U.S. patent application number 12/376812 was filed with the patent office on 2010-07-15 for structure and use of 5'phosphate oligonucleotides.
This patent application is currently assigned to Klinische Pharmakologie. Invention is credited to Gunther Hartmann, Veit Hornung.
Application Number | 20100178272 12/376812 |
Document ID | / |
Family ID | 38875059 |
Filed Date | 2010-07-15 |
United States Patent
Application |
20100178272 |
Kind Code |
A1 |
Hartmann; Gunther ; et
al. |
July 15, 2010 |
STRUCTURE AND USE OF 5'PHOSPHATE OLIGONUCLEOTIDES
Abstract
Oligonucleotides bearing free, uncapped 5' phosphate group(s)
are recognized by RIG-I, leading to the induction of type I IFN,
IL-18 and IL-1.beta. production. Bacterial RNA also induces type I
IFN production. 5' phosphate oligonucleotides and bacterial RNA can
be used for inducing an anti-viral response or an anti-bacterial
response, in particular, type I IFN and/or IL-18 and/or IL-1.beta.
production, in vitro and in vivo and for treating various disorders
and diseases such as viral infections, bacterial infections,
parasitic infections, tumors, allergies, autoimmune diseases,
immunodeficiencies and immunosuppression. Single-stranded 5'
triphosphate RNA can be used for inducing an anti-viral response,
an anti-bacterial response, or an anti-tumor response, in
particular, type I IFN and/or IL-18 and/or IL-1.beta. production,
in a target cell-specific manner.
Inventors: |
Hartmann; Gunther; (Bonn,
DE) ; Hornung; Veit; (Pullach, DE) |
Correspondence
Address: |
David S. Resnick
Nixon Peabody LLP, 100 Summer Street
Boston
MA
02110
US
|
Assignee: |
Klinische Pharmakologie
Bonn
DE
|
Family ID: |
38875059 |
Appl. No.: |
12/376812 |
Filed: |
August 8, 2007 |
PCT Filed: |
August 8, 2007 |
PCT NO: |
PCT/EP07/07024 |
371 Date: |
April 20, 2009 |
Current U.S.
Class: |
424/85.4 ;
435/325; 514/44R; 536/23.1 |
Current CPC
Class: |
A61P 37/06 20180101;
C12N 2310/335 20130101; A61P 37/02 20180101; C12N 15/117 20130101;
C12N 2310/351 20130101; A61P 37/04 20180101; A61P 35/00 20180101;
A61P 31/04 20180101; A61P 33/00 20180101; A61P 25/00 20180101; A61P
31/12 20180101; A61P 43/00 20180101; C12N 2310/31 20130101; C12N
2310/32 20130101; C07H 21/00 20130101; C12N 2310/17 20130101; A61P
31/00 20180101; A61K 31/7115 20130101; A61P 37/08 20180101; C12N
2320/30 20130101; A61K 31/7105 20130101; A61K 45/06 20130101; A61P
37/00 20180101; C12N 2310/346 20130101 |
Class at
Publication: |
424/85.4 ;
536/23.1; 514/44.R; 435/325 |
International
Class: |
A61K 38/21 20060101
A61K038/21; C07H 21/02 20060101 C07H021/02; A61K 31/7105 20060101
A61K031/7105; C12N 5/071 20100101 C12N005/071; C07H 21/04 20060101
C07H021/04; A61K 31/7088 20060101 A61K031/7088; A61P 31/12 20060101
A61P031/12; A61P 31/04 20060101 A61P031/04; A61P 33/00 20060101
A61P033/00; A61P 35/00 20060101 A61P035/00; A61P 37/02 20060101
A61P037/02 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 8, 2006 |
EP |
06016578.4 |
Oct 10, 2006 |
EP |
06021271.9 |
Claims
1. An oligonucleotide or a precursor thereof for preventing and/or
treating a disease and/or disorder selected from the group
consisting of viral infection, bacterial infection, parasitic
infection, tumor, multiple sclerosis, allergy, autoimmune diseases,
immunosuppression and immunodeficiency in a vertebrate animal,
wherein the oligonucleotide comprises at least 1, preferably at
least 3, more preferably at least 6 ribonucleotide(s) at the 5'
end, wherein the oligonucleotide comprises at least 1, preferably
at least 2, and more preferably at least 3 phosphate group(s) at
the 5' end, and wherein the phosphate group is free of any cap or
modification, wherein the oligonucleotide is at least 12,
preferably at least 18, more preferably at least 20, and even more
preferably at least 21 nucleotides in length.
2. The oligonucleotide or the precursor thereof of claim 1, wherein
the oligonucleotide is single-stranded which is free of any
sequence that is capable of forming a double-stranded structure,
and wherein the nucleotide sequence of the oligonucleotide is
complementary to a disease or disorder-related RNA,
3. The oligonucleotide or the precursor thereof of claim 1 or 2,
wherein at least one of the 5' uncapped phosphate groups is not
comprised in a triphosphate.
4. The oligonucleotide or the precursor thereof of any of claims
1-3, wherein the oligonucleotide comprises at least one inosine
(I).
5. The oligonucleotide or the precursor thereof of any of claims
1-4, wherein the first ribonucleotide at the 5' end of the
oligonucleotide comprises a ribonucleotide selected from A, C, U,
preferably a ribonucletoide selected from A and C, and most
preferably A.
6. The oligonucleotide or the precursor thereof of any of claims
1-5, wherein the sequence of the first 4 nucleotides at the 5' end
of the oligonucleotide is selected from: AAGU, AAAG, AUGG, AUUA,
AACG, AUGA, AGUU, AUUG, AACA, AGAA, AGCA, AACU, AUCG, AGGA, AUCA,
AUGC, AGUA, AAGC, AACC, AGGU, AAAC, AUGU, ACUG, ACGA, ACAG, AAGG,
ACAU, ACGC, AAAU, ACGG, AUUC, AGUG, ACAA, AUCC, AGUC, wherein the
sequence is in the 5'->3' direction.
7. The oligonucleotide or the precursor thereof of any of claims
1-6, wherein the oligonucleotide is free of modifications such as
pseudouridine, 2-thiouridine, 2'-Fluorine-dNTP, 2'-O-methylated
NTP, in particular 2'-fluorine-dCTP, 2'-fluorine-dUTP,
2'-O-methylated CTP, 2'-O-methylated UTP.
8. The oligonucleotide or the precursor thereof of any of claims
1-7, wherein the oligonucleotide or the precursor thereof comprises
at least one, preferably at least two, more preferably at least
three, even more preferably at least four, even more preferably at
least five, and most preferably at least six, of the 4-nucleotide
(4 mer) motifs selected from the group consisting of:
TABLE-US-00010 GUUC, (No. 1) GUCA, (No. 2) GCUC, (No. 3) GUUG, (No.
4) GUUU, (No. 5) GGUU, (No. 6) GUGU, (No. 7) GGUC, (No. 8) GUCU,
(No. 9) GUCC, (No. 10) GCUU, (No. 11) UUGU, (No. 12) UGUC, (No. 13)
CUGU, (No. 14) CGUC, (No. 15) UGUU, (No. 16) GUUA, (No. 17) UGUA,
(No. 18) UUUC, (No. 19) UGUG, (No. 20) GGUA, (No. 21) GUCG, (No.
22) UUUG, (No. 23) UGGU, (No. 24) GUGG, (No. 25) GUGC, (No. 26)
GUAC, (No. 27) GUAU, (No. 28) UAGU, (No. 29) GUAG, (No. 30) UUCA,
(No. 31) UUGG, (No. 32) UCUC, (No. 33) CAGU, (No. 34) UUCG, (No.
35) CUUC, (No. 36) GAGU, (No. 37) GGUG, (No. 38) UUGC, (No. 39)
UUUU, (No. 40) CUCA, (No. 41) UCGU, (No. 42) UUCU, (No. 43) UGGC,
(No. 44) CGUU, (No. 45) CUUG, (No. 46) UUAC, (No. 47)
wherein the nucleotide sequences of the motifs are 5'.fwdarw.3',
and wherein the oligonucleotide is between 12 and 64, preferably
between 12 and 50, more preferably between 14 and 40, even more
preferably between 16 and 36, and most preferably between 18 and 25
nucleotides in length.
9. The oligonucleotide or the precursor thereof of any of claims
1-8, wherein the oligonucleotide or the precursor thereof comprises
at least one, preferably at least two, more preferably at least
three, even more preferably at least four, even more preferably at
least five, and most preferably at least six, of the 4-nucleotide
(4 mer) motifs selected from the group consisting of:
TABLE-US-00011 UCGU, (No. 1) GUUG, (No. 2) UGGU, (No. 3) UGGC, (No.
4) GGUA, (No. 5) UGAU, (No. 6) UGCU, (No. 7) UUGC, (No. 8) UUGU,
(No. 9) UAGU, (No. 10) GGUU, (No. 11) GUUU, (No. 12) UGUG, (No. 13)
GUGU, (No. 14) UGCC, (No. 15) GUAU, (No. 16) GUGC, (No. 17) UGUA,
(No. 18) UGUC, (No. 19) CUGU, (No. 20) UGAC, (No. 21) UGUU, (No.
22) UAAU, (No. 23) GUAG, (No. 24) UCUU, (No. 25) UUGG, (No. 26)
UUUG, (No. 27) GGAU, (No. 28) UUUU, (No. 29) CGUU, (No. 30) UUAU,
(No. 31) GUUC, (No. 32) GUGG, (No. 33) GGUG, (No. 34) UAUU, (No.
35) UCUG, (No. 36) GUAC, (No. 37) UAGG, (No. 38) UCUC, (No. 39)
UAGC, (No. 40) UAUC, (No. 41) CUAU, (No. 42) UACU, (No. 43) CGGU,
(No. 44) UGCG, (No. 45) UUUC, (No. 46) UAUG, (No. 47) UAAG, (No.
48) UACC, (No. 49) UUAG, (No. 50) GCUU, (No. 51) CAGU, (No. 52)
UGAG, (No. 53) GAUU, (No. 54) GAGU, (No. 55) GUUA, (No. 56) UGCA,
(No. 57) UUCU, (No. 58) GCCU, (No. 59) GGUC, (No. 60) GGCU, (No.
61) UUAC, (No. 62) UCAU, (No. 63) GCGU, (No. 64) GCAU, (No. 65)
GAUG, (No. 66) GUCU, (No. 67) CGUA, (No. 68) CGAU, (No. 69)
wherein the nucleotide sequences of the motifs are 5'.fwdarw.3',
and wherein the oligonucleotide or precursor thereof is between 12
and 64, preferably between 12 and 50, more preferably between 14
and 40, even more preferably between 16 and 36, and most preferably
between 18 and 30 nucleotides in length.
10. The oligonucleotide or the precursor thereof of any of claims
1-9, further comprising a complexation agent.
11. The oligonucleotide or the precursor thereof of any of claims
1-9, wherein the oligonucleotide or the precursor thereof is
comprised in a viral vector.
12. The oligonucleotide or the precursor thereof of any of claims
1-11, wherein the oligonucleotide or the precursor thereof is for
use in combination with at least one agent selected from an
immunostimulatory agent, an anti-viral agent, an anti-bacterial
agent, an anti-tumor agent, and a gene silencing agent, and/or an
anti-tumor therapy.
13. The oligonucleotide or the precursor thereof of claim 12,
wherein the oligonucleotide or the precursor thereof is for use in
combination with retinoic acid and/or type I IFN.
14. An oligonucleotide or a precursor thereof as defined in any of
claims 1-13 for inducing apoptosis of tumor cells, inducing an
anti-viral response, inducing an anti-bacterial response, and/or
inducing an anti-tumor response in a vertebrate animal.
15. The oligonucleotide or a precursor thereof of claim 14, wherein
the anti-viral response, the anti-bacterial response and/or the
anti-tumor response comprise type I IFN production, IL-18
production, and/or IL-1.beta. production.
16. An oligonucleotide or a precursor thereof as defined in any of
claims 1-13 and at least one antigen for inducing an immune
response against the at least one antigen in a vertebrate
animal.
17. The oligonucleotide or the precursor thereof and the at least
one antigen of claim 16, wherein the oligonucleotide or the
precursor thereof is covalently linked to the at least one
antigen.
18. Use of an oligonucleotide or a precursor thereof as defined in
any of claims 1-13 for the preparation of a medicament for
preventing and/or treating a disease and/or disorder selected from
the group consisting of viral infection, bacterial infection,
parasitic infection, tumor, multiple sclerosis, allergy, autoimmune
diseases, immunosuppression and immunodeficiency in a vertebrate
animal.
19. Use of a oligonucleotide or a precursor thereof as defined in
any of claims 1-13 for the preparation of a medicament for inducing
apoptosis of tumor cells, inducing an anti-viral response, inducing
an anti-bacterial response and/or inducing an anti-tumor response
in a vertebrate animal.
20. The use of claim 19, wherein the anti-viral response, the
anti-bacterial response, and/or the anti-tumor response comprise
type I IFN production, IL-18 production, and/or IL-1.beta.
production.
21. A pharmaceutical composition comprising a oligonucleotide or a
precursor thereof as defined in any of claims 1-13.
22. A combined preparation comprising an oligonucleotide or a
precursor thereof as defined in any of claims 1-13 and at least one
agent selected from an immunostimulatory agent, an anti-viral
agent, an anti-bacterial agent, an anti-tumor agent, and a gene
silencing agent, wherein the oligonucleotide or the precursor
thereof and the at least one agent are for simultaneous, separate
or sequential administration.
23. The combined preparation of claim 22, wherein the agent is at
least one of retinoic acid and type I IFN.
24. A pharmaceutical package comprising the pharmaceutical
composition of claim 21 or the combined preparation of claim 22 or
23 and an instruction for use.
25. An in vitro method for stimulating an anti-viral and/or an
anti-bacterial and/or an anti-tumor response in a cell, comprising
the steps of: (a) mixing an oligonucleotide or precursor thereof as
defined in any of claims 1-9 with a complexation agent; and (b)
contacting a cell with the mixture of (a), wherein the cell
expresses RIG-I and/or components of the inflammasome.
26. The method of claim 25, wherein the oligonucleotide is
single-stranded and wherein the cell contains a mRNA comprising a
nucleotide sequence which is complementary to the nucleotide
sequence of the oligonucleotide.
27. A method for preparing an oligonucleotide capable of inducing
an anti-viral and/or an anti-bacterial and/or anti-tumor response,
comprising the steps of: (a) introducing at least one uncapped 5'
monophosphate, diphosphate and/or triphosphate into an
oligonucleotide; and (b) introducing a nucleotide sequence capable
of forming double-stranded structure inside a cell into the
oligonucleotide.
28. The method claim 27, further comprising the step(s) of: (c)
preparing an oligonucleotide with adenosine (A) at the 5' end;
and/or (d) preparing an olignucletide having a sequence selected
from AAGU, AAAG, AUGG, AUUA, AACG, AUGA, AGUU, AUUG, AACA, AGAA,
AGCA, AACU, AUCG, AGGA, AUCA, AUGC, AGUA, AAGC, AACC, AGGU, AAAC,
AUGU, ACUG, ACGA, ACAG, AAGG, ACAU, ACGC, AAAU, ACGG, AUUC, AGUG,
ACAA, AUCC, AGUC at the 5' end; and/or (e) introducing inosine (I)
into the oligonucleotide.
29. A method for preparing an oligonucleotide free of anti-viral
response-inducing activity and anti-bacterial response-inducing
activity, comprising the step(s) of: (a) eliminating all 5'
phosphate groups from the oligonucleotide; and/or (b) capping all
5' monophosphate, diphosphate and triphosphate of the
oligonucleotide; and/or (c) eliminating any nucleotide sequence
capable of forming double-stranded structure inside a cell from the
oligonucleotide; and/or (d) incorporating modified nucleotides such
as pseudouridine, 2-thiouridine, 2'-Fluorine-dNTPs-2'-O-methylated
NTPs, preferably 2'-fluorine-dCTP, 2'-fluorine-dUTP,
2'-O-methylated CTP, 2'-O-methylated UTP, into the
oligonucleotide.
30. The method of any of claims claim 25-29, wherein the anti-viral
response, the anti-bacterial response, and/or the anti-tumor
response comprise type I IFN production, IL-18 production, and/or
IL-1.beta. production.
31. A bacterial RNA for preventing and/or treating a disease and/or
disorder selected from the group consisting of viral infection,
bacterial infection, parasitic infection, tumor, multiple
sclerosis, allergy, autoimmune diseases, immunosuppression and
immunodeficiency in a vertebrate animal.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to the field of immunotherapy
and drug discovery. The present invention provides oligonucleotides
which are capable of inducing an anti-viral or an anti-bacterial
response, in particular, the production of type I IFN, IL-18 and/or
IL-1.beta., and their in vitro as well as therapeutic uses.
BACKGROUND OF THE INVENTION
[0002] The vertebrate immune system established different ways to
detect invading pathogens based on certain characteristics of their
microbial nucleic acids. Detection of microbial nucleic acids
alerts the immune system to mount the appropriate type of immune
response that is required for the defense against the respective
type of pathogen detected. Detection of viral nucleic acids leads
to the production of type I interferon (IFN) including IFN-.alpha.
and IFN-.beta., the key cytokines for anti-viral defense.
[0003] IFN-.alpha. was the first type of interferon to be
identified and commercialized; it is widely used clinically in the
treatment of a variety of tumors (e.g., hairy cell leukemia,
cutaneous T cell leukemia, chronic myeloid leukemia, non-Hodgkin's
lymphoma, AIDS-related Kaposi's sarcoma, malignant melanoma,
multiple myeloma, renal cell carcinoma, bladder cell carcinoma,
colon carcinoma, cervical dysplasia) and viral diseases (e.g.,
chronic hepatitis B, chronic hepatitis C). IFN-.alpha. products
that are currently in clinical use include the recombinant protein
and the highly purified natural protein, both of which have high
production costs. Therefore, there is a need for more economical
ways of providing IFN-.alpha. to patients in need. Furthermore,
IFN-.alpha. is currently administrated systematically and causes a
broad spectrum of side effects (e.g. fatigue, flu-like symptoms,
diarrhea). Most alarmingly, IFN-.alpha. causes a decrease in bone
marrow function which leads to increased susceptibility to
life-threatening infections, anemia and bleeding problems.
Therefore, there is a need for ways of providing IFN-.alpha. in a
more localized (i.e., target-specific) matter to reduce the
occurrence of side effects.
[0004] Receptor-mediated detection of pathogen-derived nucleic
acids assists in protecting the host genome from invading foreign
genetic material. A new picture is evolving in which the ability of
biological systems to detect viral nucleic acids via protein
receptor-nucleic acid ligand interactions is crucial for
maintaining the integrity of the genome and for survival.
[0005] A number of receptor proteins have evolved that take part in
nucleic acid recognition. Recent studies indicate that one of the
most important protein receptors for antiviral defense is the
retinoic-acid-inducible protein I (RIG-I), a member of the helicase
family containing two caspase-recruitment domains (CARDs) and a
DExD/H-box helicase domain (M. Yoneyama at al., Nat Immunol 5, 730
(July, 2004)). RIG-1-mediated recognition of a specific set of RNA
viruses (flaviviridae, paramyxoviridae, orthomyxoviridae and
rhabdoviridae) (M. Yoneyama et al., Nat Immunol 5, 730 (July,
2004); R. Sumpter, Jr. et al., J Virol 79, 2689 (March, 2005); H.
Kato et al., Nature 441, 101 (Apr. 9, 2006)) has a critical role in
antiviral host defense in vitro and in vivo. A second member of the
helicase family, MDA-5, is responsible for the antiviral defense
against a reciprocal set of RNA viruses (picornaviridae) (H. Kato
et al., Nature 441(7089):101-105, Apr. 9, 2006).
[0006] In addition to RIG-I and MDA-5, the four members of the
Toll-like receptor (TLR) family, TLR3, TLR7, TLR9 and TLR9, are
also known to be involved in viral nucleic acid recognition. RIG-I
and MDA-5 differ from the TLRs in their subcellular localization,
expression pattern, signal transduction pathways and ligands.
[0007] While RIG-I and MDA-5 are cytosolic receptors, TLR3, TLR7,
TLR8 and TLR9 are located in the endosomal membrane.
[0008] While TLRs are mainly expressed on certain defined immune
cell subsets (i.e. TLR9 restricted to PDC and B cells), RIG-I and
MDA-5 are expressed in both immune and non-immune cells (H. Kato et
al., Immunity 23, 19 (July, 2005)).
[0009] Besides distinct expression profiles and cellular
localization, signalling of endosomal TLRs and the two cytoplasmic
receptors RIG-I and MDA-5 differs. While TLR3 signals via TRIF and
TLR7, TLR8 and TLR9 signal via MyD88, RIG-I recruits a
CARD-containing adaptor, IPS-1 (T. Kawai et al., Nat Immunol 6, 981
(October, 2005)) (also known as MAVS (R. B. Seth et al., Cell 122,
669 (Sep. 9, 2005)), VISA (L. G. Xu et al., Mol Cell 19, 727 (Sep.
16, 2005)) or Cardif (E. Meylan et al., Nature 437, 1167 (Oct. 20,
2005))). IPS-1 relays the signal to the kinases TBK1 and IKK-i,
which phosphorylate interferon-regulatory factor-3 (IRF-3) and
IRF-7, transcription factors essential for the expression of type-I
interferons. As a consequence, in vivo, endosomal and cytoplasmic
nucleic acid receptors induce different cytokine patterns. For
example, both TLR3 and MDA-5 contribute to IL-12 production in
response to poly(I:C), while MDA-5 but not TLR3 is responsible for
IFN-.alpha. induction (H. Kato et al., Nature 441, 101 (Apr. 9,
2006)).
[0010] The ligand for TLR3 is long dsRNA such as poly(I:C) (L.
Alexopoulou, et al., Nature 413, 732 (Oct. 18, 2001)), for TLR7
ssRNA (S. S. Diebold et al., Science 303, 1529 (Mar. 5, 2004); F.
Heil et al., Science 303, 1526 (Mar. 5, 2004)) and short dsRNA with
certain sequence motifs (i.e., the immunostimulatory RNA, is RNA)
(V. Homung et al., Nat Med 11, 263 (March, 2005)), and for TLR9CpG
DNA (A. M. Krieg et al., Nature 374, 546 (Apr. 6, 1995); H. Hemmi
et al., Nature 408, 740 (Dec. 7, 2000)).
[0011] In several studies, long double-stranded RNA was proposed to
be the ligand for MDA-5 and RIG-I (M. Yoneyama et al., Nat Immunol
5, 730 (July, 2004); H. Kato et al., Nature 441, 101 (Apr. 9,
2006); S. Rothenfusser et al., J Immunol 175, 5260 (Oct. 15,
2005)). A synthetic mimic of long dsRNA is poly(I:C). Recent data
showed that poly(I:C) is a ligand for MDA-5, while it is not
recognized by RIG-I (H. Kato et al., Nature 441, 101 (Apr. 9,
2006)). On the other hand, long dsRNA was found to activate RIG-I
but not MDA-5 (H. Kato et al., Nature 441, 101 (Apr. 9, 2006)).
This discrepancy of long dsRNA and poly(I:C) activity suggests that
there is more to cytoplasmic RNA recognition than long dsRNA.
[0012] In general, compartimentalization and different molecular
structure are believed to contribute to the detection of foreign
nucleic acids. DNA (G. M. Barton et al., Nat Immunol 7, 49
(January, 2006)) and RNA (F. Heil et al., Science 303, 1526 (Mar.
5, 2004)) localized in the endosome or DNA localized in the
cytoplasm (K. J. Ishii et al., Nat Immunol 7, 40 (January, 2006))
are recognized and thus interpreted as foreign. The frequency of
so-called CpG motifs in microbial DNA serves as a molecular feature
further improving distinction of self and non-self DNA in the
endosome. Although RNA recognition in the endosome is sequence
dependent (F. Heil et al., Science 303, 1526 (Mar. 5, 2004); V.
Hornung et al., Nat Med 11, 263 (March, 2005)), no sequence motifs
have been defined so far that serve as a molecular basis to improve
distinction of self and non-self RNA (i.e. motifs that are more
frequent in viral than in self RNA) in the cytoplasm. Instead, the
molecular characteristic of double-strandedness seems to allow
distinction of self and non-self RNA. In fact, in the endosome,
long double-stranded RNA and its mimic poly(I:C), but not
single-stranded RNA, are recognized via TLR3 (L. Alexopoulou, et
al., Nature 413, 732 (Oct. 18, 2001)). In the cytoplasm, abundant
self RNA complicates our understanding of the recognition of
non-self RNA. Nevertheless, the concept that long dsRNA in the
cytoplasm is detected as non-self has never been questioned since
the discovery of type I IFN.
[0013] Unlike in the absence of RIG-I and MDA-5, antiviral defense
is largely maintained in the absence of TLRs (A. Krug et al.,
Immunity 21, 107 (July, 2004); K. Tabeta et al., Proc Natl Acad Sci
USA 101, 3516 (Mar. 9, 2004); T. Delale et al., J Immuno/175, 6723
(Nov. 15, 2005); K. Yang et al., Immunity 23, 465 (November,
2005)), underscoring the critical role of RIG-I and MDA-5 in
antiviral responses.
[0014] It is therefore an object of the present invention to
provide polynucleotides/oligonucleotides which are capable of
stimulating an anti-viral response, in particular, a type I IFN
response. It is another object of the present invention to provide
a pharmaceutical composition capable of inducing an anti-viral
response, in particular, type I IFN production, in a patient for
the prevention and treatment of diseases and disorders such as
viral infection. It is also an object of the present invention to
provide a pharmaceutical composition for treating tumor.
[0015] A recent study demonstrated that in vitro transcribed siRNAs
(small-interfering RNA), but not synthetic siRNAs, stimulated the
production of type I IFN from selected cell lines (D. H. Kim et
al., Nat Biotechnol 22, 321 (March, 2004); US 2006/0178334).
However, the structural requirements and the physiological
relevance of this induction and the mechanism of detection remain
unclear. Furthermore, in the work by Kim et al., the in vitro
transcribed siRNAs, regardless of their nucleotide sequence,
induced type I IFN production in both virally infected and
non-infected cells, regardless of whether the target mRNAs were
present or not, leading to cell death. In other words, the in vitro
transcribed siRNAs induced IFN production and consequently, cell
death, in a non-sequence-dependent and non-target cell-specific
manner. The lack of sequence- and cell-specificity severely limits,
if not precludes, the use of such in vitro transcribed siRNAs for
therapeutic purposes.
[0016] It is therefore a further object of the present invention to
provide polynucleotides/oligonucleotides which are capable of
inducing an anti-viral response, in particular, a type I IFN
response, in a nucleotide sequence-dependent and target
cell-specific manner. Such polynucleotides/oligonucleotides can be
advantageously used for the treatment of diseases and disorders
such as viral infection and tumor without harming bystander (i.e.,
healthy, non-infected or non-diseased) cells.
SUMMARY OF THE INVENTION
[0017] The present invention provides an oligonucleotide or a
precursor thereof which is capable of inducing an anti-viral,
anti-bacterial, and/or anti-tumor response in a vertebrate cell and
their in vitro and in vivo, in particular, medical, uses.
[0018] The present invention further provides a method for
preparing an oligonucleotide which is capable of inducing an
anti-viral, anti-bacterial, and/or anti-tumor response in a
vertebrate cell.
[0019] The present invention also provides a method for preparing
an oligonucleotide which lacks the capability of inducing an
anti-viral, anti-bacterial, and/or anti-tumor response in a
vertebrate cell.
BRIEF DESCRIPTION OF THE FIGURES
[0020] FIG. 1: In vitro transcribed RNA induces a potent
IFN-.alpha. response in human monocytes
[0021] (A) PDC and monocytes were plated in 96-well plates and
transfected with 200 ng in vitro transcribed RNA (2500
nucleotides). CpG-A (3 .mu.g/ml) and R848 (10 .mu.M) were used as
control stimuli for TLR9- or TLR7-mediated IFN-.alpha. induction in
PDC. Supernatant was harvested 24 hours after stimulation and
IFN-.alpha. production was assessed via ELISA. Data of two
independent donors were summarized and are depicted as mean
values.+-.SEM.
[0022] (B) pBluescript KS was used to generate DNA templates of
various lengths for in vitro transcription (lower panel). In vitro
transcribed RNAs were analyzed on a 4% denaturing agarose gel prior
to transfection. Subsequently in vitro generated RNAs were
transfected in purified PDC and monocytes plated in 96-well plate.
24 hours after transfection supernatants were analyzed for
IFN-.alpha. production. Data of two independent donors were
summarized and are depicted as mean values.+-.SEM.
[0023] (C) A set of RNA oligonucleotides was generated ranging from
27 to 9 nucleotides by gradually shortening a 27-mer
oligonucleotide from the 3' end in steps of three nucleotides.
Purified monocytes were transfected with the respective
oligonucleotides and IFN-.alpha. production was analyzes 24 hours
after stimulation. Data of five independent donors were normalized
to the IFN-.alpha. induction level of the 27 nucleotides
oligonucleotide (5876.+-.1785 pg/ml) and summarized as mean
values.+-.SEM.
[0024] (D) Purified monocytes were transfected with 200 ng in vitro
transcribed RNA with different homopolymeric 3' tails. Tri-GFPs was
included as a positive control. 24 hours after transfection,
supernatants were collected and IFN-.alpha. production was assessed
via ELISA. Data of four independent donors were summarized and are
depicted as mean values.+-.SEM.
[0025] FIG. 2: 5' phosphorylated, but not synthetic RNA
oligonucleotides are potent inducers of IFN-.alpha. in human
monocytes
[0026] (A) Synthetically synthesized or enzymatically transcribed
RNA9.2s (200 ng) was transfected into purified monocytes or PDCs.
CpG-A (3 .mu.g/ml) and R848 (10 .mu.M) were included as positive
control stimuli for TLR9- or TLR7-mediated IFN-.alpha. induction in
PDC. Data of two (monocytes) or three (PDCs) independent donors
were summarized and are depicted as mean values.+-.SEM.
[0027] (B) The sense (tri-GFPs) and the antisense (tri-GFPa) strand
of an established anti-GFP siRNA were transcribed using in vitro
transcription. Both the single stranded components and the annealed
dsRNA molecule (all 200 ng) were transfected into purified
monocytes. In addition the dsRNA molecule was incubated with RNase
T1 to remove the overhanging 5' ends from both strands. Data from
two independent donors are depicted as mean values.+-.SEM.
[0028] (C) Calf intestine alkaline phosphatase (CIAP) was used to
dephosphorylate tri-GFPs and tri-GFPa. Untreated or
dephosphorylated RNA oligonucleotides were subsequently transfected
into monocytes and PDC. Data from two independent donors were
normalized to the respective untreated control oligonucleotide and
are depicted as mean values.+-.SEM.
[0029] FIG. 3: 7-methyl-guanosine capping and eukaryotic-specific
base modifications abolish IFN-.alpha. induction via 5'triphosphate
RNA
[0030] (A) RNA molecules of various length (27 nucleotides-302
nucleotides) derived from pBKS as a template (see Table 1B) were
transcribed in the presence of the cap analogue N-7 methyl GpppG
(m7G capped RNA) or using standard NTPs (uncapped RNA). Purified
monocytes were transfected with either m7G capped or uncapped RNAs
(200 ng each) and IFN-.alpha. production was assessed 24 hours
after stimulation. For each RNA transcript, data of two independent
donors were normalized to the uncapped RNA value and summarized as
mean values.+-.SEM. The absolute values for the respective RNA
transcripts were 1401, 2351, 91, 797 and 2590 pg/ml,
respectively.
[0031] (B) & (C) Tri-GFPs and tri-GFPa were synthesized via in
vitro transcription in the presence of either
uridine-5'-triphosphate, pseudouridine-5'-triphosphate (.psi.),
2-thiouridine-5'-triphosphate (s2U) (all B) or
2'-O-methyluridine-5'-triphosphate (C). Subsequently purified
monocytes and PDCs were transfected with the respective
oligonucleotides and IFN-.alpha. production was assessed 24 hours
after stimulation. For each RNA transcript, data of two (B) or
three (C) independent donors were normalized to the value of the
RNA oligonucleotide transcribed in the presence of
uridine-5'-triphosphate and summarized as mean values.+-.SEM.
[0032] FIG. 4: Triphosphate-mediated IFN-.alpha. induction requires
RIG-I but not MDA5
[0033] (A) HEK 293 cells were transfected with either RIG-I full,
RIG-IC, RIG-I K270A or the corresponding empty vector (all 200 ng
each) in the presence of pIFN-beta-Luc (300 ng) and pSV-beta
Galactosidase (400 ng). In addition either nothing, poly I:C,
synthetic RNA9.2s, tri-GFPs or tri-GFPa (all 200 ng) were included.
24 hours after transfection pIFN-beta-Luc reporter activity was
assessed. Data from one representative experiment out of three were
normalized to the empty vector condition and are depicted as mean
values of duplicates.+-.SEM.
[0034] (B) MEFs from mice devoid of either RIG-I or MDA5 or
respective wild type MEFs were transfected with tri-GFPs or
tri-GFPds. In addition MEFs were infected with EMCV at a M.O.I. of
1. 24 hours after stimulation supernatants were collected and
assayed for IFN-.beta. production. Data from one representative
experiment out of three are depicted.
[0035] (C) In addition, HEK 293 cells were transfected with either
RIG-I full or RIG-IC (200 ng each) and T7 RNA polymerase or the
transcriptionally defective point mutant T7 RNA polymerase D812N
(300 ng each) in the presence of pIFN-beta-Luc (300 ng) and
pSV-beta Galactosidase (400 ng). In addition either nothing, X8dt
(vector based on the pBKS backbone without T7 RNA polymerase
promoter) or pBKS (all 300 ng) were included. 24 hours after
transfection pIFN-beta-Luc reporter activity was assessed.
[0036] (D) In addition HEK 293 cells were transfected with
decreasing doses of T7RNA polymerase in the presence of either
RIG-I full or RIG-IC (200 ng) with nothing or pBKS (300 ng), while
pIFN-beta-Luc (300 ng) and pSV-beta Galactosidase (400 ng) were
included. 24 hours after transfection pIFN-beta-Luc reporter
activity was assessed. Data from one representative experiment out
of three were normalized to the RIG-IC/pBKS/17 RNA polymerase (300
ng) condition and are depicted as mean values of
duplicates.+-.SEM.
[0037] FIG. 5: Viral RNA induces IFN-induction via RIG-I depending
on its 5' end phosphorylation status
[0038] (A) Vero cells were transfected with either empty vector,
RIG-I full or RIG-IC in the presence of the reporter plasmid
p125-Luc. 6 hours later, the cells were either mock-infected or
infected with RV SAD L16 or RV SAD .DELTA.PLP at a MOI of 3.
p125-Luc reporter activity was assessed 48 h after DNA
transfection. Average data from two experiments done in duplicates
are shown as mean fold values (mock=1).+-.SEM.
[0039] (B) HEK 293T cells were either mock-transfected with PEI, or
with 1 .mu.g total RNA isolated from non-infected BSR cells or
total RNA isolated from BSR cells infected with RV L16 or RV
.quadrature.PLP. RNA isolates of non-infected BSR-cells, BSR cells
infected with SAD L16 (BSR L16) and SAD .DELTA.PLP (BSR dPLP) were
additionally treated with CIAP and transfected accordingly. 48 h
after transfection p125-Luc reporter activity was assessed. Data
are shown as mean fold values (mock=1) of triplicates.+-.SEM.
[0040] (C) Either mock, RNA isolated from gradient-purified virions
(RV L16) or CIAP-treated RNA from purified virions was used to
stimulate HEK 293T cells. As a positive control, an in vitro
transcribed RNA oligonucleotide corresponding to the 5' terminal
leader sequence (58 nt) of the RV SAD L16 cRNA was used to
stimulate HEK 293T cells. 48 h after stimulation p125-Luc reporter
activity was assessed. Data from the experiment are shown as mean
fold values (mock=1) of triplicates.+-.SEM.
[0041] FIG. 6: Triphosphate RNA directly binds to RIG-I
[0042] (A) HEK 293 cells were transiently transfected with full
length RIG-I, RIG-I CARD2 or RIG-I .DELTA.HELIc. 36 hours after
transfection cells were lysed and co-incubated with the indicated
RNA oligonucleotides (0.375 .mu.g; lower right panel) for two hours
at 4.degree. C. Next, streptavidin-agarose-beads were added for an
additional period of one hour. Beads were collected by
centrifugation and washed four consecutive times. After all washing
steps, supernatants were collected and after four washes
streptavidin-agarose beads were collected by centrifugation and
boiled in Laemmli buffer. For one representative experiment out of
two, the input (A, left panel), the supernatants of the first wash
(1. SN) (A, middle panel) and the bead-bound fraction (A, right
panel) are depicted (no or little signal was seen in the
supernatant of the second, third and fourth wash; data not shown).
All preparations were run on the same gel and the membranes were
exposed for the same time period.
[0043] (B) RIG-IC was immunoprecipitated using Flag-agarose-beads
and subsequently eluted via Flag-peptide. In analogy to above
experiments, the depicted RNA oligonucleotides were added to
purified RIG-IC and subsequently co-incubated with
streptavidin-agarose beads. If indicated, RNase T1 was used to
remove the 5' portion of the oligonucleotide containing the
triphosphate group. Beads were washed four consecutive times and
the first supernatant and the bead-bound fraction were analyzed by
western blotting. One representative experiment out of three is
shown.
[0044] FIG. 7: No difference in uptake of synthetic and
triphosphate RNA oligonucleotides in monocytes
[0045] (A) Synthetic or in vitro transcribed RNA oligonucleotides
of the sequence 9.2s were chemically labeled with Alexa 647
fluorophores, resulting in a base:dye ratio of 81 and 71
respectively. Subsequently purified monocytes were transfected with
labeled RNA oligonucleotides (all 50 ng). Two hours after
transfection cells were harvested and vigorously washed with 10 mM
EDTA in PBS twice. Uptake of the fluorescently labeled
oligonucleotides were assessed by flow cytometry. Untreated
monocytes were used to set the threshold level for positive cells.
Data from two independent donors were summarized and are depicted
as mean values t SEM.
[0046] (B) Histogram plots from one representative donor are
depicted.
[0047] FIG. 8: Only guanosine triphosphate, but not guanosine
diphosphate, guanosine monophosphate or guanosine initiated RNA
oligonucleotides induce a potent IFN-.alpha. response in human
monocytes
[0048] Using a T7 RNA polymerase template coding for a 24-mer RNA
oligonucleotide with only one initial guanosine, RNA
oligonucleotides were generated via in vitro transcription in the
presence of ATP, CTP and UTP and either only guanosine,
guanosine-5'-monophosphate, guanosine-5'-diphosphate or
guanosine-5'-triphosphate. Subsequently purified monocytes were
transfected with the respective RNA oligonucleotides (all 200 ng)
and IFN-.alpha. production was analyzed 24 hours after stimulation.
Data from two independent donors were summarized and are depicted
as mean values.+-.SEM.
[0049] FIG. 9: Prokaryotic RNA, but not eukaryotic RNA induces
IFN-.alpha. production in monocytes
[0050] Total RNA was isolated from E. coli bacteria strain DH10B
and human PBMC. Subsequently monocytes were transfected with E.
coli RNA, PBMC RNA, synthetic 9.2s RNA or in vitro transcribed 9.2s
(all 200 ng). In addition LPS (100 ng/ml) was added either
exogenously or combined with cationic lipid complexed synthetic
9.2s RNA to stimulate monocytes. IFN-.alpha. production was
analyzed 24 hours after stimulation. Data from two independent
donors were summarized and are depicted as mean values.+-.SEM.
[0051] FIG. 10: 3' overhangs of double stranded triphosphate RNA
oligonucleotides do not impact on the immunostimulatory
activity
[0052] Purified monocytes were transfected with either tri-27+2s,
tri-27+2a, tri-27+0s, tri-27+0a or the respective double stranded
oligonucleotides (all 200 ng). IFN-.alpha. production was analyzed
24 hours after stimulation. Data from three independent donors were
summarized and are depicted as mean values.+-.SEM.
[0053] FIG. 11: Triphosphate RNA-mediated IFN-.alpha. induction is
independent of endosomal maturation and of TLR7
[0054] (A) & (B) Purified PDCs (A) and monocytes (B) were
pre-incubated with two-fold ascending doses of chloroquine (39-625
ng/ml) and subsequently cells were either stimulated with CpG-A (3
.mu.g/ml) or transfected with 200 ng tri-GFPa. 24 hours after
incubation supernatants were collected and IFN-.alpha. production
was assessed via ELISA. Data from two independent donors were
summarized as mean values.+-.SEM.
[0055] (C) Murine MDC were generated from bone marrow cells from
either TLR7 knock out mice (TLR7-/-) or respective control animals
(TLR7 +/-). Subsequently BM-MDC were transfected with 200 ng
tri-GFPs or stimulated with either R848 (10 .mu.M), CpG-B (3
.mu.g/ml), CpG-A (3 .mu.g/ml) or poly I:C (25 .mu.g/ml). 24 hours
after incubation supernatants were analyzed for IFN-.alpha. and
IP-10 production. One representative experiment (mean of
duplicates.+-.SEM) out of three is depicted.
[0056] FIG. 12: 5' adenosine-initiated triphosphate transcripts are
superior to 5' guanosine initiated transcripts in terms of
IFN-.alpha. induction
[0057] (A) Purified monocytes were transfected with either
RNA9.2-0A, RNA9.2s-1G or RNA9.2s-5A (all 200 ng) and IFN-.alpha.
production was analyzed 24 hours after stimulation. Data from two
independent donors were summarized and are depicted as mean
values.+-.SEM.
[0058] (B) RNA transcripts derived from either the A.PHI.16.5-35n
or the G.PHI.1)6.5-35n template were transfected into purified
monocytes and IFN-.alpha. induction was assessed 24 hours after
transfection. Data from three independent donors were summarized
and are depicted as mean values.+-.SEM.
[0059] FIG. 13: 5' sequence of adenosine-initiated 5'-triphosphate
RNA oligonucleotides dictates IFN-.alpha. inducing activity.
[0060] Adenosine-initiated triphosphate RNA oligonucleotides with
all possible base permutations (A, C, G and U) of the 2nd, 3rd and
4th position of the sequence (5'->3') were generated via in
vitro transcription (see Table 2). Subsequently monocytes from
three independent donors were isolated and transfected with the
respective RNA oligonucleotides. 36 hours after transfection,
supernatants were analyzed for IFN-.alpha. production. The obtained
IFN-.alpha. induction levels of all oligonucleotides were
normalized to the mean induction level of all oligonucleotides
(=100%). The obtained normalized induction levels of all three
donors were summarized as mean values.+-.SEM.
[0061] FIG. 14: Prokaryotic RNA, but not in vitro transcribed RNA
induces IFN-.alpha. in human monocytes after 5'
dephosphorylation.
[0062] Tri-GFPa was prepared via in vitro transcription (A), and in
addition total RNA was isolated from E. coli bacteria strain DH10B
(B). Subsequently the respective RNA preparations were treated with
CIAP to dephosphorylate the 5' end and transfected into purified
monocytes (200 ng of RNA). IFN-.alpha. production was analyzed 24
hours after stimulation. Data from two independent donors are
depicted.
[0063] FIG. 15: Combining potent immunostimulatory functions with
efficient gene-silencing activity in one RNA-molecule
[0064] (a) B16 cells were seeded in 24-well plates. At a confluency
of 50%, B16 cells were transfected with the selected chemically
synthesized siRNAs (anti-Bcl-2 2.1, anti-Bcl-2 2.2 and anti-Bcl-2
2.3) at 1.2 .mu.g/well (100 .mu.mol) using Lipofectamine 2000 (2.0
.mu.l). 48 hours after transfection protein expression of murine
Bcl-2 was analyzed by Western-Blot. Subsequently, the siRNA
anti-Bcl-2 2.2 (OH-2.2) was in vitro transcribed (termed 3p-2.2)
and tested for its ability to induce gene-silencing. Control siRNA
and 3p-GC, a non-specific double-stranded 3p-RNA, served as
negative control. One representative experiment of four is
shown.
[0065] (b) To determine the endogenous expression of RIG-I, B16
cells were stimulated with 3p-2.2 (1.2 .mu.g/well) and murine
IFN-.beta. (1000 U/ml). After 6 hours cells were lysed and analyzed
for endogenous expression of RIG-I by Western Blot. HEK293 cells
overexpressing full-length RIG-I served as positive control. One
representative experiment of two is shown.
[0066] (c) For monitoring transient IFN-.beta. activation in tumor
cells, B16 cells were seeded in 24-well plates and transfected with
the indicated expression plasmids using high molecular weight PEI
or Lipofectamine 2000. 24 cells were stimulated with poly(I:C) (200
ng/well), 3p-2.2 (200 ng/well) and OH-2.2 (200 ng/well). IRF3-5D
served as positive control. 16 h after transfection cells were
analyzed for luciferase activity with a microplate luminometer
(LUMIstar, BMGLabtechnologies). Data are shown as means.+-.SEM of
three independent experiments (*P<0.05 between 3p-2.2, OH-2.2
and poly(I:C); t-test).
[0067] (d) B16 cells were seeded in 24-well plates and
co-transfected with synthetic siRNAs (10 .mu.mol) and the indicated
expression plasmids (200 ng) as described. 24 hours after
transfection the cells were stimulated with 3p-2.2 for 16 hours.
Data are shown as means.+-.SEM of three independent experiments
(*P<0.05 between control siRNA (siCO)+3p-2.2 versus RIG-I siRNA
(siRIG-I)+3p-2.2; t-test).
[0068] (e) B16 cells were transfected with the indicated expression
plasmids for 24 hours and stimulated with 3p-2.2 for 16 hours. Data
are shown as means.+-.SEM of two independent experiments
(*P<0.05, NS3-4A*+3p-2.2 versus NS3-4A+3p-2.2; t-test).
[0069] FIG. 16: Transfection of 3p-2.2 directly triggers
Cardif-independent apoptosis in tumor cells, but not in primary
cells
[0070] Murine B16 cells were seeded in 24-well plates and
transfected with 3p-2.2 (1.2 .mu.g/well), OH-2.2 (1.2 .mu.g/well)
and Control-siRNA (1.2 .mu.g/well) using Lipofectamine (2.0 .mu.l).
24 hours after transfection cells were analyzed by flow cytometry
for apoptosis by gating on Annexin-V positive cells. Annexin-V
positive and PI-positive cells (late apoptotic or dead cells) were
excluded.
[0071] (a) One representative FACS-Analysis of four independent
experiments is shown.
[0072] (b) Results of apoptosis of B16 cells are shown as
means.+-.SEM of four independent experiments (P**<0.01 3p-2.2
versus OH-2.2 and control siRNA; t-test).
[0073] (c) Murine B16 cells were seeded in 24-well plates and
transfected with pNS3-4A and pNS3-4A* for 24 h. Then cells were
washed and stimulated for 24 hours with 3p-2.2 and the number of
apoptotic cells was determined by FACS-analysis. Data are shown as
means.+-.SEM of two independent experiments.
[0074] (d) Results of apoptosis in human PBMCs are shown as
means.+-.SEM of two independent experiments.
[0075] (e) B16 cells were incubated with control siRNA, 3p-2.2 and
poly(I:C) for 24 hours and assessed for caspase-1 activity via
immunoblotting. .alpha.-Tublin served as loading control. One
representative experiment of three is shown.
[0076] FIG. 17: IFN-.alpha. Production by 3p-2.2 requires TLR7 in
pDCs and RIG-I in cDCs and is limited to certain immune cell
subsets
[0077] GMCSF-derived cDCs of Wild-type, RIG-1-deficient (a),
MDA5-deficient (b) and TLR7-deficient (c) mice and Flt3-L-derived
pDCs of TLR7-deficient mice (d) were transfected with 200 ng of
3p-2.2, dsDNA (Sigma; dAdT), poly(I:C) (Sigma) complexed to
Lipofectamine 2000 and CpG-A 2216 (3 .mu.g/ml) in 96 well plates.
After 24 h, IFN-.alpha. was measured in the supernatants by ELISA.
Data are expressed as the mean.+-.SEM of two independent
experiments.
[0078] (e) B cells, NK cells and CD 8 T cells were purified from
spleens of wild-type mice using magnetic cell sorting and
stimulated with 200 ng of 3p-2.2. Sorted pDCs from Flt3-L induced
bone marrow cultures and GMCSF-derived cDCs stimulated with 3p-2.2
served as positive control. Data are expressed as the mean.+-.SEM
of two independent experiments.
[0079] FIG. 18: Encapsulated 3p-2.2 leads to systemic immune
activation in vivo
[0080] C57BU6 mice were injected with 200 .mu.l containing 3p-2.2
or OH-2.2 (50 .mu.g/Mouse) complexed with jetPEI.TM.. Subsequently,
the complexes were injected in the retro-orbital vein. Serum was
collected after 6 hours unless indicated otherwise. Whole blood was
obtained by tail clipping at the indicated time points. Cytokine
levels of IFN-.alpha. (a), IL-12p40 (b) and IFN-.gamma. (c) were
determined by ELISA. CpG1826 served as a positive control. Data are
shown as means.+-.SEM of 6 independent experiments; P**<0.01 or
P*<0.05.
[0081] (d-e) C57BU6 and TLR7 -/- mice were injected intravenously
with 3p-2.2 and OH-2.2 (50 .mu.g) complexed to jetPEI.TM. (Biomol).
After 6 hours, mice were sacrificed and serum was analyzed for
IFN-.alpha. (d), IL-12p40 (e) and IFN-.gamma. (f) production by
ELISA. Data are shown as means.+-.SEM of 2 independent
experiments.
[0082] FIG. 19: Dose-dependent activation of immune cell subsets by
3p-2.2 in vivo
[0083] C57BU6 mice were injected with 200 .mu.l of 3p-2.2 (25-, 50-
or 75 .mu.g/mouse) complexed with jetPEI.TM. into the retro-orbital
vein. Serum was collected after 6 h unless indicated otherwise.
[0084] (a) Serum cytokine levels of IFN-.alpha., IL-12p40 and
IFN-.gamma. were determined by ELISA. Data are shown as
means.+-.SEM of 5 independent experiments.
[0085] (b-c) C57BU6 mice were injected with 200 .mu.l of nucleic
acid (25-, 50- or 75 .mu.g/mouse) complexed with jetPEI.TM.. Spleen
cells were isolated 48 hours after injection and CD86 or CD69
expression was analyzed on pDCs, mDCs, NK cells, CD4 T cells and
CD8 T cells by flow cytometry. Surface antigen staining was
performed as described previously. (b)
[0086] Histograms of one representative experiment after
stimulation with 50 .mu.g 3p-2.2 (grey bar, unstimulated control
mice). (c) The dose-dependent activation by 3p-2.2 of different
immune cell subsets. Data are shown as means.+-.SEM of 2
independent experiments.
[0087] FIG. 20: 3p-2.2 stimulation leads to increased IFN-.alpha.
serum-levels for less than two days and induces moderate
thrombocytopenia and leukopenia in vivo.
[0088] (a) C57BU6 mice were injected with 50 .mu.g 3p-2.2 or OH-2.2
complexed with jetPEI.TM.. Serum was collected 12 h, 24 h, and 48 h
after injection unless indicated otherwise. Serum levels of
IFN-.alpha. were determined by ELISA. Data are shown as
means.+-.SEM of 2 independent experiments.
[0089] (b) C57BU6 mice were injected with 50 .mu.g 3p-2.2 complexed
with jetPEI.TM.. Blood was collected after 48 h and processed as
EDTA plasma for measurement of leucocytes (WBC) and platelets.
Blood cell counts were performed at the Central Laboratory of the
Department of Internal Medicine, University of Munich at the
indicated time point (P**<0.01 between the platelet count of
3p-2.2 and CpG). Data are shown as means.+-.SEM of 2 independent
experiments.
[0090] FIG. 21: Delivery of encapsulated 3p-2.2 results in
reduction of experimentally induced B16 melanoma lung
metastases
[0091] (a) Therapeutic regimen: Mice were challenged with
4.times.10.sup.5 B16 melanoma cells intravenously to experimentally
induce lung metastases on day 0. Mice were treated intravenously
with the indicated nucleic acid complexed to jetPEI.TM. on day 3, 6
and 9 as indicated. 14 days after challenge, the number of
macroscopically visible melanoma metastases on the surface of the
lungs was counted with the help of a dissecting microscope or the
lung weight was calculated.
[0092] (b) Groups of five C57BU6 mice were challenged with
4.times.10.sup.5 B16 and treated as described. Mice were treated
intravenously on day 3, 6 and 9 with 50 .mu.g of OH-2.2, 50 .mu.g
3p-2.2, 50 .mu.g 3p-GC (a nonspecific double-stranded 3p-RNA) or 50
.mu.g CpG oligonucleotide ligand, each complexed with jetPEI.TM..
Control groups received 100 .mu.l of Glucose 5% or 50 .mu.g of
PolyA complexed with jetPEI.TM.. Tumor growth was assessed after 14
days by measuring the weight of the lungs. Shown are lung weights
of five individual mice. The mean lung weight is indicated by a
column. The lung weight of healthy mice ranges between 0.2 and 0.24
g (P**<0.01 between 3p-2.2 and PolyA, OH-2.2 and 3p-GC; n=5;
generalized Mann-Whitney test).
[0093] (c) A single dose of complexed or non-complexed FITC-labeled
siRNA (100 .mu.g) was injected intravenously in healthy mice or in
tumor-bearing mice. After 6 h, the mice were sacrificed and various
tissues including lungs were excised and analyzed for uptake of the
RNA complexes. Tissues were then analyzed using a Zeiss LSM510
confocal microscope (Carl Zeiss, Germany) equipped with 488
nm-Argon and 633 nm-Helium-Neon lasers. One representative
experiment after injection with 100 .mu.g FITC-labeled siRNA is
shown.
[0094] FIG. 22: Mechanisms of tumor reduction by 3p-2.2
[0095] (a) Groups of 4 C57BU6 mice were injected intravenously with
4.times.10.sup.5 B16 melanoma cells to experimentally induce lung
metastases. Mice were treated intravenously on day 3, 6 and 9 with
50 .mu.g of 3p-2.2 and 50 .mu.g of poly(I:C), respectively.
PolyA-treated animals served as the control group. Tumor growth was
assessed on day 14 by counting the number of macroscopically
visible melanoma metastases on the lung surfaces. Shown are the
number of metastases in individual C57BU6 mice. The mean number of
metastases is indicated by the horizontal line (P<0.05 between
3p-2.2 and PolyA treated mice; n=4; generalized Mann-Whitney
test).
[0096] (b) Effect of 3p-2.2 complexed with jetPEI.TM. on tumor
growth in TLR.sup.-/- mice (P<0.05 between 3p-2.2 and PolyA
treated mice; n=4; generalized Mann-Whitney test).
[0097] (c) Effect of 3p-2.2 complexed with jetPEI.TM. on tumor
growth in IFNAR.sup.-/- mice (P>0.05 between 3p-2.2 and PolyA
treated mice; n=4; generalized Mann-Whitney test).
[0098] (d) Effect of antibody-mediated depletion of CD8+ T cells
and NK cells on the therapeutic anti-tumor efficacy of 3p-2.2
complexed with jetPEI.TM. in C57BU6 wild-type mice.
[0099] (e) Bcl-2 expression in metastatic lungs of IFNAR.sup.-/-
mice treated with 3p-2.2 and poly(I:C) were analyzed by flow
cytometry. Results are presented as means.+-.SEM from two
individual experiments.
[0100] FIG. 23: Induction of apoptosis in lung metastases by 3p-2.2
in vivo
[0101] Groups of 5 C57BL/6 mice were injected intravenously with
4.times.10.sup.5 B16 melanoma cells to experimentally induce lung
metastases. Mice were treated intravenously on day 3, 6 and 9 with
50 .mu.g of PolyA (a), 50 .mu.g of 3p-2.2 (b) or 50 .mu.g of
CpG1826 (c). PolyA-treated animals served as the control group. On
day 14, samples of lungs were obtained when mice were sacrificed.
Tissue specimens were fixed in absolute ethanol and embedded in
paraffin. Apoptosis was detected by the transferase-mediated dUTP
nick end-labeling (TUNEL) method according to the manufacturer's
instructions. One representative experiment of 5 is shown.
[0102] FIG. 24: Inosine content increases the IFN-.alpha. inducing
activity of 3pRNA.
[0103] (A) Monocytes were prepared from human PBMC and transfected
with RNA. 4.times.10.sup.5 cells were cultured for 18 hours, and
IFN-.alpha., was measured by ELISA.
[0104] (B) Mouse dendritic cells were prepared by incubating murine
bone marrow from wild type and MDA-5-/- mice with GMCSF. Murine
dendritic cells (2.times.10.sup.5 cells per well) were transfected
with 400 ng RNA. After 18 h, IFN-.alpha. was measured in the
supernatants by ELISA.
[0105] FIG. 25: IFN-.alpha.-inducing activity of synthetic
single-stranded 5' triphosphate RNA.
[0106] PBMC were transfected with chemically synthesized
single-strand oligonucleotides alone or together with their
complementary antisense strand (AS) by using Lipofectamine and
incubated in the presence or absence of chloroquine (Chl). CpG2331
was used as a positive and chloroquine-sensitive control for
IFN-.alpha. induction in PBMC.
DETAILED DESCRIPTION OF THE INVENTION
[0107] Detection of viral infection is vital for higher organisms
to safeguard the integrity of their genome. TLRs contribute to
recognition of viral nucleic acids, but their proper function seems
largely dispensable for effective antiviral defense (A. Krug et
al., Immunity 21, 107 (July, 2004); K. Tabeta et al., Proc Natl
Acad Sci USA 101, 3516 (Mar. 9, 2004); T. Delale et al., J Immunol
175, 6723 (Nov. 15, 2005); K. Yang et al., Immunity 23, 465
(November, 2005)). It was not until recently that it became clear
that the two cytoplasmic helicases, MDA-5 and RIG-I (M. Yoneyama et
al., Nat Immuno/5, 730 (July, 2004)), are essential for controlling
viral infection.
[0108] The present inventors identified RNA with a triphosphate
group at the 5' end and an optimal minimal length of 19 nucleotides
as a specific ligand for RIG-I. Both exogenous 5' triphosphate RNA
transfected into a cell and endogenously formed 5' triphosphate RNA
activated RIG-I. Genomic RNA prepared from a negative strand RNA
virus and RNA prepared from virus-infected cells, but not RNA from
non-infected cells, triggered a potent IFN-.alpha. response in a 5'
triphosphate-dependent manner. Binding studies of RIG-1 and 5'
triphosphate RNA revealed a direct molecular interaction.
[0109] Uncapped, unmodified 5' triphosphate RNA is the first
well-defined molecular structure of viral nucleic acids that is
detected by eukaryotic cells. Since viruses due to their lifecycle
are composed of the same molecular constituents as their host
cells, namely protein and nucleic acid, such defined molecular
structures that allow discrimination of viral and self RNA are
expected to be rare and the presence of such has been questioned.
In this regard, viruses are different from bacteria that contain a
variety of molecules such as endotoxin which are absent in
eukaryotes and which are easily recognized with high confidence by
TLRs such as TLR4 located in the cytoplasmic membrane.
[0110] Until now, localization of viral nucleic acids in the
endosome rather than a specific molecular feature of viral nucleic
acids was thought to be the major factor allowing the detection of
viruses. Although TLR-mediated recognition of single-stranded RNA
(by TLR7 and TLR8) and of short double-stranded RNA (by TLR7) in
the endosome was found to be sequence dependent, the frequency of
such sequence motifs in viruses and vertebrates is similar
(unpublished observation by the present inventors). This applies
even to CpG motifs, which are suppressed in both vertebrate and
viral but not bacterial DNA (A. M. Krieg, Annu Rev Immuno) 20, 709
(2002)). This view is supported by a recent study demonstrating
that endosomal localization of TLR9 prevents recognition of self
DNA and facilitates detection of viral DNA (G. M. Barton, J. C.
Kagan, R. Medzhitov, Nat Immunol 7, 49 (January, 2006)). CpG motif
independent recognition of DNA by TLR9 has been described by others
(J. Vollmer et al., Antisense Nucleic Acid Drug Dev 12, 165 (June,
2002)).
[0111] Given the fact that all primer-independent RNA transcripts
are initially generated as 5' triphosphate RNAs, the question
arises how eukaryotic RNA evades the recognition of RIG-I. In the
cytosol of eukaryotic cells, most if not all self RNA species do
not carry a free 5' triphosphate end. Before self RNA leaves the
nucleus and reaches the cytosol, RNA is further processed. This
holds true for RNA transcripts of all three RNA polymerases in
eukaryotes.
[0112] Polymerase I transcribes a large polycistronic precursor
ribosomal RNA (rRNA) which contains the sequences for the mature
rRNAs (18, 5.8S, 25-28S rRNA), two external transcribed spacers and
two internal transcribed spacers. This primary transcript is
subjected to many endo- and exonucleolytic-processing steps to
produce the mature rRNAs. The net result of this maturing process
is a monophosphate group at the 5' end of all polymerase I
transcribed rRNAs (M. Fromont-Racine et al., Gene 313, 17 (Aug. 14,
2003)).
[0113] Messenger RNAs (mRNAs) and small nuclear RNAs (snRNAs),
which are transcribed by polymerase II, receive a 7' methyl
guanosine group that is attached to the 5' triphosphate of the
nascent RNA by a process called capping (A. J. Shatkin, J. L.
Manley, Nat Struct Biol 7, 838 (October, 2000)). Thus, upon export
into the cytoplasm, no free triphosphate groups are found in
polymerase II transcripts.
[0114] Polymerase III synthesizes transfer RNAs (tRNAs) and rRNA 5S
that are both exported in to the cytoplasm, and other small RNAs
including U6 RNA. Prior to the export into the cytoplasm, tRNAs are
further matured in the nucleus, including the removal of various
nucleotides from the 5' end by ribonuclease P. Therefore all mature
tRNAs that can be found in the cytoplasm have been processed at the
5' end resulting in a 5' monophosphate (S. Xiao et al. Annual
review of biochemistry 71, 165 (2002)). The phosphorylation status
of the 5' end of the ribosomal RNA 5S has not been studied and at
present is unknown. U6 RNA receives a .gamma.-monomethylphosphate
(mpppG) cap structure following transcription (R. Singh, R. Reddy,
PNAS 86, 8280 (November, 1989)).
[0115] In addition to the lack of free 5' triphosphate residues,
eukaryotic RNA posttranscriptionally undergoes significant
modification of its nucleosides and its ribose backbone. Among all
nucleoside modifications, pseudouridinylation is one of the most
common posttranscriptional modifications of RNA that appears to be
universal among rRNAs and small stable RNAs such as splicing small
nuclear RNAs (snRNAs), tRNAs, and small nucleolar RNAs (snoRNAs).
However, the frequency and location of pseudouridinilated
nucleotides vary phylogenetically. Intriguingly, eukaryotes contain
far more nucleoside modifications within their RNA species than
prokaryotes. Human ribosomal RNA for example, the major constituent
of cellular RNA, contains ten times more pseudouridine (.psi.) and
25 times more 2'-O-methylated nucleosides than E. coli rRNA (J.
Rozenski et al. Nucleic acids research 27, 196 (Jan. 1, 1999)). The
same applies for eukaryotic tRNAs, the most heavily modified
subgroup of RNA with up to 25% of modified nucleosides. The host
machinery that carries out nucleoside modifications and
2'-O-methylation of the ribose backbone is located in the nucleolus
and consists of RNA-protein complexes containing snoRNAs and
several associated proteins (i.e., snoRNPs) (W. A. Decatur, M. J.
Foumier, J. Biol. Chem. 278, 695 (Jan. 3, 2003)).
[0116] Information on nucleolus specific nucleoside modifications
or ribose 2'-O-methylation of viral RNA genomes is limited. Since
most RNA viruses do not replicate in the nucleus and modification
is tightly confined to the sequence and structure of their target,
extensive modification of viral RNA seems unlikely.
[0117] Altogether, post-transcriptional modifications of eukaryotic
RNA such as 5' processing or capping as well as nucleoside
modifications or ribose backbone methylation provide the molecular
basis for the distinction of self RNA generated in the nucleus from
viral RNA of cytoplasmic origin.
[0118] The mRNAs of viruses infecting eukaryotic cells also
commonly contain 7-methyl guanosine cap-structures at their 5''ends
and poly(A) tails at their 3''ends (Y. Furuichi, A. J. Shatkin, Adv
Virus Res 55, 135 (2000)). Some viruses make use of the host
transcription machinery to acquire caps and poly(A) tails. RNA
viruses that do not rely on the host transcriptional machinery
produce their own capping enzymes or utilize other mechanisms such
as snatching the 5'-terminal regions of host mRNAs. Despite these
adaptations of viruses to the host transcriptional system, viral
RNA synthesis leads to transient cytoplasmic RNA intermediates with
an uncapped 5''triphosphate end.
[0119] With notable exceptions such as the Picornavirus family (see
below), viral RNA-dependent RNA polymerases (RdRp) initiate
polymerase activity de novo without a specific primer (C. C. Kao,
et al., Virology 287, 251 (Sep. 1, 2001)). As a consequence, these
RdRp-dependent transcripts start with an uncapped 5' triphosphate.
This has been studied in great detail for the replication of
positive strand RNA viruses of the family of Flaviviridae
(including Hepatitis C Virus, Yellow Fever Virus, Japanese
Encephalitis Virus and Dengue Virus); all of these viruses were
reported to be recognized via RIG-I (H. Kato et al., Nature 441,
101 (Apr. 9, 2006); R. Sumpter, Jr. et al., J. Virol. 79, 2689
(Mar. 1, 2005, 2005); T.-H. Chang et al., Microbes and Infection 8,
157 (2006)). Segmented negative strand RNA virus (NSV) rely on a
cap-snatched primer for mRNA transcription, yet initiate genomic
and the complementary antigenomic RNA replication by a primer
independent de novo mechanism resulting in a 5'triphosphate
initiated transcript (A. Honda, et al., Virus Res 55, 199 (June,
1998); G. Neumann, et al., Current topics in microbiology and
immunology 283, 121 (2004)). NSV with a nonsegmented genome (Order
Mononegavirales), including the Paramyxoviruses and Rhabdoviruses,
initiate both replication and transcription de novo leading to 5'
triphosphate RNA in the cytosol. Both the full length replication
products, vRNA and cRNA, and a short leader RNA which is abundantly
synthesized during initiation of transcription, maintain their 5'
triphosphate (R. J. Colonno, A. K. Banerjee, Cell 15, 93 (1978)),
while the virus-encoded mRNA transcripts are further modified at
their 5' ends by capping and cap methylation. Consequently, genomic
RNA from NSVs per se is expected to trigger an IFN-response without
the need for replication and presumed dsRNA formation. Consistent
with this notion, not only live virus but also RNA purified from
NSV virions, in this case, VSV, has been shown to trigger strong
type I interferon responses depending on RIG-I (H. Kato et al.,
Nature 441, 101 (Apr. 9, 2006)).
[0120] The present inventors confirmed and extended these
observations by demonstrating that dephosphorylation of the viral
RNA isolates completely abolished the IFN response, thereby
indicating that the 5' triphosphate moiety is required for
recognition. In case of RV-infected cells, full length RNAs are
permanently enclosed within nucleoprotein (N) to form a linear,
helical nucleoprotein-RNA complex (RNP) in which the RNA is not
accessible to even small cellular molecules such as RNases.
Similarly, leader RNA has been reported to be encapsulated by N
(Blumberg D M & Kolakofsky D, J Virol. 1981 November;
40(2):568-76; Blumberg B M et al. Cell 1981 March; 23(3):837-45).
The effective recognition of live NSV by RIG-I may suggest that the
terminal triphosphates of the linear N-RNA complex are not
completely protected by N protein or that in the initial phase of
viral transcription, the levels of newly synthesized N protein are
insufficient for complete protection. In this respect, it is
interesting to note that NSV stocks that contain defective
interfering (DI) particle RNAs are potent inducers of IFN (Strahle
L. et al. 2006, Virology 351(1):101-11). Dls only contain the
terminal promoters for replication and provide plentiful 5'
triphosphate ends under conditions of reduced expression of helper
virus proteins.
[0121] On the other hand, all viruses in the Picornavirus-like
supergroup (picorna-, poty-, como-, calici- and other viruses) use
a RdRp which exclusively employs a protein as a primer for both
positive and negative strand RNA production: this protein primer is
part of the precursor RdRp and is cleaved off as elongation of the
initial complex occurs, to become a 5'-genome-linked protein,
usually known as viral genome-linked protein (VPg) (Y. F. Lee, et
al., Proc Natl Acad Sci USA 74, 59 (January, 1977)). Thus during
the lifecycle of Picornaviruses, uncapped, triphosphorylated 5'
ends are absent. Consequently, RIG-I is expected to be involved in
the detection of Flaviviridae and NSV but not picornaviruses, which
was confirmed in a recent study (H. Kato et al., Nature 441, 101
(Apr. 9, 2006)).
[0122] Prior to the present invention, long double-stranded RNA was
believed to be the only defined nucleic acid structure that occurs
during viral infection but is absent in normal cells. The notion
that the long double-stranded RNA mimic poly(I:C) induces type I
IFNs dates back to the early days of type I IFN research (M.
Absher, W. R. Stinebring, Nature 223, 715 (Aug. 16, 1969)).
Double-stranded RNA-dependent protein kinase (PKR) was thought to
be involved in IFN-.alpha. induction (S. D. Der, A. S. Lau, Proc
Natl Aced Sci USA 92, 8841 (Sep. 12, 1995)) but Weissmann's group
demonstrated that poly(I:C)-induced type I IFN is not impaired in
PKR deficient mice (Y. L. Yang et al., Embo J 14, 6095 (Dec. 15,
1995)). Others found that poly(I:C)-induced type I IFN was
partially dependent on PKR but independent of TLR3 (S. S. Diebold
et al., Nature 424, 324 (Jul. 17, 2003)). On the other hand, TLR3
was the first receptor proven to specifically bind long dsRNA and
to induce type I IFN upon binding (L. Alexopoulou, et al., Nature
413, 732 (Oct. 18, 2001)). TLR3 was found to be activated during
viral infection (in the case of CMV) (K. Tabeta et al., Proc Natl
Acad Sci USA 101, 3516 (Mar. 9, 2004)), but was not required for
viral clearance (in the case of RSV) (B. D. Rudd et al., J Immunol
176, 1937 (Feb. 1, 2006)).
[0123] A number of studies suggested that the helicases MDA-5 and
RIG-I recognize dsRNA (M. Yoneyama et al., Nat Immunol 5, 730
(July, 2004); S. Rothenfusser et al., J Immunol 175, 5260 (Oct. 15,
2005); J. Andrejeva et al., Proc Natl Aced Sci USA 101, 17264 (Dec.
7, 2004)). However, the present inventor found that double-strand
formation of RNA is not required for RIG-1-RNA interaction and that
dsRNA is not sufficient for RIG-I activation. The present inventors
further found that MDA-5 is not involved in 5' triphosphate RNA
recognition. Although there is convincing evidence that MDA-5 is
activated by the long dsRNA mimic poly(I:C), activation of MDA-5 by
natural long dsRNA is still controversial (H. Kato et al., Nature
441, 101 (Apr. 9, 2006)). Taken together, TLR3 so far is the only
receptor that leads to the production of type I IFN upon binding of
the natural long dsRNA molecule, but the contribution of TLR3 to
type I IFN induction and viral clearance in vivo seems to be
weak.
[0124] It is widely assumed that replication of both DNA and RNA
viruses is associated with the formation of intermediate dsRNA in
the cytoplasm. A recent study confirms the formation of
intermediate dsRNA for positive strand RNA viruses, dsRNA viruses
and DNA viruses but not NSV (F. Weber, et al., J Virol 80, 5059
(May, 2006)). However, formation of endogenous dsRNA occurs
physiologically in eukaryotic cells. In healthy eukaryotic cells,
dsRNA is present in the form of micro RNAs (miRNA) and
precursor-miRNAs. Precursor-miRNA are 70-nucleotide dsRNA stem-loop
structures that are constantly exported from the nucleus into the
cytosol to be further processed into 22 nucleotides miRNAs which
posttranscriptionally regulate a large number of target genes (B.
R. Cullen, Mol Cell 16, 861 (Dec. 22, 2004)). Therefore, dsRNA is
present in normal healthy eukaryotic cells without inducing an type
I IFN response. Therefore, dsRNA in the cytoplasm per se is not
virus-specific.
[0125] There is good evidence that short dsRNA such as siRNA
generated by Dicer-mediated cleavage of long dsRNA does not elicit
a type I IFN response in non-immune cells (V. Homung et al., Nat
Med 11, 263 (March, 2005); D. H. Kim et al., Nat Biotechnol 22, 321
(March, 2004); S. M. Elbashir et al., Nature 411, 494 (May 24,
2001)). A recent study suggests that the two nucleotides overhang
at the 3' end of dicer cleavage products are essential for the lack
of immunorecognition of short dsRNA (J. T. Marques et al., Nat
Biotechnol 24, 559 (May, 2006)). In the same study, it was proposed
that synthetic blunt end short dsRNA is recognized via RIG-I. The
conclusion that RIG-I is the receptor for blunt end short dsRNA is
based on experiments using RIG-I overexpressing cells and using
RIG-I specific siRNA (short dsRNA with two nucleotides 3'
overhangs) on top of stimulation with blunt end short dsRNA. RIG-I
deficient cells were not examined in this study.
[0126] It is well known that 5' triphosphate independent
recognition of short dsRNA as well as ssRNA occurs in the endosomal
compartment of a highly specialized subset of immune cells, the
plasmacytoid dendritic cell (PDC). PDC carry only two functional
TLRs, TLR7 for the detection of RNA, and TLR9 for the detection of
DNA. In humans, TLR-induced IFN-.alpha. induction is largely
confined to PDC. It has been reported that PDC are responsible for
the early induction of IFN-.alpha. during viral infection (A. Krug
et al., Immunity 21, 107 (July, 2004)). However, depleting PDC has
no major impact on host survival after viral infection (T. Delale
et al., J Immunol 175, 6723 (Nov. 15, 2005)). Based on these data,
a concept is evolving that PDC contribute to early antiviral immune
responses, while the major antiviral activity is based on
cytoplasmic recognition of the virus via RIG-I and/or MDA-5. In
situations where the virus escapes recognition of RIG-I and/or
MDA-5, PDC and TLR-mediated virus recognition may play a more
critical role. Thus, PDC serve as sentinels for viral particles
before it comes to viral replication in virus-infected cells, and
may serve as a backup strategy if the virus escapes RIG-I and/or
MDA-5 recognition.
[0127] The potency of the 5' triphosphate RNA specific antiviral
response is illustrated by the finding of the present inventors
that human primary monocytes produce large amounts of IFN-.alpha.
upon stimulation with 5' triphosphate RNA. Unlike in mice (S. S.
Diebold et al., Nature 424, 324 (Jul. 17, 2003)), human myeloid
cells have not been shown previously to produce considerable
amounts of IFN-.alpha. upon stimulation with nucleic acids. With 5'
triphosphate RNA, now for the first time a molecule is available
which is a real mimic of viral infection of cells and consequently
is capable of inducing IFN-.alpha. in any cell type including
immune cells that normally do not make IFN-.alpha., non-immune
cells and tumor cells.
[0128] Prior to the present invention, the only way to induce a
similar type of response was to use attenuated replicating viruses.
However, attenuated viruses may cause viral infection and disease
in immunosuppressed patients and mutations could eventually revert
viruses to become more pathogenic. 5' triphosphate RNA has the
potential to mimic attenuated replicating viruses with respect to
their potent stimulation of immunity. In this respect, 5'
triphosphate RNA seems to be the perfect biologically dead molecule
which can be used in the development of vaccines, therapeutic
vaccines, or immunotherapies for the prevention and/or treatment of
established diseases such as chronic viral infection and
tumors.
[0129] In addition, the present inventors found that 5'
triphosphate RNA induces not only type I IFN production in tumor
cells, but also apoptosis of tumor cells. Tumor cells are more
susceptible than non-tumor cells to apoptosis induced by 5'
triphosphate RNA. Therefore, 5' triphosphate RNA is an ideal
candidate for tumor therapy.
[0130] In the prior art, 5' triphosphate RNAs, whether
single-stranded or double stranded, were routinely generated by in
vitro transcription using bacteriophage RNA polymerases, such as
T7, T3, and SP6, which inevitably start the transcripts with a 5' G
(Maitra U et al. (1980) PNAS 77(7):3908-3911; Stump W T & Hall
K B (1993) Nucleic Acids Research 21(23):5480-5484). In contrast to
the established practice in the art, the present inventors found
that 5' triphosphate RNAs which start with a 5' A are more potent
at inducing a type I IFN response.
[0131] Furthermore, the present inventors found that the 5'
sequence of the 5' triphosphate RNA affects its potency. In
contrast, the 3'sequence of a 5' triphosphate RNA had little impact
as short 5' triphosphate RNA oligonucleotides with poly A, poly U,
poly C or poly G at the 3' end had similar activity.
[0132] Moreover, the present inventors found that the type I
IFN-inducing activity of a 5' triphosphate RNA increases with an
increasing inosine content.
[0133] In addition, in contrast to short oligonucleotides, long 5'
triphosphate RNA showed different levels of activity. This may be
explained by secondary structure formation of long RNA molecules
that could affect accessibility of the 5' triphosphate end for
RIG-I.
[0134] It was later discovered by the present inventors that not
only free, uncapped 5' triphosphate group was capable of inducing
type I IFN production, so were free, uncapped 5' monophosphate and
diphosphate groups. Therefore, the present invention provides the
use, in particular, therapeutic use of an
oligonucleotide/polynucleotide bearing at least one free, uncapped
phosphate group at the 5' end (i.e, a 5' phosphate
olignucleotide/polynucleotide).
[0135] Even though Kim D H et al. (2004, Nature Biotech.
22(3):321-325) and US 2006/0178334 teach that in vitro-transcribed
single-stranded 5' triphosphate RNA and single-stranded viral RNA
induced type I IFN production in selected cell lines and type I
IFN-inducing single-stranded 5' triphosphate RNA may also be
obtained from chemical synthesis, surprisingly, the present
inventors found that chemically synthesized 5' triphosphate RNA did
not have any type I IFN-inducing activity on its own. Rather, the
formation of a double-stranded structure was required. The in vitro
transcribed single-stranded RNA and single-stranded viral RNA are
likely to contain double-stranded structure due to the looping back
of the 3' end or other intra- or inter-molecular double-strand
formation, which accounts for their ability to induce type I IFN in
the absence of an antisense (i.e., complementary) strand.
[0136] This surprising finding opens up the possibility of inducing
type I IFN in a sequence- and cell-specific manner. In this
approach, a single-stranded 5' phosphate RNA, in particular, a 5'
triphosphate RNA, whose sequence is complementary to a tissue- or
cell-specific RNA can be chemically synthesized and introduced into
cells, tissues, organs or whole organisms in vitro, in vivo or ex
vivo.
[0137] One example of a tissue- or cell-specific RNA is an mRNA of
a disease/disorder-related gene. When introduced into healthy cells
which do not express the disease/disorder-related gene or do not
express the disease/disorder-related gene to any significant
degree, the single-stranded 5' phosphate RNA remains
single-stranded and is incapable of being recognized by RIG-I or
inducing type I IFN. In contrast, when introduced into diseased
cells expressing the disease/disorder-related gene or expressing
the disease/disorder-related gene at an elevated level, the
single-stranded 5' phosphate RNA binds the mRNA of the
disease/disorder-related gene, forms a double-stranded structure
which is recognized by RIG-I, leading to type I IFN production.
[0138] Another example of a tissue- or cell-specific RNA is a
microRNA (miRNA). MicroRNAs (miRNAs) are single-stranded molecules
about 21-23 nucleotides in length having a hairpin or stem-loop
structure; they are partially complementary to mRNAs of genes and
regulate the expression of said genes. miRNAs are expressed in a
tissue-, cell- and/or developmental stage-specific manner and are
known to be associated with certain diseases/disorders such as
cancer and heart disease.
[0139] This way, type I IFN response, which is normally cytotoxic
to cells, is only induced in diseased cells but not in healthy
bystander cells, leading to the effective eradication of diseased
cells without harming any healthy bystander cells.
[0140] The single-stranded 5' phosphate RNA useful in the present
invention can possesses gene silencing activity. However, the
single-stranded 5' triphosphate RNA useful in the present invention
does not need to possess any gene silencing activity. So long as
the single-stranded 5' phosphate RNA is capable of binding the
target endogenous RNA, i.e., has sequence complementarity to the
target endogenous RNA, it is useful in inducing type I IFN in a
target cell-specific manner. Under certain circumstances, it may be
desirable to use a single-stranded 5' phosphate RNA with gene
silencing activity. For example, it may be desirable to use an
antisense RNA against an oncogene in tumor cells to induce type I
IFN production and to reduce the proliferative potential of the
tumor cells at the same time. Under other circumstances, it may be
desirable to use a single-stranded 5' phosphate RNA without gene
silencing activity. It is conceivable that single-stranded 5'
phosphate RNA lacking gene silencing activity does not get
effectively recognized and degraded by the cellular machinery upon
binding to its target mRNA. As a result, the single-stranded 5'
phosphate RNA lacking gene silencing activity may have a prolonged
intracelluar half life.
[0141] Furthermore, 5' triphosphate RNA is found to be capable of
inducing IL-18 and IL-1.beta. production. Without being bound to
any theory, it is believed that 5' triphosphate is recognized by
the inflammasome, leading to the production of IL-18 and
IL-1.beta.. Therefore, 5' triphosphate RNA may be useful in the
treatment of diseases and/or conditions which may be alleviated by
the induction of these respective cytokines. The diseases and/or
conditions include, but are not limited to, allergies, malignant
and benign tumors, viral infections, bacterial infections (in
particular, intracellular bacterial infections), immunodeficiencies
and Immunosuppression (including bone marrow suppression by
cytotoxic chemotherapy).
[0142] Since certain structural features are required for a 5'
triphosphate oligonucleotide to be an effective ligand for RIG-I
and thus effective in inducing type I IFN, IL-18 and/or IL-1.beta.,
it is possible to inhibit RIG-I activation and the induction of
type I IFN, IL-18 and/or IL-1.beta. by using, for example,
chemically modified 5' triphosphate RNA, high concentrations of 5'
triphosphate RNA which is too short for optimal signaling, high
concentrations of 5' triphosphate RNA in which the double-stranded
section is too short for optimal signaling, high concentration of
single-stranded 5' triphosphate RNA which lacks sequence
complementarity to any cellular mRNA in a target cell. Such
oligonucleotides has inhibitory effect on the induction of type I
IFN, IL-18 and/or IL-1.beta. either by binding RIG-I without
initiating signaling or by diluting out 5' triphosphate RNA which
is capable of inducing said cytokines.
[0143] Such inhibitory 5' triphosphate oligonucleotides may be
useful in the treatment of diseases or conditions which are
associated with elevated levels of type I IFN, IL-18 and/or IL-1.
The diseases include, but are not limited to, autoimmune diseases,
such as rheumatoid arthritis and gout, and inflammatory
diseases.
[0144] Another surprising finding of the present inventors is that,
in addition to in vitro transcribed RNA, chemically synthesized RNA
bearing free 5' phosphate group and viral RNA, bacterial RNA is
very potent in inducing a type I IFN response. Similar to in vitro
transcribed RNA and viral RNA, bacterial RNA contains a 5'
triphosphate and lacks the eukaryotic cell-specific modifications.
Even more surprisingly, it was found that the IFN-inducing activity
of bacterial RNA is not entirely attributable to the presence of
the 5' triphosphate, as is the case with in vitro transcribed RNA.
Therefore, in addition to 5' triphosphate, bacterial RNA contains
further molecular features which are responsible for its ability to
be recognized by eukaryotic cells and to induce type I IFN
production.
[0145] This surprising finding of the present inventors opens up a
new venue in the development of pharmaceutical compositions which
are capable of inducing an anti-viral response and/or an
anti-bacterial response and are useful for the treatment of
diseases such as viral infections, bacterial infections, (in
particular, intracellular bacterial infections), tumors, allergy,
autoimmune diseases and immunodeficiencies.
[0146] Bacterial RNA is advantageous over attenuated virus and
viral RNA as a therapeutic agent because of its safety profile.
Whereas attenuated virus may cause viral infection and disease and
viral RNA may integrate into the eukaryotic genome causing unwanted
genetic alteration, bacterial RNA is inert and does not cause any
undesirable diseases or conditions.
[0147] In addition, bacterial RNA can be produced in large
quantities at very low cost. Therefore, it is a lot more economical
to use bacterial RNA as a therapeutic agent than attenuated virus,
viral RNA, or in vitro transcribed RNA.
DEFINITIONS
[0148] As used herein, "a" and "an" refers to not only a single
individual, but also a group or species of entities.
Oligonucleotide
[0149] As used herein, the term "oligonucleotide" refers to a
polynucleotide formed from a plurality of linked nucleoside units;
"oligonucleotide" and "polynucleotide" are used synonymously. Such
oligonucleotides can be obtained from existing nucleic acid
sources, including genomic or cDNA, but are preferably produced by
synthetic methods including chemical synthesis, in vitro and in
vivo transcription. In preferred embodiments each nucleoside unit
includes a heterocyclic base and a pentofuranosyl, trehalose,
arabinose, 2'-deoxy-2'-substituted arabinose, 2'-O-substituted
arabinose or hexose sugar group. The nucleoside residues can be
coupled to each other by any of the numerous known internucleoside
linkages. Such internucleoside linkages include, without
limitation, phosphodiester, phosphorothioate, phosphorodithioate,
pyrophosphate, alkylphosphonate, alkylphosphonothioate,
phosphotriester, phosphoramidate, siloxane, carbonate, carboalkoxy,
acetamidate, carbamate, morpholino, borano, thioether, bridged
phosphoramidate, bridged methylene phosphonate, bridged
phosphorothioate, and sulfone internucleoside linkages. The term
"oligonucleotide" also encompasses polynucleosides having one or
more stereospecific internucleoside linkage (e.g., (R.sub.p)- or
(S.sub.p)-phosphorothioate, alkylphosphonate, or phosphotriester
linkages).
[0150] The oligonucleotides of the invention can include naturally
occurring nucleosides, modified nucleosides, or mixtures thereof.
As used herein, the term "modified nucleoside" is a nucleoside that
includes a modified heterocyclic base, a modified sugar moiety, or
a combination thereof. In some embodiments, the modified nucleoside
is a non-natural pyrimidine or purine nucleoside. In some
embodiments, the modified nucleoside is a 2'-substituted
ribonucleoside, an arabinonucleoside or a
2'-deoxy-2'-substituted-arabinoside.
[0151] As used herein, the term "2'-substituted ribonucleoside" or
"2'-substituted arabinoside" includes ribonucleosides or
arabinonucleoside in which the hydroxyl group at the 2' position of
the pentose moiety is substituted to produce a 2'-substituted or
2'-O-substituted ribonucleoside. Preferably, such substitution is
with a lower alkyl group containing 1-6 saturated or unsaturated
carbon atoms, or with an aryl group having 6-10 carbon atoms,
wherein such alkyl, or aryl group may be unsubstituted or may be
substituted, e.g., with halo, hydroxy, trifluoromethyl, cyano,
nitro, acyl, acyloxy, alkoxy, carboxyl, carboalkoxy, or amino
groups. Examples of 2'-O-substituted ribonucleosides or
2'-O-substituted-arabinosides include, without limitation,
2'-O-methylribonucleosides or 2'-O-methylarabinosides and
2'-O-methoxyethylribonucleosides or
2'-O-methoxyethylarabinosides.
[0152] The term "2'-substituted ribonucleoside" or "2'-substituted
arabinoside" also includes ribonucleosides or arabinonucleosides in
which the 2'-hydroxyl group is replaced with a lower alkyl group
containing 1-6 saturated or unsaturated carbon atoms, or with an
amino or halo group. Examples of such 2'-substituted
ribonucleosides or 2'-substituted arabinosides include, without
limitation, 2'-amino, 2'-fluoro, 2'-allyl, and 2'-propargyl
ribonucleosides or arabinosides.
[0153] The term "oligonucleotide" includes hybrid and chimeric
oligonucleotides. A "chimeric oligonucleotide" is an
oligonucleotide having more than one type of internucleoside
linkage. One preferred example of such a chimeric oligonucleotide
is a chimeric oligonucleotide comprising a phosphorothioate,
phosphodiester or phosphorodithioate region and non-ionic linkages
such as alkylphosphonate or alkylphosphonothioate linkages (see
e.g., U.S. Pat. Nos. 5,635,377 and 5,366,878).
[0154] A "hybrid oligonucleotide" is an oligonucleotide having more
than one type of nucleoside. One preferred example of such a hybrid
oligonucleotide comprises a ribonucleotide or 2'-substituted
ribonucleotide region, and a deoxyribonucleotide region (see, e.g.,
U.S. Pat. Nos. 5,652,355, 6,346,614 and 6,143,881).
[0155] RNA oligonucleotides discussed herein include otherwise
unmodified RNA as well as RNA which have been modified (e.g., to
improve efficacy), and polymers of nucleoside surrogates.
[0156] Unmodified RNA refers to a molecule in which the components
of the nucleic acid, namely sugars, bases, and phosphate moieties,
are the same or essentially the same as that which occur in nature,
preferably as occur naturally in the human body. The art has
referred to rare or unusual, but naturally occurring, RNAs as
modified RNAs, see, e.g., Limbacho et al. 1994, Nucleic Acids Res
22: 2183-2196. Such rare or unusual RNAs, often termed modified
RNAs (apparently because these are typically the result of a
post-transcriptional modification) are within the term unmodified
RNA, as used herein.
[0157] Modified RNA as used herein refers to a molecule in which
one or more of the components of the nucleic acid, namely sugars,
bases, and phosphate moieties, are different from that which occurs
in nature, preferably different from that which occurs in the human
body. While they are referred to as modified "RNAs," they will of
course, because of the modification, include molecules which are
not RNAs.
[0158] Nucleoside surrogates are molecules in which the
ribophosphate backbone is replaced with a non-ribophosphate
construct that allows the bases to the presented in the correct
spatial relationship such that hybridization is substantially
similar to what is seen with a ribophosphate backbone, e.g.,
non-charged mimics of the ribophosphate backbone.
[0159] All nucleic acid sequences listed herein are in the 5' to 3'
direction unless otherwise indicated.
[0160] The RNA oligonucleotide of the invention can be
single-stranded (ssRNA), double-stranded (dsRNA), or partially
double-stranded (partially dsRNA).
[0161] A single-stranded RNA oligonucleotide may contain
self-complementary sequences and forms a hairpin. For example,
5'-GACCTAGCCTAAAACTAGGTC-3'. The self-complementary sequence may be
a palindromic sequence. For example, 5'AAAGATCCGGATCAAAA-3'.
[0162] A double-stranded RNA oligonucleotide may have one- or
two-nucleotide overhang at the 5' or 3' end of one or both
strands.
[0163] A partially double-stranded RNA oligonucleotide may comprise
two strands of the same or different length(s), wherein at least
one of the strands contains nucleotides outside the complementary
sequence. For example,
TABLE-US-00001 Example 1: 5'-AAAAGUUCAAAGCUCAAAA-3'
3'-CAAGUUUCGAG-5' Example 2:
5'-UCAAAGUCAAAAGCUCAAAGUUGAAAGUUUAAA-3'
3'-GACUUGAAAAUUUCAGUUUUCGAGUUUAAGUUGAAAACUCG-5' Example 3:
5'-UCAAAGUCAAAAGCUCAAAGUUGAAA-3'
3'-UUUCAGUUUUCGAGUUUAAGUUGAAAACUCG-5'
[0164] The length of a single-stranded RNA oligonucleotide is the
number of nucleotides contained in the oligonucleotide.
[0165] In the case of a double-stranded or partially
double-stranded oligonucleotide, the length of the oligonucleotide
is the length of the individual strands. In other words, a
partially double-stranded oligonucleotide can have two lengths.
Enhanced Nuclease Resistance
[0166] For increased nuclease resistance and/or binding affinity to
the target, an oligonucleotide can include, for example,
2'-modified ribose units and/or phosphorothioate linkage(s) and/or
pyrophosphate linkage(s). For example, the 2' hydroxyl group (OH)
can be modified or replaced with a number of different "oxy" or
"deoxy" substituents.
[0167] Examples of "oxy"-2' hydroxyl group modifications include
alkoxy or aryloxy (OR, e.g., R.dbd.H, alkyl, cycloalkyl, aryl,
aralkyl, heteroaryl or sugar); polyethyleneglycols (PEG),
O(CH.sub.2CH.sub.2O).sub.nCH.sub.2CH.sub.2OR; "locked" nucleic
acids (LNA) in which the 2' hydroxyl is connected, e.g., by a
methylene bridge, to the 4' carbon of the same ribose sugar;
O-AMINE and aminoalkoxy, O(CH.sub.2).sub.nAMINE, (e.g.,
AMINE=NH.sub.2; alkylamino, dialkylamino, heterocyclyl amino,
arylamino, diaryl amino, heteroaryl amino, or diheteroaryl amino,
ethylene diamine, polyamino). It is noteworthy that
oligonucleotides containing only the methoxyethyl group (MOE),
(OCH.sub.2CH.sub.2OCH.sub.3, a PEG derivative), exhibit nuclease
stabilities comparable to those modified with the robust
phosphorothioate modification.
[0168] "Deoxy" modifications include hydrogen (i.e. deoxyribose
sugars, which are of particular relevance to the overhang portions
of partially dsRNA); halo (e.g., fluoro); amino (e.g. NH.sub.2;
alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino,
heteroaryl amino, diheteroaryl amino, or amino acid);
NH(CH.sub.2CH.sub.2NH).sub.nCH.sub.2CH.sub.2-AMINE (AMINE=NH.sub.2;
alkylamino, dialkylamino, heterocyclyl amino, arylamino, diaryl
amino, heteroaryl amino, or diheteroaryl amino), --NHC(O)R
(R=alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano;
mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl,
aryl, alkenyl and alkynyl, which may be optionally substituted with
e.g., an amino functionality.
[0169] Preferred substitutents are 2'-methoxyethyl, 2'-OCH3,
2'-O-allyl, 2'-C-- allyl, and 2'-fluoro.
[0170] To maximize nuclease resistance, the 2' modifications can be
used in combination with one or more phosphate linker modifications
(e.g., phosphorothioate). The so-called "chimeric" oligonucleotides
are those that contain two or more different modifications.
[0171] The inclusion of furanose sugars in the oligonucleotide
backbone can also decrease endonucleolytic cleavage. An
oligonucleotide agent can be further modified by including a 3'
cationic group, or by inverting the nucleoside at the 3'-terminus
with a 3'-3' linkage. In another alternative, the 3'-terminus can
be blocked with an aminoalkyl group, e.g., a 3' C5-aminoalkyl dT.
Other 3' conjugates can inhibit 3'-5' exonucleolytic cleavage.
While not being bound by theory, a 3' conjugate, such as naproxen
or ibuprofen, may inhibit exonucleolytic cleavage by sterically
blocking the exonuclease from binding to the 3'-end of
oligonucleotide. Even small alkyl chains, aryl groups, or
heterocyclic conjugates or modified sugars (D-ribose, deoxyribose,
glucose etc.) can block 3'-5'-exonucleases.
[0172] Similarly, 5' conjugates can inhibit 5'-3' exonucleolytic
cleavage. While not being bound by theory, a 5' conjugate, such as
naproxen or ibuprofen, may inhibit exonucleolytic cleavage by
sterically blocking the exonuclease from binding to the 5'-end of
oligonucleotide. Even small alkyl chains, aryl groups, or
heterocyclic conjugates or modified sugars (D-ribose, deoxyribose,
glucose etc.) can block 5'-3'-exonucleases.
[0173] Single-stranded RNA oligonucleotides which contain
self-complementary sequences and form a hairpin structure have
enhanced nuclease resistance compared to single-stranded
oligonucleotides which do not.
Tethered Ligands
[0174] The RNA oligonucleotides of the present invention also
include those with tethered ligands. The properties of a RNA
oligonucleotide, including its pharmacological properties, can be
influenced and tailored by the introduction of ligands, e.g.
tethered ligands.
[0175] The ligands may be coupled, covalently or non-covalently,
preferably covalently, either directly or indirectly via an
intervening tether, to the RNA oligonucleotide. In preferred
embodiments, the ligand is attached to the oligonucleotide via an
intervening tether.
[0176] In preferred embodiments, a ligand alters the distribution,
targeting or lifetime of a RNA oligonucleotide into which it is
incorporated. In preferred embodiments, a ligand provides an
enhanced affinity for a selected target, e.g., molecule, cell or
cell type, a cellular or organ compartment, tissue, organ or region
of the body.
[0177] Preferred ligands can improve transport, hybridization, and
specificity properties and may also improve nuclease resistance of
the resultant natural or modified oligoribonucleotide, or a
polymeric molecule comprising any combination of monomers described
herein and/or natural or modified ribonucleotides.
[0178] A wide variety of ligands may be used. Ligands may include
agents that allow for the specific targeting of the
oligonucleotide; diagnostic compounds or reporter groups which
allow for the monitoring of oligonucletotide distribution;
cross-linking agents; nuclease-resistance conferring moieties; and
natural or unusual nucleobases. General examples include lipophilic
moleculeses, lipids, lectins, steroids (e.g., uvaol, hecigenin,
diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin,
Friedelin, epifriedelanol derivatized lithocholic acid), vitamins,
carbohydrates (e.g., a dextran, pullulan, chitin, chitosan, inulin,
cyclodextrin or hyaluronic acid), proteins, protein binding agents,
integrin targeting molecules, polycationics, peptides, polyamines,
and peptide mimics.
[0179] The ligand may be a naturally occurring or recombinant or
synthetic molecule, such as a synthetic polymer, e.g., a synthetic
poly amino acid. Examples of poly amino acids include, without
limitation, poly L-lysine, poly L-aspartic acid, poly L-glutamic
acid, styrene-maleic acid anhydride copolymer,
poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic
anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer
(HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA),
polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide
polymers, or polyphosphazine. Example of polyamines include:
polyethylenimine, poly lysine, spermine, spermidine, polyamine,
pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer
polyamine, arginine, amidine, protamine, cationic moieties, e.g.,
cationic lipid, cationic porphyrin, quaternary salt of a polyamine,
or an alpha helical peptide.
[0180] Ligands can also include targeting groups, e.g., a cell or
tissue targeting agent, e.g., a thyrotropin, melanotropin,
surfactant protein A, Mucin carbohydrate, a glycosylated
polyaminoacid, transferrin, bisphosphonate, polyglutamate,
polyaspartate, or an RGD peptide or RGD peptide mimetic.
[0181] Ligands can be proteins, e.g., glycoproteins, lipoproteins,
e.g. low density lipoprotein (LDL), or albumins, e.g. human serum
albumin (HSA), or peptides, e.g., molecules having a specific
affinity for a co-ligand, or antibodies e.g., an antibody, that
binds to a specified cell type such as a cancer cell, endothelial
cell, or bone cell. Ligands may also include hormones and hormone
receptors. They can also include non-peptidic species, such as
cofactors, multivalent lactose, multivalent galactose,
N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose,
or multivalent fucose. The ligand can be, for example, a
lipopolysaccharide, an activator of p38 MAP kinase, or an activator
of NF-.kappa.B.
[0182] The ligand can be a substance, e.g., a drug, which can
increase the uptake of the oligonucleotide agent into the cell, for
example, by disrupting the cell's cytoskeleton, e.g., by disrupting
the cell's microtubules, microfilaments, and/or intermediate
filaments. The drug can be, for example, taxon, vincristine,
vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin
A, phalloidin, swinholide A, indanocine, or myoservin.
[0183] In one embodiment, the ligand is a lipid or lipid-based
molecule. Such a lipid or lipid-based molecule preferably binds a
serum protein, e.g., human serum albumin (HSA). An HSA binding
ligand allows for distribution of the conjugate to a target tissue,
e.g., liver tissue, including parenchymal cells of the liver. Other
molecules that can bind HSA can also be used as ligands. For
example, neproxin or aspirin can be used. A lipid or lipid-based
ligand can (a) increase resistance to degradation of the conjugate,
(b) increase targeting or transport into a target cell or cell
membrane, and/or (c) can be used to adjust binding to a serum
protein, e.g., HSA.
[0184] A lipid based ligand can be used to modulate the binding of
the conjugate to a target tissue. For example, a lipid or
lipid-based ligand that binds to HSA more strongly will be less
likely to be targeted to the kidney and therefore less likely to be
cleared from the body. A lipid or lipid-based ligand that binds to
HSA less strongly can be used to target the conjugate to the
kidney.
[0185] In another embodiment, the ligand is a moiety, e.g., a
vitamin or nutrient, which is taken up by a target cell, e.g., a
proliferating cell. These are particularly useful for treating
disorders characterized by unwanted cell proliferation, e.g., of
the malignant or non-malignant type, e.g., cancer cells. Exemplary
vitamins include vitamin A, E, and K. Other exemplary vitamins
include the B vitamins, e.g., folic acid, B12, riboflavin, biotin,
pyridoxal or other vitamins or nutrients taken up by cancer
cells.
[0186] In another embodiment, the ligand is a cell-permeation
agent, preferably a helical cell-permeation agent. Preferably, the
agent is amphipathic. An exemplary agent is a peptide such as tat
or antennapedia. If the agent is a peptide, it can be modified,
including a peptidylmimetic, invertomers, non-peptide or
pseudo-peptide linkages, and use of D-amino acids. The helical
agent is preferably an alpha-helical agent, which preferably has a
lipophilic and a lipophobic phase.
[0187] In a preferred embodiment, the ligand is an antibody or a
fragment thereof which is specific for a moiety present in a cell
to be targeted. The moiety may be a protein, a carbohydrate
structure, a polynucleotide, or a combination thereof. The moiety
may be secreted, associated with the plasma membrane (e.g., on the
extracellular or intracellular surface), cytosolic, associated with
intracellular organelles (e.g., ER, Golgi complex, mitochondria,
endosome, lysosome, secretory vesicle) or nuclear. The antibody may
be monoclonal or polyclonal. The antibody may be chemeric or
humanized. The antibody may be a single chain antibody. The
antibody fragment may be a Fab fragment, a F(ab').sub.2 fragment,
or any fragments that retain the antigen-binding specificity of the
intact antibody.
Immunostimulatory Activity
[0188] As used herein, "immunostimulatory activity" refers to the
capability of an agent, such as a molecule or a composition, to
induce an immune response. In one embodiment, the immunostimulatory
activity refers to the type I IFN-inducing activity, in particular,
the IFN-.alpha.-inducing activity.
[0189] As used herein, "inducing an immune response" means
initiating or causing an increase in one or more of B-cell
activation, T-cell activation, natural killer cell activation,
activation of antigen presenting cells (e.g., B cells, dendritic
cells, monocytes and macrophages), cytokine production, chemokine
production, specific cell surface marker expression, in particular,
expression of co-stimulatory molecules. In one aspect, such an
immune response involves the production of type I IFN (IFN-.alpha.
and/or IFN-.beta.), in particular, IFN-.alpha., in cells such as
PDC (plasmacytoid dendritic cells) and/or monocytes.
[0190] As used herein, "type I IFN inducing activity" includes
IFN-.alpha.-inducing activity and/or IFN-.beta. inducing
activity.
[0191] As used herein, "IFN-.alpha.-inducing activity" refers to
the capability of an agent, such as a molecule or composition, to
induce IFN-.alpha. production from a cell capable of producing
IFN-.alpha.. Cells capable of producing IFN-.alpha. include, but
are not limited to, peripheral blood mononuclear cells (PBMC)
(e.g., B cells, dendritic cells (myeloid dendritic cells and
plasmacytoid dendritic cells), macrophages, monocytes, natural
killer cells, granulocytes), endothelial cells, and cell lines.
[0192] As used herein, "IFN-.beta.-inducing activity" refers to the
capability of an agent, such as a molecule or composition, to
induce IFN-.beta. production from a cell capable of producing
IFN-.beta.. Any somatic cells, such as PBMC, myeloid dendritic
cells, monocytes, PDC, fibroblasts, are capable of producing
IFN-.beta..
[0193] Anti-Viral Response
[0194] As used herein, "anti-viral response" refers to the response
by a cell, tissue or organism upon infection by a virus with the
purpose of eliminating or incapacitating the virus. Typical
anti-viral responses include, but are not limited to, type I IFN,
MIP1-a, MCP, RANTES, IL-8, IL-6, IP-10, and IFN-.gamma.
production.
[0195] Anti-Bacterial Response
[0196] An anti-bacterial response is the response by a cell, tissue
or organism upon infection by a bacterium with the purpose of
eliminating or incapacitating the bacterium. Typical anti-bacterial
responses include, but are not limited to, T cell or NK
cell-mediated elimination of the infected cell by either
receptor-mediated apoptosis or cytokine-mediated apoptosis via TNF
or TRAIL, macrophage or monocytes phagocytosis.
[0197] An anti-bacterial response, in particular, type I and type
II IFN production, may be induced in immune cells or non-immune
cells. Immune cells include, but are not limited to, peripheral
blood mononuclear cells (PBMC), plasmacytoid dendritic cells (PDC),
myeloid dendritic cells (MDC), B cells, macrophages, monocytes,
natural killer cells, NKT cells, CD4+ T cells, CD8+ T cells,
granulocytes. Non-immune cells include, among others, tumor cells,
epithelial cells, endothelial cells, and fibroblasts.
Disorder/Disease-Related Gene, RNA and Antigen
[0198] As used herein, "disorder/disease-related gene" refers to a
gene that is expressed or overexpressed in a disease/disorder and
that is not expressed or expressed in reduced amount in normal
healthy cells. For example, a mutant CF gene is expressed in cystic
fibrosis patient but not in an individual without cystic fibrosis;
ErbB2 (or Her2) is overexpressed in breast cancer cells compared to
normal breast cells; a viral gene or a virally-induced host gene is
expressed in infected cells but not in uninfected cells. The gene
product of the disorder/disease-related gene is referred to herein
as the "disorder/disease-related antigen". A
"disorder/disease-related RNA" refers to an RNA molecule that is
present or present in an elevated level in a diseased cell and that
is not present or present in reduced level in a normal healthy
cell. A disorder/disease-related RNA may be an mRNA, a miRNA, or
other non-coding RNA such as rRNA or tRNA.
Mammal
[0199] As used herein, the term "mammal" includes, without
limitation, rats, mice, cats, dogs, horses, sheep, cattle, cows,
pigs, rabbits, non-human primates, and humans.
[0200] Oligonucleotide and Precursor Thereof
[0201] The present invention provides an oligonucleotide capable of
inducing an anti-viral response, in particular, type I IFN
production, wherein the oligonucleotide comprises a at least one,
preferably at least two, and more preferably at least three
phosphate groups at the 5' end, wherein the phosphate group is free
of any cap structure or modification, wherein the oligonucleotide
comprises at least 1, preferably at least 2, 3, 4, 5, more
preferably at least 6, 7, 8, 9, 10, 11, even more preferably at
least 12, 13, 14, 15, 16, 17, most preferably at least 18, 19, 20,
21 ribonucleotide(s) at the 5' end, and wherein the oligonucleotide
is at least 12, preferably at least 18, more preferably at least
19, even more preferably at least 20, and most preferably at least
21 nucleotides in length.
[0202] The oligonucleotide of the invention may be single-stranded,
single-stranded containing a self-complementary sequence which can
form a hairpin structure, double-stranded, or partially
double-stranded.
[0203] When the oligonucleotide is single-stranded, single-stranded
containing a self-complementary sequence or double-stranded, the
length of the oligonucleotide is the length of a single-strand.
[0204] When the oligonucleotide is partially double-stranded, the
length of the oligonucleotide is the length of the longer strand.
Therefore, the oligonucleotide of the present invention include
partially double-stranded oligonucleotides wherein at least one of
the strands is at least 12, 18, 19, 20 or 21 nucleotides in
length.
[0205] In the oligonucleotide of the invention, the at least 1
ribonucleotide at the 5' end comprises the at least one 5'
phosphate group in the form of a monophosphate, a diphosphate or a
triphosphate. In the case of a double-stranded or partially
double-stranded oligonucleotide, at least one of the strands
comprises at least one 5' phosphate group. When both strands
comprise 5' phosphate groups, the number of phosphate groups may be
the same or may be different on the two strands. Therefore, the
oligonucleotide of the invention may comprise 1, 2, 3, 4, 5, or 6
5' phosphate groups in the form of monophosphate, diphosphate
and/or triphosphate. In the case of a partially double-stranded
oligonucleotide, the at least 1 ribonucleotide at the 5' end which
comprises the at least one 5' phosphate can be on either the long
or the short strand, wherein at least the long strand is at least
12, 18, 19, 20, or 21 nucleotides in length.
[0206] In the oligonucleotide of the invention, the at least 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21
ribonucleotides at the 5' end are on the same strand.
[0207] In one embodiment, at least one of the 5' phosphate groups
is not comprised in a triphosphate. In another embodiment, the
oligonucleotide comprises at least one group selected from a
monophosphate and a diphosphate at the 5' end, wherein the
monophosphate and/or diphophate is free of any cap or
modification.
[0208] In one embodiment, the first ribonucleotide at the 5' end of
the oligonucleotide comprises a ribonucleotide selected from A, U,
C and G. In a preferred embodiment, the first ribonucleotide at the
5' end of the oligonucleotide comprise a ribonucleotide selected
from A, C and U. In a more preferred embodiment, the first
ribonucleotide at the 5' end of the oligonucleotide comprise a
ribonucleotide selected from A and C. In a most preferred
embodiment, the first ribonucleotide at the 5' end comprises an
adenine (A).
[0209] In preferred embodiments, the sequence of the first 4
nucleotides at the 5' end of the oligonucleotide is selected from:
AAGU, AAAG, AUGG, AUUA, AACG, AUGA, AGUU, AUUG, AACA, AGAA, AGCA,
AACU, AUCG, AGGA, AUCA, AUGC, AGUA, AAGC, AACC, AGGU, AAAC, AUGU,
ACUG, ACGA, ACAG, AAGG, ACAU, ACGC, AAAU, ACGG, AUUC, AGUG, ACAA,
AUCC, AGUC, wherein all sequences are in the 5'->3'
direction.
[0210] In more preferred embodiments, the sequence of the first 4
nucleotides at the 5' end of the oligonucleotide is selected from:
AAGU, AAAG, AUGG, AUUA, AACG, AUGA, AGUU, AUUG, AACA, AGAA, AGCA,
AACU, AUCG, AGGA, AUCA, AUGC, AGUA, AAGC, AACC, wherein all
sequences are in the 5'->3' direction.
[0211] In even more preferred embodiments, the sequence of the
first 4 nucleotides at the 5' end of the oligonucleotide is
selected from: AAGU, AAAG, AUGG, AUUA, AACG, AUGA, AGUU, AUUG,
AACA, wherein all sequences are in the 5'->3' direction.
[0212] In most preferred embodiments, the sequence of the first 4
nucleotides at the 5' end of the oligonucleotide is selected from:
AAGU, AAAG, AUGG, AUUA, wherein all sequences are in the 5'->3'
direction.
[0213] In other embodiments, the first nucleotide of the
above-listed 5' 4-nucleotide sequences is a U, C or G instead of
A.
[0214] In a preferred embodiment, the oligonucleotide comprises at
least 1, 2, 3, 4, 5, preferably at least 6, 7, 8, 9, 10, more
preferably at least 11, 12, 13, 14, 15, even more preferably at
least 16, 17, 18, 19, 20, and most preferably at least 21, 22, 23,
24, 25 inosine (I). In one embodiment, at least 1, 2, 3, 4, 5%,
preferably at least 10, 15, 20, 25, 30, more preferably at least
35, 40, 45, 50, 55, 60%, even more preferably at least 70, 80, or
90% of the adenosine (A) and/or guanosine (G) in the
oligonucleotide is replaced with inosine (I).
[0215] The oligonucleotide of the invention may be a RNA
oligonucleotide, or a chimeric RNA-DNA oligonucleotide. A chimeric
RNA-DNA oligonucleotide comprises both ribonucleotides and
deoxyribonucleotides. The ribonucleotides and the
deoxyribonucleotides may be on the same strand, or may be on
different strands.
[0216] In one embodiment, the oligonucleotide (RNA or chimeric
RNA-DNA) comprises a phosphorothioate backbone. In preferred
embodiments, at least 1, preferably at least 2, more preferably at
least 3, even more preferably at least 4 nucleotides are
phosphorothioate.
[0217] In a preferred embodiment, the oligonucleotide of the
invention does not contain any modifications such as pseudouridine,
2-thiouridine, 2'-Fluorine-dNTP, 2'-O-methylated NTP, in particular
2'-fluorine-dCTP, 2'-fluorine-dUTP, 2'-O-methylated CTP,
2'-O-methylated UTP.
[0218] In some embodiments, the oligonucleotide has gene silencing
activity. In one embodiment, the oligonucleotide is active in RNA
interference (RNAi), or is an RNAi molecule. The RNAi molecule may
be a siRNA (small interfering RNA, double-stranded), shRNA (small
hairpin RNA, single-stranded with a hairpin structure) or miRNA
(microRNA, single-stranded with a hairpin structure).
[0219] In a preferred embodiment, the RNA oligonucleotide is a
single-stranded RNA oligonucleotide which does not contain any
sequence which is capable of forming any intramolecular or
intermolecular double-stranded structure with itself under
physiological condition, in particular, physiological condition
inside a cell, and the nucleotide sequence of the ssRNA is
complementary to a RNA in a target cell.
[0220] In one embodiment, the RNA is expressed in a tissue-, cell-
and/or developmental stage-specific manner. In a preferred
embodiment, the RNA is a disease/disorder-related RNA. In one
embodiment, the disease/disorder-related RNA is an mRNA of a
disease/disorder-related gene. In another embodiment, the
disease/disorder-related RNA is a miRNA. The
disease/disorder-related RNA may be a endogenous cellular RNA, a
viral RNA, a RNA from an invading microorganism or organism such as
a bacterium, a fungus, or a parasite.
[0221] The degree of complementarity is preferably at least 50%,
60%, 70%, more preferably at least 75%, 80%, 85%, 90%, even more
preferably at least 95%, 96%, 97%, 98%, 99%, and most preferably
100%. As used in the art, the term "degree of complementarity"
between two oligonucleotides/polynucleotides refers to the
percentage of complementary bases in the overlapping region of the
two oligonucleotides. Two bases are complementary to each other if
they can form a base pair via hydrogen bonding. Base pairs include
both Waston-Crick base pairs and wobble base pairs. Waston-Crick
base pairs include A-T, C-G, A-U; wobble base pairs include G-U,
I-U, I-A, I-C. The degree of complementarily can be determined by a
skilled person using any known methods in the art, either manually
or automatically by various engines such as BLAST. For example,
ATCG has 100% complementarity to CGAT and CGATGG, and 75%
complementarity to CGTT and CGTTGG. In a preferred embodiment,
complementarity between the oligonucleotide of the present
invention and the target RNA in the target cell exists over the
entire length of the oligonucleotide.
[0222] The term "physiological condition" is used herein as
commonly understood in the art. Physiological condition inside a
cell refers to parameters such as the ionic strength, osmolarity,
salt concentration, pH, temperature that are normally found inside
a cell, i.e., in the cytosol. The cell may be in vivo, in vitro or
ex vivo. The cell may be a healthy or normal cell or a diseased or
abnormal cell. A diseased or abnormal cell may be, for example, a
cell infected by bacteria or viruses, a tumor cell, an autoimmune
cell, a cell having an inflammatory response. Physiological
condition refers to the conditions inside or outside a cell in
vivo, in vitro or ex vivo. Physiological conditions may be found in
an living organism, tissue, or cell or may be obtained artificially
in a laboratory. An example of a physiological condition is
150.+-.50 mM NaCl, pH 7.4.+-.0.8, and 20.+-.20.degree. C.
[0223] Whether a RNA oligonucleotide contains any double-stranded
structure can be readily determined by a skilled person using known
methods in the art. For example, a spectrometer may be used to
measure double-stranded versus single-stranded absorption spectra
while increasing the temperature. In certain embodiments, the
number of basepairing within the double-stranded structure is at
least 6, 7, 8, 9, preferably at least 10, 11, 12, 13, 14, 15, more
preferably at least 16, 17, 18, 19, 20, 21, even more preferably at
least 22, 23, 24, 25. Base pairs include both Waston-Crick
basepairs and wobble basepairs. Waston-Crick basepairs include A-T,
C-G, A-U; wobble basepairs include G-U, I-U, I-A, I-C.
[0224] The ssRNA oligonucleotide may be generated by chemical
synthesis.
[0225] In one embodiment, the ssRNA oligonucleotide does not have
any gene-silencing activity.
[0226] In another embodiment, the ssRNA oligonucleotide has
gene-silencing activity.
[0227] The present invention also provides precursors of the
oligonucleotide of the invention.
[0228] As used herein, the "precursor of the oligonucleotide" of
the invention refers to any molecule which can be processed to
generate the oligonucleotide of the invention. The precursors of
the oligonucleotide of the invention include, but are not limited
to, DNA or RNA molecules which can serve as templates for the
synthesis of the RNA oligonucleotides of the invention, RNA or
RNA-DNA chimeric molecules which can be enzymatically cleaved to
produce the oligonucleotides of the invention.
[0229] The oligonucleotide or precursor thereof of the invention
may also contain motifs or molecular signatures which are
recognized by TLRs. For example, long dsRNA (longer than 30 bases)
bearing a 5' phosphate can serve as a ligand for both RIG-I and
TLR3. A chimeric RNA-DNA oligonucleotide comprising a ssRNA bearing
a 5' phosphate and a ssDNA containing CpG can serve as a ligand for
both RIG-I and TLR9. ssRNA or dsRNA bearing a 5' phosphate and
defined sequence motifs (S. S. Diebold et al., Science 303, 1529
(March 5, 2004); F. Heil et al., Science 303, 1526 (Mar. 5, 2004);
V. Hornung et al., Nat Med 11, 263 (March, 2005); WO 03/086280;
European patent application no. 05020020.3) can serve as a ligand
for both RIG-I and TLR7. ssRNA bearing a 5' triphosphate and
GU-rich motifs (WO 03/086280, European patent application no. 05
020 019.5) can serve as a ligand for both RIG-I and TLR8.
[0230] In one embodiment, the oligonucleotide or precursor thereof
of the invention comprises at least one, preferably at least two,
more preferably at least three, even more preferably at least four,
even more preferably at least five, and most preferably at least
six, of the 4-nucleotide (4 mer) motifs selected from the group
consisting of:
TABLE-US-00002 GUUC, (No. 1) GUCA, (No. 2) GCUC, (No. 3) GUUG, (No.
4) GUUU, (No. 5) GGUU, (No. 6) GUGU, (No. 7) GGUC, (No. 8) GUCU,
(No. 9) GUCC, (No. 10) GCUU, (No. 11) UUGU, (No. 12) UGUC, (No. 13)
CUGU, (No. 14) CGUC, (No. 15) UGUU, (No. 16) GUUA, (No. 17) UGUA,
(No. 18) UUUC, (No. 19) UGUG, (No. 20) GGUA, (No. 21) GUCG, (No.
22) UUUG, (No. 23) UGGU, (No. 24) GUGG, (No. 25) GUGC, (No. 26)
GUAC, (No. 27) GUAU, (No. 28) UAGU, (No. 29) GUAG, (No. 30) UUCA,
(No. 31) UUGG, (No. 32) UCUC, (No. 33) CAGU, (No. 34) UUCG, (No.
35) CUUC, (No. 36) GAGU, (No. 37) GGUG, (No. 38) UUGC, (No. 39)
UUUU, (No. 40) CUCA, (No. 41) UCGU, (No. 42) UUCU, (No. 43) UGGC,
(No. 44) CGUU, (No. 45) CUUG, (No. 46) UUAC, (No. 47)
wherein the nucleotide sequences of the motifs are 5'.fwdarw.3',
wherein the oligonucleotide or precursor thereof is between 12 and
64, preferably between 12 and 50, more preferably between 14 and
40, even more preferably between 16 and 36, and most preferably
between 18 and 25 nucleotides in length.
[0231] In one embodiment, the 4 mer motifs are selected from the
group consisting of No. 1-19, No. 1-18, No. 1-17, No. 1-16,
preferably, No. 1-15, No. 1-14, No. 1-13, No. 1-12, more
preferably, No. 1-11, No. 1-10, No. 1-9, No. 1-8, No. 1-7, even
more preferably, No. 1-6, No. 1-5, No. 1-4, No. 1-3, most
preferably, No. 1-2 of the 4 mer motifs.
[0232] The oligonucleotide or precursor thereof of the invention
may comprise one or more copies of the same 4 mer motif, or one or
more copies of different 4 mer motifs.
[0233] In another embodiment, the oligonucleotide or a precursor
thereof of the invention comprises at least one, preferably at
least two, more preferably at least three, even more preferably at
least four, even more preferably at least five, and most preferably
at least six, of the 4-nucleotide (4 mer) motifs selected from the
group consisting of:
TABLE-US-00003 UCGU, (No. 1) GUUG, (No. 2) UGGU, (No. 3) UGGC, (No.
4) GGUA, (No. 5) UGAU, (No. 6) UGCU, (No. 7) UUGC, (No. 8) UUGU,
(No. 9) UAGU, (No. 10) GGUU, (No. 11) GUUU, (No. 12) UGUG, (No. 13)
GUGU, (No. 14) UGCC, (No. 15) GUAU, (No. 16) GUGC, (No. 17) UGUA,
(No. 18) UGUC, (No. 19) CUGU, (No. 20) UGAC, (No. 21) UGUU, (No.
22) UAAU, (No. 23) GUAG, (No. 24) UCUU, (No. 25) UUGG, (No. 26)
UUUG, (No. 27) GGAU, (No. 28) UUUU, (No. 29) CGUU, (No. 30) UUAU,
(No. 31) GUUC, (No. 32) GUGG, (No. 33) GGUG, (No. 34) UAUU, (No.
35) UCUG, (No. 36) GUAC, (No. 37) UAGG, (No. 38) UCUC, (No. 39)
UAGC, (No. 40) UAUC, (No. 41) CUAU, (No. 42) UACU, (No. 43) CGGU,
(No. 44) UGCG, (No. 45) UUUC, (No. 46) UAUG, (No. 47) UAAG, (No.
48) UACC, (No. 49) UUAG, (No. 50) GCUU, (No. 51) CAGU, (No. 52)
UGAG, (No. 53) GAUU, (No. 54) GAGU, (No. 55) GUUA, (No. 56) UGCA,
(No. 57) UUCU, (No. 58) GCCU, (No. 59) GGUC, (No. 60) GGCU, (No.
61) UUAC, (No. 62) UCAU, (No. 63) GCGU, (No. 64) GCAU, (No. 65)
GAUG, (No. 66) GUCU, (No. 67) CGUA, (No. 68) CGAU, (No. 69)
[0234] wherein the nucleotide sequences of the motifs are
5'.fwdarw.3', [0235] wherein the oligonucleotide or precursor
thereof is between 12 and 64, preferably between 12 and 50, more
preferably between 14 and 40, even more preferably between 16 and
36, and most preferably between 18 and 30 nucleotides in
length.
[0236] In one embodiment, the 4 mer motifs are selected from the
group consisting of No. 1-11, preferably No. 1-10, No. 1-9, No.
1-8, more preferably No. 1-7, No. 1-6, No. 1-5, No. 1-4, even more
preferably No. 1-3, No. 1-2 of the above-listed 4 mer motifs, most
preferably, the 4 mer motif is UCGU.
[0237] The oligonucleotide or precursor thereof of the invention
may comprise one or more copies of the same 4 mer motif, or one or
more copies of different 4 mer motifs.
[0238] The oligonucleotide or the precursor thereof of the
invention can be used to generate a large amount of type I IFN, in
particular, IFN-.alpha., IL-18 and/or IL-1.beta. in vitro and/or in
vivo. Said cytokines can be generated at high quantities from
different cellular sources, including both immune and non-immune
cells, from different species of vertebrates.
[0239] The oligonucleotide and precursor thereof of the invention
may be prepared by synthetic methods including, but not limited to,
chemical synthesis, in vitro transcription and in vivo
transcription. In in vitro transcription, polymerases including,
but not limited to, bacteriophage polymerase such as T7 polymerase,
T3 polymerase, SP6 polymerase, viral polymerases, and E. coli RNA
polymerase may be used. In vivo transcription may be achieved in
virally infected cells, or bacteria that are either non-infected or
infected with a phage.
[0240] Furthermore, the oligonucleotides or precursor thereof, in
particular, the RNA oligonucleotides, of the invention may be
covalently or non-covalently linked to one or more lipophilic
groups which enhance the stability and/or the activity and/or
facilitate the delivery of the oligonucleotides or precursor
thereof.
[0241] As used herein, the term "lipophilic" or "lipophilic group"
broadly refers to any compound or chemical moiety having an
affinity for lipids. Lipophilic groups encompass compounds of many
different types, including those having aromatic, aliphatic or
alicyclic characteristics, and combinations thereof.
[0242] In specific embodiments, the lipophilic group is an
aliphatic, alicyclic, or polyalicyclic substance, such as a steroid
(e.g., sterol) or a branched aliphatic hydrocarbon. The lipophilic
group generally comprises a hydrocarbon chain, which may be cyclic
or acyclic. The hydrocarbon chain may comprise various substituents
and/or at least one heteroatom, such as an oxygen atom. Such
lipophilic aliphatic moieties include, without limitation,
saturated or unsatarated fatty acids, waxes (e.g., monohydric
alcohol esters of fatty acids and fatty diamides), terpenes (e.g.,
the C.sub.10 terpenes, C.sub.15 sesquiterpenes, C.sub.20
diterpenes, C.sub.30 triterpenes, and C.sub.40 tetraterpenes), and
other polyalicyclic hydrocarbons.
[0243] The lipophilic group may be attached by any method known in
the art, including via a functional grouping present in or
introduced into the RNA oligonucleotide, such as a hydroxy group
(e.g., --CO--CH.sub.2--OH). Conjugation of the RNA oligonucleotide
and the lipophilic group may occur, for example, through formation
of an ether or a carboxylic or carbamoyl ester linkage between the
hydroxy and an alkyl group R--, an alkanoyl group RCO-- or a
substituted carbamoyl group KNHCO--. The alkyl group R may be
cyclic (e.g., cyclohexyl) or acyclic (e.g., straight-chained or
branched; and saturated or unsaturated). Alkyl group R may be a
butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl,
dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl or
octadecyl group, or the like. Preferably, the lipophilic group is
conjugated to the 5'-hydroxyl group of the terminal nucleotide. In
a preferred embodiment, the liphophilic group is
12-hydroxydodeconoic acid bisdecylamide.
[0244] In another embodiment, the lipophilic group is a steroid,
such as sterol. Steroids are polycyclic compounds containing a
perhydro-1,2-cyclopentanophenanthrene ring system. Steroids
include, without limitation, bile acids (e.g., cholic acid,
deoxycholic acid and dehydrocholic acid), cortisone, digoxigenin,
testosterone, cholesterol and cationic steroids, such as
cortisone.
[0245] In a preferred embodiment, the lipophilic group is
cholesterol or a derivative thereof. A "cholesterol derivative"
refers to a compound derived from cholesterol, for example by
substitution, addition or removal of substituents. The steroid may
be attached to the RNA oligonucleotide by any method known in the
art. In a preferred embodiment, the liphophilic group is
cholesteryl (6-hydroxyhexyl) carbamate.
[0246] In another embodiment, the lipophilic group is an aromatic
moiety. In this context, the term "aromatic" refers broadly to
mono- and polyaromatic hydrocarbons. Aromatic groups include,
without limitation, C.sub.6-C.sub.14 aryl moieties comprising one
to three aromatic rings, which may be optionally substituted;
"aralkyl" or "arylalkyl" groups comprising an aryl group covalently
linked to an alkyl group, either of which may independently be
optionally substituted or unsubstituted; and "heteroaryl" groups.
As used herein, the term "heteroaryl" refers to groups having 5 to
14 ring atoms, preferably 5, 6, 9, or 10 ring atoms; having 6, 10,
or 14.pi. electrons shared in a cyclic array; and having, in
addition to carbon atoms, between one and about three heteroatoms
selected from the group consisting of nitrogen (N), oxygen (O), and
sulfur (S).
[0247] As used herein, a "substituted" alkyl, cycloalkyl, aryl,
heteroaryl, or heterocyclic group is one having between one and
about four, preferably between one and about three, more preferably
one or two, non-hydrogen substituents. Suitable substituents
include, without limitation, halo, hydroxy, nitro, haloalkyl,
alkyl, alkaryl, aryl, aralkyl, alkoxy, aryloxy, amino, acylamino,
alkylcarbamoyl, arylcarbamoyl, aminoalkyl, alkoxycarbonyl, carboxy,
hydroxyalkyl, alkanesulfonyl, arenesulfonyl, alkanesulfonamido,
arenesulfonamido, aralkylsulfonamido, alkylcarbonyl, acyloxy,
cyano, and ureido groups.
[0248] The lipophilic group can be covalently linked directly or
indirectly via a linker to the oligonucleotide or precursor
thereof. The covalent linkage may or may not comprise a
phosphodiester group. And the linker may be of various lengths. The
preferred lengths of the linker are known to those skilled in the
art and may be determined experimentally.
[0249] In one embodiment, the lipophilic group is covalently linked
to the 3' end of at least one strand of the oligonucleotide or
precursor thereof.
[0250] In addition, the oligonucleotide or precursor thereof of the
invention may be coupled to a solid support. By "coupled" it is
meant that the oligonucleotide or precursor thereof is covalently
or non-covalently, directly or indirectly, linked to the solid
support. Suitable solid supports include, but are not limited to,
silicon wafers, synthetic polymer support such as polystyrene,
polypropylene, polyglycidylmethacrylate, substituted polystyrene
(e.g., aminated or carboxylated polystyrene, polyacrlamides,
polyamides, polyvinylchlorides, etc.), glass, agarose,
nitrocellulose, nylon and gelatin nanoparticles. Solid support may
enhance the stability and the activity of the oligonucleotide,
especially short oligonucleotides less than 16 nucleotides in
length.
Oligonucleotide Conjugates
[0251] The present invention also provides an oligonucleotide
conjugate which is capable of inducing an anti-viral response, in
particular, type I IFN production, comprising an oligonucleotide of
the invention and an antigen conjugated to the oligonucleotide. In
preferred embodiments, the antigen is conjugated to the
oligonucleotide at a position other than its 5' end which carries
the 5' triphosphate. In some embodiments, the antigen produces a
vaccine effect.
[0252] The antigen is preferably selected from
disease/disorder-related antigens. The disorder may be, for
example, a cancer, an immune disorder, a metabolic disorder, or an
infection. The antigen may be a protein, a polypeptide, a peptide,
a carbohydrate, or a combination thereof.
[0253] The oligonucleotide of the invention may be covalently
linked to the antigen, or it is otherwise operatively associated
with the antigen. As used herein, the term "operatively associated
with" refers to any association that maintains the activity of both
the oligonucleotide and the antigen. Non-limiting examples of such
operative associations include being part of the same liposome or
other such delivery vehicle or reagent. In embodiments wherein the
oligonucleotide agent is covalently linked to the antigen, such
covalent linkage preferably is at any position on the
oligonucleotide that does not interfere with the capability of the
oligonucleotide to induce an anti-viral response.
Pharmaceutical Composition
[0254] The present invention provides a pharmaceutical composition
comprising one or more of the oligonucleotide(s) or a precursor
thereof described above and a pharmaceutically acceptable
carrier.
[0255] The present invention also provides a pharmaceutical
composition comprising bacterial RNA and a pharmaceutically
acceptable carrier.
[0256] As used herein, "bacterial RNA" refers to any RNA species
isolated from a bacterium, including, but not limited to, total
RNA, mRNA, ribosomal RNA, phage RNA, miRNA, structural RNA, and
enzymatic RNA. Bacterial RNA may be endogenous to a bacterium, or
may be derived from exogenous DNA that has been introduced into the
bacterium. Bacterial RNA can be of any length. Bacterial RNA
preparations may contain a single RNA species with a single
nucleotide sequence, a single RNA species with more than one
nucleotide sequences, or multiple RNA species with more than one
nucleotide sequences. Bacterial RNA may comprise any type of
nucleotides and bases known in the field, including naturally
occurring nucleotides and nucleotides converted inside the cell,
such as inosine triphosphate and inosine, any known modifications
to the backbone and bases, and a monophosphate, a diphosphate, or a
triphosphate group at the 5' end. Bacterial RNA may be
single-stranded or double-stranded. Bacterial RNA may comprise a
heteroduplex of RNA and DNA. Bacterial RNA may be composed of a
mixture of RNAs isolated from different types of bacteria.
[0257] In a preferred embodiment, the bacterial RNA does not have a
nucleotide sequence that is more than 50%, 60%, 70%, 80%, 85%, 90%,
95%, or 99% complementary or that is 100% to a eukaryotic gene
coding sequence. In other words, the bacterial RNA preferably does
not have any gene-silencing or RNA interference (RNAi)
activity.
[0258] The term complementary is well understood by those skilled
in the art. For example, A is complementary to T, G is
complementary to C, 5'-AG-3' is complementary to 5'-CT-3'.
[0259] The degree of complementarity between two nucleotide
sequences is the percentage of complementary bases in the
overlapping region of the two nucleotide sequences. The degree of
complementarily can be determined manually or automatically by
various engines such as BLAST. For example, ATCG has 100%
complementarity to CGAT and CGATGG, and 75% complementarity to CGTT
and CGTTGG. Furthermore, the degree of complementarity between a
RNA oligonucleotide or polynucleotide and any sequences present in
the public databases (e.g., EMBL, GeneBank) can be determined by
the BLAST program.
[0260] In a preferred embodiment, the pharmaceutical composition of
the invention further comprises an agent which facilitates the
delivery of the oligonucleotide or the precursor thereof or the
bacterial RNA into a cell, in particular, into the cytosol of the
cell.
[0261] In one embodiment, the delivery agent is a complexation
agent which forms a complex with the oligonucleotide or the
precursor thereof and facilitates the delivery of the
oligonucleotide or precursor thereof into cells. In one embodiment,
the complexation agent is a polymer, preferably a cationic polymer.
In a preferred embodiment, the complexation agent is a cationic
lipid. In another preferred embodiment, the complexation agent is
polyethylenimine (PEI) (K. Wu et al., Brain Research
1008(2):284-287 (May 22, 2004); B. Urban-Klein et al. Gene Therapy
12(5):461-466 (2005)). Additional examples of complexation agent
include, but are not limited to, collagen derivatives (Y. Minakuchi
et al. Nucleic Acids Research 32(13):e109 (2004)), and
biodegradable microspheres such as liposomes (M. Sioud, D.
Sorensen, Biochem Biophys Res Commun 312(4):1220-1225 (2003); P Y
Chien et al. Cancer Gene Therapy 12(3):321-328 (2005)), virosomes
(J de Jonge et al. Gene Therapy, 13:400-411 (2006)), SNALPs (J J
Rossi, Gene Therapy 13:583-584 (2006)), SICOMATRIX.RTM. (CSL
Limited) (I. D. Davis et al. PNAS 101(29):10697-10702 (Jul. 20,
2004); M J Pearse, D. Drane, Adv Drug Deliv Rev 57(3):465-474 (Jan.
10, 2005)), and poly (D,L-lactide-co-glycolide) copolymer (PLGA)
microspheres (A. Khan et al. J Drug Target 12(6):393-404
(2004)).
[0262] Polyethylenimine (PEI) can be linear or branched. In a
preferred embodiment, PEI is in vivo-jetPEI.TM. which is a linear
PEI developed by PolyPlus-transfection for effective and
reproducible delivery of anionic oligonucleotides with low toxicity
in vivo. The preferred in vivo routes of administration include,
but are not limited to, intravenous, intracerebral and
intraperitoneal routes.
[0263] Virosomes are reconstituted viral envelopes which are
prepared from membrane-enveloped viruses, in particular influenza
virus, by solubilization of the viral membrane with a suitable
detergent, removal of the nucleocapsids by ultracentrifugation and
reconstitution of the viral envelope through extraction of the
detergent. Typically, virosomes contain viral lipids and viral
glycoproteins (such as hemagglutinin (HA) and neuraminidase (NA) in
the case of influenza virosomes), resemble the native virus
particles in size and morphology and retain the target specificity
and the fusogenic activity of the native viral particles.
[0264] SNALPs stand for Stable-Nucleic-Acid-Lipid Particles and
contain a lipid bilayer comprised of a mixture of cationic and
fusogenic lipid coated with diffusible polyethylene glycol (PEG).
The SNALPs are in the 120 nanometer diameter size range, protect
the enclosed nucleic acid from serum nucleases and allow cellular
endosomal uptake and subsequent cytoplasmic release of the nucleic
acid.
[0265] ISCOMATRIX.RTM. is made from saponin, cholesterol and
phospholipids under defined conditions and forms cage like
structures typically 40 nm in diameter. ISCOMATRIX.RTM. has the
duel capability of facilitating cargo (e.g., antigen) delivery and
stimulating the immune system, both the cellular and humoral immune
response.
[0266] In another embodiment, the delivery agent is a virus,
preferably a replication-deficient virus. In one embodiment, the
oligonucleotide described in the invention is contained in a viral
capsule. In another embodiment, the precursor of the
oligonucleotide described in the invention is comprised in a viral
vector which is contained in a viral capsule. In one embodiment,
the viral particle contains an enzyme or a nucleic acid encoding
the enzyme required for the processing of the precursor into the
oligonucleotide described in the invention. In another embodiment,
the virus comprising the precursor is administered in conjunction
with the enzyme or the nucleic acid encoding the enzyme required
for the processing of the precursor into the oligonucleotide
described in the invention.
[0267] Suitable viruses include, but are not limited to,
polymyxoviruses which target upper respiratory tract epithelia and
other cells, hepatitis B virus which targets liver cells, influenza
virus which targets epithelial cells and other cells, adenoviruses
which targets a number of different cell types, papilloma viruses
which targets epithelial and squamous cells, herpes virus which
targets neurons, retroviruses such as HIV which targets CD4.sup.+ T
cells and dendritic cells and other cells, and modified Vaccinia
Ankara which targets a variety of cells. Viruses may be selected
based on their target specificity.
[0268] In one embodiment, the virus is an oncolytic virus.
Oncolytic viruses target tumor cells and cause the lysis of the
infected tumor cells. Examples of oncolytic viruses include, but
are not limited to, naturally occurring wild-type Newcastle disease
virus (A. Phuangsab et al. Cancer Lett 172:27-36 (2001)),
attenuated strains of reovirus (M C Coffey et al. Science
282:1332-1334 (1998)) and vesicular stomatitis virus (VSV) (D F
Stojdl et al. Nat Med 6:821-825 (2000)), genetically engineered
mutants of herpes simplex virus type 1 (HSV-1), adenovirus,
poxvirus and measles virus (Chiocca E A Nat Rev Cancer 2:938-950
(2002); Russell S J Cancer Gene Ther 9:961-966 (2002); H J Zeh, D L
Bartlett Cancer Gene Ther 9:1001-1012 (2002)).
[0269] In addition to being delivered by a delivery agent, the
oligonucleotide or precursor thereof described in the invention or
bacterial RNA can be delivered into cells via physical means such
as electroporation, shock wave administration (Tschoep K et al., J
Mol Med 2001; 79:306-13), ultrasound triggered transfection, and
gene gun delivery with gold particles.
[0270] The pharmaceutical composition of the invention may further
comprises another agent such as an agent that stabilizes the
oligonucleotide or precursor thereof or bacterial RNA, in
particular, RNA oligonucleotide, e.g., a protein that complexes
with the oligonucleotide agent to form an iRNP. Still other agents
include chelators, e.g., EDTA (e.g., to remove divalent cations
such as Mg.sup.2+), salts, RNAse inhibitors (e.g., a broad
specificity RNAse inhibitor such as RNAsin) and so forth.
[0271] A formulated composition can assume a variety of states. In
some examples, the composition is at least partially crystalline,
uniformly crystalline, and/or anhydrous (e.g., less than 80, 50,
30, 20, or 10% water). In another example, the oligonucleotide
agent is in an aqueous phase, e.g., in a solution that includes
water, this form being the preferred form for administration via
inhalation.
[0272] The aqueous phase or the crystalline compositions can be
incorporated into a delivery vehicle, e.g., a liposome
(particularly for the aqueous phase), or a particle (e.g., a
microparticle as can be appropriate for a crystalline composition).
Generally, the oligonucleotide composition is formulated in a
manner that is compatible with the intended method of
administration.
[0273] The pharmaceutical compositions encompassed by the invention
may be administered by any means known in the art including, but
not limited to, oral or parenteral routes, including intravenous,
intramuscular, intraperitoneal, subcutaneous, transdermal, airway
(aerosol), ocular, rectal, vaginal, and topical (including buccal
and sublingual) administration. In preferred embodiments, the
pharmaceutical compositions are administered by intravenous or
intraparenteral infusion or injection. The pharmaceutical
compositions can also be administered intraparenchymally,
intrathecally, and/or by stereotactic injection.
[0274] For oral administration, the oligonucleotide or the
precursor thereof described in the invention or bacterial RNA will
generally be provided in the form of tablets or capsules, as a
powder or granules, or as an aqueous solution or suspension.
[0275] Tablets for oral use may include the active ingredients
mixed with pharmaceutically acceptable excipients such as inert
diluents, disintegrating agents, binding agents, lubricating
agents, sweetening agents, flavoring agents, coloring agents and
preservatives. Suitable inert diluents include sodium and calcium
carbonate, sodium and calcium phosphate, and lactose, while corn
starch and alginic acid are suitable disintegrating agents. Binding
agents may include starch and gelatin, while the lubricating agent,
if present, will generally be magnesium stearate, stearic acid or
talc. If desired, the tablets may be coated with a material such as
glyceryl monostearate or glyceryl distearate, to delay absorption
in the gastrointestinal tract.
[0276] Capsules for oral use include hard gelatin capsules in which
the active ingredient is mixed with a solid diluent, and soft
gelatin capsules wherein the active ingredient is mixed with water
or an oil such as peanut oil, liquid paraffin or olive oil.
[0277] For intramuscular, intraperitoneal, subcutaneous and
intravenous use, the pharmaceutical compositions of the invention
will generally be provided in sterile aqueous solutions or
suspensions, buffered to an appropriate pH and isotonicity.
Suitable aqueous vehicles include Ringers solution and isotonic
sodium chloride. Aqueous suspensions according to the invention may
include suspending agents such as cellulose derivatives, sodium
alginate, polyvinyl-pyrrolidone and gum tragacanth, and a wetting
agent such as lecithin. Suitable preservatives for aqueous
suspensions include ethyl and n-propyl p-hydroxybenzoate.
[0278] The pharmaceutical compositions can also include
encapsulated formulations to protect the oligonucleotide or
precursor thereof or bacterial RNA against rapid elimination from
the body, such as a controlled release formulation, including
implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. The materials can also be
obtained commercially from Alza Corporation and Nova
Pharmaceuticals, Inc. Liposomal suspensions (including liposomes
targeted to infected cells with monoclonal antibodies to viral
antigens) can also be used as pharmaceutically acceptable carriers.
These can be prepared according to methods known to those skilled
in the art, for example, as described in U.S. Pat. No. 4,522,811;
PCT publication WO 91/06309; and European patent publication
EP-A-43075.
[0279] In general, a suitable dose of an oligonucleotide or
precursor thereof or bacterial RNA will be in the range of 0.001 to
500 milligrams per kilogram body weight of the recipient per day
(e.g., about 1 microgram per kilogram to about 500 milligrams per
kilogram, about 100 micrograms per kilogram to about 100 milligrams
per kilogram, about 1 milligrams per kilogram to about 75
milligrams per kilogram, about 10 micrograms per kilogram to about
50 milligrams per kilogram, or about 1 microgram per kilogram to
about 50 micrograms per kilogram). The pharmaceutical composition
may be administered once per day, or the oligonucleotide or
precursor thereof or bacterial RNA may be administered as two,
three, four, five, six or more sub-doses at appropriate intervals
throughout the day. In that case, the oligonucleotide or precursor
thereof or bacterial RNA contained in each sub-dose must be
correspondingly smaller in order to achieve the total daily dosage.
The dosage unit can also be compounded for delivery over several
days, e.g., using a conventional sustained release formulation
which provides sustained release of the oligonucleotide agent or
bacterial RNA over a several day period. Sustained release
formulations are well known in the art. In this embodiment, the
dosage unit contains a corresponding multiple of the daily
dose.
[0280] The skilled artisan will appreciate that certain factors may
influence the dosage and timing required to effectively treat a
subject, including but not limited to the severity of the infection
or disease/disorder, previous treatments, the general health and/or
age of the subject, and other diseases/disorders present. Moreover,
treatment of a subject with a therapeutically effective amount of a
composition can include a single treatment or a series of
treatments. Estimates of effective dosages and in vivo half-lives
for the individual oligonucleotide or precursor thereof described
in the invention or bacterial RNA can be made using conventional
methodologies or on the basis of in vivo testing using an
appropriate animal model.
[0281] Toxicity and therapeutic efficacy of the oligonucleotide or
precursor thereof or bacterial RNA and the pharmaceutical
composition of the invention can be determined by standard
pharmaceutical procedures in cell cultures or experimental animals,
e.g., for determining the LD50 (the dose lethal to 50% of the
population) and the ED50 (the dose therapeutically effective in 50%
of the population). The dose ratio between toxic and therapeutic
effects is the therapeutic index and it can be expressed as the
ratio LD50/ED50. Oligonucleotide agents or bacterial RNA that
exhibit high therapeutic indices are preferred.
[0282] The data obtained from cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosages of compositions of the invention are preferably
within a range of circulating concentrations that include the ED50
with little or no toxicity. The dosage may vary within this range
depending upon the dosage form employed and the route of
administration utilized. For any oligonucleotide agent or bacterial
RNA used in the method of the invention, the therapeutically
effective dose can be estimated initially from cell culture assays.
A dose may be formulated in animal models to achieve a circulating
plasma concentration range of the oligonucleotide agent or
bacterial RNA that includes the IC50 (i.e., the concentration of
the test oligonucleotide agent which achieves a half-maximal
inhibition of symptoms) as determined in cell culture. Such
information can be used to more accurately determine useful doses
in humans. Levels in plasma may be measured, for example, by high
performance liquid chromatography.
[0283] The administering physician can adjust the amount and timing
of the administration of the pharmaceutical composition of the
invention on the basis of results observed using standard measures
of efficacy known in the art or described herein.
[0284] The pharmaceutical composition of the invention can be used
to generate a large amount of type I IFN, in particular,
IFN-.alpha., IL-18 and/or IL-1.beta., in vitro and/or in vivo. The
type I IFN, in particular, IFN-.alpha., IL-18 and/or IL-1.beta.,
can be generated at high quantities from different cellular
sources, including both immune and non-immune cells, from different
species of vertebrates.
[0285] The pharmaceutical composition of the invention can be used
for preventing and/or treating a disease and/or disorder in a
vertebrate animal, in particular, a mammal, in medical and/or
veterinary practice. The disease and/or disorder include, but are
not limited to infections, tumor, allergy, multiple sclerosis, and
immune disorders.
Combined Preparation
[0286] The present invention provides a combined preparation
comprising an oligonucleotide or a precursor thereof described in
the invention or a bacterial RNA and a pharmaceutially active
agent, wherein the oligonucleotide or a precursor thereof or the
bacterial RNA and the agent are for simultaneous, separate or
sequential administration.
[0287] The pharmaceutically active agents include, but are not
limited to, immunostimulatory RNA oligonucleotides,
immunostimulatory DNA oligonucleotides, cytokines, chemokines,
growth factors, antibiotics, anti-angiogenic factors,
chemotherapeutic agents, anti-viral agents, anti-bacterial agents,
anti-fungal agents, anti-parasitic agents, antibodies and gene
silencing agents.
[0288] The combined preparation of the invention may comprise one
or more pharmaceutically active agent(s). The more than one
pharmaceutically active agents maybe of the same or different
category as exemplified above.
[0289] In one embodiment, the combined preparation comprises an
oligonucleotide or a precursor thereof described in the invention
or a bacterial RNA and an immunostimulatory agent, wherein the
oligonucleotide or a precursor thereof or the bacterial RNA and the
agent are for simultaneous, separate or sequential administration.
In one embodiment, the combined preparation further comprises an
anti-viral and/or anti-tumor agent.
[0290] In another embodiment, the combined preparation comprises an
oligonucleotide or a precursor thereof described in the invention
or a bacterial RNA and an anti-viral and/or anti-bacterial and/or
anti-tumor agent, wherein the oligonucleotide or a precursor
thereof or the bacterial RNA and the agent are for simultaneous,
separate or sequential administration. In one embodiment, the
combined preparation further comprises an immunostimulatory
agent.
[0291] The oligonucleotide or a precursor thereof described in the
invention or the bacterial RNA and the pharmaceutically active
agent may be comprised in the same or in separate compositions. The
separate compositions may be administered simultaneously or
sequentially.
[0292] The combined preparation of the present invention may
further comprise retinoic acid and/or type I IFN. Retinoic acid
and/or type I IFN are known to upregulate RIG-I expression in most
cell types, including for example endothelial cells, epithelial
cells, fibroblasts, immune cells and tumor cells.
[0293] An immunostimulatory agent is an agent, such as a molecule
or a composition, which is capable of inducing an immune response.
Immunogstiumatory agents include, but are not limited to,
immunostimulatory RNA oligonucleotides such as those capable of
inducing IFN-.alpha. or IL-12 (Heil F et al. 2004, Science 303:
1526-1529; Sioud M et al. 2005, J Mol Biol 348: 1079-1090; Homung V
et al. 2005, Nat Med 11: 263-270; Judge A D et al. 2005, Nat
Biotechnol 2005. 23: 457-462; Sugiyama et al. 2005, J
Immuno/174:2273-2279; Gitlin L et al. 2006, PNAS 103(22):8459-8464;
European patent application nos. 05020020.3 and 05020019.5) (e.g.,
poly(I:C) and immunostimulatory DNA oligonucleotides such as a
CpG-containing or non-CpG-containing DNA oligonucleotide capable of
inducing IFN-.alpha. (see e.g., WO 01/22990, WO 03/101375),
cytokines such as type I IFN and IL-12, chemokines such as IP-10,
MIP1-.alpha., MCP, RANTES, IL-8, and growth factors such as IL-3,
GMCSF, GSCF, MCSF.
[0294] In one embodiment, the immunostimulatory agent is capable of
inducing an anti-viral response, such as type I IFN, MIP1-a, MCP,
RANTES, IL-8, and IL-6 production.
[0295] An anti-viral agent is an agent that is useful in the
prevention and the treatment of a viral infection. Anti-viral
agents include, but are not limited to nucleoside analogs (such as
aciclovir, ganciclovir, ribavirin, lamivudin, etc.), protease
inhibitors (such as ritonavir etc), cytotoxic agents (such as
taxols, carboplatins, cyclophosphamide, methotrexate, azathiprine,
5-fluoruracil, etc.)
[0296] In another embodiment, the immunostimulatory agent is
capable of inducing an anti-bacterial response, such as type I
and/or type II IFN production.
[0297] An anti-bacterial agent is an agent that is useful in the
prevention and the treatment of a bacterial infection, in
particular, intracellular bacterial infection. Anti-bacterial
agents include, but are not limited to, Aminoglycosides,
Carbapenems, Cephalosporins, Glycopeptides, Macrolides, Monobactam,
Penicillins, Polypeptides, Quinolones, Sulfonamides,
Tetracyclines.
[0298] An anti-tumor agent is an agent that is useful in the
prevention and the treatment of tumor or cancer. Anti-tumor agents
include, but are not limited to chemotherapeutic agents (such as
cisplatin, doxorubicin, taxols, carboplatins, cyclophosphamide,
methotrexate, azathiprine, 5-fluoruracil, etc.), anti-angiogenic
factors (such as vasostatin and anti-VEGF antibody), and other
anti-cancer agents such as Herceptin.RTM., Rituxan.RTM.,
Gleevec.RTM., and Iressa.RTM..
[0299] A gene silencing agent is an agent that is capable of
downregulating the expression of a gene. The gene may encode a
protein, a rRNA, a tRNA, or a miRNA. Examples of a gene siclencing
agent include, but are not limited to, an antisense RNA, a RNAi
molecule (such as siRNA, shRNA, miRNA), and an antagomir (which is
a cholesterol-conjugated ssRNA that is complementary to an
miRNA).
[0300] In a preferred embodiment, the combined preparation of the
invention further comprises an oligonucleotide delivery agent as
described previously. In other preferred embodiments, the
oligonucleotide or precursor thereof or the bacterial RNA may be
delivered by physical means as described previously.
Pharmaceutical Package
[0301] The present invention provides a pharmaceutical package
comprising the pharmaceutical composition or the combined
preparation of the invention and an instruction for use.
Use of the Oligonucleotide or Precursor Thereof or Bacterial RNA
for Inducing an Anti-Viral Response
[0302] The present application provides the use of the
oligonucleotide or precursor thereof described in the invention or
a bacterial RNA for the preparation of a pharmaceutical composition
for inducing an anti-viral response, in particular, type I IFN
production, IL-18 production, and/or IL-1.beta. production, in a
vertebrate animal, in particular, a mammal.
[0303] An anti-viral response is the response by a cell, tissue or
organism upon infection by a virus with the purpose of eliminating
or incapacitating the virus. Typical anti-viral responses include,
but are not limited to, type I IFN, MIP1-a, MCP, RANTES, IL-8,
IL-6, IP-10, and IFN-.gamma. production.
[0304] An anti-viral response, in particular, type I IFN, IL-18,
and/or IL-1.beta. production, may be induced in immune cells or
non-immune cells. Immune cells include, but are not limited to,
peripheral blood mononuclear cells (PBMC), plasmacytoid dendritric
cells (PDC), myeloid dendritic cells (MDC), B cells, CD4+ T cells,
CD8+ T cells, macrophages, monocytes, natural killer cells, NKT
cells, granulocytes. Non-immune cells include, but are not limited
to, fibroblasts, endothelial cells, epithelial cells and tumor
cells.
[0305] The induction of an anti-viral response, in particular, type
I IFN, IL-18, and/or IL-1.beta. production, may aid the prevention
and treatment of various disorders and/or diseases such as tumor,
infections, and immune disorders.
[0306] In a preferred embodiment, the RNA oligonucleotide is a
single-stranded RNA oligonucleotide which does not contain any
sequence which is capable of forming any intramolecular or
intermolecular double-stranded structure with itself under
physiological condition, in particular, physiological condition
inside a cell, and the nucleotide sequence of the ssRNA is
complementary to a viral RNA or a cellular RNA induced by the virus
in a virally infected cell.
[0307] The degree of complementarity is preferably at least 50%,
60%, 70%, more preferably at least 75%, 80%, 85%, 90%, even more
preferably at least 95%, 96%, 97%, 98%, 99%, and most preferably
100%.
[0308] In one embodiment, the ssRNA olignucleotide has gene
silencing activity. In another embodiment, the ssRNA olignucleotide
lacks gene silencing activity.
[0309] In one embodiment, the ssRNA oligonucleotide and its
complementary strand are delivered separately into cells,
preferably in a target cell-specific manner.
[0310] In another embodiment, a single-stranded RNA oligonucleotide
comprising one or more modifications selected from pseudouridine,
2-thiouridine, 2'-Fluorine-dNTP, 2'-O-methylated NTP, in particular
2'-fluorine-dCTP, 2'-fluorine-dUTP, 2'-O-methylated CTP,
2'-O-methylated UTP and having a nucleotide sequence which is
complementary to a RNA oligonucleotide described in the present
invention may be used to inactivate the RNA oligonucleotide and to
halt the anti-viral response.
[0311] In one embodiment, the pharmaceutical composition further
comprises a delivery agent as described previously. The
oligonucleotide or precursor thereof or bacterial RNA may also be
delivered by physical means as described previously. In another
embodiment, the pharmaceutical composition further comprises
another agent such as an agent that stabilizes the oligonucleotide
or precursor thereof or bacterial RNA as described previously.
[0312] In one embodiment, the oligonucleotide or precursor thereof
described in the invention or the bacterial RNA is used in
combination with at least one agent selected from an
immunostimulatory agent which is capable of inducing an anti-viral
response, an anti-viral agent and a gene silencing agent. In a
further embodiment, the oligonucleotide or precursor thereof
described in the invention or the bacterial RNA is used in
combination with retinoic acid and/or type I IFN.
[0313] Vertebrate animals include, but are not limited to, fish,
amphibians, birds, and mammals. Mammals include, but are not
limited to, rats, mice, cats, dogs, horses, sheep, cattle, cows,
pigs, rabbits, non-human primates, and humans. In a preferred
embodiment, the mammal is human.
Use of the Oligonucleotide or Precursor Thereof or Bacterial RNA
for Inducing an Anti-Bacterial Response
[0314] The present application provides the use of the
oligonucleotide or precursor thereof described in the invention or
a bacterial RNA for the preparation of a pharmaceutical composition
for inducing an anti-bacterial response, in particular, a response
against intracellular bacteria, in a vertebrate animal, in
particular, a mammal.
[0315] Intracellular bacteria include, but are not limited to,
mycobacteria (tuberculosis), chlamydia, mycoplasma, listeria, and
facultative intracellular bacteria such as staphylococcus
aureus.
[0316] An anti-bacterial response is the response by a cell, tissue
or organism upon infection by a bacterium with the purpose of
eliminating or incapacitating the bacterium. Typical anti-bacterial
responses include, but are not limited to, T cell or NK
cell-mediated elimination of the infected cell by either
receptor-mediated apoptosis or cytokine-mediated apoptosis via TNF
or TRAIL, macrophage or monocytes phagocytosis.
[0317] In one embodiment, the anti-bacterial response comprises
type I IFN, type II IFN, IL-18 and/or IL-1.beta. production.
[0318] An anti-bacterial response, in particular, type I IFN, type
II IFN, IL-18, and/or IL-1.beta. production, may be induced in
immune cells or non-immune cells. Immune cells include, but are not
limited to, peripheral blood mononuclear cells (PBMC), plasmacytoid
dendritric cells (PDC), myeloid dendritic cells (MDC), B cells,
macrophages, monocytes, natural killer cells, NKT cells, CD4+ T
cells, CD8+ T cells, granulocytes. Non-immune cells include, among
others, tumor cells, epithelial cells, endothelial cells, and
fibroblasts.
[0319] The induction of an anti-bacterial response, in particular,
type I IFN, type II IFN, IL-18 and/or IL-1.beta. production, may
aid the prevention and treatment of various disorders and/or
diseases such as tumor, infections, and immune disorders.
[0320] In a preferred embodiment, the RNA oligonucleotide is a
single-stranded RNA oligonucleotide which does not contain any
sequence which is capable of forming any intramolecular or
intermolecular double-stranded structure with itself under
physiological condition, in particular, physiological condition
inside a cell, and the nucleotide sequence of the ssRNA is
complementary to a bacterial RNA or a cellular RNA induced by the
bacteria in a bacteria-infected cell.
[0321] The degree of complementarity is preferably at least 50%,
60%, 70%, more preferably at least 75%, 80%, 85%, 90%, even more
preferably at least 95%, 96%, 97%, 98%, 99%, and most preferably
100%.
[0322] In one embodiment, the ssRNA olignucleotide has gene
silencing activity. In another embodiment, the ssRNA olignucleotide
lacks gene silencing activity.
[0323] In one embodiment, the ssRNA oligonucleotide and its
complementary strand are delivered separately into cells,
preferably in a target cell-specific manner.
[0324] In another embodiment, a single-stranded RNA oligonucleotide
comprising one or more modifications selected from pseudouridine,
2-thiouridine, 2'-Fluorine-dNTP, 2'-O-methylated NTP, in particular
2'-fluorine-dCTP, 2'-fluorine-dUTP, 2'-O-methylated CTP,
2'-O-methylated UTP and having a nucleotide sequence which is
complementary to a RNA oligonucleotide described in the present
invention may be used to inactivate the RNA oligonucleotide and to
halt the anti-bacterial response.
[0325] In one embodiment, the pharmaceutical composition further
comprises a delivery agent as described previously. The
oligonucleotide or precursor thereof or bacterial RNA may also be
delivered by physical means as described previously. In another
embodiment, the pharmaceutical composition further comprises
another agent such as an agent that stabilizes the oligonucleotide
or precursor thereof or bacterial RNA as described previously.
[0326] In one embodiment, the oligonucleotide or precursor thereof
described in the invention or the bacterial RNA is used in
combination with at least one agent selected from an
immunostimulatory agent which is capable of inducing an
anti-bacterial response, an anti-bacterial agent and a gene
silencing agent. In a further embodiment, the oligonucleotide or
precursor thereof described in the invention or the bacterial RNA
is used in combination with retinoic acid and/or type I IFN.
[0327] Vertebrate animals include, but are not limited to, fish,
amphibians, birds, and mammals.
[0328] Mammals include, but are not limited to, rats, mice, cats,
dogs, horses, sheep, cattle, cows, pigs, rabbits, non-human
primates, and humans. In a preferred embodiment, the mammal is
human.
Use of the Oligonucleotide or Precursor Thereof or Bacterial RNA
for Inducing Apoptosis
[0329] The present application provides the use of the
oligonucleotide or precursor thereof described in the invention or
a bacterial RNA for the preparation of a pharmaceutical composition
for inducing apoptosis in vitro and in vivo, in particular, in a
vertebrate animal, in particular, in a mammal.
[0330] In a preferred embodiment, the apoptosis is induced in tumor
cells.
[0331] The induction of apoptosis may be therapeutically beneficial
to individuals having diseases/disorders caused by
over-proliferation and/or compromised apoptosis of cells, for
example, tumor.
Use of the Oligonucleotide or Precursor Thereof or Bacterial RNA
for Inducing An Anti-Tumor Response
[0332] The present application provides the use of the
oligonucleotide or precursor thereof described in the invention or
a bacterial RNA for the preparation of a pharmaceutical composition
for inducing an anti-tumor response in a vertebrate animal, in
particular, a mammal.
[0333] The tumor may be benign or malignant.
[0334] The anti-tumor response comprises type I IFN induction
and/or tumor cell apoptosis.
[0335] In a preferred embodiment, the RNA oligonucleotide is a
single-stranded RNA oligonucleotide which does not contain any
sequence which is capable of forming any intramolecular or
intermolecular double-stranded structure with itself under
physiological condition, in particular, physiological condition
inside a cell, and the nucleotide sequence of the ssRNA is
complementary to a tumor-specific RNA.
[0336] The tumor-specific RNA may be an mRNA of a tumor-specific
antigen. The tumor-specific RNA may be an miRNA.
[0337] The degree of complementarity is preferably at least 50%,
60%, 70%, more preferably at least 75%, 80%, 85%, 90%, even more
preferably at least 95%, 96%, 97%, 98%, 99%, and most preferably
100%.
[0338] In one embodiment, the ssRNA olignucleotide has gene
silencing activity. In another embodiment, the ssRNA olignucleotide
lacks gene silencing activity.
[0339] In one embodiment, the ssRNA oligonucleotide and its
complementary strand are delivered separately into cells,
preferably in a target cell-specific manner.
[0340] In another embodiment, a single-stranded RNA oligonucleotide
comprising one or more modifications selected from pseudouridine,
2-thiouridine, 2'-Fluorine-dNTP, 2'-O-methylated NTP, in particular
2'-fluorine-dCTP, 2'-fluorine-dUTP, 2'-O-methylated CTP,
2'-O-methylated UTP and having a nucleotide sequence which is
complementary to a RNA oligonucleotide described in the present
invention may be used to inactivate the RNA oligonucleotide and to
halt the anti-tumor response.
Use of the Oligonucleotide or Precursor Thereof or bacterial RNA
for Treating Diseases/Disorders
[0341] The present invention provides the use of the
oligonucleotide or precursor thereof described in the invention or
a bacterial RNA for the preparation of a pharmaceutical composition
for preventing and/or treating a disease and/or disorder in a
vertebrate animal, in particular, a mammal, in medical and/or
veterinary practice.
[0342] The disease and/or disorder include, but are not limited to
infections, tumor, allergy, multiple sclerosis, and immune
disorders.
[0343] Infections include, but are not limited to, viral
infections, bacterial infections, anthrax, parasitic infections,
fungal infections and prion infection.
[0344] Viral infections include, but are not limited to, infection
by hepatitis C, hepatitis B, herpes simplex virus (HSV), HIV-AIDS,
poliovirus, encephalomyocarditis virus (EMCV) and smallpox virus.
Examples of (+) strand RNA viruses which can be targeted for
inhibition include, without limitation, picornaviruses,
caliciviruses, nodaviruses, coronaviruses, arteriviruses,
flaviviruses, and togaviruses. Examples of picornaviruses include
enterovirus (poliovirus 1), rhinovirus (human rhinovirus 1A),
hepatovirus (hepatitis A virus), cardiovirus (encephalomyocarditis
virus), aphthovirus (foot-and-mouth disease virus 0), and
parechovirus (human echovirus 22). Examples of caliciviruses
include vesiculovirus (swine vesicular exanthema virus), lagovirus
(rabbit hemorrhagic disease virus), "Norwalk-like viruses" (Norwalk
virus), "Sapporo-like viruses" (Sapporo virus), and "hepatitis
E-like viruses" (hepatitis E virus). Betanodavirus (striped jack
nervous necrosis virus) is the representative nodavirus.
Coronaviruses include coronavirus (avian infections bronchitis
virus) and torovirus (Berne virus). Arterivirus (equine arteritis
virus) is the representative arteriviridus. Togavirises include
alphavirus (Sindbis virus) and rubivirus (Rubella virus). Finally,
the flaviviruses include flavivirus (Yellow fever virus),
pestivirus (bovine diarrhea virus), and hepacivirus (hepatitis C
virus).
[0345] In certain embodiments, the viral infections are selected
from chronic hepatitis B, chronic hepatitis C, HIV infection, RSV
infection, HSV infection, VSV infection, CMV infection, and
influenza infection.
[0346] In one embodiment, the infection to be prevented and/or
treated is upper respiratory tract infections caused by viruses
and/or bacteria. In another embodiment, the infection to be
prevented and/or treated is bird flu.
[0347] Bacterial infections include, but are not limited to,
streptococci, staphylococci, E. coli, pseudomonas.
[0348] In one embodiment, bacterial infection is intracellular
bacterial infection. Intracellular bacterial infection refers to
infection by intracellular bacteria such as mycobacteria
(tuberculosis), chlamydia, mycoplasma, listeria, and facultative
intracellular bacteria such as staphylococcus aureus.
[0349] Parasitic infections include, but are not limited to, worm
infections, in particular, intestinal worm infection.
[0350] Tumors include both benign and malignant tumors (i.e.,
cancer).
[0351] Cancers include, but are not limited to biliary tract
cancer, brain cancer, breast cancer, cervical cancer,
choriocarcinoma, colon cancer, endometrial cancer, esophageal
cancer, gastric cancer, intraepithelial neoplasm, leukemia,
lymphoma, liver cancer, lung cancer, melanoma, myelomas,
neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer,
prostate cancer, rectal cancer, sarcoma, skin cancer, testicular
cancer, thyroid cancer and renal cancer.
[0352] In certain embodiments, cancers are selected from hairy cell
leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia,
chronic myeloid leukemia, non-Hodgkin's lymphoma, multiple myeloma,
follicular lymphoma, malignant melanoma, squamous cell carcinoma,
renal cell carcinoma, prostate carcinoma, bladder cell carcinoma,
breast carcinoma, ovarian carcinoma, non-small cell lung cancer,
small cell lung cancer, hepatocellular carcinoma, basaliom, colon
carcinoma, cervical dysplasia, and Kaposi's sarcoma (AIDS-related
and non-AIDS related).
[0353] Allergies include, but are not limited to, respiratory
allergies, contact allergies and food allergies.
[0354] Immune disorders include, but are not limited to, autoimmune
diseases, immunodeficiency, and immunosuppression.
[0355] Autoimmune diseases include, but are not limited to,
diabetes mellitus, arthritis (including rheumatoid arthritis,
juvenile rheumatoid arthritis, osteoarthritis, psoriatic
arthritis), multiple sclerosis, encephalomyelitis, myasthenia
gravis, systemic lupus erythematosis, automimmune thyroiditis,
dermatitis (including atopic dermatitis and eczematous dermatitis),
psoriasis, Sjogren's Syndrome, Crohn's disease, aphthous ulcer,
iritis, conjunctivitis, keratoconjunctivitis, ulcerative colitis,
asthma, allergic asthma, cutaneous lupus erythematosus,
scleroderma, vaginitis, proctitis, drug eruptions, leprosy reversal
reactions, erythema nodosum leprosum, autoimmune uveitis, allergic
encephalomyelitis, acute necrotizing hemorrhagic encephalopathy,
idiopathic bilateral progressive sensorineural hearing, loss,
aplastic anemia, pure red cell anemia, idiopathic thrombocytopenia,
polychondritis, Wegener's granulomatosis, chronic active hepatitis,
Stevens-Johnson syndrome, idiopathic sprue, lichen planus, Graves'
disease, sarcoidosis, primary biliary cirrhosis, uveitis posterior,
and interstitial lung fibrosis.
[0356] Immunodeficiencies include, but are not limited to,
spontaneous immunodeficiency, acquired immunodeficiency (including
AIDS), drug-induced immunodeficiency (such as that induced by
immunosuppressants used in transplantation and chemotherapeutic
agents used for treating cancer), immunosuppression caused by
chronic hemodialysis, trauma or surgical procedures.
[0357] Immunosuppression includes, but is not limited to, bone
marrow suppression by cytotoxic chemotherapy.
[0358] In one embodiment, the pharmaceutical composition is a tumor
vaccine. The oligonucleotide or precursor thereof described in the
invention or the bacterial RNA may induce tumor cell apoptosis
through binding to RIG-I, induce type I IFN, IL-18 and/or
IL-1.beta. production by the tumor cells, directly and/or
indirectly activate effector cells of innate immunity such as NK
cells, NKT cells, and .gamma..delta. T cells, and/or directly
and/or indirectly inactivate suppressor T cells, thereby leading to
tumor cell growth inhibition and/or destruction.
[0359] Tumor cells which have been stimulated with an RIG-I ligand,
such as the oligonucleotide or precursor thereof described in the
present invention or a bacterial RNA, may also be used as a tumor
vaccine.
[0360] In a preferred embodiment, the RNA oligonucleotide is a
single-stranded RNA oligonucleotide which does not contain any
sequence which is capable of forming any intramolecular or
intermolecular double-stranded structure with itself under
physiological condition, in particular, physiological condition
inside a cell, and the nucleotide sequence of the ssRNA is
complementary to a disease/disorder-related RNA.
[0361] In one embodiment, the disease/disorder-related RNA is an
mRNA of a disease/disorder-related gene. In another embodiment, the
disease/disorder-related RNA is a miRNA. The
disease/disorder-related RNA may be a endogenous cellular RNA, a
viral RNA, a RNA from an invading microorganism or organism such as
a bacterium, a fungus, or a parasite.
[0362] The degree of complementarity is preferably at least 50%,
60%, 70%, more preferably at least 75%, 80%, 85%, 90%, even more
preferably at least 95%, 96%, 97%, 98%, 99%, and most preferably
100%.
[0363] In one embodiment, the ssRNA olignucleotide has gene
silencing activity. In another embodiment, the ssRNA olignucleotide
lacks gene silencing activity.
[0364] In one embodiment, a single-stranded RNA oligonucleotide
comprising one or more modifications selected from pseudouridine,
2-thiouridine, 2'-Fluorine-dNTP, 2'-O-methylated NTP, in particular
2'-fluorine-dCTP, 2'-fluorine-dUTP, 2'-O-methylated CTP,
2'-O-methylated UTP and having a nucleotide sequence which is
complementary to ssRNA oligonucleotide may be used to inactivate
the ssRNA oligonucleotide and to halt type I IFN induction.
[0365] In certain embodiments, the oligonucleotide or precursor
thereof described in the invention or the bacterial RNA is used in
combination with one or more pharmaceutically active agents such as
immunostimulatory agents, anti-viral agents, antibiotics,
anti-fungal agents, anti-parasitic agents, anti-tumor agents,
cytokines, chemokines, growth factors, anti-angiogenic factors,
chemotherapeutic agents, antibodies and gene silencing agents. The
more than one pharmaceutically active agents may be of the same or
different category.
[0366] In preferred embodiments, the oligonucleotide or precursor
thereof described in the invention or the bacterial RNA is used in
combination with an anti-viral vaccine or an anti-bacterial vaccine
or an anti-tumor vaccine, wherein the vaccine can be prophylactic
and/or therapeutic.
[0367] In other embodiments, the pharmaceutical composition is for
use in combination with one or more prophylactic or therapeutic
treatments of diseases and/or disorders such as infection, tumor,
multiple sclerosis, and immunodeficiency. For example, treatments
of cancer include, but are not limited to, surgery, chemotherapy,
radiation therapy, neoadjuvant therapy, thermoablation, and
cryoablation.
[0368] In a further embodiment, the oligonucleotide or precursor
thereof described in the present invention or a bacterial RNA is
used in combination with retinoic acid and/or type I IFN. Retinoic
acid and/or type I IFN are known to upregulate RIG-I expression in
most cell types, including for example endothelial cells,
epithelial cells, fibroblasts, immune cells and tumor cells.
[0369] In one embodiment, the pharmaceutical composition further
comprises a delivery agent as described previously. The
oligonucleotide or precursor thereof or bacterial RNA may also be
delivered by physical means as described previously. In another
embodiment, the pharmaceutical composition further comprises
another agent such as an agent that stabilizes the oligonucleotide
or precursor thereof or bacterial RNA as described previously.
[0370] The pharmaceutical composition may be formulated for oral,
nasal, ocular, parenteral (including intraveneous, intradermal,
intramuscular, intraperitoneal, and subcutaneous), rectal, vaginal
or topical (including buccal and sublingual) administration.
[0371] In preferred embodiment, the pharmaceutical composition is
for prophylactic local (e.g., mucosa, skin) or systemic use. For
example, a spray (i.e., aerosol) preparation may be used to
strengthen the antiviral capability of the nasal and the pulmonary
mucosa.
[0372] Vertebrate animals include, but are not limited to, fish,
amphibians, birds, and mammals.
[0373] Mammals include, but are not limited to, rats, mice, cats,
dogs, horses, sheep, cattle, cows, pigs, rabbits, non-human
primates, and humans. In a preferred embodiment, the mammal is
human.
Use of the Oligonucleotide or Precursor Thereof or Bacterial RNA as
an Adjuvant
[0374] The prevent invention provides the use of the
oligonucleotide or precursor thereof described in the invention or
a bacterial RNA in combination with at least one antigen for the
preparation of a vaccine for inducing an immune response against
the at least one antigen in a vertebrate animal, in particular, a
mammal.
[0375] The at least one antigen may be a protein, a polypeptide, a
peptide, a carbohydrate, a nucleic acid, or a combination
thereof.
[0376] The at least one antigen is preferably a
disease/disorder-associated antigen, against which the generation
of an immune response is beneficial for the prevention and/or
treatment of the disease/disorder.
[0377] The oligonucleotide or precursor thereof or the bacterial
RNA may be covalently linked to or non-covalently complexed with
the at least one antigen. In one embodiment, the oligonucleotide or
precursor thereof or the bacterial RNA is covalently linked to the
at least one antigen. In another embodiment, both the
oligonucleotide or precursor thereof or the bacterial RNA which is
anionic and the protein or peptide antigen which is rendered
anionic by N- or C-terminal extension of glutamic acid residues are
complexed with cationic polymers. In yet another embodiment,
phosphothioates which are incorporated into the oligonucleotide or
precursor thereof or the bacterial RNA to increase nuclease
resistance complexes with cysteine residues added to the N-terminal
of antigenic protein or peptide. In a further embodiment, the at
least one antigen can be encoded by a vector, in particular, a
viral vector, which also comprises the oligonucleotide or precursor
thereof. In yet a further embodiment, the at least one antigen can
be a part of a virosome which encapsulates the oligonucleotide or
precursor thereof or the bacterial RNA.
[0378] The oligonucleotide or precursor thereof or the bacterial
RNA and the at least one antigen may also be comprised in separate
compositions which are administered simultaneously.
[0379] In one embodiment, the vaccine further comprises a delivery
agent as described previously. The oligonucleotide or precursor
thereof or the bacterial RNA may also be delivered by physical
means as described previously. In another embodiment, the
pharmaceutical composition further comprises another agent such as
an agent that stabilizes the oligonucleotide or precursor thereof
or the bacterial RNA as described previously.
[0380] Vertebrate animals include, but are not limited to, fish,
amphibians, birds, and mammals.
[0381] Mammals include, but are not limited to, rats, mice, cats,
dogs, horses, sheep, cattle, cows, pigs, rabbits, non-human
primates, and humans. In a preferred embodiment, the mammal is
human.
In Vitro Method for Stimulating an Anti-viral and/or Anti-bacterial
Response
[0382] The present invention provides an in vitro method for
stimulating an anti-viral response and/or an anti-bacterial
response in a cell, comprising the steps of: [0383] (a) mixing an
oligonucleotide or precursor described in the invention or a
bacterial RNA with a complexation agent; and [0384] (b) contacting
a cell with the mixture of (a), wherein the cell expresses RIG-I
and/or components of the inflammasome.
[0385] In a preferred embodiment, the anti-viral response or the
anti-bacterial response comprises type I IFN, in particular,
IFN-.alpha. production, type II IFN production, IL-18 production,
and/or IL-1.beta. production.
[0386] The cells include, but are not limited to, primary immune
cells, primary non-immune cells, and cell lines. Immune cells
include, but are not limited to, peripheral blood mononuclear cells
(PBMC), plasmacytoid dendritric cells (PDC), myeloid dendritic
cells (MDC), B cells, macrophages, monocytes, natural killer cells,
granulocytes, CD4+ T cells, CD8+ T cells, NKT cells. Non-immune
cells include, but are not limited to, fibroblasts, endothelial
cells, and epithelial cells. Cell lines include those that
endogenously express RIG-I and/or components of the inflammasome
and those containing exogenous DNA which directs the expression of
RIG-I and/or components of the inflammasome.
In Vitro Method for Stimulating Th1 Cytokine Production
[0387] The present invention provides an in vitro method for
stimulating the production of a Th1 cytokine in a cell, comprising
the steps of: [0388] (a) mixing an oligonucleotide or precursor
described in the invention or a bacterial RNA with a complexation
agent; and [0389] (b) contacting a cell with the mixture of (a),
wherein the cell is capable of producing the Th1 cytokine.
[0390] In one embodiment, the cell expresses RIG-I and/or
components of the inflammasome.
[0391] In a preferred embodiment, the Th1 cytokine is IL-18 or
IL-1.beta.. The cells include, but are not limited to, immune cells
and non-immune cells. Immune cells include, but are not limited to,
peripheral blood mononuclear cells (PBMC), plasmacytoid dendritric
cells (PDC), myeloid dendritic cells (MDC), B cells, macrophages,
monocytes, natural killer cells, granulocytes, CD4+ T cells, CD8+ T
cells, NKT cells. In a preferred embodiment, the cell is a
macrophage. Non-immune cells include, but are not limited to
fibroblasts, endothelial cells, and epithelial cells.
Method for Preparing an Oligonucleotide Capable of Inducing an
Anti-viral and/or Anti-Bacterial and/or Anti-Tumor Response
[0392] The present invention provides a method for preparing an
oligonucleotide capable of inducing an anti-viral and/or
anti-bacterial response, comprising the steps of: [0393] (a)
introducing at least one uncapped 5' phosphate group into an
oligonucleotide; and [0394] (b) introducing a nucleotide sequence
capable of forming double-stranded structure inside a cell into the
oligonucleotide.
[0395] The oligonucleotide may be single-stranded, single-stranded
comprising a sequence capable of forming a double-stranded
structure, or double-stranded. The double-stranded structure may be
formed inside a cell by the oligonucleotide itself either
intramolcularly or intramolecularly or between a single-stranded
oligonucloetide and a RNA molecule of the cell, such as a mRNA or
miRNA, which comprises a sequence complementary to the
oligonucleotide. The degree of complementarity is preferably at
least 50%, 60%, 70%, more preferably at least 75%, 80%, 85%, 90%,
even more preferably at least 95%, 96%, 97%, 98%, 99%, and most
preferably 100%. The degree of complementarity can be determined by
a skilled person using known methods in the art, such as BLAST. In
certain embodiments, the number of basepairing within the
double-stranded structure is at least 6, 7, 8, 9, preferably at
least 10, 11, 12, 13, 14, 15, more preferably at least 16, 17, 18,
19, 20, 21, even more preferably at least 22, 23, 24, 25. Basepairs
include both Waston-Crick basepairs and wobble basepairs.
Waston-Crick basepairs include A-T, C-G, A-U; wobble basepairs
include G-U, I-U, I-A, I-C.
[0396] One or more of the following steps may be incorporated into
the method for preparing an oligonucleotide capable of inducing an
anti-viral and/or anti-bacterial response of the present invention
to further enhance the anti-viral and/or anti-bacterial
response-inducing activity of the oligonucleotide: [0397] (c)
preparing an oligonucletide having adenosine (A) at the 5' end;
[0398] (d) preparing an olignucletide having a sequence selected
from AAGU, AAAG, AUGG, AUUA, AACG, AUGA, AGUU, AUUG, AACA, AGAA,
AGCA, AACU, AUCG, AGGA, AUCA, AUGC, AGUA, AAGC, AACC, AGGU, AAAC,
AUGU, ACUG, ACGA, ACAG, AAGG, ACAU, ACGC, AAAU, ACGG, AUUC, AGUG,
ACAA, AUCC, AGUC at the 5' end; and [0399] (e) incorporating
inosine (I) into the oligonucleotide.
[0400] In a preferred embodiment, the anti-viral response or the
anti-bacterial response comprises type I IFN, in particular,
IFN-.alpha. production, type II IFN production, IL-18 production,
and/or IL-1.beta. production.
Method for Preparing an Oligonucleotide Free of Anti-viral
Response-Inducing Activity and Anti-Bacterial Response-Inducing
Activity
[0401] The present invention also provides a method for preparing
an oligonucleotide free of any anti-viral response-inducing
activity and anti-bacterial response-inducing activity, comprising
one or more of the following steps: [0402] (a) eliminating all 5'
phosphate groups from the oligonucleotide; [0403] (b) capping all
5' monophosphate, diphosphate or triphosphate of the
oligonucleotide; [0404] (c) eliminating any nucleotide sequence
capable of forming double-stranded structure inside a cell from the
oligonucleotide; and [0405] (d) incorporating modified nucleotides
such as pseudouridine, 2-thiouridine,
2'-Fluorine-dNTPs-2'-O-methylated NTPs, preferably
2'-fluorine-dCTP, 2'-fluorine-dUTP, 2'-O-methylated CTP,
2'-O-methylated UTP, into the oligonucleotide.
[0406] Nucleotide sequence capable of forming double-stranded
structure inside a cell includes those which allow the formation of
a double-stranded structure within the same oligonucleotide (i.e.,
intramolecular), between two of the same oligonucleotides (i.e.,
intermolecular), or between an oligonucleotide and a RNA (e.g.,
mRNA, miRNA) in a target cell.
[0407] In a preferred embodiment, the anti-viral response or the
anti-bacterial response comprises type I IFN, in particular,
IFN-.alpha. production, type II IFN production, IL-18 production,
and/or IL-1.beta. production.
Method for Preparing RNA for Gene Therapy
[0408] The present invention provides a method for preparing an RNA
for use in gene therapy, comprising the step of eliminating 5'
monophosphate, diphosphate or triphosphate from an RNA and/or
incorporating modified nucleotides such as pseudouridine,
2-thiouridine, 2'-Fluorine-dNTPs-2'-O-methylated NTPs, preferably
2'-fluorine-dCTP, 2'-fluorine-dUTP, 2'-O-methylated CTP,
2'-O-methylated UTP, into the RNA. The RNA prepared according to
the method of the invention lacks immunostimulatory activity and/or
capability of inducing an anti-viral response and is therefore
suitable for gene transfer in vertebrate cells.
[0409] RNA useful in gene therapy include those that upregulate or
downregulate the expression/translation of a gene of interest. In
the former case, the RNA encodes a protein of interest, the
expression of which is of therapeutic value (e.g., a tumor
suppressor; the cystic fibrosis protein). In the latter case, the
RNA interferes with the expression of a protein of interest, the
downregulation of which is of therapeutic value (e.g., an
oncogene). In the latter case, the RNA may be an antisense RNA, an
siRNA, an shRNA or a miRNA.
[0410] The utility of the oligonucleotide or precursor thereof
described in the present invention or the bacterial RNA may be
extended to other RIG-I ligands.
[0411] The present invention is illustrated by the following
examples.
EXAMPLES
Material and Methods
Examples 1-10
Cell Culture
[0412] Human PBMC were prepared from whole blood donated by young
healthy donors by Ficoll-Hypaque density gradient centrifugation
(Biochrom, Berlin, Germany). PDC were isolated by MACS using the
blood dendritic cell Ag (BCDA)-4 dendritic cell isolation kit from
Miltenyi Biotec (Bergisch-Gladbach, Germany). Briefly, PDC were
labelled with anti-BDCA-4 Ab coupled to colloidal paramagnetic
microbeads and passed through a magnetic separation column twice
(LS column, then MS column; Miltenyi Biotec). The purity of
isolated PDC (lineage-negative, MHC-II-positive and CD123-positive
cells) was above 95%. Before isolation of monocytes, PDC were
depleted by MACS (LD column; Miltenyi Biotec) and then monocytes
were isolated using the monocyte isolation kit II (Miltenyi
Biotec). Murine bone marrow-derived conventional dendritic cells
were generated by incubating pooled bone marrow cells in the
presence of murine GM-CSF (10 ng/ml; R&D Systems, Minneapolis,
Minn.). After 7 days, these cultures typically contained more than
90% cDC (CD11c+, CD11b+, B220-). Viability was above 95%, as
determined by trypan blue exclusion. All cells, except PDC
(2.5*10.sup.6 cells/ml), were cultured at a density of 2*10.sup.6
cells/ml in RPMI 1640 culture medium (Biochrom, Berlin, Germany)
supplemented with 10% (v/v) FCS (Biochrom), 1.5 mM L-glutamine, 100
U/ml penicillin, and 100 .mu.g/ml streptomycin (all from
Sigma-Aldrich, Munich, Germany). PDC cultures were additionally
supplemented with 10 ng/ml IL-3 (R&D Systems). HEK 293 cells
(human embryonic kidney) were maintained in RPMI 1640 culture
medium (Biochrom) supplemented with 10% (v/v) FCS (Biochrom), 1.5
mM L-glutamine, 100 U/ml penicillin, and 100 .mu.g/ml streptomycin
(all from Sigma-Aldrich). Vero (African green monkey kidney) and
HEK 293T (human embryonic kidney) cells were maintained in
Dulbecco's modified Eagle's medium supplemented with antibiotics
and 5% or 10% foetal calf serum, respectively. BSR cells were
propagated in Glasgow minimal essential medium supplemented with
10% newborn calf serum, phosphate broth, amino acids and
antibiotics.
Mice
[0413] TLR7, RIG-I and MDA5 deficient mice have been previously
described (Hemmi H et al. Nat. Immunol. 3:196, February, 2002; Kato
H et al., Immunity 23:19, July, 2005; Kato H et al. Nature
441(7089):101-105, Apr. 9, 2006). Female wildtype C57BU6 mice were
purchased from Harlan-Winkelmann (Borchen, Germany). Mice were 6-12
weeks of age at the onset of experiments. Animal studies were
approved by the local regulatory agency (Regierung von Oberbayem,
Munich, Germany).
ELISA
[0414] Human IFN-.alpha. was assessed in cell culture supernatants
using the IFN-.alpha. module set (Bender MedSystems, Graz,
Austria). The murine IP-10 ELISA was from Biosource (Solingen,
Germany), the murine IFN-.alpha. ELISA was from PBL Biomedical
Laboratories (Piscataway, USA). All ELISA procedures were
performed, according to manufacturers' recommendations. Murine
IFN-.alpha. was measured according to the following protocol:
monoclonal rat anti-mouse IFN-.alpha. (clone RMMA-1) was used as
the capture Ab, and polyclonal rabbit anti-mouse IFN-.alpha. serum
for detection (both PBL Biomedical Laboratories) together with
HRP-conjugated donkey anti-rabbit IgG as the secondary reagent
(Jackson ImmunoResearch Laboratories). Mouse rIFN-A (PBL Biomedical
Laboratories) was used as the standard (IFN-.alpha. concentration
in IU/ml).
RNAs
[0415] Chemically synthesized RNA oligonucleotides were purchased
from Eurogentec (Leiden, Belgium). In vitro transcribed RNAs were
synthesized using the Silencer siRNA construction Kit (Ambion,
Huntingdon, UK) or according to the following protocol: Using
partially overlapping single stranded DNA oligonucleotides, a
double-stranded DNA template was constructed using Exo Klenow
(Fermentas). The 2500 nucleotides transcript (FIG. 1) was generated
using the control template of the Opti mRNA Kit (Curevac, Tubingen,
Germany). Templates larger than 40 by were constructed via PCR
using the pBluescript KS as a template (for a detailed list of all
in vitro transcription templates see table 1). The obtained
templates contained a T7 RNA polymerase consensus promoter followed
by the sequence of interest to be transcribed. 20 pmol of the DNA
template were incubated with 30 U T7 RNA polymerase, 40 U RNase
inhibitor, 0.3 U yeast inorganic pyrophosphatase in a buffer
containing 40 mM Tris-HCl pH 8.0, 10 mM DTT, 2 mM spermidine-HCl
(Sigma) and 20 mM MgCl.sub.2. Capped RNA was transcribed using the
Opti mRNA Kit (Curevac). To transcribe nucleoside modified RNAs,
uridine-5'-triphosphate was replaced by either
pseudouridine-5'-triphosphate or 2-thiouridine-5'-triphosphate
(both TriLink, San Diego, USA) during the in vitro transcription
reaction. For the incorporation of 2'-O-methylated UTP (Trilink),
T7 R&DNA.TM. Polymerase (Eipcentre, Madison, USA) was used.
This polymerase has single-base active-site mutations that allow
the incorporation of NTPs with 2'-substituents such as 2'-O-methyl.
In vitro transcription was carried out overnight at 37.degree. C.
The DNA template was digested using DNase I (Fermentas) and
subsequently RNAs were purified using the Roche high pure RNA
isolation kit (Roche Applied Science, Mannheim, Germany) with the
following modifications: Binding buffer was 2.0 M guanidine
thiocyanate in 70% ethanol and wash buffer was substituted by 100
mM NaCl, 4.5 mM EDTA, 10 mM Tris HCl in 70% ethanol. After elution,
excess salts and NTPs were removed by passing the RNAs through a
Mini Quick Spin.TM. Oligo Column (Roche). Size and integrity of
RNAs was checked via gel electrophoresis.
TABLE-US-00004 TABLE 1 A: DNA oligonucleotides for the generation
of in vitro transcription templates: SEQ ID Corr. No. Name Sequence
strand 84 AF6.5-35n 5'-CAGTAATACGACTCACTATTAGGGAA 1 GCGGGCA-3' 82
GF6.5-35n 5'-CAGTAATACGACTCACTATAGGGGAA 1 GCGGGCA-3' 101 RNA9.2s-0A
5'-TTGAAGGACAGGTTAAGCTAATAGTG 2 AGTCG-3' 80 RNA9.2s-1G
5'-ATTGAAGGACAGGTTAAGCTATAGTG 3 AGTCGTA-3' 97 RNA9.2s-5A
5'-GGTAATTGAAGGACAGGTTAATAGTG 2 AGTCG-3' 92 tri-09-mer
5'-GGGATCCCCTATAGTGAGTCGTA-3' 3 98 tri-12-mer
5'-GGGTTCATCCCCTATAGTGAGTCGT 3 A-3' 90 tri-15-mer
5'-GGGAAGTTCATCCCCTATAGTGAGTC 3 GTA-3' 93 tri-18-mer
5'-GGGCTGAAGTTCATCCCCTATAGTGA 3 GTCGTA-3' 91 tri-21-mer
5'-GGGACCCTGAAGTTCATCCCCTATAG 3 TGAGTCGTA-3' 94 tri-24-mer
5'-GGGCTGACCCTGAAGTTCATCCCCTA 3 TAGTGAGTCGTA-3' 89 tri-27-mer
5'-GGGAAGCTGACCCTGAAGTTCATCCC 3 CTATAGTGAGTCGTA-3' 73 tri-G-AC-U-
5'-AAATGTGTGTGTGTGTGTGTGCCTGT 5 Bio CTC-3' 74 tri-GFPa
5'-AAGATGAACTTCAGGGTCAGCCCCTA 3 TAGTGAGTCGTA-3' 75 tri-GFPs
5'-AAGCTGACCCTGAAGTTCATCCCCTA 3 TAGTGAGTCGTA-3' 102 tri-Poly A
5'-TTTTTTTTTTTTTTTTTTTTTCCTGT 5 CTC-3' 95 tri-Poly C
5'-GGGGGGGGGGGGGGGGGGGGGCCTGT 5 CTC-3' 85 tri-Poly G
5'-CCCCCCCCCCCCCCCCCCCCCCCTGT 5 CTC-3' 71 tri-Poly T
5'-AAAAAAAAAAAAAAAAAAAAACCTGT 5 CTC-3' 72 tri-
5'-AAAGTGTGTGTGTGTGTGTGTGTCTA 3 singleG- TAGTGAGTCGTA-3' 24 mer 78
tri-27 + 2s 5'-AAGTGGTGCAGATGAACTTCAGGGTC 3 AGCTATAGTGAGTCGTA-3' 76
tri-27 + 2a 5'-AAGCTGACCCTGAAGTTCATCTGCAC 2 CACTATAGTGAGTCGTA-3' 98
tri-27 + 0s 5'-GGTGCAGATGAACTTCAGGGTCAGCT 3 TAATAGTGAGTCG-3' 77
tri-27 + 0a 5'-AAGCTGACCCTGAAGUCATCTGCACC 3 TATAGTGAGTCGTA-3' 202
RV leader 5'-ACATTTTTGCTTTGCAATTGACAATG 4 RNA
TCTGTTTTTTCTTTGATCTGGTTGTTAAG CGTTATAGTGAGTCGTATTACGCG-3'
Corresponding strands: SEQ ID No. Name Sequence 100 1
5'-TGATCGGCTATGGCTGGCCGCATGCCCGCTTCC-3' 83 2
5'-CAGTAATACGACTCACTATTA-3' 99 3 5'-TAATACGACTCACTATA-3' 203 4
5'-AATTCGCGTAATACGACTCACTATA-3' -- 5 Ambion T7 Promoter Primer B:
PCR primer for the generation of in vitro transcription templates
using pBKS as the PCR template SEQ ID No. Name Sequence Forward
primer: 204 pBKS 17 5'-GGATCCTAATACGACTCACTATAGGGCGA-3' prom. SEQ
ID No. Name Sequence Backward primer: 81 pBKS
5'-CACCGCGGTGGAGCTCCAATTCGCCCTAT-3' 27-mer 88 pBKS
5'-CGGGGGATCCACTAGTTCT-3' 57-mer 86 pBKS 5'-CCTCGAGGTCGACGGTATC-3'
105-mer 87 pBKS 5'-CGGATAACAATTTCACACAGGA-3' 204-mer 79 pBKS
5'-AGTGAGCGCAACGCAATTA-3' 302-mer
RNA Isolation
[0416] RNA from E. coli strain DH10B and human PBMC was isolated
using Trizol.RTM. reagent (Invitrogen, Karlsruhe, Germany)
according to the manufacturer's protocol. CIAP treatment was
performed the following way: 10 .mu.g in vitro transcribed RNA, 15
.mu.g cellular RNA or 1.5 .mu.g viral RNA was treated with 30 U of
calf intestine alkaline phosphatase (CIAP) (Stratagene, La Jolla,
USA) for 3 hours at 37.degree. C. in a buffer containing 50 mM
Tris-HCl, 0.1 mM EDTA in the presence of 10 U of RNase inhibitor
(RNAguard.TM.; Amersham-Biosciences). Following CIAP treatment, the
RNA was cleaned up using the RNeasy Mini kit.
Cell Extracts
[0417] Cell lysates were prepared according to Meister et al. (G.
Meister et al., Mol Cell 15, 185 (Jul. 23, 2004)) with minor
modifications. HEK 293 cells were transfected using high molecular
weight (25 kDa) polyethylenimine (PEI; Sigma, 40.872-7). At a
confluency of 80-90%, cells were transfected with a PEI:DNA ratio
of 1.5:1. 24-36 hours after transfection cells were harvested and
the cell pellet was resuspended in five pellet volumes of 10 mM
KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol, 10 mM HEPES-NaOH (pH
7.9), 0.5 mM PMSF and incubated for ten minutes on ice.
Subsequently cells were washed and the cell pellet was resuspended
in two pellet volumes of the buffer described above and homogenized
by douncing. The cell nuclei were removed from the cell lysate by
centrifugation at 2.000 g for ten minutes. The supernatant was
transferred into microcentrifuge tubes and cleared further by
centrifugation at 2.000 g for ten minutes and further
centrifugation for 30 minutes at 20.000 g to obtain the cytoplasmic
extract. The concentration of KCl of the extract was subsequently
raised to 100 mM by addition of 2 M KCl and glycerol was added to a
percentage of 10%. For purification of FLAG-tagged RIG-IC
complexes, cytoplasmic extracts were incubated in FLAG M2 agarose
beads (Sigma). FLAG M2 agarose beads were washed once with 0.1 M
glycine (pH 3.5) and equilibrated by washing with 1 M Tris-HCl (pH
8.0). The beads were then resuspended in buffer C (0.1 M KCl, 5 mM
MgCl2, 10% glycerol, 10% Tween20, 10 mM .beta.-mercaptoethanol, 0.2
mM PMSF, and 20 mM Tris-HCl [pH 8.0]) and incubated with
cytoplasmic extracts for four hours at 4.degree. C. with rotation.
The beads were collected and washed twice in wash buffer (300 mM
NaCl, 5 mM MgCl2, 50 mM Tris-HCl [pH 7.5]) supplemented with 0.1%
NP40. Affinity-bound complexes were then eluted by shaking the
beads in 0.2 .mu.g/ml 3.times.FLAG peptide (Sigma) in wash buffer
for two hours at 10.degree. C. and after centrifugation the eluate
was collected.
Ligand Binding Studies
[0418] Whole cell lysate or 25 .mu.l RIG-IC eluate was incubated
with 0.375 .mu.g biotinylated RNA in the presence of 40 U RNase
inhibitor (Fermentas), 0.5 mM PMSF in a final volume of 100 .mu.l
in wash buffer for two hours at 4.degree. C. with rotation. 50
.mu.l streptavidin-coated beads (Pierce, Rockford, USA; 20347) were
added to the lysate for another hour at room temperature with
rotation. Beads were then washed four times with wash buffer
supplemented with 0.1% NP40. Supernatant and beads were lysed in
Laemli buffer for further immunoblot analysis.
Western Blotting
[0419] For Western blotting, samples were separated by SDS-PAGE and
transferred to a nitrocellulose membrane (Amersham-Biosciences, UK)
by semi-dry electroblotting. As primary antibody, monoclonal
anti-Flag antibody (Sigma) was used. As secondary antibody,
peroxidase-conjugated anti-mouse antibody (Amersham-Biosciences)
was used. Bound antibodies were visualized by enhanced
chemiluminescence system (ECL) according to the manufacturers
protocol (Amersham-Biosciences).
Reporter Assays
[0420] 12-16 hours prior to transfection, HEK 293 cells were seeded
in 48-well plates. At a confluency of 80%, HEK 293 cells were
transfected using PEI with 300 ng of a reporter plasmid
(pIFN.beta.-luc), 500 ng of a normalisation plasmid (expressing
Rous sarcoma virus .beta.-galactosidase) and the indicated
expression plasmids giving a total of 1.5 .mu.g DNA/well. 24 hours
after transfection culture medium was aspirated and the cells
washed once in 0.5 ml PBS containing 10 mM EDTA. Then cells were
lysed in 50 .mu.l luciferase lysis buffer (10% glycerol, 1%
Triton-X, 2 mM EDTA, 25 mM TrisHCl [pH 7.8], 2 mM DTT). 20 .mu.l of
each sample were mixed with 20 .mu.l of Luciferase Detection
Reagent (Promega) and analyzed for luciferase activity with a
microplate luminometer (LUMIstar, BMGLabtechnologies). To measure
beta-galactosidase activity, 10 .mu.l lysate was incubated with 100
.mu.l of solution 1 (1% Galacton-Plus [TROPIX], 0.1% 0.1 M
MgCl.sub.2, 20% 0.5 M phosphate [pH 8], 78.9% H.sub.2O) for 20
minutes and then 50 .mu.l of solution 2 was added (20% 1 M NaOH,
10% Emerald [TROPIX] 70% H.sub.2O). Luciferase activity values were
normalized against beta-galactosidase activity of the same extract.
Reporter assays for experiments involving viral infection (FIG. 5)
were performed the following way: 12 to 18 hours prior to
transfection, HEK 293T or Vero cells were seeded in 24-well plates.
At a confluency of 80%, the cells were transfected using
Lipofectamine 2000 (Invitrogen) with 400 ng of a reporter plasmid
encoding firefly luciferase (p125-Luc) and 2 ng of a plasmid
encoding CMV-controlled renilla luciferase (pRL-CMV, Promega) for
normalization along with 400 ng of empty vector of RIG-expressing
plasmids when indicated. 6 hours after DNA transfection the cells
were either infected or transfected with the indicated amounts of
RNA using PEI. 48 hours after DNA transfection the cell extracts
were prepared and assayed in the Dual Luciferase Reporter System
(Promega). Luciferase activity was measured in a Luminometer
(Berthold) according to the supplier's instructions.
Plasmids
[0421] pIFN-beta-Luc was kindly provided by T. Maniatis. RIG-I
CARD2 was kindly provided by S. Rothenfusser. p125-Luc, RIG-I full,
RIG-IC, RIG-I K270A and the empty control vector were kindly
provided by T. Fujita (M. Yoneyama et al., Nat Immunol 5, 730
(July, 2004)). RIG-I .DELTA.Helicase_C (AS 655-734) was constructed
from RIG-I full via loop out PCR using the following PCR primer
pair:
5'-ACTGAGTTTAGGATTTCCTTCAATCC-3',5'-GGTAGCAAGTGCTTCCTTCTGA-3'.
pSC6-T7-NEO was kindly provided by M. Billeter F. (Radecke et al.,
Embo J 14, 5773 (Dec. 1, 1995)). T7 D812N was constructed from
pSC6-T7-NEO via site directed mutagenesis using the following PCR
primer pair:
5'-GCACTGATTCACGCCTCCTTCGGTACC-3',5'-GGTACCGAAGGAGGCGTGAATCAGTGC-3'.
RIG-I .DELTA.Helicase_C and 17 RNA D812N were confirmed by
sequencing.
Virus Stocks
[0422] Recombinant RV SAD L16 (Schnell M J et al., 1994, EMBO J.
13(18):4195-4203) was used as wt RV. Cloning of cDNA, recovery of
recombinant SAD .DELTA.PLP virus, which encodes P from the most
promoter-distal gene position, and virus propagation, was described
previously (K. Brzozka, et al. Journal of virology 79, 7673 (June,
2005)).
[0423] For isolation of total RNA from non-infected cells or from
cells infected with RV at MOI of 1 for 2 days, the RNeasy minikit
(QIAGEN, Hilden, Germany) was used according to manufacturer's
instructions. For isolation of RV particle RNA, virions were
pelleted from cell-free supernatants by ultracentrifugation in
SW32Ti for 2 h at 4.degree. C. and 27,000 rpm. RNA was isolated
from pellets with the RNeasy minikit.
Examples 11-16
Media and Reagents
[0424] RPMI 1640 (Biochrom) supplemented with 10% (v/v)
heat-inactivated FCS (Invitrogen Life Technologies), 3 mM
L-glutamine, 0.01 M HEPES, 100 U/ml penicillin, and 100 .mu.g/ml
streptomycin (all from Sigma-Aldrich) and Dulbecco's modified
Eagle's medium (PAN, Aidenbach, Germany) supplemented with 10%
fetal calf serum (FCS), 3 mM L-glutamine, 100 U/ml penicillin and
100 .mu.g/ml streptomycin was used. CpG ODNs (Coley Pharmaceutical
Group) show small letters, phosphorothioate (PT) linkage and
capital letters, phosphodiester (PD) linkage 3' of the base;
CpG-A-ODN 2216 (5'-ggGGGACGATCGTCgggggG-3'), CpG-B ODN 1826
(5'-TCCATGACGTTCCTGACGTT-3'). Polyinosinic:polycytidylic acid
(poly(I:C)) was purchased from Sigma-Aldrich. For depletion of NK
cells and CD8 T cells, the IL-2 receptor-.beta. chain-specific mAb
TM.beta.1 and mAb RmCD8-2 were used as described (kind gift of
Ralph Mocikat, GSF-Institut fur Molekulare Immunologie, Munich,
Germany). Recombinant murine IFN.beta. was purchased at Europa
Bioproducts LTD. In vivo-jetPEI.TM. (#201-50) was purchased at
Biomol GmbH (Hamburg, Germany).
RNAs
[0425] Chemically synthesized RNA oligonucleotides were purchased
from Eurogentec (Leiden, Belgium) or MWG-BIOTECH AG (Ebersberg,
Germany) (for a detailed list of all chemically synthesized RNA
oligonucleotides see Table 3). In vitro transcribed RNAs were
synthesized according to the manufacturers instruction's using the
megashort script kit (Ambion, Huntingdon, UK) (for a detailed list
of all in vitro transcription templates see Table 4). The obtained
templates contained a T7 RNA Polymerase consensus promoter followed
by the sequence of interest to be transcribed. For generation of in
vitro transcribed double-stranded RNA the DNA templates of the
sense and anti-sense strands were transcribed for 6 hours in
separate reactions. An extra G was added to both the sense and the
anti-sense strands in order to transcribe with T7 RNA polymerase.
The reactions were then mixed and the combined reaction was
incubated overnight at 37.degree. C. The DNA template was digested
using DNAse-I (Ambion) and subsequently RNAs were purified using
phenol:chloroform extraction and alcohol precipitation. After
elution, excess salts and NTPs were removed by passing the RNAs
through a Mini Quick Spin.TM. Oligo Column (Roche). Integrity of
RNAs was checked via gel electrophoresis.
Cells
[0426] Flt3-Ligand (Flt3-L) induced mixed cultures of murine
myeloid and plasmacytoid dendritic cells were grown as described
(3). Plasmacytoid DC from FLT-3 ligand induced bone marrow cultures
were sorted with 8220 microbeads (Miltenyi Biotec). Conventional
dendritic cells (cDCs) were generated by incubating pooled bone
marrow cells in the presence of murine GM-CSF (10 ng/ml; R&D
Systems, Minneapolis, Minn.). After 7 days, these cultures
typically contained more than 80% cDC (CD11c+, CD11b+, 6220-). For
some experiments B cells were isolated from spleens of wild-type
mice by MACS using the mouse B cell isolation kit and CD19
microbeads (Milteny Biotec). Untouched NK cells and CD 8 T cells
were sorted from spleens using the NK cell isolation and the CD8 T
Cell Isolation Kit (Mileny Biotec). Viability of all cells was
above 95%, as determined by trypan blue exclusion and purity was
>90% as analyzed by FACS. Murine primary cells were cultivated
in RPMI (PAN, Aidenbach, Germany) supplemented with 10% fetal calf
serum (FCS), 4 mM L-glutamine and 10-5 M mercaptoethanol. Murine
B16 cells (H-2b) were a kind gift of Thomas Tuting and cultivated
in Dulbecco's modified Eagle's medium (PAN, Aidenbach, Germany)
supplemented with 10% fetal calf serum (FCS), 2 mM L-glutamine, 100
U/ml penicillin and 100 .mu.g/ml streptomycin.
Cell Culture
[0427] All cells were cultured at a density of 2*10.sup.6 cells/ml
and seeded in 24-well flat-bottom plates, respectively. If not
indicated otherwise, cells were incubated for 24 hours with 3
.mu.g/ml CpG-B-DN 1826 and/or CpG-ODN 2216, 1 .mu.M R848. RNAs were
transfected with Lipofectamine 2000 according to the manufacturer's
protocol (Invitrogen). If not indicated otherwise, we transfected
200 ng of nucleic acid with 0.5 .mu.l of Lipofectamine. After 24 h
the supernatants were collected for analysis of cytokine secretion
by enzyme-linked immunosorbent assay (ELISA), and cells were
harvested for flow cytometric analysis.
Cytokine Measurement
[0428] Concentrations of murine IFN-.gamma. and IL-12p40 in the
culture supernatants and sera were determined by ELISA according to
the manufacture's instructions (BD PharMingen, San Diego, Calif.).
Murine IFN-.alpha. was analysed using the mouse IFN-.alpha. ELISA
kit (PBL Biomedical Laboratories, PBL #42100-2, New Brunswick,
N.J.). For some experiments, murine IFN-.alpha. was measured
according to the following protocol: monoclonal rat anti-mouse
IFN-.alpha. (clone RMMA-1) was used as the capture Ab, and
polyclonal rabbit anti-mouse IFN-.alpha. serum for detection (both
PBL Biomedical Laboratories) together with HRP-conjugated donkey
anti-rabbit IgG as the secondary reagent (Jackson ImmunoResearch
Laboratories). Mouse rIFN-.alpha. (PBL Biomedical Laboratories) was
used as the standard (IFN-.alpha. concentration in IU/ml).
Transfection and Reporter Assay
[0429] For monitoring transient IFN-.beta. activation by 5'
triphosphate siRNA murine B16 cells were seeded in 24-well plates.
At a confluency of 70%, B16 cells were transfected using PEI with
200 ng of a reporter plasmid (pIFN.beta.-luc DAM/DCM), 200 ng of a
normalisation plasmid (expressing Renilla-Luc) and the indicated
expression plasmids giving a total of 1.5 .mu.g DNA/well. B16 cells
were transfected using high molecular weight (25 kDa)
polyethylenimine (PEI; Sigma, 40.872-7) with a PEI:DNA ratio of
1.5:1. In some experiments we used Lipofectamine 2000 (Invitrogen)
for cotransfection of synthetic siRNAs with the indicated
expression plasmids according to the manufacturer's protocol. 16
hours after transfection culture medium was aspirated, the cells
were washed once in 0.5'' ml PBS and then stimulated with different
ligands for the indicated time points. The supernatant was
collected and the cells were washed again in 0.5 ml PBS containing
10 mM EDTA. Then cells were lysed in 100 .mu.l of Promega lysis
buffer (Promega, #1531). 20 .mu.l of each sample were mixed with 20
.mu.l of Luciferase Detection Reagent (Luciferase Assay Kit, Biozym
Scientific GmbH, Oldendorf, Germany) and analyzed for luciferase
activity with a microplate luminometer (LUMIstar,
BMGLabtechnologies). To measure Renilla luciferase activity, 20
.mu.l lysate was incubated with 20 .mu.l of Renilla substrate
(Coelenterazine (Promega, #2001). Luciferase activity values were
normalized against Renilla activity of the same extract.
Plasmids
[0430] IFN-.beta.-Luc reporter plasmids, wild-type pPME-myc NS3-4A
(NS3-4A), pPME-myc MutNS3-4A (NS3-4A; containing an inactivating
Serin 139 to Ala mutation) were kindly provided by T. Maniatis and
J. Chen. RIG-I full, RIG-IC, RIG-I K270A and the empty control
vector were kindly provided by T. Fujita (Yoneyama M et al. (2004)
Nat. Immunol. 5(7):730-737). The renilla-luciferase transfection
efficiency vector (phRLTK) was purchased from Promega.
Western Blotting
[0431] For Western blotting, samples were separated by SDS-PAGE and
transferred to a nitrocellulose membrane (Amersham-Biosciences, UK)
by semi-dry electroblotting. As primary antibody polyclonal rat
anti-RIG-I (kind gift of Dr. Kremer), polyclonal rabbit anti-Bcl-2
(Santa Cruz, sc-7382) and rabbit anti-caspase-1 (Santa Cruz,
sc-7148) antibody were used. As secondary antibody,
peroxidase-conjugated anti-mouse or anti-rabbit antibody
(Amersham-Biosciences) were used. Bound antibodies were visualized
by enhanced chemiluminescence system (ECL) according to the
manufacturer's protocol (Amersham-Biosciences).
Flow Cytometry
[0432] At the time points indicated, surface antigen staining was
performed as described previously. Fluorescence-labelled monoclonal
antibodies (mAbs) against 8220, CD11c, NK1.1, CD4, CD8, CD69, CD86
and appropriate isotype control antibodies were purchased from BD
Pharmingen (Heidelberg, Germany). Flow cytometric data were
acquired on a Becton Dickinson FACSCalibur equipped with 2 lasers
(excitation at 488- and 635-nm wavelength). Data were analyzed
using Cellquest software (Becton Dickinson, Heidelberg, Germany).
To determine Bcl-2 Expression of B16 melanoma cells in metastatic
lungs single cell suspensions were prepared from lung metastases of
IFNAR-deficient mice. Cells were fixed and permabilized using 2%
PFA and Saponin and incubated with a specific unconjugated
rabbit-TRP-1 Ab (kind gift of Thomas Tilting) for 20 min on ice.
Then cells were washed and incubated with goat anti-rabbit FITC Ab
(Santa Cruz; sc-2012) for 20 min. Again cells were washed and
PE-conjugated Bcl-2-Ab (Santa Cruz, sc-7382-PE) was added to the
cells. After 20 min of incubation cells were analysed by flow
cytometry.
Quantification of Apoptotic and Dead Cells
[0433] Adherent and supernatant cells were analyzed by staining
with FITC-labelled Annexin-V (Roche) and propidium iodide (BD
Biosciences). Annexin-V staining was performed according to the
manufacturers instructions. Propidium iodide was added to a final
concentration of 0.5 mg/ml and cells were analyzed by flow
cytometry and CellQuest software (Becton Dickinson, Heidelberg,
Germany).
Confocal Microscopy
[0434] C57BU6 mice were injected intravenously with FITC labelled
RNA (100 .mu.g) complexed to jetPEI (Biomol). After 6 h mice were
sacrificed and the desired organs were analysed for uptake of the
RNA complexes. Briefly, sections of metastatic lungs or
non-diseased lungs were transferred on microscope slides and fixed
in acetone for 10 min. Nuclear counterstaining was performed using
TOPRO-3 (Molecular Probes). Washing steps were done in
Tris-buffered saline and cells were mounted in Vectarshield
Mounting Medium (Vector Laboratories). Cells were then analysed
using a Zeiss LSM510 confocal mircroscope (Carl Zeiss, Germany)
equipped with 488 nm-Argon and 633 nm-Helium-Neon lasers.
Mice
[0435] RIG-1-, MDA-5-, TLR7-deficient mice were established as
described (Kato et al. (2006) Nature 441:101; Akira S et al. (2004)
C R Biol. 327(6):581-9). IFNAR-deficient mice were a kind gift of
Ulrich Kalinke. Female C57BU6 mice were purchased from
Harlan-Winkelmann (Borchen, Germany). Mice were 6-12 weeks of age
at the onset of experiments. Animal studies were approved by the
local regulatory agency (Regierung von Oberbayern, Munich,
Germany).
Mouse Studies
[0436] For in vivo studies, we injected C57BU6 mice with 200 .mu.l
containing nucleic acids with prior jetPEI-complexation according
to the manufacturer's protocol. Briefly, 10 .mu.l of in vivo jetPEI
was mixed with 50 .mu.g of nucleic acids at a N:P ration of 10/1 in
5% Glucose solution and incubated for 15 min. Subsequently, the
complexes were injected in the retro-orbital vein. Serum was
collected after 6 h unless indicated otherwise. Whole blood was
obtained by tail clipping at the indicated time points. Serum was
prepared from whole blood by coagulation for 30 min at 37.degree.
C. and subsequent centrifugation and stored at -20.degree. C.
Cytokine levels were determined by ELISA.
Engraftment of B16 Melanoma in the Lungs and Depletion of CD8 T
Cells and NK Cells In Vivo
[0437] For the induction of lung metastases we injected
4.times.10.sup.5 B16 melanoma cells into the tail vein of the
indicated mice. On day 3, 6 and 9 we injected the mice with 200
.mu.l containing nucleic acids (50 .mu.g each) with prior
jetPEI-complexation as described. Subsequently, the complexes were
injected in the retro-orbital vein. 14 days after challenge the
number of macroscopically visible melanoma metastases on the
surface of the lungs was counted with the help of a dissecting
microscope or, in case of massive tumor load, lung weight was
determined. Depletion of NK cells and CD8 T cells was performed as
described {Adam, 2005 #49; Mocikat, 2003 #50}. Briefly, TM.beta. 1
mAb was given intraperitoneally 4 days (1 mg) before and 2 (0.2 mg)
and 14 (0.1 mg) days after tumor challenge. To neutralize CD8 T
cells, the mAb RmCD8-2 was injected intraperitoneally one (0.5 mg)
and four days (0.1 mg) before and 4 (0.1 mg) and 14 (0.1 mg) days
after tumor inoculation. Experiments were done in groups of four to
five mice and repeated two to four times.
Histopathologic Analyses
[0438] Samples of lungs were obtained when mice were sacrificed.
Tissue specimens were fixed in absolute ethanol and embedded in
paraffin. Apoptosis was detected by the transferase-mediated dUTP
nick end-labeling (TUNEL) method according to the manufacturers
instructions (Boehringer Roche, Mannheim, Germany). Briefly,
deparaffinized and rehydrated sections were incubated for 1 h at
37.degree. C. with tailing mix containing 1.times. tailing buffer,
1 mM CoCl.sub.--2, 1 .mu.l of 10.times. DIG DNA labeling mix and
200 units of terminal transferase (double dist. water added to a
total volume of 50 .mu.l). After washing in trisbuffered saline,
sections were incubated for 1 h at room temperature with an
alkaline phosphatase-conjugated antidigoxigenin antibody (diluted
1:250 in 10% fetal calf serum). The reaction was visualized with
nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate.
Example 1
In Vitro Transcribed RNA Stimulates IFN-.alpha. Production in Human
Primary Monocytes
[0439] IFN-.alpha. production in the human immune system is thought
to be largely confined to PDC. IFN-.alpha. production in human
primary monocytes has not been reported so far. As demonstrated in
previous studies (V. Homung et al., J Immunol 168, 4531 (May 1,
2002); I. B. Bekeredjian-Ding et al., J Immunol 174, 4043 (Apr. 1,
2005)), monocytes express TLR2, TLR4, TLR8 and TLR8 but no TLR3,
TLR7 or TLR9, and produce IL-6 in response to TLR2/6- TLR4- and
TLR8-ligands but not to TLR3-, TLR7- or TLR9-ligands (I. B.
Bekeredjian-Ding et al., J Immunol 174, 4043 (Apr. 1, 2005)).
Monocytes failed to produce IFN-.alpha. upon stimulation with all
TLR ligands tested including CpG-A ODN 2216 (A. Krug et al., Eur J
Immuno/31, 2154 (July, 2001)) and R848, both of which induce
IFN-.alpha. in PDC (FIG. 1 and data not shown). We hypothesized
that motif patterns or sequences in RNA may exist in long RNA
molecules that induce IFN-.alpha. in monocytes.
[0440] In vitro transcription was used to generate long ssRNA
molecules as chemical synthesis is impracticable to generate ssRNA
larger than 100 nucleotides. RNA transcripts were transfected in
monocytes and PDC and IFN-.alpha. production was assessed by
ELISA.
[0441] The present inventors found that a 2500-nucleotide long RNA
molecule, but not the TLR9 ligand CpG-A ODN 2216 or the TLR7/8
ligand R848, stimulated a strong IFN-.alpha. response in primary
human monocytes (FIG. 1A).
[0442] The templates that were used to generate the set of ssRNA
molecules of different lengths (27-302 nucleotides) were identical
at the 5' end, whereas the 3' end was gradually shortened. As a
consequence, this set of ssRNA molecules was identical in sequence
at the 5' end. IFN-a induction in monocytes was also seen when in
vitro transcribed RNA molecules of different length (from 27
nucleotides to 302 nucleotides) were used (FIG. 1B).
[0443] Next, whether the length of the 3' sequence impacts on the
IFN-.alpha.-inducing activity of 5' phosphate RNA was tested. 5'
triphosphate RNA oligonucleotides ranging from 27 to 9 nucleotides
were generated by the gradual shortening (in steps of three
nucleotides) of a 27-mer oligonucleotide from the 3' end. Whereas
RNA oligonucleoties 27, 24 and 21 nucleotides in length were potent
inducers of IFN-.alpha. in monocytes, a sharp drop of activity was
observed for shorter sequences (FIG. 1C). This suggested that in
vitro transcribed RNA had to have a minimal length of 21 bases to
induce IFN-.alpha. in monocytes.
[0444] Since the results presented in FIG. 1B may be interpreted to
suggest that the 3' sequence may influence the IFN-.alpha. inducing
activity of 5' triphosphate RNA, 31-mer (i.e., 31-nucleotide long)
5' triphosphate RNA oligonucleotides were generated in which the 3'
sequence (21 nucleotides) was either a poly G (tri-poly G), a poly
A (tri-poly A), a poly C (tri-poly C) or a poly U (tri-poly U)
homopolymer. The ten bases at the 5' end were identical for these
oligonucleotides. All four RNA oligonucleotides turned out to be
equally potent in terms of IFN-.alpha. induction in monocytes (FIG.
1D).
[0445] These results indicated that a minimal length is required
for the 5' triphosphate RNA to be recognized. Although these
results suggested that the 3' sequence of in vitro transcribed RNA
oligonucleotides had no strong impact on the IFN-.alpha.-inducing
activity, data with larger RNA molecules (FIG. 1B) pointed to a
possible influence of secondary structure formation.
[0446] Furthermore, these results indicated that a molecular
characteristic shared by all in vitro transcribed RNA molecules
rather than a specific sequence motif is responsible for
IFN-.alpha. induction in monocytes.
Example 2
The 5' Triphosphate Moiety of In Vitro Transcribed RNA is Required
for IFN-.alpha. Induction in Human Primary Monocytes
[0447] In general, for in vitro transcription of RNA, the
bacteriophage T7 DNA-dependent RNA polymerase is used. Unlike
synthetic RNA or eukaryotic mRNA, RNA generated by 17 RNA
polymerase contains an uncapped triphosphate group at the 5' end of
the RNA molecule. To study the sequence-independent contribution of
the 5' triphosphate, IFN-.alpha. induction by a synthetic and an in
vitro transcribed version of an immunostimulatory ssRNA
oligonucleotide 9.2s (is RNA9.2s, 19 nucleotides) was compared. is
RNA9.2s was identified as a potent stimulus for IFN-.alpha.
production in PDC in previous studies (V. Hornung et al., Nat Med
11, 263 (March, 2005)).
[0448] Only the in vitro transcribed version of is RNA9.2s, but not
synthetic is RNA9.2s, strongly induced IFN-.alpha. production in
monocytes (FIG. 2A upper panel). This difference in IFN-.alpha.
inducing activity was not due to different transfection efficiency
(FIG. 7). In contrast to monocytes, PDC produced IFN-.alpha. in
response to both in vitro transcribed and synthetic is RNA9.2s
(FIG. 2A lower panel).
[0449] Next, in vitro transcription was used to generate a dsRNA
oligonucleotide with an overhang of one nucleotide at the 5'
position. The two single-stranded oligonucleotides (tri-GFPs,
tri-GFPa) and the double-stranded oligonucleotide (tri-GFPds)
induced comparable levels of IFN-.alpha. in monocytes (FIG. 2B).
Cleavage of the 5' overhang (including the 5' triphosphate) of the
dsRNA (tri-GFPds) by RNAse T1, an endoribonuclease that
specifically degrades single-stranded RNA at G residues, completely
abolished the IFN-.alpha. inducing activity (FIG. 2B). Moreover,
when calf intestine alkaline phosphatase (CIAP) was used to
dephosphorylate the 5' end of the in vitro transcribed
single-stranded RNA oligonucleotides, a complete abrogation of the
IFN-.alpha. response was observed in monocytes (FIG. 2C). In
contrast, PDCs, which are known to detect single-stranded RNA
oligonucleotides via TLR7, showed no decrease in IFN-.alpha.
production when oligonucleotides were dephosphorylated (FIG.
2C).
[0450] Unlike the oligonucleotide with a guanosine-5'-triphosphate,
in vitro transcribed RNA generated to contain a
guanosine-5'-diphosphate, a guanosine-5'-monophosphate or a
guanosine-5'-hydroxyl did not induce IFN-.alpha. in monocytes (FIG.
8).
[0451] Together, these data indicated that the 5''triphosphate is
responsible for the IFN-.alpha. inducing activity of in vitro
transcribed RNA in monocytes, and that a 5' triphosphate confers
IFN-.alpha.-inducing activity to both ssRNA and dsRNA.
Example 3
7-Methyl-Guanosine Capping and Eukaryote-Specific Base
Modifications Abolish IFN-.alpha. Induction Via 5' Triphosphate
RNA
[0452] In eukaryotic cells, 7'methyl-guanosine is attached to the
5' triphosphate of a nascent mRNA transcript by a process called
capping. Capping improves the stability of eukaryotic RNA against
nucleases and enhances binding of ribosomal proteins to mRNA.
[0453] The influence of capping on the IFN-.alpha. inducing
activity of 5' triphosphate RNA was examined. Capped RNA can be
generated via in vitro transcription by including a synthetic cap
analog, N-7 methyl GpppG, in the in vitro transcription reaction.
Since both N-7 methyl GpppG and GTP (typically in a 4:1 mixture of
N-7 methyl GpppG:GTP) need to be present during in vitro
transcription and both are incorporated by 17 RNA polymerase,
approximately 80% of all transcripts are capped after in vitro
transcription. It was found that RNA of different lengths
transcribed in the presence of the synthetic cap analog, which
contained approximately 20% uncapped and 80% capped RNA, was much
less active at inducing IFN-.alpha. production in monocytes when
compared to uncapped in vitro transcribed RNA (100% uncapped) (FIG.
3A).
[0454] Besides 5' capping, eukaryotic RNA undergoes several other
posttranscriptional maturation steps including the modification of
various nucleosides of the RNA transcript and the methylation of
the backbone ribose at the 2'-hydroxyl position. In this respect,
it has been previously shown that the incorporation of nucleoside
modifications that are abundant in matured eukaryotic, but not in
prokaryotic or viral RNA can lead to the complete abrogation of a
RNA-triggered inflammatory response mediated via the TLR-system (K.
Kariko, et al. Immunity 23, 165 (August, 2005). To test whether
this phenomenon holds also true for 5' triphosphate RNA triggered
IFN-.alpha. response, RNA oligonucleotides were generated via in
vitro transcription with various NTPs substituted with the
respective nucleoside- or ribose-modified NTPs.
[0455] A significant decrease in IFN-.alpha. production was seen
when either pseudouridine (.psi.) or 2-thiouridine (s2U)
substituted for uridine (U) (FIG. 3B). Analogous results were
obtained when 2'-O-methylated UTP was incorporated into the 5'
triphosphate RNA oligonucleotides instead of UTP (FIG. 3C). In
accordance with these results, transfection of prokaryotic RNA that
lacks 5' caps and is low in the respective nucleoside and ribose
modifications resulted in a strong IFN-.alpha. response in
monocytes, whereas eukaryotic RNA was completely inactive in terms
of IFN-.alpha. induction (FIG. 9).
[0456] Lipopolysaccharide (LPS) alone or in combination with
synthetic RNA did not contribute to IFN-.alpha. production in
monocytes (FIG. 9).
[0457] Structural features like the presence of a two-nucleotide 3'
overhang in a 5' triphosphate RNA duplex, as it occurs in natural
cleavage products of the endonuclease dicer, did not interfere with
the immunostimulatory activity of the 5' triphosphate RNA
oligonucleotides (FIG. 10).
[0458] Altogether, these results indicated that posttranscriptional
modifications commonly found in mature eukaryotic RNA species
suppress the immunostimulatory activity of 5' triphosphate RNA
oligonucleotides, thereby providing molecular structures that can
be employed for the distinction of self and non-self RNA.
Example 4
IFN-.alpha. Induction by 5' Triphosphate RNA Oligonucleotides is
Independent of Endosomal Maturation
[0459] Among the family of TLRs, TLR3, TLR7, TLR8 and TLR9 are
known to detect nucleic acids. A number of studies suggest that
single-stranded RNA is recognized via TLR7 and TLR8, both located
in the endosomal membrane. Similar to CpG-DNA, recognition of
single-stranded RNA by TLR7/8 can be blocked by chloroquine, which
inhibits endosomal maturation. The present inventors found that in
PBMC, increasing concentrations of chloroquine inhibited
IFN-.alpha. induction by CpG-A but not by 5'triphosphate RNA (FIG.
12A); furthermore, chloroquine did not affect 5' triphosphate RNA
induced IFN-.alpha. production in isolated monocytes (FIG. 12B).
CpG-A is inactive in monocytes with and without chloroquine due to
the lack of TLR9 (FIG. 12B).
[0460] In analogy to the human system, murine bone marrow cells and
myeloid dendritic cells produced vast amounts of IFN-.alpha. upon
transfection with 5' triphosphate RNA. IFN-.alpha. and IP-10
induction in bone marrow-derived myeloid dendritic cells from
TLR7-/- mice (FIG. 12C) or LPS2-/- mice (data not shown) was
comparable to the level of IFN-.alpha. induction in wild type
mice.
[0461] Altogether these data suggested that the recognition of 5'
triphosphate RNA does not require endosomal maturation, and that
TLR3, TLR7/8 or TLR9 are not involved.
Example 5
Type I IFN Induction by Exogenous and Endogenous 5' Triphosphate
RNA Requires RIG-I but not MDA5
[0462] In previous studies we found that TLR7-mediated recognition
of synthetic immunostimulatory RNA requires complexation with a
cationic polymer which enables endosomal delivery and confers
protection against nuclease degradation, but not transfection of
RNA into the cytosol. In contrast to synthetic is RNA, 5'
triphosphate RNA induced IFN-.alpha. in monocytes only when
transfected into the cytosol by cationic lipids, whereas
complexation with cationic peptides was not sufficient (data not
shown). Consistent with these observations, 5' triphosphate RNA
mediated IFN-.alpha. induction required neither endosomal
maturation nor TLR7 (FIG. 11) or TLR3 (data not shown). These
results indicated that the receptor for 5' triphosphate RNA is
located in the cytosol and not in the endosomal compartment.
[0463] RIG-I and MDA-5 are cytoplasmic proteins involved in the
recognition of RNA viruses (H. Kato et al., Nature 441, 101 (Apr.
9, 2006)); both RIG-I and MDA-5 are thought to be involved in dsRNA
recognition. Although 5' triphosphate RNA in the present invention
was active as ssRNA, it remained to be determined whether RIG-I or
MDA-5 are involved in 5' triphosphate recognition.
[0464] In order to address the effect of dominant negative mutants
of RIG-I, HEK 293 cells expressing the reporter luciferase under
the control of the IFN-.beta. promoter were used instead of
monocytes. As expected, HEK 293 cells transiently transfected with
RIG-I did not respond to poly(I:C) or synthetic is RNA (RNA9.2s)
(FIG. 4A). However, unexpectedly, single-stranded 5' triphosphate
RNA (tri-GFPs and tri-GFPa) strongly activated reporter expression
in RIG-I expressing HEK 293 cells. Only HEK 293 cells expressing
full length RIG-I responded to 5''triphosphate RNA; HEK293 cells
expressing truncated RIG-I which lacked the N terminal CARD domain
or RIG-I 270KA mutant devoid of the ATPase activity did not.
[0465] To confirm that RIG-I was required for the recognition of 5'
triphosphate RNA, the activity of 5'' triphosphate RNA in RIG-I-/-
MEFs was tested. Whereas wild type MEFs produced large amounts of
IFN-.beta. (FIG. 4B) and IL-6 (data not shown) in response to 5'
triphosphate RNA stimulation, no response was detected in RIG-I-/-
MEFs (FIG. 4B). The response to 5' triphosphate RNA in MDA-5-/-
MEFs was similar to wild type MEFs.
[0466] Together, these data provided evidence that RIG-I, but not
MDA-5, is required for the recognition of 5' triphosphate RNA and
that the recognition of 5' triphosphate RNA is not confined to
immune cells such as primary monocytes.
[0467] It is hypothesized that since 5' triphosphate RNA is
recognized via RIG-I, the formation of endogenous 5' triphosphate
RNA via cytoplasmic overexpression of T7 RNA polymerase should
trigger the type I IFN pathway. To test this hypothesis, a system,
which has been extensively used to generate recombinant negative
strand RNA viruses (NSV) from in vivo transcribed cDNA in the
context of reverse genetics approaches (F. Radecke et at, Embo J
14, 5773 (Dec. 1, 1995)), was employed. This system allows
template-dependent direct transcription of RNA inside a cell via
cytosolically expressed T7 RNA polymerase.
[0468] Indeed, coexpression of wild type RIG-I and wild type T7 RNA
polymerase, in the absence of exogenously added 5' triphosphate
RNA, strongly induced a type I IFN response (FIG. 4C). No type I
IFN response was detected when a combination of wild type RIG-I and
a mutated form of T7 RNA polymerase (T7 D812N) or a combination of
mutant RIG-I (RIG-IC) and wild type T7 RNA polymerase was
expressed.
[0469] At high levels of expression, a template-independent, T7 RNA
polymerase-mediated type I IFN induction was seen (FIG. 4C: no
template and X8dT); the presence of a T7 RNA polymerase
promoter-containing template was able to enhance the transcription
dependent type I IFN induction (FIG. 4C: pBKS). When T7 RNA
polymerase was expressed at lower levels, a complete
template-dependent type I IFN induction could be seen (FIG. 4D; 100
ng T7 RNA polymerase).
[0470] These results demonstrated that not only exogenously added
but also endogenously generated 5'' triphosphate RNA is recognized
via RIG-I, and confirmed that contaminants in the exogenously added
5' triphosphate RNA preparations are not involved in the induction
of type I IFN.
Example 6
RIG-I Directly Detects Genomic Triphosphate RNA from a Mammalian
Negative Strand RNA Virus
[0471] Characteristically, all NSV initiate viral RNA replication
in a primer-independent manner, resulting in the presence of a
triphosphate moiety at the 5' end of the viral genome (vRNA) or
antigenome (cRNA). Moreover, in case of NSV with a nonsegmented
genome (Order Mononegavirales), including for example the
Paramyxoviruses and Rhabdoviruses, RNA transcription yields
abundant amounts of short (approximately 60 nt) 5' triphosphate
RNAs, known as leader RNAs, which are templated by the 3' end of
vRNA (S. P. Whelan, et al. Current topics in microbiology and
immunology 283, 61 (2004)). To assess the importance of NSV 5'
triphosphate RNAs in the recognition of virus infection by RIG-I,
rabies virus (RV), a prototype Rhabdovirus, was used.
[0472] Wildtype RV (SAD L16) encodes a potent antagonist of IFN
induction, the phosphoprotein P, and therefore does not induce
considerable IFN expression upon infection of epithelial cells. In
contrast, a RV mutant genetically engineered to express little P
(SAD .DELTA.PLP) is an efficient inducer of IFN (K. Brzozka, et al.
Journal of virology 79, 7673 (June, 2005); K. Brzozka, et al.
Journal of virology 80, 2675 (March, 2006)). To confirm that RIG-I
is involved in the recognition of RV infection, Vero cells were
infected with the IFN-inducing RV, SAD .DELTA.PLP, in the absence
or presence of transfected RIG-I or RIG-IC (a dominant negative
truncation mutant of RIG-I). SAD .DELTA.PLP infection triggered a
potent IFN-response which could be further enhanced by the
overexpression of RIG-I and strongly suppressed by RIG-IC (FIG.
5A).
[0473] These results indicated that RIG-I is required for the
initiation of an IFN-response upon RV infection, as has been
observed for other NSV, VSV and Flu (H. Kato et al., Nature 441,
101 (Apr. 9, 2006)).
[0474] To address whether RV RNA itself or viral replication is
recognized via RIG-I, RNA was isolated from RV infected BSR cells
and subsequently transfected into HEK 293T cells. RNA from
RV-infected cells, but not RNA from non-infected cells, induced a
potent IFN-.beta. response (FIG. 5B). Moreover, the observed
IFN-.beta. production was completely abrogated the isolated RNA was
dephosphorylated by CIAP prior to transfection (FIG. 5B),
indicating that the 5' triphosphate group was required for
recognition.
[0475] The RNA of NSV and of NSV-infected cells is not considered
infectious and does not allow the initiation of a replicative
cycle. The fact that RNA from RV SAD L16-infected cells was equally
potent in terms of IFN-.beta. induction as RNA from RV SAD
.DELTA.PLP-infected cells indicated that little or no productive
translation and replication was initiated via the transfection of
the respective RNA isolates.
[0476] Nevertheless, to completely rule out that replication of RV
was required to trigger a type I IFN response, full-length RNA from
virions was isolated and assessed for its capability of inducing
type I IFN expression. Transfection of 200 ng of purified RV RNA
effectively stimulated type I IFN induction in HEK 293T cells and
dephosphorylation of the genomic RV RNA completely abrogated the
IFN response. An in vitro transcribed ssRNA corresponding to the
58-nucleotide long RV leader RNA confirmed recognition of and
potent type I IFN induction by viral ssRNA.
[0477] Altogether, these results demonstrated that RIG-I directly
recognizes genomic RNA from RV independent of replication and that
this recognition is abolished if the 5' end of the RNA is
dephosphorylated.
Example 7
5' Triphosphate RNA Directly Binds to Rig-I
[0478] The fact that RIG-I is required for the recognition of 5'
triphosphate RNA provides no evidence that RIG-I is the receptor
for 5' triphosphate RNA. To identify the receptor for 5'
triphosphate RNA, in vitro binding assays was carried out to test
the ability of 5' triphosphate RNA to pull down RIG-I or RIG-IC,
the RNA binding domain of RIG-I.
[0479] RNA oligonucleotides with 3' terminal biotin tags were
generated and incubated with whole cell lysate from HEK 293 cells
overexpressing full length RIG-I, RIG-I CARD2 (the second CARD of
RIG-I) or RIG-I .DELTA. Helicase_C (RIG-I devoid of the predicted
helicase superfamily c-terminal domain). Subsequently streptavidin
beads were used to pull down the biotin tags on the 5' triphosphate
RNA oligonucleotides.
[0480] Whereas the biotinylated 5' triphosphate oligonucleotide
(tri-G-AC-U-Bio) was able to immunoprecipitate full length RIG-I
(FIG. 6A, third panel, middle part), it was not very effective at
pulling down truncated versions of RIG-I, CARD2 and RIG-I .DELTA.
Helicase_C (FIG. 6A, third panel left an right part).
Unbiotinylated control RNA oligonucleotide (tri-G-AC-U) did not
immunoprecipitate RIG-I. Purified RIG-IC was also efficiently
pulled down by 5' triphosphate RNA oligonucleotides (FIG. 6B,
second lane). If the initial 5' triphosphate group of the RNA
oligonucleotide was enzymatically removed prior to incubation with
RIG-I, no co-precipitation was seen (FIG. 6B, fourth lane).
[0481] These results indicated that 5''triphosphate RNA directly
binds to full length RIG-I or RIG-IC, i.e., RIG-I is the direct
receptor responsible for the recognition of 5' triphosphate
RNA.
Example 8
5' Adenosine Triphosphate RNA Oligonucleotides are Superior to 5'
Guanosine Triphosphate RNA Oligonucleotides in Inducing IFN-.alpha.
Production
[0482] The classical in vitro transcription system makes use of the
T7 RNA polymerase consensus promoter (J. J. Dunn, F. W. Studier, J
Mol Biol 166, 477 (Jun. 5, 1983)). Transcription under this
promoter is initiated by GTP and usually requires two or more
consecutive guanosines at the 5' end of RNA for efficient
transcription. Nevertheless, it is possible to use a promoter
system for T7 RNA polymerase which initiates with a 5' ATP (F.
Huang et al. Biochemistry 39, 15548 (Dec. 19, 2000)). Using this
system, the role of the initial 5' guanosine in the type I-IFN
inducing activity of 5' triphosphate RNA oligonucleotides was
assessed. RNA9.2s (RNA9.2s-0A) was used as a reference
oligonucleotide since it starts with a 5' adenosine.
[0483] Comparing RNA9.2s-0A (5' ATP) with RNA9.2s-1G (5' GTP),
which is shifted one base downstream of the corresponding human
TLR9 mRNA, the latter showed a reduction of approximately 25% in
IFN-.alpha. induction (FIG. 12, upper panel). Four bases further
downstream of the human TLR9 mRNA, another 19-mer oligonucleotide
could be transcribed which initiated with a 5' adenosine
(RNA9.2s-5A). RNA9.2s-5A paralleled RNA9.2-0A in terms of
IFN-.alpha. induction.
[0484] A second set of experiments corroborated these findings:
comparison of the in vitro transcribed 35-mer RNA oligonucleotide
A.PHI.6.5-35n (5' ATP) with G.PHI.6.5-35n (5' GTP) revealed a clear
superiority of the transcript initiated with an adenosine in
inducing type I IFN, even though these oligonucleotides share more
than 97% homology in sequence (FIG. 12, lower panel).
[0485] Together, these findings indicated that RNA transcripts
initiated with a 5' adenosine are more potent in terms of
IFN-.alpha. induction than those initiated with a 5' guanosine.
Further data demonstrate that of all four possible bases at the 5'
end, the highest IFN-.alpha.-inducing activity was seen when A was
at the 5' end, followed by C, U and G (FIG. 25).
Example 9
The IFN-.alpha.-Inducing Activity of Adenosine-Initiated
5'-Triphosphate RNA Oligonucleotide Depends on its 5' Nucleotide
Sequence
[0486] Adenosine-initiated triphosphate RNA oligonucleotides with
all possible base permutations (A, C, G and U) of the 2nd, 3rd and
4th position of the sequence (5'->3') (Table 2) were generated
via in vitro transcription. Subsequently monocytes from three
independent donors were isolated and transfected with the
respective RNA oligonucleotides. 36 hours after transfection,
supernatants were analyzed for IFN-.alpha. production. The obtained
IFN-.alpha. induction levels of all oligonucleotides were
normalized to the mean induction level of all oligonucleotides
(=100%). The obtained normalized induction levels of all three
donors were summarized as mean values.+-.SEM (FIG. 13).
[0487] It is clear from FIG. 13 that adenosine-initiated, in vitro
transcribed RNA oligonucleotides having identical 3' sequence but
different nucleotides at the 2nd, 3rd and 4th positions have
different levels of IFN-.alpha.-inducing activity. The 5'
4-nucleotide sequences which confer the highest
IFN-.alpha.-inducing activity include AAGU, AAAG, AUGG, AUUA, AACG,
AUGA, AGUU, AUUG, AACA, AGAA, AGCA, AACU, AUCG; AGGA, AUCA, AUGC,
AGUA, AAGC, AACC, AGGU, AAAC, AUGU, ACUG, ACGA, ACAG, AAGG, ACAU,
ACGC, AAAU, ACGG, AUUC, AGUG, ACAA, AUCC, AGUC.
TABLE-US-00005 TABLE 2 All Oligos share the same sequence except
the 2nd, 3rd and 4th position (5'-
ANNNGGGGACACACACACACACACACACAC-3') IFN-.alpha. induction (*100%)
SEQ ID No. Sequence mean SEM 111 AGGG 0.22 0.05 112 AAUA 0.40 0.07
113 AGAU 0.48 0.04 114 AGAG 0.50 0.06 115 AGCG 0.52 0.01 116 AGAC
0.62 0.10 117 ACUA 0.62 0.05 118 ACUU 0.66 0.01 119 AAUU 0.67 0.03
120 AGCU 0.69 0.01 121 AAAA 0.73 0.09 122 ACCG 0.73 0.03 123 AUAG
0.76 0.07 124 ACCU 0.76 0.01 125 ACGU 0.77 0.02 126 ACCA 0.79 0.01
127 AUAA 0.82 0.13 128 AGCC 0.87 0.04 129 AUAU 0.89 0.03 130 ACCC
0.89 0.01 131 AGGC 0.91 0.02 132 AAUC 0.94 0.05 133 AUCU 0.94 0.03
134 AAGA 0.95 0.19 135 ACAC 0.95 0.08 136 AAUG 0.96 0.07 137 ACUC
0.98 0.04 138 AUUU 0.99 0.06 139 AUAC 0.99 0.07 140 AGUC 1.00 0.08
141 AUCC 1.01 0.07 142 ACAA 1.01 0.08 143 AGUG 1.01 0.12 144 AUUC
1.03 0.07 145 ACGG 1.03 0.05 146 AAAU 1.04 0.19 147 ACGC 1.08 0.07
148 ACAU 1.11 0.09 149 AAGG 1.11 0.22 150 ACAG 1.12 0.01 151 ACGA
1.14 0.02 152 ACUG 1.14 0.08 153 AUGU 1.15 0.17 154 AAAC 1.15 0.09
155 AGGU 1.18 0.11 156 AACC 1.20 0.19 157 AAGC 1.22 0.13 158 AGUA
1.22 0.12 159 AUGC 1.23 0.10 160 AUCA 1.24 0.09 161 AGGA 1.27 0.05
162 AUCG 1.28 0.12 163 AACU 1.29 0.13 164 AGCA 1.29 0.15 165 AGAA
1.29 0.14 166 AACA 1.30 0.19 167 AUUG 1.31 0.11 168 AGUU 1.32 0.15
169 AUGA 1.32 0.01 170 AACG 1.34 0.15 171 AUUA 1.36 0.03 172 AUGG
1.38 0.10 173 AAAG 1.40 0.15 174 AAGU 1.40 0.10
Example 10
The Ifn-.alpha.-Inducing Activity of Bacterial RNA is Only
Partially Dependent On the Presence of 5' Triphosphate
[0488] As shown in FIG. 9, total bacterial RNA is capable of
inducing IFN-.alpha. production from monocytes.
[0489] To determine whether the IFN-.alpha.-inducing activity of
bacterial RNA is due to the presence of the 5' triphosphate, total
RNA was isolated from E. coli bacteria strain DH10B, either treated
or not treated with CIAP to dephosphorylate the 5' end, and
subsequently transfected into purified monocytes (200 ng of RNA).
IFN-.alpha. production was analyzed 24 hours after stimulation.
[0490] As controls, Tri-GFPa was prepared via in vitro
transcription, either treated or not treated with CIAP to
dephosphorylate the 5' end, and subsequently transfected into
purified monocytes (200 ng of RNA). IFN-.alpha. production was
analyzed 24 hours after stimulation.
[0491] As previously shown in Example 2 and FIG. 2C, the removal of
5' triphosphate from in vitro transcribed RNA oligonucleotides
almost completely abolish the ability of the oligonucleotides to
induce IFN-.alpha. from monocytes (FIG. 14B). In contrast, the
removal of 5' triphosphate from total bacterial RNA reduced the
amount of IFN-.alpha. induced from monocytes by less than 30% (FIG.
14A).
[0492] Therefore, 5' triphosphate is only one of the molecular
features which are responsible for the ability of bacterial RNA to
induce IFN-.alpha..
Example 11
Combining Potent Immunostimulatory Functions with Efficient
Gene-Silencing Activity in One RNA Molecule
[0493] We identified several sequences targeting murine Bcl-2 and
subsequently generated three synthetic siRNAs (anti-Bcl-2.1,
anti-Bcl-2.2, anti-Bcl-2.3) targeting different portions of murine
Bcl-2 mRNA (for a detailed list of all chemically synthesized RNA
oligonucleotides see Table 3).
TABLE-US-00006 TABLE 3 Chemically synthesized RNA Sequences SEQ ID
No. Name Type Sequence 5'.fwdarw.3 103 Murine Bcl-2 RNA
AUGCCUUUGUGGAACUAUA 2.1 sense 104 Murine Bcl-2 RNA
UAUAGUUCCACAAAGGCAU 2.1 antisense 105 Murine Bcl-2 RNA
GCAUGCGACCUCUGUUUGA 2.2 sense 106 Murine Bcl-2 RNA
UCAAACAGAGGUCGCAUGC 2.2 Anti-sense 107 Murine Bcl-2 RNA
GGAUGACUGAGUACCUGAA 2.3 sense 108 Murine Bcl-2 RNA
UUCAGGUACUCAGUCAUCC 2.3 Anti-sense 109 Poly-A RNA
AAAAAAAAAAAAAAAAAAA 175 Murine RIG-I RNA GAAGCGUCUUCUAAUAAUU Sense
176 Murine RIG-I RNA AAUUAUUAGAAGACGCUUC Anti-sense 177 Control RNA
UUCUCCGAACGUGUCACGU Sense 178 Control RNA ACGUGACACGUUCGGAGAA
Antisense
[0494] After transfection of the different anti-Bcl-2-siRNAs and a
control siRNA in B16 melanoma cells, we determined downregulation
of Bcl-2 by western blotting of the cell lysates (FIG. 15a, upper
panel). Different siRNAs displayed different efficiencies in target
downregulation. Treatment of B16 melanoma cells with a single dose
of anti-Bcl-2.2 (now termed OH-2.2) resulted in an efficient
downregulation of Bcl-2 expression 48 h after transfection compared
to the control siRNA (FIG. 15a, upper panel). This specific
reduction of Bcl-2 was already observed after 18 h, lasted for at
least 72 h and was confirmed by FACS analysis of intracellular
Bcl-2 (data not shown).
[0495] Subsequently, anti-Bcl-2.2 was in vitro transcribed thus
bearing 5' triphosphates (now termed 3p-2.2; for a detailed list of
all in vitro transcription templates see Table 4).
TABLE-US-00007 TABLE 4 DNA templates for in vitro transcription SEQ
ID No. Name Type Sequence 5'.fwdarw.3 68 Murine DNA
TCAAACAGAGGTCGCATGCCTATAGTGAGTCG Bcl-2 2.2 sense 69 Murine DNA
GCATGCGACCTCTGTTTGACTATAGTGAGTCG Bcl-2 2.2 Anti- sense 70 GA DNA
TTTTTTTTTTTTCCCCCCCCCCCTATAGTGAGTCG 179 GC DNA
GGCGCCCCGCCGCGCCCCGCTATAGTGAGTCG sense 180 GC DNA
GCGGGGCGCGGCGGGGCGCCTATAGTGAGTCG Anti- sense
[0496] 3p-2.2 was tested for its ability to reduce Bcl-2 expression
(FIG. 15a). Transfection of B16 cells with 3p-2.2 siRNA also
resulted in an efficient downregulation of Bcl-2. Importantly, this
specific reduction of Bcl-2 was not observed with a nonspecific
3p-siRNA (3p-GC) or a synthetic control siRNA.
[0497] Using an anti-RIG-I antibody, we next determined the
expression of endogenous RIG-I in B16 cells before and after
stimulation by western blot (FIG. 15b). Interestingly, RIG-I
-expressionin B16 cells was strongly upregulated by exogenous
IFN-.beta. (1000 U/ml), and to a similar extend by 3p-2.2
siRNA.
[0498] To investigate the immunostimulatory potential of
transfected 3p-2.2 in B16 cells, we monitored IFN-.beta. promoter
activation (FIG. 15c). Surprisingly, stimulation of B16 cells with
3p-2.2, but not poly(I:C) or OH-2.2, significantly enhanced the
induction of a reporter gene (Renilla luciferase) driven by the
IFN-.beta. promoter (pIFNI.beta.-luc; *P<0.05 between 3p-2.2,
OH-2.2 and poly(I:C)).
[0499] This prompted us to further evaluate the contribution of
RIG-I and its CARD-containing adaptor protein, Cardif (Kawai T et
al. (2005) Nat. Immunol. 6(10): 981-988; Meylan E et al (2005)
Nature 437(7062): 1167-72; Seth R et al. (2005) Cell 122(5):
669-82; Xu L et al. (2005) Mol Cell 19(6): 727-40) in B16
cells.
[0500] A synthetic siRNA targeting mouse RIG-I (see Table 3)
significantly reduced the 3p-2.2-dependent IFN-.beta. promoter
activation (FIG. 15d;*P<0.05 between control siRNA (siCO)+3p-2.2
and RIG-I siRNA (siRIG-1)+3p-2.2), demonstrating a clear role for
RIG-I in 3p-2.2-induced signaling.
[0501] NS3-4A is a multifunctional serine protease of hepatitis C
virus (HCV) which is capable of specifically cleaving and thereby
inactivating Cardif (Chen Z et al. (2007) J. Virol. 81(2):964-76;
Meylan E et al (2005) Nature 437(7062):1167-72). Expression of
NS3-4A in B16 cells greatly reduced IFN-.beta. promoter activation
by 3p-2.2, whereas expression of the inactive form NS3-4A* had no
effect on IFN-.beta. promoter activation (FIG. 15e; *P<0.05,
NS3-4A*+3p-2.2 versus NS3-4A+3p-2.2).
[0502] Taken together, these results indicate that B16 cells
upregulate RIG-I upon stimulation with 3p-2.2 and that RIG-I and
Cardif are essential for 3p-2.2-induced immunostimulation in B16
melanoma cells. Additionally, we demonstrate that 3p-2.2 induces
efficient gene-silencing of Bcl-2 in murine melanoma cells.
Example 12
Transfection of 3P-2.2 Directly Triggers Cardif-Independent
Apoptosis in Tumor Cells, but not in Primary Cells
[0503] After extended exposure to 3p-RNA, microscopic evaluation of
B16 cells revealed reduced cell numbers compared to B16 cells which
were transfected with control siRNA or OH-2.2. We hypothesized that
an increased cell death by transfection of 3p-2.2 contributed to
the reduction of viable B16 cells.
[0504] To delineate the mechanisms responsible for the observed
cell death, B16 cells were analyzed for an apoptotic phenotype by
Annexin-V and propidium iodide staining. 24 h after transfection, a
significant increase in the number of apoptotic cells was observed
with 3p-2.2 (14%) compared to the control siRNA (1.06%) (FIG. 16a).
In all experiments performed, approximately 15% (15.62%.+-.1.01;
mean %.+-.SEM) of B16 cells treated with 3p-2.2 were positive for
Annexin-V; the number of apoptotic cells was approximately 4-fold
lower in cells treated with control siRNAs (FIG. 16b;
2.93%.+-.1.12). Treatment with OH-2.2 also increased the number of
apoptotic cells (5.63%.+-.0.66), however to a significantly less
extent than 3p-2.2 (FIG. 16b).
[0505] Similar experiments were carried out using
non-target-specific 3p-RNA in B16 as well as other melanoma cell
lines and similar results were obtained, indicating that 3p-RNA
induces cell death independently of siRNA-mediated gene-silencing
(data not shown).
[0506] To identify intracellular pathways relevant for the observed
cell death, we first expressed NS3-4A and the inactive form NS3-4A*
in B16 cells and analyzed for apoptosis by Annexin-V and propidium
iodide staining (FIG. 16c). In these experiments, no change in
apoptosis was observed after additional transfection of 3p-2.2
(8.3%.+-.0.5 with the inactive form and 7.3%.+-.0.67 with the
active form), indicating that 3p-RNA induced apoptosis is
Cardif-independent.
[0507] Recent studies further reported that RIG-1-dependent viruses
and in vitro transcribed RNAs activate Caspase-1, an important
component of the inflammasome (Kanneganti T D et al. (2006) Nature
440(7081):233-6.). Caspase-1 has also been suggested to be involved
in apoptotic processes (Cuesta N (2007) J. Immunol. 178(6):3602-11;
Henry T et al. 2007 J Exp Med 204(5):987-94). We therefore analysed
Caspase-1 activation in B16 cells using western blot. In these
experiments, an increased cleavage of procaspase-1 to active
subunit p10 was observed when cells were transfected with 3p-2.2
and poly(I:C) (FIG. 16d). However, using two functional siRNAs
targeting Caspase-1. we were not able to detect any change in
apoptosis (data not shown), suggesting that Caspase-1 is not
involved in 3p-2.2-mediated apoptosis.
[0508] We then addressed the question whether 3p-2.2-mediated cell
death is restricted to tumor cells. Human primary cells, PBMCs,
were analyzed for apoptosis by Annexin-V and propidium iodid
staining after stimulation with 3p-2.2, control siRNA and OH-2.2.
Interestingly, no induction of apoptosis by 3p-2.2 was observed in
human PBMCs (FIG. 16d). Furthermore, staining of human fibroblasts
and human keratinocytes with Annexin-V revealed no increase in cell
death after transfection with 3p-2.2 (data not shown). Taken
together, these results indicate that 3p-2.2 induces apoptosis in
melanoma cells and but not in primary cells.
Example 13
IFN-.alpha. Production by 3p-2.2 Requires TLR7 in pDCs and RIG-I in
cDCs
[0509] Recent studies demonstrated that the induction of both
IFN-.alpha. and IFN-.beta. in conventional DCs (cDCs) upon exposure
to several RNA viruses, including Newcastle disease virus (NDV),
Sendai virus (SeV) and vesicular stomatitis virus (VSV), is
regulated by RIG-I (Kato H et al. (2005) Immunity 23(1): 19-28). In
contrast, plasmacytoid DCs (pDCs) preferentially use TLR7, but not
RIG-I, for the recognition of viruses such as NDV, leading to the
induction of Type I IFNs.
[0510] We examined the IFN response of wild-type, RIG-1-, TLR7-,
and MDA5-deficient cDCs after stimulation with 3p-2.2 by ELISA
(FIG. 17a, b, c). As expected, IFN-.alpha. production by
3p-2.2-stimulated cDCs from RIG-1-deficient mice was completely
abrogated (FIG. 17a). IFN-.alpha. production by 3p-2.2-stimulated
cDCs from MDA5-deficient (FIG. 17b; Wild-type versus MDA5.sup.-/-:
2509.+-.96 versus 2333.+-.178; .mu.g/ml.+-.SEM) and TLR7-deficient
(FIG. 17c; Wild-type versus TLR7''.sup.-/-; 771.+-.324 versus
881.+-.355; U/ml.+-.SEM) mice was largely normal. These results
indicate that the induction of IFN-.alpha. by 3p-2.2 is regulated
by RIG-I in cDCs.
[0511] We then purified pDCs from Flt3-L-induced BM-derived DCs
(Flt3-L-DCs) of wild-type and TLR7-deficient mice using magnetic
beads and tested for IFN-.alpha. secretion. Wild-type pDCs produced
IFN-.alpha. in response to 3p-2.2 (FIG. 17d). In contrast,
TLR7-deficient pDCs showed impaired IFN-.alpha. production in
response to 3p-2.2 (FIG. 17d).
[0512] We also observed IFN-.alpha. induction in peritoneal
macrophages (data not shown).
[0513] Next, we examined the sensitivity of different purified
immune cell subsets to 3p-2.2. Compared to cDCs and pDCs, B cells,
NK cells and CD8 T cells responded weakly to stimulation with
3p-2.2 by low IFN-.alpha.-production (cDCs 2357.+-.437; pDCs
3036.+-.354; NK cells 94.+-.2.07, B cells and CD8 T cells 0;
U/ml.+-.SEM).
[0514] These observations indicate that cDCs and pDCs mainly
exploit RIG-I and the TLR system to recognize 3p-2.2. However,
cells of the adaptive immune system do not respond to 3p-RNA in any
significant degree by IFN-.alpha. production.
Example 14
Complexed 3p-2.2 Leads to Systemic Immune Activation In Vivo
[0515] To gain insights into the biological relevance of
3p-2.2-mediated responses in vivo, we challenged mice with 3p-2.2
complexed to jetPEI.TM. and measured serum cytokines including
IFN-.alpha., IL-12p40 and IFN-.gamma. (FIG. 18a, b, c). After 6 h,
3p-2.2 induced significantly higher levels of IFN-.alpha. than CpG
1826 or OH-2.2 (FIG. 18a; P**<0.01 between 3p-2.2 and OH-2.2,
CpG 1826, jetPEI.TM. and PBS). Both 3p-2.2 and OH-2.2 induced
significant IL-12p40 production (FIG. 18b; P**<0.01 between
3p-2.2 and jetPEI.TM. and PBS). Furthermore, 3p-2.2 induced high
level of IFN-.gamma. production in vivo (FIG. 18c; P**<0.01
between 3p-2.2 and OH-2.2; P'<0.05 between 3p-2.2 and jetPEI.TM.
and PBS).
[0516] We next examined serum cytokine levels in TLR7-deficient
mice after administration of 3p-2.2. Production of IFN-.alpha.
(FIG. 18d), IL-12p40 (FIG. 18e), and IFN-.gamma. (FIG. 18f) was
only partly decreased in TLR7-deficient mice after transfection
with 3p-2.2 in comparison to wild-type mice (IFN-.alpha.: Wild-type
versus TLR7.sup.-/-, 885.+-.89 versus 406.+-.181; IL-12p40:
5635.+-.1662 versus 2609.+-.973; IFN-.gamma.: 1881.+-.259 versus
1599.+-.259). In contrast, production of IFN-.alpha., IL-12p40 and
IFN-.gamma. was severely impaired in TLR7-deficient mice after
stimulation with OH-2.2 (IFN-.alpha.: Wild-type versus
TLR7.sup.-/-, 207.+-.100 versus 0; IL-12p40: 1444.+-.19 versus
553.+-.147; IFN-.gamma.: 926.+-.30 versus 107.+-.35). Additionally,
intravenous administration of 3p-2.2 in wild-type mice enhanced
production of serum cytokines in a dose-dependent way (FIG.
19a).
[0517] To further characterize the immunostimulatory potential of
3p-2.2 in vivo, we sacrificed wild-type mice 48 h after injection
of 3p-2.2, isolated the spleen cells and analyzed surface
expression of costimulatory molecules on distinct immune cell
subsets by flow cytometry. As shown in FIGS. 19b and 19c, 3p-2.2
not only activated myeloid and plasmacytoid dendritic cells as
reflected by increased CD69 and CD86 expression in a dose-dependent
manner, but also upregulated CD69 expression on NK cells, CD4+ and
CD8+ T cells in vivo.
[0518] We then examined the time-course of IFN-.alpha. production
induced by 3p-2.2 and OH-2.2 in vivo. Consistent with our previous
in vivo data, 3p-2.2 induced higher amounts of IFN-.alpha. than its
synthetic counterpart OH-2.2. 48 hours after stimulation, the
cytokine profiles after administration of 3p-2.2 or OH-2.2
reflected moderate leukopenia (FIG. 20b) and thrombocytopenia (FIG.
20c). Thrombocytopenia was more apparent in CpG-treated mice than
in mice treated with 3p-2.2 (P**<0.01 between the platelet count
of 3p-2.2 and CpG).
[0519] Collectively, these observations indicate that 3p-2.2
potently activates distinct immune cell subsets and enhances the
production of serum cytokines in a dose-dependent and
TLR7-independent manner in vivo.
Example 15
Delivery of Encapsulated 3p-2.2 Results in Reduction of
Experimentally Induced B16 Melanoma Lung Metastases
[0520] We evaluated the anti-tumor activity of 3p-2.2 against B16
melanoma lung metastases in vivo. Groups of five mice were first
challenged intravenously with B16 melanoma cells and subsequently
treated with PolyA, OH-2.2, 3p-GC or 3p-2.2 according to the
schedule depicted in FIG. 21a. PolyA (a nonstimulatory 19-mer RNA
molecule; Table 3) complexed to jetPEI.TM. served as the negative
control. CpG 1826 complexed to jetPEI.TM. served as the positive
control. On day 14, mice were sacrificed, and lungs were excised.
Then lung metastases were counted using a dissecting microscope or,
in case of massive tumor burden, weighed to determine tumor
mass.
[0521] Mice treated with OH-2.2 showed a non-significant reduction
of lung metastases compared with the PolyA-treated control group
(FIG. 21b). Importantly, treatment with 3p-2.2 led to reduction of
lung metastases in a significant percentage of mice compared to the
OH-2,2- and PolyA-treated groups (P**<0.01 between 3p-2.2 and
PolyA, OH-2.2). As expected, CpG 1826 was able to promote a
significant reduction of lung metastases, but to a lesser extent
than 3p-2.2. Interestingly, the administration of 3p-GC, a
non-specific double-stranded 5''-triphosphate RNA not containing
any uridines (see Table 4), also reduced lung metastasis, but to a
significantly lower extent than 3p-2.2 (P**<0.01 between 3p-2.2
and 3p-GC).
[0522] These data suggested that besides immunostimulation, 3p-2.2
mediates direct anti-tumor activity in vivo.
[0523] Recently, it has been shown that intraperitoneal application
of PEI-complexed siRNAs leads to favored uptake in tumor cells
which have been implanted away from the site of injection (Aigner A
et al. (2006) J Biomed Biotechnol 2006(4):71659; Grzelinski M et
al. (2006) Hum Gene Ther. 17(7):751-66; Urban-Klein B et al. (2005)
Gene Ther. 2005 March,12(5):461-6)
[0524] We sought to examine the cellular uptake of
jetPEI.TM.-complexed siRNA after intravenous administration by
confocal microscopy. B16 cells were intravenously injected into
C57BL/6 mice and 14 days after tumor inoculation, a single dose of
FITC-labeled siRNA (100 .mu.g) was injected retroorbitally. After 6
h, the mice were sacrificed and various tissues including lungs
were excised. As expected, in the case of noncomplexed siRNAs, no
uptake was observed in lungs of healthy mice or in mice with lung
metastases, indicating rapid and complete degradation of the
FITC-labeled siRNA (FIG. 21c, upper panel, -PEI). In contrast, upon
PEI complexation, intact siRNA was detected in high amounts in
several tissues including liver and spleen (data not shown).
Considerable amounts of FITC-labeled siRNA were detected in lungs
of healthy mice, but to a lower extent in lung metastases of
diseased mice (FIG. 21c, lower panel, +PEI).
[0525] Taken together, B16 melanoma metastases were significantly
reduced in all mice receiving 3p-2.2, but not in OH-2.2-treated
mice. Furthermore, direct uptake of FITC-labeled siRNA in the tumor
cells in vivo points to direct anti-tumor effects of 3p-2.2 aside
from immunostimulation.
Example 16
Mechanisms Responsible for Reduction of B16 Melanoma Metastasis by
3p-2.2
[0526] To further investigate the mechanisms responsible for
reduction of B16 melanoma metastases in vivo, we challenged
wild-type, TLR7- and IFNAR (type I IFN receptor)-deficient mice
intravenously with B16 cells and treated these mice with PolyA,
3p-2.2 or poly(I:C). Reduction of B16 melanoma metastases by 3p-2.2
was observed in TLR7-deficient mice to an extend comparable to the
control wild-type mice (FIG. 22a, b). In contrast, the anti-tumor
activity of 3p-2.2 was diminished in IFNAR-deficient mice (FIG.
22c), suggesting a significant involvement of Type I-IFNs in
3p-2.2-mediated anti-tumor response.
[0527] Next, we examined the role of NK cells and CD8 T cells in
3p-2.2-induced anti-tumor response. 3p-2.2-mediated reduction of
metastases was abrogated when NK cells were depleted using
TM.beta.1-mAb (FIG. 22d). Thus, 3p-2.2-mediated tumor suppression
largely relies on the effector NK cells. In contrast, number of
lung metastases was not significantly changed by the treatment of
mice with anti-CD8 mAb (RmCD8-2 mAb), suggesting that CD8+ T
cell-mediated tumor suppression is minimal in this model.
[0528] To assess direct anti-tumor activity of 3p-2.2 in vivo, we
analyzed Bcl-2 expression in lung metastases of IFNAR-deficient
mice by FACS analysis and performed TUNEL stains in lungs of mice
that have been treated with 3p-2.2, CpG and PolyA. As seen in FIG.
22e, treatment with 3p-2.2, but not poly(I:C), resulted in a
non-significant downregulation of Bcl-2 expression in B16 melanoma
metastases. In addition, 3p-2.2, but not PolyA, and to a lesser
extent CpG, led to considerable amount of apoptosis among tumor
cells (FIG. 23).
[0529] Taken together, these observations indicate that 3p-2.2
reduces lung metastases in a NK cell-dependent and IFNAR-dependent
manner. Furthermore, the 3p-2.2-induced downregulation of Bcl-2 and
the increase of apoptotic tumor cells in lung metastases also point
to direct anti-tumor effects of 3p-2.2 in vivo.
Example 17
Inhibition of HBV Replication by Rig-I Stimulation with
5'-Triphosphated RNAs In Vitro and In Vivo
[0530] Here we show that 3p-siRNAs of 24 nucleotides in length
(Table 5) induced an anti-viral IFN -.alpha. response via
recognition by RIG-I, which leads to a reduction of HBV specific
replication markers in vitro and in vivo.
TABLE-US-00008 TABLE 5 SEQ ID No Name Position Sequence 181 HBV 1.1
3103-3125 sense 5'-UUUCACCUCUGCCUAAUCA UU-3' 182 (conserved)
antisense 3'-UU AAAGUGGAGACGGAUUAGU-5' 183 cDNA TT
TTTCACCTCTGCCTAATCA TC 184 HBV 1.2 2971-2993 sense
5'-CGACCUUGAGGCAUACUUC UU-3' 185 (not antisense 3'-UU
GCUGGAACUCCGUAUGAAG-5' 186 conserved) cDNA AC CGACCTTGAGGCATACTTC
AA 187 HBV 1.3 2239-2261 sense 5'-CUAUUAACAGGCCUAUUGA UU-3' 188
(not antisense 3'-UU GAUAAUUGUCCGGAUAACU 189 conserved) cDNA TC
CTATTAACAGGCCTATTGA TG 190 2326-2348 sense 5'-CUGCGUUGAUGCCUUUGUA
UU-3' 191 (not antisense 3'-UU GACGCAACUACGGAAACAU-5' 192
conserved) cDNA TC CTGCGTTGATGCCTTTGTA TG 193 HCV Sense
5'-CUGAUAGGGUGCUUGCGAGUUC-3' 194 control antisense
3'-GACUAUCCCACGAACGCUCAAG-5'
[0531] 120 nM of the 3p-siRNAs were transfected into HepG2-H1.3
cells and primary human hepatocytes which allow for the replication
of HBV 3 days post HBV infection at a MOI of 100. The effects of
3p-siRNAs on HBV replication markers were analyzed on day 3 and 6
post-transfection in comparison to untreated cells.
[0532] In infected HepG2-H1.3 cells, type I IFN and
2'-5'-oligoadenylate synthetase (2'-5'-OAS) expression was induced
at day 3 post-transfection. HBV progeny decreased by >95% at day
6 post-transfection. HBeAg levels were reduced by about 40%, HBsAg
levels by about 50%. The same results were obtained with
HBV-infected human hepatocytes.
[0533] When 3p-siRNA was injected intravenously into HBV1.3
transgenic mice (provided by H Schaller, Heidelberg, Germany),
alanin aminotransferase (ALT) levels remained in the normal range,
reflecting the absence of cytoxicity of the RIG-1-ligands.
INF-.alpha. and 2'-5'-OAS were strongly induced after 3 h, which
highly likely accounted for a 60% reduction of HBV RNA at d6 in
comparison to mock-treated mice. HBV viremia and HBeAg levels were
about 50%, and HBsAg levels about 15% reduced at d6.
[0534] Taken together, triggering the RNA helicase RIG-I with RNA
oligonucleotides bearing 5' triphosphate has profound antiviral
effects on HBV. Preferably, siRNA, shRNA or antisense RNA may be
designed to target the region of the HBV genome spanning
nucleotides 2656-3182 to be used as an anti-viral agent.
Alternatively, nucleotides 1272-3183 of the HBV genome may be
targeted.
Example 18
Inosin Content Increases the Activity of 5' Triphosphate RNA
[0535] Inosin is a nucleoside, which is composed of hypoxanthin and
ribose. Under certain circumstances, inosin is present in RNA
instead of adenosin. ADAR (adenosine deaminase acting on RNA)
desaminates adenosin to inosin (Palladino M J et al. (2000) Cell
102(4): 437-49). An important function of ADAR is the
posttranscriptional modification of mRNA (Gerber A P and Keller W
(2001) Trends Biochem Sci 26(6): 376-84). Furthermore in the
cytoplasm, adenosine in dsRNA is deaminated by ADAR to become
inosin (Bass B L and Weintraub H (1988) Cell 55(6): 1089-98). In
the case of viral dsRNA, adenins could be replaced by inosin,
resulting in I:U and I:C basepairing.
[0536] In order to test the contribution of inosin content to the
IFN-.alpha.-inducing activity of 5' triphosphate RNA, two different
dsRNA fragments (A and B, both derived from Taylor virus, plasmid
pEL39: fragment A positions 4473 to 5006 and 4499 to 5034; fragment
B positions 10953 to 519 and 26 to 548) were prepared by in vitro
transcription. For this purpose, 60% of the guanosin content was
replaced by inosin during in vitro transcription. Human monocytes
produce IFN-.alpha. only upon stimulation of cytosolic receptors
but not TLRs.
[0537] Purified human primary monocytes were transfected with
dsRNA. After 18 hours, IFN-.alpha. was determined in the
supernatants by ELISA. We found that the presence of inosin
increased the activity of both A and B fragments to induce
IFN-.alpha. in human monocytes (FIG. 24A). With inosin, the
activity of the fragments A and B both were higher than the
activity of poly(I:C).
[0538] For dsRNA fragments of 500 bp, both RIG-I and MDA-5 are
expected to contribute to the biological activity. Therefore we
tested the IFN-.alpha.-inducing activity of dsRNA fragments in bone
marrow dendritic cells from MDA-5-/- mice. In dendritic cells
derived from MDA-5-/- mice, the IFN-.alpha. inducing activity was
increased by more than 4-fold when 60% of the guanosins were
replaced by inosin (FIG. 24B). These data provide clear evidence
that the RIG-1-stimulating activity of 5' triphosphate RNA is
strongly increased if the RNA contains inosin.
Example 19
Single-Stranded RNA Bearing 5' Triphosphate is not Capable of
Inducing IFN-.alpha. Production, Double-Strandedness is
Required
[0539] In RNA generated by in vitro transcription, the length and
base composition at the 3' end is not chemically defined. In
particular, the 3' end may fold back and allow the polymerase to
generate partially double-stranded RNA. In order to analyse the
contribution of the 3' end and exactly define the contribution of
double-strand RNA to the IFN-.alpha.-inducing activity of 5'
triphosphate RNA, synthetic 5' triphosphate RNAs (Table 6) were
prepared as described (Ludwig J (1981) Acta Biochim Biophys Acad
Sci Hung. 16:131-3). By using such synthetic 5' triphosphate RNA,
uncontrolled elongation of the 3' end resulting in double-strand
formation is excluded.
TABLE-US-00009 TABLE 6 Chemically synthesized ssRNA
oligonucleotides 3P-A: A(AC).sub.10-UUU (5'end: only triphosphate)
(SEQ ID No. 195) (1-3)P-A: A(AC).sub.10-UUU (5'end: predominantly
triphosphate) (SEQ ID No. 196) (1-3)P-U: U(AC).sub.10-UUU (5'end:
predominantly triphosphate) (SEQ ID No. 197) (1-3)P-G:
G(AC).sub.10-UUU (5'end: predominantly triphosphate) (SEQ ID No.
198) (1-3)P-C: C(AC).sub.10-UUU (5'end: predominantly triphosphate)
(SEQ ID No. 199) HO-G: G(AC).sub.10-UUU (5'end: OH) (SEQ ID No.
200) As: AAA(GU).sub.10 (5'end: OH) (SEQ ID No. 201)
[0540] The is RNA9.2 (Homung V et al. (2005) Nat Med 11(3):263-70)
generated by in vitro transcription was used a positive control
(IVT2-3PRNA). CpG2331 is a TLR9 ligand.
[0541] PBMC (400,000 cells per well) were transfected with
oligonucleotides by using Lipofectamin (0.5 .mu.l, 0.2 .mu.g
oligonucleotide). Hybridization of complementary strands was
performed by heating 4 .mu.g total RNA in 20 .mu.l of buffer (final
50 mM Tris/HCl pH7.5 100 mM NaCl) up to 70.degree. C. followed by
cooling down to 40.degree. C. Chloroquine was used to block
TLR-mediated nucleic acid recognition (2.5 .mu.g/ml). After 24
hours, IFN-.alpha. (hIFN-.alpha.) was measured in the supernatants
by ELISA.
[0542] None of the chemically synthesized ssRNA oligonucleotides,
only the in vitro-transcribed control sequence (IVT2-3PRNA),
induced IFN-.alpha. in PBMC. However, when hybridized with the
corresponding antisense strand, all oligonucleotides induced
IFN-.alpha. (FIG. 25). The strongest IFN-.alpha. induction was seen
for 3P-A/AS. The same sequence in which most but not all
oligonucleotides contained a triphosphate group at the 5' end
showed lower activity. Of all four possible bases at the 5' end,
the highest IFN-.alpha.-inducing activity was seen when an A was at
the 5' end, followed by C, U and G (FIG. 25). The control without
5' triphosphate (HO-G/AS) did not induce and IFN-.alpha.. The TLR9
ligand CpG2331 also induced IFN-.alpha. which was sensitive to
chloroquine. The activity of the 5' triphosphate oligonucleotides
was not reduced by chloroquine, confirming that IFN-.alpha.
induction was independent of TLRs.
[0543] These results show that the presence of the antisense strand
is required for the IFN-.alpha.-inducing activity of a 5'
triphosphate RNA. When using in vitro transcription for the
generation of 5' triphosphate RNA oligonucleotides, the addition of
an antisense strand is not required presumably because of the
presence of the double-stranded structure in the 3' end. Therefore,
an active RIG-I ligand can be generated by in vitro transcription
where both "single" and double strand are active, or by using a
completely synthetic approach for generating a single-stranded 5'
triphosphate RNA, together with the complementary strand which can
be synthetic or non-synthetic and which does not need to contain a
5' triphosphate end.
Example 20
Target-Specific Induction of IFN-.alpha. by Synthetic
Single-Stranded RNA Bearing 5' Triphosphate
[0544] HepG2-H1.3 cells and primary human hepatocytes are infected
with HBV at a MOI of 100 or mock infected. 3 days after infection,
chemically synthesized single-stranded RNAs bearing 5' triphosphate
and having the nucleotide sequence of the antisense strand of
HBV1.1, 1.2, 1.3 and HCV control (Table 5) are transfected into
HBV-infected and mock infected cells. The induction of IFN-.alpha.
is determined by ELISA and the extend of HBV infection is
determined by the number of HBV-infected cells, HBeAg levels and
HBsAg levels 6 days after transfection.
Sequence CWU 1
1
333135DNAArtificialIn vitro transcription templates 1cagtaatacg
actcactatt aaaaagggga cacac 35235DNAArtificialIn vitro
transcription templates 2cagtaatacg actcactatt aaacagggga cacac
35335DNAArtificialIn vitro transcription templates 3cagtaatacg
actcactatt aaagagggga cacac 35435DNAArtificialIn vitro
transcription templates 4cagtaatacg actcactatt aaatagggga cacac
35535DNAArtificialIn vitro transcription templates 5cagtaatacg
actcactatt aacaagggga cacac 35635DNAArtificialIn vitro
transcription templates 6cagtaatacg actcactatt aaccagggga cacac
35735DNAArtificialIn vitro transcription templates 7cagtaatacg
actcactatt aacgagggga cacac 35835DNAArtificialIn vitro
transcription templates 8cagtaatacg actcactatt aactagggga cacac
35935DNAArtificialIn vitro transcription templates 9cagtaatacg
actcactatt aagaagggga cacac 351035DNAArtificialIn vitro
transcription templates 10cagtaatacg actcactatt aagcagggga cacac
351135DNAArtificialIn vitro transcription templates 11cagtaatacg
actcactatt aaggagggga cacac 351235DNAArtificialIn vitro
transcription templates 12cagtaatacg actcactatt aagtagggga cacac
351335DNAArtificialIn vitro transcription templates 13cagtaatacg
actcactatt aataagggga cacac 351435DNAArtificialIn vitro
transcription templates 14cagtaatacg actcactatt aatcagggga cacac
351535DNAArtificialIn vitro transcription templates 15cagtaatacg
actcactatt aatgagggga cacac 351635DNAArtificialIn vitro
transcription templates 16cagtaatacg actcactatt aattagggga cacac
351735DNAArtificialIn vitro transcription templates 17cagtaatacg
actcactatt acaaagggga cacac 351835DNAArtificialIn vitro
transcription templates 18cagtaatacg actcactatt acacagggga cacac
351935DNAArtificialIn vitro transcription templates 19cagtaatacg
actcactatt acagagggga cacac 352035DNAArtificialIn vitro
transcription templates 20cagtaatacg actcactatt acatagggga cacac
352135DNAArtificialIn vitro transcription templates 21cagtaatacg
actcactatt accaagggga cacac 352235DNAArtificialIn vitro
transcription templates 22cagtaatacg actcactatt acccagggga cacac
352335DNAArtificialIn vitro transcription templates 23cagtaatacg
actcactatt accgagggga cacac 352435DNAArtificialIn vitro
transcription templates 24cagtaatacg actcactatt acctagggga cacac
352535DNAArtificialIn vitro transcription templates 25cagtaatacg
actcactatt acgaagggga cacac 352635DNAArtificialIn vitro
transcription templates 26cagtaatacg actcactatt acgcagggga cacac
352735DNAArtificialIn vitro transcription templates 27cagtaatacg
actcactatt acggagggga cacac 352835DNAArtificialIn vitro
transcription templates 28cagtaatacg actcactatt acgtagggga cacac
352935DNAArtificialIn vitro transcription templates 29cagtaatacg
actcactatt actaagggga cacac 353035DNAArtificialIn vitro
transcription templates 30cagtaatacg actcactatt actcagggga cacac
353135DNAArtificialIn vitro transcription templates 31cagtaatacg
actcactatt actgagggga cacac 353235DNAArtificialIn vitro
transcription templates 32cagtaatacg actcactatt acttagggga cacac
353335DNAArtificialIn vitro transcription templates 33cagtaatacg
actcactatt agaaagggga cacac 353435DNAArtificialIn vitro
transcription templates 34cagtaatacg actcactatt agacagggga cacac
353535DNAArtificialIn vitro transcription templates 35cagtaatacg
actcactatt agagagggga cacac 353635DNAArtificialIn vitro
transcription templates 36cagtaatacg actcactatt agatagggga cacac
353735DNAArtificialIn vitro transcription templates 37cagtaatacg
actcactatt agcaagggga cacac 353835DNAArtificialIn vitro
transcription templates 38cagtaatacg actcactatt agccagggga cacac
353935DNAArtificialIn vitro transcription templates 39cagtaatacg
actcactatt agcgagggga cacac 354035DNAArtificialIn vitro
transcription templates 40cagtaatacg actcactatt agctagggga cacac
354135DNAArtificialIn vitro transcription templates 41cagtaatacg
actcactatt aggaagggga cacac 354235DNAArtificialIn vitro
transcription templates 42cagtaatacg actcactatt aggcagggga cacac
354335DNAArtificialIn vitro transcription templates 43cagtaatacg
actcactatt agggagggga cacac 354435DNAArtificialIn vitro
transcription templates 44cagtaatacg actcactatt aggtagggga cacac
354535DNAArtificialIn vitro transcription templates 45cagtaatacg
actcactatt agtaagggga cacac 354635DNAArtificialIn vitro
transcription templates 46cagtaatacg actcactatt agtcagggga cacac
354735DNAArtificialIn vitro transcription templates 47cagtaatacg
actcactatt agtgagggga cacac 354835DNAArtificialIn vitro
transcription templates 48cagtaatacg actcactatt agttagggga cacac
354935DNAArtificialIn vitro transcription templates 49cagtaatacg
actcactatt ataaagggga cacac 355035DNAArtificialIn vitro
transcription templates 50cagtaatacg actcactatt atacagggga cacac
355135DNAArtificialIn vitro transcription templates 51cagtaatacg
actcactatt atagagggga cacac 355235DNAArtificialIn vitro
transcription templates 52cagtaatacg actcactatt atatagggga cacac
355335DNAArtificialIn vitro transcription templates 53cagtaatacg
actcactatt atcaagggga cacac 355435DNAArtificialIn vitro
transcription templates 54cagtaatacg actcactatt atccagggga cacac
355535DNAArtificialIn vitro transcription templates 55cagtaatacg
actcactatt atcgagggga cacac 355635DNAArtificialIn vitro
transcription templates 56cagtaatacg actcactatt atctagggga cacac
355735DNAArtificialIn vitro transcription templates 57cagtaatacg
actcactatt atgaagggga cacac 355835DNAArtificialIn vitro
transcription templates 58cagtaatacg actcactatt atgcagggga cacac
355935DNAArtificialIn vitro transcription templates 59cagtaatacg
actcactatt atggagggga cacac 356035DNAArtificialIn vitro
transcription templates 60cagtaatacg actcactatt atgtagggga cacac
356135DNAArtificialIn vitro transcription templates 61cagtaatacg
actcactatt attaagggga cacac 356235DNAArtificialIn vitro
transcription templates 62cagtaatacg actcactatt attcagggga cacac
356335DNAArtificialIn vitro transcription templates 63cagtaatacg
actcactatt attgagggga cacac 356435DNAArtificialIn vitro
transcription templates 64cagtaatacg actcactatt atttagggga cacac
356526DNAArtificialIn vitro transcription templates 65gtgtgtgtgt
gtgtgtgtgt gtcccc 266632DNAArtificialIn vitro transcription
templates 66tatagttcca caaaggcatc tatagtgagt cg
326732DNAArtificialIn vitro transcription templates 67atgcctttgt
ggaactatac tatagtgagt cg 326832DNAArtificialIn vitro transcription
templates 68tcaaacagag gtcgcatgcc tatagtgagt cg
326932DNAArtificialIn vitro transcription templates 69gcatgcgacc
tctgtttgac tatagtgagt cg 327035DNAArtificialIn vitro transcription
templates 70tttttttttt ttcccccccc ccctatagtg agtcg
357129DNAArtificialIn vitro transcription templates 71aaaaaaaaaa
aaaaaaaaaa acctgtctc 297238DNAArtificialIn vitro transcription
templates 72aaagtgtgtg tgtgtgtgtg tgtctatagt gagtcgta
387329DNAArtificialIn vitro transcription templates 73aaatgtgtgt
gtgtgtgtgt gcctgtctc 297438DNAArtificialIn vitro transcription
templates 74aagatgaact tcagggtcag cccctatagt gagtcgta
387538DNAArtificialIn vitro transcription templates 75aagctgaccc
tgaagttcat cccctatagt gagtcgta 387643DNAArtificialIn vitro
transcription templates 76aagctgaccc tgaagttcat ctgcaccact
atagtgagtc gta 437741DNAArtificialIn vitro transcription templates
77aagctgaccc tgaagttcat ctgcacctat agtgagtcgt a
417843DNAArtificialIn vitro transcription templates 78aagtggtgca
gatgaacttc agggtcagct atagtgagtc gta 437919DNAArtificialIn vitro
transcription templates 79agtgagcgca acgcaatta
198033DNAArtificialIn vitro transcription templates 80attgaaggac
aggttaagct atagtgagtc gta 338129DNAArtificialIn vitro transcription
templates 81caccgcggtg gagctccaat tcgccctat 298233DNAArtificialIn
vitro transcription templates 82cagtaatacg actcactata ggggaagcgg
gca 338321DNAArtificialIn vitro transcription templates
83cagtaatacg actcactatt a 218433DNAArtificialIn vitro transcription
templates 84cagtaatacg actcactatt agggaagcgg gca
338529DNAArtificialIn vitro transcription templates 85cccccccccc
cccccccccc ccctgtctc 298619DNAArtificialIn vitro transcription
templates 86cctcgaggtc gacggtatc 198722DNAArtificialIn vitro
transcription templates 87cggataacaa tttcacacag ga
228819DNAArtificialIn vitro transcription templates 88cgggggatcc
actagttct 198941DNAArtificialIn vitro transcription templates
89gggaagctga ccctgaagtt catcccctat agtgagtcgt a
419029DNAArtificialIn vitro transcription templates 90gggaagttca
tcccctatag tgagtcgta 299135DNAArtificialIn vitro transcription
templates 91gggaccctga agttcatccc ctatagtgag tcgta
359223DNAArtificialIn vitro transcription templates 92gggatcccct
atagtgagtc gta 239332DNAArtificialIn vitro transcription templates
93gggctgaagt tcatccccta tagtgagtcg ta 329438DNAArtificialIn vitro
transcription templates 94gggctgaccc tgaagttcat cccctatagt gagtcgta
389529DNAArtificialIn vitro transcription templates 95gggggggggg
gggggggggg gcctgtctc 299626DNAArtificialIn vitro transcription
templates 96gggttcatcc cctatagtga gtcgta 269731DNAArtificialIn
vitro transcription templates 97ggtaattgaa ggacaggtta atagtgagtc g
319839DNAArtificialIn vitro transcription templates 98ggtgcagatg
aacttcaggg tcagcttaat agtgagtcg 399917DNAArtificialIn vitro
transcription templates 99taatacgact cactata 1710033DNAArtificialIn
vitro transcription templates 100tgatcggcta tggctggccg catgcccgct
tcc 3310131DNAArtificialIn vitro transcription templates
101ttgaaggaca ggttaagcta atagtgagtc g 3110229DNAArtificialIn vitro
transcription templates 102tttttttttt tttttttttt tcctgtctc
2910319RNAArtificialIn vitro transcription templates 103augccuuugu
ggaacuaua 1910419RNAArtificialIn vitro transcription templates
104uauaguucca caaaggcau 1910519RNAArtificialIn vitro transcription
templates 105gcaugcgacc ucuguuuga 1910619RNAArtificialIn vitro
transcription templates 106ucaaacagag gucgcaugc
1910719RNAArtificialIn vitro transcription templates 107ggaugacuga
guaccugaa 1910819RNAArtificialIn vitro transcription templates
108uucagguacu cagucaucc 1910919RNAArtificialIn vitro transcription
templates 109aaaaaaaaaa aaaaaaaaa 1911019RNAArtificialIn vitro
transcription templates 110agcuuaaccu guccuucaa
1911130RNAArtificialoligonucleotide 111agggggggac acacacacac
acacacacac 3011230RNAArtificialoligonucleotide 112aauaggggac
acacacacac acacacacac 3011330RNAArtificialoligonucleotide
113agauggggac acacacacac acacacacac
3011430RNAArtificialoligonucleotide 114agagggggac acacacacac
acacacacac 3011530RNAArtificialoligonucleotide 115agcgggggac
acacacacac acacacacac 3011630RNAArtificialoligonucleotide
116agacggggac acacacacac acacacacac
3011730RNAArtificialoligonucleotide 117acuaggggac acacacacac
acacacacac 3011830RNAArtificialoligonucleotide 118acuuggggac
acacacacac acacacacac 3011930RNAArtificialoligonucleotide
119aauuggggac acacacacac acacacacac
3012030RNAArtificialoligonucleotide 120agcuggggac acacacacac
acacacacac 3012130RNAArtificialoligonucleotide 121aaaaggggac
acacacacac acacacacac 3012230RNAArtificialoligonucleotide
122accgggggac acacacacac acacacacac
3012330RNAArtificialoligonucleotide 123auagggggac acacacacac
acacacacac 3012430RNAArtificialoligonucleotide 124accuggggac
acacacacac acacacacac 3012530RNAArtificialoligonucleotide
125acguggggac acacacacac acacacacac
3012630RNAArtificialoligonucleotide 126accaggggac acacacacac
acacacacac 3012730RNAArtificialoligonucleotide 127auaaggggac
acacacacac acacacacac 3012830RNAArtificialoligonucleotide
128agccggggac acacacacac acacacacac
3012930RNAArtificialoligonucleotide 129auauggggac acacacacac
acacacacac 3013030RNAArtificialoligonucleotide 130acccggggac
acacacacac acacacacac 3013130RNAArtificialoligonucleotide
131aggcggggac acacacacac acacacacac
3013230RNAArtificialoligonucleotide 132aaucggggac acacacacac
acacacacac 3013330RNAArtificialoligonucleotide 133aucuggggac
acacacacac acacacacac 3013430RNAArtificialoligonucleotide
134aagaggggac acacacacac acacacacac
3013530RNAArtificialoligonucleotide 135acacggggac acacacacac
acacacacac 3013630RNAArtificialoligonucleotide 136aaugggggac
acacacacac acacacacac 3013730RNAArtificialoligonucleotide
137acucggggac acacacacac acacacacac
3013830RNAArtificialoligonucleotide 138auuuggggac acacacacac
acacacacac 3013930RNAArtificialoligonucleotide 139auacggggac
acacacacac acacacacac 3014030RNAArtificialoligonucleotide
140agucggggac acacacacac acacacacac
3014130RNAArtificialoligonucleotide 141auccggggac acacacacac
acacacacac 3014230RNAArtificialoligonucleotide 142acaaggggac
acacacacac acacacacac 3014330RNAArtificialoligonucleotide
143agugggggac acacacacac acacacacac
3014430RNAArtificialoligonucleotide 144auucggggac acacacacac
acacacacac 3014530RNAArtificialoligonucleotide 145acggggggac
acacacacac acacacacac 3014630RNAArtificialoligonucleotide
146aaauggggac acacacacac acacacacac
3014730RNAArtificialoligonucleotide 147acgcggggac acacacacac
acacacacac 3014830RNAArtificialoligonucleotide 148acauggggac
acacacacac acacacacac 3014930RNAArtificialoligonucleotide
149aaggggggac acacacacac acacacacac
3015030RNAArtificialoligonucleotide 150acagggggac acacacacac
acacacacac 3015130RNAArtificialoligonucleotide 151acgaggggac
acacacacac acacacacac 3015230RNAArtificialoligonucleotide
152acugggggac acacacacac acacacacac
3015330RNAArtificialoligonucleotide 153auguggggac acacacacac
acacacacac 3015430RNAArtificialoligonucleotide 154aaacggggac
acacacacac acacacacac 3015530RNAArtificialoligonucleotide
155agguggggac acacacacac acacacacac
3015630RNAArtificialoligonucleotide 156aaccggggac acacacacac
acacacacac 3015730RNAArtificialoligonucleotide 157aagcggggac
acacacacac acacacacac 3015830RNAArtificialoligonucleotide
158aguaggggac acacacacac acacacacac
3015930RNAArtificialoligonucleotide 159augcggggac acacacacac
acacacacac 3016030RNAArtificialoligonucleotide 160aucaggggac
acacacacac acacacacac 3016130RNAArtificialoligonucleotide
161aggaggggac acacacacac acacacacac
3016230RNAArtificialoligonucleotide 162aucgggggac acacacacac
acacacacac 3016330RNAArtificialoligonucleotide 163aacuggggac
acacacacac acacacacac 3016430RNAArtificialoligonucleotide
164agcaggggac acacacacac acacacacac
3016530RNAArtificialoligonucleotide 165agaaggggac acacacacac
acacacacac 3016630RNAArtificialoligonucleotide 166aacaggggac
acacacacac acacacacac 3016730RNAArtificialoligonucleotide
167auugggggac acacacacac acacacacac
3016830RNAArtificialoligonucleotide 168aguuggggac acacacacac
acacacacac 3016930RNAArtificialoligonucleotide 169augaggggac
acacacacac acacacacac 3017030RNAArtificialoligonucleotide
170aacgggggac acacacacac acacacacac
3017130RNAArtificialoligonucleotide 171auuaggggac acacacacac
acacacacac 3017230RNAArtificialoligonucleotide 172auggggggac
acacacacac acacacacac 3017330RNAArtificialoligonucleotide
173aaagggggac acacacacac acacacacac
3017430RNAArtificialoligonucleotide 174aaguggggac acacacacac
acacacacac 3017519RNAArtificialSiRNA oligonucleotide 175gaagcgucuu
cuaauaauu 1917619RNAArtificialSiRNA oligonucleotide 176aauuauuaga
agacgcuuc 1917719RNAArtificialSiRNA oligonucleotide 177uucuccgaac
gugucacgu 1917819RNAArtificialSiRNA oligonucleotide 178acgugacacg
uucggagaa 1917932DNAArtificialIn vitro transcription templates
179ggcgccccgc cgcgccccgc tatagtgagt cg 3218032DNAArtificialIn vitro
transcription templates 180gcggggcgcg gcggggcgcc tatagtgagt cg
3218121RNAArtificialartificial sequence of HBV 1.1 sense
181uuucaccucu gccuaaucau u 2118221RNAArtificialartificial sequence
of HBV 1.1 antisense 182uuaaagugga gacggauuag u 2118323DNAHepatitis
B virus 183tttttcacct ctgcctaatc atc 2318421RNAArtificialartificial
sequence of HBV 1.2 sense 184cgaccuugag gcauacuucu u
2118521RNAArtificialartificial sequence of HBV 1.2 antisense
185uugcuggaac uccguaugaa g 2118623DNAHepatitis B virus
186accgaccttg aggcatactt caa 2318721RNAArtificialartificial
sequence of HBV 1.3 sense 187cuauuaacag gccuauugau u
2118821RNAArtificialartificial sequence of HBV 1.3 antisense
188uugauaauug uccggauaac u 2118923DNAHepatitis B virus
189tcctattaac aggcctattg atg 2319021RNAArtificialsense
190cugcguugau gccuuuguau u 2119121RNAArtificialantisense
191uugacgcaac uacggaaaca u 2119223DNAHepatitis B virus
192tcctgcgttg atgcctttgt atg 2319322RNAHepatitis C virus
193cugauagggu gcuugcgagu uc 2219422RNAHepatitis C virus
194gacuauccca cgaacgcuca ag 2219524RNAArtificialssRNA
oligonucleotide 195aacacacaca cacacacaca cuuu
2419624RNAArtificialssRNA oligonucleotide 196aacacacaca cacacacaca
cuuu 2419724RNAArtificialssRNA oligonucleotide 197uacacacaca
cacacacaca cuuu 2419824RNAArtificialssRNA oligonucleotide
198gacacacaca cacacacaca cuuu 2419924RNAArtificialssRNA
oligonucleotide 199cacacacaca cacacacaca cuuu
2420024RNAArtificialssRNA oligonucleotide 200gacacacaca cacacacaca
cuuu 2420123RNAArtificialssRNA oligonucleotide 201aaaacacaca
cacacacaca cac 2320279DNAArtificialIn vitro transcription template
202acatttttgc tttgcaattg acaatgtctg ttttttcttt gatctggttg
ttaagcgtta 60tagtgagtcg tattacgcg 7920325DNAArtificialIn vitro
transcription template; corresponding strand 203aattcgcgta
atacgactca ctata 2520429DNAArtificialforward primer 204ggatcctaat
acgactcact atagggcga 292054RNAArtificialSynthetic 205aagu
42064RNAartificialSynthetic 206aaag 42074RNAArtificialSynthetic
207augg 42084RNAArtificialSynthetic 208auua
42094RNAArtificialSynthetic 209aacg 42104RNAArtificialSynthetic
210auga 42114RNAArtificialSynthetic 211aguu
42124RNAArtificialSynthetic 212auug 42134RNAArtificialSynthetic
213aaca 42144RNAArtificialSynthetic 214agaa
42154RNAArtificialSynthetic 215agca 42164RNAArtificialSynthetic
216aacu 42174RNAArtificialSynthetic 217aucg
42184RNAArtificialSynthetic 218agga 42194RNAArtificialSynthetic
219auca 42204RNAArtificialSynthetic 220augc
42214RNAArtificialSynthetic 221agua 42224RNAArtificialSynthetic
222aagc 42234RNAArtificialSynthetic 223aacc
42244RNAArtificialSynthetic 224aggu 42254RNAArtificialSynthetic
225aaac 42264RNAArtificialSynthetic 226augu
42274RNAArtificialSynthetic 227acug 42284RNAArtificialSynthetic
228acga 42294RNAArtificialSynthetic 229acag
42304RNAArtificialSynthetic 230aagg 42314RNAArtificialSynthetic
231acau 42324RNAArtificialSynthetic 232acgc
42334RNAArtificialSynthetic 233aaau 42344RNAArtificialSynthetic
234acgg 42354RNAArtificialSynthetic 235auuc
42364RNAArtificialSynthetic 236agug 42374RNAArtificialSynthetic
237acaa 42384RNAArtificialSynthetic 238aucc
42394RNAArtificialSynthetic 239aguc 42404RNAArtificialSynthetic
240guuc 42414RNAArtificialSynthetic 241guca
42424RNAArtificialSynthetic 242gcuc 42434RNAArtificialSynthetic
243guug 42444RNAArtificialSynthetic 244guuu
42454RNAArtificialSynthetic 245gguu 42464RNAArtificialSynthetic
246gugu 42474RNAArtificialSynthetic 247gguc
42484RNAArtificialSynthetic 248gucu 42494RNAArtificialSynthetic
249gucc 42504RNAArtificialSynthetic 250gcuu
42514RNAArtificialSynthetic 251uugu 42524RNAArtificialSynthetic
252uguc 42534RNAArtificialSynthetic 253cugu
42544RNAArtificialSynthetic 254cguc 42554RNAArtificialSynthetic
255uguu 42564RNAArtificialSynthetic 256guua
42574RNAArtificialSynthetic 257ugua 42584RNAArtificialSynthetic
258uuuc 42594RNAArtificialSynthetic 259ugug
42604RNAArtificialSynthetic 260ggua 42614RNAArtificialSynthetic
261gucg 42624RNAArtificialSynthetic 262uuug
42634RNAArtificialSynthetic 263uggu 42644RNAArtificialSynthetic
264gugg 42654RNAArtificialSynthetic 265gugc
42664RNAArtificialSynthetic 266guac 42674RNAArtificialSynthetic
267guau 42684RNAArtificialSynthetic 268uagu
42694RNAArtificialSynthetic 269guag 42704RNAArtificialSynthetic
270uuca 42714RNAArtificialSynthetic 271uugg
42724RNAArtificialSynthetic 272ucuc 42734RNAArtificialSynthetic
273cagu 42744RNAArtificialSynthetic 274uucg
42754RNAArtificialSynthetic 275cuuc 42764RNAArtificialSynthetic
276gagu 42774RNAArtificialSynthetic 277ggug
42784RNAArtificialSynthetic 278uugc 42794RNAArtificialSynthetic
279uuuu 42804RNAArtificialSynthetic 280cuca
42814RNAArtificialSynthetic 281ucgu 42824RNAArtificialSynthetic
282uucu 42834RNAArtificialSynthetic 283uggc
42844RNAArtificialSynthetic 284cguu 42854RNAArtificialSynthetic
285cuug 42864RNAArtificialSynthetic 286uuac
42874RNAArtificialSynthetic 287ugau 42884RNAArtificialSynthetic
288ugcu 42894RNAArtificialSynthetic 289ugcc
42904RNAArtificialSynthetic 290ugac 42914RNAArtificialSynthetic
291uaau 42924RNAArtificialSynthetic 292ucuu
42934RNAArtificialSynthetic 293ggau 42944RNAArtificialSynthetic
294uuau 42954RNAArtificialSynthetic 295uauu
42964RNAArtificialSynthetic 296ucug 42974RNAArtificialSynthetic
297uagg
42984RNAArtificialSynthetic 298uagc 42994RNAArtificialSynthetic
299uauc 43004RNAArtificialSynthetic 300cuau
43014RNAArtificialSynthetic 301uacu 43024RNAArtificialSynthetic
302cggu 43034RNAArtificialSynthetic 303ugcg
43044RNAArtificialSynthetic 304uaug 43054RNAArtificialSynthetic
305uaag 43064RNAArtificialSynthetic 306uacc
43074RNAArtificialSynthetic 307uuag 43084RNAArtificialSynthetic
308ugag 43094RNAArtificialSynthetic 309gauu
43104RNAArtificialSynthetic 310ugca 43114RNAArtificialSynthetic
311gccu 43124RNAArtificialSynthetic 312ggcu
43134RNAArtificialSynthetic 313ucau 43144RNAArtificialSynthetic
314gcgu 43154RNAArtificialSynthetic 315gcau
43164RNAArtificialSynthetic 316gaug 43174RNAArtificialSynthetic
317cgua 431821DNAArtificialGACCTAGCCTAAAACTAGGTC 318gacctagcct
aaaactaggt c 2131917DNAArtificialSynthetic 319aaagatccgg atcaaaa
1732019RNAArtificialSynthetic 320aaaaguucaa agcucaaaa
1932111RNAArtificialSynthetic 321caaguuucga g
1132233RNAArtificialSynthetic 322ucaaagucaa aagcucaaag uugaaaguuu
aaa 3332341RNAArtificialSynthetic 323gacuugaaaa uuucaguuuu
cgaguuuaag uugaaaacuc g 4132426RNAArtificialSynthetic 324ucaaagucaa
aagcucaaag uugaaa 2632531RNAArtificialSynthetic 325uuucaguuuu
cgaguuuaag uugaaaacuc g 3132626DNAArtificialSynthetic 326actgagttta
ggatttcctt caatcc 2632722DNAArtificialSynthetic 327ggtagcaagt
gcttccttct ga 2232827DNAArtificialSynthetic 328gcactgattc
acgcctcctt cggtacc 2732927DNAArtificialSynthetic 329ggtaccgaag
gaggcgtgaa tcagtgc 2733020DNAArtificialSynthetic 330gggggacgat
cgtcgggggg 2033120DNAArtificialSynthetic 331tccatgacgt tcctgacgtt
2033230RNAArtificialSynthetic 332annnggggac acacacacac acacacacac
303334RNAArtificialSynthetic 333cgau 4
* * * * *