U.S. patent application number 12/713112 was filed with the patent office on 2010-06-24 for genes associated to sucrose content.
This patent application is currently assigned to UNIVERSIDADE DE S O PAULO -- USP.. Invention is credited to Marcos Buckeridge, Juliana de Maria Felix, Joselia Oliveira Marques, Flavia Stal Papini-Terzi, Amanda Pereira de Souza, Flavia Riso Rocha, Glaucia Mendes SOUZA, Marcelo Menossi Teixeira, Eug nio Cesar Ulian, Ricardo Zorzetto Nicollielo Vencio, Alessandro Jaquiel Waclawovsky.
Application Number | 20100162442 12/713112 |
Document ID | / |
Family ID | 39468287 |
Filed Date | 2010-06-24 |
United States Patent
Application |
20100162442 |
Kind Code |
A1 |
SOUZA; Glaucia Mendes ; et
al. |
June 24, 2010 |
GENES ASSOCIATED TO SUCROSE CONTENT
Abstract
Modern sugarcane cultivars are complex hybrids resulting from
crosses among several species of the Saccharum genus. Traditional
breeding methods have been extensively employed in different
countries along the past decades to develop varieties with
increased sucrose yield, and resistant to plagues and diseases.
Conventional varietal improvement is, however, limited by the
narrow pool of suitable markers. In this sense, molecular genetics
is seen as a promising tool to assist in the process of molecular
marker identification. The present invention concerns the
identification of 348 genes associated with sucrose content in
sugarcane plants. The genes were found to be differentially
expressed when high sucrose and low sucrose plants and populations
of plants were compared and/or when high and low sucrose internodes
were compared. The expression data was obtained using cDNA
microarray and quantitative PCR technologies. The genes identified
can be used to identify, distinguish, characterize and/or develop
plants with increased sucrose content. More preferably SEQ ID Nos:.
1 to 203 should be useful as molecular markers. SEQ ID Nos: 204 to
228 are given as controls or examples of genes never associated
with sucrose content. SEQ ID Nos. 1-203 and SEQ ID Nos. 229 to 373
can be targeted in the development of transgenic or non-transgenic
varieties with increased sucrose content.
Inventors: |
SOUZA; Glaucia Mendes; (Sao
Paulo, BR) ; Papini-Terzi; Flavia Stal; (Sao Paulo,
BR) ; Rocha; Flavia Riso; (Sao Paulo, BR) ;
Waclawovsky; Alessandro Jaquiel; (Sao Paulo, BR) ;
Vencio; Ricardo Zorzetto Nicollielo; (Sao Paulo, BR)
; Marques; Joselia Oliveira; (Sao Paulo, BR) ; de
Maria Felix; Juliana; (Campinas, BR) ; Teixeira;
Marcelo Menossi; (Campinas, BR) ; Buckeridge;
Marcos; (Rua do Matao, BR) ; Pereira de Souza;
Amanda; (Rua do Matao, BR) ; Ulian; Eug nio
Cesar; (Piracicaba, BR) |
Correspondence
Address: |
MORRISON & FOERSTER LLP
425 MARKET STREET
SAN FRANCISCO
CA
94105-2482
US
|
Assignee: |
UNIVERSIDADE DE S O PAULO --
USP.
Butanta
BR
UNIVERSIDADE ESTADUAL DE COMPINAS -- UNICAMP.
Campinas
BR
FUNDA O DE AMPARO PESQUISA DO ESTADO DE S O PAULO --
FAPESP
Alto de Lapa
BR
CENTRO DE TECHNOLOGIA CANAVIEIRA
Piracicaba
BR
CENTRAL DE LCOOL LUCELIA LTDA.
Colonia Paulista - Lucelia
BR
|
Family ID: |
39468287 |
Appl. No.: |
12/713112 |
Filed: |
February 25, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11716262 |
Mar 8, 2007 |
|
|
|
12713112 |
|
|
|
|
60780693 |
Mar 8, 2006 |
|
|
|
60861496 |
Nov 27, 2006 |
|
|
|
Current U.S.
Class: |
800/298 |
Current CPC
Class: |
C07K 14/415
20130101 |
Class at
Publication: |
800/298 |
International
Class: |
A01H 5/00 20060101
A01H005/00 |
Claims
1. A transgenic plant, wherein said plant comprises a vector
expressing a recombinant polynucleotide, wherein the polynucleotide
comprises the nucleotide sequence of SEQ ID NO: 161 or the
complement thereof.
2. Seed, seed-cane or setts of the transgenic plant of claim 1,
wherein the seed, seed-cane, or setts comprise the vector.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 11/716,262, filed Mar. 8, 2007, which claims the benefit
of U.S. Provisional Application No. 60/780,693, filed Mar. 8, 2006,
and U.S. Provisional Application No. 60/861,496, filed Nov. 27,
2006, all of which are hereby incorporated by reference in their
entirety.
SUBMISSION OF SEQUENCE LISTING ON ASCII TEXT FILE
[0002] The content of the following submission on ASCII text file
is incorporated herein by reference in its entirety: a computer
readable form (CRF) of the Sequence Listing (file name:
606633000210SeqList.txt, date recorded: Feb. 19, 2010, size: 566
KB).
FIELD OF THE INVENTION
[0003] The present invention refers to a method for discriminating
plants with different abilities to accumulate sugars as well as
methods to produce plants with increased sucrose content.
BACKGROUND OF THE INVENTION
[0004] The tropical crop sugarcane is of great economical interest,
contributing to about two thirds of the world's raw sugar
production (Pessoa Jr. et al., 2005). In some countries, part of
the crop is destined to the production of ethanol, an important
alternative energy source and a less polluting fuel. Due to its
unique capacity of storing sucrose in the stems, sugarcane is an
interesting model for studies on sugar synthesis, transport and
accumulation. Sugarcane is a C4 grass capable of accumulating
sucrose in its stems to levels exceeding 50% of its dry weight.
Stem internodes mature progressively towards the base of the culm
and there is a corresponding increase in sucrose concentration.
Sucrose metabolism components and regulators are likely to be key
players in determining sugarcane sucrose yield (Moore, 2005; Lunn
and Furbank, 1999). Sugarcane is a complex polyploid grass with
commercial varieties derived from conventional breeding. Recent
yield data indicates that this technology may be reaching a limit
in sugar productivity increases. It could be greatly advantageous
to have genes associated with desirable traits targeted for
directed improvement of varieties. Traditional breeding methods
have been extensively employed in different countries along the
past decades to develop varieties with increased sucrose yield, and
resistant to plagues and diseases. Conventional varietal
improvement is, however, limited by the narrow pool of suitable
markers. In this sense, molecular genetics is seen as a promising
tool to assist in the process of molecular marker identification.
Knowledge on the genes that participate in sucrose content
regulation may assist in the development of new varieties with
increased productivity. This improvement is not only economically
relevant, but has also a strong environmental appeal, considering
it can lessen the need to expand cultivation areas and that ethanol
is a source for renewable energy. Furthermore, a broader
understanding of the highly specialized sugar production and
accumulation mechanisms in sugarcane can bring new insights into
sugar metabolism in other species.
[0005] Sugarcane is the common name given to the several species of
the genus Saccharum, native to Asia, but cultivated for centuries
in all five continents. It is a very efficient photosynthesizer
making it one of the world's most important crop grasses. Sugarcane
is perennial and has sturdy, jointed fibrous stalks 2-6 m tall,
capable of storing large quantities of sucrose. Its cultivation
requires warm and humid tropical or subtropical climate. Brazil,
India and China are the largest producers. The major commercial
cultivars are complex hybrids selected from crosses between S.
officinarum, S. barberi, S. robustum, S. spontaneum and S. edule,
as well as related genera that cross with Saccharum, such as
Erianthus, Miscanthus, Narenga and Sclerostachya.
[0006] S. spontaneum genotypes, found from Afghanistan to the South
Pacific Islands, have the broadest geographical distribution in the
genus Saccharum. Together with S. officinarum, it is the species
most used in breeding programs aiming to improve vigor, fiber
content, ratooning ability, environmental stress and disease
resistance (Perez et al., 1997). The origin of S. spontaneum is not
yet clear. It is believed that it might have originated from an
introgression of Miscanthus, Erianthus and Sclerostachya (Roach and
Daniels, 1987). S. officinarum genotypes have originated in New
Guinea from S. robustum by natural and/or human selection. They
produce thick stems and are capable of accumulating high levels of
sucrose. They do not flower abundantly and are usually used as
females in breeding programs (Perez et al., 1997).
[0007] The sequencing of 238 thousand sugarcane ESTs (Expressed
Sequence Tags) by the Brazilian consortium SUCEST (Vettore et al.,
2003) was a landmark for the sugarcane biotechnology field and also
for the study of basic genetics and physiology of grasses. The ESTs
were clustered and a total of 43 thousand SAS (Sugarcane Assembled
Sequences) were identified and categorized (Vettore et al., 2003).
Functional characterization of the transcripts can be viewed on the
World Wide Web at sucest-fun.org.
[0008] This work describes the use of cDNA microarrays to identify
genes differentially expressed in two sugarcane populations
contrasting for sugar content. The methods used to identify
differential expression, the construction of cDNA microarrays,
hybridization conditions and data analysis have been previously
described (Papini-Terzi et al., 2005). A total of 5154 genes had
their expression profiled.
[0009] The plants analyzed in the present invention are derived
from multiple crossings among S. officinarum and S. spontaneum
genotypes and from commercial varieties that have been selected for
sugar content for over 12-15 years. A useful strategy for
target-gene identification has been denominated "genetical
genomics". First introduced by Jansen and Nap (2001), the method
aims to apply large-scale analysis of gene expression to a
segregating population. The use of cDNA microarrays to evaluate a
sugarcane population that segregates for a certain trait may
provide more insight into plant signaling and gene function than
classical mutagenesis studies (Meyers et al., 2004). Although S.
officinarum and S. spontaneum present a large genetic variability
in nature, very few representatives participated in the generation
of the modern commercial hybrids. Certainly, there are genes
conferring favourable traits to be identified among them that can
be explored in breeding programs. Likewise, the comparison of
progenies from different commercial varieties carefully selected
for sucrose enrichment is a strategy that can point to genes that
have been selected for over the years by traditional breeding
methods.
SUMMARY OF THE INVENTION
[0010] This invention provides methods for producing transgenic
plants, and non-naturally occurring plants with increased sugar
levels. The invention further provides methods for determining the
ability of a plant to accumulate sugar as well as methods for
altering the ability of plants to accumulate sugar. In preferred
embodiments, the plants are from the genus Saccharum. In
particularly preferred embodiments, the plants are sugarcane.
[0011] In some embodiments, the invention provides methods for
determining the ability of a plant to accumulate sugar by providing
a plant sample and measuring the expression level in the sample of
at least one polynucleotide having sequence identity to or
comprising SEQ ID NO:s 1 to 203 or SEQ ID NO:s 229 to 373, their
complements, and sequences which hybridize to SEQ ID NO:s 1 to 203
or SEQ ID NO:s 229 to 373 under high stringency conditions. High
stringency conditions refers to hybridization to filter-bound DNA
in 5.times.SSC, 2% sodium dodecyl sulfate (SDS), 100 ug/ml single
stranded DNA at 55-65.degree. C., and washing in 0.1.times.SSC and
0.1% SDS at 60-65.degree. C. For example, the polynucleotide can
have 65% sequence identity, 75% sequence identity, 85% sequence
identity, 95% sequence identity, 99% sequence identity, or be
identical. In other embodiments, the polynucleotide is a fragment
at least 14 nucleotides length of SEQ ID NO:s 1 to 203 or SEQ ID
NO:s 229 to 373, their complements, and sequences which hybridize
to SEQ ID NO:s 1 to 203 or SEQ ID NO:s 229 to 373 under high
stringency conditions.
[0012] Polynucleotide expression levels are preferably detected by
measurement of RNA levels, which can be detected by any method
known to those of skill in the art, preferably PCR or hybridization
to oligonucleotides. Samples are preferably taken from the leaf,
internode, lateral bud, root, or inflorescence.
[0013] In other embodiments, the invention provides methods for
determining the ability of a plant to accumulate sugar by providing
a plant sample and measuring the expression level in the sample of
at least one polypeptide encoded by polynucleotides having sequence
identity to or comprising SEQ NO:s 1 to 203 or SEQ ID NO:s 229 to
373, their complements, and sequences which hybridize to SEQ ID
NO:s 1 to 203 or SEQ ID NO:s 229 to 373 under high stringency
conditions. For example, the polynucleotide can have 65% sequence
identity, 75% sequence identity, 85% sequence identity, 95%
sequence identity, 99% sequence identity, or be identical.
[0014] In still other embodiments, the invention provides methods
for determining the ability of a plant to accumulate sugar by
providing a plant sample and measuring the expression level in the
sample of at least one polypeptide having similarity or comprising
a polypeptide encoded by SEQ ID NO:s 1 to 203 or SEQ ID NO:s 229 to
373. The similarity, for example, can be 65%, 75%, 85%, 95%, 99%,
or 100%.
[0015] In other embodiments, the invention provides methods for
altering the ability of a plant to accumulate sugar by providing a
plant sample, modulating the expression level of at least one of
SEQ ID NO:s 1 to 203 or SEQ ID NO:s 229 to 373 and detecting the
expression level of at least one of SEQ ID NO:s 1 to 203 or SEQ ID
NO:s 229 to 373. The modulation can be achieved by mutagenesis,
preferably by chemical or physical mutagenesis.
[0016] In yet another embodiment, the invention provides methods
for altering the ability of a plant to accumulate sugar by
providing a plant sample, expressing or interfering with the
expression of at least one polynucleotide having sequence identity
to or comprising SEQ ID NO:s 1 to 203 or SEQ ID NO:s 229 to 373,
their fragments, their complements, and sequences which hybridize
to SEQ ID NO:s 1 to 203 or SEQ ID NO:s 229 to 373 under high
stringency conditions and detecting the expression level of at
least one of SEQ ID NO:s 1 to 203 or SEQ ID NO:s 229 to 373. For
example, the polynucleotide can have 65% sequence identity, 75%
sequence identity, 85% sequence identity, 95% sequence identity,
99% sequence identity, or be identical to the sequence or a
fragment of the sequence. The invention also provides methods for
altering ability of a plant to accumulate sugar by expressing or
interfering with the expression of polypeptides having similarity
to or comprising polypeptides encoded by SEQ ID NO:s 1 to 203 or
SEQS ID NO:s 229 to 373 and detecting the expression level of at
least one of the polypeptides encoded by SEQ ID NO:s 1 to 203 or
SEQ ID NO:s 229 to 373. The similarity, for example, can be of 65%,
75%, 85%, 95%, 99%, or 100%. Typically, expression levels of
polynucleotides and the encoded polypeptides are interfered with or
decreased using anti-sense RNA or RNA interference methods.
[0017] In other embodiments, the invention provides transgenic
plants produced by any method having altered expression of least
one polynucleotide having sequence identity to or comprising SEQ ID
NO:s 1 to 203 or SEQ ID NO:s 229 to 373, their fragments, their
complements, and sequences which hybridize to SEQ ID NO:s 1 to 203
or SEQ ID NO:s 229 to 373 under high stringency conditions or
having altered expression of polypeptides having sequence identity
to or comprising a polypeptide encoded by SEQ ID NO:s 1 to 203 and
SEQ ID NO:s 229 to 373. In still other embodiments, the invention
provides transgenic plants produced by methods described above,
using genes that express or interfere with the expression of least
one polynucleotide having sequence identity to or comprising SEQ ID
NO:s 1 to 203 or SEQ ID NO:s 229 to 373, their fragments, their
complements, and sequences which hybridize to SEQ ID NO:s 1 to 203
or SEQ ID NO:s 229 to 373 under high stringency conditions or
expressing polypeptides having similarity to or comprising
polypeptides encoded by SEQ ID NO:s 1 to 203 or SEQ ID NO:s 229 to
373. Seeds, seed-canes (or setts) of such plants are also
provided.
[0018] In yet another embodiment, the invention provides
non-naturally occurring plants with altered expression levels
generated by methods described above, such as mutagenesis. Seeds,
seed-canes (or setts) of such plants are also provided.
[0019] The present invention identifies genes differentially
expressed in sugarcane progenies and varieties with different sugar
content. Comparative measures of mRNA for the genes in isolation or
combined are indicative of sucrose content. Methods that measure
transcript levels for the genes can be used to determine gene
expression levels and can include cDNA microarrays, oligonucleotide
arrays, quantitative PCR, northern blot or other hybridization
techniques. Likewise, methods that measure the proteins encoded by
the genes can also be used to characterize plants and progenies
originating from traditional breeding programs or transgenic plants
with the goal of identifying or selecting candidates that contain
high sucrose content. Additionally, the genes can be directly used
to increase plant sucrose content if they are introduced in the
plant through the generation of a transgenic plant.
[0020] The cDNA microarray technology, quantitative PCR and
northern blots were used to identify molecular markers associated
to sucrose content. The procedures used were as described in
Papini-Terzi et al, 2005 and Nogueira et al., 2003. The cDNA
microarrays contain 5154 ESTs related to sugarcane signal
transduction, stress responses, transcription, hormone signalling,
metabolism and other functional categories. The plants analyzed
derive (1) from an F3 progeny from multiple crossings among S.
officinarum and S. spontaneum genotypes, (2) an F1 progeny from a
crossing between the commercial varieties SP80-180 and SP80-4966,
(3) an F1 progeny from a crossing between the commercial varieties
SP80-144 and SP85-7215, (4) two varieties precocious and rich in
sucrose production, SP91-1049 and SP94-3166 and (5) two varieties
late and poor in sucrose production, SP83-2847 and SP89-1115.
Sucrose producing tissues, also known as source tissues (herein
leaf) and sucrose accumulating tissues, also known as sink tissues
(herein internodes) were collected from field grown plants. Soluble
sugar content (Brix) measures were made. Samples were collected
from individual and pools of 7 or 8 plants. In some cases, samples
were collected throughout the year. Three designs were used to
perform transcriptome comparisons for the identification of genes
differentially expressed when (I) High Sugar and Low Sugar plants
were directly compared, (II) High Sugar and Low Sugar plants were
compared to a common reference, or (III) High Sugar and Low Sugar
internodes were compared. Experimental Design I and II yielded 208
differentially expressed genes, while Design III revealed 140
differentially expressed genes, totalling 348 genes differentially
expressed in at least one of the samples analysed. Several
differentially expressed genes were validated by real-time PCR and
northern blots using individual plants as the source for tissues or
groups of plants which proves that the differential expression is
robust enough to distinguish between high and low sucrose plants in
a pool of plants.
[0021] The gene profiles of one or a plurality of the 203 genes
obtained from the comparisons of Design I may be useful as
molecular markers for traditional breeding, aid in the selection of
ideal progenies and parents generated in traditional breeding or
aid in the selection of transgenic events generated in the process
of transgenic plants production. The 348 genes themselves,
identified in comparisons I, II and III, may be used in the
generation of transgenic plants as they may directly function in
sucrose synthesis and/or accumulation, be mutated by classical
(non-transgenic) methods leading to varieties with improved sucrose
content, or be used as probes in search of polymorphisms.
BRIEF DESCRIPTION OF THE FIGURES
[0022] FIG. 1: Polycrosses performed among S. officinarum and S.
spontaneum cultivars to obtain the sugarcane hybrid populations
with high- and low sugar content. The graphs show the frequency of
individuals from the F3 progeny corresponding to each of the Brix
classes (Brix %). Brix was measured from juice of 500 individuals.
Tissues of the 16 extreme individuals were collected and pooled for
the microarray analysis. For real-time PCR quantification the RNA
was extracted independently for each individual tissue.
[0023] FIG. 2--Sugar content along the growing season in the
extreme individuals of a sugarcane segregant population. The Brix
(soluble solids) values of the most mature internode of each
sugarcane segregant plant were measured along the growing season.
Average Brix values and standard deviations of the seven
individuals with the highest or lowest sugar contents are shown for
the indicated times.
[0024] FIG. 3: Validation of gene expression data by real-time PCR.
mRNA levels were determined for the indicated SAS. Reactions were
done in triplicates. A polyubiquitin (PUB) gene was used as
reference. The bars show target mRNA levels relative to the
polyubiquitin mRNA. Error bars were calculated as described by
Livak and Schmittgen (2001). RNA samples from a pool of individuals
were used to generate the templates for real-time PCR reactions.
Additionally, three high brix (HB) individuals, Ind243, Ind246 and
Ind253, and three low brix (LB) individuals, Ind261, Ind265 and
Ind272, were analysed in the case of the cross between the
commercial varieties (SP80-180 and SP80-4966). A: samples derived
from a cross between two commercial varieties (SP80-180 and
SP80-4966), B: samples derived from multiple crossings among S.
officinarum and S. spontaneum genotypes. Lv=leaf; In1=internode 1;
In9=internode 9.
[0025] FIG. 4: Expression levels of differentially expressed genes
in sugarcane individuals. RNA blots were prepared using 10 .mu.g of
total RNA isolated from mature leaves of three individual clones of
each segregant population (HS--high and LS--low sugar content). The
time point evaluated in the blots corresponds to the same one used
in the cDNA microarray experiments (9 months after planting). Blots
were hybridized with the gene-specific radioactive probes
indicated. An rDNA fragment was used as a control.
[0026] FIG. 5: Expression profiles of differentially expressed
genes along the growing season. RNA-blots were prepared from total
leaf-RNA from a pool of 7 individuals with high (HS) and low (LS)
sugar content collected along the growing season (6, 7, 9, 11 and
13 months after planting). The inset graphs show the expression
levels observed for the high (black circles) and low (white
circles) sugar content plants. An rDNA fragment was used as a
control.
[0027] FIG. 6--Sugar content along the growing season in two
sugarcane cultivars poor and late in sucrose accumulation
(SP83-2847 and SP94-3116) and two sugarcane cultivars rich and
precocious in sucrose accumulation (SP91-1049 and SP89-1115). The
Brix (soluble solids) values of the most mature internode of each
sugarcane segregant plant were measured during the growing season.
Average Brix values and standard deviations are shown for the
indicated times.
[0028] FIG. 7--Alignment of nucleotide sequences for SEQ ID No.
411: CIPK-8 (SCEQLB2019B08.g); SEQ ID No. 412: CIPK-29
(SCSGHR1070F12.g); and SEQ ID No. 413: CIPK-1 (SCCCCL5001D11.g)
using CLUSTALW (Thompson et al., 1994). The line above the
sequences indicates the sequence fragment of 331 by amplified and
cloned in the plasmid in order to silence the CIPK-8 gene by RNA
interference in the transgenic plants.
[0029] FIG. 8-Expression analysis of CIPK-8, CIPK-29 and CIPK-1
mRNA levels in control (blank) and transgenic plants (grey) of
two-month old plants using quantitative PCR analysis. The bars show
mRNA levels of CIPK8 (SCEQLB2019B08.g), CIPK29 (SCSGHR1070F12.g)
and CIPK-1 (SCCCCL5001D11.g) relative to mRNA levels of the
reference gene (SCQGAM2027G09.g). All reactions were carried out in
parallel and each reaction was performed in triplicate. Error bars
were calculated as described by Livak and Schmittgen (2001). The
graph also shows sucrose levels and the ratio of sucrose to
monosaccharides in these plants.
[0030] FIG. 9--Expression analysis of COMT mRNA levels in control
(blank) and transgenic plants (grey) of two-month old plants using
quantitative PCR analysis. The bars show mRNA levels of COMT
(SCRFLR1012F12.g) relative to mRNA levels of the reference gene
(SCQGAM2027G09.g). All reactions were carried out in parallel and
each reaction was performed in triplicate. Error bars were
calculated as described by Livak and Schmittgen (2001). The graph
also shows sucrose levels and the ratio of sucrose to
monosaccharides in these plants.
DEFINITIONS
[0031] The term "plants" include any plant amenable to
transformation techniques, including angiosperms (monocotyledonous
and dicotyledonous plants), gymnosperms, ferns, and multicellular
algae. It includes plants of a variety of ploidy levels, including
aneuploid, polyploid, diploid, haploid and hemizygous. The term
"plant" includes whole plants, shoot vegetative organs/structures
(e.g. leaves, stems and tubers), roots, flowers and floral
organs/structures, seed (including embryo, endosperm, and seed
coat) and fruit (the mature ovary), plant tissue (e.g. vascular
tissue, ground tissue, and the like) and cells (e.g. guard cells,
egg cells, trichomes and the like), and progeny of same. Examples
of suitable plant targets would include but are not limited to
Acadia, alfalfa, apple, apricot, Arabidopsis, artichoke, arugula,
asparagus, avocado, banana, barley, beans, beet, blackberry,
blueberry, broccoli, brussels sprouts, cabbage, canola, cantaloupe,
carrot, cassaya, castorbean, cauliflower, celery, cherry, chicory,
cilantro, citrus, clementines, clover, coconut, coffee, corn,
cotton, cucumber, Douglas fir, eggplant, endive, escarole,
eucalyptus, fennel, figs, garlic, gourd, grape, grapefruit, honey
dew, jicama, kiwifruit, lettuce, leeks, lemon, lime, Loblolly pine,
linseed, mango, melon, mushroom, nectarine, nut, oat, oil palm, oil
seed rape, okra, olive, onion, orange, an ornamental plant, palm,
papaya, parsley, parsnip, pea, peach, peanut, pear, pepper,
persimmon, pine, pineapple, plantain, plum, pomegranate, poplar,
potato, pumpkin, quince, radiata pine, radiscchio, radish,
rapeseed, raspberry, rice, rye, sorghum, Southern pine, soybean,
spinach, squash, strawberry, sugarbeet, sugarcane, sunflower, sweet
potato, sweetgum, tangerine, tea, tobacco, tomato, triticale, turf,
turnip, a vine, watermelon, wheat, yams, and zucchini Particularly
preferred plant targets would include sugarcane and sugarbeet. More
preferably the plant is a crop plant used to produce sucrose or
that can be transformed into a sucrose producing plant. Further
preferably, the plant is sugarcane.
[0032] The term "sugarcane plants" can be/or be derived from:
[0033] any Saccharum wild-type genotype (for example, Saccharum
officinarum, Saccharum spontaneum, Saccharum robustum)
[0034] any genus that crosses with Saccharum (for example,
Miscanthus, Erianthus, Narenga, Sclerestachya)
[0035] any sugarcane hybrid generated spontaneously
[0036] any sugarcane hybrid generated by traditional breeding
techniques
[0037] any sugarcane progenies generated from crosses of wild-type
or commercial varieties
[0038] any sugarcane plant generated by the introduction of a
transgene (transgenic plants)
[0039] The term "promoter" refers to regions or sequence located
upstream and/or downstream from the start of transcription and
which are involved in recognition and binding of RNA polymerase and
other proteins to initiate transcription. A "plant promoter" is a
promoter capable of initiating transcription in plant cells.
[0040] The term "seed-cane" (or setts) refers to stem cuttings or
pieces of sugarcane stalk used to vegetatively propagate sugarcane
cultures.
DETAILED DESCRIPTION OF INVENTION
[0041] Very little is known on the molecular mechanisms governing
sucrose synthesis and accumulation in sugarcane. Although varieties
exist capable of accumulating different amounts of sucrose, studies
designed to compare these cultivars at the molecular level are
scarce. The identification of genes conferring favourable traits to
commercial hybrids is highly desirable for the sugarcane industry,
since they could be used as markers for assisted selection.
[0042] The present invention broadly relates to defining a gene
expression profile for SEQ ID NO. 1-203 that facilitates
identification, isolation and characterization of high and low
sucrose content sugarcane plants. The present invention also
relates to defining a gene expression profile for SEQ ID NO:s 1-203
and SEQ ID NO:s 229-373 that is associated with sucrose content
indicating genes that may be useful in the generation of sucrose
enriched plants. Gene expression data can be determined for plants
that can be a progeny derived from crossings (A), commercial
varieties or cultivars (B), or transgenic plants (C).
[0043] With the purpose of selecting plants with high brix (soluble
sugar content), a series of crossings involving Saccharum
officinarum and Saccharum spontaneum genotypes were performed.
First, intra-specific polycrosses were performed among 21 Saccharum
officinarum genotypes and 13 Saccharum spontaneum genotypes (Table
I). Subsequently, the progenies of these independent crossings were
evaluated for their sugar content and the most extreme individuals
intercrossed. A series of recombination and selection events was
promoted thereafter to select two populations with contrasting
sugar accumulation capacities (FIG. 1). Eight genotypes with high
brix (HB) content and eight with low brix (LB) were selected from
the F3 progeny. In the context of the present invention, but not
limited to, the brix difference ranges from 3 to 16. Table II shows
the brix values for the sixteen individuals selected. Leaf+1 and
internodes 1, 5 and 9 were collected. As used herein, leaf+1 is the
first leaf with a visible dewlap and internodes are the plant parts
above ground, with the exception of leaves. Tissues were pooled for
HB and LB independently and total RNA was extracted.
TABLE-US-00001 TABLE I S. officinarum and S. spontaneum genotypes
used for the polycrosses. S. officinarum S. spontaneum Caiana Fita
IN8458 IK76108 IN8488 Lahaina Krakatau MZ151 SES 147b MZ151 roxa
US56158 Sabura US7440 Salangor US851008 Sinimbu UM721 NG213 UM691
Fiji 47 SES 194 Hinahina 18 IK7686 Manjri Red US56193 Muntok Java
US571723 NG77142 Soff 8268 SS601 Sylva NG2880 Vae Vae Ula IJ76315
IN8425
TABLE-US-00002 TABLE II Brix measurements of the 16 individuals
(genotypes) selected for gene expression profiling. Classification
Genotype Brix High Brix CTC98-241 23.00 CTC98-242 23.90 CTC98-243
22.90 CTC98-244 23.40 CTC98-246 22.60 CTC98-252 22.20 CTC98-253
22.50 CTC98-258 22.10 Low Brix CTC98-261 8.60 CTC98-262 9.10
CTC98-265 9.10 CTC98-268 9.35 CTC98-271 10.60 CTC98-272 10.80
CTC98-277 10.60 CTC98-279 10.60
[0044] In a similar experiment, a field-grown F.sub.1 progeny
selected from a cross between the sugarcane varieties SP 80-180 and
SP 80-4966 was characterized. From a total of 500 individuals, we
picked out seven plants with the highest (7HB) and seven with the
lowest (7LB) sugar content. FIG. 2 shows the average values and
standard deviations for soluble solids level (Brix) of the most
mature internode of these two groups of plants along the growing
season (6, 7, 9, 11 and 13 months after planting).
[0045] Additionally, the F1 progeny from a cross between the
sugarcane varieties SP80-144 and SP85-7215 (selected as described
for the cross between varieties SP 80-180 and SP 80-4966), two
varieties precocious and rich in sucrose production (SP91-1049 and
SP94-3166) and two varieties late and poor in sucrose production
(SP83-2847 and SP89-1115) were also analysed. FIG. 6 shows the
sugar content during the growing season in the two sugarcane
cultivars poor and late in sucrose accumulation (SP83-2847 and
SP94-3116) and the two sugarcane cultivars rich and precocious in
sucrose accumulation (SP91-1049 and SP89-1115). For all of these,
brix measures from field-grown plants were taken, leaf tissues were
collected and total RNA was extracted. Table III lists all the
progenies and varieties used in the present invention.
TABLE-US-00003 TABLE III Sugarcane Progenies and varieties used for
molecular marker identification Tissue Plant Age Origin of High
Brix and Low Brix Plants Internode 1 7 months SP80-180 vs SP80-4966
progenies Internode 5 7 months SP80-180 vs SP80-4966 progenies
Internode 9 7 months SP80-180 vs SP80-4966 progenies Internode 1 11
months SP80-180 vs SP80-4966 progenies Internode 5 11 months
SP80-180 vs SP80-4966 progenies Internode 9 11 months SP80-180 vs
SP80-4966 progenies Internode 1 10 months S. spontaneum vs S.
officinarum progenies Internode 5 10 months S. spontaneum vs S.
officinarum progenies Internode 9 10 months S. spontaneum vs S.
officinarum progenies Leaf 10 months SP80-144 vs SP85-7215
progenies Leaf 9 months SP80-180 vs SP80-4966 progenies Leaf 10
months S. spontaneum vs S. officinarum progenies Leaf 7 months
SP83-2847 varieties Leaf 7 months SP91-1049 varieties Leaf 7 months
SP94-3116 varieties Leaf 7 months SP89-1115 varieties Leaf 12
months SP83-2847 variety Leaf 14 months SP83-2847 variety Leaf 16
months SP83-2847 variety Leaf 18 months SP83-2847 variety Internode
1 12 months SP83-2847 variety Internode 1 14 months SP83-2847
variety Internode 1 16 months SP83-2847 variety Internode 1 18
months SP83-2847 variety Leaf 12 months SP94-3116 variety Leaf 14
months SP94-3116 variety Leaf 16 months SP94-3116 variety Leaf 18
months SP94-3116 variety Internode 1 12 months SP94-3116 variety
Internode 1 14 months SP94-3116 variety Internode 1 16 months
SP94-3116 variety Internode 1 18 months SP94-3116 variety Leaf 12
months SP91-1049 variety Leaf 14 months SP91-1049 variety Leaf 16
months SP91-1049 variety Leaf 18 months SP91-1049 variety Internode
1 12 months SP91-1049 variety Internode 1 14 months SP91-1049
variety Internode 1 16 months SP91-1049 variety Internode 1 18
months SP91-1049 variety Leaf 12 months SP89-1115 variety Leaf 14
months SP89-1115 variety Leaf 16 months SP89-1115 variety Leaf 18
months SP89-1115 variety Internode 1 12 months SP89-1115 variety
Internode 1 14 months SP89-1115 variety Internode 1 16 months
SP89-1115 variety Internode 1 18 months SP89-1115 variety
[0046] In parallel, cDNA microarrays were constructed with PCR
products derived from 1857 polynucleotides representing sugarcane
genes from the cDNA libraries produced by the Sugarcane EST
Consortium (SUCEST), providing a platform for comparisons of gene
expression profile. Approximately half of all the signal
transduction genes identified by the Sugarcane Signal Transduction
(SUCAST) project are represented in these arrays (Papini-Terzi et
al., 2005), as well as genes related to general metabolism, stress,
pathogen responses and transcription. The HB (High Brix) and LB
(Low Brix) samples from each progeny or variety tissue were
compared by hybridizing to the arrayed genes. Two replicate
hybridizations were made for each comparison with the dye-swapped
in the second hybridization. To reveal molecular markers of brix
content, hybridizations were done to compare a tissue from the high
brix plant to the same tissue in a low brix plant (Design I). Also,
two high brix varieties and two low brix varieties were compared
(Design II) by performing hybridizations against a common reference
composed of an equimolar mixture of RNA samples from all four
cultivars. Two replicate hybridizations were made for each
comparison with the dye-swapped in the second hybridization.
Additionally, mature and intermediately mature internodes were
compared to immature internodes from both the high brix and the low
brix plants (Design III). Again, two replicate hybridizations were
made for each comparison with the dye-swapped in the second
hybridization. Data analysis was done essentially as described by
Papini-Terzi et al. (2005). Briefly, cut-off limits that define
"differential expression" were calculated based on "self-self"
hybridizations (Vencio and Koide, 2005). To improve data
reliability, only genes with at least 70% consistency in replicate
experiments were considered differentially expressed. A total of
208 SAS (SEQ ID Nos 1-203) were found differentially expressed in
at least one sample when tissues from HB and LB plants were
contrasted. When mature and immature internodes were compared a
total of 140 differentially expressed genes were identified (SEQ ID
Nos 229 to 373). Tables IV and XIII list all of the ESTs
corresponding to each SAS (sugarcane assembled sequence) predicted
to correspond to the same transcript as assembled by the CAP3
program (Vettore et al., 2003) and the predicted assembled
sequence. The ratio values for the microarray signals for each SAS
in each sample is presented in Tables V to IX and Table XIV to XX.
The tables also show the categories and gene functions for each
sequence.
TABLE-US-00004 TABLE IV List of Sugarcane Assembled Sequences (SAS)
and their SEQ ID Nos. SEQ ID No. 1: SCAGFL1089G08.g (CA199089,
CA224271, CA224272) SEQ ID No. 2: SCCCLR2C01G07.g (CA185584,
CA166776, CA134755, CA081538, CA166739, CA155955, CA084974,
CA157742, CA270171, CA159531, CA187781, CA159517, CA089886,
CA084049, CA159619, CA140397, CA087051, CA262468, CA159606,
CA089976, CA183396, CA129456, CA066628, CA166690, CA140819,
CA190385, CA187438, CA208612, CA190989, CA127354, CA140895,
CA106597, CA158530, CA165616, CA157955, CA158357, CA163017,
CA180366, CA156493, CA156721, CA110716, CA162841, CA088522) SEQ ID
No. 3: SCCCRZ1001C01.g (CA186259, CA147312, CA107529, CA283111,
CA275744, CA245497, CA240766, CA217267, CA129544, CA232142,
CA186319, CA132949, CA266299, CA279493, CA239038, CA069036,
CA279491, CA081552, CA172945, CA270762, CA214162, CA155441,
CA208908, CA077560, CA094623, CA080165, CA281654, CA068431,
CA080252, CA253608, CA280034, CA146798, CA149332, CA286419,
CA149406, CA208282, CA168868, CA167581, CA247594, CA245731,
CA264236, CA256980, CA196120, CA166139, CA256260, CA133068,
CA216602, CA096037, CA133422, CA209478, CA172392, CA196703,
CA148592, CA107794, CA078322, CA069441, CA262406, CA164639,
CA117241, CA291436, CA272137, CA156857, CA275745, CA233167,
CA073173, CA294936, CA096560, CA204575, CA190808, CA294814,
CA134607, CA095396, CA294999, CA233246, CA279310, CA272172,
CA121188, CA165918, CA087433, CA152584, CA163918, CA134688,
CA260773, CA232223, CA134035, CA087517, CA078469, CA280895,
CA147004, CA270846, CA285363, CA224721, CA300843, CA085545,
CA193771, CA085617, CA152497, CA147851, CA234786, CA264280,
CA190048, CA264249, CA259379, CA134846, CA284676, CA066363,
CA148782, CA134929, CA094480, CA100929, CA128739, CA230006,
CA257872, CA272842, CA153380, CA088481, CA199337, CA067318,
CA120108, CA257959, CA068501, CA227954, CA156682, CA173310,
CA064714) SEQ ID No. 4: SCEQRT1033F01.g (CA184995, CA156175,
CA130817, CA186778, CA296253, CA162940, CA133313, CA185329,
CA117474, CA186710, CA204874) SEQ ID No. 5: SCEZLR1031G10.g
(CA175202, CA165752, CA167131, CA234178, CA121597, CA067987,
CA118138, CA257467, CA098577) SEQ ID No. 6: SCEZRZ1015G02.g
(CA237872, CA095197, CA148000, CA208159) SEQ ID No. 7:
SCJFRZ2014A03.g (CA068448, CA182636, CA124874, CA151939) SEQ ID No.
8: SCUTST3090E03.g (CA187278, CA185355, CA180421, CA184313,
CA210629) SEQ ID No. 9: SCVPCL6042B11.g (CA179030, CA079210,
CA171761, CA167601, CAC99889) SEQ ID No. 10: SCVPFL3046C06.b
(CA244704, CA169357, CA226883, CA279223, CA226955, CA169444) SEQ ID
No. 11: SCACCL6008H06.g (CA297327, CA096029, CA272424) SEQ ID No.
12: SCACLR1036B06.g (CA116282, CA208326, CA185586, CA161943,
CA208173, CA164611, CA250322, CA141763, CA248417, CA173006,
CA271344, CA248060, CA295677, CA141850, CA115167, CA150326,
CA263624, CA155589, CA172473, CA210572, CA212977, CA071050,
CA223263, CA183780, CA182338, CA123614, CA263704, CA258818,
CA227706, CA185483, CA180358, CA227787, CA183645, CA183050,
CA185991, CA164775, CA187002, CA167583, CA187440, CA294229,
CA247569, CA268117, CA081801, CA175295, CA294155, CA231298,
CA198645, CA181860, CA091352, CA203545, CA234600, CA163160,
CA258992, CA211128, CA186109, CA173482, CA185124, CA194883,
CA262166, CA280273, CA169398, CA224642, CA170802, CA208174,
CA195079, CA169482, CA170947, CA170731, CA279502, CA170881,
CA181104, CA206750, CA294040, CA171028, CA152678, CA257305,
CA293976, CA213043, CA181646, CA187605, CA182139, CA143731,
CA257402, CA193572, CA180425, CA297996, CA180830, CA283968,
CA183965, CA213586, CA194480, CA086671, CA208319, CA075723,
CA194663, CA293330, CA184108, CA075807, CA295739, CA168382,
CA167495, CA212733, CA248494, CA187062, CA182290, CA181789,
CA176860, CA201177, CA081385, CA122294, CA111436, CA181610,
CA081463, CA081454, CA122407, CA172507, CA217801, CA112764,
CA119200, CA205047, CA177228, CA168599, CA217883) SEQ ID No. 13:
SCACLR1126E09.g (CA116458, CA129697, CA118229) SEQ ID No. 14:
SCACLR2007G02.g (CA127563, CA091213, CA254488, CA091132, CA157102)
SEQ ID No. 15: SCACLR2014E12.g (CA192165, CA154258, CA186575,
CA158514, CA127675, CA104491, CA154264, CA097458, CA258945,
CA164635, CA143359, CA186649, CA245697, CA113109, CA231117,
CA271862) SEQ ID No. 16: SCACSB1037A07.g (CA167445, CA204908) SEQ
ID No. 17: SCAGAM2125C01.g (CA082271) SEQ ID No. 18:
SCAGFL1089C03.g (CA232431, CA214773, CA199044, CA226812, CA251426)
SEQ ID No. 19: SCAGLB1070E01.g (CA111450, CA086189, CA214795,
CA174551, BQ804015, CA174968, CA259932, CA072721, CA214876) SEQ ID
No. 20: SCAGLR1043E04.g (CA139075, CA095747, CA163740, CA287933,
CA254860, CA287205, CA276681, CA163825, CA158080, CA159744,
CA166834, CA089831, CA146535, CA107721, CA159823, CA163282,
CA101632, CA271953, CA112877, CA165306, CA116967, CA120230,
CA165312, CA186064) SEQ ID No. 21: SCAGLR1043F02.g (CA290432,
CA292969, CA279534, CA183060, CA183152, CA121646, CA096370,
CA099981, CA192245, CA167424, CA214962, CA125300, CA267241,
CA122577, CA246321, CA214857, CA261846, CA214921, CA120097,
CA122234, CA158059, CA202210, CA273838, CA263626, CA205312,
CA183023, CA263706, CA185079, CA116969, CA275126, CA184998) SEQ ID
No. 22: SCAGLR2026G12.g (CA282277, CA117544, CA173493, CA097993,
CA123854, CA277803, CA276657, CA163057, CA089417, CA123966,
CA150636, CA152810, CA105994, CA124675, CA095504, CA260199,
CA124712, CA288917, CA145237, CA165000, CA167668, CA066913,
CA161175, CA128073, CA128273, CA157707, CA084376, CA143727,
CA143896, CA146035, CA159999, CA128260, CA123367, CA125688,
CA111277, CA081486, CA239639, CA159912, CA224751, CA135227,
CA277229, CA154488, CA114788, CA187359, CA183121, CA137987,
CA125112) SEQ ID No. 23: SCAGSD2042G08.g (CA301419, CA301408,
CA282279, CA282268) SEQ ID No. 24: SCBFFL4114B06.g (CA254510) SEQ
ID No. 25: SCBFFL5074C09.g (CA204004, CA293285, CA203956, CA244892,
CA290019, CA132334, CA244976, CA235410, CA292110, CA239336) SEQ ID
No. 26: SCBFLR1039B05.g (CA072436, CA164922, CA219265, CA294041,
CA087182, CA086094, CA133140, CA082356, CA178376, CA150762,
CA091920, CA261338, CA155935, CA092012, CA084247, CA074480,
CA163545, CA163534, CA264111, CA188825, CA079335, CA188476,
CA087023, CA271843, CA164692, CA161125, CA161569, CA186875,
CA218879, CA147374, CA086305, CA218962, CA247037, CA158661,
CA089106, CA089861, CA154471, CA172672, CA155677, CA157667,
CA240350, CA160822, CA085679, CA142367, CA067697, CA078551,
CA165453, CA193896, CA240083, CA159199, CA117385, CA083799,
CA184601, CA073646, CA087006, CA067781, CA228606, CA157128,
CA165295, CA164303, CA090710, CA157426, CA218214, CA144877,
CA082959, CA082212, CA092766, CA218299, CA082071, CA082361,
CA166357, CA092479, CA155760, CA154412, CA157932, CA080915,
CA089329, CA155569, CA084631, CA084421, CA163520, CA070855,
CA267791, CA070926, CA083685, CA193867, CA164257, CA262071,
CA280355, CA253389, CA151412, CA099704, CA099702, CA091852,
CA103683, CA218228, CA216440, CA076652, CA218313, CA081569,
CA147549, CA092093, CA092327, CA082854, CA160806, CA234098,
CA081072, CA155277, CA081503, CA156306, CA228091, CA165593,
CA084277, CA164984, CA085999) SEQ ID No. 27: SCBFLR1060F03.g
(CA117505, CA090821, CA184876, CA102138) SEQ ID No. 28:
SCBFRZ2046D07.g (CA150681, CA109085, CA179474, CA203314, CA174283)
SEQ ID No. 29: SCBFSB1046D04.g (CA167835) SEQ ID No. 30:
SCBFSB1047C02.g (CA170539, CA208192, CA167900, CA178739) SEQ ID No.
31: SCBFST3136A06.g (CA181757, CA181841, CA204913) SEQ ID No. 32:
SCBGLR1003D06.g (CA222877, CA125433, CA148517, CA123170, CA124367,
CA229025, CA191858, CA150470, CA137422, CA242621, CA067144,
CA107570, CA077924, CA219677, CA117862, CA137913, CA260601,
CA189186, CA191192, CA103772, CA149267, CA111228, CA149344,
CA283660, CA154152, CA153751, CA165134, CA177823, CA228650,
CA287491, CA136728, CA162238, CA164661, CA139437, CA189271,
CA282312, CA121420, CA289514, CA134330, CA259414, CA288712,
CA148333, CA134387, CA221721, CA264749, CA201139, CA113386,
CA078385, CA115600, CA241752, CA106360, CA118148, CA138627,
CA190187, CA115438, CA154012, CA150848, CA071918, CA226319,
CA281964, CA270512, CA146712, CA165133, CA078380, CA241934,
CA138140, CA115533, CA117783) SEQ ID No. 33: SCBGLR1023D05.g
(CA193105, CA188272, CA224873, CA241264, CA300539, CA188009,
CA241339, CA241331, CA133005, CA150388, CA079307, CA185891,
CA079026, CA088897, CA116440, CA073525, CA117725, CA286594) SEQ ID
No. 34: SCBGLR1096E06.g CA131852, CA136715, CA264334, CA198772,
CA181655, CA118258) SEQ ID No. 35: SCBGLR1099G02.g (CA118527,
CA088599) SEQ ID No. 36: SCBGLR1115D10.g (CA236898, CA118948,
CA290199, CA222803, CA247964, CA241212, CA294776, CA213997,
CA223503, CA223512, CA241290, CA077364, CA223593, CA223583,
CA228839, CA237054, CA200849, CA200388, CA238984, CA077442,
CA079128, CA271913) SEQ ID No. 37: SCCCAD1001C08.g (CA213052,
CA064626, CA208782) SEQ ID No. 38: SCCCAD1004H02.g (CA064903,
CA065602, CA196686, CA068322) SEQ ID No. 39: SCCCAM1001A03.g
(CA224922, CA097767, CA289761, CA293310, CA072765, CA177152,
CA082771, CA228990, CA200984, CA071379, CA186832, CA174514,
CA299571, CA285188, CA200732, CA074444, CA070971, CA266681,
CA292024) SEQ ID No. 40: SCCCAM2004G02.g (CA175137) SEQ ID No. 41:
SCCCAM2C04G08.g (CA188572, CA081398, CA083085, CA177802, CA081466)
SEQ ID No. 42: SCCCCL3001F04.g (CA090274, CA218633, CA271564,
CA072795, CA176380, CA212400, CA076605, CA292379, CA176809,
CA261558, CA092442, CA082952, CA171891, CA132285, CA298117,
CA136926, CA205249, CA244356, CA084659, CA174001, CA220841,
CA188161, CA262641, CA084625, CA147909, CA258069, CA130594,
CA268345, CA098011, CA297370, CA147196, CA232960, CA072355,
CA139295, CA103872, CA161619, CA076646, CA192047, CA069119,
CA269782, CA176915, CA202483, CA147582, CA142782, CA077648,
CA092390, CA082458, CA266894, CA230599, CA129577, CA192875,
CA205406, CA195633, CA258918, CA239390, CA195611, CA091961,
CA211152, CA238101, CA082565, CA261071, CA139562,
CA238798, CA267286, CA126957, CA112818, CA258847, CA097943,
CA262159, CA170717, CA070245, CA192180, CA167707, CA147514,
CA176991, CA076215, CA266294, CA071776, CA190170, CA261881,
CA082649, CA167116, CA200225, CA166545, CA174720, CA180863,
CA098735, CA078299, CA080135, CA137514, CA084364, CA146987,
CA130332, CA078373, CA215588, CA179346, CA079412, CA147435,
CA187943, CA179432, CA179450, CA167646, CA117675, CA147627,
CA279536, CA123234, CA251889, CA209472, CA094022, CA093214,
CA235526, CA066029, CA291616, CA270178, CA088732, CA079067,
CA210802, CA173849, CA208418, CA147384, CA249228, CA205005) SEQ ID
No. 43: SCCCCL3002C09.b (CA164754, CA192507, CA149213, CA260796,
CA187083, CA101050, CA232366, CA230776, CA285317, CA299708,
CA232454, CA168679, CA122474, CA179836, CA117294, CA122512,
CA123772, CA254900, CA183002, CA127885, CA168911, CA071983,
CA236670, CA266142, CA109668, CA168996, CA094485, CA273741,
CA182273, CA300109, CA259484, CA109752, CA266217, CA095537,
CA105282, CA190305, CA273812, CA095612, CA174112, CA102333,
CA222873, CA241526, CA234235, CA169388, CA138129, CA247699,
CA259138, CA169473, CA189915, CA232514, CA174741, CA221599,
CA174821, CA195129, CA205165, CA136996, CA078205, CA189405,
CA235587, CA098138, CA116327, CA114878, CA191259, CA300967,
CA191089, CA235666, CA183278, CA145262, CA137898, CA156970,
CA121379, CA095453, CA134465, CA138724, CA129675, CA134544,
CA174648, CA123308, CA137470, CA228406, CA125187, CA179729,
CA145327, CA179613, CA116680, CA134096, CA185020, CA097986,
CA241590, CA120065, CA098133, CA300763, CA248222, CA114920,
CA140135, CA260971, CA206920, CA069768, CA135583, CA241001,
CA126239, CA254670, CA104750, CA225281, CA205773, CA158716,
CA177253, CA135668, CA069844, CA176685, CA104833, CA179725,
CA175015, CA093273, CA156663, CA144277, CA077356, CA139207,
CA077433, CA156162, CA233672, CA289617, CA136244, CA092631,
CA121367, CA166600, CA285273, CA096245, CA174136, CA131526,
CA127387, CA243490, CA107152, CA130718, CA234183, CA139986,
CA242827, CA295952, CA127931, CA130008, CA134095, CA138704,
CA083624, CA291487, CA217158, CA140705, CA176381, CA300124,
CA225694, CA269792, CA142766, CA244765, CA072024, CA208843,
CA140774, CA142408, CA244840, CA240123, CA294166, CA131496,
CA242966, CA183794, CA078230, CA294108, CA171510, CA070363,
CA084393, CA243058, CA238566, CA130322, CA275283, CA149534,
CA070447, CA086950, CA275350, CA145273, CA103468, CA186854,
CA101246, CA127499, CA113173, CA255273, CA228952, CA180533,
CA188382, CA280222, CA179960, CA145293, CA205177, CA301035,
CA127828) SEQ ID No. 44: SCCCCL3080A11.b (CA195011, CA186362,
CA296480, CA296654, CA275397, CA290669, CA282198, CA221529,
CA275467, CA135001, CA167417, CA290056, CA148875, CA076391,
CA242540, CA141300, CA287167, CA076476, CA176410, CA080697,
CA252988, CA184697, CA242340, CA200871, CA179397, CA253071,
CA185063, CA159627, CA284239, CA185199, CA159286, CA291109,
CA179461, CA248226, CA086290, CA176240, CA191934, CA245914,
CA278165, CA103412, CA152746, CA230916, CA245835, CA242649,
CA230990, CA132349, CA287873, CA166292, CA273797, CA160174,
CA274023, CA122335, CA273788, CA092884, CA091203, CA154817,
CA276231, CA136820, CA287241, CA207749, CA276377, CA066806,
CA122402, CA159765, CA276035, CA296496, CA279832, CA271356,
CA091503, CA215068, CA129109, CA116743, CA121331, CA290328,
CA285668, CA287690, CA232825, CA069961, CA076390, CA101186,
CA240902, CA180980, CA076475, CA226125, CA283780, CA283709,
CA159661, CA182917, CA202160, CA065119, CA155633, CA218498,
CA217558, CA288910, CA130058, CA169110, CA249436, CA190722,
CA282286, CA169189, CA149394, CA176923, CA148689, CA123410,
CA197169, CA174886, CA202258, CA181623, CA153982, CA263764,
CA274086, CA111644, CA093560, CA273768, CA112839, CA093040,
CA065124, CA137999, CA264537) SEQ ID No. 45: SCCCCL3120C09.g
(CA164701, CA224926, CA093647, CA083169, CA111541, CA083168,
CA093732, CA122320, CA265053, CA157947, CA122415, CA122420,
CA273041, CA164238, CA130292, CA121753, CA161184, CA087082,
CA090483, CA072914) SEQ ID No. 46: SCCCCL3120G07.g (CA126728,
CA185585, CA206387, CA125243, CA265002, CA185315, CA245734,
CA180717, CA067294, CA091012, CA181272, CA244870, CA264526,
CA106164, CA199596, CA180607, CA236822, CA104054, CA244956,
CA125117, CA180803, CA067314, CA104139, CA224603, CA279337,
CA099590, CA142258, CA168155, CA094223, CA266351, CA180794,
CA231617, CA209380, CA093688, CA125829, CA187261, CA187424,
CA261208, CA067342, CA226296, CA189470, CA067295, CA168751,
CA090956, CA184722, CA178676, CA211245, CA239943, CA107492) SEQ ID
No. 47: SCCCCL4002E02.g (CA116501, CA215472, CA157057, CA272126,
CA132749, CA282608, CA185323, CA134724, CA131522, CA298731,
CA172476, CA093967, CA157851, CA177663, CA265966, CA164160,
CA157052, CA145182, CA184790, CA069776, CA222319, CA156078,
CA190828, CA140192, CA133240, CA211567, CA166155, CA067205,
CA195541, CA091963, CA172143, CA089803, CA163027, CA090747,
CA191514, CA139123, CA162363, CA225047, CA109794) SEQ ID No. 48:
SCCCCL4005F05.g (CA280584, CA301445, CA101272, CA094199, CA251241,
CA287651, CA277095, CA217700) SEQ ID No. 49: SCCCCL6002B05.g
(CA235513, CA140487, CA095693, CA183575, CA187535, CA270075,
CA259493, CA262265, CA181192, CA279039) SEQ ID No. 50:
SCCCCL6003D08.g (CA261317, CA207685, CA249487, CA295361, CA295292,
CA176975, CA249563, CA259708, CA096709) SEQ ID No. 51:
SCCCFL4094H12.g (CA235328, CA253578) SEQ ID No. 52: SCCCLB1001D03.g
(CA070103, CA233451, CA280144, CA161397, CA073973, CA246052,
CA266278, CA187448, CA087616, CA105439, CA292489, CA289895,
CA251852, CA112903, CA217956, CA110778, CA193638, CA079528,
CA109891, CA157072) SEQ ID No. 53: SCCCLB1003E11.g (CA183789,
CA280103, CA133961, CA139899, CA070532, CA110960, CA153393,
CA133885, CA263460, CA115969, CA153912, CA115964, CA271209,
CA135793, CA271124, CA186641, CA170726, CA186568) SEQ ID No. 54:
SCCCLR1001A06.g (CA190346, CA248924, CA092763, CA083592, CA188740,
CA077113, CA116115, CA158015, CA121535, CA204604, CA216472,
CA105973) SEQ ID No. 55: SCCCLR1001E04.g (CA286692, CA185203,
CA283556, CA297496, CA283763, CA107947, CA281797, CA273397,
CA288055, CA182167, CA272567, CA275912, CA115183, CA261160,
CA169335, CA275587, CA116155, CA276409, CA275516, CA113912,
CA180802, CA281743, CA169255, CA275068, CA283676, CA274801,
CA185414, CA288928, CA297998, CA276051, CA247335, CA278026,
CA276440, CA295185, CA110175, CA182175, CA281251, CA287476,
CA277138, CA277597, CA281255, CA277512, CA170522, CA282815,
CA216931, CA208645, CA208714, CA117824, CA119303, CA295245,
CA210512, CA297891, CA180801, CA284125, CA275675, CA301424,
CA285422, CA182158, CA286170, CA182550, CA284723, CA286095,
CA282404, CA274292, CA183110) SEQ ID No. 56: SCCCLR1022B11.g
(CA262370, CA175573, CA283139, CA282225, CA175736, CA098979,
CA274092, CA283705, CA234778, CA090105, CA291719, CA234765,
CA149808, CA156650, CA184954, CA162473, CA165344, CA283982,
CA145397, CA227663, CA217233, CA193153, CA098173, CA170572,
CA168929, CA133676, CA119647, CA096824, CA169015, CA181636,
CA176861, CA108797, CA095801, CA102799, CA168953, CA142627,
CA140623, CA150372, CA211448, CA065362, CA283916, CA262588,
CA296130, CA137717, CA144579, CA281526, CA097927, CA260822,
CA178228, CA099128, CA192194, CA301126, CA135072, CA179839,
CA150376, CA234766, CA297660, CA281655, CA176409, CA273865,
CA297545, CA284140, CA297734, CA098177, CA073430, CA259653,
CA136165, CA135273, CA153599, CA181778, CA282925, CA153678,
CA070825, CA144282, CA296412, CA097932) SEQ ID No. 57:
SCCCLR1022F10.g (CA233639, CA260053, CA185523, CA222669, CA095561,
CA167708, CA222802, CA278697, CA175743, CA221789, CA121319,
CA177308, CA299149, CA273209, CA244627, CA215981, CA178001,
CA066057, CA244686, CA234654, CA297895, CA179682, CA207766,
CA186315, CA194047, CA233580, CA186380, CA269743, CA186727,
CA179261, CA186798, CA146095, CA229185, CA239458, CA240513,
CA221284, CA118249, CA276970, CA253631, CA163389, CA194377,
CA184587, CA138682, CA083453, CA186061, CA168226, CA289825,
CA261002, CA279246, CA099796, CA254874, CA222389, CA269896,
CA133477, CA221786, CA298984, CA256819, CA167056, CA181465,
CA164471, CA222384, CA178907, CA244604, CA118336, CA266032,
CA118095, CA084230, CA280986, CA258373, CA266089, CA250738,
CA193208, CA122349, CA185474, CA119690, CA175851, CA103705,
CA099948, CA299982, CA276941, CA298487, CA148104, CA187876,
CA107311, CA066053, CA273213, CA137497, CA222054, CA182618,
CA244395, CA273241, CA244475, CA257856, CA205271, CA085415,
CA192092, CA097961) SEQ ID No. 58: SCCCLR1024A02.g (CA177199,
CA178859, CA148547, CA271595, CA165098, CA191796, CA284535,
CA119371, CA257923, CA284457, CA139287) SEQ ID No. 59:
SCCCLR1024C03.g (CA214530, CA092678, CA259139, CA119392, CA138689,
CA142234, CA110468, CA166793, CA235001, CA239014, CA187582,
CA153171, CA166778, CA229316, CA108240, CA142532, CA231084,
CA122112, CA249179, CA267413, CA116485, CA188769, CA130021,
CA193695, CA073718, CA205841, CA183536, CA161063, CA206262,
CA235000, CA190341, CA202723, CA090059, CA090058, CA236017,
CA082031, CA187867, CA155918, CA103108, CA070579, CA079479,
CA110879, CA119822) SEQ ID No. 60: SCCCLR1048D07.g (CA147475,
CA291066, CA096819, CA204869, CA181487, CA192930, CA209156,
CA067272, CA147995, CA244339, CA180480, CA171800, CA284134,
CA196820, CA244421, CA243578, CA182300, CA186405, CA186430,
CA283235, CA179955, CA184880, CA186482, CA145597, CA186507,
CA208666, CA197511, CA175966, CA145686, CA256333, CA204958,
CA209389, CA101793, CA101156, CA221552, CA181039, CA166999,
CA180658, CA256408, CA253875, CA192877, CA197390, CA166969,
CA093997, CA240271, CA205247, CA182628, CA181383, CA099255,
CA146394, CA070562, CA213081, CA185160, CA070652, CA070769,
CA180031, CA291102, CA170929, CA204905, CA132911, CA218801,
CA134618, CA171253, CA206709, CA167078, CA222191, CA134393,
CA244769, CA298008, CA133579, CA140427, CA221930, CA171805,
CA147956, CA145072, CA115358, CA168857, CA145152, CA221551,
CA254585, CA222208, CA193664, CA168945, CA135732, CA106240,
CA288063, CA067331, CA105045, CA182416, CA253889, CA267756,
CA211247, CA197638, CA122733, CA220849, CA217920, CA217294,
CA159483, CA267841, CA122809, CA064754, CA168537, CA205015,
CA217367, CA212148, CA195018, CA141826, CA173132, CA185041,
CA152829, CA183112, CA222487, CA066599, CA244066, CA165764,
CA096242, CA207168, CA187102, CA121886, CA172779, CA232513,
CA221622, CA163385, CA187635, CA165823, CA108173, CA216201,
CA196736, CA145978, CA253253, CA143737, CA220822,
CA066971, CA137693, CA192288, CA169323, CA149105, CA235200,
CA133460, CA231421, CA256401, CA155413, CA115687, CA231501,
CA065787, CA066028, CA130814, CA166921, CA195510, CA065872,
CA119495, CA211215, CA234020, CA097049, CA110451, CA219727,
CA130446, CA107579, CA104154, CA170754, CA169355, CA138200,
CA167435, CA192429, CA190819, CA138088, CA170937, CA187379,
CA222270, CA169442, CA256336, CA171875, CA289972, CA204877,
CA133091, CA253873, CA146649, CA171683, CA174259, CA182738,
CA180326, CA146716, CA132203, CA157422, CA192841, CA257875,
CA180828, CA157372, CA234853, CA112786, CA181526, CA205074,
CA186020, CA194299, CA217863, CA185113, CA211872, CA121463,
CA133052, CA173016, CA068878, CA195370, CA170626, CA070371,
CA216657, CA068962, CA243574, CA171193, CA216340, CA297779,
CA182680, CA067729, CA180065, CA207908, CA067811, CA180150) SEQ ID
No. 61: SCCCLR1048F03.g (CA127113, CA065075, CA127212, CA277499,
CA129554, CA121603, CA121408, CA125178, CA127440, CA276807,
CA126903, CA283043, CA236098, CA097364, CA118155, CA281809,
CA070362, CA297080, CA278048, CA121485, CA301525, CA116435,
CA120637, CA284860, CA277432, CA276771, CA189482, CA124010,
CA276938, CA120532, CA288405, CA122385, CA276469, CA215504,
CA065010, CA275948, CA126086, CA208335, CA209295, CA210653,
CA126762, CA219057, CA127157, CA072321, CA125785, CA206577,
CA190063, CA284449, CA070651, CA285051, CA065024, CA120482,
CA117975, CA208190, CA129193, CA289201, CA168876, CA289063,
CA096730, CA128766, CA282961, CA189708, CA285413, CA067943,
CA275056, CA065005, CA274114, CA276236, CA067075, CA126585,
CA126946, CA193276, CA177371, CA286524, CA281416, CA176878,
CA301261, CA120733, CA267336, CA190241, CA119190, CA297298,
CA116632, CA117265, CA276973, CA125066, CA119744, CA227317,
CA279870, CA124816, CA285933, CA121585, CA212660, CA173116,
CA125319, CA282719, CA212404, CA284489, CA066031, CA285534,
CA285189, CA118289, CA284558, CA119511, CA274189, CA065095,
CA129555, CA283138, CA283217, CA285867, CA124018, CA281823,
CA296966, CA288144, CA123645, CA126639, CA278851, CA297029,
CA117985, CA296567, CA195886, CA068236, CA219344, CA065081,
CA208255, CA129812, CA296642, CA126079, CA068319, CA129203,
CA125738, CA276707, CA194608, CA282969, CA122439, CA122553,
CA276334, CA281049, CA281213, CA208478, CA265249) SEQ ID No. 62:
SCCCLR1065F03.g (CA119768, CA180227) SEQ ID No. 63: SCCCLR1066G08.g
(CA130183, CA119863, CA190094, CA189956, CA118906, CA129694) SEQ ID
No. 64: SCCCLR1068D03.g (CA131141, CA282509, CA101490, CA156675,
CA119997, CA266674, CA131210, CA107609, CA265499) SEQ ID No. 65:
SCCCLR1C02F07.g (CA288961, CA273685, CA256939, CA112913, CA107999,
CA276603, CA241855, CA085479, CA193799, CA252891, CA097052,
CA257482, CA203818, CA239070, CA266548, CA099488, CA252672,
CA202292, CA279439, CA187630, CA298704, CA125723, CA251524,
CA179558, CA177714, CA119975, CA276149, CA128085, CA264406,
CA124059, CA247506, CA246266, CA222791, CA100437, CA252417,
CA189608, CA225806) SEQ ID No. 66: SCCCLR1C03G01.g (CA114535,
CA287070, CA203793, CA113049, CA227918, CA143767, CA239356,
CA111397, CA177088, CA130728, CA189457, CA164190, CA236768,
CA141069, CA122177, CA110741, CA276010, CA072413, CA272629,
CA174772, CA256494, CA077651, CA269728, CA178457, CA115111,
CA287055, CA126217, CA193225, CA178389, CA247689, CA228551,
CA138141, CA227995, CA286643, CA189695, CA256499, CA228805,
CA106329, CA202331, CA141201, CA142188, CA123003, CA256606,
CA097345, CA167647, CA290389, CA154610, CA081435, CA256686,
CA126629, CA115110, CA151805, CA081363, CA167055, CA235116,
CA133295, CA148899, CA173127, CA099540, CA148811, CA192344,
CA235424, CA272042, CA147268) SEQ ID No. 67: SCCCLR1C03H09.g
(CA194061, CA211639, CA280503, CA116278, CA077744, CA211491,
CA209038, CA100317, CA072278, CA096295, CA132466, CA250830,
CA292901, CA255776, CA065950, CA160220, CA106513, CA097514,
CA098595, CA104618, CA131327, CA119740, CA264663, CA299848,
CA218570, CA183289, CA097825, CA158831, CA135080, CA100314,
CA132712, CA100433, CA193691, CA138566, CA103770, CA189715,
CA160835, CA134464, CA167292, CA196381, CA172852, CA155853,
CA084870, CA180963, CA155411, CA156712, CA154796, CA139279,
CA163490, CA284118, CA156681, CA110548, CA248342, CA208017,
CA169428, CA233919, CA204384, CA295171, CA179262, CA275173,
CA100318, CA272098, CA196446, CA244403, CA220478, CA210201,
CA218571, CA117867, CA096983, CA132497, CA122468, CA251047,
CA136481, CA138022, CA211494, CA190471, CA175863, CA209234,
CA143825, CA133828, CA067734, CA180756, CA137429, CA103045,
CA100994, CA068413, CA234182, CA227939, CA263768, CA273411,
CA205106) SEQ ID No. 68: SCCCLR1C04C02.g (CA125668, CA125865,
CA189739, CA125492) SEQ ID No. 69: SCCCLR1C04G08.g (CA244725,
CA238883, CA238483, CA199706, CA117832, CA204153, CA261571,
CA167779, CA176803, CA189784, CA193796, CA276132) SEQ ID No. 70:
SCCCLR1C05B03.g (CA143788, CA143875, CA143787, CA143708, CA101128,
CA143785, CA157761, CA250652, CA185977, CA183646, CA120887,
CA189812, CA287301) SEQ ID No. 71: SCCCLR1C05B07.g (CA165238,
CA208083, CA066000, CA126133, CA201529, CA116306, CA122356,
CA295947, CA160571, CA120466, CA122884, CA211355, CA071582,
CA264046, CA155655, CA085182, CA225540, CA066152, CA122081,
CA177997, CA176532, CA071498, CA221498, CA171047, CA279593,
CA189816, CA242630, CA092278, CA125314, CA170969, CA281472,
CA081806, CA160840, CA272348, CA233103, CA204708, CA280170,
CA198137, CA233033, CA118959, CA165234, CA086800, CA123824,
CA258260, CA128698, CA140416, CA284775, CA201691, CA192826,
CA189953, CA132444, CA198335, CA091105, CA091933, CA201610,
CA121611, CA207356, CA259590) SEQ ID No. 72: SCCCLR1C05G07.g
(CA297138, CA290571, CA262529, CA220559, CA204203, CA069404,
CA115586, CA193158, CA121039, CA174217, CA115870, CA174293,
CA104946, CA274619, CA220266, CA142369, CA242315, CA160721,
CA158160, CA210774, CA218047, CA233747, CA278657, CA128109,
CA152442, CA184091, CA100098, CA097713, CA103537, CA217191,
CA196047, CA274571, CA272485, CA069076, CA196586, CA261588,
CA142478, CA202565, CA108110, CA084880, CA257882, CA229994,
CA196659, CA066247, CA133689, CA297542, CA173977, CA182109,
CA202628, CA230076, CA086869, CA219503, CA073403, CA098116,
CA173463, CA204754, CA186033, CA233775, CA101254, CA214205,
CA095524, CA069310, CA128718, CA069189, CA203720, CA243929,
CA287679, CA284184, CA262863, CA261604, CA123605, CA119184,
CA284257, CA202222, CA119783, CA196568, CA259819, CA172217,
CA196643, CA068643, CA104586, CA271898, CA222538, CA091523,
CA264674, CA193641, CA104655, CA132878, CA125332, CA156254,
CA069514, CA300556, CA176289, CA070284, CA189868, CA070369,
CA195256, CA147140, CA089091, CA234689, CA066214, CA067046,
CA192673, CA269296, CA243676, CA067124, CA264162, CA263530,
CA160302, CA157527, CA207879, CA249440, CA104497, CA193097,
CA104395, CA294629, CA117002, CA104480, CA211739, CA261852,
CA126214, CA108276, CA099770, CA111230, CA166005, CA254045,
CA132264, CA268441, CA132728, CA290796, CA173401, CA196261,
CA272490, CA233980, CA260947, CA193010, CA225272, CA290862,
CA252690, CA070750, CA114221, CA070826, CA066738, CA172334,
CA229793, CA267884, CA224989, CA207706, CA229890, CA156552,
CA192222, CA190669, CA160369, CA275764, CA066572, CA216926,
CA165930, CA244384, CA291738, CA223497, CA286984, CA178039,
CA244462, CA208957, CA240296, CA067855, CA263436, CA181579,
CA223577, CA146490, CA249333, CA185057, CA201456, CA211242,
CA144460, CA157071, CA193340, CA097777, CA194601, CA214431,
CA098121, CA295608, CA127853, CA138257, CA138018, CA218660,
CA141681, CA221859, CA218738, CA185406, CA197336, CA100940,
CA197241, CA284997, CA291940, CA159153, CA240718, CA215992,
CA225524, CA210365, CA159221, CA264160, CA235294, CA159304,
CA248608, CA186071, CA211758, CA069425, CA110260, CA072797,
CA105702, CA120991, CA100099, CA105781, CA244089, CA266283,
CA208917, CA177938, CA167214, CA181492, CA146602, CA065458,
CA183802, CA295110, CA183809, CA104306, CA227708, CA183876,
CA267695, CA181557, CA158128, CA104378, CA267781, CA183921,
CA227789, CA147775, CA262173, CA147225, CA164441, CA186580,
CA300171, CA264964, CA166300, CA186652, CA204896, CA285255,
CA226022, CA217982, CA224315, CA105942, CA158616, CA297551,
CA117447, CA220364, CA168851, CA276987, CA190237, CA106022,
CA116056, CA264622, CA184486, CA271818, CA168430, CA189345,
CA233898, CA172815, CA155992, CA206379, CA166234, CA187152,
CA212298, CA099983, CA204961, CA273020, CA169701, CA284310,
CA180342, CA064888, CA183975, CA284388, CA262319, CA186021,
CA248789, CA262273, CA282426, CA177536, CA248866, CA212699,
CA110479, CA176162, CA144804, CA141216, CA275881, CA176238,
CA184086, CA141296, CA224239, CA204895, CA276923, CA197046,
CA221422, CA068719, CA068789, CA144258, CA183632, CA130681,
CA136685, CA184391, CA112468, CA183495, CA103881, CA211815,
CA204894, CA293260, CA099929, CA094118, CA284494, CA254873,
CA135620, CA190021, CA284622, CA192812, CA135705, CA068304,
CA103086, CA155097, CA173863, CA068377, CA110653, CA255712,
CA209951, CA185502, CA278212, CA117995, CA255796, CA168934,
CA098017, CA219302, CA257679, CA169019, CA278196, CA105166,
CA101795, CA087846, CA193447, CA270003, CA105242, CA191196,
CA266313, CA288753, CA257281, CA282991, CA096227, CA068749,
CA197855, CA065529, CA222362, CA243507, CA068817, CA065600,
CA118181, CA068718, CA238905, CA273579, CA213371, CA166910,
CA185022, CA122534, CA158024, CA068788, CA070547, CA065590,
CA064671, CA183774, CA164793, CA119888, CA091778, CA202473,
CA082838, CA138229, CA099466, CA191901, CA124125, CA164484,
CA261289, CA243775, CA172637, CA253160, CA067154, CA172720,
CA097408, CA160296, CA253234, CA273519, CA067231, CA129930,
CA097192, CA126132, CA126138, CA127189, CA295338, CA206463,
CA067398, CA099677, CA097714, CA124424, CA294414, CA180655,
CA294483, CA268542, CA211287, CA168728, CA268608, CA147090,
CA117060, CA297065, CA193107, CA195812) SEQ ID No. 73:
SCCCLR1C08G10.g (CA242767, CA121427, CA190110, CA265913, CA256539,
CA230257) SEQ ID No. 74: SCCCLR2001H09.g (CA296017, CA073224,
CA150710, CA161861, CA275518, CA121510, CA236217, CA121324,
CA106856, CA275589, CA105456, CA186919, CA115199, CA072158,
CA105535, CA198312, CA279139, CA267315, CA088244, CA228873,
CA199179, CA117254, CA110928, CA120536, CA172530, CA188752,
CA127047, CA079583, CA114477, CA074802, CA236212, CA208088,
CA074878, CA214679, CA152717, CA292362, CA109321, CA121262,
CA236850, CA257917, CA109407, CA131450, CA170188, CA117821,
CA249112, CA073701, CA165055, CA280305) SEQ ID No. 75:
SCCCLR2002E04.g (CA189063, CA103400, CA105310, CA257545, CA074280,
CA081249, CA225565, CA111480, CA200578, CA205658, CA172577,
CA107282, CA203202, CA110134, CA086789, CA075665,
CA119351, CA175412, CA278217, CA262185, CA289641, CA297337,
CA178188, CA110401, CA071940, CA256334, CA073443, CA271459,
CA114734, CA214806, CA277079, CA150950, CA112857, CA201428,
CA190220, CA290653, CA189454, CA115238, CA127110, CA112237,
CA300604, CA178184, CA129133, CA178175, CA286335, CA212524,
CA213221, CA223367, CA077677, CA210590, CA251136, CA223442,
CA255159, CA124471, CA104032, CA206849, CA200562, CA278797,
CA278234, CA121278, CA295565, CA207628, CA249525, CA091812,
CA187657, CA216232, CA124525, CA177704, CA211004, CA238405,
CA220308) SEQ ID No. 76: SCCCLR2002F08.g (CA211650, CA110492,
CA148400, CA300475, CA150508, CA150497, CA300102, CA300257,
CA095819, CA104906, CA091149, CA153754, CA258870, CA269965,
CA297954, CA065422, CA174959, CA194403, CA106313, CA139292,
CA248471, CA282371, CA168458, CA300988, CA166296, CA067041,
CA288473, CA180947, CA067119, CA065892, CA162857, CA272827,
CA296238, CA274958, CA114610, CA273634, CA127125, CA260192,
CA300615, CA285686, CA152730, CA082206, CA105905, CA285436,
CA070842, CA218583, CA168512, CA070916, CA101647, CA295802,
CA211573, CA262162, CA132706, CA287764, CA285726, CA272603,
CA196573, CA273889, CA105900, CA296728, CA262057, CA162541,
CA064764, CA297035, CA297113, CA225722, CA125625, CA281507,
CA129167, CA288837, CA106118, CA287900, CA177953, CA124483,
CA128800, CA218582, CA276318, CA287392, CA278517, CA218499,
CA218007, CA299081, CA295773, CA207196, CA145252, CA150651,
CA261878, CA107256, CA155204, CA155181, CA296047, CA085447,
CA127248, CA171611, CA300905, CA274697, CA184257, CA278069,
CA275866, CA070109, CA141467, CA070191, CA152802, CA287858,
CA190605, CA154302, CA199564, CA283532, CA209584, CA296251,
CA291158, CA064871, CA102133, CA275969, CA141502, CA275504,
CA141819, CA275580, CA106944, CA120936, CA150645, CA118413,
CA274736, CA296185, CA223170, CA208853, CA283624, CA067879,
CA107873, CA264649, CA288282, CA138280, CA148571, CA276218,
CA260193) SEQ ID No. 77: SCCCLR2002H11.g (CA127148, CA113376,
CA090822, CA175277, CA144706, CA191342, CA249121, CA112140) SEQ ID
No. 78: SCCCLR2003E10.g (CA261916, CA072670, CA127180, CA082686,
CA098222, CA072679, CA227230, CA230364, CA102583, CA131720) SEQ ID
No. 79: SCCCLR2C01F06.g (CA125903, CA130165, CA127342, CA123725)
SEQ ID No. 80: SCCCLR2C02A05.g (CA116671, CA130253) SEQ ID No. 81:
SCCCLR2C02D03.g (CA262689, CA083750, CA101533, CA177058, CA236874,
CA100362, CA128908, CA171906, CA102805, CA115056, CA127401,
CA146627, CA158448, CA098804, CA146619, CA258980, CA215587,
CA265819, CA265880, CA212035, CA261941, CA071913, CA267912,
CA154469, CA079309, CA174463, CA118147, CA146622, CA273451,
CA117370, CA267710, CA188407, CA122342) SEQ ID No. 82:
SCCCRT1001E01.g (CA145556, CA265124, CA140467, CA259428, CA269652,
CA132841, CA253363, CA298816, CA258474, CA265609, CA240255,
CA185830, CA130669, CA139431, CA130399, CA260672, CA138292,
CA218105, CA266538, CA269994, CA218177, CA258974, CA145910,
CA190685, CA221999, CA190860, CA259945, CA080912, CA278886,
CA264789, CA145914, CA107290, CA273194, CA260082, CA137145,
CA265723, CA145474, CA131856, CA265716) SEQ ID No. 83:
SCCCRT2002G11.g (CA098113, CA259292, CA167710, CA160985, CA167765,
CA277212, CA301138, CA252372, CA264993, CA166058, CA174697,
CA080916, CA298478, CA108271, CA213368, CA173993, CA211356,
CA158908, CA162533, CA194961, CA184093, CA096644, CA161001,
CA300513, CA144742, CA229700, CA266477, CA092549, CA193396,
CA197153, CA096270, CA267077, CA174874, CA298338, CA158349,
CA214804, CA136971, CA263769, CA225513, CA214883, CA157020,
CA263846, CA281339, CA164770, CA160919, CA203458, CA290101,
CA161006, CA114942, CA289802, CA195261, CA298479, CA198016,
CA197064, CA298238, CA171959, CA172546, CA273048, CA299633,
CA137199, CA156278, CA160900, CA194153, CA265809, CA160988,
CA247104, CA174172, CA265871, CA191620, CA198789, CA175182,
CA141419, CA174246, CA256737, CA123842, CA171971, CA172544,
CA109630, CA163657, CA174143, CA256660, CA217966, CA109716,
CA268027, CA157316, CA295099) SEQ ID No. 84: SCCCRZ1001F02.g
(CA103948, CA150083, CA259661, CA300458, CA260819, CA115748,
CA132394, CA139574, CA150333, CA137265, CA174881, CA276459,
CA187808, CA162788, CA225541, CA236121, CA272799, CA143215,
CA086510, CA126049, CA140320, CA190692, CA214128, CA293279,
CA232739, CA288829, CA232827, CA205598, CA154561, CA258276,
CA137338, CA285532, CA128190, CA142456, CA201134, CA132162,
CA228245, CA126555, CA071690, CA209954, CA143470, CA248359,
CA200342, CA115266, CA136159, CA207491, CA279420, CA272494,
CA229717, CA287861, CA289897, CA292215, CA288557, CA123136,
CA106015, CA109649, CA124195, CA256039, CA106083, CA259023,
CA109734, CA182936, CA146835, CA267500, CA260093, CA161128,
CA213896, CA260715, CA247923, CA260696, CA232980, CA235230,
CA161214, CA233046, CA183253, CA106339, CA205597, CA226389,
CA213070, CA085049, CA118942, CA065078, CA265611, CA065008,
CA284023) SEQ ID No. 85: SCCCRZ1001H05.g (CA145736, CA287892,
CA192135, CA146862, CA234792, CA101303, CA204402, CA151180,
CA119789, CA288119, CA151262, CA080448, CA145653, CA095725) SEQ ID
No. 86: SCCCRZ1002E08.g (CA179035, CA191340, CA233483, CA300253,
CA085975, CA269763, CA262601, CA236263, CA070203, CA086063,
CA190618, CA085969, CA300380, CA120960, CA294874, CA180727,
CA292085, CA301489, CA086058, CA273085, CA131694, CA285350,
CA182564, CA244750, CA238660, CA244829, CA243124, CA180028,
CA144527, CA228073, CA159113, CA260317, CA161623, CA185003,
CA184781, CA101457, CA136411, CA287945, CA269808, CA299418,
CA142515, CA174197, CA128767, CA268523, CA174275, CA282823,
CA146924, CA251224, CA172558, CA131340, CA200210, CA228169,
CA184495, CA201598, CA178951, CA130651, CA183353) SEQ ID No. 87:
SCCCRZ1002H08.g (CA279826, CA135036, CA124184, CA076729, CA240511,
CA076725, CA146959, CA291640, CA146710, CA066324, CA122936,
CA203952, CA156670, CA162985, CA245296, CA278468, CA117478,
CA184525, CA207771, CA116304, CA240781) SEQ ID No. 88:
SCCCRZ1004H12.g (CA216874, CA081561, CA106731, CA251585, CA066538,
CA114810, CA148014, CA114649, CA267565, CA267650, CA088912,
CA149128, CA227151, CA105454, CA125437, CA269856, CA187518,
CA066036, CA286910, CA265042, CA234010, CA160780, CA185108,
CA149229, CA110623, CA264544, CA095591, CA150496, CA111584,
CA176699, CA140671, CA108165, CA123092, CA283700, CA287402,
CA167981, CA064988, CA275544, CA177425, CA141224, CA275615,
CA211803, CA125932, CA212296, CA141306, CA191643, CA140689,
CA279161, CA079659, CA240039, CA159148, CA174083, CA067685,
CA198561, CA143599, CA267523, CA097307, CA067769, CA267610,
CA101896, CA096607, CA124965, CA248186, CA124435, CA108814,
CA134608, CA192137, CA108989, CA134689, CA166683, CA094488,
CA291849, CA109073, CA153798, CA147144, CA299990, CA173707,
CA267553, CA225467, CA273321, CA110109, CA267638, CA104185,
CA161871, CA290349, CA270432, CA163555, CA154762, CA222553,
CA270296, CA166573, CA108407, CA182036, CA164299, CA202506,
CA075284, CA225393, CA277703, CA202590, CA102086, CA110611,
CA065056, CA233782, CA197286, CA229575, CA277050, CA157909,
CA277094, CA140749, CA137396, CA196896, CA282885, CA239918,
CA301434, CA196962, CA164275, CA084201, CA275533, CA145361,
CA234812, CA275603, CA081143, CA186963, CA195293, CA131246,
CA163061, CA180624, CA120533, CA181897, CA192846, CA159009,
CA067687, CA225503, CA193928, CA170449, CA067771, CA156228,
CA157265) SEQ ID No. 89: SCCCRZ2001A10.g (CA083266, CA170546,
CA213983, CA240546, CA214055, CA068172, CA243400, CA112026,
CA159624, CA178417, CA149593, CA195353) SEQ ID No. 90:
SCCCRZ2001E12.g (CA220407, CA069786, CA266584, CA117131, CA149640,
CA102694, CA107051, CA126788, CA178629, CA116298, CA189528) SEQ ID
No. 91: SCCCRZ2003E12.g (CA290451, CA171106, CA257067, CA126312,
CA285909, CA191695, CA175249, CA277181, CA198875, CA264876,
CA228763, CA257385, CA149818, CA268790, CA228758, CA239922,
CA147478) SEQ ID No. 92: SCCCRZ2C01F09.g (CA238345, CA110244,
CA292133, CA226215, CA290161, CA089133, CA225941, CA087675,
CA081960, CA263629, CA263709, CA271851, CA098120, CA103239,
CA241010, CA081617, CA127228, CA241092, CA249515, CA289050,
CA081621, CA285377, CA149903, CA084191, CA237910, CA287616,
CA170459, CA180444, CA241705, CA072646, CA198212, CA140343,
CA074071, CA260574, CA275241, CA219063, CA230826, CA216366,
CA284463, CA231731, CA275313, CA277199, CA284538, CA085114,
CA146451, CA238575, CA170457, CA241499, CA276966, CA150000,
CA194018, CA282348, CA151656, CA292177, CA151735, CA081964,
CA276948, CA281247, CA148593, CA127998, CA297924, CA098115,
CA225142, CA104406) SEQ ID No. 93: SCCCSD1003E02.g (CA284001,
CA285612, CA291203, CA278558, CA277223, CA285546, CA272455,
CA284812, CA288109, CA285276, CA274083, CA274097, CA282761,
CA284853, CA282957, CA276485, CA288135, CA282680, CA287028,
CA288317, CA301448, CA281013, CA278500, CA287354) SEQ ID No. 94:
SCCCSD1092A08.g (CA284222, CA275878, CA276919, CA284291, CA284297,
CA281361, CA273485, CA285647, CA286280, CA287406) SEQ ID No. 95:
SCCCSD2001E05.g (CA282080, CA282487, CA278050, CA284383, CA274256)
SEQ ID No. 96: SCCCSD2C03G12.g (CA301232, CA297876, CA297283) SEQ
ID No. 97: SCCCST1001C04.g (CA096261, CA241976, CA265094, CA217159,
CA169670, CA085862, CA103281, CA236141, CA230822, CA166981,
CA178741, CA173538) SEQ ID No. 98: SCCCST1006B11.g (CA211361,
CA070492, CA219037, CA070499, CA178358, CA173923, CA217421,
CA217710) SEQ ID No. 99: SCCCST3001H12.g (CA182157, CA090806,
CA135450, CA192177, CA157038, CA180203, CA186190, CA185139,
CA088464, CA107032, CA186187) SEQ ID No. 100: SCEPAM1020A03.g
(CA298761, CA238039, CA072781, CA202979, CA265514, CA203056,
CA216879, CA274267, CA154767, CA072753, CA232137, CA272619) SEQ ID
No. 101: SCEPLR1030B03.g (CA284018, CA296786, CA191311, CA135484,
CA132970, CA260298, CA293358, CA232052, CA145338, CA296858,
CA300403, CA289136, CA190455, CA256928, CA276730, CA114900,
CA151879, CA131612, CA285822, CA281761, CA277035, CA131569,
CA256849, CA139403, CA120776, CA111640, CA144584, CA109836,
CA163350, CA103723, CA138138) SEQ ID No. 102: SCEPLR1030E06.g
(CA120812, CA166500, CA121058, CA157792, CA147349) SEQ ID No. 103:
SCEPRZ1008F02.g (CA084261, CA147347, CA090873, CA152001, CA234969,
CA091560, CA150615, CA253916, CA204783, CA205748, CA192626,
CA201996, CA202076, CA280863, CA162916, CA088703,
CA085702, CA175387, CA269587, CA152933, CA092690, CA229677,
CA152922, CA200559, CA156055, CA170331, CA140801, CA256055,
CA152711, CA153264, CA199353, CA091994, CA151595, CA221404,
CA153337, CA198274, CA151680, CA273193, CA214750, CA249251,
CA084265, CA113829) SEQ ID No. 104: SCEPRZ1010E06.g (CA153095,
CA171009, CA300383, CA134779, CA147516, CA171086, CA290145,
CA187047, CA190622, CA249955, CA131632, CA285405, CA195540,
CA146683, CA255486, CA274214, CA143354, CA262861, CA250035,
CA196569, CA205156, CA196644, CA296007, CA172028, CA184943,
CA117936, CA257643) SEQ ID No. 105: SCEPRZ3087C08.g (CA160294,
CA160210) SEQ ID No. 106: SCEQLB2019B08.g (CA279976, CA272048) SEQ
ID No. 107: SCEQLR1007G03.g (CA140431, CA259456, CA211527,
CA271749, CA266277, CA141614, CA215266, CA220502, CA201033,
CA142803, CA094784, CA172036, CA107212, CA194369, CA295096,
CA065513, CA157629, CA181854, CA099236, CA296097, CA068795,
CA145592, CA157045, CA169225, CA195900, CA289800, CA083770,
CA103698, CA196336, CA066685, CA279318, CA134272, CA169306,
CA144849, CA173189, CA190898, CA206313, CA176452, CA257180,
CA084874, CA101125, CA249765, CA284335, CA162053, CA180997,
CA197651, CA143812, CA188901, CA194298, CA234171, CA085641,
CA267721, CA123786, CA267873, CA139542, CA208084, CA097722,
CA158840, CA103745, CA232413, CA177068, CA138787, CA200611,
CA183259, CA094119, CA293858, CA299758, CA232497, CA181726,
CA207021, CA270176, CA077309, CA123096, CA142484, CA251020,
CA205516, CA074457, CA144233, CA130849, CA171502, CA136847,
CA265729, CA120240, CA192591, CA265372, CA195921, CA209672,
CA125513, CA192394, CA259229, CA293855, CA105693, CA081981,
CA131054, CA269628, CA146587, CA088333, CA158446, CA258765,
CA134005, CA143367, CA258108, CA068778, CA271982, CA101526,
CA227906, CA127817, CA117772, CA107439, CA088988, CA300259,
CA135337, CA213654, CA190891, CA182017, CA120975, CA092302,
CA202807, CA094566, CA274758, CA082503, CA094014, CA237917,
CA089634, CA194363, CA089726, CA084158, CA145586, CA125521,
CA142320, CA234258, CA229530, CA293659, CA300521, CA109689,
CA191974, CA081639, CA294851, CA109766, CA074622, CA198332,
CA200961, CA187329, CA281641, CA066256, CA299442, CA264175,
CA121806, CA266806, CA241746, CA215496, CA255625, CA234149,
CA068777, CA195842, CA178628, CA178717, CA142335, CA109521,
CA148397, CA094810, CA096159, CA269632, CA077723, CA134029,
CA094404, CA198903, CA294206, CA169711, CA181781, CA168554,
CA079807, CA198035, CA071310, CA086691, CA180555, CA193559,
CA203910, CA100811, CA085634, CA076712, CA069456, CA263383,
CA280255, CA176816, CA066414, CA212509, CA167475, CA295033,
CA194573, CA071797, CA076495, CA148279, CA101133, CA186819,
CA180647, CA187603, CA198759, CA235563, CA291664, CA204052,
CA284342, CA102950, CA118149, CA085453, CA085470, CA097975,
CA183735, CA264115, CA198176) SEQ ID No. 108: SCEQLR1091A10.g
(CA114539, CA257837, CA077076, CA262215, CA274238, CA211402,
CA274108, CA230959, CA121144, CA256388, CA288382, CA079882,
CA230878, CA241079, CA256311, CA237783, CA240995, CA073200,
CA235765, CA113590, CA126147, CA077764, CA118720, CA123712,
CA286990, CA281182, CA111839, CA124521, CA077641, CA255256,
CA111725, CA129312, CA216352, CA209624, CA111908, CA155939,
CA189115, CA135189, CA235762, CA291159, CA238370) SEQ ID No. 109:
SCEQRT1024B02.g (CA216940, CA225607, CA179965, CA204515, CA132482,
CA185736) SEQ ID No. 110: SCEQRT1024E12.g (CA295147, CA260615,
CA254686, CA132523, CA197622, CA204899, CA190453, CA212246,
CA197604, CA270758, CA270346, CA130936, CA269290, CA256715,
CA132252, CA182867, CA107713, CA256638, CA258402, CA217358,
CA184651, CA109919, CA185468, CA217428, CA156179, CA220042,
CA109994, CA284009, CA214271, CA139017, CA135234, CA260181,
CA234511, CA161112, CA102825, CA183055, CA103445, CA192331,
CA107252, CA161202, CA288819, CA107320, CA258917, CA244198,
CA220062, CA259939, CA069469, CA244275, CA220141, CA185728,
CA284013) SEQ ID No. 111: SCEQRT1025D04.g (CA210404, CA217344,
CA296134, CA217415, CA187015) SEQ ID No. 112: SCEQRT1025D06.g
(CA132593, CA141785, CA141018, CA215251) SEQ ID No. 113:
SCEQRT1026H08.g (CA145460, CA069364, CA140129, CA250315, CA145544,
CA141404, CA293054, CA282922, CA163907, CA261070, CA163990,
CA205321, CA173746, CA283810, CA134025, CA170490, CA240108,
CA069401, CA280554, CA277690, CA168030, CA240167, CA222954,
CA132730, CA217518, CA277435, CA191682, CA190599, CA133625,
CA264946, CA277153, CA070912, CA217975, CA146562, CA284169,
CA143199, CA087655, CA287350, CA273405, CA084518, CA301511,
CA143266, CA290482) SEQ ID No. 114: SCEQRT1028C03.g (CA139365,
CA286665, CA260598, CA139023, CA285888, CA274666, CA137906,
CA281362, CA285687, CA136311, CA141788, CA103170, CA133136,
CA269938, CA284682, CA288527, CA141870, CA285073, CA285465,
CA284318, CA287456, CA130761, CA137490, CA144380, CA297849,
CA131873, CA143782, CA281126, CA143182, CA191432, CA284091,
CA278152, CA164514, CA139044, CA138535, CA283285, CA106682,
CA102643, CA136156, CA132845, CA276716, CA275759, CA284563,
CA268586, CA268592, CA143781, CA268641, CA284432, CA273135,
CA139564, CA297995, CA268645, CA287370, CA143142, CA138952,
CA143227, CA297005, CA101363, CA142135, CA115501, CA278630,
CA138496, CA101781, CA286567, CA141623, CA136320, CA136240,
CA288341, CA288312, CA104716, CA288071, CA193582, CA130778,
CA297953, CA104799, CA143442, CA274724, CA104459, CA104545,
CA274625, CA290645, CA278030, CA275085, CA138291, CA145190,
CA144775, CA290713, CA133241, CA141076, CA272524, CA146265,
CA293757, CA135230, CA139625, CA277500, CA131620, CA269954,
CA131757, CA106126, CA268581, CA273592, CA106187, CA136999,
CA288204, CA277749, CA143039, CA278287, CA139806) SEQ ID No. 115:
SCEQRT1031D02.g (CA074042, CA088825, CA075266, CA271676, CA295638,
CA133114, CA268786, CA112006, CA291853, CA269112, CA089768,
CA292656, CA273097, CA078197, CA073875, CA074037, CA189360,
CA260450) SEQ ID No. 116: SCEQRT1033H06.g (CA101392, CA115952,
CA155650, CA133340, CA213648, CA215953, CA108139, CA102933,
CA163612) SEQ ID No. 117: SCEQRT2098H06.g (CA172591, CA163271,
CA229649, CA139483) SEQ ID No. 118: SCEQRT2099H01.g (CA086208,
CA264357, CA086287, CA080644, CA266323, CA161194, CA300091,
CA287964, CA221671, CA131618, CA251982, CA221152, CA159591,
CA221951, CA156418, CA240390, CA161187, CA159676, CA139559,
CA077881, CA161261, CA110139, CA077863) SEQ ID No. 119:
SCEQRT2100B02.g (CA217945, CA139573, CA204327, CA260706, CA204248,
CA269222, CA269284) SEQ ID No. 120: SCEQRZ3020C02.g (CA250725,
CA161134, CA165966, CA160060, CA156919, CA164968, CA251491,
CA069428) SEQ ID No. 121: SCEZAM2058E08.g (CA188635, CA183792,
CA195687, CA084907, CA081270, CA081191, CA173384) SEQ ID No. 122:
SCEZHR1047A01.g (CA103161, CA101776) SEQ ID No. 123:
SCEZHR1087F06.g (CA253395, CA197374, CA287472, CA103877, CA278023)
SEQ ID No. 124: SCEZHR1088E02.g (CA301005, CA296733, CA247972,
CA103945, CA243569, CA251930) SEQ ID No. 125: SCEZLB1009A09.g
(CA281626, CA244568, CA116483, CA237705, CA298353, CA298000,
CA113117, CA284416, CA277289, CA284348, CA276706, CA290833,
CA203091, CA101727, CA176398, CA132760, CA096672, CA290760,
CA282167) SEQ ID No. 126: SCEZLB1010E10.g (CA111286, CA201293,
CA292534, CA113224, CA078624) SEQ ID No. 127: SCEZLB1012F10.g
(CA174564, CA069051, CA216445, CA163915, CA198521, CA068371,
CA296305, CA113392, CA099142, CA163996, CA166390, CA116217,
CA210122, CA074493, CA114992, CA275989) SEQ ID No. 128:
SCEZLR1052E07.g (CA121650, CA116831, CA120886) SEQ ID No. 129:
SCEZRZ3098G10.g (CA296471, CA160526, CA273318, CA275478, CA283208,
CA160609, CA285866, CA277278, CA158745, CA283693, CA285324,
CA285071, CA284153, CA274955, CA285128, CA297181, CA278664,
CA272542, CA273750, CA294380, CA287923, CA273821, CA294450,
CA297756, CA274726, CA296701, CA277926, CA296395, CA286712,
CA286723, CA286722, CA275718, CA275927, CA283291, CA275408) SEQ ID
No. 130: SCEZST3147A10.g (CA194007, CA182656) SEQ ID No. 131:
SCJFFL3C03C02.g (CA230214, CA230128, CA229489) SEQ ID No. 132:
SCJFLR1035E04.g (CA086527, CA195068, CA069060, CA083548, CA295865,
CA177350, CA177349, CA277098, CA276954, CA155838, CA197797,
CA244043, CA088503, CA121818, CA080812, CA155548, CA078754,
CA089206, CA163208, CA129874, CA211416, CA276961, CA144131,
CA158866, CA155542, CA199612, CA263981) SEQ ID No. 133:
SCJFLR1074E09.g (CA262344, CA266655, CA176711, CA133325, CA122163,
CA131810, CA082004, CA181680, CA180565, CA078933, CA085138,
CA210263, CA210980, CA184457, CA262635, CA176142, CA234269,
CA176141, CA178297, CA183158, CA082635, CA082991, CA198762,
CA190715, CA190706, CA274415, CA081600, CA279078, CA181928,
CA081942, CA267908, CA089450, CA084567, CA186427, CA078935) SEQ ID
No. 134: SCJFRT1005C11.g (CA177520, CA225223, CA106003, CA253319,
CA171361, CA209379, CA270001, CA185425, CA155754, CA167026,
CA270006, CA106095, CA213061, CA170199, CA287881, CA132140,
CA204757, CA155038, CA133369, CA254157, CA280727, CA260033,
CA146511, CA186031, CA161879, CA296036, CA220424, CA220423,
CA102390, CA184239) SEQ ID No. 135: SCJFRT1007E01.g (CA267659,
CA267574, CA259232, CA265484, CA145383, SCJLLB2077E09.b) SEQ ID No.
136: SCJFRT1007H07.g (CA232046, CA260877, CA092783, CA231963,
CA204189, CA133468, CA244788, CA244787, CA254691, CA244858,
CA204513, CA230346, CA256769, CA108120, CA089835, CA204647,
CA264840, CA230425, CA268306, CA258270, CA222112, CA165049,
CA222037, CA259725, CA114043, CA233931, CA259471) SEQ ID No. 137:
SCJFRT2055G07.g (CA096216, CA243260, CA285937, CA230920, CA140859,
CA083416) SEQ ID No. 138: SCJFRZ2007F10.g (CA162683, CA160048,
CA279259, CA151224, CA159697, CA156537, CA162591, CA113918,
CA160134, CA162626, CA081758, CA165192, CA159782, CA162706,
CA151304, CA266640) SEQ ID No. 139: SCJFRZ2012F04.g (CA151819,
CA226484, CA196727, CA176517, CA200020) SEQ ID No. 140:
SCJFRZ2034D04.g (CA293545, CA237627, CA152997) SEQ ID No. 141:
SCJFRZ3C03H08.g (CA159498, CA159411) SEQ ID No. 142:
SCJFST1009H11.g (CA176832, CA174223, CA174300) SEQ ID No. 143:
SCJLLR1054C03.g (CA072193, CA122571, CA137632, CA070187, CA191143,
CA188078, CA249372, CA249371, CA077923, CA208829, CA208828,
CA070105, CA261620) SEQ ID No. 144: SCJLRT1016G06.g (CA135201,
CA141549) SEQ ID No. 145: SCJLRT1021D12.g (CA169233, CA144275,
CA169232, CA076021, CA075936, CA184045, CA135772, CA095372,
CA216051, CA168410) SEQ ID No. 146: SCJLRT1023A09.g
(SCJLRT1023A09.g, CA182963, CA250841, CA248659) SEQ ID No. 147:
SCJLRZ1021D12.g (CA242041, CA249059, CA254109, CA213847, CA137917,
CA148975, CA118183, CA214586, CA197889, CA144551, CA196585,
CA262465) SEQ ID No. 148: SCJLST1022A12.g (CA212757, CA175747,
CA184421) SEQ ID No. 149: SCMCLR1123E10.g (CA123814, CA077430,
CA225563) SEQ ID No. 150: SCMCRT2103B04.g (CA172001, CA142458,
CA218053) SEQ ID No. 151: SCMCSD2061D05.g (CA281642, CA278782,
CA287422) SEQ ID No. 152: SCQGHR1010D02.g (CA106316) SEQ ID No.
153: SCQGHR1012B09.g (CA287612, CA106449) SEQ ID No. 154:
SCQGLR1085F11.g (CA264338, CA126544, CA192941, CA167483, CA123056,
CA124270, CA272314, CA261490, CA279307, CA265550, CA271792,
CA122975, CA264343, CA270329, CA273106) SEQ ID No. 155:
SCQGRT1040G03.g (CA142863, CA142796, CA136289) SEQ ID No. 156:
SCQGSB1082E12.g (CA170065) SEQ ID No. 157: SCQSRT1036D03.g
(CA136902, CA135021, CA287878, CA274443, CA296937, CA138673,
CA191058) SEQ ID No. 158: SCQSSB1077D06.g (CA170725) SEQ ID No.
159: SCRFHR1009G06.g (CA217470, CA107403, CA198006, CA217550) SEQ
ID No. 160: SCRFLR1012D12.g (CA215552, CA192043, CA124962,
CA125195, CA145888, CA121817, CA278865, CA174653, CA248262,
CA272947, CA260358, CA291459, CA203303, CA143179, CA141645,
CA178853, CA187649, CA206782, CA090093, CA143252, CA278919) SEQ ID
No. 161: SCRFLR1012F12.g (CA145277, CA176384, CA102865, CA218229,
CA171925, CA191792, CA195660, CA218314, CA240492, CA198659,
CA244914, CA182463, CA131724, CA244997, CA171817, CA194382,
CA205344, CA170805, CA205416, CA173212, CA170885, CA181179,
CA170637, CA183044, CA195239, CA206962, CA185418, CA139670,
CA195249, CA176430, CA181413, CA181342, CA091964, CA183864,
CA222085, CA258352, CA140506, CA180474, CA119811, CA222017,
CA195130, CA185570, CA296593, CA194982, CA183360, CA173154,
CA186079, CA296664, CA171270, CA195468, CA183252, CA294806,
CA132456, CA195394, CA206688, CA256506, CA131509, CA187503,
CA256594, CA108050, CA159196, CA240650, CA177662, CA159279,
CA177742, CA239913, CA171438, CA156947, CA173255, CA256346,
CA235445, CA256418, CA186679, CA219554, CA187631, CA186748,
CA245097, CA185375, CA219625, CA181621, CA187266, CA123999,
CA244218, CA245173, CA182407, CA253693, CA184655, CA143210,
CA180512, CA256622, CA244292, CA185011, CA143274, CA168051,
CA130540, CA207436, CA219682, CA066624, CA216694, CA178229,
CA256208, CA213213, CA171923, CA189901, CA181034, CA102783,
CA146612, CA118091, CA130413, CA185759, CA180234, CA184401,
CA069670, CA186382, CA186701, CA164112, CA186458, CA186769,
CA191147, CA181041, CA191952, CA298549, CA187520, CA155473,
CA111918, CA181356, CA215886, CA145798, CA143022, CA249269,
CA168083, CA215375, CA073688, CA161824, CA216676, CA198787,
CA145199, CA254628, CA186888, CA213066, CA091970, CA215884,
CA143890, CA222334, CA220813, CA171807, CA181203, CA130692,
CA186145, CA260159, CA158846, CA064841, CA295391, CA192487,
CA132539, CA300897, CA141052, CA155506, CA182241, CA187303,
CA258020, CA066321, CA125200, CA170189, CA108039, CA159362,
CA173331, CA298200, CA101575, CA159451, CA116648, CA183460,
CA107663, CA240851, CA289373, CA185342, CA240929, CA216040,
CA186847, CA181218, CA172612, CA180663, CA136914, CA217359,
CA163192, CA172697, CA228382, CA217429, CA159166, CA185025,
CA192456, CA102223, CA156933, CA101474, CA183302, CA186227,
CA159239, CA269601, CA181346, CA102790, CA187044, CA184058,
CA195530, CA255719, CA136787, CA255803, CA140448, CA247100,
CA183704, CA222949, CA183064, CA168215, CA292284, CA272087,
CA174156, CA131207, CA203204, CA181678, CA195537, CA174230,
CA113053, CA213323, CA181745, CA183105, CA137679, CA221917,
CA234916, CA191379, CA207396, CA249902, CA203603, CA257333,
CA192868, CA108462, CA131411, CA272376, CA194489, CA249816,
CA257417, CA207923, CA183017, CA194671, CA163065, CA185665,
CA257591, CA182994, CA279934, CA208015, CA186256, CA177351,
CA132757, CA146153, CA172253, CA181813, CA182473, CA181263,
CA182486, CA185227, CA144437, CA210632, CA179930, CA163280,
CA178697, CA187150, CA102845, CA183295, CA203119, CA167619,
CA183126, CA240601, CA167572, CA197131, CA187498, CA187269,
CA181877, CA154563, CA166216, CA198634, CA255532, CA221973,
CA205215, CA165092, CA211170, CA179824, CA185664, CA162302,
CA185103, CA138255, CA173288, CA168237, CA234213, CA138061,
CA256349, CA170955, CA162207, CA168159, CA134163, CA181092,
CA256421, CA081501, CA134612, CA216664, CA171033, CA180502,
CA108052, CA134694, CA242240, CA185226, CA193845, CA210899,
CA159347, CA266029, CA159436, CA171415, CA135255, CA233811,
CA171999, CA187597, CA180638, CA135773, CA253334, CA131134,
CA182234, CA184039, CA166175, CA180410, CA280449, CA297478,
CA194983, CA215483, CA264565, CA107740) SEQ ID No. 162:
SCRFLR1034G06.g (CA241449, CA235335, CA117136, CA164653, CA178183,
CA254415, CA125238, CA164095, CA222593, CA230775, CA129494,
CA187277, CA096098, CA163037, CA217349, CA216253, CA163492) SEQ ID
No. 163: SCRFLR2037F09.g (CA209741, CA268887, CA178192, CA261014,
CA242867, CA265801, CA197228, CA129199, CA263453, CA263426,
CA146361, CA212193, CA198338, CA263428, CA292726) SEQ ID No. 164:
SCRUAD1063D03.g (CA068586, CA068642, CA209109, CA068658, CA068557)
SEQ ID No. 165: SCRUAD1064B08.g (CA068774, CA209078, CA068700) SEQ
ID No. 166: SCRUFL1112F04.b (CA249652, CA097438, CA097351) SEQ ID
No. 167: SCRULB1060F05.g (CA173325, CA260726, CA086474, CA255253,
CA258837, CA166401, CA075394, CA076741, CA220439, CA079619,
CA202888, CA275737, CA272422, CA086576, CA261359, CA115018,
CA176599) SEQ ID No. 168: SCRULB2065G10.g (CA271141, CA266659,
CA271226) SEQ ID No. 169: SCRUSB1062E12.g (CA169672, CA208550,
CA182671, CA171140, CA184190) SEQ ID No. 170: SCSBAD1084C01.g
(CA104637, CA090516, CA196055, CA105810, CA069997, CA104732,
CA225658, CA250072, CA255717, CA256367, CA256852, CA104815,
CA255801, CA223408, CA217811, CA230204, CA222042, CA266094,
CA202055) SEQ ID No. 171: SCSBAM1084E01.g (CA134918, CA160648,
CA271201, CA163376, CA159473, CA079123, CA287106) SEQ ID No. 172:
SCSBAM1085B06.g (CA155118, CA160431, CA238835, CA164387, CA159328,
CA079174, CA166634, CA111526) SEQ ID No. 173: SCSBAM1086F04.g
(CA079296) SEQ ID No. 174: SCSBHR1050B11.g (CA210645, CA170681,
CA167697, CA107340, CA215631, CA206834, CA108412, CA182286,
CA197994, CA277167, CA163113, CA192646, CA276916, CA265467,
CA181920, CA184384, CA273323, CA211222, CA211754, CA185581,
CA219190, CA260157, CA102243, CA286611, CA185579, CA218411,
CA288879, CA193027, CA229712, CA196151, CA218111, CA212330,
CA256722, CA283661, CA195272, CA206786, CA197939, CA102985,
CA182506, CA284298, CA268890, CA068317, CA213471, CA211376,
CA124505, CA068559, CA110532, CA110645, CA196292, CA274987,
CA291082) SEQ ID No. 175: SCSBHR1052E03.g (CA109838, CA103669,
CA108022) SEQ ID No. 176: SCSBSD2029D11.g (CA273475, CA291058,
CA296853, SCEPSD1006B07.g, CA296781) SEQ ID NO. 177:
SCSBSD2029F05.g (CA277625, CA286610, CA287004, CA286219) SEQ ID NO.
178: SCSBST3096H04.g (CA250727, CA185029, CA081571, CA209300,
CA099207) SEQ ID NO. 179: SCSFAD1125C08.g (CA218816, CA217232,
CA265904) SEQ ID NO. 180: SCSGAM1094D05.g (CA162116, CA086160,
CA079959, CA166087, CA164634, CA259450, CA162089, CA268215,
CA162088, CA088600, CA268472, CA260072, CA265273, CA155162) SEQ ID
NO. 181: SCSGFL4193B05.g (CA256924, CA227764, CA065586) SEQ ID NO.
182: SCSGHR1069F04.b (CA068965, CA109244) SEQ ID NO. 183:
SCSGLR1045F05.g (CA227916, CA126326, CA235027, CA271367, CA096003,
CA217599, CA092647, CA123937, CA126293, CA212141, CA184768,
CA103141, CA109865, CA103057, CA198702, CA103058) SEQ ID NO. 184:
SCSGSB1009D11.g (CA172723, CA195396, CA172640) SEQ ID NO. 185:
SCUTAM2005B03.g (CA090809, CA245425) SEQ ID NO. 186:
SCUTAM2115C12.g (CA086564, CA086570, CA092157) SEQ ID NO. 187:
SCUTLR2023D06.g (CA243852, CA300860, CA067973, CA111863, CA261222,
CA116646, CA107988, CA176922, CA173185, CA085544, CA264052,
CA129911, CA208820, CA070339) SEQ ID NO. 188: SCUTRZ2022G04.g
(CA282192, CA102010, CA299087, CA217805, CA162851, CA237908,
CA101358, CA289898, CA293565, CA122383, CA070388, CA177777,
CA069853, CA153426, CA248297, CA159447) SEQ ID NO. 189:
SCUTST3084F06.g (CA186860, CA273919, CA181491, CA213324, CA181556)
SEQ ID NO. 190: SCUTST3152C08.g (CA209403, CA181973, CA187843) SEQ
ID NO. 191: SCVPAM1055A12.g (CA099145, CA234768, CA279908,
CA080282, CA243494, CA065806, CA162304, CA074300, CA198499,
CA234769, CA099202, CA218059) SEQ ID NO. 192: SCVPCL6041F01.g
(CA233726, CA099858, CA222285) SEQ ID NO. 193: SCVPFL3040D12.g
(CA246849, CA247391, CA225824) SEQ ID NO. 194: SCVPFL3045B09.g
(CA244206, CA242703, CA242545, CA227029, CA254139, CA255498,
CA243610, CA228891, CA256240, CA241190, CA226680, CA230797,
CA241549) SEQ ID NO. 195: SCVPLR1049B12.g (CA128277, CA128268,
CA113688, CA280120, CA201390, CA126944, CA263569, CA111798,
CA142645, CA117891) SEQ ID NO. 196: SCVPLR2005G05.g (CA115417,
CA269672, CA275150, CA196175, CA136519, CA150580, CA111903,
CA181691, CA285411, CA071020, CA199358, CA253634, CA100886,
CA199448, CA229814, CA164912, CA205467, CA104448, CA274931,
CA238127, CA130082, CA265998, CA104535, CA110496, CA229735,
CA266059, CA151909, CA215144, CA214637, CA175326, CA277166,
CA095092, CA166114, CA197942, CA200312, CA187461, CA214780,
CA273212, CA110942, CA180970, CA254976, CA243592, CA219837,
CA214623) SEQ ID NO. 197: SCVPLR2012A10.g (CA128947, CA084780,
CA130173, CA112670, CA081361, CA091553, CA189411, CA074286) SEQ ID
NO. 198: SCVPLR2027D02.g (CA139889, CA281733, CA276600, CA137157,
CA287148, CA196795, CA121234, CA190870, CA121263, CA285555,
CA271374, CA218165, CA101129, CA275809, CA219005, CA191396,
CA218180, CA218095, CA190921, CA135275, CA103450, CA132968,
CA218924, CA218108, CA290505, CA130317, CA110080, CA143050,
CA145955, CA131998, CA143749, CA145806, CA108915, CA187045,
CA141195, CA140686, CA103304, CA108830, CA102906, CA219000,
CA282088)
SEQ ID NO. 199: SCVPRT2074D04.g (CA216242, CA101435, CA136611,
CA237797, CA108537, CA090875, CA145883, CA175433, CA177864,
CA145938, CA164642) SEQ ID NO. 200: SCVPRT2081G05.g (CA146516) SEQ
ID NO. 201: SCVPRZ2038C12.g (CA116869, CA116232, CA246884,
CA229323, CA101842, CA138831, CA095760, CA069655, CA170285,
CA195638, CA133601, CA067592, CA291694, CA112695, CA217972,
CA273837, CA067665, CA247936, CA144990, CA136455, CA278472,
CA142261, CA247884, CA169426, CA136187, CA140235, CA294606,
CA290785, CA138166, CA095965, CA169509, CA289245, CA290853,
CA238260, CA284373, CA253974, CA274756, CA174589, CA197138,
CA089467, CA176404, CA301325, CA176402, CA108223, CA263499,
CA089556, CA085065, CA145765, CA209854, CA078829, CA185533,
CA284004, CA223109, CA184146, CA196166, CA229320, CA133147,
CA231712, CA287218, CA221504, CA153992, CA088034, CA267926,
CA178000, CA237734, CA225054, CA203790, CA232984, CA300291,
CA278621, CA204937, CA226326, CA100069, CA254749, CA096038,
CA129441, CA096280, CA298558, CA246279, CA242469, CA199423,
CA299287, CA122008, CA187480, CA240020, CA283618, CA277794,
CA273434, CA207921, CA205591, CA138290, CA265687, CA246929,
CA084012, CA102242) SEQ ID NO. 202: SCVPRZ2043F09.g (CA154468,
CA276289) SEQ ID NO. 203: SCVPRZ3025G09.g (CA166458, CA215142,
CA219273, CA067980, CA219244) The EST Genbank accession numbers are
in parentheses. The SEQ ID No. refers to the sequence identifiers
in the sequence listings. The listed ESTs assembled to the
indicated sequence and should be considered one transcript. Each
SAS is differentially expressed between plants with low and high
sucrose content.
TABLE-US-00005 TABLE V Genes differentially expressed between a
high brix pool of eight plants and a low brix pool of eight plants.
The individuals were selected from an F3 progeny of a cross between
Saccharum officinarum and Saccharum spontaneum genotypes. RNA
samples from the indicated tissues were used to generate probes for
cDNA microarray hybridizations. The fifth column indicates the
average ratios (fold induction) in high against low brix
comparisons. The last column indicates the average ratios (fold
induction) in low against high brix comparisons. The average brix
in the high brix population was 22.82. The average brix in the low
population was 9.84. Tissue SAS Category Description of homologue
High Brix Low Brix Internode 1 SCJFST1009H11.g No matches 2.03165
SCCCCL3001F04.g No matches 4.26102 SCRFLR2037F09.g Calcium
Calreticulin 1.58339 SCCCRZ1001H05.g Transcription HLH
(helix-loop-helix) 2.19048 Internode 5 SCSBHR1050B11.g Others
Putative senescence-associated protein 4.01392 SCEZST3147A10.g
Transcription Zinc finger proteins C3H 2.13461 SCCCCL3080A11.b
Ubiquitination Polyubiquitin 1.70138 SCCCCL3001F04.g No matches
3.88735 SCSBHR1050B11.g Others Putative senescence-associated
protein 3.99269 SCCCLR1048F03.g Unknown protein 1.5888
SCQGHR1012B09.g Stress Probable cytochrome P450 monooxygenase
6.70883 SCEQRT1033F01.g Zinc finger proteins C2C2/Dof 4.19139
SCCCLR1C03H09.g Ubiquitination Polyubiquitin 1.76444
SCVPRZ2038C12.g Ubiquitination Polyubiquitin 1.68302 Internode 9
SCJLLR1054C03.g Protein kinases Undefined 2.81512 SCEZRZ3098G10.g
Pathogenicity Protease inhibitors thaumatin 2.44691 SCVPFL3046C06.b
Protein Phosphatases Serine/Threonine - PPM Family PP2C Catalytic
Subunit 2.84969 SCJFRZ2007F10.g Development ARC1 (arm repeat
protein) 3.02837 SCCCRZ1004H12.g Transcription EIL
(ethylene-insensitive3-like) 2.47389 SCCCLR1C03H09.g Ubiquitination
Polyubiquitin 3.36544 SCVPRZ2038C12.g Ubiquitination Polyubiquitin
2.93819 SCBFSB1046D04.g Protein kinases Calcium-related
CBL-interacting 2.48022 SCJFRZ2012F04.g Receptors Receptor Ser/Thr
kinase RLK Undefined 2.471 SCCCRZ1002E08.g Stress Drought and cold
response putative aquaporin 2.95528 SCAGLR1043E04.g Stress
Cytochrome P450 CYP74A 2.77448 SCCCLR2003E10.g Transcription NAM
NAC 2.61186 SCCCLR1048F03.g Unknown protein 4.17702 SCBGLR1115D10.g
No matches 2.14401 SCCCAM1001A03.g Calcium Calmodulin-binding
proteins Multidrug resistant-like 2.16906 SCUTAM2005B03.g Stress
Cytochrome P450 CYP90 2.27431 SCVPCL6041F01.g Receptors Receptor
Ser/Thr kinase RLK with lectin domain 1.82155 SCCCRZ1001F02.g
Stress Drought and cold response putative aquaporin 2.01257
SCRUFL1112F04.b Others RNA stability UDP-GlcNAc 2.45556 Leaf
SCACLR1036B06.g Protein kinases Calcium-related CBL-interacting
1.98763 SCEPLR1030B03.g Pathogenicity R-genes (receptors) With
LRR/Tomato LRP protein 1.56394 SCBGLR1099G02.g Transcription
AP2/EREBP DREB1 2.17826 SCCCCL3120C09.g Receptors Receptor Ser/Thr
kinase RLK with Lys domain 1.96465 SCJFLR1035E04.g Transcription
Scarecrow 1.53914 SCACLR2014E12.g Ubiquitination E2 1.66079
SCCCSD2001E05.g Pathogenicity Protease inhibitors thaumatin 2.19065
SCCCLR1068D03.g Small GTPases Rab 1.83141 SCAGLR1043E04.g Stress
Cytochrome P450 CYP74A 1.88887 SCEQRT1024E12.g Hormone biosynthesis
Salicylic Acid 2.01108 SCSGFL4193B05.g Stress Cytochrome P450 CYP73
1.98329 SCCCCL3001F04.g No matches 2.18921 SCCCLR1001E04.g House
keeping/controls Rubisco small subunit 2.33399 SCBGLR1003D06.g
Ubiquitination E2 1.97415 SCEQRT2099H01.g Protein kinases
Calcium-related CDPK 1.62919 SCACCL6008H06.g Stress Drought and
cold response Low temperature induced (L 1.87927 SCCCRZ1002E08.g
Stress Drought and cold response putative aquaporin 1.76115
SCBFST3136A06.g No matches 2.23606 SCEQRT1026H08.g Stress
Cytochrome P450 CYP75 1.88583 SCVPFL3045B09.g Stress Metalothionein
2.01704 SCSGHR1069F04.b Stress Cytochrome P450 2.51921
SCQSRT1036D03.g Pathogenicity R-genes transduction PR 1.87037
SCAGLR2026G12.g No matches 1.94474 SCEQRT1028C03.g Pathogenicity
R-genes transduction PR 2.41575 SCUTRZ2022G04.g Others Heat shock
protein 2.3825 SCQGSB1082E12.g Receptors Receptor Ser/Thr kinase
RLK Undefined 2.41928 indicates data missing or illegible when
filed
TABLE-US-00006 TABLE VI Genes differentially expressed between a
high brix pool of eight plants and a low brix pool of eight plants.
The individuals were selected from an F1 progeny of a cross between
two commercial varieties, SP80-144 and SP85-7215. RNA samples from
the indicated tissues were used to generate probes for cDNA
microarray hybridizations. The fifth column indicates the average
ratios (fold induction) in high against low brix comparisons. The
last column indicates the average ratios (fold induction) in low
against high brix comparisons. The average brix in the high brix
population was 14.36. The average brix in the low population was
8.87. Tissue SAS Category Description of homologue High Brix Low
Brix Leaf SCVPRZ2043F09.g Receptors Receptor Ser/Thr kinase RLK
Undefined 2.94471 SCCCSD2C03G12.g Pathogenicity Fungal resistance
Undefined 4.43542 SCJFRT1007E01.g Stress Dioxygenases 1.94338
SCUTAM2115C12.g Unknown protein 2.21849 SCSBAM1086F04.g Receptors
Receptor Ser/Thr kinase RLK Undefined 2.77975 SCCCSD1092A08.g No
matches 3.85136 SCVPRZ3025G09.g Hormone biosynthesis Jasmonic Acid
12-oxo-phytodienoate reductase 5.65617 SCAGAM2125C01.g Receptors
Receptor Ser/Thr kinase RLK Undefined 1.59055 SCCCST1006B11.g
Protein kinases SNF1-related 2.62841 SCJLST1022A12.g Receptors
Receptor Ser/Thr kinase RLK undefined with LRR 2.81094
SCRULB1060F05.g Inositol Inositol kinases 1-Phosphatidylinositol
4-kinase 7.28074 SCJFFL3C03C02.g No matches 2.07492 SCCCCL4005F05.g
Protein kinases Undefined 2.29254 SCVPFL3040D12.g Transcription
CREB-binding/acetyltransferase-related 3.10639 SCSGLR1045F05.g
Unknown protein 1.69705 SCMCLR1123E10.g Others T-complex protein
(chaperonin) 3.08493 SCCCRZ1001C01.g Stress Drought-induced 2.21354
SCCCLR1C05B03.g Transcription Myb 2.39082 SCBFLR1039B05.g Others
Xyloglucan endotransglycosylase 2.72608 SCSBSD2029D11.g No matches
2.0015 SCVPCL6041F01.g Receptors Receptor Ser/Thr kinase RLK with
lectin domain 3.02993 SCCCLR2001H09.g Stress Thioredoxin 1.82511
SCBGLR1096E06.g Others Putative inosine monophosphate dehydrogenase
2.29479 SCQSSB1077D06.g Receptors Receptor Ser/Thr kinase RLK
Undefined 1.95563 SCEZLB1009A09.g Hormone related Similar to BLE1
protein 2.29938 SCEZLR1052E07.g No matches 2.98578 SCCCCL4002E02.g
Others Extensin 1.87858 SCCCRZ2003E12.g Transcription bZIP 2.41759
SCCCLB1001D03.g Protein Phosphatases Serine/Threonine - PPP Family
PP2A/Catalytic Subunit 1.88391 SCAGLB1070E01.g Receptors Receptor
Ser/Thr kinase RLK Undefined 7.40783 SCJLRZ1021D12.g Receptors
Receptor Ser/Thr kinase RLK undefined with LRR 3.33105
SCCCRT2002G11.g Protein kinase Cell cycle-related MHK (male germ
cell associated) 3.57013 SCCCLR2C02D03.g Calcium Calmodulin-binding
proteins Chaperonin 10 1.94335 SCCCRT2002G11.g Protein kinase Cell
cycle-related MHK (male germ cell associated) 3.77176
TABLE-US-00007 TABLE VII Genes differentially expressed between a
high brix variety and a low brix variety. Two individuals were
selected from SP83-2847 and two individuals from SP91-1049. RNA
samples from the indicated tissues were used to generate probes for
cDNA microarray hybridizations. The fifth column indicates the
average ratios (fold induction) in high against low brix
comparisons. The last column indicates the average ratios (fold
induction) in low against high brix comparisons. The average brix
in SP91-1049 was 20.2. The average brix in SP83- 2847 was 16.2.
Tissue SAS Category Description of homologue High Brix Low Brix
Leaf SCCCLR2002F08.g Hormone related Auxin auxin repressed 2.48663
SCRUAD1064B08.g No matches 6.06841 SCEQRT1024E12.g Hormone
biosynthesis Salicylic Acid 1.58685 SCBFST3136A06.g No matches
2.2018 SCSGSB1009D11.g Unknown protein 4.54795 SCACCL6008H06.g
Stress Drought and cold response Low temperature induced (LTI)
4.15788 SCSBAM1085B06.g Hormone biosynthesis Jasmonic Acid Linoleic
acid desaturase 2.43754 SCJLRT1016G06.g Stress Wound-induced
Ribonuclease 4.45431 SCCCLR1024C03.g Stress Drought and cold
response putative aquaporin 1.72509 SCCCLR1001E04.g House
keeping/controls Rubisco small subunit 3.10813
TABLE-US-00008 TABLE VIII Genes differentially expressed between a
high brix variety and a low brix variety. Two individuals were
selected from SP89-1115 and two individuals from SP94-3116. RNA
samples from the indicated tissues were used to generate probes for
cDNA microarray hybridizations. The fifth column indicates the
average ratios (fold induction) in high against low brix
comparisons. The last column indicates the average ratios (fold
induction) in low against high brix comparisons. The average brix
in SP89-1115 was 19.9. The average brix in SP94- 3116 was 14.2.
Tissue SAS Category Description of homologue High Brix Low Brix
Leaf SCAGSD2042G08.g No matches 2.56194 SCEQRT1033H06.g Receptors
Receptor Ser/Thr kinase RLK undefined with LRR 2.58749
SCJLRT1016G06.g Stress Wound-induced Ribonuclease 2.4137
SCEQRT1024B02.g Protein kinases Undefined (with insertion domain)
5.41746 SCCCRZ2001A10.g Inositol Inositol kinases
1-Phosphatidylinositol 4-kinase 3.90421 SCCCLR1022B11.g Stress
Drought and cold response Cysteine proteinase RD19A precursor
1.74873 SCBFLR1060F03.g Receptors Receptor Ser/Thr kinase RLK
undefined with LRR 3.23768
TABLE-US-00009 TABLE IX Genes differentially expressed between a
high brix pool of eight plants and a low brix pool of eight plants.
The individuals were selected from an F1 progeny of a cross between
two commercial varieties, SP80-180 and SP80-4966. RNA samples from
the indicated tissues were collected from March to July and used to
generate probes for cDNA microarray hybridizations. The fifth
column indicates the average ratios (fold induction) in high
against low brix comparisons. The last column indicates the average
ratios (fold induction) in low against high brix comparisons. The
average brix in the high brix population was 18.47 in March, 21.79
in May and 22.63 in July. The average brix in the low population
was 13.66 in March, 17.59 in May and 18.96 in July. Tissue SAS
Category Description of homologue High Brix Low Brix Internode 1
march SCEPLR1030E06.g Receptors Receptor Ser/Thr kinase RLK
undefined with LRR 1.87064 SCACLR2007G02.g Protein kinases Others
Abcisic acid-inducible 1.90147 SCEZLB1012F10.g Calcium
Calmodulin-binding proteins GNGC family 1.88909 SCEQRT1024E12.g
Hormone biosynthesis Salicylic Acid 1.85544 SCJLRT1016G06.g Stress
Wound-induced Ribonuclease 2.07306 SCJFRT1005C11.g Hormone
biosynthesis Ethylene ACC oxidase 3.48319 SCVPLR2005G05.g Others
Putative Mob1/phocein family protein 1.6251 SCEQRT1026H08.g Stress
Cytochrome P450 CYP75 2.40851 SCCCLR1C04C02.g No matches 2.07835
SCQGHR1010D02.g Others Putative terpene synthase 3.02686
SCBGLR1023D05.g Pathogenicity R-genes transduction LSD1 2.21144
SCUTRZ2022G04.g Others Heat shock protein 1.71301 SCCCLR1C02F07.g
Inositol Others myo-Inositol-1-phosphate synthase 1.83045
SCEQRT1028C03.g Pathogenicity R-genes transduction PR 2.46157
SCVPLR1049B12.g Unknown protein 2.59241 SCSBAM1084E01.g Protein
kinases MAPK/MAPKK/MAPKKK MAPK 1.98747 SCCCLR2002E04.g Others
Putative Bet v I pollen allergen 2.2259 SCCCCL6002B05.g Hormone
biosynthesis Auxin Nitrilase 1.67598 SCJLRT1021D12.g Stress
Wound-induced Chalcone synthase 3.6397 SCVPLR2027D02.g Stress
Wound-induced Chalcone synthase 1.73982 SCEZLB1010E10.g
Transcription Other Auxin-response factors With B3 domain 1.62134
SCRFLR1012D12.g Hormone biosynthesis Auxin Nitrilase 1.76443
SCCCLR1C05G07.g Others S-adenosylmethionine decarboxylase 1.93684
SCSBHR1052E03.g Stress ABA and stress induced 2.27594
SCRFLR1012F12.g Others caffeic acid 3-O-methyltransferase 2.22106
SCCCAM2C04G08.g Receptors Receptor Ser/Thr kinase leucine-rich
transmembrane 1.67218 kinase (LTK1) SCACCL6008H06.g Stress Drought
and cold response Low temperature induced (LTI) 1.91951
SCRFLR1034G06.g Protein kinases Undefined 1.76667 SCUTST3084F06.g
Stress Drought and cold response Low temperature induced (LTI)
1.73383 SCAGLR1043E04.g Stress Cytochrome P450 CYP74A 2.05809
SCJFRT1007H07.g Hormone biosynthesis Jasmonic Acid Lipoxygenase
3.99155 SCCCRT1001E01.g Hormone biosynthesis Jasmonic Acid
Lipoxygenase 2.71944 Internode 1 july SCCCLR2C01F06.g Stress
Wound-induced 1.78615 SCEPRZ1010E06.g Protein Phosphatases
Serine/Threonine - PPM Family PP2C-like 1.55514 SCCCLR2002F08.g
Hormone related Auxin auxin repressed 1.60673 SCJFRZ3C03H08.g
Pathogenicity R-genes (receptors) With LRR 1.75681 SCEQRT2098H06.g
Pathogenicity R-genes (receptors) With LRR/NBS-LRR 1.68827
SCEZAM2058E08.g Receptors Receptor Ser/Thr kinase RLK Undefined
1.60291 SCACSB1037A07.g Stress Cytochrome P450 CYP98A 1.63
SCAGLR1043F02.g Calcium Calmodulin-binding proteins HSP70s (heat
shock) 2.03737 SCJFRZ2007F10.g Development ARC1 (arm repeat
protein) 1.82989 SCRUSB1062E12.g Others Putative triacylglycerol
lipase 1.49831 SCCCRZ1001C01.g Stress Drought-induced 1.52895
SCEZHR1088E02.g Protein Phosphatases Tyrosine Phosphatases Dual
Specificity Protein 1.87674 Phosphatases (DSPP) Internode 5 march
SCCCLR1066G08.g Transcription HGM (High mobility group protein)
1.57463 SCEZRZ1015G02.g Unknown protein Putative protein kinase
Casein kinase I 1.91199 SCAGFL1089C03.g Stress Glutathione
S-transferase 2.10704 SCEZLR1031G10.g Protein kinases Cell
cycle-related CDC2/CRK2 2.14401 SCSGSB1009D11.g Unknown protein
2.09248 SCCCFL4094H12.g Receptors Receptor Ser/Thr kinase RLK
Undefined 1.76665 SCRULB2065G10.g No matches 2.15317
SCQGLR1085F11.g Stress Drought-induced 2.7353 SCJFRZ2034D04.g
Others SET-domain protein 2.69909 SCBFFL4114B06.g Receptors
Receptor Ser/Thr kinase RLK Undefined 3.67808 SCEPRZ3087C08.g
Stress Drought and cold response Low temperature induced (LTI)
1.78187 SCCCLR1065F03.g Pathogenicity R-genes (receptors) With
LRR/NBS-LRR 1.7714 SCCCLR2C01F06.g Stress Wound-induced 2.334
SCUTLR2023D06.g Transcription CCAAT Hap 1.68942 SCEQLR1007G03.g
Calcium Calmodulin-binding proteins EF-1 alpha 1.64492
SCACLR2007G02.g Protein kinases Others Abcisic acid-inducible
1.57037 SCUTRZ2022G04.g Others Heat shock protein 2.11424
SCQGRT1040G03.g Development Expansin 1.7436 SCEQRT1026H08.g Stress
Cytochrome P450 CYP75 1.59596 SCAGFL1089G08.g no match 2.06063
SCJFRZ3C03H08.g Pathogenicity R-genes (receptors) With LRR 2.76853
SCEQRT2098H06.g Pathogenicity R-genes (receptors) With LRR/NBS-LRR
2.6343 SCCCLR2002H11.g Unknown protein 1.64637 SCVPRT2081G05.g
Protein kinases Cell cycle-related CDK 2.15674 SCCCLR1022F10.g
Others Glycine hydroxymethyltransferase 2.02802 SCBFSB1047C02.g
Others Hypothetical protein 2.58471 SCRULB1060F05.g Inositol
Inositol kinases 1-Phosphatidylinositol 4-kinase 1.65757
SCCCLR1024A02.g Receptors Receptor Ser/Thr kinase RLK Undefined
1.60332 SCEPRZ1008F02.g Transcription LIM (protein-protein
interaction) 1.833 SCCCFL4094H12.g Receptors Receptor Ser/Thr
kinase RLK Undefined 1.84294 SCACCL6008H06.g Stress Drought and
cold response Low temperature induced (LTI) 1.92651 SCJLRT1016G06.g
Stress Wound-induced Ribonuclease 3.13455 SCEZST3147A10.g
Transcription Zinc finger proteins C3H 2.21445 SCCCRZ1002H08.g
Others Saposin B domain-containing protein 2.32254 SCCCLB1003E11.g
Protein kinases Others REK-like 3.07187 SCSFAD1125C08.g
Pathogenicity Polygalacturonase-inhibiting 2.31427 Internode 5 july
SCCCLR1C04G08.g Protein kinases Casein kinases Casein kinase I
1.76524 SCVPRT2074D04.g Others unknown protein 1.75747
SCJFRZ3C03H08.g Pathogenicity R-genes (receptors) With LRR 2.52658
SCRFLR1012F12.g Others caffeic acid 3-O-methyltransferase 1.63946
SCCCLR1024C03.g Stress Drought and cold response putative aquaporin
2.50238 SCEQLR1091A10.g Others 60S Ribosomal protein L23 1.74167
SCCCRZ2C01F09.g Ubiquitination E2 1.62723 SCEPAM1020A03.g Protein
kinases Others ATN1-like 1.9435 SCSBHR1050B11.g Others Putative
senescence-associated protein 3.83889 SCJFRZ2007F10.g Development
ARC1 (arm repeat protein) 2.38995 SCCCRZ1001H05.g Transcription HLH
(helix-loop-helix) 4.15387 SCEQRT1033F01.g -- Zinc finger proteins
C2C2/Dof 3.65977 SCCCLR1048D07.g Hormone biosynthesis Salicylic
Acid 4.58868 SCSBHR1050B11.g Others Putative senescence-associated
protein 2.34488 SCSBSD2029F05.g Unknown protein 2.73215
SCCCLR2003E10.g Transcription NAM NAC 2.44948 SCCCLR2C02A05.g
Development Expansin 1.58639 SCACSB1037A07.g Stress Cytochrome P450
CYP98A 1.85253 SCCCLR1C03G01.g Hormone biosynthesis Jasmonic Acid
Linoleic acid desaturase 1.47918 SCCCLR1C05B07.g Protein kinases
Calcium-related CBL-interacting 2.71519 SCSBHR1050B11.g Others
Putative senescence-associated protein 2.45088 SCMCRT2103B04.g
Protein kinases Undefined 1.73105 SCCCLB1003E11.g Protein kinases
Others REK-like 3.30364 SCVPAM1055A12.g Protein kinases Casein
kinases Casein kinase I 1.67698 SCEZHR1088E02.g Protein
Phosphatases Tyrosine Phosphatases Dual Specificity Protein 3.28753
Phosphatases (DSPP) SCCCRZ1001F02.g Stress Drought and cold
responsive putative aquaporin 2.29254 SCEZHR1087F06.g Stress
Cytochrome P450 CYP84 2.3784 SCBFRZ2046D07.g Protein kinases RLCK
NAK-like 2.13676 SCRUAD1063D03.g No matches 1.93091 SCSGFL4193B05.g
Stress Cytochrome P450 CYP73 1.58639 SCJFRZ2014A03.g -- R-genes
(receptors) With LRR/NBS-LRR 2.52532 SCCCLR1048F03.g Unknown
protein 2.10185 SCSBHR1050B11.g Others Putative
senescence-associated protein 3.73288 Internode 9 march
SCVPLR2012A10.g Hormone biosynthesis Ethylene ACC oxidase 1.78441
SCEQRT2100B02.g Stress Drought and cold response putative aquaporin
2.00347 SCCCRZ1001F02.g Stress Drought and cold response putative
aquaporin 1.7121 SCMCRT2103B04.g Protein kinases Undefined 1.80135
SCAGLR1043F02.g Calcium Calmodulin-binding proteins HSP70s (heat
shock) 2.89959 SCEZHR1088E02.g Protein Phosphatases Tyrosine
Phosphatases Dual Specificity Protein 2.79028 Phosphatases (DSPP)
SCCCST3001H12.g Stress Drought and cold response putative aquaporin
2.0084 SCCCRZ1002E08.g Stress Drought and cold response putative
aquaporin 1.79386 SCCCLR1024C03.g Stress Drought and cold response
putative aquaporin 1.80152 SCJFRT2055G07.g Ubiquitination
Polyubiquitin 1.60639 SCEPRZ1010E06.g Protein Phosphatases
Serine/Threonine - PPM Family PP2C-like 1.53961 SCCCCL3002C09.b
Stress Glutathione S-transferases 1.55841 SCEZRZ1015G02.g Unknown
protein Putative protein kinase Casein kinase I 1.85411
SCCCSD2001E05.g Pathogenicity Protease inhibitors thaumatin 6.05847
SCUTST3090E03.g Unknown protein 1.56216 SCBFFL5074C09.g Stress
Drought and cold response reversibly glycosylated 1.79364
polypeptide SCAGFL1089C03.g Stress Glutathione S-transferases
1.6557 SCSGSB1009D11.g Unknown protein 2.4264 SCCCSD1003E02.g
Pathogenicity Protease inhibitors thaumatin 4.87282 SCCCLR2C01F06.g
Stress Wound-induced 3.40039 SCCCAD1001C08.g Stress Peroxidases P7X
1.97943 SCCCAM2004G02.g Hormone related Auxin Auxin transport/auxin
eflux carrier 1.78676 SCSFAD1125C08.g Pathogenicity
Polygalacturonase-inhibiting 1.60435 SCCCLR1001A06.g Others
Extensin-like protein 1.57973 SCAGLR1043E04.g Stress Cytochrome
P450 CYP74A 1.9974 SCBFSB1047C02.g Others Hypothetical protein
2.05746 SCCCLR2C01G07.g Protein kinases SNF1-related 1.76015
SCEZHR1047A01.g Receptors Receptor Ser/Thr kinase RLK undefined
with LRR 1.60061 SCVPCL6041F01.g Receptors Receptor Ser/Thr kinase
RLK with lectin domain 1.59157 SCEQRT1028C03.g Pathogenicity
R-genes transduction PR 4.96024 SCCCST1001C04.g No matches 1.67914
SCRFHR1009G06.g Stress Infected libraries 2.02309 SCCCCL3120G07.g
Calcium Calmodulin-binding proteins HSP70s (heat shock) 1.67313
SCRFLR1012F12.g Others caffeic acid 3-O-methyltransferase 1.76972
SCMCSD2061D05.g Protein kinases Undefined 2.00471 Internode 9 july
SCRFLR1012F12.g Others caffeic acid 3-O-methyltransferase 1.73901
SCCCLR1022F10.g Others Glycine hydroxymethyltransferase 1.93433
SCSGAM1094D05.g Hormone biosynthesis Salicylic Acid 1.62394
SCSBAD1084C01.g Others Tubulin alpha-1 chain 1.7221 SCSBAD1084C01.g
Others Tubulin alpha-1 chain 1.70571 SCEPRZ1008F02.g Transcription
LIM (protein-protein interaction) 2.3459 Leaf march SCCCAD1004H02.g
Stress Catalases 2.34832 SCVPCL6042B11.g Receptors Receptor Ser/Thr
kinase RLK Undefined 2.05874 SCCCLR2C01F06.g Stress Wound-induced
1.68028 Leaf may SCUTST3084F06.g Stress Drought and cold response
Low temperature induced (LTI) 2.65146 SCJFLR1074E09.g Stress
Drought and cold response Low temperature induced (LTI) 1.7881
SCCCLR1C08G10.g Transcription Myb LHY/CAA1 1.7247 SCACLR1126E09.g
No matches 1.88699 SCCCLR2C01F06.g Stress Wound-induced 1.98605
SCEQLB2019B08.g Protein kinases SNF1-related 2.27361
SCEQRT1031D02.g Adapters 14-3-3 proteins 1.89991 SCCCRZ1002E08.g
Stress Drought and cold response putative aquaporin 2.22348
SCQGLR1085F11.g Stress Drought-induced 2.57185 SCJLRT1023A09.g
Transcription HLH (helix-loop-helix) 2.21673 SCSBAM1085B06.g
Hormone biosynthesis Jasmonic Acid Linoleic acid desaturase 1.87983
SCEPRZ3087C08.g Stress Drought and cold response Low temperature
induced (LTI) 2.40687 SCEQRT1025D06.g Adapters 14-3-3 proteins
2.23722 SCCCRZ2001E12.g Transcription HLH (helix-loop-helix)
PIF-like 2.17995 SCUTST3152C08.g Calcium Calmodulin 1.78114
SCACCL6008H06.g Stress Drought and cold response Low temperature
induced (LTI) 3.24015 SCSBST3096H04.g Inositol Inositol
phosphatases Inositol-1,4,5-trisphosphate 2.8703 5-Phosphatase
SCEQRZ3020C02.g Receptors Receptor Ser/Thr kinase RLK undefined
with LRR 1.70665 SCCCCL6003D08.g Ubiquitination F-box protein
1.9614
SCEQRT1025D04.g Receptors G-protein coupled 1.78293 SCEPRZ1010E06.g
Protein Phosphatases Serine/Threonine - PPM Family PP2C-like
2.54771
Confirmation of Expression Data
[0047] Real-time PCR reactions were performed to confirm the
expression data obtained. cDNA templates were generated from a pool
of 8 individuals from the cross between commercial varieties
(SP80-180 and SP80-4966), from the multiple crossings among S.
officinarum and S. spontaneum genotypes or from individual tissue
samples. Leaf or internode RNA derived from three HB genotypes
(CTC98-243, CTC98-246, CTC98-253) and three LB genotypes
(CTC98-261, CTC98-265, CTC98-272) (FIG. 3). The mRNA levels for
nine SAS show some variation in the different genotypes and pools
but all transcript levels are in agreement with the expected based
on microarray results.
[0048] The differential expression of the genes in high and low
sugar content plants could also be confirmed by northern blot
hybridization. Four genes with greater expression in the high sugar
content plants from the SP80-180 vs. SP80-4966 progenies
(SCSBAM1085B06.g, SCACLR1126E09.g, SCEQRZ3020CO2.g and
SCCCLR1C08G10.g) and three with increased expression in the low
sugar content plants (SCSBST3096H04.g, SCEQLB2019B08.g and
SCQGLR1085F11.g) were analyzed by RNA-blots using total RNA from
three sugarcane individuals to provide replication for gene
expression trends. FIG. 4 shows that the microarray data was
confirmed in at least two of the three independent samples
collected nine months after planting, indicating a high consistency
between the two data sets.
[0049] To confirm gene expression trends along the growing season
we determined the mRNA levels for the same seven genes in the 7HS
(high sugar) and 7LS (low sugar) pools collected 6, 7, 9, 11 and 13
months after planting (FIG. 5). The inset graph represents the
expression profile of each gene plotted for each population. The
four genes found to be enriched in the high sugar content plants
were consistently differentially expressed along the growing season
(FIG. 5 a-d). These genes are possibly involved in the control of
sucrose synthesis, accounting for the higher sugar content in these
segregant plants. The genes with more transcripts in the low sugar
content plants showed a less consistent pattern (FIG. 5 e-g). All
of them were differentially expressed in the plants at nine months
after planting, confirming the expression observed by microarrays,
but only the one encoding dehydrin, a stress-related protein (FIG.
5g) had a more consistent pattern along the growing season.
Identity/Function of Differentially Expressed Genes
[0050] The SAS represented in our array were chosen from 7381 genes
catalogued by the SUCAST project (Papini-Terzi et al., 2005; Souza
et al., 2001) and from the SUCAMET Catalogue of sugarcane
metabolism genes (available on the World Wide Web at
sucest-fun.org). The SUCAST Catalogue includes Protein and
Functional categories such as Receptors, Protein Kinases, Protein
Phosphatases, Small GTPases, Transcription Factors, Calcium,
Inositol, Ubiquitination, Hormone Biosynthesis, Development, Stress
and Pathogenicity, among others. The catalogue also contains 548
SAS corresponding to hypothetical proteins or new genes for which
no function can be inferred solely from the sequence or no
similarity has been found to genes in public databases (`no
matches`). The tissue-specificity of the selected genes has been
evaluated in a previous work (Papini-Terzi et al., 2005), which
revealed 217 genes with preferential expression in one of the six
tissues analyzed (flowers, buds, leaves, roots, mature and immature
internodes) and 153 highly ubiquitous genes.
[0051] Leaf mesophyll cells are the primary photosynthetic tissue,
and photosynthate, mainly in the form of sucrose, is transported to
meristems and developing organs. In sugarcane, growing young leaves
and stem are the main carbohydrate-importing tissues. Source and
sink tissues must be co-ordinately regulated at the level of gene
expression and enzyme activity to produce rapid growth and
efficient sucrose accumulation. Light and sugars regulate growth
activities by a coordinated modulation of gene expression and
enzyme activities in both, carbohydrate-exporting (source) and
carbohydrate-importing (sink) tissues. Gene regulation is based on
sensing different signals or stimuli, which then is transmitted
through a signaling pathway that in the end leads to an increase or
decrease of transcription. In sugar signaling, the first step is to
sense the nature and level of the specific sugar. While elevated
cellular levels of sugar up regulate genes involved in the
synthesis of polysaccharides, storage proteins, pigments, as well
as genes associated with defense responses and respiration, sugar
deprivation enhances the expression of genes involved in
photosynthesis and resource remobilization, such as the degradation
of starch, lipid, and protein (Koch, 1996; Yu, 1999; Ho et al.,
2001). Although the regulatory effect of sugars on photosynthetic
activity and plant metabolism has long been recognized, the concept
of sugars as central signaling molecules is relatively new
(reviewed by Rolland et al., 2002).
[0052] In this work, we evaluated the expression levels of SUCAST
and SUCAMET genes in four tissues (leaf, internodes 1, 5 and 9)
from three sugarcane populations with contrasting sugar
accumulation capacities and four commercial varieties. We describe
a total of 203 SAS (Sequence ID Nos 1-203) differentially expressed
between the high and low brix populations in at least one of the
tissues analyzed (Tables V to IX). Two of them appeared
differentially expressed in five of the samples analyzed, four in
four, fourteen in three and thirty in two, totalling 50 genes for
which transcripts are altered in more than one sample (Table X).
The differentially expressed genes belong to several functional
categories including calcium signalling, stress responses,
transcription and ubiquitination. These genes and their variants
can be used to predict sugar content from plants or generate plants
with higher sucrose content.
TABLE-US-00010 TABLE X Number of occurrences of differential
expression for each SAS in all the samples analyzed. Occurrences
Number of SAS 5 2 4 4 3 14 2 30 1 153
[0053] Since a significant number of genes encoding SNF1
related-kinases were found differentially expressed (see below) we
looked for differentially expressed genes encoding SNF1s and their
regulators in commercial varieties that varied in sucrose content.
Table XIV lists several members of this family of proteins whose
expression was found to be associated to sucrose content.
[0054] In an alternate approach, mature (Internode 9),
intermediately mature (Internode 5) and immature (Internode 1) culm
samples were compared. The aim of these comparisons was to reveal
genes differentially expressed when internodes rich in sucrose were
compared to the first internodes poor in sucrose. A total of 186
genes were identified as developmentally regulated during culm
maturation (Tables XV to XX). Forty-six of them were also found to
be differentially expressed in the direct comparisons between high
and low brix and eighteen of them were altered in up to 5 of the
samples analysed. Table XXI shows the 18 SAS found differentially
expressed in at least two of the biological samples considered (the
data regarding 14 of them were retrieved from Felix, 2006 as
indicated in the Table). SEQ ID No:s 229-373 relate to the 140 SAS
whose expression was altered in high sugar internodes which are not
contained in the SEQS Nos 1-203 group. The data revealed by this
experimental design indicates that the genes differentially
expressed in high vs. low brix plants may have a role in culm
maturation and may improve this process and consequently alter
sucrose content if altered in transgenic plants.
[0055] There are several genes encoding protein kinases involved
with the calcium signalling pathway altered in association with
sucrose content. One (SCEQRT2099H01.g) is similar to members of the
CDPK family (Calcium-dependent Protein Kinase) and nine others
(SCACLR1036B06.g, SCBFSB1046D04.g, SCCCLR1C05B07.g,
SCEQLB2019B08.g, SCMCRT2103B04.g, SCCCLR2C01G07.g, SCCCLB1002D12.g,
SCEQRT2030G04.g, SCSGHR1070F12.g) to CIPKs (CBL-interacting protein
kinases) from the SnRK3 subgroup of plant SNF-like protein kinases
(Hrabak et al., 2000). An Arabidopsis CIPK14 has been shown to be
induced by sucrose, and sucrose-responsive elements in its promoter
have been identified (Lee et al., 2005). Several studies have
reported that some CDPKs and SnRK (SNF1-related kinases) are able
to phosphorylate and regulate the enzyme sucrose synthase (Hardin
et al., 2003; Hardin et al., 2004; Huber et al., 1996; Zhang et
al., 1999). Plant SNF1-related kinases are regulated by regulatory
subunits AKINbetagamma (Lumbreras et al., 2001). We found two SAS
coding for such SnRK putative regulatory subunits, SCEQLR1092H10.g
and SCJFST1011B06.g, the latter being differentially expressed in
seven of the samples analyzed. We also found a gene encoding a
SnRK1 (SCJFRZ2032G01.g) down-regulated in mature internodes in
relation to immature internodes. SnRK1 (SNF1-Related Protein
Kinase-1) is a plant protein kinase with a catalytic domain similar
to that of SNF1 (Sucrose Non-fermenting-1) of yeast and AMPK
(AMPactivated protein kinase) of animals (Halford et al., 2003).
Carraro et al., (2001) identified at least 22 sugarcane expressed
sequence tag (EST) contigs encoding putative SnRKs in the SUCEST
database. Studies led to the hypothesis that SnRK1 is activated in
response to high intracellular sucrose and/or low intracellular
glucose levels (Halford et al., 2003). The first plant protein to
be identified as a substrate for SnRK1 was a HMG-CoA reductase in
A. thaliana (Dale et al., 1995). Subsequently, two other important
enzymes, SPS and NR were shown to be substrates for SnRK1
phosphorylation in Ser-binding sites. In both cases,
phosphorylation results in inactivation of the enzyme, although the
inactivation of NR and SPS also requires the binding of a 14-3-3
protein to the phosphorylation site (Bachmann et al., 1996;
Moorhead et al., 1999).
[0056] Four genes encoding CIPKs were found to be differentially
expressed when mature and immature internodes were compared
(SCJFRZ2032C08.g, SCJLRT1023G09.g, SCCCLR1C05B07.g,
SCJLRZ1023H04.g). Our published studies have also identified two
additional genes encoding SNF1-related SnRK3 CIPKs (SCCCLR2C01G07.g
and SCMCRT2103B04.g) that are differentially regulated when mature
and immature sugarcane internodes are compared that corroborate the
present data and confirm a role for SNF-related kinases and their
regulators in sucrose synthesis and accumulation (Felix, 2006).
Additionally, three genes encoding SNF1-related kinases similar to
osmotic stress-related kinases (SCCCST1004A07.g, SCEPRZ1009C10.g
and SCCCST1006B11.g) were also found to be differentially
expressed.
[0057] CIPKs interact with Calcineurin B-like proteins (CBL) (Shi
et al., 1999). We found six genes encoding CBLs in the SUCEST
database and thirty-one CIPKs, twenty-four of which were analyzed
in this work. A calreticulin (SCRFLR2037F09.g) and a calmodulin
(SCUTST3152C08.g) were found to be enriched in LB immature
internodes and leaves respectively, and five calmodulin-binding
proteins to be up-regulated (SCCCAM1001A03.g, SCCCLR2C02D03.g,
SCEZLB1012F10.g, SCAGLR1043F02.g, SCEQLR1007G03.g,
SCCCCL3120G07.g). Calcium signalling is effected via changes of
calcium concentration and calcium sensing proteins such as
calmodulin, calcineurin and calreticulin (Sanders et al., 2002).
The latter relay the signal downstream through phosphorylation
cascades and changes in gene expression. Studies with the sucrose
synthase from maize showed that phosphorylation of this enzyme at
the residue Ser-15 by CDPKs stimulates its sucrose cleavage
activity (Hardin et al., 2003; Huber et al., 1996). Moreover, CDPKs
may phosphorylate at Ser-170 and target this enzyme for
26S-proteasome-dependent degradation (Hardin et al., 2003; Hardin
& Huber, 1999). Sucrose synthase is related to several
physiological processes, including sink/source relationships within
the plant (Hanggi & Fleming, 2001; Zrenner et al., 1995) and
may contribute to sucrose accumulation in sugarcane. Additionally,
it has been shown that some calcium-dependent kinases can
phosphorylate and inactivate sucrose-phosphate synthase, which has
a key role in sucrose biosynthesis (McMichael et al., 1995;
Pagnussat et al., 2002). Taken together, these results suggest
that, as sucrose biosynthesis seems to be (at least partially) a
SNF1- and calcium-regulated process, genes encoding the
calcium-dependent kinases and SNF1-related protein kinases and
their modulators differentially expressed in our study may
represent critical points in the control of sucrose synthesis and
accumulation in sugarcane. Consequently, these sugarcane genes can
be used to increase sucrose content in transgenic plants.
[0058] To confirm that differential gene expression associated to
sucrose content was indeed reflecting a role for these genes in
sucrose synthesis or accumulation we obtained sugarcane transgenic
plants where the gene encoding CIPK-8 (SAS SCEQLB2019B08.g) was
silenced by RNAi interference. Sugarcane embryonic callus from the
cultivars SP80-185, SP94-3116, CTC1, SP83-2847, SP80-1842 and
SP91-1049 were bombarded by biolistics with a construct where 331
by of SAS SCEQLB2019B08.g (SEQ ID No. 378) was cloned in the sense
and antisense orientation. The 331 by fragment was obtained by PCR
using the primers SNFL1 (SEQ ID No. 374): 5'-CCCTCTAGACTCGAG
CATTCATTCCATTCCGTTCC-3' and SNFL2 (SEQ ID No. 375):
5'-CCCAAGCTTGAATTC CGCCACCAGTAGCAAATTCT-3'. The fragment was
digested with the enzymes XhoI and EcoRI and cloned in the
pHannibal vector (Wesley et al., 2001) digested with the same
enzymes for the sense orientation. The same fragment was then
digested with HindIII and XbaI and cloned in the vector already
containing the sense construct digested with the same enzymes for
the antisense orientation. FIG. 7 shows an alignment to two
additional EST sequences encoding CIPKs (CIPK-29 SCSGHR1070F12.g
and CIPK-1 SCCCCL5001D11.g) that are 95 and 85% identical,
respectively, to the CIPK-8 fragment region amplified (red line)
and show 65% overall identity when the three complete sequences are
considered. CIPK-29 has also been identified as differentially
expressed when high brix and low brix plants were compared using
cDNA microarrays. CIPK-1 was not detected by our array experiments
as a differentially expressed gene. Transgenic plants were
generated by co-transformation of the pHannibal-CIPK RNAi construct
and the pHA9 vector (Wei and Albert, U.S. Pat. No. 6,706,948) which
contains the maize ubi1 promoter driving a neomycin
phosphotransferase II gene and NOS terminator. To verify that
CIPK-8 mRNA levels were decreased in the transgenic plants obtained
CIPK-8 mRNA levels were quantitated by Real-time PCR. 8 shows the
mRNA levels for CIPK-8 in relation to the reference gene GAPDH. The
real-time PCR primers used are listed in Table XII. Since CIPK-29
and CIPK-1 were very similar to CIPK-8 their mRNA levels were also
measured in the transgenic plants. Leaves from four plants from
cultivar SP94-3116 transformed with the CIPK-8 RNAi construct and
four construct plants transformed with the empty vectors alone are
shown. The data indicates successful silencing for the CIPK-8 gene
when control and RNAi CIPK-8 plants are compared. The data also
indicates that the construct introduced was able to silence the
CIPK-29 and CIPK-1 genes as well. To confirm the increased sucrose
content due to the silencing of the genes total and reductive sugar
levels were determined by HPLC (high performance liquid
chromatography). FIG. 8 indicates the sucrose levels in control and
CIPK silenced plants as well as the ratio between sucrose to
glucose+fructose. Silenced plants presented in average 64.18 .mu.g
of sucrose/mg of leaf dried weight while control plants presented
21.95 .mu.g/mg. The ratio of sucrose/glucose+fructose was also
altered. CIPK silenced plants presented a ratio of 6.81 of sucrose
over the monosaccharides while the control plants showed an average
ratio of 0.57. This may possibly indicate an overall 12 fold more
efficient conversion of the monosaccharides glucose and fructose
into sucrose in the leaves of silenced plants.
[0059] Since both CIPK-8 and CIPK-29 were found to be
differentially expressed in sugarcane leaves we postulate that CIPK
kinases regulate sucrose synthesis in sugarcane. Additionally,
CIPKs may have a role in regulating sugar accumulation in the
internode tissues since several of them were detected as
differentially expressed in these organs. Since the fragment used
to silence the differentially expressed CIPK-8 and CIPK-29 was also
efficient in silencing CIPK-1, which has an overall identity to
CIPK-8 and CIPK-29 of 65%, it is possible that the use of
SNF1-related genes with identity to the genes protected in this
patent, either to the whole genes, or fragments of the genes, of at
least 65%, but not restricted to 65%, may also be able to silence
the protected genes. The reverse scenario is also plausible. Since
CIPK-1, a gene that was not detected in our microarray data as
associated to sucrose content, was silenced by the CIPK-8 construct
even though it presented only 65% sequence identity to its overall
available sequence, it is possible to silence sucrose associated
genes by using sequences from similar sucrose-unrelated genes.
[0060] Additional genes that may contribute to sucrose synthesis
and accumulation are described below. We identified five genes
encoding aquaporins among the differentially expressed genes when
high brix and low brix plants were compared (SCCCLR1024C03.g,
SCCCRZ1001F02.g, SCCCRZ1002E08.g, SCCCST3001H12.g,
SCEQRT2100B02.g). In a previous work they were demonstrated to be
down-regulated in the mature internodes (Felix, 2006). This large
and diverse family of membrane proteins, also known as MIPs (Major
Intrinsic Proteins) is primarily involved in the regulation of
water movement between cells and cell compartments, although many
of them also facilitate the passage of small solutes (rev. Maurel
and Chrispeels, 2001; Chaumont et al, 2005). According to their
subcellular localization, aquaporins can be classified as plasma
membrane intrinsic proteins (PIPs) or tonoplast intrinsic proteins
(TIPs). The aquaporins genes we identified as differentially
expressed fall into both of these categories. The accumulation of
sucrose in such high concentrations as seen in sugarcane cells
certainly represents an osmotic challenge, which demands efficient
control of solute compartmentation. As key players in the
equilibration of water potentials via regulation of membrane
permeability, aquaporins may have a fundamental role in the process
of sugar storage in sugarcane vacuoles. It has been observed in
Arabidopsis that loss of the aquaporin TIP1; 1 severely affects
carbohydrate metabolism and transport (Ma et al., 2004) and the
authors postulate that this aquaporin could be involved in a
vesicle-based routing of carbohydrates towards the central vacuole.
Due to the diversity of roles described for the members of this
family, additional experiments are necessary to elucidate the
possible roles of these sugarcane aquaporins in the sugar
accumulation process. Sugar-signaling pathways do not operate in
isolation but are part of cellular regulatory networks. Recent
results clearly show cross talk between different signaling
systems, especially those of sugars, phytohormones, and light. Most
of the stress-related genes are cold- and drought-induced; there is
also a ribonuclease that appeared altered four times and a
wound-induced protein differentially expressed in 5 samples. Four
sugarcane stress-related ESTs belong to a class of
low-molecular-weight hydrophobic proteins (LTI) involved in
maintaining the integrity of the plasma membrane during cold,
dehydration and salt stress conditions. These genes are activated
by environmental factors, such as dehydration and salinity and by
chemical signals such as abscisic acid (ABA) (Morsy et al.,
2005).
[0061] Sixteen differentially expressed genes encode transcription
factors. A putative AP2/EREBP transcription factor
(SCBGLR1099G02.g) was shown to have enhanced expression in leaves
from plants with high sugar content. AP2/EREBP form a family of
plant-specific transcription factors that contains an AP2/EREBP
(ethylene responsive element binding protein) domain, a conserved
region of 60 aminoacids involved in DNA binding (Jofuku et al.,
1994; Okamuro et al., 1993; Riechmann and Meyerowitz, 1998). AP2
transcription factors are involved in the specification of flower
organ and meristem identity, and suppression of flower meristem
indeterminacy (Bowman et al., 1989; Irish and Sussex, 1990; Kunst
et al., 1989; Okamuro et al., 1993). AP2 is also required for ovule
and seed coat development (Jofuku et al., 1994; Leon-Kloosterziel
et al., 1994; Modrusan et al., 1994). Although the most remarkable
function of AP2 is in flower development, its transcripts are also
detected in leaves, stems, and seedlings (Jofuku et al., 1994),
opening the possibility of diverse functions for different members
of the AP2 family. It was already shown that ap2 mutations cause
changes in the ratio of hexose to sucrose during seed development
(Ohto et al., 2005). Because of this observation, it is believed
that potential targets of AP2 activity may be enzymes involved in
sugar metabolism.
[0062] We found eight CYP-related genes altered among the
differentially expressed genes (SCEQRT1026H08.g, SCAGLR1043E04.g,
SCUTAM2005B03.g, SCSGFL4193B05.g, SCACSB1037A07.g, SCEZHR1087F06.g,
SCSGHR1069F04.b, SCQGHR1012B09.g). Cytochrome P450 monooxygenases
(P450s) are used widely in plant biosynthetic and detoxicative
pathways including synthesis of lignins, UV protectants, pigments,
defense compounds, fatty acids, hormones, signaling molecules,
breakdown of endogenous and toxic compounds (Schuler and
Werck-Reichhart, 2003). During sugarcane internode maturation,
parenchyma cells differentiate into highly specialized
sucrose-storage compartments. This process imposes cellular
reorganization to cope with osmotic and oxidative stress, and
involves progressive lignification and suberization of cell walls
to prevent pathogen invasion and water loss (Kolattukudy, 1984;
Jacobsen et al., 1992), which may explain the predominance of
stress-related genes (34 SAS) among the genes described in this
work.
[0063] Eighteen differentially expressed SAS encode for hormone
biosynthesis or hormone-related genes either when comparing the
high brix against low brix plants or the high brix against low brix
internodes (SCCCAM2004G02.g, SCCCCL6002B05.g, SCCCFL4091A07.g,
SCCCLR1048D07.g, SCCCLR1C03G01.g, SCCCLR2002F08.g, SCCCRT1001E01.g,
SCEQRT1024E12.g, SCEQRT1028H06.g, SCEZLB1009A09.g, SCJFRT1005C11.g,
SCJFRT1007H07.g, SCRFLR1012D12.g, SCSBAM1085B06.g, SCSGAM1094D05.g,
SCVPLR2012A10.g, SCVPRZ2038F04.g, SCVPRZ3025G09.g). Three encode
for salicylic acid biosynthesis and six of them code for jasmonate
biosynthesis genes. Two ESTs that were up regulated in high sugar
content (HS) mature leaves codes for an omega-3 fatty acid
desaturase-FAD8. In higher plants, the membrane lipids contain a
high proportion of trienoic fatty acids (TAs). It has been
suggested that these fatty acids, especially linolenic acid, are
precursors of a defense-related signal molecule, jasmonate (JA). In
Arabidopsis, three genes encoding the omega-3 fatty acid
desaturase, namely FADS, FAD7 and FAD8, are responsible for the
production of TAs. Environmental stimuli, such as wounding, salt
stress and pathogen invasion, which lead to a rapid increase in JA
production, significantly induce expression of the FAD7 and FAD8
genes (Nishiuchi and Iba, 1998). The data points to a role of JA
and salicylic acid synthesis in sucrose metabolism. This is the
first report of the involvement of these hormones in sucrose
synthesis.
[0064] Recent evidence suggests that plants have many different
types of receptor-like protein kinases (RLKs) that may transduce
extra cellular information into the cell. Twenty-one sugarcane SAS
encoding for a RLK were found to be differentially enriched in the
high sugar content plants and seventeen when mature and immature
internodes were compared. RLKs have been identified from a number
of plants and have been categorized into classes based on different
structural motifs found in their extra cellular domains. The
physiological functions of most RLKs are unknown, but some of them
are involved in disease resistance and plant development (Becraft,
2002).
[0065] A SAS homologous to a gene encoding a Myb-repeat
transcription factor (SCCCLR1C08G10.g), similar to CIRCADIAN CLOCK
ASSOCIATED (CCA1) or LATE ELONGATED HYPOCOTYL (LHY), was up
regulated in High Sugar mature leaves. CCA1/LHY and the TIMING OF
CAB EXPRESSION 1 (TOC1) are thought to participate in a negative
feedback loop, which is part of a model for the central oscillator
in the Arabidopsis circadian clock. In higher plants the circadian
clock controls hypocotyl elongation, daily leaf movements,
flowering time and the rhythm of CO.sub.2 fixation (McClung, 2001).
A sugarcane LHY/CCA1 was found to be enriched in the high sugar
content individuals and this expression profile was also observed
throughout the growing season. In tomato, Jones and Ort (1997) have
demonstrated that the circadian rhythm controls the timing of
sucrose-phosphate synthase phosphatase activity, which in turn,
determines the activation of sucrose phosphate synthase (SPS). SPS
catalyses the conversion of UDP-glucose and fructose-6-phosphate to
sucrose-6-phosphate, the second last step in sucrose biosynthesis
(Huber and Huber, 1996). Pathre et al., (2004) demonstrated that
the diurnal variation observed in the activity of SPS was not due
to any intrinsic rhythm, but due to the transient changes in
environmental conditions, like irradiance and temperature. When the
circadian clock was correctly tuned with the environment,
Arabidopsis plants presented increased photosynthesis and growth
(Dodd et al., 2005). The sugarcane EST was mainly expressed in
mature and immature leaves, lateral bud and flower, but also
presented a weak expression in immature internodes and roots (not
shown). We hypothesize that the expression profile of LHY/CCA1
transcripts in HS plants could be related to a photosynthetic
advantage and, consequently, an enhanced carbon fixation. LHY/CCA1
may control the transcription of a protein phosphatase that
subsequently activates the SPS enzyme, increasing sucrose
synthesis.
[0066] Two SAS encoding for 14-3-3 proteins SCEQRT1025D06.g and
SCEQRT1031D02.g) were found to be more expressed in mature leaves
from the Low Sugar population and four to be down-regulated in
mature internodes ((SCCCRZ1001D02.g, SCCCLR1022D05.g,
SCEQRT1025D06.g, SCEQRT1031D02.g). Recent reports pointed out the
importance of these adapter proteins in plant metabolic pathways
(Ferl, 2004). It was suggested that the members of this family
affect nitrate fixation by regulating nitrate reductase (NR) and
carbohydrate metabolism by binding to SPS. This enzyme has several
putative phosphorylation sites that regulate its activity by 14-3-3
dependent and independent mechanisms. Non-14-3-3 events include
phosphorylation of SPS on Ser-424 and Ser-158 which is thought to
be responsible for light/dark modulation and osmotic stress
activation of the enzyme (McMichael et al., 1993; Toroser and
Huber, 1997). However, there is a site-specific regulatory
interaction between 14-3-3 proteins and Ser-229 of spinach SPS,
which inhibits SPS activity (Toroser et al., 1998). This regulatory
node is likely to be the same that occurs in the NR regulation. In
its unphosphorylated state, SPS is active. Phosphorylation by a
kinase (e.g. SNF1, Bachmann et al., 1996; Moorhead et al., 1999)
does not inactivate SPS, but tags the enzyme for 14-3-3 binding,
which completes the signal-induced transition toward inactivation.
SPS that is phosphorylated and bound by 14-3-3s may be inactivated
directly in a reversible manner or may be destabilized and
subjected to proteolysis (Sehnke et al., 2002; Comparot et al.,
2003). It has been reported that during sugar starvation targets
for 14-3-3 proteins are degraded by proteases; the function of this
is not clear but it was suggested to represent a safety valve for
metabolic regulation (Cotelle et al., 2000). Various research
groups reported the impact of 14-3-3 proteins on metabolism.
Overexpression of 14-3-3 proteins in potato induced an increase in
catecholamine and soluble sugars contents in leaves, whilst a
14-3-3 antisense experiment increased the tuber starch content, NR
activity and amino acid composition (Prescha et al., 2001;
Swiedrych et al., 2002). In addition, Zuk et al., (2003) observed a
significant increase in potato SPS and NR activities when all of
the six 14-3-3 isoforms were repressed.
[0067] There are three enzymes involved on the biosynthetic pathway
of lignin: cinnamoyl-coenzyme A reductase (CCR), cinnamyl alcohol
dehydrogenase (CAD) and caffeic acid 3-O-methyltransferase (COMT).
A SAS coding for a COMT (SCRFLR1012F12.g) was found to be
differentially expressed in four different samples. Lignins are
phenolic polymers found in the secondary cell walls of vascular
plants. They play an important role by reducing the permeability of
the cell wall to water and provide mechanical strength and defense
against wounding and infection (Lewis and Yamamoto, 1990). The
importance of lignin biosynthesis as dominant process in maturing
sugarcane stems was observed by Casu et al., (2004). The storage
parenchyma of the sugarcane maturing stem internodes is extensively
lignified and Jacobsen et al., (1992) proposed that this process
parallels to the increase in sucrose content observed in matures
internodes. This lignification could provide defense against
wounding and infection for these plants. Low lignin levels could,
on the other hand, lead to high sucrose accumulation, or COMT could
have an additional function in sucrose synthesis or accumulation
that has not been previously identified. To test for this
hypothesis and confirm that COMT differential gene expression
associated to sucrose content was indeed reflecting a role for
these genes in sucrose synthesis or accumulation we obtained
sugarcane transgenic plants where SAS SCRFLR1012F12.g was silenced
by antisense expression. Sugarcane embryonic callus from the
cultivars SP83-2847, SP91-1049, SP80-185, CTC1 and CTC5 were
bombarded by biolistics with a construct where a 535 by fragment of
SAS SCRFLR1012F12.g (SEQ ID No. 380) was cloned in the antisense
orientation in the BamHI site of vector pAHC17. The 535 by fragment
was obtained by PCR using the primers COMT(AS)pAHC17 forward (SEQ
ID No. 376): 5' CGCGGATCCGACGTCGTCAAGTGCCAGAT3' and COMT(AS)pAHC17
reverse (SEQ ID No. 377): 5'CGGGATCCGCGTTGGCGTAGATGTAGGT3'. The
fragment was digested with the enzyme BamHI, cloned in the pAHC17
vector (Christensen and Quail, 1996) digested with the same enzyme
and clones were sequenced to identify a construct where the insert
was in the antisense orientation. Transgenic plants were generated
by co-transformation of COMT(AS)/pAHC17 construct and the pHA9
vector (Wei and Albert, U.S. Pat. No. 6,706,948). To verify that
COMT SCRFLR1012F12.g mRNA levels were decreased in the transgenic
plants obtained COMT mRNA levels were quantitated by Real-time PCR.
FIG. 9 shows the mRNA levels for SCRFLR1012F12.g in relation to the
reference gene GAPDH in plants of variety SP83-2847 transformed
with the COMT(AS/pAHC17 construct. The real-time PCR primers used
are listed in Table XII. Leaves from five plants transformed with
the COMT antisense construct and five plants transformed with the
vectors alone are shown. The data indicates successful silencing
for the COMT gene when control and antisense plants are compared.
To check if silencing of the genes would lead to increased sucrose
content, total and reductive sugar levels were determined by HPLC
(high performance liquid chromatography). FIG. 9 indicates the
sucrose levels in control and COMT silenced plants as well as the
ratio between sucrose to glucose+fructose. Silenced plants
presented in average 29.34 .mu.g of sucrose/mg of leaf dried weight
while control plants presented 20.7 .mu.g/mg. The ratio of
sucrose/glucose+fructose was also altered. COMT silenced plants
presented a ratio of 1.74 of sucrose over the monosaccharides while
the control plants showed an average ratio of 0.71. This may
possibly indicate an overall 2.4 fold more efficient conversion of
the monosaccharides glucose and fructose into sucrose in the leaves
of silenced plants.
[0068] Signals can be perceived and amplified at the cell membrane
by receptors coupled to a variety of signaling pathways, including
the inositol 1,4,5-trisphosphate (IP3) pathway. This second
messenger is produced from the hydrolysis of phosphatidylinositol
4,5 bisphosphate and raises Ca.sup.2+ levels in the cytosol
(Berridge, 1993). The inositol-polyphosphate 5-phosphatase
(5Ptases) comprise a large group of enzymes that can hydrolyze
5-phosphates from a variety of inositol phosphates, like IP3
(Majerus et al., 1999). There are four genes encoding inositol
metabolism enzymes altered in our data (SCRULB1060F05.g,
SCSBST3096H04.g, SCCCLR1C02F07.g, SCCCRZ2001A10.g) when high brix
and low brix plants were compared and a Phospholipase
C(SCSBHR1052C05.g) down-regulated in sugar-rich internodes.
Inositol derivatives may be involved in the modulation of Ca.sup.2+
levels and there are many evidences for a role of Ca.sup.2+ in
sugar signaling (reviewed by Rolland et al., 2002, see above).
[0069] In sugarcane, the use of wild ancestors as a means to
incorporate new traits or to improve variability in a well
established breeding program is something that requires a lot of
attention and caution from the breeder. Such parents can carry a
large proportion of variation inferior to current commercial
hybrids, and sugar content is likely to be poor. The crosses and
selections done in this study aimed to produce sugar content
variability, introducing new genes that exist in wild ancestors and
that had never been explored in the development of hybrid
commercial varieties. The final objective was, once a large
variability was created from the introgression studies, to perform
bulk segregation analysis in extremes of the population to
eventually identify genes that could be linked to sugar content.
The markers identified in this work have been shown to be useful to
analyze crosses between individuals from the introgression study
and elite cultivars and follow the sugar content genes coming from
wild ancestors.
[0070] It is worth to mention that the use of wild germplasm from
21 S. officinarum and 13 S. spontaneum genotypes allowed the
selection of more divergent materials than the crosses between the
commercial varieties. The range of brix content from 8.6 (the
extreme individual for LB) to 23.9 (the extreme individual for HB)
could never be reached using progeny derived from conventional
crosses. This is a valuable population for using in sucrose
accumulation studies. The results produced are probably different
from the ones that could be obtained with populations derived from
crosses between commercial varieties, with higher brix content but
not so contrasting phenotypes.
[0071] The approach described produced data and molecular markers
to be used in breeding programs, in the characterization of
transgenic plants designed to contain more sucrose, and/or used as
candidate genes for genetic manipulation in transgenic plants or
non-transgenic plants in order to improve the sugar content of
commercial varieties. Changes in more than one gene expression are
more significant while changes in three or a higher number of genes
are highly significant when searching for molecular markers but a
pattern of expression of just one gene was shown to be useful in
characterizing a plant or population of plants in regards to
sucrose content. Additionally, silencing of two genes
differentially expressed by RNA interference and antisense
expression proved useful in the development of transgenic plants
with increased sucrose content. It is very likely that changes in
transcript levels are accompanied by changes in the protein levels
encoded by the genes, thus quantification of the corresponding
proteins may also be used to identify plants with contrasting
sucrose accumulation capacities. Measures of sucrose content can
accompany gene expression measures and be complementary in defining
plants with gene expression favorable to sucrose accumulation.
These individuals may be crossed and rounds of selection with the
aid of the markers can follow each generation to yield better
sucrose producing plants.
TABLE-US-00011 TABLE XIII List of Sugarcane Assembled Sequences
(SAS) and their SEQ ID Nos. SEQ ID No. 229: SCACLR1057C07.g
(CA073791, CA220104, CA175807, CA173305, CA161664, CA208707,
CA275831, CA082360, CA232127, CA208522, CA082500, CA158772,
CA254078, CA154812, CA168711, CA265487, CA216423, CA082097,
CA282869, CA163131, CA242148, CA116387, CA088301, CA205272,
CA216758, CA083652, CA178498, CA275830, CA164981, CA173335,
CA257615, CA239707, CA164577, CA085299, CA209305, CA191774,
CA082901, CA206163, CA219544, CA256136, CA242861, CA087944,
CA219617, CA172548, CA089365, CA242929, CA296024, CA211326,
CA077845, CA065159, CA220037, CA078282, CA176305, CA087014) SEQ ID
No. 230: SCACLR1130D02.g (CA100457, CA108544, CA104245, CA139305,
CA183555, CA184261, CA075000, CA116753, CA124475, CA107618) SEQ ID
No. 231: SCACLR1130H08.g (CA285355, CA296620, CA190345, CA236470,
CA199128, CA223158, CA296543, CA237253, CA116793, CA223246,
CA275687) SEQ ID No. 232: SCACLR2022H05.g (CA185596, CA107538,
CA278239, CA142728, CA095392, CA190254, CA255382, CA118885,
CA186426, CA242032, CA083853, CA088965, CA186503, CA072676,
CA246552, CA088959, CA292397, CA269566, CA163748, CA243048,
CA287796, CA095283, CA194496, CA285226, CA102940, CA265718,
CA242052, CA194677, CA157478, CA238095, CA282663, CA127731,
CA104186) SEQ ID No. 233: SCAGLR1021G10.g (CA184947, CA241174,
CA116948, CA235280, CA148829, CA187937, CA290068, CA148916,
CA253948, CA153438, CA200242, CA288775, CA242709, CA242784,
CA147421, CA150935, CA110552, CA234507, CA277424, CA072428,
CA220958, CA221034, CA261229, CA220980, CA225630, CA215861,
CA229847, CA275017, CA229919, CA227414, CA289769, CA239844,
CA184991) SEQ ID No. 234: SCBFAD1046D01.g (CA284358, CA285672,
CA258515, CA260599, CA285724, CA284423, CA065523, CA269123) SEQ ID
No. 235: SCBGFL3095D08.g (CA230968, CA243310, CA230887) SEQ ID No.
236: SCBGFL4052C11.g (CA221542, CA181746) SEQ ID No. 237:
SCBGFL4053F12.g (CA219396, CA221898) SEQ ID No. 238:
SCBGLR1096C08.g (CA190075, CA236012, CA290681, CA281821, CA111779,
CA102557, CA224586, CA290611, CA245672, CA118621, CA219281,
CA212792, CA118254, CA239357, CA123219, CA245691) SEQ ID No. 239:
SCBGLR1117A05.g (CA069967, CA206454, CA115471, CA222775, CA300103,
CA216451, CA069882, CA240610, CA121419, CA253181, CA119047) SEQ ID
No. 240: SCCCCL2001B01.b (CA075874, CA110039, CA262153, CA138938,
CA222746, CA206852, CA195629, CA065975, CA111213, CA243704,
CA139758, CA067579, CA228104, CA112899, CA219971, CA159289,
CA067652, CA243309, CA260244, CA136110, CA260251, CA265770,
CA207439, CA141173, CA260652, CA108966, CA233446, CA109052,
CA266455, CA264812, CA196943, CA065789, CA204592, CA065874,
CA228837, CA267875, CA067584, CA114662, CA219472, CA219452,
CA067658, CA093038, CA235273) SEQ ID No. 241: SCCCCL4003D08.g
(CA064615, CA239044, CA246974, CA074795, CA290714, CA074872,
CA094033, CA095138, CA183882, CA249457, CA102981, CA172565,
CA263531, CA183925, CA255937, CA084305, CA285149, CA085127,
CA228150, CA248344, CA064616, CA290646) SEQ ID No. 242:
SCCCCL4004A10.g (CA101534, CA147302, CA227522, CA219008, CA114047,
CA177473, CA250309, CA131850, CA222728, CA096239, CA121915,
CA209925, CA174118, CA158138, CA264731, CA219404, CA241947,
CA239850, CA139416, CA088821, CA149323, CA075509, CA192414,
CA168488, CA070307, CA191927, CA227992, CA191529, CA267246,
CA213285, CA250111, CA258031, CA224522, CA122970, CA072224,
CA082052, CA098902, CA098895, CA094073, CA296040, CA238636,
CA098164, CA237674) SEQ ID No. 243: SCCCCL4004C06.g (CA184820,
CA224856, CA126504, CA232891, CA206438, CA212819, CA232897,
CA214257, CA101169, CA082190, CA167693, CA214057, CA300033,
CA094090, CA252628, CA167758, CA111995, CA074267, CA228379,
CA211130, CA249343, CA209709, CA085064, CA202861, CA119928,
CA225134, CA164339, CA225122) SEQ ID No. 244: SCCCCL4007H07.g
(CA259044, CA299572, CA172510, CA266911, CA094384, CA217028,
CA119215, CA269647, CA187053, CA288923, CA172798, CA216961,
CA180079, CA300646, CA298791) SEQ ID No. 245: SCCCCL5002B10.g
(CA221338, CA161278, CA221548, CA126743, CA176053, CA095223,
CA158980, CA175702, CA137305, CA108318) SEQ ID No. 246:
SCCCCL5004D02.g (CA192143, CA236211, CA277456, CA238363, CA207316,
CA083476, CA300881, CA105556, CA167444, CA195960, CA101127,
CA174295, CA171982, CA179165, CA082796, CA095389, CA299706,
CA235517, CA171513, CA297597, CA079747, CA159787, CA097371,
CA079116) SEQ ID No. 247: SCCCFL4091A07.g (CA223439, CA251804,
CA235024) SEQ ID No. 248: SCCCHR1004D03.g (CA286507, CA215612,
CA183433, CA065784, CA175929, CA102729, CA205573, CA264021,
CA158422) SEQ ID No. 249: SCCCHR1004H09.g (CA198695, CA218094,
CA240658, CA183261, CA257018, CA185072, CA107735, CA165864,
CA162193, CA280279, CA102770, CA238555, CA267028, CA131832,
CA257098) SEQ ID No. 250: SCCCLB1023E12.g (CA179300, CA198187,
CA088499, CA224987, CA116260, CA238936, CA132328, CA210346,
CA300142, CA158693, CA092253, CA271421, CA241178, CA182283,
CA089207, CA194934, CA092199, CA296333, CA075354, CA224675,
CA084007, CA113237, CA296334, CA066934, CA136894, CA192584,
CA111805, CA067884, CA211313, CA216712, CA092778, CA066873,
CA098107, CA280346, CA144921) SEQ ID No. 251: SCCCLB2004C08.g
(CA279906, CA261059) SEQ ID No. 252: SCCCLR1001D10.g (CA249418,
CA083581, CA252565, CA087780, CA126329, CA116150, CA256293,
CA189955, CA208608, CA189961, CA239503, CA122010, CA180875,
CA107889, CA265080, CA154811, CA250574, CA288166, CA276490,
CA203244, CA208413, CA209900, CA124777, CA289690) SEQ ID No. 253:
SCCCLR1022D05.g (CA199003, CA295779, CA243427, CA242039, CA202852,
CA128804, CA079318, CA079910, CA281772, CA281793, CA250251,
CA140942, CA081545, CA084937, CA074621, CA106617, CA181947,
CA091378, CA247107, CA140865, CA148961, CA086118, CA235025,
CA111400, CA130075, CA114483, CA193046, CA087052, CA275872,
CA119131, CA224651, CA240046, CA295949, CA255246, CA231690,
CA222739, CA130833, CA189913, CA216812, CA152690, CA129200,
CA094241, CA087758, CA300112, CA099509, CA295694, CA152604,
CA289169, CA275873, CA100849, CA151157, CA278748, CA126737,
CA219267, CA143476, CA217366, CA188937, CA149217, CA129933,
CA230200, CA088938, CA121701, CA110053, CA143403, CA217293,
CA276362, CA230113, CA155717, CA228428, CA066322, CA148305,
CA273294, CA125293, CA279142, CA133423, CA190364, CA241302,
CA109003, CA171238, CA124306, CA288895, CA152905, CA137901,
CA241224, CA171157, CA189103, CA073313, CA280288, CA222537,
CA244293, CA195698, CA284927, CA244221, CA240565, CA131978,
CA143850, CA147045, CA116042, CA273851, CA118529, CA250276,
CA114167, CA092744, CA111595, CA082835, CA283118, CA119664,
CA090489, CA243388, CA139738, CA198502, CA074106, CA241811,
CA193935, CA090417, CA144601, CA242944, CA263741, CA242878,
CA181943, CA100925, CA154899, CA255036, CA298711, CA255877,
CA231477, CA301130, CA079473, CA293695, CA249587, CA201652,
CA270939, CA092502, CA231391, CA142524, CA293643, CA155896,
CA272121, CA148488, CA249518, CA295765, CA227150, CA169631,
CA100111, CA173458, CA219272, CA067413, CA086035, CA169552,
CA238069, CA227079, CA101601, CA280785, CA264367, CA118824,
CA220340, CA116614, CA118307, CA072726, CA255181, CA143851,
CA128705, CA142362, CA230449, CA131091, CA251477, CA151152,
CA192477, CA124603, CA092380, CA126294, CA071894, CA300717,
CA179264, CA233938, CA126045, CA293018, CA283292, CA168278,
CA162958, CA202235, CA266711, CA131176, CA119234, CA111790,
CA232293, CA175336, CA092372, CA232205, CA247106, CA117673,
CA297133, CA073144, CA227288, CA150142, CA297060, CA139824,
CA205064, CA116036, CA202889, CA215601, CA296581, CA119907,
CA144265, CA192882, CA298102, CA198270, CA216807, CA182514,
CA128480, CA105914, CA108571, CA177022, CA232110, CA128410,
CA125896, CA232195, CA289717, CA295716, CA301502) SEQ ID No. 254:
SCCCLR1022H07.g (CA256002, CA153512, CA119708, CA201590, CA232582,
CA203039) SEQ ID No. 255: SCCCLR1024E11.g (CA236213, CA119421,
CA239312, CA087963, CA236209, CA093728, CA121529, CA144287,
CA110967, CA120342, CA078164) SEQ ID No. 256: SCCCLR1024F10.g
(CA248370, CA191668, CA174627, CA136231, CA240508, CA146036,
CA228222, CA220265, CA237574, CA268651, CA242965, CA146965,
CA237607, CA243057, CA268723, CA266000, CA163172, CA150009,
CA235949, CA119432, CA132957, CA153279, CA074733, CA155267,
CA134767, CA153353, CA208681, CA074819, CA174997, CA294180,
CA298533, CA251324, CA105997, CA066993, CA203286, CA291734,
CA274193, CA071109, CA071088, CA249083, CA208769, CA177604,
CA106088, CA067069) SEQ ID No. 257: SCCCLR1068G11.g (CA132953,
CA232759, CA292317, CA213697, CA232845, CA242579, CA071844,
CA133612, CA213781, CA124103, CA281045, CA243542, CA268384,
CA080234, CA228260, CA112544, CA220447, CA238600, CA120333,
CA130280, CA222523, CA085868, CA238048, CA289325, CA085954,
CA289237, CA290116, CA252889, CA230658, CA175174, CA133538,
CA246442, CA230739, CA133616, CA111266, CA080878, CA127449,
CA113622, CA130344, CA225351, CA239513, CA206259, CA289382,
CA246811, CA191694, CA129517, CA257025, CA108272, CA257105,
CA089953, CA082439, CA285102, CA090031, CA220448, CA120037,
CA296110, CA233332, CA189423, CA246856, CA247427, CA116596,
CA233412, CA246807, CA224412, CA299018, CA126355, CA221362,
CA298715, CA128521, CA077715, CA242434, CA071472, CA128603,
CA071560, CA123524, CA236982, CA139104, CA120188, CA248016) SEQ ID
No. 258: SCCCLR1072E03.g (CA149803, CA140849, CA154999, CA217167,
CA149970, CA197516, CA179657, CA113459, CA205466, CA299206,
CA119586) SEQ ID No. 259: SCCCLR1072H06.g (CA293008, CA292012,
CA208082, CA212163, CA095120, CA250666, CA095061, CA250751,
CA266742, CA140748, CA299559, CA221625, CA199195, CA280252,
CA249305, CA283511, CA119620, CA273507, CA284119) SEQ ID No. 260:
SCCCLR1C04E03.g (CA295762, CA246851, CA247540, CA295704, CA250739,
CA076585, CA129498, CA250812, CA189759, CA153500, CA182502,
CA273004, CA180831, CA225947, CA295943, CA137602, CA283935,
CA137601, CA225870, CA276088, CA239790, CA125960, CA283930,
CA085833, CA236700,
CA129446, CA206958, CA219091, CA204694, CA114854, CA164705,
CA133070, CA264948, CA076438, CA151018, CA121378, CA288667,
CA166549, CA127343, CA076524, CA120880, CA267188, CA205607,
CA228116, CA137280, CA117418, CA237518, CA182380, CA235506,
CA203663, CA075662, CA113908, CA202142, CA156760, CA117805,
CA156119) SEQ ID No. 261: SCCCLR1C07B07.g (CA281556, CA102608,
CA183206, CA267464, CA216559, CA126478, CA178227, CA224781,
CA220964, CA230932, CA196879, CA111576, CA159229, CA285341,
CA284646, CA159313, CA267717, CA089742, CA228165, CA120559,
CA267804, CA296594, CA117476, CA283020, CA291172, CA296665,
CA280265, CA248548, CA090139, CA141203, CA131303, CA142862,
CA269709, CA074994, CA141285, CA106243, CA141103, CA189990,
CA266648, CA120035, CA134522, CA157584, CA118179, CA243432,
CA210686, CA238135, CA248480, CA127949, CA290279, CA178232,
CA290337, CA279227, CA148788, CA277386, CA292004, CA163922,
CA248059, CA148876, CA216395, CA163999, CA249878, CA222979,
CA080867, CA288178, CA267417, CA113988, CA112566, CA225163,
CA249795, CA224169, CA267504, CA160144, CA199747, CA296541,
CA207876, CA173201, CA127744, CA257183, CA270601, CA186974,
CA244929, CA121034, CA245946, CA094024, CA249521, CA257253,
CA165727, CA270682, CA109618, CA165164, CA137020, CA283548,
CA274874, CA165279, CA281754, CA280871, CA079423, CA238032,
CA228443, CA157012) SEQ ID No. 262: SCCCLR2001E10.g (CA262799,
CA127278, CA280201, CA287309, CA089562, CA078214, CA077866,
CA287533, CA211102, CA180904, CA089473, CA074528, CA079677,
CA082818, CA118437, CA269971, CA092559, CA247542, CA285807,
CA091331, CA277276, CA271301, CA072671, CA263353, CA205812,
CA280164, CA116982, CA073860, CA263266, CA116704, CA089413,
CA158170, CA173734, CA180319, CA163659, CA163766, CA124561,
CA278597, CA072426, CA178645, CA271786, CA264556, CA120664,
CA112499, CA185831, CA084497, CA160409, CA083810, CA113314,
CA160061, CA187809, CA189668, CA238848, CA163841, CA114235,
CA165641, CA121314, CA129676, CA263145, CA279135, CA177340,
CA174900, CA152748, CA102472, CA112114, CA188798, CA077061,
CA185135, CA077762, CA116858, CA178901, CA147468, CA188663,
CA177888, CA274039, CA118008, CA273237, CA174048, CA264113,
CA088386, CA281646, CA157750, CA190335, CA175668, CA270524,
CA154487, CA121143, CA180710, CA181093, CA091054, CA127015,
CA187162, CA092675, CA291128, CA106777, CA088977) SEQ ID No. 263:
SCCCLR2002D04.g (CA074921, CA117323, CA243313, CA211783, CA127099,
CA286494, CA075012, CA073105, CA128761, CA128376, CA128367,
CA243946, CA122696, CA128446, CA230627, CA198414, CA298411,
CA122974, CA238383, CA216280, CA230711, CA209970, CA118723,
CA241869, CA123055, CA088133, CA241946, CA125071, CA124739,
CA240999, CA119298, CA080587, CA112133, CA270423, CA241082,
CA292850, CA114123, CA226786, CA257737, CA149929, CA120520,
CA202694, CA120498, CA123517, CA073839) SEQ ID No. 264:
SCCCLR2002G09.g (CA116535, CA124657, CA116605, CA116498, CA072958,
CA257354, CA247799, CA235108, CA103542, CA112157, CA224839,
CA257438, CA123168, CA252080, CA080895, CA102459, CA238997,
CA081185, CA236648, CA078277, CA081264, CA112560, CA112156,
CA239544, CA125043, CA088777, CA248898, CA118825, CA107504,
CA118646, CA248977, CA140223, CA203859, CA115827, CA103133,
CA115782, CA122771, CA074515, CA229803, CA116712, CA123493,
CA085075, CA122840, CA073424, CA229900, CA200897, CA073545,
CA115514, CA072446, CA232187, CA072969, CA110011, CA073999,
CA245664, CA298980, CA125253, CA072002, CA213810, CA190056,
CA230875, CA115022, CA101040, CA230956, CA228508, CA280886,
CA102455, CA245446, CA126608, CA245426, CA097164, CA243299,
CA116857, CA140025, CA257680, CA101571, CA116664, CA130312,
CA105336, CA129039, CA256731, CA095294, CA256654, CA110599,
CA073864, CA115403, CA127138, CA227390) SEQ ID No. 265:
SCCCLR2C03D05.g (CA147771, CA241187, CA239901, CA282278, CA280090,
CA263518, CA278293, CA187784, CA242098, CA244500, CA117444,
CA243119, CA220678, CA181765, CA163903, CA182831, CA154699,
CA250434, CA142468, CA127482, CA115131, CA226443, CA230328,
CA129679, CA250352, CA272571, CA121245, CA246334, CA263117,
CA247571, CA186969, CA152166, CA198196, CA112365, CA257624,
CA204733, CA194041, CA181847, CA155624, CA240278, CA201864,
CA181440, CA277850, CA181770, CA230413, CA128431, CA142473,
CA187851, CA163982, CA128359, CA129154, CA153759, CA163714,
CA129531, CA167236, CA226189, CA287855, CA203879, CA274284,
CA260310, CA124731) SEQ ID No. 266: SCCCRT1001E12.g (CA262088,
CA264485, CA209806, CA114408, CA194065, CA206359, CA254730,
CA178254, CA166387, CA132375, CA092696, CA092563, CA126173,
CA092562, CA190880, CA170137, CA102870, CA190269, CA119262,
CA089823, CA213508, CA144221, CA183640, CA130410, CA064605,
CA298178) SEQ ID No. 267: SCCCRT2001H11.g (CA236346, CA191174,
CA300423, CA105281, CA230838, CA137439, CA200619, CA195246,
CA213844, CA181724, CA108176, CA092614, CA228948, CA200693,
CA203186, CA209467, CA187262, CA240256, CA241667, CA299526,
CA262309, CA143552, CA295095, CA254981, CA220456, CA236075,
CA235832, CA300428, CA250139, CA254632, CA243208, CA293154,
CA294205, CA250212, CA269402, CA261591, CA294137, CA201093,
CA243170, CA291895, CA256863, CA256942, CA166864, CA241994,
CA182531, CA254163, CA196827, CA137128, CA262306, CA073149,
CA245330) SEQ ID No. 268: SCCCRT2002B03.g (CA220568, CA243112,
CA230852, CA160770, CA180268, CA272704, CA230939, CA137141,
CA244400) SEQ ID No. 269: SCCCRZ1001A09.g (CA212821, CA074667,
CA146782, CA272930, CA107169, CA260410) SEQ ID No. 270:
SCCCRZ1001C12.g (CA117861, CA182890, CA138133, CA096667, CA183036,
CA276095, CA167830, CA099489, CA192252, CA137344, CA125255,
CA251500, CA229153, CA082252, CA111079, CA181249, CA071519,
CA298523, CA198397, CA146190, CA180974, CA071438, CA170017,
CA071603, CA244468, CA086723, CA146809, CA179822, CA163106,
CA139751, CA194118) SEQ ID No. 271: SCCCRZ1001D02.g (CA227562,
CA113855, CA074155, CA273171, CA244452, CA244374, CA144616,
CA220668, CA244135, CA208913, CA197975, CA269055, CA125771,
CA281706, CA285773, CA300153, CA154032, CA245267, CA239706,
CA146811, CA248711, CA179814, CA194730, CA268428, CA113399,
CA242036, CA227897, CA122687, CA082472, CA299324, CA082329,
CA292801, CA292314, CA247082, CA260871, CA222252, CA233879,
CA130465, CA140466, CA200065, CA073081, CA114463, CA192580,
CA296734, CA269090, CA243519, CA078544, CA228562, CA169691,
CA177628, CA112868, CA205245, CA269027, CA080412, CA240406,
CA146360, CA229125, CA161211, CA230974, CA300322, CA295571,
CA121414, CA151083, CA230896, CA232918, CA140354, CA167344,
CA221235, CA161123, CA278179, CA092771, CA255868, CA214663,
CA250421, CA260387, CA285663, CA089684, CA250336, CA254468,
CA293447, CA244735, CA254392, CA292654, CA252918, CA126311,
CA278803, CA076762, CA258105, CA136523, CA077192, CA225269,
CA077910, CA230058, CA285260, CA229975, CA286249, CA158350,
CA233369, CA243156, CA235192, CA092793, CA233280, CA269567,
CA080589, CA121250, CA148111, CA117103, CA243125, CA242823,
CA297617, CA070960, CA070900, CA182159, CA200781, CA082483,
CA202989, CA133586, CA202917, CA166792, CA204111, CA133514,
CA191341, CA229632, CA274798, CA112081, CA083506, CA087024,
CA283073, CA075468, CA116699, CA117304, CA228310, CA123022,
CA147101, CA280824, CA122938, CA269278, CA242644, CA286222,
CA189979, CA231030, CA225697, CA216181, CA271428, CA287898,
CA216319, CA249895, CA100564, CA255365, CA182292, CA090466,
CA259629, CA185920, CA101429, CA130039, CA235211, CA235276,
CA130053, CA090380, CA120551, CA242902, CA216182, CA242824,
CA080452, CA260017, CA081490, CA278950, CA076773, CA182164,
CA209332, CA247081, CA194098, CA262165) SEQ ID No. 272:
SCCCRZ1001G10.g (CA222661, CA243406, CA269416, CA111447, CA122777,
CA169118, CA240909, CA124462, CA122846, CA250422, CA244712,
CA249447, CA287599, CA070902, CA110739, CA146855, CA256535,
CA244795, CA078236, CA067840, CA070962, CA265769, CA156647,
CA196108) SEQ ID No. 273: SCCCRZ1002F06.g (CA139097, CA266223,
CA099736, CA191325, CA138926, CA269667, CA211498, CA224822,
CA216862, CA270060, CA301136, CA287834, CA146274, CA096108,
CA181984, CA202409, CA084257, CA098085, CA291642, CA240057,
CA110222, CA291673, CA217925, CA224622, CA218519, CA240142,
CA271896, CA124695, CA232981, CA227222, CA073020, CA209126,
CA233047, CA251280, CA072868, CA206681, CA107412, CA298995,
CA094500, CA195663, CA211432, CA066295, CA146933, CA220697,
CA106447, CA099272, CA076956, CA069454, CA275222, CA145292,
CA136184, CA179267, CA148544, CA179893, CA156981, CA114064,
CA191309, CA217009, CA069184, CA212599, CA264583, CA229486,
CA172986, CA096567, CA067167, CA197128, CA172767, CA253169,
CA291720, CA146613, CA180633, CA121860, CA133791, CA199922,
CA067244, CA262313, CA078445, CA131567, CA253243, CA074238,
CA120588, CA268873, CA238585, CA219714, CA218602, CA267988,
CA268534, CA070614, CA145612, CA160457, CA180428, CA268951,
CA234136, CA098447, CA193324, CA136123, CA218518, CA184233,
CA139019, CA145699, CA260610, CA182962, CA239591, CA099732,
CA105807, CA107503, CA138654, CA212476, CA239233, CA252352,
CA131278, CA085013, CA220627, CA117443, CA079490, CA238164,
CA180322, CA112470, CA142140, CA075732, CA073680, CA068067,
CA157313, CA179892, CA233146, CA240845, CA075816, CA068156,
CA246078, CA233227, CA279126, CA240923, CA094282, CA069497,
CA197493, CA182107, CA166736, CA255275, CA251326, CA198871,
CA281656, CA137037, CA070883, CA296203, CA078532, CA207814,
CA070947, CA199983, CA282429, CA143090, CA191565, CA189249,
CA198125, CA197513, CA203121, CA264333, CA214261, CA196418,
CA251452, CA171285, CA156984, CA197506, CA211996, CA100356,
CA094466, CA133046, CA270062, CA249901, CA211434, CA225569,
CA189822, CA093801, CA100946, CA249815, CA131571, CA220355,
CA136957, CA099350, CA064927, CA285088, CA217335, CA139813,
CA146454, CA186309, CA217407, CA070684, CA268600, CA199112,
CA126792, CA112223, CA265918, CA186374, CA070764, CA099737,
CA226973, CA251532, CA142208, CA190634, CA279252, CA174635,
CA237846, CA131296, CA224758, CA209005, CA132410, CA187486,
CA230626, CA228588, CA080166, CA226226, CA131487, CA209980,
CA240058, CA211052, CA230710, CA065368, CA080253, CA165083,
CA129937, CA215432, CA280033, CA244591, CA065145, CA064807,
CA168165, CA198439, CA218272, CA099578, CA219277, CA218353,
CA096715, CA142481, CA142630, CA084917, CA100264, CA213047,
CA134830, CA175003, CA121078, CA237503, CA135573, CA244608,
CA134915, CA254178, CA135661, CA136819, CA069455, CA157330,
CA164187, CA097370, CA067491, CA145272, CA214390, CA098535,
CA097056, CA266148)
SEQ ID No. 274: SCCCRZ1003A03.g (CA259202, CA100500, CA082076,
CA122924, CA157918, CA095401, CA187294, CA090612, CA080881,
CA112947, CA090695, CA130558, CA146966, CA072719, CA296093,
CA262625, CA170785, CA145446, CA178555, CA206391, CA250364,
CA171994, CA145530, CA147572, CA240600, CA250453, CA095399,
CA282848, CA115658, CA095183, CA237700, CA079664, CA233842,
CA180299, CA262035) SEQ ID No. 275: SCCCRZ1C01H06.g (CA186428,
CA147401, CA147396, CA102140, CA131386, CA067698, CA089218,
CA174951, CA158992, CA071179, CA196935, CA190380, CA132381,
CA232396, CA211475, CA270590, CA124159, CA132671, CA175342,
CA300402, CA165879, CA192094, CA110028, CA118616, CA147228,
CA140507, CA149523, CA117528, CA130394, CA179398, CA225915,
CA187763, CA266799, CA122963, CA217785, CA232794, CA262910,
CA292429, CA094522, CA232704, CA127615, CA245193) SEQ ID No. 276:
SCCCRZ2001F06.g (CA209945, CA125138, CA089034, CA188983, CA140093,
CA239385, CA128670, CA123109, CA283553, CA077454, CA149645,
CA077376, CA239384, CA110981, CA289986, CA257955, CA274339,
CA283333, CA285711, CA248034, CA094452, CA248046, CA119336,
CA225096, CA248683, CA225120) SEQ ID No. 277: SCCCRZ2002C09.g
(CA227904, CA086301, CA178222, CA149034, CA179328, CA164395,
CA150695, CA300591, CA266120, CA214033, CA179414, CA101215,
CA232117, CA266196, CA230767, CA106384, CA221659, CA077653,
CA090620, CA242756, CA203337, CA104567, CA090436, CA214675,
CA090702, CA182664, CA299455, CA160657, CA169652, CA115444,
CA110086, CA170759, CA104628, CA090335, CA168143, CA252390,
CA083307, CA256278, CA081478, CA076382, CA257169, CA205954,
CA076469, CA213516, CA257243, CA192918, CA280631, CA151528,
CA122818, CA122358, CA088685, CA210655, CA188323, CA253393,
CA238275, CA191873, CA135967, CA150598, CA230233, CA091237,
CA126923, CA188824, CA280882, CA079326, CA184911, CA173242,
CA248830, CA251291, CA246358, CA131973, CA256847, CA075481,
CA280627, CA244443, CA241676, CA234839, CA191350, CA132923,
CA167430, CA214518, CA289890, CA129459, CA231295, CA234594,
CA231360, CA122705, CA171017, CA174592, CA213097, CA203677,
CA249784, CA241848, CA154628, CA084636, CA147920, CA084027,
CA210274, CA085409, CA073058, CA257603, CA171251, CA235287,
CA194012, CA274516, CA189176, CA205967, CA114776, CA249998,
CA170208, CA200483, CA079438, CA110598, CA213534, CA081442,
CA158958, CA171823, CA201301, CA113037, CA162250, CA091597,
CA199925, CA105728, CA149023, CA245774, CA257029, CA294516,
CA255995, CA203027, CA251151, CA257109, CA233064, CA089686,
CA165671, CA206864, CA197554, CA120723, CA294637, CA195134,
CA222415, CA206697, CA089770, CA082495, CA270377, CA096681,
CA204010, CA084811, CA225968, CA080123, CA268286, CA177754,
CA225888, CA080209, CA280835, CA075666, CA159929, CA223078,
CA148574, CA186803, CA139688, CA082737, CA169610, CA071215,
CA251920, CA071288, CA253042, CA226647, CA067362, CA149705,
CA175116, CA183854, CA253113, CA194680, CA229952, CA203951,
CA145489, CA183906, CA185885, CA236571, CA183894, CA229664) SEQ ID
No. 278: SCCCRZ2004E04.g (CA265204, CA171814, CA107719, CA149900,
CA193048, CA135977, CA070442) SEQ ID No. 279: SCCCRZ2C03B03.g
(CA152461, CA091354, CA290267, CA150127, CA098420, CA160838,
CA091259, CA210324, CA246275, CA160924, CA099832, CA246979) SEQ ID
No. 280: SCCCRZ2C03B08.g (CA189326, CA128922, CA152978, CA275251,
CA116757, CA206159, CA277339, CA273726, CA288950, CA288339,
CA122779, CA274965, CA165128, CA149798, CA281356, CA185850,
CA273473, CA083665, CA112203, CA118075, CA119323, CA258675,
CA150131, CA260681, CA189332, CA183249, CA282545, CA114816,
CA285606, CA284673, CA221505, CA277051, CA113469, CA274816,
CA220035) SEQ ID No. 281: SCCCRZ2C03D11.g (CA212623, CA218773,
CA234879, CA188440, CA150157, CA167123, CA160865, CA152558,
CA153910, CA160953, CA292253, CA198906, CA146128, CA152637,
CA253272, CA199372, CA081496, CA084800, CA210001, CA165052,
CA173701, CA098184, CA198989, CA300667, CA211850, CA160948,
CA207047, CA095115, CA136241, CA198430, CA256720, CA251375,
CA166995, CA221307, CA110797, CA199377, CA154437, CA256643,
CA237901, CA155637, CA237281, CA243431, CA199465, CA113301,
CA201599, CA152440, CA186303, CA218694, CA091459, CA075606,
CA102523) SEQ ID No. 282: SCCCRZ2C04A07.g (CA150208, CA254428,
CA264432, CA109026, CA289248, CA212120, CA068378, CA269484,
CA290794, CA150592, CA267114, CA108938, CA148663) SEQ ID No. 283:
SCCCRZ3002D03.g (CA157090, CA166754, CA166468, CA081540, CA166789,
CA159915, CA166748, CA158667, CA166054, CA160001, CA159544,
CA158534, CA157577, CA163132, CA162955, CA159630, CA162379,
CA156383, CA159213, CA156380, CA159296, CA157027, CA155724,
CA166592, CA160596, CA157767, CA159130, CA159692, CA160663,
CA157459, CA160591, CA162831, CA157771, CA161878, CA159777,
CA157345, CA162828, CA160660, CA165592, CA157437, CA156341,
CA161644, CA163699, CA166773, CA166732, CA155976, CA166749,
CA166465, CA158668, CA166747, CA166717, CA156749, CA157068,
CA161600, CA157110, CA155898, CA156928, CA155357, CA155731,
CA155982, CA166777, CA165945, CA155803, CA166847, CA158604,
CA154735, CA154876, CA157483, CA154704, CA159558, CA162867,
CA156720, CA159340, CA157550, CA157322, CA156111, CA159644,
CA159429) SEQ ID No. 284: SCCCST1004A07.g (CA183604, CA186275,
CA243234, CA183683, CA186721, CA100350, CA187378, CA155740,
CA175579, CA231947, CA228851, CA155725, CA154689, CA254179,
CA172559, CA225984, CA264609, CA242994, CA158084, CA268024,
CA173756, CA225902, CA163001, CA185577, CA159081, CA227411,
CA139414, CA167973) SEQ ID No. 285: SCCCST1005H10.g (CA156092,
CA252584, CA251786, CA095869, CA200174, CA229003, CA150731,
CA267208, CA111168, CA193424, CA298858, CA284582, CA173902,
CA239780, CA210407, CA253368, CA239582) SEQ ID No. 286:
SCCCST1007H11.g (CA239834, CA294188, CA174066, CA294125, CA289019,
CA267191, CA205751, CA247131, CA186999, CA082859, CA248451,
CA197532, CA248572, CA248681, CA229903, CA291504, CA223912,
CA268732, CA229818, CA268664, CA177922, CA299828, CA085026,
CA107150, CA270735, CA171072, CA250481, CA198295, CA224502,
CA270670, CA111282, CA250414, CA170995, CA248529, CA250649,
CA252343, CA115211, CA169576, CA250568, CA169653) SEQ ID No. 287:
SCCCST2004D11.g (CA276737, CA286409, CA290332, CA180097, CA274366,
CA290274, CA276791, CA283900) SEQ ID No. 288: SCCCST3C01D11.g
(CA192121, CA200064) SEQ ID No. 289: SCEPCL6019E04.g (CA278974,
CA178777, CA258916, CA210789, CA096932, CA228505, CA292383,
CA287368, CA260767, CA258913, CA067293) SEQ ID No. 290:
SCEPLB1043H04.g (CA112277, CA268601, CA084506, CA123703, CA130941,
CA298376, CA100990, CA092352, CA111629, CA259193, CA175844,
CA069065, CA236418, CA259195, CA194776, CA197355, CA285641,
CA279779, CA274614, CA208294) SEQ ID No. 291: SCEPRZ1009C10.g
(CA216178, CA089411, CA192966, CA085572, CA147458, CA210405,
CA186340, CA080065, CA195484, CA176812, CA086836, CA299623,
CA186790, CA174279, CA270325) SEQ ID No. 292: SCEQLB1065H07.g
(CA113324, CA112585, CA112172) SEQ ID No. 293: SCEQRT1028H06.g
(CA185370, CA217107, CA185369, CA181686, CA144447, CA259824,
CA259055, CA224656, CA132900, CA139337) SEQ ID No. 294:
SCEQRT2091B08.g (CA177838, CA138900, CA131473) SEQ ID No. 295:
SCEZLR1009F06.g (CA241512, CA233926, CA203368, CA147610, CA244100,
CA143820, CA235700, CA224287, CA076822, CA136422, CA204148,
CA132715, CA243514, CA121484, CA149083, CA270033, CA224204,
CA235620) SEQ ID No. 296: SCEZLR1052D02.g (CA290091, CA101830,
CA232662, CA121616, CA136331, CA269565, CA099181, CA274273,
CA261699, CA244896, CA264816, CA291831, CA244980, CA242167,
CA088365, CA207802, CA164209, CA083724, CA102047, CA144138,
CA287479) SEQ ID No. 297: SCEZLR1052F07.g (CA074246, CA121654,
CA248895, CA133812, CA282557, CA241182, CA114856, CA211933,
CA248974, CA276743, CA101051, CA270608, CA276796) SEQ ID No. 298:
SCEZRZ1012A02.g (CA297050, CA147663, CA157700, CA105038, CA261583,
CA271380, CA215641, CA159641, CA069275, CA177800, CA270487) SEQ ID
No. 299: SCJFAM1066B05.g (CA268766, CA074908, CA268710, CA228447,
CA244764, CA274990, CA065083, CA074999) SEQ ID No. 300:
SCJFHR1C03E01.b (CA105064, CA292248) SEQ ID No. 301:
SCJFLR1013A09.g (CA235310, CA282013, CA179055, CA283254, CA183161,
CA290788, CA164417, CA252946, CA141957, CA096624, CA265391,
CA288713, CA274581, CA190135, CA208818, CA279074, CA197553,
CA228792, CA167001, CA243611, CA173593, CA132194, CA159403,
CA301384, CA172463, CA157575, CA122731, CA163302, CA159490,
CA122807, CA290934, CA084459, CA209937, CA276141, CA124943,
CA291009, CA101340, CA219373, CA282113, CA301068, CA151204,
CA155518, CA261457, CA226015, CA281400, CA277290, CA106860,
CA151298, CA131594, CA209070, CA274261, CA230293, CA281699,
CA102959, CA242254, CA230377, CA110744, CA297719, CA273517,
CA288217, CA283872, CA069932, CA161956, CA152851, CA167994,
CA279904, CA072926, CA151486, CA294369, CA285703, CA152126,
CA151570, CA123278, CA294297, CA197602, CA169959, CA243645,
CA301385, CA264726, CA288442, CA273556, CA139713, CA195766,
CA119825, CA145652, CA101345, CA295834, CA278607, CA167657,
CA145735, CA164101, CA293116, CA289163, CA284698, CA072930,
CA164096, CA274175, CA199249, CA282860, CA253978, CA282859,
CA277633, CA274222, CA277807, CA217957, CA066317, CA154676,
CA281278, CA131869, CA121746, CA143651, CA283796, CA240378,
CA276222, CA180047, CA180206, CA178970, CA280226, CA109795,
CA268088) SEQ ID No. 302: SCJFRT1062G05.g (CA134706, CA195808,
CA245921, CA134625, CA104221) SEQ ID No. 303: SCJFRZ2009F04.g
(CA151389, CA159376, CA226687, CA146560, CA166765, CA197932,
CA159464, CA270358, CA183354) SEQ ID No. 304: SCJFRZ2010A09.g
(CA151517, CA183884, CA151430) SEQ ID No. 305: SCJFRZ2028F11.g
(CA186745, CA152421, CA186827, CA211953, CA191943, CA198909,
CA224105, CA200632, CA255362, CA066398, CA131076, CA201119,
CA299210, CA299133, CA200718, CA131498, CA157938, CA205075,
CA160778, CA064989, CA277477, CA281350) SEQ ID No. 306:
SCJFRZ2032C08.g (CA117340, CA295374, CA295303, CA152817) SEQ ID No.
307: SCJFRZ2032G01.g (CA133254, CA248557, CA175553, C0A290388,
CA170294, CA152856, CA171924, CA205645, CA233534, CA221515,
CA081654, CA171952, CA065512, CA081995, CA166558, CA065587,
CA078958, CA211764, CA237388, CA258073) SEQ ID No. 308:
SCJFST1009G05.g (CA296907, CA174288, CA269643, CA174211, CA193249)
SEQ ID No. 309: SCJLHR1028C12.g (CA106176, CA106117, CA108309,
CA107078) SEQ ID No. 310: SCJLLR1054C09.g (CA207848, CA168087,
CA168395, CA212085, CA167523, CA091873, CA122611, CA155006,
CA181705, CA134394, CA225549, CA210454, CA254817, CA110775,
CA178602, CA294600, CA247901, CA176250, CA191684, CA069266,
CA300512, CA165622, CA155090, CA067961, CA171908, CA209040,
CA173982, CA094706, CA240234, CA103017, CA122429, CA150920,
CA112960, CA162575, CA122515, CA160567, CA113924, CA066919,
CA160642, CA221530, CA208709, CA071863, CA214558, CA220510,
CA123419, CA244626, CA231363, CA228474, CA111123, CA134073,
CA146492, CA244685, CA219982, CA073891, CA174808, CA221075,
CA262113, CA114521, CA162927, CA115467, CA161791, CA168280,
CA152952, CA091868, CA233706, CA164651, CA204996, CA129415,
CA172853, CA166113, CA107134, CA254985, CA159872, CA159959,
CA088872, CA173464) SEQ ID No. 311: SCJLLR1108H07.g (CA076625,
CA161661, CA086613, CA161602, CA165554, CA245933, CA085287,
CA123416, CA161598, CA175504, CA232025, CA166769, CA102997,
CA076538, CA107411, CA155427, CA084502, CA106431, CA154641,
CA106546, CA157227, CA154884, CA079948, CA179653, CA211436,
CA121982, CA162963, CA258991, CA160716, CA243419, CA079250,
CA072412, CA086508) SEQ ID No. 312: SCJLRZ1023H04.g (CA265135,
CA190996, CA292308, CA268081, CA256348, CA207478, CA081712,
CA292758, CA256420, CA167022, CA291705, CA091971, CA179799,
CA140075, CA266752, CA291699, CA258363, CA113856, CA149162,
CA260595, CA140368, CA246964, CA235343, CA155907, CA140145,
CA279058, CA274307, CA165644, CA278889, CA205578, CA091372,
CA181941, CA166813, CA299890, CA177590, CA072486, CA156132,
CA248336) SEQ ID No. 313: SCJLRZ1026F03.g (CA149469, CA205387,
CA289827, CA184015, CA247348, CA282029, CA187706, CA205445) SEQ ID
No. 314: SCMCCL6055H06.g (CA183309, CA272155, CA071587, CA154790,
CA236184, CA111608, CA231710, CA288208, CA098251, CA238333,
CA187031, CA071503, CA293423) SEQ ID No. 315: SCMCFL5005A02.g
(CA236668, CA293232, CA251482) SEQ ID No. 316: SCQGLR1019A10.g
(CA158123, CA074136, CA078695, CA202125, CA242927, CA291653,
CA258225, CA223738, CA242859, CA124066, CA230103, CA120900,
CA154098, CA255904, CA223648, CA129680, CA230031, CA082294,
CA246357, CA262363, CA265415, CA118654, CA213833, CA125970,
CA127771, CA246827, CA247296, CA087908, CA171645, CA102269,
CA272756, CA137758, CA088231, CA148006, CA122701, CA187495,
CA239190, CA230034, CA228513, CA074865, CA285487, CA147299,
CA125885, CA236307, CA076601, CA116390, CA074785) SEQ ID No. 317:
SCQGLR1085G10.g (CA246799, CA299090, CA247266, CA285442, CA124279,
CA092800, CA073766, CA200888, CA282968) SEQ ID No. 318:
SCQGLR2032G10.g (CA080092, CA073014, CA139013, CA225342, CA159885,
CA165867, CA299929, CA118209, CA159972, CA108533, CA108413,
CA106301, CA086875, CA086531, CA129084) SEQ ID No. 319:
SCQGRZ3011D06.g (CA161694, CA227205, CA245780, CA216248) SEQ ID No.
320: SCQGSB1140F12.g (CA213355, CA173336) SEQ ID No. 321:
SCQGST1034G10.g (CA178801, CA186336, CA179790, CA176353, CA177570,
CA236876, CA131335, CA214405, CA236124, CA186273, CA284135,
CA216656, CA300978) SEQ ID No. 322: SCQSHR1023F08.g (CA282568,
CA106894, CA104925, CA211813) SEQ ID No. 323: SCRFFL5034G07.g
(CA292908, CA237588, CA237589) SEQ ID No. 324: SCRLAD1100E08.g
(CA218592, CA211503, CA218509) SEQ ID No. 325: SCRLAM1010D08.g
(CA212204, CA199909, CA248341, CA242304, CA256227, CA172929,
CA220898, CA078708, CA247486, CA280865) SEQ ID No. 326:
SCRLFL1008C11.g (CA228213, CA201789, CA206320) SEQ ID No. 327:
SCRLFL1012B10.g (CA200156, CA199546) SEQ ID No. 328:
SCRLFL3007C04.g (CA226398) SEQ ID No. 329: SCRLLR1111D02.g
(CA293691, CA293635, CA125789) SEQ ID No. 330: SCRLSD1012E03.g
(CA274071, CA285380) SEQ ID No. 331: SCRLST3166F11.g (CA182238,
CA171790, CA184723) SEQ ID No. 332: SCRUAD1063C06.g (CA068638,
CA265707, CA068550, CA109839) SEQ ID No. 333: SCRUAD1133D10.b
(CA217707, CA260899, CA295151) SEQ ID No. 334: SCRURT2010A10.g
(CA144026, CA210038, CA197343, CA252900, CA067500) SEQ ID No. 335:
SCSBAM1084F08.g (CA198503, CA079138, CA079137) SEQ ID No. 336:
SCSBHR1052C05.g (CA196243, CA215089, CA164400, CA195955, CA108007,
CA139925, CA215090, CA224796, CA098473, CA209222, CA197036,
CA209253) SEQ ID No. 337: SCSBHR1056H08.g (CA105333, CA108213) SEQ
ID No. 338: SCSBLB1035F03.g (CA264024, CA104540, CA115550,
CA212924) SEQ ID No. 339: SCSBSD2058D04.g (CA287176, CA297226,
CA287175) SEQ ID No. 340: SCSFAD1124E07.g (CA066760, CA217172,
CA066828, CA217514) SEQ ID No. 341: SCSFHR1043G09.g (CA108353,
CA218662, CA212351) SEQ ID No. 342: SCSGFL5C08F04.g (CA246146,
CA236946, CA246999) SEQ ID No. 343: SCSGLR1045E07.g (CA168455,
CA126284, CA177719, CA172031) SEQ ID No. 344: SCSGRT2066D05.g
(CA070717, CA175523, CA145621, CA187735) SEQ ID No. 345:
SCUTAM2088G02.g (CA091716, CA090231, CA091719) SEQ ID No. 346:
SCUTFL3073E12.g (CA257224, CA241247, CA292613) SEQ ID No. 347:
SCUTLR1037F04.g (CA170823, CA177197, CA279404, CA222805, CA121507,
CA289444, CA282074, CA207370, CA115893, CA105265, CA226291,
CA170108, CA263098, CA132119, CA107841, CA085728, CA126622,
CA227826, CA227505, CA260163, CA262467, CA193720, CA219325,
CA177230, CA103517, CA170340, CA170414, CA105596, CA112997,
CA228100, CA234662, CA258511, CA097304, CA120418) SEQ ID No. 348:
SCUTLR1037F12.g (CA156611, CA293535, CA249045, CA087183, CA189165,
CA086047, CA290121, CA081883, CA214139, CA229204, CA113764,
CA213924, CA260485, CA126357, CA230132, CA221003, CA187849,
CA273962, CA225939, CA102197, CA283956, CA183828, CA218025,
CA195893, CA085608, CA263834, CA290919, CA183344, CA241008,
CA104921, CA066522, CA290997, CA172858, CA095919, CA247671,
CA186981, CA133280, CA245107, CA257283, CA115814, CA258330,
CA212915, CA119073, CA194926, CA239944, CA104400, CA113297,
CA104485, CA087184, CA069789, CA179218, CA231826, CA231159,
CA086089, CA076690, CA246370, CA254495, CA091273, CA100677,
CA106434, CA230786, CA253134, CA257292, CA231505, CA225180,
CA241459, CA198266, CA115318, CA161747, CA103920, CA152307,
CA133281, CA086095, CA231031, CA187270, CA242618, CA144012,
CA111808, CA238509, CA253529, CA089266, CA157653, CA228713,
CA106021, CA117820, CA126627, CA104401, CA211834, CA182929,
CA104486) SEQ ID No. 349: SCUTLR1058C02.g (CA262461, CA168036,
CA230840, CA293241, CA281414, CA281585, CA106941, CA142008,
CA151458, CA092310, CA270530, CA270458, CA225598, CA151543,
CA202726, CA128347, CA241827, CA282746, CA128419, CA119915,
CA204605, CA215500, CA170573, CA164411, CA134253, CA142288,
CA176323, CA195642, CA255302, CA158993, CA283479, CA283473,
CA126682, CA118166, CA213449, CA157587, CA207851) SEQ ID No. 350:
SCUTLR2008E01.g (CA123373, CA129763, CA128815) SEQ ID No. 351:
SCUTRZ2024G05.g (CA234849, CA204407, CA105515, CA224224, CA109551,
CA143843, CA279720, CA161103, CA224302, CA299491, CA122794,
CA179195, CA153592, CA105749, CA164517) SEQ ID No. 352:
SCUTST3086B02.g (CA213057, CA224653) SEQ ID No. 353:
SCUTST3129E01.g (CA172415, CA213379, CA187638) SEQ ID No. 354:
SCVPCL6041F12.g (CA082429, CA161720, CA139420, CA272127, CA238764,
CA215035, CA194711, CA209687, CA171991, CA172016, CA165652,
CA156463) SEQ ID No. 355: SCVPCL6042B07.g (CA169577, CA081626,
CA106612, CA099887, CA081969) SEQ ID No. 356: SCVPLR149C09.g
(CA295256, CA300966, CA278033, CA090854, CA282609, CA121190,
CA216481, CA267073, CA111152, CA126945, CA280319, CA278841,
CA262278, CA287391, CA296360, CA296426, CA248739, CA287386,
CA259530, CA296500, CA266143, CA216477, CA150885, CA248822,
CA096454, CA099843, CA252370, CA087591, CA266218, CA071726,
CA081002, CA087680, CA240033, CA219541, CA202897, CA077216,
CA219614, CA066229, CA281069) SEQ ID No. 357: SCVPLR1049E12.g
(CA124363, CA107272, CA132969, CA09837, CA126955, CA122520,
CA182701, CA167289) SEQ ID No. 358: SCVPLR2005H03.g (CA107547,
CA139171, CA074786, CA265130, CA268083, CA243200, CA074866,
CA134745, CA100667, CA131059, CA264817, CA254269, CA268118,
CA264761, CA121869, CA201866, CA220819, CA156636, CA097099,
CA289841, CA222964, CA116567, CA091798, CA219374, CA138613,
CA221255, CA132550, CA289940, CA251888, CA205653, CA100956,
CA293549, CA243537, CA136973, CA120370, CA158202, CA228366,
CA260312) SEQ ID No. 359: SCVPLR2012B07.g (CA130160, CA266175,
CA077480, CA072583, CA084569, CA194404, CA278936, CA240283,
CA201232, CA288279, CA077401, CA066454, CA180797, CA244848,
CA266247, CA130150, CA137685, CA233499) SEQ ID No. 360:
SCVPLR2019B03.g (CA087275, CA087192, CA125068, CA101699, CA222267,
CA259282, CA248553, CA223061, CA172804, CA200147, CA130990,
CA225681, CA231261, CA223347, CA255228, CA273849, CA254244,
CA156394, CA163312, CA117607, CA078324, CA072741, CA248475,
CA212519, CA124666, CA126419, CA268138, CA105146, CA299030,
CA177516, CA222789, CA105222, CA253702, CA202841, CA077031,
CA077074, CA295407, CA118765, CA265852, CA289740, CA156183,
CA197419, CA292775, CA207673, CA225709, CA153732, CA169731,
CA102976, CA254955, CA228712, CA067636, CA264512, CA130214,
CA130204, CA106807, CA207166, CA198764, CA216476, CA197293,
CA103316, CA202300, CA077735, CA211185, CA067184, CA159570,
CA258272, CA067264, CA159656, CA200260, CA117368, CA183438) SEQ ID
No. 361: SCVPLR2027A05.g (CA235611, CA214709, CA235691, CA229065,
CA216821, CA251974, CA085301, CA101012, CA271269, CA197839,
CA223162, CA118164, CA086683, CA223250, CA221375, CA188324,
CA130277, CA130307, CA291410, CA227333, CA279299, CA289704,
CA167019, CA207029, CA206493, CA270388, CA176609, CA255410,
CA166845, CA070734, CA073573, CA070813, CA112278, CA295884) SEQ ID
No. 362: SCVPRZ2038F04.g
(CA278038, CA154019, CA185583) SEQ ID No. 363: SCVPRZ3025A12.g
(CA070455, CA292147, CA245381, CA166400, CA204294, CA242140) SEQ ID
No. 364: SCVPRZ3029G09.g (CA239171, CA273853, CA166786, CA203209)
SEQ ID No. 365: SCMCST1053A06.g (CA110730, CA157435, CA164231,
CA176670, CA079493, CA088347) SEQ ID No. 366: SCCCLB1C06H02.g
(CA189458, CA167345, CA115196, CA207187, CA252023) SEQ ID No. 367:
SCJLRT1023G09.g (CA077219, CA072472, CA136050, CA078881, CA266374,
CA224918, CA162043, CA091967, CA074650) SEQ ID No. 368:
SCCCST1004C05.g (CA098064, CA072037, CA194838, CA098063, CA173775,
CA074361, CA079156, CA098059, CA084783) SEQ ID No. 369:
SCCCLB1002D12.g (CA092064, CA238036, CA222592, CA227487, CA110870,
CA207790) SEQ ID No. 370: SCSGHR1070F12.g (CA076267, CA109334) SEQ
ID No. 371: SCEQLR1092H10.g (CA279813, CA186407, CA212604,
CA279552, CA186484, CA135161, CA069193, CA103839, CA121281,
CA153767, CA285432, CA182006, CA131451, CA285178, CA078267,
CA078257, CA205885, CA136733, CA205884, CA097155, CA264106,
CA279798, CA163611, CA091480, CA091191, CA187913, CA261976,
CA277443, CA204843, CA273593, CA287502, CA287253, CA085398,
CA222671) SEQ ID No. 372: SCJFST1011B06.g (CA239247, CA174473,
CA262684, CA211312, CA218557) SEQ ID No. 373: SCEQRT2030G04.g
(CA138771, CA145363, CA291384) The EST Genbank accession number is
in parentheses. The SEQ ID No. refers to the sequence identifiers
in the sequence listing. The listed ESTs assembled to the indicated
sequence and should be considered one transcript. Each SAS is
differentially expressed between plants with low and high sucrose
content or between internode tissues of high and low sucrose
content.
TABLE-US-00012 TABLE XIV SNF-related like kinase genes and
regulatory subunits differentially expressed between high brix and
low brix varieties. Four individuals were selected from SP83-2847
(V1), four from SP94-3116 (V3), four from SP91-1049 (V2) and four
from SP89-1115 (V4). RNA samples from the indicated tissues and
collected months were used to generate probes for cDNA microarray
hybridizations. The last four columns indicate the average ratios
and the fold induction when the high and low brix samples were
compared against an equimolar mixture of RNAs from the same
varieties collected in march (when the cell is empty differential
expression was not detected on the sample) The average brix
measures are shown in FIG. 6. High Brix Low Brix Experiment SAS
Category sub category 1 sub category 2 sub category 3 V2 V4 V1 V3
Leaf March SCCCLB1002D12.g Protein kinases SNF-like kinases
caneCIPK-24 SNF-like/CBL- 3.2 interacting Protein Kinase
SCSGHR1070F12.g Protein kinases SNF-like kinases caneCIPK-29
SNF-like/CBL- 2.7 interacting Protein Kinase SCEQLR1092H10.g
Carbohydrate met SIP homologue -- -- 2.5 (AKIN gamma)
SCJFST1011B06.g Carbohydrate met Similar to -- -- 6.7 4.6
AKINbetagamma May SCJFST1011B06.g Carbohydrate met Similar to -- --
10.5 3.7 4.7 6.2 AKINbetagamma September SCEQRT2030G04.g Protein
kinases SNF-like kinases caneCIPK-26 SNF-like/CBL- 3.2 interacting
Protein Kinase SCEQLR1092H10.g Carbohydrate met SIP homologue -- --
2.7 (AKIN gamma) SCJFST1011B06.g Carbohydrate met Similar to -- --
-4.1 1.5 AKINbetagamma Internode 1 March SCJFST1011B06.g
Carbohydrate met Similar to -- -- 1.5 1.9 3.0 AKINbetagamma May
SCJFST1011B06.g Carbohydrate met Similar to -- -- 2.4 AKINbetagamma
July SCJFST1011B06.g Carbohydrate met Similar to -- -- 3.1 2.4 3.6
2.7 AKINbetagamma September SCJFST1011B06.g Carbohydrate met
Similar to -- -- -3.0 -1.8 AKINbetagamma
TABLE-US-00013 TABLE XV Genes differentially expressed between
internode 9 (mature, rich in sugar) and internode 1 (immature, poor
in sugar) from a pool of seven high brix plants. SAS Category
Description of homologue High Low SCCCLR1001E04.g Carbohydrate
Metabolism Photosynthesis RUBISCO - small subunit 5.17088
SCSGFL5C08F04.g Unknown protein 14.5502 SCCCLR1024E11.g Stress
Superoxide dismutases Cu/Zn 3.52866 SCCCLR1068G11.g DNA metabolism
Histone H2B 3.17131 SCEZRZ1012A02.g Stress Cytochrome P450 CYP9
5.68635 SCSBAD1084C01.g Others Tubulin alpha-1 chain 2.37024
SCCCLR2002D04.g DNA metabolism Histone H4 3.09739 SCJFRZ2032G01.g
Protein kinases SNF-like kinases caneSnRK1-2 1.69948
SCCCLR2002F08.g Hormone related Auxin auxin repressed 2.0465
SCVPFL3045B09.g Stress Metalothionein 3.46187 SCJLHR1028C12.g
Stress Infected libraries Histone H4 4.71202 SCVPLR2019B03.g
Pathogenicity Polygalacturonase inhibitor 4.46784 SCJLRZ1023H04.g
Protein kinases SNF-like kinases caneCIPK-9 4.32708 SCCCLR2C03D05.g
Stress Superoxide dismutases Cu/Zn 4.75184 SCCCRT2001H11.g Small
GTPases Arf 1.9028 SCCCRZ1001D02.g Adapters 14-3-3 proteins 1.90957
SCCCRZ2C03D11.g Transcription Scarecrow 2.8597 SCRLLR1111D02.g No
matches (non-coding) 3.55119 SCCCRZ1002F06.g Stress Drought and
cold response Enolase 2.15317 SCBFAD1046D01.g Transcription HLH
(helix-loop-helix) 3.05338 SCRLST3166F11.g No matches (non-coding)
1.7087 SCCCRZ2002C09.g Others Alpha tubulin 2.30795 SCCCCL3120C09.g
Receptors Receptor Ser/Thr kinase cane RLK with LysM-1 2.72539
SCEQRT1025D06.g Adapters 14-3-3 proteins 1.76605 SCSGLR1045E07.g
Receptors Receptor Ser/Thr kinase caneLTK1-15 3.27161 (leucine-rich
transmembrane kinase) SCCCRZ1001A09.g Unknown protein 3.47497
SCUTFL3073E12.g Unknown protein 3.88751 SCJFLR1074E09.g Stress
Drought and cold response Low temperature induced (LTI) 2.73407
SCUTST3129E01.g Unknown protein 3.16936 SCVPLR2005H03.g
Transcription Aux/IAA 2.96052 SCCCLR2002G09.g DNA metabolism
Histone H4 5.40529 SCVPRT2074D04.g Unknown protein 10.9716
SCMCST1053A06.g Receptors Receptor Ser/Thr kinase canePERK1-3
2.55721 SCCCRZ1001G10.g Transcription Aux/IAA 3.20251
SCBFLR1039B05.g Carbohydrate Metabolism Xyloglucan
endotransglycosylase 7.23097 SCCCRZ1C01H06.g Calcium
Calmodulin-binding proteins Apyrase 5.42483 SCSBSD2029F05.g Unknown
protein 29.3706 SCSFHR1043G09.g Stress Infected libraries
S-adenosylmethionine synthase 2.57568 SCEZHR1087F06.g Stress
Cytochrome P450 CYP84 3.71447 SCJFLR1013A09.g Stress Drought and
cold response Cysteine proteinase 2.34682 RD19A precursor
SCCCAD1004H02.g Stress Catalase 4.81462 SCSBHR1056H08.g Receptors
EIN2 (ethylene) 2.2665 The individuals were selected from an F1
progeny of a cross between two commercial varieties, SP80-180 and
SP80-4966. RNA samples from internode 9 (mature, rich in sugar) and
internode 1 (immature, poor in sugar) were collected in March from
the seven highest brix individuals and used to generate probes for
cDNA microarray hybridizations. The column High indicates the
average ratios (fold induction) of genes more expressed in
internode 9 than in internode 1. The column Low indicates the
average ratios (fold induction) of genes more expressed in
internode 1 than in internode 9. The average brix in the highest
sugar internodes was 18.47.
TABLE-US-00014 TABLE XVI Genes differentially expressed between
Internode 9 (mature, rich in sugar) and internode 1 (immature poor
in sugar) from a pool of seven high brix plants. SAS Category
Description of homologue High Low SCCCHR1004D03.g Receptors
Receptor Ser/Thr kinase caneRLK-CII1 2.886 SCEQRT2091B08.g
Pathogenicity R-genes NBS-LRR 6.61364 SCCCRZ1001D02.g Adapters
14-3-3 proteins 4.07912 SCACLR2022H05.g Lipid metabolism Acyl
carrier protein-like 2.62875 SCCCLR1022D05.g Adapters 14-3-3
proteins 2.98657 SCCCHR1004H09.g Others Putative cholinephosphate
cytidylyltransferase 1.92571 SCAGLR1021G10.g Transcription Homeobox
knotted homeobox 2.32589 SCCCRZ1C01H06.g Calcium Calmodulin-binding
proteins Apyrase 7.92529 SCAGLR2026G12.g No matches 3.39302
SCCCRZ2002C09.g Others Alpha tubulin 4.67588 SCEZRZ1012A02.g Stress
Cytochrome P450 CYP9 4.61871 SCUTST3129E01.g Unknown protein
1.91148 SCRFLR2037F09.g Calcium Calreticulin 2.02563
SCCCLR1072H06.g Receptors Receptor Ser/Thr kinase caneRLK-CIII5
2.00064 SCCCRZ2C03B08.g Unknown protein 2.91431 SCRLAM1010D08.g
Transcription Homeobox knotted homeobox 2.79028 SCRLFL3007C04.g
Receptors Receptor Ser/Thr kinase caneRLK-D5 4.32835
SCSBAD1084C01.g Others Tubulin alpha-1 chain 4.77431
SCCCLR2C02A05.g Development Expansin 2.51264 SCBFST3136A06.g No
matches 1.64093 SCCCST1005H10.g Stress Drought and cold response
erd3-like 2.28191 SCVPRZ3025A12.g Protein kinases RLCK canePBS1-6
3.88743 SCBGFL4053F12.g Receptors Receptor Ser/Thr kinase
caneRLK-DV2 3.57578 SCCCST1007H11.g Small GTPases Rab 2.33447
SCJFRZ2009F04.g Transcription Aux/IAA 2.29158 SCJLLR1054C09.g
Transcription Aux/IAA 2.65943 SCJFST1009G05.g Protein kinases
Putative RLCK caneRLCK-A3 2.13741 SCBFLR1039B05.g Carbohydrate
Metabolism Xyloglucan endotransglycosylase 11.4992 SCSBHR1052C05.g
Inositol Others Phospholipase C 1.7622 SCCCLR2C03D05.g Stress
Superoxide dismutases Cu/Zn 3.71548 SCCCCL4004C06.g Unknown protein
5.53096 SCCCCL3120C09.g Receptors Receptor Ser/Thr kinase cane RLK
with LysM-1 4.75777 SCCCRT1001E12.g Small GTPases Rab 3.51448
SCEQRT1028H06.g Hormone biosynthesis Auxin Nitrilase 2.22559
SCCCRT2001H11.g Small GTPases Arf 3.62744 SCSGLR1045E07.g Receptors
Receptor Ser/Thr kinase caneLTK1-15 (leucine-rich transmembrane
kinase) 4.26249 SCCCRZ1001C12.g Stress Cytochrome P450 CYP51
1.63378 SCCCLB1023E12.g Receptors Receptor Ser/Thr kinase
caneRLK-DXIV1 (with LRR) 1.75209 SCUTAM2115C12.g Unknown protein
4.03376 SCCCRZ1001G10.g Transcription Aux/IAA 4.81226
SCCCLR1024E11.g Stress Superoxide dismutases Cu/Zn 2.64644
SCCCLR1072E03.g Receptors Receptor Ser/Thr kinase caneRLK-AX3
3.18447 SCCCRZ2C04A07.g Stress Cytochrome P450 CYP71E 7.26294
SCVPRT2074D04.g Unknown protein 17.1483 SCCCCL5002B10.g Protein
kinases Undefined-unclassified caneUPK-87 2.6046 SCRURT2010A10.g
Transcription Putative transcription factor (myb) 3.35245
SCRUSB1062E12.g Lipid metabolism Putative triacylglycerol lipase
2.38531 SCBGLR1096C08.g Protein kinases Cell cycle-related
caneCDK-18 3.2602 SCUTST3086B02.g Transcription AP2/EREBP Tiny
2.12353 SCSBLB1035F03.g Receptors Receptor Ser/Thr
kinase-unclassified caneURLK-119 (with LRR) 5.9116 SCEPRZ1009C10.g
Protein kinases SNF-like kinases cane osmotic stress-activated
protein kinase-1 3.54108 SCJLRZ1026F03.g Protein kinases Putative
RLCK caneRLCK-AII2 2.347 SCEQRT1031D02.g Adapters 14-3-3 proteins
3.968 SCSGFL5C08F04.g Unknown protein 16.0517 SCUTRZ2024G05.g
Transport Putative vesicle transport v-SNARE protein 1.9247
SCQGLR1085G10.g Transcription MADS 1.7433 SCRUAD1063C06.g
Pathogenicity Polygalacturonase-inhibiting 1.66301 SCEPCL6019E04.g
Carbohydrate metabolism Malic enzyme 1.89688 SCCCAD1004H02.g Stress
Catalases 2.66819 SCRLST3166F11.g No matches (non-coding) 1.95495
SCSFAD1124E07.g Transcription Myb 4.31601 SCCCCL5004D02.g No
matches 1.51467 SCQGSB1140F12.g Pathogenicity R-genes NBS-LRR
2.44294 SCCCRZ1003A03.g Calcium Calmodulin-binding proteins HSP7s
(heat shock) 1.78283 The individuals were selected from an F1
progeny of a cross between two commercial varieties, SP80-180 and
SP80-4966. RNA samples from internode 9 (mature, rich in sugar) and
internode 1 (immature, poor in sugar) were collected in July from
the seven highest brix individuals and used to generate probes for
cDNA microarray hybridizations. The column High indicates the
average ratios (fold induction) of genes more expressed in
internode 9 than in internode 1. The column Low indicates the
average ratios (fold induction) of genes more expressed in
internode 1 than in internode 9. The average brix in the highest
sugar internodes was 22.63.
TABLE-US-00015 TABLE XVII Genes differentially expressed between
Internode 9 (mature rich in sugar) Internode 1 (immature, poor in
sugar) from a pool of seven low brix plants. SAS Category
Description of homologue High Low SCUTFL3073E12.g Unknown protein
2.0326 SCBGLR1096E06.g Nucleotide metabolism Putative inosine
monophosphate dehydrogena 2.58395 SCBFLR1039B05.g Carbohydrate
Metabolis Xyloglucan endotransglycosylase 5.33996 SCSBAD1084C01.g
Others Tubulin alpha-1 chain 2.90392 SCUTLR1037F12.g Protein
metabolism 60S Ribosomal protein L5 2.60981 SCCCST1004C05.g Protein
kinases Others caneIre1-1 (Similar to ER-located tran 2.12312
SCCCLB1001D03.g Protein Phosphatases Serine/Threonine - PPP Family
PP2A/Cataly 1.55983 SCCCCL5002B10.g Protein kinases
Undefined-unclassified caneUPK-87 1.91338 SCRLFL1012B10.g Protein
kinases Cell cycle-related caneCDK-6 1.8469 SCJFRZ2010A09.g
Ubiquitination E1 2.19142 SCVPAM1055A12.g Protein kinases Casein
kinases caneCKI-11 2.3001 SCRLSD1012E03.g Ubiquitination Ubiquitin
1.97292 SCCCLR2002D04.g DNA metabolism Histone H4 2.17368
SCJFRZ2032G01.g Protein kinases SNF-like kinases caneSnRK1-2
2.89539 SCSBHR1050B11.g Development Putative senescence-associated
protein 7.68477 SCCCLR2002G09.g DNA metabolism Histone H4 4.16496
SCVPCL6042B07.g Protein kinases Others cane cyclin G-associated
kinase-like p 1.98527 SCJLLR1108H07.g Calcium Calmodulin-binding
proteins ACA 1.94396 SCVPFL3045B09.g Stress Metalothionein 2.75676
SCCCLR2C03D05.g Stress Superoxide dismutases Cu/Zn 2.09879
SCJLRT1023G09.g Protein kinases SNF-like kinases caneCIPK-19
1.95006 SCVPLR1049C09.g Calcium Calmodulin-binding proteins ATPase
2.32277 SCCCRT1001E12.g Small GTPases Rab 1.78307 SCVPLR2019B03.g
Pathogenicity Polygalacturonase inhibitor 4.69134 SCVPRZ3029G09.g
Receptors Receptor Ser/Thr kinase caneLTK1-16 (leuci 1.72477
SCCCLB1023E12.g Receptors Receptor Ser/Thr kinase caneRLK-DXIV1 (
1.94444 SCEZLR1052D02.g Unknown protein 1.9867 SCCCRZ1001G10.g
Transcription Aux/IAA 2.01005 SCEZLR1052F07.g Protein Phosphatases
Serine/Threonine - PPP Family PP2A/Subu 1.69977 SCCCRZ1004H12.g
Transcription EIL (ethylene-insensitive3-like) 2.6871
SCACLR1130H08.g Transcription Zinc finger proteins C2C2/YABBY
2.10948 SCCCLR1024F10.g Transcription Other Auxin-response factors
With B3 doma 3.03055 SCQGRZ3011D06.g Transcription Alfin-like
2.17274 SCCCLR1048F03.g Unknown protein Chloroplast hypothetical
protein 3.39922 SCCCLR1068G11.g DNA metabolism Histone H2B 3.37772
SCQSHR1023F08.g Stress Cytochrome P450 CYP71 4.45371
SCUTAM2088G02.g Unknown protein Putative GTP-binding protein
1.80345 SCRFLR2037F09.g Calcium Calreticulin 2.87788
SCCCLR1C03G01.g Hormone biosynthesis Jasmonic Acid Linoleic acid
desaturase 3.49276 SCUTST3129E01.g Unknown protein 1.93583
SCQGHR1012B09.g Stress Probable cytochrome P450 monooxygenase
5.67878 SCVPCL6041F12.g Ubiquitination Ubiquitin-specific protease
1.8455 SCJLHR1028C12.g Stress Infected libraries Histone H4 3.76242
SCVPLR2005H03.g Transcription Aux/IAA 3.15361 SCEQRT1031D02.g
Adapters 14-3-3 proteins 2.23343 SCCCCL3120C09.g Receptors Receptor
Ser/Thr kinase cane RLK with Lys 1.97526 SCCCLR2C02A05.g
Development Expansin 2.39903 SCCCCL4003D08.g Transcription Zinc
finger proteins C3H 1.90193 SCSBSD2058D04.g Ubiquitination
Ubiquitin 1.88495 SCVPRT2074D04.g Unknown protein 6.8061
SCCCRZ1001D02.g Adapters 14-3-3 proteins 2.70281 SCMCST1053A06.g
Receptors Receptor Ser/Thr kinase canePERK1-3 2.4114
SCCCLB2004C08.g Ubiquitination Ubiquitin 1.92442 SCCCRZ1002F06.g
Stress Drought and cold response Enolase 2.80387 SCCCLR1022H07.g
Protein kinases Cell cycle-related caneCDK-11 2.39455
SCCCRZ1001A09.g Unknown protein 1.97585 SCSGAM1094D05.g Hormone
biosynthesis Salicylic Acid 2.47418 SCCCLR1024E11.g Stress
Superoxide dismutases Cu/Zn 2.62077 SCCCRZ1C01H06.g Calcium
Calmodulin-binding proteins Apyrase 3.09699 SCQGLR2032G10.g
Ubiquitination Polyubiquitin 1.63756 SCACLR1057C07.g Two component
Response regulators (ARR-like) 2.18371 SCCCRZ2002C09.g Others Alpha
tubulin 2.66313 SCQGST1034G10.g Protein kinases Putative RLCK
caneRLCK-AIV3 2.34207 SCBGFL4052C11.g Transcription EIL
(ethylene-insensitive3-like) 1.73335 The individuals were selected
from an F1 progeny of a cross between two commercial varieties,
SP80-180 and SP80-4966. RNA samples from internode 9 (mature, rich
in sugar) and internode 1 (immature, poor in sugar) were collected
in March from the seven lowest brix individuals and used to
generate probes for cDNA microarray hybridizations. The column High
indicates the average ratios (fold induction) of genes more
expressed in internode 9 than in internode 1. The column Low
indicates the average ratios (fold induction) of genes more
expressed in internode 1 than in internode 9. The average brix in
the highest sugar internodes was 13.66. indicates data missing or
illegible when filed
TABLE-US-00016 TABLE XVIII Genes differentially expressed between
Internode 9 (mature, rich in sugar) and Internode 1 (immature, poor
in sugar) from a pool of seven low brix plants. SAS Category
Description of homologue High Low SCCCRZ2C04A07.g Stress Cytochrome
P450 CYP71E 9.59342 SCCCST1004A07.g Protein kinases SNF-like
kinases cane osmotic stress-activated protein kinase-7 2.37339
SCCCLR1024E11.g Stress Superoxide dismutases Cu/Zn 2.21539
SCCCCL5002B10.g Protein kinases Undefined-unclassified caneUPK-87
2.15162 SCCCRZ2C03D11.g Transcription Scarecrow 3.38429
SCBFAD1046D01.g Transcription HLH (helix-loop-helix) 2.74633
SCBFLR1039B05.g Carbohydrate Metabolism Xyloglucan
endotransglycosylase 13.7587 SCBGFL4053F12.g Receptors Receptor
Ser/Thr kinase caneRLK-DV2 4.08493 SCEQRT1028H06.g Hormone
biosynthesis Auxin Nitrilase 2.39496 SCCCRT2001H11.g Small GTPases
Arf 2.33013 SCCCCL4004C06.g Unknown protein 4.61263 SCCCRZ1C01H06.g
Calcium Calmodulin-binding proteins Apyrase 8.66427 SCCCRZ2C03B08.g
Unknown protein 2.92174 SCCCLR1001E04.g Carbohydrate Metabolism
Photosynthesis RUBISCO - small subunit 4.99165 SCSGFL5C08F04.g
Unknown protein 17.9899 SCUTAM2115C12.g Unknown protein 3.94798
SCJLRZ1023H04.g Protein kinases SNF-like kinases caneCIPK-9 4.18557
SCMCFL5005A02.g Stress Glutathione peroxidases 2.65839
SCVPRT2074D04.g Unknown protein 15.4127 SCAGLR1021G10.g
Transcription Homeobox knotted homeobox 2.46187 SCJLLR1054C09.g
Transcription Aux/IAA 2.43353 SCEPRZ1009C10.g Protein kinases
SNF-like kinases cane osmotic stress-activated protein kinase-1
2.41081 SCCCLR2C03D05.g Stress Superoxide dismutases Cu/Zn 3.06534
SCRLAM1010D08.g Transcription Homeobox knotted homeobox 2.66789
SCBFST3136A06.g No matches 1.73546 SCRLFL3007C04.g Receptors
Receptor Ser/Thr kinase caneRLK-D5 3.92386 SCCCHR1004H09.g Others
Putative cholinephosphate cytidylyltransferase 1.67693
SCCCRZ1001D02.g Adapters 14-3-3 proteins 2.07764 SCEZRZ1012A02.g
Stress Cytochrome P450 CYP9 4.02698 SCCCRZ1001G10.g Transcription
Aux/IAA 4.19655 SCCCCL3120C09.g Receptors Receptor Ser/Thr kinase
cane RLK with LysM-1 4.50352 SCCCRZ2002C09.g Others Alpha tubulin
2.30687 SCRUAD1063C06.g Pathogenicity Polygalacturonase-inhibiting
1.85181 SCCCST2004D11.g Receptors Receptor Ser/Thr kinase cane RLK
with lectin domain-2 6.70096 SCCCLR2002F08.g Hormone related Auxin
auxin repressed 1.67626 SCJFRZ2007F10.g Development ARC1 (arm
repeat protein) 2.00974 The individuals were selected from an F1
progeny of a cross between two commercial varieties, SP80-180 and
SP80-4966. RNA samples from internode 9 (mature, rich in sugar) and
internode 1 (immature, poor in sugar) were collected in July from
the seven lowest brix individuals and used to generate probes for
cDNA microarray hybridizations. The column High indicates the
average ratios (fold induction) of genes more expressed in
internode 9 than in internode 1. The column Low indicates the
average ratios (fold induction) of genes more expressed in
internode 1 than in internode 9. The average brix in the highest
sugar internodes was 18.96.
TABLE-US-00017 TABLE XIX Genes differentially expressed between
Internode 5 (intermediately mature, rich in sugar) and Internode 1
(immature, poor in sugar) from a pool of seven high brix plants.
SAS Category Description of homologue High Low SCCCCL2001B01.b
Calcium Calmodulin-binding proteins Apyrase 3.83704 SCRLAM1010D08.g
Transcription Homeobox knotted homeobox 2.47858 SCEPLB1043H04.g No
matches 2.03771 SCRLFL3007C04.g Receptors Receptor Ser/Thr kinase
caneRLK-D5 2.19385 SCJFRZ2032G01.g Protein kinases SNF-like kinases
caneSnRK1-2 2.49118 SCRLSD1012E03.g Ubiquitination Ubiquitin
2.12917 SCEQRT1033F01.g Pathogenicity Zinc finger proteins C2C2/Dof
7.73845 SCVPLR1049E12.g Small GTPases Rab 2.20693 SCCCCL4003D08.g
Transcription Zinc finger proteins C3H 3.08079 SCSBHR1050B11.g
Development Putative senescence-associated protein 3.39882
SCCCRT2001H11.g Small GTPases Arf 1.91729 SCVPRT2074D04.g Unknown
protein 9.59628 SCJLLR1108H07.g Calcium Calmodulin-binding proteins
ACA 2.13521 SCEQRT1028H06.g Hormone biosynthesis Auxin Nitrilase
1.72814 SCCCRZ1001G10.g Transcription Aux/IAA 2.77082
SCRURT2010A10.g Transcription Putative transcription factor (myb)
2.08173 SCSBSD2058D04.g Ubiquitination Ubiquitin 1.77273
SCAGLR1021G10.g Transcription Homeobox knotted homeobox 2.61934
SCCCLR1024F10.g Transcription Other Auxin-response factors With B3
domain 2.32277 SCSFHR1043G09.g Stress Infected libraries
S-adenosylmethionine synthase 2.3562 SCCCLR1048F03.g Unknown
protein Chloroplast hypothetical protein 20.3768 SCEZLR1052E07.g No
matches 1.59145 SCCCRZ2C03D11.g Transcription Scarecrow 3.57548
SCSGRT2066D05.g Stress Cytochrome P450 3.17506 SCCCRZ3002D03.g
Transcription LIM (protein-protein interaction) 5.10403
SCVPRZ2038F04.g Hormone biosynthesis Jasmonic Acid Linoleic acid
desaturase 2.7837 SCCCLR1C03G01.g Hormone biosynthesis Jasmonic
Acid Linoleic acid desaturase 2.1299 SCUTLR1037F04.g Others Ankyrin
repeat family protein Xa21 binding 2.00053 SCCCCL5002B10.g Protein
kinases Undefined-unclassified caneUPK-87 2.09228 SCCCLR1C05B07.g
Protein kinases SNF-like kinases caneCIPK-3 2.30631 SCJFRZ2007F10.g
Development ARC1 (arm repeat protein) 16.2237 SCEPLR1030B03.g
Pathogenicity Tomato LRP protein 1.77057 SCQGHR1012B09.g Stress
Probable cytochrome P450 monooxygenase 2.2378 SCCCCL3120C09.g
Receptors Receptor Ser/Thr kinase cane RLK with LysM-1 1.69331
SCEPRZ1009C10.g Protein kinases SNF-like kinases cane osmotic
stress-activated protein kinase-1 2.15245 SCRUFL1112F04.b Others
RNA stability UDP-GlcNAc 2.7596 SCVPLR2027A05.g Transcription Other
Auxin-response factors With B3 domain 2.55167 SCCCRZ1001D02.g
Adapters 14-3-3 proteins 2.02234 SCVPRZ3025A12.g Protein kinases
RLCK canePBS1-6 2.16888 SCJLRZ1023H04.g Protein kinases SNF-like
kinases caneCIPK-9 3.53497 SCEQRT2099H01.g Protein kinases
Calcium-related caneCDPK-27 1.84964 SCCCRZ1001H05.g Transcription
HLH (helix-loop-helix) 4.52862 SCMCCL6055H06.g Pathogenicity Tomato
LRP protein 1.96121 SCCCRZ1002F06.g Stress Drought and cold
response Enolase 2.22871 SCCCLR1048D07.g Hormone biosynthesis
Salicylic Acid 14.2767 SCCCRZ1C01H06.g Calcium Calmodulin-binding
proteins Apyrase 4.7337 SCSGAM1094D05.g Hormone biosynthesis
Salicylic Acid 5.14944 SCCCLR1072E03.g Receptors Receptor Ser/Thr
kinase caneRLK-AX3 2.08456 SCSGFL5C08F04.g Unknown protein 10.083
SCCCRZ2C04A07.g Stress Cytochrome P450 CYP71E 4.14116
SCUTAM2088G02.g Unknown protein Putative GTP-binding protein
1.82251 SCCCLR1C04G08.g Protein kinases Casein kinases caneCKI-3
4.08444 SCUTLR2008E01.g No matches 1.84352 SCQSRT1036D03.g
Pathogenicity R-genes transduction PR 2.02071 SCRLST3166F11.g No
matches (non-coding) 1.63126 SCEQLB1065H07.g No matches 2.42131
SCRLAD1100E08.g No matches 2.36751 SCRUAD1133D10.b Receptors
Photoreceptors Blue light receptor cry1 2.95879 SCCCLR1001D10.g
Transcription Putative AP2-domain transcription factor 2.30605
SCSBHR1056H08.g Receptors EIN2 (ethylene) 4.24768 SCCCLR1C07B07.g
Others Glycine-rich RNA-binding protein 1.84253 SCCCRZ2C03B03.g
Receptors Receptor Ser/Thr kinase cane RLK with LysM-2 1.76512
SCCCLR2001H09.g Stress Thioredoxin 2.00805 SCRLFL1008C11.g No
matches 2.48511 The individuals were selected from a F1 progeny of
a cross between two commercial varieties, SP80-180 and SP80-4966.
RNA samples from internode 5 (Intermediate sugar) and internode 1
(Low sugar) were collected in July from the seven highest brix
individuals and used to generate probes for cDNA microarray
hybridizations. The column High indicates the average ratios (fold
induction) of genes more expressed in internode 5 than in internode
1. The column Low indicates the average ratios (fold induction) of
genes more expressed in internode 1 than in internode 5. The
average brix in the highest sugar internodes was 22.63.
TABLE-US-00018 TABLE XX Genes differentially expressed between
Internode 5 (intermediately mature, rich in sugar) and Internode 1
(immature, poor in sugar) from a pool of seven low brix plants. SAS
Category Description of homologue High Low SCCCST1004A07.g Protein
kinases SNF-like kinases cane osmotic stress-activated protein
kinase-7 2.24911 SCVPLR2027A05.g Transcription Other Auxin-response
factors With B3 domain 1.92017 SCEZRZ1012A02.g Stress Cytochrome
P450 CYP9 2.66254 SCBFLR1039B05.g Carbohydrate Metabolism
Xyloglucan endotransglycosylase 6.00106 SCCCRZ1001G10.g
Transcription Aux/IAA 1.58291 SCEQRT1033F01.g Pathogenicity Zinc
finger proteins C2C2/Dof 2.69468 SCCCRZ1C01H06.g Calcium
Calmodulin-binding proteins Apyrase 4.50294 SCSBAM1084F08.g Unknown
protein Similar to cyclin 4.00643 SCCCLR1001E04.g Carbohydrate
Metabolism Photosynthesis RUBISCO - small subunit 2.99228
SCSGAM1094D05.g Hormone biosynthesis Salicylic Acid 3.03142
SCCCLR1048D07.g Hormone biosynthesis Salicylic Acid 3.86262
SCSGFL5C08F04.g Unknown protein 7.37235 SCCCRZ3002D03.g
Transcription LIM (protein-protein interaction) 3.27664
SCVPRT2074D04.g Unknown protein 9.96472 SCRURT2010A10.g
Transcription Putative transcription factor (myb) 1.75219
SCCCRZ2C03D11.g Transcription Scarecrow 2.57578 SCRLFL3007C04.g
Receptors Receptor Ser/Thr kinase caneRLK-D5 2.6318 SCCCCL4004C06.g
Unknown protein 2.12353 SCJFRZ2007F10.g Development ARC1 (arm
repeat protein) 4.00615 SCCCLR1048F03.g Unknown protein Chloroplast
hypothetical protein 3.74571 SCCCRZ2C04A07.g Stress Cytochrome P450
CYP71E 7.42158 SCSGRT2066D05.g Stress Cytochrome P450 2.16937
SCBGLR1117A05.g Small GTPases Ran 1.86344 SCCCLR1C04E03.g
Ubiquitination E2 1.56768 SCSBAD1084C01.g Others Tubulin alpha-1
chain 1.72259 SCMCLR1123E10.g Others T-complex protein (chaperonin)
2.39987 SCVPLR2012B07.g Two component Phosphorelay intermediate
Similar to ATHP1 ATHP2 ATHP3 2.91613 SCQGLR1019A10.g Small GTPases
Ran 2.08538 SCQSRT1036D03.g Pathogenicity R-genes transduction PR
1.86776 SCCCLR2001H09.g Stress Thioredoxin 2.43049 SCRFFL5034G07.g
No matches 2.21962 SCCCLR2002F08.g Hormone related Auxin auxin
repressed 1.78828 SCCCLR1C07B07.g Others Glycine-rich RNA-binding
protein 2.24474 SCJFAM1066B05.g Transcription HIT (histidine triad)
PKC inhibitor 1.85085 SCCCRT2002B03.g Protein metabolism Putative
ribosomal protein S14 2.48804 SCRLLR1111D02.g No matches
(non-coding) 1.70582 SCCCCL4007H07.g No matches 1.9409
SCJFHR1C03E01.b Protein kinases Undefined canePK-BII3 1.60982
SCCCFL4091A07.g Hormone related Giberellin Giberellin responsive
1.79817 SCJFRT1062G05.g Transcription CCAAT 1.68245 SCCCRZ2001F06.g
Protein metabolism Putative 6S ribosomal protein L11 2.1963
SCSBSD2029F05.g Unknown protein 5.22372 SCJFRZ2028F11.g Receptors
Receptor Ser/Thr kinase caneSERK-5 2.07098 SCCCRZ2003E12.g
Transcription bZIP 1.7904 SCUTLR2008E01.g No matches 2.06397
SCCCST3C01D11.g Receptors Receptor Ser/Thr kinase-unclassified
caneURLK-84 (with LRR) 1.97063 SCSBSD2029D11.g No matches 1.77589
SCEQLR1091A10.g Protein metabolism 60S Ribosomal protein L23
2.04218 SCCCLR2001E10.g No matches 1.96151 SCQSSB1077D06.g
Receptors Receptor Ser/Thr kinase caneRLK-DXII4 2.11245
SCEZHR1087F06.g Stress Cytochrome P450 CYP84 1.72424
SCRLFL1008C11.g No matches 2.58471 SCEZLR1009F06.g Carbohydrate
metabolism Pyruvate dehydrogenase 2.60268 SCCCCL4004A10.g Others
Putative polyprotein 1.97711 SCJFLR1013A09.g Stress Drought and
cold response Cysteine proteinase RD19A precursor 2.11721
SCSBHR1056H08.g Receptors EIN2 (ethylene) 3.47771 SCCCLR1001D10.g
Transcription Putative AP2-domain transcription factor 1.884
SCCCRZ2002C09.g Others Alpha tubulin 1.84438 The individuals were
selected from a F1 progeny of a cross between two commercial
varieties, SP80-180 and SP80-4966. RNA samples from internode 5
(Intermediate sugar) and internode 1 (Low sugar) were collected in
July from the seven lowest brix individuals and used to generate
probes for cDNA microarray hybridizations. The column High
indicates the average ratios (fold induction) of genes more
expressed in internode 5 than in internode 1. The column Low
indicates the average ratios (fold induction) of genes more
expressed in internode 1 than in internode 5. The average brix in
the highest sugar internodes was 18.96.
TABLE-US-00019 TABLE XXI An example of genes that are
differentially expressed both when High and Low Brix plants are
compared and when Mature (Internode 9) and Immature (Internode 1)
internodes are compared. Data indicated with an asterisk has been
published by Felix J. M. (2006). SAS category sub category 1 sub
category 2 High vs Low brix Internode 9 vs Internode 1
SCRFLR2037F09.g Calcium Calreticulin Down High Brix Down Mature
Internode SCCCRT1001E01.g Hormone biosynthesis Jasmonic Acid
Lipoxygenase Down High Brix Down Mature Internode* SCCCLR2002F08.g
Hormone related Auxin auxin repressed Down High Brix Down Mature
Internode SCRFLR1012F12.g Others caffeic acid 3-O- Up High Brix Up
Mature Internode* methyltransferase SCSFAD1125C08.g Pathogenicity
Polygalacturonase-inhibiting Down High Brix Down Mature Internode*
SCCCLR2C01G07.g Protein kinases SNF-like kinases caneCIPK-20 Up
High Brix Up Mature Internode* SCMCRT2103B04.g Protein kinases
SNF-like kinases caneCIPK-21 Up High Brix Up Mature Internode*
SCEPRZ1010E06.g Protein Phosphatases Serine/Threonine - PPM Family
PP2C-like Down High Brix Down Internode* SCCCLR2C01F06.g Stress
Wound-induced Up High Brix Up Mature Internode* SCJLRT1021D12.g
Stress Wound-induced Chalcone synthase Down High Brix Down
Internode* SCJFRT1005C11.g Hormone biosynthesis Ethylene ACC
oxidase Up High Brix Down Mature Internode* SCVPLR2012A10.g Hormone
biosynthesis Ethylene ACC oxidase Up High Brix Down Mature
Internode* SCCCLR1048D07.g Hormone biosynthesis Salicylic Acid Up
High Brix Down Mature Internode SCEQRT1024E12.g Hormone
biosynthesis Salicylic Acid Up High Brix Down Mature Internode*
SCCCLR1C02F07.g Inositol Others myo-Inositol-1- Up High Brix Down
Mature Internode* phosphate synthase SCEZHR1087F06.g Stress
Cytochrome P450 CYP84 Down High Brix Up Mature Internode
SCAGFL1089C03.g Stress Glutathione S-transferases Up High Brix Down
Mature Internode* SCCCCL3002C09.b Stress Glutathione S-transferases
Up High Brix Down Mature Internode*
Genes of this Invention
[0072] The invention provides polynucleotides described above and
their variants.
[0073] Variants
[0074] "Variants" is intended to include substantially similar
polynucleotide sequences, as long as they still have a same or
substantially similar function as polynucleotides of this
invention, e.g., marker for plants with different sugar content,
ability to modulate sugar content. Common sources for variants
include sequence identity variants, fragments, hybridizing
sequences, complements, or mutated sequences. A fragment of the
sequence is defined as a portion or region of the sequence that can
be used to alter the expression levels of one of the genes encoding
SEQ ID Nos. 1-203 or 229 to 373 in transgenic plants.
[0075] Sequence Identity
[0076] Naturally and non-naturally occurring "variants" of
differentially expressed sequences within the invention include
nucleic acid molecules having at least about 65%, 70%, 75%, 80%,
85%, 90%, or 95% sequence identity with the native sugarcane
sequences disclosed herein, i.e., SEQ ID Nos. 1-203 or 229 to 373,
or complements of these sequences. More preferably, the variants
have 97%, 98%, 99%, or at least about 99.5% sequence identity to
the whole sequence or a fragment of the sequence. Comparisons for
determination of sequence identity can be made using methods known
to those of skill in the art.
[0077] Hybridization
[0078] "Variants" also include nucleic acids molecules that
hybridize under high stringency conditions, as defined herein, to
the sugarcane nucleic acid sequences of SEQ ID Nos. 1-203 or 229 to
373 or the complement of the sequences of SEQ ID Nos. 1-203 or 229
to 373. For example, such "variants" may be nucleic acid molecules
that hybridize to the sequence of SEQ ID Nos. 1-203 or 229 to 373
or the complement of the sequences of SEQ ID Nos. 1-203 or 229 to
373 under low stringency conditions, moderate stringency
conditions, or high stringency conditions. (See Sambrook et al.
(Most recent edition) Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
[0079] As used herein, the phrase "low stringency hybridization
conditions" refers the following conditions and equivalents
thereto: hybridization at 5.times.SSC, 2% SDS, and 100 .mu.g/ml
single stranded DNA at 40.degree. C. for 8 hours, followed by at
least one wash in 2.times.SSC, 0.2% SDS, at 40.degree. C. for
thirty minutes. As used herein, the phrase "moderate stringency
hybridization conditions" refers the following conditions and
equivalents thereto: hybridization at 5.times.SSC, 2% SDS, and 100
.mu.g/ml single stranded DNA at 50.degree. C. for 8 hours, followed
by at least one wash in 0.1.times.SSC, 0.1% SDS, at 50.degree. C.
for thirty minutes. As used herein, the phrase "high stringency
hybridization conditions" refers the following conditions and
equivalents thereto: hybridization at 5.times.SSC, 2% SDS, and 100
.mu.g/ml single stranded DNA at 65.degree. C. for 8 hours, followed
by at least one wash in 0.1.times.SSC, 0.1% SDS, at 65.degree. C.
for thirty minutes.
[0080] Complements
[0081] Alternatively, nucleic acids of this invention are those
having a nucleotide sequence that is the complement of the
full-length or portions of the sequences of SEQ ID Nos. 1-203 or
229 to 373.
[0082] Polynucleotides can be as short as 14 nucleotides, but they
are not restricted to this length.
[0083] Mutants
[0084] The genes can also be mutated by radiation or chemical
mutagenesis using EMS (ethylmethane sulfonate) and mutated alleles
identified by Tilling or RFLP generating plants with increased
sucrose content through non-transgenic methodologies.
[0085] One or more point mutations can be introduced into a nucleic
acid molecule to yield a modified nucleic acid molecule using, for
example, site-directed mutagenesis (see Wu (Ed.), Meth. In Enzymol.
Vol. 217, San Diego: Academic Press (1993); Higuchi, "Recombinant
PCR" in Innis et al. (Ed.), PCR Protocols, San Diego: Academic
Press, Inc. (1990), each of which is incorporated herein by
reference). Such mutagenesis can be used to introduce a specific,
desired amino acid insertion, deletion or substitution;
alternatively, a nucleic acid sequence can be synthesized having
random nucleotides at one or more predetermined positions to
generate random amino acid substitutions. Scanning mutagenesis also
can be useful in generating a modified nucleic acid molecule
encoding substantially the amino acid sequence as polypeptides of
this invention.
Polypeptides of this Invention
[0086] In certain embodiments, this invention provides polypeptides
partially or fully encoded by the polynucleotides of this invention
or by variants of a polynucleotide of this invention.
[0087] In other embodiments, the polypeptide has an amino acid
sequence substantially similar to that encoded by polynucleotides
of this invention. As used herein, the term "substantially the same
amino acid sequence," is intended to mean a polypeptide or
polypeptide segment having an identical amino acid sequence, or a
polypeptide or polypeptide segment having a similar, non-identical
sequence that is considered by those skilled in the art to be a
functionally equivalent amino acid sequence. In particular,
polypeptide with "substantially the amino acid sequence" can have
one or more modifications such as amino acid additions, deletions
or substitutions, including conservative or non-conservation
substitutions.
[0088] Comparison of sequences for substantial similarity can be
performed between two sequences of any length and usually is
performed with sequences between about 6 and 1200 residues,
preferably between about 10 and 100 residues and more preferably
between about 25 and 35 residues. Such comparisons for substantial
similarity are performed using methodology routine in the art.
[0089] The preferred percentage of sequence similarity for
polypeptides includes polypeptides having at least about 65%
similarity, 70% similarity, 75% similarity, 80% similarity, 85%
similarity, 90% similarity, 95% similarity, 97% similarity, 98%
similarity, 99% similarity, or more preferably at least about 99.5%
similarity.
[0090] Sequence similarity is preferably calculated as the number
of similar amino acids in a pairwise alignment expressed as a
percentage of the shorter of the two sequences in the alignment.
The pairwise alignment is preferably constructed using the Clustal
W program, using the following parameter settings: fixed gap
penalty=10, floating gap penalty=10, protein weight
matrix=BLOSUM62. Similar amino acids in a pairwise alignment are
those pairs of amino acids which have positive alignment scores
defined in the preferred protein weight matrix (BLOSUM62). The
protein weight matrix BLOSUM62 is considered appropriate for the
comparisons described here by those skilled in the art of
bioinformatics. (The reference for the clustal w program
(algorithm) is Thompson, J. D., Higgins, D. G. and Gibson, T. J.
(1994) CLUSTAL W: improving the sensitivity of progressive multiple
sequence alignment through sequence weighting, positions-specific
gap penalties and weight matrix choice. Nucleic Acids Research,
22:4673-4680; and the reference for BLOSUM62 scoring matrix is
Henikoff, S. and Henikoff, J. G. (1993) Performance evaluation of
amino acid substitution matrices. Proteins, 7:49-61.)
[0091] It is understood that minor modifications of primary amino
acid sequence can result in a polypeptide that has substantially
equivalent or enhanced function polypeptides of this invention.
Further, various molecules can be attached to polypeptide thereof,
for example, other polypeptides, antigenic or other peptide tags,
carbohydrates, lipids, or chemical moieties.
Sugarcane Plants For Identification of Genes of This Invention
A--Crossings
[0092] 1--An Example of Characterization of a Progeny Derived from
Wild-Type Ancestors:
[0093] Two initial intra-specific polycrosses could be performed,
one among Saccharum officinarum genotypes and the other combining
Saccharum spontaneum genotypes. The crossing and selection process
that could follow is illustrated in FIG. 1. For each generation 500
individuals could be sampled for brix content and gene expression
and the extreme segregants selected. The hybrid individuals
selected for molecular studies could be planted in the field in one
row of 5 meters using standard sugarcane cultivation practices.
Brix readings and tissue samples could be collected very early in
the season, in March of the following year, when plants were 10
months. For brix content determination plants could be sampled by
using a hand held juice sample collector. Juice could be collected
by punching a hole in the middle of the 5.sup.th visible internode
counted from the top after removal of the lowest dry leaf sheath
still attached to the culm. A few drops of the juice could be
placed in a handheld refractometer (N1, ATAGO, Japan) and a direct
brix reading obtained. Individuals or pools of individuals (for
example, seven or eight individuals) can have their tissues
collected and RNA extracted.
[0094] 2--Examples of a Progeny Derived from Commercial
Varieties:
[0095] Five hundred sugarcane F1 plants from a cross between two
commercial varieties (SP80-180.times.SP80-4966, or
SP80-144.times.SP85-7215) could be kept in a green house or
field-grown. They could segregate for stem sugar content in a
normal manner and the seven plants presenting extreme values for
gene expression associated to high sugar and low sugar could be
selected. Mature leaves (Leaf +1, Van Dillewijn, 1952), immature
leaf, mature internode, immature and intermediate internode, root,
lateral bud and a mix of flowers in different developmental stages
could be collected from the selected plants 6, 7, 9, 11 and 13
months after planting (but not restricted to). Tissues collected at
each time point could be pooled from seven individuals of each
group or characterized for each individual sample. For RNA blot
analysis all time points could be evaluated, or only one time point
could be evaluated. Gene expression profiles could be analyzed
independently, using three individuals from each group (for
example), or be determined for a group of plants.
B--Commercial Varieties or Cultivars
[0096] Varieties can be field-grown for a year (for example, since
September) and samples collected throughout the year (for example
in March, May, July or September, but not restricted to). Tissue
samples can be collected from 2 to 4 individuals of each variety
which are pooled or analyzed independently. Examples of varieties
that have been shown to have altered expression for the genes are
the high sucrose and precocious accumulating cultivars SP91-1049
and SP89-1115 in comparison to the low sucrose and late
accumulating cultivars SP83-2847 and SP94-3116. Samples can be
collected as described above.
Methods for Determining the Ability of a Plant to Accumulate
Sugar
[0097] In certain embodiments, this invention uses genes that are
differentially expressed in plants having different sugar levels,
such as SEQ ID NO:s 1 to 203 and SEQ ID NO:s 229 to 373, to
determine the ability of the plant to accumulate sugar. In some
embodiments, the expression level of genes is measured using
various methods known in the art, such as those described below. In
other embodiments, the expression level of the polypeptide
expressed by polynucleotides of this invention is detected.
Measurement of Gene Expression
[0098] Gene expression can be determined using any technique that
will measure the product of the gene's activity, for example
transcript or mRNA levels or protein levels, including cDNA
microarrays, oligonucleotide arrays or gene chips, quantitative
PCR, northern blots, western blots/ELISA/mass spectrometry,
according to the methods described in this work.
[0099] Gene expression can be measured by various methods,
including: [0100] quantitative PCR [0101] real-time PCR [0102] cDNA
microarrays [0103] oligonucleotide arrays or gene chips [0104]
northern blots [0105] any technique that will measure transcript
levels for genes such as NASBA or TMA [0106] any technique that
will use hybridization of genes or of a product of the gene as a
measure of gene expression any technique that will measure a
product of gene expression such as the protein encoded by the genes
such as with the aid of an antibody (as in western blots and ELISA)
or mass spectrometry. cDNA Microarrays Tissue Sampling and RNA
Extraction from Sugarcane Plants
[0107] The first leaf with a visible dewlap (leaf +1) and
internodes 1, 2, 5 and 9 (counted from top to bottom where number 1
was the smallest visible internode after all leaves were removed)
can be collected from 6 to 18 month old plants. The internodal
tissue can be separated from the node, cut in small pieces, frozen
in liquid nitrogen, and stored at -80.degree. C. Internodes 1 and 2
can be pooled prior to RNA extraction and are referred as internode
1. Frozen tissues can be grinded using a homogenizer. 2-2.5 g were
weighted and grinded to a fine powder, in liquid nitrogen, using
pre-cooled mortar and pestle. The pulverized tissue will be
transferred to a 50 ml tube and homogenized with 5 ml Trizol.RTM.
(Invitrogen) per gram of tissue. The manufacturer's recommendations
for high polysaccharide content tissues will be followed for the
mature internode samples. Samples can be incubated for 5 min at
room temperature (RT), with occasional vortexing. The homogenate
will be centrifuged at 3,000 rpm; 4.degree. C. for 10 min and the
supernatant transferred to a new 50 ml tube. 0.2 ml of chloroform
(RT) will be added for each ml of Trizol.RTM. solution. The
solution will be mixed vigorously for 15 s and incubated for 3 min
at RT. After centrifugation (3,000 rpm, 4.degree. C., 15 min), the
aqueous phase will be transferred to tubes containing 0.6 volumes
of isopropanol. The solution will be mixed several times by gentle
inversion and incubated at RT for 10 min Tubes will be centrifuged
at 10,000 rpm, 4.degree. C. for 10 min and the supernatant was
carefully discarded. Pellets will be washed with cold 75% ethanol.
Samples will be briefly vortexed and centrifuged at 6,000 rpm for 5
min. The supernatant can be again discarded and pellets washed with
cold 100% ethanol. After centrifugation, the supernatant will be
discarded and pellets were allowed to dry at RT for at least 10 min
Pellets will be resuspended in 20 .mu.l of warm diethyl
pyrocarbonate-treated water, vortexing gently for about 15 min RNA
samples can be quantified in a spectrophotometer and loaded on 1.0%
agarose/formaldehyde gels for quality inspection.
PCR Amplification and Array Printing
[0108] Sugarcane cDNA plasmid clones of 6438 ESTs obtained from the
SUCEST collection can be re-arranged and amplified in 100 .mu.l PCR
reactions (40 cycles, annealing at 51.degree. C.), directly from
bacterial clones in culture, using T7 and SP6 primers. For this
work, clones had their identity validated by re-sequencing. PCR
products can be purified by filtration using 96 well filter plates
(Millipore Multiscreen.RTM. MAFBNOB50). Samples can be visualized
on 1% agarose gels to inspect PCR-amplification quality and
quantity. Purified PCR products (in 10 mM Tris-HCl pH 8.0 solution)
can be mixed with an equal volume of DMSO in 384 well V-bottom
plates. Microarrays can be constructed by arraying cDNA fragments
on DMSO optimized, metal coated glass slides (type 7, Amersham
Biosciences) using the Generation III Microarray Spotter (Molecular
Dynamics/Amersham Pharmacia Biotech). Each cDNA fragment was
spotted for this work on the slides at least four times (i.e.,
technical replicates). Following printing, the slides will be
allowed to dry and the spotted DNA was bound to the slides by
UV-cross linking (50 mJ).
Probe Preparation and Hybridization
[0109] Ten micrograms of total RNA can be reverse transcribed,
labeled, and hybridized using the reagents provided with the
CyScribe Post-Labeling kit (Amersham Biosciences), according to the
manufacturer's instructions. The products of the labeling reactions
can be purified in Millipore Multiscreen.RTM. filtering plates to
remove unincorporated labeled nucleotides. Microarrays can be
co-hybridized with the fluorescently labeled probes. Hybridizations
were performed overnight at 42.degree. C. in humid chambers. The
slides can be then washed in 1.times.SSC and 0.2% SDS (10 min,
55.degree. C.), twice in 0.1.times.SSC and 0.2% SDS (10 min,
55.degree. C.), and in 0.1.times.SSC (1 min, RT). Slides will then
be rinsed briefly in filtered milli-Q water and dried with a
nitrogen stream.
Data Acquisition, Processing and Statistical Analysis
[0110] Slides can be scanned using the Generation III Scanner.TM.
(Molecular Dynamics) adjusting the photomultiplier tube (PMT) to
700 for both channels. Images can be processed and data collected
using the ArrayVision (Imaging Research Inc.) software. For this
work, local median background was subtracted from the MTM
(median-based trimmed mean) density for each spot. Data from clones
that generated poor-quality PCR fragments (no amplification or
unspecific bands) or poor-quality spots (visually inspected) were
excluded. The data were stored and managed by the BioArray Software
environment.sup.14 free web-based database.
[0111] A set of custom programs based on R language were developed
for data processing based on methods described previously
(Papini-Terzi et al., 2005). Pearson correlation values among the
samples were calculated using normalized expression ratios obtained
from high sugar samples against low sugar samples or test samples
versus pool of samples hybridizations for 6438 genes. We used
homotypic or `self-self` hybridizations of the reference pool
sample to define intensity-dependent cutoff levels that would
indicate differentially expressed genes. The identification of
differentially expressed genes was performed using a local
implementation of the HTself method (Vencio and Koide, 2005;
available at blasto.iq.usp.bd/.about.rvencio/HTself), that uses
"self-self" hybridizations to derive an intensity-dependent cut-off
for significant fold-changes integrating the probability density
function to 98% for different signal intensity levels. The SAS
(Sugarcane Assembled Sequences) presenting more than 70% of its
replicates outside fold-change cut-off curves were defined as
differentially expressed. The fluorescence ratios were normalized
to account for systematic errors using the LOWESS fitting (Yang et
al. 2002) and used to calculate the expression ratios for all genes
between the tissue sample and the reference sample. For every gene,
the percentage of replicates within or outside the cutoff limits
was calculated in each tissue sample. Further details on the method
are available on the World Wide Web at
sucest-fun.org/pub/SUCAST.
[0112] Other methods that compare an expression pattern to another
or score a change from expressed to non-expressed, or the reverse
are useful. Changes in intensity of expression may be scored,
either increases or decreases. Any statistically significant change
can be used. Typically changes in one of SEQ ID NO. 1-203 are
suitable. However, more genes may be usefully analyzed. SEQ ID NO.
1-203 gene expression data can be used as molecular classifiers or
used to train methods to distinguish between high and low sucrose
plants or populations of plants using a variety of established
techniques such as the Fisher's linear discriminant analysis
(Meireles et al., 2004), the Prediction Analysis of Microarrays
software PAM (Tibshirani et al., 2002) or commonly used methods as
SVM (Support Vector Machines) or LVQ (Learning Vector Quantization)
(Mattfeldt et al., 2004). By doing so, SEQ ID NO. 1-203 expression
profile can be used to predict between high brix and low brix
plants and can be used to classify the individuals of a progeny or
cultivars. Genes whose expression were found to be unaltered in the
microarray experiments can aid in defining classes and be used to
train the algorithms, together with the differentially expressed
SEQ ID NO. 1-203. Table XI lists as an example 25 SAS (SEQ ID NO.
204 to 228) and the corresponding ESTs that are consistently
expressed in similar levels in all samples analyzed (high and low
brix).
TABLE-US-00020 TABLE XI Twenty-five genes not differentially
expressed between all the high and all the low brix populations and
varieties. SEQ ID NO. 204: SCAGLR1043C02.g (CA291199, CA126773,
CA103634, CA278537, CA291283, CA105620, CA129564, CA135982,
CA154949, CA137234, CA131175, CA131096, CA267022, CA136766,
CA079897, CA112911, CA202743, CA212218, CA130074, CA116962,
CA300529, CA233427, CA275519, CA215010, CA190793, CA264955,
CA275590, CA148445, CA276733, CA197411, CA285562, CA143450,
CA158699, CA148266, CA276787, CA223611, CA131410, CA129260,
CA282689, CA143509, CA127374, CA223701, CA107631, CA102547,
CA200880, CA126777, CA168082, CA143088, CA139235) SEQ ID NO. 205:
SCAGRT3046D01.g (CA300723, CA294382, CA264769, CA294452) SEQ ID NO.
206: SCBGLR1002D06.g (CA278315, CA117650, CA127739, CA212804,
CA073244, CA138816, CA152521, CA152509, CA153113, CA283276,
CA259474, CA289253, CA101319, CA126194, CA187565, CA093995,
CA150472, CA252354, CA226461, CA286965, CA142703, CA298971,
CA286850, CA111071, CA128235, CA130953, CA283578, CA181244,
CA190282, CA241875, CA076812) SEQ ID NO. 207: SCCCCL3005D01.b
(CA271043, CA272368, CA215896, CA098903, CA093456, CA150890,
CA266868, CA263152, CA093454, CA284141, CA270967, CA070480,
CA223204, CA261258) SEQ ID NO. 208: SCCCCL3080C09.g (CA259330,
CA152240, CA289512, CA124276, CA269953, CA282554, CA150365,
CA076742, CA124252, CA125409, CA189780, CA150360, CA067168,
CA185260, CA268877, CA287161, CA079640, CA180418, CA284801,
CA268954, CA296365, CA118827, CA184393, CA289786, CA111364,
CA150081, CA229568, CA200556, CA120906, CA286941, CA225985,
CA285992, CA255183, CA262927, CA277963, CA103076, CA118794,
CA118790, CA103799, CA129390, CA286405, CA100864, CA129384,
CA074893, CA093506, CA214051, CA129364, CA111366, CA152568,
CA076728, CA074983, CA124214, CA093579, CA122181, CA071338,
CA249655, CA152647, CA128317, CA131033, CA071425, CA077256,
CA117737, CA078093, CA199165, CA168557, CA125328, CA084326,
CA150876, CA082480, CA254028, CA189858, CA276734, CA118424,
CA268830, CA231681, CA276788, CA117438, CA225602, CA277928,
CA114620, CA247257, CA185669, CA076943, CA075590, CA202758) SEQ ID
NO. 209: SCCCCL7001A04.g (CA100620, CA223268, CA100961, CA199955,
CA223191, CA279575, CA103970, CA110326) SEQ ID NO. 210:
SCCCLB1C03B04.g (CA086997, CA198468, CA164949, CA299431, CA189172,
CA279831, CA175292, CA190805, CA155239, CA074671, CA131422,
CA172088, CA237966, CA113643, CA099312, CA097078, CA168581) SEQ ID
NO. 211: SCCCLR1022H01.g (CA119702, CA189837, CA274251, CA124160,
CA152830, CA202385, CA214786, CA223178, CA094030, CA092004,
CA283613, CA277116, CA146444, CA297712, CA223255, CA067746,
CA116394, CA067839, CA297889) SEQ ID NO. 212: SCCCLR1070B11.g
(CA194863, CA069696, CA120150, CA067031, CA087323, CA292894,
CA165329, CA185869, CA168662, CA064663, CA256320, CA079508,
CA064662, CA209676) SEQ ID NO. 213: SCCCLR1072A03.g (CA257676,
CA241502, CA103767, CA119541, CA212813, CA072979, CA076246,
CA260516, CA173103, CA092491, CA279357, CA076330, CA298956,
CA235977, CA283443, CA067187, CA172026, CA102965, CA243748,
CA157421, CA254836, CA086831, CA067267, CA254991, CA165072,
CA254121, CA281218, CA194801, CA107489, CA241226, CA183169,
CA259059, CA110302, CA074064, CA211578, CA259058, CA241304,
CA222499, CA167440, CA166656, CA103379, CA092495, CA251886,
CA198331, CA197814, CA095062, CA089849, CA181078, CA238993,
CA080070, CA160829, CA257963, CA077196, CA244970, CA085039,
CA170461, CA159351, CA272807, CA245352, CA107493, CA159440) SEQ ID
NO. 214: SCCCLR1075G05.g (CA064776, CA104174, CA262368, CA073013,
CA168309, CA121412, CA226304, CA230815, CA129021, CA299276,
CA123604, CA267396, CA263329, CA120286, CA177583, CA147731,
CA264721, CA123599, CA263403, CA194813, CA241253) SEQ ID NO. 215:
SCCCLR1078F05.g (CA124384, CA112238, CA228635, CA253815, CA228634,
CA120519, CA228633, CA088403, CA284381, CA153412, CA257810,
CA243271, CA089170) SEQ ID NO. 216: SCCCNR1001B12.g (CA282544) SEQ
ID NO. 217: SCCCRZ2002E06.g (CA079679, CA231568, CA121168,
CA149726, CA278060, CA136300) SEQ ID NO. 218: SCCCRZ2C04B04.g
(CA246886, CA220871, CA154329, CA280029, CA268704, CA150217,
CA219829, CA268689, CA068008, CA068007, CA117830, CA087866,
CA261807, CA268749, CA156666, CA205929, CA158955, CA167141,
CA239715) SEQ ID NO. 219: SCEPAM1020E03.g (CA072822, CA072801,
CA188039, CA072796) SEQ ID NO. 220: SCEQRT1024H10.g (CA139099,
CA281552, CA281378, CA132555, CA287054, CA251801, CA132401,
CA143578, CA284175, CA143345, CA143889, CA284251, CA143429,
CA143390, CA284886, CA296940, CA143494, CA139010, CA138862,
CA300775, CA143467, CA134226, CA277302, CA141676, CA285542,
CA142420, CA258267, CA267581, CA130719, CA274036, CA267666,
CA144676, CA278111) SEQ ID NO. 221: SCEQRT1030A03.g (CA228274,
CA133004, CA230581, CA230389, CA230510, CA235035, CA197298,
CA088047) SEQ ID NO. 222: SCJFRT1009A08.g (CA133624, CA190354) SEQ
ID NO. 223: SCJFRZ2009G01.g (CA088829, CA075098, CA139326,
CA272034, CA075189, CA151398, CA276729, CA223035, CA237807,
CA111462, CA106723, CA213636, CA123369, CA135723, CA244358,
CA246251, CA226436, CA190274, CA123851, CA244439, CA132084,
CA178674, CA113343) SEQ ID NO. 224: SCJLFL3014C10.g (CA227690,
CA227772) SEQ ID NO. 225: SCMCCL6055H06.g (CA183309, CA272155,
CA071587, CA154790, CA236184, CA111608, CA231710, CA288208,
CA098251, CA238333, CA187031, CA071503, CA293423) SEQ ID NO. 226:
SCQGLR1019C05.g (CA239321, CA259641, CA170537, CA094369, CA124046,
CA147545, CA082777, CA187852, CA199413, CA154540, CA169696,
CA099319, CA204586, CA196716, CA199496, CA171670, CA200284,
CA234725, CA068506) SEQ ID NO. 227: SCQSST1037B07.g (CA261004,
CA241250, CA183198, CA296123, CA067033, CA177822, CA241340,
CA217804, CA266141, CA126550, CA217886, CA183583, CA285691,
CA266216) SEQ ID NO. 228: SCSBSD1029F09.g (CA281292, CA275363,
CA285616, CA286914, CA273656, CA286500, CA296413, CA283987,
CA291253, CA274747) The SAS (Sugarcane Assembled Sequences) and
corresponding ESTs presenting more than 70% of its replicates
inside fold-change cut-off curves were defined as not
differentially expressed and can be used as controls in real-time
PCR reactions or to train classification algorithms.
Quantitative or Real-Time PCR(RT-PCR)
[0113] Any method to measure mRNA levels for the genes can be used.
For this work, five micrograms of total RNA were treated with DNAse
I (Amplification grade, Invitrogen) according to the manufacturer's
instructions and an aliquot of 7.5 .mu.l of the treated RNA was
reverse-transcribed using the SuperScript First-Strand Synthesis
System for RT-PCR (Invitrogen). The 20 .mu.l reverse transcription
reactions contained the RNA template, 2 .mu.l 10X RT buffer, 0.5 mM
each dATP, dGTP, dCTP and dTTP, 50 ng random hexamers, 0.25 .mu.g
oligo(dT), 5 mM MgCl.sub.2, 10 mM DTT (dithiothreitol), 40 U Rnase
OUT and 50 U SuperScript II Reverse Transcriptase. RNA, random
hexamers, dNTPs, and oligo(dT) were mixed first, incubated at
70.degree. C. for 5 min and placed on ice. Subsequently, the
remaining components, except the SuperScript II Reverse
Transcriptase, were added to the reaction and the mixture was
heated to 25.degree. C. for 10 min and then incubated at 42.degree.
C. for 2 min. The SuperScript II Reverse Transcriptase was added to
each tube and the reaction was incubated at 42.degree. C. for 1.5
h, 72.degree. C. for 10 min, and chilled on ice. An identical
reaction without the reverse transcriptase was performed as a
control, to confirm the absence of genomic DNA. The cDNA product
was treated with 2 U of RNAseH (Invitrogen) for 30 min at
37.degree. C. and for 10 min at 72.degree. C. Real-time PCR
reactions were performed using SYBR Green PCR Master Mix (Applied
Biosystems) in a GeneAmp 5700 Sequence Detection System (Applied
Biosystems). Primers were designed using the Primer Express 2.0
Software (Applied Biosystems). BLAST searches against the SUCEST
database were conducted to ensure the specificity of the selected
primers. The primer sequences designed are listed in Table XII.
Each reaction was performed in duplicates and contained 2 .mu.l of
a 1:10 dilution of the synthesized cDNA, primers to a final
concentration of 600 nM each, 12.5 .mu.l of the SYBR Green PCR
Master Mix and PCR-grade water to a total volume of 25 .mu.l. The
parameters for the PCR reaction were 50.degree. C. for 2 min,
95.degree. C. for 10 min, 40 cycles of 95.degree. C. for 15 s and
60.degree. C. for 1 min. The specificity of the amplified products
was evaluated by the analysis of the dissociation curves generated
by the equipment. Negative controls were also prepared in order to
confirm the absence of any contamination. The ratio between the
relative amounts of the target gene and the endogenous control gene
in the RT-PCR reactions was determined based on the
2.sup.-.DELTA..DELTA.Ct method.sup.18 with modifications. The
normalized expression level was calculated as L=2.sup.-.DELTA.Ct
and .DELTA.C.sub.T=C.sub.T,target-C.sub.T,reference, for each
sample. A polyubiquitin gene (SCCCST2001G02.g) and a GAPDH gene
(SCQGAM2027G09.g) was used as an endogenous reference in the RT-PCR
reactions after verification that its mRNA levels were similar in
the populations and individuals tissues (not shown).
TABLE-US-00021 TABLE XII Oligonucleotide sequences used in
real-time PCR reactions. SAS Category Subcategory Oligonucleotide
sequences SCEQRT1024E12.g Hormone Salicylic Acid
CTTCCAGGGCACTCCCATT GAGAACTGCGCGAACATGAG biosynthesis (SEQ ID No.
381) (SEQ ID No. 396) SCRFLR1012F12.g Others Caffeic acid 3-O-
CGGGTTCAAGGCCACCTA AGGTGTGCGTATTTACTTGATGAA methyltransferase (SEQ
ID No. 382) CT (SEQ ID No. 397) SCEQRT1028C03.g Pathogenicity
R-genes transduction- GAAATCGAGCCTCTCCTTCGT GCAGCATCAGGCAGTTCAAC PR
protein (SEQ ID No. 383) (SEQ ID No. 398) SCAGLR1043E04.g Stress
Cytochrome P450-CYP74A TGAAGCGGACGAATTTGAGTAG
AGCTCGCCATAGAGACTTGGAT (SEQ ID No. 384) (SEQ ID No. 399)
SCEQRT1026H08.g Stress Cytochrome P450-CYP75
GAACACCAGGTCCTGGTAGTTGT AGCAACCGCCCTCCAAA (SEQ ID No. 385) (SEQ ID
No. 400) SCACCL6008H06.g Stress Low temperature
AATCCCATCCATCCAAGCTAAG CGGCGGCCGATCCT induced(LTI) (SEQ ID No. 386)
(SEQ ID No. 401) SCCCRZ1002E08.g Stress Putative aguaporin
AGGCATTGGAAACAACCATGA GCTTTCAGATGCCGATTCAAG (TIP) (SEQ ID No. 387)
(SEQ ID No. 402) SCJLRT1016G06.g Stress Ribonuclease
TACTACACGCTGAGCCAGATCAA CACTCCACGTAGGGCTCGAA (SEQ ID No. 388) (SEQ
ID No. 403) SCCCLR2003E10.g Transcription NAM-NAC
CATCTTCTCCCACTCGTTCTT AGGGATCGCTCAGCTGGAT CTT (SEQ ID No. 389) (SEQ
ID No. 404) SCCCST2001G02.g Ubiquitination Polyubiquitin
CCGGTCCTTTAAACCAACTCAGT CCCTCTGGTGTACCTCCATTTG (SEQ ID No. 390)
(SEQ ID No. 405) SCEQLB2019B08.g Protein CIPK-8
TCCGCATATACGAGGTGATG AAAGAGCTCGCCACCAGTAG Kinase (SEQ ID No. 391)
(SEQ ID No. 406) SCSGHR1070F12.g Protein CIPK-29
GGAAATCTCGACGATGAAGTTGA TTGTTTACTTCCCATCACCTCGTA Kinase (SEQ ID No.
392) (SEQ ID No. 407) SCCCCL5001D11.g Protein CIPK-1
GGACCTCTGGTGCAACGTAGTT CGCTATCTCAGCAAATCAAGGA Kinase (SEQ ID No.
393) (SEQ ID No. 408) SCQGAM2027G09.g GAPDH* COMT CACGGCCACTGGAAGCA
TCCTCAGGGTTCCTGATGCC (SEQ ID No. 394) (SEQ ID No. 409)
SCRFLR1012F12.g Others CGGGTTCAAGGCCACCTA AGGTGTGCGTATTTACTTGATGAA
(SEQ ID No. 395) CT (SEQ ID No. 410) Primers were designed using
the Primer Express 2.0 Software (Applied Biosystems) andBLAST
searches were conducted to ensure the specificity of the selected
primers. The polyubiquitin gene (SCCCST20001G02.g) or the GAPDH
gene (SCQGAM2027G09.g) were used as the endogenous reference in the
RT-PCR reactions. The GAPDH primer sequences were retrieved from
Iskandar et al., (2004).
Northern Blot
[0114] Electrophoresis of total RNA samples (10 .mu.g) can be
carried out on 1.5% formaldehyde-containing agarose gels by
standard procedures (Sambrook et al., 1989) and transferred to
nylon filter (Hybond-N.sup.+, Amershan Biosciences). For this work,
for each gene tested, the longest EST clone of each SUCEST SAS was
selected as probe for RNA blot hybridization. Inserts were labeled
with the Read-To-Go kit (Amershan Biosciences) according to the
protocol recommended by the manufacturer. Hybridized filters were
exposed to imaging plates for 24 h and the digitized images of RNA
blot hybridization signals were detected with the FLA3000-G screen
system (Fuji Photo Film, Japan) and quantified with the Image Gauge
software v. 3.12 (Fuji Photo Film, Japan).
Methods for Detecting Protein Expression Levels
[0115] To measure or evaluate the proteins encoded by
polynucleotide SEQ ID NO. 1-203 or SEQ ID Nos. 229 to 373 a number
of well established techniques can be used (Cell Biology --A
Laboratory Handbook, Academic Press). Antibodies can be raised
against a purified recombinant protein expressed, for example in
bacterial strains, after the coding sequence is cloned in a
bacterial expression vector such as the pET vector series from
Invitrogen. Plant tissue samples can be collected, protein extracts
can be prepared and separated by gel electrophoresis or applied in
multi-well plates, and protein levels can be measured by western
blot or ELISA (enzyme-linked immunosorbent assay) using the
antibody and a secondary antibody conjugated to horseradish
peroxidase, alkaline phosphatase or fluoresceine isothiocyanate.
Alternatively, whole proteome analysis can analyze the proteins
encoded by SEQ ID NO. 1-203 or SEQ ID Nos. 229 to 373 in large
scale with the aid of mass-spectrometry technology (MALDI-TOF and
related techniques) after protein separation. Techniques that can
analyze (for a review see Newton at al., 2004) and evaluate protein
levels in large scale have also been described (Kirpatrick et al.,
2005).
Transgenic Plants of this Invention
[0116] Transgenic plants can be generated using SEQ ID NO. 1 to 203
or SEQ ID Nos. 229 to 373. Alternatively, transgenic plants can be
generated by a variety of techniques using additional genes and
characterized using SEQ ID NO.1 to 203 or SEQ ID Nos. 229 to 373.
Techniques for transforming a wide variety of higher plant species
are well known and described (Weising et al., 1988). A DNA sequence
coding for the desired polypeptide, for example a cDNA sequence
encoding a full length protein, will preferably be combined with
transcriptional and translational initiation regulatory sequences
which will direct the transcription of the sequence from the gene
in the intended tissues of the transformed plant. For example, for
overexpression, a plant promoter fragment may be employed which
will direct expression of the gene in all tissues of a regenerated
plant.
[0117] Such promoters are referred to herein as "constitutive"
promoters and are active under most environmental conditions and
states of development or cell differentiation. Examples of
constitutive promoters include the cauliflower mosaic virus (CaMV)
35S transcription initiation region, the 1'- or 2'-promoter derived
from T-DNA of Agrobacterium tumafaciens, the maize ubi1 promoter
derived from the ubiquitin gene, and other transcription initiation
regions from various plant genes known to those of skill in the
art.
[0118] Genes can be introduced into plants in expression cassettes
that will increase the expression of the genes or silence the genes
by anti-sense expression or RNA interference and lead to a higher
sucrose content plant according to the methods described in this
work.
Methods for Generating Plants with Increased Sugar Content
[0119] In certain embodiments, this invention provides methods for
generating plants with increased sugar content by either increasing
the expression of or interfering with the expression of or
decreasing the expression of the polynucleotides of this invention.
In some embodiments, the plant is transgenic and generated by
expression of a gene expressing or interfering with the expression
of a polynucleotide or polypeptide of this invention. Transgenic
plants can be generated using SEQ ID NO. 1 to 203 or SEQ ID Nos.
229 to 373. In other embodiments, the plant is one generated by
standard breeding techniques or mutagenesis.
Preparation of Recombinant Vectors for Plant Transformation
[0120] SEQ ID NO. 1-203 or SEQ ID Nos 229 to 373 can be used to
generate transgenic plants with higher sucrose content. For this,
recombinant DNA vectors suitable for transformation of plant cells
are prepared. Transgenic plants can be obtained that express a
recombinant expression cassette containing a promoter linked to one
of polynucleotides 1 to 203 or SEQ ID NO. 229 to 373 that causes an
increase in sucrose content in the transgenic plant when compared
to control untransformed plants or plants transformed with vector
alone.
[0121] Depending on whether increased sugar content is correlated
with increased or decreased expression of a particular
polynucleotide, DNA constructs can be designed to either increase
or interfere with/decrease the expression of specific genes.
[0122] Gene expression can be increased using recombinant DNA
constructs with a polynucleotide of interest in the sense
orientation relative to the promoter to achieve gene
overexpression.
[0123] Gene expression can be decreased using recombinant DNA
constructs with a polynucleotide of interest in the antisense
orientation relative to the promoter to achieve gene silencing. For
example, a fragment of a gene of interest can be cloned in the
pAHC17 vector (Christensen and Quail, 1996). Transgenic plants
obtained through this method include sugarcane transgenic plants
T1a, T1f, T2a, T2c and T3d originated from cultivar SP83-2847.
Embryogenic calli originated from this cultivar were transformed by
biolistic as described below with the COMT-AS/pAHC17 construct
containing a 535 by fragment of SEQ NO. 161 cloned into the BamHI
site for the antisense orientation. Plants were co-transformed with
pHA9 vector (Wei and Albert, U.S. Pat. No. 6,706,948).
[0124] Gene expression can be decreased or interfered with by
suppressing transcription of a gene or the accumulation of the mRNA
corresponding to that gene thereby preventing translation of the
transcript into protein. Posttranscriptional gene suppression is
mediated by transcription of integrated recombinant DNA to form
double-stranded RNA (dsRNA) having homology to a gene targeted for
suppression. This formation of dsRNA most commonly results from
transcription of an integrated inverted repeat of the target gene,
and is a common feature of gene suppression methods known as
anti-sense suppression, co-suppression and RNA interference (RNAi).
Transcriptional suppression can be mediated by a transcribed dsRNA
having homology to a promoter DNA sequence to effect what is called
promoter trans suppression.
[0125] More particularly, posttranscriptional gene suppression by
inserting a recombinant DNA construct with anti-sense oriented DNA
to regulate gene expression in plant cells is disclosed in U.S.
Pat. No. 5,107,065 (Shewmaker et al.) and U.S. Pat. No. 5,759,829
(Shewmaker et al.). Transgenic plants transformed using such
anti-sense oriented DNA constructs for gene suppression can
comprise integrated DNA arranged as an inverted repeats that result
from insertion of the DNA construct into plants by
Agrobacterium-mediated transformation, as disclosed by Redenbaugh
et al., in "Safety Assessment of Genetically Engineered Flavr
Savr.TM. Tomato, CRC Press, Inc. (1992). Inverted repeat insertions
can comprise a part or all of the T-DNA construct, e.g., an
inverted repeat of a complete transcription unit or an inverted
repeat of transcription terminator sequence. Screening for inserted
DNA comprising inverted repeat elements can improve the efficiency
of identifying transformation events effective for gene silencing
whether the transformation construct is a simple anti-sense DNA
construct which must be inserted in multiple copies or a complex
inverted repeat DNA construct (e.g., an RNAi construct) which can
be inserted as a single copy.
[0126] Posttranscriptional gene suppression by inserting a
recombinant DNA construct with sense-oriented DNA to regulate gene
expression in plants is disclosed in U.S. Pat. No. 5,283,184
(Jorgensen et al.,) and U.S. Pat. No. 5,231,020 (Jorgensen et
al.,). Inserted T-DNA providing gene suppression in plants
transformed with such sense constructs by Agrobacterium is
organized predominately in inverted repeat structures, as disclosed
by Jorgensen et al., Mol. Gen. Genet., 207:471-477 (1987). See also
Stam et al. The Plant Journal, 12(1), 63-82 (1997) who used
segregation studies to support Jorgensen's finding that gene
silencing is mediated by multimeric transgene T-DNA loci in which
the T-DNAs are arranged in inverted repeats. Screening for inserted
DNA comprising inverted repeat elements can improve the gene
silencing efficiency when transforming with simple sense-orientated
DNA constructs. Gene silencing efficiency can also be improved by
screening for single insertion events when transforming with an
RNAi construct containing inverted repeat elements
[0127] As disclosed by Redenbaugh et al., gene suppression can be
achieved by inserting into a plant genome recombinant DNA that
transcribes dsRNA. Such a DNA insert can be transcribed to an RNA
element having the 3' region as a double stranded RNA. RNAi
constructs are also disclosed in EP 0426195 A1 (Goldbach et al.,
1991) where recombinant DNA constructs for transcription into
hairpin dsRNA for providing transgenic plants with resistance to
tobacco spotted wilt virus. Double-stranded RNAs were also
disclosed in WO 94/01550 (Agrawal et al.,) where anti-sense RNA was
stabilized with a self-complementary 3' segment. Agrawal et al.,
referred to U.S. Pat. No. 5,107,065 for using such self-stabilized
anti-sense RNAs for regulating gene expression in plant cells; see
International Publication No. 94/01550. Other double-stranded
hairpin-forming elements in transcribed RNA are disclosed in
International Publication No. 98/05770 (Werner et al.,) where the
anti-sense RNA is stabilized by hairpin forming repeats of poly(CG)
nucleotides. See also U.S. Patent Application Publication No.
2003/0175965 A1 (Lowe et al.,) which discloses gene suppression
using and RNAi construct comprising a gene coding sequence preceded
by inverted repeats of 5'UTR. See also U.S. Patent Application
Publication No. 2002/0048814 A1 (Oeller) where RNAi constructs are
transcribed to sense or anti-sense RNA which is stabilized by a
poly(T)-poly(A) tail. See also U.S. Patent Application Publication
No. 2003/0018993 A1 (Gutterson et al.,) where sense or anti-sense
RNA is stabilized by an inverted repeat of a of the 3' untranslated
region of the NOS gene. See also U.S. Patent Application
Publication No. 2003/0036197 A1 (Glassman et al.,) where RNA having
homology to a target is stabilized by two complementary RNA
regions.
[0128] Gene silencing can also be effected by transcribing RNA from
both a sense and an anti-sense oriented DNA, e.g., as disclosed by
Shewmaker et al., in U.S. Pat. No. 5,107,065 where in Example 1a
binary vector was prepared with both sense and anti-sense aroA
genes. See also U.S. Pat. No. 6,326,193 where gene targeted DNA is
operably linked to opposing promoters.
[0129] Gene silencing can also be affected by transcribing from
contiguous sense and anti-sense DNA. In this regard see Sijen et
al. The Plant Cell, Vol. 8, 2277-2294 (1996) discloses the use of
constructs carrying inverted repeats of a cowpea mosaic virus gene
in transgenic plants to mediate virus resistance. Such constructs
for posttranscriptional gene suppression in plants by
double-stranded RNA are also disclosed in International Publication
No. WO 99/53050 (Waterhouse et al.,), International Publication No.
WO 99/49029 (Graham et al.), U.S. patent application Ser. No.
10/465,800 (Fillatti), U.S. Pat. No. 6,506,559 (Fire et al.). See
also U.S. application Ser. No. 10/393,347 (Shewmaker et al.,) that
discloses constructs and methods for simultaneously expressing one
or more recombinant genes while simultaneously suppressing one or
more native genes in a transgenic plant. See also U.S. Pat. No.
6,448,473 (Mitsky et al.,) that discloses multi-gene suppression
vectors for use in plants. All of the above-described patents,
applications and international publications disclosing materials
and methods for posttranscriptional gene suppression in plants are
incorporated herein by reference.
[0130] Transcriptional suppression such as promoter trans
suppression can be affected by a expressing a DNA construct
comprising a promoter operably linked to inverted repeats of
promoter DNA for a target gene. Constructs useful for such gene
suppression mediated by promoter trans suppression are disclosed by
Mette et al. The EMBO Journal, Vol. 18, No. 1, pp. 241-148, 1999
and by Mette et al. The EMBO Journal, Vol. 19, No. 19, pp.
5194-5201-148, 2000, both of which are incorporated herein by
reference.
[0131] Suppression can also be achieved by insertion mutations
created by transposable elements may also prevent gene function.
For example, in many dicot plants, transformation with the T-DNA of
Agrobacterium may be readily achieved and large numbers of
transformants can be rapidly obtained. Also, some species have
lines with active transposable elements that can efficiently be
used for the generation of large numbers of insertion mutations,
while some other species lack such options. Mutant plants produced
by Agrobacterium or transposon mutagenesis and having altered
expression of a polypeptide of interest can be identified using the
polynucleotides of the present invention. For example, a large
population of mutated plants may be screened with polynucleotides
encoding the polypeptide of interest to detect mutated plants
having an insertion in the gene encoding the polypeptide of
interest.
[0132] In some embodiments, DNA constructs can be the full length
cDNA cloned in the expression vector pAHC17 (Christensen and Quail,
1996) in a sense orientation for overexpression or in an antisense
orientation for gene silencing. Full length cDNAs can be amplified
by PCR using specific primers and cloned into the BamHI site of the
vector pAHC17 that will drive the constitutive expression of genes
under the control of the maize ubi1 promoter (Christensen et al.
1992) and has been shown to be effective in the transformation and
expression of genes in sugarcane. Other examples of constitutive
promoters include the cauliflower mosaic virus (CaMV) 35S
transcription initiation region, the 1'- or 2'-promoter derived
from T-DNA of Agrobacterium tumaefaciens, the ubi4 and ubi9
promoters isolated from sugarcane polyubiquitin genes (Wei et al.
1999; Wei et al. 2003), the rice actin Act1 promoter (McElroy et
al. 1990, McElroy et al. 1991), the pEmu promoter (Last et al.
1990, Chamberlain et al. 1994) and other transcription initiation
regions from various plant genes known to those of skill.
[0133] Alternatively, expression vectors can be constructed using
sugarcane promoters. Constitutive promoters and regulatory elements
can be isolated from genes that are expressed constitutively or at
least expressed in most if not all tissues of the plant. Such genes
include, for example, the 153 genes described by Papini-Terzi et
al., 2005 as ubiquitously expressed in sugarcane tissues.
[0134] Alternatively, the sugarcane promoter may direct expression
of a nucleic acid of the invention in a specific tissue, organ or
cell type (i.e. tissue-specific promoters) such as the 217 genes
described by Papini-Terzi et al., 2005 as being preferentially
expressed in roots, internodes, leaves, lateral buds or
inflorescences of sugarcane. For antisense constructs full length
cDNA or cDNA fragments of around (but not restricted to) 500 by in
length can be used. If a full length coding sequence is not
available it can be cloned for instance by RACE (Frohman et al.,
1988). For RNA interference (RNAi) the vector pKannibal and
pHannibal (Wesley et al., 2001) can be used. Primers can be
designed that specifically amplify around (but not restricted to)
200 to 400 by of the target gene. Two PCR fragments will be
produced with oligonucleotide primers planned to allow for cloning
in the sense and antisense orientation and for a self complementary
hairpin to be formed when expressed in the plant cell. The PCR
fragments will contain restriction sites at their end that will
allow for their introduction on the sites of XhoI/EcoRI/KpnI
(sense) and ClaI/HindIII/XbaI/BamHI (antisense) in the pKannibal or
pHannibal vector for instance. If proper polypeptide expression is
desired, a polyadenylation region at the 3'-end of the coding
region should be included. The polyadenylation region can be
derived from the natural gene, from a variety of other plant genes,
or from T-DNA. Transgenic plants obtained through this method
include sugarcane transgenic plants 12SNF8b, 12SNF7c, 8SNF2a and
8SNF2b originated from cultivar SP94-3116. Embryogenic calli
originated from this cultivar were transformed by biolistic as
described below using a 331 by fragment of SEQ NO. 106 cloned into
the XhoI/EcoRI sites for the sense and HindIII/XbaI sites for the
antisense orientations.
[0135] The expression vector comprising the sequences (e.g.,
promoters or coding regions) from genes of the invention will
typically comprise a marker gene that confers a selectable
phenotype on plant cells. For example, the marker may encode
biocide resistance, particularly antibiotic resistance, such as
resistance to kanamycin, G418, bleomycin, hygromycin, or herbicide
resistance, such as resistance to chlorosulfuron or Basta.
[0136] Vector DNA preparation for transformation of sugarcane by
bombardment uses a variation of the co-precipitation method of
Klein et al. (1988a,b).
Plant Transformation and Propagation
[0137] Sugarcane transformation is as a well established technique
(see Falco et al., 2000 for an example). Transgenic plants are
recovered from embryogenic callus transformed using a modified
biolistic protocol. Callus initiation and maintenance from
sugarcane varieties is done on medium containing Murashige &
Skoog salts, 3 mg/L 2,4-D, 5% coconut water, 150 mg/L citric acid,
250 mg/L Clavulin Beecham, and 7 g/L agar (CI-3 medium). Young leaf
rolls of 6-12 month old plants are cultured for a month in the
dark, at 27.degree. C. and selected embryogenic callus is
subcultured on the same medium every 3 weeks. Embriogenic calli can
be bombarded with plasmid expression vectors containing one of the
sequences 1 to 203 or SEQ ID Nos. 229 to 373. After bombardment,
calli are kept in the dark for 1 week on CI-3 medium, without
selection, for recovery. Transgenic calli are selected on the same
medium containing 35 mg/L of geneticin for 6 weeks. Resistant calli
are placed on the same medium without 2,4-D to regenerate plants.
After approximately 3 months, plants are transferred to soil and
kept in the greenhouse, where they are tested for vector genomic
insertion and expression. Non-transgenic control plants are
obtained by regeneration from the same callus type going through
the same tissue culture steps without bombardment and selection.
Generally, embryogenic calli of the Brazilian sugarcane (Saccharum
officinarum L.) genotype SP80-180, SP80-185, SP94-3116, CTC1,
SP83-2847, SP80-1842, SP91-1049. (but not restricted to) can be
co-transformed with the plasmid pHA9 containing genes coding for
neomycin phosphotransferase (neo) and a plasmid containing the gene
of interest (one of SEQ ID NO. 1 to 203 or SEQ ID NO. 229 to 373 in
plasmid pAHC17, pKannibal or pHannibal, for instance), by particle
bombardment. Transformed plants will be initially selected on
culture medium containing Geneticin, and resistance can be
confirmed by localized application of a kanamycin solution to
leaves of hardened plants at the nursery if desired. Southern
analysis can confirm stable integration of both target and neo
genes. Alternatively, plants can be submitted to analysis by PCR to
confirm the insertion of the expression constructs in the sugarcane
genome. Oligonucleotide primers specific to the expression
constructs will be used in amplification reactions using genomic
DNA extracted from a sample of the transformed plants. Confirmed
plants are then allowed to regenerate to 4 cm high plants and then
allowed to grow in green houses when the expression levels of the
target gene will be verified by real-time PCR. Also, brix measures
will be taken to verify sucrose content. Alternatively, genes can
be introduced into sugarcane or other plants using techniques such
as electroporation or microinjection of plant cell protoplasts.
[0138] Plant regeneration from cultured protoplasts is described in
Evans et al., Protoplasts Isolation and Culture, Handbook of Plant
Cell Culture, pp. 124-176, MacMillilan Publishing Company, New
York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts,
pp. 21-73, CRC Press, Boca Raton, 1985. Regeneration can also be
obtained from plant callus, explants, organs, or parts thereof.
Such regeneration techniques are described generally in Klee et al.
Ann. Rev. of Plant Phys. 38:467-486 (1987). The introduction of DNA
constructs using polyethylene glycol precipitation is described in
Paszkowski et al. EMBO. J. 3:2717-2722 (1984). Electroporation
techniques are described in Fromm et al. Proc. Natl. Acad. Sci. USA
82:5824 (1985). Additional details of ballistic transformation
techniques are described in Klein et al. Nature 327:70-73 (1987).
Transgenes can also be transferred to plant cells without the need
of a vector DNA backbone, using linear transgene constructs (Fu et
al., 2000, Loc et al., 2002).
[0139] Alternatively, the DNA constructs may be combined with
suitable T-DNA flanking regions and introduced into a conventional
Agrobacterium tumefaciens host vector. The virulence functions of
the Agrobacterium tumefaciens host will direct the insertion of the
construct and adjacent marker into the plant cell DNA when the cell
is infected by the bacteria. Agrobacterium tumefaciens-mediated
transformation techniques, including disarming and use of binary
vectors, are well described in the scientific literature. See, for
example Horsch et al. Science 233:496-498 (1984), and Fraley et al.
Proc. Natl. Acad. Sci. USA 80:4803 (1983) and Gene Transfer to
Plants, Potrykus, ed. (Springer-Verlag, Berlin 1995).
[0140] Alternatively, the DNA constructs may be combined with
suitable T-DNA vectors, such as pCAMBIA vectors pC1105.1, pC1105.1r
or modified versions of those, and introduced into alternative
bacterial host vectors such as Sinorhizobium meliloti, Rhizobium
sp. or Mesorhizobium loti (also known as Transbacter strains) as
described (Broothaerts et al., 2005).
[0141] Sugar measurements can be done in six month old plants.
Total and reductive sugars can be determined in leaves from control
and transgenic plants collected, immediately frozen in liquid
nitrogen and lyophilized Twenty mg of the lyophilized material can
be ground using a ball mill and subjected to extraction of soluble
sugars with 1 mL of ethanol 80% for 20 minutes. This process is
repeated six times (exhaustive extraction). The alcoholic extract
is dried in a rotoevaporator and resuspended in 1 mL of milli-Q
water. The levels of total and reductive sugars (Glc+Fru) are
quantified by a colorimetric method using the phenol-sulphuric
(Dubois et al., 1956) and the Somogy-Nelson (Somogy, 1945)
procedures and glucose 1 mg/mL as standard. The sucrose content is
estimated by subtracting the amount of reductive sugars from the
amount of total sugars. Transgenic plants can also be characterized
for brix content and considered to be improved for sucrose content
if a brix difference of 3 degrees is observed. Differential
expression of SEQ ID NO. 1-203 can be used in sucrose yield
field-trials to select for the best events (transformants) or in a
pre-test prior to field trials. Tissue samples can be obtained as
described above.
Identification of Plants with Mutated Alleles
[0142] Variations in SEQ ID NO. 1-203 or SEQ ID NO. 229 to 373
locus can be generated by non-transgenic methods, can be found in
progenies generated by traditional breeding, or can be found in
naturally occurring genotypes.
[0143] The Saccharum officinarum and Saccharum spontaneum
genotypes, the progenies of crosses between them and the crosses of
commercial varieties described in this work can be screened for
mutations in SEQ ID NO. 1-203 or SEQ ID NO. 229 to 373.
Alternatively, sugarcane seeds can be mutagenized to increase the
allelic variation for SEQ ID Nos. 1-203 or SEQ ID NO. 229 to 373.
For example sugarcane can be chemically mutagenized with EMS
(Ethylmethane sulfonate--EMS).
[0144] Mutations or natural variations in SEQ ID NO. 1-203 or SEQ
ID NO. 229 to 373 can be identified by Tilling as was described for
wheat (Slade et al., 2005). With Tilling a library of DNA samples
from mutagenized or naturally occurring variants, or variants
generated by traditional breeding can be identified. Mutations will
be detected by amplifying regions of SEQ ID NO. 1-203 by Polymerase
Chain Reaction (PCR). The PCR products will be heated and
re-annealed to allow heteroduplexes to form between mutated and
wild-type DNA. Heteroduplexes are identified through cleavage of
mismatched sites by endonucleases such as Cell and cleaved products
identified by gel-electrophoresis. The nature of the mutation will
be identified by sequencing the PCR fragment.
Use as Molecular Markers: Generation Of Molecular Markers Based On
Restriction Fragment Length Polymorphisms
[0145] SEQ ID NO. 1-203 can be used to detect differences between
individuals at the DNA sequence level. Genomic DNAs from any number
of individuals can be digested with a restriction enzyme,
preferably a six-base pair cutting enzyme, electrophoresed and can
be probed with any of the SEQ ID NO. 1-203 DNA clones, labelled
with radioisotopes. Polymorphisms in the hybridization patterns can
be due to differences in the gene sequences between the
individuals. The term "restriction fragment length polymorphism"
has been coined to describe this variation. For example, genomic
DNA can be extracted from sugarcane individuals from any of the
populations cited in this invention, digested with one restriction
enzyme, such as (but not limited to) EcoRI, Hind III, Drat, BamHI.
Restriction fragments can be separated on 0.8% (w/v) agarose gel,
using TAE (40 mM Tris acetate, pH 8.0; 2 mM EDTA) as running buffer
at 20 mA for 22 h and transferred to nylon membranes.
[0146] SEQ ID NO. 1-203 can be used to generated probes using
.sup.32PdCTP using any commercial kit, such as the Rediprime II kit
from Amersham (USA). Hybridizations can be performed in a
hybridization solution containing for example 0.5 M Na2PO4 pH 7.2,
1% BSA, 7% SDS, 100 .mu.g/mL sheared herring sperm DNA), at
65.degree. C. for up to 24 h. The membranes can be washed once
during 20 min at 65.degree. C. solution I (2.times.SSC; 5% SDS),
then 20 min at 65.degree. C. in solution II (1.times.SSC; 5% SDS
5%) and 20 min at 65.degree. C. in solution III (0.5.times.SSC; 5%
SDS).
[0147] Restriction fragment length polymorphism can be visualized
by exposition to an imaging plate for 3-10 days at -80.degree. C.
and detected using a phosphorimager, such as the FLA3000 (Fuji,
Japan). Those skilled in the art will easily use standard
procedures to marker notation, analysis of each molecular marker
segregation in the population individuals, and finally the linkage
analysis to predict the usefulness of each of the SEQ ID Nos. 1-203
as molecular markers. An example of these steps has been described
by Garcia et al., (2006).
[0148] Although the foregoing invention has been described in some
detail by way of illustration and examples for purposes of clarity
and understanding, it will be obvious that certain modifications
and alternative embodiments of the invention are contemplated which
do not depart from the spirit and scope of the invention as defined
by the foregoing teachings and appended claims.
REFERENCES
[0149] Bachmann, M., Huber, J. L., Athwal, G. S., Wu, K., Ferl, R.
J., and Huber, S. C. (1996). 14-3-3 proteins associate with the
regulatory phosphorylation site of spinach leaf nitrate reductase
in an isoform-specific manner and reduce dephosphorylation of
Ser-543 by endogenous protein phosphatases. FEBS Letters 398,
26-30. [0150] Becraft, P. W. (2002). Receptor Kinase Signaling in
Plant Development. Annual Review of Cell and Developmental Biology
18, 163-192. [0151] Berridge, M. J. (1993). Inositol Trisphosphate
and Calcium Signaling. Nature 361, 315-325. [0152] Binding,
Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press,
Boca Raton, 1985. [0153] Bornke, F. (2005). The variable C-terminus
of 14-3-3 proteins mediates isoform-specific interaction with
sucrose-phosphate synthase in the yeast two-hybrid system. J Plant
Physiol. 162, 161-8. [0154] Bowman, J. L., Smyth, D. R.,
Meyerowitz, E. M. (1989) Genes directing flower development in
Arabidopsis. Plant Cell, 1(1), 37-52. [0155] Broothaerts, W.,
Mitchell, H. J., Weir, B., Kaines, S., Smith, L. M. A Yang, W.,
Mayer, J. E., Roa-Rodriguez, C. and Jefferson, R. A. (2005). Gene
transfer to plants by diverse species of bacteria. Nature 433,
629-633. [0156] Carraro, D. M., Lambais, M. R., Carrer, H. (2001).
In silico characterization and expression analyses of sugarcane
putative sucrose non-fermenting-1 (SNF1) related kinases. Genetics
and Molecular Biology 24, 35-41. [0157] Casu, R. E., Dimmock, C.
M., Chapman, S. C., Grof, C. P. L., McIntyre, C. L., Bonnett, G. D.
and Manners, J. M. (2004) Identification of differentially
expressed transcripts from maturing stem of sugarcane by in silico
analysis of stem expressed sequence tags and gene expression
profiling. Plant Mol. Biol., 54, 503-517. [0158] Chamberlain D A,
Brettell R I S, Last D I, Wirtzens B, McElroy D, Dolferus R, Dennis
E S (1994) The use of the Emu promoter with antibiotic and
herbicide resistance genes for the selection of transgenic wheat
callus and rice plants. Austr J Plant Physiol 21: 95-112 [0159]
Chaumont, F., Moshelion, M., Daniels, M. J. (2005) Regulation of
plant aquaporin activity. Biol Cell., 97(10), 749-64. [0160]
Christensen A. H., Quail P. H. (1996). Ubiquitin promoter-based
vectors for high-level expression of selectable and/or screenable
marker genes in monocotyledonous plants. Transgenic Research 5,
213-218. [0161] Christensen A H, Sharrock R A, Quail P H (1992)
Maize polyubiquitin genes: structure, thermal perturbation of
expression and transcript splicing, and promoter activity following
transfer to protoplasts by electroporation. Plant Mol Biol 18:
675-689 [0162] Comparot, S., Lingiah, G., Martin, T. (2003).
Function and specificity of 14-3-3 proteins in the regulation of
carbohydrate and nitrogen metabolism. J. Exp. Bot. 54, 595-604.
[0163] Cotelle, V., Meek, S. E. M., Provan, F., Milne, F. C.,
Morrice, N., MacKintosh, C. (2000). 14-3-3s regulate global
cleavage of their diverse binding partners in sugar-starved
Arabidopsis cells. EMBO J. 19, 2869-2876. [0164] Dale, S., Arro,
M., Becerra, B., Morrice, N. G., Boronat, A., Hardie, D. G., and
Ferrer, A. (1995). Bacterial expression of the catalytic domain of
3-hydroxy-3-methylglutaryl-CoA reductase (isoform HMGR1) from
Arabidopsis thaliana, and its inactivation by phosphorylation at
Ser577 by Brassica oleracea 3-hydroxy-3-methylglutaryl-CoA
reductase kinase. Eur J Biochem 233, 506-513. [0165] Dodd, A. N.,
Salathia, N., Hall, A., Kevei, E., Toth, R., Nagy, F., Hibberd, J.
M., Millar, A. J., and Webb, A. A. R. (2005). Plant circadian
clocks increase photosynthesis, growth, survival, and competitive
advantage. Science 309, 630-633. [0166] DUBOIS, N.; GILLES, K. A.;
HAMILTON, J. K.; REBERS, P. A.; SMITH, F. Colorimetric method for
determination of sugars and related substances. Anal. Chem.
Washington, v. 28, p. 350-356, 1956. [0167] Evans et al.,
Protoplasts Isolation and Culture, Handbook of Plant Cell Culture,
pp. 124-176, MacMillilan Publishing Company, New York, 1983 [0168]
Falco M C, Neto A T, Ulian E C 2000 Transformation and expression
of a gene for herbicide resistance in a Brazilian sugarcane Plant
Cell Rep 19 (12):1188-1194 [0169] Felix, J. M. (2006). AN LISE DA
EXPRESS O GENICA ENVOLVIDA NO METABOLISMO DE SACAROSE EM
CANA-DE-AcCAR (Saccharum spp.). PhD thesis defended Mar. 10, 2006.
UNIVERSIDADE ESTADUAL DE CAMPINAS. CAMPINAS, Sao Paulo, Brasil.
[0170] Ferl, R. J. (2004). 14-3-3 proteins: regulation of
signal-induced events. Physiol. Plantarum 120, 173-178. [0171]
Fraley R T, Rogers S G, Horsch R B, Sanders P R, Flick J S, Adams S
P, Bittner M L, Brand L A, Fink C L, Fry J S, Galluppi G R,
Goldberg S B, Hoffmann N L, Woo S C. (1983) Expression of bacterial
genes in plant cells. Proc Natl Acad Sci USA. 80(15):4803-7. [0172]
Frohman M A, Dush M K, Martin G R (1988) Rapid production of
full-length cDNA from rare transcripts: amplification using a
single gene-specific oligonucleotide primer. Proc Natl Acad Sci USA
85(23):8998-9002 [0173] Fromm M, Taylor L P, Walbot V. (1985)
Expression of genes transferred into monocot and dicot plant cells
by electroporation. Proc Natl Acad Sci USA. 82(17):5824-8. [0174]
Halford N G, Paul, M J (2003). Carbon metabolite sensing and
signalling. Plant Biotech. J. 1, 381-398. [0175] Fu X D, Duc L T,
Fontana S, Bong B B, Tinjuangjun P, Sudhakar D, Twyman R M,
Christou P, Kohli A 2000. Linear transgene constructs lacking
vector backbone sequences generate low-copy-number transgenic
plants with simple integration patterns. Transgenic Res. 9:11-19.
[0176] Hanggi, E., Fleming, A. J. (2001) Sucrose synthase
expression pattern in young maize leaves: implications for phloem
transport. Planta, 214(2), 326-9. [0177] Hardin, S. C., Huber, S.
C. (1999) Proteasome activity and the post-translational control of
sucrose synthase stability in maize leaves. Plant Physiol Biochem.,
42(3), 197-208. [0178] Hardin, S. C., Tang, G. Q., Scholz, A.,
Holtgraewe, D., Winter, H., Huber, S. C. (2003) Phosphorylation of
sucrose synthase at serine 170: occurrence and possible role as a
signal for proteolysis. Plant J., 35(5), 588-603. [0179] Hardin, S.
C., Winter, H., Huber, S. C. (2004) Phosphorylation of the amino
terminus of maize sucrose synthase in relation to membrane
association and enzyme activity. Plant Physiol. 134(4),1427-38.
[0180] Ho, S. L., Chao, Y. C., Tong, W. F., Yu, S. M. (2001). Sugar
coordinately and differentially regulates growth- and
stress-related gene expression via a complex signal transduction
network and multiple control mechanisms. Plant Physiol. 125,
877-890. [0181] Horsch, R B, Fraley, R T, Rogers, S G, Sanders, P
R, Lloyd, A, Hoffmann, N (1984) Inheritance of functional foreign
genes in plants. Science 223:496-498. [0182] Hrabak, E. M., Chan,
C. W., Gribskov, M., Harper, J. F., Choi, J. H., Halford, N.,
Kudla, J., Luan, S., Nimmo, H. G., Sussman, M. R., Thomas, M.,
Walker-Simmons, K., Zhu, J. K., Harmon, A. C. (2000) The
Arabidopsis CDPK-SnRK superfamily of protein kinases. Plant
Physiol. 132(2), 666-80. [0183] Huber, S. C., Huber, J. L., Liao,
P. C., Gage, D. A., McMichael, R. W. Jr., Chourey, P. S., Hannah,
L. C., Koch, K. (1996) Phosphorylation of serine-15 of maize leaf
sucrose synthase. Occurrence in vivo and possible regulatory
significance. Plant Physiol., 112(2), 793-802. [0184] Huber, S. C.
and Huber, J. L. (1996). Role and Regulation of Sucrose-Phosphate
Synthase in Higher Plants. Annual Review of Plant Physiology and
Plant Molecular Biology 47, 431-444. [0185] Irish, V. F., Sussex,
I. M. (1990) Function of the apetala-1 gene during Arabidopsis
floral development. Plant Cell, 2(8), 741-53. [0186] Iskandar, H.
M., Simpson, R. S., Casu, R. E., Bonnett, G. D., MacLean, D. J. and
Manners, J. M. 2004. Comparison of reference genes for quantitative
real-time polymerase chain reaction. Plant Mol. Biol. Rep. 22,
325-337 [0187] Jacobsen, K. R., Fisher, D. G., Maretzki, A. and
Moore, P. H. (1992). Developmental-changes in the anatomy of the
sugarcane stem in relation to phloem unloading and sucrose storage.
Botanica Acta 105, 70-80. [0188] Jansen, R. C. and Nap, J. P.
(2001). Genetical genomics: the added value from segregation.
Trends in Genetics 17, 388-391. [0189] Jofuku, K. D., den Boer, B.
G., Van Montagu, M., Okamuro, J. K. (1994) Control of Arabidopsis
flower and seed development by the homeotic gene APETALA2. Plant
Cell, 6(9), 1211-25. [0190] Jones, T. L., Ort, D. R. (1997).
Circadian regulation of sucrose phosphate synthase activity in
tomato by protein phosphatase activity. Plant Physiol. 113,
1167-1175. Kirkpatrick D S, Gerber S A, Gygi S P. (2005). The
absolute quantification strategy: a general procedure for the
quantification of proteins and post-translational modifications.
Methods. 35(3):265-73. [0191] Klee H. J., Horsch R. B., Rogers S.
G. 1987 Agrobacterium mediated plant transformation and its further
applications to plant biology. Ann. Rev. Plant Physiol. 38:467 486.
[0192] Klein T. M., Wolf E. D., Wu R., Sanford J. C. (1987) High
velocity microprojectiles for delivering nucleic acids into living
cells. Nature 327:70-73. [0193] Klein, T. M., Fromm M., Weissinger
A., Tomes, D., Schaff, S., Sletten, M., Sanford, J. C. (1988a).
Transfer of foreign genes into intact maize cells with
high-velocity microprojectiles. Proc. Natl. Acad. Sci. USA
85:4305-4309. [0194] Klein, T. M. Gradziel, T. Fromm, M. E.,
Sanford, J. C. (1988b). Factors influencing gene delivery into Zea
mays cells by high-velocity microprojectiles. Biotechnolology,
6:559-563. [0195] Koch, K. E. (1996). Carbohydrate-Modulated Gene
Expression in Plants. Ann. Rev. of Plant Physiol. Plant Mol. Biol.
47, 509-540. [0196] Kolattukudy, P. E. (1984) Biochemistry and
function of cutin and suberin. Can J Bot, 62, 2918-2933. [0197]
Kunst, L., Klenz, J. E., Martinez-Zapater, J., and Haughn, G. W.
(1989) AP2 gene determines the identity of perianth organs in
flowers of Arabidopsis thaliana. Plant Cell, 1, 1195-1208. [0198]
Last D, Brettell R, Chamberlain D, Chaudhury A, Larkin P, Marsh E,
Peacock W, Dennis E (1991) pEmu: an improved promoter for gene
expression in cereal cells. Theo Appl Genet. 81: 581-588. [0199]
Lee, E. J., Iai, H., Sano, H. and Koizumi, N. (2005) Sugar
responsible and tissue specific expression of a gene encoding
AtCIPK14, an Arabidopsis CBL-interacting protein kinase. Biosci.
Biotechnol. Biochem., 69, 242-5. [0200] Leon-Kloosterziel, K. M.,
Keijzer, C. J., Koornneef, M. (1994) A seed shape mutant of
Arabidopsis that is affected in integument development. Plant Cell,
6(3), 385-392. [0201] Lewis, N. G. and Yamamoto, E. (1990). Lignin:
Occurrence, Biogenesis and Biodegradation. Annual Review of Plant
Physiology and Plant Molecular Biology 41, 455-496. [0202] Livak,
Schmittgen, T. D. (2001) Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T))
Method. Methods, 25(4), 402-8. [0203] Loc N T, Tinjuangjun P,
Gatehouse A M R, Christou P, Gatehouse J A. 2002. Linear transgene
constructs lacking vector backbone sequences generate transgenic
rice plants which accumulate higher levels of proteins conferring
insect resistance. Mol. Breeding. 9:231-244. [0204] Lumbreras, V.,
Alba, M. M., Kleinow, T., Koncz, C. and Pages, M. (2001). Domain
fusion between SNF1-related kinase subunits during plant evolution.
EMBO Rep. 2, 55-60. [0205] Lunn, J. E. and Furbank, R. T. (1999).
Sucrose biosynthesis in C-4 plants. New Phytologist 143, 221-237.
[0206] Ma H, Albert H, Paull R, Moore P (2000) Metabolic
engineering of invertase activities in different subcellular
compartments affects sucrose accumulation in sugarcane cells. Aust
J Plant Physiol 27:1021-1030. [0207] Ma S, Quist T M, Ulanov A,
Joly R, Bohnert H J (2004) Loss of TIP1;1 aquaporin in Arabidopsis
leads to cell and plant death. The Plant Journal 40(6):845-59.
[0208] Majerus, P. W., Kisseleva, M. V., and Norris, F. A. (1999).
The role of phosphatases in inositol signaling reactions. J. Biol.
Chem. 274, 10669-10672. [0209] Mattfeldt, T., Trijic, D.,
Gottfried, H. W., Kestler, H. A. (2004). Classification of
incidental carcinoma of the prostate using learning vector
quantization and support vector machines. Cell Oncol.
26(1-2):45-55. [0210] Maurel, C., Chrispeels, M. J. (2001)
Aquaporins. A molecular entry into plant water relations. Plant
Physiol., 125(1), 135-8. [0211] McClung, C. R. (2001). Circadian
Rhythms in Plants. Ann. Rev. Plant Physiol. Plant Mol. Biol. 52,
139-162. [0212] McElroy D, Blowers A D, Jenes B, Wu R (1991)
Construction of expression vectors based on the rice actin 1 (Act
1) 5'region for use in monocot transformation. Mol Gen Genet. 231:
150-160. [0213] McElroy D, Zhang W, Cao J, Wu R (1990) Isolation of
an efficient actin promoter for use in rice transformation. Plant
Cell 2: 163-171. [0214] McMichael, R. W. Jr., Bachmann, M., Huber,
S. C. (1995) Spinach feaf sucrose-phosphate synthase and nitrate
reductase are phosphorylated/inactivated by multiple protein
kinases in vitro. Plant Physiol., 108(3), 1077-1082. [0215]
McMichael, R. W., Klein, R. R., Salvucci, M. E., and Huber, S. C.
(1993). Identification of the major regulatory phosphorylation site
in sucrose-phosphate synthase. Arch. Biochem. Bioph. 307, 248-252.
[0216] Meireles S I, Cristo E B, Carvalho A F, Hirata R Jr, Pelosof
A, Gomes L I, Martins W K, Begnami M D, Zitron C, Montagnini A L,
Soares F A, Neves E J, Reis L F. (2004). Molecular classifiers for
gastric cancer and nonmalignant diseases of the gastric mucosa.
Cancer Res. 64(4):1255-65. [0217] Meyers, B. C., Galbraith, D. W.,
Nelson, T., and Agrawal, V. (2004). Methods for Transcriptional
Profiling in Plants. Be Fruitful and Replicate. Plant Physiol. 135,
637-652. [0218] Modrusan, Z., Reiser, L., Feldmann, K. A., Fischer,
R. L., Haughn, G. W. (1994) Homeotic Transformation of Ovules into
Carpel-like Structures in Arabidopsis. Plant Cell, 6(3), 333-349.
[0219] Moore, P. H. (2005). Integration of sucrose accumulation
processes across hierarchical scales: towards developing an
understanding of the gene-to-crop continuum. Field Crops Research
92, 119-135. [0220] Moorhead, G., Douglas, P., Cotelle, V.,
Harthill, J., Morrice, N., Meek, S., Deiting, U., Stitt, M.,
Scarabel, M., Aitken, A., and MacKintosh, C. (1999).
Phosphorylation-dependent interactions between enzymes of plant
metabolism and 14-3-3 proteins. The Plant Journal 18, 1-12. [0221]
Morsy, M. R., Almutairi, A. M., Gibbons, J., Yun, S. J., los Reyes,
B. G. (2005). The OsLti6 genes encoding low-molecular-weight
membrane proteins are differentially expressed in rice cultivars
with contrasting sensitivity to low temperature. Gene 344, 171-180.
[0222] Murashige, T.; Skoog, F. 1962. A revised medium for rapid
growth and bio-assays with tobacco tissue culture. Physiologia
Plantarum, 15:473-497. [0223] Newton M A, Noueiry A, Sarkar D,
Ahlquist P. (2004) Detecting differential gene expression with a
semiparametric hierarchical mixture method. Biostatistics 5,
155-76.
[0224] Nishiuchi, T. and Iba, K. (1998). Roles of plastid omega-3
fatty acid desaturases in defense response of higher plants.
Journal of Plant Research 111, 481-486. [0225] Nogueira, F. T. S.,
De Rosa, V. E., Menossi, M., Ulian, E. C., Arruda, P. (2003). RNA
expression profiles and data mining of sugarcane response to low
temperature. Plant Physiology 132, 1811-1824. [0226] Ohto M A,
Fischer R L, Goldberg R B, Nakamura K, Harada J J. (2005) Control
of seed mass by APETALA2. Proc Natl Acad Sci U.S.A., 102, 3123-8.
[0227] Okamuro, J. K., den Boer, B. G., Jofuku, K. D. (1993)
Regulation of Arabidopsis flower development. Plant Cell 5,
1183-93. [0228] Pagnussat, G. C., Fiol, D. F., Salerno, G. L.
(2002) A CDPK type protein kinase is involved in rice SPS light
modulation. Physiol Plant., 115, 183-189. [0229] Papini-Terzi, F.
S., Rocha, F. R., Vencio, R. Z., Oliveira, K. C., Felix, J. M.,
Vicentini, R., Rocha, C. S., Simoes, A. C., Ulian, E. C., di Mauro,
S. M., da Silva, A. M., Pereira, C. A., Menossi, M., Souza, G. M.
(2005) Transcription profiling of signal transduction-related genes
in sugarcane tissues. DNA Res., 12, 27-38. [0230] Paszkowski J.,
Shillito R. D., Saul M., Mandak V., Hohn T., Hohn B., Potrykus I.
(1984) Direct gene transfer to plants. EMBO J. 3:2717-2722 [0231]
Pathre, U. V., Sinha, A. K., Shirke, P. A., and Ranade, S. A.
(2004). Diurnal and seasonal modulation of sucrose phosphate
synthase activity in leaves of Prosopis juliflora. Biol. Plant. 48,
227-235. [0232] Perez, G., De Prata, F., Chinea, A., Bernal, N.,
O'Relly, J. P. (1997) Recursos geneticos de la cana de az car.
Instituto Nacional de Investigaciones de La Cana de Az car (INICA),
249p. [0233] Pessoa Junior, A., Roberto, I. C., Menossi, M.,
Santos, R. R., Ortega Filho, S., Penna, T. C. V. (2005).
Perspectives on bioenergy and biotechnology in Brazil. Appl. Bioch.
Biotech. 121, 59-70. [0234] Potrykus, I. & Spangenberg, G.
(1995). Gene transfer to plants. Springer-Verlag, Berlin. [0235]
Prescha, A., Swiedrych, A., Biernat, J., and Szopa, J. (2001).
Increase in lipid content in potato tubers modified by 14-3-3 gene
overexpression. J. Agric. Food Chem. 49, 3638-3643. [0236]
Riechmann, J. L., Meyerowitz, E. M. (1998) The AP2/EREBP family of
plant transcription factors. Biol. Chem., 379(6), 633-46. [0237]
Roach, B. T., Daniels, J. (1987) A review of the origin and
improvement of sugarcane. International Sugarcane Breeding
Workshop, pp 1-33, COPERSUCAR, Sao Paulo, Brasil. [0238] Rolland,
F., Moore, B., Sheen, J. (2002). Sugar sensing and signaling in
plants. Plant Cell 14, S185-S205. [0239] Sambrook, J., Fritsch, E.
F., Maniatis, T.; Hrsg. (1989). Molecular Cloning--A Laboratory
Manual, 2nd Edition. Cold Spring Habour Laboratory Press, New York.
[0240] Sanders, D., Pelloux, J., Brownlee, C., Harper, J. F. (2002)
Calcium at the crossroads of signaling. Plant Cell, 14,
Suppl:S401-17. [0241] Schuler, M. A., Werck-Reichhart, D. (2003)
Functional genomics of P450s. Annu Rev Plant Biol., 54, 629-67.
[0242] Sehnke, P. C., DeLille, J. M., Ferl, R. J. (2002).
Consummating signal transduction: The role of 14-3-3 proteins in
the completion of signal-induced transitions in protein activity.
Plant Cell 14, S339-S354. [0243] Shi, J., Kim, K. N., Ritz, O.,
Albrecht, V., Gupta, R., Harter, K., Luan, S., Kudla, J. (1999)
Novel protein kinases associated with calcineurin B-like calcium
sensors in Arabidopsis. Plant Cell., 11(12), 2393-405. [0244]
Slade, A. J, Fuerstenberg, S. I., Loeffler, D., Steine, M. N.,
Facciotti, D. (2005). A reverse genetic, nontransgenic approach to
wheat crop improvement by TILLING. Nat. Biotechnol. 23(1):75-81.
SOMOGY, M. A new reagent for determination of sugars. A new Sugar
Reagent, May v. 160, p. 61-63, 1945. [0245] Souza, G. M., Simoes,
A. C. Q., Oliveira, K. C., Garay, H. M., Fiorini, L. C., Gomes, F.
D., Nishiyama-Junior, M. Y., da Silva, A. M. (2001). The sugarcane
signal transduction (SUCAST) catalogue: prospecting signal
transduction in sugarcane. Genet. Mol. Biol. 24, 25-34. [0246]
Swiedrych, A., Prescha, A., Matysiak-Kata, I., Biernat, J., Szopa,
J. (2002). Repression of the 14-3-3 Gene Affects the Amino Acid and
Mineral Composition of Potato Tubers. J. Agric. Food Chem. 50,
2137-2141. [0247] Thompson, J. D., Higgins, D. G. and Gibson, T. G.
1994. CLUSTAL W: improving the sensitivity of progressive multiple
sequence alignment through sequence weighting, position-specific
gap penalties and weight matrix choice. Nuclei Acids Research 22,
4673-4680. [0248] Tibshirani R, Hastie T, Narasimhan B, Chu G.
(2002) Diagnosis of multiple cancer types by shrunken centroids of
gene expression. Proc Natl Acad Sci USA. 14; 99(10):6567-72. [0249]
Toroser, D. and Huber, S. C. (1997). Protein phosphorylation as a
mechanism for osmotic-stress activation of sucrose-phosphate
synthase in spinach leaves. Plant Physiol. 114, 947-955. [0250]
Toroser, D., Athwal, G. S., Huber, S. C. (1998). Site-specific
regulatory interaction between spinach leaf sucrose-phosphate
synthase and 14-3-3 proteins. FEBS Letters 435, 110-114. [0251]
Vain P, De Buyser J, Bui Trang V, Haicour R, Henry Y. (1995)
Foreign gene delivery into monocotyledonous species. Biotechnol
Adv. 1995; 13(4):653-71. [0252] Van Dillewijn C. (1952). Botany of
sugarcane., Walthan Mass, ed. (EUA). [0253] Vencio, R. Z. N.,
Koide, T. (2005) HTself: self-self based statistical test for low
replication microarray studies. DNA Res., 12, 211-214. [0254]
Vettore, A. L., da Silva, F. R., Kemper, E. L., Souza, G. M., da
Silva, A. M., Ferro, M. I., Henrique-Silva, F., Giglioti, E. A.,
Lemos, M. V. F., Coutinho, L. L., Nobrega, M. P., Carrer, H.,
Franca, S. C., Bacci, M., Jr., Goldman, M. H., Gomes, S. L., Nunes,
L. R., Camargo, L. E. A., Siqueira, W. J., Van Sluys, M. A.,
Thiemann, O. H., Kuramae, E. E., Santelli, R. V., Marino, C. L.,
Targon, M. L. P. N., Ferro, J. A., Silveira, H. C. S., Marini, D.
C., Lemos, E. G. M., Monteiro-Vitorello, C. B., Tambor, J. H. M.,
Carraro, D. M., Roberto, P. G., Martins, V. G., Goldman, G. H., de
Oliveira, R. C., Truffi, D., Colombo, C. A., Rossi, M., de Araujo,
P. G., Sculaccio, S. A., Angella, A., Lima, M. M. A., de Rosa, V.
E. J., Siviero, F., Coscrato, V. E., Machado, M. A., Grivet, L., Di
Mauro, S. M. Z., Nobrega, F. G., Menck, C. F. M., Braga, M. D. V.,
Telles, G. P., Cara, F. A. A., Pedrosa, G., Meidanis, J., Arruda,
P. (2003). Analysis and Functional Annotation of an Expressed
Sequence Tag Collection for Tropical Crop Sugarcane. Genome Res.
13, 2725-2735. [0255] Wei H, Albert H H, Moore P H (1999)
Differential expression of sugarcane polyubiquitin genes and
isolation of promoters from two highly-expressed members of the
gene family. J Plant Physiol 155, 513-519. [0256] Wei H, Wang M L,
Moore P H, Albert H H. (2003) Comparative expression analysis of
two sugarcane polyubiquitin promoters and flanking sequences in
transgenic plants. J Plant Physiol. 160(10): 1241-51. [0257]
Weising K, Schell J, Kahl G. (1988) Foreign genes in plants:
transfer, structure, expression, and applications. Annu Rev Genet.
1988; 22:421-77. [0258] Wesley, S. V., Helliwell, C. A., Smith, N.
A., Wang, M. B., Rouse, D. T., Liu, Q., Gooding, P. S., Singh, S.
P., Abbott, D., Stoutjesdijk, P. A., Robinson, S. P., Gleave, A.
P., Green, A. G., Waterhouse, P. M. (2001) Construct design for
efficient, effective and high-throughput gene silencing in plants.
Plant J. 27: 581-590. [0259] Yang, Y. H., Dudoit, S., Luu, P., Lin,
D. M., Peng, V., Ngai, J., Speed, T. P. (2002). Normalization for
cDNA microarray data a robust composite method addressing single
and multiple slide systematic variation. Nucleic Acids Res 30:e15
[0260] Yu, S. M. (1999). Cellular and genetic responses of plants
to sugar starvation. Plant Physiol. 121, 687-693. [0261] Zhang, X.
Q., Lund, A. A., Sarath, G., Cerny, R. L., Roberts, D. M., Chollet,
R. (1999) Soybean nodule sucrose synthase (nodulin-100): further
analysis of its phosphorylation using recombinant and authentic
root-nodule enzymes. Arch Biochem Biophys., 371(1), 70-82. [0262]
Zrenner, R., Salanoubat, M., Willmitzer, L., Sonnewald, U. (1995)
Evidence of the crucial role of sucrose synthase for sink strength
using transgenic potato plants (Solanum tuberosum L.). Plant J.,
7(1), 97-107. [0263] Zuk, M., Skala, J., Biernat, J., Szopa, J.
(2003). Repression of six 14-3-3 protein isoforms resulting in the
activation of nitrate and carbon fixation key enzymes from
transgenic potato plants. Plant Sci. 165, 731-741.
[0264] All references cited herein are incorporated by reference.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20100162442A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20100162442A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References