U.S. patent application number 12/439924 was filed with the patent office on 2010-06-24 for small molecule inhibitors of toll-like receptor 9.
Invention is credited to Grayson B. Lipford, Toan B. Nguyen, Charles M. Zepp.
Application Number | 20100160314 12/439924 |
Document ID | / |
Family ID | 39157802 |
Filed Date | 2010-06-24 |
United States Patent
Application |
20100160314 |
Kind Code |
A1 |
Lipford; Grayson B. ; et
al. |
June 24, 2010 |
Small Molecule Inhibitors of Toll-Like Receptor 9
Abstract
Small molecule compounds and compositions containing said
compounds useful for inhibiting signaling by certain Toll-like
receptors (TLRs), particularly TLR9, are provided. The compounds
and compositions can be used to inhibit immune responses, including
unwanted immune responses in particular. Compounds, compositions,
and methods are provided to treat a variety of conditions involving
unwanted immune responses, including for example autoimmune
disease, inflammation, transplant rejection, and sepsis.
Inventors: |
Lipford; Grayson B.;
(Watertown, MA) ; Zepp; Charles M.; (Hardwick,
MA) ; Nguyen; Toan B.; (Reading, MA) |
Correspondence
Address: |
PFIZER INC.;PATENT DEPARTMENT
Bld 114 M/S 114, EASTERN POINT ROAD
GROTON
CT
06340
US
|
Family ID: |
39157802 |
Appl. No.: |
12/439924 |
Filed: |
September 5, 2007 |
PCT Filed: |
September 5, 2007 |
PCT NO: |
PCT/US07/19334 |
371 Date: |
March 4, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60842252 |
Sep 5, 2006 |
|
|
|
Current U.S.
Class: |
514/234.5 ;
514/235.2; 544/119; 544/121 |
Current CPC
Class: |
G06Q 40/025 20130101;
G06Q 40/12 20131203; G06Q 40/02 20130101; G06Q 20/20 20130101; G06Q
40/00 20130101 |
Class at
Publication: |
514/234.5 ;
544/119; 544/121; 514/235.2 |
International
Class: |
A61K 31/5377 20060101
A61K031/5377; C07D 413/14 20060101 C07D413/14; A61P 37/00 20060101
A61P037/00; A61P 37/06 20060101 A61P037/06 |
Claims
1. A compound having a structure selected from ##STR00108## wherein
X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are independently nitrogen
or carbon; R.sub.1 and R.sub.2 are independently absent, hydrogen,
optionally substituted alkyl, optionally substituted alkoxy, or
halide; R.sub.3 is absent, hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, halide, Y.sub.1, or Y.sub.3; R.sub.4
is a group having the structure, ##STR00109## where R.sub.9 is
hydrogen or optionally substituted alkyl; L is optionally
substituted alkyl; R.sub.10 and R.sub.11 are independently hydrogen
or optionally substituted alkyl; and together R.sub.10 and R.sub.11
can be joined to form an optionally substituted heterocycle, or
together R.sub.9 and one of R.sub.10 or R.sub.11 can be joined to
form an optionally substituted heterocycle; R.sub.5 is absent or
hydrogen; R.sub.6 and R.sub.7 are independently hydrogen,
optionally substituted alkyl, optionally substituted alkoxy,
halide, Y.sub.1, or Y.sub.2; and R.sub.8 is hydrogen, optionally
substituted alkyl, optionally substituted alkoxy, halide, Y.sub.1,
or Y.sub.3; wherein Y.sub.1 is Ar--Y.sub.2, where Ar is optionally
substituted phenyl; Y.sub.2 is W-L.sub.1NR.sub.12R.sub.13, where W
is O, S, or NR.sub.14; L.sub.1 is optionally substituted alkyl;
R.sub.12, R.sub.13, and R.sub.14 are independently hydrogen or
optionally substituted alkyl; and together R.sub.12 and R.sub.13
can be joined to form an optionally substituted heterocycle, or
together R.sub.14 and one of R.sub.12 or R.sub.13 can be joined to
form an optionally substituted heterocycle; Y.sub.3 is optionally
substituted phenyl; and at least one of R.sub.3, R.sub.6, R.sub.7,
and R.sub.8 is Y.sub.1; or at least one of R.sub.6 and R.sub.7 is
Y.sub.2; and/or at least one of R.sub.3 and R.sub.8 is Y.sub.3.
2.-156. (canceled)
157. A compound having a structure selected from ##STR00110##
wherein X.sub.1, X.sub.3, and X.sub.4 are independently nitrogen or
carbon; R.sub.3 is absent, hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide; R.sub.4 is a group having
the structure, ##STR00111## where R.sub.9 is hydrogen or optionally
substituted alkyl; L is optionally substituted alkyl; R.sub.10 and
R.sub.11 are independently hydrogen or optionally substituted
alkyl; and together R.sub.10 and R.sub.11 can be joined to form an
optionally substituted heterocycle, or together R.sub.9 and one of
R.sub.10 or R.sub.11 can be joined to form an optionally
substituted heterocycle; R.sub.5 is absent, hydrogen, optionally
substituted alkyl, optionally substituted alkoxy, or halide;
R.sub.6, R.sub.7, and R.sub.8 are independently hydrogen,
optionally substituted alkyl, optionally substituted alkoxy, or
halide; and Y.sub.1 is Ar--Y.sub.2, where Ar is optionally
substituted phenyl; wherein Y.sub.2 is W-L.sub.1NR.sub.12R.sub.13,
where W is O, S, or NR.sub.14; L.sub.1 is optionally substituted
alkyl; R.sub.12, R.sub.13, and R.sub.14 are independently hydrogen
or optionally substituted alkyl; and together R.sub.12 and R.sub.13
can be joined to form an optionally substituted heterocycle, or
together R.sub.14 and one of R.sub.12 or R.sub.13 can be joined to
form an optionally substituted heterocycle; wherein, when the
compound has the structure (IX) wherein X.sub.3 is nitrogen,
X.sub.4 is nitrogen.
158.-172. (canceled)
173. A compound having a structure selected from ##STR00112##
wherein X.sub.1, X.sub.3, and X.sub.4 are independently nitrogen or
carbon; R.sub.3 is absent, hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide; R.sub.4 is a group having
the structure, ##STR00113## where R.sub.9 is hydrogen or optionally
substituted alkyl; L is optionally substituted alkyl; R.sub.10 and
R.sub.11 are independently hydrogen or optionally substituted
alkyl; and together R.sub.10 and R.sub.11 can be joined to form an
optionally substituted heterocycle, or together R.sub.9 and one of
R.sub.10 or R.sub.11 can be joined to form an optionally
substituted heterocycle; R.sub.5 is absent or hydrogen; R.sub.6 and
R.sub.8 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, halide, or Y.sub.3; R.sub.7 is
hydrogen, optionally substituted alkyl, optionally substituted
alkoxy, or halide; and Y.sub.2 is W-L.sub.1NR.sub.12R.sub.13, where
W is O, S, or NR.sub.14; L.sub.1 is optionally substituted alkyl;
R.sub.12, R.sub.13, and R.sub.14 are independently hydrogen or
optionally substituted alkyl; and together R.sub.12 and R.sub.13
can be joined to form an optionally substituted heterocycle, or
together R.sub.14 and one of R.sub.12 or R.sub.13 can be joined to
form an optionally substituted heterocycle; wherein Y.sub.3 is
optionally substituted phenyl.
174.-222. (canceled)
223. A compound having a structure selected from ##STR00114##
wherein X.sub.1, X.sub.3, and X.sub.4 are independently nitrogen or
carbon; R.sub.3 is absent, hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide; R.sub.4 is a group having
the structure, ##STR00115## where R.sub.9 is hydrogen or optionally
substituted alkyl; L is optionally substituted alkyl; R.sub.10 and
R.sub.11 are independently hydrogen or optionally substituted
alkyl; and together R.sub.10 and R.sub.11 can be joined to form an
optionally substituted heterocycle, or together R.sub.9 and one of
R.sub.10 or R.sub.11 can be joined to form an optionally
substituted heterocycle; R.sub.5 is absent or hydrogen; R.sub.6 and
R.sub.7 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, halide, or Y.sub.2; R.sub.8 is
hydrogen, optionally substituted alkyl, optionally substituted
alkoxy, or halide; and Y.sub.3 is optionally substituted phenyl;
wherein Y.sub.2 is W-L.sub.1NR.sub.12R.sub.13, where W is O, S, or
NR.sub.14; L.sub.1 is optionally substituted alkyl; R.sub.12,
R.sub.13, and R.sub.14 are independently hydrogen or optionally
substituted alkyl; and together R.sub.12 and R.sub.13 can be joined
to form an optionally substituted heterocycle, or together R.sub.14
and one of R.sub.12 or R.sub.13 can be joined to form an optionally
substituted heterocycle.
224.-272. (canceled)
273. A compound having a structure selected from ##STR00116##
wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are independently
nitrogen or carbon; R.sub.1, R.sub.3, and R.sub.5 are independently
absent, hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide; R.sub.6 is independently hydrogen,
optionally substituted alkyl, optionally substituted alkoxy,
halide, or Y.sub.2; R.sub.7, R.sub.8, and R.sub.15 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide; each Q is independently optionally
substituted alkyl or Y.sub.2; and n is an integer from 1-5; wherein
Y.sub.2 is W-L.sub.1NR.sub.12R.sub.13, where W is O, S, or
NR.sub.14; L.sub.1 is optionally substituted alkyl; R.sub.12,
R.sub.13, and R.sub.14 are independently hydrogen or optionally
substituted alkyl; and together R.sub.12 and R.sub.13 can be joined
to form an optionally substituted heterocycle, or together R.sub.14
and one of R.sub.12 or R.sub.13 can be joined to form an optionally
substituted heterocycle.
274.-340. (canceled)
341. A pharmaceutical composition, comprising a compound of claim 1
and a pharmaceutically acceptable carrier.
342.-343. (canceled)
344. A pharmaceutical composition, comprising a compound of claim
157 and a pharmaceutically acceptable carrier.
345.-346. (canceled)
347. A pharmaceutical composition, comprising a compound of claim
173 and a pharmaceutically acceptable carrier.
348.-349. (canceled)
350. A pharmaceutical composition, comprising a compound of claim
223 and a pharmaceutically acceptable carrier.
351.-352. (canceled)
353. A pharmaceutical composition, comprising a compound of claim
273 and a pharmaceutically acceptable carrier.
354.-355. (canceled)
356. A method for reducing signaling by a Toll-like receptor (TLR),
comprising: contacting a cell expressing a TLR, selected from TLR7,
TLR8, and TLR9, with an effective amount of a compound of claim 1
to reduce signaling by the TLR in response to an agonist of the
TLR, compared to signaling by the TLR in response to the agonist in
absence of the contacting.
357.-364. (canceled)
365. A method for reducing an immune response, comprising:
contacting a population of immune cells expressing a Toll-like
receptor (TLR), selected from TLR7, TLR8, and TLR9, with an
effective amount of a compound of claim 1 to reduce an immune
response by the immune cells, compared to an immune response by the
immune cells in absence of the contacting.
366.-377. (canceled)
378. A method for treating an autoimmune condition in a subject,
comprising: administering to a subject having an autoimmune
condition, wherein the autoimmune condition involves signaling by a
Toll-like receptor (TLR) selected from TLR7, TLR8, and TLR9, an
effective amount of a compound of claim 1 to treat the autoimmune
condition.
379.-385. (canceled)
386. A method for reducing signaling by a Toll-like receptor (TLR),
comprising: contacting a cell expressing a TLR, selected from TLR7,
TLR8, and TLR9, with an effective amount of a compound of claim 157
to reduce signaling by the TLR in response to an agonist of the
TLR, compared to signaling by the TLR in response to the agonist in
absence of the contacting.
387. A method for reducing signaling by a Toll-like receptor (TLR),
comprising: contacting a cell expressing a TLR, selected from TLR7,
TLR8, and TLR9, with an effective amount of a compound of claim 173
to reduce signaling by the TLR in response to an agonist of the
TLR, compared to signaling by the TLR in response to the agonist in
absence of the contacting.
388. A method for reducing signaling by a Toll-like receptor (TLR),
comprising: contacting a cell expressing a TLR, selected from TLR7,
TLR8, and TLR9, with an effective amount of a compound of claim 223
to reduce signaling by the TLR in response to an agonist of the
TLR, compared to signaling by the TLR in response to the agonist in
absence of the contacting.
389. A method for reducing signaling by a Toll-like receptor (TLR),
comprising: contacting a cell expressing a TLR, selected from TLR7,
TLR8, and TLR9, with an effective amount of a compound of claim 273
to reduce signaling by the TLR in response to an agonist of the
TLR, compared to signaling by the TLR in response to the agonist in
absence of the contacting.
390. A method for reducing an immune response, comprising:
contacting a population of immune cells expressing a Toll-like
receptor (TLR), selected from TLR7, TLR8, and TLR9, with an
effective amount of a compound of claim 157 to reduce an immune
response by the immune cells, compared to an immune response by the
immune cells in absence of the contacting.
391. A method for reducing an immune response, comprising:
contacting a population of immune cells expressing a Toll-like
receptor (TLR), selected from TLR7, TLR8, and TLR9, with an
effective amount of a compound of claim 173 to reduce an immune
response by the immune cells, compared to an immune response by the
immune cells in absence of the contacting.
390. A method for reducing an immune response, comprising:
contacting a population of immune cells expressing a Toll-like
receptor (TLR), selected from TLR7, TLR8, and TLR9, with an
effective amount of a compound of claim 223 to reduce an immune
response by the immune cells, compared to an immune response by the
immune cells in absence of the contacting.
391. A method for reducing an immune response, comprising:
contacting a population of immune cells expressing a Toll-like
receptor (TLR), selected from TLR7, TLR8, and TLR9, with an
effective amount of a compound of claim 273 to reduce an immune
response by the immune cells, compared to an immune response by the
immune cells in absence of the contacting.
392. A method for treating an autoimmune condition in a subject,
comprising: administering to a subject having an autoimmune
condition, wherein the autoimmune condition involves signaling by a
Toll-like receptor (TLR) selected from TLR7, TLR8, and TLR9, an
effective amount of a compound of claim 157 to treat the autoimmune
condition.
393. A method for treating an autoimmune condition in a subject,
comprising: administering to a subject having an autoimmune
condition, wherein the autoimmune condition involves signaling by a
Toll-like receptor (TLR) selected from TLR7, TLR8, and TLR9, an
effective amount of a compound of claim 173 to treat the autoimmune
condition.
394. A method for treating an autoimmune condition in a subject,
comprising: administering to a subject having an autoimmune
condition, wherein the autoimmune condition involves signaling by a
Toll-like receptor (TLR) selected from TLR7, TLR8, and TLR9, an
effective amount of a compound of claim 223 to treat the autoimmune
condition.
395. A method for treating an autoimmune condition in a subject,
comprising: administering to a subject having an autoimmune
condition, wherein the autoimmune condition involves signaling by a
Toll-like receptor (TLR) selected from TLR7, TLR8, and TLR9, an
effective amount of a compound of claim 273 to treat the autoimmune
condition.
Description
FIELD OF THE INVENTION
[0001] The present invention relates generally to immunology. More
particularly, the invention relates to small molecules capable of
inhibiting an immune response, pharmaceutical compositions
comprising the small molecule inhibitors, and methods of using the
inhibitors.
BACKGROUND OF THE INVENTION
[0002] Stimulation of the immune system, which includes stimulation
of either or both innate immunity and adaptive immunity, is a
complex phenomenon that can result in either protective or adverse
physiologic outcomes for the host. In recent years there has been
increased interest in the mechanisms underlying innate immunity,
which is believed to initiate and support adaptive immunity. This
interest has been fueled in part by the recent discovery of a
family of highly conserved pattern recognition receptor proteins
known as Toll-like receptors (TLRs) believed to be involved in
innate immunity as receptors for pathogen-associated molecular
patterns (PAMPs). Compositions and methods useful for modulating
innate immunity are therefore of great interest, as they may affect
therapeutic approaches to conditions involving autoimmunity,
inflammation, allergy, asthma, graft rejection, graft versus host
disease (GvHD), infection, cancer, and immunodeficiency.
[0003] Recently there have been a number of reports describing the
immunostimulatory effect of certain types of nucleic acid
molecules, including CpG nucleic acids and double-stranded RNA. Of
note, it was recently reported that Toll-like receptor 9 (TLR9)
recognizes bacterial DNA and CpG DNA. Hemmi H et al. (2000) Nature
408:740-5; Bauer S et al. (2001) Proc Natl Acad Sci USA 98:9237-42.
It was also recently reported that immune complexes containing IgG
and nucleic acid can stimulate TLR9 and participate in B-cell
activation in certain autoimmune diseases. Leadbetter E A et al.
(2002) Nature 416:595-8.
[0004] Chlroroquines have been recognized as useful not only as
anti-malarial agents but also as anti-inflammatory agents. Although
its mechanism of action is not well understood, chloroquine has
been used effectively in the treatment of various autoimmune
diseases, including rheumatoid arthritis (R A) and systemic lupus
erythematosus (SLE). For a review, see Wallace D J (1996) Lupus 5
Suppl 1:S59-64. Recently Macfarlane and colleagues described a
number of small molecule analogs and derivatives of chloroquine
(4-aminoquinoline) and quinacrine(9-aminoacridine) which reportedly
inhibit stimulation of the immune system. U.S. Pat. No. 6,221,882;
U.S. Pat. No. 6,479,504; U.S. Pat. No. 6,521,637; published
international patent application WO 00/76982; and published
international patent application WO 99/01154. Macfarlane and
colleagues report these small molecule inhibitors of the immune
response, even when used at nanomolar concentrations, can block the
action of immunostimulatory DNA. U.S. Pat. No. 6,221,882 B1.
Macfarlane and coworkers studied a large number of compounds by
varying substituents on a limited number of 4-aminoquinoline and
9-aminoacridine core structures related to chloroquine and
quinacrine.
[0005] More recently Lipford et al. described yet additional small
molecule TLR antagonists, including certain substituted quinoline
and quinazoline compounds, in published patent application US
2005/0119273 A1.
SUMMARY OF THE INVENTION
[0006] The present invention relates to compositions and methods
useful for inhibiting an immune response.
[0007] The invention in one aspect is a compound having a
structure
##STR00001##
wherein
[0008] X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are independently
nitrogen or carbon;
[0009] R.sub.1 and R.sub.2 are independently absent, hydrogen,
optionally substituted alkyl, optionally substituted alkoxy, or
halide;
[0010] R.sub.3 is absent, hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, halide, Y.sub.1, or Y.sub.3;
[0011] R.sub.4 is a group having the structure,
##STR00002##
[0012] where R.sub.9 is hydrogen or optionally substituted alkyl; L
is optionally substituted alkyl; R.sub.10 and R.sub.11 are
independently hydrogen or optionally substituted alkyl; and
together R.sub.10 and R.sub.11 can be joined to form an optionally
substituted heterocycle, or together R.sub.9 and one of R.sub.10 or
R.sub.11 can be joined to form an optionally substituted
heterocycle;
[0013] R.sub.5 is absent or hydrogen;
[0014] R.sub.6 and R.sub.7 are independently hydrogen, optionally
substituted alkyl, optionally substituted alkoxy, halide, Y.sub.1,
or Y.sub.2; and
[0015] R.sub.8 is hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, halide, Y.sub.1, or Y.sub.3;
wherein
[0016] Y.sub.1 is Ar--Y.sub.2, where Ar is optionally substituted
phenyl;
[0017] Y.sub.2 is W-L.sub.1NR.sub.12R.sub.13, where W is O, S, or
NR.sub.14; L.sub.1 is optionally substituted alkyl; R.sub.12,
R.sub.13, and R.sub.14 are independently hydrogen or optionally
substituted alkyl; and together R.sub.12 and R.sub.13 can be joined
to form an optionally substituted heterocycle, or together R.sub.14
and one of R.sub.12 or R.sub.13 can be joined to form an optionally
substituted heterocycle;
[0018] Y.sub.3 is optionally substituted phenyl; and
[0019] at least one of R.sub.3, R.sub.6, R.sub.7, and R.sub.8 is
Y.sub.1; or at least one of R.sub.6 and R.sub.7 is Y.sub.2; and/or
at least one of R.sub.3 and R.sub.8 is Y.sub.3.
[0020] In one embodiment according to this aspect of the invention
at least one of X.sub.1, X.sub.2, X.sub.3, and X.sub.4 is
nitrogen.
[0021] In one embodiment according to this aspect of the invention
at least two of X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are
nitrogen.
[0022] In one embodiment according to this and other aspects of the
invention, R.sub.4 is
##STR00003##
[0023] These groups are also referred to herein as follows:
##STR00004##
1-(4-methyl-piperazine) or, equivalently, pip;
##STR00005##
N--[N,N-dimethylethylenediamine] or, equivalently, diamine;
##STR00006##
N--[N,N-dimethylpropane-1,3-diamine] or, equivalently,
dipamine;
##STR00007##
(2-morpholin-4-yl-ethyl)-amine or, equivalently, dimor;
##STR00008##
(3-morpholin-4-yl-propyl)-amine or, equivalently, dipmor;
##STR00009##
[3-(4-methylpiperazin-1-yl-ethyl)]-amine or, equivalently, dipip;
and
##STR00010##
[3-(4-methylpiperazin-1-yl-propyl)]-amine or, equivalently,
dippip.
[0024] In one embodiment according to this aspect of the invention
Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip, or
dippip.
[0025] In one embodiment the compound has one of the following
structures,
##STR00011##
[0026] In one embodiment the compound has the structure
##STR00012##
[0027] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.1.
[0028] Further still according to this embodiment in which R.sub.6
is Y.sub.1, in one embodiment R.sub.3, R.sub.7, and R.sub.8 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide. Further still according to this
embodiment in which R.sub.6 is Y.sub.1, in one embodiment R.sub.3,
R.sub.7, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.6 is Y.sub.1 and R.sub.3, R.sub.7, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.6 is Y.sub.1, R.sub.3, R.sub.7,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip; or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2 is specifically embraced by the
latter embodiment, i.e.,
[0029] R.sub.4 pip and Y.sub.2 pip; R.sub.4 pip and Y.sub.2
diamine; R.sub.4 pip and Y.sub.2 dipamine; R.sub.4 pip and Y.sub.2
dimor; R.sub.4 pip and Y.sub.2 dipmor; R.sub.4 pip and Y.sub.2
dipip; R.sub.4 pip and Y.sub.2 dippip;
[0030] R.sub.4 diamine and Y.sub.2 pip; R.sub.4 diamine and Y.sub.2
diamine; R.sub.4 diamine and Y.sub.2 dipamine; R.sub.4 diamine and
Y.sub.2 dimor; R.sub.4 diamine and Y.sub.2 dipmor; R.sub.4 diamine
and Y.sub.2 dipip; R.sub.4 diamine and Y.sub.2 dippip;
[0031] R.sub.4 dipamine and Y.sub.2 pip; R.sub.4 dipamine and
Y.sub.2 diamine; R.sub.4 dipamine and Y.sub.2 dipamine; R.sub.4
dipamine and Y.sub.2 dimor; R.sub.4 dipamine and Y.sub.2 dipmor;
R.sub.4 dipamine and Y.sub.2 dipip; R.sub.4 dipamine and Y.sub.2
dippip;
[0032] R.sub.4 dimor and Y.sub.2 pip; R.sub.4 dimor and Y.sub.2
diamine; R.sub.4 dimor and Y.sub.2 dipamine; R.sub.4 dimor and
Y.sub.2 dimor; R.sub.4 dimor and Y.sub.2 dipmor; R.sub.4 dimor and
Y.sub.2 dipip; R.sub.4 dimor and Y.sub.2 dippip;
[0033] R.sub.4 dipmor and Y.sub.2 pip; R.sub.4 dipmor and Y.sub.2
diamine; R.sub.4 dipmor and Y.sub.2 dipamine; R.sub.4 dipmor and
Y.sub.2 dimor; R.sub.4 dipmor and Y.sub.2 dipmor; R.sub.4 dipmor
and Y.sub.2 dipip; R.sub.4 dipmor and Y.sub.2 dippip;
[0034] R.sub.4 dipip and Y.sub.2 pip; R.sub.4 dipip and Y.sub.2
diamine; R.sub.4 dipip and Y.sub.2 dipamine; R.sub.4 dipip and
Y.sub.2 dimor; R.sub.4 dipip and Y.sub.2 dipmor; R.sub.4 dipip and
Y.sub.2 dipip; R.sub.4 dipip and Y.sub.2 dippip;
[0035] R.sub.4 dippip and Y.sub.2 pip; R.sub.4 dippip and Y.sub.2
diamine; R.sub.4 dippip and Y.sub.2 dipamine; R.sub.4 dippip and
Y.sub.2 dimor; R.sub.4 dippip and Y.sub.2 dipmor; R.sub.4 dippip
and Y.sub.2 dipip; R.sub.4 dippip and Y.sub.2 dippip.
[0036] In one embodiment the compound has the structure
##STR00013##
wherein R.sub.7 is Y.sub.1.
[0037] Further according to this embodiment in which R.sub.7 is
Y.sub.1, in one embodiment R.sub.3, R.sub.6, and R.sub.8 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide. Further still according to this
embodiment in which R.sub.7 is Y.sub.1, in one embodiment R.sub.3,
R.sub.6, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.7 is Y.sub.1 and R.sub.3, R.sub.6, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.7 is Y.sub.1, R.sub.3, R.sub.6,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0038] In one embodiment the compound has the structure
##STR00014##
wherein R.sub.8 is Y.sub.1.
[0039] Further according to this embodiment in which R.sub.8 is
Y.sub.1, in one embodiment R.sub.3, R.sub.6, and R.sub.7 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide. Further still according to this
embodiment in which R.sub.8 is Y.sub.1, in one embodiment R.sub.3,
R.sub.6, and R.sub.7 are hydrogen. Further still according to this
embodiment in which R.sub.8 is Y.sub.1 and R.sub.3, R.sub.6, and
R.sub.7 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.8 is Y.sub.1, R.sub.3, R.sub.6,
and R.sub.7 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0040] In one embodiment the compound has the structure
##STR00015##
wherein R.sub.3 is Y.sub.1.
[0041] Further according to this embodiment in which R.sub.3 is
Y.sub.1, in one embodiment R.sub.6, R.sub.7, and R.sub.8 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide. Further still according to this
embodiment in which R.sub.3 is Y.sub.1, in one embodiment R.sub.6,
R.sub.7, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.3 is Y.sub.1 and R.sub.6, R.sub.7, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.3 is Y.sub.1, and R.sub.3,
R.sub.6, and R.sub.7 are hydrogen, and R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip, in one embodiment
Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip.
Each and every combination of R.sub.4 and Y.sub.2, as set forth
above, is specifically embraced by the latter embodiment.
[0042] In one embodiment the compound has the structure
##STR00016##
wherein R.sub.6 is Y.sub.2 and R.sub.8 is Y.sub.3.
[0043] Further according to this embodiment in which R.sub.6 is
Y.sub.2 and R.sub.8 is Y.sub.3, in one embodiment R.sub.3 and
R.sub.7 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further still according
to this embodiment in which R.sub.6 is Y.sub.2 and R.sub.8 is
Y.sub.3, in one embodiment R.sub.3 and R.sub.7 are hydrogen.
Further still according to this embodiment in which R.sub.6 is
Y.sub.2, R.sub.8 is Y.sub.3, and R.sub.3 and R.sub.7 are hydrogen,
in one embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip. Further still according to this embodiment in
which R.sub.6 is Y.sub.2, R.sub.8 is Y.sub.3, R.sub.3 and R.sub.7
are hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0044] In one embodiment the compound has the structure
##STR00017##
wherein R.sub.3 is Y.sub.3 and R.sub.7 is Y.sub.2.
[0045] Further according to this embodiment in which R.sub.3 is
Y.sub.3 and R.sub.7 is Y.sub.2, in one embodiment R.sub.6 and
R.sub.8 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further still according
to this embodiment in which R.sub.3 is Y.sub.3 and R.sub.7 is
Y.sub.2, in one embodiment R.sub.6 and R.sub.8 are hydrogen.
Further still according to this embodiment in which R.sub.3 is
Y.sub.3, R.sub.7 is Y.sub.2, and R.sub.6 and R.sub.8 are hydrogen,
in one embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip. Further still according to this embodiment in
which R.sub.3 is Y.sub.3, R.sub.7 is Y.sub.2, R.sub.6 and R.sub.8
are hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0046] In one embodiment the compound has the structure
##STR00018##
[0047] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.1.
[0048] Further still according to this embodiment in which R.sub.6
is Y.sub.1, in one embodiment R.sub.7 and R.sub.8 are independently
hydrogen, optionally substituted alkyl, optionally substituted
alkoxy, or halide. Further still according to this embodiment in
which R.sub.6 is Y.sub.1, in one embodiment R.sub.7 and R.sub.8 are
hydrogen. Further still according to this embodiment in which
R.sub.6 is Y.sub.1 and R.sub.7 and R.sub.8 are hydrogen, in one
embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.6 is Y.sub.1, R.sub.7 and R.sub.8 are hydrogen, and R.sub.4
is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip, in one
embodiment Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Each and every combination of R.sub.4 and Y.sub.2, as
set forth above, is specifically embraced by the latter
embodiment.
[0049] In one embodiment the compound has the structure
##STR00019##
wherein R.sub.7 is Y.sub.1.
[0050] Further still according to this embodiment in which R.sub.7
is Y.sub.1, in one embodiment R.sub.6 and R.sub.8 are independently
hydrogen, optionally substituted alkyl, optionally substituted
alkoxy, or halide. Further still according to this embodiment in
which R.sub.7 is Y.sub.1, in one embodiment R.sub.6 and R.sub.8 are
hydrogen. Further still according to this embodiment in which
R.sub.7 is Y.sub.1 and R.sub.6 and R.sub.8 are hydrogen, in one
embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.7 is Y.sub.1, R.sub.6 and R.sub.8 are hydrogen, and R.sub.4
is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip, in one
embodiment Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Each and every combination of R.sub.4 and Y.sub.2, as
set forth above, is specifically embraced by the latter
embodiment.
[0051] In one embodiment the compound has the structure
##STR00020##
wherein R.sub.8 is Y.sub.1.
[0052] Further still according to this embodiment in which R.sub.8
is Y.sub.1, in one embodiment R.sub.6 and R.sub.7 are independently
hydrogen, optionally substituted alkyl, optionally substituted
alkoxy, or halide. Further still according to this embodiment in
which R.sub.8 is Y.sub.1, in one embodiment R.sub.6 and R.sub.7 are
hydrogen. Further still according to this embodiment in which
R.sub.8 is Y.sub.1 and R.sub.6 and R.sub.7 are hydrogen, in one
embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.8 is Y.sub.1, R.sub.6 and R.sub.7 are hydrogen, and R.sub.4
is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip, in one
embodiment Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Each and every combination of R.sub.4 and Y.sub.2, as
set forth above, is specifically embraced by the latter
embodiment.
[0053] In one embodiment the compound has the structure
##STR00021##
wherein R.sub.6 is Y.sub.2 and R.sub.8 is Y.sub.3.
[0054] Further still according to this embodiment in which R.sub.6
is Y.sub.2 and R.sub.8 is Y.sub.3, in one embodiment R.sub.7 is
hydrogen, optionally substituted alkyl, optionally substituted
alkoxy, or halide. Further still according to this embodiment in
which R.sub.6 is Y.sub.2 and R.sub.8 is Y.sub.3, in one embodiment
R.sub.7 is hydrogen. Further still according to this embodiment in
which R.sub.6 is Y.sub.2, R.sub.8 is Y.sub.3, and R.sub.7 is
hydrogen, in one embodiment R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip. Further still according to this
embodiment in which R.sub.6 is Y.sub.2, R.sub.8 is Y.sub.3, R.sub.7
is hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0055] In one embodiment the compound has the structure
##STR00022##
[0056] Further according to this embodiment, in one embodiment
R.sub.1 is hydrogen and R.sub.6 is Y.sub.1.
[0057] Further still according to this embodiment in which R.sub.1
is hydrogen and R.sub.6 is Y.sub.1, in one embodiment R.sub.3,
R.sub.7, and R.sub.8 are independently hydrogen, optionally
substituted alkyl, optionally substituted alkoxy, or halide.
Further still according to this embodiment in which R.sub.1 is
hydrogen and R.sub.6 is Y.sub.1, in one embodiment R.sub.3,
R.sub.7, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.1 is hydrogen, R.sub.6 is Y.sub.1, and
R.sub.3, R.sub.7, and R.sub.8 are hydrogen, in one embodiment
R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip.
Further still according to this embodiment in which R.sub.1 is
hydrogen and R.sub.6 is Y.sub.1, R.sub.3, R.sub.7, and R.sub.8 are
hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0058] In one embodiment the compound has the structure
##STR00023##
wherein R.sub.1 is hydrogen and R.sub.7 is Y.sub.1.
[0059] Further still according to this embodiment in which R.sub.1
is hydrogen and R.sub.7 is Y.sub.1, in one embodiment R.sub.3,
R.sub.6, and R.sub.8 are independently hydrogen, optionally
substituted alkyl, optionally substituted alkoxy, or halide.
Further still according to this embodiment in which R.sub.1 is
hydrogen and R.sub.7 is Y.sub.1, in one embodiment R.sub.3,
R.sub.6, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.1 is hydrogen, R.sub.7 is Y.sub.1, and
R.sub.3, R.sub.6, and R.sub.8 are hydrogen, in one embodiment
R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip.
Further still according to this embodiment in which R.sub.1 is
hydrogen and R.sub.7 is Y.sub.1, R.sub.3, R.sub.6, and R.sub.8 are
hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0060] In one embodiment the compound has the structure
##STR00024##
wherein R.sub.1 is hydrogen and R.sub.8 is Y.sub.1.
[0061] Further still according to this embodiment in which R.sub.1
is hydrogen and R.sub.8 is Y.sub.1, in one embodiment R.sub.3,
R.sub.6, and R.sub.7 are independently hydrogen, optionally
substituted alkyl, optionally substituted alkoxy, or halide.
Further still according to this embodiment in which R.sub.1 is
hydrogen and R.sub.8 is Y.sub.1, in one embodiment R.sub.3,
R.sub.6, and R.sub.7 are hydrogen. Further still according to this
embodiment in which R.sub.1 is hydrogen, R.sub.8 is Y.sub.1, and
R.sub.3, R.sub.6, and R.sub.7 are hydrogen, in one embodiment
R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip.
Further still according to this embodiment in which R.sub.1 is
hydrogen and R.sub.8 is Y.sub.1, R.sub.3, R.sub.6, and R.sub.7 are
hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0062] In one embodiment the compound has the structure
##STR00025##
wherein R.sub.1 is hydrogen and R.sub.3 is Y.sub.1.
[0063] Further still according to this embodiment in which R.sub.1
is hydrogen and R.sub.3 is Y.sub.1, in one embodiment R.sub.6,
R.sub.7, and R.sub.8 are independently hydrogen, optionally
substituted alkyl, optionally substituted alkoxy, or halide.
Further still according to this embodiment in which R.sub.1 is
hydrogen and R.sub.3 is Y.sub.1, in one embodiment R.sub.6,
R.sub.7, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.1 is hydrogen, R.sub.3 is Y.sub.1, and
R.sub.6, R.sub.7, and R.sub.8 are hydrogen, in one embodiment
R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip.
Further still according to this embodiment in which R.sub.1 is
hydrogen and R.sub.3 is Y.sub.1, R.sub.6, R.sub.7, and R.sub.8 are
hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0064] In one embodiment the compound has the structure
##STR00026##
wherein R.sub.1 is hydrogen, R.sub.6 is Y.sub.2, and R.sub.8 is
Y.sub.3.
[0065] Further still according to this embodiment in which R.sub.1
is hydrogen, R.sub.6 is Y.sub.2, and R.sub.8 is Y.sub.3, in one
embodiment R.sub.3 and R.sub.7 are independently hydrogen,
optionally substituted alkyl, optionally substituted alkoxy, or
halide. Further still according to this embodiment in which R.sub.1
is hydrogen, R.sub.6 is Y.sub.2, and R.sub.8 is Y.sub.3, in one
embodiment R.sub.3 and R.sub.7 are hydrogen. Further still
according to this embodiment in which R.sub.1 is hydrogen, R.sub.6
is Y.sub.2, R.sub.8 is Y.sub.3, and R.sub.3 and R.sub.7 are
hydrogen, in one embodiment R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip. Further still according to this
embodiment in which R.sub.1 is hydrogen, R.sub.6 is Y.sub.2,
R.sub.8 is Y.sub.3, R.sub.3 and R.sub.7 are hydrogen, and R.sub.4
is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip, in one
embodiment Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Each and every combination of R.sub.4 and Y.sub.2, as
set forth above, is specifically embraced by the latter
embodiment.
[0066] In one embodiment the compound has the structure
##STR00027##
wherein R.sub.1 is hydrogen, R.sub.3 is Y.sub.3, and R.sub.7 is
Y.sub.2.
[0067] Further still according to this embodiment in which R.sub.1
is hydrogen, R.sub.3 is Y.sub.3, and R.sub.7 is Y.sub.2, in one
embodiment R.sub.6 and R.sub.8 are independently hydrogen,
optionally substituted alkyl, optionally substituted alkoxy, or
halide. Further still according to this embodiment in which R.sub.1
is hydrogen, R.sub.3 is Y.sub.3, and R.sub.7 is Y.sub.2, in one
embodiment R.sub.6 and R.sub.8 are hydrogen. Further still
according to this embodiment in which R.sub.1 is hydrogen, R.sub.3
is Y.sub.3, R.sub.7 is Y.sub.2, and R.sub.6 and R.sub.8 are
hydrogen, in one embodiment R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip. Further still according to this
embodiment in which R.sub.1 is hydrogen, R.sub.3 is Y.sub.3,
R.sub.7 is Y.sub.2, R.sub.6 and R.sub.8 are hydrogen, and R.sub.4
is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip, in one
embodiment Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Each and every combination of R.sub.4 and Y.sub.2, as
set forth above, is specifically embraced by the latter
embodiment.
[0068] In one embodiment the compound has the structure
##STR00028##
wherein R.sub.1 is Y.sub.3 and R.sub.7 is Y.sub.2.
[0069] Further still according to this embodiment in which R.sub.1
is Y.sub.3 and R.sub.7 is Y.sub.2, in one embodiment R.sub.3,
R.sub.6, R.sub.7, and R.sub.8 are independently hydrogen,
optionally substituted alkyl, optionally substituted alkoxy, or
halide. Further still according to this embodiment in which R.sub.1
is Y.sub.3 and R.sub.7 is Y.sub.2, in one embodiment R.sub.3,
R.sub.6, R.sub.7, and R.sub.8 are hydrogen. Further still according
to this embodiment in which R.sub.1 is Y.sub.3, R.sub.7 is Y.sub.2,
and R.sub.3, R.sub.6, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.1 is Y.sub.3 and R.sub.7 is Y.sub.2, R.sub.3, R.sub.6,
R.sub.7, and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip, in one embodiment
Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip.
Each and every combination of R.sub.4 and Y.sub.2, as set forth
above, is specifically embraced by the latter embodiment.
[0070] In one embodiment the compound has the structure
##STR00029##
[0071] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.1.
[0072] Further still according to this embodiment in which R.sub.6
is Y.sub.1, in one embodiment R.sub.3, R.sub.7, and R.sub.8 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide. Further still according to this
embodiment in which R.sub.6 is Y.sub.1, in one embodiment R.sub.3,
R.sub.7, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.6 is Y.sub.1 and R.sub.3, R.sub.7, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.6 is Y.sub.1, R.sub.3, R.sub.7,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0073] In one embodiment the compound has the structure
##STR00030##
wherein R.sub.7 is Y.sub.1.
[0074] Further still according to this embodiment in which R.sub.7
is Y.sub.1, in one embodiment R.sub.3, R.sub.6, and R.sub.8 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide. Further still according to this
embodiment in which R.sub.7 is Y.sub.1, in one embodiment R.sub.3,
R.sub.6, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.7 is Y.sub.1, and R.sub.3, R.sub.6, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.7 is Y.sub.1, R.sub.3, R.sub.6,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0075] In one embodiment the compound has the structure
##STR00031##
wherein R.sub.8 is Y.sub.1.
[0076] Further still according to this embodiment in which R.sub.8
is Y.sub.1, in one embodiment R.sub.3, R.sub.6, and R.sub.7 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide. Further still according to, this
embodiment in which R.sub.8 is Y.sub.1, in one embodiment R.sub.3,
R.sub.6, and R.sub.7 are hydrogen. Further still according to this
embodiment in which R.sub.8 is Y.sub.1, and R.sub.3, R.sub.6, and
R.sub.7 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.8 is Y.sub.1, R.sub.3, R.sub.6,
and R.sub.7 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0077] In one embodiment the compound has the structure
##STR00032##
wherein R.sub.3 is Y.sub.1.
[0078] Further still according to this embodiment in which R.sub.3
is Y.sub.1, in one embodiment R.sub.6, R.sub.7, and R.sub.8 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide. Further still according to this
embodiment in which R.sub.3 is Y.sub.1, in one embodiment R.sub.6,
R.sub.7, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.3 is Y.sub.1, and R.sub.6, R.sub.7, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.3 is Y.sub.1, R.sub.6, R.sub.7,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0079] In one embodiment the compound has the structure
##STR00033##
wherein R.sub.6 is Y.sub.2 and R.sub.8 is Y.sub.3.
[0080] Further still according to this embodiment in which R.sub.6
is Y.sub.2 and R.sub.8 is Y.sub.3, in one embodiment R.sub.3 and
R.sub.7 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further still according
to this embodiment in which R.sub.6 is Y.sub.2 and R.sub.8 is
Y.sub.3, in one embodiment R.sub.3 and R.sub.7 are hydrogen.
Further still according to this embodiment in which R.sub.6 is
Y.sub.2, R.sub.8 is Y.sub.3, and R.sub.3 and R.sub.7 are hydrogen,
in one embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip. Further still according to this embodiment in
which R.sub.6 is Y.sub.2 and R.sub.8 is Y.sub.3, R.sub.3 and
R.sub.7 are hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor,
dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0081] In one embodiment the compound has the structure
##STR00034##
wherein R.sub.3 is Y.sub.3 and R.sub.7 is Y.sub.2.
[0082] Further still according to this embodiment in which R.sub.3
is Y.sub.3 and R.sub.7 is Y.sub.2, in one embodiment R.sub.6 and
R.sub.8 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further still according
to this embodiment in which R.sub.3 is Y.sub.3 and R.sub.7 is
Y.sub.2, in one embodiment R.sub.6 and R.sub.8 are hydrogen.
Further still according to this embodiment in which R.sub.3 is
Y.sub.3, R.sub.7 is Y.sub.2, and R.sub.6 and R.sub.8 are hydrogen,
in one embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip. Further still according to this embodiment in
which R.sub.3 is Y.sub.3 and R.sub.7 is Y.sub.2, R.sub.6 and
R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor,
dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0083] In one embodiment the compound has the structure
##STR00035##
[0084] Further still according to this embodiment in which R.sub.6
is Y.sub.1, in one embodiment R.sub.1, R.sub.3, R.sub.7, and
R.sub.8 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further still according
to this embodiment in which R.sub.6 is Y.sub.1, in one embodiment
R.sub.1, R.sub.3, R.sub.7, and R.sub.8 are hydrogen. Further still
according to this embodiment in which R.sub.6 is Y.sub.1 and
R.sub.1, R.sub.3, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.6 is Y.sub.1, R.sub.1, R.sub.3, R.sub.7, and R.sub.8 are
hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0085] In one embodiment the compound has the structure
##STR00036##
wherein R.sub.7 is Y.sub.1.
[0086] Further still according to this embodiment in which R.sub.7
is Y.sub.1, in one embodiment R.sub.1, R.sub.3, R.sub.6, and
R.sub.8 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further still according
to this embodiment in which R.sub.7 is Y.sub.1, in one embodiment
R.sub.1, R.sub.3, R.sub.6, and R.sub.8 are hydrogen. Further still
according to this embodiment in which R.sub.7 is Y.sub.1 and
R.sub.1, R.sub.3, R.sub.6, and R.sub.8 are hydrogen, in one
embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.7 is Y.sub.1, R.sub.1, R.sub.3, R.sub.6, and R.sub.8 are
hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0087] In one embodiment the compound has the structure
##STR00037##
wherein R.sub.8 is Y.sub.1.
[0088] Further still according to this embodiment in which R.sub.3
is Y.sub.1, in one embodiment R.sub.1, R.sub.3, R.sub.6, and
R.sub.7 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further still according
to this embodiment in which R.sub.8 is Y.sub.1, in one embodiment
R.sub.1, R.sub.3, R.sub.6, and R.sub.7 are hydrogen. Further still
according to this embodiment in which R.sub.8 is Y.sub.1 and
R.sub.1, R.sub.3, R.sub.6, and R.sub.7 are hydrogen, in one
embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.8 is Y.sub.1, R.sub.1, R.sub.3, R.sub.6, and R.sub.7 are
hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0089] In one embodiment the compound has the structure
##STR00038##
wherein R.sub.3 is Y.sub.1.
[0090] Further still according to this embodiment in which R.sub.3
is Y.sub.1, in one embodiment R.sub.1, R.sub.6, R.sub.7, and
R.sub.8 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further still according
to this embodiment in which R.sub.3 is Y.sub.1, in one embodiment
R.sub.1, R.sub.6, R.sub.7, and R.sub.8 are hydrogen. Further still
according to this embodiment in which R.sub.3 is Y.sub.1 and
R.sub.1, R.sub.6, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.3 is Y.sub.1, R.sub.1, R.sub.6, R.sub.7, and R.sub.8 are
hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0091] In one embodiment the compound has the structure
##STR00039##
wherein R.sub.6 is Y.sub.2 and R.sub.3 is Y.sub.3.
[0092] Further still according to this embodiment in which R.sub.6
is Y.sub.2 and R.sub.8 is Y.sub.3, in one embodiment R.sub.1,
R.sub.3, and R.sub.7 are independently hydrogen, optionally
substituted alkyl, optionally substituted alkoxy, or halide.
Further still according to this embodiment in which R.sub.6 is
Y.sub.2 and R.sub.8 is Y.sub.3, in one embodiment R.sub.1, R.sub.3,
and R.sub.7 are hydrogen. Further still according to this
embodiment in which R.sub.6 is Y.sub.2, R.sub.8 is Y.sub.3, and
R.sub.1, R.sub.3, and R.sub.7 are hydrogen, in one embodiment
R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip.
Further still according to this embodiment in which R.sub.6 is
Y.sub.2 and R.sub.8 is Y.sub.3, R.sub.1, R.sub.3, and R.sub.7 are
hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0093] In one embodiment the compound has the structure
##STR00040##
wherein R.sub.3 is Y.sub.3 and R.sub.7 is Y.sub.2.
[0094] Further still according to this embodiment in which R.sub.3
is Y.sub.3 and R.sub.7 is Y.sub.2, in one embodiment R.sub.1,
R.sub.6, and R.sub.8 are independently hydrogen, optionally
substituted alkyl, optionally substituted alkoxy, or halide.
Further still according to this embodiment in which R.sub.3 is
Y.sub.3 and R.sub.7 is Y.sub.2, in one embodiment R.sub.1, R.sub.6,
and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.3 is Y.sub.3, R.sub.7 is Y.sub.2, and
R.sub.1, R.sub.6, and R.sub.8 are hydrogen, in one embodiment
R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip.
Further still according to this embodiment in which R.sub.3 is
Y.sub.3 and R.sub.7 is Y.sub.2, R.sub.1, R.sub.6, and R.sub.8 are
hydrogen, and R.sub.4 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip, in one embodiment Y.sub.2 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0095] The invention in one aspect is a compound having a
structure
##STR00041##
wherein
[0096] X.sub.1, X.sub.3, and X.sub.4 are independently nitrogen or
carbon;
[0097] R.sub.3 is absent, hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide;
[0098] R.sub.4 is a group having the structure,
##STR00042##
[0099] where R.sub.9 is hydrogen or optionally substituted alkyl; L
is optionally substituted alkyl; R.sub.10 and R.sub.11 are
independently hydrogen or optionally substituted alkyl; and
together R.sub.10 and R.sub.11 can be joined to form an optionally
substituted heterocycle, or together R.sub.9 and one of R.sub.10 or
R.sub.11 can be joined to form an optionally substituted
heterocycle;
[0100] R.sub.5 is absent, hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide;
[0101] R.sub.6, R.sub.7, and R.sub.8 are independently hydrogen,
optionally substituted alkyl, optionally substituted alkoxy, or
halide; and
[0102] Y.sub.1 is Ar--Y.sub.2, where Ar is optionally substituted
phenyl;
wherein
[0103] Y.sub.2 is W-L.sub.1NR.sub.12R.sub.13, where W is O, S, or
NR.sub.14; L.sub.1 is optionally substituted alkyl; R.sub.12,
R.sub.13, and R.sub.14 are independently hydrogen or optionally
substituted alkyl; and together R.sub.12 and R.sub.13 can be joined
to form an optionally substituted heterocycle, or together R.sub.14
and one of R.sub.12 or R.sub.13 can be joined to form an optionally
substituted heterocycle;
[0104] wherein, when the compound has the structure (IX) wherein
X.sub.3 is nitrogen, X.sub.4 is nitrogen.
[0105] In one embodiment according to this aspect of the invention
at least one of X.sub.1, X.sub.3, and X.sub.4 is nitrogen.
[0106] In one embodiment according to this aspect of the invention
at least two of X.sub.1, X.sub.3, and X.sub.4 are nitrogen.
[0107] In one embodiment according to this aspect of the invention,
R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip,
as disclosed above.
[0108] In one embodiment according to this aspect of the invention
Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip, or
dippip.
[0109] In one embodiment the compound has the structure
##STR00043##
[0110] In one embodiment the compound has the structure
##STR00044##
[0111] Further according to this embodiment, in one embodiment
R.sub.3, R.sub.6, R.sub.7, and R.sub.8 are independently hydrogen,
optionally substituted alkyl, optionally substituted alkoxy, or
halide. Further according to this embodiment, in one embodiment
R.sub.3, R.sub.6, R.sub.7, and R.sub.8 are hydrogen. Further still
according to this embodiment in which R.sub.3, R.sub.6, R.sub.7,
and R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Further still
according to this embodiment in which R.sub.3, R.sub.6, R.sub.7,
and R.sub.8 are hydrogen and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0112] In one embodiment the compound has the structure
##STR00045##
[0113] Further according to this embodiment, in one embodiment
R.sub.3, R.sub.6, R.sub.7, and R.sub.8 are independently hydrogen,
optionally substituted alkyl, optionally substituted alkoxy, or
halide. Further according to this embodiment, in one embodiment
R.sub.3, R.sub.6, R.sub.7, and R.sub.8 are hydrogen. Further still
according to this embodiment in which R.sub.3, R.sub.6, R.sub.7,
and R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Further still
according to this embodiment in which R.sub.3, R.sub.6, R.sub.7,
and R.sub.8 are hydrogen and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0114] The invention in one aspect is a compound having a
structure
##STR00046##
wherein
[0115] X.sub.1, X.sub.3, and X.sub.4 are independently nitrogen or
carbon;
[0116] R.sub.3 is absent, hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide;
[0117] R.sub.4 is a group having the structure,
##STR00047##
[0118] where R.sub.9 is hydrogen or optionally substituted alkyl; L
is optionally substituted alkyl; R.sub.10 and R.sub.11 are
independently hydrogen or optionally substituted alkyl; and
together R.sub.10 and R.sub.11 can be joined to form an optionally
substituted heterocycle, or together R.sub.9 and one of R.sub.10 or
R.sub.11 can be joined to form an optionally substituted
heterocycle;
[0119] R.sub.5 is absent or hydrogen;
[0120] R.sub.6 and R.sub.8 are independently hydrogen, optionally
substituted alkyl, optionally substituted alkoxy, halide, or
Y.sub.3;
[0121] R.sub.7 is hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide; and
[0122] Y.sub.2 is W-L.sub.1NR.sub.12R.sub.13, where W is O, S, or
NR.sub.14; L.sub.1 is optionally substituted alkyl; R.sub.12,
R.sub.13, and R.sub.14 are independently hydrogen or optionally
substituted alkyl; and together R.sub.12 and R.sub.13 can be joined
to form an optionally substituted heterocycle, or together R.sub.14
and one of R.sub.12 or R.sub.13 can be joined to form an optionally
substituted heterocycle;
wherein
[0123] Y.sub.3 is optionally substituted phenyl.
[0124] In one embodiment according to this aspect of the invention
at least one of X.sub.1, X.sub.3, and X.sub.4 is nitrogen.
[0125] In one embodiment according to this aspect of the invention
at least two of X.sub.1, X.sub.3, and X.sub.4 are nitrogen.
[0126] In one embodiment according to this aspect of the invention,
R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip,
as disclosed above.
[0127] In one embodiment according to this aspect of the invention
Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip, or
dippip.
[0128] In one embodiment the compound has the structure
##STR00048##
[0129] In one embodiment the compound has the structure
##STR00049##
[0130] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.3. Further according to this embodiment in which
R.sub.6 is Y.sub.3, in one embodiment R.sub.3, R.sub.7, and R.sub.8
are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which R.sub.6 is Y.sub.3, in one embodiment R.sub.3,
R.sub.7, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.6 is Y.sub.3 and R.sub.3, R.sub.7, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.6 is Y.sub.3, R.sub.3, R.sub.7,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0131] In one embodiment the compound has the structure
##STR00050##
wherein R.sub.8 is Y.sub.3. Further according to this embodiment in
which R.sub.8 is Y.sub.3, in one embodiment R.sub.3, R.sub.6, and
R.sub.7 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which R.sub.8 is Y.sub.3, in one embodiment R.sub.3,
R.sub.6, and R.sub.7 are hydrogen. Further still according to this
embodiment in which R.sub.8 is Y.sub.3 and R.sub.3, R.sub.6, and
R.sub.7 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.8 is Y.sub.3, R.sub.3, R.sub.6,
and R.sub.7 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0132] In one embodiment the compound has the structure
##STR00051##
[0133] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.3. Further according to this embodiment in which
R.sub.6 is Y.sub.3, in one embodiment R.sub.7 and R.sub.8 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide. Further according to this embodiment
in which R.sub.6 is Y.sub.3, in one embodiment R.sub.7 and R.sub.8
are hydrogen. Further still according to this embodiment in which
R.sub.6 is Y.sub.3 and R.sub.7 and R.sub.8 are hydrogen, in one
embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.6 is Y.sub.3, R.sub.7 and R.sub.8 are hydrogen, and R.sub.4
is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip, in one
embodiment Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Each and every combination of R.sub.4 and Y.sub.2, as
set forth above, is specifically embraced by the latter
embodiment.
[0134] In one embodiment the compound has the structure
##STR00052##
wherein R.sub.8 is Y.sub.3. Further according to this embodiment in
which R.sub.8 is Y.sub.3, in one embodiment R.sub.6 and R.sub.7 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide. Further according to this embodiment
in which R.sub.8 is Y.sub.3, in one embodiment R.sub.6 and R.sub.7
are hydrogen. Further still according to this embodiment in which
R.sub.8 is Y.sub.3 and R.sub.6 and R.sub.7 are hydrogen, in one
embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.8 is Y.sub.3, R.sub.6 and R.sub.7 are hydrogen, and R.sub.4
is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip, in one
embodiment Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Each and every combination of R.sub.4 and Y.sub.2, as
set forth above, is specifically embraced by the latter
embodiment.
[0135] In one embodiment the compound has the structure
##STR00053##
[0136] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.3. Further according to this embodiment in which
R.sub.6 is Y.sub.3, in one embodiment R.sub.3, R.sub.7, and R.sub.8
are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which R.sub.6 is Y.sub.3, in one embodiment R.sub.3,
R.sub.7, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.6 is Y.sub.3 and R.sub.3, R.sub.7, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.6 is Y.sub.3, R.sub.3, R.sub.7,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0137] In one embodiment the compound has the structure
##STR00054##
wherein R.sub.8 is Y.sub.3. Further according to this embodiment in
which R.sub.8 is Y.sub.3, in one embodiment R.sub.3, R.sub.6, and
R.sub.7 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which R.sub.8 is Y.sub.3, in one embodiment R.sub.3,
R.sub.6, and R.sub.7 are hydrogen. Further still according to this
embodiment in which R.sub.8 is Y.sub.3 and R.sub.3, R.sub.6, and
R.sub.7 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.8 is Y.sub.3, R.sub.3, R.sub.6,
and R.sub.7 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0138] In one embodiment the compound has the structure
##STR00055##
[0139] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.3. Further according to this embodiment in which
R.sub.6 is Y.sub.3, in one embodiment R.sub.3, R.sub.7, and R.sub.8
are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which R.sub.6 is Y.sub.3, in one embodiment R.sub.3,
R.sub.7, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.6 is Y.sub.3 and R.sub.3, R.sub.7, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.6 is Y.sub.3, R.sub.3, R.sub.7,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0140] In one embodiment the compound has the structure
##STR00056##
wherein R.sub.8 is Y.sub.3. Further according to this embodiment in
which R.sub.8 is Y.sub.3, in one embodiment R.sub.3, R.sub.6, and
R.sub.7 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which R.sub.8 is Y.sub.3, in one embodiment R.sub.3,
R.sub.6, and R.sub.7 are hydrogen. Further still according to this
embodiment in which R.sub.8 is Y.sub.3 and R.sub.3, R.sub.6, and
R.sub.7 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.8 is Y.sub.3, R.sub.3, R.sub.6,
and R.sub.7 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0141] The invention in one aspect is a compound having a
structure
##STR00057##
wherein
[0142] X.sub.1, X.sub.3, and X.sub.4 are independently nitrogen or
carbon;
[0143] R.sub.3 is absent, hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide;
[0144] R.sub.4 is a group having the structure,
##STR00058##
[0145] where R.sub.9 is hydrogen or optionally substituted alkyl; L
is optionally substituted alkyl; R.sub.10 and R.sub.11 are
independently hydrogen or optionally substituted alkyl; and
together R.sub.10 and R.sub.11 can be joined to form an optionally
substituted heterocycle, or together R.sub.9 and one of R.sub.10 or
R.sub.11 can be joined to form an optionally substituted
heterocycle;
[0146] R.sub.5 is absent or hydrogen;
[0147] R.sub.6 and R.sub.7 are independently hydrogen, optionally
substituted alkyl, optionally substituted alkoxy, halide, or
Y.sub.2;
[0148] R.sub.8 is hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide; and
[0149] Y.sub.3 is optionally substituted phenyl;
wherein
[0150] Y.sub.2 is W-L.sub.1NR.sub.12R.sub.13, where W is O, S, or
NR.sub.14; L.sub.1 is optionally substituted alkyl; R.sub.12,
R.sub.13, and R.sub.14 are independently hydrogen or optionally
substituted alkyl; and together R.sub.12 and R.sub.13 can be joined
to form an optionally substituted heterocycle, or together R.sub.14
and one of R.sub.12 or R.sub.13 can be joined to form an optionally
substituted heterocycle.
[0151] In one embodiment according to this aspect of the invention
at least one of X.sub.1, X.sub.3, and X.sub.4 is nitrogen.
[0152] In one embodiment according to this aspect of the invention
at least two of X.sub.1, X.sub.3, and X.sub.4 are nitrogen.
[0153] In one embodiment according to this aspect of the invention,
R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip,
as disclosed above.
[0154] In one embodiment according to this aspect of the invention
Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip, or
dippip.
[0155] In one embodiment the compound has the structure
##STR00059##
[0156] In one embodiment the compound has the structure
##STR00060##
[0157] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.2. Further according to this embodiment in which
R.sub.6 is Y.sub.2, in one embodiment R.sub.3, R.sub.7, and R.sub.8
are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which R.sub.6 is Y.sub.2, in one embodiment R.sub.3,
R.sub.7, and R.sub.3 are hydrogen. Further still according to this
embodiment in which R.sub.6 is Y.sub.2 and R.sub.3, R.sub.7, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.6 is Y.sub.2, R.sub.3, R.sub.7,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0158] In one embodiment the compound has the structure
##STR00061##
wherein R.sub.7 is Y.sub.2. Further according to this embodiment in
which R.sub.7 is Y.sub.2, in one embodiment R.sub.3, R.sub.6, and
R.sub.8 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which R.sub.7 is Y.sub.2, in one embodiment R.sub.3,
R.sub.6, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.7 is Y.sub.2 and R.sub.3, R.sub.6, and
R.sub.3 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.7 is Y.sub.2, R.sub.3, R.sub.6,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0159] In one embodiment the compound has the structure
##STR00062##
[0160] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.2. Further according to this embodiment in which
R.sub.6 is Y.sub.2, in one embodiment R.sub.7 and R.sub.8 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide. Further according to this embodiment
in which R.sub.6 is Y.sub.2, in one embodiment R.sub.7 and R.sub.8
are hydrogen. Further still according to this embodiment in which
R.sub.6 is Y.sub.2 and R.sub.7 and R.sub.8 are hydrogen, in one
embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.6 is Y.sub.2, R.sub.7 and R.sub.8 are hydrogen, and R.sub.4
is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip, in one
embodiment Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Each and every combination of R.sub.4 and Y.sub.2, as
set forth above, is specifically embraced by the latter
embodiment.
[0161] In one embodiment the compound has the structure
##STR00063##
wherein R.sub.7 is Y.sub.2. Further according to this embodiment in
which R.sub.7 is Y.sub.2, in one embodiment R.sub.6 and R.sub.8 are
independently hydrogen, optionally substituted alkyl, optionally
substituted alkoxy, or halide. Further according to this embodiment
in which R.sub.7 is Y.sub.2, in one embodiment R.sub.6 and R.sub.8
are hydrogen. Further still according to this embodiment in which
R.sub.7 is Y.sub.2 and R.sub.6 and R.sub.8 are hydrogen, in one
embodiment R.sub.4 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.7 is Y.sub.2, R.sub.6 and R.sub.8 are hydrogen, and R.sub.4
is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip, in one
embodiment Y.sub.2 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Each and every combination of R.sub.4 and Y.sub.2, as
set forth above, is specifically embraced by the latter
embodiment.
[0162] In one embodiment the compound has the structure
##STR00064##
[0163] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.2. Further according to this embodiment in which
R.sub.6 is Y.sub.2, in one embodiment R.sub.3, R.sub.7, and R.sub.8
are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which R.sub.6 is Y.sub.2, in one embodiment R.sub.3,
R.sub.7, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.6 is Y.sub.2 and R.sub.3, R.sub.7, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.6 is Y.sub.2, R.sub.3, R.sub.7,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0164] In one embodiment the compound has the structure
##STR00065##
wherein R.sub.7 is Y.sub.2. Further according to this embodiment in
which R.sub.7 is Y.sub.2, in one embodiment R.sub.3, R.sub.6, and
R.sub.8 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which R.sub.7 is Y.sub.2, in one embodiment R.sub.3,
R.sub.6, and R.sub.3 are hydrogen. Further still according to this
embodiment in which R.sub.7 is Y.sub.2 and R.sub.3, R.sub.6, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.7 is Y.sub.2, R.sub.3, R.sub.6,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0165] In one embodiment the compound has the structure
##STR00066##
[0166] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.2. Further according to this embodiment in which
R.sub.6 is Y.sub.2, in one embodiment R.sub.3, R.sub.7, and R.sub.8
are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which R.sub.6 is Y.sub.2, in one embodiment R.sub.3,
R.sub.7, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.6 is Y.sub.2 and R.sub.3, R.sub.7, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.6 is Y.sub.2, R.sub.3, R.sub.7,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0167] In one embodiment the compound has the structure
##STR00067##
wherein R.sub.7 is Y.sub.2. Further according to this embodiment in
which R.sub.7 is Y.sub.2, in one embodiment R.sub.3, R.sub.6, and
R.sub.8 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which R.sub.7 is Y.sub.2, in one embodiment R.sub.3,
R.sub.6, and R.sub.8 are hydrogen. Further still according to this
embodiment in which R.sub.7 is Y.sub.2 and R.sub.3, R.sub.6, and
R.sub.8 are hydrogen, in one embodiment R.sub.4 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.7 is Y.sub.2, R.sub.3, R.sub.6,
and R.sub.8 are hydrogen, and R.sub.4 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip, in one embodiment Y.sub.2 is pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.4 and Y.sub.2, as set forth above, is
specifically embraced by the latter embodiment.
[0168] The invention in one aspect is a compound having a
structure
##STR00068##
wherein
[0169] X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are independently
nitrogen or carbon;
[0170] R.sub.1, R.sub.3, and R.sub.5 are independently absent,
hydrogen, optionally substituted alkyl, optionally substituted
alkoxy, or halide;
[0171] R.sub.6 is independently hydrogen, optionally substituted
alkyl, optionally substituted alkoxy, halide, or Y.sub.2;
[0172] R.sub.7, R.sub.8, and R.sub.15 are independently hydrogen,
optionally substituted alkyl, optionally substituted alkoxy, or
halide;
[0173] each Q is independently optionally substituted alkyl or
Y.sub.2; and
[0174] n is an integer from 1-5;
wherein
[0175] Y.sub.2 is W-L.sub.1NR.sub.12R.sub.13, where W is O, S, or
NR.sub.14; L.sub.1 is optionally substituted alkyl; R.sub.12,
R.sub.13, and R.sub.14 are independently hydrogen or optionally
substituted alkyl; and together R.sub.12 and R.sub.13 can be joined
to form an optionally substituted heterocycle, or together R.sub.14
and one of R.sub.12 or R.sub.13 can be joined to form an optionally
substituted heterocycle.
[0176] In one embodiment according to this aspect of the invention,
at least one of X.sub.1, X.sub.2, X.sub.3, and X.sub.4 is
nitrogen.
[0177] In one embodiment according to this aspect of the invention,
at least two of X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are
nitrogen.
[0178] In one embodiment according to this aspect of the invention,
at least one Q is pip, diamine, dipamine, dimor, dipmor, dipip, or
dippip, as disclosed above.
[0179] In one embodiment the compound has the structure
##STR00069##
[0180] In one embodiment the compound has the structure
##STR00070##
[0181] Further according to this embodiment, in one embodiment each
and every Q is Y.sub.2.
[0182] In one embodiment the compound has the structure
##STR00071##
[0183] Further according to this embodiment, in one embodiment
Q.sub.p and Q.sub.o are independently Y.sub.2. Further according to
this embodiment in which Q.sub.p and Q.sub.o are independently
Y.sub.2, in one embodiment R.sub.3, R.sub.15, R.sub.5, R.sub.6,
R.sub.7, and R.sub.8 are independently hydrogen, optionally
substituted alkyl, optionally substituted alkoxy, or halide.
Further according to this embodiment in which Q.sub.p and Q.sub.o
are independently Y.sub.2, in one embodiment R.sub.3, R.sub.15,
R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are hydrogen. Further still
according to this embodiment in which Q.sub.p and Q.sub.o are
independently Y.sub.2 and R.sub.3, R.sub.15, R.sub.5, R.sub.6,
R.sub.7, and R.sub.8 are hydrogen, in one embodiment Q.sub.p is
pip, diamine, dipamine, dimor, dipmor, dipip, or dippip. Further
still according to this embodiment in which Q.sub.p and Q.sub.o are
independently Y.sub.2 and R.sub.3, R.sub.15, R.sub.5, R.sub.6,
R.sub.7, and R.sub.8 are hydrogen, in one embodiment Q.sub.o is
pip, diamine, dipamine, dimor, dipmor, dipip, or dippip. Further
still according to this embodiment in which Q.sub.p and Q.sub.o are
independently Y.sub.2 and R.sub.3, R.sub.15, R.sub.5, R.sub.6,
R.sub.7, and R.sub.8 are hydrogen, in one embodiment Q.sub.p and
Q.sub.o are independently pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip. Each and every combination of Q.sub.p and
Q.sub.o, analogous to each and every combination of R.sub.4 and
Y.sub.2 as set forth above, is specifically embraced by this latter
embodiment.
[0184] In one embodiment the compound has the structure
##STR00072##
[0185] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.2. Further according to this embodiment in which
R.sub.6 is Y.sub.2, in one embodiment Q is independently Y.sub.2.
Further still according to this embodiment in which R.sub.6 is
Y.sub.2 and Q is independently Y.sub.2, in one embodiment R.sub.3,
R.sub.15, R.sub.5, R.sub.7, and R.sub.8 are hydrogen. Further still
according to this embodiment in which R.sub.6 is Y.sub.2, Q is
independently Y.sub.2, and R.sub.3, R.sub.15, R.sub.5, R.sub.7, and
R.sub.8 are hydrogen, in one embodiment R.sub.6 is pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Further still according
to this embodiment in which R.sub.6 is Y.sub.2, Q is independently
Y.sub.2, and R.sub.3, R.sub.15, R.sub.5, R.sub.7, and R.sub.8 are
hydrogen, in one embodiment R.sub.6 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip. Further still according to this
embodiment in which R.sub.6 and Q are independently Y.sub.2, and
R.sub.3, R.sub.15, R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are
hydrogen, in one embodiment R.sub.6 and Q are independently pip,
diamine, dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of R.sub.6 and Q, analogous to each and every
combination of R.sub.4 and Y.sub.2 as set forth above, is
specifically embraced by this latter embodiment.
[0186] In one embodiment the compound has the structure
##STR00073##
[0187] Further according to this embodiment, in one embodiment each
and every Q is Y.sub.2.
[0188] In one embodiment the compound has the structure
##STR00074##
[0189] Further according to this embodiment, in one embodiment
Q.sub.p and Q.sub.o are independently Y.sub.2. Further according to
this embodiment in which Q.sub.p and Q.sub.o are independently
Y.sub.2, in one embodiment R.sub.15, R.sub.5, R.sub.6, R.sub.7, and
R.sub.8 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which Q.sub.p and Q.sub.o are independently Y.sub.2,
in one embodiment R.sub.15, R.sub.5, R.sub.6, R.sub.7, and R.sub.8
are hydrogen. Further still according to this embodiment in which
Q.sub.p and Q.sub.o are independently Y.sub.2 and R.sub.15,
R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment Q.sub.p is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
Q.sub.p and Q.sub.o are independently Y.sub.2 and R.sub.15,
R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment Q.sub.o is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
Q.sub.p and Q.sub.o are independently Y.sub.2 and R.sub.15,
R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment Q.sub.p and Q.sub.o are independently pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of Q.sub.p and Q.sub.o, analogous to each and every
combination of R.sub.4 and Y.sub.2 as set forth above, is
specifically embraced by this latter embodiment.
[0190] In one embodiment the compound has the structure
##STR00075##
[0191] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.2. Further according to this embodiment in which
R.sub.6 is Y.sub.2, in one embodiment Q is independently Y.sub.2.
Further still according to this embodiment in which R.sub.6 is
Y.sub.2 and Q is independently Y.sub.2, in one embodiment R.sub.15,
R.sub.5, R.sub.7, and R.sub.8 are hydrogen. Further still according
to this embodiment in which R.sub.6 is Y.sub.2, Q is independently
Y.sub.2, and R.sub.15, R.sub.5, R.sub.7, and R.sub.8 are hydrogen,
in one embodiment R.sub.6 is pip, diamine, dipamine, dimor, dipmor,
dipip, or dippip. Further still according to this embodiment in
which R.sub.6 is Y.sub.2, Q is independently Y.sub.2, and R.sub.15,
R.sub.5, R.sub.7, and R.sub.8 are hydrogen, in one embodiment
R.sub.6 is pip, diamine, dipamine, dimor, dipmor, dipip, or dippip.
Further still according to this embodiment in which R.sub.6 and Q
are independently Y.sub.2, and R.sub.15, R.sub.5, R.sub.6, R.sub.7,
and R.sub.8 are hydrogen, in one embodiment R.sub.6 and Q are
independently pip, diamine, dipamine, dimor, dipmor, dipip, or
dippip. Each and every combination of R.sub.6 and Q, analogous to
each and every combination of R.sub.4 and Y.sub.2 as set forth
above, is specifically embraced by this latter embodiment.
[0192] In one embodiment the compound has the structure
##STR00076##
[0193] Further according to this embodiment, in one embodiment each
and every Q is Y.sub.2.
[0194] In one embodiment the compound has the structure
##STR00077##
[0195] Further according to this embodiment, in one embodiment
Q.sub.p and Q.sub.o are independently Y.sub.2. Further according to
this embodiment in which Q.sub.p and Q.sub.o are independently
Y.sub.2, in one embodiment R.sub.3, R.sub.15, R.sub.6, R.sub.7, and
R.sub.8 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which Q.sub.p and Q.sub.o are independently Y.sub.2,
in one embodiment R.sub.3, R.sub.15, R.sub.6, R.sub.7, and R.sub.8
are hydrogen. Further still according to this embodiment in which
Q.sub.p and Q.sub.o are independently Y.sub.2 and R.sub.3,
R.sub.15, R.sub.6, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment Q.sub.p is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
Q.sub.p and Q.sub.o are independently Y.sub.2 and R.sub.3,
R.sub.15, R.sub.6, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment Q.sub.o is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
Q.sub.p and Q.sub.o are independently Y.sub.2 and R.sub.15,
R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment Q.sub.p and Q.sub.o are independently pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of Q.sub.p and Q.sub.o, analogous to each and every
combination of R.sub.4 and Y.sub.2 as set forth above, is
specifically embraced by this latter embodiment.
[0196] In one embodiment the compound has the structure
##STR00078##
[0197] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.2. Further according to this embodiment in which
R.sub.6 is Y.sub.2, in one embodiment Q is independently Y.sub.2.
Further still according to this embodiment in which R.sub.6 is
Y.sub.2 and Q is independently Y.sub.2, in one embodiment R.sub.3,
R.sub.15, R.sub.7, and R.sub.8 are hydrogen. Further still
according to this embodiment in which R.sub.6 is Y.sub.2, Q is
independently Y.sub.2, and R.sub.3, R.sub.15, R.sub.7, and R.sub.8
are hydrogen, in one embodiment R.sub.6 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip. Further still according to this
embodiment in which R.sub.6 is Y.sub.2, Q is independently Y.sub.2,
and R.sub.3, R.sub.15, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment R.sub.6 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.6 and Q are independently Y.sub.2, and R.sub.3, R.sub.15,
R.sub.7, and R.sub.8 are hydrogen, in one embodiment R.sub.6 and Q
are independently pip, diamine, dipamine, dimor, dipmor, dipip, or
dippip. Each and every combination of R.sub.6 and Q, analogous to
each and every combination of R.sub.4 and Y.sub.2 as set forth
above, is specifically embraced by this latter embodiment.
[0198] In one embodiment the compound has the structure
##STR00079##
[0199] Further according to this embodiment, in one embodiment each
and every Q is Y.sub.2.
[0200] In one embodiment the compound has the structure
##STR00080##
[0201] Further according to this embodiment, in one embodiment
Q.sub.p and Q.sub.o are independently Y.sub.2. Further according to
this embodiment in which Q.sub.p and Q.sub.o are independently
Y.sub.2, in one embodiment R.sub.3, R.sub.15, R.sub.6, R.sub.7, and
R.sub.8 are independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, or halide. Further according to this
embodiment in which Q.sub.p and Q.sub.o are independently Y.sub.2,
in one embodiment R.sub.3, R.sub.15, R.sub.6, R.sub.7, and R.sub.8
are hydrogen. Further still according to this embodiment in which
Q.sub.p and Q.sub.o are independently Y.sub.2 and R.sub.3,
R.sub.15, R.sub.6, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment Q.sub.p is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
Q.sub.p and Q.sub.o are independently Y.sub.2 and R.sub.3,
R.sub.15, R.sub.6, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment Q.sub.o is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
Q.sub.p and Q.sub.o are independently Y.sub.2 and R.sub.15,
R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment Q.sub.p and Q.sub.o are independently pip, diamine,
dipamine, dimor, dipmor, dipip, or dippip. Each and every
combination of Q.sub.p and Q.sub.o, analogous to each and every
combination of R.sub.4 and Y.sub.2 as set forth above, is
specifically embraced by this latter embodiment.
[0202] In one embodiment the compound has the structure
##STR00081##
[0203] Further according to this embodiment, in one embodiment
R.sub.6 is Y.sub.2. Further according to this embodiment in which
R.sub.6 is Y.sub.2, in one embodiment Q is independently Y.sub.2.
Further still according to this embodiment in which R.sub.6 is
Y.sub.2 and Q is independently Y.sub.2, in one embodiment R.sub.3,
R.sub.15, R.sub.7, and R.sub.8 are hydrogen. Further still
according to this embodiment in which R.sub.6 is Y.sub.2, Q is
independently Y.sub.2, and R.sub.3, R.sub.15, R.sub.7, and R.sub.8
are hydrogen, in one embodiment R.sub.6 is pip, diamine, dipamine,
dimor, dipmor, dipip, or dippip. Further still according to this
embodiment in which R.sub.6 is Y.sub.2, Q is independently Y.sub.2,
and R.sub.3, R.sub.15, R.sub.7, and R.sub.8 are hydrogen, in one
embodiment R.sub.6 is pip, diamine, dipamine, dimor, dipmor, dipip,
or dippip. Further still according to this embodiment in which
R.sub.6 and Q are independently Y.sub.2, and R.sub.3, R.sub.15,
R.sub.7, and R.sub.8 are hydrogen, in one embodiment R.sub.6 and Q
are independently pip, diamine, dipamine, dimor, dipmor, dipip, or
dippip. Each and every combination of R.sub.6 and Q, analogous to
each and every combination of R.sub.4 and Y.sub.2 as set forth
above, is specifically embraced by this latter embodiment.
[0204] In one aspect the invention is a pharmaceutical composition.
The pharmaceutical composition includes at least one compound of
the invention, or a pharmaceutically acceptable salt of at least
one compound of the invention, and a pharmaceutically acceptable
carrier. In one embodiment the pharmaceutical composition is
formulated for oral administration. In one embodiment the
pharmaceutical composition is formulated for parenteral
administration.
[0205] In one aspect the invention is a method for reducing
signaling by a Toll-like receptor (TLR). The method according to
this aspect of the invention includes the step of contacting a cell
expressing a TLR, selected from TLR7, TLR8, and TLR9, with an
effective amount of a composition of the invention to reduce
signaling by the TLR in response to an agonist of the TLR, compared
to signaling by the TLR in response to the agonist in absence of
the contacting.
[0206] In one embodiment the TLR is TLR7. In one embodiment the TLR
is TLR8. In one embodiment the TLR is TLR9. In one embodiment the
TLR is a human TLR.
[0207] In one embodiment the agonist of the TLR is a CpG nucleic
acid. In one embodiment the agonist of the TLR is RNA.
[0208] In one embodiment the contacting occurs in vitro.
[0209] In one embodiment the cell expressing the TLR is an immune
cell. In one embodiment the cell expressing the TLR is a cell that
is modified to express the TLR.
[0210] In one aspect the invention is a method for reducing an
immune response. The method according to this aspect of the
invention includes the step of contacting a population of immune
cells expressing a Toll-like receptor (TLR), selected from TLR7,
TLR8, and TLR9, with an effective amount of a composition of the
invention to reduce an immune response by the immune cells,
compared to an immune response by the immune cells in absence of
the contacting.
[0211] In one embodiment the TLR is TLR7. In one embodiment the TLR
is TLR8. In one embodiment the TLR is TLR9. In one embodiment the
TLR is a human TLR.
[0212] In one embodiment the contacting occurs in vitro. In one
embodiment the contacting occurs in vivo.
[0213] In one embodiment the immune response is a Th1-like immune
response. In one embodiment the immune response is secretion of a
cytokine. In one embodiment the immune response is secretion of a
chemokine.
[0214] In one embodiment the immune response is an immune response
to an antigen. In one embodiment the antigen is an allergen. In one
embodiment the antigen is a microbial antigen. In one embodiment
the antigen is an antigen characteristic of an autoimmune
condition.
[0215] In one aspect the invention is a method for treating an
autoimmune condition in a subject. The method includes the step of
administering to a subject having an autoimmune condition, wherein
the autoimmune condition involves signaling by a Toll-like receptor
(TLR) selected from TLR7, TLR8, and TLR9, an effective amount of a
composition of the invention to treat the autoimmune condition.
[0216] In one embodiment the TLR is TLR7. In one embodiment the TLR
is TLR8. In one embodiment the TLR is TLR9. In one embodiment the
TLR is a human TLR.
[0217] In one embodiment the autoimmune condition is selected from
ankylosing spondylitis, atherosclerosis, autoimmune chronic active
hepatitis, autoimmune encephalomyelitis, auto immune hemolytic
anemia, autoimmune thrombocytopenic purpura, autoimmune-associated
infertility, Behcet's syndrome, bullous pemphigoid, Churg-Strauss
disease, Crohn's disease, glomerulonephritis, Goodpasture's
syndrome, Grave's disease, Guillain-Barre syndrome, Hashimoto's
thyroiditis, idiopathic Addison's disease, insulin-dependent
diabetes mellitus, insulin resistance, mixed connective tissue
disease, multiple sclerosis, myasthenia gravis, pemphigus,
pernicious anemia, polyarteritis nodosa, polymyositis, primary
biliary sclerosis, psoriasis, rheumatoid arthritis, sarcoidosis,
scleroderma, sclerosing cholangitis, Sjogren's syndrome, systemic
lupus erythematosus, Takayasu's arteritis, temporal arteritis,
ulcerative colitis, and Wegener's granulomatosis.
[0218] In one embodiment the autoimmune condition is systemic lupus
erythematosus.
[0219] In one embodiment the autoimmune condition is rheumatoid
arthritis.
[0220] In one embodiment the subject is a human.
[0221] Each of the limitations of the invention can encompass
various embodiments of the invention. It is, therefore, anticipated
that each of the limitations of the invention involving any one
element or combinations of elements can be included in each aspect
of the invention. This invention is not limited in its application
to the details of construction and the arrangement of components
set forth in the following description or illustrated in the
drawings. The invention is capable of other embodiments and of
being practiced or of being carried out in various ways. Also, the
phraseology and terminology used herein is for the purpose of
description and should not be regarded as limiting. The use of
"including," "comprising," or "having," "containing", "involving",
and variations thereof herein, is meant to encompass the items
listed thereafter and equivalents thereof as well as additional
items.
DETAILED DESCRIPTION OF THE INVENTION
[0222] The invention is based at least in part on the discovery by
the inventors of certain small molecules that can inhibit signaling
by Toll-like receptors (TLRs) and so inhibit an immune response.
The compositions and methods of the invention can be used to
inhibit immune responses, e.g., unwanted immune responses such as
are involved in a variety of conditions and diseases characterized
by antigen-specific or antigen-nonspecific immune responses. Such
conditions and diseases include, without limitation, autoimmune
disorders, inflammation, and transplant rejection. Thus the
invention relates at least in part to novel compositions and
methods for their use in the treatment of diseases and disorders
characterized by unwanted immune responses, including autoimmune
disorders, inflammation, and transplant rejection.
[0223] Significantly, the compositions and methods of the invention
can be used either with or without knowledge of the particular
antigen or antigens that may be involved in an immune response. The
compounds discovered according to the invention are inhibitors of
one or more so-called pattern recognition receptors (PRRs) that
signal immune cells in response to their interaction with
particular nucleic acid molecules. Alternatively or in addition,
the compounds discovered according to the invention are inhibitors
of one or more so-called pattern recognition receptors (PRRs) that
signal immune cells in response to their interaction with nucleic
acid molecule-containing complexes, e.g., certain immune complexes.
Of particular interest in connection with the instant invention are
TLR7, TLR8, and TLR9, PRRs for certain nucleic acid molecules.
[0224] TLR7 interacts with single- and double-stranded RNA in a
sequence-dependent manner, as well as with the imidazoquinolines
imiquimod (R837) and resiquimod (R848). Heil F et al. (2004)
Science 303:1526-9. In humans TLR7 is expressed in B cells and both
myeloid dendritic cells (mDC) and plasmacytoid dendritic cells
(pDC). In mice TLR7 is expressed in pDC.
[0225] TLR8 interacts with single-stranded RNA in a
sequence-dependent manner, as well as with the imidazoquinolines
imiquimod (R837) and resiquimod (R848). Heil F et al. (2004)
Science 303:1526-9. In humans TLR8 is expressed in myeloid cells,
but TLR8 is not expressed in mice.
[0226] TLR9 interacts with DNA containing CpG motifs that include
unmethylated 5' cytosine-guanine 3' (CG) dinucleotides occurring
within a the context of certain short flanking nucleotide
sequences. Hemmi H et al. (2000) Nature 408:740-5. In humans TLR9
is expressed in B cells and pDC. In mice, TLR9 is expressed in B
cells, pDC, and mDC.
[0227] As used herein, the term "CpG DNA" refers to an
immunostimulatory nucleic acid which contains a cytosine-guanine
(CG) dinucleotide, the C residue of which is unmethylated. The
effects of CpG nucleic acids on immune modulation have been
described extensively in U.S. patents such as U.S. Pat. Nos.
6,194,388; 6,207,646; 6,239,116; and 6,218,371, and published
international patent applications, such as WO98/37919, WO98/40100,
WO98/52581, and WO99/56755. The entire contents of each of these
patents and published patent applications is hereby incorporated by
reference. The entire immunostimulatory nucleic acid can be
unmethylated or portions may be unmethylated but at least the C of
the 5'-CG-3' must be unmethylated.
[0228] CpG DNA includes both naturally occurring immunostimulatory
nucleic acids, as found in bacterial DNA and plasmids, as well as
synthetic oligodeoxynucleotides (ODN).
[0229] In one embodiment the CpG DNA is a CpG ODN that has a base
sequence provided by 5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (ODN 2006; SEQ
ID NO:1).
[0230] CpG ODN have been further classified by structure and
function into at least the following three classes or types, all of
which are intended to be encompassed within the term CpG DNA as
used herein: B-class CpG ODN such as ODN 2006 include the
originally described immunostimulatory CpG ODN and
characteristically activate B cells and NK cells but do not induce
or only weakly induce expression of type I interferon (e.g.,
IFN-.alpha.). A-class CpG ODN, described in published PCT
international application WO 01/22990, incorporate a CpG motif,
include a chimeric phosphodiester/phosphorothioate backbone, and
characteristically activate NK cells and induce plasmacytoid
dendritic cells to express large amounts of IFN-.alpha. but do not
activate or only weakly activate B cells. An example of an A-class
CpG ODN is 5'-G*G*G_G_G_A_C_G_A_T_C_G_T_C_G*G*G*G*G*G-3' (ODN 2216,
SEQ ID NO:2), wherein "*" represents phosphorothioate and "_"
represents phosphodiester. C-class CpG ODN incorporate a CpG,
include a wholly phosphorothioate backbone, include a GC-rich
palindromic or nearly-palindromic region, and are capable of both
activating B cells and inducing expression of IFN-.alpha.. C-class
CpG ODN have been described, for example, in published U.S. patent
application 2003/0148976. An example of a C-class CpG ODN is
5'-TCGTCGTTTTCGGCGCGCGCCG-3' (ODN 2395; SEQ ID NO:3). For a review
of the various classes of CpG ODN, see also Vollmer J et al. (2004)
Eur J Immunol 34:251-62.
[0231] TLR7, TLR8, and TLR9 are characteristically expressed in
endosomes of these particular classes of immune cells, and they are
known to be inhibited by certain compounds, including in particular
chloroquine and derivatives thereof, that are concentrated in
endosomes.
[0232] A number of publications have described small molecule
inhibitors of TLR9. These include U.S. Pat. Nos. 6,221,882,
6,399,630, 6,479,504, 6,521,637, and US Patent Application
Publication Nos. 2003-0232856 and 2005-0119273, the entire contents
of which are incorporated herein by reference. The inhibitor
molecules disclosed in these patents and published patent
applications include certain 4-aminoquinolines, 9-aminoacridines,
4-aminoquinazolines, and others, all of which are to be
distinguished from the compositions disclosed herein.
[0233] The instant invention is based in part on the use of
molecular modeling to perform a systematic study of predicted
inhibitory activities of two-ringed core compounds substituted with
any of a number of particular side group substituents. The modeling
method provides a quantitative prediction of IC.sub.50 for a given
compound, that is, the concentration required for half-maximal
inhibition of immunostimulation induced by a stimulatory amount or
concentration of suitable agonist. In one embodiment the IC.sub.50
is the concentration required for half-maximal inhibition of
immunostimulation induced by EC.sub.50 of suitable agonist, e.g.,
CpG DNA for TLR9. The EC.sub.50 of an agonist is the concentration
of agonist required for half-maximal stimulation by that agonist. A
typical EC.sub.50 value for CpG DNA in respect of TLR9 is about 1
.mu.M. In general, compounds with lower IC.sub.50 values are
preferred over compounds with higher IC.sub.50 values. Predicted
IC.sub.50 values for many compounds of interest typically fall
within the range of less than 1 nM to about 2000 nM. Many compounds
of interest have predicted IC.sub.50 values of less than or equal
to about 500 nM, including, more particularly, those with predicted
IC.sub.50 values of less than or equal to about 100 nM. As
disclosed in the examples herein, many compounds of particular
interest have predicted IC.sub.50 values of less than or equal to
about 50 nM. Also as disclosed in the examples herein, many
compounds of particular interest have predicted IC.sub.50 values of
less than or equal to about 30 nM. At least some compounds of
particular interest have predicted IC.sub.50 values of less than or
equal to about 1 nM.
[0234] Compounds identified by their predicted IC.sub.50 values can
be evaluated for their potential as immunoinhibitory compounds and
therapeutic agents. As disclosed herein, a candidate compound can
be selected on the basis of its predicted IC.sub.50 value and
tested in vitro to determine a corresponding actual in vitro
IC.sub.50 value. Similarly, a candidate compound can be selected on
the basis of its predicted IC.sub.50 value and tested in vivo to
determine a corresponding actual in vivo IC.sub.50 value. Compounds
with lower predicted IC.sub.50 values can be selected for in vitro
and in vivo evaluation ahead of other compounds with higher
predicted IC.sub.50 values. Generally compounds with lower actual
IC.sub.50 values can be selected for further evaluation and
development. Additional factors such as toxicity and solubility may
be assessed in order to help select particular compounds for
further development.
[0235] Particularly for clinical use, the invention embraces both
the compounds alone as disclosed herein, as well as
pharmaceutically acceptable salts thereof. The compounds of the
invention, including pharmaceutically acceptable salts thereof, can
be placed in pharmaceutically acceptable carriers to make
pharmaceutical compositions. The compounds and compositions of the
invention optionally can in addition be used or presented in
combination with at least one other pharmaceutically active
agent.
[0236] Also embraced by the instant invention are stereoisomers of
the compounds as disclosed herein.
[0237] Compounds of the invention generally have certain core
structures characterized by a two-ringed system, variously and
optionally substituted in specified positions with particular
substituents, as disclosed herein as structural formulas I-XXXVII.
In addition to those compounds disclosed on the basis of their
broader structural formulas and descriptions, nonlimiting
embodiments of specific compounds according to the invention are
disclosed in the examples below.
[0238] As used herein, the term "alkyl" is recognized in the art
and may include saturated aliphatic groups, including
straight-chain alkyl groups, branched-chain alkyl groups,
cycloalkyl (alicyclic) groups, alkyl substituted cycloalkyl groups,
and cycloalkyl substituted alkyl groups. In certain embodiments, a
straight chain or branched chain alkyl has about 30 or fewer carbon
atoms in its backbone (e.g., C.sub.1-C.sub.30 for straight chain,
C.sub.3-C.sub.30 for branched chain), and alternatively, about 20
or fewer. Likewise, cycloalkyls have from about 3 to about 10
carbon atoms in their ring structure, and alternatively about 5, 6
or 7 carbons in the ring structure. Examples of alkyl groups
include methyl, ethyl, propyl, isopropyl, butyl, isobutyl,
tert-butyl, cyclopentyl, cyclohexyl, and the like.
[0239] As used herein, the term "alkoxy" shall refer to the group
--O-alkyl.
[0240] As used herein, the term "halide" is given its ordinary
meaning in the art and shall refer to a fluorine, chlorine,
bromine, or iodine atom.
[0241] As used herein, the term "heterocycle" is recognized in the
art and shall refer to 3- to about 10-membered ring structures,
such as 3- to about 7-membered rings, whose ring structures include
one to four heteroatoms. Heterocycles may also be polycycles.
Examples of heterocyclyl groups include, for example, thiophene,
thianthrene, furan, pyran, isobenzofuran, chromene, xanthene,
phenoxathin, pyrrole, imidazole, pyrazole, isothiazole, isoxazole,
pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindole,
indole, indazole, purine, quinolizine, isoquinoline, quinoline,
phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline,
pteridine, carbazole, carboline, phenanthridine, acridine,
pyrimidine, phenanthroline, phenazine, phenarsazine, phenothiazine,
furazan, phenoxazine, pyrrolidine, oxolane, thiolane, oxazole,
piperidine, piperazine, morpholine, lactones, lactams such as
azetidinones and pyrrolidinones, sultams, sultones, and the
like.
[0242] As used herein, the term "substituted" is contemplated to
include all permissible substituents of organic compounds,
"permissible" being in the context of the chemical rules of valence
known to those of ordinary skill in the art. In some cases,
"substituted" may generally refer to replacement of a hydrogen with
a substituent as described herein. In a broad aspect, the
permissible substituents include acyclic and cyclic, branched and
unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic
substituents of organic compounds. Illustrative substituents
include, for example, include those described herein. The
permissible substituents can be one or more and the same or
different for appropriate organic compounds. For purposes of this
invention, the heteroatoms such as nitrogen may have hydrogen
substituents and/or any permissible substituents of organic
compounds described herein which satisfy the valencies of the
heteroatoms. This invention is not intended to be limited in any
manner by the permissible substituents of organic compounds.
Examples of substituents include, but are not limited to, lower
alkyl, lower aryl, lower aralkyl, lower cyclic alkyl, lower
heterocycloalkyl, hydroxy, lower alkoxy, lower aryloxy,
perhaloalkoxy, aralkoxy, lower heteroaryl, lower heteroaryloxy,
lower heteroarylalkyl, lower heteroaralkoxy, azido, amino, halogen,
lower alkylthio, oxo, lower acylalkyl, lower carboxy esters,
carboxyl, -carboxamido, nitro, lower acyloxy, lower aminoalkyl,
lower alkylaminoaryl, lower alkylaryl, lower alkylaminoalkyl, lower
alkoxyaryl, lower arylamino, lower aralkylamino, lower
alkylsulfonyl, lower-carboxamidoalkylaryl, lower-carboxamidoaryl,
lower hydroxyalkyl, lower haloalkyl, lower alkylaminoalkylcarboxy-,
lower aminocarboxamidoalkyl-, cyano, lower alkoxyalkyl, lower
perhaloalkyl, lower arylalkyloxyalkyl, and the like.
[0243] As used herein, the term "optionally substituted", as used
in reference to a particular class of chemical substituent, shall
refer both to the unsubstituted form of the substituent and to a
substituted form of the substituent. For example, the phrase
"optionally substituted alkyl" refers both to alkyl and to
substituted alkyl.
[0244] As used herein, the terms "nitrogen" and, equivalently, "N",
refer to a nitrogen atom.
[0245] As used herein, the terms "oxygen" and, equivalently, "O",
refer to an oxygen atom.
[0246] As used herein, the terms "hydrogen" and, equivalently, "H",
refer to a hydrogen atom.
[0247] The invention in one aspect relates to a method for reducing
signaling by a TLR selected from TLR7, TLR8, and TLR9. Each of
these TLRs induces one or more intracellular signaling pathways as
a consequence of interaction with a suitable agonist, e.g., a
natural ligand. The signaling normally leads eventually to
activation of at least one gene or at least one protein. In one
embodiment a protein activated by a TLR signaling pathway is
NF-.kappa.B. Activated NF-.kappa.B is a ubiquitous transcription
factor that binds to promoters of a variety of genes involved in
immune cell activation, thereby stimulating transcription of these
genes.
[0248] In addition to its ability to stimulate expression of
endogenous genes, activated NF-.kappa.B can also stimulate
expression of suitable NF-.kappa.B-sensitive exogenous genes such
as reporter constructs well known in the art and described herein.
A common NF-.kappa.B-sensitive reporter construct is based on a
luciferase gene placed under the control of an
NF-.kappa.B-sensitive promoter. When introduced into a suitable
host cell, and in the presence of activated NF-.kappa.B, this
reporter construct directs the expression in the cell of
luciferase, a luminescent protein that can be conveniently and
quantitatively assayed by measurement, at an appropriate
wavelength, of light emitted by the expressed luciferase protein.
Thus signaling by a TLR selected from TLR7, TLR8, and TLR9 can be
measured, for example, by measuring NF-.kappa.B activation, either
directly or indirectly, such as through measurement of an expressed
product of an NF-.kappa.B-driven endogenous gene or
NF-.kappa.B-driven reporter (e.g., luciferase).
[0249] The method results in a reduced level of signaling by the
TLR in response to an agonist of the TLR as compared to a control
level of signaling by the TLR in response to the agonist of the
TLR. A control level of signaling is that level of signaling in
response to the agonist of the TLR that occurs in absence of
contacting a cell expressing the TLR with a compound or composition
of the invention. For purposes of comparing treatment and control
amounts of signaling, conditions are generally selected such that
the number or concentration of TLR-expressing cells, the amount or
concentration of the TLR agonist, temperature, and other such
variables are identical or at least comparable between treatment
and control measurements, so as to isolate the effect of the
composition of the invention. Treatment and control measurements
can be made in parallel or they can be made independently. For
example, in one embodiment the control is a historical control. In
one embodiment the control is a concurrent, parallel control.
[0250] Signaling is reduced whenever it is measurably less than a
corresponding control amount of signaling. In various separate
embodiments the reduced signaling is at least 5 percent, at least
10 percent, at least 15 percent, at least 20 percent, at least 25
percent, at least 30 percent, at least 40 percent, and at least 50
percent less than control. In other words, in various separate
embodiments the reduced signaling is less than or equal to 95
percent, less than or equal to 90 percent, less than or equal to 85
percent, less than or equal to 80 percent, less than or equal to 75
percent, less than or equal to 70 percent, less than or equal to 60
percent, and less than or equal to 50 percent of control.
[0251] The method involves contacting a cell expressing the TLR, or
a population of cells expressing the TLR, with a compound or
composition of the invention. As used herein, a "cell expressing a
TLR" refers to any cell which expresses, either naturally or
artificially, a functional TLR. A functional TLR is a full-length
TLR protein or a fragment thereof capable of inducing a signal in
response to interaction with its ligand. Generally the functional
TLR will include at least a TLR ligand-binding fragment of the
extracellular domain of the full-length TLR and at least a fragment
of a TIR domain capable of interacting with another Toll homology
domain-containing polypeptide, e.g., MyD88. In various embodiments
the functional TLR is a full-length TLR selected from TLR7, TLR8,
and TLR9.
[0252] In one embodiment a cell expressing the TLR is a cell that
naturally expressed the TLR.
[0253] In one embodiment a cell that naturally expresses TLR9 is a
cell from human multiple myeloma cell line RPMI 8226 (ATCC CCL-155,
American Type Culture Collection, Manassas, Va.). This cell line
was established from the peripheral blood of a 61-year-old man at
the time of diagnosis of multiple myeloma (IgG lambda type).
Matsuoka Y et al. (1967) Proc Soc Exp Biol Med 125:1246-50. RPMI
8226 was previously reported as responsive to CpG nucleic acids as
evidenced by the induction of IL-6 protein and IL-12p40 mRNA.
Takeshita F et al. (2000) Eur J Immunol 30:108-16; Takeshita F et
al. (2000) Eur J Immunol 30:1967-76. Takeshita et al. used the cell
line solely to study promoter constructs in order to identify
transcription factor binding sites important for CpG nucleic acid
signaling. It is now known that RPMI 8226 cells secrete a number of
other chemokines and cytokines including IL-8, IL-10 and IP-10 in
response to immunostimulatory nucleic acids. Because this cell line
expresses TLR9, through which immunostimulatory nucleic acids such
as for example CpG nucleic acids mediate their effects, it is a
suitable cell line for use in the methods of the invention relating
to reducing signaling by human TLR9.
[0254] Similar to peripheral blood mononuclear cells (PBMCs), the
RPMI 8226 cell line has been observed to upregulate its cell
surface expression of markers such as CD71, CD86 and HLA-DR in
response to CpG nucleic acid exposure. This has been observed by
flow cytometric analysis of the cell line. Accordingly, the methods
provided herein can be structured to use appropriately selected
cell surface marker expression as a readout, in addition to or in
place of chemokine or cytokine production or other readouts
described elsewhere herein.
[0255] The RPMI 8226 cell line has also been found to respond to
certain small molecules including imidazoquinoline compounds. For
example, incubation of RPMI 8226 cells with the imidazoquinoline
compound R848 (resiquimod) induces IL-8, IL-10, and IP-10
production. It has recently been reported that R848 mediates its
immunostimulatory effects through TLR7 and TLR8. The ability of
RPMI 8226 to respond to R848 suggests that the RPMI 8226 cell line
also expresses TLR7, as previously reported for normal human B
cells.
[0256] The RPMI cell line can be used in unmodified form or in a
modified form. In one embodiment, the RPMI 8226 cell is transfected
with a reporter construct. Preferably, the cell is stably
transfected with the reporter construct. The reporter construct
generally includes a promoter, a coding sequence and a
polyadenylation signal. The coding sequence can include a reporter
sequence selected from the group consisting of an enzyme (e.g.,
luciferase, alkaline phosphatase, beta-galactosidase,
chloramphenicol acetyltransferase (CAT), secreted alkaline
phosphatase, etc.), a bioluminescence marker (e.g., green
fluorescent protein (GFP, U.S. Pat. No. 5,491,084), etc.), a
surface-expressed molecule (e.g., CD25), a secreted molecule (e.g.,
IL-8, IL-12 p40, TNF-.alpha., etc.), and other detectable protein
products known to those of skill in the art. Preferably, the coding
sequence encodes a protein having a level or an activity that is
quantifiable.
[0257] In certain embodiments the TLR is artificially expressed
(including over-expressed) by a cell, for example by introduction
into the cell of an expression vector bearing a coding sequence for
the TLR wherein the coding sequence is operably linked to a gene
expression sequence. As used herein, a coding sequence and a gene
expression sequence are said to be operably linked when they are
covalently linked in such a way as to place the expression or
transcription and/or translation of the coding sequence under the
influence or control of the gene expression sequence. Two DNA
sequences are said to be operably linked if induction of a promoter
in the 5' gene expression sequence results in the transcription of
the coding sequence and if the nature of the linkage between the
two DNA sequences does not (1) result in the introduction of a
frame-shift mutation, (2) interfere with the ability of the
promoter region to direct the transcription of the coding sequence,
or (3) interfere with the ability of the corresponding RNA
transcript to be translated into a protein. Thus, a gene expression
sequence would be operably linked to a coding sequence if the gene
expression sequence were capable of effecting transcription of that
coding sequence such that the resulting transcript is translated
into the desired protein or polypeptide.
[0258] As noted above, in one embodiment a coding sequence includes
a coding sequence for a TLR. In another embodiment a coding
sequence includes a coding sequence for a reporter, e.g.
luciferase.
[0259] A cell that artificially expresses a TLR can be a cell that
does not express the TLR but for the TLR expression vector. For
example, human 293 fibroblasts (ATCC CRL-1573) do not express TLR7,
TLR8, or TLR9. Such cells can be transiently or stably transfected
with a suitable expression vector (or vectors) so as to yield cells
that express TLR7, TLR8, TLR9, or any combination thereof.
Alternatively, a cell that artificially expresses a TLR can be a
cell that expresses the TLR at a significantly higher level with
the TLR expression vector than it does without the TLR expression
vector.
[0260] Coding sequences for various TLRs of various species are
known in the art and are available from public databases. For
example, complementary DNA (cDNA) sequences for human and murine
TLR7, TLR8, and TLR9 are all available from GenBank. These cDNA
sequences and GenBank entries include and further specify coding
sequences for each TLR.
[0261] In one embodiment a coding sequence for human TLR7 is
provided as nucleotides 140-3289 in GenBank Accession No.
NM.sub.--016562. In one embodiment a coding sequence for murine
TLR7 is provided as nucleotides 49-3201 of GenBank Accession No.
AY035889.
[0262] In one embodiment a coding sequence for human TLR8 is
provided as nucleotides 49-3174 in GenBank Accession No. AF245703.
In one embodiment a coding sequence for murine TLR8 is provided as
nucleotides 59-3157 of GenBank Accession No. AY035890.
[0263] In one embodiment a coding sequence for human TLR9 is
provided as nucleotides 145-3243 in GenBank Accession No. AF245704.
In one embodiment a coding sequence for murine TLR9 is provided as
nucleotides 40-3138 of GenBank Accession No. AF348140.
[0264] For use in the methods of the instant invention, a cell that
artificially expresses a TLR is in one embodiment a stably
transfected cell that expresses the TLR. Such a cell can also be
stably transfected with a suitable reporter construct.
[0265] The invention in one aspect relates to a method for reducing
an immune response. As used herein, an immune response refers to a
response to an appropriate stimulus by a cell of the immune system,
a population of cells of the immune system, or by an immune system.
An immune system as used herein refers to an immune system of a
mammal, specifically including but not limited to an immune system
of a human.
[0266] A cell of an immune system can be any cell that is
classified as an immune cell. Such cells include B cells, T cells,
natural killer (NK) cells, mast cells, basophils, granulocytes,
monocytes, macrophages, bone marrow-derived dendritic cells, and
other professional antigen-presenting cells, as well as
subcategories and precursors thereof. In one embodiment a cell of
the immune system can be an isolated cell of the immune system.
[0267] A population of cells of the immune system refers to at
least two cells, and more typically at least one thousand cells, of
the immune system. In one embodiment a population of cells of the
immune system can be an isolated population of cells of the immune
system. In one embodiment a population of cells of the immune
system is an isolated population of PBMC.
[0268] In one embodiment the method involves contacting a
population of immune cells expressing a TLR selected from TLR7,
TLR8, and TLR9, with a compound or composition of the invention.
Immune cells that express TLR7, TLR8, or TLR9 can, but need not
necessarily, be mutually exclusive. As mentioned above, immune
cells expressing TLR7 can include B cells and dendritic cells, and
immune cells expressing TLR8 can include myeloid cells. Also as
mentioned above, immune cells expressing TLR9 can include B cells
and pDC.
[0269] The method involves measuring a reduced immune response
compared to a control immune response. A control immune response is
an immune response that occurs in absence of contacting an immune
cell, or a population of immune cells, with a compound or
composition of the invention. For purposes of comparing treatment
and control immune responses, conditions are generally selected
such that the number or concentration of TLR-expressing cells, the
amount or concentration of the TLR agonist, temperature, and other
such variables are identical or at least comparable between
treatment and control measurements, so as to isolate the effect of
the composition of the invention. Treatment and control
measurements can be made in parallel or they can be made
independently. For example, in one embodiment the control is a
historical control. In one embodiment the control is a concurrent,
parallel control.
[0270] An immune response is reduced whenever it is measurably less
than the control immune response. In various separate embodiments
the reduced immune response is at least 5 percent, at least 10
percent, at least 15 percent, at least 20 percent, at least 25
percent, at least 30 percent, at least 40 percent, and at least 50
percent less than control. In other words, in various separate
embodiments the reduced immune response is less than or equal to 95
percent, less than or equal to 90 percent, less than or equal to 85
percent, less than or equal to 80 percent, less than or equal to 75
percent, less than or equal to 70 percent, less than or equal to 60
percent, and less than or equal to 50 percent of control.
[0271] In one embodiment the immune response is a Th1-like immune
response. A Th1-like immune response refers to an immune response
characterized by at least one feature characteristic of a Th1
immune response. In one embodiment a Th1-like immune response is a
Th1 immune response. Features of a Th1 immune response can include
secretion of one or more Th1 cytokines, immunoglobulin class
switching to IgG1 (in humans) or IgG2a (in mice), and cell-mediated
immunity. In contrast, features of a Th2 immune response can
include secretion of one or more Th2 cytokines, immunoglobulin
class switching to IgE (in humans and in mice) and IgG2 (in humans)
or IgG1 (in mice), and humoral immunity.
[0272] As used herein, "cytokine" refers to any of a number of
soluble proteins or glycoproteins that act on immune cells through
specific receptors to affect the state of activation and function
of the immune cells. Cytokines include interferons, interleukins,
tumor necrosis factor, transforming growth factor beta,
colony-stimulating factors (CSFs), chemokines, as well as others.
Various cytokines affect innate immunity, acquired immunity, or
both. Cytokines specifically include, without limitation,
IFN-.alpha., IFN-.beta., IFN-.gamma., IL-1, IL-2, IL-3, IL-4, IL-5,
IL-6, IL-9, IL-10, IL-12, IL-13, IL-18, TNF-.alpha., TGF-.beta.,
granulocyte colony-stimulating factor (G-CSF), and
granulocyte-macrophage colony-stimulating factor (GM-CSF).
Chemokines specifically include, without limitation, IL-8, IP-10,
I-TAC, RANTES, MIP-1.alpha., MIP-1.beta., Gro-.alpha., Gro-.beta.,
Gro-.gamma., MCP-1, MCP-2, and MCP-3.
[0273] Most mature CD4.sup.+ T helper cells can be categorized into
one of two cytokine-associated, cross-regulatory subsets or
phenotypes: Th1 or Th2. Th1 cells are associated with IL-2, IL-3,
IFN, GM-CSF, and high levels of TNF-.alpha.. Th2 cells are
associated with IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-13, GM-CSF,
and low levels of TNF-.alpha.. The Th1 subset promotes both
cell-mediated immunity and humoral immunity that is characterized
by immunoglobulin class switching to IgG2a in mice. Th1 responses
can also be associated with delayed-type hypersensitivity and
autoimmune disease. The Th2 subset induces primarily humoral
immunity and induces immunoglobulin class switching to IgE and IgG1
in mice. The antibody isotypes associated with Th1 responses
generally have good neutralizing and opsonizing capabilities,
whereas those associated with Th2 responses are associated more
with allergic responses.
[0274] Several factors have been shown to influence commitment to
Th1 or Th2 profiles. The best characterized regulators are
cytokines. IL-12 and IFN-.gamma. are positive Th1 regulators and
negative Th2 regulators. IL-12 promotes IFN-.gamma. production, and
IFN-.gamma. provides positive feedback for IL-12. IL-4 and IL-10
appear to be required for the establishment of the Th2 cytokine
profile and to down-regulate Th1 cytokine production; the effects
of IL-4 are in some cases dominant over those of IL-12. IL-13 has
been reported to inhibit expression of inflammatory cytokines,
including IL-12 and TNF-.alpha. by LPS-induced monocytes, in a way
similar to IL-4.
[0275] The method will generally further involve contacting the
immune cells with an antigen, TLR agonist, or other stimulus
normally involved inducing an immune response by the immune cells.
The contacting in one embodiment can involve the step of adding or
administering an antigen, TLR agonist, or other stimulus normally
involved inducing an immune response by the immune cells. In one
embodiment the contacting can entail passive exposure of the immune
cells with an antigen, TLR agonist, or other stimulus normally
involved inducing an immune response by the immune cells. Passive
contacting can occur, for example, in a subject having an
autoimmune disease, inflammation, or transplant rejection.
[0276] In one embodiment the method relates to a method for
reducing an immune response in a subject. As used herein, a subject
refers to a mammal. In one embodiment the subject is a human. In
another embodiment the subject is a non-human primate. In yet
another embodiment the subject is a mammal other than a primate,
including but not limited to a mouse, rat, hamster, guinea pig,
rabbit, cat, dog, goat, sheep, pig, horse, or cow.
[0277] In one embodiment the immune response is an immune response
to an antigen. As used herein, an antigen refers to any substance
that induces an adaptive (specific) immune response. An antigen
typically is any substance that can be specifically bound by a
T-cell antigen receptor, antibody, or B-cell antigen receptor.
Antigenic substances include, without limitation, peptides,
proteins, carbohydrates, lipids, phospholipids, nucleic acids,
autacoids, and hormones. Antigens specifically include allergens,
autoantigens (i.e., self-antigens), cancer antigens, and microbial
antigens. In respect of peptide antigens and protein antigens,
antigens further include both antigens per se and nucleic acids
encoding said antigens.
[0278] An allergen is a substance that can induce an allergic or
asthmatic response in a susceptible subject. The list of allergens
is enormous and can include pollens, insect venoms, animal dander,
dust, fungal spores and drugs (e.g., penicillin). Examples of
natural animal and plant allergens include proteins specific to the
following genera: Canis (Canis familiaris); Dermatophagoides (e.g.,
Dermatophagoides farinae); Felis (e.g., Felis domesticus); Ambrosia
(e.g., Ambrosia artemuisfolia); Lolium (e.g., Lolium perenne and
Lolium multiflorum); Cryptomeria (e.g., Cryptomeria japonica);
Alternaria (e.g., Alternaria alternata); Alder; Alnus (e.g., Alnus
gultinosa); Betula (e.g., Betula verrucosa); Quercus (e.g., Quercus
alba); Olea (e.g., Olea europa); Artemisia (e.g., Artemisia
vulgaris); Plantago (e.g., Plantago lanceolata); Parietaria (e.g.,
Parietaria officinalis and Parietaria judaica); Blattella (e.g.,
Blattella germanica); Apis (e.g., Apis multiforum); Cupressus
(e.g., Cupressus sempervirens, Cupressus arizonica, and Cupressus
macrocarpa); Juniperus (e.g., Juniperus sabinoides, Juniperus
virginiana, Juniperus communis, and Juniperus ashel); Thuya (e.g.,
Thuya orientalis); Chamaecyparis (e.g., Chamaecyparis obtusa);
Periplaneta (e.g., Periplaneta americana); Agropyron (e.g.,
Agropyron repens); Secale (e.g., Secale cereale); Triticum (e.g.,
Triticum aestivum); Dactylis (e.g., Dactylis glomerata); Festuca
(e.g., Festuca elatior); Poa (e.g., Poa pratensis and Poa
compressa); Avena (e.g., Avena sativa); Holcus (e.g., Holcus
lanatus); Anthoxanthum (e.g., Anthoxanthum odoratum); Arrhenatherum
(e.g., Arrhenatherum elatius); Agrostis (e.g., Agrostis alba);
Phleum (e.g., Phleum pratense); Phalaris (e.g., Phalaris
arundinacea); Paspalum (e.g., Paspalum notatum); Sorghum (e.g.,
Sorghum halepensis); and Bromus (e.g., Bromus inermis). The term
"allergy" refers to acquired hypersensitivity to a substance
(allergen). An "allergic reaction" is the response of an immune
system to an allergen in a subject allergic to the allergen.
Allergic conditions include eczema, allergic rhinitis or coryza,
hay fever, bronchial asthma, urticaria (hives) and food allergies,
and other atopic conditions.
[0279] Autoantigens include any antigen of host origin, but they
specifically include antigens characteristic of an autoimmune
disease or condition. Autoantigens characteristic of an autoimmune
disease or condition can be associated with, but not necessarily
established as causative of, an autoimmune disorder. Specific
examples of autoantigens characteristic of an autoimmune disease or
condition include but are not limited to insulin, thyroglobulin,
glomerular basement membrane, acetylcholine receptor, DNA, and
myelin basic protein.
[0280] A cancer antigen as used herein is a compound, such as a
peptide or protein, associated with a tumor or cancer cell surface
and which is capable of provoking an immune response when expressed
on the surface of an antigen-presenting cell in the context of a
major histocompatibility complex (MHC) molecule. Cancer antigens
can be prepared from cancer cells either by preparing crude
extracts of cancer cells, for example, as described in Cohen P A et
al. (1994) Cancer Res 54:1055-8, by partially purifying the
antigens, by recombinant technology, or by de novo synthesis of
known antigens. Cancer antigens include but are not limited to
antigens that are recombinantly expressed, an immunogenic portion
thereof, or a whole tumor or cancer cell. Such antigens can be
isolated or prepared recombinantly or by any other means known in
the art.
[0281] The terms "cancer antigen" and "tumor antigen" are used
interchangeably and refer to antigens which are differentially
expressed by cancer cells and can thereby be exploited in order to
target cancer cells. Cancer antigens are antigens which can
potentially stimulate apparently tumor-specific immune responses.
Some of these antigens are encoded, although not necessarily
expressed, by normal cells. These antigens can be characterized as
those which are normally silent (i.e., not expressed) in normal
cells, those that are expressed only at certain stages of
differentiation and those that are temporally expressed such as
embryonic and fetal antigens. Other cancer antigens are encoded by
mutant cellular genes, such as oncogenes (e.g., activated ras
oncogene), suppressor genes (e.g., mutant p53), fusion proteins
resulting from internal deletions or chromosomal translocations.
Still other cancer antigens can be encoded by viral genes such as
those carried on RNA and DNA tumor viruses.
[0282] Examples of tumor antigens include MAGE, MART-1/Melan-A,
gp100, Dipeptidyl peptidase IV (DPPIV), adenosine deaminase-binding
protein (ADAbp), cyclophilin b, Colorectal associated antigen
(CRC)--0017-1A/GA733, Carcinoembryonic Antigen (CEA) and its
immunogenic epitopes CAP-1 and CAP-2, etv6, aml1, Prostate Specific
Antigen (PSA) and its immunogenic epitopes PSA-1, PSA-2, and PSA-3,
prostate-specific membrane antigen (PSMA), T-cell receptor/CD3-zeta
chain, MAGE-family of tumor antigens (e.g., MAGE-A1, MAGE-A2,
MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9,
MAGE-A10, MAGE-A11, MAGE-A12, MAGE-Xp2 (MAGE-B2), MAGE-Xp3
(MAGE-B3), MAGE-Xp4 (MAGE-B4), MAGE-C1, MAGE-C2, MAGE-C3, MAGE-C4,
MAGE-C5), GAGE-family of tumor antigens (e.g., GAGE-1, GAGE-2,
GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, GAGE-9), BAGE,
RAGE, LAGE-1, NAG, GnT-V, MUM-1, CDK4, tyrosinase, p53, MUC family,
HER2/neu, p21 ras, RCAS1, .alpha.-fetoprotein, E-cadherin,
.alpha.-catenin, .beta.-catenin and .gamma.-catenin, p120ctn,
gp100.sup.Pmel 117, FRAME, NY-ESO-1, cdc27, adenomatous polyposis
coli protein (APC), fodrin, Connexin 37, Ig-idiotype, p15, gp75,
GM2 and GD2 gangliosides, viral products such as human
papillomavirus proteins, Smad family of tumor antigens, lmp-1, P1
A, EBV-encoded nuclear antigen (EBNA)-1, brain glycogen
phosphorylase, SSX-1, SSX-2 (HOM-MEL-40), SSX-1, SSX-4, SSX-5,
SCP-1 and CT-7, and c-erbB-2.
[0283] Cancers or tumors and tumor antigens associated with such
tumors (but not exclusively), include acute lymphoblastic leukemia
(etv6; aml1; cyclophilin b), B cell lymphoma (Ig-idiotype), glioma
(E-cadherin; .alpha.-catenin; .beta.-catenin; .gamma.-catenin;
p120ctn), bladder cancer (p21ras), biliary cancer (p21ras), breast
cancer (MUC family; HER2/neu; c-erbB-2), cervical carcinoma (p53;
p21ras), colon carcinoma (p21 ras; HER2/neu; c-erbB-2; MUC family),
colorectal cancer (Colorectal associated antigen
(CRC)--C017-1A/GA733; APC), choriocarcinoma (CEA), epithelial cell
cancer (cyclophilin b), gastric cancer (HER2/neu; c-erbB-2; ga733
glycoprotein), hepatocellular cancer (.alpha.-fetoprotein),
Hodgkin's lymphoma (imp-1; EBNA-1), lung cancer (CEA; MAGE-3;
NY-ESO-1), lymphoid cell-derived leukemia (cyclophilin b), melanoma
(p115 protein, gp75, oncofetal antigen, GM2 and GD2 gangliosides),
myeloma (MUC family; p21ras), non-small cell lung carcinoma
(HER2/neu; c-erbB-2), nasopharyngeal cancer (Imp-1; EBNA-1),
ovarian cancer (MUC family; HER2/neu; c-erbB-2), prostate cancer
(Prostate Specific Antigen (PSA) and its immunogenic epitopes
PSA-1, PSA-2, and PSA-3; prostate-specific membrane antigen (PSMA);
HER2/neu; c-erbB-2), pancreatic cancer (p21ras; MUC family;
HER2/neu; c-erbB-2; ga733 glycoprotein), renal cancer (HER2/neu;
c-erbB-2), squamous cell cancers of cervix and esophagus (viral
products such as human papillomavirus proteins), testicular cancer
(NY-ESO-1), T-cell leukemia (HTLV-1 epitopes), and melanoma
(Melan-A/MART-1; cdc27; MAGE-3; p21ras; gp100.sup.Pmel117).
[0284] A microbial antigen can be an antigen that is or is derived
from an infectious microbial agent, including a bacterium, a virus,
a fungus, or a parasite.
[0285] Examples of infectious bacteria include: Helicobacter
pylori, Borrelia burgdorferi, Legionella pneumophila, Mycobacteria
sps (such as. M. tuberculosis, M. avium, M. intracellulare, M.
kansasii, and M. gordonae), Staphylococcus aureus, Neisseria
gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes,
Streptococcus pyogenes (Group A Streptococcus), Streptococcus
agalactiae (Group B Streptococcus), Streptococcus (viridans group),
Streptococcus faecalis, Streptococcus bovis, Streptococcus
(anaerobic sps.), Streptococcus pneumoniae, pathogenic
Campylobacter sp., Enterococcus sp., Haemophilus influenzae,
Bacillus anthracis, Chlamydia trachomatis, Corynebacterium
diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae,
Clostridium perfringens, Clostridium tetani, Enterobacter
aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides
sp., Fusobacterium nucleatum, Streptobacillus moniliformis,
Treponema pallidum, Treponema pertenue, Leptospira, and Actinomyces
israelii.
[0286] Examples of infectious virus include: Retroviridae
(including but not limited to human immunodeficiency virus (HIV));
Picornaviridae (for example, polio viruses, hepatitis A virus;
enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (such as strains that cause gastroenteritis);
Togaviridae (for example, equine encephalitis viruses, rubella
viruses); Flaviviridae (for example, dengue viruses, encephalitis
viruses, yellow fever viruses); Coronaviridae (for example,
coronaviruses); Rhabdoviridae (for example, vesicular stomatitis
viruses, rabies viruses); Filoviridae (for example, ebola viruses);
Paramyxoviridae (for example, parainfluenza viruses, mumps virus,
measles virus, respiratory syncytial virus); Orthomyxoviridae (for
example, influenza viruses); Bunyaviridae (for example, Hantaan
viruses, bunya viruses, phleboviruses, and Nairo viruses);
Arenaviridae (hemorrhagic fever viruses); Reoviridae (e.g.,
reoviruses, orbiviurses, and rotaviruses); Birnaviridae;
Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses);
Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae
(most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1
and HSV-2, varicella zoster virus, cytomegalovirus (CMV), herpes
viruses); Poxyiridae (variola viruses, vaccinia viruses, pox
viruses); and Iridoviridae (such as African swine fever virus); and
unclassified viruses (for example, the etiological agents of
spongiform encephalopathies, the agent of delta hepatitis (thought
to be a defective satellite of hepatitis B virus), the agents of
non-A, non-B hepatitis (class 1=internally transmitted; class
2=parenterally transmitted (i.e., Hepatitis C); Norwalk and related
viruses, and astroviruses).
[0287] Examples of infectious fungi include, but are not limited
to, Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides
immitis, Blastomyces dermatitidis, and Candida albicans.
[0288] The invention in one aspect relates to a method for treating
an autoimmune condition in a subject. As used herein, an autoimmune
condition refers to an autoimmune disease or disorder, i.e., an
immunologically mediated acute or chronic process, directed by
immune cells of a host subject against a tissue or organ of the
host subject, resulting in injury to the tissue or organ. The term
encompasses both cellular and antibody-mediated autoimmune
phenomena, as well as organ-specific and organ-nonspecific
autoimmunity.
[0289] Autoimmune conditions specifically include insulin-dependent
diabetes mellitus, rheumatoid arthritis, systemic lupus
erythematosus (SLE), multiple sclerosis, atherosclerosis, and
inflammatory bowel disease. Inflammatory bowel disease includes
Crohn's disease and ulcerative colitis. Autoimmune diseases also
include, without limitation, ankylosing spondylitis, autoimmune
chronic active hepatitis, autoimmune encephalomyelitis, autoimmune
hemolytic anemia, autoimmune thrombocytopenic purpura,
autoimmune-associated infertility, Behcet's syndrome, bullous
pemphigoid, Churg-Strauss disease, glomerulonephritis,
Goodpasture's syndrome, Graves' disease, Guillain-Barre syndrome,
Hashimoto's thyroiditis, idiopathic Addison's disease, idiopathic
thrombocytopenia, insulin resistance, mixed connective tissue
disease, myasthenia gravis, pemphigus, pernicious anemia,
polyarteritis nodosa, polymyositis/dermatomyositis, primary biliary
sclerosis, psoriasis, Reiter's syndrome, sarcoidosis, sclerosing
cholangitis, Sjogren's syndrome, systemic sclerosis (scleroderma
and CREST syndrome), Takayasu's arteritis, temporal arteritis, and
Wegener's granulomatosis. All of these entities are well known in
the medical arts and need not be described further here.
[0290] The method of treatment of an autoimmune condition in a
subject specifically includes treatment of a human subject. In one
embodiment the autoimmune condition is systemic lupus
erythematosus. In one embodiment the autoimmune condition is
rheumatoid arthritis.
[0291] The method of treatment of an autoimmune condition in a
subject optionally can further include administration of another
treatment agent or treatment modality useful in the treatment of
the autoimmune condition. For example, the method can include
administration of a compound or composition of the invention,
either alone or in combination with an agent such as a
corticosteroid (e.g., prednisone), a cytokine (e.g., IFN-.alpha.),
or other suitable immunomodulatory agent. In this context, "in
combination with" can refer to simultaneous administration at a
single site of administration, or at different sites of
administration. Alternatively and in addition, "in combination
with" can refer to sequential administration at a single site of
administration, or at different sites of administration.
[0292] As will be evident from the foregoing, autoimmune diseases
also include certain immune complex-associated diseases. The term
"immune complex-associated disease" as used herein refers to any
disease characterized by the production and/or tissue deposition of
immune complexes, including, but not limited to systemic lupus
erythematosus (SLE) and related connective tissue diseases,
rheumatoid arthritis, hepatitis C- and hepatitis B-related immune
complex disease (e.g., cryoglobulinemia), Behcet's syndrome,
autoimmune glomerulonephritides, and vasculopathy associated with
the presence of LDL/anti-LDL immune complexes.
[0293] As used herein, the term "treat" as used in reference to a
disorder, disease, or condition means to prevent or slow the
development of the disorder, disease, or condition; to prevent,
slow or halt the progression of the disorder, disease, or
condition; and/or to eliminate the disorder, disease, or
condition.
[0294] For purposes of description that follows, unless otherwise
indicated or except as apparent from context, an "active agent"
refers to a compound or composition of the invention, disclosed
herein.
[0295] The term "effective amount" refers to the amount necessary
or sufficient to realize a desired biologic effect. Combined with
the teachings provided herein, by choosing among the various active
compounds and weighing factors such as potency, relative
bioavailability, patient body weight, severity of adverse
side-effects and preferred mode of administration, an effective
prophylactic or therapeutic treatment regimen can be planned which
does not cause substantial toxicity and yet is effective to treat
the particular subject. The effective amount for any particular
application can vary depending on such factors as the disease or
condition being treated, the particular active agent being
administered, the size of the subject, or the severity of the
disease or condition. One of ordinary skill in the art can
empirically determine the effective amount of a particular active
agent and/or other therapeutic agent without necessitating undue
experimentation. It is preferred generally that a maximum dose be
used, that is, the highest safe dose according to some medical
judgment. Multiple doses per day may be contemplated to achieve
appropriate systemic levels of compounds. Appropriate system levels
can be determined by, for example, measurement of the subject's
peak or sustained plasma level of the active agent. "Dose" and
"dosage" are used interchangeably herein.
[0296] Generally, daily oral doses of active compounds will be from
about 0.01 milligrams/kg per day to 1000 milligrams/kg per day. It
is expected that oral doses in the range of 0.5 to 50
milligrams/kg, in one or several administrations per day, will
yield the desired results. Dosage may be adjusted appropriately to
achieve desired drug levels, local or systemic, depending upon the
mode of administration. For example, it is expected that
intravenous administration would be from an order to several orders
of magnitude lower dose per day. In the event that the response in
a subject is insufficient at such doses, even higher doses (or
effective higher doses by a different, more localized delivery
route) may be employed to the extent that patient tolerance
permits. Multiple doses per day are contemplated to achieve
appropriate systemic levels of compounds.
[0297] For any compound described herein the therapeutically
effective amount can be initially determined from animal models. A
therapeutically effective dose can also be determined from human
data for active agents which have been tested in humans and for
compounds which are known to exhibit similar pharmacological
activities, such as other related active agents. Higher doses may
be required for parenteral administration. The applied dose can be
adjusted based on the relative bioavailability and potency of the
administered compound. Adjusting the dose to achieve maximal
efficacy based on the methods described above and other methods as
are well known in the art is well within the capabilities of the
ordinarily skilled artisan.
[0298] The formulations of the invention are administered in
pharmaceutically acceptable solutions, which may routinely contain
pharmaceutically acceptable concentrations of salt, buffering
agents, preservatives, compatible carriers, adjuvants, and
optionally other therapeutic ingredients.
[0299] For use in therapy, an effective amount of the active agent
can be administered to a subject by any mode that delivers the
active agent to the desired surface. Administering the
pharmaceutical composition of the present invention may be
accomplished by any means known to the skilled artisan. Preferred
routes of administration include but are not limited to oral,
parenteral, intravenous, intramuscular, intraperitoneal,
intranasal, sublingual, intratracheal, inhalation, ocular, vaginal,
and rectal.
[0300] For oral administration, the compounds (i.e., active agents,
and other therapeutic agents) can be formulated readily by
combining the active compound(s) with pharmaceutically acceptable
carriers well known in the art. Such carriers enable the compounds
of the invention to be formulated as tablets, pills, drapes,
capsules, liquids, gels, syrups, slurries, suspensions and the
like, for oral ingestion by a subject to be treated. Pharmaceutical
preparations for oral use can be obtained as solid excipient,
optionally grinding a resulting mixture, and processing the mixture
of granules, after adding suitable auxiliaries, if desired, to
obtain tablets or dragee cores. Suitable excipients are, in
particular, fillers such as sugars, including lactose, sucrose,
mannitol, or sorbitol; cellulose preparations such as, for example,
maize starch, wheat starch, rice starch, potato starch, gelatin,
gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose,
sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP).
If desired, disintegrating agents may be added, such as the
cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt
thereof such as sodium alginate. Optionally the oral formulations
may also be formulated in saline or buffers, e.g. EDTA for
neutralizing internal acid conditions or may be administered
without any carriers.
[0301] Also specifically contemplated are oral dosage forms of the
above component or components. The component or components may be
chemically modified so that oral delivery of the derivative is
efficacious. Generally, the chemical modification contemplated is
the attachment of at least one moiety to the component molecule
itself, where said moiety permits (a) inhibition of proteolysis;
and (b) uptake into the blood stream from the stomach or intestine.
Also desired is the increase in overall stability of the component
or components and increase in circulation time in the body.
Examples of such moieties include: polyethylene glycol, copolymers
of ethylene glycol and propylene glycol, carboxymethylcellulose,
dextran, polyvinyl alcohol, polyvinylpyrrolidone and polyproline.
Abuchowski and Davis, 1981, "Soluble Polymer-Enzyme Adducts" In:
Enzymes as Drugs, Hocenberg and Roberts, eds., Wiley-Interscience,
New York, N.Y., pp. 367-383; Newmark, et al. (1982) J. Appl.
Biochem. 4:185-189. Other polymers that could be used are
poly-1,3-dioxolane and poly-1,3,6-tioxocane. Preferred for
pharmaceutical usage, as indicated above, are polyethylene glycol
moieties.
[0302] For the component (or derivative) the location of release
may be the stomach, the small intestine (the duodenum, the jejunum,
or the ileum), or the large intestine. One skilled in the art has
available formulations which will not dissolve in the stomach, yet
will release the material in the duodenum or elsewhere in the
intestine. Preferably, the release will avoid the deleterious
effects of the stomach environment, either by protection of the
active agent (or derivative) or by release of the biologically
active material beyond the stomach environment, such as in the
intestine.
[0303] To ensure full gastric resistance a coating impermeable to
at least pH 5.0 is essential. Examples of the more common inert
ingredients that are used as enteric coatings are cellulose acetate
trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP),
HPMCP 50, HPMCP 55, polyvinyl acetate phthalate (PVAP), Eudragit
L30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L,
Eudragit S, and Shellac. These coatings may be used as mixed
films.
[0304] A coating or mixture of coatings can also be used on
tablets, which are not intended for protection against the stomach.
This can include sugar coatings, or coatings which make the tablet
easier to swallow. Capsules may consist of a hard shell (such as
gelatin) for delivery of dry therapeutic, e.g., powder; for liquid
forms, a soft gelatin shell may be used. The shell material of
cachets could be thick starch or other edible paper. For pills,
lozenges, molded tablets or tablet triturates, moist massing
techniques can be used.
[0305] The therapeutic can be included in the formulation as fine
multi-particulates in the form of granules or pellets of particle
size about 1 mm. The formulation of the material for capsule
administration could also be as a powder, lightly compressed plugs
or even as tablets. The therapeutic could be prepared by
compression.
[0306] Colorants and flavoring agents may all be included. For
example, the active agent (or derivative) may be formulated (such
as by liposome or microsphere encapsulation) and then further
contained within an edible product, such as a refrigerated beverage
containing colorants and flavoring agents.
[0307] One may dilute or increase the volume of the therapeutic
with an inert material. These diluents could include carbohydrates,
especially mannitol, a-lactose, anhydrous lactose, cellulose,
sucrose, modified dextrans and starch. Certain inorganic salts may
be also be used as fillers including calcium triphosphate,
magnesium carbonate and sodium chloride. Some commercially
available diluents are Fast-Flo, Emdex, STA-Rx 1500, Emcompress and
Avicell.
[0308] Disintegrants may be included in the formulation of the
therapeutic into a solid dosage form. Materials used as
disintegrants include but are not limited to starch, including the
commercial disintegrant based on starch, Explotab. Sodium starch
glycolate, Amberlite, sodium carboxymethylcellulose,
ultramylopectin, sodium alginate, gelatin, orange peel, acid
carboxymethylcellulose, natural sponge and bentonite may all be
used. Another form of the disintegrants are the insoluble cationic
exchange resins. Powdered gums may be used as disintegrants and as
binders and these can include powdered gums such as agar, Karaya or
tragacanth. Alginic acid and its sodium salt are also useful as
disintegrants.
[0309] Binders may be used to hold the therapeutic agent together
to form a hard tablet and include materials from natural products
such as acacia, tragacanth, starch and gelatin. Others include
methyl cellulose (MC), ethyl cellulose (EC) and
carboxymethylcellulose (CMC). Polyvinylpyrrolidone (PVP) and
hydroxypropylmethyl cellulose (HPMC) could both be used in
alcoholic solutions to granulate the therapeutic.
[0310] An anti-frictional agent may be included in the formulation
of the therapeutic to prevent sticking during the formulation
process. Lubricants may be used as a layer between the therapeutic
and the die wall, and these can include but are not limited to:
stearic acid including its magnesium and calcium salts,
polytetrafluoroethylene (PTFE), liquid paraffin, vegetable oils and
waxes. Soluble lubricants may also be used such as sodium lauryl
sulfate, magnesium lauryl sulfate, polyethylene glycol of various
molecular weights, Carbowax 4000 and 6000.
[0311] Glidants that might improve the flow properties of the drug
during formulation and to aid rearrangement during compression
might be added. The glidants may include starch, talc, pyrogenic
silica and hydrated silicoaluminate.
[0312] To aid dissolution of the therapeutic into the aqueous
environment a surfactant might be added as a wetting agent.
Surfactants may include anionic detergents such as sodium lauryl
sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium
sulfonate. Cationic detergents might be used and could include
benzalkonium chloride or benzethomium chloride. Potential non-ionic
detergents that could be included in the formulation as surfactants
include lauromacrogol 400, polyoxyl 40 stearate, polyoxyethylene
hydrogenated castor oil 10, 50, and 60, glycerol monostearate,
polysorbate 40, 60, 65, and 80, sucrose fatty acid ester, methyl
cellulose and carboxymethylcellulose. These surfactants could be
present in the formulation of the active agent or derivative either
alone or as a mixture in different ratios.
[0313] Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. Microspheres formulated for oral
administration may also be used. Such microspheres have been well
defined in the art. All formulations for oral administration should
be in dosages suitable for such administration.
[0314] For buccal administration, the compositions may take the
form of tablets or lozenges formulated in conventional manner.
[0315] For administration by inhalation, the compounds for use
according to the present invention may be conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g. gelatin for use in an inhaler or insufflator may
be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
[0316] Also contemplated herein is pulmonary delivery of the active
agent (or derivative thereof). The active agent (or derivative) is
delivered to the lungs of a mammal while inhaling and traverses
across the lung epithelial lining to the blood stream. Other
reports of inhaled molecules include Adjei et al. (1990)
Pharmaceutical Research 7:565-569; Adjei et al. (1990)
International Journal of Pharmaceutics 63:135-144 (leuprolide
acetate); Braquet et al. (1989) Journal of Cardiovascular
Pharmacology 13(suppl. 5):143-146 (endothelin-1); Hubbard et al.
(1989) Annals of Internal Medicine 111:206-212
(.alpha.1-antitrypsin); Smith et al. (1989) J. Clin. Invest.
84:1145-1146 (.alpha.-1-proteinase inhibitor); Oswein et al., 1990,
"Aerosolization of Proteins", Proceedings of Symposium on
Respiratory Drug Delivery II, Keystone, Colo., March, (recombinant
human growth hormone); Debs et al. (1988) J. Immunol. 140:3482-3488
(interferon-.gamma. and tumor necrosis factor alpha); and Platz et
al., U.S. Pat. No. 5,284,656 (granulocyte colony stimulating
factor). A method and composition for pulmonary delivery of drugs
for systemic effect is described in U.S. Pat. No. 5,451,569, issued
Sep. 19, 1995 to Wong et al.
[0317] Contemplated for use in the practice of this invention are a
wide range of mechanical devices designed for pulmonary delivery of
therapeutic products, including but not limited to nebulizers,
metered dose inhalers, and powder inhalers, all of which are
familiar to those skilled in the art.
[0318] Some specific examples of commercially available devices
suitable for the practice of this invention are the Ultravent
nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Mo.; the
Acorn II nebulizer, manufactured by Marquest Medical Products,
Englewood, Colo.; the Ventolin metered dose inhaler, manufactured
by Glaxo Inc., Research Triangle Park, North Carolina; and the
Spinhaler powder inhaler, manufactured by Fisons Corp., Bedford,
Mass.
[0319] All such devices require the use of formulations suitable
for the dispensing of active agent (or derivative). Typically, each
formulation is specific to the type of device employed and may
involve the use of an appropriate propellant material, in addition
to the usual diluents, adjuvants and/or carriers useful in therapy.
Also, the use of liposomes, microcapsules or microspheres,
inclusion complexes, or other types of carriers is contemplated.
Chemically modified active agent may also be prepared in different
formulations depending on the type of chemical modification or the
type of device employed.
[0320] Formulations suitable for use with a nebulizer, either jet
or ultrasonic, will typically comprise active agent (or derivative)
dissolved in water at a concentration of about 0.1 to 25 mg of
biologically active agent per ml of solution. The formulation may
also include a buffer and a simple sugar (e.g., for active agent
stabilization and regulation of osmotic pressure). The nebulizer
formulation may also contain a surfactant, to reduce or prevent
surface induced aggregation of the active agent caused by
atomization of the solution in forming the aerosol.
[0321] Formulations for use with a metered-dose inhaler device will
generally comprise a finely divided powder containing the active
agent (or derivative) suspended in a propellant with the aid of a
surfactant. The propellant may be any conventional material
employed for this purpose, such as a chlorofluorocarbon, a
hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon,
including trichlorofluoromethane, dichlorodifluoromethane,
dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, or
combinations thereof. Suitable surfactants include sorbitan
trioleate and soya lecithin. Oleic acid may also be useful as a
surfactant.
[0322] Formulations for dispensing from a powder inhaler device
will comprise a finely divided dry powder containing active agent
(or derivative) and may also include a bulking agent, such as
lactose, sorbitol, sucrose, or mannitol in amounts which facilitate
dispersal of the powder from the device, e.g., 50 to 90% by weight
of the formulation. The active agent (or derivative) should most
advantageously be prepared in particulate form with an average
particle size of less than 10 mm (or microns), most preferably 0.5
to 5 mm, for most effective delivery to the distal lung.
[0323] Nasal delivery of a pharmaceutical composition of the
present invention is also contemplated. Nasal delivery allows the
passage of a pharmaceutical composition of the present invention to
the blood stream directly after administering the therapeutic
product to the nose, without the necessity for deposition of the
product in the lung. Formulations for nasal delivery include those
with dextran or cyclodextran.
[0324] For nasal administration, a useful device is a small, hard
bottle to which a metered dose sprayer is attached. In one
embodiment, the metered dose is delivered by drawing the
pharmaceutical composition of the present invention solution into a
chamber of defined volume, which chamber has an aperture
dimensioned to aerosolize and aerosol formulation by forming a
spray when a liquid in the chamber is compressed. The chamber is
compressed to administer the pharmaceutical composition of the
present invention. In a specific embodiment, the chamber is a
piston arrangement. Such devices are commercially available.
[0325] Alternatively, a plastic squeeze bottle with an aperture or
opening dimensioned to aerosolize an aerosol formulation by forming
a spray when squeezed is used. The opening is usually found in the
top of the bottle, and the top is generally tapered to partially
fit in the nasal passages for efficient administration of the
aerosol formulation. Preferably, the nasal inhaler will provide a
metered amount of the aerosol formulation, for administration of a
measured dose of the drug.
[0326] The compounds, when it is desirable to deliver them
systemically, may be formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form,
e.g., in ampoules or in multi-dose containers, with an added
preservative. The compositions may take such forms as suspensions,
solutions or emulsions in oily or aqueous vehicles, and may contain
formulatory agents such as suspending, stabilizing and/or
dispersing agents.
[0327] Pharmaceutical formulations for parenteral administration
include aqueous solutions of the active compounds in water-soluble
form. Additionally, suspensions of the active compounds may be
prepared as appropriate oily injection suspensions. Suitable
lipophilic solvents or vehicles include fatty oils such as sesame
oil, or synthetic fatty acid esters, such as ethyl oleate or
triglycerides, or liposomes. Aqueous injection suspensions may
contain substances which increase the viscosity of the suspension,
such as sodium carboxymethylcellulose, sorbitol, or dextran.
Optionally, the suspension may also contain suitable stabilizers or
agents which increase the solubility of the compounds to allow for
the preparation of highly concentrated solutions.
[0328] Alternatively, the active compounds may be in powder form
for constitution with a suitable vehicle, e.g., sterile
pyrogen-free water, before use.
[0329] The compounds may also be formulated in rectal or vaginal
compositions such as suppositories or retention enemas, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
[0330] In addition to the formulations described previously, the
compounds may also be formulated as a depot preparation. Such long
acting formulations may be formulated with suitable polymeric or
hydrophobic materials (for example as an emulsion in an acceptable
oil) or ion exchange resins, or as sparingly soluble derivatives,
for example, as a sparingly soluble salt.
[0331] The pharmaceutical compositions also may comprise suitable
solid or gel phase carriers or excipients. Examples of such
carriers or excipients include but are not limited to calcium
carbonate, calcium phosphate, various sugars, starches, cellulose
derivatives, gelatin, and polymers such as polyethylene
glycols.
[0332] Suitable liquid or solid pharmaceutical preparation forms
are, for example, aqueous or saline solutions for inhalation,
microencapsulated, encochleated, coated onto microscopic gold
particles, contained in liposomes, nebulized, aerosols, pellets for
implantation into the skin, or dried onto a sharp object to be
scratched into the skin. The pharmaceutical compositions also
include granules, powders, tablets, coated tablets,
(micro)capsules, suppositories, syrups, emulsions, suspensions,
creams, drops or preparations with protracted release of active
compounds, in whose preparation excipients and additives and/or
auxiliaries such as disintegrants, binders, coating agents,
swelling agents, lubricants, flavorings, sweeteners or solubilizers
are customarily used as described above. The pharmaceutical
compositions are suitable for use in a variety of drug delivery
systems. For a brief review of methods for drug delivery, see
Langer (1990) Science 249:1527-1533, which is incorporated herein
by reference.
[0333] The active agents and optionally other therapeutics may be
administered per se (neat) or in the form of a pharmaceutically
acceptable salt. When used in medicine the salts should be
pharmaceutically acceptable, but non-pharmaceutically acceptable
salts may conveniently be used to prepare pharmaceutically
acceptable salts thereof. Such salts include, but are not limited
to, those prepared from the following acids: hydrochloric,
hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic,
salicylic, p-toluene sulphonic, tartaric, citric, methane
sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and
benzene sulphonic. Also, such salts can be prepared as alkaline
metal or alkaline earth salts, such as sodium, potassium or calcium
salts of the carboxylic acid group.
[0334] Suitable buffering agents include: acetic acid and a salt
(1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a
salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
Suitable preservatives include benzalkonium chloride (0.003-0.03%
w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and
thimerosal (0.004-0.02% w/v).
[0335] The pharmaceutical compositions of the invention contain an
effective amount of active agent and optionally therapeutic agents
included in a pharmaceutically-acceptable carrier. The term
pharmaceutically-acceptable carrier means one or more compatible
solid or liquid filler, diluents or encapsulating substances which
are suitable for administration to a human or other vertebrate
animal. The term carrier denotes an organic or inorganic
ingredient, natural or synthetic, with which the active ingredient
is combined to facilitate the application. The components of the
pharmaceutical compositions also are capable of being commingled
with the compounds of the present invention, and with each other,
in a manner such that there is no interaction which would
substantially impair the desired pharmaceutical efficiency.
[0336] In one embodiment the pharmaceutical composition is a
sterile preparation containing the active agent. The composition
can be made sterile by any suitable means, including filter
sterilization.
[0337] The therapeutic agent(s), including specifically but not
limited to the active agent, may be provided in particles.
Particles as used herein means nano or microparticles (or in some
instances larger) which can consist in whole or in part of the
active agent or the other therapeutic agent(s) as described herein.
The particles may contain the therapeutic agent(s) in a core
surrounded by a coating, including, but not limited to, an enteric
coating. The therapeutic agent(s) also may be dispersed throughout
the particles. The therapeutic agent(s) also may be adsorbed into
the particles. The particles may be of any order release kinetics,
including zero order release, first order release, second order
release, delayed release, sustained release, immediate release, and
any combination thereof, etc. The particle may include, in addition
to the therapeutic agent(s), any of those materials routinely used
in the art of pharmacy and medicine, including, but not limited to,
erodible, nonerodible, biodegradable, or nonbiodegradable material
or combinations thereof. The particles may be microcapsules which
contain the active agent in a solution or in a semi-solid state.
The particles may be of virtually any shape.
[0338] Both non-biodegradable and biodegradable polymeric materials
can be used in the manufacture of particles for delivering the
therapeutic agent(s). Such polymers may be natural or synthetic
polymers. The polymer is selected based on the period of time over
which release is desired. Bioadhesive polymers of particular
interest include bioerodible hydrogels described by H. S. Sawhney,
C. P. Pathak and J. A. Hubell in Macromolecules, (1993) 26:581-587,
the teachings of which are incorporated herein. These include
polyhyaluronic acids, casein, gelatin, glutin, polyanhydrides,
polyacrylic acid, alginate, chitosan, poly(methyl methacrylates),
poly(ethyl methacrylates), poly(butylmethacrylate), poly(isobutyl
methacrylate), poly(hexylmethacrylate), poly(isodecyl
methacrylate), poly(lauryl methacrylate), poly(phenyl
methacrylate), poly(methyl acrylate), poly(isopropyl acrylate),
poly(isobutyl acrylate), and poly(octadecyl acrylate).
[0339] The therapeutic agent(s) may be contained in controlled
release systems. The term "controlled release" is intended to refer
to any drug-containing formulation in which the manner and profile
of drug release from the formulation are controlled. This refers to
immediate as well as non-immediate release formulations, with
non-immediate release formulations including but not limited to
sustained release and delayed release formulations. The term
"sustained release" (also referred to as "extended release") is
used in its conventional sense to refer to a drug formulation that
provides for gradual release of a drug over an extended period of
time, and that preferably, although not necessarily, results in
substantially constant blood levels of a drug over an extended time
period. The term "delayed release" is used in its conventional
sense to refer to a drug formulation in which there is a time delay
between administration of the formulation and the release of the
drug therefrom. "Delayed release" may or may not involve gradual
release of drug over an extended period of time, and thus may or
may not be "sustained release."
[0340] Use of a long-term sustained release implant may be
particularly suitable for treatment of chronic conditions.
"Long-term" release, as used herein, means that the implant is
constructed and arranged to deliver therapeutic levels of the
active ingredient for at least 7 days, and preferably 30-60 days.
Long-term sustained release implants are well-known to those of
ordinary skill in the art and include some of the release systems
described above.
[0341] The present invention is further illustrated by the
following Examples, which in no way should be construed as further
limiting. The entire contents of all of the references (including
literature references, issued patents, published patent
applications, and co-pending patent applications) cited throughout
this application are hereby expressly incorporated by
reference.
EXAMPLES
Example 1
Predicted Activities for Compounds of Formula III
[0342] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula III wherein R.sub.3, R.sub.7, and R.sub.8 are hydrogen, and
R.sub.6 is Y.sub.i (Ar--Y.sub.2). Substitutions for R.sub.4 and
Y.sub.2 were made as shown in Table 1 below. In this set of data
the compound with the lowest predicted IC.sub.50, 33 nM, had
R.sub.4=dipip and Y.sub.2=dippip.
TABLE-US-00001 TABLE 1 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 83 59 49 64 48 50 61 diamine 150 56 47 45
64 48 49 dipamine 59 120 74 75 86 48 79 dimor 66 58 41 50 38 41 58
dipmor 100 58 52 42 41 43 40 dipip 69 41 36 57 39 50 33 dippip 90
46 39 43 58 43 37
Example 2
Predicted Activities for Compounds of Formula III
[0343] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula III wherein R.sub.3, R.sub.6, and R.sub.8 are hydrogen, and
R.sub.7 is Y.sub.1 (Ar--Y.sub.2). Substitutions for R.sub.4 and
Y.sub.2 were made as shown in Table 2 below. In this set of data
the compound with the lowest predicted IC.sub.50, 33 nM, had
R.sub.4=diamine and Y.sub.2=dippip.
TABLE-US-00002 TABLE 2 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 67 77 76 75 73 84 91 diamine 79 120 79 65
87 75 33 dipamine 68 67 170 90 81 65 110 dimor 65 79 82 83 68 66 36
dipmor 64 75 90 87 79 77 90 dipip 69 55 86 78 66 65 73 dippip 75 73
75 63 72 84 85
Example 3
Predicted Activities for Compounds of Formula III
[0344] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula III wherein R.sub.3, R.sub.6, and R.sub.7 are hydrogen, and
R.sub.8 is Y.sub.1 (Ar--Y.sub.2). Substitutions for R.sub.4 and
Y.sub.2 were made as shown in Table 3 below. In this set of data
the compound with the lowest predicted IC.sub.50, 51 nM, had
R.sub.4=dimor and Y.sub.2=dipip.
TABLE-US-00003 TABLE 3 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 530 460 120 330 440 410 160 diamine 100 98
78 66 88 83 82 dipamine 96 88 82 78 76 91 72 dimor 100 64 73 92 77
51 80 dipmor 79 70 77 120 130 69 66 dipip 94 75 68 77 78 110 76
dippip 65 67 55 79 60 71 72
Example 4
Predicted Activities for Compounds of Formula III
[0345] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula III wherein R.sub.6, R.sub.7, and R.sub.8 are hydrogen, and
R.sub.3 is Y.sub.1 (Ar--Y.sub.2). Substitutions for R.sub.4 and
Y.sub.2 were made as shown in Table 4 below. In this set of data
the compound with the lowest predicted IC.sub.50, 36 nM, had
R.sub.4=Y.sub.2=dipip.
TABLE-US-00004 TABLE 4 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 80 90 130 100 110 81 37 diamine 54 100 71
110 220 43 49 dipamine 140 98 150 44 220 400 290 dimor 75 76 42 110
230 110 58 dipmor 110 180 130 67 210 110 37 dipip 70 50 64 110 150
36 54 dippip 68 89 370 230 200 180 430
Example 5
Predicted Activities for Compounds of Formula III
[0346] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula III wherein R.sub.3 and R.sub.7 are hydrogen, R.sub.6 is
Y.sub.2, and R.sub.8 is Y.sub.3 (unsubstituted phenyl).
Substitutions for R.sub.4 and Y.sub.2 were made as shown in Table 5
below. In this set of data the compound with the lowest predicted
IC.sub.50, 31 nM, had R.sub.4=Y.sub.2=dipip.
TABLE-US-00005 TABLE 5 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 1200 930 580 1100 650 880 760 diamine 120
170 160 70 42 77 120 dipamine 150 600 140 220 250 130 210 dimor 250
130 97 110 72 110 140 dipmor 430 430 470 490 460 430 190 dipip 130
170 110 110 140 31 49 dippip 830 120 200 400 280 390 460
Example 6
Predicted Activities for Compounds of Formula III
[0347] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula III wherein R.sub.6 and R.sub.8 are hydrogen, R.sub.3 is
Y.sub.3 (unsubstituted phenyl), and R.sub.7 is Y.sub.2.
Substitutions for R.sub.4 and Y.sub.2 were made as shown in Table 6
below. In this set of data the compound with the lowest predicted
IC.sub.50, 36 nM, had R.sub.4=pip and Y.sub.2=dippip.
TABLE-US-00006 TABLE 6 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 1200 63 42 770 120 63 36 diamine 630 100
53 180 230 110 50 dipamine 240 46 630 350 390 270 80 dimor 750 87
220 140 45 130 210 dipmor 320 63 82 1000 290 130 100 dipip 530 100
190 360 110 69 210 dippip 200 51 270 290 170 89 96
Example 7
Predicted Activities for Compounds of Formula IV
[0348] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula IV wherein R.sub.7 and R.sub.8 are hydrogen, and R.sub.6 is
Y.sub.1 (Ar--Y.sub.2). Substitutions for R.sub.4 and Y.sub.2 were
made as shown in Table 7 below. In this set of data the compound
with the lowest predicted IC.sub.50, 37 nM, had
R.sub.4=Y.sub.2=diamine.
TABLE-US-00007 TABLE 7 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 73 120 110 87 220 95 240 diamine 97 37 140
1000 140 320 600 dipamine 100 120 920 140 400 820 100 dimor 55 120
300 65 1300 89 760 dipmor 91 85 110 460 260 160 92 dipip 110 78 960
86 480 100 320 dippip 290 250 1200 260 210 220 220
Example 8
Predicted Activities for Compounds of Formula IV
[0349] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula IV wherein R.sub.6 and R.sub.8 are hydrogen, and R.sub.7 is
Y.sub.1 (Ar--Y.sub.2). Substitutions for R.sub.4 and Y.sub.2 were
made as shown in Table 8 below. In this set of data the compound
with the lowest predicted IC.sub.50, 170 nM, had R.sub.4=dippip and
Y.sub.2=diamine.
TABLE-US-00008 TABLE 8 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 1300 1200 1300 1300 510 1300 1300 diamine
560 1200 1300 1200 640 1300 400 dipamine 1100 1200 920 560 600 470
470 dimor 180 1100 540 860 420 1100 470 dipmor 690 830 460 380 310
300 500 dipip 200 520 370 660 980 1100 390 dippip 410 170 730 1200
500 1200 560
Example 9
Predicted Activities for Compounds of Formula IV
[0350] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula IV wherein R.sub.6 and R.sub.7 are hydrogen, and R.sub.8 is
Y.sub.1 (Ar--Y.sub.2). Substitutions for R.sub.4 and Y.sub.2 were
made as shown in Table 9 below. In this set of data the compound
with the lowest predicted IC.sub.50, 340 nM, had R.sub.4=dipmor and
Y.sub.2=dimor.
TABLE-US-00009 TABLE 9 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 1300 1900 1900 1600 1600 1500 1600 diamine
1200 1600 350 1500 1300 1400 380 dipamine 810 560 1200 1300 1300
1200 1200 dimor 1200 1500 1200 1300 1200 1200 1200 dipmor 1200 1300
1500 340 1400 1300 1100 dipip 1200 1500 1300 1300 1200 1200 610
dippip 1100 1400 460 830 1200 780 1200
Example 10
Predicted Activities for Compounds of Formula IV
[0351] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula IV wherein R.sub.7 is hydrogen, R.sub.6 is Y.sub.2, and
R.sub.8 is Y.sub.3 (unsubstituted phenyl). Substitutions for
R.sub.4 and Y.sub.2 were made as shown in Table 10 below. In this
set of data the compound with the lowest predicted IC.sub.50, 100
nM, had R.sub.4=dippip and Y.sub.2=
TABLE-US-00010 TABLE 10 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 1200 1600 620 1300 730 1400 490 diamine
730 480 990 1300 660 790 810 dipamine 750 1200 380 310 1300 240 950
dimor 1200 1200 1600 1200 1400 220 440 dipmor 330 700 1600 1300
1300 1400 1000 dipip 350 1200 880 1100 1100 320 330 dippip 100 1300
120 1200 170 1200 460
Example 11
Predicted Activities for Compounds of Formula V
[0352] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula V wherein R.sub.1, R.sub.3, R.sub.7, and R.sub.8 are
hydrogen, and R.sub.6 is Y.sub.1 (Ar--Y.sub.2). Substitutions for
R.sub.4 and Y.sub.2 were made as shown in Table 11 below. In this
set of data the compound with the lowest predicted IC.sub.50, 38
nM, had R.sub.4=diamine and Y.sub.2=dippip.
TABLE-US-00011 TABLE 11 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 56 56 52 58 93 72 72 diamine 42 42 58 50
45 42 38 dipamine 73 83 63 79 65 82 62 dimor 59 54 56 65 54 61 60
dipmor 88 62 50 71 65 69 69 dipip 43 40 65 65 60 52 56 dippip 75 77
85 73 52 88 64
Example 12
Predicted Activities for Compounds of Formula V
[0353] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula V wherein R.sub.1, R.sub.3, R.sub.6, and R.sub.8 are
hydrogen, and R.sub.7 is Y.sub.i (Ar--Y.sub.2). Substitutions for
R.sub.4 and Y.sub.2 were made as shown in Table 12 below. In this
set of data the compound with the lowest predicted IC.sub.50, 4.7
nM, had R.sub.4=pip and Y.sub.2=dipamine. Eleven additional
compounds in this set of data had predicted IC.sub.50 values less
than or equal to 30 nM.
TABLE-US-00012 TABLE 12 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 49 37 4.7 44 37 42 38 diamine 57 30 38 35
19 35 34 dipamine 87 29 5.6 28 29 39 65 dimor 54 37 41 36 39 34 26
dipmor 65 34 30 56 28 35 33 dipip 49 43 16 31 33 9.2 36 dippip 45
41 31 38 40 31 70
Example 13
Predicted Activities for Compounds of Formula V
[0354] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula V wherein R.sub.1, R.sub.3, R.sub.6, and R.sub.7 are
hydrogen, and R.sub.8 is Y.sub.1 (Ar--Y.sub.2). Substitutions for
R.sub.4 and Y.sub.2 were made as shown in Table 13 below. In this
set of data the compound with the lowest predicted IC.sub.50, 110
nM, had R.sub.4=dipamine and Y.sub.2=pip.
TABLE-US-00013 TABLE 13 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 2000 580 2000 310 1900 140 570 diamine 160
750 970 1200 680 270 1100 dipamine 110 240 270 230 600 330 240
dimor 240 1000 670 370 880 1200 1300 dipmor 140 450 590 250 510 360
470 dipip 170 750 620 490 390 1100 400 dippip 140 520 440 270 510
390 350
Example 14
Predicted Activities for Compounds of Formula V
[0355] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula V wherein R.sub.1, R.sub.6, R.sub.7, and R.sub.8 are
hydrogen, and R.sub.3 is Y.sub.1 (Ar--Y.sub.2). Substitutions for
R.sub.4 and Y.sub.2 were made as shown in Table 14 below. In this
set of data two compounds shared the lowest predicted IC.sub.50, 28
nM; one of these compounds had R.sub.4=dimor and Y.sub.2=dipamine,
and the other compound had R.sub.4=dipip and Y.sub.2=dipamine.
TABLE-US-00014 TABLE 14 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 810 49 33 560 59 58 90 diamine 340 74 130
470 36 80 220 dipamine 850 160 130 230 1200 41 1200 dimor 79 130 28
120 85 160 94 dipmor 510 170 160 590 160 75 150 dipip 350 53 28 100
330 590 100 dippip 480 320 91 250 710 1500 330
Example 15
Predicted Activities for Compounds of Formula V
[0356] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula V wherein R.sub.1, R.sub.3, and R.sub.7 are hydrogen,
R.sub.6 is Y.sub.2, and R.sub.8 is Y.sub.3 (unsubstituted phenyl).
Substitutions for R.sub.4 and Y.sub.2 were made as shown in Table
15 below. In this set of data the compound with the lowest
predicted IC.sub.50, 2.4 nM, had R.sub.4=dippip and Y.sub.2=dipmor.
Two additional compounds in this set of data had predicted
IC.sub.50 values less than or equal to 30 nM.
TABLE-US-00015 TABLE 15 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 87 91 90 78 89 78 83 diamine 210 110 360
750 1100 740 98 dipamine 110 110 100 140 110 130 100 dimor 270 740
940 800 900 210 1000 dipmor 130 98 120 250 130 120 120 dipip 330
310 400 640 580 230 500 dippip 80 100 84 3.1 2.4 3.6 130
Example 16
Predicted Activities for Compounds of Formula V
[0357] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula V wherein R.sub.1, R.sub.6, and R.sub.8 are hydrogen,
R.sub.3 is Y.sub.3 (unsubstituted phenyl), and R.sub.7 is Y.sub.2.
Substitutions for R.sub.4 and Y.sub.2 were made as shown in Table
16 below. In this set of data two compounds shared the lowest
predicted IC.sub.50, 27 nM; one of these compounds had
R.sub.4=dippip and Y.sub.2=dipmor, and the other of these compounds
had R.sub.4=Y.sub.2=dippip. One additional compound in this set of
data had predicted IC.sub.50 value less than or equal to 30 nM.
TABLE-US-00016 TABLE 16 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 160 97 43 100 54 73 34 diamine 320 62 50
200 48 76 39 dipamine 210 70 73 170 96 240 63 dimor 800 210 64 94
680 75 150 dipmor 220 120 270 200 470 350 580 dipip 530 120 54 210
38 200 63 dippip 41 120 28 480 27 31 27
Example 17
Predicted Activities for Compounds of Formula V
[0358] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula V wherein R.sub.3, R.sub.6, and R.sub.8 are hydrogen,
R.sub.1 is Y.sub.3 (unsubstituted phenyl), and R.sub.7 is Y.sub.2.
Substitutions for R.sub.4 and Y.sub.2 were made as shown in Table
17 below. In this set of data the compound with the lowest
predicted IC.sub.50, 31 nM, had R.sub.4=dippip and Y.sub.2=pip.
TABLE-US-00017 TABLE 17 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 310 150 100 250 210 270 110 diamine 1200
1900 1400 2000 1900 1500 1900 dipamine 490 320 250 400 590 1400 280
dimor 400 2000 2000 2300 2100 2100 1300 dipmor 790 440 190 660 540
960 180 dipip 170 1500 1200 1400 1200 1600 140 dippip 78 350 150
480 440 510 480
Example 18
Predicted Activities for Compounds of Formula V
[0359] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula V wherein R.sub.3 and R.sub.7 are hydrogen, R.sub.6 is
Y.sub.2, and R.sub.8 is Y.sub.3 (unsubstituted phenyl).
Substitutions for R.sub.4 and Y.sub.2 were made as shown in Table
18 below. In this set of data the compound with the lowest
predicted IC.sub.50, 28 nM, had R.sub.4=dimor and
Y.sub.2=dipip.
TABLE-US-00018 TABLE 18 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 170 510 820 1800 640 1100 940 diamine 120
120 150 160 120 130 150 dipamine 810 200 150 740 170 130 480 dimor
66 140 110 140 110 28 170 dipmor 830 330 390 410 580 460 390 dipip
100 110 110 180 200 130 130 dippip 970 570 220 190 270 440 340
Example 19
Predicted Activities for Compounds of Formula VI
[0360] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula VI wherein R.sub.3, R.sub.7, and R.sub.8 are hydrogen, and
R.sub.6 is Y.sub.1 (Ar--Y.sub.2). Substitutions for R.sub.4 and
Y.sub.2 were made as shown in Table 19 below. In this set of data
two compounds shared the lowest predicted IC.sub.50, 33 nM; one of
these compounds had R.sub.4=dipip and Y.sub.2=dipmor, and the other
compound had R.sub.4=Y.sub.2=dipip.
TABLE-US-00019 TABLE 19 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 110 76 53 61 64 38 64 diamine 62 41 45 36
36 35 35 dipamine 160 140 120 110 41 35 71 dimor 73 37 34 37 36 35
36 dipmor 150 38 40 71 75 50 59 dipip 79 35 35 34 33 33 35 dippip
75 40 43 55 38 94 37
Example 20
Predicted Activities for Compounds of Formula VI
[0361] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula VI wherein R.sub.3, R.sub.6, and R.sub.8 are hydrogen, and
R.sub.7 is Y.sub.1 (Ar--Y.sub.2). Substitutions for R.sub.4 and
Y.sub.2 were made as shown in Table 20 below. In this set of data
the compound with the lowest predicted IC.sub.50, 60 nM, had
R.sub.4=diamine and Y.sub.2=dippip.
TABLE-US-00020 TABLE 20 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 75 82 84 85 95 110 78 diamine 81 110 78 74
91 80 60 dipamine 89 120 120 86 120 83 79 dimor 69 78 81 88 92 68
90 dipmor 64 73 68 88 85 99 89 dipip 78 74 74 66 70 92 81 dippip 65
92 78 84 93 83 76
Example 21
Predicted Activities for Compounds of Formula VI
[0362] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula VI wherein R.sub.3, R.sub.6, and R.sub.7 are hydrogen, and
R.sub.8 is Y.sub.1 (Ar--Y.sub.2). Substitutions for R.sub.4 and
Y.sub.2 were made as shown in Table 21 below. In this set of data
the compound with the lowest predicted IC.sub.50, 37 nM, had
R.sub.4=dimor and Y.sub.2=diamine.
TABLE-US-00021 TABLE 21 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 630 110 320 260 370 290 170 diamine 88 130
55 69 100 87 81 dipamine 67 78 59 64 52 59 53 dimor 81 37 53 79 82
62 84 dipmor 140 51 60 79 59 85 70 dipip 89 52 73 55 72 54 68
dippip 73 54 52 52 63 60 61
Example 22
Predicted Activities for Compounds of Formula VI
[0363] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula VI wherein R.sub.6, R.sub.7, and R.sub.8 are hydrogen, and
R.sub.3 is Y.sub.1 (Ar--Y.sub.2). Substitutions for R.sub.4 and
Y.sub.2 were made as shown in Table 22 below. In this set of data
two compounds shared the lowest predicted IC.sub.50, 19 nM; one of
these compounds had R.sub.4=dipip and Y.sub.2=dipamine, and the
other compound had R.sub.4=dipip and Y.sub.2=dipamine. Three
additional compounds in this set of data had predicted IC.sub.50
values less than or equal to 30 nM.
TABLE-US-00022 TABLE 22 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 50 23 27 36 39 55 43 diamine 46 55 76 86
210 42 150 dipamine 51 110 360 96 79 99 340 dimor 42 57 95 43 97 74
120 dipmor 80 54 100 320 80 82 150 dipip 45 19 19 46 220 93 81
dippip 54 87 230 27 4410 110 110
Example 23
Predicted Activities for Compounds of Formula VI
[0364] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula VI wherein R.sub.1, R.sub.6, and R.sub.8 are hydrogen,
R.sub.3 is Y.sub.3 (unsubstituted phenyl), and R.sub.7 is Y.sub.2.
Substitutions for R.sub.4 and Y.sub.2 were made as shown in Table
23 below. In this set of data the compound with the lowest
predicted IC.sub.50, 41 nM, had R.sub.4=dipmor and
Y.sub.2=dipip.
TABLE-US-00023 TABLE 23 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 510 57 49 270 80 66 88 diamine 440 79 67
170 450 180 520 dipamine 290 110 190 930 500 150 460 dimor 300 120
74 69 200 69 640 dipmor 190 150 71 780 320 41 330 dipip 490 46 100
440 340 57 290 dippip 290 52 69 110 1100 660 670
Example 24
Predicted Activities for Compounds of Formula VI
[0365] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula VI wherein R.sub.1, R.sub.6, and R.sub.8 are hydrogen,
R.sub.3 is Y.sub.3 (unsubstituted phenyl), and R.sub.7 is Y.sub.2.
Substitutions for R.sub.4 and Y.sub.2 were made as shown in Table
24 below. In this set of data the compound with the lowest
predicted IC.sub.50, 31 nM, had R.sub.4=dippip and
Y.sub.2=diamine.
TABLE-US-00024 TABLE 24 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 360 39 56 100 110 48 140 diamine 530 160
87 150 94 64 78 dipamine 540 60 150 180 910 96 330 dimor 440 32 75
150 150 68 130 dipmor 240 59 200 130 100 81 150 dipip 340 51 77 140
37 36 88 dippip 290 31 62 250 160 52 400
Example 25
Predicted Activities for Compounds of Formula VII
[0366] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula VII wherein R.sub.1, R.sub.3, R.sub.7, and R.sub.8 are
hydrogen, and R.sub.6 is Y.sub.1 (Ar--Y.sub.2). Substitutions for
R.sub.4 and Y.sub.2 were made as shown in Table 25 below. In this
set of data the compound with the lowest predicted IC.sub.50, 38
nM, had R.sub.4=dipamine and Y.sub.2=diamine.
TABLE-US-00025 TABLE 25 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 250 120 130 110 110 110 220 diamine 79 60
270 130 120 290 69 dipamine 160 38 240 170 650 400 580 dimor 78 130
99 88 100 160 1300 dipmor 350 250 670 150 250 57 100 dipip 110 120
66 130 130 110 77 dippip 150 190 150 140 120 100 130
Example 26
Predicted Activities for Compounds of Formula VII
[0367] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula VII wherein R.sub.1, R.sub.3, R.sub.6, and R.sub.8 are
hydrogen, and R.sub.7 is Y.sub.1 (Ar--Y.sub.2). Substitutions for
R.sub.4 and Y.sub.2 were made as shown in Table 26 below. In this
set of data the compound with the lowest predicted IC.sub.50, 22
nM, had R.sub.4=dimor and Y.sub.2=dippip.
TABLE-US-00026 TABLE 26 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 2100 110 120 91 110 100 110 diamine 120
110 93 97 100 77 82 dipamine 410 120 210 130 110 91 95 dimor 98 94
90 74 98 120 22 dipmor 170 88 110 110 120 35 120 dipip 140 100 81
130 110 73 87 dippip 100 99 110 76 120 190 120
Example 27
Predicted Activities for Compounds of Formula VII
[0368] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula VII wherein R.sub.1, R.sub.3, R.sub.6, and R.sub.7 are
hydrogen, and R.sub.3 is Y.sub.1 (Ar--Y.sub.2). Substitutions for
R.sub.4 and Y.sub.2 were made as shown in Table 27 below. In this
set of data the compound with the lowest predicted IC.sub.50, 130
nM, had R.sub.4=dipamine and Y.sub.2=dippip.
TABLE-US-00027 TABLE 27 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 1400 1200 1200 330 700 690 660 diamine 510
1300 240 390 310 820 160 dipamine 610 780 290 490 360 270 130 dimor
680 1700 220 220 230 180 280 dipmor 230 340 620 1300 230 280 710
dipip 410 350 220 350 240 200 220 dippip 410 320 820 630 210 420
180
Example 28
Predicted Activities for Compounds of Formula VII
[0369] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula VII wherein R.sub.6, R.sub.7, and R.sub.8 are hydrogen, and
R.sub.3 is Y.sub.1 (Ar--Y.sub.2). Substitutions for R.sub.4 and
Y.sub.2 were made as shown in Table 28 below. In this set of data
the compound with the lowest predicted IC.sub.50, 18 nM, had
R.sub.4=Y.sub.2=dimor. Three additional compounds in this set of
data had predicted IC.sub.50 values less than or equal to 30
nM.
TABLE-US-00028 TABLE 28 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 43 59 87 90 130 96 40 diamine 42 62 120 65
42 35 250 dipamine 71 93 140 140 75 130 110 dimor 36 37 120 18 280
190 85 dipmor 75 49 30 110 170 440 70 dipip 40 38 89 48 88 38 170
dippip 58 24 26 200 230 88 170
Example 29
Predicted Activities for Compounds of Formula VII
[0370] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula VII wherein R.sub.1, R.sub.3, and R.sub.7 are hydrogen,
R.sub.6 is Y.sub.2, and R.sub.8 is Y.sub.3 (unsubstituted phenyl).
Substitutions for R.sub.4 and Y.sub.2 were made as shown in Table
29 below. In this set of data the compound with the lowest
predicted IC.sub.50, 95 nM, had R.sub.4=dipamine and
Y.sub.2=dipip.
TABLE-US-00029 TABLE 29 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 2000 1900 1100 1200 840 730 790 diamine
220 250 1000 300 210 280 390 dipamine 1500 210 920 1800 1600 95 610
dimor 400 180 900 320 370 240 780 dipmor 1600 1700 730 1000 1200
1400 580 dipip 470 290 250 520 380 170 210 dippip 200 440 1300 1700
920 1000 820
Example 30
Predicted Activities for Compounds of Formula X
[0371] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula X wherein R.sub.3, R.sub.6, R.sub.7, and R.sub.8 are
hydrogen, and Y.sub.1 is Ar--Y.sub.2. Substitutions for R.sub.4 and
Y.sub.2 were made as shown in Table 30 below. In this set of data
the compound with the lowest predicted IC.sub.50, 29 nM, had
R.sub.4=pip and Y.sub.2=dippip.
TABLE-US-00030 TABLE 30 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 66 39 48 33 42 65 29 diamine 64 78 58 36
58 95 180 dipamine 220 160 48 120 96 43 170 dimor 120 110 44 120 62
54 45 dipmor 180 53 340 46 350 190 54 dipip 110 100 100 61 32 67 72
dippip 51 170 160 110 80 66 190
Example 31
Predicted Activities for Compounds of Formula XI
[0372] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XI wherein R.sub.3, R.sub.6, R.sub.7, and R.sub.8 are
hydrogen, and Y.sub.1 is Ar--Y.sub.2. Substitutions for R.sub.4 and
Y.sub.2 were made as shown in Table 31 below. In this set of data
the compound with the lowest predicted IC.sub.50, 0.82 nM, had
R.sub.4=dipip and Y.sub.2=dimor. Forty-two additional compounds in
this set of data had predicted IC.sub.50 values less than or equal
to 30 nM.
TABLE-US-00031 TABLE 31 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 4.6 1.7 6.6 3.2 2.4 2.8 4.5 diamine 18 2.8
4.5 0.89 1.8 2.7 25 dipamine 8.8 3.1 4.6 1.5 2.1 2.6 27 dimor 34
3.1 1.6 1.1 34 1.9 4.3 dipmor 35 1.5 29 2.5 32 2.7 1.9 dipip 47 11
1.5 0.82 1.6 2.3 7.3 dippip 90 1.1 2.9 1.1 9.5 14 12
Example 32
Predicted Activities for Compounds of Formula XIV
[0373] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XIV wherein R.sub.3, R.sub.7, and R.sub.8 are hydrogen and
R.sub.6 is Y.sub.3. Substitutions for R.sub.4 and Y.sub.2 were made
as shown in Table 32 below. In this set of data the compound with
the lowest predicted IC.sub.50, 49 nM, had R.sub.4=dippip and
Y.sub.2=dipip. One additional compound in this set of data had a
predicted IC.sub.50 value less than or equal to 30 nM.
TABLE-US-00032 TABLE 32 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 86 51 53 48 53 51 55 diamine 350 150 230
1100 88 110 360 dipamine 100 36 140 93 98 38 170 dimor 570 170 130
490 160 260 97 dipmor 94 35 260 110 470 170 120 dipip 160 240 93
280 200 120 290 dippip 140 6.8 66 190 70 2 35
Example 33
Predicted Activities for Compounds of Formula XIV
[0374] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XIV wherein R.sub.3, R.sub.6, and R.sub.7 are hydrogen and
R.sub.8 is Y.sub.3. Substitutions for R.sub.4 and Y.sub.2 were made
as shown in Table 33 below. In this set of data the compound with
the lowest predicted IC.sub.50, 44 nM, had R.sub.4=dimor and
Y.sub.2=pip.
TABLE-US-00033 TABLE 33 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 260 300 110 180 100 600 150 diamine 280
680 330 89 320 150 46 dipamine 46 1000 580 200 390 230 93 dimor 44
1400 120 1300 160 970 390 dipmor 580 460 1100 810 620 1000 310
dipip 370 220 120 310 130 56 190 dippip 72 95 740 1100 950 63
160
Example 34
Predicted Activities for Compounds of Formula XV
[0375] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XV wherein R.sub.7 and R.sub.8 are hydrogen and R.sub.6 is
Y.sub.3. Substitutions for R.sub.4 and Y.sub.2 were made as shown
in Table 34 below. In this set of data the compound with the lowest
predicted IC.sub.50, 39 nM, had R.sub.4 dipmor and
Y.sub.2=diamine.
TABLE-US-00034 TABLE 34 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 89 43 71 40 46 39 54 diamine 200 1500 54
1300 140 1300 550 dipamine 79 40 62 85 130 66 370 dimor 190 1200
110 1200 53 740 250 dipmor 85 39 71 42 150 240 95 dipip 190 330 150
1400 370 150 69 dippip 88 49 95 54 52 49 42
Example 35
Predicted Activities for Compounds of Formula XV
[0376] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XV wherein R.sub.6 and R.sub.7 are hydrogen and R.sub.8 is
Y.sub.3. Substitutions for R.sub.4 and Y.sub.2 were made as shown
in Table 35 below. In this set of data the compound with the lowest
predicted IC.sub.50, 49 nM, had R.sub.4=dipamine and
Y.sub.2=dipip.
TABLE-US-00035 TABLE 35 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 240 780 120 570 120 520 150 diamine 230
290 150 1100 140 500 110 dipamine 510 250 370 500 730 49 710 dimor
58 1400 230 520 230 1400 590 dipmor 750 1000 740 520 1200 1500 870
dipip 410 1300 110 57 130 1200 550 dippip 650 160 480 1300 400 1400
1200
Example 36
Predicted Activities for Compounds of Formula XVI
[0377] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XVI wherein R.sub.3, R.sub.7, and R.sub.8 are hydrogen and
R.sub.6 is Y.sub.3. Substitutions for R.sub.4 and Y.sub.2 were made
as shown in Table 36 below. In this set of data the compound with
the lowest predicted IC.sub.50, 62 nM, had R.sub.4=dippip and
Y.sub.2=dipamine.
TABLE-US-00036 TABLE 36 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 97 210 110 1400 500 280 220 diamine 290 75
84 170 520 73 240 dipamine 310 240 110 210 140 110 280 dimor 230 74
100 170 290 87 73 dipmor 130 200 93 170 400 77 170 dipip 120 180 79
160 300 270 240 dippip 140 140 62 200 240 80 250
Example 37
Predicted Activities for Compounds of Formula XVI
[0378] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XVI wherein R.sub.3, R.sub.6, and R.sub.7 are hydrogen and
R.sub.8 is Y.sub.3. Substitutions for R.sub.4 and Y.sub.2 were made
as shown in Table 37 below. In this set of data the compound with
the lowest predicted IC.sub.50, 50 nM, had R.sub.4=diamine and
Y.sub.2=dipip.
TABLE-US-00037 TABLE 37 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 480 440 1400 1300 1200 380 1200 diamine
210 270 600 350 720 50 870 dipamine 340 710 400 130 310 350 740
dimor 1200 820 1400 1000 1300 340 1100 dipmor 1500 420 1200 590
1500 880 1300 dipip 220 550 970 860 1500 1200 1200 dippip 150 390
120 170 1500 96 1300
Example 38
Predicted Activities for Compounds of Formula XVII
[0379] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XVII wherein R.sub.3, R.sub.7, and R.sub.8 are hydrogen and
R.sub.6 is Y.sub.3. Substitutions for R.sub.4 and Y.sub.2 were made
as shown in Table 38 below. In this set of data the compound with
the lowest predicted IC.sub.50, 22 nM, had R.sub.4=dippip and
Y.sub.2=dipip.
TABLE-US-00038 TABLE 38 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 44 39 59 39 80 38 110 diamine 81 160 94
170 180 240 120 dipamine 81 160 130 53 56 99 180 dimor 89 240 310
300 200 310 160 dipmor 75 31 61 61 280 85 270 dipip 170 240 120 500
240 200 230 dippip 60 41 72 55 35 22 31
Example 39
Predicted Activities for Compounds of Formula XX
[0380] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XX wherein R.sub.3, R.sub.7, and R.sub.8 are hydrogen and
R.sub.6 is Y.sub.2. Substitutions for R.sub.4 and Y.sub.2 were made
as shown in Table 39 below. In this set of data the compound with
the lowest predicted IC.sub.50, 16 nM, had R.sub.4=dippip and
Y.sub.2=pip. Five additional compounds in this set of data had
predicted IC.sub.50 values less than or equal to 30 nM.
TABLE-US-00039 TABLE 39 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 42 31 30 32 57 35 55 diamine 40 57 130 50
62 80 100 dipamine 14 56 72 30 190 41 180 dimor 17 42 140 64 100 85
79 dipmor 47 44 130 32 110 73 110 dipip 17 42 77 72 87 68 100
dippip 16 55 140 66 53 96 130
Example 40
Predicted Activities for Compounds of Formula XXI
[0381] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXI wherein R.sub.7 and R.sub.8 are hydrogen and R.sub.6 is
Y.sub.2. Substitutions for R.sub.4 and Y.sub.2 were made as shown
in Table 40 below. In this set of data the compound with the lowest
predicted IC.sub.50, 9.4 nM, had R.sub.4=dipmor and Y.sub.2=pip.
Five additional compounds in this set of data had predicted
IC.sub.50 values less than or equal to 30 nM.
TABLE-US-00040 TABLE 40 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 55 35 61 33 48 42 71 diamine 25 62 49 39
98 68 42 dipamine 15 70 62 61 53 63 51 dimor 18 55 120 64 100 69
120 dipmor 9.4 58 63 63 150 54 75 dipip 24 44 120 72 110 32 110
dippip 17 71 54 57 83 67 150
Example 41
Predicted Activities for Compounds of Formula XXI
[0382] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXI wherein R.sub.6 and R.sub.8 are hydrogen and R.sub.7 is
Y.sub.2. Substitutions for R.sub.4 and Y.sub.2 were made as shown
in Table 41 below. In this set of data the compound with the lowest
predicted IC.sub.50, 8.7 nM, had R.sub.4=dippip and Y.sub.2=pip.
Two additional compounds in this set of data had predicted
IC.sub.50 values less than or equal to 30 nM.
TABLE-US-00041 TABLE 41 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 360 71 87 83 80 77 69 diamine 68 60 59 45
53 39 65 dipamine 40 40 180 67 89 48 120 dimor 78 62 84 50 76 50 64
dipmor 12 29 73 57 60 32 66 dipip 43 34 69 62 56 61 76 dippip 8.7
56 47 55 73 70 72
Example 42
Predicted Activities for Compounds of Formula XXII
[0383] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXII wherein R.sub.3, R.sub.7, and R.sub.8 are hydrogen and
R.sub.6 is Y.sub.2. Substitutions for R.sub.4 and Y.sub.2 were made
as shown in Table 42 below. In this set of data the compound with
the lowest predicted IC.sub.50, 36 nM, had R.sub.4=dipip and
Y.sub.2=pip.
TABLE-US-00042 TABLE 42 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 46 61 75 4 620 50 120 diamine 41 62 57 120
170 250 63 dipamine 55 84 280 300 1300 190 1500 dimor 53 80 330 53
59 92 81 dipmor 49 130 86 780 1000 360 1100 dipip 36 80 56 850 100
170 240 dippip 44 61 180 100 610 120 440
Example 43
Predicted Activities for Compounds of Formula XXII
[0384] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXII wherein R.sub.3, R.sub.6, and R.sub.8 are hydrogen and
R.sub.7 is Y.sub.2. Substitutions for R.sub.4 and Y.sub.2 were made
as shown in Table 43 below. In this set of data the compound with
the lowest predicted IC.sub.50, 26 nM, had R.sub.4=dimor and
Y.sub.2=dipmor. Two additional compounds in this set of data had
predicted IC.sub.50 values less than or equal to 30 nM.
TABLE-US-00043 TABLE 43 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 280 540 230 1200 1200 1200 1600 diamine 78
42 48 130 720 86 77 dipamine 57 40 110 200 140 69 58 dimor 91 61
150 220 26 74 770 dipmor 59 48 64 470 730 76 730 dipip 110 41 40 76
280 71 76 dippip 39 180 240 930 290 76 190
Example 44
Predicted Activities for Compounds of Formula XXIII
[0385] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXIII wherein R.sub.3, R.sub.7, and R.sub.8 are hydrogen
and R.sub.6 is Y.sub.2. Substitutions for R.sub.4 and Y.sub.2 were
made as shown in Table 44 below. In this set of data the compound
with the lowest predicted IC.sub.50, 9.7 nM, had R.sub.4=dippip and
Y.sub.2=pip. Five additional compounds in this set of data had
predicted IC.sub.50 values less than or equal to 30 nM.
TABLE-US-00044 TABLE 44 Y.sub.2 pip diamine dipamine dimor dipmor
dipip dippip R.sub.4 pip 98 54 75 45 68 56 67 diamine 36 55 57 42
68 61 200 dipamine 16 69 110 55 260 87 250 dimor 25 52 49 72 48 70
99 dipmor 16 51 83 74 99 73 22 dipip 23 37 76 100 94 45 94 dippip
9.7 72 73 120 110 50 110
Example 45
Predicted Activities for Compounds of Formula XXX
[0386] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXX wherein each of R.sub.3, R.sub.15, R.sub.5, R.sub.6,
R.sub.7, and R.sub.8 is hydrogen, and each of Q.sub.p and Q.sub.o
is Y.sub.2. Substitutions for Q.sub.p and Q.sub.o were made as
shown in Table 45 below. In this set of data the compound with the
lowest predicted IC.sub.50, 2.9 nM, had Q.sub.p=dipip and
Q.sub.o=pip. Eighteen additional compounds in this set of data had
predicted IC.sub.50 values less than or equal to 30 nM.
TABLE-US-00045 TABLE 45 Q.sub.p pip diamine dipamine dimor dipmor
dipip dippip Q.sub.o pip 26 17 5.3 8.3 4.6 2.9 14 diamine 26 45 41
33 50 19 42 dipamine 31 24 40 40 44 52 52 dimor 608 5.3 22 13 23 38
40 dipmor 30 36 67 53 45 42 49 dipip 34 36 6.9 45 43 6.5 42 dippip
38 6 55 52 84 13 5.9
Example 46
Predicted Activities for Compounds of Formula XXXI
[0387] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXXI wherein each of R.sub.3, R.sub.15, R.sub.5, R.sub.7,
and R.sub.8 is hydrogen; and each of R.sub.6 and Q is Y.sub.2.
Substitutions for R.sub.6 and Q were made as shown in Table 46
below. In this set of data two compounds shared the lowest
predicted IC.sub.50, 32 nM; one of these compounds had Q=dipmor and
R.sub.6=dippip, and the other had Q=dipip and R.sub.6=diamine.
TABLE-US-00046 TABLE 46 Q pip diamine dipamine dimor dipmor dipip
dippip R.sub.6 pip 67 41 50 43 50 40 72 diamine 67 48 41 49 38 32
38 dipamine 73 35 47 49 60 38 38 dimor 57 38 55 39 46 35 38 dipmor
68 37 60 46 44 36 40 dipip 59 34 45 46 50 35 45 dippip 57 35 36 44
32 36 33
Example 47
Predicted Activities for Compounds of Formula XXXII
[0388] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXXII wherein each of R.sub.15, R.sub.5, R.sub.6, R.sub.7,
and R.sub.3 is hydrogen, and each of Q.sub.p and Q.sub.o is
Y.sub.2. Substitutions for Q.sub.p and Q.sub.o were made as shown
in Table 47 below. In this set of data two compounds shared the
lowest predicted IC.sub.50, 1.5 nM; one of these compounds had
Q.sub.p=dipamine and Q.sub.o=pip, and the other compound had
Q.sub.1=dipip and Q.sub.2=pip. Thirty-four additional compounds in
this set of data had predicted IC.sub.50 values less than or equal
to 30 nM.
TABLE-US-00047 TABLE 47 Q.sub.p pip diamine dipamine dimor dipmor
dipip dippip Q.sub.o pip 13 8.8 1.5 5.9 2.3 1.5 4.5 diamine 2 8.8
1.9 40 43 18 45 dipamine 38 35 9.5 48 51 17 57 dimor 11 2.9 25 26
2.3 6.2 40 dipmor 17 9.3 11 46 13 17 53 dipip 13 7.9 4.3 7.9 13 48
2.7 dippip 14 16 13 16 66 12 18
Example 48
Predicted Activities for Compounds of Formula XXXIII
[0389] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXXIII wherein each of R.sub.15, R.sub.5, R.sub.7, and
R.sub.8 is hydrogen; and each of R.sub.6 and Q is Y.sub.2.
Substitutions for R.sub.6 and Q were made as shown in Table 48
below. In this set of data the compound with the lowest predicted
IC.sub.50, 33 nM, had Q=R.sub.6=dippip.
TABLE-US-00048 TABLE 48 Q pip diamine dipamine dimor dipmor dipip
dippip R.sub.6 pip 83 70 57 53 62 53 160 diamine 56 35 75 40 46 41
49 dipamine 65 40 46 45 37 49 44 dimor 59 47 52 53 50 44 43 dipmor
64 51 56 48 45 40 40 dipip 60 41 59 44 46 36 45 dippip 61 49 54 47
53 40 33
Example 49
Predicted Activities for Compounds of Formula XXXIV
[0390] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXXIV wherein each of R.sub.1, R.sub.3, R.sub.15, R.sub.6,
R.sub.7, and R.sub.8 is hydrogen, and each of Q.sub.p and Q.sub.o
is Y.sub.2. Substitutions for Q.sub.p and Q.sub.o were made as
shown in Table 49 below. In this set of data the compound with the
lowest predicted IC.sub.50, 26 nM, had Q.sub.p=Q.sub.o=pip.
TABLE-US-00049 TABLE 49 Q.sub.p pip diamine dipamine dimor dipmor
dipip dippip Q.sub.o pip 26 40 180 86 480 63 55 diamine 240 82 110
1200 180 75 40 dipamine 100 35 300 1100 340 77 330 dimor 43 57 490
1200 1200 100 48 dipmor 61 33 150 210 1200 1200 1100 dipip 42 51 54
80 33 93 740 dippip 54 140 180 1400 120 140 340
Example 50
Predicted Activities for Compounds of Formula XXXV
[0391] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXXV wherein each of R.sub.3, R.sub.15, R.sub.7, and
R.sub.8 is hydrogen; and each of R.sub.6 and Q is Y.sub.2.
Substitutions for R.sub.6 and Q were made as shown in Table 50
below. In this set of data the compound with the lowest predicted
IC.sub.50, 31 nM, had Q=dimor and R.sub.6=dippip.
TABLE-US-00050 TABLE 50 Q pip diamine dipamine dimor dipmor dipip
dippip R.sub.6 pip 1200 1200 400 530 220 470 150 diamine 1200 1200
500 1200 1200 1100 1300 dipamine 1300 420 620 1100 1300 720 310
dimor 1200 1200 250 1200 250 1200 700 dipmor 1200 460 590 460 470
1200 200 dipip 1300 1200 1300 1200 430 1100 430 dippip 38 330 35 31
36 38 34
Example 51
Predicted Activities for Compounds of Formula XXXVI
[0392] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXXVI wherein each of R.sub.3, R.sub.15, R.sub.6, R.sub.7,
and R.sub.8 is hydrogen, and each of Q.sub.p and Q.sub.o is
Y.sub.2. Substitutions for Q.sub.p and Q.sub.o were made as shown
in Table 51 below. In this set of data the compound with the lowest
predicted IC.sub.50, 1.5 nM, had Q.sub.p=dipamine and Q.sub.o=pip.
Thirty-five additional compounds in this set of data had predicted
IC.sub.50 values less than or equal to 30 nM.
TABLE-US-00051 TABLE 51 Q.sub.p pip diamine dipamine dimor dipmor
dipip dippip Q.sub.o pip 16 9.1 1.5 6.6 8.6 34 2.9 diamine 25 18 27
4.5 11 26 34 dipamine 40 9.7 22 6.3 33 39 33 dimor 22 12 2.9 32 27
31 32 dipmor 48 8.4 15 18 44 30 28 dipip 18 5.4 7.3 30 22 26 15
dippip 33 28 4 28 29 28 33
Example 52
Predicted Activities for Compounds of Formula XXXVII
[0393] Based on computer modeling, IC.sub.50 values (nM) were
predicted in respect of TLR9 activity for compounds according to
Formula XXXVII wherein each of R.sub.3, R.sub.15, R.sub.7, and
R.sub.8 is hydrogen; and each of R.sub.6 and Q is Y.sub.2.
Substitutions for R.sub.6 and Q were made as shown in Table 52
below. In this set of data the compound with the lowest predicted
IC.sub.50, 26 nM, had Q=dimor and R.sub.6=dippip. Seventeen
additional compounds in this set of data had predicted IC.sub.50
values less than or equal to 30 nM.
TABLE-US-00052 TABLE 52 Q pip diamine dipamine dimor dipmor dipip
dippip R.sub.6 pip 72 29 39 28 31 28 39 diamine 65 32 35 27 36 28
34 dipamine 58 33 31 27 64 30 31 dimor 36 28 37 27 34 31 38 dipmor
38 28 31 27 35 27 35 dipip 36 28 38 27 43 27 43 dippip 55 30 33 26
35 27 33
Example 53
Synthesis of Compound #401-92
Step 1
Preparation of 5-bromoanthranilamide
##STR00082##
[0395] To a stirred slurry of 5-bromoisatoic anhydride (10 gm,
4.13.times.10.sup.-2 moles; Aldrich Chemical, product number
477702) in dry tetrahydrofuran (THF; 50 mL) was added concentrated
ammonium hydroxide solution (20 mL). The anhydride quickly
dissolved forming a clear solution. After about 2 minutes a
biphasic mixture had formed. This was stirred for 1 hour and was
then kept at room temperature overnight. The THF was evaporated
under vacuum to give a thick slurry. Water (20 mL) was added and
the solid product was isolated by filtration. The anthranilamide
was washed with water and dried at 80.degree. C. to provide 6.3 gm
(70.9%) of the product as a white solid. Thin layer chromatography
(TLC; silica, 10% methanol in methylene chloride) showed only the
product spot.
Step 2
Preparation of 6-bromo-2-phenylquinazolin-4-one
##STR00083##
[0397] A mixture of 5-bromoanthranilamide (7.5 gm,
3.49.times.10.sup.-2 moles), benzaldehyde (3.7 gm,
3.49.times.10.sup.-2 moles), sodium metabisulfite (4.98 gm,
2.62.times.10.sup.-2 moles), and water (0.5 mL) in
dimethylacetamide (50 mL) was stirred at 150.degree. C. for 2
hours. The slurry was cooled to 50.degree. C. and water (200 mL)
was added. This slurry was stirred for 10 minutes and was then
filtered to isolate the product. The solid was washed well on the
filter with water. While still damp, the solid product was
recrystallized from dimethylformamide to give the quinazolinone as
an off white solid in a yield of 4.45 gm (42.3%).
Step 3
Preparation of
6-bromo-4-(4-methyl-1-piperazinyl)-2-phenylquinazoline
##STR00084##
[0399] A slurry of 6-bromo-2-phenylquinazolin-4-one (4.44 gm,
1.47.times.10.sup.-2 moles) was stirred and heated in
1,2-dichlorobenzene (40 mL) to 130.degree. C. Phosphorus
oxychloride (4.52 gm, 2.95.times.10.sup.-2 moles) was added to the
stirred, hot mixture over a 5 minute period. The mixture was
stirred at 130.degree. C. until a clear orange solution formed and
then for an additional 30 minutes. The total reaction time was 2
hours. After cooling to room temperature the reaction solution was
diluted with tert-butylmethyl ether (200 mL) and the solution was
shaken in a separatory funnel with water (200 mL). The aqueous
phase (pH=2.0) was discarded and the organic solution was washed
with a solution of sodium hydroxide (5.88 gm, 0.147 moles) in water
(200 mL). The tert-butylmethyl ether was stripped under vacuum to
give a slurry of 6-bromo-4-chloro-2-phenylquinazoline in
1,2-dichlorobenzene.
[0400] This slurry was diluted with n-butanol (40 mL) and
N-methylpiperazine (4.4 gm, 4.4.times.10.sup.-2 moles) was added.
This mixture was heated to reflux which caused the formation of a
clear yellow solution. The solution was kept at reflux for 30
minutes at which point TLC (silica, 10% methanol in methylene
chloride) showed that all of the starting material had been
consumed with the formation of a single product. The solution was
cooled to room temperature and was diluted with tert-butylmethyl
ether (200 mL). This solution was extracted once with 10%
hydrochloric acid (150 mL). These acidic extracts were stirred and
made basic by the addition of 10% sodium hydroxide. The
precipitated product was extracted into methylene chloride (200
mL). Methylene chloride was evaporated under vacuum to provide the
product as an oil in a crude yield of 5.2 gm (92%). The oil was
dissolved in hexane (25 mL) and with scratching, the product
crystallized. The solid was isolated by filtration, washed with
hexane and dried to give 2.5 gm (44.4%) of purified
6-bromo-4-(4-methyl-1-piperazinyl)-2-phenylquinazoline as an off
white solid.
Step 4
Preparation of
6-N-[2-(4-morpholinyl)ethyl]-4-[4-methyl-1-piperazinyl]-2-phenylquinazoli-
ne
##STR00085##
[0402] A mixture of
6-bromo-4-(4-methyl-1-piperazinyl)-2-phenylquinazoline (1.0 gm,
2.6.times.10.sup.-3 moles), tris-dibenzylideneacetone
dipalladium(0) (23.8 mg, 2.6.times.10.sup.-5 moles), racemic
2,2'-Bis(diphenylphosphino)-1,1'-binaphthalene (+/-Binap; 48.6 mg,
7.8.times.10.sup.-5 moles), sodium t-butoxide (350 mg,
3.6.times.10.sup.-3 moles) and toluene (5 mL) was stirred as argon
was passed through. The flask was sealed with a septum and
2-morpholinoethylamine (406 mg, 3.12.times.10.sup.-3 moles)
dissolved in toluene was added by syringe. The reaction mixture was
stirred at 90.degree. C. for 2 hours. TLC of an aliquot (silica,
10% methanol in methylene chloride) showed complete conversion of
the starting quinazoline to a single new product. The mixture was
cooled and diluted with ethyl acetate (100 mL). This was washed
with water (100 mL) and then extracted with 10% hydrochloric acid
(2.times.25 mL). The combined extracts were washed once with ethyl
acetate (25 mL) and were then made basic by the addition of 10%
sodium hydroxide solution. The product that separated from the
basified mixture was extracted into methylene chloride (2.times.25
mL). The combined extracts were evaporated to give
6-N-[2-(4-morpholinyl)ethyl]-4-[4-methyl-1-piperazinyl]-2-phenylquinazoli-
ne as a pale yellow solid in a yield of 1.02 gm (90.7%).
Example 54
Synthesis of Compounds of Formula III
[0403] Compounds of class A3I represent compounds of Formula III
wherein R.sub.6, R.sub.7, and R.sub.8 are hydrogen and R.sub.3 is
Y.sub.1 (Ar--Y.sub.2), as defined herein.
##STR00086##
[0404] Compounds of the A3I class are synthesized in the following
manner. 2-Aminoacetophenone and 4-bromobenzaldehyde are condensed
in the presence of alkali to provide 2-amino-4'-bromochalcone. The
chalcone is cyclized to the dihydroquinolone in the presence of
phosphoric acid and subsequently acetylated with acetic anhydride
as described by Donnelley and Farrell. Donnelly J A et al. (1990) J
Org Chem 55:1757-61. This dihydroquinolone is oxidized and
rearranged in the presence of thallium salts and perchloric acid to
the 3-aryl-4-quinolone as described by Singh and Kapil. Singh O V
et al. (1992) SYNLETT 751-2. Conversion to the 4-chloroquinoline is
achieved by the usual method using phosphorus oxychloride.
Displacement of the chlorine in the 4 position of the quinoline
with a primary or secondary alkyl amine provides the
3-(4-bromophenyl)-4-alkylaminoquinoline which is converted to the
A3I using the Buchwald amination procedure. Buchwald S L et al.
(2004) Org Syn Coll. Vol. 10:423.
Example 55
Synthesis of Compounds of Formula III
[0405] Compounds of class AbI represent compounds of Formula III
wherein R.sub.4 and R.sub.8 are hydrogen, R.sub.3 is Y.sub.3
(unsubstituted phenyl), and R.sub.7 is Y.sub.2, as defined
herein.
##STR00087## ##STR00088##
[0406] Compounds of the form AbI are synthesized using the methods
described in the synthesis of compounds of form A3I (Example 54).
In the case of the AbI compounds, the starting 2-amino-4-bromo is
prepared from the commercially available 2-nitro-4-bromobenzoic
acid by acylation of diethylmalonate followed by hydrolysis and
decarboxylation to 2-nitro-4-bromoacetophenone (Reynolds G A et al.
(1963) Org Syn Coll. Vol. 4:708) and subsequent reduction to
2-amino-4-bromoacetophenone. In the case of the AbI compounds the
bromine on the quinoline ring is displaced with an amine using
Buchwald amination as described earlier.
Example 56
Synthesis of Compounds of Formula XV
[0407] Compounds of class CII represent compounds of Formula XV
wherein R.sub.7 and R.sub.8 are hydrogen and R.sub.6 is Y.sub.3, as
defined herein.
##STR00089##
[0408] CII compounds are made by conversion of 5-bromoisatoic
anhydride to 5-bromoanthranilamide in the presence of ammonium
hydroxide. Condensation with diethyl malonate provides the
2,4-dihydroxy-6-bromoquinazoline. Suzuki coupling (Goodson F E et.
al. (2004) Org Syn Coll. Vol. 10:501) is used to synthesize
2,4-dihydroxy-6-phenylquinazoline which is converted to the
dichloroquinazoline through the use of phosphorus oxychloride.
Sequential displacement of the chlorine in the 4-position of the
quinazoline followed by displacement of the chlorine in the
2-position by the same or different amines provides the CII
compounds.
Example 57
Synthesis of Compounds of Formula XI
[0409] Compounds of class BIV represent compounds of Formula XI
wherein R.sub.3, R.sub.6, R.sub.7, and R.sub.8 are hydrogen and
Y.sub.1 is Ar--Y.sub.2, as defined herein.
##STR00090##
[0410] BIV compounds are prepared by condensation of
3-aminopicolinic acid, via its methyl ester, with
4-bromoacetophenone to give
2-(4-bromophenyl)-4-hydroxynaphthyridine. Conversion to the
4-chloro naphthyridine and displacement of the chlorine first,
followed by the bromine are achieved by methods described
above.
Example 58
Synthesis of Compounds of Formula XXI
[0411] Compounds of class DbII represent compounds of Formula XXI
wherein R.sub.6 and R.sub.8 are hydrogen and R.sub.7 is Y.sub.2, as
defined herein.
##STR00091##
[0412] The starting point for the synthesis of the DbII compounds
is 2-nitro-4-bromobenzoic acid. This is converted to
4-bromoanthranilamide by forming the acid chloride and aminating
this with ammonium hydroxide. Condensation with benzaldehyde in the
presence of sodium bisulfite (Imai Y et al. (1981) Synthesis 1:35)
gives 2-phenyl-4-hydroxy-7-bromoquinazoline. Formation of the DbII
compounds involves the conversion of the 4-hydroxyquinazoline to
the 4-chloroquinazoline followed by displacement of the chlorine
and then the bromine with amines by the methods described
earlier.
Example 59
Synthesis of Compounds of Formula XX
[0413] Compounds of class DI represent compounds of Formula XX
wherein R.sub.3, R.sub.7, and R.sub.8 are hydrogen and R.sub.6 is
Y.sub.2, as defined herein.
##STR00092##
[0414] The synthesis of DI compounds starts with 5-bromoisatoic
anhydride. This is converted to methyl-5-bromoanthranilate by
reaction with methanol. Condensation with acetophenone provides
2-phenyl-4-hydroxy-6-bromoquinoline. This is converted to the
4-chloroquinoline by reaction with phosphorus oxychloride.
Displacement of the chlorine and then the bromine with amines by
the methods described earlier provide the DI compounds
Example 60
Synthesis of Compounds of Formula XIV
[0415] Compounds of class CI represent compounds of Formula XIV
wherein R.sub.3, R.sub.7, and R.sub.8 are hydrogen and R.sub.6 is
Y.sub.3, as defined herein.
##STR00093##
[0416] Condensation of 4-aminobiphenyl with diethyl malonate in
polyphosphoric acid is used to synthesize
2,4-dihydroxy-6-phenylquinoline. This is converted to the
2,4-dichloro-6-phenylquinoline by reaction with phosphorus
oxychloride. Sequential displacement of the chlorine in the
2-position of the quinoline followed by displacement of the
chlorine in the 4-position by the same or different amines (Lister
T et al (2003) Australian Journal of Chemistry 56(9):913-6)
provides the CI compounds.
Example 61
Synthesis of Compounds of Formula XIV
[0417] Compounds of class CaI represent compounds of Formula XIV
wherein R.sub.3, R.sub.6, and R.sub.7 are hydrogen and R.sub.8 is
Y.sub.3, as defined herein.
##STR00094##
[0418] 2-bromoaniline is converted into
2,4-dihydroxy-8-bromoquinoline and subsequently into the CaI
compounds by methods described earlier.
Example 62
Synthesis of Compounds of Formula XV
[0419] Compounds of class A3I represent compounds of Formula XV
wherein R.sub.6 and R.sub.7 are hydrogen and R.sub.8 is Y.sub.3, as
defined herein.
##STR00095## ##STR00096##
[0420] 3-bromoanthranilic acid is converted to 3-phenylanthranilic
acid by Suzuki coupling procedures described above. The
3-phenylanthranilic acid is used to prepare the isatoic anhydride
by reaction with a phosgene equivalent. Ring opening with ammonium
hydroxide provides the anthranilamide which is converted to the
dihydroxyquinazoline by the methods described earlier. Conversion
to the dichloroquinazoline followed by sequential displacement of
the chlorine in the 4-position of the quinazoline and displacement
of the chlorine in the 2-position by the same or different amines
provides the CaII compounds.
Example 63
In Vitro Testing
[0421] Peripheral blood mononuclear cell (PBMC) buffy coat
preparations from healthy male and female human donors were
obtained from the Institute for Hemostaseology and Transfusion
Medicine of the University of Dusseldorf (Germany).
[0422] PBMC were purified by centrifugation over Ficoll-Hypaque
(Sigma). Purified PBMC were washed twice with 1.times.PBS and
resuspended in RPMI 1640 culture medium supplemented with 5% (v/v)
heat-inactivated human AB serum (BioWhittaker, Belgium) or 10%
(v/v) heat-inactivated fetal calf serum (FCS), 1.5 mM L-glutamine,
100 U/ml penicillin and 100 mg/ml streptomycin (all from Sigma,
Deisenhofen, Germany).
[0423] Freshly isolated PBMC were resuspended at a concentration of
3.times.10.sup.6/ml to 5.times.10.sup.6/ml with RPMI 1640 culture
medium and added to 96-well round-bottomed plates (150 .mu.l/well)
which had previously received nothing or selected concentrations
(typically 10 .mu.M-0.085 nM as 7-fold serial dilutions) of small
molecule. To assay antagonist reaction for TLR9, 1 .mu.M CpG
oligodeoxynucleotide (ODN) 2395 (TCGTCGTTTTCGGCGCGCGCCG; SEQ ID
NO:3) was added to wells containing small molecules. To assay
antagonist reaction for TLR7 and TLR8, 0.5 .mu.M
oligoribonucleotide (ORN) R-1362 (UUGUUGUUGUUGUUGUUGUU; SEQ ID
NO:4) complexed to 5 .mu.g/ml DOTAP was added to wells containing
small molecules. To calculate response to CpG ODN 2395 alone or ORN
R-1362+DOTAP alone, wells without small molecules were stimulated
with CpG ODN 2395 or ORN R-1362+DOTAP.
[0424] Cells were cultured in a humidified incubator at 37.degree.
C. for 16 h. Culture supernatants were then collected and, if not
used immediately, frozen at -20.degree. C. until required.
[0425] Amounts of cytokines in the supernatants were assessed using
enzyme-linked immunosorbent assays (ELISA) specific for IFN-.alpha.
or TNF-.alpha. using commercially available antibodies or kits from
BD Pharmingen or Diaclone, respectively. IFN-.alpha. readout using
CpG 2395 was used to measure TLR9 response. IFN-.alpha. readout
using ORN R-1362+DOTAP was used to measure TLR7 response.
TNF-.alpha. release using R-1362 complexed to DOTAP was used to
measure TLR8-mediated immune response.
Example 64
Synthesis and In Vitro Characterization of a Compound from Example
4
##STR00097##
[0426] Synthesis of 2:
[0427] A solution of p-bromophenethyl alcohol (2.23 g, 11.5 mmol)
in dichloromethane (DCM) (20 mL) was treated with Dess-Martin
reagent (6.5 g) at room temperature. After stirring at room
temperature overnight, the solution was diluted with DCM (100 mL),
washed with saturated NaHCO.sub.3, dried (Na.sub.2SO.sub.4), and
purified by column chromatography (EtOAc:hexane=20:80) to provide
the aldehyde 2 (1.0 g, 43%).
Synthesis of 3:
[0428] A mixture of the aldehyde 2 (1.0 g, 5 mmol) with
methylanthranilate (1.03 g, 6.8 mmol) in toluene (1 mL) was stirred
at room temperature for 2 h. To the formed solid was added
additional toluene (6 mL) and ethyl acetate(EtOAc) (5 mL), which
was filtered, washed with hexane, and dried under vacuum to provide
the imine (700 mg).
[0429] To a stirred solution of the imine (700 mg) in
tetrahydrofuran (THF) (10 mL) was added potassium
hexamethyldisilazide (KHMDS) (6.6 mL of 0.5M/toluene, 3.3 mmol) at
-78.degree. C. The resulting dark solution was warmed to room
temperature and stirred for 2 h. To the solution was added H.sub.2O
(10 mL) and the solvents were removed under vacuum. The resulting
residue was purified by column chromatography to provide 3 (120 mg,
.about.8%).
Synthesis of 4:
[0430] A mixture of 3 (114 mg, 0.4 mmol) with POCl.sub.3 (2 mL) was
heated at 100.degree. C. for 4 h. After pouring into ice/H.sub.2O
(10 mL), the mixture was extracted with dichloromethane (20 mL)
followed by EtOAc (20 mL). The combined organic extracts were dried
(Na.sub.2SO.sub.4), passed through a short pad of SiO.sub.2, and
concentrated to provide 4 (142 mg, 100%) as a brown solid. Without
further purification this solid 4 was used for the next
reaction.
Synthesis of 5:
[0431] To a screw-capped vial was placed 4 (142 mg, 0.4 mmol),
followed by N-methylpyrrolidinone (NMP) (3 mL),
2-morpholinoethanamine (160 mg), and diisopropylethylamine (DIEA)
(200 .mu.L). The resulting solution was heated at 160.degree. C.
for 24 h. After concentration, the resulting residue was diluted
with EtOAc (100 mL), washed with saturated NaHCO.sub.3 (50 mL),
dried (Na.sub.2SO.sub.4), and concentrated to give a brown solid,
which was purified by flash chromatography (hexane:EtOAc=50:50 to
0:100) to provide crude product 5 which was used for the next
reaction.
Synthesis of 6 (A3I):
[0432] To a screw-capped vial was placed above 5, followed by
toluene (3 mL), KO-t-Bu (110 mg),
tris(dibenzylideneacetone)dipalladium (0) [Pd.sub.2(dba).sub.3] (34
mg), and 2-(di-tert-butylphosphino)biphenyl (22 mg), and
N-methylpiperazine (124 .mu.L). The suspension was flushed again
with N.sub.2, capped, and the resulting suspension was heated at
100.degree. C. for 2 days. The solution was extracted with EtOAc
(20 mL). Organic extract was dried (Na.sub.2SO.sub.4) and purified
by preparative TLC (DCM:MeOH=80:20) to provide 6. .sup.1H NMR
(CD.sub.3OD, 400 MHz) .delta. 2.25 (br, 4H), 2.35 (s, 3H), 2.39 (t,
2H), 2.63 (t, 4H), 3.26 (m, overlapped with solvent, 4H+2H), 3.49
(t, 4H), 7.10 (d, 2H), 7.35 (d, 2H), 7.51 (t, 1H), 7.66 (t, 1H),
7.84 (d, 1H), 8.20 (d, 1H), 8.27 (s, 1H); LC/MS ES+432 (M+1),
>95% pure.
In Vitro Characterization of 6 (A3I):
[0433] Compound 6 in this example corresponds to a compound of
Formula III with R.sub.6, R.sub.7 and R.sub.8=H; R.sub.3=Y.sub.1
(Ar--Y.sub.2), Y.sub.2=pip; R.sub.4=dimor. See Example 4, Table 4,
Y.sub.2=pip and R.sub.4=dimor. In vitro testing as described in
Example 63 yielded the following results, expressed as IC.sub.50
(nM):
TABLE-US-00053 TLR7 TLR8 TLR9 Experimental 720 110 73 Calculated
75
Example 65
Synthesis and In Vitro Characterization of a Compound from Example
6
##STR00098##
[0434] Synthesis of 3:
[0435] A mixture of 1 (2.3 g, 10 mmol) with phenylacetaldehyde (2.3
mL, 20 mmol) was stirred at room temperature for 2 h. The solid
which formed was filtered, washed with hexane, and dried to provide
2. Without further purification the product was used for the next
reaction.
[0436] To a stirred solution of above 2 in THF (30 mL) was added
lithium diisopropylamide (LDA) (5.5 mL of
2M/heptane/THF/ethylbenzene, 11 mmol) at -78.degree. C. The
resulting dark solution was warmed to room temperature and stirred
for 2 h. To the solution was added H.sub.2O (10 mL) and the organic
layer was removed. The resulting residue was purified by column
chromatography to provide 3 (540 mg, 26%) as a solid.
Synthesis of 4:
[0437] Above 3 (540 mg, 1.8 mmol) with POCl.sub.3 (5 mL) was heated
at reflux overnight. After pouring into ice/H.sub.2O (10 mL), the
mixture was extracted with dichloromethane (20 mL) followed by
EtOAc (20 mL). The combined organic extracts were dried
(Na.sub.2SO.sub.4), passed through a short pad of SiO.sub.2, and
concentrated to provide 4. The crude product was purified by flash
chromatography (EtOAc:hexane=10:90) to provide 4 (270 mg, 47%) as a
solid.
Synthesis of 5:
[0438] To a screw-capped vial was placed 4 (270 mg, 0.85 mmol),
followed by NMP (1 mL), 2-morpholinoethanamine (500 mg), and
diisopropylethylamine (200 .mu.L). The resulting solution was
heated at 170.degree. C. for 18 h. After concentration, the
resulting residue was diluted with EtOAc (100 mL), washed with
saturated NaHCO.sub.3 (50 mL), dried (Na.sub.2SO.sub.4), and
concentrated to give a brown solid, which was purified by flash
chromatography (EtOAc:hexane=80:20 to 100:0) to provide 5 (173 mg,
49%) as a solid.
Synthesis of 6 (AbI):
[0439] To a screw-capped vial was placed above 5 (82 mg, 0.2 mmol),
followed by toluene (3 mL), KO-t-Bu (34 mg, 0.3 mmol),
Pd(OAc).sub.2 (3 mg), N-methylpiperazine (20 mg, 0.2 mmol) and
2-(di-tert-butylphosphino)biphenyl (6 mg). After heating at
100.degree. C. for 2 h, the solution was subjected to purification
by column chromatography (MeOH:DCM=20:80) to give 6 (22 mg, 26%). A
second batch was carried out to obtained additional 6 (.about.20
mg). .sup.1H NMR (CD.sub.3OD, 400 MHz) .delta. 2.25 (br, 4H), 2.38
(br, 2H+3H), 2.68 (br, 4H), 3.09 (t, 2H, J=6.4 Hz), 3.36 (br, 4H),
3.49 (br, 4H), 7.3-7.6 (set of m, 7H), 7.77 (d, 1H, J=8.8 Hz), 8.12
(s, 1H); ES+334 (M+1), >95% pure.
In Vitro Characterization of 6 (AbI):
[0440] Compound 6 in this example corresponds to a compound of
Formula III with R.sub.6 and R.sub.8=H; R.sub.3=Y.sub.3=phenyl;
R.sub.7=Y.sub.2=pip; and R.sub.4=dimor. See Example 6, Table 6,
Y.sub.2=pip and R.sub.4=dimor. In vitro testing as described in
Example 63 yielded the following results, expressed as IC.sub.50
(nM):
TABLE-US-00054 TLR7 TLR8 TLR9 Experimental 180 160 160 Calculated
750
Example 66
Synthesis and In Vitro Characterization of a Compound from Example
31
##STR00099##
[0441] Synthesis of 2:
[0442] A mixture of 1 (2.0 g, 14 mmol) in concentrated
H.sub.2SO.sub.4 (a few drops) in MeOH (5 mL) was heated at reflux
overnight. After concentration the residue was taken up into EtOAc,
washed with saturated NaHCO.sub.3, H.sub.2O, and dried
(Na.sub.2SO.sub.4) to provide 2 (400 mg, 20%) as a yellow
solid.
Synthesis of 3:
[0443] To a stirred solution of NaO-t-Bu (253 mg, 2.6 mmol) in dry
THF (5 mL) was added 4-bromoacetophenone (131 mg, 0.66 mmol) at
0.degree. C. under N.sub.2. To this solution was added 2 (100 mg,
0.66 mmol) at the same temperature. The reaction was warmed to room
temperature and stirred overnight. After addition of H.sub.2O (1
mL), the solution was extracted with EtOAc (20 mL). The organic
extract was dried (Na.sub.2SO.sub.4) and concentrated to give a
dark brown semi-solid, which was subjected to purification by
preparative thin layer chromatography (TLC) (CHCl.sub.3:MeOH=90:10
with 1% of NH.sub.4OH) to obtain 3 (30 mg, 15%) as a pale yellow
film. A mass of 301(mass+1) was determined for this compound by
liquid chromatography/mass spectroscopy. [LC/MS 301(M+1)]
Synthesis of 4:
[0444] A mixture of 3 (22 mg, 0.07 mmol) with POCl.sub.3 (1.5 mL)
and 2,6-lutidine (0.7 mL) was heated at 90.degree. C. for 16 h.
After pouring into ice/H.sub.2O (10 mL), the mixture was extracted
with dichloromethane (20 mL) followed by EtOAc (20 mL). The
combined organic extracts were dried (Na.sub.2SO.sub.4), passed
through a short pad of SiO.sub.2, and concentrated to provide 4 (25
mg) which was used for the next reaction.
Synthesis of 5:
[0445] To a screw-capped vial was placed 4 (25 mg, 0.07 mmol),
followed by NMP (2 mL), 2-morpholinoethanamine (30 mg). Resulting
solution was heated at 170.degree. C. for 16 h. After dilution with
EtOAc, the solution was washed with brine (3.times.), dried
(Na.sub.2SO.sub.4) to obtain 5 (18 mg, 64%), after purification by
column chromatography (dichloromethane/methanol). The compound 5
was used for the next reaction.
Synthesis of 6 (BIV):
[0446] To a screw-capped vial was placed above 5 (17 mg, 0.05
mmol), followed by toluene (2 mL), NaO-t-Bu (15 mg),
Pd.sub.2(dba).sub.3 (14 mg), and 2-(di-tert-butylphosphino)biphenyl
(9 mg), and N-methylpiperazine (17 .mu.L). The reaction was heated
at 100.degree. C. for 4 h. After dilution with EtOAc (3 mL) and 10%
HCl/H.sub.2O (1.5 mL/1.5 mL), the aqueous phase was separated,
neutralized by 2N NaOH, and extracted with EtOAc (2.times.), dried
(Na.sub.2SO.sub.4), and concentrated. The residue was then
recrystallized with CHCl.sub.3 and hexane to provide 6 (11.4 mg,
52%) as a yellow solid. LC/MS ES+433 (M+1), >95% pure.
In Vitro Characterization of 6 (BIV):
[0447] Compound 6 in this example corresponds to a compound of
Formula XI with R.sub.3, R.sub.6, R.sub.7, and R.sub.8=H;
Y.sub.1=Ar--Y.sub.2=pip; and R.sub.4=dimor. See Example 31, Table
31, Y.sub.2=pip and R.sub.4=dimor. In vitro testing as described in
Example 63 yielded the following results, expressed as IC.sub.50
(nM):
TABLE-US-00055 TLR7 TLR8 TLR9 Experimental 70 100 44 Calculated
34
Example 67
Synthesis and In Vitro Characterization of a Compound from Example
32
##STR00100##
[0448] Synthesis of 2:
[0449] A mixture of 1 (3.4 g, 23.7 mmol) in dimethylmalonate (16
mL) was heated at refluxed (ca 150-165.degree. C.) for 20 h. After
concentration, the dark residue was purified by column
chromatography (EtOAc:hexane=25:75 to 40:60) to provide 2 (4.5 g,
80%).
Synthesis of 3 and 4:
[0450] To a stirred solution of 2 (3.3 g, 12.3 mmol) in
chlorobenzene (50 mL) was added portion wise AlCl.sub.3 (4.9 g, 36
mmol) at 0.degree. C. under a N.sub.2 atmosphere. The resulting
solution was heated at 120.degree. C. for 3 h. The dark solution
was slowly poured into ice/H.sub.2O to provide a precipitate. The
solid was collected by filtration, washed with water, and dried to
provide 3.
Without further purification, the product was used for the next
reaction.
[0451] To the above solid was added POCl.sub.3 (15 mL) at room
temperature. The resulting solution was heated at reflux for 3 h.
The reaction was poured into ice/H.sub.2O, and extracted with EtOAc
(3.times.). The combined organic extracts were dried
(Na.sub.2SO.sub.4) and purified by flash chromatography
(DCM:hexane=5:95) to obtain 4 (310 mg, 9.2%) as a solid.
Synthesis of 5:
[0452] To a screw-capped vial was placed 4 (220 mg, 0.8 mmol),
followed by N-methylpyrrolidinone (1.5 mL), 2-morpholinoethanamine
(160 mg), and diisopropylethylamine (300 .mu.L). The resulting
solution was heated at 100.degree. C. for 16 h. After dilution with
EtOAc, the solution was washed with brine (3.times.) and dried
(Na.sub.2SO.sub.4) to provide 5 (262 mg, 63%) after purification by
flash chromatography (EtOAc:hexane=80:20 to MeOH:EtOAc=5:95).
Synthesis of 6 (CI):
[0453] To a screw-capped vial was placed 5 (112 mg, 0.3 mmol),
followed by N-methylpiperazine (2 mL). The resulting solution was
heated at 150.degree. C. for 18 h. After dilution with EtOAc, the
solution was washed with brine (2.times.) and dried
(Na.sub.2SO.sub.4) to provide 6 (48 mg for first crop and 68 mg;
second crop, total 87%) after recrystallization with EtOAc/hexane.
.sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 2.34 (s, 3H), 2.53 (brm,
8H), 2.78 (t, 2H), 3.32 (dd, 2H), 3.73 (br, 8H), 5.74 (br, 1H),
5.93 (s, 1H), 7.32 (t, 1H), 7.44 (t, 2H), 7.72 (set of m, 5H).
LC/MS m/e 432 (M+1).
In Vitro Characterization of 6 (CI):
[0454] Compound 6 in this example corresponds to a compound of
Formula XIV with R.sub.3, R.sub.7, and R.sub.8=H;
R.sub.6=Y.sub.3=phenyl; Y.sub.2=pip; and R.sub.4=dimor. See Example
32, Table 32, Y.sub.2=pip and R.sub.4=dimor. In vitro testing as
described in Example 63 yielded the following results, expressed as
IC.sub.50 (nM):
TABLE-US-00056 TLR7 TLR8 TLR9 Experimental 200 600 200 Calculated
570
Example 68
Synthesis and In Vitro Characterization of a Compound from Example
33
##STR00101##
[0455] Synthesis of 3 and 4:
[0456] To a stirred solution of 2 (8.3 g, 31 mmol), which was
prepared by the same procedure as described before (Synthesis of
CI), in chlorobenzene (80 mL) was added portionwise AlCl.sub.3
(12.3 g, 93 mmol) at 0.degree. C. under a N.sub.2 atmosphere. The
resulting solution was heated at 110-120.degree. C. for 4 h. The
dark solution was slowly poured into ice/H.sub.2O with vigorous
stirring. The resulting solution was extracted with chloroform
(3.times.). The combined organic extracts were washed with brine
and dried (Na.sub.2SO.sub.4). After concentration, the gummy
residue was triturated with EtOAc to afford 3 as a pink powder,
which was washed with EtOAc and hexane. Without further
purification, the product 3 was used for the next reaction.
[0457] To the above 3 was added POCl.sub.3 (30 mL) at room
temperature. The resulting solution was heated at 80.degree. C. for
4 h. The reaction was poured into ice/H.sub.2O (300 mL), and
extracted with EtOAc (3.times.). The combined organic extracts were
washed with saturated NaHCO.sub.3, brine, dried (Na.sub.2SO.sub.4),
and purified by flash chromatography (EtOAc:hexane=3:97) to provide
4 (310 mg, 3.5%) as a solid.
Synthesis of 5:
[0458] To a screw-capped vial was placed 4 (310 mg, 1.1 mmol),
followed by N-methylpyrrolidine (3 mL), 2-morpholinoethanamine (160
mg), and diisopropylethylamine (700 .mu.L). The resulting solution
was heated at 100.degree. C. for 18 h. After dilution with EtOAc,
the solution was washed with brine (3.times.) and dried
(Na.sub.2SO.sub.4) to provide 5 (190 mg, 47%) after purification by
flash chromatography (EtOAc=100 to MeOH:EtOAc=5:95).
Synthesis of 6 (CaI):
[0459] To a screw-capped vial was placed 5 (90 mg, 0.24 mmol),
followed by N-methylpiperazine (2 mL). The resulting solution was
heated at 150.degree. C. for 20 h. After dilution with EtOAc, the
solution was washed with brine (2.times.) and dried
(Na.sub.2SO.sub.4) to provide 6 (49 mg, 46%) after purification by
flash chromatography (EtOAc to MeOH:EtOAc=10:90). .sup.1H NMR
(CDCl.sub.3, 400 MHz) .delta. 2.39 (s, 3H), 2.53 (br, 4H), 2.58
(br, 4H), 2.78 (t, 2H, J=5.6 Hz), 3.31 (m, 2H), 3.68 (br, 4H), 3.74
(br, 4H), 5.75 (br, 1H), 5.91 (s, 1H), 7.24 (t, 1H, overlapped with
solvent), 7.30 (t, 1H), 7.39 (t, 2H), 7.57 (t, 2H), 7.74 (t, 2H).
LC/MS 433 (M+1).
In Vitro Characterization of 6 (CaI):
[0460] Compound 6 in this example corresponds to a compound of
Formula XIV with R.sub.3, R.sub.6, and R.sub.7=H;
R.sub.8=Y.sub.3=phenyl; Y.sub.2=pip; and R.sub.4=dimor. See Example
33, Table 33, Y.sub.2=pip and R.sub.4=dimor. In vitro testing as
described in Example 63 yielded the following results, expressed as
IC.sub.50 (nM):
TABLE-US-00057 TLR7 TLR8 TLR9 Experimental 790 140 250 Calculated
44
Example 69
Synthesis and In Vitro Characterization of a Compound from Example
34
##STR00102##
[0461] Synthesis of 2:
[0462] To a stirred solution of 6-bromoisatoic anhydride 1 (10 g,
41.3 mmol) in THF to (500 mL) was added slowly NH.sub.4OH (20 mL)
at room temperature. The suspension became clear. The solution was
then stirred at room temperature overnight and concentrated to
provide a white solid. The resulting solid was collected by
filtration, washed with H.sub.2O (.about.50 mL), and dried to
afford 2 (6.7 g, 76%) as an off-white solid.
Synthesis of 3:
[0463] A suspension of 2 (500 mg, 2.3 mmol) in THF (6 mL) was
treated with 1,1'-carbonyldimidazole (CDI) (410 mg, 2.5 mmol). The
resulting suspension was heated at 75.degree. C. overnight. During
the reaction, the suspension became clear, then solid was formed.
After concentration, the resulting solid was collected, washed with
dichloromethane, and dried to afford 3 (450 mg, 82%) as a pale
yellow solid. The NMR was consistent with the structure of 3.
Synthesis of 4:
[0464] A solution of 3 (500 mg, 2 mmol) in POCl.sub.3 (4 mL) in a
vial (15 mL) was treated with 2,6-lutidine (1.3 mL) at room
temperature. The resulting suspension was then heated at
140.degree. C. overnight. After pouring into ice/H.sub.2O (10 mL),
the mixture was extracted with dichloromethane (20 mL) followed by
EtOAc (20 mL). The combined organic extracts were dried
(Na.sub.2SO.sub.4), passed through a short pad of SiO.sub.2, and
concentrated to provide 4 (390 mg) as a brown solid. Without
further purification this solid 4 was used for the next
reaction.
Synthesis of 5:
[0465] The product obtained as described in the previous step, 4
(2.3 g) was suspended in EtOH (50 mL) and treated with
diisopropylethylamine (DIEA) (4 mL), followed by
2-morpholinoethylamine (3 mL) at room temperature. The solution was
heated at reflux overnight. After concentration, the resulting
residue was diluted with EtOAc (100 mL), washed with saturated
NaHCO.sub.3 (50 mL), dried (Na.sub.2SO.sub.4), and concentrated to
give a brown solid, which was purified by flash chromatography
(hexane:EtOAc=50:50 to 0:100) to provide 5 (350 mg) as a brown
solid.
Synthesis of 6:
[0466] Monosubstituted quinazoline 5 (320 mg, 0.86 mmol) was
dissolved in isoamyl alcohol (5 mL) and distributed equally into
two vials (15 mL capacity). Each vial was treated with
N-methylpiperazine (200 .mu.L). The resulting solution was heated
at 140.degree. C. overnight. After concentration, the resulting
solid was purified by flash chromatography (EtOAc to DCM:MeOH=95:5
to 80:20) to provide 6 (120 mg) as a solid.
Synthesis of CII:
[0467] The above solid 6 (120 mg, 0.27 mmol) was placed in a vial
(15 mL capacity), followed by phenylboronic acid (66 mg, 0.5 mmol),
Pd(OAc).sub.2 (2 mg), K.sub.2CO.sub.3 (140 mg, 1 mmol), and
Bu.sub.4NBr (12 mg, 0.35 mmol). The mixture was flushed with
N.sub.2 and to this was added H.sub.2O (4 mL) and toluene (2 mL).
The suspension was flushed again with N.sub.2 and capped. The
resulting suspension was heated at 100.degree. C. for 2 days. The
mixture was extracted with EtOAc (20 mL). The organic extract was
dried (Na.sub.2SO.sub.4) and purified by preparative TLC
(DCM:MeOH=80:20) to provide CII (35 mg, 30%) a white solid. .sup.1H
NMR (CDCl.sub.3, 400 MHz) .delta. 2.37 (s, 3H), 2.53 (br, 4H+4H),
2.70 (t, 2H), 3.67 (dd, 2H), 3.74 (t, 4H), 3.97 (br, 4H), 7.3-7.8
(set of t, d, s, 8H, aromatic H); LC/MS 433 (M+1), >98%
pure.
In Vitro Characterization of CII:
[0468] Compound CII in this example corresponds to a compound of
Formula XV with R.sub.7 and R.sub.8=H; R.sub.6=Y.sub.3=phenyl;
Y.sub.2=pip; and R.sub.4=dimor. See Example 34, Table 34,
Y.sub.2=pip and R.sub.4=dimor. In vitro testing as described in
Example 63 yielded the following results, expressed as IC.sub.50
(nM):
TABLE-US-00058 TLR7 TLR8 TLR9 Experimental 630 500 100 Calculated
190
Example 70
Synthesis and In Vitro Characterization of a Compound from Example
39
##STR00103##
[0469] Synthesis of 2:
[0470] To a stirred solution of KHMDS (4 equivalents) in dry THF
was added acetophenone (1 equivalent) at 0.degree. C. under
N.sub.2. To this solution was added 1 (1 equivalent) at the same
temperature. The reaction was warmed to room temperature and
stirred overnight. The reaction was worked up as described for the
synthesis of BIV (See below).
Synthesis of 3:
[0471] Synthesis of 3 from 2 was carried out as described in
Example 66 for the synthesis of 6 (BIV).
Synthesis of 4:
[0472] Synthesis of 4 from 3 was carried out as described in
Example 66 for the synthesis of 6 (BIV).
Synthesis of 5:
[0473] Synthesis of 5 from 4 was carried out as described in
Example 66 for the synthesis of 6 (BIV). MS 432 (M+1), >95%
pure.
In Vitro Characterization of 5 (DI):
[0474] Compound 5 in this example corresponds to a compound of
Formula XX with R.sub.3, R.sub.7, and R.sub.8=H; Y.sub.3=phenyl;
R.sub.6=Y.sub.2=pip; and R.sub.4=dimor. See Example 39, Table 39,
Y.sub.2=pip and R.sub.4=dimor. In vitro testing as described in
Example 63 yielded the following results, expressed as IC.sub.50
(nM):
TABLE-US-00059 TLR7 TLR8 TLR9 Experimental 75 28 72 Calculated
17
Example 71
Synthesis and In Vitro Characterization of a Compound from Example
40
##STR00104##
[0475] Synthesis of 1:
[0476] A mixture of 5-bromoanthranilamide (7.5 g, 3.49 mmol),
benzaldehyde (3.7 g, 3.49 mmol), sodium metabisulfite (4.98 g, 26.2
mmol) and water (0.5 mL) in dimethylacetamide was stirred at
150.degree. C. for 2 h. After this time, the slurry was cooled to
50.degree. C. and water (200 mL) was added. This slurry was stirred
for 10 minutes and was then filtered to isolate the product. The
filter cake was washed with water and was then, while still damp,
recrystallized from DMF. The yield of purified 1 was 4.45 g
(42.3%).
Synthesis of 2 and 3:
[0477] A slurry of 2-phenyl-6-bromoquinazolin-4-one (4.44 g, 14.7
mmol) in 1,2-dichlorobenzene (40 mL) was stirred at 130.degree. C.
as phosphorous oxychloride (4.52 g, 29.5 mmol) was added over 5
minutes. This mixture was stirred at 130.degree. C. until a clear,
pale orange solution formed (about 90 minutes) and then for an
additional 30 minutes longer. After cooling, the solution was
diluted with t-butylmethyl ether (200 mL) and this solution was
shaken with water (200 mL). The aqueous phase was discarded and the
tert-butylmethyl ether (TBME) solution was washed with a solution
of sodium hydroxide (5.9 g) in water (200 mL). The TBME was then
evaporated to give a slurry of 2 in 1,2-dichlorobenzene. This
slurry was diluted with n-butanol (40 mL) and N-methylpiperazine
(4.40 g, 44 mmol) was added. This mixture was heated to reflux
which provided a clear yellow solution. The reaction was examined
by TLC (silica, 10% methanol in methylene chloride) after 30
minutes at reflux and was found to have gone to completion. The
solution was cooled and diluted with TBME (200 mL). This solution
was extracted with 10% HCl (150 mL) and the acidic extracts were
then made basic by the addition of 10% sodium hydroxide solution.
The product that separated from the basic mixture was extracted
into methylene chloride (200 mL). Evaporation of the methylene
chloride under vacuum gave the product 3 as an oil in a yield of
5.2 g (92%). The oil was dissolved in hexane (25 mL) from which it
crystallized as a white powder.
Synthesis of 4:
[0478] The bromoquinazoline 3 (1.0 g, 2.6 mmol) was combined with
tris-(dibenzylideneacetone)dipalladium (0) (23.8 mg,
2.6.times.10.sup.-5 mol), +/-binaphthyl (BINAP) (48.6 mg,
7.8.times.10.sup.-5 mol), sodium tert-butoxide (350 mg, 3.6 mmol)
and toluene (5 mL). This mixture was stirred under nitrogen for 15
minutes and was then treated with 2-aminoethylmorpholine (406 mg,
3.12 mmol) in toluene (3 mL). The reaction was then stirred under
nitrogen for 2 h. The reaction was examined by TLC (silica, 10%
methanol in methylene chloride) after this time and was found to
have gone to completion. After cooling, the reaction mixture was
diluted with ethyl acetate (100 mL) and was washed with water (100
mL). The ethyl acetate solution was then extracted with 10% HCl
(2.times.25 mL). The yellow acidic extracts were combined and were
washed with ethyl acetate (25 mL) after which they were made basic
by the addition of 10% sodium hydroxide solution. The solid which
precipitated was extracted into methylene chloride (2.times.25 mL).
Evaporation of the solvents gave the product 4 as a yellow solid in
a yield of 1.02 g (90.7%). This solid was recrystallized from a
mixture of toluene and hexane.
In Vitro Characterization of 4:
[0479] Compound 4 in this example corresponds to a compound of
Formula XXI with R.sub.7 and R.sub.8=H; Y.sub.3=phenyl;
R.sub.6=Y.sub.2=dimor; and R.sub.4=pip. See Example 40, Table 40,
Y.sub.2=dimor and R.sub.4=pip. In vitro testing as described in
Example 63 yielded the following results, expressed as IC.sub.50
(nM):
TABLE-US-00060 TLR7 TLR8 TLR9 Experimental 170 ND* 53 Calculated 33
*not done
Example 72
Synthesis and In Vitro Characterization of a Compound from Example
40
##STR00105## ##STR00106##
[0480] Synthesis of 2:
[0481] To a suspension of 2-nitro-5-fluorobenzoic acid (20 g, 0.108
mol) in methylene chloride (150 mL) was added thionyl chloride
(14.3 g, 0.12 mol) and DMF (1 mL). This mixture was stirred at
reflux until a clear solution formed (120 min) and then for 30
minutes longer. After cooling the solution was dripped into a well
stirred mixture of methylene chloride (200 mL), concentrated
ammonium hydroxide (200 mL) and ice (200 g). After the addition was
complete, the mixture was stirred for 30 minutes. The solid amide
was isolated by filtration and was washed with water. After drying
at 70.degree. C. the 2-nitro-5-fluorobenzamide 2 was obtained as a
white solid in a yield of 6.6 g (33%).
Synthesis of 3:
[0482] A mixture of 2-nitro-5-fluorobenzamide 2 (6.6 g, 0.036 mol)
and N-methylpiperazine (7.25 g, 0.072 mol) in n-butanol (100 mL)
was stirred at reflux for 12 h. After cooling, the mixture was
diluted with ethyl acetate (200 mL) and was then extracted with 5%
HCl (2.times.200 mL). The combined extracts were neutralized with
sodium bicarbonate and the resulting yellow solution was treated
with solid potassium acetate (20 g). After stirring at room
temperature for 30 minutes the crystalline product, which had
separated, was isolated by filtration. The yellow solid was washed
with cold water and dried at 70.degree. C. The yield of 3 was 4.1 g
(43.1%). The compound was shown to be >99% purity by HPLC and
the mass spec gave the correct molecular ion.
Synthesis of 4 and 5:
[0483] A suspension of
N-methyl-N'-(3-carboxamido-4-nitro)piperazine 3 (4.1 g, 15.5 mmol)
in ethanol (100 mL) was treated with 10% palladium on carbon (500
mg) and was stirred at reflux. A solution of ammonium formate (2.92
g, 46.4 mmol) in water (5 mL) was added over a one minute period
and the resulting mixture was stirred at reflux for 2 h. TLC
(silica, 10% methanol in methylene chloride) showed that the
reaction had gone to completion. The reaction was cooled and the
catalyst was removed by filtration. To the filtrates was added
benzaldehyde (1.65 g, 15.5 mmol) and 5 drops of concentrated
sulfuric acid. This mixture was refluxed for 5 minutes and then
cooled. The ethanol was removed under vacuum and dimethylacetamide
(100 mL) was added. To this solution was added concentrated
sulfuric acid until an orange coloration formed which did not
immediately fade (about 2 g). The solution was heated to 90.degree.
C. with stirring and chloranil (3.8 g, 15.5 mmol) was added in
portions over 2 minutes. Heating was continued for 15 minutes after
which the reaction mixture was allowed to cool to room temperature.
The quinazoline sulfate salt 5 crystallized as small pale green
needles and was isolated by filtration. The solid was washed with
ethanol and dried at 70.degree. C. to give the product in a yield
of 4.1 g, (63.2%).
Synthesis of 6, 7, 8 and 9:
[0484] Phosphorous oxychloride (30 mL) and the quinazoline sulfate
salt 5 (4.1 g, 9.8 mmol) were stirred together as diisopropylethyl
amine (3.8 g, 29 mmol) was slowly added. The resulting warm yellow
suspension was stirred at reflux for 90 minutes. At this time, TLC
(silica, 10% methanol in methylene chloride) showed that the
reaction had gone to completion. Excess phosphorous oxychloride
(about 15 mL) was removed by distillation and the residue was
cautiously added to water (200 mL), ice (200 g), and sodium
bicarbonate (60 g) with vigorous stirring. The addition was at a
rate that controlled foaming. Once the reaction mixture had been
added, stirring was continued for 30 minutes. The solid precipitate
was extracted into methylene chloride (200 mL) and this solution
was dried over magnesium sulfate. After filtration, the methylene
chloride was evaporated to give a mixture of 6 and 7 as a white
solid (2.8 g). This material was combined with
N-2-aminoethylmorpholine (2.15 g, 16.6 mmol) in n-butanol (100 mL).
The mixture was stirred at reflux for 5 h. After cooling, the
reaction mixture was partitioned between ethyl acetate (200 mL) and
2% potassium carbonate solution (200 mL). The ethyl acetate
solution was isolated and extracted with warm 5% HCl (300 mL). The
acidic extracts were washed with ethyl acetate (2.times.100 mL) and
were then made basic by the addition of solid potassium carbonate.
The oil which precipitated was extracted into methylene chloride
(200 mL) and these extracts were evaporated under vacuum to provide
a mixture of 8 and 9 as an oil which crystallized on standing.
HPLC/mass spec analysis of the oil showed that it consisted of a
mixture of 8 (47.7%) and 9 (52.3%) in a total yield of 3.5 g.
Compounds 8 and 9 were separated by column chromatography on silica
using methylene chloride (100 mL) followed by 5% methanol in
methylene chloride (500 mL) and 10% methanol in methylene chloride
(500 mL) as eluent. HPLC showed that compound 8 was isolated with
an HPLC purity of 100% and compound 9 with an HPLC purity of 99.4%.
Mass spec and NMR were used to identify compound 8 as the
quinazoline, unsubstituted at position 5, and compound 9 as the
5-chloro derivative.
In Vitro Characterization of 8:
[0485] Compound 8 in this example corresponds to a compound of
Formula XXI with R.sub.7 and R.sub.8=H; Y.sub.3=phenyl;
R.sub.6=Y.sub.2=pip; and R.sub.4=dimor. See Example 40, Table 40,
Y.sub.2=pip and R.sub.4=dimor. In vitro testing as described in
Example 63 yielded the following results, expressed as IC.sub.50
(nM):
TABLE-US-00061 TLR7 TLR8 TLR9 Experimental 76 18 78 Calculated
18
Example 73
Synthesis and In Vitro Characterization of a Compound from Example
41
##STR00107##
[0486] Synthesis of 2:
[0487] To a stirred solution of 4-bromo-2-nitrobenzoic acid (3.0 g,
12.2 mmol) in CHCl.sub.3 (20 mL) was added thionyl chloride (1.1
mL, 14.6 mmol) at room temperature. Heating at reflux was continued
until a clear solution formed. This solution was used for the next
step.
[0488] To a stirred mixture of NH.sub.4OH (85 mL of 35% solution)
in CHCl.sub.3 (25 mL) was added dropwise the above acid chloride
solution at ca -25.degree. C. After stirring at 0.degree. C. for 15
min the reaction mixture was poured onto ice cold water. The solid
obtained was filtered, washed with H.sub.2O, and dried to provide 2
(3.09 g) as a white solid.
Synthesis of 3:
[0489] A mixture of 2 (2.0 g, 10.6 mmol) in EtOAc (200 mL) was
treated with SnCl.sub.2 (9.4 g, 42 mmol) at reflux for 20 min.
After addition of 1N NaOH, the formed solid was filtered and washed
with EtOAc. The organic phase was separated. The aqueous phase was
neutralized (pH.about.7) and extracted with EtOAc (2.times.70 mL).
The combined organic extracts were concentrated to provide 3 (1.53
g, 67%) as a tan solid.
Synthesis of 4:
[0490] A mixture of 3 (1.5 g, 7.2 mmol) with benzaldehyde (0.73 mL,
7.2 mmol) and sodium bisulfite (1.1 g, 10.8 mmol) in
dimethylacetamide (DMA) (5 mL) was heated at reflux for 3 h. After
pouring into H.sub.2O (20 mL), the solution was allowed to warm up
to room temperature. The solid which formed was filtered, washed
with H.sub.2O, followed by Et.sub.2O to provide 4 (1.5 g, 69%) as a
yellow solid, after recrystallization with MeOH/EtOAc.
Synthesis of 5:
[0491] A mixture of 4 (1.5 g, 4.9 mmol) in POCl.sub.3 (5 mL) was
heated at reflux overnight. After cooling to room temperature, the
dark solution was poured into H.sub.2O/ice. The resulting solid was
filtered, washed with H.sub.2O, followed by Et.sub.2O to provide 5
(900 mg) as brown yellow solid. Evaporation of the filtrates
provided an additional amount of 5 (400 mg) after concentration and
trituration with EtOAc/hexane.
Synthesis of 6:
[0492] To a screw-capped vial was placed 5 (200 mg, 0.63 mmol) in
EtOH (0.5 mL), followed by 2-morpholinoethanamine (100 mg, 0.75
mmol). The resulting solution was heated at 80.degree. C. for 3 h.
After concentration, the residue was purified by preparative TLC
(MeOH:EtOAc=20:80) to provide 6 (90 mg, 35%) as a yellow solid.
Synthesis of 7 (DbII):
[0493] To a screw-capped vial was placed 6 (90 mg, 0.22 mmol),
followed by NaO-t-Bu (25 mg, 0.26 mmol), N-methylpiperazine (0.29
mL, 0.26 mmol), Pd.sub.2(dba).sub.3 (4 mg, 0.005 mmol),
+/-2,2'-bis(diphenylphosphiono-1,1'binaphthalene, (BINAP) (4 mg,
0.007 mmol), and toluene (1 mL). After degassing with nitrogen the
suspension was heated at 80.degree. C. overnight. After
concentration, the residue was filtered through a short pad of
SiO.sub.2 to provide 7 (32 mg, 35%) after purification by
preparative TLC (MeOH:EtOAc=20:80). .sup.1H NMR (CDCl.sub.3, 400
MHz) .delta. 2.35 (s, 3H), 2.58 (br, 4H+4H), 2.77 (t, 2H), 3.40
(br, 4H), 3.75 (t, 4H), 3.85 (dd, 2H), 7.0-8.5 (set of t, d, s, 8H,
aromatic H); LC/MS: 433 (M+1), >98% pure.
In Vitro Characterization of 7 (DbII):
[0494] Compound 7 in this example corresponds to a compound of
Formula XXI with R.sub.6 and R.sub.8=H; Y.sub.3=phenyl;
R.sub.7=Y.sub.2=pip; and R.sub.4=dimor. See Example 41, Table 41,
Y.sub.2=pip and R.sub.4=dimor. In vitro testing as described in
Example 63 yielded the following results, expressed as IC.sub.50
(nM):
TABLE-US-00062 TLR7 TLR8 TLR9 Experimental 24 29 38 Calculated
78
Example 74
In Vivo Testing
[0495] Separate groups of mice are administered 100 .mu.g-300 .mu.g
CpG ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT; SEQ ID NO:1) by
intraperitoneal injection. One group of mice receiving CpG ODN is
also administered 100 ng-300 .mu.g of a compound of the invention,
orally or intravenously. Serum samples are obtained from mice from
each group and/or mice from each group are sacrificed at one or
more specified times, 1 to 48 hours following administration of CpG
ODN alone or CpG ODN plus compound of the invention. Cytokine
expression is evaluated in sera and/or splenocyte cultures derived
from each group at each time point. Th1 cytokine expression in mice
receiving both CpG ODN and compound of the invention is reduced
compared to Th1 cytokine expression in mice receiving CpG ODN
alone. Percent of control expression of Th1 cytokine is plotted as
a function of concentration of compound of the invention. IC.sub.50
corresponds to the concentration of compound which reduces Th1
cytokine expression to 50 percent of control expression of Th1
cytokine.
Example 75
In Vivo Testing in a Murine Model of Autoimmune Diabetes
Mellitus
[0496] Two groups of age-matched female non-obese diabetic (NOD)
mice are administered 100 .mu.g-300 .mu.g CpG ODN 2006 by
intraperitoneal injection, once weekly beginning at six weeks of
age. One group of NOD mice receiving CpG ODN is also administered
100 ng-300 .mu.g of a compound of the invention, orally or
intravenously, once weekly beginning at six weeks of age.
Optionally another group of age-matched female NOD mice receiving
compound alone can also be included, as can be another group of
age-matched female NOD mice receiving neither CpG ODN nor compound.
All mice are maintained on a regular diet and monitored at least
once weekly for development of hyperglycemia (random blood glucose
.gtoreq.350 mg/dL measured on at least one occasion). Age at
development of hyperglycemia is compared between groups. The group
receiving CpG ODN alone develops hyperglycemia earlier than the
group receiving CpG ODN and compound.
EQUIVALENTS
[0497] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
examples provided, since the examples are intended as a single
illustration of one aspect of the invention and other functionally
equivalent embodiments are within the scope of the invention.
Various modifications of the invention in addition to those shown
and described herein will become apparent to those skilled in the
art from the foregoing description and fall within the scope of the
appended claims. The advantages and objects of the invention are
not necessarily encompassed by each embodiment of the invention.
Sequence CWU 1
1
4124DNAArtificial sequenceSynthetic oligonucleotide 1tcgtcgtttt
gtcgttttgt cgtt 24220DNAArtificial sequenceSynthetic
oligonucleotide 2gggggacgat cgtcgggggg 20322DNAArtificial
sequenceSynthetic oligonucleotide 3tcgtcgtttt cggcgcgcgc cg
22420RNAArtificial sequenceSynthetic oligonucleotide 4uuguuguugu
uguuguuguu 20
* * * * *