U.S. patent application number 12/685544 was filed with the patent office on 2010-07-22 for dual charging system for selectively introducing non-native amino acids into proteins using an in vitro synthesis method.
This patent application is currently assigned to Sutro Biopharma, Inc.. Invention is credited to Daniel Gold, Christopher James Murray, James Edward Rozzelle, Nathan Uter, Alexei M. Voloshin, Gang Yin, James F. Zawada.
Application Number | 20100184134 12/685544 |
Document ID | / |
Family ID | 42316861 |
Filed Date | 2010-07-22 |
United States Patent
Application |
20100184134 |
Kind Code |
A1 |
Voloshin; Alexei M. ; et
al. |
July 22, 2010 |
DUAL CHARGING SYSTEM FOR SELECTIVELY INTRODUCING NON-NATIVE AMINO
ACIDS INTO PROTEINS USING AN IN VITRO SYNTHESIS METHOD
Abstract
This invention provides for a novel means of incorporating
non-native amino acids into preselected positions of a protein
using a cell-free synthesis system. The methods involve the use of
non-orthogonal, native isoaccepting sense tRNAs that are encoded by
the genetic code. Such methods allow for numerous non-native amino
acids to be incorporated through the use of sense codons without
having to rely upon orthogonal tRNA-synthetase pairs.
Inventors: |
Voloshin; Alexei M.; (South
San Francisco, CA) ; Zawada; James F.; (South San
Francisco, CA) ; Gold; Daniel; (South San Francisco,
CA) ; Murray; Christopher James; (Soquel, CA)
; Rozzelle; James Edward; (San Francisco, CA) ;
Uter; Nathan; (South San Francisco, CA) ; Yin;
Gang; (South San Francisco, CA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER, EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
Sutro Biopharma, Inc.
South San Francisco
CA
|
Family ID: |
42316861 |
Appl. No.: |
12/685544 |
Filed: |
January 11, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61144083 |
Jan 12, 2009 |
|
|
|
61144097 |
Jan 12, 2009 |
|
|
|
61144030 |
Jan 12, 2009 |
|
|
|
Current U.S.
Class: |
435/68.1 |
Current CPC
Class: |
C12P 21/02 20130101;
C07K 1/02 20130101 |
Class at
Publication: |
435/68.1 |
International
Class: |
C12P 21/06 20060101
C12P021/06 |
Claims
1. An in vitro method of introducing non-native amino acids into
pre-selected positions of a polypeptide using a cell-free synthesis
system, the method comprising the steps of: a) Obtaining a nucleic
acid template comprising degenerate sense codons where a first
sense codon and a second sense codon correspond to a same native
amino acid but differ in their respective nucleotide sequence; b)
Generating a cell lysate; c) Preventing an endogenous native amino
acid from incorporating into a growing polypeptide chain at
positions corresponding to the first and second sense codons; d)
Adding a first catalytic aminoacylating agent to a first reaction
vessel containing a charging reaction mixture including an amino
acid and a first isoaccepting sense tRNA said first isoaccepting
sense tRNA recognizing the first sense codon; e) Aminoacylating the
first isoaccepting sense tRNA with the amino acid to yield a
tRNA:amino acid charged moiety; f) Adding a second catalytic
aminoacylating agent to a second reaction vessel containing a
charging reaction mixture including a non-native amino acid and a
second isoaccepting sense tRNA said second isoaccepting sense tRNA
recognizing the second sense codon; g) Aminoacylating the second
isoaccepting sense tRNA with the non-native amino acid to yield a
tRNA:non-native amino acid charged moiety; h) Combining the cell
lysate with: 1) the tRNA:amino acid charged moiety; 2) the
tRNA:non-native amino acid charged moiety; and, 3) the nucleic acid
template comprising the first and second codons under conditions
appropriate to generate a polypeptide from the template; and; i)
Permitting the reaction to generate the polypeptide bearing
non-native amino acids in those positions corresponding to the
second sense codons of the template.
2. The method of claim 1, wherein the endogenous native amino acid
is prevented from incorporating into a growing polypeptide chain at
positions corresponding to the first and second sense codons by
depleting the native aminoacyl-tRNA synthetase that aminoacylates
the endogenous native amino acid.
3. The method of claim 1, wherein one or both of the catalytic
aminoacylating agents are aminoacyl-tRNA synthetases.
4. The method of claim 3, wherein the aminoacyl-tRNA synthetases
are removed from the charging reaction mixture prior to combining
the tRNA:amino acid charged moiety and tRNA:non-native amino acid
charged moiety with the cell lysate.
5. The method of claim 1, wherein one or both of the catalytic
aminoacylating agents are ribozymes.
6. The method of claim 1, wherein the cell population is a
population of bacterial cells.
7. The method of claim 6, wherein the bacterial cells are
Escherichia coli.
8. The method of claim 7, wherein the cells are depleted for
arginine decarboxylase.
9. The method of claim 1, wherein the cell population are rabbit
reticulocytes.
10. The method of claim 1, wherein the cell lysate exhibits active
oxidation phosphorylation during protein synthesis.
11. The method of claim 2 further comprising the steps of: a)
transforming the cells used to generate the cell lysate with a gene
wherein said gene expresses an aminoacyl-tRNA synthetase fused to a
capture moiety that is capable of functionally replacing the native
aminoacyl-tRNA synthetase; b) altering said cells to inhibit
expression of the native aminoacyl-tRNA synthetase gene; and c)
depleting the cell lysate of the aminoacyl-tRNA synthetase fused to
the capture moiety.
12. The method of claim 11 further comprising the step of depleting
the aminoacyl-tRNA synthetase fused to a capture moiety by affinity
chromatography.
13. The method of claim 12, wherein the affinity chromatography is
immunoaffinity chromatography.
14. The method of claim 11, wherein the aminoacyl-tRNA synthetase
fused to a capture moiety is heterologous to the cells forming the
cell lysate.
15. The method of claim 11, wherein the aminoacyl-tRNA synthetase
fused to a capture moiety is depleted by immunoprecipitation using
an antibody that recognizes the capture moiety.
16. The method of claim 2 further comprising the steps of: a)
transforming the cells used to generate the cell lysate with a gene
wherein said gene expresses an unstable recombinant aminoacyl-tRNA
synthetase that is capable of functionally replacing the native
aminoacyl-tRNA synthetase; b) altering said cells to inhibit
expression of the native aminoacyl-tRNA synthetase gene; and c)
depleting the cell lysate of the unstable recombinant
aminoacyl-tRNA synthetase.
17. The method of claim 16, wherein the recombinant aminoacyl-tRNA
synthetase is thermally unstable.
18. The method of claim 2, wherein the cell lysate is depleted of
its native aminoacyl-tRNA synthetase by immunoaffinity
chromatography.
19. The method of claim 2, wherein the cell lysate is depleted of
its native aminoacyl-tRNA synthetase by immunoprecipitation.
20. The method of claim 2, wherein the cell lysate is depleted of
its native aminoacyl-tRNA synthetase by introducing an
aminoacyl-tRNA synthetase inhibitor specific to the native
aminoacyl-tRNA synthetase.
21. An in vitro synthesis reaction system for introducing
non-native amino acids into pre-selected positions of a protein
comprising: a) a first catalytic aminoacylating reagent reaction
vessel comprising a complete charging mixture of reagents able to
aminoacylate a first isoaccepting sense tRNA with its corresponding
amino acid to yield a tRNA:amino acid charged moiety; b) a second
catalytic aminoacylating reagent reaction vessel comprising a
complete charging mixture of reagents able to aminoacylate a second
isoaccepting sense tRNA with a non-native amino acid to yield a
tRNA:non-native amino acid charged moiety; and c) a reaction vessel
containing a cell lysate containing a mixture of reagents able to
carry out in vitro synthesis of proteins from a nucleic acid
template; where all three vessels have openings that permit the
combining of the two charging mixtures and cell lysate into a
single reaction mixture.
22. The system of claim 21, wherein the cell lysate is derived from
a bacterial population.
23. The system of claim 22, wherein the bacterial population is
Escherichia coli.
24. The system of claim 23, wherein the Escherichia coli are
depleted for arginine decarboxylase.
25. The system of claim 21, wherein the cell lysate has a
functional oxidative phosphorylation system.
26. The system of claim 21, wherein one or both of the catalytic
aminoacylating reagents are aminoacyl-tRNA synthetases.
27. The system of claim 21, wherein one or both of the catalytic
aminoacylating reagents are ribozymes.
28. A kit for the in vitro synthesis of proteins having non-native
amino acids introduced into preselected positions of the protein,
the kit comprising: a) a first catalytic aminoacylating reagent
reaction vessel comprising a complete charging mixture of reagents
able to aminoacylate a first isoaccepting sense tRNA with its
corresponding amino acid to yield a tRNA:amino acid charged moiety;
b) a second catalytic aminoacylating reagent reaction vessel
comprising a complete charging mixture of reagents able to
aminoacylate a second isoaccepting sense tRNA with a non-native
amino acid to yield a tRNA:non-native amino acid charged moiety;
and c) a reaction vessel containing a cell lysate containing a
mixture of reagents able to carry out in vitro synthesis of
proteins from a nucleic acid template.
29. The kit of claim 28, wherein the cell lysate is derived from a
bacterial population.
30. The kit of claim 29, wherein the bacterial population is
Escherichia coli.
31. The kit of claim 30, wherein the Escherichia coli are depleted
for arginine decarboxylase.
32. The kit of claim 28, wherein one or both of the catalytic
aminoacylating reagents are aminoacyl-tRNA synthetases.
33. The kit of claim 28, wherein one or both of the catalytic
aminoacylating reagents are ribozymes.
34. The kit of claim 28, wherein the cell lysate has a functional
oxidative phosphorylation system.
35. The method of claim 1, wherein the non-native amino acids are
selected from the group consisting of glycol modified amino acids,
metal-chelating groups, aryl-azide containing amino acids, and
ketone containing amino acids.
36. The method of claim 1, wherein the endogenous native amino acid
is prevented from incorporating into a growing polypeptide chain at
positions corresponding to the first and second sense codons by
inactivating both a native first isoaccepting sense tRNA that
recognizes the first sense codon and a native second isoaccepting
sense tRNA that recognizes the second sense codon.
37. The method of claim 36, wherein the native first and second
isoaccepting sense tRNAs are inactivated by adding an inactivated
aminoacyl-tRNA synthetase that selectively binds to the native
first and second isoaccepting sense tRNAs, said inactivated
synthetase having the ability to outcompete the native
aminoacyl-tRNA synthetase.
38. The method of claim 36, wherein the native first and second
isoaccepting sense tRNAs are inactivated by adding anti-sense DNA
that selectively binds to the native first and second isoaccepting
sense tRNAs.
39. The method of claim 36, wherein the native first and second
isoaccepting sense tRNAs are inactivated by adding a specific tRNA
ribonuclease or active fragments thereof that selectively cleave
the native first and second isoaccepting sense tRNAs.
40. The method of claim 39, wherein the native first and second
isoaccepting sense tRNAs are inactivated by adding colicin D or an
active fragment of colicin D.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application claims the benefit under 35 U.S.C.
.sctn.1.119(e) of U.S. Application Nos. 61/144,083, 61/144,097 and
61/144,030, all filed Jan. 12, 2009, each of which is incorporated
by reference in its entirety for all purposes.
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH OR DEVELOPMENT
[0002] NOT APPLICABLE
REFERENCE TO A "SEQUENCE LISTING," A TABLE, OR A COMPUTER PROGRAM
LISTING APPENDIX SUBMITTED ON A COMPACT DISK.
[0003] NOT APPLICABLE
BACKGROUND OF THE INVENTION
[0004] Protein synthesis is a fundamental biological process that
underlies the development of polypeptide therapeutics, vaccines,
diagnostics, and industrial enzymes. With the advent of recombinant
DNA (rDNA) technology, it has become possible to harness the
catalytic machinery of the cell to produce a desired protein. This
can be achieved within the cellular environment or in vitro using
lysates derived from cells.
[0005] Because only twenty amino acids are naturally incorporated
into proteins, limitations to the production of a desired protein
exist. For example, a peptide that is potentially useful as a
therapeutic agent may be quickly degraded or otherwise inactivated
upon administration to a patient as a result of proteases present
within the patient. Likewise, infectious agents such as bacteria or
viruses are more likely to develop resistance against peptides that
contain only naturally occurring amino acids. This occurs because
enzymes that are produced by the bacteria or virus that can
inactivate a peptide drug are more likely to inactivate a peptide
containing naturally occurring amino acids as opposed to a peptide
containing non-native amino acids. Such limitations become even
more apparent when compared with small organic molecule synthesis,
in which any structural change can be made to influence functional
properties of the compound. As a result, proteins containing
non-native amino acids are becoming more auspicious for therapeutic
uses. Furthermore, peptides containing non-native amino acids are
extremely useful for non-therapeutic research purposes, such as
uses relevant to the structural and functional probing of proteins,
construction of peptide libraries for combinatorial chemistry, and
proteomic studies.
[0006] Although the twenty naturally occurring amino acids can be
modified by post-translational modification, expanding the genetic
code to include additional non-native amino acids with novel
biological, chemical, or physical properties will increase the
utility of the protein containing such novel non-native amino
acids. Protein properties may include the size, acidity,
nucleophilicity, hydrogen-bonding, or hydrophobicity of the
protein.
[0007] Different strategies have been utilized to synthesize
peptides containing non-native amino acids. Synthetic peptide
chemistry has been used routinely for this purpose. See, e.g.,
Eckert et al., Cell 99:103-15 (1999). However, routine solid-phase
peptide synthesis is generally limited to small peptides with less
than 100 residues. With the recent development of enzymatic
ligation and native chemical ligation of peptide fragments, it is
possible to make larger proteins. However, these methods are not
easily scaled. See, e.g., Dawson and Kent, Annu Rev. Biochem.
69:923 (2000).
[0008] In vivo translation using living cells is widely used for
the efficient synthesis and post-translational modification of
proteins from a genetically encoded natural or recombinant DNA
sequence. However, folding may be inefficient if the protein is
expressed in inclusion bodies. Most importantly, such methods are
more difficult for the selective incorporation of multiple
non-native amino acids, or to control the post-translational
modification process.
[0009] In vitro, or cell-free, protein synthesis offers several
advantages over conventional in vivo protein expression methods.
Cell-free systems can direct most, if not all, of the metabolic
resources of the cell towards the exclusive production of one
protein. Moreover, the lack of a cell wall and membrane components
in vitro is advantageous since it allows for control of the
synthesis environment. For example, tRNA levels can be changed to
reflect the codon usage of genes being expressed. The redox
potential, pH, or ionic strength can also be altered with greater
flexibility than with in vivo protein synthesis because concerns of
cell growth or viability do not exist. Furthermore, direct recovery
of purified, properly folded protein products can be easily
achieved.
[0010] The productivity of cell-free systems has improved over
2-orders of magnitude in recent years, from about 5 .mu.g/ml-hr to
about 500 .mu.g/ml-hr. Such improvements have made in vitro protein
synthesis a practical technique for laboratory-scale research and
provides a platform technology for high-throughput protein
expression. It further indicates the feasibility for using
cell-free technologies as an alternative means to in vivo
large-scale, commercial production of protein pharmaceuticals.
[0011] The incorporation of non-native amino acids into proteins
remains a challenge with both in vivo and in vitro protein
synthesis systems. A major hurdle in this field of endeavor is
promoting recognition of an aminoacyl-tRNA synthetase with a
non-native amino acid. An aminoacyl-tRNA synthetase is an enzyme
that catalyzes the bond of a specific amino acid to its cognate
tRNA molecule. In most cases, each naturally occurring amino acid
has one specific aminoacyl-tRNA synthetase that will aminoacylate
that amino acid to its proper tRNA molecule, which is known as tRNA
charging. There exists relatively few aminoacyl-tRNA synthetases
considering the fact that the degeneracy of the genetic code allows
amino acids to be charged to more than one kind of tRNA molecule.
Thus, the success of incorporating non-native amino acids into
proteins depends on the recognition of the non-native amino acid by
aminoacyl-tRNA synthetases, which in general requires high
selectively to insure the fidelity of protein translation. The
fidelity of aminoacylation is maintained both at the level of
substrate discrimination and proofreading of both non-cognate
intermediates and protein products.
[0012] One strategy has been to incorporate non-native amino acids
into proteins using aminoacyl-tRNA synthetases that cannot
discriminate between non-native amino acids that are structurally
similar to their natural counterparts due to lack of proofreading
mechanisms. Because the proofreading activity of the aminoacyl-tRNA
synthetase has been disabled, structural analogs of natural amino
acids that have been misactivated may escape the editing functions
of the synthetase, and be incorporated into the growing peptide
chain as desired. See, e.g., Doring et al., Science 292:501
(2001).
[0013] A major limitation of the abovementioned strategy is that
all sites corresponding to a particular natural amino acid
throughout the protein are replaced. The extent of incorporation of
the natural and non-native amino acid may also vary because it is
difficult to completely deplete the cognate natural amino acid
inside the cell. Another limitation is that these strategies make
it difficult to study the mutant protein in living cells because
the multi-site incorporation of analogs often results in toxicity.
Finally, this method is applicable in general only to close
structural analogs of the common amino acids, again because
substitutions must be tolerated at all sites in the genome.
[0014] More recently, orthogonal tRNAs and corresponding orthogonal
aminoacyl-tRNA synthetases that charge the orthogonal tRNA with the
desired non-native amino acid has been used as a strategy to
overcome previous limitations. An orthogonal tRNA is a tRNA that
base pairs with a codon that is not normally associated with an
amino acid such as a stop codon or 4 base pair codon, etc.
Importantly, orthogonal components do not cross-react with any of
the endogenous tRNAs, aminoacyl-tRNA synthetases, amino acids, or
codons in the host organism.
[0015] A commonly used orthogonal system for the incorporation of
non-native amino acids is the amber suppressor orthogonal tRNA.
Using this system, a suppressor tRNA is prepared that recognizes
the stop codon UAG and is chemically aminoacylated with a
non-native amino acid. Conventional site-directed mutagenesis is
used to introduce the stop codon TAG at the site of interest in the
protein gene. When the aminoacylated suppressor tRNA and the mutant
gene are combined in an in vitro transcription/translation system,
the non-native amino acid is incorporated in response to the UAG
codon which gives a protein containing the non-native amino acid at
the specified position. See, e.g., Sayers et al., Nucleic Acids
Res. 16:791-802 (1988). Evidence has shown that the desired
non-native amino acid is incorporated at the position specified by
the UAG codon and that the non-native amino acid is not
incorporated at any other site in the protein. See, e.g., Noren et
al., Science 244:182-88 (1989); Ellman et al., Science 255: 197-200
(1992). For additional discussion of orthogonal translation systems
that incorporate non-native amino acids, and methods for their
production and use, see also Wang and Schultz, Chem. Commun. 1:1-11
(2002); Xie and Schultz, Methods 36:227-38 (2005); Xie and Schultz,
Curr. Opinion in Chemical Biology 9:548-554 (2005); Wang et al.,
Annu Rev. Biophys. Biomol. Struct. 35:225-49 (2006); and Xie and
Schultz, Nat. Rev. Mol. Cell Biol. 7:775-82 (2006).
[0016] However, the incorporation of non-native amino acids using
orthogonal components suffers from much lower yields because it
relies on inherently inefficient suppressor tRNAs competing with
termination factors. In addition, the use of orthogonal components
for incorporation of non-native amino acids has been restricted to
selective incorporation of only a single non-native amino acid per
protein at only one of the three nonsense termination codons (the
UAG amber stop codon) because of competition at amino acid sense
codons from natural amino acids catalyzed by the tRNA charging and
proofreading activities of the twenty different aminoacyl-tRNA
synthetases, and because attempts to use a second termination codon
(UGA) often fails due to read through by the ribosome. See, e.g.,
Cload et al., Chem. and Biol. 3:1033-38 (1996).
[0017] While some attempts have been made to incorporate non-native
amino acids into proteins using tRNAs that recognize sense codons,
such attempts have been made using a pure reconstituted in vitro
translation system. See Tan et al., Methods 36:279-90 (2005);
Forster et al., U.S. Pat. No. 6,977,150. However, such pure
reconstituted translation systems require purified translational
components, which is impractical outside of the context of
research, very expensive, and not shown to be highly efficient.
[0018] There exists a need in the art for incorporating non-native
amino acids into a growing polypeptide chain, where orthogonal
tRNA/aminoacyl-tRNA synthetase pairs can be avoided, where native
isoaccepting tRNAs aminoacylated with non-native amino acids
recognize sense codons and subsequently incorporate the non-native
amino acid into a growing polypeptide chain at a position defined
by the sense codon, where numerous non-native amino acids can be
incorporated at defined positions, and where a crude cell-free
protein synthesis system can be used that avoids the
impracticality, expense, and inefficiency of a pure reconstituted
in vitro translation system. The invention described herein
fulfills these and other needs, as will be apparent upon review of
the following disclosure.
BRIEF SUMMARY OF THE INVENTION
[0019] This invention discloses a method for introducing non-native
amino acids into pre-selected positions of a protein using a
cell-free synthesis system comprising the steps of 1) obtaining a
nucleic acid template comprising degenerate sense codons, 2) lysing
a cell population to yield a cell lysate, 3) aminoacylating a first
and second isoaccepting sense tRNA in separate tRNA charging
reactions, said first isoaccepting sense tRNA charged with an amino
acid and said second isoaccepting sense tRNA charged with a
non-native amino acid, 4) adding the first and second isoaccepting
sense tRNAs charged with their respective amino acids and the
nucleic acid template to the cell lysate and permitting the
reaction to generate a protein bearing non-native amino acids in
positions corresponding to the second sense codons of the
template.
[0020] More specifically, this invention is an in vitro method of
introducing non-native amino acids into pre-selected positions of a
protein using a cell-free synthesis system, the method comprising
the steps of:
[0021] a) Obtaining a nucleic acid template comprising degenerate
sense codons where a first sense codon and a second sense codon
correspond to a same native amino acid but differ in their
respective nucleotide sequence;
[0022] b) Generating a cell lysate;
[0023] c) Preventing an endogenous native amino acid from
incorporating into a growing polypeptide chain at positions
corresponding to the first and second sense codons;
[0024] d) Adding a first catalytic aminoacylating agent to a first
reaction vessel containing a charging reaction mixture including an
amino acid and a first isoaccepting sense tRNA said first
isoaccepting sense tRNA recognizing the first sense codon;
[0025] e) Aminoacylating the first isoaccepting sense tRNA with the
amino acid to yield a tRNA:amino acid charged moiety;
[0026] f) Adding a second catalytic aminoacylating agent to a
second reaction vessel containing a charging reaction mixture
including a non-native amino acid and a second isoaccepting sense
tRNA said second isoaccepting sense tRNA recognizing the second
sense codon;
[0027] g) Aminoacylating the second isoaccepting sense tRNA with
the non-native amino acid to yield a tRNA:non-native amino acid
charged moiety;
[0028] h) Combining the cell lysate with: [0029] 1) the tRNA:amino
acid charged moiety; [0030] 2) the tRNA:non-native amino acid
charged moiety; and, [0031] 3) the nucleic acid template comprising
the first and second codons under conditions appropriate to
generate a polypeptide from the template; and;
[0032] i) Permitting the reaction to generate the polypeptide
bearing non-native amino acids in those positions corresponding to
the second sense codons of the template.
[0033] An endogenous native amino acid can be prevented from being
incorporated into the desired polypeptide chain at positions
corresponding to the first and second sense codons by depleting the
native aminoacyl-tRNA synthetase that aminoacylates the endogenous
native amino acid.
[0034] The endogenous native amino acid can also be prevented from
incorporating into a growing polypeptide chain at positions
corresponding to the first and second sense codons by inactivating
both a native first isoaccepting sense tRNA that recognizes the
first sense codon and a native second isoaccepting sense tRNA that
recognizes the second sense codon. This may be accomplished by
adding an inactivated aminoacyl-tRNA synthetase that selectively
binds to the native first and second isoaccepting sense tRNAs, said
inactivated synthetase having the ability to outcompete the native
aminoacyl-tRNA synthetase. This may also be accomplished by adding
anti-sense DNA that selectively binds to the native first and
second isoaccepting sense tRNAs. In some embodiments, the first and
second isoaccepting sense tRNAs are inactivated by adding a
specific tRNA ribonuclease or active fragments thereof that
selectively cleave the native first and second isoaccepting sense
tRNAs. In some embodiments, the first and second isoaccepting sense
tRNAs are inactivated by adding colicin D or an active fragment of
colicin D.
[0035] The above-described method can be performed wherein one or
both of the catalytic aminoacylating agents are aminoacyl-tRNA
synthetases. When the catalytic aminoacylating agents are
aminoacyl-tRNA synthetases, said aminoacyl-tRNA synthetases are
removed from the reaction vessel of the tRNA charging reaction
prior to combining the tRNA:amino acid charged moiety and
tRNA:non-native amino acid charged moiety with the cell lysate. The
catalytic aminoacylating agents can also be ribosomes. The
above-described method may use a cell population comprises
bacterial cells, preferably E. coli cells. The cell population may
be depleted for arginine decarboxylase. The cell population
comprise rabbit reticulocytes. The above-described method may also
utilize a cell lysate that exhibits active oxidation
phosphorylation during protein synthesis.
[0036] In a related method of this invention, the cell lysate is
depleted of the native aminoacyl-tRNA synthetase by genetically
altering the cells prior to lysing where the alteration replaces
the gene encoding the native aminoacyl-tRNA synthetase with a gene
encoding an aminoacyl-tRNA synthetase fused to a capture moiety.
The native aminoacyl-tRNA synthetase tagged with a capture moiety
may be heterologous to the host cell population. The
above-described method may comprise the step of capturing the
native aminoacyl-tRNA synthetase fused to a capture moiety by
affinity chromatography. The affinity chromatography method may be
immunoaffinity chromatography. The capturing of the native
aminoacyl-tRNA synthetase fused to a capture moiety may occur by
immunoprecipitation using an antibody that recognizes the capture
moiety.
[0037] In a related system, this invention is a cell-free synthesis
reaction system for introducing non-native amino acids into
preselected positions of a protein comprising: [0038] a) a first
catalytic aminoacylating reagent reaction vessel comprising a
complete charging mixture of reagents able to aminoacylate a first
isoaccepting sense tRNA with its corresponding amino acid to yield
a tRNA:amino acid charged moiety; [0039] b) a second catalytic
aminoacylating reagent reaction vessel comprising a complete
charging mixture of reagents able to aminoacylate a second
isoaccepting sense tRNA with a non-native amino acid to yield a
tRNA:non-native amino acid charged moiety; and [0040] c) a reaction
vessel containing a cell lysate containing a mixture of reagents
able to carry out in vitro synthesis of proteins from a nucleic
acid template;
[0041] where all three vessels have openings that permit the
combining of the two charging mixtures and cell lysate into a
single reaction mixture. The above mentioned system may be used
with cells derived from a bacterial population, preferably a
bacterial population of E. coli cells. The system is optionally
practiced using E. coli cells depleted of arginine decarboxylase.
The system is further optionally practiced wherein the cell lysate
has a functional oxidative phosphorylation system. The system
described herein can be used where one or both of the catalytic
aminoacylating reagents are either aminoacyl-tRNA synthetase or
ribozymes.
[0042] The invention further provides a kit for the in vitro
synthesis of proteins having non-native amino acids introduced into
preselected positions of the protein, the kit comprising: [0043] a)
a first catalytic aminoacylating reagent reaction vessel comprising
a complete charging mixture of reagents able to aminoacylate a
first isoaccepting sense tRNA with its corresponding amino acid to
yield a tRNA:amino acid charged moiety; [0044] b) a second
catalytic aminoacylating reagent reaction vessel comprising a
complete charging mixture of reagents able to aminoacylate a second
isoaccepting sense tRNA with a non-native amino acid to yield a
tRNA:non-native amino acid charged moiety; and [0045] c) a reaction
vessel containing a cell lysate containing a mixture of reagents
able to carry out in vitro synthesis of proteins from a nucleic
acid template.
[0046] The above mentioned kit may be used with cells derived from
a bacterial population, preferably a bacterial population of E.
coli cells. The kit is optionally practiced using E. coli cells
depleted of arginine decarboxylase. The kit is further optionally
practiced wherein the cell lysate has a functional oxidative
phosphorylation system. The kit described herein can be used where
one or both of the catalystic aminoacylating reagents are either
aminoacyl-tRNA synthetase or ribozymes.
BRIEF DESCRIPTION OF THE DRAWINGS
[0047] FIG. 1 shows (a) the tRNA.sub.GAA.sup.Phe HDV ribozyme
plasmid DNA template used for in vitro transcription, (b) a
fragment of the DNA template detailing the orientation of the T7
promotor, tRNA.sub.GAA.sup.Phe coding sequence fused to the
hepatitis delta virus (HDV) ribozyme sequence, and (c) the
resulting E. coli isoaccepting tRNA.sub.GAA.sup.Phe transcript
secondary structure with the anticodon sequence GAA in red, where
the subscript denotes the corresponding anticodon sequence.
[0048] FIG. 2 shows the process flow diagram illustrating the steps
required to generate novel nnAA-tRNAs including (a) in vitro
transcription of tRNA-HDV ribozyme DNA template (b) isolation of
tRNA 2,3'-cyclic phosphate by size exclusion chromatography, (c)
enzymatic hydrolysis of tRNA 2,3'-cyclic phosphate using T4
polynucleotide kinase (PNK) and, (d) aminoacylation of engineered
isoaccepting tRNAs with nnAAs catalyzed by engineered amino acid
tRNA synthetase (aaRS) enzymes.
[0049] FIG. 3 shows TBE/UREA gels for protocols 1-4 used for
optimization of in vitro transcription of two different engineered
E. coli tRNA.sub.CUC.sub.Glu constructs. Both constructs are
mutated at U34C to produce a CUC anticodon; the rightmost construct
contains additional noted mutations that should theoretically
increase transcription yield.
[0050] FIG. 4 shows TBE/UREA gels of in vitro transcription
protocols 1-4 for two different engineered tRNA.sub.UUG.sup.Gln
constructs from E. coli and H. pylori, respectively.
[0051] FIG. 5 shows (a) an illustration of the Hepatitis Delta
Virus (HDV) consensus sequence used for generating 3' homogeneous
tRNA. The autocatalytic ribozyme cleaves at the 3' end of the tRNA
leaving a 2',3'-cyclic phosphate that is subsequently removed
before aminoacylation. (b) Size exclusion chromatographic
separation of the transcription product illustrating separation of
the 73 nucleotide tRNA 2',3'-cyclic phosphate product from the
self-cleaved HDV ribozyme.
[0052] FIG. 6 shows the effect of various additives on RNA
stability.
[0053] FIG. 7 shows the time dependence of the dephosphorylation of
tRNA 2'-3'-cyclic phosphate by PNK treatment as measured by (a)
separation of reactant and product using acid/urea gel
electrophoresis or (b) using a malachite green phosphate release
assay.
[0054] FIG. 8 shows IMAC purification profiles of (a) E coli GluRS
6XHis and (b) H pylori GluRS2 (ND) enzymes used for charging tRNA
with non-native amino acids (nnAA).
[0055] FIG. 9 shows (a) the dimeric structure of the homologous T.
thermophilus PheRS illustrating the amino acid recognition site
containing A294G and the anti-codon recognition site. (b) IMAC
purification profile of cell-free produced PheRS(A294G) showing
pull-down of the dimeric complex by the 6X His-tagged PheS(A294G)
domain.
[0056] FIG. 10 shows the purification of several PheRS(A294G,
A794X) variants produced by cell-free protein synthesis.
[0057] FIG. 11 shows percent Phe aminoacylation analysis of
[.sup.30-32Phe-tRNA.sup.Phe catalyzed by PheRS(A294G) for 30 min.
(a) P1 nuclease digestion of (b) Phe-tRNA.sub.AAA.sup.Phe,
Phe-tRNA.sub.CUA.sup.Phe, or Phe-tRNA.sub.GAA.sup.Phe results in
[.sup.32P]Phe-AMP that can be separated from free [.sup.32P]AMP on
PEI cellulose TLC plates and imaged using autoradiography.
[0058] FIG. 12 shows percent para-acetyl Phe (pAF) aminoacylation
analysis of pAF-tRNA.sup.Phe variants catalyzed by PheRS(A294G)
under various conditions as measured by autoradiography using a
end-labeled [.sup.32P]-3' tRNA.
[0059] FIG. 13 shows the time dependence of the formation of (a)
pAF-tRNA.sub.CUA.sup.Phe and (b) pAF-tRNA.sub.AAA.sup.Phe as
measured by autoradiography.
[0060] FIG. 14 shows that (a) E. coli GluRS can robustly
aminoacylate tRNA.sub.CUC.sup.Glu with cognate glutamate as
measured using a [.sup.32P]-3' tRNA end-labeling assay under
optimized conditions. Mono-fluoroglutamate (F-Glu) AMP is not
separated from [.sup.32P]-AMP under these chromatographic
conditions. (b) H. pylori GluRS2(ND) can aminoacylate H. pylori
tRNA.sub.CUC.sup.Glu with Glu and F-Glu, although F-Glu AMP is not
separated from AMP under these chromatographic conditions.
[0061] FIG. 15 shows (a) the separation of aminoacylated
pAF-tRNA.sub.GAA.sup.Phe from tRNA.sub.GAA.sup.Phe using
hydrophobic interaction chromatography, and (b) the chromatographic
mobility of aminoacylated pAF-tRNA.sub.GAA.sup.Phe,
tRNA.sub.GAA.sup.Phe, and tRNA.sub.GAA.sup.Phe2',3' cyclic
phosphate by acid-urea gel electrophoresis.
[0062] FIG. 16 shows (a) the separation of aminoacylated
pAF-tRNA.sub.CUA.sup.Phe from tRNA.sub.CUA.sup.Phe and (b)
pAF-tRNA.sub.AAA.sup.Phe from tRNA.sub.AAA.sup.Phe using
hydrophobic interaction chromatography.
[0063] FIG. 17 shows that (a) Wild type E. coli tRNA.sup.Glu and
(b) in vitro transcribed E coli tRNA.sub.CUC.sup.Glu can be
robustly charged with mono-fluoroglutamate as determined by
acid/urea gel electrophoresis.
[0064] FIG. 18 shows cell-free synthesis yields of GMCSF as
function of the concentration of added lysine, phenylalanine, or
glutamic acid to the extract.
[0065] FIG. 19 shows (a) a diagram of the species involved in
non-native amino acid incorporation into fluorescent turboGFP in
the cell-free synthesis reaction, including background recharging
of engineered isoaccepting tRNA by endogenous E coli PheRS, (b) the
chemical structure of an active-site directed inhibitor of PheRS,
5'-O-[N-(Phenylalanyl) sulfamoyl] adenosine, Phe-SA, and (c) the
determination of IC.sub.50 for inhibition of the rate of cell-free
synthesis of turboGFP as a function of added inhibitors Phe-SA
(IC.sub.50=0.8 nM) or Glu-SA (IC.sub.50=54 nM).
[0066] FIG. 20 shows a response surface describing the relationship
between added Phe amino acid and [Phe-SA] inhibitor on the rate of
turboGFP cell-free synthesis
[0067] FIG. 21 shows a schematic diagram illustrating the salient
features of dual-charging nnAA incorporation
[0068] FIG. 22 illustrates the salient features of the turboGFP
Y50TAG amber suppressor protein used to establish incorporation of
para-acetyl phenylalanine (pAF) at position 50.
[0069] FIG. 23 shows the conditions used to demonstrate
dual-charging incorporation of para-acetyl phenylalanine (pAF) into
turboGFP Y50TAG.
[0070] FIG. 24 illustrates how the removal or inhibition of PheRS
from the cell-free extract, while adding exogenously synthesized
pAF-tRNA.sub.CUA.sup.Phe and Phe-tRNA.sub.GAA.sup.Phe, can be used
to site-specifically incorporate a nnAA into a protein by
engineered ribosomal protein synthesis.
[0071] FIG. 25 is a schematic showing a cell-free protein synthesis
system as described herein. In this example, the native
aminoacyl-tRNA synthetase is depleted following cell lysis. Native
aaRS refers to the native aminoacyl-tRNA synthetase. tRNA.sub.1 and
tRNA.sub.2 refer to the first and second isoaccepting sense tRNAs,
respectively. NAA depicts a native amino acid, and nnAA depicts a
non-native amino acid.
[0072] FIG. 26 is a schematic showing an example of the two tRNA
charging reactions as described herein. In this example, the
aminoacylating reagent is an aminoacyl-tRNA synthetase, the first
isoaccepting sense tRNA is charged with the native amino acid, and
the second isoaccepting sense tRNA is charged with a non-native
amino acid. aaRS refers to an aminoacyl-tRNA synthetase. tRNA.sub.1
and tRNA.sub.2 refer to the first and second isoaccepting sense
tRNAs, respectively. NAA depicts a native amino acid, and nnAA
depicts a non-native amino acid.
DETAILED DESCRIPTION OF THE INVENTION
I. Introduction
[0073] This invention provides for a novel means of incorporating
non-native amino acids into preselected positions of a protein
using a cell-free synthesis system. The methods involve the use of
non-orthogonal, native isoaccepting sense tRNAs that are encoded by
the genetic code. Such methods allow for numerous non-native amino
acids to be incorporated through the use of sense codons without
having to rely upon orthogonal tRNA-synthetase pairs.
[0074] Important to the present invention is the utilization of
isoaccepting sense tRNAs to differentially incorporate either
native or non-native amino acids into a protein even though such
tRNAs are normally charged with the same amino acid in nature. This
invention exploits the degeneracy of the genetic code to
incorporate non-native amino acids into a growing polypeptide chain
based on an mRNA sense codon sequence without compromising the
ability to incorporative the native amino acid into the protein.
Following cell lysis, a lysate is created that contains all the
cellular components required for protein synthesis. A nucleic acid
template is then added that has sense codons specifying positions
in which the non-native amino acid will be incorporated. The
endogenous native amino acid that is coded for by the sense codons
must be prevented from being incorporated into the desired protein.
Preventing incorporation of the endogenous native amino acid is
accomplished either by depleting the native aminoacyl-tRNA
synthetase, or by inactivating the isoaccepting tRNA molecules that
function to position an amino acid within a growing polypeptide
chain based on the mRNA template sequence. The native
aminoacyl-tRNA synthetase has the ability to charge both
isoaccepting tRNAs. Thus, the native aminoacyl-tRNA synthetase must
be depleted from the lysate protein prior to the protein synthesis
reaction to prevent uncharged isoaccepting sense tRNA molecules
from being charged with the incorrect amino acid while in the
lysate, if the invention is practiced by depleting a native
aminoacyl-tRNA synthetase.
[0075] Each isoaccepting sense tRNA is separately aminoacylated in
a tRNA charging reaction. This aspect of the invention is referred
to as "dual charging" because each isoaccepting sense tRNA is
charged in a separate reaction vessel. Any method that will
aminoacylate a tRNA molecule is sufficient regardless of whether an
aminoacyl-tRNA synthetase is utilized for the separate charging
reaction. For example, either a purified ribozyme or any functional
aminoacyl-tRNA synthetase may be used to separately charge each
respective isoaccepting sense tRNA molecule. The first isoaccepting
sense tRNA is charged with any amino acid, preferably the native
amino acid. The second isoaccepting sense tRNA is charged in yet
another separate reaction with the desired non-native amino acid.
The first isoaccepting sense tRNA and second isoaccepting sense
tRNA that have been charged with their respective amino acids are
then purified from the charging reaction mixtures, which includes
isolation from any aminoacyl-tRNA synthetases that was used in the
reaction vessel. The purified isoaccepting sense tRNA molecules are
then added to the lysate in which the protein synthesis reaction
will occur to generate a desired protein containing both native and
non-native amino acids in positions specified by the different
sequences recognized by isoaccepting sense tRNAs.
[0076] The uses of proteins containing non-native amino acids
include desired changes in protein structure and/or function, which
would include changing the size, acidity, nucleophilicity, hydrogen
bonding, hydrophobicity, or accessibility of protease target sites.
Proteins that include an non-native amino acid can have enhanced or
even entirely new catalytic or physical properties such as modified
toxicity, biodistribution, structural properties, spectroscopic
properties, chemical and/or photochemical properties, catalytic
ability, serum half-life, and the ability to react with other
molecules, either covalently or non-covalently. Proteins that
include at least one non-native amino acid are useful for, but not
limited to, novel therapeutics, diagnostics, catalytic enzymes,
binding proteins, and the study of protein structure and
function.
[0077] The cell-free non-native amino acid incorporation method of
this invention is distinct from the non-native amino acid
incorporation methods previously employed in the art. Most notably,
this invention uses isoaccepting tRNAs that recognize sense codons,
which circumvents the requirement of having to utilize orthogonal
tRNAs and orthogonal aminoacyl-tRNA synthetases in order to
incorporate non-native amino acids. Using orthogonal tRNAs relies
on inherently inefficient suppressor tRNAs. This inefficiency is a
result competition at the non-orthogonal sense codons from natural
amino acids catalyzed by the tRNA charging and proofreading
activities of the twenty different aminoacyl-tRNA synthetases in
addition to inherently inefficient suppressor tRNAs competing with
termination factors. This results in selective incorporation of
only a single non-native amino acid per protein at only one of the
three termination codons: the UAG "amber" codon. Additionally,
orthogonal protein synthesis systems that utilize amber stop codons
to incorporate non-native amino acids often fail to terminate at
the second termination codon due to read through by the ribosome.
See, e.g., Cloud et al., Chem. and Biol. 3:1033-38 (1996). Although
attempts have been made to utilize sense codon recognition for
incorporation of non-native amino acids (see e.g. Tan et al.,
Methods 36:279-90 (2005); Forster et al., U.S. Pat. No. 6,977,150),
such pure reconstituted translation systems require purified
translational components, which is impractical outside of the
context of research, very expensive, and not shown to be highly
efficient.
[0078] The protein synthesis reaction of this invention is
practiced by obtaining a nucleic acid encoding the desired protein
as described above, obtaining a cell lysate, preventing the
endogenous native amino acid from being incorporated into the
desired polypeptide, obtaining two isoaccepting sense tRNAs, one of
which has been charged with an amino acid in a tRNA charging
reaction in the first reaction vessel, and one of which has been
charged with a non-native amino acid in a separate tRNA charging
reaction that takes place in the second reaction vessel, and
combining the nucleic acid and charged isoaccepting sense tRNAs
with the cellular lysate to form a protein synthesis reaction
mixture. The amino acid used to charge the first isoaccepting tRNA
in the first charging reaction may or may not be a native amino
acid, but will not be the endogenous native amino acid produced by
the host cell population used to generate the lysate.
[0079] The modified protein may also be referred to as the desired
protein, selected protein, or target protein. As used herein, the
modified protein refers generally to any peptide or protein having
more than about 5 amino acids. The modified protein comprises at
least one non-native amino acid at a pre-determined site, and may
contain multiple non-native amino acids. If present at two or more
sites in the polypeptide, the non-native amino acids can be the
same or different. Where the non-native amino acids are different,
the tRNA codons for each non-native amino acids will also be
different.
[0080] The modified protein may be homologous to, or may be
exogenous, meaning that they are heterologous, i.e., foreign, to
the cells from which the cell-free lysate is derived, such as a
human protein, viral protein, yeast protein, etc. produced in a
bacterial cell-free extract. Modified proteins may include, but are
not limited to, molecules such as, e.g., renin, a growth hormone,
including human growth hormone; bovine growth hormone; growth
hormone releasing factor; parathyroid hormone; thyroid stimulating
hormone; lipoproteins; alpha-1-antitrypsin; insulin A-chain;
insulin B-chain; proinsulin; follicle stimulating hormone;
calcitonin; luteinizing hormone; glucagon; clotting factors such as
factor VIIIC, factor IX, tissue factor, and von Willebrands factor;
anti-clotting factors such as Protein C; atrial natriuretic factor;
lung surfactant; a plasminogen activator, such as urokinase or
human urine or tissue-type plasminogen activator (t-PA); bombesin;
thrombin; hemopoietic growth factor; tumor necrosis factor-alpha
and -beta; enkephalinase; RANTES (regulated on activation normally
T-cell expressed and secreted); human macrophage inflammatory
protein (MIP-1-alpha); a serum albumin such as human serum albumin;
mullerian-inhibiting substance; relaxin A-chain; relaxin B-chain;
prorelaxin; mouse gonadotropin-associated peptide; a microbial
protein, such as beta-lactamase; DNase; inhibin; activin; vascular
endothelial growth factor (VEGF); receptors for hormones or growth
factors; integrin; protein A or D; rheumatoid factors; a
neurotrophic factor such as bone-derived neurotrophic factor
(BDNF), neurotrophin-3,-4, -5, or -6 (NT-3, NT-4, NT-5, or NT-6),
or a nerve growth factor such as NGF-(3; platelet-derived growth
factor (PDGF); fibroblast growth factor such as aFGF and bFGF;
epidermal growth factor (EOF); transforming growth factor (TGF)
such as TGF-alpha and TGF-beta, including TGF-(31, TGF-(32,
TGF-(33, TGF-(34, or TGF-(35; insulin-like growth factor-I and -II
(IGF-I and IGF-II); des(1-3)-IGF-I (brain IGF-I), insulin-like
growth factor binding proteins; CD proteins such as CD-3, CD-4,
CD-8, and CD-I 9; erythropoietin; osteoinductive factors;
immunotoxins; a bone morphogenetic protein (BMP); an interferon
such as interferon- alpha, -beta, and -gamma; colony stimulating
factors (CSFs), e.g., M-CSF, GM-CSF, and G-CSF; interleukins (ILs),
e.g., IL-1 to IL-10; superoxide dismutase; T-cell receptors;
surface membrane proteins; decay accelerating factor; viral antigen
such as, for example, a portion of the AIDS envelope; transport
proteins; homing receptors; addressins; regulatory proteins;
antibodies; and fragments of any of the above-listed
polypeptides.
II. Definitions
[0081] "Aminoacylation" or "aminoacylate" refers to the complete
process in which a tRNA is "charged" with its correct amino acid
that is a result of adding an aminoacyl group to a compound. As it
pertains to this invention, a tRNA that undergoes aminoacylation or
has been aminoacylated is one that has been charged with an amino
acid, and an amino acid that undergoes aminoacylation or has been
aminoacylated is one that has been charged to a tRNA molecule.
[0082] "Aminoacyl-tRNA synthetase" or "tRNA synthetase" or
"synthetase" or "aaRS" or "RS" refers to an enzyme that catalyzes a
covalent linkage between an amino acid and a tRNA molecule. This
results in a "charged" tRNA molecule, which is a tRNA molecule that
has its respective amino acid attached via an ester bond.
[0083] "Binding moiety" refers to any substrate or ligand that is
part of a molecular association responsible for eliminating a
desired aminoacyl-tRNA synthetase from a reaction mixture. Such
ligand or substrate moieties may include, but are not limited to,
antibodies, affinity supports, matrices, resins, columns, or coated
beads.
[0084] "Cell-free synthesis system" refers to the in vitro
synthesis of polypeptides in a reaction mix comprising biological
extracts and/or defined reagents. The reaction mix will comprise a
template for production of the macromolecule, e.g. DNA, mRNA, etc.;
monomers for the macromolecule to be synthesized, e.g. amino acids,
nucleotides, etc.; and co-factors, enzymes and other reagents that
are necessary for the synthesis, e.g. ribosomes, uncharged tRNAs,
tRNAs charged with unnatural amino acids, polymerases,
transcriptional factors, etc.
[0085] "Capture moiety" refers to a tag that genetically engineered
onto a protein. Such tags may include, but are not limited to a
His-tag, GFP-tag, GST-tag, FLAG-tag, etc.
[0086] "Catalytic aminoacylating reagent" refers to any enzyme or
molecule that has the capability to charge a tRNA molecule. Such
aminoacylating reagents may refer to, but are not limited to,
aminoacyl-tRNA synthetases or ribozyme columns.
[0087] "Charged tRNA" or "aminoacylated tRNA" refers to a tRNA
molecule that has an amino acid bound at the amino acid attachment
site. During protein synthesis, the amino acid to transferred to
the growing polypeptide chain, releasing the tRNA, which is
referred to as the "released tRNA."
[0088] "Charging reaction mixture" refers to an in vitro reaction
mixture in which an isoaccepting sense tRNA is charged with its
respective amino acid. The mixture contains only isoaccepting tRNAs
with a specific codon sequence that is to be charged. Methods for
charging natural, non-native and/or arbitrary tRNA with natural,
non-native and/or arbitrary amino acids are known in the art, and
include, but are not limited to, chemical aminoacylation,
biological misacylation, acylation by modified aminoacyl tRNA
synthetases, ribozyme-based, and protein nucleic acid-mediated
methods.
[0089] "Degenerate codon" refers to the degeneracy of the genetic
code such that one amino acid or translation termination site may
be coded for by more than one codon. A codon is a three nucleotide
sequence that specifies either an amino acid or translational stop
sequence. Degeneracy is a result of all proteins being made up of
only 20 amino acids even though 64 possible codons exist.
[0090] "DNA" refers to a sequence of two or more covalently bonded,
naturally occurring or modified deoxyribonucleotides.
[0091] "Gene" refers to a hereditary unit consisting of a sequence
of DNA that has a specific chromosomal location. A gene is
expressed to produce a protein product.
[0092] "Heterologous" as it pertains to this invention refers to an
aminoacyl-tRNA synthetase that originates from a species different
from the host cell in which it is expressed.
[0093] "Isoaccepting sense tRNA" refers to different tRNA species
that bind to alternate codons for the same amino acid.
[0094] "Lysate" is any cell derived preparation comprising the
components required for protein synthesis machinery, wherein such
cellular components are capable of expressing a nucleic acid
encoding a desired protein where a majority of the biological
components are present in concentrations resulting from the lysis
of the cells rather than having been reconstituted. A lysate may be
further altered such that the lysate is supplemented with
additional cellular components, e.g. amino acids, nucleic acids,
enzymes, etc. The lysate may also be altered such that additional
cellular components are removed following lysis.
[0095] "Native amino acid" refers to one or more naturally
occurring amino acids encoded by the genetic code. An "endogenous
native amino acid" refers to a native amino acid produced by the
host cells used to generate the lysate.
[0096] "Native aminoacyl-tRNA synthetase" refers to a host cell
aminoacyl-tRNA synthetase enzyme that is found in nature. Native
aminoacyl-tRNA synthetases may be synthesized and added exogenously
to a tRNA reaction vessel as defined by this invention. Native
aminoacyl tRNA synthetases include, but are not limited to, a
natural aminoacyl tRNA synthetases from one or more of plants,
microorganisms, prokaryotes, eukaryotes, protozoa, bacteria,
mammals, yeast, E. coli, or humans.
[0097] "Native isoaccepting sense tRNA" refers to either a first or
second isoaccepting sense tRNA that is produced by the host
population of cells used to create the lysate used for the
cell-free protein synthesis reaction.
[0098] "Non-native amino acids" or "nnAA" refer to amino acids that
are not one of the twenty naturally occurring amino acids that are
the building blocks for all proteins, but are nonetheless capable
of being biologically engineered such that they are incorporated
into proteins. Non-native amino acids may include D-peptide
enantiomers or any post-translational modifications of one of the
twenty naturally occurring amino acids. A wide variety of
non-native amino acids can be used in the methods of the invention.
The non-native amino acid can be chosen based on desired
characteristics of the non-native amino acid, e.g., function of the
non-native amino acid, such as modifying protein biological
properties including toxicity, biodistribution, or half life,
structural properties, spectroscopic properties, chemical and/or
photochemical properties, catalytic properties, ability to react
with other molecules (either covalently or noncovalently), or the
like. Non-native amino acids that can be used in the methods of the
invention may include, but are not limited to, an non-native
analogue of a tyrosine amino acid; an non-native analog of a
glutamine amino acid; an non-native analog of a phenylalanine amino
acid; an non-native analog of a serine amino acid; an non-native
analog of a threonine amino acid; an alkyl, aryl, acyl, azido,
cyano, halo, hydrazine, hydrazide, hydroxyl, alkenyl, alkynl,
ether, thiol, sufonly, seleno, ester, thioacid, borate, boronate,
phospho, phosphono, phosphine, heterocyclic, enone, imine,
aldehyde, hydroxylamine, keto, or amino substituted amino acid, or
any combination thereof; an amino acid with a photoactivatable
cross-linker; a spin-labeled amino acid; a fluorescent amino acid;
an amino acid with a novel functional group; an amino acid that
covalently or noncovalently interacts with another molecule; a
metal binding amino acid; a metal-containing amino acid; a
radioactive amino acid; a photocaged and/or photoisomerizable amino
acid; a biotin or biotin-analog containing amino acid; a
glycosylated or carbohydrate modified amino acid; a keto containing
amino acid; amino acids comprising polyethylene glycol or
polyether; a heavy atom substituted amino acid; a chemically
cleavable or photocleavable amino acid; an amino acid with an
elongated side chain; an amino acid containing a toxic group; a
sugar substituted amino acid, e.g., a sugar substituted serine or
the like; a carbon-linked sugar-containing amino acid, e.g., a
sugar substituted serine or the like; a carbon-linked
sugar-containing amino acid; a redox-active amino acid; an
.alpha.-hydroxy containing acid; an amino thio acid containing
amino acid; an .alpha., .alpha. disubstituted amino acid; a
.beta.-amino acid; a cyclic amino acid other than praline, etc.
[0099] "Polypeptide" or "peptide" or "protein" refers to two or
more naturally occurring amino acids, joined by one or more peptide
bonds.
[0100] "Reaction vessel" refers to the containment that is
autonomous from the protein synthesis reaction in which the tRNA
charging reaction occurs.
[0101] "Ribozyme" refers an RNA molecule that is capable of
catalyzing a chemical reaction. As it pertains to the current
invention, a ribozyme has aminoacylating activity such that it will
charge a tRNA molecule independent of an aminoacyl-tRNA
synthetase.
[0102] "RNA" refers to a sequence of two or more covalently bonded,
naturally occurring or modified ribonucleotides.
[0103] "Sense codon" refers to a set of three nucleotides in a
protein coding sequence that specify an amino acid. As used in this
invention, a sense codon does not include a termination signal or
stop codon.
[0104] "tRNA" or "transfer RNA" refers to a small RNA molecule that
transfers a specific amino acid to a growing polypeptide chain at
the ribosomal site of protein synthesis during translation. tRNAs
contain a three base codon that pairs to the corresponding mRNA
codon. As a result of the degeneracy of the genetic code, an amino
acid can associate with multiple tRNAs, while each type of tRNA
molecule can only associate with one type of amino acid.
[0105] "tRNA charging reaction" refers to the reaction in which a
synthesized native tRNA is charged with its respective amino acid
separate from the protein synthesis reaction, whether said amino
acid is natural or non-native.
[0106] "tRNA:first amino acid charged moiety" refers generally to
an isoaccepting tRNA molecule that has been charged with an amino
acid. As it pertains to this invention, "tRNA:first amino acid
charged moiety" is used in conjunction, and relative to, a
tRNA:non-native amino acid charged moiety.
[0107] "tRNA:non-native amino acid charged moiety" refers generally
to a tRNA molecule that is an isoaccepting tRNA molecule to the
isoaccepting first tRNA molecule, but which has been charged with a
non-native amino acid in place of the native amino acid.
[0108] "Transforming" a cell or population of cells refers to the
alteration of the gene expression of a host cell or cells from
which the lysate is derived. As used in this invention,
transforming a cell refers to the process in which is cell is
altered such that an exogenous nucleic acid sequence is introduced
that expresses a recombinant protein.
III. Template
[0109] In order to produce the proteins of this invention, one
needs a nucleic acid template. The template for cell-free protein
synthesis can be either mRNA or DNA. The template can encode for
any particular gene of interest, and may encode a full-length
polypeptide or a fragment of any length thereof. Nucleic acids to
serve as sequencing templates are optionally derived from a natural
source or they can be synthetic or recombinant. For example, DNAs
can be recombinant DNAs, e.g., plasmids, viruses or the like. The
nature of the invention uses sense codons for the incorporation of
non-native amino acids, and circumvents the requirement of
orthogonal components as is commonly found in the art. As a result,
a preferred embodiment of the invention will use a template that is
capable of translating a complete and functional protein regardless
of whether non-native amino acids are chosen to be
incorporated.
[0110] A DNA template that comprises the gene of interest will be
operably linked to at least one promoter and to one or more other
regulatory sequences including without limitation repressors,
activators, transcription and translation enhancers, DNA-binding
proteins, etc. Suitable quantities of DNA template for use herein
can be produced by amplifying the DNA in well known cloning vectors
and hosts, or by polymerase chain reaction (PCR).
[0111] A preferred embodiment uses a bacterial lysate. A DNA
template be constructed for bacterial expression by operably
linking a desired protein-encoding DNA to both a promoter sequence
and a bacterial ribosome binding site (Shine-Delgarno sequence).
Promoters suitable for use with the DNA template in the cell-free
transcription-translation methods of the invention include any DNA
sequence capable of promoting transcription in vivo in the bacteria
from which the bacterial extract is derived. Preferred are
promoters that are capable of efficient initiation of transcription
within the host cell. DNA encoding the desired protein and DNA
containing the desired promoter and Shine-Dalgarno (SD) sequences
can be prepared by a variety of methods known in the art.
Alternatively, the desired DNA sequences can be obtained from
existing clones or, if none are available, by screening DNA
libraries and constructing the desired DNA sequences from the
library clones.
[0112] RNA templates encoding the protein of interest can be
conveniently produced from a recombinant host cell transformed with
a vector constructed to express a mRNA with a bacterial ribosome
binding site (SD sequence) operably linked to the coding sequence
of the desired gene such that the ribosomes in the reaction mixture
are capable of binding to and translating such mRNA. Thus, the
vector carries any promoter capable of promoting the transcription
of DNA in the particular host cell used for RNA template
synthesis.
[0113] Because it is difficult to extract undegraded RNA from
bacteria, higher eukaryotic cell culture is preferred for the
production of the RNA template. In principle, any higher eukaryotic
cell culture is workable, including both vertebrate and
invertebrate cell cultures. The RNA template can be conveniently
isolated in a total cellular RNA fraction extracted from the host
cell culture. Total cellular RNA can be isolated from the host cell
culture by any method known in the art. The desired RNA template
can be isolated along with most of the cellular mRNA if the RNA
template is designed to contain at its 3' end a polyadenylation
signal recognized by the eukaryotic host cell. Thus, the host cell
will produce the RNA template with a polyadenylate (poly(A)) tail.
Polyadenylated mRNAs can be separated from the bulk of cellular RNA
by affinity chromatography on oligodeoxythymidylate (oligo
(dT))-cellulose columns using any methods known in the art. If the
size of the mRNA encoding the desired protein is known, the mRNA
preparation can be further purified for mRNA molecules of the
particular size by agarose gel electrophoresis of the RNA.
[0114] Examples of appropriate molecular techniques for generating
recombinant nucleic acids, and instructions sufficient to direct
persons of skill through many closing exercises are found in Berger
and Kimmel, Guide to Molecular Cloning Techniques, Methods in
Enzymology (Volume 152 Academic Press, Inc., San Diego, Calif.
1987); PCR Protocols: A Guide to Methods and Applications (Academic
Press, San Diego, Calif. 1990). Product information from
manufacturers of biological reagents and experimental equipment
also provide information useful in known biological methods. Such
manufacturers include SIGMA (Saint Louis, Mo.), R&D systems
(Minneapolis, Minn.), Pharmacia LKB Biotechnology (Piscataway,
N.J.), Clontech Laboratories, Inc. (Palo Alto, Calif.), Aldrich
Chemical Company (Milwaukee, Wis.), Invitrogen (San Diego, Calif.),
Applied Biosystems (Fosters City, Calif.), as well as many other
commercial sources known to one of skill in the art.
IV. Generating a Lysate
[0115] The present invention utilizes a cell lysate for in vitro
translation of a target protein. For convenience, the organism used
as a source for the lysate may be referred to as the source
organism or host cell. Host cells may be bacteria, yeast, mammalian
or plant cells, or any other type of cell capable of protein
synthesis. A lysate comprises components that are capable of
translating messenger ribonucleic acid (mRNA) encoding a desired
protein, and optionally comprises components that are capable of
transcribing DNA encoding a desired protein. Such components
include, for example, DNA-directed RNA polymerase (RNA polymerase),
any transcription activators that are required for initiation of
transcription of DNA encoding the desired protein, transfer
ribonucleic acids (tRNAs), aminoacyl-tRNA synthetases, 70S
ribosomes, N.sup.10-formyltetrahydrofolate,
formylmethionine-tRNAf.sup.Met synthetase, peptidyl transferase,
initiation factors such as IF-1, IF-2, and IF-3, elongation factors
such as EF-Tu, EF-Ts, and EF-G, release factors such as RF-1, RF-2,
and RF-3, and the like.
[0116] An embodiment uses bacterial cells from which a lysate is
derived. A bacterial lysate derived from any strain of bacteria can
be used in the methods of the invention. The bacterial lysate can
be obtained as follows. The bacteria of choice are grown up
overnight in any of a number of growth media and under growth
conditions that are well known in the art and easily optimized by a
practitioner for growth of the particular bacteria. For example, a
natural environment for synthesis utilizes cell lysates derived
from bacterial cells grown in medium containing glucose and
phosphate, where the glucose is present at a concentration of at
least about 0.25% (weight/volume), more usually at least about 1%;
and usually not more than about 4%, more usually not more than
about 2%. An example of such media is 2YTPG medium, however one of
skill in the art will appreciate that many culture media can be
adapted for this purpose, as there are many published media
suitable for the growth of bacteria such as E. coli, using both
defined and undefined sources of nutrients. Cells that have been
harvested overnight can be lysed by suspending the cell pellet in a
suitable cell suspension buffer, and disrupting the suspended cells
by sonication, breaking the suspended cells in a French press,
continuous flow high pressure homogenization, or any other method
known in the art useful for efficient cell lysis. The cell lysate
is then centrifuged or filtered to remove large DNA fragments.
Methods of bacterial lysate preparation are well known in the art.
See, e.g., Sambrook, et al., Molecular Cloning: A Laboratory
Manual, Second Edition (Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y. 1989).
[0117] Another embodiment uses rabbit reticulocyte cells from which
to derive a lysate. Reticulocyte lysate is prepared following the
injection of rabbits with phenylhydrazine, which ensures reliable
and consistent reticulocyte production in each lot. The
reticulocytes are purified to remove contaminating cells which
could otherwise alter the translational properties of final lysate.
The cells can then be lysed by suspending the cell pellet in a
suitable cell suspension buffer, and disrupting the suspended cells
by sonication, breaking the suspended cells in a French press, or
any other method known in the art useful for efficient cell lysis.
After the reticulocytes are lysed, the lysate is treated with
micrococcal nuclease and CaCl.sub.2 in order to destroy endogenous
mRNA and thus reduce background translation. EGTA is further added
to chelate the CaCl.sub.2 thereby inactivating the nuclease. Hemin
may also be added to the reticulocyte lysate because it is a
suppressor of an inhibitor of the initiation factor eIF2a. In the
absence of hemin, protein synthesis in reticulocyte lysates ceases
after a short period of incubation. See e.g., Jackson, R. and Hunt,
T., Meth. In Enzymol. (1983). Potassium acetate and magnesium
acetate are added at a level recommended for the translation of
most mRNA species. For further detail on preparing rabbit
reticulocyte lysate, one skilled in the art can refer to, e.g.,
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y. 1989).
[0118] An embodiment may use a plant lysate such as wheat germ
lysate. Generally, wheat germ lysate is prepared by grinding wheat
germ in a lysate buffer, followed by centrifugation to remove cell
debris. The supernatant is then separated by chromatography from
endogenous amino acids and plant pigments that are inhibitory to
translation. The lysate is also treated with micrococcalnuclease to
destroy endogenous mRNA, to reduce background translation to a
minimum. The lysate contains the cellular components necessary for
protein synthesis, such as tRNA, rRNA and initiation, elongation,
and termination factors. The lysate is further optimized by the
addition of an energy generating system consisting of
phosphocreatine kinase and phospocreatine, and magnesium acetate is
added at a level recommended for the translation of most mRNA
species. For more detail on the preparation of wheat germ lysate,
see e.g., Roberts, B. E. and Paterson, B. M. (1973), Proc. Natl.
Acad. Sci. U.S.A. Vol. 70, No. 8, pp. 2330-2334), following the
modifications described by Anderson, C. W., et al., Meth. Enzymol.
(Vol. 101, p. 635; 1983).
[0119] Lysates are also commercially available from manufacturers
such as Promega Corp.(Madison, Wis.), Stratagene (La Jolla,
Calif.), Amersham (Arlington Heights, Ill.) and GIBCO (Grand
Island, N.Y.).
V. Preventing Incorporation of Endogenous Native Amino Acids
[0120] The endogenous native amino acids recognized by the
isoaccepting tRNAs used in the tRNA charging reactions that are
produced by the host cell population must be prevented from being
incorporated into the desired polypeptide. This allows the dual
nature of the present invention to place native or non-native amino
acids not produced by the host cell population into the first and
second codon positions, respectively. One skilled in the art can
prevent incorporation of an endogenous native amino acid either by
depleting native aminoacyl-tRNA synthetases that would function to
aminoacylate the native amino acid, or by disrupting the function
of the isoaccepting tRNAs.
A. Depleting Native Aminoacyl-tRNA Synthetases
[0121] The native aminoacyl-tRNA synthetase may be depleted from
the cell lysate either before lysis of the host cell population, or
directly from the lysate following lysis of the host cell
population in order to prevent incorporation of an endogenous
native amino acid.
[0122] In embodiments where the native aminoacyl-tRNA synthetase is
depleted from the cell lysate before lysis, the host cell
population is altered such that the native aminoacyl-tRNA
synthetase is replaced with an aminoacyl-tRNA synthetase fused to a
tag referred to as a capture moiety. The native aminoacyl-tRNA
synthetase is replaced by transforming said cells with a gene
wherein said gene expresses an aminoacyl-tRNA synthetase fused to a
capture moiety that is capable of functionally replacing the native
aminoacyl-tRNA synthetase. The purpose of replacing the native
aminoacyl-tRNA synthetase with a tagged aminoacyl-tRNA synthetase
is to provide a simple manner in which the lysate will be cleared
of an aminoacyl-tRNA synthetase capable of charging both
isoaccepting sense tRNAs while retaining survival of the host cell
population in the absence of the native aminoacyl-tRNA
synthetase.
[0123] When using an aminoacyl-tRNA synthetase fused to a capture
moiety to functionally replace the native aminoacyl-tRNA synthetase
prior to lysis, one also needs to alter the host cell such that the
expression of the native aminoacyl-tRNA synthetase is inhibited.
This may be accomplished by any method known in the art including,
but not limited to, creating a host cell line that has a deletion
for the entire DNA sequence that codes for the synthetase mRNA;
deleting a portion of the DNA sequence that codes for the
synthetase mRNA such that any resulting synthetase protein is
rendered non-functional, where the deleted portion may include an
exon, intron, promoter, or enhancer sequence; or introducing any
type of exogenous intervening sequence into the coding or
regulatory sequence of the endogenous aminoacyl-tRNA synthetase,
such as a transposon, that functions to disrupt or completely
inhibit the function of the synthetase. Methods of disrupting
endogenous gene function are well known in the art, and should not
be limited only to these discussed. Such methods are well known in
the art, and are common to the practice of molecular biology. For
greater detail on such techniques, see e.g., Sambrook et al.,
Molecular Cloning-A Laboratory Manual, 3rd Ed. (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. 2000).
[0124] When using an aminoacyl-tRNA synthetase fused to a capture
moiety to functionally replace the native aminoacyl-tRNA synthetase
prior to lysis, the aminoacyl-tRNA synthetase fused to a capture
moiety itself must be depleted from the lysate following lysis in
order to prevent any cross-reactivity that might aminoacylate both
isoaccepting sense tRNAs with the same amino acid. The
aminoacyl-tRNA synthetase fused to a capture moiety may be depleted
from the lysate by any method known in the art that will allow a
tagged protein to be removed from a lysate, which may include but
is not limited to, affinity chromatography, immunoaffinity
chromatography, or immunoprecipitation.
[0125] In embodiments where an aminoacyl-tRNA synthetase fused to a
capture moiety is depleted from the cell lysate by affinity
chromatography, one may utilize a variety of tags known in the art.
A common tag e.g., is a Histidine-tag (His-tag), which has an
affinity towards nickel or cobalt ions. Here, the tagged
aminoacyl-tRNA synthetase to be depleted may be engineered into a
recombinant protein that will express the desired synthetase having
the His-tag exist as part of the expressed protein. If one
immobilizes nickel or cobalt ions on a resin column, an affinity
support that specifically binds to histidine-tagged proteins can be
created. As it relates to the present invention, the resin
immobilized with either the nickel or cobalt ions is the binding
moiety. Because the only protein in the lysate that will have a
His-tag will be the aminoacyl-tRNA synthetase fused to the His-tag,
that synthetase will be the only protein that will bind to the
resin, letting all other proteins pass through the column. Such
techniques are well known in the art, and His-tag vectors are
commercially available from manufacturers such as Qiagen (Valencia,
Calif.), Roche Applied Science (Rotkreuz, Switzerland), Biosciences
Clontech (Palo Alto, Calif.), Promega (San Luis Obispo, Calif.) and
Thermo Scientific (Rockford, Ill.).
[0126] Immunoaffinity chromatography may also be used to deplete
from the lysate the aminoacyl-tRNA synthetase fused to a capture
moiety. Immunoaffinity chromatography is a method of affinity
chromatography that is achieved by tagging the aminoacyl-tRNA
synthetase with a capture moiety that is recognized by an antibody.
The capture moiety may be any tag that is commercially available
and recognized by commercially available antibodies. Such tags may
include, but are not limited to, Green Fluorescent Protein (GFP)
tag, Glutathione-S-transferase (GST) tag, and the FLAG-tag tag.
Immunoaffinity chromatography methods are well known in the art.
For more detail on either affinity or immunoaffinity
chromatography, see, e.g., Affinity Chromatography: Principles
& Methods (Pharmacia LKB Biotechnology 1988), and Doonan,
Protein Purification Protocols (The Humana Press 1996).
[0127] In another embodiment of the present invention, the
aminoacyl-tRNA synthetase fused to a capture moiety may be depleted
from the lysate by immunoprecipitation. In this embodiment,
antibodies are raised against the capture moiety, but such systems
often provide for the use of commercial antibodies raised against
commercially available recombinant tags. The antibody is then
immobilized on a solid-phase substrate binding moiety that may
include, but is not limited to, microscopic superparamagnetic or
microscopicagarose beads. The beads bind to the substrate of
choice, and when added to the cell lysate, the proteins that are
targeted by the antibodies are bonded onto the substrate.
Alternatively, the antibodies may also be directly added to the
lysate and allowed to associate with the targeted aminoacyl-tRNA
synthetase to be depleted. Beads coated in Protein A/G are then
added to the antibody/aminoacyl-tRNA synthetase mixture, at which
time the antibodies and bound synthetase will bind to the Protein
A/G beads. The substrate can then be removed from the lysate, for
example, via magnetic fields for superparamagnetic substrates or
centrifugation for microscopicagarose substrates.
Immunoprecipitation methods are well known in the art. See, e.g. E.
Harlow, Antibodies: A Laboratory Manual (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. 1988).
[0128] In some embodiments of the present invention, the native
aminoacyl-tRNA synthetase is depleted prior to lysis and
functionally replaced by transforming the host cell population with
a recombinant aminoacyl-tRNA gene that produces an aminoacyl-tRNA
synthetase that is thermally instable. Following cell lysis, heat
can be used to denature the thermally instable aminoacyl-tRNA
synthetase to prevent unwanted charging of the isoaccepting tRNA
molecules within the lysate. Similarly, the host cell population
can be replaced with a recombinant aminoacyl-tRNA synthetase gene
that expresses an aminoacyl-tRNA synthetase that is unstable under
ionic, physical, or chemical conditions.
[0129] In embodiments where the native aminoacyl-tRNA synthetase is
depleted from the cell lysate following lysis, replacing the
aminoacyl-tRNA synthetase with an aminoacyl-tRNA synthetase tagged
with a capture moiety is unnecessary. In these embodiments,
immunoaffinity chromatography or immunoprecipitation may be used to
deplete the endogenous native aminoacyl-tRNA synthetase. This
embodiment requires raising antibodies against the native
aminoacyl-tRNA synthetase. Once antibodies that sufficiently
recognize the native aminoacyl-tRNA synthetase are raised, either
immunoaffinity chromatography or immunoprecipitation, as described
above, may be used to deplete the lysate of the native
aminoacyl-tRNA synthetase.
[0130] In other embodiments where the native aminoacyl-tRNA
synthetase is depleted following cell lysis, the native
aminoacyl-tRNA synthetase may be functionally depleted using an
aminoacyl-tRNA synthetase inhibitor that is specific to that
synthetase desired to be depleted. Many aminoacyl-tRNA synthetase
inhibitors are amino acid analogs that inhibit a specific
aminoacyl-tRNA synthetase, although a particular inhibitor may
sometimes inhibit aminoacyl-tRNA synthetases associated with more
than one amino acid. Aminoacyl-tRNA synthetase specific inhibitors
can also be searched in databanks such as BioInfoBank
(http://ia.bioinfo.pl/). A person skilled in the art would also
readily recognize that a specific inhibitor can be designed,
screened, and tested, based on the available structural models of
aminoacyl-tRNA synthetases.
[0131] Examples of aminoacyl-tRNA synthetase inhibitors include
S-trityl-L-cysteine; L-asparaginamide; 4-aza-DL-leucine; DL-serine
hydroxamate; proflavine (hemisulfate salt); L-isoleucinol;
N-phenylglycine; L-leucinol; L-methioninol; phe-leu-amide;
tyramine; L-isoleucinol; 3,4-dehydro-DL-proline;
S-carbamyl-L-cysteine; a-methyl-DL-methionine; chloro-L-alanine;
cis-hydroxy proline; L-prolinol; L-histidonol; L-tyrprophan
hydroxamate; DL-4-thiaisoleucine; DL-amino-.epsilon.-caprolactam;
L-aspartic acid amide; DL-.beta.-hydroxynorvaline;
cis-4-fluoro-L-proline; trans-4-fluoro-L-carboxylic acid;
.alpha.-methyl-DL-histidine; N-formyl-L-histidine;
L-2-amino-3-sulfamoylpropionic acid; L-aspartic
acid-.beta.-hydroxamate; .beta.-cyano-L-alanine; selenocystamine;
4-amino-n-butyric acid amide; DL-5-hydroxylysine;
L-lysinhydroxamate; 3-(N-phenylacetyl)amino-2,6-piperidinedione
(antineoplaston A10); 4-amino-4 phosphonobutyric acid; ethionamide;
1,2-diamino-3(4-imidazolyl)propane(histidinamine);
.alpha.-methylhistidine; (S)-2-methylbutylamine;
L-O-methylthreonine; DL-armentomycin (2-amino-4,4-dichlorobutyric
acid); DL-3-dehydroarmentomycin; DL-3-hydroxyleucine;
5,5,5-trifluoro-DL-leucine; .beta.-(3-aminocyclohexyl)-DL-alanine;
DL-p-chloroamphetamine; trans-2,6-diaminohex-4-enoic acid;
DL-2,6-diphthalimidocaproic acid methyl ester; DL-5-hydroxylysine;
L-lysinhydroxamate; DL-4-oxalysine; DL-4-selenalysine;
L-methioninamide; 2-amino-4-methylhex-4-enoic acid;
(1S,2S)-2-amino-1-phenyl-1,3-propanediol; N-benzyl-D-amphetamine;
N-benzyl-L-phenylalanine; N-benzyl-D-phenylethylamine;
1,3-bis(acetoxy)-2-nitro-1-phenylpropane (fenitropan);
1,2-diamino-3-(2,6-dichlorophenyl)propane;
1,2-diamino-3-hydroxy-5-phenylpentane; 1,2-diamino-3-phenylpropane;
N-(2,6-dichlorobenzylidene)-2-phenylethylamine;
N-(2,6-dichlorobenzyl)-2-phenylethylamine;
N-(4-fluorobenzyl)-L-phenylalanine; DL-2-fluorophenylalanine;
2-hydroxyethyl-2-phenylammonium sulfate; .alpha.-and
.beta.-methyl-DL-phenylalanine; L-phenylalaninol;
L-.alpha.-phenylglycine; DL-threo-.beta.-phenylserine;
.beta.-2-thienyl-DL-alanine; N-trifluroacetyl-L-phenylalanine
cyclohexyl ester; 2-aminomethyl-4-isopropyloxypyrrolidine oxalate;
2-amino-methylpyrrolidine; L-4-thiaproline; N-benzylethanolamine;
N-(2,6-dichlorobenzyl)ethanolamine;
N-(2,6-dichlorobenzylidene)ethanolamine; DL-.beta.-hydroxyleucine;
1,2-diamino-5-phenyl-3-pentanol; DL-7-azatryptophan; DL-4-and
DL-6-flurotryptophan; 5-hydroxytryptamine; L-5-hydroxytryptophan;
DL-.alpha.-methyltryptamine; .alpha.- and
.beta.-methyl-DL-tryptophan; tryptamine;
DL-2-amino-1-(4-hydroxyphenyl)-1-propanol; DL-3-fluorotyrosine;
3-iodo-L-tyrosine; 3-nitro-L-tyrosine; L-tyrosinol.HCl;
L-threo-2-amino-3-chlorobutyric acid; hexafluoro-DL-valine;
DL-norvaline; L-4-thialysine; DL-ethionine; N,N'-di-CBZ-L-lysine;
DL-3-fluorophenylalanine; DL-4-fluorophenylalanine; and
DL-3,4-dihydroxyphenylalanine. These compounds are known in the
art.
[0132] Whilst the methods listed above for depleting proteins are
the most commonly employed in the art, the methods of the present
invention should not be limited only to those procedures described
above. Any functional means for depleting a native aminoacyl-tRNA
synthetase will accord with the methods of incorporating non-native
amino acids as claimed in the present invention.
B. Inactivating Native Isoaccepting tRNAs
[0133] Endogenous native amino acids can further be prevented from
incorporation into the desired polypeptide by inactivating native
isoaccepting tRNAs. Native isoaccepting tRNAs can be inactivated
using either an inactivated aminoacyl-tRNA synthetase variant that
that has been engineered to selectively bind to the native first
and second isoaccepting sense tRNAs; or by using antisense DNA.
[0134] The aminoacyl-tRNA synthetase variants are engineered to
lack aminoacylating activity, but nonetheless outcompete the native
aminoacyl-tRNA synthetases. Thus, the aminoacyl-tRNA synthetase
variants will be able to inactivate specific isoaccepting tRNAs by
binding to said isoaccepting tRNAs without aminoacylating its
target tRNA.
[0135] Engineered tRNA/aminoacyl-tRNA synthetase pairs and
promiscuous aminoacyl-tRNA synthetases may be engineered using a
variety of methods generally used for protein directed evolution.
Various types of mutagenesis may be used to produce novel
synthetases. Such types of mutagenesis may include, but are not
limited to, site-directed, random point mutagenesis, homologous
recombination (DNA shuffling), mutagenesis using uracil containing
templates, oligonucleotide-directed mutagenesis,
phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped
duplex DNA or the like. Additional suitable methods include point
mis-match repair, mutagenesis using repair-deficient host strains,
restriction-selection and restriction-purification, deletion
mutagenesis, mutagenesis by total gene synthesis, double-strand
break repair, and the like. The mutants are then screened using a
functional assay for desired activity. Mutagenesis, e.g., involving
chimeric constructs, can also be used. Specific sites for
increasing the affinity of the protein to its cognate tRNA can be
identified by examining X-ray crystal structures. Engineering
aminoacyl-tRNA synthetases to recognize non-native amino acids has
become well known in the art. See, e.g. Liu et al., Proc. Natl.
Acad. Sci. 94:10092-7 (1997); Furter, Protein Sci., 7:419 (1998);
Zhang et al., Proc. Natl. Acad. Sci. 94:4504-09 (1997); Ohno et
al., J. Biochem. 130:417-23 (2001). The reaction conditions in
which a tRNA is charged with an amino acid in the tRNA charging
reaction is illustrated in the examples provided herein.
[0136] Once specific aminoacyl-tRNA synthetase variants for
isoaccepting tRNAs are identified, the lysate can be depleted of a
specific isoaccepting tRNA by immobilizing the binding molecules on
a column and passing the lysate through this column to recover the
depleted isoaccepting tRNA lysate.
[0137] An embodiment of the present invention uses antisense DNA to
inactivate isoaccepting tRNAs to prevent an endogenous native amino
acid from incorporating into the desired polypeptide. Here, the
antisense DNA recognizes the anticodon sequence of its target tRNA,
hence preventing the native isoaccepting tRNA from associating with
its mRNA codon sequence.
[0138] Inactivating and depleting tRNA molecules is well known in
the art. See, e.g., Lindsley and Guarneros, Mol. Microbiology
48:1267-74 (2003); Jackson et al., RNA 7:765-73 (2001); Kanda et
al., Biochem. Biophys. Res. Commun. 270:1136-9 (2000); Kanda et
al., FEBS Letters 440:273-76 (1998); Kanda et al., Bioorganic &
Medicinal Chemistry 8:675-79; Schmidt and Schimmel, PNAS 90:6919-23
(1993).
[0139] Specific t-RNA ribonucleases (tRNAses) can be used to
inactive specific tRNAs by selectively cleaving specific tRNAs.
Examples of specific tRNAses include colicin D, colicin E5, and
PrrC. See, e.g., Tomita et al., Proc. Natl. Acad. Sci. 97:8278-83
(2000); Morad et al., J. Biol. Chem. 268:26842-9 (1993); Ogawa et
al., 283:2097-2100 (1999); de Zamarozy et al., Mol. Cell 8:159-168
(2001). Active fragments of these specific t-RNA ribonucleases,
e.g., C-terminal domain of colicin D or colicin E5, can be used for
the present invention. Specific t-RNA ribonucleases can be further
engineered to inactivate a subset of their target t-RNAs, or can be
altered to inactivate a different tRNA target. When the
ribonuclease activity is not longer desired, the tRNAses may be
inhibited by an inhibitor, e.g., ImmD protein (see, e.g., de
Zamarozy et al.).
VI. In Vitro tRNA Aminoacylation
[0140] The isoaccepting sense tRNAs must be charged in order to
incorporate the non-native amino acids into the desire protein. The
tRNA charging reaction, as used herein, refers to the in vitro tRNA
aminoacylation reaction in which desired isoaccepting sense tRNAs
are aminoacylated with their respective amino acid of interest. The
tRNA charging reaction comprises the charging reaction mixture, an
isoaccepting sense tRNA, and as used in this invention, may include
either natural or non-native amino acids.
[0141] The present invention is a dual charging system because the
isoaccepting sense tRNA is charged with either a native or
non-native amino acid in a separate tRNA charging reaction. The
present invention requires separate in vitro tRNA charging
reactions for each respective isoaccepting sense tRNA, as different
types of amino acids are desired to be added to a growing
polypeptide chain at the first and second sense codons where only
one native amino acid would normally be added.
[0142] The separate tRNA charging reaction can be any reaction that
aminoacylates a sense tRNA molecule with a desired amino acid
separate from the protein synthesis reaction. This reaction can
take place in an extract, an artificial reaction mixture, or a
combination of both.
[0143] Suitable tRNA aminoacylation reaction conditions are well
known to those of ordinary skill in the art. Typically, tRNA
aminoacylation is carried out in a physiological buffer with a pH
value ranging from 6.5 to 8.5, 0.5-10 mM high energy phosphate
(such as ATP), 5-200 mM MgCl.sub.2, 20-200 mM KCl. Preferably, the
reaction is conducted in the presence of a reducing agent (such as
0-10 mM dithiothreitol). Where the aminoacyl-tRNA synthetase is
exogenously added, the concentration of the synthetase is typically
1-100 nM. One skilled in the art would readily recognize that these
conditions can be varied to optimize tRNA aminoacylation, such as
high specificity for the pre-selected amino acids, high yields, and
lowest cross-reactivity.
[0144] The reaction can be carried out in a temperature ranging
from 4 to 40.degree. C., or more preferably 20-37.degree. C. Where
the cell lysate is derived from a thermophilic bacteria, the
reaction may be carried out in a higher temperature (e.g.
70.degree. C.). Where a thermally unstable aminoacyl-tRNA
synthetase is used, the reaction is preferably carried out in a
lower temperature (e.g. 4.degree. C.). The reaction temperature may
also be varied to optimize tRNA aminoacylation.
[0145] In a preferred embodiment of the invention isoaccepting
tRNAs are charged by aminoacyl-tRNA synthetases. In this
embodiment, a first isoaccepting sense tRNA would be charged with
the native amino acid in one tRNA charging reaction. A second
isoaccepting tRNA that associates with a different codon sequence,
but for the same amino acid as the codon for the first isoaccepting
sense tRNA, would be charged with a non-native amino acid in a
second tRNA charging reaction. The second tRNA charging reaction
would proceed in a separate reaction vessel as the first tRNA
charging reaction. Because the first and second tRNA charging
reaction occur in separate reactions, the first and second
isoaccepting sense tRNAs are not required to be charged using the
same aminoacyl-tRNA synthetase.
[0146] The tRNA charging reactions can thus utilize either the
native aminoacyl-tRNA synthetase specific to the isoaccepting sense
tRNAs to be charged, an engineered aminoacyl-tRNA synthetase, or a
"promiscuous" aminoacyl tRNA synthetase capable of charging a tRNA
molecule with more than one type of amino acid. Promiscuous
aminoacyl-tRNA synthetases may either themselves be engineered, or
may include endogenously produced aminoacyl-tRNA synthetases that
are sometimes found in nature.
[0147] The aminoacyl-tRNA synthetase utilized depends on the amino
acid to be incorporated. For native amino acids, the charging
reaction may use a native, engineered, or promiscuous
aminoacyl-tRNA synthetase. For non-native amino acids, the charging
reaction typically use either an engineered or promiscuous
aminoacyl-tRNA synthetase. For efficiently charging a modified tRNA
and/or a non-native amino acid, the aminoacyl-tRNA synthetase can
be engineered to aminoacylate the modified tRNA with a non-native
amino acid under conditions similar to native reaction conditions.
Engineering tRNA/aminoacyl-tRNA synthetase pairs is discussed
above. An example of engineered synthetases is Ala294.fwdarw.Gly
Phe-RS, with the Ala294.fwdarw.Gly mutation at the active site of
the synthetase. In some embodiments, an engineered synthetase
allows the aminoacylation of a modified tRNA and/or a non-native
amino acid under conditions similar to normal reaction
conditions
[0148] Alternatively, a modified tRNA and/or a non-native amino
acid can be charged under gently-denaturing reaction conditions,
e.g., elevated pH, increased MgCl2 concentrations, the addition of
detergents, DMSO, or spermidine. An example of such reaction
conditions includes:100 mM Hepes pH 8.1, 75 mM MgCl2, 5 mM ATP, 40
mM KCl, 1.4 M DMSO, 0.1% Triton X-100, 10-100 .mu.M tRNAphe, 5-20
mM p-acetyl-phenylalanine, and 1-10 .mu.M Ala294.fwdarw.Gly Phe-RS.
In some embodiments, a modified tRNA and/or a non-native amino acid
can be charged under the gently-denaturing reaction conditions by a
native aminoacyl-tRNA synthetase.
[0149] In some systems, the isoaccepting codons are serviced by the
same tRNA, with the first codon perfectly matched by the tRNA and
the second codon mismatched by wobble base-paring. In these
systems, it is possible to have a modified tRNA that favors the
second codon, i.e., perfectly matching the second codon.
[0150] Therefore, engineered tRNA/aminoacyl-tRNA synthetase pairs
useful for the charging reaction further include a system utilizing
a modified tRNA derived from a native tRNA. The native tRNA forms
Watson-Crick base-pairing with a sense codon encoding a native
amino acid, and forms wobble base-pairing with one or more wobble
degenerate sense codon(s) encoding the same native amino acid. The
modified tRNA according to the present invention comprises a
modified anticodon sequence that forms Watson-Crick base-pairing
with one of the wobble degenerate sense codon(s).
[0151] An aminoacyl-tRNA synthetase aminoacylates the modified tRNA
with a non-native amino acid. In some embodiments, the modified
tRNA is charged with a non-native amino acid by an engineered
aminoacyl-tRNA synthetase. An example of engineered tRNA is an
engineered E. coli phenylalanine tRNA in which the anticodon GAA
has been modified to an anticodon AAA (see Kwon et al., JACS
125:7512-7513, 2003). An example of engineered aminoacyl-tRNA
synthetase is a modified phenylalanine-tRNA synthetase, e.g., a
Thr415Gly mutant. An example of non-native amino acids to be
charged using the engineered tRNA/aminoacyl-tRNA synthetase pair is
L-3-(2-naphthyl)alanine (Nal).
[0152] Other examples of engineered tRNAs include an asparagine
tRNA in which the anticodon GUU has been modified to an anticodon
AUU (GUU.fwdarw.AUU); a GCA.fwdarw.ACA cysteine tRNA; a
UUC.fwdarw.CUC glutamine tRNA; a GUG.fwdarw.AUG histidine tRNA; a
UUU.fwdarw.CUU lysine tRNA; an CGU.fwdarw.AGU threonine tRNA.
Examples of non-native amino acids to be charged further include,
e.g., fluro-glutamine and para-acetyl-phenylalanine
[0153] Following the aminoacylation of the isoaccepting sense tRNA
in the separate charging reaction, the charged isoaccepting sense
tRNA must be purified in order to add it to the cell-free protein
synthesis reaction. This aspect of the invention requires the
charged isoaccepting sense tRNA to be isolated from the
aminoacyl-tRNA synthetase used in the tRNA charging reaction to
ensure that the synthetases utilized for the charging reaction do
not cross react with the tRNAs and/or amino acids in the protein
synthesis reaction
[0154] Amino-acylated tRNA may be purified from unreacted tRNA and
any aminoacyl-tRNA synthetase using elongation factor-Tu (Ef-Tu)
from E. coli or T. thermophilis, immobilized on Sepharose 4B (GE
Healthcare) see Derwnskus, Fischer, & Sprinzl, Anal. Biochem.,
136, 161 (1984). Briefly, the immobilized protein is activated in
the presence of GTP, pyruvate kinase, and phosphoenolpyruvate to
generate immobilized Ef-Tu-GDP that specifically binds the
amino-acylated tRNA. The column is washed in low ionic strength
buffer (10 mM KCl; 50 mM HEPES; pH 7.4) and eluted in high salt
buffer to yield purified amino-acylated tRNA.
[0155] Another embodiment charges an isoaccepting sense tRNA with a
non-native amino acid using a ribozyme column that is capable of
transferring an aminoacyl group from the 5'-OH of the ribozyme
(after being charged by an oligonucleotide donor) to the 3'-OH of
the tRNA molecule. Ribozymes currently employed in the art result
in the ability to catalyze reactions between a broad spectrum of
isoaccepting sense tRNAs and non-native amino acids, which is
particularly useful for making isoaccepting sense tRNAs
aminoacylated with non-native amino acids when using in vitro
translation reactions. Ribozymes currently known in the art further
enable efficient affinity purification of the aminoacylated
products, examples of suitable substrates including agarose,
sepharose, and magnetic beads. Such methods bypass the requirement
for aminoacyl-tRNA synthetases in order for proper isoaccepting
sense tRNA charging. Isoaccepting tRNAs that are aminoacylated
using ribozymes can be accomplished in a variety of ways. One
suitable method is to elute the aminoacylated isoaccepting tRNAs
for a column with a buffer such as EDTA. See, e.g., Bessho et al.,
Nature Biotechnology 20:723-28 (2002); Lee et al., Nat. Struct.
Biol. 20:1797-806 (2001).
[0156] tRNA molecules to be used in the tRNA charging reaction can
be synthesized from a synthetic DNA template for any tRNA of choice
following amplification by PCR in the presence of appropriate 5'
and 3' primers. The resulting double-stranded DNA template,
containing a T7-promoter sequence, can then be transcribed in vitro
using T7 RNA polymerase to produce the tRNA molecule, which is
subsequently added to the tRNA charging reaction.
VII. Cell-Free Protein Synthesis Reaction
[0157] The above described charged isoaccepting sense tRNAs
associated with the first and second codons are now combined with
the cell lysate along with the nucleic acid template for synthesis
of the desired protein having non-native amino acids as preselected
positions.
[0158] The reaction mixture will further comprise monomers for the
macromolecule to be synthesized, e.g. amino acids, nucleotides,
etc., and such co-factors, enzymes and other reagents that are
necessary for the synthesis, e.g. ribosomes, tRNA, polymerases,
transcriptional factors, etc. In addition to the above components
such as a cell-free extract, genetic template, and amino acids,
materials specifically required for protein synthesis may be added
to the reaction. The materials include salts, folinic acid, cyclic
AMP, inhibitors for protein or nucleic acid degrading enzymes,
inhibitors or regulators of protein synthesis, adjusters of
oxidation/reduction potentials, non-denaturing surfactants, buffer
components, spermine, spermidine, putrescine, etc. Metabolic
inhibitors to undesirable enzymatic activity may be added to the
reaction mixture. Alternatively, enzymes or factors that are
responsible for undesirable activity may be removed directly from
the extract, or the gene encoding the undesirable enzyme may be
inactivated or deleted from the chromosome.
[0159] The cell-free synthesis reaction may utilize a large scale
reactor, small scale reactor, or may be multiplexed to perform a
plurality of simultaneous syntheses. Continuous reactions will use
a feed mechanism to introduce a flow of reagents, and may isolate
the end-product as part of the process. Batch systems are also of
interest, where additional reagents may be introduced to prolong
the period of time for active synthesis. A reactor may be run in
any mode such as batch, extended batch, semi-batch,
semi-continuous, fed-batch and continuous, and which will be
selected in accordance with the application purpose.
[0160] In embodiments wherein a DNA template is used to drive in
vitro protein synthesis, the individual components of the protein
synthesis reaction mixture may be mixed together in any convenient
order. RNA polymerase is added to the reaction mixture to provide
enhanced transcription of the DNA template. RNA polymerases
suitable for use herein include any RNA polymerase that functions
in the bacteria from which the bacterial extract is derived. In
embodiments wherein an RNA template is used to drive in vitro
protein synthesis, the components of the reaction mixture can be
admixed together in any convenient order, but are preferably
admixed in an order wherein the RNA template is added last.
[0161] The reaction mixture can be incubated at any temperature
suitable for the transcription and/or translation reactions. The
reaction mixture can be agitated or unagitated during incubation.
The use of agitation enhances the speed and efficiency of protein
synthesis by keeping the concentrations of reaction components
uniform throughout and avoiding the formation of pockets with low
rates of synthesis caused by the depletion of one or more key
components. The reaction can be allowed to continue while protein
synthesis occurs at an acceptable specific or volumetric rate, or
until cessation of protein synthesis, as desired. The reaction can
be conveniently stopped by incubating the reaction mixture on ice,
or rapid dilution with water or an appropriate buffer. The reaction
can be maintained as long as desired by continuous feeding of the
limiting and non-reusable transcription and translation
components.
[0162] Various cell-free synthesis reaction systems are well known
in the art. See, e.g., Kim, D. M. and Swartz, J. R. Biotechnol.
Bioeng. 66:180-8 (1999); Kim, D. M. and Swartz, J. R. Biotechnol.
Prog. 16:385-90 (2000); Kim, D. M. and Swartz, J. R. Biotechnol.
Bioeng. 74:309-16 (2001); Swartz et al., Methods Mol. Biol.
267:169-82 (2004); Kim, D. M. and Swartz, J. R. Biotechnol. Bioeng.
85:122-29 (2004); Jewett, M. C. and Swartz, J. R., Biotechnol.
Bioeng. 86:19-26 (2004); Yin, G. and Swartz, J. R., Biotechnol.
Bioeng. 86:188-95 (2004); Jewett, M. C. and Swartz, J. R.,
Biotechnol. Bioeng. 87:465-72 (2004); Voloshin, A. M. and Swartz,
J. R., Biotechnol. Bioeng. 91:516-21 (2005).
[0163] Cell-free protein synthesis can exploit the catalytic power
of the cellular machinery. Obtaining maximum protein yields in
vitro requires adequate substrate supply, e.g. nucleoside
triphosphates and amino acids, a homeostatic environment, catalyst
stability, and the removal or avoidance of inhibitory byproducts.
The optimization of in vitro synthetic reactions benefits from
recreating the in vivo state of a rapidly growing organism. In some
embodiments of the invention, cell-free synthesis is therefore
performed in a reaction where oxidative phosphorylation is
activated, i.e. the CYTOMIM.TM. system. The CYTOMIM.TM. system is
defined by using a reaction condition in the absence of
polyethylene glycol with optimized magnesium concentration. The
CYTOMIM.TM. system does not accumulate phosphate, which is known to
inhibit protein synthesis, whereas conventional secondary energy
sources result in phosphate accumulation.
[0164] The concentration of magnesium in the reaction mixture
affects the overall synthesis. There is often magnesium present in
the cell lysate, which may then be adjusted with additional
magnesium to optimize the concentration. The CYTOMIM.TM. system
utilizes a preferred concentration of magnesium at least about 5
mM, usually at least about 10 mM, and preferably at least about 12
mM, and at a concentration of not more than about 20 mM, and
usually not more than about 15 mM. Other changes that may enhance
synthesis with respect to the CYTOMIM.TM. system is the removal of
HEPES buffer and phosphoenol pyruvate from the reaction mixture.
The CYTOMIM.TM. system is described in U.S. Pat. No. 7,338,789,
herein incorporated by reference.
[0165] In some embodiments of the invention, cell-free synthesis is
performed in a reaction where the redox conditions in the reaction
mixture is optimized. This may include adding a redox buffer to the
reaction mix in order to maintain the appropriate oxidizing
environment for the formation of proper disulfide bonds, e.g. by
the inclusion of glutathione at an appropriate ratio of oxidized to
reduced forms. The reaction mixture may further be modified to
decrease the activity of endogenous molecules that have reducing
activity. Preferably such molecules can be chemically inactivated
prior to cell-free protein synthesis, e.g. by treatment of the
lysate with iodoacetamide (IAM), or other compounds that
irreversibly inactivate free sulfhydryl groups. The presence of
endogenous enzymes having reducing activity may be further
diminished by the use of extracts prepared from genetically
modified cells having inactivation mutations in such enzymes, for
example thioredoxin reductase, glutathione reductase, etc.
Alternatively, such enzymes can be removed by selective removal
from the cell lysate during its preparation. Maximizing redox
conditions is described in U.S. Pat. Nos. 6,548,276 and 7,041,479,
herein incorporated by reference.
[0166] In some embodiments of the invention, cell-free synthesis is
performed in a reaction where the optimal amino acid concentration
is maintained by inhibiting enzymes that act to undesirably
metabolize specific amino acids Inhibition of enzymes that catalyze
the metabolism of amino acids can be achieved by addition of
inhibitory compounds to the reaction mix, modification of the
reaction mixture to decrease or eliminate the responsible enzyme
activities, or a combination of both. A preferred embodiment
eliminates arginine decarboxylase. Other such inhibitory compounds
to be eliminated from the protein synthesis reaction mixture may
include, but are not limited to, tryptophanase, alanine glutamate
transaminase, or pyruvate oxidase. Eliminating enzymatic activity
in order to optimize amino acid metabolism during cell-free protein
synthesis is described in U.S. Pat. No. 6,994,986, herein
incorporated by reference.
[0167] Following the in vitro synthesis reaction, synthesized
proteins containing non-native amino acids can be purified as in
standard in the art. Proteins of the invention can be recovered and
purified by methods including, but not limited to, ammonium sulfate
or ethanol precipitation, acid or base extraction, column
chromatography, affinity column chromatography, anion or cation
exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, hydroxylapatite
chromatography, lectin chromatography, gel electrophoresis, etc.
Newly synthesized proteins containing non-native amino acids must
be correctly folded. Proper folding may be accomplished using high
performance liquid chromatography (HPLC), affinity chromatography,
or other suitable methods where high purity is desired. A variety
of purification/protein folding methods are known in the art, e.g.,
Deutscher, Methods in Enzymology Vol. 182: Guide to Protein
Purification (Academic Press, Inc. N.Y. 1990); Bollag et al.,
Protein Methods, 2nd Edition, (Wiley-Liss, N.Y. 1996).
[0168] Following purification, proteins containing non-native amino
acids can possess a conformation different from the desired
conformations of the relevant polypeptides. In general, it is
occasionally desirable to denature and reduce expressed
polypeptides and then to cause the polypeptides to re-fold into the
preferred conformation. For example, guanidine, urea, DTT, DTE,
and/or a chaperone can be added to a translation product of
interest.
[0169] methods of reducing, denaturing and renaturing proteins are
well known to those of skill in the art. See, e.g. Debinski et al.,
J. Biol. Chem. 268:14065-70 (1993); Buchner et al., Anal. Biochem.
205:263-70 (1992).
[0170] The methods of the present invention provide for modified
proteins containing non-native amino acids that have biological
activity comparable to the native protein. One may determine the
specific activity of a protein in a composition by determining the
level of activity in a functional assay, quantitating the amount of
protein present in a non-functional assay, e.g. immunostaining,
ELISA, quantitation on coomasie or silver stained gel, etc., and
determining the ratio of biologically active protein to total
protein. Generally, the specific activity as thus defined will be
at least about 5% that of the native protein, usually at least
about 10% that of the native protein, and may be about 25%, about
50%, about 90% or greater. See, e.g., Sambrook et al., Molecular
Cloning: A Laboratory Manual (Cold Spring Harbor Press, Cold Spring
Harbor, N.Y. 1989).
[0171] Following the in vitro synthesis reaction and subsequent
purification, the desired protein containing the non-native amino
acids may be optionally used e.g., as assay components, therapeutic
reagents, or as immunogens for antibody production.
[0172] An embodiment of the current invention provides a cell-free
synthesis reaction system. The reaction system comprises a first
and second catalytic aminoacylating reagent reaction vessel that
comprises a charging mixture of reagents that are able to
aminoacylate each respective isoaccepting sense tRNA with its
respective corresponding amino acid, such that different
isoaccepting sense tRNAs are differentially charged with either a
native or non-native amino acid as desired. The reaction system
further has a reaction vessel that contains a cell lysate
containing a mixture of reagents able to carry out a cell-free
protein synthesis, in which the vessels described in the system
have openings that permit the combining of the two charging
mixtures and cell lysate into a single reaction mixture.
[0173] An embodiment of the current invention provides a kit for
the in vitro synthesis of proteins having non-native amino acids
introduced into preselected positions of the protein. The kit
contains the reaction vessels with the appropriate reagents
required for aminoacylating the isoaccepting sense tRNAs. The kit
further has a reaction vessel that contains a cell lysate
containing a mixture of regents able to carry out in vitro
synthesis of proteins from a nucleic acids template. One embodiment
utilizes aminoacyl-tRNA synthetases as the catalytic aminoacylating
reagent. Another embodiment utilizes a ribozyme as the catalytic
aminoacylating reagent. One embodiment contains a cell lysate
derived from a bacterial population. Another embodiment contains a
cell lysate derived from an E. coli population. Another embodiment
provides a cell lysate that has a function oxidative phophorylation
system.
[0174] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference.
[0175] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be readily apparent to those of ordinary
skill in the art in light of the teachings of this invention that
certain changes and modifications may be made thereto without
departing from the spirit or scope of the appended claims.
Examples
[0176] The following examples are provided by way of illustration
only and not by way of limitation. Those of skill will readily
recognize a variety of noncritical parameters which could be
changed or modified to yield essentially similar results.
Example 1
General Methods
[0177] Standard methods in molecular biology are described
(Maniatis et al. (1982) Molecular Cloning, A Laboratory Manual,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.;
Sambrook and Russell (2001) Molecular Cloning, 3yd ed., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Wu (1993)
Recombinant DNA, Vol. 217, Academic Press, San Diego, Calif.).
Standard methods also appear in Bindereif, Schon, & Westhof
(2005) Handbook of RNA Biochemistry, Wiley-VCH, Weinheim, Germany
which describes detailed methods for RNA manipulation and
analysis.
[0178] Methods for protein purification, chromatography,
electrophoresis, centrifugation, and crystallization are described
(Coligan et al. (2000) Current Protocols in Protein Science, Vol.
1, John Wiley and Sons, Inc., New York). Methods for cell-free
synthesis are described in Spirin & Swartz (2008) Cell-free
Protein Synthesis, Wiley-VCH, Weinheim, Germany. Methods for
incorporation of non-native amino acids into proteins using
cell-free synthesis are described in Shimizu et al (2006) FEBS
Journal, 273, 4133-4140.
Example 2
In Vitro Transcription and Isolation of tRNA 2',3'-cyclic
Phosphate
[0179] Isoaccepting tRNAs aminoacylated with non-native amino acids
can be produced from a designed tRNA-HDV ribozyme template DNA,
illustrated by example in FIG. 1, by in vitro transcription,
followed by purification by size exclusion chromatography (SEC),
enzymatic removal of the 2',3'-cyclic phosphate, and charging of
the tRNA with non-native amino acids (nnAAs) using engineered tRNA
synthetase enzymes, as illustrated in FIG. 2. In order to optimize
the transcription yield, four different in vitro transcription
protocols were tested for the tRNA transcripts illustrated in FIG.
3 and FIG. 4. All four different in vitro transcription protocols
gave similar tRNA yields. Transcription optimization was generally
carried out for 2-3 h at 37.degree. C. in 50 .mu.L reactions.
Reaction conditions were as follows: (1) 40 mM HEPES (pH 7.9), 10
mM DTT, 10 mM MgCl.sub.2, 2.5 mM spermidine, 4 U/ml
pyrophosphatase, 0.4 U/ml supeRNAse-in (Ambion), 20 mM NaCl, 4 mM
NTP, 0.024 mg/ml T7 RNA polymerase, 0.028 mg/ml plasmid DNA
template. (2) 80 mM HEPES (pH 7.5), 5 mM DTT, 22 mM MgCl.sub.2, 1
mM Spermidine, 0.12 mg/ml Bovine Serum Albumin (BSA), 1 U/ml
pyrophosphatase, 0.4 U/ml SupeRNAse-in, 3.75 mM NTPs, 0.024 mg/ml
T7 RNA polymerase, 0.028 mg/ml plasmid DNA template (3) 30 mM HEPES
(pH 7.9) 10 mM DTT, MgCl.sub.2, 2 mM Spermidine, 1 U/ml
pyrophosphatase, 0.4 U/ml supeRNAse-in, 4 mM NTPs, 0.024 mg/ml T7
RNA polymerase, 0.028 mg/ml plasmid DNA template. (4) 40 mM HEPES
(pH 8.0), 10 mM DTT, 46 mM MgCl.sub.2; 2 mM Spermidine, 0.4 U/ml
supeRNAse-in, 10 mM NaCl, 3 mM NTP, 0.024 mg/ml T7 RNA polymerase,
0.028 mg/ml plasmid DNA template. In contrast to previous findings
(Bindereif, Schon, & Westhof (2005)), we found that templates
encoding for Uracil at position 1 or 2 of the tRNA (e.g. constructs
1 and 4) were not seriously defective for transcription by T7 RNA
polymerase. As a result, the construct 1 tRNA.sub.CUC.sup.Glu was
preferred. The tRNA product produced using Protocol 1 was the most
homogenous so this protocol was used for large-scale transcriptions
with the exceptions noted below.
[0180] To produce large amounts of tRNA.sub.CUA.sup.Phe,
tRNA.sub.AAA.sup.Phe or tRNA.sub.CUA.sup.Glu construct 1, 100 mL
transcriptions were set up in certified RNAse free 50 ml conical
tubes. For example, large scale reactions for tRNA.sub.CUA.sup.Glu
construct 1 contained 0.4 U/.mu.L pyrophosphatase and 0.04 U/.mu.L
superRNAse-in were used. Transcription reactions were incubated for
2 hours at 37.degree. C., supplemented with another 0.024 mg/ml T7
RNA polymerase and incubated for 2 more hours at 37.degree. C.,
then filtered through 0.20 .mu.m PES filters (VWR catalog
#87006-062).
[0181] Typically, aliquots of 50 mL transcriptions were loaded onto
a 2 L Sephacryl S-100 or S-300 size exclusion resin in XK50/100
columns using an AKTA with 50 mM Tris (pH 6.5), 250 mM NaCl, 0.1 mM
EDTA to separate tRNA-2,3' cyclic phosphate from precursor RNA
transcripts and cleaved HDV ribozyme RNA (FIG. 5). 25 mL fractions
were collected and tRNA peak fractions were determined by TBE/UREA
PAGE gel electrophoresis. tRNA-2,3' cyclic diphosphate was
precipitated by adding 1/10 volume 3 M sodium acetate (pH 5.2) and
an equal volume of isopropanol, followed by incubation for 30
minutes at -80.degree. C., and pelleting tRNA by centrifugation
(20,000.times.g for 30 min in a FiberLite F-13 rotor). Pellets were
washed with 70% ethanol, air dried briefly, then resuspended in 1
mM sodium citrate buffer (pH 6.4).
[0182] Production of H. pylori tRNA.sub.UUG.sup.Gln (2 ml) was
carried out using Protocol 1. tRNA purification was performed with
a 26/60 Sephacryl S-200 size exclusion column (FIGS. 2a and 2b).
EDTA was omitted from the sizing column buffer. H. pylori tRNAGln
was resuspended in 50 mM Tris (pH 8.5).
[0183] In the course of these experiments we found that (1)
addition of 0.1 mM EDTA and (2) addition of RNAse inhibitor in the
transcription reactions prevents degradation of RNA (compare lanes
1 and 2 of FIG. 6A), due presumably due to significant RNAse
contamination in NTPs (Sigma Aldrich catalog #: U6625; G8877,
C1506, A7600). As shown in FIG. 6B intact purified tRNA.sup.Glu
incubated overnight at 37.degree. C. with NTPs was completely
degraded (lane 2), however, addition of RNAse inhibitor abrogated
this degradation (lane 3). This degradation was unlikely due to
simple metal dependent cleavage as addition of EDTA did not affect
degradation lane (lane 4). (Incubation with EDTA alone produces no
tRNA degradation (lane 5).) Second, we found in that in some cases,
tRNA purified without EDTA in the sizing column buffer and without
a chelating agent in the resuspension buffer was susceptible to
damage/degradation in the presence reducing agents (FIG. 6C;
compare lanes 1 and 2), perhaps due to heavy metal contamination of
tRNAs as it can be abrogated with the addition of EDTA (lane
3).
Example 3
Dephosphorylation of tRNA 2',3'-cyclic Phosphate to Release Active
tRNA
[0184] T4 polynucleotide kinase (PNK), required for the removal of
the 2'-3' cyclic phosphate from tRNA cleaved by HDV ribozyme (cf.
FIGS. 2 & 5), was produced as follows The PNK gene with an
N-terminal 6-Histidine tag was gene synthesized (DNA 2.0, Menlo
Park., Calif.), and cloned into plasmid pYD317. The plasmid
T4PNK_pYD317 was used to transform BL21(DE3) cells. These cells
were grown in a Braun 10 L fermenter on autoinduction media
(Studier F. W. (2005) Protein Expr. Purif, 41:207-234) for 18 hours
to a final OD of 21. Cells were harvested by centrifugation and to
obtain 240 g of cell pellet. 40 g of cell pellet were resuspended
in 500 ml Buffer A (50 mM Tris (pH 7.8), 300 mM KCl, 10 mM
imidazole), lysed by homogenization, was clarified by
centrifugation, and loaded onto a 35 mL Ni-IMAC column. The column
was washed with 5 column volumes of Buffer A. Buffer A plus 0.5 mM
BME, 300 mM imidazole, 0.1 .mu.M ATP, and 10% glycerol (v/v) was
used for elution. To prevent aggregation, PNK-containing fractions
were immediately diluted 4.times. with Buffer A containing 20%
glycerol. PNK-containing fractions were pooled and buffer exchanged
into PNK storage buffer (20 mM Tris (pH 7.6), 100 mM KCl, 0.2 mM
EDTA, 2 mM DTT, 50% glycerol) at a final concentration of 1.2
mg/mL.
[0185] tRNA-2',3'-cyclic phosphate (40 .mu.M) was incubated at
37.degree. C. with 50 .mu.g/ml PNK in 50 mM MES (pH 5.5), 10 mM
MgCl.sub.2, 300 mM NaCl, and 0.1 mM EDTA for 1 hr leaving 2',3'-OH
groups at the 3' terminus of the tRNA, followed by
phenol:chloroform:isoamylalcohol extraction and buffer exchanged
using a PD10 (GE health sciences) size exclusion column
pre-equilibrated in 0.3 M sodium acetate (pH 5.2) to remove
inorganic phosphate and excess phenol. tRNA was precipitated by
addition of an equal volume isopropanol, incubation at -80.degree.
C. for 30 min, centrifuged for 30 min at 20,000.times.g, washed
with 70% ethanol, centrifuged for 10 min at 20,000.times.g, air
dried and resuspended in 0.1 mM sodium citrate (pH 6.4). tRNA was
refolded by heating to 70.degree. C., addition of 10 mM MgCl.sub.2,
and then slowly cooled to room temperature. tRNA concentration was
determined using a NanoDrop 1000 spectrophotometer (Thermo
Scientific) with 1A.sub.260=40 .mu.g/mL, and confirmed by TBE/urea
gel electrophoresis. Yields of .about.2-10 mg of active, chargeable
tRNA could be achieved from a 100 mL transcription reaction. H.
pylori tRNA.sup.Gln was prepared similarly using an earlier
iteration of this protocol with the following differences: tRNA
concentration was 8.6 .mu.M; in PNK reactions, PNK concentration
was 0.020 mg/ml, EDTA was omitted, and 1 mM .beta.-mercaptoethanol
was added. The tRNA was resuspended in DEPC treated sterile water
after purification.
[0186] The extent of dephosphorylation was assayed by acid/urea gel
electrophoresis and by phosphate release using a Malachite Green
phosphate detection assay (R&D Systems, Inc). FIG. 7 shows that
dephosphorylated tRNA has a reduced mobility in acid/urea gel
electrophoresis (Bindereif, Schon, & Westhof (2005)). Aliquots
containing 3 .mu.g of dephosphorylated tRNA were diluted 2-fold in
loading buffer (100 mM sodium acetate (pH 5.2), 7 M urea, 1 mg/ml
bromophenol blue dye) and loaded on a 6.5% 19:1 acrylamide, 100 mM
sodium acetate (pH 5.2), 7 M urea gel (40 cm.times.34 cm) and
electrophoresed overnight at 40 W. Gels were stained using 0.06%
methylene Blue, 0.5 M sodium acetate (pH 5.2) for 30 minutes and
destained with deionized water. Both assays indicated essentially
complete and quantitative dephosphorylation after 1 h.
Example 4
Recombinant Expression of an Aminoacyl-tRNA Synthetase: Vectors,
Enzyme Expression, and Purification
[0187] The separate tRNA aminoacylation (charging) reactions
illustrated by the last step in FIG. 2 require the use of an
engineered aminoacyl-tRNA synthetase to aminoacylate isoaccepting
tRNA molecules. This synthetase can be obtained by expressing a
recombinant engineered synthetase as described in the examples
below.
[0188] E. coli glutamyl-tRNA synthetase (GluRS) was cloned,
expressed and purified by IMAC chromatography. The E. coli GluRS
expression construct was transformed into BL21(DE3) cells. Colonies
were inoculated into 2 ml LB broth supplemented with 100 .mu.g/ml
ampicillin (LB-AMP) and grown to saturation at 37.degree. C. This
culture was diluted into 100 ml LB-AMP and grown to saturation at
37.degree. C. This entire culture was used to inoculate 10 L of
autoinduction media (Studier (2005), Protein Expr Purif.;
41,207-34) supplemented with 100 .mu.g/mlAmpicillin in a Bioflo
3000 fermentor. This culture was grown for 18 hours at 37.degree.
C. until it reached an OD of .about.12. Cells were harvested in
Sharples centrifuge and frozen at -80.degree. C. 30 g of cell
pellet was resuspend in 500 ml of GluRS Lysis Buffer (50 mM sodium
phosphate (pH 8.0), 300 mM NaCl, 10 mM imidazole, 10% glycerol) and
lysed by passage through an Avestin C55A homogenizer. Lysate was
clarified by centrifugation in a JA-17 (Beckman) rotor at
40,000.times.g for 30 min. The supernatant was passed over a 30 ml
Ni.sup.2+ Sepharose 6 Fast Flow (GE Healthcare) column equilibrated
in GluRS lysis buffer. The column was then washed with 15 column
volumes of GluRS Wash Buffer (50 mM sodium phosphate pH 8.0; 300 mM
sodium chloride; 20 mM imidazole; 10% glycerol), and eluted with 5
column volumes of GluRS Elution Buffer (50 mM sodium phosphate pH
8.0; 300 mM sodium chloride; 300 mM imidazole; 10% glycerol) as
illustrated in FIG. 8a. Peak fractions were pooled, dialyzed twice
into 2 L of 2.times. GluRS Storage Buffer (100 mM HEPES, pH 8.0; 40
mM sodium chloride; 1 mM dithiothreitol (DTT); 0.2 mM EDTA), and
diluted 2-fold with 100% glycerol. Recovery was .about.945 mg GluRS
from 30 g of cell pellet. Protein was stored at -80.degree. C. for
extended periods of time and -20.degree. C. once thawed.
[0189] H. pylori GluRS2 (ND) (also termed a non-discriminating (ND)
synthetase) was cloned, expressed, and purified by IMAC as follows.
The H. pylori GluRS2 (ND) expression construct was transformed into
BL21 (DE3) cells and plated on two LB-AMP plates at 37.degree. C.
The next morning 10 ml LB was added to the plates and they were
then scrapped with a sterile pipet to resuspend all colonies. The
resuspension was added to 2 L of LB-AMP and grown at 37.degree. C.
In keeping with previous work (Skouloubris, Ribas de Pouplana et
al. (2003) Proc Natl Acad Sci USA, 100, 11297-302), to avoid
incorporation of glutamate in GluRS2(ND)'s glutamine codons as a
result of its own expression, overexpression was induced with 1 mM
isopropyl .beta.-D-thiogalactoside at OD.sub.600.about.0.9 for only
30 min Cells were harvested by centrifugation at 4500 rpm for 30
min in a Sorvall RC-3B centrifuge, and frozen at -80.degree. C.
Cell pellet from 2 L of culture was resuspended in 25 ml lysis
buffer (20 mM Tris, pH 8.5; 300 mM NaCl; 10% glycerol; 10 mM
imidazole) supplemented with 250 .mu.L bacterial protease inhibitor
cocktail (Sigma). Cells were lysed by addition of lysozyme (to 1
mg/ml) and passage 10.times. through a 22 gauge blunt needle. Total
lysate was clarified by centrifugation at 35,000.times.g for 30
min. Lysate was diluted 3.times. in lysis buffer then bound in
batch mode for 10 minutes to 1 ml of IMAC High Performance
Sepharose charged with NiSO.sub.4 and equilibrated in lysis buffer.
The resin was washed with 10 column volumes of lysis buffer
supplemented with 0.5 mM DTT, and then eluted 5.times. with 1 ml
GluRS2 (ND) Elution Buffer (Lysis Buffer supplemented with 300 mM
imidazole and 0.5 mM DTT) as illustrated in FIG. 8b. Peak fractions
were concentrated by Vivaspin 10 kD MWCO ultrafiltration.
Preliminary dialysis of concentrated protein into 40 mM HEPES, pH
7.2, 0.2 mM EDTA, 1 mM DTT resulted in GluRS2 (ND) precipitation.
Sodium chloride was added to resolubilize and protein was instead
dialyzed into GluRS2 (ND) Storage Buffer (20 mM Tris, pH 8.5; 300
mM NaCl; 10% glycerol; 0.5 mM DTT; 0.1 mM EDTA). Protein was stored
in small aliquots at -80.degree. C. .about.0.6 mg of GluRS2(ND) was
recovered from the purification.
[0190] E. coli phenylalanyl-tRNA synthetase (PheRS) is an obligate
dimer consisting of two subunits, PheS and PheT, as illustrated in
FIG. 9a for the homologous enzyme from T. thermophilis. The
mutation A294G was introduced in the E. coli PheS in order to
increase the percent charging of non-native para-substituted
phenylalanine analogs (Datta, Wang et al. (2002) J Am Chem Soc,
124, 5652-3) using a QuickChange Mutagenesis kit (Stratagene) and
overlapping primers The resulting 6XHisPheS(A294G) gene was
subcloned into pET21(a) using Nde I to Sal I restriction sites.
This plasmid was used to transform BL21(DE3) competent cells. Cells
were grown overnight in auto-induction media yielding PheS(A294G)
subunit in inclusion bodies. Cells were lysed by homogenization and
the inclusion bodies were pelleted by centrifugation, completely
resuspended in 6 M guanidine, then diluted with PBS to a final
concentration of 2 M guanidine-HCl. The PheT gene was amplified
from E. coli genomic DNA using primers containing NdeI and XhoI
restriction sites. The PCR fragment was subcloned into pET24(b),
and expressed using the identical autoinduction media as
PheS(A294G). In contrast to PheS(A294G), the expressed PheT subunit
was soluble. Cells were lysed in Ni affinity purification load
buffer: 50 mM NaPO4 buffer (pH 7.5), 300 mM NaCl, and 5 mM
imidazole. The lysate was clarified, and then PheS(A294G) in 2 M
guanidine-HCl was added slowly with stirring. Refolded PheRS was
isolated by Ni affinity chromatography followed by size exclusion
chromatography using an S100 size exclusion resin.
[0191] Alternatively, and more efficiently, PheRS(A294G) and
variants in the anticodon recognition site of the PheT domain were
produced by cell-free synthesis from independent PheS and PheT
genes cloned into pYD317 as summarized in Table 1:
TABLE-US-00001 TABLE 1 PheT Variants in FIG. 10 Corresponding
Mutations PheT MP R794M R788P PheT QP R794Q R791P PheT AP R794A
A791P PheT K R794K PheT KV R794K A15V
Plasmids of pYD317 PheS(A294G) and pYD317 PheT variants were added
to cell-free reactions simultaneously at a concentration of ug/mL.
and cell-free synthesis was carried out for hrs. The heterodimeric
protein variants were purified by IMAC is shown in FIG. 10 and can
subsequently be used to charge isoaccepting tRNAs.
Example 5
Radioactive Methods for Monitoring tRNA Aminoacylation with
nnAAs
[0192] The 3' terminal adenosine nucleotide of tRNAs was exchanged
with .alpha.-.sup.32P-AMP using E. coli CCA nucleotidyl transferase
enzyme as described (Ledoux & Uhlenbeck (2008), Methods, 44,
74-80). Reaction conditions are driven toward removal of the 3'-AMP
using excess PPi, and then toward addition of AMP using PPiase.
Active tRNA was incubated with CCA enzyme in 50 mM Glycine pH 9.0,
10 mM MgCl.sub.2, 0.3 .mu.M .alpha.-.sup.32P-ATP, 0.05 mM PPi for 5
min at 37.degree. C. 1 .mu.l of 10 .mu.M CTP and 10 U/ml (1 Unit)
of inorganic pyrophosphatase (yeast-Sigma) was added, and incubated
for 2 min longer, then 1/10th volume of 3 M NaOAc pH 5.2 was added
to each aliquot. The resulting 3'-end radiolabeled tRNA was diluted
1:5 with water and refolded prior to use.
[0193] Aminoacylation of nnAAs onto tRNA.sup.Phe was performed
using optimized conditions. The conditions for wild-type
tRNA.sub.GAA.sup.Phe aminoacylation were 50 mM Hepes pH 7.5, 40 mM
KCl, 10 mM MgCl.sub.2, 5 mM ATP, 8-40 .mu.M tRNA.sub.GAA.sup.Phe,
10 mM DTT, 10-100 mM amino acid (Phe or para-acetyl Phenylalanine
(pAF)), and 1-100 .mu.M PheRS or PheRS A294G. End labeled tRNA
reactions are digested with P1 nuclease for 20-60 min at room
temperature and 1 .mu.l is spotted on a pre-washed (water) PEI
cellulose TLC plate and allowed to air dry. AMP is resolved from
aa-AMP in acetic acid/1M NH.sub.4Cl/ddH.sub.2O (5:10:85) as
monitored by autoradiography using a Molecular Dynamics storage
phosphor screen with a Storm 840 Phosphoimager (FIGS. 11 and 12).
In contrast to the results shown in FIG. 11, Peterson and Uhlenbeck
(Peterson and Uhlenbeck (1992) Biochemistry, 31, 10380-9) have
shown that under limiting [ tRNA.sub.CUA.sup.Phe], charging by
phenylalanine is very inefficient.
[0194] The kinetics of tRNA.sub.CUA.sup.Phe and
tRNA.sub.AAA.sup.Phe aminoacylation with pAF were monitored in 50
mM Hepes pH 8.1, 40 mM KCl, 75 mM MgCl.sub.2, 5 mM ATP, 0.1% Triton
X-100, 1.4 M DMSO, .025 U/.mu.l Inorganic pyrophosphatase, 8-40
.mu.M tRNA.sub.CUA.sup.Phe or tRNA.sub.AAA.sup.Phe, 10 mM DTT,
10-100 mM pAF, and 1-100 .mu.M PheRS or PheRS(A294G). FIG. 13 shows
that pAF is efficiently charged to form pAF-tRNA.sub.CUA.sup.Phe
and pAF-tRNA.sub.AAA.sup.Phe under the conditions of this
reaction.
[0195] We used high concentrations--18 .mu.M each--of E.coli GluRS
and tRNA.sub.CUC.sup.Glu in the charging reactions. Normal charging
conditions were: 10 .mu.L reactions, 37.degree. C. incubation for
30 min in 50 mM HEPES, pH 7.5; 10 mM MgCl.sub.2; 10 mM DTT; 10 mM
ATP; 10 mM glutamic acid, pH 7.5; 10 U/ml pyrophosphatase; and 1
.mu.L of [.sup.32P] end labeled tRNA.sub.CUC.sup.Glu Reactions were
quenched with 1 .mu.L of 3 M sodium acetate. Encouragingly, with
such high concentrations of tRNA and GluRS, we found that mutant
tRNA.sub.CUC.sup.Glu could be charged with cognate glutamate to 75%
even with normal buffer conditions (FIG. 14a, lane 2). By changing
the reaction pH to 8.1 and increasing Mg.sup.2+ concentrations to
70 mM charging increased slightly to 77%. Further addition of
dimethyl sulfoxide (DMSO) to 2.5 M and Tween-20 to 0.25% resulted
in an additional increase to 84% charging (FIG. 14a, lane 4).
Fluoro substituted glutamate charging onto wild type tRNA.sup.Glu
could not be detected under the conditions of this assay (FIG. 14a,
lane 5), due to the poor separation of fluoro substituted
glutamate-AMP and AMP in the thin layer chromatography (Hartman,
Josephson et al. (2007) PLoS ONE, 2, e972).
[0196] We also confirmed the activity of the purified H. pylori
GluRS2(ND) (1.9 .mu.M) using, H. pylori tRNA.sup.Gln 3.4 .mu.M,
pyrophosphatase 50 U/ml and 0.5 .mu.L of [.sup.32P] end labeled H.
pylori tRNA.sup.Gln was included in each reaction. Similarly, no
charging of mono-fluoro substituted glutamate was observed using
this assay (FIG. 14b)
Example 6
Non-Radioactive Methods for Monitoring tRNA Aminoacylation with
nnAAs
[0197] Non-radiolabledtRNA.sub.GAA.sup.Phe tRNA.sub.CUA.sup.Phe,
and tRNA.sub.AAA.sup.Phe were aminoacylated in 50 mM Hepes pH 7.5,
40 mM KCl, 10 mM MgCl.sub.2, 5 mM ATP, 8-40 .mu.M
tRNA.sub.GAA.sup.Phe, 10 mM DTT, 10-100 mM amino acid (Phe or pAF),
and 1-100 .mu.M PheRS or PheRS A294G. The conditions for
tRNA.sub.CUA.sup.Phe and tRNA.sub.AAA.sup.Phe aminoacylation were
50 mM Hepes pH 8.1, 40 mM KCl, 75 mM MgCl.sub.2, 5 mM ATP, 0.1%
Triton X-100,1.4 M DMSO, 8-40 .mu.M tRNA.sub.AAA.sup.Phe or
tRNA.sub.CUA.sup.Phe, 10 mM DTT, 10-100 mM pAF , and 1-100 .mu.M
PheRS or PheRS A294G. Reactions are incubated at 37.degree. C. for
15 min and quenched with 2.5 volumes of 300 mM sodium acetate pH
5.5. The quenched sample was extracted with 25:24:1
phenol:chloroform:isoamyl alcohol pH 5.2 (Ambion), vortexed for 2
min, then centrifuged at 14,000.times.g for 10-30 min at 4.degree.
C. to separate the aqueous (tRNA) and organic phases (protein). The
aqueous phase (containing charged tRNA) was removed and added to a
pre-equilibrated (300 mM NaOAc) G25 sephadex resin size exclusion
column that separates based on the size of the molecule. The eluant
was mixed with 2.5 volumes of 100% ethanol and incubated at
-80.degree. C. for 15-30 minutes and centrifuged at
.about.14,000.times.g for 30-45 minutes. The pelleted aminoacylated
tRNA is stored at -80.degree. C. or resuspended in a slightly
acidic buffer for injection into the HPLC and/or use in cell-free
synthesis reactions.
[0198] Aminoacylation of non-radiolabeled tRNA.sub.GAA.sup.Phe,
tRNA.sub.CUA.sup.Phe, and tRNA.sub.AAA.sup.Phe monitored by HPLC
hydrophobic interaction chromatography (HIC) that resolved the
aminoacylated and unaminoacylated moieties of tRNA as shown in FIG.
15 & FIG. 16. The HPLC C5 column was equilibrated in buffer A
(50 mM potassium phosphate and 1.5 M ammonium sulfate pH 5.7), then
1-10 .mu.g of pelleted aminoacylated tRNA mixed with 100 .mu.l of
2.times. buffer A was injected and separated with a gradient from
buffer A to buffer B (50 mM potassium phosphate and 5% isopropanol)
over 50 minutes. The fraction of aminoacylated tRNA determined by
peak area showed good agreement with the fraction determined using
[.sup.32P]-end labeled tRNA as in FIG. 13 for reactions run under
the same conditions.
[0199] Alternatively, tRNA.sub.CAC.sup.Gln charged using E. coli
GluRS to aminoacylate with mono-fluoroglutamate or
pAF-tRNA.sub.CAC.sup.Phe and tRNA.sub.GAA.sup.Phe (FIG. 15) were
separated using acid/urea polyacrylamide 40 cm.times.34 cm gel
electrophoresis. For charging tRNA.sub.CAC.sup.Glu reaction
conditions were: 12.5 .mu.L reactions, 37.degree. C. incubation for
30 minutes in 50 mM HEPES, pH 8.1; 70 mM MgCl.sub.2; 10 mM DTT; 10
mM ATP; 10 mM amino acid, pH 8.1; 16.6 U/ml pyrophosphatase. (To
assure absence of RNAse in charging reactions, prior to tRNA
addition the buffer was ultrafiltered through a 3000 Dalton
molecular weight cut-off membrane (Microsep 3K Omega; Pall
lifesciences). Reactions were quenched with 1.25 .mu.L of 3M sodium
acetate, diluted 2-fold in loading buffer (100 mM sodium acetate pH
5.2; 7 M urea; 1 mg/ml bromophenol blue dye) and loaded on 6.5%
19:1 acrylamide; 100 mM sodium acetate, pH 5.2; 7 M urea gels and
electrophoresed overnight at 40 W. Gels were stained using 0.18%
Methylene Blue, 0.5 M sodium acetate, pH 5.2 for 30 minutes and
destained with deionized water. Charging of wild type tRNA.sup.Glu
(Chemical Block, Moscow, Russia) or in vitro transcribed
tRNA.sub.CUC.sup.Glu with cognate glutamate or non-native
fluoroglutamate could be observed up to 70% (FIG. 17).
Example 7
Cell-Free Protein Synthesis to Manipulate nnAA Incorporation
[0200] Cell-free extracts or lysates were generated to maximize
ribosome yield using rapid growth of high cell density
fermentations of E. coli strain KGK10 (Knapp, Goerke et al. (2007)
Biotechnol Bioeng, 97, 901-8), essentially as described by Liu et
al.(Liu, Zawada et al. (2005) Biotechnol Prog, 21, 460-5)
DL-dithiothreitol was not added to the cell lysate following
homogenization. A modified "run-off procedure" was used to prepare
the cell-free extract. Fermentation volume to generate sufficient
cell-free extract was typically 2.5.times. the desired cell-free
reaction volume. To inactivate the reducing activity of the cell
extract, iodoacetamide (IAM) at various concentrations was added as
previously described (Yang, Kanter et al. (2004) Biotechnol Prog,
20, 1689-96). Gene expression was under the control of the T7
promoter. In order to facilitate translation initiation, genes were
synthesized (DNA 2.0, Menlo Park, Calif.) with synonymous codons at
the 5' end of the gene with ATG start codon (N-terminal methionine
residue) optimized for mRNA instability as measured by mRNA
.DELTA.G.sub.fold in the -6 to +37 positions (Kudla, Murray et al.
(2009) Science, 324, 255-258) and rare codons were replaced.
[0201] Cell-free reactions were run at 30.degree. C. containing 8
mM magnesium glutamate, 10 mM ammonium glutamate, 130 mM potassium
glutamate, 35 mM sodium pyruvate, 1.2 mM AMP, 0.86 mM each of GMP,
UMP, & CMP, 2 mM amino acids (1 mM for tyrosine), 4 mM sodium
oxalate, 1 mM putrescine, 1.5 mM spermidine, 15 mM potassium
phosphate, 100 nM T7 RNA polymerase, 2-50 nM DNA template(s), 1-10
.mu.M E. coli DsbC, and 24-30% (v/v) IAM-treated cell-free extract.
The redox potential was manipulated by the addition of reduced
(GSH) and oxidized (GSSG) glutathione to a total concentration of
.about.5 mM. The initial redox potential was calculated using the
Nernst equation with E.sup.0=-205 mV as the standard potential of
the GSH/GSSG couple at 30.degree. C. and pH 7 (Wunderlich and
Glockshuber (1993) Protein Science, 2, 717-726).
[0202] GMCSF was expressed in the cell-free protein synthesis
system at 30.degree. C. for 6 hours. FIG. 18 illustrates how the
concentration of added amino acids, Lys and Phe, but not Glu, may
be manipulated in the cell-free reaction to affect protein
synthesis.
Example 8
Depletion of an Endogenous Aminoacyl-tRNA Synthetase
[0203] The genomic copy of glutamate-tRNA synthetase (gltX) was
tagged with a C-terminal FLAG-tag in order to remove the synthetase
activity using FLAG-tag affinity chromatography while maintaining
the enzyme activity for preparation of the cell-extract prepared
from E. coli KGK10. Gene insertion was carried out using Quick
&Easy E.coli Gene Deletion Kit (Cat. No. K006) from GENE
BRIDGES (Heidelberg, Germany) according to the protocol suggested
by the manufacturer. A 708-FLPecm.sup.R expression plasmid (A105,
GENE BRIDGES) was used to eliminate the selection marker from E.
coli chromosome. The DNA insertion cassette was amplified by PCR
extension using AccuPrime pfx SuperMix (Invitrogen) according to
the protocol suggested by the manufacturer. DNA template was
FTR-PGK-gb2-neo-FRT template DNA from Quick &Easy E.coli Gene
Deletion Kit. Primers included:
TABLE-US-00002 5'GCGTATCAACAAAGCGCTGGATTTTATTGCTGAACGCGAAAATCAGCA
GGGTGGCGACTACAAAGATGACGATGACAAATAAAATTAACCCTCACTAA AGGGCGG3' and
5'AGGGATTATCGGATTGTTACAACGCTTAGGGATTCGCGATAGCAAATA
ATTAATACGACTCACTATAGGGCTCG3'
[0204] PCR fragments were purified with QIAGEN DNA purification kit
before transforming E. coli KGK10 by electroporation. The DNA
fragment including 3' end and downstream of gltX was amplified from
chromosome DNA of KGK10.DELTA.gltX::gltX-Flag using primers
5'GTTCAACACCGACAAGCTGCTGTGGCTG3' and 5'
GCGGGAAGGGATTATCGGATTGTTACAACGC3'. Flag-tag encoding sequence was
confirmed by using a primer, 5'GATTACTGACTGGACCGCTG3'. First,
primers were designed for PCR amplification the DNA fragment
containing the Flag-tag encoding sequence at 3'end of gltX. The
Flag-tag sequence DYKDDDDK was connected to the C-terminus of
glutamate-tRNA synthetase through a dipeptide GG. The tag peptide
sequence was back translated to DNA sequence,
5'GGGTGGCGACTACAAAGATGACGATGACAAA3'. A stop codon TAA was added
just behind the FLAG-tag encoding sequence. The forward primer
included a 50 Nt homology sequence that encoded the C-terminus of
glutamate--tRNA synthetase (GluRS) at 5'end, the Flag-tag sequence
in the middle, and the amplifying sequence AATTAACCCTCACTAAAGGGCGG
at the 3'end. The backward primer was designed by connecting the
amplifying sequence TAATACGACTCACTATAGGGCTCG to a 50 Nt homology
sequence which is located downstream of gltX gene. Second, the
linear fragment for FLAG-tag sequence insertion was amplified and
transformed into KGK10 to replace a 441 by sequence downstream of
gltX. Flag-tag insertion mutants were selected by kanamycin
resistance marker which was inserted to the genomic DNA of KGK10.
Then, the kanamycin resistance marker for selection was eliminated
using 708-FLPecm.sup.R expression plasmid . Finally, the FLAG-tag
encoding sequence was confirmed by sequencing the PCR fragment
which was amplified from the mutant KGK10.DELTA.gltX::gltX-Flag. A
DNA sequence, 5'GGGTGGCGACTACAAAGATGACGATGACAAA3', was attached to
the 3' end of the gltX gene in the KGK10 chromosome. This fragment
encodes the amino acid sequence GGDYKDDDDK, two Gly residues and a
FLAG-tag. Removal of the FLAG-tagged GluRS protein from the
cell-free extract is achieved by passing the extract over anti-FLAG
M2 magnetic beads (Sigma cat # M8823) and removing the beads.
Example 9
Depletion of Endogenous aaRS Activity Using Active Site Directed
Inhibitors Phe- and Glu-sulfamoyladenosine (Phe-SA &
Glu-SA)
[0205] FIG. 19 illustrates how the reactivity of added isoaccepting
charged nnAA-tRNAs added to the cell-free reaction can be modulated
using active site directed inhibitors to limit the background
recharging of the added isoaccepting tRNA.
[0206] The 5'-O-[N-(aminoacyl)sulfamoyl] adenosine inhibitor Phe-SA
(FIG. 19b) was synthesized as follows: to a solution of alcohol (7
g, 17.03 mmol, 1.0 eq) in DMAC (70 mL) at 0.degree. C. was added
DIEA (10.62 mL, 59.61 mmol, 4.0 eq) and sulfamoyl chloride (4 eq)
and the reaction mixture was stirred at room temperature for 15 h.
The reaction mixture was diluted with ethyl acetate (300 mL) and
washed with water (4.times.50 mL). The organic layer was dried over
MgSO.sub.4, evaporated and purified by column chromatography (DCM
to 20% MeOH in DCM) to give the activated sulfamate (4.5 g, 9.18
mmol, 54% yield) To a solution of sulfamate (2.0 g, 4.07 mmole, 1
eq), DCC (0.841 g, 4.07 mmol, 1 eq), DMAP (050 g, 4.07 mmol, 1.0
eq) in DCM (45 mL) was added Boc-Phe-OH (1.1 g, 4.07 mmol, 1 eq)
and the reaction mixture was stirred at room temperature for 10 h.
The reaction mixture was diluted with ethyl acetate (450 mL),
washed with saturated aqueous NaHCO.sub.3, water, brine, dried over
MgSO.sub.4, and evaporated. The crude product was dissolved in
MeOH/n-butylamine (30mL/30mL) and stirred at room temperature for 3
h. The solvents were evaporated and the crude product was purified
by flash chromatography (EtOAc to 10% MeOH/EtOAc) to give the
Phe-SA inhibitor (0.90 g, 1.4 mmol, 35% yield)
[0207] The effects of 5'-O-[N-(aminoacyl)sulfamoyl] adenosine
inhibitors (Phe-SA and Glu-SA) in cell-free synthesis of a GFP
reporter protein, turboGFP are illustrated in FIG. 19c. Cell-free
synthesis reactions at 30.degree. C. were monitored by fluorescence
(.lamda..sub.Ex=476 nm and .lamda..sub.Em=490 nm). with an adhesive
cover (VWR, 9503130) in a Molecular Devices SpectraMaxM5 plate
reader for 5 h. Aminoacyl synthetase inhibitors Phe-SA and Glu-SA
(Integrated DNA Technologies, Iowa) were serially diluted 3-fold in
DEPC-water from stock solutions in TE buffer (Invitrogen, 12090)
and transferred to a 96-well V-bottom polypropylene plate (Greiner
Bio-One, 651207). The cell-free reaction mix was immediately added
to the microplate with inhibitor for a 25 .mu.L final reaction
volume. The maximal rate of fluorescence change (V.sub.0
(RFU/sec)=no inhibitor, V=in the presence of inhibitor) were
determined and the percent relative activity determined as a
function of added inhibitor concentration as shown. Importantly,
these inhibitors are competitively specific to their respective
aminoacyl tRNA synthetases (PheRS and GluRS), as turboGFP
fluorescence activity in the presence of 1 nM Phe-SA inhibitor
(.about.50% activity) can be completely restored with the addition
of >10 .mu.M PheRS(A294G) as shown in FIG. 20. Surface response
analysis of GFP activity as a function of varying both [Phe-SA] and
added L-phenylalanine is consistent with the competitive and
specific nature of the Phe-SA inhibition.
Example 10
Incorporation of pAF into turboGFP Y50TAG
[0208] FIG. 21 illustrates the features required for efficient
dual-charging of isoaccepting tRNAs that requires removal (or
inhibition) of a native, endogenous tRNA synthetase, followed by
the addition of specific isoaccepting engineered charged tRNAs for
efficient incorporation of nnAAs into proteins. Here, the potential
recharging of exogenously introduced tRNAs can be overcome if the
synthetase(s) responsible for regenerating the aminoacyl-tRNA
moiety are removed (cf example 8) or inhibited (cf example 9).
[0209] To control and optimize the cell-free synthesis of proteins
containing non-native amino acids (nnAAs) we aimed to establish a
quantitative framework that describes the kinetics and
thermodynamics of individual steps in the overall process (cf FIG.
19a). Such a framework provides insights into the functions and
mechanisms of each participant in the process and serves as a
foundation for in-depth analyses and optimization of the cell-free
incorporation of nnAAs into proteins.
[0210] We constructed and analyzed a minimal kinetic model (cf FIG.
19) based on the cell-free synthesis of the green fluorescent
protein from Anthropoda, turboGFP (Evdokimov, Pokross et al. (2006)
EMBO Rep, 7, 1006-12). An amber (UAG) codon was introduced at
position 50 in the protein sequence, yielding plasmid turboGFP
Y50TAG (FIG. 22). In the absence of added suppressor tRNA, only the
expected 6 kD truncated protein is synthesized from this
plasmid.
[0211] The kinetics of the cell-free synthesis of fluorescent
turboGFP in microtiter plate format were monitored by fluorescence
(.lamda..sub.Ex=476 nm and .lamda..sub.Em=510 nm) with an adhesive
cover (VWR, 9503130) in a Molecular Devices SpectraMax M5 plate
reader for up to 5 h in a volume of 25 .mu.l per well. FIG. 23
shows that the reference pYD317-turboGFP plasmid yields a strong
fluorescent signal after 5 h of synthesis. A control reaction
containing turboGFP Y50TAG plasmid only yields no fluorescence,
consistent with the ca. 6 kD truncated product (cf FIG. 22). The
incorporation of para-acetyl phenylalanine at position 50 using the
UAG-specific E. coli phenylalanine tRNA.sub.CUA.sup.Phe and
tRNA.sub.GAA.sup.Phe was measured in the presence 12 nM Phe-SA
inhibitor, to inhibit the endogenous activity of PheRS (cf. FIG.
19c). No protein was synthesized when uncharged
tRNA.sub.CUA.sup.Phe and tRNA.sub.GAA.sup.Phe were added under
these conditions, showing that a) none of the other 19 aaRS can
react with these tRNAs (FIG. 24) and b) PheRS is completely
inhibited under these conditions. Also, addition of a single
charged Phe-tRNA.sub.GAA.sup.Phe does not result in protein
synthesis, showing that this tRNA is specific only for TTC or TTT
codons. In contrast, addition of various concentrations of both
charged pAF-tRNA.sub.CUA.sup.Phe and Phe-tRNA.sub.GAA.sup.Phe
results in 13-20% of the wild-type fluorescence after 5 h,
consistent with significant protein synthesis with incorporation of
pAF at position 50. As the [Phe-tRNA.sub.GAA.sup.Phe] was
increased, the total fluorescence increased to up to .about.20% of
the positive control expression, suggesting there is an optimal
concentration of Phe-tRNA.sub.GAA.sup.Phe for achieving high
nnAA-protein yield. These results suggest that the acylated tRNAs
are stable and are effectively delivered to the ribosome (FIG. 24)
during the time course of the cell-free reaction.
Example 11
Obtaining a Template
[0212] The present invention requires the use of a nucleic acid
template for the cell-free protein synthesis reaction. The
following provides an example of generating a template having codon
sequences constructed based on placement of non-native amino acids
within the desired polypeptide.
[0213] An amino acid sequence of human granulocyte macrophage
colony stimulating factor (hGMCSF) is obtained from Research
Collaboratory for Structural Bioinformatics (RCSB) protein data
bank (PDB). A structural DNA gene encoding hGMCSF protein is
synthesized de novo (DNA 2.0, Menlo Park, Calif.) such that all,
but the second, glutamine amino-acid residues are encoded by the
first codon CAA. The second glutamine from the N-terminus of the
protein is encoded by the codon CAG. The gene is flanked by the T7
promoter and terminator and is inserted into a plasmid vector
containing an E. coli origin of replication and kanamycin
resistance gene. The circular plasmid DNA template is prepared by
transforming XL1Blue (Stratagene, La Jolla, Calif.) strain of E.
coli, growing up the culture at 37.degree. C. overnight and
purifying DNA using a purification kit (Qiagen, Valencia,
Calif.).
Example 12
Generating a Lysate Useful for In Vitro Protein Synthesis
[0214] A lysate must be generated that will be useful for
expressing proteins containing non-native amino acids. This example
demonstrates the generation of a lysate from E. coli that is
modified such that a native aminoacyl-tRNA synthetase is expressed
with a 6Xhis-tag useful for depleting said synthetase as described
in subsequent examples.
[0215] E. coli
A19.DELTA.endA.DELTA.tonA.DELTA.speA.DELTA.tnaA.DELTA.sdaA.DELTA.sdaB.DEL-
TA.gshA.DELTA.gorTrxBHAmet.sup.+ is first modified such that a DNA
fragment encoding 6Xhis-tag is appended to the native Gln-RS at the
C-terminal end in the E. coli chromosome.
[0216] E. coli cells are then grown in a 10 L Braun Biostat C
fermentor. The cells are grown on 2YPTG media in batch mode with pH
control at pH 7.0. The cells are harvested at 3.2 OD (595) at
growth rate of >0.7 per hour. Cells are separated from the media
by centrifugation at 6000 g, 4.degree. C. for 25 min and the
resulting cell paste is stored at -80.degree. C. The cell paste is
thawed at 4.degree. C. in S30 buffer (10mM TRIS-acetate pH 8.2
(Sigma-Aldrich Corp. St. Louis, Mo.), 14 mM magnesium acetate
(Sigma-Aldrich), and 60 mM potassium acetate (Sigma-Aldrich)) at a
ratio of 1 mL of buffer per 1 g of wet cell paste. Resuspended
cells are passed through a high pressure homogenizer (Emulsiflex
C-50, Avestin Inc., Ottawa, Ontario, Canada). The pressure drop is
set at 20000 psi. The homogenized mixture is then centrifuged at
30000 g, 4.degree. C. for 30 minutes. The procedure is repeated
twice and the supernatant is retained both times. The mixture is
incubated at 37.degree. C. for 80 min in a rotary shaker. After the
incubation, the extract is dialyzed with 10 diavolumes of S30
buffer at 4.degree. C. using tangential flow filtration across 5000
MWCO membrane (Millipore, Billerica, Mass.).
Example 13
Depletion of the Endogenous Aminoacyl-tRNA Synthetase
[0217] The present invention requires inactivation of an endogenous
aminoacyl-tRNA synthetase. The purpose of this inactivation is to
prevent uncharged isoaccepting tRNAs that would normally have been
charged with a non-native amino acids from being mis-aminoacylated
with native amino acids.
[0218] Endogenous tRNA synthetase expression can be reduced by
inactivating or "knocking out" tRNA synthetase nucleic acid
sequence(s) or their promoters using targeted homologous
recombination of genomic DNA (e.g., see Smithies et al., Nature
317: 230-234 (1985); Thomas and Capecchi, Cell 51: 503-512 (1987);
Zhang et al., Nature Biotech 18:1314-1318 (2000)). For example, a
mutant, non-functional tRNA synthetase (or a completely unrelated
DNA sequence) flanked by DNA homologous to the endogenous tRNA
synthetase (either the coding regions or regulatory regions of
seryl tRNA synthetase) can be used, with or without a selectable
marker and/or a negative selectable marker, to transform cells that
express the endogenous tRNA synthetase. Insertion of the DNA
construct, via targeted homologous recombination, results in
inactivation of the tRNA synthetase.
[0219] Targeted homologous recombination can be used to insert a
DNA construct comprising a mutant tagged tRNA synthetase in the
cell, as described above. In another embodiment, targeted
homologous recombination can be used to insert a DNA construct
comprising a nucleic acid that encodes a tRNA synthetase
polypeptide variant that differs from that present in the cell.
[0220] Alternatively, endogenous tRNA synthetase expression can be
reduced by targeting deoxyribonucleotide sequences complementary to
the regulatory region of a tRNA synthetase gene (i.e. promoter
and/or enhancers) to form triple helical structures that prevent
transcription of the tRNA synthetase in target cells.
[0221] The endogenous aminoacyl-tRNA synthetase in the E. coli
extract above may be deactivated by addition of micromolar
concentration of 5 -O-[N-(Phenyalanylacyl)sulfamoyl] adenosine
during the pretreatment with iodoacetamide, prior to addition of
the template DNA as described above.
[0222] To remove a chromosomally integrated native 6Xhis-tag tRNA
synthetase as described in Example 2, a volume of the appropriately
engineered S30 extract is incubated with varying volumes of
pre-equilibrated Ni-NTA magnetic beads (20 mM Tris-HCl, 0.1 M NaCl
at pH 7.5) before use for 30 min at 4.degree. C. After removing the
beads with the help of a magnetic separator, the remaining extract
is used for protein synthesis.
Example 14
Recombinant Expression of an Aminoacyl-tRNA Synthetase: Vectors,
Enzyme Expression, and Purification
[0223] The separate tRNA charging reactions require the use of an
aminoacyl-tRNA synthetase to aminoacylate isoaccepting tRNA
molecules. This synthetase can be obtained by expressing a
recombinant synthetase as described in this example.
[0224] The structural gene for E. coli gln-tRNA synthetase is
PCR-amplified from E coli genomic DNA (ATCC #10798D-5) using the
forward and reverse primers as shown in Table 2. PCR products are
then cloned into pET23b vector (Novagen, Gibbstown, N.J.) after a
double digestion with NdeI and HindIII to generate plasmids,
pET23b-GlnRSH (histidine-tagged) and pET23b-GlnRS. The resulting
plasmids contain Gln-RS sequences with or without 6xhistidine-tag
under the control of a T7 promoter for over-expression.
TABLE-US-00003 TABLE 2 Primers used for the construction of each
type of expression vector Name Type Sequence GlnRSH Forward
5'-AAAAAACATATGAGTGAGGCAG-3' primer (SEQ ID NO: 1) Reverse C-
5'-AAAAAAAAGCTTCTCGCCTACTTTC-3' primer terminal (SEQ ID NO: 2) His
tag GlnRS Forward Wild 5'-AAAAAACATATGAGTGAGGCAG-3' primer type
(SEQ ID NO: 3) Reverse 5'-AAAAAAAAGCTTTTACTCGCCTACTTTC-3' primer
(SEQ ID NO: 4) Sequences of the restriction sites are underlined.
The stop codon is shown in boldface letters.
[0225] GlnRS overproducer plasmid (pET23b-GlnRSH) is transformed
into chemically competent BL-21 cells (Promega; Madison, Wis.) and
plated on LB/carbenicillin plates. A single colony is grown
overnight in TB/100 ug/mL carbenicillin and then used to inoculate
a large culture at 1:50 dilution. The cells are grown in rich media
to mid-log phase at 37.degree. C. before induction with 1 mM IPTG
for 5 h. All subsequent purification steps are carried out at
4.degree. C. Crude cell extracts are prepared by centrifugation at
5000 g, followed by cell-lysis under high pressure. The extracts
are mixed with 5 mL of Ni-NTA resin that has been preequilibrated
in lysis buffer. After a 1 h incubation of the protein on ice to
allow binding to the resin, this mixture is poured into a 10 mL
column. Weakly bound proteins are removed with wash buffer (50 mM
potassium phosphate, pH 6.0, 300 mM NaCl, 10 mM
.beta.-mercaptoethanol, 10% glycerol) until the A.sub.280 of the
eluate drops below 0.1. The protein is eluted with a gradient of
0-0.5 M imidazole in wash buffer. Peak fractions identified by
activity or SDS-PAGE are pooled together and dialyzed against
buffer containing 50 mM potassium phosphate, pH 7.0, 100 mM KCl,
and 10 mM .beta.-mercaptoethanol at 4.degree. C. overnight. Protein
is then concentrated to a final concentration of 10 mg/mL in 40%
glycerol and then stored at -20.degree. C.
Example 15
Engineering Aminoacyl-tRNA Synthetase Variants
[0226] Non-native amino acids cannot usually be charged to
isoaccepting sense tRNA molecules by naturally occurring
aminoacyl-tRNA synthetases. In some instances, "promiscuous"
aminoacyl-tRNA synthetases may previously exist that have the
capability to charge isoaccepting tRNAs with non-native amino
acids. In other instances wherein no aminoacyl-tRNA synthetases
exist with such capability, new aminoacyl-tRNA synthetases must be
engineered such that the desired non-native amino acid can be
charged to a tRNA molecule in the separate tRNA charging
reaction.
[0227] Active site residues of a thermostable tRNA synthetases
known to be involved in substrate recognition are identified using
Pymol molecular viewing software. Residues within 5-10 .ANG. of the
amino acid side chain are identified. A 2.times.20 amino acid=400
member `library` of site directed variants corresponding to the
indentified residues is constructed as follows. A cassette library
of 35-mer oligonucleotides, representing sense or antisense strands
coding for the amino acids on each side of the codons are
synthesized (Operon, Huntsville, Ala.) with NNK (where N=G,A,T,C
and K=G or T nucleoside triphosphates). Using the Quickchange
Multisite mutagenesis protocol (Stratagene, La Jolla, Calif.), the
pooled oligos are annealed to template DNA, amplified by DNA
polymerase, plasmid template is degraded with Dpnl, and the library
is transformed and plated. Ninety-six clones are sequenced to
confirm the diversity of the library.
Example 16
Screening Aminoacyl-tRNA Synthetase Variants for Non-Native-tRNA
Charging
[0228] High throughput expression of variants as described in
Example 5 is conducted in a 96-well format as follows. Plated
colonies are transferred by sterile toothpicks to 96-well deep well
plates and grown in rich medium to OD.sub.600=0.5 followed by
induction with 1 mM IPTG and overnight growth. The purification is
carried out in 96-well format using Millipore
[0229] Multiscreen filtration plates (Millipore Corp.). Cells are
harvested & lysed, the lysate diluted with 4.times. volume of
PBS buffer, and 200 .mu.L is loaded onto Ni-chelating sepharose
media in the Multiscreen plate. Enzyme elutions are optimized using
increasing concentrations of imidazole. The filtrate is filtered by
vacuum filtration and high yields of pure recombinant protein are
produced.
[0230] The enzyme activity of each variant is assayed using
radiolabeled non-native amino acids by a discontinuous steady state
assay that monitors the formation of [.sup.3H]-labeled
nnAA-tRNA.sup.nnAA at 37.degree. C. in 50 mM Tris-HCl (or Hepes) pH
7.5, 20 mM KCl1, 4 mM DTT, 10 mM MgCl.sub.2, 0.2 mg/ml bovine serum
albumin, and a range of amino acid, ATP, and tRNA concentrations.
The activities are normalized for the enzyme concentration
independently determined by fluorescence using a coupled enzyme
assay that measures released pyrophosphate.
Example 17
Synthesis of Non-Native Amino Acids
[0231] GalNAc L-Threonine is an example of a non-native amino acid,
which is synthesized from commercially available GalNAc L-Threonine
(N-Fmoc-O-(2-acetamido-3,4,6-tri-O-acetyl-2-deoxy-.alpha.-D-galactopyrano-
syl)-L-threonine (V-Labs, Inc., Covington, La.). This synthesis
occurs by selective deprotection of the Fmoc group with piperidine
in dichloromethane to give the free amino acid followed by
selective enzymatic hydrolysis of the carbohydrate acetates using
lipase WG (The sample is purified using reversed phase HPLC).
Example 18
tRNA Charging Reaction
[0232] The present invention requires the charging of isoaccepting
sense tRNAs with either native or non-native amino acids in a
charging reaction separate from the protein synthesis reaction.
[0233] tRNA Synthetic DNA oligonucleotides (Integrated DNA
Technologies, Inc., Coralville, Iowa) are designed such that the
sense strand corresponding to the 5' end of the sequence possesses
a 10-bp overlap with the 3' antisense strand. The oligonucleotides
used for construction of the E. coli tRNA2 Gln gene are: 5'-AAT
TCCTGCAGTAATACGACTCACTATAGGGGGTATCGCCA AGCGGTAAGGCACCGG-3' (SEQ ID
NO:5); 5'-mTmGGCTGGGGTACGAGATTCGAACCTCGGAATGCCGGAATCAGAATCCGGTG
CCTT-3' (SEQ ID NO:6), where mT and mG represent the 5'-O-methyl
nucleotides and the underlined portions represent the overlapped
region. Bold type indicates the T7 RNA polymerase promoter.
Oligonucleotides are mixed to an equimolar concentration of 4 mM in
a reaction solution containing 400 mM dNTPs, 10 mM Tris-HCl, pH
7.5, 10 mM MgSO4, 7.5 mM DTT, and 50 U/mL Klenow fragment
polymerase (Promega). The mixture is cycled between 10.degree. C.
and 37.degree. C. at 30 s intervals for eight cycles, after which
the DNA is precipitated in 65% ethanol/0.3 M sodium acetate,
pelleted, and resuspended in 100 mL PMS buffer (5 mM PIPES, pH
7.5/10 mM MgSO4). Transcription is performed in solutions
containing 250 mM HEPES-KOH, pH 7+5, 30 mM MgCl2, 2 mM spermidine,
40 mM DTT, 0.1 mg/mL bovine serum albumin, 5 mM dNTPs, 5 mg
inorganic pyrophosphatase (Boeringer Mannheim), 50 U RNasin
(Amersham), 40 mg/mL T7 RNA polymerase, and 1 mM DNA template from
the Klenow extension reaction . The 2-mL reaction mixture is
incubated at 37 deg C for 8-10 h, at which time RQ1 RNase-free
DNase (Promega) is added to 10 U/mL and the incubation continued
for a further 2-3 hr. The reactions are then loaded on a 5-mL DE-52
(Whatman) column preequilibrated with 100 mM HEPES-KOH, pH 7.5, 12
mM MgCl.sub.2, and 200 mM NaCl. The column is washed with 30 mL
equilibration buffer and the RNA eluted with a solution of 100 mM
HEPES-KOH, pH 7.5, 12 mM MgCl.sub.2, 600 mM NaCl. Fractions
containing tRNA are dialyzed into PMS buffer and refolded by
heating to 70.degree. C., followed by slow cooling to room
temperature.
[0234] GalNAc L-Gln-tRNA2 The formation of charged GalNAc
L-Gln-tRNA2 is catalyzed by a recombinant aaRS as follows. A
typical reaction mixture contains 50 mM Tris-HCl (or Hepes) pH 7.5,
20 mM KCl, 4 mM DTT, 10 mM MgCl.sub.2, 0.2 mg/ml bovine serum
albumin, 1-5 nM aaRS, and a range of amino acid, ATP, and tRNA
concentrations. The charged tRNA may be purified by immobilized
Ef-Tu chromatography as previously described. The recombinant aaRS
used for this charging reaction is described in Ran et al., J. Am.
Chem. Soc. 126:15654-55 (2004).
Example 19
In Vitro Protein Synthesis Reaction
[0235] The cell-free protein synthesis reaction contains the
reagents summarized in Table 3 along with an E. coli lysate
generated as described in Example 2 and subsequently depleted of a
native aminoacyl-tRNA synthetase as described in Example 3.
TABLE-US-00004 TABLE 3 Summary of Reagents added the Cell- free
Protein Expression system Reagent Concentration Magnesium Glutamate
8 mM Ammonium Glutamate 10 mM Potassium Glutamate 130 mM AMP 1.20
mM GMP 0.86 mM UMP 0.86 mM CMP 0.86 mM Amino Acids 2 mM GalNAc
L-Gln-tRNA2 2 mM Gln-Gln-tRNA1 2 mM Pyruvate 30 mM NAD 3.3 mM CoA
2.7 mM Oxalic Acid 4 mM Spermidine 1.5 mM Putrescine 1 mM T7 RNA
polymerase 0.10 mg/ml Plasmid 0.0133 mg/ml E. coli DsbC 75 ug/ml E.
coli extract 6/25 total reaction volume
[0236] The extract is pretreated with 100 .mu.M iodoacetamide at
21.degree. C. for 30 min. The plasmid contains the structural gene
encoding the target protein and is constructed as explained above.
GalNAc L-Gln-tRNA2 is the charged tRNA as described above.
Gln-Gln-tRNA1 is the glutamine tRNA recognizing a codon different
from that of Gln-tRNA2 charged with native glutamine amino acid.
The charging reaction is carried out as described in Example 8
except that native E. coli GlnRS is used to catalyze the charging
reaction of Gln-tRNA1. Native GlnRS is produced according to
procedure in Example 4. Amino Acids are in an equimolar mixture of
all 20 native amino acids except for glutamine (19 amino acids
total in the mixture).
[0237] The 1 mL of reaction mixture is spread on the bottom of a
petri dish (Thermo Fisher Scientific, Rochester, N.Y.) and
incubated at 30.degree. C. in a sealed humidified incubator for 4
hours.
Sequence CWU 1
1
24122DNAArtificial Sequencesynthetic E. coli Gln-tRNA synthase
structural gene PCR amplification forward primer for expression
vector pET23b-GlnRSH and expression vector pET23b-GlnRS 1aaaaaacata
tgagtgaggc ag 22225DNAArtificial Sequencesynthetic E. coli Gln-tRNA
synthase structural gene PCR amplification reverse primer for
expression vector pET23b-GlnRSH 2aaaaaaaagc ttctcgccta ctttc
25328DNAArtificial Sequencesynthetic E. coli Gln-tRNA synthase
structural gene PCR amplification forward primer for expression
vector pET23b-GlnRS 3aaaaaaaagc ttttactcgc ctactttc
28457DNAArtificial Sequencesynthetic tRNA DNA oligonucleotide sense
strand for construction of E. coli tRNA2 Gln gene 4aattcctgca
gtaatacgac tcactatagg gggtatcgcc aagcggtaag gcaccgg
57555DNAArtificial Sequencesynthetic tRNA DNA oligonucleotide 3'
antisense strand for construction of E. coli tRNA2 Gln gene
5nngctggggt acgagattcg aacctcggaa tgccggaatc agaatccggt gcctt
55676RNAArtificial Sequencesynthetic E. coli isoaccepting
Phe-tRNA-GAA transcript 6gcccggauag cucagucggu agagcagggg
auugaaaauc cccguguccu ugguucgauu 60ccgaguccgg gcacca
76776RNAArtificial Sequencesynthetic partial tRNA-HDV ribozyme
sequence 7ccaggccggc auggucccag ccuccucgcu ggcgccggcu gggcaacacc
auugcacucc 60gguggcgaau gggacu 76838RNAArtificial Sequencesynthetic
partial hepatitis delta virus (HDV) autocatalytic ribozyme
consensus sequence 8ccgaccuggg cauccgagca cucggauggc cucgcggu
38914RNAArtificial Sequencesynthetic partial hepatitis delta virus
(HDV) autocatalytic ribozyme consensus sequence 9gggcaucucc accu
141015RNAArtificial Sequencesynthetic partial hepatitis delta virus
(HDV) autocatalytic ribozyme consensus sequence 10ggagagccac uuuuc
151133RNAArtificial Sequencesynthetic partial tRNA 11gcggauuuag
cucaguuggg agagcgccag acu 331247RNAArtificial Sequencesynthetic
partial tRNA 12gaucuggagg uccuguguuc gauccacaga auucgcacca gggucgg
47136PRTArtificial Sequencesynthetic 6XHis tag, 6-histidine
affinity tag, C-terminal His-tag 13His His His His His His1
514105DNAArtificial Sequencesynthetic PCR extension amplification
primer for DNA insertion cassette 14gcgtatcaac aaagcgctgg
attttattgc tgaacgcgaa aatcagcagg gtggcgacta 60caaagatgac gatgacaaat
aaaattaacc ctcactaaag ggcgg 1051574DNAArtificial Sequencesynthetic
PCR extension amplification primer for DNA insertion cassette
15agggattatc ggattgttac aacgcttagg gattcgcgat agcaaataat taatacgact
60cactataggg ctcg 741628DNAArtificial Sequencesynthetic
amplification primer for DNA fragment including 3' end and gltX
downstream sequence 16gttcaacacc gacaagctgc tgtggctg
281731DNAArtificial Sequencesynthetic amplification primer for DNA
fragment including 3' end and gltX downstream sequence 17gcgggaaggg
attatcggat tgttacaacg c 311820DNAArtificial Sequencesynthetic
primer for confirming Flag-tag encoding sequence 18gattactgac
tggaccgctg 20198PRTArtificial Sequencesynthetic Flag-tag sequence
19Asp Tyr Lys Asp Asp Asp Asp Lys1 52031DNAArtificial
Sequencesynthetic DNA sequence back translated from Flag-tag
peptide 20gggtggcgac tacaaagatg acgatgacaa a 312123DNAArtificial
Sequencesynthetic amplifying sequence at 3' end of forward primer
21aattaaccct cactaaaggg cgg 232224DNAArtificial Sequencesynthetic
amplifying sequence of backward primer 22taatacgact cactataggg ctcg
242331DNAArtificial Sequencesynthetic DNA sequence attached to 3'
end of gltX gene in KGK10 chromosome encoding two Gly residue
dipeptide and Flag-tag sequence 23gggtggcgac tacaaagatg acgatgacaa
a 312410PRTArtificial Sequencesynthetic two Gly residue dipeptide
connected to Flag-tag sequence 24Gly Gly Asp Tyr Lys Asp Asp Asp
Asp Lys1 5 10
* * * * *
References