U.S. patent application number 12/594026 was filed with the patent office on 2010-07-01 for method of treating ischemic disorders.
Invention is credited to Marc S. Penn.
Application Number | 20100166717 12/594026 |
Document ID | / |
Family ID | 39808660 |
Filed Date | 2010-07-01 |
United States Patent
Application |
20100166717 |
Kind Code |
A1 |
Penn; Marc S. |
July 1, 2010 |
METHOD OF TREATING ISCHEMIC DISORDERS
Abstract
A method of treating an ischemic disorders in a subject includes
administering stromal cell derived factor-1 (SDF-1) to ischemic
tissue of the subject in an amount effective to inhibit apoptosis
of cells of the tissue.
Inventors: |
Penn; Marc S.; (Beachwood,
OH) |
Correspondence
Address: |
TAROLLI, SUNDHEIM, COVELL & TUMMINO L.L.P.
1300 EAST NINTH STREET, SUITE 1700
CLEVELAND
OH
44114
US
|
Family ID: |
39808660 |
Appl. No.: |
12/594026 |
Filed: |
March 27, 2008 |
PCT Filed: |
March 27, 2008 |
PCT NO: |
PCT/US08/58461 |
371 Date: |
March 1, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60921044 |
Mar 30, 2007 |
|
|
|
Current U.S.
Class: |
424/93.7 ;
514/1.1; 514/6.9 |
Current CPC
Class: |
A61P 11/00 20180101;
A61P 7/02 20180101; A61K 38/195 20130101; A61P 43/00 20180101; A61K
48/0075 20130101; A61K 35/28 20130101; A61P 13/12 20180101; A61P
9/10 20180101 |
Class at
Publication: |
424/93.7 ;
514/12 |
International
Class: |
A61K 35/12 20060101
A61K035/12; A61K 38/19 20060101 A61K038/19; A61P 9/10 20060101
A61P009/10 |
Claims
1. A method of treating an ischemic disorders in a subject, the
method comprising administering stromal cell derived factor-1
(SDF-1) to ischemic tissue of the subject in an amount effective to
inhibit apoptosis of cells of the tissue.
2. The method of claim 1, the SDF-1 being administered to cells
including SDF-1 receptors that are up-regulated as a result of the
ischemic disorder.
3. The method of claim 2, the SDF-1 receptor comprising CXCR4.
4. The method of claim 1, the SDF-1 being administered at amount
effect to increase Akt-phosphorylation of the cells.
5. The method of claim 1, the SDF-1 being administered by
expressing SDF-1 in the tissue being treated.
6. The method of claim 5, the SDF-1 being expressed from a cell
that is biocomaptible with the ischemic tissue being treated.
7. The method of claim 5, the SDF-1 being expressed from a cell of
the ischemic tissue or a cell about the periphery of the ischemic
tissue.
8. The method of claim 7, the cell expressing the SDF-1 being
genetically modified by at least one of a vector, plasmid DNA,
electroporation, and nano-particles to express SDF-1.
9. The method of claim 1, further comprising administering MCP-3 to
the ischemic tissue at amount effective to recruit stem cells an/or
progenitor cells to the ischemic tissue.
10. The method of claim 9, the stem cells comprising autologous
and/or syngeneic mesenchymal stem cells.
11-16. (canceled)
17. The method of claim 1, the ischemic disorder comprising at
least one of a peripheral vascular disorder, a pulmonary embolus, a
venous thrombosis, a myocardial infarction, a transient ischemic
attack, unstable angina, cerebral vascular ischemia, a reversible
ischemic neurological deficit, ischemic kidney disease, or a stroke
disorder.
18. A method of mitigating apoptosis in cells of a tissue following
tissue injury, comprising administering to cells of the tissue an
amount of SDF-1 effective to inhibit apoptosis in the cells.
19. The method of claim 18, the cells including SDF-1 receptors
that are up-regulated as a result of the ischemic disorder.
20. The method of claim 19, the SDF-1 receptor comprising
CXCR4.
21. The method of claim 18, the SDF-1 being administered at amount
effect to increase Akt-phosphorylation of the cells.
22. The method of claim 18, the SDF-1 being administered by
expressing SDF-1 in the tissue.
23. The method of claim 22, the SDF-1 being expressed from a cell
that is biocomaptible with the tissue.
24. The method of claim 18, the SDF-1 being expressed from a cell
of the tissue or a cell about the periphery of the tissue.
25. The method of claim 23, the cell expressing the SDF-1 being
genetically modified by at least one of a vector, plasmid DNA,
electroporation, and nano-particles to express SDF-1.
26-49. (canceled)
50. A method of mitigating apoptosis of cells or tissue
transplanted to a subject being treating, comprising administering
SDF-1 to cells or tissue to be transplanted to the subject being
treated, the cells or tissue expressing an SDF-1 receptor.
51. The method of claim 50, the SDF-1 being administered to the
cells or tissue prior to transplantation of the subject being
treated.
52. The method of claim 50, the SDF-1 being administered to the
cells or tissue during and/or after transplantation of the
cells.
53. The method of claim 50, the SDF-1 receptor comprising
CXCR4.
54. The method of claim 50, the SDF-1 being administered at amount
effect to increase Akt-phosphorylation of the apoptotic cells.
55. The method of claim 50, the cells comprising stem cells and/or
progenitor cells expressing SDF-1 receptor.
Description
RELATED APPLICATION
[0001] This application claims priority from U.S. provisional
patent application Ser. No. 60/921,044, filed on Mar. 30, 2007, the
subject matter of which is incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to compositions and methods of
treating disorders associated with ischemia and/or tissue
injury.
BACKGROUND OF THE INVENTION
[0003] Ischemia is a condition wherein the blood flow is completely
obstructed or considerably reduced in localized parts of the body,
resulting in anoxia, reduced supply of substrates and accumulation
of metabolites. Although the extent of ischemia depends on the
acuteness of vascular obstruction, its duration, tissue sensitivity
to it, and developmental extent of collateral vessels, dysfunction
usually occurs in ischemic organs or tissues, and prolonged
ischemia results in atrophy, denaturation, apoptosis, and necrosis
of affected tissues.
[0004] Ischemic cerebrovascular injury development mechanisms are
classified into three types, thrombotic, embolic, and hemodynamic.
The principal pathological condition for all three types is
nevertheless cerebral ischemia, whose severeness and duration
define the extent of cerebral tissue injuries. At the site of
severe ischemia, nerve and endothelial cells rapidly suffer from
irreversible injuries, forming typical infarction nidi due to
necrosis. Although the bloodstream moderately declines and
functions of neurocytes are suspended in the ischemic penumbra,
their survival capacity is not lost and the remaining
cerebrovascular system can recover its functions when circulation
is resumed via collateral vessels.
[0005] In ischemic cardiopathy, which are diseases that affect the
coronary artery and cause myocardial ischemia, the extent of
ischemic myocardial cell injury proceeds from reversible cell
damage to irreversible cell damage with increasing time of the
coronary artery obstruction.
SUMMARY OF THE INVENTION
[0006] The present invention relates to methods of mitigating cell
apoptosis, treating ischemic disorders, and/or treating cell
apoptosis associated with the ischemic disorders and/or tissue
injury. The ischemic disorder can include a peripheral vascular
disorder, a pulmonary embolus, a venous thrombosis, a myocardial
infarction, a transient ischemic attack, unstable angina, cerebral
vascular ischemia, a reversible ischemic neurological deficit,
ischemic kidney disease, or a stroke disorder. The ischemic
disorder can also comprise an iatrogenically induced ischemic
disorder.
[0007] The methods can include locally administering SDF-1 to
apoptotic cells that express or upregulate SDF-1 receptors. The
apoptotic cells can include cells to be transplanted to a subject
being treated and/or apoptotic cells of ischemic tissue being
treated. In an aspect of the invention, the SDF-1 receptors can be
expressed as a result of cell injury, an ischemic disorder, and/or
tissue injury. In another aspect of the invention, the SDF-1
receptor can comprise CXCR4 and/or CXCR7, and the SDF-1 can be
administered at an amount effect to mitigate and/or inhibit
apoptosis of the cells and/or to increase Akt-phosphorylation of
the cells. The SDF-1 can also be locally administered to ischemic
tissue at an amount effective to promote angiogensis in the
ischemic tissue and/or recruit stem cells expressing CXCR4 and/or
CXCR7 to the ischemic tissue.
[0008] In an aspect of the invention, the SDF-1 can be locally
administered by expressing the SDF-1 from an apoptotic cell, a
biocompatible cell delivered to the apoptotic cells or ischemic
tissue, or a cell of the ischemic or injured tissue being treated.
The SDF-1 can also be expressed from a cell about the periphery of
the ischemic tissue. The SDF-1 can be expressed by genetically
modifying one of the forgoing cells using at least one of a vector,
plasmid DNA, electroporation, and nano-particles to express SDF-1.
The SDF-1 can also be expressed from the foregoing cells by
administering an agent to the cells that promotes upregulation of
SDF-1 from the cells. The SDF-1 can also be locally administered to
apoptotic cell or ischemic tissue by providing the SDF-1 in a
pharmaceutical composition and delivering the SDF-1 to the tissue
being treated.
[0009] The present invention also relates to a method of treating
ischemic disorders in a subject by administering stromal cell
derived factor-1 (SDF-1) to ischemic tissue of the subject in an
amount effective to inhibit apoptosis of cells of the tissue in
conjunction with administering MCP-3 to the ischemic tissue at
amount effective to recruit stem cells an/or progenitor cells to
the ischemic tissue.
[0010] The SDF-1 can be administered by delivering a pharmaceutical
composition comprising SDF-1 to the tissue being treated and/or
expressing SDF-1 in the tissue being treated. The SDF-1 can be
expressed in the tissue being treated from a cell that is
biocomaptible with the ischemic tissue being treated. The SDF-1 can
also expressed from a cell of the ischemic tissue or a cell about
the periphery of the ischemic tissue. The SDF-1 can be expressed
from the cell of the tissue being treated by genetically modifying
the cell by at least one of a vector, plasmid DNA, electroporation,
and nano-particles to express SDF-1.
[0011] The MCP-3 can be administered by delivering a pharmaceutical
composition comprising MCP-3 to the tissue being treated or
expressing MCP-3 in the tissue being treated. The MCP-3 can be
expressed in the tissue being treated from a cell that is
biocomaptible with the ischemic tissue being treated.
[0012] The MCP-3 can also be expressed from a cell of the ischemic
tissue or a cell about the periphery of the ischemic tissue. The
MCP-3 can be expressed from the cell of the tissue being treated by
genetically modifying the cell by at least one of a vector, plasmid
DNA, electroporation, and nano-particles to express MCP-3.
[0013] In a further aspect of the invention, the cell expressing
the SDF-1 can also express MCP-3. The cell expressing SDF-1 and
MCP-3 can be transfected by a bicistronic expression construct
expressing SDF-1 and MCP-3.
[0014] The present invention further relates to a pharmaceutical
composition for treating ischemic disorders. The pharmaceutical
composition includes a therapeutically effective amount of SDF-1
and MCP-3. In an aspect of the invention, the pharmaceutical
composition can include at least one expression vector to express
SDF-1 and MCP-3 from a cell of the ischemic tissue. The at least
one vector can include a bicistronic vector comprising DNA for
expressing SDF-1 and DNA for expressing MCP-3. In another aspect of
the invention, the pharmaceutical composition can include at least
one cell biocompatible with the ischemic tissue that expresses
SDF-1 and/or MCP-3 in the ischemic tissue when administered to the
ischemic tissue.
[0015] A further aspect of the invention relates to a method of
treating an ischemic disorder of a mammalian subject. In the
method, SDF-1 and MCP-3 can be locally administered to the ischemic
tissue and/or areas proximate the ischemic tissue. The
concentration (or number) of stem cells in the peripheral blood of
the ischemic tissue can be increased from the first concentration
to a second concentration while SDF-1 and MCP-3 are provided in the
ischemic tissue.
[0016] In an aspect of the invention, the number of stem cells
and/or progenitor cells in the peripheral blood can be increased by
injecting stem cells and/or progenitor cells into the peripheral
blood and/or arterial or venous infusion of the stem cells into the
mammalian subject being treated. One example of a particular type
of stem cell that can be injected or infused in accordance with the
present invention is an autologous mesenchymal stem cell (MSC). An
example of a progenitor cell that can be potentially injected or
infused is a autologous, syngeneic, or allogeneic bone marrow
derived multipotent adult progenitor cell (MAPC).
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Further features of the present invention will become
apparent to those skilled in the art to which the present invention
relates from reading the following description of the invention
with reference to the accompanying drawings in which:
[0018] FIG. 1 illustrates a.) Western blot in control and SDF-1
expressing MSC and b.) immunofluorescence staining for CXCR4 in
control MSC. c.) Ten thousand control and SDF-1 expressing MSC were
separately plated per well in a 12 well plate in serum free DMEM. A
100 mL of media obtained at 1, 6 and 24 h later. SDF-1 levels in
the media were quantified using ELISA (R&D Systems). Equal cell
number was verified by quantifying total protein per cell layer at
the end of the experiment. Data is expressed as picograms of SDF-1
per ml of total media. Experiments were performed in triplicate.
Data represent mean.+-.SD. d.) Western blot analysis for Akt and
phosphorylated Akt in control and SDF-1 expressing MSC. Western
blots were performed with 50 ng of total cell protein separated on
a 10% SDS-PAGE gel.
[0019] FIG. 2 illustrates a.) Representative FACS analyses for
Annexin V positive cells in cultures of MSC or SDF-1 expressing
cells after 72 h of being cultured under hypoxic condition (0.1%
oxygen) in serum deprived culture medium (1% FBS). b.)
Representative immunofluorescent staining for BrdU (FITC, Green) in
the infarct zone 96 h after LAD ligation from rats that received 2
million control (left) or SDF-1 expressing MSC (right) 24 h after
LAD ligation. c.) Number of MSC per square millimeter within the
infarct zone at 4 d and 5 w after LAD ligation. Animals received 2
million control or SDF-1 expressing MSC 24 h after LAD ligation.
MSC per square millimeter was quantified following
immunofluorescent staining for BrdU. Two independent observers
blinded to treatment group quantified the number of BrdU positive
nuclei in the infarct zone in 10 random fields from 5 different
sections (total 50 fields) obtained from the mid left ventricle.
Data represent mean.+-.SD. * represents p<0.01 compared to Ctrl
MSC infusion.
[0020] FIG. 3 illustrates a.) Confocal image of representative
immunofluorescent staining for CXCR4 (Alexa Fluor 488, Green) and
Troponin I (Alexa Fluor 594, Red) in the infarct border zone 12-72
h after LAD ligation. b.) and c.) Confocal image of representative
immunofluorescent staining for (Left) Cardiac Myosin (Alexa Fluor
594, Red) and (Center) TUNEL (Alexa Fluor 488, Green) and (Right)
merged image from an animal 96 h after LAD ligation and 72 h after
infusion of b. control and c. SDF-1 expressing MSC. Arrows identify
the same nuclei in each picture of a given series. d.) Number of
TUNEL positive nuclei in the infarct border zone 96 h after LAD
ligation in animals that received control or SDF-1 over-expressing
MSC 24 h after AMI. Two independent observers blinded to treatment
group quantified the number of TUNEL positive nuclei in 1000 nuclei
within 4-5 cells from the infarct border zone from 5 different
sections (total 5000 nuclei total) obtained from the mid left
ventricle. Data represent the mean percent TUNEL positive
cells.+-.SD. * represents p<0.0001 compared to Ctrl MSC
infusion. e.) Percent area positive for cardiac myosin within the
infarct zone 5 w after LAD ligation in animals that received saline
or control or SDF-1 over-expressing MSC 24 h after AMI. Percent
cardiac myosin positive area was obtained by segmenting the image
based on greyscale value using NIH Image by an observer blinded to
treatment group. Five sections per animal were quantified. Data
represent mean.+-.SD. & represents p<0.01 and * represents
p<0.0001 compared to Saline infusion. f.) Representative
sections obtained 5 w after AMI stained for cardiac myosin (FITC,
green) from animals that received saline, control or SDF-1
over-expressing MSC.
[0021] FIG. 4 illustrates a.) Cardiac function and b. Left
ventricular size as quantified by the echocardiographic parameters
shortening fraction and left ventricular end diastolic dimension
(LVEDD), respectively. 2D and M-mode echocardiography was performed
at baseline, 2 and 5 weeks after LAD ligation in animals that
received saline (diamond, n=7), SDF-1 support of ischemic
myocardium Zhang et al. 23 or 1 million cardiac fibroblasts
(triangle, n=5), control MSC (open square, n=6) or SDF-1
over-expressing MSC (filled circle, n=8). For the animals that
received saline and cardiac fibroblasts data represent mean.+-.SD.
For the animals that received MSC, individual data points are
presented and the mean for that group is represented by a
horizontal line. & represents p<0.01 and * represents
p<0.0001 compared to Saline infusion.
[0022] FIG. 5 illustrates representative images from tissue 5 weeks
after AMI and infusion of 2 million of control or SDF-1 expressing
MSC 1 day after AMI. a) Immunofluorescent staining for smooth
muscle cell .alpha.-actin (Cy3, Red) and cell nuclei (DAPI, Blue)
from animals that received control (left) or SDF-1 expressing
(right) MSC. b.) Confocal image of immunofluorescent staining for
.alpha.-actin (Cy3, Red), cell nuclei (DAPI, Blue) and b. BrdU
(FITC, Green) and c.) connexin 45 (Alexa Fluor 488, Green) from an
animal that received SDF-1 expressing MSC. d.) Low power confocal
image of immunofluorescent staining as in c.
[0023] FIG. 6 illustrates representative images from tissue 5 weeks
after AMI and infusion of 2 million of control or SDF-1 expressing
GFP positive MSC 1 day after AMI. All animals received BrdU twice
daily for 14 days beginning on the day after cell transplantation
a. Confocal images of immunofluorescent staining in the infarct
border zone for cardiac myosin (Red), BrdU (Green) and cell nuclei
(DAPI, Blue) from animals that received PBS or control or SDF-1
expressing MSC. Column of images on the right are high power images
of the delineated areas in the low power overlay images.
[0024] FIG. 7 illustrates MSC transiently home to the myocardium
following acute MI. Two million BrdU labeled MSC were infused via
the tail vein 1 d or 14 d after LAD ligation. The number of BrdU
positive cells was quantified per square millimeter by
immunohistochemistry 3 d after MSC infusion. Data represent
mean.+-.SD, n=5 per group.
[0025] FIG. 8 illustrates MCP-3 is a candidate MSC homing factor.
(a) Schematic representation of strategy and findings of array
analysis identifying chemokines (Italics, Light Grey on left)
expressed in the myocardium following LAD ligation and chemokine
receptors (Underlined, Dark Grey Circle on right) expressed by MSC
and not expressed by cardiac fibroblasts. Matched chemokine and
chemokine receptors pairs of interest are delineated in the area of
overlap represented by the area in the open area (b) Representative
agarose gel of PCR products (40 cycles) for identified chemokine
receptors in MSC at passage 6 and 20, cardiac fibroblasts and
spleen (positive control). GAPDH was used as a loading control. PCR
study was repeated with at least 5 samples per cell type/passage
per receptor target.
[0026] FIG. 9 illustrates MCP-3 causes MSC chemotaxis in vitro. MSC
migrated in response to MCP-3 in a concentration dependent manner
in an in vitro chemotaxis assay. Data represent mean.+-.SD, n=10
per MCP-3 concentration.
[0027] FIG. 10 illustrates MCP-3 expression leads to MSC homing to
the myocardium in vivo. One month after LAD ligation 1 million
control (.quadrature.) or MCP-3 expressing (.box-solid.) cardiac
fibroblasts (CF) were transplanted into the infarct border zone.
Three days later the animals received either saline, one dose
(Single Infusion) or 6 doses (Multiple Infusions) 20 Schenk et al.
MCP-3 and MSC homing SC-06-0293/R1 over 12 days of 1 million BrdU
labeled MSC. Single Infusion animals were sacrificed 1 week after
MSC infusion and Multiple Infusion animals were sacrificed 1 month
after MSC infusions (10 weeks after LAD ligation). (a) The number
of engrafted MSC in each treatment group was quantified per square
millimeter by immunofluorescence using an antibody against BrdU.
Data represent mean.+-.SD. n=7-10 animals per group. (b)
Representative photomicrographs of infarct zone following staining
for BrdU (green, center images) and counterstaining for nuclei
(DAPI, blue, left most images). Merged images of BrdU and nuclei
are on the right. *p<0.05, #p<0.001 compared to infusion
matched control cardiac fibroblast group.
[0028] FIG. 11 illustrates MCP-3 expression combined with MSC
infusions results in improved cardiac function and remodeling. One
month after LAD ligation cardiac function (Shortening Fraction (%),
a, c) and left ventricular end diastolic dimension (LVEDD, b, d)
were quantified by echocardiography (.smallcircle., .quadrature.).
After echocardiography 1 million control ( ) or MCP-3 expressing
cardiac fibroblasts (.box-solid.) were transplanted into the
infarct border zone. Beginning three days after cardiac fibroblast
injections the animals received the first dose of 6 doses of 1
million BrdU labeled MSC (a, b) or saline (c, d). Successive doses
were given every other day over the ensuing 12 days.
Echocardiography was repeated 6 weeks after cardiac fibroblast
transplantation (10 weeks after LAD ligation, , .box-solid.). Data
represent individual animals. Solid lines represent the mean for
the group. n=7-10 per group. *p<0.05, #p<0.001 compared to
baseline parameter measured at 1 month post after myocardial
infarction.
[0029] FIG. 12 illustrates MCP-expression combined with MSC
infusions causes ventricular remodeling and myofibroblasts
recruitment. Representative photomicrographs of 21 Schenk et al.
MCP-3 and MSC homing SC-06-0293/R1 Masson tri-chrome stained cross
sections of the mid-ventricular segments from animals the received
(a) MCP-3 expressing or (b) control cardiac fibroblasts 4 weeks
after LAD ligation followed by serial infusions of MSC. The (c)
percent area the ventricle containing collagen fibriles or (d) the
percent of the endocardial circumference in which there was
collagen fibriles was quantified in 5 animals per group. Data
represent mean.+-.SD, n=5 per group *p<0.05. Representative
confocal micrographs of myofibroblasts in the infarct border zone
in animals that received serial infusions of MSC following
transplantation of (e) MCP-3 expressing or (f) control cardiac
fibroblasts. Tissue was stained 10 weeks after LAD ligation using
immunofluorescence with an antibody that recognizes vimentin
(green). The nuclei were counterstained with DAPI (blue) and the
cardiac myocytes were identified using an antibody that recognizes
ventricular myosin heavy chain (red).
DETAILED DESCRIPTION
[0030] Unless otherwise defined, all technical terms used herein
have the same meaning as commonly understood by one of ordinary
skill in the art to which this invention belongs. Commonly
understood definitions of molecular biology terms can be found in,
for example, Rieger et al., Glossary of Genetics: Classical and
Molecular, 5th edition, Springer-Verlag: New York, 1991; and Lewin,
Genes V, Oxford University Press: New York, 1994.
[0031] Methods involving conventional molecular biology techniques
are described herein. Such techniques are generally known in the
art and are described in detail in methodology treatises, such as
Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed.
Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989; and Current Protocols in Molecular Biology, ed.
Ausubel et al., Greene Publishing and Wiley-Interscience, New York,
1992 (with periodic updates). Methods for chemical synthesis of
nucleic acids are discussed, for example, in Beaucage and
Carruthers, Tetra. Letts. 22:1859-1862, 1981, and Matteucci et al.,
J. Am. Chem. Soc. 103:3185, 1981. Chemical synthesis of nucleic
acids can be performed, for example, on commercial automated
oligonucleotide synthesizers. Immunological methods (e.g.,
preparation of antigen-specific antibodies, immunoprecipitation,
and immunoblotting) are described, e.g., in Current Protocols in
Immunology, ed. Coligan et al., John Wiley & Sons, New York,
1991; and Methods of Immunological Analysis, ed. Masseyeff et al.,
John Wiley & Sons, New York, 1992. Conventional methods of gene
transfer and gene therapy can also be adapted for use in the
present invention. See, e.g., Gene Therapy: Principles and
Applications, ed. T. Blackenstein, Springer Verlag, 1999; Gene
Therapy Protocols (Methods in Molecular Medicine), ed. P. D.
Robbins, Humana Press, 1997; and Retro-vectors for Human Gene
Therapy, ed. C. P. Hodgson, Springer Verlag, 1996.
[0032] The present invention relates to methods of mitigating cell
apoptosis, treating ischemic disorders, and/or treating cell
apoptosis associated with the ischemic disorders and/or tissue
injury. The methods can include locally administering (or locally
delivering) to apoptotic cells (e.g., endothelial cells,
hematopoietic cells, etc.) expressing or upregulating SDF-1
receptors an amount of stromal-cell derived factor-1 (SDF-1) that
is effective to mitigate apoptosis of the apoptotic cells. By
apoptotic cells it is meant cells that are undergoing apoptosis as
a result of the injury or ischemia and/or cells that are at risk of
undergoing apoptosis as a result of the injury or ischemia. The
SDF-1 receptors can be expressed prior to and/or as a result of
cell injury, a ischemic disorder, and/or tissue injury and can
include, for example, CXCR4 and/or CXCR7.
[0033] It was found that sustained localized administration of
SDF-1 to cells expressing SDF-1 receptors or cells with SDF-1
receptors up-regulated as a result of ischemic disorders and/or
tissue injury increases Akt phosphorylation in the cells, which can
in turn mitigate apoptosis of the cells. Additionally, long-term
localized administration of SDF-1 to ischemic tissue facilitates
recruitment of stem cells and/or progenitor cells expressing CXCR4
and/or CXCR7 to the tissue being treated, which can facilitate
revascularization of the ischemic tissue.
[0034] The cell apoptosis in accordance with the present invention
can include cell apoptosis that is caused by or results from cell
injury, ischemia, or tissue injury as well as cell apoptosis that
results from medical procedures, such as cell transplantation,
tissue transplantation, and/or cell therapy. Ischemic disorders
and/or tissue injuries that result in cell apoptosis and expression
or upregulation of SDF-1 receptors and that can be treated by the
methods of the present invention can include, for example, a
peripheral vascular disorder, a pulmonary embolus, a venous
thrombosis, a myocardial infarction, a transient ischemic attack,
unstable angina, cerebral vascular ischemia, a reversible ischemic
neurological deficit, ischemic kidney disease, or a stroke
disorder.
[0035] The ischemic disorder can also include an iatrogenically
induced ischemic disorder. The iatrogenic ischemic disorder can
result from a subject undergoing, for example, angioplasty, heart
surgery, lung surgery, spinal surgery, brain surgery, vascular
surgery, abdominal surgery, kidney surgery, or organ
transplantation surgery. The organ transplantation can comprise
heart, lung, pancreas, kidney, or liver translation surgery.
[0036] It will be appreciated that the present application is not
limited to the preceding ischemic disorders and that other ischemic
disorders and tissue injuries, which result in cell apoptosis, can
be treated by the compositions and methods of the present
invention.
[0037] Mammalian subjects, which will be treated by methods and
compositions of the present invention, can include any mammal, such
as human beings, rats, mice, cats, dogs, goats, sheep, horses,
monkeys, apes, rabbits, cattle, etc. The mammalian subject can be
in any stage of development including adults, young animals, and
neonates. Mammalian subjects can also include those in a fetal
stage of development.
[0038] In one example, the SDF-1 can be administered to cells of a
mammalian tissue undergoing apoptosis as a result of an ischemic
disorder and/or tissue injury. It was found that immediately after
onset of an ischemic disorder or tissue injury, cells in the
ischemic tissue or about the periphery or the border of the
ischemic tissue can up regulate expression of SDF-1. After about 24
hours, SDF-1 expression by the cells is reduced. The SDF-1 of the
present invention can be administered to the apoptotic cells after
about onset of down-regulation of SDF-1 by the cells of the
ischemic tissue following tissue injury to about days, weeks, or
months after onset of down-regulation of SDF-1. The period of time
that the SDF-1 is administered to the cells can comprise from about
immediately after onset of the ischemic disorder or tissue injury
to about days, weeks, or months after the onset of the ischemic
disorder or tissue injury.
[0039] In another example, the SDF-1 can be administered to cells
or tissue prior to transplantation or administration of the cells
or tissue to a subject being treated. Administration of SDF-1 to
cells or tissue to be transplanted can potentially mitigate
apoptosis of the transplanted cells or tissue and promote long term
survival of the cells or tissue. In one aspect of the invention,
the SDF-1 can be administered to the cells or tissue to be
transplanted by providing the SDF-1 in a culture medium with the
cells or tissue. For example, hematopoietic stem cells, mesenchymal
stem cells, neural stem cells, other stem cells, and/or other
progenitor cells, which express SDF-1 receptors, can be cultured in
a medium with SDF-1 prior to transplantation for a therapeutic
application. The SDF-1 can promote survival of the cultured stem
cells and/or progenitor cells so that the cells have enhanced
survivability when administered or transplanted to a subject being
treated. In another aspect, the SDF-1 can be co-transplanted with
the cells or tissue to be transplanted to mitigate potential
apoptosis of the cells or tissue.
[0040] SDF-1 in accordance with the present invention can have an
amino acid sequence that is substantially similar to a native
mammalian SDF-1 amino acid sequence. The amino acid sequence of a
number of different mammalian SDF-1 protein are known including
human, mouse, and rat. The human and rat SDF-1 amino acid sequences
are about 92% identical. SDF-1 can comprise two isoform, SDF-1
alpha and SDF-1 beta, both of which are referred to herein as SDF-1
unless identified otherwise.
[0041] SDF-1 can have an amino acid sequence substantially
identical to SEQ ID NO: 1. The SDF-1 that is over-expressed can
also have an amino acid sequence substantially similar to one of
the foregoing mammalian SDF-1 proteins. For example, the SDF-1 that
is over-expressed can have an amino acid sequence substantially
similar to SEQ ID NO: 2. SEQ ID NO: 2, which substantially
comprises SEQ ID NO: 1, is the amino sequence for human SDF-1 and
is identified by GenBank Accession No. NP954637. The SDF-1 that is
over-expressed can also have an amino acid sequence that is
substantially identical to SEQ ID NO: 3. SEQ ID NO: 3, which also
substantially comprises SEQ ID NO: 2, includes the amino acid
sequences for rat SDF and is identified by GenBank Accession No.
AAF01066.
[0042] The SDF-1 in accordance with the present invention can also
be a variant of mammalian SDF-1, such as a fragment, analog and
derivative of mammalian SDF-1. Such variants include, for example,
a polypeptide encoded by a naturally occurring allelic variant of
native SDF-1 gene (i.e., a naturally occurring nucleic acid that
encodes a naturally occurring mammalian SDF-1 polypeptide), a
polypeptide encoded by an alternative splice form of a native SDF-1
gene, a polypeptide encoded by a homolog or ortholog of a native
SDF-1 gene, and a polypeptide encoded by a non-naturally occurring
variant of a native SDF-1 gene.
[0043] SDF-1 variants have a peptide sequence that differs from a
native SDF-1 polypeptide in one or more amino acids. The peptide
sequence of such variants can feature a deletion, addition, or
substitution of one or more amino acids of a SDF-1 variant Amino
acid insertions are preferably of about 1 to 4 contiguous amino
acids, and deletions are preferably of about 1 to 10 contiguous
amino acids. Variant SDF-1 polypeptides substantially maintain a
native SDF-1 functional activity. Examples of SDF-1 polypeptide
variants can be made by expressing nucleic acid molecules within
the invention that feature silent or conservative changes.
[0044] SDF-1 polypeptide fragments corresponding to one or more
particular motifs and/or domains or to arbitrary sizes, are within
the scope of the present invention. Isolated peptidyl portions of
SDF-1 can be obtained by screening peptides recombinantly produced
from the corresponding fragment of the nucleic acid encoding such
peptides. For example, a SDF-1 polypeptides of the present
invention may be arbitrarily divided into fragments of desired
length with no overlap of the fragments, or preferably divided into
overlapping fragments of a desired length. The fragments can be
produced recombinantly and tested to identify those peptidyl
fragments which can function as agonists of native CXCR-4
polypeptides.
[0045] Variants of SDF-1 polypeptides can also include recombinant
forms of the SDF-1 polypeptides. Recombinant polypeptides preferred
by the present invention, in addition to SDF-1 polypeptides, are
encoded by a nucleic acid that can have at least 70% sequence
identity with the nucleic acid sequence of a gene encoding a
mammalian SDF-1.
[0046] SDF-1 variants can include agonistic forms of the protein
that constitutively express the functional activities of native
SDF-1. Other SDF-1 variants can include those that are resistant to
proteolytic cleavage, as for example, due to mutations, which alter
protease target sequences. For example, the SDF-1 can include SDF-1
resistant to MMP-2 clevage, such as S-SDF-1 (S4V), which is
described in Circulation, 2007, 1006. Whether a change in the amino
acid sequence of a peptide results in a variant having one or more
functional activities of a native SDF-1 can be readily determined
by testing the variant for a native SDF-1 functional activity.
[0047] The SDF-1 nucleic acid that encodes the SDF-1 protein can be
a native or non-native nucleic acid and be in the form of RNA or in
the form of DNA (e.g., cDNA, genomic DNA, and synthetic DNA). The
DNA can be double-stranded or single-stranded, and if
single-stranded may be the coding (sense) strand or non-coding
(anti-sense) strand. The nucleic acid coding sequence that encodes
SDF-1 may be substantially similar to a nucleotide sequence of the
SDF-1 gene, such as nucleotide sequence shown in SEQ ID NO: 4 and
SEQ ID NO: 5. SEQ ID NO: 4 and SEQ ID NO: 5 comprise, respectively,
the nucleic acid sequences for human SDF-1 and rat SDF-1 and are
substantially similar to the nucleic sequences of GenBank Accession
No. NM199168 and GenBank Accession No. AF189724. The nucleic acid
coding sequence for SDF-1 can also be a different coding sequence
which, as a result of the redundancy or degeneracy of the genetic
code, encodes the same polypeptide as SEQ ID NO: 1, SEQ ID NO: 2,
and SEQ ID NO: 3.
[0048] Other nucleic acid molecules that encode SDF-1 within the
invention are variants of a native SDF-1, such as those that encode
fragments, analogs and derivatives of native SDF-1. Such variants
may be, for example, a naturally occurring allelic variant of a
native SDF-1 gene, a homolog or ortholog of a native SDF-1 gene, or
a non-naturally occurring variant of a native SDF-1 gene. These
variants have a nucleotide sequence that differs from a native
SDF-1 gene in one or more bases. For example, the nucleotide
sequence of such variants can feature a deletion, addition, or
substitution of one or more nucleotides of a native SDF-1 gene.
Nucleic acid insertions are preferably of about 1 to 10 contiguous
nucleotides, and deletions are preferably of about 1 to 10
contiguous nucleotides.
[0049] In other applications, variant SDF-1 displaying substantial
changes in structure can be generated by making nucleotide
substitutions that cause less than conservative changes in the
encoded polypeptide. Examples of such nucleotide substitutions are
those that cause changes in (a) the structure of the polypeptide
backbone; (b) the charge or hydrophobicity of the polypeptide; or
(c) the bulk of an amino acid side chain. Nucleotide substitutions
generally expected to produce the greatest changes in protein
properties are those that cause non-conservative changes in codons.
Examples of codon changes that are likely to cause major changes in
protein structure are those that cause substitution of (a) a
hydrophilic residue (e.g., serine or threonine), for (or by) a
hydrophobic residue (e.g., leucine, isoleucine, phenylalanine,
valine or alanine); (b) a cysteine or proline for (or by) any other
residue; (c) a residue having an electropositive side chain (e.g.,
lysine, arginine, or histidine), for (or by) an electronegative
residue (e.g., glutamine or aspartine); or (d) a residue having a
bulky side chain (e.g., phenylalanine), for (or by) one not having
a side chain, (e.g., glycine).
[0050] Naturally occurring allelic variants of a native SDF-1 gene
within the invention are nucleic acids isolated from mammalian
tissue that have at least 70% sequence identity with a native SDF-1
gene, and encode polypeptides having structural similarity to a
native SDF-1 polypeptide. Homologs of a native SDF-1 gene within
the invention are nucleic acids isolated from other species that
have at least 70% sequence identity with the native gene, and
encode polypeptides having structural similarity to a native SDF-1
polypeptide. Public and/or proprietary nucleic acid databases can
be searched to identify other nucleic acid molecules having a high
percent (e.g., 70% or more) sequence identity to a native SDF-1
gene.
[0051] Non-naturally occurring SDF-1 gene variants are nucleic
acids that do not occur in nature (e.g., are made by the hand of
man), have at least 70% sequence identity with a native SDF-1 gene,
and encode polypeptides having structural similarity to a native
SDF-1 polypeptide. Examples of non-naturally occurring SDF-1 gene
variants are those that encode a fragment of a native SDF-1
protein, those that hybridize to a native SDF-1 gene or a
complement of to a native SDF-1 gene under stringent conditions,
and those that share at least 65% sequence identity with a native
SDF-1 gene or a complement of a native SDF-1 gene.
[0052] Nucleic acids encoding fragments of a native SDF-1 gene
within the invention are those that encode, amino acid residues of
native SDF-1. Shorter oligonucleotides that encode or hybridize
with nucleic acids that encode fragments of native SDF-1 can be
used as probes, primers, or antisense molecules. Longer
polynucleotides that encode or hybridize with nucleic acids that
encode fragments of a native SDF-1 can also be used in various
aspects of the invention. Nucleic acids encoding fragments of a
native SDF-1 can be made by enzymatic digestion (e.g., using a
restriction enzyme) or chemical degradation of the full length
native SDF-1 gene or variants thereof.
[0053] Nucleic acids that hybridize under stringent conditions to
one of the foregoing nucleic acids can also be used in the
invention. For example, such nucleic acids can be those that
hybridize to one of the foregoing nucleic acids under low
stringency conditions, moderate stringency conditions, or high
stringency conditions are within the invention.
[0054] Nucleic acid molecules encoding a SDF-1 fusion protein may
also be used in the invention. Such nucleic acids can be made by
preparing a construct (e.g., an expression vector) that expresses a
SDF-1 fusion protein when introduced into a suitable target cell.
For example, such a construct can be made by ligating a first
polynucleotide encoding a SDF-1 protein fused in frame with a
second polynucleotide encoding another protein such that expression
of the construct in a suitable expression system yields a fusion
protein.
[0055] The nucleic acids encoding SDF-1 can be modified at the base
moiety, sugar moiety, or phosphate backbone, for example, to
improve stability of the molecule, hybridization, etc. The nucleic
acids within the invention may additionally include other appended
groups such as peptides (e.g., for targeting target cell receptors
in vivo), or agents facilitating transport across the cell
membrane, hybridization-triggered cleavage. To this end, the
nucleic acids may be conjugated to another molecule, (e.g., a
peptide), hybridization triggered cross-linking agent, transport
agent, hybridization-triggered cleavage agent, etc.
[0056] The SDF-1 can be administered directly to the apoptotic
cells or ischemic tissue or about the periphery of apoptotic cells
or ischemic tissue to mitigate apoptosis of the cells or tissue. In
one aspect of the invention, the SDF-1 can be locally delivered to
the apoptotic cells or ischemic tissue neat or in a pharmaceutical
composition. In another aspect of the invention, the SDF-1 can be
delivered to or about the periphery of the ischemic tissue by
administering the SDF-1 neat or in a pharmaceutical composition to
or about the ischemic tissue. The pharmaceutical composition can
provide localized release of the SDF-1 to the ischemic tissue or
cells being treated. Pharmaceutical compositions in accordance with
the invention will generally include an amount of SDF-1 or variants
thereof admixed with an acceptable pharmaceutical diluent or
excipient, such as a sterile aqueous solution, to give a range of
final concentrations, depending on the intended use. The techniques
of preparation are generally well known in the art as exemplified
by Remington's Pharmaceutical Sciences, 16th Ed. Mack Publishing
Company, 1980, incorporated herein by reference. Moreover, for
human administration, preparations should meet sterility,
pyrogenicity, general safety and purity standards as required by
FDA Office of Biological Standards.
[0057] The pharmaceutical composition can be in a unit dosage
injectable form (e.g., solution, suspension, and/or emulsion).
Examples of pharmaceutical formulations suitable for injection
include sterile aqueous solutions or dispersions and sterile
powders for reconstitution into sterile injectable solutions or
dispersions. Th carrier can be a solvent or dispersing medium
containing, for example, water, ethanol, polyol (e.g., glycerol,
propylene glycol, liquid polyethylene glycol, and the like),
suitable mixtures thereof and vegetable oils.
[0058] Proper fluidity can be maintained, for example, by the use
of a coating, such as lecithin, by the maintenance of the required
particle size in the case of dispersion and by the use of
surfactants. Nonaqueous vehicles such a cottonseed oil, sesame oil,
olive oil, soybean oil, corn oil, sunflower oil, or peanut oil and
esters, such as isopropyl myristate, may also be used as solvent
systems for compound compositions
[0059] Additionally, various additives which enhance the stability,
sterility, and isotonicity of the compositions, including
antimicrobial preservatives, antioxidants, chelating agents, and
buffers, can be added. Prevention of the action of microorganisms
can be ensured by various antibacterial and antifungal agents, for
example, parabens, chlorobutanol, phenol, sorbic acid, and the
like. In many cases, it will be desirable to include isotonic
agents, for example, sugars, sodium chloride, and the like.
Prolonged absorption of the injectable pharmaceutical form can be
brought about by the use of agents delaying absorption, for
example, aluminum monostearate and gelatin. According to the
present invention, however, any vehicle, diluent, or additive used
would have to be compatible with the compounds.
[0060] Sterile injectable solutions can be prepared by
incorporating the compounds utilized in practicing the present
invention in the required amount of the appropriate solvent with
various amounts of the other ingredients, as desired.
[0061] Pharmaceutical "slow release" capsules or "sustained
release" compositions or preparations may be used and are generally
applicable. Slow release formulations are generally designed to
give a constant drug level over an extended period and may be used
to deliver the SDF-1. The slow release formulations are typically
implanted in the vicinity of the ischemic tissue site, for example,
at the site of cell expressing CXCR4 and/or CXCR7 in or about the
ischemic tissue.
[0062] Examples of sustained-release preparations include
semipermeable matrices of solid hydrophobic polymers containing the
SDF-1, which matrices are in the form of shaped articles, e.g.,
films or microcapsule. Examples of sustained-release matrices
include polyesters; hydrogels, for example,
poly(2-hydroxyethyl-methacrylate) or poly(vinylalcohol);
polylactides, e.g., U.S. Pat. No. 3,773,919; copolymers of
L-glutamic acid and .gamma. ethyl-L-glutamate; non-degradable
ethylene-vinyl acetate; degradable lactic acid-glycolic acid
copolymers, such as the LUPRON DEPOT (injectable microspheres
composed of lactic acid-glycolic acid copolymer and leuprolide
acetate); and poly-D-(-)-3-hydroxybutyric acid.
[0063] While polymers such as ethylene-vinyl acetate and lactic
acid-glycolic acid enable release of molecules for over 100 days,
certain hydrogels release proteins for shorter time periods. When
encapsulated SDF-1 remain in the body for a long time, and may
denature or aggregate as a result of exposure to moisture at
37.degree. C., thus reducing biological activity and/or changing
immunogenicity. Rational strategies are available for stabilization
depending on the mechanism involved. For example, if the
aggregation mechanism involves intermolecular S--S bond formation
through thio-disulfide interchange, stabilization is achieved by
modifying sulfhydryl residues, lyophilizing from acidic solutions,
controlling moisture content, using appropriate additives,
developing specific polymer matrix compositions, and the like.
[0064] In certain embodiments, liposomes and/or nanoparticles may
also be employed with the SDF-1. The formation and use of liposomes
is generally known to those of skill in the art, as summarized
below.
[0065] Liposomes are formed from phospholipids that are dispersed
in an aqueous medium and spontaneously form multilamellar
concentric bilayer vesicles (also termed multilamellar vesicles
(MLVs). MLVs generally have diameters of from 25 nm to 4 .mu.m.
Sonication of MLVs results in the formation of small unilamellar
vesicles (SUVs) with diameters in the range of 200 to 500 .ANG.,
containing an aqueous solution in the core.
[0066] Phospholipids can form a variety of structures other than
liposomes when dispersed in water, depending on the molar ratio of
lipid to water. At low ratios, the liposome is the preferred
structure. The physical characteristics of liposomes depend on pH,
ionic strength and the presence of divalent cations. Liposomes can
show low permeability to ionic and polar substances, but at
elevated temperatures undergo a phase transition which markedly
alters their permeability. The phase transition involves a change
from a closely packed, ordered structure, known as the gel state,
to a loosely packed, less-ordered structure, known as the fluid
state. This occurs at a characteristic phase-transition temperature
and results in an increase in permeability to ions, sugars and
drugs.
[0067] Liposomes interact with cells via four different mechanisms:
Endocytosis by phagocytic cells of the reticuloendothelial system
such as macrophages and neutrophils; adsorption to the cell
surface, either by nonspecific weak hydrophobic or electrostatic
forces, or by specific interactions with cell-surface components;
fusion with the plasma cell membrane by insertion of the lipid
bilayer of the liposome into the plasma membrane, with simultaneous
release of liposomal contents into the cytoplasm; and by transfer
of liposomal lipids to cellular or subcellular membranes, or vice
versa, without any association of the liposome contents. Varying
the liposome formulation can alter which mechanism is operative,
although more than one may operate at the same time.
[0068] Nanocapsules can generally entrap compounds in a stable and
reproducible way. To avoid side effects due to intracellular
polymeric overloading, such ultrafine particles (sized around 0.1
.mu.m) should be designed using polymers able to be degraded in
vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet
these requirements are contemplated for use in the present
invention, and such particles may be are easily made.
[0069] In another aspect, the SDF-1 can be administered directly to
or about the periphery of the ischemic tissue by introducing an
agent into target cells that causes, increases, and/or upregulates
expression of SDF-1 in or about the periphery of the ischemic
tissue. The SDF-1 protein is expressed in or about the periphery of
the ischemic tissue can be an expression product of a genetically
modified cell. The target cells can include cells within or about
the periphery of the ischemic tissue or ex vivo cells that are
biocompatible with the ischemic tissue being treated. The
biocompatible cells can also include autologous cells that are
harvested from the subject being treated and/or biocompatible
allogeneic or syngeneic cells, such as autologous, allogeneic, or
syngeneic stem cells (e.g., mesenchymal stem cells), progenitor
cells (e.g., multipotent adult progenitor cells) and/or other cells
that are further differentiated and are biocompatible with the
ischemic tissue being treated.
[0070] The agent can comprise natural or synthetic nucleic acids,
according to present invention and described above, that are
incorporated into recombinant nucleic acid constructs, typically
DNA constructs, capable of introduction into and replication in the
cell. Such a construct preferably includes a replication system and
sequences that are capable of transcription and translation of a
polypeptide-encoding sequence in a given target cell.
[0071] Other agents can also be introduced into the cells to
promote expression of SDF-1 from the stem cells. Such agents can
include, for example, human Sonic Hedghog (Shh), human Desert
Hedgehog (Dhh), and human Indian Hedgehog (Ihh) proteins, which are
described in U.S. Patent Application Publication No. 20060105950
and 20070173471, which are herein incorporated by reference in
their entirety. Other examples, agents that increase the
transcription of a gene encoding SDF-1, increase the translation of
an mRNA encoding SDF-1, and/or those that decrease the degradation
of an mRNA encoding SDF-1 could be used to increase SDF-1 protein
levels. Increasing the rate of transcription from a gene within a
cell can be accomplished by introducing an exogenous promoter
upstream of the gene encoding SDF-1. Enhancer elements, which
facilitate expression of a heterologous gene, may also be
employed.
[0072] One method of introducing the agent into a target cell
involves using gene therapy. Gene therapy refers to gene transfer
to express a therapeutic product from a cell in vivo or in vitro.
Gene therapy in accordance with the present invention can be used
to express SDF-1 protein from a target cell in vivo or in
vitro.
[0073] In an aspect of the invention, the gene therapy can use
naked DNA or a vector including a nucleotide sequence encoding an
SDF-1 protein. A "vector" (sometimes referred to as gene delivery
or gene transfer "vehicle") refers to a macromolecule or complex of
molecules comprising a polynucleotide to be delivered to a target
cell, either in vitro or in vivo. The polynucleotide to be
delivered may comprise a coding sequence of interest in gene
therapy. Vectors include, for example, viral vectors (such as
adenoviruses (`Ad`), adeno-associated viruses (AAV), and
retroviruses), liposomes and other lipid-containing complexes, and
other macromolecular complexes capable of mediating delivery of a
polynucleotide to a target cell.
[0074] Vectors can also comprise other components or
functionalities that further modulate gene delivery and/or gene
expression, or that otherwise provide beneficial properties to the
targeted cells. Such other components include, for example,
components that influence binding or targeting to cells (including
components that mediate cell-type or tissue-specific binding);
components that influence uptake of the vector nucleic acid by the
cell; components that influence localization of the polynucleotide
within the cell after uptake (such as agents mediating nuclear
localization); and components that influence expression of the
polynucleotide. Such components also might include markers, such as
detectable and/or selectable markers that can be used to detect or
select for cells that have taken up and are expressing the nucleic
acid delivered by the vector. Such components can be provided as a
natural feature of the vector (such as the use of certain viral
vectors which have components or functionalities mediating binding
and uptake), or vectors can be modified to provide such
functionalities.
[0075] Selectable markers can be positive, negative or
bifunctional. Positive selectable markers allow selection for cells
carrying the marker, whereas negative selectable markers allow
cells carrying the marker to be selectively eliminated. A variety
of such marker genes have been described, including bifunctional
(i.e. positive/negative) markers (see, e.g., Lupton, S., WO
92/08796, published May 29, 1992; and Lupton, S., WO 94/28143,
published Dec. 8, 1994). Such marker genes can provide an added
measure of control that can be advantageous in gene therapy
contexts. A large variety of such vectors are known in the art and
are generally available.
[0076] Vectors for use in the present invention include viral
vectors, lipid based vectors and other non-viral vectors that are
capable of delivering a nucleotide according to the present
invention to the target cells. The vector can be a targeted vector,
especially a targeted vector that preferentially binds to cells of
the ischemic tissue. Viral vectors for use in the invention can
include those that exhibit low toxicity to a target cell and induce
production of therapeutically useful quantities of SDF-1 protein in
a tissue-specific manner.
[0077] Examples of viral vectors are those derived from adenovirus
(Ad) or adeno-associated virus (AAV). Both human and non-human
viral vectors can be used and the recombinant viral vector can be
replication-defective in humans. Where the vector is an adenovirus,
the vector can comprise a polynucleotide having a promoter operably
linked to a gene encoding the SDF-1 protein and is
replication-defective in humans.
[0078] Other viral vectors that can be use in accordance with the
present invention include herpes simplex virus (HSV)-based vectors.
HSV vectors deleted of one or more immediate early genes (IE) are
advantageous because they are generally non-cytotoxic, persist in a
state similar to latency in the target cell, and afford efficient
target cell transduction. Recombinant HSV vectors can incorporate
approximately 30 kb of heterologous nucleic acid. An example of a
HSV vector is one that: (1) is engineered from HSV type I, (2) has
its IE genes deleted, and (3) contains a tissue-specific promoter
operably linked to a SDF-1 nucleic acid. HSV amplicon vectors may
also be useful in various methods of the invention. Typically, HSV
amplicon vectors are approximately 15 kb in length, and possess a
viral origin of replication and packaging sequences.
[0079] Retroviruses, such as C-type retroviruses and lentiviruses,
might also be used in the invention. For example, retroviral
vectors may be based on murine leukemia virus (MLV). See, e.g., Hu
and Pathak, Pharmacol. Rev. 52:493-511, 2000 and Fong et al., Crit.
Rev. Ther. Drug Carrier Syst. 17:1-60, 2000. MLV-based vectors may
contain up to 8 kb of heterologous (therapeutic) DNA in place of
the viral genes. The heterologous DNA may include a tissue-specific
promoter and an SDF-1 nucleic acid. In methods of delivery to
ischemic tissue, it may also encode a ligand to a tissue specific
receptor.
[0080] Additional retroviral vectors that might be used are
replication-defective lentivirus-based vectors, including human
immunodeficiency (HIV)-based vectors. See, e.g., Vigna and Naldini,
J. Gene Med. 5:308-316, 2000 and Miyoshi et al., J. Virol.
72:8150-8157, 1998. Lentiviral vectors are advantageous in that
they are capable of infecting both actively dividing and
non-dividing cells. They are also highly efficient at transducing
human epithelial cells.
[0081] Lentiviral vectors for use in the invention may be derived
from human and non-human (including SIV) lentiviruses. Examples of
lentiviral vectors include nucleic acid sequences required for
vector propagation as well as a tissue-specific promoter operably
linked to a SDF-1 gene. These former may include the viral LTRs, a
primer binding site, a polypurine tract, att sites, and an
encapsidation site.
[0082] A lentiviral vector may be packaged into any suitable
lentiviral capsid. The substitution of one particle protein with
another from a different virus is referred to as "pseudotyping".
The vector capsid may contain viral envelope proteins from other
viruses, including murine leukemia virus (MLV) or vesicular
stomatitis virus (VSV). The use of the VSV G-protein yields a high
vector titer and results in greater stability of the vector virus
particles.
[0083] Alphavirus-based vectors, such as those made from semliki
forest virus (SFV) and sindbis virus (SIN), might also be used in
the invention. Use of alphaviruses is described in Lundstrom, K.,
Intervirology 43:247-257, 2000 and Perri et al., Journal of
Virology 74:9802-9807, 2000. Alphavirus vectors typically are
constructed in a format known as a replicon. A replicon may contain
(1) alphavirus genetic elements required for RNA replication, and
(2) a heterologous nucleic acid such as one encoding a SDF-1
nucleic acid. Within an alphavirus replicon, the heterologous
nucleic acid may be operably linked to a tissue-specific (e.g.,
myocardium) promoter or enhancer.
[0084] Recombinant, replication-defective alphavirus vectors are
advantageous because they are capable of high-level heterologous
(therapeutic) gene expression, and can infect a wide target cell
range. Alphavirus replicons may be targeted to specific cell types
by displaying on their virion surface a functional heterologous
ligand or binding domain that would allow selective binding to
target cells expressing a cognate binding partner. Alphavirus
replicons may establish latency, and therefore long-term
heterologous nucleic acid expression in a target cell. The
replicons may also exhibit transient heterologous nucleic acid
expression in the target cell.
[0085] In many of the viral vectors compatible with methods of the
invention, more than one promoter can be included in the vector to
allow more than one heterologous gene to be expressed by the
vector. Further, the vector can comprise a sequence which encodes a
signal peptide or other moiety which facilitates the secretion of a
SDF-1 gene product from the target cell.
[0086] To combine advantageous properties of two viral vector
systems, hybrid viral vectors may be used to deliver a SDF-1
nucleic acid to a target tissue. Standard techniques for the
construction of hybrid vectors are well-known to those skilled in
the art. Such techniques can be found, for example, in Sambrook, et
al., In Molecular Cloning: A laboratory manual. Cold Spring Harbor,
N.Y. or any number of laboratory manuals that discuss recombinant
DNA technology. Double-stranded AAV genomes in adenoviral capsids
containing a combination of AAV and adenoviral ITRs may be used to
transduce cells. In another variation, an AAV vector may be placed
into a "gutless", "helper-dependent" or "high-capacity" adenoviral
vector. Adenovirus/AAV hybrid vectors are discussed in Lieber et
al., J. Virol. 73:9314-9324, 1999. Retrovirus/adenovirus hybrid
vectors are discussed in Zheng et al., Nature Biotechnol.
18:176-186, 2000. Retroviral genomes contained within an adenovirus
may integrate within the target cell genome and effect stable SDF-1
gene expression.
[0087] Other nucleotide sequence elements which facilitate
expression of the SDF-1 gene and cloning of the vector are further
contemplated. For example, the presence of enhancers upstream of
the promoter or terminators downstream of the coding region, for
example, can facilitate expression.
[0088] In accordance with another aspect of the present invention,
a tissue-specific promoter, can be fused to a SDF-1 gene. By fusing
such tissue specific promoter within the adenoviral construct,
transgene expression is limited to a particular tissue. The
efficacy of gene expression and degree of specificity provided by
tissue specific promoters can be determined, using the recombinant
adenoviral system of the present invention.
[0089] By way of example, the use of tissue specific promoters,
such as tissue-specific transcriptional control sequences of left
ventricular myosin light chain-2 (MLC.sub.2v) or myosin heavy chain
(MHC), directed to cardiomyocytes alone (i.e., without concomitant
expression in endothelial cells, smooth muscle cells, and
fibroblasts within the heart) when delivering the SDF-1 gene in
vivo provides adequate expression of the SDF-1 protein for
therapeutic treatment. Limiting expression to the cardiomyocytes
also has advantages regarding the utility of gene transfer for the
treatment of CHF. In addition, cardiomyocytes would likely provide
the longest transgene expression since the cells do not undergo
rapid turnover; expression would not therefore be decreased by cell
division and death as would occur with endothelial cells.
Endothelial-specific promoters are already available for this
purpose (Lee, et al., J. Biol. Chem., 265:10446-10450, 1990).
[0090] In addition to viral vector-based methods, non-viral methods
may also be used to introduce a SDF-1 nucleic acid into a target
cell. A review of non-viral methods of gene delivery is provided in
Nishikawa and Huang, Human Gene Ther. 12:861-870, 2001. An example
of a non-viral gene delivery method according to the invention
employs plasmid DNA to introduce a SDF-1 nucleic acid into a cell.
Plasmid-based gene delivery methods are generally known in the
art.
[0091] Synthetic gene transfer molecules can be designed to form
multimolecular aggregates with plasmid DNA. These aggregates can be
designed to bind to a target cell. Cationic amphiphiles, including
lipopolyamines and cationic lipids, may be used to provide
receptor-independent SDF-1 nucleic acid transfer into target cells
(e.g., cardiomyocytes). In addition, preformed cationic liposomes
or cationic lipids may be mixed with plasmid DNA to generate
cell-transfecting complexes. Methods involving cationic lipid
formulations are reviewed in Feigner et al., Ann N.Y. Acad. Sci.
772:126-139, 1995 and Lasic and Templeton, Adv. Drug Delivery Rev.
20:221-266, 1996. For gene delivery, DNA may also be coupled to an
amphipathic cationic peptide (Fominaya et al., J. Gene Med.
2:455-464, 2000).
[0092] Methods that involve both viral and non-viral based
components may be used according to the invention. For example, an
Epstein Barr virus (EBV)-based plasmid for therapeutic gene
delivery is described in Cui et al., Gene Therapy 8:1508-1513,
2001. Additionally, a method involving a DNA/ligand/polycationic
adjunct coupled to an adenovirus is described in Curiel, D. T.,
Nat. Immun 13:141-164, 1994.
[0093] Additionally, the SDF-1 nucleic acid can introduced into the
target cell by transfecting the target cells using electroporation
techniques. Electroporation techniques are well known and can be
used to facilitate transfection of cells using plasmid DNA.
[0094] Vectors that encode the expression of SDF-1 can be delivered
to the target cell in the form of an injectable preparation
containing pharmaceutically acceptable carrier, such as saline, as
necessary. Other pharmaceutical carriers, formulations and dosages
can also be used in accordance with the present invention.
[0095] Where the target cell comprises an apoptotic cell, a cell of
the ischemic tissue, or about the periphery of the ischemic tissue,
the vector can be delivered by direct injection, for example, using
a tuberculin syringe under fluoroscopic guidance, at an amount
sufficient for the SDF-1 protein to be expressed to a degree which
allows for highly effective therapy. By injecting the vector
directly to, into, or about the apoptotic cell or the periphery of
the ischemic tissue, it is possible to target the vector
transfection rather effectively, and to minimize loss of the
recombinant vectors.
[0096] This type of injection enables local transfection of a
desired number of cells, especially in or about the ischemic
tissue, thereby maximizing therapeutic efficacy of gene transfer,
and minimizing the possibility of an inflammatory response to viral
proteins. Optionally, the vector can be administered to the
ischemic tissue by attaching a tissue specific cell targeting
moiety to the vector and introducing systemically (e.g.,
intravenous infusion) the tissue specific targeted vector into the
subject. Upon introduction into the subject, the tissue specific
targeted expression will localize to the targeted tissue and
facilitate localized expression of the SDF-1 from the targeted
tissue.
[0097] Where the target cell is a cultured cell that is later
transplanted into ischemic tissue, the vectors can be delivered by
direct injection into the culture medium. A SDF-1 nucleic acid
transfected into cells may be operably linked to a regulatory
sequence.
[0098] The transfected target cells can then be transplanted to a
subject or to the ischemic tissue by well known transplantation
techniques, such as by direct injection. By first transfecting the
target cells in vitro and then transplanting the transfected target
cells to the ischemic tissue, the possibility of inflammatory
response in the ischemic tissue is minimized compared to direct
injection of the vector into the ischemic tissue. Optionally, the
transfected cells can be administered to the ischemic tissue by
attaching a tissue specific cell targeting moiety to the
transfected cells and introducing the cells systemically (e.g.,
intravenous infusion) into the subject. Upon introduction into the
subject, the tissue specific targeted cells will localize to the
targeted tissue and facilitate localized expression of the SDF-1
from the targeted tissue.
[0099] SDF-1 can be expressed for any suitable length of time
within the target cell, including transient expression and stable,
long-term expression. In one aspect of the invention, the SDF-1
nucleic acid will be expressed in therapeutic amounts for a defined
length of time effective to mitigate apoptosis of the apoptotic
cells.
[0100] A therapeutic amount is an amount, which is capable of
producing a medically desirable result in a treated animal or
human. As is well known in the medical arts, dosage for any one
animal or human depends on many factors, including the subject's
size, body surface area, age, the particular composition to be
administered, sex, time and route of administration, general
health, and other drugs being administered concurrently. Specific
dosages of proteins, nucleic acids, or small molecules) can be
determined readily determined by one skilled in the art using the
experimental methods described below.
[0101] Long term SDF-1 expression is advantageous because it allows
the concentration of stem cells to be increased in the ischemic
tissue. Chronic up-regulation in SDF-1 protein expression causes
long term homing of stem cells into the ischemic tissue from the
peripheral blood without the need of stem cell mobilization.
[0102] Another aspect of the invention relates to a method of
treating ischemic disorders in a subject by administering monocyte
chemotactic protein-3 (MCP-3) to the ischemic tissue at amount
effective to recruit stem cells an/or progenitor cells to the
ischemic tissue in conjunction with the administering SDF-1 to
ischemic tissue described above to inhibit apoptosis of cells of
the tissue.
[0103] The MCP-3 in accordance with the present invention can be
administered to or about the ischemic tissue of a mammalian subject
to induce mobilization of stem cells and/or progenitor cells of the
subject to the tissue for therapeutic applications and/or cellular
therapy. The of stem cells and/or progenitor cells, which are
induced, can differentiate into specialized and/or partially
specialized cells that can repopulate (i.e., engraft),
revascularize, and partially or wholly restore the normal function
of the tissue being treated.
[0104] Stem cells in accordance with the present invention include
unspecialized autologous, syngeneic, or allogeneic cells that can
self-renew indefinitely and that can differentiate into more mature
cells with specialized functions. In humans, stem cells have been
identified in the inner cell mass of the early embryo, in some
tissues of the fetus, the umbilical cord and placenta, and in
several adult organs. In some adult organs, stem cells can give
rise to more than one specialized cell type within that organ. Stem
cells, which are able to differentiate into cell types beyond those
of which they normally reside exhibit plasticity. When a stem cell
is found to give rise to multiple tissue types associated with
different organs it is referred to as multipotent or
pluripotent.
[0105] One example of a particular type of stem cell that can be
induced by the MCP-3 in accordance with the present invention is a
mesenchymal stem cell (MSC). MSCs include the formative pluripotent
blast or embryonic cells that differentiate into the specific types
of connective tissues, (i.e., the tissue of the body that support
specialized elements, particularly including adipose, osseous,
cartilaginous, elastic, muscular, and fibrous connective tissues
depending on various in vivo or in vitro environmental influences.
These cells can be present in bone marrow, blood, dermis, and
periosteum and can be isolated and purified using various well
known methods, such as those methods disclosed in U.S. Pat. No.
5,197,985 to Caplan and Haynesworth, herein incorporated by
reference, as well as other numerous literature references.
[0106] An example of a progenitor cell that can be potentially
induced by MCP-3 in accordance with the presence is a multipotent
adult progenitor cell (MAPC) (e.g., skeletal derived MAPC). MAPCs
in accordance with the present invention comprise adult progenitor
or stem cells that are capable of differentiating into cells types
beyond those of the tissues in which they normally reside (i.e.,
exhibit plasticity). Examples of MAPCs can include adult MSCs and
hematopoietic progenitor cells. Sources of MAPCs can include bone
marrow, blood, ocular tissue, dermis, liver, and skeletal muscle.
By way of example, MAPCs comprising hematopoietic progenitor cells
can be isolated and purified using the methods disclosed in U.S.
Pat. No. 5,061,620, herein incorporated by reference, as well as
other numerous literature sources.
[0107] Stems cells, such as MSCs, MAPCs, and/or other stem cells,
can naturally express various CXC and CC chemokine receptors,
including CXCR5, CCR-1, Cmkbr1L2, CCR2, CCR3, CCR5, CCR7, CCR8,
CCR9, CMKOR1, and CX3CR1. It was found that MCP-3 can function as
chemoattractants for MSCs and/or MAPCs in a mammalian subject.
[0108] The MCP-3 in accordance with the present invention can have
amino sequence substantially similar to native mammalian MCP-3. For
example, the MCP-3 can have amino sequences substantially similar
to, respectively, SEQ ID NO: 6, which is substantially similar to
the nucleic sequences of, respectively, GenBank Accession No.
CAA50407.
[0109] The MCP-3 of the present invention can also be a variant of
native MCP-3, such as a fragment, analog and derivative of
mammalian MCP-3. Such variants can include, for example, a
polypeptide encoded by a naturally occurring allelic variant of a
native MCP-3 gene (i.e., a naturally occurring nucleic acid that
encodes a naturally occurring mammalian MCP-3), a polypeptide
encoded by an alternative splice form of a native MCP-3 gene, a
polypeptide encoded by a homolog or ortholog of a native MCP-3
gene, and a polypeptide encoded by a non-naturally occurring
variant of a native MCP-3 gene.
[0110] MCP-3 variants can have a peptide (or amino acid) sequence
that differs from native MCP-3 in one or more amino acids. The
peptide sequence of such variants can feature a deletion, addition,
or substitution of one or more amino acids of MCP-3 protein Amino
acid insertions are preferably of about 1 to 4 contiguous amino
acids, and deletions are preferably of about 1 to 10 contiguous
amino acids. Variant MCP-3 proteins substantially maintain a native
MCP-3 protein functional activity. Examples of MCP-3 protein
variants can be made by expressing nucleic acid molecules within
the invention that feature silent or conservative changes.
[0111] MCP-3 protein fragments corresponding to one or more
particular motifs and/or domains or to arbitrary sizes, are within
the scope of the present invention. Isolated peptidyl portions of
MCP-3 proteins can be obtained by screening peptides recombinantly
produced from the corresponding fragment of the nucleic acid
encoding such peptides. In addition, fragments can be chemically
synthesized using techniques known in the art such as conventional
Merrifield solid phase f-Moc or t-Boc chemistry. For example, a
MCP-3 protein of the present invention may be arbitrarily divided
into fragments of desired length with no overlap of the fragments,
or preferably divided into overlapping fragments of a desired
length. The fragments can be produced recombinantly and tested to
identify those peptidyl fragments which can function as agonists of
a native MCP-3 protein.
[0112] Variants of MCP-3 protein can also include recombinant forms
of the proteins. Recombinant polypeptides preferred by the present
invention, in addition to a MCP-3 protein, are encoded by a nucleic
acid that can have at least 85% sequence identity with the nucleic
acid sequence of a gene encoding a mammalian protein.
[0113] MCP-3 protein variants can include agonistic forms of the
protein that constitutively express the functional activities of a
native MCP-3 protein. Other protein variants can include those that
are resistant to proteolytic cleavage, as for example, due to
mutations, which alter protease target sequences. Whether a change
in the amino acid sequence of a peptide results in a variant having
one or more functional activities of a native MCP-3 protein can be
readily determined by testing the variant for a native MCP-3
protein functional activity.
[0114] Nucleic acid molecules that encode the MCP-3 protein can be
a native or non-native nucleic acid and be in the form of RNA or in
the form of DNA (e.g., cDNA, genomic DNA, and synthetic DNA). The
DNA can be double-stranded or single-stranded, and if
single-stranded may be the coding (sense) strand or non-coding
(anti-sense) strand.
[0115] For example, nucleic acid molecules that encode the MCP-3
can have sequences substantially similar to, respectively, SEQ ID
NO: 7. SEQ ID NO: 7 is substantially similar to the nucleic
sequences of GenBank Accession No. NM006273.
[0116] Other nucleic acid molecules that encode MCP-3 protein
within the invention can be variants of a native MCP-3 protein
gene, such as those that encode fragments, analogs and derivatives
of a native MCP-3 protein. Such variants may be, for example, a
naturally occurring allelic variant of a native MCP-3 gene, a
homolog of a native MCP-3 gene, or a non-naturally occurring
variant of a native MCP-3 gene. These variants have a nucleotide
sequence that differs from a native MCP-3 gene in one or more
bases. For example, the nucleotide sequence of such variants can
feature a deletion, addition, or substitution of one or more
nucleotides of a native MCP-3gene. Nucleic acid insertions are
preferably of about 1 to 10 contiguous nucleotides, and deletions
are preferably of about 1 to 10 contiguous nucleotides.
[0117] In other applications, variant native MCP-3 proteins
displaying substantial changes in structure can be generated by
making nucleotide substitutions that cause less than conservative
changes in the encoded polypeptide. Examples of such nucleotide
substitutions are those that cause changes in (a) the structure of
the polypeptide backbone; (b) the charge or hydrophobicity of the
polypeptide; or (c) the bulk of an amino acid side chain.
Nucleotide substitutions generally expected to produce the greatest
changes in protein properties are those that cause non-conservative
changes in codons. Examples of codon changes that are likely to
cause major changes in protein structure are those that cause
substitution of (a) a hydrophilic residue, e.g., serine or
threonine, for (or by) a hydrophobic residue, e.g., leucine,
isoleucine, phenylalanine, valine or alanine; (b) a cysteine or
proline for (or by) any other residue; (c) a residue having an
electropositive side chain, e.g., lysine, arginine, or histidine,
for (or by) an electronegative residue, e.g., glutamine or
aspartine; or (d) a residue having a bulky side chain, e.g.,
phenylalanine, for (or by) one not having a side chain, e.g.,
glycine.
[0118] Naturally occurring allelic variants of a native MCP-3 gene
within the invention are nucleic acids isolated from mammalian
tissue that have at least 75% sequence identity with a native MCP-3
gene, and encode polypeptides having structural similarity to a
native MCP-3, protein. Homologs or orthologs of a native MCP-3 gene
within the invention are nucleic acids isolated from other species
that have at least 75% sequence identity with the native gene, and
encode polypeptides having structural similarity to a native
MCP-3protein. Public and/or proprietary nucleic acid databases can
be searched to identify other nucleic acid molecules having a high
percent (e.g., 70% or more) sequence identity to a native
MCP-3gene.
[0119] Non-naturally occurring MCP-3 gene variants are nucleic
acids that do not occur in nature (e.g., are made by the hand of
man), have at least 75% sequence identity with a native MCP-3 gene,
and encode polypeptides having structural similarity to a native
MCP-3 protein. Examples of non-naturally occurring MCP-3 gene
variants are those that encode a fragment of a native MCP-3
protein, those that hybridize to a native MCP-3 gene or a
complement of to a native MCP-3 gene under stringent conditions,
those that share at least 65% sequence identity with a native MCP-3
gene or a complement of a native MCP-3 gene, and those that encode
a MCP-3 fusion protein.
[0120] Nucleic acids encoding fragments of a native MCP-3protein
within the invention are those that encode, amino acid residues of
a native MCP-3protein. Shorter oligonucleotides that encode or
hybridize with nucleic acids that encode fragments of a native
MCP-3 protein can be used as probes, primers, or antisense
molecules. Longer polynucleotides that encode or hybridize with
nucleic acids that encode fragments of a native MCP-3 protein can
also be used in various aspects of the invention. Nucleic acids
encoding fragments of a MCP-3 can be made by enzymatic digestion
(e.g., using a restriction enzyme) or chemical degradation of the
full length native MCP-3gene or variants thereof.
[0121] Nucleic acids that hybridize under stringent conditions to
one of the foregoing nucleic acids can also be used in the
invention. For example, such nucleic acids can be those that
hybridize to one of the foregoing nucleic acids under low
stringency conditions, moderate stringency conditions, or high
stringency conditions are within the invention.
[0122] Nucleic acid molecules encoding an MCP-3 fusion protein may
also be used in the invention. Such nucleic acids can be made by
preparing a construct (e.g., an expression vector) that expresses
an MCP-3, fusion protein when introduced into a suitable target
cell. For example, such a construct can be made by ligating a first
polynucleotide encoding a MCP-3 protein fused in frame with a
second polynucleotide encoding another protein such that expression
of the construct in a suitable expression system yields a fusion
protein.
[0123] The oligonucleotides of the invention can be DNA or RNA or
chimeric mixtures or derivatives or modified versions thereof,
single-stranded or double-stranded. Such oligonucleotides can be
modified at the base moiety, sugar moiety, or phosphate backbone,
for example, to improve stability of the molecule, hybridization,
etc. Oligonucleotides within the invention may additionally include
other appended groups such as peptides (e.g., for targeting target
cell receptors in vivo), or agents facilitating transport across
the cell membrane, hybridization-triggered cleavage. To this end,
the oligonucleotides may be conjugated to another molecule, e.g., a
peptide, hybridization triggered cross-linking agent, transport
agent, hybridization-triggered cleavage agent, etc.
[0124] The MCP-3 can be provided into or about the ischemic tissue
of the mammalian subject to be treated by administering the MCP-3
to the tissue neat or in a pharmaceutical composition. The
pharmaceutical composition can comprise the MCP-3 can be delivered
by various methods depending on the tissue, which is to be treated.
In one aspect, the pharmaceutical composition can be delivered by
injection.
[0125] When administering the MCP-3 parenterally, the MCP-3 will
generally be formulated in a unit dosage injectable form (e.g.,
solution, suspension, and/or emulsion). Examples of pharmaceutical
formulations suitable for injection include sterile aqueous
solutions or dispersions and sterile powders for reconstitution
into sterile injectable solutions or dispersions. Th carrier can be
a solvent or dispersing medium containing, for example, water,
ethanol, polyol (e.g., glycerol, propylene glycol, liquid
polyethylene glycol, and the like), suitable mixtures thereof and
vegetable oils.
[0126] Proper fluidity can be maintained, for example, by the use
of a coating, such as lecithin, by the maintenance of the required
particle size in the case of dispersion and by the use of
surfactants. Nonaqueous vehicles such a cottonseed oil, sesame oil,
olive oil, soybean oil, corn oil, sunflower oil, or peanut oil and
esters, such as isopropyl myristate, may also be used as solvent
systems for compound compositions
[0127] Additionally, various additives which enhance the stability,
sterility, and isotonicity of the compositions, including
antimicrobial preservatives, antioxidants, chelating agents, and
buffers, can be added. Prevention of the action of microorganisms
can be ensured by various antibacterial and antifungal agents, for
example, parabens, chlorobutanol, phenol, sorbic acid, and the
like. In many cases, it will be desirable to include isotonic
agents, for example, sugars, sodium chloride, and the like.
Prolonged absorption of the injectable pharmaceutical form can be
brought about by the use of agents delaying absorption, for
example, aluminum monostearate and gelatin. According to the
present invention, however, any vehicle, diluent, or additive used
would have to be compatible with the compounds.
[0128] Sterile injectable solutions can be prepared by
incorporating the MCP-3 utilized in practicing the present
invention in the required amount of the appropriate solvent with
various amounts of the other ingredients, as desired.
[0129] The MCP-3 can also be provided in pharmaceutical "slow
release" capsules or "sustained release" compositions or
preparations, as described above. The slow release formulations are
typically implanted in the vicinity of the ischemic tissue site,
for example, in or about the ischemic tissue.
[0130] Alternatively, the MCP-3 can be provided in or about the
ischemic tissue of the mammalian subject to be treated by
introducing an agent into target cells that causes, increases,
and/or upregulates expression of the MCP-3 from the target cells.
The target cells can include cells within or about the periphery of
the ischemic tissue or ex vivo cells that are biocompatible with
the ischemic tissue being treated. The biocompatible cells can
include autologous cells that are harvested from the subject being
treated and/or biocompatible allogeneic or syngeneic cells, such as
autologous, allogeneic, or syngeneic stem cells (e.g., mesenchymal
stem cells), progenitor cells (e.g., multipotent adult progenitor
cells) and/or other cells that are further differentiated and are
biocompatible with the ischemic tissue being treated. Where the
target cells are cells that are transplanted into the tissue to be
treated, the target cell can be same cell type as the cells of the
tissue being treated or a different cell type. Optionally, the
target cell can comprises the same cells that are genetically
modified to express SDF-1.
[0131] By way of example, where the tissue to be treated is
infarcted myocardium the cells that are transplanted into the
tissue to be treated can include cultured heart cells, skeletal
myoblasts, fibroblasts, smooth muscle cells, and bone marrow
derived cells. These cells can be harvested from the subject to be
treated (i.e., autologous cells) and cultured prior to
transplantation. Autologous cells are preferred to allogeneic and
syngeneic cells in order to increase the biocompatibily of the
cells upon transplantation and minimize the likelihood of
rejection.
[0132] The cultured cells can be transplanted in the ischemic
tissue by, for example, injecting a suspension of the cultured
cells using a tuberculin syringe into the ischemic tissue.
[0133] The agent that is introduced into the target cells can
comprise natural or synthetic nucleic acids (e.g., MCP-3 nucleic
acids) that are incorporated into recombinant nucleic acid
constructs, typically DNA constructs, capable of introduction into
and replication in the cell. Such a construct preferably includes a
replication system and sequences that are capable of transcription
and translation of a polypeptide-encoding sequence in a given
target cell.
[0134] Other agents can also be introduced into the target cells to
cause expression of the chemokine ligands from the target cells.
For example, agents that increase the transcription of a gene
encoding MCP-3 increase the translation of an mRNA encoding MCP-3,
and/or those that decrease the degradation of an mRNA encoding
MCP-3 could be used to increase MCP-3 levels. Increasing the rate
of transcription from a gene within a cell can be accomplished by
introducing an exogenous promoter upstream of the gene encoding
MCP. Enhancer elements which facilitate expression of a
heterologous gene may also be employed.
[0135] One method of introducing the agent into a target cell
involves using gene therapy. Gene therapy in accordance with the
present invention can be used to express the MCP-3 from a target
cell in vivo or in vitro.
[0136] One method of gene therapy uses a vector including a
nucleotide encoding a MCP-3. Vectors can include, for example,
viral vectors (such as adenoviruses (`Ad`), adeno-associated
viruses (AAV), and retroviruses), liposomes and other
lipid-containing complexes, and other macromolecular complexes
capable of mediating delivery of a polynucleotide to a target
cell.
[0137] Vectors can also comprise other components or
functionalities that further modulate gene delivery and/or gene
expression, or that otherwise provide beneficial properties to the
targeted cells, such as described above with respect to SDF-1.
[0138] Vectors that encode the expression of the MCP-3 can be
delivered to the target cell in the form of an injectable
preparation containing pharmaceutically acceptable carrier, such as
saline, as necessary. Other pharmaceutical carriers, formulations
and dosages can also be used in accordance with the present
invention.
[0139] Where the target cell comprises a cell of the tissue to be
treated, the vector can be delivered by, for example, direct
injection using a tuberculin syringe under fluoroscopic guidance,
at an amount sufficient for the MCP-3 to be expressed to a degree
which allows for highly effective therapy. By injecting the vector
directly into the tissue to be treated it is possible to target the
gene rather effectively, and to minimize loss of the recombinant
vectors.
[0140] This type of injection enables local transfection of a
desired number of cells, in the effected tissue, thereby maximizing
therapeutic efficacy of gene transfer, and minimizing the
possibility of an inflammatory response to viral proteins.
[0141] Where the target cell is a cultured cell that is later
transplanted into the ischemic tissue, the vectors can be delivered
by direct injection into the culture medium. The MCP-3 nucleic
acids transfected into cells may be operably linked to any suitable
regulatory sequence, including a tissue specific promoter and
enhancer.
[0142] The transfected target cells can then be transplanted to
ischemic tissue by well known transplantation techniques, such as
by direct injection. By first transfecting the target cells in
vitro and then transplanting the transfected target cells to the
ischemic tissue, the possibility of inflammatory response in the
ischemic tissue is minimized compared to direct injection of the
vector into the ischemic tissue.
[0143] The MCP-3 of the present invention may be expressed for any
length of time within the target cell, including transient
expression and stable, long-term expression. Long term expression
of the MCP-3 is advantageous because it allows the concentration of
stem cells to be increased at a time remote from surgery or a
procedure that transplants transfected target cells. Additionally,
long term or chronic up-regulation of MCP-3 would allow multiple
attempts at increasing the stem cell concentration in the
peripheral blood. Further, chronic up-regulation in the chemokine
ligand expression causes long term homing of stem cells into the
tissue to be treated from the peripheral blood without the need of
stem cell mobilization agent.
[0144] In an aspect of the invention, the MCP-3 can be administered
to or about the periphery of the ischemic tissue before, after, or
at the substantially the same time as the administration of the
SDF-1. In one aspect of the invention, where the SDF-1 and MCP-3
are administered to the ischemic tissue at substantially the same
time, the SDF-1 and MCP-3 can be provided in pharmaceutical
composition, which can be administered to or about the periphery of
the ischemic tissue. In another aspect, where the SDF-1 and MCP-3
are expressed from a target cell in the ischemic tissue at
substantially the same time, the target cell can be transfected
with a bicistronic expression construct that expresses the SDF-1
and MCP-3. Bicistronic expression constructs are known in the art
and can be readily employed in the present therapeutic process.
[0145] In still a further aspect of the invention, the method can
include a step of increasing the concentration (i.e., number) of
stem cells and/or progenitor cells, such as MSCs, MAPCs, and/or
other stem cells and/or progenitor cells, in the peripheral blood
from a first concentration to a second concentration substantially
greater than the first concentration. The first concentration of
stem cells and/or progenitor cells can be the concentration of stem
cells typically found in the peripheral blood at a time remote from
the onset of the ischemic disorder or tissue injury. The
concentration of stem cells and/or progenitor cells in the
peripheral blood can be increased while the concentration of SDF-1
and/or MCP-3 protein in or about the periphery of the ischemic
tissue is increased. The concentration of stem cells and/or
progenitor cells in the peripheral blood can be increased either
before or after the SDF-1 and/or MCP-3 protein administration to
the ischemic tissue.
[0146] The stem cells and/or progenitor cells can be provided in
the peripheral blood of the tissue being treated by directly
injecting the stem cells and/or progenitor cells into the tissue or
tissue proximate the tissue being treated by using, for example, a
tuberculin syringe. The stem cells and/or progenitor cells can also
be provided in the peripheral blood by venous or arterial infusion
of the stem cells into the mammalian subject to be treated. The
infused stem cells and/or progenitor cells can then be induced to
migrate to the tissue being treated by the SDF-1 and/or MCP-3
provided in or about the tissue.
[0147] The stem cells and/or progenitor cells can be injected or
infused into the mammalian subject after providing the SDF-1 and/or
MCP-3 in the tissue being treated. The stem cells and/or progenitor
cells, however, can be administered before providing the SDF-1
and/or MCP-3 in the tissue being treated.
[0148] Alternatively, the stem cells and/or progenitor cells can be
provided in the tissue to be treated by administering an agent to
induce mobilization of stem cells, such as MSCs and/or MAPCs, to
the peripheral blood of the subject. The stem cells and/or
progenitor cells can be mobilized to the peripheral blood of the
subject to increase stem cells and/or progenitor cells
concentration in peripheral subject using a number of agents. For
example, to increase the number of stem cells in the peripheral
blood of a mammalian subject, an agent that causes a pluripotent
stem cells and/or progenitor cells to mobilize from the bone marrow
can be administered to the subject. A number of such agents are
known and include cytokines, such as granulocyte-colony stimulating
factor (G-CSF), granulocyte-macrophage colony stimulating factor
(GM-CSF), interleukin (IL)-7, IL-3, IL-12, stem cell factor (SCF),
and flt-3 ligand; chemokines such as IL-8, Mip-1.alpha., and
Gro.beta., and the chemotherapeutic agents of cylcophosamide (Cy)
and paclitaxel. These agents differ in their time frame to achieve
stem cell mobilization, the type of stem cell mobilized, and
efficiency.
[0149] The mobilizing agent can be administered by direct injection
of the mobilizing agent into the subject. Preferably, the
mobilizing agent is administered after the SDF-1 and/or MCP-3 is
provided in the ischemic tissue being treated. The mobilizing
agent, however, can be administered before the SDF-1 and/or MCP-3
is administered in the tissue being treated.
EXAMPLES
[0150] The present invention is further illustrated by the
following series of examples. The examples are provided for
illustration and are not to be construed as limiting the scope or
content of the invention in any way.
Example 1
SDF-1 Expression by Mesenchymal Stem Cells Results in Trophic
Support of Cardiac Myocytes Following Myocardial Infarction
[0151] The transplantation of multiple stem cell types at the time
of myocardial infarction has been shown to improve left ventricular
perfusion and/or function in preclinical and clinical studies.
While this strategy holds great potential for the prevention and
treatment of congestive heart failure, a condition that affects
over 5 million Americans, the mechanisms behind the improvement
remain unclear. One possibility is that the transplanted stem cells
regenerate myocardial tissue by differentiating into cardiac
myocytes, endothelial cells and smooth muscle cells. Another less
explored possibility is that the introduction of stem cells into
the myocardium at the time of acute myocardial infarction (AMI)
supports the injured tissue through as yet undefined trophic
effects leading to preservation of cardiac myocytes and improved
cardiac function. If trophic effects of stem cells prove important
in the improving cardiac tissue then we have the ability to
exacerbate the effects through cell based gene therapy strategies.
We have recently demonstrated that stromal cell derived factor-1
(SDF-1 or CXCL12) is expressed by the heart immediately post-MI and
that re-establishment of SDF-1 expression at a time remote from MI
can reestablish stem cell homing to damaged cardiac tissue. CXCR4
is the cell surface receptor for SDF-1, and is expressed on early
hematopoietic stem cells (HSC) and endothelial progenitor cells.
Unfortunately, emerging data indicate that these cell types do not
differentiate into cardiac myocytes. While the expression of SDF-1
results in homing of HSC and endothelial progenitor cells to the
injured myocardium, evidence suggests that SDF-1 can have
additional non-stem cell recruiting effects including increasing
stem cell survival. Recently, SDF-1 has been shown to have growth
and survival benefits in CXCR4 expressing MSC. MSC normally express
SDF-1; therefore, in an attempt to define the trophic effects of
MSC stem cell infusion through SDF-1, we generated MSC that
over-expressed SDF-1. We then compared the effects of saline, MSC
and MSC that over-express SDF-1 on MSC survival, cardiac myocyte
survival and regeneration, and cardiac function. Our results
demonstrate a significant role for non-stem cell homing trophic
effects of SDF-1 on injured myocardium.
Materials and Methods
LAD Ligation:
[0152] All animal protocols were approved by the Animal Research
Committee and all animals were housed in the AAALAC animal facility
of the Cleveland Clinic Foundation. Ligation of the left anterior
descending artery in Lewis rat was performed as previously
described. Briefly Animals were anesthetized with intraperitoneal
ketamine and xylazine and intubated and ventilated with room air at
75 breaths per minute using a pressure-cycled rodent ventilator
(RSP1002, Kent Scientific Corp, Torrington, Conn.). Anterior wall
myocardial infarction was induced by direct ligation of the left
anterior descending (LAD) artery with the aid of a surgical
microscope (M500, LEICA Microsystems, Bannockburn, Ill.).
Cell Preparation and Delivery:
[0153] Rat bone marrow was isolated by flushing the femurs with 0.6
ml DMEM (GIBCO, Invitrogen, Carlsbad, Calif.). Clumps of bone
marrow were gently minced with a 20 gauge needle. Cells were
separated by Percoll density gradient. The cells were centrifuged
for 10 minutes at 260 g and washed with three changes of PBS with
100 U/ml penicillin 100 g/ml streptomycin (Invitrogen, Carlsbad,
Calif.). The washed cells were then re-suspended and plated in
DMEM-LG (GIBCO, Invitrogen, Carlsbad, Calif.) with 10% FBS and 1%
antibiotic and antimycotic (GIBCO, Invitrogen, Carlsbad, Calif.).
The cells were incubated at 37.degree. C. Non-adherent cells were
removed by replacing the medium after 3 days. Cultures were refed
every 3-4 days. When cultures became 70% confluence, adherent cells
were detached following incubation with 0.05% trypsin and 2 mM EDTA
(INVITROGEN, Carlsbad, Calif.) for 5 minutes and subsequently
passaged. In preceding experiments, MSC Cultures were depleted of
CD45+, CD34+ cells by negative selection using 10 .mu.l each of
primary PE-conjugated mouse anti-rat CD45 (BD Biosciences, San
Diego, Calif.) and CD34 antibodies (Santa Cruz Biotechnology, Inc.,
Santa Cruz, Calif.) per 106 cells. PE-positive cells were
negatively selected using the EasySep PE selection kit according to
the manufacturer's instruction (Stem Cell technologies) to prevent
non-specific selection of monocytes and macrophages. Confluent
cells were passaged and plated out at 1:2 to 1:3 dilutions until
passage 11. Cells were assayed for their ability to be induced into
the adipogenic, chondrogenic, and osteogenic lineages, as described
in the. Cells were maintained in differentiation media for 2 to 3
weeks. Differentiation was validated by staining the cells with Oil
Red (adipogenic lineage), alcian blue (chondrogenic lineage), or
alkaline phosphatase (osteogenic lineage). Two million labeled
cells (cardiac fibroblasts, MSC or SDF-1 expressing MSC) harvested
in 200 ml of PBS or 200 ml of PBS alone were infused via tail vein
24 hours after myocardial infarction.
BrdU Labeling:
[0154] MSC in vitro prior to cell transplantation: MSC (passage 6)
were stably transfected with rat SDF-1 expression vector or
pcDNA3.1 (control vector). Two days before infusion, the cells were
freshly plated out at 1:3 ratio and incubated in complete medium
with 10 .mu.M BrdU (5-bromo 2-deoxyuridine) to label those cells in
the S phase of the cell cycle during the 48 h period prior to
harvest for cell transplantation.
Cell In Vivo after Cell Transplantation:
[0155] In those studies in which proliferating cells in vivo were
labeled BrdU (50 mg/kg) was injected ip every 12 hours for 14 days
beginning the day after cell transplantation.
GFP Labeling of Cells:
[0156] We used a VSV-G pseudotyped lentivirus expressing EGFP or
SDF-1. The lentivirus was made using four plasmid vector system by
the Viral Core at the Cleveland Clinic Foundation. The MSC were be
transduced twice for 8 h with purified lentivirus in the presence
of 8 .mu.g/ml of polybrene at a multiplicity of infection (MOI) of
30. The media was changed 72 h post transfection and replaced with
regular media containing zeocin (EGFP) or zeocin and blasticidin
(hSDF1 and EGFP). Thus, only cells that have incorporated the viral
genome, including the zeocin and/or blasticidin resistance gene
survived.
Real-Time PCR:
[0157] RT-PCR was performed following isolation of RNA from 6
million cells by using a Rneasy Mini Kit (Qiagen Inc., Valencia,
Calif.) according to manufacturer instructions. Quantitative
real-time PCR was performed by using the ABI Prism 7700 sequence
detector (Applied Biosystems, Foster City, Calif.). The reaction
mixture contained SYBR Green PCR master mix (Applied Biosystems,
Foster City, Calif.), each primer at 300 nM, and 10 ul of cDNA.
After activation of the AmpliTaq Gold (Applied Biosystems, Foster
City, Calif.) for 10 minutes at 95.degree. C., we carried out 45
cycles with each cycle consisting of 15 seconds at 95.degree. C.
followed by 1 minute at 60.degree. C. The dissociation curve for
each amplification was analyzed to confirm that there were no
nonspecific PCR products. CXCR4 Primer Sequences: Forward:
ATCATCTCCAAGCTGTCACACTCC (SEQ ID NO: 8); Reverse:
GTGATGGAGATCCACTTGTGCAC (SEQ ID NO: 9)
Immunostaining:
[0158] Animals were sacrificed 96 h or 5 w following myocardial
infarction. Tissues were fixed in formalin and embedded in paraffin
blocks according to established protocols. Antigen retrieval was
performed using 10 mM sodium citrate buffer (pH 6.0) and heat at
95.degree. C. for 5 minutes. The buffer was replaced with fresh
buffer and re-heated for an additional 5 minutes and then cooled
for approximately 20 minutes. The slides were then washed in
de-ionized water three times for 2 minutes each. Specimens were
then incubated with 1% normal blocking serum in PBS for 60 minutes
to suppress non-specific binding of IgG. Slides were then incubated
for 60 minutes with the mouse anti-BrdU primary antibody (BD
Biosciences, San Jose, Calif.). Optimal antibody concentration was
determined by titration. Slides were then washed with phosphate
buffered saline (PBS) and then incubated for 45 minutes with
FITC-conjugated secondary antibody (Santa Cruz Biotechnology Inc.,
Santa Cruz, Calif.) diluted to 1.5 ug/ml in PBS with serum and
incubated in a dark chamber. After washing extensively with PBS,
coverslips were mounted with aqueous mounting medium (Vectashield
Mounting Medium with DAPI, H-1200; Vector Laboratories, Burlingame,
Calif.).
Confocal Immunofluorescence Microscopy:
[0159] Tissue were analyzed using a upright spectral laser scanning
confocal microscope (Model TCS-SP; Leica Microsystems, Heidelberg,
Germany) equipped with blue argon (for DAPI), green argon (for
Alexa Fluor 488) and red krypton (for Alexa Fluor 594) laser. Data
was collected by sequential excitation to minimize "bleed-through".
Image processing, analysis and the extent of colocalization was
evaluated using the Leica Confocal software. Optical sectioning was
averaged over four frames and the image size was set at
1024.times.1024 pixels. There were no digital adjustments made to
the images.
Flow Cytometric Analysis:
[0160] MSC cultures were prepared by Trypsin/EDTA digest. Wash
cells twice with cold (1.times.) D-PBS and then resuspend cells in
1.times. binding buffer (10 mM HEPES, 140 mM NaCl, 2.5 mM
CaCl.sub.2, pH 7.4) at a concentration of 1.times.106 cells/ml.
Transfer 100 .mu.L (1.times.105) cells to a 5 ml tube. Single-cell
suspensions were then incubated with either 1 .mu.L of Annexin
V-PE-Cy5 (abcam, Cambridge, Mass.) or 5 .mu.L Propidium Iodide (PI)
(BD Biosciences, San Diego, Calif.) or isotype-matched control
antibody. The cells were vortex gently and incubate at room
temperature for 15 minutes in the dark. Then 400 mL of 1.times.
binding buffer were added to each tube and the samples data were
acquired by a Guava EasyCyte flowcytometer (Guava Technologies
Hayward, Calif.) and analyzed with FlowJo (Tree Star, Inc.,
Ashland, Oreg.) flowcytometric analysis programs within one
hour.
TUNEL Assay for Assessment of Apoptotic Cell Death:
[0161] TUNEL for detection of apoptotic nuclei was performed using
terminal deoxynucleotidyl transferase (TdT)-mediated in situ
fluorescein conjugated-dUTP nick end-labeling technique according
to the manufacturer's protocol (Roche, Indianapolis, Ind.). The
sections were incubated again with mouse monoclonal antibody
(Chemicon International, Inc.) recognizing cardiac Ventricular
myosin heavy chain .alpha./.beta. to specifically recognize
apoptotic cardiomyocytes. The fluorescence staining was viewed with
a confocal laser scanning microscope. The number of apoptotic cells
was counted and expressed as percentage of total myocyte
population.
Western Protocol:
[0162] Cell extracts were prepared in 4.times. reducing Lamellae
Buffer (200 mM Tris HCl (pH 6.8), 8% SDS, 0.1% Bromophenol Blue,
40% Glycerol). Sodium dodecyl sulfate (SDS) gels were prepared
according to established protocols. Proteins were separated in a
10% SDS polyacrylamide gel. The blotting membrane was placed in 5%
milk in 1.times.TBST (Tris Base-2.42 g, NaCl-8g, 1M HCl-3.8 mL with
pH to 7.5, Water-1L, Tween 20-2 mL) for one hour and then probed
with primary antibody (1:1000 in 5% Milk in 1.times.TBST) against
phosphorylated Akt (Santa Cruz Biotechnology Inc., Santa Cruz,
Calif.) followed by incubation with the peroxidase-conjugated
anti-mouse secondary antibody (1:5000 in 1.times.TBST).
Chemiluminescence (Amersham Biosciences UK Limited,
Buckinghamshire, England) was used for visualization.
Antibodies Implemented in these Studies: Primary Antibodies:
[0163] Mouse anti-Myosin-Ventricular Heavy Chain alpha/beta
Monoclonal antibody (Chemicon International, Inc.); Mouse
monoclonal anti-alpha-sarcomeric actin IgM (Sigma); Mouse
anti-troponin I monoclonal IgG2b antibody (Chemicon International,
Inc.); Rabbit anti-GATA 4 polyclonal IgG antibody (Santa Cruz
Biotechnology, Inc.); Goat polyclonal anti-Nkx-2.5 IgG antibody
(Santa Cruz Biotechnology, Inc.); Rabbit polyclonal anti-MEF-2 IgG
antibody (Santa Cruz Biotechnology, Inc.); mouse Monoclonal
anti-alpha-smooth muscle actin-Cy3 conjugated antibody (Sigma);
Rabbit polyclonal anti-human von willebrand factor; Rabbit
anticonnexin-43 polyclonal IgG antibody (Santa Cruz Biotechnology,
Inc.); Rabbit anticonnexin 45 polyclonal IgG antibody (Santa Cruz
Biotechnology, Inc.); Goat Polyclonal anti-connexin-40 IgG Antibody
(Santa Cruz Biotechnology, Inc.); Mouse IgG1 monoclonal anti-Akt1
antibody (Cell Signaling Technology); Mouse monoclonal
anti-Phospho-Akt (ser473) IgG2b antibody (Cell Signaling
Technology); Rabbit polyclonal anti-CXCR4 IgG (abcam); Rat
monoclonal anti-BrdU-FITC conjugated (abcam).
Secondary Antibodies:
[0164] Goat anti-mouse IgG Alexa Fluor 488 (Molecular Probes); Goat
anti-mouse IgG Alexa Fluor 594 (Molecular Probes); Donkey
anti-rabbit IgG Alexa Fluor 488 (Molecular Probes); Donkey
anti-rabbit IgG Alexa Fluor 594(Molecular Probes); Goat polyclonal
IgG anti-Fluorescein antibody (Molecular Probes); Donkey anti-goat
IgG Alexa Fluor 488 antibody (Molecular Probes); Donkey anti-goat
IgG antibody Alexa Fluor 594 (Molecular Probes); Goat anti-mouse
IgM Alexa Fluor 488 (Molecular Probes).
Echocardiography:
[0165] 2D-echocardiography was performed at 2 and 5 weeks following
LAD ligation and MSC transplantation using a 15 MHz linear array
transducer interfaced with a Sequoia C256 and GE Vision 7 as
previously described (9;11). LV dimensions and wall thickness were
quantified by digitally recorded 2D clips and M-mode images in a
short axis view from the mid-LV just below the papillary muscles to
allow for consistent measurements from the same anatomical location
in different rats. The ultrasonographer was blinded to treatment
group. Measurements were made by two independent blinded observers
off-line using ProSolv echocardiography software. Measurements in
each animal were made 6 times from 3 out of 5 randomly chosen
M-mode clips recorded by an observer blinded to the treatment arm.
Shortening fraction was calculated from the Mmode recordings.
Shortening fraction (%)=(LVEDD-LVESD)/LVEDD.times.100, where
LVEDD=left ventricular end diastolic dimension and LVESD=left
ventricular end systolic dimension.
Statistical Analyses:
[0166] Data are presented as mean.+-.s.d. Comparisons between
groups were by unpaired Student t-test (vascular density), or by
ANOVA with Bonferroni correction (echocardiographic data and cell
engraftment data) for multiple comparisons where appropriate.
Results
Characterization of Engineered MSC
[0167] We generated MSC that were stably transfected with an SDF-1
expression vector driven by the CMV promoter (11). The MSC used in
our studies expressed CXCR4 by RTPCR, Western blot (FIG. 1a) and
immunohistochemistry (FIG. 1b). The population of stably
transfected MSC used in our studies expressed 5.29.+-.1.25 fold
greater SDF-1 mRNA than MSC transfected with the control construct.
Transfection with SDF-1 expression vector did not change CXCR4
expression (0.81.+-.0.24, relative CXCR4 mRNA expression in SDF-1
and control MSC). Over a 24 h period in culture SDF-1
overexpressing MSC secreted significantly greater amounts of SDF-1
into the media than MSC transfected with control vector (FIG. 1c).
No significant release of SDF-1 was observed in parallel cultures
of cardiac fibroblasts. Consistent with SDF-1 inducing
up-regulation of pro-survival signaling, as seen in progenitor
cells, the MSC that over-expressed SDF-1 had greater phosphorylated
Akt than control cells (FIG. 1d).
Effects of SDF-1 on MSC Survival During Hypoxia
[0168] To determine if the increase in Akt phosphorylation improved
MSC survival, we cultured control and SDF-1:MSC under hypoxic
conditions (1% oxygen) and quantified evidence of cell injury using
FACS. The data in FIG. 2a demonstrate that >25% of MSC grown
under hypoxic conditions express Annexin V compared to <10% of
MSC that over-express SDF-1. Similar results were observed when the
percentage of propidium iodide positive cells, a marker of cell
death, was quantified (data not shown). We assessed whether similar
results would be observed in vivo following myocardial infarction.
Acute anterior wall myocardial infarction was induced by direct LAD
ligation, twenty-four hours later, 2 million syngeneic cardiac
fibroblasts stably transfected with empty plasmid, or 2 million
syngeneic MSC stably transfected with empty plasmid or plasmid
encoding SDF-1 were infused by tail vein injection. BrdU was added
to the culture medium of the cells for 2 days prior to harvesting
in order to label the cellular DNA. Control rats received an
intravenous infusion of saline. Seventy-two hours and 5 weeks
following treatment with cardiac fibroblasts (CF), control or SDF-1
expressing MSC or saline infusion, the animals were sacrificed and
the hearts were harvested. The presence of infused CF and MSC in
the heart was quantified as the number of BrdU positive cells per
area. We found that the number of MSC in the heart was
significantly increased by the over-expression of SDF-1 (FIG. 2b)
at both time points, although the increase was significantly less
at 5 weeks compared to 72 h after treatment (FIG. 2c). We did not
observe evidence of significant homing or engraftment of infused
cardiac fibroblasts (4 days: 3.6.+-.2.7 cells/mm.sup.2 and 5 weeks:
2.9.+-.2.1 cells/mm.sup.2)
Effect of SDF-1 Over-Expression on Ischemic Myocardium
[0169] FIG. 3a (24 h) shows that there is an increase in CXCR4
expression in the infarct zone as early as 24 h after AMI. These
cells are not cardiac myocytes; rather, these CXCR4 positive cells
are leukocytes and endothelial cells. FIG. 3a (24-48 h)
demonstrates that cardiac myocytes in the infarct border zone begin
to express CXCR4 as early as 48 h after AMI, and that the level of
cardiac myocyte CXCR4 expression at the infarct border zone
increases through 96 h after AMI. The over-expression of SDF-1
within the infarct zone via the infusion of SDF-1 expressing MSC
led to an increase in the level of Akt-phosphorylation in the
cardiac myocytes at the infarct border (data not shown). This
increase in Akt-Phosphorylation was accompanied by a significant
decrease in the number of TUNEL positive cardiac myocyte nuclei
(FIG. 3b, c and d). The decrease in cardiac myocytes apoptosis in
animals that received SDF-1 expressing MSC was accompanied by a
significant increase in the area of surviving bundles of cardiac
myocytes within the infarct zone compared to saline controls (FIGS.
3e and f). The cardiac myocytes within the infarct zone at this
time point were not BrdU positive; therefore, they were not
regenerated from the engrafted MSC. Rather, they appear to be
native cardiac myocytes that survived the ischemic insult.
Effects of SDF-1 Over-Expression on Cardiac Remodeling and
Function
[0170] We quantified left ventricular function and dimensions 14
and 35 d following LAD ligation in animals infused with saline,
cardiac fibroblasts or control or SDF-1 over-expressing MSC 1 d
following LAD ligation. We found a statistically significant
attenuation of LV dilation and improvement in shortening fraction
with MSC infusion compared to saline controls. (FIGS. 4a and b,
respectively). In those animals treated with control and SDF-1
expressing MSC, shortening fraction was significantly increase by
71% and 238%, respectively, compared to saline controls. No
significant difference was observed between saline infusion and
cardiac fibroblast infusion.
[0171] Immunofluorescence using antibody for vWF was used to
identify and quantify the vascular density within the infarct zone
following each treatment. We observed a significant increase in the
number of capillaries and small arterioles in those animals that
received SDF-1 over-expressing MSC (18.2.+-.4.0 vs. 7.6.+-.2.3
vessels/mm.sup.2, p<0.01). This observation is consistent with
previous studies that have demonstrated that local SDF-1 expression
leads to homing of endothelial progenitor cells (11;14).
Cardiac Myocytes Regeneration Verses Preservation
[0172] The data in FIG. 3 demonstrates that MSC and to a greater
extent SDF-1 expressing MSC increase the area and number of cardiac
myocytes within the infarct zone. While the data in FIGS. 1-3
support the concept that this increase is due to cardiac
preservation, we wanted to determine the extent to which either the
injected MSC or the endogenous cardiac stem cells participated in
cardiac myocyte regeneration. To determine the fate of the
engrafted MSC, we stained sections of myocardial tissue for markers
of cardiac myocytes (Cardiac Myosin, Troponin I, GATA4 and Connexin
43), smooth muscle cells (SMC .alpha.-actin and Connexin 45) and
endothelial cells (vWF and Connexin 40). We observed that the BrdU
or GFP labeled cells engrafted into the myocardium were
.alpha.-actin positive (FIG. 5a). BrdU or GFP positive cells were
never vWF and rarely (<2%) cardiac myosin positive suggesting
that with or without SDF-1 transfection, MSC appear to either not
differentiate (MSC are SMC .alpha.-actin in culture, data not
shown) or differentiate into smooth muscle cells.
[0173] We also observed a significant increase in .alpha.-actin
cells within the infarct zone of those animals that received SDF-1
expressing MSC that were not BrdU or GFP positive (FIG. 5b). We
stained these sections for Connexin 40, 43 and 45 to determine if
these cells could be electrically coupled, and thus, contribute to
the improved cardiac function we observed in animals that received
SDF-1 expressing MSC. We found that the .alpha.-actin cells were
connexin 45 positive (FIG. 5c) and Connexin 40 and 43 negative. Of
note, MSC in culture were SMC .alpha.-actin and connexin 45
positive in culture; therefore, it is unclear if the MSC in our
studies differentiated at all. These .alpha.-actin and connexin 45
positive cells formed a band along the middle of the infarct zone
in those animals that received SDF-1 expressing MSC, but not MSC
alone (FIG. 5d).
[0174] To determine if cardiac stem cells led to the regeneration
of cardiac myocytes we repeated our studies using GFP-labeled MSC
and GFP-labeled SDF-1 over-expressing MSC, but in these studies we
administered BrdU to the animals twice-daily beginning on the day
after cell transplantation. We hypothesized that if cardiac stem
cells differentiate into cardiac myocytes following LAD ligation
and MSC infusion, they would proliferate prior to migration and/or
differentiation. Therefore, if there were no BrdU positive cardiac
myocytes we could rule out a role for cardiac stem cells in cardiac
myocyte regeneration.
[0175] The data in FIG. 6 show representative images from saline,
MSC and SDF-1:MSC treated animals double stained for BrdU and
cardiac myosin. There is a greater number of BrdU positive cells in
the SDF-1:MSC treated animals compared to MSC and saline treated
animals. Interestingly, many of these BrdU positive cells in the
SDF-1:MSC treated animals are cardiac myosin positive suggesting
that they could be of cardiac stem cell origin; however, these BrdU
and cardiac myosin positive cells are not mature cardiac myocytes.
These data are consistent with the hypothesis that cardiac stem
cells are mobilized by MSC alone and to a greater extent SDF-1
over-expressing MSC, they do not form mature cardiac myocytes, at
least by 5 weeks after LAD ligation.
[0176] To determine if the engrafted MSC proliferated within the
myocardial tissue, we double stained BrdU and GFP tissue sections
from saline, MSC and SDF-1 expressing over-expressing MSC treated
animals. We observed significant MSC proliferation with control and
SDF-1 over-expressing MSC; however, the majority of BrdU positive
cells within the tissue sections were not derived from the infused
MSC (data not shown).
Discussion
[0177] The goal of stem cell based therapies following AMI is to
(i) minimize myocardial cell death, (ii) optimize LV remodeling and
(iii) regenerate myocardial structures, including blood vessels and
cardiac myocytes. Recent studies have suggested that stem cell
engraftment into recently infarcted myocardium can lead to improved
cardiac function. Whether this is guided by a cache of resident
cardiac stem cells that replace damaged myocardium, bone
marrow-derived stem cells that home to damaged myocardium, or
exogenous cells infused intravenously following MI is not fully
understood. Furthermore, the ability of hematopoietic stem cells to
transdifferentiate into cardiac myocytes remains a matter of
ongoing debate, however, appears unlikely given recent results.
Despite this uncertainty, it is clear that the introduction of a
variety of stem cell types from varied sources can lead to improved
cardiac function. These findings ultimately suggest that a
naturally occurring albeit clinically inefficient cardiac
reparative system seems to exist at some basal level that is
potentially exploitable.
Effects of SDF-1 in Post-MI Myocardial Tissue
[0178] The goal of our study was to determine the potential role
SDF-1 has in the reparative process, and to determine if
over-expressing SDF-1 in the peri-infarct period would lead to
improvements in left ventricular function.
[0179] We chose to use MSC to deliver SDF-1 to the infarct zone
because they are easy to expand in culture, may be able to
differentiate into cardiac myocytes, and home to the newly
infracted myocardium. We chose to use a cell therapy based approach
for the delivery of SDF-1 in order to induce a sustained release of
SDF-1, similar to that which may be achieved through the
transplantation of stem cells in to the myocardium. Multiple recent
studies suggest that some populations of MSC do express CXCR4;
however, the extent to which CXCR4 expressing MSC home SDF-1 in
vivo remains unclear Inhibition of SDF-1:CXCR4 binding has only
been shown to partially block recruitment of these MSC to the bone
marrow. Also, MSC make SDF-1 (FIG. 1a) and there is little
precedent for a cell that expresses both receptor and ligand to
home to that ligand. Finally, the MSC delivery strategy employed in
these studies is a non-invasive way to deliver genes to the
recently injured heart. CXCR4 expressing MSC do respond to SDF-1.
Consistent with our data, it has recently been shown that SDF-1
leads to increased survival and growth of CXCR4 expressing MSC.
[0180] The engraftment of SDF-1 expressing MSC had multiple
positive effects. Cardiac myocytes and muscle progenitor cells have
previously been shown to express CXCR4. First, we found that
cardiac myocytes naturally begin to express CXCR4 between 24 and 48
h after AMI (FIG. 3a). This observation suggests that delivering
SDF-1 to the cell surface of injured cardiac myocytes could lead to
inhibition of myocyte apoptosis as it did to MSC cultured under
ischemic conditions (FIG. 2a). We observed an .about.80% decrease
in cardiac myocytes apoptosis at the infarct border zone in those
animals that received SDF-1 over-expressing MSC. This led to a
significant increase in the survival of cardiac myocytes bundles
within the infarct zone of those animals that received SDF-1
expressing MSC.
[0181] Second, the over-expression of SDF-1 in the infarct zone
resulted in neovascularization. This is likely due to the increased
recruitment of endothelial progenitor cells, as we have previously
shown in a model of ischemic cardiomyopathy. There was no gross
pathological evidence of hemangioma formation from the sustained
expression of SDF-1 over 5 weeks.
[0182] Third, the over-expression of SDF-1 in the infarct zone
unexpectedly led to a marked increase in the number of smooth
muscle .alpha.-actin and connexin 45 expressing cells that appear
to form a band along the middle of the infarct zone. While some of
these cells are from the MSC that were infused 1 day post MI, the
majority are not. Furthermore, most of these smooth muscle cells
were not associated with blood vessels, as demonstrated by a void
of vWF or connexin expression in the area of the SMC. While it is
not clear that these cells contract in unison, it is intriguing to
note that these SMC express connexin 45 and may contract in
response to mechanical stretch during the cardiac cycle.
[0183] Fourth, SDF-1 in the myocardium led to recruitment and
proliferation of a cardiac myosin positive cell population
consistent with cardiac stem cells. While these cells did not
appear to differentiate into mature cardiac myocytes within the
time frame of our studies, the presence of these cells may suggest
a potential for long-term benefit.
Route of Delivery
[0184] The route of cell delivery in our study was tail vein
infusion. Other studies have sought to define the ideal route of
cell delivery, including mobilization from bone marrow,
catheter-based intra-coronary infusion, and intra-myocardial
injection. Catheter based intra-coronary delivery of MSC in the
left circumflex artery of dogs led to microinfarction, which may
not be well tolerated in patients with little cardiac reserve. Our
results highlight the fact that a simple intravenous infusion may
be highly effective; while at the same time minimize mechanical
risk to the freshly injured myocardium.
MSC Differentiation
[0185] Reports in the literature suggest that MSC delivered during
the peri-infarct period can differentiate into cardiac myosin
expressing cells. Despite being able to significantly increase MSC
survival in post-MI myocardium, MSC whether labeled with BrdU or
GFP did not demonstrate significant regeneration of cells with a
cardiac myocyte phenotype. Thus, while it is possible that a small
population of the engrafted MSC may have differentiated to a
cardiac myocyte phenotype, our data are consistent with the
hypothesis that the overall benefit of MSC therapy is not due to
regeneration, but rather preservation of cardiac tissue and that at
least one factor mediating this effect is SDF-1.
CONCLUSIONS
[0186] Our data are consistent with the concept that there is a
naturally occurring regenerative repair process that occurs in
infarcted myocardium that can be enhanced through the
over-expression of SDF-1 within the myocardium following myocardial
infarction. Interestingly, we observed multiple beneficial effects
on the myocardium, apparently independent of the effects of the
intravenously delivered stem cells themselves. Rather, these
observed beneficial effects may be due to local paracrine effects;
and could explain the improvement in cardiac function that is
observed with the introduction of unfractionated bone marrow
preparations in the peri-infarct period. These studies demonstrate
that stem cell transplantation may have significant effects on
cardiac function independent of cardiac myocyte regeneration, and
that strategies designed to exploit these effects can lead to
significant preservation of cardiac function. Several studies have
demonstrated the utility and safety of allogeneic and autologous
MSC infusion in clinical populations, thus translation of an SDF-1
based therapy for preservation of myocardial tissue to patients
with acute myocardial infarction should be possible.
Example 2
MCP-3 is a Myocardial Mesenchymal Stem Cell Homing Factor
[0187] We have previously demonstrated that there is transient
homing of hematopoietic stem cells (HSC) to the heart following
myocardial infarction (MI). The transient nature of HSC homing is
due, at least in part, to the transient expression of SDF-1.
Whereas HSC seem not to transdifferentiate into cardiac tissue, MSC
can acquire some properties of cardiomyocytes in vitro. Since MSC
have also been shown to home to the heart early after MI, we
hypothesized that there are similarly chemokine(s) temporally
secreted by the myocardium that can attract MSC. The current study
was to identify potential MSC homing factor(s) and to test their
effect on myocardial function if stably expressed within the border
zone of at a time remote from MI.
Materials and Methods
LAD Ligation:
[0188] The Animal Research Committee approved all animal protocols
and all animals were housed in the AAALAC animal facility of the
Cleveland Clinic Foundation. Ligation of the left anterior
descending (LAD) artery in an inbred strain of rat, Lewis rat, was
performed as previously described. Briefly animals were
anesthetized with intraperitoneal ketamine and xylazine and
intubated and ventilated with room air at 80 breaths per minute
using a pressure-cycled rodent ventilator (RSP1002, Kent Scientific
Corp, Torrington, Conn.). Anterior wall myocardial infarction was
achieved with the aid of a surgical microscope (M500, LEICA
Microsystems, Bannockburn, Ill.).
Cell Preparation and Delivery:
[0189] Rat bone marrow was isolated by flushing the femurs with 0.6
ml DMEM (GIBCO, Invitrogen, Carlsbad, Calif.). Clumps of bone
marrow were gently minced with a 20-gauge needle. Cells were
separated by Percoll density gradient. The cells were centrifuged
for 10 minutes at 260 g and washed with three changes of PBS
containing 100 U/ml penicillin/100 g/ml and streptomycin
(Invitrogen, Carlsbad, Calif.). The washed cells were then
re-suspended and plated in DMEM-LG (GIBCO, Invitrogen, Carlsbad,
Calif.) with 10% FBS and 1% antibiotic and antimycotic (GIBCO,
Invitrogen, Carlsbad, Calif.). The cells were incubated at
37.degree. C. Non-adherent cells were removed by replacing the
medium after 3 days. Fourteen days later (passage 4) cells were
harvested by incubation 0.05% trypsin and 2 mM EDTA (INVITROGEN,
Carlsbad, Calif.) for 5 minutes. MSC Cultures were depleted of
CD45+ cells by negative selection using 10 .mu.l each of primary
PE-conjugated mouse anti-rat CD45 antibodies per 106 cells (Vendor:
BD Biosciences; Cat Number: 554878). PE-positive cells were
negatively selected using the EasySep PE selection kit according to
the manufacturer's instruction (Stem Cell technologies). The
resulting MSC (passage 6-12) were used for our studies. Three days
before infusion, the cells were freshly plated out at 1:3 ratio and
incubated in complete medium with 10 .mu.M BrdU (5-bromo
2-deoxyuridine) to label those cells in the S phase of the cell
cycle. BrdU labeled MSC were harvested at 106 cells/100 .mu.l of
PBS.
[0190] The status of our MSC phenotype was validated by staining
the cells with Oil Red (adipogenic lineage), alcian blue
(chondrogenic lineage), or alkaline phosphatase (osteogenic
lineage) following culture under specific differentiation
conditions. The BrdU labeling had no effect on MSC proliferation or
differentiation capacity.
[0191] Syngeneic rat cardiac fibroblasts were obtained from a donor
Lewis rat heart stably transfected with rat MCP-3 expression vector
or pcDNA3.1 (control vector) as described previously. The
expression of MCP-3 was confirmed by real-time PCR. Confluent cells
were passaged and plated out at 1:2 to 1:3 dilutions until passage
11.
Gene Array Analysis:
[0192] We used a chemokine/chemokine receptor array nylon membrane
array system that contained 67 distinct targets (SuperArray
Bioscience Corp). One microgram of total RNA was used to make cDNA
by reverse transcription using random primers. cRNA was generated
and hybridization performed using company supplied protocols.
Chemiluminescent signals were measured using a cooled CCD camera
with a 20 sec exposure time. Each filter was used once. Three
individual animals were studied at each time point. Time points
studied were 1 hour and 1, 3, 7 and 10 d after LAD ligation.
Control groups included no surgery and 1 hour and 7 days after sham
LAD ligation in which a suture was placed but not tightened over
the LAD.
Myocardial Chemokine Expression as a Function of Time after
AMI:
[0193] A positive result for a specific chemokine in myocardial
tissue was a 3 fold increase in expression of one experimental
animal compared to all controls (Sham and no surgery) that is also
at least 2 fold increased in the remaining experimental animals
compared to each of the controls at that time point. Furthermore,
all other time points had to be increased or no change from
controls.
Identification of Differential Receptor on MSC compared to Cardiac
Fibroblasts:
[0194] Because there is less variability in expression profiles
from cells in cultures compared to tissue, we increased the
stringency of a positive result in arrays performed on cells in
culture. In this case a significant difference in receptor
expression levels was defined as a 10 fold increase in expression
in MSC compared to cardiac fibroblasts. Three separate cultures of
each cell type were studied. All positive results were confirmed by
PCR or real-time PCR.
Real-Time PCR:
[0195] RT-PCR was performed following isolation of RNA from 6
million cells by using a Rneasy Mini Kit (Qiagen Inc., Valencia,
Calif.) according to manufacturer instructions. Quantitative
real-time PCR was performed using the ABI Prism 7700 sequence
detector (Applied Biosystems, Foster City, Calif.). The reaction
mixture contained SYBR Green PCR master mix (Applied Biosystems,
Foster City, Calif.), each primer at 300 nM, and 10 ul of cDNA.
After activation of the AmpliTaq Gold (Applied Biosystems, Foster
City, Calif.) for 10 minutes at 95.degree. C., we carried out 45
cycles with each cycle consisting of 15 seconds at 95.degree. C.
followed by 1 minute at 60.degree. C. The dissociation curve for
each amplification was analyzed to confirm that there were no
nonspecific PCR products.
Immunostaining:
[0196] Animals were sacrificed 72 hours or 4 weeks following
myocardial infarction. Tissues were fixed in formalin and embedded
in paraffin blocks according to established protocols. Antigen
retrieval was performed using 10 mM sodium citrate buffer (pH 6.0)
and heat at 95.degree. C. for 5 minutes. The buffer was replaced
with fresh buffer and re-heated for an additional 5 minutes and
then cooled for approximately 20 minutes. The slides were then
washed in de-ionized water three times for 2 minutes each.
Specimens were then incubated with 1% normal blocking serum in PBS
for 60 minutes to suppress non-specific binding of IgG. Slides were
then incubated for 60 minutes with the mouse anti-BrdU primary
antibody (BD Biosciences, San Jose, Calif.). Optimal antibody
concentration was determined by titration. Slides were then washed
with phosphate buffered saline (PBS) and then incubated for 45
minutes with FITC-conjugated secondary antibody (Santa Cruz
Biotechnology Inc., Santa Cruz, Calif.) diluted to 1.5 ug/ml in PBS
with 1% serum and incubated in a dark chamber. After washing
extensively with PBS, coverslips were mounted with aqueous mounting
medium (Vectashield Mounting Medium with DAPI, H-1200; Vector
Laboratories, Burlingame, Calif.).
Confocal Immunofluorescence Microscopy:
[0197] Tissue were analyzed using a upright spectral laser scanning
confocal microscope (Model TCS-SP; Leica Microsystems, Heidelberg,
Germany) equipped with blue argon (for DAPI), green argon (for
Alexa Fluor 488) and red krypton (for Alexa Fluor 594) laser. Data
was collected by sequential excitation to minimize "bleed-through".
Image processing, analysis and the extent of co-localization were
evaluated using the Leica Confocal software. Optical sectioning was
averaged over four frames and the image size was set at
1024.times.1024 pixels. There were no digital adjustments made to
the images.
Quantification of MSC Engraftment and Vascular Density:
[0198] Engrafted MSC were quantified as the number of BrdU positive
cells per high power field. The number of vessels was quantified as
the number of vWF positive vessels per high power field. At least 8
high power fields across the infarct zone were randomly counted by
two observers blinded to the treatment of the animals. The number
of cells or vessels per high power field were averaged and
normalized by the calibrated area per high power field.
Echocardiography:
[0199] 2D-echocardiography was performed at 2 and 5 weeks following
LAD ligation and MSC transplantation using a 15 MHz linear array
transducer interfaced with a Sequoia C256 and GE Vision 7 as
previously described. LV dimensions and wall thickness were
quantified by digitally recorded 2D clips and M-mode images in a
short axis view from the mid-LV just below the papillary muscles to
allow for consistent measurements from the same anatomical location
in different rats. The ultrasonographer was blinded to treatment
group. Measurements were made by two independent blinded observers
off-line using ProSolv echocardiography software. Measurements in
each animal were made 6 times from 3 out of 5 randomly chosen
M-mode clips recorded by an observer blinded to the treatment arm.
Shortening fraction was calculated from the M-mode recordings.
Shortening fraction (%)=(LVEDD-LVESD)/LVEDD.times.100, where
LVEDD=left ventricular end diastolic dimension and LVESD=left
ventricular end systolic dimension.
Determination of Collagen Content:
[0200] Paraffin sections (5 .mu.m) of the heart tissue were
prepared. Sections were stained with collagen-specific
Masson-Trichrome stain and observed by light microscopy.
Quantitative estimation of collagen content was performed to assess
fibrillar collagen accumulation (stained blue) using Image-Pro Plus
version 5.1, image analysis software. Fibrosis size was quantified
by % LV area containing collagen tissue (blue). Because the hearts
were 8 weeks after MI and the anterior wall had significantly
thinned, was also quantified the % of the LV cavity circumference
that had collagen tissue as a measure of infarct size following
remodeling.
In Vitro Migration Assay:
[0201] MSCs were detached with trypsin-EDTA, counted, and
resuspended in complete media. Cells (1.times.105 in 400 mL) were
then plated onto Millicell culture inserts (8-nm pore size;
Millipore, Bedford, Mass.) in a 24 well plate and allowed to adhere
for overnight at 37.degree. C. To initiate migration, DMEM
containing 1% FBS (600 mL) without or with the chemoattractant
factor MCP-3 (R&D Systems, Minneapolis, Minn.) was added to the
lower wells (in triplicate). Cells were allowed to migrate through
the insert membrane for 4 hours at 37.degree. C. The inserts were
then washed with PBS and the non-migrating cells remaining on the
upper surface of the insert were removed with a cotton swab.
Migrating cells were fixed with 4% PFA, stained with 0.25% crystal
violet and counted using a microscope (10.times.). The mean number
of cells (.+-.SEM) of four randomly chosen fields was calculated
for each treatment.
Statistical Analysis:
[0202] Data are presented as mean.+-.s.d. Comparisons between
groups were by unpaired Student t-test (cell engraftment, collagen
content), or by ANOVA with Bonferroni correction (echocardiographic
data) for multiple comparisons where appropriate.
Results
MSC Transiently Home to Injured Myocardium
[0203] Two million BrdU labeled MSC were infused into the tail vein
of the rat at 1 or 14 d after LAD ligation. Three days following
MSC infusion, the rats were killed and the heart harvested. MSC
were quantified as the number of BrdU positive cells per mm.sup.2.
The data in FIG. 7 demonstrate that our MSC preparation transiently
homes to the myocardium following acute myocardial infarction. One
day after LAD ligation, a significant number of MSC was identified
per unit area, where as 14 d after LAD ligation, the infusion of
MSC did not result in significant MSC engraftment within the
infarct zone.
Identification of Candidate MSC Homing Factors
[0204] FIG. 8a depicts the strategy we implemented to identify
candidate MSC homing factors. We used the chemokine and chemokine
receptor array to identify two distinct lists: the first list was
the population of chemokines that were expressed as early as 1 h
after LAD ligation, and whose expression was gone by 10 d after LAD
ligation, with a peak expression at least 3 fold over that of sham
operated animals (Light Grey Grouping on Left, FIG. 8a). The second
list represented chemokine receptors that were expressed at least
10 fold greater on MSC compared to cardiac fibroblasts (Dark Grey
Grouping on Right, FIG. 8a). The intersection of the candidate MSC
homing factors were those chemokines that were contained in the
Circle on the left (Light Grey) (transiently expressed by
myocardial tissue after LAD ligation) that bound receptors that
were contained in the Circle on the right (Dark Grey) (expressed by
MSC and not cardiac fibroblasts) are presented in the open
non-shaded area. As depicted in the open area of FIG. 8a, only two
families of chemokines were identified, the monocyte chemotactic
proteins (1 and 3) via receptors CCR-1 and CCR-2 and MIP-1.alpha.
and .beta. via the receptor CCR-5.
[0205] In order to validate and refine the findings from our array
studies, we performed PCR to further assess the presence of CCR1,
CCR2 and CCR5. FIG. 8b shows PCR products from passages 6 and 20
MSC, CF and rat Spleen (positive control). These results indicate
that expression of CCR1 and CCR5 are significantly greater than CF
in young MSC, and that the expression of CCR5 by MSC is lost with
passage.
Effect of MCP-3 Expression on MSC Homing
[0206] Based on the observation that (i) CCR1 expression appears to
be maintained in MSC and (ii) the ability of MSC to home over time
is not lost, we chose to focus on MCP-3. An additional pre-defined
criterion for identifying an MSC homing factor is that MSC do not
express the chemokine of interest. We performed real-time PCR
analysis for MCP-3 expression in MSC and CF that showed MSC do not
express significant levels of MCP-3 (data not shown).
[0207] To test if MCP-3 can induce MSC homing, we performed in
vitro cell migration studies to test the ability of MSC to migrate
in response to varying concentrations of MCP-3. The data in FIG. 9
show that there was an increase in MSC migration in a concentration
dependent manner
[0208] To test the ability of MCP-3 to recruit MSC to remotely
injured myocardium, 1 months after LAD ligation we transplanted
control or MCP-3 expressing CF into the infarct border zone. Three
days later, we infused 1 million BrdU labeled MSC via the tail
vein, and quantified MSC engraftment 3 days later (6 days after CF
transplantation). The data in FIG. 10 (single infusion) demonstrate
that re-establishment of MCP-3 expression in myocardial tissue
restores the ability of MSC to home to myocardial tissue. While
these data are consistent with MCP-3 having a role in MSC homing,
the level of MSC engraftment was low compared to HSC engraftment in
response to chronic SDF-1 expression in the same model.
[0209] We reasoned that among the causes of the relatively low
engraftment of MSC in response to MCP-3 was the fact that, unlike
HSC, MSC are not constitutively released by the bone marrow, some
MSC are trapped in the lung when given i.v., and that the half-life
of MSC in the blood stream following intravenous infusion is short
(<1 h). We hypothesized that serial infusions of MSC into
animals transplanted with MCP-3 expressing CF would lead to greater
MSC engraftment. The data in FIG. 4 (multiple infusions) show that
following 6 intravenous infusions over 12 days of 1 million MSC per
infusion there were significantly greater MSC engrafted in the
myocardium of animals that received MCP-3 expressing CF compared to
control CF (FIGS. 10a and b).
Effect of Re-Establishing MSC Homing on Cardiac Function
[0210] We transplanted control and MCP-3 expressing CF 1 month
after LAD ligation. Following CF transplantation animals then
received 6 infusions of 1 million MSC per infusion every other day
for 12 days or saline beginning 3 days after CF transplantation.
Cardiac function and dimensions were quantified by echocardiography
1 month after MI before CF transplantation (baseline), and 1 month
after CF transplantation (2 months after MI). The data in FIG. 11a
demonstrate that cardiac function as measured by shortening
fraction was significantly increased in those animals that received
MCP-3 expressing CF and MSC infusions. No significant benefit was
seen when animals received MCP-3 expressing CF without MSC inufions
(FIG. 11c). There was evidence of reverse remodeling with a
decrease in LVEDD 1 month after infusion of MSC into animals that
received MCP-3 expressing CF and MSC infusions. Further dilation of
the left ventricular cavity was observed in those animals that
received either control CF despite serial infusions of MSC or MCP-3
expressing CF without serial infusions of MSC (FIGS. 11b and
d).
[0211] The engrafted MSC did not differentiate into cardiac
myocytes. Co-staining for BrdU and cardiac myosin, troponin I or
connexin 43 revealed that none of the engrafted MSC expressed
cardiac markers in vivo (data not shown). We hypothesized that MSC
engraftment resulted in remodeling of the infarct zone leading to
improvement in cardiac function. Mason's trichrome staining
revealed a significant difference in collagen content in the
infarct/infarct border zone between animals that were treated with
control and MCP-3 expressing cardiac fibroblast prior to serial MSC
infusion (FIGS. 12a and b, respectively). No changes were observed
with the injection of MCP-3 expressing cardiac fibroblasts without
MSC infusion (data not shown). Injection of CF with our without
MCP-3 expression and with or without MSC infusions had no effect on
vascular density (data not shown). The percent of the LV that
stained positive for collagen was significantly decreased by 25.4%
(p<0.02, FIG. 12c) in the animals that received MCP-3 expressing
cardiac fibroblasts and serial MSC infusions. In these animals we
observed a 35.3% (p<0.01, FIG. 12d) decrease in the LV
circumference that stained positive for collagen. These data are
consistent with our observation that there was a significant
decrease in LVEDD (FIG. 11) in animals that received MCP-3
expressing cardiac fibroblasts and serial MSC infusions.
Myofibroblasts have been associated with improved cardiac
remodeling and function; therefore, we wanted to determine if the
favorable collagen remodeling was associated with a greater number
of myofibroblasts in the infarct zone. Staining with an antibody to
vimentin and .alpha.-smooth muscle cell actin demonstrated a
greater number of myofibroblasts in the infarct border zone of
animals that received MCP-3 and serial MSC infusions compared to
those that received control CF and serial MSC infusions (FIGS. 12e
and f). The vimentin+ cells were rarely BrdU positive, suggesting
that the majority of these cells were recruited to the infarct
border zone in response to MSC engraftment since MCP-3 expression
alone did not result in an increase in myofibroblasts.
Discussion
[0212] MSC are under active investigation as a stem cell source for
tissue repair. MSC are known to home to injured tissue of multiple
organs; however, the biological signals responsible for MSC homing
have not been previously described. In this study we identified
MCP-3 as a homing factor for MSC.
[0213] Some studies have suggested that MSC home in response to
SDF-1. Moreover, SDF-1 seems important for growth and survival of
MSC, perhaps due to autocrine mechanisms, since MSC themselves
express SDF-1, but these effects of SDF-1 are distinct from SDF-1
being responsible for MSC homing. Consistent with the idea that
SDF-1 over-expression at a time remote from MI does not induce
significant homing of MSC, we only encountered HSC recruitment and
engraftment in previous studies that defined SDF-1 as a myocardial
stem cell homing factor.
[0214] MCP-3 belongs to the family of CC chemokines with potent
chemotactic activities for several cell types, including monocytes,
leukocytes, and dendritic cells. These chemokines exert their
effects through interaction with the chemokine receptors CCR1,
CCR2, CCR3, and CCR5. MCP-3 has been shown to be expressed at
multiple sites of inflammation, although its role in wound healing
has not been fully elucidated. In this study, we show that MCP-3 is
transiently expressed by myocardial tissue following acute
myocardial infarction. Since MSC are not known to be mobilized in
response to myocardial infarction, the utility of MCP-3 expression
as a MSC homing factor for the intrinsic repair of the heart at the
time of MI is unclear. However, as shown by our study exploiting
the MSC homing effects of MCP-3 may have therapeutic potential.
[0215] Our data demonstrate that following myocardial infarction
there is a transient up-regulation and release of multiple
chemokines that may impact on stem cell trafficking to sites of
injury. Identification and re-expression of these stem cell homing
factors weeks to months after myocardial infarction appears to
re-establish the ability of stem cells to traffic to and engraft in
the infarct zone. Furthermore, injecting the heart with cells that
re-establish stem cell homing in the myocardial tissue could be a
potential strategy for increasing stem cell content in the heart
overtime. Future studies are necessary to determine if this
strategy is equally or more efficacious as either multiple invasive
injections over time and/or what can be achieved with a single
injection of stem cells.
[0216] The recruitment of MSC to the heart one month after
myocardial infarction did not result in regeneration of cardiac
myocytes. Rather, as has been shown with MSC injections in the
peri-infarct period, MSC engraftment results in beneficial
remodeling in the infarct zone. The lack of new cardiac myocyte
formation could be due to the inability of MSC to differentiate
into cardiac myocytes or the lack of critical mediators of cell
signaling required for cardiac differentiation being present in the
myocardial tissue beyond the peri-infarct period. MSC are known to
release multiple factors including VEGF, SDF-1, FGF, and IGF-1.
While beyond the scope of our current study demonstrating that
MCP-3 is an MSC homing factor, it is interesting to note that we
observed improved cardiac function in the absence of vasculogenesis
or angiogenesis. Thus the effects of recruiting MSC via the
over-expression of MCP-3 appears distinct from that observed
following over-expression of an HSC homing factor or injection of
HSC themselves. This observation suggests that the mechanism of
benefit following re-establishment of MSC homing and engraftment of
MSC at a time remote from myocardial infarction for MSC
transplantation at a time remote from acute myocardial infarction
is related to improved cardiac remodeling, and perhaps trophic
effects on surviving myocardium; rather than improved tissue
perfusion.
[0217] From the above description of the invention, those skilled
in the art will perceive improvements, changes and modifications.
Such improvements, changes and modifications within the skill of
the art are intended to be covered by the appended claims
Additionally, all references, publications, and patent
applications, and patents referred to in this application are
herein incorporated by reference in their entirety.
* * * * *