat-containing gene
transcripts in a cell comprising providing to said cell the
oligonucleotide according to claim 16.
23. (canceled)
24. The method according to claim 11 wherein the oligonucleotide
has a length of about 12 to about 30 nucleotides.
25. The method of claim 12 wherein the single stranded
oligonucleotide has a phosphorothioate-containing backbone.
26. The oligonucleotide of claim 16 that further comprises a
detectable label.
27. A method for detecting the presence of nucleic acid repetitive
elements in cells, comprising: (a) contacting the cells or a lysate
or extract thereof with the oligonucleotide according to claim 18,
under conditions wherein said oligonucleotide hybridizes with
cellular DNA and/or RNA; (b) detecting hybridization of said
oligonucleotide, wherein the hybridization of said oligonucleotide
is indicative of the presence of said repeat elements in said
cells.
28. A method for diagnosing a genetic disorder associated with
human cis-element repeat instability in a subject, comprising
performing the method of claim 27 on cells, or obtained from a
subject with, suspected of having, or at risk for said disorder, or
on a lysate or extract of said cells, wherein detection of the
presence of said repeat elements in said cells, lysate or extract
is diagnostic of said genetic disorder.
Description
FIELD OF THE INVENTION
[0001] The current invention relates to the field of medicine, in
particular to the treatment of genetic disorders associated with
genes that have unstable repeats in their coding or non-coding
sequences, most in particular unstable repeats in the human
Huntington disease causing HD gene or the myotonic dystrophy type 1
causing DMPK gene.
BACKGROUND OF THE INVENTION
[0002] Instability of gene-specific microsatellite and
minisatellite repetitive sequences, leading to increase in length
of the repetitive sequences in the satellite, is associated with
about 35 human genetic disorders. Instability of trinucleotide
repeats is for instance found in genes causing X-linked spinal and
bulbar muscular atrophy (SBMA), myotonic dystrophy type 1 (DM1),
fragile X syndrome (FRAX genes A, E, F), Huntington's disease (HD)
and several spinocerebellar ataxias (SCA gene family). Unstable
repeats are found in coding regions of genes, such as the
Huntington's disease gene, whereby the phenotype of the disorder is
brought about by alteration of protein function and/or protein
folding. Unstable repeat units are also found in untranslated
regions, such as in myotonic dystrophy type 1 (DM1) in the 3' UTR
or in intronic sequences such as in myotonic dystrophy type 2
(DM2). The normal number of repeats is around 5 to 37 for DMPK, but
increases to premutation and full disease state two to ten fold or
more, to 50, 100 and sometimes 1000 or more repeat units. For
DM2/ZNF9 increases to 10,000 or more repeats have been reported.
(Cleary and Pearson, Cytogenet. Genome Res. 100: 25-55, 2003).
[0003] The causative gene for Huntington's disease, HD, is located
on chromosome 4. Huntington's disease is inherited in an autosomal
dominant fashion. When the gene has more than 35 CAG trinucleotide
repeats coding for a polyglutamine stretch, the number of repeats
can expand in successive generations. Because of the progressive
increase in length of the repeats, the disease tends to increase in
severity and presents at an earlier age in successive generations,
a process called anticipation. The product of the, HD gene is the
348 kDa cytoplasmic protein huntingtin. Huntingtin has a
characteristic sequence of fewer than 40 glutamine amino acid
residues in the normal form; the mutated huntingtin causing the
disease has more than 40 residues. The continuous expression of
mutant huntingtin molecules in neuronal cells results in the
formation of large protein deposits which eventually give rise to
cell death, especially in the frontal lobes and the basal ganglia
(mainly in the caudate nucleus). The severity of the disease is
generally proportional to the number of extra residues.
[0004] DM1 is the most common muscular dystrophy in adults and is
an inherited, progressive, degenerative, multisystemic disorder of
predominantly skeletal muscle, heart and brain. DM1 is caused by
expansion of an unstable trinucleotide (CTG)n repeat in the 3'
untranslated region of the DMPK gene (myotonic dystrophy protein
kinase) on human chromosome 19q (Brook et al, Cell, 1992). Type 2
myotonic dystrophy (DM2) is caused by a CCTG expansion in intron 1
of the ZNF9 gene, (Liguori et al, Science 2001). In the case of
myotonic dystrophy type 1, the nuclear-cytoplasmic export of DMPK
transcripts is blocked by the increased length of the repeats,
which form hairpin-like secondary structures that accumulate in
nuclear foci. DMPK transcripts bearing a long (CUG)n tract can form
hairpin-like structures that bind proteins of the muscleblind
family and subsequently aggregate in ribonuclear foci in the
nucleus. These nuclear inclusions are thought to sequester
muscleblind proteins, and potentially other factors, which then
become limiting to the cell. In DM2, accumulation of ZNF9 RNA
carrying the (CCUG)n expanded repeat form similar foci. Since
muscleblind proteins are splicing factors, their depletion results
in a dramatic rearrangement in splicing of other transcripts.
Transcripts of many genes consequently become aberrantly spliced,
for instance by inclusion of fetal exons, or exclusion of exons,
resulting in non-functional proteins and impaired cell
function.
[0005] The observations and new insights above have led to the
understanding that unstable repeat diseases, such as myotonic
dystrophy type 1, Huntington's disease and others can be treated by
removing, either fully or at least in part, the aberrant transcript
that causes the disease. For DM1, the aberrant transcript that
accumulates in the nucleus could be down regulated or fully
removed. Even relatively small reductions of the aberrant
transcript could release substantial and possibly sufficient
amounts of sequestered cellular factors and thereby help to restore
normal RNA processing and cellular metabolism for DM (Kanadia et
al., PNAS 2006). In the case of HD, a reduction in the accumulation
of huntingtin protein deposits in the cells of an HD patient can
ameliorate the symptoms of the disease.
[0006] A few attempts have been made to design methods of treatment
and medicaments for unstable repeat disease myotonic dystrophy type
1 using antisense nucleic acids, RNA interference or ribozymes. (i)
Langlois et al. (Molecular Therapy, Vol. 7 No. 5, 2003) designed a
ribozyme capable of cleaving DMPK mRNA. The hammerhead ribozyme is
provided with a stretch RNA complementary to the 3' UTR of DMPK
just before the CUG repeat. In vivo, vector transcribed ribozyme
was capable of cleaving and diminishing in transfected cells both
the expanded CUG repeat containing mRNA as well as the normal mRNA
species with 63 and 50% respectively. Hence, also the normal
transcript is gravely affected by this approach and the affected
mRNA species with expanded repeats are not specifically
targeted.
[0007] (ii) Another approach was taken by Langlois et al., (Journal
Biological Chemistry, vol 280, no. 17, 2005) using RNA
interference. A lentivirus-delivered short-hairpin RNA (shRNA) was
introduced in DM1 myoblasts and demonstrated to down regulate
nuclear retained mutant DMPK mRNAs. Four shRNA molecules were
tested, two were complementary against coding regions of DMPK, one
against a unique sequence in the 3' UTR and one negative control
with an irrelevant sequence. The first two shRNAs were capable of
down regulating the mutant DMPK transcript with the amplified
repeat to about 50%, but even more effective in down regulating the
cytoplasmic wildtype transcript to about 30% or less. Equivalent
synthetic siRNA delivered by cationic lipids was ineffective. The
shRNA directed at the 3' UTR sequence proved to be ineffective for
both transcripts. Hence, also this approach is not targeted
selectively to the expanded repeat mRNA species.
[0008] (iii) A third approach by Furling et al. (Gene Therapy, Vol.
10, p 795-802, 2003) used a recombinant retrovirus expressing a
149-bp long antisense RNA to inhibit DMPK mRNA levels in human DM1
myoblasts. A retrovirus was designed to provide DM1 cells with the
149 by long antisense RNA complementary to a 39 bp-long (CUG)13
repeat and a 110 by region following the repeat to increase
specificity. This method yielded a decrease in mutated (repeat
expanded) DMPK transcript of 80%, compared to a 50% reduction in
the wild type DMPK transcript and restoration of differentiation
and functional characteristics in infected DM1 myoblasts. Hence,
also this approach is not targeted selectively to the expanded
repeat mRNA species, it depends on a very long antisense RNA and
can only be used in combination with recombinant viral delivery
techniques.
DETAILED DESCRIPTION OF THE INVENTION
[0009] The methods and techniques described above provide nucleid
acid based methods that cause non-selective breakdown of both the
affected repeat expanded allele and unaffected (normal) allele for
genetic diseases that are associated with repeat instability and/or
expansion. Moreover, the art employs sequences specific for the
gene associated with the disease and does not provide a method that
is applicable to several genetic disorders associated with repeat
expansion. Finally, the art only teaches methods that involve use
of recombinant DNA vector delivery systems, which need to be
adapted for each oligonucleotide and target cell and which still
need to be further optimised.
[0010] The current invention provides a solution for these problems
by using a short single stranded nucleic acid molecule that
comprises or consists of a sequence, which is complementary to the
expanded repeat region only, i.e. it does not rely on hybridisation
to unique sequences in exons or introns of the repeat containing
gene. Furthermore, it is not essential that the employed nucleic
acid (oligonucleotide) reduces transcripts by the RNAse H mediated
breakdown mechanism.
[0011] Without wishing to be bound by theory, the current invention
may cause a decrease in transcript levels by alterations in
posttranscriptional processing and/or splicing of the premature
RNA. A decrease in transcript levels via alternative splicing
and/or postranscriptional processing is thought to result in
transcripts lacking the overly expanded or instable (tri)nucleotide
repeat, but still possessing functional activities. The reduction
of aberrant transcripts by altered RNA processing and/or splicing
may prevent accumulation and/or translation of aberrant, repeat
expanded transcripts in cells.
[0012] Without wishing to be bound by theory the method of the
current invention is also thought to provide specificity for the
affected transcript with the expanded repeat because the kinetics
for hybridisation to the expanded repeat are more favourable. The
likelihood that a repeat specific complementary nucleic acid
oligonucleotide molecule will hybridise to a complementary stretch
in an RNA or DNA molecule increases with the size of the repetitive
stretch. RNA molecules and in particular RNA molecules comprising
repetitive sequences are normally internally paired, forming a
secondary structure comprising open loops and closed hairpin parts.
Only the open parts are relatively accessible for complementary
nucleic acids. The short repeat stretches of a wild type transcript
not associated with disease is often only 5 to about 20-40 repeats
and due to the secondary structure relatively inaccessible for base
pairing with a complementary nucleic acid. In contrast, the repeat
units of the expanded repeat and disease associated allele is
normally at least 2 fold expanded but usually even more, 3, 5, 10
fold, up to 100 or even more than 1000 fold expansion for some
unstable repeat disorders. This expansion increases the likelihood
that part of the repeat is, at least temporarily, in an open loop
structure and thereby more accessible to base pairing with a
complementary nucleic acid molecule, relative to the wild type
allele. So despite the fact that the oligonucleotide is
complementary to a repeat sequence present in both wildtype and
repeat-expanded transcripts and could theoretically hybridise to
both transcripts, the current invention teaches that
oligonucleotides complementary to the repetitive tracts preferably
hybridise to the disease-associated or disease-causing transcripts
and leave the function of normal transcripts relatively unaffected.
This selectivity is beneficial for treating diseases associated
with repeat instability irrespective of the mechanism of reduction
of the aberrant transcript.
[0013] The invention thus provides a method for the treatment of
unstable cis-element DNA repeat associated genetic disorders, by
providing nucleic acid molecules that are complementary to and/or
capable of hybridising to the repetitive sequences only. This
method thereby preferentially targets the expanded repeat
transcripts and leaves the transcripts of the normal, wild type
allele relatively unaffected. This is advantageous since the normal
allele can thereby provide for the normal function of the gene,
which is at least desirable and, depending on the particular gene
with unstable DNA repeats, may in many cases be essential for the
cell and/or individual to be treated.
[0014] Furthermore, this approach is not limited to a particular
unstable DNA repeat associated genetic disorder, but may be applied
to any of the known unstable DNA repeat diseases, such as, but not
limited to: coding regions repeat diseases having a polyglutamine
(CAG) repeat: Huntington's disease, Haw River syndrome, Kennedy's
disease/spinobulbar muscular atrophy, spino-cerebellar ataxia, or
diseases having polyalanine (GCG) repeats such as: infantile spasm
syndrome, deidocranial dysplasia,
blepharophimosis/ptosis/epicanthus invensus syndrome,
hand-foot-genital syndrome, synpolydactyly, oculopharyngeal
muscular dystrophy, holoprosencephaly. Diseases with repeats in
non-coding regions of genes to be treated according to the
invention comprise the trinucleotide repeat disorders (mostly CTG
and/or CAG and/or CCTG repeats): myotonic dystrophy type 1,
myotonic dystrophy type 2. Friedreich's ataxia (mainly GAA),
spino-cerebellar ataxia, autism. Furthermore, the method of the
invention can be applied to fragile site associated repeat disorder
comprising various fragile X-syndromes, Jacobsen syndrome and other
unstable repetitive element disorders such as myoclonus epilepsy,
facioscapulohumeral dystrophy and certain forms of diabetes
mellitus type 2.
[0015] Another advantage of the current invention is that the
oligonucleotides specific for a repeat region may be administered
directly to cells and it does not rely on vector-based delivery
systems. The techniques described in the prior art, for instance
those mentioned above for treatment of DM1 and removal of DMPK
transcripts from cells, require the use of vector based delivery
systems to administer sufficient levels of oligonucleotides to the
cell. The use of plasmid or viral vectors is yet less desirable for
therapeutic purposes because of current strict safety regulations
for therapeutic recombinant DNA vectors, the production of
sufficient recombinant vectors for broad clinical application and
the limited control and reversibility of an exaggerated (or
non-specific) response after application. Nevertheless,
optimisation in future is likely in these areas and viral delivery
of plasmids could yield an advantageous long lasting effect. The
current inventors have surprisingly found that oligonucleotides
that comprise or consist of a sequence that is complementary to
repetitive sequences of expanded repeat transcripts, due to the
expansion of their molecular target for hybridisation, have a much
increased affinity and/or avidity for their target in comparison to
oligonucleotides that are specific for unique sequences in a
transcript. Because of this high affinity and avidity for the
repeat expanded target transcript, lower amounts of oligonucleotide
suffice to yield sufficient inhibition and/or reduction of the
repeat expanded allele by RNase H degradation, RNA interference
degradation or altered post-transcriptional processing (comprising
but not limited to splicing or exon skipping) activities. The
oligonucleotides of the current invention which are complementary
to repetitive sequences only, may be produced synthetically and are
potent enough to be effective when delivered directly to cells
using commonly applied techniques for direct delivery of
oligonucleotides to cells and/or tissues. Recombinant vector
delivery systems may, when desired, be circumvented by using the
method and the oligonucleotide molecules of the current
invention.
[0016] In a first aspect, the current invention discloses and
teaches the use of an oligonucleotide comprising or consisting of a
sequence that is complementary only to a repetitive sequence in a
human gene transcript for the manufacture of a medicament for the
diagnosis, treatment or prevention of a cis-element repeat
instability associated genetic disorders in humans. The invention
hence provides a method of treatment for cis-element repeat
instability associated genetic disorders.
[0017] In a second aspect, the invention also pertains to an
oligonucleotide which can be used in the first aspect of the
invention and/or applied in method of the invention to prevent the
accumulation and/or translation of repeat expanded transcripts in
cells.
[0018] An oligonucleotide of the invention may comprise a sequence
that is complementary only to a repetitive sequence as defined
below. Preferably, the repetitive sequence is at least 50% of the
length of the oligonucleotide of the invention, more preferably at
least 60%, even more preferably at least 70%, even more preferably
at least 80%, even more preferably at least 90% or more. In a most
preferred embodiment, the oligonucleotide of the invention consists
of a sequence that is complementary only to a repetitive sequence
as defined below. For example, an oligonucleotide may comprise a
sequence that is complementary only to a repetitive sequence as
defined below and a targeting part, which is later on called a
targeting ligand.
[0019] A repeat or repetitive element or repetitive sequence or
repetitive stretch is herein defined as a repetition of at least 3,
4, 5, 10, 100, 1000 or more, of a repetitive unit or repetitive
nucleotide unit or repeat nucleotide unit comprising a
trinucleotide repetitive unit, or alternatively a 4, 5 or 6
nucleotide repetitive unit, in a transcribed gene sequence in the
genome of a subject, including a human subject.
[0020] An oligonucleotide may be single stranded or double
stranded. Double stranded means that the oligonucleotide is an
heterodimer made of two complementary strands, such as in a siRNA.
In a preferred embodiment, an oligonucleotide is single stranded. A
single stranded oligonucleotide has several advantages compared to
a double stranded siRNA oligonucleotide: (i) its synthesis is
expected to be easier than two complementary siRNA strands; (ii)
there is a wider range of chemical modifications possible to
optimise more effective uptake in cells, a better (physiological)
stability and to decrease potential generic adverse effects; and
(iii) siRNAs have a higher potential for non-specific effects and
exaggerated pharmacology (e.g. less control possible of
effectiveness and selectivity by treatment schedule or dose) and
(iv) siRNAs are less likely to act in the nucleus and cannot be
directed against introns. Therefore, in a preferred embodiment of
the first aspect, the invention relates to the use of a single
stranded oligonucleotide comprising or consisting of a sequence
that is complementary only to a repetitive sequence in a human gene
transcript for the manufacture of a medicament for the diagnosis,
treatment or prevention of a cis-element repeat instability
associated genetic disorders in humans.
[0021] The oligonucleotide(s) preferably comprise at least 10 to
about 50 consecutive nucleotides complementary to a repetitive
element, more preferably 12 to 45 nucleotides, even more preferably
12 to 30, and most preferably 12 to 25 nucleotides complementary to
a repetitive stretch, preferably having a trinucleotide repeat unit
or a tetranucleotide repeat unit. The oligonucleotide may be
complementary to and/or capable of hybridizing to a repetitive
stretch in a coding region of a transcript, preferably a
polyglutamine (CAG) or a polyalanine (GCG) coding tract. The
oligonucleotide may also be complementary to and/or capable of
hybridizing to a non-coding region for instance 5' or 3'
untranslated regions, or intronic sequences present in precursor
RNA molecules.
[0022] In a preferred embodiment the oligonucleotide to be used in
the method of the invention comprises or consists of a sequence
that is complementary to a repetitive element having as repetitive
nucleotide unit a repetitive nucleotide unit selected from the
group consisting of (CAG)n, (GCG)n, (CUG)n, (CGG)n (GAA)n, (GCC)n
and (CCUG)n. and said oligonucleotide being a single or double
stranded oligonucleotide. Preferably, the oligonucleotide is double
stranded.
[0023] The use of an oligonucleotide that comprises or consists of
a sequence that is complementary to a polyglutamine (CAG)n tract in
a transcript is particularly useful for the diagnosis, treatment
and/or prevention of the human disorders Huntington's disease,
several forms of spino-cerebellar ataxia or Haw River syndrome,
X-linked spinal and bulbar muscular atrophy and/or
dentatorubral-pallidoluysian atrophy caused by repeat expansions in
the HD, HDL2/JPH3, SBMA/AR, SCA1/ATX1, SCA2/ATX2, SCA3/ATX3,
SCA6/CACNAIA, SCAT, SCA17, AR or DRPLA human genes.
[0024] The use of an oligonucleotide that comprises or consists of
a sequence that is complementary to a polyalanine (GCG)n tract in a
transcript is particularly useful for the diagnosis, treatment
and/or prevention of the human disorders: infantile spasm syndrome,
deidocranial dysplasia, blepharophimosis, hand-foot-genital
disease, synpolydactyl), oculopharyngeal muscular dystrophy and/or
holoprosencephaly, which are caused by repeat expansions in the
ARX, CBFA1, FOXL2, HOXA13, HOXD13, OPDM/PABP2, TCFBR1 or ZIC2 human
genes.
[0025] The use of an oligonucleotide that comprises or consists of
a sequence that is complementary to a (CUG)n repeat in a transcript
and is particularly useful for the diagnosis, treatment and/or
prevention of the human genetic disorder myotonic dystrophy type 1,
spino-cerebrellar ataxia 8 and/or Huntington's disease-like 2
caused by repeat expansions in the DM1/DMPK, SCA8 or JPH3 genes
respectively. Preferably, these genes are from human origin.
[0026] The use of an oligonucleotide that comprises or consists of
a sequence that is complementary to a (CCUG)n repeat in a
transcript is particularly useful for the diagnosis, treatment
and/or prevention of the human genetic disorder myotonic dystrophy
type 2, caused by repeat expansions in the DM2/ZNF9 gene.
[0027] The use of an oligonucleotide that comprises or consists of
a sequence that is complementary to a (CGG)n repeat in a transcript
is particularly useful for the diagnosis, treatment and/or
prevention of human fragile X syndromes, caused by repeat expansion
in the FRAXA/FMR1, FRAXE/FMR2 and FRAXF/FAM11A genes.
[0028] The use of an oligonucleotide that comprises or consists of
a sequence that is complementary to a (CCG)n repeat in a transcript
is particularly useful for the diagnosis, treatment and/or
prevention of the human genetic disorder Jacobsen syndrome, caused
by repeat expansion in the FRA11B/CBL2 gene.
[0029] The use of an oligonucleotide that comprises or consists of
a sequence that is complementary to a (GAA)n repeat in a transcript
is particularly useful for the diagnosis, treatment and/or
prevention of the human genetic disorder Friedreich's ataxia.
[0030] The use of an oligonucleotide that comprises or consists of
a sequence that is complementary to a (ATTCT)n repeat in an intron
is particularly useful for the diagnosis, treatment and/or
prevention of the human genetic disorder Spinocerebellar ataxia
type 10 (SCA10).
[0031] The repeat-complementary oligonucleotide to be used in the
method of the invention may comprise or consist of RNA, DNA, Locked
nucleic acid (LNA), peptide nucleic acid (PNA), morpholino
phosphorodiamidates (PMO), ethylene bridged nucleic acid (ENA) or
mixtures/hybrids thereof that comprise combinations of naturally
occurring DNA and RNA nucleotides and synthetic, modified
nucleotides. In such oligonucleotides, the phosphodiester backbone
chemistry may further be replaced by other modifications, such as
phosphorothioates or methylphosphonates. Other oligonucleotide
modifications exist and new ones are likely to be developed and
used in practice. However, all such oligonucleotides have the
character of an oligomer with the ability of sequence specific
binding to RNA. Therefore in a preferred embodiment, the
oligonucleotide comprises or consists of RNA nucleotides, DNA
nucleotides, locked nucleic acid (LNA) nucleotides, peptide nucleic
acid (PNA) nucleotides, morpholino phosphorodiamidates,
ethylene-bridged nucleic acid (ENA) nucleotides or mixtures thereof
with or without phosphorothioate containing backbones.
[0032] Oligonucleotides containing at least in part naturally
occurring DNA nucleotides are useful for inducing degradation of
DNA-RNA hybrid molecules in the cell by RNase H activity
(EC.3.1.26.4).
[0033] Naturally occurring RNA ribonucleotides or RNA-like
synthetic ribonucleotides comprising oligonucleotides may be
applied in the method of the invention to form double stranded
RNA-RNA hybrids that act as enzyme-dependent antisense through the
RNA interference or silencing (RNAi/siRNA) pathways, involving
target RNA recognition through sense-antisense strand pairing
followed by target RNA degradation by the RNA-induced silencing
complex (RISC).
[0034] Alternatively or in addition, steric blocking antisense
oligonucleotides (RNase-H independent antisense) interfere with
gene expression or other precursor RNA or messenger RNA-dependent
cellular processes, in particular but not limited to RNA splicing
and exon skipping, by binding to a target sequence of RNA
transcript and getting in the way of processes such as translation
or blocking of splice donor or splice acceptor sites. Alteration of
splicing and exon skipping techniques using modified antisense
oligonucleotides are well documented, known to the skilled artisan
and may for instance be found in U.S. Pat. No. 6,210,892,
WO9426887, WO04/083446 and WO02/24906. Moreover, steric hindrance
may inhibit the binding of proteins, nuclear factors and others and
thereby contribute to the decrease in nuclear accumulation or
ribonuclear foci in diseases like DM1.
[0035] The oligonucleotides of the invention, which may comprise
synthetic or modified nucleotides, complementary to (expanded)
repetitive sequences are useful for the method of the invention for
reducing or inactivating repeat containing transcripts via the
siRNA/RNA interference or silencing pathway.
[0036] Single or double stranded oligonucleotides to be used in the
method of the invention may comprise or consist of DNA nucleotides,
RNA nucleotides, 2'-O substituted ribonucleotides, including alkyl
and methoxy ethyl substitutions, peptide nucleic acid (PNA), locked
nucleic acid (LNA) and morpholino (PMO) antisense oligonucleotides
and ethylene-bridged nucleotides (ENA) and combinations thereof,
optionally chimeras with RNAse H dependent antisense. Integration
of locked nucleic acids in the oligonucleotide changes the
conformation of the helix after base pairing and increases the
stability of the duplex. Integration of LNA bases into the
oligonucleotide sequence can therefore be used to increase the
ability of complementary oligonucleotides of the invention to be
active in vitro and in vivo to increase RNA degradation inhibit
accumulation of transcripts or increase exon skipping capabilities.
Peptide nucleic acids (PNAs), an artificial DNA/RNA analog, in
which the backbone is a pseudopeptide rather than a sugar, have the
ability to form extremely stable complexes with complementary DNA
oligomers, by increased binding and a higher melting temperature.
Also PNAs are superior reagents in antisense and exon skipping
applications of the invention. Most preferably, the
oligonucleotides to be used in the method of this invention
comprise, at least in part or fully, 2'-O-methoxy ethyl
phosphorothioate RNA nucleotides or 2'-O-methyl phosphorothioate
RNA nucleotides. Oligonucleotides comprising or consisting of a
sequence that is complementary to a repetitive sequence selected
from the group consisting of (CAG)n, (GCG)n, (CUG)n, (CGG)n,
(CCG)n, (GAA)n, (GCC)n and (CCUG)n having a length of 10 to 50,
more preferably 12 to 35, most preferably 12 to 25 nucleotides, and
comprising 2'-.beta.-methoxyethyl phosphorothioate RNA nucleotides,
2'-O-methyl phosphorothioate RNA nucleotides, LNA nucleotides or
PMO nucleotides are most preferred for use in the invention for the
diagnosis, treatment of prevention of cis-element repeat
instability genetic disorders.
[0037] Accordingly, in a preferred embodiment, an oligonucleotide
of the invention and used in the invention comprises or consists of
a sequence that is complementary to a repetitive sequence selected
from the group consisting of (CAG)n, (GCG)n, (CUG)n, (CGG)n,
(GAA)n, (GCC)n and (CCUG)n, has a length of 10 to 50 nucleotides
and is further characterized by: [0038] a) comprising
2'-O-substituted RNA phosphorothioate nucleotides such as
2'-O-methyl or 2'-O-methoxy ethyl RNA phosphorothiote nucleotides,
LNA nucleotides or PMO nucleotides. The nucleotides could be used
in any combination and/or with DNA phosphorothioate or RNA
nucleotides; and/or [0039] b) being a single stranded
oligonucleotide.
[0040] Accordingly, in another preferred embodiment, an
oligonucleotide of the invention and used in the invention
comprises or consists of a sequence that is complementary to a
repetitive sequence selected from the group consisting of (CAG)n,
(GCG)n, (CUG)n, (CGG)n, (GAA)n, (GCC)n and (CCUG)n, has a length of
10 to 50 nucleotides and is further characterized by: [0041] c)
comprising 2'-O-substituted RNA phosphorothioate nucleotides such
as 2'-O-methyl or 2'-O-methoxy ethyl RNA phosphorothiote
nucleotides, LNA nucleotides or PMO nucleotides. The nucleotides
could be used in combination and/or with DNA phosphorothioate or
RNA nucleotides; and/or [0042] d) being a double stranded
oligonucleotide.
[0043] In case, the invention relates to a double stranded
oligonucleotide with two complementary strands, the antisense
strand, complementary only to a repetitive sequence in a human gene
transcript, this double stranded oligonucleotide is preferably not
the siRNA with antisense RNA strand (CUG).sub.7 and sense RNA
strand (GCA).sub.7 applied to cultured monkey fibroblast (COS-7) or
human neuroblastoma (SH-SY5Y) cell lines with or without
transfection with a human Huntington gene exon 1 fused to GFP and
as depicted in Wanzhao Liu et al (Wanzhao Liu et al, (2003), Proc.
Japan Acad, 79: 293-298). More preferably, the invention does
neither relate to the double stranded oligonucleotide siRNA (with
antisense strand (CUG).sub.7 and sense strand (GCA).sub.7) nor to
its use for the manufacture of a medicament for the treatment or
prevention of Huntington disease, even more preferably for the
treatment or prevention of Huntington disease gene exon 1
containing construct.
[0044] Although use of a single oligonucleotide may be sufficient
for reducing the amount of repeat expanded transcripts, such as
nuclear accumulated DMPK or ZNF9 transcripts or segments thereof or
sufficient reduction of accumulation of repeat expanded HD protein,
it is also within the scope of the invention to combine 2, 3, 4, 5
or more oligonucleotides. The oligonucleotide comprising or
consisting of a sequence that is complementary to a repetitive part
of a transcript may be advantageously combined with
oligonucleotides that comprise or consist of sequences that are
complementary to and/or capable of hybridizing with unique
sequences in a repeat containing transcript. The method of the
invention and the medicaments of the invention comprising repeat
specific oligonucleotides may also be combined with any other
treatment or medicament for cis-element repeat instability genetic
disorders. For diagnostic purposes the oligonucleotide used in the
method of the invention may be provided with a radioactive label or
fluorescent label allowing detection of transcripts in samples, in
cells in situ in vivo, ex vivo or in vitro. For myotonic dystrophy,
labelled oligonucleotides may be used for diagnostic purposes, for
visualisation of nuclear aggregates of DMPK or ZNF9 RNA transcript
molecules with associated proteins. Fluorescent labels may comprise
Cy3, Cy5, FITC, TRITC, Rhodamine, GFP and the like. Radioactive
labels may comprise .sup.3H, .sup.35S, .sup.32/33P, .sup.125I.
Enzymes and/or immunogenic haptens such as digoxigenin, biotin and
other molecular tags (HA, Myc, FLAG, VSV, lexA) may also be used.
Accordingly, in a further aspect, the invention discloses an vitro
or ex vivo detection and/or diagnostic method wherein a
oligonucleotide as defined above is used.
[0045] The oligonucleotides for use according to the invention are
suitable for direct administration to cells, tissues and/or organs
in vivo of individuals affected by or at risk of developing a
cis-element repeat instability disorder, and may be administered
directly in vivo, ex vivo or in vitro. Alternatively, the
oligonucleotides may be provided by a nucleic acid vector capable
of conferring expression of the oligonucleotide in human cells, in
order to allow a sustainable source of the oligonucleotides.
Oligonucleotide molecules according to the invention may be
provided to a cell, tissue, organ and/or subject to be treated in
the form of an expression vector that is capable of conferring
expression of the oligonucleotide in human cells. The vector is
preferably introduced in the cell by a gene delivery vehicle.
Preferred vehicles for delivery are viral vectors such as
retroviral vectors, adeno-associated virus vectors (AAV),
adenoviral vectors, Semliki Forest virus vectors (SFV), EBV vectors
and the like. Also plasmids, artificial chromosomes, plasmids
suitable for targeted homologous recombination and integration in
the human genome of cells may be suitably applied for delivery of
oligonucleotides. Preferred for the current invention are those
vectors wherein transcription is driven from polIII promoters,
and/or wherein transcripts are in the form fusions with U1 or U7
transcripts, which yield good results for delivering small
transcripts.
[0046] In a preferred embodiment, a concentration of
oligonucleotide, which is ranged between about 0.1 nM and about 1
.mu.M is used. More preferably, the concentration used is ranged
between about 0.3 to about 400 nM, even more preferably between
about 1 to about 200 nM. If several oligonucleotides are used, this
concentration may refer to the total concentration of
oligonucleotides or the concentration of each oligonucleotide
added. The ranges of concentration of oligonucleotide(s) as given
above are preferred concentrations for in vitro or ex vivo uses.
The skilled person will understand that depending on the
oligonueleotide(s) used, the target cell to be treated, the gene
target and its expression levels, the medium used and the
transfection and incubation conditions, the concentration of
oligonucleotide(s) used may further vary and may need to be
optimised any further.
[0047] More preferably, the oligonucleotides to be used in the
invention to prevent, treat or diagnose cis-element repeat
instability disorders are synthetically produced and administered
directly to cells, tissues, organs and/or patients in formulated
form in pharmaceutically acceptable compositions. The delivery of
the pharmaceutical compositions to the subject is preferably
carried out by one or more parenteral injections, e.g. intravenous
and/or subcutaneous and/or intramuscular and/or intrathecal and/or
intraventricular administrations, preferably injections, at one or
at multiple sites in the human body. An intrathecal or
intraventricular administration (in the cerebrospinal fluid) is
preferably realized by introducing a diffusion pump into the body
of a subject. Several diffusion pumps are known to the skilled
person.
[0048] Pharmaceutical compositions that are to be used to target
the oligonucleotide molecules comprising or consisting of a
sequence that is complementary to repetitive sequences may comprise
various excipients such as diluents, fillers, preservatives,
solubilisers and the like, which may for instance be found in
Remington: The Science and Practice of Pharmacy, 20th Edition.
Baltimore, Md.: Lippincott Williams & Wilkins, 2000.
[0049] Particularly preferred for the method of the invention is
the use of excipients that will aid in delivery of the
oligonucleotides to the cells and into the cells, in particular
excipients capable of forming complexes, vesicles and/or liposomes
that deliver substances and/or oligonucleotide(s) complexed or
trapped in the vesicles or liposomes through a cell membrane. Many
of these substances are known in the art. Suitable substances
comprise polyethylenimine (PEI), ExGen 500, synthetic amphiphils
(SAINT-18), Lipofectin.TM., DOTAP and/or viral capsid proteins that
are capable of self assembly into particles that can deliver
oligonucleotides to cells. Lipofectin represents an example of
liposomal transfection agents. It consists of two lipid components,
a cationic lipid N-[1-(2,3
dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) (cp.
DOTAP which is the methylsulfate salt) and a neutral lipid
dioleoylphosphatidylethanolamine (DOPE). The neutral component
mediates the intracellular release. Another group of delivery
systems are polymeric nanoparticles. Polycations such like
diethylaminoethylaminoethyl (DEAE)-dextran, which are well known as
DNA transfection reagent can be combined with butylcyanoacrylate
(PBCA) and hexylcyanoacrylate (PHCA) to formulate cationic
nanoparticles that can deliver oligonucleotides across cell
membranes into cells. In addition to these common nanoparticle
materials, the cationic peptide protamine offers an alternative
approach to formulate oligonucleotides as colloids. This colloidal
nanoparticle system can form so called proticles, which can be
prepared by a simple self-assembly process to package and mediate
intracellular release of the oligonucleotides. The skilled person
may select and adapt any of the above or other commercially
available alternative excipients and delivery systems to package
and deliver oligonucleotides for use in the current invention to
deliver oligonucleotides for the treatment of cis-element repeat
instability disorders in humans.
[0050] In addition, the oligonucleotide could be covalcntly or
non-covalcntly linked to a targeting ligand specifically designed
to facilitate the uptake in to the cell, cytoplasm and/or its
nucleus. Such ligand could comprise (i) a compound (including but
not limited to peptide(-like) structures) recognising cell, tissue
or organ specific elements facilitating cellular uptake and/or (ii)
a chemical compound able to facilitate the uptake in to cells
and/or the intracellular release of an oligonucleotide from
vesicles, e.g. endosomes or lysosomes. Such targeting ligand would
also encompass molecules facilitating the uptake of
oligonucleotides into the brain through the blood brain barrier.
Therefore, in a preferred embodiment, an oligonucleotide in a
medicament is provided with at least an excipient and/or a
targeting ligand for delivery and/or a delivery device of the
oligonucleotide to cells and/or enhancing its intracellular
delivery. Accordingly, the invention also encompasses a
pharmaceutically acceptable composition comprising an
oligonucleotide of the invention and further comprising at least
one excipient and/or a targeting ligand for delivery and/or a
delivery device of the oligonucleotide to the cell and/or enhancing
its intracellular delivery.
[0051] The invention also pertains to a method for the reduction of
repeat containing gene transcripts in a cell comprising the
administration of a single strand or double stranded
oligonucleotide molecule, preferably comprising 2'-O-substituted
RNA phosphorothioate nucleotides such as 2'-O-methyl or
2'-O-methoxy ethyl RNA phosphorothioate nucleotides or LNA
nucleotides or PMO nucleotides, and having a length of 10 to 50
nucleotides that are complementary to the repetitive sequence only.
The nucleotides could be used in combination and/or with DNA
phosphorothioate nucleotides.
[0052] In this document and in its claims, the verb "to comprise"
and its conjugations is used in its non-limiting sense to mean that
items following the word are included, but combinations and/or
items not specifically mentioned are not excluded. In addition,
reference to an element by the indefinite article "a" or "an" does
not exclude the possibility that more than one of the element is
present, unless the context clearly requires that there be one and
only one of the elements. The indefinite article "a" or "an" thus
usually means "at least one".
FIGURE LEGENDS
[0053] FIG. 1: Northern blot of RNA isolated from myotubes
transfected with different oligonucleotides or mock control. The
myotubes were derived from immorto mouse myoblast cell lines
containing a transgenic human DMPK genes with (CTG)n repeat
expansion length of approximately 500 next to its normal mouse DMPK
gene without (CTG) repeat. The blot shows human DMPK mRNA (top),
mouse DMPK (mDMPK) mRNA (middle) and mouse GAPDH mRNA (bottom).
[0054] FIG. 2: The human and mouse DMPK signals of FIG. 1 were
quantified by phosphoimager analysis and normalized, to the GAPDH
signal. The results are expressed relative to the mock treatment
(set to 100).
[0055] FIG. 3: Northern blot of total RNA isolated from murine
myotubes containing a mouse-human chimaeric DMPK gene in which the
3' part of the mDMPK gene was replaced by the cognate segment of
the human DMPK gene including a (CTG).sub.110-repeat. The blot was
probed for DMPK mRNA (upper panel) and mouse GAPDH mRNA (bottom).
Cells were transfected with antisense oligonucleotide PS58 or
control.
[0056] FIG. 4 shows the response of DM500 myotubes treated with
various concentrations of oligonucleotide PS58. The expression of
hDMPK was quantified via Northern blot analysis followed by
phosphoimager analysis. The signal was normalised to the GAPDH
signal and expressed relative to the response after mock
treatment.
[0057] FIG. 5 shows the Northern blot of total RNA of DM500
myotubes transfected with 200 nM PS58 at different time points: 2
h, 4 h, 8 h and 48 h before harvesting. Mock treatment was
performed 48 h before harvesting. Northern blots show human and
mouse DMPK and mouse GAPDH mRNA. These were quantified by
phosphoimager and the normalized DMPK signal was expressed relative
to mock treatment.
[0058] FIG. 6 shows the Northern blot of total RNA of DM500
myotubes harvested 2 d, 4 d, 6 d and 8 d after transfection with
200 nM PS58 or mock control. Northern blot analysis and
quantification was performed as before.
[0059] FIG. 7 shows a Northern blot of total RNA from
MyoD-transformed myoblasts treated with oligonucleotide PS58 (20
and 200 nM) or mock control. The myoblasts were derived from
fibroblasts obtained from a congenital myotonic dystrophy type I
patient bearing a hDMPK allele with a triplet repeat expansion
length of approximately 1500 and a hDMPK allele with normal length
of 11 repeats. The Northern blot was hybridized with a human DMPK
(hDMPK) probe and GAPDH mRNA probe. The human DMPK signals were
normalized to the GAPDH signal and expressed relative to mock
control.
[0060] FIG. 8 shows the RT-PCR analysis of DM500 myotubes
transfected with 20011M of oligonucleotide PS58, specific to the
(CUG) repeat sequence only, oligonucleotide PS113, specific to a
sequence in exon 1, or mock control. RT-PCR analysis was performed
with primers specific for hDMPK mRNA and three other gene
transcripts with a naturally occurring (CUG) repeat in mice: Ptbp1
mRNA with a (CUG)6, Syndecan3 mRNA with a (CUG)6 and Taxilinbeta
mRNA with a (CUG)9. The intensity of the signals were normalized to
the actin signal and expressed relative to mock control.
[0061] FIG. 9 shows FISH analysis of DM500 myoblasts transfected
with 200 nM PS58 (B) or mock control (A). Fourty eight hours after
the start of the treatment, the cells were washed and fixed and
subsequently hybridized with fluorescently labeled oligonucleotide
Cy3-(CAG)10-Cy3. The ribonuclear foci indicative of hDMPK
(CUG).sub.500 mRNA aggregation in the nucleus were visualized using
a Bio-Rad MRC1024 confocal laser scanning microscope and
LaserSharp2000 acquisition software.
[0062] FIG. 10 shows the relative cell count for the presence of
ribonuclear foci in the nucleus of DM500 myoblasts transfected with
PS58 or mock control from the experiment depicted in FIG. 9.
[0063] FIG. 11 shows the RT-PCR analysis of hDMPK mRNA in muscle of
DM500 mice treated with PS58 or mock control. Shortly, PS58 (2
nmol) was injected in the GPS complex of one-year-old DM500 mice
and this procedure was repeated after 24 h. After 15 days, M.
plantaris and M. gastrocnemius were isolated and RT-PCR was
performed on total RNA for hDMPK and mouse actin. The intensity of
the hDMPK signal was normalized to the actin signal and the values
expressed relative to mock control.
[0064] FIG. 12 shows a Northern blot analysis of DM500 myotubes
treated with different oligonucleotides (200 nM) or mock control.
PS58, PS146 and PS147 carried a full 2'O-methyl phosphorothiate
backbone, but differed in length, (CAG)7, (CUG)10 and (CUG)5,
respectively. PS142 has a complete phosphorothiate DNA backbone
with a (CAG)7 sequence. hDMPK and mDMPK signals were normalized to
mouse GAPDH and expressed as percentage to mock control.
Quantification is shown in the lower panel.
EXAMPLES
Example 1
[0065] Immortomyoblast cell lines were derived from DM500 or CTG110
mice using standard techniques known to the skilled person. DM500
mice were derived from mice obtained from de Gourdon group in
Paris. CTG110 mice are described below and present at the group of
Wiering a and Wansink in Nijmegen. Immortomyoblast cell lines DM500
or CTG 110 with variable (CTG)n repeat length in the DMPK gene were
grown subconfluent and maintained in a 5% CO.sub.2 atmosphere at
33.degree. C. on 0.1% gelatin coated dishes. Myoblast cells were
grown subconfluent in DMEM supplemented with 20% FCS, 50 .mu.g/ml
gentamycin and 20 units of .gamma.-interferon/ml. Myotube formation
was induced by growing myoblast cells on Matrigel (BD Biosciences)
coated dishes and placing a confluent myoblast culture at
37.degree. C. and in DMEM supplemented with 5% horse serum and 50
.mu.g/ml gentamycin. After five days on this low serum media
contracting myotubes arose in culture and were transfected with the
desired oligonucleotides. For transfection NaCl (500 mM, filter
sterile), oligonucleotide and transfection reagens PEI (ExGen 500,
Fermentas) were added in this specific order and directly mixed.
The oligonucleotide transfection solution contained a ratio of 5
.mu.l ExGen500 per ug oligonucleotide which is according to the
instructions (ExGen 500, Fermentas). After 15 minutes of incubation
at room temperature the oligonucleotide transfection solution was
added to the low serum medium with the cultured myotubes and gently
mixed. The final oligonucleotide concentration was 200 nM. Mock
control treatment is carried out with transfection solution without
an oligonucleotide. After four hours of incubation at 37.degree.
C., fresh medium was added to the culture (resulting in a dilution
of approximately 2.3.times.) and incubation was extended overnight
at 37.degree. C. The next day the medium containing the
oligonucleotide was removed and fresh low serum medium was added to
the myotubes which were kept in culture at 37.degree. C. for
another day. Fourty eight hours after the addition of
oligonucleotide to the myotube culture (which is seven days after
switching to low serum conditions to induced myotube formation),
RNA was isolated with the "Total RNA mini kit" (Bio-Rad) and
prepared for Northern blot and RT-PCR analysis. The Northern blot
was hybridized with a radioactive human DMPK (hDMPK) probe and a
mouse GAPDH probe. The probe used for DMPK is a human DMPK cDNA
consisting of the DMPK open reading frame with full 3' UTR and 11
CTGs.
[0066] The human and mouse DMPK signal were quantified by
phosphoimager analysis and normalized to the GAPDH signal. Primers
that were used for the RT-PCR for hDMPK mRNA were situated in the
3' untranslated part with the sequence 5'-GGGGGATCACAGACCATT-3' and
5'-TCAATGCATCCAAAACGTGGA-3' and for murine actin the primers were
as followed: Actin sense 5'-GCTAYGAGCTGCCTGACGG-3' and Actin
antisense 5'-GAGGCCAGGATGGAGCC-3'. PCR products were run on an
agarose gel and the signal was quantified using Labworks 4.0 (UVP
BioImaging systems, Cambridge, United Kingdom). The intensity of
each band was normalized to the intensity of the corresponding
actin band and expressed relative to mock control.
[0067] Thirteen different oligonucleotides were tested (for an
overview see Table 1) as described above on the immortomyoblast
DM500 cell line containing transgenic human DMPK gene with (CTG)n
repeat length of approximately 500 and a normal mouse DMPK gene
without (CTG) repeat. FIG. 1 shows the Northern blot of the
isolated RNA from the oligonucleotide transfected myotubes
visualized with the hDMPK probe and a GAPDH probe for loading
control. Quantification of the human DMPK (with CTG repeat) and
murine DMPK (without CTG repeat) signal on the Northerm blot is
shown in FIG. 2. The signal was normalized to murine GAPDH and
expressed relative to mock control.
[0068] Table 2 indicates the level of hDMPK mRNA reduction that is
caused by a specific oligonucleotide. The minus (-) stands for no
reduction and the number of positive signs (+) stands for the
relative level of hDMPK mRNA break-down. Clearly, oligonucleotide
PS58, specifically targeted to the repeat sequence, is much more
potent in reducing or altering hDMPK transcripts than the other
oligonucleotides complementary to unique sequences in the hDMPK
transcripts.
[0069] FIG. 3 shows the effect of PS58 in murine immortomyotubes
derived from CTG110 mice, a knock-in mouse containing a DMPK gene
with the 3' part of the human DMPK gene including a (CTG) repeat of
approximately 110. Northern blot analysis showed that the DMPK
transcript containing the (CTG)110 repeat was reduced by the
treatment with oligonucleotide PS58 but not after mock
treatment.
Example 2
FIG. 4
[0070] The DM500 immortomyoblast cell line carrying a human DMPK
gene with an approximate (CTG)500 repeat expansion was cultured,
prepared and transfected as described above (see example 1). In
this example, the transfection was carried out with PS58 at
different concentrations. Eighty four hours after start of
treatment, the myotubes were harvested and Northern blot analysis
was performed on isolated RNA as described above (see example
1).
[0071] FIG. 4 shows the quantification of the hDMPK mRNA signal
preformed by phosphoimager analysis and normalized to the GAPDH
signal at different concentrations. Under these conditions, a half
maximal effect was observed at around 1 nM.
Example 3
FIGS. 5 and 6
[0072] The DM500 immortomyoblast cell line carrying a human DMPK
gene with an approximate (CTG)500 repeat expansion was cultured,
prepared and transfected as described above (see example 1).
However, in this example the transfection with 200 nM PS58 was
carried out at different time points. Usually DM500 myotubes were
harvested seven days after switching to low serum conditions to
induce myotube formation. The standard procedure (as in example 1
and 2) was to start treatment (transfection) 48 h (two days) before
harvesting. Now, treatment with PS58 was started 2 h-48 h (FIG. 5)
or 2 d-8 d (FIG. 6) before harvesting. Northern blot analysis and
quantification was performed as before.
[0073] FIG. 5 shows that expanded hDMPK mRNA in DM500 myotubes was
decreased rapidly within 2 h of treatment with oligonucleotide PS58
compared to mock control treatment.
[0074] FIG. 6 shows a persistent decrease in expanded hDMPK mRNA in
DM500 myotubes for at least 8 days. Please note that in the case of
the 8 d experiment, cells were transfected in the myoblast stage
(approximately 60% confluent, 33.degree. C., high serum) and that
they have received fresh medium on various occasions until
harvesting (including a change to low serum at 37.degree. C., two
days after transfection). Example 2 and 3 are indicative of a
highly efficient inhibitory intervention by an oligonucleotide
directed solely to the repeat expansion. The magnitude of this
effect might be influenced by the relative low levels of hDMPK
expression in these model cell systems, which normally is also seen
in humans.
Example 4
FIG. 7
[0075] In this example, fibroblasts obtained from a human patient
with congenital myotonic dystrophy type 1 (cDM1) were used. These
patient cells carry one disease causing DMPK allele with a triplet
repeat expansion length of 1500 and one normal DMPK allele with a
repeat length of 11. The size of the (CTG)n expansion on both
alleles was confirmed with PCR and Southern blotting.
[0076] The fibroblasts were grown sub confluent and maintained in a
5% CO.sub.2 atmosphere at 37.degree. C. on 0.1% gelatin coated
dishes. Fibroblasts were grown subconfluent in DMEM supplemented
with 10% FCS and 50 .mu.g/ml gentamycin. Myotube formation was
induced by growing fibroblasts cells on Matrigel (BD Biosciences)
coated dishes and infecting the cells at 75% confluency with
MyoD-expressing adenovirus (Ad5Fib50MyoD, Crucell, Leiden)
(MOI=100) in DMEM supplemented with 2% HS and 50 .mu.g/ml
gentamycin for 2 hours. After the incubation period MyoD adenovirus
was removed and DMEM supplemented with 10% FCS and 50 .mu.g/ml
gentamycin was added. The cells were maintained hi this medium in a
5% CO.sub.2 atmosphere at 37.degree. C. until 100% confluency. At
this point cells were placed in DMEM supplemented with 2% FCS and
50 .mu.g/ml gentamycin. After five days on this low serum media
cells were transfected with PS58 following the procedure according
to the instructions (ExGen 500, Fermentas) and as described above.
The final oligonucleotide concentration was 200 nM and 20 nM.
Fourty eight hours after start of the treatment (which is seven
days after switching to low serum conditions), RNA was isolated
with the "Total RNA mini kit" (Bio-Rad) and prepared for Northern
blot. The Northern blot was hybridized with a radioactive human
DMPK (hDMPK) and mouse GAPDH mRNA probe. The human DMPK signals
were quantified by phosphoimager analysis and normalized to the
GAPDH signal and expressed relative to mock control.
[0077] FIG. 7 shows the Northern blot analysis of the
MyoD-transformed myoblasts treated with oligonucleotide PS58 (20
and 200 nM). The results demonstrate an effective complete
inhibition of the disease-causing hDMPK (CUG)1500 RNA transcript,
while the smaller normal hDMPK (CUG)11 RNA transcript is only
moderately affected at the two concentrations. Thus,
oligonucleotides directed to the repeat region exhibit selectivity
towards the larger repeat size (or disease causing expansion).
Example 5
FIG. 8
[0078] In this example, the DM500 immortomyoblast cell line
carrying a human DMPK gene with an approximate (CTG)500 repeat
expansion was cultured, transfected and analysed as described
before in example 1. The DM500 myotubes were treated 48 h before
harvesting with 200 nM of oligonucleotide PS58, specific to the
(CUG) repeat sequence only, oligonucleotide PS113, specific to a
sequence in exon 1, or mock control. RT-PCR analysis was performed
on hDMPK mRNA expressed in this murine cell line (for primers see
example 1) and on three other gene transcripts with a naturally
occurring (CUG) repeat in mice, Ptbp1 with a (CUG)6, Syndecan3 with
a (CUG)6 and Taxilinbeta with a (CUG)9.
[0079] The PCR primers used were for Ptbp1:
5'-TCTGTCCCTAATGTCCATGG-3' and 5'-GCCATCTGCACAAGTGCGT-3'; for
Syndecan3: 5'-GCTGTTGCTGCCACCGCT-3' and 5'-GGCGCCTCGGGAGTGCTA-3';
and for Taxilinbeta: 5'-CTCAGCCCTGCTGCCTGT-3' and
5'-CAGACCCATACGTGCTTATG-3'. The PCR products were run on an agarose
gel and signals were quantified using the Labworks 4.0 program (UVP
BioImaging systems, Cambridge, United Kingdom). The intensity of
each signal was normalized to the corresponding actin signal and
expressed relative to mock control.
[0080] FIG. 8 shows the RT-PCR results with a maximal inhibition of
hDMPK mRNA expression by PS58. The other gene transcripts carrying
a naturally occurring small (CUG) repeat were not or only
marginally affected by the oligonucleotide PS58, specific to the
(CUG) repeat, compared to oligonucleotide PS113, which has no
complementary sequence to these gene transcripts.
[0081] This example confirms the selectivity of an oligonucleotide,
directed solely to the repeat region, towards the long repeat size
(or disease causing expansion) compared to naturally occurring
shorter repeat sizes.
Example 6
FIGS. 9 and 10
[0082] In this example, the DM500 immortomyoblast cell line
carrying a human DMPK gene with an approximate (CTG)500 repeat
expansion was cultured and transfected with PS58 (200 nM). Here,
FISH analysis was carried out on the cells. Fourty eight hours
after the start of the treatment, the cells were fixed with 4%
formaldehyde, 5 mM MgCl.sub.2 and 1.times.PBS for 30 minutes.
Hybridization with fluorescently labeled oligonucleotide
Cy3-(CAG)10-Cy3 was performed overnight at 37.degree. C. in a humid
chamber. After hybridization the material was washed and mounted in
mowiol and allowed to dry overnight. Nuclear inclusions
(ribonuclear foci) were visualized using a Bio-Rad MRC1024 confocal
laser scanning microscope and LaserSharp2000 acquisition software.
In total 50 cells were counted and scored for the presence of
inclusions in the nuclei of these cells.
[0083] Literature indicates that DMPK mRNA containing a (CUG)
expanded repeat accumulates and aggregates in the nucleus to form
ribonuclear foci with regulatory nuclear proteins and transcription
factors. Therefore, normal nuclear gene processing and cell
function gets impaired.
[0084] FIG. 9 shows a mock treated cell containing ribonuclear
inclusions in the nucleus, while these are no longer present in the
cell nucleus after treatment with PS58. FIG. 10 shows that the
percentage of nuclei containing ribonuclear foci seen under control
conditions in DM500 myotubes is strongly decreased by the treatment
with PS58. This result demonstrates that inhibition of hDMPK mRNA
expression also inhibits the disease related triplet repeat (CUG)
rich inclusions.
Example 7
FIG. 11
[0085] Here, the effect of PS58 was evaluated in vivo in DM500 mice
containing hDMPK with a (CTG)n expansion of approximately 500
triplets. The DM500 mice were derived by somatic expansion from the
DM300 mouse (e.g. see Gomes-Pereira M et al (2007) PLoS Genet. 2007
3(4): e52). A (CTG) triplet repeat expansion of approximately 500
was confirmed by southern blot and PCR analysis.
[0086] In short, PS58 was mixed with transfection agent ExGen 500
(Fermentas) according to the accompanying instructions for in vivo
use. PS58 (2 nmol, in the transfection solution with Exgen 500) was
injected (40 .mu.l) in the GPS complex of one-year-old DM500 mice
and this procedure was repeated after 24 h. As a control, DM500
mice were treated similarly with the transfection solution without
PS58. After 15 days, the mice were sacrificed, muscles were
isolated and total RNA was isolated from the tissues (using Trizol,
Invitrogen). RT-PCR analysis was performed to detect hDMPK mRNA in
the muscle similar as described above. The intensity of each band
was performed using the Labworks 4.0 program (UVP BioImaging
systems, Cambridge, United Kingdom) and normalized to the intensity
of the corresponding actin band. Primer location is indicated in
the figure.
[0087] FIG. 11 shows that in vivo treatment of DM500 mice with PS58
strongly reduced the presence of hDMPK mRNA containing a (CUG)n
repeat expansion compared to mock treatment in the M. plantaris and
M. gastrocnemius.
Example 8
FIG. 12
[0088] In this example, different oligonucleotides (in length and
backbone chemistry) but all with a sequence directed solely to the
(CTG)n repeat expansion were compared. DM500 myotubes were
cultured, transfected and analysed as described above in example 1.
Northern blots were quantified by phosphoimager analysis and DMPK
signals were normalized to GAPDH.
[0089] Here, the DM500 myotubes were treated with the following
oligonucleotides (200 nM), all with a complete phosphorothioate
backbone (see Table 3).
[0090] FIG. 12 shows that treatment of the DM500 myotubes results
in a complete reduction of (CUG)n expanded hDMPK mRNA for all
oligonucleotides tested. Under the present conditions, the maximal
effect obtainable is independent of oligonucleotide length,
backbone modification or potential mechanism of inhibition by the
employed single stranded oligonucleotides.
Example 9
[0091] Fibroblasts (GM 00305) from a male patient with Huntington's
Disease were obtained from Coriell Cell Repository (Camden, N.J.,
US) and cultured according to the accompanying instructions and
standard techniques known to the skilled person in the art.
Huntington patients carry one healthy and one disease-causing
allele of the Huntington gene resulting in the expression of both
mRNAs with respectively a normal number and an expanded number of
(CAG) repeats, respectively.
[0092] The fibroblasts were transfected with a 21-mer 2'O-methyl
phosphorothioate RNA antisense oligonucleotide PS57 with a (CUG)7
sequence, complementary to the (CAG) triplet repeat in Huntington
mRNA. Transfection occurred at 100 or 200 nM in the presence of PEI
as indicated by the manufacturer. Twenty four hours after
transfection the cells were harvested and total RNA was isolated
and analysed by RT-PCR. The Huntington transcript was determined
using primers in downstream exon 64 (5' GAAAG TCAGT CCGGG TAGAA
CTTC 3' and 5' CAGAT ACCCG CTCCA TAGCA A 3'). This method detects
both types of Huntington mRNAs, the normal and mutant transcript
with the additional (CAG) expansion. GAPDH mRNA (housekeeping gene)
was also determined. The signals were quantified and the total
amount of Huntington mRNA was normalised to the amount of GAPDH
mRNA in the same sample. The results are expressed relative to a
control treated (without oligonucleotide) sample from fibroblasts
(which was to 100%).
[0093] In the samples from fibroblasts transfected with either 100
or 200 .mu.M of PS57, significantly lower levels of total
Huntington mRNA levels were observed of approximately 53% and 66%
compared to the levels in control-treated cells, respectively.
[0094] Thus, PS57, an oligonucleotide directed only to the (CAG)
repeat, induces a decrease in Huntington mRNA levels and these
results are consistent with a selective inhibition of mutant over
normal Huntington mRNA.
TABLE-US-00001 TABLE 1 Overview oligonucleotides tested Oligo name
Modification Sequence Position PS40 2'OMe RNA phosphorothioate/FAM
GAGGGGCGUCCAGGGAUCCG intron 14-exon 15 PS41 2'OMe RNA
phosphorothioate GCGUCCAGGGAUCCGGACCG intron 14-exon 15 PS42 2'OMe
RNA phosphorothioate CAGGGAUCCGGACCGGAUAG intron 14-exon 15 PS56
DNA CAGCAGCAGCAGCAGCAGCAG repeat in exon 15 PS58 2'OMe RNA
phosphorothioate/FAM CAGCAGCAGCAGCAGCAGCAG repeat in exon 15 PS59
2'OMe RNA phosphorothioate UGAGUUGGCCGGCGUGGGCC ESE exon 15 PS60
2'OMe RNA phosphorothioate UUCUAGGGUUCAGGGAGCGCGG ESE exon 15 PS61
2'OMe RNA phosphorothioate ACUGGAGCUGGGCGGAGACCC ESE exon 15 PS62
2'OMe RNA phosphorothioate CUCCCCGGCCGCUAGGGGGC ESE exon 15 PS113
DNA phosphothioroate GAGCCGCCTCAGCCGCACCTC Exon 1 PS114 DNA
phosphothioroate GAAGTCGGCCACGTACTTGTC Exon 1 P8115 DNA
phosphothioroate GGAGTCGAAGACAGTTCTAGG Exon 15 PS116 DNA
phosphothioroate GGTACACAGGACTGGAGCTGG Exon 15
TABLE-US-00002 TABLE 2 Reduction of hDMPK mRNA after oligo
transfection: Oligo Reduction hDMPK mRNA SEQ ID No.'s PS40 + 1 PS41
- 2 PS42 - 3 PS59 - 4 PS60 - 5 PS61 +/- 6 PS62 - 7 PS58 ++++ 8 PS56
- 9 PS113 - 10 PS114 - 11 PS115 +/- 12 PS116 + 13 (-) indicates no
reduction, (+) indicates level of reduction in hDMPK mRNA.
TABLE-US-00003 TABLE 3 Oligonucleotides used in example 9 RNAse H
breakdown # Length (CAG)n Substitution ribose possible PS58 21-mer
n = 7 2'O-Methyl No PS146 30-mer n = 10 2'O-Methyl No PS147 15-mer
n = 5 2'O-Methyl No PS142 21-mer n = 7 Deoxyribose (DNA) Yes *all
oligonucleotides full length phosphorothioate and substitution
Sequence CWU 1
1
34120RNAUnknownchemically synthesized oligonucleotide PS40
1gaggggcguc cagggauccg 20220RNAUnknownchemically synthesized
oligonucleotide PS41 2gcguccaggg auccggaccg
20320RNAUnknownchemically synthesized oligonucleotide PS42
3cagggauccg gaccggauag 20421DNAUnknownchemically synthesized
oligonucleotide PS56 4cagcagcagc agcagcagca g
21521RNAUnknownchemically synthesized oligonucleotide PS57
5cugcugcugc ugcugcugcu g 21621RNAUnknownchemically synthesized
oligonucleotide PS58 6cagcagcagc agcagcagca g
21720RNAUnknownchemically synthesized oligonucleotide PS59
7ugaguuggcc ggcgugggcc 20822RNAUnknownchemically synthesized
oligonucleotide PS60 8uucuaggguu cagggagcgc gg
22921RNAUnknownchemically synthesized oligonucleotide PS61
9acuggagcug ggcggagacc c 211020RNAUnknownchemically synthesized
oligonucleotide PS62 10cuccccggcc gcuagggggc
201121DNAUnknownchemically synthesized oligonucleotide PS113
11gagccgcctc agccgcacct c 211221DNAUnknownchemically synthesized
oligonucleotide PS114 12gaagtcggcc acgtacttgt c
211321DNAUnknownchemically synthesized oligonucleotide PS115
13ggagtcgaag acagttctag g 211421DNAUnknownchemically synthesized
oligonucleotide PS116 14ggtacacagg actggagctg g
211521DNAUnknownchemically synthesized oligonucleotide PS142
15cagcagcagc agcagcagca g 211630RNAUnknownchemically synthesized
oligonucleotide PS146 16cagcagcagc agcagcagca gcagcagcag
301715RNAUnknownchemically synthesized oligonucleotide PS147
17cagcagcagc agcag 151812RNAUnknownchemically synthesized
oligonucleotide (CAG)n 18cagcagcagc ag 121912RNAUnknownchemically
synthesized oligonucleotide (GCG)n 19gcggcggcgg cg
122012RNAUnknownchemically synthesized oligonucleotide (CUG)n
20cugcugcugc ug 122112RNAUnknownchemically synthesized
oligonucleotide (CGG)n 21cggcggcggc gg 122212RNAUnknownchemically
synthesized oligonucleotide (CCUG)n 22ccugccugcc ug
122318DNAArtificialprimer 1 hDMPK 23gggggatcac agaccatt
182421DNAArtificialprimer 2 hDMPK 24tcaatgcatc caaaacgtgg a
212519DNAArtificialActin sense primer 25gctaygagct gcctgacgg
192617DNAArtificialactin antisense primer 26gaggccagga tggagcc
172720DNAArtificialprimer 1 Ptbp1 27tctgtcccta atgtccatgg
202819DNAArtificialprimer 2 Ptbp1 28gccatctgca caagtgcgt
192918DNAArtificialprimer 1 Syndecan3 29gctgttgctg ccaccgct
183018DNAArtificialprimer 2 Syndecan3 30ggcgcctcgg gagtgcta
183118DNAArtificialprimer 1 Taxilinbeta 31ctcagccctg ctgcctgt
183220DNAArtificialprimer 2 Taxilinbeta 32cagacccata cgtgcttatg
203324DNAArtificialprimer 1 Huntington 33gaaagtcagt ccgggtagaa cttc
243421DNAArtificialprimer 2 Huntington 34cagatacccg ctccatagca a
21
* * * * *