Compositions, Methods and Related Uses for Cleaving Modified DNA

Abstract

Compositions, methods and related uses are provided relating to cleaving modified DNA. For example, a set of DNA fragments obtainable by enzymatic cleavage of a large DNA is described where at least 50% are similarly sized and have a centrally positioned modified nucleotide. In addition, an enzyme preparation is provided that includes one or more enzymes that recognize a modified nucleotide in a DNA and cleave the DNA at a site that is at a non-random distance from the modified nucleotide. The one or more enzymes are further characterized by an N-terminal conserved domain with greater than 90% amino acid sequence homology to WXD(X).sub.10YXGD. The related uses include creating a methylome, methods of purifying DNA fragments containing a modified nucleotide and diagnostic applications.

Description

CROSS REFERENCE

[0001] This application claims priority from U.S. Provisional Applications Ser. No. 61/140,586 filed Dec. 23, 2008 and Ser. No. 61/267,617 filed Dec. 8, 2009, herein incorporated by reference.

BACKGROUND

[0002] DNA cleaving enzymes associated with methyltransferases are widely present in the prokaryotic genomes. The DNA cleaving enzymes typically consist of restriction endonucleases, which protect host cells from invading DNA (e.g., bacteriophages) by cleaving DNA at defined sites, and DNA methyltransferases, which protect host DNA from being degraded by methylating a specific base within the restriction endonuclease sites (Roberts, et al. Nucleic Acids Res 35: D269-270 (2007)). Hence, these restriction endonucleases are termed methylation-sensitive.

[0003] While modified bases in prokaryotes and phage DNA play a role in protecting the genome against cleavage by restriction endonucleases, methylated cytosine (m5C) is involved in gene expression of the mammalian genome. Techniques for identifying methylated DNA are cumbersome and experimentally difficult to implement in a reproducible fashion. Two approaches are commonly used. One involves the use of restriction enzymes like HpaII and MspI which are differently sensitive to cytosine methylation. For example, HpaII endonuclease is blocked by methylation of either of the two cytosines within the CCGG recognition site, but its isoschozimer, MspI, is blocked only when the outer C is methylated. It will cleave DNA when the inner cytosine is modified. The second method involves bisulfite modification of the unmethylated cytosine residues followed by selective amplification and sequencing of the remaining DNA. In this method, methylated cytosines are resistant to the treatment. This method is not easy to optimize and involves a complicated chemical modification step followed by amplification using a complicated set of primers. The method is widely used in the absence of simpler alternative approaches.

SUMMARY

[0004] In an embodiment of the invention, a set of double-stranded oligonucleotide fragments are provided that are obtainable by enzymatic cleavage of a large DNA wherein the large DNA contains one or more modified nucleotides and may be derived from mammalian cells, more specifically human cells. At least 50% of the fragments in the set should preferably be of a similar size and preferably contain a centrally positioned modified nucleotide. One or more fragments may be isolated from the set. The large DNA may be at least 100 nucleotides in length; the modified nucleotide is, for example, a modified cytosine such as a methylated cytosine or a hydroxymethylated cytosine and a modified cytosine may be proximate to a guanine to form a CpG or a CNG. However, a modified cytosine may be alternatively located next to another cytosine, an adenine or a thymidine. Oligonucleotide fragments in the set may preferably be less than 60 nucleotides long, for example 28-36 nucleotides; and/or the modified nucleotide, in particular, cytosine may be located within 30 nucleotides from either end of the fragment.

[0005] In an embodiment of the invention, an enzyme preparation is provided that is characterized by one or more enzymes that recognize a modified nucleotide in a DNA such that each enzyme is capable of cleaving the DNA at a site that is a non-random distance from the modified nucleotide. More particularly, the non-random distance between the cleavage site and the modified nucleotide may be characteristic for the enzyme so as to generate a set of fragments of the type described above. The one or more enzymes are further characterized by an N-terminal conserved domain with greater than 90% amino acid sequence homology with WXD(X).sub.10YXGD, more particularly with greater than 90% amino acid sequence homology with WXD(X).sub.6G(X).sub.3YXGD(X).sub.10-15GN(X).sub.2L X.sub.10-20PX.sub.3F.

[0006] In an embodiment of the invention, the one or more enzymes in the enzyme preparation are further defined by a recognition domain and a cleavage domain within a single open reading frame. The cleavage domain may have an amino acid sequence which has greater than 90% amino acid sequence homology to FEX.sub.20-30DX.sub.2-4DX.sub.19-22(Q/E)XK. In addition, at least one of the enzymes may have an amino acid sequence homology of greater than 90% to any of the sequences identified as SEQ ID NOS:7-22. Additionally, one or more of the enzymes may be covalently or non-covalently linked or fused to a protein affinity tag or other tag. Examples of suitable affinity tags include a chitin-binding domain, maltose-binding domain, an antibody and a His tag. In addition, the one or more enzymes may be recognized by an antibody with binding specificity for an amino acid sequence comprising WXD(X).sub.10YXGD. Additionally, the preparation may include an activator DNA.

[0007] In an embodiment of the invention, an enzyme preparation is provided that includes one or more enzymes that recognize a modified nucleotide in a DNA such that each enzyme is capable of cleaving the double-stranded DNA at a site that is at a non-random distance from the modified nucleotide, more particularly where the distance between the cleavage site and the modified nucleotide is characteristic for the enzyme, thereby generating a set of fragments. The set of fragments may be of similar size if the DNA contains a modified nucleotide on each strand of the duplex at approximately opposing positions or may be of varying size for hemi-modified DNA. The one or more enzymes may be further characterized by an N-terminal conserved domain with greater than 90% amino acid sequence homology to WXD(X).sub.10YXGD.

[0008] In an embodiment of the invention, an antibody is provided that is capable of recognizing and binding to an N-terminal domain of an enzyme described above.

[0009] In an embodiment of the invention, a method is provided which comprises cleaving a large DNA containing one or more modified nucleotides with a composition described above and obtaining a set of oligonucleotide fragments. The method may further include separating the set of oligonucleotide fragments from uncleaved DNA and additionally may include sequencing from the separated set of fragments at least one fragment to determine the location of one or more modified nucleotides contained within at least one fragment. The method may include analyzing some or all of the oligonucleotide fragments for the presence and location of one or more modified nucleotides in the large DNA by sequencing or other means and mapping the sequences onto a genome or methylome map to determine the location of modified nucleotides.

[0010] In an embodiment of the invention, a method is provided for identifying an enzyme such as described above that includes searching a sequence database using a sequence selected from the group consisting of SEQ ID NO:7-22 and variants thereof, and identifying additional sequences having an N-terminal region characterized by a consensus sequence of WXD(X).sub.10YXGD. The method may include the further step of identifying a C-terminal end comprising a catalytic domain with a consensus sequence of FEX.sub.20-30DX.sub.2-4DX.sub.19-22(Q/E)XK, more particularly FE(X).sub.2A(X).sub.15-18 T/SX.sub.4DGGXDX.sub.2G/LX.sub.15-20E/QAK.

[0011] In an embodiment of the invention, a method is provided for isolating from a mixture of DNA fragments those DNA fragments containing one or more modified nucleotides, the mixture resulting from enzyme cleavage of a large DNA containing at least one modified nucleotide. The method may include adding to the mixture an immobilized or labeled affinity-binding molecule that is capable of binding selectively those fragments containing a modified nucleotide. Alternatively, those fragments containing a modified nucleotide may be size-separated from those fragments that do not contain a modified nucleotide. An example of an affinity-binding molecule is an enzyme preparation described above, wherein the one or more enzymes in the enzyme preparation have been mutated so as to lack enzyme cleavage activity and wherein the mutated enzyme is immobilized on a solid surface so as to bind the DNA fragments containing one or more modified nucleotides. Other examples of affinity-binding molecules include antibodies, inactivated T4 glucosyltransferase and the methyl-binding domain of a cell protein such as DNMT1. These molecules may in turn be fused to any of a chitin-binding domain, a maltose-binding domain or a biotin molecule for example and hence, bind to a suitable column.

[0012] In another embodiment of the invention, a method is provided for identifying a present or future phenotypic property in a cell preparation or tissue sample from a pattern of modified nucleotides. The method includes cleaving into fragments a large DNA from a cell preparation or tissue by means of an enzyme preparation described above; and comparing a location for modified nucleotides in the fragments with a pattern of modified nucleotides in a control DNA so as to determine a present or future phenotypic property.

[0013] In another embodiment of the invention, the above method further comprises contacting the cleavage fragments with an affinity-binding molecule capable of binding the modified nucleotide or by means of electrophoresis or other means known in the art capable of effecting size separation. The binding moiety may include an enzyme preparation as described above, wherein the enzyme cleavage activity has been inactivated by conventional means. Thus, fragments with a modified nucleotide may be separated from fragments lacking a modified nucleotide. The above method may additionally include identifying on a methylome or a genome a location for the one or more modified nucleotides in the immobilized cleavage fragments. The location may be determined by sequencing the separated fragments.

[0014] In another embodiment of the invention, a method is provided for determining the location of at least one modified nucleotide in a large DNA. The method includes: cleaving a large DNA with an enzyme preparation described above; obtaining a set of oligonucleotide cleavage products containing at least one modified nucleotide; and determining the location of the at least one modified nucleotide in a sequence of the large DNA by for example sequencing the set of oligonucleotide cleavage products. The number of oligonucleotide fragments for sequencing in the set may depend on whether the set is derived from cloned DNA or from repeats in which it may be sufficient to sequence a subset of fragments or on whether the set is expected to contain unique sequences in which it may be desirable to sequence substantially all the fragments in the set.

[0015] In an embodiment of the invention, a method is provided for obtaining a purified preparation of fragments containing one or more modified nucleotides that includes contacting a mixture of DNA fragments in which one or more the fragments contain at least one modified nucleotide with an immobilized affinity-binding protein capable of binding covalently or non-covalently to the DNA fragment. An example of an affinity-binding protein is a mutated enzyme in the enzyme preparation described above, wherein the enzyme cleavage activity has been inactivated. The method may further include binding the one or more fragments containing at least one modified nucleotide to the binding protein; and obtaining a purified preparation of fragments containing one or more modified nucleotides.

[0016] In an embodiment of the invention, a kit for generating oligonucleotide fragments containing a modified nucleotide is provided that includes an enzyme preparation described above in a container with instructions for use. The kit may further include an activator molecule.

BRIEF DESCRIPTION OF THE FIGURES

[0017] FIGS. 1A-1B show the MspJI RM system.

[0018] FIG. 1A shows the genomic segment of Mycobacterium sp. JLS encoding the MspJI RM system. NCBI annotations for open reading frames are: MjIs0821, putative helicase; MjIs0822 (MspJI), restriction endonuclease; MjIs0823 (V.MspJIP), DNA mismatch endonuclease vsr; MjIs0824 (M.MspJI), DNA cytosine methyltransferase.

[0019] FIG. 1B shows the schematic domain structure of the MspJI enzyme family. The N-terminal domain is defined here as about 50% of the protein sequence upstream of the remaining C-terminal domain.

[0020] FIG. 1C shows the conserved motif in the N-terminal domain.

[0021] FIG. 1D shows the conserved motif in the C-terminal domain.

[0022] FIG. 2A shows modification-dependent enzyme activity for MspJI.

[0023] Lane 1, 1 .mu.g of pBR322(dcm+) DNA only;

[0024] Lane 2, 1 .mu.g of pBR322(dcm+)+0.8 .mu.g MspJI;

[0025] Lane 3, 1 .mu.g of pBR322(dcm+)+0.8 .mu.g MspJI+10 units of BstNI;

[0026] Lane 4, 1 .mu.g of pBR322(dcm+)+10 units of BstNI only;

[0027] Lane 5, 1 .mu.g of pBR322(dcm-) DNA only; and

[0028] Lane 6, 1 .mu.g of pBR322(dcm-)+0.8 .mu.g MspJI.

[0029] All reactions were incubated at 37.degree. C. for 1 hour and resolved on a 1% agarose gel. Lanes 3 and 4 show that MspJI does not cut any sites not cut by BstNI. Thus, on this substrate which is methylated at CmC A/T GG, only modified Dcm sites are cut by MspJI. All Dcm sites are cut by BstNI which is not sensitive to Dcm methylation.

[0030] FIG. 2B shows MspJI digestion on pBR322(dcm-) methylated at other sites. All reactions were done in 50 .mu.l volume at 37.degree. C. for 2 hours and resolved on 1% agarose gel. 0.8 .mu.g of MspJI were used in all reactions.

[0031] Lane 1, 1 .mu.g of M.MspI (C.sup.mCGG) modified pBR322;

[0032] Lane 2, 1 .mu.g of M.HaeIII (GG.sup.mCC) modified pBR322;

[0033] Lane 3, 1 .mu.g of M.HpaII (C.sup.mCGG) modified pBR322;

[0034] Lane 4, 1 .mu.g of M.HhaI (G.sup.mCGC) modified pBR322; and

[0035] Lane 5, 1 .mu.g of M.AluI (AG.sup.mCT) modified pBR322.

[0036] FIG. 2C shows MspJI digestion on hydroxymethylcytosine-containing DNA. All reactions were carried out in 50 .mu.l volume at 37.degree. C. for 1 hour.

[0037] Lane 1, 1 .mu.g of T4 wild-type (wt) DNA with glucosylated hydroxymethylcytosine;

[0038] Lane 2, 1 .mu.g of T4 gt DNA with hydroxymethylcytosine;

[0039] Lane 3, 1 .mu.g of T4 wt DNA+10 units of McrBC;

[0040] Lane 4, 1 .mu.g of T4 gt DNA+10 units of McrBC;

[0041] Lane 5, 1 .mu.g of T4 wt DNA+20 units of MspI;

[0042] Lane 6, 1 .mu.g of T4 gt DNA+20 units of MspI;

[0043] Lane 7, 1 .mu.g of T4 wt DNA+0.8 .mu.g of MspJI; and

[0044] Lanes 8 through 11, 1 .mu.g of T4 gt DNA with 2-fold serially-diluted MspJI starting at 1.6 .mu.g (Lane 8).

[0045] FIG. 2D shows the effect of different amounts of a DNA activator on MspJI activity. From Lanes 1 to 5, each reaction contains 1 .mu.g (0.35 pmol) pBR322 and 1.6 pmol MspJI. Lanes 1-4 show a titration (40, 20, 10, 5 pmol) of the DNA activator containing methylated CCWGG sites. Lane 5 shows pBR322-digestion using MspJI without DNA activator. Lane 6 shows pBR322-digestion using BstNI (CCWGG).

[0046] FIG. 3 shows a schematic diagram of MspJI's cleavage activity on fully-methylated DNA. The double-stranded cleavage can happen at either side of the methylated site. The cleavage is on the 3' side of the recognized methylated base. In this figure, when the top strand methylated cytosine is recognized, MspJI cleaves on the right side; when the bottom strand methylated cytosine is recognized, MspJI cleaves on the left side. The distances from the cleavage sites to the recognized methylated cytosine are fixed. For example, when top strand methylated cytosine is recognized, the bottom strand nicking site is 16 nucleotides away from it and the top strand nicking site is 12 nucleotides away from it.

[0047] FIGS. 4A-4D show MspJI cleavage on fully-methylated and hemi-methylated oligo substrates, fractionated on a denaturing gel.

[0048] FIG. 4A shows the expected enzyme cleavage sites (designated Rt, Rb, Lt, Lb) in a synthetic double-stranded oligonucleotide TGGTAATAATAAGGTTGAGGACTTTTTCCGGATGCCCGGAATGGGTTCAAA GG (SEQ ID NO:1). The 3' end of the top strand or the 5' end of the bottom strand is labeled with FAM as indicated in 4B.

[0049] FIG. 4B shows MspJI-digestion on fully and hemi-methylated oligo substrates.

[0050] Lane 1, no methylation, top strand labeled;

[0051] Lane 2, no methylation, bottom strand labeled;

[0052] Lane 3, both top and bottom methylated, top strand labeled;

[0053] Lane 4, both top and bottom strand methylated, bottom strand labeled; cleaved products with sizes of 8 nt and 7 nt suggest wobbling cuts in the bottom strand;

[0054] Lane 5, top strand methylated, top strand labeled;

[0055] Lane 6, top strand methylated, bottom strand labeled; as in Lane 4, cleaved products with sizes of 8 nt and 7 nt suggest wobbling cuts in the bottom strand;

[0056] Lane 7, bottom strand methylated, top strand labeled; and

[0057] Lane 8, bottom strand methylated, bottom strand labeled.

[0058] As a control, markers are run on the right side of the gel.

[0059] FIG. 4C shows an oligonucleotide sequence having a CpG and enzymatic cleavage sites that would yield a fragment with the CpG in a central location.

[0060] FIG. 4D shows digestion of the oligonucleotide shown in FIG. 4C using MspJI in the presence or absence of activator DNA. Reactions were done in 10 .mu.l at 37.degree. C. for 1 hour. The oligonucleotide is 1 pmol and MspJI is 0.4 .mu.g in each reaction. In reactions with activator, 1 .mu.l of stock (15 .mu.M) was added into the 10 .mu.l reaction. 5 .mu.l of reactions were taken out and stopped at different time points and resolved on 20% native polyacrylamide gel.

[0061] Lane 1, DNA only;

[0062] Lane 2, digestion reaction without activator at 30 min;

[0063] Lane 3, digestion reaction with activator at 30 min;

[0064] Lane 4, digestion reaction without activator at 1.5 hour; and

[0065] Lane 5, digestion reaction with activator at 1.5 hour.

[0066] FIG. 5 shows the sequence analysis of MspJI cleavage site positions on different m5C methylated sites. pBR322 DNA (dcm-) was methylated using various methyltransferases. The methyltransferases are shown under the column heading "methylase". The run-off sequencing pattern is shown under the column "examples of sequencing chromatogram" (SEQ ID NOS:2-6). The deduced cleavage patterns are shown in column "MspJI cleavage site".

[0067] FIG. 6A shows a double-stranded DNA with a centrally located modified cytosine, which is a representative fragment of the set of oligonucleotides obtained when a large DNA is cleaved with a member of the novel enzyme family.

[0068] FIG. 6B shows a DNA sample of human genomic DNA on a polyacrylamide gel in which the set of oligonucleotide fragments shown in FIG. 6A appear as a coherent band. The 32 bp band represents the pool of short fragments containing methylated CpG sites from the genome. This pool can be purified and directly put into the Next-Generation sequencing platforms for methylome analysis.

[0069] FIG. 6C shows a comparison of cleavage products generated by various member enzymes in the MspJI family. The first lane contains DNA markers. All subsequent lanes contain the digests of CpG-methyated Hela genomic DNA, each with a different MspJI family member enzyme. Lanes 1-3 and 5 show a band that corresponds to about 32 nucleotides in length (arrow). In lane 4, RlaI recognizes CCWGG and cleaves on either side of the recognition site to provide a centrally located modified cytosine. However, this sequence is not found in Hela genomic DNA.

[0070] Lane 1 shows the cleavage product from MspJI;

[0071] Lane 2 shows the cleavage product from Frankia 5336;

[0072] Lane 3 shows the cleavage product from Lpg 1234;

[0073] Lane 4 shows the cleavage product from RlaI;

[0074] Lane 5 shows the cleavage product from AspBHI; and

[0075] Lane 6 shows DNA only.

[0076] FIGS. 7-1 to 7-7 shows the amino acid sequence alignment of representative members of the MspJI family of enzymes. Residues conserved in 5 or more members of the alignment are indicated in the top line ("Conservation"). Secondary structure prediction is listed at the bottom ("Consensus_ss"). Secondary structural elements are: e, .beta. sheet; h, .alpha. helix.

[0077] FIGS. 8-1 to 8-2 shows a bioinformatics analysis of CG-centered sequences of different lengths in three organisms. Total number of CG sites are listed for each organism for human, mouse and Arabidopsis genomes. Columns report the number of CG-centered sequences that are distinct (differ in sequence), the number that are unique (occur in single copy), the fraction of the total such CG-centered sequences that are unique and the fraction of distinct CG-centered sequences that are unique (single copy).

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0078] A novel family of modification-specific DNA cleavage enzymes has been found where the members of the family recognize a modified nucleotide in double-stranded DNA and then cut at a non-random distance downstream (3' direction) from the modified nucleotide. One of the unique properties of these enzymes is that they are capable of releasing short DNA fragments containing a modified nucleotide directly from large DNA including genomic DNA. These enzymes are capable of generating double-stranded breaks in the DNA on both strands when a modified nucleotide is present in opposing positions on each strand. When DNA contains a modified nucleotide on one strand only, double strand breaks occur on one side of the modified nucleotide. The location of the modified nucleotide in a large DNA can thus be deduced by cloning the cleavage products and/or by sequencing. Using ultra high throughput sequencing platforms, it is possible to identify and map modified nucleotides such as methylated cytosines or hydroxyl-methylated cytosines in a reliable and quick manner.

[0079] "Modified" nucleotide is intended to refer to any nucleotides that contain an extra chemical group such as a 5-hydroxymethyl or 5-methyl group. For example, a "modified" cytosine generally arises in mammalian genomes as a CpG and in plant genomes as a CNG which, because of the symmetry, make possible methylation on both strands at the same position. Hydroxymethylcytosine has been recognized as a constituent of human DNA (Tahiliani et al., Science 324(5929): 930-5 (2009); Kriaucionis and Heintz, Science 324(5929): 929-30 (2009)).

[0080] "Large DNA" is intended to refer to any naturally occurring or synthetic DNA having a size greater than 100 nucleotides up to a size of a genome.

[0081] "Similar size" with reference to a "set" of oligonucleotide fragments is intended to refer to fragments that vary no more than about .+-.5 nucleotides in length. However, different "sets" of fragments may have a size range of 5-50 nucleotides.

[0082] "Centrally positioned" is intended to correspond to a location of a modified nucleotide on one strand which is approximately centered in the same strand of a double-stranded fragment. The location is generally within 5 nucleotides of the center determined by counting the nucleotides from either end of the fragment.

[0083] "N-terminal domain" refers to a region extending to about 50% of the amino acid sequence of the protein. In an embodiment of the invention, a conserved region within the N-terminal domain corresponds to amino acids 81 to 224 of SEQ ID:NO:22 (MspJI) and a conserved region within the C-terminal domain corresponds to amino acids 300 to the C-terminus of the protein (SEQ ID NO: 22 (MspJI)).

[0084] A "set of oligonucleotide fragments" of similar size obtained by cleavage of a large double-stranded DNA refers to the fragments resulting from cleavage of the large DNA on both sides of a modified nucleotide when the modified nucleotide is located on one strand approximately opposite to another modified nucleotide on the second complementary strand.

[0085] An "enzyme preparation" is intended to refer to a reagent and not something occurring in its natural state in vivo.

[0086] If a genome that consists of multiple large DNAs (e.g., chromosomes) is cleaved, each large DNA will give rise to a set of oligonucleotide fragments of similar size. A mixture of fragments obtained from cleavage of an entire human genome can be considered as a plurality of sets of oligonucleotide fragments, each set derived from a chromosome or as a single set of fragments depending on the context. In an embodiment, the set of oligonucleotides comprises at least 6 oligonucleotide fragments with different DNA sequences. For example, the set of oligonucleotides may comprise at least 10 oligonucleotides with different sequences or at least 20 oligonucleotides with different sequences. In one embodiment, a cloned double-stranded DNA can be enzymatically modified at a target nucleotide at one site for example, modification of a cytosine at a CpG on both strands. In this example, double strand cleavage by a member of the MspJI enzyme family will occur on both sides of the modified cytosine at a non-random distance. The set of oligonucleotides will consist of similarly sized fragments with a centrally located modified nucleotide.

[0087] Members of the newly described MspJI family of enzymes have been identified from microbial sources although enzymes in the family are not limited to those found in microbes. A BLAST search has shown that the number of sequences identified in the DNA database containing genomes from all living sources that encode proteins in the family as defined herein is relatively small. Sixteen homologs are shown in FIGS. 1C, 1D and 7-1 to 7-7 and their % sequence identity and % homology (similarity) are shown in Table 2.

[0088] Enzymes capable of recognizing a modified nucleotide and cleaving the DNA at a non-random distance from the modified nucleotide have been found to share sequence motifs in the N-terminal domain. These enzymes have been found to be capable of uniquely cleaving the DNA on both sides of the modified nucleotide to produce a fragment of a non-random size. A modification on the 5 position of cytosine (m5C) in a eukaryotic genome is most commonly associated with regulation of gene expression. Embodiments of the invention may encompass enzymes capable of recognizing a modified cytosine at a CpG site, the exocyclic N4 position of cytosine (mN4C) or a modified nucleotide other than cytosine such as adenine, for example, the exocyclic N6 position of adenine (mN6A) where such enzymes cleave on either side of the modified recognition sequence.

[0089] The family of enzymes defined herein by a conserved sequence domain and certain functional features include derivative enzymes or variants that have sequence modifications outside or inside the recognition and/or catalytic domains. Additionally, recombinant derivative enzymes or enzyme variants are included in the family that may be fused to a second protein which serves as a label, tag or marker (U.S. Pat. No. 5,643,758) or may contain a substitution which acts as a label such as occurs with a selenocysteine substitution (see U.S. Pat. No. 7,141,366). In addition to the above described family of enzymes, derivative enzymes and enzyme variants are contemplated in which the catalytic domain is modified or absent such that the N-terminal domain acts as a methylated DNA or hydroxymethylated DNA binding domain.

[0090] The use of the MspJI family of enzymes to generate a set of oligonucleotide fragments may rely on a single enzyme or may include a plurality of enzymes where some or all of the enzymes are members of the MspJI family or are derived from members of the MspJI family.

[0091] The members of the newly defined family, before chemical modification or mutation, can be defined structurally by one or more of the features listed below. [0092] (a) non-heteromeric; [0093] (b) recognition and cleavage functions in a single open reading frame; [0094] (c) the coding sequence and protein sequence do not contain methyltransferase motifs; [0095] (d) at least 90% sequence homology to a conserved motif in the N-terminal domain which is WXD(X).sub.10YXGD; and [0096] (e) common secondary structure elements that encompass the conserved motif.

[0097] FIG. 1B and FIGS. 7-1 to 7-7 show an embodiment of the enzyme family in which the overall order of the secondary structure elements that build the catalytic core is helix(H1)-helix(H2)-sheet(S1)-sheet(S2)-sheet(S3)-helix(H3)-sheet(S4)-hel- ix(H4) (see, for example, FIGS. 7-1 to 7-7 where h=helix and a series of e represents a .beta.-pleated sheet). The conserved FE is in an .alpha.-helix H2; the first conserved aspartic acid (D) is in a hinge region between two .beta. sheets S1 and S2; the second conserved aspartic acid is in .beta. sheet S2; the conserved (Q/E)XK is in a .beta. sheet S3.

[0098] Members of the family may be identified by a BLAST search using a sequence selected from SEQ ID NO:7-22 or a related sequence. The hits are then further searched for the above specified consensus sequence in the N-terminal domain and also optionally searched for at least 90% sequence homology or identity in the C-terminal domain of a consensus sequence FEX.sub.20-30DX.sub.2-4DX.sub.19-22(Q/E)XK. Optionally, the conserved sequence in the N-terminal domain can be extended to greater than 90% sequence homology to WXD(X).sub.6G (X).sub.3YXGD(X).sub.10-15GN(X).sub.2L X.sub.10-20PX.sub.3F and/or greater than 90% sequence homology with FE(X).sub.2A(X).sub.15-18 T/SX.sub.4DGGXDX.sub.2G/LX.sub.15-20E/QAK.

[0099] The selected sequences may then be expressed by techniques known in the art, for example in vitro transcription-translation (PURExpress.TM., New England Biolabs, Inc. (NEB), Ipswich, Mass.) or by cloning into a microbial host lacking modified bases such as #ER2655 (NEB Express, #C2523, NEB, Ipswich, Mass.) and assayed for cleavage of DNA containing modified nucleotides to produce oligonucleotide fragments of a defined size and/or containing a centrally located modified nucleotide.

[0100] Antibodies may be raised to members of the newly defined family of enzymes (MspJI enzyme family) using standard techniques for generating monoclonal or polyclonal antibodies. These antibodies or fragments thereof may be used for in situ-labeling of a member of an MspJI enzyme family bound to the modified large DNA. The enzyme may be mutated so that the cleavage function is inactivated or removed. In this context, the fragments may then be separated by binding to affinity matrices capable of antibody binding.

[0101] Functionally, MspJI was identified as a DNA sequence in the database adjacent to a methylase gene sequence and was hence named an endonuclease gene. However, when it was expressed as a protein, it was found to be inactive using standard assays for determining restriction endonuclease activity. This would have normally terminated any further study but for the fortuitous discovery described here that when incubated with DNA from a Dcm+ strain of E. coli, the enzyme was active, while it was inactive when tested on DNA from a Dcm- strain of E. coli. When the enzyme was incubated with eukaryotic DNA that is known to contain modified cytosines such as human genomic DNA, a smear of high molecular weight DNA was observed on polyacrylamide gels together with a clearly visible band containing fragments that correspond to a size of about 32 base pairs (see FIG. 6B).

[0102] A family of related enzymes were identified (FIGS. 7-1 to 7-7) and DNA cleavage by representative examples of these enzymes were tested with human genomic DNA. The tested enzymes yielded a set of similarly sized oligonucleotide fragments of about 32 nucleotides as can be observed on the gel in FIG. 6C.

[0103] The newly defined family of enzymes described here is of particular interest for reasons that include their ability to recognize nucleotide residues modified at the 5 position and to produce a set of oligonucleotide fragments where cleavage occurs at a substantially fixed distance downstream of the enzyme recognition site on the DNA (see FIGS. 6A, 6B and 6C). In embodiments of the invention, the cleavage distance from the modified sites conform to the following rules:

[0104] (1) For double-stranded DNA with a palindromic m5 CpG or other modified nucleotide on both strands in close proximity, a double-stranded break may be generated on each side of the modified nucleotide to generate fragments of similar size. In one embodiment, the distance between the cleavage site on one strand with a modified CpG was found to be 12 bases and the distance to the cleavage site on the opposite strand from the m5C was found to be 16 bases (MspJI) including a 4 base overhang resulting in oligonucleotide fragments of 32 bases in length.

[0105] (2) For hemi-modified double-stranded DNA, a double-stranded break occurs at a position which is 3' downstream from the modified nucleotide. The distance from the cleavage site on the same strand to the modified nucleotide is constant (for example for MspJI the distance is 12 bases and the distance from the cleavage site on the other strand to the modified nucleotide is 16 bases). Sites of hemi-modification in the DNA can be detected by ligating an oligonucleotide containing a site recognized by an MmeI-like enzyme (such as MmeI, see U.S. Pat. No. 7,115,407) to a hemi-modified DNA cleaved at one side at a site 16 nucleotides from the modified nucleotide. The oligonucleotide may include four degenerate nucleotides at the 5' end of the MmeI-site oligonucleotide to allow annealing to the 4 base extension on the bottom strand. Alternatively, a blunt-ended oligonucleotide might be used such that the single strand region at the 4-base extension is filled in using standard molecular biology techniques. The MmeI-like enzyme will cleave 18 or 19 nucleotides upstream which for MspJI cleavage fragments is about 2 nucleotides upstream of the modified fragment. Fragments produced in this manner can be sequenced and the position of the hemi-modified nucleotide in the DNA determined.

[0106] The number of CpG sites in genomes from human, mouse and Arabidopsis has been determined using bioinformatics. If the genomes of these organisms are then cleaved into various length fragments from 24 bases to 60 bases containing a centrally positioned CpG, then the fragments with unique sequences represent between 71% and 91% of the total unique sequence in humans according to increasing size, 83% to 90% in mice and 89% to 95% in Arabidopsis by the same criteria.

[0107] If those sequences of a defined length which have a distinct sequence are distinguished from the total sequence and separately analyzed, then 96%-98% of fragments of size 24-60 nucleotides will match a single locus in the human genome. In the bioinformatic analysis provided in FIGS. 8-1 to 8-2, if the fragment length is 60 nucleotides, then there are 26,185,493 fragments that contain a centrally positioned CpG of which 25,538,480 have distinct sequences and 98% of these match a single locus in the genome (see FIGS. 8-1 to 8-2).

[0108] Hence, there is significant informational value in a set of oligonucleotide fragments generated by an enzyme in the newly defined family where the enzyme recognizes a modified nucleotide and cleaves the DNA at a distance from the modified nucleotide to preferably generate fragments of a similar size. The data shows that a large fraction of such fragments are highly likely to map to a single locus in the genome. This makes possible for the first time a simple and efficient method for creating a methylome. Consequently, high throughput sequence analysis can yield the location of the majority if not all of the actual modified nucleotides in the genome rapidly and easily.

[0109] In an embodiment of the invention, screening assays are described for determining modification-specific cleavage activity of an enzyme (see Example 1). These assays are not intended to be limiting. In one embodiment, selected host cells were transformed with a plasmid containing a specific DNA methyltransferase gene. The expressed methyltransferase then methylated the host genome at specific sites. Hundreds of methyltransferases with varying defined sequence specificities have been described in the literature (see for example REBASE.RTM., a publicly available online database maintained by New England Biolabs, Ipswich, Mass.). Any of these methyltransferases with different methylation specificities can be used for screening purpose. Introduction of a compatible plasmid expressing a gene with modification-dependent cleavage activity able to act on the host's modification pattern would reduce or eliminate the viability of these transformed cells, leading to a low transformation plating efficiency. Non-methylated hosts would show high plating efficiency in a parallel transformation with the methylation-specific endonuclease gene. Thus, this test would confirm the modification-dependent cleavage property of the encoded gene product.

[0110] It was found that the activity of the enzymes in the MspJI family can be enhanced in the presence of a double strand DNA activator preferably having a length of less than 16 by and containing a modified dcm site (for example, dcm(C.sup.5mCWGG) site). A 30 bp cleavage-resistant DNA activator containing phosphorothioate linkages at the cleavage site also stimulated the enzyme reaction.

[0111] Determining the level of methylation or hydroxymethylation of DNA samples is important for epigenetic studies. Epigenetic regulation of the genome includes chromatin remodeling which may be accomplished by the addition of methyl groups to the DNA, mostly at CpG sites to convert cytosine to 5-methylcytosine, and its reversal possibly via hydroxymethylcytosine. Methylation of cytosines in the eukaryotic genome may persist from the germline of one parent into the zygote marking the chromosome as being inherited from this parent (genetic imprinting). Moreover, large changes in methylation occur following zygosis and in tissues of the developing organism (Morgan et al. Hum Mol Genet 14 Spec No. 1:R47-58 (2005)). In addition, methylation in some regions of the genome may vary in response to environmental factors (Li, et al Cell 69 (6): 915-926 (1992)). Differences in methylation pattern may be critical indicators of inappropriate developmental processes for example for embryonic stem cells (Brunner et al. Genome Research 19:1044-1056 (2009)).

[0112] Certain enzymes (such as DNMT1) have a high affinity for the m5C. If this enzyme reaches a "hemi-methylated" portion of DNA (where methylcytosine is in only one of the two DNA strands), the enzyme will methylate the other half.

[0113] DNA methylation occurs in repeated sequences, and helps to suppress the expression and mobility of transposable elements (Slotkin, et al. Nat Rev Genet. 8(4):272-85 (2007)). Because of spontaneous deamination, 5-methylcytosine can be converted to thymidine; hence, CpG sites are frequently mutated and thus become rare in the genome, except at CpG islands where they remain unmethylated. Deamination in this situation converts cytosine to uracil. Diagnostic changes in methylation pattern have the potential to detect increased frequencies of permanent genetic mutation. Methylation in the human genome has been studied in cancer cells for purposes of exploring therapies (see for example, Gargiulo, et al. The International Journal of Biochemistry & Cell Biology 41:127-35 (2009); and Gronbaek, et al. Basic Clin Pharmacol Toxicol 103:389-96 (2008)).

[0114] Embodiments of the invention significantly advance the ability to map modified nucleotides in a genome to generate a map (methylome). A human methylome would facilitate studies on interpersonal phenotypic variations in whole organisms and in individual cells and can yield useful information on development, aging and disease. From this information, it may be possible to determine susceptibility for diseases such as cancer even before a pathology appears and to design appropriate treatments with the possibility of providing powerful diagnostic tests and therapeutic agents.

[0115] The identification of a family of enzymes with novel properties and the creation of novel oligonucleotide fragments permits a description of the status of the human methylome by allowing the isolation of a set or sets of oligonucleotide fragments that provide a concentration of modified bases found in the human genome. Isolation of the set(s) of fragments can be facilitated by gel electrophoresis, solid phase affinity-binding or other means. Methylome analysis can be aided by the addition of a control that may include treating the genome with M.SssI, which methylates substantially all CpG dinucleotides in the genome. (Yegnasubramanian et al. Nucleic Acids Res 34:e19 (2006)).

[0116] The set(s) of oligonucleotide fragments resulting from enzyme cleavage can be sequenced using high throughput sequencing methods of the sort that are currently available using NextGen sequencing methods to identify and map modified cytosine nucleotides in a DNA. This approach greatly simplifies the generation of a methylome for any large DNA or genome such as a mammalian genome. Selection of specific oligonucleotide cleavage products for rapid diagnostic methods to particular regions of the genome can determine the abnormal presence or absence of modified cytosines correlated with a disease such as cancer. Specific oligonucleotides may be used to determine a particular phenotype for an individual. For example, hybridization of a set of fragments to a defined sequence or set of sequences presented on a solid surface (array hybridization) or tagged in a solution (or visa versa) can reveal discrepancies with a standard set of fragments that characterize the methylome. qPCR or array hybridization may also be used to interrogate one or more known locations of interest for abundance. The modified nucleotide or binding molecule may be labelled with a fluorescent or chemiluminescent tag or other labelling methods known in the art to facilitate detection.

[0117] Modified nucleotides in the genome may be identified in situ using a mutant enzyme member of the newly defined family having an inactivated cleavage site. By visualizing the binding sites of the mutant enzyme, the location of the modified nucleotides can be determined.

[0118] The members of the newly defined family of enzymes may be genetically engineered so as to form recombinant proteins for large scale production. The purification of recombinant proteins may be facilitated by the formation of fusion proteins such that the enzyme is fused to an affinity tag which has an additional use. For example, if the tag is biotin, a His peptide, chitin-binding domain or maltose-binding protein or another substrate-binding domain, the member of the family may be isolated on an affinity matrix either directly itself acting as a methyl-binding domain or by binding to an antibody affinity matrix or by means of the affinity tag. The recombinant protein either alone, modified or fused to a tag may be fluorescently labeled for imaging purposes.

[0119] Where the enzyme kinetics are single turnover, low turnover or the enzyme lacks catalytic activity altogether, the enzyme or enzyme fusion protein while bound to a modified nucleotide-containing fragment may also be bound directly to an affinity matrix to separate the oligonucleotide fragments containing modified nucleotides from the remaining fragments for sequencing or for diagnostic tests.

[0120] The experimental protocols provided below in large part for MspJI are not intended to be limiting. One of ordinary skill in the art could employ the experimental design as provided below to any additional member of the newly defined family.

EXAMPLES

Example 1

Methylation-Specific DNA Cleavage Activity of MspJI Enzyme Family

Production of the Enzymes

[0121] Recombinant members of the MspJI enzyme family were expressed in dcm- strain ER2566 and purified until substantially homogeneous using multiple chromatography steps. The enzymes which had an N-terminal 8.times.His Tag were first purified on a HiTrap Heparin HP column (GE, Piscataway, N.J.), then a HisTrap HP column (GE, Piscataway, N.J.), and finally a HiTrap SP column (GE, Piscataway, N.J.). The purification procedure followed the manufacturer's recommendation. The cleavage activity of the enzyme fractions were assayed on lambda DNA (which is partially dcm- methylated). To further improve expression levels, the DNA encoding the enzymes can be codon-optimized.

Determining Cleavage Patterns of MspJI Enzyme Family by a Screening Assay

[0122] The assay may include one or more of the following steps: [0123] 1. Methylate a target nucleotide in a synthetic or naturally occurring large DNA optionally having a known sequence. For example, lambda DNA can be used which is partially dcm- methylated at CmCWGG sites and XP-12 phage genomic DNA whose cytosines are completely replaced by 5mC cytosines. [0124] 2. React the large DNA with an MspJI enzyme family. [0125] 3. Size-separate the cleavage products for example using a polyacrylamide gel. [0126] 4. Sequence a set of oligonucleotide fragments of similar size to determine the position of the modified nucleotide; and [0127] 5. Optionally map the fragment sequence on the large DNA sequence.

[0128] An elaboration of step (1) includes using different large DNA preparations which have been reacted with different methyltransferases for modifying the DNA in vitro. These substrates are used to identify substrate specificities.

[0129] The products are analyzed by 1% agarose gel electrophoresis and can be visualized by ethidium bromide. For example, M.HpaII (NEB, Ipswich, Mass.) can produce CmCGG-modified DNA. Plasmid DNA-digestion can be monitored by 1% agarose gel electrophoresis and visualization using ethidium bromide staining. Alternatively, synthetic double-stranded oligonucleotide containing a modified site can be used in which any methylated sites can be easily created, independent of the availability of the methyltransferases. Modified nucleotides in palindromic sites of interest include for example, NmCGN, mCNG, NGmCN, GNmC etc., where N is A, T, G or C. In addition to fully-methylated oligonucleotides, oligonucleotides with hemi-methylated sites can be tested in this way. Other types of modification, such as 5-hydroxymethylated cytosine and 5-glucosylated-hydroxymethylated cytosine, can be either directly incorporated into the oligonucleotides during synthesis or by further modification of hydroxymethylated cytosine residues with bacteriophage T4 glucosyltransferase.

[0130] To determine cleavage sites, substrate oligonucleotides are labeled either at their 5' end or 3' end with .sup.33P. Cleavage products are run on a 7M-urea 20% polyacrylamide denaturing gel to single nucleotide resolution and analyzed.

Characterizing MspJI Enzyme Family Members by an In Vivo Screening Assay

[0131] The ER1992 strain with endogenous methylase gene dcm, which methylates the inner cytosine in CCWGG sites to CmCWGG and serves as a target substrate for an enzyme with the desired cleavage activity, and ER2566, with a dcm- genotype with no 5-methyl cytosine and not subject to cleavage by a methylation-specific enzyme, were used to screen for methylation-specific activity of a novel recombinant restriction endonuclease.

Measuring the Activity of MspJI Enzyme Family Members by an In Vitro Assay

[0132] A plasmid is used which contains only two methyl-C's separated by 1 kb of intervening sequence. This cleaves leaving three fragments, the plasmid backbone 3 kb, the insert 1 kb and the two 32 bp fragments. When this digest goes to completion, the uncut plasmid disappears and subsequent appearance of the 1 kb and backbone bands is easily quantifiable on an agarose gel. This plasmid is transformed into a dam-dcm- strain and purified as an assay substrate. Such plasmids are described in Stewart, F., et al. Biological Chemistry 379:611-616 (1998).

Determining Specificity of MspJI Enzyme Family Members for Modified Binding Sequences Versus Unmodified Binding Sequences Using an In Vitro Assay

[0133] The in vitro activity of MspJI was assessed on a variety of methylated and non-methylated DNA substrates, as shown in FIG. 2A for the dcm- methylated plasmid DNA pBR322. MspJI showed endonuclease activity (FIG. 2A, Lanes 1 and 2) where this endonuclease activity was DNA methylation-dependent. In contrast, MspJI did not act on pBR322 without dcm- modification (FIG. 2A, Lanes 5 and 6). By using the restriction enzyme BstNI (CC.dwnarw.WGG), which is insensitive to m5C methylation, in a double-digestion assay, cleavage sites on pBR322(dcm+) by MspJI were shown to be at or close to the dcm sites (FIG. 2A, Lanes 2, 3 and 4). The double digest did not alter the BstNI pattern, suggesting that MspJI did not cleave at non-BstNI sites.

[0134] In addition to the m5C-modified DNA tested above, MspJI did not exhibit endonuclease activity on M.TaqI-(TCGmA) or dam-(GmATC) methylated pBR322(dcm-) DNA. This confirmed that MspJI did not target m.sup.6-adenine methylated DNA, consistent with the fact that the MspJI gene can be maintained and expressed in a dam+ strain (ER2566, NEB, Ipswich, Mass.). Moreover, MspJI does not apparently act on N.sup.4-methylcytosine-containing plasmid DNA, as can be determined by using M.BstNI (CCWGG, a N4-cytosine methylase) methylated DNA.

Assaying Activity of MspJI Enzyme Family Members on DNA Substrates which Contain 5-Hydroxymethylcytosine or 5-Glucosyl-Hydroxymethylcytosine

[0135] Wild-type T4 phage DNA with glucosylated cytosines and the DNA from a T4 .alpha. gt57 .beta. gt14 (a mutant which has defective glucosyltransferases and therefore contains hydroxymethylated cytosines in DNA hereafter T4gt) were used as substrates (FIG. 2C, Lanes 1 and 2). MspJI was able to degrade T4 gt DNA (FIG. 2C, Lanes 8-11) and was inactive on glucosylated DNA (FIG. 2C, Lane 7). For comparison, activity of another modification-dependent endonuclease, McrBC (FIG. 2C, Lanes 3 and 4) and a typical type IIP restriction enzyme MspI (FIG. 2C, Lanes 5 and 6) with these modified DNA substrates were shown. McrBC, which recognizes pairs of (A/G).sup.mC separated by 40-3000 base pairs, also exhibited nuclease activity on the hydroxymethylcytosine-containing DNA but not on T4 wild-type DNA, while MspI was inactive with respect to both substrates. Note that MspJI was able to degrade T4 gt DNA to a greater extent than McrBC, which can be explained by its broader recognition sequence than McrBC. Overall, it appears that MspJI specifically targets cytosine-modified DNA with 5-CH.sub.3 or 5-CH.sub.2OH addition on the pyrimidine ring.

Determining Substrate Sequences Around a Cleavage Site

[0136] MspJI-digested DNA samples with different methylated sites were subjected to capillary sequencing and the cleavage sites were deduced from the location at which peaks are reduced in height near the methylated sites in the sequencing chromatograms (examples shown in FIG. 5). Positions of cleavage occur at locations where the sequence signals (peaks) are reduced in height. In many cases, a non-templated adenine is added as the polymerase runs off the DNA, and location of such a "runoff peak" adenine is additional evidence for the location of cleavage. One observation on the sequencing chromatogram data was that cleavage sites occur at a site distant from the methylated sites. FIG. 5 also displays the deduced cleavage pattern of MspJI on different methylated sites. Another observation was that the height reduction in sequencing peaks and addition of adenine not present in the substrate were generally present on both sides of the methylated sites. The response in the chromatogram on both sides demonstrated that MspJI cleaved the DNA each side of the methylated binding sequence. This is consistent with the symmetry of the methylated binding sites. The presence of two run-off peaks is evidence for two independent cleavage events on the same strand.

[0137] It was concluded that MspJI recognized the m5C on one strand and then cut 12 nucleotides 3' downstream on the same strand and 16 nucleotides downstream on the complementary strand to leave a 4-base 5' overhang. Similarly, when the m5C on the complementary strand was recognized, the same pattern of cleavage was observed demonstrating that two double-stranded breaks around the same recognition site released the fragment with the methylated site in the middle. The exact length of that fragment depended on the distance between the methyl groups on the two strands. In the case of HpaII methylated sites (Cm5CGG) or HhaI methylated sites (Gm5CGC), the length of the fragment excised from the DNA substrate was expected to be 32 nucleotides including the two 4-base 5' overhangs.

Comparing the Activity of an MspJI Enzyme Family Members on Fully-Methylated and Hemi-Methylated DNA

[0138] To investigate whether MspJI is active on hemi-methylated DNA substrates, which can arise during replication, FAM-labeled synthetic substrates were used in a digestion assay (FIG. 4A). FIG. 4A indicates the expected cleavage sites and product sizes and FIG. 4B shows the digestion reactions resolved on a 7M urea 20% polyacrylamide denaturing gel. The m5C for interrogation is at an M.HpaII site (CmCGG) in the oligos. Null-methylation, full-methylation, hemi-methylation on the top strand or bottom strand wer tested and the cleavage events on the top strand and bottom strands were observed by labeling them individually, as shown in FIG. 4B.

[0139] On fully-methylated DNA, MspJI makes cuts on both sides of the methylated site. On the top strand, it cleaves on either side of the methylated site, resulting in 40 by (from cut Lt) and 11 or 12 by (from cut Rt) fragments (FIG. 4B, Lane 3). Symmetrically, on the bottom strand, it cleaves twice and generates a long fragment of 36 nt (from cut Lb) and a shorter fragment of 7 or 8 nt (from cut Rb) (FIG. 4B, Lane 4).

[0140] On the hemi-methylated substrates, strand methylation status dictates the side of the cleavage, so that double-stranded breaks only occur on the 3' side of the strand containing the methylated base. For example, for substrate with only top strand methylation, each cleavage event is at the 3' side of the 5mC so that only shorter fragments are observed (FIG. 4B, Lanes 5 and 6). The same applies to the substrate with bottom strand methylation where only longer fragments are seen (FIG. 4B, Lanes 7 and 8). The results show that each m5C is associated with two cuts on the same side and such association is symmetrical. Thus, while not wishing to be bound by theory, it is proposed that MspJI recognizes each half of the methylated site separately in a fully-methylated site, either the top or the bottom strand, and that the half site then dictates the directionality of the cleavage.

Characterizing the MspJI Enzyme Family Members with Shared Conserved DNA Sequences, Secondary Sequence Motifs, and Binding and Cleavage Properties

[0141] By using the amino acid sequence of a member of the MspJI family such as MspJI as the query sequence, a PSI-BLAST search (Altschul et al., Nucleic Acids Res 25:3389-3402 (1997)) against GenBank retrieved more than 100 hits with significant sequence homology. Sixteen genes among the top hits had significant similarity to MspJI throughout the sequence length. In FIG. 1D, a partial multiple sequence alignment is provided around the conserved catalytic motif inside the MspJI subfamily. The significance of the conserved catalytic motif is shown by the site-directed mutagenesis experiments, in which both D334A and Q355A mutations completely abolish the catalytic activity of MspJI.

[0142] The predicted secondary structure elements of the MspJI family were determined using multiple sequence alignment created by PROMALS webserver (Pei et al. Nucleic Acids Res 35:W649-652 (2007)) (FIG. 1B shows a schematic and FIGS. 7-1 to 7-7 the full alignment). The structure core of the catalytic C-terminal domain has three consecutive strands (.beta.1.beta.2.beta.3 in FIG. 1B), with the motif (Q/E)xK at the end of .beta.3 and the conserved residue D at the beginning of .beta.2 (FIGS. 7-1 to 7-7) (Wah et al. Proc Natl Acad Sci USA 95:10564-10569 (1998)). The two helices and strands in the order of .alpha.4-.beta.4-.alpha.5-.beta.5 after .beta.1.beta.2.beta.3 forms an interaction interface between monomers (FIG. 1B).

Determining the Role of an Activator in Improving Cleaving Activity of Members of the Newly Defined Family of Enzymes

[0143] An activator dimer containing double-stranded 5-methyl cytosine (e.g., 11mer, 15-mer, 19mer and 23mer) are tested to determine whether digestion by members of the MspJI enzyme family can be enhanced. These dimers are constructed by annealing two single strand oligonucleotides or by hairpin formation of a single oligonucleotide.

[0144] The assay for the activator includes constructing self-complementary oligonucleotides containing 5-methyl-C's at the center of various lengths. Oligonucleotides are biotinylated at the 5' end for subsequent removal from reactions and 3' amino-modified such that they cannot be ligated or extended. The activators are then assayed for their abilities to enhance cleavage before and after streptavidin bead removal for interference in sequencing.

Example 2

Demonstration of the Application of Enzymes in Mapping the Methylome

[0145] To analyze the methylome analysis of a mouse or a human genome, 1-2 .mu.gs of human or mouse genomic DNA is used for the methylome analysis at single nucleotide resolution. The genome is digested with a member of the MspJI family optionally in the presence of biotin-containing activator molecules, followed by removal of activator molecules using streptavidin magnetic affinity beads. The digested DNA is end-repaired using the NEBNext.TM. (NEB, Ipswich) end-repair module, ethanol-precipitated and dissolved in a suitable volume of water. The digested genomic DNA is ligated to bar-coded SOLiD primer and P1 primer using NEBNext.TM. quick ligation module (NEB, Ipswich, Mass.). The ligated product is separated on a 10% TBE polyacrylamide gel and the ligated product of .about.110 bps (between 100-130 bp) is excised after visualization by ethidium bromide staining. A crush and soak or a suitable elution method is used to isolate DNA for SOLiD sequencing (Applied Biosystems, Inc., Life Technologies, Inc., Carlsbad, Calif.). MspJI for example does not distinguish between methylated and hydroxymethylated cytosine residues for cleavage, thus the sequencing data will result in analysis of the whole methylome.

Determination of the Biological Role of 5-Hydroxy Methylcytosine in Mammals

[0146] The dynamic changes of DNA methylation during mouse embryonic stem cell (ES) differentiation can be identified using the newly defined family of enzymes. Previous reports suggest that as much as 10% of the modified cytosines are in the form of 5-hydroxymethylcytosine. These will have been missed using current methodologies involving bisulfite. This modified adduct is complementary to guanine and is read as cytosine in polymerase-based amplification.

Exploration of Methylomes of Other Model Organisms.

[0147] The MspJI enzyme family not only acts on mCpG, but is capable of recognizing and cleaving other types of methylated sites. For example, mCNG, which is present in the genomic DNA of Arabidopsis, is a natural substrate for MspJI. This provides a simple method of assaying for the presence of modified bases in any organism. For instance, digestion of total genomic DNA with MspJI gives a 32 by fragment that is easy to isolate from a polyacrylamide gel. It can then be digested to mononucleosides using a standard cocktail of enzymes and the total digest examined by HPLC and/or mass spectrometry to identify the modified bases. A variety of organisms such as Arabidopsis, Xenopus, zebrafish, chicken, Neurospora crassa as well as genomes known to contain unusual modifications like Base J found in kinetoplastid protozoans such as Trypanosomes (Cross et al. EMBO J. 18:6573-6581 (1999)) is studied by the methods described herein. Once an epigenome is confirmed, the digested bands can be sent for high throughput sequencing using the established protocols for human.

TABLE-US-00001 TABLE 1 Genomic context analysis of the MspJI subfamily Close to Activity on # Gene ID Genbank ID methylase? Species Additional notes 5mC DNA* 1 MspJI YP_001069123 Y Mycobacterium sp. JLS close to M and V genes Y 2 Sbal195_0369 YP_001552810 Y Shewanella baltica OS195 2 ORFs from M gene N/T 3 PE36_01892 ZP_01896882 Y Moritella sp. PE36 SAM-dependent N/T methylase 4 Spea_3849 YP_001503694 N Shewanella pealeana ATCC N 700345 5 Xcc3577 NP_638923 N Xanthomonas campestris Among transposase N ATCC 33913 islands 6 Lhv_0031 YP_001576608 N Lactobacillus helveticus DPC Among transposase N 4571 islands 7 Lpg1234 YP_095265 Y Legionella pneumophila strain Close to R and M Y Philadelphia 1 genes; M gene is active. 8 Franean1_5336 YP_001509600 N Frankia sp. EAN1pec Standalone Y 9 CATMIT_00196 ZP_03681584 N/A Catenibacterium mitsuokai Unfinished genome N/T DSM 15897 sequence 10 Rmet_0004 YP_582159 N Ralstonia metallidurans CH34 Standalone N 11 Bcenmc03_0011 YP_001763314 Y Burkholderia cecepacia MC0-3 Close to M and V N/T genes 12 AspBH1 YP_931859 Y Azoarcus sp. BH72 Close to M and V Y genes 13 RlaI ZP_03168528 N Ruminococcus lactaris ATCC Close to V gene Y 29176 14 Xccb100_0619 YP_001902024 N Xanthomonas campestris strain Among transposase N/T B100 islands 15 ZP_03855940 ZP_03855940 Y Veillonella parvula DSM 2008 Close to M gene N

TABLE-US-00002 TABLE 2 Similarity and identity of sequences in the family similarity identity AspBHI Bcenmc03_0011 CATMIT_00196 Franean1_5336 MspJI PE36_01892 RlaI Rmet_0004 AspBHI 100/100 36.5/47.4 41.3/57.7 40.1/52.4 25.6/38.0 22.8/38.3 42.2/58.0 38.6/52.7 Bcenmc03_0011 36.5/47.4 100/100 30.8/43.6 27.9/40.6 18.9/28.7 16.7/29.8 32.8/45.9 33.4/47.4 CATMIT_00196 41.3/57.7 30.8/43.6 100/100 35.9/51.1 20.2/37.1 24.7/41.2 40.9/61.8 33.1/47.3 Franean1_5336 40.1/52.4 27.9/40.6 35.9/51.1 100/100 22.3/34.5 23.2/37.0 36.6/51.7 35.9/46.7 MspJI 25.6/38.0 18.9/28.7 20.2/37.1 22.3/34.5 100/100 36.5/53.4 23.1/40.2 22.6/35.3 PE36_01892 22.8/38.3 16.5/29.1 24.7/41.2 23.2/37.0 36.5/53.4 100/100 21.6/36.8 24.1/36.7 RlaI 42.3/58.2 32.8/45.9 40.9/61.8 36.6/51.7 23.1/40.2 21.6/36.8 100/100 38.0/53.4 Rmet_0004 38.6/52.7 32.3/48.5 33.1/47.3 35.5/46.5 22.5/36.6 24.0/37.7 38.0/53.4 100/100 Sbal195_0369 22.6/36.7 16.4/28.8 24.7/42.0 22.8/35.0 36.3/54.4 73.8/83.3 24.3/41.3 24.1/35.1 SgriT_16873 45.7/60.9 30.2/42.8 37.0/55.4 52.1/64.2 25.4/39.8 26.4/40.6 41.3/57.7 37.4/50.8 Spea_3849 21.5/35.2 17.5/29.7 24.8/43.5 23.6/36.2 34.3/53.9 70.6/81.7 23.9/42.0 24.2/35.2 Xcc3577 24.2/37.9 19.6/30.2 25.7/38.7 22.4/32.0 38.2/51.5 40.9/60.0 21.5/39.5 22.6/36.7 gi|227372459| 39.1/58.0 29.6/44.8 42.3/60.6 31.9/47.7 22.2/41.2 24.8/39.7 42.3/59.9 34.8/49.2 ref|ZP_03855940.1| V.par gi|260101829 22.2/36.1 19.4/34.6 22.3/39.1 21.4/30.3 29.2/43.6 34.6/50.9 24.1/38.0 23.8/39.2 DSM 20075 lhv_0031 21.3/34.8 17.3/30.8 23.2/40.7 21.7/31.0 30.4/46.0 36.3/53.5 24.8/40.0 21.5/34.9 lpg1234 42.6/62.9 28.4/43.8 37.8/57.0 37.0/52.4 21.3/37.8 26.1/40.9 41.6/58.7 49.3/62.1 similarity gi|227372459| ref| ZP_03855940.1| gi|260101829 identity Sbal195_0369 SgriT_16873 Spea_3849 Xcc3577 V.par DSM 20075 lhv_0031 lpg1234 AspBHI 22.6/36.7 45.7/60.9 21.5/35.2 24.2/37.9 39.1/58.0 22.2/36.1 21.3/34.8 42.6/62.9 Bcenmc03_0011 16.4/28.8 30.2/42.8 17.5/29.7 19.6/30.2 29.6/44.8 19.4/34.6 17.3/30.8 28.4/43.8 CATMIT_00196 24.7/42.0 37.0/55.4 24.8/43.5 25.7/38.7 42.3/60.6 22.3/39.1 23.2/40.7 37.8/57.0 Franean1_5336 22.8/35.0 52.1/64.2 24.0/36.3 22.4/32.0 31.9/47.7 21.4/30.3 21.7/31.0 37.0/52.4 MspJI 36.3/54.4 25.4/39.8 34.3/53.9 38.2/51.5 22.2/41.2 29.2/43.6 30.4/46.0 21.3/37.8 PE36_01892 73.8/83.3 26.2/40.4 70.6/81.7 40.9/60.0 24.8/39.7 34.6/50.9 36.3/53.5 26.1/40.9 RlaI 24.3/41.3 41.3/57.7 23.9/42.0 22.2/40.2 42.5/60.1 24.1/38.0 24.8/40.0 41.6/58.7 Rmet_0004 24.1/35.1 37.1/50.4 24.2/35.2 22.6/36.7 34.8/49.2 23.8/39.2 21.5/34.9 49.3/62.1 Sbal195_0369 100/100 24.0/36.5 86.5/93.1 40.6/60.7 22.9/40.7 36.0/50.1 38.6/54.9 25.1/41.3 SgriT_16873 24.0/36.5 100/100 25.4/38.2 23.2/32.7 38.8/56.1 23.7/36.4 25.3/38.4 44.3/60.1 Spea_3849 86.5/93.1 25.4/38.2 100/100 39.9/58.9 24.7/42.7 35.1/49.8 36.5/53.0 23.5/38.0 Xcc3577 40.6/60.7 23.2/32.7 39.9/58.9 100/100 21.2/38.2 31.5/48.5 33.1/51.6 19.8/39.0 gi|227372459|ref| 22.9/40.7 38.8/56.1 24.7/42.7 21.2/38.2 100/100 100/100 23.9/40.7 42.0/60.9 ZP_03855940.1| V.par gi|260101829 36.0/50.1 23.9/36.6 35.1/49.8 31.5/48.5 100/100 100/100 88.2/88.2 21.3/35.6 DSM 20075 lhv_0031 38.6/54.9 25.5/38.5 36.5/53.0 33.1/51.6 23.9/40.7 88.2/88.2 100/100 23.2/38.7 lpg1234 25.1/41.3 44.3/60.1 23.5/38.0 19.8/40.4 42.0/60.9 21.3/35.6 23.2/38.7 100/100

Sequence CWU 1

1

54153DNAartificialoligonucleotide 1tggtaataat aaggttgagg actttttccg gatgcccgga atgggttcaa agg 53276DNAartificialsynthetic construct 2gcaagaggcc cggcagtacc ggcataacca agcctatgcm tacagcatcc agggtgacgg 60tgccgangat gacgat 76363DNAartificialsynthetic construct 3gcagcggtcg ggctgaacgg ggggttnnnn nnnacnnnnn nncttgnann gaannannnn 60nac 63471DNAartificialsynthetic construct 4gatcaaagga tcttcttgag atcntttttt tctgcgcgta atctgctgct trcaaacaaa 60aaaaccaccg c 71573DNAartificialsynthetic construct 5gcacaacatg ggggatcatg taactcgcct tgatmgttgg gaaccggagc tgaatgaagc 60mataccaaac gac 73666DNAartificialsynthetic construct 6ccacgggtgc gcntaatcgt gctcctgtmg ttgnggaccc ggctaggctg gcggggttgc 60cttact 667390PRTVeillonella parvula 7Met Ile Ser Phe Lys Asp Val Cys Glu Thr Glu Val Asp Leu Val Ile1 5 10 15Asp Glu Ile Tyr Glu Gly Gly Ala Val Gly Asn Ile Leu Asp Asp Val 20 25 30Leu Thr Lys Leu Met Gly Val Gln Asn Ala Gly Gly Phe Arg Tyr Arg 35 40 45Asn Val Leu Asn Thr Thr Asp Lys Ala Tyr Ile Val Leu Tyr Ser Ser 50 55 60Asn Glu Asp Ile Asp Trp Pro Asp Val Leu Glu Ala Glu Thr Gly Lys65 70 75 80Phe Lys Tyr Tyr Gly Asp Asn Lys Arg Pro Gly Asp Lys Val Asp Ser 85 90 95Lys Lys Gly Asn Leu Ile Leu Glu Thr Ile Phe Asn Glu Lys Asn Arg 100 105 110Asn Lys Ile Pro Pro Val Phe Ile Phe Met Lys Asn Pro Thr Val Ala 115 120 125Ser Asn Arg Ser Val Arg Phe Leu Gly Leu Ala Val Pro Glu Asp Tyr 130 135 140Tyr Leu Gly Lys Asp Asn Ser Leu Lys Ala Ile Trp Arg Thr Ser Asn145 150 155 160Ser Glu Arg Phe Ile Asn Tyr Glu Ala His Phe Thr Ile Leu Asn Thr 165 170 175Lys Ser Ile Asn Arg Glu Trp Leu Ser Cys Leu Ile Asn Gly Asp Ser 180 185 190Leu Asn Thr Arg Phe Ala Pro Asp Ala Trp Leu Lys Tyr Val Lys Gln 195 200 205Gly Leu Thr Asp Asp Ile Ile Leu Ser Ala Pro Lys Asn Lys Glu Tyr 210 215 220Arg Ser Lys Ile Glu Gln Leu Pro Ser Thr Asp Lys Asp Leu Arg Lys225 230 235 240Leu Asp Phe Ile Tyr Gln Tyr Tyr Lys Asp Glu Pro Tyr Lys Phe Glu 245 250 255Tyr Phe Ala Ala Lys Leu Val Gly Leu Met Asp Asn Asn Phe Leu Asn 260 265 270Phe Asn Ile Thr Arg Thr Val Arg Asp Gly Gly Ile Asp Ala Ile Gly 275 280 285Glu Tyr Arg Leu Gly His Lys Asn Asn Ser Ile Lys Leu Arg Cys Ala 290 295 300Leu Glu Ala Lys Cys Tyr Gln Arg Asp Asn Ser Asn Gly Val Lys Leu305 310 315 320Leu Ser Arg Leu Ile Ser Arg Leu Lys Tyr Arg Asp Phe Gly Ile Phe 325 330 335Val Thr Thr Ser Tyr Val Ser Glu Gln Ala Tyr Lys Glu Leu Leu Glu 340 345 350Asp Gly His Pro Val Ile Ile Ile Ser Gly Gly Asp Ile Ile Glu Ile 355 360 365Leu Thr Asn Asn Arg Ile Asn Thr Lys Glu Ser Leu Leu Asn Phe Met 370 375 380Asp Thr Ile Asp Tyr Leu385 3908405PRTCatenibacterium mitsuokai 8Met Val Glu Val Ala Phe Glu Asp Leu Gln Asn Ala Asp Leu Gln Ile1 5 10 15Gly Cys Val Tyr Lys Gly Gly Thr Ala Pro Asn Leu Gly Ser Asp Pro 20 25 30Leu Ser His Leu Phe Pro Cys Gly Asn Ala Gly Gly Phe Arg Arg Val 35 40 45Asn Arg Arg Asp Gly Ser Arg Leu Pro Ala Tyr Val Ile Leu Tyr Thr 50 55 60Ser Met Glu Glu Leu Glu Trp Pro Asp Phe Leu Asp Glu Glu Thr Gly65 70 75 80Val Phe Arg Tyr Tyr Gly Asp Asn Arg Lys Pro Gly Asn Asp Ile Arg 85 90 95Asn Thr Lys Lys Lys Gly Asn Leu Leu Leu Glu Glu Val Phe Glu Leu 100 105 110Leu Asn Ser Asn Asn Leu Glu Asp Met Pro Pro Phe Phe Val Phe Lys 115 120 125Lys Thr Gly Asn Gly Arg Asp Ile Gln Phe Leu Gly Leu Ala Ala Pro 130 135 140Gly Asn Ser Asn Ile Ser Pro Gly Arg Asp Leu Val Ala Leu Trp Cys145 150 155 160Ser Leu Asn Gly Gln Lys Phe Gln Asn Tyr Glu Ala Tyr Phe Thr Ile 165 170 175Leu Asp Thr Lys Gly Lys Gly Ile Ser Arg Asp Trp Ile Lys Ser Leu 180 185 190Ser Glu Asp His Ser Ala Ser Ile Asp Val Ala Pro Asp Val Trp Lys 195 200 205Lys Phe Ile Ser Gln Gly Arg Asp Gly Ile Glu Ala Leu Lys Ala Pro 210 215 220Lys Ile Ile His Ile Pro Ser Lys Cys Asp Gln Leu Gln Cys Asp Asp225 230 235 240Glu Gly Lys Lys Cys Val Asp Ala Ile Arg Glu His Tyr Lys Asp Asn 245 250 255Pro Tyr Gly Phe Glu Ser Cys Ala Met Asp Leu Leu Met Lys Met Asp 260 265 270Asn His Phe Val Asp Phe Asn Leu Thr Arg Pro Trp Arg Asp Gly Gly 275 280 285Arg Asp Ser Ile Gly Tyr Tyr Ser Ile Asn Ser Gly Gly Lys Val Asn 290 295 300Ala Pro Leu Lys Ile Asp Cys Ala Leu Glu Ala Met Cys Tyr Ala Glu305 310 315 320Thr Asn Gly Ile Gly Ile Lys Gln Met Ser Arg Leu Ile Ser Arg Ile 325 330 335Arg Tyr Arg Gln Phe Gly Ile Leu Ile Thr Thr Ser Tyr Val Asp Glu 340 345 350Gln Ala Tyr Gln Glu Val Val Glu Asp Gly His Pro Ile Leu Val Val 355 360 365Thr Ala Thr Asp Ile Ala Arg Ile Leu Arg Ile Asn Ser Ile Thr Ser 370 375 380Glu Asn Ile Asp Glu Tyr Leu Asn Ser Ile Asp Ser Arg Arg Lys Glu385 390 395 400Trp Glu Gln Asp Lys 4059450PRTFrankia sp. 9Met Gln Ser Thr Gly Val Arg Pro Cys Pro Leu Ala Ser Val Ala Val1 5 10 15Ala Thr Glu Val Ala Thr Pro Gly Gly Ala Ser Asp Ala Arg Cys Leu 20 25 30Asp Glu Pro Ser Ser Gly Leu Gly Ser Leu Arg Ala Val Asp Asp Lys 35 40 45Ser Gln Val Val Pro Phe Val Asp Leu Pro Thr Ala Ala Leu Val Val 50 55 60Asp Gln Leu Tyr Glu Gly Gly Thr Ala Gly Thr Leu Ala Asp Asp Pro65 70 75 80Leu Ala Arg Leu Leu Pro Val Gly Asn Gln Gly Gly Phe Arg Tyr Ala 85 90 95Gly Ser Pro Arg Lys Gly Thr Val Arg Leu Ser Val Leu Tyr Thr Thr 100 105 110Gly Ala Val Ala Asp Trp Pro Asp Thr Leu Asp Pro Ser Thr Gly Val 115 120 125Phe Thr Tyr Tyr Gly Asp Asn Arg Lys Pro Gly Arg Asp Leu His Asp 130 135 140Thr Gln Arg Ser Gly Asn Leu Leu Leu Arg Asp Val Phe Glu His Ala145 150 155 160His Gly Ser Val Glu Glu Arg Arg Thr Val Pro Pro Phe Leu Leu Phe 165 170 175Glu Thr Ala Pro Pro Gly Arg Arg Ile Met Phe Arg Gly Leu Leu Ala 180 185 190Pro Gly Ala Ala Thr Leu Thr Ser Asp Asp Asp Leu Val Ala Ile Trp 195 200 205Arg Asn Thr Arg Gly His Arg Phe Gln Asn Tyr Arg Ala His Phe Thr 210 215 220Val Leu Asp Val Ala Thr Val Thr Arg Thr Trp Leu Thr Asp Ile Leu225 230 235 240Ala Gly His Ala Thr Asp Ser Glu His Cys Pro Pro Ala Trp Thr Ala 245 250 255Trp Val Asp Gly Arg Ala Tyr Ser Pro Leu Ile Ala Pro Ser Thr Thr 260 265 270Ile Ile Arg Thr Lys Ala Glu Gln Gln Pro Pro Asp Pro Thr Gly Val 275 280 285Ala Ile Leu Ala Ala Ile Arg Glu His Tyr Arg Gly His Glu His Asp 290 295 300Phe Glu Phe Cys Ala Val Glu Leu Trp Arg Leu Ile Ala Pro Ala Thr305 310 315 320Gly Arg Cys Asp Val Thr Pro Pro Ser Arg Asp Gly Gly Arg Asp Ala 325 330 335Ile Gly Asp Tyr Ile Leu Gly Pro Leu Ser Asp Pro Ile Ala Ile Asp 340 345 350Phe Ala Leu Glu Ala Lys Cys Tyr Thr Asp Thr Asn Ser Val Gly Val 355 360 365Arg Asp Val Ala Arg Leu Ile Ser Arg Leu Arg His Arg His Phe Gly 370 375 380Val Phe Ile Thr Thr Ser His Phe Asn Gln Gln Val Tyr Thr Glu Val385 390 395 400Arg Thr Asp Arg His Pro Ile Ala Leu Val Ser Gly Arg Asp Ile Val 405 410 415Asn Ala Leu Arg Ala His Gly Tyr Ala Asp Val Asn Ala Val Asn Ala 420 425 430Trp Leu Gly Lys Ile Pro Asn Val His Val Ser Ala Lys Gly Ala Pro 435 440 445Asn Pro 45010402PRTStreptomyces griseoflavus 10Met Pro Leu Ala Asp Ala Pro Val Pro His Val Thr Phe Ala Glu Leu1 5 10 15Thr Thr Thr Asp Leu Val Val Asp Ala Val Tyr Ala Gly Gly Ser Ser 20 25 30Gly His Thr Gly Asp Asp Pro Met Ser Lys Ile Ile Lys Gly Ile Gly 35 40 45Asn Gln Gly Gly Phe Arg Tyr Ala Gly Ser Pro Ala Leu Gly Thr Val 50 55 60Lys Leu Ala Val Leu Tyr Thr Ser Gly Gly Glu Val Asp Trp Pro Asp65 70 75 80Tyr Leu Asp Val Glu Thr Gly Thr Phe Thr Tyr Tyr Gly Asp Asn Arg 85 90 95Arg Pro Gly Gln Ser Leu His Glu Thr Pro Arg Ser Gly Asn Ile Leu 100 105 110Leu Arg Asp Ala Phe Ala Ala Ser His Gly Thr Pro Ala Asp Arg Ser 115 120 125Lys Val Pro Pro Phe Phe Leu Phe Glu Lys Ala Ala Ala Arg Gly Arg 130 135 140Ser Val Leu Phe Arg Gly Leu Leu Ala Pro Gly Gly Pro Asn Leu Thr145 150 155 160Ser Asp Asp Glu Leu Ala Ala Ile Trp Arg Ala Thr Asp Gly Arg Arg 165 170 175Phe Gln Asn Tyr Arg Ala Arg Phe Thr Val Leu Glu Val Asp Arg Val 180 185 190Pro Arg Ala Trp Ile Gln His Leu Leu Asn Gly Gly Asp Pro Leu Asp 195 200 205Gly Glu Cys Pro Asp Ala Trp Arg Thr Trp Thr Glu Ser Arg Val Tyr 210 215 220Arg Pro Leu Leu Ala Pro Ser Thr Thr Val Val Arg Ser Lys Ala Asp225 230 235 240Gln Leu Pro Gly Asp Ala Val Gly Lys Ala Met Leu Gln Glu Ile Arg 245 250 255Asp Tyr Phe Arg Gly Arg Glu His Asp Phe Glu Leu Cys Ala Val Ala 260 265 270Ile Trp Arg Leu Met Ala Pro Ser Thr Gly Ala Val Asp Val Thr Arg 275 280 285Pro Ser Arg Asp Gly Gly Arg Asp Ala Val Gly Thr Tyr Leu Leu Gly 290 295 300Pro Ala Ala Asn Arg Ile Ala Val Asp Phe Ala Leu Glu Ala Lys Cys305 310 315 320Tyr Gly Pro Asp Asn Ser Val Gly Val Arg Glu Val Ser Arg Leu Ile 325 330 335Ser Arg Leu Arg His Arg Asn Phe Gly Val Leu Val Thr Thr Ser Phe 340 345 350Leu Asn Lys Gln Val Gln Asp Glu Ile Gln Glu Asp Gly His Pro Ile 355 360 365Ala Leu Val Cys Gly Arg Asp Ile Val Glu Val Leu Arg Gln His Gly 370 375 380Arg Thr Thr Ala Asp Ser Val Arg Gln Trp Leu Thr Gln Ser Phe Pro385 390 395 400Gln Pro11388PRTAzoarcus sp. 11Met Thr Phe Phe Thr Gly Glu Thr Leu Gly Gln Val Asp Leu Ile Val1 5 10 15Asp Ala Val Tyr Ala Gly Tyr Lys Thr Glu Arg Gly Gly Met Ala Asp 20 25 30Pro Leu Val Pro Leu Val Gly Val Ser Arg Gln Gly Gly Phe Arg Tyr 35 40 45Arg Gly Thr Arg Glu Arg Pro Thr Leu Leu Val Leu Thr Ser Asn Leu 50 55 60Ala Glu Pro Glu Trp Pro Asp Gln Leu Asp Glu Thr Thr Gly Thr Phe65 70 75 80Ile Tyr Tyr Gly Asp Asn Arg His Pro Gly Arg Leu Leu His Asp Thr 85 90 95Pro Arg Phe Gly Asn Gln Leu Leu Arg Gln Ile Phe Asp Trp Ala His 100 105 110Leu Gly Gln Arg His Leu Val Pro Pro Ile Leu Val Phe Thr Thr Glu 115 120 125Ala Thr Gly Arg Thr Phe Arg Phe Arg Gly Leu Ala Val Pro Gly Ser 130 135 140Pro Ala Leu Ala Ala Thr Glu Asp Leu Val Ala Leu Trp Lys Thr Thr145 150 155 160Glu Gly Gln Arg Phe Gln Asn Tyr Lys Ala Val Phe Thr Ile Leu Asp 165 170 175Glu Ala Val Ile Pro Arg Ala Trp Val His Ala Val Gly Arg Gly Glu 180 185 190Thr Ser Gly Leu Ala Pro Val Ala Trp Asn Ala Trp Leu Ser Ala Gly 195 200 205Gly Ile Arg Pro Leu Met Ala Pro Arg Ser Leu Leu Val Arg Ser Lys 210 215 220Ala Glu Gln Leu Pro Ala Thr Pro Glu Asp Gln Ala Leu Ile Glu Val225 230 235 240Ile Arg Gln Arg Tyr Lys Glu Asn Pro Phe Gly Phe Glu Ala Cys Ala 245 250 255Gly Ala Leu Thr Arg Leu Leu Leu Pro Asp Val Ala Arg Leu Asp Leu 260 265 270Thr Arg Pro Trp Arg Asp Gly Gly Arg Asp Gly Ile Gly Arg Leu Arg 275 280 285Ile Gly Gln Ser Pro Ala Ala Ile Glu Val Asp Phe Ala Leu Glu Ala 290 295 300Lys Cys Tyr Gly Ala Asn Asn Ala Val Gly Val Lys Glu Val Ser Arg305 310 315 320Leu Ile Ser Arg Ile Lys His Arg Glu Phe Gly Val Leu Val Thr Thr 325 330 335Ser Tyr Val Asp Arg Gln Ala Tyr Gln Glu Val Thr Asp Asp Gly His 340 345 350Pro Val Ile Leu Thr Thr Ala Gln Asp Ile Val Gly Leu Leu Arg Ser 355 360 365Ala Gly Val Arg Thr Pro Thr Gln Val Asp Ala Trp Leu Asp Gly Ile 370 375 380Thr Ala Ser Val38512285PRTBurkholderia cenocepacia 12Met Leu Arg Asn Leu Phe Asp Glu Ala His Gln Phe Gln Gln Ser Ser1 5 10 15Ser Phe Pro Pro Ile Leu Leu Phe Gly Asn Ala Gly Thr Tyr Arg Asp 20 25 30Val Arg Phe Leu Gly Leu Ala Val Pro Gly Ala Ala Gly Met Gly Ala 35 40 45Asp Asp Asp Leu Val Ala Val Trp Arg Thr Thr Glu Asp Gly Val Arg 50 55 60Phe Gln Asn Tyr Lys Ala Thr Phe Thr Ile Leu Asp Leu Pro Val Val65 70 75 80Ser Arg Ala Trp Ile Lys Asp Val Gln Asn Gly Asn Ala Val Ser Ser 85 90 95Ala His Ala Pro Lys Ala Trp Leu Asp Trp Val Ser Gly Arg Lys Tyr 100 105 110Thr Pro Leu Lys Ser Val Pro Val Ser Val Val Arg Ser Lys Arg Gln 115 120 125Gln Val Pro Asp Thr Pro Glu Leu Ala Ala Tyr Val Lys Thr Val Tyr 130 135 140Glu His Tyr Lys Glu Asp Pro Tyr Ala Phe Glu Arg Cys Ala Met Glu145 150 155 160Leu Ala Arg Leu Phe Met Pro Ala Ile Gln His Trp Glu Leu Thr Arg 165 170 175Pro Trp Arg Asp Gly Gly Arg Asp Ala Leu Gly Thr Tyr Arg Ile Gly 180 185 190His Gly Ala Gly Ala Ile Asp Val Glu Phe Ala Met Glu Ala Lys Cys 195 200 205Tyr Asp Gln Asn Val Gly Val Gly Ile Lys Pro Leu Ser Arg Leu Ile 210 215 220Ser Arg Leu Arg His Arg Gln Phe Gly Ile Leu Val Thr Thr Ser Tyr225 230 235 240Leu Asp Ala Gln Ala Tyr Ser Glu Leu Val His Asp Thr His Pro Val 245 250 255Val Val Ile Ser Ala Lys Asp Ile Ser Met Lys Leu Arg Glu Arg Phe 260 265 270Gly Ser Leu Glu Ser Ile Lys Leu Trp Leu Gln Arg Ile 275 280

28513399PRTLegionella pneumophila 13Met Lys Ile Tyr Ser Phe Asp Thr Leu Ala Asn Ala Asp Leu Ile Ile1 5 10 15Asp Ala Val Tyr Glu Gly Gly Ser Ser Gly Asn Ala Ser Asp Asp Pro 20 25 30Ile Ser Lys Ile Ile Lys Gly Ile Gly Asn Met Gly Gly Phe Arg Ser 35 40 45Ala Gly Gln Gly Ile Phe Lys Lys Leu Ile Val Leu Tyr Thr Asn Met 50 55 60Glu Asp Gly Asp Trp Pro Asp Ser Ile Asp Thr Ser Lys Gly Gln Phe65 70 75 80Ile Tyr Tyr Gly Asp Asn Lys His Pro Gly His Asp Ile His Asp Thr 85 90 95Pro Arg Gln Gly Asn Ala Thr Leu Lys Met Leu Phe Asp Ser Thr His 100 105 110Asn Glu Lys Asp Ala Arg Arg Ile Val Pro Pro Ile Phe Ile Phe Val 115 120 125Lys Tyr Pro Thr Ala Ser Ser Ser Arg Ser Val Gln Phe Lys Gly Val 130 135 140Ala Val Pro Gly Tyr Pro Gly Leu Ser Ala Thr Asp Asp Leu Ile Ala145 150 155 160Val Trp Lys Thr Thr Asn Gly Gln Arg Phe Gln Asn Tyr Arg Ala Ile 165 170 175Phe Thr Ile Leu Asn Ile Pro Met Val Ser Arg Lys Trp Ile Asn Ser 180 185 190Leu Phe Asp Pro Phe Gly Gln Asp Asn Ser Leu Asn Pro Phe Tyr Gln 195 200 205Trp Lys Ile Ser Gly Lys Ala Asp Val Leu Ile Ala Pro Ser Thr Lys 210 215 220Thr Ile Arg Thr Gln Ile Glu Gln Met Pro Arg Thr Lys Leu Glu Arg225 230 235 240Glu Ile Leu Gln Ala Val Phe Asp Tyr Phe Cys Glu Ala Pro Ile Lys 245 250 255Phe Glu Ala Cys Ala Ala Lys Ile Phe Gln Leu Tyr Asp Glu Asn Val 260 265 270Leu Ile Asp Glu Ile Thr Arg Ser Ala Val Asp Gly Gly Lys Asp Ala 275 280 285Ile Gly Arg Tyr Val Leu Gly Ile Lys Glu Asp Pro Val Tyr Ala Glu 290 295 300Phe Phe Leu Glu Ala Lys Cys Tyr Gln Pro Gly Leu Asn Gly Gln Asn305 310 315 320Ile Asn Ser Val Gly Val Lys Glu Val Ser Arg Leu Ile Ser Arg Ile 325 330 335Lys Asn Arg Gln Phe Gly Val Leu Val Thr Thr Ser Phe Ile Ala Lys 340 345 350Gln Ala Tyr Gly Glu Val Arg Glu Asp Gly His Pro Ile Val Phe Leu 355 360 365Ser Gly Gly Asp Ile Ser Arg Ile Leu Ile Lys Lys Gly Ile Asn Ser 370 375 380Thr Asp Ala Val Leu Ala Trp Leu Asn Ser Glu Phe Ser Lys Ser385 390 39514369PRTRalstonia metallidurans 14Met Gly Gly Phe Arg Val Thr Gly Arg Gly Glu Gln Lys Ser Trp Val1 5 10 15Val Leu Phe Thr Thr Gly Glu Asp Lys Asp Trp Pro Asp Thr Leu Asp 20 25 30Leu Ser Thr Gly Lys Phe Val Tyr Phe Gly Asp Asn Lys Thr Pro Gly 35 40 45His Glu Leu His Glu Thr Arg Gly Gly Asn Lys Val Leu Arg Tyr Ser 50 55 60Phe Glu Arg Leu His Ala Ala Val Asn Pro Arg Ala Asp Val Ala Pro65 70 75 80Phe Leu Val Phe Lys Lys Tyr Pro Leu Ala His Gly Ala Arg Ser Val 85 90 95Gln Phe Lys Gly Leu Ala Val Pro Gly Phe Pro Ser Leu Ser Ser Thr 100 105 110Glu Asp Leu Val Ala Val Trp Lys Ser Ser Glu Gly Gln Arg Phe Gln 115 120 125Asn Tyr Arg Ala Val Phe Thr Ile Leu Asn Ala Pro Val Leu Ser Arg 130 135 140Ala Trp Ile Asn Asp Leu Lys Ala Gly Asp Leu Asn Ser Ser Asn Ala145 150 155 160Pro Arg Ala Trp Arg Gln Trp Arg Glu Ser Gly Lys Tyr Ser Pro Leu 165 170 175Ala Ala Ala Pro Thr Thr Asn Ile Arg Ser Ala Asn Ala Gln Ser Pro 180 185 190Asp Thr Ala Leu Lys Arg Glu Leu Leu Glu Cys Ile Trp Gln His Tyr 195 200 205Lys Gly Ala Pro Ile Ala Phe Glu Ala Phe Ala Ala Arg Val Phe Gln 210 215 220Met Thr Asp Glu Arg Val Val Ile Asp Glu Ile Thr Arg Gly Val Val225 230 235 240Asp Gly Gly Arg Asp Ala Ile Gly Arg Tyr Arg Leu Gly Ser Met Ala 245 250 255Asp Pro Val Tyr Ala Glu Phe Ser Leu Glu Ala Lys Cys Tyr Arg Pro 260 265 270Pro Leu Asn Gly Asp Thr Pro Ile Thr Val Ser Val Ser Asp Val Ala 275 280 285Arg Leu Ile Ser Arg Ile Arg His Arg Gln Phe Gly Val Leu Val Thr 290 295 300Thr Ser Val Ile Ala Ser Gln Ala Tyr Lys Glu Val Arg Glu Asp Arg305 310 315 320His Pro Ile Val Phe Ile Ser Gly Gly Asp Met Val Asn Ile Leu Ile 325 330 335Asp Lys Gly Tyr Asn Thr Arg Gly Arg Val Gln Glu Leu Leu Ser Ser 340 345 350Asp Phe Ala Leu Val Ala Ala Ala Ser Ser Glu Pro Val Asp Lys Pro 355 360 365Arg 15392PRTRuminococcus lactaris 15Met Gln Arg Ile Ala Phe Glu Lys Leu Lys Thr Ala Asp Leu Phe Val1 5 10 15Asp Ala Val Tyr Glu Ser Asn Gly Ala Thr Asn Leu Asn Gly Asp Val 20 25 30Leu Ser Lys Leu Met Ser Val Gly Thr Gln Gly Gly Phe Arg Pro Val 35 40 45Asn Ile Arg Asn Gln Lys Gly Lys Ala Ala Tyr Ile Val Leu Glu Ser 50 55 60Thr Asn Lys His Pro Asp Trp Leu Asp Asn Ile Asp Tyr Glu Ser Gly65 70 75 80Ile Ile Gln Tyr Tyr Gly Asp Asn Arg Glu Pro Gly Arg Glu Leu His 85 90 95Asp Ser Lys Arg Gly Gly Asn Lys Val Leu Arg Asp Val Phe Glu Met 100 105 110Leu Gln Asp Asn Arg Arg Gln Glu Ile Pro Pro Phe Phe Tyr Phe Glu 115 120 125Ser Glu Glu Gly Arg Asn Arg Arg Phe Leu Gly Leu Leu Val Pro Gly 130 135 140Ser Asp Lys Phe Lys Leu Glu Glu Leu Leu Val Ala Ile Trp Arg Met145 150 155 160Lys Asn Gly Glu Arg Tyr Gln Asn Tyr Lys Ala Val Phe Thr Ile Leu 165 170 175Asp Val Ala Ser Val Ser Arg Gly Trp Leu Glu Asp Leu Leu Ser Gly 180 185 190Asn Gly Tyr Gln Ser Asp Phe Ala Pro Lys Glu Trp Lys Lys Trp Ile 195 200 205Asp Lys Gly Val Tyr Thr Pro Leu Tyr Ala Ser Asp Ser Val Leu Asn 210 215 220Tyr Arg Thr Gln Asp Gln Gln Met Pro Phe Lys Asp Asp Asp Lys Gln225 230 235 240Lys Leu Gln Ser Ile Tyr Asp Tyr Phe Asp Asn Pro Tyr Glu Phe Glu 245 250 255Lys Cys Ala Met Lys Ile Val Gln Leu Met Asp Ser Asn Ile His Ser 260 265 270Leu Lys His Thr Arg Phe Val Arg Asp Gly Gly Arg Asp Ala Ile Gly 275 280 285Leu Tyr Arg Ile Gly Arg Gln Cys Asp Gly Val Asp Val Glu Phe Ala 290 295 300Leu Glu Ala Lys Arg Tyr Ser Ser Asn Asp Gly Ile Gly Val Lys Glu305 310 315 320Val Ser Arg Leu Ile Ser Arg Leu Arg His Arg Gln Phe Gly Ile Leu 325 330 335Val Thr Thr Ser Phe Val Ala Leu Gln Ala Tyr Gln Glu Ile Lys Glu 340 345 350Asp Gly His Pro Ile Val Ile Ile Ser Gly Met Asp Ile Leu Arg Ile 355 360 365Leu Tyr Asp Ser Gly Ile Lys Thr Lys Asp Glu Ile Gln Glu Trp Leu 370 375 380Val Lys Thr Phe Pro Lys Asp Glu385 39016433PRTLactobacillus helveticus 16Met Val Leu His Ile Gly Val Ser Tyr Lys Thr Gly Pro Gln Ala Lys1 5 10 15Lys Glu Ala Gln Glu Ile Ser Asp Thr Tyr Tyr Ile Ser Glu Asp Asp 20 25 30Asp Ser Ser Lys Asn Tyr Phe Ile Glu Thr His Leu Lys Asp Gly Lys 35 40 45Lys Asn Tyr Phe Asn Gln Ala Gly Ile Phe Lys Pro Ala Glu Asn Glu 50 55 60Cys Ile Ile Ile Ser Ser Asn Thr Lys Ser Arg Gly Ile Asn Tyr Asn65 70 75 80Pro Trp Glu Asp Glu Phe Asn Glu Asp Val Gly Tyr Ile Asn Tyr Tyr 85 90 95Gly Asp Asn Lys Arg Pro Asp Thr Asp Pro Ala Thr Thr Arg Gly Asn 100 105 110Lys Tyr Leu Leu Asp Gln Phe Lys Ile Ser His Asp Pro Asn Pro Glu 115 120 125Val Arg Ala Thr Ala Val Pro Ile Ile Phe Phe Glu Thr Arg Lys Gln 130 135 140Gly Glu Arg Ile Phe His Gly Tyr Gly Val Ile Lys Asn Val Lys Leu145 150 155 160Val Thr Gln Tyr Thr Gly Ser Gly Ala Asp Lys Ala Tyr Phe Ser Asn 165 170 175Tyr Leu Phe Thr Phe Cys Val Phe Ser Met Lys Lys Glu Gln Glu Gly 180 185 190Phe Asp Trp Ser Trp Ile Glu Ala Arg Lys Gln Ala Ala Lys Asp Lys 195 200 205Asn Phe Leu Ser Leu Ala Asn Ala Leu Ala Pro Lys Glu Trp Lys Phe 210 215 220Trp Ile Arg Thr Gly Asp Leu Glu Lys Val Arg Arg Lys Val Tyr Gly225 230 235 240Arg Ser Thr Ser Lys Lys Glu Glu Gln Leu Pro Thr Pro Gly Ser Ala 245 250 255Asp Asp Lys Ile Leu Asn Gln Ile Tyr Glu Tyr Tyr Arg Lys Lys Asp 260 265 270Asn Ser Lys Ala His Ser Gly Asp Phe Glu Phe Glu Gly Leu Ala Lys 275 280 285Glu Ile Thr Arg Leu Ile Ile Gly Asp Ala Cys His Asp Gly Trp Val 290 295 300Thr Lys Ser Ser Gly Asp Gly Gly Tyr Asp Phe Val Leu Arg Val Asp305 310 315 320Ile Gly Thr Lys Gly Ile Ser Gln Val Arg Gln Val Val Leu Gly Gln 325 330 335Ala Lys Cys Tyr Arg Arg Asp Gln Arg Ile Thr Gly Glu Ala Val Asp 340 345 350Arg Val Val Ala Arg Leu Lys Arg Gly Trp Ile Ala Ala Phe Val Thr 355 360 365Thr Ser Phe Phe Ser Asp Pro Ala Gln Arg Glu Ile Leu Glu Asp Asp 370 375 380Tyr Pro Ile Met Leu Ile Ser Gly Lys Gln Val Ala Gln Thr Val Arg385 390 395 400Lys Tyr Ile Tyr Glu Lys Asn Ile Thr Leu Arg Glu Tyr Leu Asp Ser 405 410 415Leu Ser Arg Asp Gln Ser Phe Lys Ser Pro Glu Asp Ile Leu Lys Glu 420 425 430Glu 17383PRTLactobacillus helveticus 17Tyr Phe Asn Gln Ala Gly Ile Phe Lys Pro Ala Glu Asn Glu Cys Ile1 5 10 15Ile Ile Ser Ser Asn Thr Lys Ser Arg Gly Ile Asn Tyr Asn Pro Trp 20 25 30Glu Asp Glu Phe Asn Glu Asp Val Gly Tyr Ile Asn Tyr Tyr Gly Asp 35 40 45Asn Lys Arg Pro Asp Thr Asp Pro Ala Thr Thr Arg Gly Asn Lys Tyr 50 55 60Leu Leu Asp Gln Phe Lys Ile Ser His Asp Pro Asn Ser Glu Val Arg65 70 75 80Ala Thr Ala Val Pro Ile Ile Phe Phe Glu Thr Arg Lys Gln Gly Glu 85 90 95Arg Ile Phe His Gly Tyr Gly Val Ile Lys Asn Val Lys Leu Val Thr 100 105 110Gln Tyr Thr Gly Ser Gly Ala Asp Lys Ala Tyr Phe Ser Asn Tyr Leu 115 120 125Phe Thr Phe Cys Val Phe Ser Met Lys Lys Glu Gln Glu Gly Phe Asp 130 135 140Trp Ser Trp Ile Glu Ala Arg Lys Gln Ala Ala Lys Asp Lys Asn Phe145 150 155 160Leu Ser Leu Ala Asn Ala Leu Ala Pro Lys Glu Trp Lys Phe Trp Ile 165 170 175Arg Thr Gly Asp Leu Glu Lys Val Arg Arg Lys Val Tyr Gly Arg Ser 180 185 190Thr Ser Lys Lys Glu Glu Gln Leu Pro Thr Pro Gly Ser Ala Asp Asp 195 200 205Lys Ile Leu Asn Gln Ile Tyr Glu Tyr Tyr Arg Lys Lys Asp Asn Ser 210 215 220Lys Ala His Ser Gly Asp Phe Glu Phe Glu Gly Leu Ala Lys Glu Ile225 230 235 240Thr Arg Leu Ile Ile Gly Asp Ala Cys His Asp Gly Trp Val Thr Lys 245 250 255Ser Ser Gly Asp Gly Gly Tyr Asp Phe Val Leu Arg Val Asp Ile Gly 260 265 270Thr Lys Gly Ile Ser Gln Val Arg Gln Val Val Leu Gly Gln Ala Lys 275 280 285Cys Tyr Arg Arg Asp Gln Arg Ile Thr Gly Glu Ala Val Asp Arg Val 290 295 300Val Ala Arg Leu Lys Arg Gly Trp Ile Ala Ala Phe Val Thr Thr Ser305 310 315 320Phe Phe Ser Asp Pro Ala Gln Arg Glu Ile Leu Glu Asp Asp Tyr Pro 325 330 335Ile Met Leu Ile Ser Gly Lys Gln Val Ala Gln Thr Val Arg Lys Tyr 340 345 350Ile Tyr Glu Lys Asn Ile Thr Leu Arg Glu Tyr Leu Asp Ser Leu Ser 355 360 365Arg Asp Gln Ser Phe Lys Ser Pro Glu Asp Ile Leu Lys Glu Glu 370 375 38018436PRTShewanella pealeana 18Met Ile Asn Ile Val Glu Ile Gln Ile Gly Val Val Leu Arg Tyr Lys1 5 10 15Lys Pro Ser Cys Ala Val Asn Met Tyr Glu Asp Gly His Leu Asn Phe 20 25 30His Phe Leu Thr Lys His Ser Glu Ala Asn Asn Leu Gln Leu Glu Lys 35 40 45Gly Ile Asn Pro Ser Ala Lys Ile Lys Thr Asn Ser Gly Glu Leu Val 50 55 60Arg Ser Ala Ile Leu Val Ser Ser Ser Pro Asn Lys Lys Gly Ser Ile65 70 75 80Glu Thr Pro Trp Glu Asp Phe Tyr Asp Val Asp Asn Gly His Ile Arg 85 90 95Tyr Phe Gly Asp Asn Lys Glu Pro Gly Lys Asp Pro Ala Thr Ala Pro 100 105 110Gly Asn Lys Ala Leu Leu Glu Ala Phe Arg Leu Ala His Ser His Ser 115 120 125Ala Glu Glu Arg Ala Leu Thr Pro Pro Ile Leu Phe Phe Lys Arg Ala 130 135 140Val Ile Asn Gly Val Ala Lys Gly Tyr Pro Gln Phe Tyr Gly Leu Gly145 150 155 160Ile Ile Asn Ser Val Glu Leu Val Thr Gln Trp Asp Asn Lys Leu Ala 165 170 175Arg Thr Phe Thr Asn Tyr Ala Phe Asp Phe Thr Val Leu Cys Ile Ala 180 185 190Ser Glu His Glu Glu Phe Glu Trp Asp Trp Ile Asn Ser Arg Arg Lys 195 200 205Lys Gly Phe Ser Leu Ser Ile Thr Asn Lys Ala Ser Pro Lys Ser Trp 210 215 220Arg Gln Trp Leu Ile Glu Gly Ser Asn Ser Leu Asn Lys Leu Arg Arg225 230 235 240Arg Val Ser Lys Leu Ser Leu Glu Lys Thr Val Asn Gln Lys Pro Ile 245 250 255Pro Gly Ser Glu Ser Asp Arg Ile Leu Asn Glu Ile Tyr Ile Tyr Tyr 260 265 270Ala Asn Lys Lys His Arg Phe Glu Ala Leu Ala Glu Val Ile Ala Ala 275 280 285Arg Val Ile Asp Arg Glu Phe Gly Ile Tyr His Lys Gly Trp Val Thr 290 295 300Gln Gly Ser Ser Asp Gly Gly Ala Asp Phe Val Gly Lys Val Thr Leu305 310 315 320Gly Ser Gly Phe Ser Lys Val Glu Leu Ile Val Leu Gly Gln Ala Lys 325 330 335Cys Glu Ala Leu Asn Ser Pro Thr Gly Gly Asn His Ile Ala Arg Thr 340 345 350Val Ala Arg Leu Lys Arg Gly Trp Leu Gly Val Tyr Val Thr Thr Ser 355 360 365Tyr Phe Ser Asp Ser Val Gln Arg Glu Val Ile Glu Asp Lys Tyr Pro 370 375 380Ile Ile Leu Ile His Gly Arg Arg Ile Ala Glu Glu Val Ala Lys Ile385 390 395 400Val Tyr Glu Ser Glu Glu Phe Glu Ser Val Asn Ser Phe Leu Val Ala 405 410 415Met Asp Lys Asp Tyr Pro Thr Arg Leu Lys Gln Arg Gln Ala Glu Glu 420 425 430Val Leu Asn Ile 43519432PRTShewanella baltica 19Met Glu Ile Gln Ile Gly Asp Val Leu Arg Tyr Lys Lys Pro Ala Cys1 5 10 15Gly Glu Asn Met Tyr Glu Asp Gly Tyr Leu Asn Phe His Phe Leu Thr 20 25 30Lys Ser Ile Asp Ala Asn Asn Leu Gln Leu

Glu Lys Gly Ile Asn Pro 35 40 45Ser Ala Lys Ile Lys Thr Ser Leu Gly Gln Leu Val Arg Pro Ala Ile 50 55 60Leu Ile Ser Ser Ser Pro Asn Lys Lys Gly Ser Ile Glu Thr Pro Trp65 70 75 80Glu Asp Phe Tyr Asp Val Asp Asn Gly His Ile Arg Tyr Phe Gly Asp 85 90 95Asn Lys Glu Pro Gly Lys Asp Pro Ala Thr Ala Pro Gly Asn Lys Ala 100 105 110Leu Leu Glu Ala Phe Arg Leu Ala His Ser His Asn Val Asp Glu Arg 115 120 125Leu Leu Thr Pro Pro Ile Leu Phe Phe Lys Arg Ala Ile Val Asn Gly 130 135 140Val Ala Lys Gly Tyr Pro Gln Phe Tyr Gly Leu Gly Ile Ile Asn Ser145 150 155 160Val Glu Leu Val Thr Gln Trp Asp Asn Lys Leu Ala Arg Thr Phe Thr 165 170 175Asn Tyr Ala Phe Asp Phe Thr Val Leu Cys Ile Ala Gly Glu His Glu 180 185 190Lys Phe Glu Trp Asp Trp Ile Asn Asn Arg Arg Lys Lys Ala Phe Ser 195 200 205Leu Ala Ile Thr Asn Gln Thr Ala Pro Lys Ser Trp Arg Gln Trp Leu 210 215 220Cys Glu Gly Ser Asn Ala Leu Asn Lys Leu Arg Arg Arg Val Ser Lys225 230 235 240Leu Ser Leu Glu Lys Ala Val Asn Gln Lys Pro Ile Pro Gly Ser Glu 245 250 255Ser Asp Lys Ile Leu Asn Gln Ile Tyr Asp Tyr Tyr Ala Asn Lys Lys 260 265 270His Arg Phe Glu Ala Leu Ala Glu Val Ile Ala Glu Arg Val Ile Asp 275 280 285Arg Glu Leu Gly Ile Tyr Gln Lys Gly Trp Val Thr Gln Gly Ser Gly 290 295 300Asp Gly Gly Ala Asp Phe Ile Gly Lys Val Thr Leu Gly Ser Gly Phe305 310 315 320Ser Lys Val Glu Leu Ile Val Leu Gly Gln Ala Lys Cys Glu Ser Leu 325 330 335Asn Thr Pro Thr Gly Gly Asn His Ile Ala Arg Thr Val Ala Arg Leu 340 345 350Lys Arg Gly Trp Leu Gly Val Tyr Val Thr Thr Ser Tyr Phe Ser Asp 355 360 365Ser Val Gln Arg Glu Val Ile Glu Asp Lys Tyr Pro Ile Val Leu Ile 370 375 380His Gly Arg Arg Leu Ala Glu Glu Val Ala Lys Ile Val Tyr Glu Ser385 390 395 400Glu Ala Tyr Ser Asn Val Thr Glu Phe Leu Ile Ala Met Asp Ala Val 405 410 415Tyr Pro Ser Arg Leu Lys Gln Arg Gln Ala Glu Glu Ile Leu Asn Asn 420 425 43020432PRTMoritella sp. 20Met Glu Ile Lys Ile Asn Asp Ile Leu Arg Tyr Lys Lys Pro Ala Cys1 5 10 15His Glu Asn Ala Tyr Glu Asp Gly His Leu Asn Phe His Phe Leu Thr 20 25 30Asn Val Pro Thr Ser Lys Lys Leu Gln Leu Glu Lys Gly Ile Asn Pro 35 40 45Ser Ala Ala Leu Lys Thr Ser Asp Lys Glu Leu Val Arg Pro Val Ile 50 55 60Leu Ile Ser Ser Ser Pro Asn Lys Lys Gly Ser Ala Glu Thr Pro Trp65 70 75 80Gln Asp Phe Tyr Asp Thr Asp Asn Gly His Ile Arg Tyr Phe Gly Asp 85 90 95Asn Lys Glu Pro Gly Lys Asp Pro Thr Gln Ala Pro Gly Asn Lys Ala 100 105 110Leu Leu Glu Ala Phe Arg Leu Ala His Ser His Asp Ile Lys Glu Arg 115 120 125Gln Lys Thr Pro Pro Ile Val Phe Phe Lys Arg Val Thr Val Asn Gly 130 135 140Val Pro Lys Gly Tyr Pro Met Phe Gln Gly Leu Gly Ile Ile Asn Ser145 150 155 160Ile Glu Leu Val Thr Gln Trp Asp Asn Asn Lys Gln Gln Ser Phe Thr 165 170 175Asn Tyr Ala Phe Asp Phe Thr Val Leu Cys Met Ala Lys Glu His Asp 180 185 190Thr Phe Glu Trp Asp Trp Ile Asn Ser Arg Arg His Pro Asn Phe Ser 195 200 205Ile Gln Asp Thr Asn Lys Lys Ala Pro Ala Ser Trp Asn Gln Trp Phe 210 215 220Lys Ser Gly Ala Asn Glu Leu Asn Thr Val Arg Arg Arg Val Ser Lys225 230 235 240Leu Gln Ile Val Lys Ser Ala Asp Gln Lys Pro Thr Ile Gly Ser Glu 245 250 255Gln Asp Ala Ile Leu Asn Lys Ile Tyr Lys Phe Tyr Asp Gly Arg Lys 260 265 270His His Phe Glu Ala Leu Ala Glu Phe Ile Thr Glu Arg Val Ile Gly 275 280 285Lys Glu Leu Gly Ile Tyr His Lys Gly Trp Ile Thr Gln Gly Ser Ser 290 295 300Asp Gly Gly Ala Asp Phe Ile Gly Lys Val Val Leu Gly Ser Gly Phe305 310 315 320Ser Lys Val Glu Leu Ile Val Leu Gly Gln Ala Lys Cys Glu Ser Leu 325 330 335Thr Thr Pro Thr Gly Gly Asn His Ile Ala Arg Thr Val Ala Arg Leu 340 345 350Lys Arg Gly Trp Leu Gly Ala Tyr Val Thr Thr Ser Tyr Phe Ser Asp 355 360 365Ser Val Gln Arg Glu Val Ile Glu Asp Lys Tyr Pro Ile Leu Leu Ile 370 375 380Asn Gly Lys Arg Ile Ala Glu Glu Val Ser Gln Leu Leu His Glu Ser385 390 395 400Asp Thr Tyr Ser Asp Ile Asp Glu Phe Leu Ala Tyr Met Ala Glu Arg 405 410 415Tyr Pro Lys Arg Leu Lys Gln Arg Gln Pro Glu Glu Ile Leu His Val 420 425 43021426PRTXanthomonas campestris 21Met Lys Arg Phe Arg Met Gly Glu Leu Tyr Arg Tyr Ala Arg Pro Ala1 5 10 15Leu Pro Glu Val Leu Glu Ile Asp Gly Ile Ser Asn Phe His Tyr Val 20 25 30Val Ala Ala Pro Gly Ser Pro Ser Leu Gln Leu Glu Arg Arg Ile Asn 35 40 45Ala Pro Ser Val Thr Arg Ala Ile Asp Gly Asp Arg Val Ala Val Val 50 55 60Leu Leu Ala Ser Asn Glu His Lys Arg Gly Ser Met Glu Asn Pro Trp65 70 75 80His Asp Thr Leu Ala Pro Asp Glu Gly Phe Ala Arg Tyr Phe Gly Asp 85 90 95Asn Arg Thr Pro Asp Val Asp Pro Gly Thr Ala Ile Gly Asn Arg Thr 100 105 110Leu Leu Arg Gln Phe Glu Phe His Thr Ser Pro Asp Gln Gly Lys Arg 115 120 125Glu Arg Ala Ala Pro Val Leu Leu Phe Arg Ser Thr Lys Lys Gly Phe 130 135 140Lys Glu Phe Ser Gly Leu Ala Leu Ile Val Gly Ala Arg Arg Val Thr145 150 155 160Gln Phe Ser Glu Lys Asn Gly Gly Phe Phe Thr Asn Tyr Leu Phe Asp 165 170 175Leu Ala Val Leu Ser Leu Thr Glu Glu Asp Glu Ser Leu Ala Met Leu 180 185 190Trp Ile His Asp Arg Arg Asp Pro Ser Arg Ala Cys Gly Val Ala Asn 195 200 205Ala Met Ala Pro Lys Ala Trp Gln Arg Trp Val Lys Phe Gly Ser Pro 210 215 220Glu Ile Glu Arg Ile Lys Arg Arg Val Ala Arg Tyr His Ile Leu Pro225 230 235 240Lys Arg Asp Gln Val Ala Pro Val Ser Ser Glu Gly Gly Lys Thr Leu 245 250 255Glu Ala Ile Tyr Arg Phe Tyr Glu Pro Lys Arg His Arg Phe Glu Ala 260 265 270Leu Ala Ser Leu Ala Cys Glu Ser Met Val Arg Gly Thr Gly Ala Glu 275 280 285Tyr His Arg Gly Trp Leu Thr Arg Gly Thr Gly Asp Gly Gly Leu Asp 290 295 300Phe Val Gly Arg Ile Asp Ile Gly Glu Gly Leu Trp Gly Thr Lys Leu305 310 315 320Val Val Leu Gly Gln Ala Lys Cys Glu Lys Ile Asp Ala Pro Thr Gly 325 330 335Gly Val His Ile Ala Arg Thr Val Ala Arg Leu Arg Arg Gly Trp Leu 340 345 350Gly Ala Tyr Val Thr Thr Ser Phe Phe Ser Glu Ala Val Gln Arg Glu 355 360 365Val His Asp Asp Gln Tyr Pro Val Leu Leu Leu Asn Gly Ala Gly Leu 370 375 380Ala Ala Glu Val Thr Lys Leu Arg Leu Glu Gly Gly Phe Ala Ser Thr385 390 395 400Glu Gln Phe Leu Glu His Ile Asp Ala Asp Tyr Glu Ala Gln Val Ser 405 410 415Ser Arg Arg Pro Glu Glu Val Leu Trp Glu 420 42522456PRTMycobacterium sp. 22Met Asn Gly Pro Lys Ala Asp Ile Ala Trp Ala Ala Ser Ala Glu Val1 5 10 15Ala Asn Lys Pro Arg Leu Val Phe Val Gly Asp Glu Leu Arg Tyr Ala 20 25 30Gln Gly Ala Asn Gln Arg Asp Val Glu Leu Asp Gly Phe Val Asn Tyr 35 40 45His Trp Leu Thr Ser Pro Gly Gly Leu Gly Leu Pro Lys Val Met Leu 50 55 60Glu Ala Gly Ile Asn Ala Pro Ala Glu Val Val Gly Pro Asp Arg Ser65 70 75 80Arg Arg Ala Leu Ile Ala Ile Arg Ser Ser Pro Trp Lys Ala Gly His 85 90 95Glu Thr Asn Pro Trp His Asp Glu Phe Asp Leu Asp His Gly His Val 100 105 110Arg Tyr Phe Gly Asp His Lys Pro Ser Thr Val Gly Leu Pro Gly Glu 115 120 125Thr Lys Gly Asn Arg Leu Leu Leu Glu Ala Ala Arg Leu His Ala Gly 130 135 140Thr Thr Arg Glu Glu Arg Leu Leu Ala Pro Pro Leu Phe Leu Phe Arg145 150 155 160Ala Val Thr Val His Arg Ala Gly Arg Ala Val Val Lys Gly His Val 165 170 175Glu Phe Cys Gly Ala Ala Ile Ile Glu Arg Leu Glu His Val Val Gln 180 185 190Arg Asp Pro Glu Thr Gly Arg Ser Phe Pro Asn Leu Ser Leu Asp Leu 195 200 205Ala Val Val Ser Gly Gly Glu Ile Asp Gly Val Asp Phe Arg Trp Ile 210 215 220Asp Asp Arg Arg Asn Ala Ala Leu Ala Ala Gly Glu Thr Leu Arg His225 230 235 240Ala Pro Glu Ser Trp Ile Arg Trp Val Arg Gln Gly Arg Leu Ala Ile 245 250 255Pro Gly Ile Arg Arg Arg Val Leu Ala Ser Ala Val Gln Ser Ser Lys 260 265 270Glu Gln Gln Pro Ala Ser Gly Ser Ala Glu Ala Ala Thr Leu Gln Thr 275 280 285Leu Tyr Lys Phe Tyr Asp Gly Arg Lys His Ala Phe Glu Leu Leu Ala 290 295 300Ser Arg Val Ala Ala Glu Val Phe Arg Glu Ser Gly Ala Arg Tyr Lys305 310 315 320Glu Gly Trp Leu Ser Arg Ser Ser Gly Asp Gly Gly Val Asp Phe Ile 325 330 335Gly Arg Ile Asp Met Gly Ser Leu Lys Ala Ser Thr Pro Val Val Val 340 345 350Leu Gly Gln Ala Lys Cys Ile Gln Pro Thr Ser Ser Val Ser Pro Glu 355 360 365Gln Val Ala Arg Val Val Ala Arg Leu Arg Arg Gly Trp Ile Gly Val 370 375 380Tyr Val Thr Thr Gly Ser Phe Ser Arg Gln Ala Gln Val Glu Ile Ile385 390 395 400Asp Asp Gln Tyr Pro Val Val Leu Ile Ala Gly Gly Thr Leu Ala Ala 405 410 415Thr Val Arg Arg Met Val Gln Ala Asn Tyr Gly Gly Asp Leu Asp Ala 420 425 430Leu Leu Ala Ser Thr Val Asp Glu Tyr Gly Ala Ala Val Thr His Arg 435 440 445Arg Pro Glu Glu Val Ile Ser Leu 450 4552361PRTVeillonella parvulaMISC_FEATURE(1)..(61)conserved motif in the N-terminal domain of seq id no. 7 23Glu Asp Ile Asp Trp Pro Asp Val Leu Glu Ala Glu Thr Gly Lys Phe1 5 10 15Lys Tyr Tyr Gly Asp Asn Lys Arg Pro Gly Asp Lys Val Asp Ser Lys 20 25 30Lys Gly Asn Leu Ile Leu Glu Thr Ile Phe Asn Glu Lys Asn Arg Asn 35 40 45Lys Ile Pro Pro Val Phe Ile Phe Met Lys Asn Pro Thr 50 55 602466PRTCatenibacterium mitsuokaiMISC_FEATURE(1)..(66)conserved motif in the N-terminal domain of seq id no 8 24Glu Glu Leu Glu Trp Pro Asp Phe Leu Asp Glu Glu Thr Gly Val Phe1 5 10 15Arg Tyr Tyr Gly Asp Asn Arg Lys Pro Gly Asn Asp Ile Arg Asn Thr 20 25 30Lys Lys Lys Gly Asn Leu Leu Leu Glu Glu Val Phe Glu Leu Leu Asn 35 40 45Ser Asn Asn Leu Glu Asp Met Pro Pro Phe Phe Val Phe Lys Lys Thr 50 55 60Gly Asn652568PRTFrankia sp.MISC_FEATURE(1)..(68)conserved motif in the N-terminal domain of seq id no. 9 25Ala Val Ala Asp Trp Pro Asp Thr Leu Asp Pro Ser Thr Gly Val Phe1 5 10 15Thr Tyr Tyr Gly Asp Asn Arg Lys Pro Gly Arg Asp Leu His Asp Thr 20 25 30Gln Arg Ser Gly Asn Leu Leu Leu Arg Asp Val Phe Glu His Ala His 35 40 45Gly Ser Val Glu Glu Arg Arg Thr Val Pro Pro Phe Leu Leu Phe Glu 50 55 60Thr Ala Pro Pro652668PRTStreptomyces griseoflavusMISC_FEATURE(1)..(68)conserved motif in the N-terminal domain of seq id no. 10 26Gly Glu Val Asp Trp Pro Asp Tyr Leu Asp Val Glu Thr Gly Thr Phe1 5 10 15Thr Tyr Tyr Gly Asp Asn Arg Arg Pro Gly Gln Ser Leu His Glu Thr 20 25 30Pro Arg Ser Gly Asn Ile Leu Leu Arg Asp Ala Phe Ala Ala Ser His 35 40 45Gly Thr Pro Ala Asp Arg Ser Lys Val Pro Pro Phe Phe Leu Phe Glu 50 55 60Lys Ala Ala Ala652766PRTAzoarcus sp.MISC_FEATURE(1)..(66)conserved motif in the N-terminal domain of seq id no.11 27Ala Glu Pro Glu Trp Pro Asp Gln Leu Asp Glu Thr Thr Gly Thr Phe1 5 10 15Ile Tyr Tyr Gly Asp Asn Arg His Pro Gly Arg Leu Leu His Asp Thr 20 25 30Pro Arg Phe Gly Asn Gln Leu Leu Arg Gln Ile Phe Asp Trp Ala His 35 40 45Leu Gly Gln Arg His Leu Val Pro Pro Ile Leu Val Phe Thr Thr Glu 50 55 60Ala Thr652828PRTBurkholderia cenocepaciaMISC_FEATURE(1)..(28)conserved motif in the N-terminal domain of seq id no. 12 28Met Leu Arg Asn Leu Phe Asp Glu Ala His Gln Phe Gln Gln Ser Ser1 5 10 15Ser Phe Pro Pro Ile Leu Leu Phe Gly Asn Ala Gly 20 252968PRTLegionella pneumophilaMISC_FEATURE(1)..(68)conserved motif in the N-terminal domain of seq id no. 13 29Glu Asp Gly Asp Trp Pro Asp Ser Ile Asp Thr Ser Lys Gly Gln Phe1 5 10 15Ile Tyr Tyr Gly Asp Asn Lys His Pro Gly His Asp Ile His Asp Thr 20 25 30Pro Arg Gln Gly Asn Ala Thr Leu Lys Met Leu Phe Asp Ser Thr His 35 40 45Asn Glu Lys Asp Ala Arg Arg Ile Val Pro Pro Ile Phe Ile Phe Val 50 55 60Lys Tyr Pro Thr653067PRTRalstonia metalliduransMISC_FEATURE(1)..(67)conserved motif in the N-terminal domain of seq id no. 14 30Glu Asp Lys Asp Trp Pro Asp Thr Leu Asp Leu Ser Thr Gly Lys Phe1 5 10 15Val Tyr Phe Gly Asp Asn Lys Thr Pro Gly His Glu Leu His Glu Thr 20 25 30Arg Gly Gly Asn Lys Val Leu Arg Tyr Ser Phe Glu Arg Leu His Ala 35 40 45Ala Val Asn Pro Arg Ala Asp Val Ala Pro Phe Leu Val Phe Lys Lys 50 55 60Tyr Pro Leu653165PRTRuminococcus lactarisMISC_FEATURE(1)..(65)conserved motif in the N-terminal domain of seq id no. 15 31Lys His Pro Asp Trp Leu Asp Asn Ile Asp Tyr Glu Ser Gly Ile Ile1 5 10 15Gln Tyr Tyr Gly Asp Asn Arg Glu Pro Gly Arg Glu Leu His Asp Ser 20 25 30Lys Arg Gly Gly Asn Lys Val Leu Arg Asp Val Phe Glu Met Leu Gln 35 40 45Asp Asn Arg Arg Gln Glu Ile Pro Pro Phe Phe Tyr Phe Glu Ser Glu 50 55 60Glu653268PRTLactobacillus helveticusMISC_FEATURE(1)..(68)conserved motif in the N-terminal domain of seq id no. 16 32Ile Asn Tyr Asn Pro Trp Glu Asp Glu Phe Asn Glu Asp Val Gly Tyr1 5 10 15Ile Asn Tyr Tyr Gly Asp Asn Lys Arg Pro Asp Thr Asp Pro Ala Thr 20 25 30Thr Arg Gly Asn Lys Tyr Leu Leu Asp Gln Phe Lys Ile Ser His Asp 35 40 45Pro Asn Pro Glu Val Arg Ala Thr

Ala Val Pro Ile Ile Phe Phe Glu 50 55 60Thr Arg Lys Gln653368PRTLactobacillus helveticusMISC_FEATURE(1)..(68)conserved motif in the N-terminal domain of seq id no. 17 33Ile Asn Tyr Asn Pro Trp Glu Asp Glu Phe Asn Glu Asp Val Gly Tyr1 5 10 15Ile Asn Tyr Tyr Gly Asp Asn Lys Arg Pro Asp Thr Asp Pro Ala Thr 20 25 30Thr Arg Gly Asn Lys Tyr Leu Leu Asp Gln Phe Lys Ile Ser His Asp 35 40 45Pro Asn Ser Glu Val Arg Ala Thr Ala Val Pro Ile Ile Phe Phe Glu 50 55 60Thr Arg Lys Gln653468PRTShewanella pealeanaMISC_FEATURE(1)..(68)conserved motif in the N-terminal domain of seq id no. 18 34Ser Ile Glu Thr Pro Trp Glu Asp Phe Tyr Asp Val Asp Asn Gly His1 5 10 15Ile Arg Tyr Phe Gly Asp Asn Lys Glu Pro Gly Lys Asp Pro Ala Thr 20 25 30Ala Pro Gly Asn Lys Ala Leu Leu Glu Ala Phe Arg Leu Ala His Ser 35 40 45His Ser Ala Glu Glu Arg Ala Leu Thr Pro Pro Ile Leu Phe Phe Lys 50 55 60Arg Ala Val Ile653568PRTShewanella balticaMISC_FEATURE(1)..(68)conserved motif in the N-terminal domain of seq id no. 19 35Ser Ile Glu Thr Pro Trp Glu Asp Phe Tyr Asp Val Asp Asn Gly His1 5 10 15Ile Arg Tyr Phe Gly Asp Asn Lys Glu Pro Gly Lys Asp Pro Ala Thr 20 25 30Ala Pro Gly Asn Lys Ala Leu Leu Glu Ala Phe Arg Leu Ala His Ser 35 40 45His Asn Val Asp Glu Arg Leu Leu Thr Pro Pro Ile Leu Phe Phe Lys 50 55 60Arg Ala Ile Val653668PRTMoritella sp.MISC_FEATURE(1)..(68)conserved motif in the N-terminal domain of seq id no. 20 36Ser Met Glu Asn Pro Trp His Asp Thr Leu Ala Pro Asp Glu Gly Phe1 5 10 15Ala Arg Tyr Phe Gly Asp Asn Arg Thr Pro Asp Val Asp Pro Gly Thr 20 25 30Ala Ile Gly Asn Arg Thr Leu Leu Arg Gln Phe Glu Phe His Thr Ser 35 40 45Pro Asp Gln Gly Lys Arg Glu Arg Ala Ala Pro Val Leu Leu Phe Arg 50 55 60Ser Thr Lys Lys653768PRTXanthomonas campestrisMISC_FEATURE(1)..(68)conserved motif in the N-terminal domain of seq id no. 21 37Ser Met Glu Asn Pro Trp His Asp Thr Leu Ala Pro Asp Glu Gly Phe1 5 10 15Ala Arg Tyr Phe Gly Asp Asn Arg Thr Pro Asp Val Asp Pro Gly Thr 20 25 30Ala Ile Gly Asn Arg Thr Leu Leu Arg Gln Phe Glu Phe His Thr Ser 35 40 45Pro Asp Gln Gly Lys Arg Glu Arg Ala Ala Pro Val Leu Leu Phe Arg 50 55 60Ser Thr Lys Lys653869PRTMycobacterium sp.MISC_FEATURE(1)..(69)conserved motif in the N-terminal domain of seq id no. 22 38His Glu Thr Asn Pro Trp His Asp Glu Phe Asp Leu Asp His Gly His1 5 10 15Val Arg Tyr Phe Gly Asp His Lys Pro Ser Thr Val Gly Leu Pro Gly 20 25 30Glu Thr Lys Gly Asn Arg Leu Leu Leu Glu Ala Ala Arg Leu His Ala 35 40 45Gly Thr Thr Arg Glu Glu Arg Leu Leu Ala Pro Pro Leu Phe Leu Phe 50 55 60Arg Ala Val Thr Val653963PRTVeillonella parvulaMISC_FEATURE(1)..(63)conserved motif in the C-terminal domain of seq id no. 7 39Gln Tyr Tyr Lys Asp Glu Pro Tyr Lys Phe Glu Tyr Phe Ala Ala Lys1 5 10 15Leu Val Gly Leu Met Asp Asn Asn Phe Leu Asn Phe Asn Ile Thr Arg 20 25 30Thr Val Arg Asp Gly Gly Ile Asp Ala Ile Gly Glu Tyr Arg Leu Gly 35 40 45His Lys Asn Asn Ser Ile Lys Leu Arg Cys Ala Leu Glu Ala Lys 50 55 604066PRTCatenibacterium mitsuokaiMISC_FEATURE(1)..(66)conserved motif in the C-terminal domain of seq id no. 8 40Glu His Tyr Lys Asp Asn Pro Tyr Gly Phe Glu Ser Cys Ala Met Asp1 5 10 15Leu Leu Met Lys Met Asp Asn His Phe Val Asp Phe Asn Leu Thr Arg 20 25 30Pro Trp Arg Asp Gly Gly Arg Asp Ser Ile Gly Tyr Tyr Ser Ile Asn 35 40 45Ser Gly Gly Lys Val Asn Ala Pro Leu Lys Ile Asp Cys Ala Leu Glu 50 55 60Ala Met654163PRTFrankia sp.MISC_FEATURE(1)..(63)conserved motif in the C-terminal domain of seq id no. 9 41Glu His Tyr Arg Gly His Glu His Asp Phe Glu Phe Cys Ala Val Glu1 5 10 15Leu Trp Arg Leu Ile Ala Pro Ala Thr Gly Arg Cys Asp Val Thr Pro 20 25 30Pro Ser Arg Asp Gly Gly Arg Asp Ala Ile Gly Asp Tyr Ile Leu Gly 35 40 45Pro Leu Ser Asp Pro Ile Ala Ile Asp Phe Ala Leu Glu Ala Lys 50 55 604263PRTStreptomyces griseoflavusMISC_FEATURE(1)..(63)conserved motif int he C-terminal domain of seq id no. 10 42Asp Tyr Phe Arg Gly Arg Glu His Asp Phe Glu Leu Cys Ala Val Ala1 5 10 15Ile Trp Arg Leu Met Ala Pro Ser Thr Gly Ala Val Asp Val Thr Arg 20 25 30Pro Ser Arg Asp Gly Gly Arg Asp Ala Val Gly Thr Tyr Leu Leu Gly 35 40 45Pro Ala Ala Asn Arg Ile Ala Val Asp Phe Ala Leu Glu Ala Lys 50 55 604363PRTAzoarcus sp.MISC_FEATURE(1)..(63)conserved motif in the C-terminal domain of seq id no. 11 43Gln Arg Tyr Lys Glu Asn Pro Phe Gly Phe Glu Ala Cys Ala Gly Ala1 5 10 15Leu Thr Arg Leu Leu Leu Pro Asp Val Ala Arg Leu Asp Leu Thr Arg 20 25 30Pro Trp Arg Asp Gly Gly Arg Asp Gly Ile Gly Arg Leu Arg Ile Gly 35 40 45Gln Ser Pro Ala Ala Ile Glu Val Asp Phe Ala Leu Glu Ala Lys 50 55 604463PRTBurkholderia cenocepaciaMISC_FEATURE(1)..(63)conserved motif in the C-terminal domain of seq id no. 12 44Glu His Tyr Lys Glu Asp Pro Tyr Ala Phe Glu Arg Cys Ala Met Glu1 5 10 15Leu Ala Arg Leu Phe Met Pro Ala Ile Gln His Trp Glu Leu Thr Arg 20 25 30Pro Trp Arg Asp Gly Gly Arg Asp Ala Leu Gly Thr Tyr Arg Ile Gly 35 40 45His Gly Ala Gly Ala Ile Asp Val Glu Phe Ala Met Glu Ala Lys 50 55 604563PRTLegionella pneumophilaMISC_FEATURE(1)..(63)conserved motif in the C-terminal domain of seq id no. 13 45Asp Tyr Phe Cys Glu Ala Pro Ile Lys Phe Glu Ala Cys Ala Ala Lys1 5 10 15Ile Phe Gln Leu Tyr Asp Glu Asn Val Leu Ile Asp Glu Ile Thr Arg 20 25 30Ser Ala Val Asp Gly Gly Lys Asp Ala Ile Gly Arg Tyr Val Leu Gly 35 40 45Ile Lys Glu Asp Pro Val Tyr Ala Glu Phe Phe Leu Glu Ala Lys 50 55 604663PRTRalstonia metalliduransMISC_FEATURE(1)..(63)conserved motif in the C-terminal domain of seq id no. 14 46Gln His Tyr Lys Gly Ala Pro Ile Ala Phe Glu Ala Phe Ala Ala Arg1 5 10 15Val Phe Gln Met Thr Asp Glu Arg Val Val Ile Asp Glu Ile Thr Arg 20 25 30Gly Val Val Asp Gly Gly Arg Asp Ala Ile Gly Arg Tyr Arg Leu Gly 35 40 45Ser Met Ala Asp Pro Val Tyr Ala Glu Phe Ser Leu Glu Ala Lys 50 55 604762PRTRuminococcus lactarisMISC_FEATURE(1)..(62)conserved motif in the C-terminal domain of seq id no. 15 47Asp Tyr Phe Asp Asn Pro Tyr Glu Phe Glu Lys Cys Ala Met Lys Ile1 5 10 15Val Gln Leu Met Asp Ser Asn Ile His Ser Leu Lys His Thr Arg Phe 20 25 30Val Arg Asp Gly Gly Arg Asp Ala Ile Gly Leu Tyr Arg Ile Gly Arg 35 40 45Gln Cys Asp Gly Val Asp Val Glu Phe Ala Leu Glu Ala Lys 50 55 604865PRTLactobacillus helveticusMISC_FEATURE(1)..(65)conserved motif in the C-terminal domain of seq id no. 16 48Ser Lys Ala His Ser Gly Asp Phe Glu Phe Glu Gly Leu Ala Lys Glu1 5 10 15Ile Thr Arg Leu Ile Ile Gly Asp Ala Cys His Asp Gly Trp Val Thr 20 25 30Lys Ser Ser Gly Asp Gly Gly Tyr Asp Phe Val Leu Arg Val Asp Ile 35 40 45Gly Thr Lys Gly Ile Ser Gln Val Arg Gln Val Val Leu Gly Gln Ala 50 55 60Lys654965PRTLactobacillus helveticusMISC_FEATURE(1)..(65)conserved motif in the C-terminal domain of seq id no. 17 49Ser Lys Ala His Ser Gly Asp Phe Glu Phe Glu Gly Leu Ala Lys Glu1 5 10 15Ile Thr Arg Leu Ile Ile Gly Asp Ala Cys His Asp Gly Trp Val Thr 20 25 30Lys Ser Ser Gly Asp Gly Gly Tyr Asp Phe Val Leu Arg Val Asp Ile 35 40 45Gly Thr Lys Gly Ile Ser Gln Val Arg Gln Val Val Leu Gly Gln Ala 50 55 60Lys655067PRTShewanella pealeanaMISC_FEATURE(1)..(67)conserved motif in the C-terminal domain of seq id no. 18 50Ile Tyr Tyr Ala Asn Lys Lys His Arg Phe Glu Ala Leu Ala Glu Val1 5 10 15Ile Ala Ala Arg Val Ile Asp Arg Glu Phe Gly Ile Tyr His Lys Gly 20 25 30Trp Val Thr Gln Gly Ser Ser Asp Gly Gly Ala Asp Phe Val Gly Lys 35 40 45Val Thr Leu Gly Ser Gly Phe Ser Lys Val Glu Leu Ile Val Leu Gly 50 55 60Gln Ala Lys655167PRTShewanella balticaMISC_FEATURE(1)..(67)conserved motif in the C-terminal domain of seq id no. 19 51Asp Tyr Tyr Ala Asn Lys Lys His Arg Phe Glu Ala Leu Ala Glu Val1 5 10 15Ile Ala Glu Arg Val Ile Asp Arg Glu Leu Gly Ile Tyr Gln Lys Gly 20 25 30Trp Val Thr Gln Gly Ser Gly Asp Gly Gly Ala Asp Phe Ile Gly Lys 35 40 45Val Thr Leu Gly Ser Gly Phe Ser Lys Val Glu Leu Ile Val Leu Gly 50 55 60Gln Ala Lys655267PRTMoritella sp.MISC_FEATURE(1)..(67)MISC_FEATURE(1)..(67)conserved motif in the C-terminal domain of seq id no. 20 52Lys Phe Tyr Asp Gly Arg Lys His His Phe Glu Ala Leu Ala Glu Phe1 5 10 15Ile Thr Glu Arg Val Ile Gly Lys Glu Leu Gly Ile Tyr His Lys Gly 20 25 30Trp Ile Thr Gln Gly Ser Ser Asp Gly Gly Ala Asp Phe Ile Gly Lys 35 40 45Val Val Leu Gly Ser Gly Phe Ser Lys Val Glu Leu Ile Val Leu Gly 50 55 60Gln Ala Lys655367PRTXanthomonas campestrisMISC_FEATURE(1)..(67)conserved motif in the C-terminal domain of seq id no. 21 53Arg Phe Tyr Glu Pro Lys Arg His Arg Phe Glu Ala Leu Ala Ser Leu1 5 10 15Ala Cys Glu Ser Met Val Arg Gly Thr Gly Ala Glu Tyr His Arg Gly 20 25 30Trp Leu Thr Arg Gly Thr Gly Asp Gly Gly Leu Asp Phe Val Gly Arg 35 40 45Ile Asp Ile Gly Glu Gly Leu Trp Gly Thr Lys Leu Val Val Leu Gly 50 55 60Gln Ala Lys655467PRTMycobacterium sp.MISC_FEATURE(1)..(67)conserved motif in the C-terminal domain of seq id no. 22 54Lys Phe Tyr Asp Gly Arg Lys His Ala Phe Glu Leu Leu Ala Ser Arg1 5 10 15Val Ala Ala Glu Val Phe Arg Glu Ser Gly Ala Arg Tyr Lys Glu Gly 20 25 30Trp Leu Ser Arg Ser Ser Gly Asp Gly Gly Val Asp Phe Ile Gly Arg 35 40 45Ile Asp Met Gly Ser Leu Lys Ala Ser Thr Pro Val Val Val Leu Gly 50 55 60Gln Ala Lys65

Claims

1. A set of double-stranded oligonucleotide fragments obtainable by enzymatic cleavage of a large DNA, the large DNA containing one or more modified nucleotides, the set comprising fragments wherein at least 50% are of a similar size and have a centrally positioned modified nucleotide.

2. A set according to claim 1, wherein the one or more of the fragments are isolated from the set.

3. A set of oligonucleotide fragments according to claim 1, wherein the large DNA is at least 100 nucleotides in length.

4. A set of oligonucleotide fragments according to claim 1, wherein the large DNA is a mammalian genomic DNA.

5. A set of oligonucleotide fragments according to claim 1, wherein the large DNA is human genomic DNA.

6. A set of oligonucleotide fragments according to claim 1, wherein the centrally located modified nucleotide is a cytosine.

7. A set of oligonucleotide fragments according to claim 6, wherein the centrally located modified cytosine is proximate to a guanine.

8. A set of oligonucleotide fragments according to claim 7, wherein the modified cytosine is a methylated or hydroxymethylated cytosine.

9. A set of oligonucleotide fragments according to claim 1, wherein the fragments are less than 60 nucleotides in size.

10. A set of oligonucleotide fragments according to claim 9, wherein the fragments have a similar size in the range of 28-36 nucleotides.

11. A set of oligonucleotide fragments according to claim 1, wherein at least one of the modified nucleotides is located within 30 nucleotides from one end of the fragment.

12. An enzyme preparation, comprising: at least one enzyme that recognizes a modified nucleotide in a DNA and cleaves the DNA at a site that is distant from the modified nucleotide thereby generating a set of fragments as claimed in claim 1, the at least one enzyme further characterized by an N-terminal conserved domain with greater than 90% amino acid sequence homology to WXD(X).sub.10YXGD.

13. An enzyme preparation according to claim 12, wherein the at least one enzyme cleaves the DNA at a non-random distance from the modified nucleotide.

14. An enzyme preparation according to claim 12, wherein the at least one enzyme has an N-terminal conserved domain with greater than 90% sequence homology with WXD(X).sub.6G(X).sub.3YXGD(X).sub.10-15GN(X).sub.2L X.sub.10-20PX.sub.3F.

15. An enzyme preparation according to claim 12, wherein the at least one enzyme comprises a recognition domain and a cleavage domain encoded by a single open reading frame.

16. An enzyme preparation according to claim 12, wherein the at least one enzyme has a C-terminal conserved domain with greater than 90% amino acid sequence homology to FEX.sub.20-30DX.sub.2-4DX.sub.19-22(Q/E) XK.

17. An enzyme preparation according to claim 12, wherein the at least one enzyme has an amino acid sequence with greater than 90% sequence homology to a protein sequence selected from SEQ ID NOS: 7-22.

18. An enzyme preparation according to claim 12, wherein the at least one enzyme is fused to an affinity tag.

19. An enzyme preparation according to claim 17, wherein the affinity tag is selected from the group consisting of a chitin-binding domain, maltose-binding domain and a His tag.

20. An enzyme preparation according to claim 12, further comprising an activator DNA.

21. An enzyme preparation according to claim 12, wherein the N-terminal domain is capable of being recognized by an antibody.

22. An antibody as defined in claim 21.

23. An enzyme preparation, comprising: one or more enzymes that recognize a modified nucleotide in a DNA and cleave the DNA at a site that is at a non-random distance from the modified nucleotide, the one or more enzymes further characterized by an N-terminal conserved domain with greater than 90% amino acid sequence homology with WXD(X).sub.10YXGD.

24. A method for obtaining a set of oligonucleotide fragments as claimed in claim 1, comprising: a. enzymatically cleaving a large DNA containing one or more modified nucleotides; and b. obtaining the set of oligonucleotide fragments.

25. A method according to claim 24, further comprising separating the set of oligonucleotide fragments from uncleaved DNA.

26. A method according to claim 25, further comprising: sequencing from the separated set of fragments at least one fragment in the set of fragments to determine the location of one or more modified nucleotides contained within the at least one fragment.

27. A method according to claim 24, further comprising: analyzing some target oligonucleotide fragments for the presence and location of one or more modified nucleotides in the large DNA.

28. A method according to claim 24, further comprising: sequencing substantially all the fragments in the set of oligonucleotide fragments and mapping the sequences onto a genome sequence map to determine the location of modified cytosines.

29. A method for identifying one or more isolated enzymes in the enzyme preparation according to claim 12, comprising: a. searching a sequence database using a sequence selected from the group consisting of SEQ ID. NO: 7-22 and variants thereof; and b. identifying additional sequences having an N-terminal region characterized by a consensus sequence of WXD(X).sub.6G (X).sub.3YXGD(X).sub.10-15GN(X).sub.2L X.sub.10-20PX.sub.3F.

30. A method according to claim 29, wherein the identified additional sequences have a C-terminal end comprising a catalytic domain with a consensus sequence of FEX.sub.20-30DX.sub.2-4DX.sub.19-22(Q/E)XK.

31. A method for isolating from a mixture, DNA fragments containing one or more modified nucleotides, comprising: a. adding to the mixture an enzyme preparation according to claim 12, wherein the at least one enzyme has been mutated so as to lack enzyme cleavage activity, wherein the mutant enzyme is immobilized on a solid surface; and b. separating the DNA fragments bound to the immobilized enzyme from the mixture.

32. A method to determine the location of at least one modified nucleotide in a large DNA, comprising: a. cleaving a large DNA with an enzyme preparation according to claim 12; b. obtaining a set of oligonucleotide fragments, each fragment containing at least one modified nucleotide; and c. determining the location of the at least one modified nucleotide in a sequence map of the large DNA by sequencing one or more oligonucleotides in the set of oligonucleotide cleavage products.

33. A method of identifying a present or future phenotypic property in a cell preparation or tissue sample from a pattern of modified nucleotides; comprising: a. cleaving into fragments a large DNA from a cell preparation or tissue sample by means of an enzyme preparation described in claim 12; and b. comparing a location for modified nucleotides in the fragments with a pattern of modified nucleotides in a control DNA so as to determine a present or future phenotypic property.

34. A method according to claim 33, wherein (a) further comprises: separating fragments with one or more modified nucleotides from fragments lacking a modified nucleotide by: (i) contacting the cleavage fragments with a molecule that binds to the fragments containing the one or more modified nucleotides with an immobilized preparation of an affinity-binding protein; or (ii) size separation.

35. A method according to claim 34, wherein the affinity-binding protein is derived from an enzyme preparation according to claim 12, wherein the enzyme cleavage activity of the at least one enzyme has been inactivated.

36. A method according to claim 33, where (a) further comprises: identifying on a methylome or a genome a location for the one or more modified nucleotides in the immobilized cleavage fragments.

37. A method for obtaining a purified preparation of fragments containing one or more modified nucleotides, comprising: a. contacting a mixture of DNA fragments in which one or more of the fragments contain at least one modified nucleotide with an immobilized preparation of an affinity-binding molecule; b. binding the one or more fragments containing at least one modified nucleotide to the affinity-binding molecule; and c. obtaining a purified preparation of fragments containing one or more modified nucleotides.

38. A method according to claim 37, wherein the affinity-binding molecule is an enzyme preparation according to claim 12, wherein the enzyme cleavage activity has been inactivated.

39. A method according to claim 38, wherein the isolated enzymes in the enzyme preparation are associated with a binding moiety.

40. A kit, comprising: an enzyme preparation according to claim 12, in a container and instructions for use.

41. A kit according to claim 40, further comprising an activator molecule.