Diagnostic Methods Using Tenascin-w Compositions

Abstract

Tenascin-W. an extracellular matrix molecule that is specifically expressed in metastatic tumours is provided. A system comprising a sample expressing tenascin-W is used as an in vitro method for screening possible anti-tumour agents or for agents that promote osteogenesis.

Description

[0001] The present invention relates to polypeptides specifically expressed in tumours, to active agents having anti-tumour and/or anti-tumourigenic activity and to agents effective in improving conditions dependent on stem cell differentiation, in particular osteoblast formation, such as in osteogenesis, to pharmaceutical compositions of these agents and to the pharmaceutical uses of such agents and compositions. The invention also relates to in vitro methods of screening agents for anti-tumour and/or anti-tumourigenic activity as well as for agents effective in promoting stem cell differentiation.

[0002] The adherence of cells to each other and to the extracellular matrix (ECM) as well as the cellular signals transduced as a consequence of such binding are of fundamental importance to the development and maintenance of body form and function. The ECM has an important regulatory function in tissue homeostasis and, together with oncogenes and tumour suppressor genes is critically involved in tumourigenesis (reviewed in Boudreau, N. & Bissell, M. J. (1998) Curr Opin Cell Biol 10: 640-646 and Kuoslahli, E. (1999) Adv Cancer Res 76:1-20).

[0003] In the more affluent countries of the world cancer is the cause of death of roughly one person in live with the five most common cancers being those of the lung, stomach, breast, colon/rectum and the uterine cervix. Tumors of this type often metastasize through lymphatic and vascular channels. Cancer is not fatal in every case and only about half the number of people who develop cancer die of it. The problem facing cancer patients and their physicians is that seeking to cure cancer is like trying to get rid of weeds.

[0004] One way to treat cancer effectively is to get an early diagnosis. Most cancers are not extensively vascularized (and therefore not invasive) during the early stages of development. The transition to a highly vascularized, invasive and ultimately metastatic cancer which spreads throughout the body commonly takes ten years or longer. If the cancer is detected prior to invasion, surgical removal of the cancerous tissue is an effective cure. However, cancer is often detected only upon manifestation of clinical symptoms. Generally, such symptoms arc present only when the disease is well established, often after metastasis has occurred, and the prognosis for the patient is poor, even after surgical resection of the cancerous tissue. Early detection of cancer therefore is important in that detection may significantly reduce morbidity. A reliable, non-invasive, and accurate technique or diagnosing cancer at an early stage would help save many lives.

[0005] Cancer cells can be removed surgically or destroyed with toxic compounds or with radiation but it is very hard to eliminate all of the cancerous cells. A general goal is therefore to find better ways or selectively killing cancer cells whilst leaving normal cells of the body unaffected. Part of that effort involves identifying new anti-cancer agents.

[0006] Apart from tumorgenesis, the ECM has an important regulatory function in tissue homeostasis and in the development and maintenance of body form and function, e.g. in the development or remodeling of skeleton or in bone morphogenesis. Bone marrow has stem cells with osteogenic potential and is made up of determined osteogenic precursor cells that are committed to osteogenesis and of inducible osteogenic precursor cells. Determined osteogenic precursor cells can differentiate into bone without an exogenous signal. Inducible osteogenic precursor cells require a molecular signal for initiating the differentiation program, e.g. induction by binding to extracellular matrix.

[0007] A number of molecules mediating cell adhesion have been identified and characterized at the molecular level both in vertebrates and invertebrates. Tenains are a family of large multimeric extracellular matrix proteins, each having homologous subunits built from variable numbers of repeated domains. These include heptad repeats, epidermal growth factor (EGF)-like repeats, fibronectin type III domains and a C-terminal globular domain which is also found in fibrinogens. Tenascin-C was the first member of the family to be discovered, in one instance as a muyotendious antigen (Chiquet, M. & Fambrough, D M. (1984) J Cell Biol 98(6):1997-1946) and in another, as a protein enriched in the stroman of gliomas (Bourdon, M A. et al (1983) Cancer Res 43(6):2796-2805, reflecting the major sites of tenascin-C expression, namely in tendons and ligaments and the extra-cellular matrix of tumor stroma. A further instance of the discovery of tenascin-C (also termed hexabrachion) reflects its interaction with fibronectin (Erickson, H P. et al. (1984) Nature 311(5983):267-9). Enforced interaction of tumour cells with fibronectin can block proliferation in cell culture and can decrease tumour growth in nude mice (Arkamatsu H. et al (1996) Cancer Res 56: 4541-4546 and Giancotti, F. G & Ruoslahti, E. (1990) Cell 60: 849-859). Tenascin-C was shown to disrupt the interaction of cells with fibronectin and in this manner may enhance tumour cell proliferation. Chiquet-Ehrismann, R. et a. (1988) Cell 53: 383-390 were the first to show that tenascin-C binds to fibronection, blocks cell attachment to fibronectin and increases proliferation of rat breast adenocarcinoma cells (Chiquet-Ehrismann, R. et al (1986) Cell 47: 131-139).

[0008] Tenascin-C is present in a large number of developing tissues including the nervous system. Although abundant in mature ligaments and tendons, it is absent from skeletal and heart muscle, unless the muscle has been injured. Tenascin-C expression is elevated in essentially all carcinomas as well as in many other types of tumors (for review see Chiquet-Ehrismann, R. (1993) Semin Cancer Biol 4(5):301-10). Furthmore, tenascin-C is upregulated in would healing (Latijnhouwers, M A. et al (1996) J Patol 178(1):30-5), during skeletogenesis (Koyama, E. et al (1996) J Orthop Res. 14(3):403412 and Hall, B K. & Miyake, T. (1995) Int J Dev Biol. 39(6):881-893) as well as in many diseases involving infections and inflammation (Schenk, S. et al. (1995) Int J Cancer 61(4):443-9).

[0009] Each tenascin family member exhibits a specific gene expression pattern during embryogenesis and in the adult (for review see Chiquet-Ehrismann, R. (1995) Experientia 51(9-10):853-62) suggesting specific roles for each member. Tenascin-R is an extracellular matrix component of the nervous system found mainly in brain tissue (Pasheva, P. et al. (2001) Prog Brain Res. 132:103-14. Review), whereas tenascin-X is prominently expressed in muscle and skin connective tissue. In one patient, tenascin-X deficiency has been reported to result in an Ehler'3 s Danlos phenotype (Burch, G H. et al. (1997) Nat Genet 17(1):104-8).

[0010] To date there is only one report on tenascin-W available in the literature. (Weber, P. et al. (1998) J Neurobiol 35(1):1-16). In this study, a cDNA encoding tenascin-W was isolated from a 20-28 h postfertilization zebralish cDNA library on the basis of the conserved epidermal growth factor-like domains found in all tenascin molecules. The expression pattern of tenascin-W transcripts was studied in the developing zebralish by in situ hybridisation. It was found to be present in neural crest and selerotome cells and the developing skeleton. Genebank sequence AJ001423 provides a zebralish tenascin-W, and AL049689 provides a "novel human mRNA from chromosome 1, similar to Tenascin-R", whose function is not known.

[0011] The present invention provides a composition comprising an isolated nucleic acid molecule having a nucleotide sequence selected from the group consisting of: [0012] (a) a nucleotide sequence as set forth in SEQ ID NO: 1; [0013] (b) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2; [0014] (c) a nucleotide sequence with at least 85% identity to the sequence of (a) or (b); [0015] (d) a subsequence of more than 50 consecutive nucleotides of a sequence of (a), (b) or (c); and [0016] (e) a nucleotide sequence complementary to any of the nucleotide sequences or subsequence in (a), (b), (c) or (d).

[0017] In one aspect of the invention, the isolated nucleic acid molecule having a nucleotide sequence preferably (a); preferably encoding a variant of the amino acid sequence shown in SEQ ID NO: 2, such as a variant comprising an amino acid deletion, addition (e.g. fusion proteins) or substitution of the amino acid sequence shown in SEQ ID NO:2. Preferably, the variant comprises a conservative substitution of at least one amino acid in said amino acid sequence in SEQ ID: NO: 2, more preferably the variant has stem cell differentiation inducing activity, in particular an activity that induces osteoblast development from stem cells. Most preferred is when the isolated nucleic acid molecule encodes a protein with the amino acid sequence shown in SEQ ID NO: 2.

[0018] The nucleic acid molecule can be an antisense molecule, in which case it might be desirable to have nucleotide residues that are resistant to nuclease degradation substituting some or all of the ribo- or deoxyribonucleolidcs.

[0019] Also provided are nucleic acid vectors comprising the nucleic acid molecules of the invention, as well as host cells comprising the vectors or nucleic acids, and transgenic, knockout or genetically modified animals (other than humans, in particular mice), comprising manipulated nucleic acids of the invention or absent the endogenous sequence.

[0020] The invention also provides a composition comprising an isolated polypeptide having an amino acid sequence selected from the group consisting of: [0021] (a) an amino acid sequence as set forth in SEQ ID No. 2; and [0022] (b) an amino acid sequence with at least 85% identity to the sequence of (a); and [0023] (c) a subsequence of at least 30 consecutive amino acids of the sequence of (a) or (b), with the proviso that said subsequence does not fall within amino acid nos. 1102 and 1152 of SEQ ID NO:2.

[0024] Preferably, the amino acid sequence in (b) comprises a conservative substitution of at least one amino acid of the amino acid sequence of SEQ ID: NO: 2. More preferably, the polypeptide or fragment has stem cell differentiation inducing activity, as described above. Useful fragments may exhibit an epitope recognized by polyclonal antibodies raised against the polypeptide having the amino acid sequence shown in SEQ ID NO: 2, for example. A particularly preferred polypeptide is that encoded by the amino acid sequence shown in SEQ ID NO: 2.

[0025] Also provided are antibodies that are specifically reactive against the polypeptides of the invention.

[0026] In another aspect of the invention, a composition comprising an isolated nucleic acid molecule having a nucleotide sequence selected from the group consisting of: [0027] (a) a nucleotide sequence as set forth in SEQ ID No. 1 or SEQ ID No. 3; [0028] (b) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4; [0029] (c) a nucleotide sequence with at least 35% identity to any one of the sequences of (a) or (b), preferably (a); [0030] (d) a subsequence of a least 15 consecutive nucleotides of the sequence of (a), (b) or (c); and, [0031] (e) a nucleotide sequence complementary to (a), (b), (c), or (d), and a pharmaceutically acceptable excipient, diluent or carrier.

[0032] In one embodiment, the nucleic acid molecule preferably encodes a protein having stem cell differentiation inducing activity. In another embodiment, the nucleic acid molecule has a subsequence that is antisense to SEQ ID NO:1 or SEQ ID NO:3, wherein the nucleic acid molecule may comprise nucleotide residues that are resistant to nuclease degradation. In another embodiment, the isolated nucleic acid molecule encodes the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO:4. In yet another embodiment, the nucleic acid molecule has a subsequence selected from the group consisting of nucleotides 2380-3171 of SEQ ID No:1, nucleotides 2371-3162, of SEQ ID No:3, a complement of nucleotides 2380-3171 of SEQ ID No:1, and a complement of nucleotides 2371-3162 of SEQ ID No:3, or an RNA equivalent thereof.

[0033] Thus, also provided are nucleic acid compositions as described above for use as a pharmaceutical, as well as the use of such compositions for the manufacture of a medicament for the prophylaxis or treatment of cancer or bone pathologies.

[0034] Also provided are compositions comprising tenascin-W, preferably recombinant tenascin-W, and a pharmaceutically acceptable excipient, diluent or carrier. In preferred embodiments, the tenascin-W is a polypeptide having an amino acid sequence selected from the group consisting of: [0035] (a) an amino acid sequence asset forth in SEQ ID No. 2 or 4; [0036] (b) an amino acid sequence with at least 35% identity to the sequence of (a); and [0037] (c) a subsequence of at least 30 consecutive amino acids of the sequence of (a) or (b).

[0038] Preferably, the polypeptide has stem cell differentiation inducing activity as described above. More preferably, the polypeptide is encoded by the amino and sequence shown in SEQ ID NO: 4.

[0039] Thus, also provided is the use of tenascin-W for treatment or prophylactic treatment of any disease or condition requiring increased tenascin-W levels, e.g. thrombosis, wound healing or atherosclerosis, as well as a condition ameliorated by the promotion of osteogenesis, e.g. bone healing, osteoporosis, as well as the use of tenascin-W as a stem cell marker.

[0040] Also provided arc antibodies that specifically recognizes tenascin W for use as a pharmaceutical, as well as for the manufacture of a medicament, for the prophylaxis or treatment of cancer (e.g., glioblastoma, prostate, lung, colorectal, osteo- or breast carcinoma), including metastatic cancer, or for the prophylaxis or treatment of any disease or condition involving tenascin-W, e.g. excessive bone growth.

[0041] The present invention also provides methods tor identifying agents for the prevention or the prophylactic treatment of tumourigenesis or the treatment or prophylactic treatment of tumours or cancer, or the treatment or prophylactic treatment of any disease or condition involving tenascin-W, e.g. a condition ameliorated by the promotion or inhibition of osteogenesis, comprising contacting a test compound with a tenascin-W expressing cell sample and then measuring a change in one or more of: [0042] (a) cell proliferation, e.g. cell progression entering S-phase of the cell cycle; [0043] (b) DNA synthesis; [0044] (c) cell adhesion; [0045] (d) cell spreading; [0046] (e) focal adhesion and actin stress fibre formation on fibronectin; and [0047] (f) cell binding to extracellular matrix (ECM)

[0048] relative to when said test compound is absent.

[0049] Optionally, the method further comprises measuring a change in tenascin-W expression relative to when the test compound is absent. The tenascin-W may have any one-or more of the features described above. A particularly preferred assays is carried out in the form of an enzyme linked immunosorbent assay (ELISA).

[0050] Also provided is a method for identifying modulators of tenascin W function, comprising: [0051] (a) contacting a test compound with tenascin W and/or alpha8 beta1 integrin, and [0052] (b) measuring the binding of the test compound to tenascin-W and/or alpha8 beta1 integrin, or [0053] (c) measuring a disruption of binding of tenascin-W to alpha8 beta1 integrin, [0054] relative to when the test compound is absent.

[0055] Optionally the method further comprises measuring the binding of a control compound to tenascin-W. In one embodiment, the tenascin-W is attached to a solid surface, for example using an antibody reactive against tenascin-W. The binding can be conveniently detected using an antibody labelled with a fluorescent label, a fluorescence quencher, a radioactive label, a scintilant or an enzyme. Alternatively, the binding is detected by measuring the adhesion of alpha8 beta1 to the immobilized tenascin-W (as described in example 8) or vice versa. A decrease in binding of tenascin-W to alpha8 beta1 integrin is indicative of an inhibitor of the tenascin-W to alpha8 beta1 integrin is indicative of an inhibitor of the tenascin-W to alpha8 beta1 integrin interaction (and therefore an inhibitor of tenascin W function). An increase in binding of tenascin-W to alpha8 beta1 integrin in the presence of a test compound is indicative of a potential agent that activates alpha8 beta1 integrin, thereby acting as an agonist of tenascin-W function.

[0056] Thus also provided, are agents for the prevention or the prophylactic treatment of tumourigenesis or the diagnosis or the treatment or prophylatic treatment of tumours, or the treatment or prophylactic treatment of any disease or condition involving tenascin-W, e.g. a condition amelorated by the promotion of osteogensis, identified by a screening method of the invention.

[0057] Also provided are methods of diagnosing or prognosing cancer comprising: [0058] (a) analysing a sample obtained from an individual for the presence of tenascin-W; and [0059] (b) correlating the presence of tenascin-W with an unfavourable prognosis or diagnosis.

[0060] Optionally, the method may further comprise correlating in an increase in (elevated level of) tenascin-W in the sample relative to healthy tissue with an unfavourable prognosis or diagnosis. Tenascin-W can be conveniently detected using an antibody specific for tenascin-W or alternatively tenascin-w can be detected at the transcript level using techniques well known in the art, such as a polymerase chain reaction (e.g., RT-PCR). The method may also include the additional use of controls.

[0061] The sample can be blood serum from an individual, for example. The method may also further comprise propagating cells in a sample in cell culture. In one embodiment, the method further comprises analysing the sample for the presence of alpha 8 integrin, the presence of alpha 8 integrin correlating with an unfavourable prognosis or diagnosis.

[0062] The present inventors have investigated extractular matrix molecules, their expression during development, cell adhesion and proliferation of tumour cells and have characterized a novel member of the mammalian tenascin family. Prior to the present invention, no tenascin-W had been identified from a mammalian source and its function was not previously known. The present inventors have identified and characterized the complete cDNA sequence encoding the mouse and human tenascin-W. Anti-sera were prepared against a fragment of tenascin-W, which detect tenascin W in tumour stroma, in the periosteum and in liver tissue, and cross react with tenascin W from several mammalian species. In particular, the inventors have discovered that tenascin-W is specifically expressed in metastatic tumour cells as well as in the periosteum, the stem cell compartment for osteogenesis.

[0063] Thus in one aspect, the present invention provides a composition comprising an Isolated nucleic acid molecule having a nucleotide sequence selected from the group consisting of: [0064] (a) a nucleotide sequence as set forth in SEQ ID NO: 1; [0065] (b) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2; [0066] (c) a nucleotide sequence with al least 85% identity to the sequence of (a) or (b); [0067] (d) a subsequence of more than 50, 75, 100, 200 or more consecutive nucleotides of a sequence of (a), (b) or (c); and [0068] (e) a nucleotide sequence complementary to any of the nucleotide sequences or subsequence in (a), (b), (c) or (d).

[0069] The compositions include various types of nucleic acid, including genomic DNA, cDNA and mRNA, for example. In one aspect of the invention, the isolated nucleic acid molecule having a nucleotide sequence preferably exhibits at least 85%, identity, more preferably 90% identity, most preferably 95, 98 or 100% identity to the sequence of (a) (SEQ ID NO:1). Also encompassed are nucleic acids that encode polypeptides having the amino acid sequence shown in SEQ ID NO: 2, or variants thereof such as a variant comprising an amino acid deletion, addition (e.g. fusion proteins) or substitution relative to the amino acid sequence shown in SEQ ID NO:2. The various nucleic acids that can encode these polypeptides therefore may differ because of the degeneracy of the genetic code, in that most amino acids are encoded by more than one triplet codon. The identity of such codons is well known in this art, and this information can be used for the cons ruction of the nucleic acids within the scope of the invention. Variants differ from wild-type protein in having one or more amino acid substitutions that either enhance, add, or diminish a biological activity of the wild-type protein. Once the amino acid change is selected, a nucleic acid encoding that variant is constructed according to methods well known in the art.

[0070] Preferably, the variant comprises a conservative substitution of at least one amino acid in said amino acid sequence in SEQ ID: NO: 2. The variant will typically exhibit a biological function of the polypeptide as set forth in SEQ ID NO:2, that is, stem cell differentiation inducing activity, in particular an activity that induces osteoblast development from stem cells, or binding to an antibody that specifically recognizes Tenascin-W. To maintain biological activity, only conservative substitutions are therefore preferred as is well known in the art. Most preferred is when the isolated nucleic acid molecule encodes a protein with the amino acid sequence shown in SEQ ID NO: 2.

[0071] The nucleic acid molecule can be an antisense molecule, in which case it might be desirable to have nucleotide residues that are resistant to nuclease degradation substituting some or all of the ribo- or deoxyribonucleotides. Such nucleotide residues resistant to nucleases are well known in the art and can be easily synthesized by chemical means.

[0072] Also provided are nucleic acid vectors comprising the nucleic acid molecules of the invention, as well as host cells comprising the vectors of nucleic acids, and transgenic, knockout or genetically modified animals (other than humans, in particular mice), comprising manipulated nucleic acids of the invention or absent the endogenous sequence.

[0073] The invention also provides a composition comprising an isolated polypeptide having an amino acid sequence selected from the group consisting of: [0074] (a) an amino acid sequence as set forth in SEQ ID NO: 2; [0075] (b) an amino acid sequence with at least 85% identity, preferably 90, 95, 98 or 100% identity to the sequence of (a); and [0076] (c) a subsequence of at least 30, 40, 50, 75, 100 or more consecutive amino acids of the sequence of (a) or (b), with the proviso that said subsequence does not fall within amino acid nos. 1102 and 1152 of SEQ ID NO:2.

[0077] Preferably, the amino acid sequence in (b) comprises a conservative substitution of at least one amino acid of the amino acid sequence of SEQ ID: NO: 2. More preferably, the polypeptide or fragment has stem cell differentiation inducing activity, as described above. Useful fragments may exhibit an epitope recognized by polyclonal antibodies raised against the polypeptide having the amino acid sequence shown in SEQ ID NO: 2, for example. A particularly preferred polypeptide is that encoded by the amino acid sequence shown in SEQ ID NO: 2, derived from mouse tissue.

[0078] Therefore, also included within the invention are variants and derivatives of the polypeptide described by SEQ ID NO:2 or fragment thereof, whether produced by recombinant means or synthetic means or isolated from naturally occurring sources. For example, peptides having modified amino acids/peptide linkages, and peptides containing non-naturally occurring amino acids and/or cyclic peptides, which may have improved properties such as stability or activity are included. In addition the peptides of the inventing may be in the form or a fusion with another protein, for example, tags for the targeted delivery or detection, or purification of the polypeptide (including fragments thereof.

[0079] A "variant" in terms of amino acid sequence defines an amino acid sequence that differs by one or more amino acids from another, usually related amino acid sequence. The variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties (e.g. replacement of leucine with isoleucine). Less likely, a variant may have "on-conservative" changes, e.g. replacement of a glycine with a tryptophan. Similar minor variations may also include amino acid deletions or insertions (i.e. additions), or both. Guidance in determining which and how many amino acid residues may be substituted, inserted or deleted without abolishing activity (e.g., anti-cancer activity, osteoblast promoting activity, antigenic activity) may be found using computer programs well known in the art. Variants of the polypeptides of the invention include all forms of mutant variants, for example wherein at least one amino acid is deleted or substituted. Any changes involving substitution of amino acids are preferably neutral or conservative substitutions. Other variants include proteins or polypeptides comprising al least one additional amino acid in the sequence, and/or further comprising an additional amino acid sequence or domain, such as fusion proteins, as is well known in the art.

[0080] Further variants of the polypeptides of the invention include those wherein at least one of the amino acids in the sequence is a natural or unnatural analogue. Also, one or more amino acids in the sequence may be chemically modified, e.g. to increase physical stability or to lower susceptibility to enzymic, particularly protease or kinase, activity.

[0081] Also provided are antibodies that are specifically reactive against the polypeptides of the invention. Methods for producing antibodies are well known in the art. An antibody specific for the polypeptide of the invention can be easily obtained by immunizing an animal with an immunogenic amount of the polypeptide. Therefore, an antibody recognizing the polypeptide of the invention embraces polyclonal antibodies and antiserum which are obtained by immunizing an animal, and which can be confirmed to specifically recognize the polypeptide of the invention by Western blotting, ELISA, immunostaining or other routine procedure known in the art.

[0082] It is well known that if a polyclonal antibody can be obtained by sensitization, a monoclonal antibody secreted by a hybridoma may be obtained from the lymphocytes of the sensitized animal (Chapter 6, Antibodies A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1988). Therefore, monoclonal antibodies recognizing the polypeptide of the invention are also provided. Methods of producing polyclonal and monoclonal antibodies are known to those of skill in the art and described in the scientific and patent literature, see, e.g., Coligan, Current Protocols in Immunology, Wiley/Green, NY (1991); Stites (eds.) Basic and Clinical Immunology (7th ed.) Lange Medical Publications, Los Altos, Calif., and references cited therein (Stites); Goding, Monoclonal Antibodies: Principles and Practice (2nd ed.) Academic Press, New York, N.Y. (1986); and Kohler (1975) Nature 256: 495. Such techniques include selection of antibodies from libraries of recombinant antibodies displayed in phage or similar on cells. See, Huse (1989) Science 246: 1275 and Ward (1989) Nature 341: 544. Recombinant antibodies can be expressed by transient or stable expression vectors in mammalian cells, as in Norderhaug (1997) J. Immunol Methods 204: 77-87.

[0083] In this invention, an antibody a so embraces an active fragment thereof. An active fragment means a fragment of an antibody having activity of antigen-antibody reaction. Specifically named, these are active fragments, such as F(ab')2, Fab', Fab, and Fv. For example, F(ab')2 results it the antibody of this invention is digested with pepsin, and Fab results if digested with papain. Fab' results if F(ab')2 is reduced with a reagent such as 2-mercaptoetbanol and alkylated with monoiodoacetic acid. Fv is a monoactive fragment where the variable region of heavy chain and the variable region of light chain are connected with a linker. A chimeric antibody is obtained by conserving these active fragments and substituting the fragments of another animal for the fragments other than these active fragments. In particular, humanized antibodies are envisioned.

[0084] The nucleic acid and polypeptide sequences investigated herein have been found to be differentially expressed in samples obtained from metastatic cancer cell lines and are predicative of tenascin-W expression in metastatic cancer tissue, as well as in other types of cancer and diseases.

[0085] Accordingly, certain aspects of the present invention relate to nucleic acids differentially expressed in tumour tissue, especially metastatic cancer cell lines, polypeptides encoded by such nucleic acids, and antibodies immunoreactive with these polypeptides, and preparations of such compositions. Moreover, the present invention provides diagnostic and therapeutic assays and reagents for detecting and treating disorders involving, for example, aberrant expression of the subject nucleic acids.

[0086] Thus, in a further aspect of the invention, a composition is provided comprising an isolated nucleic acid molecule encoding tenascin W or a fragment thereof and a pharmaceutically acceptable excipient, diluent or carrier. The pharmaceutical use of nucleic acids encoding tenascin W had not previously been suggested and therefore in this embodiment, the nucleic acids of the pharmaceutical compositions are not limited to the nucleic acids of the invention. In particular, the composition may comprise an isolated nucleic acid having a nucleotide sequence selected from the group consisting of: [0087] (a) a nucleotide sequence as set forth in SEQ ID No. 1 or SEQ ID No. 3 (encoding human tenascin W); [0088] (b) a nucleotide sequence including the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4; [0089] (c) a nucleotide sequence with at least 35% identity, preferably at least 40, 50, 60, 70, 80, 90, 95 or 100% identity to any one of the sequences of (a) or (b), preferably (a); [0090] (d) a subsequence of at least 10, 15, 20, 25, 30, 40, 50, 75, 100 or more consecutive nucleotides of the sequence of (a), (b) or (c); and [0091] (e) a nucleotide sequence complementary to (a), (b), (c), or (d), and a pharmaceutically acceptable excipient, diluent or carrier.

[0092] In one embodiment, the nucleic acid molecule encodes tenascin-W having the amino acid sequence as set forth in SEQ ID No. 2 or SEQ ID NO. 4 or an amino acid with at least 30%, preferably at least 50%, 70%, 80%, 90%, 95%, or 100%, identity to a sequence corresponding to SEQ ID NO:2 or 4. The nucleic acid molecules are at least 10, preferably at least 15, 20, 30, 50, 75, 100 or more consecutive nucleotides of SEQ ID No. 1 or SEQ ID No.2 or a sequence complementary thereto.

[0093] In one embodiment, the invention provides a composition comprising a nucleotide sequence fragment selected from the group consisting of nucleotides 2380-3171 of SEQ ID No:1 or nucleotides 2371-3162 of SEQ ID No:3, a complement of nucleotides 2380-3171 of SEQ ID No: 1 or of nucleotides 2371-3162 of SEQ ID No:3, and RNA equivalents thereof, which encode an epitope for the binding with an antibody paratope.

[0094] In another embodiment, the nucleic acid molecule preferably encodes a protein having stem cell differentiation inducing activity. Although it is well within the skill of the art to identify polypeptides with the appropriate activity using routine methodology, the isolated nucleic acid molecule preferably encodes the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO:4, most preferably that of SEQ ID NO:4.

[0095] In yet another embodiment, the nucleic acid molecule has a subsequence that is antisense to SEQ ID NO: 1 or SEQ ID NO:3, wherein the nucleic acid molecule may comprise nucleotide residues that arc resistant to nuclease degradation.

[0096] The nucleic acid may be antisense to all or a part of a nucleic acid which hybridizes under stringent conditions to SEQ ID No: 1 or SEQ ID No:3, or antisense to a sequence having at least 70% identity with SEQ ID NO:1 or SEQ ID NO:3, that is able to hybridize under low stringency conditions to SEQ ID NO:1 or SEQ ID NO:3, and which encodes tenascin-W. Low stringency conditions employs around 0.01.times.SSC buffer compared to high stringency which employs about a 10 fold greater concentration. Alternatively, the antisense RNA may be antisense to regulatory sequences of the tenascin-W gene, in particular to 5' upstream sequences (promoter region) of the gene. Similarly, small RNAI oligonucleoties can be designed to inhibit expression of Tenascin-W in a specific manner.

[0097] The nucleic acids can be RNA or DNA, sense or antisense, and in some embodiments, double stranded (including siRNA) or single stranded. In certain embodiments at least some of the nucleotide residues of the nucleic acids (sense or antisense) may be made resistant to nuclease degradation and these can be selected from residues such as phophorothioates and/or methylphosphonates.

[0098] The antisense nucleic acids as hereinbefore described can advantageously be used as pharmaceuticals, preferred pharmaceutical applications being for the manufacture of a medicament for the prophylaxis or treatment of cancer.

[0099] Thus, the invention also provides a method of preventing or treating a condition dependent on Tenascin W, comprising administering to an individual an effective amount of a nucleic acid, as hereinbefore described. Thus, the invention encompasses the use of such nucleic acid molecules as a pharmaceutical, as well as for the manufacturer of a medicament, in particular for the prophylaxis or treatment of cancer or bone pathologies.

[0100] In yet another aspect, the present invention provides expression vectors capable of replicating in a host cell, comprising one or more vector sequences and a nucleic acid sequence encoding tenascin-W. The construct for use as a pharmaceutical is also provided, as well as its use for the manufacture of a medicament for the prophylaxis or treatment of cancer or the prophylaxis or treatment of bone pathologies.

[0101] Other embodiments of the invention include nucleic acid constructs capable of replicating in a host cell, comprising (a) at least one nucleic acid sequence portion encoding a tenascin-W protein or polypeptide of the invention (b) antisense nucleic acids as hereinbefore described (or their complement, for example, if expression of the antisense RNA in a cell is foreseen), or (c) nucleic acids as hereinbefore described and at least one nucleic acid sequence encoding a protein other than tenascin-W (or its homologues), e.g. vector sequence. Such constructs are not naturally occurring sequences. The constructs lack essential sequences of DNA which might permit them to function as vectors but are not naturally occurring as "hybrid" nucleic acids. They may include nucleic acid sequences that function as linkers or restriction sites which include without limitation a transcriptional regulatory sequence operably linked to a nucleotide sequence of the invention so as to render said nucleic acid construct capable of replicating in a host cell. Preferred constructs are synthesised using methods of oligonucleotides synthesis well known to those of skill in the art.

[0102] Also provided are vectors comprising a construct as hereinbefore described. Preferred vectors are expression vectors, preferably plasmids or viruses although cloning vectors are also provided for, optionally in the form of plasmids.

[0103] The invention provides host cells containing vectors. Preferred host cells are eukaryotic cells, more preferably insect cells or mammalian cells.

[0104] Constructs, vectors and transformed host cells of the invention are of use as pharmaceuticals, as well as for the manufacture of a medicament for the prophylaxis or treatment of a condition dependent on tenascin W, such as cancer or home disorders.

[0105] Similarly, in a further aspect of the invention, a composition is provided comprising tenascin W, preferably recombinant tenascin-W, or a fragment thereof and a pharmaceutically acceptable excipient, diluent or carrier. In preferred embodiments, the tenascin-W is a polypeptide having an amino acid sequence selected from the group consisting of: [0106] (a) an amino acid sequence as set forth in SEQ ID No. 2 or 4; [0107] (b) an amino acid sequence with at least 35% identity, preferably at least 50%, 70%, 80%, 90%, 95%, or 99% identity to the sequence of (a); and [0108] (c) a subsequence of at least 5, 10, 15, 20, 30, 50, 75, 100 or more consecutive amino acids of the sequence of (a) or (b).

[0109] Preferably, the polypeptide has stem cell differentiation inducing activity as described above. More preferably, the polypeptide is encoded by the amino acid sequence shown in SEQ ID NO:4.

[0110] Thus, also provided is the use of tenascin-W for the treatment or prophylactic treatment of any disease or condition requiring increased tenascin-W levels, e.g. thrombosis, wound healing or atherosclerosis, as well as a condition ameliorated by the promotion of osteogensis, e.g. bone healing, osteoporosis, as well as the use of tenascin-W as a stem cell marker. In yet a further aspect, the tenascin-W protein is used as a pharmaceutical.

[0111] The present invention further provides the use of a tenascin-W, e.g. for the manufacture of a medicament, for the prevention or prophylactic treatment of tumourigenesis or the treatment or prophylactic treatment of tumours or cancer. The invention also includes the use of the tenascin-W or for the manufacture of a medicament for the treatment or prophylactic treatment of any one or more of bone disease, rheumatism, asthma, allergic diseases, autoimmune diseases, prevention of transplant rejection and any other diseases involving tenascin e.g. thrombosis, cancer, wound healing and artherosclerosis.

[0112] The invention therefore provides pharmaceutical compositions for humans or veterinary compositions for animal use that comprise one or more of the aforementioned active fragments of tenascin-W. The compositions may also include other active or non-active agents. Non-active agents may include a pharmaceutically acceptable excipient, diluent or carrier, but not limited to saline, buffered saline, dextrose and water.

[0113] The compositions and medicaments of the invention may therefore be used prophylaelically in order to prevent tumours from forming, or they may be used in a curative or partly curative way to treat or contain a pre-existing tumourous condition. As well as tumours, cancerous or malignant conditions may be prevented or treated with compositions or medicaments of the invention.

[0114] In a particular aspect, the present invention provides the use of the nucleic acid or proteins or polypeptides as hereinabove described, for radioimmunotherapy. Use of radiolabeled antibody is a promising approach to target radiotherapy directly into the tumor. Anti-tenascin-C antibodies are currently tested in phase I and II clinical trials. Patients with malignant gliomas were administrated locoregional radioimmunotherapy (LR-RIT) using .sup.131I labeled anti-tenascin antibody injected directly in the tumor (Riva et al., 1999a). The first results show that IR-RIT can be safely performed, with good results especially in patients with minimal disease. Similar approach was performed with .sup.90Y (a pure beta emitter)-labeled antibodies Riva el al., 1999b), with promising results. Potentially more efficient radioimmunotherapics were shown to be possible using other isotopes, like in the case of an .sup.211At-labeled anti-tenascin antibody (Zalutsky et al., 2001), without excessive toxicity for the patient. It is as well a useful tool for precise imaging of tumors, since the presence of isotopes specifically targeted into the tumor allows sequential scintigraphies of the tumor (Riva el al., 1999a), and makes possible a direct estimation of the success of the therapy. Similar methodologies can be applied using antibodies specific for tenascin-w.

[0115] The tumours or tumor cells of the present invention are preferably those which express tenascin-W in the stroma. In particularly preferred embodiments the tumours are solid tumours, e.g. mesenchymal tumours such as osteosarcoma, glioblastoma or epithelial cancers such as breast, prostate, lung and colorectal carcinoma.

[0116] The invention further provides the use of tenascin-W for the treatment or prophylactic treatment of a condition ameliorated by the promotion of osteogenesis, e.g osteoporosis, osteoarthritis, treatment of cartilage and bone pathologies. A protein or polypeptide as hereinabove described may be used to be incorporated into implants including without limitation hip joints, knee joints, or broken bones, to promote osteogensis.

[0117] The invention also provides a method of preventing or prophylatic treatment of tumourigenesis or of treatment or prophylactic treatment of tumours or cancer or of any one or more of rheumatism, asthma, allergic diseases, autoimmune diseases, prevention of transplant rejection or the treatment or prophylactic treatment of any disease involving tenascin-W, e.g., thrombosis, wound healing and atherosclerosis in an individual comprising administering an effective amount of a tenascin-W or a fragment thereof.

[0118] The invention also provides a method of treatment or prophylactic treatment of a condition ameliorated by the promotion of osteogenesis, e.g. osteoporosis, osteoarthritis, treatment of cartilage and bone pathologies in an individual comprising administering an effective amount of tenascin-W or a fragment thereof.

[0119] The determination of an effective dose is well within the capability of those skilled in the art. For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in an appropriate animal model. The animal model is also used to achieve a desirable concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.

[0120] A therapeutically effective dose refers to that amount of active agent which ameliorates the symptoms or condition. Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in in cell cultures or experimental animals (e.g., ED.sub.50, the dose therapeutically effective in 50% of the population; and LD.sub.50, the dose lethal to 50% of the population). The dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as th ratio, LD.sub.50/ED.sub.50. Pharmaceutical compositions which exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED.sub.50 with little or not toxicity. The dosage varies within this range depending upon the dosage from employed, sensitivity of the patient, and the route of administration.

[0121] The exact dosage may be chosen by the individual physician in view of the patient to be treated. Dosage and administration can be adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Additional factors which may be taken into account include the severity of the disease state (e.g. tumour size and location); age, weight and gender of the patient; diet; time and frequency of administration; drug combination(s); reaction sensitivities; and tolerance/response to therapy. Long acting pharmaceutical compositions can be administered on a daily basis, every 3 to 4 days, every week, or once every two weeks, depending on half-life and clearance rate of the particular formulation.

[0122] The present inventors have observed stem cells, especially the periosteum, the stem cell compartment for osteogenesis, expressing tenascin-W and therefore also encompassed by the invention is a method of the invention, wherein tenascin-W is used as a stem cell marker for cells including without limitation osteogenic precursor cells in the bone marrow. Therefore, also provided is a method of selecting stem cells or progenitor cells having the ability to differentiate into osteoblasts from other cells, not having this ability. Stem cells expressing tenascin-W can be detected by an antibody. The antibody recognizing tenascin-W can be detected using secondary antibodies specific for the tenascin-W antibody, which are optionally labelled with a radio-label, an enzyme, avidin or biotin, or fluorescent materials (e.g. green fluorescent protein (GFP) or rhodamine), for example. The cells are characterized by having tenascin-W expression above basal levels and arc preferably selected from a mixed population of cells using the fluorescence-activated cell sorter (FACS) (see for example Abe et al., Dev Biol. 1996; 180(2):468-72). The selected cells therefore carry a protein delectable by fluorescence. The sorted cells are useful for the production of biological parts of the body, e.g. bone tissue.

[0123] Also provided are antibodies that specifically recognizes tenascin W for use as a pharmaceutical, as well as for the manufacture of a medicament, for the prophylaxis or treatment of cancer (e.g., glioblastoma, prostate, lung, colorectal, osleo- or breast carcinoma), including metastatic cancer, or for the prophylaxis or treatment of any disease or condition involving tenascin-W, e.g. excessive bone growth. In another aspect of the present invention, an antibody specifically reactive against tenascin-W or a fragment thereof, and the use or an antibody for the manufacture of a medicament for the prophylaxis or treatment of cancer, and the antibody for use as pharmaceutical is provided.

[0124] Antibodies that specifically recognize tenascin-W or a fragment thereof are also provided, in particular anti-bodies that recognise the above mentioned epitope.

[0125] Methods for detecting tenascin-W embrace, for example, the use of an antibody as referred to above, optionally with the use of an enzyme reaction. The antibody recognizing tenascin-W can be detected using secondary antibodies specific for the tenascin-W antibody, which are optionally labelled with a radiolabel, an enzyme, avidin or biotin, or fluorescent materials (FITC or rhodamine), for example.

[0126] Also encompassed by the invention is the use of an antibody that specifically recognizes tenascin-W for the manufacture of a medicament, in particular a medicament for the prophylaxis or treatment of cancer, the prophylaxis or treatment of bone disease, or as a pharmaceutical. In particularly encompassed by the invention is the use of an antibody that specifically recognizes tenascin-W for the diagnosis of tumour, especially metastatic tumour.

[0127] In a further embodiment, the present invention provides a method for identifying agents for the prevention or the prophylactic treatment of tumourigenesis or the treatment or prophylactic treatment of tumours or cancer, or the treatment or prophylactic treatment of any disease or condition involving tenascin-W. e.g. a condition ameliorated by the promotion (or inhibition) of osteogenesis, comprising contacting a test compound with a tenascin-W expressing sample and then measuring a change in one or more of (a) cell proliferation, e.g. cell progression entering S-phase of the cell cycle; (b) DNA synthesis; (c) cell adhesion; (d) cell spreading; (e) focal adhesion and actin stress fibre formation on fibronectin; (f) cell binding to extracellular matrix (ECM), relative to when said test compound is absent.

[0128] Cells may be encouraged to proliferate by the addition of tenascin-W to the cell culture, preferably by coating the solid substrate therewith. A substrate can be any surface that promotes cell adhesion. The solid substrate may also be coated by other ECM which include without limitation fibronectin, collagen, etc. The cell cultures are preferably grown on a solid substrate or in a liquid medium. A first measurement of one or more of (a) to (f) may be made prior to contacting the cells with a test substance. A second measurement may be made thereafter. A multiplicity of further measurements may be made over a period of hours or days after contact of the cells with the test compound. In this way a time course of the cellular response(s) may be obtained and analysed.

[0129] In one preferred embodiment of the present invention, the presence of tenascin-W in the liquid medium is measured relative to when a test compound is absent. An increase in the level of tenascin-W present to the medium relative to when said test agent is absent correlates to an agent effective in the promotion of osteogenesis, for example. A decrease in the level of tenascin-W present in the medium relative to when said test agent is absent correlates to an anti-proliferative or anti-tumour agent, or an agent effective in inhibiting osteogenesis or osteoblast formation.

[0130] In preferred aspects one or more of the following conditions arising after contacting cells with a test compound is indicative of an anti-proliferative or anti-tumour agent, or an inhibitor of osteoblast formation: [0131] (a) a reduction in cell proliferation; or a decrease in the proportion of cells entering S-phase of the cell cycle; [0132] (b) a reduction in DNA synthesis; [0133] (c) an increase in cell adhesion; [0134] (d) an increase in cell spreading; [0135] (e) an increase in focal adhesion and actin stress fibre formation on fibronectin; and [0136] (f) an increase in the binding of cells to ECM, preferably fibronectin;

[0137] In other preferred aspects one or more of the following conditions arising after contacting cells with a test compound may indicate an osteogenesis promoting agent: [0138] (a) an increase in cell proliferation; or an increase in the proportion of cells entering S-phase of the cell cycle; [0139] (b) an increase in DNA synthesis; [0140] (c) and (d) an increase in the expression of bone-specific markers such as alkaline phosphates activity, calcification or any others known in the art (e.g., Raouf and Seth, 2002, Bone 30: 463-71).

[0141] Actin stress fibre formation may be assayed according to the Actin Assembly Assay described in Bloom, I. et al (1999) Mol Biol Cell 10: 1521-1536. Adhesion assays may be performed according to the method described in Bloom, I. et al (1999).

[0142] In other embodiments, the method of the invention may further comprise control cells grown in the absence of test substance and (a), (b), (c), (d), (e), and/or (f) are measured in both control and test cultures. The test measurements can thereby be normalised with respect to the control.

[0143] The screening method further provides an essentially cell-free system for the identification of potential anti-tumour or tumor preventing agents or for an agent inhibiting osteogenesis. This method relies on the ability of a potential anti-tumour agent to prevent, inhibit or disrupt the binding between an ECM and tenascin-W. The nature of any disruption of the ECM and tenascin-W binding may be determined by performing a binding assay for ECM and tenascin (see e.g. example 10). For example, calorimetric methods may be used or measurement of labelled reagents.

[0144] Alternatively, a method is provided for identifying modulators of tenascin W function, comprising: (a) contacting a test compound with tenascin W and/or alpha8 beta1 integrin, and (b) measuring the binding of the test compound to tenascin-W and/or alpha8 beta1 integrin, or (c) measuring a disruption of binding of tenascin-W to alpha8 beta1 integrin, relative to when the test compound is absent. A decrease in binding of tenascin-W to alpha8 beta1 integrin is indicative of an inhibitor of this interaction, and increased binding could indicated that the test compound activates the alpha8 beta1 integrin, thereby increasing the interaction between tenascin-W and alpha8 beta1.

[0145] The relative amounts or concentrations of reagents and test substance may be varied, hereby permitting calculation of inhibition constants and other parameters, e.g. binding affinities. The optimisation of assay conditions will be well within the realm of one of ordinary skill in the art. The system may further comprise a control without test substance and the binding is measured in the control, thereby permitting corresponding measurements in the test system to be normalised relative to the control.

[0146] Where one component of the assay (screening) systems of the invention is coupled lo a solid particle or substrate, then one or more of the other components not so coupled may be labelled. Examples of labels include radio-labels e.g. .sup.14C or .sup.3H, dyes, metal sols, enzymes or biotin/avidin. By attaching such labels to "free" components in the system any binding assay may be carried out in solution in accordance with procedures well known in the art. After allowing the components to react solid phase particles can be separated from solution, e.g. by filtration or sedimentation (including centrifugation). In some embodiments immunoprecipitation may be used to separate bound and free labelled components. Usually, an antibody may be employed to bring an unlabelled component out of solution (whether or not this component has bound to another labelled component or not). After separation, the label present in solution (free) and the label present in or on the solid phase (bound) may be measured. Standard analyses of such bound and free data, e.g. Scatchard plots and the determination of affinity and inhibition constants for binding are well known to the person of ordinary skill in the art.

[0147] Where the solid phase is not particulate, e.g. in the form of a surface, such as a microfilter plate well, then binding assays measuring bound and free label may be performed but this will normally involve th removal of liquid phase from the wells after binding reactions have occurred. Advantageously, this assay format may dispense with the need for providing specifically labelled reaction components. Instead, labelled antibodies may be used to measure the binding of previously free reaction components to solid phase components.

[0148] In some embodiments the tenascin-W molecule, variant or fragment thereof may be attached directly to a solid phase. In preferred immunoassay embodiments of this type, tenascin-W bound to an ECM is measured using an antibody reactive against tenascin-W.

[0149] Immunological binding assays are known in the art. For a review, see Methods in Cell Biology Vol 37: Antibodies in Cell Biology. Asai, (Ed.) Academic Press, Inc. New York (1993).

[0150] A label may be any detectable composition whereby the detection can be spectroscopic, photochemical, biochemical, immunochemical, physical or chemical. For example, useful labels can include .sup.32P, .sup.35S, .sup.3H, .sup.14C, .sup.125I, .sup.131I, fluorescent dyes (e.g. FITC, rhodamine and lanthanide phosphors), electron-dense reagents, enzymes, e.g. as commonly used in ELISA (e.g. horseradish peroxidase, beta-galactosidase, luciferase and alkaline phosphatase), biotin, dioxigenin, or haptens and proteins, for which antisera or monoclonal antibodies are available. The label may be directly incorporated into a target compound to be detected, or it may be attached to a probe or antibody which binds to the target.

[0151] Throughout the assays of the invention, incubation and/or washings steps may be required after each application of reagent or incubation of combinations of reagents. Incubation steps may vary from about 5 minutes to several hours, perhaps from about 30 minutes to about 6 hours. However, the incubation time usually depends upon the assay format, analyte, volume of solution, concentrations, and so forth. Usually, the assays should be carried out at ambient temperature, although they may be conducted at temperatures; in the range of 10.degree. C., to 40.degree. C., for example.

[0152] A particularly preferred assay format is an enzyme-linked immunosorbent assay (ELISA).

[0153] All of the aforementioned methods of screening of this invention are equally applicable to the screening of substances for biological activity and potential agents for any other disease or condition involving tenascin-W, e.g. wound healing or treatment of artherosclerosis.

[0154] Also included within the scope of the present invention are anti-tumourigenic, anti-tumor, anti-metastatic, (anti-)osteogenic, wound healing or anti-arthrosclerosis substances or substances for the treatment or prophylatic treatment of any disease or condition involving tenascin-W identified by any of the screening methods of the invention. These substances may be proteins, polypeptides or small organic molecules (drugs). The invention therefore includes pharmaceutical compositions for preventing or treating tumours, metastasis, or bone pathologies and comprising one or more of the substances identified by a method of the invention. For example, inhibitors of tenascin-W expression or activity are considered potential anti-cancer agents, whereas tenascin W or agonists thereof are considered agents effective in promoting osteogenesis, which can be used in vivo or ex vivo.

[0155] Thus, the present invention provides a novel mammalian member of the tenascin family and uses thereof. It permits the identification of agents effective against conditions dependent on tenascin-W, in particular anti-cancer agents or agents that promote osteogenesis, by performance of any of the methods of screening described herein. Preferred anti-cancer agents are those which inhibit proliferation of the cancer cells and which may be general anti-proliferative agents.

[0156] The invention includes all nucleic acid molecules and proteins and polypeptides as hereinabove described, as well as agents identified by performing the methods, and the use of these agents as pharmaceuticals, particularly as medicaments for the prophylaxis or treatment of cancer and other conditions dependent on tenascin W.

[0157] Thus, in a further aspect the invention provides for the use of tenascin-W and of an agent identified by a screening method or the invention as a pharmaceutical.

[0158] The invention further provides tenascin-W or an agent identified by a screening method of the invention, for the manufacture of a medicament for the prophylaxis or treatment of a condition dependent on tenascin-W, for use to treat cancer or bone diseases or an immunological defect.

[0159] The invention provides a method of preventing or treating a condition dependent on tenascin-W comprising administering to an individual an effective amount of a construct, vector, host cell or antibody described above.

[0160] The invention also provides a method of inhibiting a condition dependent on tenascin-W comprising administering an effective amount of the modulator identified by a screening method of the invention described above, for the treatment of cancer or bone disease or an immunological defect.

[0161] Also provided by the invention are the nucleic acid molecules, the proteins, and the agents referred to above in a pharmaceutical composition, possibly in the presence of suitable exponents known to one of ordinary skill in the art. The compositions may be administered in the form of any suitable composition as detailed below by any suitable method of administration within the knowledge of a skilled man. The preferred route of administration is parentally. In parenteral administration, the compositions of this invention will be formulated in a unit dosage injectable form such as a solution, suspension or emulsion, in association with a pharmaceutically acceptable excipient. Such excipients are inherently nontoxic and nontherapeutic. Examples of such excipients are saline. Ringers solution, dextrose solution and Hank's solution. Nonaqueous excipients such as fixed oils and ethyl oleate may also be used. A preferred excipient is 5% dextrose in saline. The excipient may contain minor amounts of additives such as substances that enhance iso-tonicity and chemical slability, including buffers and preservatives.

[0162] Any protein is administered al a concentration that is therapeutically effective to prevent allograft rejection, GVHD, allergy and autoimmune diseases. The dosage and mode of administration will depend on the individual. Generally, the compositions are administered so that the functional protein is given at a dose between 1 pg/kg and 10 mg/kg, more preferably between 10 ug/kg and 5 mg/kg, most preferably between 0.1 and 2 mg/kg. Preferably, it is given as a bolus dose. Continuous short time infusion (during 30 minutes) may also be used. The compositions according to the invention may be infused at a dose between 5 and 20 .mu.g/kg/minute, more preferably between 7 and 15 ug/kg/minute.

[0163] According to a specific case, the "therapeutically effective amount" of a composition needed should be determined as being the amount sufficient to cure the patient in need to treatment or al least to partially arrest the disease and its complications. Amounts effective for such use will depend on the severity of the disease and the general state of the patient's health. Single or multiple administrations may be required depending on the dosage and frequency as required and tolerated by the patient.

[0164] The present invention also provides a method of diagnosing or prognosing cancer, or any other condition dependent on elevated tenascin W levels, comprising, (a) analysing a sample obtained from an individual for the presence of tenascin-W; and (b) correlating the presence of tenascin-W with an unfavourable prognosis or diagnosis.

[0165] The methods of the present invention will typically involve the determination of the presence, level, or activity of tenascin-W in a cell or tissue sample, which sample will often be obtained from a human, but one can also readily understand that samples tested by the present method can be obtained from agriculturally important mammals, such as cattle, horses, sheep, etc., or other animals of veterinary interest, such as cats and dogs. The assay may be carried out on any cell or tissue sample, such as somatic tissues, germiline tissues, or cancerous tissues, as well as on samples from body fluids, such as pleural fluid, blood, serum, plasma and urine. The method may also further comprise propagating cells in the sample in cell culture.

[0166] A "sample"is the material being analyzed which is usually, but not necessarily, subjected to pretreatment to provide the tenascin-W in assayable from. This would for example, entail forming a cell extract, methods for which are known in the art (for example, see Scopes, Protein Purification: Principles and Practice, Second Edition (Springer-Verlag, N.Y., 1987)).

[0167] In the broader aspects of the invention, there is no limitation on the collection and handling of samples as long as consistency is maintained. The sample is obtained by methods known in the art, such as, biopsies, surgical resections, smears, or the like. Optionally, cells obtained in a sample may be propagated in cell culture.

[0168] Consistency of measurement of tenascin-W or tenascin-W activity in clinical samples can be ensured by using a variety of techniques. For example, to control for the quality of each tissue extract, another enzymatic activity, such as alkaline phosphatase, can serve as an internal control. In addition, an internal standard can be measured concurrently with tenascin-W in the sample as a control for assay conditions. Thus, the analyzing step can comprise detecting a control protein in the sample, optionally normalizing the value obtained for tenascin-W with a signal obtained with the control protein.

[0169] The presence of tenascin-W in the sample can be determined by detecting the tenascin-W protein using methods known in the art. In this invention, there are no limitations on the type of assay used to measure tenascin-W or tenascin-W activity. Tor example, tenascin-W can be deflected by immunoassays using antibodies specific for tenascin-W. The antibody can be used, for example, in Western blots of two dimensional gels where the protein is identified by enzyme linked immunoassay or in dot blot (Antibody Sandwich) assays of total cellular protein, or partially purified protein.

[0170] Methods for sample concentration and protein purification are described in the literature (see Scopes, 1987). For example, if desired, the tenascin-W present in the cell extract can be concentrated, by precipitating with ammonium sulfate or by passing the extract through a commercially available protein concentration filter, e.g., an Amicon or Millipore, ultrafiltration unit. The extract can be applied lo a suitable purification matrix, such as an anion or a cation exchange resin, or a gel filtration matrix, or subjected to preparative gel electrophoresis. In such cases, the tenascin-W and protein yield after each purification step needs to be considered in determining the amount of tenascin-W in a sample.

[0171] Tenascin-W may be detected using an antibody specific for tenascin-W, and a control assay can be carried out using an antibody specific for another tenascin molecule. Optionally, the method may further comprise correlating in an increase in tenascin-W in the sample relative to healthy tissue. For example, tenascin-W can be detected using an antibody specific for tenascin-W expressed in tumour tissue and compared to antibody binding to any tenascin-W expressed (or non-specific reaction) in healthy tissue.

[0172] The sample is preferably a tissue sample mounted onto a solid surface for histochemical analysis. The presence of detectable, accessible tenascin-W indicates that tenascin-W is accessible to cells for binding. This leads to a unfavourable diagnosis or prognosis. If, on the other hand, the antibody does not react with tenascin-W in the tissue section, then there is an expectation that tenascin-W is not present. This leads to a favourable diagnosis or prognosis.

[0173] The present inventors have found that tenascin-W is specifically expressed in solid tumours, in particular metastatic tumour tissue or siroma thereof. The presence of tenascin-W therefore indicates a cancerous condition, in particular the presence of metastatic tumour tissue, whereas the absence of tenascin-W indicates healthy tissue or non-metastatic tumour tissue. Tenascin-W was identified in developing mouse tissues by western blotting. High expression of tenascin-W was found in the metastatic tumours of non-metastatic tumours. The presence of tenascin-W (170 kD) is indicative of unfavourable diagnosis.

[0174] In a further embodiment, the diagnostic and prognostic methods of the invention further comprises analysing the sample for the presence of alpha 8 integrin, the presence of alpha 8 integrin correlating with an unfavourable prognosis or diagnosis. This can easily be achieved, for example, using an antibody as described in detail in Example 8 below.

[0175] In a preferred embodiment, the invention provides kits suitable for use in the diagnostic or prognostic methods of the invention. Such kits comprise reagents useful for carrying out these methods, for example, antibodies from one or more species specific for tenascin-W and alpha 8 beta1 integrin. Secondary antibodies that recongnise either or both such primary anti-fibronectin antibodies can also be included for the purpose of recognition and detection of primary antibody binding to a sample. Such secondary antibodies can be labelled for detection e.g. with fluorophores, enzymes, radioactive labels or otherwise. Other detection labels will occur to those skilled in the art. Alternatively, the primary anti-tenascin-W antibodies can be labelled for direct detection.

EXAMPLE 1

Cloning of Mouse Tenascin-W

[0176] Mouse tenascin-W was cloned from a cDNA library of 19d whole mouse embryos (DupLEX-A DLM-110; OriGene Inc.). In a first step the following PCR primers derived from a sequence from chromosome 1, similar to Tenascin-R (Accession number AL049689) were used for nested PCR reactions with the Expand High Fidelity PCR System (Roche) using the mouse cDNA library as template. The first reaction was performed with the primer set 5'-TAGCAGCCCACAGCATCTACTTGCC-3' (SEQ ID NO:5)/5'-ATTGCTGTTCTGCTGAACCTGACTGCA-3' (SEQ ID NO:6) and the second reaction with 5'-ATGGATCCAGAAATTGACGGCCCCAAAACCTAG-3' (SEQ ID NO:7)/5'-ATAAGCTTGTGGAGAGGGTGGTGGATACATTTC-3' (SEQ ID NO:8). The second primer set included a BamHI and a HindIII restriction site, respectively, to allow the directed cloning into the bacterial expression vector pQE30 (Qiagen) supplying a C-terminal His-tag for the purification of the recombinant proteins.

[0177] The mouse proteins (tenascin W polypeptide fragments obtained as a result of the above procedure) were expression in E. coli and purified by a affinity chromatography to a Ni-NTA matrix (Qiagen) according to the matrix supplier's manual. The protein was purified under native conditions and was eluted with 250 mM imidazole.

[0178] Full length tenascin-W was cloned by the use of mouse tenascin-W specific primers derived from the above mouse tenascin-W cDNA and primers matching the vector of the same 19d whole mouse embryo cDNA library used before. To obtain the complete 5' sequences, the following PCR reactions using the above cDNA as template were performed: The first PCR reaction was performed using the primer pair 5'-AGGAGATGGTGGCTGTATTTTCGG-3' (SEQ ID NO:9)/5'-AGCCTCTTGCTGAGTGGAGATGCC-3' (SEQ ID NO:10) followed by a second PCR reaction with the primer set 5TAGAATTCGGTCACCTGATTGGTCACTAGG-3' (SEQ ID NO:1)/5'-TTATGATGTGCCAGATTATGCC-3' (SEQ ID NO:12). To complete the 3' part of the tenascin-W cDNA the following PCR reactions were performed. In the first reaction the primer pair 5'-CTCAAAATTGATGGCTACATTTTGACC-3' (SEQ ID NO:13)/5'-MGCCGACAACCTTGATTGGAGAC-3' (SEQ ID NO:14) was used followed by the primer pair 5'-TACCAGTTCCCAAATGGCACCG-3' (SEQ ID NO:15)/5'-AAACCTCTGGCGMGAAGTCC-3'(SEQ ID NO: 16). In each case the longest products were cloned. These overlapping tenascin-W cDNA clones were assembled into one full length mouse tenascin-W cDNA and cloned into the expression vector pCEP/Pu (see Kohfeldt et al. (1997).

[0179] FEBS I. eft. 414:557-61). At the 3' end of the tenascin-W cDNA a 6.times.His-tag was inserted in front of the stop codon to allow the purification of full length mouse tenascin-W protein expressed in mammalian cell culture.

[0180] The recombinant mouse tenascin-W protein comprises three C-terminal fibronectin type III repeats in the region defined by amino acids 794-1057 of the complete amino acid sequence of mouse tenascin-W, encoded by nucleotides 2380-3171 of the tenascin-W nucleotide sequence.

EXAMPLE 2

Characterization of Mouse Tenascin-W

[0181] The full length cDNA of mouse tenascin-W was cloned as described in example 1. The cDNA sequence encodes a typical member of the tenascin protein family and harbors from the N-terminus to the C-terminus of the protein the following structural domains: signal peptide for secretion, N-terminal domain for dimerisation of two tenascin-W trimers that are assembled by heptad repeats. This results in a disulfide-linked hexameric protein complex where each subunit contains three and a half EGF-like repeals, nine fibronectin type III repeats, and a fibrinogen-like C-terminal globular domain.

[0182] The full length tenascin-W cDNA was transfected into HEK 293 cells using the transaction reagent fugene (Roche). Transfected cells were selected with puromycin and the medium containing the secreted tenascin-W protein was collected and the protein was purified by sequential chromatography over a gclatin-agarosc column (Sigma) to remove any contaminating fibronectin in the preparation and by adsorption to a Ni-NTA matrix (Qiagen). The tenascin-W was eluted from the nickel column by 250 mM imidazole.

[0183] The recombinant protein was also analyzed by SDS-PAGE (sodium dodecyl sulfate--polyacrytamide gel electrophoresis) on 6% polyacrylamide gels, under reducing and non-reducing conditions as well as by electron micros-copy after rotary shadowing using the same procedure as described for tenascin-C (Chiquet-Ehrismann, R. et al. (1988) Cell 53, 383-390). Tenascin-W showed a similarly slow migration as the hexameric tenascin-C protein. Electronmicrographs of tenascin-W after rotary shadowing indeed revealed hexameric molecules with six subunits of about 50 nm length radiating from a central globular domain.

EXAMPLE 3

Cloning of Human Tenascin-W

[0184] Human tenascin-W was cloned from cDNA made from mRNA isolated from the osteosarcoma cell line Saos-2 (ATCC; HTB 85) essentially as described in Example 1 using the same PCR primers. The human protein was expressed and purified by affinity chromatography to a Ni-NTA matrix (Qiagen) according to the matrix suppliers manual. The protein was purified under native conditions and was eluted with 250 mM imidazole.

[0185] The recombinant protein comprises the three C-terminal fibronectin type III repeats in the region defined by amino acids 791-1054 of the complete amino acid sequence of human tenascin-W encoded by nucleotides 2371-3163 of the tenascin-W nucleotide sequence of the database entry AL049689), respectively.

[0186] Full length tenascin-W is cloned by the use of human tenascin-W specific primers derived from the above human tenascin-W cDNA and human genomic sequences 5' to the ATG start condon of the cDNA sequence entry AL049689 using cDNA made from mRNA isolated from osteoarcoma cell line Saos-2 (ATCC; HTB 85) as the template. The following primers are used for three sets of nested PCRs:

TABLE-US-00001 hTNW1: 5'CATCCTGGAGGGTCTGCTCC3' (SEQ ID NO: 17) hTNW2: 5'GGGCAATTGGTGTCAGCTTTC3' (SEQ ID NO: 18) hTNW3: 5'GACTCGAGCTTTCCAAGGATGAGTCTCC3' (SEQ ID NO: 19) hTNW4: 5'GAGGATCCCCTGGTTGCCCCTTTCAG3' (SEQ ID NO: 20) hTNW5: 5'GCGCTACACTTCTGCTGATG3' (SEQ ID NO: 21) hTNW6: 5'CTGTGGAGAGGGTGGTGG3' (SEQ ID NO: 22) hTNW7: 5'GACTCGAGTGCACAAGGATGAGAGCAG3' (SEQ ID NO: 23) hTNW8: 5'GAGGATCCACCCTTAAAGGCAACAAGGG3' (SEQ ID NO: 24) hTNW8: 5'GAGGATCCACCCTTAAAGGCAACAAGGG3' (SEQ ID NO: 24) hTNW9: P 5'CGCAGTCTGGTGGCATATTG3' (SEQ ID NO: 25) hTNW10: 5'CATGATTTGTTCTGCGGGC3' (SEQ ID NO: 26) hTNW11: 5'GACTCGAGCGGCTACATTCTGACTTACC3' (SEQ ID NO: 27) hThW12: 5'GAGGATCCTCAGTGATGGTGATGGTGATG3' (SEQ ID NO: 28)

[0187] The following PCR reactions are performed using for fragment A primer combinations hTNW1/hTNW2 followed by hTNW3/hTNW4, for fragment B htNW5/hTNW6 followed by hTNW7/hTNW8 and for fragment C hTNW9/htNW10 followed by hTNW11/hTNW12. These three fragments can be joined together to make up the full length human tenascin-W by digesting fragment A with XhoI and AccI, fragment B with AccI/NarI and fragment C with NarI/BamIII and cloning the ligated assembly into the XhoI/BamHI sites or the expression vector pCEP/Pu (see Kohfeldt et al. (1997) FEBS Lett. 414:557-61). At the 3'end of the human tenascin-W cDNA a 6.times.His-tag was inserted in front of the stop codon for ease of purification upon expression in mammalian cell culture. Human tenascin-W is purified as described for mouse tenascin-W (example 2).

EXAMPLE 4

Antibody Production, Immunohistochemistry and Immunoblots: Expression of Tenascin-W During Development

[0188] The bacterially expressed recombinant fragment of mouse tenascin-W as described above in Example 1, was used to raise polyclonal antiserta in rabbits using standard immunization procedures. These antisera were used to detect tenascin-W in tissue extracts and cryosections of developing mouse embryos using methods described for tenascin-Y (Hagios, C. et al. (1996) J. Cell Biol. 134, 1499-1512). The antiserum reacted specifically with purified full-length recombinant tenascin-W as well as with endogenous tenascin-W in tissue extracts of mouse organs, as demonstrated by Western blotting. In both cases, tenascin-W was identified as a 170 kDa molecular weight species.

[0189] The anti-tenascin-W antiserum was used to investigate tenascin-W expression during normal mouse development by immunohistochemistry. For immunohistochemistry, tissues were fixed in ice-cold 4% paraformaldehyde in phosphate-buffered saline (PBS) overnight, washed with PBS and cryoprotected with 25% sucrose in PBS overnight at 4.degree. C. The tissues were embedded in OCT (Optimal Cutting Temperature) mounting medium (Cal. No. 27050 OCT Compound by Ted Pella Inc., Calif.) and sections of 12-16 .mu.m were cut and collected onto glass slides. The sections were air-dried for 2 hours before staining with anti-tenascin-W antiserum followed by a fluorescently labelled secondary antibody.

[0190] Tenascin-W first appears at embryonic day 11.5 (E11.5) in the maxillary process. Between: E14.5 and E16.5, tenascin-W and tenascin-C expression overlaps in developing connective tissue (palate and mandible) in the face and jaw. Furthermore tenascin-W is found in the extracellular matrix (ECM) or smooth muscle, mesothelia and bone. In the adult mouse tenascin-W is found in a subset of the tenascin-C-positive ECM of the aortic valve and the limbus. In these locations its expression coincides with the stem cell compartment of the respective tissue. Tenascin-W is also expressed in the periosteum, the stem cell compartment for osteogenesis. Tenascin-W is also expressed in kidney and the digestive tract in a subset of tenascin-C-positive regions, but not in the brain.

EXAMPLE 5

Monoclonal Antibodies Against Human Tenascin-W

[0191] The bacterially expressed recombinant fragment of human tenascin-W as described above in Example 3 was used to raise monoclonal antibodies against human tenascin-W using standard procedures. The monoclonal antibodies reacted specifically with human tenascin-W having better building than relying on the crossreactivity of the anti-mouse tenascin-W for human tenascin-W. The monoclonal antibodies are particularly useful to stain human tissues.

EXAMPLE 6

Tenascin-W Expression in Tumor Cells

[0192] Tenascin-W expression in tumour cells was tested and compared with the known results for tenascin-C which has been found to be highly expressed in tumour tissues (Chiquet-Ehrismann, R. (1993) Sem. Cancer Biol. 4, 301-310). Mouse mammary tumours develop readily in transgenic mice expressing oncogenes under the control of mammary glad-specific promoters. Overexpression of c-myc results in the growth of non-mestasatic tumours whereas overexpression of 11a-ras leads to the development of meta-static tumours (I.i, F. et al. (1994) Int. J. Cancer 59, 560-568).

[0193] In this Example, the antisera described in Example 4 were used to detect tenascin-W in mouse mammary tumours as described for tenascin-Y by Hagios, C. et a., (1996). High expression of tenascin-W (about 170 kDa) was found in the tumours of res-transgenic mice (metastatic), but not in the mye- or neuT-transformed non-metastatic tumours, whereas tenascin-C was over-expressed in both types of tumours.

[0194] As a control, expression of tenascin-W was examined in healthy tissue, using blood serum, for example. The content of tenascin-W in serum is analyzed by Western blotting. For improved sensitivity a Sandwich ELISA test as described previously for tenascin-C (Schenk et al 1995. Int. J. Cancer 61:443-449) can be used. Briefly, 96-well plates are coated with either polyclonal or monoclonal anti-tenascin-W antibodies. The serum samples are applied, the wells washed and the bound tenascin-W is detected by either a polyclonal or a monoclonal anti-tenascin-W antibody followed by an appropriate perioxidase-labeled secondary anti-body. No expression of Tenascin-W was found in blood serum from wild-type mice. In contrast, healthy kidney, heart valve and periosterum was found to express Tenascin-W. Transgenic mice overexpressing neuT develop non-metastasizing mammary tumours, whereas in transgenic mice overexpressing neuT together with EphB4 receptor tyrosine kinase the tumours are metasatic (Munarini, N, et al. (2002) Cell Sci. 115, 25-37). Using this model system we again found high expression of tenascin-W in mestastic tumours, but not in non-metastatic ones. These expression patterns were confirmed by SDS-PAGE (SDS-polyacrylamide gel electrophoresis), by fractionating tumour extracts, blotting on polyvinylidene difluride membranes, and analyzing the extract using anti-tenascin-W antisera.

EXAMPLE 7

Adhesion Assay

[0195] The purified tenascin-W was used for cell adhesion studies of MDA-MB435 mammary carcinoma cells (ATTC; HTB-129), C2C12 mouse skeletal myoblasts (AITC; CRL-1772, T98G glioblastoma cells (AITC; CRI.-1690) and NIH-3T3 fibroblasts (ATTC; CRI.-1658). In brief, 60-well microliter plates (Nunc) were coated with 2-100 .mu.g/ml tenascin-W for 1 h at 37.degree. C. The non-coated plastic surface was blocked with 1% heat-inactivated BSA in PHS.

[0196] Cells were trypsinised, trypsin was blocked with 100 .mu.g/ml soybean trypsin inhibitor in PBS and, cells were resuspended in serum-free medium and counted 200-500 cells per well were plated for the indicated time points, fixed by addition of glutaraldehyde (2% final concentration) for 15 minutes and stained with 0.1% crystalviolet in 20% methanol for 30 minutes. Cells were observed under a microscope (Nikon diaphot).

[0197] Most cells adhered to tenascin-W cooled at 2-100 .mu.g, whereas cell adhesion to tenascin-C was minimal.

[0198] We compared the morphology and actin cytoskeleton of C2C12 mouse skeletal myoblasts and T98G glioblastoma plated on tenascin-W to cells plated on fibronectin or tenascin-C. The shape of the cells on tenascin-W was very different from the cells on fibronectin, which became particularly evident after F-actin staining with phalloidin. The cells on fibronectin were well spread containing stress fibers, whereas the cells on tenascin-W had many actin-rich processes but no stress fibers and the cell bodies remained relatively round.

EXAMPLE 8

Identification of a Cellular Tenascin-W Receptor

[0199] To determine the cellular receptor(s) responsible for cell adhesion to tenascin-W we tested the effect of integrin function-blocking antibodies on adhesion of T98G glyoblasloma cells on tenascin-W. Antibodies to .alpha.1, .alpha.2, .alpha.3, .alpha.4, .alpha.5, .alpha.6 and .alpha.V were unable to inhibit adhesion of T98G cells to tenascin-W. Nevertheless. this adhesion was .beta.1 integrin-depended since 10 .mu.g/ml of the anti-.beta.1 integrin blocking antibody P4C10 (Sigma) was able to completely inhibit adhesion to tenascin-W.

[0200] IDG tripeptidc motifs have been reported be the recognition sequence for alpha9 beta1 integin (Yokosakt et al., 1998). Since mouse tenascin-W contains three IDG motifs we investigated whether .alpha.9 integrin could be the receptor for tenascin-W. We plated SW480 colon carcinoma cells transfected either with an empty vector or with the vector containing the cDNA for .alpha.9 integrin (Yokosakt et al. J Biol. Chem. 1996 Sep. 27;271(39):24144-50) on tenascin-W coated wells. However, the .alpha.9-and mock-transfected SW480 cells failed to adhere top tenascin-W whereas they adhered well to fibronectin and collagen.

[0201] Integrin .alpha.8 is expressed in developing rib bone, in kidney and in smooth muscle from the gastrointestinal tract (Denda et al. Biochemistry. 1998 Apr. 21;37(16):5464-74). Since this expression pattern coincides with the presence of tenascin-W it seemed that integrin .alpha.8 was a good candidate receptor for tenascin-W as well. We tested this hypothesis by using the leukemia cell line K562, transfected with .alpha.8 integrin (Denda et al. Biochemistry. 1998 Apr. 21;37(16):5464-74). Transfected K562 cells could indeed adhere to tenascin-W and the mock-transfected control cells did not. Therefore, .alpha.8.beta.1 integrin is a receptor for tenascin-W.

EXAMPLE 9

DNA Replication and Publication Assay

[0202] 96-well plates (Falcon) are coated as described above. Cells are serum starved overnight and trypainised. 10.sup.4 cells are transferred onto the coated plates in the presence of 1% serum or 40 nM PDGF BB (Platelet-derived growth factor BB). 14 h later cells are labelled with radioactive .sup.3H-thymidine (0.5 .mu.Ci/well) for 4 h at 37.degree. C., incorporated .sup.3H-thymidine precipitated with 10% TCA and determined with a Beckman scintillation counter after cell lysis in 0.3N NaOH, 2% SDS. Alternatively, incorporation of BrdU is measured or cells numbers are counted over a growth period of several days of cells plated on different substrates. Cancer cells grown on tenascin-W show an increased growth rate over cells plated on fibronectin, as established by counting cells or an increase in radioactive .sup.3H-thymidine or BrdU incorporation into cellular RNA.

EXAMPLE 10

In Vitro Binding Assay (EUSA)

[0203] 96-well ELISA plates are coated with the appropriate ECM proteins (e.g. fibronectin or tenascin-W) for 1 h at 37.degree. C., blocked with 1% milkpowder, 0.05% Tween-20 in PBS ECM protein (tenascin-W or fibronectin) are added in blocking solution for 1 h, washed with blocking solution and the appropriate antibodies are added. In this way, an intersection between tenascin-W and fibronectin can be tested, for example. Bound proteins are detected by immune reaction with a peroxidase-coupled secondary antibody followed by colour reaction with 21 mg/ml citric and 1-hydrate, 34 mg/ml Na.sub.2HPO.sub.42H.sub.2O, 0.4 mg/ml phenylenediamine, 1 .mu.l H.sub.2O.sub.2, which can be stopped with 4M sulphuric acid. The absorbance was read at 590 nm.

EXAMPLE 11

Immunofluorescence Microscopy

[0204] 10.sup.4 cells are transferred onto 4-well Cellstar plastic plates (Greiner) that are coated with ECM proteins essentially as described above. Cells are fixed with 4% paraformaldehyde, 50 mM phosphate buffer, 5 mM EDTA in PBS for 15 minutes, blocked with 3% BSA, 0.5% Tween-20 in PBS and incubated with primary and secondary antibodies in blocking solution. Slides are embedded in 10.5% Mowiol containing 2.5% DABCO as antifade agent. Cells are analysed by microscopy. This method is particularly useful for the detection of tenascin-W or any other protein produced by cells in culture to which an antibody is available and can be used to analyze substances that affect the synthesis or deposition of the respective antigens.

[0205] As is apparent to one of ordinary skill in the art, variations in the above-described methods can be introduced with case to attain the same objective. Various incubating conditions, labels, apparatus and materials can be chosen according to individual preference. All publications referred to herein are incorporated by reference in their entirety as if each were referred so individually.

Sequence CWU 1

1

2813891DNAMus musculusCDS(1)...(3891)Mouse tenascin-W 1atg ggt ctc tgg ggg atg ctc gcc ttc ccc ctg gga ttt ctg ctt gct 48Met Gly Leu Trp Gly Met Leu Ala Phe Pro Leu Gly Phe Leu Leu Ala 1 5 10 15tct gtg ctc ctg gtg gct tcg gcc cca gcc act cca gag tct ccc ggc 96Ser Val Leu Leu Val Ala Ser Ala Pro Ala Thr Pro Glu Ser Pro Gly 20 25 30tgc agc aac aaa gag caa cag gtc act gtt agc cac acc tac aag att 144Cys Ser Asn Lys Glu Gln Gln Val Thr Val Ser His Thr Tyr Lys Ile 35 40 45gac gtg ccc aag tct gct ctg gtt caa gta gag acc gac cca cag tca 192Asp Val Pro Lys Ser Ala Leu Val Gln Val Glu Thr Asp Pro Gln Ser 50 55 60ctc agc gat gat ggg aca tca ctc ttg gct ccc ggg gag gat ggg gag 240Leu Ser Asp Asp Gly Thr Ser Leu Leu Ala Pro Gly Glu Asp Gly Glu 65 70 75 80gag cag aac att atc ttc agg cac aac atc cgt ctt cag aca ccg cag 288Glu Gln Asn Ile Ile Phe Arg His Asn Ile Arg Leu Gln Thr Pro Gln 85 90 95aag aat tgc gac ctg gca gac agt gtc cag gac ctg cta gcc cgg atg 336Lys Asn Cys Asp Leu Ala Asp Ser Val Gln Asp Leu Leu Ala Arg Met 100 105 110aaa aag ctg gag gaa gag atg gca gag ctg aag gag cag tgc aat acc 384Lys Lys Leu Glu Glu Glu Met Ala Glu Leu Lys Glu Gln Cys Asn Thr 115 120 125aac cgc tgc tgc cag ggg gct gct gat ctg agc cgt cac tgc agt ggc 432Asn Arg Cys Cys Gln Gly Ala Ala Asp Leu Ser Arg His Cys Ser Gly 130 135 140cac ggg acc ttc ctc cct gag acc tgc agc tgc cac tgt gac cag ggc 480His Gly Thr Phe Leu Pro Glu Thr Cys Ser Cys His Cys Asp Gln Gly145 150 155 160tgg gag ggc gca gac tgt gat cag ccc acc tgt cct ggg gct tgc aac 528Trp Glu Gly Ala Asp Cys Asp Gln Pro Thr Cys Pro Gly Ala Cys Asn 165 170 175ggc cac ggg cgc tgt gtg gat ggg cag tgc gtg tgt gac gcg ccc tat 576Gly His Gly Arg Cys Val Asp Gly Gln Cys Val Cys Asp Ala Pro Tyr 180 185 190gtg ggg gtc gac tgc gcc tac gcc gcc tgt ccc cag gac tgc agt ggg 624Val Gly Val Asp Cys Ala Tyr Ala Ala Cys Pro Gln Asp Cys Ser Gly 195 200 205cat ggc gtg tgc gtg cag ggt gtc tgc cag tgc cac gag gac ttc aca 672His Gly Val Cys Val Gln Gly Val Cys Gln Cys His Glu Asp Phe Thr 210 215 220gca gag gac tgc agc gag cag cgc tgt cct ggc gac tgt agt ggc aat 720Ala Glu Asp Cys Ser Glu Gln Arg Cys Pro Gly Asp Cys Ser Gly Asn225 230 235 240ggt ttc tgt gac act ggc gag tgt tac tgt gag atg ggc ttt act ggc 768Gly Phe Cys Asp Thr Gly Glu Cys Tyr Cys Glu Met Gly Phe Thr Gly 245 250 255ccc gac tgt tcc cag gtg gtg gct cct cag ggc ctg cag ttg ctc aag 816Pro Asp Cys Ser Gln Val Val Ala Pro Gln Gly Leu Gln Leu Leu Lys 260 265 270agc acg gag aac tct ctg ctg gtg agt tgg gag ccc tcc agt gag gta 864Ser Thr Glu Asn Ser Leu Leu Val Ser Trp Glu Pro Ser Ser Glu Val 275 280 285gac tac tac ctg ctc agc tac tac ccc ctg ggg aag gag caa gct aca 912Asp Tyr Tyr Leu Leu Ser Tyr Tyr Pro Leu Gly Lys Glu Gln Ala Thr 290 295 300aaa cag gtc cgg gta ccc aag gag cag cac acc tat gac atc acc ggc 960Lys Gln Val Arg Val Pro Lys Glu Gln His Thr Tyr Asp Ile Thr Gly305 310 315 320ttg ctg cct gga acc aag tac ata gtc acc ctg cgc aac gtg aag aaa 1008Leu Leu Pro Gly Thr Lys Tyr Ile Val Thr Leu Arg Asn Val Lys Lys 325 330 335gac att tcc agc agc cct cag cat cta ctt gcc acc aca gac ctt gct 1056Asp Ile Ser Ser Ser Pro Gln His Leu Leu Ala Thr Thr Asp Leu Ala 340 345 350gtg ctt ggc act gcc tgg gta aat gaa gag act gag aca tcc ctc gat 1104Val Leu Gly Thr Ala Trp Val Asn Glu Glu Thr Glu Thr Ser Leu Asp 355 360 365gtg gag tgg gag aac cct ctg act gag gtg gac tat tac aag ctt cgg 1152Val Glu Trp Glu Asn Pro Leu Thr Glu Val Asp Tyr Tyr Lys Leu Arg 370 375 380tat ggc ccc tta aca ggg cag gag gtg aca gag gtc act gtg ccc aag 1200Tyr Gly Pro Leu Thr Gly Gln Glu Val Thr Glu Val Thr Val Pro Lys385 390 395 400agc cgt gat ccc aag agc aga tat gac atc act ggt ctg cag cct gga 1248Ser Arg Asp Pro Lys Ser Arg Tyr Asp Ile Thr Gly Leu Gln Pro Gly 405 410 415acg gaa tat aaa atc aca gtt gtg ccc atc cga ggt gat ctg gag gga 1296Thr Glu Tyr Lys Ile Thr Val Val Pro Ile Arg Gly Asp Leu Glu Gly 420 425 430aag ccg att ctc ctg aat ggc agg aca gaa att gat gga cca acc aat 1344Lys Pro Ile Leu Leu Asn Gly Arg Thr Glu Ile Asp Gly Pro Thr Asn 435 440 445gtg gtc aca aat cag gtg aca gaa gac aca gca tct gtt tcc tgg gat 1392Val Val Thr Asn Gln Val Thr Glu Asp Thr Ala Ser Val Ser Trp Asp 450 455 460cca gtg agg gct gac ata gac aag tat gtg gtg cgc tat atc gcc ccc 1440Pro Val Arg Ala Asp Ile Asp Lys Tyr Val Val Arg Tyr Ile Ala Pro465 470 475 480gat ggg gag acc aag gag aag gca gta cca aag gac cag agc agc acc 1488Asp Gly Glu Thr Lys Glu Lys Ala Val Pro Lys Asp Gln Ser Ser Thr 485 490 495gtt ctc aca ggc ctg aag cca gga gag gcc tac aaa gtc ttt gtg tgg 1536Val Leu Thr Gly Leu Lys Pro Gly Glu Ala Tyr Lys Val Phe Val Trp 500 505 510gct gag agg ggc aac caa ggc agc aag aaa gca gac acc aag gcc ctc 1584Ala Glu Arg Gly Asn Gln Gly Ser Lys Lys Ala Asp Thr Lys Ala Leu 515 520 525aca gaa att gac agt cca gaa aac ctg gtg act gac cgg gtg aca gag 1632Thr Glu Ile Asp Ser Pro Glu Asn Leu Val Thr Asp Arg Val Thr Glu 530 535 540aac agc ctc tct gtc tcg tgg gac cca gtg gag gct gac atc gac agg 1680Asn Ser Leu Ser Val Ser Trp Asp Pro Val Glu Ala Asp Ile Asp Arg545 550 555 560tat gtg gta agc tac act tcc gtg gat gga gag acg aag cag gtt cca 1728Tyr Val Val Ser Tyr Thr Ser Val Asp Gly Glu Thr Lys Gln Val Pro 565 570 575gtg aag aag gac cag agg agc acc gtc ctc acc ggc ctg agt ccc ggt 1776Val Lys Lys Asp Gln Arg Ser Thr Val Leu Thr Gly Leu Ser Pro Gly 580 585 590gtg gag tac aaa gtt tac gtg tgg gca gag aaa ggc gat cgg gag agc 1824Val Glu Tyr Lys Val Tyr Val Trp Ala Glu Lys Gly Asp Arg Glu Ser 595 600 605aag aag gcc aac acc aag gct ccc aca gac atc gac agc ccc aaa aac 1872Lys Lys Ala Asn Thr Lys Ala Pro Thr Asp Ile Asp Ser Pro Lys Asn 610 615 620ttg gta act gac cag gtg aca gag aac act ctc agt gtc tcc tgg gac 1920Leu Val Thr Asp Gln Val Thr Glu Asn Thr Leu Ser Val Ser Trp Asp625 630 635 640cct gtt cag gcc aac att gac agg tat atg gtg agc tac acc tct gcc 1968Pro Val Gln Ala Asn Ile Asp Arg Tyr Met Val Ser Tyr Thr Ser Ala 645 650 655gat gga gag aca aga gag gtc cca gtg cct aag gag aag agc agt acc 2016Asp Gly Glu Thr Arg Glu Val Pro Val Pro Lys Glu Lys Ser Ser Thr 660 665 670gtc ctg act ggc ctg agg cca ggt gtg gag tac aag gtc cat gtg tgg 2064Val Leu Thr Gly Leu Arg Pro Gly Val Glu Tyr Lys Val His Val Trp 675 680 685gcc cag aag ggg acc cag gag agc aga aag gcc aac acc aag gcc ccc 2112Ala Gln Lys Gly Thr Gln Glu Ser Arg Lys Ala Asn Thr Lys Ala Pro 690 695 700aca gat att gat ggc ccc aaa aac ctg gtg act gac cag gtg acc gag 2160Thr Asp Ile Asp Gly Pro Lys Asn Leu Val Thr Asp Gln Val Thr Glu705 710 715 720acc act ctt agt gtc tcc tgg gac cca gtg gag gct gac att gat agg 2208Thr Thr Leu Ser Val Ser Trp Asp Pro Val Glu Ala Asp Ile Asp Arg 725 730 735tac atg gtt cgc tac acg tct cct gat gga gag acc aag gag gtg cct 2256Tyr Met Val Arg Tyr Thr Ser Pro Asp Gly Glu Thr Lys Glu Val Pro 740 745 750gtg tca aag gat aag agc agc aca gtc ctg agg ggc ctg agg cca ggt 2304Val Ser Lys Asp Lys Ser Ser Thr Val Leu Arg Gly Leu Arg Pro Gly 755 760 765gtg gag tac aag gtg gat gta tgg gcc cag aag ggg gcc cag gac agc 2352Val Glu Tyr Lys Val Asp Val Trp Ala Gln Lys Gly Ala Gln Asp Ser 770 775 780cgg aag gcc aac acc aag gcc ccc aca gat att gac agc cct aaa aac 2400Arg Lys Ala Asn Thr Lys Ala Pro Thr Asp Ile Asp Ser Pro Lys Asn785 790 795 800cta gtg act gag cag gtg gca gag agc act gcc acc gtg tcc tgg gac 2448Leu Val Thr Glu Gln Val Ala Glu Ser Thr Ala Thr Val Ser Trp Asp 805 810 815cca gta gag gct gac atc gac agg tat gtg gtg cgc tac acc tct gct 2496Pro Val Glu Ala Asp Ile Asp Arg Tyr Val Val Arg Tyr Thr Ser Ala 820 825 830gat gga gag acc agg gag att cca gtg agg aag gag aag agc agc act 2544Asp Gly Glu Thr Arg Glu Ile Pro Val Arg Lys Glu Lys Ser Ser Thr 835 840 845gtc ctc aca ggc ctg aga ccg ggt gtg gag tac acg gtc caa gtg tgg 2592Val Leu Thr Gly Leu Arg Pro Gly Val Glu Tyr Thr Val Gln Val Trp 850 855 860gct cag aag ggg gcc cgg gag agc aag aag gcc aaa acc aag gcc ccc 2640Ala Gln Lys Gly Ala Arg Glu Ser Lys Lys Ala Lys Thr Lys Ala Pro865 870 875 880aca gaa att gac agc ccc aag aac ttg gtg acc aac cga gtg aca gaa 2688Thr Glu Ile Asp Ser Pro Lys Asn Leu Val Thr Asn Arg Val Thr Glu 885 890 895aat aca gcc acc atc tcc tgg gac cca gtg cga gcc aac att gac agg 2736Asn Thr Ala Thr Ile Ser Trp Asp Pro Val Arg Ala Asn Ile Asp Arg 900 905 910tac atg gtt cgc tac acc tct gcg gat gga gag act aag gag att cca 2784Tyr Met Val Arg Tyr Thr Ser Ala Asp Gly Glu Thr Lys Glu Ile Pro 915 920 925gtg tca aag gat cag agt aac acc atc ctg aca ggc ctg aaa cca ggc 2832Val Ser Lys Asp Gln Ser Asn Thr Ile Leu Thr Gly Leu Lys Pro Gly 930 935 940atg gaa tat acc att cat gtg tgg gcc cag aag ggg gcc cgg gag agc 2880Met Glu Tyr Thr Ile His Val Trp Ala Gln Lys Gly Ala Arg Glu Ser945 950 955 960aag aag gct gat acc aag gcc cta aca gaa att gac cct ccc aga aat 2928Lys Lys Ala Asp Thr Lys Ala Leu Thr Glu Ile Asp Pro Pro Arg Asn 965 970 975ctc cgt ccg ttc ggg gta aca cat tct ggt ggg gtt ttg acc tgg ttg 2976Leu Arg Pro Phe Gly Val Thr His Ser Gly Gly Val Leu Thr Trp Leu 980 985 990ccc cca tct gct caa att gat ggc tac att ttg acc tac cag ttc cca 3024Pro Pro Ser Ala Gln Ile Asp Gly Tyr Ile Leu Thr Tyr Gln Phe Pro 995 1000 1005aat ggc acc gtg aag ggg gtg gag ctc cca aga ggc cag cag aga ttt 3072Asn Gly Thr Val Lys Gly Val Glu Leu Pro Arg Gly Gln Gln Arg Phe 1010 1015 1020gaa ttg caa gac ctg gaa cag ggt gtc acc tat cct gtt tcc ttg gtt 3120Glu Leu Gln Asp Leu Glu Gln Gly Val Thr Tyr Pro Val Ser Leu Val1025 1030 1035 1040gcc ttc aaa ggt aat cag cgg agc cgg act gtg tct acc acc ctt tct 3168Ala Phe Lys Gly Asn Gln Arg Ser Arg Thr Val Ser Thr Thr Leu Ser 1045 1050 1055aca gtg gat gct cgc ttt cca cac ccc tca gac tgc agt caa gtt cag 3216Thr Val Asp Ala Arg Phe Pro His Pro Ser Asp Cys Ser Gln Val Gln 1060 1065 1070cag aac acc aac gct gcc agt ggg ctc tac acc atc tac ctc aat ggt 3264Gln Asn Thr Asn Ala Ala Ser Gly Leu Tyr Thr Ile Tyr Leu Asn Gly 1075 1080 1085gat gcc agc cgg ccc atg cag gtg tac tgc gac atg gac act gac gga 3312Asp Ala Ser Arg Pro Met Gln Val Tyr Cys Asp Met Asp Thr Asp Gly 1090 1095 1100ggc ggc tgg att gtc ttc cag aga cgg aac act ggg cag ctg gat ttc 3360Gly Gly Trp Ile Val Phe Gln Arg Arg Asn Thr Gly Gln Leu Asp Phe1105 1110 1115 1120ttc aag cgt tgg cgg agt tat gta gaa ggt ttt ggg gac ccc atg aag 3408Phe Lys Arg Trp Arg Ser Tyr Val Glu Gly Phe Gly Asp Pro Met Lys 1125 1130 1135gag ttc tgg ctt gga ctt gat aaa cta cat aat ctc acc act ggc acc 3456Glu Phe Trp Leu Gly Leu Asp Lys Leu His Asn Leu Thr Thr Gly Thr 1140 1145 1150acc act cgg tat gag gtg agg gca gac tta cag act ttc aat gaa tct 3504Thr Thr Arg Tyr Glu Val Arg Ala Asp Leu Gln Thr Phe Asn Glu Ser 1155 1160 1165gcc tac gct gta tat gat ttc ttc caa gtg gca tcc agc aaa gag cgg 3552Ala Tyr Ala Val Tyr Asp Phe Phe Gln Val Ala Ser Ser Lys Glu Arg 1170 1175 1180tac aag ctg tcg gtt ggg aaa tac aga ggc aca gcc ggg gat gct ctc 3600Tyr Lys Leu Ser Val Gly Lys Tyr Arg Gly Thr Ala Gly Asp Ala Leu1185 1190 1195 1200acc tac cac aat gga tgg aag ttc acg act ttt gac aga gac agt gat 3648Thr Tyr His Asn Gly Trp Lys Phe Thr Thr Phe Asp Arg Asp Ser Asp 1205 1210 1215att gcc ctc agc aac tgt gca ctg acg cat cat ggt ggc tgg tgg tat 3696Ile Ala Leu Ser Asn Cys Ala Leu Thr His His Gly Gly Trp Trp Tyr 1220 1225 1230aag aac tgc cat ttg gcc aac ccg aat ggc aaa tat ggg gag acc aag 3744Lys Asn Cys His Leu Ala Asn Pro Asn Gly Lys Tyr Gly Glu Thr Lys 1235 1240 1245cac agc gag ggg gtg aac tgg gag cca tgg aag gga cat gag ttc tcc 3792His Ser Glu Gly Val Asn Trp Glu Pro Trp Lys Gly His Glu Phe Ser 1250 1255 1260att cct tat gtg gag ctg aaa atc cgc ccg ttt ggt tac agc aga gac 3840Ile Pro Tyr Val Glu Leu Lys Ile Arg Pro Phe Gly Tyr Ser Arg Asp1265 1270 1275 1280cgt ttc tct ggc aga aag aag cgc tcc ata gga aaa gca agg atg ttc 3888Arg Phe Ser Gly Arg Lys Lys Arg Ser Ile Gly Lys Ala Arg Met Phe 1285 1290 1295tga 3891*21296PRTMus musculus 2Met Gly Leu Trp Gly Met Leu Ala Phe Pro Leu Gly Phe Leu Leu Ala 1 5 10 15Ser Val Leu Leu Val Ala Ser Ala Pro Ala Thr Pro Glu Ser Pro Gly 20 25 30Cys Ser Asn Lys Glu Gln Gln Val Thr Val Ser His Thr Tyr Lys Ile 35 40 45Asp Val Pro Lys Ser Ala Leu Val Gln Val Glu Thr Asp Pro Gln Ser 50 55 60Leu Ser Asp Asp Gly Thr Ser Leu Leu Ala Pro Gly Glu Asp Gly Glu65 70 75 80Glu Gln Asn Ile Ile Phe Arg His Asn Ile Arg Leu Gln Thr Pro Gln 85 90 95Lys Asn Cys Asp Leu Ala Asp Ser Val Gln Asp Leu Leu Ala Arg Met 100 105 110Lys Lys Leu Glu Glu Glu Met Ala Glu Leu Lys Glu Gln Cys Asn Thr 115 120 125Asn Arg Cys Cys Gln Gly Ala Ala Asp Leu Ser Arg His Cys Ser Gly 130 135 140His Gly Thr Phe Leu Pro Glu Thr Cys Ser Cys His Cys Asp Gln Gly145 150 155 160Trp Glu Gly Ala Asp Cys Asp Gln Pro Thr Cys Pro Gly Ala Cys Asn 165 170 175Gly His Gly Arg Cys Val Asp Gly Gln Cys Val Cys Asp Ala Pro Tyr 180 185 190Val Gly Val Asp Cys Ala Tyr Ala Ala Cys Pro Gln Asp Cys Ser Gly 195 200 205His Gly Val Cys Val Gln Gly Val Cys Gln Cys His Glu Asp Phe Thr 210 215 220Ala Glu Asp Cys Ser Glu Gln Arg Cys Pro Gly Asp Cys Ser Gly Asn225 230 235 240Gly Phe Cys Asp Thr Gly Glu Cys Tyr Cys Glu Met Gly Phe Thr Gly 245 250 255Pro Asp Cys Ser Gln Val Val Ala Pro Gln Gly Leu Gln Leu Leu Lys 260 265 270Ser Thr Glu Asn Ser Leu Leu Val Ser Trp Glu Pro Ser Ser Glu Val 275 280 285Asp Tyr Tyr Leu Leu Ser Tyr Tyr Pro Leu Gly Lys Glu Gln Ala Thr 290 295 300Lys Gln Val Arg Val Pro Lys Glu Gln His Thr Tyr Asp Ile Thr Gly305 310 315 320Leu Leu Pro Gly Thr Lys Tyr Ile Val Thr Leu Arg Asn Val Lys Lys 325 330 335Asp Ile Ser Ser Ser Pro Gln His Leu Leu Ala Thr Thr Asp Leu Ala 340 345 350Val Leu Gly Thr Ala Trp Val Asn Glu Glu Thr Glu Thr Ser Leu Asp 355 360 365Val Glu Trp Glu Asn Pro Leu

Thr Glu Val Asp Tyr Tyr Lys Leu Arg 370 375 380Tyr Gly Pro Leu Thr Gly Gln Glu Val Thr Glu Val Thr Val Pro Lys385 390 395 400Ser Arg Asp Pro Lys Ser Arg Tyr Asp Ile Thr Gly Leu Gln Pro Gly 405 410 415Thr Glu Tyr Lys Ile Thr Val Val Pro Ile Arg Gly Asp Leu Glu Gly 420 425 430Lys Pro Ile Leu Leu Asn Gly Arg Thr Glu Ile Asp Gly Pro Thr Asn 435 440 445Val Val Thr Asn Gln Val Thr Glu Asp Thr Ala Ser Val Ser Trp Asp 450 455 460Pro Val Arg Ala Asp Ile Asp Lys Tyr Val Val Arg Tyr Ile Ala Pro465 470 475 480Asp Gly Glu Thr Lys Glu Lys Ala Val Pro Lys Asp Gln Ser Ser Thr 485 490 495Val Leu Thr Gly Leu Lys Pro Gly Glu Ala Tyr Lys Val Phe Val Trp 500 505 510Ala Glu Arg Gly Asn Gln Gly Ser Lys Lys Ala Asp Thr Lys Ala Leu 515 520 525Thr Glu Ile Asp Ser Pro Glu Asn Leu Val Thr Asp Arg Val Thr Glu 530 535 540Asn Ser Leu Ser Val Ser Trp Asp Pro Val Glu Ala Asp Ile Asp Arg545 550 555 560Tyr Val Val Ser Tyr Thr Ser Val Asp Gly Glu Thr Lys Gln Val Pro 565 570 575Val Lys Lys Asp Gln Arg Ser Thr Val Leu Thr Gly Leu Ser Pro Gly 580 585 590Val Glu Tyr Lys Val Tyr Val Trp Ala Glu Lys Gly Asp Arg Glu Ser 595 600 605Lys Lys Ala Asn Thr Lys Ala Pro Thr Asp Ile Asp Ser Pro Lys Asn 610 615 620Leu Val Thr Asp Gln Val Thr Glu Asn Thr Leu Ser Val Ser Trp Asp625 630 635 640Pro Val Gln Ala Asn Ile Asp Arg Tyr Met Val Ser Tyr Thr Ser Ala 645 650 655Asp Gly Glu Thr Arg Glu Val Pro Val Pro Lys Glu Lys Ser Ser Thr 660 665 670Val Leu Thr Gly Leu Arg Pro Gly Val Glu Tyr Lys Val His Val Trp 675 680 685Ala Gln Lys Gly Thr Gln Glu Ser Arg Lys Ala Asn Thr Lys Ala Pro 690 695 700Thr Asp Ile Asp Gly Pro Lys Asn Leu Val Thr Asp Gln Val Thr Glu705 710 715 720Thr Thr Leu Ser Val Ser Trp Asp Pro Val Glu Ala Asp Ile Asp Arg 725 730 735Tyr Met Val Arg Tyr Thr Ser Pro Asp Gly Glu Thr Lys Glu Val Pro 740 745 750Val Ser Lys Asp Lys Ser Ser Thr Val Leu Arg Gly Leu Arg Pro Gly 755 760 765Val Glu Tyr Lys Val Asp Val Trp Ala Gln Lys Gly Ala Gln Asp Ser 770 775 780Arg Lys Ala Asn Thr Lys Ala Pro Thr Asp Ile Asp Ser Pro Lys Asn785 790 795 800Leu Val Thr Glu Gln Val Ala Glu Ser Thr Ala Thr Val Ser Trp Asp 805 810 815Pro Val Glu Ala Asp Ile Asp Arg Tyr Val Val Arg Tyr Thr Ser Ala 820 825 830Asp Gly Glu Thr Arg Glu Ile Pro Val Arg Lys Glu Lys Ser Ser Thr 835 840 845Val Leu Thr Gly Leu Arg Pro Gly Val Glu Tyr Thr Val Gln Val Trp 850 855 860Ala Gln Lys Gly Ala Arg Glu Ser Lys Lys Ala Lys Thr Lys Ala Pro865 870 875 880Thr Glu Ile Asp Ser Pro Lys Asn Leu Val Thr Asn Arg Val Thr Glu 885 890 895Asn Thr Ala Thr Ile Ser Trp Asp Pro Val Arg Ala Asn Ile Asp Arg 900 905 910Tyr Met Val Arg Tyr Thr Ser Ala Asp Gly Glu Thr Lys Glu Ile Pro 915 920 925Val Ser Lys Asp Gln Ser Asn Thr Ile Leu Thr Gly Leu Lys Pro Gly 930 935 940Met Glu Tyr Thr Ile His Val Trp Ala Gln Lys Gly Ala Arg Glu Ser945 950 955 960Lys Lys Ala Asp Thr Lys Ala Leu Thr Glu Ile Asp Pro Pro Arg Asn 965 970 975Leu Arg Pro Phe Gly Val Thr His Ser Gly Gly Val Leu Thr Trp Leu 980 985 990Pro Pro Ser Ala Gln Ile Asp Gly Tyr Ile Leu Thr Tyr Gln Phe Pro 995 1000 1005Asn Gly Thr Val Lys Gly Val Glu Leu Pro Arg Gly Gln Gln Arg Phe 1010 1015 1020Glu Leu Gln Asp Leu Glu Gln Gly Val Thr Tyr Pro Val Ser Leu Val1025 1030 1035 1040Ala Phe Lys Gly Asn Gln Arg Ser Arg Thr Val Ser Thr Thr Leu Ser 1045 1050 1055Thr Val Asp Ala Arg Phe Pro His Pro Ser Asp Cys Ser Gln Val Gln 1060 1065 1070Gln Asn Thr Asn Ala Ala Ser Gly Leu Tyr Thr Ile Tyr Leu Asn Gly 1075 1080 1085Asp Ala Ser Arg Pro Met Gln Val Tyr Cys Asp Met Asp Thr Asp Gly 1090 1095 1100Gly Gly Trp Ile Val Phe Gln Arg Arg Asn Thr Gly Gln Leu Asp Phe1105 1110 1115 1120Phe Lys Arg Trp Arg Ser Tyr Val Glu Gly Phe Gly Asp Pro Met Lys 1125 1130 1135Glu Phe Trp Leu Gly Leu Asp Lys Leu His Asn Leu Thr Thr Gly Thr 1140 1145 1150Thr Thr Arg Tyr Glu Val Arg Ala Asp Leu Gln Thr Phe Asn Glu Ser 1155 1160 1165Ala Tyr Ala Val Tyr Asp Phe Phe Gln Val Ala Ser Ser Lys Glu Arg 1170 1175 1180Tyr Lys Leu Ser Val Gly Lys Tyr Arg Gly Thr Ala Gly Asp Ala Leu1185 1190 1195 1200Thr Tyr His Asn Gly Trp Lys Phe Thr Thr Phe Asp Arg Asp Ser Asp 1205 1210 1215Ile Ala Leu Ser Asn Cys Ala Leu Thr His His Gly Gly Trp Trp Tyr 1220 1225 1230Lys Asn Cys His Leu Ala Asn Pro Asn Gly Lys Tyr Gly Glu Thr Lys 1235 1240 1245His Ser Glu Gly Val Asn Trp Glu Pro Trp Lys Gly His Glu Phe Ser 1250 1255 1260Ile Pro Tyr Val Glu Leu Lys Ile Arg Pro Phe Gly Tyr Ser Arg Asp1265 1270 1275 1280Arg Phe Ser Gly Arg Lys Lys Arg Ser Ile Gly Lys Ala Arg Met Phe 1285 1290 129533885DNAHomo sapiensCDS(1)...(3885)Human tenascin-W 3atg ttc cgc ttc cct atg ggg ctc ctg ctt ggc tct gtg ctc ctg gtg 48Met Phe Arg Phe Pro Met Gly Leu Leu Leu Gly Ser Val Leu Leu Val 1 5 10 15gct tcg gcc cca gcc act ctg gag cct ccc ggc tgc agc aac aag gag 96Ala Ser Ala Pro Ala Thr Leu Glu Pro Pro Gly Cys Ser Asn Lys Glu 20 25 30caa cag gtc act gtc agc cac acc tac aag atc gat gtg ccc aag tct 144Gln Gln Val Thr Val Ser His Thr Tyr Lys Ile Asp Val Pro Lys Ser 35 40 45gcc ttg gtt cag gtt gac gct gac cct cag ccc ctc agt gac gat ggg 192Ala Leu Val Gln Val Asp Ala Asp Pro Gln Pro Leu Ser Asp Asp Gly 50 55 60gct tcg ctc ttg gcc ctg ggg gag gcc agg gag gaa cag aac atc atc 240Ala Ser Leu Leu Ala Leu Gly Glu Ala Arg Glu Glu Gln Asn Ile Ile 65 70 75 80ttc agg cac aac atc cgc ctt cag acg cca cag aag gac tgc gag ttg 288Phe Arg His Asn Ile Arg Leu Gln Thr Pro Gln Lys Asp Cys Glu Leu 85 90 95gca ggc agt gtc cag gac ctc ctg gcc cgg gtg aag aag ctg gag gaa 336Ala Gly Ser Val Gln Asp Leu Leu Ala Arg Val Lys Lys Leu Glu Glu 100 105 110gag atg gtg gag atg aag gaa cag tgt agt gcc cag cgc tgc tgc cag 384Glu Met Val Glu Met Lys Glu Gln Cys Ser Ala Gln Arg Cys Cys Gln 115 120 125gga gtc act gat cta agc cgc cac tgc agc ggc cac ggg acc ttc tcc 432Gly Val Thr Asp Leu Ser Arg His Cys Ser Gly His Gly Thr Phe Ser 130 135 140ctg gag acc tgc agc tgc cac tgc gaa gag ggc agg gag ggc ccc gcc 480Leu Glu Thr Cys Ser Cys His Cys Glu Glu Gly Arg Glu Gly Pro Ala145 150 155 160tgc gag cgg ctg gcc tgc ccc ggg gcg tgc agc ggc cac ggg cgt tgc 528Cys Glu Arg Leu Ala Cys Pro Gly Ala Cys Ser Gly His Gly Arg Cys 165 170 175gtg gac ggg cgc tgc ctg tgc cat gag ccc tac gtg ggt gcc gac tgc 576Val Asp Gly Arg Cys Leu Cys His Glu Pro Tyr Val Gly Ala Asp Cys 180 185 190ggc tac ccg gcc tgc cct gag aac tgc agc gga cac ggc gag tgc gtg 624Gly Tyr Pro Ala Cys Pro Glu Asn Cys Ser Gly His Gly Glu Cys Val 195 200 205cgc ggc gtg tgc cag tgc cac gaa gac ttc atg tcg gag gac tgc agc 672Arg Gly Val Cys Gln Cys His Glu Asp Phe Met Ser Glu Asp Cys Ser 210 215 220gag aag cgc tgt ccc ggc gac tgc agc ggc cac ggc ttc tgt gac acg 720Glu Lys Arg Cys Pro Gly Asp Cys Ser Gly His Gly Phe Cys Asp Thr225 230 235 240ggc gag tgc tac tgc gag gag ggc ttc aca ggc ctg gac tgt gcc cag 768Gly Glu Cys Tyr Cys Glu Glu Gly Phe Thr Gly Leu Asp Cys Ala Gln 245 250 255gtg gtc acc cca cag ggc ctg cag ctg ctc aag aac acg gag gat tct 816Val Val Thr Pro Gln Gly Leu Gln Leu Leu Lys Asn Thr Glu Asp Ser 260 265 270ctg ctg gtg agc tgg gag ccc tcc agc cag gtg gat cac tac ctc ctc 864Leu Leu Val Ser Trp Glu Pro Ser Ser Gln Val Asp His Tyr Leu Leu 275 280 285agc tac tac ccc ctg ggg aag gag ctc tct ggg aag cag atc caa gtg 912Ser Tyr Tyr Pro Leu Gly Lys Glu Leu Ser Gly Lys Gln Ile Gln Val 290 295 300ccc aag gag cag cac agc tat gag att ctt ggt ttg ctg cct gga acc 960Pro Lys Glu Gln His Ser Tyr Glu Ile Leu Gly Leu Leu Pro Gly Thr305 310 315 320aag tac ata gtc acc ctg cgt aac gtc aag aat gaa gtt tct agc agc 1008Lys Tyr Ile Val Thr Leu Arg Asn Val Lys Asn Glu Val Ser Ser Ser 325 330 335cca cag cat cta ctt gcc acc aca gac ctt gct gtg ctt ggc act gcc 1056Pro Gln His Leu Leu Ala Thr Thr Asp Leu Ala Val Leu Gly Thr Ala 340 345 350tgg gtg aca gat gag act gag aac tcc ctt gac gtg gag tgg gaa aac 1104Trp Val Thr Asp Glu Thr Glu Asn Ser Leu Asp Val Glu Trp Glu Asn 355 360 365ccc tca act gag gtg gac tac tac aag ctg cga tat ggc ccc atg aca 1152Pro Ser Thr Glu Val Asp Tyr Tyr Lys Leu Arg Tyr Gly Pro Met Thr 370 375 380gga cag gag gta gct gag gtc act gtg ccc aag agc agt gac ccc aag 1200Gly Gln Glu Val Ala Glu Val Thr Val Pro Lys Ser Ser Asp Pro Lys385 390 395 400agc cga tat gac atc act ggt ctg cac ccg ggg act gag tat aag atc 1248Ser Arg Tyr Asp Ile Thr Gly Leu His Pro Gly Thr Glu Tyr Lys Ile 405 410 415acg gtg gtg ccc atg aga gga gag ctg gag ggc aag ccg atc ctc ctg 1296Thr Val Val Pro Met Arg Gly Glu Leu Glu Gly Lys Pro Ile Leu Leu 420 425 430aat ggc agg aca gaa att gac agt cca acc aat gtt gtc act gat cga 1344Asn Gly Arg Thr Glu Ile Asp Ser Pro Thr Asn Val Val Thr Asp Arg 435 440 445gtg act gaa gac aca gca act gtc tcc tgg gac cca gtg cag gct gtc 1392Val Thr Glu Asp Thr Ala Thr Val Ser Trp Asp Pro Val Gln Ala Val 450 455 460ata gac aag tat gta gtg cgc tac act tct gct gat ggg gac acc aag 1440Ile Asp Lys Tyr Val Val Arg Tyr Thr Ser Ala Asp Gly Asp Thr Lys465 470 475 480gaa atg gca gtg cac aag gat gag agc agc act gtc ctg acg ggc ctg 1488Glu Met Ala Val His Lys Asp Glu Ser Ser Thr Val Leu Thr Gly Leu 485 490 495aag cca gga gag gca tac aag gtc tac gtg tgg gct gaa agg ggc aac 1536Lys Pro Gly Glu Ala Tyr Lys Val Tyr Val Trp Ala Glu Arg Gly Asn 500 505 510cag ggg agc aag aaa gct gac acc aat gcc ctc aca gaa att gac agc 1584Gln Gly Ser Lys Lys Ala Asp Thr Asn Ala Leu Thr Glu Ile Asp Ser 515 520 525cca gca aac ctg gtg act gac cgg gtg act gag aat acc gcc acc atc 1632Pro Ala Asn Leu Val Thr Asp Arg Val Thr Glu Asn Thr Ala Thr Ile 530 535 540tcc tgg gac ccg gta cag gcc acc att gac aag tac gtg gtg cgc tac 1680Ser Trp Asp Pro Val Gln Ala Thr Ile Asp Lys Tyr Val Val Arg Tyr545 550 555 560acc tct gct gac gac caa gag acc aga gag gtt ctg gtg ggg aag gag 1728Thr Ser Ala Asp Asp Gln Glu Thr Arg Glu Val Leu Val Gly Lys Glu 565 570 575cag agc agc act gtc ctg aca ggc ctg agg cca ggt gtg gag tac aca 1776Gln Ser Ser Thr Val Leu Thr Gly Leu Arg Pro Gly Val Glu Tyr Thr 580 585 590gtg cat gtc tgg gcc cag aag ggg gac cga gag agc aag aag gct gac 1824Val His Val Trp Ala Gln Lys Gly Asp Arg Glu Ser Lys Lys Ala Asp 595 600 605acc aac gcc ccg aca gat att gac agc ccc aaa aac ctg gtg act gac 1872Thr Asn Ala Pro Thr Asp Ile Asp Ser Pro Lys Asn Leu Val Thr Asp 610 615 620cgg gtg aca gag aat atg gcc acg gtc tcc tgg gac ccg gtg cag gcc 1920Arg Val Thr Glu Asn Met Ala Thr Val Ser Trp Asp Pro Val Gln Ala625 630 635 640gcc att gac aag tac gtg gtg cgc tac acc tct gct ggt gga gag acc 1968Ala Ile Asp Lys Tyr Val Val Arg Tyr Thr Ser Ala Gly Gly Glu Thr 645 650 655agg gag gtt ccg gtg ggg aag gag cag agc agc aca gtc ctg aca ggc 2016Arg Glu Val Pro Val Gly Lys Glu Gln Ser Ser Thr Val Leu Thr Gly 660 665 670ctg aga ccg ggt atg gag tac atg gtg cac gtg tgg gcc cag aag ggg 2064Leu Arg Pro Gly Met Glu Tyr Met Val His Val Trp Ala Gln Lys Gly 675 680 685gac cag gag agc aag aag gcc gac acc aag gcc cag aca gac att gac 2112Asp Gln Glu Ser Lys Lys Ala Asp Thr Lys Ala Gln Thr Asp Ile Asp 690 695 700agc ccc caa aac ctg gtg acc gac cgg gtg aca gag aat atg gcc act 2160Ser Pro Gln Asn Leu Val Thr Asp Arg Val Thr Glu Asn Met Ala Thr705 710 715 720gtc tcc tgg gac ccg gtg cgg gcc acc att gac agg tat gtg gtg cgc 2208Val Ser Trp Asp Pro Val Arg Ala Thr Ile Asp Arg Tyr Val Val Arg 725 730 735tac acc tct gcc aag gac gga gag acc agg gag gtt ccg gtg ggg aag 2256Tyr Thr Ser Ala Lys Asp Gly Glu Thr Arg Glu Val Pro Val Gly Lys 740 745 750gag cag agt agc act gtc ctg acg ggc ctg agg ccg ggt gtg gag tac 2304Glu Gln Ser Ser Thr Val Leu Thr Gly Leu Arg Pro Gly Val Glu Tyr 755 760 765acg gtg cac gtg tgg gcc cag aag ggg gcc cag gag agc aag aag gct 2352Thr Val His Val Trp Ala Gln Lys Gly Ala Gln Glu Ser Lys Lys Ala 770 775 780gac acc aag gcc cag aca gac att gac agc ccc caa aac ctg gtc act 2400Asp Thr Lys Ala Gln Thr Asp Ile Asp Ser Pro Gln Asn Leu Val Thr785 790 795 800gac tgg gtg aca gag aat aca gcc act gtc tcc tgg gac ccg gtg cag 2448Asp Trp Val Thr Glu Asn Thr Ala Thr Val Ser Trp Asp Pro Val Gln 805 810 815gcc acc att gac agg tat gtg gtg cac tac acg tct gcc aac gga gag 2496Ala Thr Ile Asp Arg Tyr Val Val His Tyr Thr Ser Ala Asn Gly Glu 820 825 830acc agg gag gtt cca gtg ggg aag gag cag agc agc act gtc ctg acg 2544Thr Arg Glu Val Pro Val Gly Lys Glu Gln Ser Ser Thr Val Leu Thr 835 840 845ggc ctg agg ccg ggc atg gag tac acg gtg cac gtg tgg gcc cag aag 2592Gly Leu Arg Pro Gly Met Glu Tyr Thr Val His Val Trp Ala Gln Lys 850 855 860ggg aac cag gag agc aag aag gct gac acc aag gcc cag aca gaa att 2640Gly Asn Gln Glu Ser Lys Lys Ala Asp Thr Lys Ala Gln Thr Glu Ile865 870 875 880gac ggc ccc aaa aac cta gtg act gac tgg gtg acg gag aat atg gcc 2688Asp Gly Pro Lys Asn Leu Val Thr Asp Trp Val Thr Glu Asn Met Ala 885 890 895act gtc tcc tgg gac ccg gtt cag gcc acc att gac aag tac atg gtg 2736Thr Val Ser Trp Asp Pro Val Gln Ala Thr Ile Asp Lys Tyr Met Val 900 905 910cgc tac acc tct gct gac gga gag acc agg gag gtt ccg gtg ggg aag 2784Arg Tyr Thr Ser Ala Asp Gly Glu Thr Arg Glu Val Pro Val Gly Lys 915 920 925gag cac agc agc act gtc ctg acg ggc ctg aga cca ggc atg gag tac 2832Glu His Ser Ser Thr Val Leu Thr Gly Leu Arg Pro Gly Met Glu Tyr 930 935 940atg gtg cac gtg tgg gcc cag aag ggg gcc cag gag agc aag aag gct 2880Met Val His Val Trp Ala Gln Lys Gly Ala Gln Glu Ser Lys Lys Ala945 950 955 960gac acc aag gcc

cag aca gaa ctc gac cct ccc aga aac ctt cgt cca 2928Asp Thr Lys Ala Gln Thr Glu Leu Asp Pro Pro Arg Asn Leu Arg Pro 965 970 975tct gct gta acg cag tct ggt ggc ata ttg acc tgg acg ccc ccc tct 2976Ser Ala Val Thr Gln Ser Gly Gly Ile Leu Thr Trp Thr Pro Pro Ser 980 985 990gct cag atc cac ggc tac att ctg act tac cag ttc cca gat ggc aca 3024Ala Gln Ile His Gly Tyr Ile Leu Thr Tyr Gln Phe Pro Asp Gly Thr 995 1000 1005gtt aag gag atg cag ctg gga cgg gaa gac cag agg ttt gcg ttg caa 3072Val Lys Glu Met Gln Leu Gly Arg Glu Asp Gln Arg Phe Ala Leu Gln 1010 1015 1020ggc ctt gag caa ggc gcc acc tac cct gtc tcc ctt gtt gcc ttt aag 3120Gly Leu Glu Gln Gly Ala Thr Tyr Pro Val Ser Leu Val Ala Phe Lys1025 1030 1035 1040ggt ggt cgc cgg agc aga aat gta tcc acc acc ctc tcc aca gtt ggt 3168Gly Gly Arg Arg Ser Arg Asn Val Ser Thr Thr Leu Ser Thr Val Gly 1045 1050 1055gcc cgt ttc cca cac cct tcg gac tgc agt cag gtt cag cag aac agc 3216Ala Arg Phe Pro His Pro Ser Asp Cys Ser Gln Val Gln Gln Asn Ser 1060 1065 1070aat gcc gcc agt ggt ctg tac acc atc tac ctg cat ggc gat gcc agc 3264Asn Ala Ala Ser Gly Leu Tyr Thr Ile Tyr Leu His Gly Asp Ala Ser 1075 1080 1085cgg ccc ctg cag gtg tac tgt gac atg gaa acg gac gga ggt ggc tgg 3312Arg Pro Leu Gln Val Tyr Cys Asp Met Glu Thr Asp Gly Gly Gly Trp 1090 1095 1100att gtc ttc cag agg cgg aac act ggg cag ctg gat ttc ttc aag cga 3360Ile Val Phe Gln Arg Arg Asn Thr Gly Gln Leu Asp Phe Phe Lys Arg1105 1110 1115 1120tgg agg agc tat gtg gaa ggc ttt ggg gac ccc atg aag gag ttc tgg 3408Trp Arg Ser Tyr Val Glu Gly Phe Gly Asp Pro Met Lys Glu Phe Trp 1125 1130 1135ctt gga ctt gac aag cta cac aac ctc acc acc ggc act cca gcg cgg 3456Leu Gly Leu Asp Lys Leu His Asn Leu Thr Thr Gly Thr Pro Ala Arg 1140 1145 1150tat gag gtg aga gtg gat tta cag act gcc aat gaa tct gcc tat gct 3504Tyr Glu Val Arg Val Asp Leu Gln Thr Ala Asn Glu Ser Ala Tyr Ala 1155 1160 1165ata tat gat ttc ttc caa gtg gcc tcc agc aag gag cgg tat aag ctg 3552Ile Tyr Asp Phe Phe Gln Val Ala Ser Ser Lys Glu Arg Tyr Lys Leu 1170 1175 1180aca gtt ggg aaa tac aga ggc acg gca ggg gat gct ctt act tac cac 3600Thr Val Gly Lys Tyr Arg Gly Thr Ala Gly Asp Ala Leu Thr Tyr His1185 1190 1195 1200aat gga tgg aag ttt aca act ttt gac aga gac aat gat atc gca ctc 3648Asn Gly Trp Lys Phe Thr Thr Phe Asp Arg Asp Asn Asp Ile Ala Leu 1205 1210 1215agc aac tgt gcc ctg aca cat cat ggt ggc tgg tgg tat aag aac tgc 3696Ser Asn Cys Ala Leu Thr His His Gly Gly Trp Trp Tyr Lys Asn Cys 1220 1225 1230cac ttg gcc aac cct aat ggc aga tat ggg gag acc aag cac agt gag 3744His Leu Ala Asn Pro Asn Gly Arg Tyr Gly Glu Thr Lys His Ser Glu 1235 1240 1245ggg gtg aac tgg gag cct tgg aaa gga cat gaa ttc tcc att cct tac 3792Gly Val Asn Trp Glu Pro Trp Lys Gly His Glu Phe Ser Ile Pro Tyr 1250 1255 1260gtg gag ttg aaa atc cgc cct cat ggc tac agc agg gag cct gtc ctg 3840Val Glu Leu Lys Ile Arg Pro His Gly Tyr Ser Arg Glu Pro Val Leu1265 1270 1275 1280ggc aga aag aag cgg acg ctg aga gga agg ctg cga acg ttc tga 3885Gly Arg Lys Lys Arg Thr Leu Arg Gly Arg Leu Arg Thr Phe * 1285 129041294PRTHomo sapiens 4Met Phe Arg Phe Pro Met Gly Leu Leu Leu Gly Ser Val Leu Leu Val 1 5 10 15Ala Ser Ala Pro Ala Thr Leu Glu Pro Pro Gly Cys Ser Asn Lys Glu 20 25 30Gln Gln Val Thr Val Ser His Thr Tyr Lys Ile Asp Val Pro Lys Ser 35 40 45Ala Leu Val Gln Val Asp Ala Asp Pro Gln Pro Leu Ser Asp Asp Gly 50 55 60Ala Ser Leu Leu Ala Leu Gly Glu Ala Arg Glu Glu Gln Asn Ile Ile65 70 75 80Phe Arg His Asn Ile Arg Leu Gln Thr Pro Gln Lys Asp Cys Glu Leu 85 90 95Ala Gly Ser Val Gln Asp Leu Leu Ala Arg Val Lys Lys Leu Glu Glu 100 105 110Glu Met Val Glu Met Lys Glu Gln Cys Ser Ala Gln Arg Cys Cys Gln 115 120 125Gly Val Thr Asp Leu Ser Arg His Cys Ser Gly His Gly Thr Phe Ser 130 135 140Leu Glu Thr Cys Ser Cys His Cys Glu Glu Gly Arg Glu Gly Pro Ala145 150 155 160Cys Glu Arg Leu Ala Cys Pro Gly Ala Cys Ser Gly His Gly Arg Cys 165 170 175Val Asp Gly Arg Cys Leu Cys His Glu Pro Tyr Val Gly Ala Asp Cys 180 185 190Gly Tyr Pro Ala Cys Pro Glu Asn Cys Ser Gly His Gly Glu Cys Val 195 200 205Arg Gly Val Cys Gln Cys His Glu Asp Phe Met Ser Glu Asp Cys Ser 210 215 220Glu Lys Arg Cys Pro Gly Asp Cys Ser Gly His Gly Phe Cys Asp Thr225 230 235 240Gly Glu Cys Tyr Cys Glu Glu Gly Phe Thr Gly Leu Asp Cys Ala Gln 245 250 255Val Val Thr Pro Gln Gly Leu Gln Leu Leu Lys Asn Thr Glu Asp Ser 260 265 270Leu Leu Val Ser Trp Glu Pro Ser Ser Gln Val Asp His Tyr Leu Leu 275 280 285Ser Tyr Tyr Pro Leu Gly Lys Glu Leu Ser Gly Lys Gln Ile Gln Val 290 295 300Pro Lys Glu Gln His Ser Tyr Glu Ile Leu Gly Leu Leu Pro Gly Thr305 310 315 320Lys Tyr Ile Val Thr Leu Arg Asn Val Lys Asn Glu Val Ser Ser Ser 325 330 335Pro Gln His Leu Leu Ala Thr Thr Asp Leu Ala Val Leu Gly Thr Ala 340 345 350Trp Val Thr Asp Glu Thr Glu Asn Ser Leu Asp Val Glu Trp Glu Asn 355 360 365Pro Ser Thr Glu Val Asp Tyr Tyr Lys Leu Arg Tyr Gly Pro Met Thr 370 375 380Gly Gln Glu Val Ala Glu Val Thr Val Pro Lys Ser Ser Asp Pro Lys385 390 395 400Ser Arg Tyr Asp Ile Thr Gly Leu His Pro Gly Thr Glu Tyr Lys Ile 405 410 415Thr Val Val Pro Met Arg Gly Glu Leu Glu Gly Lys Pro Ile Leu Leu 420 425 430Asn Gly Arg Thr Glu Ile Asp Ser Pro Thr Asn Val Val Thr Asp Arg 435 440 445Val Thr Glu Asp Thr Ala Thr Val Ser Trp Asp Pro Val Gln Ala Val 450 455 460Ile Asp Lys Tyr Val Val Arg Tyr Thr Ser Ala Asp Gly Asp Thr Lys465 470 475 480Glu Met Ala Val His Lys Asp Glu Ser Ser Thr Val Leu Thr Gly Leu 485 490 495Lys Pro Gly Glu Ala Tyr Lys Val Tyr Val Trp Ala Glu Arg Gly Asn 500 505 510Gln Gly Ser Lys Lys Ala Asp Thr Asn Ala Leu Thr Glu Ile Asp Ser 515 520 525Pro Ala Asn Leu Val Thr Asp Arg Val Thr Glu Asn Thr Ala Thr Ile 530 535 540Ser Trp Asp Pro Val Gln Ala Thr Ile Asp Lys Tyr Val Val Arg Tyr545 550 555 560Thr Ser Ala Asp Asp Gln Glu Thr Arg Glu Val Leu Val Gly Lys Glu 565 570 575Gln Ser Ser Thr Val Leu Thr Gly Leu Arg Pro Gly Val Glu Tyr Thr 580 585 590Val His Val Trp Ala Gln Lys Gly Asp Arg Glu Ser Lys Lys Ala Asp 595 600 605Thr Asn Ala Pro Thr Asp Ile Asp Ser Pro Lys Asn Leu Val Thr Asp 610 615 620Arg Val Thr Glu Asn Met Ala Thr Val Ser Trp Asp Pro Val Gln Ala625 630 635 640Ala Ile Asp Lys Tyr Val Val Arg Tyr Thr Ser Ala Gly Gly Glu Thr 645 650 655Arg Glu Val Pro Val Gly Lys Glu Gln Ser Ser Thr Val Leu Thr Gly 660 665 670Leu Arg Pro Gly Met Glu Tyr Met Val His Val Trp Ala Gln Lys Gly 675 680 685Asp Gln Glu Ser Lys Lys Ala Asp Thr Lys Ala Gln Thr Asp Ile Asp 690 695 700Ser Pro Gln Asn Leu Val Thr Asp Arg Val Thr Glu Asn Met Ala Thr705 710 715 720Val Ser Trp Asp Pro Val Arg Ala Thr Ile Asp Arg Tyr Val Val Arg 725 730 735Tyr Thr Ser Ala Lys Asp Gly Glu Thr Arg Glu Val Pro Val Gly Lys 740 745 750Glu Gln Ser Ser Thr Val Leu Thr Gly Leu Arg Pro Gly Val Glu Tyr 755 760 765Thr Val His Val Trp Ala Gln Lys Gly Ala Gln Glu Ser Lys Lys Ala 770 775 780Asp Thr Lys Ala Gln Thr Asp Ile Asp Ser Pro Gln Asn Leu Val Thr785 790 795 800Asp Trp Val Thr Glu Asn Thr Ala Thr Val Ser Trp Asp Pro Val Gln 805 810 815Ala Thr Ile Asp Arg Tyr Val Val His Tyr Thr Ser Ala Asn Gly Glu 820 825 830Thr Arg Glu Val Pro Val Gly Lys Glu Gln Ser Ser Thr Val Leu Thr 835 840 845Gly Leu Arg Pro Gly Met Glu Tyr Thr Val His Val Trp Ala Gln Lys 850 855 860Gly Asn Gln Glu Ser Lys Lys Ala Asp Thr Lys Ala Gln Thr Glu Ile865 870 875 880Asp Gly Pro Lys Asn Leu Val Thr Asp Trp Val Thr Glu Asn Met Ala 885 890 895Thr Val Ser Trp Asp Pro Val Gln Ala Thr Ile Asp Lys Tyr Met Val 900 905 910Arg Tyr Thr Ser Ala Asp Gly Glu Thr Arg Glu Val Pro Val Gly Lys 915 920 925Glu His Ser Ser Thr Val Leu Thr Gly Leu Arg Pro Gly Met Glu Tyr 930 935 940Met Val His Val Trp Ala Gln Lys Gly Ala Gln Glu Ser Lys Lys Ala945 950 955 960Asp Thr Lys Ala Gln Thr Glu Leu Asp Pro Pro Arg Asn Leu Arg Pro 965 970 975Ser Ala Val Thr Gln Ser Gly Gly Ile Leu Thr Trp Thr Pro Pro Ser 980 985 990Ala Gln Ile His Gly Tyr Ile Leu Thr Tyr Gln Phe Pro Asp Gly Thr 995 1000 1005Val Lys Glu Met Gln Leu Gly Arg Glu Asp Gln Arg Phe Ala Leu Gln 1010 1015 1020Gly Leu Glu Gln Gly Ala Thr Tyr Pro Val Ser Leu Val Ala Phe Lys1025 1030 1035 1040Gly Gly Arg Arg Ser Arg Asn Val Ser Thr Thr Leu Ser Thr Val Gly 1045 1050 1055Ala Arg Phe Pro His Pro Ser Asp Cys Ser Gln Val Gln Gln Asn Ser 1060 1065 1070Asn Ala Ala Ser Gly Leu Tyr Thr Ile Tyr Leu His Gly Asp Ala Ser 1075 1080 1085Arg Pro Leu Gln Val Tyr Cys Asp Met Glu Thr Asp Gly Gly Gly Trp 1090 1095 1100Ile Val Phe Gln Arg Arg Asn Thr Gly Gln Leu Asp Phe Phe Lys Arg1105 1110 1115 1120Trp Arg Ser Tyr Val Glu Gly Phe Gly Asp Pro Met Lys Glu Phe Trp 1125 1130 1135Leu Gly Leu Asp Lys Leu His Asn Leu Thr Thr Gly Thr Pro Ala Arg 1140 1145 1150Tyr Glu Val Arg Val Asp Leu Gln Thr Ala Asn Glu Ser Ala Tyr Ala 1155 1160 1165Ile Tyr Asp Phe Phe Gln Val Ala Ser Ser Lys Glu Arg Tyr Lys Leu 1170 1175 1180Thr Val Gly Lys Tyr Arg Gly Thr Ala Gly Asp Ala Leu Thr Tyr His1185 1190 1195 1200Asn Gly Trp Lys Phe Thr Thr Phe Asp Arg Asp Asn Asp Ile Ala Leu 1205 1210 1215Ser Asn Cys Ala Leu Thr His His Gly Gly Trp Trp Tyr Lys Asn Cys 1220 1225 1230His Leu Ala Asn Pro Asn Gly Arg Tyr Gly Glu Thr Lys His Ser Glu 1235 1240 1245Gly Val Asn Trp Glu Pro Trp Lys Gly His Glu Phe Ser Ile Pro Tyr 1250 1255 1260Val Glu Leu Lys Ile Arg Pro His Gly Tyr Ser Arg Glu Pro Val Leu1265 1270 1275 1280Gly Arg Lys Lys Arg Thr Leu Arg Gly Arg Leu Arg Thr Phe 1285 1290525DNAMus musculusprimer_bind(1)...(25)First polymerase chain reaction primer 5tagcagccca cagcatctac ttgcc 25627DNAMus musculusprimer_bind(1)...(27)First polymerase chain reaction primer 6attgctgttc tgctgaacct gactgca 27734DNAMus musculusprimer_bind(1)...(34)Second polymerase chain reaction primer 7atggatccag aaattgacgg ccccaaaaac ctag 34833DNAMus musculusprimer_bind(1)...(33)Second polymerase chain reaction primer 8ataagcttgt ggagagggtg gtggatacat ttc 33924DNAMus musculusprimer_bind(1)...(24)First PCR primer for sequencing 5' end 9aggagatggt ggctgtattt tcgg 241024DNAMus musculusprimer_bind(1)...(24)First PCR primer for sequencing 5' end 10agcctcttgc tgagtggaga tgcc 241130DNAMus musculusprimer_bind(1)...(30)Second PCR primer for sequencing 5' end 11tagaattcgg tcacctgatt ggtcactagg 301222DNAMus musculusprimer_bind(1)...(22)Second PCR primer for sequencing 5' end 12ttatgatgtg ccagattatg cc 221326DNAMus musculusprimer_bind(1)...(26)First PCR reaction for sequencing 3' end 13ctcaaattga tggctacatt ttgacc 261424DNAMus musculusprimer_bind(1)...(24)First PCR primer for sequencing 3' end 14aagccgacaa ccttgattgg agac 241522DNAMus musculusprimer_bind(1)...(22)Second PCR primer for sequencing 3' end 15taccagttcc caaatggcac cg 221621DNAMus musculusprimer_bind(1)...(21)Second PCR primer for sequencing 3' end 16aaacctctgg cgaagaagtc c 211720DNAHomo sapiensprimer_bind(1)...(20)hTNW1 17catcctggag ggtctgctcc 201820DNAHomo sapiensprimer_bind(1)...(20)hTNW2 18gggcattggt gtcagctttc 201928DNAHomo sapiensprimer_bind(1)...(28)hTNW3 19gactcgagct ttccaaggat gagtctcc 282026DNAHomo sapiensprimer_bind(1)...(26)hTNW4 20gaggatcccc tggttgcccc tttcag 262120DNAHomo sapiensprimer_bind(1)...(20)hTNW5 21gcgctacact tctgctgatg 202218DNAHomo sapiensprimer_bind(1)...(18)hTNW6 22ctgtggagag ggtggtgg 182327DNAHomo sapiensprimer_bind(1)...(27)hTNW7 23gactcgagtg cacaaggatg agagcag 272428DNAHomo sapiensprimer_bind(1)...(28)hTNW8 24gaggatccac ccttaaaggc aacaaggg 282520DNAHomo sapiensprimer_bind(1)...(20)hTNW9 25cgcagtctgg tggcatattg 202619DNAHomo sapiensprimer_bind(1)...(19)hTNW10 26catgatttgt tctgcgggc 192728DNAHomo sapiensprimer_bind(1)...(28)hTNW11 27gactcgagcg gctacattct gacttacc 282829DNAHomo sapiensprimer_bind(1)...(29)hTNW12 28gaggatcctc agtgatggtg atggtgatg 29

Claims

1-52. (canceled)

53. A method of diagnosing or prognosing cancer comprising: analysing a sample obtained from an individual for the presence of tenascin-W protein or tenascin-W transcript; and determining the presence of the tenascin-W protein or the tenascin-W transcript in the sample by a detection method, wherein the detection of the presence of the tenascin-W protein or the tenascin-W transcript in the sample using the detection method indicates an unfavorable prognosis or diagnosis.

54. The method of claim 53, wherein in the step of determining, the presence of the tenascin-W protein or the tenascin-W transcript is indicated by an elevated level of the tenascin-W protein or the tenascin-W transcript in the sample, and the detection of the elevated level of the tenascin-W protein or the tenascin-W transcript in the sample relative to healthy tissue indicates the unfavorable prognosis or diagnosis.

55. The method of claim 53, wherein the sample used in the step of analyzing is blood serum or plasma from the individual.

56. The method of claim 55, wherein the tenascin-W protein is detected in the detection method using an antibody specific for the tenascin-W protein.

57. The method of claim 55, wherein the tenascin-W transcript is detected in the detection method using a polymerase chain reaction.

58. The method of claim 53, further comprising: analyzing the sample for the presence of alpha 8 integrin expression; and determining the presence of the alpha 8 integrin expression in the sample by a second detection method, wherein the detection of the presence of the alpha 8 integrin indicates an unfavourable prognosis or diagnosis.

59. The method of claim 58, wherein the alpha 8 integrin is detected in the second detection method using an antibody specific for the alpha 8 integrin.

60. The method of claim 53, wherein the method further comprises: propagating cells in the sample in cell culture.

61. The method of claim 53, wherein the step of analysing includes a prior step of pre-treating the sample.

62. The method of claim 61, wherein the step of pre-treating includes forming a cell extract.

63. The method of claim 53, wherein the step of analysing includes detecting a control protein in the sample, and optionally normalizing a value obtained for the tenascin-W protein or the tenascin-W transcript with the control protein.