U.S. patent application number 12/331285 was filed with the patent office on 2010-06-24 for methods for identifying agents that modulate p44.
This patent application is currently assigned to Evolutionary Genomics, Inc.. Invention is credited to Walter Messier, James Sikela.
Application Number | 20100159440 12/331285 |
Document ID | / |
Family ID | 34280136 |
Filed Date | 2010-06-24 |
United States Patent
Application |
20100159440 |
Kind Code |
A1 |
Messier; Walter ; et
al. |
June 24, 2010 |
METHODS FOR IDENTIFYING AGENTS THAT MODULATE p44
Abstract
The present invention provides methods for identifying
evolutionarily significant polynucleotide and polypeptide sequences
in human and/or non-human primates which may be associated with a
physiological condition, such as enhanced resistance to HCV
infection. The invention also provides methods for identifying
evolutionarily significant polynucleotides with mutations that are
correlated with susceptibility to diseases, such as BRCA1 exon 11.
The methods employ comparison of human and non-human primate
sequences using statistical methods. Sequences thus identified may
be useful as host therapeutic targets and/or in screening
assays.
Inventors: |
Messier; Walter; (Longmont,
CO) ; Sikela; James; (Englewood, CO) |
Correspondence
Address: |
SWANSON & BRATSCHUN, L.L.C.
8210 SOUTHPARK TERRACE
LITTLETON
CO
80120
US
|
Assignee: |
Evolutionary Genomics, Inc.
Lafayette
CO
|
Family ID: |
34280136 |
Appl. No.: |
12/331285 |
Filed: |
December 9, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11058065 |
Feb 15, 2005 |
7462460 |
|
|
12331285 |
|
|
|
|
10098600 |
Mar 14, 2002 |
6866996 |
|
|
11058065 |
|
|
|
|
09942252 |
Aug 28, 2001 |
|
|
|
10098600 |
|
|
|
|
09591435 |
Jun 9, 2000 |
6280953 |
|
|
09942252 |
|
|
|
|
09240915 |
Jan 29, 1999 |
6228586 |
|
|
09591435 |
|
|
|
|
60098987 |
Sep 2, 1998 |
|
|
|
60073263 |
Jan 30, 1998 |
|
|
|
Current U.S.
Class: |
435/5 ;
436/501 |
Current CPC
Class: |
Y02A 50/58 20180101;
Y02A 90/10 20180101; C12Q 1/6883 20130101; Y02A 50/30 20180101;
C12Q 2600/158 20130101; Y02A 90/26 20180101 |
Class at
Publication: |
435/5 ;
436/501 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70; G01N 33/566 20060101 G01N033/566 |
Claims
1. A method for identifying an agent as a candidate for increasing
human p44 function, comprising: contacting at least one candidate
agent with a p44 polypeptide selected from the group consisting of
(a) a human p44 polypeptide comprising SEQ ID NO:36; (b) a
polypeptide encoded by a polynucleotide comprising SEQ ID NO:34;
(c) a polypeptide encoded by a polynucleotide consisting
essentially of nucleotides 1-457 of SEQ ID NO:34, and (d) a
polypeptide consisting essentially of amino acids 1 to 152 of SEQ
ID NO:36; and detecting whether the agent binds to the human p4-4
polypeptide encompassing least one of the following positions:
Arg36, Ser68, Glu71, Gly72, Asp84, Cys95, and Thr106.
2. A method for identifying an agent that increases a human or
chimpanzee p44 function, comprising: contacting at least one
candidate agent with a p44 polypeptide selected from the group
consisting of: (a) a polypeptide encoded by a polynucleotide
comprising nucleotides 1-457 of SEQ ID NO:34 or SEQ ID NO:31, and;
(b) a polypeptide having at least one amino acid change at
positions 36, 68, 71, 72, 84, 95, and 106, but is otherwise
identical to amino acids 1 to 152 of SEQ ID NO:36 or SEQ ID NO: 34;
and (ii) detecting a p44 polypeptide function, wherein said agent
is identified by its ability to increase the human or chimpanzee
p44 polypeptide function relative to the function of the p44
polypeptide in the absence of the candidate agent.
3. The method of claim 2, wherein the p44 function is selected from
the group consisting of microtubule assembly and resistance to HCV
infection.
4. The method of claim 2 wherein the p44 polypeptide function to be
increased is human.
5. The method of claim 4 wherein the increase of the p44 function
results in a human function that is more similar to a chimpanzee
p44 function.
6. The method of claim 4 wherein said candidate agent is a small
molecule that forms a complex with human p44 that mimics the
three-dimensional structure of the chimpanzee p44, whereby the
human p44 function is increased.
7. The method of claim 4 wherein said candidate agent is a small
molecule that interacts with human p44 amino acids so as to
increase the human p44 polypeptide function.
8. The method of claim 1, wherein said candidate agent is a small
molecule that binds with at least one human p44 amino acid selected
from the group consisting of Arg36, Ser68, Glu71, Gly72, Asp84,
Cys95, and Thr106 of SEQ ID NO:36.
9. A method for identifying an agent that decreases susceptibility
to a human's hepatitis C virus (HCV) infection, comprising: (i)
contacting at least one candidate agent with a p44 polypeptide
capable of decreasing susceptibility to a human's HCV infection
selected from the group consisting of: (a) a polypeptide encoded by
a polynucleotide comprising nucleotides 1-457 of SEQ ID NO:34 or
SEQ ID NO:31, and (b) a polypeptide having at least one amino acid
change at positions 36, 68, 71, 72, 84, 95, and 106, but is
otherwise identical to amino acids 1 to 152 of SEQ ID NO:36 or SEQ
ID NO: 34; and (ii) detecting susceptibility to HCV infection in in
vitro hepatocytes or in vivo animal model.
10. The method of claim 9, wherein said agent is identified by its
ability to decrease susceptibility to HCV infection relative to the
susceptibility to HCV infection in the absence of the candidate
agent.
11. The method of claim 3, wherein increased microtubule assembly
is detected via antibody detection of enhanced p44 assembly into
microtubules in cultured hepatocytes.
12. The method of claim 3, wherein increased resistance to HCV
infection is detected via decreased viral titer in in vitro
hepatocytes or an in vivo animal model.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Ser. No.
11/058,065, filed Feb. 15, 2005 (now U.S. Pat. No. 7,462,460),
which is a divisional of U.S. Ser. No. 10/098,600, filed Mar. 14,
2002 (now U.S. Pat. No. 6,866,996), which is a continuation-in-part
of U.S. Ser. No. 09/942,252, filed Aug. 28, 2001 (now abandoned),
which is a continuation-in-part of U.S. Ser. No. 09/591,435, filed
Jun. 9, 2000, now U.S. Pat. No. 6,280,953, which is a
continuation-in-part of U.S. patent application Ser. No.
09/240,915, filed Jan. 29, 1999, now U.S. Pat. No. 6,228,586, which
claims priority from U.S. Provisional Patent Application Ser. No.
60/098,987, filed Sep. 2, 1998, and U.S. Provisional Patent
Application Ser. No. 60/073,263, filed Jan. 30, 1998, each of which
is incorporated herein in its entirety by reference.
TECHNICAL FIELD
[0002] This invention relates to using molecular and evolutionary
techniques to identify polynucleotide and polypeptide sequences
corresponding to evolved traits that may be relevant to human
diseases or conditions, such as unique or enhanced human brain
functions, longer human life spans, susceptibility or resistance to
development of infectious disease (such as AIDS and hepatitis C),
susceptibility or resistance to development of cancer, and
aesthetic traits, such as hair growth, susceptibility or resistance
to acne, or enhanced muscle mass.
BACKGROUND OF THE INVENTION
[0003] Humans differ from their closest evolutionary relatives, the
non-human primates such as chimpanzees, in certain physiological
and functional traits that relate to areas important to human
health and well-being. For example, (1) humans have unique or
enhanced brain function (e.g., cognitive skills, etc.) compared to
chimpanzees; (2) humans humans have a longer life-span than
non-human primates; (3) chimpanzees are resistant to certain
infectious diseases that afflict humans, such as AIDS and hepatitis
C; (4) chimpanzees appear to have a lower incidence of certain
cancers than humans; (5) chimpanzees do not suffer from acne or
alopecia (baldness); (6) chimpanzees have a higher percentage of
muscle to fat; (7) chimpanzees are more resistant to malaria; (8)
chimpanzees are less susceptible to Alzheimer=s disease; and (9)
chimpanzees have a lower incidence of atherosclerosis. At the
present time, the genes underlying the above human/chimpanzee
differences are not known, nor, more importantly, are the specific
changes that have evolved in these genes to provide these
capabilities. Understanding the basis of these differences between
humans and our close evolutionary relatives will provide useful
information for developing effective treatments for related human
conditions and diseases.
[0004] Classic evolution analysis, which compares mainly the
anatomic features of animals, has revealed dramatic morphological
and functional differences between human and non-human primates;
yet, the human genome is known to share remarkable sequence
similarities with that of other primates. For example, it is
generally concluded that human DNA sequence is roughly 98.5%
identical to chimpanzee DNA and only slightly less similar to
gorilla DNA. McConkey and Goodman (1997) TIG 13:350-351. Given the
relatively small percentage of genomic difference between humans
and closely related primates, it is possible, if not likely, that a
relatively small number of changes in genomic sequences may be
responsible for traits of interest to human health and well-being,
such as those listed above. Thus, it is desirable and feasible to
identify the genes underlying these traits and to glean information
from the evolved changes in the proteins they encode to develop
treatments that could benefit human health and well-being.
Identifying and characterizing these sequence changes is crucial in
order to benefit from evolutionary solutions that have eliminated
or minimized diseases or that provide unique or enhanced
functions.
[0005] Recent developments in the human genome project have
provided a tremendous amount of information on human gene
sequences. Furthermore, the structures and activities of many human
genes and their protein products have been studied either directly
in human cells in culture or in several animal model systems, such
as the nematode, fruit fly, zebrafish and mouse. These model
systems have great advantages in being relatively simple, easy to
manipulate, and having short generation times. Because the basic
structures and biological activities of many important genes have
been conserved throughout evolution, homologous genes can be
identified in many species by comparing macromolecule sequences.
Information obtained from lower species on important gene products
and functional domains can be used to help identify the homologous
genes or functional domains in humans. For example, the homeo
domain with DNA binding activity first discovered in the fruit fly
Drosophila was used to identify human homologues that possess
similar activities.
[0006] Although comparison of homologous genes or proteins between
human and a lower model organism may provide useful information
with respect to evolutionarily conserved molecular sequences and
functional features, this approach is of limited use in identifying
genes whose sequences have changed due to natural selection. With
the advent of the development of sophisticated algorithms and
analytical methods, much more information can be teased out of DNA
sequence changes. The most powerful of these methods,
"K.sub.A/K.sub.S" involves pairwise comparisons between aligned
protein-coding nucleotide sequences of the ratios of
nonsynonymous nucleotide substitutions per nonsynonymous site ( K A
) synonymous substitutions per synonymous site ( K S )
##EQU00001##
[0007] (where nonsynonymous means substitutions that change the
encoded amino acid and synonymous means substitutions that do not
change the encoded amino acid). "K.sub.A/K.sub.S-type methods"
includes this and similar methods. These methods have been used to
demonstrate the occurrence of Darwinian molecular-level positive
selection, resulting in amino acid differences in homologous
proteins. Several groups have used such methods to document that a
particular protein has evolved more rapidly than the neutral
substitution rate, and thus supports the existence of Darwinian
molecular-level positive selection. For selection. For example,
McDonald and Kreitman (1991) Nature 351:652-654 propose a
statistical test of neutral protein evolution hypothesis based on
comparison of the number of amino acid replacement substitutions to
synonymous substitutions in the coding region of a locus. When they
apply this test to the Adh locus of three Drosophila species, they
conclude that it shows instead that the locus has undergone
adaptive fixation of selectively advantageous mutations and that
selective fixation of adaptive mutations may be a viable
alternative to the clocklike accumulation of neutral mutations as
an explanation for most protein evolution. Jenkins et al. (1995)
Proc. R. Soc. Lond. B 261:203-207 use the McDonald & Kreitman
test to investigate whether adaptive evolution is occurring in
sequences controlling transcription (non-coding sequences).
[0008] Nakashima et al. (1995) Proc. Natl. Acad. Sci. USA
92:5606-5609, use the method of Miyata and Yasunaga to perform
pairwise comparisons of the nucleotide sequences of ten PLA2
isozyme genes from two snake species; this method involves
comparing the number of nucleotide substitutions per site for the
noncoding regions including introns (K.sub.N) and the K.sub.A and
K.sub.S. They conclude that the protein coding regions have been
evolving at much higher rates than the noncoding regions including
introns. The highly accelerated substitution rate is responsible
for Darwinian molecular-level evolution of PLA2 isozyme genes to
produce new physiological activities that must have provided strong
selective advantage for catching prey or for defense against
predators. Endo et al. (1996) Mol. Biol. Evol. 13(5):685-690 use
the method of Nei and Gojobori, wherein d.sub.N is the number of
nonsynonymous substitutions and d.sub.S is the number of synonymous
substitutions, for the purpose of identifying candidate genes on
which positive selection operates. Metz and Palumbi (1996) Mol.
Biol. Evol. 13(2):397-406 use the McDonald & Kreitman test as
well as a method attributed to Nei and Gojobori, Nei and Jin, and
Kumar, Tamura, and Nei; examining the average proportions of
P.sub.n, the replacement substitutions per replacement site, and
P.sub.s, the silent substitutions per silent site, to look for
evidence of positive selection on bindin genes in sea urchins to
investigate whether they have rapidly evolved as a prelude to
species formation. Goodwin et al. (1996) Mol. Biol. Evol.
13(2):346-358 uses similar methods to examine the evolution of a
particular murine gene murine gene family and conclude that the
methods provide important fundamental insights into how selection
drives genetic divergence in an experimentally manipulatable
system. Edwards et al. (1995) use degenerate primers to pull out
MHC loci from various species of birds and an alligator species,
which are then analyzed by the Nei and Gojobori methods (d.sub.N:
d.sub.S ratios) to extend MHC studies to nonmammalian vertebrates.
Whitfield et al. (1993) Nature 364:713-715 use Ka/Ks analysis to
look for directional selection in the regions flanking a conserved
region in the SRY gene (that determines male sex). They suggest
that the rapid evolution of SRY could be a significant cause of
reproductive isolation, leading to new species. Wettsetin et al.
(1996) Mol. Biol. Evol. 13(1):56-66 apply the MEGA program of
Kumar, Tamura and Nei and phylogenetic analysis to investigate the
diversification of MHC class I genes in squirrels and related
rodents. Parham and Ohta (1996) Science 272:67-74 state that a
population biology approach, including tests for selection as well
as for gene conversion and neutral drift are required to analyze
the generation and maintenance of human MHC class I polymorphism.
Hughes (1997) Mol. Biol. Evol. 14(1):1-5 compared over one hundred
orthologous immunoglobulin C2 domains between human and rodent,
using the method of Nei and Gojobori (d.sub.N:d.sub.S ratios) to
test the hypothesis that proteins expressed in cells of the
vertebrate immune system evolve unusually rapidly. Swanson and
Vacquier (1998) Science 281:710-712 use d.sub.N: d.sub.s ratios to
demonstrate concerted evolution between the lysin and the egg
receptor for lysin and discuss the role of such concerted evolution
in forming new species (speciation).
[0009] Due to the distant evolutionary relationships between humans
and these lower animals, the adaptively valuable genetic changes
fixed by natural selection are often masked by the accumulation of
neutral, random mutations over time. Moreover, some proteins evolve
in an episodic manner; such episodic changes could be masked,
leading to inconclusive results, if the two genomes compared are
not close enough. Messier and Stewart (1997) Nature 385:151-154. In
fact, studies have shown that the occurrence of adaptive selection
in protein evolution is often underestimated when predominantly
distantly related sequences are compared. Endo et al. (1996) Mol.
Biol. Evol. 37:441-456; 456; Messier and Stewart (1997) Nature
385:151-154.
[0010] Molecular evolution studies within the primate family have
been reported, but these mainly focus on the comparison of a small
number of known individual genes and gene products to assess the
rates and patterns of molecular changes and to explore the
evolutionary mechanisms responsible for such changes. See
generally, Li, Molecular Evolution, Sinauer Associates, Sunderland,
Mass., 1997. Furthermore, sequence comparison data are used for
phylogenetic analysis, wherein the evolution history of primates is
reconstructed based on the relative extent of sequence similarities
among examined molecules from different primates. For example, the
DNA and amino acid sequence data for the enzyme lysozyme from
different primates were used to study protein evolution in primates
and the occurrence of adaptive selection within specific lineages.
Malcolm et al. (1990) Nature 345:86-89; Messier and Stewart (1997).
Other genes that have been subjected to molecular evolution studies
in primates include hemoglobin, cytochrome c oxidase, and major
histocompatibility complex (MHC). Nei and Hughes in: Evolution at
the Molecular Level, Sinauer Associates, Sunderland, Mass. 222-247,
1991; Lienert and Parham (1996) Immunol. Cell Biol. 74:349-356; Wu
et al. (1997) J. Mol. Evol. 44:477-491. Many non-coding sequences
have also been used in molecular phylogenetic analysis of primates.
Li, Molecular Evolution, Sinauer Associates, Sunderland, Mass.
1997. For example, the genetic distances among primate lineages
were estimated from orthologous non-coding nucleotide sequences of
beta-type globin loci and their flanking regions, and the evolution
tree constructed for the nucleotide sequence orthologues depicted a
branching pattern that is largely congruent with the picture from
phylogenetic analyses of morphological characters. Goodman et al.
(1990) J. Mol. Evol. 30:260-266.
[0011] Zhou and Li (1996) Mol. Biol. Evol. 13(6):780-783 applied
K.sub.A/K.sub.S analysis to primate genes. It had previously been
reported that gene conversion events likely have occurred in
introns 2 and 4 between the red and green retinal pigment genes
during human evolution. However, intron 4 sequences of the red and
green retinal pigment genes from one European human were completely
identical, suggesting a recent gene conversion conversion event. In
order to determine if the gene conversion event occurred in that
individual, or a common ancestor of Europeans, or an even earlier
hominid ancestor, the authors sequenced intron 4 of the red and
green pigment gene from a male Asian human, a male chimpanzee, and
a male baboon, and applied K.sub.A/K.sub.S analysis. They observed
that the divergence between the two genes is significantly lower in
intron 4 than in surrounding exons, suggesting that strong natural
selection has acted against sequence homogenization.
[0012] Wolinsky et al. (1996) Science 272:537-542 used comparisons
of nonsynonymous to synonymous base substitutions to demonstrate
that the HIV virus itself (i.e., not the host species) is subject
to adaptive evolution within individual human patients. Their goal
was simply to document the occurrence of positive selection in a
short time frame (that of a human patient=s course of disease).
Niewiesk and Bangham (1996) J Mol Evol 42:452-458 used the
D.sub.n/D.sub.s approach to ask a related question about the HTLV-1
virus, i.e., what are the selective forces acting on the virus
itself. Perhaps because of an insufficient sample size, they were
unable to resolve the nature of the selective forces. In both of
these cases, although K.sub.A/K.sub.S-type methods were used in
relation to a human virus, no attempt was made to use these methods
for therapeutic goals (as in the present application), but rather
to pursue narrow academic goals.
[0013] As can be seen from the papers cited above, analytical
methods of molecular evolution to identify rapidly evolving genes
(K.sub.A/K.sub.S-type methods) can be applied to achieve many
different purposes, most commonly to confirm the existence of
Darwinian molecular-level positive selection, but also to assess
the frequency of Darwinian molecular-level positive selection, to
understand phylogenetic relationships, to elucidate mechanisms by
which new species are formed, or to establish single or multiple
origin for specific gene polymorphisms. What is clear is from the
papers cited above and others in the literature is that none of the
authors applied K.sub.A/K.sub.S-type methods to identify
evolutionary solutions, specific evolved changes, that could be
mimicked or used in the development of treatments to prevent or
cure human conditions or diseases or to modulate unique or enhanced
human functions. They have not used K.sub.A/K.sub.S type analysis
as a as a systematic tool for identifying human or non-human
primate genes that contain evolutionarily significant sequence
changes and exploiting such genes and the identified changes in the
development of treatments for human conditions or diseases.
[0014] The identification of human genes that have evolved to
confer unique or enhanced human functions compared to homologous
chimpanzee genes could be applied to developing agents to modulate
these unique human functions or to restore function when the gene
is defective. The identification of the underlying chimpanzee (or
other non-human primate) genes and the specific nucleotide changes
that have evolved, and the further characterization of the physical
and biochemical changes in the proteins encoded by these evolved
genes, could provide valuable information, for example, on what
determines susceptibility and resistance to infectious viruses,
such as HIV and HCV, what determines susceptibility or resistance
to the development of certain cancers, what determines
susceptibility or resistance to acne, how hair growth can be
controlled, and how to control the formation of muscle versus fat.
This valuable information could be applied to developing agents
that cause the human proteins to behave more like their chimpanzee
homologues.
[0015] All references cited herein are hereby incorporated by
reference in their entirety.
SUMMARY OF THE INVENTION
[0016] The present invention provides methods for identifying
polynucleotide and polypeptide sequences having evolutionarily
significant changes which are associated with physiological
conditions, including medical conditions. The invention applies
comparative primate genomics to identify specific gene changes
which may be associated with, and thus responsible for,
physiological conditions, such as medically or commercially
relevant evolved traits, and using the information obtained from
these evolved genes to develop human treatments. The non-human
primate sequences employed in the methods described herein may be
any non-human primate, and are preferably a member of the hominoid
group, more preferably a chimpanzee, bonobo, gorilla and/or
orangutan, and most preferably a chimpanzee.
[0017] In one preferred embodiment, a non-human primate
polynucleotide or polypeptide has undergone natural selection that
resulted in a positive evolutionarily significant change (i.e., the
non-human primate polynucleotide or polypeptide has a positive
attribute not present in humans). In this embodiment the positively
selected polynucleotide or polypeptide may be associated with
susceptibility or resistance to certain diseases or with other
commercially relevant traits. Examples of this embodiment include,
but are not limited to, polynucleotides and polypeptides that are
positively selected in non-human primates, preferably chimpanzees,
that may be associated with susceptibility or resistance to
infectious diseases and cancer. An example of a commercially
relevant trait may include aesthetic traits such as hair growth,
muscle mass, susceptibility or resistance to acne. An example of
the disease resistance/susceptibility embodiment includes
polynucleotides and polypeptides associated with the susceptibility
or resistance to HIV dissemination, propagation and/or development
of AIDS. The present invention can thus be useful in gaining
insight into the molecular mechanisms that underlie resistance to
HIV dissemination, propagation and/or development of AIDS,
providing information that can also be useful in discovering and/or
designing agents such as drugs that prevent and/or delay
development of AIDS. Specific genes that have been positively
selected in chimpanzees that may relate to AIDS or other infectious
diseases are ICAM-1, ICAM-2, ICAM-3, MIP-1-a, CD59 and DC-SIGN.
17-.beta.-hydroxysteroid dehydrogenase Type IV is a specific gene
has been positively selected in chimpanzees that may relate to
cancer.
[0018] Additionally, the p44 gene is a gene that has been
positively selected in chimpanzees and is believed to contribute to
their HCV resistance.
[0019] In another preferred embodiment, a human polynucleotide or
polypeptide has undergone natural selection that resulted in a
positive evolutionarily significant change (i.e., the human
polynucleotide or polypeptide has a positive attribute not present
in non-human primates). One example of this embodiment is that the
polynucleotide or polypeptide may be associated with unique or
enhanced functional capabilities of the human brain compared to
non-human primates. Another is the longer life-span of humans
compared to non-human primates. A third is a commercially important
aesthetic trait (e.g., trait (e.g., normal or enhanced breast
development). The present invention can thus be useful in gaining
insight into the molecular mechanisms that underlie unique or
enhanced human functions or physiological traits, providing
information which can also be useful in designing agents such as
drugs that modulate such unique or enhanced human functions or
traits, and in designing treatment of diseases or conditions
related to humans. As an example, the present invention can thus be
useful in gaining insight into the molecular mechanisms that
underlie human cognitive function, providing information which can
also be useful in designing agents such as drugs that enhance human
brain function, and in designing treatment of diseases related to
the human brain. A specific example of a human gene that has
positive evolutionarily significant changes when compared to
non-human primates is a tyrosine kinase gene, the KIAA0641 or
NM.sub.--004920 gene.
[0020] Accordingly, in one aspect, the invention provides methods
for identifying a polynucleotide sequence encoding a polypeptide,
wherein said polypeptide may be associated with a physiological
condition (such as a medically or commercially relevant positive
evolutionarily significant change). The positive evolutionarily
significant change can be found in humans or in non-human primates.
In a preferred embodiment the invention provides a method for
identifying a human AATYK polynucleotide sequence encoding a human
AATYK polypeptide associated with an evolutionarily significant
change. In another preferred embodiment, the invention provides a
method for identifying a p44 polynucleotide and polypeptide that
are associated with enhanced HCV resistance in chimpanzees relative
to humans.
[0021] For any embodiment of this invention, the physiological
condition may be any physiological condition, including those
listed herein, such as, for example, disease (including
susceptibility or resistance to disease) such as cancer, infectious
disease (including viral diseases such as AIDS or HCV-associated
chronic hepatitis); life span; brain function, including cognitive
function or developmental sculpting; and aesthetic or cosmetic
qualities, such as enhanced breast development.
[0022] In one aspect of the invention, methods are provided for
identifying a polynucleotide sequence encoding a human polypeptide,
wherein said polypeptide may be associated with a physiological
condition that is present in human(s), comprising the steps of: a)
comparing human protein-coding polynucleotide sequences to
protein-coding polynucleotide sequences of a non-human primate,
wherein the non-human primate does not have the physiological
condition (or has it to a lesser degree); and b) selecting a human
polynucleotide sequence that contains a nucleotide change as
compared to corresponding sequence of the non-human primate,
wherein said change is evolutionarily significant. In some
embodiments, the human protein coding sequence (and/or the
polypeptide encoded therein) may be associated with development
and/or maintenance of a physiological condition or trait or a
biological function. In some embodiments, the physiological
condition or biological function may be life span, brain or
cognitive function, or breast development (including adipose, gland
and duct development). Methods used to assess the nucleotide
change, and the nature(s) of the nucleotide change, are described
herein, and apply to any and all embodiments. In a preferred
embodiment, the method is a method for identifying a human AATYK
polynucleotide sequence encoding a human AATYK polypeptide.
[0023] In other embodiments, methods are provided that comprise the
steps of: (a) comparing human protein-coding nucleotide sequences
to protein-coding nucleotide sequences of a non-human primate,
preferably a chimpanzee, that is resistant to a particular
medically relevant disease state, wherein the human protein coding
sequence is or is believed to be associated with development of the
disease; and (b) selecting a non-human polynucleotide sequence that
contains at least one nucleotide change as compared to the
corresponding sequence of the human, wherein the change is
evolutionarily significant. The sequences identified by these
methods may be further characterized and/or analyzed to confirm
that they are associated with the development of the disease state
or condition. The most preferred disease states that are applicable
to these methods are cancer and infectious diseases, including
AIDS, hepatitis C and leprosy.
[0024] In one embodiment, chimpanzee polynucleotide sequences are
compared to human polynucleotide sequences to identify a p44
sequence that is evolutionarily significant. The significant. The
p44 protein is (or is believed to be) associated with the enhanced
HCV resistance of chimpanzees relative to humans.
[0025] In another aspect, methods are provided for identifying an
evolutionarily significant change in a human brain
polypeptide-coding polynucleotide sequence, comprising the steps of
a) comparing human brain polypeptide-coding polynucleotide
sequences to corresponding sequences of a non-human primate; and b)
selecting a human polynucleotide sequence that contains a
nucleotide change as compared to corresponding sequence of the
non-human primate, wherein said change is evolutionarily
significant. In some embodiments, the human brain polypeptide
coding nucleotide sequences correspond to human brain cDNAs. In
preferred embodiments, the human brain polypeptide-coding
polynucleotide sequence is an AATYK sequence.
[0026] Another aspect of the invention includes methods for
identifying a positively selected human evolutionarily significant
change. These methods comprise the steps of: (a) comparing human
polypeptide-coding nucleotide sequences to polypeptide-coding
nucleotide sequences of a non-human primate; and (b) selecting a
human polynucleotide sequence that contains at least one (i.e., one
or more) nucleotide change as compared to corresponding sequence of
the non-human primate, wherein said change is evolutionarily
significant. The sequences identified by this method may be further
characterized and/or analyzed for their possible association with
biologically or medically relevant functions or traits unique or
enhanced in humans. In preferred embodiments, the human
polypeptide-coding nucleotide sequence is an AATYK sequence.
[0027] Another embodiment of the present invention is a method for
large scale sequence comparison between human polypeptide-coding
polynucleotide sequences and the polypeptide-coding polynucleotide
sequences from a non-human primate, e.g., chimpanzee, comprising:
(a) aligning the human polynucleotide sequences with corresponding
polynucleotide sequences from non-human primate according to
sequence homology; and (b) identifying any nucleotide changes
within the human sequences as compared to the homologous sequences
from the non-human primate, wherein the changes are evolutionarily
significant. In some embodiments, the protein coding sequences are
sequences are from brain.
[0028] In some embodiments, a nucleotide change identified by any
of the methods described herein is a non-synonymous substitution.
In some embodiments, the evolutionary significance of the
nucleotide change is determined according to the non-synonymous
substitution rate (K.sub.A) of the nucleotide sequence. In some
embodiments, the evolutionarily significant changes are assessed by
determining the K.sub.A/K.sub.S ratio between the human gene and
the homologous gene from non-human primate (such as chimpanzee),
and preferably that ratio is at least about 0.75, more preferably
greater than about 1 (unity) (i.e., at least about 1), more
preferably at least about 1.25, more preferably at least about
1.50, and more preferably at least about 2.00. In other
embodiments, once a positively selected gene has been identified
between human and a non-human primate (such as chimpanzee or
gorilla), further comparisons are performed with other non-human
primates to confirm whether the human or the non-human primate
(such as chimpanzee or gorilla) gene has undergone positive
selection.
[0029] In another aspect, the invention provides methods for
correlating an evolutionarily significant human nucleotide change
to a physiological condition in a human (or humans), which comprise
analyzing a functional effect (which includes determining the
presence of a functional effect), if any, of (the presence or
absence of) a polynucleotide sequence identified by any of the
methods described herein, wherein presence of a functional effect
indicates a correlation between the evolutionarily significant
nucleotide change and the physiological condition. Alternatively,
in these methods, a functional effect (if any) may be assessed
using a polypeptide sequence (or a portion of the polypeptide
sequence) encoded by a nucleotide sequence identified by any of the
methods described herein.
[0030] In a preferred embodiment, the polynucleotide sequence or
polypeptide sequence is a human or chimpanzee p44 polynucleotide
sequence (SEQ ID NO. 34 OR 31) or polypeptide sequence (SEQ ID NO.
36 OR 33). In a more preferred embodiment, the p44 polynucleotide
sequences are the exon 2 sequences having nucleotides 1-457 of SEQ
ID NO:34 (human), and nucleotides 1-457 of SEQ ID NO:31
(chimpanzee), or fragments thereof containing the exon 2
evolutionarily significant chimpanzee nucleotides or the
corresponding human nucleotides. Such fragments are preferably
between 18 and 225 nucleotides in length.
[0031] The present invention also provides comparison of the
identified polypeptides by physical and biochemical methods widely
used in the art to determine the structural or biochemical
consequences of the evolutionarily significant changes. Physical
methods are meant to include methods that are used to examine
structural changes to proteins encoded by genes found to have
undergone adaptive evolution. Side-by-side comparison of the
three-dimensional structures of a protein (either human or
non-human primate) and the evolved homologous protein (either
non-human primate or human, respectively) will provide valuable
information for developing treatments for related human conditions
and diseases. For example, using the methods of the present
invention, the chimpanzee ICAM-1 gene was identified as having
positive evolutionary changes compared to human ICAM-1. In a
three-dimensional model of two functional domains of the human
ICAM-1 protein it can be seen that five of the six amino acids that
have been changed in chimpanzees are immediately adjacent to (i.e.,
physically touching) amino acid residues known to be crucial for
binding to the ICAM-1 counter-receptor, LFA-1; in each case, the
human amino acid has been replaced by a larger amino acid in the
chimpanzee ICAM-1. Such information allows insight into designing
appropriate therapeutic intervention(s). Accordingly, in another
aspect, the invention provides methods for identifying a target
site (which includes one or more target sites) which may be
suitable for therapeutic intervention, comprising comparing a human
polypeptide (or a portion of the polypeptide) encoded in a sequence
identified by any of the methods described herein, with a
corresponding non-human polypeptide (or a portion of the
polypeptide), wherein a location of a molecular difference, if any,
indicates a target site.
[0032] Likewise, human and chimpanzee p44 polypeptide computer
models or x-ray crystallography structures can be compared to
determine how the evolutionarily significant amino acid changes of
the chimpanzee p44 exon 2 alter the protein's structure, and how
agents might be designed to interact with human p4-4 in such a
manner that permits it to permits it to mimic chimpanzee p44
structure and/or function.
[0033] In another aspect, the invention provides methods for
identifying a target site (which includes one or more target sites)
which may be suitable for therapeutic intervention, comprising
comparing a human polypeptide (or a portion of the polypeptide)
encoded in a sequence identified by any of the methods described
herein, with a corresponding non-human primate polypeptide (or a
portion of the polypeptide), wherein a location of a molecular
difference, such as an amino acid difference, if any, indicates a
target site. Target sites can also be nonsynonymous nucleotide
changes observed between a positively selected polynucleotide
identified by any of the methods described herein and its
corresponding sequence in the human or non-human primate. In
preferred embodiments, the target site is a site on a human p44
polypeptide.
[0034] Biochemical methods are meant to include methods that are
used to examine functional differences, such as binding
specificity, binding strength, or optimal binding conditions, for a
protein encoded by a gene that has undergone adaptive evolution.
Side-by-side comparison of biochemical characteristics of a protein
(either human or non-human primate) and the evolved homologous
protein (either non-human primate or human, respectively) will
reveal valuable information for developing treatments for related
human conditions and diseases.
[0035] In another aspect, the invention provides methods of
identifying an agent which may modulate a physiological condition,
said method comprising contacting an agent (i.e., at least one
agent to be tested) with a cell that has been transfected with a
polynucleotide sequence identified by any of the methods described
herein, wherein an agent is identified by its ability to modulate
function of the polynucleotide sequence. In other embodiments, the
invention provides methods of identifying an agent which may
modulate a physiological condition, said method comprising
contacting an agent (i.e., at least one agent) to be tested with a
polypeptide (or a fragment of a polypeptide and/or a composition
comprising a polypeptide or fragment of a polypeptide) encoded in
or within a polynucleotide identified by any of the methods
described herein, wherein an agent is identified by its ability to
modulate function of the polypeptide. In preferred embodiments
embodiments of these methods the polynucleotide sequence is an
evolutionarily significant chimpanzee p44 polynucleotide sequence
or its corresponding human polynucleotide. In more preferred
embodiments, the polynucleotide sequence is nucleotides 1-457 of
SEQ ID NO:31 (chimpanzee), and nucleotides 1-458 of SEQ ID NO:34
(human), or fragments thereof containing preferably 18-225
nucleotides and at least one of the chimpanzee evolutionarily
significant nucleotides or corresponding human nucleotides. The
invention also provides agents which are identified using the
screening methods described herein.
[0036] In another aspect, the invention provides methods of
screening agents which may modulate the activity of the human
polynucleotide or polypeptide to either modulate a unique or
enhanced human function or trait or to mimic the non-human primate
trait of interest, such as susceptibility or resistance to
development of a disease, such as HCV-associated chronic hepatitis
or AIDS. These methods comprise contacting a cell which has been
transfected with a polynucleotide sequence with an agent to be
tested, and identifying agents based on their ability to modulate
function of the polynucleotide or contacting a polypeptide
preparation with an agent to be tested and identifying agents based
upon their ability to modulate function of the polypeptide. In
preferred embodiments, the polynucleotide sequence is an
evolutionarily significant chimpanzee p44 polynucleotide sequence
or its corresponding human polynucleotide sequence. In more
preferred embodiments, the polynucleotide sequence is nucleotides
1-457 of SEQ ID NO: 31(chimpanzee), or nucleotides 1-457 of SEQ ID
NO:34 (human), or fragments thereof containing preferably 18-225
nucleotides and at least one of the chimpanzee evolutionarily
significant nucleotides or corresponding human nucleotides.
[0037] In another aspect of the invention, methods are provided for
identifying candidate polynucleotides that may be associated with
decreased resistance to development of a disease in humans,
comprising comparing the human polynucleotide sequence with the
corresponding non-human primate polynucleotide sequence to identify
any nucleotide changes; and determining whether the human
nucleotide changes are evolutionarily significant. It has been
observed that human polynucleotides that are evolutionarily
significant may, in some instances, be associated with increased
susceptibility or decreased resistance to the development of human
diseases such as cancer. As is described herein, the strongly
positively selected BRCA1 gene's exon 11 is also the location of a
number of mutations associated with breast, ovarian and/or prostate
cancer. Thus, this phenomenon may represent a trade-off between
enhanced development of one trait and loss or reduction in another
trait in polynucleotides encoding polypeptides of multiple
functions. In this way, identification of positively selected human
polynucleotides can serve to identify a pool of genes that are
candidates for susceptibility to human diseases.
[0038] Human candidate evolutionarily significant polynucleotides
that are identified in this manner can be evaluated for their role
in conferring susceptibility to diseases by analyzing the
functional effect of the evolutionarily significant nucleotide
change in the candidate polynucleotide in a suitable model system.
The presence of a functional effect in the model system indicates a
correlation between the nucleotide change in the candidate
polynucleotide and the decreased resistance to development of the
disease in humans. For example, if an evolutionarily significant
polynucleotide containing all the evolutionarily significant
nucleotide changes, or a similar polynucleotide with a lesser
number of nucleotide changes, is found to increase the
susceptibility to the disease at issue in a non-human primate
model, this would be a functional effect that correlates the
nucleotide change and the disease.
[0039] Alternatively, human candidate evolutionarily significant
polynucleotides may, in some individuals, have mutations aside from
the evolutionarily significant nucleotide changes, that confer the
increased susceptibility to the disease. These mutations can be
tested in a suitable model system for a functional effect, such as
conversion to a neoplastic phenotype, to correlate the mutation to
the disease.
[0040] Further, the subject method includes a diagnostic method to
determine whether a human patient is predisposed to decreased
resistance to the development of a disease, by assaying the
patient's nucleic acids for the presence of a mutation in an
evolutionarily significant polynucleotide, where the presence of
the mutation in the polynucleotide has been determined by methods
described herein as being diagnostic for decreased resistance to
the development of the disease. In one embodiment, the
polynucleotide is BRCA1 exon 11, and the disease is breast,
prostate or ovarian cancer.
BRIEF DESCRIPTION OF THE DRAWINGS
[0041] FIG. 1 depicts a phylogenetic tree for primates within the
hominoid group. The branching orders are based on well-supported
mitochondrial DNA phylogenies. Messier and Stewart (1997) Nature
385:151-154.
[0042] FIG. 2 (SEQ ID NOS:1-3) is a nucleotide sequence alignment
between human and chimpanzee ICAM-1 sequences (GenBank.RTM.
accession numbers X06990 and X86848, respectively). The amino acid
translation of the chimpanzee sequence is shown below the
alignment.
[0043] FIG. 3 shows the nucleotide sequence of gorilla ICAM-1 (SEQ
ID NO:4).
[0044] FIG. 4 shows the nucleotide sequence of orangutan ICAM-1
(SEQ ID NO:5).
[0045] FIGS. 5(A)-(E) show the polypeptide sequence alignment of
ICAM-1 from several primate species (SEQ ID NO:6).
[0046] FIGS. 6(A)-(B) show the polypeptide sequence alignment of
ICAM-2 from several primate species (SEQ ID NO:7).
[0047] FIGS. 7(A)-(D) show the polypeptide sequence alignment of
ICAM-3 from several primate species (SEQ ID NO:8).
[0048] FIG. 8 depicts a schematic representation of a procedure for
comparing human/primate brain polynucleotides, selecting sequences
with evolutionarily significant changes, and further characterizing
the selected sequences. The diagram of FIG. 8 illustrates a
preferred embodiment of the invention and together with the
description serves to explain the principles of the invention,
along with elaboration and optional additional steps. It is
understood that any human/primate polynucleotide sequence can be
compared by a similar procedure and that the procedure is not
limited to brain polynucleotides.
[0049] FIG. 9 illustrates the known phylogenetic tree for the
species compared in Example 14, with values of b.sub.N and b.sub.s
mapped upon appropriate branches. Values of b.sub.N and b.sub.s
were calculated by the method described in Zhang et al. (1998)
Proc. Natl. Acad. Sci. USA 95:3708-3713. Values are shown above the
branches; all values are shown 100.times., for reasons of clarity.
Statistical significance was calculated as for comparisons in Table
5 (Example 14), and levels of statistical significance are as shown
as in Table 5. Note that only the branch leading from the
human/chimpanzee common ancestor to modern humans shows a
statistically significant value for b.sub.N-b.sub.s.
[0050] FIG. 10 illustrates a space-filling model of human CD59 with
the duplicated GPI link (Asn) indicated by the darkest shading.
This GPI link is duplicated in chimpanzees so that chimp CD59
contains 3 GPI links. The three areas of intermediate shading in
FIG. 10 are other residues which differ between chimp and
human.
[0051] FIG. 11 shows the coding sequence of human DC-SIGN (Genbank
Ace. No. M98457) (SEQ. ID. NO. 9).
[0052] FIG. 12 shows the coding sequence of chimpanzee DC-SIGN
(SEQ. ID. NO. 10).
[0053] FIG. 13 shows the coding sequence of gorilla DC-SIGN (SEQ.
ID. NO. 11).
[0054] FIG. 14A shows the nucleotide sequence of the human AATYK
gene. Start and stop codons are underlined (SEQ ID NO:14).
[0055] FIG. 14B shows an 1207 amino acid sequence of the human
AATYK gene (SEQ ID NO:16).
[0056] FIG. 15A shows an 1806 base-pair region of the chimp AATYK
gene (SEQ ID NO:17).
[0057] FIG. 15B shows an 1785 base-pair region of the gorilla AATYK
gene (SEQ ID NO:18).
[0058] FIG. 16 shows a 1335 nucleotide region of the aligned
chimpanzee (SEQ ID NO:31) and human (SEQ IS NO:34) p44 gene coding
region. The underlined portion is exon 2, which was determined to
be evolutionarily significant. Non-synonymous differences between
the two sequences are indicated in bold, synonymous differences in
italics. Chimpanzee has a single heterozygous base (position 212),
shown as M (IUPAC code for A or C. The C base represents a
nonsynonymous difference from human, while A is identical to the
same position in the human homolog. Thus, these two chimpanzee
alleles differ slightly in the K.sub.A/K.sub.S ratios relative to
human p44.
DETAILED DESCRIPTION OF THE INVENTION
[0059] The present invention applies comparative genomics to
identify specific gene changes which are associated with, and thus
may contribute to or be responsible for, physiological conditions,
such as medically or commercially relevant evolved traits. The
invention comprises a comparative genomics approach to identify
specific gene changes responsible for differences in functions and
diseases distinguishing humans from other non-humans, particularly
primates, and most preferably chimpanzees, including the two known
species, common chimpanzees and bonobos (pygmy chimpanzees). For
example, chimpanzees and humans are 98.5% identical at the DNA
sequence level and the present invention can identify the adaptive
molecular changes underlying differences between the species in a
number of areas, including unique or enhanced human cognitive
abilities or physiological traits and chimpanzee resistance to HCV,
AIDS and certain cancers. Unlike traditional genomics, which merely
identifies genes, the present invention provides exact information
on evolutionary solutions that eliminate disease or provide unique
or enhanced functions or traits. The present invention identifies
genes that have evolved to confer an evolutionary advantage and the
specific evolved changes.
[0060] The present invention results from the observation that
human protein-coding polynucleotides may contain sequence changes
that are found in humans but not in other evolutionarily closely
related species such as non-human primates, as a result of adaptive
selection during evolution.
[0061] The present invention further results from the observation
that the genetic information of non-human primates may contain
changes that are found in a particular non-human primate but not in
humans, as a result of adaptive selection during evolution. In this
embodiment, a non-human primate polynucleotide or polypeptide has
undergone natural selection that resulted in a positive
evolutionarily significant change (i.e., the non-human primate
polynucleotide or polypeptide has a positive attribute not present
in humans). In this embodiment the positively selected
polynucleotide or polypeptide may be associated with susceptibility
or resistance to certain diseases or other commercially relevant
traits. Medically relevant examples of this embodiment include, but
are not limited to, polynucleotides and polypeptides that are
positively selected in non-human primates, preferably chimpanzees,
that may be associated with susceptibility or resistance to
infectious diseases and cancer. An example of this embodiment
includes polynucleotides and polypeptides associated with the
susceptibility or resistance to progression from HIV infection to
development of AIDS. The present invention can thus be useful in
gaining insight into the molecular mechanisms that underlie
resistance to progression from HIV infection to development of
AIDS, providing information that can also be useful in discovering
and/or designing agents such as drugs that prevent and/or delay
development of AIDS. Likewise, the present invention can be useful
in gaining insight into the underlying mechanisms for HCV
resistance in chimpanzees as compared to humans. Commercially
relevant examples include, but are not limited to, polynucleotides
and polypeptides that are positively selected in non-human primates
that may be associated with aesthetic traits, such as hair growth,
absence of acne or muscle mass.
[0062] Positively selected human evolutionarily significant changes
in polynucleotide and polypeptide sequences may be attributed to
human capabilities that provide humans with competitive advantages,
particularly when compared to the closest evolutionary relative,
chimpanzee, such as unique or enhanced human brain functions. The
present invention identifies human genes that evolved to provide
unique or enhanced human cognitive abilities and the actual protein
changes that confer functional differences will be quite useful in
therapeutic approaches to treat cognitive deficiencies as well as
cognitive enhancement for the general population.
[0063] Other positively selected human evolutionarily significant
changes include those sequences that may be attributed to human
physiological traits or conditions that are enhanced or unique
relative to close evolutionary relatives, such as the chimpanzee,
including enhanced breast development. The present invention
provides a method of determining whether a polynucleotide sequence
in humans that may be associated with enhanced breast development
has undergone an evolutionarily significant change relative to a
corresponding polynucleotide sequence in a closely related
non-human primate. The identification of evolutionarily significant
changes in the human polynucleotide that is involved in the
development of unique or enhanced human physiological traits is
important in the development of agents or drugs that can modulate
the activity or function of the human polynucleotide or its encoded
polypeptide.
[0064] The practice of the present invention employs, unless
otherwise indicated, conventional techniques of molecular biology,
genetics and molecular evolution, which are within the skill of the
art. Such techniques are explained fully in the literature, such
as: "Molecular Cloning: A Laboratory Manual", second edition
(Sambrook et al., 1989); "Oligonucleotide Synthesis" (M. J. Gait,
ed., 1984); "Current Protocols in Molecular Biology" (F. M. Ausubel
et al., eds., 1987); "PCR: The Polymerase Chain Reaction", (Mullis
et al., eds., 1994); "Molecular Evolution", (Li, 1997).
DEFINITIONS
[0065] As used herein, a "polynucleotide" refers to a polymeric
form of nucleotides of any length, either ribonucleotides or
deoxyribonucleotides, or analogs thereof. This term refers to the
primary structure of the molecule, and thus includes double- and
single-stranded DNA, as well as double- and single-stranded RNA. It
also includes modified polynucleotides such as methylated and/or
capped polynucleotides. The terms "polynucleotide" and "nucleotide
sequence" are used interchangeably.
[0066] As used herein, a "gene" refers to a polynucleotide or
portion of a polynucleotide comprising a sequence that encodes a
protein. It is well understood in the art that a gene also
comprises non-coding sequences, such as 5= and 3=flanking sequences
(such as promoters, enhancers, repressors, and other regulatory
sequences) as well as introns.
[0067] The terms "polypeptide," "peptide," and "protein" are used
interchangeably herein to refer to polymers of amino acids of any
length. These terms also include proteins that are
post-translationally modified through reactions that include
glycosylation, acetylation and phosphorylation.
[0068] A "physiological condition" is a term well-understood in the
art and means any condition or state that can be measured and/or
observed. A "physiological condition" includes, but is not limited
to, a physical condition, such as degree of body fat, alopecia
(baldness), acne or enhanced breast development; life-expectancy;
disease states (which include susceptibility and/or resistance to
diseases), such as cancer or infectious diseases. Examples of
physiological conditions are provided below (see, e.g., definitions
of "human medically relevant medical condition", "human
commercially relevant condition", "medically relevant evolved
trait", and "commercially relevant evolved trait") and throughout
the specification, and it is understood that these terms and
examples refer to a physiological condition. A physiological
condition may be, but is not necessarily, the result of multiple
factors, any of which in turn may be considered a physiological
condition. A physiological condition which is "present" in a human
or non-human primate occurs within a given population, and includes
those physiological conditions which are unique and/or enhanced in
a given population when compared to another population.
[0069] The terms "human medically relevant condition" or "human
commercially relevant condition" are used herein to refer to human
conditions for which medical or non-medical intervention is
desired.
[0070] The term "medically relevant evolved trait" is used herein
to refer to traits that have evolved in humans or non-human
primates whose analysis could provide information (e.g., physical
or biochemical data) relevant to the development of a human medical
treatment.
[0071] The term "commercially relevant evolved trait" is used
herein to refer to traits that have evolved in humans or non-human
primates whose analysis could provide information (e.g., physical
or biochemical data) relevant to the development of a medical or
non-medical product or treatment for human use.
[0072] The term "K.sub.A/K.sub.S-type methods" means methods that
evaluate differences, frequently (but not always) shown as a ratio,
between the number of nonsynonymous substitutions and synonymous
substitutions in homologous genes (including the more rigorous
methods that determine non-synonymous and synonymous sites). These
methods are designated using several systems of nomenclature,
including but not limited to K.sub.A/K.sub.S, d.sub.N/d.sub.s,
D.sub.N/D.sub.s.
[0073] The terms "evolutionarily significant change" or "adaptive
evolutionary change" refers to one or more nucleotide or peptide
sequence change(s) between two species that may be attributed to a
positive selective pressure. One method for determining the
presence of an evolutionarily significant change is to apply a
K.sub.A/K.sub.S-type analytical method, such as to measure a
K.sub.A/K.sub.S ratio. Typically, a K.sub.A/K.sub.S ratio at least
about 0.75, more preferably at least about 1.0, more preferably at
least about 1.25, more preferably at least about 1.5 and most
preferably at least about 2.0 indicates the action of positive
selection and is considered to be an evolutionarily significant
change.
[0074] Strictly speaking, only K.sub.A/K.sub.S ratios greater than
1.0 are indicative of positive selection. It is commonly accepted
that the ESTs in GenBank.RTM. and other public databases often
suffer from some degree of sequencing error, and even a few
incorrect nucleotides can influence K.sub.A/K.sub.S scores. Thus,
all pairwise comparisons that involve public ESTs must be
undertaken with care. Due to the errors inherent in the publicly
available databases, it is possible that these errors could depress
a K.sub.A/K.sub.S ratio below 1.0. For this reason, K.sub.A/K.sub.S
ratios between 0.75 and 1.0 should be examined carefully in order
to determine whether or not a sequencing error has obscured
evidence of positive selection. Such errors may be discovered
through sequencing methods that are designed to be highly
accurate.
[0075] The term "positive evolutionarily significant change" means
an evolutionarily significant change in a particular species that
results in an adaptive change that is positive as compared to other
related species. Examples of positive evolutionarily significant
changes are changes that have resulted in enhanced cognitive
abilities or enhanced or unique physiological conditions in humans
and adaptive changes in chimpanzees that have resulted in the
ability of the chimpanzees infected with HIV or HCV to be resistant
to progression of the infection.
[0076] The term "enhanced breast development" refers to the
enlarged breasts observed in humans relative to non-human primates.
The enlarged human breast has increased adipose, duct and/or gland
tissue relative to other primates, and develops prior to first
pregnancy and lactation.
[0077] The term "resistant" means that an organism, such as a
chimpanzee, exhibits an ability to avoid, or diminish the extent
of, a disease condition and/or development of the disease,
preferably when compared to non-resistant organisms, typically
humans. For example, a chimpanzee is resistant to certain impacts
of HCV, HIV and other viral infections, and/or it does not develop
the ultimate disease (chronic hepatitis or AIDS, respectively).
[0078] The term "susceptibility" means that an organism, such as a
human, fails to avoid, or diminish the extent of a disease
condition and/or development of the disease condition, preferably
when compared to an organism that is known to be resistant, such as
a non-human primate, such as chimpanzee. For example, a human is
susceptible to certain impacts of HCV, HIV and other viral
infections and/or development of the ultimate disease (chronic
hepatitis or AIDS).
[0079] It is understood that resistance and susceptibility vary
from individual to individual, and that, for purposes of this
invention, these terms also apply to a group of individuals within
a species, and comparisons of resistance and susceptibility
generally refer to overall, average differences between species,
although intra-specific comparisons may be used.
[0080] The term "homologous" or "homologue" or "ortholog" is known
and well understood in the art and refers to related sequences that
share a common ancestor and is determined based on degree of
sequence identity. These terms describe the relationship between a
gene found in one species and the corresponding or equivalent gene
in another species. For purposes of this invention homologous
sequences are compared.
[0081] "Homologous sequences" or "homologues" or "orthologs" are
thought, believed, or known to be functionally related. A
functional relationship may be indicated in any one of a number of
ways, including, but not limited to, (a) degree of sequence
identity; (b) same or same or similar biological function.
Preferably, both (a) and (b) are indicated. The degree of sequence
identity may vary, but is preferably at least 50% (when using
standard sequence alignment programs known in the art), more
preferably at least 60%, more preferably at least about 75%, more
preferably at least about 85%. Homology can be determined using
software programs readily available in the art, such as those
discussed in Current Protocols in Molecular Biology (F. M. Ausubel
et al., eds., 1987) Supplement 30, section 7.718, Table 7.71.
Preferred alignment programs are MacVector (Oxford Molecular Ltd,
Oxford, U.K.) and ALIGN Plus (Scientific and Educational Software,
Pennsylvania). Another preferred alignment program is Sequencher
(Gene Codes, Ann Arbor, Mich.), using default parameters.
[0082] The term "nucleotide change" refers to nucleotide
substitution, deletion, and/or insertion, as is well understood in
the art.
[0083] The term "human protein-coding nucleotide sequence" which is
"associated with susceptibility to AIDS" as used herein refers to a
human nucleotide sequence that encodes a protein that is associated
with HIV dissemination (within the organism, i.e., intra-organism
infectivity), propagation and/or development of AIDS. Due to the
extensive research in the mechanisms underlying progression from
HIV infection to the development of AIDS, a number of candidate
human genes are believed or known to be associated with one or more
of these phenomena. A polynucleotide (including any polypeptide
encoded therein) sequence associated with susceptibility to AIDS is
one which is either known or implicated to play a role in HIV
dissemination, replication, and/or subsequent progression to
full-blown AIDS. Examples of such candidate genes are provided
below.
[0084] "AIDS resistant" means that an organism, such as a
chimpanzee, exhibits an ability to avoid, or diminish the extent
of, the result of HIV infection (such as propagation and
dissemination) and/or development of AIDS, preferably when compared
to AIDS-susceptible humans.
[0085] "Susceptibility" to AIDS means that an organism, such as a
human, fails to avoid, or diminish the extent of, the result of HIV
infection (such as propagation and dissemination) and/or
development of AIDS, preferably when compared to an organism that
is known to be AIDS resistant, such as a non-human primate, such as
chimpanzee.
[0086] The term "human protein-coding nucleotide sequence" which is
"associated with susceptibility to HCV infection" as used herein
refers to a human nucleotide sequence that encodes a polypeptide
that is associated with HCV dissemination (within the organism,
i.e., intra-organism infectivity), propagation and/or development
of chronic hepatitis. Candidate human genes are believed or known
to be associated with human susceptibility to HCV infection. A
polynucleotide (including any polypeptide encoded therein) sequence
associated with susceptibility to chronic hepatitis is one which is
either known or implicated to play a role in HCV dissemination,
replication, and/or subsequent progression to chronic hepatitis or
hepatocellular carcinoma. One example of a polynucleotide
associated with susceptibility is human p44 exon 2.
[0087] "HCV resistant" means that an organism, such as a
chimpanzee, exhibits an ability to avoid, or diminish the extent
of, the result of HCV infection (such as propagation and
dissemination) and/or development of chronic hepatitis, preferably
when compared to HCV-susceptible humans.
[0088] "Susceptibility" to HCV infection means that an organism,
such as a human, fails to avoid, or diminish the extent of, the
result of HCV infection (such as propagation and dissemination)
and/or development of chronic hepatitis, preferably when compared
to an organism that is known to be HCV infection resistant, such as
a non-human primate, such as chimpanzee.
[0089] The term "brain protein-coding nucleotide sequence" as used
herein refers to a nucleotide sequence expressed in the brain that
encodes a protein. One example of the "brain protein-coding
nucleotide sequence" is a brain cDNA sequence.
[0090] As used herein, the term "brain functions unique or enhanced
in humans" or "unique functional capabilities of the human brain"
or "brain functional capability that is unique or enhanced in
humans" refers to any brain function, either in kind or in degree,
that is identified and/or observed to be enhanced in humans
compared to other non-human primates. Such brain functions include,
but are not limited to high capacity information information
processing, storage and retrieval capabilities, creativity, memory,
language abilities, brain-mediated emotional response, locomotion,
pain/pleasure sensation, olfaction, and temperament.
[0091] "Housekeeping genes" is a term well understood in the art
and means those genes associated with general cell function,
including but not limited to growth, division, stasis, metabolism,
and/or death. "Housekeeping" genes generally perform functions
found in more than one cell type. In contrast, cell-specific genes
generally perform functions in a particular cell type (such as
neurons) and/or class (such as neural cells).
[0092] The term "agent", as used herein, means a biological or
chemical compound such as a simple or complex organic or inorganic
molecule, a peptide, a protein or an oligonucleotide. A vast array
of compounds can be synthesized, for example oligomers, such as
oligopeptides and oligonucleotides, and synthetic organic and
inorganic compounds based on various core structures, and these are
also included in the term "agent". In addition, various natural
sources can provide compounds for screening, such as plant or
animal extracts, and the like. Compounds can be tested singly or in
combination with one another.
[0093] The term "to modulate function" of a polynucleotide or a
polypeptide means that the function of the polynucleotide or
polypeptide is altered when compared to not adding an agent.
Modulation may occur on any level that affects function. A
polynucleotide or polypeptide function may be direct or indirect,
and measured directly or indirectly.
[0094] A "function of a polynucleotide" includes, but is not
limited to, replication; translation; and expression pattern(s). A
polynucleotide function also includes functions associated with a
polypeptide encoded within the polynucleotide. For example, an
agent which acts on a polynucleotide and affects protein
expression, conformation, folding (or other physical
characteristics), binding to other moieties (such as ligands),
activity (or other functional characteristics), regulation and/or
other aspects of protein structure or function is considered to
have modulated polynucleotide function.
[0095] A "function of a polypeptide" includes, but is not limited
to, conformation, folding (or other physical characteristics),
binding to other moieties (such as ligands), activity (or other
functional characteristics), and/or other aspects of protein
structure or functions. For example, an agent that acts on a
polypeptide and affects its conformation, folding (or other
physical characteristics), binding to other moieties (such as
ligands), activity (or other functional characteristics), and/or
other aspects of protein structure or functions is considered to
have modulated polypeptide function. The ways that an effective
agent can act to modulate the function of a polypeptide include,
but are not limited to 1) changing the conformation, folding or
other physical characteristics; 2) changing the binding strength to
its natural ligand or changing the specificity of binding to
ligands; and 3) altering the activity of the polypeptide.
[0096] The terms "modulate susceptibility to development of AIDS"
and "modulate resistance to development of AIDS", as used herein,
include modulating intra-organism cell-to-cell transmission or
infectivity of HIV. The terms further include reducing
susceptibility to development of AIDS and/or cell-to-cell
transmission or infectivity of HIV. The terms further include
increasing resistance to development of AIDS and/or cell-to-cell
transmission or infectivity of HIV. One means of assessing whether
an agent is one that modulates susceptibility or resistance to
development of AIDS is to determine whether at least one index of
HIV susceptibility is affected, using a cell-based system as
described herein, as compared with an appropriate control. Indicia
of HIV susceptibility include, but are not limited to, cell-to-cell
transmission of the virus, as measured by total number of cells
infected with HIV and syncytia formation.
[0097] The terms "modulate susceptibility to HCV infection" and
"modulate resistance to HCV infection", as used herein, include
modulating intra-organism cell-to-cell transmission or infectivity
of HCV. The terms further include reducing susceptibility to
development of chronic hepatitis and/or cell-to-cell transmission
or infectivity of HCV. The terms further include increasing
resistance to infection by HCV and/or cell-to-cell transmission or
infectivity of HCV. One means of assessing whether an agent is one
that modulates susceptibility or resistance to development of
HCV-associated chronic hepatitis is to determine whether at least
one index of HCV susceptibility is affected, using a cell-based
system as described herein, as compared with an appropriate
control. Indicia of Indicia of HCV susceptibility include, but are
not limited to, cell-to-cell transmission of the virus, as measured
by total number of cells infected with HCV.
[0098] The term "target site" means a location in a polypeptide
which can be one or more amino acids and/or is a part of a
structural and/or functional motif, e.g., a binding site, a
dimerization domain, or a catalytic active site. It also includes a
location in a polynucleotide where there is one or more
non-synonymous nucleotide changes in a protein coding region, or
may also refer to a regulatory region of a positively selected
gene. Target sites may be a useful for direct or indirect
interaction with an agent, such as a therapeutic agent.
[0099] The term "molecular difference" includes any structural
and/or functional difference. Methods to detect such differences,
as well as examples of such differences, are described herein.
[0100] A "functional effect" is a term well known in the art, and
means any effect which is exhibited on any level of activity,
whether direct or indirect.
[0101] An agent that interacts with human p44 polypeptide to form a
complex that "mimics the structure" of chimpanzee or other
non-human primate p44 polypeptide means that the interaction of the
agent with the human p44 polypeptide results in a complex whose
three-dimensional structure more closely approximates the
three-dimensional structure of the chimpanzee or non-human p44
polypeptide, relative to the human p44 polypeptide alone.
[0102] An agent that interacts with human p44 polypeptide to form a
complex that "mimics the function" of chimpanzee or other non-human
primate p44 polypeptide means that the complex of human p44
polypeptide and agent attain a biological function or enhance a
biological function that is characteristic of the chimpanzee or
other non-human primate p44 polypeptide, relative to the human p44
polypeptide alone. Such biological function of chimpanzee p44
polypeptide includes, without limitation, microtubule assembly
following HCV infection, and resistance to HCV infection of
hepatocytes.
General Procedures Known in the Art
[0103] For the purposes of this invention, the source of the human
and non-human polynucleotide can be any suitable source, e.g.,
genomic sequences or cDNA sequences. Preferably, cDNA sequences
from human and a non-human primate are compared. Human
protein-coding sequences can be obtained from public databases such
as the Genome Sequence Data Bank and GenBank. These databases serve
as repositories of the molecular sequence data generated by ongoing
research efforts. Alternatively, human protein-coding sequences may
be obtained from, for example, sequencing of cDNA reverse
transcribed from mRNA expressed in human cells, or after PCR
amplification, according to methods well known in the art.
Alternatively, human genomic sequences may be used for sequence
comparison. Human genomic sequences can be obtained from public
databases or from a sequencing of commercially available human
genomic DNA libraries or from genomic DNA, after PCR.
[0104] The non-human primate protein-coding sequences can be
obtained by, for example, sequencing cDNA clones that are randomly
selected from a non-human primate cDNA library. The non-human
primate cDNA library can be constructed from total mRNA expressed
in a primate cell using standard techniques in the art. In some
embodiments, the cDNA is prepared from mRNA obtained from a tissue
at a determined developmental stage, or a tissue obtained after the
primate has been subjected to certain environmental conditions.
cDNA libraries used for the sequence comparison of the present
invention can be constructed using conventional cDNA library
construction techniques that are explained fully in the literature
of the art. Total mRNAs are used as templates to reverse-transcribe
cDNAs. Transcribed cDNAs are subcloned into appropriate vectors to
establish a cDNA library. The established cDNA library can be
maximized for full-length cDNA contents, although less than
full-length cDNAs may be used. Furthermore, the sequence frequency
can be normalized according to, for example, Bonaldo et al. (1996)
Genome Research 6:791-806. cDNA clones randomly selected from the
constructed cDNA library can be sequenced using standard automated
sequencing techniques. Preferably, full-length cDNA clones are used
for sequencing. Either the entire or a large portion of cDNA clones
from a Either the entire or a large portion of cDNA clones from a
cDNA library may be sequenced, although it is also possible to
practice some embodiments of the invention by sequencing as little
as a single cDNA, or several cDNA clones.
[0105] In one preferred embodiment of the present invention,
non-human primate cDNA clones to be sequenced can be pre-selected
according to their expression specificity. In order to select cDNAs
corresponding to active genes that are specifically expressed, the
cDNAs can be subject to subtraction hybridization using mRNAs
obtained from other organs, tissues or cells of the same animal.
Under certain hybridization conditions with appropriate stringency
and concentration, those cDNAs that hybridize with non-tissue
specific mRNAs and thus likely represent "housekeeping" genes will
be excluded from the cDNA pool. Accordingly, remaining cDNAs to be
sequenced are more likely to be associated with tissue-specific
functions. For the purpose of subtraction hybridization,
non-tissue-specific mRNAs can be obtained from one organ, or
preferably from a combination of different organs and cells. The
amount of non-tissue-specific mRNAs are maximized to saturate the
tissue-specific cDNAs.
[0106] Alternatively, information from online public databases can
be used to select or give priority to cDNAs that are more likely to
be associated with specific functions. For example, the non-human
primate cDNA candidates for sequencing can be selected by PCR using
primers designed from candidate human cDNA sequence. Candidate
human cDNA sequences are, for example, those that are only found in
a specific tissue, such as brain or breast, or that correspond to
genes likely to be important in the specific function, such as
brain function or breast tissue adipose or glandular development.
Such human tissue-specific cDNA sequences can be obtained by
searching online human sequence databases such as GenBank, in which
information with respect to the expression profile and/or
biological activity for cDNA sequences are specified.
[0107] Sequences of non-human primate (for example, from an AIDS-
or HCV-resistant non-human primate) homologue(s) to a known human
gene may be obtained using methods standard in the art, such as
from public databases such as GenBank or PCR methods (using, for
example, GeneAmp PCR System 9700 thermocyclers (Applied Biosystems,
Inc.)). For example non-human primate cDNA candidates for
sequencing can be selected by PCR using primers designed from
candidate human cDNA sequences. For PCR, primers may be made from
the human sequences using standard methods in the art, including
publicly available primer design programs such as PRIMER7
(Whitehead Institute). The sequence amplified may then be sequenced
using standard methods and equipment in the art, such as automated
sequencers (Applied Biosystems, Inc.).
General Methods of the Invention
[0108] The general method of the invention is as follows. Briefly,
nucleotide sequences are obtained from a human source and a
non-human source. The human and non-human nucleotide sequences are
compared to one another to identify sequences that are homologous.
The homologous sequences are analyzed to identify those that have
nucleic acid sequence differences between the two species. Then
molecular evolution analysis is conducted to evaluate
quantitatively and qualitatively the evolutionary significance of
the differences. For genes that have been positively selected
between two species, e.g., human and chimp, it is useful to
determine whether the difference occurs in other non-human
primates. Next, the sequence is characterized in terms of
molecular/genetic identity and biological function. Finally, the
information can be used to identify agents useful in diagnosis and
treatment of human medically or commercially relevant
conditions.
[0109] The general methods of the invention entail comparing human
protein-coding nucleotide sequences to protein-coding nucleotide
sequences of a non-human, preferably a primate, and most preferably
a chimpanzee. Examples of other non-human primates are bonobo,
gorilla, orangutan, gibbon, Old World monkeys, and New World
monkeys. A phylogenetic tree for primates within the hominoid group
is depicted in FIG. 1. Bioinformatics is applied to the comparison
and sequences are selected that contain a nucleotide change or
changes that is/are evolutionarily significant change(s). The
invention enables the identification of genes that have evolved to
confer some evolutionary advantage and the identification of the
specific evolved changes.
[0110] Protein-coding sequences of human and another non-human
primate are compared to identify homologous sequences.
Protein-coding sequences known to or suspected of having a specific
biological function may serve as the starting point for the
comparison. Any appropriate mechanism for completing this
comparison is contemplated by this invention. Alignment may be
performed manually or by software (examples of suitable alignment
programs are known in the art). Preferably, protein-coding
sequences from a non-human primate are compared to human sequences
via database searches, e.g., BLAST searches. The high scoring
"hits," i.e., sequences that show a significant similarity after
BLAST analysis, will be retrieved and analyzed. Sequences showing a
significant similarity can be those having at least about 60%, at
least about 75%, at least about 80%, at least about 85%, or at
least about 90% sequence identity. Preferably, sequences showing
greater than about 80% identity are further analyzed. The
homologous sequences identified via database searching can be
aligned in their entirety using sequence alignment methods and
programs that are known and available in the art, such as the
commonly used simple alignment program CLUSTAL V by Higgins et al.
(1992) CABIOS 8:189-191.
[0111] Alternatively, the sequencing and homologous comparison of
protein-coding sequences between human and a non-human primate may
be performed simultaneously by using the newly developed sequencing
chip technology. See, for example, Rava et al. U.S. Pat. No.
5,545,531.
[0112] The aligned protein-coding sequences of human and another
non-human primate are analyzed to identify nucleotide sequence
differences at particular sites. Again, any suitable method for
achieving this analysis is contemplated by this invention. If there
are no nucleotide sequence differences, the non-human primate
protein coding sequence is not usually further analyzed. The
detected sequence changes are generally, and preferably, initially
checked for accuracy. Preferably, the initial checking comprises
performing one or more of the following steps, any and all of which
are known in the art: (a) finding the points where there are
changes between the non-human primate and human sequences; (b)
checking the sequence fluorogram (chromatogram) to determine if the
bases that appear the bases that appear unique to non-human primate
correspond to strong, clear signals specific for the called base;
(c) checking the human hits to see if there is more than one human
sequence that corresponds to a sequence change. Multiple human
sequence entries for the same gene that have the same nucleotide at
a position where there is a different nucleotide in a non-human
primate sequence provides independent support that the human
sequence is accurate, and that the change is significant. Such
changes are examined using public database information and the
genetic code to determine whether these nucleotide sequence changes
result in a change in the amino acid sequence of the encoded
protein. As the definition of "nucleotide change" makes clear, the
present invention encompasses at least one nucleotide change,
either a substitution, a deletion or an insertion, in a human
protein-coding polynucleotide sequence as compared to corresponding
sequence from a non-human primate. Preferably, the change is a
nucleotide substitution. More preferably, more than one
substitution is present in the identified human sequence and is
subjected to molecular evolution analysis.
[0113] Any of several different molecular evolution analyses or
K.sub.A/K.sub.S-type methods can be employed to evaluate
quantitatively and qualitatively the evolutionary significance of
the identified nucleotide changes between human gene sequences and
that of a non-human primate. Kreitman and Akashi (1995) Annu. Rev.
Ecol. Syst. 26:403-422; Li, Molecular Evolution, Sinauer
Associates, Sunderland, Mass., 1997. For example, positive
selection on proteins (i.e., molecular-level adaptive evolution)
can be detected in protein-coding genes by pairwise comparisons of
the ratios of nonsynonymous nucleotide substitutions per
nonsynonymous site (K.sub.A) to synonymous substitutions per
synonymous site (K.sub.S) (Li et al., 1985; Li, 1993). Any
comparison of K.sub.A and K.sub.S may be used, although it is
particularly convenient and most effective to compare these two
variables as a ratio. Sequences are identified by exhibiting a
statistically significant difference between K.sub.A and K.sub.S
using standard statistical methods.
[0114] Preferably, the K.sub.A/K.sub.S analysis by Li et al. is
used to carry out the present invention, although other analysis
programs that can detect positively selected genes between species
can also be used. Li et al. (1985) Mol. Biol. Evol. 2:150-174; Li
(1993); see also J. Mol. see also J. Mol. Evol. 36:96-99; Messier
and Stewart (1997) Nature 385:151-154; Nei (1987) Molecular
Evolutionary Genetics (New York, Columbia University Press). The
K.sub.A/K.sub.S method, which comprises a comparison of the rate of
non-synonymous substitutions per non-synonymous site with the rate
of synonymous substitutions per synonymous site between homologous
protein-coding region of genes in terms of a ratio, is used to
identify sequence substitutions that may be driven by adaptive
selections as opposed to neutral selections during evolution. A
synonymous ("silent") substitution is one that, owing to the
degeneracy of the genetic code, makes no change to the amino acid
sequence encoded; a non-synonymous substitution results in an amino
acid replacement. The extent of each type of change can be
estimated as K.sub.A and K.sub.S, respectively, the numbers of
synonymous substitutions per synonymous site and non-synonymous
substitutions per non-synonymous site. Calculations of
K.sub.A/K.sub.S may be performed manually or by using software. An
example of a suitable program is MEGA (Molecular Genetics
Institute, Pennsylvania State University).
[0115] For the purpose of estimating K.sub.A and K.sub.S, either
complete or partial human protein-coding sequences are used to
calculate total numbers of synonymous and non-synonymous
substitutions, as well as non-synonymous and synonymous sites. The
length of the polynucleotide sequence analyzed can be any
appropriate length. Preferably, the entire coding sequence is
compared, in order to determine any and all significant changes.
Publicly available computer programs, such as Li93 (Li (1993) J.
Mol. Evol. 36:96-99) or INA, can be used to calculate the K.sub.A
and K.sub.S values for all pairwise comparisons. This analysis can
be farther adapted to examine sequences in a "sliding window"
fashion such that small numbers of important changes are not masked
by the whole sequence. "Sliding window" refers to examination of
consecutive, overlapping subsections of the gene (the subsections
can be of any length).
[0116] The comparison of non-synonymous and synonymous substitution
rates is represented by the K.sub.A/K.sub.S ratio. K.sub.A/K.sub.S
has been shown to be a reflection of the degree to which adaptive
evolution has been at work in the sequence under study. Full length
or partial segments of a coding sequence can be used for the
K.sub.A/K.sub.s analysis. The higher the K.sub.A/K.sub.S ratio, the
more likely that a sequence has undergone adaptive evolution and
the non-synonymous substitutions are evolutionarily significant.
See, for example, Messier and Stewart (1997). Preferably, the
K.sub.A/K.sub.S ratio is at least about 0.75, more preferably at
least about 1.0, more preferably at least about 1.25, more
preferably at least about 1.50, or more preferably at least about
2.00. Preferably, statistical analysis is performed on all elevated
K.sub.A/K.sub.S ratios, including, but not limited to, standard
methods such as Student=s t-test and likelihood ratio tests
described by Yang (1998) Mol. Biol. Evol. 37:441-456.
[0117] K.sub.A/K.sub.S ratios significantly greater than unity
strongly suggest that positive selection has fixed greater numbers
of amino acid replacements than can be expected as a result of
chance alone, and is in contrast to the commonly observed pattern
in which the ratio is less than or equal to one. Nei (1987); Hughes
and Hei (1988) Nature 335:167-170; Messier and Stewart (1994)
Current Biol. 4:911-913; Kreitman and Akashi (1995) Ann. Rev. Ecol.
Syst. 26:403-422; Messier and Stewart (1997). Ratios less than one
generally signify the role of negative, or purifying selection:
there is strong pressure on the primary structure of functional,
effective proteins to remain unchanged.
[0118] All methods for calculating K.sub.A/K.sub.S ratios are based
on a pairwise comparison of the number of nonsynonymous
substitutions per nonsynonymous site to the number of synonymous
substitutions per synonymous site for the protein-coding regions of
homologous genes from related species. Each method implements
different corrections for estimating "multiple hits" (i.e., more
than one nucleotide substitution at the same site). Each method
also uses different models for how DNA sequences change over
evolutionary time. Thus, preferably, a combination of results from
different algorithms is used to increase the level of sensitivity
for detection of positively-selected genes and confidence in the
result.
[0119] Preferably, K.sub.A/K.sub.S ratios should be calculated for
orthologous gene pairs, as opposed to paralogous gene pairs (i.e.,
a gene which results from speciation, as opposed to a gene that is
the result of gene duplication) Messier and Stewart (1997). This
distinction may be made by performing additional comparisons with
other non-human primates, such as gorilla and orangutan, which
allows for phylogenetic tree-building. Orthologous genes
Orthologous genes when used in tree-building will yield the known
"species tree", i.e., will produce a tree that recovers the known
biological tree. In contrast, paralogous genes will yield trees
which will violate the known biological tree.
[0120] It is understood that the methods described herein could
lead to the identification of human polynucleotide sequences that
are functionally related to human protein-coding sequences. Such
sequences may include, but are not limited to, non-coding sequences
or coding sequences that do not encode human proteins. These
related sequences can be, for example, physically adjacent to the
human protein-coding sequences in the human genome, such as introns
or 5=- and 3=-flanking sequences (including control elements such
as promoters and enhancers). These related sequences may be
obtained via searching a public human genome database such as
GenBank or, alternatively, by screening and sequencing a human
genomic library with a protein-coding sequence as probe. Methods
and techniques for obtaining non-coding sequences using related
coding sequence are well known to one skilled in the art.
[0121] The evolutionarily significant nucleotide changes, which are
detected by molecular evolution analysis such as the
K.sub.A/K.sub.S analysis, can be further assessed for their unique
occurrence in humans (or the non-human primate) or the extent to
which these changes are unique in humans (or the non-human
primate). For example, the identified changes can be tested for
presence/absence in other non-human primate sequences. The
sequences with at least one evolutionarily significant change
between human and one non-human primate can be used as primers for
PCR analysis of other non-human primate protein-coding sequences,
and resulting polynucleotides are sequenced to see whether the same
change is present in other non-human primates. These comparisons
allow further discrimination as to whether the adaptive
evolutionary changes are unique to the human lineage as compared to
other non-human primates or whether the adaptive change is unique
to the non-human primates (i.e., chimpanzee) as compared to humans
and other non-human primates. A nucleotide change that is detected
in human but not other primates more likely represents a human
adaptive evolutionary change. Alternatively, a nucleotide change
that is detected in a non-human primate (i.e., chimpanzee) that is
not detected in humans or other non-human detected in humans or
other non-human primates likely represents a chimpanzee adaptive
evolutionary change. Other non-human primates used for comparison
can be selected based on their phylogenetic relationships with
human. Closely related primates can be those within the hominoid
sublineage, such as chimpanzee, bonobo, gorilla, and orangutan.
Non-human primates can also be those that are outside the hominoid
group and thus not so closely related to human, such as the Old
World monkeys and New World monkeys. Statistical significance of
such comparisons may be determined using established available
programs, e.g., t-test as used by Messier and Stewart (1997) Nature
385:151-154. Those genes showing statistically high K.sub.A/K.sub.S
ratios are very likely to have undergone adaptive evolution.
[0122] Sequences with significant changes can be used as probes in
genomes from different human populations to see whether the
sequence changes are shared by more than one human population. Gene
sequences from different human populations can be obtained from
databases made available by, for example, the Human Genome Project,
the human genome diversity project or, alternatively, from direct
sequencing of PCR-amplified DNA from a number of unrelated, diverse
human populations. The presence of the identified changes in
different human populations would further indicate the evolutionary
significance of the changes. Chimpanzee sequences with significant
changes can be obtained and evaluated using similar methods to
determine whether the sequence changes are shared among many
chimpanzees.
[0123] Sequences with significant changes between species can be
further characterized in terms of their molecular/genetic
identities and biological functions, using methods and techniques
known to those of ordinary skill in the art. For example, the
sequences can be located genetically and physically within the
human genome using publicly available bio-informatics programs. The
newly identified significant changes within the nucleotide sequence
may suggest a potential role of the gene in human evolution and a
potential association with human-unique functional capabilities.
The putative gene with the identified sequences may be further
characterized by, for example, homologue searching. Shared homology
of the putative gene with a known gene may indicate a similar
biological biological role or function. Another exemplary method of
characterizing a putative gene sequence is on the basis of known
sequence motifs. Certain sequence patterns are known to code for
regions of proteins having specific biological characteristics such
as signal sequences, DNA binding domains, or transmembrane
domains.
[0124] The identified human sequences with significant changes can
also be further evaluated by looking at where the gene is expressed
in terms of tissue- or cell type-specificity. For example, the
identified coding sequences can be used as probes to perform in
situ mRNA hybridization that will reveal the expression patterns of
the sequences. Genes that are expressed in certain tissues may be
better candidates as being associated with important human
functions associated with that tissue, for example brain tissue.
The timing of the gene expression during each stage of human
development can also be determined.
[0125] As another exemplary method of sequence characterization,
the functional roles of the identified nucleotide sequences with
significant changes can be assessed by conducting functional assays
for different alleles of an identified gene in a model system, such
as yeast, nematode, Drosophila, and mouse. Model systems may be
cell-based or in viva, such as transgenic animals or animals with
chimeric organs or tissues. Preferably, the transgenic mouse or
chimeric organ mouse system is used. Methods of making cell-based
systems and/or transgenic/chimeric animal systems are known in the
art and need not be described in detail herein.
[0126] As another exemplary method of sequence characterization,
the use of computer programs allows modeling and visualizing the
three-dimensional structure of the homologous proteins from human
and chimpanzee. Specific, exact knowledge of which amino acids have
been replaced in a primate's protein(s) allows detection of
structural changes that may be associated with functional
differences. Thus, use of modeling techniques is closely associated
with identification of functional roles discussed in the previous
paragraph. The use of individual or combinations of these
techniques constitutes part of the present invention. For example,
chimpanzee ICAM-3 contains a glutamine residue (Q101) at the site
in which human ICAM-3 contains a proline (P101). The human The
human protein is known to bend sharply at this point. Replacement
of the proline by glutamine in the chimpanzee protein is likely to
result in a much less sharp bend at this point. This has clear
implications for packaging of the ICAM-3 chimpanzee protein into
HIV virions.
[0127] Likewise, chimpanzee p44 has been found to contain an exon
(exon2) having several evolutionarily significant nucleotide
changes relative to human p44 exon 2. The nonsynonymous changes and
corresponding amino acid changes in chimpanzee p44 polypeptide are
believed to confer HCV resistance to the chimpanzee. The mechanism
may involve enhanced p44 microtubule assembly in hepatocytes.
[0128] The sequences identified by the methods described herein
have significant uses in diagnosis and treatment of medically or
commercially relevant human conditions. Accordingly, the present
invention provides methods for identifying agents that are useful
in modulating human-unique or human-enhanced functional
capabilities and/or correcting defects in these capabilities using
these sequences. These methods employ, for example, screening
techniques known in the art, such as in vitro systems, cell-based
expression systems and transgenic/chimeric animal systems. The
approach provided by the present invention not only identifies
rapidly evolved genes, but indicates modulations that can be made
to the protein that may not be too toxic because they exist in
another species.
Screening Methods
[0129] The present invention also provides screening methods using
the polynucleotides and polypeptides identified and characterized
using the above-described methods. These screening methods are
useful for identifying agents which may modulate the function(s) of
the polynucleotides or polypeptides in a manner that would be
useful for a human treatment. Generally, the methods entail
contacting at least one agent to be tested with either a cell that
has been transfected with a polynucleotide sequence identified by
the methods described above, or a preparation of the polypeptide
encoded by such polynucleotide sequence, wherein an agent is
identified by its ability to modulate function of either the
polynucleotide sequence or the polypeptide.
[0130] As used herein, the term "agent" means a biological or
chemical compound such as as a simple or complex organic or
inorganic molecule, a peptide, a protein or an oligonucleotide. A
vast array of compounds can be synthesized, for example oligomers,
such as oligopeptides and oligonucleotides, and synthetic organic
and inorganic compounds based on various core structures, and these
are also included in the term "agent". In addition, various natural
sources can provide compounds for screening, such as plant or
animal extracts, and the like. Compounds can be tested singly or in
combination with one another.
[0131] To "modulate function" of a polynucleotide or a polypeptide
means that the function of the polynucleotide or polypeptide is
altered when compared to not adding an agent. Modulation may occur
on any level that affects function. A polynucleotide or polypeptide
function may be direct or indirect, and measured directly or
indirectly. A "function" of a polynucleotide includes, but is not
limited to, replication, translation, and expression pattern(s). A
polynucleotide function also includes functions associated with a
polypeptide encoded within the polynucleotide. For example, an
agent which acts on a polynucleotide and affects protein
expression, conformation, folding (or other physical
characteristics), binding to other moieties (such as ligands),
activity (or other functional characteristics), regulation and/or
other aspects of protein structure or function is considered to
have modulated polynucleotide function. The ways that an effective
agent can act to modulate the expression of a polynucleotide
include, but are not limited to 1) modifying binding of a
transcription factor to a transcription factor responsive element
in the polynucleotide; 2) modifying the interaction between two
transcription factors necessary for expression of the
polynucleotide; 3) altering the ability of a transcription factor
necessary for expression of the polynucleotide to enter the
nucleus; 4) inhibiting the activation of a transcription factor
involved in transcription of the polynucleotide; 5) modifying a
cell-surface receptor which normally interacts with a ligand and
whose binding of the ligand results in expression of the
polynucleotide; 6) inhibiting the inactivation of a component of
the signal transduction cascade that leads to expression of the
polynucleotide; and 7) enhancing the activation of a transcription
factor involved in transcription of the polynucleotide.
[0132] A "function" of a polypeptide includes, but is not limited
to, conformation, folding (or other physical characteristics),
binding to other moieties (such as ligands), activity (or other
functional characteristics), and/or other aspects of protein
structure or functions. For example, an agent that acts on a
polypeptide and affects its conformation, folding (or other
physical characteristics), binding to other moieties (such as
ligands), activity (or other functional characteristics), and/or
other aspects of protein structure or functions is considered to
have modulated polypeptide function. The ways that an effective
agent can act to modulate the function of a polypeptide include,
but are not limited to 1) changing the conformation, folding or
other physical characteristics; 2) changing the binding strength to
its natural ligand or changing the specificity of binding to
ligands; and 3) altering the activity of the polypeptide.
[0133] A "function" of a polynucleotide includes its expression,
i.e., transcription and/or translation. It can also include
(without limitation) its conformation, folding and binding to other
moieties.
[0134] Generally, the choice of agents to be screened is governed
by several parameters, such as the particular polynucleotide or
polypeptide target, its perceived function, its three-dimensional
structure (if known or surmised), and other aspects of rational
drug design. Techniques of combinatorial chemistry can also be used
to generate numerous permutations of candidates. Those of skill in
the art can devise and/or obtain suitable agents for testing.
[0135] The in vivo screening assays described herein may have
several advantages over conventional drug screening assays: 1) if
an agent must enter a cell to achieve a desired therapeutic effect,
an in vivo assay can give an indication as to whether the agent can
enter a cell; 2) an in vivo screening assay can identify agents
that, in the state in which they are added to the assay system are
ineffective to elicit at least one characteristic which is
associated with modulation of polynucleotide or polypeptide
function, but that are modified by cellular components once inside
a cell in such a way that they become effective agents; 3) most
importantly, an in vivo assay system allows identification of
agents affecting any component of a pathway that ultimately results
in characteristics that are associated with polynucleotide or
polypeptide function.
[0136] In general, screening can be performed by adding an agent to
a sample of appropriate cells which have been transfected with a
polynucleotide identified using the methods of the present
invention, and monitoring the effect, i.e., modulation of a
function of the polynucleotide or the polypeptide encoded within
the polynucleotide. The experiment preferably includes a control
sample which does not receive the candidate agent. The treated and
untreated cells are then compared by any suitable phenotypic
criteria, including but not limited to microscopic analysis,
viability testing, ability to replicate, histological examination,
the level of a particular RNA or polypeptide associated with the
cells, the level of enzymatic activity expressed by the cells or
cell lysates, the interactions of the cells when exposed to
infectious agents, such as HIV, and the ability of the cells to
interact with other cells or compounds. For example, the
transfected cells can be exposed to the agent to be tested and,
before, during, or after treatment with the agent, the cells can be
infected with a virus, such as HCV or HIV, and tested for any
indication of susceptibility of the cells to viral infection,
including, for example, susceptibility of the cells to cell-to-cell
viral infection, replication of the virus, production of a viral
protein, and/or syncytia formation following infection with the
virus. Differences between treated and untreated cells indicate
effects attributable to the candidate agent. Optimally, the agent
has a greater effect on experimental cells than on control cells.
Appropriate host cells include, but are not limited to, eukaryotic
cells, preferably mammalian cells. The choice of cell will at least
partially depend on the nature of the assay contemplated.
[0137] To test for agents that upregulate the expression of a
polynucleotide, a suitable host cell transfected with a
polynucleotide of interest, such that the polynucleotide is
expressed (as used herein, expression includes transcription and/or
translation) is contacted with an agent to be tested. An agent
would be tested for its ability to result in increased expression
of mRNA and/or polypeptide. Methods of making vectors and
transfection are well known in the art. "Transfection" encompasses
any method of introducing the exogenous sequence, including, for
example, lipofection, transduction, infection or electroporation.
infection or electroporation. The exogenous polynucleotide may be
maintained as a non-integrated vector such as a plasmid) or may be
integrated into the host genome.
[0138] To identify agents that specifically activate transcription,
transcription regulatory regions could be linked to a reporter gene
and the construct added to an appropriate host cell. As used
herein, the term "reporter gene" means a gene that encodes a gene
product that can be identified (i.e., a reporter protein). Reporter
genes include, but are not limited to, alkaline phosphatase,
chloramphenicol acetyltransferase, (3-galactosidase, luciferase and
green fluorescence protein (GFP). Identification methods for the
products of reporter genes include, but are not limited to,
enzymatic assays and fluorimetric assays. Reporter genes and assays
to detect their products are well known in the art and are
described, for example in Ausubel et al. (1987) and periodic
updates. Reporter genes, reporter gene assays, and reagent kits are
also readily available from commercial sources. Examples of
appropriate cells include, but are not limited to, fungal, yeast,
mammalian, and other eukaryotic cells. A practitioner of ordinary
skill will be well acquainted with techniques for transfecting
eukaryotic cells, including the preparation of a suitable vector,
such as a viral vector; conveying the vector into the cell, such as
by electroporation; and selecting cells that have been transformed,
such as by using a reporter or drug sensitivity element. The effect
of an agent on transcription from the regulatory region in these
constructs would be assessed through the activity of the reporter
gene product.
[0139] Besides the increase in expression under conditions in which
it is normally repressed mentioned above, expression could be
decreased when it would normally be maintained or increased. An
agent could accomplish this through a decrease in transcription
rate and the reporter gene system described above would be a means
to assay for this. The host cells to assess such agents would need
to be permissive for expression.
[0140] Cells transcribing mRNA (from the polynucleotide of
interest) could be used to identify agents that specifically
modulate the half-life of mRNA and/or the translation of mRNA. Such
cells would also be used to assess the effect of an agent on the
processing and/or post-translational modification of the
polypeptide. An agent could modulate the amount of polypeptide in a
cell by modifying the turnover (i.e., increase or decrease the
half-life) of the polypeptide. The specificity of the agent with
regard to the mRNA and polypeptide would be determined by examining
the products in the absence of the agent and by examining the
products of unrelated mRNAs and polypeptides. Methods to examine
mRNA half-life, protein processing, and protein turn-over are well
know to those skilled in the art.
[0141] In vivo screening methods could also be useful in the
identification of agents that modulate polypeptide function through
the interaction with the polypeptide directly. Such agents could
block normal polypeptide-ligand interactions, if any, or could
enhance or stabilize such interactions. Such agents could also
alter a conformation of the polypeptide. The effect of the agent
could be determined using immunoprecipitation reactions.
Appropriate antibodies would be used to precipitate the polypeptide
and any protein tightly associated with it. By comparing the
polypeptides immunoprecipitated from treated cells and from
untreated cells, an agent could be identified that would augment or
inhibit polypeptide-ligand interactions, if any. Polypeptide-ligand
interactions could also be assessed using cross-linking reagents
that convert a close, but noncovalent interaction between
polypeptides into a covalent interaction. Techniques to examine
protein-protein interactions are well known to those skilled in the
art. Techniques to assess protein conformation are also well known
to those skilled in the art.
[0142] It is also understood that screening methods can involve in
vitro methods, such as cell-free transcription or translation
systems. In those systems, transcription or translation is allowed
to occur, and an agent is tested for its ability to modulate
function. For an assay that determines whether an agent modulates
the translation of mRNA or a polynucleotide, an in vitro
transcription/translation system may be used. These systems are
available commercially and provide an in vitro means to produce
mRNA corresponding to a polynucleotide sequence of interest. After
mRNA is made, it can be translated in vitro and the translation
products compared. Comparison of translation products between an in
vitro expression system that does not contain any agent (negative
control) with an in vitro expression system that does contain an
agent indicates whether the agent is affecting the agent is
affecting translation. Comparison of translation products between
control and test polynucleotides indicates whether the agent, if
acting on this level, is selectively affecting translation (as
opposed to affecting translation in a general, non-selective or
non-specific fashion). The modulation of polypeptide function can
be accomplished in many ways including, but not limited to, the in
vivo and in vitro assays listed above as well as in in vitro assays
using protein preparations. Polypeptides can be extracted and/or
purified from natural or recombinant sources to create protein
preparations. An agent can be added to a sample of a protein
preparation and the effect monitored; that is whether and how the
agent acts on a polypeptide and affects its conformation, folding
(or other physical characteristics), binding to other moieties
(such as ligands), activity (or other functional characteristics),
and/or other aspects of protein structure or functions is
considered to have modulated polypeptide function.
[0143] In an example for an assay for an agent that binds to a
polypeptide encoded by a polynucleotide identified by the methods
described herein, a polypeptide is first recombinantly expressed in
a prokaryotic or eukaryotic expression system as a native or as a
fusion protein in which a polypeptide (encoded by a polynucleotide
identified as described above) is conjugated with a
well-characterized epitope or protein. Recombinant polypeptide is
then purified by, for instance, immunoprecipitation using
appropriate antibodies or anti-epitope antibodies or by binding to
immobilized ligand of the conjugate. An affinity column made of
polypeptide or fusion protein is then used to screen a mixture of
compounds which have been appropriately labeled. Suitable labels
include, but are not limited to fluorochromes, radioisotopes,
enzymes and chemiluminescent compounds. The unbound and bound
compounds can be separated by washes using various conditions (e.g.
high salt, detergent) that are routinely employed by those skilled
in the art. Non-specific binding to the affinity column can be
minimized by pre-clearing the compound mixture using an affinity
column containing merely the conjugate or the epitope. Similar
methods can be used for screening for an agent(s) that competes for
binding to polypeptides. In addition to affinity chromatography,
there are other techniques such as measuring the change of melting
temperature or the fluorescence anisotropy of a protein which will
anisotropy of a protein which will change upon binding another
molecule. For example, a BIAcore assay using a sensor chip
(supplied by Pharmacia Biosensor, Stitt et al. (1995) Cell 80:
661-670) that is covalently coupled to polypeptide may be performed
to determine the binding activity of different agents.
[0144] It is also understood that the in vitro screening methods of
this invention include structural, or rational, drug design, in
which the amino acid sequence, three-dimensional atomic structure
or other property (or properties) of a polypeptide provides a basis
for designing an agent which is expected to bind to a polypeptide.
Generally, the design and/or choice of agents in this context is
governed by several parameters, such as side-by-side comparison of
the structures of a human and homologous non-human primate
polypeptides, the perceived function of the polypeptide target, its
three-dimensional structure (if known or surmised), and other
aspects of rational drug design. Techniques of combinatorial
chemistry can also be used to generate numerous permutations of
candidate agents.
[0145] Also contemplated in screening methods of the invention are
transgenic animal systems and animal models containing chimeric
organs or tissues, which are known in the art.
[0146] The screening methods described above represent primary
screens, designed to detect any agent that may exhibit activity
that modulates the function of a polynucleotide or polypeptide. The
skilled artisan will recognize that secondary tests will likely be
necessary in order to evaluate an agent further. For example, a
secondary screen may comprise testing the agent(s) in an
infectivity assay using mice and other animal models (such as rat),
which are known in the art. In addition, a cytotoxicity assay would
be performed as a further corroboration that an agent which tested
positive in a primary screen would be suitable for use in living
organisms. Any assay for cytotoxicity would be suitable for this
purpose, including, for example the MTT assay (Promega).
[0147] The invention also includes agents identified by the
screening methods described herein.
Methods Useful for Identifying Positively Selected Non-Human
Traits
[0148] In one aspect of the invention, a non-human primate
polynucleotide or polypeptide has undergone natural selection that
resulted in a positive evolutionarily significant change (i.e., the
non-human primate polynucleotide or polypeptide has a positive
attribute not present in humans). In this aspect of the invention,
the positively selected polynucleotide or polypeptide may be
associated with susceptibility or resistance to certain diseases or
with other commercially relevant traits. Examples of this
embodiment include, but are not limited to, polynucleotides and
polypeptides that have been positively selected in non-human
primates, preferably chimpanzees, that may be associated with
susceptibility or resistance to infectious diseases, cancer, or
acne or may be associated with aesthetic conditions of interest to
humans, such as hair growth or muscle mass. An example of this
embodiment includes polynucleotides and polypeptides associated
with the susceptibility or resistance to HIV progression to AIDS.
The present invention can thus be useful in gaining insight into
the molecular mechanisms that underlie resistance to HIV infection
progressing to development of AIDS, providing information that can
also be useful in discovering and/or designing agents such as drugs
that prevent and/or delay development of AIDS. For example, CD59,
which has been identified as a leukocyte and erythrocyte protein
whose function is to protect these cells from the complement arm of
the body=s MAC (membrane attack complex) defense system (Merl et
al. (1996) Biochem. J. 616:923-935), has been found to be
positively selected in the chimpanzee (see Example 16). It is
believed that the CD59 found in chimpanzees confers a resistance to
the progression of AIDS that is not found in humans. Thus, the
positively selected chimpanzee CD59 can serve in the development of
agents or drugs that are useful in arresting the progression of
AIDS in humans, as is described in the Examples.
[0149] Another example involves the p44 polynucleotides and
polypeptides associated with resistance to HCV infection in
chimpanzees. This discovery can be useful in discerning the
molecular mechanisms that underlie resistance to HCV infection
progression to chronic hepatitis and/or hepatocellular carcinoma in
chimpanzees, and in providing information useful in the discovery
and/or design of agents that prevent and/or delay chronic hepatitis
or hepatocellular carcinoma.
[0150] Commercially relevant examples include, but are not limited
to, polynucleotides and polypeptides that are positively selected
in non-human primates that may be associated with aesthetic traits,
such as hair growth, acne, or muscle mass.
Accordingly, in one aspect, the invention provides methods for
identifying a polynucleotide sequence encoding a polypeptide,
wherein said polypeptide may be associated with a medically or
commercially relevant positive evolutionarily significant change.
The method comprises the steps of: (a) comparing human
protein-coding nucleotide sequences to protein-coding nucleotide
sequences of a non-human primate; and (b) selecting a non-human
primate polynucleotide sequence that contains at least one
nucleotide change as compared to corresponding sequence of the
human, wherein said change is evolutionarily significant. The
sequences identified by this method may be further characterized
and/or analyzed for their possible association with biologically or
medically relevant functions unique or enhanced in non-human
primates.
Methods Useful for Identifying Positively Selected Human Traits
[0151] This invention specifically provides methods for identifying
human polynucleotide and polypeptide sequences that may be
associated with unique or enhanced functional capabilities or
traits of the human, for example, brain function or longer life
span. More particularly, these methods identify those genetic
sequences that may be associated with capabilities that are unique
or enhanced in humans, including, but not limited to, brain
functions such as high capacity information processing, storage and
retrieval capabilities, creativity, and language abilities.
Moreover, these methods identify those sequences that may be
associated to other brain functional features with respect to which
the human brain performs at enhanced levels as compared to other
non-human primates; these differences may include brain-mediated
emotional response, locomotion, pain/pleasure sensation, olfaction,
temperament and longer life span.
[0152] In this method, the general methods of the invention are
applied as described above. Generally, the methods described herein
entail (a) comparing human protein-coding polynucleotide sequences
to that of a non-human primate; and (b) selecting those human
protein-coding polynucleotide sequences having evolutionarily
significant changes that may be associated with unique or enhanced
functional capabilities of the human as compared to that of the
non-human primate.
[0153] In this embodiment, the human sequence includes the
evolutionarily significant change (i.e., the human sequence differs
from more than one non-human primate species sequence in a manner
that suggests that such a change is in response to a selective
pressure). The identity and function of the protein encoded by the
gene that contains the evolutionarily significant change is
characterized and a determination is made whether or not the
protein can be involved in a unique or enhanced human function. If
the protein is involved in a unique or enhanced human function, the
information is used in a manner to identify agents that can
supplement or otherwise modulate the unique or enhanced human
function.
[0154] As a non-limiting example of the invention, identifying the
genetic (i.e., nucleotide sequence) differences underlying the
functional uniqueness of human brain may provide a basis for
designing agents that can modulate human brain functions and/or
help correct functional defects. These sequences could also be used
in developing diagnostic reagents and/or biomedical research tools.
The invention also provides methods for a large-scale comparison of
human brain protein-coding sequences with those from a non-human
primate.
[0155] The identified human sequence changes can be used in
establishing a database of candidate human genes that may be
involved in human brain function. Candidates are ranked as to the
likelihood that the gene is responsible for the unique or enhanced
functional capabilities found in the human brain compared to
chimpanzee or other non-human primates. Moreover, the database not
only provides an ordered collection of candidate genes, it also
provides the precise molecular sequence differences that exist
between human and chimpanzee (and other non-human primates), and
thus defines the changes that underlie the functional differences.
This information can be useful in the identification of potential
sites on the protein that may serve as useful targets for
pharmaceutical agents.
[0156] Accordingly, the present invention also provides methods for
correlating an evolutionarily significant nucleotide change to a
brain functional capability that is unique or enhanced in humans,
comprising (a) identifying a human nucleotide sequence according to
the methods described above; and (b) analyzing the functional
effect of the presence or absence of the identified sequence in a
model system.
[0157] Further studies can be carried out to confirm putative
function. For example, the putative function can be assayed in
appropriate in vitro assays using transiently or stably transfected
mammalian cells in culture, or using mammalian cells transfected
with an antisense clone to inhibit expression of the identified
polynucleotide to assess the effect of the absence of expression of
its encoded polypeptide. Studies such as one-hybrid and two-hybrid
studies can be conducted to determine, for example, what other
macromolecules the polypeptide interacts with. Transgenic nematodes
or Drosophila can be used for various functional assays, including
behavioral studies. The appropriate studies depend on the nature of
the identified polynucleotide and the polypeptide encoded within
the polynucleotide, and would be obvious to those skilled in the
art.
[0158] The present invention also provides polynucleotides and
polypeptides identified by the methods of the present invention. In
one embodiment, the present invention provides an isolated AATYK
nucleotide sequence selected from the group consisting of
nucleotides 2180-2329 of SEQ ID NO:14, nucleotides 2978-3478 of SEQ
ID NO:14, and nucleotides 3380-3988 of SEQ ID NO:14; and an
isolated nucleotide sequence having at least 85% homology to a
nucleotide sequence of any of the preceding sequences.
[0159] In another embodiment, the invention provides an isolated
AATYK polypeptide selected from the group consisting of a
polypeptide encoded by a nucleotide sequence selected from the
group consisting of SEQ ID NO:17 and SEQ ID NO:18; wherein said
encoding is based on the open reading frame (ORF) of SEQ ID NO:14,
and a polypeptide encoded by a nucleotide sequence having at least
85% homology to a nucleotide sequence selected from the group
consisting of SEQ ID NO:17 and SEQ ID NO:18; wherein said encoding
is based on the open reading frame of SEQ ID NO:14.
[0160] In a further embodiment, the present invention provides an
isolated AATYK polypeptide selected from the group consisting of a
polypeptide encoded by a nucleotide sequence selected from the
group consisting of nucleotides 1-501 of SEQ ID NO:17, nucleotides
1-150 of SEQ ID NO:17, nucleotides 100-249 of SEQ ID NO:17,
nucleotides 202-351 of SEQ ID NO:17, nucleotides 301-450 of SEQ ID
NO:17, nucleotides 799-948 of SEQ ID NO:17, nucleotides 901-1050 of
SEQ ID NO:17, nucleotides 799-1299 of SEQ ID NO:17, and nucleotides
1201-1809 of SEQ ID NO:17; wherein said encoding is based on the
open reading frame of SEQ ID NO:14; and a polypeptide encoded by a
nucleotide sequence having at least 85% homology to any of the
preceding nucleotide sequences.
[0161] In still another embodiment, the invention provides an
isolated polypeptide selected from the group consisting of a
polypeptide encoded by a nucleotide sequence selected from the
group consisting of nucleotides 1-501 of SEQ ID NO:18, nucleotides
799-1299 of SEQ ID NO:18, and nucleotides 1201-1809 of SEQ ID
NO:18; wherein said encoding is based on the open reading frame of
SEQ ID NO:14; and a polypeptide encoded by a nucleotide sequence
having at least 85% homology to nucleotides 1-501 of SEQ ID NO:18,
nucleotides 799-1299 of SEQ ID NO:18, and nucleotides 1201-1809 of
SEQ ID NO:18.
[0162] In another embodiment, the invention provides an isolated
polynucleotide comprising SEQ ID NO:17, wherein the coding capacity
of the nucleic acid molecule is based on the open reading frame of
SEQ ID NO:14. In a preferred embodiment, the polynucleotide is a
Pan troglodytes polynucleotide.
[0163] In another embodiment, the invention provides an isolated
polynucleotide comprising SEQ ID NO:18, wherein the coding capacity
of the nucleic acid molecule is based on the open reading frame of
SEQ ID NO:14. In a preferred embodiment, the polynucleotide is a
Gorilla gorilla polynucleotide.
[0164] In some embodiments, the polynucleotide or polypeptide
having 85% homology to an isolated AATYK polynucleotide or
polypeptide of the present invention is a homolog, homolog, which,
when compared to a non-human primate, yields a K.sub.A/K.sub.S
ratio of at least 0.75, at least 1.00, at least 1.25, at least
1.50, or at least 2.00.
[0165] In other embodiments, the polynucleotide or polypeptide
having 55% homology to an isolated AATYK polynucleotide or
polypeptide of the present invention is a homolog which is capable
of performing the function of the natural AATYK polynucleotide or
polypeptide in a functional assay. Suitable assays for assessing
the function of an ATTYK polynucleotide or polypeptide include a
neuronal differentiation assay such as that described by Raghunath,
et al., Brain Res Mol Brain Res. (2000) 77:151-62, or a tyrosine
phosphorylation assay such as that described in Tomomura, et al.,
Oncogene (2001) 20(9):1022-32. The phrase "capable of performing
the function of the natural AATYK polynucleotide or polypeptide in
a functional assay" means that the polynucleotide or polypeptide
has at least about 10% of the activity of the natural
polynucleotide or polypeptide in the functional assay. In other
preferred embodiments, has at least about 20% of the activity of
the natural polynucleotide or polypeptide in the functional assay.
In other preferred embodiments, has at least about 30% of the
activity of the natural polynucleotide or polypeptide in the
functional assay. In other preferred embodiments, has at least
about 40% of the activity of the natural polynucleotide or
polypeptide in the functional assay. In other preferred
embodiments, has at least about 50% of the activity of the natural
polynucleotide or polypeptide in the functional assay. In other
preferred embodiments, the polynucleotide or polypeptide has at
least about 60% of the activity of the natural polynucleotide or
polypeptide in the functional assay. In more preferred embodiments,
the polynucleotide or polypeptide has at least about 70% of the
activity of the natural polynucleotide or polypeptide in the
functional assay. In more preferred embodiments, the polynucleotide
or polypeptide has at least about 80% of the activity of the
natural polynucleotide or polypeptide in the functional assay. In
more preferred embodiments, the polynucleotide or polypeptide has
at least about 90% of the activity of the natural polynucleotide or
polypeptide in the functional assay.
Description of the AIDS Embodiment (An Example of a Positively
Selected Non-Human Trait)
[0166] The AIDS (Acquired Immune Deficiency Syndrome) epidemic has
been estimated to threaten 30 million people world-wide
(UNAIDS/WHO, 1998, "Report on the global HIV/AIDS epidemic"). Well
over a million people are infected in developed countries, and in
parts of sub-Saharan Africa, 1 in 4 adults now carries the virus
(UNAIDS/WHO, 1998). Although efforts to develop vaccines are
underway, near term prospects for successful vaccines are grim.
Baiter and Cohen (1998) Science 281:159-160; Baltimore and Heilman
(1998) Scientific Am. 279:98-103. Further complicating the
development of therapeutics is the rapid mutation rate of HIV (the
human immunodeficiency virus which is responsible for AIDS), which
generates rapid changes in viral proteins. These changes ultimately
allow the virus to escape current therapies, which target viral
proteins. Dobkin (1998) Inf Med. 15(3):159. Even drug cocktails
which initially showed great promise are subject to the emergence
of drug-resistant mutants. Baiter and Cohen (1998); Dobkin (1998).
Thus, there is still a serious need for development of therapies
which delay or prevent progression of AIDS in HIV-infected
individuals. Chun et al. (1997) Proc. Natl. Acad. Sci. USA
94:13193-13197; Dobkin (1998).
[0167] Human=s closest relatives, chimpanzees (Pan troglodytes),
have unexpectedly proven to be poor models for the study of the
disease processes following infection with HIV-1. Novembre et al.
(1997); J. Virol. 71(5):4086-4091. Once infected with HIV-1,
chimpanzees display resistance to progression of the disease. To
date, only one chimpanzee individual is known to have developed
full-blown AIDS, although more than 100 captive chimpanzees have
been infected. Novembre et al. (1997); Villinger et al. (1997) J.
Med. Primatol. 26(1-2):11-18. Clearly, an understanding of the
mechanism(s) that confer resistance to progression of the disease
in chimpanzees may prove invaluable for efforts to develop
therapeutic agents for HIV-infected humans.
[0168] It is generally believed that wild chimpanzee populations
harbored the HIV-1 virus (perhaps for millennia) prior to its
recent cross-species transmission to humans. Dube et al., (1994);
Virology 202:379-389; Zhu and Ho (1995) Nature 374:503-504; Zhu et
al. et al. (1998); Quinn (1994) Proc. Natl. Acad. Sci. USA
91:2407-2414. During this extended period, viral/host co-evolution
has apparently resulted in accommodation, explaining chimpanzee
resistance to AIDS progression. Burnet and White (1972); Natural
History of Infectious Disease (Cambridge, Cambridge Univ. Press);
Ewald (1991) Hum. Nat. 2(i):1-30. All references cited herein are
hereby incorporated by reference in their entirety.
[0169] One aspect of this invention arises from the observations
that (a) because chimpanzees (Pan troglodytes) have displayed
resistance to development of AIDS although susceptible to HIV
infection (Alter et al. (1984) Science 226:549-552; Fultz et al.
(1986) J. Virol. 58:116-124; Novembre et al. (1997) J. Virol.
71(5):4086-4091), while humans are susceptible to developing this
devastating disease, certain genes in chimpanzees may contribute to
this resistance; and (b) it is possible to evaluate whether changes
in human genes when compared to homologous genes from other species
(such as chimpanzee) are evolutionarily significant (i.e.,
indicating positive selective pressure). Thus, protein coding
polynucleotides may contain sequence changes that are found in
chimpanzees (as well as other AIDS-resistant primates) but not in
humans, likely as a result of positive adaptive selection during
evolution. Furthermore, such evolutionarily significant changes in
polynucleotide and polypeptide sequences may be attributed to an
AIDS-resistant non-human primate=s (such as chimpanzee) ability to
resist development of AIDS. The methods of this invention employ
selective comparative analysis to identify candidate genes which
may be associated with susceptibility or resistance to AIDS, which
may provide new host targets for therapeutic intervention as well
as specific information on the changes that evolved to confer
resistance. Development of therapeutic approaches that involve host
proteins (as opposed to viral proteins and/or mechanisms) may delay
or even avoid the emergence of resistant viral mutants. The
invention also provides screening methods using the sequences and
structural differences identified.
[0170] This invention provides methods for identifying human
polynucleotide and polypeptide sequences that may be associated
with susceptibility to post-infection development of AIDS.
Conversely, the invention also provides methods for identifying
polynucleotide and polypeptide sequences from an AIDS-resistant
non-human primate (such as chimpanzee) that may be associated with
resistance to development of AIDS. Identifying the genetic (i.e.,
nucleotide sequence) and the resulting protein structural and
biochemical differences underlying susceptibility or resistance to
development of AIDS will likely provide a basis for discovering
and/or designing agents that can provide prevention and/or therapy
for HIV infection progressing to AIDS. These differences could also
be used in developing diagnostic reagents and/or biomedical
research tools. For example, identification of proteins which
confer resistance may allow development of diagnostic reagents or
biomedical research tools based upon the disruption of the disease
pathway of which the resistant protein plays a part.
[0171] Generally, the methods described herein entail (a) comparing
human protein-coding polynucleotide sequences to that of an AIDS
resistant non-human primate (such as chimpanzee), wherein the human
protein coding polynucleotide sequence is associated with
development of AIDS; and (b) selecting those human protein-coding
polynucleotide sequences having evolutionarily significant changes
that may be associated with susceptibility to development of AIDS.
In another embodiment, the methods entail (a) comparing human
protein-coding polynucleotide sequences to that of an
AIDS-resistant non-human primate (such as chimpanzee), wherein the
human protein coding polynucleotide sequence is associated with
development of AIDS; and (b) selecting those non-human primate
protein-coding polynucleotide sequences having evolutionarily
significant changes that may be associated with resistance to
development of AIDS.
[0172] As is evident, the methods described herein can be applied
to other infectious diseases. For example, the methods could be
used in a situation in which a non-human primate is known or
believed to have harbored the infectious disease for a significant
period (i.e., a sufficient time to have allowed positive selection)
and is resistant to development of the disease. Thus, in other
embodiments, the invention provides methods for identifying a
polynucleotide sequence encoding a polypeptide, wherein said
polypeptide may be associated with resistance to development of an
infectious disease, comprising the steps of: (a) comparing
infectious disease-resistant non-human primate protein coding
sequences to human protein coding sequences, wherein the human
protein coding sequence is associated with development of the
infectious disease; and (b) selecting an infectious
disease-resistant non-human primate sequence that contains at least
one nucleotide change as compared to the corresponding human
sequence, wherein the nucleotide change is evolutionarily
significant. In another embodiment, the invention provides methods
for identifying a human polynucleotide sequence encoding a
polypeptide, wherein said polypeptide may be associated with
susceptibility to development of an infectious disease, comprising
the steps of: (a) comparing human protein coding sequences to
protein-coding polynucleotide sequences of an infectious
disease-resistant non-human primate, wherein the human protein
coding sequence is associated with development of the infectious
disease; and (b) selecting a human polynucleotide sequence that
contains at least one nucleotide change as compared to the
corresponding sequence of an infectious disease-resistant non-human
primate, wherein the nucleotide change is evolutionarily
significant.
[0173] In the present invention, human sequences to be compared
with a homologue from an AIDS-resistant non-human primate are
selected based on their known or implicated association with HIV
propagation (i.e., replication), dissemination and/or subsequent
progression to AIDS. Such knowledge is obtained, for example, from
published literature and/or public databases (including sequence
databases such as GenBank). Because the pathway involved in
development of AIDS (including viral replication) involves many
genes, a number of suitable candidates may be tested using the
methods of this invention. Table 1 contains a exemplary list of
genes to be examined. The sequences are generally known in the
art.
TABLE-US-00001 TABLE 1 Sample List of Human Genes to be/have been
Examined Gene Function eIF-5A intiation factor hPC6A protease hPC6B
protease P56.sup.lck Signal transduction FK506-binding protein
Immunophilin calnexin ? Bax PCD promoter bcl-2 apoptosis inhibitor
lck tyrosine kinase MAPK (mitogen activated protein kinase) protein
kinase CD43 sialoglycoprotein CCR2B chemokine receptor CCR3
chemokine receptor Bonzo chemokine receptor BOB chemokine receptor
GPR1 chemokine receptor stromal-derived factor-1 (SDF-1) chemokine
tumor-necrosis factor-.alpha. (TNF-.alpha.) PCD promoter
TNF-receptor II (TNFRII) receptor interferon .gamma. (IFN-.gamma.)
cytokine interleukin 1 .alpha.(IL-1 .alpha.) cytokine interleukin 1
.beta.(IL-1 .beta.) cytokine interleukin 2 (IL-2) cytokine
interleukin 4 (IL-4) cytokine interleukin 6 (IL-6) cytokine
interleukin 10 (IL-10) cytokine interleukin 13 (IL-13) cytokine B7
signaling protein macrophage colony-stimulating factor cytokine
(M-CSF) granulocyte-macrophage colony-stimulating cytokine factor
phosphatidylinositol 3-kinase (PI 3-kinase) kinase
phosphatidylinositol 4-kinase (PI 4-kinase) kinase HLA class I
.alpha. chain histocompatibility antigen .beta..sub.2 microglobulin
lymphocyte antigen CD55 decay-accelerating factor CD63 glycoprotein
antigen CD71 ? interferon .alpha. (IFN-.alpha.) cytokine CD44 cell
adhesion CD8 glycoprotein Genes already examined (13) ICAM-1 Immune
system ICAM-2 Immune system ICAM-3 Immune system leukocyte
associated function 1 molecule .alpha. Immune system (LFA-1)
leukocyte associated function 1 molecule .beta. Immune system
(LFA-1) Mac-1 .alpha. Immune system Mac-1 .beta. (equivalent to
LFA-1.beta.) Immune system DC-SIGN Immune system CD59 complement
protein CXCR4 chemokine receptor CCR5 chemokine receptor
MIP-1.alpha. chemokine MIP-1.beta. chemokine RANTES chemokine
[0174] Aligned protein-coding sequences of human and an AIDS
resistant non-human primate such as chimpanzee are analyzed to
identify nucleotide sequence differences at particular sites. The
detected sequence changes are generally, and preferably, initially
checked for accuracy as described above. The evolutionarily
significant nucleotide changes, which are detected by molecular
evolution analysis such as the K.sub.A/K.sub.S analysis, can be
further assessed to determine whether the non-human primate gene or
the human gene has been subjected to positive selection. For
example, the identified changes can be tested for presence/absence
in other AIDS- resistant non-human primate sequences. The sequences
with at least one evolutionarily significant change between human
and one AIDS-resistant non-human primate can be used as primers for
PCR analysis of other non-human primate protein-coding sequences,
and resulting polynucleotides are sequenced to see whether the same
change is present in other non-human primates. These comparisons
allow further discrimination as to whether the adaptive
evolutionary changes are unique to the AIDS-resistant non-human
primate (such as chimpanzee) as compared to other non-human
primates. For example, a nucleotide change that is detected in
chimpanzee but not other primates more likely represents positive
selection on the chimpanzee gene. Other non-human primates used for
comparison can be selected based on their phylogenetic
relationships with human. Closely related primates can be those
within the hominoid sublineage, such as chimpanzee, bonobo,
gorilla, and orangutan. Non-human primates can also be those that
are outside the hominoid group and thus not so closely related to
human, such as the Old World monkeys and New World monkeys.
Statistical significance of such comparisons may be determined
using established available programs, e.g., t-test as used by
Messier and Stewart (1997) Nature 385:151-154.
[0175] Furthermore, sequences with significant changes can be used
as probes in genomes from different humans to see whether the
sequence changes are shared by more than one individual. For
example, certain individuals are slower to progress to AIDS ("slow
progressers") and comparison (a) between a chimpanzee sequence and
the homologous sequence from the slow-progresser human individual
and/or (b) between an AIDS-susceptible individual and a
slow-progresser individual would be of interest. Gene sequences
from different human populations can be obtained from databases
made available by, for example, the human genome diversity project
or, alternatively, from direct sequencing of PCR-amplified DNA from
a number of unrelated, diverse human populations. The presence of
the identified changes in human slow progressers would further
indicate the evolutionary significance of the changes.
[0176] As is exemplified herein, the CD59 protein, which has been
associated with the chimpanzee=s resistance to the progression of
AIDS, exhibits an evolutionarily significant nucleotide change
relative to human CD59. CD59 (also known as protectin, 1F-5Ag, H19,
HRF20, MACIF, MIRL and P-18) is expressed on peripheral blood
leukocytes and erythrocytes, and functions to restrict lysis of
human cells by complement (Meri et al. (1996) Biochem. J. 316:923).
More specifically, CD59 acts as an inhibitor of membrane attack
complexes, which are complement proteins that make hole-like
lesions in the cell in the cell membranes. Thus, CD59 protects the
cells of the body from the complement arm of its own defense system
(Meri et al., supra). The chimpanzee homolog of this protein was
examined because the human homolog has been implicated in the
progression of AIDS in infected individuals. It has been shown that
CD59 is one of the host cell derived proteins that is selectively
taken up by HIV virions (Frank et al. (1996) AIDS 10:1611).
Additionally, it has been shown that HIV virions that have
incorporated host cell CD59 are protected from the action of
complement. Thus, in humans, HIV uses CD59 to protect itself from
attack by the victim=s immune system, and thus to further the
course of infection. As is theorized in the examples,
positively-selected chimpanzee CD59 may constitute the adaptive
change that inhibits disease progression. The virus may be unable
to usurp the chimpanzee=s CD59 protective role, thereby rendering
the virus susceptible to the chimpanzee=s immune system.
[0177] As is further exemplified herein, the DC-SIGN protein has
also been determined to be positively selected in the chimpanzee as
compared to humans and gorilla. DC-SIGN is expressed on dendritic
cells and has been documented to provide a mechanism for travel of
the HIV-1 virus to the lymph nodes where it infects
undifferentiated T cells (Geijtenbeek, T. B. H. et al. (2000) Cell
100:587-597). Infection of the T cells ultimately leads to
compromise of the immune system and subsequently to full-blown
AIDS. The HIV-1 virus binds to the extracellular portion of
DC-SIGN, and then gains access to the T cells via their CD4
proteins. DC-SIGN has as its ligand ICAM-3, which has a very high
K.sub.A/K.sub.S ratio. It may be that the positive selection on
chimpanzee ICAM-3 was a result of compensatory changes to permit
continued binding to DC-SIGN. As is theorized in the examples,
positively-selected chimpanzee DC-SIGN may constitute another
adaptive change that inhibits disease progression. Upon resolution
of the three-dimensional structure of chimpanzee DC-SIGN and
identification of the mechanism by which HIV-1 is prevented from
binding to DC-SIGN, it may be possible to design drugs to mimic the
effects of chimpanzee DC-SIGN without disrupting the normal
functions of human DC-SIGN.
Description of the HCV Embodiment (An Example of a Positively
Selected Non-Human Trait)
[0178] Some four million Americans are infected with the hepatitis
C virus (HCV), and worldwide, the number approaches 40 million
(Associated Press, Mar. 11, 1999). Many of these victims are
unaware of the infection, which can lead to hepatocellular
carcinoma. This disease is nearly always fatal. Roughly 14,500
Americans die each year as a result of the effects of
hepatocellular carcinoma (Associated Press, Mar. 11, 1999). Thus
identification of therapeutic agents that can ameliorate the
effects of chronic infection are valuable both from an ethical and
commercial viewpoint.
[0179] The chimpanzee is the only organism, other than humans,
known to be susceptible to HCV infection (Lanford, R. E. et al.
(1991) J. Med. Virol. 34:148-153). While the original host
population for HCV has not yet been documented, it is likely that
the virus must have originated in either humans or chimpanzees, the
only two known susceptible species. It is known that the
continent-of-origin for HCV is Africa (personal communication, A.
Siddiqui, University of Colorado Health Science Center, Denver). If
the chimpanzee population were the original host for HCV, as many
HCV researchers believe (personal communication, A. Siddiqui,
University of Colorado Health Science Center), then, as is known to
be true for the HIV virus, chimpanzees would likely have evolved
resistance to the virus. This hypothesis is supported by the
well-documented observation that HCV-infected chimpanzees are
refractory to the hepatic damage that often occurs in hepatitis
C-infected humans (Walker, C. M (1997) Springer Semin.
Immunopathol. 19:85-98; McClure, H. M., pp. 121-133 in The Role of
the Chimpanzee in Research, ed. by Eder, G. et al., 1994, Basel:
Karger; Agnello, V. et al. (1998) Hepatology 28:573-584). In fact,
although in 2% of HCV-infected humans, the disease course leads to
hepatocellular carcinoma, HCV-infected chimpanzees do not develop
these tumors (Walker, C. M (1997) Springer Semin. Immunopathol.
19:85-98). Further support for the hypothesis that chimpanzees were
the original host population, and that they have, as a result of
prolonged experience with the virus, evolved resistance to the
ravages of HCV-induced disease, is added by the observation that
HCV-infected chimpanzees in general chimpanzees in general have a
milder disease course (i.e., not simply restricted to hepatic
effects) than do humans (Lanford, R. E. et al. (1991) J. Med.
Virol. 34:148-153; and Walker, C. M (1997) Springer Semin.
Immunopathol. 19:85-98).
[0180] As is exemplified herein, the p44 gene in chimpanzees has
been positively selected relative to its human homolog. The p44
protein was first identified in liver tissues of chimpanzees
experimentally infected with HCV (Shimizu, Y. et al. (1985) PNAS
USA 82:2138).
[0181] The p44 gene, and the protein it codes for, represents a
potential therapeutic target, or alternatively a route to a
therapeutic, for humans who are chronically infected with hepatitis
C. The protein coded for by this gene in chimpanzees is known to be
up-regulated in chimpanzee livers after experimental infection of
captive chimpanzees (Takahashi, K. et al. (1990) J. Gen. Virol.
71:2005-2011). The p44 gene has been shown to be a member of the
family of .alpha./.beta. interferon inducible genes (Kitamura, A.
et al. (1994) Eur. J. Biochem. 224:877-883). It is suspected that
the p44 protein is a mediator in the antiviral activities of
interferon.
[0182] This is most suggestive, since as noted above, HCV-infected
chimpanzees have been documented to be refractory to the hepatic
damage that often occurs in HCV-infected humans. The combination of
the observations that this protein is only expressed in chimpanzee
livers after hepatitis C infection, the fact that chimpanzees are
refractory to the hepatic damage that can occur in humans (Agnello,
V. et al. (1998) Hepatology 28:573-584), the observation that
HCV-infected chimpanzees in general have a milder disease course
than do humans, and that the p44 gene has been positively selected
in chimpanzees, strongly suggest that the chimpanzee p44 protein
confers resistance to hepatic damage in chimpanzees. Whether the
protein is responsible for initiating some type of cascade in
chimpanzees that fails to occur in infected humans, or whether the
selected chimpanzee homolog differs in some critical biochemical
functions from its human homolog, is not yet clear. It has been
speculated that the milder disease course observed in chimpanzees
may be due in part to lower levels of viral replication (Lanford,
R. E. et al. (1991) J. Med. Viral. 34:148-153).
[0183] This invention includes the medical use of the specific
amino acid residues by which chimpanzee p44 differs from human p44.
These residues that were positively selected during the period in
which chimpanzees evolved an accommodation to the virus, allow the
intelligent design of an effective therapeutic approach for
chronically HCV-infected humans. Several methods to induce a
chimpanzee-like response in infected humans will be apparent to one
skilled in the art. Possibilities include the intelligent design of
a small molecule therapeutic targeted to the human homolog of the
specific amino acid residues selected in chimpanzee evolution. Use
of molecular modeling techniques might be valuable here, as one
could design a small molecule that causes the human protein to
mimic the three-dimensional structure of the chimpanzee protein.
Another approach would be the design of a small molecule
therapeutic that induces a chimpanzee-like functional response in
human p44. Again, this could only be achieved by use of the
knowledge obtained by this invention, i.e., which amino acid
residues were positively selected to confer resistance to HCV in
chimpanzees. Other possibilities will be readily apparent to one
skilled in the art.
[0184] In addition to screening candidate agents for those that may
favorably interact with the human p44 (exon 2) polypeptide so that
it may mimic the structure and/or function of chimpanzee p44, the
subject invention also concerns the screening of candidate agents
that interact with the human p44 polynucleotide promoter, whereby
the expression of human p44 may be increased so as to improve the
human patient's resistance to HCV infection. Thus, the subject
invention includes a method for identifying an agent that modulates
expression of a human's p44 polynucleotide, by contacting at least
one candidate agent with the human's p44 polynucleotide promoter,
and observing whether expression of the human p44 polynucleotide is
enhanced. The human p44 promoter has been published in Kitamura et
al. (1994) Eur. J. Biochem. 224:877 (FIG. 4).
Description of the Breast Enhancement Embodiment (An Example of a
Positively Selected Human Trait)
[0185] Relative to non-human primates, female humans exhibit
pre-pregnancy, pre-lactation expanded breast tissue. As is
discussed in the Examples, this secondary sex characteristic is
believed to facilitate evolved behaviors in humans associated with
long term pair bonds and long-term rearing of infants. One aspect
of this invention concerns identifying those human genes that have
been positively selected in the development of enlarged breasts.
Specifically, this invention includes a method of determining
whether a human polynucleotide sequence which has been associated
with enlarged breasts in humans has undergone evolutionarily
significant change relative to a non-human primate that does not
manifest enlarged breasts, comprising: a) comparing the human
polynucleotide sequence with the corresponding non-human primate
polynucleotide sequence to identify any nucleotide changes; and b)
determining whether the human nucleotide changes are evolutionarily
significant.
[0186] It has been found that the human BRCA1 gene, which has been
associated with normal breast development in humans, has been
positively selected relative to the BRCA1 gene of chimpanzees and
other non-human primates. The identified evolutionarily significant
nucleotide changes could be useful in developing agents that can
modulate the function of the BRCA1 gene or protein.
Therapeutic Compositions that Comprise Agents
[0187] As described herein, agents can be screened for their
capacity to increase or decrease the effectiveness of the
positively selected polynucleotide or polypeptide identified
according to the subject methods. For example, agents that may be
suitable for enhancing breast development may include those which
interact directly with the BRCA1 protein or its ligand, or which
block inhibitors of BRCA1 protein. Alternatively, an agent may
enhance breast development by increasing BRCA1 expression. As the
mechanism of BRCA1 is further elucidated, strategies for enhancing
its efficacy can be devised.
[0188] In another example, agents that may be suitable for reducing
the progression of AIDS could include those which directly interact
with the human CD59 protein in a manner to make the protein
unusable to the HIV virion, possibly by either rendering the human
CD59 unsuitable for packing in the virion particle or by changing
the orientation of the protein with respect to the cell membrane
(or via some other mechanism). The candidate agents can be screened
for their capacity to modulate CD59 function using an assay in
which the agents are contacted with HIV infected cells which
express human CD59, to determine whether syncytia formation or
other indicia of the progression of AIDS are reduced. The assay may
permit the detection of whether the HIV virion can effectively pack
the CD59 and/or utilize the CD59 to inhibit attack by MAC
complexes.
[0189] One agent that may slow AIDS progression is a human CD59
that has been modified to have multiple GPI links. As described
herein, chimp CD59, which contains three GPI links as compared to
the single GPI link found in human CD59, slows progression of HIV
infections in chimps. Preferably, the modified human CD59 contains
three GPI links in tandem.
[0190] Another example of an agent that may be suitable for
reducing AIDS progression is a compound that directly interacts
with human DC-SIGN to reduce its capacity to bind to HIV-1 and
transport it to the lymph nodes. Such an agent could bind directly
to the HIV-1 binding site on DC-SIGN. The candidate agents can be
contacted with dendritic cells expressing DC-SIGN or with a
purified extracellular fragment of DC-SIGN and tested for their
capacity to inhibit HIV-1 binding.
[0191] Various delivery systems are known in the art that can be
used to administer agents identified according to the subject
methods. Such delivery systems include aqueous solutions,
encapsulation in liposomes, microparticles or microcapsules or
conjugation to a moiety that facilitates intracellular
admission.
[0192] Therapeutic compositions comprising agents may be
administered parenterally by injection, although other effective
administration forms, such as intra-articular injection, inhalant
mists, orally-active formulations, transdermal iontophoresis or
suppositories are also envisioned. The carrier may contain other
pharmacologically-acceptable excipients for modifying or
maintaining the pH, osmolarity, viscosity, clarify, color,
sterility, stability, stability, rate of dissolution, or odor of
the formulation. The carrier may also contain other
pharmacologically-acceptable excipients for modifying or
maintaining the stability, rate of dissolution, release or
absorption of the agent. Such excipients are those substances
usually and customarily employed to formulate dosages for
parenteral administration in either unit dose or multi-dose
form.
[0193] Once the therapeutic composition has been formulated, it may
be stored in sterile vials as a solution, suspension, gel,
emulsion, solid, or dehydrated or lyophilized powder. Such
formulations may be stored either in a ready to use form or
requiring reconstitution immediately prior to administration. The
manner of administering formulations containing agents for systemic
delivery may be via subcutaneous, intramuscular, intravenous,
intranasal or vaginal or rectal suppository. Alternatively, the
formulations may be administered directly to the target organ
(e.g., breast).
[0194] The amount of agent which will be effective in the treatment
of a particular disorder or condition will depend on the nature of
the disorder or condition, which can be determined by standard
clinical techniques. In addition, in vitro or in vivo assays may
optionally be employed to help identify optimal dosage ranges. The
precise dose to be employed in the formulation will also depend on
the route of administration, and the seriousness or advancement of
the disease or condition, and should be decided according to the
practitioner and each patient's circumstances. Effective doses may
be extrapolated from dose-response curves derived from in vitro or
animal model test systems. For example, an effective amount of an
agent identified according to the subject methods is readily
determined by administering graded doses of a bivalent compound of
the invention and observing the desired effect.
Description of a Method for Obtaining Candidate Polynucleotides
that may be Associated with Human Diseases, and Diagnostic Methods
Derived Therefrom
[0195] According to the subject invention, BRCA1 exon 11 is an
evolutionarily significant polynucleotide that has undergone
positive selection in humans relative to chimpanzees, and is
associated with the enhanced breast development observed in humans
relative to humans relative to chimpanzees (see Example 14). Exon
11 has also been found to have mutations that are associated with
the development of breast cancer. BRCA1 exon 11 mutations are known
to be associated with both familial and spontaneous breast cancers
(Kachhap, S. K. et al. (2001) Indian J. Exp. Biol. 39(5):391-400;
Hadjisavvas, A. et al. (2002) Oncol. Rep. 9(2):383-6; Khoo, U. S.
et al. (1999) Oncogene 18(32):4643-6).
[0196] Encompassed within the subject invention are methods that
are based on the principle that human polynucleotides that are
evolutionarily significant relative to a non-human primate, and
which are associated with a improved physiological condition in the
human, may also be associated with decreased resistance or
increased susceptibility to one or more diseases. In one
embodiment, mutations in positively selected human BRCA1
polynucleotide exon 11 may be linked to elevated risk of breast,
ovarian and/or prostate cancer. This phenomenon may represent a
trade-off between enhanced development of one trait and loss or
reduction in another trait in polynucleotides encoding polypeptides
of multiple functions. In this way, identification of positively
selected human polynucleotides can serve to identify a pool of
genes that are candidates for susceptibility to human diseases.
[0197] Thus, in one embodiment, the subject invention provides a
method for obtaining a pool of candidate polynucleotides that are
useful in screening for identification of polynucleotides
associated with increased susceptibility or decreased resistance to
one or more human diseases. The method of identifying the candidate
polynucleotides comprises comparing the human polynucleotide
sequences with non-human primate polynucleotide sequences to
identify any nucleotide changes, and determining whether those
nucleotide changes are evolutionarily significant. Evolutionary
significance can be determined by any of the methods described
herein including the K.sub.A/K.sub.S method. Because evolutionary
significance involves the number of non-silent nucleotide changes
over a defined length of polynucleotide, it is the polynucleotide
containing the group of nucleotide changes that is referred to
herein as "evolutionarily significant." That is, a single
nucleotide change in a human polynucleotide relative to a non-human
primate cannot be analyzed for evolutionary significance without
considering the length of the polynucleotide and the polynucleotide
and the existence or (non-existence) of other non-silent nucleotide
changes in the defined polynucleotide. Thus, in referring to an
"evolutionarily significant polynucleotide" and the nucleotide
changes therein, the size of the polynucleotide is generally
considered to be between about 30 and the total number of
nucleotides encompassed in the polynucleotide or gene sequence
(e.g., up to 3,000-5,000 nucleotides or longer). Further, while
individual nucleotide changes cannot be analyzed in isolation as to
their evolutionary significance, nucleotide changes that contribute
to the evolutionary significance of a polynucleotide are referred
to herein as "evolutionarily significant nucleotide changes."
[0198] The subject method further comprises a method of correlating
an evolutionarily significant nucleotide change in a candidate
polynucleotide to decreased resistance to development of a disease
in humans, comprising identifying evolutionarily significant
candidate polynucleotides as described herein, and further
analyzing the functional effect of the evolutionarily significant
nucleotide change(s) in one or more of the candidate
polynucleotides in a suitable model system, wherein the presence of
a functional effect indicates a correlation between the
evolutionarily significant nucleotide change in the candidate
polynucleotide and the decreased resistance to development of the
disease in humans. As discussed herein, model systems may be
cell-based or in vivo. For example, the evolutionarily significant
human BRCA1 exon 11 (or variations thereof having fewer
evolutionarily significant nucleotide changes) could be transfected
or knock-out genomically inserted into mice or non-human primates
(e.g., chimpanzees) to determine if it induces the functional
effect of breast, ovarian or prostate cancer in the test animals.
Such test results would indicate whether specific evolutionarily
significant changes in exon 11 are associated with increased
incidence of breast, ovarian or prostate cancer.
[0199] In addition to evaluating the evolutionarily significant
nucleotide changes in candidate polynucleotides for their relevance
to development of disease, the subject invention also includes the
evaluation of other nucleotide changes of candidate human
polynucleotides, such as alleles or mutant polynucleotides, that
may be responsible for the development of the disease. For example,
the evolutionarily significant BRCA1 exon 11 has a number of
allelic or mutant exon 11s in human populations that have been
found to be associated with breast, ovarian or prostate cancer
(Rosen, E. M. et al. (2001) Cancer Invest. 19(4):396-412; Elit, L.
et al. (2001) Int. J. Gynecol. Cancer 11(3):241-3; Shen, D. et al.
(2000) J. Natl. Med. Assoc. 92(1):29-35; Khoo, U. S. et al. (1999)
Oncogene 18(32):4643-6; Presneau, N. et al. (1998) Hum. Genet.
103(3):334-9; Dong, J. et al. (1998) Hum. Genet. 103(2):154-61; and
Xu, C. F. et al. (1997) Genes Chromosomes 18(2):102-10). For
example, Grade, K. et al. (1996) J. Cancer Res. Clin. Oncol.
122(11):702-6, report that of 127 human BRCA1 mutations published
by 1996, 55% of them are localized in exon 11. Many of the
cancer-causing mutations in BRCA1 exon 11 are not considered to be
predominantly present in humans, and are therefore not considered
to contribute to the evolutionarily significance of BRCA1 exon 11.
Polynucleotides that are strongly positively selected for the
development of one trait in humans may be hotspots for nucleotide
changes (evolutionarily significant or otherwise) that are
associated with the development of a disease. Thus, according to
the subject invention, identification of candidate polynucleotides
that have been positively selected, is a very efficient start to
identifying corresponding mutant or allelic polynucleotides
associated with a disease.
[0200] To identify whether mutants or alleles of evolutionarily
significant polynucleotides in humans can be correlated to
decreased resistance or increased susceptibility to the disease,
the variant polynucleotide can be tested in a suitable model, such
as the MCF10a normal human epithelial cell line (Favy, D A et al.
(2001) Biochem. Biophys. Res. Commun. 274(1):73-8). This model
system for breast cancer can involve transfection of or knock-out
genomic insertion into the MCF10a normal human breast epithelial
cell line with mutant or allelic BRCA1 exon 11 polynucleotides to
determine whether the nucleotide changes in the mutant or allelic
polynucleotides result in conversion of the cell line to a
neoplastic phenotype, i.e., a phenotype similar to cancer cell
lines MCF-7, MDA-MB231 or HBL100 (Favy et al., supra).
Additionally, mutants of candidate polynucleotides can be compared
to patient genetic data to determine whether, for example, BRCA1
exon 11 mutant nucleotide changes are present in familial and/or
and/or sporadic breast, ovarian and/or prostate tumors. In this
way, mutations in candidate evolutionarily significant human
polynucleotides can be evaluated for their functional effect and
their correlation to development of breast, ovarian and/or prostate
cancer in humans.
[0201] The following examples are provided to further assist those
of ordinary skill in the art. Such examples are intended to be
illustrative and therefore should not be regarded as limiting the
invention. A number of exemplary modifications and variations are
described in this application and others will become apparent to
those of skill in this art. Such variations are considered to fall
within the scope of the invention as described and claimed
herein.
EXAMPLES
Example 1
cDNA Library Construction
[0202] A chimpanzee cDNA library is constructed using chimpanzee
tissue. Total RNA is extracted from the tissue (RNeasy kit,
Quiagen; RNAse-free Rapid Total RNA kit, 5 Prime-3 Prime, Inc.) and
the integrity and purity of the RNA are determined according to
conventional molecular cloning methods. Poly A+ RNA is isolated
(Mini-Oligo(dT) Cellulose Spin Columns, 5 Prime-3 Prime, Inc.) and
used as template for the reverse-transcription of cDNA with oligo
(dT) as a primer. The synthesized cDNA is treated and modified for
cloning using commercially available kits. Recombinants are then
packaged and propagated in a host cell line. Portions of the
packaging mixes are amplified and the remainder retained prior to
amplification. The library can be normalized and the numbers of
independent recombinants in the library is determined.
Example 2
Sequence Comparison
[0203] Suitable primers based on a candidate human gene are
prepared and used for PCR amplification of chimpanzee cDNA either
from a cDNA library or from cDNA prepared from mRNA. Selected
chimpanzee cDNA clones from the cDNA library are sequenced using an
automated sequencer, such as an ABI 377. Commonly used primers on
the cloning vector such as the M13 Universal and Reverse primers
are used to carry out the sequencing. For inserts that are not
completely sequenced by end sequencing, dye-labeled terminators are
used to fill in remaining gaps.
[0204] The detected sequence differences are initially checked for
accuracy, for example by finding the points where there are
differences between the chimpanzee and human sequences; checking
the sequence fluorogram (chromatogram) to determine if the bases
that appear unique to human correspond to strong, clear signals
specific for the called base; checking the human hits to see if
there is more than one human sequence that corresponds to a
sequence change; and other methods known in the art, as needed.
Multiple human sequence entries for the same gene that have the
same nucleotide at a position where there is a different chimpanzee
nucleotide provides independent support that the human sequence is
accurate, and that the chimpanzee/human difference is real. Such
changes are examined using public database information and the
genetic code to determine whether these DNA sequence changes result
in a change in the amino acid sequence of the encoded protein. The
sequences can also be examined by direct sequencing of the encoded
protein.
Example 3
Molecular Evolution Analysis
[0205] The chimpanzee and human sequences under comparison are
subjected to K.sub.A/K.sub.S analysis. In this analysis, publicly
available computer programs, such as Li 93 and INA, are used to
determine the number of non-synonymous changes per site (K.sub.A)
divided by the number of synonymous changes per site (K.sub.S) for
each sequence under study as described above. Full-length coding
regions or partial segments of a coding region can be used. The
higher the K.sub.A/K.sub.S ratio, the more likely that a sequence
has undergone adaptive evolution. Statistical significance of
K.sub.A/K.sub.S values is determined using established statistic
methods and available programs such as the t-test.
[0206] To further lend support to the significance of a high
K.sub.A/K.sub.S ratio, the sequence under study can be compared in
multiple chimpanzee individuals and in other non-human primates,
e.g., gorilla, orangutan, bonobo. These comparisons allow further
discrimination discrimination as to whether the adaptive
evolutionary changes are unique to the human lineage compared to
other non-human primates. The sequences can also be examined by
direct sequencing of the gene of interest from representatives of
several diverse human populations to assess to what degree the
sequence is conserved in the human species.
Example 4
Identification of Positively Selected ICAM-1, ICAM-2 and ICAM-3
[0207] Using the methods of the invention described herein, the
intercellular adhesion molecules ICAM-1, ICAM-2 and ICAM-3 have
been shown to have been strongly positively selected. The ICAM
molecules are involved in several immune response interactions and
are known to play a role in progression to AIDS in HIV infected
humans. The ICAM proteins, members of the Ig superfamily, are
ligands for the integrin leukocyte associated function 1 molecule
(LFA-1). Makgoba et al. (1988) Nature 331:86-88. LFA-1 is expressed
on the surface of most leukocytes, while ICAMs are expressed on the
surface of both leukocytes and other cell types. Larson et al.
(1989) J. Cell Biol. 108:703-712. ICAM and LFA-1 proteins are
involved in several immune response interactions, including T-cell
function, and targeting of leukocytes to areas of inflammation.
Larson et al. (1989).
[0208] Total RNA was prepared using either the RNeasy.RTM. kit
(Qiagen), or the RNAse-free Rapid Total RNA kit (5 Prime-3 Prime,
Inc.) from primate tissues (chimpanzee brain and blood, gorilla
blood and spleen, orangutan blood) or from cells harvested from the
following B lymphocyte cell lines: CARL (chimpanzee), ROK
(gorilla), and PUTI (orangutan). mRNA was isolated from total RNA
using the Mini-Oligo(dT) Cellulose Spin Columns (5 Prime-3 Prime,
Inc.). cDNA was synthesized from mRNA with oligo dT and/or random
priming using the cDNA Synthesis Kit (Stratagene.RTM.). The
protein-coding region of the primate ICAM-1 gene was amplified from
cDNA using primers (concentration=100 nmole/.mu.l) designed by hand
from the published human sequence. PCR conditions for ICAM-1
amplification were 94.degree. C. initial pre-melt (4 min), followed
by 35 cycles of 94.degree. C. (15 see), 58.degree. C. (1 min 15
sec), 72.degree. C. (1 min 15 see), and a final 72.degree. C.
extension for 10 minutes. PCR was accomplished using
Ready-to-Go.TM. PCR beads (Amersham Pharmacia Biotech) in a 50
microliter total reaction volume. Appropriately-sized products were
purified from agarose gels using the QiaQuick.RTM. Gel Extraction
kit (Qiagen). Both strands of the amplification products were
sequenced directly using the Big Dye Cycle Sequencing Kit and
analyzed on a 373A DNA sequencer (ABI BioSystems).
[0209] Comparison of the protein-coding portions of the human,
gorilla (Gorilla gorilla), and orangutan (Pongo pygmaeus) ICAM-1
genes to that of the chimpanzee yielded statistically significant
K.sub.A/K.sub.S ratios (Table 2). The protein-coding portions of
the human and chimpanzee ICAM-1 genes were previously published and
the protein-coding portions of gorilla (Gorilla gorilla), and
orangutan (Pongo pygmaeus) ICAM-1 genes are shown in FIGS. 3 and 4,
respectively.
[0210] For this experiment, pairwise K.sub.A/K.sub.S ratios were
calculated for the mature protein using the algorithm of Li (1985;
1993). Statistically significant comparisons (determined by
t-tests) are shown in bold. Although the comparison to gorilla and
human was sufficient to demonstrate that chimpanzee ICAM-1 has been
positively-selected, the orangutan ICAM-1 was compared as well,
since the postulated historical range of gorillas in Africa
suggests that gorillas could have been exposed to the HIV-1 virus.
Nowak and Paradiso (1983) Walker=s Mammals of the World (Baltimore,
Md., The Johns Hopkins University Press). The orangutan, however,
has always been confined to Southeast Asia and is thus unlikely to
have been exposed to HIV over an evolutionary time frame. (Nowak
and Paradiso, 1983) (Gorillas are most closely-related to humans
and chimpanzees, while orangutans are more distantly-related.)
TABLE-US-00002 TABLE 2 K.sub.A/K.sub.S Ratios: ICAM-1 Whole Protein
Comparisons Species Compared K.sub.A/K.sub.S Ratio Chimpanzee to
Human 2.1 (P < 0.01) Chimpanzee to Gorilla 1.9 (P < 0.05)
Chimpanzee to Orangutan 1.4 (P < 0.05) Human to Gorilla 1.0
Human to Orangutan 0.87 Gorilla to Orangutan 0.95
[0211] Even among those proteins for which positive selection has
been demonstrated, few show K.sub.A/K.sub.S ratios as high as these
ICAM-1 comparisons. Lee and Vacquier (1992) Biol. Bull. 182:97-104;
Swanson and Vacquier (1995) Proc. Natl. Acad. Sci. USA
92:4957-4961; Messier and Stewart (1997); Sharp (1997) Nature
385:111-112. The results are consistent with strong selective
pressure resulting in adaptive changes in the chimpanzee ICAM-1
molecule.
[0212] The domains (D1 and D2) of the ICAM-1 molecule which bind to
LFA-1 have been documented. Staunton et al. (1990). Cell
61:243-254. Pairwise K.sub.A/K.sub.S comparisons between primate
ICAM-1 genes. K.sub.A/K.sub.S ratios were calculated for domains D1
and D2 only, using the algorithm of Li (1985; 1993) (Table 3).
Statistically significant comparisons (determined by t-tests) are
shown in bold. The very high, statistically significant
K.sub.A/K.sub.S ratios for domains D1 and D2 suggest that these
regions of the protein were very strongly positively-selected.
These regions of chimpanzee ICAM-1 display even more striking
K.sub.A/K.sub.S ratios (Table 3) than are seen for the whole
protein comparisons, thus suggesting that the ICAM-1/LFA-1
interaction has been subjected to unusually strong selective
pressures.
TABLE-US-00003 TABLE 3 K.sub.A/K.sub.S Ratios: Domains D1 + D2 of
ICAM-1 Species Compared K.sub.A/K.sub.S Ratio Chimpanzee to Human
3.1 (P < 0.01) Chimpanzee to Gorilla 2.5 (P < 0.05)
Chimpanzee to Orangutan 1.5 (P < 0.05) Human to Gorilla 1.0
Human to Orangutan 0.90 Gorilla to Orangutan 1.0
Example 5
Characterization of ICAM-1, ICAM-2 and ICAM-3 Positively Selected
Sequences
[0213] A sequence identified by the methods of this invention may
be further tested and characterized by cell transfection
experiments. For example, human cells in culture, when transfected
with a chimpanzee polynucleotide identified by the methods
described herein (such as ICAM-1 (or ICAM-2 or ICAM-3); see below),
could be tested for reduced viral dissemination and/or propagation
using standard assays in the art, and compared to control cells.
Other indicia may also be measured, depending on the perceived or
apparent functional nature of the polynucleotide/polypeptide to be
tested. For example, in the case of ICAM-1 (or ICAM-2 or ICAM-3),
syncytia formation may be measured and compared to control
(untransfected) cells. This would test whether the resistance
arises from prevention of syncytia formation in infected cells.
[0214] Cells which are useful in characterizing sequences
identified by the methods of this invention and their effects on
cell-to-cell infection by HIV-1 are human T-cell lines which are
permissive for infection with HIV-1, including, e.g., H9 and HUT78
cell lines, which are available from the ATCC.
[0215] For cell transfection assays, ICAM-1 (or ICAM-2 or ICAM-3)
cDNA (or any cDNA identified by the methods described herein) can
be cloned into an appropriate expression vector. To obtain maximal
expression, the cloned ICAM-1 (or ICAM-2 or ICAM-3) coding region
is operably linked to a promoter which is active in human T cells,
such as, for example, an IL-2 promoter. Alternatively, an ICAM-1
(or ICAM-2 or ICAM-3) cDNA can be placed under transcriptional
control of a strong constitutive promoter, or an inducible
promoter. Expression systems are well known in the art, as are
methods for introducing an expression vector into cells. For
example, an expression vector comprising an ICAM-1 (or ICAM-2 or
ICAM-3) cDNA can be introduced into cells by DEAE-dextran or by
electroporation, or any other known method. The cloned ICAM-1 (or
ICAM-2 or ICAM-3) molecule is then expressed on the surface of the
cell. Determination of whether an ICAM-1 (or ICAM-2 or ICAM-3) cDNA
is expressed on the cell surface can be the cell surface can be
accomplished using antibody(ies) specific for ICAM-1 (or ICAM-2 or
ICAM-3). In the case of chimpanzee ICAM-1 (or ICAM-2 or ICAM-3)
expressed on the surface of human T cells, an antibody which
distinguishes between chimpanzee and human ICAM-1 (or ICAM-2 or
ICAM-3) can be used. This antibody can be labeled with a detectable
label, such as a fluorescent dye. Cells expressing chimpanzee
ICAM-1 (or ICAM-2 or ICAM-3) on their surfaces can be detected
using fluorescence-activated cell sorting and the anti-ICAM-1 (or
ICAM-2 or ICAM-3) antibody appropriately labeled, using
well-established techniques.
[0216] Transfected human cells expressing chimpanzee ICAM-1 (or
ICAM-2 or ICAM-3) on their cell surface can then be tested for
syncytia formation, and/or for HIV replication, and/or for number
of cells infected as an index of cell-to-cell infectivity. The
chimpanzee ICAM-1 (or ICAM-2 or ICAM-3)-expressing cells can be
infected with HIV-1 at an appropriate dose, for example tissue
culture infectious dose 50, i.e., a dose which can infect 50% of
the cells. Cells can be plated at a density of about
5.times.10.sup.5 cells/ml in appropriate tissue culture medium,
and, after infection, monitored for syncytia formation, and/or
viral replication, and/or number of infected cells in comparison to
control, uninfected cells. Cells which have not been transfected
with chimpanzee ICAM-1 (or ICAM-2 or ICAM-3) also serve as
controls. Syncytia formation is generally observed in
HIV-1-infected cells (which are not expressing chimpanzee ICAM-1
(or ICAM-2 or ICAM-3)) approximately 10 days post-infection.
[0217] To monitor HIV replication, cell supernatants can be assayed
for the presence and amount of p24 antigen. Any assay method to
detect p24 can be used, including, for example, an ELISA assay in
which rabbit anti-p24 antibodies are used as capture antibody,
biotinylated rabbit anti-p24 antibodies serve as detection
antibody, and the assay is developed with avidin-horse radish
peroxidase. To determine the number of infected cells, any known
method, including indirect immunofluorescence methods, can be used.
In indirect immunofluorescence methods, human HIV-positive serum
can be used as a source of anti-HIV antibodies to bind to infected
cells. The bound antibodies can be detected using FITC-conjugated
anti-human IgG, the cells visualized by fluorescence microscopy
fluorescence microscopy and counted.
[0218] Another method for assessing the role of a molecule such as
ICAM-1 (or ICAM-2 or ICAM-3) involves successive infection of cells
with HIV. Human cell lines, preferably those that do not express
endogenous ICAM (although cell lines that do express endogenous
ICAM may also be used), are transfected with either human or
chimpanzee ICAM B1 or B2 or B3. In one set of experiments, HIV is
collected from the supernatant of HIV-infected human ICAM-1 (or
ICAM-2 or ICAM-3)-expressing cells and used to infect chimpanzee
ICAM-1 (or ICAM-2 or ICAM-3)-expressing cells or human ICAM-1 (or
ICAM-2 or ICAM-3)-expressing cells. Initial infectivity, measured
as described above, of both the chimpanzee ICAM-1 (or ICAM-2 or
ICAM-3)- and the human ICAM-1 (or ICAM-2 or ICAM-3)-expressing
cells would be expected to be high. After several rounds of
replication, cell to cell infectivity would be expected to decrease
in the chimpanzee ICAM-1 (or ICAM-2 or ICAM-3) expressing cells, if
chimpanzee ICAM-1 (or ICAM-2 or ICAM-3) confers resistance. In a
second set of experiments, HIV is collected from the supernatant of
HIV-infected chimpanzee ICAM-1 (or ICAM-2 or ICAM-3)-expressing
cells, and used to infect human ICAM-1 (or ICAM-2 or
ICAM-3)-expressing cells. In this case, the initial infectivity
would be expected to be much lower than in the first set of
experiments, if ICAM-1 (or ICAM-2 or ICAM-3) is involved in
susceptibility to HIV progression. After several rounds of
replication, the cell to cell infectivity would be expected to
increase.
[0219] The identified human sequences can be used in establishing a
database of candidate human genes that may be involved in
conferring, or contributing to, AIDS susceptibility or resistance.
Moreover, the database not only provides an ordered collection of
candidate genes, it also provides the precise molecular sequence
differences that exist between human and an AIDS-resistant
non-human primate (such as chimpanzee) and thus defines the changes
that underlie the functional differences.
Example 6
Molecular Modeling of ICAM-1 and ICAM-3
[0220] Modeling of the three-dimensional structure of ICAM-1 and
ICAM-3 has provided provided additional evidence for the role of
these proteins in explaining chimpanzee resistance to AIDS
progression.
[0221] In the case of ICAM-1, 5 of the 6 amino acid replacements
that are unique to the chimpanzee lineage are immediately adjacent
(i.e., physically touching) to those amino acids identified by
mutagenic studies as critical to LFA-1 binding. These five amino
acid replacements are human L18 to chimp Q18, human K29 to chimp
D29, human P45 to chimp G45, human R49 to chimp W49, and human E171
to chimp Q171. This positioning cannot be predicted from the
primary structure (i.e., the actual sequence of amino acids). None
of the amino acid residues critical for binding has changed in the
chimpanzee ICAM-1 protein.
[0222] Such positioning argues strongly that the chimpanzee ICAM-1
protein=s basic function is unchanged between humans and
chimpanzees; however, evolution has wrought fine-tuned changes that
may help confer upon chimpanzees their resistance to progression of
AIDS. The nature of the amino acid replacements is being examined
to allow exploitation of the three-dimensional structural
information for developing agents for therapeutic intervention.
Strikingly, 4 of the 5 chimpanzee residues are adjacent to critical
binding residues that have been identified as N-linked
glycosylation sites. This suggests that differences exist in
binding constants (to LFA-1) for human and chimpanzee ICAM-1. These
binding constants are being determined. Should the binding
constants prove lower in chimpanzee ICAM-1, it is possible to
devise small molecule agents to mimic (by way of steric hindrance)
the change in binding constants as a potential therapeutic strategy
for HIV-infected humans. Similarly, stronger binding constants, if
observed for chimpanzee ICAM-1, will suggest alternative strategies
for developing therapeutic interventions for HIV-1 infected
humans.
[0223] In the case of ICAM-3, a critical amino acid residue
replacement from proline (observed in seven humans) to glutamine
(observed in three chimpanzees) is predicted from our modeling
studies to significantly change the positional angle between
domains 2 and 3 of human and chimpanzee ICAM-3. The human protein
displays an acute angle at this juncture. Klickstein, et al., 1996
J. Biol. Chem. 27:239 20-27. Loss of this sharp angle (bend) is
predicted to render chimpanzee ICAM-3 less easily packaged into
HIV-1 virions (In infected humans, after ICAMs are packaged into
HIV virions, cell-to-cell infectivity dramatically increases.
Barbeau, B. et al., 1998 J. Viral. 72:7125-7136). This failure to
easily package chimp ICAM-3 into HIV virions could then prevent the
increase in cell-to-cell infectivity seen in infected humans. This
would then account for chimpanzee resistance to AIDS
progression.
[0224] A small molecule therapeutic intervention whereby binding of
a suitably-designed small molecule to the human praline residue
causes (as a result of steric hindrance) the human ICAM-1 protein
to mimic the larger (i.e., less-acute) angle of chimpanzee ICAM-3
is possible. Conservation between the 2 proteins of the critical
binding residues (and the general resemblance of immune responses
between humans and chimpanzees) argues that alteration of this
angle will not compromise the basic function of human ICAM-3.
However, the human ICAM-3 protein would be rendered resistant to
packaging into HIV virions, thus mimicking (in HIV-1 infected
humans) the postulated pathway by which infected chimpanzees resist
progression to AIDS.
[0225] Essentially the same procedures were used to identify
positively selected chimpanzee ICAM-2 and ICAM-3 (see Table 4). The
ligand binding domain of ICAM-1 has been localized as exhibiting
especially striking positive selection in contrast to ICAMs-2 and
-3, for which positive selection resulted in amino acid
replacements throughout the protein. Thus, this comparative genomic
analysis reveals that positive selection on ICAMs in chimpanzees
has altered the proteins=primary structure, for example, in
important binding domains. These alterations may have conferred
resistance to AIDS progression in chimpanzees.
TABLE-US-00004 TABLE 4 K.sub.A/K.sub.S Ratios: ICAM-2 and 3 Whole
Protein Comparisons Species Compared K.sub.A/K.sub.S Ratio
Chimpanzee to Human ICAM-2 2.1 (P < 0.01) Chimpanzee to Human
ICAM-3 3.7 (P < 0.01)
[0226] Binding of ICAM-1, -2, and -3 has been demonstrated to play
an essential role in the formation of syncytia (i.e., giant,
multi-nucleated cells) in HIV-infected cells in vitro. Pantaleo et
al. (1991) J. Ex. Med. 173:511-514. Syncytia formation is followed
by the depletion of CD.sup.+ cells in vitro. Pantaleo et al.
(1991); Levy (1993) Microbiol. Rev. 57:183-189; Butini et al.
(1994) Eur. J. Immunol. 24:2191-2195; Finkel and Banda (1994) Curr.
Opin. Immunol. 6:605-615. Although syncytia formation is difficult
to detect in viva, clusters of infected cells are seen in lymph
nodes of infected individuals. Pantaleo et al., (1993) N. Eng. J.
Med. 328:327-335; Finkel and Banda (1994); Embretson et al. (1993)
Nature 362:359-362; Pantaleo et al. (1993) Nature 362:355-358.
Syncytia may simply be scavenged from the body too quickly to be
detected. Fouchier et al. (1996) Virology 219:87-95.
Syncytia-mediated loss of CD4.sup.+ cells in vivo has been
speculated to occur; this could contribute directly to compromise
of the immune system, leading to opportunistic infection and
full-blown AIDS. Sodrosky et al. (1986) Nature 322:470-474;
Hildreth and Orentas (1989) Science 244:1075-1078; Finkel and Banda
(1994). Thus critical changes in chimpanzee ICAM-1, ICAM-2 or
ICAM-3 may deter syncytia formation in chimpanzee and help explain
chimpanzee resistance to AIDS progression. Because of the
polyfunctional nature of ICAMs, these positively selected changes
in the ICAM genes may additionally confer resistance to other
infectious diseases or may play a role in other inflammatory
processes that may also be of value in the development of human
therapeutics. The polypeptide sequence alignments of ICAM-1, -2,
and -3 are shown in FIGS. 5, 6, and 7, respectively.
Example 7
Identifying Positive Selection of MIP-1.alpha.
[0227] MIP-1.alpha. is a chemokine that has been shown to suppress
HIV-1 replication in human cells in vitro (Cocchi, F. et al., 1995
Science 270:1811-1815). The chimpanzee homologue of the human
MIP-1.alpha. gene was PCR-amplified and sequenced. Calculation of
the K.sub.A/K.sub.S ratio (2.1, P<0.05) and comparison to the
gorilla homologue reveals that the chimpanzee gene has been
positively-selected. As for the other genes discussed herein, the
nature of the chimpanzee amino acid replacements is being examined
to determine how to how to exploit the chimpanzee protein for
therapeutic intervention.
Example 8
Identifying Positive Selection of 17-1'-Hydroxysteroid
Dehydrogenase
[0228] Using the methods of the present invention, a chimpanzee
gene expressed in brain has been positively-selected
(K.sub.A/K.sub.S=1.6) as compared to its human homologue (GenBank
Acc. #X87176) has been identified. The human gene, 17-0
hydroxysteroid dehydrogenase type IV, codes for a protein known to
degrade the two most potent estrogens, .beta.-estradiol, and 5-diol
(Adamski, J. et al. 1995 Biochem J. 311:437-443). Estrogen-related
cancers (including, for example, breast and prostate cancers)
account for some 40% of human cancers. Interestingly, reports in
the literature suggest that chimpanzees are resistant to
tumorigenesis, especially those that are estrogen-related. This
protein may have been positively-selected in chimpanzees to allow
more efficient degradation of estrogens, thus conferring upon
chimpanzees resistance to such cancers. If so, the specific amino
acid replacements observed in the chimpanzee protein may supply
important information for therapeutic intervention in human
cancers.
Example 9
cDNA Library Construction for Chimpanzee Brain Tissue
[0229] A chimpanzee brain cDNA library is constructed using
chimpanzee brain tissue. The chimpanzee brain tissue can be
obtained after natural death so that no killing of an animal is
necessary for this study. In order to increase the chance of
obtaining intact mRNAs expressed in brain, however, the brain is
obtained as soon as possible after the animals death. Preferably,
the weight and age of the animal are determined prior to death. The
brain tissue used for constructing a cDNA library is preferably the
whole brain in order to maximize the inclusion of mRNA expressed in
the entire brain. Brain tissue is dissected from the animal
following standard surgical procedures.
[0230] Total RNA is extracted from the brain tissue and the
integrity and purity of the RNA are determined according to
conventional molecular cloning methods. Poly A+ RNA is selected and
used as template for the reverse-transcription of cDNA with oligo
(dT) as a primer. The synthesized cDNA is treated and modified for
cloning using commercially available kits. Recombinants are then
packaged and propagated in a host cell line. Portions of the
packaging mixes are amplified and the remainder retained prior to
amplification. The library can be normalized and the numbers of
independent recombinants in the library is determined.
Example 10
Sequence Comparison of Chimpanzee and Human Brain cDNA
[0231] Randomly selected chimpanzee brain cDNA clones from the cDNA
library are sequenced using an automated sequencer, such as the ABI
377. Commonly used primers on the cloning vector such as the M13
Universal and Reverse primers are used to carry out the sequencing.
For inserts that are not completely sequenced by end sequencing,
dye-labeled terminators are used to fill in remaining gaps.
[0232] The resulting chimpanzee sequences are compared to human
sequences via database searches, e.g., BLAST searches. The high
scoring "hits," i.e., sequences that show a significant (e.g.,
>80%) similarity after BLAST analysis, are retrieved and
analyzed. The two homologous sequences are then aligned using the
alignment program CLUSTAL V developed by Higgins et al. Any
sequence divergence, including nucleotide substitution, insertion
and deletion, can be detected and recorded by the alignment.
[0233] The detected sequence differences are initially checked for
accuracy by finding the points where there are differences between
the chimpanzee and human sequences; checking the sequence
fluorogram (chromatogram) to determine if the bases that appear
unique to human correspond to strong, clear signals specific for
the called base; checking the human hits to see if there is more
than one human sequence that corresponds to a sequence change; and
other methods known in the art as needed. Multiple human sequence
entries for the same gene that have the same nucleotide at a
position where there is a different chimpanzee nucleotide provides
independent support that the human sequence is accurate, and that
the chimpanzee/human difference is real. Such changes are examined
using public database information and the genetic code to determine
whether these DNA sequence changes result in a change in the amino
acid sequence of the encoded encoded protein. The sequences can
also be examined by direct sequencing of the encoded protein.
Example 11
Molecular Evolution Analysis of Human Brain Sequences Relative to
Other Primates
[0234] The chimpanzee and human sequences under comparison are
subjected to K.sub.A/K.sub.S analysis. In this analysis, publicly
available computer programs, such as Li 93 and INA, are used to
determine the number of non-synonymous changes per site (K.sub.A)
divided by the number of synonymous changes per site (K.sub.S) for
each sequence under study as described above. This ratio,
K.sub.A/Ks, has been shown to be a reflection of the degree to
which adaptive evolution, i.e., positive selection, has been at
work in the sequence under study. Typically, full-length coding
regions have been used in these comparative analyses. However,
partial segments of a coding region can also be used effectively.
The higher the K.sub.A/K.sub.S ratio, the more likely that a
sequence has undergone adaptive evolution. Statistical significance
of K.sub.A/K.sub.S values is determined using established statistic
methods and available programs such as the t-test. Those genes
showing statistically high K.sub.A/K.sub.S ratios between
chimpanzee and human genes are very likely to have undergone
adaptive evolution.
[0235] To further lend support to the significance of a high
K.sub.A/K.sub.S ratio, the sequence under study can be compared in
other non-human primates, e.g., gorilla, orangutan, bonobo. These
comparisons allow further discrimination as to whether the adaptive
evolutionary changes are unique to the human lineage compared to
other non-human primates. The sequences can also be examined by
direct sequencing of the gene of interest from representatives of
several diverse human populations to assess to what degree the
sequence is conserved in the human species.
Example 12
Further Sequence Characterization of Selected Human Brain
Sequences
[0236] Human brain nucleotide sequences containing evolutionarily
significant changes are further characterized in terms of their
molecular and genetic properties, as well as their biological
functions. The identified coding sequences are used as probes to
perform in situ mRNA hybridization that reveals the expression
pattern of the gene, either or both in terms of what tissues and
cell types in which the sequences are expressed, and when they are
expressed during the course of development or during the cell
cycle. Sequences that are expressed in brain may be better
candidates as being associated with important human brain
functions. Moreover, the putative gene with the identified
sequences are subjected to homologue searching in order to
determine what functional classes the sequences belong to.
[0237] Furthermore, for some proteins, the identified human
sequence changes may be useful in estimating the functional
consequence of the change. By using such criteria a database of
candidate genes can be generated. Candidates are ranked as to the
likelihood that the gene is responsible for the unique or enhanced
abilities found in the human brain compared to chimpanzee or other
non-human primates, such as high capacity information processing,
storage and retrieval capabilities, language abilities, as well as
others. In this way, this approach provides a new strategy by which
such genes can be identified. Lastly, the database not only
provides an ordered collection of candidate genes, it also provides
the precise molecular sequence differences that exist between human
and chimpanzee (and other non-human primates), and thus defines the
changes that underlie the functional differences.
[0238] In some cases functional differences are evaluated in
suitable model systems, including, but not limited to, in vitro
analysis such as indicia of long term potentiation (LTP), and use
of transgenic animals or other suitable model systems. These will
be immediately apparent to those skilled in the art.
Example 13
Identification of Positive Selection in a Human Tyrosine Kinase
Gene
[0239] Using the methods of the present invention, a human gene
(GenBank Acc.# AB014541), expressed in brain has been identified,
that has been positively-selected as compared to its gorilla
homologue. This gene, which codes for a tyrosine kinase, is
homologous to a well-characterized mouse gene (GenBank Acc.#
AF011908) whose gene product, called AATYK, is known to trigger
apoptosis (Gaozza, E. et al. 1997 Oncogene 15:3127-3135). The
literature suggests that this protein controls apoptosis in the
developing mouse brain (thus, in effect, "sculpting" the developing
brain). The AATYK-induced apoptosis that occurs during brain
development has been demonstrated to be necessary for normal brain
development.
[0240] There is increasing evidence that inappropriate apoptosis
contributes to the pathology of human neurodegenerative diseases,
including retinal degeneration, Huntington's disease, Alzheimer's
disease, Parkinson's disease and spinal muscular atrophy, an
inherited childhood motoneuron disease. On the other hand in neural
tumour cells, such as neuroblastoma and medulloblastoma cells,
apoptotic pathways may be disabled and the cells become resistant
to chemotherapeutic drugs that kill cancer cells by inducing
apoptosis. A further understanding of apoptosis pathways and the
function of apoptosis genes should lead to a better understanding
of these conditions and permit the use of AATYKI in diagnosis of
such conditions.
[0241] Positively-selected human and chimpanzee AATYK may
constitute another adaptive change that has implications for
disease progression. Upon resolution of the three-dimensional
structure of human and chimpanzee AATYK, it may be possible to
design drugs to modulate the function of AATYK in a desired manner
without disrupting any of the normal functions of human AATTK.
[0242] It has been demonstrated that mouse AATYK is an active,
non-receptor, cytosolic kinase which induces neuronal
differentiation in human adrenergic neuroblastoma (NB):SH-SY5Y
cells. AATYK also promotes differentiation induced by other agents,
including all-trans retinoic acid (RA), 12-O-Tetradecanoyl phorbol
13-acetate (TPA) and IGF-I. Raghunath, et al., Brain Res Mol Brain
Res. (2000) 77:151-62. In experiments with rats, it was found that
the AATYK protein was expressed in virtually all regions of the
adult rat brain in which neurons are present, including olfactory
bulb, forebrain, cortex, midbrain, cerebellum and pons.
Immunohistochemical labeling of adult brain sections sections
showed the highest levels of AATYK expression in the cerebellum and
olfactory bulb. Expression of AATYK was also up-regulated as a
function of retinoic acid-induced neuronal differentiation of p19
embryonal carcinoma cells, supporting a role for this protein in
mature neurons and neuronal differentiation. Baker, et al.,
Oncogene (2001) 20:1015-21.
Nicolini, et al., Anticancer Res (1998) 18:2477-81 showed that
retinoic acid (RA) differentiated SH-SY5Y cells were a suitable and
reliable model to test the neurotoxicity of chemotherapeutic drugs
without the confusing effects of the neurotrophic factors commonly
used to induce neuronal differentiation. The neurotoxic effect and
the course of the changes is similar to that observed in clinical
practice and in in vivo experimental models. Thus, the model is
proposed as a screening method to test the neurotoxicity of
chemotherapy drugs and the possible effect of neuroprotectant
molecules and drugs. Similarly, AATYK differentiated SYSY-5Y cells
could be used as a model for screening chemotherapeutic drugs and
possible side effects of neuroprotectant molecules and drugs.
[0243] It has also been shown that AATYK mRNA is expressed in
neurons throughout the adult mouse brain. AATYK possessed tyrosine
kinase activity and was autophosphorylated when expressed in 293
cells. AATYK mRNA expression was rapidly induced in cultured mouse
cerebellar granule cells during apoptosis induced by KCl. The
number of apoptotic granule cells overexpressing wild-type AATYK
protein was significantly greater than the number of apoptotic
granule cells overexpressing a mutant AATYK that lacked tyrosine
kinase activity. These findings suggest that through its tyrosine
kinase activity, AATYK is also involved in the apoptosis of mature
neurons. Tomomura, et al., Oncogene (2001) 20(9):1022-32.
[0244] The tyrosine kinase domain of AATYK protein is highly
conserved between mouse, chimpanzee, and human (as are most
tyrosine kinases). Interestingly, however, the region of the
protein to which signaling proteins bind has been
positively-selected in humans, but strongly conserved in both
chimpanzees and mice. The region of the human protein to which
signaling proteins bind has not only been positively-selected as a
result of point nucleotide mutations, but additionally displays
duplication of several src homology 2 homology 2 (SH2) binding
domains that exist only as single copies in mouse and chimpanzee.
This suggests that a different set of signaling proteins may bind
to the human protein, which could then trigger different pathways
for apoptosis in the developing human brain compared to those in
mice and chimpanzees. Such a gene thus may contribute to unique or
enhanced human cognitive abilities. Human AATYK has been mapped on
25.3 region of chromosome 17. Seki, et al., J Hum Genet (1999)
44:141-2.
[0245] Chimpanzee DNA was sequenced as part of a high-throughput
sequencing project on a MegaBACE 1000 sequencer (AP Biotech). DNA
sequences were used as query sequences in a BLAST search of the
GenBank database. Two random chimpanzee sequences, termed stch856
and stch610, returned results for two genes in the non-redundant
database of GenBank: NM 004920 (human apoptosis-associated tyrosine
kinase, AATYK) and AB014541 (human KIAA641, identical nucleotide
sequence to NM.sub.--004920), shown in FIG. 14A, and also showed a
high K.sub.A/K.sub.S ratio compared to these human sequences.
Primers were designed for PCR and sequencing of AATYK. Sequence was
obtained for the 3 prime end of this gene in chimp and gorilla. The
5 prime end of the gene was difficult to amplify, and no sequence
was confirmed in human and gorilla. The human AATYK gene (SEQ ID
NO:14) has a coding region of 3624 by (nucleotides 413-4036 of SEQ
ID NO:14), and codes for a protein of 1207 amino acids (SEQ ID
NO:16). 1809 by were sequenced in both chimp and gorilla. See FIGS.
15A and 15B. The partial sequences (SEQ ID NO:17 and SEQ ID NO:18)
did not include the start or stop codons, although they were very
close to the stop codon on the 3 prime end (21 codons away). These
sequences correspond to nucleotides 2170-3976 or 2179-3988 of the
corresponding human sequences taking into account the gaps
described below.
[0246] There were also several pairs of amino acid
insertions/deletions among chimp, human and gorilla in the coding
region. The following sequences are in reading frame:
TABLE-US-00005 Chimp GGTGAGGGCCCCGGCCCCGGGCCC (SEQ ID NO: 19) Human
2819 GGTGAGGGC::::::CCCGGGCCC 2836 (SEQ ID NO: 20) Gorilla
GGCGAGGGC::::::CCCGGGCCC (SEQ ID NO: 21) Chimp
CTGGAGGCTGAGGCCGAGGCCGAG (SEQ ID NO: 22) Human 2912
CTCGAGGCT::::::GAGGCCGAG 2929 (SEQ ID NO: 23) Gorilla
CTGGAGGCT::::::GAGGCCGAG (SEQ ID NO: 24) Chimp
CCCACGCCC::::::GCTCCCTTC (SEQ ID NO: 25) Human 3890
CCCACGCCCACGCCCGCTCCCTTC 3913 (SEQ ID NO: 26) Gorilla
CCCACGCCC::::::GCTCCCTTC (SEQ ID NO: 27) Chimp
CCCACGTCCACGTCCCGCTTCTCC (SEQ ID NO: 28) Human 3938
CCCACGTCC::::::CGCTTCTCC 3955 (SEQ ID NO: 29) Gorilla
CCCACGTCC::::::CGCTTCTCC (SEQ ID NO: 30)
[0247] Each of these insertions/deletions affected two amino acids
and did not change the reading frame of the sequence. Sliding
window K.sub.A/K.sub.S for chimp to human, chimp to gorilla, and
human to gorilla, excluding the insertion/deletion regions noted
above, showed a high Ka/Ks ratio for some areas. See Table 9.
[0248] The highest Ka/Ks ratios are human to gorilla and chimp to
gorilla, suggesting that both the human and chimp gene have
undergone selection, and is consistent with the idea that the two
species share some enhanced cognitive abilities relative to the
other great apes (gorillas, for example). Such data bolsters the
view that this gene may play a role with regard to enhanced
cognitive functions. It should also be noted that in general, the
human-containing pairwise comparisons are higher than the analogous
chimp-containing comparisons.
TABLE-US-00006 TABLE 9 K.sub.A/K.sub.S ratios for various windows
of AATYK on chimp, human, and gorilla bp of NM 004920 AATYK K.sub.A
K.sub.S K.sub.A/K.sub.S K.sub.A SE K.sub.S SE size bp bp of partial
CDS t (pub human AATYK) chimp gorilla 0.02287 0.03243 0.705211
0.00433 0.00832 1809 1-1809 1.019266 2180-3988 chimp human 0.01538
0.01989 0.773253 0.00366 0.0062 1809 1-1809 0.626415 2180-3988
human gorilla 0.02223 0.03204 0.69382 0.00429 0.00848 1809 1-1809
1.032263 2180-3988 ch1 hu1 0.03126 0.02009 1.555998 0.01834 0.02034
150 1-150 0.407851 2180-2329 ch2 hu2 0.03142 0.04043 0.777146
0.01844 0.02919 150 100-249 0.260958 2279-2428 ch3 hu3 0.02073
0.02036 1.018173 0.01481 0.02087 150 202-351 0.014458 2381-2530 ch4
hu4 0.02733 0.02833 0.964702 0.01753 0.02383 150 301-450 0.033803
2480-2629 ch5 hu5 0 0.05152 0 0 0.03802 150 400-549 1.355076
2579-2728 ch6 hu6 0.00836 0.03904 0.214139 0.00838 0.03964 150
502-651 0.75723 2681-2830 ch7 hu7 0.00888 0.05893 0.150687 0.0089
0.0439 150 601-750 1.11736 2780-2929 ch8 hu8 0.02223 0.03829
0.580569 0.01589 0.03886 150 700-849 0.382534 2879-3028 ch9 hu9
0.04264 0.03644 1.170143 0.02173 0.02628 150 799-948 0.181817
2978-3127 ch10 hu10 0.02186 0.01823 1.199122 0.01563 0.01851 150
901-1050 0.149837 3080-3229 ch11 hull 0.01087 0 #DIV/0! 0.01093 0
150 1000-1149 0.994511 3179-3328 ch12 hu12 0.01093 0 #DIV/0!
0.01099 0 150 1099-1248 0.99454 3278-3427 ch13 hu13 0.01031 0
#DIV/0! 0.01036 0 150 1201-1350 0.995174 3380-3529 ch14 hu14
0.01053 0 #DIV/0! 0.01058 0 150 1300-1449 0.995274 3479-3628 ch15
hu15 0.01835 0.02006 0.914756 0.01315 0.02057 150 1399-1548
0.070042 3578-3727 ch16 hu16 0 0.02027 0 0 0.02062 150 1501-1650
0.983026 3680-3829 ch17 hu17 0.00666 0 #DIV/0! 0.00667 0 210
1600-1809 0.998501 3779-3988 chA huA 0.02366 0.02618 0.903743
0.00875 0.01251 501 1-501 0.165069 2180-2680 chB huB 0.01159
0.03863 0.300026 0.00585 0.01811 501 400-900 1.420809 2579-3079 chC
huC 0.02212 0.0108 2.048148 0.00846 0.00768 501 799-1299 0.990721
2978-3478 chD huD 0.00851 0.00734 1.159401 0.00458 0.00602 609
1201-1809 0.154676 3380-3988 chA gorA 0.02082 0.04868 0.427691
0.00795 0.0191 501 1-501 1.346644 2180-2680 chB gorB 0.01416
0.04039 0.350582 0.00639 0.0172 501 400-900 1.429535 2579-3079 chC
gorC 0.01737 0.00538 3.228625 0.00717 0.00542 501 799-1299 1.333991
2978-3478 chD gorD 0.00644 0.00244 2.639344 0.00408 0.00346 609
1201-1809 0.747722 3380-3988 huA gorA 0.02246 0.02759 0.814063
0.00829 0.01523 501 1-501 0.295847 2180-2680 huB gorB 0.01418
0.06809 0.208254 0.0064 0.02388 501 400-900 2.180583 2579-3079 huC
gorC 0.01993 0.00541 3.683919 0.00762 0.00544 501 799-1299 1.550854
2978-3478 huD gorD 0.00723 0.00488 1.481557 0.0042 0.0049 609
1201-1809 0.364133 3380-3988
Example 14
Positively Selected Human BRCA1 Gene
[0249] Comparative evolutionary analysis of the BRCA1 genes of
several primate species has revealed that the human BRCA1 gene has
been subjected to positive selection. Initially, 1141 codons of
exon 11 of the human and chimpanzee BRCA1 genes (Hacia et al.
(1998) Nature Genetics 18:155-158) were compared and a strikingly
high K.sub.A/K.sub.S ratio, 3.6, was found when calculated by the
method of Li (Li (1993) J. Mol. Eva. 36:96-99; Li et al. (1985)
Mol. Biol. Eva. 2:150-174). In fact, statistically significant
elevated ratios were obtained for this comparison regardless of the
particular algorithm used (see Table 5A). Few genes (or portions of
genes) have been documented to display ratios of this magnitude
(Messier et al. (1997) Nature 385:151-154; Endo et al. (1996) Mol.
Biol. Evol. 13:685-690; and Sharp (1997) Nature 385:111-112). We
thus chose to sequence the complete protein-coding region (5589 bp)
of the chimpanzee BRCA1 gene, in order to compare it to the
full-length protein-coding sequence of the human gene. In many
cases, even when positive selection can be shown to have operated
on limited regions of a particular gene, K.sub.A/K.sub.S analysis
of the full-length protein-coding sequence fails to reveal evidence
of positive selection (Messier et al. (1997), supra). This is
presumably because the signal of positive selection can be masked
by noise when only small regions of a gene have been positively
selected, unless selective pressures are especially strong.
However, comparison of the full-length human and chimpanzee BRCA1
sequences still yielded K.sub.A/K.sub.S ratios in excess of one, by
all algorithms we employed (Table 5A). This suggests that the
selective pressure on BRCA1 was intense. A sliding-window
K.sub.A/K.sub.S analysis was also performed, in which intervals of
varying lengths (from 150 to 600 bp) were examined, in order to
determine the pattern of selection within the human BRCA1 gene.
This analysis suggests that positive selection seems to have been
concentrated in exon 11.
TABLE-US-00007 TABLE 5A Human-Chimpanzee K.sub.A/K.sub.S
Comparisons Method K.sub.A/K.sub.S (exon 11) K.sub.A/K.sub.S
(full-length) Li (1993) J. Mol. Evol. 36: 96; 3.6*** 2.3* Li et al.
(1985) Mol. Biol. Evol. 2: 150 Ina Y. (1995) J. Mol. Evol. 3.3**
2.1* 40: 190 Kumar et al., MEGA: Mol. 2.2* 1.2 Evol. Gen. Anal. (PA
St. Univ, 1993)
TABLE-US-00008 TABLE 5B K.sub.A/K.sub.S for Exon 11 of BRCA1 from
Additional Primates Comparison K.sub.A K.sub.S K.sub.A/K.sub.S
Human Chimpanzee 0.010 0.003 3.6* Gorilla 0.009 0.009 1.1 Orangutan
0.018 0.020 0.9 Chimpanzee Gorilla 0.006 0.007 0.8 Orangutan 0.014
0.019 0.7 Gorilla Orangutan 0.014 0.025 0.6
[0250] The Table 5B ratios were calculated according to Li (1993)
J. Mol. Evol. 36:96; Li et al. (1985) Mol. Biol. Evol. 2:150. For
all comparisons, statistical significance was calculated by
t-tests, as suggested in Zhang et al. (1998) Proc. Natl. Acad. Sci.
USA 95:3708. Statistically significant comparisons are indicated by
one or more asterisks, with values as follows: *, P<0.05, **,
P<0.01, ***, P<0.005. Exon sequences are from Hacia et al.
(1998) Nature Genetics 18:155. GenBank accession numbers: human,
NM.sub.--000058.1, chimpanzee, AF019075, gorilla, AF019076,
orangutan, AF019077, rhesus, AF019078.
[0251] The elevated K.sub.A/K.sub.S ratios revealed by pairwise
comparisons of the human and chimpanzee BRCA1 sequences demonstrate
the action of positive selection, but such comparisons alone do not
reveal which of the two genes compared, the human or the
chimpanzee, has been positively selected. However, if the primate
BRCA1 sequences are considered in a proper phylogenetic framework,
only those pairwise comparisons which include the human gene show
ratios greater than one, indicating that only the human gene has
been positively selected (Table 5B). To confirm that positive
selection operated on exon 11 of BRCA1 exclusively within the human
lineage, the statistical test of positive selection proposed by
Zhang et al. (1998) Proc. Natl. Acad. Sci. USA 95:3708-3713, was
used. This test is especially appropriate when the number of
nucleotides is large, as in the present case (3423 bp). This
procedure first determines nonsynonymous nucleotide substitutions
per nonsynonymous site (b.sub.N) and synonymous substitutions per
synonymous site (b.sub.s) for each individual branch of a
phylogenetic tree (Zhang et al. (1998), supra), Positive selection
is supported only on those branches for which b.sub.N b.sub.s can
be shown to be statistically significant (Zhang et al. (1998),
supra). For BRCA1, this is true for only one branch of the primate
tree shown in FIG. 9: the branch which leads from the
human/chimpanzee common ancestor to modern humans, where
b.sub.N/b.sub.S=3.6. Thus, we believe that in the case of the BRCA1
gene, positive selection operated directly and exclusively on the
human lineage.
[0252] While it is formally possible that elevated K.sub.A/K.sub.S
ratios might reflect some locus or chromosomal-specific anomaly
(such as suppression of K.sub.S due, for example, to isochoric
differences in GC content), rather than the effects of positive
selection, this is unlikely in the present case, for several
reasons. First, the estimated K.sub.S values for the hominoid BRCA1
genes, including human, were compared to those previously estimated
for other well-studied hominoid loci, including lysozyme (Messier
et al. (1997), supra) and ECP (Zhang et al. (1998), supra). There
is no evidence for a statistically significant difference in these
values. This argues against some unusual suppression of K.sub.S in
human BRCA1. Second, examination of GC content (Sueoka, N. in
Evolving Genes and Proteins (eds. Bryson, V. & Vogel, H. J.)
479-496 (Academic Press, NY, 1964)) and codon usage patterns (Sharp
et al. (1988) Nucl. Acids Res. 16:8207-8211) of the primate BRCA1
genes shows no significant differences from average mammalian
values.
[0253] This demonstration of strong positive selection on the human
BRCA1 gene constitutes the first molecular support for a theory
long advanced by anthropologists. Human infants require, and
receive, prolonged periods of post-birth care--longer than in any
of our close primate relatives. Short, R. V. (1976) Proc. R. Soc.
Land. B 195:3-24, first postulated that human females can only
furnish such extended care to human infants in the context of a
long term pair bond with a male partner who provides assistance.
The maintenance of long term pair bonds was strengthened by
development of exaggerated (as compared to our close primate
relatives) human secondary sex characteristics including enlarged
female breasts (Short (1976), supra). Thus, strong selective
pressures resulted in development of enlarged human breasts which
develop prior to first pregnancy and lactation, contrary to the
pattern seen in our hominoid relatives (Dixson, A. F. in Primate
Sexuality: Comparative Studies of the Prosimians, Monkeys, Apes and
Human Beings. 214 (Oxford Univ. Press, Oxford, 1998)).
[0254] Evidence suggests that in addition to its function as a
tumor suppressor (Xu et al. (1999) Mol. Cell 3(3):389-395; Shen et
al. (1998) Oncogene 17(24):3115-3124; Dennis, C. (1999) Nature
Genetics 22:10; and Xu et al. (1999) Nature Genetics 22:37-43), the
BRCA1 protein plays an important role in normal development of
breast tissue (Dennis, C. (1999), supra; Xu et al. (1999) Nature
Genetics 22:37-43; and Thompson et al. (1999) Nature Genetics
9:444-450), particularly attainment of typical mammary gland and
duct size (Dennis, C. (1999), supra; and Xu et al. (1999) Nature
Genetics 22:37-43). These facts suggest that positive selection on
this gene in humans promoted expansion of the female human breast,
and ultimately, helped promote long term care of dependent human
infants. This long term dependency of human infants was essential
for the development and transmission of complex human culture.
Because positive selection seems to have been concentrated upon
exon 11 of BRCA1, the prediction follows that the region of the
BRCA1 protein encoded by exon 11 specifically plays a role in
normal breast development. The data provided here suggests that
strong selective pressures during human evolution led to amino acid
replacements in B RCA 0.1 that promoted a unique pattern of breast
development in human females, which facilitated the evolution of
some human behaviors.
Example 15
Characterization of BRCA1 Polynucleotide and Polypeptide
[0255] Having identified evolutionarily significant nucleotide
changes in the BRCA1 gene and corresponding amino acid changes in
the BRCA1 protein, the next step is to test these molecules in a
suitable model system to analyze the functional effect of the
nucleotide and amino acid changes on the model. For example, the
human BRCA1 polynucleotide can be transfected into a cultured host
cell such as adipocytes to determine its effect on cell growth or
replication.
Example 16
Identification of Positively-Selected CD59
[0256] Comparative evolutionary analysis of the CD59 genes of
several primate species has revealed that the chimpanzee CD59 gene
has been subjected to positive selection. CD59 protein is also
known as protectin, 1F-5Ag, H19, HRF20, MACIF, MIRL, and P-18. CD59
is expressed on all peripheral blood leukocytes and erythrocytes
(Meri et al. (1996) Biochem. J. 316:923-935). Its function is to
restrict lysis of human cells by complement (Meri et al. (1996),
supra). More specifically, CD59 acts as one of the inhibitors of
membrane attack complexes (MACs). MACs are complexes of 20 some
complement proteins that make hole-like lesions in cell membranes
(Meri et al. (1996), supra). These MACs, in the absence of proper
restrictive elements (i.e., CD59 and a few other proteins) would
destroy host cells as well as invading pathogens. Essentially then,
CD59 protects the cells of the body from the complement arm of its
own defense systems (Meri et al. (1996), supra). The chimpanzee
homolog of this protein was examined because the human homolog has
been implicated in progression to AIDS in infected individuals. It
has been shown that CD59 is one of the host cell derived proteins
that is selectively taken up by HIV virions (Frank et al. (1996)
AIDS 10:1611-1620). Additionally, it has been shown (Saifuddin et
al. (1995) J. Exp. Med. 182:501-509) that HIV virions which have
incorporated host cell CD59 are protected from the action of
complement. Thus it appears that in humans, HIV uses CD59 to
protect itself from attack by the victim=s immune system, and thus
to further the course of infection.
[0257] To obtain primate CD59 cDNA sequences, total RNA was
prepared (using either the RNeasy.RTM. kit (Qiagen), or the
RNAse-free Rapid Total RNA kit (5 Prime-3 Prime, Inc.)) from
primate tissues (whole fresh blood from chimpanzees, gorillas, and
orangutans). mRNA was isolated from total RNA using the
Mini-Oligo(dT) Cellulose Spin Columns (5 Prime-3 Prime, Inc.). cDNA
was synthesized from mRNA with oligo dT and/or random priming using
the SuperScript Preamplification System for First Strand cDNA
Synthesis (Gibco BRL). The protein-coding region of the primate
CD59 gene was amplified from cDNA using primers (concentration=100
nmole/.mu.l) designed from the published human sequence. PCR
conditions for CD59 amplification were 94EC initial pre-melt (4
min), followed by 35 cycles of 94EC (15 see), 58EC (1 min 15 see),
72EC (1 min 15 sec), and a final 72EC extension for 10 minutes. PCR
was accomplished on a Perkin-Elmer GeneAmp7 PCR System 9700
thermocycler, using Ready-to-Go PCR beads (Amersham Pharmacia
Biotech) in a 50 .mu.l total reaction volume. Appropriately-sized
products were purified from agarose gels using the QiaQuick Gel
Extraction kit (Qiagen). Both strands of the amplification products
were sequenced directly using the Big Dye Cycle Sequencing Kit and
analyzed on a 373A DNA sequencer (ABI BioSystems).
[0258] As shown in Table 6, all comparisons to the chimpanzee CD59
sequence display K.sub.A/K.sub.S ratios greater than one,
demonstrating that it is the chimpanzee CD59 gene that has been
positively-selected.
TABLE-US-00009 TABLE 6 K.sub.A/K.sub.S Ratios for Selected Primate
CD59 cDNA Sequences Genes Compared K.sub.A/K.sub.S Ratios
Chimpanzee to Human 1.8 Chimpanzee to Gorilla 1.5 Chimpanzee to
Orangutan 2.3 Chimpanzee to Green Monkey 3.0
Example 17
Characterization of CD59 Positively-Selected Sequences
[0259] Proceeding on the hypothesis that strong selection pressure
has resulted in adaptive changes in the chimpanzee CD59 molecule
such that disease progression is retarded retarded because the
virus is unable to usurp CD59=s protective role for itself, it then
follows that comparisons of the CD59 gene of other closely-related
non-human primates to the human gene should display K.sub.A/K.sub.S
ratios less than one for those species that have not been
confronted by the HIV-1 virus over evolutionary periods.
Conversely, all comparisons to the chimpanzee gene should display
K.sub.A/K.sub.S ratios greater than one. These two tests, taken
together, will definitively establish whether the chimpanzee or
human gene was positively selected. Although the gorilla (Gorilla
gorilla) is the closest relative to humans and chimpanzees, its
postulated historical range in Africa suggests that gorillas could
have been at some time exposed to the HIV-1 virus. We thus examined
the CD59 gene from both the gorilla and the orangutan (Pongo
pygmaeus). The latter species, confined to Southeast Asia, is
unlikely to have been exposed to HIV over an evolutionary time
frame. The nucleotide sequences of the human and orangutan genes
were determined by direct sequencing of cDNAs prepared from RNA
previously isolated from whole fresh blood taken from these two
species.
[0260] The next step is to determine how chimpanzee CD59
contributes to chimpanzee resistance to progression to full-blown
AIDS using assays of HIV replication in cell culture. Human white
blood cell lines, transfected with, and expressing, the chimpanzee
CD59 protein, should display reduced rates of viral replication
(using standard assays familiar to practitioners of the art) as
compared to control lines of untransfected human cells. In
contrast, chimpanzee white blood cell lines expressing human CD59
should display increased viral loads as compared to control,
untransfected chimpanzee cell lines.
Example 18
Molecular Modeling of CD59
[0261] Modeling of the inferred chimpanzee protein sequence of CD59
upon the known three-dimensional structure of human (Merl et al.
1996 Biochem J. 316:923-935) has provided additional evidence for
the role of this protein in explaining chimpanzee resistance to
AIDS progression. It has been shown that in human CD59, residue Asn
77 is the link for the GPI anchor (Meri et al. (1996) Biochem J.
316:923-935), which is essential for function of the protein. The
GPI anchor is responsible for anchoring the protein to the cell
membrane (Meri et al. (1996), supra). Our sequencing of the
chimpanzee CD59 gene reveals that the inferred protein structure of
chimpanzee CD59 contains a duplication of the section of the
protein that contains the GPI link, i.e., NEQLENGG (see Table 7 and
FIG. 10).
TABLE-US-00010 TABLE 7 Comparison of Human and Chimpanzee CD59
Amino Acid Sequence Human SLQCYNCPNP TADCKTAVNC SSDFDACLIT
KAGLQVYNYC Chimpanzee SLQCYNCPNP TADCKTAVNC SSDFDACLIT KAGLQVYNKC
Human WKFEHCNFND VTTRLRENEL TYYCCKKDLC NFNEQLENGG Chimpanzee
WKLEHCNFKD LTTRLRENEL TYYCCKKDLC NFNEQLENGG Human
-----------------TSLS EKTVLLLVTP FLAAAAWSLHP Chimpanzee NEQLENGGNE
QLENGGTSLS EKTVLLRVTP FLAAAAWSLHP Human (SEQ ID NO: 12) Chimpanzee
(SEQ ID NO: 13) Italics/underline indicates variation in amino
acids.
[0262] This suggests that while the basic function of CD59 is most
likely conserved between chimpanzee and human, some changes have
probably occurred in the orientation of the protein with respect to
the cell membrane. This may render the chimpanzee protein unusable
to the HIV virion when it is incorporated by the virion.
Alternatively, the chimpanzee protein may not be subject to
incorporation by the HIV virion, in contrast to the human CD59.
Either of these (testable) alternatives would likely mean that in
the chimpanzee, HIV virions are subject to attack by MAC complexes.
This would thus reduce amounts of virus available to replicate, and
thus contribute to chimpanzee resistance to progression to
full-blown AIDS. Once these alternatives have been tested to
determine which is correct, then the information can be used to
design a therapeutic intervention for infected humans that mimics
the chimpanzee resistance to progression to full-blown AIDS.
Example 19
Identification of Positively-Selected DC-SIGN
[0263] Comparative evolutionary analyses of DC-SIGN genes of human,
chimpanzee and gorilla have revealed that the chimpanzee DC-SIGN
gene has been subjected to positive selection. FIGS. 11-13 (SEQ.
ID. NOS. 6-8) show the nucleotide sequences of human, chimpanzee
and gorilla DC-SIGN genes, respectively. Table 8 provides the
K.sub.A/K.sub.S values calculated by pairwise comparison of the
human, chimpanzee and gorilla DC-SIGN genes. Note that only those
comparisons with chimpanzee show K.sub.A/K.sub.S values greater
than one, indicating that the chimpanzee gene has been positively
selected.
TABLE-US-00011 TABLE 8 K.sub.A/K.sub.S Ratios for Selected Primate
DC-SIGN cDNA Sequences Genes Compared K.sub.A/K.sub.S Ratios
Chimpanzee to Human 1.3 Human to Gorilla 0.87 Chimpanzee to Gorilla
1.3
[0264] As discussed herein, DC-SIGN is expressed on dendritic cells
and is known to provide a mechanism for transport of HIV-1 virus to
the lymph nodes. HIV-1 binds to the extracellular portion of
DC-SIGN and infects the undifferentiated T cells in the lymph nodes
via their CD4 proteins. This expansion in infection ultimately
leads to compromise of the immune system and subsequently to
full-blown AIDS. Interestingly, DC-SIGNS's major ligand appears to
be ICAM-3. As described herein, chimpanzee ICAM-3 shows the highest
K.sub.A/K.sub.S ratio of any known AIDS-related protein. It is not
yet clear whether positive selection on chimpanzee ICAM-3 was a
result of compensatory changes that allow ICAM-3 to retain its
ability to bind to DC-SIGN.
Example 20
Detection of Positive Selection upon Chimpanzee p44
[0265] As is often true, whole protein comparisons for human and
chimpanzee p44 display K.sub.A/K.sub.S ratios less than one. This
is because the accumulated "noise" of silent substitutions in the
full-length CDS can obscure the signal of positive selection if it
has occurred in a small section of the protein. However,
examination of exon 2 of the chimpanzee and human homologs reveals
that this portion of the gene (and the polypeptide it codes for)
has been positively selected. The K.sub.A/K.sub.S ratio for exon 2
is 1.5 (P<0.05). Use of this invention allowed identification of
the specific region of the protein that has been positively
selected.
[0266] Two alleles of p44 were detected in chimpanzees that differ
by a single synonymous substitution (see FIG. 16). For human to
chimpanzee, the whole protein K.sub.A/K.sub.S ratio for allele A is
0.42, while the ratio for allele B is 0.45.
[0267] In FIG. 16, the CDS of human (Ace. NM.sub.--006417) and
chimpanzee (Ace. D90034) p44 gene are aligned, with the positively
selected exon 2 underlined (note that exon 2 begins at the start of
the CDS, as exon 1 is non-coding.). Human is labeled Hs (Homo
sapiens), chimpanzee is labeled Pt (Pan troglodytes). Nonsynonymous
differences between the two sequences are in bold, synonymous
differences are in italics. Chimpanzee has a single heterozygous
base (position 212), shown as "M", using the IUPAC code to signify
either adenine ("A") or cytosine ("C"). Note that one of these
("C") represents a nonsynonymous difference from human, while "A"
is identical to the same position in the human homolog. Thus these
two chimpanzee alleles differ slightly in their K.sub.A/K.sub.S
ratios relative to human p44.
Example 21
Methods for Screening Agents that May be Useful in Treatment of HCV
in Humans
[0268] Candidate agents can be screened in vitro for interaction
with purified p44, especially exon 2. Candidate agents can be
designed to interact with human p44 exon 2 so that human p44 can
mimic the structure and/or function of chimpanzee p44. Human and
chimpanzee p44 are known and can be synthesized using methods known
in the art.
[0269] Molecular modeling of small molecules to dock with their
targets, computer assisted new lead design, and computer assisted
drug discovery are well known in the art and are described, e.g.,
in Cohen, N. C. (ed.) Guidebook on Molecular Modeling in Drug
Design, Academic Press (1996). Additionally, there are numerous
commercially available available molecular modeling software
packages.
[0270] Affinity chromatography can be used to partition candidate
agents that bind in vitro to human p44 (especially exon 2) from
those that do not. It may also be useful to partition candidate
agents that no only bind to human p44 exon 2, but also do not bind
to chimpanzee p44 exon 2, so as to eliminate those agents that are
not specific to the human p44 exon 2.
[0271] Optionally, x-ray crystallography structures of p44-agent
complexes can be compared to x-ray structures of human p44 and
chimpanzee p44 to determine if the human p44-agent complexes more
closely resemble x-ray structures of chimpanzee p44 structures.
[0272] Further, candidate agents can be screened for favorable
interactions with p44 during HCV infection of hepatocytes in vitro.
Fournier et al. (1998) J. Gen. Virol. 79:2367 report that adult
normal human hepatocytes in primary culture can be successfully
infected with HCV and used as an in vitro HCV model (see also Rumin
et al. (1999) J. Gen. Virology 80:3007). Favre et al. (2001) CR
Acad. Sci. III 324(12):1141-8, report that a robust in vitro
infection of hepatocytes with HCV is facilitated by removal of
cell-bound lipoproteins prior to addition of viral inocula from
human sera. Further, Kitamura et al. (1994) Eur. J. Biochem.
224:877-83, report that IFN.alpha./.beta. induces human p44 gene in
hepatocytes in vitro. The p44 protein is produced in vivo in
infected human livers (Patzwahl, R. et al. (2000) J. Virology
75(3):1332). While it is presently not clear if p44 is produced by
human hepatocytes in vitro during HCV infection, if it is not,
IFN.alpha./.beta. could be added to induce p44. This in vitro
system could serve as a suitable model for screening candidate
agents for their capacity to favorably interact with human p44 in
HCV infected hepatocytes.
[0273] An assay for favorable interaction of candidate agents with
p44 in in vitro cultured cells could be the enhancement of p44
assembly into microtubules in the cultured hepatocytes. Assembled
chimpanzee p44 microtubular aggregates associated with NANB
hepatitis infection in chimpanzees have been detected by antibodies
described in Takahashi, K. et al. (1990) J. Gen. Virology
71(Pt9):2005-11. These antibodies may be useful in detecting human
p44 microtubular aggregates. Alternatively, antibodies to human p44
can be made using methods known in the art.
[0274] A direct link between enhanced p44 microtubular assembly and
increased resistance to HCV infection in chimpanzees or humans is
not known at this time. However, the literature does indicate that
increased p44 microtubular assembly is associated with HCV
infection in chimpanzees, and chimpanzees are able to resist HCV
infection. Specifically, Patzwahl, R. et al. (2000) J. Virology
75:1332-38, reports that p44 is a "component of the double-walled
membranous tubules which appear as a distinctive alteration in the
cytoplasm of hepatocytes after intravenous administration of human
non-A, non-B (NANB) hepatitis inocula in chimpanzees." Likewise,
Takahashi, K. et al. (1990) J. Gen. Virology 71(Pt9):2005-11,
report that p44 is expressed in NANB hepatitis infected chimpanzees
and is a host (and not a viral) protein. Additionally, Patzwahl, R.
et al. (2000), supra, report that p44 expression is increased in
HCV infected human livers; it is not clear whether the human p44
assembles into microtubules. Finally, Kitamura, A. et al. (1994)
Eur. J. Biochem. 224:877 suggest at page 882 that "p44 may function
as a mediator of anti-viral activity of interferons against
hepatitis C . . . infection, through association with the
microtubule aggregates."
[0275] A suitable control could be in vitro cultured chimpanzee
hepatocytes that are infected with HCV, and which presumably would
express p44 that assembles into microtubules and resist the HCV
infection.
[0276] The foregoing in vitro model could serve to identify those
candidate agents that interact with human p44 to produce a function
(microtubule assembly or HCV resistance) that is characteristic of
chimpanzee p44 during HCV infection. Candidate agents can also be
screened in in vivo animal models for inhibition of HCV. Several in
vivo human HCV models have been described in the literature.
Mercer, D. et al. (2001) Nat. Med. 7(8):927-33, report that a
suitable small animal model for human HCV is a SCID mouse carrying
a plasminogen activator transgene (Alb-uPA) with transplanted
normal human hepatocytes. The mice have chimeric human livers, and
when HCV is administered via inoculation with infected human serum,
serum viral titres increase. HCV viral proteins were localized were
localized to the human hepatocyte nodules.
[0277] Galun, E. et al. (1995) describe a chimeric mouse model
developed from BNX (beige/nude/X-linked immunodeficient) mice
preconditioned by total body irradiation and reconstituted with
SCID mouse bone marrow cells, into which were implanted
HCV-infected liver fragments from human patients, or normal liver
incubated with HCV serum.
[0278] LaBonte, P. et al. (2002) J. Med. Virol. 66(3):312-9,
describe a mouse model developed by orthotopic implantation of
human hepatocellular carcinoma cells (HCC) into athymic nude mice.
The human tumors produce HCV RNA.
[0279] Any of the foregoing mouse models could be treated with
IFN-.alpha./.beta. to induce p44 production (if necessary), and
candidate agents could be added to detect any inhibition in HCV
infection by, e.g., reduction in serum viral titer.
[0280] As a control, chimpanzee liver hepatocytes can be implanted
into SCID or another suitable mouse to create a chimeric liver, and
infected with HCV. Presumably, the chimp livers in the control
mouse model would express p44 and be more resistant to HCV
infection.
[0281] The experimental mice with the human hepatocytes are
administered candidate agents and the course of the HCV infection
(e.g., viral titres) is then monitored in the control and
experimental models. Those agents that improve resistance in the
experimental mice to the point where the human p44 function
approaches (or perhaps exceeds) the chimpanzee p44 function in the
control mouse model, are agents that may be suitable for human
clinical trials.
[0282] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
and understanding, it will be apparent to those of ordinary skill
in the art that certain changes and modifications can be practiced.
Therefore, the description and examples should not be construed as
limiting the scope of the invention, which is delineated by the
appended claims.
Sequence CWU 1
1
3611518DNAHomo sapiens 1cagacatctg tgtccccctc aaaagtcatc ctgccccggg
gaggctccgt gctggtgaca 60tgcagcacct cctgtgacca gcccaagttg ttgggcatag
agaccccgtt gcctaaaaag 120gagttgctcc tgcctgggaa caaccggaag
gtgtatgaac tgagcaatgt gcaagaagat 180agccaaccaa tgtgctattc
aaactgccct gatgggcagt caacagctaa aaccttcctc 240accgtgtact
ggactccaga acgggtggaa ctggcacccc tcccctcttg gcagccagtg
300ggcaagaacc ttaccctacg ctgccaggtg gagggtgggg caccccgggc
caacctcacc 360gtggtgctgc tccgtgggga gaaggagctg aaacgggagc
cagctgtggg ggagcccgct 420gaggtcacga ccacggtgct ggtgaggaga
gatcaccatg gagccaattt ctcgtgccgc 480actgaactgg acctgcggcc
ccaagggctg gagctgtttg agaacacctc ggccccctac 540cagctccaga
cctttgtcct gccagcgact cccccacaac ttgtcagccc ccgggtccta
600gaggtggaca cgcaggggac cgtggtctgt tccctggacg ggctgttccc
agtctcggag 660gcccaggtcc acctggcact gggggaccag aggttgaacc
ccacagtcac ctatggcaac 720gactccttct cggccaaggc ctcagtcagt
gtgaccgcag aggacgaggg cacccagcgg 780ctgacgtgtg cagtaatact
ggggaaccag agccaggaga cactgcagac agtgaccatc 840tacagctttc
cggcgcccaa cgtgattctg acgaagccag aggtctcaga agggaccgag
900gtgacagtga agtgtgaggc ccaccctaga gccaaggtga cgctgaatgg
ggttccagcc 960cagccactgg gcccgagggc ccagctcctg ctgaaggcca
ccccagagga caacgggcgc 1020agcttctcct gctctgcaac cctggaggtg
gccggccagc ttatacacaa gaaccagacc 1080cgggagcttc gtgtcctgta
tggcccccga ctggacgaga gggattgtcc gggaaactgg 1140acgtggccag
aaaattccca gcagactcca atgtgccagg cttgggggaa cccattgccc
1200gagctcaagt gtctaaagga tggcactttc ccactgccca tcggggaatc
agtgactgtc 1260actcgagatc ttgagggcac ctacctctgt cgggccagga
gcactcaagg ggaggtcacc 1320cgcgaggtga ccgtgaatgt gctctccccc
cggtatgaga ttgtcatcat cactgtggta 1380gcagccgcag tcataatggg
cactgcaggc ctcagcacgt acctctataa ccgccagcgg 1440aagatcaaga
aatacagact acaacaggcc caaaaaggga cccccatgaa accgaacaca
1500caagccacgc ctccctga 151821518DNAPan troglodytesCDS(1)..(1518)
2cag aca tct gtg tcc ccc cca aaa gtc atc ctg ccc cgg gga ggc tcc
48Gln Thr Ser Val Ser Pro Pro Lys Val Ile Leu Pro Arg Gly Gly Ser1
5 10 15gtg cag gtg aca tgc agc acc tcc tgt gac cag ccc gac ttg ttg
ggc 96Val Gln Val Thr Cys Ser Thr Ser Cys Asp Gln Pro Asp Leu Leu
Gly 20 25 30ata gag acc ccg ttg cct aaa aag gag ttg ctt ctg ggt ggg
aac aac 144Ile Glu Thr Pro Leu Pro Lys Lys Glu Leu Leu Leu Gly Gly
Asn Asn 35 40 45tgg aag gtg tat gaa ctg agc aat gtg caa gaa gat agc
caa cca atg 192Trp Lys Val Tyr Glu Leu Ser Asn Val Gln Glu Asp Ser
Gln Pro Met 50 55 60tgc tat tca aac tgc cct gat ggg cag tca aca gct
aaa acc ttc ctc 240Cys Tyr Ser Asn Cys Pro Asp Gly Gln Ser Thr Ala
Lys Thr Phe Leu65 70 75 80acc gtg tac tgg act cca gaa cgg gtg gaa
ctg gca ccc ctc ccc tct 288Thr Val Tyr Trp Thr Pro Glu Arg Val Glu
Leu Ala Pro Leu Pro Ser 85 90 95tgg cag cca gtg ggc aag gac ctt acc
cta cgc tgc cag gtg gag ggt 336Trp Gln Pro Val Gly Lys Asp Leu Thr
Leu Arg Cys Gln Val Glu Gly 100 105 110ggg gca ccc cgg gcc aac ctc
acc gtg gtg ctg ctc cgt ggg gag aag 384Gly Ala Pro Arg Ala Asn Leu
Thr Val Val Leu Leu Arg Gly Glu Lys 115 120 125gag ctg aaa cgg gag
cca gct gtg ggg gag ccc gct gag gtc acg acc 432Glu Leu Lys Arg Glu
Pro Ala Val Gly Glu Pro Ala Glu Val Thr Thr 130 135 140acg gtg ctg
gtg gag aga gat cac cat gga gcc aat ttc tcg tgc cgc 480Thr Val Leu
Val Glu Arg Asp His His Gly Ala Asn Phe Ser Cys Arg145 150 155
160act gaa ctg gac ctg cgg ccc caa ggg ctg cag ctg ttt gag aac acc
528Thr Glu Leu Asp Leu Arg Pro Gln Gly Leu Gln Leu Phe Glu Asn Thr
165 170 175tcg gcc ccc cac cag ctc caa acc ttt gtc ctg cca gcg act
ccc cca 576Ser Ala Pro His Gln Leu Gln Thr Phe Val Leu Pro Ala Thr
Pro Pro 180 185 190caa ctt gtc agc ccc cgg gtc cta gag gtg gac acg
cag ggg acc gtg 624Gln Leu Val Ser Pro Arg Val Leu Glu Val Asp Thr
Gln Gly Thr Val 195 200 205gtc tgt tcc ctg gac ggg ctg ttc cca gtc
tcg gag gcc cag gtc cac 672Val Cys Ser Leu Asp Gly Leu Phe Pro Val
Ser Glu Ala Gln Val His 210 215 220ctg gca ctg ggg gac cag agg ttg
aac ccc aca gtc acc tat ggc aat 720Leu Ala Leu Gly Asp Gln Arg Leu
Asn Pro Thr Val Thr Tyr Gly Asn225 230 235 240gac tcc ttc tcg gcc
aag gcc tca gtc agt gtg acc gca gag gac gag 768Asp Ser Phe Ser Ala
Lys Ala Ser Val Ser Val Thr Ala Glu Asp Glu 245 250 255ggc acc cag
cgg ctg acg tgt gca gta ata ctg ggg aac cag agc cgg 816Gly Thr Gln
Arg Leu Thr Cys Ala Val Ile Leu Gly Asn Gln Ser Arg 260 265 270gag
aca ctg cag aca gtg acc atc tac agc ttt ccg gcg ccc aac gtg 864Glu
Thr Leu Gln Thr Val Thr Ile Tyr Ser Phe Pro Ala Pro Asn Val 275 280
285att ctg acg aag cca gag gtc tca gaa ggg acc gag gtg aca gtg aag
912Ile Leu Thr Lys Pro Glu Val Ser Glu Gly Thr Glu Val Thr Val Lys
290 295 300tgt gag gcc cac cct aga gcc aag gtg acg ctg aat ggg gtt
cca gcc 960Cys Glu Ala His Pro Arg Ala Lys Val Thr Leu Asn Gly Val
Pro Ala305 310 315 320cag cca gtg ggc ccg agg gtc cag ctc ctg ctg
aag gcc acc cca gag 1008Gln Pro Val Gly Pro Arg Val Gln Leu Leu Leu
Lys Ala Thr Pro Glu 325 330 335gac aac ggg cgc agc ttc tcc tgc tct
gca acc ctg gag gtg gcc ggc 1056Asp Asn Gly Arg Ser Phe Ser Cys Ser
Ala Thr Leu Glu Val Ala Gly 340 345 350cag ctt ata cac aag aac cag
acc cgg gag ctt cgt gtc ctg tat ggc 1104Gln Leu Ile His Lys Asn Gln
Thr Arg Glu Leu Arg Val Leu Tyr Gly 355 360 365ccc cga ctg gac gag
agg gat tgt ccg gga aac tgg acg tgg cca gaa 1152Pro Arg Leu Asp Glu
Arg Asp Cys Pro Gly Asn Trp Thr Trp Pro Glu 370 375 380aat tcc cag
cag act cca atg tgc cag gct tcg ggg aac cca ttg ccc 1200Asn Ser Gln
Gln Thr Pro Met Cys Gln Ala Ser Gly Asn Pro Leu Pro385 390 395
400gag ctc aag tgt cta aag gat ggc act ttc cca ctg ccc gtc ggg gaa
1248Glu Leu Lys Cys Leu Lys Asp Gly Thr Phe Pro Leu Pro Val Gly Glu
405 410 415tca gtg act gtc act cga gat ctt gag ggc acc tac ctc tgt
cgg gcc 1296Ser Val Thr Val Thr Arg Asp Leu Glu Gly Thr Tyr Leu Cys
Arg Ala 420 425 430agg agc act caa ggg gag gtc acc cgc aag gtg acc
gtg aat gtg ctc 1344Arg Ser Thr Gln Gly Glu Val Thr Arg Lys Val Thr
Val Asn Val Leu 435 440 445tcc ccc cgg tat gag att gtc atc atc act
gtg gta gca gcc gca gtc 1392Ser Pro Arg Tyr Glu Ile Val Ile Ile Thr
Val Val Ala Ala Ala Val 450 455 460ata atg ggc act gca ggc ctc agc
acg tac ctc tat aac cgc cag cgg 1440Ile Met Gly Thr Ala Gly Leu Ser
Thr Tyr Leu Tyr Asn Arg Gln Arg465 470 475 480aag atc agg aaa tac
aga cta caa cag gct caa aaa ggg acc ccc atg 1488Lys Ile Arg Lys Tyr
Arg Leu Gln Gln Ala Gln Lys Gly Thr Pro Met 485 490 495aaa ccg aac
aca caa gcc acg cct ccc tga 1518Lys Pro Asn Thr Gln Ala Thr Pro Pro
500 5053505PRTPan troglodytes 3Gln Thr Ser Val Ser Pro Pro Lys Val
Ile Leu Pro Arg Gly Gly Ser1 5 10 15Val Gln Val Thr Cys Ser Thr Ser
Cys Asp Gln Pro Asp Leu Leu Gly 20 25 30Ile Glu Thr Pro Leu Pro Lys
Lys Glu Leu Leu Leu Gly Gly Asn Asn 35 40 45Trp Lys Val Tyr Glu Leu
Ser Asn Val Gln Glu Asp Ser Gln Pro Met 50 55 60Cys Tyr Ser Asn Cys
Pro Asp Gly Gln Ser Thr Ala Lys Thr Phe Leu65 70 75 80Thr Val Tyr
Trp Thr Pro Glu Arg Val Glu Leu Ala Pro Leu Pro Ser 85 90 95Trp Gln
Pro Val Gly Lys Asp Leu Thr Leu Arg Cys Gln Val Glu Gly 100 105
110Gly Ala Pro Arg Ala Asn Leu Thr Val Val Leu Leu Arg Gly Glu Lys
115 120 125Glu Leu Lys Arg Glu Pro Ala Val Gly Glu Pro Ala Glu Val
Thr Thr 130 135 140Thr Val Leu Val Glu Arg Asp His His Gly Ala Asn
Phe Ser Cys Arg145 150 155 160Thr Glu Leu Asp Leu Arg Pro Gln Gly
Leu Gln Leu Phe Glu Asn Thr 165 170 175Ser Ala Pro His Gln Leu Gln
Thr Phe Val Leu Pro Ala Thr Pro Pro 180 185 190Gln Leu Val Ser Pro
Arg Val Leu Glu Val Asp Thr Gln Gly Thr Val 195 200 205Val Cys Ser
Leu Asp Gly Leu Phe Pro Val Ser Glu Ala Gln Val His 210 215 220Leu
Ala Leu Gly Asp Gln Arg Leu Asn Pro Thr Val Thr Tyr Gly Asn225 230
235 240Asp Ser Phe Ser Ala Lys Ala Ser Val Ser Val Thr Ala Glu Asp
Glu 245 250 255Gly Thr Gln Arg Leu Thr Cys Ala Val Ile Leu Gly Asn
Gln Ser Arg 260 265 270Glu Thr Leu Gln Thr Val Thr Ile Tyr Ser Phe
Pro Ala Pro Asn Val 275 280 285Ile Leu Thr Lys Pro Glu Val Ser Glu
Gly Thr Glu Val Thr Val Lys 290 295 300Cys Glu Ala His Pro Arg Ala
Lys Val Thr Leu Asn Gly Val Pro Ala305 310 315 320Gln Pro Val Gly
Pro Arg Val Gln Leu Leu Leu Lys Ala Thr Pro Glu 325 330 335Asp Asn
Gly Arg Ser Phe Ser Cys Ser Ala Thr Leu Glu Val Ala Gly 340 345
350Gln Leu Ile His Lys Asn Gln Thr Arg Glu Leu Arg Val Leu Tyr Gly
355 360 365Pro Arg Leu Asp Glu Arg Asp Cys Pro Gly Asn Trp Thr Trp
Pro Glu 370 375 380Asn Ser Gln Gln Thr Pro Met Cys Gln Ala Ser Gly
Asn Pro Leu Pro385 390 395 400Glu Leu Lys Cys Leu Lys Asp Gly Thr
Phe Pro Leu Pro Val Gly Glu 405 410 415Ser Val Thr Val Thr Arg Asp
Leu Glu Gly Thr Tyr Leu Cys Arg Ala 420 425 430Arg Ser Thr Gln Gly
Glu Val Thr Arg Lys Val Thr Val Asn Val Leu 435 440 445Ser Pro Arg
Tyr Glu Ile Val Ile Ile Thr Val Val Ala Ala Ala Val 450 455 460Ile
Met Gly Thr Ala Gly Leu Ser Thr Tyr Leu Tyr Asn Arg Gln Arg465 470
475 480Lys Ile Arg Lys Tyr Arg Leu Gln Gln Ala Gln Lys Gly Thr Pro
Met 485 490 495Lys Pro Asn Thr Gln Ala Thr Pro Pro 500
50541515DNAGorilla gorilla 4cagacatctg tgtccccccc aaaagtcatc
ctgccccggg gaggctccgt gctggtgaca 60tgcagcacct cctgtgacca gcccaccttg
ttgggcatag agaccccgtt gcctaaaaag 120gagttgctcc tgcttgggaa
caaccagaag gtgtatgaac tgagcaatgt gcaagaagat 180agccaaccaa
tgtgttattc aaactgccct gatgggcagt caacagctaa aaccttcctc
240accgtgtact ggactccaga acgggtggaa ctggcacccc tcccctcttg
gcagccagtg 300ggcaaggacc ttaccctacg ctgccaggtg gagggtgggg
caccccgggc caacctcatc 360gtggtgctgc tccgtgggga ggaggagctg
aaacgggagc cagctgtggg ggagcccgcc 420gaggtcacga ccacggtgcc
ggtggagaaa gatcaccatg gagccaattt cttgtgccgc 480actgaactgg
acctgcggcc ccaagggctg aagctgtttg agaacacctc ggccccctac
540cagctccaaa cctttgtcct gccagcgact cccccacaac ttgtcagccc
tcgggtccta 600gaggtggaca cgcaggggac tgtggtctgt tccctggacg
ggctgttccc agtctcggag 660gcccaggtcc acctggcact gggggaccag
aggttgaacc ccacagtcac ctatggcaac 720gactccttct cagccaaggc
ctcagtcagt gtgaccgcag aggacgaggg cacccagtgg 780ctgacgtgtg
cagtaatact ggggacccag agccaggaga cactgcagac agtgaccatc
840tacagctttc cggcacccaa cgtgattctg acgaagccag aggtctcaga
agggaccgag 900gtgacagtga agtgtgaggc ccaccctaga gccaaggtga
cactgaatgg ggttccagcc 960cagccaccgg gcccgaggac ccagttcctg
ctgaaggcca ccccagagga caacgggcgc 1020agcttctcct gctctgcaac
cctggaggtg gccggccagc ttatacacaa gaaccagacc 1080cgggagcttc
gtgtcctgta tggcccccga ctggatgaga gggattgtcc gggaaactgg
1140acgtggccag aaaattccca gcagactcca atgtgccagg cttgggggaa
cccattgccc 1200gagctcaagt gtctaaagga tggcactttc ccactgcccg
tcggggaatc agtgactgtc 1260actcgagatc ttgagggcac ctacctctgt
cgggccagga gcactcaagg ggaggtcacc 1320cgcgaggtga ccgtgaatgt
gctctccccc cggtatgagt ttgtcatcat cgctgtggta 1380gcagccgcag
tcataatggg cactgcaggc ctcagcacgt acctctataa ccgccagcgg
1440aagatcagga aatacagact acaacaggct caaaaaggga cccccatgaa
accgaacaca 1500caagccacgc ctccc 151551515DNAPongo pygmaeus
5cacacatctg tgtcctccgc caacgtcttc ctgccccggg gaggctccgt gctagtgaat
60tgcagcacct cctgtgacca gcccaccttg ttgggcatag agaccccgtt gcctaaaaag
120gagttgctcc cgggtgggaa caactggaag atgtatgaac tgagcaatgt
gcaagaagat 180agccaaccaa tgtgctattc aaactgccct gatgggcagt
cagcagctaa aaccttcctc 240accgtgtact ggactccaga acgggtggaa
ctggcacccc tcccctcttg gcagccagtg 300ggcaagaacc ttaccctacg
ctgccaggtg gagggtgggg caccccgggc caacctcacc 360gtggtattgc
tccgtgggga ggaggagctg agccggcagc cagcggtggg ggagcccgcc
420gaggtcacgg ccacggtgct ggcgaggaaa gatgaccacg gagccaattt
ctcgtgccgc 480actgaactgg acctgcggcc ccaagggctg gagctgtttg
agaacacctc ggccccccac 540cagctccaaa cctttgtcct gccagcgact
cccccacaac ttgtcagccc ccgggtccta 600gaggtggaca cgcaggggac
cgtggtctgt tccctggacg ggctgttccc agtctcggag 660gcccaggtcc
acttggcact gggggaccag aggttgaacc ccacagtcac ctatggcgtc
720gactccctct cggccaaggc ctcagtcagt gtgaccgcag aggaggaggg
cacccagtgg 780ctgtggtgtg cagtgatact gaggaaccag agccaggaga
cacggcagac agtgaccatc 840tacagctttc ctgcacccaa cgtgactctg
atgaagccag aggtctcaga agggaccgag 900gtgatagtga agtgtgaggc
ccaccctgca gccaacgtga cgctgaatgg ggttccagcc 960cagccgccgg
gcccgagggc ccagttcctg ctgaaggcca ccccagagga caacgggcgc
1020agcttctcct gctctgcaac cctggaggtg gccggccagc ttatacacaa
gaaccagacc 1080cgggagcttc gagtcctgta tggcccccga ctggacgaga
gggattgtcc gggaaactgg 1140acgtggccag aaaactccca gcagactcca
atgtgccagg cttgggggaa ccccttgccc 1200gagctcaagt gtctaaagga
tggcactttc ccactgccca tcggggaatc agtgactgtc 1260actcgagatc
ttgagggcac ctacctctgt cgggccagga gcactcaagg ggaggtcacc
1320cgcgaggtga ccgtgaatgt gctctccccc cggtatgaga ttgtcatcat
cactgtggta 1380gcagccgcag ccatactggg cactgcaggc ctcagcacgt
acctctataa ccgccagcgg 1440aagatcagga tatacagact acaacaggct
caaaaaggga cccccatgaa accaaacaca 1500caaaccacgc ctccc
15156505PRTHomo sapiens 6Gln Thr Ser Val Ser Pro Ser Lys Val Ile
Leu Pro Arg Gly Gly Ser1 5 10 15Val Leu Val Thr Cys Ser Thr Ser Cys
Asp Gln Pro Lys Leu Leu Gly 20 25 30Ile Glu Thr Pro Leu Pro Lys Lys
Glu Leu Leu Leu Pro Gly Asn Asn 35 40 45Arg Lys Val Tyr Glu Leu Ser
Asn Val Gln Glu Asp Ser Gln Pro Met 50 55 60Cys Tyr Ser Asn Cys Pro
Asp Gly Gln Ser Thr Ala Lys Thr Phe Leu65 70 75 80Thr Val Tyr Trp
Thr Pro Glu Arg Val Glu Leu Ala Pro Leu Pro Ser 85 90 95Trp Gln Pro
Val Gly Lys Asn Leu Thr Leu Arg Cys Gln Val Glu Gly 100 105 110Gly
Ala Pro Arg Ala Asn Leu Thr Val Val Leu Leu Arg Gly Glu Lys 115 120
125Glu Leu Lys Arg Glu Pro Ala Val Gly Glu Pro Ala Glu Val Thr Thr
130 135 140Thr Val Leu Val Arg Arg Asp His His Gly Ala Asn Phe Ser
Cys Arg145 150 155 160Thr Glu Leu Asp Leu Arg Pro Gln Gly Leu Glu
Leu Phe Glu Asn Thr 165 170 175Ser Ala Pro Tyr Gln Leu Gln Thr Phe
Val Leu Pro Ala Thr Pro Pro 180 185 190Gln Leu Val Ser Pro Arg Val
Leu Glu Val Asp Thr Gln Gly Thr Val 195 200 205Val Cys Ser Leu Asp
Gly Leu Phe Pro Val Ser Glu Ala Gln Val His 210 215 220Leu Ala Leu
Gly Asp Gln Arg Leu Asn Pro Thr Val Thr Tyr Gly Asn225 230 235
240Asp Ser Phe Ser Ala Lys Ala Ser Val Ser Val Thr Ala Glu Asp Glu
245 250 255Gly Thr Gln Arg Leu Thr Cys Ala Val Ile Leu Gly Asn Gln
Ser Gln 260 265 270Glu Thr Leu Gln Thr Val Thr Ile Tyr Ser Phe Pro
Ala Pro Asn Val 275 280 285Ile Leu Thr Lys Pro Glu Val Ser Glu Gly
Thr Glu Val Thr Val Lys 290 295 300Cys Glu Ala His Pro Arg Ala Lys
Val Thr Leu Asn Gly Val Pro Ala305 310 315 320Gln Pro Leu Gly Pro
Arg Ala Gln Leu Leu Leu Lys Ala Thr Pro Glu 325 330 335Asp Asn Gly
Arg Ser Phe Ser Cys Ser Ala Thr Leu Glu Val Ala Gly 340 345 350Gln
Leu Ile His Lys Asn Gln Thr Arg Glu Leu Arg Val Leu Tyr Gly
355 360 365Pro Arg Leu Asp Glu Arg Asp Cys Pro Gly Asn Trp Thr Trp
Pro Glu 370 375 380Asn Ser Gln Gln Thr Pro Met Cys Gln Ala Trp Gly
Asn Pro Leu Pro385 390 395 400Glu Leu Lys Cys Leu Lys Asp Gly Thr
Phe Pro Leu Pro Ile Gly Glu 405 410 415Ser Val Thr Val Thr Arg Asp
Leu Glu Gly Thr Tyr Leu Cys Arg Ala 420 425 430Arg Ser Thr Gln Gly
Glu Val Thr Arg Glu Val Thr Val Asn Val Leu 435 440 445Ser Pro Arg
Tyr Glu Ile Val Ile Ile Thr Val Val Ala Ala Ala Val 450 455 460Ile
Met Gly Thr Ala Gly Leu Ser Thr Tyr Leu Tyr Asn Arg Gln Arg465 470
475 480Lys Ile Lys Lys Tyr Arg Leu Gln Gln Ala Gln Lys Gly Thr Pro
Met 485 490 495Lys Pro Asn Thr Gln Ala Thr Pro Pro 500
5057254PRTHomo sapiens 7Ser Asp Glu Lys Val Phe Glu Val His Val Arg
Pro Lys Lys Leu Ala1 5 10 15Val Glu Pro Lys Gly Ser Leu Glu Val Asn
Cys Ser Thr Thr Cys Asn 20 25 30Gln Pro Glu Val Gly Gly Leu Glu Thr
Ser Leu Asp Lys Ile Leu Leu 35 40 45Asp Glu Gln Ala Gln Trp Lys His
Tyr Leu Val Ser Asn Ile Ser His 50 55 60Asp Thr Val Leu Gln Cys His
Phe Thr Cys Ser Gly Lys Gln Glu Ser65 70 75 80Met Asn Ser Asn Val
Ser Val Tyr Gln Pro Pro Arg Gln Val Ile Leu 85 90 95Thr Leu Gln Pro
Thr Leu Val Ala Val Gly Lys Ser Phe Thr Ile Glu 100 105 110Cys Arg
Val Pro Thr Val Glu Pro Leu Asp Ser Leu Thr Leu Phe Leu 115 120
125Phe Arg Gly Asn Glu Thr Leu His Tyr Glu Thr Phe Gly Lys Ala Ala
130 135 140Pro Ala Pro Gln Glu Ala Thr Ala Thr Phe Asn Ser Thr Ala
Asp Arg145 150 155 160Glu Asp Gly His Arg Asn Phe Ser Cys Leu Ala
Val Leu Asp Leu Met 165 170 175Ser Arg Gly Gly Asn Ile Phe His Lys
His Ser Ala Pro Lys Met Leu 180 185 190Glu Ile Tyr Glu Pro Val Ser
Asp Ser Gln Met Val Ile Ile Val Thr 195 200 205Val Val Ser Val Leu
Leu Ser Leu Phe Val Thr Ser Val Leu Leu Cys 210 215 220Phe Ile Phe
Gly Gln His Leu Arg Gln Gln Arg Met Gly Thr Tyr Gly225 230 235
240Val Arg Ala Ala Trp Arg Arg Leu Pro Gln Ala Phe Arg Pro 245
2508518PRTHomo sapiens 8Gln Glu Phe Leu Leu Arg Val Glu Pro Gln Asn
Pro Val Leu Ser Ala1 5 10 15Gly Gly Ser Leu Phe Val Asn Cys Ser Thr
Asp Cys Pro Ser Ser Glu 20 25 30Lys Ile Ala Leu Glu Thr Ser Leu Ser
Lys Glu Leu Val Ala Ser Gly 35 40 45Met Gly Trp Ala Ala Phe Asn Leu
Ser Asn Val Thr Gly Asn Ser Arg 50 55 60Ile Leu Cys Ser Val Tyr Cys
Asn Gly Ser Gln Ile Thr Gly Ser Ser65 70 75 80Asn Ile Thr Val Tyr
Gly Leu Pro Glu Arg Val Glu Leu Ala Pro Leu 85 90 95Pro Pro Trp Gln
Pro Val Gly Gln Asn Phe Thr Leu Arg Cys Gln Val 100 105 110Glu Gly
Gly Ser Pro Arg Thr Ser Leu Thr Val Val Leu Leu Arg Trp 115 120
125Glu Glu Glu Leu Ser Arg Gln Pro Ala Val Glu Glu Pro Ala Glu Val
130 135 140Thr Ala Thr Val Leu Ala Ser Arg Asp Asp His Gly Ala Pro
Phe Ser145 150 155 160Cys Arg Thr Glu Leu Asp Met Gln Pro Gln Gly
Leu Gly Leu Phe Val 165 170 175Asn Thr Ser Ala Pro Arg Gln Leu Arg
Thr Phe Val Leu Pro Val Thr 180 185 190Pro Pro Arg Leu Val Ala Pro
Arg Phe Leu Glu Val Glu Thr Ser Trp 195 200 205Pro Val Asp Cys Thr
Leu Asp Gly Leu Phe Pro Ala Ser Glu Ala Gln 210 215 220Val Tyr Leu
Ala Leu Gly Asp Gln Met Leu Asn Ala Thr Val Met Asn225 230 235
240His Gly Asp Thr Leu Thr Ala Thr Ala Thr Ala Thr Ala Arg Ala Asp
245 250 255Gln Glu Gly Ala Arg Glu Ile Val Cys Asn Val Thr Leu Gly
Gly Glu 260 265 270Arg Arg Glu Ala Arg Glu Asn Leu Thr Val Phe Ser
Phe Leu Gly Pro 275 280 285Ile Val Asn Leu Ser Glu Pro Thr Ala His
Glu Gly Ser Thr Val Thr 290 295 300Val Ser Cys Met Ala Gly Ala Arg
Val Gln Val Thr Leu Asp Gly Val305 310 315 320Pro Ala Ala Ala Pro
Gly Gln Pro Ala Gln Leu Gln Leu Asn Ala Thr 325 330 335Glu Ser Asp
Asp Gly Arg Ser Phe Phe Cys Ser Ala Thr Leu Glu Val 340 345 350Asp
Gly Glu Phe Leu His Arg Asn Ser Ser Val Gln Leu Arg Val Leu 355 360
365Tyr Gly Pro Lys Ile Asp Arg Ala Thr Cys Pro Gln His Leu Lys Trp
370 375 380Lys Asp Lys Thr Arg His Val Leu Gln Cys Gln Ala Arg Gly
Asn Pro385 390 395 400Tyr Pro Glu Leu Arg Cys Leu Lys Glu Gly Ser
Ser Arg Glu Val Pro 405 410 415Val Gly Ile Pro Phe Phe Val Asn Val
Thr His Asn Gly Thr Tyr Gln 420 425 430Cys Gln Ala Ser Ser Ser Arg
Gly Lys Tyr Thr Leu Val Val Val Met 435 440 445Asp Ile Glu Ala Gly
Ser Ser His Phe Val Pro Val Phe Val Ala Val 450 455 460Leu Leu Thr
Leu Gly Val Val Thr Ile Val Leu Ala Leu Met Tyr Val465 470 475
480Phe Arg Glu His Gln Arg Ser Gly Ser Tyr His Val Arg Glu Glu Ser
485 490 495Thr Tyr Leu Pro Leu Thr Ser Met Gln Pro Thr Glu Ala Met
Gly Glu 500 505 510Glu Pro Ser Arg Ala Glu 51591212DNAHomo sapiens
9atgagtgact ccaaggaacc aagactgcag cagctgggcc tcctggagga ggaacagctg
60agaggccttg gattccgaca gactcgagga tacaagagct tagcagggtg tcttggccat
120ggtcccctgg tgctgcaact cctctccttc acgctcttgg ctgggctcct
tgtccaagtg 180tccaaggtcc ccagctccat aagtcaggaa caatccaggc
aagacgcgat ctaccagaac 240ctgacccagc ttaaagctgc agtgggtgag
ctctcagaga aatccaagct gcaggagatc 300taccaggagc tgacccagct
gaaggctgca gtgggtgagc ttccagagaa atctaagctg 360caggagatct
accaggagct gacccggctg aaggctgcag tgggtgagct tccagagaaa
420tctaagctgc aggagatcta ccaggagctg acctggctga aggctgcagt
gggtgagctt 480ccagagaaat ctaagatgca ggagatctac caggagctga
ctcggctgaa ggctgcagtg 540ggtgagcttc cagagaaatc taagcagcag
gagatctacc aggagctgac ccggctgaag 600gctgcagtgg gtgagcttcc
agagaaatct aagcagcagg agatctacca ggagctgacc 660cggctgaagg
ctgcagtggg tgagcttcca gagaaatcta agcagcagga gatctaccag
720gagctgaccc agctgaaggc tgcagtggaa cgcctgtgcc acccctgtcc
ctgggaatgg 780acattcttcc aaggaaactg ttacttcatg tctaactccc
agcggaactg gcacgactcc 840atcaccgcct gcaaagaagt gggggcccag
ctcgtcgtaa tcaaaagtgc tgaggagcag 900aacttcctac agctgcagtc
ttccagaagt aaccgcttca cctggatggg actttcagat 960ctaaatcagg
aaggcacgtg gcaatgggtg gacggctcac ctctgttgcc cagcttcaag
1020cagtattgga acagaggaga gcccaacaac gttggggagg aagactgcgc
ggaatttagt 1080ggcaatggct ggaacgacga caaatgtaat cttgccaaat
tctggatctg caaaaagtcc 1140gcagcctcct gctccaggga tgaagaacag
tttctttctc cagcccctgc caccccaaac 1200ccccctcctg cg 1212101212DNAPan
troglodytes 10atgagtgact ccaaggaacc aagactgcag cagctgggcc
tcctggagga ggaacagctg 60agaggccttg gattccgaca gactcgaggc tacaagagct
tagcagggtg tcttggccat 120ggtcccctgg tgctgcaact cctctccttc
acgctcttgg ctgggctcct tgtccaagtg 180tccaaggtcc ccagctccat
aagtcaggaa gaatccaggc aagacgtgat ctaccagaac 240ctgacccagc
ttaaagctgc agtgggtgag ctctcagaga aatccaagct gcaggagatc
300taccaggagc tgacccagct gaaggctgca gtgggtgagc ttccagagaa
atctaagcag 360caggagatct accaggagct gacccggctg aaggctgcag
tgggtgagct tccagagaaa 420tctaagatgc aggagatcta ccaggagctg
actcggctga aggctgcagt gggtgagctt 480ccagagaaat ctaagatgca
ggagatctac caggagctga ctcggctgaa ggctgcagtg 540ggtgagcttc
cagagaaatc taagcagcag gagatctacc aggagctgac ccagctgaag
600gctgcagtgg gtgagcttcc agagaaatct aagcagcagg agatctacca
ggagctgacc 660cagctgaagg ctgcagtggg tgagcttcca gagaaatcta
agcagcagga gatctaccag 720gagctgaccc ggctgaaggc tgcagtggaa
cgcctgtgcc gccgctgccc ctgggaatgg 780acattcttcc aaggaaactg
ttacttcatg tctaactccc agcggaactg gcacgactcc 840atcactgcct
gcaaagaagt gggggcccag ctcgtcgtaa tcaaaagtgc tgaggagcag
900aacttcctac agctgcagtc ttccagaagt aaccgcttca cctggatggg
actttcagat 960ctaaatgagg aaggcatgtg gcaatgggtg gacggctcac
ctctgttgcc cagcttcaac 1020cagtaytgga acagaggaga gcccaacaac
gttggggagg aagactgcgc ggaatttagt 1080ggcaatggct ggaatgacga
caaatgtaat cttgccaaat tctggatctg caaaaagtcc 1140gcagcctcct
gctccaggga tgaagaacag tttctttctc cagcccctgc caccccaaac
1200ccccctcctg cg 1212111212DNAGorilla gorilla 11atgagtgact
ccaaggaacc aagactgcag cagctgggcc tcctggagga ggaacagctg 60agaggccttg
gattccgaca gactcgaggc tacaagagct tagcagggtg tcttggccat
120ggtcccctgg tgctgcaact cctctccttc acgctcttgg ctgcgctcct
tgtccaagtg 180tccaaggtcc ccagctccat aagtcaggaa caatccaggc
aagacgcgat ctaccagaac 240ctgacccagt ttaaagctgc agtgggtgag
ctctcagaga aatccaagct gcaggagatc 300tatcaggagc tgacccagct
gaaggctgca gtgggtgagc ttccagagaa atctaagcag 360caggagatct
accaggagct gagccagctg aaggctgcag tgggtgagct tccagagaaa
420tctaagcagc aggagatcta ccaggagctg acccggctga aggctgcagt
gggtgagctt 480ccagagaaat ctaagcagca ggagatctac caggagctga
cccggctgaa ggctgcagtg 540ggtgagcttc cagagaaatc taagcagcag
gagatctacc aggagctgag ccagctgaag 600gctgcagtgg gtgagcttcc
agagaaatct aagcagcagg agatctacca ggagctgagc 660cagctgaagg
ctgcagtggg tgagcttcca gagaaatcta agcagcagga gatctaccag
720gagctgaccc agctgaaggc tgcagtggaa cgcctgtgcc gccgctgccc
ctgggaatgg 780acattcttcc aaggaaactg ttacttcatg tctaactccc
agcggaactg gcacgactcc 840atcaccgcct gccaagaagt gggggcccag
ctcgtcgtaa tcaaaagtgc tgaggagcag 900aacttcctac agctgcagtc
ttccagaagt aaccgcttca cctggatggg actttcagat 960ctaaatcatg
aaggcacgtg gcaatgggtg gacggctcac ctctgttgcc cagcttcgag
1020cagtattgga acagaggaga gcccaacaac gttggggagg aagactgcgc
ggaatttagt 1080ggcaatggct ggaacgatga caaatgtaat cttgccaaat
tctggatctg caaaaagtct 1140gcagcctcct gctccaggga tgaagaacag
tttctttctc cagcctctgc caccccaaac 1200ccccctcctg cg 121212105PRTPan
troglodytes 12Ser Leu Gln Cys Tyr Asn Cys Pro Asn Pro Thr Ala Asp
Cys Lys Thr1 5 10 15Ala Val Asn Cys Ser Ser Asp Phe Asp Ala Cys Leu
Ile Thr Lys Ala 20 25 30Gly Leu Gln Val Tyr Asn Lys Cys Trp Lys Phe
Glu His Cys Asn Phe 35 40 45Asn Asp Val Thr Thr Arg Leu Arg Glu Asn
Glu Leu Thr Tyr Tyr Cys 50 55 60Cys Lys Lys Asp Leu Cys Asn Phe Asn
Glu Gln Leu Glu Asn Gly Gly65 70 75 80Thr Ser Leu Ser Glu Lys Thr
Val Leu Leu Leu Val Thr Pro Phe Leu 85 90 95Ala Ala Ala Ala Trp Ser
Leu His Pro 100 10513121PRTPan troglodytes 13Ser Leu Gln Cys Tyr
Asn Cys Pro Asn Pro Thr Ala Asp Cys Lys Thr1 5 10 15Ala Val Asn Cys
Ser Ser Asp Phe Asp Ala Cys Leu Ile Thr Lys Ala 20 25 30Gly Leu Gln
Val Tyr Asn Lys Cys Trp Lys Leu Glu His Cys Asn Phe 35 40 45Lys Asp
Leu Thr Thr Arg Leu Arg Glu Asn Glu Leu Thr Tyr Tyr Cys 50 55 60Cys
Lys Lys Asp Leu Cys Asn Phe Asn Glu Gln Leu Glu Asn Gly Gly65 70 75
80Asn Glu Gln Leu Glu Asn Gly Gly Asn Glu Gln Leu Glu Asn Gly Gly
85 90 95Thr Ser Leu Ser Glu Lys Thr Val Leu Leu Arg Val Thr Pro Phe
Leu 100 105 110Ala Ala Ala Ala Trp Ser Leu His Pro 115
120145140DNAHomo sapiens 14ctccagacct acccagaaag atgcccggat
ggatcctgca gctccgtggc ttttctggga 60agcagcggcc cctgctctca agagaccctg
gctcctgatg gtggccccaa ggttgccagc 120tggtgctagg gactcaggac
agtttcccag aaaaggccaa gcgggcagcc cctccagggg 180ccgggtgagg
aagctggggg gtgcggaggc cacactgggt ccctgaaccc cctgcttggt
240tacagtgcag ctcctcaagt ccacagacgt gggccggcac agcctcctgt
acctgaagga 300aatcggccgt ggctggttcg ggaaggtgtt cctgggggag
gtgaactctg gcatcagcag 360tgcccaggtg gtggtgaagg agctgcaggc
tagtgccagc gtgcaggagc agatgcagtt 420cctggaggag gtgcagccct
acagggccct gaagcacagc aacctgctcc agtgcctggc 480ccagtgcgcc
gaggtgacgc cctacctgct ggtgatggag ttctgcccac tgggggacct
540caagggctac ctgcggagct gccgggtggc ggagtccatg gctcccgacc
cccggaccct 600gcagcgcatg gcctgtgagg tggcctgtgg cgtcctgcac
cttcatcgca acaatttcgt 660gcacagcgac ctggccctgc ggaactgcct
gctcacggct gacctgacgg tgaagattgg 720tgactatggc ctggctcact
gcaagtacag agaggactac ttcgtgactg ccgaccagct 780gtgggtgcct
ctgcgctgga tcgcgccaga gctggtggac gaggtgcata gcaacctgct
840cgtcgtggac cagaccaaga gcgggaatgt gtggtccctg ggcgtgacca
tctgggagct 900ctttgagctg ggcacgcagc cctatcccca gcactcggac
cagcaggtgc tggcgtacac 960ggtccgggag cagcagctca agctgcccaa
gccccagctg cagctgaccc tgtcggaccg 1020ctggtacgag gtgatgcagt
tctgctggct gcagcccgag cagcggccca cagccgagga 1080ggtgcacctg
ctgctgtcct acctgtgtgc caagggcgcc accgaagcag aggaggagtt
1140tgaacggcgc tggcgctctc tgcggcccgg cgggggcggc gtggggcccg
ggcccggtgc 1200ggcggggccc atgctgggcg gcgtggtgga gctcgccgct
gcctcgtcct tcccgctgct 1260ggagcagttc gcgggcgacg gcttccacgc
ggacggcgac gacgtgctga cggtgaccga 1320gaccagccga ggcctcaatt
ttgagtacaa gtgggaggcg ggccgcggcg cggaggcctt 1380cccggccacg
ctgagccctg gccgcaccgc acgcctgcag gagctgtgcg cccccgacgg
1440cgcgcccccg ggcgtggttc cggtgctcag cgcgcacagc ccgtcgctgg
gcagcgagta 1500cttcatccgc ctagaggagg ccgcacccgc cgccggccac
gaccctgact gcgccggctg 1560cgcccccagt ccacctgcca ccgcggacca
ggacgacgac tctgacggca gcaccgccgc 1620ctcgctggcc atggagccgc
tgctgggcca cgggccaccc gtcgacgtcc cctggggccg 1680cggcgaccac
taccctcgca gaagcttggc gcgggacccg ctctgcccct cacgctctcc
1740ctcgccctcg gcggggcccc tgagtctggc ggagggagga gcggaggatg
cagactgggg 1800cgtggccgcc ttctgtcctg ccttcttcga ggacccactg
ggcacgtccc ctttggggag 1860ctcaggggcg cccccgctgc cgctgactgg
cgaggatgag ctagaggagg tgggagcgcg 1920gagggccgcc cagcgcgggc
actggcgctc caacgtgtca gccaacaaca acagcggcag 1980ccgctgtcca
gagtcctggg accccgtctc tgcgggctgc cacgctgagg gctgccccag
2040tccaaagcag accccacggg cctcccccga gccggggtac cctggagagc
ctctgcttgg 2100gctccaggca gcctctgccc aggagccagg ctgctgcccc
ggcctccctc atctatgctc 2160tgcccagggc ctggcacctg ctccctgcct
ggttacaccc tcctggacag agacagccag 2220tagtgggggt gaccacccgc
aggcagagcc caagcttgcc acggaggctg agggcactac 2280cggaccccgc
ctgccccttc cttccgtccc ctccccatcc caggagggag ccccacttcc
2340ctcggaggag gccagtgccc ccgacgcccc tgatgccctg cctgactctc
ccacgcctgc 2400tactggtggc gaggtgtctg ccatcaagct ggcttctgcc
ctgaatggca gcagcagctc 2460tcccgaggtg gaggcaccca gcagtgagga
tgaggacacg gctgaggcca cctcaggcat 2520cttcaccgac acgtccagcg
acggcctgca ggccaggagg ccggatgtgg tgccagcctt 2580ccgctctctg
cagaagcagg tggggacccc cgactccctg gactccctgg acatcccgtc
2640ctcagccagt gatggtggct atgaggtctt cagcccgtcg gccactggcc
cctctggagg 2700gcagccgcga gcgctggaca gtggctatga caccgagaac
tatgagtccc ctgagtttgt 2760gctcaaggag gcgcaggaag ggtgtgagcc
ccaggccttt gcggagctgg cctcagaggg 2820tgagggcccc gggcccgaga
cacggctctc cacctccctc agtggcctca acgagaagaa 2880tccctaccga
gactctgcct acttctcaga cctcgaggct gaggccgagg ccacctcagg
2940cccagagaag aagtgcggcg gggaccgagc ccccgggcca gagctgggcc
tgccgagcac 3000tgggcagccg tctgagcagg tctgtctcag gcctggggtt
tccggggagg cacaaggctc 3060tggccccggg gaggtgctgc ccccactgct
gcagcttgaa gggtcctccc cagagcccag 3120cacctgcccc tcgggcctgg
tcccagagcc tccggagccc caaggcccag ccaaggtgcg 3180gcctgggccc
agccccagct gctcccagtt tttcctgctg accccggttc cgctgagatc
3240agaaggcaac agctctgagt tccaggggcc cccaggactg ttgtcagggc
cggccccaca 3300aaagcggatg gggggcccag gcacccccag agccccactc
cgcctggctc tgcccggcct 3360ccctgcggcc ttggagggcc ggccggagga
ggaggaggag gacagtgagg acagcgacga 3420gtctgacgag gagctccgct
gctacagcgt ccaggagcct agcgaggaca gcgaagagga 3480ggcgccggcg
gtgcccgtgg tggtggctga gagccagagc gcgcgcaacc tgcgcagcct
3540gctcaagatg cccagcctgc tgtccgagac cttctgcgag gacctggaac
gcaagaagaa 3600ggccgtgtcc ttcttcgacg acgtcaccgt ctacctcttt
gaccaggaaa gccccacccg 3660ggagctcggg gagcccttcc cgggcgccaa
ggaatcgccc cctacgttcc ttagggggag 3720ccccggctct cccagcgccc
ccaaccggcc gcagcaggct gatggctccc caaatggctc 3780cacagcggaa
gagggtggtg ggttcgcgtg ggacgacgac ttcccgctga tgacggccaa
3840ggcagccttc gccatggccc tagacccggc cgcacccgcc ccggctgcgc
ccacgcccac 3900gcccgctccc ttctcgcgct tcacggtgtc gcccgcgccc
acgtcccgct tctccatcac 3960gcacgtgtct gactcggacg ccgagtccaa
gagaggacct gaagctggtg ccgggggtga 4020gagtaaagag gcttgagacc
tgggcagctc ctgcccctca aggctggcgt caccggagcc 4080cctgccaggc
agcagcgagg atggtgaccg agaaggtggg gaccacgtcc tggtggctgt
4140tggcagcaga ttcaggtgcc tctgccccac
gcggtgtcct ggagaagccc gtgggatgag 4200aggccctgga tggtagatcg
gccatgctcc gccccagagg cagaattcgt ctgggctttt 4260aggcttgctg
ctagcccctg ggggcgcctg gagccacagt gggtgtctgt acacacatac
4320acactcaaaa ggggccagtg cccctgggca cggcggcccc caccctctgc
cctgcctgcc 4380tggcctcgga ggacccgcat gccccatccg gcagctcctc
cggtgtgctc acaggacact 4440taaaccagga cgaggcatgg ccccgagaca
ctggcaggtt tgtgagcctc ttcccacccc 4500ctgtgccccc acccttgcct
ggttcctggt ggctcagggc aaggagtggc cctgggcgcc 4560cgtgtcggtc
ctgtttccgc tgcccttatc tcaaagtccg tggctgtttc cccttcactg
4620actcagctag acccgtaagc ccacccttcc cacagggaac aggctgctcc
cacctgggtc 4680ccgctgtggc cacggtgggc agcccaaaag atcaggggtg
gaggggcttc caggctgtac 4740tcctgccccg tgggccccgt tctagaggtg
cccttggcag gaccgtgcag gcagctcccc 4800tctgtggggc agtatctggt
cctgtgcccc agctgccaaa ggagagtggg ggccatgccc 4860cgcagtcagt
gttggggggc tcctgcctac agggagaggg atggtgggga aggggtggag
4920ctgggggcag ggcagcacag ggaatatttt tgtaactaac taactgctgt
ggttggagcg 4980aatggaagtt gggtgatttt aagttattgt tgccaaagag
atgtaaagtt tattgttgct 5040tcgcaggggg atttgttttg tgttttgttt
gaggcttaga acgctggtgc aatgttttct 5100tgttccttgt tttttaagag
aaatgaagct aagaaaaaag 5140155140DNAHomo sapiensCDS(413)..(4036)
15ctccagacct acccagaaag atgcccggat ggatcctgca gctccgtggc ttttctggga
60agcagcggcc cctgctctca agagaccctg gctcctgatg gtggccccaa ggttgccagc
120tggtgctagg gactcaggac agtttcccag aaaaggccaa gcgggcagcc
cctccagggg 180ccgggtgagg aagctggggg gtgcggaggc cacactgggt
ccctgaaccc cctgcttggt 240tacagtgcag ctcctcaagt ccacagacgt
gggccggcac agcctcctgt acctgaagga 300aatcggccgt ggctggttcg
ggaaggtgtt cctgggggag gtgaactctg gcatcagcag 360tgcccaggtg
gtggtgaagg agctgcaggc tagtgccagc gtgcaggagc ag atg cag 418 Met Gln
1ttc ctg gag gag gtg cag ccc tac agg gcc ctg aag cac agc aac ctg
466Phe Leu Glu Glu Val Gln Pro Tyr Arg Ala Leu Lys His Ser Asn Leu
5 10 15ctc cag tgc ctg gcc cag tgc gcc gag gtg acg ccc tac ctg ctg
gtg 514Leu Gln Cys Leu Ala Gln Cys Ala Glu Val Thr Pro Tyr Leu Leu
Val 20 25 30atg gag ttc tgc cca ctg ggg gac ctc aag ggc tac ctg cgg
agc tgc 562Met Glu Phe Cys Pro Leu Gly Asp Leu Lys Gly Tyr Leu Arg
Ser Cys35 40 45 50cgg gtg gcg gag tcc atg gct ccc gac ccc cgg acc
ctg cag cgc atg 610Arg Val Ala Glu Ser Met Ala Pro Asp Pro Arg Thr
Leu Gln Arg Met 55 60 65gcc tgt gag gtg gcc tgt ggc gtc ctg cac ctt
cat cgc aac aat ttc 658Ala Cys Glu Val Ala Cys Gly Val Leu His Leu
His Arg Asn Asn Phe 70 75 80gtg cac agc gac ctg gcc ctg cgg aac tgc
ctg ctc acg gct gac ctg 706Val His Ser Asp Leu Ala Leu Arg Asn Cys
Leu Leu Thr Ala Asp Leu 85 90 95acg gtg aag att ggt gac tat ggc ctg
gct cac tgc aag tac aga gag 754Thr Val Lys Ile Gly Asp Tyr Gly Leu
Ala His Cys Lys Tyr Arg Glu 100 105 110gac tac ttc gtg act gcc gac
cag ctg tgg gtg cct ctg cgc tgg atc 802Asp Tyr Phe Val Thr Ala Asp
Gln Leu Trp Val Pro Leu Arg Trp Ile115 120 125 130gcg cca gag ctg
gtg gac gag gtg cat agc aac ctg ctc gtc gtg gac 850Ala Pro Glu Leu
Val Asp Glu Val His Ser Asn Leu Leu Val Val Asp 135 140 145cag acc
aag agc ggg aat gtg tgg tcc ctg ggc gtg acc atc tgg gag 898Gln Thr
Lys Ser Gly Asn Val Trp Ser Leu Gly Val Thr Ile Trp Glu 150 155
160ctc ttt gag ctg ggc acg cag ccc tat ccc cag cac tcg gac cag cag
946Leu Phe Glu Leu Gly Thr Gln Pro Tyr Pro Gln His Ser Asp Gln Gln
165 170 175gtg ctg gcg tac acg gtc cgg gag cag cag ctc aag ctg ccc
aag ccc 994Val Leu Ala Tyr Thr Val Arg Glu Gln Gln Leu Lys Leu Pro
Lys Pro 180 185 190cag ctg cag ctg acc ctg tcg gac cgc tgg tac gag
gtg atg cag ttc 1042Gln Leu Gln Leu Thr Leu Ser Asp Arg Trp Tyr Glu
Val Met Gln Phe195 200 205 210tgc tgg ctg cag ccc gag cag cgg ccc
aca gcc gag gag gtg cac ctg 1090Cys Trp Leu Gln Pro Glu Gln Arg Pro
Thr Ala Glu Glu Val His Leu 215 220 225ctg ctg tcc tac ctg tgt gcc
aag ggc gcc acc gaa gca gag gag gag 1138Leu Leu Ser Tyr Leu Cys Ala
Lys Gly Ala Thr Glu Ala Glu Glu Glu 230 235 240ttt gaa cgg cgc tgg
cgc tct ctg cgg ccc ggc ggg ggc ggc gtg ggg 1186Phe Glu Arg Arg Trp
Arg Ser Leu Arg Pro Gly Gly Gly Gly Val Gly 245 250 255ccc ggg ccc
ggt gcg gcg ggg ccc atg ctg ggc ggc gtg gtg gag ctc 1234Pro Gly Pro
Gly Ala Ala Gly Pro Met Leu Gly Gly Val Val Glu Leu 260 265 270gcc
gct gcc tcg tcc ttc ccg ctg ctg gag cag ttc gcg ggc gac ggc 1282Ala
Ala Ala Ser Ser Phe Pro Leu Leu Glu Gln Phe Ala Gly Asp Gly275 280
285 290ttc cac gcg gac ggc gac gac gtg ctg acg gtg acc gag acc agc
cga 1330Phe His Ala Asp Gly Asp Asp Val Leu Thr Val Thr Glu Thr Ser
Arg 295 300 305ggc ctc aat ttt gag tac aag tgg gag gcg ggc cgc ggc
gcg gag gcc 1378Gly Leu Asn Phe Glu Tyr Lys Trp Glu Ala Gly Arg Gly
Ala Glu Ala 310 315 320ttc ccg gcc acg ctg agc cct ggc cgc acc gca
cgc ctg cag gag ctg 1426Phe Pro Ala Thr Leu Ser Pro Gly Arg Thr Ala
Arg Leu Gln Glu Leu 325 330 335tgc gcc ccc gac ggc gcg ccc ccg ggc
gtg gtt ccg gtg ctc agc gcg 1474Cys Ala Pro Asp Gly Ala Pro Pro Gly
Val Val Pro Val Leu Ser Ala 340 345 350cac agc ccg tcg ctg ggc agc
gag tac ttc atc cgc cta gag gag gcc 1522His Ser Pro Ser Leu Gly Ser
Glu Tyr Phe Ile Arg Leu Glu Glu Ala355 360 365 370gca ccc gcc gcc
ggc cac gac cct gac tgc gcc ggc tgc gcc ccc agt 1570Ala Pro Ala Ala
Gly His Asp Pro Asp Cys Ala Gly Cys Ala Pro Ser 375 380 385cca cct
gcc acc gcg gac cag gac gac gac tct gac ggc agc acc gcc 1618Pro Pro
Ala Thr Ala Asp Gln Asp Asp Asp Ser Asp Gly Ser Thr Ala 390 395
400gcc tcg ctg gcc atg gag ccg ctg ctg ggc cac ggg cca ccc gtc gac
1666Ala Ser Leu Ala Met Glu Pro Leu Leu Gly His Gly Pro Pro Val Asp
405 410 415gtc ccc tgg ggc cgc ggc gac cac tac cct cgc aga agc ttg
gcg cgg 1714Val Pro Trp Gly Arg Gly Asp His Tyr Pro Arg Arg Ser Leu
Ala Arg 420 425 430gac ccg ctc tgc ccc tca cgc tct ccc tcg ccc tcg
gcg ggg ccc ctg 1762Asp Pro Leu Cys Pro Ser Arg Ser Pro Ser Pro Ser
Ala Gly Pro Leu435 440 445 450agt ctg gcg gag gga gga gcg gag gat
gca gac tgg ggc gtg gcc gcc 1810Ser Leu Ala Glu Gly Gly Ala Glu Asp
Ala Asp Trp Gly Val Ala Ala 455 460 465ttc tgt cct gcc ttc ttc gag
gac cca ctg ggc acg tcc cct ttg ggg 1858Phe Cys Pro Ala Phe Phe Glu
Asp Pro Leu Gly Thr Ser Pro Leu Gly 470 475 480agc tca ggg gcg ccc
ccg ctg ccg ctg act ggc gag gat gag cta gag 1906Ser Ser Gly Ala Pro
Pro Leu Pro Leu Thr Gly Glu Asp Glu Leu Glu 485 490 495gag gtg gga
gcg cgg agg gcc gcc cag cgc ggg cac tgg cgc tcc aac 1954Glu Val Gly
Ala Arg Arg Ala Ala Gln Arg Gly His Trp Arg Ser Asn 500 505 510gtg
tca gcc aac aac aac agc ggc agc cgc tgt cca gag tcc tgg gac 2002Val
Ser Ala Asn Asn Asn Ser Gly Ser Arg Cys Pro Glu Ser Trp Asp515 520
525 530ccc gtc tct gcg ggc tgc cac gct gag ggc tgc ccc agt cca aag
cag 2050Pro Val Ser Ala Gly Cys His Ala Glu Gly Cys Pro Ser Pro Lys
Gln 535 540 545acc cca cgg gcc tcc ccc gag ccg ggg tac cct gga gag
cct ctg ctt 2098Thr Pro Arg Ala Ser Pro Glu Pro Gly Tyr Pro Gly Glu
Pro Leu Leu 550 555 560ggg ctc cag gca gcc tct gcc cag gag cca ggc
tgc tgc ccc ggc ctc 2146Gly Leu Gln Ala Ala Ser Ala Gln Glu Pro Gly
Cys Cys Pro Gly Leu 565 570 575cct cat cta tgc tct gcc cag ggc ctg
gca cct gct ccc tgc ctg gtt 2194Pro His Leu Cys Ser Ala Gln Gly Leu
Ala Pro Ala Pro Cys Leu Val 580 585 590aca ccc tcc tgg aca gag aca
gcc agt agt ggg ggt gac cac ccg cag 2242Thr Pro Ser Trp Thr Glu Thr
Ala Ser Ser Gly Gly Asp His Pro Gln595 600 605 610gca gag ccc aag
ctt gcc acg gag gct gag ggc act acc gga ccc cgc 2290Ala Glu Pro Lys
Leu Ala Thr Glu Ala Glu Gly Thr Thr Gly Pro Arg 615 620 625ctg ccc
ctt cct tcc gtc ccc tcc cca tcc cag gag gga gcc cca ctt 2338Leu Pro
Leu Pro Ser Val Pro Ser Pro Ser Gln Glu Gly Ala Pro Leu 630 635
640ccc tcg gag gag gcc agt gcc ccc gac gcc cct gat gcc ctg cct gac
2386Pro Ser Glu Glu Ala Ser Ala Pro Asp Ala Pro Asp Ala Leu Pro Asp
645 650 655tct ccc acg cct gct act ggt ggc gag gtg tct gcc atc aag
ctg gct 2434Ser Pro Thr Pro Ala Thr Gly Gly Glu Val Ser Ala Ile Lys
Leu Ala 660 665 670tct gcc ctg aat ggc agc agc agc tct ccc gag gtg
gag gca ccc agc 2482Ser Ala Leu Asn Gly Ser Ser Ser Ser Pro Glu Val
Glu Ala Pro Ser675 680 685 690agt gag gat gag gac acg gct gag gcc
acc tca ggc atc ttc acc gac 2530Ser Glu Asp Glu Asp Thr Ala Glu Ala
Thr Ser Gly Ile Phe Thr Asp 695 700 705acg tcc agc gac ggc ctg cag
gcc agg agg ccg gat gtg gtg cca gcc 2578Thr Ser Ser Asp Gly Leu Gln
Ala Arg Arg Pro Asp Val Val Pro Ala 710 715 720ttc cgc tct ctg cag
aag cag gtg ggg acc ccc gac tcc ctg gac tcc 2626Phe Arg Ser Leu Gln
Lys Gln Val Gly Thr Pro Asp Ser Leu Asp Ser 725 730 735ctg gac atc
ccg tcc tca gcc agt gat ggt ggc tat gag gtc ttc agc 2674Leu Asp Ile
Pro Ser Ser Ala Ser Asp Gly Gly Tyr Glu Val Phe Ser 740 745 750ccg
tcg gcc act ggc ccc tct gga ggg cag ccg cga gcg ctg gac agt 2722Pro
Ser Ala Thr Gly Pro Ser Gly Gly Gln Pro Arg Ala Leu Asp Ser755 760
765 770ggc tat gac acc gag aac tat gag tcc cct gag ttt gtg ctc aag
gag 2770Gly Tyr Asp Thr Glu Asn Tyr Glu Ser Pro Glu Phe Val Leu Lys
Glu 775 780 785gcg cag gaa ggg tgt gag ccc cag gcc ttt gcg gag ctg
gcc tca gag 2818Ala Gln Glu Gly Cys Glu Pro Gln Ala Phe Ala Glu Leu
Ala Ser Glu 790 795 800ggt gag ggc ccc ggg ccc gag aca cgg ctc tcc
acc tcc ctc agt ggc 2866Gly Glu Gly Pro Gly Pro Glu Thr Arg Leu Ser
Thr Ser Leu Ser Gly 805 810 815ctc aac gag aag aat ccc tac cga gac
tct gcc tac ttc tca gac ctc 2914Leu Asn Glu Lys Asn Pro Tyr Arg Asp
Ser Ala Tyr Phe Ser Asp Leu 820 825 830gag gct gag gcc gag gcc acc
tca ggc cca gag aag aag tgc ggc ggg 2962Glu Ala Glu Ala Glu Ala Thr
Ser Gly Pro Glu Lys Lys Cys Gly Gly835 840 845 850gac cga gcc ccc
ggg cca gag ctg ggc ctg ccg agc act ggg cag ccg 3010Asp Arg Ala Pro
Gly Pro Glu Leu Gly Leu Pro Ser Thr Gly Gln Pro 855 860 865tct gag
cag gtc tgt ctc agg cct ggg gtt tcc ggg gag gca caa ggc 3058Ser Glu
Gln Val Cys Leu Arg Pro Gly Val Ser Gly Glu Ala Gln Gly 870 875
880tct ggc ccc ggg gag gtg ctg ccc cca ctg ctg cag ctt gaa ggg tcc
3106Ser Gly Pro Gly Glu Val Leu Pro Pro Leu Leu Gln Leu Glu Gly Ser
885 890 895tcc cca gag ccc agc acc tgc ccc tcg ggc ctg gtc cca gag
cct ccg 3154Ser Pro Glu Pro Ser Thr Cys Pro Ser Gly Leu Val Pro Glu
Pro Pro 900 905 910gag ccc caa ggc cca gcc aag gtg cgg cct ggg ccc
agc ccc agc tgc 3202Glu Pro Gln Gly Pro Ala Lys Val Arg Pro Gly Pro
Ser Pro Ser Cys915 920 925 930tcc cag ttt ttc ctg ctg acc ccg gtt
ccg ctg aga tca gaa ggc aac 3250Ser Gln Phe Phe Leu Leu Thr Pro Val
Pro Leu Arg Ser Glu Gly Asn 935 940 945agc tct gag ttc cag ggg ccc
cca gga ctg ttg tca ggg ccg gcc cca 3298Ser Ser Glu Phe Gln Gly Pro
Pro Gly Leu Leu Ser Gly Pro Ala Pro 950 955 960caa aag cgg atg ggg
ggc cca ggc acc ccc aga gcc cca ctc cgc ctg 3346Gln Lys Arg Met Gly
Gly Pro Gly Thr Pro Arg Ala Pro Leu Arg Leu 965 970 975gct ctg ccc
ggc ctc cct gcg gcc ttg gag ggc cgg ccg gag gag gag 3394Ala Leu Pro
Gly Leu Pro Ala Ala Leu Glu Gly Arg Pro Glu Glu Glu 980 985 990gag
gag gac agt gag gac agc gac gag tct gac gag gag ctc cgc tgc 3442Glu
Glu Asp Ser Glu Asp Ser Asp Glu Ser Asp Glu Glu Leu Arg Cys995 1000
1005 1010tac agc gtc cag gag cct agc gag gac agc gaa gag gag gcg
ccg gcg 3490Tyr Ser Val Gln Glu Pro Ser Glu Asp Ser Glu Glu Glu Ala
Pro Ala 1015 1020 1025gtg ccc gtg gtg gtg gct gag agc cag agc gcg
cgc aac ctg cgc agc 3538Val Pro Val Val Val Ala Glu Ser Gln Ser Ala
Arg Asn Leu Arg Ser 1030 1035 1040ctg ctc aag atg ccc agc ctg ctg
tcc gag acc ttc tgc gag gac ctg 3586Leu Leu Lys Met Pro Ser Leu Leu
Ser Glu Thr Phe Cys Glu Asp Leu 1045 1050 1055gaa cgc aag aag aag
gcc gtg tcc ttc ttc gac gac gtc acc gtc tac 3634Glu Arg Lys Lys Lys
Ala Val Ser Phe Phe Asp Asp Val Thr Val Tyr 1060 1065 1070ctc ttt
gac cag gaa agc ccc acc cgg gag ctc ggg gag ccc ttc ccg 3682Leu Phe
Asp Gln Glu Ser Pro Thr Arg Glu Leu Gly Glu Pro Phe Pro1075 1080
1085 1090ggc gcc aag gaa tcg ccc cct acg ttc ctt agg ggg agc ccc
ggc tct 3730Gly Ala Lys Glu Ser Pro Pro Thr Phe Leu Arg Gly Ser Pro
Gly Ser 1095 1100 1105ccc agc gcc ccc aac cgg ccg cag cag gct gat
ggc tcc cca aat ggc 3778Pro Ser Ala Pro Asn Arg Pro Gln Gln Ala Asp
Gly Ser Pro Asn Gly 1110 1115 1120tcc aca gcg gaa gag ggt ggt ggg
ttc gcg tgg gac gac gac ttc ccg 3826Ser Thr Ala Glu Glu Gly Gly Gly
Phe Ala Trp Asp Asp Asp Phe Pro 1125 1130 1135ctg atg acg gcc aag
gca gcc ttc gcc atg gcc cta gac ccg gcc gca 3874Leu Met Thr Ala Lys
Ala Ala Phe Ala Met Ala Leu Asp Pro Ala Ala 1140 1145 1150ccc gcc
ccg gct gcg ccc acg ccc acg ccc gct ccc ttc tcg cgc ttc 3922Pro Ala
Pro Ala Ala Pro Thr Pro Thr Pro Ala Pro Phe Ser Arg Phe1155 1160
1165 1170acg gtg tcg ccc gcg ccc acg tcc cgc ttc tcc atc acg cac
gtg tct 3970Thr Val Ser Pro Ala Pro Thr Ser Arg Phe Ser Ile Thr His
Val Ser 1175 1180 1185gac tcg gac gcc gag tcc aag aga gga cct gaa
gct ggt gcc ggg ggt 4018Asp Ser Asp Ala Glu Ser Lys Arg Gly Pro Glu
Ala Gly Ala Gly Gly 1190 1195 1200gag agt aaa gag gct tga
gacctgggca gctcctgccc ctcaaggctg 4066Glu Ser Lys Glu Ala
1205gcgtcaccgg agcccctgcc aggcagcagc gaggatggtg accgagaagg
tggggaccac 4126gtcctggtgg ctgttggcag cagattcagg tgcctctgcc
ccacgcggtg tcctggagaa 4186gcccgtggga tgagaggccc tggatggtag
atcggccatg ctccgcccca gaggcagaat 4246tcgtctgggc ttttaggctt
gctgctagcc cctgggggcg cctggagcca cagtgggtgt 4306ctgtacacac
atacacactc aaaaggggcc agtgcccctg ggcacggcgg cccccaccct
4366ctgccctgcc tgcctggcct cggaggaccc gcatgcccca tccggcagct
cctccggtgt 4426gctcacagga cacttaaacc aggacgaggc atggccccga
gacactggca ggtttgtgag 4486cctcttccca ccccctgtgc ccccaccctt
gcctggttcc tggtggctca gggcaaggag 4546tggccctggg cgcccgtgtc
ggtcctgttt ccgctgccct tatctcaaag tccgtggctg 4606tttccccttc
actgactcag ctagacccgt aagcccaccc ttcccacagg gaacaggctg
4666ctcccacctg ggtcccgctg tggccacggt gggcagccca aaagatcagg
ggtggagggg 4726cttccaggct gtactcctgc cccgtgggcc ccgttctaga
ggtgcccttg gcaggaccgt 4786gcaggcagct cccctctgtg gggcagtatc
tggtcctgtg ccccagctgc caaaggagag 4846tgggggccat gccccgcagt
cagtgttggg gggctcctgc ctacagggag agggatggtg 4906gggaaggggt
ggagctgggg gcagggcagc acagggaata tttttgtaac taactaactg
4966ctgtggttgg agcgaatgga agttgggtga ttttaagtta ttgttgccaa
agagatgtaa 5026agtttattgt tgcttcgcag ggggatttgt tttgtgtttt
gtttgaggct tagaacgctg 5086gtgcaatgtt ttcttgttcc ttgtttttta
agagaaatga agctaagaaa aaag 5140161207PRTHomo sapiens 16Met Gln Phe
Leu Glu Glu Val Gln Pro Tyr Arg Ala Leu Lys His Ser1 5 10 15Asn Leu
Leu Gln Cys Leu Ala Gln Cys Ala Glu Val Thr Pro Tyr Leu 20 25 30Leu
Val Met Glu Phe Cys Pro Leu Gly Asp Leu Lys Gly Tyr Leu Arg 35 40
45Ser Cys Arg Val Ala Glu Ser Met Ala Pro Asp Pro Arg Thr Leu Gln
50 55 60Arg Met Ala Cys Glu Val Ala Cys Gly Val Leu His Leu His Arg
Asn65 70 75 80Asn Phe Val His Ser Asp Leu Ala Leu Arg Asn Cys Leu
Leu Thr Ala 85 90
95Asp Leu Thr Val Lys Ile Gly Asp Tyr Gly Leu Ala His Cys Lys Tyr
100 105 110Arg Glu Asp Tyr Phe Val Thr Ala Asp Gln Leu Trp Val Pro
Leu Arg 115 120 125Trp Ile Ala Pro Glu Leu Val Asp Glu Val His Ser
Asn Leu Leu Val 130 135 140Val Asp Gln Thr Lys Ser Gly Asn Val Trp
Ser Leu Gly Val Thr Ile145 150 155 160Trp Glu Leu Phe Glu Leu Gly
Thr Gln Pro Tyr Pro Gln His Ser Asp 165 170 175Gln Gln Val Leu Ala
Tyr Thr Val Arg Glu Gln Gln Leu Lys Leu Pro 180 185 190Lys Pro Gln
Leu Gln Leu Thr Leu Ser Asp Arg Trp Tyr Glu Val Met 195 200 205Gln
Phe Cys Trp Leu Gln Pro Glu Gln Arg Pro Thr Ala Glu Glu Val 210 215
220His Leu Leu Leu Ser Tyr Leu Cys Ala Lys Gly Ala Thr Glu Ala
Glu225 230 235 240Glu Glu Phe Glu Arg Arg Trp Arg Ser Leu Arg Pro
Gly Gly Gly Gly 245 250 255Val Gly Pro Gly Pro Gly Ala Ala Gly Pro
Met Leu Gly Gly Val Val 260 265 270Glu Leu Ala Ala Ala Ser Ser Phe
Pro Leu Leu Glu Gln Phe Ala Gly 275 280 285Asp Gly Phe His Ala Asp
Gly Asp Asp Val Leu Thr Val Thr Glu Thr 290 295 300Ser Arg Gly Leu
Asn Phe Glu Tyr Lys Trp Glu Ala Gly Arg Gly Ala305 310 315 320Glu
Ala Phe Pro Ala Thr Leu Ser Pro Gly Arg Thr Ala Arg Leu Gln 325 330
335Glu Leu Cys Ala Pro Asp Gly Ala Pro Pro Gly Val Val Pro Val Leu
340 345 350Ser Ala His Ser Pro Ser Leu Gly Ser Glu Tyr Phe Ile Arg
Leu Glu 355 360 365Glu Ala Ala Pro Ala Ala Gly His Asp Pro Asp Cys
Ala Gly Cys Ala 370 375 380Pro Ser Pro Pro Ala Thr Ala Asp Gln Asp
Asp Asp Ser Asp Gly Ser385 390 395 400Thr Ala Ala Ser Leu Ala Met
Glu Pro Leu Leu Gly His Gly Pro Pro 405 410 415Val Asp Val Pro Trp
Gly Arg Gly Asp His Tyr Pro Arg Arg Ser Leu 420 425 430Ala Arg Asp
Pro Leu Cys Pro Ser Arg Ser Pro Ser Pro Ser Ala Gly 435 440 445Pro
Leu Ser Leu Ala Glu Gly Gly Ala Glu Asp Ala Asp Trp Gly Val 450 455
460Ala Ala Phe Cys Pro Ala Phe Phe Glu Asp Pro Leu Gly Thr Ser
Pro465 470 475 480Leu Gly Ser Ser Gly Ala Pro Pro Leu Pro Leu Thr
Gly Glu Asp Glu 485 490 495Leu Glu Glu Val Gly Ala Arg Arg Ala Ala
Gln Arg Gly His Trp Arg 500 505 510Ser Asn Val Ser Ala Asn Asn Asn
Ser Gly Ser Arg Cys Pro Glu Ser 515 520 525Trp Asp Pro Val Ser Ala
Gly Cys His Ala Glu Gly Cys Pro Ser Pro 530 535 540Lys Gln Thr Pro
Arg Ala Ser Pro Glu Pro Gly Tyr Pro Gly Glu Pro545 550 555 560Leu
Leu Gly Leu Gln Ala Ala Ser Ala Gln Glu Pro Gly Cys Cys Pro 565 570
575Gly Leu Pro His Leu Cys Ser Ala Gln Gly Leu Ala Pro Ala Pro Cys
580 585 590Leu Val Thr Pro Ser Trp Thr Glu Thr Ala Ser Ser Gly Gly
Asp His 595 600 605Pro Gln Ala Glu Pro Lys Leu Ala Thr Glu Ala Glu
Gly Thr Thr Gly 610 615 620Pro Arg Leu Pro Leu Pro Ser Val Pro Ser
Pro Ser Gln Glu Gly Ala625 630 635 640Pro Leu Pro Ser Glu Glu Ala
Ser Ala Pro Asp Ala Pro Asp Ala Leu 645 650 655Pro Asp Ser Pro Thr
Pro Ala Thr Gly Gly Glu Val Ser Ala Ile Lys 660 665 670Leu Ala Ser
Ala Leu Asn Gly Ser Ser Ser Ser Pro Glu Val Glu Ala 675 680 685Pro
Ser Ser Glu Asp Glu Asp Thr Ala Glu Ala Thr Ser Gly Ile Phe 690 695
700Thr Asp Thr Ser Ser Asp Gly Leu Gln Ala Arg Arg Pro Asp Val
Val705 710 715 720Pro Ala Phe Arg Ser Leu Gln Lys Gln Val Gly Thr
Pro Asp Ser Leu 725 730 735Asp Ser Leu Asp Ile Pro Ser Ser Ala Ser
Asp Gly Gly Tyr Glu Val 740 745 750Phe Ser Pro Ser Ala Thr Gly Pro
Ser Gly Gly Gln Pro Arg Ala Leu 755 760 765Asp Ser Gly Tyr Asp Thr
Glu Asn Tyr Glu Ser Pro Glu Phe Val Leu 770 775 780Lys Glu Ala Gln
Glu Gly Cys Glu Pro Gln Ala Phe Ala Glu Leu Ala785 790 795 800Ser
Glu Gly Glu Gly Pro Gly Pro Glu Thr Arg Leu Ser Thr Ser Leu 805 810
815Ser Gly Leu Asn Glu Lys Asn Pro Tyr Arg Asp Ser Ala Tyr Phe Ser
820 825 830Asp Leu Glu Ala Glu Ala Glu Ala Thr Ser Gly Pro Glu Lys
Lys Cys 835 840 845Gly Gly Asp Arg Ala Pro Gly Pro Glu Leu Gly Leu
Pro Ser Thr Gly 850 855 860Gln Pro Ser Glu Gln Val Cys Leu Arg Pro
Gly Val Ser Gly Glu Ala865 870 875 880Gln Gly Ser Gly Pro Gly Glu
Val Leu Pro Pro Leu Leu Gln Leu Glu 885 890 895Gly Ser Ser Pro Glu
Pro Ser Thr Cys Pro Ser Gly Leu Val Pro Glu 900 905 910Pro Pro Glu
Pro Gln Gly Pro Ala Lys Val Arg Pro Gly Pro Ser Pro 915 920 925Ser
Cys Ser Gln Phe Phe Leu Leu Thr Pro Val Pro Leu Arg Ser Glu 930 935
940Gly Asn Ser Ser Glu Phe Gln Gly Pro Pro Gly Leu Leu Ser Gly
Pro945 950 955 960Ala Pro Gln Lys Arg Met Gly Gly Pro Gly Thr Pro
Arg Ala Pro Leu 965 970 975Arg Leu Ala Leu Pro Gly Leu Pro Ala Ala
Leu Glu Gly Arg Pro Glu 980 985 990Glu Glu Glu Glu Asp Ser Glu Asp
Ser Asp Glu Ser Asp Glu Glu Leu 995 1000 1005Arg Cys Tyr Ser Val
Gln Glu Pro Ser Glu Asp Ser Glu Glu Glu Ala 1010 1015 1020Pro Ala
Val Pro Val Val Val Ala Glu Ser Gln Ser Ala Arg Asn Leu1025 1030
1035 1040Arg Ser Leu Leu Lys Met Pro Ser Leu Leu Ser Glu Thr Phe
Cys Glu 1045 1050 1055Asp Leu Glu Arg Lys Lys Lys Ala Val Ser Phe
Phe Asp Asp Val Thr 1060 1065 1070Val Tyr Leu Phe Asp Gln Glu Ser
Pro Thr Arg Glu Leu Gly Glu Pro 1075 1080 1085Phe Pro Gly Ala Lys
Glu Ser Pro Pro Thr Phe Leu Arg Gly Ser Pro 1090 1095 1100Gly Ser
Pro Ser Ala Pro Asn Arg Pro Gln Gln Ala Asp Gly Ser Pro1105 1110
1115 1120Asn Gly Ser Thr Ala Glu Glu Gly Gly Gly Phe Ala Trp Asp
Asp Asp 1125 1130 1135Phe Pro Leu Met Thr Ala Lys Ala Ala Phe Ala
Met Ala Leu Asp Pro 1140 1145 1150Ala Ala Pro Ala Pro Ala Ala Pro
Thr Pro Thr Pro Ala Pro Phe Ser 1155 1160 1165Arg Phe Thr Val Ser
Pro Ala Pro Thr Ser Arg Phe Ser Ile Thr His 1170 1175 1180Val Ser
Asp Ser Asp Ala Glu Ser Lys Arg Gly Pro Glu Ala Gly Ala1185 1190
1195 1200Gly Gly Glu Ser Lys Glu Ala 1205171803DNAPan troglodytes
17gctccctgcc tggttacacc ctcctggaca gagacagccg gtagtggggg tgaccacccg
60caggcagagc ccaagcttgc cacggaggct gagggcactg ccggaccctg tctgcccctt
120ccttccgtcc cctccccatc ccaggaggga gccccacttc cctcggagga
ggccagtgcc 180cctgacgccc ctgatgccct gcctgactct cccatgcctg
ctactggtgg cgaggtgtct 240gccatcaagc tggcttctgt cctgaatggc
agcagcagct ctcccgaggt ggaggcaccc 300agcagcgagg atgaggacac
ggctgaggcc acctcaggca tcttcaccga cacgtccagc 360gacggcctgc
aggccgagag gctggatgtg gtgccagcct tccgctctct gcagaagcag
420gtggggaccc ccgactccct ggactccctg gacatcccat cctcagccag
tgatggtggc 480tatgaggtct tcagcccgtc ggccactggc ccctctggag
ggcagccccg agcgctggac 540agtggctatg acaccgagaa ctatgagtcc
cctgagtttg tgctcaagga ggcgcaggaa 600gggtgtgagc cccaggcctt
tgaggagctg gcctcagagg gtgagggccc cggccccggg 660cccgagacgc
ggctctccac ctccctcagt ggcctcaacg agaagaatcc ctaccgagac
720tctgcctact tctcagacct ggaggctgag gccgaggccg aggccacctc
aggcccagag 780aagaagtgcg gcggggacca agcccccggg ccagagctgg
acctgccgag cactgggcag 840ccgtctgagc aggtctccct caggcctggg
gtttccgggg aggcacaagg ctctggcccc 900ggggaggtgc tgcccccact
gctgcggctt gaaggatcct ccccagagcc cagcacctgc 960ccctcgggcc
tggtcccaga gcctccggag ccccaaggcc cagccgaggt gcggcctggg
1020cccagcccca gctgctccca gtttttcctg ctgaccccgg ttccgctgag
atcagaaggc 1080aacagctctg agttccaggg gcccccagga ctgttgtcag
ggccggcccc acaaaagcgg 1140atggggggcc taggcacccc cagagcccca
ctccgcctgg ctctgcccgg cctccctgcg 1200gccttggagg gccggccgga
ggaggaggag gaggacagtg aggacagcgg cgagtctgac 1260gaggagctcc
gctgctacag cgtccaggag cctagcgagg acagcgaaga ggaggcgccg
1320gcggtgcccg tggtggtggc tgagagccag agcgcgcgca acctgcgcag
cctgctcaag 1380atgcccagcc tgctgtccga ggccttctgc gaggacctgg
aacgcaagaa gaaggccgtg 1440tccttcttcg acgacgtcac cgtctacctc
tttgaccagg aaagccccac ctgggagctc 1500ggggagccct tcccgggcgc
caaggaatcg ccccccacgt tccttagggg gagccccggc 1560tctcccagcg
cccccaaccg gccgcagcag gctgatggct ccccaaatgg ctccacagcg
1620gaagagggtg gtgggttcgc gtgggacgac gacttcccgc tgatgccggc
caaggcagcc 1680ttcgccatgg ccctagaccc ggccgcaccc gccccggctg
cgcccacgcc cgctcccttc 1740tcgcgcttca cggtgtcgcc cgcgcccacg
tccacgtccc gcttctccat cacgcacgtg 1800tct 1803181785DNAGorilla
gorilla 18gctccctgcc tggttacacc ctcctggaca gagacagacg gtagtggggg
tgaccacccg 60caggcagagc ccaagcttgc cacggaggct gagggcactg ccggaccccg
cctgcccctt 120ccttccgtcc cctccccatc ccaggaggga gccccacttc
cctcggagga ggccagtgcc 180cccgacgccc ctgatgccct gcctgactcg
cccacgcctg ctactggtgg cgaggtgtct 240gccaccaagc tggcttccgc
cctgaatggc agcagcagct ctcccgaggt ggaggcaccc 300agcagtgagg
atgaggacac ggctgaggca acctcaggca tcttcaccga cacgtccagc
360gacggcctgc aggccgagag gcaggatgtg gtgccagcct tccactctct
gcagaagcag 420gtggggaccc ccgactccct ggactccctg gacatcccgt
cctcagccag tgatggtggc 480tatgaggtct tcagcccgtc ggccacgggc
ccctctggag ggcagccccg agcgctggac 540agtggctatg acaccgagaa
ctatgagtcc cctgagtttg tgctcaagga ggcgcaggaa 600gggtgtgagc
cccaggcctt tgcggagctg gcctcagagg gcgagggccc cgggcccgag
660acgcggctct ccacctccct cagtggcctc aacgagaaga atccctaccg
agattctgcc 720tacttctcag acctggaggc tgaggccgag gctacctcag
gcccagagaa gaagtgcggt 780ggggaccaag cccccgggcc agagctgggc
ctgccgagca ctgggcagcc gtctgagcag 840gtctccctca gtcctggggt
ttccgtggag gcacaaggct ctggccccgg ggaggtgctg 900cccccactgc
tgcggcttga agggtcctcc ccagagccca gcacctgccc ctcgggcctg
960gtcccagagc ctccggagcc ccaaggccca gccgaggtgc ggcctgggcc
cagccccagc 1020tgctcccagt ttttcctgct gaccccggtt ccgctgagat
cagaaggcaa cagctctgag 1080ttccaggggc ccccaggact gttgtcaggg
ccggccccac aaaagcggat ggggggccca 1140ggcaccccca gagccccaca
ccgcctggct ctgcccggcc tccctgcggc cttggagggc 1200cggccggagg
aggaggagga ggacagtgag gacagcgacg agtctgacga ggagctccgc
1260tgctacagcg tccaggagcc tagcgaggac agcgaagagg aggcgccggc
ggtgcccgtg 1320gtggtggctg agagccagag cgcgcgcaac ctgcgcagcc
tgctcaagat gcccagcctg 1380ctgtccgagg ccttctgcga ggacctggaa
cgcaagaaga aggccgtgtc cttcttcgac 1440gacgtcaccg tctacctctt
tgaccaggaa agccccaccc gggagctcgg ggagcccttc 1500ccgggcgcca
aggaatcgcc ccccacgttc cttaggggga gccccggctc ttccagcgcc
1560cccaaccggc cgcagcaggc tgatggctcc ccaaatggct ccacagcgga
agagggtggt 1620gggttcgcgt gggacgacga cttcccgctg atgccggcca
aggcagcctt cgccatggcc 1680ctagacccgg ccgcacccgc cccggctgcg
cccacgcccg ctcccttctc gcgcttcacg 1740gtgtcgcccg cgcccacgtc
ccgcttctcc atcacgcacg tgtct 17851924DNAPan troglodytes 19ggtgagggcc
ccggccccgg gccc 242018DNAHomo sapiens 20ggtgagggcc ccgggccc
182118DNAGorilla gorilla 21ggcgagggcc ccgggccc 182224DNAPan
troglodytes 22ctggaggctg aggccgaggc cgag 242318DNAHomo sapiens
23ctcgaggctg aggccgag 182418DNAGorilla gorilla 24ctggaggctg
aggccgag 182518DNAPan troglodytes 25cccacgcccg ctcccttc
182624DNAHomo sapiens 26cccacgccca cgcccgctcc cttc 242718DNAGorilla
gorilla 27cccacgcccg ctcccttc 182824DNAPan troglodytes 28cccacgtcca
cgtcccgctt ctcc 242918DNAHomo sapiens 29cccacgtccc gcttctcc
183018DNAGorilla gorilla 30cccacgtccc gcttctcc 18311335DNAPan
troglodytes 31atggcagtga caactcgttt gacatggttg catgaaaaga
tcctgcaaaa tcattttgga 60gggaagcggc ttagccttct ctataagggt agtgtccatg
gattccataa tggagttttg 120cttgacagat gttgtaatca agggcctact
ctaacagtga tttatagtga agatcatatt 180attggagcat atgcagaaga
gggttaccag gmaagaaagt atgcttccat catccttttt 240gcacttcaag
agactaaaat ttcagaatgg aaactaggac tatatacacc agaaacactg
300ttttgttgtg acgttgcaaa atataactcc ccaactaatt tccagataga
tggaagaaat 360agaaaagtga ttatggactt aaagacaatg gaaaatcttg
gacttgctca aaattgtact 420atctctattc aggattatga agtttttcga
tgcgaagatt cactggacga aagaaagata 480aaaggggtca ttgagctcag
gaagagctta ctgtctgcct tgagaactta tgaaccatat 540ggatccctgg
ttcaacaaat acgaattctg ctgctgggtc caattggagc tgggaagtct
600agctttttca actcagtgag gtctgttttc caagggcatg taacgcatca
ggctttggtg 660ggcactaata caactgggat atctgagaag tataggacat
actctattag agacgggaaa 720gatggcaaat acctgccatt tattctgtgt
gactcactgg ggctgagtga gaaagaaggc 780ggcctgtgca tggatgacat
atcctacatc ttgaacggta acattcgtga tagataccag 840tttaatccca
tggaatcaat caaattaaat catcatgact acattgattc cccatcgctg
900aaggacagaa ttcattgtgt ggcatttgta tttgatgcca gctctattga
atacttctcc 960tctcagatga tagtaaagat caaaagaatt cgaagggagt
tggtaaacgc tggtgtggta 1020catgtggctt tgctcactca tgtggatagc
atggatctga ttacaaaagg tgaccttata 1080gaaatagaga gatgtgtgcc
tgtgaggtcc aagctagagg aagtccaaag aaaacttgga 1140tttgctcttt
ctgacatctc ggtggttagc aattattcct ctgagtggga gctggaccct
1200gtaaaggatg ttctaattct ttctgctctg agacgaatgc tatgggctgc
agatgacttc 1260ttagaggatt tgccttttga gcaaataggg aatctaaggg
aggaaattat caactgtgca 1320caaggaaaaa aatag 1335321335DNAPan
troglodytesCDS(1)..(1332)misc_feature(212)..(212)The 'm' at
location 212 stands for either a or c. 32atg gca gtg aca act cgt
ttg aca tgg ttg cat gaa aag atc ctg caa 48Met Ala Val Thr Thr Arg
Leu Thr Trp Leu His Glu Lys Ile Leu Gln1 5 10 15aat cat ttt gga ggg
aag cgg ctt agc ctt ctc tat aag ggt agt gtc 96Asn His Phe Gly Gly
Lys Arg Leu Ser Leu Leu Tyr Lys Gly Ser Val 20 25 30cat gga ttc cat
aat gga gtt ttg ctt gac aga tgt tgt aat caa ggg 144His Gly Phe His
Asn Gly Val Leu Leu Asp Arg Cys Cys Asn Gln Gly 35 40 45cct act cta
aca gtg att tat agt gaa gat cat att att gga gca tat 192Pro Thr Leu
Thr Val Ile Tyr Ser Glu Asp His Ile Ile Gly Ala Tyr 50 55 60gca gaa
gag ggt tac cag gma aga aag tat gct tcc atc atc ctt ttt 240Ala Glu
Glu Gly Tyr Gln Xaa Arg Lys Tyr Ala Ser Ile Ile Leu Phe65 70 75
80gca ctt caa gag act aaa att tca gaa tgg aaa cta gga cta tat aca
288Ala Leu Gln Glu Thr Lys Ile Ser Glu Trp Lys Leu Gly Leu Tyr Thr
85 90 95cca gaa aca ctg ttt tgt tgt gac gtt gca aaa tat aac tcc cca
act 336Pro Glu Thr Leu Phe Cys Cys Asp Val Ala Lys Tyr Asn Ser Pro
Thr 100 105 110aat ttc cag ata gat gga aga aat aga aaa gtg att atg
gac tta aag 384Asn Phe Gln Ile Asp Gly Arg Asn Arg Lys Val Ile Met
Asp Leu Lys 115 120 125aca atg gaa aat ctt gga ctt gct caa aat tgt
act atc tct att cag 432Thr Met Glu Asn Leu Gly Leu Ala Gln Asn Cys
Thr Ile Ser Ile Gln 130 135 140gat tat gaa gtt ttt cga tgc gaa gat
tca ctg gac gaa aga aag ata 480Asp Tyr Glu Val Phe Arg Cys Glu Asp
Ser Leu Asp Glu Arg Lys Ile145 150 155 160aaa ggg gtc att gag ctc
agg aag agc tta ctg tct gcc ttg aga act 528Lys Gly Val Ile Glu Leu
Arg Lys Ser Leu Leu Ser Ala Leu Arg Thr 165 170 175tat gaa cca tat
gga tcc ctg gtt caa caa ata cga att ctg ctg ctg 576Tyr Glu Pro Tyr
Gly Ser Leu Val Gln Gln Ile Arg Ile Leu Leu Leu 180 185 190ggt cca
att gga gct ggg aag tct agc ttt ttc aac tca gtg agg tct 624Gly Pro
Ile Gly Ala Gly Lys Ser Ser Phe Phe Asn Ser Val Arg Ser 195 200
205gtt ttc caa ggg cat gta acg cat cag gct ttg gtg ggc act aat aca
672Val Phe Gln Gly His Val Thr
His Gln Ala Leu Val Gly Thr Asn Thr 210 215 220act ggg ata tct gag
aag tat agg aca tac tct att aga gac ggg aaa 720Thr Gly Ile Ser Glu
Lys Tyr Arg Thr Tyr Ser Ile Arg Asp Gly Lys225 230 235 240gat ggc
aaa tac ctg cca ttt att ctg tgt gac tca ctg ggg ctg agt 768Asp Gly
Lys Tyr Leu Pro Phe Ile Leu Cys Asp Ser Leu Gly Leu Ser 245 250
255gag aaa gaa ggc ggc ctg tgc atg gat gac ata tcc tac atc ttg aac
816Glu Lys Glu Gly Gly Leu Cys Met Asp Asp Ile Ser Tyr Ile Leu Asn
260 265 270ggt aac att cgt gat aga tac cag ttt aat ccc atg gaa tca
atc aaa 864Gly Asn Ile Arg Asp Arg Tyr Gln Phe Asn Pro Met Glu Ser
Ile Lys 275 280 285tta aat cat cat gac tac att gat tcc cca tcg ctg
aag gac aga att 912Leu Asn His His Asp Tyr Ile Asp Ser Pro Ser Leu
Lys Asp Arg Ile 290 295 300cat tgt gtg gca ttt gta ttt gat gcc agc
tct att gaa tac ttc tcc 960His Cys Val Ala Phe Val Phe Asp Ala Ser
Ser Ile Glu Tyr Phe Ser305 310 315 320tct cag atg ata gta aag atc
aaa aga att cga agg gag ttg gta aac 1008Ser Gln Met Ile Val Lys Ile
Lys Arg Ile Arg Arg Glu Leu Val Asn 325 330 335gct ggt gtg gta cat
gtg gct ttg ctc act cat gtg gat agc atg gat 1056Ala Gly Val Val His
Val Ala Leu Leu Thr His Val Asp Ser Met Asp 340 345 350ctg att aca
aaa ggt gac ctt ata gaa ata gag aga tgt gtg cct gtg 1104Leu Ile Thr
Lys Gly Asp Leu Ile Glu Ile Glu Arg Cys Val Pro Val 355 360 365agg
tcc aag cta gag gaa gtc caa aga aaa ctt gga ttt gct ctt tct 1152Arg
Ser Lys Leu Glu Glu Val Gln Arg Lys Leu Gly Phe Ala Leu Ser 370 375
380gac atc tcg gtg gtt agc aat tat tcc tct gag tgg gag ctg gac cct
1200Asp Ile Ser Val Val Ser Asn Tyr Ser Ser Glu Trp Glu Leu Asp
Pro385 390 395 400gta aag gat gtt cta att ctt tct gct ctg aga cga
atg cta tgg gct 1248Val Lys Asp Val Leu Ile Leu Ser Ala Leu Arg Arg
Met Leu Trp Ala 405 410 415gca gat gac ttc tta gag gat ttg cct ttt
gag caa ata ggg aat cta 1296Ala Asp Asp Phe Leu Glu Asp Leu Pro Phe
Glu Gln Ile Gly Asn Leu 420 425 430agg gag gaa att atc aac tgt gca
caa gga aaa aaa tag 1335Arg Glu Glu Ile Ile Asn Cys Ala Gln Gly Lys
Lys 435 44033444PRTPan troglodytesmisc_feature(71)..(71)The 'Xaa'
at location 71 stands for either Glu or Ala. 33Met Ala Val Thr Thr
Arg Leu Thr Trp Leu His Glu Lys Ile Leu Gln1 5 10 15Asn His Phe Gly
Gly Lys Arg Leu Ser Leu Leu Tyr Lys Gly Ser Val 20 25 30His Gly Phe
His Asn Gly Val Leu Leu Asp Arg Cys Cys Asn Gln Gly 35 40 45Pro Thr
Leu Thr Val Ile Tyr Ser Glu Asp His Ile Ile Gly Ala Tyr 50 55 60Ala
Glu Glu Gly Tyr Gln Xaa Arg Lys Tyr Ala Ser Ile Ile Leu Phe65 70 75
80Ala Leu Gln Glu Thr Lys Ile Ser Glu Trp Lys Leu Gly Leu Tyr Thr
85 90 95Pro Glu Thr Leu Phe Cys Cys Asp Val Ala Lys Tyr Asn Ser Pro
Thr 100 105 110Asn Phe Gln Ile Asp Gly Arg Asn Arg Lys Val Ile Met
Asp Leu Lys 115 120 125Thr Met Glu Asn Leu Gly Leu Ala Gln Asn Cys
Thr Ile Ser Ile Gln 130 135 140Asp Tyr Glu Val Phe Arg Cys Glu Asp
Ser Leu Asp Glu Arg Lys Ile145 150 155 160Lys Gly Val Ile Glu Leu
Arg Lys Ser Leu Leu Ser Ala Leu Arg Thr 165 170 175Tyr Glu Pro Tyr
Gly Ser Leu Val Gln Gln Ile Arg Ile Leu Leu Leu 180 185 190Gly Pro
Ile Gly Ala Gly Lys Ser Ser Phe Phe Asn Ser Val Arg Ser 195 200
205Val Phe Gln Gly His Val Thr His Gln Ala Leu Val Gly Thr Asn Thr
210 215 220Thr Gly Ile Ser Glu Lys Tyr Arg Thr Tyr Ser Ile Arg Asp
Gly Lys225 230 235 240Asp Gly Lys Tyr Leu Pro Phe Ile Leu Cys Asp
Ser Leu Gly Leu Ser 245 250 255Glu Lys Glu Gly Gly Leu Cys Met Asp
Asp Ile Ser Tyr Ile Leu Asn 260 265 270Gly Asn Ile Arg Asp Arg Tyr
Gln Phe Asn Pro Met Glu Ser Ile Lys 275 280 285Leu Asn His His Asp
Tyr Ile Asp Ser Pro Ser Leu Lys Asp Arg Ile 290 295 300His Cys Val
Ala Phe Val Phe Asp Ala Ser Ser Ile Glu Tyr Phe Ser305 310 315
320Ser Gln Met Ile Val Lys Ile Lys Arg Ile Arg Arg Glu Leu Val Asn
325 330 335Ala Gly Val Val His Val Ala Leu Leu Thr His Val Asp Ser
Met Asp 340 345 350Leu Ile Thr Lys Gly Asp Leu Ile Glu Ile Glu Arg
Cys Val Pro Val 355 360 365Arg Ser Lys Leu Glu Glu Val Gln Arg Lys
Leu Gly Phe Ala Leu Ser 370 375 380Asp Ile Ser Val Val Ser Asn Tyr
Ser Ser Glu Trp Glu Leu Asp Pro385 390 395 400Val Lys Asp Val Leu
Ile Leu Ser Ala Leu Arg Arg Met Leu Trp Ala 405 410 415Ala Asp Asp
Phe Leu Glu Asp Leu Pro Phe Glu Gln Ile Gly Asn Leu 420 425 430Arg
Glu Glu Ile Ile Asn Cys Ala Gln Gly Lys Lys 435 440341335DNAHomo
sapiens 34atggcagtga caactcgttt gacatggttg cacgaaaaga tcctgcaaaa
tcattttgga 60gggaagcggc ttagccttct ctataagggt agtgtccatg gattccgtaa
tggagttttg 120cttgacagat gttgtaatca agggcctact ctaacagtga
tttatagtga agatcatatt 180attggagcat atgcagaaga gagttaccag
gaaggaaagt atgcttccat catccttttt 240gcacttcaag atactaaaat
ttcagaatgg aaactaggac tatgtacacc agaaacactg 300ttttgttgtg
atgttacaaa atataactcc ccaactaatt tccagataga tggaagaaat
360agaaaagtga ttatggactt aaagacaatg gaaaatcttg gacttgctca
aaattgtact 420atctctattc aggattatga agtttttcga tgcgaagatt
cactggatga aagaaagata 480aaaggggtca ttgagctcag gaagagctta
ctgtctgcct tgagaactta tgaaccatat 540ggatccctgg ttcaacaaat
acgaattctc ctcctgggtc caattggagc tcccaagtcc 600agctttttca
actcagtgag gtctgttttc caagggcatg taacgcatca ggctttggtg
660ggcactaata caactgggat atctgagaag tataggacat actctattag
agacgggaaa 720gatggcaaat acctgccgtt tattctgtgt gactcactgg
ggctgagtga gaaagaaggc 780ggcctgtgca gggatgacat attctatatc
ttgaacggta acattcgtga tagataccag 840tttaatccca tggaatcaat
caaattaaat catcatgact acattgattc cccatcgctg 900aaggacagaa
ttcattgtgt ggcatttgta tttgatgcca gctctattca atacttctcc
960tctcagatga tagtaaagat caaaagaatt caaagggagt tggtaaacgc
tggtgtggta 1020catgtggctt tgctcactca tgtggatagc atggatttga
ttacaaaagg tgaccttata 1080gaaatagaga gatgtgagcc tgtgaggtcc
aagctagagg aagtccaaag aaaacttgga 1140tttgctcttt ctgacatctc
ggtggttagc aattattcct ctgagtggga gctggaccct 1200gtaaaggatg
ttctaattct ttctgctctg agacgaatgc tatgggctgc agatgacttc
1260ttagaggatt tgccttttga gcaaataggg aatctaaggg aggaaattat
caactgtgca 1320caaggaaaaa aatag 1335351335DNAHomo
sapiensCDS(1)..(1335) 35atg gca gtg aca act cgt ttg aca tgg ttg cac
gaa aag atc ctg caa 48Met Ala Val Thr Thr Arg Leu Thr Trp Leu His
Glu Lys Ile Leu Gln1 5 10 15aat cat ttt gga ggg aag cgg ctt agc ctt
ctc tat aag ggt agt gtc 96Asn His Phe Gly Gly Lys Arg Leu Ser Leu
Leu Tyr Lys Gly Ser Val 20 25 30cat gga ttc cgt aat gga gtt ttg ctt
gac aga tgt tgt aat caa ggg 144His Gly Phe Arg Asn Gly Val Leu Leu
Asp Arg Cys Cys Asn Gln Gly 35 40 45cct act cta aca gtg att tat agt
gaa gat cat att att gga gca tat 192Pro Thr Leu Thr Val Ile Tyr Ser
Glu Asp His Ile Ile Gly Ala Tyr 50 55 60gca gaa gag agt tac cag gaa
gga aag tat gct tcc atc atc ctt ttt 240Ala Glu Glu Ser Tyr Gln Glu
Gly Lys Tyr Ala Ser Ile Ile Leu Phe65 70 75 80gca ctt caa gat act
aaa att tca gaa tgg aaa cta gga cta tgt aca 288Ala Leu Gln Asp Thr
Lys Ile Ser Glu Trp Lys Leu Gly Leu Cys Thr 85 90 95cca gaa aca ctg
ttt tgt tgt gat gtt aca aaa tat aac tcc cca act 336Pro Glu Thr Leu
Phe Cys Cys Asp Val Thr Lys Tyr Asn Ser Pro Thr 100 105 110aat ttc
cag ata gat gga aga aat aga aaa gtg att atg gac tta aag 384Asn Phe
Gln Ile Asp Gly Arg Asn Arg Lys Val Ile Met Asp Leu Lys 115 120
125aca atg gaa aat ctt gga ctt gct caa aat tgt act atc tct att cag
432Thr Met Glu Asn Leu Gly Leu Ala Gln Asn Cys Thr Ile Ser Ile Gln
130 135 140gat tat gaa gtt ttt cga tgc gaa gat tca ctg gat gaa aga
aag ata 480Asp Tyr Glu Val Phe Arg Cys Glu Asp Ser Leu Asp Glu Arg
Lys Ile145 150 155 160aaa ggg gtc att gag ctc agg aag agc tta ctg
tct gcc ttg aga act 528Lys Gly Val Ile Glu Leu Arg Lys Ser Leu Leu
Ser Ala Leu Arg Thr 165 170 175tat gaa cca tat gga tcc ctg gtt caa
caa ata cga att ctc ctc ctg 576Tyr Glu Pro Tyr Gly Ser Leu Val Gln
Gln Ile Arg Ile Leu Leu Leu 180 185 190ggt cca att gga gct ccc aag
tcc agc ttt ttc aac tca gtg agg tct 624Gly Pro Ile Gly Ala Pro Lys
Ser Ser Phe Phe Asn Ser Val Arg Ser 195 200 205gtt ttc caa ggg cat
gta acg cat cag gct ttg gtg ggc act aat aca 672Val Phe Gln Gly His
Val Thr His Gln Ala Leu Val Gly Thr Asn Thr 210 215 220act ggg ata
tct gag aag tat agg aca tac tct att aga gac ggg aaa 720Thr Gly Ile
Ser Glu Lys Tyr Arg Thr Tyr Ser Ile Arg Asp Gly Lys225 230 235
240gat ggc aaa tac ctg ccg ttt att ctg tgt gac tca ctg ggg ctg agt
768Asp Gly Lys Tyr Leu Pro Phe Ile Leu Cys Asp Ser Leu Gly Leu Ser
245 250 255gag aaa gaa ggc ggc ctg tgc agg gat gac ata ttc tat atc
ttg aac 816Glu Lys Glu Gly Gly Leu Cys Arg Asp Asp Ile Phe Tyr Ile
Leu Asn 260 265 270ggt aac att cgt gat aga tac cag ttt aat ccc atg
gaa tca atc aaa 864Gly Asn Ile Arg Asp Arg Tyr Gln Phe Asn Pro Met
Glu Ser Ile Lys 275 280 285tta aat cat cat gac tac att gat tcc cca
tcg ctg aag gac aga att 912Leu Asn His His Asp Tyr Ile Asp Ser Pro
Ser Leu Lys Asp Arg Ile 290 295 300cat tgt gtg gca ttt gta ttt gat
gcc agc tct att caa tac ttc tcc 960His Cys Val Ala Phe Val Phe Asp
Ala Ser Ser Ile Gln Tyr Phe Ser305 310 315 320tct cag atg ata gta
aag atc aaa aga att caa agg gag ttg gta aac 1008Ser Gln Met Ile Val
Lys Ile Lys Arg Ile Gln Arg Glu Leu Val Asn 325 330 335gct ggt gtg
gta cat gtg gct ttg ctc act cat gtg gat agc atg gat 1056Ala Gly Val
Val His Val Ala Leu Leu Thr His Val Asp Ser Met Asp 340 345 350ttg
att aca aaa ggt gac ctt ata gaa ata gag aga tgt gag cct gtg 1104Leu
Ile Thr Lys Gly Asp Leu Ile Glu Ile Glu Arg Cys Glu Pro Val 355 360
365agg tcc aag cta gag gaa gtc caa aga aaa ctt gga ttt gct ctt tct
1152Arg Ser Lys Leu Glu Glu Val Gln Arg Lys Leu Gly Phe Ala Leu Ser
370 375 380gac atc tcg gtg gtt agc aat tat tcc tct gag tgg gag ctg
gac cct 1200Asp Ile Ser Val Val Ser Asn Tyr Ser Ser Glu Trp Glu Leu
Asp Pro385 390 395 400gta aag gat gtt cta att ctt tct gct ctg aga
cga atg cta tgg gct 1248Val Lys Asp Val Leu Ile Leu Ser Ala Leu Arg
Arg Met Leu Trp Ala 405 410 415gca gat gac ttc tta gag gat ttg cct
ttt gag caa ata ggg aat cta 1296Ala Asp Asp Phe Leu Glu Asp Leu Pro
Phe Glu Gln Ile Gly Asn Leu 420 425 430agg gag gaa att atc aac tgt
gca caa gga aaa aaa tag 1335Arg Glu Glu Ile Ile Asn Cys Ala Gln Gly
Lys Lys 435 440 44536444PRTHomo sapiens 36Met Ala Val Thr Thr Arg
Leu Thr Trp Leu His Glu Lys Ile Leu Gln1 5 10 15Asn His Phe Gly Gly
Lys Arg Leu Ser Leu Leu Tyr Lys Gly Ser Val 20 25 30His Gly Phe Arg
Asn Gly Val Leu Leu Asp Arg Cys Cys Asn Gln Gly 35 40 45Pro Thr Leu
Thr Val Ile Tyr Ser Glu Asp His Ile Ile Gly Ala Tyr 50 55 60Ala Glu
Glu Ser Tyr Gln Glu Gly Lys Tyr Ala Ser Ile Ile Leu Phe65 70 75
80Ala Leu Gln Asp Thr Lys Ile Ser Glu Trp Lys Leu Gly Leu Cys Thr
85 90 95Pro Glu Thr Leu Phe Cys Cys Asp Val Thr Lys Tyr Asn Ser Pro
Thr 100 105 110Asn Phe Gln Ile Asp Gly Arg Asn Arg Lys Val Ile Met
Asp Leu Lys 115 120 125Thr Met Glu Asn Leu Gly Leu Ala Gln Asn Cys
Thr Ile Ser Ile Gln 130 135 140Asp Tyr Glu Val Phe Arg Cys Glu Asp
Ser Leu Asp Glu Arg Lys Ile145 150 155 160Lys Gly Val Ile Glu Leu
Arg Lys Ser Leu Leu Ser Ala Leu Arg Thr 165 170 175Tyr Glu Pro Tyr
Gly Ser Leu Val Gln Gln Ile Arg Ile Leu Leu Leu 180 185 190Gly Pro
Ile Gly Ala Pro Lys Ser Ser Phe Phe Asn Ser Val Arg Ser 195 200
205Val Phe Gln Gly His Val Thr His Gln Ala Leu Val Gly Thr Asn Thr
210 215 220Thr Gly Ile Ser Glu Lys Tyr Arg Thr Tyr Ser Ile Arg Asp
Gly Lys225 230 235 240Asp Gly Lys Tyr Leu Pro Phe Ile Leu Cys Asp
Ser Leu Gly Leu Ser 245 250 255Glu Lys Glu Gly Gly Leu Cys Arg Asp
Asp Ile Phe Tyr Ile Leu Asn 260 265 270Gly Asn Ile Arg Asp Arg Tyr
Gln Phe Asn Pro Met Glu Ser Ile Lys 275 280 285Leu Asn His His Asp
Tyr Ile Asp Ser Pro Ser Leu Lys Asp Arg Ile 290 295 300His Cys Val
Ala Phe Val Phe Asp Ala Ser Ser Ile Gln Tyr Phe Ser305 310 315
320Ser Gln Met Ile Val Lys Ile Lys Arg Ile Gln Arg Glu Leu Val Asn
325 330 335Ala Gly Val Val His Val Ala Leu Leu Thr His Val Asp Ser
Met Asp 340 345 350Leu Ile Thr Lys Gly Asp Leu Ile Glu Ile Glu Arg
Cys Glu Pro Val 355 360 365Arg Ser Lys Leu Glu Glu Val Gln Arg Lys
Leu Gly Phe Ala Leu Ser 370 375 380Asp Ile Ser Val Val Ser Asn Tyr
Ser Ser Glu Trp Glu Leu Asp Pro385 390 395 400Val Lys Asp Val Leu
Ile Leu Ser Ala Leu Arg Arg Met Leu Trp Ala 405 410 415Ala Asp Asp
Phe Leu Glu Asp Leu Pro Phe Glu Gln Ile Gly Asn Leu 420 425 430Arg
Glu Glu Ile Ile Asn Cys Ala Gln Gly Lys Lys 435 440
* * * * *